Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Contents SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 2...

Author: David George Furth

40 downloads 985 Views 10MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Contents

SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology

Editor David G. Furth

i

ii

David Furth

This page intentionally left blank

Contents

Special Topics in Leaf Beetle Biology Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology Editor David G. Furth

Sofia-Moscow 2003

iii

iv

David Furth SPECIAL TOPICS IN LEAF BEETLE BIOLOGY Proceedings of the Fifth International Symposium on the Chrysomelidae 25-27 August 2000, Iguassu Falls, Brazil, XXI International Congress of Entomology Edited by David G. Furth

Pensoft Series Faunistica No 29 ISSN 1312-0174

First published 2003 ISBN 954-642-170-7

© PENSOFT Publishers All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form by any means, electronic, mechanical, photocopying, recording or otherwise, without the prior written permission of the copyright owner. Pensoft Publishers, Acad. G. Bonchev Str., Bl.6, 1113 Sofia, Bulgaria Fax: +359-2-70-45-08, e-mail: [email protected], www.pensoft.net Printed in Bulgaria, February 2003

Contents

v

TABLE OF CONTENTS Dedication: Pierre H. A. Jolivet David G. Furth ........................................................................................................................................ vii FISCB: Events in Iguassu Falls, Brazil, 25-27 August 2000 ................................................................... xi Survey and quantitative assessment of flea beetle diversity in a Costa Rican rainforest (Coleoptera: Chrysomelidae: Alticinae) David G. Furth, J. T. Longino, M. Paniagua ........................................................................................ 1 The diversity of the Chrysomelidae fauna in Costa Rica: Insights from a Malaise trapline R. Wills Flowers, and P. E. Hanson ..................................................................................................... 25 Nepal as a centre of speciation for Himalayan Chrysomelid fauna Eva Sprecher-Übersax ............................................................................................................................ 53 Leaf Beetle fauna of the Carpathian Basin (Central Europe). Historical background and perspectives (Coleoptera: Chrysomelidae) Károly Vig ................................................................................................................................................. 63 Systematic position of the subfamilies Megalopodinae and Megascelinae (Chrysomelidae) based on the comparative morphology of the internal reproductive system Kunio Suzuki .......................................................................................................................................... 105 Cladistic analysis of the Oedionychines of southern Brazil (Galerucinae: Alticini) based on two molecular markers Catherine Duckett and K. M. Kjer .................................................................................................... 117 Present status of a taxonomic revision of Afrotropical Monolepta and related groups (Galerucinae) Thomas Wagner ..................................................................................................................................... 133 Interspecific differentiation in eggs and first instar larvae of the genus Procalus Clark 1865 (Chrysomelidae: Alticinae) Viviane Jerez ........................................................................................................................................... 147 Feeding behavior of Fulcidax monstrosa (Chlamisinae) on its host plant Byrsonima sericea (Malpighiaceae) V. Flinte, Margarete V. Macedo, R. C. Vieira and J. B. Karren ..................................................... 155 Natural enemies of Neotropical cassidinae (Coleoptera: Chrysomelidae) and their phenology Flavia Nogueira de Sá and João Vasconcellos-Neto ...................................................................... 161 Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) Astrid Eben and A. Espinosa de los Monteros ............................................................................... 175 A review of the biology and host plants of the Hispinae and Cassidinae (Coleoptera: Chrysomelidae) of Australia Trevor J. Hawkeswood ......................................................................................................................... 183 Performance and food preference of Botanochara impressa (Panzer, 1798) (Chrysomelidae, Cassidinae): A laboratory comparison among four species of Ipomoea (Convovulaceae) S. M. Kerpel and Lenice Medeiros .................................................................................................... 201

vi

David Furth

Notes on the biology and host plants of the Australian leaf beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) Trevor J. Hawkeswood and P. H. Jolivet ........................................................................................... 209 Biological and ecological studies on Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) Fernando A. Frieiro-Costa and João Vasconcellos-Neto .............................................................. 213 Chemical signaling between host plant (Ulmus minor) and egg parasitoid (Oomyzus gallerucae) of the Elm Leaf Beetle (Xanthogaleruca luteola) Torsten Meiners and M. Hilker .......................................................................................................... 227 Advantages and disadvantages of abdominal shields of chrysomelid larvae: Mini-review Caroline Müller and M. Hilker ........................................................................................................... 243 Distribution of toxins in chrysomeline leaf beetles: Possible taxonomic inferences Jacques M. Pasteels, A. Termonia, D. Daloze and D. M. Windsor .............................................. 261 Flight polymorphism observed in an alpine leaf beetle and associated costs Nicole M. Kalberer and Martine Rahier ........................................................................................... 277 Population ecology of the polymorphic species Chelymorpha cribraria (Col.: Chrysomelidae) in Rio de Janeiro, Brazil Gonçalves, R. O. and Margarete V. Macedo .................................................................................... 285 Genetic diversity of the phytophagous beetle Docema darwini Mutchler, 1925 (Coleoptera, Chrysomelidae), endemic to the Galápagos Islands Peter Verdyck, D. Konjev and D. Hilde ............................................................................................ 295 Subaquatic Chrysomelidae Pierre Jolivet ........................................................................................................................................... 303 ABSTRACTS Vertical stratification of Chrysomelid fauna in Panama Elroy Charles (presented by Yves Basset) ........................................................................................ 335 Systematic position of two polymorphic species of Chelymorpha Boh. (Coleoptera: Chrysomelidae: Cassidinae) João Vasconcellos-Neto, D. Windsor, Z. J. Buzzi, and V. Rodriguez .......................................... 336 Phylogeny and biogeography of the genus Procalus Clark (Chrysomelidae: Alticinae) Viviane Jerez ........................................................................................................................................... 337 Chemical defense in Neotropical Leaf Beetles. Jacques M. Pasteels, D. Windsor, N. Plasman, D. Daloze, J.C. Braekman and T. Hartmann ...... ............................................................................................................................................................ 338 Molecular phylogeny of the genus Cyrtonus (Coleoptera: Chrysomelidae) Irene Garneria, C. Juan and E. Petitpierre ....................................................................................... 339

Contents

vii

Pierre H. A. Jolivet Pierre H. A. Jolivet (born in Avranches, Manche, France, on 12 October 1922) is certainly the best-traveled and most knowledgeable Chrysomelid biologist of modern times. I first contacted him in early 1973, early in my studies of Alticinae. At that time he was living in South Korea and I in Israel. Ever since then we have been in more or less continual contact, although between his moving around the world and mine it has been rather like trying to catch a flea beetle, always jumping around. For example, he was stationed (working primarily for Food and Agriculture Organization of the United Nations or the World Health Organization) in Sudan, Morocco, Papua New Guinea (1961-70), Thailand (1970), France (1971-72), South Korea (1972-74), Upper Volta (Burkina Fasso, 1975-77), Afghanistan (1977), Sudan (1978), Thailand (1978), La Reunion (197879), Mauritius (1979), Senegal (1979-80), South Vietnam (1980-83), Cape Verde Islands (1983-84), etc., but also he was, and still is, continually travelling from wherever he is actually living. A true Chryso-globe-trotter, but he has always maintained his home base in Paris.

Fig. 1. Fifth International Symposium on the Chrysomelidae, Iguassu Falls, Brazil, 25 August 2000: Madeleine Jolivet, David Furth, Thomas Wagner, Pierre Jolivet (photo: K. Suzuki).

viii

David Furth

Between 1941-1946 he received multiple degrees in general and applied zoology, general and applied botany, geology, mineralogy, chemistry from the Université de Rennes. Early in his career he published a remarkable faunistic treatment of the Chrysomeloidea of the Balearic Islands (Jolivet, 1953). About the same time he did a brilliant doctoral thesis (1954) at the University of Paris (Sorbonne) on the wing morphology of Chrysomeloidea (Jolivet, 1957, 1959) as a student of one of the truly great French biologists Pierre P. Grassé (author of Traité de Zoologie). Of course, his favorite creatures are species of the genus Timarcha, the Tenebrionid-like, apparently primitive Chrysomelinae. After his B. Sc. at the University of Caen (1941), he became passionate about this group which was the subject of his zoology diploma at the University of Rennes (M.Sc., 1943) and his first publication about Timarcha was the same year (Jolivet, 1943). In one of his first letters to me while I was conducting my Ph.D. fieldwork in Israel, he urged me to look there for the “missing link” between the Timarcha known from Turkey and the ones known from Libya. He has published numerous articles about all aspects of Timarcha biology, ecology (natural history), systematics, etc. But his recent editorial in the bulletin of the Balearic natural history society (Jolivet, 2000) or his more appropriately titled “Timarchophilia or Timarchomania: Reflections on the genus Timarcha” (Jolivet, 1999) truly summarize his passion. Yes, Pierre Jolivet has that “inordinate fondness

Fig. 2. Fourth International Symposium on the Chrysomelidae, Firenze, Italy, 30 August 1996: Mauro Daccordi, Carlo Leonardi, Pierre Jolivet (photo: D. Furth).

Contents Dedication: Pierre H. A. Jolivet

ix

for beetles”, especially for Timarcha, but also for all Chrysomelidae, and even for all insects and their natural history. The first of his approximately 400 scientific publications concerned hybridization in two species of Chrysolina (Jolivet, 1942). He has authored or edited many books concerning Chrysomelidae, ants and plants, carnivorous plants, general entomology, etc. He has also described Chrysomelidae species new to science in the subfamilies Orsodacninae, Donaciinae, Sagrinae, Criocerinae, Clytrinae, Cryptocephalinae, Chlamisinae, Eumolpinae, Chrysomelinae, Galerucinae, Alticinae, and Hispinae. Pierre has been an inspiration to me and to dozens of other chrysomelid workers around the globe. He always has very interesting stories and information concerning almost any group of chrysomelids as well as many other insect groups. I have never ceased to be fascinated by his discussion about a wide variety of subjects. If, as the proverbial saying goes, “variety is the spice of life” then Pierre Jolivet has had and will continue to have the fullest and “spiciest” of lives. Pierre Jolivet is a true Renaissance biologist. He and Madeleine (his wife of 40 years) have attended and participated in all five International Symposia on the Chrysomelidae: 1984 (Hamburg); 1988 (Vancouver); 1992 (Beijing); 1996 (Firenze); 2000 (Iguassu). So it is with the greatest honor, pleasure and the unanimous concurrence of my chrysomelid colleagues everywhere that I dedicate this Fifth International Symposium on the Chrysomelidae in Brazil (FISCB) to Pierre H. A. Jolivet .

Fig. 3. Madeleine and Pierre Jolivet, collecting on FISCB field trip in Parana, Brazil, 27 August 2000 (photo: D. Furth).

x

David Furth

Fig. 4. Pierre and Madeleine Jolivet at XX International Congress of Entomology, Beijing, China, 3 July 1992 (photo: K. Suzuki).

LITERATURE CITED Jolivet, P. 1942. Hybridization probable de deux ChrysomPles: C. polita X C. menthastri. Bull. Soc. Ent. Fr. 47(9):141. Jolivet, P. 1943. Sur un cas de “phorJsie” observJ chez deux espPces du genre Timarcha. Bull. Soc. Linn. Norm. 9(3):107-108. Jolivet, P. 1953. Les Chrysomeloidea (Coleoptera) des Sles BalJares. Mem. Inst. Roy. Sci. Natur. Belgique 2(50):1-88. Jolivet, P. 1957. L’aile des Chrysomeloidea (Coleoptera), PremiPre Part. Mem. Ent. Inst. Roy. Sci. Natur. Belgique 2(51):1-180. Jolivet, P. 1959. Recherches sur l’aile des Chrysomeloidea (Coleoptera), DeuxiPme Part. Mem. Ent. Inst. Roy. Sci. Natur. Belgique 2(58):1-152. Jolivet, P. 1999. Timarchophilia or Timarchomania reflexions on the genus Timarcha (Coleoptera, Chrysomelidae). Nouv. Rev. Ent. (N.S.) 16(1):11-18. Jolivet, P. 2000. CrisomPlids, una font d’inspiraci\ [Leaf Beetles, a source of inspiration]. Boll. Soc.Hist. Natur. Balears 43:9-13.

David G. Furth, Editor 8 July 2002

Contents

xi

Fifth International Symposium on the Chrysomelidae (Iguassu Falls) Brazil The Fifth International Symposium on the Chrysomelidae (FISCB) was held as part of the XXI International Congress of Entomology (ICE) on Friday, Saturday and Sunday (25-27 August 2000), in Iguassu Falls, Parana, Brazil. As planned Friday was a full day of 17 oral presentations, Saturday consisted of 8 posters and 5 oral presentations, Sunday was a field trip to a local preserve in Parana. Friday ORAL PRESENTATIONS were moderated by David Furth (Organizer) and João Vasconcellos-Neto (Co-Organizer). The Symposium was dedicated to Pierre Jolivet. Each presentation was 20 minutes. The order, titles and authors of the oral presentations were as follows, with the presenters in bold letters: Introduction – Dedication to Pierre Jolivet (David G. Furth) Alticinae diversity in Costa Rica – David G. Furth (USA), Maylin Paniagua (Costa Rica), John T. Longino (USA); The diversity of the Chrysomelidae fauna in Costa Rica: Insights from a Malaise trapline – R. Wills Flowers (USA) and Paul E. Hansen (Costa Rica); Nepal as a center of speciation for Himalayan Chrysomelid fauna – Eva Sprecher-Ubersax (Switzerland); The Leaf Beetle fauna of the Carpathian Basin: What do we really know? Historical background and perspectives – Karoly Vig (Hungary); Phylogenies of the Oedionychina – Catherine N. Duckett (Puerto Rico, USA); Phylogeny and biogeography of the genus Procalus (Clark) (Chrysomelidae: Alticinae) – Viviane Jerez (Chile); Phylogeny and biogeography of Afrotropical Monolepta and related taxa – Thomas Wagner (Germany); Systematic position of two polymorphic species of Chelymorpha Boh. (Coleoptera: Chrysomelidae: Cassidinae) – Joao Vasconcellos-Neto (Brazil), D. Windsor (USA), Z. J. Buzzi (Brazil), and V. Rodriguez (USA); Systematic position of the subfamilies Megapodinae and Megascelinae (Chrysomelidae) based on the comparative morphology of the internal reproductive system – Kunio Suzuki (Japan); Chemical signaling between a host plant and egg parasitoid of a galerucine leaf beetle – Torsten Meiners and M. Hilker (Germany); Chemical defense in Neotropical Leaf Beetles – Jacques Pasteels, D. Windsor (USA), N. Plasman, D. Daloze, J. C. Braekman (Blegium), T. Hartmann (Germany); The abdominal shields of Tansy feeding Cassidine species – Defense versus attraction – Caroline Muller (USA) and M. Hilker (Germany); Polymorphism in a Cassidinae species – Margarete V. Macedo, R. O. Gongalves and J. Vasconcellos-Neto (Brazil); Molecular phylogeny of the genus Cyrtonus (Coleoptera: Chrysomelidae) – Irene Garneria, C. Juan, and E. Petitpierre (Spain); Genetic patterns in phytophagous beetles of the Galapagos Archipelago -Peter Verdyck, K. Desender, H. Dhuyvetter (Belgium); Subaquatic Chrysomelidae – Pierre Jolivet (France); Vertical stratification of Chrysomelid fauna in Panama – Elroy Charles (Guyana), presented by Yves Bassett (USA/Panama). Saturday POSTERS: Interspecific differentiation in eggs and larvae of Procalus (Chrysomelidae: Altcinae) – Viviane Jerez (Chile); Biological and ecological studies on Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) – F. A. Frieiro-Costa and J. Vasconcellos-Neto, (Brazil); Biological data and population abundance of three species of Cassidinae (Coleoptera:

xii

David Furth

Chrysomelidae) in a Brazilian tropical forest – Flavia N. Sa and J. Vasconcellos-Neto (Brazil); The evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) – Astrid Eben and A. Espinosa de los Monteros (Mexico); Lining on a hairy surface: Movement and feeding behavior of Gratiana spadicea (Coleoptera: Chrysomelidae: Cassidinae) on its host plant Solanum sisymbriifolium (Solanaceae) – Lenice Medeiros and G. R. P. Moreira (Brazil); Feeding specialization and host defense in Chrysomelinae Leaf Beetles did not lead to an evolutionary dead end – A. Termonia (Belgium), T. H. Hsiao (USA), Jacques Pasteels, M. Milinkovitch (Belgium); Systematic position of two polymorphic species of Chelymorpha Boh.(Coleoptera: Chrysomelidae: Cassidinae) – Jono Vasconcellos-Neto (Brazil), D. Windsor (USA), Z. J. Buzzi(Brazil), and V. Rodriguez (USA). Saturday ORAL PRESENTATIONS: Scenes from the four previous international symposia on Chrysomelidae – David G. Furth (USA); Molecular phylogeny, chromosomes, and host plant affiliation in Chrysolina and Oreina (Coleoptera: Chrysomelidae) – Eduard Petitpierre, C. F. Garin, B. De Astorza, C. Juan, and I. Garneria (Spain); Cost of flight dispersal in Oreina cacaliae (Coleoptera: Chrysomelidae) – Nicole M. Kalberer and M. Rowell-Rahier (Switzerland); Influence of natural enemies in the populations of two Stolaini species (Coleoptera: Chrysomelidae: Cassidinae) in a Brazilian tropical forest – Flavia N. Sa and J. Vasconcellos-Neto(Brazil); Searching for Sumacs and flea beetles: From African poison arrows to Mexican poison ivy – David G. Furth (USA). Sunday FIELD TRIP was to a new local reserve (a state conservation area) in the state of Parana called Cabeca do Cachorro (Dog’s Head) in Toledo County, about 130 kilometers northeast of Iguassu Falls. Unfortunately it was a rainy day, nevertheless 18 of us (from 10 countries) rented 2 minivans with drivers and we drove for about 90 minutes to the small town near the reserve. However, because of the rain, the 8 kilometers of dirt road to the reserve from the main highway was too muddy for the minivans and so we went into the small town in order to try to locate someone with better vehicles who could transport us to the reserve. We waited in a small restaurant for about 2 hours where we had a typical Parana lunch. Then two vehicles from the reserve took us in several trips to the reserve. We managed to have several hours to wander the reserve and fortunately the rain finally stopped. The director of the reserve gave us a warm welcome and he said he was very proud that his reserve could host such an international group of scientists.

David G. Furth (ed.) 2003 © PENSOFTSurvey Publishers and Quantitative Assessment of Flea Beetle Diversity in aSpecial Costa Rican 1 Topics in Leaf... Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 1-23

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican Rainforest (Coleoptera: Chrysomelidae: Alticinae) David G. Furth1, John T. Longino2, and Maylin Paniagua3 1

Section of Entomology, National Museum of Natural History, Smithsonian Institution, P.O. Box 37012, Washington, D. C. 20013-7012 USA. Email: [email protected] 2 The Evergreen State College, Olympia, Washington, 98505 USA 3 Project ALAS, La Selva Biological Station, Puerto Viejo de Sarapiquí, Costa Rica

ABSTRACT Only 113 species in 43 genera of Alticinae are recorded in the literature from Costa Rica. The Arthropods of La Selva project (ALAS) carried out a quantitative inventory of the Alticinae at the La Selva Biological Station, a rainforest site in the Atlantic lowlands of Costa Rica. In addition, collections were examined for additional alticine material for Costa Rica as a whole. The quantitative inventory yielded 3221 specimens from Malaise traps, 2260 from canopy fogging, and 203 from miscellaneous other methods. A total of 247 species in 68 genera was obtained. The abundance distribution was bimodal, deviating from a lognormal by an overabundance of rare species. Canopy fogging was more efficient than Malaise trapping when compared on a per sample basis, but Malaise traps were far more efficient than canopy fogging on a per individual basis. Thus, over a long time Malaise trapping is more efficient. There was broad overlap in the species composition of the two sampling methods, and combining methods did not improve efficiency over single methods. Fogging multiple species of trees captured species at a higher rate than fogging single species when species accumulation curves were compared on a per individual basis, but not when compared on a per sample basis. Richness estimates did not stabilize as sample size increased, and the species accumulation curve was logarithmic, with no evidence of approaching a plateau. However, final richness estimates were only 10-15% higher than observed species richness, and the singletons curve was beginning to decline. Adding additional records from elsewhere in Costa Rica, there are about 350 species in 89 genera known from the country as a whole. This study recorded 10 genera new to Central America and 47 new to Costa Rica. Based on this study we predict there may be 1000 species of Alticinae in Costa Rica. All Central American countries certainly have a much higher actual diversity than is recorded in the literature.

RESUMEN En la literatura de Costa Rica unicamente se han registrado 112 especies de 43 géneros de Alticinae. El proyecto Artrópodos de La Selva (ALAS), realizó un inventario cuantitativo de los Alticinae en la

2

David G. Furth, John T. Longino & Maylin Paniagua

Estación Biológica La Selva, localizada en el bosque tropical lluvioso, en las tierras bajas del atlántico de Costa Rica. Además, se examinaron colecciones para incluir material adicional de los Alticinae. El inventario cuantitativo dió un resultado de 3,221 especimenes en trampas de Malaise, 2260 especimenes de la fumigación del dosel, y 203 obtenidos por otros métodos. Un total de 247 especies en 68 géneros fueron obtenidos. La distribución de abundancia fue bi-modal, desviándose del logaritmo normal por la sobre abundancia de especies raras. La fumigación del dosel fue más eficiente que las trampas de Malaise cuando comparamos por muestra, pero las trampas de Malaise fueron mucho más eficientes que la fumigación del dosel cuando comparamos a nivel de individuos. De este modo a largo plazo las trampas de Malaise son más efectivas. Obtuvimos un amplio traslape en la composición de las especies de los dos métodos de muestreo, y si los combinamos esto no ayuda a la eficacia sobre métodos individuales. La fumigación de multiples especies de árboles registró una alta proporción de especies comparada con la fumigación de árboles de la misma especie, cuando las curvas de acumulación fueron comparadas a nivel individual, pero no cuando las comparamos a nivel de muestra . Las estimaciones de riqueza no se estabilizaron cuando incrementamos el tamaño de muestra, y la curva de acumulación de especies fue logarítmica, sin ninguna evidencia de que alcance la estabilidad. Sin embargo, las estimaciones finales de riqueza fueron de 10-15% más altas que la observada en la riqueza de las especies, y la curva de “singletons” empezó a declinar. Añadiendo registros adicionales de otros lados de Costa Rica, encontramos que hay cerca de 350 especies en 89 géneros conocidos para todo el país. Basado en éste estudio predecimos que hay cerca de 1000 especies de Alticinae en Costa Rica. Todos los paises Centroamericanos poseen una diversidad más alta de la que se indica en la literatura. INTRODUCTION The Chrysomelidae are a major component of tropical arthropod biodiversity (Wagner, 2000), and the flea beetles (Alticinae) comprise the largest subfamily. These highly diverse, phytophagous insects have important ecological roles as abundant herbivores, and many species have become important agricultural pests that affect human welfare. Detailed knowledge of species-level diversity patterns is important for conservation biology, natural product development, biodiversity monitoring, community ecology, and systematics research. Costa Rica is attempting to develop such knowledge through a nation-wide biodiversity inventory carried out by the Instituto Nacional de Biodiversidad (INBio). An important contribution to INBio’s national inventory effort is the Arthropods of La Selva project (ALAS, Longino, 1994), which provides inventories for many arthropod taxa at one lowland rainforest site, La Selva Biological Station. This long-term, large-scale inventory is a collaboration of locally-trained people (parataxonomists) and taxonomic specialists from many institutions. We contribute to this effort by reporting here a detailed assessment of alticine diversity. Inventory and monitoring using arthropods can often be more informative than using vertebrates, because invertebrates are often more sensitive indicators of environmental change and usually consist of more diverse species assemblages. Too often diversity studies and resulting planning for conservation or sustainable use concentrates on well-known groups (e.g., mammals, birds, and plants) and have ignored the most diverse (“hyperdiverse”) organisms (e.g., arthropods, nematodes, and fungi) (Colwell and Coddington, 1994). More knowledge of the correlation between the well-known and hyperdiverse groups is needed before the “indicator group” strategy can be reliably applied to biodiversity surveys and estimates (Colwell and Coddington, 1994). Good inventory information about invertebrates can be very useful for management and planning in conservation efforts and

Survey and Quantitative Assessment of Flea Beetle Diversity in a Costa Rican ...

3

areas, assessing the sustainable use of natural resources, and measuring changes in an ecosystem in response to natural processes or human activities (Kremen et al., 1993). Some invertebrate groups can be more effective indicators than others and Alticinae offer great potential, not only because of their high diversity, but also because of the relatively close association with their food plants. However, a requirement for an effective indicator group is that they can be readily and accurately identified to the species level. This is still a steep challenge for Neotropical Alticinae because of few specialists, few reliably determined collections, few monographs and keys, and lack of easy accessibility to good collections. There are many implications of diversity studies in tropical rainforests. It is well known that much of the world’s biological diversity resides in tropical rainforests, especially in the canopies of such forests, and that much of this diversity consists of species and even genera previously unknown to science. Therefore, purely from the perspective of discovery such surveys are fascinating and exciting. Many models, predictions and attempts at application of the results of diversity surveys and inventories have been made with the goal of conservation. Some studies have applied the results of diversity studies to statistical modeling and others have used them to demonstrate optimum and effective sampling methods for estimating biological diversity (Longino and Colwell, 1997). For hyperdiverse taxa, intensive local inventories are a valuable starting point for understanding diversity at larger spatial scales. There are a variety of reasons why it is important to know local species richness or diversity, including the study of geographical patterns of species richness, chronological changes in species richness, causes of tropical diversity, altitudinal changes in diversity, and application to conservation issues and sustainable use (Longino, et al. 2002). Ecologists have devised methods for estimating species richness based on quantitative sampling (Soberón and Llorente, 1993, Colwell and Coddington, 1994), but traditional methodologies of collecting species information in the field have been inconsistent and non-quantitative (Colwell and Coddington, 1994, Longino et al. 2002). Many studies of species diversity have relied on observed species richness, which is always an underestimate of true community richness. Most diversity studies use limited sampling techniques carried out over a limited amount of time, which results in observed richness being far lower than true community richness. Since the early 1980s there have been many attempts to estimate the global species richness of insects. For many of the studies on which the estimates have been based in tropical rainforests the main sampling method has been canopy fogging (Erwin, 1982). Subsequently there has also been significant debate as to whether the global estimates of species richness are accurate (Gaston, 1991, Erwin, 1991). These global estimates usually rely on assumptions of host specificity of insect herbivores, assumptions that are rarely tested. Novotny and Basset (2000) have made significant progress in revealing patterns of host specificity in chrysomelid communities. They conducted a three-year study in Papua New Guinea, in which they sampled from thousands of trees and carried out extensive feeding tests on live material. More recently Novotny et al. (2002) indicates that most herbivores in tropical forests have lower host specificity than assumed in many previous species richness/abundance studies. Our study does not address host plant relationships, but relies almost entirely on various mass-sampling techniques. In a quantitative survey of the ants of La Selva, Longino et al. (2002) emphasized that it is difficult to estimate species richness for diverse faunas without a major sampling effort. They found that when single methods were examined, a high proportion of species were rare, species accumulation curves did not appear asymptotic, various richness estimates failed to stabilize, and the richness estimates were usually much higher than the observed richness. In contrast, when multiple sampling

4


methods were employed, the proportion of rare species declined, and the species accumulation curve showed signs of approaching an asymptote. Richness estimates still did not stabilize, but they did closely converge with observed richness (i.e., no more than 6% above observed). Longino et al. (2002) proposed that convergence of estimated and observed species richness was a good indicator of inventory completeness. Specialized collecting by an ant expert (Longino) was an important method. Longino found 293 of 437 species, a higher proportion than any other single method. Quantitatively structured sampling was good for estimating relative abundance of common species, but under-represented many species due to the limited scope and number of methods. Specialized collecting, actually the non-quantitative application of many methods, made it unlikely that there was a large pool of rare, unseen species at La Selva. Thus, a combination of non-quantitative specialist (taxonomist) collecting and quantitatively structured sampling resulted in a relatively complete inventory. In surveys, inventories and other biological diversity studies the subject of species rarity is often discussed, but its cause is still somewhat enigmatic. Rarity is often quantified in terms of singletons (species known from one specimen), doubletons (species known from two specimens), uniques (species known from one sample, regardless of how many individuals occur in each sample), and duplicates (species known from two samples). Richness estimates are highly influenced by rare species, and often an attempt is made to partition rare species into low density elements of local communities and those that somehow do not belong (“tourists”). Longino et al. (2002) used natural history and distribution data to classify a number of the unique ant species as geographic or methodological “edge” species, the former being common outside of La Selva but rare on the property itself, and the latter possibly common at La Selva but not easily captured with any of the methods used. They also pointed out that species rare in ecological samples are often not rare to museum taxonomists. For taxonomists, rare species are often methodological edge species. It was striking how many of the La Selva uniques were known from additional collections outside of La Selva. Only 7 of 437 ant species were known from only one collection in the world. Our current knowledge of alticine diversity is based on a history of collecting by taxonomists rather than quantitative inventories. There are over 500 genera of Alticinae and probably 8,000 species worldwide. Of these, over 230 genera have been described from the Neotropical Region (Seeno and Wilcox, 1982). The only key to Neotropical genera was done by Scherer (1962). However, since then about 50 new genera have been described, making even genus-level determinations extremely difficult. Faunal records for Costa Rican Alticinae have gradually accumulated over time. In the Biologia Centrali Americana, Jacoby (1884-1892) recorded 16 genera and 38 species. In the Coleopterorum Catalogus, Heikertinger and Csiki (1939-1940) recorded 16 genera and 39 species. Wilcox (1975) recorded 29 genera and 51+ species. Based on all the previous literature Furth and Savini (1996, 1998) listed 41 genera and 107 species. Furth (1998) added 3 Blepharida Chevrolat species records, Savini (1999) added Heikertingerella marini Bechyné and Bechyné, Duckett and Moya (1999) described Ptocadica tica, and Savini and Furth (2001) added Neosphaeroderma coerulea (Jacoby), raising the total number of recorded species to 113. Furth and Savini (1996, 1998) listed the following Alticinae diversity from some other Central American countries: Panama with 70 genera and 270 species; Mexico with 75 genera and 391 species; and a total from all Central America of 113 genera and 884 species. These totals were taken from previous catalogues, checklists, monographs, revisions and other taxonomic publications. As for most arthropod groups, relatively little comprehensive new fieldwork had been attempted in order to more accurately or realistically understand the Alticinae diversity of Costa Rica. Nor


5

have there been many attempts to survey museum collections in order to determine this diversity based on various collecting events of many entomologists over time. Large numbers of undetermined Alticinae reside in many institutional collections and in private collections. Part of this is because this largest subfamily of the Leaf Beetles (Chrysomelidae) is very confused nomenclaturally and taxonomically and very few specialists can even reliably determine correct generic names much less specific ones. So the quantity of undetermined Alticinae continues to grow in collections and few specialists have tried to do significant sorting. Point surveys of alticine diversity are few. Farrell and Erwin (1988) found 126 common species of chrysomelids at a single site in Peru, but 64 (mostly Alticinae) could not even be identified to genus. We present here an analysis of the alticine fauna of La Selva, based on an intensive program of structured sampling, and we review the knowledge of the fauna for Costa Rica as a whole. The results reveal how little we know of the Neotropical alticine fauna in general, and suggest efficient sampling methods for future surveys. METHODS Study Site The study site is La Selva Biological Station (Heredia, Costa Rica) [84° 01’W, 10° 26’N]. It consists of a lowland tropical rainforest of about 1500 hectares with elevations from 50-150 meters and a mean annual rainfall of 4 meters. The habitat is a mosaic of lowland rainforest, second growth forest of various ages and abandoned pastures (McDade et al., 1993). Project ALAS The Alticinae inventory was conducted as part of Project ALAS (http://viceroy.eeb.uconn.edu.ALAS/ ALAS.html). Project ALAS is a large collaborative effort to survey the arthropods of La Selva Biological Station. A generalized set of sampling methods has been applied to a wide range of arthropod taxa, from spiders and mites to many groups of Coleoptera, Diptera, Lepidoptera and Hymenoptera. Field sampling and sample processing has been carried out largely by a resident staff of four persons (including the third author) recruited from communities surrounding La Selva and trained in entomological techniques (parataxonomists, sensu Janzen, 1991). A relational database of collection, specimen, and identification data is managed using the biodiversity database application Biota (Colwell, 1996). This on-going project is a collaboration with the Instituto Nacional de Biodiversidad in Costa Rica (INBio, Gamez, 1991). All specimens resulting from this project are labeled with INBio barcodes (in addition to standard locality labels). Specimens are deposited in the INBio collections facility in Santa Domingo de Heredia, Costa Rica, with the exception of those distributed to taxonomic specialists or collaborators, following INBio and Costa Rican regulations. Sampling Methods in this Study Malaise traps. A program of quantitative sampling was initiated in March 1993. Sixteen areas were selected on a La Selva station map, stratified by soil type (alluvial vs. residual) and forest type (primary vs. secondary). This design yielded four replicates for each soil and forest type combination. Sites were easily accessible from a trail system, but widely dispersed. A Malaise trap (Marris House,

6


with black vertical panel and white roof) was erected in each area. Malaise traps are open-sided tents with a collecting head in which flying or crawling arthropods are trapped and accumulate. The collecting head was a plastic bottle containing 75% ethanol. Malaise traps were placed in light gaps and potential flyways and maintained from March 1993 to March 1994, for a total of 13 months. At the beginning and the middle of each month, the collecting bottle with accumulated arthropods was removed and replaced with a fresh bottle of ethanol. After the first two months four distant traps were changed to a monthly sampling regime, resulting in a few one-month samples, but these are less than 5% of the processed samples. New traps were installed and a second series of Malaise samples was taken from June 1995 until June 1996. The traps were installed at the same sites as previously, excluding the 4 most distant sites. This sampling program yielded a total of 664 samples. Finally, a single Malaise trap was installed in a recent treefall gap near the laboratory in 1999, from which 6 samples were processed. Fogging. Canopy fogging was done using the general procedures of Erwin (1983), Adis et al. (1984), and Stork (1988). During the 1993-1994 sampling period, eighteen trees were selected for canopy fogging: six individual trees of the most common tree species at La Selva (Pentaclethra macroloba (Willd.) O. Ktze., Fabaceae), six individual trees of a species of intermediate abundance (Virola koschnyi Warb., Myristicaceae), and one individual each of trees from six additional families. Six areas were chosen on a La Selva station map, such that the areas were dispersed across the available primary forest, and at the same time accessible from the trail system. In each area three trees were selected: a Pentaclethra, a Virola, and one of the six unique species. Trees were chosen that had large crowns, little overlap with adjacent crowns, and good access for climbing. The three trees in a group were usually fogged on consecutive days, and the 6 groups were fogged at approximately twomonth intervals over one calendar year. A second set of fogging samples was obtained in October and November of 1994. Seven sets of three trees were fogged, all compressed into this two-month period instead of spread over a year. Again each group of three contained a Pentaclethra macroloba, a Virola koschnyi, and a distinct species in the “other” category. Finally, a set of six samples was taken in late December 1999 and early January 2000. These were from diverse species in a variety of families, all from one area in primary forest. Arthropods were captured in funnels slung beneath tree crowns. Ropes were strung from trunk to trunk between the focal tree and neighboring trees to form an irregular network 2-3m high above ground level. Forty funnels, each intercepting an area of 1 square meter, were suspended from these ropes, distributed as evenly as possible in the area beneath the crown of the focal tree. The funnels were composed of ripstop nylon mounted on a metal hoop, with a threaded ring at the bottom for the attachment of a plastic sample bottle. Palm leaves and other vegetation immediately above the funnels were clipped or bent back, but otherwise the understory vegetation was left intact. Funnels were left upside down on the ground overnight to avoid accumulation of debris before fogging. Before dawn the next morning the funnels were re-suspended and the bottles filled with 75% ethanol. An operator climbed to the first branches at the base of the crown, 15 to 20m above ground level, and commenced fogging at about 0600hrs. We used a Golden Eagle DynaFogger, on setting 6, to fog 3.8 l of Pyrethrins 123 insecticide (Summit Chemical Co.). This is a 3% solution of a natural pyrethrin insecticide with synergists, in a petroleum distillate carrier. The operator gradually fogged in a 360 degree circle, attempting to cover the crown evenly. Following fogging, a two-hour drop time was allowed, after which the sides of the funnels were washed down with ethanol and the bottles were collected. Fogging events were classified into three “treatments” related to tree species: Pentaclethra macroloba, Virola koschnyi, and “diverse” (comprising many species of trees from many


7

families). At the time of this analysis 29 fogging events had been processed: 7 Pentaclethra macroloba, 9 Virola koschnyi, and 13 diverse. Other. A few specimens were hand collected or netted by the ALAS staff and visiting scientists. A few specimens were collected at lights and one in a Berlese sample. The first author collected at La Selva by selective sweeping of the vegetation for several days in August of 1989 and for 2 days in January 1995. Species Identification The first author identified the ALAS samples first to genus using published literature on the Neotropical Alticinae fauna as well as an unpublished key to genera. In addition specimens were determined to genus or species by comparison to types or reliably identified specimens from a variety of institutional collections. Many identifications were possible because of the indefinite loan to the first author of M. Jacoby specimens in the F. C. Bowditch Collection (Museum of Comparative Zoology, Harvard University). Specimens were identified to actual species name or to genus name with a morphospecies name (e..g., Acallepitrix DF-002). Such morphospecies names were used consistently throughout the study and vouchers are deposited both at INBio and the U. S. National Museum of Natural History (USNMNH). Unique vouchers are temporarily maintained by the first author for further identifications and until either more specimens are discovered or the project is concluded, in which case uniques will be deposited at INBio. Generic author names can be found in Furth and Savini (1996, 1998). In addition to the ALAS project specimens, the first author has examined and determined specimens from additional collections at INBio and USNMNH, both from La Selva and from elsewhere in Costa Rica. These additional collections add notable genus and species records to the knowledge of the Alticinae diversity of Costa Rica. Inventory Efficiency and Richness Estimation Data were analyzed using the program EstimateS (Version 5, R. K. Colwell, http:// viceroy.eeb.uconn.edu/estimates). This program calculates species accumulation curves and associated values for a variety of richness estimators, presenting the mean of a user-designated number of random re-orderings of the samples. Species accumulation curves were “sample-based rarefaction curves” (sensu Gotelli and Colwell, 2001) and were examined based on number of samples (a measure of species density) and number of individuals (a measure of species richness) (Gotelli and Colwell, 2001). Inventory efficiency was investigated using the combined curve method of Longino and Colwell (1997). Species accumulation curves for Malaise samples, fogging samples, and the two methods combined were examined. In like manner, the three fogging treatments were compared with the combined curve method. The fogging treatments were also compared with respect to within-sample measures of diversity, using 1-way ANOVA. Two variables were examined: number of species, and number of species following rarefaction. Rarefaction was calculated using the Coleman equation, with each fogging sample rarefied to the sample size (number of individuals) of the smallest fogging sample. Species richness was estimated with two estimators: fitting of the Michaelis-Menten equation to the smoothed species accumulation curve and the Abundance-based Coverage Estimator (ACE) (Colwell and Coddington 1994, Chazdon et al. 1998, and see the EstimateS website for references

8


and calculation methods). Richness estimates were evaluated by plotting them as a function of sample size, with presence of a plateau being indicative of a reliable richness estimate, and convergence with observed species richness being a measure of inventory completeness (e.g., Longino et al., 2002). RESULTS This survey more than doubled the known diversity of Costa Rican Alticinae, at both the generic and species level (Tables 1 and 2). Generic diversity rose from 43 previously known genera to 89 reported here (Table 1). Of these 46 new genera, 3 are new to science, 10 new to Central America (8 from La Selva) and 33 are new to Costa Rica ( 26 from La Selva). From Table 1, of the 10 genera new to Central America are: Andiroba Bechyné and Bechyné; Calipeges Clark; Chaparena Bechyné (not recorded from La Selva); Coroicona Bechyné; Egleraltica Bechyné and Bechyné; Loxoprosopus Guerin; Palmaraltica Bechyné; Paralacticoides Bechyné and Bechyné (not recorded from La Selva); Roicus Clark; and Stenophyma Baly. And of the 33 genera new to Costa Rica, 7 are not recorded from La Selva: Acrocyum Jacoby; Calliphron Jacoby; Euphenges Clark; Hydmosyne Clark; Lacpatica Bechyné and Bechyné; and Megasus Jacoby; Octogonotes Drapiez. In addition, the following 12 genera have been previously recorded from Costa Rica (Furth and Savini, 1996, 1998, Furth, 1998), but were not found at La Selva during the current ALAS Project sampling: Ayalaia Bechyné and Bechyné; Blepharida Chevrolat; Cacoscelis Chevrolat; Chalatenanganya Bechyné and Bechyné; Diphaulaca Chevrolat; Distigmoptera Blake; Hylodromus Clark; Macrohaltica Bechyné; Megistops Boheman; Pedilia Clark; Pseudogona Jacoby; and Resistenciana Bechyné. Specimens of all the above genera are represented in the collections of INBio and/or USNMNH. Species richness rose from 113 species recorded for the country as a whole to 247 species and morphospecies known from La Selva alone (Table 2). Only 11 of the La Selva species were previously recorded from Costa Rica. Even though most of the species from La Selva have only a morphospecies name, the first author believes that almost all of these are not conspecific with any of the species in the same genera previously recorded from Costa Rica. Adding records of additional species examined in collections but not known to occur at La Selva, the total for Costa Rica is about 350 species. The Total column of Table 2 indicates species abundance with a typical pattern for rich tropical faunas with a few common species and many “rare” species, represented by either a single (singleton) specimen or by 2 (doubleton) specimens. There were relatively few “abundant” species (more than 200 specimens captured): “Aphthona” robusta; Genaphthona transversicollis; Glenidion jacobyi (Bechyné); Heikertingerella DF-001; Hypolampsis DF001; and Neothona DF-001. It is perhaps not surprising that two of these belong to the two most diverse Neotropical genera of Alticinae Heikertingerella and Hypolampsis (Furth, unpublished), and many species were represented by relatively few specimens. Of the 74 species that can be considered as “rare”: 26 species were represented by singletons (uniques) and 48 species by doubletons. Fig. 4 demonstrates the situation of the rare and very rare species (doubletons and uniques, respectively). The doubletons continue to increase slightly and the uniques decline slightly with increased sampling. It is also interesting that the total of singletons is continually higher than that for doubletons. Until the host plant relationships of the Alticinae of La Selva are better understood or until host plant testing of the species is conducted along with the sampling, especially for canopy fogging, it will be difficult to discern the cause or reasons for the rare and very rare species there. As demonstrated by this and other surveys, rare species are a


9

Table 1. Genera of Alticinae currently known from Costa Rica. This list was compiled from previous literature records (Furth and Savini, 1996, 1998 and included references), the ALAS quantitative sampling program, additional hand collecting by the senior author and others, and additional examination of museum collections at INBio and USNMNH. An “x” in the La Selva column indicates genera known from La Selva. An “x” in the Costa Rica column indicates genera known from Central America but newly reported for Costa Rica. An “x” in the Central America column indicates genera known from the Americas but newly reported for Central America. An “x” in the New Genus column indicates genera new to science. A number of genera (e.g., Ayalaia, Chalatenanganya, etc.) have no “x” indication in any of the columns, this is because these genera have been recorded in the literature as being from Costa Rica, but were not found in this study of La Selva. * “Aphthona” is not considered as a separate genus because it actually belongs to another genus of the Aphthonini (sensu Bechyné) included here. Genus Acallepitrix Acanthonycha Acrocyum Alagoasa Allochroma Andiroba “Aphthona”* Asphaera Ayalaia Bellacincta Blepharida Brasilaphthona Cacoscelis Calipeges Calliphron Centralaphthona Cerichrestus Chaetocnema Chalatenanganya Chaparena Coroicona Cyrsylus Dinaltica Diphaltica Diphaulaca Disonycha Distigmoptera Egleraltica Epitrix Epitrix A Euphenges Exartematopus Exoceras Genaphthona Gioia Glenidion

La Selva

Costa Rica

x x

x

Central America

New Genus

x x x x x x

x

x

x

x

x

x x x x x x x x

x x x x x x x

x x x x x x x x x

x x x x

10


Table 1. Continued. Genus Heikertingerella Heikertingeria Homotyphus Hydmosyne Hylodromus Hypolampsis Lacpatica Leptophysa Longitarsus Loxoprosopus Lupraea Macrohaltica Margaridisa Megasus Megistops Mesodera Monomacra Monoplatini Monotalla-like Nasigona Neodiphaulaca Neosphaeroderma Neothona Notozona Octogonotes Omophoita Palmaraltica Panchrestus Paralacticoides Parasyphraea Parchicola Pedilia Phenrica Phylacticus Physimerus Platiprosopus Plectotetra Pseudogona Ptocadica Resistenciana Rhinotmetus Roicus Sparnus Sphaeronychus Stegnea Stenophyma Strabala

La Selva x x x x x x x x

Costa Rica

Central America

New Genus

x x x x x x x x

x x x x x x x x x x x

x x x x x x

x x x

x x

x x x x x x x

x x x x

x x x x x x x x

x x x x x x


11

Table 1. Continued. Genus Styrepitrix Syphrea Systena Tetragonotes Trichaltica Varicoxa Walterianella Total Genera Grand Total: 89

La Selva

Costa Rica

x x x x x x x 68

x

Central America

New Genus

10

3

x 33

Table 2. Alticine species known from La Selva Biological Station. Trap bias (“M” for Malaise traps, “F” for canopy fogging) was examined with a binomial test for each species, with the binomial probability equal to the proportion of all individuals across all species in canopy fogging samples (0.41). * = p 3000 m

Sagrinae 2 Donaciinae 1 Criocerinae 34 Zeugophorinae 6 Megalopodinae 7 Clytrinae 34 Cryptocephalinae 51 Chlamisinae 8 Lamprosomatinae 4 Eumolpinae 79 Chrysomelinae 42 Galerucinae 219 Alticinae 230 Hispinae 52 Cassidinae 28 total 797

1 1 3 1 2 10 5 1 2 26 15 73 63 18 9 230

0 0 0 0 0 0 0 0 0 0 0 1 11 0 0 12

0 0 1 1 3 4 14 4 2 17 18 44 86 4 2 200

0 0 0 0 0 0 2 0 0 0 4 1 1 0 0 8

0 0 2 2 0 3 6 0 0 14 14 43 58 0 0 142

species apterous > 4000 m genera 0 0 0 0 0 0 1 0 0 0 7 6 11 0 0 25

0 0 0 0 0 0 0 0 0 0 4 3 18 0 0 25

Weise, Crosita Motschulsky, Phratora Chevrolat, Linaeidea Motschulsky, Sclerophaedon Daccordi and Medvedev, Semenovia Weise, Oreomela Jacobson, Galeruca Muller, Galerucella Crotch, Stenoluperus Ogloblin, Batophila Foudras, Minota Kutschera and Novofoudrasia Jacobson. Only 25 species were found at an

56

Eva Sprecher-Uebersax

altitude of more than 4000 m, among them 15 endemic species and the transpalaearctic Chrysomela populi (Linnaeus) (Tab. 2). All known Chrysomelid subfamilies are found in Nepal except some small ones such as the Aulacoscelinae, Orsodacninae, Megascelinae and Synetinae. The worldwide geographical representation of the Chrysomelidae by subfamilies differs from area to area. Generally

Tab. 2. Species found at an altitude of more than 4000 meters (the distribution in Nepal is mentioned as numbers of districts, the altitude in 1000 m-steps in letters A - E) endemic Species

x x x x x x

x

x x

x x x x

x x

altitude

distribution in Nepal general distribution

Cryptocephalus exsulans Suffrian, 1854 Chrysomela populi Linné, 1758

A, B, C, D, E widely distributed B, C, D, E

widely distributed

Oreomela himalayensis nepalica Medv. & Sprecher, 1998 Phaedon lesagei Daccordi, 1984 Sclerophaedon brendelli Daccordi & Medv., 1998 Sclerophaedon takizawai Daccordi & Medv., 1998 Semenovia daccordii Medv. & Sprecher, 1998 Semenovia nagaja Daccordi, 1982 Arthrotidea nepalensis (Kimoto, 1970) Cneorane tibialis Chûjô, 1966 Galeruca indica Baly, 1878 Meristata pulunini (Bryant, 1952) Nepalogaleruca angustilineata Kimoto & Tak., 1972 Nepalogaleruca schmidti Medv. & Sprecher, 1997 Altica himalayensis Chen, 1936

E

NW 24

D, E E

CE 48, CE 50, CE 51 Nepal CW 37 Nepal

D, E

CW 34, CW 38, CW 48 Nepal

D, E

CW 30, CW 38

Asiorestia schenklingi (Csiki, 1940) Asiorestia thoracica Medvedev, 1990 Batophila femorata Scherer, 1989 Benedictus medvedevi Döberl, 1991 Bhutajana nepalensis Scherer, 1989 Chaetocnema (C.) alticola Maulik, 1926 Chaetocnema (C.) cognata Baly, 1877 Paraminota minima Scherer, 1989 Paraminota nepalensis Döberl, 1991 Taizonia minima (Scherer, 1969)

Nepal, Bhutan, China, India Nepal, Bhutan, whole palaearktic Nepal

Nepal

C, E E 69, E 74 A, B, C, D, E widely distributed

Nepal Nepal, India

B, C, D, E C, D, E B, C, D, E C, D, E

widely widely widely widely

Nepal, India Nepal, India Nepal Nepal

E

CW 38

distributed distributed distributed distributed

A, B, C, D, E widely distributed D, E E C, D, E E E B, D, E

CW 40, E 69, E 74 CE 51, E 69 CW 30, CE 51 CE 51 CE 51 CW 30, CE 48, E 69

B, E

CW 39, E 69

D, E E B, C, D, E

CW 37, CE 51 CW 40, CE 51 widely distributed

Nepal Nepal, India, China, Taiwan Nepal, India Nepal Nepal Nepal Nepal Nepal, India Nepal, India, Bhutan, Sri Lanka Nepal Nepal Nepal, India

Nepal as a centre of speciation for Himalayan Chrysomelid fauna

57

speaking the Oriental fauna has a combination of Galerucinae and Alticinae dominant. The high proportion of Alticinae as is the case in Nepal is a character of high mountain. MATERIALS AND METHODS In the following museum collections a large amount of material was studied: Naturhistorisches Museum Basel (Switzerland), Naturkundemuseum Erfurt (Germany), Staatliches Museum für Naturkunde Stuttgart (Germany), Staatliches Museum für Tierkunde Dresden (Germany). Furthermore, all information found in the available literature concerning Nepalese leaf beetles was included. For information about the distribution of each species the country was divided into 5 zones following the phytogeographical zones of Dobremez in 1976 (Fig. 3) and vertically into 5 zones of altitude in 1000 m steps. RESULTS Additions to the Chrysomelid Catalogue of Nepal One species not yet mentioned in the catalogue is Trachyaphthona hiunchulii Sprecher. The catalogue of the Chrysomelidae of Nepal was published knowing well that it was just a provisional result and that in future several species new for Nepal as well as new for science would be added. Because new material from Nepal is continuously at our disposal, the research of Nepalese Chrysomelidae is far from finished. So, soon after the catalogue’s publication a new Alticinae species belonging to the genus Trachyaphthona Heikertinger was discovered. Heikertinger (1924) described Trachyaphthona and Zipangia Heikertinger as independent genera, because a main feature of Zipangia is a basal transverse furrow on the prothorax, which is absent in Trachyaphthona. But this characteristic is not constant enough to separate both genera, therefore, Ohno (1961) synonymized them. Scherer (1969) mentioned again both genera giving reasons for it by the basal transverse furrow on the prothorax of Zipangia. However, as the development of this furrow is not always distinct and transition stages from furrowless to a weak furrow till a distinct one exist, all concerned species in our catalogue are mentioned as Trachyaphthona. In 1979 Scherer described 2

Fig. 3. To study the horizontal distribution the country was divided into 5 zones using the phytogeographical zones of Dobremez (1976) and further dividing the central part (C) into a western and an eastern one. (O = west, NO = north-west, C = central, E = east zone)

58


further species of this genus from the Himalayas. Therefore, together with the new described species 12 species of Trachyaphthona from the Himalayas are known till now. T. hiunchulii shows an only weak furrow. Besides the shape of the aedeagus it differs from T. fulvicornis Scherer by the rounded sides of the prothorax, from T. infuscaticornis Scherer by the absence of spots on the elytra and the unicoloured antenna and from T. subcostata Medvedev by a non-ribbbed surface of the elytra. Further distinctive remarks were given in a key (Sprecher, 2000). The holotype was found in 1993 by Schmidt in the Annapurna Mts. near Ulleri south of Ghorepani at an altitude of 2000 m and is deposited in the Naturkundemuseum Erfurt in Germany. The 4 paratypes are from the same locality, 2 are deposited in the Naturkundemuseum Erfurt, 2 in the Naturhistorisches Museum Basel (Switzerland). Derivatio nominis: a peak in the Annapurna mountains near Ulleri, the village where the specimens were found gives the name. The massif of Annapurna consists of a chain of several very high peaks. One of them is the Hiunchuli. This peak and the Annapurna South are situated the nearest to Ulleri. While the Annapurna I with its 8091 m reaches the 8000 m-line, the Hiunchuli measures only 6441 m. Additional species not yet mentioned in the catalogue of the Chrysomelidae of Nepal are: Temnaspis quadrimaculata Bryant, Lema terminata Lac., Lilioceris cheni Gr./Kim., L. cyaneicollis (Pic), Aspidolopha melanophthalma (Lac.), Clytra gracilis (Lac.), Smaragdina dohertyi (Jac.), S. flavobasalis (Jac.), Coenobius birmanicus Jac., Cryptocephalus evae Lop., C. gestroi Jac., Basilepta beccarii (Jac., ), B. makiharai Kim., Cleorina fulva Jac., Colaspoides nepalensis Kim., Lypesthes albidus Pic, Platycorynus undatus (Ol.), Xanthonia oblonga Tak./Basu, Chrysolina tangalaensis Kim., Arthrotus nigripennis (Jac.), Aulacophora foveicollis (Lucas), Hesperomorpha hirsuta (Jac.), Monolepta lineata Weise, M. semiluperina Kim., M. severini (Jac.), M. trifasciata Jac.M. quadrisignata, Morphosphaera margaritacea Lab., Paridea ruficollis Jac., Pyrrhalta digambara Mlk., P. medvedevi Spr./Zoia, P. tatesuji Kim., P. indica Lab., Pseudoides marginalis (Chujo), Sastracella collaris Kim., Stenoluperus emotoi Kim., S. thundmensis Kim., S. verticalis Kim., Amphimela apicalis Kim., A. subgeminata Kim., Amphimeloides sexmaculatus Kim./Tak., Aphthona basantapurica Kim., A. dobangensis Kim., A. opaca All., Aphthonoides picea Scherer, Aphthonomorpha minuta Chen, Batophila castanea Scherer, Chaetocnema nigrica (Motsch.), Hemipyxis intermedia Jac., H. neelys (Mlk.), H. nigricornis Baly, Hespera dakshina Mlk., H. fulvimembris Kung/Chen, H. lomosa Mlk., H. naini Scherer, H. rufipes Mlk., H. strigiceps Kim., Letzuella viridis Chen, Longitarsus cheni Scherer, Luperomorpha nepalica Kim., Manobia shimai Kim., Manobidia major Kim., Maulika bengalensis Lop., Pentamesa haroldi (Baly), Phygasia hookeri Baly, Psylliodes shira Mlk., Sphaeroderma luteipenne Weise, S. nakanishii Kim., Tegyrius piceus Kim., Dactylispa higoniae (Lewis), D. platycanthoides Kim., Hispa ramosa Gyll (Kimoto 2001, Kimoto & Takizawa 2002, Lopatin 2002, Sprecher & Zoia 2002). Vertical Distribution The vertical distribution of the Nepalese leaf beetles is divided in 5 different zones. In each zone there are some typical species that are only found at this altitude and connected with food plants of this zone: At an altitude till 1000 m 299 species were found, 46 species only there, e.g. Aetheodactyla dimitiatipennis Baly, Galerucella birmanica (Jacoby), Aspidomorpha miliaris (Fabricius). It is a torrid zone with a typical vegetation of monsoon forests and agricultural fields with rice, corn, millet, tobacco etc. At an altitude of 1000-2000 m the biggest number of species was reported, that is totally 542 species and 159 only there, e.g. Chlamisus stercoralis Gressitt, Basilepta puncticolle (Lefèvre), Paridea tetraspilota (Hope). It is a subtropical zone with rather warm summer and rather cold winter. Bamboo, different grasses, lemon trees and Alnus nepalensis are growing there. At the following altitude of 2000-3000 m the climate is temperate. Rhododendron and conifers are the typical vegetation, there are still some fields with cabbage, carrots etc. 415 Chrysomelid species were registered there, 79


59

only in this zone, e.g. Oomorphoides nepalensis Takizawa, Dercetisoma persimilis (Kimoto), Aphthonoides rotundipennis Scherer. At an altitude of 3000-4000 m the number of species is distinctly decreasing, only 146 species were registered and 21 exclusively there, e.g. Phaedon indicus Chen, Mimastra suwai Takizawa, Martensomela aptera Medvedev. Many of them are apterous. It is a subalpine zone reaching the tree limit and with a dry, frigid and windy climate. Rhododendron and Ericaceae, some potatoes

Cassidinae Hispinae Alticinae Galerucinae Chrysomelinae Eumolpinae Lamprosomatinae Chlamisinae Cryptocephalinae Clytrinae Megalopodinae Zeugophorinae Crocerinae Donaciinae Sagrinae 0

5

10

15

20

25

30

35 %

Fig. 4. The distribution of subfamilies (in %) at an altitude till 1000 meters.

Cassidinae Hispinae Alticinae Galerucinae Chrysomelinae Eumolpinae Lamprosomatinae Chlamisinae Cryptocephalinae Clytrinae Megalopodinae Zeugophorinae Crocerinae Donaciinae Sagrinae 0

10

20

30

40

50 %

Fig. 5. The distribution of subfamilies (in %) at an altitude between 3000 and 4000 meters.

60


and barley are still growing. Finally, in the alpine zone at more than 4000 m only 25 species could be found, 7 exclusively there, e.g. Nepalogaleruca schmidti Medvedev and Sprecher, Asiorestia thoracica Medvedev, Paraminota nepalensis Döberl (Tab. 2). Almost all of them are apterous. This is the zone between the tree limit and the snow-line with extremely cold winter temperatures and a only short and cool summer. At an altitude of over 3000 m only species from Criocerinae, Zeugophorinae, Clytrinae, Cryptocephalinae, Eumolpinae, Chrysomelinae, Galerucinae and Alticinae were found, at more than 4000 m only 1 Cryptocephalinae, 7 Chrysomelinae, 6 Galerucinae and 11 Alticinae. The large number of Alticinae at high altitudes is very remarkable: 29% of all Alticinae were found above 3000 m, 39% of all Chrysomelid species at this altitude are Alticinae, while in lower altitudes Galerucinae and Eumolpinae are also quite numerous (Figs. 4, 5). Horizontal Distribution Also the horizontal distribution is interesting. The different occurrence of species is caused by the different climates in the western and eastern region which influence the vegetation: 657 species were found in the east of Nepal, 335 species only there, 432 in the west, 118 only there and 627 in the central zones, 321 only there. The east of Nepal reaching from the Arun till Sikkim shows a monsoon climate, while the west from the Dhaulagiri till the Indian boundaries is more dry with a meso- and xerophile vegetation. In the centre of the country the climate is less moist than in the east with a coexistence of hydro- and mesophile plants. Some species are differentiated in western and eastern subspecies, e.g. Chrysolina dhaulagirica dhaulagirica Medvedev and Meristata pulunini occidentalis Medvedev in the west and C. dhaulagirica arunensis Medvedev and M. pulunini pulunini (Bryant) in the east. The subspecies Chrysolina dhaulagirica arunensis differs from the nominative form in the bronze, not dark blue upperside, the feebler elytral rows of punctures, a more narrow red basal margin of the elytra and a smaller size. Meristata pulunini occidentalis differs from the typical M. pulunini by the colour: while the nominative form shows 2 small and round spots on the prothorax and a small and round preapical spot on the elytra, the western subspecies has only a single large transverse black patch in the middle of the prothorax and a rather large, distinctly transverse and often curved preapical spot on the elytra. Nepalogaleruca Kimoto is known with 4 species, N. angustilineata Kimoto and Takizawa has a more western distribution, N. elegans Kimoto a more eastern one, 2 further species were found in the central part. N. angustilineata which is found higher in the mountains has the blackish margins of the dorsal surface much more expanded than N. elegans which lives in lower regions. Species, which were only registered in the west, are e.g. Cryptocephalus notogrammus Suffrian or Smaragdina minutissima (Lopatin), both known from Afghanistan, Pakistan and India. Trachyaphthona fulvicornis Scherer and Nepalicrepis darjeelingensis Scherer, both known from India, are examples of species found only in the east. From the subfamilies Sagrinae, Zeugophorinae, Megalopodinae, Chlamisinae and Lamprosomatinae there are no species exclusively found in the west, also the Criocerinae have only a few species there. Among the Alticinae, Galerucinae and Hispinae there are also fewer species exclusively found in the west, but much more exclusively found in the east. Therefore, the moist climate in the east might be more favourable for some Chrysomelid species. Endemic Species Studying the Nepalese Chrysomelidae the most amazing fact is that the number of endemic genera is unusually large. Not less than 12 such genera were found, they are: Nepalolepta Medvedev


61

Fig. 6. A relief of Nepal (Donner, 1994) showing the deep river valleys and the very high mountains separating the region into isolated habitats.

belonging to the Galerucinae as well as Aphthonaria Medvedev, Ascuta Medvedev, Chabriella Medvedev, Himalalta Medvedev, Martensomela Medvedev, Paraminota Scherer, Schawalleria Medvedev and Yetialtica Medvedev belonging to the Alticinae, all apterous, and Aphthonotarsa Medvedev, Asiorella Medvedev and Lipraria Medvedev, also Alticinae, but with wings. Nearly all are found at very high altitudes, 80% of them are apterous and they belong mainly to the Alticinae. There are also several endemic species which replace each other from east to west, e.g. Sclerophaedon besucheti (Daccordi), S. brendelli Daccordi and Medvedev, S. nepalicus Daccordi and Medvedev, S. takizawai Daccordi and Medvedev, Semenovia daccordii Medvedev and Sprecher and S. nagaja Daccordi or Asiorestia himalayana Medvedev and Sprecher, A. irrorata Medvedev, A. nepalica Medvedev, A. thoracica Medvedev and A. wittmeri Medvedev. The genus Sclerophaedon is mostly distributed in Europe, Semenovia is mainly found in China and Asiorestia is widely known in the Holarctic zone. DISCUSSION The rich spectrum of Chrysomelid species is due to the numerous faces of the Nepalese countryside. At high altitudes there are a lot of specialized species adapted to the rough mountainous conditions while pest species occur in lower regions where agricultural fields are found. Such large occurrence of endemics as is found in Nepal is in fact quite uncommon. However, there is no doubt that in the future some of them will probably be found also in other places of the Himalayan region. Till now there is no knowledge about the existence of these species in neighbouring countries, therefore, it is unknown if disjunctions do exist. The isolation in the mountain regions, the extreme

62


altitudes and the reduction of wings may explain this high number of endemic genera and species. The very high mountains and the deep river valleys separating the region into isolated habitats offer good conditions for isolating populations and generating new species (Fig. 6). Therefore, Nepal might be a centre of speciation of Himalayan Chrysomelid species, which are spreading out from there into neighbouring regions. ACKNOWLEDGEMENTS I am extremely grateful to Lev Medvedev who encouraged me to do this study. I am also thankful to all persons who gave me the opportunity to study the collections in different museums. LITERATURE CITED Dobremez J.-F. 1976. Le Népal. Ecologie et biogéographie. Ed. Centre nature Recherche Scientifique. 355 pp. Donner W. 1994. Lebensraum Nepal - eine Entwicklungsgeographie. Institut für Asienkunde, Hamburg. 728 pp. Heikertinger, F. 1924. Die Halticinengenera der Palaearktis und Nearktis. Koleopterologische Rundschau 11(12):25-70. Kimoto S. 2001. The Chrysomelidae (Insecta: Coleoptera) collected by the Kyushu University Scientific Expedition to the Nepal Himalaya in 1971 and 1972. Bull. Kitakyushu Mus. Nat. Hist. 20: 17-80. Kimoto S. and Takizawa H. 2002. Chrysomelid beetles of Nepal Collected by the Himalaya Expedition 1979 of the National Science Museum, Tokyo. Bull. Natn. Sci. Mus. Tokyo, Ser. A 28 (3): 143-149. Lopatin I. K. 2002. New data on the leaf-beetles of the South and East Asia (Coleoptera, Chrysomelidae). Descriptions and synonymic remarks. Eurasian Entomol. J. 1 (1): 83-86. Medvedev L. and E. Sprecher 1999. Katalog der Chrysomelidae von Nepal. Entomologica Basiliensia 21:261354. Ohno M. 1961. On the species of the genus Trachyaphthona Heikertinger and the new genus Sphaeraltica. Tokyo Univ. Bull. Dept. Lib. Arts 2: 73-91. Scherer, G. 1969. Die Alticinae des indischen Subkontinentes (Coleoptera-Chrysomelidae). Pacific Insect Monographs 22:1-251. Scherer G. 1979. Ergebnisse der Bhutan-Expedition 1972 des Naturhistorischen Museums in Basel (Coleoptera: Chrysomelidae, Alticinae), 1.Teil. Entomologica Basiliensia 4:127-139. Sprecher-Uebersax E. 2000. Trachyaphthona hiunchulii, eine neue Alticinen-Art in Nepal. Entomologica Basiliensia 22:203-207. Sprecher-Uebersax E. and Zoia S. 2002. Pyrrhalta medvedevi sp. nov., a new species from the Nepal Himalayas (Coleoptera: Chrysomelidae, Galerucinae). Mitt. Schweiz. Ent. Ges. 75: 161-167.

© PENSOFT Publishers Leaf Beetle Fauna Sofia - Moscow

David G. Furth (ed.) 2003 of the Carpathian Basin (Central Europe): Historical Background... 63 Special Topics in Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 63-103

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background and Perspectives (Coleoptera, Chrysomelidae) Károly Vig1 1

Department of Natural History, Savaria Museum, H-9700 Szombathely, Kisfaludy S. u. 9., Hungary. Email: [email protected]

ABSTRACT First papers concerning the beetle fauna of the Carpathian Basin (Central Europe) are from the XVIII century (Scopoli 1772; Conrad 1782; Townson 1797). Due to the flourishing scientific interest, the exploration of the fauna accelerated in the XIX century. The results accumulated made possible to elaborate the unique volumes of the catalogue entitled Fauna Regni Hungariae published between 1897 and 1920. Authors of the catalogue presented all faunistical data for all animal taxa known from the Carpathian Basin at that time. In the paper concerning the beetle fauna one can find locality data of 508 leaf beetle species (Kuthy 1897). In the middle decades of the XX century a huge project, the series of Fauna Hungariae was launched. As a part of this monumental work the late Zoltán Kaszab revised the leaf beetle material of the Carpathian Basin preserved in the Hungarian Natural History Museum (Budapest) and published the result as a 63rd volume of the series (Kaszab 1962a). According to Kaszab’s work the fauna of the Carpathian Basin includes 628 species and subspecies of Chrysomelidae. It is necessary to note, that Kaszab incorporated more than 50 species into his key that could occur on the recent territory of Hungary. During the seventies and nineties exhaustive collections were carried out in the territory of Hungarian National Parks and other protected areas of the country. The results of these investigations added new species to the checklist of the Chrysomelidae of the area and a lot of localities meant new records to the distribution of some rare species. Summarizing the new evidences the fauna of the Carpathian Basin includes 666 species and subspecies of Chrysomelidae (this number includes all questionable taxa.). On the other hand 525 species or subspecies (with some doubtful species) are known from the present-day territory of Hungary. Recently similar considerable collections are being concluded in Hungary, though their results still have not been published yet. We do hope that these investigations will enrich the fauna with new species or at least some new distribution records. In this paper author defines the territory of the Carpathian Basin as a biogeographical unit and outlines the faunistical researches are to be done on the area in the future.

HISTORICAL BACKGROUND The first entomological work by a Hungarian, András Regéczi Horváth, was published in 1637, in Wittenberg, entitled: “Disputatio Physica de Insectis” (Fig. 1.). In the XVIII century other zoological

64

Károly Vig

Fig. 1. The front page of the first entomological paper written by Hungarian author, András Regéczi Horváth. It was published in 1637 in Wittenberg.

works followed it, but already in Hungarian language. In 1702 the “Egy Jeles Vadkert” (“A Prominent Game Preserve”) was published, by Gáspár Miskolci (Miskolci 1702) after which János Molnár (Molnár 1783) and István Gáti (Gáti 1792, 1795) published a natural history work in Hungarian language. In these works, however, few words were written about insects. One of the first publications on beetles appeared in the book of Giovanni Antonio Scopoli dealing with description of new beetle species. Eighteen of these species were found in the territory of historical Hungary (Scopoli 1772). A similar situation can be found in the case of data by Antoine Guillaume Olivier (Olivier 1789) and Christian Creutzer (Creutzer 1799). Mátyás Piller and Lajos Mitterpacher published an excellent description about their two-month research trip in Szerémség (now in Serbia), in 1782 in Latin language and described 42 new beetle species (Piller and Mitterpacher 1783). An anonymous author published 74 beetle species from Bars County (now in Slovakia)(Anonymous 1792). József Conrád listed 30 beetles, mostly Lamellicornia, from Sopron County (Conrád 1782). In the period prior to 1800, the work that dealt with the largest number of beetles, and which described many new species concerning the Carpathian Basin, was the travel book and the attachment of this book by an English nobleman, Robert Townson (Townson 1797) (Fig. 2). The imposingly rich species list and some habitat descriptions constitute the first comprehensive coleopterological work published about Hungary (Merkl 1999). A few years later in the list published on his own collection, Tóbiás Koy enumerated 2,765 beetle species (Koy 1800) (Fig. 3.).

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background...

Fig. 2. The front cover of the book published by Robert Townson on his journey in Hungary in the year 1793. Its appendix “Entomologia” is an important piece of the early entomological literature of Hungary and it is considered to be the first faunistic list of beetles from present-day Hungary.

65

Fig. 3. The front cover of the paper published by Tóbiás Koy on his own insect collection. In his list 2,765 beetle species were enumerated. This booklet is a unique rarity.

In the XIX century, the publications concerning the Hungarian insect fauna were increasingly widening. According to the discoveries up to that date, Imre Frivaldszky could publish an excellent book in 1865. In this pioneer work Frivaldszky firstly recognized the characteristic species for the Carpathian Basin from the aspects of zoogeography and fauna development and presented the characteristic species to it (Frivaldszky 1865). Taking into consideration the one and half century passed we can deservedly state that the study of Imre Frivaldszky is still a milestone in the knowledge about the Hungarian fauna. A relative of Imre Frivaldszky, János Frivaldszky, made the lion’s share of explorations of the Hungarian beetle-world, touring through and through historical Hungary together with the preparator János Pável and collecting a significant quantity of material during their expeditions. The results of the work has been published in the form of reports. The influence of his activity has been spread all over the Carpathian Basin. The work of the two Frivaldszky’s formed the scientific basis for the regular exploration of the Hungarian fauna, the start of which can be dated to the second half of the XIX century. The results of the research work have been summarized in a huge study book, published at the end of the

66

Károly Vig

century, being unique in those times: the work presenting the faunistical knowledge on the whole Carpathian Basin. The book “A Magyar Birodalom Állatvilága – Fauna Regni Hungariae” (The Fauna of the Hungarian Empire), has been published in several volumes. This work constituted a decisive starting point for all faunistic activities for long decades (Fig. 4.). Although the Arthropoda part was indicated as published in 1900 (Fig. 4), we do not generally know the dates for all the individual chapters within the Arthropoda, but we do know that the Coleoptera chapter was published in 1897 by Dezső Kuthy. Who could the undertaking rely on? Could the small number of zoologists undertake the exhaustive work of collection, work-up and publication? Although the period after the Conciliation between Hapsbourg-Austrian Empire and Hungary in 1867, the economical boost, social “peace” created a much more flexible atmosphere for the scientific research than we can find today, the answer is still: “perhaps not”. The Hungarians, considering the number in the society, offered a large number of internationally renowned zoologists to the world. It should be enough to mention the names of Imre Frivaldszky, János Frivaldszky, Ottó Herman, Sándor Mocsáry, Győző Szépligeti, Géza Horváth, Kálmán Kertész, Ernő Csiki, Lajos Bíró. We must not forget, however, that besides these personalities, all over the country, a large number of amateur entomologists (in the noblest sense of the word) were working in the exploration of the neighbouring living world: teachers, doctors, pharmacists,

Fig. 4. The front page of volume Arthropoda of the book “A Magyar Birodalom Állatvilága – Fauna Regni Hungariae” (The Fauna of the Hungarian Empire). All arthropod taxa known from the Carpathian Basin at that time was gathered into this unique volume.


67

church and other officials. Many people were bending over insect boxes day after day with magnifying glasses with the help of what was at the time excellent entomological books in the quiet and familiarity of the country houses, and teachers’ rooms. If the attempts proved to be without results, the experts of the Natural History Museum, Budapest, could always find time to examine the collected material. The school yearbooks, newsletters and the starting zoological papers meant publication opportunity for the results consisted mainly of the animal species’ list found in the environs of certain towns and villages. Where are these collections today? The storms of the last century left one or two of them behind. The chaos of the wars, the lack of care, and laziness caused the loss of the collections that documented the abundance of the fauna of the Carpathian Basin at that time. Therefore, unfortunately enough, the data included in some rare publications can be accepted only with doubt by zoologists of today. The chapter dealing with the beetles in the “A Magyar Birodalom Állatvilága” – “Fauna Regni Hungariae” (The Fauna of the Hungarian Empire) has been compiled by Dezső Kuthy. In the enumeration a total of 6,043 beetle taxa are presented, constituting 60% of the today known taxa in Hungary. The list contains the occurrence data of 508 leaf beetle species (Kuthy 1897). RESULTS OF THE XX CENTURY Hungary, as a losing party in the First World War, and according to the Trianon Peace Treaty, lost two thirds of her area and one third of her population. The regions being under Hungarian rule were attached to Austro-Hungarian Empire’s successor states. Hungary got only the inner areas of the Carpathian Basin. The researcher familiar with the Central-European faunistical literature, therefore, can encounter several versions (our faunal region, the area of the historical Hungary, the area of the Carpathian Basin) that mean the same thing in the literature, but these are different than the present territory of Hungary. The term “Carpathian Basin” geographically means the mountains of the Carpathians and the territory enclosed by the arch of the Carpathians and the high mountains of the Alps, bordered in the southwest by the Dinaric Mountains. This border is more or less arbitrary. The contour line roughly follows the altitude 600 meters on the outer slopes of the Carpathians and on the eastern slopes of the Alps. In the case of the Dinaric Mountains it follows the altitude 200 meters. This territory belongs to 11 countries (Austria, Bosnia and Herzegovina, Croatia, Czech Republic, Hungary, Poland, Romania, Slovakia, Slovenia, Ukraine, and Yugoslavia). The entire territory of Hungary and Slovakia belongs to this entity (Móczár 1972; Vidlička and Sziráki 1997) (Fig. 5.). The change of area of Hungary as well as the change of the taxonomical-systematical knowledge caused large-scale faunistical exploration work concerning the present territory of Hungary. In the 1950s a research program commenced within a framework of new booklets that are still published. The authors of “Magyarország Állatvilága – Fauna Hungariae” (The Hungarian Fauna) series present the taxa of the Hungarian animal kingdom, providing identification keys for determination. As a part of this monumental undertaking, the late Zoltán Kaszab worked up the Budapest Natural History Museum’s full Carpathian Basin leaf beetle collection, about 100,000 specimens. The collection includes the old, so-called historical collections and the recent collections as well. The huge collection includes almost all species and varieties published from territory of present-day Hungary and the Carpathian Basin. The result of this has been published in the 63rd volume of the “Magyarország Állatvilága” (Kaszab 1962a) (Fig. 6.). The most important data were published in a

68

Károly Vig

Fig. 5. The schematic map of the Carpathian Basin and the adjoining territories. The continuous line represents the contour line of the basin, the dotted lines represent the borders of countries (modified after Vidlička and Sziráki 1997).

separate publication (Kaszab 1962b). According to that study there were 628 species and 829 varieties known in the Carpathian Basin. A species (Longitarsus pannonicus) and two subspecies (Chrysomela [=Chrysolina] aurichalcea problematica; C. hemisphaerica bechyéana),1 as well as 83 varieties were new to science while 4 species, 5 subspecies and 7 forms proved to be synonyms and 2 subspecies and 4 forms had to be renamed.2 These taxonomical and nomenclatural results were to be expected as nobody dealt before in detail with the leaf beetles of the Carpathian Basin. Taking into consideration the topographical, orographical relations of the Carpathian Basin and its rich flora, this number of 628 leaf beetle taxa is not incredible at all. However, it has to be mentioned that Zoltán Kaszab indicated the presence of several species based on literature data only, while the species had no voucher specimen in the collections. Or, if there was a voucher 1

Today, the species and perhaps the two subspecies described by Zoltán Kaszab are not valid taxa. In the time when Zoltán Kaszab’s faunistical work had been carried out, special attention was paid to differentiation and documentation of different forms. Today, due to the changes in species concept, these taxonomical categories, as manifestations of the variety within the species level, have less importance. This, however, is true for the zootaxonomy only. The botanists are still paying special attention to the differentiation of these micro-taxa. 2


69

Fig. 6. The cover page of the leaf beetle monograph by the late Zoltán Kaszab published as a 63rd volume of the series Fauna Hungariae.

specimen, the label had a mark of the country name only (e.g. “Hungaria” or “Hungaria cent”). Besides these, almost 50 species were included in the identification key, which do not presently occur in Hungary, they can be found somewhere in the Carpathian Basin only. The third phase of the Hungarian fauna research is the knowledge of the living world of the areas under environment protection. The experts of the Hungarian Natural History Museum (Budapest) researched mainly the fauna and flora of the national parks while the researchers working in other cities’ museums were researching the areas related to a particular museum. Besides this most recent scientific material, mostly found in the Hungarian Natural History Museum (Budapest), the provincial museums also have coleopterological materials of inestimable value. The collections began to grow in the 1950s and 1960s when the newly graduated members of the natural science researchers and museologists began to work. These collections were carried out in more “untouched” parts of Hungary, in several habitats that were later diminished or intensely degraded. Based on the material collected we can form a picture of the former areas and their vegetation. By studying the material of collections and comparing it with the present data we can predict the short time-scale flora and fauna changes. In parallel with this, the evaluation of data provides a pivot point for the changes in distribution and population relations of certain species. It is not accidental that the study of the collections found in museums has a prominent role in the strategic research program commenced by the Hungarian Academy of Sciences.

70

Károly Vig

In the beginning years of the above-mentioned research, a book about the Bátorliget Natural Protection Area was published in 1953. As a result of the intensive collection and study, Bátorliget became the best-researched area of the country. The beetles were studied by Zoltán Kaszab and Viktor Székessy (Kaszab and Székessy 1953). They indicated the presence of 152 leaf beetle species in the area (and 22 varieties as well). After forty years, the experts of the museum examined again the fauna of the area and revised the material collected in the 1950s, therefore, 190 leaf beetles are known from that area today (Merkl 1991). Besides these large-scale programs, several provincial research programs commenced reviewing the natural values of a given region or protected area. The realization of the program entitled: “A Bakony Természeti Képe” (The Natural History of Bakony Mt.) commenced in 1962 in the Bakony Museum (Veszprém). This was the first such undertaking in the country serving as a model for similar research later. In the southern part of the Transdanubia, the Barcs Landscape Protection Area, the BédaKarapancsa Landscape Protection Area, the Boronka Landscape Protection Area as well as along the Dráva River intensive research work has been carried out. After the fashion of the programs mentioned above the Department of Natural History of the Savaria Museum (Szombathely) commenced the research program entitled „Az Alpokalja Természeti Képe” (Natural History of Praenoricum). On the commission of the Fertő–Hanság National Park, the colleagues of the Savaria Museum researched the living world of the Őrség Landscape Protection Area in 1994-95. The exploration of the fauna of the Hortobágy National Park resulted in four new species, which are missing, from Kaszab’s Chrysomelidae book (Tomov and Gruev 1981). Chaetocnema picipes (Marsham) was found from the forests of the national park, and recently was collected at several other localities. Its distribution is much wider than it appeared to be earlier. Revision of the Chaetocnema concinna (Marsham) material of Hungarian collections will result in further locality data of this species. Longitarsus junicola (Foudras) specimens collected in the Hortobágy NP were confused with Longitarsus lycopi (Foudras), however, Carlo Leonardi (Milan, Italy) has selected and identified some specimens. There were three additional specimens from the Kiskunság NP, which were also identified by Carlo Leonardi (Gruev et al. 1987). Longitarsus salviae Gruev was first recorded from Hortobágy NP and later was collected from other parts of the country. Longitarsus noricus Leonardi was until now known from Nagyvázsony (Transdanubia), but, in fact it has a wide distribution in the country. The late Josef Král (Prague, Czech Republic) was the first who dared to revise the Hungarian material of Longitarsus pratensis group. He reported two species as new to the Hungarian fauna: Longitarsus strigicollis Wollaston (as L. bombycinus Mohr) and Longitarsus reichei (Allard). Two specimens of Longitarsus strigicollis were collected in the Kiskunság NP (Gruev et al. 1987), while Longitarsus reichei seems to have wider distribution in the country since that time. Almost two decades later, on the basis of the most recent systematic results, Blagoy Gruev (Plovdiv, Bulgaria) and Otto Merkl (Budapest, Hungary) revised again the Hungarian material of Longitarsus pratensis group (Gruev and Merkl 1992). There are two other Longitarsus species missing from the faunal book. Longitarsus bertii Leonardi occurs all over the country, while Longitarsus medvedevi Shapiro has only a few data up to now. Both species had been collected a long time ago, but were misidentified. Finally, Longitarsus brisouti Heikertinger deserves also a note. It is a very rare species in Hungary; only two additional specimens were captured during the collecting programs (Tomov and Gruev 1981). One Altica and one Phyllotreta species were also added to the checklist. Both Altica cornivorax Král and Phyllotreta astrachanica Lopatin, formerly confused with Phyllotreta diademata (Foudras) (Gruev 1982), are widely distributed species all over the country.


71

The species listed above come mainly from the Great Plain of Hungary, but many rare species were found on the hilly areas of the country as well. While the northeastern part of Hungary, the Bükk and the Zemplén Mountains were open for entomological research, the western areas along the Austrian and Yugoslavian borders were closed due to the well-known political situation. Only when the program “Natural History of Praenoricum” started in 1976 was there opportunity for entomological collecting behind the “iron curtain” on the territory of the Őrség and of the Kőszegi Mt. These investigations resulted in many new localities to the distribution of mountainous species that were formerly known from the Bükk or Zemplén Mt. only (see for more details Vig 1992). The leaf beetle fauna of the Western Transdanubia has been studied in the middle 1990s (Vig 1996). The area covered contained the territory of Őrség, from where the results concerning the leaf beetle fauna had already been published (Vig and Rozner 1996). The most noteworthy result was the discovery of three species that were new to the Hungarian fauna. Cryptocephalus querceti Suffrian and Chrysolina eurina (Frivaldszky) are rare in our faunistic region, while the distribution of Oulema duftschmidi (Redtenbacher) can only be confirmed after the revision of the whole Hungarian Oulema melanopus (Linnaeus) material. The Bükk National Park is situated in the northeastern part of Hungary. The territory of the national park consisting of karstic highland and an extensive submountain region covers the largest part of the Bükk Mountains. Only very little has been known up to now about the chrysomelid fauna of this region. Between 1954 and 1956 several organized collecting trips were carried out by the Hungarian Natural History Museum, but on a limited basis. The old material is mainly originates from this fieldwork. An intensive collecting program has been carried out by the same museum between 1981 and 1985. It covered various habitats all over the national park and yielded many more specimens. A total of 278 leaf beetle species were collected in the Bükk NP of which four species Chrysolina aurichalcea (Mannerheim); Neocrepidodera motschulskii (Konstantinov); Dibolia carpathica Weise and Minota halmae (Apfelbeck) proved to be new to the Hungarian fauna (Tomov et al. 1996). The morphological characters of one old Chrysolina aurichalcea specimen known from the territory fits well the description of subspecies Chrysolina aurichalcea problematica (Kaszab) from Transylvania. However, another specimen from the nearby Mátra Mt. is identical to the northern subspecies Chrysolina aurichalcea bohemica (G. Müller). Since that time several specimens were collected in the territory of the Aggtelek National Park (Jósvafő: Nagyoldal) (Vig 1999). Its subspecific division, if any, needs further clarification. A single Minota halmae specimen was collected. It was the first voucher Hungarian specimen. A re-examination of the Minota material collected in the Carpathian Basin resulted in the discovery of two further specimens from Zirc (Bakony Mt.). At the same time a lot of old Minota carpathica Heikertinger specimens were known from the Bükk Mt. The Hungarian material was elaborated by the late Zoltán Kaszab who identified it as M. obesa carpathica Heikertinger, Maurizio Biondi (L’Aquila, Italy) raised it to a species rank. The Aggtelek National Park is situated on a southern extension of the Gömör–Torna Karst, which is connected to the Slovak Karst. Until the 1990s scarcely anything had been known on the non-cavernicolous fauna of the territory. This statement especially concerns the insects, consequently there was no data for the Chrysomelidae of the territory. Only several random collections were made by the late Zoltán Kaszab yielding a few specimens only. An intensive collecting program has been carried out by the staff of the Hungarian Natural History Museum (Budapest). Identification of the chrysomelid material yielded 243 species. Two species, Longitarsus pallidicornis Kutschera and Longitarsus monticola Kutschera proved to be new for the Hungarian fauna. The collecting resulted the first voucher specimens of Longitarsus nanus (Foudras) from the recent territory of Hungary.

72

Károly Vig

Two interesting Lilioceris specimens were also caught. The sclerotized parts of the genitalia of these specimens differ from the genuine Lilioceris merdigera (Linnaeus). There is no detectable difference in external morphology, if only that, the tarsal joints are red, while these joints are black in specimens of genuine Lilioceris merdigera. Further specimens are needed to clarify the status of these species. Psylliodes illyricus Leonardi and Gruev was described from Hungary and from the Balkan region (Leonardi and Gruev 1993). Since that time, several additional specimens were captured in the territory of the Aggtelek NP (Vig 1999). The next study considered the leaf beetle material data gathered in the area of the Duna–Dráva National Park, more exactly, at the Barcsi Borókás Landscape Protection Area in the 1970s and 1980s as well as at the Dráva-side areas in 1992-94 and later, in 1996-97. 156 leaf beetle taxa could be shown from the examined area. The collection of two specimens of Chrysolina eurina constitutes a prominent faunistical data – this species up to this time has been known from the Őrség only. The leaf beetle fauna is interesting because of numerous rare (or rated as rare) species (Vig 1998a). The evaluation of the Villány Hills commenced in 1997. Numerous experts contributed to the fieldwork. 161 leaf beetle species with more than 1,400 specimens were collected from the area (Vig 2000). The author has studied the Mátra Museum’s (Gyöngyös) leaf beetle collection. The collection includes 210 leaf beetle species and more than 3,000 specimens. During the work, five leaf beetle species were found from the Bükk Mountains area that were missing from the publication on the Bükk National Park leaf beetle fauna. The following taxa are uncertain concerning distribution, and taxonomic status: Chrysolina aurichalcea taxons of subspecies rank (ssp. bohemica and ssp. problematica), the members of Chrysolina hemisphaerica species complex and the members of Chrysolina rufa species complex (Vig 1998b). The Savaria Museum at Szombathely has bought in 1995 the leaf beetle collection of Attila Podlussány, an amateur coleopterologist. The collection has 13,000 leaf beetle specimens, mostly deriving from the Carpathian Basin as well as the Balkan Peninsula. Recently the author studied the specimens from northern, central and southeastern Europe (except Turkey), about 10,000 specimens. This part of the collection represents 442 taxa. During the study, the differentiation of several highaltitude species could be clarified regarding the Balkan Peninsula. Two new species to the Hungarian fauna could be found (Lilioceris schneideri (Weise); Cassida bergeali Bordy) (Vig 2002). A specimen of the Cassida bergeali Bordy, was captured by Slovak colleagues (Jan Bezděk and Aleš Bezděk) in Hungary, therefore, this was the first proof of Hungarian occurrence of the species (in coll. K. Vig). The Cassida leucanthemi Bordy species was described near Cassida sanguinolenta O. F. Müller that is common in the Carpathian Basin. Since the Cassida leucanthemi has been found in Poland (Borowiec and Świętojańska 1997), it is expected to occur in Hungary as well. The revision of the whole Carpathian Basin material regarding the Cassida sanguinolenta and Cassida vibex Linnaeus is necessary. Similarly, concerning the Galerucella nymphaeae (Linnaeus) it turned out that it is a complex of several related species (Lohse 1989). In this case also a full revision of the material from the Carpathian Basin is needed in order to decide which species of the complex can be found in the affected area. In the fauna book of Zoltán Kaszab (Kaszab, 1962a), only two Lilioceris-species were mentioned: Lilioceris lilii (Scopoli) and the Lilioceris merdigera. In the revision work on the genus (Berti and Rapilly 1976) the authors indicated the occurrence of Lilioceris faldermanni (Guérin-Meneville) and Lilioceris schneideri from Hungary. The voucher specimen of Lilioceris schneideri has actually been found (Vig 2002).


73

Diabrotica virgifera Le Conte a serious pest of maize, was introduced to Serbia by organized charities during the Balkan War. It was firstly discovered near Belgrade. Its range in Serbia has expanded and reached the southern border of Hungary in the 1990s. Recently it has become established in the warm, southern counties (mainly in Békés County) of the country, but it reached the southern border of Slovakia as well. Cryptocephalus species and forms included in the hypochaeridis group were critically studied by Carlo Leonardi and Davide Sassi. They, among others, elevated C. hypochaeridis hypochaeridis (Linnaeus) and C. hypochaeridis transiens Franz to a species rank and described a new species, C. solivagus Leonardi and Sassi. All three species occur in the territory of the Carpathian Basin (Leonardi and Sassi 2001) but, on the other hand, their exact distribution is unknown yet. In the following some additional species are mentioned that are known from the Carpathian Basin fauna, therefore, their occurrence in Hungary is to be expected or, they have to be deleted from the fauna of Hungary (for details see Strejček 1993; Gruev and Döberl 1977): Phyllotreta acutecarinata Heikertinger; Aphthona beckeri Jacobson and Longitarsus nimrodi Furth are recorded from Slovakia, thus these species are expected to occur in Hungary. Longitarsus bulgaricus Gruev is known from Herkulesfürdő (=Baile Herculane, Romania), thus this species also a member of the leaf beetle fauna of the Carpathian Basin (Gruev and Döberl 1997). Longitarsus callidus Warchałowski is distributed from Asia Minor through southeast Europe to Austria, thus the occurrence of this species in Hungary was quite probable. Recently this species was collected in the territory of the Fertő–Hanság National Park (Vig in press a). In the surrounding of Hungary, Longitarsus celticus Leonardi is known from Austria (environs of Vienna) and Ukraine. Psylliodes laticollis Kutschera is known from Croatia (Dalmatia). Mantura mathewsi (Stephens) distributed near Hungary in Austria, Croatia, Slovakia and Ukraine (Carpathians) while Neocrepidodera brevicollis (J. Daniel) is known from south Austria and Slovakia. Occurrence of all of these species in Hungary is quite probable. Altica fruticola (Weise) was originally described from Transsylvania (Romania). Recently it is known from Austria, Romania and Ukraine (Carpathians). Its occurrence in Hungary is probable. Crepidodera nigricoxis (Allard) is distributed in the Balkan Peninsula, Slovenia and Austria. Its occurrence is expected in the southern parts of Transdanubia (Hungary). Cryptocephalus bameuli Duhaldeborde was recently decribed from Cryptocephalus flavipes Fabricius material. This species is suspected to occur in the whole Palearctic Region, thus its occurence in Hungary is not surprizing (Duhaldeborde 1999). One specimen of Cryptocephalus marginellus Olivier and one specimen of Cryptocephalus czwalinai Weise are known both from Siófok (coll. Lichtneckert). The occurrence of these species in the recent territory of Hungary is questionable, thus they distribution needs further confirmation. The species Chrysolina substrangulata Bourdonné was described based on a single specimen, with a locality indicated as “Hungaria” (Bourdonné 1986). There is little chance that record was from Hungary, because in our limestone mountains, the most possible places for the occurrence of the species (e.g. Bükk Mt., Villány Hills or the Aggtelek Karst), intensive collections were recently performed. It can be supposed that the species is from the present-day Croatia or Slovenia. In these places another species of the Bechynia subgenus, the Chrysolina milleri (Weise) also occurs. The occurrence of Sclerophaedon carniolicus (Germar) has been indicated based on literature data by Zoltán Kaszab, from the Mecsek Mt. The examination on the specimen kept in the Janus Pannonius Museum (Pécs) reveals that the identification was a mistake and the species has to be deleted from the Hungarian fauna (Vig in press b). Kaszab (1962b) described a species: Longitarsus panonicus Kaszab that turned out to be a junior synonym of Longitarsus tristis Weise. It had been listed as an endemic species for the Carpathian Basin.

74

Károly Vig

The whole area of Slovakia and Hungary constitutes a geographical unit of the Carpathian Basin, therefore, it is natural that the researchers of these countries could have a higher contribution to the knowledge of the Basin’s fauna. The Slovakian colleagues are working with high intensity (Strejček 1993; Čižek 1995; Čižek et al. 1995; Zúber 1995; Bezděk and Bezděk 1998; Čižek and Fornůsek 2000) and based on their work the Hungarian fauna also was increased with a flea beetle species: Aphthona aeneomicans Allard (Čižek and Fornůsek 2000). A significant part of the neighbouring Romania also belongs to the Carpathian Basin. Unfortunately, Romania in recent times has no expert in leaf beetles, therefore, Hungarian experts and a foreign colleague carried out the revision of the Romanian flea beetles. As a result of the revision, four species new to the Romanian fauna were found: Chaetocnema picipes; Chaetocnema montenegrina Heikertinger; Longitarsus absynthii Kutschera and Longitarsus kutscherae (Rye) (Gruev et al. 1993). All four species were found in Transylvania, therefore, they form a part of the leaf beetle fauna of the Carpathian Basin. Summarizing the new evidence the fauna of the Carpathian Basin includes 666 species and subspecies of Chrysomelidae, including all questionable taxa. On the other hand 525 species or subspecies (with some doubtful species) are known from the present-day territory of Hungary. Finally, a brief remark should be added. It is evident that new faunistic results come from places where significant collecting has been carried out. Recently, similar significant work has been concluded in several parts of Hungary (for example, in the territory of the Fertő–Hanság National Park and the Kőrös–Maros National Park) and in the Carpathians, though their results still have not published. We hope that these investigations will enrich the fauna with new species or at least some new distribution records. OVERVIEW AND FUTURE POSSIBILITIES The diversity of the insects according to our present knowledge exceeds any other group of living origanisms and at the same time this diversity is highly jeopardized. Besides the protection of this biodiversity, it is also necessary to become familiar with this diversity as much as possible, to document its element species with specimens, to preserve them and to make them available for future research. The entomological collections play a decisive role in this task. Unfortunately, the role of these collections has been underestimated over a long period, collectionsbased scientific work has been deemed unnecessary by many and the financial support for collections maintenance has been minimal. This has happened for several reasons in Hungary (Papp 1983; Mahunka and Vásárhelyi 1990). Despite the supposed awareness the leading role of taxonomy in biodiversity, there has been little support and relief. The problem is even worse because taxonomy is bound to specimen collections which voucher the scientific experience through specimens, and their continuous development and protection. The ever-increasing pressure of collections maintenance and conservation burdens each institution, mainly museums, with the exponential growth of the costs and work. Of course, at the same time the collection thus reduces the overall ability and flexibility of the institution to do a great variety of things. Therefore, in several cases the research institutions which are exempt from the “burden” of collections, thus avoid those large costs and become more flexible to use the majority of their resources for other things they consider to be more “popular” or appealing to the public or more effective for fund raising. In the competition for resources, especially funding, the museums start with a handicap, because expectiations of their history, culture and society require the unconditional preservation of their collections (Vásárhelyi 1998).


75

The decrease of social appreciation of the taxonomical research and its low level of support for decades is responsible for the “aging and decline” of this profession. Certain groups have no Hungarian – or even European – expert anymore. The negative comments above characterize not only Hungarian taxonomy, but similar tendencies can be observed in other countries of Europe. Although the participants of the “Rio Conference” declared the importance of the preservation of biodiversity and its knowledge, little has been done beyond the solemn declarations and nothing has been done for the creation of the financial foundation to ensure this. In Hungary, the site for taxonomic work is in most cases a museum. The restricted financing of public collections as well as the decrease of appreciation of professionalism in museums means that less and less are “born” as museum researchers. Glancing around, we can see that in all countries of the Carpathian Basin there is a similar situation. Although taxonomic research is not always burdened with political problems, it is still a delicate question to answer who can perform taxonomic work, not only the study, but also the collection management (curation). Who is allowed to coordinate a faunal exploration program for the whole Carpathian Basin? Should a single country monopolize this task? The nostalgic reminiscences of the historical past do entitle us to proclaim ourselves as the best participants of this work? (Taking into consideration that the majority of collections of the Carpathian Basin representing almost all groups of the living world are kept in Budapest!) At the XVIII National Meeting of the Hungarian Muselogists of Natural Sciences (Piliscsaba, 79 August 2000), entitled “Museums of Natural Sciences in the Carpathian Basin”, experts from Hungary and neighbouring countries accepted a co-operative declaration and drafted outlines for future joint research. The context of this collaboration depends on many factors and on the researchers themselves. Scientific experts consider it more important to know and preserve the elements of the living world, in spite of the impediments of politics, economics and history. The leaf beetle fauna of the Carpathian Basin is still unexplored. Both the nomenclature changes and new taxonomic examination methods can help rewrite the older manuals. We can state with reasonable hope that the future still has many of tasks for taxonomists for whom research is equally a source of joy and a profession. AN UPDATED CHECK-LIST OF CHRYSOMELIDAE OF THE CARPATHIAN BASIN István Rozner updated the leaf beetle fauna of the Carpathina Basin in 1996 (Rozner 1996). Unfortunately, due to the systematic, nomenclatoric changes, new faunistic evidence appeared since that time and some errors and misspellings were made, the list needs strong revision. The systematics and nomenclature are based generally on Mroczkowski (1990), Kippenberg and Döberl (1994, 1998), and Gruev and Döberl (1997) in the following check-list. The names used by Kaszab (1962a) differing from those in the present follow them and are after equal sign (=). The taxa in brackets ([ ]) are expected to occur in the recent territory of Hungary but do occur in the Carpathian Basin or in the adjoining territories as well. A question mark (?) means that the validity of the taxa is questionable. Orsodacninae Orsodacne Latreille, 1802 Orsodacne cerasi (Linnaeus, 1758) Orsodacne lineola (Panzer, 1794)

76

Károly Vig

Zeugophorinae Zeugophora Kunze, 1818 Zeugophora flavicollis (Marsham, 1802) [Zeugophora frontalis Suffrian, 1840] Zeugophora scutellaris Suffrian, 1840 Zeugophora subspinosa (Fabricius, 1781) Donaciinae Haemoniini Chen, 1964 Macroplea Samouelle, 1819 = Haemonia Latreille Macroplea appendiculata (Panzer, 1794) Macroplea mutica balatonica (Székessy, 1941) Donaciini Kirby, 1837 Donacia Fabricius, 1775 [Askevoldia Kippenberg, 1994] [Donacia (Askevoldia) reticulata Gyllenhal, 1817] Donacia s. str. Donacia (s. str.) antiqua Kunze, 1818 Donacia (s. str.) aquatica (Linnaeus, 1758) Donacia (s. str.) bicolora Zschach, 1788 Donacia (s. str.) brevicornis Åhrens, 1810 Donacia (s. str.) crassipes Fabricius, 1775 Donacia (s. str.) dentata Hoppe, 1795 Donacia (s. str.) impressa Paykull, 1799 Donacia (s. str.) malinovskyi Åhrens, 1810 = Malinovskyi Ahrens Donacia (s. str.) marginata Hoppe, 1795 Donacia (s. str.) obscura Gyllenhal, 1813 [Donacia (s. str.) polita Kunze, 1818] Donacia (s. str.) semicuprea Panzer, 1796 Donacia (s. str.) simplex Fabricius, 1775 [Donacia (s. str.) sparganii Åhrens, 1810] Donacia (s. str.) thalassina Germar, 1811 Donacia (s. str.) versicolorea (Brahm, 1790) = versicolor Brahm Donacia (s. str.) vulgaris Zschach, 1788 Donaciella Reitter, 1920 Donacia (Donaciella) cinerea Herbst, 1784 Donacia (Donaciella) clavipes Fabricius, 1792 Donacia (Donaciella) tomentosa Åhrens, 1810 Plateumarini Askevold, 1990 Plateumaris Thomson, 1859 Plateumaris s. str. Plateumaris (s. str.) sericea (Linnaeus, 1758)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = discolor Panzer Juliusina Reitter, 1920 Plateumaris (Juliusina) braccata (Scopoli, 1772) Plateumaris (Juliusina) consimilis (Schrank, 1781) Plateumaris (Juliusina) rustica (Kunze, 1818) = affinis Kunze Criocerinae Lemini Heinze, 1962 Lema Fabricius, 1798 Lema cyanella (Linnaeus, 1758) Oulema Gozis, 1886 = Lema Lacordaire Oulema duftschmidi (Redtenbacher, 1874) Oulema erichsonii (Suffrian, 1841) = Erichsoni Suffrian Oulema gallaeciana (Heyden, 1870) = lichenis Voet Oulema melanopus (Linnaeus, 1758) Oulema rufocyanea (Suffrian, 1847) Oulema septentrionis (Weise, 1880) Oulema tristis (Herbst, 1786) Criocerini Latreille, 1807 Crioceris O. F. Müller, 1764 = Crioceris Fourcroy Crioceris asparagi (Linnaeus, 1758) Crioceris duodecimpunctata (Linnaeus, 1758) [Crioceris paracenthesis (Linnaeus, 1767)] Crioceris quatuordecimpunctata (Scopoli, 1763) Crioceris quinquepunctata (Scopoli, 1763) Lilioceris Reitter, 1912 = Crioceris Fourcroy [Lilioceris faldermanni (Guérin-Meneville, 1829)] Lilioceris lilii (Scopoli, 1763) Lilioceris merdigera (Linnaeus, 1758) Lilioceris schneideri (Weise, 1900) Clytrinae Clytrini Kirby, 1837 Labidostomis Germar, 1822 = Labidostomis Redtenbacher Labidostomis cyanicornis Germar, 1822 Labidostomis humeralis (Schneider, 1792) Labidostomis longimana (Linnaeus, 1761) Labidostomis lucida axillaris (Lacordaire, 1848)

77

78

Károly Vig Labidostomis pallidipennis (Gebler, 1829) [Labidostomis taxicornis (Fabricius, 1792)] = taxicornis Redtenbacher Labidostomis tridentata (Linnaeus, 1758) Cheilotoma Chevrolat, 1837 = Chilotoma Redtenbacher Cheilotoma musciformis (Goeze, 1777) Lachnaia Chevrolat, 1837 = Lachnaea Redtenbacher Lachnaia sexpunctata (Scopoli, 1763) = Lachnaea longipes Fabricius Tituboea Lacordaire, 1848 = Antipa De Geer Tituboea macropus (Illiger, 1800) [Tituboea sexmaculata (Fabricius, 1781)] [Miopristis Lacordaire, 1848] [Miopristis bimaculata (Rossi, 1790)] Clytra Laicharting, 1781 Clytra appendicina Lacordaire, 1848 Clytra laeviuscula (Ratzeburg, 1837) Clytra quadripunctata (Linnaeus, 1758) Coptocephala Chevrolat, 1837 Coptocephala chalybaea (Germar, 1824) Coptocephala rubicunda (Laicharting, 1781) Coptocephala scopolina (Linnaeus, 1767) Coptocephala unifasciata (Scopoli, 1763) Smaragdina Chevrolat, 1837 = Cyaniris Redtenbacher Smaragdina s. str. [Smaragdina (s. str.) chloris (Lacordaire, 1848)] Monrosia L. Medvedev, 1971 Smaragdina (Monrosia) affinis (Illiger, 1794) Smaragdina (Monrosia) aurita (Linnaeus, 1767) Smaragdina (Monrosia) flavicollis (Charpentier, 1825) [Smaragdina (Monrosia) graeca (Lefévre, 1872)] [Smaragdina (Monrosia) hypocrita Lacordaire, 1848] Smaragdina (Monrosia) salicina (Scopoli, 1763) = cyanea Fabricius ? Smaragdina (Monrosia) tibialis hungarica (Weise, 1895) Smaragdina (Monrosia) xanthaspis (Germar, 1824)

Cryptocephalinae [Stylosomini Chapuis, 1874] [Stylosomus Suffrian, 1848] [Stylosomus tamaricis (Herrich-Schäffer, 1838)]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Stylosomus minutissimus (Germar, 1823)] Pachybrachini Chapuis, 1874 Pachybrachis Chevrolat, 1837 = Pachybrachys Suffrian [Pachybrachis carpathicus (Rey, 1883)] Pachybrachis fimbriolatus (Suffrian, 1848) Pachybrachis flexuosus (Weise, 1882) Pachybrachis hieroglyphicus (Laicharting, 1781) Pachybrachis hippophaes (Suffrian, 1848) = hippophäes Suffrian [Pachybrachis pallidulus suturalis (Weise, 1882)] = suturalis Weise [Pachybrachis picus (Weise, 1882)] Pachybrachis sinuatus (Mulsant et Rey, 1859) = haliciensis Suffrian [Pachybrachis scripticollis Faldermann, 1837] Pachybrachis tessellatus (Olivier, 1791) Cryptocephalini Gyllenhal, 1813 Cryptocephalus Geoffroy, 1762 = Cryptocephalus Fourcroy Disopus Stephens, 1839 Cryptocephalus (Disopus) pini (Linnaeus, I758) Protophysus Chevrolat, 1837 = Proctophysus Redtenbacher Cryptocephalus (Protophysus) schaefferi Schrank, 1789 Cryptocephalus (Protophysus) villosulus Suffrian, 1847 Asionus Lopatin, 1988 Cryptocephalus (Asionus) apicalis Gebler, 1830 Cryptocephalus (Asionus) bohemius Drapiez, 1819 Cryptocephalus (Asionus) gamma Herrich-Schäffer, 1829 [Cryptocephalus (Asionus) gamma semilugens Dudich, 1924] Cryptocephalus (Asionus) quatuordecimmaculatus Schneider, 1792 Cryptocephalus (Asionus) reitteri Weise, 1882 = Reitteri Weise Lamellosus Tomov, 1979 Cryptocephalus (Lamellosus) laevicollis Gebler, 1830 Heterichnus Warchałowski, 1991 [Cryptocephalus (Heterichnus) carinthiacus Suffrian, 1848] Cryptocephalus (Heterichnus) coryli (Linnaeus, 1758) Cryptocephalus s. str. Cryptocephalus (s. str.) aureolus illyricus Franz, 1949 Cryptocephalus (s. str.) bameuli Duhaldeborde, 1999 Cryptocephalus (s. str.) bicolor Eschscholtz, 1818 Cryptocephalus (s. str.) biguttatus (Scopoli, 1763) [Cryptocephalus (s. str.) bimaculatus Fabricius, 1781]

79

80

Károly Vig Cryptocephalus (s. str.) bipunctatus (Linnaeus, 1758) Cryptocephalus (s. str.) androgyne Marseul, 1875 = caerulescens Sahlberg Cryptocephalus (s. str.) cordiger (Linnaeus, 1758) Cryptocephalus (s. str.) decemmaculatus (Linnaeus, 1758) [Cryptocephalus (s. str.) distinguendus Schneider, 1792] Cryptocephalus (s. str.) elongatus Germar, 1824 Cryptocephalus (s. str.) flavipes Fabricius, 1781 Cryptocephalus (s. str.) frenatus Laicharting, 1781 Cryptocephalus (s. str.) gridellii Burlini, 1950 = Gridellii Burlini Cryptocephalus (s. str.) hypochaeridis (Linnaeus, 1758) = hypochoeridis hypochoeridis Linnaeus Cryptocephalus (s. str.) imperialis Laicharting, 1781 Cryptocephalus (s. str.) janthinus Germar, 1824 Cryptocephalus (s. str.) laetus Fabricius, 1792 Cryptocephalus (s. str.) marginatus Fabricius, 1781 [Cryptocephalus (s. str.) marginellus Olivier, 1791] Cryptocephalus (s. str.) moraei (Linnaeus, 1758) = Moraei Linnaeus Cryptocephalus (s. str.) nitidulus Fabricius, 1787 Cryptocephalus (s. str.) nitidus (Linnaeus, 1758) Cryptocephalus (s. str.) octacosmus Bedel, 1891 Cryptocephalus (s. str.) octomaculatus Rossi, 1790 Cryptocephalus (s. str.) octopunctatus (Scopoli, 1763) Cryptocephalus (s. str.) parvulus O. F. Müller, 1776 Cryptocephalus (s. str.) quadriguttatus Richter, 1820 Cryptocephalus (s. str.) quadripustulatus Gyllenhal, 1813 Cryptocephalus (s. str.) quinquepunctatus (Scopoli, 1763) Cryptocephalus (s. str.) sericeus (Linnaeus, 1758) s. str. [Cryptocephalus (s. str.) sericeus zambanellus Marseul, 1875] Cryptocephalus (s. str.) sexpunctatus (Linnaeus, 1758) Cryptocephalus (s. str.) signatifrons Suffrian, 1847 = signatifrons Fabricius Cryptocephalus (s. str.) solivagus Leonardi and Sassi, 2001 = hypochoeridis hypochoeridis Linnaeus (partim) Cryptocephalus (s. str.) transiens Franz, 1949 = hypochoeridis transiens Franz Cryptocephalus (s. str.) trimaculatus Rossi, 1790 [Cryptocephalus (s. str.) turcicus Suffrian, 1847] Cryptocephalus (s. str.) variegatus Fabricius, 1781 Cryptocephalus (s. str.) violaceus Laicharting, 1781 Cryptocephalus (s. str.) virens Suffrian, 1847 Cryptocephalus (s. str.) vittatus Fabricius, 1775

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Burlinius Lopatin, 1965 Cryptocephalus (Burlinius) bilineatus (Linnaeus, 1767) [Cryptocephalus (Burlinius) carpathicus J. Frivaldszky, 1883] Cryptocephalus (Burlinius) chrysopus Gmelin, 1790 Cryptocephalus (Burlinius) connexus Olivier, 1808 [Cryptocephalus (Burlinius) czwalinae Weise, 1882] = Czwalinai Weise Cryptocephalus (Burlinius) elegantulus Gravenhorst, 1807 Cryptocephalus (Burlinius) exiguus Schneider, 1792 Cryptocephalus (Burlinius) frontalis Marsham, 1802 Cryptocephalus (Burlinius) fulvus (Goeze, 1777) Cryptocephalus (Burlinius) labiatus (Linnaeus, 1761) Cryptocephalus (Burlinius) macellus Suffrian, 1860 Cryptocephalus (Burlinius) ocellatus Drapiez, 1819 Cryptocephalus (Burlinius) ochroleucus Fairmaire, 1859 = ochroleucus Stephens Cryptocephalus (Burlinius) pallifrons Gyllenhal, 1813 = pallidifrons Gyllenhal Cryptocephalus (Burlinius) planifrons Weise, 1882 Cryptocephalus (Burlinius) populi Suffrian, 1848 Cryptocephalus (Burlinius) punctiger Paykull, 1799 Cryptocephalus (Burlinius) pusillus Fabricius, 1776 Cryptocephalus (Burlinius) pygmaeus Fabricius, 1792 = vittula Suffrian Cryptocephalus (Burlinius) querceti Suffrian, 1848 Cryptocephalus (Burlinius) rufipes (Goeze, 1777) Cryptocephalus (Burlinius) saliceti Zebe, 1855 Cryptocephalus (Burlinius) strigosus Germar, 1824 Lamprosomatinae Oomorphus Curtis, 1831 = Lamprosoma Kirby Oomorphus concolor (Sturm, 1807) = Kolbei Scholtz Eumolpinae Colaspini Jacobson, 1908 Pales Chevrolat, 1837 = Eupales Lefévre Pales ulema (Germar, 1813) Adoxini Baly, 1863 Bromius Chevrolat, 1837 = Adoxus Kirby Bromius obscurus (Linnaeus, 1758) s. str. Bromius obscurus villosulus (Schrank, 1781)

81

82

Károly Vig

Myochroini Jacobson, 1908 Pachnephorus Chevrolat, 1837 = Pachnephorus Redtenbacher Pachnephorus pilosus (Rossi, 1790) Pachnephorus tessellatus (Duftschmid, 1825) Pachnephorus villosus (Duftschmid, 1825) Eumolpini Thomson, 1859 Eumolpus Illiger, 1798 = Chrysochus Redtenbacher Eumolpus asclepiadeus (Pallas, 1773) Chrysomelinae Timarchini Motschulsky, 1860 Timarcha Dejean, 1821 = Timarcha Latreille = Metallotimarcha Motschulsky (partim) Timarcha s. str. Timarcha (s. str.) goettingensis (Linnaeus, 1758) Timarcha (s. str.) pratensis (Duftschmid, 1825) Timarcha (s. str.) rugulosa Herrich-Schäffer, 1838 Timarcha (s. str.) tenebricosa moravica Bechyné, 1945 Metallotimarcha Motschulsky, 1860 Timarcha (Metallotimarcha) metallica (Laicharting, 1781) [Timarcha (Metallotimarcha) gibba Hagenbach, 1825] Entomoscelini Chevrolat, 1843 Entomoscelis Chevrolat, 1837 Entomoscelis adonidis (Pallas, 1771) Entomoscelis sacra (Linnaeus, 1758) Chrysomelini Latreille, 1802 Leptinotarsa Chevrolat, 1837 = Leptinotarsa Stål Leptinotarsa decemlineata (Say, 1824) Crosita Motschulsky, 1860 Crosita salviae (Germar, 1824) Chrysolina Motschulsky, 1860 = Chrysomela Linnaeus Threnosoma Motschulsky, 1860 [Chrysolina (Threnosoma) cribrosa (Åhrens, 1812)] = cribrosa Ahrens Chrysolina (Threnosoma) fimbrialis (Küster, 1845) s. str. ? [Chrysolina (Threnosoma) fimbrialis avulsa Bechyné, 1946] ? Chrysolina (Threnosoma) fimbrialis hungarica (Fuss, 1861) ? [Chrysolina (Threnosoma) obenbergeri Bechyné, 1950] = Obenbergeri Bechyné [Chrysolina (Threnosoma) weisei (J. Frivaldszky, 1883)]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = Weisei J. Frivaldszky Ovostoma Motschulsky, 1860 Chrysolina (Ovostoma) globipennis (Suffrian, 1851) s. str. ? [Chrysolina (Ovosoma) globipennis deubeli Bechyné, 1950] = globipennis Deubeli Bechyné [Chrysolina (Ovosoma) globipennis euminuta Bechyné, 1950] Chrysolina (Ovostoma) olivieri (Bedel, 1892) s. str. = caerulea caerulea Csiki = caerulea collina Csiki ? [Chrysolina (Ovostoma) olivieri montanella Bechyné, 1950] = caerulea montanella Bechyné Chrysolina (Ovosoma) olivieri slovaka Bechyné, 1946 ? [Chrysolina (Ovosoma) olivieri subalpina Csiki, 1952] Timarchida Ganglbauer, 1897 Chrysolina (Timarchida) deubeli (Ganglbauer, 1897) = Timarchida Deubeli Ganglbauer Synerga Weise, 1900 Chrysolina (Synerga) coerulans (Scriba, 1791) Chrysolina (Synerga) herbacea (Duftschmid, 1825) Euchrysolina Bechyné, 1950 Chrysolina (Euchrysolina) graminis (Linnaeus, 1758) [Heliostola Motschulsky, 1860] [Chrysolina (Heliostola) lichenis moravica (Weise, 1882)] [Chrysolina (Heliostola) lichenis rhipaea (Weise, 1898)] [Chrysolina (Heliostola) carpathica (Fuss, 1856) s. str.] [(Chrysolina (Heliostola) carpathica gabrieli (Weise, 1903)] = carpathica Gabrieli Weise [Chrysolina (Heliostola) schneideri (Weise, 1882)] Erythrochrysa Bechyné, 1950 Chrysolina (Erythrochrysa) polita (Linnaeus, 1758) Bechynia Bourdonné, 1977 Chrysolina (Bechynia) substrangulata Bourdonné, 1986 Chrysolina s. str. Chrysolina (s. str.) staphylaea (Linnaeus, 1758) Chrysomorpha Motschulsky, 1860 [Chrysolina (Chrysomorpha) cerealis (Linnaeus, 1767) s. str.] = cerealis bivittata Schrank Chrysolina (Chrysomorpha) cerealis alternans (Panzer, 1799) = cerealis plorans Bechyné Sphaerochrysolina Kippenberg, 1994 [Chrysolina (Sphaerochrysolina) biharica (Breit, 1919)] Chrysolina (Sphaerochrysolina) rufa squalida (Suffrian, 1851) = rufa diminuta Bechyné = lapidaria Bechyné = lapidaria pachysomoides Bechyné

83

84

Károly Vig = menthae Duftschmid Chrysolina (Sphaerochrysolina) rufa crassicollis (Suffrian, 1851) = crassicollis Suffrian ? [Chrysolina (Sphaerochrysolina) rufa rementina (Bechyné, 1950)] = crassicollis rementina Bechyné ? [Chrysolina (Sphaerochrysolina) rufa robusta (Breit, 1919)] = crassicollis robusta Breit [Chrysolina (Sphaerochrysolina) umbratilis (Weise, 1887) s. str.] ? [Chrysolina (Sphaerochrysolina) umbratilis erudita (Bechyné, 1952)] Cyrtochrysolina Kippenberg, 1994 [Chrysolina (Cyrtochrysolina) marcasitica (Germar, 1824) s. str.] Chrysolina (Cyrtochrysolina) marcasitica turgida (Weise, 1882) Colaphoptera Motschulsky, 1860 Chrysolina (Colaphoptera) globosa (Panzer, 1802) s. str. ? [Chrysolina (Colaphoptera) globosa banatica (Csiki, 1940)] ? [Chrysolina hemisphaerica bechynéana (Kaszab, 1962)] = hemisphaerica Béchyana Kaszab [Chrysolina hemisphaerica fallaciosa (G. Müller, 1949)] = hemisphaerica Germar = fallaciosa Franzi Bechyné ? [Chrysolina (Colaphoptera) hemisphaerica plumbeonigra (Reitter, 1912)] = purpurascens plumbeonigra Reitter Chrysolina (Colaphoptera) hemisphaerica purpurascens (Germar, 1822) = crassimargo Germar = purpurascens Germar Ovosoma Motschulsky, 1860 [Chrysolina (Ovosoma) atrovirens (J. Frivaldszky, 1876)] Chrysolina (Ovosoma) susterai Bechyné, 1950 = morio Krynicki Minckia E. Strand, 1935 Chrysolina (Minckia) chalcites (Germar, 1824) Chrysolina (Minckia) oricalcia (O. F. Müller, 1776) Colaphodes Motschulsky, 1860 Chrysolina (Colaphodes) haemoptera (Linnaeus, 1758) Colaphosoma Motschulsky, 1860 Chrysolina (Colaphosoma) sturmi (Westhoff, 1882) = diversipes Bedel Taeniosticha Motschulsky, 1860 Chrysolina (Taeniosticha) reitteri (Weise, 1884) =? lurida lineata Papp Stichoptera Motschulsky, 1860 Chrysolina (Stichoptera) kuesteri (Helliesen, 1912) = Küsteri Helliesen Chrysolina (Stichoptera) gypsophilae (Küster, 1845) Chrysolina (Stichoptera) rossia (Illiger, 1802)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = Rossia Illiger Chrysolina (Stichoptera) sanguinolenta (Linnaeus, 1758) Anopachys Motschulsky, 1860 Chrysolina (Anopachys) aurichalcea bohemica (G. Müller, 1948) ? Chrysolina (Anopachys) aurichalcea problematica (Kaszab, 1962) Chrysolina (Anopachys) eurina (J. Frivaldszky, 1883) = eurina perplexa Breit Sphaeromela Bedel, 1892 Chrysolina (Sphaeromela) varians (Schaller, 1783) = lichenis Havelkai Bechyné Hypericia Bedel, 1892 Chrysolina (Hypericia) cuprina (Duftschmid, 1825) Chrysolina (Hypericia) didymata (Scriba, 1791) [Chrysolina (Hypericia) geminata (Paykull, 1799)] Chrysolina (Hypericia) hyperici (Forster, 1771) ? Chrysolina (Hypericia) quadrigemina (Suffrian, 1851) = cuprina ab. quadrigemina Suffrian Chalcoidea Motschulsky, 1860 Chrysolina (Chalcoidea) analis (Linnaeus, 1767) Chrysolina (Chalcoidea) carnifex (Fabricius, 1792) Chrysolina (Chalcoidea) cinctipennis (Harold, 1874) Chrysolina (Chalcoidea) marginata (Linnaeus, 1758) Craspeda Motschulsky, 1860 Chrysolina (Craspeda) limbata (Fabricius, 1775) s. str. = limbata Kavani Bechyné (partim) ? [Chrysolina (Craspeda) limbata findeli (Suffrian, 1851)] = limbata Findeli Suffrian [Taeniochrysea Bechyné, 1950] [Chrysolina (Taeniochrysea) americana (Linnaeus, 1758)] Fastuolina Warchałowski, 1991 = Dlochrysa Motschulsky Chrysolina (Fastuolina) fastuosa (Scopoli, 1763) Oreina Chevrolat, 1837 = Chrysochloa Hope Allorina Weise, 1902 [Oreina (Allorina) bidentata Bontems, 1981] = tristis Fabricius Oreina (Allorina) luctuosa (Olivier, 1804) = rugulosa Suffrian [Intricatorina Kühnelt, 1984] [Oreina (Intricatorina) intricata (Germar, 1824) s. str.] = intricata Germar [Oreina (Intricatorina) intricata anderschi (Duftschmid, 1825)] = intricata Anderschi Duftschmid Oreina s. str.

85

86

Károly Vig

Oreina (Oreina) alpestris (Schummel, 1844) s. str. = alpestris Schummel [Oreina (Oreina) alpestris banatica (Weise, 1884)] = alpestris ab. banatica Weise [Oreina (Oreina) alpestris variabilis (Weise, 1883)] = variabilis Apfelbecki Winkler [Oreina (Oreina) bifrons decora (Richter, 1820)] = bifrons decora Richter [Oreina (Oreina) bifrons heterocera (Reitter, 1917)] = bifrons Obenbergeri Marchand [Oreina (Oreina) speciosa bosnica Apfelbeck, 1912] = gloriosa bosnica Apfelbeck [Oreina (Oreina) viridis (Duftschmid, 1825) s. str.] = viridis Duftschmidt [Oreina (Oreina) viridis merkli (Weise, 1884)] = viridis ab. Merkli Weise [Protorina Weise, 1894] [Oreina (Protorina) plagiata (Suffrian, 1861) s. str.] [Oreina (Protorina) plagiata commutata (Suffrian, 1861)] = plagiata croatica Weise Virgulatorina Kühnelt, 1894 Oreina (Virgulatorina) virgulata (Germar, 1824) s. str. = virgulata Germar Oreina (Virgulatorina) virgulata praefica (Weise, 1884) = virgulata ab. praefica Weise [Chrysochloa Hope, 1840] [Oreina (Chrysochloa) cacaliae (Schrank, 1785) s. str.] = cacaliae dinarica Apfelbeck [Oreina (Chrysochloa) cacaliae senecionis (Schummel, 1843)] [Oreina (Chrysochloa) speciosissima (Scopoli, 1763) s. str.] [Oreina (Chrysochloa) speciosissima fuscoaenea (Schummel, 1843)] = speciosissima ab. Letzneri Weise [Oreina (Chrysochloa) speciosissima juncorum (Suffrian, 1851)] Phaedonini Weise, 1915 Colaphus Dahl, 1823 = Colaphellus Weise Colaphus sophiae (Schaller, 1783) Gastrophysa Chevrolat, 1837 = Gastroidea Hope Gastrophysa polygoni (Linnaeus, 1758) Gastrophysa viridula (De Geer, 1775) Phaedon Dahl, 1823 = Phaedon Latreille Phaedon Phaedon armoraciae (Linnaeus, 1758)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = veronicae Bedel Phaedon cochleariae (Fabricius, 1792) Phaedon laevigatus (Duftschmid, 1825) [Phaedon salicinus (Heer 1845)] = veronicae ab. salicinus Heer Neophaedon Jacobson, 1901 Neophaedon pyritosus (Rossi, 1792) [Sternoplatys Motschulsky, 1860] [Sternoplatys segnis (Weise, 1884)] Sclerophaedon Weise, 1882 [Sclerophaedon carniolicus (Germar, 1824)] [Sclerophaedon carpathicus Weise, 1875] Sclerophaedon orbicularis (Suffrian, 1851) Prasocuris Latreille, 1802 Prasocuris s. str. Prasocuris junci (Brahm, 1790) Prasocuris phellandrii (Linnaeus, 1758) Hydrothassa C. G. Thomson, 1866 Prasocuris (Hydrothassa) flavocincta (Brullé, 1832) Prasocuris (Hydrothassa) glabra (Herbst, 1783) [Prasocuris (Hydrothassa) hannoveriana (Fabricius, 1775)] = hannoverana Fabricius Prasocuris (Hydrothassa) marginella (Linnaeus, 1758) Plagiodera Chevrolat, 1837 = Plagiodera Redtenbacher Plagiodera versicolora (Laicharting, 1781) = versicolor Laicharting Linaeidea Motschulsky, 1860 = Melasoma Stephens Linaeidea aenea (Linnaeus, 1758) = aeneum Linnaeus Chrysomela Linnaeus, 1758 = Melasoma Stephens Strickerus Lucas, 1920 Chrysomela (Strickerus) cuprea Fabricius, 1775 = cupreum Fabricius Chrysomela (Strickerus) lapponica Linnaeus, 1758 = lapponicum Linnaeus Chrysomela (Strickerus) vigintipunctata (Scopoli, 1763) = vigintipunctatum Scopoli Pachylina Medvedev, 1969 Chrysomela (Pachylina) collaris Linnaeus, 1758 = collare Linnaeus Chrysomela s. str. Chrysomela (s. str.) populi Linnaeus, 1758

87

88

Károly Vig

Chrysomela (s. str.) saliceti Suffrian, 1849 Chrysomela (s. str.) tremula Fabricius, 1787 = tremulae Fabricius Phratorini Weise, 1915 Gonioctena Chevrolat, 1837 = Phytodecta Kirby Spartoxena Motschulsky, 1860 Gonioctena (Spartoxena) fornicata Brüggemann, 1873 Gonioctena s. str. Gonioctena (s. str.) decemnotata (Marsham, 1802) = rufipes De Geer Gonioctena (s. str.) flavicornis (Suffrian, 1851) [Gonioctena (s. str.) kaufmanni (Miller, 1881)] = Kaufmanni Miller Gonioctena (s. str.) linnaeana (Schrank, l781) = Linnaeana Schrank Gonioctena (s. str.) viminalis (Linnaeus, 1758) Spartophila Stephens, 1834 Gonioctena (Spartophila) olivacea (Forster, 1771) Goniomena Motschulsky, 1860 Gonioctena (Goniomena) intermedia (Helliesen, 1913) Gonioctena (Goniomena) pallida (Linnaeus, 1758) Gonioctena (Goniomena) interposita (Franz et Palmén, 1950) Gonioctena (Goniomena) quinquepunctata (Fabricius, 1787) Phratora Chevrolat, 1837 = Phyllodecta Kirby Chaetoceroides Strand, 1935 Phratora (Chaetoceroides) vulgatissima (Linnaeus, 1758) Phratora s. str. Phratora (s. str.) atrovirens (Cornelius, 1857) Phratora (s. str.) laticollis (Suffrian, 1851) Phratora (s. str.) tibialis (Suffrian, 1851) Phratora (s. str.) vitellinae (Linnaeus, 1758) Galerucinae Galerucini Latreille, 1802 Diabrotica Chevrolat, 1844 Diabrotica virgifera Le Conte, 1858 Galerucella Crotch, 1873 Galerucella s. str. = Hydrogaleruca Laboissière Galerucella (s. str.) aquatica (Fourcroy, l785) = nymphaeae ab. aquatica Fourcroy Galerucella (s. str.) grisescens (Joannis, 1866) [Galerucella (s. str.) kerstensi Lohse, 1989]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Galerucella (s. str.) sagittariae (Gyllenhal, 1813)] Galerucella (s. str.) nymphaeae (Linnaeus, 1758) Neogalerucella Chujó, 1962 Galerucella (Neogalerucella) calmariensis (Linnaeus, 1767) Galerucella (Neogalerucella) lineola (Fabricius, 1781) Galerucella (Neogalerucella) pusilla (Duftschmid, 1825) Galerucella (Neogalerucella) tenella (Linnaeus, 1761) Xanthogaleruca Laboissière, 1934 Xanthogaleruca luteola (O. F. Müller, 1766) Pyrrhalta Joannis, 1866 Pyrrhalta viburni (Paykull, 1799) Lochmaea Weise, 1883 Lochmaea caprea (Linnaeus, 1758) = capreae Linnaeuas Lochmaea crataegi (Forster, 1771) Lochmaea suturalis (C. G. Thomson, 1866) Galeruca O. F. Müller, 1764 = Galeruca Fourcroy Haptoscelis Weise, 1886 Galeruca (Haptoscelis) melanocephala (Ponza, 1805) Emarhopa Weise, 1886 Galeruca (Emarhopa) rufa Germar, 1824 Galeruca s. str. Galeruca (s. str.) dahli (Joannis, 1866) = Dahli Joannis [Galeruca (s. str.) interrupta (Illiger, 1802) s. str.] Galeruca (s. str.) interrupta circumdata Duftschmid, 1825 [Galeruca (s. str.) interrupta hungarica J. Frivaldszky, 1876] Galeruca (s. str.) laticollis Sahlberg, 1837 [Galeruca (s. str.) littoralis Fabricius, 1787] Galeruca (s. str.) pomonae (Scopoli, 1763) Galeruca (s. str.) tanaceti (Linnaeus, 1758) Sermylassini Mroczkowski, 1990 Sermylassa Reitter, 1912 Sermylassa halensis (Linnaeus, 1767) Agelasticini Chapuis, 1875 Agelastica Chevrolat, 1837 = Agelastica Redtenbacher Agelastica alni (Linnaeus, 1758) Luperini Chapuis, 1875 Phyllobrotica Chevrolat, 1837 = Phyllobrotica Redtenbacher Phyllobrotica adusta (Creutzer, 1799) Phyllobrotica quadrimaculata (Linnaeus, 1758)

89

90

Károly Vig Euluperus Weise, 1886 Euluperus major Weise, 1886 Euluperus xanthopus (Duftschmid, 1825) Calomicrus Dillwyn, 1829 = Luperus Fourcroy Calomicrus circumfusus (Marsham, 1802) Calomicrus pinicola (Duftschmid, 1825) Luperus Geoffroy, 1762 = Luperus Fourcroy [Luperus aetolicus Kiesenwetter, 1861] [Luperus caucasicus mixtus Weise, 1879] [Luperus cyanipennis Küster, 1848] ? Luperus carniolicus Kiesenwetter, 1861 Luperus flavipes (Linnaeus, 1767) Luperus longicornis (Fabricius, 1781) Luperus luperus (Sulzer, 1776) = lyperus Sulzer [Luperus nigripes Kiesenwetter, 1861] Luperus rugifrons Weise, 1886 Luperus saxonicus (Gmelin, 1790) Luperus viridipennis Germar, 1824 Luperus xanthopoda (Schrank, 1781)

Alticinae = Halticinae Phyllotreta Chevrolat, 1837 = Phyllotreta Stephens [Phyllotreta acutecarinata Heikertinger, 1941] Phyllotreta armoraciae (Koch, 1803) Phyllotreta astrachanica Lopatin, 1977 Phyllotreta atra (Fabricius, 1775) Phyllotreta austriaca Heikertinger, 1909 Phyllotreta balcanica Heikertinger, 1909 Phyllotreta christinae Heikertinger, 1941 = Christinae Heikertinger [Phyllotreta corrugata Reiche, 1858] Phyllotreta cruciferae (Goeze, 1777) Phyllotreta diademata Foudras, 1859 [Phyllotreta dilatata C. G. Thomson, 1866] = tetrastigma ab. Weiseana Csiki [Phyllotreta erysimi Weise, 1900 s. str.] Phyllotreta exclamationis (Thunberg, 1784) Phyllotreta flexuosa (Illiger, 1794) [Phyllotreta ganglbaueri Heikertinger, 1909] = Ganglbaueri Heikertinger

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Phyllotreta hochetlingeri Fleischer, 1917] = Hochetlingeri Fleischer Phyllotreta nemorum (Linnaeus, 1758) Phyllotreta nigripes (Fabricius, 1775) s. str. Phyllotreta nodicornis (Marsham, 1802) Phyllotreta ochripes (Curtis, 1837) Phyllotreta procera (Redtenbacher, 1849) Phyllotreta punctulata (Marsham, 1802) = aerea Allard Phyllotreta scheuchi Heikertinger, 1941 = Scheuchi Heikertinger Phyllotreta striolata (Fabricius, 1803) = vittata Fabricius Phyllotreta tetrastigma (Comolli, 1837) Phyllotreta undulata Kutschera, 1860 [Phyllotreta variipennis (Boieldieu, 1859) s. str.] Phyllotreta vittula (Redtenbacher, 1849) Aphthona Chevrolat, 1837 Aphthona abdominalis (Duftschmid, 1825) Aphthona aeneomicans Allard, 1875 s. str. Aphthona atrovirens (Förster, 1849) [Aphthona beckeri Jacobson, 1897] Aphthona cyanella (Redtenbacher, 1849) Aphthona cyparissiae (Koch, 1803) [Aphthona czwalinae Weise, 1888] = Czwalinai Weise [Aphthona erichsoni (Zetterstedt, 1838)] = Erichsoni Zetterstedt Aphthona euphorbiae (Schrank, 1781) Aphthona flava Guillebeau, 1895 Aphthona flaviceps Allard, 1859 Aphthona franzi Heikertinger, 1944 = Franzi Heikertinger Aphthona herbigrada (Curtis, 1837) Aphthona lacertosa (Rosenhauer, 1847) Aphthona lutescens (Gyllenhal, 1808) [Aphthona nigriceps (W. Redtenbacher, 1842)] Aphthona nigriscutis Foudras, 1860 Aphthona nonstriata (Goeze, 1777) = caerulea Fourcroy Aphthona ovata Foudras, 1860 Aphthona pallida (Bach, 1856) Aphthona placida (Kutschera, 1864) Aphthona pygmaea (Kutschera, 1861) Aphthona semicyanea Allard, 1859 s. str.

91

92

Károly Vig [Aphthona stussineri Weise, 1888] = Stussineri Weise Aphthona venustula (Kutschera, 1861) Aphthona violacea (Koch, 1803) Longitarsus Latreille in Berthold, 1827 Longitarsus s. str. Longitarsus (s. str.) absynthii Kutschera, 1862 = absinthii Kutschera Longitarsus (s. str.) aeneicollis (Faldermann, 1837) = suturalis Marsham Longitarsus (s. str.) albineus (Foudras, 1860) Longitarsus (s. str.) apicalis (Beck, 1817) Longitarsus (s. str.) atricillus (Linnaeus, 1761) Longitarsus (s. str.) ballotae (Marsham, 1802) Longitarsus (s. str.) bertii Leonardi, 1973 = ferrugineus Foudras (partim) Longitarsus (s. str.) brisouti Heikertinger, 1912 = Brisouti Heikertinger Longitarsus (s. str.) brunneus (Duftschmid, 1825) Longitarsus (s. str.) callidus Warchałowski, 1967 [Longitarsus (s. str.) celticus Leonardi, 1975] Longitarsus (s. str.) cerinthes (Schrank, 1798) = nervosus cerinthes Schrank Longitarsus (s. str.) curtus (Allard, 1860) Longitarsus (s. str.) echii (Koch, 1803) Longitarsus (s. str.) exsoletus (Linnaeus, 1758) s. str. = exoletus Linnaeus [Longitarsus (s. str.) fallax Weise, 1888] Longitarsus (s. str.) ferrugineus (Foudras, 1860) = Waterhousei Kutschera Longitarsus (s. str.) foudrasi Weise, 1893 = Foudrasi Weise Longitarsus (s. str.) fulgens (Foudras, 1860) Longitarsus (s. str.) ganglbaueri Heikertinger, 1912 s. str. = Ganglbaueri Heikertinger Longitarsus (s. str.) gracilis Kutschera, 1864 Longitarsus (s. str.) helvolus Kutschera 1863 = membranaceus Foudras Longitarsus (s. str.) holsaticus (Linnaeus, 1758) Longitarsus (s. str.) jacobaeae (Waterhouse, 1858) Longitarsus (s. str.) juncicola (Foudras, 1860) Longitarsus (s. str.) kutscherae (Rye, 1872) = melanocephalus var. Kutscherae Rey Longitarsus (s. str.) languidus Kutschera, 1863 Longitarsus (s. str.) lateripunctatus personatus Weise, 1893

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Longitarsus (s. str.) lewisii (Baly, 1874) = scutellaris Rey (partim) Longitarsus (s. str.) linnaei (Duftschmid, 1825) = Linnaei Duftschmidt Longitarsus (s. str.) longipennis Kutschera, 1863 Longitarsus (s. str.) longiseta Weise, 1889 Longitarsus (s. str.) luridus (Scopoli, 1763) s. str. Longitarsus (s. str.) lycopi (Foudras, 1860) Longitarsus (s. str.) medvedevi Shapiro, 1956 Longitarsus (s. str.) melanocephalus (De Geer, 1775) Longitarsus (s. str.) membranaceus (Foudras, 1860) Longitarsus (s. str.) minimus Kutschera, 1863 = pratensis ab. minimus Kutschera Longitarsus (s. str.) minusculus (Foudras, 1860) Longitarsus (s. str.) monticola Kutschera, 1863 = curtus ab. monticola Kutschera Longitarsus (s. str.) nanus (Foudras, 1860) Longitarsus (s. str.) nasturtii (Fabricius, 1792) Longitarsus (s. str.) niger (Koch, 1803) Longitarsus (s. str.) nigerrimus (Gyllenhal, 1827) Longitarsus (s. str.) nigrofasciatus (Goeze, 1777) s. str. [Longitarsus (s. str.) nimrodi Furth, 1979 ] Longitarsus (s. str.) noricus Leonardi, 1976 Longitarsus (s. str.) obliteratus (Rosenhauer, 1847) Longitarsus (s. str.) ochroleucus (Marsham, 1802) s. str. Longitarsus (s. str.) pallidicornis Kutschera, 1863 = Hubenthali Wanka Longitarsus (s. str.) parvulus (Paykull, 1799) Longitarsus (s. str.) pellucidus (Foudras, 1860) Longitarsus (s. str.) pratensis (Panzer, 1794) Longitarsus (s. str.) pulmonariae Weise, 1893 Longitarsus (s. str.) quadriguttatus (Pontoppidan, 1765) Longitarsus (s. str.) rectilineatus (Foudras, 1860) = rectelineatus Foudras Longitarsus (s. str.) reichei (Allard, 1860) [Longitarsus (s. str.) rubellus (Foudras, 1860)] Longitarsus (s. str.) rubiginosus (Foudras, 1860) Longitarsus (s. str.) salviae Gruev, 1975 Longitarsus (s. str.) scobripennis Heikertinger, 1913 Longitarsus (s. str.) scutellaris (Mulsant & Rey, 1874) Longitarsus (s. str.) strigicollis Wollaston, 1864 = bombycinus Mohr Longitarsus (s. str.) substriatus Kutschera, 1863 Longitarsus (s. str.) succineus (Foudras, 1860) Longitarsus (s. str.) suturellus (Duftschmid, 1825)

93

94

Károly Vig Longitarsus (s. str.) symphyti Heikertinger, 1912 Longitarsus (s. str.) tabidus (Fabricius, 1775) s. str. Longitarsus (s. str.) tristis Weise, 1888 = pannonicus Kaszab Testergus Weise, 1893 Longitarsus (Testergus) anchusae (Paykull, 1799) [Longitarsus (Testergus) bulgaricus Gruev, 1973] Longitarsus (Testergus) fuscoaeneus Redtenbacher, 1849 s. str. Longitarsus (Testergus) pinguis Weise, 1888 Altica O. F. Müller, 1764 = Haltica O. F. Müller Altica brevicollis Foudras, 1860 s. str. Altica brevicollis coryletorum Král, 1964 Altica carduorum Guérin-Méneville, 1858 [Altica carinthiaca Weise, 1888] Altica cornivorax Král, 1969 = ampelophaga Guérin-Méneville [Altica fruticola (Weise, 1888)] Altica helianthemi (Allard, 1895) = pusilla Duftschmid Altica impressicollis (Reiche, 1862) Altica lythri Aubé, 1843 Altica oleracea (Linnaeus, 1758) s. str. ? [Altica oleracea breddini (Mohr, 1958)] Altica palustris (Weise, 1888) Altica quercetorum Foudras, 1860 s. str. Altica quercetorum saliceti (Weise, 1888) Altica tamaricis Schrank, 1785 s. str. Hermaeophaga Foudras, 1860 Hermaeophaga mercurialis (Fabricius, 1792) Batophila Foudras, 1860 Batophila fallax Weise, 1888 [Batophila moesica Heikertinger, 1948] = moesiaca Heikertinger Batophila rubi (Paykull, 1799) Lythraria Bedel, 1897 Lythraria salicariae (Paykull, 1800) Ochrosis Foudras, 1860 Ochrosis ventralis (Illiger, 1807) Neocrepidodera Heikertinger, 1911 = Crepidodera Stephens [Neocrepidodera brevicollis (J. Daniel, 1904)] Neocrepidodera corpulenta (Kutschera, 1860) Neocrepidodera crassicornis (Faldermann, 1837) s. str. [Neocrepidodera cyanescens (Duftschmid, 1825) s. str.]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... [Neocrepidodera cyanipennis (Kutschera, 1860)] Neocrepidodera femorata (Gyllenhal, 1813) Neocrepidodera ferruginea (Scopoli, 1763) [Neocrepidodera impressa (Fabricius, 1801) s. str.] [Neocrepidodera melanostoma (Redtenbacher, 1849)] Neocrepidodera motschulskii (Konstantinov, 1991) = sublaevis Motschulsky Neocrepidodera nigritula (Gyllenhal, 1813) [Neocrepidodera norica (Weise, 1890)] [Neocrepidodera puncticollis (Reitter, 1880)] = cyanipennis var. puncticollis Reitter [Neocrepidodera transsilvanica (Fuss, 1864)] = transsylvanica Fuss Neocrepidodera transversa (Marsham, 1802) Orestia Germar, 1845 [Orestia alpina (Germar, 1824)] [Orestia aubei Allard, 1859] = Aubéi Allard Orestia carpathica Reitter, 1879 [Orestia paveli J. Frivaldszky, 1877] = Páveli J. Frivaldszky Derocrepis Weise, 1886 Derocrepis rufipes (Linnaeus, 1758) Hippuriphila Foudras, 1860 Hippuriphila modeeri (Linnaeus, 1761) = Modeeri Linnaeus Crepidodera Chevrolat, 1837 = Chalcoides Foudras Crepidodera aurata (Marsham, 1802) Crepidodera aurea (Geoffroy, 1785) = aurea Fourcroy Crepidodera fulvicornis (Fabricius, 1792) Crepidodera lamina (Bedel, 1901) [Crepidodera nigricoxis Allard, 1879] Crepidodera nitidula (Linnaeus, 1758) Crepidodera plutus (Latreille, 1804) = Plutus Latreille Epitrix Foudras, 1860 = Epithrix Foudras Epitrix atropae Foudras, 1860 Epitrix intermedia Foudras, 1860 Epitrix pubescens (Koch, 1803) Minota Kutschera, 1859 Minota carpathica Heikertinger, 1911 = obesa carpathica Heikertinger

95

96

Károly Vig

Minota halmae (Apfelbeck, 1906) = obesa Walt (sensu Kaszab 1962) [Minota obesa (Waltl, 1839)] Podagrica Chevrolat, 1837 = Podagrica Foudras Podagrica fuscicornis (Linnaeus, 1767) = fuscicornis chrysomelina Waltl Podagrica malvae (Illiger, 1807) s. str. [Podagrica malvae semirufa (Küster, 1847)] Podagrica menetriesi (Faldermann, 1837) = Menetriesi Faldermann Mantura Stephens, 1831 Mantura chrysanthemi (Koch, 1803) [Mantura mathewsi (Stephens, 1832)] Mantura obtusata (Gyllenhal, 1813) Mantura rustica (Linnaeus, 1767) Chaetocnema Stephens, 1831 Tlanoma Motschulsky, 1845 Chaetocnema (Tlanoma) breviuscula (Faldermann, 1884) Chaetocnema (Tlanoma) chlorophana (Duftschmid, 1825) Chaetocnema (Tlanoma) concinna (Marsham, 1802) Chaetocnema (Tlanoma) conducta (Motschulsky, 1838) Chaetocnema (Tlanoma) major (Jacquelin du Val, 1852) s. str. [Chaetocnema (Tlanoma) orientalis (Bauduér, 1874)] Chaetocnema (Tlanoma) picipes (Marsham, 1802) = concinna Marsham (partim) Chaetocnema (Tlanoma) scheffleri (Kutschera, 1864) = Scheffleri Kutschera Chaetocnema (Tlanoma) semicoerulea (Koch, 1803) s. str. = semicaerulea Koch Chaetocnema (Tlanoma) tibialis (Illiger, 1807) Chaetocnema s. str. Chaetocnema (s. str.) aerosa (Letzner, 1846) Chaetocnema (s. str.) arenacea (Allard, 1860) Chaetocnema (s. str.) arida Foudras, 1860 Chaetocnema (s. str.) aridula (Gyllenhal, 1827) Chaetocnema (s. str.) compressa (Letzner, 1846) Chaetocnema (s. str.) confusa (Boheman, 1851) Chaetocnema (s. str.) hortensis (Geoffroy, 1785) = hortensis Foudras [Chaetocnema (s. str.) montenegrina Heikertinger, 1912] Chaetocnema (s. str.) mannerheimii (Gyllenhal, 1827) = Mannerheimi Gyllenhal Chaetocnema (s. str.) obesa (Boieldieu, 1859) Chaetocnema (s. str.) procerula (Rosenhauer, 1856)

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... Chaetocnema (s. str.) sahlbergii (Gyllenhal, 1827) = Sahlbergi Gyllenhal Chaetocnema (s. str.) subcoerulea (Kutschera, 1864) = subcaerulea Kutschera Sphaeroderma Stephens, 1831 Sphaeroderma rubidum (Graëlls, 1858) Sphaeroderma testaceum (Fabricius, 1775) Argopus Fischer von Waldheim, 1824 Argopus ahrensii (Germar, 1817) = Ahrensi Germar Argopus bicolor Fischer von Waldheim, 1824 Argopus nigritarsis (Gebler, 1823) Apteropeda Chevrolat, 1837 = Apteropeda Stephens [Apteropeda globosa (Illiger, 1794)] Apteropeda orbiculata (Marsham, 1802) [Apteropeda splendida Allard, 1860] Mniophila Stephens, 1831 Mniophila muscorum (Koch, 1803) s. str. Dibolia Latreille, 1829 Eudibolia Khnzorian, 1968 Dibolia (Eudibolia) femoralis Redtenbacher, 1849 s. str. [Dibolia (Eudibolia) russica Weise, 1893] Dibolia (Eudibolia) schillingii (Letzner, 1847) = Schillingi Letzner Dibolia s. str. Dibolia (s. str.) carpathica Weise, 1893 Dibolia (s. str.) cryptocephala (Koch, 1803) Dibolia (s. str.) cynoglossi (Koch, 1803) Dibolia (s. str.) depressiuscula Letzner, 1847 Dibolia (s. str.) foersteri Bach, 1859 = Foersteri Bach Dibolia (s. str.) occultans (Koch, 1803) Dibolia (s. str.) phoenicia Allard, 1866 = orientalis Weise Dibolia (s. str.) rugulosa Redtenbacher, 1849 Dibolia (s. str.) timida (Illiger, 1807) Psylliodes Latreille, 1827 = Psylliodes Berthold Psylliodes s. str. Psylliodes (s. str.) aereus Foudras, 1860 s. str. Psylliodes aereus austriacus Heikertinger, 1911 = aerea austriaca Heikertinger Psylliodes (s. str.) affinis (Paykull, 1799) Psylliodes (s. str.) attenuatus (Koch, 1803)

97

98

Károly Vig = attenuata Koch Psylliodes (s. str.) brisouti Bedel, 1898 = napi ab. Brisouti Bedel Psylliodes (s. str.) chalcomerus (Illiger, 1807) = chalcomera Illiger Psylliodes (s. str.) chrysocephalus (Linnaeus, 1758) s. str. = chrysocephala Linneaus Psylliodes (s. str.) circumdatus (Redtenbacher, 1842) = circumdata Redtembacher [Psylliodes (s. str.) cucullatus (Illiger, 1807)] = cucullata Illiger Psylliodes (s. str.) cupreatus (Duftschmid, 1825) = cupreata Duftschmidt Psylliodes (s. str.) cupreus (Koch, 1803) = cuprea Koch Psylliodes (s. str.) dulcamarae (Koch, 1803) [Psylliodes (s. str.) frivaldszkyi Weise, 1888] = Frivaldszkyi Weise [Psylliodes (s. str.) glaber (Duftschmid, 1825)] = glabra Duftschmidt Psylliodes (s. str.) hyoscyami (Linnaeus, 1758) = hyosciami Linnaeus Psylliodes (s. str.) illyricus Leonardi & Gruev, 1993 = picina Marsham (partim) Psylliodes (s. str.) instabilis Foudras, 1860 Psylliodes (s. str.) isatidis Heikertinger, 1912 Psylliodes (s. str.) kiesenwetteri Kutschera, 1864 = gibbosa Kiesenwetteri Kutschera [Psylliodes (s. str.) laticollis Kutschera, 1864] Psylliodes (s. str.) luteolus (O. F. Müller, 1776) = luteola O. F. Müller Psylliodes (s. str.) napi (Fabricius, 1792) s. str. [Psylliodes (s. str.) napi flavicornis Weise, 1883] = napi var. flavicollis Weise Psylliodes (s. str.) picinus (Marsham, 1802) = picina Marsham [Psylliodes (s. str.) picipes Redtenbacher, 1849] [Psylliodes (s. str.) pyritosus Kutschera, 1864] = pyritosa Kutschera [Psylliodes (s. str.) rambouseki Heikertinger, 1909 s. str.] [Psylliodes (s. str.) rambouseki forojuliensis Heikertinger, 1926] = Rambouseki forojuliensis Heikertinger [Psylliodes (s. str.) sturanyi Apfelbeck, 1906] = Sturányi Apfelbeck [Psylliodes (s. str.) subaeneus Kutschera, 1864 s. str.]

Leaf Beetle Fauna of the Carpathian Basin (Central Europe): Historical Background... = subaenea Kutschera Psylliodes (s. str.) thlaspis Foudras, 1860 Psylliodes (s. str.) toelgi Heikertinger, 1914 = Tölgi Heikertinger Psylliodes (s. str.) tricolor Weise, 1888 = sophiae Heikertinger [Psylliodes (s. str.) vindobonensis Heikertinger, 1914] Semicnema Weise, 1888 Psylliodes reitteri Weise, 1888 s. str. = Semicnema Reitteri Weise Hispinae Hispa Linnaeus, 1767 Hispa atra Linnaeus, 1767 Cassidinae Cassida Linnaeus, 1758 Cassida s. str. Cassida (s. str.) atrata Fabricius, 1787 Cassida (s. str.) aurora Weise, 1907 Cassida (s. str.) bergeali Bordy, 1995 Cassida (s. str.) berolinensis Suffrian, 1844 Cassida (s. str.) denticollis Suffrian, 1844 Cassida (s. str.) ferruginea Goeze, 1777 Cassida (s. str.) flaveola Thunberg, 1794 Cassida (s. str.) inquinata Brullé, 1832 [Cassida (s. str.) leucanthemi Bordy, 1995] Cassida (s. str.) lineola Creutzer, 1799 Cassida (s. str.) nebulosa Linnaeus, 1758 Cassida (s. str.) pannonica Suffrian, 1844 Cassida (s. str.) panzeri Weise, 1907 Cassida (s. str.) prasina Illiger, 1798 Cassida (s. str.) rubiginosa O. F. Müller, 1776 Cassida (s. str.) rufovirens Suffrian, 1844 Cassida (s. str.) sanguinolenta O. F. Müller, 1776 Cassida (s. str.) sanguinosa Suffrian, 1844 Cassida (s. str.) seladonia Gyllenhal, 1827 Cassida (s. str.) stigmatica Suffrian, 1844 Cassida (s. str.) vibex Linnaeus, 1767 Cassidulella Strand, 1928 Cassida (Cassidulella) nobilis Linnaeus, 1758 Cassida (Cassidulella) vittata Villers, 1789 Pseudocassida Desbrochers, 1891 Cassida (Pseudocassida) murraea Linnaeus, 1767 Mionycha Weise, 1891

99

100

Károly Vig Cassida (Mionycha) azurea Fabricius, 1801 Cassida (Mionycha) margaritacea Schaller, 1783 Cassida (Mionycha) subreticulata Suffrian, 1844 Lordiconia Reitter, 1926 Cassida (Lordiconia) canaliculata Laicharting, 1781 Hypocassida Weise, 1893 Cassida (Hypocassida) subferruginea Schrank, 1776 Odontionycha Weise, 1891 Cassida (Odontionycha) viridis Linnaeus, 1758 Mionychella Spaeth, 1952 Cassida (Mionychella) hemisphaerica Herbst, 1799 Pilemostoma Desbrochers, 1891 Cassida (Pilemostoma) fastuosa Schaller, 1783

ACKNOWLEDGEMENTS The author would like to express his hearty thanks to Blagoy Gruev (Plovdiv, Bulgaria) and Horst Kippenberg (Herzogenaurach, Germany) for their help reviewing the checklist of Chrysomelidae of the Carpathian Basin. Many thanks are due also to David Furth (Smithsonian Institution, USA) for his valuable help. My research on leaf beetles was supported by the János Bolyai Scholarship of the Hungarian Academy of Sciences. LITERATURE CITED Anonymus. 1792. Beitrag zur Entomologie von Ungarn. Neues Ungarisches Magazin 2(5):337. Berti, N. and M. Rapilly 1976. Faune d’Iran. Liste d’espèces et révision du genre Lilioceris Reitter (Coleoptera, Chrysomelidae). Annales de la Société Entomologique de France, Paris (N.S.) 12(1):31-73. Bezděk, J. and A. Bezděk 1998. Cassida bergeali Bordy, 1995 (Coleoptera, Chrysomelidae) – first record for Slovakia. Entomological Problems 29(1):18. Borowiec, L. and J. Świętojańska 1997. Cassida leucanthemi Bordy, 1995 i C. bergeali Bordy, 1995 (Coleoptera: Chrysomelidae: Cassidinae), nowe dla fauny Polski [Cassida leucanthemi Bordy, 1995 and C. bergeali Bordy, 1995 (Coleoptera: Chrysomelidae: Cassidinae), new to the fauna of Poland]. Wiad. entomol. (1996) 15(4):237-240. Bourdonné, J-. C. 1986. Chrysolina (Bechynia) substrangulata, nouvelle espèce de Hongrie (Coleoptera, Chrysomelidae). Nouvelle Revue d’Entomologie (N. S.) 3(2):235-241. Čižek, P. 1995. Nové druhy brouků (Coleoptera, Chrysomelidae) pro území Slovenska [The species of beetles (Coleoptera, Chrysomelidae) new for the territory of Slovakia]. Klapalekiana 31:71. Čižek, P. and R. Fornůsek 2000. Příspěvek k poznání dřepčíků (Coleoptera: Chrysomelidae: Alticinae) Čech, Moravy, Slovenska a Mad’arska I. [Beitrag zur Kenntnis der Flohkäfer (Coleoptera: Chrysomelidae: Alticinae) von Böhmen, Mähren, der Slowakei und Ungarn I.] Klapalekiana 36:29-32. Čižek, P., J. Hejkal and J. Stanovský 1995. Příspěvek k poznání brouků čeledi Chrysomelidae (Coleoptera) Čech, Moravy a Slovenska [Contribution to the knowledge of the family Chrysomelidae (Coleoptera) from Bohemia, Moravia and Slovakia]. Klapalekiana 31: 1-10. Conrád, J. 1782. Bemerkungen über die Entomologie überhaupt; nebst Beiträgen zur Kenntniß der um Oedenburg befindlichen Insekten. Ungarisches Magazin 2:5-19. Creutzer, C. 1799. Entomologische Versuche. Karl Schaumburg und Comp., Wien.


101

Duhaldeborde, F. 1999. Description de Cryptocephalus (s. str.) bameuli n. sp., nouvelle espèce paléarctique à large répartition géographique (Coleoptera, Chrysomelidae). Nouvelle Revue d’Entomologie (N. S.) 16:123-135. Frivaldszky, I. 1865. Jellemző adatok Magyarország faunájához. A Magyar Tudományos Akadémia Évkönyvei 11(4):1-274 + XIII. Gáti, I. 1792. Természet históriája. [The locality of the edition is not indicated] Gáti, I. 1795. A természet históriája, melyben az ásványoknak, plántáknak és az állatoknak három világok, azoknak megismertető bélyegeivel, természetekkel, hasznokkal, hazájokkal, rendbeszedve és a gyenge elméhez alkalmaztatva, mind együtt magyar nyelven legelőször bocsátja ki. Wéber S. P, Pozsony. [The second edition also in Pozsony, at 1798] Gruev, B. 1982. Neue Angaben über einige Blattkäfer aus der Alten Welt (Insecta, Coleoptera, Chrysomelidae). Faunistische Abhandlungen staatliches Museum für Tierkunde in Dresden 9(8):109-114. Gruev, B. and M. Döberl 1997. General distribution of flea beetles in the Palaearctic subregion (Coleoptera, Chrysomelidae, Alticinae). Scopolia 37:1-496. Gruev, B. and O. Merkl 1992. To the geographic distribution of the Longitarsus pratensis-group (Coleoptera, Chrysomelidae: Alticinae). Folia Entomologica Hungarica (1991) 52:15-20. Gruev, B., O. Merkl and K. Vig 1993. Geographical distribution of Alticinae (Coleoptera, Chrysomelidae) in Romania. Annales Historico-Naturales Musei Nationalis Hungarici 85:75-132. Gruev, B., V. Tomov and O. Merkl 1987. Chrysomelidae of the Kiskunság National Park (Coleoptera), pp. 227241. In: S. Mahunka (Ed.), The fauna of the Kiskunság National Park 2. Akadémiai Kiadó, Budapest. Kaszab, Z. 1962a. Levélbogarak – Chrysomelidae. In: V. Székessy (Ed.), Magyarország Állatvilága (Fauna Hungariae 63), Coleoptera IV, IX(6):1-416. Akadémiai Kiadó, Budapest. [in Hungarian] Kaszab, Z. 1962b. Beiträge zur Kenntnis der Chrysomeliden-Fauna des Karpaten-beckens nebst Beschreibung neuer Formen (Coleoptera). Folia Entomologica Hungarica (N. S.) 15(3):25-93. Kaszab, Z. and V. Székessy 1953. Bátorliget bogárfaunája (Coleoptera) [Beetle fauna of Bátorliget], pp. 194285. In: V. Székessy (Ed.), Bátorliget élővilága. Akadémiai Kiadó, Budapest. [in Hungarian with German summary] Kippenberg, H. and M. Döberl 1994. 88. Familie: Chrysomelidae, pp. 17-142. In: G. A. Lohse and W. H. Lucht (Eds.), Die Käfer Mitteleuropas 3. Supplementband mit Katalogteil. Goecke & Evers, Krefeld. Kippenberg, H. and M. Döberl 1998. 88. Familie: Chrysomelidae, pp. 313-324. In: W. H. Lucht and B. Klausnitzer (Eds.), Die Käfer Mitteleuropas 4. Supplementband. Goecke & Evers, Krefeld. Koy, T. 1800. Alphabetisches Verzeichniss meiner Insecten-Sammlung. Gedruckt mit königl. UniversitätsSchriften, Ofen [Buda]. Kuthy, D. (1897). Ordo Coleoptera, pp. 5-214. In: Fauna Regni Hungariae, III. (Arthropoda). Királyi Magyar Természettudományi Társulat, Budapest. Leonardi, C. and B. Gruev 1993. Notes on systematics and geographical distribution of some Psylliodes included in the cluster of Ps. picinus (Marsh.), with description of a new species (Coleoptera, Chrysomelidae). Atti della Società Italiana di Scienze Naturali e del Museo Civicio di Storia Naturale di Milano (1992) 133(2):13-32. Leonardi, C. and S. Sassi 2001. Studio critico sulle specie de Cryptocephalus del gruppo hypochaeridis (Linné, 1758) e sulle forme ad esse attribuite (Coleoptera, Chrysomelidae). Atti della Società Italiana di Scienze Naturali e del Museo Civicio di Storia Naturale di Milano 142(1):3-96. Lohse, G. A. 1989. Hydrogaleruca-Studien. Entomologische Blätter 85(1-2):61-69. Mahunka, S. and T. Vásárhelyi 1990. A zoológia Magyarországon. Fontos-e kutatnunk hazánk élővilágát? [The state of zoology in Hungary. Is it important to research our fauna?] Magyar Tudomány 1990(9):1055-1060. [in Hungarian]

102

Károly Vig

Merkl, O. 1991. Reassessment of the beetle fauna of Bátorliget, NE Hungary (Coleoptera), pp. 381-498. In: S. Mahunka (Ed.), The Bátorliget Nature Reserve – after forty years. Volume 1. Hungarian Natural History Museum, Budapest. Merkl, O. 1999. “Entomologia” by Robert Townson, pp. 95-116. In: P. Rózsa (Ed.), Robert Townson’s travels in Hungary. Kossuth Egyetemi Kiadó, Debrecen. Miskolci, G. 1702. Egy Jeles Vad-Kert, Avagy az oktalan állatoknak öt könyvekbe foglaltatott teljes historiája. Lőcse. Móczár, L. 1972. A Kárpát-medence Hymenoptera faunakatalógusainak (I-XXIV.) lelőhely jegyzéke (Cat. Hym. XXV.) [Das Fundortverzeichnis des Faunenkatalogs der Hymenopteren I-XXIV. des Karpatenbeckens (Cat. Hym. XXV)]. Folia Entomologica Hungarica (N. S.) 25(7):111-164. Molnár, J. 1783. A természet három országának rövid ismertetése, kezdet gyanánt. Magyar Könyv Háza 1(4):175-232. Mroczkowski, M. 1990. Coleoptera: Chrysomelidae, pp. 1-279. In: Burakowski, M. Mroczkowski and J. Stefańska (Eds.), Katalog fauny Polski, część XXIII, 16, Warszawa. Olivier, A. G. 1789. Entomologie ou historie naturelle des Insectes, avec leurs caracteres génériques et spécifiques, leur description, leur synonymie, et leur figure enluminée. Coléoptères. Tome premier. L’Imprimerie de Baudouin, Paris. Papp, L. 1983. A zootaxonómia hatékonyságának egyes kérdései [Certian question of the efficiency of zootaxonomy]. Állattani Közlemények 70:63-67. [in Hungarian with English summary] Piller, M. and L. Mitterpacher. 1783. Iter per Poseganam, Slavoniae provinciam mensibus Junio et Julio 1782 sesceptum. Typis Regiae Universitatis, Budae. Rozner, I. 1996. An updated list of the Chrysomelidae of Hungary and adjoining parts of the Carpathian Basin (Coleoptera). Folia Entomologica Hungarica 57:243-260. Scopoli, J. A. 1772. Annus V. Historico-Naturalis. Hilscher. Lipsiae. Strejček, J. 1993. Chrysomelidae, pp. 123-132. In: J. Jelinek (Ed.), Check-list of Czechoslovak Insects IV (Coleoptera). Folia Heyrovskyana Supplementum 1. Praha. Tomov, V. and B. Gruev. 1981. The chrysomelid (Coleoptera) fauna of the Hortobágy National Park, pp. 159168. In: S. Mahunka (Ed.), The fauna of the Hortobágy National Park 1. Akadémiai Kiadó, Budapest. Tomov, V., B. Gruev, K. Vig and O. Merkl 1996. Chrysomelidae (Coleoptera) of the Bükk National Park, pp. 327-349. In: S. Mahunka, L. Zombori and L. Ádám (Eds.), The fauna of the Bükk National Park 2. Magyar Természettudományi Múzeum, Budapest. Townson, R. 1797. Travels in Hungary, with a short account of Vienna in the year 1793. London. Vásárhelyi, T. 1998. Gyűjtemények múltja és jövője [Past and future of our collections]. Természet Világa (Természettudományi Közlöny) 129(12):540-543. [in Hungarian] Vidlička, L’. and Gy. Sziráki. 1997. The native cockroaches (Blattaria) in the Carpathian Basin. Folia Entomologica Hungarica 58:187-220. Vig, K. 1992. Contribution to the knowledge of the Chrysomelidae (Coleoptera) of the Carpathian Basin, pp. 602-606. In: L. Zombori and L. Peregovits (Eds.), Proceedings of the 4th ECE/XIII. SIEEC, Gödöllő 1991. Vig, K. 1996. A Nyugat-magyarországi-peremvidék levélbogár faunájának alapvetése (Coleoptera, Chrysomelidae sensu lato) [Leaf beetle fauna of Western Transdanubia (Hungary)]. Preanorica Folia Historico-naturalia 3:1-178. [In Hungarian, with English and German summaries] Vig, K. 1998a. A Duna–Dráva Nemzeti Park levélbogár faunája (Coleoptera: Chrysomelidae sensu lato) [Leaf beetle fauna of the Duna–Dráva National Park]. Dunántúli Dolgozatok, Természettudományi Sorozat 9:249-268. [in Hungarian, with English summary]


103

Vig, K. 1998b. Leaf beetle collection of the Mátra Museum, Gyöngyös (Coleoptera, Chrysomelidae sensu lato). Folia Historico Naturalia Musei Matraensis 22:175-201. Vig, K. 1999. Leaf beetle fauna of the Aggtelek National Park (Coleoptera, Chrysomelidae sensu lato), pp. 265287. In: S. Mahunka (Ed.), The fauna of the Aggtelek National Park 1. Magyar Természettudományi Múzeum, Budapest. Vig, K. 2000. A Villányi-hegység levélbogár faunája (Coleoptera: Chrysomelidae sensu lato) [Leaf beetle fauna of the Villány Hills (South Hungary)]. Dunántúli Dolgozatok, Természettudományi Sorozat 10: 229-248. [in Hungarian, with English summary] Vig, K. (2002). Beetle collection of the Savaria Museum (Szombathely, Hungary) II, Leaf beetle collection of Attila Podlussány. Specimens from North, Middle and Southeastern Europe (excluding Turkey). (Coleoptera, Chrysomelidae). Preanorica Folia Historico-naturalia 5:1-171. Vig, K. (in press a). Leaf beetle fauna of the Fertő–Hanság National Park. In: S. Mahunka (Ed.), The fauna of the Fertő–Hanság National Park. Magyar Természettudományi Múzeum, Budapest. Vig, K. (in press b). Leaf beetle collection of the Janus Pannonius Museum, Pécs (Coleoptera, Chrysomelidae). A Janus Pannonius Múzeum Évkönyve, Természettudományok. Vig, K. and I. Rozner 1996. Leaf beetle fauna of Őrség (Coleoptera: Chrysomelidae sensu lato). In: K. Vig (Ed.), Natural history of Őrség Landscape Conservation Area II, Savaria a Vas megyei Múzeumok Értesítője 23(2):163-202. Zúber, M. 1995. Faunistické správy zo Slovenska. Entomofauna Carpathica 9(1):28. [in Slovakian]

24



David G. Furth (ed.) 2003 © PENSOFT Publishers Systematic Position of the Subfamilies Megalopodinae and Megascelinae ... Beetle Biology 105 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 105-116

Systematic Position of the Subfamilies Megalopodinae and Megascelinae (Chrysomelidae) Based on the Comparative Morphology of Internal Reproductive System Kunio Suzuki1 1

Department of Biology, Faculty of Science, Toyama University, Toyama, 930-8555 Japan. E-mail: [email protected]

ABSTRACT The internal reproductive systems (IRS; the whole system for male and the spermathecal organ for female) are reported for three Panamanian genera (Megalopus, Mastosthetus, and Agathomerus) of Megalopodinae for the first time. They show fundamentally the same characteristics as those of Japanese Colobaspis japonica (Baly) studied by Suzuki (1988). Several common stable characters could be found for these four megalopodine genera and Zeugophora (Zeugophorinae). This strongly indicates that Megalopodinae and Zeugophorinae, as well as the Australasian Palophaginae studied by Kuschel and May (1990), must constitute sister groups derived from one monophyletic stock as suggested by Suzuki (1988, 1994a, 1996), Reid (1995) and Suzuki and Windsor (1999). The IRSs of two (one Panamanian and one Mexican) Megascelis species of Megascelinae clearly indicate a close relationship to those of Eumolpinae. The male IRS of Megascelinae is reported for the first time. As several workers have pointed out Megascelinae and Eumolpinae are sister groups of a single monophyletic group. Based mainly on the results of the comparative morphology of the IRS and several other morphological characters (hind wing venation, male external genitalia, etc.), that have been considered phylogenetically important, the systematic position of Megalopodinae and Megascelinae is discussed. KEY WORDS: systematic position, Chrysomelidae, Megalopodinae, Megascelinae, internal reproductive system (IRS)

INTRODUCTION I visited the Smithsonian Tropical Research Institute (STRI), Panama, in July 1997 and, therefore, had a fortunate opportunity to dissect fresh material of several species of three phylogenetically important subfamilies Aulacoscelinae, Megascelinae, and Megalopodinae with the aid of Donald M. Windsor (STRI). The geographical distribution of the first and second groups is restricted in Central and South America. Several workers have proposed hypotheses about the systematic position of these three subfamilies within the superfamily Chrysomeloidea and/or the family Chrysomelidae (cf. Reid, 1995; Suzuki, 1996). I have also occasionally given a review of higher classification of the

106

Kunio Suzuki

family Chrysomelidae since 1980 (cf. Suzuki, 1996). But until today no reliable system covering the whole of this family has been established. Suzuki and Windsor (1999) already published the results of comparative morphological studies on Aulacoscelis sp., a species closely related to Aulacoscelis melanocera Duponchel and later described as a new species A. appendiculata (Cox and Windsor, 1999). It was clearly established that the subfamilies Aulacoscelinae and Orsodacninae are sister groups of single monophyletic stock (Suzuki and Windsor, 1999). This conclusion also supports the proposal by Reid (1995). In this paper, I would like to report the results of the comparative morphology of both male and female internal reproductive systems (IRS) of other two subfamilies Megalopodinae and Megascelinae and to give some comments on their systematic position. Subfamily Megalopodinae The subfamily Megalopodinae auct. should be classified into the three sister groups. Suzuki (1996) treated all of them as ‘tribes’; that is, Megalopodini, Zeugophorini and Palophagini. Table 1 shows the previous and current studies that have been made for the IRS of the subfamily Megalopodinae s. str. (Suzuki’s ‘tribe Megalopodini’) Table 1. IRS studies of Megalopodinae s. str. Colobaspis japonica (Baly) † and ‡ Suzuki (1974, 1988) Colobaspis sp. ‡: Present study Agathomerus sp. † and ‡: Present study Mastostethus sp. ‡: Present study Megalopus sp. † and ‡: Present study

The male and female IRSs of the subfamily Megalopodinae s. str. have been reported so far for only one Japanese species Colobaspis japonica (Baly) (Suzuki, 1988). The IRSs of three genera, Megalopus, Mastosthetus, and Agathomerus, of this subfamily s. str. are reported here for the first time. Fig. 1 shows both male and female IRSs of Colobaspis japonica from Japan cited in Suzuki (1988). The male IRS of C. japonica is characteristic in having a fused testis, long lateral ejaculatory ducts, a well-developed ejaculatory sac, and very long posterior ejaculatory duct. Fig. 2 shows the female spermathecal organ (SptO) of Colobaspis sp. whose locality is unknown. The female SptOs of the two Colobaspis species examined are quite similar to each other and have very specialized spermathecal capsules, long spermathecal ducts, and a very long spermathecal gland. Fig. 3 shows the male IRS and female SptO of Megalopus sp. In the male IRS an apparently fused testis, long vas efferens, and long common and posterior ejaculatory ducts with a well-developed ejaculatory sac are characteristic. Other than the subfamily Megalopodinae s. str., fused testes can be seen only in the species of the subfamilies Galerucinae and Alticinae. In the female SptO, a strongly specialized spermathecal capsule, a long spermathecal duct, and a very long spermathecal gland are characteristic of Megalopodinae. Fig. 4 shows the SptO of Mastostethus sp. It is very similar to those of Colobaspis species and Megalopus sp. I could not observe the male IRS of this Mastostethus species. Fig. 5 shows the male IRS and female SptO of Agathomerus sp. Both male and female systems are identical with those of previous four species of the three genera. Table 2 shows the main characteristics in both male and female IRSs of the subfamily Megalopodinae s. str.

Systematic Position of the Subfamilies Megalopodinae and Megascelinae ...

107

Fig. 1. The male IRS (a) and female SptO (b) of Colobaspis japonica (Baly) (Megalopodinae, ‘Megalopodini’) from Japan. Scale bar 1.0 mm. (after Suzuki 1988).

Fig. 2. The female SptO of Colobaspis sp. (locality unknown; Museum of Comparative Zoology Coll.). (Megalopodinae, ‘Megalopodini’). Scale bar 1.0 mm.

108

Kunio Suzuki

Fig. 3. The male IRS (a) and female SptO (b) of Megalopus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Chiriqui Prov., 1300 m alt., 4-VII-1997, J. Wappes leg.). Scale bar 1.0 mm.

Fig. 4. The female SptO of Mastostethus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Cerro Campana, 16-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm.


109

Fig. 5. The male IRS (a: whole system; b: a right half of Tes part, peritoneal sheath removed) and female SptO (c, d) of Agathomerus sp. (Megalopodinae, ‘Megalopodini’) from Panama (Cerro Campana, 16-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm. Table 2. Main IRS characteristics in Megalopodinae s. str. Male 1. Fused testis, including 4 sperm tubes Common in the three genera (Megalopus, Agathomerus, Colobaspis) and present in all Galerucinae+Alticinae. 2. A pair of tubular accessory glands 3. A very long ejaculatory duct, with a well-developed ejaculatory sac Female 1. A very specialized spermathecal capsule 2. A very long spermathecal duct 3. A very long and well-developed spermathecal gland

A combination of the above three male characteristics is seen in only the subfamily Megalopodinae s. str. and a combination of the three female characteristics in only the subfamilies Megalopodinae s. str. and Zeugophorinae s. str. These characteristics are very stable in their fundamental morphological structures. Especially, I would like to point out the importance of the combination of these and

110

Kunio Suzuki

relative size of each of the elementary parts making up the system. The subfamily Megalopodinae s. str., which has been generally accepted so far, should be regarded as one monophyletic group along with the generally accepted the subfamilies Zeugophorinae s. str. and Palophaginae s. str. In my system each of these three groups is treated as an independent ‘tribe’ within the subfamily Megalopodinae, respectively. Table 3 shows the previous studies of the IRS of the subfamilies Zeugophorinae s. str. and Palophaginae s. str. Table 3. IRS studies of Zeugophorinae s. str. and Palophaginae s. str. Zeugophorinae s. str. Zeugophora (Pedrillia) annulata (Baly) † and ‡ Suzuki (1974, 1988) Zeugophora (Pedrillia) bicolor (Jacoby) † and ‡ Suzuki (unpublished) Zeugophora (Pedrillia) vitinea (Oke) ‡: Reid, 1989 Zeugophora (Pedrillia) williamsi Reid ‡: Reid, 1989 Palophaginae s. str. Palophagus bunyae Kuschel et May ‡: Kuschel and May (1990) Palophagus australiensis Kuschel et May ‡: Kuschel and May (1990) Cucujopsis setifer Crowson ‡: Kuschel and May (1990)

Fig. 6 shows the IRSs of both sexes of Zeugophora (Pedrillia) annnulata from Japan cited in Suzuki (1988). Besides non-fused testis, both male and female IRSs are basically identical with those of the previous four genera of the subfamily Megalopodinae s. str. Fig. 7 shows the female SptOs of two Palophagus species, P. bunyae and P. australiensis, and Cucujopsis setifer. Though those figures are schematic, they show well the fundamental characteristics, of members of the megalopodine groups.

Fig. 6. The male IRS (a) and female SptO (b) of Zeugophora (Pedrillia) annulata (Baly) (Megalopodinae, ‘Zeugophorini’) from Japan. Scale bar 0.5 mm. (after Suzuki 1988).


111

Fig. 7. The female SptOs of two Palophagus species, P. bunyae Kuschel et May (a) and P. australiensis Kuschel et May (b), and of Cucujopsis setifer Crowson (Megalopodinae, ‘Palophagini’). Scale bar 1.0 mm. (after Kuschel and May 1990).

Subfamily Megascelinae Table 4 shows the studies of the IRS of the subfamily Megascelinae s. str., namely Suzuki’s ‘tribe Megascelini’. Table 4. IRS studies of Megascelinae s. str. Megascelis sp.1 ‡: Suzuki (1974, 1988) Megascelis sp.2 † and ‡: Suzuki (unpublished) Megascelis puella Lacordaire, 1845 † and ‡: Present study

Concerning the male and female IRSs of the ‘tribe Megascelini’ no reliable information has been obtained, except the SptO of Megascelis sp. studied by Suzuki (1974, 1988). The male IRS of the subfamily Megascelinae s. str. is reported here for the first time. I was able to dissect two (one Panamanian and one Mexican) species of the genus Megascelis. The main characteristics of both male and female IRSs in the two Megascelis species can be compiled as in Table 5. Table 5. Main IRS characteristics in Megascelinae s. str. Male 1. A long and thick vas deferens 2. Very long accessory glands

112

Kunio Suzuki

3. An anterior ejaculatory duct forming a weekly developed ejaculatory sac and a short posterior ejaculatory duct Female 1. A very specialized proximal part of spermathecal capsule 2. A slender and long spermathecal duct 3. A long spermathecal gland

A combination of the above characteristics in both sexes is seen in only the subfamilies Megascelinae s. str. and Eumolpinae auct. Fig. 8 shows both male IRS and female SptO of Megascelis puella from Panama. The IRS of another Mexican species is almost same as that of M. puella in both sexes. Fig. 9 shows the male IRS and female SptO of Colposcelis variabilis of the subfamily Eumolpinae s. str., Suzuki’s ‘tribe Eumolpini’, from Japan cited in Suzuki (1988). One can quickly find that no fundamental difference is seen in the IRSs of either sex of the species belonging to the subfamilies Megascelinae s. str. and Eumolpinae auct. DISCUSSION Based on the results of the comparative morphology of the IRS, I would like to consider the systematic position of the subfamilies Megalopodinae s. str. and Megascelinae s. str. and the phylogenetic relationships among them and their relatives. I propose the following two hypotheses about the phylogenetic relationships among the three subfamilies studied.

Fig. 8. The male IRS (a) and female SptO (b) of Megascelis puella Lacordaire (Eumolpinae, ‘Megascelini’) from Panama (Gamboa, 15-VII-1997, K. Suzuki and D. M. Windsor leg.). Scale bar 1.0 mm for a, 0.5 mm for b.


113

Fig. 9. The male IRS of Colposcelis variabilis (Baly) (a) and female SptO of Basilepta fulvipes (Motschulsky) (b) (Eumolpinae, ‘Eumolpini’) from Japan. Scale bar 0.5 mm for a, 0.25 mm for b. (after Suzuki 1988).

1. The subfamily Megalopodinae s. str., together with the subfamilies Zeugophorinae s. str. and Palophaginae s. str., constitutes a monophyletic group (Suzuki’s ‘subfamily Megalopodinae’), but they have a close phylogenetic relationship with some ancestral forms of the family Cerambycidae (e.g. Lamiinae) rather than with any other groups of the family Chrysomelidae. 2. The subfamilies Megascelinae and Eumolpinae are sister groups which might have originated from an ancestral form and constitute a monophyletic group (Suzuki’s ‘subfamily Eumolpinae’). The two hypotheses proposed here are basically consistent with my higher classification system of the family Chrysomelidae proposed since Suzuki (1980) and with the results of the comparative morphology of external genitalia and hind wing venation (Suzuki, 1994a). For the results of comparison of the IRS with other phylogenetic and/or systematic characters like external genitalia, hind wing venation, and so on, refer to my recent papers listed in the References section below. Finally, I would like to take this opportunity to mention briefly the phylogenetic relationship of the subfamilies Orsodacninae and Aulacoscelinae. Recently I have published the results of IRS studies of the subfamily Aulacoscelinae (Suzuki, 1994 b; Suzuki and Windsor, 1999). Table 6 shows the previous studies, which have been made for the IRSs of the subfamilies Orsodacninae and Aulacescelinae. Table 6. IRS studies of Orsodacninae and Aulacoscelinae Orsodacninae Orsodacne arakii Chûjô † and ‡: Suzuki (1974, 1988) Orosodacne lineola Panzer † and ‡: Mann and Crowson (1981) Aulacoscelinae Aulacoscelis melanocephala Jacoby ‡: Suzuki (1994b)

114

Kunio Suzuki Aulacoscelis confusa Monrós ‡: Suzuki (1994b) Aulacoscelis costaricensis Bechyné ‡: Suzuki (1994b) Aulacoscelis tibialis Jacoby ‡: Suzuki (1994b) Aulacoscelis variabilis variabilis Jacoby ‡: Suzuki (1994b) Aulacoscelis candezei Chapuis ‡: Suzuki (1994b) Aulacoscelis sp. † and ‡: Suzuki and Windsor (1999) Janbechynea (Janbechynea) elongata (Jacoby) ‡: Suzuki (1994b)

Fig. 10 shows the male IRS and female SptO of Aulacoscelis sp. from Panama cited in Suzuki and Windsor (1999). Fig. 11 shows the male IRS and female SptO of Orsodacne arakii from Japan cited in Suzuki (1988). It can easily be recognized that these two groups have many characteristics in common in both sexes. Until I examined the male IRS of Aulacoscelis sp. from Panama, I retained my previous opinion of the systematic position of the subfamily Aulacoscelinae (Suzuki, 1996). But, their IRS obviously indicated a direct relationship to the subfamily Orsodacninae. Through comparative morphological studies of the hind wing venation and male and female IRSs, I have confirmed the effectiveness of these morphological characters in considering the phylogenetic relationships among higher taxa. I would like to retain my previous phylogenetic system, which is a revised version of that of Suzuki (1994a) paper as shown in Fig. 12 (Suzuki 1994a, 1996; Suzuki and Windsor, 1999). I am convinced that this system is consistent with the data, which have been obtained from morphological as well as other aspects of biology.

Fig. 10. The male IRS (a) and female SptO (b) of Aulacoscelis sp. (Orsodacninae, ‘Aulacoscelini’) from Panama. Scale bar 1.0 mm. (after Suzuki and Windsor, 1999).


115

Fig. 11. The male IRS (a) and female SptO (b) of Orsodacne arakii Chûjô (Orsodacninae, ‘Orsodacnini’) from Japan. Scale bar 0.5 mm for a, 0.25 mm for b. (after Suzuki 1988).

Fig. 12. Supposed phylogenetic relationships among the ‘subfamilies’ and ‘tribes’ of the family Chrysomelidae (after Suzuki and Windsor 1999).

116

Kunio Suzuki

ACKNOWLEDGEMENTS I deeply thank D. M. Windsor of the Smithsonian Tropical Research Institute, Panama, for his kind help and hospitality during my stay in Panama. I also thank D. G. Furth for his constant assistance and friendship. LITERATURE CITED Cox, M. L. and D. M. Windsor 1999. The first instar larva of Aulacoscelis appendiculata n. sp. (Coleoptera: Chrysomelidae: Aulacoscelinae) and its value in the placement Aulacoscelinae. J. Nat. Hist. 33:1049-1087. Kuschel, G. and B. M. May 1990. Palophaginae, a new subfamily for leaf-beetles, feeding as adult and larva on Araucarian pollen in Australia (Coleoptera: Megalopodinae). Invert. Taxon. 3:697-719. Mann, J. S. and R. A. Crowson 1981. The systematic position of Orsodacne Latr. and Syneta Lac. (Coleoptera Chrysomelidae), in relation to characters of larvae, internal anatomy and tarsal vestiture. J. Nat. Hist. 15:727-749. Reid, C. A. M. 1989. The Australian species of the tribe Zeugophorini (Coleoptera: Chrysomelidae: Megalopodinae). Gen. Appl. Ent. 21:39-47. Reid, C. A. M. 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea) , pp. 559-631. In: J. Pakaluk and S. A. Slipinski (Eds.), Biology, Phylogeny, and Classification of Coleoptera (Papers Celebrating the 80th Birthday of Roy A. Crowson). Museum i Instytut Zoologii PAN, Warszawa. Vol. 2. Suzuki, K. 1974. Phylogeny of the family Chrysomelidae based on the comparative morphology of the internal reproductive system (Insecta: Coleoptera). Ph D. Thesis, Tokyo Metropolitan University, 186 pp. Suzuki, K. 1988. Comparative morphology of the internal reproductive system of the Chrysomelidae (Coleoptera), pp. 317-355. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.). Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht/Boston/ London. Suzuki, K. 1994a. Comparative morphology of the hindwing venation of the Chrysomelidae (Coleoptera), pp. 337-354. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht/Boston/London. Suzuki, K. 1994b. The systematic position of the subfamily Aulacoscelinae (Coleoptera: Chrysomelidae), pp. 45-59. In: D. G. Furth (Ed.), Proc. 3rd Int. Symp. Chrysomelidae, Beijing, 1992. Backhuys Publ., Leiden. Suzuki, K. 1996. Higher classification of the family Chrysomelidae (Coleoptera), pp. 3-54. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology, Vol. 1: The Classification, Phylogeny and Genetics. SPB Academic Publishing, Amsterdam. Suzuki, K. and D. M. Windsor 1999. The internal reproductive system of Panamanian Aulacoscelis sp. (Coleoptera: Chrysomelidae, Aulacoscelinae) and comments on the systematic position of the subfamily. Entomological Science 2:391-398.

LEGEND FOR FIGURES Abbreviations for the male internal reproductive system (IRS) and female spermathecal organ (SptO) used in Figures 1-12: AG: accessory gland; EdC: common ejaculatory duct; EdL: lateral ejaculatory duct; EdP: posterior ejaculatory duct; ES: ejaculatory sac; GC: genital chamber; IS: internal sac; ML: median lobe; MO: median orifice; MS; median strut; SptC: spermathecal capsule; SptD: spermathecal duct; SptGl: spermathecal gland; ST: sperm tube; SV: seminal vesicle; Tes: testis; Tg: tegmen; Vd: vas deferens; Ve: vas efferens. (see also Suzuki 1988)

© PENSOFT Publishers Sofia - Moscow

David G. Furth (ed.) 2003 Cladistic Analysis of the Oedionychines of Southern Brazil ... Beetle Biology 117 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 117-132

Cladistic Analysis of the Oedionychines of Southern Brazil (Galerucinae: Alticini) Based on Two Molecular Markers Catherine N. Duckett1,2 and Karl M. Kjer2 1

University of Puerto Rico, San Juan, Puerto Rico, 00931-3360. Email: [email protected] 2 Rutgers University, Cook College, New Brunswick, NJ 08901. Email: [email protected]

ABSTRACT A phylogenetic analysis of the southern Brazilian oedionychine genera based on two molecular markers, EF1-alpha and COI, is presented. The Oedionychina is strongly supported as a monophyletic group based on the genera analyzed including the African genus, Physodactyla. The monoplatines analyzed form a monophyletic group which is not the sister taxon of the Oedionychina. The closest taxon analyzed to the Oedionychina is Hemipxyis, and the character of apical hind tarsomere-globosely swollen does not appear to define monophyletic groups within the Oedionychina. There is apparently considerable variation among populations within some species for the COI marker fragment used and not in others. COI can be useful for associating larvae with adults with appropriate sampling of other sympatric congeners. Genetic heterogeneity of the genera Alagoasa and Capraita is discussed.

RESUMEN Se presenta un análisis filogenético de las especies oedionychine del sur de Brasil, basado en dos marcadores moleculares, EF1-alpha y COI. En base a las especies analizadas, entre ellas, la especie africana, Physodactyla rubiginosa, la Oedionychina se muestra como un grupo monofilético. Los monoplatinos analizados forman un grupo monfilético que no es hermano taxonómico de la Oedionychina. El grupo taxonómico más próximo a la Oedionychina que se analizó es Hemipyxis. El carácter globoso de los tarsos apicales de las patas traseras no parece definir grupos monofiléticos en la Oedionychina. Aparentemente, hay variaciones considerables del fragmento del marcador COI que se utilizó entre las poblaciones dentro de algunas especies. No así en otras. El marcador COI puede ser útil para asociar larvas y adultos con una muestra adecuada de otros congéneres simpátricos. Se discute la heterogeneidad genética de Alagoasa y Capraita. INTRODUCTION The Oedionychina sensu Bechyné and Bechyné consists of 23 genera, 4 from the Old World and 19 from the New World; they are large jewel-like beetles with robust jumping legs, which are also known for their globosely swollen hind tarsal segment, and the pronotum with lateral flanges produced

118

Catherine N. Duckett & Karl M. Kjer

forward (see Fig.1)(Bechyné and Bechyné 1966). Oedionychina is a diverse group with more than 600 species in the New World alone; some species are economically important crop pests (Martorell 1975) some are also being investigated as possible biocontrol agents (Samuelson 1985, Hill pers. comm.). These flea beetles constitute an ecologically significant component of the Neotropical fauna. As a group, they are among the largest (by weight) of the flea beetles, and, in some areas, are very common. Oedionychina is also notable as one of the few suprageneric groups of Alticini that most workers consider valid and monophyletic (Scherer 1983,1988; Seeno and Wilcox 1982; Virkki 1989; Virkki and Santiago-Blay 1996). Most Oedionychina are brightly colored and many participate in mimicry complexes (Begossi and Benson 1988; Duckett 1998). Because the Oedionychina includes many morphologically different and speciose mimicry complexes, (Balsbaugh 1988, Begossi and Benson 1988), some mimetic species participate in mimicry complexes with species from other genera, (e.g. Asphaera auripennis Harold and Alagoasa libentina (Germar)). Moreover, others like Alagoasa plaumanni Bechyné are polymorphic and may participate in as many as 5 mimicry complexes that may include species from the same genus or different genera (Bechyné 1955a). Both polymorphism within species and mimeticism between genera can complicate our ability to accurately reconstruct the phylogeny by making homology assessments based on morphology difficult. Although the Oedionychina is generally assumed to be monophyletic no phylogenetic hypothesis of the relationships among the genera has been proposed and doubts about the monophyly of the genera have been expressed informally and formally (Swigonova and Duckett, 1998; Flowers 2001; see Taxonomic History for discussion). Given these doubts and the need for phylogenetic tests of taxonomic hypotheses, we undertook this study to test the monophyly of the oedionychines of southern Brazil, which is part of a larger study of the Oedionychina world-wide, with the objective to identify the genera most in need of taxonomic revision. Because of the extreme lack of phylogenetic (or even taxonomic) work in the flea beetles, any cladistic hypothesis is valuable; moreover, any understanding of relationships among out-group taxa will be useful as well. This study has three basic objectives. The primary goal is to test monophyly of the sub-tribe Oedionychina and to investigate the generic level relationships of the common southern Brazilian genera using nuclear and mitochondrial DNA sequence data. Mimicry and its concomitant selection pressures towards external similarity may be one of the reasons the Oedionychina have been considered so difficult by traditional taxonomists (Begossi and Benson 1988, Scherer 1983). However, use of molecular characters is particularly conducive to elucidating problems in mimicry (Brower 1996). The second objective is to examine the putative phylogenetic utility of the globosely swollen hind tarsus to group genera (see Fig. 1). The Oedionychina has two phenetic groups which appear in Scherer’s keys (1962, 1983) and reflect Horn’s 1889 division of the group into ‘Oedionyches’ (with very globosely swollen hind tarsi) and the ‘Aspicelae’ with less swollen hind tarsi. Because of this characteristic the Oedionychina have also been considered associated with the monoplatines and the pseudolampsines (Clark 1860, 1865) (see Taxonomic History below). There is currently little evidence to support or refute these groupings and we test them here. Finally, we wish to present evidence of genetic variability within and among species of oedionychine for both genetic markers used, especially cytochrome oxidase I (COI), which may permit accurate association of larvae with adults in many species. Investigation and discussion of intraspecific genetic variability is essential to the scientific credibility of molecular phylogenetics (Reid 1995).

Cladistic Analysis of the Oedionychines of Southern Brazil ...

119

Fig. 1. Dorsal habitus of Paranaita generosa, (Harold). 8 mm. Luz Elvia Diaz, illustrator.

Taxonomic History The Oedionychina have been recognized (at least informally) since the 1860’s when Clark (1860, 1865) recognized 6 genera including the diverse genera Oedionychus Berthold, 1827, Asphaera Chevrolat, 1842, Omophoita Chevrolat, 1837 as well as the smaller genera Eutornus Clark, 1865 from Africa, Aspicela Dejean, 1837 from the Andes and Pachyonchis Clark, 1860 from the Mid-Atlantic USA. Clark (1860) hypothesized that the monoplatines are the sister group of the oedionychines by morphological association. Chapuis (1875) formally described the tribe-Oedionychites. Horn (1889) divided the oedionychines into two series the Oedionyches and Aspicelae. The Aspicelae included the genera with less globosely swollen hind tarsi, at that time only Omophoita, Asphaera and Aspicela. Except for Hamletia Crotch, 1873 which is a synonym of Pachyonchis only two new genera were described until the 1950’s, Chlöephaga Weise 1899 and Philopona Weise 1903 from Africa and Asia. However, Chlöephaga is a homonym of a genus of birds and consequently was replaced with Capraita Bechyné 1957. Leng (1920) formalized the Oedionychini and Aspicelini as tribes of the subfamily Alticinae. Most New World species were described in the genera Oedionychus, Asphaera and Omophoita for the next 75 years until each genus included about 200 species. However, in 1996, Konstantinov and Vandenberg recognized Oedionychus as nomen nudum, making Oedionychis Latreille 1829 the generic basis for the sub-tribe (Konstantinov and Vandenberg 1996). In the 1950’s Bechyné split Oedionychus and Asphaera (Bechyné 1951, 1955a,b, 1956, 1957, 1959 b), adding 17 more generic names to the Oedionychina. Oedionychus was restricted to a small group of species in Spain and North Africa, and most of the new world species were placed in Kuschelina, Bechyné 1951, Alagoasa Bechyné, 1955, Paranaita Bechyné, 1955, Walterianella Bechyné, 1955 and Wanderbiltiana Bechyné, 1955. Genera for species of specialized morphology were also proposed: Pydixaltica for the erotyloid mimic Oedionychus variegata Jacoby (Bechyné 1956), Callangaltica for the highly hemispherical Amazonian species O. batesi Baly, (Bechyné 1958), Nycteronychis (Bechyné 1955b)

120


for O. trivitatta Baly from Rio de Janiero, Araoua for O. umbricata Oliver (Bechyné 1955b). Cuyabasa Bechyné, 1956 has 3 species with metallic blue elytra and pronotal angles, which are barely produced forward and has been shunted between the Oedionychina and the Disonychina (Bechyné and Bechyné 1966 and in litteris, Seeno and Wilcox 1982). A recent cladistic analysis places Cuyabasa (Duckett 1999) as an oedionychine. However, these genera have proved taxing to work with; Scherer (1983), describing his key to the Oedionychine genera referred to the new genera proposed by Bechyné as ‘presenting great difficulties, which also is apparent in this key’ (Scherer 1962, 1983). However, most morphologically generalized species were placed in Alagoasa or Kuschelina. Some of these changes were done in litteris or on museum labels and were later formalized by Furth and Savini (1996, 1998). Many taxonomists have informally speculated that Kuschelina and Alagoasa as currently defined may overlap and that Alagoasa may be an artificial assemblage (Swigonova and Duckett 1998). Omphoita and Asphaera have been confused both physically and taxonomically for a long time (Leng 1920, Bechyné 1955a, b, 1958, Bechyné and Bechyné 1973, 1977, Flowers 2001); as we note below even the identity of the type species of the genera is debated. Both genera have a slightly (rather than highly) globose hind tarsus and neither has been revised. Horn (1889) recognized Asphaera as an invalid name and used Homophoeta Erichson instead. Jacoby (1888; 1890) refused to recognize the validity of Horn’s Homophoeta and used Asphaera without formal taxonomic treatment. In 1955 a, b, and 1957 Bechyné considered Asphaera Chevrolat 1843 (sic) as a synonym of Omophoita Chevrolat 1857. In 1955 he presented Omophoita as reserved for the species removed from Asphaera and Homophoeta as a subgenus, defined by the discrete character of a white frons apparently bordered by sutures. In 1957 Bechyné presented Homophoeta as if it were a genus in its own right (Bechyné 1957), and 6 species formally in Asphaera were presented as Omophoita. Later, Bechyné 1963 and Bechyné and Bechyné (1977) defined Omophoita by a “primitive”, irregular setation on the labrum and Asphaera by the 4 regular punctuations. In 1963 Bechyné recognizes Homophoeta as a junior synonym of Omophoita with O. equestris (F.) as the type species. However, Scherer in his 1983 key continued to use Homophoeta, recognizing H. albicollis (F.) as the type. Asphaera was split by Bechyné (1955b, 1958, 1959b, 1963) into 5 genera , 4 with the root ‘asphera’ in their names: Rhynchasphaera Bechyné 1955, (3 species) Longasphaera Bechyné 1955 (monotypic), Pleurasphaera Bechyné, 1958 (monotypic), Palmaraltica Bechyné, 1959, (3 species); and Asphaerina Bechyné 1963 (monotypic). As stated above, most of the remaining species of Asphaera were informally transferred to Omophoita including both the species that are variously, though invalidly, considered as the type species for Asphaera: A. auripennis Harold (Scherer 1962, 1983) and Chysomela nobilitata F. (Bechyné, 1963; Bechyné and Bechyné 1978). Despite the confusing situation of Asphaera and Omophoita, some of the other oedionychine genera are quite distinctive, species of Paranita, are similar in general appearance, being very highly and hemi-spherically vaulted with coarse elytral punctations (Fig. 1). Walterianella is also easy to recognize as it is very dorso-ventrally flat, because of this it is sometimes confused with Capraita, which is small, and dorso-ventrally flattened and by definition has an indentation of the vertex and a prebasal pronotal indentation (Bechyné and Bechyné 1977). METHODS Collection, Amplification, and Sequencing In the field, collected chrysomelids were placed in 95% ethanol, and either brought promptly to the lab for DNA extraction or frozen. Two legs were removed from the specimens and the rest was


121

retained as a voucher, see table 1 for extraction number , color form of species, collection locality and Genbank accession number of each sequence. The legs were placed in a labeled Eppendorf tube and ground under liquid nitrogen, using micro tissue grinders (Phenix Research). DNA was extracted with SDS, Proteinase-K, and phenol/chloroform as described by Hillis and Davis (1986). Dried DNA pellets were resuspended in 100-250 ul of TE (Tris-EDTA). Most of this material is separated as a stock DNA collection and kept at -70oC. The rest was kept in a frost free freezer in the lab for PCR. Phenol, buffers, water, oil, etc. were aliquoted into single-use portions to avoid potential contamination. Samples were amplified on a thermal cycler using reaction conditions as described in Sambrook et al. (1989). Amplified DNA was separated on a 1.5% low melting point agarose gel (NuSieve 3:1, FMC Bioproducts). Bands of DNA were cut from the agarose gel, purified with GeneClean (Bio 101), and sequenced on an ABI 377 automated sequencer using the manufacturer’s recommendations (Applied Biosystems), except that we used one half the recommended enzyme concentration, in a half volume reaction. Molecular Markers, Primers and Phylogenetic Analyses Two protein coding molecular fragments were amplified: 481 base pairs of Elongation Factor Alpha (EF-1α) (primers 90F 5’ ATCGAGAAGTTCGAGAARGARGC-3’ and 580R 5’-CCAYCCCTTRAACCANGGCAT-3’) and 466 bp of Cytochrome Oxidase I (COI) primers (Simon et al. 1994) (1791-F 5’GGATCACCTGATATAGC-ATTCCC-3’, and 2191-R 5’-CCYGGTAAAATTAAAATATAAACTTC-3’). Sequence data was aligned by eye and checked using MacClade 4.0 by translation into codons. Misalignment resulting in frame shift “mutations” or stop codons was reassessed; a one codon insertion is present in Aedmon morissoni’s COI sequence. Sequences were submitted to Genbank under accession numbers AF466310- AF466345 and AF479419- AF479484 (See Table 1). Table. 1. Collection, extraction and Gen-bank accession numbers for specimens studied. Species name

form

Aedmon morissoni Alagoasa apicalis Alagoasa bicolor1 Alagoasa bicolor2 Alagoasa cruxnigra or nr Alagoasa cruxnigra Red larva Alagoasa formosa lavender Alagoasa formosa spotted Alagoasa formosa stripped Alagoasa libentina Alagoasa libentina Alagoasa nigroscutata Alagoasa plaumanni spotted Alagoasa plaumanni spotted Alagoasa plaumanni red Alagoasa plaumanni white

extraction# 207 126 AB AB2 313 318 302 204 200 303 314 315 031 079 320 112

locality

COI-accession# alpha EF1 accession#

Puerto Rico:South Coast Brazil:PA, Piraquara. Puerto Rico: Vega Alta. Puerto Rico: Vega Alta. Brazil:SC, Morro do Baú Brazil:SC, Morro do Baú Brazil:RS, Maqiné Brazil:RS, San Francisco de Paula Brazil:RS, Maqiné Brazil:PA,Estancia Betancia. Brazil:SP, São Paulo City. Brazil:SC, Morro do Baú Brazil:RS, Cangucu, Coxilhia do Fogo. Brazil:RS, Maqiné Brazil:PA, Piraquara Brazil:RS, San Francisco de Paula

AF479421 AF479463 AF479464 AF479465 AF479466 AF479438 AF479467 AF479468 AF479469 AF479470 AF479471 AF479472 AF479473 AF479474 AF479475 AF479476

AF466312 AF466333 AF466334 AF466335 AF466336

AF466337

AF466339 AF466340

122


Table. 1. Continued. Species name

form

extraction#

Allochroma sp, nr nigripes Asphaera abdominalis Asphaera lustrans Asphaera auripennis Asphaera deleta Asphaera unicolor Aspicela scutata Aspicela undescribed sp pink Blepharida sp nr ornata Capraita clarissa Capraita clarissa2 Capraita conspurcatus Capraita nigrosignata Capraita obsidiana Capraita quercata Capraita sexmaculata Disonycha conjuncta Hemipyxis balyi Hemipyxis plagioderoides Hemipyxis plagioderoides Hypolampsis sp. Kuschelina concinna Kushelina petaurista Kushelina petaurista Kushelina rugiceps Oedionychis cinctus Oedionychis cinctus Omophoita equestris1 Omophoita equestris3 Omophoita equestris2 Omophoita equestris4 Omophoita octoguttata Omophoita personata Omophoita sericella Omophoita sp. Yellow larva Omophoita sp. Yellow larva Paranaita bilimbata Paranaita crotchi Paranaita opima red Paranaita opima white Physodactyla rubiginosa Walterianella argentinensis Walterianella biarcuata Walterianella bucki

locality


709 241 309 115 124 113 233 245

Brazil:PA, Areia Branca Mexico:DF, UNAM, Parque escutorico. USA:TX, Brazil:PA, Piraquara Brazil:PA, Piraquara Brazil:SP, São Paulo City. Colombia: Cali. Ecuador: Napo.

AF479422 AF479444 AF479445 AF479446 AF479447 AF479448 AF479442 AF479443

209 040 b40 251 309 310 216 300 061 218 308 208 101 317 215 312 080 388 388a 049 142 b49 316 042 107 027 322 323 026 305 001 201 253 098 239 039

South Africa:Kwa-zulu Natal AF479419 Brazil:RS, Maqiné AF479449 Brazil:RS, Maqiné AF479450 Mexico:DF, UNAM, Parque escutorico. AF479451 USA:TX, AF479452 USA:TX AF479453 USA:NJ, Dividing Creek AF479454 USA:TX AF479455 Brazil:RS, Maqiné AF479420 China: Beijing AF479424 Japan: Toyama, Kureha Hills. AF479425 China: Beijing AF479426 Brazil:RS, San Francisco de Paula AF479423 USA:Texas. AF479477 USA:NJ, Dividing Creek AF479478 USA:Texas. AF479479 Brazil:RS, Maqiné AF479480 Spain: Malaga AF479428 Spain: Malaga AF479429 Brazil:RS, Maqiné AF479432 Brazil:RS, Piraquara AF479433 Brazil:RS, Maqiné AF479434 Brazil:RS, Maqiné AF479439 Brazil:RS, Maqiné AF479430 Brazil:RS, Porto Alegre, Jardim BotanicoAF479431 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479435 Brazil:PA, Almirante Tamandaré. AF479436 Brazil:SP, São Paulo City. AF479437 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479481 Brazil:PA, Almirante Tamandaré. AF479482 Brazil:RS, Cangucu, Coxilhia do Fogo. AF479483 Brazil:RS, Bom Jesus AF479484 AF466345 South Africa:Kwa-zulu Natal, Howick AF479427 Brazil:RS, San Francisco de Paula AF479456 Mexico:Veracruz, highway 125. AF479457 Brazil:RS, Maqiné AF479458

AF466314 AF466321 AF466322 AF466323

AF466310 AF466324 AF466325 AF466326 AF466311 AF466315 AF466316 AF466314 AF466341 AF46634 AF466319 AF466320 AF466317 AF466318

AF466343 AF466344 AF466327 AF466328


123

Table. 1. Continued. Species name

form

Walterianella bucki Walterianella fusconotatta Walterianella interuptovittata Wanderbiltiana concolor Wanderbiltiana nitida or nr

extraction# 305 310 203 140 012

locality


Brazil:PA, Piraquara Brazil:SC, Morro do Baú Brazil: RS, Truinfo, Copesul plant. Brazil:PA, Piraquara Brazil:RS, Cangucu, Coxilhia do Fogo.

AF479459 AF466329 AF479460 AF479462 AF466332 AF479461 AF466330

Because we could not amplify and sequence both markers for all taxa at this time, we performed 3 analyses, all equally weighted parsimony and the result of 500-1000 heuristic searches using TBR branch swapping with random addition. These analyses included a combined analysis of a smaller taxon set (n=34), for which both markers are available (see Fig. 2) and two additional for larger taxon sets for which only EF-1a (n=35) (Fig. 3) and Cytochrome Oxidase I were available (n= 63 sequences) (see Fig. 4). All phylogenetic and statistical analyses were performed with PAUP 4.08b (Swofford 2001) except where noted below. Branch support was calculated using bootstrap (Felsenstein 1985) and decay indices (Bremer 1988; Donaghue et al.1994). We used PAUP to calculate bootstrap support and Autodecay 3.0 (Eriksson 1999) combined with PAUP to calculate decay index. Bootstrap values are the result of 500 replicates each composed of 10 heuristic searches. Decay index was calculated using 100 heuristic searches with random addition branch swapping per node. Base frequencies across taxa were calculated and were submitted to a Chi-squared test to evaluate homogeneity among taxa. Taxon Sampling The goal was to analyze both genetic markers for at least two and as many as five, species of each of the major oedionychine genera present in southern Brazil. When congeners could not be obtained from Southern Brazil, taxa from other localities were substituted. The monotypic genera of Pydixaltica, Pleaurasphaera, and Longasphaera were unavailable. This work is regarded as preliminary because not all genera and relatively few species are represented. However, all of the genera present in southern Brazil, which are not monotypic, are represented. We chose 9 species in 8 genera as outgroups based on recent phylogenetic hypotheses as well as the morphological work cited above. These genera are: Blepharida Chevrolat, Hemipxyis Dejean, Disonycha Chevrolat, Hypolampsis Clark, Allochroma Clark and Aedmon Clark. Morphological work has variously supported monophyly of the New World monoplatines and disonychines, as well as the Old World taxa Hyphasis Haroldand Hemipxyis as sister taxa to the oedionychines (Maulik1926, Bechyné 1968; Seeno and Wilcox 1982). Because Clark (1860, 1865) placed the monoplatines as the closest relatives of the oedionychines we included the monoplatine species Aedmon morissoni Clark, Allochroma sp, and Hypolampsis sp. Based on characters of the abdomen, pronotum and unstated ecological characters, Bechyné and Bechyné (1966) asserted that the Disonychina was the sister taxon on the Oedionychina. Although Duckett’s (1999) phylogenetic analysis of the Disonychina does not support this relationship, we included Disonycha conjuncta (Gremar) as an outgroup to test this hypothesis. Hemipyxis is hypothesized to be a very close relative of oedionychines based on morphology and cytogenetics (Seeno and Wilcox 1982, Petitpierre et al. 1988). Moreover, Bechyné

124


Fig. 2. Phylogram of combined data from COI and EF-1a gene fragments, branch length proportional to number of base changes, as estimated by parsimony. All taxa are from Brazil except where noted; Brazilian and U.S. states are indicated given standard abbreviations, e.g. RS= Rio Grande do Sul, PR= Paraná, n and s indicate northern and southern localities within states. Bootstrap support is presented above the branch; decay indices are shown below the branch. “nr’ indicates the node was not recovered in bootstrap analyses. Note the strong support for the Oedionychina node. Taxa with reduced swelling of hind tarsomere indicated by vertical bars. Tree length is 1856, 826 nucleotides.


125

Fig. 3. Strict consensus phylogram 66 trees of EF1a nucleotide data, branch length represents number of base changes, all trees 752 in length, 444 nucleotides. Locality labels and bootstrap support values arepresented as described for Figure 2. Taxa with reduced swelling of hind tarsomere indicated by vertical bars.

(1968) included Hemipyxis as a oedionychine. This transitional status makes it a particularly suitable outgroup for the Brazilian oedionychines because it is either an outgroup to the Oedionychina as whole or a functional outgroup for the New World taxa. In order to increase the probability of correctly polarizing our characters we also included Blepharida in our analysis, which has been predicted to be a primitive alticine (Heikertinger and Ciski 1940, Seeno and Wilcox 1982).

126


Fig. 4. Strict consensus phylogram 29 trees of COI nucleotide data, branch length represents number of base changes, all trees 1454 steps in length, 424 nucleotides. Locality labels and bootstrap and jackknife support are presented as described for Figure 2.


127

Because the two most recent phylogenetic hypotheses of relatedness among select flea beetle genera differ regarding the monophyly of the flea beetles (Farrell 1998; Lingafelter and Konstantinov 2000) there is additional motivation for this comprehensive outgroup sampling. Farrell (1998) in an analysis using 18S Ribosomal DNA and Reid’s (1995) morphological data, concluded that the galerucines and the alticines are both monophyletic, in striking contrast to Reid’s conclusion. Conversely, Lingafelter and Konstantinov (2000) hypothesize paraphyly of the Galerucini sensu stricto with respect to the Alticini. This disagreement is profound, and each hypothesis suggests a different potential outgroup for our study. Farrell’s (1998) analysis included the oedionychine, Alagoasa bicolor (Linn.), placing it well within the flea beetles as sister to Hyphasis. However, although Lingafelter and Konstantinov did not analyze an Oedionychine, they found that Disonycha was basal and Allochroma apical in their analysis. A Blepharida species was included by Lingafelter and Konstantinov (2000) and found to be apical; Podontia Dalman is hypothesized to be a close relative of Blepharida by classical taxonomy, and found to be close to Alagoasa by Farrell (1998). Although Allochroma, Disonycha, and Blepharida were included in our study a priori, comparison to these studies is additional motivation for their inclusion. For reasons of accuracy and documentation of molecular variation, most species were resequenced from more than one individual. Different individuals are represented on the cladogram by different numbers or an indication of color-morph and/or locality e.g. Alagoasa plaumanni, white nRG (north Rio Grande do Sul State and Alagoasa plaumanni, spotted sRG, (South Rio Grande do Sul State). Wanderbiltian nitida (Fabr.), and Oedionychus cinctus (Olivier) were re-sequenced from one individual to check the accuracy of the sequence. RESULTS We present 3 analyses; a combined analysis of a smaller taxon set, for which both markers are available (Fig. 2.) and two additional cladograms for larger taxon sets for which only EF-1a (Fig. 3) and Cytochrome Oxidase I were available (Fig. 4). Branch support is given for all nodes where support is calculable, bootstrap support is given above the line and Bremer Decay indices below the line. In the combined data set, there are 868 included characters of which 456 characters are constant; 86 variable characters are parsimony-uninformative (autapomorphies), and 326 characters are parsimonyinformative. We obtained one most parsimonious tree with a length of 1856 steps (see Fig. 2). The EF-1α data alone is presented in Figure 3. Only one taxon, Walterianella fusconotata (Jacoby) was added to the matrix. In this data set, there are 444 characters of which 255 characters are constant and 42 variable characters are parsimony-uninformative (autapomorphies) 127 characters are parsimony-informative. In the analysis of COI data alone a reduced outgroup set was used (only Hemipyxis species)(see Figure 4) because the increased number of taxa creates a computational burden and we were confident of the choice of Hemipyxis as the closest outgroup, from the analyses of the other genes. Moreover, several preliminary analyses had been performed using all or select pairs of outgroup taxa presented in the combined analysis in addition to the two Hemipyxis species (not shown). Analyses using these additional outgroups produced a larger number of most parsimonious cladograms and much longer shortest trees (the shortest tree was 70 steps longer). Significantly, in these analyses Hemipyxis was always resolved as the sister taxon to the oedionychines. Figure 4 is the strict consensus tree of 29 most parsimonious trees with number of base changes shown, 182 characters are constant, 60 variable nucleotides are autapomorphic, and 182 parsimony informative characters are present.

128


Some insect genes have been shown to harbor severe compositional biases, which complicate phylogenetic analyses (Collins et al. 1994). Oedionychine mt DNA exhibits an AT bias (64%). The EF-1α shows a 55% AT base composition. Importantly, base composition appears similar in all lineages, and a chi square test of heterogeneity showed no significant heterogeneity in either of the genes. CONCLUSIONS Combined analysis of COI and Ef1-α markers indicate that the taxa sampled from the Oedionychina constitute a monophyletic group with very strong bootstrap and Bremer support for the monophyly of these taxa (Fig. 2). Additionally, separate analyses of each gene also support the monophyly of the Oedionychina (Figs. 2 and 3) with high levels of support. The COI tree is especially interesting because the Old World taxa Oedionychis Latreille and Physodactyla Chapuis are represented. Physodactyla is apparently an oedionychine, which agrees with Bechyné (1968), and is in contrast to Scherer (1969) and the Seeno and Wilcox (1982) catalog where it is placed as transitional between the Oedionychina and the Monoplatina. Our own morphological analysis (unpublished) also supports Physodactlya as an oedionychine. Moreover, the combined analysis supports the assertion that neither Disonycha conjuncta nor the 3 monoplatine genera sampled are sister taxa to the Oedionychina. All analyses resolved Hemipyxis as the sister group of Oedionychina (of the taxa sampled), including analysis of COI data for all taxa in Figures 2 and 3 (not shown). Interestingly, the 3 monoplatine taxa Aedmon morissoni, Allochroma sp. and Hypolampsis sp are also very strongly supported as a monophyletic group with bootstrap support of 99, in separate and combined analyses of both genes. Beyond the statements above, few taxonomic generalizations can be made. Although the combined analysis resulted in a fully resolved cladogram the support for many of the nodes is weak (Fig. 2). Moreover, because none of the genera included has been revised, recommendations of the taxonomic placement of species not included in this analysis would be imprudent. Although, the phylogenies implied by the analysis of the combined and EF1a data are congruent, many of the relationships implied by the COI data do conflict with the other two hypotheses, e.g. the relationship between Alagoasa bicolor and A. libentina. Although the relationships in the COI tree are not strongly supported, the conflict exists. It is apparent that the “great difficulty” Scherer (1983) cites for morphological study of the genera of the Oedionychina is also present in these molecular characters. Given the caveats above, there are several ideas suggested by the cladograms which are interesting to discuss and will hopefully stimulate further research. One of these is the fact that these trees all fail to support the taxonomic utility of the highly globosely swollen hind apical tarsomere. If it evolved only once, then the monoplatines would group with the Oedionychina. If the highly globose vs. slightly globose were a phylogenetically relevant criterion then the genera Paranaita, Capraita, Wanderbilitiana, Walterianella, Alagoasa and Kuschelina would fall together, and separated from Omophoita, Asphaera and Aspicela which have less globosely swollen apical tarsomeres. We have indicated the taxa with slightly swollen tarsomeres with vertical bars on the right side of the phylograms in Figures 2 and 3. As clearly shown by the discontinuous bars, these analyses do not support the idea that the Omophoita, and Asphaera together are a monophyletic group (see barred groups in Figs. 2 and 3). The strong support for the monophyly of Paranaita is noteworthy and congruent with the morphological cohesiveness of the genus . The only other grouping that is strongly supported in all 3 analyses is the Alagoasa plaumanni-cruxnigra clade, which is also interesting ecologically (see below).


129

All analyses also strongly suggest the paraphyly of Alagoasa and surprisingly of Capraita. Alagoasa has been informally maligned as a ‘trash basket’ (Swigonova and Duckett 1998) and here we present the first phylogenetic analysis that suggests that the genus, as currently defined, is not monophyletic. However, the multiple placements of Capraita species at more than one place in all 3 analyses is highly suggestive that Capraita should be viewed as a potentially artificial taxon and it is certainly in need of revision. The COI data set that includes 6 species from a wide geographic range (southern Brazil to New Jersey, USA) shows 3 distinct groups of Capraita. Asphaera and Omophoita have also been suggested to be synonymous (Flowers 2001) but here the combined data did not support this hypothesis. Instead, they seem to support 3 grouping of species from this generic grouping. However, because these genera are composed of more than 200 species with distributions throughout the Neotropics we plan further study of these Asphaera and Omophoita including more species from more widely distributed localities. We have included more taxa in the analysis of COI (Fig. 4) for two reasons: to show genetic divergences within and among taxa and to see if COI is useful for associating larvae with adults. In order to document genetic variation and to test whether externally different morphs differ genetically we sequenced up to 4 individuals of some species. As shown (Fig. 4) some taxa are extremely homogeneous within and among localities, for example Omophoita equestris from the same locality in northern Rio Grande do Sul and Paraná States a show very little genetic differentiation. On the other hand, two individuals of Capraita clarissa (Bechyné), (from the same locality, show a surprising amount of variation, (see also Paranaita opima (Germar) from northern and southern Río Grande do Sul State.) Other notably variable taxa include Alagoasa plaumanni, which has 18 published color morphs and is distributed from southern Río Grande do Sul state to Río de Janiero. As shown, COI from the various localities is significantly divergent and these differences have strong support indices. We feel that it could be significant that the spotted morphs from 400 km apart are apparently more closely related to one another than to another morph (white) collected 45 km away. It is also interesting that Alagoasa cruxnigra Jacoby or near is very near A. plaumanni. Alagoasa plaumanni and A. cruxnigra both feed on different species in the genus Eupatorium (Asteraceae)(Duckett, unpublished data). The larvae of A. cruxnigra were originally sequenced to support their association with the adult. Duckett found the adults and larvae feeding on the same plant but was not able to rear adults from the larvae. Because A. nigroscutata was also found abundantly in the same collecting site, although never on the host plant, we sequenced the larvae to test the presumed association. The sequence from the larva was identical to the A. cruxnigra adult sequence and this sequence is 12.6% divergent from that of A. nigroscutata. We also tried to associate abundant yellow larvae with adults found in their vicinity (Duckett and Pedreros unpublished data). These larvae, which appear morphologically identical are found in Paraná and São Paulo states associated with Omophoita personata (Illiger) or near in Paraná and Omophoita sexnotata Harold in São Paulo. Although these larvae can be correctly placed in genus Omophoita, unfortunately we are unable to identify these larvae to species at this time. In summary, the Oedionychina is strongly supported as a monophyletic group based on the genera analyzed including Physodactyla. The monoplatines analyzed form a monophyletic group which is not the sister taxon of the Oedionychina. The closest taxon analyzed to the Oedionychina is Hemipxyis, and the character of apical hind tarsomere-globosely swollen does not appear to be useful as predicted. There is apparently considerable variation within some species for the COI marker fragment used and not in others. COI can be useful for associating larvae with adults, if appropriate caution is exercised- host plant associations of adults and larvae must be noted and sympatric closely related adults also sequenced.

130


ACKNOWLEDGEMENTS We thank David G. Furth and Alexander Konstantinov (at the U. S. National Museum of Natural History), Chris Reid (Australian Museum), Edward G. Riley (Texas A & M University), Shawn Clark and two anonymous reviewers for valuable discussion and/ or comments on the manuscript. We thank Joe Gillespie, Sung Jin Kim, Bradley Lovett and Zuzana Swigonova for help in the lab. We are most grateful to the following individuals for helping to collect or identify specimens used in this paper: Shawn Clark, Wills Flowers, David Furth, Beth Grobbelaar, Ting Hsiao, Luciano Moura, Salvador Mandry, Eduard Petitpierre, Chris Reid, Ed Riley, Atilano Contreras, Roger Blahnik, Joe Gillespie, Doug Tallamy, Jose Henriqe Pedroso, Kunio Suzuki, and Niilo Virkki. We are grateful to Luz Elvia Diaz for the habitus drawing of Paranaita generosa. David Furth and Charles Staines (Smithsonian Institution), Wills Flowers (Florida A & M University), Alexander Konstantinov (Systematic Entomology Lab, USDA), Ed Riley (Texas A. & M. University) kindly helped with consultations of the literature. We also thank Aurora Lauzardo who translated the abstract and Sheila Ward who proofread the manuscript. We are most grateful for financial support to CND in the form of NSF grant DEB 97-07534076, Fondos Institutionales para Investigacion from Univ of Puerto Rico and to NSF grant DEB-9974036 to both of us. We are especially grateful to the following persons who facilitated our obtaining permits or our understanding of the permit process in their respective countries and cheerfully provided us with abundant hospitality: Atilano Contreras (Mexico), Maria Helena Galileo (Fundacão Zoobotanica, Brazil), Beth Grobbelaar (Institute of Plant Protection, South Africa), and Luciano Moura (Fundacão Zoobotanica, Brazil). CND thanks the Gilson Moreira Family of Coxhilia do Fogo, Cangucu in Rio Grande do Sul State, J. H. Pedreros of Universidade Federal do Paraná, Curitiba, and Lenice Medeiros and Artur Muller of Porto Alegre for lodging and/or generous hospitality while collecting. LITERATURE CITED Balsbaugh, J. 1988. Mimicry and the Chrysomelidae. In: Biology of the Chrysomelidae, P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. pp. 261-284. Bechyné, J. 1951. Chrysomeloidea Americains nouveaux ou peu connus (Coleoptera). Bull. Mens. Soc. Linn. Lyon 32(8):325-239. Bechyné, J. 1955a. Troisième note sur les chrysomeloidea neotropicaux des collections de l’institut Royal des sciences naturelles de Belgique (Col. Phytophaga) deuxieme partie. Inst. Roy. Sci. Nat. Belg. 31(19):1-28, 60 figs. Bechyné, J. 1955b. Reise des Herrn G. Frey in Sudamerika: Alticidae (Col. Phytophaga). Ent. Arb. Mus. Frey 6:74-266; 3 plates. Bechyné, J. 1956. Les espèces du genero Wanderbiltiana (Col. Phytoph. Alticidae) Dusenia. 7:329-340. Bechyné, J. 1957. Provisorische Liste der Alticiden von Rio Grande do Sul (Col. Phytoph. Chrysomeloidea). Iheringia Zool. 3:1-52. Bechyné, J. 1958. Notizen zu den neotropischen Chrysomeloidea (Col. Phytophaga). Ent. Arb. Mus. Frey 9(2):478-706, 2 Figs. Bechyné, J. 1959a. Notes sur quelques Oedionychini de Madagascar. Bull. Mens. Soc. Linn. Lyon 28(10):318-323. Bechyné, J. 1959b. Beitrage zur kenntnis der Alticidenfauna Boliviens (Coleopt. Phytophaga). Beitr. Neotrop. Fauna 1(4):269-381. Bechyné, J. 1963. Notes sur quelques Chrysomeloidea neotropicaux nouveaux ou peu connus (Col. Phytophga). Bull. mens. Soc. Linn. Lyon 32(8):325-239.


131

Bechyné, J. 1964. Notizen zu den Madagasischen Chrysomeloidea (Col. Phytophaga). Mitt. Munch. Entomol. Gesell. 54:68-161. Bechyné, J. 1968. Contribution a la Faune du Congo (Brazzaville). Mission A. Villiers et A. Descarpentries. LXXXI/ Coleopteres, Alticidae. Bull. Inst. Fr. Africa. Noire Ser. A. 30 (4):1687-1728. Bechyné, J. and B. Springlová de Bechyné, 1966. Evidenz der bisher bekannten Phenrica-Arten . (Col. Phytophaga, Alticidae). Ent. Tidskr. 87(3-4):142-170. Bechyné, J. and B. Springlová de Bechyné. 1973. Notas sobre algunos Phytophaga de origen paleantártico (Coleoptera). Rev. Chilena. Entomol. 7:25-30. Bechyné, J. and B. Springlová de Bechyné. 1977. Zur Phylogenesis einiger neotropischen Alticiden (Coleoptera, Phytophaga). Studies Neotropical Fauna and Environment 12(2):81-146. Bechyné, J. and B. Springlová de Bechyné. 1978. Sobre algunos alticidae (Alticinae y Oedionychinae) (Coleoptera:Phytophaga) Rev. Fac. Agron. (Maracay) 26:67-83. Begossi, A. and W. Benson. 1988. Host plants and defense mechanisms in Oedionychina (Alticinae), . pp 5771. In: Biology of the Chrysomelidae, P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Bremer, K. 1988. The limits of amino acid sequence data in angiosperm phylogenetic reconstruction. Evolution 42: 795-803. Brower, A.V.Z.1996. Parallel race formation and the evolution of mimicry in Heliconius butterflies: a phylogenetic hypothesis from mitochondrial DNA sequences. Evolution 50:195-221. Chapuis, F. 1875. In: Lacordaire, Histoire naturelle des insectes. Genera des coleopteres. Vol. 11, Famille des Phytophages, 420ppl, pls. 124-134. Paris. Clark, H. 1860. Catalog of Halticidae in the collection of the British Museum, part 1, 301 pp., 10pls. Clark, H. 1865. An Examination of Halticidae of South America. Journ. Ent. 2:375-412. Collins, T.M., P.H. Wimberger, and G. Naylor. 1994. Compositional bias, character-state bias, and characterstate reconstruction using parsimony. Syst. Biol. 43:482-496. Donoghue, M. J., R. G. Olmstead, J. F. Smith, and J. D. Palmer. 1992. Phylogenetic relationships of Dipsacales based on rbcl sequences. Ann. Miss. Bot. Gard. 79:333-345. Duckett, C. N. 1998. Looking for larvae in Brazil. Chrysomela 35:8-9. Duckett, C. N. 1999.A preliminary cladistic analysis of the subtribe Disonychina with special emphasis on the series Paralactica (Chrysomelidae: Galerucinae: Alticini), pp. 105-136. In: Advances in Chrysomelidae Biology. M. L. Cox (Ed.). Backhyus Publishers, Leiden, The Netherlands. Eriksson, T. 1999. Autodecay 4.0. A program distributed by the author. Department of Botany, Stockholm University. Stockholm. Farrell, B. D.1998. “Inordinate Fondness” Explained: Why are there so many beetles? Science 281:555-559. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791. Flowers, R. W. 2001. Seed feeding by a multispecies swarm of flea beetles (Coleoptera: Chrysomelidae: Galerucinae: Alticini). Proc. Ent. Soc. Wash. 103:257-259. Furth, D. G. and V. Savini, 1996. Checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 10(1-4):45-68. Furth, D. G. and V. Savini, 1998. Corrections, clarifications, and additions to the 1996 checklist of the Alticinae of Central America, including Mexico (Coleoptera: Chrysomelidae). Insecta Mundi 12(1-2):133-138. Heikertinger, F. and C. Csiki. 1940. Coleopterorum Catalogus, Halticinae, II, 25(169):337-635. Horn, G. H. 1889. A synopsis of the Halticini of boreal America. Trans. Amer. Ent. Soc.16:163-320. Jacoby, M. 1888. Biologia Centrali-Americana. Insecta: Coleoptera, 625 pp. vol vi. part 1. Phytophaga (part) London.

132


Jacoby, M. 1890. Biologia Centrali-Americana. Insecta: Coleoptera. vol vi. part 1. supplement. Phytophaga (part) London, 375 pp., 43 plates. Leng, C. W. 1920. Catalogue of the Coleoptera of America, North of Mexico, 470 pp. Mount Vernon, N.Y. Lingafelter, S. W. and A. S. Konstantinov. 2000. The monophyly and relative rank of alticine and galerucine leaf beetles: A cladistic analysis using adult morphological characters (Coleoptera: Chrysomelidae). Ent. Scand. 30:397-416. Maddison, W. P., and D. R. Maddison. 2000. MacClade: Analysis of Phylogeny and Character Evolution. Version 4.0. Sinauer, Sunderland, MA. Martorell, L. F., 1975. Annotated food plant catalog of the insects of Puerto Rico. Agricultural Experiment Station. University of Puerto Rico. Maulik, S. 1926. The fauna of British India, including Ceylon and Burma. Coleoptera, Chrysomelidae (Chrysomelinae and Halticinae). London. 442 pp. Petitpierre, E., C. Segarra, S. J. Yadav, and N. Virkki. 1988. Chromosome numbers and meioformulae of Chrysomelidae, pp.161-186. In: Biology of the Chrysomelidae. P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Reid, C. A. M., 1995. A cladistic analysis of subfamilial relationships in the Chrysomelidae sensu lato (Chrysomeloidea), pp. 559-631. In: J. Pakaluk and S. A. Slipinski (Eds.). Biology, Phylogeny, and Classification of Coleoptera: Papers Celebrating the 80th Birthday of Roy A. Crowson. Muzeum i Instytut Zoologii PAN, Warszawa. Samuelson, G. A. 1985. Description of a new species of Alagoasa (Coleoptera: Chrysomelidae) from Sothern Brazil associated with Lantana (Verbenaceae). Revta. Bras. Ent. 29(3/4):579-585. Scherer, G. 1962. Bestimmungsschluessel der neotropischen Alticinen-genera (Coleoptera:Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 13(2):497-607. Scherer, G. 1969. Beitrag zur Kenntnis de Alticinae Afrikas (Coleoptera: Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 21:298-304, 4 figs. Scherer, G. 1983. Diagnostic Key for the Neotropical Alticine Genera, (Coleoptera: Chrysomelidae: Alticinae). Ent. Arb. Mus. Frey 31/32:1-89. Scherer, G. 1988. The origins of the Alticinae, pp. 115-130. In: Biology of the Chrysomelidae. P. Jolivet, E. Petitpierre, and T.H. Hsiao (Eds.). The Netherlands. Kluwer Acad. Publ. Seeno, T.N. and J. A. Wilcox, 1982. Leaf Beetle Genera (Coleoptera: Chrysomelidae). Entomography 1:1-222. Sidow, A. and A. C. Wilson. 1991. Compositional statistics evaluated by computer simulations, pp. 129-146. In: M. M. Miyamoto and J. Cracraft (Eds.). Phylogenetic analysis of DNA sequences. Oxford University Press, Oxford. Simon, C., F. Frati, A. Beckenbach, B. Crespi, H. Liu and P. Flook. 1994. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Ent. Soc. Amer. 87:651-701. Swigonova, Z. and C. N. Duckett. 1998. The 1998 Mid-Atlantic states field trip. Chrysomela, 36:7. Swofford, D. L. 2001. PAUP*: Phylogenetic Analysis Using Parsimony, Version 4.08b Computer program distributed by Sinauer. Virkki, N. 1989. On the cytological justification of the flea beetle subtribes Oedionychina and Disonychina (Bechyné and Springlová de Bechyné 1966). Entomography 6:545-550. Virkki, N. and J. A. Santiago-Blay. 1996. Atypical cytology in some neotropical flea beetles (Coleoptera: Chrysomelidae: Alticinae: Oedionychina) from one of the most intense natural radiation sites known, Morro do Ferro (Brazil). Cytobios 85:167-184.

© PENSOFT Publishers Present Status Sofia - Moscow

David G. Furth (ed.) 2003 of a Taxonomic Revision of Afrotropical Monolepta and ... Beetle Biology 133 SpecialRelated Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 133-146

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related Groups (Galerucinae) Thomas Wagner1 1

Universität Koblenz-Landau, Institut für Biologie, Universität sstr. 1, 56070 Koblenz, Germany. Email: [email protected] 12th contribution to the taxonomy, phylogeny and biogeography of afrotropical Galerucinae.

ABSTRACT A taxonomic revision of the Afrotropical “Monoleptites” sensu Wilcox (1973) was started recently. Herein, external and genitalic characters are described and illustrated for major genera whose type species were described from continental Africa, i.e. Monolepta Chevrolat, 1837, Candezea Chapuis, 1879, Barombiella Laboissière, 1931, Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892), Monoleptocrania Laboissière, 1940, and additionally Bonesioides Laboissière, 1925, and the recently described Afromaculepta Hasenkamp and Wagner, 2000. Primary types of 285 species and about 55,000 specimens from all major collections of Afrotropical insects were studied. Characters previously used for generic delimitation, like open prothoracic coxal cavities or relative length of the basi-metatarsus differ significantly in several taxa within genera and are therefore misleading for generic delimitation. Only the genitalic structures of both sexes allow a reliable delimitation and identification of genera. “Monoleptites” and all species-rich genera were found to be polyphyletic and many species need to be transferred to other genera. Additionally, species described in Monolepta and Candezea from Asia, Australia or Central America appear heterogeneous. In particular, species of Central America cannot be considered congeneric to Monolepta and Candezea.

INTRODUCTION Since 1993, canopy dwelling arthropod communities in Central and East African forests have been studied (Wagner 1997, 1999b). Arthropods were predominantly collected by insecticidal canopy fogging, which allows a quantitative sampling, particularly of surface dwelling insects like the Chrysomelidae (Basset et al. 1997). Studying the diversity of arthropods is dependant on species numbers, but the taxonomic status and generic delimitation of many tropical insects is still unsatisfactory, and the only way to get species numbers is to assign the material to morpho-types. This was carried out for beetles, where particularly the Chrysomelidae turned out as one of the most abundant and species-rich beetle groups in the canopies of African forests (Wagner 1999b). Additionally, many taxonomists are generously identifying material of various groups, but for most galerucine taxa, which were amazingly abundant in our samples, there was obviously no

134

Thomas Wagner

specialist. Thus, a taxonomic revision of beetles which were assigned to the Section “Monoleptites“ in the most recent catalogue on the Galerucinae (Wilcox 1973) was started in 1997. In addition to material collected during field studies in Rwanda, Kivu, Uganda and Kenya, specimens and type material from numerous collections were studied (Table 1). Since the first paper of this revision, published four years ago (Wagner 1999a), further material has been investigated and several results were published more recently or are in press (Hasenkamp and Wagner 2000; Stapel and Wagner 2000; Schmitz and Wagner 2001; Freund and Wagner 2002; Middelhauve and Wagner 2001; Wagner 2000a, b, 2001a, b, 2002a, b). Herein, a synopsis of the taxonomic revision is presented. External Table 1. Collections, specimens and numbers of primary types of Afrotropical Monolepta and related groups (“Monoleptites“ sensu Wilcox 1973) studied. collection Musée Royal d’ Afrique Centrale, Tervuren Institut Royal des Sci. Nat. de Belgique, Brussel Natural History Museum, London Museum für Naturkunde, Berlin Musée National d’ Histoire Naturelle, Paris Naturhistoriska Centralmuseet, Helsinki Plant Protection Institute, Pretoria Hungarian Natural History Museum, Budapest National Museum of Kenya, Nairobi Transvaal Museum, Pretoria National Museum of Namibia, Windhoek Zoologisches Institut und Zoolog. Museum, Hamburg Swedish Museum of Natural History, Stockholm Zoologisk Museum, Universitet Kobenhavn Naturhistorisches Museum, Basel Naturhistorisches Museum, Wien Deutsches Entomologisches Institut, Eberswalde Museo Civico di Storia Naturale, Genova South African Museum, Cape Town Naturkundemuseum Erfurt University Museum, Oxford Zoological Institute St. Petersburg Museo Zoologico de “La Specola”, Firenze Zoolog. Forschungsinstitut und Museum Koenig, Bonn Smithsonian Institution, Washington Instituto de Investigacao Científica Tropical, Lisboa Bishop Museum, Honolulu Zoologische Staatssammlung, München The Manchester Museum, Manchester Museum für Tierkunde, Dresden Staatliches Museum für Naturkunde, Stuttgart Forschungsinstitut Senckenberg, Frankfurt Museu du Histórica Natural, Coimbra Museo Civico di Storia Naturale, Trieste Natuurhistorisch Museum, Leiden

specimens

primary types

25000 8500 3900 3600 2800 2000 1800 1300 1100 700 550 470 450 400 400 260 220 250 250 200 170 170 170 150 120 100 100 75 70 50 40 30 20 15 10 55440

39 30 80 58 31 19 9 1 1 7 1 1 4 2 2 285

Present Status of a Taxonomic Revision of Afrotropical Monolepta and Related ...

135

and genitalic characters of major galerucine genera with elongated basi-metatarsi are given and illustrated. Described Genera, Species Numbers, History and Material Investigated In the most recent catalogue of the Galerucinae (Wilcox 1973), species which are characterized by an elongated basi-metatarus and lacking any pronotal depressions are assigned to the ‘Monoleptites’. Most species were described between 1890 and 1950 (Wagner 1999a), whilst for the last 35 years no further species have been described from Africa. With very few exceptions, the descriptions by previous authors were based on external characters only. Studies of the genitalic structures, in particular the median lobes, now allow a much better characterization of Monolepta and other taxa. In addition, the phylogenetic delimitation of Monolepta from other, presumably closely related taxa, was inconsistent and required redefinition. In addition to Monolepta, Candezea Chapuis, 1879, Barombiella Laboissière, 1931, Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892), and Monoleptocrania Laboissière, 1940 were described from continental Africa. Furthermore, Bonesioides Laboissière, 1925 which was placed in the “Scelidites“ (Wilcox 1973) needs to be involved in this revision. About one third of the species originally described in those genera need to be transferred to other taxa according to their phylogenetic position, and some new genus-names, like the recently described Afromaculepta Hasenkamp and Wagner, 2000, are necessary. A total of 285 primary types of 306 nominal species of Afrotropical “Monoleptites“ could be located in 35 institutional collections (Table 1). Type material of a few remaining species, most of them described in the 19th century, is not available, and other type material was destroyed by fires such as those of 1944 in Hamburg, and 1978 in Lisbon. About 55,000 dried specimens have been studied up to now in this revision, nearly half of them from the Africa Museum in Tervuren (Table 1). About 70 % of all specimens studied were not identified to species before. Monolepta Chevrolat, 1837 This is the largest genus of the Galerucinae and comprises approximately 600 nominal species (Wilcox 1973). Most of them were described from tropical Africa, Australia and South-East Asia, with a few others from adjacent palaearctic sites and from Central America. Monolepta was originally proposed with 21 species of Galerucinae from Africa and 18 species from tropical Asia and New Guinea. Chevrolat (1849) designated Crioceris bioculata Fabricius, a species described from the Cape of Good Hope, as geno-type (Fig. 1). Erichson (1843) was the first author who adapted the name for a new species, Galeruca (Monolepta) pauperata. The name, derived from “mono” = one and “leptos” = thin, refers to the long first article of the metatarsus which is longer than the other articles together. A character often used for delimitation of Monolepta from other galerucine genera, the prothoracic coxal cavities being open or closed, varies greatly among Monolepta species. Chapuis (1875) and Weise (1923), described Monolepta as a group with closed prothoracic coxal cavities, whilst Weise (1893) previously described this genus as having open prothoracic coxal cavities. They are comparatively widely open in Monolepta bioculata (Wagner 1999a), but among other “true“ Monolepta there are species with closed or widely open coxal cavities. A much better external character for Monolepta is the relative length of the basal antennal articles, where the second and third articles are approximately of same length (Fig. 2), while in most other

136

Thomas Wagner

taxa the third article is significantly longer (Figs. 8, 13, 19, 31). However, several less diverse taxa share this character and only the dissection of the genitalia allows a reliable allocation to Monolepta for both sexes. Species of Monolepta are characterized by an elongated median lobe, which is bilaterally symmetrical, has no incisions at the apex or at the apex of the tectum, and bears symmetrically arranged endophallic armatures, usually with three distinct types of spiculae (Figs. 3, 4). The spermatheca is also of distinct shape (Fig. 5), and there are two pairs of well sclerotized bursal sclerites of different sizes and shapes. Many Afrotropical species originally described in Monolepta are not closely related to the geno-type and need to be transferred to other monophyletic groups. Furthermore, about 30 species described in Monolepta from SE Asia and Australia, and 10 species from Central America were studied recently. Most of these species, including all from Central America, are not congeneric with Monolepta bioculata. About 95% of Afrotropical Monolepta species were described between 1880 and 1950, usually on the basis of a few external characters and coloration only, but coloration patterns have been found to be highly variable in many species. Thus, some species were described several times, and up to nine synonyms for widely distributed species could be found (Fig. 6; Wagner, unpublished data). About 20,000 specimens of Afrotropical Monolepta were examined. The taxonomic revision of Monolepta is not yet complete, and thus the number of species occurring in tropical Africa is not precisely known. Prior to the recent revision, 180 Afrotropical species of Monolepta were described

Figs. 1-5. Characters of Monolepta bioculata (Fabricius); 1: body shape and colour pattern (dot-shaded: red; without signature: yellow); 2: basal antennal articles; 3: aedeagus, median lobe, lateral view, including endophallic armature; 4: aedeagus, same dorsal view; 5: spermatheca. Scale bars for Fig. 1, and Figs. 2-5 (and all following figures) each 1 mm.


137

20 18

synonyms

16

described species without synonyms

14 12 10 8 6 4 2

2000

1980

1960

1940

1920

1900

1880

1860

1840

1820

1800

1780

0

Fig. 6. Numbers of Monolepta species described from tropical continental Africa per decade and numbers of synonyms found (only “true“ Monolepta species sensu Monolepta bioculata are included).

Figs. 7-11. Characters of Candezea occipitalis (Reiche); 7: body shape and colour pattern; 8: basal antennal articles; 9: aedeagus, median lobe, lateral view, including endophallic armature; 10: aedeagus, same dorsal view; 11: spermatheca.

138

Thomas Wagner

Figs. 12-17. Characters of Afrocrania latifrons (Weise); 12: body shape; 13: basal antennal articles (male); 14: aedeagus, median lobe, lateral view, including endophallic armature; 15: aedeagus, same dorsal view; 16: aedeagus, same ventral view, without endophallic armature; 17: spermatheca.

(Wagner 1999a; Wilcox 1973). About 40 of these species were found to be synonyms and roughly 90 needed to be transferred to other genera due to their phylogenetic relationships. In addition to the 50 remaining valid species, roughly the same number of species was recently described (e.g. Wagner 2000a, 2000b, 2001a, 2001b, 2002a) or awaits description. Therefore, about 100 species of Monolepta exist in tropical Africa (Figs. 6, 42). Only a few Monolepta species are distributed pan-Afrotropically and known from different biomes. Those which occur in savannas are often more widely distributed, while forest dwelling species are usually more restricted, and a high degree of endemism is found in montane areas. The diversification of Monolepta is obviously strongly effected by geographical speciation in isolated montane forests. Twelve species, e.g. M. umbrobasalis Laboissière, M. wittei Laboissière, and several new species, are endemic to montane forests along the Albertine Rift (Kivu, western Uganda, Rwanda, Burundi). Ten are restricted to east African mountains in Kenya and Tanzania, mainly to Mt. Kenya, Mt. Kilimanjaro and to the Eastern Arc Mountains mosaic. These include M. usambarica Weise, M. deleta Weise, M. miltinoptera Weise, and M. alluaudi Laboissière. Additionally, nine species are restricted to Ethiopia and Eritrea. In the latter area, the degree of endemism is highest, since nine of 16 species, e.g. M. longiuscula Chapuis, M. postrema Chapuis, M. euchroma Fairmaire, M. nigropicta Laboissière, M. gobensis Laboissière, and M. nigrocruciata Laboissère, are only known from Ethiopia and Eritrea. To a lesser extent, montane regions in Cameroon show a high species diversity and some endemism (Wagner 2002b). Many Monolepta species, particularly those with restricted distribution in montane forest areas, are obviously evolutionary young species. The Quarternary extension of the forest biome may have


139

been crucial for the present distribution pattern. In the late Pleistocene, the climate, particularly in Central and East Africa, was much cooler and drier (Hamilton 1981, 1989). The upper border for forest vegetation was about 1000 m lower than at present (Bonnefille et al. 1990, Lovett 1993), and most lowland areas, including the Congo Basin, were too dry for forest vegetation and covered by savannas. The proposed forest refugial core areas in Africa coincide well with the highest degree of endemism and highest diversity of Monolepta species in montane areas. Candezea Chapuis, 1879 Candezea was established for “Monoleptites“ with long antennae and tarsi, elongate epipleura and the third antennal article much longer than the second (Fig. 8). Monolepta occipitalis Reiche, a species described from Ethiopia, was designated as geno-type (Fig. 7), and further 45 species from tropical Africa were subsequently described in this genus (Fig. 42). Particularly here, delimitation to other genera was very inconsistent, and e.g. Weise (1892) used Candezea only as a subgenus within Monolepta. Genitalic characters were studied for most African species originally described in this genus, and it turned out that this group is also clearly polyphyletic. Based on external characters, the number of species in Candezea will be reduced to only eight species (Kurtscheid and Wagner, in prep.), while the others need to be transferred to other genera. Candezea are comparatively large Galerucinae with a total length between 5.7 and 8.1 mm. The pronotum and elytra are yellow or pale yellowish brown, the latter with irregular small black spots (Fig. 7) or a reddish apex in some species. The median lobe is slender, round in cross-section, with three similar pairs of strong hooked spiculae (Figs. 9, 10), and males of some species are sexual dimorphic with carinate elytra. The spermatheca is characterized by a long, curved cornu (Fig. 11), and there is only one pair of strongly sclerotized, spiny sclerites on the bursa. Candezea species are distributed in savannas and forests of east, central and southern Africa, but not known from West Africa. Some species, like C. flaveola (Gerstäcker) and C. irregularis (Ritsema), are very abundant. Most of the about 12,000 specimens of Candezea examined belong to these two species. Afrocrania Hincks, 1949 (= Pseudocrania Weise, 1892) Weise described a slender, brownish yellow Galerucinae with elongated basi-metatarsi, with males characterized by a cavity on the frons and curved fourth antennal articles, Pseudocrania latifrons Weise, which was the type species of the genus by monotypy (Figs. 12, 13). A few years later another species was described in this group: Pseudocrania nigricornis Weise, a species Weise later synonymized with Monolepta africana Jacoby as Monolepta foveolata Karsch (Weise 1903). Hincks (1949) found Pseudocrania Weise to be a junior homonym of Pseudocrania M’Coy, a fossil group of Brachiopoda, and consequently the name was changed to Afrocrania. In addition to the species described by Weise, two more species in which the males have head cavities were found (Middelhauve and Wagner 2001). However, among the 1000 specimens studied, there are also species in which the males lack a head cavity, which need to be transferred to Afrocrania or described in new genera. These species have a peculiar sexually dimorphic character, complex folded extrusions along the suture at the elytral base in males. Furthermore, there are some species with simple, shallow “hump-backed“ extrusions at the elytral base. Afrocrania are slender Galerucinae, with elongated antennal articles and a uniform pale brownish dorsum. The pronotum is significantly narrowed at the base, while Monolepta and Candezea have a wide pronotal

140

Thomas Wagner

base. The median lobe of Afrocrania is slender, the apical part is usually elongated, and the apex is often slightly enlarged (Figs. 14-16) and has an apically pointed tectum, which is broad in the middle and narrowed at base. The endophyllic armature has two types of endophallic spiculae: one pair of hooked spiculae and one pair, or in a few species, two pairs of slender usually straight spiculae. Spermathecae and (Fig. 17) bursal sclerites of Afrocrania are similar to those of Candezea. Afrocrania is distributed throughout the Afrotropical region, but most species are known from small areas and seem to be restricted to western parts of central Africa (Gabon and Cameroon) and to southern Congo. Monoleptocrania Laboissière, 1940 Next to the above listed species-rich taxa, there are also some phylogenetically isolated taxa which include only single species. One of them was described by Laboissière in 1940, when he transferred Galeruca foveata Olivier, 1807, which was listed in Monolepta by Weise (1924), to his new genus Monoleptocrania. Monoleptocrania foveata can be clearly distinguished from all other Galerucinae with elongated basi-metatarsi by an impression on the vertex, which is shallow and approximately circular in females, but deep and pentagonal in males (cf. Stapel and Wagner 2000; Fig. 18). This was noticed by Olivier (1807) and later also by Thomson (1858) when both authors named the species after this conspicuous character (Galeruca foveata, Galeruca cavifrons Thomson). Thomson‘s choice is not very favourable since it is not the frons (like in males of some Afrocrania species), but the vertex, which bears the cavity. Within our revision of the Afrotropical “Monoleptites“ no further species of this genus could be found (Stapel and Wagner 2000). Body shape, coloration, relative length of the basal antennal articles (Fig. 19), and female genitalic structures (Fig. 23) are most similar to Afrocrania, and both genera are surely closely related. However, morphometric measurements and particularly the male sexually dimorphic characters and genitalia (Figs. 20-22) have many peculiarities and emphasize the generic delimitation. Few specimens are available of this species which is only known from a few locations in the coastal region of west and central Africa from Sierra Leone to northern Namibia. Most specimens have been found in Gabon, and all available specimens were collected before 1910. Afromaculepta Hasenkamp and Wagner, 2000 In the third edition of the Dejean catalogus, Chevrolat (1837) transferred Crioceris bioculata Fabricius, 1781 as geno-type in his new genus Monolepta, along with several new species. One of them was Monolepta frontalis (Fig. 25), which is clearly not closely related to the type species of Monolepta. This species was recently transferred as geno-type to Afromaculepta a long with Monolepta decemmaculata Jacoby, and its four synonyms, with Monolepta octomaculata Jacoby, and with three new species. Afromaculepta are characterized by a small body size, predominantly yellow coloration, small, symmetrically arranged black spots on the elytra (Fig. 24), second and third antennal articles of same length (Fig. 25), and a very different genital pattern as compared to all other groups listed here (Figs. 26-29; Hasenkamp and Wagner 2000). About 1000 specimens, one third of them recently collected in southern Africa, could be studied. The other genera listed above include many species which are distributed in or are even restricted to, wet tropical forests where Afromaculepta species do not occur. This genus has its highest diversity in the South African savanna of Natal and Transvaal, where up to five species occur sympatrically


141

Figs. 18-23. Characters of Monoleptocrania foveata (Olivier); 18: body shape; 19: basal antennal articles; 20: aedeagus, median lobe, lateral view, including endophallic armature; 21: aedeagus, same dorsal view; 22: aedeagus, same ventral view, without endophallic armature; 23: spermatheca.

Figs. 24-29. Characters of Afromaculepta frontalis (Chevrolat); 24: body shape and colour pattern; 25: basal antennal articles; 26: aedeagus, median lobe, lateral view, including endophallic armature; 27: aedeagus, same dorsal view; 28: aedeagus, same ventral view, without endophallic armature; 29: spermatheca.

142

Thomas Wagner

(Wagner 2002b). All species appear adapted to dry habitats; A. ursulae Hasenkamp and Wagner and A. namibiae Hasenkamp and Wagner, 2000, in particular occur mainly in dry savannas and deserts in Transvaal, Botswana or Namibia. Only A. decemmaculata (Jacoby) has a much wider distribution and is known from Senegal in the west to Eritrea in the east, as well as throughout eastern Africa to the western Cape Province in South Africa and Namibia on the west coast. However, this widely distributed species does not occur in the Guineo-Congolian rainforest biome. Bonesioides Laboissière, 1925 Laboissière (1925) designated Ootheca coerulea Allard, an entirely metallic blue galerucine with moderately elongated basi-metatarsi, as geno-type (Fig. 30). Examination of the type material revealed that external morphological characters (Fig. 31), as well as genitalic structures (Figs. 32-35), are very similar to many species originally described in Barombiella Laboissière, and most of the metallic-blue or -green species described in this genus need to be transferred to Bonesioides (Fig. 42). About 850 specimens were examined, and these included material of eleven newly described species. A total of 21 species is now known in Bonesioides (Freund and Wagner in press).

Figs. 30-35. Characters of Bonesioides coerulea (Allard); 30: body shape; 31: basal antennal articles; 32: aedeagus, median lobe, lateral view, including endophallic armature; 33: aedeagus, same dorsal view; 34: aedeagus, same ventral view, without endophallic armature; 35: spermatheca.


143

Bonesioides shows strong morphological differences from the other genera listed above. Within Bonesioides, the relative length of the basi-metatarus differs remarkably, and, in some species, it is much less elongated. Most Bonesioides are clearly associated with more humid conditions in Africa. The evolutionary origins of this group are presumably located in the central African forest block, and only a few species are probably secondarily adapted to drier conditions of savannas. Barombiella Laboissière, 1931 Originally described as Barombia Jacoby, Laboissière (1931) found this to be a junior homonym to Barombia Karsch (Orthoptera) and substituted the genus name. Most of the metallic coloured species need to be transferred to Bonesioides (see above). Barombiella metallica (Jacoby), the geno-type (Fig. 36) is an abundant species known throughout the Guineo-Congolian forest from Sierra Leone to eastern Congo. It has many peculiarities, like large body size, yellow antennae and legs, slightly elongated third antennal article (Fig. 37), strongly trapezoidal pronotum, broad median lobe without endophallic spiculae (Figs. 38-40), and shape of spermatheca (Fig. 41). Therefore, a separation from all other species mainly decribed by Laboissière in Barombiella is warranted. Some of those species, characterized by slender body shape, dorso-ventrally compressed thorax, and pale yellow elytra, need to be transferred to Galerudolphia Hincks.

Figs. 36-41. Characters of Barombiella metallica (Jacoby); 36: body shape; 37: basal antennal articles; 38: aedeagus, median lobe, lateral view, including endophallic armature; 39: aedeagus, same dorsal view; 40: aedeagus, same ventral view, without endophallic armature; 41: spermatheca.

144

Thomas Wagner

Monolepta 180 described species - 40 synomyns - 90 "non"- Monolepta + ~ 50 new species 1 Ootheca 1 Beiratia

7

~ 100 species

3 2

Bonesioides 3 described species

+ 5 from Barombiella - 9 synomyns + 11 new species = 21 species

~ 120 nom. species

Candezea

Afromaculepta Galerudolphia Barombiella Monoleptocrania

45 described species - 9 synomyns - 29 "non"- Candezea + 1 new species = 8 species

several new taxa names

1

Afrocrania 4 described species - 2 synonym - 2 "non"-Afrocrania + 11 new species = 12 species

Fig. 42. Taxonomic change in species rich genera studied. Only Afrotropical species (excluding Madagascar) are included.

CONCLUSION AND FUTURE OUTLOOK The revision clearly shows that “Monoleptites“, as well as all of its species rich taxa are typological, polyphyletic groups and many species need to be transferred to other genera. Characters previously used for generic delimitation, like open prothoracic coxal cavities or relative length of the basimetatarsus, differ significantly in several taxa and are not useful to characterize monophyletic groups. Only the genitalic structures of both sexes allow a reliable delimitation and identification of such monophyla, i.e. genera. Additionally, species described in Monolepta and Candezea from Asia, Australia or Central America appears heterogeneous, and, in particular species of Central America, cannot be considered congeneric to these taxa. Since the taxonomic revision is nearly finished for several species-rich taxa, the phylogenetic position of these groups can now be addressed. This will include taxa outside tropical Africa, and in addition to external and genitalia characters, molecular characters will be included in a comprehensive approach. ACKNOWLEDGEMENTS Special thanks are due to the students who performed the main work on the revision of the many taxa: Agnes Kurtscheid (Candezea), Jens Middelhauve (Afrocrania), Heidi Stapel (Monoleptocrania), Ruth Hasenkamp (Afromaculepta) and Wolfram Freund (Bonesioides, Barombiella). Thanks are also extended to Bernhard Misof and Eva-Maria Levermann for valuable comments


145

on the manuscript. This study was supported by Deutsche Forschungsgemeinschaft (grant no. Schm 1137/2-2 and Wa 1393/3-2). LITERATURE CITED Basset, Y., N. D. Springate, H. P. Aberlencand, and G. Delvare 1997. A review of methods for sampling arthropods in tree canopies, pp. 27-67. In: N. E. Stork, J. Adis and R. K. Didham (Eds.). Canopy arthropods. Chapman and Hall, New York. Bonnefille, R., J. C. Roeland and J. Guiot 1990. Temperature and rainfall estimates for the past 40,000 years in equatorial Africa. Nature 346:347-349. Chapuis, F. 1875. Familie de Phytophages. In: Th. Lacordaire and F. Chapuis (Eds.), Historie naturelle des insects. Genera des Coléoptères, 11: 420. Paris. Chapuis, F. 1879. Phytophages Abyssiniens du musée civique d’histoire naturelle de Gênes. Annali di Museo Civico Storia Naturale Genova 15:5-31. Chevrolat, L. A. A. 1837. Chrysomelidae. In: Dejean (Ed.), Catalogue des coléoptères de la collection de M. le Compte Dejean. 3rd. Edition, revue, corrigee et augmentee, 5: 407. Paris. Chevrolat., L. A. A. 1849. Galérucites. In: D’Orbigny, Ch. (Ed.), Dictionaire universel d’histoire naturelle. Vol. 6:4-6. Paris. Erichson, W. F. 1843. Beitrag zur Insecten-Fauna von Angola. Archiv für Naturgeschichte, 9:199-267. Freund, W. and T. Wagner in press. Revision of Bonesioides Laboissière, 1925 (Coleoptera; Chrysomelidae; Galerucinae) from continental Africa. Journal of Natural History. Hamilton, A. C. 1981. The quaternary history of African forests: its relevance for conservation. Journal of African Ecology 19:1-6. Hamilton, A. C. 1989. African forests, pp. 155-182. In: H. Lieth and M. J. A. Werger, (Eds), Ecosystems of the world 14B: Tropical rainforest ecosystems. Elsevier, Amsterdam. Hasenkamp, R. and T. Wagner 2000. Revision of Afromaculepta gen. n., a monophyletic group of Afrotropical Galerucinae leaf beetles (Coleoptera: Chrysomelidae). Insect Systematics and Evolution 31:3-26. Hincks, W. D. 1949. Some nomenclatorial notes on Chrysomelidae, No. 1, Galerucinae. Annals and Magazine of Natural History 2 (12):607-622. Laboissière, V. 1925. Supplément au Catalogus Coleopterorum, pars 78 (Galerucinae), de J. Weise, pécédé de remarques sur la classification des Galerucini. Encyclopédie Entomologique 1:33-62. Laboissière, V. 1931. Galerucini (Coleoptera Chrysomelidae) d’Angola. Revue Suisse de Zoologie 38:405-418. Laboissière, V. 1940. Observations sur les Galerucinae des collections du Musée Royal d’Histoire Naturelle de Belgique et descriptions de nouveaux genres et especes. Bulletin du Musée Royal d‘Histoire Naturelle de Belgique 16(25) :1-16. Lovett, J. C. 1993. Climatic history and forest distribution in eastern Africa, pp. 23-29. In: J. C. Lovett and S. K. Wasser (Eds), Biogeography and ecology of the rain forest of Eastern Africa. Cambridge University Press. Middelhauve, J. and T. Wagner 2001. Revision of Afrocrania Hincks, 1949 (Coleoptera: Chrysomelidae, Galerucinae). Part I: Species with head cavities and extended elytral extrusions in males. European Journal of Entomology 98:511-531. Olivier, G. A. 1807. Entomologie, ou histoire naturelles des insects. Coléoptères 6:663. Schmitz, J. and T. Wagner 2001. Afromegalepta gen. nov. from tropical Africa (Coleoptera: Chrysomelidae: Galerucinae). Entomologische Zeitschrift 111:283-286. Stapel, H. and T. Wagner 2000. Revision of Monoleptocrania Laboissière, 1940 (Coleoptera, Chrysomelidae, Galerucinae). Mitteilungen des Internationalen Entomologischen Vereins 25: 137-145.

146

Thomas Wagner

Thomson, J. 1857. Voyage du Gabon. Insects. I. ordre Coléoptères. Archives Entomologiques 2:29-239. Wagner, T. 1997. The beetle fauna of different tree species in forests of Rwanda and East-Zaire, pp. 167-181. In: N. E. Stork, J. Adis and R. K. Didham (Eds.), Canopy Arthropods. Chapman and Hall, London. Wagner, T. 1999a. An introduction to the revision of the Afrotropical Monolepta and related taxa (Galerucinae, Chrysomelidae, Coleoptera). Courier Forschungs-Institut Senckenberg 215:215-220. Wagner, T. 1999b. Arboreal chrysomelid community structure and faunal overlap between different types of forests in Central Africa, pp. 247-270. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology 1. Backhuys Publ., Leiden. Wagner, T. 2000a. New Monolepta species (Coleoptera: Chrysomelidae, Galerucinae) from Eastern Africa. Entomologische Zeitschrift 110:34-40. Wagner, T. 2000b. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part I: species with red and black coloured elytra, pronotum and head, with description of new species. Entomologische Zeitschrift 110:226-237. Wagner, T. 2001a. New Monolepta-species (Coleoptera, Chrysomelidae, Galerucinae) from Central and Southern Africa. Entomologische Blätter 96:199-210. Wagner, T. 2001b. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part II: Species with red head, prothorax and elytra. With description of new species. Bonner Zoologische Beiträge 50:49-65. Wagner, T. 2002a. Revision of Afrotropical Monolepta species (Coleoptera, Chrysomelidae, Galerucinae). Part III: Species with red elytra and yellow prothorax. With description of new species. Deutsche Entomologische Zeitschrift 49:27-45. Wagner, T. 2002b. Biogeographical and evolutionary aspects of Afrotropical Monolepta, Afromaculepta and Bonesioides (Coleoptera, Chrysomelidae, Galerucinae). Cimbebasia 17: 237-244. Weise, J. 1892. Chrysomeliden und Coccinelliden von der Insel Nias, nebst Bemerkungen über andere, meist südostasiatische Arten. Deutsche Entomologische Zeitschrift 1892:385-400. Weise, J. 1893. Chrysomelidae. In: W. F. Erichson, et al.(Eds.). Naturgeschichte der Insecten Deutschlands. 6:569-768, Berlin. Weise, J. 1923. Uebersicht der Galerucinen.Wiener Entomologische Zeitung 40:124. Weise, J. 1924. Chrysomelidae: Galerucinae. In: Junk, W. (Ed.), Coleopterorum Catalogus. 78:1-225, Junk, ‘sGravenhage. Wilcox, J. A. 1973. Chrysomelidae: Galerucinae: Luperini: Luperina. In: Junk, W. (Ed), Coleopterorum Catalogus. Suppl. 78(3):433-664, Junk, ‘s-Gravenhage.

David G. Furth (ed.) 2003 © PENSOFT Publishers Interspecific Differentiation in Eggs and First Instar Larvae in The Genus ... Beetle Biology 147 SpecialProcalus Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 147-153

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus Clark 1865 (Chrysomelidae: Alticinae) Viviane Jerez1 1

Departamento de Zoología, Facultad de Ciencias Naturales y Oceanográficas, Universidad de Concepción. Casilla 160 - C, Concepción, Chile. Email: [email protected]

ABSTRACT The structure and ornamentation of chorion, micropyle, head, eggs bursters and other features in eggs and first instar larvae of six Procalus species are described. Pairs of P. mutans , P. reduplicatus, P. silvai, P. viridis , P. artigasi and P. ortizi , were collected in the field and maintained in plastic cages in order to obtain the eggs and larva. For each species, the structure of chorion, micropyle, head, labrum, mandibles, labium, tarsungulus and egg bursters were examined and described. Chorion ultrastructure and egg bursters were studied with scanning electron microscopy. The results of this study demonstrate that the eggs of Procalus have an exochorion sculptured into polygonal cells; the micropyle is rounded, slightly invaginated with interspecific differences in the number and diameter of aeropyles. Also, differences in the mandible teeth, anterior margin of labrum and tarsungulus are observed. Finally, the egg bursters and chaetotaxy, shows interspecific differences in relation to the position, form and length of the hatching spine and setae.

RESUMEN Se analizó y describió la estructura y ornamentación del corion, micropila, cabeza, ruptor ovi y otras estructuras de los huevos y del primer estadio larvario en seis especies del género Procalus. Para ello, parejas de P. mutans , P. reduplicatus, P. silvai , P. viridis , P. artigasi and P. ortizi , fueron recolectadas en terreno y mantenidas en cajas de crianza para obtener huevos y larvas. Para cada especie, se describió la estructura del corion, micropila, cabeza, labro, mandíbulas, labio, tarsungulus y ruptor ovi mediante microscopía óptica y electrónica de barrido. Los resultados de este estudio muestran que los huevos de Procalus tienen un exocorion esculpido en células poligonales; la micropila es redondeada, débilmente invaginada y con diferencias interespecíficas en el número y diámetro de las aeropilas. También existen diferencias en los dientes mandibulares, margen anterior del labro y tarsungulus. Finalmente en relación a los “ruptor ovi” se encontró diferencias interespecíficas en relación a la posición, forma y largo de la espina de eclosión y del número de setas.

148

Viviane Jerez

INTRODUCTION In insects and especially Coleoptera, the chorionic microsculpture contains important diagnostic characters at the family and generic level. Nevertheless, current systematics studies have not considered the diagnostic value of the egg chorion and micropyle to separate closely related species (Rowley and Peters, 1972; Jerez, 1999a). Otherwise, morphological characters of larvae, might reveal congruence and incongruity into the classification systems proposed for the adults insects that can not to be separated using only imaginal characters (Jerez, 1995, 1996; Reid, 2000). Procalus Clark, 1865 is a genus of flea beetles that comprises nine species, widespread in the Mediterranean Zone of Chile. Lithrea and Schinus species are the host plants and both genera are of the family Anacardiaceae (Jerez, 1999b). A description on the habitat and morphology of eggs and larval stage of genus Procalus, and a complete revision of genus was done by Jerez, 1999 a and b. The egg of Procalus species show a polygonal patterns on the eggshell, that change in the micropilar area. Three larval instars are recognized and clearly distinguished by the width of head capsules and morphological patterns (Jerez, 1999b). My observations in the genus Procalus, have demonstrated interspecific differences exist in the eggshell and in the larval morphology; furthermore there are differences in the chaetotaxy of the eggs bursters. The aim of this paper is to compare the chorionic microsculpture and mycropyle of the eggs and the first instar larvae in all six species of Procalus: P. mutans (Blanchard, 1851), P. viridis (Phil. and Phil., 1864), P. reduplicatus Bechyné, 1951, P. silvai Jerez, 1999a, P. artigasi Jerez, 1999a and P. ortizi Jerez 1999a. MATERIALS AND METHODS To obtain the eggs and first instar larvae, pairs of adults of each species were collected in field and maintained in rearing boxes and provided with food plants. The eggs and larvae were fixed in 70º alcohol. The eggs were dehydrated in pure alcohol, coated with gold, and the chorion ultrastructure was studied with a scanning electron microscope (SEM). The larvae were prepared for observation under optical and SEM following the method described by Jerez (1999). The labrum, mandibles, egg bursters and legs were dissected and illustrated with the aid of a camera lucida adapted to an Olympus microscope. RESULTS Egg Description The eggs of Procalus species are oval in shape, tapering at both ends. The eggshell or chorion is reticulated and displays a layer of polygonal (pentagonal - hexagonal) cells. The polygonal cells are distributed throughout all over the surface of chorion, as seen using SEM except in the micropilar area (Fig. 1). Some species have small pores, uniformly distributed (Fig. 2). The micropyle is located at the anterior end of the egg and can be recognized by its circular and slightly depressed form; a pore is located in the middle. The inner space of the micropyle appears usually smooth or finely reticulated and aeropyles are open and regularly distributed. The aeropyles vary in number and diameter in the species (Fig. 3). The chorion of P. mutans and P. reduplicatus is characterized by the presence of small interpolygonal pores lacking in the remaining species. Eggs of P. mutans, P. viridis, P. silvai, P. artigasi and P. ortizi are

Interspecific Differentiation in Eggs and First Instar Larvae in The Genus Procalus ...

149

Figs. 1-4. Chorion ultrastructure of Procalus eggs. 1. P. ortizi, m: micropyle. 2. P. ortizi, p: pore. 3. P. reduplicatus, ae: aeropyle, pm: micropylar pore. 4. P. silvai, ae: aeropyles, p: pore.

pierced with a few aeropyles around the micropilar area (Fig. 4) and only P. reduplicatus has a lot of aeropyles. The inner space of micropyle is smooth in P. mutans, P. viridis, P. reduplicatus and P. artigasi (Fig. 5) while it is finely reticulated in P. silvai and P. ortizi (Fig. 4). First Instar Larva Diagnosis: The first instar larva is recognized by the curved body, head and prothoracic shield strongly sclerotized and eggs bursters situated on a pair of mesothoracic dorsal sclerites (Jerez, 1999a). Description: Head hypognathous, rounded and strongly sclerotized; epicranium smooth, bearing setae; epicranial suture Y-form; frontal sutures elongate, strongly divergent and slightly curved; frontoclypeal suture obvious; frontal region dorsally depressed. Clypeus rectangular not fused with the labrum. Labrum subcircular and medially emarginate. Antenna two segmented; segment 1 with rigid setae; segment

150

Viviane Jerez

Figs. 5-8. 5. P. viridis, micropilar area, ae: aeropyles; m: micropyle; p: pore. 6. Head capsule of the first instar larva of P. silvai, a: antennae; c: clypeus; fr: frons; la: labrum, m: mandibles; o: ocellus. 7. Chaetotaxy of eggs bursters of P. reduplicatus larvae. ls: long setae; bsp: bursting spine; ss: small setae. 8. Chaetotaxy of the egg bursters of P. mutans larvae. bsp: bursting spine ss: small setae.

2 very small. One stemmata lateral and dorso-lateral to the antennae. Mandibles palmate bearing five apical teeth. Maxillary palpi three segmented; labial palpi two segmented. Thorax rounded laterally, with surface glabrous; prothoracic shield strongly sclerotized, formed by two transverse mid-dorsal plates bearing microsetae. Ecdysial suture well developed. Egg bursters situated dorsolaterally and posterior to mesothoracic spiracle bearing three or four setae (Fig. 7). Mesothoracic spiracle annular and uniforous. Legs short and stout, five segmented, including tarsungulus. Abdomen with eight segments, curved form and rounded in cross section. Cuticle smooth, bearing microsetae. IX segment rounded on the apex, bearing rigid setae. X segment serves as an anal pseudopod. Anal opening vertical. Ambulatory lobes occur ventrally in all abdominal segments. Spiracles annular and uniforous with peritreme obvious. The first instar larvae of the six Procalus species exhibit all the morphological features described in this study. However, there are differences in the mandibular teeth, anterior margin of labrum,


151

form at tarsungulus and number of egg burster setae. Thus, the second mandibular teeth can be quadrangular in P. mutans and P. ortizi, (Figs. 15, 20) or pointed in P. viridis, P. reduplicatus, P. silvai and P. artigasi (Figs. 16, 17, 18, 19). In some species the labrum is sinuate (P. mutans and P. ortizi), (Figs. 9, 14); in others he can be emarginate ( P. viridis, P. reduplicatus, P. silvai and P. artigasi) (Figs. 10, 11, 12, 13). The tarsungulus can be incurved (Fig. 23, 24) or perpendicular to the central axis (Fig. 22, 25). Finally, the egg bursters setae vary in the species. There are three in P. viridis, P. reduplicatus and P. artigasi (Fig. 7) and four in P. mutans, P. silvai and P. ortizi. (Fig. 8). DISCUSSION In Chrysomelidae, the form and chaetotaxy of labrum of the adult and larval stage, are in general important diagnostic characters for all subfamilies (Steinhausen, 1994); however, in the Procalus species analyzed, the labrum form reveals an important diagnostic character at the specific level. The presence of the egg bursters in larvae of first instar, has been useful to separate Alticinae from Galerucinae, because they are lacking in the latter subfamily (Cox, 1994). Thus, this character in Procalus species justifies the inclusion of genus in Alticinae. Furthermore, the analysis of the eggshell,

Figs. 9-14. Labrum of the first instar larvae of the Procalus species. 9. P. mutans. ma: anterior margin; sd: dorsal setae; sl: lateral setae; sm: marginal setae; sbm: submarginal setae. 10 .P. viridis. 11. P. reduplicatus. 12. P. silvai. 13. P. artigasi. 14. P. ortizi .

152

Viviane Jerez

Figs. 15-20. Mandibles of the first instar larvae of the Procalus species. 15. Teeth of P. mutans. 16. P. viridis. 17. P. reduplicatus. 18. P. silvai. 19. P. artigasi. 20. P. ortizi.

Figs. 21-26. Tarsungulus of the first instar larvae of the Procalus species. 21. P. mutans, sm: medial setae; h: hook. 22. P. viridis. 23. P. reduplicatus. 24. P. silvai. 25. P. artigasi. 26. P. ortizi.


153

micropyle, labrum, mandibles, tarsungulus and egg bursters demonstrate the usefulness of these structures as taxonomic and phylogenetic markers. ACKNOWLEDGEMENTS The author is grateful to David Furth for his encouragement and for correcting and revising the manuscript. This research was supported by FONDECYT 1940995 and Grant DIUC 200.113.055 - 1.0. Finally, I am very grateful to the members of the Electronic Microscopy Laboratory of the University of Concepción. LITERATURE CITED Cox, M. L. 1994. Egg bursters in the Chrysomelidae, with a review of their occurrence in the Chrysomeloidea (Coleoptera), pp. 75-110. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers. 582 pp. Jerez, V. 1995. Stenomela pallida Erichson, 1847. Redescripción, ontogenia y afinidad con el género Hornius (Chrysomelidae - Eumolpinae). Gayana Zool. 59(1):1-12. Jerez, V. 1996. Biology and phylogenetic remarks of the subantarctic genera Hornius, Stenomela, and Dictyneis (Chrysomelidae - Eumolpinae), 3:239-258. In: P. Jolivet, and M. L.Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishing. 365 pp. Jerez, V. 1999a . Filogenia y Biogeografía del Género Procalus Clark, 1865, (Coleoptera - Chrysomelidae) y su relación con Anacardiaceae. Tesis Doctoral. Universidad de Concepción. 300 pp. Jerez, V. 1999b. Biology and ecology of the genus Procalus Clark, 1865, endemic to the andinopatagonian region (Alticinae), pp. 545 - 555. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publishers, Leiden, The Netherlands, 671 pp. Jerez, V. 2000. Microescultura coriónica en huevos de Lysathia atrocyanea (Phil. and Phil.) (Coleoptera: Chrysomelidae). Rev. Chilena Ent. 27:75 - 78. Nordell - Paavola, A.; S. Nokkala; S. Koponen and C. Nokkala 1999. The utilization of chorion ultrastructure and chorion polypeptide analysis in recognizing taxonomic units in north european Galerucini (Col. Chrysomelidae), pp. 95 - 104. In: M. L. Cox (Ed.), Advances in Chrysomelidae Biology I. Backhuys Publishers, Leiden, The Netherlands, 671 pp. Reid, C. A. M. 2000. Spilopyrinae Chapuis: a new subfamily in the Chrysomelidae and its systematic position placement (Coleoptera). Invertebrate Taxonomy 14:837-862. Rowley, W. A. and D.C. Peters. 1972. Scanning Electron Microscopy of the eggshell of four species of Diabrotica (Coleoptera: Chrysomelidae). Ann. Ent. Soc.Amer. 65(5):1188-1191. Steinhausen, W. 1994. Larvae of palearctic Timarcha Latreille, 1:119-125. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers. 582 pp.

24



© PENSOFT Publishers Feeding Behavior of Sofia - Moscow

David G. Furth (ed.) 2003 Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ... Beetle Biology 155 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 155-159

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima sericea (Malpighiaceae) Vivian Flinte1, Margarete V. Macedo1, Ricardo C. Vieira2, and Jay B. Karren3 1

Laboratório de Ecologia de Insetos, Depto. de Ecologia, CP 68020, IB, UFRJ, Rio de Janeiro, Brasil. Email: [email protected] 2 Laboratório de Anatomia Fisiológica, Depto. de Botânica, IB, UFRJ, Rio de Janeiro, Brasil 3 Dept. of Biology, Utah State University Extension, Utah, USA

ABSTRACT Adults and larvae of Fulcidax monstrosa feed on Byrsonima sericea, chewing its stems. The histological analysis of attacked stems shows that F. monstrosa feeds on the upper layers of tissue with a rasping action, consuming the following tissues from the outside to the inside: periderm, cortical parenchyma and phloem, stopping exactly at the outer layer of the xylem. Often the stem is chewed along its whole circumference, and since the phloem is the vascular tissue which transports organic substances to the entire plant, its removal leads to death and drying up of the attacked stems. The larvae are responsible for most of the damage on the host plant, since they are more numerous and are restricted to a relatively few young stems.

RESUMO Adultos e larvas de Fulcidax monstrosa se alimentam de Byrsonima sericea, raspando seus ramos. A análise histológica de ramos jovens e de ramos mais velhos mostra que F. monstrosa raspa as camadas superiores de tecido, consumindo, de fora para dentro, os seguintes tecidos: periderme, parênquima cortical e floema, parando exatamente na fronteira do xilema. Freqüentemente, o ramo é raspado em toda a sua circunferência e, como o floema é o tecido vascular que trasporta as substâncias orgânicas para toda a planta, a sua remoção causa a morte e o ressecamento dos ramos atacados. As larvas são responsáveis pelo maior dano à planta, já que são mais numerosas e ficam restritas aos ramos. INTRODUCTION Chlamisinae includes small, robust and cylindrical beetles, which have the head hidden under the prothorax almost to the eyes. When disturbed, they retract their legs into grooves on the underside of the body and fall to ground, remaining motionless (Borror and DeLong, 1969). Many of them exhibit metallic brilliant colors and protuberances on the surface of the body. The larvae are enclosed

156

Vivian Flinte, Margarete V. Macedo, Ricardo C. Vieira & Jay B. Karren

in a case made of their own excrement and move about with this case, which serves as a shelter. Because the case is smaller than the body, the abdomen is folded in a U-shape inside the case. Pupation takes place in this fecal case. Fulcidax monstrosa was first described from Cajennae (Guyana) by Fabricius (1798) as Clythra monstrosa, who referenced Olivier’s Clythra monstrosa. It appears that Olivier’s name was not applied to a properly described specimen, so the original description is attributed to Fabricius. Later, it was cited with different names by several authors: Chlamys monstrosa Olivier (1808), Fulcidax azureus Voet (1806), Poropleura monstrosa Lacordaire (1848) and finally Fulcidax monstrosa Blackwelder (1946), with distribution in Brazil and Guyana. F. monstrosa is one of the largest species in the subfamily, dark blue colored, brilliant on the top and dull on the venter, with a strong elevation on the pronotum and many irregular excavations in four series on the elytra (Costa Lima, 1955). The female lays single eggs on young stems of its host plant Byrsonima sericea, then covers it with her excrement. When the larva hatches it uses the fecal covered eggshell as its first shelter. As it begins to feed, it adds more excrement layers to accommodate its growth and development (Erber, 1988; Olmstead, 1994). There is evidence (Wallace, 1970) that the excrement case of one species of Chlamisus helps protect its larvae from attacks by ants. Byrsonima sericea DC. is a member of the family Malpighiaceae and can occur in the form of a bush or a tree in the restinga (coastal sand dunes). The leaves are green on the adaxial surface and golden and pilose on the abaxial surface. The older stems exhibit a gray coloration while the young ones are green. The geographic distribution of B. sericea is restricted to Martinique and, in Brazil, to the states of Ceará, Piauí, Pernambuco, Sergipe, Bahia, Goiás, Espírito Santo, Minas Gerais, Rio de Janeiro and Paraná (Pereira, 1953). Field observations showed that adults and larvae of F. monstrosa feed on B. sericea and plants on which larvae were found had a considerable number of dried up stems. Our study describes the feeding behavior of F. monstrosa and the effect of this type of feeding on the host plant B. sericea. MATERIAL AND METHODS The behavioral field observations of F. monstrosa were made in Macaé (22o 19’S and 41o 44’W) at the National Park of Jurubatiba Restinga, RJ, Brazil, in an area where the host plant B. sericea is abundant. The restinga is an environment of coastal sand dunes and contains an enormous diversity of habitats e.g. bush restinga, paludous restinga, forests, swamps, rivers, lagoons and others. The ecological importance of the littoral area included between the municipal districts of Macaé and Quissamã was already recognized in 1992 by UNESCO, who considered this area as a “reserve of the biosphere”. Histological analysis of non-attacked stems on advanced secondary growth (older ones) and of attacked and non-attacked stems on initial secondary growth (younger ones) was made to evaluate the damage caused by F. monstrosa on its host plant. The stems were collected soon after being fed upon by F. monstrosa and fixed in alcohol 70GL. Cross sections 20mm thick were cut from samples of non-attacked older stems using a sliding microtome. Samples of the younger attacked and non-attacked stems were free hand cross cut. The sections of both samples were stained with the Safrablau technique (Bukatsch, 1972). To verify the presence of starch in the stem tissues, a drop of IKI (Iodine- Potassium Iodide) was placed onto the free-hand sections for more than five minutes (Ruzin, 1999).

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ...

157

RESULTS AND DISCUSSION Besides B. sericea, there are at least four other species of Malpighiaceae at the National Park of Jurubatiba Restinga, but F. monstrosa was only found feeding on B. sericea. The same happened at the Restinga of Jacarepiá, RJ, where F. monstrosa only occurred on the same host plant. While F. monstrosa seems to be monophagous in these areas, there are records of other species of the genus feeding on more than one Malpighiaceae species (Jolivet and Hawkeswood, 1995). F. monstrosa females lay their single eggs on young stems of B. sericea (Fig. 1A). Larvae hatch from the round excrement case wherein the egg was located and starts feeding upon the stems. Often the whole circumference of the stem is chewed by the larva (Fig. 1B), causing the death of the attacked stem from its damaged point to the top. Upon completion of its development the larva closes the case and pupates within it (Fig. 1C). The anatomical cross section of older stems shows the following tissues: periderm; cortical parenchyma with sclereids, fiber bundles and crystalliferous idioblasts with prismatic crystals; phloem; well-developed xylem and medullar parenchyma (Fig. 2A). In contrast, the younger stem has a smaller medulla, a less developed xylem ring and a fiber ring that surrounds the phloem (Fig. 2B); in

Figure 1. (A) Female of Fulcidax monstrosa ovopositing on a stem of Byrsonima sericea. Scale: 20mm; (B) Stem of B. sericea chewed in its whole circumference. Scale: 3mm; (C) Pupa of F. monstrosa. Scale: 5mm.

Figure 2. Cross sections of an older stem (A) and of a younger stem (B) of Byrsonima sericea. (A) The older stem has fiber bundles dispersed in the cortical parenchyma and presents a thicker xylem. Scale: 300µm; (B) The chewing of Fulcidax monstrosa stops exactly at the outer layer of the xylem. Scale: 150µm. P = periderm; C = cortical parenchyma; F = fiber ring; Ph = phloem; X = xylem; M = medulla; FB = fiber bundles.

158

Vivian Flinte, Margarete V. Macedo, Ricardo C. Vieira & Jay B. Karren

Figure 3. Dried up stems of Byrsonima sericea which have been chewed by Fulcidax monstrosa larvae.

addition, trichomes can be found on the epidermis. The anatomical section of an attacked stem (Fig. 2B), clearly shows that the beetle chews, from the outside to the inside, the following tissues: periderm, cortical parenchyma, fiber ring and phloem, stopping exactly at the outer edge of the xylem. The phloem is probably the most nutritional valuable tissue for F. monstrosa, since it is the vascular tissue responsible for the transport of organic substances such as sugars and hormones. The IKI test proved that starch is not used for the nutrition of F. monstrosa because it only occurs in the medullar parenchyma. With the removal of the phloematic tissue, the transport of organic substances is interrupted, compromising the survival and development of the young stems, leading to their death and desiccation. Field and laboratory observations showed that both larvae and adults of F. monstrosa feed preferably on young stems, probably because of the less lignified cortex. A significant number of dried up stems, which show signs of the characteristic feeding of F. monstrosa can be found on one single plant, showing that the damage to the host plant is not restricted to the loss of the consumed tissues (Fig. 3). The anatomical sections also reveal that adults and larvae chew the same plant tissues. The larvae are responsible for most of the damage on the host plant, since they are less mobile, are not capable of flying, and are more numerous. Consequently, each larva is restricted to a few stems of the plant and tends to chew until completely girdling the stem. Adults, however, are often feeding on several different stems, not strongly damaging each one. ACKNOWLEDGMENTS Financial support came from CNPq/PELD and FAPERJ. Vivian Flinte has a scholarship from CNPq/PIBIC.

Feeding Behavior of Fulcidax montrosa (Chlamisinae) on Its Host Plant Byrsonima ...

159

LITERATURE CITED Blackwelder, R. E. 1946 Checklist of the Coleopterous insects of Mexico, Central America, the West Indies and South America. Part 4. Bull. U. S. Nat. Mus. 185:551-763. Borror, D. J. and DeLong, D. M. 1969. Introdução ao Estudo dos Insetos. pp. 260-262. Editora Edgard Blücher Ltda. São Paulo. 653pp. Bukatsch, F. 1972. Bemerkung zur Doppelfarbung Astrablau-Safranin. Mikrokosmos 61(8):225. Costa-Lima, A. 1955. Insetos do Brasil. 9o Tomo. Coleópteros. 3a Parte. Escola Nacional de Agronomia, 289pp. Erber, D. 1988. Biology of Camptosomata. Clytrinae-Cryptocephalinae-Chlamisinae-Lamprosomatinae [pp. 513-552]. In: P. H. Jolivet, E. Petitpierre, T. H. and Hiaso (eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. 640pp. Fabricius, J. C. 1798. Supplementum Entomologiae Systematicae Hafniae. 572pp. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the world. An Essay about the Relationships between the Leaf-beetles and their Food-plants. Backhuys Publishers Leiden. 281pp. Lacordaire, J. T. 1848. Monographie des Coléoptères Subpentamères de la Famille des Phytophages, Vol. 2. Mém. Soc. Roy. Sci. Liège. Vol 5. 890pp. Olivier, A. G. 1808. Entomologie ou histoire naturelle des insectes, avec leurs caractères générique et spécifiques, leur description, leur synonymie, et leur figure enlumineé. Coléoptères vol. 6. Paris. Olmstead, K. L. 1994. Waste products as chrysomelid defenses [pp. 311-318]. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, The Netherlands. xxiii + 582pp. Pereira, E. 1953. Contribuição ao conhecimento da Família Malpighiaceae. Arquivo do Serviço Florestal, RJ. Ministério da Agricultura, Vol. 7. 70pp. Ruzin, S. E. 1999. Plant Microtechnique and Microscopy. New York. Oxford University Press. 322pp. Voet, J. E. 1806. Catalogus Systematicus Coleopteroum. Vol. 2. La Haye. Wallace, J. B. 1970. The defensive function of a case on a chrysomelid larva. J. Georgia Ent. Soc. 5:19-24.

24



© PENSOFT Publishers Natural Enemies Sofia - Moscow

David G. Furth (ed.) 2003 of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ... Beetle Biology 161 Special Topics in Leaf Proc. 5th Int. Sym. on the Chrysomelidae, pp. 161-173

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and Their Phenology Flávia Nogueira-de-Sá1,2 and João Vasconcellos-Neto1 1 Universidade Estadual de Campinas, Institute of Biology, Department of Zoology. Campinas, SP, Brazil, 13083-970. 2 Graduate Program in Ecology, Universidade Estadual de Campinas, SP, Brazil. Email: [email protected]

ABSTRACT Three species of Cassidinae, Stolas chalybea, Stolas areolata and Anacassis phaeopoda (Tribe Stolaini), were investigated to better understand their interactions with natural enemies in a tropical forest. The majority of parasitoids reared from these species were Hymenoptera, but some dipterous parasites were also observed on larvae of the three species. The only parasite reared from adults was a nematode. Some heteropterans and arachnids preyed on adults and larvae. A one-year census of invertebrates on host plants of targeted Cassidinae revealed that the abundance of potential predators fluctuated synchronously with the abundance of the beetles, sometimes with a small lag. This suggests that populations of invertebrate predators may have an influence on the regulation of Cassidinae populations. Our results support the well-accepted hypothesis that natural enemies do control herbivore populations.

RESUMO Três espécies de Cassidinae, Stolas chalybea, Stolas areolata e Anacassis phaeopoda (Tribo Stolaini), foram investigadas em uma floresta tropical para melhor se entender suas interações com inimigos naturais. A maioria dos organismos parasitas obtidos destes cassidíneos foram Hymenoptera, mas nós também observamos Diptera em larvas das três espécies. O único parasita observado em adultos foi um nematódeo. Alguns heterópteros e aracnídeos foram observados predando adultos e larvas. Um ano de censo de invertebrados nas plantas hospedeiras dos Cassidinae estudados revelou que a abundância de predadores potenciais flutuou sincrônicamente com a abundância dos besouros, algumas vezes com um atraso. Isto sugere que as populações de predadores invertebrados podem influenciar a regulação das populações de Cassidinae. Nossos resultados apoiam a hipótese de que inimigos naturais controlam populações de herbívoros. INTRODUCTION The importance of natural enemies in controlling herbivore populations was emphasized in the 1960 “landmark” paper by Hairston, Smith and Slobodkin. According to these authors, populations of herbivores are unlikely to be limited by food supply or by fluctuations in climate. Recent work upholds

Flávia Nogueira-de-Sá & João Vasconcellos Neto

162

the importance of predators and parasitoids in the suppression of many phytophagous insect populations (Oksanen and Ericson, 1987; Denno et al., 1990; Hawkins et al., 1997; Keese, 1997; Cornell et al., 1998). Cox (1996) further points out that predators and parasitoids are not mutually exclusive; other authors contend that predation and parasitism are inversely related (see Keese, 1997; Monteiro, 1981 for examples). Losses suffered by parasitoid populations due to predation of their hosts may depend on the degree to which the risks of predation and parasitism covary (Memmott et al., 1993). Due to the large impact predators and parasitoids exert on populations of phytophagous insects, including chrysomelids, many programs for biological control have been successful (Cox, 1996). Natural enemies have imposed a selective pressure on Cassidinae. Therefore, they influenced diverse physical, behavioral and possibly chemical adaptations for defense. Despite these attributes, Table 1. List of taxonomic groups of natural enemies of Chrysomelidae at egg, larval, pupal and adult stages of development and their respective effects on their prey/hosts. Taxa of natural enemy

Stage of development of the beetle - Effect Protozoa (Microsporidia and Eggs, larvae and pupae – Intracellular Gregarines) parasite, extremely pathogenic Ants (Formicidae) Egg – Predator Hymenopterans (e.g. Egg – Parasitoid, heavily impact Eulophidae and Tetracampidae) populations. Bacteria (Bacillus) Larvae - Parasite Nematodes (Mermithidae) Larvae and adults - Parasite, kill hosts. Virus Larvae and adults – Intracellular parasite, causes pathological damage or significant mortality. Hymenopterans (e.g. Larvae – Parasitoid Ichneumonidae and Pteromalidae) Diptera:(Tarchinidae) Tachinidae Larvae – Parasitoid

Hymenopterans (Mutilidae and Eumenidae) Spiders (Theridiidae and Thomisidae) Hetropterans (Pentatomidae and Reduviidae)

Larvae – Predator

Beetles (Carabidae) Hymenopterans (Chalcididae and Pteromalidae) Fungi (Laboulbeliales) Flies (Tachinidae)

Larvae - Predator Pupae – Parasitoid

Birds

Adults - Predator

Larvae - Predator Larvae - Predator

Adults - Parasite, low damage Adults – Parasitoid

Example of reference Toguebaye et al., 1988; Theodoridès, 1988 Windsor, 1987; Olmstead, 1996 Cox, 1994; Olmstead, 1996 Peterson and Schalk, 1994. Poinar, 1988 Selman, 1988 Cox, 1994 Olmstead, 1996; Logan et al., 1987; Cappaert et al., 1991a; Charlet, 1992; Heineck-Leonel and Salles, 1997; Keese, 1997. Cox, 1994 Kosior, 1975 (as cited in Olmstead, 1996) Windsor, 1987; Logan et al., 1987; Cappaert et al., 1991a; Cloutier and Bauduin, 1995; FrieiroCosta, 1995; Cox, 1996; Paleari, 1997; Nogueira-de-Sá and Macêdo, 1998 Eisner and Eisner, 2000 Cox, 1994; Nogueira-de-Sá and Macêdo, 1998 Balazuc, 1988 Kosior, 1975 (as cited in Olmstead, 1996) Chittenden, 1924; Yeung, 1934 (both as cited in Olmstead, 1996)

Natural Enemies of Neotropical Cassidinae (Coleoptera: Chrysomelidae) and ...

163

natural enemies can heavily impact tortoise beetle populations in the field (Olmstead, 1996). Life tables and population studies of various Cassidinae species indicate that most enemy-induced mortality takes place in the egg or larval stage. Roughly 65% of reported enemy-cassidine interactions involve larvae and pupae (Olmstead, 1996). Most records for insect enemies of Chrysomelidae are from the Holartic, with far fewer records coming from the tropical regions of the New World, Africa, and Asia (Cox, 1996). Considering such data it is possible to notice that natural enemies of Chrysomelidae are represented by organisms of many different taxa. They vary from intracellular parasites to large avian predators (see examples of most frequent ones at Table 1 or see a more extent list at Cox (1994) and Olmstead (1996)). Besides, these data suggest that Cassidinae is the most frequently parasitized subfamily among the Chrysomelidae (Olmstead, 1996). Cox (1994) attributed this to the sedentary behavior of larvae, hence their predictability on host plants. Abundance of enemies of Cassidinae is another important parameter in chrysomelid mortality to be taken into account. There is evidence that predation and parasitism are density-dependent interactions and that populations of natural enemies are synchronized to that of their prey. Charlet (1992) observed that Myiophanus macellus (Reinhard) (Diptera: Tachinidae), a larva parasitoid of Zygogramma exclamationis (F.) (Chrysomelidae), showed synchrony with its host and a functional response to larval populations, maintaining even rates of parasitism. Cappaert et al. (1991b) detected a significant correlation between number of eggs of Leptinotarsa decemlineata (Say) and predators (or group of predators), suggesting a synchrony between them. During this study the peak of predator abundance coincided with the peak of beetle oviposition, sometimes with a small lag. A significant relationship was also detected between egg density and the rate of egg damage. According to the authors, these observations indicate that predation of L. decemlineata is density-dependent. Considering the importance of predation records Neotropical Chrysomelidae and the earlier evidence of synchony between enemies and hosts we studied the parasitoids, parasites and predators attacking the cassidines Stolas chalybea (Germar), S. areolata (Germar), and Anacassis phaeopoda Buzzi. Our objectives were to identify the natural enemies and to follow populations of hosts and Cassidinae prey in an Atlantic forest area in Brazil. MATERIALS AND METHODS Study Area This work was conducted at Serra do Japi (23° 11’S/46° 52’ W), a mountain ridge located at the southern limit of the tropical zone in São Paulo state, Brazil. This site was chosen because of the rich community of Chrysomelidae that inhabits the area. The climate in the region corresponds to the subtropical moist type, with two distinct seasons: a warm and rainy summer and a cold and dry winter. The forest is seasonal with the period of leaf fall from April to September, approximately (Leitão-Filho, 1992). During this same period, populations of insects are lower (F. Nogueira-de-Sá and J. Vaconcellos-Neto, personal observation). Natural Enemies Mortality during egg stage for each cassidine species was estimated by the difference between average number of individuals per egg cluster and larval groups. To estimate mortality during the larval stage, we considered the difference between the average number of individuals per three

164


classes of development: larvae in the first and second instar, larvae in the third and fourth instar and larvae in the fifth instar. Because the three species of Cassidinae were specialist on their host plants at Serra do Japi, data was obtained by censusing 60 individuals of Calea pinnatifida (R. Br.) Less. (Asteraceae) and Mikania cordifolia (L.f.) Willd. (Asteraceae), host plants of S. chalybea and S. areolata respectively, and 30 individuals of Baccharis trimera DC. (Asteraceae), host plant of A. phaeopoda, every fifteen days, from October, 1997 to September, 1998. In the census, we visually inspected each host plant, recording the number of individuals in each group of eggs or larvae encountered. During the summer, around every week from December until March, we collected egg clusters, larvae and adults of S. chalybea, S. areolata and A. phaeopoda (for this species egg clusters were not collected) and maintained in laboratory conditions (room temperature, humidity and photoperiod) to obtain their parasitoids. The beetles were reared in plastic boxes (11 cm height, 10 cm ∅) and we provided them with new leaves of their host plant every other day. Beetles were also inspected every two days for parasitoid emergence. Eggs were maintained until hatching, larvae were maintained until pupation and adults were reared for a month. Because egg clusters of S. chalybea were more abundant and easier to find in the field, to know the fate of eggs, we recorded the number of eggs infected by fungi, parasitized, preyed upon or hatched (these last three conditions were evaluated by marks on the eggs) from every egg cluster found during study period (not only on censused host plants). Abundance of Natural Enemies on Host Plants The influence of natural enemies on the three cassidine species was evaluated during the census described earlier, by recording the number of potential predators of the cassidines found on host plants. Predator species found in less than 10% of the plant censuses were not included in the analysis below. Therefore we only considered heteropterans, spiders and ants, which were the main potential predators found on the host plants. We only recorded the organisms that we considered able to kill the beetles in any stage of their development. The Spearman rank correlation index was used to determine the relationship, if any, between the abundance of the three beetle species and main potential predators in the area. We tested Cassidinae abundance (using data of Nogueira-de-Sá and Vasconcellos-Neto, 2003) versus the number of plants with predators in each census, and Cassidinae abundance versus the number of predator morphospecies observed in each census. We also correlated abundance of each of the three species with lags of 30, 45, 60 and 75 days (Lags 1, 2, 3 and 4) versus the abundance of their potential predators. Organisms Studied Host plants and insects were identified by specialists and voucher specimens are deposited in collections their respective institutions. RESULTS Natural Enemies We estimated that the greatest mortality of S. chalybea, S. areolata and A. phaeopoda was between the egg phase to 1st and 2nd instar larvae. The average number of larvae in groups at that stage was


165

66.98%, 87.5% and 65.65% lower than the average number of egg in clusters of S. chalybea, S. areolata and A. phaeopoda respectively (Fig. 1). Decrease in the mean size of larval groups was also observed between 1st-2nd instar larvae and 3rd-4th instar larvae (42.46%,and 11.5% for S. chalybea and A. phaeopoda respectively) and between 3rd-4th and 5th instar larvae, it was of 20.20% and 39.91% for S. chalybea and S. areolata respectively (Fig. 1). Infection by fungi, parasitism and predation together accounted for the death of 60.58% of S. chalybea eggs in the field (n=319 eggs) (Fig. 2). We obtained six different parasitoid species from eggs, all Microhymenoptera. Two other species were phoretic on S. chalybea elytra (Table 2). Phoretic parasitoids were not commonly observed. Only two species were reared from the eggs of S. areolata (Table 2). Neither species parasitized all eggs in a cluster. We have not investigated the occurrence of parasitoids from the eggs of A. phaeopoda at Serra do Japi because they were too rare. We obtained the same species of Tachinidae (Diptera), Eucelatoria parkeri (Sabrosky), as a larval parasitoid from S. chalybea and A. phaeopoda (Table 2).We obtained a second species of Tachinidae from larvae of S. areolata (Table 1), which infected all larvae within a single group. The nymphs of the pentatomids, Stiretrus decemguttatus (Lepeletier and Serville)) and Oplomus catena (Drury) (Hemiptera: Pentatomidae: Asopinae), and some other non-identified Asopinae nymphs

20 18

S. chalybea

No. individuals/group

16

S. areolata A. phaeopoda

14 12 10 8 6 4 2

*

*

0 Egg cluster

1st-2nd instar 3rd-4th instar

5th instar

Fig. 1. Mean and standard deviation of the number of individuals per group of each developmental stage found on their host plants in the field (Atlantic forest, Brazil). * Standard deviation could not be calculated because n= 1.

166


% of eggs

40 30 20 10 0 Predator

Fungi

Parasitoid

Alive

Fig. 2. Fate of Stolas chalybea eggs (n=319) in the field.

Table 2. Egg and larval parasitoids of Stolas chalybea, S. areolata and Anacassis phaeopoda found at Serra do Japi, SP and their rate of parasitism. Parasitoid species EULOPHIDAE (HYMENOPTERA) Emersonella sp.1 Emersonella sp.2 Emersonella sp.3* Emersonella sp.4 Tetrastichus sp. Paracryas sp. 1 Paracryas sp. 2* ENCYRTIDAE (HYMENOPTERA) Ooencyrtus sp. TACHINIDAE (DIPTERA). Eucelatoria parkeri Tachinidae sp. % of parasitism Egg parasitoids** Larva parasitoids** Adult parasitoids**

S.chalybea Egg Larva

S. areolata Egg Larva

X X X X X X X

X

A. phaeopoda Egg Larva

X

X X 51.93 (n=181) 19.39 (n=98) 0 (n=100)

X 28.57 (n=84) 46.15 (n=26) 0 (n=30)

X Not investigated 20 (n=5) 0 (n=7)

* Phoretic species. ** Sample size (n) corresponds to the number of hosts examined.

preyed upon S. chalybea larvae. Some species of spiders, like a species of Misumenops F. O. P. Cambridge (Thomisidae) and Achearanea tesselata (Keyserling) (Theridiidae) for example, also preyed upon larvae. Adults S. chalybea were observed attached to the web of Nephila clavipes (Linneaus) (Tetragnathidae) (R. Xavier, personal communication), and also to the webs of other unindentified spiders. The nematode, Hexamermis sp. (Mermithidae), parasitized 3% of adults of S. chalybea (n=100). It was not reared from the other two species of cassidines.


167

We did not detect in the field any natural enemy that would weaken the beetles instead of killing them; besides we did not observe any cassidine that did not seem to be “healthy”. In the absence of predators and under laboratoy conditions, mortality rates of larvae and adults of S. chalybea were 5.2% (n= 77) and 10% (n= 50), and of S. areolata were 16.67% (n= 12) and 10% (n= 30). Abundance of Potential Predators on Cassidinae Host Plants Ants (Formicidae) attending Aleyrodidae homopterans or foraging on plants, spiders and heteropterans (especially Pentatomidae) were the most frequent predators found on Cassidinae host plants. Censuses of host plants of S. chalybea, S. areolata and A. phaeopoda over the course of a year showed that potential predators were not found all year round. The temporal occurrence of predators was similar on the three host plant species (Fig. 3). Abundance of potential predators of cassidines on C. pinnatifida and on M. cordifolia were positively correlated with the abundance of their prey, S. chalybea and S. areolata (Table 3). No significant correlation was detected for the potential predators of A. phaeopoda on its host plant B. trimera. DISCUSSION This study confirms the large variety of potential enemies of Cassidinae. However, we add new records of the natural enemies attacking beetles on different stages of development and some peculiarities of the interactions. For instance, rates of S. areolata egg parasitism were lower in this study than indicated by some records in the literature. We observed that 28.57% of S. areolata eggs were parasitised, whereas Carroll (1978) and Paleari (1997) found egg parasitism rates of 37.93 and 88%, respectively. On the other hand, Nakamura and Abbas (1989) observed that eggs of two species of Aspidomorpha (A. miliaris (Fabricius) and A. sanctaecrucis (Fabricius)) were parasitized by one species of parasitoid each [respectively Tetrastichus Haliday sp. (Eulophidae), Cassidocida aspidomorphae Crawford (Tetracampidae)] and at rates of 39.8% and 27.7%, respectively. The relatively low abundance of the S. areolata population and the habit of ovipositing on neighboring plants Table 3. Correlation between the abundance of Stolas spp. and the number of host plants with potential predators and the number of species of predators throughout 1997 -1998 in an Atlantic forest area in Brazil.

Species

Development phase**

S. chalybea

Eggs Larvae Lag 2 adults Eggs Lag 2 eggs Lag 4 eggs

S. areolata

Number of Plants with Predators X Cassidinae 0.549* (n= 20) 0.458* (n= 20) Ns (n= 18) Ns (n= 20) 0.596* (n= 18) 0.647* (n= 16)

Number of species of Predators X Cassidinae 0.580 (n= 20) Ns (n=20) -0.480* (n= 18) 0.489* (n= 20) Ns (n= 18) 0.669* (n= 16)

* r significant at p< 0,05. ns.- non significant ** For every development phase, we also tested the correlation between Cassidinae with 1, 2 , 3 and 4 Lag periods and Number of plants with predators and between Cassidinae and number of species of predators. Results not mentioned in the table above were not significant on both correlations.

168


Predator/Plant

Calea pinnatifida Hemiptera Spider Ant

1,4 1,2 1 0,8 0,6 0,4 0,2 0

O

N

D

J

F

M

A

M

J

J

S Time

Predator/Plant

Mikania cordifolia Hemiptera Spider Ant

1,4 1,2 1 0,8 0,6 0,4 0,2 0 O

N

D

J

F

M

A

M

J

J

S Time

Predator/Plant

Baccharis trimera 1,4 1,2 1 0,8 0,6 0,4 0,2 0

Spider Ant

S

0

N

D

J

F

M

A

M

J

A

S Time

Fig. 3. Frequency of potential predators of Stolas chalybea, S. areoloata and Anacassis phaeopoda found on their host plants The number of individuals of Baccharis trimera censused was half the number of each of the other species.

(Nogueira-de-Sá and Vasconcellos-Neto, 2003) may explain the low parasitism. This latter factor may reduce the likelihood that they will be found by parasitoids that use plant chemical cues to find their herbivorous hosts (Vinson, 1976; Rowell-Rahier and Pasteels, 1992; Köpf et al., 1997 and


169

Meiners and Hilker, 1997). However, predation on S. areolata eggs of this species was not quantified. Although the studies of Carroll (1978) and Paleari (1997) were conducted in the Amazon region, well known for its high biodiversity, we observed in the Atlantic forest a higher diversity of parasitoids attacking Cassidinae eggs. Species of Emersonella Giralt (Eulophidae) represented 50% of the species of egg parasitoids that we obtained. This genus has been frequently collected by other authors (e.g. Carroll, 1978; Nakamura and Abbas, 1989; Frieiro-Costa, 1995 and Paleari, 1997) and causes high mortality eggs in the field. Most cases indicate that Emersonella attacks Cassidinae species in the tribe Stolaini, the same of Stolas Billberg and Anacassis Spaeth. According to Paleari (1997), similarity of host body size and shape and reproductive potential are characteristics that might explain the susceptibility of more than one species of Cassidinae to parasitism by Emersonella spp. Parasitism of eggs of different species by the same parasitoid species is quite common (M. Tavares, personal communication). Mortality was highest during the egg stage probably due to the wider diversity of natural enemies. Parasitism, fungi infection and predation had similar impact on eggs of S. chalybea. The main Cassidinae egg predators are hymenopterans, hemipterans and arachnids according to Olmstead (1996). These groups were very common on the studied host plants. Ant predation might have been the most influential mortality factor because we observed many host plants with ants (especially Myrmicinae and Ponerinae) attending nymphs of Aleyrodidae homopterans. The hemipteran bug, Stiretrus decemguttatus, which was observed preying on larvae of S. chalybea, may be also a potential predator of eggs. According to Paleari (1997), most records of this species suggests that it mostly preys on eggs and pupae, and is restricted to Chrysomelidae. In the literature, larval parasitism rates are highly variable in time. The Tachinidae, Myiophanus macellus (Reinhard), parasitized larvae of Zygogramma exclamationis at rates varying from 0 to 100% during different study years (Charlet 1992). Different authors, studying Tachinidae parasitism on different species of Chrysomelidae [like Leptinotarsa decemlineata (Cappaert et al., 1991a), Zygogramma exclamationis (Charlet, 1992) and Diabrotica speciosa (Germ.) (Heineck-Leonel and Salles, 1997)], also found completely different rates of parasitism in the course of a single year or in different years. Therefore, a single year data, as we present at this study, may not reflect parasitism patterns for longer periods. Our observation of a single tachinid species (Eucelatoria parkeri Sabrosky) attacking different prey species (Stolas chalybea and Anacassis phaeopoda, as presented here and S. fuscata (Klug) and S. prolixa (Boheman) (Guimarães, 1977)) is not uncommon in nature. Other species of Eucelatoria Townsend attack at least four different genera of Neotropical Chrysomelidae (Guimarães, 1977). Other cases of tachinids parasitizing different species of Chrysomelidae were reported by Logan et al. (1987) and Keese (1997). Many authors consider predation as the most important mortality factor for phytophagous insects (Bernays, 1997; Gomes-Filho, 1997 and Hawkins et al., 1997). There are some examples in which low parasitism is compensated by predation (see Monteiro, 1981 and references therein). Invertebrate predators are often considered generalized feeders, and the presence of these generalist species in the field increases the chances of predation. In our case, ants and pentatomid heteropterans were the most common invertebrate predators of Cassidinae found in the field, thus we expect that they caused high mortality. Ants that attack larvae and pupae have a substantial impact on populations of Cassidinae (Olmstead, 1996). However, Carroll (1978) has observed that only young larvae fall victim to foraging ants. Although we did not observe any ant attack during our study, we only observed older larvae being preyed upon by pentatomid bugs. Paleari (1997) describes a similar

170


situation: attacks on fourth and fifth instar larvae of Botanochara sedemcimpustulata (Fabricius), Zathrephina lineata (Fabricius) and Chelymorpha aff. alternans Boheman (all Stolaini) were caused by the pentatomid Stiretrus decemguttatus. This author suggested that the predators obtained more food by feeding on older larvae. In our study, we did not detect any negative influence of vertebrate predators. Nogueira-de-Sá (1999) conducted an exclusion experiment to detect the most important group of predators of S. chalybea and observed that flying invertebrates seemed to be the main organisms responsible for larvae mortality. Also, chicks only rarely preyed upon these larva (Nogueira-de-Sá, unpublished data). However, Gomez (1997) suggested that predation by vertebrates upon Cassidinae may be higher than generally assumed and perhaps, of great impact. In her work, she suggested that the disappearance of larvae of Eurypedus Gistel (Cassidinae) was due to a lizard or an avian predator. The literature includes few observations on natural enemies of adult Cassidinae. Because parasitism by nematodes is frequently low (see also Heineck-Leonel and Salles, 1997), it is not expected to constitute an important influence in decreasing S. chalybea populations. Predators, like spiders and heteropterans (including S. decemguttaus) were observed on host plants and at the study area, suggesting their high importance. Nevertheless, adult Cassidinae definitely did not seem to be the preferred prey for those predators, or they must be well protected against them. Thanatosis, dropping off their host plants and regurgitating were the possible defensive strategies observed in the field for the three studied species. Predation experiments on Chelymorpha cribraria (Fabr.) adults (Cassidinae: Stolaini) showed that they were unpalatable to birds and spiders (Vasconcellos-Neto, 1988). Potential predators of S. chalybea, S. areolata and A. phaeopoda had a pattern of occurrence over the year very similar to their cassidine prey. They were more abundant on host plants in the summer months, coinciding with higher abundance of Cassidinae (Nogueira-de-Sá and Vasconcellos-Neto, in press). Synchrony between prey and predators or parasitoids has been detected by other authors (Charlet, 1992 and Cappaert et al., 1991b). We believe the same synchrony occurs with the populations of both Stolas species and Anacassis and their parasitoids, because of the decrease of insect populations during winter months. Low, but significant positive correlations between S. chalybea and S. areolata and the occurrence and richness of predators on their host plants suggest their influence on potential predators. Significant results with lag, may indicate that occurrence and richness of predators not only was related to the abundance of their prey at the present time, but also may increase their population as a response to higher abundance of Cassidinae in the past. Negative correlation between the richness of potential predators and Lag 2 adults is the only exception, and we believe that this may be influenced by other factors but the availability of their prey in the past. Because host plants of Cassidinae were so abundant in the field, we believe that they are not a limiting factor to the beetles. Additionally, in our previous investigations on S. chalybea, S. areolata and A. phaeopoda, at the same site, we have observed that some abiotic factors, like rain and temperature, only weakly explained the low numbers and the fluctuation of these populations in the field (Nogueirade-Sá and Vasconcellos Neto, 2003). Therefore, it seems to us that natural enemies are important in regulating Cassidinae populations, as its is believed for many phytophagous insects (see Hairston et al., 1960, Oksanen and Ericson, 1987; Denno et al., 1990; Hawkins et al., 1997; Keese, 1997; Cornell et al., 1998, for instance). Although more direct observations on the influence of predators and more intense collections of these beetles, specially S. areolata and A. phaeopoda, are still needed, this work supports the hypothesis of the control of herbivore populations by their natural enemies.


171

ACKNOWLEDGEMENTS The authors acknowledge the following professionals for their valuable work of identification of studied organisms: Caroline Chaboo (Cornell University, USA) and José Z. Buzzi (UFPR, Brazil) (Cassidinae), Jorge Tamashiro (Unicamp, Brazil) and João Semir (Unicamp, Brazil) (Asteraceae), Marcelo Tavares (Uniara, Brazil) (Microhymenoptera), José H. Guimarães (MZUSP, Brazil) (Tachinidae), Luis C.C.B. Ferraz (ESALQ/USP, Brazil) (Nematoda), Jocélia Grazia (UFRGS, Brazil) (Hemiptera) and. Adalberto J. Santos (Unicamp, Brazil) (Arachnida). We thank Antonio M. Rosa for field assistance and Lauro, Ivan and the staff of Ecological House at Serra do Japi for care and logistic support. We also thank Kleber del Claro, Margarete Macêdo, Donald Windsor and an anonymous reviewer for comments on earlier drafts of this manuscript. This research was supported by a grant from FAPESP to FNS (97/03311-2). LITERATURE CITED Balazuc, J. 1988. Laboulbeniales (Ascomycetes) parasitic on Chrysomelidae), pp. 389-398. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Bernays, E. A. 1997. Feeding by lepidopteran larvae is dangerous. Ecological Entomology 22:121-123. Cappaert, D. L, F. A. Drummond and P. A. Logan 1991a. Incidence of natural enemies of the Colorado potato beetle, Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) on a native host in Mexico. Entomophaga 36(3):369-378. Cappaert, D. L, F. A. Drummond and P. A. Logan 1991b. Population dynamics of the Colorado potato beetle (Coleoptera: Chrysomelidae) on native host in Mexico. Environmental Entomology 20(6):1549-1555. Carroll, C. R. 1978. Beetles, parasitoids and tropical morning glories: a study in host discrimination. Ecological Entomology 3:79-85. Charlet, L. D. 1992. Seasonal abundance and parasitism of the Sunflower beetle (Coleoptera: Chrysomelidae) on cultivated Sunflower in the Northern Great Plains. Journal Economical Entomology 85(3):766-771. Cloutier, C. and F. Bauduin 1995. Biological control of the colorado potato beetle Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) in Québec by augmentative releases of the two-spotted stinkbug Perillus bioculatus (Hemiptera: Pentatomidae). The Canadian Entomologist 127:195-212. Cornell, H. V., B. A. Hawkins and M. E. Hochberg 1998. Towards an empirically-based theory of herbivore demography. Ecological Entomology 23:340-349. Cox, M. L. 1994. The Hymenoptera and Diptera parasitoids of Chrysomelidae, pp. 419-467. In: P. H. Jolivet, M. L. Cox and E. Petitipierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Dordrecht, The Netherlands. Cox, M. L. 1996. Insect predators of Chrysomelidae, pp. 23-91. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers, Amsterdam, The Netherlands. Denno, R. F., S. Larsson and K. L. Olmstead 1990. Role of enemy-free space and plant quality in host-plant selection by willow beetles. Ecology 71(1):124-137. Eisner, T. and M. Eisner 2000. Defensive use of a fecal thatch by a beetle larva (Hemisphaerota cyanea). Proceedings of the National. Academy of Science (USA) 97(6):2632-2636. Frieiro-Costa, F. 1995 Biologia de populações e etologia de Omaspides tricolorata (Boheman, 1854) (Coleoptera: Chrysomelidade: Cassidinae) na Serra do Japi – Jundiaí, SP. Ph.D Thesis. Universidade Estadual de Campinas.

172


Gomez, N. E. 1997. The fecal shields of larvae of tortoise beetles (Cassidinae: Chrysomelidae): a role in chemical defense using plant-derived secondary compounds. Ph.D Thesis Universität Carolo-Wilhelmina zu Braunschweig. Guimarães, J. H. 1977. Host -parasite and parasite-host catalogue of South American Tachinidae (Diptera). Museu de Zoologia da Universidade de São Paulo 28(3). São Paulo, Brazil. Gomes-Filho, A. 1997. Predação no fitófago tropical Eurema albula (Cramer, 1775) Lepidoptera: Pieridae): uma avaliação experimental. MSc. Thesis. Universidade Estadual de Campinas. Hairston, N. G., F. Smith and L. B. Slobodkin. 1960. Community structure, population control and competition. American Naturalist 44: 421-425. Hawkins, B. A., H. V. Cornell and M. E. Hochberg 1997. Predators, parasitoids, and pathogens as mortality agents in phytophagous insect populations. Ecology 78(7):2145-2152. Heineck-Leonel, M. A. and L. A. B. Salles 1997. Incidência de parasitóides e patógenos em adultos de Diabrotica speciosa (Germ.) (Coleoptera: Chrysomelidae) na região de Pelotas, RS. Anais Sociedade de Entomologia 26(1):81-85. Keese, M. C. 1997. Does escape to enemy-free space explain host specialization in two closely related leaffeeding beetles (Coleoptera: Chrysomelidae). Oecologia 112:81-86. Köpf, A., N. Rank; H. Roininen and J. Tahvanainen 1997. Defensive larval secretions of leaf beetles attract a specialist predator Parasyrphus nigritarsis. Ecological Entomology 22:176-183. Leitão-Filho, H. F. 1992 A flora arbórea da Serra do Japi, pp. 40-62. In: Morellato, L. P. C (Org.), História Naural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Editora da Unicamp. Logan, P. A., R. A. Casagrande, T. H. Hsiao and F. A. Drummond 1987. Collections of natural enemies of Leptinotarsa decemlineata (Coleoptera: Chrysomelidae) in Mexico. 1980-1985. Entomophaga 32(3):249-254. Meiners, T. and M. Hilker 1997. Host location in Oomyzus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle Xanthogaleruca luteola (Coleoptera: Chrysomelidae). Oecologia 112:87-93. Memmot, J., H. C. J. Godfray and B. Bolton 1993. Predation and parasitism in a tropical herbivore community. Ecological Entomology 18:348-352. Monteiro, R. F. 1981. Regulação populacional em Ithomiinae (Lep.: Nymphalidae): ecologia da interação parasitóide x hospedeiro. M.Sc. Thesis, Universidade Estadual de Campinas. Nakamura, K. and I. Abbas 1989.Seasonal change in abundance and egg mortality of two tortoise beetles under a humid-equatorial climate in Sumatra (Coleoptera, Chrysomelidae, Cassidinae), pp. 487-495. In: D. G. Furth and T. N. Seeno (Eds.). Proceedings of the Second International Symposium on the Chrysomelidae. Entomography 6:343-552. Nogueira-de-Sá, F. 1999. Influência da interação com plantas hospedeiras (Asteraceae) e inimigos naturais de três espécies de Cassidinae (Coleoptera: Chrysomelidae) na Serra do Japi, SP. M.Sc. Thesis, Universidade Estadual de Campinas. Nogueira-de-Sá, F. and M. V. Macêdo 1998. Host plant preference of Plagiometriona flavescens (Coleoptera: Chrysomelidae) for two Solanaceous species, pp. 287-297. In: M. Biondi, M. Daccordi and D. G. Furth (Eds.), Proceedings of the Fourth International Symposium on the Chrysomelidae. Atti Museo Regione di Scienze Naturali, Torino, 327 pp. Nogueira-de-Sá, F. and J. Vasconcellos-Neto 2003. Host plant utilization and population abundance of three tropical species of Cassidinae (Coleoptera: Chrysomelidae). Journal of Natural History (in press). Oksanen, L. and L. Ericson 1987. Preface: Why should we care about predation and parasitism? Oikos 50(3):274-275. Olmstead, K. 1996. Cassidinae defenses and natural enemies, pp. 3-21. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers. Amsterdam, The Netherlands.


173

Paleari, L. M. 1997. Partilha de recurso entre Botanochara sedecimpustulata (Fabricius, 1781) e Zatrephina lineata (Fabricius, 1787) (Coleoptera, Chrysomelidae, Cassidinae), em Ipomoeae asarifolia (Convolvulaceae), na Ilha de Marajó, Pará, Brasil. Ph.D. Thesis. Universidade Estadual de Campinas. Peterson, J. K. and J. M. Schalk 1994. Internal Bacteria in the Chrysomelidae, pp. 393-405. In: P. H. Jolivet and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Poinar, G. O. Jr. 1988. Nematode parasites of Chrysomelidae, pp. 433-448. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, the Netherlands. Rowell-Rahier, M. and J. M. Pasteels 1992. Third trophic level influences of plant allelochemicals, pp. 243-277. In: G. A. Rosenthal and M. R. Berembaum (Eds.), Herbivores: Their interactions with secondary plant metabolites. Vol. II: Evolutionary and Ecological Processes. Academic Press. San Diego. Selman, B. J. 1988. Viruses and Chrysomelidae, pp. 379-387. In: P. H. Jolivet; E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, the Netherlands. Théodoridès, J. 1988. Gregarines of Chrysomelidae, pp. 417-431. In: P. H. Jolivet; E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Toguebaye, B. S., B. Marchand and G. Bouix 1988. Microsporidia of the Chrysomelidae, pp. 399-416. In: P. H. Jolivet, E. Petitpierre and T. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dodrecht, The Netherlands. Vasconcellos-Neto, J. 1988. Genética Ecológica de Chelymorpha cribraria, F. 1775 (Cassidinae, Chrysomelidae). Ph.D. Thesis. Universidade Estadual de Campinas. Vinson, S. B.1976. Host selection by insect parasitoids. Annual Review of Entomology 21:109-133. Windsor, D. M. 1987. Natural history of a subsocial tortoise beetle, Acromis sparsa Boheman (Chrysomelidae, Cassidinae) in Panama. Psyche 94:127-150.

24



David G. Furth (ed.) 2003 © PENSOFTEvolution Publishers of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) 175 Special Topics in Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 175-182

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae) Astrid Eben1 and Alejandro Espinosa de los Monteros2 1

Departamento de Ecología Vegetal, Instituto de Ecología, A.C., Km 2.5 Antigua Carretera a Coatepec, 91000 Xalapa, Veracruz, Mexico. Email: [email protected] 2 Departamento de Ecología y Comportamiento Animal, Instituto de Ecología, A.C., Km 2.5 Antigua Carretera a Coatepec, 91000 Xalapa, Veracruz, Mexico

ABSTRACT The association of Diabroticites with bitter Cucurbitaceae was interpreted as an example for chemically mediated plant-insect coevolution. This hypothesis is based on experiments with a limited number of species distributed in the USA, where they were apparently introduced from Mexico and Mesoamerica together with corn and squash. We recovered a maximum parsimony phylogeny of 19 Mexican Diabroticite species from six different genera based on 472 bp of COI and 43 external morphological characters. Our preliminary results corroborate the monophyly of the genera Diabrotica and Acalymma. Nonetheless, other currently recognized groups (e.g., fucata group) were not recovered as natural lineages. The evolutionary scenario depicted from this phylogeny allows us to conclude that the genus Acalymma diverged after the specialization of ancestral Diabroticites on Cucurbitaceae. An ancestor which was specialized on Cucurbitaceae gave rise to the polyphagous genus Diabrotica. Within this genus, the basal species have a host range from polyphagous to narrow, feeding on Poaceae, Fabaceae or a few other families. The species in the virgifera group have a larval host plant range restricted to Poaceae. Nevertheless, all species feed as adults on bitter cucurbits in the wild. Our data corroborate the hypothesis that the kairomonal response to secondary compounds in Cucurbitaceae is a relic of the ancestral host plant association. Furthermore, the data suggest that specialization is not a dead end in the evolution of Diabroticites. Instead, host plant range apparently became restricted and broadened several times within the evolution of the section.

RESUMEN La asociación de las Diabroticinas con calabazas amargas fue interpretada como un ejemplo de coevolución insectos-plantas mediada por compuestos químicos. Esta hipótesis, sin embargo, está basada en experimentos realizados con un número limitado de especies distribuidas en los EUA. Más aun, dichas especies fueron introducidas desde México y Mesoamérica junto con maíz y calabazas. Usando parsimonia reconstruimos una filogenia para 19 especies de Diabroticinas de seis géneros diferentes basada en 472 bp del gen mitocondrial COI y 43 caracteres morfológicos externos. Nuestros

176

Astrid Eben & Alejandro Espinosa de los Monteros

resultados corroboraron la monofilia de los género Diabrotica y Acalymma. Sin embargo, otros grupos comúnmente aceptados (e.g., grupo fucata) no fueron identificados como naturales en este análisis El escenario evolutivo inferido a partir de esta filogenia permite concluir que el género Acalymma radió posteriormente a la especialización de las Diabroticinas ancestral en Cucurbitaceae. Un ancestro especializado en Cucurbitaceae dio origen al género polífago Diabrotica, dentro del cual, la polifagia caracteriza a los linajes basales. Por otro lado, las especies del grupo virgifera presentan un ámbito de plantas hospederas restringido a Poaceae y Cucurbitaceae. Bajo condiciones naturales, sin embargo, todas las especies de Diabrotica se encuentran asociadas a flores de calabazas amargas. Nuestros datos preliminares corroboran la hipótesis que la respuesta kairomonal hacia compuestos secundarios de cucúrbitas puede ser el vestigio de la asociación ancestral con calabazas. Finalmente, la especialización no es un callejón sin salida en Diabroticinas. El uso de hospederos se ha restringido y ampliado varias veces durante la historia evolutiva de este grupo. INTRODUCTION Beetle species of the section Diabroticites (Chrysomelidae: Galerucinae: Luperini) are distributed in the New World, mainly in the tropics (Krysan and Branson 1983). One of the major questions concerning this herbivorous group is how to explain its radiation onto a large variety of plant families. It is striking that the majority of the Diabroticites share the Cucurbitaceae as a common host plant family. Current knowledge of the species of economic importance distributed in the USA indicates that Acalymma Barber spp. are monophagous on cucurbits, whereas Diabrotica Chevrolat spp. show a higher plasticity. Traditional classification has divided the latter genus in the grassfeeding virgifera group and the polyphagous fucata group (Smith and Lawrence 1967). Nevertheless, data on host plants of Neotropical species are scarce, especially for genera that are not of economic interest (Eben and Barbercheck 1996). Unfortunately, due to the lack of a phylogenetic hypothesis, we have been unable to understand the evolution of host plant relationships in these insects. The objective of this study was to recover a historical hypothesis about the interrelationships of Diabroticites. Based on this hypothesis we will infer an evolutionary scenario for host plant use in Diabroticites. Individual scenarios will be addressed to evaluate the plasticity of Diabroticites to invade plants of economic importance. MATERIAL AND METHODS Insects: Nineteen Diabroticite species, one Ceratomite species and one outgroup species were used for this study. All adult beetles were collected in the state of Veracruz, Mexico. Host plant use was confirmed with feeding choice assays (Eben et al. 1997). Molecular Characters: Total genomic DNA was extracted from frozen tissue using a Chelex 5% solution w/v following the method suggested by Singer-Sam et al. (1989). To minimize the risk of amplifying translocated nuclear copies, the mitochondrial COI gene region was isolated and amplified as a single fragment using specifically designed PCR primers. This fragment covers the sequence between the primers

Evolution of host plant breadth in Diabroticites (Coleoptera: Chrysomelidae)

177

S1718 (5´ ggaggatttggaaattgattagttcc 3´) and Nancy (5´cccggtaaaattaaaatataaacttc 3´). Detailed PCR and sequencing strategies are described elsewhere (Espinosa de los Monteros 2000). For all taxa, both strands were sequenced to guarantee accuracy. Morphological Characters: Forty three external morphological characters of adult insects were used as an additional data set for phylogenetic reconstruction (Appendix). Phylogenetic Analysis: Phylogenetic hypotheses were recovered by maximum parsimony conducted with the program PAUP* (Swofford 2000). The large number of taxa included in this study did not allow the use of exhaustive searching algorithms. Therefore, parsimony analyses were performed using heuristic searches. One thousand replicate searches with random addition of taxa were performed to eliminate input order bias. During all analysis, character polarization was established by outgroup comparison, and nucleotide transformations were considered unordered. Branch length was optimized using delayed transformation (DELTRAN) which favors parallelisms over reversals. Branch swapping was done using the tree bisection reconnection algorithm (TBR). In those cases in which the solution included multiple equally parsimonious trees, the signal was identified using strict consensus trees. Retention and consistency indexes were computed to evaluate the level of homoplasy in the most parsimonious tree. Evolutionary scenarios were reconstructed with the aid of the program MacClade v. 3.0. To avoid circularity, the characters mapped were not included in the phylogenetic analysis. RESULTS AND DISCUSSION Phylogenetic analyses of each data set (i.e. morphology and DNA) were performed. The 43 morphological characters yielded three equally parsimonious trees of 70 steps in length, 0.464 CI, and 0.635 RI (Fig. 1). An exploratory analysis of the DNA sequences revealed that the COI gene presents some saturation of transitions (Fig. 2A). After dividing the COI sequences by codon position, a clear saturation pattern can be observed on 3rd position transitions (Fig. 2B). Based on this evidence, a weighting scheme was applied downloading 3rd position transitions 1:2 with respect to 1st and 2nd positions and 3rd position transversions. The DNA analyses resulted in one most parsimonious tree of 1293 steps, 0.365 CI, and 0.371 RI (Fig. 3). A partition homogeneity test showed that the data matrices for the DNA and morphology were compatible for combined analysis (p=0.034). A more robust result is expected once compatible independent data sets are pooled together. The total evidence approach resulted in a single most parsimonious tree of 1387 steps, 0.360 CI, and 0.371 RI (Fig. 4). Slight differences can be observed on the three different analyses presented here. However, a common pattern in the phylogenetic relationships for the Diabroticites is evident. First, Acalymma sensu stricto is a monophyletic group, and apparently Amphelasma Barber is its sister taxon. These lineages are closely related to the genus Diabrotica and are sister groups of each other. Diabrotica as currently defined is a paraphyletic group. Most probably, Isotes Weise and Paratriarius Schaeffer have to be included within Diabrotica to create a natural group. The so-called virgifera group appears to be a monophyletic lineage. On the other hand, the fucata group is polyphyletic, and should therefore be removed from natural classifications. The genus Gynandrobrotica BechynJ is not monophyletic. The

178


Figure 1. Strict consensus of three equally parsimonious trees based on 43 morphological characters.

Figure 2. Saturation plot for the COI gene. a) global pattern for transition and transversion; b) saturation on transitions by codon position.

genus Cerotoma Chevrolat is the sister group of one of the Gynandrobrotica. A more exhaustive analysis of these genera must be undertaken before reaching a definite conclusion. The evolutionary scenario suggests that the ancestor of the Diabroticites was monophagous on cucurbits (Fig. 5 and Fig. 8). One of the most basal lineages, that encompasses Cerotoma atrofasciata Jacoby and Gynandrobrotica lepida (Say), independently gained fabaceous plants (i.e. beans) as secondary hosts. Nevertheless, in the more basal lineages of the remaining Diabroticites, a monophagy on cucurbits was retained. The basal lineages include all the species of the genus Acalymma. The monophagy was also maintained in Amphelasma cavum (Say). However, this species switched to an unrelated plant family, the Lamiaceae. Apparently, the large diversity encountered in the genus Diabrotica might be the result of the acquisition of polyphagy (Fig. 6). Finally, a tendency towards


179

Figure 3. Single most parsimonious tree based on DNA characters only.

Figure 4. Single most parsimonious tree based on a total evidence analysis.

Figure 5. Historical scenario for the evolution of diet breadth in Diabroticites.

Figure 6. Historical scenario for the invasion of Fabaceae.

the loss of host families in apical lineages of Diabrotica is suggested by the scenario, resulting in a secondary return to monophagy on cucurbits. A particular scenario regarding Fabaceae suggests

180


Figure 7. Historical scenario for the invasion of Poaceae.

Figure 8. Reconstructed evolutionary scenario for the evolution of host use in Diabroticite beetles.

that Diabroticites adapted to this family four times (Fig. 6). This might have independently happened at least three times within the genus Diabrotica. Our field records and bioassays demonstrated that D. undecimpunctata duodecimnotata Harold does not feed on beans, which is explained in the evolutionary scenario as a secondary loss. In the same manner, the invasion of corn apparently occurred independently three times within Diabrotica, and we postulate one secondary loss of this host in D. scutellata Jacoby (Fig. 7). In conclusion, in the Diabroticites, specialization on Cucurbitaceae is apparently an ancestral state, yet, does not represent a dead end in the evolution of the group (Fig. 8). ACKNOWLEDGEMENTS We thank the Departamento de Sistematica Vegetal (Instituto de Ecologia, Xalapa) for permission to use the Laboratory of Molecular Systematics. This research was partly funded by the Departamento de Ecologia Vegetal (902-16). LITERATURE CITED Eben, A. and M. E. Barbercheck 1996. Field observations on host plant associations and natural enemies of Diabroticite beetles (Chrysomelidae: Luperini) in Veracruz, Mexico. Acta Zool. Mex. 67:47-65. Eben, A., M. E. Barbercheck and M. Aluja S. 1997. Mexican Diabroticite beetles: I. Laboratory tests on host breadth of Acalymma and Diabrotica spp. Ent. Exp. Appl. 82:53-62. Espinosa de los Monteros, A. 2000. Higher-level phylogeny of Trogoniformes. Mol. Phylogenet. Evol. 14:20-34.


181

Krysan, J. L. and T. F. Branson 1983. Biology, ecology and distribution of Diabrotica. In: D. T. Gordon, J. K. Knoke, L. R. Nault and R. M. Ritter (Eds.). Proceedings International Maize Virus Disease Colloquium and Workshop, 2-6 August 1982. The Ohio State University, Ohio Agricultural Research and Development Center, Wooster. Singer-Sam, J., R. L. Tanguay and A. D. Riggs 1989. Use of Chelex to improve PCR signals from a small number of cells. Amplifications: a forum for PCR users 3:11. Smith, R. F. and J. F. Lawrence 1967. Clarification of the status of the type specimens of Diabroticites (Coleoptera, Chrysomelidae, Galerucinae). University of California Publications in Entomology, Volume 45, 174 pp. University of California Press, Berkeley. Swofford, D. L. 2000. PAUP* Phylogenetic analysis using parsimony (* and other methods) version 4.0b8. Sinauer Associates, Sunderland, Massachusetts, USA.

APPENDIX Morphological characters of Diabroticite species and outgroup taxa. All characters apply to adult beetles. 1. 2. 3. 4. 5.

Body size (0) smaller or equal to 5 mm, (1) larger than 5 mm. Color of thorax and elytra (0) same or (1) different. Color of thorax : (0) pale, yellow, green, (1) black, (2) combination of two colors, or (3) red, orange. Thorax bifoveate : (0) yes, (1) no, or (2) with transverse groove. Pattern on elytra : (0) no pattern, (1) transverse bands, (2) large spots, (3) small spots, (4) one stripe, (5) two or more stripes, (6) circles. 6. Hairs on elytra arranged (0) in rows, (1) irregularly, or (2) no hairs present. 7. Elytral punctures : (0) uniform, (1) variable, or (2) striate. 8. Elytra with (0) or without (1) sinuate sulci. 9. Raised areas or depressions on elytra : (0) absent or (1) present. 10. Metallic, shiny coloration of elytra : (0) yes, (1) no. 11. Elytra with variable color pattern : (0) yes, (1) no. 12. Elytra : (0) stripes connected at base, (1) not connected, (2) no stripes. 13. Elytra : (0) apical angle pointed, (1) apical angle not pointed, truncate. 14. Elytra : (0) with humeral vittae, (2) without humeral vittae. 15. Elytra : (0) with strongly punctured plicae in posthumeral area, (1) without such structures. 16. Elytra : (0) with pale outer line, (1) without pale outer line. 17. Antennae : (0) uniform color of all segments, (1) not all segments of the same color. 18. Antennal insertion : (0) close to eyes, (1) not close to eyes. 19. Antennae : (0) third segment longer than second, (1) third segment equal to second. 20. Antennae : (0) third segment as long as fourth, (1) third segment not as long as fourth, (2) third segment longer than fourth. 21. Legs : (0) tarsal claws bifid, (1) tarsal claws appendiculate. 22. Legs : (0) several tarsal segments with an adhesive patch, (1) no adhesive patch, (2) only one segment with adhesive patch. 23. Legs : (0) tibia with apical spurs, (1) tibia without apical spurs. 24. Legs : (0) first segment of midtarsus as long as following segments together, (1) first segment of midtarsus short, sub equal to the following segments.

182


25. Legs : (0) uniform color, (1) not uniformly colored. 26. Legs : (0) same color as abdomen, (1) not same color as abdomen. 27. Abdomen : (0) black, (1) pale, brownish, yellow 28. Size of eyes : (0) large, (1) small. 29. Front excavated : (0) with prominant median tubercle and thin lamella above arcuate, marginate in middle, (1) excavation without tubercule and lamella, (2) no excavation. 30. Apical segment of maxillary palpi : (0) no setae, (1) one seta, (2) 2 or more setae. 31. Labrum : (0) anterior margin slightly to strongly concave, (1) anterior margin even or convex. 32. Number of setae at labral margin : (0) none, (1) 2-3, (2) 4 or more. 33. Form of setae at labrum : (0) stout, short, (1) long, slender, (2) no setae. 34. Elongated setae at rear margin of wings : (0) absent, (1) present. 35. Color of head : (0) same color as thorax, (1) not same color as thorax. 36. Shape of thorax : (0) as broad as long (quadriculate), (1) not as broad as long (transverse), (2) longer as broad. 37. Thorax : (0) narrowed at middle, (1) not narrowed at middle. 38. Pronotum marginate : (0) yes, (1) no. 39. Pronotum at front and posterior end with pointed corners : (0) yes, (1) no. 40. Elytra covering entire abdomen (0), or (1) leaving one segment visible. 41. Third and fourth antennal segments of males modified : (0) absent, (1) present. 42. Elytra of males at apex with depressions and hairs : (0) absent, (1) present. 43. Clypeus in males excavated : (0) absent, (1) present.

© PENSOFT Publishers A Review Sofia - Moscow

David G. Furth (ed.) 2003 of the Biology and Host Plants of the Hispinae and Cassidinae 183 Special Topics in ... Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 183-199

A Review of the Biology and Host Plants of the Hispinae and Cassidinae (Coleoptera: Chrysomelidae) of Australia Trevor J. Hawkeswood1 1

270 Terrace Road, North Richmond, New South Wales, 2754, Australia. Email: [email protected]

ABSTRACT The biology and host plants of the Australian Hispinae and Cassidinae are reviewed from the literature and discussed. Some of these genera/species represent relictual endemics while others are extensions of larger genera which are poorly represented on the Australian continent. The species discussed here are as follows: Aproida balyi Pascoe, 1863, Brontispa castanea Lea, 1926, Eurispa vittata Baly, 1858, Hispellinus multispinosus (Germar, 1848), Promecotheca callosa Baly, 1876, P. varipes Baly, 1858 (Hispinae), Aspidimorpha deusta (Fabricius, 1775), A. interrupta (Fabricius, 1775), A. maculatissima (Boheman, 1856), Cassida compuncta (Boheman, 1855), C. diomma (Boisduval, 1835), Notosacantha dorsalis (Waterhouse, 1877) (Cassidinae).

INTRODUCTION The Hispinae and Cassidinae, two distinctive groups of the highly speciose beetle family Chrysomelidae, are mostly tropical in distribution with most of the genera and species occurring in South America (Seeno and Wilcox, 1982; Jolivet and Hawkeswood, 1995). Australia, compared to other tropical areas, including the neighbouring Pacific region is very depauperate in genera and species. The following genera of Hispinae are known from Australia (from Seeno and Wilcox, 1982 and other references cited therein): Aproida Pascoe, 1863, Eurispa Baly 1858, Leucipa Chapuis 1875, Brontispa Sharp 1903, Heterrachispa Gressitt 1957, Promecotheca Blanchard 1853, Hispellinus Weise 1897. The following genera of Cassidinae are known from Australia (Seeno and Wilcox, 1982 and other references): Notosacantha Chevrolat 1837, Aspidimorpha Hope 1840, Cassida Linnaeus 1758, Thlaspidula Spaeth 1901, Meroscalsis Spaeth 1903, Emdenia Spaeth 1915, Austropsecadia Hincks 1950. For the Australian taxa, biological data and host plant information are presently only available for Aproida, Eurispa, Brontispa, Promecotheca, Hispellinus, Aspidimorpha, Cassida and Notosacantha. These aspects are summarised and discussed below.

184

Trevor J. Hawkeswood

HISPINAE Aproida Pascoe, 1863 Aproida balyi Pascoe (Fig. 1) Distribution: Australia (Queensland, New South Wales). Host-plants: Eustrephus latifolius Benth. and Hook. (Philesiaceae) (Monteith, 1970; Hawkeswood, 1987; Samuelson, 1989); Convallaria sp. (Convallariaceae) (Hawkeswood, 1987). Biology: Monteith (1970) first provided some brief notes on the biology of this species, noting that all of the life-stages are passed completely exposed on the host plant, including the pupa, which is rather peculiar among the Hispinae. The female lays one egg at a time in an ootheca on a leaf of the host plant; the larvae, as they grow older, resemble cherry slugs or other sawfly larvae (Hawkeswood, 1987; Jolivet and Hawkeswood, 1995). The pupa, which is suspended from the withered skin of the final instar, closely resembles the pendant flower buds of the host plant (Monteith, 1970; Hawkeswood, 1987, Jolivet and Hawkeswood, 1995). Further biological and behavioural details are provided by Hawkeswood (1987) who also provided the first published coloured photograph of the insect, and noted that the adults mimic certain grasshoppers or rainforest bugs. Tillyard (1926) had previously noted that the general appearance of this beetle was like that of a coreid bug. Life-stages: The larva, pupa and adult are illustrated by Monteith (1970). The adult is also illustrated by Pascoe (1863), Hawkeswood (1987), Samuelson (1989) and Lawrence and Britton (1994). Brief comments on the larval appearance are provided by Hawkeswood (1987), Jolivet and Hawkeswood (1995). Published Collection Records with Biological Data: Brookfield, Gold Creek, Brisbane, Queensland, 4 Sept. 1983, J. Conran, from Eustrephus leaves (Philesiaceae) (Samuelson, 1989); Springbrook Plateau,

Fig. 1. Aproida balyi Pascoe. Adult on the leaves/stems of the host plant Eustrephus latifolius (Philesiaceae) at Cunninghams Gap, south-eastern Queensland. (Photo: T. J. Hawkeswood, from Hawkeswood, 1987).

A Review of the Biology and Host Plants of the Hispinae and Cassidinae ...

185

Queensland, 24 Nov. 1982, J. Conran, laying eggs and feeding on the leaves of Eustrephus sp. (Philesiaceae) (Samuelson, 1989). Brontispa Sharp, 1903 Brontispa castanea Lea Distribution: Lord Howe Island. Host plant: Howea forsteriana (C. Moore and F. Muell.) Wendl. and Drude (Arecaceae) (Lea, 1926). Biology: Undescribed. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: Lord Howe Island, A.M. Lea (I.7628, holotype), from kentia palm (Howea forsteriana (C. Moore and F. Muell.) Wendl. and Drude (Arecaceae) (Lea, 1926). Eurispa Baly, 1856 Eurispa vittata Baly Distribution: Australia (Queensland, New South Wales, Victoria, Tasmania). Host-plants: Gahnia sp. (Cyperaceae) (Kershaw, 1906); “sedges” (Cyperaceae) (Froggatt, 1907; Tillyard, 1926; McKeown, 1942); Gahnia sieberiana Kunth. (Cyperaceae) (Hawkeswood, 1991; Hawkeswood and Takizawa, 1997). Biology: Kershaw (1906) noted that this species (cited as Euryspa) was collected from “common rushes” (presumably Gahnia sp., Cyperaceae) at Ferntree Gully, Victoria, while Froggatt (1907) briefly noted that the beetle (also cited as Euryspa) was associated with “sedges” (Cyperaceae) but did not elaborate on this record. Tillyard (1926) briefly noted that the genus Eurispa contained “numerous slender species” that were found on sedges (Cyperaceae). McKeown (1942) briefly noted that the species fed on sedges and often occurred in large numbers in swampy areas. Further details on the biology of this hispine have been provided by Hawkeswood (1991) and Hawkeswood and Takizawa (1997): adults and larvae of E. vittata are usually found in the tight spaces between the basal unfolded parts of the leaves of the native sedge plant, Gahnia sieberiana Kunth (Cyperaceae); during mating, adults are often located and exposed on unfolded leaves at or near the ends of the leaves at the tops of plants; young larvae are mostly found feeding on the newer, recently unfolded foliage in the centre of plants or amidst leaf bundles, at or near the tops of plants; they later crawl downwards towards the more tightly clustered leaves at the bases of the plants; wherever they feed, the larvae and adults chew extensive patches of mesophyll tissue between the parallel veins of the host plant leaves; these areas later become brownish in colour and are thus conspicuous on the plants; feeding by larvae and adults is usually extensive on several leaves per leaf bundle and occurs in one area for a period of time before they move to another area on the same leaf or an adjacent leaf; the mature larvae pupate at or near the base of the plant or leaf bundle between very tightly clustered leaf bases; adults are present concealed amongst the tight foliage for most of the year but numbers increase during the months of November to January but gradually decline again during February to April, reaching their lowest level during June and July; adults which remain through the coldest months are most likely overwintering and undergoing some kind of dormancy as they are sluggish when collected; larvae are usually not present during the winter but young larvae first appear on the

186


host plants during late October to early November; adults usually dropped to the ground or slid down the leaf blade towards the base of the plant if disturbed and were never observed taking or engaging in flight, even during hot, humid days. Further details on biology can be found in Hawkeswood and Takizawa (1997). Life-stages: The larva, pupa and adult are described by Hawkeswood and Takizawa (1997). Published Collection Records with Biological Data: 5 larvae, 3 pupae, 12 adults, Hastings Point, New South Wales, Nov.-Dec. 1995, T.J. Hawkeswood, from the foliage of Gahnia sieberiana Kunth (Cyperaceae) (Hawkeswood and Takizawa, 1997). Hispellinus Weise, 1897 Hispellinus multispinosus (Germar) Distribution: Australia (Queensland, New South Wales). Host-plants: “grasses” (Poaceae) (Froggatt, 1907; Tillyard, 1926; Hawkeswood, 1987, 1988). Biology: Froggatt (1907) briefly noted that this species (as Monochirus multispinosus) was common on grass blades in southern coastal New South Wales. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: 1, James Cook University campus, Townsville, Queensland, 29 Nov. 1981, T.J. Hawkeswood, amongst grass (Poaceae) (Hawkeswood, 1988); 2, Townsville, Queensland, 20 Dec. 1981, T.J. Hawkeswood, amongst grass (Hawkeswood, 1988). Promecotheca Blanchard, 1853 Promecotheca callosa Baly Distribution: Australia (Queensland,). Host-plant: “native palms” (Cocos nucifera?) (Arecaceae) (Froggatt, 1914). Biology: Froggatt (1914) briefly noted that this species (named by him as the Queensland Coconut Hispid) had been found on unidentified “native palms” in northern Australia and by the vernacular inferred that the species was also a feeder on coconut, although finally stated that “nothing has been recorded of the exact food-plant of this beetle.”. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: None available. Promecotheca varipes Baly Distribution: Australia (Northern Territory), Papua New Guinea. Host-plant: Pandanus sp. (Pandanaceae) (Froggatt, 1914). Biology: Froggatt (1914) briefly noted that this species (named by him as the Port Darwin Coconut Hispid) had been found on the foliage of an unidentified Pandanus sp. (Pandanaceae). [I am not certain why it should be called a coconut hispid when it occurs on Pandanus- Froggatt gives no indication of the coconut as a host in this paper]. Life-stages: The egg, larva and pupa have not been described. Published Collection Records with Biological Data: None available.


187

CASSIDINAE Aspidimorpha Hope, 1840 Aspidomorpha deusta (Fabricius) (Fig. 2) Distribution: Australia (Queensland, Northern Territory), Malaysia, Indonesia, Papua New Guinea, Philippines. Host-plants: Ipomoea pes-caprae Roth. (Convolvulaceae) (Hawkeswood, 1987; 1988; Bach, 1998); Ipomoea batatas (L.) Lam. (Convolvulaceae) (Hawkeswood, 1988; Borowiec, 1992). Biology: Hawkeswood (1988) provided brief observations on the biology of this species in northeastern Queensland. This is one of the first insects described from Australia, the type being collected by Banks and Solander, presumably from the Endeavour River at Cooktown (Radford, 1981). They probably collected the species from I. pes-caprae which is widely and commonly distributed on north Queensland sand dunes. All life stages appear to be restricted to leaves of I. pes-caprae at Townsville, Tully and Port Douglas (Hawkeswood, 1988). Feeding by larvae and adults results in minor damage to leaves, often causing a shot-hole effect similar to that of the related species A. maculatissima Boheman on I. abrupta R. Br. (Hawkeswood, 1982). No other chrysomelids or other beetles appear to utilize the plant for food at Townsville. [However, Ipomoea pes-caprae is a common food plant of adult and larval Cassidinae on the beaches in the Pacific and Far-East (Jolivet and Hawkeswood, 1995)]. Further notes on the biology of this species and a colour illustration of the adult of A. deusta are provided in Hawkeswood (1987). [In Indonesia, where A. deusta also occurs, it has been recorded

Fig. 2. Aspidimorpha deusta (Fabricius). Adult and immature larva on the leaf of Ipomoea pes-caprae (Convolvulaceae) at Port Douglas, north-eastern Queensland. (Note. a tourist resort now covers the area where this beetle was photographed). (Photo: T. Helder, from Hawkeswood, 1987).

188


from Ipomoea carnea (Convolvulaceae) (Nakamura and Abbas, 1987, 1989: host plant cited as Ipomea; Noerdjito and Nakamura, 1999)]. Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: 11, between Pallarenda and Townsville, Queensland, 23 Jan. 1981, T.J. Hawkeswood (Hawkeswood, 1988); 2, Pallarenda, 30 Jan. 1981, T.J. Hawkeswood (Hawkeswood, 1988); 1, Pallarenda, 20 Feb.1981, T.J. Hawkeswood (Hawkeswood, 1988); 4, 1 km S of Port Douglas, 24 May 1981 T.J. Hawkeswood (Hawkeswood, 1988); 13, Brampston Beach near Tully, Queensland, 28 May 1981, T.J. Hawkeswood (Hawkeswood, 1988) [all specimens collected on leaves of Ipomoea pes-caprae Roth. (Convolvulaceae)]. Aspidomorpha interrupta (Fabricius) (Fig. 3) Distribution: Australia (Queensland, Northern Territory). Host-plants: Ipomoea triloba L. (Convolvulaceae) (Hawkeswood, 1988). Biology: A rare and poorly known species, which probably feeds on leaves of Ipomoea triloba at Townsville, although the early life stages have not been collected, while the behaviour and feeding biology are unknown. Adults are ready fliers, often alighting on vegetation, not regarded by the author as food plants, such as grasses (Poaceae) a common component of the Townsville vegetation (Hawkeswood, 1988). Evans (1985) reported A. interrupta on Glycine max L. (Fabaceae: Leguminosae) but this is not a food plant, only an incidental record (Hawkeswood, 1988).

Fig. 3. Aspidimorpha interrupta (Fabricius). Adult female on the leaf of Ipomoea triloba (Convolvulaceae) at Mt. Elliot, about 15 km south of Townsville, north eastern Queensland. (Photo: T. J. Hawkeswood, from Hawkeswood, 1988).


189

Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1988). Published Collection Records with Biological Data: 1, Mt. Elliot, c. 15 km S of Townsville, Queensland, 11 May 1981, T. Helder, on Ipomoea triloba L. (Hawkeswood, 1988); 2, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood and P. Singh, amongst Panicum grass (Poaceae) (Hawkeswood, 1988); 1, Mt. Louisa, Townsville,13 Dec.1981, TJH & A. Taplin, amongst Themeda and Bothriochloa grass (Poaceae) (Hawkeswood, 1988). Aspidimorpha maculatissima Boheman (Fig. 4) Distribution: Australia (Queensland, Northern Territory). Host-plants: Ipomoea abrupta R.Br. (Convolvulaceae) (Hawkeswood, 1982, 1987, 1988); Ipomoea batatas (L.) Lam., I. velutina R. Br. (Convolvulaceae) (Hawkeswood, 1982, 1988). Biology: Hawkeswood (1982) provided detailed observations on the biology of this species. The oothecae are usually placed on the abaxial (lower) surface of mature, healthy leaves of the food plants (Hawkeswood, 1982). The larvae, when first hatched, feed together near the discarded ootheca and begin to radiate outwards after 1-1.5 days, feeding on epidermal and palisade mesophyll tissue; as the larvae grow older, they either disperse and feed on different leaves or may form small groups of up to five larvae on the one large leaf (Hawkeswood, 1982). Feeding by adults and larvae results in small holes being formed between the major veins. Hawkeswood (1982) found that despite such feeding, no leaves were killed by the larvae or adults and that defoliation did not occur. The amount

Fig. 4. Aspidimorpha maculatissima Boheman. Adult resting with legs and antennae retracted on leaf of the host plant, Ipomoea abrupta (Convolvulaceae) at Townsville, north-eastern Queensland. (Photo: T. Helder, from Hawkeswood, 1987).

190


of leaf material consumed was usually 5-10% of the total leaf area by the time individual larvae had pupated (no adults were found on leaves occupied by larvae) (Hawkeswood, 1982). Despite the presence of many other Ipomoea species in the Townsville area, A. maculatissima was only found on I. abrupta and at Herveys Range on I. velutina, but it appears that the species may occasionally feed on on sweet potato (I. batatas) (Hawkeswood, 1982). The duration of the life-stages is as follows: Eggs6-10 days to hatch after being laid; First instar larva- 4-5 days; Second instar larva- 3-5 days; Third instar-larva- 3-5 days; Fifth instar larva- 2-4 days; Pupae- 3-7 days; Adults- more than 5 days-3 weeks and possibly more (Hawkeswood, 1982). A species of Pediobius (Eulophidae: Hymenoptera) has been recorded as a pupal parasitoid (Hawkeswood, 1982). A brief summary of the biology of this species was provided by Hawkeswood (1987, 1988) from Hawkeswood (1982). Life-stages: The egg, larva and pupa have been described by Hawkeswood (1982). The adult and pupa have been illustrated in colour by Hawkeswood (1987). Published Collection Records with Biological Data: Gordonvale, Queensland, 22 Dec. 1930, (collector unknown), on sweet potato (Ipomoea batatas, Convolvulaceae) (Hawkeswood, 1982); James Cook University campus, Townsville, 8, 10 Feb., 22 April, 5 May 1981, T.J. Hawkeswood, from Ipomoea abrupta (Convolvulaceae) (Hawkeswood, 1982); Herveys Range, 35 km west of Townsville, Queensland, 18 April 1981, T.J. Hawkeswood, from Ipomoea velutina (Convolvulaceae) (Hawkeswood, 1982). Cassida Linnaeus, 1758 Cassida compuncta (Boheman) Distribution: Australia (Queensland, New South Wales). Host-plant: Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997). Biology: Feeding by both larvae and adults of this species occurs mostly on the underside of the leaves and results in small to medium-sized, irregular to rounded holes measuring 2-8 mm in diameter or large eaten-out areas; foliage is chewed so that most of the palisade mesophyll is consumed (Hawkeswood et al., 1997). Larvae are cryptically coloured in bright green and are very difficult to find amongst the tightly packed foliage at the tops of plants where twining is greatest; in one instance, many early to later instar larvae were observed resting or feeding on the upper surface of a number of leaves at the end of a branch section of the host plant where they were orientated parallel to the main leaflets and with their faecal shields held over the dorsum of the body, they were often difficult to find, as the green matched the colour of the leaflets and the narrow shield of cast skins resembled curled up necrotic leaf margins etc; in response to direct strong sunlight, the larvae will orientate their bodies in a direct line with the incidence of light, and place the row of cast skins over their bodies for protection, but if the heat is too intense, they will seek cover under the leaves; adults are particularly wary and will fly from the host plants during hot periods of the day if disturbed; during other times, they may simply drop from the plants to the ground below where they are usually indistinguishable amongst leaf litter and twig debris (Hawkeswood et al., 1997). The species has only been recorded from Ipomoea cairica but one adult has been found overwintering in the tightly clustered leaves of the sedge Gahnia erythrocarpa R.Br. (Cyperaceae) during August 1992 in northern New South Wales (LeBreton and Hawkeswood, 1993; Hawkeswood et al., 1997). Life-stages: The egg has not been described. The larva, pupa and adult have been described by Hawkeswood et al. (1997).


191

Published Collection Records with Biological Data: 17 larvae, 7 pupae, Hastings Point, New South Wales, 15-18, 18-24 March 1997 (respectively), T.J. Hawkeswood, from leaves of Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997); 2 and 3 adults, Hastings Point, New South Wales, 28 Feb., 24 March 1997 (respectively), T.J. Hawkeswood, feeding and resting on the underside of leaves of Ipomoea cairica (L.) Sweet (Convolvulaceae) (Hawkeswood et al., 1997). Cassida diomma (Boisduval) (Fig. 5) Distribution: Australia (Queensland). Host-plants: Ipomoea sp. (Convolvulaceae) (Hawkeswood, 1987); Ipomoea triloba L., I. batatas (L.) Lam. (Convolvulaceae) (Hawkeswood, 1988). Biology: Although widespread, this species is apparently short-lived and the early life stages have not been collected; it is most likely that, with further examination of Ipomoea plants in the Townsville area, the eggs, larvae and pupae of C. diomma will be revealed (Hawkeswood, 1988, beetle cited as Metriona holmgreni). Adults appear to utilize I. triloba and I. batatas as food plants in the Townsville area, and are active fliers, often found alighting amongst grass or flying amongst weeds and other vegetation near the host plants. The specimens obtained from curled leaves of C. anacardioides were probably overwintering and did not utilize this plant for food (Hawkeswood, 1988). Hawkeswood (1987) previously mentioned that this species (cited as Metriona holmgreni) is often found on food plants in disturbed habitats recolonised by Ipomoea species. Adults are active in sunlight and fly readily if disturbed; the larvae are dark green and flat, with marginal spines- like adults, they chew small holes in the host plant leaves, without killing the leaves. Hawkeswood (1987) also mentioned

Fig. 5. Cassida diomma (Boisduval). Adult on leaf of an Ipomoea sp. (Convolvulaceae) at Brisbane, Queensland. (Photo: D. G. Knowles, from Hawkeswood, 1987).

192


that the species occurs in rainforests, vine forest and disturbed areas near rainforests. [Borowiec (1990) also recorded this species from Papua New Guinea where it was recorded from Ipomoea batatas (L.) Lam. (cited incorrectly as Ipomena batatas)]. Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: 12, Townsville Common, Queensland, 17 May 1981, T.J. Hawkeswood, on leaves of Ipomoea triloba (Linn.) (Convolvulaceae) (Hawkeswood, 1988); 2, Townsville Common, 15 Aug. 1981, T.J. Hawkeswood, in curled leaves of Cupaniopsis anacardioides (A. Rich.) Radlkf (Sapindaceae) (Hawkeswood, 1988), 6, Mt. Louisa, Townsville, 23 Oct. 1981, A. Taplin, on leaves of I. batatas (L.) Lam. (Hawkeswood, 1988); 3, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood, on leaves of Panicum sp. (Poaceae) (Hawkeswood, 1988); 3, 10 km W of Townsville, 29 Nov. 1981, T.J. Hawkeswood & R Singh, on Panicum grass (Hawkeswood, 1988); 3, Pallarenda, 6 km N of Townsville, 30 Nov. 1981, T.J. Hawkeswood, flying around passionfruit vines, Passiflora foetida R. Br. (Passifloraceae) (Hawkeswood, 1988). Notosacantha Chevrolat, 1837 Notosacantha dorsalis (Waterhouse) (Fig. 6) Distribution: Australia (Queensland). Host-plant: Acacia crassa Pedley subsp. crassa (Mimosaceae) (Hawkeswood, 1987, 1989, 1994; Monteith, 1991).

Fig. 6. Notosacantha dorsalis (Waterhouse). Adults on a leaf the food plant Acacia crassa (Mimosaceae) in the Barakula State Forest., Queensland. Note the characteristic parallel feeding pattern of the adults which follow the venation of the leaves. (Photo: T. J. Hawkeswood, from Hawkeswood, 1987, 1989).


193

Biology: Hawkeswood (1987, 1989) noted that this beetle (cited as Hoplionota dorsalis) is restricted to Eucalyptus-Callitris woodlands and Eucalyptus-Acacia dry sclerophyll forests of semi-arid Queensland where the adults feed during summer in a characteristic manner on the moderately broad, phyllodinous leaves of A. crassa subsp. crassa; the adults prefer feeding on young plants of A. crassa (0.5-1.2 m high) and this results in extensive grooves between the main longitudinal leaf veins which later darken to a brown colour (Hawkeswood, 1989). The beetles feed on the cutical, epidermal and mesophyll (chlorenchyma) and vascular tissues and they tend to remain on the host plants during the day and in the hotter afternoons, they tended to occupy sites on leaf surfaces facing away from the direct sunlight (Hawkeswood, 1989). Most feeding damage occurs on the adaxial (upper) surface of the leaves and feeding damage is not affected by the size of the phyllode since small leaves were consumed in similar fashion as larger leaves (Hawkeswood, 1989). Also feeding did not appear to result in the death of of any leaves or plants, i.e. no plants were defoliated. Hawkeswood (1987, 1989) also noted that N. dorsalis adults retract their legs and antennae when touched or disturbed and attach themselves strongly onto the leaf surface and that their colour pattern is undoubtedly associated with their behaviour pattern; the colour pattern matches in part the colour of the chewed areas on the phyllodes and when motionless, the adults resemble a necrotic leaf spot or a birddropping (see colour plate 157 in Hawkeswood, 1987 and Fig. 6. this paper). These are most probably procryptic adaptations against predation by birds (Hawkeswood, 1989, 1994). Life-stages: The egg, larva and pupa have not been described. A colour illustration of the adult of this species was provided by Hawkeswood (1987). Published Collection Records with Biological Data: None available. DISCUSSION Hispinae Aproida Pascoe, is a genus of three known species from the tropical and subtropical rainforests of Queensland and north-eastern New South Wales (Samuelson, 1989) but biological data are only available for the most common and widespread species, A. balyi Pascoe. The host plant, Eustrephus latifolius (Philesiaceae), is known as the Wombat Berry and is a glabrous, much-branched climber, often extending to several metres in length and is widespread in eastern Australia in moist communities especially on the margins of rainforest and coastal swamps. Aproida balyi is the only chrysomelid recorded as utilising this plant as a host (Jolivet and Hawkeswood, 1995). Only the leaves are consumed by the adults and larvae and even though flowering plants are inhabited, flowers are not consumed. The beetle may be common in some areas and absent in others. Samuelson (1989) commented on the fact that the genus Aproida was closely related to the genera of the Oriental Anisoderini but that further studies were required to tell whether there was any true relationship. Wurmli (1975) vaguely suggested that the adult Aproida facies were most similar to the Australian Eurispa but mentioned that the true affinities were unclear. Samuelson (1989) compared some of the adult head morphology of the two genera and even on these characters, his conclusions indicated very little similarity. The morphology, host plants, adult behaviour, larvae, pupae and eggs of Aproida are most unusual among the Hispinae and it is possible that a detailed study of all aspects of the life stages and biology of A. balyi and the other two known species of the genus would lead to placing these Coleoptera in a separate subfamily of the Chrysomelidae (although this group would be closer to Hispinae than to

194


Cassidinae) and to this end I will be researching this species in the future once suitable material again becomes available The striking mimicry of rainforest bugs or grasshoppers (Hawkeswood, 1987, Jolivet and Hawkeswood, 1995) is one of the most peculiar features of A. balyi. It could become evident that Aproida, an obviously archaic genus with little genetic plasticity, is at an evolutionary dead-end, having emerged/speciated in the Cretaceous (or soon after) and only managed to survive in the wet forests of eastern Australia after the drying out of the Australian continent during the Tertiary. Samuelson (1989) noted that the obvious great phylogenetic distance between Aproida and its closest (as yet unknown) relative and its geographical restriction suggest a long period of isolation and Gondwanian origins. Brontispa Sharp is a genus represented by many species throughout the Indian-Pacific region and especially in Papua New Guinea (e.g. Gressitt, 1960, 1963), although very few species are known from Australia and much less their biology. The only published host data for an Australian species appears to be the old record of Lea (1926) and nothing since has been published on the biology of the genus in Australia. It is apparent that both the species in question, B. castanea and its host plant, the kentia palm (Howea forsteriana), are both endemics to Lord Howe Island (situated about 1,000 km from the east coast of Australia and one of its Territories) and have co-evolved over a long period of time after being separated on the island from congeners probably originating from the northwest where Brontispa is better developed in terms of species numbers. However, even though the species has been restricted in time and space, B. castanea’s food selection is in keeping with that of the genus overall: Jolivet (1989) and Jolivet and Hawkeswood (1995) list over 25 genera of Arecaceae known to be utilised by Brontispa species, although as far as I am aware, Howea has not been recorded as a host for any other hispine or any other chrysomelid, although future detailed field work on Lord Howe Island may reveal further species of Coleoptera from Howea. Eurispa Baly is a small genus of about 6-8 species occurring in eastern Australia and southern Papua New Guinea. They appear to be associated with sedges such as Gahnia (Cyperaceae) (Jolivet, 1989; Jolivet and Hawkeswood, 1995) and reports from grasses (Poaceae) [(e.g. Monteith (1970) and Lawrence and Britton (1994)] appear to be erroneous (Hawkeswood and Takizawa 1997). Hawkeswood and Takizawa (1997) discussed the possible evolution, host-plant co-evolution and relationships of Eurispa. It seems probable that E. balyi is one of only a few species of Australian Hispinae which were able to colonise areas that became colder (and drier) during the evolution of the Australian landmass. Gressitt (1959) made the interesting observation that hispine beetles (at least species from the Oriental region) are less tolerant of cold than their host plants (Hawkeswood and Takizawa, 1997). This may explain why Hispinae are largely absent from the southern areas of Australia and Tasmania, i.e. these areas were already cold in the Tertiary when migration of ancestral Coleoptera from hotter, more tropical/equatorial regions occurred; these “warm” to “hot adapted” species failed to adapt to the colder regions, although E. balyi appears to be an exception (Hawkeswood and Takizawa, 1997). Hispellinus Weise is another widespread tropical and subtropical genus which is poorly represented in Australia. The host-plants are various taxa of grasses (Poaceae) (Jolivet, 1989; Jolivet and Hawkeswood, 1995). The most common, well-known and most readily collected Australian species, H. multispinosus, has been recorded a number of times from grasses (Poaceae) (Froggatt, 1907; Tillyard, 1926; Hawkeswood, 1987, 1988) but the identity of these grasses has never been determined, presumably because of their often inadequate taxonomy and their difficulty of being readily and accurately identified. H. multispinosus has also been collected from Papua New Guinea where it has been recorded from Imperata sp., Saccharum officinarum L. and Themeda sp. (Poaceae) (Gressitt, 1963).


195

This host-selection is in keeping with other members of the genus which have been recorded from such grass genera as Saccharum, Zea, Miscanthus and Themeda (e.g. Gressitt, 1960, 1963; Takizawa, 1978; Jolivet and Hawkeswood, 1995). The greater diversity of Hispellinus species in the PapuaOriental area suggests that the genus originated there with a some incursions into Australia where few species have survived/evolved. The genus, like other Australian Hispinae (viz. Brontispa and Promecotheca), is badly in need of revision and further detailed biological studies. Promecotheca Blanchard is a moderately large, Asian and Indo-Australian genus (Seeno and Wilcox, 1982; Jolivet and Hawkeswood, 1995). Host-plants of various members of the genus include genera of Arecaceae, Flagellariaceae, Zingiberaceae, Poaceae, Heliconiaceae, Pandanaceae and Marantaceae (Jolivet, 1989; Jolivet and Hawkeswood, 1995). Arecaceae are among the most regularly utilised host plants, and like Hispellinus, the host selections of the two Australian species, P. callosa and P. varipes are in keeping with the trophic selections of extra-Australian species. Also, as with the case of Hispellinus in Australia, the greater species development of Promecotheca in the Papua-Oriental area suggests that the genus originated there with a some incursions into Australia where few species have survived/evolved and these are now restricted to hot, tropical northern Australia (Queensland and the Northern Territory). A lack of suitable host plants for evolving/colonising Hispinae cannot be proposed for the lack of speciation of Hispinae in Australia, because the main plant hosts of the subfamily in the Oriental region, i.e. Poaceae, Cyperaceae, Pandanaceae, Arecaceae and Araceae are well represented in the Australian flora (Hawkeswood and Takizawa, 1997). For instance, the family Zingiberaceae is well represented in Australian tropical and subtropical rainforests, but as yet (as far as I am aware), no Chrysomelidae have been collected from them, yet Alpinia, Elettaria and Zingiber are hosts to many Chrysomelidae (including Hispinae) in New Guinea and elsewhere (e.g. Gressitt, 1957, 1959, 1960, 1963, 1965; Gressitt and Kimoto, 1963; Kimoto et al., 1984; Schmitt, 1988; Hawkeswood and Samuelson, 1995; Jolivet and Hawkeswood, 1995). Likewise, the Pandanaceae is well represented in Australia, especially in the northern parts of the continent, but only one species of Hispinae, Promecotheca varipes Baly has been recorded from Pandanus in Australia (Froggatt, 1914; this paper see above). Pandanus is also well utilised by Chrysomelidae (especially Hispinae) in New Guinea, the Solomon Islands and other Pacific regions (e.g. Gressitt, 1957, 1960, 1963, 1965; Jolivet and Hawkeswood, 1995). Cassidinae Notosacantha dorsalis is the only species of Cassidinae known to feed on Acacia species (Mimosaceae). Jolivet and Hawkeswood (1995) noted that certain extra-Australian species of the genus have been known to feed on Areca (Arecaceae) in Asia and (accidentally?) on Phyllanthus sp. (Euphorbiaceae) in Vietnam. These records are not very conclusive nor extensive but it is most unlikely that these species of Notosacantha or others feed on Acacia as does the Australian N. dorsalis. As mentioned by Hawkeswood (1994), only one species of Notosacantha is known from Acacia and that the relationships of Australian Notosacantha with the Asian species are unclear. Notosacantha is poorly represented in Australia and as with Hispellinus, Brontispa and Promecotheca of the Hispinae, as well as Cassida and Aspidimorpha (see below), the native representatives appear to be derived from the Papua-Oriental region. As pointed out by Hawkeswood (1989), N. dorsalis appears to be a relictual cassidine closely related to Aspidimorpha (cited as Aspidomorpha) and that it was highly probable that the species originated from an ancestor of Aspidimorpha during the drying out of the central Australian landmass

196


during the Tertiary period. During my observations on N. dorsalis in the Barakula State Forest of Queensland (Hawkeswood, 1989), I did not find any evidence of eggs, larvae or pupae, although collecting at other times will undoubtedly locate them. The species was originally described from the Mackenzie River in semi-arid central Queensland (Waterhouse, 1877) from a similar habitat to that where my observations were undertaken. It is apparent that N. dorsalis is the only cassidine species known to inhabit Acacia in inland, semi-arid Queensland. Since the genus Notosacantha as a whole is tropical and subtropical in distribution, I believe N. dorsalis is a relict species from a time when the Australian continent was much wetter and with more luxuriant vegetation. The inland dried out during the Tertiary and later periods of geological time leaving this as a relictual species which was well adapted due to its secretive behavior and mimicry (at least in the adult stage) and predadpted for feeding on hard, sclerophyllous leaved Acacia species and extremes of climatic conditions (in all stages). [These semi-arid areas are extremely hot during summer- viz. 40°C and often freezing during winter, less that 0°C]. I agree with Monteith (1991) that a detailed morphological study of Notosacantha larvae and adults is required, but also aspects of their eggs, host-plants, defence mechanisms and behaviour need to be addressed. The genus appears to have many interesting behaviours and host plants. For instance, Medvedev and Eroskina (1988) studied the biology of Notosacantha siamensis Spaeth from south-east Asia and illustrated the larva which they found to be a leaf miner. Rane et al. (2000) described the life history of Notosacantha viscaria (Spaeth) which feeds on the mangrove Carallia brachiata (Rhizophoraceae). This is the only chrysomelid known to feed on this genus of plant (Hawkeswood and Jolivet, unpub. data). The genera Cassida and Aspidimorpha Hope (previously Aspidomorpha) utilise a large number of genera and families as host plants (Jolivet, 1988, Jolivet and Hawkeswood, 1995) although Aspidimorpha has a much narrower host selection (Jolivet and Hawkeswood, 1995). Ipomoea (Convolvulaceae) is a predominant host plant genus for both Cassida and Aspidimorpha (Jolivet and Hawkeswood, 1995) and this trend is evident in the Australian species for which the host -plants are known. All of the Australian species of Cassida and Aspidimorpha where biological details are known (see above) have only been recorded from Ipomoea and no other hosts. As with the various genera of Australian Hispinae noted above, Cassidinae and Aspidimorpha are poorly represented in the Australian fauna. Like the world Hispinae in general, Cassida and Aspidimorpha are mostly tropical and their poor species development in Australia would appear not to have resulted from a paucity of food-plants, but the effects of cooling (and drying) of the southern Australian landmass during various times during the Tertiary and during more recent periods such as the Pleistocene. The present concentration of species of Australian Hispinae and Cassidinae in the northern tropical and subtropical regions (Western Australia, Northern Territory and Queensland) indicates support for this suggestion although the real situation may have been more complicated than this scenario. CONCLUSIONS Compared to other tropical regions of the world the Australian representation of Hispinae and Cassidinae appears to be rather depauperate. In addition., biological information on most species is lacking and most of the genera need revision. Further detailed studies on some of the groups viz. Aproida and Notosacantha will undoubtedly and significantly add to the meagre knowledge already existing and clarify aspects of evolution and host-plant selection. It appears likely that the Hispinae and Cassidinae of Australia have been derived from at least two sources (a) Gondwanaland (e.g. Aproida, Eurispa) and (b) later invasion from the Papuan-Oriental area (Brontispa, Hispellinus,


197

Promecotheca, Aspidimorpha, Cassida, Notosacantha) but very few species were apparently able to survive the climatic changes of the Australian continent in post-Tertiary times. However, much remains to be learned of the evolutionary relationships of these groups to each other and to other species/ genera in the Pacific and elsewhere and further studies should shed more light on the reasons why Australia, despite the development of suitable host plants and tropical/sub-tropical habitats is so depauperate in species of these two subfamilies. ACKNOWLEDGEMENTS I would like to thank the indomitable Professor Pierre H. Jolivet for assistance and encouragement over two decades. I dedicate this paper to him, a truthful, great biologist, an accurate inquirer and documenter of the extremely complicated natural world. LITERATURE CITED Bach, C. 1998. Seedling survivorship of the beach morning glory, Ipomoea pes-caprae (Convolvulaceae). Australian Journal of Botany 46:123-133. Borowiec, L. 1990. A review of the genus Cassida L. of the Australian Region and Papuan Subregion (Coleoptera: Chrysomelidae: Cassidinae). Genus 1:1-51. Borowiec, L. 1992. A review of the tribe Aspidomorphini of the Australian Region and Papuan Subregion (Coleoptera: Chrysomelidae: Cassidinae). Genus 3:121-184. Evans, M. L. 1985. Arthropod species in soybeans in southeast Queensland. Journal of the Australian Entomological Society 24:169-177. Froggatt, W. W. 1907. Australian Insects. William Brooks & Co., Sydney. pp. 449. Froggatt, W. W. 1914. Australasian Hispidae (sic) of the genera Bronthispa (sic) and Promecotheca which destroy coconut palm fronds. Bulletin of Entomological Research 5:149-152. Gressitt, J. L. 1957. Hispine beetles from the South Pacific (Coleoptera: Chrysomelidae). Nova Guinea 8:205324 + plate XV. Gressitt, J. L. 1959. Host relations and distribution of New Guinea hispine beetles. Proceedings of the Hawaiian Entomological Society 17:70-75. Gressitt, J. L. 1960. Papuan-West Polynesian Hispine beetles (Chrysomelidae). Pacific Insects 2:1-90. Gressitt, J. L. 1963. Hispine beetles (Chrysomelidae) from New Guinea. Pacific Insects 5:591-714. Gressitt, J. L. 1965. Chrysomelid beetles from the Papuan subregion. I. (Sagrinae, Zeugophorinae, Criocerinae). Pacific Insects 7:131-189. Gressitt, J. L. and S. Kimoto 1963. The Chrysomelidae (Coleoptera) of China and Korea. Pacific Insects Monographs 1B:301-1026. Hawkeswood, T. J. 1982. Notes on the life history of Aspidomorpha maculatissima Boheman (Coleoptera: Chrysomelidae: Cassidinae) at Townsville, north Queensland. Victorian Naturalist 99:92-101. Hawkeswood, T. J. 1987. Beetles of Australia. Angus and Robertson Publishers, Sydney. 248 pp. Hawkeswood, T. J. 1988. A survey of the leaf beetles (Coleoptera: Chrysomelidae) from the Townsville district, northern Queensland, Australia. Giornale Italiano di Entomologia 4:93-112. Hawkeswood, T. J. 1989. Studien zu Biologie und Verhalten des australischen Schildkäfers Hoplionota dorsalis Waterhouse (Coleoptera: Chrysomelidae). Entomologische Zeitschrift 99:346-349. Hawkeswood, T. J. 1991. Some preliminary notes on the biology and host plant of Eurispa vittata Baly (Coleoptera: Chrysomelidae) from north-eastern New South Wales. Victorian Entomologist 21:132-134.

198


Hawkeswood, T. J. 1994. Review of the biology and host plants of Australian Chrysomelidae (Coleoptera) associated with Acacia (Mimosaceae), Chapter 12, pp. 191-204. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Hawkeswood, T. J. and G. A. Samuelson 1995. Notes on some leaf beetles from the Passam area, East Sepik Province, and Port Moresby area, Central Province, Papua New Guinea (Insecta, Coleoptera, Chrysomelidae). Spixiana 18:165-176 Hawkeswood, T. J. and H. Takizawa 1997. Taxonomy, ecology and descriptions of the larva, pupa and adult of the Australian hispine beetle, Eurispa vittata Baly (Insecta, Coleoptera, Chrysomelidae). Spixiana 20:245-253. Hawkeswood, T. J., H. Takizawa and P. H. Jolivet 1997. Observations on the biology and host plants of the Australian tortoise beetle, Cassida compuncta (Boheman), with a description of the larva, pupa and adult (Insecta: Coleoptera: Chrysomelidae). Mauritiana 16:333-339. Jolivet, P. 1988. Sélection trophique chez les Cassidinae (Col. Chrysomelidae). Bulletin de la Societe Linnéenne de Lyon 57:301-320. Jolivet, P. 1989. Sélection trophique chez les Hispinae (Coleoptera Chrysomelidae Cryptostoma). Bulletin de la Societe Linnéenne de Lyon 58:297-317. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the World. An essay about the relationships between the leaf-beetles and their food-plants. Backhuys Publishers, Leiden, The Netherlands. 281 pp. Kershaw, J. A. 1906. Excursion to Upper Ferntree Gully. Victorian Naturalist 22:148-151. Kimoto, S., J. Ismay and G. A. Samuelson 1984. Distribution of chrysomelid pests associated with certain agricultural plants in Papua New Guinea (Coleoptera). Esakia 21:49-57. Lawrence, J. F. and E. B. Britton 1994. Australian Beetles. Melbourne University Press, Carlton, Victoria. 192 pp. Lea, A. M. 1926. Notes on some miscellaneous Coleoptera with descriptions of new species. Part VI. Transactions of the Royal Society of South Australia 50:45-84. LeBreton, M. and T. J. Hawkeswood 1993. Notes on some Coleoptera collected from the foliage of Gahnia erythrocarpa R. Br. (Cyperaceae) in north-eastern New South Wales. Sydney Basin Naturalist 2:35-36. McKeown, K.C. 1942. Australian Insects. An Introductory Handbook. Royal Zoological Society of New South Wales, Sydney. 304 pp. Medvedev, L. N. and G. A. Eroskina 1988. Place of the genus Notosacantha in the system of Chrysomelidae and relationships between the subfamilies Hispinae and Cassidinae. Zoologischekii Zhurnal Mosckva 67:698704. (In Russian) (Not seen). Monteith, G. B. 1970. Miscellaneous Insect Notes. Life history of the chrysomelid, Aproidea (sic) balyi Pascoe. News Bulletin of the Entomological Society of Queensland 72:9-10. Monteith, G. B. 1991. Corrections to published information on Johannica gemellata (Westwood) and other Chrysomelidae (Coleoptera). Victorian Entomologist 21:147-154. Nakamura, K. and I. Abbas 1987. Preliminary life-table of the spotted tortoise beetle, Aspidomorpha miliaris (Col., Chrysomelidae) in Sumatra. Researches in Population Ecology 29:229-236. Nakamura, K. and I. Abbas 1989. Seasonal change in abundance and egg mortality of two tortoise beetles under a humid equatorial climate in Sumatra (Coleoptera, Chrysomelidae, Cassidinae). Entomography 6:487-495. Noerdjito, W. A. and K. Nakamura 1999. Population dynamics of two species of tortoise beetles, Aspidomorpha miliaris and A. sanctaecrucis (Coleoptera: Chrysomelidae: Cassidinae) in East Java, Indonesia. 1. Seasonal changes in population size and longevity of adult beetles. Tropics 8:409-425.


199

Pascoe, F. P. 1863. Notices of new or little-known genera and species of Coleoptera. Part IV. Journal of Entomology 2:26-56. Radford, W. P. K. 1981. The Fabrician types of the Australian and New Zealand Coleoptera in the Banks Collection at the British Museum (Natural History). Records of the South Australian Museum 18:155-197. Rane, N., S. Ranade and H. V. Ghate 2000. Some observations on the biology of Notasacantha vicaria (Spaeth) (Coleoptera: Chrysomelidae: Cassdidinae). Genus 11:197-204. Samuelson, G. A. 1989. A review of the hispine tribe Aproidini (Coleoptera: Chrysomelidae). Memoirs of the Queensland Museum 27:599-604. Schmitt, M. 1988. The Criocerinae: biology, phylogeny and evolution, Chapter 28, pp. 475-495. In: P. Jolivet, E. Petitpierre, and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Seeno, T. N. and J. A. Wilcox 1982. Leaf beetle genera (Coleoptera: Chrysomelidae). Entomography 1:1-221. Takizawa, H. 1978. Notes on Taiwanese chrysomelid-beetles, 2. Kontyu 46:596-602. Tillyard, R. J. 1926. The Insects of Australia and New Zealand. Angus and Robertson, Sydney. 660 pp. + xvi. Waterhouse, C. O. 1877. New Coleopterous insects from Queensland. Annals of the Magazine of Natural History 4(19):423-425. Wurmli, M. 1975. Gattungmonographie der altweltlichen Hispinen (Coleoptera: Chrysomelidae: Hispinae). Entomologische Arbeiten Museum G. Frey 26:1-83. (Not seen, cited from Samuelson, 1989).

24



David G. Furth (ed.) 2003 © PENSOFT PublishersPerformance and Food Preference of Botanochara Impressa (Panzer) ... Beetle Biology 201 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 201-208

Performance and Food Preference of Botanochara impressa (Panzer) (Chrysomelidae, Cassidinae): A Laboratory Comparison Among Four Species of Ipomoea (Convolvulaceae) Solange Maria Kerpel1 and Lenice Medeiros2 1

Programa de Pós-Graduação em Ecologia, Universidade Federal do Rio Grande do Sul (UFRGS). Porto Alegre, 91501-970, RS, Brazil. Email: [email protected]. 2 Depto de Biologia e Química, CP 560, Universidade Regional do Noroeste do Estado do Rio Grande do Sul (UNIJUI). Ijuí, 98700-000, RS, Brazil. Email: [email protected].

ABSTRACT Botanochara impressa (Panzer) is a Neotropical cassidine that feeds on leaves and flowers of members of the Convovulaceae, mainly in the genus Ipomoea. In Ijuí County, Rio Grande do Sul State, Brazil, both larvae and adults feed on leaves of I. aristolochiaefolia and I. batatas (L.) Lam. Larvae and adults were reared on four sympatric species of Ipomoea; I. aristolochiaefolia, I. batatas, I. longicuspis, and I. cairica (L.) Sweet to determine the food plant influence on their survival, development time, fecundity, and egg viability. Larval and adult host-plant preference was determined in a choice trial, offering simultaneously leaf discs of the four Ipomoea species. No larvae or adults developed on I. cairica. The survival rate was greater for larvae reared on I. batatas, but the development time did not differ among the three host plants. Adult longevity and fecundity did not differ among the three Ipomoea hosts. A greater percentage of eggs on I. longicuspis were viable than on the other two hosts. Both larvae and adults rejected I. cairica. Adults did not show preference for any of the three species of Ipomoea while larvae preferred I. aristolochiaefolia. The possible mechanisms involved with the observed patterns are discussed. KEY WORDS: host-plant selection, preference, Botanochara impressa, Chrysomelidae, Cassidinae, Ipomoea

RESUMO Botanochara impressa (Panzer) é um cassidíneo Neotropical que se alimenta de flores e folhas dos membros de Convovulaceae, sobretudo do gênero Ipomoea. No município de Ijuí, estado do Rio Grande do Sul, Brasil, as larvas e os adultos se alimentam de folhas de I. aristolochiaefolia e I. batatas (L.) Lam. Larvas e adultos foram criados em quatro espécies simpátricas de Ipomoea; I. aristolochiaefolia, I. batatas, I. longicuspis e I. cairica (L.) Sweet, a fim de determinar a influência das plantas hospedeiras na sobrevivência, tempo de desenvolvimento, fecundidade e viabilidade dos ovos. A preferência alimentar de larvas e adultos foi verificada em um experimento de escolha, oferecendo-se, simultaneamente, discos foliares das quatro espécies de Ipomoea. Nenhuma larva ou adulto se

202

Solange Maria Kerpel & Lenice Medeiros

desenvolveu em I. cairica. A taxa de sobrevivência foi maior para as larvas criadas em I. batatas, mas o tempo de desenvolvimento não diferiu entre as três plantas hospedeiras. A longevidade e fecundidade dos adultos não diferiram entre as três espécies de Ipomoea. A maior viabilidade dos ovos foi encontrada naqueles depositados por fêmeas alimentadas com I. longicuspis. As larvas e adultos rejeitaram I. cairica. Os adultos não apresentaram preferência por qualquer Ipomoea, enquanto as larvas preferiram I. aristolochiaefolia. Os possíveis mecanismos envolvidos com os padrões observados são discutidos. INTRODUCTION Food utilization by any herbivore is not an indiscriminate event. On the contrary, there is often a strong correspondence between plant and animal taxa, suggesting the occurrence of coevolution between the herbivores and their hosts (Ehrlich and Raven, 1964; Cates, 1980; Futuyma et al., 1993). The selection of food by insects involves complex behavioral mechanisms (Dethier, 1980, 1982; Feeny et al., 1983) and, although the host represents a nutritional resource, nutritionally adequate plants are not always selected and vice-versa (Hanson, 1983; Thompson, 1988; Denno et al., 1991). The cassidine beetles tend to be highly specialized in their feeding habits. In general, both larvae and adults feed in a limited group of plants and in some cases on a single host (Buzzi, 1988, 1994; Jolivet, 1988; Jolivet and Hawkeswood, 1995). Buzzi (1994) listed 170 Neotropical cassidine species and their hosts, pointing that near 50% are strictly monophagous, and 24.1% live on only two plant species. Although the Cassidinae represents an important group for experimental studies on the evolution and maintenance of insect-plant interactions, there are still relatively few studies available for most species. Botanochara impressa (Panzer) is abundant in the Neotropics, and is found in Argentina, Bolivia, Brazil, Paraguay, and Peru feeding on leaves and flowers of several species of Convovulaceae, mainly on genus Ipomoea Linn. (Borowiec, 1996; Buzzi, 1988, 1994; Habib and Vasconcellos-Neto, 1979). Habib and Vasconcellos-Neto (1979) studied some biological aspects of B. impressa in Campinas, SP, Brazil. In that locality larvae and adults feed on leaves of I. acuminata (Vahl) Roem. & Schult. and I. purpurea (L.) Roth, which grow in cotton fields. The authors suggest that B. impressa should be evaluated as a biological agent to control Ipomoea weeds. Indeed, due to their food specialization some Cassidinae have been investigated as potential agents for the biological control against weedy plants in some world regions (Hill and Hulley, 1995, 1996; Olckers and Zimmermann, 1991; Siebert, 1975). In Ijuí County, Rio Grande do Sul State, Brazil, both larvae and adults feed on leaves of I. aristolochiaefolia G. Don. and I. batatas (L.) Lam., whose tubers are used in human diet and are economically important. In this region, B. impressa is found in field from mid December to the end of April, the populations peak is in February (Kerpel and Medeiros, unpublished). The aim of this study was to use laboratory trials to compare performance and food preferences of B. impressa on four species of Ipomoea, which naturally occurs in disturbed places, such as highway borders, fallow lands, and in soybean and maize fields in Ijuí, RS, Brazil. MATERIALS AND METHODS Larvae and adults of B. impressa were collected in spring and summer of 1996 and 1997, from naturally occurring Ipomoae batatas, and kept in an environmental chamber (25 ± 1°C; 14:10 L:D; ca.

Performance and Food Preference of Botanochara Impressa (Panzer) ...

203

70% relative humidity), at the Zoology Department of University of Northwest of Rio Grande do Sul State (UNIJUI), Ijuí, RS, Brazil. The plants used to feed the insects were grown from seedlings and tubers of I. aristolochiaefolia and I. batatas, respectively. The leaves of I. longicuspis Meissn. and I. cairica (L.) Sweet were taken from field plants. The leaves used to feed insects were always freshly picked. To determine the larval survival and development time on the four Ipomoea species, eggs were collected from females that were kept on potted plants of I. batatas. Four groups of 100 eggs were transferred to plastic Gerboxes (11.5 cm sides X 3.5 cm high) covered with moistened filter paper, and containing fresh leaves of one of each host plant, I. batatas, I. aristolochiaefolia, I. longicuspis or I. cairica. The food was changed daily, and the life stage of the beetles were noted, until their death or adult emergence. Larval survivorship curves were compared with logrank tests (a = 0.05) (Motulsky, 1999). The development time on each host plant was compared by ANOVA followed by Tukey’s tests (a = 0.05). Just after adult emergence, ten pairs were isolated and maintained in plastic Gerboxes containing leaves of the same host plant on which the male and female developed. The lifespan, fecundity and egg viability were determined for each pair. The results on longevity were compared through nonparametric tests (Kruskal-Wallis) because the variances were not equal (Zar, 1996). Fecundity was compared by ANOVA followed by Tukey’s tests (a = 0.05). Egg viability was determined based on the percent of hatched eggs related to total deposited. Percentages hatched on each specie of Ipomoea were compared with Chi-square tests ((a = 0.05). The choice trials were conducted with first instar larvae from eggs deposited by females reared in I. batatas, I. aristolochiaefolia or I. longicuspis (n=20 per host plant). Immediately after hatching, larvae were placed in petri dishes (5.6 cm of diameter) that were lined with moistened paper filter. Four discs (area=113 mm2 per disc) perforated from fresh leaves of each host plants were placed in alternate and equidistant positions, following specific and variable combinations to avoid any position effect (Singer, 1986). The larvae were placed in the center of the dishes and kept in an environmental chamber (conditions as described above) for 24 hours. The same procedure was used for the adults, but each adult was offered eight leaf discs, two of each host plant. The consumed area of each leaf disc was determined based on the overlapping of these on graph paper and counting the number of missing squares. The leaf area consumed was compared through the nonparametric Kruskal-Wallis tests, since residuals did not follow the normal distribution (Zar, 1996). RESULTS The larvae of B. impressa fed I. batatas leaves had significantly higher survival, compared to those fed I. aristolochiaefolia and I. longicuspis. When fed I. cairica, all larvae died while in the first instar, although some individuals survived for eight days (Figure 1). Larval developmental time did not differ among the other three species of Ipomoea. Adult longevity and fecundity, expressed as mean egg number per female during their life, also did not vary in relation to host-plants species. Egg viability varied depending on the maternal host plant and was greater for those fed I. longicuspis followed by those fed I. batatas and I. aristolochiaefolia (Table 1). The results of the choice tests confirm that both larvae and adults do not feed on I. cairica. The adults did not show preference for any species of Ipomoea, as the area consumed did not significantly differ among the three Ipomoea that were not rejected. On average, larvae consumed significantly more I. aristolochiaefolia than I. longicuspis and I. batatas (Table 2).

204


I. batatas

I.aristolochiaefolia

I. longicuspis

I. cairica

100

Survivors (%)

80 a

60 b

40

b

20 c

0 0

5

10

15

20

25

30

Time (days) Fig. 1. Survival curves of Botanochara impressa (n=100) from hatching to adult emergence, fed on one of four Ipomoea species. Lines followed by the same letters do not significantly differ (Logrank tests; α = 0.05). Table 1. Performance components of Botanochara impressa larvae and adult fed three Ipomoea species. Host-plant

Mean (± SE) larval Mean (± SE) adult Mean (± SE) egg Egg viability development time (days)1 longevity, in days (n=60)2 number (per 9 females)1 (%)3

I. aristolochiaefolia 25.5 ± 1.18a(n=24) I. batatas 26.8 ± 1.15a(n=33) I. longicuspis 24.8 ± 0.96a(n=34)

142.8 ± 23.88a 136.7 ± 20.31a 118.7 ± 12.57a

798.1 ± 266.4a 1093 ± 186.5a 617.2 ± 133.1a

48.8c 53.9b 68.7a

Means followed by different letters significantly differ (ANOVA followed by Tukey´s tets; α = 0.05). Means followed by different letters significantly differ (Kruskal-Wallis tests; α = 0.05). 3 Percent followed by different letters significantly differ (Chi-aquare tests; α = 0.05). 1

2

Table 2. Mean (± SE) leaf area consumed by Botanochara impressa larvae (n=60) and adults (n=49) under a choice test with four Ipomoea species. Plant species I. aristolochiaefolia I. batatas I. cairica I. longicuspis

Leaf area (mm2) consumed by larvae

Leaf area (mm2) consumed by adults

4.267 ± 0.599a 0.767 ± 0.288b 0 1.208 ± 0.373c

72.39 ± 13.98a 39.67 ± 10.26a 0.20 ± 0.2b 33.59 ± 8.77a

Means followed by different letters significantly differ (Kruskal-Wallis tests; α = 0.05).


205

DISCUSSION Throughout its geographical range, B. impressa feeds on several Ipomoea species (Buzzi, 1994, 1996; Habib and Vasconcellos-Neto, 1979). At Ijuí County, I. aristolochiaefolia, I. batatas, I. longicuspis and I. cairica are very common and occur together at the same localities. Frequently their branches are intertwined, but B. impressa is never found feeding on I. longicuspis and I. cairica in the field. Under laboratory conditions both larvae and adults did not accept I. cairica. In fact, all larvae died due to starvation when reared with this plant, as they did not ingest the plant. Also, no larvae choose I. cairica during the choice tests, and only one adult did. The mechanisms involved in host plant selection by herbivore insects have been widely studied and several factors are thought to mediate host choice (e.g. Cates, 1980; Dethier, 1982; Feeny et al., 1983; Hanson, 1983; Jaenike, 1990; Jones, 1991; Rausher, 1992; Bernays and Chapman, 1994). The acceptance of a host plant by herbivores is mediated by two major kinds of mechanisms: pre- and post- ingestives (Scriber and Slansky, 1981). The pre-ingestive mechanisms are related to plant attributes associated with the herbivore’s capability of initial consumption, and include characteristics such as leaf toughness, density of trichomes, types and concentration of volatile allelochemicals (Dethier, 1980, 1982; Scriber and Slansky, 1981). Considering that in this study both larvae and adults of B. impressa rejected I. cairica it is possible that this plant presents some chemical and/or mechanical restrictions that impairs its use by this beetle. Although B. impressa do not feed on I. longicuspis under natural conditions, this plant was suitable to larval development and adult survival in the laboratory. In addition, the viability of the eggs deposited by females fed with this plant was greater than those deposited by females reared on their natural host plants. The incorporation of new host plants in herbivores’ diet must be favored by similar chemical properties among food plants (Erhlich and Raven, 1964). In this sense it is probable that I. longicuspis presents chemical similarities (nutritional and allelochemicals) to the natural B. impressa host plants, I. batatas and I. aristolochiaefolia. This idea is reinforced by the fact that other cassidine species are found utilizing these three Ipomoea as food in Ijuí (Kerpel and Medeiros, 1996). The greater egg viability from females that were reared on I. longicuspis indicates that in addition to being a suitable host, this plant may provide nutritional contents that are better assimilated by females. The question that arises is why I. longicuspis is not used by B. impressa under natural conditions. The best host plants in laboratory may not be the best in the field, considering that larvae on this host can be prone to natural enemies attacks, and also to competition (Bernays and Graham, 1988). The larvae of cassidine usually carry a shield formed from old exuviae and/or feces behind their back, which provide protection from predators (Eisner, 1967; Olmstead and Deeno, 1993; Olmstead, 1994). It has been shown that host-plants metabolites can be incorporated into cassidine larval shields (Morton and Vencl, 1998). Muller and Hilker (1999) showed that plant derived volatiles from fecal shields of Cassida spp vary depending on host chemical composition and, in some cases, attract generalist predators. So, it is possible that larvae can be better protected on some hosts than on others, which could help explain why plants that are suitable to survival and development on laboratory are not used under natural conditions. Also, field variation in plant abundance and/or nutritional quality may affect its use as a host, although this cannot be easily incorporated into laboratory trials (Nylin and Janz, 1996). For cassidine beetles, the host plant of larvae and adults is usually the same and one could expect a similar food-plant effect on both. However, for B. impressa there was not a tight correspondence between larval and adult preference and performance. The adults consumed more I. aristolochiaefolia

206


than the other Ipomoea, but the differences were not significant, indicating no preference for any host. It is probably because the three Ipomoea confers similar longevity and fecundity. On the other hand, I. batatas provided the higher larval survival rate, but I. aristolochiaefolia was preferred on the choice tests. The lack of correspondence between the preferred plants and those that provides better performance is not unusual. In fact, it has been demonstrated that for some species of insect the females prefer hosts that do not confer the best larval performance (Deeno et al., 1990; Thompson, 1988; 1996). We believe that B. impressa larvae preferred I. aristolochiaefolia due to its leaf anatomical properties. Additional observations (Kerpel and Medeiros, unpublished) showed that this plant presents smoother leaves with very low trichome density compared to I. batatas and I. longicuspis. For newly hatched larvae these leaf characteristics may facilitate and or not impair feeding activity, although this plant does not confer the best performance. Additional observations and experiments are necessary to better explain this apparent contradiction. ACKNOWLEDGEMENTS The authors thank the colleagues Thiago K. dos Santos and Candice G. Spies for helping on laboratory tests and rearing. We also are grateful to David Furth who encouraged us to write this manuscript, and to Karen Olmstead for useful comments that improved the manuscript. Financial support granted to Solange M. Kerpel came from a CNPq scholarship (PIBIC). LITERATURE CITED Bernays, E. A. and M. Graham. 1988. On the evolution of host specificity in phytophagous arthropods. Ecology 69:886-892. Borowiec, L. 1996. Faunistic records of Neotropical Cassidinae (Coleoptera: Chrysomelidae). Pol. J. Entomol. 65:119-251. Buzzi, Z. 1988. Biology of Neotropical Cassidinae, pp. 559-580. In: P. Jolivet; E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, Buzzi, Z. 1994. Host plants of Neotropical Cassidinae, pp. 205-212. In: P. Jolivet; M. L. Cox, E. Petitpierre and T. H. Hsiao (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Cates, R.G. 1980. Feeding patterns of monophagous, oligophagous and polyphagous herbivores: the effect of resource abundance and plant chemistry. Oecologia 46:22-31. Deeno, R. F., S. Larsson and K. L. Olmstead. 1990. Role of enemy-free space and plant quality in host-plant selection by willow beetles. Ecology 71(1):124-137. Eisner, T., E. V. Tassel and J. E. Carrel. 1967. Defensive use of a “fecal shield” by a beetle larva. Science 158:1471-1473. Dethier, V. G. 1980. Evolution of receptor sensitivity to secondary plant substances with special reference to deterrents. Am. Natur. 115: 45-66. Dethier, V. G.1982. Mechanism of host-plant recognition. Entomol. Exp. Appl. 31:49-56. Ehrlich, P. R. and P.H. Raven. 1964. Butterflies and plants: A study in coevolution. Evolution 18:586-608. Feeny, P., L. Rosenberry and M. Carter. 1983. Chemical aspects of oviposition behavior in butterflies, pp. 2776. In: S. Ahmad (Ed.), Herbivorous insects: Host seeking behavior and mechanisms. New York, Academic Press.


207

Futuyma, D. J., M. C. Keese and S. J. Scheffer. 1993. Genetic constraints and the phylogeny of insect-plant associations: responses of Ophraella communa (Coleoptera: Chrysomelidae) to host plants of its congeners. Evolution 47:888-905. Habib, M. E. M. and J. Vascocellos-Neto. 1979. Biological studies of Botanochara impressa Panzer, 1789 (Coleoptera: Chrysomelidae). Rev. Biol. Trop. 27(1):103-110. Hanson, F. E. 1983. The behavioral and neurophysiological basis of food plant selection by lepidopterous larvae, pp. 3-23. In: S. Ahmad (Ed.), Herbivorous insects: Host seeking behavior and mechanisms. Academic Press, New York. Hill, M. P. and P. E. Hulley. 1995. Biology and host range of Gratiana spadicea (Klug, 1829) (Coleoptera: Chrysomelidae: Cassidinae), a potential biological control agent for the weed Solanum sisymbriifolium Lamarck (Solanaceae) in South Africa. Biol. Control 5:345-352. Hill, M. P. and P. E. Hulley. 1996. Suitability of Metriona elatior (Klug) (Coleoptera: Chrysomelidae: Cassidinae) as a biological control agent for Solanum sisymbriifolium Lamarck (Solanaceae). African Entomol. 4:117-123. Jaenike, J. 1990 Host specialization in phytophagous insects. Ann. Rev. Ecol. Syst. 21:243-273. Jolivet, P. 1988. Food habits and food selection of Chrysomelidae: bionomic and evolutionary perspectives, pp. 1-20. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Jolivet, P. and T. J. Hawkeswood. 1995. Host-plants of Chrysomelidae beetles of the world: an essay about the relationships between leaf beetles and their food-plants. Leiden, Backhuys Publishers, 281 pp. Jones, R. E. 1991. Host location and oviposition on plants, p. 108-137. In: W. J. Bailey and J. Heidsdill-Smith (Eds.), Reproductive behavior of insects: Individuals and populations. New York, Chapman and Hall. Kerpel, S. M. and L. Medeiros 1996. Ciclo evolutivo de Botanochara impressa (Panzer, 1798) (Coleoptera, Chrysomelidae, Cassidinae) em quatro espécies de Convovulaceae. In: III Congresso de Ecologia do Brasil, 1996, Brasília, DF, Brasil. Resumos, v. 1:355. Muller, C. and M. Hilker. 1999. Unexpected reactions of a generalist predator towards defensive devices of cassidine larvae (Coleoptera, Chrysomelidae). Oecologia 118:166-172. Morton, T. C. and F. V. Vencl. 1998. Larval beetle form a defense from recycled host-plant chemicals discharged as fecal wastes. J. Chem. Ecol. 24:765-785. Motulsky, H. 1999. Analyzing data with graph pad prism software. Graph Pad Software, San Diego. Nylin, S. and N. Janz. 1996. Host plant preferences in the comma butterfly (Polygonia c-album): Do parents and offspring agree? Ecoscience 3:285-289. Olckers, T. and P. E. Hulley. 1995. Importance of pre-introduction surveys in the biological control of Solanum weeds in South Africa. Agric. Ecos. and Environm. 52:179-185. Olmstead, K. L. 1994. Waste products as chrysomelid defenses, pp. 311-318. In: P. Jolivet; M. L. Cox, E. Petitpierre and T. H. Hsiao (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht. Olmstead, K. L. and R. F. Deeno. 1993. Effectiveness of tortoise beetle larval shields against different predator species. Ecology 74(5):1394-1405. Rausher, M. D. 1992. Natural selection and the evolution of plant-insect interactions, pp. 20-88. In: B. D. Roitberg and M. B. Isman (Eds.), Insect chemical ecology: An evolutionary approach. Chapman and Hall, New York. Scriber, J. M. and F. Slansky, Jr. 1981. The nutritional ecology of immature insects. Ann. Rev. Entomol. 26: 183-211. Siebert, M. W. 1975. Candidates for the biological control of Solanum eleagnifolium Cav. in South Africa. I. laboratory studies on the biology of Gratiana lutescens (Boh.) and Gratiana pallidula (Boh.) (Coleoptera: Cassidinae). J. Entom. Soc. South Africa 38: 297-304.

208


Singer, M. C. 1986. The definition and measurement of oviposition preference in plant feeding insects, pp. 6594. In. J. Miller and J.A. Miller (Eds.), Plant-insect interactions. New York, Springer-Verlag. Thompson, J. N. 1988. Evolutionary ecology of the relationship between oviposition preference and performance of offspring in phytophagous insects. Entomol. Exper. et Appl. 47:3-14. Thompson, J. N. 1996. Trade-offs in larval performance on normal and novel hosts. Entomol. Exper. Appl. 80:133-139. Zar, J. H. 1996. Biostatistical analysis. 3rd edition. New Jersey, Prentice Hall, 662p.

© PENSOFT Publishers Notes on the Sofia - Moscow

David G. Furth (ed.) 2003 Biology and Host Plants of the Australian Leaf BeetleSpecial Podagrica 209 Topics in ... Leaf Beetle Biology Proc. 5th Int. Sym. on the Chrysomelidae, pp. 209-212

Notes on the Biology and Host Plants of the Australian Leaf Beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) Trevor J. Hawkeswood1 and P. H. Jolivet2 1

270 Terrace Road, North Richmond, New South Wales, Australia, 2754 Email: [email protected] 2 67 Boulevard Soult, F-75012 Paris FRANCE

ABSTRACT A new host plant Solanum stelligerum Sm. (Solanaceae) is recorded for the Australian flea beetle Podagrica submetallica (Blackburn) (Coleoptera: Chrysomelidae: Alticinae) from Victoria Point, Brisbane, Queensland. Little is known of the biology of this species which has been previously recorded from species of Abutilon, Gossypium, Hibiscus, Sida (Malvaceae) and Duboisia, Solanum (Solanaceae) as well as from the purported host of Mentha (Lamiaceae).

INTRODUCTION The biology of the Australian flea beetle fauna (Coleoptera: Chrysomelidae: Alticinae) is poorly known. Recent publications by the first author and others (viz. Hawkeswood, 1988; Hawkeswood and Furth, 1994) have greatly increased the known host plants of a number of native species but there is almost an unlimited amount of data to be gathered at the present time. The need for more general biological observations has never been more acute due to a lack of entomologists, funding and the disappearance of beetle habitats through clearing and fires. Recent observations on the host plants and feeding behaviour of Podagrica submetallica (Blackburn) a native Australian species are provided below. OBSERVATIONS During 26 December 2000, the first author closely examined several living plants of Solanum stelligerum Sm. (Solanaceae) at Eprapah Park, Victoria Point, near Brisbane, south-eastern Queensland during hot, moist weather conditions, with temperatures over 30 degrees Celsius. The Solanum plants were growing in two main clumps either side of a sealed track in the northern area of the park. The largest clump of the population of S. stelligerum was on the northern part of the track and appeared to be the least affected by feeding damage caused by P. submetallica. The southern part of the Solanum population was comprised of approximately 6 plants, all of which displayed feeding damage. Approx.

210

Trevor J. Hawkeswood & P. H. Jolivet

90-95% of the leaves of each plant had tiny holes resulting from Podagrica feeding. The leaves are linear-lanceolate to ovate-lanceolate and measure mostly 3-10 cm long and 1-1.5 cm wide. No beetles were observed on the adaxial (upper) side of the leaves and the flowers/fruits were also not affected. Examination of the abaxial (underside) of the leaves revealed a small number (less than 10) of adult P. submetallica but no larvae or eggs. The adults were very active and flicked away at the slightest disturbance. It appeared that most of the adult generation had completed its life stage and only a few beetles remained, two of which were collected for further reference. No other plants harboured beetles and no other insects were found on the Solanum plants at the time. Solanum stelligerum is commonly called Devil’s Needles because of the very sharp and dangerous prickles on the stems and sometimes on the leaves, which easily prick human fingers causing an awful sensation and often drawing blood. The undersurface of the leaves is covered in stellate and other hairs forming a dense tomentum. The adaxial side of the leaves is coloured dark green and the tomentose undersurface is greyish to light brownish in colour. Feeding by P. submetallica is between the minor veins and results in removal of 25-60% of the leaf mesophyll tissues. The position and size of the feeding holes indicate that the beetles nibble for a period of time, mostly creating irregular-shaped holes measuring 1.0-1.5 mm in diameter, before moving off to another part of the same leaf or another leaf. The large number of affected leaves and feeding holes indicates that the population of P. submetallica was probably much larger earlier in the season as the few beetles detected on 26 December could not have been responsible for all of the feeding damage observed. DISCUSSION Habitat The site at Victoria Point, south-eastern Queensland, comprises a complex mosaic of swampland (mangrove community) and vine-infested sclerophyll woodland habitats and which has suffered considerable degradation over the past 50 years or so, through frequent fires of various intensities and scope, partial clearing of shrubs and other vegetation, selective logging and some invasion by non-native plant species, e.g. Ochna serrulata (Hochst.) Walp. (Ochnaceae), Lantana camara L. (Verbenaceae), Cinnamomum camphora (L.) Nees and Eberm. (Lauraceae). However there remains a high diversity of native plants within the site, e.g. the tree (canopy) stratum is comprised of such species as Eucalyptus intermedia R. T. Baker, Eucalyptus umbra R.T. Baker, Eucalyptus crebra F. Muell., Lophostemon confertus Wilson & Waterhouse, Melaleuca quinquenervia (Cav.) S. T. Blake, Syncarpia glomulifera (Sm.) Niedenzu (Myrtaceae), Glochidion ferdinandii (Muell. Arg.) F. M. Bail. (Euphorbiaceae), Elaeocarpus reticulatus Sm. (Elaeocarpaceae), Casuarina littoralis Ait. (Casuarinaceae), Alphitonia excelsa (Fenzl) Benth. (Rhamnaceae) and others. The shrub layer is mostly sparse as a result of fires and partial habitat clearing, but comprises smaller specimens of the above-mentioned native trees as well as Acacia falcata Willd., A. fimbriata A. Cunn. ex G. Don., A. leiocalyx (Domin) Pedley, (Mimosaceae), Ficus coronata Spin, F. opposita Miquel (Moraceae), Notolaea ovata R. Br. (Lauraceae), Jacksonia scoparia R. Br. (Fabaceae), Psychotria loniceroides Sieb. ex DC. (Rubiaceae), Solanum stelligerum Sm. (Solanaceae) and Callistemon citrinus (Curtis) Skeels (Myrtaceae). There is a preponderance of native and introduced vines and brambles at the site indicating the disturbed nature of the habitat. These vines and brambles include the following species: Parsonsia straminea (R.Br.) (Apocynaceae), Passiflora suberosa Sims (Passifloraceae), Rubus moluccanus L. (Rosaceae), Eustrephus latifolius R. Br. ex Ker-Gawl. (Philesiaceae) and Cayratia clematidea (F. Muell.) Domin, Cissus antarctica Vent. (Vitaceae). The site also contains

Notes on the Biology and Host Plants of the Australian Leaf Beetle Podagrica ...

211

numerous species of native and introduced ferns and grasses as well as other small native herbs, e.g. Lomandra spp. (Lomandraceae), Pseuderanthemum variabile (R. Br.) Radlkofer (Acanthaceae). The site, despite being altered from its original condition by human-induced influences and by the effects from the introduction of non-native plants and animals (e.g. dogs and cats), is probably in a disclimactic state, but with a majority of the pre-settlement plant species still extant, such that a relatively high biodiversity of plant species is still present. In effect, the reserve acts as an island community surrounded by housing developments. Associated with this plant diversity appears to be a comparatively high diversity of insect species (Hawkeswood, 1980-2000, personal observations). Host plants of P. submetallica Seven species of chrysomelid were obtained from the Park during a morning’s survey despite fire having damaged most of the site during the previous year. The record of P. submetallica from Solanum stelligerum is one of the interesting discoveries since no Australian chrysomelid has been recorded previously from this plant which is endemic to coastal areas of eastern Australia (Robinson, 1997). However, P. submetallica has been recorded previously from one other Solanum species (introduced) and other genera from the Solanaceae as well as Malvaceae: Abutilon sp. (Malvaceae)(Turner, 1934; Hawkeswood and Furth, 1994); Sida cordifolia L. (Malvaceae) (Hawkeswood, 1988; Hawkeswood and Furth, 1994); Hibiscus cannabinus L. (Malvaceae)(Kay and Brown, 1991; Hawkeswood and Furth, 1994); Sida rhombifolia L., Gossypium hirsutum L., Hibiscus heterophyllus Vent. (Malvaceae), Duboisia leichhardtii (F.Muell.) F. Muell., Solanum mauritianum Scop. (Solanaceae) (Hawkeswood and Furth, 1994). The beetle has also been recorded feeding (presumably) from the flowers of Leucaena sp. (Caesalpiniaceae) in Queensland (Hawkeswood and Furth, 1994). From the information which has been recorded to date, it appears that adults of P. submetallica may feed on flowers as well as leaves of host plants, although some species of Podagrica may show flower or leaf-feeding only and not both. Seed feeding has not been verified but a possibility. Turner (1934) briefly noted that this species (cited as Nisotra submetallica) fed as adults on the flowers of Abutilon sp. (Malvaceae) on Masthead Island, off the Queensland coast. Hawkeswood (1988) recorded adults feeding on the petals and pollen from the open flowers of Sida cordifolia L. (Malvaceae) in north-eastern Queensland. Hawkeswood and Furth (1994) suggested, based on the data present at that time, that P. submetallica is closely associated with Malvaceae and possibly Solanaceae. The new record above from Brisbane, Queensland confirms that Solanaceae are also important in the nutrition of this alticine. Jolivet (1991) and Jolivet and Hawkeswood (1995) noted that various genera of Malvaceae were the preferred hosts of Podagrica (and the closely related if not synonymous Nisotra) but did not list Solanaceae. Malvaceous plants may still be the preferred hosts of P. submetallica and other Podagrica (Nisotra) species, but in the absence of these, the secondary hosts become the plants consumed in any one area. Such a strategy is common in Alticinae and other subfamilies of Chrysomelidae, and this has been undoubtedly one factor leading to their evolutionary success as well as pre- and post-mating feeding and feeding on pollen and flowers of non-host plants (e.g. Hawkeswood and Furth, 1994; Jolivet and Hawkeswood, 1995). Furthermore, it is interesting to note that Froggatt (1907) briefly noted that this species (cited as Nisotra submetallica) fed on “mint” leaves (presumably Mentha sp., Lamiaceae); Jolivet (1991) and Jolivet and Hawkeswood (1995) regarded the record of Mentha sp. as a host by Froggatt (1907) as a record of an accidental occurrence and that the record needed confirmation in the absence of recent observations. However, it should be noted that for the European species, P. malvae (Illiger) which normally feeds on certain Malvaceae (e.g. Biondi, 1993; Vig, 1996;

212

Trevor J. Hawkeswood & P. H. Jolivet

Petitpierre, 1999) has also recently been recorded from an unidentified species of Marrubium (Lamiaceae) by Petitpierre (1999), as well as Asteraceae and Cistaceae (Helianthemum sp.) (Petitpierre, 1999). This kind of host-plant selection (polyphagy) by alticines such as Podagrica suggests a preadaptation in the adult stage for feeding on non-related host-plants. Hence the Australian P. submetallica may also possess a pre-adaptation for feeding on Lamiaceae (and other plant groups such as Solanaceae) during times of shortage or absence of the normal hosts of Malvaceae. This preadaptation may have been an important factor in the evolutionary success of these chrysomelid beetles as well as the food selection of not only leaves but flowers and pollen of the host plants as additional and important nutritive sources during egg production. It should be noted that botanically, the Lamiaceae and Malvaceae are not closely related. Further field observations throughout the range of this species in Queensland should yield further hosts. ACKNOWLEDGEMENTS Thanks are expressed to M. Biondi (Italy), E. Petitpierre (Spain) and K. Vig (Hungary) for sending their valuable reprints to the authors. Rod Eastwood, Brisbane, Queensland sent the first author a copy of the paper by Kay and Brown (1991). REFERENCES Biondi, M. 1993. Il popolamento a Coleoptera Chrysomelidae dell’appennino umbro-marchigiano: considerazioni zoogeografiche ed ecologiche. Biogeographica 27:321-365. Froggatt, W. W. 1907. Australian Insects. W. Brooks & Co., Sydney. Hawkeswood, T. J. 1988. A survey of the leaf beetles (Coleoptera: Chrysomelidae) from the Townsville district, northern Queensland, Australia. Giornale Italiano di Entomologia 4:93-112. Hawkeswood, T. J. and D. G. Furth 1994. New host plant records for some Australian Alticinae (Coleoptera: Chrysomelidae). Spixiana 17:43-49. Jolivet, P. 1991. Selection trophique chez les Alticinae (Col. Chrysomelidae). Bulletin de la Societe Linnéenne de Lyon 60:26-40, 53-72. Jolivet, P. and T. J. Hawkeswood 1995. Host-plants of Chrysomelidae of the World. An essay about the relationships between the leaf-beetles and their food-plants. Backhuys Publishers, Leiden, The Netherlands, 281 pp. Kay, I. R. and J. D. Brown 1991. Insects associated with kenaf in northern Queensland. Australian Entomological Magazine 18:75-82. Petitpierre, E. 1999. Catalog dels coleopters crisomelids de Catalunya IV. Alticinae. Bull. Inst. Cat. Hist. Nat. 67:91-129. Robinson, L. 1997. Field guide to the native plants of Sydney. Revised 2nd Edition, Kangaroo Press, Kenthurst, Sydney, 448 pp. Turner, A. J. 1934. Notes on insects of Masthead Island, Qd. In: H. Hacker, Exhibits. Minutes Entomological Society of Queensland, June 1934, 20:1-2. Vig, K. 1996. Leaf beetle fauna of Western Transdanubia (Hungary)(Coleoptera: Chrysomelidae sensu lato). Praenorica, Folia Hist. Nat. 3:1-178. (In Hungarian with English title and summary).

David G. Furth (ed.) 2003 © PENSOFTBiological Publishers and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ... Beetle Biology 213 Special Topics in Leaf Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 213-225

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata Boheman 1854 (Coleoptera: Chrysomelidae: Cassidinae) F. A. Frieiro-Costa 1 and João Vasconcellos-Neto 2 1

Programa de Pós-Graduação em Ecologia.Universidade Estadual de Campinas - Inst. Biologia Depto. Zoologia. Campinas, SP, Brazil, 13083-970 2 Universidade Estadual de Campinas - Inst. Biologia - Depto. Zoologia CP 6109. Campinas, SP, Brazil, 13083-970. Email: [email protected]

ABSTRACT We studied a population of Omaspides tricolorata Boheman 1854, a species with maternal care at Serra do Japi, Jundiaí, São Paulo State, Brazil (23º 11’ S; 46º 52’ W) during almost three years (1988-1990). The life cycle of this species is closely tied to season and phenology of its host plant, Ipomoea alba L. (Convolvulaceae). Egg-clutch size varied form 28 to 80 eggs with an average of 55.1 ± 12.2 eggs (n = 56 clutches). Incubation period of egg stage was 15.5 ± 4.4 days (n = 120 clutches); mean duration of larval stage, containing five instars, was 28.0 ± 5.2 days (n = 86 larval groups) and pupal stage lasted 13.7 ± 5.3 days (n = 48 pupal groups). Immature life cycle lasted 57.3 ± 5.7 days (n = 48) and during these two months female took care of its offspring. All these biological data were obtained under field conditions. Adults appeared in October (spring), remained active until April when they entered diapause, and were hidden during winter dry season, starting the next reproductive cycle again in the next spring. The first egg-clutches were found in October (1988) or November (1989), showing two peaks of egg-clutch abundance: one in December and the other in February. The last egg-clutches were observed in April (1989) and March (1990), and females and their offsprings need at least two months to complete their life cycle. At this time (May) the cold dry season starts and the host plant shows old leaves, which fall during the winter. Females feed only during larval development of their offspring or before laying eggs. One female can take care of only two generations each reproductive period. Maternal care and cycloalexy are important behavior against natural enemies.

INTRODUCTION In spite of the great diversity of chrysomelid beetles, few studies examing their natural history, biology and population dynamics have been carried out in the field. Despite the fact that many species have singular ways of life, presenting extremely peculiar morphological and behavioural characteristics, studies on natural history are almost always left aside.

214

F. A. Frieiro-Costa & João Vasconcellos-Neto

Some tropical populations of Chrysomelidae beetles are active throughout the year (Nakamura et al., 1989; Macêdo et al. 1994; Sá and Macêdo, 1999). Nonetheless, other authors, studying other chrysomelid species in subtropical areas or close areas, show that they may undergo a winter diapause and reproduce in the summer. This seasonal pattern of population dynamics was described for Cassidinae (Frieiro-Costa, 1995; Becker and Freire 1996; Garcia and Paleari 1993; Sá and VasconcellosNeto, 2002), Chrysomelinae (Medeiros and Vasconcellos-Neto, 1994; Vasconcellos-Neto and Jolivet, 1998); Alticinae (Del-Claro, 1991b) and Megalopodinae (Nogueira-Pinto, 2000) in this same region. This same seasonality was observed for other insect groups like butterflies (Vasconcellos-Neto, 1991; Brown, 1992) and Tettigoniidae orthopterans (Del-Claro, 1991a). In this work we studied the biology, reproductive behaviour and population dynamics of the beetle Omaspides tricolorata Boheman (Chrysomelidae: Cassidinae) in natural conditions. Adults and larvae feed on one annual plant, Ipomoea alba L. (Convolvulaceae), with scandent habit and native to tropical America. Study Area This work was conducted in southeastern Brazil, at Serra do Japi (23º 11’ S / 46º 52’ W), a mountainous area covered by a semideciduous mesophitic altitude forest (Leitão-Filho, 1992) at the south limit of tropical zone in São Paulo State, Brazil. The climate in the area is classified as Cwa, according to Koppen system, corresponding to the tropical moist type. Because of the large range of altitude (700 m to 1300 m above sea level), mean temperature varies from 11.8º to 18.4º C in July (the coldest month) to 18.4º to 22.2º C in January (warmest month) (Pinto, 1992). Rainfall is higher

Fig. 1. Omaspides tricolorata female taking care of her offspring. Female can copulated with male when taking care its egg-clutch.

Biological and Ecological Studies on the Tortoise Beetle Omaspides tricolorata ...

215

in December and January when precipitation can reach 250 mm per month, but during the winter, June to August, the colder months, mean precipitation in this period is 41 mm. Climatic conditions result in two distinct seasons during the year: a warm and rainy summer and a cold and dry winter (Pinto, 1992). We concentrated our study along one track “Paraiso III” (1000 to 1070 m of altitude) at one extension of 3.6 km. At this site, vegetation was basically of short trees (20 m high) of low diameter (Leitão-Filho, 1992). MATERIALS AND METHODS We made 111 trips to Serra do Japi, totalizing 1009 hours of observation, and of these, 45 were nocturnal, during two Omaspides tricolorata biological cycles (August 1988 to August 1990). We marked and counted 332 individuals of Ipomoea alba along the 3.6 km in Paraíso III track boards. The number of plants was not constant during the period; those that grew or regrew during the cycle were incorporated into the total number, and those that died were deducted. For each plant found during the visits, the following plant phenology aspects were registered: branch re-growth; presence of young, mature and senescent leaves; and senescence period with leaves loss and branch dryness. For each plant, we registered the number of adult beetles (males and females) which were classified as young or mature, depending on the chitinization degree and elytral color. Each adult had its elytra slightly scraped and was individually numbered with permanent ink so that we could follow its longevity, number of offspring, period of offspring care and development time. Numbering the mother beetle also represented a way of offspring individualization. It was also registered the presence of guarded or non guarded egg-clutch by the mother, being each egg-clutch in this way followed until adults’ emergence. After larval eclosion and adult emergence, the rest of the egg clutch and exuviae were taken to the laboratory where egg and pupae number were counted. The accompanying observation of each offspring development period, in their different stages, was done in field conditions. Feeding Habits Omaspides tricolorata adults are found in feeding and reproductive activities from the middle of October (spring) until April, entering diapause from May on. This species is monophagous, feeding only on Ipomoea alba, despite occurring on four other Convolvulaceae species in the study area (Ipomoea cairica, I. bona-nox, Ipomoea sp. and Merremia sp.). Ipomoea alba is a liana which grows in open areas supported by other support-plants and little shaded places along tracks and small roads in forest areas. Each plant contains on average three branches with eighteen leaves per branch. Leaves measure on average 100.3 ± 30.3 mm in length and 80.9 ± 40.3 mm in width (n = 30 plants). The plant loses its already senescent leaves from the middle of autumn on and the branches dry. New branches regrow about the end of winter (September), having mature leaves again in the beginning of spring. From October to March, there is a large quantity of mature leaves and from April and May on leaves begin to show signs of senescence and then fall during the winter. This cycle probably repeats itself as a function of climatic seasonality. Herbivory marks left on leaves by larvae or adults are good indicators of the beetle development stage. First and second larval stadia feed only between the veins, scratching the leaf surface and leaving the leaf with a skeletonized appearance. Third and fourth larval stadia eat the leaf entirely,

216


including the veins (main and secondaries) and the petiole. Adults only feed on the foliar surface, beginning either an undamaged leaf or at some already existant holes in the leaf surface. Immediately after eclosion, larvae place themselves around the egg-clutch and begin to feed, moving on and eating the leaf in the direction of the petiole and from there go on to another leaf. The larval group, when moving from an eaten leaf to an intact leaf, walks in line on the petiole and main vein to the distal edge of the leaf, and only then do they begin to feed. Maternal Care and Cycloalexy Omaspides tricolorata females lay eggs in clutches and take care of them during the entire egg development not feeding on her host plant. When larvae eclose, they stay around the egg-clutch before starting to feed. After that, they abandon the egg-clutch and, during the day, form defense rings (cycloalexy) in which the external individuals keep themselves with the anal regions turned to the outside and the heads turned towards the inside of the circle. Whenever the larvae are in cycloalexy, the guarding-mother remains over or close to them. In evening crepuscule, larvae go in a line to the distal leaf portion to feed, and afterwards return to the ring formation during morning crepuscule. When the female notices the appearance of a natural enemy through its movement on the leaf, it attacks it. Defense ring formation (cycloalexy) was also described for the larvae of other chrysomelid species, including tortoise beetles (Vasconcellos-Neto and Jolivet, 1988,1994). When larvae complete development, they migrate to the plant base, forming an aggregation on one of the branches, staying one attached to the other. During pre-pupae and pupae phase, the mother guards over its offspring until the adults emerge. Contrary to some subsocial insect species in which females take care of only one offspring and then die (e.g. Dias, 1975; 1976), O. tricolorata females can be active for at least two reproductive cycles. In some situtations, when the female is attacked or notices some imminent danger, she may fall to the ground, abandoning the offspring for some minutes, escaping from a potential predator’s action. Because the egg-clutch is located in regions less visited by ants, the guardian mother can come back before it has been attacked. BIOLOGY Egg-clutch O. tricolorata egg-clutch consists of eggs solidly fixed together, positioned on the edge of a firmly tight peduncle of the leaf. The egg shape is oval, measuring 1.42 ± 0.11 in length and 0.61 ± 0.15 in width and they are not covered by membrane, feces or some other type of secretion, as is usually the case in tortoise beetles (Muir and Sharp, 1904; Gressitt, 1952; Chapman, 1969; Kosior, 1975; Hinton, 1981; Crowson, 1981; Frieiro-Costa, 1984; Buzzi, 1988; Jolivet, 1988). Shortly after oviposition, the eggs are amber-colored, changing gradually to straw yellow as the chorion hardens. This characteristic permits differentiation of the recently placed egg-clutches from those in place for more than five hours. The egg-clutches have a shape similar to a lozenge, containing on average 55.1 ± 12.2 eggs (n = 3,085 eggs in 56 clutches). Adults occur not only on plants that received direct solar light during the majority of the day, but also on plants in shaded locations. Nonetheless, the majority of the egg-clutches were on shaded plant leaves (n = 205) and only one egg clutch occured in a sunny location. Egg-clutches were placed on leaves measuring on average 100.6 ± 30.0 mm and 90.6 ± 20.8 mm in width (n = 134),


217

with no preference for larger leaves, as these did not significantly differ in relation to the average size of the plant leaves. All egg-clutches were located on the abaxial surface of the leaves. Of these, 183 (89.30%) were deposited in the distal edge, always on the main vein and the other 22 egg-clutches (10.70%) were located on the leaf surface. On the leaf surface, there was no preference for a specific location; however, none of the egg-clutches were on the half of the leaf closest to the petiole. Six egg-clutches found on the leaf blade were on leaves which had the edge eaten by some other herbivores and we never observed egg-clutches on leaves which were green-colored and had the texture modified by age or some other factor. According to Chapman (1969) and Singer (1986), the choice of the egg deposition site has great importance on the survival of eggs and on the survival of the immatures after the eclosion. Other researchers have noticed that many cassidinae species prefer the abaxial surface to deposit their eggs. Frers (1922) observed that Chelymorpha indigesta (Boheman), C. variabilis (Boheman) and Metriona argentina Spaeth (a non-subsocial cassidinae) prefer to place their eggs on the abaxial leaf surface of their host plants, but the causes for this were not discussed. Kosior (1975), from his and many other authors’ observations mentioned that the majority of species in the genus Cassida prefer to oviposit on the abaxial leaf surface of their host plants, suggesting that this behavior is adaptive and would be acting as protection against environmental physical factors and against natural enemies. According to Frieiro-Costa (1984), the temperature is the ecological factor responsible for the oviposition on the Solanum sisymbriifolium Lam. (Solanaceae) abaxial leaf surface by Gratiana spadicea (Klug). In O. tricolorata, the temperature is probably one of the determinant factors of this kind of behavioral pattern, because, with one exception, no egg-clutches were found on plants exposed to the sun most of the day. Differences between the nutritional qualities and leaf toughness together with microclimate could be determining this population pattern of host plant use. In Serra do Japi, during summer, the temperature in open areas can reach 38ºC on the hottest days (Pinto, 1992), which can dehydrate and provoke the death of the O. tricolorata larvae. According to Wigglesworth (l972), Leptinotarsa sp. (Chrysomelinae) larvae die when water quantity in their bodies falls below 60 %; and Maw (1976) observed that the Cassida hemisphaerica Herbst. (Chrysomelidae: Cassidinae) first stadium larvae are very susceptible to dehydration. The oviposition behavior on distal portions of the leaf may have been selected for by ant predation. Ants visit the extrafloral nectaries located on leaf basal region of I. alba. Although ants patrol the leaf, the basal region closest to the extrafloral nectaries is visited with higher frequency. The eggclutches which were abandoned by the mother (n = 23) were attacked by ants. The necessary time for the egg incubation was 15.5 ± 4.4 days (n = 120 clutches). All eggs belonging to one egg clutch eclosed on the same day, with an interval of some hours between the first and the last one. Larval Stage The larval stage has five stadia and completes its development in 28.0 ± 5.2 days (n = 86 offspring). The larvae are straw-yellow colored with some brown spots in the upper region. They are long and dorso-ventrally flat, with various lateral spines and a furca on the last abdominal segment. The exuvia of each molt remains tightly attached to the furca, where feces can also be accumulated, forming a dorsal shield that may have a role in the defense against natural enemies. This has been noted for some other Cassidinae species (see Eisner et al. 1967; Olmstead and Denno, 1992, 1993; Olmstead, 1996). To accumulate the exuviae is a common peculiarity of all representatives of this

218


subfamily (Muir and Sharp, 1904; Frers, 1922; 1925; Takizawa, 1980; Freire, 1982) and allows one to determine the exact larval stadium by counting of the cephalic capsules. In general, cassidinae larvae lose the dorsal shield when pupating (Frers, 1922; Siebert, 1975; Vasconcellos-Neto, 1987; Buzzi, 1988), but O. tricolorata keeps it tightly attached to the last exuvia furca, which remains also tightly attached to the pupa. The greatest larval activity (feeding or displacement) occurred from the evening crepuscule continuing until approximately 11PM, when there is a pause. Activities resume around 4AM, ceasing by the end of morning crepuscule, which occurred around 6AM. Only when the day was cloudy, or shortly after it rained and temperatures were milder, were the larvae found feeding during other morning hours. In the afternoon, larvae were only active immediately after eclosion. Pre-pupal and Pupal Stages Larvae remained on leaves until the end of the fifth stadium, after which, they moved down onto one of the host plant branches to a more shaded and protected place near to the ground. Here they positioned themselves evenly overlapping, fixed by the abdominal edge, and begin the pre-pupae stage. Most of the time, larvae searched for the main branch and positioned themselves close to the region where this branch emerged from the ground. On two occasions, we found pupae fixed in circles on leaves, but in small numbers of three to five, respectively. Both of these sets were preyed upon, the one with five pupae by ants and other by a mantis. Shortly after reaching the pupal stage, they were yellow in coloration, which gradually darkens, and after approximately 24 hours, they were bright dark brown in color. The average duration of this phase (pre-pupae and pupal stages) was 13.7 ± 5.3 days (n = 48 offsprings). The total period of immature development was 57.3 ± 5.7 days. Comparing these results to those of non-subsocial tropical Cassidinae development (Freire, 1982; Vasconcellos-Neto and Habib, 1979; Vasconcellos-Neto, 1987; Buzzi, 1988), it was noticed that from egg development until adult emergence, O. tricolorata required an average period approximately two times longer. Windsor (1987) studied the tortoise beetle Acromis sparsa (Boheman) (Coleoptera: Chrysomelidae: Cassidinae) in Panama and observed that pupal development time varied from 10 to 17 days, but he did not refer to the other stages. Adult Stage Adults of Omaspides tricolorata adults average 10 mm in length and 5 mm in width. Generally, females are larger than males, and do not present other morphological characteristics that allow for easy identification of the sexes. Sexually matured adults have straw-yellow elytra, with a black line delineating the internal disc and light brown pronotum. When they emerge from pupa, the teneral adults have translucent elytra, and the black lines are not visible. Gradually, they become light green with slightly darker pronotum. After five or six hours, the elytra acquire the pronotal color and the black line is completely defined. The complete hardening of the elytra takes from five to seven days and they retain the light-green coloration during the rest of the cycle until entering diapause. These young adults were never observed in copula and/or guarding offspring in the same emergence cycle. All individuals found in copula and/or having offspring under their care had straw yellow coloration. In many species of the genus Cassida, adults only reach the final coloration after leaving diapause (Kosior, 1975).


219

POPULATION DYNAMICS Omaspides tricolorata adults diapause during the beginning of spring (October) in both cycles. Adult populations continued to be recruited from diapause until December and, from January on, the population increase happened through young greenish-colored adults recruitment. Young adults do not generally reproduce in the same cycle of their emergence, but only in the next cycle, after diapause. In both cycles, the adult population reached its peak during March. From mid-April with the reduction of precipitation, mean temperature and photoperiod, the adult population on I. alba started to decline, reaching zero in May. From the first week of May, they entered diapause, remaining this way during autumn and winter. Adults were sheltered under trunks, tree bark, bromeliaceae rosettes, and in other cavities close to the ground which gave them shelter. With the beginning of the spring rains, adults left their diapause sites (Fig. 2). The first egg-clutches were found by the end of October or beginning of November, occurring in two peaks: one in December and other in February (Fig. 3). The reproductive cycle goes from October to the beginning of April. In this six-month period, adults leaving diapause need to obtain necessary food to invest in reproduction, i.e., to find a partner, mate, oviposit their first egg-clutch (30 days) and take care of their offspring for at least two months. Generally, the mother stays with their adult offspring recently emerged, until the elytra are partially hard and they disperse (7 days). After that, the female must invest in feeding (20 days) to produce a second set of offspring, which for many individuals generally occurs between January and February. In this way, investing two more months taking care of their second set of offspring, it is then time to enter diapause. Therefore, a successful female can produce up to two sets of offsprings per reproductive cycle. According to ADULTS OF OMASPIDES TRICOLORATA 500

NUMBER OF INDIVIDUALS

450 400 350 300 250 200 150 100 50 0 A 88

S

O

N

D

J 89

F

M

A

M

J

J

A

S

O

N

D

J 90

F

M

A

M

J

J

A

Fig. 2. Omaspides tricolorata adult population dynamics (88/89 and 89/90) in Serra do Japi, Jundiaí, State of São Paulo, during two reproductive cycles. The number of host plant reached 155 individuals in the study site during the first cycle and 177 in the second. There are 332 marked individuals of I. alba in the study site.


220

NEW EGG-CLUTCHES 60

Nº OF NEW CLUCTHES

50

40

30

20

10

0 A 88

S

O

N

D

J 89

F

M

A

M

J

J

A

S

O

N

D

J F 90

M

A

M

J

J

A

Fig. 3. Number of O. tricolorata new egg-clutches monthly found, during two reproductive cycles 88/89 and 89/90, in Serra do Japi.

Williams (1966) and Cockburn (1991), the cost in offspring care, during four stages in the development cycle, must be replenished at some time. For O. tricolorata this replenishment is done in the period which precedes each oviposition and partially during the larvae feeding period. The Ipomoea alba population, which goes through the winter without leaves, begins to regrow leaves from the end of August and September, developing new and mature leaves by October. Adults of O. tricolorata begin to appear in their host plants in October and the majority only initiate oviposition during December, because there were difficulties in finding mates, or because they only abandoned their diapause sites after higher temperatures and denser rains. In this period, there are enough resources and good conditions for feeding and larvae development. On average, adults take care of their offspring for two months, the majority of the females are only ready for new oviposition in February. From then on, the amount of oviposition begins to diminish because most of the females are with offspring through the end of March and begining of April, until May when ovipositions are interrupted. From April on, the mean temperature begins to decrease and the majority of the host plant leaves are already senescent. Any other offspring at this time would have low probability of completing their development. During winter, the majority of the host plants are without leaves and some branches are completely dried. Clutch Survivorship In the first cycle, we followed the development of 74 egg clutch development. All of them, without exception were totally or partially attacked by natural enemies. A total of 23 egg clutches (31.1%) were attacked and totally destroyed. Of the 51 egg clutches where at least one individual


221

reached the larval stage, 12 (23.5%) were totally consumed by predators and/or parasitoids. Of the 39 remaining clutches, at least one individual managed to reach pupal stage. Natural enemies completely attacked 15 of these (38.5%), resulting in 23 offsprings, that reached the adult stage. Number of offspring in which there were adult emergences corresponds to 59% of the total of assemblages which reached pupal stage, and to 31.1% of those assemblages which were followed since egg stage. In total, 223 adults of these 23 offsprings emerged. In the second cycle, we followed the development of 131 egg clutches, 56.5% more than the previous period. In 81 of these (61.8%), there was eclosion of at least one egg. Of these clutches, 34 (42.0%) were totally preyed upon and, the 47 (58.0%) were partially attacked with some larva reaching pupal stage. From 25 clutches, (53.1%), at least one adult managed to emerge. The total number of adults derived from these assemblages was 288. In the two studied cycles, of the 205 egg clutches we followed there were emergences in 49 (23.4%) of those assemblages initially present in nature. Considering the number of clutches and the mean number of eggs per clutch, the total of adults which emerged in relation to the initial total of eggs corresponds to 5.5% survival in the first cycle and 4% survival in the second. In analyzing these data, it is observed that the percent assemblage survivorship is great when compared to other insects in general (Abbas, Nakamura and Hasyim, 1985; Nakamura, Pudjiastuti and Katakura, 1992) and particularly compared to other Cassidinae. This greater survivorship can be attributed to parental care efficiency, which reduces attacks by natural enemies on offspring and allow a greater number to reach the adult phase. Clutch Number and Longevity A total of 27 females produced two offspring in the same cycle, with 9 in the first and 18 in the second. The time interval between two offspring was 20.3 ± 4.1 days (n = 8). After oviposition, females remained without food for 16 days until larval eclosion. During offspring care, they feed only during the larval development period, remaining on average 14 more days without feeding during pre-pupae and pupa stages. Adults fed again when their adult offspring emerged. Due to the long period which is invested by females until the adult emergence, it would be expected a smaller interval between two offspring for females to better explore the available resources, however, according to Trivers (1974), females need to recompose their energetic sources to exert offspring care again. In the second cycle, we observed 6 of the 44 marked females from the previous period (13.7%) with new offspring. These results demonstrate that females of this species have great longevity, while males have an estimated longevity of one year, because marked individuals from one cycle were never found in another. Once climatic seasonality decreases the reproductive period and time dedicated to offspring is long. This great longevity seems adaptative as it allows females to reproduce in two cycles. This relation between parental care and longevity is indicated for various insects (see Michener, 1969; Wilson, 1971; 1975; Mattews and Mattews, 1978; Eickwort, 1981; Talllamy and Wood, 1986). The necessary investment to take care of immatures is only worthwhile if the reproduction rate of offspring, that received care is greater than that of offspring that did not receive suppport from their mothers. For example, according to Hassell (1978), Tallamy (1984) and Tallamy and Wood (1986), eggs placed in groups can be more attractive to predators, than if isolated singly. This kind of selective pressure may favor the evolution of parental care in the Cassidine.

222


CONCLUDING REMARKS Omaspides tricolorata is a monophagous herbivore, which is subsocial and gregarious. In the study area , it is active in nature from October to May. It has a long immature development period (two months) when compared to tortoise beetles species without parental care. Females stay over the offspring from oviposition to the emergence of the new adults. Taking care of offspring is an essential behavior, especially during egg and larval stages, for their survivorship of immature stadia. Climatic seasonality and phenology of its host plant greatly affects population dynamics of this tortoise beetle. Phenology of I. alba and herbivoros, O. tricolorata, are synchronized and depend on enviromental seasonality. ACKNOWLEDGMENT We would like to gratefully acknowledge the financial support received by CAPES through the PICD (FAFC) grant and CNPq through the research grant (JVN - Proc. Nº 300539/94-0); Prefeitura Municipal de Jundiaí and Guard Municipal for the authorization for working in the field and all the logistic support. LITERATURE CITED Abbas, I., K. Nakmura and A. Hasyim 1985. Survivorship and fertility schedules of a Sumatran epilachnine “species” feeding on Solanum torvum under laboratory conditions (Coleoptera: Coccinellidae). Appl. Ent. Zool. 20:50-55. Becker, M. and A. J. P. Freire 1996. Population ecology of Gratiana spadicea (Klug), a monophagous Cassidinae on an early successional Solanaceae in Southern Brazil, pp. 271-287. In: P. H. A. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology, volume 2: Ecological studies. SPB Academic Publishing, Amsterdam, The Netherlands. Brown, K. S. Jr. 1992. Borboletas da Serra do Japi: diversidade, hábitos, recursos alimentares e variação temporal. In: L. P. C. Morellato (Org.). História Natural da Serra do Japi: Ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. Unicamp. Campinas. 321 pp. Buzzi, Z. J. 1988. Biology of neotropical cassidinae. In: P. Jolivet, E. Petitpierre and T. H. Hsiao (Eds.), Biology of Chrysomelidae. Kluwer Academic Publishers. Dordrecht. 615 pp. Chaboo, C. S. 2001. Revision and phylogenetic analysis of Acromis Chevrolat (Coleoptera: Crysomelidae: Cassidinae: Stolaini). The Coleopterists Bulletin 55(1):75-102. Chapman, R. F. 1969. The insects: Structure and function. London, Hodder and Stoughton Ltd. 819 pp. Clutton-Brock, T. H. 1991. The evolution of parental care. Princeton University Press. Princeton. 352 pp. Cockburn, A. 1991. An introduction to evolutionary Ecology. Blackwell Scientific Publications. Oxford. 370 pp. Crowson, R. A. 1981. The biology of the coleoptera. Academic Press. London. 802 pp. Del-Claro, K. 1991a. Polimorfismo mimético de Scaphura nigra Thunberg 1824 (Tettigoniidae: Phaneropterinae). M. Sc. Thesis. Universidade Estadual de Campinas. Del-Claro, K. 1991b. Notes on mimicry between two tropical beetles in south-eastern Brazil. J. Trop. Ecol. 7:407-410. Dias, B. F. S. 1975. Comportamento pré-social de sínfitas do Brasil Central. I. Themos olfersii (Klug) (Hymenoptera, Argidae). Studia Ent. 18(1-4):401/32.


223

Dias, B. F. S. 1976. Comportamento pré-social de sínfitas do Brasil Central. II. Dielocerus diasi Smith, 1975 (Hymenoptera, Argidae). Studia Ent. 19(1-4):461/501. Eickwort, G. C. 1981. Presocial insects. In: H. R. Hermann (Ed.), Social Insects. vol.II. Academic Press. New York. 459 pp. Eisner, T., E. Van Tassel and J. E. Carrol 1967. Defensive use of a fecal shield by a beetle larva. Science 158:1471/73. Freire, A. J. P. 1982. Flutuação na abundância e distribuição espacial de Gratiana spadicea (Coleoptera: Chrysomelidae: CassidInae) em Solanum sisymbriifolium Lam (Solanaceae). Dissertação de Mestrado, Universidade Federal do Rio Grande do Sul. Porto Alegre, 154 pp. Frers, A.G. 1922. Metamorfosis de coleópteros argentinos. Physis 5:245-262. Frers, A.G. 1925. Metamorfosis de coleópteros argentinos. Physis 8:82-92. Frieiro-Costa, F. A. 1984. Natalidade e mortalidade no estágio de ovo em uma população natural de Gratiana spadicea (Klug, 1829) (Coleoptera: Chrysomelidae: Cassidinae) em Solanum sisymbriifolium Lam (Solanaceae). Dissertação de Mestrado, Universidade Federal do Rio Grande do Sul. Porto Alegre, 116 pp. Frieiro-Costa, F. A. 1995. Biologia de populações e etologia de Omaspides tricolorata (Boheman, 1854) (Coleoptera: Chrysomelidae: Cassidinae) na Serra do Japi - Jundiaí - SP. Tese de Doutorado. Universidade Estadual de Campinas. Campinas. 1995. 179 pp. Garcia, M. A. and L. M. Paleari 1993. Ciclo de vida e potencial de crescimento populacional de Charidotis punctatostriata (Coleoptera, Chrysomelidae, Cassidinae) em laboratório. Revista Bras. Ent. 37(2):329-334. Gressitt, J.L. 1952. The tortoise beetles of China (Chrysomelidae: Cassidinae). Proc. Calif. Acad. Sci., 27(17):433592. Habib, M. E. M. and J. Vasconcellos-Neto 1978. Biological studies on Botanochara impressa Panzer, 1798 (Coleoptera, Chrysomelidae). Rev. Biol. Trop. 27(1):103-110. Hassell, M. P. 1978. The dynamics of arthropod predator-prey systems. Princeton University Press. Princeton, 237 pp. Hinton, H.E. 1981. Biology of insects eggs. Pergamon Press Oxford. 1.125 pp. Jolivet, P. 1988. Les soins parentaux chez les Chrysomélides (Col.). Entomologiste, (Paris), 44(2): 93/101. Kosior, A. 1975. Biology, ecology and economic importance of Cassids (Coleoptera: Chrysomelidae: Cassidinae) of the Ojców National Park. Acta Zool. Cracow 20 (9):251-292. Leitão-Filho, H. F. 1992. A flora arbórea da Serra do Japi. In: L. P. C. Morellato (Org.). História Natural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. Unicamp. Campinas. 321 pp. Macêdo, M. V., R. F. Monteiro and T. M. Lewinsohn 1994. Biology and ecology of Mecistomela marginata (Thunberg, 1821) (Hispinae: Alurnini) in Brazil, pp. 567-571. In: P. H. Jolivet, M. L. Cox and E. Petitipierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Mattews, R. W. and J. R. Mattews 1978. Insect behavior. John Wiley and Sons. New York, 507 pp. Maw, M. G. 1976. Biology of the tortoise beetle, Cassida hemisphaerica (Coleoptera: Chrysomelidae) a possible biological control agent for bladder campion, Silene cucubalus (Cariophilaceae) in Canada. Can. Ent. 108(9):945-954. Medeiros, L. and J. Vasconcellos-Neto 1994. Host plants and seasonal abundance patterns of some Brazilian Chrysomelidae, pp. 185-189. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers. Michener, C. D. 1969. Comparative social behavior of bees. Ann. Rev. Entomol. 14:299-342. Muir, F. E. S. and D. Sharp 1904. On the egg-case and early stages of some Cassidinae. Trans. Ent. Soc. Lond. 1:1-23.

224


Nakamura, K. and I. Abbas 1987. Preliminary life table of the spotted tortoise beetle, Aspidomorpha miliaris (Coleoptera: Chrysomelidae) in Sumatra. Res. Popul. Ecol. 29:229-236. Nakamura, K. and I. Abbas 1989. Seasonal change in abundance and egg mortality of tortoise beetle (Coleoptera, Chrysomelidae, Cassidinae) under humid-equatorial climate in Sumatra. Entomography 6:487-495. Nakamura, K., L. E. Pudjiastuti and H. Katakura 1992. Survivorship and fertility schedules of three epilachnine species under laboratory conditions in Bogor, West Java. In: K. Nakamura and H. Katakura (Eds.), Evolutionary Biology and Population Dynamics of Herbivorous Ladybeetles in Indonesia. Saporo. 91 pp Nogueira-Pinto, Y. Y. A. 2000. Herbivoria em Erechtites valerianaefolia DC. (Asteraceae): Distribuição de ataque dos herbívoros e respostas compensatórias da planta. Ph. D. Thesis. Universidade Estadual de Campinas. Campinas, SP. Olmstead, K. 1996. Cassidinae defenses and natural enemies, pp. 3-21. In: P. H. Jolivet and M. L. Cox (Eds.), Chrysomelidae Biology. SPB Academic Publishers, Amsterdam, The Netherlands. Olmstead, K. and R. F. Denno 1992. Cost of shield defense in tortoise beetles (Coleoptera: Chrysomelidae). Ecol. Entomol. 17:237-243. Olmstead, K. and R. F. Denno 1993. Effectiveness of tortoise beetle larval shields against different predator species. Ecology 74:1394-1405. Pinto, H. S. 1992. Clima da Serra do Japi. In: L. P. C. Morellato (Org.), História Natural da Serra do Japi: ecologia e preservação de uma área florestal no sudeste do Brasil. Ed. da Unicamp. Campinas. 321 pp. Sá, F. N. and M. V. Macêdo 1999. Behavior and population fluctuation of Plagiometriona flavescens (Boheman) (Chrysomelidae: Cassidinae), pp. 299-305. In: M. L. Cox (Ed.), Advances in Chrysomelidae 1. Backhuys Publishers, Leiden, The Netherlands. Sá, F. N. and J. Vasconcellos-Neto 2002. Host plant utilization and population abundance of three species of cassidinae (Coleoptera: Chrysomelidae) in a tropical forest area in Brazil. Journal of Natural History. (in press) Siebert, M. W. 1975. Candidates for the biological control of Solanum elaeagnifolium Cav. (Solanaceae) in South Africa. 1. Laboratory studies on the biology or Gratiana lutescens (Boh.) and Gratiana pallidula (Boh) (Col., Cas.). J. Ent. Soc. S. Afr. 38 (2):297-304. Singer, M. C. 1986. The definition and measurement of oviposition preference in plant-finding insects, pp. 6594. In: J. R. Miller and T. A. Miller (Eds.), Insects-plant interactions. Springer-Verlag. New York. 342 pp. Takizawa, H. 1980. Immature stages of some indian Cassidinae (Col., Chrys.). Insect Matsum. 21:19-48. Tallamy, D. W. 1984. Insect parental care. Bioscience 34(1):20-24 Tallamy, D. W. and T. K. Wood 1986. Convergence patterns in subsocial insects. Ann. Rev. Entomol. 31:369390. Trivers, R. L. 1974. Parent-offspring conflict. Amer. Zool. 14: 249-264. Vasconcellos-Neto, J. 1987. Genética ecológica de Chelymorpha cribraria F. 1775 (CassidInae, Chrysomelidae). Tese de Doutorado. Universidade Estadual de Campinas. Campinas. 254 pp. Vasconcellos-Neto, J. 1991. Interactions between Ithomiine butterflies and Solanaceae: feeding and reproductive strategies, pp. 291-313. In: P. W. Price, T. M. Lewinsohn, G. W. Fernandes and W. W. Benson (Eds.), Plant-animal interactions. Evolutionary ecology in tropical and temperate regions. John Wiley and Sons Inc., New York, USA. Vasconcellos-Neto, J. and P. Jolivet 1988. Une nouvelle stratégie de defense: La stratégie de défense annulaire (cycloalexie) chez quelques larvas de Chysomélides brésiliens. Bull. Soc. Ent. Fr. 92 (9-10):291-299. Vasconcellos-Neto, J. and P. Jolivet 1994. Cycloalexy among chrysomelid larvae, pp 303-309. In: P. Jolivet, M. L. Cox and E. Petitpierre (Eds), Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Netherlands.


225

Wigglesworth, V. B. 1972. The principles of insect physiology. 7ª Edição. Chapman and Hall. London. 827 pp. Williams, G. C. 1966. Natural selection, the costs of reproduction and a refinement of Lack’s principle. Amer. Natur. 100: 687-690 Wilson, E. O. 1971. The insect societes. Belknap Press of Harvard University Press. Cambridge. 548 pp. Wilson, E. O. 1975. Sociobiology - The new synthesis. Belknap Press of Harvard University Press. Cambridge. 697 pp. Windsor, D. M. 1987. Natural history of a subsocial tortoise beetle, Acromis sparsa Boheman (Chrysomelidae, Cassidinae) in Panama. Psyche 94(1-2):127-150. Wood, T. K. 1976. Biology and presocial behavior of Platycotis vittata (Homoptera: Membracidae). Ann. Ent. Soc. Am. 69:807-811. Wood, T. K. 1977. Role of parent females and attendant ants in the maturation of the treehopper, Entylia bactriana (Homoptera: Membracidae). Sociobiology 2:257-272. Wood, T. K. 1984. Life history patterns of tropical membracids (Homoptera: Membracidae). Sociobiology 8:299-344.

24



David G. Furth (ed.) 2003 © PENSOFT Publishers Chemical Signalling Between Host Plant (Ulmus minor) and Egg Special Parasitoid 227 Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 227-241

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid (Oomyzus gallerucae) of the Elm Leaf Beetle (Xanthogaleruca luteola) Torsten Meiners1 and Monika Hilker1 1

Freie Universität Berlin, Institut für Biologie, Angewandte Zoologie / Ökologie der Tiere, Haderslebener Str. 9, 12163 Berlin, Germany. Email: [email protected]

ABSTRACT Eggs of the elm leaf beetle Xanthogaleruca (Pyrrhalta) luteola (Coleoptera, Chrysomelidae) experience heavy parasitization by the egg parasitoid Oomyzus gallerucae (Hymenoptera, Eulophidae) in the field. We investigated the tritrophic interactions between the elm leaf beetle, its host plant, the field elm (Ulmus minor = U. campestris = U. procera), and its egg parasitoid. This paper summarizes our research on this tritrophic system and relates the specific utilization of infochemicals to the biology of the organisms involved. We found that oviposition of X. luteola induces the elm leaves to release volatiles that attract the egg parasitoid (induced synomones). Studies on the mechanism of this synomone induction revealed that neither intact elm leaves nor leaves damaged by feeding beetles released attractive volatiles. But oviduct secretion of X. luteola, which glues the eggs onto the leaves, was proved to elicit the emission of the attractive synomones. The eggs are always glued onto a small epidermal wound, which is inflicted to the lower leaf surface by the female prior to oviposition. The oviduct secretion only functions as synomone elicitor when applied onto such a wound. Scratching a leaf by a scalpel to mimic the wound and application of oviduct secretion results into the release of synomones. Our studies on the specificity of the synomone induction showed that the attractiveness of induced volatiles was specific both for the Ulmus species and the herbivore species depositing eggs. Further steps in the egg parasitoid’s host location process are mediated by kairomones from host feces and egg masses. These kairomones were also shown to be host specific, since O. gallerucae clearly discriminates between host and non-host (e.g. Galerucella lineola) cues during host finding and host recognition. The tritrophic system studied here is characterized by oligophagous and monophagous relationships on the second and the third trophic level. These intrinsic characteristics of the tritrophic system might have been a prerequisite for the development of such selective responses of a parasitoid towards specific infochemicals and of the specific indirect defense reaction of the plant to oviposition of the chrysomelid host. KEY WORDS: elm leaf beetle, Oomyzus gallerucae, infochemicals oviposition behavior, synomones, kairomones, host specificity

228

Torsten Meiners & Monika Hilker

INTRODUCTION Most plants are endowed with constitutive (permanent) and inducible resistance systems against pathogens and herbivores. Herbivore feeding (mechanic damage of leaf tissue) can induce plants to produce chemicals that in turn decrease herbivore preference or performance on the plant (Tallamy and Raupp, 1991). While there is increasing knowledge on non-volatile induced chemicals (e.g., proteinase inhibitors, resistance related plant hormones) affecting the fitness of herbivores by killing them or reducing growth and fecundity (Karban and Baldwin, 1997), almost nothing is known about their effect on the third trophic level - the carnivores. Up to now, the use of induced plant volatiles seemed to be limited to larval parasitoids or predators (Dicke, 1994; Rutledge, 1996; Turlings and Benrey, 1998). Contrary to larval parasitoids, egg parasitoids should not rely on volatiles induced in plants by the feeding of herbivores. For egg parasitoids, volatiles of undamaged or damaged leaves are easy to detect but would not indicate the presence of host eggs with great reliability, except when the parasitoids have learned to connect plant volatiles with the presence of host eggs (Honda and Walker, 1996). Host eggs themselves would be a reliable odor source, but these odors have a low detectability, because eggs hardly emit any odors (Kaiser et al., 1989). Some egg parasitoids have applied an infochemical detour strategy (Vet and Dicke, 1992) to find their hosts’ eggs by orientating to cues from non-target life stages, e.g. sex or aggregation pheromones (Lewis et al., 1982; Noldus, 1988; Van Huis et al., 1994; Leal et al., 1995; Arakaki et al., 1996, 1997; Collazza et al., 1997). Much of the research on chemical cues mediating interactions between parasitoids and herbivorous hosts refers mainly to parasitoids of aphids or braconid wasps attacking lepidopterous larvae (Rutledge, 1996; Turlings and Benrey, 1998). However, the most diverse group of insect herbivores is the leaf beetles (Coleoptera: Chrysomelidae). A multitude of chrysomelid-plant relationships have evolved (Jolivet et al., 1988; Jolivet et al., 1994; Jolivet and Cox, 1996) that in turn might influence the range and the success of their hymenopteran and dipteran endo- and ectoparasitoids (Cox, 1994; Hilker and Meiners, 1999). Reproduction in parasitoids is based on the completion of different steps: host (micro-) habitat location, host location, host recognition, and host acceptance (e.g., Vinson, 1998). The foraging strategies of parasitoids are hypothesized to be largely shaped by their degree of specialization with respect to both their host specificity and the host plant range of the concerning herbivores. The specialist egg parasitoid Oomyzus gallerucae Fonscolombe (Hymenoptera, Eulophidae) feeds monophagously on the host Xanthogaleruca luteola (Mueller) (Coleoptera, Chrysomelidae) and the the beetle feeds on different elm (Ulmus) species (Fig. 1). In spring overwintering females of the elm leaf beetle deposit their yellow eggs (30-40 per batch) in rows exclusively on the under-surface of elm leaves. These eggs were often parasitized by O. gallerucae. Both, beetles and parasitoids undergo 2-3 generations in Southern France. X. luteola is known as a pest on different elm species in Europe, North America and Australia. O. gallerucae has repeatedly been introduced into the United States for biological control of the elm leaf beetle (Ehler et al., 1987; Hall and Johnson, 1983). The main goal of this paper is to provide information on the understanding of tritrophic level interactions between plants, herbivores, and egg parasitoids. A first overview on the interactions of X. luteola, its host plant U. minor Mill., and the egg parasitoid O. gallerucae was given by Hilker and Meiners (1999). Here we summarize now in detail the information we have gained so far on the tritrophic interactions in this system. First, answers to the following questions will be given: Does

Chemical Signalling Between Host Plant (Ulmus minor) and Egg Parasitoid ...

229

Trophic Level III

Egg parasitoid: Oomyzus gallerucae

II

Herbivore: Xanthogaleruca luteola

I

Host plants: Ulmus spec.

Fig. 1. Trophic relationships of egg parasitoid, chrysomelid host, and host plants. Arrows indicate feeding relationships and orientation pattern.

the egg parasitoids O. gallerucae use any chemical cues (kairomones) from its chrysomelid hosts during the different stages of host approach? Are there any volatiles (synomones) from the chrysomelids’ foodplants involved in the host location and host finding of the eulophid wasp? Do the leaf beetles induce the emission of volatiles in host plants that affect the parasitoids’ host search? Which factor does elicit the induction of plant synomones? Is the induction of plant synomones by leaf beetle eggs locally restricted to the leaf carrying eggs or is it a systemic effect? How specific are the kairomones from the hosts and the synomones from the host plants for hostsearching O. gallerucae? How do the egg parasitoids solve the above outlined reliability/detectability problem? Then the specific utilization of infochemicals in this tritrophic system will be discussed from the viewpoint of each trophic level and related to the biology of the organisms involved. METHODS Insects and Rearing Conditions Adults and eggs of X. luteola were collected from 1992 - 1999 in Southern France. For detailed rearing conditions see Meiners and Hilker, 1997. Females of the tansy leaf beetle Galeruca tanaceti Linn., larvae of the lepidopteran species Opisthograptis luteolata (Linn.) (Geometridae) (feeding on U. minor) and eggs of Galerucella lineola (from leaves of Salix fragilis Linn.) were collected in the environs of Berlin. All insects were kept at 20 °C and 16h/8h [l:d], except the tansy leaf beetle, which was kept at 20 °C and 12h/12h [l:d]. Adults of X. luteola and caterpillars of O. luteolata were fed leaves of U. minor (except the experiment required another feeding regime), G. tanaceti were fed Chinese cabbage (Brassica pekinensis L.).

230


Bioassays All observations and behavioral assays except for the olfactometer tests were made by using a stereomicroscope. The events of all bioassays were recorded by the Noldus Observer programme 3.0 (Wageningen, NL). Only experienced female parasitoids with prior contact to host eggs were studied. These females encountered host eggs two days prior to the experiments for a period of 24 h. Kairomones and Synomones Utilized in Habitat Location The effect of odors from the habitat of X. luteola was studied in a four arm airflow olfactometer similar to the one described by Vet et al. (1983) (for details see Meiners et al., 1997). In order to elucidate volatiles attractive to the parasitoids (kairomones) that are emitted by the host itself, the attractiveness of the following odor sources was tested: (a) 20 egg masses (48 hours old) of X. luteola that had been cautiously removed from elm leaves by using a razor blade, (b) 10 gravid females of X. luteola, (c) feces of 20 adult beetles that had been collected for 48 hours, (d) 10 third instar larvae of X. luteola, (e) and feces of 30 third instar larvae that had been collected for 48 hours. All experiments concerning plant volatiles were conducted with elm twigs with 15–20 leaves that were treated on the day of cutting. All treated twigs were tested only 72 h after treatment. During the period before testing, the twigs were kept in water at 20°C, 16L:8D, and 2000 lux. To investigate if any synomones from elm leaves attract the egg parasitoids and if they are emitted systemically, the following treatments were tested: undamaged elm leaves, elm leaves damaged by feeding of 20 adult beetles, twigs with feeding-damaged elm leaves onto which 15-20 egg masses were oviposited, feeding-damaged leaves (that had never contact with eggs) and eggs separately, feeding-damaged elm leaves where the egg masses were removed after oviposition, and leaves (without eggs) on a twig neighbored to leaves with egg masses (for details see Meiners and Hilker, 1997; Meiners et al., 2000). For oviposition, a gravid elm leaf beetle gnaws a small groove into the under-surface of a leaf and glues several rows comprising a total of about 10 to 30 eggs with its oviduct secretion into this groove. In order to elucidate when and how the elm leaf beetle female deposits a synomone elicitor and how the signal is transferred in the plant, the effects of volatiles from differently treated elm twigs and from elm leaf beetle eggs on the parasitoids were tested using the following odor sources: leaves that were scratched with a sharp scalpel and freshly oviposited egg masses transferred onto the wounds, scratched leaves with oviduct secretion smeared into the scratches, undamaged leaves with eggs transferred onto the undersurface (see also Meiners and Hilker, 2000). Data were statistically evaluated by FriedmanANOVA and pair wise comparisons were made using Wilcox-Wilcoxon tests. Kairomones Utilized in Host Finding To investigate whether contact cues from non-host feces and kairomones from feces of its host species elicit a response in O. gallerucae, elm leaves were offered for 48 hrs to adult elm leaf beetles or to caterpillars of O. luteolata in rearing containers. A piece of a filter paper contaminated with feces from caterpillars and a piece of filter paper contaminated with host-feces was offered sequentially in a Petri dish for three minutes to a female of O. gallerucae (n=15). When contacting host feces or host eggs, O. gallerucae shows a frequent drumming behavior with her antennae. The duration of antennal drumming on the filter paper was recorded (see Meiners et al., 2000). Data were statistically evaluated by Wilcoxon signed rank test for matched pairs.


231

Kairomones Utilized in Host Recognition An egg mass dummy made of filter paper, a non-host egg mass of G. lineola and a host egg mass of X. luteola were offered separately in Petri dishes to a female of O. gallerucae. The duration of antennal drumming on the dummy and the egg masses was recorded each for three minutes (n=10). Data were statistically evaluated by Kruskall-Wallis ANOVA and pair wise comparisons were made using the Mann-Whitney U test. RESULTS Kairomones and Synomones Utilized in Habitat Location Odors of elm leaf beetle eggs, of gravid females, and of larvae were not attractive to female O. gallerucae. However odor of feces from larvae and from adult beetles showed a kairomonal effect and attracted the parasitoids (Table 1; Meiners and Hilker, 1997). The odor from undamaged field elm leaves and the odor from elm leaves damaged by feeding of adult beetles were not attractive to O. gallerucae (Table 2; Meiners and Hilker, 1997). However, oviposition of the elm leaf beetle on elm leaves has an attractive effect towards the egg parasitoids. A combination of odors of feeding damaged leaves (that never had contact with eggs) and odor from egg masses was not active. However, odor of leaves where eggs have been removed 72 h after oviposition did affect the behavior of the female parasitoids. This shows that oviposition of the elm leaf beetle induces the emission of synomones attractive to O. gallerucae. Since also leaves neighbored to leaves with eggs emitted these synomones, the induction is systemic – a signal is transported from the site of oviposition to other Table 1. Response of female Oomyzus gallerucae to odours from its host Xanthogaleruca luteola. + preference of odour source over control odours; n.s. not significant; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • • •

eggs gravid females feces of adult leaf beetles larvae feces of larvae

RESPONSE

N

P

+

25 25 20 20 25

n.s. n.s. *** n.s. ***

+

Table 2. Response of female Oomyzus gallerucae to odours from differently treated Ulmus minor leaves. Feeding damage by Xanthogaleruca luteola. + preference of odour source over control odours; — avoidance; n.s. not significant; * p < 0.05; ** p < 0.01; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • • • • •

intact elm leaves artificially damaged elm leaves elm leaves damaged by feeding elm leaves damaged by feeding onto which eggs were deposited feeding damaged elm leaves and eggs combined feeding damaged elm leaves (eggs removed) neighboured leaves (systemic)

RESPONSE — + + +

N

P

25 25 20 40 25 30 36

n.s. * n.s. *** n.s. ** *

232


leaves. The elicitor is located in the oviduct secretion that coats the eggs. Epidermal wounding is necessary (possibly by mediating direct contact of the elicitor with the plant cells), but is not active alone (Table 3; Meiners and Hilker, 2000). Leaves of U. glabra Huds. carrying eggs of the elm leaf beetle did not emit odors that significantly attracted O. gallerucae. Eggs of G. tanaceti transferred onto leaves of U. minor did not induce these leaves to emit an odor that attracted or arrested O. gallerucae (Table 4; Meiners et al., 2000). Kairomones Utilized in Host Finding When offering filter paper pieces treated with feces of adult elm leaf beetles and filter paper pieces treated with feces of the geometrid larvae of O. luteolata fed on elms, the parasitoids showed significantly longer drumming behavior when contacting the host feces (Table 5; Meiners et al., 2000). Kairomones Utilized in Host Recognition The dummy, non-host eggs and host eggs elicited significantly different degrees of host recognition behavior in O. gallerucae. Antennal drumming was significantly longer on the eggs of the chrysomelid Table 3. Response of female Oomyzus gallerucae to odours from differently treated Ulmus minor leaves. Scratching done by scalpell. + preference of odour source over control odours; — avoidance; n.s. not significant; ** p < 0.01; *** p < 0.001 (Friedman – ANOVA). TESTED ODOUR SOURCE • • • •

scratched elm leaves scratched elm leaves with transplanted eggs scratched elm leaves and oviduct secretion undamaged elm leaves and transplanted eggs

RESPONSE

N

P

+ +

20 32 31 21

n.s. ** *** n.s.

Table 4. Response of female Oomyzus gallerucae to odours from leaves of two elm species treated with eggs of different galerucine leaf beetles. n.s. not significant (Friedman – ANOVA). TESTED ODOUR SOURCE change of the plant species: • Ulmus glabra leaves with eggs of X. luteola change of the herbivore: • Ulmus minor leaves with eggs of Galeruca tanaceti

N

P

22

n.s.

22

n.s.

Table 5. Specificity of host finding cues. Response of female Oomyzus gallerucae to contact with feces from host and non-host herbivores feeding on Ulmus minor. * p < 0.05; *** p < 0.001(Wilcoxon signed rank test). TEST PARAMETER Duration [s] of antennal drumming spent on substratum

FECES OF Lepidopteran larva (Opistograpthis luteola)

N

P

Elm leaf beetles 21.3 + 24.2 68.4 + 43.8

1.9 + 4.0 45.3 + 23.8

15 15

*** *


233

Table 6. Specificity of host recognition cues. Response of female Oomyzus gallerucae to contact with egg masses from host and non-host galerucine leaf beetles and a filter paper dummy. * p < 0.05; *** p < 0.001(Wilcoxon signed rank test). TESTED EGG MASS filter paper dummy Galerucella lineola Xanthogaleruca luteola

Duration of antennal drumming [s]

N

P

0.2 + 0.4 6.7 + 5.3 60.1 + 37.1

10 10 10

a b c

non-host than on the filter paper dummy, but duration of antennal drumming on host eggs was by far the longest (Table 6; Meiners et al., 2000). DISCUSSION The use of semiochemicals (chemicals involved in the chemical interactions between organisms) in tritrophic systems should be influenced by the ecological setting, the evolutionary potential of the users, and the evolutionary consequences of their use (Price, 1981). In the following we will look at different factors that might influence the host location of parasitoids. First we will outline how plants, leaf beetles, the parasitoids themselves and associated organisms may influence the suitability of kairomones and synomones for the host search of parasitoids. Then a connection is drawn between infochemical use of the parasitoid, its life history and the phenology of its host. The final conclusion suggests further directions in studying tritrophic level interactions. How do Plants Influence Host Search of Parasitoids? Plants can influence the interactions between parasitoids and herbivores in different ways (reviewed in Price et al., 1980; Godfray, 1994). For example, plants may provide food (nectar) for the parasitoids (Patt et al., 1997; Baggen and Gurr, 1998), plant architecture can affect the parasitoids’ host searching process (Wang et al., 1997; Romeis et al., 1998), plant quality and toxins can influence the parasitoids via host quality (e.g., Reitz and Trumble, 1996). Finally plants can attract parasitoids by emitting volatiles. The emission of specific plant volatiles that are only induced after herbivore feeding was shown in the last ten years for different tritrophic systems (Turlings et al., 1990; 1991; Dicke, 1994; Mattiacci et al., 1994; Du et al., 1996; 1998). It has been suggested that the primary function of these induced chemicals is defense against herbivores and micro-organisms (Turlings and Tumlinson, 1991). The plant would only gain secondary benefit from attracting parasitoids. Although egg parasitoids are of great importance as biological control agents (Wajnberg and Hassan, 1994) and much is known about their use of kairomones in host location and host recognition (e.g., Strand and Vinson, 1982; Noldus and van Lenteren, 1985; Frenoy et al., 1992; Mattiacci et al., 1993; Aldrich et al., 1995; Conti et al., 1996; Lee et al., 1997), little is known about synomone use in egg parasitoids (Honda and Walker, 1996; Romeis et al., 1997) and up to this study nothing was known about the use of induced synomones. The induced chemicals in the field elm attracting egg parasitoids of O. gallerucae after oviposition of the elm leaf beetle (Table 2; Meiners and Hilker, 1997; 2000) might also have served primarily as defense against micro-organisms or to prevent further egg depositions or future feeding of developing larvae. Up to now it is unknown whether induced elm leaves affect the performance of elm leaf

234


beetles, but there are some studies which have shown that herbivore-induced changes influence oviposition site preference and feeding behavior of other herbivorous insects (e.g., Baur, et al., 1996; McAuslane and Alborn, 1998; Anderson and Alborn, 1999). Specific volatiles emitted by plants in response to oviposition of an arthropod can allow egg parasitoids to track directly the host’s lifestage needed for reproduction. This mechanism represents an elegant solution of the reliability/detectability problem for egg parasitoids by providing them with both detectable and reliable information on the presence of host eggs. How do the Hosts Influence the Host Search of Parasitoids? Organisms should avoid giving away any clue that might deliver information on their presence to predators or parasitoids. However, since organisms have to feed, to defend themselves against enemies, and to reproduce from time to time they inevitably leave traces in their environment that can be used by their antagonists as kairomones. Although much is known about infochemical use by parasitoids during host search (Vinson, 1991; Rutledge, 1996; Hilker and Meiners, 1999), there is little information on how hosts might influence this process to avoid parasitization. Feeding on different plant species might alter the kairomonal activity of a herbivore’s feces in a way that it becomes unrecognizable to the parasitoid. Being polyphagous can also influence synomone use of parasitoids. Females of X. luteola might avoid plant synomone induction by choosing other elm species than the field elm for egg deposition or by changing their oviposition behavior (Meiners et al., 2000). However, these changes might affect their progeny’s fitness negatively in other ways. How Can the Internal State of Parasitoids Affect Host Location? The patterns of host selection and host use by arthropod parasitoids are assumed to show high plasticity, responding to environmental conditions and physiological states (Heimpel et al., 1996). Intraspecific intrinsic variation in foraging behavior of parasitoids is assumed to have three major sources: physiological state of the parasitoid, phenotypic plasticity (learning capacity), and genotypically fixed differences between individuals (Lewis et al., 1990). The physiological state of the female parasitoids was shown to have a strong effect on the number of ovipositions (Van Roermund et al., 1997). The host value varies dynamically with parasitoid state variables such as egg load and prior experience (Mackauer et al., 1996). These and other internal factors like age (Hérard et al., 1988), mating status (Guertin et al., 1996) and general health status (Hamm et al., 1988) can influence the parasitoids’ response to infochemical cues by modifying the parasitoids’ activity, motivation and reactivity. A lack of mature eggs can reduce the response to olfactory cues (Shahjahan, 1974), hungry parasitoids are supposed to react to plant volatiles indicating food, whereas females foraging for hosts are supposed to orient to host or host plant cues (Lewis et al., 1990). Experience of female parasitoids can alter their response to semiochemicals during host search (Honda and Walker, 1996; Du et al., 1997; Steidle and Schöller, 1997; Geervliet et al., 1998). This plasticity is assumed to be more prevalent in specialist parasitoids than in generalists, which possess a larger niche breadth (Vet et al., 1990). Genotypically fixed differences among individuals are adapted to different foraging environments and can be reflected in the geographic variation of infochemical use. The females of O. gallerucae became experienced by oviposition and motivated for host searching prior to the experiments (Meiners and Hilker, 2000). Age, mating status and physiological needs of


235

the parasitoids were taken into account (Hamerski and Hall, 1988; Köpf, 1993; Stein, 1995). This standardization of the parasitoids’ rearing conditions does not reflect the situation in the field. Further investigations on the infochemical use of parasitoids should include the variation of internal factors, especially when the studies are carried out with respect to application of parasitoids as biological control agents. How Are the Interactions in the Investigated Tritrophic System Influenced by Other Species? Systems focusing on the three species of three trophic levels cannot be looked at isolated from trophic and communicational relationships with other organisms. Price (1981) gives an excellent overview over all possible interactions in multitrophic systems. The study of semiochemicals in a certain system has to take into account the influence of associated plants and insects on the communicational interactions in the respective system. Associated plants and insects are plants growing near the host plant and other insects in the foodwebs based on these plants. Feces of non-hosts feeding on the same plant did not elicit host finding behavior in O. gallerucae (Table 4, Meiners et al., 2000). This mechanism prevents the studied parasitoids from mistaking cues from non-host herbivores for host cues. Does the Use of Certain Kairomones and Synomones by O. gallerucae Correspond to the Life History of this Parasitoid or to the Phenology of its Host? In the linear trophic system O. gallerucae - X. luteola - U. minor the egg parasitoid can ‘concentrate’ on infochemicals from one specific host and from a few species of the genus Ulmus. The specialist O. gallerucae uses host cues and host plant cues (emanating after host-plant interaction) for habitat location. O. gallerucae parasitizes monophagously eggs of X. luteola, which is restricted to elms as foodplants. This means that the female parasitoids can rely on elm-specific synomones and host-specific kairomones in locating the host’s habitat. The use of fecal host kairomonal (Table 1) and specifically induced elm volatiles (Table 2) reflects the host specificity of O. gallerucae and the narrow foodplant range of X. luteola. The fact that infochemicals from both first and second trophic level affect foraging behavior of O. gallerucae might be explained by the phenologies of the parasitoid and the host. When overwintering females of O. gallerucae start foraging for host eggs in spring, the population density of likewise overwintered X. luteola might be very low. In that case volatiles from feces would not be a very detectable host location cue for the parasitoids and induced synomones might be responsible for parasitization success of O. gallerucae. This situation changes when the population size of elm leaf beetles increases during the season with the emergence of further generations of X. luteola. Egg parasitoids are dependent on having enough time to develop in their host’s eggs (Vinson, 1998). Consequently parasitoid females have to find host eggs within a certain period of time. This period might be important for the eulophid O. gallerucae, because eggs of the elm leaf beetle X. luteola develop within seven days. O. gallerucae has to find and parasitize host eggs within three days after oviposition of the elm leaf beetle (Stein, 1995). The induction time of 72 hrs chosen in the experiments corresponded with this period. As a consequence the selection pressure on O. gallerucae to utilize chemicals connected with oviposition might be very high and favor the specific synomone use described in Meiners and Hilker (2000). To summarize, the degree of host specialization of the egg parasitoid reflects in infochemical use during host location processes. The specialist O. gallerucae uses host cues and host plant cues for habitat location. In the host finding process O. gallerucae uses contact kairomones from the feces of

236


its host (Meiners and Hilker, 1997; Meiners et al., 2000) and is thus able to locate their chrysomelid hosts in the habitat. CONCLUSIONS AND OUTLOOK Our work provides new aspects of the interaction between plants, chrysomelid herbivores, and eulophid egg parasitoids. It was shown for the first time that oviposition of a phytophagous insect induces a plant to emit volatiles that are attractive to an antagonist of the herbivore. To fully understand the phenomenon of the attraction of the egg parasitoid O. gallerucae by volatile synomones induced in the field elm by oviposition of X. luteola, it is necessary to undertake further investigations on the chemical nature and the specificity of the induced volatiles and the inducing elicitor. Geographic variation of infochemical use by parasitoids is likely to occur, but it has hardly been studied so far. Variation in chemicals within a plant species or chemical differences between host plants utilized by a single herbivorous species may alter considerably the chemical environment in which the herbivore and its enemy live thus modifying the interactions between all three trophic levels. Natural populations are likely to be highly variable in space and time. Different selection pressures may operate on all trophic levels in different geographic environments or they may change with time in one single location. For example, different elm species show differences in the constituent secondary plant metabolites (Santamour, 1972). It would be interesting to study variation in searching behavior and infochemical use of the egg parasitoid O. gallerucae on a geographical scale. A plant’s capacity to make up for tissue losses by herbivory is to some extent dependent on its life form (Whitham et al., 1991). Therefore long-lived trees might have other strategies of host defense than short-lived annuals or biennials (Coley et al., 1985). The allocation of resources between direct and indirect defense might differ for both plant types and that might affect their interactions with the antagonists of their herbivorous enemies. Hawkins (1994) showed that the complexity of the plant architecture has an effect on parasitoid species richness with herbs having less parasitoid species than shrubs and the latter less than trees in natural habitats. The authors discuss several reasons for this phenomenon concerning the host’s foodplant - habitat interactions. It might be possible that different infochemical abilities between the different plant types influence the parasitoid species richness. Evaluating plant specificity of volatile induction in elm species by the oviposition of X. luteola might help to gain information on the evolution of the tritrophic communication between elms, elm leaf beetles and O. gallerucae. If there is a general mechanism of induction, close relatives to the field elm should also attract O. gallerucae, and the effect should diminish with increasing distance from the original system. The role of induced plant responses for the second trophic level, the elm leaf beetles, remains to be elucidated. This work was mainly focused on the infochemical use of volatiles by the third trophic level, the parasitoids. Contrary to the growing knowledge on the use of induced plant volatiles by predators and parasitoids, only little is known about how herbivores are influenced by herbivoreinduced secondary plant chemicals in their performances like foodplant orientation, feeding behavior or oviposition site preference (Baur et al., 1996; Bolter et al., 1997; McAuslane and Alborn, 1998). The study of interactions between elms and elm leaf beetles seems to be promising to supply additional information on the use of volatile infochemicals by the second trophic level, the herbivores. Consideration of the third trophic level (natural enemies of herbivores) when studying insect-plant interactions helps to improve ecological understanding and offers also the possibility to improve biological control (Poppy, 1997). Knowledge of the chemical nature of kairomones and synomones


237

could be applied for biological control. Useful parasitoids could be directed with the help of an odor stimulus to threatened plant cultures before the host density reaches a critical level. This might work at least in some cases where plants in distinct areas need protection. Elms and unwillingly elm leaf beetles have been introduced into North America and Australia. The control of the elm leaf beetle has gained increasing interest and financial support (Dahlsten et al., 1994; Kwong and Field, 1994). While the release of O. gallerucae and thus biological control of the elm leaf beetle has succeeded in some cases in North America, it has failed in Australia. If the chemical nature of the kairomones and synomones that lead O. gallerucae to its host and the physiology of the plant reaction are known, this knowledge might be employed to improve protection of elms against the elm leaf beetle in the field. ACKNOWLEDGEMENTS We thank Katja Hadwich and Christine Westerhaus for their help in culturing and testing the insects and Eva Häffner for providing drawings on plants, beetles and parasitoids. Two anonymous reviewers gave valuable comments on this manuscript. This research was supported in part by DFGgrants Hi-416/3-2 and Hi-416/3-3. LITERATURE CITED Aldrich, J. R., Rosi, M. C. and F. Bin 1995. Behavioral correlates for minor volatile compounds from stink bugs (Heteroptera: Pentatomidae). Journal of Chemical Ecology 21:1907-1920. Anderson, P. and H. T. Alborn 1999. Effects on oviposition behaviour and larval development of Spodoptera littoralis by herbivore-induced changes in cotton plants. Entomologia Experimentalis et Applicata 92:45-51. Arakaki, N., S. Wakamura, and T. Yasuda 1996. Phoretic egg parasitoid, Telenomus euproctidis (Hymenoptera: Scelionidae), uses sex pheromone of tussock moth Euproctis taiwana (Lepidoptera: Lymantriidae) as a kairomone. Journal of Chemical Ecology 22:1079-1085. Arakaki, N., S., Wakamura, T. Yasuda and K. Yamagishi 1997. Two regional strains of a phoretic egg parasitoid, Telenomus euproctidis (Hymenoptera: Scelionidae), that use different sex pheromones of two allopatric tussock moth species as kairomones. Journal of Chemical Ecology 23:153-161. Baggen, L. R. and G. M. Gurr 1998. The influence of food on Copidosoma koehleri (Hymenoptera: Encyrtidae) and the use of flowering plants as a habitat management tool to enhance biological control of potato moth, Phthorimaea opercullela (Lepidoptera: Gelechiidae). Biological Control 11:9-17. Baur, R., V. Kostal, B. Parrian and E. Städler 1996. Preferences for plants damaged by conspecific larvae in ovipositing cabbage root flies: influence of stimuli from leaf surface and roots. Entomologia Experimentalis et Applicata 81:353-364. Bolter, C. J., M. Dicke, J. J. A. Van Loon, J. H. Visser and M. A. Posthumus 1997. Attraction of Colorado potato beetle to herbivore-induced plants during herbivory and after its termination. Journal of Chemical Ecology 23:1003-1023. Colazza, S., M. C. Rosi and A. Clemente 1997. Response of egg parasitoid Telenomus busseolae to sex pheromone of Sesamia nonagrioides. Journal of Chemical Ecology 23:2437-2444. Coley, P. D., J. P. Bryant and F. S. Chapin III 1985. Resource availability and plant antiherbivore defense. Science 230:895-899. Conti, E., W. A. Jones, F. Bin and S. B. Vinson 1996. Physical and chemical factors involved in host recognition behavior of Anaphes iole Girault, an egg parasitoid of Lygus hesperus Knight (Hymenoptera: Mymaridae, Heteroptera: Miridae). Biological Control 7:10-16.

238


Cox, M. L. 1994. The hymenoptera and diptera parasitoids of Chrysomelidae, pp. 419-468. In: P. H. Jolivet, M. L. Cox and E. Petitpierre (Eds.), Novel aspects of the biology of Chrysomelidae. Kluwer Academic Press, Dordrecht. Dahlsten, D. L., D. L. Rowney and S. M. Tait 1994. Development of integrated pest management pro grams in urban forests: The elm leaf beetle (Xanthogaleruca luteola (Muller)) in California, USA. Forest Ecology and Management 65:31-44. Dicke, M. 1994. Local and systemic production of volatile herbivore-induced terpenoids: their role in plantcarnivore mutualism. Journal of Plant Physiology 143:465-472. Du, Y. J., M. Poppy and W. Powell 1996. Relative importance of semiochemicals from first and second trophic levels in host foraging behavior of Aphidius ervi. Journal of Chemical Ecology 22:1591-1605. Du, Y., G. M. Poppy, W. Powell, J. A. Picket, L. J. Wadhams and C. M. Woodcock 1998. Identification of semiochemicals released during aphid feeding that attract parasitoid Aphidius ervi. Journal of Chemical Ecology 24:1355-1368. Du, Y., G. M. Poppy, W. Powell and L. J. Wadhams 1997. Chemically mediated associated learning in the host foraging behavior of the aphid parasitoid Aphidius ervi (Hymenoptera: Braconidae). Journal of Insect Behavior 10:509-522. Ehler, L. E., R. L. Bugg, M. B. Hertlein, H. P. Sauter and K. Thrarinsson 1987. Patch-exploitation patterns in an egg parasitoid of the elm leaf beetle. Entomophaga 32:233-239. Frenoy, C., C. Durier, and N. Hawlitzky. 1992. Effect of kairomones from egg and female adult stages of Ostrinia nubialis (Hübner) (Lepidoptera, Pyralidae) on Trichogramma brassicae Bezdenko (Hymenoptera, Trichogrammatidae) female kinesis. Journal of Chemical Ecology 18:761-773. Geervliet, J. B. F., A. I. Vreugdenhil, M. Dicke and L. E. M. Vet 1998. Learning to discriminate between infochemicals from different plant-host complexes by the parasitoids Cotesia glomerata and C. rubecula. Entomologia Experimentalis et Applicata 86:241-252. Godfray, H. C. J. 1994. Parasitoids. Behavioral and evolutionary ecology. Princeton, Princeton University Press. 473 pp. Guertin, D. S., P. J. Ode, M. R. Strand and M. F. Antolin 1996. Host-searching and mating in an outbreeding parasitoid wasp. Ecological Entomology 21:27-33. Hall, R. W. and N. F. Johnson 1983. Recovery of Tetrastichus gallerucae (Hymenoptera: Eulophidae), an introduced egg parasitoid of the elm leaf beetle (Pyrrhalta luteola) (Coleptera: Chrysomelidae). Journal of the Kansas Entomological Society 56:297-298. Hamerski, M. R. and R. W. Hall 1988. Laboratory rearing of Tetrastichus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle (Coleoptera:Chrysomelidae). Journal of Economic Entomology 81:1503-1505. Hamm, J. J., E. L. Steyer and W. J. Lewis 1988. A baculovirous pathogenic in the parasitoid, Microplitis croceipes (Hymenoptera, Braconidae). Journal of Invertebrate Pathology 52:189-191. Hawkins, B. A. 1994. Pattern and process in host-parasitoid interactions. Cambridge: University Press. Heimpel, G. E., J. A. Rosenheim and M. Mandel 1996. Egg limitation, host quality, and dynamic behavior by a parasitoid in the field. Ecology 77:2410-2420. Hérard, F., M. A. Keller, W. J. Lewis and J. H. Tumlinson 1988. Beneficial arthropod behaviour mediated by airborne semiochemicals. III. Influence of age and experience on flight chamber responses of Microplitis demolitor Wilkinson. Journal of Chemical Ecology 14:1583-1596. Hilker, M. and T. Meiners 1999. Chemical cues mediating interactions between chrysomelids and parasitoids, pp. 197-216. In: M. J. Cox (Ed.), Advances in Chrysomelidae Biology. Backhuys Publishers. Leiden, The Netherlands.


239

Honda, J. Y. and G. P. Walker 1996. Olfactory response of Anagrus nigriventris (Hym.: Mymaridae): Effects of host plant chemical cues mediated by rearing and oviposition experience. Entomophaga 41:3-13. Jolivet, P. H. A. and M. L. Cox (Eds.). 1996. Chrysomelidae biology, (Vol. I-III). SPB Academic Publishing bv., Amsterdam. Jolivet, P. H. A., M. L. Cox and E. Petitpierre (Eds.). 1994. Novel aspects of the biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Jolivet, P. H. A., E. Petitpierre and T. H. Hsiao 1988. Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands. Kaiser, L., M. H. Pham-Delègue, E. Backchine and C. Masson 1989. Olfactory response of Trichagramma madidis Pint. et Voeg.; effect of chemical cues and behavioural plasticity. Journal of Insect Behavior 2:701710. Karban, R. and I. T. Baldwin 1997. Induced responses to herbivory. The University of Chicago Press, Chicago. Köpf, A. 1993. Die Bedeutung der Galerucinen-Anthrachinone für Parasitoide und Prädatoren. Diplomarbeit, Universität Bayreuth. Kwong, R. M. and R. P. Field 1994. Elm leaf beetle life history and distribution in southern Victoria. Plant Protection Quarterly 9:43-47. Leal, W.-S., H. Higuchi, N. Mizutani, H. Nakamori, T. Kadosawa and M. Ono 1995. Multifunctional communication in Riptortus clavatus (Heteroptera: Alydidae): Conspecific nymphs and egg parasitoid Oocencyrtus nezarae use the same adult attractant pheromone as chemical cue. Journal of Chemical Ecology 973-985. Lee, H. P., K. S. Boo, S. O. Kim and K. S. Lee. 1997. Gypsy moth kairomones affecting host acceptance behavior of the egg parasitoids Ooencyrtus kuvanae (Hymenoptera: Encyrtidae). Korean Journal of Applied Entomology 36:88-95. Lewis, W. J., D. A. Nordlund, R. C. Gueldner, P. E. A. Teal and J. H. Tumlinson 1982. Kairomones and their use for management of entomophagous insects. XIII. Kairomonal activity for Trichogramma spp. of abdominal tips, excretion and a synthetic sex pheromone blend of Heliothis zea (Boddie) moths. Journal of Chemical Ecology 8:1323-1331. Lewis, W. J., L. E. M. Vet, J. H. Tumlinson, J. C. van Lenteren and D. R. Papaj 1990. Variations in parasitoid foraging behavior: essential element of a sound biological control theory. Environmental Entomology 19:1183-1193. Mackauer, M., J. P. Michaud and W. Völkl 1996. Host choice by aphidiid parasitoids (Hymenoptera: Aphidiidae): Host recognition, host quality, and host value. Canadian Entomologist 128:959-980. Mattiacci, L., M. Dicke and M. A. Posthumus 1994. Induction of parasitoid attracting synomone in brussels sprouts plants by feeding of Pieris brassicae larvae: role of mechanical damage and herbivore elicitor. Journal of Chemical Ecology 20:2229-2247. Mattiacci, L., S. B. Vinson, H. J. Williams, J. R. Aldrich and F. Bin 1993. A long-range attractant kairomone for egg parasitoid Trissolcus basalis, isolated from defensive secretion of its host, Nezara viridula. Journal of Chemical Ecology 19:1167-1181. McAuslane, H. J. and H. T. Alborn 1998. Systemic induction of allelochemicals in glanded and glandless isogenic cotton by Spodoptera exigua feeding. Journal of Chemical Ecology 24:399-416. Meiners T. and M. Hilker 1997. Host location in Oomyzus gallerucae (Hymenoptera: Eulophidae), an egg parasitoid of the elm leaf beetle Xanthogaleruca luteola (Coleoptera: Chrysomelidae). Oecologia 112:87-93. Meiners T. and M. Hilker 2000. Induction of plant synomones by oviposition of a phytophagous insect. Journal of Chemical Ecology 26:221-232. Meiners T., C. Westerhaus and M. Hilker 2000. Specificity of chemical cues used by a specialist egg parasitoid during host location. Entomologia Experimentalis et Applicata 95:151-159.

240


Noldus, L. P. J. J. 1988. Response of the egg parasitoid Trichogramma pretiosum to the sex pheromone of its host Heliothis zea. Entomologia Experimentalis et Applicata 48:293-300. Noldus, L. P. J. J. and J. C. van Lenteren 1985. Kairomones for the egg parasite Trichogramma evanescens Westwood. II. Effect of contact chemicals produced by two of its hosts, Pieris brassicae L. and Pieris rapae L. Journal of Chemical Ecology 11:793-800. Patt, J. M., G. C. Hamilton and J. H. Lashomb 1997. Foraging success of parasitoid wasps on flowers: interplay of insect morphology, floral architecture and searching behavior. Entomologia Experimentalis et Applicata 83:21-30. Poppy, G. M. 1997. Tritrophic interactions: Improving ecological understanding and biological control? Endeavour 21:61-65. Price, P. W. 1981. Semiochemicals in evolutionary time, pp. 251-279. In: D. A. Nordlund, R. L. Jones and W. J. Lewis (Eds.), Semiochemicals, their Role in Pest Control. J. Wiley, New York. Price, P. W., C. E. Bouton, P. Gross, B. A. McPheron, J. N. Thompson and A. E. Weis 1980. Interactions among three trophic levels: Influence of plants on interactions between insect herbivores and natural enemies. Annual Review of Ecological Systematics 11:41-65. Reitz, S. R. and J. T. Trumble 1996. Tritrophic interactions among linear furanocoumarins, the herbivore Trichoplusia ni (Lepidoptera: Noctuidae), and the polyembryonic parasitoid Copidosoma floridanum (Hymenoptera: encyrtidae). Environmental Entomology 25:1391-1397. Romeis, J., T. G. Shanower and C. P. W. Zebitz 1997. Volatile plant infochemicals mediate plant preference of Trichogramma chilonis. Journal of Chemical Ecology 23:2455-2465. Romeis, J., T. G. Shanower and C. P. W. Zebitz 1998. Physical and chemical plant characters inhibiting the searching behaviour of Trichogramma chilonis. Entomologia Experimentalis et Applicata 87:275-284. Rutledge, C. E. 1996. A survey of identified kairomones and synomones used by insect parasitoids to locate and accept their hosts. Chemoecology 7:121-131. Santamour, F. S. 1972. Flavonoid distribution in Ulmus. Bulletin Torrey Botanical Club 99:127-131. Shahjahan, M. 1974. Erigeron flowers as a food and attractive odour source for Peristenus pseudopallipes, a braconid parasitoid of the tarnished plant bug. Environmental Entomology 3:69-72. Steidle, J. L. M. and M. Schöller 1997. Olfactory host cues and learning in the granary weevil parasitoid Lariophagus distinguendus (Hymenoptera: Pteromalidae). Journal of Insect Behavior 10:331-342. Stein, C. 1995. Untersuchungen zur Bedeutung chemischer und physikalischer Signale für die Parasitoide von Blattkäfer-Eiern der Unterfamilie Galerucinae durch die Parasitoide Oomyzus gallerucae und O. galerucivorus (Chalcidoidea; Eulophidae). Diplomarbeit, Universität Bayreuth. Strand, M. R. and S. B. Vinson 1982. Source and characterization of an egg recognition kairomone of Telenomus heliothidis, a parasitoid of Heliothis virescens. Physiological Entomology 7:83-90. Tallamy, D. W. and M. J. Raupp 1991. Phytochemical induction by herbivores. New York: John Wiley. Turlings, T. C. J. and B. Benrey 1998. Effects of plant metabolites on the behavior and development of parasitic wasps. Ecoscience 5:321-333. Turlings, T. C. J. and J. H. Tumlinson 1991. Do parasitoids use herbivore-induced plant chemical defenses to locate hosts? Florida Entomologist 74:42-50. Turlings, T. C. J., J. H. Tumlinson, F. J. Eller and W. J. Lewis 1991. Larval-damaged plants: source of volatile synomones that guide the parasitoid Cotesia marginiventris to the microhabitat of its host. Entomologia Experimentalis et Applicata 58:72-85. Turlings, T. C. J., J. H. Tumlinson and W. J. Lewis 1990. Exploitation of herbivore-induced plant odors by host seeking parasitic wasps. Science 250:1251-1253.


241

Van Huis, A., C. Schütte, M. H. Cools, P. Fanget, H. Van der Hoek and S. P. Piquet 1994. The role of semiochemicals in host location by Uscana lariophaga, egg parasitoid of Callosobruchus maculatus. Proceedings of the 6th International Working Conference on Stored-product Protection 2:1158-1164. Van Roermund, H. J. W., J. C. Van Lenteren and R. Rabbinge 1997. Analysis of foraging behavior of the whitefly parasitoid Encarsia formosa on a leaf: A simulation study. Biological Control 8:22-36. Vet, L. E. M. and M. Dicke 1992. Ecology of infochemical use by natural enemies in a tritrophic context. Annual Review of Entomology 37:141-172. Vet, L. E. M., W. J. Lewis, D. R. Papaj and J. C. van Lenteren 1990. A variable-response model for parasitoid foraging behaviour. Journal of Insect Behavior 3:471-490. Vet, L. E. M., J. C. Lenteren, M. van, Heymanns and E. Meelis 1983. An airflow olfactometer for measuring olfactory responses of hymenopterous parasitoids and other small insects. Physiological Entomology 8:97106. Vinson, S. B. 1991. Chemical signals used by parasitoids, pp. 15-42. In: F. Bin (Ed.), Proceedings of the 4th European workshop, Insect prasitoids, (Perugia, April 3-5: 1991). Redia, Perugia. Vinson, S. B. 1998. The general host selection behavior of parasitoid Hymenoptera and a comparison of initial strategies utilized by larvaphagous and oophagous species. Biological Control 11:79-96. Wajnberg, E. and S. A. Hassan 1994. Biological control with egg parasitoids. Oxford University Press, Oxford. Wang, B., D. N. Ferro and D. W. Hosmer 1997. Importance of plant size, distribution of egg masses, and weather conditions on egg parasitism of the European corn borer, Ostrinia nubilalis by Trichogramma ostriniae in sweet corn. Entomologia Experimentalis et Applicata 83:337-345. Whitham, T. G., J. Maschinski, K. C. Larson and K. N. Paige 1991. Plant responses to herbivory, the continuum from negative to positive and underlying physiological mechanisms, pp. 227-256. In: P. W. Price, T. M. Lewinsohn, G. W. Fernandes and W. W. Benson (Eds.), Plant-Animal Interactions. Evolutionary Ecology in Tropical and Temperate Regions. John Wiley, New York.

24



David G. Furth (ed.) 2003 © PENSOFT Publishers The Advantages and Disadvantages of Larval Abdominal Shields the 243 Specialon Topics in ... Leaf Beetle Biology Sofia - Moscow Proc. 5th Int. Sym. on the Chrysomelidae, pp. 243-259

The Advantages and Disadvantages of Larval Abdominal Shields on the Chrysomelidae: Mini-review Caroline Müller1,2 and Monika Hilker2 1

Institute of Evolutionary and Ecological Sciences, Leiden University, P.O. Box 9516, NL - 2300 RA Leiden, The Netherlands. E-mail: [email protected] 2 Freie Universität Berlin, Institut für Zoologie, Haderslebener Str. 9, 12163 Berlin, Germany

ABSTRACT Several chrysomelid larvae, namely members of the Criocerinae, Alticinae, Hispinae, and Cassidinae, collect their faeces and the latter two also exuviae at their abdominal tips and form a so-called abdominal shield. Possible protective functions of these shields towards unfavourable abiotic and biotic factors have been discussed for a long time. It has been suggested that the shields are used as a defensive device against predators. During recent years more and more experiments have been conducted in total in 15 different chrysomelid species to study the effectiveness of these structures towards predators such as Araneae, Dermaptera, Neuroptera, Heteroptera, Coleoptera, and Hymenoptera. The effectiveness of the chrysomelid shields against these different antagonists varies from advantageous effects, meaning that the attacker can be repelled or deterred, to disadvantageous effects, meaning that some predators are even attracted by the shield. These conflicting reactions of predators were found in Cassida stigmatica and C. denticollis, tortoise beetles larvae feeding on tansy [Tanacetum (Chrysanthemum) vulgare, Asteraceae]. In this mini-review, the experiments on the defensive effectiveness of larval shields in these tansy feeding cassidine species are outlined and embedded in a summary of experimental studies on the effectiveness of the larval shields of Criocerinae, Hispinae, Alticinae, and Cassidinae. The overview considers the studies with respect to (a) the shield type (faecal or exuvial), (b) the taxonomy and type of the predatory species, (c) the host plant chemistry, (d) the role of physical cues of the shields (mobility, detachability), and (e) the larval behaviour (aggregation).

INTRODUCTION Herbivorous insects may defend against predators and parasitoids by an array of devices that include specific morphological structures, noxious chemicals, and movements that serve to repel enemies. For the large beetle familiy Chrysomelidae, the effectiveness of defensive devices has been studied for all life stages. These include eggs covered by faeces or secretions (e.g. Pasteels et al. 1988a, Hilker 1994); larvae with spines, eversible glands, or abdominal shields (e.g. Pasteels and Grégoire 1984, Dettner 1987, Blum 1994); the pupal stage, with exuvia of the last larval instar,

244

Caroline Müller & Monika Hilker

which may contain exocrine glands filled with volatile secretions (Matsuda and Sugawara 1980, Cox 1994); and the adults, with their pronotal and elytral glands or their digestive regurgitates or reflex bleeding (e.g. Pasteels et al. 1982, Rowell-Rahier et al. 1995). However, benefits from the evolution of effective defensives against generalist enemies may be offset by costs from specialist predators or parasitoids that evolve means to counter the defences. For example, the glandular secretion of several chrysomeline larvae effectively deter ants (Pasteels et al. 1986), but are used by specialists like predatory syrphid larvae as chemical beacons, or kairomones (Köpf et al. 1997). Furthermore, some antagonists have learning abilities and can habituate to previously encountered “defensives” (Pasteels and Grégoire 1984). Additionally, the production of defensives can be costly. Several cost-benefit studies have demonstrated the trade-offs, or costs (Pasteels et al. 1988b, Olmstead and Denno 1992). This paper focuses on the effectiveness of the abdominal shields of larval members of chrysomelid subfamilies, namely members of the Criocerinae, Alticinae, Hispinae, and Cassidinae. The larval cases of Camptosomata will not be considered here (therefore, see Olmstead 1994). In the cassidines, shields are formed by an unusual procedure. At every moult, the exuviae stay attached to two caudal processes that project forward from the abdominal tip close to the anal turret. Moist faeces or faecal strands are glued on the shield in a symmetrical manner (Eisner and Eisner 2000). Barbs on the processes of early instar-larvae may help in the retention of shield material (McBride et al. 2000). The consistency and chemistry of faecal shields is highly variable from species to species and from host to host (Fiebrig 1910, Olmstead 1994, Gómez 1997, Vencl et al. 1999). In some species, shields consist of exuviae only (exuvial, or skin shield). Larval shields are sometimes retained by the pupal stage (Steinhausen 1950). Even though the shields of tortoise beetle larvae have fascinated scientists for several generations, their functions still remain poorly understood. The larval shields as well as faecal coverings of the Cassidinae, Alticinae, Hispinae and Criocerinae were suggested to act as protective devices against abiotic and biotic factors (see discussion for references). However, unequivocal proof of their functions is lacking in the majority of cases. Olmstead (1994, 1996) already excellently reviewed the defensive role of waste products of Chrysomelidae and devices of defence in cassidine species. However, at the time of these reviews, the chemicals present in the abdominal shields and their relationship to the phytochemical profile of the host plant had not yet been studied (Olmstead 1994). Furthermore, since these former reviews, new methods have been used to study the modes of action of the abdominal shields’ defences. These methods include contact bioassays with larvae reared on a different diet (Vencl et al. 1999), contact bioassays with dummies, and olfactometer bioassays (Müller and Hilker 1999, Müller 2002). In the present overview, we outline new studies on the effectiveness of the abdominal shields of two cassidine species, Cassida stigmatica Suffrian and C. denticollis Suffrian that specialise on the plant tansy (Tanacetum vulgare Linn.) (Asteraceae). Larvae of C. stigmatica have exuvial shields while those of C. denticollis have faecal shields. Interactions with four different potential invertebrate predators were tested in bioassays. They were the ant workers (Myrmica rubra L., Hymenoptera: Formicidae), adult earwigs (Forficula auricularia L., Dermaptera: Forficulidae), adult ladybird beetles (Coccinella septempunctata L., Coleoptera: Coccinellidae), and larval lacewings (Chrysoperla carnea Steph., Neuroptera: Chrysopidae). The results of these tritrophic studies are integrated into a review of published laboratory and field studies on the effectiveness of larval abdominal shields in the Chrysomelidae.

The Advantages and Disadvantages of Larval Abdominal Shields on the ...

245

MATERIALS AND METHODS Plant Leaves of Tanacetum vulgare were collected from a field site close to the laboratory. Tanacetum vulgare is chemically quite diverse and occurs in different chemotypes (Schantz and Järvi 1966, Holopainen et al. 1987). The chemotypes are characterised by a quantitatively and qualitatively different pattern of mono- and sesquiterpenes. Because different chemotypes were present at the field site, the leaves we offered as larval food were assumed to represent a random mixture of the available chemotypes. Herbivores Adults of Cassida stigmatica and C. denticollis were collected at rural sites in Berlin, Germany, and were reared in plastic containers (20 x 20 x 6 cm, Gerda GmbH & Co., Schwelm, Germany) with a gauze lid (120 mm). The containers were lined with filter paper. Leaves of T. vulgare were offered as food plant. The adults laid eggs on the plant (C. stigmatica) or on the filter paper (C. denticollis). Hatching larvae were kept in additional plastic containers on T. vulgare leaves. Rearing conditions were 20ºC, 75 % r.h. and L16:D8. Predators Earwigs (Forficula auricularia) and ladybird beetles (Coccinella septempunctata (Linn.)) were collected from tansy plants at the field site. Single individuals were maintained in Petri dishes (diam. 9 cm) on moistened filter paper and were fed daily with the aphids, Metopeurum fuscoviride Stroy and Aphis fabae Scop. Larvae of the lacewing Chrysoperla carnea acquired from a laboratory culture of Neudorff, Emmerthal, Germany, were maintained on an aphid diet (M. fuscoviride) on tansy plants kept in a green house. A colony of M. rubra was kept in the laboratory. Contact Bioassays The predator responses to cassidine larvae were tested in dual choice bioassays. Individual earwigs, ladybird beetles or lacewing larvae or groups of ants (n = 20) were offered to a larva of one of the Cassida species with its abdominal shield intact and one larva of the same species whose shield had been carefully removed with forceps. The response variables measured were contact frequency, number of bites, and the number of consumed larvae. For further details see Müller and Hilker (1999), Müller (2002). Olfactometer Bioassays Reactions of ladybird beetles towards volatiles of C. denticollis faecal shields were tested in a Yshaped olfactometer (length of Y-arms: 10 cm, diam. 1 cm) with an air-flow of 90 ml/min. Incoming air was purified and saturated with constant humidity by passing it through a glass cylinder with charcoal, and a cylinder with distilled water, respectively. Intact faecal shields (150 mg, 2nd-3rd instar) were placed in a test cylinder connected to one of the Y-tube arms. An empty cylinder was

246

Caroline Müller & Monika Hilker

connected to the other control arm. Individual ladybird beetles were released at the basis of the Y and their decisions recorded. For further details see Müller (2002). The reactions of the ant M. rubra towards shield volatiles were tested in a T-shaped static olfactometer (Hilker 1989), placed on gauze. Intact faecal shields of C. denticollis (5th instar) or exuvial shields of C. stigmatica (5th instar) were offered below one of the T-arms, 1 – 2 cm away from the crossing of the T. Individual ants were released at the base of the T. Decisions of the ants for either T-arm was recorded. For further details see Müller and Hilker (1999). RESULTS The defensive effectiveness of the two abdominal shield types of tansy feeding cassidine larvae was diverse (Table 1). Earwigs contacted larvae with, and without shields at a similar frequency, but consumed more larvae without shields. Adult ladybirds did not discriminate between C. stigmatica larvae with, and without exuvial shields. Cassida denticollis larvae with faecal shields were contacted significantly more often by the ladybird beetles. However, they consumed finally more larvae without Table 1. Predator reactions to larvae with and without abdominal shields. Predators were tested in dual choice contact assays offering either larvae of Cassida stigmatica with and without exuvial shield, or larvae of C. denticollis with and without faecal shield. Predators were tested individually with the exception of Myrmica rubra, where ants were tested in groups of 20. (For detailed methods see Müller and Hilker 1999 and Müller 2002). Contact frequency (fr.) was analysed with the Wilcoxon signed-rank test for matched pairs; the number of prey consumed or of bites (M. rubra) was analysed with the sign test. n.s. not significant; * P

Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Lepidoptera of Israel: Noctuidae (Pensoft Series Faunistica)

Forest And Dragonflies: 4th Wda Symposium of Odonatology, Pontevedra, Spain, July 2005 (Faunistica) (Pensoft Series Faunistica)

Distributional Atlas & Catalogue of the Leaf Beetles of Bulgaria: (Coleoptera: Chrysomelidae) (Faunistica)

Sea Slugs of the Red Sea (Pensoft Series Faunistica)

Zoogeography of Bulgaria Bibliography: Scroll 1 (Pensoft Series Faunistica)

Dragonflies and Damelflies of South Africa (Pensoft Series Faunistica)

BIOMAT 2009 : International Symposium on Mathematical and Computational Biology, Brasilia, Brazil, 1-6 August 2009

Proceedings of the Ninth International Symposium on Cyclodextrins

The Millipedes (Diplopoda) of the Asian Part of Russia (Pensoft Series Faunistica)

Catalogue of the Malaysian Chrysomelidae (Insecta: Coleoptera) (Faunistica)

Proceedings of the International Congress of Mathematicians, August 21-29, 1990, Kyoto, Japan (International Congress of Mathematicians Proceedings)

Special Topics in the Theory of Piezoelectricity

Special Topics in the Theory of Piezoelectricity

Advances in Bioinformatics and Computational Biology: Second Brazilian Symposium on Bioinformatics, BSB 2007, Angra dos Reis, Brazil, August 29-31,

Proceedings of the 25th International Congress of Papyrology, Ann Arbor, July 29-August 4, 2007

Frontiers of Fundamental Physics : Proceedings of the Sixth International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Leaf Of The Lotus

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Annotated Catalogue of the Carabid Beetles of Albania (Coleoptera: Carabidae): v. 64 (Pensoft Series Faunistica)

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Computer mathematics : proceedings of the Fourth Asian Symposium (ASCM 2000)

Characterisation of Porous Solids VIII: Proceedings of the 8th International Symposium on the Characterisation of Porous Solids (Special Publication)

Proceedings of the symposium on algebraic geometry in East Asia

Smart Graphics: 9th International Symposium, SG 2008, Rennes, France, August 27-29, 2008, Proceedings

Special Topics in Leaf Beetle Biology: Proceedings of the Fifth International Symposium on the Chrysomelidae, 25-27 August 2000, Iguassu Falls, Brazil, ... of entomol (Pensoft Series Faunistica, 29)

Lepidoptera of Israel: Noctuidae (Pensoft Series Faunistica)

Forest And Dragonflies: 4th Wda Symposium of Odonatology, Pontevedra, Spain, July 2005 (Faunistica) (Pensoft Series Faunistica)

Distributional Atlas & Catalogue of the Leaf Beetles of Bulgaria: (Coleoptera: Chrysomelidae) (Faunistica)

Sea Slugs of the Red Sea (Pensoft Series Faunistica)

Zoogeography of Bulgaria Bibliography: Scroll 1 (Pensoft Series Faunistica)

Dragonflies and Damelflies of South Africa (Pensoft Series Faunistica)

BIOMAT 2009 : International Symposium on Mathematical and Computational Biology, Brasilia, Brazil, 1-6 August 2009

Proceedings of the Ninth International Symposium on Cyclodextrins

The Millipedes (Diplopoda) of the Asian Part of Russia (Pensoft Series Faunistica)

Catalogue of the Malaysian Chrysomelidae (Insecta: Coleoptera) (Faunistica)

Proceedings of the International Congress of Mathematicians, August 21-29, 1990, Kyoto, Japan (International Congress of Mathematicians Proceedings)

Special Topics in the Theory of Piezoelectricity

Special Topics in the Theory of Piezoelectricity

Advances in Bioinformatics and Computational Biology: Second Brazilian Symposium on Bioinformatics, BSB 2007, Angra dos Reis, Brazil, August 29-31,

Proceedings of the 25th International Congress of Papyrology, Ann Arbor, July 29-August 4, 2007

Frontiers of Fundamental Physics : Proceedings of the Sixth International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Leaf Of The Lotus

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume I

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Proceedings of the Fifth International Congress of Mathematicians (Cambridge, 22-28 August 1912) - Volume II

Annotated Catalogue of the Carabid Beetles of Albania (Coleoptera: Carabidae): v. 64 (Pensoft Series Faunistica)

Frontiers of Applied Mathematics: Proceedings of the 2nd International Symposium

Computer mathematics : proceedings of the Fourth Asian Symposium (ASCM 2000)

Characterisation of Porous Solids VIII: Proceedings of the 8th International Symposium on the Characterisation of Porous Solids (Special Publication)

Proceedings of the symposium on algebraic geometry in East Asia

Smart Graphics: 9th International Symposium, SG 2008, Rennes, France, August 27-29, 2008, Proceedings

Recommend Documents