Stem Cells and Their Potential for Clinical Application (NATO Science for Peace and Security Series NATO Science for Peace and Security Series A: Chemistry and Biology)

Stem Cells and their Potential for Clinical Application

NATO Science for Peace and Security Series This Series presents the results of scientific meetings supported under the NATO Programme: Science for Peace and Security (SPS). The NATO SPS Programme supports meetings in the following Key Priority areas: (1) Defence Against Terrorism; (2) Countering other Threats to Security and (3) NATO, Partner and Mediterranean Dialogue Country Priorities. The types of meeting supported are generally "Advanced Study Institutes" and "Advanced Research Workshops". The NATO SPS Series collects together the results of these meetings. The meetings are coorganized by scientists from NATO countries and scientists from NATO's "Partner" or "Mediterranean Dialogue" countries. The observations and recommendations made at the meetings, as well as the contents of the volumes in the Series, reflect those of participants and contributors only; they should not necessarily be regarded as reflecting NATO views or policy. Advanced Study Institutes (ASI) are high-level tutorial courses intended to convey the latest developments in a subject to an advanced-level audience Advanced Research Workshops (ARW) are expert meetings where an intense but informal exchange of views at the frontiers of a subject aims at identifying directions for future action Following a transformation of the programme in 2006 the Series has been re-named and re-organised. Recent volumes on topics not related to security, which result from meetings supported under the programme earlier, may be found in the NATO Science Series. The Series is published by IOS Press, Amsterdam, and Springer, Dordrecht, in conjunction with the NATO Public Diplomacy Division. Sub-Series A. B. C. D. E.

Chemistry and Biology Physics and Biophysics Environmental Security Information and Communication Security Human and Societal Dynamics

http://www.nato.int/science http://www.springer.com http://www.iospress.nl

Series A: Chemistry and Biology

Springer Springer Springer IOS Press IOS Press

Stem Cells and their Potential for Clinical Application

edited by

Nadja M. Bilko National University “Kyiv-Mohyla Academy”, Kyiv, Ukraine

Boris Fehse University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Wolfram Ostertag Medical School Hannover, Germany

Carol Stocking Heinrich-Pette-Institute for Experimental Virology and Immunology, Hamburg, Germany and

Axel R. Zander University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Published in cooperation with NATO Public Diplomacy Division

Proceedings of the NATO Advanced Research Workshop on Stem Cells and their Potential for Clinical Application Kiev and Simeiz, Ukraine August 23– 31, 2006

A C.I.P. Catalogue record for this book is available from the Library of Congress.

ISBN 978-1-4020-6468- 5 (PB) ISBN 978-1-4020-6467-8 (HB) ISBN 978-1-4020-6469-2 (e-book)

Published by Springer, P.O. Box 17, 3300 AA Dordrecht, The Netherlands. www.springer.com

Printed on acid-free paper

All Rights Reserved © 2008 Springer No part of this work may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, microfilming, recording or otherwise, without written permission from the Publisher, with the exception of any material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.

TABLE OF CONTENTS Preface ..................................................................................................... ix Acknowledgement ................................................................................... xi List of Participants................................................................................. xiii I HAEMATOPOIETIC STEM CELLS AND HAEMATOPOIESIS Clonal Dominance after Reconstitution of the Haematopoietic System with Bone Marrow Cells Retrovirally Transduced with Murine CD34 Variants Gottfried von Keudell, Kerstin Cornils, Anita Badbaran, Claudia Lange, Boris Fehse ..................................................................... 1 Function of the Membrane-Bound Isoform Ligands of the Receptor Tyrosine Kinase Subclass III in Inducing Self-Renewal of Early Hematopoietic Progenitor Cells Jutta Friel, Christoph Heberlein, Maren Geldmacher, Wolfram Ostertag ................................................................................... 17 Functional and Phenotypic Heterogeneity of the Human Hematopoietic Stem Cell (HSC) Compartment Olga I. Gan, Joby L. Mckenzie, Monica Doedens, John E. Dick ........... 45 Alterations of Frequency of Hematopoietic Precursors in Mice Subjected to Multiple Courses of Low-Dose G-CSF Injections Irina N. Nifontova, Daria A. Svinareva, Joseph L. Chertkov, Valerii G. Savchenko, Nina J. Drize ...................................................... 55

v

vi

TABLE OF CONTENTS

Regulation of Hematopoiesis by Growth Factors E. Richard Stanley .................................................................................. 63 II BIOLOGY OF NON-HAEMATOPOIETIC STEM CELLS Stem Cell Technologies in Gerontological Research Gennadij M. Butenko.............................................................................. 77 Osteopetrotic Models for Identifying Genes that Control Bone Resorption Wieslaw Wiktor-Jedrzejczak .................................................................. 83 Non-Hematopoietic Bone Marrow Cells for Regenerative Medicine Claudia Lange, Florian Tögel, Kai Jaquet, Harald Ittrich, Christoph Westenfelder, Axel Zander .................................................. 105 Epithelial Plasticity of Hepatocytes During Liver Tumor Progression Mario Mikula, Christian Lahsnig, Alexandra N. M. Fischer, Verena Proell, Heidemarie Huber, Eva Fuchs, Andreas Eger, Hartmut Beug, Wolfgang Mikulits ....................................................... 123 Blood Vessels as a Source of Progenitor Cells in Human Embryonic and Adult Life Mihaela Crisan, Bo Zheng, Elias T. Zambidis, Solomon Yap, Manuela Tavian, Bin Sun, Jean-Paul Giacobino, Louis Casteilla, Johnny Huard, Bruno Péault .............................................................. 137

TABLE OF CONTENTS

vii

III STEM CELLS AND MALIGNANCY Stem Cells and Leukaemia Volodymyr Bebeshko, Dimitry Bazyka ................................................. 149 Telomere and Stem Cell Biology in Chronic Myeloid Leukemia Stefan Balabanov, Ute Brassat, Mirja Bernhard, Viola Kob, Artur Gontarewicz, Tim H. Brümmendorf............................................ 163 Potential Immune Escape Mechanisms of Tumors: MHC Class I Molecules – Enemies or Friends Barbara Seliger .................................................................................... 171 The RUNX1 Transcription Factor: A Gatekeeper in Acute Leukemia Carol Stocking, Birte Niebuhr, Meike Fischer, Maike Täger, Jörg Cammenga.................................................................................... 183 IV CELL PROCESSING, EXPANSION AND GENETIC MODIFICATION Novel Methodological Approaches in Assessment and Enrichment of Stem Cell Population Nadja M. Bilko, Dennis I. Bilko ........................................................... 201 Animal Hybrids and Stem Cells: Their Use in Biotechnology and Clinical Practice Lev P. Djakonov ................................................................................... 211

viii

TABLE OF CONTENTS

Cryopreservation of Stem Cells Valentin I. Grischenko, Lubov A. Babiychik, Alexander Yu. Petrenko ........................................................................ 223 The M813 Retrovirus belongs to a Unique Interference Group and is Highly Fusogenic Vladimir Prassolov, Sibyll Hein, Dmitry Ivanov, Jürgen Löhler, Pavel Spirin, Carol Stocking ................................................................ 233 Reconstructing an Anti-Tumor Immune Repertoire for Targeted AML Therapy Matthias Theobald ............................................................................... 245 V CLINICAL HAEMATOPOIETIC STEM CELL TRANSPLANTATION Experience of Kyiv Center of Stem Cell Transplantation Viktor I. Khomenko............................................................................... 252 Anti Thymocyte Globuline Allows for Successful Transplantation from HLA Mismatched Unrelated Donors Axel R Zander, Tatjana Zabelina, Francis Ayuk, Christine Wolschke, Olga Waschke, Gitta Amtsfeld, Thomas Eiermann, Hartmut Kabisch, Boris Fehse, Jürgen Berger, Rudolf Erttmann, Nicolaus M Kröger.... 263

PREFACE This publication was initiated on the occasion of the NATO-Advanced Study Institute (ASI) meeting “Stem Cells and their potential for clinical application” which took place from August 23 – 25, 2006 in Kyiv and from August 26 – 31, 2006 in Simeiz, Ukraine. The meeting was devoted to “hot topics” in Stem cell research such as Regulation of Haematopoietic and Non-haematopoietic Stem Cells, Clinical Application of Stem Cells, Preclinical Models and Gene Therapy. The editors are pleased that the original idea of a book could eventually be realised. This was made possible because of the willingness of many meeting participants to saddle themselves with the additional work of compiling their data and thoughts in form of an article for this edition. We are thus foremost grateful to all contributors for their valuable input. In accordance with the conference’s main topics, the book is divided into five chapters - “Haematopoietic stem cells and haematopoiesis”, “Biology of nonhaematopoietic stem cells”, “Stem cells and malignancy”, “Cell processing; expansion and genetic modification” and “Clinical haematopoietic stem cell transplantation”. In the first part, various aspects of the regulation of haematopoiesis and haematopoietic stem cells (HSC) are described by such pioneers in the field as John Dick, Wolfram Ostertag and Richard Stanley. Olga Gan, John Dick and co-workers give an excellent overview on the heterogeneity of human HSC compartments. Jutta Friel et al. (from Wolfram Ostertag’s laboratory) deal with the role of membrane-bound isoform ligands in inducing HSC self-renewal and Richard Stanley reviews the role of growth factors in haematopoiesis. The effects of multiple injections of one particular growth factor, G-CSF, are described in a research article by Irina Nifontova, Nina Drize and colleagues, whereas Gottfried von Keudell, Boris Fehse and co-workers report their data on the impact of retroviral insertions on the clonal behaviour in murine HSC transplantation models. The second chapter of the book starts with a contribution of Gennadij Butenko on the use of stem cell technologies in gerontological research. Wieslav Wiktor-Jedrzejczak describes an interesting approach for the identification of genes involved in bone resorption control. An overview on the use of nonhaematopoietic bone marrow-derived stem cells for regenerative medicine is given by Claudia Lange, Axel Zander and co-workers. The topic of “plasticity” is covered by two groups: Mario Mikula, Wolfgang Mikulits and colleagues have investigated epithelial plasticity of hepatocytes during liver tumour ix

x

PREFACE

progression and Mihaela Crisan et al. from Bruno Peault’s lab introduce an innovative concept utilising blood vessels as a source of progenitor cells. The third chapter is mainly devoted to leukaemia research. Volodymyr Bebeshko and Dimitry Bazyka present an important insight into the changes of HSC due to irradiation after the Chernobyl accident. An outstanding review on the (stem cell) biology of chronic myeloid leukaemia with particular focus on the role of telomers is given by Stefan Balabanov, Tim Brümmendorf and colleagues. Barbara Seliger focuses on immune escape mechanisms of tumours, while Carol Stocking and her group present their data on the important role of RUNX1in the pathogenesis of acute leukaemia. Chapter 4 contains several contributions in the areas of cell processing, expansion and genetic modification. Nadja Bilko and Dennis Bilko propose novel methodological approaches to assess and enrich stem cells. L.P. Djakonov discusses the possibility of using animal hybrids in biotechnology. Valentin Grischenko, Lubov Babiychik and Alexander Petrenko have thorougly analysed the impact of various cryopreservation regimens on different HSC – a highly relevant question in transplantation medicine. During their search for novel gene analysis and therapy tools Vladimir Prassolov, Carol Stocking et al. have identified a novel retrovirus M813 which is described in their report. Concluding this chapter, Matthias Theobald presents his efforts on reprogramming T cells for targeted AML therapy. The final chapter comprises two reports on clinical haematopoietic stem cell transplantation (HSCT). Viktor Khomenko shares the experience of the Kiev center for stem cell transplantation. The final article in this book by Axel Zander and colleagues summarises data with the use of Antithymocyte globuline (ATG) in (HLA-mismatched) allogeneic transplantation, an approach which was promoted in the Hamburg Clinic for HSCT. The editors hope that this book reflects the spirited interaction and interesting scientific discussions which characterised the NATO-ASI meeting “Stem Cells and their potential for clinical application”. As the conference the book is not only intended to provide state-of-the-art articles in this field, but also to give insights into some of the highly interesting projects ongoing in Clinical Haematology and Stem cell research in Eastern Europe. Hamburg, Kyiv, St. Petersburg. Nadja N. Bilko, Boris Fehse, Wolfram Ostertag, Carol Stocking, Axel Zander.

ACKNOWLEDGEMENT The organisers as well as the participants of the “Stem Cells and their potential for clinical application”-meeting are most grateful to the NATO-Advanced Study Institute for the generous support which made this conference possible. Thanks are also due to the Ukrainian Ministry for Education and Science, the Ministry of Public Health and the National University “Kyiv-Mohyla Academy” for their support in executing the meeting. Special thanks go to the local teams for the excellent organisation at both locations. Finally, the editors are indebted to the team at Springer for the support during compilation of this book. Hamburg, Kyiv, St. Petersburg. Nadja N. Bilko, Boris Fehse, Wolfram Ostertag, Carol Stocking, Axel Zander.

xi

LIST OF PARTICIPANTS Prof. Dr. Dimitry Bazyka Dept. of Clinical Immunology Research Centre for Radiation Medicine Melnikova 53 Kyiv, 04050 Ukraine [email protected]

Prof. Dr. John E. Dick Div. of Cell and Molecular Biology University Health Network Toronto Medical Discovery Tower, Rm 8-301 101 College Street Toronto, ON, M5G 1L7, Canada [email protected]

Prof. Dr. Nadija Bilko National University “Kiev-MohylaAcademy” Centre of molecular and cell investigations 2, Skovoroda Kiev 04070 / Ukraine [email protected]

Prof. L. P. Djakonov All-Russian scientific research institute of veterinary medicine Russian academy of agricultural sciences Moscow, Russia [email protected]

PD Dr. Tim H. Brümmendorf Dept. of Hematology and Oncology with Sections BMT and Pneumology University Medical Center HamburgEppendorf Martinistraße 52 20246 Hamburg, Germany [email protected]

PD Dr. Boris Fehse Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Martinistr. 52 20251 Hamburg, Germany [email protected]

Prof. Dr. Gennadij M. Butenko Institute of Gerontology AMS of Ukraine Vyshgorodskaya st. 67 Kyiv04114, Ukraine [email protected]

Prof. Dr. Valentin I. Grischenko Institute for Problems of Cryobiology and Cryomedicine of the National Academy of Sciences of Ukraine 23 Pereyaslavskaya Str. 61015, Kharkov, Ukraine [email protected]

xiii

xiv

LIST OF PARTICIPANTS

Prof. Dr. Wiesław Wiktor-Jędrzejczak Department of Hematology, Oncology, and Internal Diseases Medical University of Warsaw Banacha 1a 02-097 Warsaw, Poland, [email protected] Viktor I. Khomenko Kiev City BMT Center BMT Department Pobeda Str. 119-121 Kiev, Ukraine Dr. Claudia Lange Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Martinistr. 52 20251 Hamburg, Germany [email protected] Prof. Dr. Wolfgang Mikulits Department of Medicine I, Institute of Cancer Research Medical University of Vienna Borschke-Gasse 8° 1090 Vienna, Austria [email protected] Dr. Irina Nifontova National Hematology Research Center Russian Academy of Medical Sciences Novozykovsky 4a 125167 Moscow, Russia [email protected]

Prof. Dr. Wolfram Ostertag Hannover Medical School Carl-Neuberg-Str. 1 D-30625 Hannover, Germany [email protected] Prof. Bruno Péault, Ph.D. Children’s Hospital of Pittsburgh Rangos Research Center Pittsburgh, USA [email protected] Prof. Dr. Vladimir Prassolov Engelhardt Institute of Molecular Biology Russian Academy of Science Vavilov Str. 32 Moscow 117984 / Russia [email protected] Prof. Dr. Barbara Seliger Martin Luther University HalleWittenberg Institute of Medical Immunology Magdeburger Straße 2 06112 Halle, Germany [email protected] Prof. Dr. E. Richard Stanley Albert Einstein College of Medicine 1300 Morris Park Avenue, Bronx New York 10461, USA [email protected]

LIST OF PARTICIPANTS

Dr. Carol Stocking Heinrich-Pette-Institut Martinistr. 52 20251 Hamburg / Germany e-mail: [email protected] Prof. Dr. Matthias Theobald Johannes Gutenberg-University Department of Hematology & Oncology Langenbeckstrasse 1 55101 Mainz, Germany [email protected]

Prof. Dr. Dr. h.c. Axel R Zander Universitätsklinikum HamburgEppendorf Onkologisches Zentrum Klinik für Stammzelltransplantation Direktor Martinistr. 52 20251 Hamburg [email protected]

xv

I HAEMATOPOIETIC STEM CELLS AND HAEMATOPOIESIS

CLONAL DOMINANCE AFTER RECONSTITUTION OF THE HAEMATOPOIETIC SYSTEM WITH BONE MARROW CELLS RETROVIRALLY TRANSDUCED WITH MURINE CD34 VARIANTS GOTTFRIED VON KEUDELL, KERSTIN CORNILS, ANITA BADBARAN, CLAUDIA LANGE, BORIS FEHSE* Clinic for Stem Cell Transplantation, University Medical Centre Hamburg-Eppendorf, Hamburg, Germany

Keywords: CD34; bone marrow transplantation; retroviral vector; insertional mutagenesis

Abstract. Using a long-term serial bone marrow transplantation assay we have recently observed that retroviral gene marking may result in both benign clonal dominance as well as malignant transformation of single cell clones. The growth advantage of dominant clones has been attributed to insertional mutagenesis, i.e. transcriptional dys-regulation of key growth-regulatory genes due to near-by vector insertions. In order to investigate the physiological role of the CD34 antigen we have of recent performed an analogous serial bone marrow transplantation assay with retroviral vectors encoding murine fulllength or truncated CD34 or, as control, eGFP followed by BM transplantation with long-term follow-up. Therefore, 6 animals were serially transplanted for each of the three transgene groups according to our previously published protocol. Similarly to our earlier results, in long-term repopulating bone marrow stem cells we found insertions into genes shown to be involved in cell cycle regulation and stem cell self-renewal such as a Core-binding factor α group member (Cbfα2t3h), runt-related Runx3, Ras p21 protein activator 4 (RasA4), Hematopoietically expressed homeobox (Hhex) or FBJ Osteosarcoma Oncogene B (Fosb). We detected common insertion sites (CIS) within the three groups, but also within the much larger insertional dominance database (IDDb). However, despite the small group size some differences in insertion site

______ * To whom correspondence should be addressed. PD Dr. Boris Fehse, Clinic for Stem Cell Transplantation, University Medical Centre Hamburg-Eppendorf, Martinistrasse 52, D-20246 Hamburg, Germany, E-mail: [email protected]

1 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 1–15. © 2008 Springer.

2

G. VON KEUDELL ET AL.

patterns were noted for the different transgenes requiring further investigation. It is therefore tempting to speculate that common features as well as differences in insertion pattern of retroviral vectors expressing different transgenes may allow investigating the mutual influence of retroviral vector insertion sites (RVIS), transgenes and host factors during insertional mutagenesis. 1. Introduction Stable integration into the host genome is an important feature of retroviral (RV) vectors making them an interesting tool for gene transfer experiments as well as gene therapy applications which require long-term transgene expression. Integration of RV vectors occurs, as earlier shown for their replicationcompetent ancestors in a semi-random fashion, preferentially in the vicinity of transcribed genes.1-4 Importantly, any integration into (or in the neighbourhood of) a gene locus represents a genetic lesion and may impact (e.g. disrupt, activate) the expression of the respective “targeted” gene thus fulfilling the criteria of “insertional mutagenesis”. In a more restricted sense, only those events which lead to changes in a cell’s phenotype are referred to as insertional mutagenesis. Those alterations may become particularly significant, if the retroviral (vector) insertion leads to the up-regulation of cellular protooncogenes (POG) or the disruption of tumour suppressor genes.5-9 In a worst-case-scenario, insertional mutagenesis may thus lead to oncogenic transformation of normal cells.5-9 Malignant transformation as a consequence of retroviral vector-mediated gene transfer has therefore always represented a safety concern in the development of human gene therapy, although earlier theoretical considerations estimated this risk to be very low.10 In line, initial gene therapy trials did not reveal major consequences of random vector insertions.10,11 However, in 2002 we first reported acute myeloid leukaemia (AML) development in a murine marking study with a γ-retroviral vector expressing the marker gene ∆LNGFR (truncated low-affinity nerve growth factor receptor).5 Molecular analysis of the leukaemic clone revealed that an insertion of the RV vector in front (5’) of the second exon of the Evi1 protooncogene had led to a strong (more than 1000 fold) transcriptional upregulation of this gene.5,12 Several lines of evidence indicated that the used transgene, a signalling molecule, played a supportive role during leukaemia establishment.5 Unfortunately, only a few months later one of the boys treated for X-linked severe combined immune-deficiency (SCID-X1) in the worldwide very first successful gene therapy trial developed a lymphoproliferative disease.6 Subsequently, another two out of the meanwhile 10 patients in that

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

3

trial have developed similar diseases resembling acute lymphoid leukaemia (ALL).6 In all those cases, insertion into one and the same proto-oncogene, LMO-2, has apparently played a crucial role.5 Moreover, in striking similarity with our murine study there is evidence12, although conflicting13, suggesting a leukaemia-promoting role of the therapeutic transgene, the common γ-chain of the IL-2 (IL-2R γc) and other interleukin receptors. In fact, in a parallel gene therapy study with the same transgene there has not been any sign of lymphoproliferative disease so far, although both studies differ only very slightly.14 Therefore, the subsequent events promoting leukaemia development after LMO-2 activation still remain to be elucidated. Recently we have shown that insertional mutagenesis may not only result in malignant transformation, but also lead to benign clonal dominance.15 We found that benign clonal dominance represents one possible consequence of the transcriptional dysregulation of various genes, in particular proto-oncogenes in the absence of additional tumour-promoting events. This data has been confirmed in various in vitro studies and in a non-human primate model.16-18 Eventually, very similar observations were again made in a clinical gene therapy study, this time on the treatment of Chronic granulomatous disease (CGD). In that study, RV vector-mediated insertional mutagenesis led to the dominance of haematopoietic clones almost all bearing vector insertion sites in one of the three gene loci MDS1-EVI1, PRDM16 or SETBP1.19 Since transcription of the respective targeted gene was strongly up-regulated in each (analysed) case and the distribution of insertion sites immediately after transduction was, as expected, semirandom without any preference for one of the three genes, it is safe to suggest that insertional mutagenesis was critical for the establishment of clonal dominance. Moreover the authors even concluded that the significant clinical benefit seen in their study was augmented by insertional activation of the three genes.19 Taken together the above data indicates that RV vector-mediated insertional mutagenesis is an efficient tool to identify genes involved in (benign as well as malignant) clonal dominance. Those genes obviously play a crucial role in the regulation of (stem cell) self renewal as well as proliferation and are therefore of great interest for a better understanding of stem cell biology. Moreover, potential stem cell growth factors identified by this approach may be of great interest for the expansion of stem cells, e.g. in the frame of cell therapy strategies. At the same time efficient (even large scale) identification of vector insertion sites in mixed samples has become possible based on sensitive new technologies20-21 and the completion of the murine and human genome projects22. Therefore we have aimed at the establishment of a database that contains retroviral vector insertion sites (RVIS) in long-term reconstituting

4

G. VON KEUDELL ET AL.

haematopoietic stem and progenitor cells (Insertional dominance database, IDDb)23. The present work summarises our efforts to identify insertion sites in clones which have reconstituted murine haematopoiesis after retroviral gene transfer. We transduced bone marrow (stem) cells with retroviral vectors expressing one of the following three different transgenes: murine full-length CD34, murine (naturally occurring) truncated CD34 and enhanced Green fluorescent protein (eGFP). Gene-modified BM cells were transplanted into lethally irradiated recipient mice which were followed up for more than 6 months before their BM was serially transplanted into secondary recipients.24 RVIS in long-term repopulating cells of both primary and secondary cohorts were identified by LM-PCR. 2. Material and Methods 2.1. MURINE STUDY

Design of the mouse experiments has been described elsewhere in detail.24,25 In short, a sex-mismatched (male into female) diallelic (CD45.2/Ly5.2 into CD45.1/Ly5.1) C56Bl/6J mouse model was used. After 48 and 72 hours prestimulation of bone marrow stem cells in cytokine-containing medium,24 two rounds of retroviral transduction were carried with spleen focus-forming virus (SFFV)-derived vectors24,26 in Retronectin®-coated (Takara Shuzo, Otsu, Japan) vector-preloaded plates.25,27

Figure 1. Experimental Set-up. Irradiated female mice were transplanted with retrovirally transduced BM cells from male donors (6 mice per vector). After 6 months of monitoring a secondary BMT took place. Spleen cells were used for the analysis of retroviral vector insertion sites (RVIS) by means of Ligation-Mediated PCR (LM-PCR)20,21. After another 6 months followup spleen cells of the secondary recipients were again analysed for RVIS via LM-PCR.

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

5

Three vector groups (murine full-length CD34, mfCD34; murine truncated CD34, mtCD34; enhanced Green fluorescent protein, eGFP) and one control group were included. Transduced cells (1 x 106) were transplanted into lethally (10 Gy) irradiated recipient mice (6 per group). After six months, mice were humanely killed and haematopoietic organs were isolated. Serial BMT was performed into 6 (per group) lethally (10 Gy) irradiated recipient mice. An overview of the experimental design is given in Fig. 1. 2.2. ISOLATION OF DNA

DNA was isolated from 5 x 106 spleen cells using QIAamp spin columns (QIAGEN Blood Mini Kit, Hilden, Germany) according to the manufacturer’s instructions. DNA concentrations were determined on a spectrophotometer. 2.3. LIGATION-MEDIATED PCR (LM-PCR) AND SPECIFIC PCR

LM-PCR was performed as described to retrieve sequences adjacent to the 5’ LTR of the SF91 vector.7,15,21 In short, genomic DNA obtained from spleen cells of transplanted animals was digested with 5 U of the Tsp509 I restriction enzyme (New England BioLabs, UK) per 200ng DNA for 15 minutes at 37° and subsequently for 2h at 65° C. For primer extension (PE) (95° for 5 min; 64° for 30 min; 72° for 15 min) 0.25 pmol/µl of biotinylated retroviral primer A1RV (5’ Biotin CTGGGGACCATCTGTTCTTGGCCTC 3’) was used. The PE product was purified using QIAquick PCR kit (QIAGEN) and enriched with streptavidin-labeled Dynabeads. An asymmetric polylinker cassette (linker oligo 1: 5‘-GACCCGGGAGATCTGAATTCAGTGGCACAGCAGTTAGG3‘; linker oligo 2: 5‘-CCTAACTGCTGTGCCACTGAATTCAGATCTCCCG3‘) was attached to those fragments by blunt-end ligation to allow directed PCR amplification. Both first and nested PCR (94°C for 2 min; 94°C for 15 sec, 60°C for 30 sec, 68°C for 2 min for 30 cycles; 68°C for 10 min) were performed using Extensor Hi-Fidelity PCR Master Mix (ABgene, Hamburg, Germany) with LTR-specific primers A2RV (5’ GCCCTTGATCTGAACTTCTC 3’), A3RV (5’ CCATGCCTTGCAAAATGGC 3’) and linker-specific primers OC1 (5’ GACCCGGGAGATCTGAATTC 3’) and OC2 (5’ AGTGGCACAGCAGTTAGG 3’), respectively.15,21 PCR products were isolated after gel electrophoresis using QIAquick Gel Extraction Kit (QIAGEN) and subjected to directly sequencing using the primer RAseq (5’ CTTGCAAAATGGC 3’) and Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City , CA, USA). A detailed description of all LMPCR procedures is given in Kustikova et al.21

6

G. VON KEUDELL ET AL.

Correct identification of insertion sites was proven by specific PCR reactions. Therefore, locus-specific primers were designed based on sequences obtained as described above. PCR was carried out using the LTR-specific primers A2RV and the respective locus-specific primer using Extensor HiFidelity PCR Master Mix and the same conditions as described above. 2.4. INSERTION SITE ANALYSIS

Sequences recovered as detailed above were screened using the NCBI mouse genome database (http://www.ncbi.nlm.nih.gov/BLAST). In case of unclear results (such as hits in BAC clones), the UCSC database was used (http://www.ensembl.org). Gene classification followed database records and PubMed literature. Further analysis of verified insertion sites was per formed by screening the Retrovirus tagged cancer gene databases (RTCGD) at http://rtcgd.ncifcrf.gov and the Stem cell database (SCDb) at http://stemcell.princeton.edu. 3. Results 3.1. RETRIEVAL OF RV INSERTION SITES

In this study we analysed haematopoietic cells from 13 primary (3 eGFP [11,13,14], 5 mfCD34 [22-26], 5 mtCD34 [27,28,30-32]) and 18 secondary (6 for each group) transplanted animals. Numbers of primary animals were lower because a few mice died or showed low haematopoietic chimaerism and were therefore excluded from secondary BMT. DNA probes isolated from spleen cells from all those animals underwent LM-PCR. Dominant PCR signals representing abundant clones21 were isolated from the agarose gel and directly sequenced (Fig. 2). In total, 238 distinct signals were analysed. To identify unequivocal RV insertion sites the presence of LTR (and LM-PCR polylinker) sequences was always required. If LTR sequences could not be found in the sequence, a PCR with insertion-specific primers (one located in the LTR and one in the putative integration site) was performed to verify the exact RV vector LTR/genome transition point. For 166 (70%) of the isolated PCR fragments, the obtained sequences could be unambiguously located on the mouse genome. For the other PCR signals, sequences were either too short to be assigned to a given locus or integration had occurred in a repetitive sequence. Some isolated PCR fragments did not allow sequencing, probably due to high GC content and/or low DNA quantity. Unexpectedly, some sequences were not locatable despite high

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

7

Figure 2. Typical LM-PCR gel showing RVIS after secondary transplantation. Common RVIS in different animals are indicated by stars (e.g.: *1: RasA4; *2: Cbfa2t3h; *4: Hic; compare Table 1).

quality. The latter observation obviously reflects remaining gaps of the mouse genome project. In many cases, identical insertions were found in more than one animal of the same group (Fig. 2). Since pooled bone marrow was used in each case for transplantation (Fig. 1), those identical insertions reflect the dominant growth features of the identified clone. Overall, a total of 43 different insertion sites from all three groups were identified in the first cohort, 34 in the second cohort. 3.2. RV VECTOR INSERTIONS IN RECONSTITUTING CELLS ARE PREDOMINANTLY LOCATED IN LOCI OF SIGNALLING GENES AND PROTO-ONCOGENES

As reported previously, insertion sites of RV vectors in reconstituting cells showed a non-random distribution. In fact, if considering a locus of ±100kb susceptible to transcriptional dysregulation28, already insertions in the first cohorts of mice showed a clear preference for proto-oncogene (>20%) and signalling gene (>50%) loci (Fig. 3). The obvious selective advantage of clones with insertions in those genes resulted in even higher proto-oncogene insertion prevalence (almost 40%) in secondary BMT recipients. Together, more than 80% of all insertions retrieved from secondary recipients had occurred in loci containing signalling genes or proto-oncogenes. The list of insertions contains a number of genes which had been initially detected by insertional mutagenesis or are listed as common insertion sites (CIS) in the Retrovirus Tagged Cancer

G. VON KEUDELL ET AL.

8

Gene Database (RTCGD)29, a database summarising insertion sites obtained with replication-competent retroviruses (RCR). In addition, several genes were also detected in various recent studies using RV vector gene transfer thus representing common retroviral vector insertion sites (CRVIS) in the Insertional Dominance Database (IDDb).23 All RVIS identified in our study and their putative functions are summarised in Table 1. 3.3. DIFFERENCES WITH DIFFERENT TRANSGENE

Rel. numbers of insertions into… [%]

Although the groups used in this study were relatively small, we subsequently analysed distribution of insertion sites for the three different transgene groups. Combining all integration data from primary and secondary recipients we thus compared 18 RVIS for the eGFP vector, 30 RVIS for mtCD34 and 35 RVIS for mfCD34. As could be seen from Fig. 3, no significant differences were seen with regard to the distribution of RVIS in different types of genes, although the tCD34 vector revealed less insertions into gene loci of groups 1 and 2 (protooncogenes and signalling genes) and more insertions into gene groups 3 and 4 (other and unknown genes). 60 Oncogenes Signalling Other Unknown

50 40 30 20 10 0 First Cohort (n=43)

Second Cohort (n=34)

Figure 3. Distribution of RVIS in different types of genes in repopulating hematopoietic cells of 1st and 2nd cohort animals. RVIS were classified as in Table 1. Note the strong overrepresentation of RVIS into oncogenes already in the first cohort, which even further increases after serial transplantation.

4. Discussion Retroviral insertional mutagenesis has been used for more than 2 decades to identify proto-oncogenes. More recently, a causal role of retroviral

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

9

vector-mediated insertional mutagenesis in the development of clonal dominance in long-term haematopoiesis has been established in preclinical models and clinical trials.5-9,15-18 In those studies it has been shown that RV vector insertions into gene loci of key regulatory factors may increase self-renewal and/or initiate malignant transformation. Following this path we here used a gene marking/bone marrow transplantation model established in our laboratory to assess possible side effects of retroviral gene transfer.5,15,25 In particular we were interested in a possible role of different transgenes on insertion site distribution in long-term reconstituting haematopoietic cell clones. Therefore we comparatively analysed the impact of three retroviral vectors expressing different transgenes (murine full-length CD34, mfCD34; murine truncated CD34, mtCD34; eGFP) from identical viral backbones (SF91)26. We have recently described physiological consequences of ectopic expression of the two murine CD34 variants in murine haematopoietic cells.24 In this report we have focussed on the analysis of a possible impact of RV vector insertion sites on long-term haematopoiesis. In cell clones reconstituting long-term hematopoiesis we found a strong overrepresentation of RVIS in proto-oncogenes and signalling genes. After primary BMT, more than 70% of all insertions were detected in gene loci of proto-oncogenes (>20%) or signalling genes (>50%). This frequency was even higher (>80%, almost 40% in POG) in secondary recipients. This data is in full agreement with our previous findings obtained with other RV vectors.15 Moreover, our results have contributed to a large Insertional Dominance Database (IDDb) comprising at the time being 280 insertion sites retrieved from long-term reconstituting hematopoietic cell clones.23 Establishment of the latter has been the result of common efforts of different laboratories in Europe and the US. The use of different transgenes and retroviral vectors by the contributing laboratories mainly excludes effects attributable to certain vector or gene types. In fact, a thorough analysis of the IDDb showed no effect of vector backbone or transgene type on insertion site distribution so far. We therefore concluded that in the majority of cases the retroviral vector insertion site in dominant (stem cell) clones has had directly affected the cells’ phenotype leading to clonal dominance.23 Based thereon, the IDDb may become an important tool for the identification of genes encoding key regulators of the stem cell phenotype (self renewal, unlimited proliferation), so-called stemness genes.30 It is not surprising that many of the genes found in our study as well as in the IDDb represent well-known proto-oncogenes involved in the regulation of cell proliferation. However, there is a number of other genes which so far were not known as regulators of stem cell growth (Table 1). Those genes may be very interesting novel candidate stemness genes, in particular if the insertions

G. VON KEUDELL ET AL.

10

represent common insertion sites (CIS) in the RTCGD29 or CRVIS within the IDDb23. From the given study, a number of genes may be added to the list of putative stemness genes, as for example: (i) known proto-oncogenes (Fosb, Hhex, Hic1, Rhof), (ii) transcription factors (Cbfα2t3h , Runx3, Utf1), (iii) genes involved in apoptosis signalling (FasL, Tnfsf10), (iv) receptor molecules (Edg1, Ly78) or (v) other signalling genes (Dirc, Rab3gap2, RasA4, Sesn2, Tbc1d5, Terf2) most of them being listed in the RTCGD or IDDb as CIS or CRVIS. TABLE 1. Summary of RVIS detected in repopulating haematopoietic cells of primary and secondary mice. Mouse numbers (second cohort mice are labelled with II) and transgenes (t = mtCD34, f = mfCD34, g = eGFP) are indicated. Gene classes are defined as follows: class 1 = common insertion sites, proto-oncogenes and self-renewal genes, class 2 = signalling genes and classes 3&4 = other and unknown genes.23 Mice Locus

From/to TSS Chromo- Hits in Name, (proposed ) function RTCGD Orientation some /IDDb

11GI Akt2

+3 kb (i2)

13g

Class

Akt1: 3/2

Thymoma viral oncogene homolog 1 2, kinase

+100 kb(i11) 17A3.3 R

0

Ankyrin Repeat and SAM Domain 2 Containing 1 (Odin)

27t Arid1b II.1t

+330 kb (i15) 17A1 F

0

AT Rich Interactive Domain 1B (Swi1 like)

3

II.2,3f Atf7ip

-46 kb R

6G1

2/1

Activating TF 7 interacting protein, transcription co-repressor activity

1

8E1

7/1

Core-binding factor, runt domain, a subunit 2, translocated 2, 3 1 homolog

+19 kb R

15E1

0

Cdc42 Effector Protein 1, Rho GTPase binding

2 3

Anks1

31t Cbfα2t3h -15kb F II.2t 13g

Cdc42ep1

7A3

24

Dhrs3

+56 kb F

4E1

0

Dehydrogenase reductase SDR Family3

26f

Dirc2

+13 kb (3.I) F

16B3

0

Disrupted in renal cell carcinoma 2 2, peptidase activity

23f 31t

Edg1 (Dph5)

-100 kb F -102 kb F

3G1

0/2

Endothelial differentiation, sphingolipid G-protein-coupled receptor 1, endothelial differentiation

1

32t

FasL

-8.5 kb R

1H2.1

0/2

Fas ligand (TNF superfamily, member 6), apoptosis induction

1

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION Mice Locus

From/to TSS Chromo- Hits in Name, (proposed ) function RTCGD Orientation some /IDDb

11 Class

11 II.1

Fosb

-24 kb F

7A2

0/1 (Fos: 5/0)

FBJ osteosarcoma oncogene B, DNA binding

1

II.1f II.6f

Frmd6

+62 kb (6.I) R

12C2

0

FERM domain containing 6, function: protein-binding?

2

II.2f

Ggta1

-45kb R

2B

0

GlycoproteinGalactosyltransferase alpha 1.3

2

28t

Gtf2i

+28 kb (i9)

5G2

0/2

General Transcription Factor 2, transcriptional activation of growth- 2 regulated genes

25f

H3f3a

+36 kb F

1H4

0

H3 histone, family 3A, DNA binding

3

II.6t

Hhex

+2.5 kb (i2) R

19C1

26/1

Hematopoietically expressed homeobox gene, T-cell oncogene

1

24f

Hic1

-39 kb R +86 kb F

11B5

3/3

Hypermethylated in cancer 1, 1 transcription factor, Wnt antagonism

32t

Insm1

-8,5 kb R

2G2

0

13g

LOC

+45kb R

2E4

0

LOC 624373, hypothetical protein

4

24f

LOC

-4 kb R

7E3

0

LOC 626307, hypothetical protein

4

24

LOC

+28kb R

3F2.2

0

14g

LOC

>350 kb(I?) F 10D1

0

II.4f

LOC

-9 kb F

8B3.3

0

15D1

0/2

28t 30t

Lrrc6

-2.8 kb R +23 kb (i3) R

Insulinoma associated 1, nucleic acid binding

LOC195514, similar to glyceraldehyde3-phosphate dehydrogenase LOC629040, similar To Neuron Navigator 2 LOC621377, similar to Adenine phosphoribosyltransferase (APRT) Leucin repeat containing 6

3

4 4 4 1

Latent transforming growth factor 23f

Ltbp1

+33 kb (2.I) F 17E

0

binding protein 1,TGF-β receptor

2

pathway II.5g

Ly78

-26 kb R

13D1

0/2

31t

Nr1d1

-11kb R

11D

0

Odc1

-151 kb R

12A1.1

0

II.1, 5,6f

lymphocyte antigen 78 (CD180), receptor, signalling Nuclear Receptor Subunit1 group D member 1 Ornithin-Decarboxylase 1, checkpoint that guards against tumourogenesis

1 2 2

G. VON KEUDELL ET AL.

12

Mice Locus

Hits in From/to TSS ChromoRTCGD Name, (proposed ) function Orientation some /IDDb

22f

Ogfr11

+10 kb (1.I) F

28t

Pef1

+0.5 kb (1.I) 4D2.2 F

Phlpp

+103 kb (i1) 1E2.1 R

Ppfia4

+33 kb (i26) 1E4 F

II.2f

30t

1A4

Class

0

Opioid growth factor receptor like 2 1, receptor activity

0

Penta EF-hand domain containing 2 1, signalling, apoptosis

0

PH domain and leucin rich repeat protein phosphatase, dephos2 phorylates Akt, promotes apoptosis, and suppresses tumour growth

0

Protein Tyrosine Phosphatase, Receptor Type, f polypeptide (PTPRF) interacting protein (liprin), alpha 4

2

14g, Rab3ga -37 kb F II.4g p2

1H5

0

similar to Rab3 GTPase activating protein, regulation of GTPase 2 activity

27t

Rapgef2 -34 kb F

3E3

0

Rap guanine nucleotide exchange 2 factor 2, intracellular signalling

28t

Rapgef3 +40 kb R

15F1

0

Rap guanine nucleotide exchange 2 factor 3, intracellular signalling

27t, II.1t

RasA4

+8,5 kb (i3) F

5G2

0

RAS p21 protein activator 4, intracellular signalling

II.3g Rhof

-4.4 kb R

5F

4/1

Ras homolog gene family member, 1 small GTPase mediated signalling

27t II.1t

Rik

+15 kb (i2) R 4D1

0

RIKEN cDNA 4931406I20 gene, ubiquitin cycle

4

30t

Rnpc1

+19 kb R

2H3

0

RNA-binding Region (RNP1, RRM) containing 1 (Seb4)

3

II.2f

Runx3

-80 kb F

4D2.3

5/1

Runt related 3, myeloid development

1

24f II.2f

Sesn2

+6 kb (i1) F

4D2.3

0/3

Sestrin 2, induction in response to DNA damage

1

28t

Synj2

+30,5 kb (6.I) F

17A1

0

Synaptojanin 2, IP signalling

2

22f/ II.3f

Tbc1d5

+150 kb(i3) F

17C

1/1

TBC domain family member 5, GTPase activator activity

1

+47 kb F

8D3

0

Telomeric Repeat binding factor 2, telomere length regulation

2

25f Terf2 II.2,4f

2

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

Mice Locus

Hits in From/to TSS ChromoRTCGD Name, (proposed ) function Orientation some /IDDb

Class

19C1

0

Transmembran Protein 23, kinase2 transferase activity

+13 kb (3.I) II.6g Tnfsf10 F 32t +200 kb F

3A3

2/2

Tumour necrosis factor (ligand) superfamily, member 10, apoptosis induction

1

25f Terf2 II.2,4f

+47 kb F

8D3

0

Telomeric Repeat binding factor 2, telomere length regulation

2

II.1t

Treml2 +24 kb F

17C

0

Triggering receptor expressed on 2 myeloid cells like 2, signalling

11g

Trp53i1 -25 kb R 1

2E1

0

Trp53 inducible Protein 11, Tumour-Protein p53 inducible

2

II.3f II.4f

Utf1

+29 kb F

7F4

0

Undifferentiated embryonic cell transcription factor 1, ES-cell oncogene

1

22f

Usp36

+43 kb (3') F 11E2

3/1

Ubiquitin specific peptidase 36; guanyl-nucleotide release factor activity/ tumour suppressor gene?

1

14f

Tmem2 +19 kb R 3

13

We also assessed a possible influence of the expressed transgene on the RVIS distribution. In our relatively small study, some tendency towards decreased frequencies of RVIS in POG and signalling gene loci might be seen for the mtCD34 vector. However, within the much larger IDDb23 there was no difference in the distribution of insertion sites between vectors encoding fluorescent vs. cell surface marker genes. In conclusion the present report confirms the significant impact of γretroviral vector insertion sites on the establishment of clonal dominance in hematopoiesis after (serial) bone marrow transplantation. The identification of a number of putative stemness genes may contribute not only to a better understanding of stem cell biology but, in the long run also to the development of novel approaches for stem cell based therapeutic regimens, e.g. in regenerative medicine. Acknowledgements

This work was kindly supported by the Deutsche Forschungsgemeinschaft (FE568/5-2) and the Erich und Gertrud Roggenbuck-Stiftung.

14

G. VON KEUDELL ET AL.

References 1. Rohdewohld H., Weiher H., Reik W., Jaenisch R. and Breindl M. (1987) Retrovirus integration and chromatin structure: Moloney murine leukemia proviral integration sites map near DNase I-hypersensitive sites. Journal of Virology 61, 336-343. 2. Mooslehner K., Karls U. and Harbers K. (1990) Retroviral integration sites in transgenic Mov mice frequently map in the vicinity of transcribed DNA regions. Journal of Virology 64, 3056-3058. 3. Wu X., Li Y., Crise B. and Burgess S.M. (2003) Transcription start regions in the human genome are favored targets for MLV integration. Science 300, 1749-1751. 4. Mitchell R.S., Beitzel B.F., Schroder A.R., Shinn P., Chen H., Berry C.C., Ecker J.R. and Bushman F.D. (2004) Retroviral DNA integration: ASLV, HIV, and MLV show distinct target site preferences. PLoS Biol. Aug; 2(8):E234. 5. Li Z., Düllmann J., Schiedlmeier B., Schmidt M., von Kalle C., Meyer J., Forster M., Stocking C., Wahlers A., Frank O., Ostertag W., Kühlcke K., Eckert H.-G., Fehse B. and Baum C. (2002) Murine Leukemia Induced by Retroviral Gene Marking. Science 296, 497. 6. Hacein-Bey-Abina S., von Kalle C., Schmidt M., McCormack M.P., Wulffraat N., Leboulch P., Lim A., Osborne C.S., Pawliuk R., Morillon E., Sorensen R., Forster A., Fraser P., Cohen J.I., de Saint-Basile G., Alexander I., Wintergerst U., Frebourg T., Aurias A., Stoppa-Lyonnet D., Romana S., Radford-Weiss I., Gross F., Valensi F., Delabesse E., Macintyre E. et al. (2003) LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-419. 7. Modlich U., Kustikova O.S., Schmidt M., Rudolph C., Meyer J., Li Z., Kamino K., von Neuhoff N., Schlegelberger B., Kuehlcke K., Bunting K.D., Schmidt S., Deichmann A., von Kalle C., Fehse B., Baum C. (2005) Leukemias following retroviral transfer of multidrug resistance 1 (MDR1) are driven by combinatorial insertional mutagenesis. Blood 105, 42354246. 8. Du Y., Spence S.E., Jenkins N.A. and Copeland N.G. (2005) Cooperating cancer-gene identification through oncogenic-retrovirus-induced insertional mutagenesis. Blood 106, 2498-2505. 9. Seggewiss R., Pittaluga S., Adler R.L., Guenaga F.J., Ferguson C., Pilz I.H., Ryu B., Sorrentino B.P., Young W.S. 3rd, Donahue R.E., von Kalle C., Nienhuis A.W. and Dunbar C.E. (2006) Acute myeloid leukemia associated with retroviral gene transfer to hematopoietic progenitor cells of a rhesus macaque. Blood 107, 3865-3867. 10. Cornetta K., Morgan R.A. and Anderson W.F. (1991) Safety issues related to retroviralmediated gene transfer in humans. Human Gene Therapy 2, 5-14. 11. Anderson W.F. (2000) Gene therapy. The best of times, the worst of times. Science 288, 627629. 12. Woods N.B., Bottero V., Schmidt M., von Kalle C., Verma I.M. (2006) Gene therapy: therapeutic gene causing lymphoma. Nature 440, 1123. 13. Thrasher A.J., Gaspar H.B., Baum C., Modlich U., Schambach A., Candotti F., Otsu M., Sorrentino B., Scobie L., Cameron E., Blyth K., Neil J., Abina S.H., Cavazzana-Calvo M. and Fischer A. (2006) Gene therapy: X-SCID transgene leukaemogenicity. Nature 443, 7109. 14. Gaspar H.B., Parsley K.L., Howe S., King D., Gilmour K.C., Sinclair J., Brouns G., Schmidt M., von Kalle C., Barington T., Jakobsen M.A., Christensen H.O., Al Ghonaium A., White H.N., Smith J.L., Levinsky R.J., Ali R.R., Kinnon C. and Thrasher A.J. (2004) Gene therapy of X-linked severe combined immunodeficiency by use of a pseudotyped gammaretroviral vector. Lancet 364, 2181-2187.

CLONALITY AFTER RETROVIRAL CD34 TRANSDUCTION

15

15. Kustikova O., Fehse B., Modlich U., Yang M., Düllmann J., Kamino K., von Neuhoff N., Schlegelberger B., Li Z. and Baum C. (2005) Clonal dominance of hematopoietic stem cells triggered by retroviral gene marking. Science 308, 1171-1174. 16. Du Y., Jenkins N.A. and Copeland N.G. (2005) Insertional mutagenesis identifies genes that promote the immortalization of primary bone marrow progenitor cells. Blood 106, 39323939. 17. Modlich U., Bohne J., Schmidt M., von Kalle C., Knöss S., Schambach A. and Baum C. (2006) Cell culture assays reveal the importance of retroviral vector design for insertional genotoxicity. Blood 108, 2545-2553. 18. Calmels B., Ferguson C., Laukkanen M.O., Adler R., Faulhaber M., Kim H.-J., Sellers S., Hematti P., Schmidt M., von Kalle C., Akagi K., Donahue R.E. and Dunbar C.E. (2005) Recurrent retroviral vector integration at the Mds1/Evi1 locus in nonhuman primate hematopoietic cells. Blood 106, 2530-2533. 19. Ott M.G., Schmidt M., Schwarzwaelder K., Stein S., Siler U., Koehl U., Glimm H., Kühlcke K., Schilz A., Kunkel H., Naundorf S., Brinkmann A., Deichmann A., Fischer M., Ball C., Pilz I., Dunbar C., Du Y., Jenkins N.A., Copeland N.G., Luthi U., Hassan M., Thrasher A.J., Hoelzer D., von Kalle C., Seger R. and Grez M. (2006) Correction of X-linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1-EVI1, PRDM16 or SETBP1. Nature Medicine 12, 401-409. 20. Schmidt M., Hoffmann G., Wissler M., Lemke N., Mussig A., Glimm H., Williams D.A., Ragg S., Hesemann C.U. and von Kalle C. (2001) Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples. Human Gene Therapy 12, 743-749. 21. Kustikova O.S., Baum C. and Fehse B. (2007) Retroviral integration site analysis in hematopoietic stem cells. Methods in Molecular Medicine, in press 22. Mouse Genome Sequencing Consortium; Waterston RH, et al. (2002) Initial sequencing and comparative analysis of the mouse genome. Nature 420, 520-562. 23. Kustikova O., Geiger H., Li Z., Brugman M.H., Chambers S.M., Shaw C.A., Pike-Overzet K., de Ridder D., Staal F.J..T, von Keudell G., Cornils K., Nattamai K.J., Modlich U., Wagemaker G., Goodell M.A.., Fehse B. and Baum C. (2006) Retroviral vector insertion sites associated with dominant hematopoietic clones mark “stemness” pathways. Blood, in press 24. Lange C., Li Z., Fang L., Baum C. and Fehse B. (2007) CD34 modulates the trafficking behavior of hematopoietic cells in vivo. Stem cells and Development, in press 25. Li Z., Fehse B., Schiedlmeier B., Düllmann J., Frank O., Zander A.R., Ostertag W. and Baum C. (2002) Persisting multilineage transgene expression in the clonal progeny of a hematopoietic stem cell. Leukemia 16, 1655-1663. 26. Hildinger M., Abel K.L., Ostertag W., and Baum C. (1999) Design of 5' untranslated sequences in retroviral vectors developed for medical use. Journal of Virology 73, 4083-4089. 27. Kühlcke K., Fehse B., Schilz A., Loges S., Lindemann C., Ayuk F., Lehmann F., Stute N., Fauser A.A., Zander A.R. and Eckert H.-G. (2002) Highly efficient retroviral gene transfer based on centrifugation-mediated vector pre-loading of tissue culture vessels. Molecular Therapy 5, 473-478. 28. Bartholomew C. and Ihle J.N. (1991) Retroviral insertions 90 kilobases proximal to the Evi-1 myeloid transforming gene activate transcription from the normal promoter. Molecular and Cellular Biology 11, 1820-1828. 29. Akagi K., Suzuki T., Stephens R.M., Jenkins N.A. and Copeland N.G. (2004) RTCGD: retroviral tagged cancer gene database. Nucleic Acids Research 32, D523-527. 30. Ivanova N.B., Dimos J..T, Schaniel C., Hackney J.A., Moore K.A. and Lemischka I.R. (2002) A stem cell molecular signature. Science 298, 601-604.

FUNCTION OF THE MEMBRANE-BOUND ISOFORM LIGANDS OF THE RECEPTOR TYROSINE KINASE SUBCLASS III IN INDUCING SELF-RENEWAL OF EARLY HEMATOPOIETIC PROGENITOR CELLS

JUTTA FRIEL1 , CHRISTOPH HEBERLEIN 2, MAREN * GELDMACHER 3 AND WOLFRAM OSTERTAG 3 1Heinrich-Pette-Institut für Experimentelle Virologie und Immunologie an der Universität Hamburg, Hamburg, Germany 2CellTec GmbH, Hamburg, Germany 3Hannover Medical School, Hannover, Germany

Keywords: Stroma-hematopietic cell interaction; Stroma-encoded membrane-bound and soluble ligands; Stroma-independent mutants

Abstract. Maintenance and differentiation of hematopoietic stem and progenitor cells are controlled by complex interactions with the stroma microenvironment. Stroma-cell interactions can be supported by locally expressed membranespanning cell-surface growth factors. Ligands of the tyrosine receptor kinases subclass III like SCF or CSF-1 are expressed by stroma as soluble glycoproteins, proteoglycans or membrane-bound glycoproteins. SCF synergizes with other growth factors in enhancing growth of early progenitor cells whereas CSF-1 is known to regulate the survival, proliferation and differentiation of mononuclear phagocytes. Whereas the biological role of the soluble isoforms of SCF and CSF1 are well characterized, the function of the membrane-bound ligands remain unclear. To analyze the biological significance of membrane-bound SCF and -CSF-1 in vitro we used an epithelial cell line to ectopically express the different isoforms. In cocultures of SCF- or CSF-1 transduced epithelial cells with primary early hematopoietic progenitor cells we examined whether interaction between

______ * To whom correspondence should be addressed. Wolfram Ostertag, Hannover Medical School, CarlNeuberg-Str. 1, D-30625 Hannover, Germany

17 N. M. Bilko et al. (eds.), Stem Cells and their Potential for Clinical Application, 17–44. © 2008 Springer.

18

J. FRIEL ET AL.

the membrane-bound isoforms of SCF and CSF-1 and their receptors mediate cell proliferation, self-renewal or differentiation. We show here that the membranebound isoforms of SCF and CSF-1 both have functions in inducing self-renewal of early hematopoietic cells. In contrast, soluble SCF and CSF-1 exert specific functions: SCF by itself causes clonal extinction whereas CSF-1 is involved in the macrophage differentiation. In context with the stroma-hematopoietic cell interaction we also show that CSF-1 can sustain the self-renewal of a murine stem cell line Myl-D7. 1. Introduction Hematopoietic stem cell development is governed by a complex interplay between signals from stem cells and those emanating from the bone marrow stroma. In stroma, stem cells must periodically activate to produce progenitoror transient amplifying cells that are committed to produce mature hematopoietic lineages. Stromal cells form a hematopoietic microenvironment by expressing growth factors, adhesion molecules and matrix proteins, all of which regulate the homing, growth, survival and differentiation of stem cells. Growth factors produced by stroma include cytokines such as IL-1 and IL6, ligands of receptor tyrosine kinase like SCF, CSF-1 and Flt-3 ligand; Notch ligands, bone morphogenetic protein 4 and sonic hedgehog. Hematopoietic stem cells interact with their microenvironment differently, involving cellcell interactions, association to extracellular matrix proteins and binding to membrane-bound- and soluble growth factors. Growth factors, which are produced both as soluble and membrane-bound isotype proteins include members of the receptor tyrosine kinase subclass III, such as stem cell factor (SCF) (Anderson et al., 1990; Huang et al., 1990), colony stimulating factor-1 (CSF-1, M-CSF) (Ladner et al., 1988; Ceretti et al., 1988) and Flt 3 ligand (Hannum et al., 1994; McClanahan et al., 1996). SCF is encoded by the mouse Steel (Sl) loci (Zsebo et al., 1990). The SlDickie allele of mutant mice (Sld) encodes a smaller protein due to deletions of the transmembrane and intracellular domains. Sld cells exclusively express a secreted form of SCF (Flanagan et al., 1991). Another mutation of the Steel locus, Sl/Sl, results in complete loss of SCF production (Zsebo et al., 1990). Mutations of both the Steel and Sld loci result in similar phenotypic disorders of hematopoiesis characterized by reduction in stem cell numbers, anemia, mast cell- and repair deficiencies (Nocka et al., 1989; McCulloch et al., 1965). Phenotypes of Sld mice show that the membrane inserted SCF must have an

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

19

essential function that differs from that of soluble SCF (Dexter and Moore, 1977; Fujita et al., 1988). The kit receptor is expressed on hematopoietic stem cells implying a function of SCF in the regulation of self renewal and/or adhesion of cells to stroma (Ogawa et al., 1991; Ikuta and Weissman,1992; Kodoma et al., 1994). Soluble SCF synergizes with early and late acting cytokines including the Flt3 ligand, Thrombopoietin (TPO), IL-3, GM-CSF and erythropoietin (Epo) to enhance the growth of primitive cells (McNiece et al., 1991; Lemoli et al., 1993; Ramsfjell et al., 1997). Other studies indicate that hematopoiesis, controlled by stroma cell interaction, also functions with stroma deficient in the synthesis of SCF (Ikuta and Weissman, 1992; Sutherland et al., 1993; Itoh et al., 1989). CSF-1 and SCF are evolutionary related and show genetic and structural homologies: the gene structure, the sequence of the extracellular domains, the proteolytic maturation and the tertiary folds of the proteins are very similar. Additionally, the receptors for CSF-1 and SCF appear to have diverged from an ancestor molecule of the PDGF receptor (Yarden et al., 1986,1987). The CSF-1 receptor (c-fms) is expressed on primitive multipotent hematopoietic cells (Bartelmez and Stanley, 1985), phagocyte progenitor cells (Tushinski et al., 1982), monoblasts, promonocytes, monocytes (Byrne et al., 1981) and tissue macrophages (Stanley et al., 1983). Several studies suggest that the CSF-1 receptor could be also involved in the regulation of more early cells: primitive hematopoietic cells express the CSF-1 receptor and CSF-1 synergize with IL-1, IL-3, IL-6, G-CSF and GM-CSF to induce the formation of multipotential colonies (Broxmeyer et al., 1988; Bartelmez et al., 1989; Friel et al., 2005). Furthermore, the progenitor activity of day 12 spleen colony-forming cells can be blocked by neutralizing antibodies against the CSF-1 receptor (Gilmore and Shadduck, 1995). Whatever the nature of the receptor tyrosine kinase subclass III ligand isoforms involved, it is presently unclear whether they induce different signaling effects in early hematopoietic cells upon binding to its receptor. To determine the function of the SCF/CSF-1 isoforms we used an embryonic epithelial cell line to express ectopically each membrane-bound and soluble ligand. In cocultures with human and murine early progenitor cells we determined their proliferative and developmental responses. The murine hematopoietic stem cell line Myl-D7 spontaneously differentiate along the lymphoid, myeloid and erythroid lineages. Myl-7 cells shows a strict stromal dependence for growth of self-renewing stem cells and express high levels of CSF-1 receptor (Itoh et al., 1996). We used this cell line to analyze the function of CSF-1 in maintaining multipotent cells. In an other attempt to characterize unknown factors that could sustain stem cells we

J. FRIEL ET AL.

20

generated stroma-independent Myl-D7 mutants. The autostimulatory activity of these mutants was examined. 2. Results To verify the different functions of the isoforms of SCF and CSF-1 in promoting stroma-dependent growth a non-stromal cell system was used to express the soluble and membrane-bound cDNA isoforms. TABLE 1. Cell lines used and expression of SCF/CSF-1 ligands Feeder cell cDNA used for line transduction

-

MS5 MMCE MMCE MMCE

Sld m2 SCF

UNC Sl/Sl

-

SCF expression

CSF-1 expression

membranebound

soluble

membranebound

soluble

+

+

+

+

+

+

-

-

+

-

-

-

-

UNC Sl/Sl Sld

-

+

+

+

UNC Sl/Sl m2 SCF

+

-

-

+ +

+ + +

+ + +

MS Sl-2 MS Sl-2

m2 SCF

+

+

Described as

MS5 MMCE MMCE MMCE Sl/Sl stroma Sl/Sl stroma Sl/Sl stroma Sld stroma Sld stroma

To exclude synergistic effects between stroma encoded factors and the ectopically expressed SCF/CSF-1 isoforms we used as a coculture system the murine embryonic epithelial cell line MMCE (Rapp et al., 1979). MMCE does not produce any isoform of SCF or CSF-1 and does not express genes for those growth factors like IL-1α, IL-6, IL-11, Flt 3 ligand, G-CSF, Epo or TPO that are known to synergize with SCF or CSF-1 in augmenting growth of hematopoietic cells (McNiece et al., 1991; Lemoli et al., 1993: Ramsfjell et al., 1997). MMCE cells also do not express genes for MIP-1α or TGF-β that could inhibit the maintentance of hematopoietic progenitors on stroma (Mayami et al.,

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

21

1995). The only growth factor mRNA detected of the large number tested was PDGF-A (data not shown, Friel et al., 2002). Untransduced MMCE cells failed to support short or long term proliferation of hematopoietic progenitors. The untransduced murine stromal cell line MS5 (Itoh et al., 1989) expressing wildtype SCF and CSF-1 was used as a control. For SCF/CSF-1 expression of different cell lines used see Table 1. 2.1. MEMBRANE-BOUND SCF ON ITS OWN IS BIOLOGICALLY ACTIVE AND INDUCES LONG TERM GROWTH OF TF1 CELLS IN COCULTURE ON EPITHELIAL CELLS

To determine the function of the SCF isoforms in inducing long-term growth of hematopoietic cells we used the human CD34+ progenitor cell line TF1 (Kitamura et al., 1989). Ectopic secretion of soluble Sld SCF by MMCE could not stimulate long term proliferation of TF1 in coculture. Conditioned medium of MMCE cells synthesizing soluble Sld SCF stimulated only a short term response of TF1 cells (Fig. 1).

Figure 1. Long term growth of TF1 induced by epithelial MMCE cells expressing membranebound SCF. Long term growth of TF1 cells was determined by serial clone transfer experiments. 48 clones from several independent experiments with cell numbers >5·10² cells were transferred on new feeders during the first and second transfer. Each point represents the mean (±SD) of five independent experiments. The results are calculated as % of TF1/Sl+ MS5 control cocultures. C.E.s at the first clonal transfer of TF1 cells were set to 100%. t MMCE transduced with cDNA for mb SCF, s MMCE transduced with cDNA for soluble Sld SCF, C parental MMCE, I Sl+MS5.

22

J. FRIEL ET AL.

Ectopic expression of membrane-bound (mb) SCF, however, confered stroma like growth promoting activity to epithelial MMCE cells (Fig. 1). The initial cloning efficiency of TF1 on transduced MMCE expressing mb SCF was about one third compared to cocultures on murine Sl+MS5 stroma. On repeated serial transfer the proliferation of TF1 clones on MMCE ectopically expressing mb SCF was as high as that on Sl+MS5 stroma (data not shown). This reflects the selection of adapted TF1 clones in coculture on transduced competent MMCE cells. Thus, mb SCF on its own can mediate long term growth promoting signals to hematopoietic precursor cells. MMCE cells express PDGF-A which is not a specific hematopoietic cytokine but shows potential mitogenic effects on hematopoietic cells in presence of other primary factors (Michalevicz et al., 1986; Delwiche et al., 1985). Its effects are presumably indirectly mediated, for example by upregulation of IL-1 (Yan et al., 1993) in stromal macrophages, CSF-1 or IL-6 from mesenchymal cells (Hall et al., 1989). From our RT-PCR analysis no upregulation of any one of the tested factors could be observed in MMCE cells expressing the PDGF-A gene, regardless whether transduced with SCF encoding retroviral vectors or not (Friel et al., 2002). However, we cannot exclude some synergistic action between membrane-bound SCF and PDGF in cocultures on modified MMCE. Certainly, parental MMCE could not support proliferation of TF1 (cf. Fig. 1). 2.2. EXOGENOUSLY ADDED SOLUBLE SCF CAN NOT IMPAIR OR MIMIC THE EFFECT OF MEMBRANE-BOUND SCF

Two reasons could explain the failure of soluble Sld SCF to induce long term growth of hematopoietic cells on stroma. One might be the production of inadequate levels of protein by Sld stroma and by Sl/Sl and MMCE cells ectopically expressing Sld SCF. The other could be an antagonistic function of the mutated Sld SCF compared to the membrane-bound isoform. To test for these possibilities we added recombinant soluble SCF, that is produced as a cleavage product of mb SCF, to TF1 feeder cocultures. Addition of exogenous recombinant SCF even in excess of 100ng/ml to TF1 on Sl+MS5 cells had little or no effect on cloning efficiencies (Fig. 2a). In contrast, supplementation of Sld stroma cocultures with recombinant SCF further reduced the growth promoting potential about 2.5-fold (Fig. 2b). Functional neutralization of the added recombinant SCF by anti SCF antibodies surprisingly increased the cloning efficiency 2-fold beyond that seen without adding recombinant SCF. In contrast, addition of recombinant SCF to Sld stroma cocultures ectopically expressing mb SCF did not influence the proliferation rate of TF1 (Fig. 2b). Addition of recombinant SCF to cocultures of TF1 on Sl/Sl

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

23

stroma not expressing any isoform of SCF showed an even more dramatic effect. The growth promoting potential is reduced 4-fold. Neutralization of the exogenously supplied SCF by anti SCF antibodies restored the original growth inducing activity of the parental Sl/Sl stroma (Fig. 2c). Supplementation of recombinant SCF to cocultures of TF1 on Sl/Sl stroma already ectopically expressing soluble Sld SCF showed only a slight effect. This most likely is caused by the already synthesized SCF. Again, addition of recombinant SCF to Sl/Sl cocultures ectopically expressing mb SCF did not impair the proliferation rate of TF1 (Fig. 2c).

Figure 2. Soluble SCF reduces the cloning efficiency of TF1 cells. TF1 cells were cultured on feeders in presence of various amounts of reombinant mouse SCF. Neutralizing anti-SCF antibody was added as indicated from day 10 to day 16. Viable clones were counted following the second transfer. Each column represents the mean±SD of four independent experiments calculated as % of CEs of control cocultures. Titration of recombinant SCF on: a) Sl+MS5 cocultures expressing wildtype SCF. C.E. of control coculture on Sl+MS5 without addition of recombinant SCF was set to 100%. b) Stroma cocultures producing Sld or Sld plus mb SCF. C.E.s of control cocultures without addition of recombinant SCF on Sld stroma (white columns), or Sld stroma transduced to express mb SCF (dark grey) were set to 100%. c) Sl/Sl cocultures expressing no SCF, soluble Sld SCF or mb SCF. C.E.s of control cocultures without addition of recombinant SCF on Sl/Sl UNC (white columns), or Sl/Sl UNC transduced to express Sld SCF (grey columns) or mb SCF (dark grey) were set to 100%. d) MMCE cocultures producing mb SCF. C.E. of control coculture on MMCE transduced to express mb SCF without addition of recombinant SCF was set to 100%. Dark grey columns: cell lines presenting mb SCF.

24

J. FRIEL ET AL.

Not unexpectedly, addition of large quantities of recombinant SCF to TF1 cocultures on parental MMCE synthesizing no SCF or transduced Sld SCF did not increase the cloning efficiencies of TF1 cells. Addition of recombinant SCF, even in excess of 100 ng/ml to cocultures of TF1 on MMCE cells transduced to present mb SCF could not impair the growth promoting potential of these feeder cells (Fig. 2d). Taken together, supplementation of stromal or epithelial cocultures with recombinant SCF in absence of membrane-bound SCF suppresses the cloning efficiency of TF1 cells. Neutralization of the effect of soluble SCF by anti-bodies abolishes the negative effect and restored the original growth promoting activity of the stroma. Thus, soluble SCF, either as recombinant protein or as mutated Sld SCF, on its own induces the growth abrogating effect in TF1 feeder cocultures. Even high concentrations (100 ng/ml) of recombinant SCF can not mimic the effect of membrane SCF in providing growth support for TF1. 2.3. NEUTRALIZATION OF THE SCF/C-KIT INTERACTION CAN INCREASE OR INHIBIT PROLIFERATION OF TF1 ON FEEDER CELLS

To verify that the SCF c-kit interaction plays the essential role in stimulating TF1 in our coculture system, neutralization experiments were set up using the anti c-kit monoclonal antibody YB5.B8 (Lerner et al., 1991). Data presented in Fig. 3a show that addition of α-c-kit drastically inhibited growth of TF1 on wildtype Sl+MS5 stroma in a concentration dependent manner. Application of α-c-kit to cocultures of TF1 on parental Sld stroma confirmed the importance of the SCF/c-kit interaction (Fig. 3b). Preventing binding of SCF to c-kit by adding α-c-kit antibodies increased the cloning efficiency of TF1 on Sld stroma up to 2-fold (Fig. 3b). Thus, addition of SCF antibodies (cf. Fig. 2b) as well as α-c-kit antibodies to cocultures results in a beneficial effect on the growth promoting potential of Sld cells. Hence, Sld stroma can promote long term growth of TF1 cells only by mechanisms independent of the SCF-c-kit complex when the effect of soluble SCF is neutralized. Addition of α-c-kit to cocultures of TF1 on transduced Sld stroma producing mbSCF reduced the cloning efficiency about 2-fold. Even high amounts of antibodies (5.6 µg/ml) could not completely inhibit the proliferation of TF1 cells (Fig. 3b). One explanation could be that addition of neutralizing α-c-kit prevented the interaction of Sld SCF with c-kit, thereby promoting an SCF/c-kit independent growth stimulatory pathway. α-c-kit antibodies if added to cocultures of TF1 on transduced MMCE expressing mbSCF causes complete inhibition of growth as expected (Fig. 3d). These inhibition experiments thus confirmed the essential role of the SCF/c-kit interaction in supporting long term stroma dependent growth of TF1.

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

25

Figure 3. Neutralizing anti c-kit moAb inhibits proliferation of TF1 on feeder cells expressing membrane-bound SCF. TF1 cells were cocultured in presence of serial dilutions of YB5.B8 moAb on stromal or epithelial cell lines expressing either endogenous and/or transduced SCF genes. Viable clones were counted after the second serial transfer. Data are mean±SD values of three to five independent experiments calculated as % of control Sl+MS5 cocultures which was not supplemented with α-c-kit Ab. Neutralizing anti-c-kit antibody was added as indicated from day 10 to day 16. Potential nonspecific inhibiting effects of the antibody preparation were excluded by culturing TF1 cells in suspension with 100 U/mL rGM-CSF in presence of various amounts of YB5.B8 moAb and counting proliferating cells after 72 hours. Addition of α-c-kit Ab to: a) P Sl+MS5 cocultures expressing wild type SCF; ! TF1 cells grown in suspension with 100 U/ml r GM-CSF. b) P Sld cocultures producing Sld or I Sld and ectopically mb SCF. c) 1 Sl/Sl cocultures producing no SCF, ectopically p soluble Sld SCF or i mb SCF. d) s epithelial MMCE cocultures expressing transduced mb SCF.

2.4. MEMBRANE-BOUND SCF IS SUPERIOR TO SOLUBLE SLD SCF IN SUPPORTING GROWTH OF PRIMARY HEMOPOIETIC CELL GROWTH

A number of reports have shown that CD34+ cells obtained from umbilical cord blood (CB) are quiescent (Mayani and Lansdorp, 1998). We therefore extended our system for SCF induced proliferation to the CB CD34+

26

J. FRIEL ET AL.

population to evaluate which isoform of SCF could more efficient induce proliferation. CD34+ cells were cocultured on MMCE cells expressing mb or soluble Sld SCF and as controls on untransduced MMCE and on Sl+MS5 stroma.

Figure 4. Membrane-bound SCF stimulates clonogenic CD34+ CB progenitors stronger than soluble SCF. Cord blood CD34+ cells were seeded on feeders. Each point represents the mean ±SD of six independent experiments. A) net increase of total cord blood cells; B) Colony forming units (CFU) are calculated as CFU per 100 cells plated in methylcellulose. Cloning efficiencies were recorded after coculturing for 7, 14, 21, and 28 days. Data are mean(±SD) of several independent experiments as indicated. p CD34+ cells cocultured on Sl+ MS5 stroma; P CD34+ cells cocultured on untransduced MMCE cells; i CD34+ cells cocultured on MMCE cells expressing membrane-bound SCF; I CD34+ cells cocultured on MMCE cells expressing soluble Sld SCF.

Within one week the total number of hematopoietic cells increased on stimulation with Sl+MS5 stroma 5-fold (Fig. 4a). Membrane-bound SCF was slightly more effective (3.5-fold) than soluble Sld SCF (2.8-fold) in enhancing the total number of hematopoietic cells at this time point. A proliferating cell population was also initially detected in coculture with untransduced epithelial cells, although the proliferation capacity declined within two weeks (Fig. 4a). After four weeks in coculture the proliferation potential of Sld SCF induced CB cells was 6-fold decreased, that of mb SCF stimulated cells 1.5-fold. Thus, proliferating cells were maintained significantly longer in cultures supported by membrane-bound SCF than by Sld SCF. To investigate the cloning efficiency of the progenitor cells in these cocultures we analyzed their colony formation ability in methylcellulose supplemented with recombinant growth factors. The results indicate that within the first two weeks mb SCF as well as Sld SCF or Sl+MS5 stroma induced

STROMA CELL SIGNALLING FOR HSC SELF RENEWAL

27

comparable cloning efficiencies of primary hematopoietic cells (Fig. 4b). After four weeks the cloning efficiency of soluble Sld SCF stimulated hematopoietic progenitors declined 3-fold as opposed to cells driven by mb SCF. MMCE feeder by itself was unable to stimulate progenitors longer than one week (Fig. 4b). These results clearly show that membrane-bound SCF was superior to soluble Sld SCF in stimulating clonogenic progenitors throughout the culture period of four weeks. Furthermore, membrane-bound SCF induces comparable proliferation rates of clonogenic precursors as Sl+MS5 stroma. The conditioning of the CD34+ cells as analyzed by colony assays in methylcellulose revealed that membrane-bound SCF mainly supports the maintenance of multipotent and bipotent progenitors. The number of CFU-GM and CFU-GEMM constituted 32% of total colony-forming cells after one week and 52% after two weeks in coculture. In contrast, the proportion of multipotent progenitors in cocultures induced by Sld SCF are 4-fold lower after three weeks in culture (Table 2), but the contents of erythroid colonies (BFU-e’s) increased 1.5-fold at the same time point. The results indicate that soluble Sld SCF promotes more committed cells than membrane-bound SCF. Mature myeloid colonies increased about 1.5-fold in contrast to CFU-C derived from membrane-bound SCF expressing cultures (Friel et al., 2002). The effect of soluble Sld SCF on the stimulation of erythroid precursors is at the first glance unexpected, since Sld mice bear erythroid deficiencies (McCulloch et al., 1965). The simplest explanation is, that the increased appearance of BFU-e’s is correlated with the increased number of macrophage colonies. It is known that macrophage colonies in vitro cultures have supporting effects on erythroid colonies, perhaps by secreting Epo. Nevertheless, we could not exclude that due to a synergistic effect of an uncharacterized factor produced by epithelial MMCE cells the number of erythroid progenitors in Sld conditioned hematopoietic cells is promoted. TABLE 2. Membrane-bound isoforms of SCF and CSF-1 show comparabel effects in inducing proliferation of primary CD34+ cells but membrane-bound SCF has a stronger effect on the selfrenewing potential. 250 cord blood cells cocultured on MMCE feeders expressing different CSF-1 isoforms were weekly plated in methylcellulose supplemented with hematopoietic growth factors. On day 14 colonies were examined. CFU-values were calculated as % of total CFU. Data are mean±SD of five experiments. *) After three weeks in coculture 500 cells were plated in methylcellulose. a) Cloning efficieny of CD34+ cells stimulated by different SCF- or CSF-1 isoforms as indicated. **) mb CSF-1 and soluble SCF yielded significant differences (P