Recombinant DNA, Part H, Vol. 217 (Methods in Enzymology)

Contributors to V o l u m e 217 Article numbers are in parentheses following the names of contributors. Affiliations li...

Author: John N. Abelson | Melvin I. Simon | Ray Wu

29 downloads 990 Views 21MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Contributors to V o l u m e 217 Article numbers are in parentheses following the names of contributors. Affiliations listed are current.

GIOVANNA F E R R O - L u z z 1 A M E S ( 3 2 ) , Department of Molecular and Cell Biology, Division of Biochemistry, University of California, Berkeley, Berkeley, California 94720

lina, Chapel Hill, North Carolina 27599 RICHARD L. CATE (29), Biogen, Inc., Cambridge, Massachusetts 02142 KARL X. CHA1 (23), Department qf Biochemistry and Molecular Biology, Medical University of South Carolina. Charleston, South Carolina 29425 JULIE CHAO (23), Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29425

SILV1A B~HRING (5), Institutfi~r Molekularhiologie, Abteilung Molekulare Zellgenetik, D-Ill5 Berlin-Buch, Germany VLADIMIR [. BARANOV (9), RiboGene, Inc., Hayward, California 94545 CARL A. BATT (18), Department of Food Science, Cornell University, Ithaca, New York, 14853

LEE CHAO (23), Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston. South Carolina 29425

JEAN-PAUL BEHR (41), Laboratoirede Chi. mie Gdndtique, Universitd Louis Pasteur, CNRS URA 1386, F-67401 lllkirch, France

LIN CHEN (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138

MARTIN W. BERCHTOLD (8), lnstitut fiir Pharmakologie und Biochemie, Universitiit Ziirich-lrchel, Ch-8057 Zurich, Switzerland

YUNJE CHO (18), Field of Microbiology. Cornell University, Ithaca, New York 14853 CHRISTOPHER COLECLOUGH (11), Department of Immunology, St. Jude Children's Research Hospital, Memphis, Tennessee 38101 MATTHEW COTTEN (42), Research Institute of Molecular Pathology, A-I030 Vienna. Austria

MAX L. BIRNSTIEL (42), Research Institute of Molecular Pathology, A-I030 Vienna, Austria JOHN E. BOYNTON (37), Department of Botany, Duke University, Durham, North Carolina 27706 |RENA BRONSTEIN (29), Tropix, Inc., Bedford, Massachusetts 01730 LAKI BULUWELA (28), Department of BiDchemistry, Charing Cross and Westminster Medical School, London W6 8RF, England ZELING CAI (17), Department oflmmunology, Mayo Clinic, Rochester, Minnesota 55905 CELESTE CANTRELL (31), Department of Pharmacology, University of North Caroix

RICHARD G. H. COTTON (19), Olive Miller Protein Laborato~, Murdoch Institute. Royal Children's Hospital, Parkville Victoria 3052. Australia HENRY DANIELL (38), Department of Botany and Microbiology, Auburn Universit3", Auburn, Alabama 36849 BIMALENDU DASMAHAPATRA (10), Department of Antiviral Chemotherapy, Schering-Plough Research Corporation, Bloomfield, New Jersey 07003

X

CONTRIBUTORS TO VOLUME 217

NORMAN DAVIDSON (33), Division of Biol-

MICKEY C-T. Hu (33), Department of Ex-

ogy, California Institute of Technology, Pasadena, California 91125 ANTONIA DESTREE (39), Therion Biologics Corporation, Cambridge, Massachusetts 02142 V. J. DWARK! (43), Vical Inc., San Diego, California 92121 FRITZ ECKSTEIN (13), Abteilung Chemie, Max-Planck-lnstitut fiir Experimentelle Medizin, D-3400 GOttingen, Germany CHRISTIAN W. EHRENFELS (29), Biogen, Inc., Cambridge, Massachusetts 02142 J. VICTOR GARCIA (40), Department of Virology and Molecular Biology, St. Jude Children's Research Hospital, Memphis, Tennessee 38101 NICHOLAS W. GILLHAM (37), Department of Zoology, Duke University, Durham, North Carolina 27706 ALEXANDER N. GLAZER (30), Department of Molecular and Cell Biology, Division of Biochemistry and Molecular Biology, University of California, Berkeley, Berkeley, California 94720 MICHAEL M. GOTTESMAN (4), Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 RICHARD P. HAUGLAND (30), Molecular Probes, Inc., Eugene, Oregon 97402 STEFEAN N. Ho (17), Department of Pathology, Stanford University Medical School, Stanford, California 94305 BERND HOFER (12), Abteilung Mikrobiologie, Gesellschaft far Biotechnologische Forschung, D-3300 Braunschweig, Germany CHRISTA HORICKE-GRANDPIERRE (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut fiir Ziichtungsforschung, D-5000 KOIn 30, Germany

perimental Hematology, Amgen, Inc., Amgen Center, Thousand Oaks, California 91320 TIM C. HUFFArER (21), Section of Biochemistry, Molecular and Cell Biology, Cornell University, Ithaca, New York 14853 HENRY D. HUNT (17), Department of Immunology, Mayo Clinic, Rochester, Minnesota 55905 ANDREW C. JAMIESON (18), Melvin Calvin Laboratory, University of California, Berkeley, California 94730 R. JILK (22), Department of Biochemistry, College of Agricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 SUSAN E. KANE (4), City of Hope National Medical Center, Duarte, California 91010 PETR KARLOVSKY (24), Institute of Plant Pathology, University of GOttingen, D-3400 Gdttingen, Germany DAVID C. KASLOW (20), Molecular Vaccine Section, Laboratory of Malaria Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892 M. P. KREBS (22), Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

ROBERT M. HORTON (17), Department of

Biochemistry, Gortner Laboratories, University of Minnesota, St. Paul, Minnesota 55108

BIRGIT Kt)HLEIN (12), Max-Planck-lnstitut

far Experimentelle Endocrinologie, D-3000 Hannover, Germany ERIC LAI (31), Department of Pharmacol-

ogy, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599 ANDRE LIEBER (5), Abteilung Molekulare

Zellgenetik, lnstitut fiir Molekularbiologie, D-1115 Berlin-Buch, Germany JEAN-PHILIPPE LOEFFLER (41), lnstitut de

Physiologie, CNRS URA 1446, F-67084 Strasbourg, France


Xi

CARMEL M. LYNCH (40), Targeted Genetics

HENRig 0RUM (2), Department of Biochem-

Corporation, Seattle, Washington 98101 CHRISTOPH MAAS (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, MaxPlanck-lnstitut fiir Ziichtungsforschung, D-5000 KOln 30, Germany KURTIS D. MACFERRIN (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 KAYO MAEDA (1), European Molecular Biology Laboratory, Hamburg Outstation, D-2000 Hamburg, Germany ANNA MASR (39), Integrated Genetics, Inc., Framingham, Massachusetts 01701 J. C. MAKRIS* (22), Lawrence Livermore National Laboratory, Livermore, California, 94551 ROBERT W. MALONE (43), Department of Pathology, University of California, Davis Medical Center, Sacramento, Califi~rnia, 95817 RICHARD A. MATHIES (30), Department of Chemistry, University of California, Berkeley, Berkeley, California 94720 GAIL P. MAZZARA (39), Therion Biologics Corporation, Cambridge, Massachusetts 02142 A. DUSTY MILLER (40), Program in Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 DANIEL G. MILLER (40), Program in Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 CESAR MILSTEIN (28), Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, England OWEN J. MURPHY (29), Tropix, Inc., Bedford, Massachusetts 01730 P. L. NORDMANN (22), Department of Microbiology, Biozentrum, University of Basel, CH-4056 Basel, Switzerland DAVID B. OLSEN (13), Merck Sharp and Dohme, Research Laboratories, West Point, Pennsylvania 19486

istry B, The Panum Institute, Research Center for Medical Biotechnology, University of Copenhagen, DK-2200 Copenhagen N, Denmark

* Deceased.

GARY V. PADDOCK (25), Department of Mi-

crobiology and Immunology, Medical University of South Carolina, Charleston, South Carolina 29425 R. PADMANABHAN (14), Department of Bio-

chemistry and Molecular Biology, University of Kansas Medical Center. Kansas City, Kansas 66013 THOMAS L. PAULS (8), lnstitutfiir Pharma-

kologie und Biochemie, Universitdt Zt~rich-lrchel, CH-8057 Zurich, Switzerland LARRY R. PEASE (17), Department of Immu-

nology, Mayo Clinic', Rochester, Minnesota 55905 HUNTINGTON POTTER (34), Department of

Neurobiology, Harvard Medical School, Boston, Massachusetts 02115 LAgs K. POULSEN (2), Department of Mi-

crobiology, Denmark Technical University, DK-2800 Lyngby, Denmark ANNEMARIE POUSTKA (26, 27), lnstitut j'~r

Virusforschung, Angewandte Tumorvirologie, Deutsches Krebsforschungszen(rum, D-6900 Heidelberg, Germany JEFFREY K. PULLEN (17), Department of

Immunology, Mayo Clinic, Rochester. Minnesota 55905 MARK A. QUESADA (30), Department of

Chemistry, University of California, Berkeley, Berkeley, California 94720 DAVID J. RAWLINGS (20), Howard Hughes

Medical Institute, University of California, Los Angeles, Los Angeles, California 90024 W. S. REZNIKOFF (22), Department of Bio-

chemistry, College of Agricultural and Life Sciences, University of WisconsinMadison, Madison, Wisconsin 53706 J. A. RUSSELL (36), Department of Horticul-

tural Sciences, New York State Agricul-

xii


tural Experiment Station, Cornell University, Geneva, New York 14456 HAYS S. RYE (30), Department of Molecular

and Cell Biology, Division of Biochemistry and Molecular Biology, University of California, Berkeley, Berkeley, California 94720 JENNIFER A. SALEEBA (19), Department of Biological Science, Dartmouth College, Hanover, New Hampshire 03755 VOLKER SANDIG (5), lnstitutfiir Molekularbiologie, Abteilung Molekulare Zellgenetik, D-1115 Berlin-Buch, Germany J. C. SANFORD (36), Department of Horti-

cultural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, New York 14456 JON R. SAYERS (13), School of Biological Science, University of North Wales, Bangor, Gwynedd, Wales LL57 2DG JEFF SCHELL (6), Abteilung Genetische

Grundlagen der Pflanzenziichtung, MaxPlanck-lnstitut fiir Ziichtungsforschung, D-5000 KOln 30, Germany STUART L. SCr~REIRER (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 JAMIE K. SCOTT (15), Division of Biological

Sciences, University of Missouri, Columbia, Missouri 65211 GEORG SCZAKIEL (1), Angewandte Tumorvirologie, Deutsches Krebsforschungszentrum, D-6900 Heidelberg, Germany VENKATAKRISHNASHYAMALA(32), Chiron

Corporation, Emeryville, California 94608 JOHN R. SIMON (35), Department of Biologi-

cal Chemistry and Laboratory of Biomedical & Environmental Sciences, University of California School of Medicine, Los Angeles, California 90024 F. D. SMITH (36), Department of Horticul-

tural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, New York 14456 GEORGE P. SMITH (15), Division of Biologi-

cal Sciences, University of Missouri, Columbia, Missouri 65211

WOLFGANG SOMMER (5), lnstitut far Mole-

kularbiologie, Abteilung Molekulare Zellgenetik, D-Ill5 Berlin-Buch, Germany ALEXANDER S. SPIRIN (9), Institute of Protein Research, Academy of Sciences, 142292 Pushchino, Moscow Region, Russia HANS-HENNING STEINBISS (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut far Ziichtungsforschung, D-5000 KOln 30, Germany MICHAEL STRAUSS (5), Max-Planck Group of the Humboldt University, MaxDelbriick Center for Molecular Medicine, D-I 115 Berlin-Buch, Germany MICHAEL P. TERRANOVA(7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 RICHARD TIZARD (29), Biogen, Inc., Cambridge, Massachusetts 02142 REINHARD TOPFER (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut far Ziichtungsforschung, D-5000 KOln 30, Germany SHIGEZO Ut)AKA (3), Department of Food Science and Technology, Faculty of Agriculture, Nagoya University, Nagoya 464, Japan GREGORY L. VERDINE (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 INDER M. VERMA (43), Molecular Biology and Virology Laboratory, The Salk Institute, San Diego, California 92186 JOHN C. VOYTA (29), Tropix, Inc., Bedford, Massachusetts O1730 ERNST WAGNER (42), Research Institute of Molecular Pathology, A-I030 Vienna, Austria MARY M. Y. WAYE (16), Department of Biochemistry, Chinese University of Hong Kong, Hong Kong M. WEINREICH (22), Department of Biochemistry, College of Agricultural and Life Sciences, University of WisconsinMadison, Madison, Wisconsin 53706

CONTRIBUTORS TO VOLUME 217 T. WIEGAND (22), Department of Biochem-

istry, College of Agricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 LAI-CHu W c (28), Davis Medical Center, Departments of Medical Biochemistry and Internal Medicine, The Ohio State University, Columbus, Ohio 43210 HIDEO YAMAGATA (3), Department of Food Science and Technology, Faculty of Agriculture, Nagoya University, Nagoya 464, Japan C. YUNG YU (28), Departments of Pediatrics and Medical Microbiology and lm-

Xlll

munology, The Ohio State University and Children's Hospital Research Foundation, Columbus, Ohio 43205 STEPHEN YUE (30), Molecular Probes, Inc.,

Eugene, Oregon 97402 Q.-X. ZHANG (14), Department of Biochem-

istry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103 L.-J. ZHAO (14), Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103

[1]

E. coli EXPRESSIONPLASMIDpPLEX

[1] V e c t o r p P L E X

By

3

for E x p r e s s i o n o f N o n f u s i o n P o l y p e p t i d e s in E s c h e r i c h i a coli

GEORG SCZAKIEL a n d KAYO MAEDA

Introduction Escherichia coli bacteria are a powerful tool for the production of heterologous proteins in large quantities, which is of general experimental importance in many fields of natural sciences, for example, in biochemical and biophysical studies. The functional genes coding for polypeptides of interest are introduced stably into E. coli bacteria by E. coli vectors (e.g., plasmids, bacteriophages, cosmids, and phagemids). The expressed polypeptides originate from a unique type of coding DNA and thus, in E. coli from nonspliceable mRNAs, the peptide sequence of expressed molecules is defined exactly, that is, they are monoclonal. For many studies, monoclonal polypeptides are of great advantage in comparison with protein preparations from natural sources, which may consist of numerous closely related but not identical isoforms. Escherichia coli is one of the best studied organisms and many well-established methodologies used in molecular biology can be applied to modify and handle vectors and coding sequences. 1,2 Polypeptides of interest can be expressed in E. coli as fusion proteins, usually extended at the amino terminus with prokaryotic portions intended to provide increased translational initiation, stability, solubility, alternative purification protocols, and yield, or to allow secretion. Fusion proteins can be used for immunological studies, such as the production of antisera, or as antigens in enzyme-linked immunosorbent assay (ELISA) or Western analysis. However, their use in other studies, for example, those concerning enzymatic activities and three-dimensional structures, is limited, especially in the latter case, where the expression of nonfusion proteins is desirable. The necessary elements that an expression plasmid should supply are an origin of replication, a dominant selection marker for plasmid propagation and maintenance, and transcriptional (promoter) and translaLT. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 2 F. M. Ausubel, R. Breut, R. E. Kingston, D, D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, "Current Protocols in Molecular Biology." Wiley, New York, 1987.

METHODS IN ENZYMOLOGY, VOL. 217

Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

4

VECTORS FOR EXPRESSING CLONED GENES

[1]

tional initiation sites (Shine-Dalgarno sequence and start codon), as well as termination signals for translation and transcription. Transcription directed by strong promoters can down-regulate plasmid replication, which may result in the loss ofplasmid. For this reason transcription from strong promoters usually needs to be terminated by efficient transcriptional terminators, A number of other parameters for successful expression of heterologous eukaryotic sequences in E. coli must be considered and tested: (1) DNA sequence and primary and secondary structure of the transcript in the vicinity of the start codon, 3 (2) codon usage, 4 (3) possible toxicity of expression products for E. coli, (4) posttranslational modifications, (5) RNA editing of eukaryotic sequences in the homologous system, 5'6 which does not occur in E. coli, and (6) evaluation of the ability of expressed portions of proteins to form defined structures. The techniques for prokaryotic gene expression have been described in detail. 7 Principle of Method The expression vector pPLEX 8 contains all elements necessary for the expression of open reading frames in E. coli. For transcription the bacteriophage h-derived strong PL Promoter9 and the t R terminator are used. The PL promoter can be regulated, that is, repressed or induced by the thermolabile h ci857 repressor,10 which is active at the permissive temperature of 28 ° but is inactive at 37 or 42 °. The gene coding for the ci857 repre s sor can be plasmid encoded or can be integrated into the host cell chromosome (e.g., E. coli strain NF 1). The translational control elements, that is, the ribosomal binding site and stop codons in all three reading frames as well as unique cloning sites in between, are indicated in Fig. 1. Materials and Methods

Escherichia coli Strains NF1 (K12) AH1 H): F - A(bio- uvrB) lacZam hNam7 Nam53 ci857 AH1 (cro-F-A-J-b2 ) 3 H. A. De Boer and A. S. Hui, this series, Vol. 185, p. 103. 4 p. M. Sharp and W.-H. Li, Nucleic Acids Res. 15, 1281 (1987). 5 L. Simpson and J. Shaw, Cell 57, 355 (1989). 6 A. M. Weiner and N. Maizels, Cell 61, 917 (1990). 7 D. V. Goeddel, this series, Vol. 185, p. 3. 8 G. Sczakiel, A. Wittinghofer, and J. Tucker, Nucleic" Acids Res. 15, 1878 (1987). 9 E. Remaut, P. Stanssens, and W. Fiers, Gene 15, 81 (1981). l0 M. Lieb, J. Mol. Biol. 16, 149 (1966). ii H.-U. Bernard, E. Remaut, M. V. Hershfield, H. K. Das, D. R. Helinski, C. Yanowsky, and N. Franklin, Gene 5, 59 (1979).

[1]

E. coli EXPRESSION PLASMID p P L E X

5

(130) NCOI

SalI

HindIII

HpaI

BclI

I CCATr~GTCGAC AAG CTT AC;TTAACTOATCA (o)

~

Stul

Pvu[

/

/

/ I-

\

/

"\ \

(3450)"~ ( {

PstI l \

/

pPLEX

i

\

/ /¢~/

fO /

/

(~ Ms 2 Shine- Datgarno Sequence: EcoR 1 GAATTCCGAC

TGCGAGCTTA

TTGTTAAGGC

AATGCAAGGT

CTCCTAAAAG

ATGGAAACCC

GATTCCCTCA

GCAATCGCAG

CAAACTCCGG

CATCTACTAA

TAGACGCCGG

CCATTCAAAC

ATGAGGATTA

CCCATGG

Nco 1 ®

%tR

Sequence:

TAAATAACCC

CGCTCTTACA

CATTCCAGCC

CTGAAAAAGG

Nsi I GCATCAAATT

AAACCACACC

TATGGTGTAT

GCATACATTC

AATCAATTGT

TATCTAAGGA A A T A C T T A C A

GCATTTATTT TATG

FIG. 1. Structure of the E. coli expression plasmid pPLEX and sources of sequence elements: A, MS 2 Shine-Dalgarno (S.D.) sequence [G. Simons, E. Remaut, B. Allet, R. Devos, and W. Fiers, Gene 28, 55 (1984)]; B, htR fragment; C, galactokinase gene [C. Debouck, A. Riccio, D. Schlumperli, K. McKenney, J. Jeffers, C. Hughes, and M. Rosenberg, Nuclei(" Acids Res. 13, 1841 (1985)]; D, fragment from pPLc245 containing the ,kpL promoter [E. Remaut, P. Stanssens, and W. Fiers, Nucleic Acids Res. 11, 4677 (1983)]. Note that BclI is sensitive to Dam methylation. In order to use the BclI site pPLEX must be grown in a dam- E. coli strain. An additional AccI site located on the pBR322 sequence that is present in the original plasmid pPLEX but was filled in with Klenow fragment and nucleotide triphosphates, that is, it was destroyed in pPLEXAcc • (J. Tucker, unpublished observations, 1986.)

6


[1]

W6 (origin not known): su-, cI (wild type) unc195912: lacI Q lacL8 thr-1 ara-14 leuB6 A(gpt-proA) 62 lacY1 1on-22 supE44 galK2 h- sulA27 hisG4 rpsL31 xyl-5 mtl-1 thi-1

Cloning Methods of recombinant DNA technology are essentially performed following the protocols of Maniatis et al.1 For cloning pPLEX-derived constructs we use E. coli strain W6, containing the h wild-type cI repressor integrated into its chromosome. The wild-type repressor is able to shut off the PL promoter efficiently, thus allowing stable replication and high copy numbers of recombinant pPLEX-derived constructs. In principle an E. coli strain harboring the thermolabile ci857 repressor is also suitable at the permissive temperature of 28°; however, the clearly decreased growth rate at this temperature seems to be a disadvantage. For induction of the PL promoter, E. coli host strains NFI and unc1959, both containing a cI857-carrying plasmid, are used. Transformation of E. coli cells is performed following the CaCI2 method 13 for W6 and NF1 or the protocol developed by Hanahan 14 for DH2/6. The transformation yields for 1 /xg of pPLEX DNA with freshly prepared bacteria are in the range of 5 × 105 for W6 and 1 × 106 for NF1. The transformation frequency after storage of transformation-competent cells in 5% (v/v) glycerol at - 7 0 ° is decreased by a factor of approximately 10.

Induction of hPL Promoter The protocol for the induction of the hPL promoter of E. coli strains carrying pPLEX constructs is depicted schematically in Fig. 2. As an alternative way of induction of the LMM expression plasmid pEXLMM74 a temperature shift to 42 ° may be performed for 15 min with subsequent incubation at 37° for 4 hr. To raise the temperature quickly to 42 ° for large volumes (e.g., 10 liter), an appropriate amount of fresh medium preheated to 60 ° is added. On induction, suppression of the htR terminator results in transcription of a bicistronic mRNA consisting of the heterologous open reading frame and the coding sequence for galactokinase. Thus, an increase in galactokinase activity monitors efficient hpL-directed transcription.

12 Obtained from B. Bachman, E. coli Genetic Stock Centre, New Haven, Connecticut. I3 M. Mandel and A. Higa, J. Mol. Biol. 53~ 159 (1970). 14 D. Hanahan, J. Mol. Biol. 166, 557 (1983).

[1]

E. coli EXPRESSION PLASMID pPLEX

7

Grow 1 ml overnight culture of E. coli strain NF1 transformed with pPLEX construct in medium (standard I or L-broth supplemented with 100 p.g/ml ampiciUin) at 28° $ Inoculate 1 ml of fresh medium with 10/xl of dense overnight culture Incubate for 1 hr at 28° $ Divide culture in two 0.5-ml aliquots

/

\

4 hr, 28° (uninduced control)

4 hr, 28° (induced control)

l

Protein analysis

Protein analysis

1

FIG. 2. Protocol for the induction of the PL promoter-driven expression cassette of pPLEX. In analysis of expression products by SDS-polyacrylamide gel electrophoresis induced cultures have higher cell densities, i.e., protein concentrations, than do control cultures grown at 28°.

Analysis o f Expression Products Soluble Protein Fraction. Escherichia coti cells are harvested by centrifugation (30 sec, r o o m t e m p e r a t u r e , 7000 rpm, E p p e n d o r f centrifuge) and the cell pellet is r e s u s p e n d e d with 1 ml 50 m M Tris-HCl (pH 7.4). After centrifugation the pellet is r e s u s p e n d e d vigorously in 0.5 ml lysis buffer containing 50 m M Tris-HCl (pH 7.4), 0.5 m M dithioerythritol (DTE), 0. I m M phenylmethylsulfonyl fluoride (PMSF), and 1 m M ethylenediaminetetraacetic acid (EDTA). L y s o z y m e (3/zl, 10 mg/ml in 10 m M Tris-HCl p H 8.0, 1 m M E D T A ) is added and the mixture is maintained for 10 to 20 min at r o o m t e m p e r a t u r e . Sodium d e o x y c h o l a t e (3/zl, 40 mg/ml in water) is added and the solution is kept for 15 min at r o o m temperature. After centrifugation (15 min, 4 °, E p p e n d o r f centrifuge) soluble proteins are contained in the clear supernatant. Sodium Dodecyl Sulfate-Soluble Proteins. Escherichia coli cells are spun d o w n by centrifugation (30 sec, r o o m t e m p e r a t u r e , 7000 rpm, E p p e n d o r f centrifuge), the cell pellet is r e s u s p e n d e d once with 1 ml of 50 m M Tris-HC1 (pH 7.4), and cells are centrifuged again (30 sec, r o o m

8


[1]

temperature, 7000 rpm, Eppendorf centrifuge). The cell pellet is resuspended in 1 × sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer [3 x sample buffer: 62.5 mM Tris-HCl (pH 6.8), 15% (v/v) glycerol, 2.5% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, and 0.001% (v/v) bromphenol blue] and boiled for 5 rain to lyse cells. Hot samples are applied to polyacrylamide gels by using a Hamilton syringe. Proteins Soluble in 8 M Urea. 8 M urea-soluble fraction contains expression products that form so-called inclusion bodies: stable aggregates of partially denatured and partially structured particles, held together mainly by hydrophobic interactions. However, inclusion bodies do not necessarily have to be insoluble. (For a review of solubilization of inclusion bodies and subsequent renaturation see Ref. 15.) Examples for Use of pPLEX Figure 3 describes the expression of a subfragment of rabbit fast skeletal muscle myosin, that is, a 74-kDa portion of light meromyosin (LMM), which is a structural domain of the myosin heavy chain, a component of myosin. The quaternary structure of LMM is assumed to be a coiled coil formed by two molecules.16 The structure of the recombinant LMM74 is similar to that of the native protein, as indicated by electron microscopy. 17 Moreover, recombinant LMM74, like native LMM, can be enriched by high-salt solubilization with 0.5 M KC1 and precipitation by dialysis with low-salt buffers (for details, see the caption to Fig. 3). This property of LMM74 makes it feasible to use this LMM fragment for the generation of fusion proteins with the possible advantages listed above and, in addition, these fusion proteins could be enriched or purified by the high/low-salt method described here [e.g., LMM/human immunodeficiency virus 1 (HIV-1) Tat fusion proteins18]. It should be mentioned that the smaller (-64-kDa) band in Fig. 3 is a product of internal initiation and not a result ofprotease-mediated degradation of LMM74.17 This phenomenon might be of general importance, because it is reasonable to assume that there is no selection pressure against prokaryotic regulatory elements in sequences of higher eukaryotic cells (e.g., cDNA). Other examples for the use of pPLEX to express heterologous open reading frames in E. coli are listed in Table I. 15 R. Rudolph, in "Modern Methods in Protein- and Nucleic Acid Research" (H. Tschesche, ed.), p. 149. de Gruyter, Berlin, 1990. 16 C. Cohen and D. A. D. Parry, Proteins 7, 1 (1990). 17 K. Maeda, G. Sczakiel, W. Hofmann, J.-F. Menetret, and A. Wittinghofer, J. Mol. Biol. 205, 269 (1989). ~8 V. Wolber, K. Maeda, R. Schumann, B. Brandmeier, L. Wiesmiiller, and A. Wittinghofer, Biotechnology 10, 900-904 (1992).

E. coli EXPRESSION PLASMID p P L E X

[1]

A 12

3 4 5 6 7

9

B 1 2

3

4

5

6

7

116 m,, 97 66,,, 4 5 m,-

2 9 m,.

FIG. 3. Expression of a portion of a rabbit fast skeletal muscle light meromyosin (LMM) by use of pPLEX analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting. Bacterial extracts were collected and enriched fractions of recombinant LMM were applied to a 10% (w/v) polyacrylamide gel [U. K. Laemmli, Nature (London) 227, 680 (1970)] and either stained with Coomassie Blue (A) or blotted onto nitrocellulose and reacted first with a polyclonal rabbit anti-myosin antibody, then with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma, St. Louis, MO) according to the method of Towbin, T. Staehlin, and J. Gordon Proc Natl. Acad. Sci. U.S.A. 76, 4350 (1979) (B). Lanes numbered from 1 to 7 contain the following samples: total lysate of E. coli strain NF1 transformed with pPLEX and grown at 28° (lane 1) and at 42° (lane 2); total lysate of NF1 transformed with pEXLMM 74 (cDNA coding for a 74-kDa portion of the rabbit skeletal muscle LMM inserted into pPLEX) and grown at 28° (lane 3) and after induction for 1, 3, and 5 hr at 42 ° (lanes 4 to 6, respectively); LMM74 after two cycles of high-salt and low-salt buffer as described below (lane 7). Bacterial extracts, that is, soluble proteins, were prepared following the scheme outlined in Fig. 2. For enrichment of expressed LMM (see lane 7) bacteria were harvested by centrifugation after a 5-hr induction at 42 ° and washed once with 50 mM TrisHCI (pH 7.5). Subsequently the cell pellet was lysed. After addition of sodium deoxycholate, KCI was added (final concentration, 0.6 M). The lysate was further incubated for 15 min at room temperature and was centrifuged. The supernatant was dialyzed overnight against 10 mM potassium phosphate (pH 6.5) containing 0.1 M KCI. After dialysis the precipitate was pelleted by centrifugation and dissolved in 10 mM potassium phosphate (pH 6.5) containing 0.6 M KC1. Insoluble proteins were separated again by centrifugation and the cycle was repeated once w;th the supernatant.

l0

VECTORS FOR EXPRESSINGCLONED GENES

[1]

TABLE I pPLEX-DIRECTED EXPRESSIONOF HETEROLOGOUS SEQUENCESIN Escherichia coli Heterologous expression product Wheat Rubisco (ribulose-bisphosphate carboxylase), small subunit Spinach Rubisco activase, two isoforms (41 and 45 kDa) Human papillomavirus type 16, E7 protein Human papillomavirus type 18, E7 protein Dengue virus type 2, nonstructural protein (NS5) Portions of rabbit skeletal muscle light meromyosin (74 and 59 kDa) Portion of human cardiac/3-myosin heavy chain (subfragment l, amino acid residues 1-524)

Detection method, isolation

Reference

Western analysis

a

Purified proteins

b

NF1 and unc 1959 NF1

Western analysis

c

Western analysis

c

N4830-1

Western analysis

d

NFl

Purified protein

e

NFI

Western analysis

f

Host strain N4830-1 and NF1 UT421

M. A. Kaderbhai, M. He, R. B. Beecbey, and N. Kaderbhai, DNA Cell Biol. 9, 11 (1990). b j . B. Shen, E. M. Orozco, and W. L. Ogren, J. Biol. Chem. 266, 8963 (1991). c I. Jochmus and L. Gissmann, personal communication (1991). d A. Bartholomeusz and P. J. Wright, personal communication (1991). e K. Maeda, G. Sczakiel, W. Hofmann, J.-F. Menetret, and A. Wittinghofer, J. Mol. Biol. 205, 269 (1989). f M. Pfordt, Ph.D. thesis, University of Heidelberg, 1991.

C o n c l u d i n g R e m a r k s and Discussion Figure 3 and Table I list e x a m p l e s for the use o f the e x p r e s s i o n plasmid p P L E X . Certainly for p P L E X , and p r e s u m a b l y for o t h e r e x p r e s s i o n vectors as well, there h a v e b e e n a fair n u m b e r o f u n s u c c e s s f u l a t t e m p t s to e x p r e s s h e t e r o l o g o u s p r o t e i n - c o d i n g s e q u e n c e s in E. coli. T h e p a r a m e t e r s generally listed u n d e r T r o u b l e s h o o t i n g (below) are helpful; h o w e v e r , often the s e a r c h f6r i m p r o v e m e n t s r e m a i n s empirical. Critical p a r a m e t e r s for successful p r o d u c t i o n o f p P L E X - e n c o d e d proteins include the c o n d i t i o n s o f induction, that is, the time period and t e m p e r a t u r e o f h e a t shock. B e c a u s e the induction o f the )kpL p r o m o t e r usually is m e d i a t e d b y a t e m p e r a t u r e shift to 42 °, the h e a t - s h o c k r e s p o n s e o f E. coli cells, w h i c h is a c c o m p a n i e d b y i n d u c e d e x p r e s s i o n o f E. coli p r o t e a s e s , 19 c a n affect the stability o f e x p r e s s e d proteins. In addition 19D. W. Mount, Annu. Rev. Genet. 14, 279 (1980).

[1]

E. coli EXPRESSIONPLASMIDpPLEX

11

the time period of induction determines the accumulation of expression products, which has a crucial effect on yields and the physical form of the expression products. In some instances high intracellular concentrations of expressed polypeptides lead to a high potential of formation of insoluble inclusion bodies, whereas low intracellular concentrations result in a higher probability of leaving the expression products in a soluble form. Alternative expression systems for the production of eukaryotic polypeptides (baculovirus and yeast systems, and eukaryotic tissue culture cells) can circumvent some of the fundamental critical points for expression in E. coli as summarized above, particularly posttranslational modifications (e.g., glycosylation). However, expression in E. coli is still one of the most reasonable ways to mass produce structural and enzymatically active polypeptides. One of the more recent improvements of pPLEX was the insertion of additional restriction sites (XbaI, BamHI, SmaI, KpnI, and SstI) between the SalI and BclI sites, creating the modified vector pPLEXI9. 2° Troubleshooting Troubleshooting should include codon usage; secondary structure around start codon (mutations); clonal variability, that is, testing a larger number of transformants; internal translational start sites; and different E. coli strains (e.g., protease-deficient ones, such as unc1857). When heterologous expression products are known to be toxic for E. eoli expression, products can be obtained with expression vector systems that allow almost complete shut-off of the promoter. In this regard the hPc promoter has an advantage over many other widely used promoters, for example, tacp, trcp, or lacp. However, expression systems offering expression cascades (e.g., T7pol-T7 promoter zl) might be alternatives. Acknowledgments We thank B. Miiller for mapping pPLEX restriction sites. 20 j. B. Shen, E. M. Orozco, and W. L. Ogren, J. Biol. Chem. 266, 8963 (1991). 21 F. W. Studier and B. A. Moffatt, J. Mol. Biol. 189, 113 (1986).

12


[2]

[2] I n - F r a m e G e n e F u s i o n By HENRIK ~RUM and LARS K. POULSEN Introduction Gene fusion (the joining of unrelated genes) is an extensively used approach in the analysis of a multitude of biological problems. ~To facilitate in vitro gene fusion several vector systems have been developed that carry multiple cloning sites in any of the three reading frames. 2 When the gene of interest has been cloned and sequenced, the desired gene fusion can usually be made by choosing the appropriate vector and restriction site. Alternatively, when there are some means of detecting the gene product, for example, by antibodies, the DNA can be randomly inserted into an expression vector and the clones expressing the desired product identified by subsequent screening with the antibody. Often, neither the sequence of the gene nor an assay for its product is available. In these cases gene fusions can be selected by using vectors known as ORF vectors (open reading frame vectors). 3 ORF vectors utilize the fact that the lacZ gene-encoded fl-galactosidase enzyme is usually active when an additional polypeptide is inserted near its N terminus. Thus, when an open reading frame DNA fragment is inserted near the 5' end of the lacZ gene, the correct fusion (a tripartite gene) will have a Lac ÷ phenotype whereas the incorrect fusions will be L a c - . To confer the Lac ÷ phenotype, the DNA insert must contain an ORF and be in frame with the lacZ gene at both its 5' and 3' ends. Thus, to secure in-frame cloning of a DNA fragment of defined length (i.e., generated by restriction enzyme cleavage) nine different ORF vectors are required. Clearly, handling nine different vectors to make an inframe cloning is impractical. Instead, a single ORF vector is used and in-frame cloning is facilitated by size randomizing the DNA insert prior to cloning. We discuss here a novel in-frame cloning principle that simplifies inframe cloning of DNA fragments of defined length to involve a single vector.

I T. J. Silhavy and J. R. Beckwith, Microbiol. Rev. 49, 398 (1985). 2 p. H. Pouwels, B. E. Enger-Valk, and W. J. Brammer, "Cloning Vectors: A Laboratory M a n u a l . " Elsevier, Amsterdam, 1985. 3 G. M. Weinstock, Genet. Eng. 6, 31 (1984).

METHODS IN ENZYMOLOGY,VOL. 217

Copyright © 1993 by AcademicPress, Inc. All rights of reproduction in any form reserved.

[2]

13

IN-FRAME GENE FUSION

l-"BssXlI-~ rBssHll-- I

r-B,s,X~l -i ]

GCGCGCGCGC CGCGCGCGCG

s ' - cGcGc

GCGCG-S"

REARING F R A M E l

S ' - CGC,;CGC

~CG- S"

REARING FRAME 3

I S' - CGCGCGCGC GCG- S" I I

[,,. REARING FRAME 2

I

i

FIG. 1. The digestion patterns of the BssHlI box. The sequence GCGCGCGCGC [(GC)5] contains three overlapping BssHIl restriction sites, each corresponding to one of the three reading frames. Because cleavage at any one site destroys the two other sites, a particular (GC) 5 box can be cleaved only once.

Materials All chemicals and apparatus referred to in this chapter are commercially available. Except for BssHII [New England Biolabs (Beverly, MA) and Stratagene (La Jolla, CA)] all enzymes were obtained from Boehringer Mannheim (Indianapolis, IN). T4 DNA ligase was purchased in two concentrations [1 unit(U) and 8 U//zl] for use in sticky-end and blunt-end ligation reactions, respectively. Escherichia coli strains DH5a and JM 109 were used as hosts. Principle of Method The restriction enzyme BssHII recognizes and cleaves the alternating sequence GCGCGC and generates 4-b protruding 5' termini. Consequently, the alternating sequence, GCGCGCGCGC [(GC)5], contains three overlapping, mutually exclusive BssHII restriction sites, each corresponding to one of the three different reading frames (see Fig. I). When contained in a vector, the (GC)5 motif is cleaved at an approximate ratio of 2 : 1 : 2, resulting in a mixture of vectors carrying cloning sites in all three reading frames. 4 Thus, by using either one or two (GC)5 boxes, vectors can be 4 H. 0rum and L. K. Poulsen, Nucleic Acids Res. 17, 3107 (1989).

14


[2]

/--(-BssHI I) x 3 Mlul / Kpnl / nindllI

/

I I

?

~. % /

T

Pstl

~ I/

plFF 8

SoII/AccI/HIncl i

"Ir

1

hm,,

Smal/Xmal ApaI

~ II~ SP6 1 \

2 8 0 9 bp

A•

\

~

Sacll

\ (B.,.,,). L..NotI

T7promoter EcoRl (BssH ll) x 3 Mlul Kpnl Hindlll Pstl P TRRTACGACTCACTATAGGGCGARTTCAGCGCGCGCGCARCGCGTGGTACCAA GCTrGGCTGCAG I

I

I

I

I

I

I

I

I

!

I

I

!

I

i

I

I

I

I

I

I

I

Sall Xmal Reel Smal Ncol XIncll BamHl Rp,a.l, Secll (DssHll) x 3 Notl GTCGRCGGATCCCCGGGCCCATGGCCGCGGTCGCGTATATGCGCGCGCGCARRGCTGGCGGCCGC I

I

I

!

I

I

i

I

i

I

I

i

!

I

!

I

I

SP6 promoter A GCTI'GAGTATTCTITI'AGTGTG A G CTA A ATAGCTFG 6C GTAATC ATG GTC AT I

I

I

I

I

|

I

I

I

|

I

I

I

I

I

I

|

I

!

I

!

I

'~ Plac

I

lacZ Initiation I ¢odon I

FIG. 2. Schematic representation of the ORF vector plFF8. The sequence of the 5' part of the lacZ-c~ gene including the lacZ initiation codon, the ORF multiple cloning site, the two (GC)s boxes, the NotI site, and the SPG and T7 promoters are shown. Pt,c designates the lacZ promoter. The vector carries the /~-lactamase gene (bla), conferring resistance to ampicillin.

constructed that allow in-frame cloning of DNA fragments of defined length at one or two fusion points, respectively. Figure 2 shows a schematic representation of an ORF vector, termed pIFF8 (in-frame fusion) constructed by this principle. It is derived from a previously described vector, pIFF5, 4 and carries the inducible lacZ gene

[2]


15

promoter and the lacZ a fragment. Inserted near the 5' end of the lacZ ct fragment are two (GC) 5 BssHII recognition boxes that allow cleavage randomization at two cloning points. In the previous vector, plFF5, a 1.2kilobase (kb) fragment was inserted between the two (GC)5 boxes to avoid the possibility that close proximity of these boxes would prevent cleavage at some of the BssHII sites. In plFF8 this spacer fragment is replaced by a multiple cloning site that has two features: (1) it does not contain stop codons in any of the three reading frames; and (2) it restores the lacZ reading frame, giving the plFF8 vector a Lac ÷ phenotype. As discussed in Procedure 1.2 (below), these new features facilitate in-frame cloning by an indirect procedure. To allow verification of selected clones, the plFF8 vector further carries a unique NotI site located upstream of the 5'-most (GC)5 box (Section 4). Furthermore, the vector contains an SP6 and T7 promoter sequence that allows transcription through the multiple cloning site. Methods 1. Preparation of Vector for In-Frame Cloning The pIFF8 vector can be used to select open reading frames in DNA/ cDNA fragments carrying BssHII-compatible sticky ends (fragments generated by BssHII and/or MluI cleavage) or blunt ends. To prepare the vector for either type of cloning, it is first cleaved with BssHII to produce the nine possible cloning combinations. It is important that the vector sample is totally cleaved at this step because residual uncleaved pIFF8 will give rise to false positives in subsequent transformation/plating (both the desired recombinant pIFF8 vector as well as the pIFF8 vector itself have a Lac + phenotype). After cleavage with BssHII, the vector is treated with calf intestinal phosphatase (CIP) to remove the terminal 5'-phosphate groups. This treatment prevents the vector from recircularizing without insert and thus eliminates yet another source of false positives ( - 3 5 % of recircularized pIFF8 vectors will have a Lac + phenotype). If blunt-ended DNA fragments are to be cloned, the vector is further treated with Klenow polymerase in the presence of all four dNTPs to fill in the BssHII sticky ends. Although very little vector is used in a cloning experiment, it is convenient to prepare an excess amount that can subsequently be stored as a "ready to use" vector. The following procedures will usually give a good result. Procedure 1.1: BssHII Cleavage. Mix 10 tzg of vector (purified by CsCI gradient centrifugation) and 50 U of BssHII enzyme in a 100-tzl reaction

16


12]

containing 25 mM NaCI, 6 mM Tris-HCl, pH 7.4, 6 mM MgCI2, and 5 mM dithiothreitol (DTT). Overlay the reaction with a drop of paraffin oil and incubate 3 hr at 50 °. Place the reaction on ice; remove a 3-/zl aliquot (-0.3 /zg of vector) and analyze the extent of cleavage by electrophoresis through a 1% TAE (tris-acetate-ethylenediaminetetraacetic acid) agarose gel using appropriate DNA size markers. If more than one vector band is observed, add more BssHII enzyme and continue the incubation. When the cleavage is complete, extract twice with phenol and chloroform and precipitate the DNA with 1/10 vol of 2.5 M sodium acetate, pH 5.2, and two vol of 96% ethanol for 30 min at - 2 0 °. Recover the DNA by centrifugation at 12,000 g for 30 min at 4 ° and redissolve in 20 ~1 of TE [I0 mM Tris CI, pH 8.0 and I mM ethylenediaminetetraacetic acid (EDTA)]. Procedure 1.2: Phosphatase Treatment. Mix the BssHII-cleaved vector and 3 U of CIP enzyme in a 50-/xl reaction containing 50 mM Tris-HCl, pH 9.0, 1 mM MgCI 2, 1 mM ZnC12, and 1 mM spermidine. Incubate at 37 ° for 30 min, add an additional 2 U of CIP enzyme, and continue the incubation for another 30 min. Add 5 tzl of STE buffer (100 mM Tris C1, pH 8.0, 1 M NaCI, and I0 mM EDTA), 5/zl of 10% (w/v) sodium dodecyl sulfate (SDS), and 40 ~1 of distilled water. Incubate 15 min at 70 °, extract with phenol and chloroform, and precipitate the DNA as above. Redissolve the vector in TE buffer to a final concentration of 50 ng//zl (usually between 150 and 200/~1). Store the vector at - 2 0 ° to prevent evaporation. Note: It is advisable to test the efficiency of the dephosphorylation step by trying to recircularize the vector in the absence of added insert. To do this, set up a "vector alone" standard ligation (Section 2, procedure 2.1 without target DNA) and transform and plate competent E. coli cells as described in Section 3, procedure 3.1. Optimally, there should be no colonies on the plate. Usually, however, even properly dephosphorylated vector preparations give rise to several colonies. If there are many colonies on the plates and these are predominantly blue (Lac+), the problem relates to incomplete cleavage with the BssHII enzyme (uncleaved plFF8 vector is Lac÷). In contrast, if the main part of the colonies are white (Lac-), the problem relates to the dephosphorylation step (about 65% recircularized vectors are Lac-). Procedure 1.3: Filling-In Reaction. Mix I0/zg of BssHII-cleaved/dephosphorylated vector and 5 U of Klenow polymerase in a 100-/zl reaction containing 50 mM Tris-HC1, pH 8.0, 10 mM MgCI 2 , 100 mM NaCI, and 0.5 mM dATP, dCTP, dTTP, and dGTP. Incubate at 23-25 ° for 30 min, heat to 70 ° for 10 min, extract with phenol and chloroform, and precipitate the vector as above. Dry and redissolve the vector in TE buffer to a

[2]


17

final concentration of 100 ng//zl (-75-100/xl). Store at - 2 0 ° to prevent evaporation.

2. Preparation and Cloning of DNA Fragments Any of several reliable methods can be used to prepare DNA/cDNA for cloning in pIFFS. For direct in-frame cloning in pIFF8 (prepared as above) the foreign DNA fragment must carry either BssHII-compatible ends or blunt ends. There are presently only two enzymes (BssHII and MluI) that will provide BssHII-compatible sticky ends and the recognition sequence for the BssHII enzyme appears to be rare in DNA. Consequently, it may not be possible to locate the gene of interest to a BssHII and/or MluI-generated DNA fragment of a size suitable for cloning. In contrast, there is a whole range of enzymes that will generate blunt ends and as such it will usually be possible to locate the gene of interest in a properly sized blunt-ended fragment. Alternatively, the DNA fragment of interest can be cloned in frame by a simple, indirect procedure. First, the DNA fragment is cloned into one of the several unique restriction sites in the ORF multiple cloning site of pIFFS. This cloning destroys the lacZ reading frame, allowing the desired recombinant to be selected by its L a c - phenotype. Second, purified vector from the selected L a c - clone is cleaved with BssHII, extracted with phenol and chloroform, precipitated with ethanol, and religated using T4 DNA ligase (Section 2, procedure 2.3). This ligation shuffles the BssHIIexcised insert/vector fragments, with the result that a subset of inserts are brought in frame with the lacZ gene. Clones containing these vectors can then be selected by their Lac + phenotype. When using the indirect inframe cloning procedure as outlined above, self-circularization of vectors during the shuffling step will produce a background of false positives, that is, Lac + vectors without insert. As described in the following section, these vectors can often be distinguished from the desired recombinants by the intensity of the blue color of the resulting colonies. Alternatively, the BssHII-excised insert can be isolated by agarose gel electrophoresis and cloned in a premade pIFF8 vector (Section l) to avoid the selfcircularized vector background. The optimal conditions for ligating vector/DNA fragments carrying blunt ends or sticky ends are somewhat different. We usually obtain a good result using the following conditions.

Direct In-Frame Cloning Procedure 2.1.: Ligation of Vector and DNA Fragments with Sticky Ends. Mix 100 ng of prepared vector (Section l) and target DNA in a molar

18


[2]

ratio of 1 : 3 with I U of T4 DNA ligase (1 U//A) in a 20-~1 reaction containing 50 mM Tris-HC1, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/.tg/ml of bovine serum albumin (BSA). Incubate for 4-16 hr at 16° and store at - 2 0 ° until use. Procedure 2.2: Ligation of Vector and DNA Fragments with Blunt Ends. Mix 200 ng of prepared vector (Section 1) and target DNA in a molar ratio of 1 : 3 with 12 U of T4 DNA ligase (8 U//A) (efficient blunt-end ligation requires a great deal ofT4 DNA ligase) in a 20-/xl reaction containing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI 2 , 1 mM ATP, 20 mM DTT, 5% (w/v) polyethylene glycol (PEG) 6000, and 50/xg/ml BSA. Incubate for 4-16 hr at 23-25 ° and store at - 2 0 ° until use.

Indirect In-Frame Cloning Procedure 2.3: Shuffling of Vector and Insert. Mix 100 ng of BssHIIcleaved vector obtained from a L a c - clone with 1 U of T4 DNA ligase (1 U//xl) in a 20-/zl reaction containing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/zg/ml of BSA. Incubate for 4-16 hr at 16° and store at - 2 0 ° until use. 3. Transformation and Selection of Recombinants The plFF8 vector uses lacZ a complementation to produce a Lac ÷ phenotype and therefore requires E. coli strains carrying the lacZ AM15 gene as host; that is, E. coli DH5a, XLl-blue, JM101-109, etc. To prepare the cells for transformation, we use the CaC1 method 5 or, where improved transformation efficiencies are required, the method of Hanahan. 6 Procedure 3.1: Transformation. Mix 100/xl of competent cells and 2/A of the ligation reaction in an Eppendorf tube and incubate on wet ice for 1 hr. Place the tube in a water bath at 42 ° for 45 sec and return the tube to the wet ice for 2 min. Add 900/~1 of LB medium [1% (w/v) Bactotryptone, 0.5% (w/v) Bacto-yeast extract (Difco, Detroit, MI) 1% (w/v) NaCI, pH 7.5] and incubate the tube at 37° for 1 hr in a shaking incubator. To facilitate subsequent isolation of individual clones, plate 20- and 200/A samples onto LB agar plates containing 0.5 mM isopropyl-~/-o-thiogalactopyranoside (IPTG), 40/zg/ml 5-bromo-4-chloro-3-indolyl-fl-D-galactopyranoside (X-Gal) and 50/zg/ml of ampicillin. Incubate the plates (head up) overnight at 37 °. Following transformation and plating, one should in principle obtain 5 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed., pp. 182-184. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. 6 D. Hanahan, in " D N A Cloning" (D. M. Glover, ed.), Vol. 1, p. 109. IRL Press, Washington, D.C., 1985.

[2]


19

(1) white colonies (Lac-) containing vectors with either a DNA fragment that is not an ORF or an ORF DNA fragment inserted out of frame with the lacZ gene and (2) blue colonies (Lac ÷) containing vectors with a correctly fused ORF DNA. Unfortunately, it is rarely as simple as that. Thus, blue colonies may also contain (1) a vector with a DNA fragment that is not in frame with the 5' end of the lacZ gene but contains a translation initiation site in frame with the 3' part of the lacZ ~ gene or (2) vectors without a DNA insert (caused by either insufficient BssHII cleavage or vector self-circularization). To show that an inserted DNA fragment contains an ORF, it must therefore subsequently be verified that Lac" vectors contain the DNA insert and that translation initiates at the lacZ translation start site. In selecting a number of candidate clones for these analyses the color of the colonies may be of some help. Thus, depending on how the insert DNA affects transcription and/or translation of the tribrid gene/mRNA, affects folding and stability of the tribrid protein, and so on, colonies containing the correct fusion will range in color from deep to light blue (for a detailed discussion of factors affecting clonal color development, see Ref. 3). Similarly, the blue color of colonies containing a vector where translation initiates within the insert will depend on several factors, including how efficiently translation initiates within the insert. In contrast, Lac ÷ colonies containing vectors without a DNA insert will always be deep blue. Thus, when colonies exhibit different shades of blue one usually selects a number of clones from each group for further verification, with preference for those that are light blue. 4. Verification of Selected Clones To verify that the inserted DNA contains an ORF, the first step is to prepare a vector minipreparation from each of the selected clones. For this we use the alkaline lysis method, which is both rapid and reliable. 7 Next, purified vectors are digested with restriction enzymes followed by electrophoresis in agarose or polyacrylamide gels to determine which of the vectors contain the correct insert. Digestion with BssHII excises the insert, thus allowing its size to be determined against coelectrophoresed DNA size markers. However, BssHII is an expensive enzyme and for this reason the use of alternative restriction enzymes should be considered. For instance, combined digestion with EcoRI and NotI also excises the insert. Alternatively, when the size of the insert is such that vector plus insert can be distinguished from vector alone, any restriction enzyme that cleaves only once in the vector can be used (in this case several fragments 7 H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979).

20


[2]

A Notl

P~.c ~

i:~c'::~c~] INSERT llacZ-a ~-RTG

I

(RTG)

'~................. ...................................

B

TRIBRID GENE

•

mRNA

~-Lac +

TRRNSLATI ON STARTS WITHIN INSERT

... Lac +

TRANSLATION STARTS RTlacZ 5" END

J DIGESTWITHNotiFILL IN TXE STICKY E N D S - RELIGATE.

Insertion 4bp.

of

Plac ~ C ~ c S ~ C C c S C . ~

INSERT

~" RTG

i lacZ

(ATG)

- ~

I

TRIBRIO GENE

i~

mRNA

i !

: .............

.... ~

-

~

"

"~

Lac'l"

Lac-

TRANSLATION STARTS WITHIN INSERT TRANSLATION STARTS ATIacZ 5" ENn

FI6.3. Schematic outline of the strategy to distinguish between translation initiation at the lacZ translation start site or from within the insert. (A) The recombinant vector isolated from a Lac + clone; translation initiation at the lacZ translation start site or from within the insert both confers a Lac + phenotype on the host. (B) Introduction of 4 bp between the lacZ translation initiation site and the 5' end of the insert disrupts the lacZ reading frame read from the lacZ translation initiation site, but does not affect the reading frame initiated from translation start sites within the insert. Thus the phenotype of vectors containing a correctly fused insert where translation initiates at the lacZ start site will change from Lac + to Lacwhereas incorrectly fused inserts will remain Lac +.

may result from the digestion depending on whether target sequences for the enzymes are present in the insert or not). Those vectors that contain the correct DNA insert are then analyzed to distinguish between the possibility that translation initiates at the lacZ translation start site or within the insert. The rationale behind this analysis is shown schematically in Fig. 3. First, the selected vectors are digested with NotI. Provided there are no NotI sites in the insert (NotI recognizes an 8-bp DNA sequence and its target sequence is thus rare in DNA), this digestion linearizes the vector between the lacZ translation start site and

[2]


21

the 5' end of the DNA insert. The NotI site is then filled in with Klenow polymerase in the presence of all four dNTPs (Section 1, procedure 1.3) and the vector is recircularized using T4 DNA ligase (the ligation reaction is similar to procedure 2.3 except that the reaction volume is increased to 100/xl to favor vector self-circularization). This treatment introduces 4 bp between the 5' end of the lacZ gene and the insert, thereby disrupting the lacZ reading frame read from the lacZ translation start site. In contrast, the lacZ reading frame read from any spurious translation start site within the insert is not affected. Thus, the phenotype of vectors containing the correctly fused insert will change from Lac + to Lac , whereas vectors that do not will remain Lac +. Examples

Selection of Open Reading Frames in DNA/cDNA The pIFF series of vectors, and in particular pIFF8, are recent vector constructions and examples on experimental applications are therefore limited at present. The pIFF5 vector has been used to select the ORF in a 1.6-kb cDNA fragment encoding an internal part of the enzyme phenylalanine ammonia-lyase from the basidiomycete yeast Rhodotorula glutinis.4 In a parallel experiment the corresponding genomic pal gene fragment did not contain an ORF, as evidenced by the lack of blue colonies, and this was later shown to be due to the presence of several small introns. 8 The major difference between pIFF8 and pIFF5 is in the spacing of the two (GC)5 boxes. In pIFF5, these boxes are separated by a 1.2-kb spacer fragment whereas in pIFF8 they are separated by a small ORF multiple cloning site. To determine whether the decrease in spacing between the two (GC)5 boxes in pIFF8 would affect the pattern of BssHII cleavage, pIFF8 was cleaved with BssHH and the small multiple cloning site fragment purified from a 2% (w/v) agarose gel. The purified fragment was then dephosphorylated with calf intestinal phosphatase, labeled with [7-32p]ATP and T4 DNA kinase, and digested with PstI, which cleaves the labeled fragment into two unequal halves. Finally, the labeled products were separated by electrophoresis in a polyacrylamide sequencing gel and autoradiographed. Two sets of bands corresponding to cleavage at all BssHII sites in the 3'-most (GC)5 box [31, 33, and 35 nucleotides (nt)] and 5'-most (GC)5 box (50, 52, and 54 nt) were detected on the film, showing that all BssHII sites in both (GC) 5 boxes were accessible to cleavage. Moreover, the bands corresponding to 33 and 52 nt were less intense than 8 j. G. Anson, H. J. Gilbert, J. O. Oram, and N. P. Minton, Gene 58, 189 (1987).

22


[2]

the bands corresponding to 31, 35, 50, and 54 nt, supporting the previous observation that the center BssHII site in a (GC)5 box is cleaved less frequently than the flanking BssHII sites. From this we conclude that the close proximity of the two (GC)~ boxes in plFF8 does not have any major distortive effect on BssHII cleavage characteristics compared to the characteristics of previously described plFF vectors. Discussion Applications and Limitations

This chapter has focused on the use of (GC)5 boxes in the construction of gene-fusion vectors. When applied to ORF vectors the system offers the major advantage that DNA fragments generated by restriction enzyme cleavage can be cloned in frame without the need for prior size randomization. In addition to simplifying the use of ORF vectors in general, this feature potentially expands their uses. For instance, information on possible introns and a rough map of protein-coding domains in a cloned gene can be rapidly provided by subcloning specific restriction fragments in plFF8 and such information may be useful in setting up a sequencing strategy. Likewise, provided a correctly fused ORF DNA insert is sufficiently large so that the ORF can be considered biologically significant, the reading frame can be established by sequencing through the vector/ insert junctions, and this knowledge is useful in subsequent interpretation of sequencing data. As with other ORF vectors, the proper function of plFF8 requires that the lacZ-encoded part of the fusion protein retain enzymatic activity. In plFF8, the foreign DNA is inserted into the small lacZ ~ gene, which must successfully complement the host encoded product of the lacZ AM 15 gene to produce the Lac ÷ phenotype. Thus, compared to other ORF vectors that usually carry the entire lacZ gene, it may be expected that insertion of foreign ORF DNA fragments in plFF8 has a more pronounced effect on the Lac ÷ phenotype. Consistent with this notion, insertion of a 1.6-kb pal cDNA fragment in plFF8 produced light blue colonies that, however, turned deep blue when the lacZ t~ gene was substituted by the entire lacZ gene. This suggests that the functional limits of plFF8 can be expanded by insertion of the entire lacZ gene. On the other hand, when using the indirect in-frame cloning procedure, the present construction is probably advantageous in that a clear effect of the DNA insertions on the Lac ÷ phenotype allows an easier distinction between the desired recombinants and the false positives (i.e., vectors without insert).

[3]

HETEROLOGOUS

PROTEIN PRODUCTION

BY

B. brevis

23

[3] H i g h - L e v e l S e c r e t i o n o f H e t e r o l o g o u s P r o t e i n s b y Bacillus brevis By SHIGEZO U D A K A a n d H I D E O YAMAGATA Introduction

Among various host-vector systems for the production of foreign proteins in microorganisms, the use of Bacillus breois as a host offers the advantage that proteins are secreted directly into the culture medium, where they are accumulated at high levels in a relatively pure state. The secreted proteins are usually correctly folded, soluble, and biologically active. Bacillus brevis is known to be a harmless inhabitant of soil, milk, and cheese. Many of these advantages are shared with another thoroughly studied Bacillus species, B. subtilis. The major advantage of B. brevis over B. subtilis, however, is a very low level of extracellular protease activity, so that secreted proteins are usually stable and not significantly degraded. 1 For example, human a-amylase was secreted in quantities of up to 60 mg/liter by B. brevis, 2 whereas none was produced by B. subtilis. 3 Bacillus brevis 47 was isolated from soil as a protein-hyperproducing bacterium and was found to show little extracellular protease activity. 1.4 The two main proteins secreted by B. brevis 47 were indistinguishable from the two major proteins found in the outer two protein layers of the cell wall. The major cell wall proteins (CWP) synthesized during the logarithmic phase of growth form hexagonal arrays on the cell surface. During the early stationary phase of growth, the protein layers begin shedding concomitantly with a prominent increase in protein secretion. 5 During the stationary growth phase, cells continue to synthesize and secrete the cell wall proteins. These proteins do not stay on the cell surface, but instead accumulate in the medium as extracellular proteins with concentrations up to 20 g/liter of culture. The amount of extracellular protein reaches more than twice that of intracellular proteins. The genes coding for the major cell wall proteins (an outer wall protein and a middle wall I H, Takagi, K. Kadowaki, and S. Udaka, Agric. Biol. Chem. 53, 691 (1989). 2 H. Konishi, T. Sato, H. Yamagata, and S. Udaka, Appl. Microbiol. Biotechnol. 34, 297 (1990). 3 T. Himeno, T. Imanaka, and S. Aiba, FEMS Microbiol. Lett. 35, 17 (1986). 4 S. Udaka, Agric. Biol. Chem. 40, 523 (1976). 5 H. Yamada, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 148, 322 (1981).



24


[3l

protein) were cloned, and an operon (cwp) for cell wall protein genes was f o u n d . 6,7

Taking advantage of these characteristics of B. brevis, we developed a host-vector system for efficient production of heterologous proteins. The 5' region of the cell wall protein gene containing the powerful promoter and the signal peptide-coding sequence is utilized to construct expression-secretion vectors that are introduced into the protein-hyperproducing B. brevis. Media and Reagents

T2U medium contains 10 g of polypeptone (Nihon Pharmaceutical, Tokyo, Japan; tryptone, Difco, Detroit, MI), 5 g of meat extract (Wako Pure Chemical Industries, Osaka, Japan), 2 g of yeast extract (Difco), 0.1 g of uracil, and 10 g of glucose per liter. PM medium contains 20 g of polypeptone, 10 g of meat extract, 4 g of yeast extract, 0.1 g of uracil, and 10 g of glucose per liter and 2 mM CaC12 (pH is adjusted to 7 with NaOH). Solid medium contains 15 g of agar per liter. Erythromycin (10/zg/ml) or neomycin (60/xg/ml) is added for the growth of plasmid-bearing bacteria. MTP is prepared as follows: 20 ml of 0.1 M sodium maleate (pH 6.5), 10 ml of phosphate buffer [7% (w/v) K2HPO4 and 2.5% (w/v) KH2PO4)], and 18 ml of H20 are mixed and sterilized by autoclaving; after cooling the mixture, 2 ml of 1 M MgCI2 and 50 ml of T2U medium are added. Polyethylene glycol (PEG) solution is prepared by dissolving 40 g of PEG 6000 (average M r 7500) in 20 ml of 0.1 M sodium maleate (pH 6.5) and adjusting the volume to 100 ml with H20. TE contains 10 mM Tris-HCl (pH 8) and 1 mM disodium salt of ethylenediaminetetraacetic acid (EDTA). Sterilization of all the solutions, except for antibiotics, is carried out by autoclaving at 120° for 15 min. Host Bacterium Bacillus brevis 47-5Q is derived from strain 47-5, which is a uracilrequiring mutant of the wild-type 47. 4 Strain 47-5Q generally shows one or two orders of magnitude higher transformability and certain plasmids are more stably maintained in this strain than in strain 47-5. Bacillus brevis 47-5Q shows little protease activity in its culture supernatant. This bacterium hardly sporulates when cultured in ordinary media. 6 H. Yamagata, T. Adachi, A. Tsuboi, M. Takao, T. Sasaki, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 169, 1239 (1987). 7 S. Tsuboi, R. Uchihi, T. Adachi, T. Sasaki, S. Hayakawa, H. Yamagata, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 170, 935 (1988).

[3]

HETEROLOGOUS PROTEIN PRODUCTION BY B. brevis

25

Preservation of Bacteria Bacillus brevis cells, including those having plasmids, can be preserved at or below - 80° in the presence of 20% (w/w) glycerol for several years. Routinely, they may be maintained at room temperature on plates (T2 agar is appropriate) by transferring every 2-3 weeks. The bacteria will die at 4°. It is advisable to keep cells harboring plasmids containing foreign genes at or below - 80°, becuase both plasmids and hosts tend to mutate so that they no longer produce the foreign proteins.

Plasmids pUB 1108 is a high-copy-number plasmid in B. brevis, useful for overproduction of polypeptides from cloned genes. The neomycin resistance gene on this plasmid can be used as a selective marker for transformation. However, B. breois 47 spontaneously gives rise to mutants resistant to this drug at a relatively high frequency, so that examination for the presence of the plasmid is necessary to distinguish transformants from the spontaneous mutants. pHWl 9 is a low-copy-nu.mber plasmid and is useful as a cloning vector, especially when products of the cloned gene are deleterious to the host cells. Therefore, pHW 1 was used for cloning the genes encoding the middle wall protein (MWP) and the outer wall protein (OWP) ofB. brevis 47. The erythromycin resistance gene (Em0 on this plasmid, originally found in pE 194, is useful for selection of transformants because almost no spontaneous erythromycin-resistant mutants appear under the standard transformation conditions, pRU100 was constructed by inserting a multicloning site derived from M13mpl9 between the EcoRI and PvulI sites of pHWl. Another series of vectors was constructed from a low-copy-number cryptic plasmid, pWT481, found in B. brevis 481. l° pHY481 was constructed by inserting the erythromycin resistance gene into pWT481 and is stably maintained in B. brevis 47 even in the absence of the selective drug. H Although pHY481 and its derivatives have not been used extensively to date, results suggest that these plasmids are useful for efficient protein production. 6 8 T. McKenzie, T. Hoshino, T. Tanaka, and N. Sueoka, Plasmid 15, 93 (1986). 9 S. Horinouchi and B. Weisblum, J. Bacteriol. 150, 804 (1982). 10 H. Yamagata, W. Takahashi, K. Yamaguchi, N. Tsukagoshi, and S. Udaka, Agric. Biol. Chem. 48, 1069 (1984). fl H. Yamagata, K. Nakagawa, N. Tsukagoshi, and S. Udaka, Appl. Environ. Microbiol. 49, 1076 (1985).


26

[3]

60

Mfl I

ATCAGATCCGCTATCCTOTCTTACAACTTOOCTOTTOTAAACTTTOAAAATOCATTAOOA 120

AATTAACCTAATTCAAGCAAGATTATOAO(]TTTT(]AACCAAATTGGAAAAAGOTTCAGTC

l~ 18o 0TGACAGGCCGCCATATOI'CCCCTATAATACGGATTOTGGCOGATGTCACTTCOTACATA 240 ATGGACAGOTGAATAACGAACCACGAAAAAAACTTTAAATTTTTTTCGAAGGGGCCGCAA

Z~ 300 CTTTTOATTCGCTCAGGCOTTTAATAGGATOTGACACGAAAAACOGGOAAT~rOTOTAAAA EcoRI SpeI 3~ 360 AAOATTCACGAATTCTAGCAC, TTGTGTTACACTAGTGATTGTTGCATTTTACACAATACT

41 5~ SDI 4zo GAATATACTAOAGATTTTTAACACAAAAAGCGAGGCTTTCCTGCGAAAGGAGGTGACACG 480 COCTTGCAGGATTCGGGCTTTAAAAAGAAAGATAGATTAACAACAAATATTCCCCAAGAA fHetGlnAspSerGlyPhebysLysLysAspArgLeuThrThrAsnlleProGlnGlu S D 2 Hpal 540 CAATTTGTTTATACTAGAGGAGGAGAACACAAGGTTATGAAAAAGGTCGTTAACAGTGTA GlnPheValTyrThrArgG-G-f~yGi'uIllsgysVa i Me t bys Lys ValValAsnSer Val

ApaLI Ncol PstI B a m H I Sall TTGOCTAOTOCACTCGCACTTACTGTTOGTCCCATOUGTTTCOCTGCAGGATCGOTCGAC beuA l a S e r A l a b e u A l m b e u T h r V a l A l a P r o M e t A l a P h e A l a

,l.XcTb:IGA~PTA~CABG~ITICITCXTIC°~Gg: i~'~77~CIT~

"

EcoRI,,

/

/
o L )

u~ e

g2~ ~

m

0

--

~ ~.~ [.. ~

.g
P

l~^V/l~m S -iHtUg 8 I ~qx

;>

1 lSd

t~ r~ c~

148


[10]

2/.d linearized plasmid DNA (1 /zg//zl) in water or in Tris-ethylenediaminetetraacetic acid (EDTA) buffer RNasin [final concentration = 1 unit (U)/tzl] T7 RNA polymerase (10 U) Bring the volume up to 50/xl with diethyl pyrocarbonate (DEPC)-treated water. Each of the components should be added in the order shown and the mixture should be kept at room temperature during the addition of each successive component, because DNA can precipitate in the presence of spermidine if kept at 4 °. Nucleotide stock solutions should be neutralized to pH 7. 2. Incubate at 37 ° for 60 min. 3. Add RNase-free DNase to a concentration of ! U//zg DNA. 4. Incubate for 15 min at 37°. 5. Extract with an equal volume of phenol-chloroform. 6. Add 0.5 vol 7.5 M ammonium acetate and 2.5 vol ethanol to precipitate the RNA. 7. Spin, wash the pellet with 70% (v/v) ethanol, and dry the pellet. 8. Resuspend the RNA in 20/.d DEPC-treated water. Transcripts may be analyzed by electrophoresis on an RNase-free agarose gel) 2 Cell-Free Translation of in Vitro-Synthesized RNA Cell-free translations of in vitro synthesized RNA using rabbit reticulocyte lysates are carried out in the presence of [35S]methionine according to the protocol described by Promega Biotec. Translation Protocol 1. Combine the following: 35/xl nuclease-treated reticulocyte lysate (slowly thawed in ice-water) 6 ~l DEPC-treated water 1/A RNasin (40 U//zl) 1/xl 1 mM amino acid mixture (minus methionine) 2/xl RNA transcript (I-2/xg) 15a 5/xl [35S]methionine (1150 Ci/mmol) at 9.2 mCi/ml 2. Incubate at 30° for 60 min. 15a Optimal concentrations for RNA transcripts are determined by translating different amounts of the RNA transcript with the same amount of assay mixture. Also, denaturing RNA transcripts by keeping them at 65° for 5 min prior to translation removes secondary structure and may improve translational efficiency.

[10]

INSECT VIRUS TRANSLATIONAL INITIATION SIGNAL

C

1

149

2

P1 3CD 3D

VP1

3C i

i i

F1G. 3. SDS-PAGE analysis of cell-free protein synthesis from plasmids pC1BI and pC 11B9. Plasmid DNAs were transcribed in vitroand the products were translated in reticulocyte lysates as described in Materials and Methods. Lanes 1 and 2 represent translation mixtures programmed with RNA molecules derived from plasmids pCI1B9 and pC1BI, respectively. Lane C contains 35S-labeled proteins produced in the CVB3-infected HeLa cells.

Analysis o f Coxsackievirus 3C Protease Expression Sodium dodecyl sulfate-polyacrylamide gel electrophoresis ( S D S P A G E ) 16 is used to analyze the CV3C protease expression in reticulocyte lysates. A 2-/A aliquot of [35S]methionine-labeled cell-free translation products is diluted with sample buffer [0.0625 M Tris-HC1, p H 6.8, 2% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, 10% (v/v) glycerol, and 0.001% (v/v) b r o m p h e n o l blue] and heated at 90 ° for 5 rain before loading onto an S D S - p o l y a c r y l a m i d e gel as described in Fig. 3. After electrophoresis the 16U. K. Laemmli, Nature (London) 227, 680 (1970).

150


[10]

gel is soaked in 40% (v/v) methanol containing 10% (v/v) acetic acid, dried under vacuum, and exposed to Kodak (Rochester, NY) XAR-5 film. Results The cell-free expression plasmid, pBD7, contains the 5' UTR and initiator ATG of BBV RNA 1 downstream of the promoter for T7 RNA polymerase (see Fig. 2). Therefore, RNA transcripts made from pBD7 derivatives by the bacteriophage RNA polymerase have the BBV translational initiation signal at their 5' termini. The expression plasmid pC1B I contains the coxsackievirus coding sequence fused in frame to the BBV initiator ATG. The chimeric RNA transcribed from the AvaI-linearized pC 1B 1 encodes a protein with a molecular weight of 72,000 that derives the initiator methionine and the second amino acid, threonine, from the vector sequence and the rest from CV polyprotein (Fig. 2). In coxsackievirus-infected cells a single large viral polyprotein (250K) is produced that, in its nascent form, is proteolytically processed by two viral proteases, 2A and 3C, into several mature viral proteins. 17.18The 72K CV protein encoded in the pC 1B 1 transcript contains 26 amino acids from the carboxyl end of 2C, all of 3A, 3B, the protease 3C, and the aminoterminal 288 amino acids of the polymerase 3D. 14The 3C protease autocatalytically cleaves itself out of the viral precursor polyprotcin between glutamine and glycine pairs present 183 amino acids apart, thus creating its own amino and carboxy termini. 17The RNA transcript produced from the plasmid pC 11B9 contains an in-frame insertion of four amino acids (P, D, P, D) within the 3C protease sequence of the same 72K protein encoded by the pC1B1 transcript. The mutant 3C protease encoded by the pC1 IB9 transcript is defective in its autocatalytic activity. 18aChimeric RNAs were translated in rabbit reticulocyte lysates, and synthesis of CV-specific proteins with the BBV translational initiation signal was analyzed by SDS-polyacrylamide gel electrophoresis. The results (Fig. 3) showed that a major protein, with an approximate molecular weight of 72K, was synthesized from pC 11B9 transcripts encoding the mutant 3C protease (Fig. 3, lane 1). As expected, the 72K protein was absent in the translation ofpC1Bl-transcripts (Fig. 3, lane 2). Instead, several other proteins ranging from 20K to 56K, presumably produced by the autocatalytic activity of the 3C protease, were seen (Fig. 3, lane 2). 17 H. G. Krausslich and E. Wimmer, A n n u . Rev. Biochem. 57, 701 (1988). 18 A. C. Palmenberg, in "Positive Strand RNA Viruses" (M. A. Brinton and R. R. Rueckert, eds.), p. 25. New York, 1987. taa B. Dasmahapatra, E. J. Rozhon, A. M. Hart, S. Cox, S. Tracy, and J. Schwartz, Virus Res. 20, 237 (1991).

[10]

INSECT VIRUS TRANSLATIONAL INITIATION SIGNAL

151

The 20K protein comigrates with the native 3C protease produced in CVB3-infected HeLa cells. This indicates that the 3C protease sequence contained in the 72K protein is autocatalytically active. The other prominent protein bands represent the products of the autocatalytic activity in the 72K protein. These results suggest that the BBV translational initiation signal is able to direct synthesis of CVB3-specific protein in vitro. Comments The BBV sequence contained in the plasmid pBD7 is sufficient to direct translational expression of the coxsackievirus coding sequence, which lacks its own signal for the initiation of translation. The expressed gene products are biologically active. The plasmid pBD7 has also been used for the cell-free expression of c-fos and Epstein-Barr virus Zta genes, in which the BBV sequence has been reported to yield at least 20-fold more Zta protein than the translational initiation signal provided by the Zta leader sequence. ~9 Untranslated leader sequences of eukaryotic mRNAs contain information that not only guides ribosomes to initiate protein synthesis correctly, but also regulates the efficiency of translation. Some of these parameters influencing the efficiency of translation of an mRNA are the cap structure at the 5' end of the mRNA, the sequences flanking the initiator ATG codon, the presence or absence of upstream ATG codons, and the secondary structure in the 5' U T R . 9'2°'21 The BBV sequence contained in the plasmid pBD7 is not predicted to form stable secondary structure. Moreover, it contains an adenosine residue at the - 3 position relative to the initiation codon. The chimeric RNAs produced from pBD7 derivatives are capped at their 5' termini. Native viral RNAs are translated efficiently.22'23 These may explain the relative efficiency of the BBV sequence in pBD7 in directing translation of heterologous coding sequences. Acknowledgments I wish to thank Dr. P. Kaesberg, University of Wisconsin (Madison), for permission to use the BBV sequence in this study. I also want to express my appreciation to A. Hart for technical assistance.

t9 y . N. Chang, D. L. Y. Dong, G. S. Hayward, and D. Hayward, J. Virol. 64, 3358 (1990). 2o A. J. Shatkin, Cell 9, 645 (1976). 2r M. Kozak, Nature (London) 3118, 241 (1984). z2 p. D. Friesen and R. R. Rueckert, J. Virol. 49, 116 (1984). 23 p. D. Friesen, P. Scotti, J. Longworth, and R. R. Rueckert, J. Virol. 35, 741 (1980).

152


[1 1l

[11] Cell-Free Expression of Large Collections of cDNA Clones Using Positive-Selection h Phage Vectors By

CHRISTOPHER COLECLOUGH

Cell-free transcription and translation is frequently used to gain information about the structure and activity of proteins encoded by cDNA clones. Hitherto it has generally been applied to specific, individual clones, identified and isolated by some other means. The analogous procedure of microinjection of translationally competent RNA transcribed from collections of recombinants has, however, been used successfully in isolating clones encoding proteins with known biological activities (see Ref. 1 for an example). Here I describe vectors and technology appropriate to the analysis of large groups of clones as well as individual clones, in terms of their protein-coding capacity. This methodology can be used not only in searches for clones encoding specific proteins, but also in the analysis of complex mRNA populations. This chapter is concerned chiefly with technical details, but some applications of the methodology will be discussed. Vector Design A general problem in cDNA cloning is the dilution of true recombinants in libraries by nonrecombinant genome types, lacking cDNA sequences. At present, most libraries are made with a view to recovering one or a few particular clones for which specific probes--nucleic acid or antibody--are available. As the plaque-screening methods used can usually be applied to very large numbers of plaques, a high frequency of nonrecombinants is therefore most often accommodated by simply making larger libraries. A low incidence of true recombinants, however, becomes a severe problem if more complicated screening schemes are envisaged. The frequency of nonrecombinant types can be greatly reduced if true recombinants develop a selectable phenotypic trait not possessed by the parental vector. ~gtl0 is the most commonly used vector that allows such selection. 2 It is a temperate phage, which forms turbid plaques on its usual host Escherichia coli strain, due to partial repression. On hfl (highi y . Noma, P. Sideras, T. Naito, S. Bergstedt-Lundquist, C. Azuma, E. Severinson, T. Tanabe, T. Kinashi, F. Matsuda, Y. Yaoita, and T. Honjo, Nature (London) 324, 70 (1986). 2 T. V. Huynh, R. A. Young, and R. W. Davis, in "DNA Cloning: A Practical Approach" (D. M. Glover, ed.), Vol. I, p. 49. IRL Press, Oxford, England, 1985.


Copyright© 1993by AcademicPress, Inc. All rights-ofreproductionin any formreserved.

[11]

h PHAGEVECTORS

153

frequency lysogeny) varients ofE. coli, however, repression is so efficient that plaque formation by parental hgtl0 is entirely suppressed, cDNA insertion into the hgtl0 genome is directed to the cI gene (which encodes the phage repressor) and when this gene is thus disrupted, the inability of recombinants to elaborate active repressor leads to clear plaque formation, even on hfl strains. Although this device is quite effective, it places an absolute restriction on the context into which cDNA can be inserted. It therefore precludes, for example, juxtaposition of cDNA with a promoter for T7 or SP6 RNA polymerase, desirable if in vitro expression is planned. (Modified versions of hgtl0 that include these promoters do exist, but they have lost the capacity for genetic selection.) I have constructed a family of vectors that allows a strong genetic selection for true recombinants, yet is much more flexible with regard to the context into which cDNA can be inserted. This is because the phenotypic difference between parental and recombinant types results in part from the acquisition of a cDNA-linked marker, rather than from the disruption of a vector function. This marker is the chi recombination target, which being only 8 nucleotides long can easily be incorporated into the oligo(dT)-containing primer used in cDNA synthesis. Two vectors, hjac and hecc, are illustrated in Fig. 1; they are based on hgtWES.hB 3 and inherit its general structure and amber mutations, differing from it around the site of cDNA insertion. These vectors are r e d - but contain functional gam genes, so are spi ÷ (sensitive to P2 interference) and do not form plaques on E. coli lysogenic for phage P2. Preparation of hjac and hecc to receive cDNA inserts deletes the g a m gene; r e d - gam - h phage are s p i and will form plaques on P2 lysogens, but grow exceedingly poorly (when host recombination systems are active) unless they contain chi sites, which hjac and hecc lack. The necessary chi sites are provided in the primer-restriction end adapter (PRE adapter) used to initiate cDNA synthesis. (See Stahi 4 for a review of spi and chi.)

Primer-Restriction End Adapters Several years ago, to reduce the number of steps in cDNA cloning schemes, we introduced the use of bifunctional PRE adapters that serve both as primers for reverse transcription and as restriction ends for ligation to vectors. 5'6 The PRE adapters used to insert cDNA into hjac and hecc 3 p. 4 F. C. 6 C.

Leder, D. Tiemeier, and L. Enquist, Science 196, 175 (1977). W. Stahl, Sci. Am. 2S6, 53 (1987). Coleclough and F. Erlitz, Gene 34, 305 (1985). Coleclough, this series, Vol. 154, p. 64.

154

[11]


cosL]

nin5 Wam

Eam

~gtWES.,

35

36

PL

;P6

Xjac XZ ,ST SZ

SZ NZ~ t

I

i

TSP6~PT7 PL

. . _ T T 7 PSP6~ (zm

t

~,

PL

i~

,1.ecc NZ s'r

SZ

SZ XI"

FIG. 1. Structure of hjac and hecc. hjac and hecc are based on hgtWES.hB, the structure of which is illustrated, highlighting the areas altered in the new vectors. Numbers 32-36 indicate the sequence coordinates on the conventional h map, not the physical distance from the left-hand end. PL, h phage PL promoter; PSP6, promoter for SP6 RNA polymerase; TSP6, terminator for SP6 RNA polymerase; PT7, promoter for T7 RNA polymerase; TT7, terminator for T7 RNA polymerase. Restriction enzyme cleavage sites: ERI, EcoRI; NI, NotI; SI, Sail; XI, Xhol.

are shown in Fig. 2. The adapters are used in two ways: (1) to convert a staggered restriction end into a 3' homopolymer tail, and (2) to provide cDNA molecules both with a chi site and with a staggered restriction end suitable for ligating to vector molecules. Each function requires a pair of partially complementary partner oligonucleotides. PRE adapters can be designed for sequence-specific or, as here, general cDNA synthesis (see Ref. 6) and for ligation to any staggered restriction end. Oligo(dC) tailing of ~,jac requires a pair of PRE adapters, (iii) and (iv) in Fig. 2, suitable for ligation to XhoI ends, while a pair compatible with NotI ends, (v) and (vi) in Fig. 2, is used for hecc. Pair (i) and (ii) in Fig. 2, used for cDNA synthesis and ligation to a SalI end, can be used with either vector. Following standard solid-phase synthesis, elution, and deprotection of the oligonucleotides, purify them by polyacrylamide gel electrophoresis (PAGE), DEAE-cellulose chromatography, and filtration on Sephadex G-50 superfine. Adapters (i), (iii), and (v) should be fully 5' phosphorylated before use. Incubate them at 1-5/zM with 50-100 units of T4 polynucleotide kinase in l mM ATP, 50 mM Tris-HC1 (pH 7.6), 10 mM MgCI2, 5 mM dithiothreitol (DTT), 1 mM spermidine, 1 mM ethylenediaminetetraacetic

[1 II

h PHAGE VECTORS

155

(i) (ii)

ch£ 5' TCGAC~CCACCAGCTCTTTTTTTTTTTTTTTT 3' GTtGGTGGTC~AGAAAAA 5'

(iii) (iv)

5' TCGAGTCTAGACGCGTTCCCCCCCCCC 3' CAGATCTGCGC 5'

(v) (vi)

5' GGCCGCTCTAGATCTCTTCCCCCCCCCC 3' CGAGATCTAGAG 5'

3'

3'

3'

FIG. 2. PRE adapters for use with kjac and hecc. Set (i) and (ii) provides a primer for reverse transcription, a SalI end, and contain a chi site. Set (iii) and (iv) converts a Xhol end into an oligo(dC) tail and is used for tailing hjac. Set (v) and (vi) converts an Nod end into an oligo(dC) tail and is used with hecc.

acid (EDTA), for 3 hr at 37 °. R e c o v e r the oligonucleotide by filtration through G-50 superfine. T o check that phosphorylation is efficient, set up a parallel reaction with a small quantity of the starting oligonucleotide and a known molar excess of ATP to which is added some fresh [y-32p]ATP: the incorporation of radiolabel should approximate the molar ratio. Store the oligonucleotides in 1 m M E D T A at - 2 0 °.

Vector Preparation Preparation of hjac or hecc D N A to receive e D N A inserts consists of four steps, illustrated in Fig. 3, which for simplicity shows only the preparation of hjac; the preparation of hecc is similar, but uses different restriction e n z y m e s and adapters, as will be described. The steps are the following: (I) restriction e n z y m e digestion, (2) ligation to PRE adapters, (3) digestion with a second restriction enzyme, and (4) removal of small fragments. 1. Digest kjac D N A with X h o I , hecc D N A with N o t I , to completion; r e c o v e r D N A by p h e n o l - C H C l , extraction, and ethanol precipitation. 2. For e v e r y 100/xg of digested, redissolved vector DNA: add 3/xg of adapter (iii) or (v) and 1.3/xg of adapter (iv) or (vi)--using (iii) and (iv) for hjac; (v) and (vi) for h e c c w r o u g h l y a 40-fold molar excess of PRE adapters over vector ends. Treat with T4 D N A ligase at 150 Weiss units/ml in 50 m M Tris-HCl (pH 7.8), 10 m M MgCI:, 10 m M DTT, 1 m M ATP, 100/xg/ ml bovine serum albumin (BSA) for 16 hr at 16° in a final volume of I00 /xl. Precipitate vector DNA, now ligated at cos ends and with two oligo(dC)

156

[11]


~.jac: digest with XhoZ anneal and Ilgate to (il) and (iv) 11am

1

cos

cccccl.II II

mRNA: reverse transcribe using (i) as primer. Tail with TdTase

ccccc

and d GTP

SalZ

1

digest with SalZ, remove small fragments

3" GGGG~%,.-~J-~TTT I~JAGC~ 5"

!

TCGA

-C06 ~--

fractlonate, if desired CCCCC

J anneal with (ll) Ilgate and gap-fill

1

COS

TCGA" - ~

CCCCC

AA~

TCGA~

COS

CCCCC

package in vitro

1 plate on I:>2lysogen FIG. 3. Flow chart for inserting cDNA into hjac.

tails, by addition of NaCI to 0.5 M and polyethylene glycol (PEG) 6000 to 8%, 7 3. Digest DNA with SalI to completion. 4. Separate the finished vector (39 kb) from the smaller digestion products [0.7, 0.5 kilobases (kb)], by centrifugation through a 10-40% sucrose gradient. 8 mRNA Isolation A library intended for cell-flee expression should ideally be constructed from a pure mRNA preparation. In practice, it is impossible to state with confidence that any RNA preparation contains only mRNA, that is, only those molecules actually translatable into complete polypeptides. A rigorous mRNA preparation protocol would include careful purification of polysomes free from other ribonucleoprotein (RNP) particles, specific release and purification of mRNP from the polysomes, and purifi7 j. Lis, this series, Vol. 65, p. 347. 8 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.

[11]

h PHAGEVECTORS

157

cation of mRNA from mRNP, avoiding throughout any nucleolytic cleavage. In contrast, it has become standard practice to recover " m R N A " from guanidinium lysates of cells, neglecting any subcellular fractionation. The following is a compromise that removes much, but not all, unwanted RNA of nuclear origin and is appropriate for all but the most nucleaseridden sources. Cells are lysed with nonionic detergent, in the presence of vandium-ribonucleoside complexes to inhibit RNase, 9 and nuclei are pelleted before extracting RNA from the supernatant. Artifactual degradation can be further avoided by keeping samples cold and working quickly. Use of a microfuge greatly speeds up the process so that the initial steps take only 2-3 min, and should be used for l0 s cells or less; if the microfuge is at room temperature, remove and prechill the rotor head. Vanadylribonucleoside complex (VRC) should be prepared, not purchased, carefully following published protocols for avoiding oxidation, J0 and stored in aliquots under liquid N 2 . Wash cells in 0.9% (w/v) NaC1. Using about 1 ml/10 s cells, resuspend cells in ice-cold 10 mM Tris-HCl (pH 8.6), 12 mM MgCI 2, 10 mM VRC. Add 20-50/~l/ml cold 10% (v/v) Triton X-100 and vortex 5 sec, or homogenize using a Dounce homogenizer for 6 strokes. Spin at 10,000 g for 5 rain in a preparative centrifuge, or 15 sec in a microfuge. Transfer supernatant and add, for each milliliter, 30/zl of 5 M NaC1, 50/zl of 0.5 M EDTA, 50 kd of 20% technical grade sodium dodecyl sulfate (SDS) and 0.6 ml of phenol/CHCl3/8-hydroxyquinoline (50 : 50 : 0.2), saturated with 0.1 M NaC1, 10 mM sodium acetate, pH 6.0, 1 mM EDTA.~I Mix vigorously for 5 sec and spin at room temperature to separate phases. Reextract the upper, aqueous phase after addition of 20/.d/ml 20% SDS by shaking 2 min with an equal volume of phenol/CHC13 . Repeat the extraction, with 3 min of shaking, and precipitate RNA by addition of 2 vol of ethanol and storage at - 2 0 °. This lysis buffer itself will throw a bulky ethanol precipitate, probably a mixture of sulfates. This does not interfere with oligo(dT)-cellulose chromatography; however, if it is desired to avoid the chromatography step, it may be necessary to purify the RNA further, or to omit VRC from the lysis buffer. Purify poly(A)-containing RNA by passage over oligo(dT)-cellulose. It is important to find a grade of highcapacity oligo(dT)-cellulose that will efficiently retain mRNA in 0.15 M NaC1, or less. Use a small column: a 0.5-ml bed should be sufficient to recover mRNA from up to 20 mg of cytoplasmic RNA. After two cycles 9 S. L, Berger and C. S. Birkenmeier, Biochemistry 18, 5134 (1979). ~0G. E. Lienhard, I. I. Secemski, K. A. Koehler, and R. N. Lindquist, Cold Spring Harbor Symp. Quant. Biol. 36, 45 (1971). fl R. P, Perry, J. La Torre, D. E. Kelley, and J. R. Greenberg, Biochim. Biophys. Acta 262, 220 (1972).

158


[1 II

of binding and elution, separated by a heat treatment of 2 min at 65 °, remove SDS and any fines by adding potassium acetate to 0.2 M and shaking with phenol/CHCl3 ; precipitate RNA by adding 2 vol of ethanol. Store purified mRNA at 1 mg/ml in diethyl pyrocarbonate-treated water, in aliquots at - 7 0 °. cDNA Preparation More details of this reaction can be found in the article in this series by Coleclough. 6 The quality of the reverse transcriptase is the principal determinant of the quality of a cDNA library. Use XL grade AMV reverse transcriptase from Life Sciences (St. Petersburg, FL). It is convenient to dispense the enzyme into 5-/zl aliquots of 65 unitsmsufficient enzyme to copy 5 /zg of mRNA--diluting the reverse transcriptase with RNasin (Promega, Madison, WI), if necessary; store them at - 7 0 °. Prepare 10 × RT buffer by combining 0.7 M KCI, 0.5 M Tris-HCl, pH 8.78 at 25 °, and 0.1 M MgC1z ; store at - 20° in aliquots. To 5/zl of 1 mg/ml mRNA, add 5/zl of freshly diluted 20 mM methylmercuric hydroxide (Alfa, Ward Hill, MA). After 2 min at room temperature, transfer the reaction tube to an ice bath and add, in this order: 10/xl of a 20-/xg/ml solution of PRE adapter (i); 5/~1 of a solution of dATP, dCTP, dGTP, and dTTP (20 mM each); 1/~1 of fresh [a-3ep]dCTP (I0 mCi/ml); 1 /zl of water; 5 /xl of 10 × RT buffer; 6 ~1 of freshly diluted 300 mM 2-mercaptoethanol; 2.5 /zl of actinomycin D (1 mg/ml); 0.5 ~1 of polynucleotide kinase (10,000 units/ml); 4 tzl of RNasin (I0,000 units/ml); and 5/~1 of reverse transcriptase, aliquoted as above. Incubate 2 min at 16°, 20 min at 43 °, and 5 min at 48 °. Add 2/zl of 0.5 M EDTA, 3 tzl of 20% (w/v) SDS, 1 tzl of proteinase K (10 mg/ml), and incubate 20 min at 48 °. Add 1/xl 100 mM phenylmethylsulfonyl fluoride (PMSF) in dimethyl sulfoxide (DMSO), chill, extract with phenol/CHCl3, and ethanol precipitate. Dissolve the pellet in 20/xl of 0.2 M NaOH and 1 mM EDTA, and incubate at 60° for 20 min. Cool and dilute the sample with water to 50/xl, then load onto a calibrated column of Sephacryl S-500 HR (Pharmacia, Piscataway, NJ), previously washed in 10 mM NaOH. Collect and pool cDNA longer than 300 nucleotides. Neutralize and concentrate the solution to 50 txl by extraction with 2-butanol, then recover cDNA by ethanol precipitation. The object of the gel-filtration step is to eliminate PRE adapter molecules not incorporated into cDNA. S-500 columns formed in siliconized Pasteur pipettes can resolve single-stranded DNA chains a few hundred nucleotides long well enough to achieve this and, with appropriate care, are sufficiently reproducible that calibration of one of a batch of columns

[11]

X PHAGEVECTORS

159

with marker DNA fragments should allow removal of low molecular weight species, without the need for analysis of all fractions. The yield of cDNA can be calculated from the molar incorporation of dCTP and should be 2-3 tzg. For reactions of this size, it is worth checking the yield spectrophotometrically, as the incorporation of nucleotide may be misleadingly low. The recipe given above generates cDNA with a specific activity of (very roughly) 30,000 Cerenkov counts per minute (cpm)//xg. cDNA is elongated with a 3'-oligo(dG) tail by treatment with terminal transferase: adjust volumes so that the final cDNA concentration is 60 tzg/ ml (or less) in 50 # M dGTP, 600 units/ml terminal transferase, and 100 mM potassium cacodylate; 25 mM Tris base; 1 mM CoC1 z; 0.2 mM DTT, pH about 6.9 (see Ref. 12); incubate exactly 3 min at 16°, then add EDTA to 10 mM, SDS to 1% (w/v), extract with phenol/CHC13 and ethanol precipitate; redissolve the cDNA in 10 mM NaOH and I mM EDTA, filter it through Sephacryl S-500 HR in 10 mM NaOH, neutralize, concentrate, and ethanol precipitate it, all as above. Single-stranded DNA at low concentration tends to stick to surfaces and interfaces, so whenever possible these manipulations should be performed on cDNA in quantities of 1 /zg or more; parceling out a cDNA preparation into samples of about 100 ng, with a view to avoid wasting it, is more likely to result in the loss of the entire sample. cDNA Fractionation by Subtractive Hybridization Insertion of cDNA into hjac or hecc is performed in approximate molar equivalence of cDNA and vector. As this requires about a 70-fold mass excess of vector DNA, use of much more than 100 ng of cDNA becomes prohibitively expensive. Therefore, as more cDNA will probably be made than can be used, unless the application demands construction of a representative library, it is worthwhile considering ffactionating the cDNA, by size or by molecular hybridization, before cloning. We have found hybridization with biotinylated mRNA, followed by liganding with streptavidin and phenol/chloroform removal of complexes, ~3 to be a simple, efficient, and high-yield tactic for enrichment of differentially expressed sequences prior to cloning. mRNA is biotinylated by treatment with a photoactivatable biotin derivative, as described by Forster e t al. 14 RNA at l mg/ml in water is ~2R. Roychudhury and R. Wu, this series, Vol. 65, p. 43. 13H. L. Sive and T. StJohn, Nucleic Acids Res. 16, 10937(1988). 14A. C. Forster, J. L. Mclnnes, D. C. Skingle, and R. H. Symons, Nucleic Acids 745 (1985).

Res.

13,

160


[11]

mixed under subdued light with an equal volume of photobiotin (Calbiochem, La Jolla, CA) dissolved at 1.5 mg/ml in water; the mixture is sealed in a siliconized glass capillary and exposed to light from a 275-W sunlamp bulb (available from Bethesda Research Laboratories, Gaithersburg, MD) 10 cm away for 20 min. The solution is kept cold by immersion in a shallow ice/water bath. Biotinylated RNA is recovered by flushing out the contents of the capillary with 100/zl of 0.1 M Tris-HCl, pH 9.0, twice extracting with n- or 2-butanol, and precipitation with 2 vol of ethanol after addition of NaCI to 0.2 M. Hybridization reactions contain biotinylated mRNA at 0.5-2.0 mg/ml, 250/xg/ml oligo(C), 2 mg/ml poly(A), 0.6 M NaCI, 50 mM piperazineN,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.8), 5 mM EDTA, and 0.5% (w/v) SDS and are held at 65° typically for 5-15 hr. Optimally, such reactions are constantly agitated, for example, by rotating the mixture sealed in a capillary tube with a few glass beads, but they can be performed in tightly capped microcentrifuge tubes with some loss of efficiency. The efficiency of RNA-driven hybridization of DNA and the effects of salt concentration and other parameters on the hybridization rate are fully discussed by Van Ness and Hahn. ~5 Oligo(C) is prepared by limited hydrolysis ofpoly(C)~6:4 mg ofpoly(C) in 10 mM Tris-HC1, pH 7.5, is mixed with 0.5 ml of 0.4 M NH4HCO3/ NH4OH, pH I0.0, and the mixture sealed in a glass ampoule and placed in a boiling water bath for 1 hr. At the completion of the hybridization reaction, the mixture is diluted 30-fold with water, BSA is added to 300/zg/ml, and streptavidin to 30 /zg/ml. The mixture is then vortexed with an equal volume of phenol/ chloroform and spun in a microcentrifuge for ! min. After reextraction with 1 vol of phenol/chloroform, nucleic acids are precipitated from the aqueous phase with 2.5 vol of ethanol. We have usually used two rounds of subtractive hybridization before cloning. Finally, cDNA is freed of RNA by alkaline hydrolysis and separation on Sephacryl S-500 HR, as above. Insertion of cDNA into Vector Molecules cDNA insertion is a one-tube, two-stage reaction (see Fig. 3). In the first stage, the 5' end ofcDNA is rendered partially duplex by hybridization of the PRE adapter (i) sequence, which forms the cDNA 5' terminus, with 15 j. Van Ness and W. E. Hahn, Nucleic Acids Res. 10, 8061 (1982). 16j. M, Coffin, J. T. Parsons, L. Ryrno, R. K. Haroz, and C. Weissman, J. Mol. Biol. 86, 373 (1974).

[11]

,k PHAGE VECTORS

161

the partner adapter (ii), then covalently attached to the SalI end of the vector. At the same time, the 3' oligo(dG) tail of the cDNA hybridizes to the other, oligo(dC) vector terminus, cDNA, thus forming a singlestranded bridge linking left-hand and right-hand X arms. In the second stage, cDNA is at last rendered double stranded in a gap-filling reaction of DNA polymerase, and remaining nicks are sealed. Figure 4 illustrates the structure of a typical hjac recombinant, which was recovered from a small library of about 5000 clones made from 2 ng of cDNA. This clone encodes the T cell receptor/3 chain expressed by the AKR mouse thymorea line BW5147, frequently used as a T cell hybridoma parent. A representative reaction was performed as follows: 60 ng of tailed cDNA and 4.5/xg of appropriately prepared hecc DNA were combined in 20 txl together with 5 ng of adapter (ii) and 2.5/xl of 1 M Tris-HCl, pH 7.8, and 100 mM MgC12. This mix was annealed by placing the reaction tube in a beaker of water, initially at 60°, which was allowed to cool to 20° over the course of about 1 hr. The reaction volume was then increased to 25 ~zl with the addition of BSA to 50/xg/ml, DTT to 10 raM, ATP to 300/xM, and 3 Weiss units of T4 DNA ligase, and incubated at 16°C for 16 hr. The second stage of the reaction was performed in conditions of molecular crowding by polyethylene glycol (PEG)iV: to the 25-/xl first-stage reaction was added 15/xl of 50% PEG 6000 and 5/zl of 10 x stage 2 buffer (see below), and the volume was brought to 50 ~!, adding dATP, dCTP, dGTP, and dTTP (each to 500 ~M), 3 units each ofE. coli DNA polymerase I and T4 DNA polymerase, and 0.2/xg of E. coli DNA ligase. To prepare 10 x stage 2 buffer, combine 1 M NaCI, 0.02 M (NH4)2SO4, 0.1 M Tris-HCl (pH 7.5), 60 mM MgC12,50 mM DTT, 10 mM spermidine, and 3 mM NAD. The reaction was allowed to stand for 3 hr at room temperature, then DNA was pelleted by spinning in a microfuge for 2 rain and resuspended in 4 /xl of water. Ligated DNA can now be packaged into infectious )t particles using a commercial packaging kit. Unfortunately, the in vitro packaging reaction, treated here as a black box, is the most sensitive step in the whole process: when cloning attempts yield greatly fewer plaques than expected, this is most likely due to inhibition of the packaging reaction. DNA purified from agarose gels can carry contaminants--probably charged polysaccharides--which do not affect any of the enzymes used, but profoundly inhibit packaging. Also, carryover of PEG into the packaging reaction must be minimized: at low concentrations PEG is noninhibitory, but slight increases can precipitate components of the packaging mix with disastrous results. The cDNA-vector i7 S. B. Zimmerman and B. Harrison, Proc. Natl. Acad, Sci. U.S.A. 84, 1871 (1987).

162


zl

CO

~

o

0 0 0

0 0

,-.= "-~

,]i °

°° Ig

oo G.~

X

0 0 < Z

£ 0

~._o

[ l 1]

[11]

h PHAGEVECTORS

163

ligation reactions should therefore be performed in microfuge tubes that resist wetting, allowing complete removal of the supernatant after pelleting the ligated DNA. Forming a Sectored Library The selective host for spi- recombinants of hjac and hecc is LE392/ P2, a P2 lysogenic derivative of the supE supF E. coli strain LE392. Grow these bacteria in L broth [1% (w/v) tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCI] containing 0.4% (w/v) maltose and 10 mM MgSO4 to stationary phase at room temperature, shaking vigorously, then pellet them at 2000 g for 10 min and resuspend them in a two-thirds volume of 10 mM MgSO4. Dilute packaged, recombinant phage to 0.5 ml with phage buffer and plate no more than 20 ~1 of this suspension on one 100-mm petri dish, using 0.2 ml of LE392/P2 and 2.5 ml of 0.6% (w/v) top agar. Mix the phage and bacteria and incubate for 20 min at 37°, then add the agar (cooled to 43 °) and plate. Phage buffer contains 0.1 M NaCI, 25 mM Tris-HCl (pH 7.5), 10 mM MgSO4, 0.02% (w/v) gelatin. Bottom agar for plates is 1.2% (w/v) agar in L broth containing 10 mM MgSO4 and 0.1% (w/v) maltose; top agar contains 0.6 or 0.3% (w/v) agar, as indicated, in the same medium. The quality of the packaging mix is the primary determinant of the efficiency of clone formation; about 2000 clones/ng of cDNA is routine. A sectored library is desirable for many applications using these vectors. Division of the library into sectors is preferably performed on the primary plates. Sectors can be of any complexity; 500-1000 clones per sector is probably the most generally useful size for nonenriched libraries. Decide the number of pie-type sectors into which each plate should be divided, draw a template on the lid of a petri dish, and use this as a guide for each plate. Using a straight-edged nickel spatula, scrape the top agar from each sector into a 15-ml polypropylene tube, taking care not to touch other sectors. Between each sector, wash the spatula in 80% ethanol, flame it, and rinse it in 10 mM MgSO4. To the collected agar in each tube add 1 ml of phage buffer containing 20% (v/v) glycerol and 1 ml of CHCI 3 ; cap and shake it for 20 rain. Spin the tubes at 2000 g for 10 rain, transfer the clear supernatant to vials, and store them at - 70°. This is the primary sectored library. Expanding Sectors and Clones Single clones, sets of clones, and library sectors are all expanded in the same fashion to produce a standard, high-titer stock that can be used

164


[11]

to seed cultures for DNA preparation. To 150/~1 of a suspension of LE392/ P2, prepared as above, add the equivalent of one plaque of phage and after absorption plate with 3 ml of 0.3% (w/v) top agar. Use a fairly fresh plate. A bacterial lawn should be visible after 4 hr, and confluent lysis evident after about 7 hr. Scrape the sloppy top agar into a 15-ml polypropylene tube, add 1 ml of phage buffer containing 50% (v/v) glycerol and 2-3 ml of CHC13, and shake and spin as above. This generates a phage stock of about 101~plaque-forming units (pfu)/ml, stable at - 70 °; expanded primary library sectors are termed secondary sectors. Preparing DNA for Cell-Free Expression Use LE392/P2 for all growth of spi- recombinants on plates, and LE392 for growth in suspension culture. Reportedly spi-h grows better on recD E. coli, so substitution of LE392 by the supE supF recD strain TAP90 ~s might well increase the phage yield from these cultures; I have not compared the two strains. Prepare LE392 for infection as above. Allow 1 /~1 of high-titer phage stock to absorb to 250/xl of bacteria in a 50-ml polypropylene tube. Add 20 ml of L broth containing 10 mM MgSO 4 and 0.01% (w/v) maltose and shake the tube vigorously in a horizontal position at 37°. Lysis should be evident after 5 hr. Add a drop of CHCI 3, spin out debris (there may be very little), and precipitate phage by addition of 1.2 g of NaC1 and 2 g of PEG 6000. Hold at least 1 hr on ice. Pellet phage at 3000 g, for 10 rain at 4°, and resuspend in 800/zl of 10 mM Tris-HCl, pH 7.5 and 10 mM MgCI2 containing 10/.tg/ml each of DNase I and RNase A. Shake at 37° for 10 min. Add 0.5 ml of CHCI3, mix well (do not vortex), spin briefly, and transfer the supernatant to a microfuge tube. Add 25/zl of 0.5 M EDTA, 50/xl of 20% (w/v) SDS, and 12/zl of proteinase K (10 mg/ml), and incubate 45 min at 37°. Add I0 gl of I00 mM PMSF in DMSO, hold 5 min, then add 50 /zl of 4 M KC1, extract with phenol/CHCl3, shaking by hand, and precipitate DNA with 0.6 ml of 2-propanol. The routine yield is 7-10/zg of DNA, which is fine for restriction enzyme analysis and, often, for transcription too; the degree of contamination with degraded bacterial nucleic acid, however, may be sufficient strong to inhibit RNA polymerase. It would probably be worthwhile investigating other, more selective agents for precipitating large DNA, such as PEG 7 or spermine, 19 with a view to eliminating this contamination, but gel filtration on Sephacryl S-1000, which is effective if somewhat tedious, has been routinely in~s T. A. Patterson and M. Dean, Nucleic Acids Res. 15, 6298 (1987). 19 B. C. Hoopes and W. R. McClure, Nucleic Acids Res. 9, 5493 (1981).

[11]

X PHAGEVECTORS

165

cluded, k DNA reproducibly begins to elute after 0.9 ml of washing of a Pasteur pipette S-I000 column, while small nucleic acid fragments appear after passage of 1.5 ml. This fraction can be collected from many columns run simultaneously in 30 mM potassium acetate, 5 mM Tris-HC1, pH 7.5, and 0.5 mM EDTA, and concentrated about fivefold by 2-butanol extraction; then the DNA may be recovered by ethanol precipitation and dissolved at about 100/xg/ml in 10 mM Tris-HC1, pH 7.5, 1 mM EDTA.

Transcription Sense-strand, translatable transcripts of recombinants of hjac or hecc are referred to as "ersatz m R N A " to emphasize that they can substitute for genuine, natural mRNA for most purposes. Ersatz mRNA is generated from hjac recombinants with SP6 RNA polymerase, and from hecc recombinants with T7 R N A polymerase. Both vectors have fairly effective terminators immediately distal to the site of cDNA insertion, so it is not necessary to digest DNA with restriction enzymes to produce discrete transcripts. A standard transcription reaction is 30/xl, which includes 6/zl of DNA, prepared as above, 500/xM ATP, CTP and UTP, 150/xM GTP, and 500/xM m7GpppG. It is convenient to add about 1/zCi of [a-3Zp]GTP to each reaction to help trace the RNA product. Final reaction conditions for SP6 RNA polymerase are as follows: 40 mMTris-HCl (pH 7.9); 6 mM MgCI2, 10 mM DTT, 100/xg/ml BSA, 500 units/ml RNasin. Conditions for T7 RNA polymerase are similar, except that the MgCI2 concentration is 10 raM. Use 1/zl of either polymerase, as obtained commercially, for each reaction; this usually contains about 5 units of the SP6 enzyme, but much more T7 polymerase. The T7 enzyme is produced commercially from synthetic constructs in E. coli, and at the moment is routinely supplied at much higher activity than the SP6 enzyme. Reactions are incubated at 37° for 90 rain. Ersatz mRNA is most simply purified by binding to a tiny oligo(dT)-ceUulose column: to the 30/zl transcription reaction, add 1/xl of 0.5 M EDTA, 2/xl of 20% (w/v) SDS, 5/.tl of 5 M NaCI, and 12 of/xl water, and extract with 50/xl of phenol/CHCl s. Apply the extract directly to a small (about 20 p.l) column of oligo(dT)-cellulose, formed in a plugged 1-ml micropipette tip. Wash the column with 200/zl of 0.5 M NaCI, 10 mM TrisHCI (pH 8.0), 1 mM EDTA, 0.2% (w/v) SDS, and elute with applications of 15, 15, and 70/xl of 5 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, 0.1% (w/v) SDS, using the first two batches to rinse the sides of the column and pooling the eluates. Add I/xg of calf liver tRNA (Boehringer Mannheim, Indianapolis, IN) and 5/xl of 5 M potassium acetate to the eluted RNA, extract with 100/xl of phenol/CHC13 and precipitate with 2 vol of ethanol.

166

VECTORS F O R E X P R E S S I N G C L O N E D G E N E S

[11]

Typical yields are 0.5-1.0/.,g of ersatz mRNA when SP6 polymerase is used, and 2-3/zg with the higher-activity T7 enzyme. The cap dinucleotide can be omitted for RNA to be used for some other purpose than translation. Even though all transcripts from a ~,ecc, or from a hjac, library share a common 5' terminal sequence--contributed by the vector and by the PRE adapter used for tailing the vectormdifferent clones vary greatly in their dependence on a 5' cap for translation. Some are unaffected by the lack of a cap, while the translation of others is entirely cap dependent; therefore, unless the object is to assay a species known to be cap independent, all ersatz mRNA for translation should be transcribed in the presence of m7GpppG. Translation For routine analytical purposes, rabbit reticulocyte, nuclease-treated lysate #N90 from Amersham (Arlington Heights, IL) is used to translate ersatz and genuine mRNA, using [35S]methionine as label. A typical reaction will include all of the product of a standard SP6 transcription reaction, or one-third of a T7 transcription, in a final volume of 20 ~1, of which 16 /zl is reticulocyte lysate. Incubate for 90 min at 30°, then add 1 /.d of RNase A (2 mg/ml; to degrade aminoacyl-tRNA), and incubate for 10 min. Polypeptide products can now be displayed on polyacrylamide gels; it must be borne in mind that the hemoglobin concentration in the translation reaction is about 60 mg/ml, limiting the fraction of the reaction that can be applied to a typical gel lane. The routine here is to dilute 4/zl with 25 /zl of 3% (w/v) SDS loading buffer for application to a 4 × 0.75 mm well. The reticulocyte lysate will generate a labeled protein complex endogenously, which usually has an apparent molecular weight of about 45K on SDS-PAGE, when methionine is used as label. [35S]Cysteine does not label this complex. Two-dimensional (2D) gel patterns of in vitro translation products of the same mRNA preparation labeled alternatively in methionine or in cysteine are surprisingly different, those labeled with [35S]cysteine usually showing the greater number of spots; this suggests that methionine and cysteine should both be labeled when complete representation of the complexity of an mRNA sample is desired. Discussion Ersatz mRNA, transcribed from cDNA clones, can substitute genuine mRNA in any application; thus it can be translated, hybridized, reverse transcribed, and microinjected. A vast array of experimental possibilities is therefore available for the exploitation of libraries in hjac or hecc;

[11]

x PHAGEVECTORS

167

here examples are shown only of the use of gel electrophoresis to probe relatively complex collections of clones. The analysis of proteins, translated in vitro from natural or ersatz mRNA, can be viewed in two ways: (1) in the absence of a high-resolution separation method for large R N A molecules, complex collections of mRNA molecules are best analyzed by translation into proteins for which high-resolution analytical methods do exist, and (2) in vitro translation products may resemble naturally biosynthesized proteins sufficiently closely as to allow the identification of cDNA clones that encode proteins of interest through the physical or biological properties of the cell-free translation products of ersatz mRNA. The first of these statements, which does not presuppose any identifiable relationship between in vivo and in vitro translation products of the same mRNA species, is certainly true. The second, and more exciting, is true in some but not all cases. As yet we do not know to what fraction of cases it applies, although we know it is a sizable fraction. It may well turn out to be possible, with adequate attention, to relate the great majority of proteins physically detectable in cell extracts directly to cognate cDNA clones, which can be retrieved without the need for sequence information or sequence-specific probes. 2°'2~

Two-Dimensional Gel Analysis of Translation Products Running many 2D gels with high and reproducible resolution demands considerable expertise. The examples shown here were run in the laboratory of Dr. I. Lefkovits, of the Basel Institute for Immunology. Technical details for 2D gel electrophoresis or computer-assisted image analysis have not been included in this chapter; both of these aspects have generated a considerable technical literature, which should be consulted by potential users. However, occasional 2D gel electrophoresis should be within the compass of most laboratories; it is most easily accomplished in commercially available equipment following the recommendations of the supplier, and it is extremely valuable for the analysis of hecc or Xjac libraries, even if the quality of the gels is less than pristine. This is particularly so in evaluating "difference" libraries, formed from cDNA that has been enriched for species of interest by subtractive hybridization. The construction of difference libraries, enriched for some cDNA species of interest, has become a popular tactic, especially since its successful 20 C. Coleclough, L. Kuhn, and I. Lefkovits, Proc. Natl. Acad. Sci. U.S.A. 87, 1753 (1990). 21 I. Lefkovits, J. Kettrnan, and C. Coleclough, lmmunol. Today 11, 157 (1990).

168


[11]

use in the cloning of T cell antigen receptor genes. 22 However, so far it has failed to achieve the status of an analytical tool: it has not been possible, by simple inspection of a difference library, to determine by how many species two mRNA populations differ. Use of hjac or hecc as vectors for difference library construction, together with 2D gels for their analysis, may redress this deficiency, as indicated in Fig. 5. Here, we were interested in mRNA species induced by lectin treatment of a T cell hybridoma. Comparison of 2D gels of the cell-free translation products of mRNA from treated and untreated cells did not reveal any obvious differences, so we could not use the direct, sib-selection approach previously successful in retrieving clones of interest. 2° Instead we constructed a difference library, enriching for induced cDNA species by subtractive hybridization with mRNA from untreated cells, as described above, prior to insertion into hecc. Figure 5B shows the translational readout of that difference library, while Fig. 5A shows the translation product of natural mRNA from untreated ceils. There are no spots that clearly occur on both gels: evidently subtractive hybridization efficiently removed most common species, allowing induced mRNAs, too sparse for their translation product to be detected after the translation of total mRNA, to dominate the difference library. This situation can be contrasted with the gels shown in Fig. 5C and D. These two gels show proteins expressed from two random sectors, both containing about 1000 clones, from an unenriched library of the mRNAs expressed in BW5147. In collaboration with Dr. I. Lefkovits we are currently attempting to catalog all of the genes detectably expressed in this cell line, by computer-assisted comparison of a large number of sectors like those shown in Fig. 5C and D. 21 mRNA species abundant in the cell will be represented in many of these sectors--as each random sector contains about 1000 clones, any mRNA species that makes up more than 0,1% of the total mRNA complement will have a good chance of being represented in any sector. Therefore, unlike the evaluation of the difference library in Fig. 5A and B, in this case one expects to see species common to both gels. Indeed, many such species can be discerned; 12 are indicated. NOTE ADDED IN PROOF. Since preparing this manuscript further observations, and a number of technical modifications that increase efficiency, have been made. They are listed here:

22 S. M. Hedrick, E. A. Nielsen, J. Kavaler, D. I. Cohen, and M. Davis, Nature (London) 308, 153 (1984).

IX 1] A

h PHAGE VECTORS

169

B

FIG. 5. Two-dimensional gels of cell-free translation products. (A) Polypeptides translated from mRNA of untreated BW5147 cells, using a nuclease-treated reticulocyte lysate, labeling with [35S]methionine. (B) Cell-free expression product of a hecc difference library, formed from concanavalin A-treated BW5147 cDNA, subtractively hybridized with mRNA from untreated cells. (C and D) Cell-free expression products of random sectors, each containing about 1000 clones, from a representative hecc library of BW5147 cDNA.

1. Strain TAP90, mentioned briefly above, is now used to grow recombinant phage in liquid culture for DNA preparation. DNA yields are severalfold increased over growth in LE392. However, it must be appreciated that there is no genetic selection for recombinants in this strain and therefore it should be used only for recombinants that have been through at least two rounds of selection in the P2 lysogen derivative of LE392. TAP90 can be obtained from the American Type Culture Collection (ATCC; Rockville, MD).

170


[11]

2. Polyethylene glycol precipitates of phage from lysed liquid cultures are considerably cleaner if DNase and RNase are added immediately after lysis, before removal of bacterial debris. Add both enzymes to 1-2 tzg/ml of culture and shake at 37° for 10 min before addition of NaC1 to 1 M and centrifugation as described above. The precipitates formed by the addition to the supernatant of PEG to 10% can now, after pelleting, be dissolved directly in 10 mM EDTA, 25 mM Tris-HC1 (pH 8.6), 1% (w/v) SDS, containing 100/zg/ml proteinase K, then processed as described above. 3. Conditions now used are modified from those recommended by Gurevitch et al. 23for transcription of phage DNA. Twenty-microliter reactions contain 80 mM H E P E S / K O H , (pH 7.5), 10 mM DTT, 2 mM spermidine, 3 mM each of ATP, UTP, CTP and mVGpppG, 1 mM GTP, 0.5-1.0 /xg of phage DNA, 30 units T7 RNA polymerase, and 80 units RNase inhibitor. Incubation is at 38° for 3 hr. 4. Recent batches of Amersham reticulocyte lysate N90 have, alarmingly, proved almost entirely incapable of translating capped, ersatz mRNA generated by in vitro transcription of hecc recombinants, although these lysates were highly active on genuine mRNA. Fortunately the nuclease-treated reticulocyte lysate retailed by Ambion (Austin, TX) was capable of translating the same ersatz mRNA preparations, and the translation products yielded appeared normal on gel electrophoresis. The biochemical basis of this disturbing problem has not been determined; it is obviously imperative for users of the technology described here to screen several sources of lysate for activity on their in vitro transcripts, and to consider buying or making sufficient amounts of active lysate before embarking on any sizable series of experiments. Acknowledgments I thank I. Lefkovits and L. Kuhn for performing 2D gel analyses. St. Jude Children's Research Hospital is supported by Grant CA 21765 from the National Cancer Institute and by the American Lebanese Syrian Association (ALSAC).

23 V. V, Gurevich, I, D, Pokrovskaya, T. A. Obukhova, and S. A. Zozulya, Anal. Biochem. 195, 207 (1991).

[12]

EFFICIENT MUTAGENESIS IN PLASMIDS

173

[12] Site-Specific M u t a g e n e s i s in Plasmids: A G a p p e d Circle M e t h o d

By

B E R N D H O F E R a n d BIRGIT K ~ H L E I N

Site-specific mutagenesis is one of the key techniques in molecular genetics and protein engineering. The DNA segments to be mutagenized are usually contained in plasmids. The possibility of carrying out sitespecific mutagenesis with these plasmids directly, that is, without any subcloning steps, represents a substantial simplification and acceleration of this technique. A number of such procedures have in fact been described. However, the earlier methods either gave low yields of the desired mutation 1-7 or were not generally applicable as they needed a unique restriction site close to the target region of mutagenesis. 8-t° More recently, other laboratories devised techniques that circumvent these problems.l~-~4 Procedures using the polymerase chain reaction have also been developed tS-~s that are fast

R. B. Wallace, P. F. Johnson, S. Tanaka, M. Sch61d, K. Itakura, and J. Abelson, Science 209, 1396 (1980). 2 G. Dalbadie-McFarland, L. W. Cohen, A. D. Riggs, C. Morin, K. Itakura, and J. H. Richards, Proc. Natl. Acad. Sci. U.S.A. 79, 6409 (1982). 3 E. D. Lewis, S. Chen, A. Kumar, G. Blanck, R. E. Pollack, and J. L. Manley, Proc. Natl. Acad. Sci. U.S.A. 80, 7065 (1983). 4 B. A. Oostra, R. Harvey, B. K. Ely, A. F. Markham, and A. E. Smith, Nature (London) 304, 456 (1983). 5 S. M. Hollenberg, J. S. Lai, J. L. Weickmann, and T. Date, Anal. Biochem. 143, 341 (1984). 6 y. Morinaga, T. Franceschini, S. Inouye, and M, Inouye, Bio/Technology 2, 636 (1984). 7 K. Foss and W. H. McClain, Gene 59, 285 (1987). s W. Mandecki, Proc. Natl. Acad. Sci. U.S.A. 83, 7177 (1986). 9 G.-J, J. Chang, B. J. B. Johnson, and D. W. Trent, DNA 7, 211 (1988). 10 A. V. Bellini, F. de Ferra, and G. Grandi, Gene 69, 325 (1988), H B. Hofer and B. Kiihlein, Gene 84, 153 (1989). 12 M. Sugimoto, N. Esaki, H. Tanaka, and K. Soda, Anal. Biochem. 179, 309 (1989). 13 S. N. Slilaty, M. Fung, S.-H. Shen, and S. Lebel, Anal. Biochem. 185, 194 (1990). 14 D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). J5 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res, 16, 7351 (1988). z6 R. M. Nelson and G. L. Long, Anal. Biochem. 180, 147 (1989). r7 A. Hemsley, N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas, Nucleic Acids Res. 17, 6545 (1989). t8 M. Tomic, I. Sunjevaric, E. S. Savtchenko, and M. Blumenberg, Nucleic Acids Res. 18, 1656 (1990).


Copyright © 1993by AcademicPress, Inc. All rightsof reproductionin any form reserved.

174

MUTAGENESIS AND GENE DISRUPTION

[12]

but require an additional cloning step. This chapter details a method that yields average frequencies of mutants of around 60%. Principle of Method The fundamental prerequisite for site-specific mutagenesis is the presence of the DNA target region in single-stranded form to allow annealing of the mutagenic oligonucleotide. One way to achieve this (which has a number of advantages; see below) is the combination of two plasmid single strands of different origin to form a gapped plasmid. 4 This is shown in Fig. l, steps 2-4. An aliquot of the plasmid is cleaved with one or two restriction enzymes in such a way that the target segment for mutagenesis is cut out, and the nontarget segment is isolated. A second aliquot of the plasmid is linearized to allow physical separation of the two DNA strands in the following step. The respective cut must lie outside the target region to regenerate circular molecules in the subsequent reaction. Both double-stranded DNA (dsDNA) species are then mixed, "melted," and reannealed. As shown in Fig. l, this strategy in fact yields two complementary gapped circular molecules in equal amounts. As the mutagenic oligonucleotide will anneal to only one of them, the other will lead to wild-type progeny. To eliminate this "undesired" gapped circle, it is linearized and separated. Linearization is achieved by restriction endonuclease cleavage after selective annealing of an appropriate "restriction oligonucleotide" to its single-stranded region (Fig. 1, steps 5a and b). Subsequently, the remaining circular molecule can easily be separated from the linear species (which would be partially converted into circular molecules during the following elongation/ligation reaction) by agarose gel electrophoresis (AGE). To suppress the progeny from the wild-type strand of the heteroduplex, different mechanisms of biological selection have been exploited. 19-24The only one of these that is independent from any plasmid-based feature has been described by Kunkel et al. 21 for M13 vectors. The strand to be selected against is isolated from a d u t - u n g - host and consequently contains some dU residues. Such a DNA strand is preferentially degraded 19 S. Hirose, T. Kazuyuki, H. Hori, T. Hirose, S. Inayama, and Y. Suzuki, Proc. Natl. Acad. Sci. U.S.A. 81, 1394 (1984). 20 W. Kramer and H.-J. Fritz, this series, Vol. 154, p. 350. 21 T, A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. 22 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 23 M. A. Vandeyar, M. P. Weiner, C. J. Hutton, and C. A. Batt, Gene 65, 129 (1988), 24 j. Messing, this series, Vol. 101, p. 20.

[121 STEP 1

3/2


175

AQBtransform > reisolate A ~ B dut-g..ng-strain piasmid >

C cleave at A, f3 [ isolate non~ target fragment

C

|

I cleave at C A

4

5a

5b

6

denature and reanneal

B

J

anneal restriction a igonuc eotide D

l cleave at D

isolate gapped circ e

FIG. 1. Scheme illustrating the preparation of the plasmid substrate for mutagenesis. Normal and dU-containing DNA strands are distinguished by thick and thin lines, respectively. A, B, C, and D are restriction sites. The target segment for mutagenesis is indicated by zigzag lines. The linear products formed during reannealing are omitted for clarity. [Reprinted from B. Hofer and B. Kiahlein, Gene 84, 153 (1989) with permission.]

176


[12]

in strains that are wild type in this trait. The strategy (annealing of strands of different origin) used to form the gapped circle easily allows the combination of a dU-containing template strand with a normal complementary one (Fig. 1, steps 1-4). In addition, the use of a gapped circle, as compared to a completely single-stranded circle, has a number of advantages for mutagenesis. First, in vitro DNA synthesis is facilitated. Second, the major part of the DNA molecule is protected against unintentional annealing of the mutagenic oligonucleotide, which may lead to unwanted mutations (see Unintentional Mutations in General, below). Third, the probability of masking the target region by formation of stable intramolecular secondary structures is considerably reduced. This suggests, therefore, that the smaller one makes the gap, the better. One extreme is that the whole gap can be filled by the oligonucleotide. In this case unintentional annealing virtually cannot occur, and moreover the DNA polymerase reaction (which presumably reduces the mutant yield) is no longer necessary. However, if mutations are to be introduced into the same DNA segment at different sites, it is economical to choose a gap size that allows the same gapped circle to be used as a substrate for all mutagenesis experiments. Once the gapped circle has been isolated, the actual mutageneses are carried out in a conventional way. The phosphorylated oligonucleotide is annealed to the gapped circle, the gap is filled by a DNA polymerase, the remaining nicks are closed by a DNA ligase, and the resulting heteroduplex molecule is introduced into a bacterial cell.

Materials and Reagents

Strains CJ23625 [dutl ungl thil relA1/pCJl05 (Cmr)] BMH71-18mutS 26 [A(lac-proAB) thi supE mutS215::Tn10/F' l a d q ZAM15 proA +B +] DH127 [endA1 hsdRl7 (rk-, mk ÷) supE44 thil recA1 gyrA96 relA1] Media LB (per liter): 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCI, pH adjusted to 7.5 with NaOH. For plates, 15 g Bacto-agar is added ,.5 j. Geisselsoder, F. Witney, and P. Yuckenberg, BioTechniques 5, 786 (1987). :6 B. Kramer, W. Kramer, and H.-J. Fritz, Cell 38, 879 (1984). 27 D. Hanahan, J. Mol. Biol. 166, 557 (1983).

[12]

E F F I C I E N T M U T A G E N E S I S IN P L A S M I D S

177

TB (per liter): Dissolve 12 g Bacto-tryptone and 24 g Bacto-yeast, extract in 900 ml water, add 4 ml glycerol, and autoclave. Dissolve 12.5 g K2HPO 4 and 2.31 g KH2PO 4 in 100 ml water and autoclave. Mix both solutions

Buffers and Solutions TE: 10 mM Tris-HC1 (pH 8.0), 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0) 8x HB (hybridization buffer): 1.5 M KC1, 0.1 M Tris-HCl (pH 7.5) 5 x KB (kinase buffer): 300 mM Tris-HCl (pH 8.0), 50 mM MgC12 , 0.5 mg/ml bovine serum albumin (BSA) 2 x MB (mutagenesis buffer): 23 mM Tris-HCl (pH 7.5), 9 mM MgC12, 4 mM dithiothreitol (DTT), 1.5 mM ATP, 0.8 mM each dNTP 5 x TMN: 200 mM Tris-HCl (pH 8.0), 50 mM MgCI2, 250 mM NaCI TENA: 40 mM Tris base, 1 mM EDTA, 20 mM sodium acetate, adjusted to pH 8.3 with acetic acid GMM (gel loading mix): 40% (v/v) glycerol, 50 mM EDTA (pH 8.0), 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanol Solution I (minipreparation): 50 mM glucose, 25 mM Tris-HC1 (pH 8.0), 10 mM EDTA (pH 8.0) Solution II (minipreparation): 0.2 N NaOH, 1% (w/v) sodium dodecyl sulfate (SDS) Phenol solution: 227 g phenol, 100 ml I M Tris-HCl (pH 8.0), 12.5 ml water, 12.5 ml m-cresol, 0.5 ml 2-mercaptoethanol, 0.25g 8-hydroxyquinoline PCI solution: Phenol solution chloroform/isoamyl alcohol (50/48/2, v/v/v) CI solution: Chloroform/isoamyl alcohol (2/1, v/v) tRNA solution: 1/xg//xl tRNA (Bethesda Research Laboratories, Gaithersburg, MD) in TE

Enzymes T4 and T7 DNA polymerases (Pharmacia, Uppsala, Sweden), T4 DNA ligase (Boehringer Mannheim, Mannheim, Germany), T4 polynucleotide kinase (New England BioLabs, Beverly, MA), and restriction enzymes (Pharmacia, New England BioLabs, Bethesda Research Laboratories, and Boehringer Mannheim) are commercial preparations

Oligonucleotides Oligonucleotides are synthesized from phosphoramidite monomers on a "Gene Assembler" (Pharmacia) according to the instructions of the manufacturer and are purified by polyacrylamide gel electrophoresis.

178


[12]

Other Materials "Qiagen" columns (Qiagen, Chatsworth, CA) Method

Preparation of Gapped Circle Preparation ofdU-Containing Linear Plasmid. The plasmid to be mutagenized is isolated from a dut- ung- strain such as CJ236. It is cleaved at a preferably unique restriction site located outside the target region for mutagenesis. The DNA is purified and taken up in a buffer of low ionic strength or in water. This is necessary for formation of the gapped circles. For the plasmid isolation we initially used a standard CsC1 gradient protocol (see, for example, Ref. 28). When we tried a small-scale procedure, we encountered problems in formation of the gapped circles. However, when the minipreparation procedure was combined with a purification step using a Qiagen column, these problems could be overcome. Procedure 1. Prepare competent cells of a dut- ung- strain (e.g., CJ236) and transform them with the plasmid. We use the Hanahan procedure z7 with some slight modifications29: RbCI, DTT, and dimethyl sulfoxide are replaced by KC1, 2-mercaptoethanol, and dimethylformamide, respectively. 2. Screen a few transformants for the presence of intact plasmid: Isolate the plasmids by a quick minipreparation procedure (see, for example, Ref. 30), cleave them with a frequently cutting restriction enzyme and with the enzymes to be used for the mutagenesis, and check by AGE if the fragment patterns are as expected. 3. For a medium-scale preparation grow the transformed cells in a rich medium (e.g., TB) containing uridine (0.25 /zg/ml) and the appropriate antibiotic. The plasmid may be isolated using a standard CsC1 gradient protocol (see, for example, Ref. 28) or a Qiagen column as described by the supplier. 4. Linearize about 10 pmol of plasmid with an appropriate restriction enzyme. 5. Add EDTA to complex all divalent cations and purify the DNA by repeated extraction with the PCI solution. Remove the organic phase from the bottom of the tube to minimize the loss of plasmid. 28 D. Ish-Horowicz and J. F. Burke, Nucleic Acids Res. 9, 2989 (1981). 29 B. Hofer, Eur. J. Biochem. 167, 307 (1987). 30 D. S. Holmes and M. Quigley, Anal. Biochem. 114, 193 (1981).

[12]


179

6. After the last removal transfer the remaining aqueous phase to a new tube. Ethanol precipitate the plasmid and resolve it in 0.1 x TE. Preparation of Unmodified Nontarget Segment. Unmodified plasmid is isolated from a normal (i.e., dut + ung +) strain. The target segment is cut out with appropriate restriction enzyme(s). The nontarget segment is isolated by AGE and taken up in a buffer of low ionic strength or in water. For the isolation we use low melting gels and a modified version of the protocol of Wieslander. 31

Procedure 1. Isolate the unmodified plasmid as described in Preparation of dUContaining Linear Plasmid (above). 2, Digest about 10 pmol of the plasmid with the restriction enzyme(s) appropriate to cut out the target segment. 3. Add EDTA to complex all divalent cations and extract once with PCI solution. 4. To the aqueous phase add 0.25 vol of GMM and load on about 150 mm 2 of an appropriate low-melting-agarose gel. We generally use a horizontal submarine 0.8% (w/v) gel [14 (length) x 11 x 0.4 cm] prepared with TENA buffer containing 0.5 t~g/ml ethidium bromide. Run the gel in the same buffer at 70-100 V. 5. Mark the position of the nontarget fragment during brief illumination at 360 nm and cut out the gel piece. 6. Melt the gel piece at 65 ° . 7. Add 1 vol of phenol solution prewarmed to 65 °, vortex for 45 sec, and spin in an Eppendorf centrifuge at full speed for 2 min. Remove the organic phase, briefly recentrifuge the aqueous phase, and transfer it to a new tube. 8. Extract twice with 1 vol of PCI solution. 9. Extract once with 1 vol of CI solution, 10. Concentrate approximately twofold by extraction with 2.5 vol of l-butanol: vortex and spin for 30 sec each. I 1. Add 0.1 vol of 3 M sodium acetate, pH 4.8 (with acetic acid) and precipitate with 3 vol of ethanol, wash with 70% (v/v) ethanol, dry, and dissolve in 0. ! x TE. Formation of Gapped Circles. The dU-containing linear plasmid and the unmodified nontarget segment of the plasmid, both in water or in buffer of low ionic strength, are mixed. The duplexes are converted into single strands by heat, and these are reannealed by increasing the ionic strength followed by cooling to room temperature. This yields two complementary 31 L. Wieslander, Anal. Biochem. 98, 305 (1979).

180


1

gc~ lin~ fr~

2

[12]

3

~OC

-,~l lin

FIG. 2. Verification of gapped circle formation by AGE. Lane 1, mixture of the linearized plasmid (lin) and the nontarget fragment fir); lane 2, same as lane 1, but after the denaturation/ renaturation step (gc, gapped circle); lane 3, reference containing linear din) and open circular (oc) plasmid. [Reprinted from B. Hofer and B. Kiihlein, Gene 84, 153 (1989) with permission.]

gapped circle species (inseparable by AGE) as well as the linear starting products. In our experience, this step is susceptible to the purity and ionic strength of the DNA solutions, to the DNA concentration, and to minor changes in the melting/reannealing procedure. Therefore it is highly advisable to check the reaction by AGE (Fig. 2). The gapped circle migrates somewhat faster than the open circle (a by-product in most plasmid preparations, and which usually is a good marker), depending on the size of its gap. It may happen that the gapped circle band coincides with one of the linear DNA bands and may thus be hidden. This problem can always be resolved by altering the agarose concentration, which (along with other factors such as temperature) influences the relative mobilities of linear and circular DNA. We normally use a three- to fivefold excess of linear plasmid over nontarget segment, A poor formation of gapped circles was observed below as well as above certain DNA concentrations. In our hands, amounts of 1-5 pmol (2-10/zg) of linear plasmid in a final volume of 200 /~1 work well. The mixture of the gapped circles was found to be somewhat unstable even when stored at - 2 0 °. Presumably the gapped molecules are reconverted into the thermodynamically more stable starting products. Therefore, this mixture should be used within 1-2 weeks.

[12]


181

The following procedure is a modification of the protocol of Kramer and Fritz. z°

Procedure 1. Mix 2.5 pmol of linear dU-containing plasmid, 0.75 pmol of unmodified nontarget segment, and H20 to yield a volume of 175/M. 2. Hold the mixture at 70 ° for 5 rain. 3. Add 25/zl of 8 × HB, prewarmed to 70 °, and continue the incubation at 70 ° for another 3 rain. 4. Cool the tube to room temperature in air (5 rain). Cleavage and Separation of Undesired Gapped Circle. To selectively cleave the undesired gapped circle, a "restriction oligonucleotide" is used that specifically anneals to it. This oligonucleotide contains one strand of a restriction site that must not occur outside the gap, but that may occur in the gap more than once. A 20-mer usually is of sufficient length to obtain complete cleavage at 370.9 Incubation with the restriction enzyme should not be extensively long as this may lower the yield of the desired gapped circle. Presumably some annealing of this DNA to the complementary gapped circular (or, after cleavage, gapped linear) species and/or to the oligonucleotide (via its restriction "half-site," which in most cases will be self-complementary) accounts for this decrease. Therefore, the enzyme concentration and incubation time given in the procedure should be regarded only as a guideline and may have to be determined empirically. Cleavage is analyzed by AGE. The intensity of the band representing the gapped circle(s) should have decreased by 50%. The remaining gapped circle is isolated from a preparative gel.

Procedure I. Mix 200/zl of the gapped circle solution with 50 pmol of the "restriction oligonucleotide." Supplement and adjust appropriately for the subsequent restriction digest. 2. Incubate for 5 min at 65 ° and for 5 min at room temperature (air). 3. Add 60 units of restriction enzyme and incubate at the appropriate temperature for 45 min. 4. Withdraw an aliquot for AGE; store the remainder at - 2 0 °. 5. If the reaction is complete, complex Mg 2+ with EDTA, extract once with PCI solution, ethanol precipitate (if the volume is too large, butanol concentrate or add carrier), and take up in 25/zl TE. 6. Add 0.25 vol of GMM and load on about 30 mm 2 of an appropriate low-melting-agarose gel. Run at 70-85 V. 7. Isolate the gapped circle as described in Preparation of Unmodi-

182


[12]

fled Nontarget Segment (above). Prior to elution add 4/xl tRNA solution to the gel piece as a carrier. (The tRNA remains in the mixture. There are no indications that it interferes with the mutagenesis procedure.) 8. Finally, take up the gapped circle in about 100/zl TE (corresponding to a DNA concentration of about 1 fmol//~l).

Oligonucleotide-Directed Mutagenesis Phosphorylation of Mutagenic Oligonucleotides: Procedure 1. Incubate 20 pmol of mutagenic primer in 15/zl KB, 10 mM DTT, 0.1 mM ATP with 1 unit T4 polynucleotide kinase for 30 min at 37 °. 2. Incubate for 10 min at 70 °, and briefly quench in ice. Use without purification.

Conversion of Gapped Circle into Covalently Closed Heteroduplex Circle. The mutagenic oligonucleotide is annealed to the isolated gapped circle, the remainder of the gap is filled by a DNA polymerase, and the nicks are closed by a DNA ligase. T4 DNA polymerase (at 37 °) consistently led to higher mutant yields than Klenow enzyme (at room temperature), as has also been reported by others. 25'32 The reason for this increase may be that the T4 enzyme has a reduced capacity to displace double-stranded structures. 33 However, T4 polymerase is more sensitive to secondary structures in the template. If this is a problem, addition of the T4 ssDNA-binding protein or of a small amount of Klenow enzyme is recommended. 34

Procedure 1. Mix 3.0/~1 of phosphorylated primer with 2.5/zl of isolated gapped circle, 1.0/zl H20, and 0.5/xl 8 × HB. 2. Incubate for 5 min at 65° and for 3 min at room temperature (air). Add 10.0/zl 2 × MB, 1.0/zl H20, 1/xl T4 DNA ligase (2 units//xl), and 1 /xl T4 DNA polymerase (1 unit//zl) 4. Incubate for I0 min at room temperature followed by 110 min at 37 °. 5. Add 2/xl 150 mM EDTA (pH 8.0). Transformations. Two subsequent transformations are carried out. In the first transformation, the strain must be wild type for dut and ung. It should also be deficient in mismatch repair, which seems to act efficiently .

32 W. Kramer, A, Ohmayer, and H.-J. Fritz, Nucleic Acids Res. 16, 7207 (1988). 33 N. G. Nossal, J. Biol. Chem. 249, 5668 (1974). 34 K. C. Deen, T. A. Landers, and M. Berninger, Anal. Biochem. 135, 456 (1983).

[12]


183

not only on incorrectly paired or unpaired bases, but also on bulge loops .35 Different strains 2°'35 are available that are deficient in the dam-instructed repair system; this seems to be responsible for the majority of repair events .35 As the primary transformants were found occasionally to contain progeny from both the normal (mutant) and the dU-substituted (wild-type) strand, a second transformation is carried out. The cells from the first transformation are therefore not spread on plates, but used to inoculate a liquid broth, from which plasmids are then isolated. A strain of choice is subsequently transformed with this plasmid mixture, and the cells are plated out. Procedure

1. Use 1-4/xl of the mixture of in vitro mutagenesis to transform 80 /xl of competent dut + ung + cells as described in Preparation of dUContaining Linear Plasmid (above). 2. After the 1-hr incubation in SOC medium, 27 use 200 ~zl of the cell suspension to inoculate 2 ml LB medium containing the appropriate antibiotic. Grow this culture overnight. 3. Isolate plasmid DNA from 1 ml of this culture by a fast minipreparation procedure (see, for example, Ref. 30) and take up in 50/xl 0.1 x TE. 4. Use 1/xl of a 1 : 100 dilution of this preparation to transform 20 pJ of competent cells (e.g., strain DH1). 5. Spread 3 /zl of the resulting 100 /zl on LB plates containing the appropriate antibiotic. A few hundred colonies are usually obtained. Screening for and Analysis of Mutants

Normally the analysis of three colonies of an individual mutagenesis experiment is sufficient to find at least one mutant clone. Therefore, DNA sequencing can be used for screening. However, if many mutageneses are carried out simultaneously, single-base sequencing or restriction analysis (when feasible) may be considered. Whatever screening method is used, we emphasize that it is insufficient to demonstrate only the presence of the intended mutation, and that it is absolutely necessary to sequence the whole region relevant for subsequent investigations to verify the absence of any unintentional mutation (see Unintentional Mutations, below). Isolation o f Plasmids. When RNase is omitted, plasmids prepared by the following minipreparation procedure 36 yield excellent sequencing 35 R. A. Fishel, E. C. Siegel, and R. Kolodner, J. Mol. Biol. 188, 147 (1986). 36 G. Morelle, Focus U , 7 (1989).

184


[12]

results. About 3 ml of each culture grown in LB medium was sufficient with our plasmids. A lower copy number may be compensated for by using a richer medium (e.g., TB).

Procedure 1. Pellet cells from 2.8 ml of each culture for 1 min at 8,000 rpm in an Eppendorf centrifuge; remove supernatants completely. 2. Resuspend pellets in 150/zl of ice-cold solution I by vortexing; leave at room temperature for 5 min. 3. Add 300 ~1 of solution II (freshly prepared), mix by inverting the tubes several times, and place on ice for 5 min. 4. Add 225/zl of 7.5 M ammonium acetate and mix by inverting the tubes several times; place on ice for 10 min. 5, Centrifuge at full speed for 5 rain, and carefully transfer about 600 /zl of the supernatants into new tubes. 6. To the supernatants add I vol of 2-propanol, mix, place on ice for 10 min, spin at full speed for I0 min, and discard supernatants. 7. To the pellets add ! ml of 70% (v/v) ethanol, vortex briefly, spin at full speed for 3 min, carefully remove the supernatants, and dry the pellets under vacuum for a few minutes. 8. Resolve the pellets in 100/zl 0.1 x TE. Double-Stranded DNA Sequencing. The plasmids isolated by the minipreparation procedure described above were denatured essentially as reported by Hattori and Sakaki. 37 If necessary, this step can be checked by AGE: the denatured plasmid migrates somewhat faster than the native form. The sequencing reaction was adopted from Tabor and Richardson 38 with a few modifications. When relatively high primer-to-template ratios were used (see Procedure, below), the signal-to-background ratio of the autoradiographs was usually indistinguishable from that obtained with CsCI gradient-purified DNA.

Procedure 1. Mix 80/xl of minipreparation and 20/zl of 1 N NaOH, 1 mM EDTA. Leave at room temperature for 5 min. 2. Mix with 40/zl 5 M ammonium acetate and 420/zl ethanol. Place in a - 7 0 ° freezer for 15 min, spin at full speed for 10 min (4°), and remove the supernatant. 3. Add 1 ml 70% (v/v) ethanol (-20°), vortex briefly, spin for 3 min 37 M, Hattori and Y. Sakaki, Anal. Biochem. 152~ 232 (1986).

3~ S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 84, 4767 (1987).

[12]


185

as above, carefully remove supernatant, and dry the pellet under vacuum for a few minutes. 4. Resolve the pellet in 32 p~! H20. 5. Mix 7 t~l (about 0.25 pmol) of this solution with 2 t~l 5 × TMN and I/~1 primer (5 pmol). Incubate at 65° for 5 min, then at room temperature (air) for 3 rain. 6. Perform the primer elongations, for example, as described by Tabor and Richardson. 38 We take only half their dNTP concentration in the labeling step and use unmodified T7 DNA polymerase. Limitations and Modifications of the Method There are no limitations as far as the type (substitution, deletion, or insertion) and position of the mutation are concerned. However, three restriction sites (A, B, and C) are required to generate the gapped circles (Fig. 1). Sites A and B are likely to be found in any recombinant plasmid, because the cloning site(s) may serve this purpose. Site C (outside the target region), preferably unique but not necessarily, is also likely to be available in any plasmid. There is no absolute need for an additional site D to linearize the undesired gapped circle, as in most instances it should be possible to make use of either site A or site B for this purpose. In both gapped circles site A (or B) is incomplete. To our knowledge, there are no data in the literature on the substrate properties of incomplete (distinct from single-stranded) restriction sites. It is tempting to assume that such sequences are generally uncleavable; however, preliminary results indicate that this is not the case (see below). Three situations may be envisaged. 1. The site is not cleaved in both gapped circles. Therefore selective cleavage is possible by using a "restriction oligonucleotide" (or limited enzymatic elongation). 2. The site is cleaved in both gapped circles. In this case it cannot be used as site D. 3. The site is cleaved in only one of the two gapped circles. This gapped circle is then chosen to be the undesired one and can be selectively linearized without the need for a restriction oligonucleotide (or limited enzymatic elongation). The third case most likely applies only to sites produced by staggered cuts, as only then are the structures of the sites in the complementary gapped circles not identical. To illustrate this, when the gap has been generated using EcoRI and HindIII, the structures of the sites in the gapped circles (termed "gc + " and " g c - ") are as follows:

186


gc +

........ G AGCTT ........ ........ CTTAAG .......................... TTCGAA ........ / / /

gc-

[12]

/

........ GAATTC .......................... AAGCTT ........ ........ CTTAA A ........

The internucleotide linkages that would be cut by the endonucleases in the complete recognition sequences are indicated by slash marks (/). For each enzyme, the respective internucleotide linkages are located in the single-stranded segment of one gapped circle, but in the double-stranded segment of the other. Preliminary results indicate that HindlII is unable to cut either of its truncated sites, whereas EcoRI is able to cleave the site in g c - , but not in gc +. Therefore, when EcoRI is used, g c - is defined as the "undesired" gapped circle and can be linearized even without a restriction oligonucleotide. Unintentional Mutations

Mutant screening frequently was done by single-base or complete DNA sequencing. The application of this technique resulted in the accumulation of a substantial body of information on unintentional mutations (UMs).

Unintentional Mutations in General About one-half of the UMs observed can be explained by unintentional annealing of the mutagenic oligonucleotide in combination with the enzymatic activities of the in vitro system. An example is shown in Fig. 3. Evidently, even a single base pair at the 5' end of such a hybrid can be sufficient to stabilize the structure long enough to reach replication. The residual UMs comprised large deletions (hundreds of base pairs), which also might be mediated by template-primer interactions, and a few point mutations, which might be due to errors by a DNA polymerase (in vitro or in vivo). With some oligonucleotides the yield of UMs was high (about 40%) or even appeared to be coupled to the generation of the desired mutation. Thus it became a problem to obtain the intended mutation without the simultaneous introduction of the unintended one. In these cases an additional high-temperature incubation with the DNA polymerase prior to

[12]

187

EFFICIENT MUTAGENESIS IN PLASMIDS T

C C A @ A @ @ T T

T

@ A

@ T T C

T T

C TAAA©ACA@C

TA C@ @ATA A A C

A

I

3'

C @ CoC O

T,@ @C

AAT

TEMPLATE

@C@

AT

oT ~

. ojjJ'° @C TA TA TC@

@

ILPR33

@

T T @@C Co

C@ TA¢ T A Tc T @T @ T A A A T T C A A A A T OTA C @@Q;AAOT T C CcTOCTT

5' FIG. 3. Formation of an unwanted mutation by unintentional annealing of the primer ILPR33 to the template. The structure shown was calculated by a program of Zuker and Stiegler [M. Zuker and P. Stiegler, Nucleic Acids Res. 9, 133 (1981)] originally written for RNA, The G • T pair in the hybrid is indicated by a circle. Exonucleolytic degradation of the unannealed 3' end of the primer (8 nt), elongation, and finally ligation yielding a covalently closed circular (ccc) plasmid would explain the observed mutation.

elongation at room temperature (as originally described by Strauss e t al. 39 to increase the yield of site-specific deletions) proved to be most helpful. In these experiments we used the Klenow enzyme (under conditions de39 M. Strauss, C. H. Streuli, and B. E. Griffin, Gene 49, 331 (1986).

188


[12]

scribed by Kramer et al.4°). We have evidence, however, that the hightemperature step might also work with T4 polymerase (see below). After annealing of template and primer for 5 min at 68 ° (or, if lower, at the calculated Tm of the hybrid39), dNTPs, salts, and Klenow enzyme (0.75 units) were added and the incubation was continued at the same temperature for another 5 min. Only then was the mixture cooled to room temperature (in air for 5 min), after which 0.4 units of DNA polymerase and 5 units of DNA ligase were added, and the standard protocol was followed. This modified procedure was performed with three "problematic" primers. No UMs were found in 18 clones analyzed while the intended mutations were obtained at the same frequency as with the standard protocol. Experiments with 5'-labeled primers demonstrated that all unannealed molecules were partially degraded by the 3'-exonucleolytic activity of the Klenow enzyme during the high-temperature (68 °) incubation. This gives a rationale for the observed suppression of UMs formed by unintentional annealing. So far, we have not needed to use the additional high-temperature step when mutagenesis reactions were carried out with T4 DNA polymerase. If necessary, it should be possible to apply the T4 enzyme successfully in the high-temperature protocol. A pilot experiment as described in the preceding paragraph, but under T4 mutagenesis conditions, showed that after the 68 ° step the selective degradation of unannealed 28-mer primers was, as may be expected, even more pronounced than when the Klenow enzyme was used. Unintentional M u t a t i o n s in Insertions

When mutant DNAs were sequenced that originated from experiments with oligonucleotides designed to generate insertions, as many as 17 of a total number of 47 (36%) showed sequence deviations in the regions originating from the mutagenic primers. We observed substitutions and deletions of one or two adjacent or nonadjacent nucleotides (nt). Remarkably, all of these sequence errors were located in the insertions (varying from 27 to 45 nt in length), that is, in those parts of the primers that did not base pair with the template. They are probably due to errors in chemical synthesis and not to some biological loop "repair" mechanism. When we used one of these primers in a modified mutagenesis procedure (currently under investigation) in which the wild-type strand was degraded beyond 40 W. Kramer, V. Drutsa, H.-W. Jansen, B. Kramer, M. Pflugfelder, and H.-J. Fritz, Nucleic Acids Res. 12, 9441 (1984).

[13]

HIGH-EFFICIENCY

SITE-DIRECTED

MUTAGENESIS

189

the position of the loop prior to transformation, unintentional mutations again were found in some of the inserts. 41 Results reported by Clackson and Winter42 also argue against a biological phenomenon. They replaced 383-nt-long DNA segments by site-directed mutagenesis using polymerase chain reaction (PCR)-generated primers. Despite the formation of 383-ntlong (interior) loops on annealing of the polynucleotides, all 14 positive clones sequenced were found to be correct. Acknowledgments The authors wish to thank H. Bl6cker, R. Frank, and co-workers for oligonucleotide synthesis, P. Artelt, J. Hoppe, and H.-J. Fritz for the gifts of vectors and strains, and R. Brownlie for linguistic advice. This work was supported by the Bundesministerium fiir Forschung und Technologie through Grant No. 03 8706 9. 4J R. Wefel and B. Hofer, unpublished observations (1991). 4: T. Clackson and G. Winter, Nucleic Acids Res. 17, 10163 {1989),

[13] S i t e - D i r e c t e d M u t a g e n e s i s of S i n g l e - S t r a n d e d a n d Double-Stranded DNA by Phosphorothioate Approach

By DAVID B. OLSEN, JON R. SAVERS, and FRITZ ECKSTEIN Introduction

Oligonucleotide-directedmutagenesis allows the introduction of almost any precisely defined mutation into a cloned, sequenced gene. The mutation may comprise single or multiple mismatches or it may involve the insertion or deletion of a large number of bases. There are a number of methods described in the literature for the efficient production of site-directed mutations. The gapped duplex,l uracilcontaining template, 2 and coupled primer approaches3 have all been used to improve the basic method described in detail by Zoller and Smith. 4-6 However, these methods are limited to protocols using single-stranded vectors, involve the transfection of heteroduplex DNA (resulting in the W. Krammer and H.-J. Fritz, this series, Vol. 154, p. 350. z T. A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. P. Carter, this series, Vol. 154, p. 382. 4 M. J. Zoller and M. Smith, Nucleic Acids Res. 10, 6487 (1982). -~M, J. Zoller and M. Smith, this series, Vol. 100, p. 468. M. J. Zoller and M. Smith, this series, VD1. 154, p. 329.



190


[13]

need for specialized E s c h e r i c h i a coli strains such as mismatch repairdeficient cells, d u t - u n g - , etc.), and very often require plaque purification steps. The original phosphorothioate-based mutagenesis method 7 has undergone a number of improvements, s-t° and has several advantages over the previously mentioned methods. The fundamental difference is that selection against the wild-type sequence is carried out in vitro. Therefore, special cell lines and plaque purification are avoided. Very high mutational efficiencies are obtainable, on the order of 70-90%, 9A° which allows for direct genotypic screening by DNA sequencing) 1 In addition, random mutagenesis procedures, such as those developed by Knowles and coworkers, ~2:3 are also possible due to the high efficiency that is essential for the productive application of such protocols. Finally, the phosphorothioate approach is not limited to the use of single-stranded or phagemid 14 DNA but has been extended to double-stranded DNA vectors. ~°'~5

Principle of Phosphorothioate-Based Mutagenesis Methodology for Single-Stranded DNA The phosphorothioate-based oligonucleotide-directed mutagenesis method exploits the observation that several restriction endonucleases cannot linearize DNA containing certain phosphorothioate internucleotidic linkages. 8'16-19The first step of the procedure involves annealing of a mismatch oligonucleotide primer to the (+)strand of a single-stranded

7 j. W. Taylor, J. Ott, and F. Eckstein, Nucleic Acids Res. 13, 8765 (1985). s K. L. Nakamaye and F. Eckstein, Nucleic Acids Res. 14, 9679 (1986). 9 j. R. Sayers, W. Schmidt, and F. Eckstein, Nucleic Acids Res. 16, 791 (1988). 10 D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). u L. Serrano, A. Horovitz, B. Avaron, M. Bycroft, and A. R. Fersht, Biochemistry 29, 9343

(1990). 12 j. D. Hermes, S. M. Parekh, S. C. Blacklow, H. Koester, and J. R. Knowles, Gene 84, 143 (1989). 13 j. D. Hermes, S. C. Blacklow, and J. R. Knowles, Proc. Natl. Acad. Sci. U.S.A. 87, 696 (1990). 14 j. Vieira and J. Messing, this series, Vol. 153, p. 3. i5 D. B. Olsen and F. Eckstein, in "Directed Mutagenesis: A Practical Approach" (M. J. McPherson, ed.), p. 83. IRL Press, Oxford, England, 1991. 16 j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985). 17j. R. Sayers, D. B. Olsen, and F. Eckstein, Nucleic Acids Res. 17, 9495 (1989). 18 D. B. Olsen, G. Kotzorek, and F. Eckstein, Biochemistry 29, 9546 (1990). 19 D. B. Olsen, G. Kotzorek, J. R. Sayers, and F. Eckstein, J. Biol. Chem. 265, 14389 (1990).

[13]

HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS

A

B

C

D

19l

E

SCHEME[. Schematic representationof the phosphorothioate-based mutagenesis method. Single-stranded DNA, annealed with a mismatch primer [ t , position of the mismatch nucleotide(s)] (A), is converted to RFIV DNA using T7 DNA polymerase, T4 DNA ligase, and dNTPaS mix (B). The region containing phosphorothioate internucleotidic linkages in the newly synthesized ( - )strand is drawn with bold lines. The wild-type ( + )strand is specifically hydrolyzed by reaction with a restriction endonuclease resulting in a nicked DNA product (C). The nick is taken as the starting point for digestion by either a 3' ~ 5'- or a 5' ---, 3'-exonuclease (D). A fully complementary homoduplex RFIV molecule, which is ready for transformation, is generated on repolymerization (E).

circular phage DNA (Scheme IA). The primer is extended by T7 DNA polymerase using a mixture of three deoxynucleoside triphosphates and the Sp-diastereomer of a deoxynucleoside 5'-O-(l-thiotriphosphate) (dNTPo~S) such as dCTPaS (Fig. 1). The resulting ( - )strand of the newly synthesized RFIV DNA contains phosphorothioate groups (see bold lines in Scheme IB). This strand asymmetry is exploited by reaction with a restriction enzyme (e.g., NciI 8) that hydrolyzes only the wild-type (+)strand (Scheme IC). The resulting nick is converted to a gap by reaction with an exonuclease (Scheme ID). The gapped DNA is repolymerized using the mutant strand as the template, resulting in the formation of a mutant homoduplex with the mutant sequence present in both strands (Scheme IE). The DNA can be transformed into any E. coli host strain.

NH 2

-0-,,

o

o

o

II

II

!

P~O

I

O.

P ~ O ~ P ~ O

I

O-

....

t

S OH

FIG. 1. Structure of the Sp-diastereomer of deoxycytidine 5'-O-(1-thiotriphosphate), dCTPaS. The sulfur atom replaces a nonbridging oxygen atom of the a-phosphorus.

192


[13]

Experimental

Media 2YT medium: 16 g tryptone, l0 g yeast extract, 5 g NaC1 per liter; autoclave B-broth soft agar: 0.5 g tryptone, 0.4 g NaCI, 50/zl 1% (v/v) B~ solution, 0.3 g agar in 50 ml H20; autoclave Bx solution: l0 mg/ml thiamin hydrochloride

Reagents TE buffer: 10 mM Tris-HCl (pH 8), l mM ethylenediaminetetraacetic acid (EDTA); autoclave NTE buffer: 100 mM NaCI, I mM EDTA, 10 mM Tris-HC1 (pH 8); autoclave DNA buffer: 20 mM NaCI, 1 mM EDTA, 20 mM Tris-HCl (pH 8); autoclave 4 x dNTP mix: l0 mM dATP, l0 mM dCTP, 10 mM dGTP, 10 mM dTTP; sterile filter dCTPaS mix: 5 mM dATP, 5 mM dCTPaS, 5 mM dGTP, 5 mM dTTP; sterile filter dGTPaS mix: 5 mM dATP, 5 mM dCTP, 5 mM dGTPaS, 5 mM dTTP; sterile filter Buffer A (10 x ): 100 mM MgCI z , 50 mM dithiothreitol (DTT), 500 mM Tris-HC1 (pH 8) Buffer B (10 x): 1 M Tris-HCl (pH 8), 1 M NaC1; autoclave Buffer C (10 x ): 70 mM MgC12, 50 mM DTT, 100 mM Tris-HCl (pH 8), 600 mM NaC1; sterile filter. Prepare immediately prior to use Buffer D (10 x ): 80 mM MgClz, 400 mM NaCI, 500 mM Tris-HCl (pH 7.4); autoclave Isopropyl-/3-o-thiogalactopyranoside (IPTG) solution: 30 mg IPTG in 1 ml H20; sterile filter 5-Bromo-4-chloro-3-indolyl-3-galactoside) (X-Gal) solution: 20 mg X-Gal in 1 ml deionized dimethylformamide (do not sterilize!) EcoRI nicking buffer (10 x ): 4 mM CoClz, 1 M NaC1, 1 M Tris-HC1 (pH 7.4) Ethidium bromide solution: 0.5 mg/ml

Materials and Enzymes The Sp-diastereomers of the deoxynucleosides [5'-O-(1-thiotriphosphates)] were purchased from Amersham (Amersham, England) or syn-

[13]


193

thesized according to the procedure of Ludwig and Eckstein) ° Qiagen (Diisseldorf, Germany) tip 500 was used for the isolation of plasmid DNA. Nitrocellulose filters (SMl1336, 13 mm in diameter, 0.45-/xm pore size) were supplied by Sartorius. Filter units were from Millipore (Bedford, MA). Centricon-100 filtration units were obtained from Amicon Corporation (Danvers, MA). The enzymes T7 DNA polymerase, T4 polynucleotide kinase, and T7 exonuclease were obtained from United States Biochemicals (Cleveland, OH). All restriction endonucleases and exonuclease III were purchased from New England Biolabs (Beverly, MA) and E. coli DNA polymerase I was from Boehringer Mannheim (Mannheim, Germany). T4 DNA ligase 16and T5 exonuclease 21were prepared as previously described. Preparation of Single-Stranded Template DNA The first step toward successful completion of a mutagenesis experiment is effective growth and isolation of phage DNA. One of the biggest mistakes that can be made is to attempt site-directed mutagenesis with DNA that is not free from RNA or DNA fragments that are capable of acting as primers in the polymerization reaction. Even the novice can prepare sufficiently pure DNA without the need to perform RNase treatments or cesium chloride density gradient purifications. The method we recommend (procedure 1) is given below and includes two polyethylene glycol phage precipitation steps that are important factors in the preparation of suitable template DNA. Although the procedure is stretched over several days, it requires only a minimal amount of time during the first 3 days. When performing this procedure, it is important to avoid allowing phage particles to contact any of the solutions used for transformation of the mutated DNA.

Procedure 1: Preparation of Template DNA The phage carrying a sequenced insert must be present in a singlestranded DNA vector such as one of the M13 vectors characterized by Messing. 22

Day 1 1. Plate out the phage so as to give single plaques. 2. Prepare an overnight culture of, for example, SMH50 or TG1 cells 20 j. Ludwig and F. Eckstein, J. Org. Chem. $4, 631 (1989). 21 j. R. Sayers and F. Eckstein, J. Biol. Chem. 265, 18311 (1990). 22 j. Messing, this series, Vol. 101, p. 20.

194


[13]

in 3 ml 2YT medium by picking a colony from a glucose-minimal medium plate. (If starting with DNA, follow procedure 12 for the transformation of competent cells).

Day 2 1. Prepare fresh cells by adding I drop of overnight culture into 3 ml fresh 2YT medium and incubate at 37° for 3 hr in a shaker. 2. Prepare a phage solution by picking a single plaque into 100/xl of fresh cells and incubate overnight at 37 °. 3. Set up another 3-ml overnight cell culture.

Day 3 1. Inoculate 100 ml 2YT medium (in a 250-ml flask) with l ml of fresh cells (prepared as described above) and grow at 37°, with shaking, to an A660of 0.3. 2. Add the phage solution and continue incubation for 5 hr. 3. Transfer the solution to centrifuge tubes and pellet the cells by centrifugation for 20 min at 23,000 g in a Sorvall (Norwalk, CT) centrifuge using a GSA rotor. 4. Immediately decant the supernatant and add 1/5 vol of 20% (v/v) polyethylene glycol (PEG) 6000 in 2.5 M NaC1. Allow the phage to precipitate for 30 min (or overnight) at 4 °.

Day 4 1. Centrifuge at -3500 g in a Sorvall centrifuge using a GSA rotor for 20 min at 4 °. Discard the supernatant and remove traces of liquid with a tissue or drawn-out pipette. 2. Add 10 ml TE buffer and resuspend the phage pellet. 3. Centrifuge at -3500 g for 20 rain at 4 °. Transfer the phage containing supernatant to a clean centrifuge tube. 4. Add 2.2 ml 20% (v/v) PEG in 2.5 M NaCI. Precipitate at 4 ° for 30 min. Centrifuge at -3500 g for 20 min at 4 °. 5. Discard the supernatant, remove any excess liquid using a drawnout pipette, and then dissolve the phage pellet in 500/.d NTE buffer and transfer to a sterile microcentrifuge tube. 6. Add 200/zl of buffer-equilibrated phenol, vortex for 30 sec, and spin briefly in a microcentrifuge. Transfer the aqueous (upper) layer to a new microcentrifuge tube. 7. Repeat step 6. 8. Add 500/xl H20 saturated diethyl ether, vortex for 30 sec, and spin briefly in a microcentrifuge. Discard the upper (ether) layer. Repeat the process three more times.

[13]


195

9. Add 50 ~l 3 M sodium acetate (pH 6), vortex, and divide the solution equally between two microcentrifuge tubes. 10. Add 700/A absolute ethanol to each tube, and cool to - 7 0 ° in a dry ice/2-propanol bath for 60 min. Centrifuge for 5 min at 14,000 rpm in a microcentrifuge. 11. Discard the supernatant, add 700/A 70% (v/v) ethanol, and invert the tube to drain off the solvent, taking great care not to dislodge the pellet. 12. Label the tubes X and Y and add 50 IA DNA buffer to tube X. Resuspend the pellet by vortexing and transfer the buffer containing DNA from tube X to tube Y. 13. Add 50 ~1 of DNA buffer to tube X, vortex, centrifuge briefly, and transfer the contents to tube Y. Vortex to resuspend the pellet. 14. Take a 10-/.d sample, dilute to 1000/A, and determine the optical density on an ultraviolet (UV) spectrometer at 260 and 280 nm in a 1-mi quartz cuvette. The ratio of A260/280should be 1.8 or higher; if not, repeat the phenol extraction and the following steps. One A260unit corresponds to - 3 7 / ~ g single-stranded DNA. Keep this sample as a standard for gel analysis (14/~1 diluted with stop mix). We highly recommend that a self-priming test (procedure 2, below) be performed on all newly isolated single-stranded DNA. After the test, the DNA can be analyzed by agarose gel electrophoresis. If significant amounts of polymerized material are observed we recommend that procedure 1 be repeated. Figure 2 shows the results after each stage of a typical single-stranded DNA mutagenesis experiment. The novice should compare results after each stage of the mutagenesis procedure with the results presented in Fig. 2.

Procedure 2: Self-Priming Test for Single-Stranded DNA 1. To a 1.5-ml sterile microcentrifuge tube, add Buffer B, 2.5 p.l Single-stranded DNA template, 5/~g 2. Adjust the final reaction volume to 23 ~l with H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 70 ° for 5 min in a hot water bath. Transfer immediately to a heating block at 37 ° and leave for 20 rain. Place on ice. Then add Buffer A, 3.5 ~1 4 × dNTP mix, 2 pA ATP (10 mM), 5 pA

196


[13]

/ FIG. 2. Analysis of single-stranded DNA mutagenesis intermediates by agarose gel elec-

trophoresis.

DNA polymerase I, 5 units T4 DNA ligase, 5 units 5. Bring the volume of the solution to 35/zl using sterile H20. 6. Briefly vortex and spin down the solution. 7. Incubate at 37° for 2 hr. Remove a 2-/zl sample for gel analysis. This analysis should be carried out with a control reaction containing an appropriate primer that can anneal to the single-stranded DNA.

Phosphorothioate-Based Mutagenesis Using Single-Stranded DNA Vectors

Mutant Oligonucleotide The sequence of the mutant oligonucleotide determines how the target DNA sequence is to be mutated. Different types of changes such as transition or tranversion mutations as well as insertions and deletions are all possible with the phosphorothioate-based procedure. As previously

[13]


197

pointed out, 23 this method provides a distinct advantage when performing insertion mutagenesis because the selection step against the wild-type strand occurs in vitro. Preferentially, the oligonucleotide should have 6-7 bases on the 3' end to protect it from the 3' --~ 5' exonuclease proofreading activity of the polymerase. 24 For single- or double-base mismatches we routinely use oligomers of 18-22 nucleotides in length with the mismatch(s) positioned toward the center. Another important concern is that the oligonucleotide does not contain a high degree of self-complementarity. This could cause problems in the annealing step due to self-association. Finally, the primer should not normally contain a recognition site for the restriction enzyme that is to be used in the nicking reaction. Such a site, if present, would lead to the linearization of the DNA during the nicking reaction as the primer does not contain any phosphorothioate groups. However, it is possible to use a primer with such a recognition site provided that the primer is chemically synthesized with phosphorothioate groups at the positions required to protect it from endonuclease-catalyzed hydrolysis. 25 Procedure 3 below provides a simple procedure for the phosphorylation of the mutant oligomer. A phosphorylated primer is required so that ligation can occur after complete synthesis of the mutant strand resulting in the conversion of RFII to RFIV DNA.

Procedure 3: Phosphorylation of Mismatch Oligonucleotide 1. Add the following to a sterile 1.5-ml microcentrifuge tube: Buffer A (10x), 3.5/xl ATP (I0 mM), 3/xl Oligonucleotide primer (stock of 5 A260units/ml for an oligomer of 18-24 bases), 2/xl 2. Bring the volume to 34/zl using sterile H20. 3. Add 5 units of polynucleotide kinase. 4. Briefly vortex and spin down the solution. 5. Incubate in a heating block at 37 ° for 15 min and then heat inactivate the enzyme at 70° for 10 min in a water bath. Store on ice.

23 T. A. Kunkel, in "Nucleic Acids and Molecular Biology" (F. Eckstein and D. M. J. Lilley, eds.), Vol. 2, p. 124. Springer-Verlag, Berlin, 1988. 24 S. Tabor, H. Huber, and C. C. Richardson, J. Biol. Chem. 252, 16212 (1987). 25 R. P. Iyer, L. R. Phillips, W. Egan, J. B. Regan, and S. L. Beaucage, J. Org. Chem. 55, 4693 (1990).

198

[13]

MUTAGENESIS AND GENE DISRUPTION TABLE I RESTRICTION ENDONUCLEASES UNABLE TO HYDROLYZE PHOSPHOROTHIOATECONTAINING DNA

Enzyme A v a I b'c AvalI b BamHI BanII b EcoRI EcoRV b FspI HindII

HindIII KasI NciI b,c PstI b

PvuI b PvulI SacI SmaI

DNA ~ M13mp2 qbX174 M13mp2 M 13mpl 8 Ml3mp2 M 13mp 18 M 13mp 18 M13mpl8 Ml3mpl8 M13mp2 M13mp9 M13mpl8 M 13mp 18 M 13mp2 M 13mp2 M13mpl8 M 13mp9 M13mpl8 pUC19 M13mp2 Ml3mpl8 M13mpl8 M13mpl8

Analog used for polymerization

Ref.

dCTPaS dTTP~S dGTPczS dATPc~S/dGTPaS dCTP~S/dNTPaS f

d d d e d, f, g

dCTPaS/dGTPaS f

dATPaS/dGTPczS dATPaS dGTP~xS dGTPczS

e e, g, h i d, i

dATPaS/dTTPo~S dGTPczS dCTPczS

e i d, j

dGTPaS

dCTPaS dCTPczS/dGTPt~S dCTPaS/dGTPaS

dGTPaS k

d, g, j

d e e l

a The initial nicking conditions were determined using the DNA vectors listed. We recommend that all nicking reactions be carried out according to the buffer and incubation conditions given in the original reference. o Most consistent results have been obtained using these enzymes. c This restriction endonuclease recognizes a degenerate recognition sequence and therefore incorporation of a different phosphorothioate might be required for the inhibition of hydrolysis with different DNA vectors. a j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985). e j. R. Sayers, D. B. Olsen, and F. Eckstein, Nucleic Acids Res. 17, 9495 (1989). f B a n l I recognizes the sequence 5'-GPuGCPy/C-3'. Our results [D. B. Olsen, G. Kotzorek, J. R. Sayers, and F. Eckstein, J. Biol. Chem. 265, 14389 (1990)] indicate that to inhibit this enzyme a phosphorothioate must be at the two positions designated by asterisks in the following sequence: 5'-GPuGCPy*C*N-3'. For M13mp2, rap7, mp8, mp9, or mpl0, the 3'-N is a cytosine in the ( - ) strand and therefore is protected by the presence of only dCMPS. However, Ml3mpl8 has a G in the ( - ) strand 3' to the recognition sequence and therefore the DNA must contain dCMPS and dGMPS groups.

[13]


199

Preparation of RFIV Heteroduplex DNA Annealing. For most mutations two molar equivalents of primer are annealed to the target sequence in a high-salt buffer, as described in Procedure 4. Procedure 4: Annealing of Primer to Template DNA 1. Add the following to a sterile microcentrifuge tube: Buffer B (10 ×), 3.5 ~1 Phosphorylated primer solution from procedure 3, 6 ~1 Single-stranded DNA template (from procedure 1, typically 2-5/xg//~l), 10/xg 2. Adjust the final reaction volume to 35/xl with H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 70 ° for 5 min in a hot water bath, transfer immediately to a heating block at 37°, and incubate for 20 min before placing on ice. Polymerization. The choice of deoxynucleoside phosphorothioate for the polymerization reaction is dependent on which restriction enzyme is to be used in the subsequent nicking reaction (see Table I for a list of appropriate restriction endonucleases). The restriction enzymes NciI and AvaI have been used most extensively and both require the incorporation of dCMPS groups into M13mpl8 DNA to limit the hydrolysis to the wildtype strand. Native T7 DNA polymerase is the enzyme of choice for extension of the mutant oligonucleotide and complete synthesis of the mutant ( - )strand. This enzyme has several advantages over other DNA polymerases in that it is very processive, it does not strand displace, and pure enzyme is commercially available. In addition, this enzyme efficiently incorporates dNMPS analogs and the polymerization reaction is normally complete after short incubation periods. Alternatively, the Klenow fragment of DNA polymerase I yields acceptable results when used at 16° overnight.

g D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). h D. B. Olsen, G. Kotzorek, and F. Eckstein, Biochemistry 29, 9546 (1990). i C. Krekel and J. R. Sayers, unpublished observations. J K. L. Nakamaye and F. Eckstein, Nucleic Acids Res. 14, 9679 (1986). k Nicking using Sinai requires 40/zg/ml ethidium bromide in the reaction in addition to dGMPS at the site of cleavage. J. R. Sayers, W. Schmidt, A. Wendler, and F. Eckstein, Nucleic Acids Res. 16, 803 (1988).

200


[13]

Procedure 5: Polymerization Reaction

1. Add the following reagents to the template/primer mixture (procedure 4) after the annealing mixture has been cooled on ice for 10 min: dCTPaS, 8/xl ATP (10 mM), 8/zl Buffer A (10×), 8/zl T7 DNA polymerase, 26 6 units T4 DNA ligase, 10 units 2. Adjust the volume to 80/zl with sterile H20. 3. Briefly vortex and spin down the solution. 4. Incubate for 1 hr at 37 °. Heat inactivate at 70° for 10 min and remove a 2-/zl sample for agarose gel analysis (see Fig. 2). Removal o f Wild-Type Single-Stranded DNA. The nitrocellulose filtration step described below is designed to remove any unpolymerized singlestranded DNA that remains after the polymerization reaction. Even though our procedure uses an excess of oligonucleotide for priming, some single-stranded DNA usually remains after the reaction, which can greatly reduce mutational efficiency. Procedure 6: Nitrocellulose Filtration z7

1. Using forceps place the rubber seal and two nitrocellulose filters (do not use autoclaved filters) in the female end of the filter housing. 2. Carefully apply 40/zl 500 mM NaCI to moisten the filter disks and then assemble the unit. 3. Attach a 2-ml disposable syringe to the outlet side of the filter unit using a l-cm length of silicone tubing. 4. Add 6/xl 5 M NaCI to the polymerization reaction. Mix and apply to the inlet side. 5. Slowly draw the sample through the filter unit using the syringe plunger. If necessary tap the housing gently to collect the filtrate. 6. Add 50/zl 500 mM NaC1 to the top of the filter unit and draw the wash through. 7. Carefully remove the filter unit and transfer the filtrate into a fresh, sterile microcentrifuge tube. 8. Rinse the syringe with 50/zl 500 mM NaC1 and combine with the filtrate. 26 It is important to add the T7 DNA polymerase after the nucleotide mix; otherwise, the strong proofreading activity associated with the enzyme may digest the mutant oligonucleotide. 27 The phosphorothioate-based mutagenesis kit supplied by the Amersham Corporation contains filter units that are operated by centrifugal force instead of a syringe system.

[13]


201

9. Add 400/zl cold absolute ethanol, mix, and place at - 7 8 ° for 15 min. 10. Spin in a microcentrifuge for 15 min at 14,000 rpm at room temperature. 11. Discard the supernatant (a small pellet of salt/DNA should be visible). 12. Carefully add 400/zl of 70% ethanol and invert the tube. Check that the pellet has not been dislodged. Open the cap to release the liquid, being careful not to disturb the pellet. 13. Remove the remaining amount of liquid using a Speed-Vac concentrator (Savant Instruments, Inc., Farmingdale, NY) for 2-3 min at room temperature.

Preparation of Mutant Homoduplex Strand-Selective Hydrolysis of Wild-Type DNA. There are a number of restriction endonucleases that can be used to hydrolyze the unmodified (nonphosphorothioate containing) strand of the mutant heteroduplex DNA (Table I). Below we have provided conditions for nicking reactions with the enzymes NciI and AvaI. After the nicking reaction is complete, we recommend that the user analyze the reaction products by agarose gel electrophoresis. There should be no RFIV DNA visible on the gel. Procedure 7: Restriction Endonuclease Nicking of Heteroduplex DNA NciI reaction 1. Resuspend the pellet (from procedure 6) in 190/zl H20 and add Buffer A (10 x ), 25/zl NciI, 120 units 2. Bring the volume to 250 txl with sterile H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 37° for 90 min. Heat inactivate the enzyme at 70 ° for 10 min. Keep a 6-/zl sample for gel analysis (see Fig. 2). Alternatively, the DNA may be nicked with the enzyme AvaI. 1. Resuspend the DNA pellet in 160/xl H20 and add Buffer C (10 x ), 25/zl AvaI, 70 units 2. 3. 4. a 6-/zl

Bring the volume to 250/~1 with sterile H20. Briefly vortex and spin down the solution. Incubate at 37 ° for 180 rain. Heat inactivate at 70° for 10 min. Take sample for gel analysis (see Fig. 2).

202


[13]

Hydrolytic digestion of wild-type DNA by exonuclease digestion. The 5'--* 3' activity of T7 exonuclease gaps nicked double-stranded DNA and removes almost all the nicked wild-type strand under normal gapping conditions. Partially gapped DNA species are not detected by agarose gel analysis, indicating the highly processive character of this enzyme. Commercial samples of T7 exonuclease normally are endonuclease free and therefore prolonged incubation times are possible. In theory, this exonuclease can be used in combination with any restriction endonuclease because it removes almost all of the (+)strand in less than 15 min using nicked M13mpl8 as substrate. The T7 gapping protocol is given below. 9 Procedure 8: Gapping Using T7 Exonuclease. Exonuclease T7 functions in either buffer used for performing the nicking reaction. 1. Add I0 units T7 exonuclease per microgram double-stranded DNA. 2. Briefly vortex and spin down the solution. 2. Incubate at 37 ° for 30 min. 3. Heat inactivate the exonuclease at 70 ° for 15 min and place directly into a 37° heating block for 20 min. 4. Remove a 14-/A sample for gel analysis (see Fig. 2) and then place on ice. A band that runs close to a single-stranded DNA marker should be evident. Alternatively, exonuclease III can be used as the gapping enzyme. It digests double-stranded DNA containing a free 3' terminus in the 3' ~ 5' direction. We have found that exonuclease III gaps best in a buffer containing - 1 2 0 mM NaCI, 50 mM Tris-HC1 (pH 8), 6 mM MgCI2, 10 mM DTT, and 15 units of exonuclease per microgram of nicked DNA. Gel analysis of the reaction product revealed a distinct band whose electrophoretic mobility increases progressively with longer incubation time, 28 indicative of a distributive gapping mechanism, z9 Therefore, this enzyme is ideally suited for gapping in conjunction with a restriction endonuclease that produces a nick at the 3' side of the mutation in the (+)strand. We have frequently used the M13mpl8 DNA vector together with the NciI nicking/exonuclease III gapping combination to degrade the wildtype (+)strand. NciI has sites at positions 1924, 6247, 6248, and 6838 in this vector. Interestingly, neither DNA strand of the double site in the polylinker of M13mpl8 (CCCGGG 6247/8) is hydrolyzed when dCMPS is present in the (-)strand. 8 The nearest downstream NciI site to the polylinker is at position 6838. Because exonuclease III gaps nicked DNA at a 28 W. Schmidt, "Untersuchungen zum Abbau von DNA mit Exonuklease III," Diplomarbeit. University of Goettingen, Goettingen, Germany, 1986. 29 S. G. Rogers and B. Weiss, this series, Vol. 65, p. 201.

[13]


203

rate of about 150 nucleotides/min,9'29 a mismatch site in the middle of the polylinker in an insert of 1000 bases would require approximately 20 min (allowing a safety margin) to gap past the mismatch. Exonuclease III may of course be used in conjunction with restriction endonucleases other than NciI, provided that the buffer conditions are adjusted accordingly. Note that higher salt concentrations are essential for reproducible gapping of the DNA with exonuclease III.

Procedure 9: Gapping Using Exonuclease IIl 1. To the nicked DNA from procedure 7, add NaC1 to a concentration of 120 mM (3/zl of a 5 M solution for the AvaInicked and 6/zl for the NciI-nicked DNA) Exonuclease III, 300 units 2. Briefly vortex and spin down the solution. 3. Incubate at 37° for the time period required to gap at least several hundred bases past the mismatch. 4. Heat inactivate the exonuclease at 70° for 15 min and place directly into a 37° heating block for 20 min. 5. Remove an 8-/M sample for gel analysis (see Fig. 2) and place on ice. Repolymerization. The DNA resulting from either gapping procedure described above must be repolymerized to the double-stranded form to obtain high transformational efficiencies. Even exhaustive gapping with either T7 exonuclease or exonuclease III leaves a small stretch of doublestranded DNA that can be used as the primer for repolymerization. Obviously, the mutant DNA strand is used as a template for the reaction resulting in the formation of a mutant homoduplex.

Procedure 10: Formation of Mutant Homoduplex I. To the gapped DNA solution prepared as described above, add

E. coli DNA polymerase I (not the Klenow fragment), l0 units dNTP mix (4 x ), 5/zl ATP (10 raM), 20/zl T4 DNA ligase, 10 units 2. Incubate at 16° overnight or at 37° for 2 hr. 3. Remove a 14-/zl sample for gel analysis (see Fig. 2).

Transformation of Competent Cells As mentioned previously, special cell lines are not required for transformation when using the phosphorothioate-based mutagenesis method. We

204


[13]

recommend the cell lines SMH503° or TG1, 31 because they yield consistently high transformational efficiencies even if little or no RFIV DNA is visible by agarose gel electrophoresis after repolymerization. A transfection protocol is described for competent cells prepared by the CaC12 method (see procedure 11). There are a number of other transformational protocols available. 32'33 In some instances the presence of nucleoside triphosphates can result in low plaque yields. 34 This may be countered by purification of the DNA by precipitation or 35 one-step spun-column chromatography. 36

Procedure 11: Preparation of Competent Cells 1. Add 3 ml of an overnight culture (see procedure 1) to 100 ml of sterile 2YT medium in a 250-ml flask. 2. Incubate in a shaker at 37° until the A660 is 0.6 ( ~ 1 hr). 3. Transfer cells to suitable sterile centrifuge tubes, cap, and spin at -3000 g for 15 min at 4 °. 4. Discard the supernatant and resuspend the cells in a total volume of 50 ml prechilled sterile 50 mM CaCI2 solution. 5. Leave on ice for 30 min. Centrifuge as in step 3. 6. Discard the supernatant and resuspend the cells in a total volume of 20 ml prechilled sterile 50 mM CaCI2 solution. 7. The cells can be used for 1 week if stored at 4 °. 8. For long-term storage of the competent cells, take 10 ml of the competent cells and mix gently with 2 ml of 87% (v/v) glycerol (sterilized by autoclaving). 9. Portion the cells (300/~1), using a wide-bore disposable pipette, into sterile polypropylene tubes and quick freeze using liquid nitrogen. Store at - 80 °. The frozen cells can be used for several months without a serious decrease in transformational ability. 30 j. E. LeClerc, N. L. Istock, B. R. Saran, and R. Allan, J. Mol. Biol. 180, 217 (1984). 31 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 32 D. Hanahan, in " D N A Cloning: A Practical Approach" (D. M. Glover, ed.), p. 109. IRL Press, Oxford, England, 1985. 33 C. T. Chung, S. L. Niemela, and R. H. Miller, Proc. Natl. Acad. Sci. U.S.A. 86, 2172 (1989). 34 A. Taketo, J. Biochem. (Tokyo) 75, 895 (1974). 35 T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual," p. 461. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 36 T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual," p. 466. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982.

[13]


205

Procedure 12: Transformation of Escherichia coli with the Mutated DNA 1. Place 5 sterile polypropylene tubes containing 3-ml portions of B-broth soft agar in a 55 ° water bath. 2. Place a tube containing 300/~1 of competent cells (procedure 11) on ice. 3. Dilute 20/zl repolymerized DNA with 30/A sterile H20. 4. Add 2-, 5-, 10-, and 20-/~1 aliquots of diluted DNA to the competent cells. 5. To the fifth tube make a mock transfection with 20 tzl sterile H20 used in diluting the DNA. Swirl the tubes gently to mix the contents and place on ice for - 3 5 min. 7. Combine 1400/zl flesh cells with 280/zl IPTG solution and 280 tzl X-Gal solution. 8. To each aliquot of transformed competent cells (from steps 4 and 5) add 270/xl of fresh cell mix from step 7. 9. Add 3 ml top agar to each tube and pour immediately onto plates prewarmed to 37 °. Allow to set and invert. 10. Incubate overnight at 37°. 11. Pick two to five plaques and prepare single-stranded DNA for direct genotypic screening of mutants by DNA sequencing. .

Principle of Phosphorothioate-Based Plasmid Mutagenesis Method As stated in the introduction, the phosphorothioate-based mutagenesis method has been extended to double-stranded or plasmid DNA vectors. 10 This is an important extension of the previous protocols because the user now avoids time-consuming subcloning steps of the gene of interest into a M13 type single-stranded DNA vector. 22 Alternatively, subcloning may also be avoided if the gene is present in a phagemid vector. 14 However, working with these constructs may require prior experience to obtain single-stranded DNA suitable for mutagenesis. The plasmid mutagenesis method is based on the creation of a specific region of single-stranded DNA to which a mismatch oligonucleotide can anneal. A strand asymmetry is created on polymerization by the specific incorporation of phosphorothioate internucleotidic linkages in a certain region of the DNA. A subsequent step using a restriction endonuclease that is unable to hydrolyze phosphorothioates containing DNA removes all the remaining wild-type DNA. Mutational efficiencies using this protocol have reached those obtained with high-efficiency methods for singlestranded DNA.

Mutatio~~HindIII Pst l

Site

A

~ HindIII/Ethidium Bromide

3"

BOQ O® cQQ ExonucleaseIII O

~

Productivelygapped

1. Add mismatch primer ~ e D 2. "1"7DNA polymerase dGTP(zS mix 3. T4 DNA Ligase Pst I

Pst I

o00

Pst l

.4--- Mutant Heteroduplex

I Pstl nicking/linearization

0 I Q

T7 Exonuclease

F

~

E . c o / i DNA Polymerase I 4 dNTPs,T4 ligase, ATP

G

Q

Transform Competent Cells

~

MutantHomoduplex

[13]


207

Plasmid Mutagenesis Strategy Scheme II outlines one combination of enzymatic reactions that can be used for the mutagenesis of double-stranded DNA. The first step involves the site-specific nicking of the vector in the vicinity of the desired mutation (Scheme IIB). This reaction, which is not strand specific, is accomplished by incubation of the plasmid DNA with a restriction endonuclease in the presence of ethidium bromide. The nick can be used as the starting point for digestion by a nonprocessive exonuclease such as exonuclease III (Scheme IIC). Two differently gapped products are obtained, depending on which strand contains the nick. We have designated the DNA species that has a small stretch of single-stranded DNA complementary to the synthetic mutant oligonucleotide as "productively gapped." After strand-selective hybridization of the primer to the "productively gapped" DNA, the surrounding gaps are filled in by polymerization using T7 DNA polyrnerase, three dNTPs, and one dNTPaS. As with the single-stranded mutagenesis method described above, the choice of dNTPaS is dependent on the restriction enzyme to be used in the following step (Scheme liD). As shown, the desired mutation is present as a heteroduplex in only one of the various plasmid DNA species present after polymerization. The introduction of phosphorothioate groups into the mutant strand during the polymerization step allows for strand selection, which is required for highly efficient plasmid mutagenesis. Subsequent reaction with a restriction endonuclease such as PstI (Scheme IIE), which is unable to cleave phosphorothioate-containing DNA (Table I), hydrolyzes all the wild-type DNA in solution. This includes the linearization of roughly 50% of the DNA population that was not "productively gapped." In contrast, the heteroduplex DNA containing phosphorothioates in the mutant strand at the recognition site of PsiI is only nicked. This situation is very similar to the mutagenesis procedure described above. The nick is again used as the starting point for exonuclease digestion (Scheme IIF). The mutant

SCHEME II. Schematic of the oligonucleotide-directed plasmid mutagenesis technique. (A) Plasmid DNA site of mutation and several convenient restriction endonuclease sites; (B} products from HindIII/ethidium bromide nicking reaction; (C) products of limited exonuclease III digestion; (D) the mutant heteroduplex after annealing of the mutant oligonucleotide and polymerization; (E) products from PstI nicking/linearization reaction; (F) products after T7 exonuclease digestion of the wild-type DNA; (G) repolymerized mutant homoduplex. O, Mismatch bases within the mismatch oligonucleotide. Heavy lines indicate the area where phosphorothioates have been incorporated. The plasmids that have been linearized are crossed off because they transform inefficiently.

208


[13]

FIG. 3. Analysis of pUC19 plasmid mutagenesis intermediates by 2% (w/v) agarose gel electrophoresis.

strand is then used as a template for repolymerization, resulting in the formation of a mutant homoduplex species carrying the desired changes in both strands (Scheme IIG). Figure 3 shows the agarose gel electrophoretic results after each stage of a typical plasmid mutagenesis experiment. The novice should compare results after each stage of the procedure with the results presented in Fig. 3.

Preparation of Plasmid DNA The purity of the plasmid DNA is very important for the successful completion of the mutagenesis protocol. There are two important variables that we have found to decrease mutational efficiencies significantly. First, the plasmid preparation should be free of large amounts of concatemeric DNA. If this is a problem, the plasmid can be grown in a RecA- strain of E. coli such as JM109. Second, small amounts of RNA that remain after many typical plasmid isolation procedures (including CsC1 centrifugation) must bc removed. In our hands plasmid DNA isolated according to the Qiagen plasmid DNA maxipreparation procedure is of sufficient purity for use without further manipulation.

[13]


209

Preparation of Mutant Heteroduplex

Site-Specific Restriction Endonuclease/Ethidium Bromide Nicking of Plasmid To create a stretch of single-stranded DNA to which the mutant oligonucleotide can anneal, the double-stranded DNA must be nicked in a region near the site of mutation. Although it is unimportant if the nicking site is upstream or downstream from the mutation site, it is advantageous if it is within several hundred base pairs so that subsequent digestion by the exonuclease does not have to proceed very far. Nicking can be carried out by incubation of the DNA with one of a number of restriction endonucleases that is unable to cleave both strands of DNA when incubated in the presence of ethidium bromide. 10,37-41Procedure 13 outlines the protocol for nicking plasmid DNA with the restriction enzymes HindlII and EcoRI. The use of these enzymes should be most universal because they are found at either the upstream or downstream end of a number of different multiplecloning sites in popular plasmid vectors. The protocol requires a large amount of plasmid DNA, which allows convenient monitoring of each enzymatic reaction by agarose gel electrophoresis. The amount of DNA and reaction volumes can be scaled down if desired. If one of the restriction enzymes mentioned above does not have a site, or is present at multiple positions, within the vector to be mutated then nicking conditions must be determined for another enzyme. Normally, it is a simple process to find proper nicking conditions with alternative restriction endonucleases. Almost all restriction endonucleases cleave two strands of double-stranded DNA in a stepwise fashion. It is believed that the decrease in enzyme-catalyzed hydrolysis of the second strand in the presence of ethidium bromide is due to the intercalation of the dye into the relaxed DNA. The delay between scission of the two strands can be optimized by testing several reaction conditions using suboptimal salt, pH, and/or temperature conditions for the enzyme and 10-100 tzg/ml ethidium bromide. It is advisable to use an endonuclease that does not 37 G. Dalbadie-McFarland, L. W. Cohen, A. D. Riggs, C. Morin, K. Itakura, and J. H. Richards, Proc. Natl. Acad. Sci. U.S.A. 79, 6409 (1982). 38 M. Osterlund, S. Luthman, S. V. Nilsson, and G. Magnusson, Gene 20, 121 (1982). 39 R. C. Parker, R. M. Watson, and J. Vinograd, Proc. Natl. Acad. Sci. U.S.A. 74, 851 (1977). 4o D. R. Rawlins and N. Muzyczka, J. Virol. 36, 611 (1980). 4i D. Shortle and D. Nathans, Proc. Natl. Acad. Sci. U.S.A. 75, 2170 (1978).

210


[13]

exhibit star activity under adverse buffer conditions. 42 It is not important to nick 100% of the plasmid DNA because any unreacted DNA will be destroyed in a later step.

Procedure 13: Nicking of Plasmid DNA 1. Add the following reagents to a 1.5-ml sterile microcentrifuge tube: Plasmid DNA (Qiagen purified), -20/.tg Buffer D (10×), 24/zl Ethidium bromide solution (500/.Lg/ml), 20/zl HindlII, 200 units 2. 3. 4. 5.

Adjust the volume to 240/xl using sterile distilled H20. Briefly vortex and spin down the solution. Incubate at 30 ° for 60 min. Remove 2/zl for agarose gel electrophoresis (see Fig. 3).

Alternatively, the DNA can be nicked using EcoRI with the conditions given below. 1. Combine the following reagents: Plasmid DNA, -20/.tg EcoRI nicking buffer (10 × ), 26/zl Ethidium bromide (500/zg/ml), 72/zl EcoRI, 600 units 2. 3. 4. 5.

Adjust the volume to 260 txl using sterile distilled H20. Briefly vortex and spin down the solution. Incubate at 16° for 15 hr. Remove 2/xl for agarose gel electrophoresis (see Fig. 3).

Successful nicking of the plasmid should result in greater than 50% nicked DNA as determined by agarose gel electrophoresis (e.g., see Fig. 3). It may be necessary to increase or decrease the amount of enzyme in the reaction. After the nicking reaction is complete the enzyme and ethidium bromide must be removed. This is accomplished by phenol extraction followed by spin dialysis using a Centricon-100 (Amicon, Danvers, MA) microconcentrator (procedure 14). 42 A l t h o u g h the restriction e n d o n u c l e a s e E c o R I is k n o w n to exhibit star activity, it has been s h o w n that w h e n Co 2+ is u s e d as the metal cofactor, the e n z y m e exhibits very stringent substrate specificity. 43 43 j. L. W o o d h e a d , N. Bhave, and A. D. B. Malcolm, Fur. J. Biochem. 115, 293 (1981).

[13]


211

Procedure 14: Extraction and Spin Dialysis 1. Add 200/~l buffer-equilibrated phenol and vortex vigorously for 30 see.

2. Briefly spin the tube and remove the aqueous top layer with a pipette. 3. Repeat steps 1 and 2 using 200 t*1 H20 saturated chloroform/isoamyl alcohol (24 : 1). 4. Repeat steps 1 and 2 using 1 ml H20 saturated diethyl ether. 5. Remove the final traces of ether by heating the tube with the cap open at 37° for 10 min. 6. Dilute the sample with 2 ml of distilled sterile H20. 7. Add the sample to a Centricon-100 and spin for 20 min at 1000 g with a Sorvall SS34 fixed angle rotor at room temperature. 8. Repeat steps 6 and 7 two more times. 9. Collect the sample, and transfer solvent-containing DNA (50-60 >1) to a sterile 1.5-ml microcentrifuge tube.

Preparation of Single-Stranded Gap to Which Mutant Oligonucleotide Can Anneal The DNA is now prepared for reaction using a 3' --~ 5' nonprocessive exonuclease that will gap the nicked DNA in a defined direction. The size of the gap must encompass not only the site to which the mutant oligonucleotide is to anneal, but it must also gap past the second restriction endonuclease site. A nonprocessive exonuclease (one in which the time of incubation determines the number of hydrolyzed bases) is required so that on repolymerization phosphorothioate residues are incorporated into distinct regions of the DNA. The protocol for gapping using the enzyme exonuclease III is given below. Alternatively, the 5' ~ 3' activity of T5 exonuclease can also be used for this step 44 and this enzyme will be commercially available in the near future from Amersham and United States Biochemicals.

Procedure 15: Gapping with Exonuclease III 1. Adjust the volume of the solution to 80/~1 with H20 and add Buffer C (10 × ), 10/~1 NaCI (1 M), 4/~1 Exonuclease III, 100 units 2. Briefly vortex and spin down the solution. 44 j. R. Sayers and F. Eckstein, Nucleic Acids Res. 19, 4127 (1991).

212


[13]

3. Incubate at 37° for the time required for digestion past the mismatch and the second restriction enzyme site. 45 4. Remove 2/zl for agarose gel electrophoresis (see Fig. 3). It is important that the products of the gapping reaction are checked by agarose gel electrophoresis. Digestion of the DNA should not proceed to such an extent that on repolymerization, phosphorothioate residues are incorporated into the wild-type strand in the vicinity of the second restriction endonuclease site. This will protect the unwanted wild-type DNA from hydrolysis, resulting in a decrease in mutational efficiency. In general, there should be a distinct increase in mobility of the gapped DNA when compared to a marker of the nicked DNA sample. Figure 3 shows an example of a T5 exonuclease-gapped pUC19 plasmid in which several hundred bases were removed.

Annealing of Mutant Oligonucleotide The oligonucleotide sequence will determine the type of mutation (point mutation, insertion, or deletion; see discussion above). Mutagenesis with plasmid DNA has two strands to which the mutant oligonucleotide can potentially anneal. Therefore, careful consideration must be given to the sequence of the oligonucleotide because it is dependent on the directionality of the exonuclease employed (procedure 15) and whether the initial nicking of the plasmid occurred upstream or downstream of the site of mutation (Scheme III). Before the oligonucleotide can be annealed to the gapped plasmid (procedure 16) it must be phosphorylated (procedure 3). One advantage of the plasmid mutagenesis procedure is that nonspecific binding of oligomer to target DNA is decreased because only a portion of the plasmid remains double-stranded after exonuclease digestion.

Procedure 16: Annealing of Mutant Primer to Single-Stranded Region of Plasmid 1. Add the following reagents to the solution containing the gapped DNA: NaCI (1 M), 10/xl Two to three molar equivalents of phosphorylated primer (procedure 3) with respect to the amount of plasmid DNA 2. Briefly vortex and spin down the solution. 45 See p r o c e d u r e 9 for information regarding the time of the gapping reaction using exon u c l e a s e III.

[13]

213

HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS EcoRI

Mutation Site

Hind ll

,a,

Ethidium Mutation Site

B

Bromide

5'

Mutation Site

5'

Limited Exonudease III gapping

C

5'

5'

3'~

~

3" Anneal mutant oligomer

D 5' 3'===

~

~

5'~= 3'

oligo A A

oligo B

SCHEMEIII. Representation of two differently gapped plasmid species, both of which were "productively gapped" using exonuclease IIl. Downstream (HindIII) or upstream nicking (EcoRI) can dictate the proper sequence of the mutant oligonucleotide (either A or B) required for the production of the same genotypic change. The lettering is the same as for the steps in Scheme II. The DNA species can be nicked either upstream or downstream of the site of mutation (B). Subsequent gapping using the 3' ~ 5' activity of exonuclease III leaves two different DNA species (C). The proper mutant oligonucleotide (primer A or primer B) is required to anneal to the single-stranded DNA region.

3. I n c u b a t e at 70 ° for 10 m i n a n d t h e n p l a c e the t u b e into a 56 ° h e a t i n g b l o c k a n d cool s l o w l y to 37 ° o v e r - 3 0 min.

Polymerization Reaction T h e g a p p e d D N A is filled in u s i n g n a t i v e T7 D N A p o l y m e r a s e , t h r e e d N T P s , and one d N T P ~ S analog. The choice of nucleoside phosphorothioate is d e p e n d e n t o n the r e s t r i c t i o n e n d o n u c l e a s e u s e d in the n e x t step. W e s u g g e s t u s i n g dGTPo~S in c o m b i n a t i o n with PstI.

214


[13]

An improvement in the plasmid mutagenesis procedure is the use of T7 DNA polymerase for the creation of the mutant heteroduplex. This enzyme does not strand displace the mutant oligonucleotide on polymerization even when used at 37°. Products of the reaction should be checked by agarose gel electrophoresis. There should be a new DNA band that migrates differently than the supercoiled plasmid DNA marker on the gel. The polymerized DNA must be separated from the salt, nucleotides, and enzyme before being nicked.

Procedure 17: Preparation of Mutant Heteroduplex 1. Add the following reagents to the sample solution: Buffer A (10 × ), 21/xl dGTPaS mix, 20 t~l ATP (10 mM), 20 t~l T7 DNA polymerase, 10 units T4 ligase, 15 units 2. Add sterile distilled H20 to bring the volume to 210/xl. 3. Briefly vortex and spin down the solution. 4. Incubate at 37 ° for 2 hr. 5. Remove 6/.d for agarose gel electrophoresis (see Fig. 3). 6. Repeat procedure 14 to prepare the DNA for the nicking/linearization reaction. Preparation of Mutant Homoduplex

Strand-Selective Hydrolysis of Wild-Type DNA The dGMPS-containing DNA is now ready for the strand-selective nicking/linearization reaction catalyzed by PstI (procedure 18). There are a number of other restriction endonucleases that can be used for this step 8'16-19 (see Table I) as long as the enzyme chosen has its recognition site(s) located within the region protected by phosphorothioate groups in the mutant strand. As seen in Scheme II, reaction with PstI will linearize roughly 50% of the DNA in solution. Therefore, analysis by agarose gel electrophoresis should reveal a large amount of linear DNA as well as a nicked plasmid product. Most importantly, there should be no trace of covalently closed circular DNA seen on the gel.

Procedure 18: Pst! Nicking and Linearization Reaction 1. After extraction and spin dialysis, bring the volume to 85/xl with sterile HzO and add

[13]


215

Buffer D (10 x ), 10/~1 PstI, 70 units 2. 3. 4. 5.

Briefly vortex and spin down the solution. Incubate at 37° for 80 min. Remove 3/xl for agarose gel electrophoresis (see Fig. 3). Repeat extraction and spin dialysis (procedure 14). 46

Exonuclease Digestion of Mutant Heteroduplex Wild-Type Strand The nicked DNA is gapped most efficiently using T7 exonuclease and the conditions given in procedure 19. This enzyme is very processive and will digest virtually the entire wild-type strand after short incubation periods. In many cases it is not possible to observe the fully gapped product after reaction by agarose gel electrophoresis (compare with Fig. 3) because of the poor ability of DNA to bind ethidium bromide (because it is essentially single-stranded DNA). It is possible, however, to see that the nicked and linear DNA resulting from procedure 19 has been digested when compared to the DNA analyzed after PstI nicking. In some instances, where the nick is downstream to the mutation in the wild-type strand, the user may use exonuclease III for this step. 10However, we have obtained the most reproducible results using T7 exonuclease.

Procedure 19: Gapping of Nicked Mutant Heteroduplex 1. Adjust the volume of the solution to 90/xl with H20 and add Buffer C (10 x ), 10/zl T7 exonuclease, 100 units 2. Briefly vortex and spin down the solution. 3. Incubate at 37° for 30 min. 4. Heat inactivate the enzyme by incubation at 70° for 10 min and place directly into a 37° heating block for 20 min. 5. Remove 10/.d for agarose gel electrophoresis (see Fig. 3). In theory, the gapped DNA could be used directly to trasnsform competent cells because the wild-type DNA has been almost completely hydrolyzed. However, we have observed an increase in mutational efficiency of up to 20% if the DNA is first repolymerized with E. coli DNA polymerase I, 46 It is important to repeat the extraction/dialysis procedure after PstI nicking because this enzyme binds tightly to the nicked phosphorothioate-containing DNA, which can inhibit exonuclease digestion?

216


[13]

TABLE II TROUBLE-SHOOTING FOR MUTAGENESISOF SINGLE-AND DOUBLE-STRANDED DNA VECTORS Problem

Possible causes

Polymerization results in RFII DNA

Nonspecific priming by mutant oligonucleotide Inactive ligase

Incomplete nicking by the restriction endonuclease Restriction endonuclease reaction results in linearization of the DNA

Restriction endonuclease activity too low

Incomplete nicking of plasmid

Restriction endonuclease activity too low

No cccDNA observable by agarose gel electrophoresis after repolymerization

Low product yield DNA was destroyed during exonuclease reaction

False restriction endonuclease/ dNTPaS combination Restriction enzyme site in mutant oligonucleotide sequence

Remedy Decrease primer concentration Check enzyme and ATP concentrations Increase incubation time or enzyme concentration Check Table I for correct dNTPc~S/restriction enzyme combination Choose another restriction enzyme or protect site in the oligonucleotide with phosphorothioatecontaining oligomer (see text) Increase enzyme concentration or reaction temperature Attempt transformation Repeat procedure using fresh gapping buffer and new batch of T7 exonuclease

f o u r n o r m a l d N T P s , A T P , a n d T4 ligase. 10 T h e n i c k - t r a n s l a t i o n a c t i v i t y o f t h e p o l y m e r a s e m i g h t r e m o v e s o m e D N A still b o u n d to t h e m u t a n t o l i g o n u c l e o t i d e a f t e r e x o n u c l e a s e d i g e s t i o n , w h i c h c o u l d a c c o u n t for t h e i n c r e a s e in m u t a t i o n a l e f f i c i e n c i e s .

Procedure 20: Preparation of Mutant Homoduplex 1. A d d t h e f o l l o w i n g r e a g e n t s to t h e s o l u t i o n c o n t a i n i n g the g a p p e d DNA: B u f f e r A (10 x ), 5 ~1 D N A p o l y m e r a s e I, 10 u n i t s 4 x dNTP Mix, I0/zl A T P (10 m M ) , 2 0 / x l T4 D N A l i g a s e , 15 units 2. A d d s t e r i l e d i s t i l l e d H 2 0 to b r i n g t h e v o l u m e to 220/~I. 3. Briefly v o r t e x a n d s p i n d o w n t h e s o l u t i o n .

[ 13]

HIGH-EFFICIENCY SITE-DIRECTEDMUTAGENESIS

217

4. Incubate at 37° for 3 hr. 5. Remove 14 p,l for agarose gel analysis (see Fig. 3). 6. Remove 2 tzl for transformation of competent cells (procedure 21). Transformation of Competent Cells It is sometimes difficult to observe a band corresponding to covalently closed circular plasmid DNA. We recommend that a sample of the DNA be transformed nonetheless. The competent cells prepared according to procedure 11 can be used for the transformation with the mutated DNA according to procedure 21. Procedure 21: Transformation o f Competent Cells

1. Place tube containing 100 /zl of competent cells, prepared as in procedure 11, on ice. 2. Add at least 2/zl of repolymerized DNA from procedure 20, mix gently, and place on ice for 10-40 min. 3. Add 300/zl 2YT medium and shake at 37° for 60 min. 4. Take 2, 10, and 80/zl and spread onto agar plates containing the appropriate antibiotic selection marker. 5. On another plate spread 10/zl of competent cells that have not come in contact with any DNA. 6. Incubate the plates overnight at 37° and pick two to five colonies for DNA characterization. Troubleshooting One advantage of performing in vitro site-directed mutagenesis is that each step of the procedure may be conveniently analyzed by agarose gel electrophoresis. We recommend that the novice check the products after each enzymatic reaction before proceeding to the next step. Figures 2 and 3 give examples of how the different DNA species should appear after agarose gel analysis. It is important to run the gels in the presence of ethidium bromide and 2-mercaptoethanol because these compounds increase resolution as well as the stability of the DNA. 7'47 Table II gives a brief summary of potential pitfalls that might become evident after electrophoretic analysis. Acknowledgments We kindlyexpress our appreciationto A. Fahrenholzand A. Kroggelfor expert technical assistance and to R. Mackinfor critical reading of the manuscript. 47B. V. L. Potter and F. Eckstein,J. Biol. Chem. 259~ 14243 (1984).

218

MUTAGENESISAND GENEDISRUPTION

[14]

[14] P o l y m e r a s e C h a i n R e a c t i o n - B a s e d Point Mutagenesis Protocol

By L.-J.

ZHAO,

Q. X.

ZHANG,

and R. PADMANABHAN

Introduction Since its inception in 1985, the polymerase chain reaction I (PCR) has become an extremely useful technique in molecular biology. Its use ranges from clinical diagnostics to structure and functional studies involving sitedirected mutagenesis. The PCR involves the selective amplification of a segment of DNA template flanked by two synthetic complementary oligodeoxynucleotide primers by repeated cycles of three basic steps: heat denaturation of the template DNA, annealing of the primers to the template to form stable duplexes, and extension of the 3' ends of the primers by a DNA polymerase. Each new cycle of PCR amplification gives rise to twice the number of copies of the template DNA from the previous cycle as a result of annealing and extension of these primers by DNA polymerase. Thus the region between the two primers is amplified exponentially by approximately 2n-fold, where n is the number of cycles. 1,2Initially, Escherichia coli DNA polymerase I (Klenow fragment) was used for DNA synthesis from the annealed primers,3 but was replaced later by the thermostable DNA polymerase from Thermus aquaticus (Taq), which allowed the automation of this amplification method. One of the powerful applications of the PCR is in site-directed mutagenesis protocol to carry out the structural and functional analysis of genes encoding proteins or regulatory elements. Deletions, insertions, and point mutagenesis can be carried out using the PCR. Previous methods for deletion mutagenesis involve the wide use of either BAL 31 nuclease, which progressively shortens a double-stranded DNA fragment from both the 5' and 3' ends, or exonuclease III, which digests the target DNA from the 3' ends. The latter method can be applied to digest target DNA unidirectionally. 4 The extent of digestion in both cases is controlled by incubation time or the temperature of the reaction or both. Before the i R. K. Saiki, D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich, Science 239, 487 (1988). 2 K. B. Mullis and F. A. Faloona, this series, Vol. 155, p. 335. 3 R. K. Saiki, S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. A r n h e i m , Science 230, 1350 (1985). 4 S. Henikoff, Gene 28, 351 (1984).


Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.

[14]

PCR-BASED POINT MUTAGENESIS PROTOCOL

219

advent of the PCR technique, the insertion mutagenesis method commonly involved the ligation of synthetic restriction site linkers to the target DNA linearized by partial digestion with nonspecific deoxyribonuclease I (DNase I) in the presence of Mn 2÷ . An alternate method for obtaining linear DNA is by digestion with a restriction enzyme having a tetranucleotide recognition site in the presence of ethidium bromide. 5,6The insertional mutagenesis is random when DNase I is used, or limited to those regions containing the restriction sites on the target DNA. Several methods have been described to introduce point mutations along the segment of DNA. 6 These methods include mutagenesis by (1) treatment with sodium bisulfite, which deaminates deoxycytidine to deoxyuridine, resulting in the substitution of an A : T base pair for a G : C base pair in approximately 50% of the template molecules after one round of replication, 7'8 (2) enzymatic incorporation of nucleotide analogs,9 or misincorporation of normal nucleotides or ct-thionucleotide l°'~t by DNA polymerases. Oligo-directed mutagenesis has been extremely useful to generate deletion, insertion, and point mutations at preselected sites on the DNA molecule. Prior to mutagenesis, the target DNA is cloned into an M13 vector so that singlestranded wild-type DNA template can be produced. The oligo mutagen is then annealed to this template, producing a noncomplementary (looped out) region on the oligo primer or on the template, resulting in an insertion or a deletion, respectively. A third possibility is a base pair mismatch between the template and the primer in the case of point mutagenesis. Although these methods are efficient, they are still time consuming because of the number of steps involved, such as cloning of the target DNA into an MI3 vector, screening for the mutants by DNA sequence analysis, and recloning of the mutant DNA segments back into the parent plasmid for functional studies. On the other hand, the PCR-based mutagenesis methods 12-16 are simple and rapid compared to the more conventional methods described above.

5 R. C. Parker, R. M. Watson, and J. Vinograd, Proc. Natl. Acad. Sci. U.S.A. 74, 851 (1977). M. Smith, Annu. Rev. Genet. 19, 423 (1985). 7 D. Shortle and D. Nathans, Proc, Natl. Acad. Sci. U.S.A. 75, 2170 (1978). 8 D. Botstein and D. Shortle, Science 229, 1193 (1985). 9 W. Mueller, H. Weber, F. Meyer, and C. Weissmann, J. Mol. Biol. 124, 343 (1978). to R. A. Zakour and L. A. Loeb, Nature (London) 295, 708 (1982). tt D. Shortle, P. Grisafi, S. Benkovic, and D. Botstein, Proc. Natl. Acad. Sci. U.S.A. 79, 1588 (1982). t2 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res, 16, 7351 (1988). t3 F. Vallette, E. Mege, A. Reis, and M. Adesnik, Nucleic Acids Res. 17, 723 (1989). 14 H. Kadowaki, T. Kadowaki, F. E. Wondisford, and S. 1. Taylor, Gene 76, 161 (1989).

220


[14]

We have utilized this PCR-mediated point mutagenesis protocol to analyze the function of the nuclear localization signal (NLS) domain in the 140-kDa adenovirus DNA (AdPol) that is required for replication of the adenovirus genome. AdPol contains three clusters of basic amino acids (R8ARR, R25RRVR, and R41ARRRR, BS I-III) which resemble the NLS domain of the simian virus 40 (SV40) large T antigen type, and therefore could potentially be involved in the nuclear targeting of AdPol or the heterologous cytoplasmic protein, E. coli fl-galactosidase (fl-Gal). 17 To examine the contribution of the basic amino acids in each cluster and the interactions between these positively charged regions in the nuclear targeting function, the PCR point mutagenesis protocol described here was used to introduce mutations into BS I-BS III (Fig. 1). Principle of Method To analyze the function of a DNA segment, either encoding a protein or a regulatory region, saturation mutagenesis in a defined region is a useful experimental approach to examine the contribution of the defined region to the overall function. It is also important that point mutations could be introduced at will along any stretch of DNA without the necessity of having convenient restriction sites in close proximity to the mutagenesis site. In the methods described to date for point mutagenesis by the PCR, the desired mutation is incorporated into one of the oligo primers. Amplification between the normal and mutant primers gives rise to the desired mutant DNA fragment. One drawback of this approach is that it requires one mutant oligo for each desired point mutation. Moreover, in cases in which the mutational analysis of a region of DNA is exploratory due to a lack of information regarding its function, it is best to produce several nucleotide substitutions at defined regions in the target DNA in a minimum number of steps. In the PCR mutagenesis protocol described here, mixedsite oligo in which the mutations are preselected along the length of a mutagenic oligo primer are chemically synthesized and used for the PCR to give rise to a mixture of PCR-generated mutant DNA fragments. To carry out functional analysis of mutations, the mutant fragment needs to be substituted for the wild-type fragment in the plasmid. To achieve this aim, the double-stranded mutant DNA fragments obtained in the first PCR were used as primers for amplification on wild-type templates. Different 15 M. Kammann, J. Laufs, J. J. Schell, and B. Gronenborn, Nucleic Acids Res. 17, 5404 (1989). 16 S. N. Ho, D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease, Gene 77, 51 (1989). 17 C. Dingwall and R. A. Laskey, Annu. Rev. Cell Biol. 2, 367 (1986).

[14]

221


A oligo

#i BS M

A

L

V

Q

A

H

R

A

I R

R

L

H

A

E

CCATG-GCC-CTT-GTT-CAA-GCT-CAC-CGG-GCC-CGT-CGT-CTT-CAC-GCA-GAG-GCG GGTAC-CGG-GAA-CAA-GTT-CGA-GTG-GCC-CGG-GCA GCA GAA-GTG-CGT-CTC oligo

A

CGC

13

GCC-CGG-GCA-GCA-GAA-GT T T BS P

D

S

G

D

Q

P

P

R

R

II R

V

R

Q

Q

P

P

R

A

CCA-GAT-TCA-GGA-GAT-CAA-CCG-CCG-CGT-CGT-CGC-GTT-CGC-CAG-CAA-CCT-CCG-CGC-GCA GGT-CTA-AGT-CCT-CTA-GTT-GGC-GGC-GCA-GCA-GCG-CAA-GCG-GTC-GTT-GGA-GGC-GCG-CGT GC-GGC-GCA-GCA-GCG-CAA T T T Oligo BS A

P

A

P

A

R

A

R

GC

14

III R

R

R

A

P

A

P

S

P

GCA-CCA-GCT-CCT-GCC-CGC-GCG-CGG-CGC-CGA-CGT-GCC-CCT-GCC-CCC-TCT-CCC CGT-GGT-CGA-GGA-CGG-GCG-CGC-GCC-GCG-GCT-GCA-CGG-GGA-CGG-GGG-AGA-GGG GG-GCG-CGC-GCC-GCG-GCT-GCA-CGG-GGA-CGG-GGG-AGA~GGG A A T A T A A A

Oligo

15

B #13 Ncol

#14

I-En--I ----

#5

~

[

# 15

# 6 ~,

BSIH

]

PCR ~mplate

Kpnl

I

] I st PCR products :# 8¢ - - - - - . ~

I

-]

I I

2nd PCR products

I Cloning and sequenceanalysis

KpnI

FIG. 1. (A and B) Two-step PCR point mutagenesis strategy. The application of this mutagenesis method is to analyze the function of three clusters of basic amino acids (BS I-III) in the N-terminal region of adenovirus DNA polymerase. 2° (A) The first-step PCR was carried out between oligo 1 as primer 1, and oligo 13, 14, or 15 as primer 2 for mutagenesis of BS I, BS II, or BS III, respectively. (B) The second PCR was carried out initially by using the first PCR product as primers, and later by the addition of oligo 1 as primer 1, and oligo 5 or 6 as primer 2. The plasmid template (pGZ1) used for PCR contained the full-length coding sequence of adenovirus DNA polymerase.

222


[14]

primers were then added for the second PCR step. These primers contained sequences flanking two convenient restriction sites on the wildtype plasmid template (Fig. 1B). It was found that this two-step PCR mutagenesis method was effective in introducing multiple mutations in a defined region preselected by mixed-site mutagenic oligodeoxynucleotides. Materials and Reagents The reagents for PCR were purchased from Perkin-Elmer-Cetus (Norwalk, CT) as a kit. Escherichia coil (HB101 or DH5 strain) was used for all plasmid transformations. Triton X-100 was from Sigma Chemical (St. Louis, MO). The deoxynucleoside triphosphates used initially were from the PCR kit; in later experiments they were purchased from Pharmacia (Piscataway, N J). Oligo primers were synthesized using BioSearch model 8600 (Milligen,Burlington,MA). Reagents for the synthesis of DNAprimers were purchased as kits from MilliGen Biosearch. Mixed-site oligo primers were synthesized using the automatic mixed-site capability of the DNA synthesizer. During the coupling step, each monomer is alternately sampled and mixed before arriving at the column. The PCR was carried out using the thermocycler from Coy Laboratory Products (Ann Arbor, MI) and in later experiments using the GeneAmp instrument (Perkin-ElmerCetus). Screening the mutants was done by DNA sequencing of the recombinants using the DNA isolated from 4-ml cultures. 18The DNA sequencing was carried out by the dideoxy chain termination method of Sanger, using T7 DNA polymerase (Sequenase; U.S. Biochemicals, Cleveland, OH) from a kit.

Polymerase Chain Reaction Mutagenesis Method First Polymerase Chain Reaction Step. This mutagenesis strategy involves a two-step PCR amplification, cloning, and screening the mutants by DNA sequence analysis. The first-step PCR was initiated between wildtype oligo 1,5'-CGCCATTTGACCATTCACCA-3', corresponding to nucleotides 20-40 in pRSV-LTR vector, 19and either mixed-site oligo 13 (for BS I), oligo 14 (for BS II), or oligo 15 (for BS III) (see Fig. 1) to give rise to mutant PCR products that were amplified on the wild-type PCR template 18 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 19 C. Gorman, G. Merlino, M. Willingham, I. Pastan, and B. H. Howard, Proc. Natl. Acad. Sci. U.S.A. 77, 313 (1980).

[14]


223

(the plasmid pGZ1, containing the AdPol coding sequence cloned into the RSV-LTR plasmid vector). The PCRs were carried out using Taq polymerase (Perkin-Elmer-Cetus) or Vent DNA polymerase (New England BioLabs, Beverly, MA) according to the conditions of the manufacturer. Briefly, the incubation mixture (I00 ~1) contained 6.6 fmol of template (pGZ1 plasmid) 1 ~M each of the PCR primers, 200/~M dNTPs, 50 mM KCI, 10 mM Tris-HCl (pH 8.3 at room temperature), 1.5 mM MgCI2, 0.01% (w/v) gelatin, and 2.5 units of Taq polymerase. The sample was then overlaid with 100 ~1 paraffin oil (Fisher Scientific, Pittsburgh, PA). The PCR was carried out either in the thermocycler from Coy Laboratory Products or in GeneAmp from Perkin-Elmer-Cetus. The conditions of the three basic PCR steps were denaturation at 94° for 2 min 30 sec in the first cycle and 1 min 30 sec for cycles 2-25, annealing at 45-50 ° for 2 rain 30 sec, and polymerization at 72 ° for 2 rain. At the end of 25 cycles, the time of polymerization was extended to 10 rain, and the PCR DNA was subsequently stored at 4° until further use. The products were analyzed by electrophoresis on a polyacrylamide gel (8%) (Fig. 2A). Second Polymerase Chain Reaction Step. The first, double-stranded PCR product was diluted 10- to 50-fold, depending on the yield of the first PCR product, and was used in the second PCR as primers for elongation and subsequent amplification directed by oligo primers. These oligo primers were chosen from the sequences flanking two convenient restriction sites so that the amplified products from the second PCR could be cloned into those sites on a suitable plasmid vector and screened by DNA sequence analysis. The second PCR reaction mixture (100/zl) contained the template (1.6 fmol), 2.5-10% of the first PCR incubation mixture containing an about 500-fold molar excess of the first PCR product over the wildtype template concentration, and the rest of the components of the first PCR except the oligo primers. The DNA fragment from the first PCR product that contained the desired mutation was allowed to extend on wild-type template in the second PCR step. The second PCR was carried out for seven cycles in the absence of any additional primers except those oligos present as a carryover from the first PCR. The oligo primers 1 and 6 or 1 and 5 (Fig. 1B) were then added to the reaction at 1/zM concentration, and the PCR was continued for an additional 18 cycles. The conditions of this two-step PCR mutagenesis are given in Table I. The desired DNA fragments (311 bp between oligos 1 and 6, and 173 bp between oligos I and 5, as shown in Fig. 2B) were purified from the second PCR on an 8% (w/v) polyacrylamide gel by standard techniques of electroelution, 1~ NENSorb (Du Pont, Wilmington, DE) column purification, followed by lyophilization of the column eluate according to the protocol of the manufacturer. The purified DNA was then either digested with NcoI alone

224


A

1

[14]

B 2

3

1

2

3

a

b C

d e ¸

f

a

b " 1 3 9 bp c d

,311

bp

, 9 2 lap e f ,9192 bp

FIG. 2. Analysis of PCR products by electrophoresis on polyacrylamide gels. The PCR products were analyzed on polyacrylamide gels (8%) as described/8 (A) Lane 1, DNA size markers; a - f represent 344, 298,220, 201,154, and 134 bp. Lanes 2 and 3, first PCR products obtained in experiments 1 and 2 of Table I, respectively. The arrowheads indicate the 92and 139-bp products. (B) Lane l, same as in (A). Lanes 2 and 3, second PCR was initiated by the first PCR products as primers on the template pGZ1 as shown in Table I, and later continued by the addition of oligo 1 and 6 as terminal primers. The arrowheads show the final product of 311 bp (lanes 2 and 3) and, in addition, some of the first PCR product (92 bp in lane 2).

(for 173 bp) and cloned in the NcoI-SmaI-digested plasmid pLZ401,20 or digested with NcoI plus KpnI (311 bp) and cloned in the NcoI-KpnI sites of a pBR322 derivative. The transformants were screened by DNA sequence analysis. The frequency and the number of point mutations introduced into the various domains, BS I-III, were obtained from the DNA sequence analysis data, and are shown in Table II. 2o L.-J. Zhao and R. Padmanabhan, Cell 55, 1005 (1988).

[14]


225

TABLE I EXPERIMENTAL CONDITIONS FOR Two-STEP POLYMERASE CHAIN REACTION MUTAGENESIS PROTOCOLa

Experiment

First PCR primers

Size of first PCR product b (bp)

Second PCR primers 1-7 cycles b 8-25 cycles

1

Oligo 1 + oligo 13

92

92 bp (50 ng)

2

oligo I + oligo 14

139

139bp (50 ng)

3

oligo 1 + oligo 15

209

209 bp (50 ng)

oligo 1 + oligo 5 (or 6) oligo 1 + oligo 5 (or 6) oligo 1 + oligo 6

Size of second PCR product' (bp) 173; 311

173; 311

311

The XhoI-linearized wild-type plasmid containing the AdPol coding sequence was used as the template (6.6 fmol for the first PCR and 1.6 fmol for the second PCR). All oligo primers were used at 1 p.M final concentration. b The primers for the second PCR during the first seven cycles were the 92-, 139-, and 209-bp double-stranded first PCR products obtained in experiments 1-3, respectively. c The sizes of the second PCR products were 173 and 311 bp, respectively, when oligo pairs 1 + 5 and 1 + 6 were used during cycles 8-25.

Discussion The PCR mutagenesis protocol described above gives rise to multiple point mutations as shown in Table II. The total number of sites varied in a mutagenic oligo dictated the number of point mutations introduced in the final product obtained as the predominant species. For example, in the mutagenesis of BS I, two sites in oligo 13 were varied, and hence 85% of the clones screened contained two point mutations (Table II). In the case of BS II and BS III, because there are three or more mixed sites in oligos 14 and 15 (Fig. 1A), there is a preponderance of clones with three or more point mutations. It is possible that during the synthesis of mixed-site oligos, the oligos with multiple mutations were disproportionately abundant over oligos with single point mutations. The nature of the nucleotide chosen for a particular site of mutation and the overall yield of the chemical synthesis at each of the mixed sites could influence the abundance of a mutant oligo in the mixture. An alternate explanation for the generation of clones with more than one point mutation is as follows. At the annealing temperature of the PCR (45-50°), the mutagenic oligos with double or more mutations could form more stable hybrids with the mutant amplified DNA, produced within a few cycles of the first PCR containing a single shared mutation, than with the wild-type template. Further amplification

226

[14]


T A B L E II FREQUENCY AND NUMBER OF POINT MUTATIONS ACCUMULATED USING TwO-STEP POLYMERASE CHAIN REACTION MUTAGENESlS METHOD N u m b e r of point mutations b Size o f second P C R product cloned (bp) 173 173 311 311 311

Mutant domain BS BS BS BS BS

I II I II III

F r e q u e n c y of mutation a

1

2

3

4

1.0 1.0 0.9 0.65 0.69

2 0 3 0 0

11 1 6 3 2

-10 -8 13

---3

F r e q u e n c y of mutation r e p r e s e n t s the ratio of the n u m b e r of m u t a n t s obtained divided by the total n u m b e r of t r a n s f o r m a n t s screened. b Total n u m b e r o f m u t a n t t r a n s f o r m a n t s obtained containing one, two, three, or four point m u t a t i o n s in the various domains.

resulting from this stable annealing would give rise to mutant DNA with multiple mutations in subsequent cycles. If this explanation is correct, then it would suggest that the use of excess wild-type template (in the range of 80-160 fmol) and a fewer number of cycles (about 10) in the first PCR might give rise to clones with single point mutations. However, in some structure-function studies the mutagenesis protocol described here should be useful. For example, in functional studies involving a regulatory region isolation and characterization of multiple mutations in several defined regions would be helpful to identify the contributions of individual regions toward the overall function. We also noticed that Vent DNA polymerase (isolated from the extreme thermophile Thermococcus litoralis, and sold by New England BioLabs) could also be used for this mutagenesis procedure successfully (BS I and BS II mutations in the first two rows of Table II), except that a lower annealing temperature (42-45 °) was required. At a higher annealing temperature, the frequency of mutations was considerably reduced. This attribute of Vent DNA polymerase might be related to its exceedingly stable 3' ~ 5' proofreading exonuclease activity as advertised by the manufacturer, which might effectively reduce the concentration of the mutagenic oligo, but not the fraction of the wild-type oligo annealing to the wild-type template in the first PCR. For the second PCR, the double-stranded mutant DNA obtained in the first PCR was used as primers for elongation by Taq DNA polymerase on a wild-type template. We varied the amount of the first PCR product added to the second PCR from 2.5 to 10% of the incubation mixture without the

[14]


227

need for phenol extraction or gel purification step. The amount of the first PCR product needed as primers for a successful second PCR had to be established empirically. Therefore, it is recommended that the second PCR be carried out using two or three different concentrations of the first PCR product as primers for elongation and subsequent amplification. Use of double-stranded mutant DNA as primers for the PCR has been reported. 2~'z2 In one report, 2~ the two independent point mutants of exon 4 (182 bp) of the tyrosinase gene were amplified from the M13/exon 4 subclones, using oligo primers flanking the mutational sites. The doublestranded amplified DNA product was used as a primer in the second-step PCR for obtaining a longer fragment containing exons 2, 3, and 4, which was then inserted to replace the corresponding portion of the wild-type gene in an expression plasmid. In the second report, 22the mutagenic oligo containing a single mutation was used as one PCR primer. The hybrid primer, in which the 3' end contained sequences from the template region to be amplified, and the 5' end contained unique sequences not present in the template, was used as the second primer. The double-stranded mutant DNA was used as primer in the second-step PCR, in addition to two oligos, one from a site upstream of the mutation, and the other containing the 5' end sequences of the hybrid primer used in the first PCR. This strategy-'" allowed the selection of mutant DNA against the wild-type DNA. However, it required three oligonucleotides flanking a mutational site, and one mutagenic oligo for each desired point mutation. The method described here is well suited for introducing multiple mutations in a defined region. Although the transformants need to be screened by DNA sequence analysis in this procedure, different mutants can be identified by a single sequencing gel. Sequencing the transformants also achieves the purpose of verifying the accuracy of the PCR amplification, as would be required for any mutagenesis protocol. 2E L. B. Giebel and R. A. Spritz, Nucleic Acids Res. 18, 4947 (1990). 22 R. M. Nelson and G. L. Long, Anal. Biochem. 180, 147 (1989).

228


[15]

[15] L i b r a r i e s o f P e p t i d e s a n d P r o t e i n s D i s p l a y e d o n Filamentous Phage

By GEORGE P. SMITH and JAM1E K. SCOTT Introduction A "fusion phage" is a flamentous virion displaying on its surface a foreign peptide fused to a coat protein, and harboring the gene for the fusion protein within its genome.l'2 In this chapter we will emphasize an application for which these surface expression vectors are particularly well suited: construction of epitope libraries. In such a library--at least the kind so far constructed--the phages display "random" foreign peptides encoded by degenerate synthetic oligonucleotides spliced into the coat protein gene, the library as a whole representing up to billions of peptide sequences. 3-5 If a phage displays a peptide that is a strong ligand for an antibody or other binding protein, it can be readily affinity purified out of a library--even one containing a vast excess of nonbinding clones. Affinitypurified phages are eluted without destroying their infectivity; and the peptide sequences responsible for binding are easily ascertained by infecting the eluted phages into bacteria, propagating the resulting phage clones, and sequencing the relevant part of their viral DNAs. In this way, billions of peptide epitopes can be encompassed in a few microliters of solution and effectively surveyed for tight binding to a given protein, using simple microbiological and recombinant DNA procedures. The number of peptides that can be accommodated with this technology exceeds by at least a factor of 100-1000 the number that can be screened with conventional expression systems, in which the epitope is not displayed as part of the propagatable unit that encodes it. At the end of the chapter we will touch on more complex libraries, in which the displayed ligands are whole folded domains. Such constructs include most notably libraries of "phage antibodies" that would (it is hoped) display an array of binding specificities large enough to accommodate almost any possible antigen; these libraries hold out the promise of l G. P. Smith, Science 228, 1315 (1985). 2 S. F. P a r m l e y and G. P. Smith, Gene 73, 305 (1988). 3 j. K. Scott and G. P. Smith, Science 249, 386 (1990). 4 j. j. Devlin, L. C. Panganiban, and P. E. Devlin, Science 249, 404 (1990). 5 S. E. Cwirla, E. A. Peters, R. W. Barrett, and W. J. Dower, Proc. Natl. Acad. Sci. U.S.A. 87, 6378 (1990).


Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.

[15]

LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE

229

dramatically simplifying the isolation of monoclonal antibodies to almost any antigen. To simplify the discussion we will consistently use the term ligate to refer to the molecule that specifically binds a phage-borne peptide or protein domain and ligand to refer to a molecule (whether phage-borne or not) that specifically binds a ligate. In the case of epitope libraries displaying short peptides, the ligate is almost always a binding protein such as an antibody or receptor; in this case our terminology conforms with the convention that refers to the smaller, less structured partner of a binding pair as the ligand. As the phage-borne ligand becomes more and more structured, however, especially in the case of phage antibodies, smaller and smaller molecules can serve as ligates, including simple, nonproteinaceous determinants; in such circumstances, our terminology reverses the usual convention. In this chapter we describe the basic methods of fusion-phage technology, emphasizing the random hexapeptide epitope library that has been studied in our laboratory, but touching on alternative developments.

Design of Fusion Phage Vectors Representative published fusion-phage constructs are listed in Table l, along with key features that will be described in this section; some of the entries are specific constructs rather than general cloning vectors. All are based on the Ff class of filamentous phage: the class that infects bacteria harboring the F episome and that includes wild-type strains M13, fl, and fd. The filamentous phage infection cycle 6'7 is initiated by the attachment of phage coat protein pIII (product of phage gene III) to the tip of the F pilus, followed by internalization of the single-stranded viral DNA (ssDNA). This so-called plus strand serves as template for minus-strand synthesis, which starts at a specific origin and results in a double-stranded replicative form (RF). The RF is the template for mRNA transcription, RF replication, and production of progeny ssDNA. Progeny virions are assembled, not in the cytoplasm, but rather by extrusion of ssDNA through the bacterial envelope without killing the cell or preventing cell division. As it emerges from the cell, the ssDNA acquires its extracellular sheath of coat proteins from the membrane. The coat consists of a tubular array 6 G. P. Smith, in "Vectors: A Survey of Molecular Cloning Vectors and Their Uses" (R. L. Rodriquez and D. T. Denhardt, eds.), p. 61. Butterworths, Boston, 1988. 7 p. Model and M. Russel, in "The Bacteriophages" (R. Calendar, ed.), Vol. 2, p. 375. Plenum, New York, 1988.

230


[15]

TABLE I FUSION-PHAGE CONSTRUCTS

Name

Gene

fUSE5

III

fAFF1 M 13LP67 phGH-M 13glII

1II 111 III

pSEX

Ili

pCBAK8

VIII

fdH

VIII

pKfdH

VIII

Features Defective for (-)strand synthesis Noncomplementary, non-selfcomplementary termini Tetracycline resistance Infectivity requires insert Same as fUSE5 Ampicillin resistance Phagemid Human growth hormone fused directly to C-terminal domain of pill Must be complemented with helper to supply wild-type plII, other phage functions Ampicillin resistance Phagemid Single-chain antibody Fv domain fused to full-length plII Must be complemented with helper to supply other phage functions Ampicillin resistance Phagemid Antibody Fab domain fused to pVIll Must be complemented with helper to supply wild-type pVIII, other phage functions Ampicillin resistance Tolerates only foreign peptides with ---six amino acids Plasmid, not a phagemid: not suitable for library construction Must be complemented with helper to supply wild-type pVIII, other phage functions Ampicillin resistance

Sequence at amino terminus of mature hybrid protein ~

Ref.

ADc~Xd3GAETVESCLAK--

b

X.chCLAK--

c

X,,flAETVESCLAK--

d

e

f

g

AEVX.NDP--

h

AEVXnNDP- -

h

" Only general cloning vectors are entered, a, V, A, D, E, or G;/3, S, P, T, or A; cb, any amino acid but W, Q, M, K, or E. b j. K. Scott and G, P. Smith, Science 249, 386 (1990).

[15]


231

of thousands of pVIII molecules (product of phage gene VIII) and four minor coat proteins, including five copies of pIII incorporated into the trailing tip of the emerging virion. Both pIII and pVIII are synthesized with posttranslationally cleaved signal peptides, and before incorporation into the virion are anchored in the inner membrane with the N-terminal portion (the bulk of the protein in the case ofpIII) exposed in the periplasm. The gene III protein appears to have two functional domains, each roughly 200 residues long: an exposed N-terminal domain that binds the F pilus but is not required for virion assembly, and a C-terminal domain that is buried in the particle and is an integral part of the capsid structure. In the virion, the C-terminal portion of pVIII appears to be inside the virion, close to the DNA, while the N terminus is exposed to the solvent. In most fusion-phage constructs the foreign amino acids are inserted just downstream of the pIII signal peptide, and propagation of the recombinant phage requires that the recombinant pIII retain its functions. In a wild-type filamentous phage background, defects in gene III (and in most other phage genes) cause the phages to kill the cell with almost no phage production. In mutants with a defective minus-strand origin of replication, however, gene III defects are tolerated, probably as a result of reduced RF copy number. Such phages still replicate as a result of adventitious minus-strand initiations; and if all the other phage genes are functional the virions are infective, even giving small plaques. Many of the fusion-phage vectors, including the fUSE vectors and fAFF1, derive from fd-tet, which has a tetracycline (Tc) resistance determinant spliced into the minus-strand origin. This phage can be propagated like any Tc-resistance plasmid, independently of pIII function. 8 This allows a gene III frameshift to be engineered into the cloning site, so that vector without insert is noninfective; in such "frame-shifted" vectors, only clones bearing frame-restoring inserts contribute infectious particles to a library. Use of low copy number vectors may also help accommodate inserts that partially debilitate pIII 8 G. P. Smith, Virology 167, 156 (1988).

" S. E. Cwirla, E. A. Peters, R. W. Barrett, and W. J. Dower, Proc. Natl. Acad. Sei. U.S.A. 87, 6378 (1990). d j. j. Devlin, L. C. Panganiban, and P. E. Devlin, Science 249, 404 (1990). e S. Bass, R. Greene, and J. A. Wells, Proteins: Struct., Funct. Genet. 8, 309 (1990). f F. Breitling, S. Dubel, T. Seehaus, I. Klewinghaus, and M, Little, Gene 104, 147 (1991). g A. S. Kang, C. F. Barbas, K. D. Janda, S. J. Benkovic, and R. A. Lerner, Proc. Natl. Acad. Sci. U.S.A. 88, 4363 (1991). h j. Greenwood, A. E. Willis, and R. N. Perham, J. Mol. Biol. 220, 821 (1991).

232


[15]

and might be strongly selected against in high copy number vectors because of cell killing. A recombinant coat protein gene can be transplanted from the phage genome into a type of plasmid called a p h a g e m i d . 9 Phagemids contain the filamentous phage intergenic region comprising the origins of plus- and minus-strand synthesis and all other cis-acting elements needed for synthesis of ssDNA and packaging it into virions. They also contain a nonphage origin of replication and an antibiotic resistance gene so they can be propagated like any plasmid independently of phage function. When a cell harboring a phagemid is infected by filamentous helper phage, it secretes the phagemid (as well as the helper phage) in the form of infectious virions. These virions display a mixture of recombinant coat protein molecules encoded by the phagemid and wild-type molecules encoded by the helper. Phagemid virions are readily distinguishable from helper virions in that they transduce antibiotic resistance into any cell they infect. In the phagemid pSEX of Breitling et al. ~othe foreign domain is fused to the N terminus of wild-type pill, while in phagemid hGH-MI3glII of Bass et al. 11 the foreign domain r e p l a c e s the exposed N-terminal domain of the wild-type protein. Either design might allow display of foreign domains that would otherwise interfere with infectivity, which does not seem to require that all pill molecules on a particle be functional. Once infected into cells, clones are propagated as ampicillin resistance plasmids independently of pill or pVIII function. Kang et al. 12 (phagemid pCBAK8) and Greenwood et al. t3 (phage fdH and plasmid pKfdH) have spliced foreign inserts into the major coat protein pVIII, resulting in virions with many more displayed copies of the foreign peptide than in the case of gene I I I fusions. Peptides of up to six amino acids can be directly spliced into phage gene VIII, thereby being displayed on all copies of pVIII (2700 in wild-type particles). ~3 By transferring the recombinant gene V I I I to a phagemid or other plasmid and complementing with a helper phage to supply wild-type pVIII, much larger peptides-indeed, a 50-kDa antibody Fab domain12--can be displayed in dozens to hundreds of copies along the length of the virion. Such virions can be used directly as highly effective immunogens for eliciting antibodies against the 9 D. A. Mead and B. Kemper, in "Vectors: A Survey of Molecular Cloning Vectors and Their U s e s " (R. L. Rodriquez and D. T. Denhardt, eds.), p. 85. Butterworths, Boston, 1988. 10 F. Breitling, S. Dubel, T. Seehaus, I. Klewinghaus, and M. Little, Gene 104, 147 (1991). li S. Bass, R. Greene, and J. A. Wells, Proteins: Struct., Funct. Genet. 8, 309 (1990). 12 A. S. Kang, C. F. Barbas, K. D. Janda, S. J. Benkovic, and R. A. Lerner, Proc. Natl. Acad. Sci. U . S . A . 88, 4363 (1991). 13 j. Greenwood, A. E. Willis, and R. N. Perham, J. Mol. Biol. 220, 821 (1991).

[15]


233

foreign peptides.13 Such a vector could be of particular utility in vaccine development. To create a library, RF or plasmid DNA is restricted and spliced to the foreign DNA insert. Several vectors have two restriction sites yielding single-stranded termini that are neither complementary nor self-complementary; after the short "stuffer" between the sites has been removed, the linear vector DNA cannot be self-ligated, so that circularization requires that a compatible foreign insert be spliced in. TM Table I shows (for the general cloning vectors) the N-terminal primary sequence of the recombinant pill or pVIII encoded by clones carrying a frame-preserving or frame-restoring insert, assuming signal peptidase cleaves in the usual position. The variable part of the sequence, which the user is completely free to specify in the insert, is abbreviated Xn. As can be seen, two of the vectors (fAFF1 and M13LP67) allow the user to specify even the N-terminal residue of the mature gene Ili protein; most amino acids seem to be accepted at the first position after the signal peptide without impairing phage yield or infectivity, 5 although it has not yet been shown that signal peptidase actually cleaves such fusion proteins at the expected position. In the other vectors, insert-specified residues are preceded in the mature protein by a few vector-specified residues. Unless specifically noted, the procedures in this chapter are those used with the fUSE vectors in our laboratory. Although for the most part these procedures exemplify methods in general use with filamentous fusion phage, a few will have to be changed--usually in obvious ways--when applied to other vector systems. Bacterial Strains K-91 is a h- derivative of K-3815; it is Hfr Cavalli and has chromosomal genotype thi. K-91Kan is K-91 with the "mini-kan hopper" element, j6 a kanamycin-resistance transposon without its own transposase gene, inserted into the lacZ gene. K-80217is F - and has chromosomal genotype galK2 galT22 metB1 (lac-3 or lacY1) supE44 hsdr2. MC1061, ]8 the host for electroporation, is F - and has chromosomal genotype hsdR mcrB araD139 A(araABC-leu)7679 AlacI74 galU galK strA thi. z4 A. Aruffo and B. Seed, Proc. Natl. Acad. Sci. U.S.A. 84, 8573 (1987). 15 L. B. L y o n s and N. D. Zinder, Virology 49, 45 (1972). 16 j. C. Way, M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner, Gene 32, 369 (1984). 17 W. B. Wood, J. Mol. Biol. 16, 118 (1966). ]8 p. S. Meissner, W. P. Sisk, and M. L. B e r m a n , Proc. Natl. Acad. Sci. U.S.A. 84, 4171 (1987).

234


[15]

Recipes ABTS solution: Dissolve 2,2'-azinobis(3-ethylbcnthiazoline-6-sulfonic acid) (Sigma, St. Louis, MO) at 0.22 mg/ml in a 386 : 614 (v/v) mixture of 0.2 M Na2HPO 4 and 0.1 M citric acid; then add 1/1000 vol of 30% (w/v) H202 and use within 15 min Avidin-peroxidase complex: ABC reagent (Vector Laboratories, Burlingame, CA) is prepared in TBS (see below) with 0.1% (v/v) Tween 20 as recommended by supplier. Presumably other avidin-peroxidase or streptavidin-peroxidase complexes can be substituted Bovine serum albumin (BSA): Unless otherwise indicated, this is bovine serum albumin fraction V (Sigma); the protein is dissolved at 50 mg/ml in water, filter-sterilized, and stored at 4 or - 2 0 ° Acetylated BSA: This nuclease-free protein, which is used as a carrier for DNA reactions, is purchased from Promega (Madison, WI) as a l-mg/ml stock and stored at - 2 0 ° Dialyzed BSA: We use dialyzed fraction V BSA (Sigma) as a carrier protein when small amounts of contaminating biotin might interfere; a 50-mg/ml stock solution is prepared and stored as for nondialyzed BSA Blocking solution: 5 mg/ml dialyzed BSA, 0.1 M NaHCO3, 0.1 tzg/ml streptavidin, 0.02% (w/v) NaN3 ; filter sterilized and stored in refrigerator; can be reused many times Blotto solution: 5 g nonfat dry milk in 100 ml TBS/azide (see below) Bonding coat: Mix 20 tzl 7-methacryloxypropyltrimethoxysilane (Sigma) with 20 m195% (v/v) ethanol, then add a mixture of 60 tzl glacial acetic acid and 600 tzl water; use within 1 hr Buffered glucose: 50 mM glucose, 25 mM Tris-HCl (pH 8.0), 10 mM EDTA, pH 8 (see below). Store in refrigerator EDTA, pH 8 (250 mM stock): 0.25 M ethylenediaminetetraacetic acid disodium salt (N%EDTA), pH adjusted to 8.0 with NaOH; the stock is autoclaved and stored at room temperature Elution buffer: 0.1 N HC1 adjusted to pH 2.2 with glycine, 1 mg/ml BSA; store in refrigerator. The glycine hydrochloride buffer is made as a 4 × stock, filter sterilized, and stored at room temperature Ethanol: 100% ethanol is poured into a sterile glass-stoppered bottle and used directly; 70% (v/v) ethanol is 64.9% (w/w) ethanol in sterile water Formamide load buffer: Mix 6.65 ml formamide, 280 IA 0.5 M Na2EDTA (pH adjusted to 8.0 with NaOH), 3.5 mg bromphenol blue, 3.5 mg xylene cyanol FF, and 70 tzl water; store at - 2 0 ° GB B (40 × stock): 1.68 M Tris, 0.8 M sodium acetate, 72 mM Na2EDTA, pH adjusted to 8.3 with glacial acetic acid; store at room temperature

[15]


235

Kinase buffer (10 × stock): 0.5 M Tris-HCl (pH 7.5), 100 mM MgC12, 50 mM dithioerythritol, 1 mM spermidine, 1 mM EDTA (pH 8). Store at - 2 0 °, thaw, and refreeze as needed LB medium: See Sambrook e t a l . 19 Ligation buffer (5 × stock): 150 mM Tris-HCl (pH 7.5), 10 mM dithiothreitol (DTT), 1 mM EDTA (pH 8), 5 mM spermidine, 1.25 mM ATP (added as 100 mM stock neutralized to pH -7), 150 mM NaCI, 37 mM MgCI 2 , 500-800/xg/ml acetylated BSA NaN 3 (5% stock): A 5% (w/w) solution is made up, taking precautions to avoid exposure to the toxic chemical; store in refrigerator NAP buffer: Autoclave 90 ml 88 mM NaC1; when cool add 10 ml sterile 0.5 M NH4H2PO 4 (pH adjusted to 7.0 with NH4OH; made as 0.5 M stock, which is separately autoclaved in tightly closed bottle and stored at room temperature) NZY medium: Same as NZYM (Sambrook e t al. 19) without added MgSO4; autoclave and store at room temperature NZY agar medium: For 1 liter (about forty 100-mm petri dishes) autoclave 11 g Bacto-agar (Difco, Detroit, MI) in 500 ml water in a 2-liter plastic flask; while still hot add 500 mi sterile 2 x NZY at room temperature (and antibiotics and other heat-labile components as appropriate), mix by gentle swirling, and pour - 2 5 ml per 100-mm petri dish NZY/Tc agar medium: NZY/agar medium with Tc at 40/~g/ml NZY/Tc medium: NZY with 20/zg/ml Tc PEG/NaC1 solution: Mix 100 g polyethylene glycol (PEG) 8000 (Fisher, St. Louis, MO), 116.9 g NaCI and 475 ml water, heating if necessary to dissolve all the solid; store at room temperature or in refrigerator. Can be autoclaved, but must be mixed occasionally as it cools to prevent separation of phases Sequencing gel solution: The 40% (w/w) acrylamide stock is 38% (w/w) acrylamide, 2% (w/w) bisacrylamide; it is made up taking precautions to avoid exposure to the neurotoxic monomer, and stored up to - I year in the refrigerator. The 6% acrylamide gel solution (500 ml) is made by mixing 75 ml 40% acrylamide stock, 125 ml water 250 g ultrapure urea, and 100 ml 5 x TBE buffer (see below); the solution is filtered through a 0.45-~m nitrocellulose filter, degassed, and stored for up to - 2 months at room temperature in an amber bottle SOC medium: See Sambrook e t a l . 19

19 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed., Vols. 1-3. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.

236


[15]

Sodium acetate buffer (3 M stock): 3 M sodium acetate adjusted to pH 6.0 with acetic acid; autoclave with cap tight, store at room temperature Soft agar: Autoclave 1 g Bacto-tryptone, 0.5 g NaC1, and 0.75 g Bactoagar in 100 ml water; store at room temperature; for use, melt in microwave oven and dispense -3-ml portions into sterile 13 × 100 mm tubes in a 50° heating block as needed TBE buffer (5 x stock): 0.5 M Tris, 0.5 M H3BO3, I0 mM NazEDTA; store at room temperature TBS (10 x stock): 1.5 M NaCI, 0.5 M Tris-HCl (pH 7.5); dilute and autoclave as needed; both the 1 × and 10x solutions are stored at room temperature TBS/Tween: make by diluting 0.5 ml Tween 20 in 100 ml TBS; autoclave and store at room temperature TBS/gelatin: 0.1% (w/v) gelatin in TBS; autoclave and store at room temperature TBS/azide: TBS with 0.02% (w/v) NaN3 ; store at room temperature TE: l0 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8); make as 10 × stock, dilute and autoclave as needed; store at room temperature Termination mixes and termination diluent: Diluent contains 67 ~M dNTPs (purchased from Pharmacia, Piscataway, N J, as 100 mM stock solutions neutralized to pH -7), 16.7 mMTris-HC1 (pH 7.5), 66.7 mM NaCI, 13.3 mM dithioerythritol, and 100 ~g/ml acetylated BSA. The Q, R, W, M, K, and S mixes contain in addition the following ddNTPs (purchased from Pharmacia as 5 mM stock solutions neutralized to pH -7): R, 3.2/~M ddATP and ddGTP, 0.32/~M ddCTP; Q, 3.2/~M ddTTP and ddATP, 0.32/~M ddCTP; W, 3.2/~M ddATP and ddTTP; M, 3.2/~M ddATP and ddCTP; K, 3.2/~M ddGTP and ddTTP; S, 3.2 /~M ddGTP and ddCTP. All these solutions are stored at - 2 0 ° and thawed and refrozen as needed Tetracycline (Tc) (20-mg/ml stock): Dissolve solid in water at 40 mg/ml, filter sterilize into an equal volume of autoclaved, cooled glycerol, mix, and store at - 2 0 ° General Procedures

Phenol Extraction, Chloroform Extraction, and Ethanol Precipitation from Sodium Acetate Solution The steps are carried out as outlined by Sambrook et al. 19 Removal of Supernatant. In some procedures it is advantageous to remove almost all supernatant from a pellet; to accomplish this, decant or aspirate the supernatant, recentrifuge the tube (maintaining the same

[15]


237

orientation in the rotor), and aspirate or pipette off the residual supernatant that is thus driven to the bottom of the tube. Electroporation. Large-scale transfections for library construction are accomplished by electroporation. 2° Frozen Escherichia coli MCl061 cells 2° (40-50 /~l) are thawed, mixed with DNA (up to - l p~g in 1-5 p,l water), transferred to a cold 2-ram cuvette (Bio-Rad Laboratories, Richmond, CA) connected in parallel with a 400-f~ resistor, and shocked by charging a 25-/~F capacitor to 2.5 kV and discharging it through the resistor. The shocked cells are immediately suspended in SOC medium containing 0.2/~g/ml Tc, transferred to a sterile 15-ml culture tube, and shaken at 37 ° for 30-60 min before spreading 200-/~1 portions on NZY/Tc agar medium in 100-mm petri dishes or inoculating into liquid NZY/Tc medium. Small-scale transfections (e.g., for strain constructions) are accomplished by the CaCl 2 method as described. 21 Vector DNA. Noninfective phage (e.g., fUSE vectors) should be propagated in an F - (uninfectable) host to guard against accumulation of infective pseudorevertants; infective phage can be grown in male (F +, F', or Hfr) strains. Cultures are grown to stationary phase in 1 liter of LB medium containing 15 /.Lg/ml Tc. Cells are suspended in 40 ml buffered glucose and RF is extracted by alkaline lysis (Sambrook et al.19), except that no lysozyme is required. The crude DNA, dissolved in l0 ml TE, is extracted twice with phenol and once with chloroform, reprecipitated with ethanol, and purified by CsCl-ethidium bromide density gradient centrifugation (Sambrook et al., 19pp. 1.42-1.43); one tube for the VTi50 rotor (Beckman Instruments, Fullerton, CA) accommodates DNA from up to 2 liters of culture; because of the large amount of RNA in the lysate, at least 25 mg ethidium bromide should be included to ensure enough free dye to saturate the DNA. Purified DNA is cleaved with appropriate restriction enzyme(s) and extracted with phenol and chloroform. To remove a "stuffer" fragment released by cleavage at two restriction sites, the cleaved DNA (37/~g/ml in restriction buffer or a dilution thereof) is precipitated by adding 1/9 vol 3 M sodium acetate buffer and 2/3 vol 2-propanol, incubating on ice 20 min, microfuging 30 rain at room temperature, removing all supernatant (see Removal of Supernatant, above), washing gently in 70% (v/v) ethanol, and again removing all supernatant. The precipitate is dried briefly under vacuum, dissolved in TE, ethanol precipitated, and quantified spectrophotometrically. Large-Scale Purification o f Virions. The following procedure is for derivatives of fd-tet, which yield about 5 x l0 ll particles/ml of culture. 20 W. J. Dower, J. F. Miller, and C. W. Ragsdale, Nucleic Acids Res. 16, 6127 (1988). 2i F. K. Nelson, S. M. F r i e d m a n , and G. P. Smith, Virology 108, 338 (1981).

238


[15]

One liter of stationary-phase culture (previous section) is freed of cells by two successive 10-min centrifugations [5000 and 8000 rpm in three 500-ml bottles in the Sorvall (Norwalk, CT) GS3 rotor at 4 °]; the final supernatant is distributed equally in three 500-ml centrifuge bottles. (If needed, RF can be prepared from the cell pellet, as described in the previous section.) After adding 0.15 vol PEG/NaC1 solution, the supernatnat is thoroughly mixed and incubated overnight in the refrigerator. Precipitated virions are collected by a 30-min centrifugation (8000 rpm in the Sorvall GS3 rotor at 4°), removing all supernatant. The precipitate is dissolved and pooled in a total of 30 ml TBS, transferred to a single Oak Ridge tube (Nalge, Rochester, NY), cleared by a 10-min, 15,000-rpm centrifugation (Sorvall SS34 rotor), and reprecipitated from the supernatant by adding 4.5 ml PEG/ NaCI solution and incubating at least 1 hr in the refrigerator. Virions are collected by centrifugation (again taking care to remove all supernatant), dissolved in 10 ml TBS, and cleared by centrifuging at 15,000 rpm for 10 rain at 4 ° (Sorvall SS34 rotor). The final supernatant is transferred to a tared vessel and TBS added to bring the total net weight to I0.75 g; 4.83 g CsC1 is added to bring the density to 1.30 g/ml. The CsC1 solution is transferred into a ~ × 2½ in. polyaUomer tube (topping with mineral oil if necessary) and centrifuged at 37,000 rpm for at least 40 hr in the SW41 rotor (Beckman Instruments) at 4 °. (Note: For phage other than fd-tet derivatives, the particle yield is - 2 × 1012virions/ml, and the virions from 1 liter of culture should be distributed into three or four SW41 tubes.) After centrifugation light-scattering bands are visualized by shining a bright light downward through the tube and looking through the wall of the tube at right angles to the light beam. The translucent, nonflocculent phage band lies near the middle of the tube just above a sharp, white, flocculent band; 1015 particles can give a band - I cm wide. The phages are collected by puncturing the side of the tube with a 16-gauge needle attached to a 3-ml syringe. Phages from one or two tubes are transferred to 26-ml polycarbonate bottles for the Beckman 60Ti rotor; the bottles are filled with TBS and centrifuged at 50,000 rpm for 4 hr at 4° to pellet virions. After removing all supernatant (see Removal of Supernatant, above), the virion pellet in each bottle is dissolved in 3.2 ml TBS, divided into three 1.5-ml microcentrifuge tubes (800/zl each), and cleared by microfuging 3 min; supernatants are transferred to polyallomer microcentrifuge tubes for the Beckman TLA-100.1 rotor and centrifuged at 57,000 rpm for 90 mip. at 4 °. After again removing all supernatant, the pellets from 1 liter of original culture are dissolved and pooled in a total volume of 3 ml TBS. Virions are quantified spectrophotometrically by scanning a 1/50 dilution from 240 to 320 nm, giving a broad peak at 260-280 nm with peak absorp22 L. A. Day, J. Mol. Biol. 39, 265 (1969).

[15]


239

tion at 269 n m . 22 Virion concentration (physical particles per milliliter) can be estimated a s A269 X 6 X 10t6/(bases/ssDNA); a typical yield for fd-tet derivatives is 3 x 10 u virions/ml of culture supernatant. Starved Cells. Filamentous phages infect E. coli strains displaying the sex pilus encoded by the F episome (Hfr, F*, or F' strains). Because phages adsorb slowly to cells at log-phase concentrations ( - 5 x 10s cells/ ml), we concentrate cells to - 10~°cells/ml after starvation. 23 Cells are first grown in 20 ml NZY medium at 37 ° with vigorous shaking to an optical density of - 0 . 4 - 0 . 6 at 600 nm; shaking is then slowed for 5 min, and care is taken in subsequent steps to avoid shearing the fragile F pili. The culture is centrifuged (2200 rpm for 10 rain in a Sorvall SS34 rotor), the supernatant is poured off, and the cells are gently resuspended in 20 ml 80 mM NaCI and shaken gently in a 125-ml culture flask at 37 ° for 45 rain to starve the cells. The cells are collected as above and resuspended in 1 ml cold NAP buffer; they can be stored in the refrigerator for about 5 days without affecting titers. Titering Transducing Units. Infections are ordinarily carried out either in disposable 15-ml culture tubes (if only a few infections are involved) or in wells of a 24-well culture dish (Costar, Cambridge, MA). To 20/zl phage (appropriately diluted in TBS/gelatin) is added 20/zl starved cells; after 10 min at room temperature the mixture is diluted with 0.2-2 ml NZY medium containing 0.2/xg/ml Tc and incubated with shaking (gentle shaking in the case of 24-well culture dishes) for 20-40 min. These cultures or appropriate dilutions of them (using NZY with or without 0.2 gg/ml Tc as diluent) are then spotted (20/.d/spot) or spread (50-200/zl/100-mm dish) on NZY/Tc agar medium. Colonies are counted after 16-36 hr at 37 °, each colony representing a transducing unit (TU). Biotinylation. The following protocol is used for biotinylating antibodies and antibody Fab fragments; it may have to be modified for other ligates. The protein must be freed of primary and secondary amines, azide. and strong buffers that would prevent pH adjustment in the next step. Antibody (10-50/~g in 20/xl) is brought to pH 8-9 in a siliconized 1.5-ml microtube by adding 4.4/zl 1 M NaHCO3. Sulfosuccinimidyl-6-(biotinamido)hexanoate (NHS-LC-biotin, M r 556.6; Pierce Chemical, Rockfold, IL) is dissolved at 0.5 mg/ml (0.88 mM) in 2 mM sodium acetate buffer and 20/xl is immediately added to the antibody; the NHS-LC-biotin, which is freely water soluble because of the sulfo group, is slowly depleted by hydrolysis in aqueous solution. Coupling is allowed to progress 2 hr at room temperature, then quenched by adding 200/~1 1 M ethanolamine (pH adjusted to 9.0 with HCI) and incubating two additional hours at room temperature. Carrier protein (20/xl 50-mg/ml dialyzed BSA) is added and 2~ H. Tzagoloff and D. Pratt,

Virology 24, 372 (1964).

240


[].5]

the reaction mixture is diluted with 1 ml TBS and concentrated and washed twice with TBS and once with TBS/azide on a 30-kDa Centricon ultrafilter (Amicon, Danvers, MA) according to the directions of the supplier. The concentration of biotinylated antibody is calculated from the volume of the final concentrate (usually 35-50/~1), assuming no loss. Processing Small Cultures. Colonies are inoculated into 1.5 ml NZY/ Tc medium in 15-ml disposable culture tubes or in 18 x 150 mm glass culture tubes. The tubes are secured vertically in a shaker incubator and shaken vigorously at 37° for 12-24 hr. Each culture is poured into a 1.5-ml microtube and microfuged - 1 min to pellet cells; 1 ml of the culture supernatant is pipetted into a fresh microtube containing 150/xl PEG/NaC1 solution, and after thorough mixing virions are allowed to precipitate overnight in the refrigerator. Precipitated virions are collected by microfuging (15 min at - 4 ° or at room temperature) and removing all supernatant (see Removal of Supernatant, above), and dissolved in 1 ml TBS; virion concentration is - 5 x 10 u particles/ml. A sequencing template can be prepared from 200/.d of this solution. Alternatively, if phage are to be used for enzyme-linked immunosorbent assay (ELISA) they can be further purified as described in the next section. Partial Purification of Phage for ELISA. The dissolved first PEG precipitate (1 ml; see previous section) is cleared by microfuging - 1 min, and supernatant pipetted into a fresh microtube containing 150 txl PEG/NaCI solution. Phage are precipitated and collected as in the previous section, and dissolved in 110/xl unbuffered 0.15 M NaCI. The solution is cleared by microfuging - 1 min, and 100 ~1 of the supernatant is transferred to a fresh microtube containing 11 /xl 1 M acetic acid; after I0 min at room temperature and 10 min on ice, acid-precipitated virions are collected by microfuging 30 min at - 4 ° and removing all supernatant. The final virion pellet is dissolved in 500 txl TBS, giving a phage concentration of - 5 x 10u particles/ml. A sequencing template can be prepared from 200/xl of this solution. Sequencing Template. Phages (200 tzl containing -1011 particles purified by at least one PEG precipitation, as in previous two sections) are extracted once with phenol and once with chloroform in 500-tzl microtubes. The final aqueous phase (100-150 /xl) is transferred to a 1.5-ml microtube containing 250 ~1 TE and 40 ~1 3 M sodium acetate buffer (see Recipes, above), and the viral ssDNA precipitated by adding 1 ml ethanol. After at least 1 hr at 4 °, ssDNA is collected by microfuging 30 min, aspirating the supernatant, gently adding - 1 ml 70% (v/v) ethanol, and removing all supernatant; the DNA is dried briefly in vacuo, dissolved in 7.5/xl water, and stored at - 2 0 ° until use. Sequencing Reactions. We use an 18-base primer complementary to the wild-type gene III sequence 18-32 bases 3' of the cloning sites in the

[15]


241

fUSE vectors. The primer is end labeled by mixing 267 ng of the 5'-OH oligonucleofide with 200/xCi [y-32p]ATP [specific activity -7000 Ci/mmol; crude preparation from ICN Biochemicals (Costa Mesa, CA) is used within - 4 weeks of reference date], 1 /zl 10 x kinase buffer, and 1 /zl T4 polynucleotide kinase, in a total volume of 10/zl in a 1.5-ml microtube; incubating at 37° for 30 min; and adding 125/zl TE and heating to 65-70 ° for 15 min to inactivate the enzyme. If sequences are to be "piggy-backed," this end-labeled primer is freed of unincorporated isotope and other impurities by adsorption to NENSORB 20 (New England Nuclear, Boston, MA), washing with adsorption buffer and water, and eluting with a 1 : 1 (v/v) ethanol-water mixture as in the supplier instructions; the radioactive fractions are dried in vacuo and dissolved in water. Water and stock solutions are added to the labeled primer (whether NENBSORB purified or not) to give final concentrations of 128 mM Tris-HC1 (pH 7.5), 160 mM NaCI, and 48 mM DL-isocitrate (pH adjusted to 7-7.5 with NaOH) in a final volume of 200-900/zl; this solution is called 2 x primer-buffer, and is stored for up to 4 weeks at - 2 0 °. Just before use, the required volume of 2 x primer-buffer is mixed with an equal volume of 16 mM MnCI 2, and 6.7 p~l of the mixture is added to sequencing template in 7.5/~1 water (previous section); after microfuging briefly to mix the solutions, the mixture is heated at 65-70 ° for 5-10 min, then allowed to cool gradually to room temperature over a period of at least 30 min; the resulting primed templates can be stored in the refrigerator or freezer for at least 4 days, during which time they turn brown without apparent ill effects. The primed template is microfuged briefly to drive condensation to the bottom, and 3-/zl droplets are deposited in a grid pattern on a polystyrene petri dish--two droplets (R and Q) per template for two-lane sequencing, four droplets (W, M, K, and S) for four-lane sequencing. Up to 40 droplets fit easily in a single 100-mm dish; it is convenient to deposit droplets to be loaded on the sequencing gel at different times on different dishes. T7 DNA polymerase (e.g., Sequenase version 1 or 2 from United States Biochemical, Cleveland, OH) is added to the appropriate volume of one of the termination mixes (diluted with termination diluent if appropriate) in a siliconized microtube to give a concentration of 0.25 units//zl; 3-/zl portions of the mixture are immediately deposited on each of the appropriate droplets on the petri dish. This process is repeated with the remaining termination mix(es), and the petri dish is floated on a 37 ° water bath for 5-10 min. Polymerization reactions are stopped by depositing a 4-/.d droplet of formamide load buffer on each droplet. The petri dish can be stored at - 2 0 ° for several days if convenient. Pouring and Running Sequencing Gels. Sequencing gels (38 cm long, 30.5 cm wide, and 0.4 mm thick) are run in a standard sequencing gel

242


[15]

apparatus (e.g., model $2; Bethesda Research Laboratories, Gaithersburg, MD). The short glass plate is coated twice with - 7 ml Rain-X 24 (Unelko, Scottsdale, AZ); after each coat has been applied with a Kimwipe, the reagent is allowed to dry, then the plate is wiped with 95% (v/v) ethanol and buffed with a Kimwipe. Meanwhile, the long plate is coated three times with - 6 ml bonding coat (see Recipes, above); after each coat has been applied with a Kimwipe, the reagent is allowed to dry and the plate is buffed with a Kimwipe. It is crucial not to cross-contaminate the plates. The acrylamide bonds covalently to the coated long plate, and after electrophoresis can be dried onto the glass surface without cracking. Plates are assembled into a sandwich with a spacer along the bottom as well as each side, and clamped together with clips; there is no need to seal the sandwich with tape. Sequencing gel solution (100 ml) is measured into a beaker and mixed with 1 ml 10% (w/w) freshly dissolved ammonium persulfate. A 3-ml portion is mixed with 3/xl N,N,N',N'-tetramethylethylenediamine (TEMED) in a test tube and immediately pipetted down one edge of the sandwich, which is laid flat as the gel polymerizes ( - 5 min), sealing the edges and bottom of the sandwich. Then 21 /zl TEMED is added to the remainder of the gel solution, which is mixed, poured into a 250-ml squirt bottle, and injected between the glass plates. The nonserrated eges of sharkstooth combs are inserted to create a flat surface, and the gel is polymerized 2-24 hr. The gel is assembled into the electrophoresis apparatus with sharkstooth combs, creating either forty-nine 6-mm or ninety-seven 3-mm wells, and preelectrophoresed until the surface temperature is - 5 0 °. Just before loading, the petri dish containing the reactions (previous section) is floated with its lid off on a water bath at 80-90 ° for 3 min, thus denaturing the DNA and evaporating the samples to - 4 - 5 / x l . After wells are rinsed to remove urea, samples are loaded (4 /zl/6-mm well, 2/zl/3-mm well) and the gel is electrophoresed until the xylene cyanol FF (blue-green) band has migrated 21 cm for a normal 6% (w/v) gel. On a piggy-back gel, xylene cyanol FF is run to 14 cm, then a second set of samples is loaded and run until the xylene cyanol FF from the first stample has run 24 cm. This allows reliable reading of strands from the first load with lengths between 55 and 80 bases (including the primer), without interference from primer breakdown products from the second load. This is adequate for clones from our hexapeptide epitope library, in which the 18-residue sequence encoding the variable hexapeptide corresponds to strand lengths between 61 and 78 bases. After electrophoresis, the gel, which is bonded to the long glass plate, 24 R. S. Barnett and J. N. Davidson, in " F o c u s , " (N. Sasavage, ed.) Vol. 11, p. 75. Bethesda Research Laboratories, Bethesda, Maryland, 1989.

[15]

LIBRARIES OF P E P T I D E S D I S P L A Y E D BY P H A G E

243

is washed twice with 600-1000 ml 10% (v/v) methanol, 10% (v/v) acetic acid (the second wash can serve as the first wash of the next gel), dried onto the plate (e.g., - 3 hr at room temperature under a current of air), and autoradiographed at room temperature. Overnight exposure is usually sufficient for short sequences with undiluted termination mixes; 24-48 hr usually suffices for longer sequences. After use, the long glass plate is soaked in 1 N NaOH to remove the gel and cleave off the bonding coat; the gel is scooped into radioactive waste, while the alkaline solution can be reused several times. The plate is then rinsed and recoated as described above. Making a Library

Design of Degenerate Oligonucleotide Insert Most libraries to date have used synthetic degenerate oligonucleotides as the insert. A degenerate oligonucleotide is a mixture of sequences created in a single synthesis by coupling mixtures of nucleotides, rather than single nucleotides, at selected positions in the growing chain. At the codon level degeneracy can be of two general types: fully degenerate codons encode all 20 amino acids with no bias beyond what is entailed by the unequal degeneracy of the genetic code; while doped codons are biased toward one particular amino acid in order to introduce random substitutions into a base peptide or polypeptide sequence. The first two positions of each fully degenerate codon are synthesized by adding an equimolar mixture of dA, dC, dG, and T to the growing oligonucleotide; the third position has an equal mixture of dG and T (dG and dC are also acceptable). The resulting mixture of 32 triplets encodes all 20 amino acids, and includes only the amber chain termination codon. Doped codons are synthesized by doping each nucleotide encoding the base peptide sequence with a mixture of the other three nucleotides. For instance, a nucleotide substitution rate of 30% results if, during synthesis, 60% of the nucleotide in each step is specified and 40% comes from an equimolar mixture of all four nucleotides. Whatever its design, the inserted coding sequence must fuse correctly to the coat protein reading frame at both ends of the cloning site in order to retain or restore gene function and thereby be expressed on the virion.

Construction of Library Efficient cloning of oligonucleotides with long degenerate sequences presents a special problem. Even if as few as six degenerate codons are

244


[15]

represented, the overall complexity exceeds that of the entire human genome, and it is not practical to create a double-stranded degenerate insert simply by annealing complementary degenerate oligonucleotides. Two ways of circumventing degeneracy have been used: polymerase chain reaction (PCR) amplification of a single-stranded degenerate oligonucleotide template with primers corresponding to nondegenerate flanking sequences3; and creation of "gapped duplexes," in which the degenerate region remains as a single-stranded gap in an otherwise double-stranded insert. 5 To synthesize a double-stranded degenerate insert by PCR, nondegenerate sequences with appropriate restriction sites are positioned on both sides of the degenerate codons in the chemically synthesized template. The template is PCR amplified using 5'-biotinylated primers corresponding to the flanking regions. A 1-ml PCR mixture containing -40 pmol template and 750 pmol of each biotinylated primer is incubated with 25 units of AmpliTaq DNA polymerase (Perkin-Elmer-Cetus, Norwalk, CT) in the buffer recommended by supplier; after five temperature cycles (2.5 min at 95°, 4 min at 42°, 4.4 min at 72°) and 5 min at 72°, polymerization is stopped by the addition of 4/A 250 mM EDTA, pH 8. The product is precipitated with ethanol and dissolved in 100/A TE and crudely quantified by gel electrophoresis next to appropriate double-stranded oligonucleotide standards. A 300-ng portion is digested in a 500-/B reaction mixture containing 1200 units of a restriction enzyme that will produce appropriate overhanging ends for splicing into linearized vector DNA. The digestion is stopped by addition of 22 /A 250 mM EDTA, pH 8, and mixed with streptavidin-agarose beads [Bethesda Research Laboratories; 200/A 50% (w/v) suspension] that have previously been washed l0 times with 0.1 M NaCl in TE by suspension and centrifugation. After 30 min of gentle agitation, the beads are centrifuged and the supernatant is removed to another tube. Beads are washed twice with 200/A water, and the supernatants are pooled with the main supernatant. The final product is extracted with phenol and chloroform, concentrated by evaporation in vacuo, and quantified roughly by gel electrophoresis. The ligation reaction contains 5 p,g/ml linearized vector DNA, a twofold molar excess of double-stranded degenerate insert, and 10 units/ml T4 DNA ligase in ligation buffer. After incubation at 20° for 12-18 hr, products are analyzed by running a 20-/A portion of the ligation mixture on a 0.8% (w/v) agarose gel containing 4 x GBB and 1.5 /xg/ml ethidium bromide. The product usually consists of a mixture of nicked circular, covalently closed circular, and residual linear RF DNA, which comigrate with linear double-stranded marker fragments of -11, - 5 , and 9.2 kbp, respectively. A good ligation produces - 2 × l07 Tcresistant transfectants per microgram vector input by electroporation.

[15]

L I B R A R I E S O F P E P T I D E S D I S P L A Y E D BY P H A G E

245

In the gapped duplex method, 5 a long degenerate oligonucleotide is annealed to two short oligonucleotides ("patches") complementary to nondegenerate regions at its 5' and 3' ends. When ligated to linearized vector DNA (essentially as described above), this gapped duplex produces transfectants at about the same frequency as do double-stranded inserts. When the degenerate region is short (e.g., six codons), most phage in a library produced by either procedure have inserts with the correct reading frame and sequence. When long degenerate sequences (e.g., 20 codons) are cloned as gapped duplexes, however, the incidence of rearranged sequences increases (J. K. Scott, unpublished observations, 1991); this problem can be at least partially ameliorated by filling in the long singlestranded gaps with DNA polymerase plus ligase. The ligation product is transfected into cells by 50-100 separate electroporations; the transfected cells are propagated in 10 to twenty l-liter flasks containing 100 ml NZY/Tc medium (5 electroporations/flask) at 37 ° with vigorous shaking for 24 hr. The cultures are pooled and the virions purified and quantified spectrophotometrically (see Large-Scale Purification of Virions, above); the concentration of infectious particles is determined by titering transducing units. Gross clonal bias and sequence abnormalities can be detected by sequencing individual clones of electroporated cells. Affinity Purification of Phage from Epitope Library

Biopanning This affinity purification technique z relies on the superstrong biotin-streptavidin reaction to attach ligate-binding phage to a solid surface (Fig. 1). Alternative techniques are discussed in the next section. Into a 60-mm polystyrene petri dish is pipetted 2 ml 0.1 M NaHCO3 ; 20 tzl 1-mg/ ml streptavidin is pipetted into the buffer, and the dish is jiggled until the entire bottom surface remains wetted. The dish is covered with the lid and kept overnight at - 4 ° in a humid chamber, preferably on a rocker. The next day the lid is discarded, the streptavidin solution is poured off, and the dish is filled with blocking solution (see Recipes, above) and rotated or rocked 1-2 hr at room temperature. The blocking solution is poured back into its container for reuse, and the dish is washed three times by filling it with TBS/Tween, pouring out the buffer, and slapping the dish on a clean paper towel (the last wash is not poured off until just before the ligate-reacted phages are added). Meanwhile, a phage mixture--typically 5 ~1 of a library--is reacted overnight with up to 1/xg biotinylated ligate (typically in 5/zl TBS/Tween) in a 1.5-ml microtube in the cold. The reaction is diluted with 1 ml TBS/

246


[15]

() Oligo Insert encoding epltope

q

Epltope ( ~.

Blotlnylated

antibody

Streptavldin-coated petri dish FIG. 1. Biopanning. Phages in the epitope library are represented with different oligonucleotide inserts in their DNA and the corresponding peptides displayed on pill at one tip of the virion; only one recombinant pill molecule is shown, although there are actually five per particle. Phages displaying a ligand for the biotinylated ligate (an antibody in this example) are captured on the dish by binding of the biotin moiety to immobilized streptavidin.

Tween and immediately pipetted onto the streptavidin-coated dish, which is rocked at room temperature for 10-15 min; during this incubation, phages whose displayed ligands have bound to the biotinylated ligate are in turn attached to the plastic surface via biotin-streptavidin bonds (Fig. 1). The fluid is poured out, and the plate is washed 10 times with TBS/Tween, each time rocking the dish a few minutes, decanting the wash, and slapping the dish face down on a clean paper towel to remove residual wash; the entire process takes 15-60 min. Bound phages are eluted by pipetting 800/zl of elution buffer (see Recipes, above) into the dish, rocking it 5-15 min, and pipetting the eluate into a 1.5-ml microtube containing 48/xl 2 M Tris (pH unadjusted), raising the pH of the eluate to - 8 . The first round of biopanning is critical to success. Ordinarily each clone in the original library is represented by only - I 0 0 infectious units (TU) in the initial 5-p.l aliquot. Because biopanning gives only a 1% yield with strongly binding phage, many binding clones will be represented (if at all) by a single TU. That is why a large amount of biotinylated ligate

[15]


247

(1 g.g) is used in the first round, to maximize yield even at the cost of reduced discrimination. Ordinarily a single round of biopanning is not sufficient to purify binding clones from a large, complex library. Consequently, phages in the first eluate are biopanned again after amplification. Because it is important to represent as many of the phages as possible (previous paragraph), the eluate is first concentrated (and washed once or twice with TBS) on a Centricon 30-kDa ultrafilter so that the entire eluate can be amplified. The retentate ( - 5 0 tzl) is mixed with 50 /xl starved cells (usually K-91 or K-91Kan; no more than I day old; see General Procedures, above) in a sterile 15-ml tube; after 10 min at room temperature, 2 ml NZY medium containing 0.2/xl/ml Tc is added and the tube is incubated at 37 ° (with shaking if possible) for 45-60 min. The culture is then spread on ten 100-mm dishes (200/zl/dish) containing NZY/Tc agar medium and grown 24-48 hr at 37°; usually there are 500-5000 colonies per dish. The phages (along with the cells that have secreted them) are harvested from the petri dish by scraping them into a total of 30 ml TBS. The suspension is cleared by two centrifugations (5000 and 10,000 rpm, 10 min each, in Oak Ridge tubes in the Sorvall SS34 rotor), and the phages are precipitated from the cleared supernatant in an Oak Ridge tube by adding 0.15 vol of PEG/NaCI solution, mixing thoroughly by multiple inversions, and chilling in the refrigerator at least 4 hr. The precipitate is collected by centrifugation (10,000-15,000 rpm for 15 min in the Sorvall SS34 rotor), and after removing all supernatant (see Removal of Supernatant, above) the pellet is dissolved in 1 ml TBS and transferred to a 1.5-ml microtube. The phage solution is cleared by microfuging a few minutes, the supernatant is transferred to a fresh microtube, and the phages are reprecipitated by adding 150 tzl PEG/NaC1 solution, mixing thoroughly by multiple inversions, and chilling in the refrigerator at least 1 hr. The precipitate is collected by microfuging 5-10 min, all supernatant is removed, the pellet is dissolved in 100/xl TBS, and the solution is cleared by microfuging a few minutes and transferring the cleared supernatant to a fresh microtube. This amplified eluate typically has a titer of 10W 1013TU/ml; the yield is not dependent on the number of colonies per dish, as long as that number exceeds -500. A 5-/~1 portion of the amplified eluate is biopanned in the same manner as the original library. If binding clones predominate in the eluate, there can be as much as 4 pmol phage-borne ligand in 5 ~1 of amplified eluate. By using substantially less than 4 pmol ligate in the second round of biopanning, it is possible to set up a competition among binding clones, thus potentially increasing discrimination. This reduces the yield of binding clones, of course; but because 5 ~1 of amplified first eluate will contain at least 105 TU/TU in the original unamplified first eluate, high yields are

248


[15]

not nearly as important as in the first round of biopanning. Usually a 50/zl portion of the second eluate (unconcentrated) is amplified as described above, except that only 1 ml of NZY medium with 0.2/zg/ml Tc is added, the infected cells are grown in only five 100-mm petri dishes, and the final PEG pellet is dissolved in 50/zl TBS. Although this amplifies only 6% of the second eluate, this still represents the yield from at least 6000 TU/TU in the original unamplified first eluate. A 5-tzl portion of the amplified second eluate is then subjected to yet a third round of biopanning. The final (usually third) eluate is titered to give well-separated colonies (see titering transducing units), so that individual colonies can be propagated and analyzed (see Analysis of Affinity-Purified Phage, below).

Other Methods of Affinity Purification Two affinity matrices other than a polystyrene surface have been used for affinity purifying phage: agarose beads 1°,25 and oxirane acrylic particles. 11The agarose beads are large and have pores that are large compared to the ligate but small compared to the long dimension of the virion; it seems likely, therefore, that only a tiny fraction of immobilized ligate will be available to virions. The nature of binding to such an affinity matrix is not clear. Because the virions are presumably thin enough to partially penetrate the pores end first, for example, phage might bind a ligate just inside the interior and become "caged" in the immediate vicinity of the ligate; this could promote binding by increasing the effective off-time. The oxirane acrylic particles are small (-1/zm), hydrophilic, and nonporous; because they are not retained by any standard chromatography bed support, bound virions are separated from free virions by repeated centrifugation. Bound phages can be dissociated from immobilized ligand by means other than low pH, including competing free ligate or ligand and high pH (up to pH 11 for a few minutes). Phages are also resistant to urea (6 M for - 1 0 min, 4 M for >20 rain), sulfhydryl (e.g., 50 mM dithiothreitol), and trypsin (and probably many other specific proteases). Sometimes specific binding will be reversible, especially when the ligate is monovalent (see Discussion, below); in such circumstances binding will be manifested as delayed release even in a nondissociating wash buffer.

Quantifying Enrichment The progress of enrichment of binding clones can be followed crudely by spot-titering the input and output of the second and subsequent rounds 25 j. McCafferty, A. D. Griffiths, G. Winter, and D. J. Chiswell, Nature (London) 348, 552 (1990).

[15]


249

of biopanning (see Titering Transducing Units, above). The input for each round is the amplified eluate from the previous round. Yields substantially in excess of 3 x 10-5%--the background yield with wild-type phage--indicate enrichment of binding clones, although the binding responsible for enrichment is not necessarily specific. Yields on the order of 1-5 x 10-4% are often associated with sequence motifs that recur regardless of ligate specificity, as will be discussed later. Yields higher than 0.01% usually (but not always) indicate the presence of a strong binding sequence motif in the phage-borne peptide. Seldom is the yield higher than - 1 % , even when ligate is in excess, and the individual clones that predominate in the input give higher yields when propagated and tested individually. Analysis of Affinity-Purified Phage Biopanning and other affinity purification techniques yield clones even when there is no specific binding of the ligate to phage-borne ligand-hence the need for independent confirmation of specific binding. The amino acid sequences of the displayed ligands (determined by sequencing the coding nucleotides in the viral DNA) are the primary and most informative data, but in many instances it is useful to supplement those data with direct binding assays, including ELISA and a miniaturized version of biopanning we call "micropanning." Analysis starts by processing small cultures of individual affinity-purified clones.

Sequencing The experimenter with many affinity-purified clones to analyze faces an unusual sequencing problem: the number of clones to process is large (we usually sequence 20 per experiment), but the number of unknown bases is small (e.g., 18 for a hexapeptide epitope library). Moreover, the penalty for mistakes is low, because little work has been invested in individual clones. The protocol described in General Procedures (see Sequencing Template, Sequencing Reactions, and Pouring and Running Sequencing Gels, above) attempts to meet this demand; its main features are (1) use of an end-labeled primer, eliminating the need for a separate "labeling" reaction for each template to be sequenced, (2) use of combinations of dideoxy terminators at different concentrations to reduce the number of lanes per template from four to two ("two-lane sequencing"), and (3) piggy-backing two sets of sequences on a single sequencing gel. The essence of two-lane sequencing is the use of termination mixes containing combinations of ddNTPs: the Q mix contains high concentrations of ddATP and ddCTP and a 10-fold lower concentration of ddCTP;

250

MUTAGENESIS::~vND GENE DISRUPTION

[15]

while the R mix contains high concentrations of ddATP and ddGTP and a 10-fold lower concentration of ddCTP. When Q and R reactions are run side by side in a sequencing gel, a strong band in both lanes signifies an A residue in the synthesized strand; a strong band in the Q lane (and no band in the R lane) signifies T; a strong band in the R lane (and no band in the Q lane) signifies G; and a weak band in both lanes signifies C. Because this method depends on reliable intensity differences, MnCI2 is substituted for MgCI2 in the buffer to reduce nonuniform incorporation of ddNTPs. 26 Two-lane sequencing works well for up to - 6 0 bases; beyond that point it becomes difficult to see the weak C bands over the entire sequence without multiple exposures of the X-ray film. For longer sequences we use four termination mixes with combinations of ddNTPs at a uniformly high concentration: mixture W has ddATP and ddTTP; M has ddATP and ddCTP; K has ddGTP and ddTTP; and S has ddGTP and ddCTP. The W, M, K, and S reactions are run in that order in the sequencing gel. Bands in both the W and M lanes signify A in the synthetic strand; bands in the W and K lanes signify T; bands in the M and S lanes signify C; and bands in the K and S lanes signify G. This system provides considerable redundancy of information (e.g., any three of the lanes contain enough information to deduce the sequence), and requires only side-by-side alignment of bands, thus greatly reducing ambiguity in ordering residues in the sequence. The concentrations of ddNTPs in the termination mixes are appropriate for sequencing up to - 6 0 bases from the primer. When longer inserts are to be sequenced, the termination mixes are diluted with termination diluent, which has no ddNTPs but contains all the other components of the termination mixes; a one-fourth dilution is suitable for sequencing up to -200 bases, and a one-eighth dilution for up to -400 bases.

ELISA and Other Binding Assays Binding of ligate to the phage-borne ligand can be demonstrated by ELISA; this serves to confirm binding in a way that is quite different from the affinity purification that isolated clones in the first place. Here we describe an ELISA in which phage themselves are immobilized in the wells of microtiter dishes. Phage are partially purified for ELISA, and 35-/zl portions containing - 2 × 101° virions are placed in microtiter wells overnight in the refrigerator; it is a good idea to include negative control phage prepared in the same way. The wells are filled with 100/xl Blotto solution (see Recipes, above), emptied by shaking out the solution and slapping the dish face down on a clean paper towel to remove 26 S. T a b o r and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 86, 4076 (1989).

[15]


251

residual solution, refilled with 350 /zl Blotto solution, and incubated at least 90 min at room temperature to block nonspecific binding sites on the plastic surface. The wells are emptied, washed three times with TBS/ Tween, and filled with biotinylated ligate in 35/xl TBS/Tween/azide containing 1 mg/ml BSA. Biotinylated monoclonal IgG and Fab fragments are typically used at concentrations of 1 and 300 nM, respectively; other ligates may require different concentrations. After reaction for 1-24 hr at - 4 °, the wells are emptied, washed once with TBS/Tween, filled with 85 t~l avidin-peroxidase complex (see Recipes, above), and incubated at room temperature for 15-30 min. The wells are emptied, thoroughly washed 10 times with TBS/Tween, and filled with 85/~1 freshly prepared ABTS solution (see Recipes, above). The wells are then allowed to react - 1 hr at room temperature before being read on a plate reader. The difference between A405 and A495 is taken as the signal, although A405 alone serves well enough. The strongest signals amount to -0.6, while background is -0.02. Only relatively strong ligands give signals in this assay. The foregoing method requires that phages be partially purified to reduce impurities that might interfere with adsorption to the plastic or give a high background signal. Purification is a tedious undertaking when hundreds of clones are to be assayed, and in many cases it can be circumvented with the aid of an anti-phage antibody directed against the major coat protein. Labeled anti-phage antibody can be used for specific detection of phages that have bound immobilized ligate25; alternatively, immobilized anti-phage antibody can be used for specific capture of phages in order to follow their reaction with labeled ligate] 7 An attractive alternative to binding assays that use the phages themselves is chemical synthesis of the phage-borne peptides on plastic pins in a microtiter array. 28 The pin-borne peptides can be used directly in a microtiter assay that confirms binding of the ligate to the peptides in an entirely independent way.

Micropanning Micropanning is a miniaturized version of biopanning designed to test affinity purification on many individual clones] We will give here a method appropriate for confirming tight binding of an antibody to phage, then discuss modifications for detecting weak binding. To each well of a microtiter dish (e.g., Immulon-2; Dynatech, Alexandria, VA) containing 20/~10.1 M NaHCO3 is added 1/x1200/zg/ml streptavi.,7 W. J. Dower, personal c o m m u n i c a t i o n , 1991. 28 H. M. G e y s e n , Immunol. Today 6, 364 (1985).

252


[15]

din; the streptavidin is allowed to coat the plastic overnight in a humidified chamber in the refrigerator. Meanwhile, the wells of another microtiter dish are filled with 20/zl 0.1-1 nM biotinylated antibody in TBS/azide with 1 mg/ml dialyzed BSA, and 1/xl of each culture supernatant (typically 4.5 × l 0 7 T U ) is added to one of the wells; the reaction is allowed to proceed overnight in the refrigerator in a humidified chamber. The next day the wells of the streptavidin-coated plate are emptied, filled with blocking solution, reacted 1 hr at room temperature, and emptied and washed four times with TBS/Tween. Meanwhile, the phage-antibody reactions are diluted with 90/zl TBS/Tween and 15-/zl portions are transferred into the streptavidin-coated wells. After I0 min at room temperature the wells are emptied, washed I0 times with TBS/Tween, and eluted with 20/xl elution buffer. After 10 min at room temperature the elution buffer is neutralized by adding 140 /xl of a 69:1 (v/v) mixture of TBS and 2 M Tris (pH unadjusted). Four-microliter portions of the neutralized eluates are pipetted into the wells of a microtiter dish containing 10/~1 K-91 starved cells, and after 10 min at room temperature 336 ~1NZY medium containing 0.2/zg/ml Tc is added to each well. After incubation at 37 ° for 30-45 min, 20-/xl portions are spotted onto NZY/Tc agar medium. Strongly positive clones give >50 colonies per spot, indicating a yield of - 1 % , while negative clones give 0-1 colony per spot, possibly representing contamination from neighboring wells rather than genuine yield. This procedure can be modified at several points to detect weaker binding: (1) the phage-antibody reactions need not be diluted before the 15-/.,1 portions are pipetted into the streptavidin-coated dish; (2) eluates can be neutralized with 1.2 ~12 M Tris; (3) 20-~1 portions of the neutralized eluates can be spotted directly on an NZY/Tc agar medium that has previously been seeded with 1 ml of log-phase K-91 culture poured in - 3 ml soft agar. When weak binding is to be detected, it is also advantageous to titer dilutions of the original culture supernatants to control for variations in phage yield.

Summary of Results In this section we emphasize experiments with our hexapeptide epitope library, in which the N-terminal sequence of pIII is ADGAX6GAAGA-, X6 being the variable peptide. We have biopanned the library with at least five monoclonal antibodies (MAbs) that were known or suspected in advance to be specific for continuous peptide epitopes--that is, epitopes composed of amino acids that are contiguous in the primary sequence of the eliciting antigen. All of them identified peptide ligands with a Consensus sequence similar to that of the

[15]


253

eliciting epitope. Often there were a few differences between the phageborne peptides and the eliciting epitope; but in those cases in which the specificity of the MAb had been studied independently by binding studies with synthetic peptides, the differences turned out to be mostly at positions that are tolerant of multiple substitutions. When binding of the antibody to phage has been checked by ELISA, strong binding is evident (ELISA signal, 0.3-0.6). The foregoing results contrast with those using ligates that were not known in advance to bind continuous epitopes. In Table II we summarize results of three parallel biopannings with such ligates. MAb 3-4B is a mouse monoclonal IgM that reacts with the large subunit of Caenorhabditis elegans RNA polymerase II and with a fusion protein containing 148 residues of that polypeptide] 9 Insulin normally binds a cell surface receptor, although it has also been shown to bind a hexapeptide. 3° IL-2R~ is the extracellular binding domain of the small (o0 subunit of the IL-2 receptor; it binds the polypeptide hormone IL-2 without the large subunit. 31'32 For each ligate the table shows the peptide sequences (X6) displayed by each affinity-purified clone, and the ELISA signal with each of the three ligates. As Table II shows, a single peptide sequence PTWRSM predominates among the clones affinity purified with MAb 3-4B. Phage displaying this peptide reacted weakly with the MAb (ELISA signal, 0.03), but still at least 10-fold above the background signal and all the other ELISA signals reported in Table II (0.000-0.003). The consensus peptide shows no convincing similarity to any continuous hexapeptide segment of the antigen. This contrasts with our results using antibodies specific for continuous epitopes discussed above, and raises the possibility that PTWRSM is an example of what Geysen and coUeagues 33'34 call a " m i m o t o p e " m a short peptide that mimicks the binding properties of an assembled epitope (one formed from residues distant in the primary sequence of the antigen but contiguous in its folded structure). A few other MAbs specific for assembled epitopes have identified putative mimotopes in our epitope library, ~9 j. Prenger, M. Golomb, and J. Jones, personal communication (1991). 30 V. P. Knutson, J. Biol. Chem. 263, 14146 (1988). ~ B. F. Treiger, W. J. Leonard, P. Svetlik, L. A. Rubin, D. L. Nelson, and W. C. Greene, J. lmmunol. 136, 4099 (1986). 32 j. Haikimi, C. Seals, L. E. Anderson, F. J. Podlaski, P. Lin, W. Danho, J. C. Jenson, A. Perkins, P. E. Donadio, P. C. Familletti, Y. E. Pan, W. Tsien, R. A. Chizzonite, L. Casabo, D. L. Nelson, and B. R. Cullen, J. Biol. Chem. 36, 17336 (1987). 33 H. M. Geysen, S. M. Rodda, and T. J. Mason, in "Synthetic Peptides as Antigens" (R. Porter and J. Whelan, eds.), p. 130. Wiley, New York, 1986. 34 H. M. Geysen, S. M. Rodda, and T. J. Mason, Mol. Immunol. 23, 709 (1986).

254

[15]

MUTAGENESIS AND GENE DISRUPTION T A B L E 1I RESULTS OF BIOPANNING EXPERIMENTa

E L I S A signal ( × 103) with Ligate

N u m b e r of clones

MAb3-4B

10 1 1 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I 1 1

Insulin

IL-2Ra

X 6 sequence

PTWRSM TRMRPG VLLSVA INQVRF WCSRLF PCHCSF RGYFFK ATWAVL AVMTSS SWFLQW REWlSH YTALLI CYLCSV LFSSGK VWHLLH VPWWVP LSRILF PGHSPW WNLRSS IALMDY RAWSYV KGRYQQ EHGRPQ GCSDVL NLLSMT CLGEHD RFYGGS ILPLRI LSRSYF NLYLVH AWFRRL LRGKLS VDVGRS

M A b 3-4b

Insulin

IL-2Ra

30-33 2 1 2 2 1 0 0 0 0 0 0 - 1 1 3 0 1 1 0 0 0 1 0 - 1 - I 0 - 1 1 0 2 0 - 1 1

0-3 3 3 3 3 1 2 I 1 1 1 1 0 4 0 1 0 0 1 1 0 0 0 1 0 1 0 1 1 0 0 1 1

0-3 3 2 3 2 1 1 1 1 1 1 1 1 2 1 0 1 1 1 1 2 1 2 2 1 1 1 1 1 1 1 1 2

a The experiment is explained in text.

but most such antibodies have given results similar to those with insulin and IL-2Ra to be discussed in the next paragraph. Unlike MAb 3-4B, neither insulin nor IL-2Ra yielded affinity-purified clones with a consensus sequence; nor did any of the phages bind either ligate by ELISA (Table II). At best, therefore, these phages display weak ligands with little sequence specificity; and it is entirely possible that they

[15]


255

represent merely the low background of nonspecific yield observed when any nonbinding phage is subjected to the biopanning procedure ( - 3 x 10-5%). These data are included here merely as an example of sequence and ELISA results we ordinarily regard as negative, and should not be overinterpreted. For instance, we did not show by any independent experiment that either biotinylated ligate retained its binding capacity. Furthermore, unlike antibodies, both these ligates are monovalent and for that reason may release even tight-binding phages during the long washes of the biopanning procedure (see Discussion, below). Two consensus sequences are observed repeatedly with a variety of antibodies and other ligates: PWflWLX (where fl is usually either A or E), and GDWVFI and related variants. Presumably, these peptides bind some component of the system other than the ligate. The binding must be weak, because the peptides never appear when strong ligands are identified with antibodies against continuous epitopes. The presence of these peptide sequences indicates that the ligate has not identified a strong ligand in the library. Although the absence of a strong ligand is presumably a necessary condition for observing these peptides, it probably is not a sufficient condition: if none of these weak ligands happens to survive the first round of biopanning, when each clone is represented by only -100 TU, it obviously cannot become a consensus sequence after further rounds. Discussion

Biopanning and Kinetics of Binding The mechanism of purifying binding phages from the library is complex. Phages are reacted with a biotinylated ligate, then the complexes are diluted, bound to streptavidin-coated plates, washed extensively, and eluted. The apparent off-rate of phage-borne peptides must be low for them to remain bound through 30-60 rain of washing. In cases where dissociation constants of free peptides were known, the off-rates of phages bearing a peptide of known sequence were orders of magnitude lower than the presumed off-rate of the corresponding free peptide. This discrepancy may be explained by assuming that the phages, which bear up to five copies of each epitope, allow multivalent binding to the antigen-binding sites on antibodies (and some receptors). This "avidity boost" would greatly reduce the apparent binding off-rate, because once binding has occurred there would be a much lower chance of both binding sites being released simultaneously. It is also possible that other factors, such as the slower diffusion rate of phage compared with free peptide, may play a role in this effect. In every case tested, when intact, bivalent antibody contin-

256


[15]

ues to bind phage after extensive washing, the corresponding Fab' does also; however, about a 100-fold higher concentration of Fab' is required to produce the same effect. Although this may reflect true monovalent affinity of the binding site for phage-borne ligand, it is equally possible that it is due to the presence of a small fraction of bivalent species in the Fab' preparations. If multivalency of binding sites is required for biopanning to be successful, it is not surprising that, as yet, even moderateaffinity peptides have not been identified when the hexapeptide library has been screened with monovalent ligates such as insulin and IL-2Ra (see above). The effect of valency on binding off-rate awaits testing with indisputably monovalent ligates or phage-borne epitopes.

Can Ligands Be Found for Most Binding Proteins? In the beginning we hoped the hexapeptide epitope library would contain strong ligands for virtually any binding protein. In the case of antibodies against continuous peptide epitopes this hope has been fulfilled, but as discussed above there are many ligates--particularly antibodies against assembled epitopes--for which tight ligands cannot be isolated from the hexapeptide epitope library. There are at least two possible reasons for this failure. First, some binding sites may require structural features that cannot be effectively mimicked by short peptides. Second, the particular invariant residues that flank the hexapeptide epitope in our library may be nonpermissive for binding to some ligates. These difficulties might be overcome with epitope libraries that display longer variable regions, or with "constrained" epitope libraries in which structural constraints restrict the variable residues to particular conformations. Such constraints might be imposed by disulfide bonds, or by displaying the variable residues in the context of a small structured domain fused to the coat protein (see the next section). We speculate that a limited number of structured libraries might suffice to provide strong ligands for almost any ligate.

Cloning Structured Domains A variety of small protein domains have been fused to pIII and pVIII for the purposes of making libraries and studying mutant proteins. Bass and co-workers H expressed human growth hormone (hGH) on virions using a construct in which the exposed N-terminal domain of pIII was replaced with the 191-residue hormone. The hGH-phage retained full infectivity, as no more than one of the five pIII proteins on each virion was recombinant; the remaining pIII molecules were supplied by a helper phage, and were wild type. The hGH-phage bound hGH receptor and MAbs that recognize only the native structure, showing that the fusion

[15]


257

protein folded properly, and could be specifically enriched from nonrecombinant phage on hGH receptor-coated beads. McCafferty et al. z5 constructed an N-terminal pIIl fusion displaying a single-chain antibody specific for hen egg-white lysozyme. These so-called "phage antibodies" retained native specificity and could be enriched from nonrecombinant phage on lysozyme affinity columns. Parallel work by Kang et al. 12 shows that as many as 30 Fab domains can be displayed along the length of virions as fusions to the gene VIII protein; the bulk of the pVIII molecules are wild-type subunits encoded by a helper phage. These examples demonstrate that foreign domains displayed by phage can retain at least partial native folding and activity, and that phage displaying these fusion products can be selectively enriched by affinity purification. This capability suggests the feasibility of libraries in which sequence variability (ranging from a low frequency of substitutions to totally random sequences) can be targeted to specific regions in a folded protein domain. P h a g e - A n t i b o d y Libraries

Phage-antibody libraries may be seen as an extreme form of constrained epitope library. The immunoglobulin framework residues provide a rigid scaffolding for displaying six variable peptides--the so-called complementarity-determining regions (CDRs), three of which are present in both the light and heavy chain variable regions. It is the CDRs that primarily determine the binding specificity of an antibody. Different clones in the phage-antibody library would display different antibody domains with different specificities. A great diversity of specificities would be incorporated into the library as a whole, either by cloning the natural repertoire of antibody genes present in animals, or by randomizing the CDRs. An ideal phage-antibody library--not yet a reality--would include antibodies specific for any antigen. It would be manufactured on a large scale and distributed to multiple experimenters, who would use their chosen antigens to affinity purify out of the library those phage whose displayed antibody domains bind with highest affinity. Affinity might be improved by subjecting these initial clones to further rounds of random mutagenesis and selection by affinity purification. These may be the monoclonal antibodies of the future: produced without need for animals or animal cells in culture, and available to any laboratory able to carry out simple recombinant DNA techniques.

258


[16]

[16] U s e o f M 1 3 P i n g - P o n g V e c t o r s a n d T 4 D N A P o l y m e r a s e in O l i g o d e o x y n u c l e o t i d e - D i r e c t e d M u t a g e n e s i s B y MARY M . Y . W A V E

Introduction Oligodeoxynucleotide-directed mutagenesis has undergone rapid improvement since its introduction. 1 Although "single priming" without strand selection using a repair host strain generally gives acceptable resuits, 2,3 various methods of improving the efficiency of mutagenesis have been developed. They rely on selection against the parental template, via (1) the use of EcoK/EcoB selection, 2'4 (2) the use of nonsense c o d o n s Y (3) the use of hemimethylated D N A , 6'7 (4) the use of phosphorothioatemodified DNA, 8-1° or (5) the use of a uracil-containing parental template that is inactivated by uracil N-glycosylase. 11.12Deletion mutagenesis using oligodeoxynucleotides can be problematic without any selection. The frequency of deletion mutants can vary from 0.4 to 2 0 % . 4'13 This chapter describes a new vector, M13B119, and an improved strategy for "cyclic selection" that is especially useful for creating multiple mutations with large deletions. Another new vector, M13K119W, is also used to demonstrate how the conditions for oligodeoxynucleotide-directed mutagenesis can be optimized. For example, an improvement of 2- to 18-fold can be obtained with deletional mutagenesis using T4 DNA polymerase. However, the use of different polymerases, including T4 polymerase, Sequenase (trade name for a modified T7 DNA polymerase; United States Biot M, Smith, Annu. Rev. Genet. 19, 423 (1985). 2 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 3 p. Carter, this series, Vol. 154, p. 382. 4 M. M. Y. Waye, M. E. Verhoeyen, P. T. Jones, and G. Winter, Nucleic Acids Res. 13, 8561 (1985). 5 W. Kramer, V. Drutsa, H. W. Jansen, B. Kramer, M. Pflugfelder, and H.-J. Fritz, Nucleic Acids Res. 12, 9441 (1984). 6 W. Kramer, K. Schughart, and H.-J. Fritz, Nucleic Acids Res. 10, 6475 (1982). 7 A. Marmenout, E. Remaut, J. Van Boom, and W, Fiers, Mol. Gen. Genet. 195, 126 (1984). 8 D. B. Olsen, J. R. Sayers, and F. Eckstein, this volume [13]. 9 j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985), 10j. W. Taylor, J. Ott, and F. Eckstein, Nucleic Acids Res. 13, 8765 (1985). ii T. A. Kunkel, Proc. Natl. Acad. Sci. U.S.A. 82, 488 (1985). lZ T. A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. 13 V.-L. Chan and M. Smith, Nucleic Acids Res. 12, 2407 (1984).

METHODS IN ENZYMOLOGY.VOL. 217

Copyright© 1993by AcademicPress, Inc. All fightsof reproductionin any formreserved.

[16]

M13 VECTORS FOR SITE-DIRECTED MUTAGENESIS

259

chemical Corporation, Cleveland, OH), and pollk (the Klenow fragment of Escherichia coli DNA polymerase), gives similar ratios of true mutants to spurious deletional mutants. The use of higher temperature (37 or 20° instead of 15°) helps to reduce the percentage of spurious deletional mutants by approximately 10-20%.

Principles of Method

Design of Oligonucleotide Primers The design of oligonucleotide primers has been reviewed, z Competing priming sites can be avoided by comparing the proposed sequence of the oligonucleotide with that of the vector and cloned insert by using a computer program such as ANALYSEQ. ~4 Furthermore, it is necessary to ensure that the two primers do not have large regions of homology when using "coupled primer" selection. More recently, computer programs, for example, Primer Designer, GeneJockey, and Oligo have also been developed to evaluate primer designs. Primer Designer is available from Scientific and Educational Software (PA), GeneJockey is available from Biosoft (Cambridge, England), and Oligo is available from National Biosciences (Plymouth, MN).

Use of EcoK/EcoB Selection If double-stranded DNA containing an EcoK site is introduced into a K strain (rK + mK+), the DNA will be either modified if one strand is already modified or it will be restricted if neither strand is modified. ~5-17The same principles apply to EcoB sites introduced into a B strain (rB + mB+). 18 Because the M13 DNA replicates rapidly and the amount of EcoK enzyme in a bacterium is limiting, a substantial amount of DNA escapes restriction if only one copy of EcoK is used as a selection site. This problem can be overcome by using four tandem copies of the EcoK site as the selection site. 4 This chapter describes the use of new vectors with four overlapping copies of EcoB or EcoK sites so that the selection primer and the selection site can be smaller and more portable. 14 R. Staden, Nucleic Acids Res. 12, 521 (1984). 15 N. C. Kan, J. A. Lautenberger, M. H. Edgell, and C. A. Hutchison IIl, J. Mol. Biol. 130, 191 (1979). 16 p. Modrich, Q. Rev. Biophys. 12, 315 (1979). 17 R. Yuan, Annu. Rev. Biochem. 50, 285 (1981). i8 j. A. Lautenberge, M. H. Edgell, C. A. Hutchison III, and G. N. Godson, J. Mol. Biol. 131, 871 (1979).

260


[16]

Use of M13 Ping-Pong Vectors The technique described in this chapter is designed to increase mutant yield by selecting against progeny phage from the parental M13. One oligonucleotide is used to construct the "silent" deletion or mutation of interest and a second primer (selection primer 1) to remove a selectable marker (four overlapping copies of EcoB) in the template. These two primers are then extended by T4 DNA polymerase and the nascent strands ligated to the kinased primers. The heteroduplex DNA is then used to transfect an E. coli host strain that has the EcoB restriction enzyme so that the template strands and any progeny that copied the EcoB sites will be selected against. Only the progeny phage from which the selectable marker (four overlapping copies of EcoB) has been removed will be viable. At the same time that the first selection marker (four overlapping copies of EcoB) is removed, another selection marker (four overlapping copies of EcoK) is introduced by the first selection primer so that the process can be repeated again for constructing a second, "silent" deletion or mutation of interest. The second silent deletion will be accompanied by a second selection primer 2, which will remove a selectable marker (four overlapping copies of EcoK) from the template and add another selection marker (four overlapping copies of EcoB). Thus, multiple deletion or mutations can be constructed by cycling between these two selectable markers.

Use of Different DNA Polymerases The three different polymerases used in this study have different properties. T4 DNA polymerase has a 5' ~ 3' polymerizing activity and a 3' ~ 5'-exonuclease activity; unlike E. coli DNA polymerase, it does not have a 5' ~ 3'-exonuclease activity.19 The Klenow fragment of E. coli DNA polymerase I has a 5' ~ 3' polymerizing activity and a 3' --~ 5'-exonuclease activity, but lacks the 5' ~ 3'-exonuclease activity, z° Sequenase, which is a modified T7 DNA polymerase, has high processivity and low 3' ~ 5'-exonuclease activity. 2~ T4 DNA polymerase has been used for oligodeoxynucleotide-directed mutagenesis in preference to the Klenow fragment of E. coli DNA polymerase 1222due to its lack of strand displacement of the mutagenic primer, z3 This chapter describes the use of the EcoK/EcoB vectors in choosing between the three polymerases and in optimizing the temperature of the polymerization/ligation reaction. 19 N. G. Nossal, J. Biol. Chem. 249, 5668 (1974). 20 H. Jacobsen, H. Klenow, and K. Overgaard-Hansen, Eur. J. Biochem. 45, 623 (1974). 2l S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 84, 4767 (1987). 22 j. Geisselsoder, F. Witney, and P. Yuckenberg, BioTechniques 5, 785 (1987). 23 M. Goulian, Z. J. Lucas, and A. Kornberg, J. Biol. Chem. 243, 627 (1968).

[16]

M13

VECTORS

FOR

261

SITE-DIRECTED MUTAGENESIS

TABLE I M13 VECTORS WITH EcoK/EcoB SELECTION MARKER(S) MI3 strains MI3KI8 M13K19 M13BI8 M13BI9 M13Kll MI3K11RX M13KII9 M13BI19W MI3KII9W MI3BlI9

EcoK

EcoB

Blue/White

EcoB in II a

Ref.

---

B B

---

b b

1x

B

--

b

1x

-+ + -----

b

---4 × ovlp -4 x ovlp

B B B B W W B

1x 1x

4x 4x 4x 4x

--tdm" tdm tdm -ovlp" --

c d d d, e d, f

" EcoB in II: the presence of EcoB site in gene H of M 13; tdm, tandem; ovlp, overlapping. b p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). ' M. M. Y. Waye, M. E. Verhoeyen, P. T. Jones, and G. Winter, Nucleic Acids Res. 13, 8561 (1985). d M. M. Y. Waye, F. Mui, and K. Wong, Technique 1, 188 (1989). e Starting clone for studies of different polymerases and polymerization/ligation temperature. Starting vector used for c-fos cyclic deletion experiments described as an example in this chapter. Materials

and Methods

Experimental Details Enzymes. T4 DNA polymerase and T4 DNA ligase are purchased from P h a r m a c i a ( P i s c a t a w a y , N J ) ; p o l I k , t h e K l e n o w f r a g m e n t o f E. coli D N A p o l y m e r a s e I, is p u r c h a s e d f r o m e i t h e r B e t h e s d a R e s e a r c h L a b o r a t o r i e s ( G a i t h e r s b u r g , M D ) o r P h a r m a c i a ; S e q u e n a s e is p u r c h a s e d f r o m U S B (United States Biochemical Corporation). B a c t e r i a l S t r a i n s a n d V e c t o r s . T h e f o l l o w i n g E. coli s t r a i n s a r e u s e d : A C 2 5 2 2 : A n E. coli s t r a i n t h a t h a s E c o B b u t n o E c o K r e s t r i c t i o n e n z y m e : B / r , H f r , sul-124 J M 1 0 1 : a n E. coli s t r a i n t h a t h a s E c o K b u t n o E c o B r e s t r i c t i o n e n z y m e 25 T G I : A n E. coli K - 1 2 s t r a i n t h a t h a s n o E c o K r e s t r i c t i o n e n z y m e 26 Vector M13K119W: Used to test the different conditions Vector M13Bl19: Used as the starting vector for the cyclic deletion e x p e r i m e n t s ( s e e T a b l e I) 24 H. Boyer, J. Bacteriol. 91, 1767 (1966). -,5 j. Messing, Recomb. DNA Tech. Bull. 2, 43 (1979). 26 T. J. Gibson, Ph.D. thesis. University of Cambridge, Cambridge, England, 1984.

262


[16]

Methods for mutagenesis are essentially the same as those described previously, 2'27'28 except for the following:

Hybridization 1. Anneal primer and template together in an Eppendorf tube: Kinased primer 1 (5 pmol//zl), 2/zl Kinased primer 2 (5 pmol//zl), 2 ~1 Template (1 /~g/~l), 1 /xl TM buffer (10 × ) [100 mM Tris-HC1 (pH 8.0), 100 mM MgClz], 1/zl Water, 4/zl 2. Place the tube containing the sample in a small beaker of hot water (80°), and let cool to room temperature. This will take about 30 min.

Extension/Ligation I. Add to the annealing mix: TM Buffer (I0 x ), 1 p.l rATP (5 mM), 1 /xl dNTPs (5 mM), 1 /xl Dithiothreitol (DTT) (100 mM), 1 p.l Water, 4/xl 2. Place on ice and then add T4 DNA ligase (10 U; Pharmacia) and Klenow fragment of DNA polymerase (3 U; Pharmacia). Then incubate 12-20 hr at 15° or other specified temperatures. For experiments on testing different polymerases, either Sequenase (3 U) or T4 DNA polymerase (3 U) was used instead of the Klenow fragment of DNA Polymerase, and the temperature of extension/ligation was either 15, 20, or 37°.

Results of Experiment The four times-overlapping EcoB vector was used to delete all three introns of the c-fos gene by a double-primer strategy (see Fig. 1 for a schematic diagram, Fig. 2 for the DNA sequence of the selection primers, and Fig. 3 for the polylinker region of the vector M13B 119). The following oligonucleotides were used: The 45-mer (sel 1): 5'-CCC TA(G CAC GCA CCG GTT AGT TGC ACG CAC ACG TTA GTT) TCA TTG-3' was used to construct M13K119. The nucleotides in parentheses are complementary to nucleotides that 27 W.-Y. Shen and M. M. Y. Waye, this series, Vol. 218, pp. 58-71. 28 W. Shen and M. M. Y. Waye, Gene 70, 205 (1988).

[16]

263

M13 VECTORS FOR SITE-DIRECTEDMUTAGENESIS 4X ECOB

Grow M13 c-fos in TG1 (EcoK," Ecol')

B

+ DEL #1 PRIMER + SEL #1 PRIMER (4 X ECOK ) M13 C-FOS

AC2522

ECOWECOB SELECTION

( ECOB +)

+ SEL#2 PRIMER (4 X ECOB) + DEL #3 PRIMER

B

SELECT IN JM101 ( ECOK + )

0

+ SEL #1 PRIMER ( 4 X ECOK)

K L.

+ DEL #2 PRIMER l

(9 SELECT IN AC2522 ( ECOB +)

K

i3cFosl intron -

FIG. 1. A schematic diagram of the cyclic deletion strategy using double primers and the MI3Bl19 vector. Intron 1 was removed first, followed by removal of introns 3 and 2.

h a v e four overlapping copies of the EcoK site. The deletion primer for deleting the introns were (deI1):5'-dGTCAACGCGCAGGACTTCTGCACG (deI2):5'-dAAGGTGGAACAGTTATCTCCAGAA (del3):5'-dACACTCCAAGCGGAGACAGACCAA The sequencing p r i m e r (spl) for analyzing the deletion in the first intron was 5 ' - d T C C C G T T G T G A A G A C C A .

Cloning of c-fos D N A Insert into an M13 Ping-Pong Vector M13B119. The plasmid pF4 (which has the 5.4-kb BamHI fragment of the h u m a n

264

MUTAGENESIS AND GENE DISRUPTION l E(X~ I

[16]

TGN~NNNNNNNTGCT TGANNNNNNNNTGCT TGANNNNNNNNTGCT

I

T j GANNNNNNNNTC.-,CT

M13B119 IA'I-rCCCAACCTGAAACTGACGTGCTGATGCTGATGTGCTCGTGC'I-rAAGGGGATCC 3' 56-MER ITAAGGGTTGGACTI-I'GACTGCACGACTACGACTACACGAGCACGAATTCCCCTAGG 5' # 2 51-MER Ir CTTAAGGG'I-I'ACTI-rGACTGCACGACTACGACTACACGAGCACGATCCCCT. 5' #1 45-MER & 3 ' GI'I'AC'ITI'GA'I-I"GCACACGCACGI-I'GA1-FGGCCACGCACGATCCC5' M13K119W [ 5' CAATGAAACTAACGTGTGCGTGCAACTAACCGGTGCGTGCTA~3' AACNNNNN~TGC E(X]K AACNNNNNNGTGC l AACNNNNNNGTGC

I

I'

MC,NNNNNNGT~ FIG. 2. The DNA sequence of the selection primers 1 and 2 used for the cyclic deletion strategy described in Fig. 1 and the 56-mer oligonucleotide used for constructing the vector M I3B 119. The overlapping EcoK and EcoB sites are shown below and above the primers, respectively.

c-los gene 29'3°) was obtained from N. Miyamoto (Ontario Cancer Institute, Toronto, Canada). The AurlI-NotI fragment (2.657 kb) ofpF4 was cloned into the EcoRV site of vector M 13B 119 and the orientation was confirmed by D N A sequencing using the universal priming site. The resultant clone was named M13 c-fos and single-stranded D N A template was grown in TG1 (EcoK-, EcoB-). Removal of First Intron. Both the selection primer (sel 1, a 45-mer with four copies of EcoK) and the deletion primer (del 1) were used for the mutagenesis experiment and the heteroduplex was transformed into AC2522 (EcoB +). When selection was used (by transfecting AC2522 with the heteroduplex), 28% of the transformants obtained were hybridization positive with the deletion primer and 30% of the clones sequenced were true positive. (Thus an overall percentage true positive of 28% x 30% = 8%.) However, when no selection was applied (by using either TG1 cells or by omitting the selection oligonucleotide, only 1 or 0% of overall true positive clones were obtained (see Table II and Table III). Removal of Third Intron. Both the selection primer (sel 2, a 51-mer with four copies of EcoB) and the deletion primer (del 3) were used for the mutagenesis experiment and the heteroduplex was transformed into JM101 (EcoK+). 29 T. Curran, W. P. MacConnell, F. Van Straaten, and I. M. Verma, Mol. Cell. Biol. 3, 914 (1983). 3o F. Van Straaten, R. MOiler, T. Curran, C. Van Veveren, and I. M. Verma, Proc. Natl. Acad. Sci. U.S.A. 80, 3183 (1983).

[16]


lacZ ~ M T M I T ATGACCATGATT~ TACIWoG~ACTAA -

265

AccI SalI Hind II

Hind Ill

TAC~L~GATATCGAG TCTCL~ATAGCI~ Xbal EcoRV

PstI

Four EcoB sites . o . °

° . o °

° o o °

. . ° °

::: ::: ::: ::: GGTAGGAA~CmAACTGA~~YGIGCTCGTCf2AAA CF_ATCCI~~CITIW_~~CTACGACTACACGA~_ACV_~ATTT ECORI

FXa recognition site 4V---R G E I GGGC~TCCGTCGACCTA~TGGA _ T'IV_A~ CCCL~AGGCA~T C~GAGCTACCTAGGGC4X~~AAGSC~EF/;G - -~I SacI - Bar~qI SalI AccI BamHI EcoRI SmaI FspI

HgiEII

// PvuI

Bgl

Ystll

universal sequencing primer

FIG. 3. The DNA sequence of the polylinker region of the vector MI3B119. The colons above the sequence indicate the first 3 bp of the EcoB restriction sites. The dots above the sequence indicate the last 4 bp of the EcoB restriction sites.

Removal of Second Intron. Both the selection primer (sel l, a 45-mer with four copies of EcoK) and the deletion primer (del 2) were used for the mutagenesis experiment and the heteroduplex was transformed into AC2522, which is EcoB +. Conditions for the mutagenesis experiment used in deleting the introns of c-los were as previously described, 4 except that two primers were used in this study and the starting vectors were different. Test of different DNA Polymerases and Temperature of Extension/ Ligation. The phage M 1 3 K l l 9 W , which has four copies of EcoK and a

266

[16]


T A B L E II EFFECT OF E c o K OR E c o B SELECTION ON FREQUENCY OF HYBRIDIZATION POSITIVES a Oligo used

Results obtained with hybridization E. coli used

Deletion oligo

Selection oligo

A1 A1 A1

N u m b e r of base pairs deleted

EcoK/B

Strain

45-mer 45-mer None

EcoB +

AC2522 TG 1 TG1

753

A2 A2 A2

45-mer 45-mer None

EcoB ÷

AC2522 TG1 TG1

431

A3 A3 A3

51-mer 51-mer None

EcoK +

JM101 TG1 TGI

113

---

---

---

Number positive

Number screened

Percentage positive

Improved ratio

27 16 32

97 200 200

28 8 16

23x

65 38 37

197 200 200

33 19 19

1.7x

35 13 15

85 88 88

41 15 17

2.6x

Oligo, oligodeoxynucleotide. Improved ratios were obtained by dividing the percentrage positive of the first row by the average percentage positive of the controls (second and third rows) for each group.

white phenotype, was used for the experiments described in Figs. 4 and 5 of this study. The selection primer (a 56-mer oligonucleotide) was used to generate M13B 119, which has four overlapping copies of EcoB, using M13K119W as the template. Mutants that have lost the EcoK sites were selected by transfecting the heteroplex into JM101 cells, which have the EcoK restriction enzyme. The 56-mer deleted the four copies of EcoK while introducing the four copies of EcoB. The use of higher temperatures (37 or 20 ° instead of 15°) increases the efficiency of mutagenesis T4 DNA polymerase by 10-20% (see Fig. 4, compare bars on the left or bars on the right). In the presence of selection (i.e., by transfecting the heteroduplex in JM101), Sequenase and T4 DNA polymerase or pollk do not differ significantly in their ability to generate T A B L E III EFFECT OF E c o K OR E c o B SELECTION ON FREQUENCY OF CLONES WITH CORRECT SEQUENCE Results obtained by sequencing

Oligo used E. coli used

Deletion oligo

Selection oligo

AI A1 AI

45-met 45-mer None

EcoK/B

Strain

True positives

Spurious mutants

EcoB

AC2522 TGI TG1

3 1 0

10 7 10

---

Percentage true positives (3/10), 30% (1/7), 14% (0/10), 0%

Overall percentage true positives a (28% x 30%) = 8% (8% × 14%) = 1% (16% × 0%) = 0%

a Oligo, oligodeoxynucleotide. Overall percentage true positives are obtained by multiplying the percentage hybridization positives from Table II by the percentage true (sequenced) positives from Table III.

[16]

M I 3 VECTORS FOR SITE-DIRECTED MUTAGENESIS

267

80

6O

4o

20

0 3.25

6.25

Units of Enzyme used FIG. 4. The difference in the efficiency of mutagenesis obtained at different temperatures of incubation. Black bars, T4, 37°, JM + ; white bars, T4, 20°, JM + ; gray bars, T4, 15°, JM +.

nonspurious deletional mutants (compare the black bars in Fig. 5); in the absence of selection, T4 polymerase gives higher percentages of mutants (compare the open bars in Fig. 5). DNA sequence analysis was performed to confirm that blue plaques are bona fide mutants: 24 of 24 clones sequenced have the correct sequence, whereas white plaques have either 80

60

40

~-

20

T4 pol

Pollk

Sequenase

E n z y m e used FIG. 5. The effect of using different enzymes on the frequency of mutation, n , With selection; [], without selection. T4 pol, T4 DNA polymerase; Pollk, Klenow fragment of E. co/i DNA polymerase; Sequenase (trade name for modified T7 DNA polymerase).

268


[16]

shifted reading frames (15 out of 24 sequenced) or their universal priming site deleted (9 out of 24 sequenced).

Schemes 1. Synthesize the following selection primers: The 45-mer (sel 1): 5'-CCC (TA(G CAC GCA CCG GTT AGT TGC ACG CAC ACG TTA GTT) TCA TTG-3' and the 51-mer (sel 2): 5'-TCC CCT (AGC ACG AGC ACA TCA GCA TCA GCA CGT CAG TTT CA)T TGG GAA TTC-3'. Purify the primers by polyacrylamide gel electrophoresis. 2. Design and synthesize the appropriate mutagenic and sequencing oligonucleotides for analysis of the deletion junction. 3. Grow (e.g., 50/zg from 100-ml cultures) RF of M13Bl19 in TG1 cells, digest the vector DNA and also the DNA of interest, then clone the insert into any unique restriction site upstream of the EcoB selection sites of M13Bl19 (e.g., the EcoRV site). 4. Grow single-strand DNA template of the recombinant M13 in TG1 for mutagenesis (e.g., 18/xg from 6-ml cultures). 5. Kinase the deletion primer and selection primer 1. Anneal the recombinant phage DNA with the two primers, extend using T4 DNA polymerase, and ligate with T4 DNA ligase at 37°. Prepare overnight cultures of AC2522. 6. Transform AC2522 with the heteroduplex using the method of Hanahan. 3~Pick plaques and grow them on agar plates as infected colonies (the expected number of plaques is approximately 200//zg of heteroduplex transformed). Hybridize the infected colonies with 32p-labeled deletion primer 1 and plaque purify putative positive clones (optional). 7. Sequence putative positive clones (-20) with an appropriate sequencing primer. 8. Plaque purify and grow up the resultant true positive clone in AC2522 and mutagenize with the second deletion primer and selection primer 2. Prepare overnight cultures of JM 101 for Hanahan transformation the next day. 9. Repeat steps 6 to 8 to isolate and characterize any additional mutants.

Troubleshooting for Ping-Pong Mutagenesis Method Table IV lists problems, possible causes, and remedies useful in PingPong mutagenesis studies. 3I D. Hanahan, J. Mol. Biol. 166, 557 (1983).

[16]

269


TABLE IV TROUBLESHOOTING FOR PING-PONG MUTAGENESIS METHOD

Problem Low number of transformants (close to background)

Possible causes Polymerase or ligase activity too low

Use flesh polymerase or ligase

Primers degraded

Use fleshly kinased primers Use lower temperature for annealing/extension and ligation reaction Repeat with gel-purified primers Use RNase or PEG ppt to purify DNA templates Redesign primers or use higher temperature for annealing/extension and ligation reaction Remove EcoK or EcoB sites by primers if possible Repeat with plaquepurified template DNA Repeat with cells whose genotype have been reconfirmed Check primers design

Primer too nonspecific

Primers impure High frequency of spurious mutants

All plaques tested were same as parent clone

No plaque observed (even in the control with no primers)

Remedy

Template has too much contaminating RNA Primer has partial homology with several positions along the template Template DNA has EcoK or EcoB sites Template is contaminated with recombinants Incorrect cell strain used

Primer used hybridized to other locations Hanahan procedure failed

Template DNA degraded

Repeat with freshly prepared competent cells Repeat with freshly prepared template DNA

Concluding Remarks F r o m t h e n u m b e r o f p o s i t i v e c l o n e s t h a t h y b r i d i z e d p o s i t i v e l y to the mutagenic oligonucleotide, we have shown that the combined use of the s e l e c t i o n w i t h f o u r c o p i e s o f E c o K / E c o B in t h e v e c t o r / p r i m e r s y s t e m i m p r o v e d the f r e q u e n c y o f h y b r i d i z a t i o n p o s i t i v e c l o n e s a p p r o x i m a t e l y t w o f o l d ( c o m p a r e r o w s 1 a n d 3, 4 a n d 6, a n d 7 a n d 9 o f T a b l e II). T h i s i m p r o v e m e n t is n o t d u e to t h e m e r e p r e s e n c e o f t w o p r i m e r s b e c a u s e t h e u s e o f t h e n o n s e l e c t i v e h o s t TG1 ( E c o K - , E c o B - ) d o e s n o t g i v e a signific a n t i n c r e a s e in t h e f r e q u e n c y o f h y b r i d i z a t i o n - p o s i t i v e c l o n e s , e v e n w i t h

270


[17]

double primers (compare rows 2 and 3, 5 and 6, and 8 and 9 of Table II). There is no direct relationship between the length of D N A deleted and the percentage o f positive clones obtained (Table II). When the D N A sequences o f the putative positive clones were analyzed, the improvement of the f r e q u e n c y of mutation was even more dramatic (Table III). The percentage of true positive clones as determined by sequence analysis was 30% when selection was used but no mutant was obtained without selection. This result is similar to that obtained when the M I 3 K l l R X vector, which has four tandem copies of EcoK, was used. 4 H o w e v e r , the design of this series of deletion experiments is more flexible than the previous design 4 because the four copies of the EcoK/EcoB site are adjacent to rather than inside the loop of D N A to be deleted. In summary, novel M13 cloning vectors with four overlapping copies o f EcoK (M 13K 119W) and EcoB (M 13B 119) were designed for improving the efficiency o f mutagenesis using oligodeoxynucleotides. These vectors complement the v e c t o r series with four tandem copies of EcoK, M 1 3 K l l R X , which has been shown to be useful in the generation of a series o f unidirectional deletional mutants by a mixture of oligodeoxyribonucleotides. 4,28 Furthermore, we have shown that with the combined use of T4 D N A polymerase and EcoK selection, a high efficiency of mutagenesis of up to 75% can be obtained for large deletions. Acknowledgments I thank the members of the laboratory: V. Li and F. Mui for conducting the sequence analysis, Ken Wong for help in cloning c-fos into the M13 vector. In addition, thanks go to Dr. T. Kunkel for helpful advice and Dr. J. Ferrier for reading the manuscript. K. Wong is a recipient of an MRC summer Farquharson Research Scholarship. This work is supported by a group grant from the Medical Research Council of Canada and a University of Toronto Cannanght research grant.

[17] G e n e S p l i c i n g b y O v e r l a p E x t e n s i o n

By ROBERT M. HORTON, STEFFAN N. H o , JEFFREY K. PULLEN, HENRY D. HUNT, ZELING CAI, and LARRY R. PEASE Introduction Conventional methods o f engineering recombinant D N A make use o f restriction enzymes to cut molecules apart at specific nucleotide METHODS IN ENZYMOLOGY, VOL. 217


[17]

GENE SPLICING BY OVERLAP EXTENSION

271

sequences and ligases to rejoin the parts. A significant limitation of this technology is that restriction enzymes are sequence dependent and these recognition sequences appear more or less randomly in DNA. That is, restriction enzymes cut where recognition sites are located and not necessarily at optimal positions along the gene for purposes of genetic engineering. The polymerase chain reaction (PCR) has made possible a sequence-independent engineering method that we have referred to as "gene splicing by overlap extension" or " S O E . " This technology is especially useful in complicated constructions that require precise recombination points, such as joining two coding sequences in frame, and it also provides a straightforward way of performing site-directed mutagenesis. ~,2

Method The basic scheme of gene splicing by overlap extension is illustrated in Fig. 1. 3 The process requires two steps. First, the specific fragments to be joined are isolated by PCR. The ends of the amplified fragments are modified during this step so that the two fragments "overlap," or share complementary sequences on the strands to be joined. Following denaturation and reannealing, strands from the two fragments act as primers on each other. Extension of the overlap by DNA polymerase results in the recombinant product. A detailed depiction of the overlap region is shown in Fig. 2). The first step in the SOE reaction is an application of "mispriming," in which extra, unrelated sequences added to the 5' end of a PCR primer become incorporated into the end of the product. 4 It is a conventional reaction, but it uses specially designed primers. The second step (overlap extension) is as simple to carry out as the first; it just requires the two purified fragments to be put together under"PCR conditions," with buffer, dNTPs, polymerase, and thermal cycling. Only one strand from each of the original PCR products is actually incorporated into the final product. The two strands act as primers on each other to form a single fused molecule. Inclusion of PCR primers for the distal ends of each fragment allows the final product to be amplified.

1 R. M. Horton, H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease, Gene 77, 61 (1989). 2 S. N. Ho, H. D. Hunt, R. M. Horton, J. K. Pullen, and L, R. Pease, Gene 77, 51 (1989). 3 R. M. Horton, Z. Cai, S. N. Ho, and L. R. Pease, BioTechniques 8, 528 (1990). 4 K. Mullis and F. Faloona, this series, Vol. 155, p. 335.

272


[17]

G e n e II

PCR 2 J,~l II!11~1 U

_ _ _ J

. . . .

AP~

/

HecomDlnant proouct FIG. 1. The general concept of overlap extension. First, two PCR products are made in separate reactions; primers a and b produce product AB from gene I and primers c and d are used to amplify fragment CD from gene H. DNA segments are depicted as paired antiparallel strands. An arrowhead indicates the 5'-to-3' direction of each strand of the primers and PCR products; the ends of the template genes are not shown. Primers b and c have had sequences added to their 5' ends so that the right end of AB matches the sequence at the left end of CD. When these products are mixed in an SOE reaction, the top strand of AB "overlaps" with the bottom strand of CD, their 3' ends being oriented toward each other. This allows them to act as primers on one another to make a giant "primer dimer," which is the recombinant product. The other strands, which point in the wrong directions, do not form product and are not necessary to the reaction. (Reprinted from Horton e t al. 3 with permission from the publisher.)


[17]

273

Product AD (433 bp)

~

AGAGGTCAAATTCCACC-~ TCTCCAGTTTAAGGTGG"s' +

~"AGAGGTCAAATTCCACC~ , ~

S'-TCT COAGTT T AAGGT(~:~~ , ~ " ~",,~" Product EH (581 lop)

........................

.~.:..~...~

'~

................... i

~'~ i ~

~

/~AGAGGTCAAATTCCACC.-~~ ~r'TCTCCAGTTTAAGGTO~

~'%

e

i

i ........................

~

..................

AGAGGTCAAATTCCACC~--~ J P ' ~ ~ TCTCCAGTTTAAGGT~,~ ~ 7 Reeomi~antProduct

"

X

(997 bp)

FIG. 2. Detail of ends of fragments being spliced together. In this figure, the two products being joined are AD and EH. The design of this construct is discussed elsewhere) Strands with the 5'-to-3' direction going left to right are shown in white, and the opposite strands are shown in black. The right end of AD has the same sequence as the left end of EH. When AD and EH are mixed in an SOE reaction, heated, and reannealed, the 3' end of the white strand of AD overlaps with the 3' end of the black strand from EH, Extension of this overlap by DNA polymerase creates the recombinant product.

Examples Site-Directed Mutagenesis A simple example of the use of overlap extension is for site-directed mutagenesis. As illustrated in Fig. 3, the same template is used to make both fragments AB and CD. Differences from the template sequence are introduced in the primers that generate the overlap regions in the amplified fragments generated in the primary PCR (Fig. 4A).

Splicing Genes Together An example of gene splicing by overlap extension is the construction of a chimeric class I major histocompatibility complex molecule using parts from two different members of this multigene family. The purpose was to examine the functional role of the a helices in these molecules by switching them from one molecule to the other. This construction is complex because it involves splicing together four fragments in consecutive reactions, as illustrated in Fig. 5. Notice also that the segments originated from different exons in the original templates, but that the intron has been

274


[17]

C

(1) ~ a~

b

(2) 1 c+~

d

AB CO (a)

~ ~ NB4.CO

. . . . .

oo...

o . . . . . e o ~ .

J

MUTANT FU~ON PRODUCT

FIG. 3. Mutagenesis by overlap extension. In simple mutagenesis, both of the products to be joined are amplified from the same template. Changes to the original sequence, represented by the black rectangle, are made by "mispriming" using primers b and c. (Reprinted from Ho e t al. 2 with permission from the publisher.)

A

5' CGGTACATGTCTGTCGGCTACGTC 5' .... GCCCCGGTACATGGAAGTCGGCTACGTC.... .... CGGGGCCATGTACCTTCAGCCGATGCAG.... 5' CGGGGCCATGTACAGACAGCCG 5'

B

template

5' TCCCTGCGGCGGCTGCGCACAGGTGC 3' 5' AGGGACGCCGCCGA 5'

FIG. 4. Examples of primers used in overlap extension reactions. (A) Site-directed mutagenesis: The relationships between the mutagenic oligonucleotides and the template are indicated. Mutations to be introduced are indicated by asterisks. (B) Gene splicing by overlap extension: The regions of the oligonucleotides that allow them to act as primers on the appropriate template are underlined. The complementary regions of overlap between the pairs of primers that allow them to be spliced together are indicated by asterisks.

[17]


275

deleted in the final construct. This precise "splicing" of exon sequences is a trivial exercise using SOE, but the reader is invited to consider how difficult such a construction might be using conventional restriction enzyme methods, unless useful sites are serendipitously present at the exon boundaries. General Considerations In designing a project using SOE, it is essential to keep the strands and their orientations straight. The notation used in Figs. 1, 3, and 5 is useful in this regard. Each strand is represented by an arrow that indicates the 5'-to-3' direction. This is the direction in which DNA polymerase can extend the strand when it acts as a primer. By convention, DNA sequences are usually written out so that the reading frame of reference reads left to right, and the top strand has its 5' end at the left and its 3' end at the right. If only one strand is shown, it is assumed to be the top strand. When designing SOE primers, it is useful to write out the sequence of both strands of the recombinant product (or mutant) wanted, as in Fig. 4, and to copy the primer sequence from this. It is important to design the primers carefully because their sequences must be exactly correct. Although these words of caution may sound superfluous, it has been our experience that most errors associated with this approach occur in the planning phase. Each primer extension event requires sequence homology between the primer and the template to permit hybridization. We have empirically designed our primers to overlap with the template by approximately 16 to 20 bp. In our experience, oligonucleotides with a minimum 16-bp region of homology have consistently provided adequate amplifications. Given the decreasing cost of oligonucleotide synthesis, we have not spent significant effort in working out parameters such as the minimum number of overlapping nucleotides or the base composition of the overlapping region that is required for SOE or mutagenesis using this approach. In general, we try to avoid sequences with significant internal homology. When given the option, we choose sequences containing more or less equal amounts of all four nucleotides. An example of an overlapping region we have used successfully is shown in Fig. 4B. In the few cases in which a given oligonucleotide did not provide adequate amplification, resynthesis of the same sequence usually resulted in successful amplifications. Gene splicing by overlap extension is clearly the method of choice for certain constructs that would be difficult to carry out using conventional techniques such as restriction enzyme digestion and ligation. A common example of such a project is engineering fusion proteins, in which the reading frame and the sequence of the desired protein place rigid con-

MUTAGENESIS AND GENE

276

[17]

DISRUPTION

A exon 2

~,y

infron 2

exon 3

y....~

PCRI (1) fra~,n~ AS

.

~"I~

ePCR~(3)~-'"f fraQment ~..

..

_

c( heix

~

¢*----1""~

c( heix v . H_2Ld 81~w~lfleetrWnolleklB

t -,

'A

•

~ X

H-2K 10......... t"............... r.r........-~......... ..w.......~...w.L...*............................. ..~m.......w............ .~.....~....r.~............. .~....:~

c F'CR~(2)'"-d

g

PCR~(4)

T

h

T

. . . . . . . . . . . . . . . . . . . . . . . . . .--% ~.__

~=====================:-=============l====== ~.

fragment CO

fragment GH

B fragnmnt AB

T" . . . . . . . . . . . . . . . . . . . . . . .

fragment CD

SOEI( 1) fragm6nt EF b/c joint ..................... ~ fragment AD .::. i SOEI(3) exon 2 Z 09

a-.-~

:'::";'":;':;;;;;":;"::";;':;':;":':: I fragment GH SOE~(2) f/g joint =='=;=';;=".==='"';=;'=;='=;'"==;='='='; fragment EH exon 3

oc helix Y:mtron deleted at die joint

:::~:::::,*::7,:',::::

o¢helix ~ X

:::::::::::::::::::::::::::::::::::

e.

.e.~

g..

......

~":

':'-

~":

"' h

b

"d f Recombinant Molecule

FIG. 5. Strategy for c o n s t r u c t i n g a c o m p l e x fusion protein by splicing parts together. (A) P C R - g e n e r a t e d f r a g m e n t s . (B) S O E reactions. (Reprinted f r o m H o r t o n e t al. i with p e r m i s s i o n f r o m the publisher.)

straints on how the recombination can be made. However, SOE has certain drawbacks that make it less appealing for "ordinary" applications. First, because anything done with PCR involves in vitro synthesis of DNA (both chemical and enzymatic), there is an increased probability of errors being introduced. Thus, for many applications, especially when the product is

[17]


277

to be cloned, the possibility exists that several clones may have to be sequenced to find one that is entirely correct. We have found error frequencies (i.e., the proportion of incorrect nucleotides in the final product) between 0.026 and 0.06% in overlap extension reactions using Taq DNA polymerase. ~,2 Other polymerases with lower error rates would presumably lower this frequency even further. The cloning strategy used in the examples shown here is a "cassette" approach, in which the final product is cloned into a plasmid vector in the conventional manner. Several groups have demonstrated that products can be spliced directly into vectors. 5-8 While these techniques remove some of the limitations inherent in using restriction enzymes, and may simplify and speed up the cloning process, the cassette approach has the advantage that only the cassette portion of the final construct has been subjected to DNA synthesis in vitro, limiting the amount of sequencing that must be done to be sure of having an error-free clone. Other interesting examples of this and related technologies have appeared in the literature. 9-12

Protocols

Solutions and Reagents Standard PCR buffers and conditions are suitable for SOE. Because a high [Mg z+ ] appears to lead to increased rates of misincorporation by Taq polymerase,13 it is advisable to use the lowest concentration of magnesium compatible with amplification of the specific segments of interest. Generally, a titration from 0.5 to 2.5 mM will reveal a range of [Mg 2+] that gives good amplification; working on the low end of this range should result in lower error rates. For these titrations, it is convenient to have the MgC% separate from the buffer [10 x buffer is 500 mM KC1, 100 mM Tris-HC1 (pH 8.3)]. 5 D. H. Jones and B. H. Howard, BioTechniques 8, 178 (1990). 6 A. R. Schuldiner, K. Tanner, L. A. Scott, C. A. Moore, and J. Roth, Anal. Biochem. 194, 9 (1991). 7 G. S. Sandhu and B. K. Kline, Minn. PCR Symp. abstract and poster (1991). 8 A. R. Schuldiner, L. A. Scott, and J. Roth, Nucleic Acids Res. 18, 1920 (1990). 9 G. Sarkar and S. S. Sommer, BioTechniques 8, 404 (1990). ~0R. M. Horton and L. R. Pease, in "Directed Mutagenesis: A Practical Approach" (M. J. McPherson, ed.), p. 217. IRL Press, Oxford, England, 1991. u B. Berkhout, A. Gatignol, A. B. Rabson, and K.-T. Jeang, Cell 62, 757 (1990). 12 C. Abate L. Patel, F. J. Rauscher III, and T. Curran, Science 249, 1157 (1990). 13 K. A. Eckert and T. A. Kunkel, Nucleic Acids Res. 18, 3739 (1990).

278


[17]

Polymerase Chain Reaction Conditions Polypropylene tubes (0.6 ml) (Robbins Scientific, Sunnyvale, CA) Native Taq DNA polymerase (Perkin-Elmer-Cetus, Norwalk, CT) Ultrapure dNTP mix (Pharmacia, Piscataway, N J) Mineral oil, light (Sigma, St. Louis, MO) DNA thermal cycler (we use a model from Perkin-Elmer Cetus); for 25 cycles: Denaturation at 94 ° for 1 min Annealing at 50 ° for 2 min Extension at 72 ° (1 to 3 min, as determined by an enzyme rate of 1000 bases/min) The shortest denaturation and annealing temperatures required will vary from instrument to instrument. Very short cycling times have been used successfully by some investigators 14

Overlap Extension 1. Amplify the intermediate products AB and CD in separate tubes: Template, 100-500 ng/100/zl Primer 1, 1/zM Primer 2, 1 IzM Buffer, 1 x Mg 2+, empirically determined dNTPs, 200/~M Taq polymerase, 0.025 U//xl Final volume, 100 tzl Mineral oil: Add 2-3 drops to assembled reaction mixtures In the first reaction, the template is gene I and the primers are a and b. This produces product AB. In the second reaction, to produce product CD, the primers are c and d, and the template is gene H. For simple sitedirected mutagenesis, both reactions use the same template. A broad range of template concentrations will work. On theoretical grounds, we recommend starting with as much as 0.5/~g of template, if possible. This reduces the number of rounds of replication required to amplify a workable amount of product. Too much template DNA can inhibit the reaction, however; for plasmids we have found that concentrations above 1 tzg/100 ~1 commonly cause inhibition. The actual number of rounds of synthesis (doublings) is not the same as the number of cycles of heating/cooling the sample has been exposed to; once the reaction reaches 14 C. T. Wittwer, G. C. Fillmore, and D. J. Garling, Anal. Biochern. 186, 328 (1990).

[17]


279

a maximum, further cycling has little effect. Therefore, we have made no attempt to minimize the number of cycles, and generally let it go for 20 or 25. 2. Gel-purify products AB and CD: Fragments larger than about 300 bp can be electrophoresed through an agarose gel in TAE buffer [40 mM Tris-acetate, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 8.2], then the desired band can be cut out and the DNA recovered by the glass bead elution procedure (GeneClean; Bio 101, La Jolla, CA). For small fragments, better resolution can be obtained with high-percentage agarose gels [1% (w/v) normal agarose plus 1-3% NuSieve GTG agarose (FMC BioProducts, Rockland, ME)]. Fragments smaller than about 200 bp cannot be recovered efficiently from glass beads, so an alternative procedure should be used, such as running the band into a well cut in the gel, 15adding 10/zg yeast tRNA (Bethesda Research Laboratories, Gaithersburg, MD) as a carrier, and precipitating with ethanol. 15 Other workers use less extensive purification schemes, ~6 or do not purify the intermediates at all. ~7 In our experience, gel purification of the intermediates reduces the background of unwanted side products, sometimes quite dramatically. 3. SOE fragments AB and CD: The SOE reaction is done under the same conditions as the PCRs, except that two templates are used instead of one: Template 1 (product AB), - 2 5 % of total Template 2 (product CD), - 2 5 % of total Primer 1 (primer a), 1 ~M Primer 2 (d), I /xM Buffer, 1 × Mg 2+, emperically determined dNTPs, 200/xM Taq polymerase, 0.025 U//xl Again, a wide range of template concentrations will work, but larger amounts of template theoretically will lead to lower error frequencies. We recommend using about one-fourth of the purified product from a 100-/sl reaction to permit additional reactions, should the first be unsuccessful. Although we usually use roughly equimolar amounts of the two SOE templates, this is not necessary. The reaction will work even if one template is in gross excess over the other. ~5T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 16 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res. 15, 7351 (1988). 17 j. Yon and M. Fried, Nucleic Acids Res. 17, 4895 (1989).

280


[18]

[18] S e l e c t i o n o f O l i g o d e o x y n u c l e o t i d e - D i r e c t e d M u t a n t s By CARL A. BATT, YUNJE CHO, and ANDREW C. JAMIESON Introduction Mutational analysis has been used for many years to probe the genetic basis of a given phenotype. Prior to advances in in vitro nucleic acid enzymology this was usually accomplished by treating the targeted organism with a chemical or physical agent to enhance the rate of mutation. Depending on the particular mutagenic agent, base substitutions, deletions, or insertions could be anticipated. The challenge was then to devise a suitable screening protocol to identify mutations of interest and characterize them within the limits of the available biochemical methods. The ability to manipulate nucleic acids in vitro, coupled with techniques for precisely determining changes to a given sequence, has permitted the directed mutation of DNA. Although methodologies for chemical and random enzymatic mutagenesis have been established, where the target sequence and desired change can be defined, oligonucleotide site-directed mutagenesis is usually the method of choice. Examples of the potential of site-directed mutagenesis include probing the role of specific amino acid residues in the structure of a protein, incorporating desired restriction sites, and studying the effect of altering a nucleotide sequence on binding of a regulatory protein.

Principle of Method Oligonucleotide-mediated site-directed mutagenesis allows the selective substitution, insertion, or deletion of one or more targeted nucleotides. 1 A mutagenic primer containing the desired nucleotide sequence change is annealed to a template and the remainder of the sequence is synthesized enzymatically. For single-stranded templates (i.e., M 13mp 19) one would intuitively assume that the population of molecules recovered by transformation would be a ratio of 50 : 50, wild type : mutant. This in practice is never the case and the frequency of mutants can be as low as 95%) culture of differentiated (neurite extending) neurons within 3 days (Fig. 7).

Transfection Prior to transfection, cells are washed with DMEM. The transfection mix is prepared as described for chromaffin cells [2/zg DNA (TRE/tkCAT) and 1 ml/dish]. The transfection step lasted for 5 hr. Then cells are

[41]

GENE TRANSFER USING LIPOPOLYAMINE-COATEDD N A

611

B

A

a

b

FIG, 7. Transfection of differentiated neurons. (A) Cerebellar neurons (b) are transfected without noticeable morphological change (a). Bar: 100/zm. (B) Autoradiogram of the CAT activities corresponding to (a): TRE/tk-CAT-DOGS transfection prior to plating, and (b): control. w a s h e d twice and cultured in serum-free medium for 48 hr and C A T activity is determined. This t r e a t m e n t results in efficient C A T activity and is not toxic b e c a u s e overall cell survival (trypan blue exclusion test) is not affected in transfected neurons as c o m p a r e d to untreated cells (Fig. 7). Optimal transfection conditions are then determined by varying the lipopolyamine ( D O G S and D P P E S ) - t o - D N A ratio. Figure 8 shows that a i

100]

0

DOGS

'~

DPPES

E o

>-

50.

io < t-< (.I

0

0.1

I

3

5

10

DNA (2pg) ; LIPID RATIO

FIG. 8. CAT activity in lipospermines [DOGS ((3) and DPPES (V)] transfected granular neurons increases sharply when the compacted complex bears a net positive charge (abscissa, ratio of lipid to nucleic acid charges). Inset: Autoradiogram obtained with D O G S - T R E / t k CA T.

612

METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS

[41]

sharp increase in transfection efficiency occurs around neutrality of the lipid-DNA complex as was noticed previously with melanotrope cells3; furthermore, both lipospermines show similar transfection efficiency. Gene Transfer in a Permanent Pituitary Cell Line

AtT20 Cell Culture AtT20 cells are corticotrophic cells derived from a mouse anterior pituitary tumor. (The AtT20/D-16 V subclone was obtained from J.-L. Roberts, New York). Cells are propagated in DMEM supplemented with 10% (v/v) fetal calf serum, glutamine (286 rag/liter), penicillin (50/zg/ml), streptomycin (50/zg/ml), and kanamycin (50 ~g/ml). Cells are plated on Costar dishes (3.5 cm) and cultured at 37° in 95% 02/5% COz. They are generally used at 30 to 50% confluency for transfection studies.

Optimization of Method for AtT20 Cells Because initially the method showed variable efficiency in different hands, a careful search was undertaken to optimize and describe it unambiguously. Preparation of the Lipospermine/Plasmid Complex. DNA condensation by polyamines is known to be dependent on concentrations of reactants, on ionic strength, as well as on the presence of other polycations. A similar conclusion was reached for condensation by lipopolyamines, and in addition to the observation that DOGS slowly precipitated out of DMEM (but not out of water or sodium chloride solutions), this may be the clue to why the preparation of the complex could influence transfection. Optimal and nearly time-independent conditions for association were found in - 1 5 0 mM sodium chloride or in alkaline-earth cation-depressed DMEM (see Recent Improvements and Transfection of Other Cells, below) in the 10/zM base pair (or less) range of DNA concentration. The amount of lipospermine necessary for strong CAT activity (2-4/zl of a 2 mM solution per microgram plasmid) agreed with the general observation of a threshold level around charge neutrality of the complex. Optimal Transfection Time. Variation of CAT activity with transfection time, that is, with the time after which cells were washed and serum supplemented, showed a plateau after - 1 5 hr. Thus attached AtT20 cells take much longer to transfect than nonattached primary melanotrope cells (Fig. 4): there is, for instance, a residual 30% CAT activity increase between 8 and 15 hr of incubation (which may in part be accounted for by the cell population increase). Finally, the following procedure was taken

[41]

GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA

613

for subsequent studies: 1 /xg of plasmid is diluted into 500 /xl DMEM in which the concentration of divalent cation is depressed (see Recent Improvements and Transfection of Other Cells, below); 2/A of a 2 mM DOGS solution [in ethanol or 10% (v/v) ethanol in distilled water] is diluted into another 500/xl of DMEM; these solutions are mixed and poured after a few minutes onto the cells kept in a small volume of serum-free DMEM; after 10-12 hr the transfection medium is removed.

Lipopolyamine-Based Gene Transfer to Study Second Messengers: Protein Kinase A Pathway In mammalian cells, extracellular signals (neurotransmitters and hormones) can modulate gene expression by stimulating cAMP formation in response to ligand-receptor interaction on the external side of the cell membrane. The intracellular effects of cAMP, including regulation of gene expression, are mediated by protein kinase A [PKA; ATP : protein phosphostransferase (EC 2.7.1.37)]. At low cAMP levels, PKA is an inactive tetramer of two catalytic subunits and two regulatory subunits. The biological effects of PKA are mediated by phosphorylation of specific substrates of the catalytic subunits. At the nuclear level, activation of gene transcription by cAMP is mediated in many cases by the trans-acting factor CREB (cAMP response element-binding protein), a phosphorylation substrate of PKA. Point mutations in the regulatory subunit of PKA can suppress the binding sites for cAMP. Introduction of such mutated regulating subunits (by gene transfer) inactivates PKA because these mutated regulatory subunits are no longer released when the cAMP level increases. Inactivation of PKA by this approach indeed blocks cAMP-induced gene expression. 12,13 Taking advantage of the optimized protocol described above, we used this approach in AtT20 cells to study cAMP-mediated gene control. Figure 9 shows that chimeric genes bearing a canonical cAMP-responsive consensus sequence (TGACGTCA) are efficiently stimulated by forskolin, a drug that stimulates adenylate cyclase directly and increases cAMP levels. Cotransfection of this reporter gene (CAT) with a mutated regulatory subunit of PKA suppresses induction by forskolin. This experiment shows that lipopolyamine-mediated gene transfer can be used in AtT20 cells as an efficient tool for introduction of specific biochemical modifications in regulatory pathways. We are now using this approach to study the regulat2 G. S. McKnight, G. G. Cadd, C. H. Clegg, A. D. Otten, and L. A. Correll, Cold Spring Harbor Syrup. Quant. Biol. 53, 111 (1988). 13 p. L. Mellon, C. H. Clegg, L. A. Correll, and G. S. McKnight, Proc. Natl. Acad. Sci. U.S.A. 86, 4887 (1989).

614

METHODSFOR TRANSFORMING ANIMAL AND PLANT CELLS

[41]

CRE/tk-CAT

Mt-REVAB

hGH poly (A) R1 cDNA

CRE/tk-CAT

CRE/tk-CAT +Mt-REVA8

+ PCH 110

I

I

Ct

FK

I

// Ct

I

FK

FIG. 9. Mutated regulatory PKA subunits abolish cAMP-dependent induction of CREcontaining genes. AtT20 cells were simultaneously cotransfected with a CRE-containing gene (CRE/tK-CAT) (1/zg/well) and an expression vector (2 p.g/well) coding for a mutated regulatory PKA subunit (lacking cAMP-binding sites) (Mt-REVAB)or with a control plasmid (2 /xg/well) (PCHII0, an expression vector coding for/3-galactosidase, or pUC18). The transfection step lasted 10 hr, after which cells were switched to serum-free DMEM for 24 hr and then stimulated with forskolin (FK, 5 x 10 -6 M) for 10 hr. CAT activity was determined and taken as an index of CRE/tK-CAT transcription. Induction of CRE/tK-CAT transcription by FK was completely abolished in AtT20 cells cotransfected with Mt-REVAB, in contrast to cells cotransfected with PCHll0 or pUC18. tory mechanism of neurotransmitters. For example, preliminary experim e n t s s h o w t h a t in A t T 2 0 cells c o r t i c o t r o p i n - r e l e a s i n g f a c t o r ( C R F ) c a n s t i m u l a t e c h i m e r i c g e n e s b e a r i n g c A M P - r e s p o n s i v e e l e m e n t s , an e f f e c t t h a t is s u p p r e s s e d b y i n t r o d u c t i o n o f m u t a t e d r e g u l a t i n g s u b u n i t s o f P K A , i n d i c a t i n g t h a t this s t r a t e g y c a n b e u s e d to i n v e s t i g a t e i n t r a c e l l u l a r r e g u l a t o r y p a t h w a y s l i n k e d to g i v e n r e c e p t o r s . S i m i l a r d a t a h a v e b e e n o b t a i n e d on the complete promoter sequence (rather than the isolated regulatory consensus sequence) of the proopiomelanocortin (POMC) gene, a cAMP-

[41]

GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA

615

inducible gene that lacks the classical cAMP-responsive motif. Thus, specific inactivation of regulatory pathways by lipopolyamine-mediated gene transfer can be used for investigation of more complex regulatory sequences. Furthermore, because high DNA transfer is also achieved in neurons and endocrine cells, similar competition experiments with mutated kinase subunits may be used to investigate peptide gene expression (POMC and proenkephalin) in these primary culture models. Recent Improvements and Transfection of Other Cells Transfection efficiency depends on multiple factors. The best approach for achieving a reasonable and reproducible gene transfer protocol is to work in a defined medium, to follow rigorously a known transfection procedure, and to adapt it by optimizing a few crucial parameters. Obviously the cell type, but also the level of confluence and even the pretransfection conditions (serum growth factors), will have an influence on the cell surface properties, on the rate of endocytosis, or on the cell cycle. Hence there is variable" competence" for accepting and expressing (stably or not) an exogene. Among important and easy-to-adapt parameters are those governing the DNA-lipospermine association (range and ratio of concentrations, nature of the medium) and the coated DNA-ceU surface interaction (transfection medium and time). Condensation of nucleic acids by polyamines is known to be competitively inhibited by other cations in the expected order: Mg2+, Ca 2+ >~ Na +, K+; polyanions [e.g., phosphate, heparin, albumin, and ethylenediaminetetraacetic acid (EDTA)] also may interfere. Thus, the size of compacted lipospermine-coated particles (see Fig. 2) is not only dependent on the initial lipid and DNA concentrations, but also on medium composition and ionic strength. On the other hand, unless there is an optimal size for endocytosis small particles should transfect better, so both partners should be highly diluted before being allowed to encounter. Variations along these lines led in practice to separate dilution of the plasmid (1-5/zg) and the lipid to 100-500/zl before mixing. As compacting medium, pure water and high ionic strength were found to be less effective than 150 mM NaCI or DMEM. However, alkaline-earth cations present at millimolar concentration in DMEM severely depress transfection; they may be removed by a freeze-thaw cycle o f a 2 × DMEM solution followed by quick filtration of the insoluble MgHPO 4 and CaHPO4. As to the charge ratio of lipopolyamine to nucleic acid, experiments with endocrine cells, 3 cerebellar neurons (Fig. 8), or AtT20 cells (see Optimization of Method for AtT20 Cells, above) demonstrate that transfection is efficient only when the complex bears a strong net positive charge,

616


[41]

irrespective of the valence of the lipocation.3 The upper limit to the excess cationic charge may be toxicity, especially for quaternary ammonium salts that are used in other "cationic liposome"-based transfection techniques and are not easily handled by the cell. Charge ratios are calculated on the following basis: 1 /xg DNA contains 3.07 nmol of phosphate anionic charges (assuming a mean molecular weight of 325 for a nucleotide sodium salt); 1/xl of a 2 mM (2.5 mg/ml DOGS tetratrifluoroacetate, Mr 1263; or 2.7 mg/ml DPPES tetratrifluoroacetate, Mr 1331) lipospermine solution contains at least 6 nmol of ammonium cationic charges at neutral pH. The net charge requirement of the complex reflects a necessary electrostatic interaction with the cell membrane, so cells that are refractory to net cationic conditions may be checked for transfection by compacted net anionic complexes obtained with default lipopolyamine charges. Other variables affect the coated DNA-cell surface interaction directly. Transfection media seem less critical than the DNA coating medium, yet trypsin (used to detach cells) and competing polyions (especially macromolecules present in serum) should be absent; also, the total volume over the cells should be kept minimal to favor fast encounter. Serum should be added only if needed because it may affect transfection efficiency and also gene expression in an unpredictable way. Optimal transfection times may be highly variable, ranging from 95% of the cells, suggesting that the DNA complexes were now in the vesicular (endosomal?) system of the c e l l . 37

We observe that, at least for some cell types, transferrinfection is very much enhanced by the addition of chloroquine during the 4-hr duration of transferrinfection, but this requirement appears to vary in a highly idiosyncratic and unpredictable manner from cell type to cell type. We presume that where chloroquine is beneficial, as is the case for K562 cells, this lysosomatropic drug increases the pH in the endosomal and the lysosomal compartments and thus prevents degradation of the reporter D N A during passage from endosomes to the nuclear compartment. But the action of chloroquine is not fully understood and other mechanisms of action are not excluded. Other lysosomatropic substances added with or instead of chloroquine, such as monensin, do not facilitate transferrinfection, but actually interfere with it. NH4C1 and methylamine are ineffective. An alternative, and often superior, protocol that allows high-level expression involves treating transferrinfected cells with a defective adenovirus. In cells that can bind and internalize adenovirus (most human and many mouse cell types) the entry of adenovirus involves a membrane disruption as the pH drops in the endosome. We have found that treatment of cells supplied with various ligand-polycation DNAs (e.g., transferrin-polylysine, gpl20-polylysine, antibody-polylysine) in the presence of the replication-defective adenovirus di312 allows enhanced gene expression in the absence of chloroquine (see note added in proof). Ligands Other Than Transferrin. DNA can be targeted to other receptors by choosing different ligand-receptor systems. Thus, it has been 40 E. Mattia, K. Rao, D. Shapiro, H. Sussman, and R. Klausner, J. Biol. Chem. 259, 2689 (1984).

[42]

RECEPTOR-MEDIATED TRANSFEROF DNA

623

possible to target the cell membrane protein CD4 in CD4-positive lines with conjugates formed between polylysine and anti-CD4 monoclonal antibodies or polylysine and recombinant gp 120 (the envelope protein of HIV; a kind gift of Genentech, South San Francisco, CA). Other receptors were targeted with anti-CD7 monoclonal antibodies and asialofetuin (unpublished observations, 1992). A related procedure using asialoorosomucoid-polylysine conjugates has been successfully used to deliver DNA, via the asialoglycoprotein receptor, to hepatocytes, both in tissue culture and in r a t s . 41'42 Quantitative Aspects. High DNA concentrations during transferrinfection are desirable but the DNA concentration in stock solutions cannot exceed 20-30/xg/ml because of the limited solubility of the T f p L - D N A complexes. We find that plasmids of 13 kb work as well as plasmids of 6 kb. We are currently testing alternate DNA packaging schemes to increase the size of plasmid that can be reliably transfected. (See note added in proof. 5) Quantitative Southern analysis revealed that initially, after a few hours of incubation, on the order of 5000 ("episomal") DNA plasmids per cell became associated with K562 cells. One or 2 weeks later the number of DNA molecules was reduced by a factor of about 1000. In the case of K562 cells, virtually all cells take up DNA (see above) and close to 100% of the cells express the reporter gene (see Ref. 37 and below). Especially where chloroquine is not required, there is no cell death during transferrinfection. This means that the procedure can be repeated several times on the same cell culture and in this way the amount of DNA that is transferred into the cells can be increased. 37 Where there is no selection for the transferred gene, expression after transferrinfection is transient. Expression of the Rous sarcoma virus long terminal repeat (LTR)-driven luciferase expression plasmid (pRSVL) in K562 cells, after reaching a maximum of expression around 18 to 24 hr, decays with a half-life of days when measured in the cell culture as a whole. When the pRSVL construct is presented to K562 cells in the context of a dominant control region of the globin gene cluster, 43 expression is maximal after day 2 and a high level persists in the cell culture as a whole for about 2 to 3 weeks. This protracted expression may render the establishment of stable cell lines unnecessary in some distances. When transfection of a selectable marker (e.g., neomycin phosphotransferase)

4t C. Wu, J. Wilson, and G. Wu, J, Biol. Chem. 2,64, 16985 (1989). 42 G. Y. Wl.l and C. H. Wu, J. Biol. Chem. 263, 14621 (1988). 43 p. Collis, M. Antoniou, and F. Grosveld, EMBO J. 9, 233 (1990).

624


[42]

is performed on K562 cells about 0.5 to 1% of the cells form colonies of stable transformants.

Methods

Synthesis of Transferrin-Polylysine Conjugates The initial conjugate synthesis 36'39 involved the modification of one to two amino groups on the transferrin molecule with the reactive bifunctional reagent N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), followed by the ligation to the similarily modified polycations (polylysine or protamine) through the formation of disulfide bonds (see Conjugation Method 1, below). We have also synthesized transferrin-polylysine conjugates that contain a specific ligation through modification of the transferrin carbohydrate moiety. 44 The two terminal exocyclic carbon atoms of the sialic acids within the carbohydrate chains of human transferrin are selectively removed by periodate oxidation. 45 The oxidized aldehyde-containing form of transferrin was used for coupling to the amino groups of polylysine. The junction that results from aldimine formation was stabilized by reduction with sodium cyanoborohydride to the corresponding amine linkage (see Conjugation Method 2, below). There are a number of advantages of the carbohydrate linkage procedure compared to the SPDP procedure. The carbohydrate method has the advantage of being less time consuming. It is useful for scaling up for the preparation of large quantities of conjugates and it generates conjugates having defined polycation-transferrin ligation sites with "nature-derived" carbohydrate spacers.

Preparation of Conjugates General Procedures Quantitative Assays. The polylysine content of fractions was estimated spectrophotometrically by the ninhydrin assay and, in the case of fluorescein isothiocyanate (FITC)-labeled polylysine, by absorption at 495 nm. The amount of dithiopyridine linkers in modified transferrin was determined, after reduction of an aliquot with dithiothreitol, by an absorption measurement of released pyridine-2-thione at 340 nm. The amount of free 44 E. W a g n e r , M. Cotten, K. Mechtler, H. Kirlappos, and M. L. Birnstiel, Bioconjugate Chem. 2, 226 (1991). 45 T. K i s h i m o t o and M. Tavassoli, Anal. Biochem. 153, 324 (1986).

[42]


625

mercapto groups was determined using Ellman's reagent 46 and measurement at 412 nm. Transferrin content of the fractions was determined by ultraviolet (UV) measurement at 280 nm and correction (where necessary) of the value by subtraction of the corresponding UV absorption of FITC, dithiopyridine, or buffer at 280 nm.

Conjugation Method 1: Transferrin-Polylysine Conjugate Synthesis through Disulfide Linkages Conjugation method 1 has been used for the preparation of conjugates of transferrin or conalbumin with various poly(L-lysines), 36poly(D-lysine), poly(L-arginine) (unpublished observations, 1990), salmon sperm protamine, 36 and a synthetic protamine analog39; conjugates of poly(L-lysines) with rgpl2047'48 have been synthesized (unpublished observations, 1990), as well as poly(L-lysine)-antibody conjugates [with anti-CD4, anti-CD7 (unpublished observations, 1990)] and with asialofetuin (unpublished observations, 1990). A related procedure for the synthesis of asialoorosomucoid poly(L-lysine) conjugates has been described by Wu and Wu. 42 Transferrin-poly(L-lysine) conjugates with polylysines of an average chain length of 200 or 450 lysine monomers (pL200, pL450) have been synthesized as described36'~9: coupling of transferrin to polylysine was performed by ligation via disulfide bonds after modification with the bifunctional reagent succinimidyl-3-(2-pyridyldithio)proprionate (SPDP; Pharmacia, Piscataway, N J). 3-(2-Pyridyldithio)propionate-Modified Transferrin. A solution of 100 mg (1.25 /zmol) of human transferrin (iron free, Sigma, St Louis, MO) in 3 ml of 100 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) buffer, pH 7.9, was subjected to gel filtration on a Sephadex G25 column. To the resulting 5-ml solution, 260/~1 of a 10 mM ethanolic solution of SPDP (2.6/zmol) was added with vigorous mixing. After 1 hr at room temperature, purification was performed by a further Sephadex G-25 gel filtration to give 6 ml of a solution of 1.1/~mol transferrin modified with 2.1 /~mol dithiopyridine linker. 3-Mercaptopropionate-Modified Polylysine. Poly(L-lysine) of different molecular weights was used, namely those with an average chain length of 200 or 450 lysine monomers (PL200 or pL450 hydrobromide; Sigma). Both unlabeled and fluorescent-labeled polylysines were used; fluorescent labeling with FITC (Sigma) was performed in sodium bicarbonate buffer, 46 G. L. Ellman, Arch. Biochem. Biophys. 82, 70 (1959). 47 L. Lasky, J. Groopman, C. Fennie, P. Benz, D. Capon, D. Dowbenko, G. Nakamura, W. Nunes, M. Renz, and P. Berman, Science 233, 209 (1987). 48 L. Lasky, G. Nakamura, D. Smith, C. Fennie, C. Shimasaki, E. Patzer, P. Berman, T. Gregory, and D. Capon, Cell 50, 975 (1987).

626


[42]

pH 9, for 3 hr. A gel-filtered solution of 0.57/xmol pL200 (FITC labeled) in 3 ml 20 mM sodium acetate buffer was brought to pH 7.9 by the addition of 300/~l of 1 M HEPES buffer and 204/.tl of a 10 mM ethanolic solution of SPDP (2.04/.tmol) was added with vigorous mixing. One hour later 500 /zl of 1 M sodium acetate, pH 5, was added; after gel filtration with 20 mM sodium acetate the solution contained 0.54/xmol PL200 with 1.86/zmol of dithiopyridine linker. The solution was brought to pH 7 by addition of HEPES buffer, and 36 mg dithiothreitol (DTT) was added. The solution was kept under argon at pH 7.5 for 1 hr. The pH was adjusted to 5.2 by addition of 400/xl 3 M sodium acetate buffer. After gel filtration (Sephadex G-25, 14 x 180 mm column, 15 mM sodium acetate, pH 5.0) a solution of 0.50 ~mol PL20o, which was modified with 1.84/~mol mercaptopropionate linker, was obtained. Following the same procedure, modification of 0.20 /zmol PL450 with 0.70/zmol SPDP gave a product of 0.18/.~mol PL450 with 0.57/zmol dithiopyridine groups; treatment with DTT and isolation gave 0.175/zmol PL450 modified with 0.56/zmol mercapto groups. Conjugation of Transferrin with Polylysine. TfPL200 conjugates were prepared by mixing 1.06/xmol modified transferrin (see 3-(2-Pyridyldithio)propionate-Modified Transferrin, above) in 100 mM HEPES buffer, pH 7.9, with 0.20/xmol modified pLz00 (see previous section) in sodium acetate buffer under an argon atmosphere. The reaction mixture was kept for 18 hr at room temperature. TfPL450 conjugates were prepared in a similar manner starting with 0.61/xmol modified transferrin and 0.12/zmol mercapto-modified pL450. Both TfPL200 and TfPL450 were isolated from the reaction mixture by cation-exchange chromatography [Pharmacia Mono S column HR 10/10; gradient elution, buffer A: 50 mM HEPES (pH 7.9) and buffer B: buffer A plus 3 M sodium chloride]; it was essential for the recovery of the polycation conjugates to add sodium chloride to the reaction mixture (final concentration, 0.6 Min case ofTfpL200 or 1 Min case of TfpL4s0 conjugates) before loading the column and to start the gradient at this salt concentration. The excess of uncoupled transferrin was eluted first. The product fractions were eluted at salt concentrations around 1.4 M with TfpL200 or around 2 M salt with TfpL450 . The TfpLz0o product fractions were pooled into three conjugate fractions, A-C, with increasing polylysine:transfen-in ratio. The TfpL450 conjugates were separated into four fractions, A-D. After dialysis against HBS [20 mM HEPES (pH 7.4), 150 mM NaC1], conjugate fractions were obtained with overall yields of 80% (TfpL200, containing 39 mg conjugated transferrin) or 64% (TfpL450, containing 20 mg conjugated transferrin). The yields are based on equivalents oftransferrin in the product relative to equivalents ofmercapto groups in the modified polylysine starting material.

[42]


627

Conjugation Method 2: Transferrin-Polylysine Conjugate Synthesis through Carbohydrate Modification Conjugation method 2 has been applied to the synthesis of transferrin-polylysine conjugates, 44 for the conjugation of rgpl20 to polylysine (unpublished observations, 1992), and for the conjugation of transferrin to a synthetic protamine analog or to the DNA intercalator ethidium homodimer. 44 However, the method could not be used for the preparation of conalbumin-polylysine conjugates, 36'44 probably due to the absence of sialic acid residues in the conalbumin carbohydrate. 49 A solution of 102 mg (1.28 /xmol) of transferrin (human, iron-free; Sigma) in 3 ml of a 30 mM sodium acetate buffer (pH 5) was subjected to gel filtration on a Sephadex G-25 (Pharmacia) column. This gelfiltration step serves to remove low molecular weight contaminants that interfere with the modification steps. The resulting 3.8-ml solution was cooled to 0° and 80 /zl of a 30 mM sodium acetate buffer (pH 5) containing 4 mg (19/zmol) of sodium periodate was added. The mixture was kept in an ice bath in the dark for 90 min. For removal of the low molecular weight products, a further gel filtration (Sephadex G-25, 30 mM sodium acetate buffer, pH 5) was performed and yielded a solution containing about 82 mg (1.03/xmol) of oxidized transferrin {monitoring: UV absorption at 280 nm and ninhydrin assay; the oxidized form that contains aldehydes in contrast to unmodified transferrin, gives a color reaction on staining with anisaldehyde reagent [a sample is dropped on a silica gel thin-layer plate, dried, immersed into p-anisaldehyde/sulfuric acid/ethanol (1/1/18, v/v/v) and followed by drying and heating]}. The transferrin solution was added to a solution containing 0.50 /zmol of fluorescently labeled poly(L-lysine) with an average chain length of 300 lysine monomers [derived from 34 mg hydrobromide salt (Sigma) after labeling with 130/xg of fluorescein isothiocyanate in sodium bicarbonate buffer (pH 9) for 3 hr and subsequent gel filtration] in 4.5 ml of 100 mM sodium acetate (pH 5) with vigorous mixing at room temperature. The pH of the solution was brought to 7.5 by addition of 1 M sodium bicarbonate after 20 min; to the mixture, four portions of 9.5 mg (150 /xmol) of sodium cyanoborohydride were added at 1-hr intervals. Purification proceeded in the same fashion as described in conjugation method 1: after 18 hr of reduction, 1.9 ml of 5 M sodium chloride was added to bring the solution to an overall salt concentration of about 0.75 M. The reaction mixture was loaded on a cation-exchange column (Pharmacia Mono S HR 10/10) and was fractionated with a sodium chloride gradient from 0.75 to 2.5 M with a constant content of 25 mM 49j. Williams,Biochem.J. 108, 57 (1968).

628


[42]

HEPES (pH 7.3). Some transferrin protein (about 30%) together with a weak fluorescence activity eluted in the flow-through; the major amount of fluorescent conjugate eluted between 1.35 and 1.9 M salt and was pooled into three fractions. After dialysis twice against 2 liters of 25 mM HEPES (pH 7.3), these yielded (in order of elution) fraction A, containing 19 mg (0.24 /~mol) of transferrin modified with 80 nmol of polylysine; fraction B, containing 27 mg (0.34 /xmol) of transferrin modified with 150 nmol of polylysine; and fraction C, containing 5 mg (62 nmol) of transferrin modified with 80 nmol of polylysine. The overall yield of these conjugates based on transferrin was 50%, based on polylysine (62%).

Storage of Conjugates and Iron Incorporation for Transferrin Ligands Transferrin conjugates, unless used immediately, can be stored after shock-freezing (liquid nitrogen) at - 2 0 ° for up to 12 months in the ironfree form. Before iron incorporation, samples (about 0.5 to 1.5 mg) are brought to physiological salt concentration (150 mM) by the addition of sodium chloride; the iron incorporation is performed by the addition of 4 to 8/zl of 10 mM iron(III)-citrate buffer (containing 200 mM citrate and adjusted to pH 7.8 by sodium bicarbonate addition) per milligram transferrin content. The iron-loaded conjugates are used for DNA complex formationas described (see Conjugate DNA-ComplexFormation). To limit the deterioration of the conjugates that often occurs on several freeze-thaw cycles, the conjugates are divided into convenient small aliquots, shockfrozen, and kept at - 2 0 °. In general, iron-incorporated samples maintain their transfection activity for 2-3 months if repeated freeze-thaw cycles are avoided.

Application of Conjugates Choice of Cells We have tested a variety of cells for their ability to be transfected with transferrin-polycation conjugates. These results are summarized in Table I. The cell types fall into three categories based on the luciferase activity obtained. Luciferase expression appears to be a good general indicator of gene expression. We have tested other parameters of gene transfer such as RNA production by both class II and class III polymerase, generation of/3-galactosidase protein, generation of tat trans-activation with an HIV LTR system, and generation of stable cell lines expressing neomycin phosphotransferase. The values obtained are consistent with luciferase values.

[42]


629

TABLE I TRANSFERRINFECTIONWITHVARIOUSCELLTYPES Cell type

Efficiency of transfection"

Cells that work well (> 105 light units/106 cells) Human K562 cells Human Ewing's sarcoma EW-2 cells Chicken HD3 erythroblasts Chicken REV-NPB4 lymphoblasts Cells that work moderately well (5 x 103 to 105 light units/106 cells) Human HeLa cells Human HepG2 cells Human H9 cells Hamster CHO cells Mouse Ehrlich ascites Monkey COS cells Rat H4IIEC3 cells Rat 1A cells Chicken EGFR-myb erythroblasts Chicken normal bone marrow cells Cells that work poorly (

Recombinant DNA, Part H, Vol. 217 (Methods in Enzymology)

Methods in Enzymology, Volume 100: Recombinant DNA, Part B

Recombinant DNA

Numerical Computer Methods, Part E (Methods in Enzymology Vol 384)

Methods in Enzymology Vol 208: Protein-DNA Interactions

Methods in Enzymology 409 - DNA repair

DNA Replication, Volume 262 (Methods in Enzymology)

Methods in Enzymology 408 - DNA repair

Methods in Enzymology Vol 36: Hormone Action Part B

Methods in Enzymology Vol 440: Nitric Oxide, Part F

Methods in Enzymology Vol 440: Nitric Oxide, Part F

Methods in Enzymology Vol.334, Hyperthermophilic Enzymes (Part C)

Methods in Enzymology Vol 42: Carbohydrate Metabolism, Part C

Methods in Enzymology Vol 441: Nitric Oxide, Part G

Methods in Enzymology Vol 131: Enzyme Structure Part L

Methods in Enzymology Vol 284: Lipases, Part A

Methods in Enzymology Vol 314: Antisense Technology, Part B

Methods in Enzymology Vol 39: Hormone Action Part D

Methods in Enzymology Vol 461: Chemokines, Part B

Methods in Enzymology Vol 369: Combinatorial Chemistry, Part B

Programmed Cell Death Part A (Methods in Enzymology, Vol 442)

Methods in Enzymology Vol 460: Chemokines, Part A

Methods in Enzymology 466 - Biothermodynamics, Part B

Methods in Enzymology 488 - Biothermodynamics, Part 3

Methods in Enzymology 465 - Liposomes, Part G

Methods in Enzymology Vol 387: Liposomes, Part D

Methods in Enzymology Vol 367: Liposomes, Part A

Recombinant Dna Vaccines

Methods in Enzymology 464 - Liposomes, Part F

Methods in Enzymology 492 - Biothermodynamics, Part 4

Methods in Enzymology 455 - Biothermodynamics, Part 1

Recombinant DNA, Part H, Vol. 217 (Methods in Enzymology)

Methods in Enzymology, Volume 100: Recombinant DNA, Part B

Recombinant DNA

Numerical Computer Methods, Part E (Methods in Enzymology Vol 384)

Methods in Enzymology Vol 208: Protein-DNA Interactions

Methods in Enzymology 409 - DNA repair

DNA Replication, Volume 262 (Methods in Enzymology)

Methods in Enzymology 408 - DNA repair

Methods in Enzymology Vol 36: Hormone Action Part B

Methods in Enzymology Vol 440: Nitric Oxide, Part F

Methods in Enzymology Vol 440: Nitric Oxide, Part F

Methods in Enzymology Vol.334, Hyperthermophilic Enzymes (Part C)

Methods in Enzymology Vol 42: Carbohydrate Metabolism, Part C

Methods in Enzymology Vol 441: Nitric Oxide, Part G

Methods in Enzymology Vol 131: Enzyme Structure Part L

Methods in Enzymology Vol 284: Lipases, Part A

Methods in Enzymology Vol 314: Antisense Technology, Part B

Methods in Enzymology Vol 39: Hormone Action Part D

Methods in Enzymology Vol 461: Chemokines, Part B

Methods in Enzymology Vol 369: Combinatorial Chemistry, Part B

Programmed Cell Death Part A (Methods in Enzymology, Vol 442)

Methods in Enzymology Vol 460: Chemokines, Part A

Methods in Enzymology 466 - Biothermodynamics, Part B

Methods in Enzymology 488 - Biothermodynamics, Part 3

Methods in Enzymology 465 - Liposomes, Part G

Methods in Enzymology Vol 387: Liposomes, Part D

Methods in Enzymology Vol 367: Liposomes, Part A

Recombinant Dna Vaccines

Methods in Enzymology 464 - Liposomes, Part F

Methods in Enzymology 492 - Biothermodynamics, Part 4

Methods in Enzymology 455 - Biothermodynamics, Part 1

Recommend Documents