Molecular Pathology: The Molecular Basis of Human Disease

Molecular Pathology Companion Web Site: http://books.elsevier.com/companions/9780123744197 Molecular Pathology: The...

Author: William B. Coleman | Gregory J. Tsongalis

302 downloads 2996 Views 53MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Molecular Pathology

Companion Web Site:

http://books.elsevier.com/companions/9780123744197

Molecular Pathology: The Molecular Basis of Human Disease William B. Coleman and Gregory J. Tsongalis, Editors

Resources for Professors:

· · ·

All figures from the book available as both Power Point slides and .jpeg files Links to web sites carefully chosen to supplement the content of the textbook Contact the editors with questions and/or suggestions

T O O L S FOR A LLYOUR TEACHING N E E D S textbooks.elsevier.com

ACADEMIC PRESS To adopt this book for course use, visit http://textbooks.elsevier.com.

Molecular Pathology The Molecular Basis of Human Disease Edited by

William B. Coleman, Ph.D.

Gregory J. Tsongalis, Ph.D.

Department of Pathology and Laboratory Medicine UNC Lineberger Comprehensive Cancer Center University of North Carolina School of Medicine Chapel Hill, NC

Department of Pathology Dartmouth Medical School Dartmouth Hitchcock Medical Center Norris Cotton Cancer Center Lebanon, NH

Academic Press is an imprint of Elsevier 30 Corporate Drive, Suite 400, Burlington, MA 01803, USA 525 B Street, Suite 1900, San Diego, California 92101-4495, USA 84 Theobald’s Road, London WC1X 8RR, UK Copyright # 2009, Elsevier Inc. All rights reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone: (þ44) 1865 843830, fax: (þ44) 1865 853333, E-mail: [email protected]. You may also complete your request online via the Elsevier homepage (http://elsevier.com), by selecting “Support & Contact” then “Copyright and Permission” and then “Obtaining Permissions.” Notice Medicine is an ever-changing field. Standard safety precautions must be followed, but as new research and clinical experience broaden our knowledge, changes in treatment and drug therapy may become necessary or appropriate. Readers are advised to check the most current product information provided by the manufacturer of each drug to be administered to verify the recommended dose, the method and duration of administrations, and contraindications. It is the responsibility of the treating physician, relying on experience and knowledge of the patient, to determine dosages and the best treatment for each individual patient. Neither the publisher nor the authors assume any liability for any injury and/or damage to persons or property arising from this publication.

Library of Congress Cataloging-in-Publication Data APPLICATION SUBMITTED British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library. ISBN: 978-0-12-374419-7 For information on all Academic Press publications visit our Web site at www.elsevierdirect.com

Printed in China 08 09 10 9 8 7

6 5 4 3 2 1

Dedication

The wealth of information contained in this textbook represents the culmination of innumerable small successes that emerged from the ceaseless pursuit of new knowledge by countless experimental pathologists working around the world on all aspects of human disease. Their ingenuity and hard work have dramatically advanced the field of molecular pathology over time and in particular in the last two decades. This book is a tribute to the dedication, diligence, and perseverance of the individuals who have contributed to the advancement of our understanding of the molecular basis of human disease, especially the graduate students, laboratory technicians, and postdoctoral fellows, whose efforts are so frequently taken for granted, whose accomplishments are so often unrecognized, and whose contributions are so quickly forgotten. Molecular Pathology: The Molecular Basis of Human Disease is dedicated to the memory of two bright, resourceful, hard-working, young molecular pathologists who were taken from life at an early age: Dr. Rhonda Simper Ronan (who passed away on September 3, 2007) and Dr. Sharon Ricketts Betz (who passed away on July 24, 2008). Both Rhonda and Sharon were accomplished experimental pathologists that were on their way to promising careers in molecular pathology. They were dear friends and cherished colleagues to many people at their respective institutions. We share the sadness of their families, friends, and colleagues. This book is dedicated to their courage and example, and to the inspiration that they provide.

Their memory will forever remind us that there is too much work left to be done for us to rest on our accomplishments. We also dedicate Molecular Pathology: The Molecular Basis of Human Disease to the many people that have played crucial roles in our successes. We thank our many scientific colleagues, past and present, for their camaraderie, collegiality, and support. We especially thank our scientific mentors for their example of research excellence. We are truly thankful for the positive working relationships and friendships that we have with our faculty colleagues. We also thank our students for teaching us more than we may have taught them. We thank our parents for believing in higher education, for encouragement through the years, and for helping our dreams into reality. We thank our brothers and sisters, and extended families, for the many years of love, friendship, and tolerance. We thank our wives, Monty and Nancy, for their unqualified love, unselfish support of our endeavors, understanding of our work ethic, and appreciation for what we do. Lastly, we give a special thanks to our children, Tess, Sophie, Pete, and Zoe, for providing an unwavering bright spot in our lives, for their unbridled enthusiasm and boundless energy, for giving us a million reasons to take an occasional day off from work just to have fun. William B. Coleman Gregory J. Tsongalis

This page intentionally left blank

Contents

List of Contributors xi Chapter

Preface xv

3

Foreword xvii

Infection and Host Response 41 Margret D. Oethinger, M.D., Ph.D., and Sheldon M. Campbell, M.D., Ph.D.

Acknowledgments xix

Microbes and Hosts—Balance of Power? 41 The Structure of the Immune Response 41 Regulation of Immunity 43 Pathogen Strategies 43 The African Trypanosome and Antibody Diversity: Dueling Genomes 43 Staphylococcus Aureus: the Extracellular Battleground 48 Mycobacterium Tuberculosis and the Macrophage 52 Herpes Simplex Virus: Taking Over 55 HIV: The Immune Guerilla 57 Perspectives 60

PART

I

Essential Pathology – Mechanisms of Disease

Chapter

1

Molecular Mechanisms of Cell Death 3 John J. Lemasters, M.D., Ph.D. Introduction 3 Modes of Cell Death 3 Structural Features of Necrosis and Apoptosis 3 Cellular and Molecular Mechanisms Underlying Necrotic Cell Death 5 Pathways to Apoptosis 12 Mitochondria 15 Nucleus 18 Endoplasmic Reticulum 18 Lysosomes 18 Concluding Remark 19

Chapter

2

Chapter

4

Neoplasia 63 William B. Coleman, Ph.D., and Tara C. Rubinas, M.D. Introduction 63 Cancer Statistics and Epidemiology 63 Classification of Neoplastic Diseases 70 Characteristics of Benign and Malignant Neoplasms 78 Clinical Aspects of Neoplasia 82

PART Acute and Chronic Inflammation Induces Disease Pathogenesis 25

II

Vladislav Dolgachev, Ph.D., and Nicholas W. Lukacs, Ph.D. Introduction 25 Leukocyte Adhesion, Migration, and Activation 25 Acute Inflammation and Disease Pathogenesis 28 Pattern Recognition Receptors and Inflammatory Responses 29 Chronic Inflammation and Acquired Immune Responses 32 Tissue Remodeling During Acute and Chronic Inflammatory Disease 34

Concepts in Molecular Biology and Genetics

Chapter

5

Basic Concepts in Human Molecular Genetics 89 Kara A. Mensink, M.S., C.G.C., and W. Edward Highsmith, Ph.D. Introduction 89

vii

Contents Molecular Structure of DNA, DNA Transcription, and Protein Translation 89 Molecular Pathology and DNA Repair Mechanisms 92 Modes of Inheritance 96 Central Dogma and Rationale for Genetic Testing 101 Allelic Heterogeneity and Choice of Analytical Methodology 104 Conclusion 107

Microdissection Technology Brings Molecular Analysis to the Tissue Level 165 Serum Proteomics: An Emerging Landscape for Early Stage Cancer Detection 174 Chapter

10

Integrative Systems Biology: Implications for the Understanding of Human Disease 185 M. Michael Barmada, Ph.D., and David C. Whitcomb, M.D., Ph.D.

Chapter

6

Introduction 185 Data Generation 186 Data Integration 188 Modeling Systems 189 Implications for Understanding Disease 190 Discussion 192

The Human Genome: Implications for the Understanding of Human Disease 109 Ashley G. Rivenbark, Ph.D. Introduction 109 Structure and Organization of the Human Genome 109 Overview of the Human Genome Project 111 Impact of the Human Genome Project on the Identification of Disease-Related Genes 113 Sources of Variation in the Human Genome 115 Types of Genetic Diseases 116 Genetic Diseases and Cancer 117 Perspectives 119

Chapter

7

PART

III Chapter

The Human Transcriptome: Implications for the Understanding of Human Disease 123

11

Introduction 123 Gene Expression Profiling: The Search for Candidate Genes Involved in Pathogenesis 123 Transcriptome Analysis Based on Microarrays: Technical Prerequisites 126 Microarrays: Bioinformatic Analysis 130 Microarrays: Applications in Basic Research and Translational Medicine 137 Perspectives 146

Introduction 197 Terms, Definitions, and Concepts 197 A Brief History of Approaches to Disease 198 Current Practice of Pathology 203 The Future of Diagnostic Pathology 206 Conclusion 207 Chapter

12

Chapter

The Human Epigenome: Implications for the Understanding of Human Disease 151

157

Chapter

9

Clinical Proteomics and Molecular Pathology 165 Lance A. Liotta, M.D., Ph.D., Virginia Espina, M.S., M.T., Claudia Fredolini, Ph.D., Weidong Zhou, M.D., Ph.D., and Emanuel Petricoin, Ph.D. Understanding Cancer at the Molecular Level: An Evolving Frontier 165

viii

Understanding Molecular Pathogenesis: The Biological Basis of Human Disease and Implications for Improved Treatment of Human Disease 209 William B. Coleman, Ph.D., and Gregory J. Tsongalis, Ph.D. Introduction 209 Hepatitis C Virus Infection 209 Acute Myeloid Leukemia 212 Cystic Fibrosis 213

Maria Berdasco, Ph.D., and Manel Esteller, Ph.D. Introduction 151 Epigenetic Regulation of the Genome 151 Genomic Imprinting 152 Cancer Epigenetics 154 Human Disorders Associated with Epigenetics Environment and the Epigenome 160

Pathology: The Clinical Description of Human Disease 197 William K. Funkhouser, M.D., Ph.D.

Matthias E. Futschik, Ph.D., Wolfgang Kemmner, Ph.D., Reinhold Scha¨fer, Ph.D., and Christine Sers, Ph.D.

8

Principles and Practice of Molecular Pathology

Chapter

13

Integration of Molecular and Cellular Pathogenesis: A Bioinformatics Approach 219 Jason H. Moore, Ph.D., and C. Harker Rhodes, M.D., Ph.D. Introduction 219 Overview of Bioinformatics 220 Database Resources 221 Data Analysis 222 The Future of Bioinformatics 223

Contents Neoplastic Lung and Pleural Diseases 305 Non-neoplastic Lung Disease 323 Obstructive Lung Diseases 323 Interstitial Lung Diseases 331 Pulmonary Vascular Diseases 338 Pulmonary Infections 342 Pulmonary Histiocytic Diseases 352 Pulmonary Occupational Diseases 354 Developmental Abnormalities 356

PART

IV

Molecular Pathology of Human Disease

Chapter

14

Molecular Basis of Cardiovascular Disease 227 Amber Chang Liu, and Avrum I. Gotlieb, M.D.C.M. Introduction 227 General Molecular Principles of Cardiovascular Diseases 227 The Cells of Cardiovascular Organs 227 Atherosclerosis 232 Ischemic Heart Disease 235 Aneurysms 235 Vasculitis 236 Valvular Heart Disease 236 Cardiomyopathies 238

19

Introduction 365 Gastric Cancer 365 Colorectal Cancer 372 Chapter

Introduction 395 Molecular Basis of Liver Development 395 Molecular Basis of Liver Regeneration 397 Adult Liver Stem Cells in Liver Health and Disease 399 Molecular Basis of Hepatocyte Death 400 Molecular Basis of Nonalcoholic Fatty Liver Disease 402 Molecular Basis of Alcoholic Liver Disease 406 Molecular Basis of Hepatic Fibrosis and Cirrhosis 407 Molecular Basis of Hepatic Tumors 408

Introduction and Overview of Coagulation 247 Disorders of Soluble Clotting Factors 249 Disorders of Fibrinolysis 256 Disorders of Platelet Number or Function 256 Thrombophilia 260 Chapter

Molecular Basis of Lymphoid and Myeloid Diseases 265 Joseph R. Biggs, Ph.D., and Dong-Er Zhang, Ph.D. Development of the Blood and Lymphoid Organs 265 Myeloid Disorders 271 Lymphocyte Disorders 279

Chapter

21

Acute Pancreatitis 421 Chronic and Hereditary Pancreatitis 426 Summary 430

Molecular Basis of Diseases of Immunity 291 David O. Beenhouwer, M.D. Introduction 291 Normal Immune System 291 Major Syndromes 296

Chapter

18

Molecular Basis of Pulmonary Disease 305 Carol F. Farver, M.D., and Dani S. Zander, M.D. Introduction 305

Molecular Basis of Diseases of the Exocrine Pancreas 421 Matthias Sendler, Ph.D., Julia Mayerle, Ph.D., and Markus M. Lerch, M.D.

Chapter

17

Molecular Basis of Liver Disease 395 Satdarshan P. Singh Monga, M.D., and Jaideep Behari, M.D., Ph.D.

Molecular Basis of Hemostatic and Thrombotic Diseases 247 Alice D. Ma, M.D., and Nigel S. Key, M.D.

16

Molecular Basis of Diseases of the Gastrointestinal Tract 365 Antonia R. Sepulveda, M.D., Ph.D., and Dara L. Aisner, M.D., Ph.D.

20

Chapter

15

Chapter

Chapter

22

Molecular Basis of Diseases of the Endocrine System 435 Alan Lap-Yin Pang, Ph.D., Malcolm M. Martin, M.D., Arline L.A. Martin, M.D., and Wai-Yee Chan, Ph.D. Introduction 435 The Pituitary Gland 435 The Thyroid Gland 439 The Parathyroid Gland 446 The Adrenal Gland 450 Puberty 454

ix

Contents Chapter

23

Chapter

Molecular Basis of Gynecologic Diseases 465

27

Joshua A. Sonnen, Ph.D., C. Dirk Keene, M.D., Ph.D., Robert F. Hevner, M.D., Ph.D., and Thomas J. Montine, M.D., Ph.D.

Introduction 465 Benign and Malignant Tumors of the Female Reproductive Tract 465 Disorders Related to Pregnancy 477

Anatomy of the Central Nervous System 551 Neurodevelopmental Disorders 554 Neurological Injury: Stroke, Neurodegeneration, and Toxicants 564 Neoplasia 577 Disorders of Myelin 583

Chapter

24

Molecular Pathogenesis of Prostate Cancer: Somatic, Epigenetic, and Genetic Alterations 489 Carlise R. Bethel, Ph.D., Angelo M. De Marzo, M.D., Ph.D., and William G. Nelson, M.D., Ph.D. Introduction 489 Hereditary Component of Prostate Cancer Risk 490 Somatic Alterations in Gene Expression 490 Epigenetics 493 Advances in Mouse Models of Prostate Cancer 494 Conclusion 496 Acknowledgments 496

PART

V

28

Introduction 591 History of Molecular Diagnostics 591 Molecular Laboratory Subspecialties 593 Future Applications 602

Natasa Snoj, M.D., Phuong Dinh, M.D., Philippe Bedard, M.D., and Christos Sotiriou, M.D., Ph.D. Chapter

29

Introduction 605 The Current Molecular Infectious Disease Paradigm 606 A New Paradigm for Molecular Diagnostic Applications 607 BCR-ABL: A Model for the New Paradigm 610 Conclusion 612

Molecular Basis of Skin Disease 519 Vesarat Wessagowit, M.D., Ph.D., and John A. McGrath, Ph.D. Introduction 519 Skin Diseases and Their Impact 519 Molecular Basis of Healthy Skin 519 Skin Development and Maintenance Provide New Insight into the Molecular Mechanisms of Disease 523 Molecular Pathology of Mendelian Genetic Skin Disorders 524 Molecular Pathology of Common Inflammatory Skin Diseases 531 Skin Proteins as Targets for Inherited and Acquired Disorders 535 Molecular Pathology of Skin Cancer 539 Molecular Diagnosis of Skin Disease 544 New Molecular Mechanisms and Novel Therapies 545

x

Molecular Assessment of Human Disease in the Clinical Laboratory 605 Joel A. Lefferts, Ph.D., and Gregory J. Tsongalis, Ph.D.

Chapter

26

Molecular Diagnosis of Human Disease 591 Lawrence M. Silverman, Ph.D., and Grant C. Bullock, M.D., Ph.D.

Molecular Biology of Breast Cancer 501

Introduction 501 Traditional Breast Cancer Classification 501 Biomarkers 503 Gene Expression Profiling 509 Conclusion 513

Practice of Molecular Medicine

Chapter

Chapter

25

Molecular Pathology: Neuropathology 551

Samuel C. Mok, Ph.D., Kwong-kwok Wong, Ph.D., Karen Lu, M.D., Karl Munger, Ph.D., and Zoltan Nagymanyoki, Ph.D.

Chapter

30

Pharmacogenomics and Personalized Medicine in the Treatment of Human Diseases 613 Hong Kee Lee, Ph.D., and Gregory J. Tsongalis, Ph.D. Introduction 613 Conclusion 620

Index 623

List of Contributors

Dara L. Aisner, M.D., Ph.D. Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Hospital of the University of Pennsylvania, Philadelphia, PA, USA

Curriculum in Toxicology, Program in Translational Medicine, UNC Lineberger Comprehensive Cancer Center, University of North Carolina School of Medicine, Chapel Hill, NC, USA

M. Michael Barmada, Ph.D. Department of Human Genetics, Graduate School of Public Health, University of Pittsburgh, Pittsburgh PA, USA

Angelo M. De Marzo, M.D., Ph.D. Sidney Kimmel Comprehensive Cancer Center, Department of Pathology, and the Brady Urological Research Institute, Johns Hopkins University School of Medicine, Baltimore, MD, USA

Philippe Bedard, M.D. Translational Research Unit, Jules Bordet Institute Universite´, Libre de Bruxelles, Brussels, Belgium David O. Beenhouwer, M.D. Department of Medicine, David Geffen School of Medicine at University of California, and Division of Infectious Diseases, Veterans Affairs Greater Los Angeles Healthcare System, Los Angeles, CA Jaideep Behari, M.D., Ph.D. Department of Medicine, Division of Gastroenterology, Hepatology, and Nutrition, University of Pittsburgh School of Medicine, Pittsburgh, PA, USA

Phuong Dinh, M.D. Translational Research Unit, Jules Bordet Institute Universite´, Libre de Bruxelles, Brussels, Belgium Vladislav Dolgachev, Ph.D. Department of Pathology, University of Michigan Medical School, Ann Arbor, MI, USA Virginia Espina, M.S., M.T. George Mason University, Center for Applied Proteomics and Molecular Medicine Manassas, VA, USA

Maria Berdasco, M.D. Cancer Epigenetics and Biology Program, Catalan Institute of Oncology, Barcelona, Catalonia, Spain

Manel Esteller, Ph.D Cancer Epigenetics and Biology Program, Catalan Institute of Oncology, Barcelona, Catalonia, Spain

Carlise R. Bethel, Ph.D. Sidney Kimmel Comprehensive Cancer Center, Department of Pathology, and the Brady Urological Research Institute, Johns Hopkins University School of Medicine, Baltimore, MD, USA

Carol Farver, M.D. Director, Pulmonary Pathology, Vice-Chair for Education, Pathology and Laboratory Medicine Institute, Department of Anatomic Pathology, Cleveland Clinic Foundation, Cleveland, OH, USA

Joseph R. Biggs, Ph.D. Departments of Pathology and Biological Sciences, University of California, San Diego, La Jolla, CA, USA

Claudia Fredolini, Ph.D. George Mason University, Center for Applied Proteomics and Molecular Medicine Manassas, VA, USA

Grant C. Bullock, M.D., Ph.D. Department of Pathology, University of Virginia Health System, Charlottesville, VA, USA

William K. Funkhouser, M.D., Ph.D. Department of Pathology and Laboratory Medicine, University of North Carolina School of Medicine, Chapel Hill, NC, USA

Sheldon M. Campbell, M.D., Ph.D., F.C.A.P. Department of Laboratory Medicine, Yale University School of Medicine Pathology and Laboratory Medicine, VA Connecticut Healthcare System, West Haven, CT, USA Wai-Yee Chan, Ph.D. Laboratory of Clinical Genomics, National Institute of Child Health and Human Development, NIH, Bethesda, MD, and Departments of Pediatrics, Biochemistry & Molecular Biology, Georgetown University School of Medicine, Washington, D.C., USA William B. Coleman, Ph.D. Professor and Director of Graduate Studies, Department of Pathology and Laboratory Medicine,

Matthias E. Futschik, Ph.D. Institute for Theoretical Biology, Charite´, HumboldtUniversita¨t, Berlin, Germany, Centre for Molecular and Structural Biomedicine, University of Algarve, Faro, Portugal Avrum I. Gotlieb, M.D.C.M. Department of Pathology, Toronto General Research Institute, University Health Network, Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada Robert Hevner, Ph.D., M.D. Professor, Neurological Surgery/Neuropathology, University of Washington School of Medicine, USA

xi

List of Contributors W. Edward Highsmith, Ph.D. Molecular Genetics Laboratory, Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN, USA C. Dirk Keene, M.D., Ph.D. Associate Professor, Neurological Surgery/Neuropathology, University of Washington School of Medicine, USA Wolfgang Kemmner, Ph.D. Department of Surgery and Surgical Oncology, Robert-Ro¨ssle-Klinik Berlin, Charite´ – Universita¨tsmedizin Berlin, Berlin, Germany Nigel S. Key, M.D. Department of Medicine, University of North Carolina School of Medicine, Chapel Hill, NC, USA Hong Kee Lee, Ph.D. Department of Pathology, Dartmouth Medical School, Dartmouth Hitchcock Medical Center and Norris Cotton Cancer Center, Lebanon, NH, USA Joel A. Lefferts, Ph.D. Department of Pathology, Dartmouth Medical School, Dartmouth Hitchcock Medical Center and Norris Cotton Cancer Center, Lebanon, NH, USA John J. Lemasters, M.D., Ph.D. Center for Cell Death, Injury and Regeneration, Departments of Pharmaceutical & Biomedical Sciences and Biochemistry & Molecular Biology, Medical University of South Carolina, Charleston, SC, USA Markus M. Lerch, M.D Department of Internal Medicine A, Ernst-Moritz-ArndtUniversita¨t Greifswald, Greifswald, Germany Lance Liotta, Ph.D. George Mason University, Center for Applied Proteomics and Molecular Medicine, Manassas, VA, USA Amber Chang Liu, M.Sc. Department of Pathology, Toronto General Research Institute, University Health Network, Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada Karen Lu, M.D. Department of Gynecologic Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX, USA Nicholas W. Lukacs, Ph.D. Professor of Pathology, Director Molecular and Cellular Pathology Graduate Program University of Michigan Medical School, Ann Arbor, MI, USA Alice Ma, M.D. Department of Medicine, University of North Carolina School of Medicine, Chapel Hill, NC, USA Arlene Martin, M.D. Department of Pediatrics, Georgetown University School of Medicine, Washington, DC, USA Malcolm M. Martin, M.D. Department of Pediatrics, Georgetown University School of Medicine, Washington, DC, USA Julia Mayerle Department of Internal Medicine A, Ernst-Moritz-ArndtUniversita¨t Greifswald, Greifswald, Germany xii

John A. McGrath, M.D. FRCP Genetic Skin Disease Group, St John’s Institute of Dermatology, King’s College London, Guy’s Campus, London, UK Kara A. Mensink, M.S. Molecular Genetics Laboratory, Department of Laboratory Medicine and Pathology, Mayo Clinic, Rochester, MN, USA Samuel Chi-ho Mok, Ph.D. Department of Gynecologic Oncology, University of Texas, M.D. Anderson Cancer Center, Houston, TX, USA Satdarshan (Paul) Singh Monga, M.D. Director-Division of Experimental Pathology, Associate Professor of Pathology and Medicine, University of Pittsburgh, School of Medicine Pittsburgh, PA, USA Thomas J. Montine, M.D., Ph.D. Division of Neuropathology, Department of Pathology, University of Washington, Harborview Medical center, Seattle, WA, USA Jason H. Moore, Ph.D. Computational Genetics Laboratory, Norris-Cotton Cancer Center, Departments of Genetics and Community and Family Medicine, Dartmouth Medical School, Lebanon, NH Karl Mu¨nger, Ph.D. Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA Zoltan Nagymanyoki, M.D., Ph.D. Division of Gynecologic Oncology, Department of Obstetrics and Gynecology, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA William G. Nelson, M.D., Ph.D. Sidney Kimmel Comprehensive Cancer Center, Department of Oncology, and the Brady Urological Research Institute, Johns Hopkins University School of Medicine, Baltimore, MD, USA Margret Oethinger, M.D., Ph.D. Department of Clinical Pathology, Clinical Microbiology Section, Cleveland Clinic, Cleveland, OH, USA Alan LP Pang, Ph.D. Laboratory of Clinical Genomics, National Institute of Child Health and Human Development, NIH, Bethesda, MD, USA Emanuel Petricoin, Ph.D. George Mason University, Center for Applied Proteomics and Molecular Medicine, Manassas, VA, USA Ashley Rivenbark, Ph.D. UNC Lineberger Comprehensive Cancer Center, Department of Biochemistry and Biophysics, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA C. Harker Rhodes, M.D., Ph.D. Norris-Cotton Cancer Center, Department of Pathology, Dartmouth Medical School, Lebanon, NH Tara Rubinas, M.D. Department of Pathology and Laboratory Medicine, University of North Carolina School of Medicine, Chapel Hill, NC, USA

List of Contributors Reinhold Schafer, Ph.D. Laboratory of Molecular Tumor Pathology, Charite´ – Universita¨tsmedizin Berlin, Berlin, Germany

Vesarat Wessagowit, M.D., Ph.D. The Institute of Dermatology, Rajvithi Phyathai, Bangkok, Thailand

Matthias Sendler Department of Internal Medicine A, Ernst-Moritz-ArndtUniversita¨t Greifswald, Greifswald, Germany

David C. Whitcomb, Ph.D. Department of Human Genetics, Graduate School of Public Health, University of Pittsburgh, Division of Gastroenterology, Hepatology, and Nutrition, Department of Medicine, University of Pittsburgh Medical Center, Pittsburgh, PA, USA

Antonia Sepu´lveda, M.D., Ph.D. Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Hospital of the University of Pennsylvania, Philadelphia, PA, USA Christine Sers, Ph.D. Laboratory of Molecular Tumor Pathology, Charite´ – Universita¨tsmedizin Berlin, Berlin, Germany Lawrence M. Silverman, Ph.D. Department of Pathology, University of Virginia Health System, Charlottesville, VA, USA Natasha Snoj, M.D. Translational Research Unit, Jules Bordet Institute Universite´, Libre de Bruxelles, Brussels, Belgium Joshua A. Sonnen, Ph.D. Department of Pathology, Neuropathology Division, University of Washington, USA Christos Sotiriou, M.D., Ph.D. Translational Research Unit, Jules Bordet Institute Universite´, Libre de Bruxelles, Brussels, Belgium

Kwong-kwok Wong, Ph.D. Department of Gynecologic Oncology, University of Texas M.D. Anderson Cancer Center, Houston, TX, USA Dani S. Zander, M.D. Professor and Chair of Pathology, University Chair in Pathology, Penn State Milton S. Hershey Medical Center/ Penn State University College of Medicine, Department of Pathology, Hershey, PA, USA Dong-Er Zhang, Ph.D. Departments of Pathology and Biological Sciences, University of California, San Diego, La Jolla, CA, USA Weidong Zhou, M.D., Ph.D. George Mason University, Center for Applied Proteomics and Molecular Medicine, Manassas, VA, USA

Gregory J. Tsongalis, Ph.D. Department of Pathology, Dartmouth Medical School, Dartmouth Hitchcock Medical Center and Norris Cotton Cancer Center, Lebanon, NH, USA

xiii


Preface

Pathology is the study of disease. The field of pathology emerged from the application of the scientific method to the study of human disease. Thus, pathology as a discipline represents the complimentary intersection of medicine and basic science. Early pathologists were typically practicing physicians who described the various diseases that they treated and made observations related to factors that contributed to the development of these diseases. The description of disease evolved over time from gross observation to microscopic inspection of diseased tissues based upon the light microscope, and more recently to the ultrastructural analysis of disease with the advent of the electron microscope. As hospital-based and community-based registries of disease emerged, the ability of investigators to identify factors that cause disease and assign risk to specific types of exposures expanded to increase our knowledge of the epidemiology of disease. While descriptive pathology can be dated to the earliest written histories of medicine and the modern practice of diagnostic pathology dates back perhaps 200 years, the elucidation of mechanisms of disease and linkage of disease pathogenesis to specific causative factors emerged more recently from studies in experimental pathology. The field of experimental pathology embodies the conceptual foundation of early pathology – the application of the scientific method to the study of disease – and applies modern investigational tools of cell and molecular biology to advanced animal model systems and studies of human subjects. Whereas the molecular era of biological science began over 50 years ago, recent advances in our knowledge of molecular mechanisms of disease have propelled the field of molecular pathology. These advances were facilitated by significant improvements and new developments associated with the techniques and methodologies available to pose questions related to the molecular biology of normal and diseased states affecting cells, tissues, and organisms. Today, molecular pathology encompasses the investigation of the molecular mechanisms of disease and interfaces with translational medicine where new basic science discoveries form the basis for the development of new strategies for disease prevention, new therapeutic approaches and targeted therapies for the treatment of disease, and new diagnostic tools for disease diagnosis and prognostication. With the remarkable pace of scientific discovery in the field of molecular pathology, basic scientists, clinical scientists, and physicians have a need for a source

of information on the current state-of-the-art of our understanding of the molecular basis of human disease. More importantly, the complete and effective training of today’s graduate students, medical students, postdoctoral fellows, and others, for careers related to the investigation and treatment of human disease requires textbooks that have been designed to reflect our current knowledge of the molecular mechanisms of disease pathogenesis, as well as emerging concepts related to translational medicine. Most pathology textbooks provide information related to diseases and disease processes from the perspective of description (what does it look like and what are its characteristics), risk factors, disease-causing agents, and to some extent, cellular mechanisms. However, most of these textbooks lack in-depth coverage of the molecular mechanisms of disease. The reason for this is primarily historical – most major forms of disease have been known for a long time, but the molecular basis of these diseases are not always known or have been elucidated only very recently. However, with rapid progress over time and improved understanding of the molecular basis of human disease the need emerged for new textbooks on the topic of molecular pathology, where molecular mechanisms represent the focus. In this volume on Molecular Pathology: The Molecular Basis of Human Disease we have assembled a group of experts to discuss the molecular basis and mechanisms of major human diseases and disease processes, presented in the context of traditional pathology, with implications for translational molecular medicine. This volume is intended to serve as a multi-use textbook that would be appropriate as a classroom teaching tool for medical students, biomedical graduate students, allied health students, and others (such as advanced undergraduates). Further, this textbook will be valuable for pathology residents and other postdoctoral fellows that desire to advance their understanding of molecular mechanisms of disease beyond what they learned in medical/graduate school. In addition, this textbook is useful as a reference book for practicing basic scientists and physician scientists that perform disease-related basic science and translational research, who require a ready information resource on the molecular basis of various human diseases and disease states. To be sure, our understanding of the many causes and molecular mechanisms that govern the development of human diseases is far from complete. Nevertheless, the amount of information related to

xv

Preface

these molecular mechanisms has increased tremendously in recent years and areas of thematic and conceptual consensus have emerged. We have made an effort to integrate accepted principles with broader theoretical concepts in an attempt to present a current and comprehensive view of the molecular basis of human disease. We hope that Molecular Pathology: The Molecular Basis of Human Disease will accomplish its purpose of providing students and researchers with in-depth coverage of the molecular basis of major

xvi

human diseases in the context of traditional pathology so as to stimulate new research aimed at furthering our understanding of these molecular mechanisms of human disease and advancing the theory and practice of molecular medicine. William B. Coleman Gregory J. Tsongalis

Foreword

Traditionally, pathologists were involved in clinical practice as physicians trained in the diagnosis of human disease using morphologic and clinical laboratory techniques. Pathologists also serve as consultants to other clinicians and as teachers for medical students, allied health students, graduate students, residents, and fellows. Recent advances in basic sciences, including cell biology, genetics, and molecular biology, have opened up a new era of research in pathology that is being applied to the practice of molecular pathology. The recent development of powerful new tools for quantitative imaging and molecular analysis of human tissue, in combination with traditional morphological, clinical, and radiologic imaging, has enabled the practice of molecular pathology. Quantitative imagining techniques have been developed that allow multiparameter imaging of single cells in three-dimensional tissues (confocal scanning laser microscopy) or in tissue sections or cytological preparations (laser scanning cytometry). With laser capture microdissection, it is possible to precisely identify and collect individual cell populations for subsequent molecular and proteomic analyses. New microarray technologies, coupled with molecular genetics, allow comprehensive analysis of genetic and chromosomal alterations in normal and diseased cells and tissues. At the same time, new transgenic models of human disease using conditional, tissue-specific gene targeting are increasingly important in identifying early steps in the pathogenesis of disease and in assessing novel approaches for disease prevention, intervention, and therapy. Pathologists play a key role in interpretation of anatomic changes in transgenic animals and in correlating these changes with human disease. These scientific and technological advances have developed rapidly over the past two decades leading to significant advances in understanding the molecular and genetic mechanisms of human disease. These basic research advances are now being translated into novel approaches for the prevention, diagnosis, and treatment of major human diseases including

cardiovascular disease, hereditary and metabolic diseases, and cancer. This new textbook bridges traditional morphologic and clinical pathology and the emerging discipline of molecular pathology. The readers of this textbook written for medical students, graduate students in biomedical research, allied health professionals, residents, and fellows will experience the excitement of these recent scientific and technological advances in modern pathology. A unique feature of this textbook is integration of molecular and genetic pathology with traditional clinical and pathologic descriptions of human disease using a “systems biology” approach. The concept of “molecular pathogenesis” of disease is illustrated with selected diseases to demonstrate how perturbations in molecular pathways contribute to the evolution of disease from normal cells and tissues. This textbook provides a basic foundation in mechanisms of disease, molecular and genetic pathology, and the systems biology approach to disease pathogenesis integrated with morphologic manifestations of human disease. Current and future strategies in molecular diagnosis of human disease are described and placed in the context of morphological and clinical laboratory diagnosis. The impact of molecular diagnosis on treatment decisions and the practice of personalized medicine conclude this textbook with the ultimate vision of translation of basic research in molecular and genetic pathology to clinical practice. This textbook provides a valuable resource for students, biomedical researchers, and physician-scientists who will be working together in interdisciplinary research teams to achieve this vision and embark on the future practice of molecular medicine. Agnes B. Kane, M.D., Ph.D. Professor and Chair Department of Pathology and Laboratory Medicine Director, NIEHS Training Program in Environmental Pathology, The Warren Alpert Medical School of Brown University

xvii


Acknowledgments

The editors would like to acknowledge the significant contributions of a number of people to the successful production of Molecular Pathology: The Molecular Basis of Human Disease. We would like to thank the individuals that contributed to the content of this volume. The remarkable coverage of the state-of-the-art in the molecular pathology of human disease would not have been possible without the hard work and diligent efforts of the 67 authors of the individual chapters. Many of these contributors are our long-time colleagues, collaborators, and friends, and they have contributed to other projects that we have directed. We appreciate their willingness to contribute once again to a project that we found worthy. We especially thank the contributors to this volume that were willing to work with us for the first time. This group also includes some of our long-time friends and colleagues, as well as some new friends. We look forward to working with all of these authors again in the future. Each of these contributors provided us with an excellent treatment of their topic and we hope that they will be proud of their individual contributions to the textbook. Furthermore, we would like to give a special thanks to our colleagues that co-authored chapters with us for this textbook. There is no substitute for an excellent co-author when you are juggling the several responsibilities of concurrently editing and contributing to a textbook. Collectively, we can all be proud of this volume as it is proof that the whole can be greater than the sum of its parts. We would also like to thank the many people that work for Academic Press and Elsevier that made this project possible. Many of these people we have not met and do not know, but we appreciate their efforts to bring this textbook to its completed form. Special thanks goes to three key people that made significant

contributions to this project on the publishing side, and proved to be exceptionally competent and capable. Ms. Mara Conner (Academic Press, San Diego, CA) embraced the concept of this textbook when our ideas were not yet fully developed and encouraged us to pursue this project. She was receptive to the model for this textbook that we envisioned and worked closely with us to evolve the project into its final form. We thank her for providing excellent oversight (and for displaying optimistic patience) during the construction and editing of the textbook. Ms. Megan Wickline (Academic Press, San Diego, CA) provided excellent support to us throughout this project. As we interacted with our contributing authors, collected and edited manuscripts, and through production of the textbook, Megan assisted us greatly by being a constant reminder of deadlines, helping us with communication with the contributors, and generally providing support for details small and large, all of which proved to be critical. Ms. Christie Jozwiak (Elsevier, Burlington, MA) directed the production of the textbook. She worked with us closely to ensure the integrity of the content of the textbook as it moved from the edited manuscripts into their final form. Throughout the production process, Christie gave a tremendous amount of time and energy to the smallest of details. We thank her for her direct involvement with the production and also for directing her excellent production team. It was a pleasure to work with Mara, Megan, and Christie on this project. We hope that they enjoyed it as much as we did, and we look forward to working with them again soon. William B. Coleman Gregory J. Tsongalis

xix


P a r t

I Essential Pathology — Mechanisms of Disease

1


C h a p t e r

1 Molecular Mechanisms of Cell Death John J. Lemasters

INTRODUCTION A common theme in disease is death of cells. In diseases ranging from stroke to congestive heart disease to alcoholic cirrhosis of the liver, death of individual cells leads to irreversible functional loss in whole organs and ultimately mortality. For such diseases, prevention of cell death becomes a basic therapeutic goal. By contrast in neoplasia, the purpose of chemotherapy is to kill proliferating cancer cells. For either therapeutic goal, understanding the mechanisms of cell death becomes paramount.

(ATP) depletion, apoptosis may take hours to go to completion and is an ATP-requiring process without a clearly distinguished point of no return. Although apoptosis and necrosis were initially considered separate and independent phenomena, an alternate view is emerging that apoptosis and necrosis can share initiating factors and signaling pathways to become extremes on a phenotypic continuum of necrapoptosis or aponecrosis [5–7].

MODES OF CELL DEATH

STRUCTURAL FEATURES OF NECROSIS AND APOPTOSIS Oncotic Necrosis

Although many stresses and stimuli cause cell death, the mode of cell death typically follows one of two patterns. The first is necrosis, a pathological term referring to areas of dead cells within a tissue or organ. Necrosis is typically the result of an acute and usually profound metabolic disruption, such as ischemia/reperfusion and severe toxicant-induced damage. Since necrosis as observed in tissue sections is an outcome rather than a process, the term oncosis has been introduced to describe the process leading to necrotic cell death [1,2], but the term has yet to be widely adopted in the experimental literature. Here, the terms oncosis, oncotic necrosis, and necrotic cell death will be used synonymously to refer both to the outcome of cell death and the pathogenic events precipitating cell killing. The second pattern is programmed cell death, most commonly manifested as apoptosis, a term derived from an ancient Greek word for the falling of leaves in the autumn. In apoptosis, specific stimuli initiate execution of well-defined pathways leading to orderly resorption of individual cells with minimal leakage of cellular components into the extracellular space and little inflammation [3,4]. Whereas necrotic cell death occurs with abrupt onset after adenosine triphosphate

Cellular changes leading up to onset of necrotic cell death include formation of plasma membrane protrusions called blebs, mitochondrial swelling, dilatation of cisternae of the endoplasmic reticulum (ER) and nuclear membranes, dissociation of polysomes, and cellular swelling leading to rupture with release of intracellular contents (Table 1.1, Figure 1.1). After necrotic cell death, characteristic histological features of loss of cellular architecture, vacuolization, karyolysis, and increased eosinophilia soon become evident (Figure 1.2). Cell lysis evokes an inflammatory response, attracting neutrophils and monocytes to the dead tissue to dispose of the necrotic debris by phagocytosis and defend against infection (Figure 1.3). In organs like heart and brain with little regenerative capacity, healing occurs with scar formation, namely replacement of necrotic regions with fibroblasts and collagen, as well as other connective tissue components. In organs like the liver that have robust regenerative capacity, cell proliferation can replace areas of necrosis with completely normal tissue within a few days. The healed liver tissue shows with little or no residua of the necrotic event, but if regeneration fails, collagen deposition and fibrosis will occur instead to cause cirrhosis.

Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

3

Part I

Essential Pathology — Mechanisms of Disease

Table 1.1

Comparison of Necrosis and Apoptosis

Necrosis

Apoptosis

Accidental cell death Contiguous regions of cells Cell swelling Plasmalemmal blebs without organelles Small chromatin aggregates Random DNA degradation Cell lysis with release of intracellular contents Inflammation and scarring Mitochondrial swelling and dysfunction Phospholipase and protease activation ATP depletion and metabolic disruption Cell death precipitated by plasma membrane rupture

Controlled cell deletion Single cells separating from neighbors Cell shrinkage Zeiotic blebs containing large organelles Nuclear condensation and lobulation Internucleosomal DNA degradation Fragmentation into apoptotic bodies Absence of inflammation and scarring Mitochondrial permeabilization Caspase activation ATP and protein synthesis sustained Intact plasma membrane

Figure 1.2 Histology of necrosis after hepatic ischemia/ reperfusion in a mouse. Note increased eosinophilia, loss of cellular architecture, and nuclear pyknosis and karyolysis. Bar is 50 µm.

Figure 1.1 Electron microscopy of oncotic necrosis to a rat hepatic sinusoidal endothelial cell after ischemia/ reperfusion. Note cell rounding, mitochondrial swelling (arrows), rarefaction of cytosol, dilatation of the ER and the space between the nuclear membranes (*), chromatin condensation, and discontinuities in the plasma membrane. Bar is 2 µm.

Apoptosis Unlike necrosis, which usually represents an accidental event in response to an imposed unphysiological stress, apoptosis is a process of physiological cell deletion that has an opposite role to mitosis in the regulation of cell populations. In apoptosis, cell death occurs with little release of intracellular contents, 4

inflammation, and scar formation. Individual cells undergoing apoptosis separate from their neighbors and shrink rather than swell. Distinctive nuclear and cytoplasmic changes also occur, including chromatin condensation, nuclear lobulation and fragmentation, formation of numerous small cell surface blebs (zeiotic blebbing), and shedding of these blebs as apoptotic bodies that are phagocytosed by adjacent cells and macrophages for lysosomal degradation (Table 1.1, Figure 1.3). Characteristic biochemical changes also occur, typically activation of a cascade of cysteineaspartate proteases, called caspases, leakage of proapoptotic proteins like cytochrome c from mitochondria into the cytosol, internucleosomal deoxyribonucleic acid (DNA) degradation, degradation of poly (ADP-ribose) polymerase (PARP), and movement of phosphatidyl serine to the exterior leaflet of the plasmalemmal lipid bilayer. Thus, apoptosis manifests a very different pattern of cell death than oncotic necrosis (Table 1.1, Figure 1.3).

Chapter 1

Molecular Mechanisms of Cell Death

Figure 1.3 Scheme of necrosis and apoptosis. In oncotic necrosis, swelling leads to bleb rupture and release of intracellular constituents which attract macrophages that clear the necrotic debris by phagocytosis. In apoptosis, cells shrink and form small zeiotic blebs that are shed as membrane-bound apoptotic bodies. Apoptotic bodies are phagocytosed by macrophages and adjacent cells. Adapted with permission from [2].

CELLULAR AND MOLECULAR MECHANISMS UNDERLYING NECROTIC CELL DEATH Metastable State Preceding Necrotic Cell Death Cellular events culminating in necrotic cell death are somewhat variable from one cell type to another, but certain events occur regularly. As implied by the term oncosis, cellular swelling is a prominent feature of oncotic necrosis [1,8]. In many cell types, swelling of 30–50% occurs early after ATP depletion associated with formation of blebs on the cell surface (Figure 1.4) [9,10]. These blebs contain cytosol and ER but exclude larger organelles like mitochondria and lysosomes. Bleb formation is likely due to cytoskeletal alterations after ATP depletion, whereas swelling arises from disruption of cellular ion transport [11,12]. Mitochondrial swelling and dilatation of cisternae of ER and nuclear membranes accompany bleb formation (see Figure 1.1).

After longer times, a metastable state develops, which is characterized by mitochondrial depolarization, lysosomal breakdown, bidirectional leakiness of the plasma membrane to organic anions (but not cations), intracellular Ca2þ and pH dysregulation, and accelerated bleb formation with more rapid swelling [13–16]. The metastable state lasts only a few minutes and culminates in rupture of a plasma membrane bleb (Figure 1.4) [14–16]. Bleb rupture leads to loss of metabolic intermediates such as those that reduce tetrazolium dyes, leakage of cytosolic enzymes like lactate dehydrogenase, uptake of dyes like trypan blue, and collapse of all electrical and ion gradients across the membrane. This all-or-nothing breakdown of the plasma membrane permeability barrier is long-lasting, irreversible, and incompatible with continued life of the cell. Some work suggests that opening of a nonspecific anion channel in the plasma membrane initiates the metastable state [17,18]. Although potassium and sodium channels open early after metabolic disruption, cellular impermeability to chloride limits the 5

Part I


Figure 1.4 Bleb rupture at onset of necrotic cell death. After metabolic inhibition with cyanide and iodoacetate, inhibitors of respiration and glycolysis, respectively, a surface bleb of the cultured rat hepatocyte on the right has just burst. Note the discontinuity of the plasma membrane surface in the scanning electron micrograph. The hepatocyte on the left is also blebbed, but the plasma membrane is still intact, and viability has not yet been lost. Bar is 5 mm. Adapted with permission from [16].

Figure 1.5 Plasma membrane permeabilization leading to necrotic cell death. Early after hypoxia and other metabolic stresses, ATP depletion leads to inhibition of the Na,K-ATPase and opening of monovalent cation channels causing cation gradients (Naþ and Kþ) to collapse. Swelling is limited by impermeability to anions. Later, glycine and strychnine-sensitive anion channels open to initiate anion entry and accelerate bleb formation and swelling. Swelling continues until a bleb ruptures. With abrupt and complete loss of the plasma membrane permeability barrier, viability is lost. Supravital dyes like trypan blue and propidium iodide enter the cell to stain the nucleus, and cytosolic enzymes like lactate dehydrogenase (LDH) leak out. With permission from [209].

rate of swelling. At onset of the metastable state, a relatively nonspecific chloride-conducting anion channel appears to open, permitting electroneutral uptake of electrolytes (principally sodium and chloride) and initiating rapid swelling driven by colloid osmotic (oncotic) forces (Figure 1.5). Rapid swelling continues until one of the plasma membrane blebs ruptures.

6

Bleb rupture is the final irreversible event precipitating cell death, since removal of the instigating stress (e.g., reoxygenation of anoxic cells) leads to cell recovery prior to bleb rupture but not afterwards [15]. Glycine and the glycine receptor antagonist strychnine protect against necrotic cell killing. Protection is associated with inhibition of this anion death channel

Chapter 1

and suppression of swelling in the metastable state. Glycine protection occurs without restoration of ATP or prevention of other metabolic derangements [12,18–21]. The glycine-gated chloride channel (GlyR) appears responsible for glycine cytoprotection, since glycine is not cytoprotective in cells not expressing the GlyRa1 subunit, and since GlyRa1 confers glycine cytoprotection in such cells [22].

Mitochondrial Dysfunction and ATP Depletion Ischemia as occurs in strokes and heart attacks is perhaps the most common cause of necrotic cell killing [8]. In ischemia, oxygen deprivation prevents ATP formation by mitochondrial oxidative phosphorylation, a process providing up to 95% of ATP utilized by highly aerobic tissues [23]. The role of mitochondrial dysfunction in necrotic killing can be assessed experimentally by the ability of glycolytic substrates to rescue cells from lethal cell injury (Figure 1.6) [24]. As an alternative source of ATP, glycolysis partially replaces ATP production lost after mitochondrial dysfunction. Maintenance of as little as 15% or 20% of normal ATP then rescues cells from necrotic death. Glucose and glycogen are prototypic glycolytic substrates that delay or prevent anoxic cell killing in most cell types. However, an important function of the liver is to maintain blood glucose levels constant, and


hepatocytes do not consume glucose even during anoxia. For hepatocytes, fructose is a much better glycolytic substrate, and fructose but not glucose prevents loss of viability of hepatocytes during anoxia, respiratory inhibition, and inhibition of the mitochondrial ATP synthase [25,26]. In aerobic cells, exogenous glucose and fructose at high concentrations cause intracellular ATP to decrease because of ATP consumption by hexokinase and fructokinase, the first enzymes in the glycolytic metabolism of the respective two hexoses. As glucose6-phosphate and other sugar phosphates accumulate, intracellular inorganic phosphate (Pi) also decreases [27]. In fructose-treated livers, decreased ATP has been interpreted as evidence of toxicity, but decreased Pi offsets the decline of ATP such that fructose-treated hepatocytes and livers maintain their ATP/ADPPi ratio (phosphorylation potential). Phosphorylation potental, rather than ATP concentration, ATP/ADP ratio or energy charge (defined as ([ATP]þ1=2 [ADP])/ ([ATP]þ[ADP]þ[AMP])), is the relevant thermodynamic variable reflecting cellular bioenergetic status [28]. Moreover, in anoxic livers and hepatocytes, glycolysis of fructose and endogenous glycogen increases ATP to protect against necrotic cell killing [25,26]. Fructose also protects against hepatocellular toxicity by oxidant chemicals, suggesting that mitochondria are also a primary target of cytotoxicity in oxidative stress [29].

Mitochondrial Uncoupling in Necrotic Cell Killing

Figure 1.6 Progression of mitochondrial injury. Respiratory inhibition inhibits oxidative phosphorylation and leads to ATP depletion and necrotic cell death. Glycine blocks plasma membrane permeabilization causing necrotic cell death downstream of ATP depletion. Glycolysis restores ATP and prevents cell killing. Mitochondrial uncoupling as occurs after reperfusion due to the mitochondrial permeability transition (MPT) activates the mitochondrial ATPase to futilely hydrolyze glycolytic ATP, and protection against necrotic cell death is lost. By inhibiting the mitochondrial ATPase, oligomycin prevents ATP depletion and rescues cells from necrotic cell death if glycolytic substrate is present. With permission from [209].

Mitochondrial injury and dysfunction are progressive (Figure 1.6). Anoxia and inhibition with a toxicant like cyanide inhibit respiration to cause ATP depletion and ultimately necrotic cell death. Glycolysis can replace this ATP supply, although only partially in highly aerobic cells, to rescue cells from necrotic killing. In the absence of respiration, mitochondrial membrane potential (DC) is sustained by reversal of the ATP synthase reaction (mitochondrial adenosine triphosphatase, or F1F0-ATPase). However, when mitochondria become permeable to protons (uncoupling), then maximal stimulation of F1F0-ATPase occurs. Since glycolytic ATP production cannot keep pace, ATP levels fall profoundly, mitochondria depolarize, and necrotic cell death ensues. In the presence of glycolytic substrate, oligomycin, an inhibitor of the F1F0-ATP synthase, prevents uncoupler-induced ATP depletion and subsequent cell death. Because oligomycin does not reverse uncoupling, mitochondrial △C is not restored [24,26]. Cytoprotection by oligomycin requires glycolytic ATP generation, since in the absence of glycolysis, oligomycin is itself toxic by inhibiting oxidative phosphorylation. Cytoprotection requiring the combination of glycolytic substrate and oligomycin indicates cytotoxicity mediated by mitochondrial uncoupling as shown, for example, for calcium ionophore toxicity and oxidative stress [29,30].

7

Part I


Mitochondrial Permeability Transition Inner membrane permeability

association with CypD and other molecular chaperones (Figure 1.7) [43].

In oxidative phosphorylation, respiration drives translocation of protons out of mitochondria to create an electrochemical proton gradient composed of a negative inside membrane potential (DC) and an alkaline inside pH gradient (DpH). ATP synthesis is then linked to protons returning down this electrochemical gradient through the mitochondrial ATP synthase. This chemiosmotic proton circuit requires the mitochondrial inner membrane to be impermeable to ions and charged metabolites. Thus, metabolite exchange for oxidative phosphorylation occurs via specific transporters and exchangers in the inner membrane, including the adenine nucleotide translocator (ANT), which exchanges ATP for adenosine diphosphate (ADP); the phosphate transporter; and one of several transporter systems for uptake of respiratory substrates like pyruvate and fatty acids. By contrast, the outer membrane is nonspecifically permeable to ions and hydrophilic metabolites, which move across the outer membrane through a channel called the voltage dependent anion channel (VDAC) [31,32]. Despite its name, VDAC has only weak anion selectivity and conducts freely most solutes up to a molecular mass of about 5 kDa.

pH-dependent ischemia/reperfusion injury

Mitochondrial permeability transition pore In the mitochondrial permeability transition (MPT), the mitochondrial inner membrane abruptly becomes nonselectively permeable to solutes of molecular weight up to about 1500 Da [33–35]. Ca2þ, oxidative stress, and numerous reactive chemicals induce the MPT, whereas cyclosporin A and pH less than 7 inhibit. Onset of the MPT causes mitochondrial depolarization, uncoupling, and large amplitude mitochondrial swelling driven by colloid osmotic forces. Opening of highly conductive permeability transition (PT) pores in the mitochondrial inner membrane underlies the MPT. Patch clamping shows that conductance through permeability transition pores (PT pores) is so great that opening of a single PT pore may be sufficient to cause mitochondrial depolarization and swelling [36]. The composition of PT pores is uncertain. In one model, PT pores are formed by ANT from the inner membrane, VDAC from the outer membrane, the cyclosporin A binding protein cyclophilin D (CypD) from the matrix, and possibly other proteins (Figure 1.7) (reviewed in [37,38]). Although once widely accepted, the validity of this model has been challenged by genetic knockout studies showing that the MPT still occurs in mitochondria that are deficient in ANT and VDAC [39–41]. Moreover, although CypD is responsible for pore inhibition by cyclosporin A, a cyclosporin A-insensitive MPT still occurs in CypD deficient mitochondria [34,42]. An alternative model for the PT pore is that oxidative and other stresses damage membrane proteins that then misfold and aggregate to form PT pores in 8

Ischemia is an interruption of blood flow and hence oxygen supply to a tissue or organ. In ischemic tissue, anaerobic glycolysis, hydrolysis of ATP, and release of protons from acidic organelles cause tissue pH to decrease by a unit or more. The naturally occurring acidosis of ischemia actually protects against onset of necrotic cell death. Acidosis also dramatically delays cell killing from oxidant chemicals, ionophores, and alkylating agents [44–48]. Although acidosis protects against cell killing during ischemia, reoxygenation and recovery of pH after reperfusion act to precipitate necrotic cell death. In cultured cells and perfused organs, ischemia/reperfusion injury can be reproduced using anoxia at acidotic pH to simulate ischemia followed by reoxygenation at normal pH to simulate reperfusion. Reperfusion in this model causes necrotic cell killing with release of intracellular enzymes like lactate dehydrogenase and nuclear labeling with vital dyes like trypan blue and propidium iodide [12,49–56]. Much of reperfusion injury leading to necrotic cell death is attributable to recovery of pH, since reoxygenation at low pH prevents cell killing entirely, whereas restoration of normal pH without reoxygenation produces similar cell killing as restoration of pH with reoxygenation, a socalled pH paradox (Figure 1.8). Cell death in the pH paradox is linked to intracellular pH. Ionophores like monensin that accelerate recovery of intracellular pH from the acidosis of ischemia after reperfusion also accelerate necrotic cell killing [51]. Conversely, inhibition of Naþ/Hþ exchange with dimethylamiloride or Naþ-free medium delays recovery of intracellular pH and prevents reperfusioninduced necrotic cell killing almost completely [51,52,54,55]. Cell killing in the pH paradox is linked specifically to intracellular pH and occurs independently of changes of cytosolic and extracellular free Naþ and Ca2þ [44,51,52,55].

Role of the mitochondrial permeability transition in pH-dependent reperfusion injury pH below 7 inhibits PT pores, and recovery of intracellular pH to 7 or greater after reperfusion induces the MPT, as shown directly by confocal/multiphoton microscopy [55]. During ischemia, mitochondria depolarize because of respiratory inhibition, but the mitochondrial inner membrane remains impermeant to fluorophores like calcein which can only pass through PT pores (Figure 1.8). After reperfusion at normal pH, mitochondria repolarize initially, as shown by uptake of membrane potential-indicating fluorophores (Figure 1.9). Subsequently and in parallel with recovery of intracellular pH to neutrality, the MPT occurs, leading to permeabilization of the inner membrane to calcein and mitochondrial depolarization (Figures 1.8 and 1.9). ATP depletion then follows, and necrotic cell death occurs.

Chapter 1


Reperfusion at acidotic pH to prevent recovery of pH and reperfusion in the presence of PT pore blockers (e.g., cyclosporin A and its derivatives) prevents mitochondrial inner membrane permeabilization, depolarization, and cell killing (Figures 1.8 and 1.9). Notably, cyclosporin A protects when added only during the reperfusion phase, as now confirmed by decreased infarct size in patients receiving percutaneous coronary intervention (PCI) for ischemic heart disease [55–59]. Thus, the MPT is the proximate cause of pH-dependent cell killing in ischemia/reperfusion injury. Minocycline, a semisynthetic tetracycline derivative that protects against neurodegenerative disease, trauma, and hypoxia–ischemia [60–68], also inhibits the MPT and protects against cell killing after reperfusion of livers stored by cold ischemia for transplantation [69]. However, the mechanism of MPT blockade differs from cyclosporin A. Rather than blocking through an interaction with CypD, minocycline blocks the MPT by inhibiting mitochondrial calcium uptake. This observation implies that calcium uptake into mitochondria is a prerequisite for MPT onset after reperfusion.

Oxidative stress

Figure 1.7 Models of mitochondrial permeability transition pores. In one model (A), PT pores are composed of the adenine nucleotide translocator (ANT) from the inner membrane (IM), cyclophilin D (CypD) from the matrix and the voltage-dependent anion channel (VDAC) from the outer membrane (OM). Other proteins, such as the peripheral benzodiazepine receptor (PBR), hexokinase (HK), creatine kinase (CK), and Bax may also contribute. PT pore openers include Ca2þ, inorganic phosphate (Pi), reactive oxygen and nitrogen species (ROS, RNS), and oxidized pyridine nucleotides (NAD(P)þ) and glutathione (GSSG). An alternative model (B) proposes that oxidative and other damage to integral inner membrane proteins leads to misfolding. These misfolded proteins aggregate at hydrophilic surfaces facing the hydrophobic bilayer to form aqueous channels. CypD and other chaperones block conductance of solutes through these nascent PT pores. High matrix Ca2þ acting through CypD leads to PT pore opening, an effect blocked by cyclosporin A (CsA). As misfolded protein clusters exceed the number of chaperones to regulate them, constitutively open channels form. Such unregulated PT pores are not dependent on Ca2þ for opening and are not inhibited by CsA. With permission from [210].

Reactive oxygen species (ROS) and reactive nitrogen species (RNS), including superoxide, hydrogen peroxide, hydroxyl radical, and peroxynitrite, have long been implicated in cell injury leading to necrosis (Figure 1.10). In hepatocytes, mitochondrial NAD(P)H oxidation after oxidative stress disrupts mitochondrial Ca2þ homeostasis to cause an increase of mitochondrial Ca2þ, which in turn stimulates intramitochondrial ROS formation and onset of the MPT [29,70– 73]. In cardiac myocytes after reperfusion, intramitochondrial ROS formation also occurs to initiate the MPT and subsequent necrotic cell death (Figure 1.9) [56]. Notably, inhibition of the MPT with cyclosporin A does not prevent mitochondrial ROS generation after reperfusion (Figure 1.9). Although intramitochondrial Ca2þ may be permissive for MPT onset after reperfusion, massive Ca2þ overloading and hypercontracture in myocytes does not occur until after the MPT, and MPT inhibitors prevent Ca2þ overloading and cell death [56]. In neurons, excitotoxic stress with glutamate and N-methyl-D-aspartate (NMDA) receptor agonists also stimulates mitochondrial ROS formation, leading to the MPT and excitotoxic injury [74–77]. Iron potentiates injury in a variety of diseases and is an important catalyst for hydroxyl radical formation from superoxide and hydrogen peroxide (Figure 1.10) [78–81]. Increased intracellular chelatable iron contributes to cell death after cold ischemia/reperfusion [82,83], and addition of a membrane permeable Fe3þ complex causes the MPT and consequent necrotic and apoptotic cell death [84]. During oxidative stress and hypoxia/ischemia, lysosomes rupture [14,85–87], and lysosomal rupture releases chelatable (loosely bound) iron with consequent pro-oxidant cell damage [88–91]. This 9

Part I


pH 7.4

−1 min

10 min

20 min

30 min

60 min

pH 6.2

pH 7.4+CsA

25 μm Figure 1.8 Mitochondrial inner membrane permeabilization in adult rat cardiac myocytes after ischemia and reperfusion. After loading mitochondria of cardiac myocytes with calcein, cells were subjected to 3 h of anoxia at pH 6.2 (ischemia) followed by reoxygenation at pH 7.4 (A), pH 6.2 (B), or pH 7.4 with 1 mM CsA (C). Red-fluorescing propidium iodide was present to detect loss of cell viability. Note that green calcein fluorescence was retained by mitochondria at the end of ischemia (1 min before reperfusion), indicating that PT pores had not opened. After reperfusion at pH 7.4, mitochondria progressively released calcein over 30 min. at which time calcein was nearly evenly distributed throughout cytosol. After 60 min, all cellular calcein was lost, and the nucleus stained with PI, indicating loss of viability. After reperfusion at pH 6.2 (B) or at pH 7.4 in the presence of CsA (C), calcein was retained and cell death did not occur. Thus, reperfusion at pH 7.4 induced onset of the MPT and necrotic cell death that were blocked with CsA and acidotic pH. Adapted with permission from [56].

iron is taken up into mitochondria by the mitochondrial calcium uniporter and helps catalyze mitochondrial ROS generation. Iron chelation with desferal prevents this ROS formation and decreases cell death in oxidative stress and hypoxia/ischemia [56,91,92].

Protein kinase signaling and the MPT Reperfusion with nitric oxide suppresses MPT onset and reperfusion-induced cell killing after ischemia [93]. A signaling cascade of guanylyl cyclase, cyclic guanosine monophosphate (cGMP), and cGMPdependent protein kinase (protein kinase G) mediates nitric oxide protection against MPT onset. In isolated mitochondria, a combination of cGMP, cytosolic extract as a source of protein kinase, and ATP blocks the Ca2þ-induced MPT. Thus, protein kinases act directly on mitochondria to negatively regulate MPT [93]. Protein kinase C epsilon (PKCe), together with 10

inhibition of glycogen synthase kinase-3 beta (GSK-3e), also lead to MPT inhibition, whereas c-Jun nuclear kinase-2 (JNK-2) promotes the MPT in reperfusion injury and acetaminophen hepatotoxicity [94–99].

Other Stress Mechanisms Inducing Necrotic Cell Death Poly (ADP-Ribose) Polymerase Single strand breaks induced by ultraviolet (UV) light, ionizing radiation, and ROS (particularly hydroxyl radical and peroxynitrite) activate PARP isoforms 1 and 2 (PARP-1/2). PARP assists in the repair of single-strand DNA breaks by recruiting scaffolding proteins, DNA ligases, and polymerases that mediate base excision repair [100]. With excess DNA damage, PARP attaches ADP-ribose to the strand breaks and elongates ADP-ribose polymers attached to the DNA.

Chapter 1


Figure 1.9 Mitochondrial ROS formation after reperfusion. Myocytes were co-loaded with red-fluorescing tetramethylrhodamine methyester (TMRM) and green-fluorescing chloromethyldichlorofluorescin (cmDCF) to monitor mitochondrial membrane potential and ROS formation, respectively. At the end of 3 h of ischemia, mitochondria were depolarized (lack of red TMRM fluorescence). After 20 min of reperfusion, mitochondria took up TMRM, indicating repolarization, and cmDCF fluorescence increased progressively inside mitochondria (A). Subsequently, hypercontraction and depolarization occurred after 40 min, and viability was lost within 120 min, as indicated by nuclear labeling with red-fluorescing propidium iodide. When cyclosporin A was added at reperfusion (B), mitochondria underwent sustained repolarization, and hypercontracture and cell death did not occur. Nonetheless, mitochondrial cmDCF fluorescence still increased. By contrast, reperfusion with antioxidants prevented ROS generation and MPT onset with subsequent cell death (data not shown). Thus, mitochondrial ROS generation induces the MPT and cell death after ischemia/reperfusion. Adapted with permission from [56].

Consumption of the oxidized form of nicotinamide adenine dinucleotide (NADþ) in this fashion leads to NADþ depletion, disruption of ATP-generation by glycolysis and oxidative phosphorylation, and ATP depletion-dependent cell death [100,101]. Mice deficient in PARP-1 or PARP-2 and mice treated with PARP inhibitors are protected against such DNA damageinduced necrosis [102,103]. Glycosidases cleave long ADP-ribose polymers attached to DNA into large oligomers. Such oligomers can translocate to mitochondria

to cause mitochondrial dysfunction and possibly the MPT [104]. PARP-dependent necrosis is an example of so-called programmed necrosis since PARP actively promotes a cell death-inducing pathway that otherwise would not occur. Necrotic cell death also frequently occurs when apoptosis is interrupted, as by caspase (cysteine-aspartate protease) inhibition. Such caspase independent cell death is the consequence of mitochondrial dysfunction (e.g., depolarization, loss of 11

Part I


Figure 1.10 Iron-catalyzed free radical generation. Oxidative stress causes oxidation of GSH and NAD(P)H, important reductants in antioxidant defenses, promoting increased net formation of superoxide (O2) and hydrogen peroxide (H2O2). Superoxide dismutase converts superoxide to hydrogen peroxide, which is further detoxified to water by catalase and peroxidases. In the iron-catalyzed Haber Weiss reaction (or Fenton reaction), superoxide reduces ferric iron (Fe3þ) to ferrous iron (Fe2þ), which reacts with hydrogen peroxide to form the highly reactive hydroxyl radical (OH). Hydroxyl radical reacts with lipids to form alkyl radicals (L) that initiate an oxygen-dependent chain reaction generating peroxyl radicals (LOO) and lipid peroxides (LOOH). Iron also catalyzes a chain reaction generating alkoxyl radicals (LO) and more peroxyl radicals. Nitric oxide synthase catalyzes formation of nitric oxide (NO) from arginine. Nitric oxide reacts rapidly with superoxide to form unstable peroxynitrite anion (ONOO-), which decomposes to nitrogen dioxide and hydroxyl radical. In addition to attacking lipids, these radicals also attack proteins and nucleic acids.

cytochrome c needed for respiration) or other metabolic disturbance.

PATHWAYS TO APOPTOSIS Roles of Apoptosis in Biology

Plasma membrane injury

Apoptosis is an essential event in both the normal life of organisms and in pathobiology. In development, apoptosis sculpts and remodels tissues and organs, for example, by creating clefts in limb buds to form fingers and toes [3]. Apoptosis is also responsible for reversion of hypertrophy to atrophy and immune surveillance-induced killing of preneoplastic cells and virally infected cells [108,109]. In the gastrointestinal tract especially, renewal of epithelial cells can occur every few days, and cell deletion by programmed cell death closely matches mitotic proliferation [110]. The literature on apoptosis is large and complex and continues to grow. One pattern that has emerged is that each of several organelles gives rise to signals initiating apoptotic cell killing [111–113]. Often these signals converge on mitochondria as a common pathway to apoptotic cell death. In most apoptotic signaling, activation of caspases 3 or 7 from a family of caspases (Table 1.2) begins execution of the final and committed phase of apoptotic cell death. Caspase 3/7 has many targets.

An intact plasma membrane is essential for cell viability. Detergents and pore-forming agents like mastoparan from wasp venom defeat the barrier function of the plasma membrane and cause immediate cell death [105]. Immune-mediated cell killing can act similarly. In particular, complement mediates formation of a membrane attack complex that in conjunction with antibody lyses cells [106]. Complement component 9, an amphipathic molecule, inserts through the cell membrane, polymerizes, and forms a pore visible as a tubular channel in electron micrographs [107]. Indeed, a single membrane attack complex may be sufficient to cause swelling and lysis of an individual erythrocyte. Pores also cause calcium entry, leading to mitochondrial dysfunction and most likely onset of the MPT. The resulting bioenergetic failure is further aggravated by pore-dependent ATP leakage across the plasma membrane. 12

Chapter 1

Table 1.2

Mammalian caspases. Caspases are evolutionarily conserved aspartate specific cysteinedependent proteases that function in apoptotic and inflammatory signaling [212]. Initiator caspases are involved in the initiation and propagation of apoptotic signaling, whereas effector caspases act on a wide variety of proteolytic substrates to induce the final and committed phase of apoptosis. Initiator and inflammatory caspases have large prodomains containing oligomerization motifs such as the caspase recruitment domain (CARD) and the death effector domain. Effector caspases have short prodomains and are proteolytically activated by large prodomain caspases and other proteases. Proteolytic cleavage of procaspase precursors forms separate large and small subunits that assemble into active enzymes consisting of two large and two small subunits. Caspase activation occurs in multimeric complexes that typically consist of a platform protein that recruits procaspases either directly or by means of adaptors. Such caspase complexes include the apoptosome and the death-inducing signaling complex (DISC). Caspase 14 plays a role in terminal keratinocyte differentiation in cornified epithelium [213].

Initiator Caspases Caspase Caspase Caspase Caspase Caspase


2 8 9 10 12

Prodomain

Amino Acid Target Sequence for Proteolysis

19/12 18/11 17/10 17/12 20/10

Long Long Long Long Long

VDVAD (L/V/D)E(T/V/I)D (L/V/I)EHD (I/V/L)EXD ATAD

32 34 35

17/12 18/11 20/12

Short Short Short

45 43 48 42

20/10 20/10 20/10 20/10

Long Long Long Long

42

20/10

Short

Molecular Weight of Proenzyme (kDa)

Active subunits (kDa)

51 55 45 55 50

with with with with with

CARD two DED CARD two DED CARD

Effector Caspases Caspase 3 Caspase 6 Caspase 7

DE(V/I)D (T/V/I)E(H/V/I)D DE(V/I)D

Inflammatory Caspases Caspase Caspase Caspase Caspase

1 4 5 11

with with with with

CARD CARD CARD CARD

(W/Y/F)EHD (W/L)EHD (W/L/F)EHD (V/I/P/L)EHD

Other Caspases Caspase 14

Degradation of the nuclear lamina and cytokeratins contributes to nuclear remodeling, chromatin condensation, and cell rounding [114,115]. Degradation of endonuclease inhibitors activates endonucleases to cause internucleosomal DNA cleavage. The resulting DNA fragments have lengths in multiples of 190 base pairs, the nucleosome to nucleosome repeat distance. In starch gel electrophoresis, these fragments produce a characteristic ladder pattern. DNA strand breaks can also be recognized in tissue sections by the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay [116]. Additionally, caspase activation leads to cell shrinkage, phosphatidyl serine externalization on the plasma membrane, and formation of numerous small surface blebs (zeiosis). Unlike necrotic blebs, these zeiotic blebs contain membranous

(W/I)E(T/H)D

organelles and are shed as apoptotic bodies. However, not all apoptotic changes depend on caspase 3/7 activation. For example, release of apoptosis-inducing factor (AIF) from mitochondria and its translocation to the nucleus promotes DNA degradation in a caspase 3-independent fashion [117]. Pathways leading to activation of caspase 3 and related effector caspases like caspase 7 are complex and quite variable between cells and specific apoptosis-instigating stimuli, and each major cellular structure can originate its own set of unique signals to induce apoptosis (Figure 1.11). Proapoptotic signals are often associated with specific damage or perturbation to the organelle involved. Consequently, cells choose death by apoptosis rather than life with organelle damage. 13

Part I


Figure 1.11 Scheme of apoptotic signaling from organelles. Adapted with permission from [113].

Plasma Membrane The plasma membrane is the target of many receptormediated signals. In particular, various ‘death ligands’ (e.g., tumor necrosis factor a, or TNFa; Fas ligand; tumor necrosis factor-related apoptosis-inducing ligand, or TRAIL) acting through their corresponding receptors (TNF receptor 1, or TNFR1; Fas; death receptor 4/5, or DR4/5) initiate activation of apoptotic pathways [112,118,119]. Binding of a ligand like TNFa leads to receptor trimerization and formation of so-called Complex I through association of adapter proteins (e.g., receptor interacting protein-1, or RIP1, and TNF receptor-associated death domain protein, or TRADD). After receptor dissociation, Complex II, 14

or death-inducing signaling complex (DISC), forms through association with Fas-associated protein with death domain (FADD) and pro-caspase 8, which are internalized. Pro-caspase 8 becomes activated and in turn proteolytically activates other downstream effectors (Figure 1.12). In Type I signaling, caspase 8 activates caspase 3 directly, whereas in Type II signaling, caspase 3 cleaves Bid (novel BH3 domain-only death agonist) to truncated Bid (tBid) to activate a mitochondrial pathway to apoptosis [120]. Similar signaling occurs after association of FasL with Fas (also called CD95) and TRAIL with DR4/5. Many events modulate death receptor signaling in the plasma membrane. For example, the extent of gene and surface expression of death receptors is an

Chapter 1


TNFα TNFR1

FADD DD DD DD DED DED DED DED DED

Receptor Dissociation DD

RIP

Complex I

DD

TRADD

DD DD DD DD DD

Complex II

Procaspase 8

TRAF2 Caspase 8

Bid

tBid JNK

NFκB

Survival Signals

Cell Death Survival Genes

Mitochondrial Permeabilization Apoptosis

Figure 1.12 TNFa apoptotic signaling. TNFa binds to its receptor, TNFR1, and Complex I forms composed of TRADD (TNFR-associated protein with death domain), RIP (receptor-interacting protein), TRAF-2 (TNF-associated factor-2]. Complex I activates NFkB (nuclear factor kappa B), and JNK (c-jun N-terminal kinase). NFkB activates transcription of survival genes, including antiapoptotic inhibitor of apoptosis proteins (IAPs), antiapoptotic Bcl-XL, and inducible nitric oxide synthase. Complex I then undergoes ligand-dissociated internalization to form DISC Complex II. Complex II recruits FADD (Fas-associated death domain) via interactions between conserved death domains (DD) and activates procaspase 8 through interaction with death effector domains (DED). Active caspase 8 cleaves Bid to t Bid, which translocates to mitochondria leading to mitochondrial permeabilization, cytochrome c release, and apoptosis. Adapted with permission from [111].

important determinant in cellular sensitivity to death ligands. Stimuli like hydrophobic bile acids can recruit death receptors to the cell surface and sensitize cells to death-inducing stimuli [121]. Surface recruitment of death receptors may also lead to self-activation even in the absence of ligand. Death receptors localize to lipid rafts containing relatively rigid cholesterol and sphingomyelin, the latter concentrated in the outer leaflet of the bilayer. After death receptor activation, sphingomyelin hydrolysis occurs in these rafts via acid sphingomyelinase, an enzyme that may also incorporate into the plasma membrane through fusion of endomembrane vesicles. Ceramide formed from sphingolipids self-associates through hydrogen bonding to promote raft coalescence and formation of molecular platforms that cluster signal transducer components of DISC [118]. Ceramide is apoptogenic in many cells, and rearrangement of lipid rafts into larger platforms appears to be co-stimulatory factor in death receptor-mediated apoptosis [122]. Glycosphingolipids, such as ganglioside GD3, also integrate into DISCs to promote apoptosis [123]. Consistent with the importance of surface expression and sphingolipids metabolism in apoptosis, toxic hydrophobic bile acids cause a sphingomyelinase and ceramide-dependent activation of the reduced form of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase generating an ROS signal activating Yes (a cellular viral sarcoma proto-oncogenic tyrosine kinase (Src) family member)-, JNK-, and epithelial growth factor receptor (EGFR)-dependent CD95 (Fas) tyrosine phosphorylation, recruitment of Fas to the cell surface, and formation of the DISC [124].

MITOCHONDRIA Cytochrome c release Mitochondria often play a central role in apoptotic signaling. In the so-called Type II pathway, DISC-activated caspase 8 proteolytically cleaves the protein Bid to a truncated fragment, tBid [119,125–128]. Bid is a BH3 only domain member of the B-cell lymphoma2 (Bcl2) family that includes both pro- and antiapoptotic proteins (Figure 1.13). tBid formed after caspase 8 activation translocates to mitochondria where it interacts with either Bak (Bcl2 homologous antagonist/killer) or Bax (a conserved homolog that heterodimerizes with Bcl2), two other proapoptotic Bcl2 family members, to induce cytochrome c release through the outer membrane into the cytosol [129]. Cytochrome c in the cytosol interacts with apoptotic protease activating factor-1 (Apaf-1) and procaspase 9 to assemble haptomeric apoptosomes and an ATP (or deoxyadenosine triphosphate, or dATP)-dependent cascade of caspase 9 and caspase 3 activation [130,131]. Caspase 3, an effector caspase, in turn acts on a variety of substrates to induce the final morphological and biochemical events of apoptosis. In many cell lines, cytochrome c release from the space between the mitochondrial inner and outer membranes appears to occur via formation of specific pores in the mitochondrial outer membrane. Except for the requirement for either Bak or Bax, the molecular composition and properties of cytochrome c release channels remain poorly understood [129,132]. In HeLa cells (a cell line derived from an atypical cervical adenocarcinoma), activated caspase 3 acts retrogradely 15

Part I


Figure 1.13 Bcl2 family proteins. BH1–4 are highly conserved domains among the Bcl2 family members. Also shown are a-helical regions. Except for A1 and BH3 only proteins, Bcl2 family members have carboxy-terminal hydrophobic domains to aid association with intracellular membranes. With permission from [211].

to proteolytically degrade a subunit of the reduced form of nicotinamide adenine dinucleotide (NADH)ubiquinone oxidoreductase (mitochondrial respiratory Complex I) to inhibit respiration and produce mitochondrial depolarization [133,134]. By contrast in hepatocytes exposed to death ligands like TNFa, TRAIL, Fas ligand, Type II signaling leads to PT pore opening [135–138]. Cytochrome c release then occurs due to large amplitude mitochondrial swelling and rupture of the outer membrane [130,131,133,135, 136,138]. Because the MPT represents such a severe perturbation to mitochondria, onset of the MPT virtually assures cell death, but ensuing apoptosis or necrosis depends on other factors. If the MPT occurs rapidly and affects most mitochondria of a cell, as happens after severe oxidative stress and ischemia/reperfusion, a precipitous fall of ATP (and dATP) will occur that actually blocks apoptotic signaling by inhibiting ATP-requiring caspase 9/3 activation. With ATP depletion, oncotic necrosis ensues. However, if the MPT occurs more slowly and asynchronously among the mitochondria of a cell, or when alternative sources for ATP generation are present (e.g., glycolysis), then necrosis is prevented and caspase 9/3 becomes activated and caspase-dependent apoptosis occurs instead (Figure 1.14) [5, 30,139–142]. Indeed, because cytochrome c is an essential component of the mitochondrial respiratory chain, cytochrome c release by any mechanism causes respiratory dysfunction. Crosstalk between apoptosis and necrosis also occurs in other ways. For example, after TNFa binding to its receptor, recruitment of RIP1 to TNFR1 can activate NADPH oxidase leading to superoxide generation and sustained activation of JNK, resulting in oncotic necrosis rather than apoptosis [143]. 16

Figure 1.14

Shared pathways to apoptosis and necrosis.

Controversy remains concerning the specific roles of the MPT versus specific outer membrane permeabilization in cytochrome c release in apoptotic signaling. An argument against the MPT in apoptotic cell killing is that apoptosis occurs without mitochondrial swelling, but careful electron microscopy shows that mitochondrial swelling with outer membrane rupture

Chapter 1

occurs in a broad range of apoptotic models [144]. Whatever the mechanisms are, virtually all soluble mitochondrial intermembrane proteins are released along with cytochrome c during apoptotic signaling, including proapoptotic AIF, Smac, and endonuclease A, among others. Indeed, the outer membrane becomes permeable to all solutes up to at least two million Da molecular mass [145]. One proposal is that the cytochrome c release channel is a lipid ceramide barrel structure that grows progressively in size after proapoptotic signaling [146,147]. Future investigations are needed to better define the mechanisms of cytochrome c release. Multiple mechanisms are likely, since redundancy of apoptotic signaling exists in virtually all other aspects of apoptosis. For example, although various individual cell types are described as having Type I or Type II apoptotic signaling, in reality both pathways can co-exist, one simply producing faster signaling that the other [136]. Redundancy of signaling and multiplicity of mechanisms implies that apoptotic pathways must be individually assessed for each cell type of interest.


flavoprotein oxidoreductase that promotes DNA degradation and chromatin condensation), endonuclease G (a DNA degrading enzyme), and HtrA2/Omi (high temperature requirement A2, a serine protease that degrades IAPs) [154,158–162]. Disruption of mitochondrial function induces fragmentation of larger filamentous mitochondria into smaller more spherical structures. Such changes are also often prominent in apoptosis. Mitochondrial fission is mediated by dynamin-like protein type 1 (Drp1], a large cytosolic GTPase mechanoenzyme, and fission-1 (Fis1) in the outer membrane. Drp1 forms complexes with proapoptotic Bcl2 family members like Bax to promote cytochrome c release during apoptosis [163]. Mitochondrial fusion depends on optic atrophy-1 (Opa1) in the inner membrane, which is mutated in dominant optic atrophy, and mitofusin 1 and 2 (Mfn1/2), two proteins in the outer membrane [164]. Fission events in mitochondria seem to promote apoptotic signaling, since dynamin-like protein type 1 (Drp-1) overexpression promotes apoptosis, whereas Mfn1/2 overexpression retards apoptosis [164].

Regulation of the Mitochondrial Pathway to Apoptosis

Antiapoptotic Survival Pathways

Mitochondrial pathways to apoptosis vary depending on expression of procaspases, Apaf-1, and other proteins. Some terminally differentiated cells, particularly neurons, do not respond to cytochrome c with caspase activation and apoptosis, which may be linked to lack of Apaf-1 expression [148,149]. Antiapoptotic Bcl2 proteins, like Bcl2, Bcl extra long (Bcl-xL), and myeloid cell leukemia sequence 1 (Mcl-1), block apoptosis and are frequently overexpressed in cancer cells (Figure 1.13) [150,151]. Antiapoptotic Bcl2 family members form heterodimers with proapoptotic family members like Bax and Bak, to prevent the latter from oligomerizing into cytochrome c release channels. VDAC in the outer membrane is an anchoring point for Bax and other proteins regulating cytochrome c release [152,153]. Inhibitor of apoptosis proteins (IAPs), including Xlinked inhibitor of apoptosis protein (XIAP), cellular IAP1 (c-IAP1), cellular IAP2 (c-IAP2), and survivin, oppose apoptotic signaling by inhibiting caspase activation [154,155]. Many IAPs can recruit E2 ubiquitinconjugating enzymes and catalyse the transfer of ubiquitin onto target proteins, leading to proteosomal degradation. Some IAPs inhibit apoptotic pathways upstream of mitochondria at caspase 8, whereas others like XIAP inhibit caspase 9/3 activation downstream of mitochondrial cytochrome c release. Additional proteins like Smac suppress the action of IAPs, providing an “inhibitor of the inhibitor” effect promoting apoptosis. Smac is a mitochondrial intermembrane protein that is released with cytochrome c [154,156,157]. Smac inhibits XIAP and promotes apoptotic signaling after mitochondrial signaling. Thus, high Smac to XIAP ratios favor caspase 3 activation after cytochrome c release. Other proapoptotic proteins released from the mitochondrial intermembrane space during apoptotic signaling include AIF (a

Ligand binding to death receptors can also activate antiapoptotic signaling to prevent activation of apoptotic death programs. Binding of the adapter protein, TNFRassociated factor 2 (TRAF2), to death receptors activates IkB kinase (IKK), which in turn phosphorylates IkB, an endogenous inhibitor of nuclear factor kB (NFkB), leading to proteosomal IkB degradation [119,165]. IkB degradation relieves inhibition of NFkB and allows NFkB to activate expression anti-apoptotic genes, including IAPs, Bcl-xL, inducible nitric oxide synthase (iNOS), and other survival factors [166,167]. Nitric oxide from iNOS produces cGMP-dependent suppression of the MPT, as well as S-nitrosation and inhibition of caspases [168,169]. As a consequence in many models, apoptosis after death receptor ligation occurs only when NFkB ignaling is blocked, as after inhibition of proteosomes or protein synthesis [119,135,166]. In liver, for example, induction of hepatocellular apoptosis with TNFa requires co-treatment with galactosamine, which depletes uridine triphosphate (UTP) and thus blocks messenger ribonucleic acid (mRNA) synthesis and gene expression [170,171]. The phosphoinositide 3-kinase (PI3) kinase/protooncogene product of the viral oncogene v-akt (Akt) pathway is another source of antiapoptotic signaling [172,173]. When phosphoinositide 3-kinase (PI3 kinase) is activated by binding of insulin, insulin-like growth factor (IGF) and various other growth factors to their receptors, phosphatidylinositol trisphosphate (PIP3) is formed that activates Akt/protein kinase B, a serine/threonine protein kinase. One consequence is the phosphorylation and inactivation of Bad (heterodimeric partner for Bcl-xL), a proapoptotic Bcl2 family member, but other antiapoptotic targets of PI3 kinase/Akt signaling also exist. In cell lines, withdrawal of serum or specific growth factors typically induces 17

Part I


apoptosis due to suppression of the PI3 kinase/Akt survival pathway.

NUCLEUS In the so-called extrinsic pathway, death receptors initiate apoptosis by either a Type I (nonmitochondrial) or Type II (mitochondrial) caspase activation sequence. In the intrinsic pathway, by contrast, events in the nucleus activate apoptotic signaling, such as DNA damage caused by ultraviolet or ionizing (gamma) irradiation. DNA damage leads to activation of the p53 nuclear transcription factor, and expression of genes for apoptosis and/or cell-cycle arrest, especially the proapoptotic Bcl2 family members PUMA, NOXA, and Bax for apoptosis, and p21 for cell cycle arrest, especially the proapoptotic Bcl2 family members p53 upregulated modulator of apoptosis (PUMA), NOXA and Bax for apoptosis, and 21 kDa promoter (p21) for cell cycle arrest (Figure 1.11) [174,175]. PUMA, NOXA, and Bax translocate to mitochondria to induce cytochrome c release by similar mechanisms as discussed previously for the extrinsic pathway [176–178]. To escape p53-dependent induction of apoptosis, many tumors, especially those from the gastrointestinal tract, have loss of function mutations for p53. DNA damage also activates PARP. With moderate activation, PARP helps mend DNA strand breaks, but with strong activation PARP exhausts cellular ATP and causes necrotic cell death. However, caspase 3 proteolytically degrades and inactivates PARP to prevent both DNA repair and this pathway to necrosis. Thus, DNA damage can lead to either necrosis or apoptosis depending on which occurs more quickly—PARP activation and ATP depletion, or caspase 3 activation and PARP degradation [179,180].

ENDOPLASMIC RETICULUM The ER also gives rise to proapoptotic signals. Oxidative stress and other perturbations can inhibit ER calcium pumps to induce calcium release into the cytosol. Uptake of this calcium into mitochondria from the cytosol may then induce a Ca2þ-dependent MPT and subsequent apoptotic or necrotic cell killing (Figure 1.11) [181,182]. ER calcium release into the cytosol can also activate phospholipase A2 and the formation of arachidonic acid, another promoter of the MPT [183]. ER calcium depletion also disturbs the proper folding of newly synthesized proteins inside ER cisternae to cause ER stress and the unfolded protein response (UPR) [184–186]. Blockers of glycosylation, inhibitors of ER protein processing and secretion, various toxicants, and synthesis of mutant proteins can also cause ER stress. Calcium-binding chaperones, including glucose-regulated protein-78 (GRP78) and glucoseregulated protein-94 (GRP94), mediate detection of unfolded and misfolded proteins and promote folding of nascent unfolded proteins into a proper mature 18

protein conformation. In the absence of unfolded/ misfolded proteins, GRP78 inhibits specific sensors of ER stress, but in the presence of unfolded proteins GRP78 translocates from the sensors to the unfolded proteins to cause sensor activation by disinhibition. The main sensors of ER stress are RNA-activated protein kinase (PKR), PKR like ER kinase (PERK), type 1 ER transmembrane protein kinase (IRE1), and activating transcription factor 6 (ATF6). PKR and PERK are protein kinases whose activation leads to phosphorylation of eukaryotic initiation factor-2a (eIF-2a). Phosphorylation of eIF-2a suppresses ER protein synthesis, which decreases the rate of delivery of newly synthesized unfolded protein to the ER lumen and relieves the unfolding stress [187]. Ire1 is both a protein kinase and a riboendonuclease that initiates splicing of a preformed mRNA encoding X-box-binding protein 1 (XBP) into an active form [188]. ATF6 is another transcription factor that translocates to the Golgi after ER stress where proteases process ATF6 to an aminoterminal fragment that is taken up into the nucleus [189]. Together Ire1 and ATF6 increase gene expression of chaperones and other proteins to alleviate the unfolding stress. A strong and persistent UPR induces Ire1- and ATF6-dependent expression of C/EBP homologous protein (CHOP) and continued activation of Ire1 to initiate apoptotic signaling (Figure 1.11). Association of TRAF2 with activated IRE1 leads to activation of caspase 12 and JNK [190,191]. Caspase 12 activates caspase 3 directly, whereas JNK and CHOP promote mitochondrial cytochrome c release as a pathway to caspase 3 activation. ER stress also induces Ca2þ release, which is taken up by mitochondria to promote mitochondrial signaling. In addition to mitochondria, Bcl-2 family members associate with ER membranes, and proapoptotic Bcl2 family members like Bax and Bak act to increase the size of the ER calcium store, thus increasing the proapoptotic potential of ER calcium release [192]. Chaperones require ATP to induce proper protein folding [193]. ATP depletion and ER stress may act synergistically, since perturbations that decrease ATP will augment ER stress.

LYSOSOMES Lysosomes and the associated process of autophagy (self-digestion) are another source of proapoptotic signals. So-called autophagic cell death is characterized by an abundance of autophagic vacuoles in dying cells and is especially prominent in involuting tissues, such as post-lactation mammary gland [194]. In autophagy, isolation membranes (also called phagophores) envelop and then sequester portions of cytoplasm to form double membrane autophagosomes. Autophagosomes fuse with lysosomes and late endosomes to form autolysosomes [195,196]. The process of autophagy acts to remove and degrade cellular constituents, an appropriate action for a tissue undergoing involution. Originally considered to be random, much evidence

Chapter 1


Figure 1.15 Progression of mitophagy, apoptosis, and necrosis. Stimuli that induce the MPT produce a graded cellular response. Low levels of stimulation induce autophagy as a repair mechanism. With more stimulation, apoptosis begins to occur in addition due to cytochrome c release after mitochondrial swelling. Necrosis becomes evident after even stronger stimulation as ATP becomes depleted. With highest stimulation, autophagy and apoptosis as ATP-requiring processes become inhibited, and only oncotic necrosis occurs. MPT inducers include death ligands, oxidation of NAD(P)H and GSH, formation of reactive oxygen species (ROS) and reactive nitrogen species (RNS), and mutation of mitochondrial DNA (mtDNAX) which causes synthesis of abnormal mitochondrial membrane proteins.

suggests that autophagy can be selective for specific organelles, especially if they are damaged [197,198]. For example, stresses inducing the MPT seem to signal autophagy of mitochondria [199]. Whether or not autophagy promotes or prevents cell death is controversial [200–203]. In some circumstances, autophagy promotes cell death because suppression of expression of certain autophagy genes decreases apoptosis, and some have suggested that autophagic cell death as its own category of programmed cell killing. Under other conditions, autophagy protects against cell death, since disruption of autophagic processing and/or lysosomal function promotes caspase-dependent cell death [201,202,204]. When autophagic processing and lysosomal degradation are disrupted, cathepsins and other hydrolases can be released from lysosomes and autophagosomes to initiate mitochondrial permeabilization and caspase activation. Cathepsin B is released from lysosomes (or related structures such as late endosomes) during TNFa signaling to augment death receptor-mediated apoptosis and contribute to mitochondrial release of cytochrome c [205,206]. In addition, lysosomal extracts cleave Bid to tBid, and cathepsin D, another lysosomal protease, activates Bax [207,208].

general, apoptosis is a better outcome for the organism since apoptosis promotes orderly resorption of dying cells, whereas necrotic cell death releases cellular constituents into the extracellular space to induce an inflammatory release that can extend tissue injury. Because of shared pathways, an admixture of necrosis and apoptosis occurs in many pathophysiological settings. For stimuli inducing the MPT, a graded response seems to occur (Figure 1.15) [6]. When limited to a few mitochondria, the MPT stimulates mitochondrial autophagy (mitophagy) and elimination of the damaged organelles—a repair mechanism. With greater stimulation, more mitochondria undergo the MPT, and apoptosis begins to occur due to cytochrome c release from swollen mitochondria leading to caspase activation. Cathepsin leakage from an overstimulated autophagic apparatus likely also promotes apoptotic signaling. Indeed, autophagy is often a prominent feature in cells undergoing programmed cell death. As the majority of mitochondria undergo the MPT, oxidative phosphorylation fails and ATP plummets, which precipitates necrotic cell death while simultaneously suppressing ATP-requiring apoptotic signaling.

Necrapoptosis/Aponecrosis

Apoptosis and necrosis are prominent events in pathogenesis. An understanding of cell death mechanisms forms the basis for effective interventions to either prevent cell death as a cause of disease or promote cell death in cancer chemotherapy.

In many and possibly most instances of apoptosis, mitochondrial permeabilization with release of cytochrome c and other proapoptotic factors is a final common pathway leading to a final and committed phase. At higher levels of stimulation, the same factors that induce apoptosis frequently also cause ATP depletion and a necrotic mode of cell death. Such necrotic cell killing is a consequence of mitochondrial dysfunction. Such shared pathways leading to different modes of cell death constitute necrapoptosis (or aponecrosis) [5–7]. In

CONCLUDING REMARK

ACKNOWLEDGMENTS This work was supported, in part, by Grants DK37034, DK73336, DK70844, DK070195, and AA016011 from the National Institutes of Health. 19

Part I


REFERENCES 1. Majno G, Joris I. Apoptosis, oncosis, and necrosis. An overview of cell death. Am J Pathol. 1995;146(1):3–15. 2. Van CS, Van Den BW. Morphological and biochemical aspects of apoptosis, oncosis and necrosis. Anat Histol Embryol. 2002;31(4): 214–223. 3. Kerr JF, Wyllie AH, Currie AR. Apoptosis: A basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer. 1972;26(4):239–257. 4. Searle J, Harmon BV, Bishop CJ, et al. The significance of cell death by apoptosis in hepatobiliary disease. J Gastroenterol Hepatol. 1987;2:77–96. 5. Lemasters JJ. V. Necrapoptosis and the mitochondrial permeability transition: Shared pathways to necrosis and apoptosis. Am J Physiol. 1999;276(1 Pt 1):G1–G6. 6. Lemasters JJ. Modulation of mitochondrial membrane permeability in pathogenesis, autophagy and control of metabolism. J Gastroenterol Hepatol. 2007;22(Suppl 1):S31–37. 7. Formigli L, Papucci L, Tani A, et al. Aponecrosis: Morphological and biochemical exploration of a syncretic process of cell death sharing apoptosis and necrosis. J Cell Physiol. 2000; 182(1):41–49. 8. Trump BF, Goldblatt PJ, Stowell RE. Studies of necrosis in vitro of mouse hepatic parenchymal cells. Ultrastructural alterations in endoplasmic reticulum, Golgi apparatus, plasma membrane, and lipid droplets. Lab Invest. 1965;14:2000–2028. 9. Lemasters JJ, Ji S, Thurman RG. Centrilobular injury following hypoxia in isolated, perfused rat liver. Science. 1981;213(4508): 661–663. 10. Lemasters JJ, Stemkowski CJ, Ji S, et al. Cell surface changes and enzyme release during hypoxia and reoxygenation in the isolated, perfused rat liver. J Cell Biol. 1983;97(3):778–786. 11. Gores GJ, Herman B, Lemasters JJ. Plasma membrane bleb formation and rupture: A common feature of hepatocellular injury. Hepatology. 1990;11(4):690–698. 12. Nishimura Y, Romer LH, Lemasters JJ. Mitochondrial dysfunction and cytoskeletal disruption during chemical hypoxia to cultured rat hepatic sinusoidal endothelial cells: The pH paradox and cytoprotection by glucose, acidotic pH, and glycine. Hepatology. 1998;27(4):1039–1049. 13. Gores GJ, Nieminen A-L, Wray BE, et al. Intracellular pH during ‘chemical hypoxia’ in cultured hepatocytes. J Clin Invest. 1989; 83:386–396. 14. Zahrebelski G, Nieminen AL, al Ghoul K, et al. Progression of subcellular changes during chemical hypoxia to cultured rat hepatocytes: A laser scanning confocal microscopic study. Hepatology. 1995;21(5):1361–1372. 15. Herman B, Nieminen AL, Gores GJ, et al. Irreversible injury in anoxic hepatocytes precipitated by an abrupt increase in plasma membrane permeability. FASEB J. 1988;2(2):146–151. 16. Nieminen AL, Gores GJ, Wray BE, et al. Calcium dependence of bleb formation and cell death in hepatocytes. Cell Calcium. 1988; 9(5–6):237–246. 17. Dong Z, Patel Y, Saikumar P, et al. Development of porous defects in plasma membranes of adenosine triphosphatedepleted Madin-Darby canine kidney cells and its inhibition by glycine. Lab Invest. 1998;78(6):657–668. 18. Nishimura Y, Lemasters JJ. Glycine blocks opening of a death channel in cultured hepatic sinusoidal endothelial cells during chemical hypoxia. Cell Death Differ. 2001;8(8):850–858. 19. Weinberg JM, Davis JA, Abarzua M, et al. Cytoprotective effects of glycine and glutathione against hypoxic injury to renal tubules. J Clin Invest. 1987;80:1446–1454. 20. Miller GW, Schnellmann RG. Cytoprotection by inhibition of chloride channels: The mechanism of action of glycine and strychnine. Life Sci. 1993;53(15):1211–1215. 21. Dong Z, Venkatachalam MA, Weinberg JM, et al. Protection of ATP-depleted cells by impermeant strychnine derivatives: Implications for glycine cytoprotection. Am J Pathol. 2001;158(3): 1021–1028. 22. Pan C, Bai X, Fan L, et al. Cytoprotection by glycine against ATPdepletion-induced injury is mediated by glycine receptor in renal cells. Biochem J. 2005;390(Pt 2):447–453.

20

23. Saraste M. Oxidative phosphorylation at the fin de siecle. Science. 1999;283(5407):1488–1493. 24. Nieminen AL, Dawson TL, Gores GJ, et al. Protection by acidotic pH and fructose against lethal injury to rat hepatocytes from mitochondrial inhibitors, ionophores and oxidant chemicals. Biochem Biophys Res Commun. 1990;167(2):600–606. 25. Anundi I, King J, Owen DA, et al. Fructose prevents hypoxic cell death in liver. Am J Physiol. 1987;253(3 Pt 1):G390–G396. 26. Nieminen AL, Saylor AK, Herman B, et al. ATP depletion rather than mitochondrial depolarization mediates hepatocyte killing after metabolic inhibition. Am J Physiol. 1994;267(1 Pt 1):C67–C74. 27. Mayes PA. Intermediatry metabolism of fructose. Am J Clin Nutr. 1993;58(Suppl):754S–765S. 28. Nicholls DG, Ferguson SJ. Bioenergetics 3. London: Academic Press; 2002. 29. Imberti R, Nieminen AL, Herman B, et al. Mitochondrial and glycolytic dysfunction in lethal injury to hepatocytes by t-butylhydroperoxide: Protection by fructose, cyclosporin A and trifluoperazine. J Pharmacol Exp Ther. 1993;265(1): 392–400. 30. Qian T, Herman B, Lemasters JJ. The mitochondrial permeability transition mediates both necrotic and apoptotic death of hepatocytes exposed to Br-A23187. Toxicol Appl Pharmacol. 1999; 154(2):117–125. 31. Colombini M. VDAC: The channel at the interface between mitochondria and the cytosol. Mol Cell Biochem. 2004;256–257 (1–2):107–115. 32. Rostovtseva TK, Komarov A, Bezrukov SM, Colombini M. VDAC channels differentiate between natural metabolites and synthetic molecules. J Membr Biol. 2002;187(2):147–156. 33. Hunter DR, Haworth RA, Southard JH. Relationship between configuration, function, and permeability in calcium-treated mitochondria. J Biol Chem. 1976;251:5069–5077. 34. Bernardi P, Forte M. The mitochondrial permeability transition pore. Novartis Found Symp. 2007;287:157–164; discussion 164–169. 35. Kim JS, He L, Lemasters JJ. Mitochondrial permeability transition: A common pathway to necrosis and apoptosis. Biochem Biophys Res Commun. 2003;304(3):463–470. 36. Zoratti M, Szabo I. The mitochondrial permeability transition. Biochim Biophys Acta. 1995;1241(2):139–176. 37. Halestrap AP, Brennerb C. The adenine nucleotide translocase: A central component of the mitochondrial permeability transition pore and key player in cell death. Curr Med Chem. 2003;10 (16):1507–1525. 38. Crompton M, Virji S, Doyle V, et al. The mitochondrial permeability transition pore. Biochem Soc Symp. 1999; 66:167–179. 39. Kokoszka JE, Waymire KG, Levy SE, et al. The ADP/ATP translocator is not essential for the mitochondrial permeability transition pore. Nature. 2004;427(6973): 461–465. 40. Krauskopf A, Eriksson O, Craigen WJ, et al. Properties of the permeability transition in VDAC1(-/-) mitochondria. Biochim Biophys Acta. 2006;1757(5–6):590–595. 41. Juhaszova M, Wang S, Zorov DB, et al. The identity and regulation of the mitochondrial permeability transition pore: Where the known meets the unknown. Ann NY Acad Sci. 2008;1123: 197–212. 42. Forte M, Bernardi P. Genetic dissection of the permeability transition pore. J Bioenerg Biomembr. 2005;37(3):121–128. 43. He L, Lemasters JJ. Regulated and unregulated mitochondrial permeability transition pores: A new paradigm of pore structure and function? FEBS Lett. 2002;512(1–3):1–7. 44. Gores GJ, Nieminen AL, Wray BE, et al. Intracellular pH during "chemical hypoxia" in cultured rat hepatocytes. Protection by intracellular acidosis against the onset of cell death. J Clin Invest. 1989;83(2):386–396. 45. Bronk SF, Gores GJ. Efflux of protons from acidic vesicles contributes to cytosolic acidification of hepatocytes during ATP depletion. Hepatology. 1991;14(4 Pt 1):626–633. 46. Penttila A, Trump BF. Extracellular acidosis protects Ehrlich tumor cells and rat renal cortex against anoxic injury. Science. 1974;185:277–278. 47. Bonventre JV, Cheung JY. Effects of metabolic acidosis on viability of cells exposed to anoxia. Am J Physiol. 1985;249:C149–C159. 48. Gores GJ, Nieminen AL, Fleishman KE, et al. Extracellular acidosis delays onset of cell death in ATP-depleted hepatocytes. Am J Physiol. 1988;255(3 Pt 1):C315–C322.

Chapter 1 49. Currin RT, Gores GJ, Thurman RG, et al. Protection by acidotic pH against anoxic cell killing in perfused rat liver: Evidence for a pH paradox. FASEB J. 1991;5(2):207–210. 50. Bond JM, Herman B, Lemasters JJ. Protection by acidotic pH against anoxia/reoxygenation injury to rat neonatal cardiac myocytes. Biochem Biophys Res Commun. 1991;179(2):798–803. 51. Bond JM, Chacon E, Herman B, et al. Intracellular pH and Ca2þ homeostasis in the pH paradox of reperfusion injury to neonatal rat cardiac myocytes. Am J Physiol. 1993;265(1 Pt 1):C129–C137. 52. Harper IS, Bond JM, Chacon E, et al. Inhibition of Naþ/Hþ exchange preserves viability, restores mechanical function, and prevents the pH paradox in reperfusion injury to rat neonatal myocytes. Basic Res Cardiol. 1993; 88(5):430–442. 53. Zager RA, Schimpf BA, Gmur DJ. Physiological pH. Effects on posthypoxic proximal tubular injury. Circ Res. 1993;72:837–846. 54. Kaplan SH, Yang H, Gilliam DE, et al. Hypercapnic acidosis and dimethyl amiloride reduce reperfusion induced cell death in ischaemic ventricular myocardium. Cardiovasc Res. 1995;29(2): 231–238. 55. Qian T, Nieminen AL, Herman B, et al. Mitochondrial permeability transition in pH-dependent reperfusion injury to rat hepatocytes. Am J Physiol. 1997;273(6 Pt 1):C1783–C1792. 56. Kim JS, Jin Y, Lemasters JJ. Reactive oxygen species, but not Ca2þ overloading, trigger pH- and mitochondrial permeability transition-dependent death of adult rat myocytes after ischemia-reperfusion. Am J Physiol Heart Circ Physiol. 2006;290(5):H2024–H2034. 57. Griffiths EJ, Halestrap AP. Protection by cyclosporin A of ischemia/reperfusion-induced damage in isolated rat hearts. J Mol Cell Cardiol. 1993;25(12):1461–1469. 58. Griffiths EJ, Halestrap AP. Mitochondrial non-specific pores remain closed during cardiac ischaemia, but open upon reperfusion. Biochem J. 1995;307(Pt 1):93–98. 59. Piot C, Croisille P, Staat P, et al. Effect of cyclosporine on reperfusion injury in acute myocardial infarction. N Engl J Med. 2008; 359(5):473–481. 60. Chu HC, Lin YL, Sytwu HK, et al. Effects of minocycline on Fasmediated fulminant hepatitis in mice. Br J Pharmacol. 2005;144 (2):275–282. 61. Friedlander RM. Mechanisms of disease: Apoptosis and caspases in neurodegenerative diseases. N Engl J Med. 2003;348(14): 1365–1375. 62. Gao W, Washington MK, Bentley RC, et al. Antiangiogenic agents protect liver sinusoidal lining cells from cold preservation injury in rat liver transplantation. Gastroenterology. 1997;113(5): 1692–1700. 63. Kelly KJ, Sutton TA, Weathered N, et al. Minocycline inhibits apoptosis and inflammation in a rat model of ischemic renal injury. Am J Physiol Renal Physiol. 2004;287(4):F760–F766. 64. Wang J, Wei Q, Wang CY, et al. Minocycline up-regulates Bcl2 and protects against cell death in mitochondria. J Biol Chem. 2004;279(19):19948–19954. 65. Wang X, Zhu S, Drozda M, et al. Minocycline inhibits caspase-independent and -dependent mitochondrial cell death pathways in models of Huntington’s disease. Proc Natl Acad Sci USA. 2003; 100(18):10483–10487. 66. Wells JEA, Hurlbert RJ, Fehlings MG, et al. Neuroprotection by minocycline facilitates significant recovery from spinal cord injury in mice. Brain. 2003;126:1628–1637. 67. Yong VW, Wells J, Giuliani F, et al. The promise of minocycline in neurology. Lancet Neurology. 2004;3(12):744–751. 68. Zhu S, Stavrovskaya IG, Drozda M, et al. Minocycline inhibits cytochrome c release and delays progression of amyotrophic lateral sclerosis in mice. Nature. 2002;417(6884):74–78. 69. Theruvath TP, Zhong Z, Pediaditakis P, et al. Minocycline and N-methyl-4-isoleucine cyclosporin (NIM811) mitigate storage/ reperfusion injury after rat liver transplantation through suppression of the mitochondrial permeability transition. Hepatology. 2008;47(1): 236–246. 70. Imberti R, Nieminen AL, Herman B, et al. Synergism of cyclosporin A and phospholipase inhibitors in protection against lethal injury to rat hepatocytes from oxidant chemicals. Res Commun Chem Pathol Pharmacol. 1992;78(1):27–38. 71. Nieminen AL, Saylor AK, Tesfai SA, et al. Contribution of the mitochondrial permeability transition to lethal injury after

72.

73.

74. 75. 76. 77.

78. 79. 80. 81. 82. 83.

84. 85. 86. 87. 88. 89. 90. 91. 92. 93.

94. 95.


exposure of hepatocytes to t-butylhydroperoxide. Biochem J. 1995;307(Pt 1):99–106. Nieminen AL, Byrne AM, Herman B, et al. Mitochondrial permeability transition in hepatocytes induced by t-BuOOH: NAD(P)H and reactive oxygen species. Am J Physiol. 1997;272 (4 Pt 1):C1286–C1294. Byrne AM, Lemasters JJ, Nieminen AL. Contribution of increased mitochondrial free Ca2þ to the mitochondrial permeability transition induced by tert-butylhydroperoxide in rat hepatocytes. Hepatology. 1999;29(5):1523–1531. Greenwood SM, Connolly CN. Dendritic and mitochondrial changes during glutamate excitotoxicity. Neuropharmacology. 2007;53(8):891–898. Stefanis L. Caspase-dependent and -independent neuronal death: Two distinct pathways to neuronal injury. Neuroscientist. 2005;11(1):50–62. Dubinsky JM, Brustovetsky N, Pinelis V, et al. The mitochondrial permeability transition: The brain’s point of view. Biochem Soc Symp. 1999;66:75–84. Nieminen AL, Petrie TG, Lemasters JJ, et al. Cyclosporin A delays mitochondrial depolarization induced by N-methyl-Daspartate in cortical neurons: Evidence of the mitochondrial permeability transition. Neuroscience. 1996;75(4):993–997. Kehrer JP. The Haber-Weiss reaction and mechanisms of toxicity. Toxicology. 2000;149(1):43–50. Swanson CA. Iron intake and regulation: Implications for iron deficiency and iron overload. Alcohol. 2003;30(2):99–102. Petersen DR. Alcohol, iron-associated oxidative stress, and cancer. Alcohol. 2005;35(3):243–249. Brewer GJ. Iron and copper toxicity in diseases of aging, particularly atherosclerosis and Alzheimer’s disease. Exp Biol Med (Maywood). 2007;232(2):323–335. Kerkweg U, Li T, de Groot H, et al. Cold-induced apoptosis of rat liver cells in University of Wisconsin solution: The central role of chelatable iron. Hepatology. 2002;35(3):560–567. Rauen U, Kerkweg U, de GH. Iron-dependent vs. iron-independent cold-induced injury to cultured rat hepatocytes: A comparative study in physiological media and organ preservation solutions. Cryobiology. 2007;54(1):77–86. Rauen U, Petrat F, Sustmann R, et al. Iron-induced mitochondrial permeability transition in cultured hepatocytes. J. Hepatology. 2004;40:607–615. Wildenthal K, Decker RS. The role of lysosomes in the heart. Adv Myocardiol. 1980;2:349–358. Ollinger K, Brunk UT. Cellular injury induced by oxidative stress is mediated through lysosomal damage. Free Radic Biol Med. 1995;19(5):565–574. Kurz T, Terman A, Brunk UT. Autophagy, ageing and apoptosis: The role of oxidative stress and lysosomal iron. Arch Biochem Biophys. 2007;462(2):220–230. Persson HL, Yu Z, Tirosh O, et al. Prevention of oxidant-induced cell death by lysosomotropic iron chelators. Free Radic Biol Med. 2003;34(10):1295–1305. Yu Z, Persson HL, Eaton JW, et al. Intralysosomal iron: A major determinant of oxidant-induced cell death. Free Radic Biol Med. 2003;34(10):1243–1252. Kurz T, Gustafsson B, Brunk UT. Intralysosomal iron chelation protects against oxidative stress-induced cellular damage. FEBS J. 2006;273:3106–3117. Uchiyama A, Kim J-S, Kon K, et al. Translocation of iron from lysosomes into mitochondria is a key event during oxidative stress-induced hepatocellular injury. Hepatology. 2008;In press. Gores GJ, Flarsheim CE, Dawson TL, et al. Swelling, reductive stress, and cell death during chemical hypoxia in hepatocytes. Am J Physiol. 1989;257(2 Pt 1):C347–C354. Kim JS, Ohshima S, Pediaditakis P, et al. Nitric oxide protects rat hepatocytes against reperfusion injury mediated by the mitochondrial permeability transition. Hepatology. 2004;39(6): 1533– 1543. Costa AD, Garlid KD. Intramitochondrial signaling: Interactions among mitoKATP, PKCE, ROS, and MPT. Am J Physiol Heart Circ Physiol. 2008;295(2):H874–H882. Gomez L, Paillard M, Thibault H, et al. Inhibition of GSK3beta by postconditioning is required to prevent opening of the

21

Part I


mitochondrial permeability transition pore during reperfusion. Circulation. 2008;117(21):2761–2768. 96. Theruvath TP, Snoddy MC, Zhong Z, et al. Mitochondrial permeability transition in liver ischemia and reperfusion: Role of c-Jun N-terminal kinase 2. Transplantation. 2008;85(10):1500–1504. 97. Mozaffari MS, Schaffer SW. Effect of pressure overload on cardioprotection of mitochondrial KATP channels and GSK-3beta: Interaction with the MPT pore. Am J Hypertens. 2008;21(5): 570–575. 98. Obame FN, Plin-Mercier C, Assaly R, et al. Cardioprotective effect of morphine and a blocker of glycogen synthase kinase 3 beta, SB216763 [3–(2,4–dichlorophenyl)-4(1–methyl-1Hindol-3-yl)-1H-pyrrole-2,5-dione], via inhibition of the mitochondrial permeability transition pore. J Pharmacol Exp Ther. 2008;326(1):252–258. 99. Latchoumycandane C, Goh CW, Ong MM, et al. Mitochondrial protection by the JNK inhibitor leflunomide rescues mice from acetaminophen-induced liver injury. Hepatology. 2007;45 (2):412–421. 100. Hassa PO, Haenni SS, Elser M, et al. Nuclear ADP-ribosylation reactions in mammalian cells: Where are we today and where are we going? Microbiol Mol Biol Rev. 2006;70(3):789–829. 101. Berger NA, Whitacre CM, Hashimoto H, et al. NAD and poly (ADP-ribose) regulation of proteins involved in response to cellular stress and DNA damage. Biochimie. 1995;77(5):364–367. 102. Pacher P, Szabo C. Role of poly(ADP-ribose) polymerase 1 (PARP-1) in cardiovascular diseases: The therapeutic potential of PARP inhibitors. Cardiovasc Drug Rev. 2007;25(3):235–260. 103. Shall S, de MG. Poly(ADP-ribose) polymerase-1: What have we learned from the deficient mouse model? Mutat Res. 2000; 460(1):1–15. 104. Heeres JT, Hergenrother PJ. Poly(ADP-ribose) makes a date with death. Curr Opin Chem Biol. 2007;11(6):644–653. 105. Bernheimer AW, Rudy B. Interactions between membranes and cytolytic peptides. Biochim Biophys Acta. 1986;864(1):123–141. 106. Cole DS, Morgan BP. Beyond lysis: How complement influences cell fate. Clin Sci (Lond). 2003;104(5):455–466. 107. Podack ER, Tschopp J. Membrane attack by complement. Mol Immunol. 1984;21(7):589–603. 108. Kim R, Emi M, Tanabe K, et al. The role of Fas ligand and transforming growth factor beta in tumor progression: Molecular mechanisms of immune privilege via Fas-mediated apoptosis and potential targets for cancer therapy. Cancer. 2004;100(11): 2281–2291. 109. Black DM, Behrns KE. A scientist revisits the atrophy-hypertrophy complex: Hepatic apoptosis and regeneration. Surg Oncol Clin N Am. 2002;11(4):849–864. 110. Stappenbeck TS, Wong MH, Saam JR, et al. Notes from some crypt watchers: Regulation of renewal in the mouse intestinal epithelium. Curr Opin Cell Biol. 1998;10(6):702–709. 111. Malhi H, Gores GJ, Lemasters JJ. Apoptosis and necrosis in the liver: A tale of two deaths? Hepatology. 2006;43(2 Suppl 1): S31–S44. 112. Malhi H, Gores GJ. Cellular and molecular mechanisms of liver injury. Gastroenterology. 2008;134(6):1641–1654. 113. Lemasters JJ. Dying a thousand deaths: Redundant pathways from different organelles to apoptosis and necrosis. Gastroenterology. 2005;129(1):351–360. 114. Oshima RG. Apoptosis and keratin intermediate filaments. Cell Death Differ. 2002;9(5):486–492. 115. Kramer A, Liashkovich I, Oberleithner H, et al. Apoptosis leads to a degradation of vital components of active nuclear transport and a dissociation of the nuclear lamina. Proc Natl Acad Sci USA. 2008;105(32):11236–11241. 116. Gavrieli Y, Sherman Y, Ben-Sasson SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol. 1992;119(3):493–501. 117. Lorenzo HK, Susin SA. Therapeutic potential of AIF-mediated caspase-independent programmed cell death. Drug Resist Updat. 2007;10(6):235–255. 118. Peter ME, Krammer PH. The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ. 2003;10(1):26–35. 119. Ding WX, Yin XM. Dissection of the multiple mechanisms of TNF-alpha-induced apoptosis in liver injury. J Cell Mol Med. 2004;8(4):445–454.

22

120. Scaffidi C, Fulda S, Srinivasan A, et al. Two CD95 (APO-1/Fas) signaling pathways. EMBO J. 1998;17:1675–1687. 121. Higuchi H, Gores GJ. Bile acid regulation of hepatic physiology: IV. Bile acids and death receptors. Am J Physiol Gastrointest Liver Physiol. 2003;284(5):G734–G738. 122. Gulbins E, Kolesnick R. Raft ceramide in molecular medicine. Oncogene. 2003;22(45):7070–7077. 123. Morales A, Colell A, Mari M, et al. Glycosphingolipids and mitochondria: Role in apoptosis and disease. Glycoconj J. 2004;20 (9):579–588. 124. Reinehr R, Haussinger D. CD95 activation in the liver: Ion fluxes and oxidative signaling. Arch Biochem Biophys. 2007;462 (2):124–131. 125. Liu X, Kim CN, Yang J, et al. Induction of apoptotic program in cell-free extracts: Requirement for dATP and cytochrome c. Cell. 1996;86:147–157. 126. Luo X, Budihardjo I, Zou H, et al. Bid, a Bcl2 interacting protein, mediates cytochrome c release from mitochondria in response to activation of cell surface death receptors. Cell. 1998;94(4):481–490. 127. Li H, Zhu H, Xu CJ, et al. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell. 1998;94(4):491–501. 128. Gross A, Yin XM, Wang K, et al. Caspase cleaved BID targets mitochondria and is required for cytochrome c release, while BCL-XL prevents this release but not tumor necrosis factorR1/Fas death. J Biol Chem. 1999;274(2):1156–1163. 129. Wei MC, Zong WX, Cheng EH, et al. Proapoptotic BAX and BAK: A requisite gateway to mitochondrial dysfunction and death. Science. 2001;292(5517):727–730. 130. Green DR, Kroemer G. The pathophysiology of mitochondrial cell death. Science. 2004;305(5684):626–629. 131. Ferraro E, Corvaro M, Cecconi F. Physiological and pathological roles of Apaf1 and the apoptosome. J Cell Mol Med. 2003; 7(1):21–34. 132. Ow YL, Green DR, Hao Z, et al. Cytochrome c: Functions beyond respiration. Nat Rev Mol Cell Biol. 2008;9(7):532–542. 133. Bossy-Wetzel E, Newmeyer DD, Green DR. Mitochondrial cytochrome c release in apoptosis occurs upstream of DEVDspecific caspase activation and independently of mitochondrial transmembrane depolarization. EMBO J. 1998;17(1):37–49. 134. Ricci JE, Munoz-Pinedo C, Fitzgerald P, et al. Disruption of mitochondrial function during apoptosis is mediated by caspase cleavage of the p75 subunit of complex I of the electron transport chain. Cell. 2004;117(6):773–786. 135. Bradham CA, Qian T, Streetz K, et al. The mitochondrial permeability transition is required for tumor necrosis factor alpha-mediated apoptosis and cytochrome c release. Mol Cell Biol. 1998;18(11):6353–6364. 136. Hatano E, Bradham CA, Stark A, et al. The mitochondrial permeability transition augments Fas-induced apoptosis in mouse hepatocytes. J Biol Chem. 2000;275(16):11814–11823. 137. Black D, Bird MA, Samson CM, et al. Primary cirrhotic hepatocytes resist TGFbeta-induced apoptosis through a ROS-dependent mechanism. J Hepatol. 2004;40(6):942–951. 138. Zhao Y, Ding WX, Qian T, Watkins S, Lemasters JJ, Yin XM. Bid activates multiple mitochondrial apoptotic mechanisms in primary hepatocytes after death receptor engagement. Gastroenterology. 2003;125(3):854–867. 139. Kim JS, Qian T, Lemasters JJ. Mitochondrial permeability transition in the switch from necrotic to apoptotic cell death in ischemic rat hepatocytes. Gastroenterology. 2003;124(2):494–503. 140. Jaeschke H, Lemasters JJ. Apoptosis versus oncotic necrosis in hepatic ischemia/reperfusion injury. Gastroenterology. 2003; 125(4):1246–1257. 141. Kon K, Kim JS, Jaeschke H, et al. Mitochondrial permeability transition in acetaminophen-induced necrosis and apoptosis of cultured mouse hepatocytes. Hepatology. 2004;40(5): 1170–1179. 142. Denecker G, Vercammen D, Declercq W, et al. Apoptotic and necrotic cell death induced by death domain receptors. Cell Mol Life Sci. 2001;58(3):356–370. 143. Kim YS, Morgan MJ, Choksi S, et al. TNF-induced activation of the Nox1 NADPH oxidase and its role in the induction of necrotic cell death. Mol Cell. 2007;26(5):675–687.

Chapter 1 144. Sesso A, Marques MM, Monteiro MM, et al. Morphology of mitochondrial permeability transition: Morphometric volumetry in apoptotic cells. Anat Rec A Discov Mol Cell Evol Biol. 2004;281(2):1337–1351. 145. Kuwana T, Mackey MR, Perkins G, et al. Bid, Bax, and lipids cooperate to form supramolecular openings in the outer mitochondrial membrane. Cell. 2002;111(3):331–342. 146. Siskind LJ, Kolesnick RN, Colombini M. Ceramide channels increase the permeability of the mitochondrial outer membrane to small proteins. J Biol Chem. 2002;277(30):26796–26803. 147. Siskind LJ, Davoody A, Lewin N, et al. Enlargement and contracture of C2-ceramide channels. Biophys J. 2003;85(3):1560–1575. 148. Chang LK, Putcha GV, Deshmukh M, et al. Mitochondrial involvement in the point of no return in neuronal apoptosis. Biochimie. 2002;84(2–3):223–231. 149. Johnson CE, Huang YY, Parrish AB, et al. Differential Apaf-1 levels allow cytochrome c to induce apoptosis in brain tumors but not in normal neural tissues. Proc Natl Acad Sci USA. 2007;104(52):20820–20825. 150. Scorrano L, Korsmeyer SJ. Mechanisms of cytochrome c release by proapoptotic BCL-2 family members. Biochem Biophys Res Commun. 2003;304(3):437–444. 151. Packham G, Stevenson FK. Bodyguards and assassins: Bcl-2 family proteins and apoptosis control in chronic lymphocytic leukaemia. Immunology. 2005;114(4):441–449. 152. Tsujimoto Y, Shimizu S. The voltage-dependent anion channel: An essential player in apoptosis. Biochimie. 2002;84(2–3): 187–193. 153. Adachi M, Higuchi H, Miura S, et al. Bax interacts with the voltage-dependent anion channel and mediates ethanol-induced apoptosis in rat hepatocytes. Am J Physiol Gastrointest Liver Physiol. 2004;287(3):G695–G705. 154. Vaux DL, Silke J. IAPs, RINGs and ubiquitylation. Nat Rev Mol Cell Biol. 2005;6(4):287–297. 155. Salvesen GS, Duckett CS. IAP proteins: Blocking the road to death’s door. Nat Rev Mol Cell Biol. 2002;3(6):401–410. 156. Du C, Fang M, Li Y, et al. Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition. Cell. 2000;102(1):33–42. 157. Verhagen AM, Ekert PG, Pakusch M, et al. Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins. Cell. 2000; 102(1):43–53. 158. Cande C, Cohen I, Daugas E, et al. Apoptosis-inducing factor (AIF): A novel caspase-independent death effector released from mitochondria. Biochimie. 2002;84(2–3):215–222. 159. Suzuki Y, Imai Y, Nakayama H, et al. A serine protease, HtrA2, is released from the mitochondria and interacts with XIAP, inducing cell death. Mol Cell. 2001;8(3):613–621. 160. Parrish J, Li L, Klotz K, et al. Mitochondrial endonuclease G is important for apoptosis in C. elegans. Nature. 2001;412(6842): 90–94. 161. Li LY, Luo X, Wang X. Endonuclease G is an apoptotic DNase when released from mitochondria. Nature. 2001;412(6842):95–99. 162. Suzuki Y, Takahashi-Niki K, Akagi T, et al. Mitochondrial protease Omi/HtrA2 enhances caspase activation through multiple pathways. Cell Death Differ. 2004;11(2): 208–216. 163. Karbowski M, Youle RJ. Dynamics of mitochondrial morphology in healthy cells and during apoptosis. Cell Death Differ. 2003;10(8):870–880. 164. de Brito OM, Scorrano L. Mitofusin 2: A mitochondria-shaping protein with signaling roles beyond fusion. Antioxid Redox Signal. 2008;10(3):621–633. 165. Greten FR, Karin M. The IKK/NF-kappaB activation pathway— A target for prevention and treatment of cancer. Cancer Lett. 2004;206(2):193–199. 166. Yin XM, Ding WX. Death receptor activation-induced hepatocyte apoptosis and liver injury. Curr Mol Med. 2003;3(6): 491–508. 167. Hatano E, Bennett BL, Manning AM, et al. NF-kappaB stimulates inducible nitric oxide synthase to protect mouse hepatocytes from TNF-alpha- and Fas-mediated apoptosis. Gastroenterology. 2001;120(5):1251–1262. 168. Li J, Bombeck CA, Yang S, et al. Nitric oxide suppresses apoptosis via interrupting caspase activation and mitochondrial

169.

170. 171. 172. 173. 174. 175. 176. 177. 178. 179. 180.

181. 182. 183.

184. 185. 186. 187.

188. 189. 190. 191.

192. 193.


dysfunction in cultured hepatocytes. J Biol Chem. 1999;274 (24):17325–17333. Kim JS, Ohshima S, Pediaditakis P, et al. Nitric oxide protects rat hepatocytes against reperfusion injury mediated by the mitochondrial permeability transition. Hepatology. 2004;39(6): 1533–1543. Keppler D, Holstege A, Weckbecker G, et al. Potentiation of antimetabolite action by uridylate trapping. Adv Enzyme Regul. 1985;24:417–427. Lehmann V, Freudenberg MA, Galanos C. Lethal toxicity of lipopolysaccharide and tumor necrosis factor in normal and D-galactosamine-treated mice. J Exp Med. 1987;165(3):657–663. Downward J. PI 3-kinase, Akt and cell survival. Semin Cell Dev Biol. 2004;15(2):177–182. Song G, Ouyang G, Bao S. The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med. 2005;9(1):59–71. Harris SL, Levine AJ. The p53 pathway: Positive and negative feedback loops. Oncogene. 2005;24(17):2899–2908. Pei XH, Xiong Y. Biochemical and cellular mechanisms of mammalian CDK inhibitors: A few unresolved issues. Oncogene. 2005;24(17):2787–2795. Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell. 1995;80(2): 293–299. Oda E, Ohki R, Murasawa H, et al. Noxa, a BH3-only member of the Bcl-2 family and candidate mediator of p53-induced apoptosis. Science. 2000;288(5468): 1053–1058. Yu J, Zhang L, Hwang PM, et al. PUMA induces the rapid apoptosis of colorectal cancer cells. Mol Cell. 2001;7(3):673–682. Nicoletti VG, Stella AM. Role of PARP under stress conditions: Cell death or protection? Neurochem Res. 2003;28(2):187–194. Decker P, Muller S. Modulating poly (ADP-ribose) polymerase activity: Potential for the prevention and therapy of pathogenic situations involving DNA damage and oxidative stress. Curr Pharm Biotechnol. 2002;3(3):275–283. Szabadkai G, Rizzuto R. Participation of endoplasmic reticulum and mitochondrial calcium handling in apoptosis: More than just neighborhood? FEBS Lett. 2004;567(1):111–115. Orrenius S, Zhivotovsky B, Nicotera P. Regulation of cell death: The calcium-apoptosis link. Nat Rev Mol Cell Biol. 2003;4(7): 552–565. Penzo D, Petronilli V, Angelin A, et al. Arachidonic acid released by phospholipase A(2) activation triggers Ca(2þ)-dependent apoptosis through the mitochondrial pathway. J Biol Chem. 2004;279(24):25219–25225. Liu CY, Kaufman RJ. The unfolded protein response. J Cell Sci. 2003;116(Pt 10):1861–1862. Rao RV, Ellerby HM, Bredesen DE. Coupling endoplasmic reticulum stress to the cell death program. Cell Death Differ. 2004;11(4):372–380. Ji C, Kaplowitz N. Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury. World J Gastroenterol. 2004;10(12):1699–1708. Harding HP, Novoa I, Bertolotti A, et al. Translational regulation in the cellular response to biosynthetic load on the endoplasmic reticulum. Cold Spring Harb Symp Quant Biol. 2001;66:499–508. Urano F, Bertolotti A, Ron D. IRE1 and efferent signaling from the endoplasmic reticulum. J Cell Sci. 2000;113(Pt 21):3697–3702. Shen J, Chen X, Hendershot L, et al. ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev Cell. 2002;3(1):99–111. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science. 2000;287(5453):664–666. Yoneda T, Imaizumi K, Oono K, et al. Activation of caspase-12, an endoplastic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J Biol Chem. 2001;276(17): 13935–13940. Scorrano L, Oakes SA, Opferman JT, et al. BAX and BAK regulation of endoplasmic reticulum Ca2þ: A control point for apoptosis. Science. 2003;300(5616):135–139. Brostrom MA, Brostrom CO. Calcium dynamics and endoplasmic reticular function in the regulation of protein synthesis:

23

Part I

194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204.


Implications for cell growth and adaptability. Cell Calcium. 2003; 34(4–5):345–363. Bursch W, Ellinger A, Gerner C, et al. Programmed cell death (PCD). Apoptosis, autophagic PCD, or others? Ann N Y Acad Sci. 2000;926:1–12. Levine B, Klionsky DJ. Development by self-digestion: Molecular mechanisms and biological functions of autophagy. Dev Cell. 2004;6(4):463–477. Klionsky DJ. Autophagy: From phenomenology to molecular understanding in less than a decade. Nat Rev Mol Cell Biol. 2007;8(11):931–937. Kiel JA, Komduur JA, van dK I, et al. Macropexophagy in Hansenula polymorpha: Facts and views. FEBS Lett. 2003;549 (1–3):1–6. Bellu AR, Komori M, van dK I, et al. Peroxisome biogenesis and selective degradation converge at Pex14p. J Biol Chem. 2001;276(48):44570–44574. Elmore SP, Qian T, Grissom SF, et al. The mitochondrial permeability transition initiates autophagy in rat hepatocytes. FASEB J. 2001;15(12):2286–2287. Tsujimoto Y, Shimizu S. Another way to die: Autophagic programmed cell death. Cell Death Differ. 2005;12(Suppl 2): 1528–1534. Debnath J, Baehrecke EH, Kroemer G. Does autophagy contribute to cell death? Autophagy. 2005;1:66–74. Gozuacik D, Kimchi A. Autophagy as a cell death and tumor suppressor mechanism. Oncogene. 2004;23(16):2891–2906. Vicencio JM, Galluzzi L, Tajeddine N, et al. Senescence, apoptosis or autophagy? When a damaged cell must decide its path—A mini-review. Gerontology. 2008;54(2):92–99. Boya P, Gonzalez-Polo RA, Casares N, et al. Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol. 2005;25(3): 1025–1040.

24

205. Guicciardi ME, Deussing J, Miyoshi H, et al. Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c. J Clin Invest. 2000;106(9):1127–1137. 206. Foghsgaard L, Wissing D, Mauch D, et al. Cathepsin B acts as a dominant execution protease in tumor cell apoptosis induced by tumor necrosis factor. J Cell Biol. 2001;153(5):999–1010. 207. Stoka V, Turk B, Schendel SL, et al. Lysosomal protease pathways to apoptosis. Cleavage of bid, not pro-caspases, is the most likely route. J Biol Chem. 2001;276(5):3149–3157. 208. Bidere N, Lorenzo HK, Carmona S, et al. Cathepsin D triggers Bax activation, resulting in selective apoptosis-inducing factor (AIF) relocation in T lymphocytes entering the early commitment phase to apoptosis. J Biol Chem. 2003;278(33): 31401–31411. 209. Lemasters JJ, Qian T, He L, et al. Role of mitochondrial inner membrane permeabilization in necrotic cell death, apoptosis, and autophagy. Antioxid Redox Signal. 2002;4(5):769–781. 210. Kim JS, He L, Qian T, et al. Role of the mitochondrial permeability transition in apoptotic and necrotic death after ischemia/reperfusion injury to hepatocytes. Curr Mol Med. 2003; 3(6):527–535. 211. Cory S, Adams JM. The Bcl2 family: Regulators of the cellular life-or-death switch. Nat Rev Cancer. 2002;2(9):647–656. 212. Lamkanfi M, Festjens N, Declercq W, et al. Caspases in cell survival, proliferation and differentiation. Cell Death Differ. 2007;14(1):44–55. 213. Denecker G, Ovaere P, Vandenabeele P, et al. Caspase-14 reveals its secrets. J Cell Biol. 2008;180(3):451–458.

C h a p t e r

2 Acute and Chronic Inflammation Induces Disease Pathogenesis Vladislav Dolgachev

INTRODUCTION The recognition of pathogenic insults can be accomplished by a number of mechanisms that function to initiate inflammatory responses and mediate clearance of invading pathogens. This initial response when functioning optimally will lead to a minimal leukocyte accumulation and activation for the clearance of the inciting agent and have little effect on homeostatic function. However, often the inciting agent elicits a very strong inflammatory response, either due to host recognition systems or due to the agent’s ability to damage host tissue. Thus, the host innate immune system mediates the damage and tissue destruction in an attempt to clear the inciting agent from the system. No matter, these initial acute responses can have longterm and even irreversible effects on tissue function. If the initial responses are not sufficient to facilitate the clearance of the foreign pathogen or material, the response shifts toward a more complex and efficient process mediated by lymphocyte populations that respond to specific residues displayed by the foreign material. Normally, these responses are coordinated and only minimally alter physiologic function of the tissue. However, in unregulated responses the initial reaction can become acutely catastrophic, leading to local or even systemic damage to the tissue or organs, resulting in degradation of normal physiologic function. Alternatively, the failure to regulate the response or clear the inciting agent could lead to chronic and progressively more pathogenic responses. Each of these potentially devastating responses has specific and often overlapping mechanisms that have been identified and lead to the damage within tissue spaces. A series of events take place during both acute and chronic inflammation that lead to the accumulation of leukocytes and damage to the local environment. Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

Nicholas W. Lukacs

LEUKOCYTE ADHESION, MIGRATION, AND ACTIVATION Endothelial Cell Expression of Adhesion Molecules The initial phase of the inflammatory response is characterized by a rapid leukocyte migration into the affected tissue. Upon activation of the endothelium by inflammatory mediators, upregulation of a series of adhesion molecules is initiated that leads to the reversible binding of leukocytes to the activated endothelium. The initial adhesion is mediated by E and P selectins that facilitate slowing of leukocytes from circulatory flow by mediating rolling of the leukocytes on the activated endothelium [1–4]. The selectinmediated interaction with the activated endothelium potentiates the likelihood of the leukocyte to be further activated by endothelial-expressed chemokines, which mediate G-protein coupled receptor (GPCR) induced activation [5–7]. If the rolling leukocytes encounter a chemokine signal and an additional set of adhesion molecules is also expressed, such as intracellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1), the leukocytes firmly adhere to the activated endothelium. The mechanism of chemokine-induced adhesion of the leukocyte is dependent on actin reorganization and a confirmational change of the b-integrins on the surface of the leukocytes [8–12]. Subsequently, the firm adhesion allows leukocytes to spread along the endothelium and to begin the process of extravasating into the inflamed tissue following chemoattractant gradients that guide the leukocyte to the site of inflammation. Each of these events has been thoroughly examined over the past several years and has resulted in a better-defined process of coordinated events that 25

Part I


lead the leukocyte from the vessel lumen into the inflamed tissue. The initial binding of the leukocytes to E and P selectins is mediated by interaction with glycosylated ligands expressed on the leukocytes, most commonly P-selectin glycoprotein ligand 1 (PSGL1) [13–15]. The ability to capture leukocytes onto the inflamed vessel wall is both dependent on the ability of selectin interactions to rapidly bind to its ligands and on the flow rate of the leukocytes in post-capillary vessels where the lower shear rate allows the productive interactions to occur. Once the leukocyte is tethered by the selectin molecules on the vessel wall, a series of binding and release events allow the leukocyte to roll along the activated endothelial cell surface. While the activation and signaling processes that mediate leukocyte release from the selectin interaction continue to be the focus of investigation, current information suggests that these processes may be dependent on key signaling molecules that are initiated upon selectin binding to its ligands. The expression of phosphoinositide 3-kinase-g (PI3Kg) in activated endothelium appears to be critical for securing the tethered leukocyte to the vessel wall, whereas spleen tyrosine kinase (SYK) signals downstream of PSGL1 in the bound leukocyte and regulates the rolling process [16–20]. In addition to selectin-mediated leukocyte rolling, there may be a number of instances in which specific integrins can also participate in leukocyte rolling. The CNS, intestinal track, and lung are three examples where this has been specifically observed. Early studies utilizing selectin-deficient animals demonstrated that leukocytes continue to marginate and migrate into the lung during bacterial infections despite the absence of selectin function. Using in vitro flow analysis, cells expressing a4b7 integrins can roll on immobilized mucosal vascular addressin cell adhesion molecule-1 (MADCAM1) that is highly expressed in the intestinal track [21–23]. Likewise, very late antigen 4 (VLA4) supports monocyte and lymphocyte rolling in vitro and lymphocyte rolling in the CNS [24–28]. While it is not clear under what circumstances the integrin-mediated rolling occurs, it is likely functional under low shear flow conditions when an initial tethering event is not as crucial. It is most likely that the cooperation of selectin-mediated and integrin-mediated rolling and adhesion is required for leukocyte rolling. The transition from leukocyte rolling to firm adhesion depends on several distinct events to occur in the rolling leukocyte. First, the integrin needs to be modified through a G protein-mediated signaling event enabling a conformational change that exposes the binding site for the specific adhesion molecule. Second, the density of adhesion molecule expression needs to be high enough to allow the leukocyte to spread along the activated endothelium and appropriate integrin clustering on the leukocyte surface. Finally, it appears that a phenomenon known as outside-in signaling (recently reviewed [29]) is also necessary for strengthening the adhesive interactions through several important signaling events that include FGR and HCK, two SRC-like protein tyrosine 26

kinases (PTKs). Together, these coordinated events facilitate preparation of leukocytes for extravasation through the endothelium into the inflamed tissue. Transendothelial cell migration of leukocytes requires that numerous potential obstacles be managed. After firmly adhering to the activated endothelium, leukocytes appear to spread and crawl along the border until they reach an endothelial cell junction that has been appropriately “opened” by the inflamed environment. While it has not been completely established, it appears that endothelial cell junctions that support transmigration of leukocytes express higher levels of adhesion molecules that allow a haptotatic gradient for the crawling cells to traverse through. This paracellular route of migration is a favored and well-supported mechanism that is optimized by tissue expressed chemoattractants for mediating the crawling into the junctional region without harming the endothelial cell border. A number of molecules have been implicated in this route of migration, but PECAM1 has been the most thoroughly studied and appears to be functionally required for the process with targeted expression at the endothelial cell junction region [30,31]. Another protein, junction adhesion molecule-A (JAM-A), has also been shown to be associated with migration of cells through the tight junctions of endothelial layer of vessels and is found on the surface of several leukocyte populations including PMNs [32,33]. It appears that PECAM1 and JAM-A are utilized in a sequential manner to allow movement through the endothelial barrier [34,35]. An alternative and recently described mode of transendothelial migration is via a transcellular route. This was initially described using in vitro analyses, but has also been identified in the CNS and during inflammatory responses in other tissues. These migratory pathways through the endothelial cell membrane and cytoplasmic region are associated with vesiculo-vacuolar organelles (VVOs), which have been described as membrane-associated passageways that can allow rapid leukocyte transendothelial migration into inflamed tissue compartments [36,37]. It has been suggested that these mechanisms may occur under conditions of dense adhesion molecule expression that appears to trigger the formation of the intracellular passageways in association with caveolin-1 [38]. While this mechanism of leukocyte extravasation may represent a less frequent method of migration across inflamed endothelium, under certain conditions, such as in high shear where paracellular migration could be more difficult, it may represent an important form of migration. The final obstacle for the leukocyte to traverse prior to entering into the tissue from the vessel is the basement membrane. The model that has been proposed over the years suggests that metalloproteinases (MMPs) are activated to degrade the basement membrane extracellular matrix (ECM), enabling leukocytes to penetrate toward the site of inflammation [39–41]. While evidence in vitro suggests that matrix degradation is necessary and that MMPs are required, it has not been clearly identified how the basement membrane is traversed by leukocytes without substantial damage to the integrity of the vessel wall.

Chapter 2

Chemoattractants Over the past several years researchers have identified multiple families of chemoattractants that can participate in the extravasation of leukocytes. Perhaps the most readily accessible mediator class during inflammation is the complement system. These proteins are found in circulation or can be generated de novo upon cellular stimulation. Upon activation, bacterial products or immune complexes (as previously reviewed [42,43]) through the alternative or classical pathways mediate cleavage of C3 and/or C5 into C3a and C5a that can provide an immediate and effective chemoattractant to induce neutrophil and monocyte activation. The role of C3a as an anaphylactic agent illustrates the importance of this early activation event on mast cell biology. In addition, C5a stimulates neutrophil oxidative metabolism, granule discharge, and adhesiveness to vascular endothelium. Interestingly, C5a activates endothelial cells via C5aR to induce expression of P-selectin that can further increase local inflammatory events. C3a lacks these latter activities. Altogether, these functions of C3a and C5a indicate that they are potent inflammatory mediators. While these chemoattractant molecules have previously been well described, recent literature has provided additional evidence that has rekindled excitement toward targeting these factors for therapeutic intervention [44,45]. These diseases include sepsis, acute respiratory distress syndrome (ARDS), asthma, arthritis, as well as several other acute and chronic inflammatory diseases. A second mediator system that is involved in early and immediate leukocyte migration is the leukotrienes, a class of lipid mediators that are preformed in mast cells or are quickly generated through the efficient arachadonic acid pathway induced by 5-LO [46,47]. In particular, leukotriene B4 (LTB4) has especially been implicated in the early induction of neutrophil migration, but also can generate long-term problems during inflammation. LTB4 can be rapidly synthesized by phagocytic cells (PMNs and macrophages) following stimulation with bacterial LPS or other pathogen products. Furthermore, the LTB4 receptor has been implicated in recruitment of T lymphocytes that mediate chronic inflammatory diseases, including rodent models of asthma and arthritis, as well as in transplantation rejection models. In particular, the LTB4 receptor BLT1 has been implicated in preferential recruitment of Th2 type T-lymphocytes during allergic responses [48–50]. Thus, besides their potent function as a neutrophil chemoattractant in acute inflammatory events, LTB4 and BLT1 also play important roles in chronic immune reactions. As such, they are now being considered targets for therapy in chronic immune responses. In addition to LTB4, the cysteinyl leukotrienes, LTC4, D4, and E4, also appear to have some chemotactic activity [51,52], suggesting that targeting the conversion of arachodonic acid into the leukotriene pathway may be generally beneficial. Chemokines represent a large and well-characterized family of chemoattractants composed of over 50 polypeptide molecules that are expressed in numerous

Acute and Chronic Inflammation Induces Disease Pathogenesis

acute and chronic immune responses [53]. Given the number of individual molecules contained in the chemokine family, there is confusion of function. The promiscuous binding relationship between multiple members with a single receptor, as well as a specific receptor able to bind multiple chemokines contributes considerably to our relative lack of understanding of the biology of the family. The determination of what leukocyte populations are recruited to a particular tissue during a response is dictated by the chemokine ligands that are induced and the specific receptors that are displayed on subsets of leukocytes. This latter aspect can be best observed during acute inflammatory responses, such as in bacterial infections, when the cellular infiltrate is primarily neutrophils and it is the production of CxCR binding chemokines that mediate the process [54]. Likewise, when more insidious pathogens are present and the acute inflammatory mechanisms are not able to control the infectious process, immune cytokines, such as IFN and IL-4, tend to drive the production of chemokines that facilitate the recruitment of mononuclear cells, macrophages, and lymphocytes to the site of infection [54,55]. This allows a more sophisticated immune response to develop for clearance of the pathogen. Thus, although there are numerous chemokines being produced during any single response, the overall profile of the response may be directed for recruitment of cells that are most appropriate to deal with the particular stimuli. In addition to their ability to bind to cellular receptors, chemokines are also able to bind to glycosaminoglycans (GAGs) [55]. Unlike with complement and lipid chemoattractants, this allows chemokines to accumulate within tissue and on endothelium for long periods without being washed away or otherwise cleared through various biologic processes. This provides several advantages with respect to the maintenance of chemoattractant gradients in inflamed tissue over long periods of time, with the most intense signals maintained at the site of inflammation. Chemokines are important at the endothelial border where they mediate firm adhesion of leukocytes undergoing selectin-associated rolling to activate their b-integrins to the activated endothelial cells and subsequently direct migration of these cells to the site of inflammation. Finally, at higher concentrations (such as those found at the site of inflammation), chemokines induce leukocyte activation for effector function (for instance, degranulation). Thus, the progressive movement of leukocytes from the endothelial cell border in activated vessels through their arrival at the site of inflammation relies on the coordinated expression and interaction of chemokines and adhesion molecules. The activation of leukocytes by chemoattractants is mediated by a common signaling cascade via Gi-protein coupled receptor pathways [56]. These pathways can be monitored by calcium mobilization and cellular migration mediated by the Gi alpha and Gi beta/ gamma subunits, respectively. Signaling through these subunits results in the activation of important downstream pathways including PI3K, MAPK, and FAK. The PI3K pathway has been the most thoroughly 27

Part I


studied after a chemotactic signal and depends on the P110 subunits a, b, g [57]. The importance of PI3K was best demonstrated in studies using cells deficient in PI3K P110g, as well as in localization studies that identified activated P110g at the leading edge of migrating cells [58–60]. Once activated, PI3K appears to couple with the p85 adaptor protein that mediates activation of other pathways, including rac, rho, and Cdc42 GTPases leading to actin polymerization. These PI3Kinduced responses can be actively regulated by PTEN (phosphatase and tensin homology deleted on chromosome ten protein) and involved in directional sensing [61,62]. Interestingly, while PI3K appears to be localized to the leading edge during migration, PTEN is found in the trailing edge and is excluded from the leading edge via mechanisms related to GTPase-associated amplification of PIP3 activation [63–67]. Thus, the activation of this system clearly regulates directional leukocyte movement by differential cellular localization of key signaling molecules that regulate actin and other structural proteins.

ACUTE INFLAMMATION AND DISEASE PATHOGENESIS The initiation of a rapid innate immune response to invading pathogens is essential to inhibit the colonization of microorganisms or to sequester toxic and noxious substances. Once an infection is established, pathogenic bacteria have the capability to multiply and expand at a rate that can surpass the ability of the host to clear and destroy the bacteria. A number of mechanisms have developed to inhibit the establishment of pathogenic bacteria in tissues. The primary mechanism is activation of edema and local fluid release to flood the affected tissue, along with early activation of the complement system in response to bacterial components, resulting in cleavage of C3 and C5. These early inflammatory mediators provide a relatively effective and rapid initiation of PMN and mononuclear phagocyte infiltration to sites of infection. The recruited phagocytic cells engulf invading pathogenic bacteria and quickly activate to begin producing LTB4 as well as early response cytokines, such as IL-1 and TNF, that enhance phagocytosis and killing. The early response cytokines subsequently activate resident cell populations to produce other important mediators of inflammation, such as IL-6 and IL-8 (CxCL8), and promote cytokine cascades that lead to continued leukocyte migration and activation. These early events are critical for regulation of the intensity of the inflammatory response as well as effective containment of the pathogens and foreign substances. This multipronged approach to the activation of the inflammatory response and inhibition of the pathogen expansion is normally tightly regulated. However, in situations in which the inflammatory stimuli are intense, such as in a bolus dose of bacteria, severe trauma, or in burn victims, the acute inflammatory response can become dangerously unregulated. In these types of situations when mediators are produced 28

in an unregulated manner, the host/patient can quickly become subjected to a systemic inflammatory response even though the initial insult may be quite localized. This is a result of mediator production (especially TNF and IL-1) that is systemically delivered to multiple organs, creating an overproduction of leukocyte chemoattractants in distal organs and inducing inflammatory cell influx. These types of responses can quickly damage target organs including liver, lung, and kidney. In this form of septic response, the overwhelming PMN recruitment and activation to multiple organs can lead to tissue damage and organ dysfunction. The ensuing cytokine storm that develops in the affected tissues results from a cascade of cytokine and chemokine production, leading to uncontrolled leukocyte infiltration and activation that damages the tissue leading to organ dysfunction. While these events can affect any tissue of the organism, the liver and lung appear to be primary targets due to their relatively high numbers of resident macrophage populations that can quickly respond to the inflammatory cytokine signals. In the lung, the development of acute respiratory distress syndrome (ARDS) is often observed in patients experiencing a septic insult. Although early research focused on TNF and IL-1 as lead targets to combat these responses, clinical trials using specific inhibitors, along with more clinically relevant animal models, have not shown any benefit to blocking these central inflammatory mediators in acute diseases, such as sepsis. These failures are likely due to the fact that the early response cytokines are produced and cleared prior to the induction of the most severe aspects of disease. Thus, by the time these mediators were targeted in the sick patient, their detrimental inflammatory function has already been performed. More recent targets include complement receptors (C3aR and C5aR), as well as numerous chemokines and their receptors to attempt to block the recruitment and activation of the cell populations during the responses. However, it is not yet clear whether merely blocking a signal mediator or receptor system will be sufficient or consistent enough to significantly alter the outcome of severely unregulated septic responses. In the case of viral infections, the system must deal with clearance in a different manner since the ability to recognize and phagocytize virus particles is not reasonable due to their size. Instead, the system is geared to recognize the organisms once a target cell has been infected with the virus. One of the most effective early means of blocking the spread is through the immediate production of type I interferon (IFN). This class of mediators facilitates the blockade of spread by both altering the metabolism of infected cells and by promoting the production of additional antiviral factors in uninfected cells to reduce the chance of successful viral assembly and further spread. While the antiviral effects of type I IFNs was initially identified many years ago, researchers continue to attempt to fully understand the mechanisms that are initiated by this class of mediators.

Chapter 2

PATTERN RECOGNITION RECEPTORS AND INFLAMMATORY RESPONSES Toll-Like Receptors The initiation of acute inflammation and the progression of chronic disease are often fueled by infectious agents that provide strong stimuli to the host. These responses evolved to be beneficial for the rapid recognition of pathogenic motifs that are not normally present in the host during homeostatic circumstances. These pathogen recognition systems form the basis for our innate immune system, which is rapidly activated to destroy pathogens prior to their colonization. However, at the same time the overactivation of this system can contribute to significant pathology in the host. While there are now a number of diverse families of pattern recognition systems, the best-characterized family is the toll-like receptors (TLR) [68,69]. The Toll system was first discovered in Drosophila as a crucial part of the antifungal defense for the organism. The TLR family in mammalian species consists of transmembrane receptors that reside either on the cell surface or within the endosome and that characteristically consist of leucine rich repeats (LRR) for motif recognition and an intracytoplasmic region for signal transduction (Figure 2.1). While TLRs are most notably identified on immune/inflammatory cell populations, they can also be expressed on nonimmune structural cells and provide an activation signal for the initiation of inflammatory mediator production. Cellular activation signals are transmitted by TLRs via cytoplasmic adapter molecules that initiate a cascade

LRR

TLR4 LRR

TLR2

TRAM TIRAP MyD88

TRIF

endosome LRR TLR3

TLR7,8,9

IRAK4 IRAK1 TRAF6

LRR

RIP-1 TBK1

MyD88 IRAK4 IRAK1

TAK1 IRF3 IKK NFκB

IRF7

TRAF6 TAK1

IFNβ IFN-ind. genes

NFκB Type I IFNα/β IFN-inducible genes Inflammatory Inflammatory cytokines cytokines Nucleus

Figure 2.1 TLR activation leads to induction of diverse inflammatory, chemotactic, and activating cytokine production.


of now well-defined activation pathways including NFkB, IRF3, IRF7, as well as a link to MAPK pathways [70,71]. These activation pathways provide strong stimuli that alert the host with “danger signals” that allow effective immune cell activation. One of the first molecules in this family that was identified was toll-like receptor 4 (TLR4), which primarily recognizes lipopolysaccharide (LPS; also known as endotoxin), a component of the cell wall of gram-negative bacteria. The TLR4 activation pathway is unique among TLRs as it signals via multiple adaptor proteins, including MyD88, TRIF, and MD-2, making it the most dynamic TLR within the family [72]. It is the TLR4 pathway that is likely the most prominent during sepsis for the strong systemic activation during acute inflammatory responses. In addition to recognizing LPS, RSV F protein [73] and other complex carbohydrate and lipid molecules from pathogens, TLR4 has also been demonstrated to recognize free fatty acids from host adipose tissue and may contribute to the inflammatory syndrome observed during obesity and in type 2 diabetes [74]. This latter activation cascade may contribute to an unknown number of diseases where obesity and insulin resistance predispose individuals to more severe disease progression. This aspect will surely become a focus in future investigations related to disease severity and obesity. Other TLR family members recognize distinct and now better-defined factors that allow the immediate activation of the innate immune system and subsequent signaling of the adaptive immune responses. TLR2 appears to have the most diverse range of molecules that are recognized directly including peptidoglycan, mycoplasm lipopeptide, a number of fungal antigens, as well as a growing number of carbohydrate residues on parasitic, fungal, and bacterial moities. In addition, TLR2 can heterodimerize with TLR1 and TLR6 to further expand its recognition capabilities. TLR5 specifically recognizes flagellin and is therefore important for recognizing both gram-negative and gram-positive bacteria. While the previously described TLRs are expressed on the cell membrane, a number of TLRs are predominantly expressed in endosomic membrane compartments of innate immune cells, including TLR3, TLR7, TLR8, and TLR9 [9]. These pathogen recognition receptors (PRR) are involved in recognition of nucleic acid motifs including dsRNA (TLR3), ssRNA (TLR7 and TLR8), and unmethylated CpG DNA (TLR9). Together, these TLRs function in the recognition of viral and bacterial pathogens that enter the cell via receptor-mediated endocytosis or that are actively phagocytized. All of these TLRs exclusively utilize the MyD88 adaptor pathway for activation, except TLR3, which uses TRIF. Thus, these pathways are important for the initiation of innate cytokines, including TNF, IL-12, and type I IFN [75,76], as outlined in Figure 2.1. However, the activation of antigen-presenting cells via the TLR pathways is also extremely important for integrating acute inflammatory events mediated by the innate immune system with acquired immunity and therefore also implicates TLR activation with chronic inflammation. 29

Part I


Cytoplasmic Sensors of Pathogens While the TLR proteins have been the best characterized, it is now evident that they are not the only molecules that are important for recognition of pathogenic insults. One of the early observations that surround the TLR recognition system was the fact that they are expressed either on the surface membrane or on the endoplasmic membranes. However, if pathogens infect directly into the cytoplasm or escape endosomal degradation pathways, the host cell must have the ability to recognize and deal with the cytoplasmic insult. Cells have developed a number of additional recognition systems to specifically identify pathogen products in the cytoplasm. Similar to the TLR system, Nod-like receptors (NLR; also known as catapiller proteins) are able to recognize specific pathogen patterns that are distinct from host sequences [77–80]. Nod1 and Nod2 sense bacterial molecules produced by the synthesis and/or degradation of peptidoglycans (PGN) (Figure 2.2). Specifically, Nod1 recognizes PGNs that contain mesodiaminopimelic acid produced by gram-negative bacteria and some gram-positive bacteria, while Nod2 recognizes muramyl dipeptide that is found in nearly all PGNs. Other members of this family include NALPs (NACHT-, LRR-, and pyrin-domain-containing proteins), IPAF (ICE-protease activating factor), and NAIPs (neuronal apoptosis inhibitor proteins) [79,81]. An interesting aspect of NLRs is that they contain a conserved caspase associated receptor domain (CARD) that was initially related to proteins involved in programmed cell death or apoptosis. These proteins specifically activate cells through a complex of proteins known as the inflammasome. The central protein of

NLR PATHWAYS DAMPS PGN NOD1

NOD2 RICK

NALP

ASC

NALP

ASC

Procaspase 1

Procaspase 1

Inflammasone

IKK Complex Pro-IL-1β

Active-IL-1β

NFκB Cytoplasm Inflammatory cytokines

Nucleus

the inflammasome is caspase 1, which is bound by the CARD of the NLRs. A simplified model of the NLR activation pathway suggests that binding to caspase 1 leads to processing of pro-IL-1b and pro-IL-18 to their active and released forms. Interestingly, these same activation pathways can lead to programmed cell death, possibly depending on the activation state of the responding cell and/or the intensity of the NLR signal. In addition to the inflammasome-mediated activation of proinflammatory cytokine release, NOD proteins have also been shown to induce NFkB and MAPK activation through a RICK/RIP2 signaling pathway [82]. This opens up a number of additional gene activation events via this bacterial-induced pathway. Beyond the activation of cytosolic sensors by bacterial products, host organisms are also armed with a system that recognizes viral products that either escape endosomic recognition or directly infect in a cytosolic manner. Several years ago it was recognized that PKR proteins had the ability to recognize dsRNA, an intermediate step in nearly every viral infection. Interestingly, one of the apparent functions of PKR is that it phosphorylates the alpha-subunit of eukaryotic translation initiation factor 2 (eIF2), which causes inhibition of cellular and viral protein synthesis [83–85]. This latter function works in concert with type I IFN that is also a product of PKR activation for creating an antiviral environment [86]. PKR has a long history of investigation related to antiviral effects of infected cells and appears to provide an important aspect to the response against a productive virus infection. More recent investigations have identified two helicase proteins that have the ability to recognize dsRNA, RIG-I (retinoic acid-inducible gene) and MDA5 (melanoma differentiation-associated gene) [87,88]. The activation of the protein products of either of these genes in the cytoplasm leads to an immediate activation of type I IFNs (Figure 2.3). The signaling pathway that RIG-I utilizes was initially surprising since it also utilizes its CARD to interact with a mitochondriaassociated protein, MAVS [89]. This interaction leads to a scaffold involving TRAF-3, TBK-1, and IRF-3 activation [90]. While this pathway continues to be defined, it appears to be very important in several forms of viral infection. Interestingly, various viruses may differentially activate the two helicases, and this differential activation may define the type and intensity of the ensuing immune responses. Overall, the number of proteins that have the ability to recognize dsRNA not only demonstrates redundancy in the system but also indicates the importance of being able to detect this specific PAMP that is a clear sign of a productive viral infection.

Pattern Recognition and Pathologic Consequences Figure 2.2 Cytoplasmic pathogen receptors allow activation of cytokines responsible for the upregulation of inflammatory processes. 30

One of the potential pathogenic side effects of activation of cells by TLRs, NLRs, and other pathogen-sensing receptor systems is the initiation of a wide range of

Chapter 2 HELICASE PATHWAYS

dsRNA RIGI

MAVS

dsRNA MDA5 FADD

TBK1

mitochondria RIP1

IRF3

IFNβ

IRF7

Nemo NFκB

IFNα

Inflammatory cytokines Nucleus

Figure 2.3 Helicase proteins induce early response and activating cytokines by recognition of dsRNA.

inflammatory molecules that, if not properly controlled, could lead to detrimental pathogenic responses. The focus for researchers and clinicians has been centered on the role that pattern recognition receptors play in the initiation of immune responses. However, these mechanisms can also swing the opposite way by promoting inflammation that causes tissue pathology. Two important activation systems that are strongly upregulated by PRRs are the type I IFN (IRF-mediated) and early response cytokine (NFkB-mediated) cascades. Both of these systems have a strong impact on the intensity and direction of the inflammatory responses through their ability to drive chemokine production. In addition to the cytokine cascades that lead to increased levels of these chemotactic molecules, the PRR systems directly regulate the chemokine expression, as many of the chemokine genes have either or both NFkB and/or IRF transcription factor binding sites in their promoter regions. Thus, a local inflammatory response can quickly become amplified and spread the inflammatory damage to neighboring, uninvolved areas. This response is greatly enhanced and perpetuated in more persistent pathogenic insults or with nonpathogenic stimuli that cannot be cleared, such is the case with silica.

Regulation of Acute Inflammatory Responses The most successful therapy to date for controlling inflammation has been the use of steroidal compounds that nonspecifically inhibit the production of many inflammatory cytokines. The continued dependence on this strategy, although often effective, demonstrates our lack of complete understanding of the mechanisms that control inflammatory responses. A number of well-described regulators may be suited for management of acute inflammatory responses.


Several anti-inflammatory mediators have been investigated, including IL-10, TGFb, IL-1 receptor antagonist (IL-1ra), as well as IL-4 and IL-13 [91–93]. Perhaps the most attractive anti-inflammatory cytokine with broadspectrum activity is IL-10. IL-10 is predominantly produced by macrophage populations, Th2-type lymphocytes, and B-cells, but can be produced by airway epithelial cells and by several types of tumor cell populations. The function of IL-10 appears to be important during normal physiologic events, as IL-10 gene knockout mice develop lethal inflammatory bowl dysfunction [94]. The importance of this cytokine has been demonstrated in models of endotoxemia and sepsis that neutralized IL-10 during the acute phase and led to increased lethality. In addition, administration of IL-10 to mice protects them from a lethal endotoxin challenge [95,96]. These latter observations can be attributed to the ability of IL-10 to downregulate multiple inflammatory cytokines, including TNF, IL-1, IL-6, IFN-g, expression of adhesion molecules, and production of nitric oxide. The downregulation of the inflammatory cytokine mediators by IL-10 therapy suggest an extremely potent anti-inflammatory agent that might be used for intervention of inflammationinduced injury. The ability of IL-10 to act as a potent anti-inflammatory cytokine has been shown in other disease states, such as in transplantation responses. However, in severe acute inflammatory diseases, such as sepsis, IL-10 also appears to have a role in promoting secondary or opportunistic infections due to its inhibitory activity [97,98]. IL-10 may also have a role in promoting end-stage disease if not properly regulated. Thus, its role as a therapeutic has been questioned. Other cytokines also function to suppress the inflammatory response. Transforming growth factor beta (TGFb) has antiproliferative effects in macrophages and lymphocytes, downregulates cytokine production, and inhibits endotoxin-induced inflammation [99]. In TGFb gene knockout mice, a progressive inflammatory response was observed early in neonatal development (day 14 after birth) throughout the body including heart, lung, salivary glands, and in virtually every organ at later time points. Thus, TGFb, like IL-10, plays a critical role in homeostatic regulation of inflammatory responses within the body. However, the use of this cytokine as a therapeutic must be viewed very cautiously as TGFb may promote fibrogenic outcomes and can skew the T-cell response toward a Treg or Th17 phenotype. In addition, the overexpression of TGFb has demonstrated enhanced inflammatory responses during endotoxemia [100,101]. Therefore, the therapeutic potential for this cytokine is very limited, if not nonexistent. Another cytokine which has demonstrated anti-inflammatory functions is IL-4. IL-4 is a member of the Th2-type cytokine family and has the ability to downregulate the production of inflammatory cytokines from macrophages. However, like TGFb, IL-4 has a number of alternate functions that should be viewed carefully, including upregulation of VCAM-1, IgE antibody isotype switching, Th2 cell skewing, and fibroblast activation. IL-4 has been 31

Part I


shown to play an important role in the progression of pulmonary granulomatous responses, in allergic airway eosinophilia, and in proliferation and collagen-gene expression in pulmonary fibroblast populations [102,103]. The use of either TGFb or IL-4 as a therapeutic anti-inflammatory agent will likely not be considered.

CHRONIC INFLAMMATION AND ACQUIRED IMMUNE RESPONSES Perhaps one of the most difficult and important aspects of disease pathogenesis to regulate is when and how to turn off an immune/inflammatory response. Clearly, pathogen clearance is a primary focus for our immune system, and leukocyte accumulation and activation are a critical event that must be coordinated with the continued presence of pathogens. PRR activation is a critical recognition system that not only activates important cytokine and chemokine pathways for increasing leukocyte function, but also initiates critical antigen presentation cell (APC) functions to optimize lymphocyte activation for pathogen clearance. However, uncontrolled or inefficient immune responses can lead to continual inflammatory cell recruitment and tissue damage that, if persistent and unregulated, can result in organ dysfunction. There are numerous pathogen- and non-pathogenrelated diseases that have been classically regarded as being caused by chronic inflammation, including rheumatoid arthritis (RA), chronic obstructive pulmonary disease (COPD), asthma, mycobacterial diseases, multiple sclerosis (MS), and viral hepatitis, among others. However, more recently additional diseases that have not been traditionally grouped with those associated with chronic inflammation have now been recognized to have defects in regulation of inflammation. These disease states include atherosclerosis, numerous obesity-related diseases, as well as various cancers. Persistent inflammatory mediators can be induced by an antigenic or pathogenic stimulus, such as in the case of allergic, bacteria or viral responses, or

chronic inflammation may be driven by nonantigenic stimuli that are persistent and cannot be effectively cleared, such as in the case of silicosis. In addition to the persistence of the inflammatory response during chronic inflammatory disorders, there is also a shift in the cellular composition of the leukocyte populations that accumulate. While neutrophils and macrophages may continue to be the end-stage effector cells that mediate the damage, a significant component of the inflammatory responses now comprises lymphocyte infiltration. The presence of activated T- and B-lymphocytes likely indicates the presence of a persistent antigen that induces cell-mediated and humoral immune responses. It is critical to regulate T-lymphocytes since they are central to the activation and regulation of the acquired immune response, as well as the intensity of PMN and macrophage activation.

T-Lymphocyte Regulation of Chronic Inflammation The nature, duration, and intensity of episodes of chronic inflammatory events are largely determined by the presence and persistence of antigen that is recognized and cleared by acquired immune responses. Thus, the regulation of T-cells is central to the outcome of the inflammatory/immune responses and is mediated through a combination of cytokine environment and transcription factor regulation (Figure 2.4). When a pathogenic insult is encountered, the most effective immune response is a cell-mediated Th1-type response, which is induced by IL-12 with Stat4 activation and characterized by IFN production along with T-bet transcription factor expression [104]. However, long term this immune response can be devastating to the host, as unregulated it can rapidly destroy local tissue and organ function. Thus, the immune response must be modulated and begin to shift to a less harmful response for the tissue, which in T-cells is regulated by IL-4 production and STAT6 activation leading to GATA3 transcription factor expression. While this shift in responses does not represent a sudden switch, rather

Cytokine Mileau Dendritic cell

IL-12

IL-4 CD4+ T cell

TGFβ IL-6 TGFβ

Transcription Factor IFNγ IL-1 IL-4 IL-5 IL-13

T-bet

TH1

GATA3

TH2

RORγ+

TH 17

IL-17 IL-21 IL-22

FoxP3

T Reg

IL-10 TGFβ

Figure 2.4 The cytokine environment during antigen presentation controls T-cell differentiation by regulation of specific transcription factor activation. 32

Chapter 2

a gradual transition, the long-term consequences of chronic inflammation are often a result of a combined cytokine phenotype that leads to altered macrophage function and continual tissue damage. One of the aspects of the Th2 response that can be detrimental is the shift toward tissue remodeling designed to promote both restoration of function and host protection. Clearly, regulation of both the Th1- and Th2-type immune responses is central to resolving inflammatory responses and limiting damage once the inciting agent has been removed. An area that has held a significant level of interest has been the differentiation of T regulatory (Treg) cells during the development of chronic responses [105–107]. This cell subset has been divided into several subpopulations, including natural Treg cells and inducible Treg cells (iTreg). Natural Treg cells develop in the thymus and are essential for control of autoimmune diseases, whereas inducible iTreg cells develop following an antigen-specific activation event and appear to function to modulate an ongoing response. In addition, Treg cells can also be subdivided based on the mechanism of inhibition that they use, such as production of IL-10 and/or TGFb or use of CTLA-4. Some common ground has been forged in these cell populations based on the expression of Foxp3 transcription factor, although apparently not all Treg populations express this protein [108]. Support for the importance of Foxp3þ Treg cells comes from studies with mice missing this factor and in humans who have mutations in FOXP3, both of which develop multiorgan autoimmune diseases [109,110]. Thus, no matter the nomenclature, this cell population appears to be centrally important for the regulation of immune responses, and defects in this pathway may lead to chronic disease phenotypes. More recent investigations have further enhanced our understanding of the role of T-cell subsets in chronic disease with the explosion of data that has described a newer subset of T-cells (Th17) that characteristically produce IL-17 [111]. This subset of T-cells has only recently begun to be understood during chronic inflammatory diseases. IL-17 producing cells were first described as an important component of antibacterial immunity. Subsequently, the Th17 subset has been identified as having a central role in the severity of autoimmune responses, in cancer, in transplantation immunology, as well as in infectious diseases [111,112]. Interestingly, the critical aspect of whether T-cells will differentiate into a Th17 cell depends on the expression RORgt transcription factor [113]. Similar to the Treg cells, the differentiation of these cells depends on exposure to TGFb, but is additionally dependent on IL-6 or other STAT3 signals along with RORgt. The differentiation of Th17 cells also appears to be enhanced by IL-23, an IL-12 family cytokine that is upregulated in APC populations upon TLR signaling. Thus, in a coordinated effort to better remove an infectious pathogen, utilization of a combination of Th1 and Th17 responses appears to be the most detrimental trigger for exacerbating a chronic autoimmune disease. While it is not yet clear, the relationship between Treg and Th17


development and regulation appears to be closely controlled, perhaps dependent on whether IL-6 is present in the inflammatory environment along with TGFb [114–116]. Thus, the differentiation of CD4þ T helper cell subsets clearly depends on the immune environment that the cells find themselves. Rather than clearly differentiated cell subsets, T-cell activation represents a continuum of activation depending on the immune environment and pathogenic cues that the T-cells receive from APC when being activated and differentiating. As outlined in Figure 2.4, T-cell activation and cytokine phenotypes depend on the distinct transcription factor expressed for the activation of the particular T-cell subset. Clearly, these subsets and the cytokines that they produce dictate the outcome of a chronic response not only based on the cascade of mediators that they induce but also by the leukocyte subsets that are used as end-stage effectors during the responses.

B-Lymphocyte and Antibody Responses The pathogenic role of the humoral immune system has been implicated in a number of chronic disease phenotypes, including allergic responses, autoimmune diseases, arthritis, vasculitis, and any other disease where immune complexes are deposited into tissues [117– 120]. Antibodies produced by B-lymphocytes are a primary goal of the acquired immune response to combat infectious organisms at mucosal surfaces, in the circulation, and within tissues of the host. To be effective, antibodies need to have the ability to bind to specific antigens on the surface of pathogen and through their Fc portion to facilitate phagocytosis by macrophages and PMNs for clearance and complement fixation for targeted killing of the microorganism by the lytic pathway. However, these features can also lead to detrimental aspects and tissue damage due to inappropriate activation of inflammatory effector cell populations. In particular, one of the more pathogenic side effects of antibody effector function is the inappropriate activation of PMNs leading to release of their granular products and destroying host tissue. This is often a problem in autoimmune diseases such as systemic lupus (SLE) and rheumatoid arthritis, where a wide array of antibodies directed against self-antigens is formed. In SLE, immune complexes form and are often deposited in the skin, driving a local inflammatory response and vasculitis. Even more serious for the host is the deposition of immune complexes in the kidney, leading to glomerulonephritis and possible severe kidney disease [118,119]. Autoantibodies directed against tissue antigens can also induce damage due to FcR cross-linking on phagocytic cells including PMN, macrophages, and NK cells. This is often a central mechanism for initiating local inflammation and damage within autoimmune responses, such as with joints of RA patients with autoantibodies directed against matrix proteins. The induction of allergic responses in developed nations has been steadily increasing for the past three decades. Incidence of food, airborne, and industrial 33

Part I


allergies has a significant impact on the development of chronic diseases in the skin, lung, and gut, including atopic dermatitis, inflammatory bowel disease (IBD), and asthma. The production of IgE leading to mast cell and basophil activation is the central mechanism that regulates the induction of these diseases [121]. While it continues to be controversial whether there is an increase in mast cell numbers during the development of these diseases, it is clear that their local activation by IgE is a key initiating mechanism for the induction of the response. As the antibody isotype produced by the B-cell is governed by the T-lymphocyte response and production of specific cytokines, determining mechanisms that regulate T-cells during allergic diseases has been central to research in these fields. In particular, IL-4 production from T-lymphocytes is key to isotype switching to IgE in B-cells [122–124]. More recently, pharmaceutical focus on inhibiting IgE-mediated responses has centered on directly clearing IgE from the host using an anti-IgE antibody as a therapeutic [125]. The use of this reagent appears not only to clear IgE from the system prior to its interaction with the FceR on mast cells and basophils, but also may target the IgE-producing B-cells and kill them. Thus, this strategy may help alleviate the initial activation and chronic mast cell and basophil-mediated inflammatory responses. This treatment appears to be especially efficacious in patients with severe food allergies who are at risk for anaphylactic responses.

Exacerbation of Chronic Diseases While much of the research in this field has centered on understanding the factors involved and defining targets for therapy of chronic disease, less research has focused on what exacerbates and/or extends the severity of these diseases. This becomes much more difficult when the mechanisms and causative agents that initiate the chronic response are not clearly identified or may be heterogeneous within the patient population. No matter the disease, it appears that a common initiating factor for the exacerbation is an infectious stimulus, bacterial or viral. In fact, in diseases such as multiple sclerosis (MS) or SLE, a number of viruses and bacteria have been implicated as the causative agents for the initiation and/ or exacerbation of the responses [126–128]. The reality is that any stimulus that initiates a strong inflammatory signal has the ability to break the established maintenance and reinitiate the chronic response in individuals with an underlying disease. This is most often manifested in diseases where an antigenic response is the underlying cause of the chronic disease and the antigen is environmental or host available, such as allergic asthma or autoimmunity. The strong activation of immune cells locally within the affected tissue would provide the reactivation of a well-regulated immune response. The mediators that are upregulated, IL-12 and/or IL-23, in DC might dictate the type of effector response that is initiated, such as Th1 and/or Th17, respectively. A common activation pathway for these responses is the use of molecules that can quickly and effectively recognize pathogens, such as the TLR family members. 34

While these molecules are clearly expressed on immune cell populations and facilitate an effective host response, it may be their inappropriate expression on nonimmune cells, such as epithelial cells and fibroblasts, which presents the host with the most detrimental response. The expression of TLRs on nonimmune cells within chronic lesions would predispose these cells to strong infectious stimuli that initiate (or reinitiate) an inflammatory response through the activation and expression of cytokines and inflammatory mediators. While it has not been clearly established, a number of studies have indicated that TLR expression on nonimmune cells in chronic lesions is upregulated and would presumably predispose these tissues to hyperstimulation during infectious insults. This alone could cause the exacerbation of a chronic response without any other specific stimuli. The continual reactivation of tissue inflammation with infectious insults, such as in the lung and gut, could provide the mechanism for tissue damage and potentially remodeling that over time could lead to gradual but continuous organ dysfunction. The addition of other antigenic stimuli, such as an auto-antigen, would further enhance the damaging responses and lead to more severe and accelerated disease phenotypes along with end-stage disease that often accompanies tissue remodeling and ineffective repair.

TISSUE REMODELING DURING ACUTE AND CHRONIC INFLAMMATORY DISEASE Repair of damaged tissues is a fundamental feature of biological systems and properly regulated has little harmful effect on normal organ function. Abnormal healing and repair, however, can lead to severe problems in the function of organs, and in some cases the perpetuation of the remodeling and repair can result in end-stage disease. Damage to tissues can result from various acute or chronic stimuli, including infections, autoimmune reactions, or mechanical injury. In some cases acute inflammatory reactions, such as ARDS in septic patients, can result in a rapid and devastating disorder that is complicated by significant lung fibrosis and eventual dysfunction. However, more common chronic inflammatory disorders of organ systems (including pulmonary fibrosis, systemic sclerosis, liver cirrhosis, cardiovascular disease, progressive kidney disease) and the joints (such as rheumatoid arthritis and osteoarthritis) are a major cause of morbidity and mortality and enormous burden on healthcare systems. A common feature of these diseases is the destruction and remodeling of extracellular matrix (ECM) that has a significant effect on tissue structure and function [129]. A delicate balance between deposition of ECM by myofibroblasts and ECM degradation by tissue leukocytes determines the tissue restructuring during repair processes, and proper function versus development of pathologic scarring. Chronic inflammation, tissue necrosis, and infection lead to persistent myofibroblast activation and excessive deposition of ECM

Chapter 2

(including collagen type I, collagen type III, fibronectin, elastin, proteoglycans, and lamin [130–136]), which promote formation of a permanent fibrotic scar. Most chronic fibrotic disorders have a persistent irritant that stimulates production of proteolytic enzymes, growth factors, fibrogenic cytokines, and chemokines. Together, they orchestrate excessive deposition of connective tissue and a progressive destruction of normal tissue organization and function (Figure 2.5). A mechanism that counteracts deposition of ECM and formation of fibrotic foci is activation of matrix metalloproteinases (MMPs), which represent a class of catalytic enzymes that degrade various components of ECM. All MMPs are composed of shared molecules but have different primary structures (reviewed in [137]). MMPs are produced by cells in latent form and need to be activated by removal of a propeptide from the active site. Some MMPs are constitutive or homeostatic (MMP-2) and expressed in most cells under normal conditions. Others are inducible (MMP-9) or inflammatory. Activities of MMPs are always dependent on a balance between proteinases and natural inhibitors (TIMPs, tissue inhibitors of metalloproteinases) [137]. It may be that the upregulation of TIMPs during chronic disease can be more detrimental for developing severe fibrosis than downregulation of MMPs. Overall, the maintenance of ECM deposition may depend on the active removal and proper arrangement of the components allowing proper restructuring of the tissue and basement membrane.

Profibrogenic Cytokines and Growth Factors Involved in Fibrotic Tissue Remodeling Alterations in the balance of cytokines can lead to pathological changes, abnormal tissue repair, and tissue fibrosis. The most well-studied cytokines involved in these processes include transforming growth factor b (TGFb), tumor necrosis factor-a (TNFa), platelet-derived growth


factor (PDGF), basic fibroblasts growth factor (BFGF), monocyte chemoattractant protein-1 (MCP-1), macrophage inflammatory protein-1-a (MIP-1-a), and interleukin-1 (IL-1), IL-13, and IL-8 [138–143].

TGFb TGFb is one of the most well-studied profibrotic cytokines. Upregulation of TGFb1 has been associated with pathological fibrotic processes in many organs (Table 2.1), such as chronic obstructive pulmonary disease [144], cataract formation [145], systemic sclerosis [146], renal fibrosis [133,147], heart failure [140,148–152], and many others [133,134,136, 153–162]. The TGFb family represents a group of multifunctional cytokines that includes at least five known isoforms [133,134,136,143,153–162], three of which are expressed by mammalian cells (TGFb1–3). TGFb-induced effects are mainly mediated by signaling via the TGFb receptors. TGFb isoforms are known to induce the expression of ECM proteins (such as collagen I, collagen III, and collagen V; fibronectin; and a number of glycoproteins and proteoglycans normally associated with development) in mesenchymal cells, and to stimulate the production of protease inhibitors that prevent enzymatic breakdown of the ECM. In addition, some ECM proteins (such as fibronectin) are known to be chemoattractants for fibroblasts and are released in increased amounts by fibroblasts and epithelial cells in response to TGFb [162]. Elevated TGFb expression in affected organs correlates with abnormal connective tissue deposition observed during Table 2.1

TGFb Contributes to Fibrosis of These Diseases by Excessive Matrix Accumulation

Organ

Disease

Eye

Graves ophthalmopathy Conjunctival cicatrization Pulmonary fibrosis Pulmonary sarcoids Cardiac fibrosis, cardiomyopathy Cirrhosis Primary biliary cirrhosis Glomerulosclerosis Interstitial fibrosis Chronic or fibrosing pancreatitis Hypertrophic scar Keloids Scleroderma Dupuytren’s contracture Endometriosis Sclerosing peritonitis Postsurgical adhesion Retroperitoneal fibrosis Renal osteodystrophy Polymyositis, dermatomyositis Muscular dystrophy Eosinophilia-myalgia Myelofibrosis Carcinoid

Lung Heart Liver Kidney Pancreas Skin Subcutaneous tissue Endometrium Peritoneum Retroperitoneum Bone Muscle

Figure 2.5 The persistent production of cytokines, fibrogenic growth factors, and proteolytic enzymes can result in tissue remodeling and eventual organ dysfunction.

Bone marrow Neuroendocrine

35

Part I


the beginning of fibrotic diseases [143,163]. For example, fibroblasts derived from lungs of idiopathic pulmonary fibrosis patients show an enhanced synthetic activity in response to growth factors, whereas normal fibroblasts show a predominantly proliferative response [164]. Thus, while TGFb is necessary for normal repair processes, its overexpression plays a pivotal role in deposition of ECM and end-stage disease.

TNFa Another cytokine that has been often linked to chronic remodeling diseases is tumor necrosis factor alpha. TNFa is a well-known early response cytokine that is key in initiating responses and is rapidly expressed in response to many kinds of stress (mechanical injury, burns, irradiation, viruses, bacteria) [165,166]. However, the role of TNFa is much more complex than simply serving as a trigger of cytokine cascades. TNFa is a proinflammatory mediator that is involved in the extracellular matrix network, as shown in the healing infarct and collagen synthesis by cardiac fibroblasts [167]. The pathologic events in asthma also correlate with increased TNFa production both in vivo and in vitro in cellular isolates from asthmatic patients. The most convincing evidence that TNFa plays a role in pathophysiology of asthma was observed in normal subjects receiving inhaled recombinant TNFa [168]. These studies demonstrate a significant increase in airway hyper-responsiveness and decreases in FEV1 within those subjects receiving TNFa compared to the placebo group linked to its ability to change extracellular matrix and upregulate pathways specific for leukocyte recruitment. A direct role of TNFa in fibrogenesis was recently demonstrated using human epithelioid dermal microvascular endothelial cell cultures. Exposure of those cells to TNFa for 20 days induced permanent transformation into myofibroblasts. Similar transformation events following chronic inflammatory stimulation in vivo may explain one source of myofibroblasts in skin fibrogenesis [169].

Table 2.2

Rheumatoid arthritis (RA) represents a chronic disease that highlights the importance of TNFa. TNFadependent cytokine cascades were identified in the in vitro culture of synovium from joints of patients with RA and led to studies of TNFa blockage in experimental animal models of RA. Using a collagen-induced human RA model in DBA/J mice, researchers showed that anti-TNF antibodies ameliorate arthritis and reduce joint damage [170,171]. This led to the use of TNF blockade in human RA. With the success of antiTNF treatment in RA, this approach was tested in a number of other chronic disorders [165], including inflammatory bowel disease, asthma, and graft versus host (GVD) during bone marrow transplantation. Successful targeting of TNF has been observed in a number of chronic diseases where anti-TNF therapy has been approved for use and is now also being examined in numerous additional inflammatory, infectious, and neoplastic diseases (Table 2.2). However, anti-TNF therapy is not appropriate in all diseases, as there have been a number of failed clinical trials, including those using anti-TNF treatment for MS and congestive heart failure. In addition, a potential side effect of using anti-TNF therapy is the increased susceptibility to infectious organisms.

IL-13 While the profile of cytokines expressed during a specific response can be classified in several ways, for many chronic diseases a Th2-type immune environment accompanies a profibrotic response. In particular, IL-13 expression is often linked to the progression of end-stage disease phenotypes, both in animal models and in human diseases [102,172]. The initial studies examining IL-13 in fibrosis demonstrated that by neutralization of the IL-13 in vivo resulted in a significant reduction in remodeling and end-stage disease. These findings were repeated using IL-13 deficient mice and followed up by demonstrating that although IL-13 does not directly cause myofibroblast conversion, it does enhance ECM production by

Targeting of TNFa in Chronic Inflammatory Disorders

Approved for Use

Not Completed Trials and Pilot Studies

Clinical Failures

-

-

-

Rheumatoid arthritis Juvenile rheumatoid arthritis Crohn’s disease Psoriatic arthritis Ankylosing spondylitis Psoriasis

36

Ulcerative colitis Behçet syndrome Vasculitis (small and large vessel) Glomerulonephritis Systemic lupus erythematosus Joint prosthesis loosening Hepatitis Polymyositis Systemic sclerosis Amyloidosis Sarcoidosis Ovarian cancer Steroid-resistant asthma Refractory uveitis

Congestive heart failure Multiple sclerosis Chronic obstructive pulmonary disease Sjo¨gren syndrome Wegener granulomatosis

Chapter 2

myofibroblasts. Similar findings have been made in other organ systems, especially in lung and liver remodeling in infectious and allergic diseases. Convincingly, the overexpression of IL-13 in the lung, by itself, induced a significant remodeling response [173]. However, the remodeling of the lung was accompanied by a substantial eosinophil accumulation. The role of the eosinophil was crucial, as when IL-13 transgenic mice were bred with CCR3–/-– mice, the fibrotic responses were nearly abrogated, correlating to an absence of eosinophil accumulation [174]. These studies further suggested that this was due to the production of TGFb by the eosinophils. This conclusion is supported by numerous other studies that have indicated that eosinophils can facilitate remodeling via their ability to produce TGFb. Thus, a complex cascade is likely to be necessary to initiate and maintain long-term fibrotic responses and the reason for the relatively rare occurrence of end-stage disease in most patient populations.

IL-10 One of the most surprising contributors to tissue remodeling may be IL-10, since it has been demonstrated to exert an overall suppressive effect on most cytokines, including TNF and IL-13. Thus, initially it was envisioned that IL-10 would be very useful in chronic diseases like rheumatoid arthritis, inflammatory bowel disease, and liver cirrhosis [175–177]. This was supported by studies using rIL-10 in experimental models during the induction stage prior to or during the initiation of the fibrotic responses. However, IL-10 also regulates ECM metabolism. The role for IL-10 may be most devastating in later stages of disease where it inhibits the production of MMPs that would help break down excessive ECM deposition and induce TIMPs that would promote the further blockade of ECM degradation [178]. Therefore, the use of rIL-10 in established disease might have the undesirable effect of altering and worsening the remodeling responses. In fact, using an overexpression model in the lung led to the overproduction of collagen and increased remodeling, and was at least coincident with increased IL-13 production, even without an inciting agent [179]. Thus, the role of IL-10 during fibrotic diseases likely depends on the nature and cause of the responses as well as the stage of the disease when the function of IL-10 is investigated.

REFERENCES 1. Zarbock A, Ley K. Mechanisms and consequences of neutrophil interaction with the endothelium. Am J Pathol. 2008;172:1–7. 2. Etzioni A. Leukocyte adhesion deficiencies: Molecular basis, clinical findings, and therapeutic options. Adv Exp Med Biol. 2007; 601:51–60. 3. Smith CW. Possible steps involved in the transition to stationary adhesion of rolling neutrophils: A brief review. Microcirculation. 2000;7:385–394. 4. McEver RP, Cummings RD. Role of PSGL-1 binding to selectins in leukocyte recruitment. J Clin Invest. 1997;100:S97–S103.

Acute and Chronic Inflammation Induces Disease Pathogenesis 5. Alon R, Grabovsky V, Feigelson S. Chemokine induction of integrin adhesiveness on rolling and arrested leukocytes local signaling events or global stepwise activation? Microcirculation. 2003;10:297–311. 6. DiVietro JA, Smith MJ, Smith BR, et al. Immobilized IL-8 triggers progressive activation of neutrophils rolling in vitro on P-selectin and intercellular adhesion molecule-1. J Immunol. 2001;167: 4017–4025. 7. Luscinskas FW, Gerszten RE, Garcia-Zepeda EA, et al. C-C and C-X-C chemokines trigger firm adhesion of monocytes to vascular endothelium under flow conditions. Ann NY Acad Sci. 2000; 902:288–293. 8. Johnston B, Butcher EC. Chemokines in rapid leukocyte adhesion triggering and migration. Semin Immunol. 2002;14:83–92. 9. Laudanna C, Kim JY, Constantin G, et al. Rapid leukocyte integrin activation by chemokines. Immunol Rev. 2002;186:37–46. 10. Ley K. Arrest chemokines. Microcirculation. 2003;10:289–295. 11. Szabo MC, Butcher EC, McIntyre BW, et al. RANTES stimulation of T lymphocyte adhesion and activation: Role for LFA-1 and ICAM-3. Eur J Immunol. 1997;27:1061–1068. 12. Kishimoto TK, Jutila MA, Berg EL, et al. Neutrophil Mac-1 and MEL-14 adhesion proteins inversely regulated by chemotactic factors. Science. 1989;245:1238–1241. 13. Sperandio M. Selectins and glycosyltransferases in leukocyte rolling in vivo. FEBS J. 2006;273:4377–4389. 14. Furie B, Furie BC. Role of platelet P-selectin and microparticle PSGL-1 in thrombus formation. Trends Mol Med. 2004;10:171–178. 15. Yang J, Furie BC, Furie B. The biology of P-selectin glycoprotein ligand-1: Its role as a selectin counterreceptor in leukocyteendothelial and leukocyte-platelet interaction. Thromb Haemost. 1999;81:1–7. 16. Schymeinsky J, Then C, Sindrilaru A, et al. Syk-mediated translocation of PI3Kdelta to the leading edge controls lamellipodium formation and migration of leukocytes. PLoS ONE. 2007; 2:e1132. 17. Bruyninckx WJ, Comerford KM, Lawrence DW, et al. Phosphoinositide 3-kinase modulation of beta(3)-integrin represents an endogenous “braking” mechanism during neutrophil transmatrix migration. Blood. 2001;97:3251–3258. 18. Willeke T, Schymeinsky J, Prange P, et al. A role for Syk-kinase in the control of the binding cycle of the beta2 integrins (CD11/ CD18) in human polymorphonuclear neutrophils. J Leukoc Biol. 2003;74:260–269. 19. Mocsai A, Zhou M, Meng F, et al. Syk is required for integrin signaling in neutrophils. Immunity. 2002;16:547–558. 20. Siddiqui RA, English D. Phosphatidylinositol 30 -kinase-mediated calcium mobilization regulates chemotaxis in phosphatidic acid-stimulated human neutrophils. Biochim Biophys Acta. 2000; 1483:161–173. 21. Nagamatsu H, Tsuzuki Y, Matsuzaki K, et al. Regulation of T-lymphocyte trafficking by ICAM-1, MAdCAM-1, and CCR7 in microcirculation of appendicular and intestinal lymphoid tissues. Microcirculation. 2004;11:493–502. 22. Abitorabi MA, Mackay CR, Jerome EH, et al. Differential expression of homing molecules on recirculating lymphocytes from sheep gut, peripheral, and lung lymph. J Immunol. 1996;156: 3111–3117. 23. Hamann A, Andrew DP, Jablonski-Westrich D, et al. Role of alpha 4-integrins in lymphocyte homing to mucosal tissues in vivo. J Immunol. 1994;152:3282–3293. 24. Laschinger M, Engelhardt B. Interaction of alpha4-integrin with VCAM-1 is involved in adhesion of encephalitogenic T cell blasts to brain endothelium but not in their transendothelial migration in vitro. J Neuroimmunol. 2000;102:32–43. 25. Male D, Rahman J, Pryce G, et al. Lymphocyte migration into the CNS modelled in vitro: Roles of LFA-1, ICAM-1 and VLA-4. Immunology. 1994;81:366–372. 26. Meerschaert J, Furie MB. Monocytes use either CD11/CD18 or VLA-4 to migrate across human endothelium in vitro. J Immunol. 1994;152:1915–1926. 27. Chuluyan HE, Issekutz AC. VLA-4 integrin can mediate CD11/ CD18-independent transendothelial migration of human monocytes. J Clin Invest. 1993;92:2768–2777. 28. Hakkert BC, Kuijpers TW, Leeuwenberg JF, et al. Neutrophil and monocyte adherence to and migration across monolayers

37

Part I

29. 30. 31. 32. 33.

34.

35. 36. 37.

38.

39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51.

52. 53.


of cytokine-activated endothelial cells: The contribution of CD18, ELAM-1, and VLA-4. Blood. 1991;78:2721–2726. Alon R, Dustin ML. Force as a facilitator of integrin conformational changes during leukocyte arrest on blood vessels and antigen-presenting cells. Immunity. 2007;26:17–27. Muller WA. The role of PECAM-1 (CD31) in leukocyte emigration: Studies in vitro and in vivo. J Leukoc Biol. 1995;57:523–528. DeLisser HM, Newman PJ, Albelda SM. Molecular and functional aspects of PECAM-1/CD31. Immunol Today. 1994;15:490–495. Naik MU, Naik UP. Junctional adhesion molecule-A-induced endothelial cell migration on vitronectin is integrin alpha v beta 3 specific. J Cell Sci. 2006;119:490–499. Corada M, Chimenti S, Cera MR, et al. Junctional adhesion molecule-A-deficient polymorphonuclear cells show reduced diapedesis in peritonitis and heart ischemia-reperfusion injury. Proc Natl Acad Sci USA. 2005;102:10634–10639. Woodfin A, Reichel CA, Khandoga A, et al. JAM-A mediates neutrophil transmigration in a stimulus-specific manner in vivo: Evidence for sequential roles for JAM-A and PECAM-1 in neutrophil transmigration. Blood. 2007;110:1848–1856. Nourshargh S, Krombach F, Dejana E. The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues. J Leukoc Biol. 2006;80:714–718. Dvorak AM, Feng D. The vesiculo-vacuolar organelle (VVO). A new endothelial cell permeability organelle. J Histochem Cytochem. 2001;49:419–432. Dvorak AM, Kohn S, Morgan ES, et al. The vesiculo-vacuolar organelle (VVO): A distinct endothelial cell structure that provides a transcellular pathway for macromolecular extravasation. J Leukoc Biol. 1996;59:100–115. Feng D, Nagy JA, Dvorak HF, et al. Ultrastructural studies define soluble macromolecular, particulate, and cellular transendothelial cell pathways in venules, lymphatic vessels, and tumor-associated microvessels in man and animals. Microsc Res Tech. 2002;57:289–326. Marom B, Rahat MA, Lahat N, et al. Native and fragmented fibronectin oppositely modulate monocyte secretion of MMP-9. J Leukoc Biol. 2007;81:1466–1476. Hu Y, Ivashkiv LB. Costimulation of chemokine receptor signaling by matrix metalloproteinase-9 mediates enhanced migration of IFN-alpha dendritic cells. J Immunol. 2006;176:6022–6033. Schor H, Vaday GG, Lider O. Modulation of leukocyte behavior by an inflamed extracellular matrix. Dev Immunol. 2000;7:227–238. Guo RF, Ward PA. Role of C5a in inflammatory responses. Annu Rev Immunol. 2005;23:821–852. Guo RF, Ward PA. Mediators and regulation of neutrophil accumulation in inflammatory responses in lung: Insights from the IgG immune complex model. Free Radic Biol Med. 2002;33:303–310. Allegretti M, Moriconi A, Beccari AR, et al. Targeting C5a: Recent advances in drug discovery. Curr Med Chem. 2005;12:217–236. Ricklin D, Lambris JD. Complement-targeted therapeutics. Nat Biotechnol. 2007;25:1265–1275. Osher E, Weisinger G, Limor R, et al. The 5 lipoxygenase system in the vasculature: Emerging role in health and disease. Mol Cell Endocrinol. 2006;252:201–206. Patarroyo M, Prieto J, Rincon J, et al. Leukocyte-cell adhesion: A molecular process fundamental in leukocyte physiology. Immunol Rev. 1990;114:67–108. Tager AM, Bromley SK, Medoff BD, et al. Leukotriene B4 receptor BLT1 mediates early effector T cell recruitment. Nature Immunol. 2003;4:982–990. Islam SA, Thomas SY, Hess C, et al. The Leukotriene B4 lipid chemoattractant receptor BLT1 defines antigen-primed T-cells in humans. Blood. 2006;107:444–453. Luster AD, Tager AM. T-cell trafficking in asthma: Lipid mediators grease the way. Nature Rev Immunol. 2004;4:711–724. Fregonese L, Silvestri M, Sabatini F, et al. Cysteinyl leukotrienes induce human eosinophil locomotion and adhesion molecule expression via a CysLT1 receptor-mediated mechanism. Clin Exp Allergy. 2002;32:745–750. Busse W, Kraft M. Cysteinyl leukotrienes in allergic inflammation: Strategic target for therapy. Chest. 2005;127:1312–1326. Rot A, Von Andrian UH. Chemokines in innate and adaptive host defense: Basic chemokinese grammar for immune cells. Annu Rev Immunol. 2004;22:891–928.

38

54. Kobayashi Y. Neutrophil infiltration and chemokines. Crit Rev Immunol. 2006;26:307–316. 55. Sanchez-Sanchez N, Riol-Blanco L, Rodriguez-Fernandez JL. The multiple personalities of the chemokine receptor CCR7 in dendritic cells. J Immunol. 2006;176:5153–5159. 56. Lombardi MS, Kavelaars A, Heijnen CJ. Role and modulation of G protein-coupled receptor signaling in inflammatory processes. Crit Rev Immunol. 2002;22:141–163. 57. Sotsios Y, Ward SG. Phosphoinositide 3-kinase: A key biochemical signal for cell migration in response to chemokines. Immunol Rev. 2000;177:217–235. 58. Chang JD, Sukhova GK, Libby P, et al. Deletion of the phosphoinositide 3-kinase p110gamma gene attenuates murine atherosclerosis. Proc Natl Acad Sci USA. 2007;104:8077–8082. 59. Reif K, Okkenhaug K, Sasaki T, et al. Cutting edge: Differential roles for phosphoinositide 3-kinases, p110 gamma and p110 delta, in lymphocyte chemotaxis and homing. J Immunol. 2004; 173:2236–2240. 60. Naccache PH, Levasseur S, Lachance G, et al. Stimulation of human neutrophils by chemotactic factors is associated with the activation of phosphatidylinositol 3-kinase gamma. J Biol Chem. 2000;275:23636–23641. 61. Comer FI, Parent CA. Phosphoinositides specify polarity during epithelial organ development. Cell. 2007;128:239–240. 62. Devreotes P, Janetopoulos C. Eukaryotic chemotaxis: Distinctions between directional sensing and polarization. J Biol Chem. 2003;278:20445–20448. 63. Wu Y, Hannigan MO, Kotlyarov A, et al. A requirement of MAPKAPK2 in the uropod localization of PTEN during FMLPinduced neutrophil chemotaxis. Biochem Biophys Res Commun. 2004;316:666–672. 64. Iijima M, Huang YE, Luo HR, et al. Novel mechanism of PTEN regulation by its phosphatidylinositol 4,5-bisphosphate binding motif is critical for chemotaxis. J Biol Chem. 2004;279:16606– 16613. 65. Merlot S, Firtel RA. Leading the way: Directional sensing through phosphatidylinositol 3-kinase and other signaling pathways. J Cell Sci. 2003;116:3471–3478. 66. Huang YE, Iijima M, Parent CA, et al. Receptor-mediated regulation of PI3Ks confines PI(3,4,5)P3 to the leading edge of chemotaxing cells. Mol Biol Cell. 2003;14:1913–1922. 67. Iijima M, Devreotes P. Tumor suppressor PTEN mediates sensing of chemoattractant gradients. Cell. 2002;109:599–610. 68. Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu Rev Immunol. 2003;21:335–376. 69. Akira S, Hemmi H. Recognition of pathogen-associated molecular patterns by TLR family. Immunol Lett. 2003;85:85–95. 70. Moynagh PN. TLR signalling and activation of IRFs: Revisiting old friends from the NF-kappaB pathway. Trends Immunol. 2005;26:469–476. 71. O’Neill LA. Signal transduction pathways activated by the IL-1 receptor/toll-like receptor superfamily. Curr Top Microbiol Immunol. 2002;270:47–61. 72. Beutler B, Jiang Z, Georgel P, et al. Genetic analysis of host resistance: Toll-like receptor signaling and immunity at large. Annu Rev Immunol. 2006;24:353–389. 73. Kurt-Jones EA, Popova L, Kwinn L, et al. Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nature Immunol. 2000;1:398–401. 74. Shi H, Kokoeva MV, Inouye K, et al. TLR4 links innate immunity and fatty acid-induced insulin resistance. J Clin Invest. 2006;116:3015–3025. 75. Colonna M. TLR pathways and IFN-regulatory factors: To each its own. Eur J Immunol. 2007;37:306–309. 76. Pasare C, Medzhitov R. Toll-like receptors: Linking innate and adaptive immunity. Adv Exp Med Biol. 2005;560:11–18. 77. Freche B, Reig N, van der Goot FG. The role of the inflammasome in cellular responses to toxins and bacterial effectors. Semin Immunopathol. 2007;29:249–260. 78. Lee MS, Kim YJ. Signaling pathways downstream of patternrecognition receptors and their cross talk. Annu Rev Biochem. 2007; 76:447–480. 79. Kufer TA, Sansonetti PJ. Sensing of bacteria. NOD a lonely job. Curr Opin Microbiol. 2007;10:62–69.

Chapter 2 80. Philpott DJ, Girardin SE. The role of toll-like receptors and Nod proteins in bacterial infection. Mol Immunol. 2004;41:1099–1108. 81. Kanneganti TD, Lamkanfi M, Nunez G. Intracellular NOD-like receptors in host defense and disease. Immunity. 2007;27: 549–559. 82. Park JH, Kim YG, Shaw M, et al. Nod1/RICK and TLR signaling regulate chemokine and antimicrobial innate immune responses in mesothelial cells. J Immunol. 2007;179:514–521. 83. de Haro C, Mendez R, Santoyo J. The eIF-2alpha kinases and the control of protein synthesis. FASEB J. 1996;10:1378–1387. 84. Wek RC. eIF-2 kinases: Regulators of general and gene-specific translation initiation. Trends Biochem Sci. 1994;19:491–496. 85. Jagus R, Gray MM. Proteins that interact with PKR. Biochimie. 1994;76:779–791. 86. Kaempfer R. RNA sensors: Novel regulators of gene expression. EMBO Rep. 2003;4:1043–1047. 87. Kato H, Takeuchi O, Sato S, et al. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature. 2006;441:101–105. 88. Yoneyama M, Kikuchi M, Natsukawa T, et al. The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses. Nature Immunol. 2004;5:730–737. 89. Seth RB, Sun L, Ea CK, et al. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell. 2005;122:669–682. 90. Seth RB, Sun L, Chen ZJ. Antiviral innate immunity pathways. Cell Res. 2006;16:141–147. 91. Bradley JR. TNF-mediated inflammatory disease. J Pathol. 2008;214:149–160. 92. Prud’homme GJ. Pathobiology of transforming growth factor beta in cancer, fibrosis and immunologic disease, and therapeutic considerations. Lab Invest. 2007;87:1077–1091. 93. Christodoulou C, Choy EH. Joint inflammation and cytokine inhibition in rheumatoid arthritis. Clin Exp Med. 2006;6:13–19. 94. Davidson NJ, Leach MW, Fort MM, et al. T helper cell 1-type CD4þ T cells, but not B cells, mediate colitis in interleukin 10-deficient mice. J Exp Med. 1996;184:241–251. 95. Howard M, Muchamuel T, Andrade S, et al. Interleukin 10 protects mice from lethal endotoxemia. J Exp Med. 1993; 177: 1205–1208. 96. Gerard C, Bruyns C, Marchant A, et al. Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J Exp Med. 1993;177:547–550. 97. Steinhauser ML, Hogaboam CM, Kunkel SL, et al. IL-10 is a major mediator of sepsis- induced impairment in lung antibacterial host defense. J Immunol. 1999;162:392–399. 98. Greenberger MJ, Strieter RM, Kunkel SL, et al. Neutralization of IL-10 increases survival in a murine model of Klebsiella pneumonia. J Immunol. 1995;155:722–729. 99. Karres I, Kremer JP, Steckholzer U, et al. Transforming growth factor-beta 1 inhibits synthesis of cytokines in endotoxin-stimulated human whole blood. Arch Surg. 1996;131:1310–1316. 100. Garcia-Lazaro JF, Thieringer F, Luth S, et al. Hepatic overexpression of TGF-beta1 promotes LPS-induced inflammatory cytokine secretion by liver cells and endotoxemic shock. Immunol Lett. 2005;101:217–222. 101. Vodovotz Y, Kopp JB, Takeguchi H, et al. Increased mortality, blunted production of nitric oxide, and increased production of TNF-alpha in endotoxemic TGF-beta1 transgenic mice. J Leukoc Biol. 1998;63:31–39. 102. Jakubzick C, Kunkel SL, Puri RK, et al. Therapeutic targeting of IL-4– and IL-13–responsive cells in pulmonary fibrosis. Immunol Res. 2004;30:339–349. 103. McGaha TL, Bona CA. Role of profibrogenic cytokines secreted by T cells in fibrotic processes in scleroderma. Autoimmun Rev. 2002;1:174–181. 104. Kaplan MH, Grusby MJ. Regulation of T helper cell differentiation by STAT molecules. J Leukoc Biol. 1998;64:2–5. 105. Suvas S, Rouse BT. Regulation of microbial immunity: The suppressor cell renaissance. Viral Immunol. 2005;18:411–418. 106. Maizels RM. Infections and allergy—helminths, hygiene and host immune regulation. Curr Opin Immunol. 2005;17:656–661. 107. Paust S, Cantor H. Regulatory T cells and autoimmune disease. Immunol Rev. 2005;204:195–207.

Acute and Chronic Inflammation Induces Disease Pathogenesis 108. Chatila T. The regulatory T cell transcriptosome: E pluribus unum. Immunity. 2007;27:693–695. 109. Chang X, Zheng P, Liu Y. FoxP3: A genetic link between immunodeficiency and autoimmune diseases. Autoimmun Rev. 2006;5:399–402. 110. Bacchetta R, Passerini L, Gambineri E, et al. Defective regulatory and effector T cell functions in patients with FOXP3 mutations. J Clin Invest. 2006;116:1713–1722. 111. McGeachy MJ, Cua DJ. Th17 cell differentiation: The long and winding road. Immunity. 2008;28:445–453. 112. Weaver CT, Harrington LE, Mangan PR, et al. Th17: An effector CD4 T cell lineage with regulatory T cell ties. Immunity. 2006;24:677–688. 113. Ivanov II, McKenzie BS, Zhou L, et al. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17þ T helper cells. Cell. 2006;126:1121–1133. 114. Ichiyama K, Yoshida H, Wakabayashi Y, et al. Foxp3 inhibits RORgamma t-mediated IL-17A mRNA transcription through direct interaction with RORgamma t. J Biol Chem. 2008;283: 17003–17008. 115. Mucida D, Park Y, Kim G, et al. Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science. 2007;317:256–260. 116. Nishihara M, Ogura H, Ueda N, et al. IL-6-gp130-STAT3 in T cells directs the development of IL-17þ Th with a minimum effect on that of Treg in the steady state. Int Immunol. 2007;19:695–702. 117. Ward PA, Lentsch AB. Endogenous regulation of the acute inflammatory response. Mol Cell Biochem. 2002;234–235: 225–228. 118. Bugatti S, Codullo V, Caporali R, et al. B cells in rheumatoid arthritis. Autoimmun Rev. 2007;7:137–142. 119. Nimmerjahn F, Ravetch JV. Fc-receptors as regulators of immunity. Adv Immunol. 2007;96:179–204. 120. Okroj M, Heinegard D, Holmdahl R, et al. Rheumatoid arthritis and the complement system. Ann Med. 2007;39: 517–530. 121. Kinet JP. The high-affinity IgE receptor (Fc epsilon RI): From physiology to pathology. Annu Rev Immunol. 1999;17:931–972. 122. Davies JM, O’Hehir RE. Immunogenetic characteristics of immunoglobulin E in allergic disease. Clin Exp Allergy. 2008; 38:566–578. 123. Boyce JA. Mast cells: Beyond IgE. J Allergy Clin Immunol. 2003; 111:24–32. 124. Bacharier LB, Geha RS. Molecular mechanisms of IgE regulation. J Allergy Clin Immunol. 2000;105:S547–S558. 125. Avila PC. Does anti-IgE therapy help in asthma? Efficacy and controversies. Annu Rev Med. 2007;58:185–203. 126. Poole BD, Scofield RH, Harley JB, et al. Epstein-Barr virus and molecular mimicry in systemic lupus erythematosus. Autoimmunity. 2006;39:63–70. 127. Ascherio A, Munger K. Epidemiology of multiple sclerosis: From risk factors to prevention. Semin Neurol. 2008;28:17–28. 128. McCoy L, Tsunoda I, Fujinami RS. Multiple sclerosis and virus induced immune responses: Autoimmunity can be primed by molecular mimicry and augmented by bystander activation. Autoimmunity. 2006;39:9–19. 129. Laurent GJ, Chambers RC, Hill MR, et al. Regulation of matrix turnover: Fibroblasts, forces, factors and fibrosis. Biochem Soc Trans. 2007;35:647–651. 130. Samuel CS, Lekgabe ED, Mookerjee I. The effects of relaxin on extracellular matrix remodeling in health and fibrotic disease. Adv Exp Med Biol. 2007;612:88–103. 131. Gomperts BN, Strieter RM. Fibrocytes in lung disease. J Leukoc Biol. 2007;82:449–456. 132. Duprez DA. Aldosterone and the vasculature: Mechanisms mediating resistant hypertension. J Clin Hypertens. 2007;9:13–18. 133. Sato M, Muragaki Y, Saika S, et al. Targeted disruption of TGFbeta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J Clin Invest. 2003;112:1486–1494. 134. Jagadeesan J, Bayat A. Transforming growth factor beta (TGFbeta) and keloid disease. Int J Surg. 2007;5:278–285. 135. Gressner OA, Weiskirchen R, Gressner AM. Biomarkers of liver fibrosis: Clinical translation of molecular pathogenesis or based

39

Part I

136. 137. 138. 139. 140. 141. 142. 143. 144. 145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155. 156. 157. 158.

159.


on liver-dependent malfunction tests. Clin Chim Acta. 2007; 381:107–113. Burke JP, Mulsow JJ, O’Keane C, et al. Fibrogenesis in Crohn’s disease. Am J Gastroenterol. 2007;102:439–448. Hu J, Van den Steen PE, Sang QX, et al. Matrix metalloproteinase inhibitors as therapy for inflammatory and vascular diseases. Nature Rev Drug Discov. 2007;6:480–498. Breitkopf K, Haas S, Wiercinska E, et al. Anti- TGF-beta strategies for the treatment of chronic liver disease. Alcohol Clin Exp Res. 2005;29:121S–131S. Hinz B, Phan SH, Thannickal VJ, et al. The myofibroblast: One function, multiple origins. Am J Pathol. 2007;170:1807–1816. Leask A. TGFbeta, cardiac fibroblasts, and the fibrotic response. Cardiovasc Res. 2007;74:207–212. Wynn TA. Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J Clin Invest. 2007;117:524–529. Boerrigter G, Burnett Jr JC. Nitric oxide-independent stimulation of soluble guanylate cyclase with BAY 41–2272 in cardiovascular disease. Cardiovasc Drug Rev. 2007;25:30–45. Verrecchia F, Mauviel A. Transforming growth factor-beta and fibrosis. World J Gastroenterol. 2007;13:3056–3062. de Boer WI, Alagappan VK, Sharma HS. Molecular mechanisms in chronic obstructive pulmonary disease: Potential targets for therapy. Cell Biochem Biophys. 2007;47:131–148. Wederell ED, Brown H, O’Connor M, et al. Laminin-binding integrins in rat lens morphogenesis and their regulation during fibre differentiation. Exp Eye Res. 2005;81:326–339. Verrecchia F, Mauviel A, Farge D. Transforming growth factorbeta signaling through the Smad proteins: Role in systemic sclerosis. Autoimmun Rev. 2006;5:563–569. Negri AL. Prevention of progressive fibrosis in chronic renal diseases: Antifibrotic agents. J Nephrol. 2004;17:496–503. Bujak M, Frangogiannis NG. The role of TGF-beta signaling in myocardial infarction and cardiac remodeling. Cardiovasc Res. 2007;74:184–195. Dabek J, Kulach A, Monastyrska-Cup B, et al. Transforming growth factor beta and cardiovascular diseases: The other facet of the ‘protective cytokine.’ Pharmacol Rep. 2006;58:799–805. Everett TH 4th, Olgin JE. Atrial fibrosis and the mechanisms of atrial fibrillation. Heart Rhythm. 2007;4:S24–S27. Lim H, Zhu YZ. Role of transforming growth factor-beta in the progression of heart failure. Cell Mol Life Sci. 2006;63:2584–2596. Ruiz-Ortega M, Rodriguez-Vita J, Sanchez-Lopez E, et al. TGFbeta signaling in vascular fibrosis. Cardiovasc Res. 2007;74: 196–206. Eickelberg O, Morty RE. Transforming growth factor beta/bone morphogenic protein signaling in pulmonary arterial hypertension: Remodeling revisited. Trends Cardiovasc Med. 2007;17:263–269. Klahr S, Morrissey J. Obstructive nephropathy and renal fibrosis: The role of bone morphogenic protein-7 and hepatocyte growth factor. Kidney Int Suppl. 2003;S105–S112. Petersen M, Thorikay M, Deckers M, et al. Oral administration of GW788388, an inhibitor of TGF-beta type I and II receptor kinases, decreases renal fibrosis. Kidney Int. 2008;73:705–715. Akool el S, Doller A, Muller R, et al. Nitric oxide induces TIMP-1 expression by activating the transforming growth factor betaSmad signaling pathway. J Biol Chem. 2005;280:39403–39416. Jones SE, Kelly DJ, Cox AJ, et al. Mast cell infiltration and chemokine expression in progressive renal disease. Kidney Int. 2003;64:906–913. Grandaliano G, Pontrelli P, Cerullo G, et al. Protease-activated receptor-2 expression in IgA nephropathy: A potential role in the pathogenesis of interstitial fibrosis. J Am Soc Nephrol. 2003; 14:2072–2083. Gruber BL, Marchese MJ, Kew RR. Transforming growth factor-beta 1 mediates mast cell chemotaxis. J Immunol. 1994; 152:5860–5867.

40

160. Kolodsick JE, Toews GB, Jakubzick C, et al. Protection from fluorescein isothiocyanate-induced fibrosis in IL-13-deficient, but not IL-4-deficient, mice results from impaired collagen synthesis by fibroblasts. J Immunol. 2004;172:4068–4076. 161. de Iongh RU, Wederell E, Lovicu FJ, et al. Transforming growth factor-beta-induced epithelial-mesenchymal transition in the lens: A model for cataract formation. Cells Tissues Organs. 2005;179:43–55. 162. Gabbiani G. The myofibroblast in wound healing and fibrocontractive diseases. J Pathol. 2003;200:500–503. 163. Diegelmann RF, Evans MC. Wound healing: An overview of acute, fibrotic and delayed healing. Front Biosci. 2004;9:283–289. 164. Hetzel M, Bachem M, Anders D, et al. Different effects of growth factors on proliferation and matrix production of normal and fibrotic human lung fibroblasts. Lung. 2005; 183:225–237. 165. Feldmann M, Pusey CD. Is there a role for TNF-alpha in antineutrophil cytoplasmic antibody-associated vasculitis? Lessons from other chronic inflammatory diseases. J Am Soc Nephrol. 2006;17:1243–1252. 166. Friedman WJ. Cytokines regulate expression of the type 1 interleukin-1 receptor in rat hippocampal neurons and glia. Exp Neurol. 2001;168:23–31. 167. Siwik DA, Chang DL, Colucci WS. Interleukin-1beta and tumor necrosis factor-alpha decrease collagen synthesis and increase matrix metalloproteinase activity in cardiac fibroblasts in vitro. Circ Res. 2000;86:1259–1265. 168. Walsh CJ, Sugerman HJ, Mullen PG, et al. Monoclonal antibody to tumor necrosis factor alpha attenuates cardiopulmonary dysfunction in porcine gram-negative sepsis. Arch Surg. 1992; 127:138–144. 169. Chaudhuri V, Zhou L, Karasek M. Inflammatory cytokines induce the transformation of human dermal microvascular endothelial cells into myofibroblasts: A potential role in skin fibrogenesis. J Cutan Pathol. 2007;34:146–153. 170. Marinova-Mutafchieva L, Williams RO, Funa K, et al. Inflammation is preceded by tumor necrosis factor- dependent infiltration of mesenchymal cells in experimental arthritis. Arthritis Rheum. 2002;46:507–513. 171. Williams RO, Feldmann M, Maini RN. Anti-tumor necrosis factor ameliorates joint disease in murine collagen-induced arthritis. Proc Natl Acad Sci USA. 1992;89:9784–9788. 172. Wynn TA. IL-13 effector functions. Annu Rev Immunol. 2003; 21:425–456. 173. Zhu Z, Homer RJ, Wang Z, et al. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest. 1999;103:779–788. 174. Fulkerson PC, Fischetti CA, Rothenberg ME. Eosinophils and CCR3 regulate interleukin-13 transgene-induced pulmonary remodeling. Am J Pathol. 2006;169:2117–2126. 175. Papadakis KA, Targan SR. Role of cytokines in the pathogenesis of inflammatory bowel disease. Annu Rev Med. 2000;51:289–298. 176. Williams RO. Collagen-induced arthritis in mice: A major role for tumor necrosis factor-alpha. Methods Mol Biol. 2007; 361:265–284. 177. Tilg H, Kaser A, Moschen AR. How to modulate inflammatory cytokines in liver diseases. Liver Int. 2006;26:1029–1039. 178. Lacraz S, Nicod LP, Chicheportiche R, et al. IL-10 inhibits metalloproteinase and stimulates TIMP-1 production in human mononuclear phagocytes. J Clin Invest. 1995;96:2304–2310. 179. Lee CG, Homer RJ, Cohn L, et al. Transgenic overexpression of interleukin (IL)-10 in the lung causes mucus metaplasia, tissue inflammation, and airway remodeling via IL-13-dependent and independent pathways. J Biol Chem. 2002;277:35466–35474.

C h a p t e r

3 Infection and Host Response Margret D. Oethinger

MICROBES AND HOSTS—BALANCE OF POWER? Disease is one of the major driving forces of evolution. Humans have a generation time of roughly 20 years, and even small mammals reproduce in weeks to months. In contrast, microbial generation times range from minutes to days. Thus, microbes evolve hundreds to thousands of times more rapidly than their vertebrate hosts. In this context, it is hardly remarkable that microbes have found numerous ways to exploit multicellular creatures for their own ends. Rather, it is remarkable that humans and other higher organisms have managed to survive at all. Large multicellular creatures represent concentrated, extremely rich nutrient sources for microbes. Therefore, the survival of multicellular creatures requires that they have sufficient defenses to prevent easy invasion and consumption. Recent advances in basic immunology illustrate the breadth and depth of the adaptations that have evolved to protect multicellular organisms from microbial invasion. However, the wondrous complexity and power of mammalian host defenses serve only as a backdrop to the even more astonishing complexity of microbial strategies for evading them. In the great scheme of things, humans (and other multicellular organisms) survive only because the microbes let us live. Because pathogens exert immense selective pressure, many aspects of host physiology have a role in preventing infection, in addition to the elements normally thought of as the immune system. Physical and chemical barriers such as skin, mucosal surfaces, and gastric acidity prevent invasion by microbes. Behavioral adaptations, such as avoidance of decayed food and slapping at insects, are most likely driven by preventing exposure to microbial threats. These aspects of host response to infection, while important, will not be further discussed here. In most cases, the pathologies induced by microbial pathogens primarily serve to aid microbial spreading to new hosts. Thus, coughing, sneezing, and diarrhea


n

Sheldon M. Campbell

are all mechanisms for microbial spread, and the distress caused to the host is merely incidental. We will illustrate major host response mechanisms using examples of five microbes that are exposed to, but circumvent, those responses.

THE STRUCTURE OF THE IMMUNE RESPONSE [1–3] The response to invading microbes consists of three major arms: (i) the innate immune system, which recognizes pathogens and cellular damage; (ii) adaptive immunity, which mounts a pathogen-specific response; and (iii) effector mechanisms, directed by both innate and adaptive mechanisms, which inactivate pathogens (listed in Table 3.1). These divisions are somewhat arbitrary. In fact, nearly every cell in the body participates to a degree in all three functions; there really is no clear division between the immune system proper and the rest of the body. Of course, cells such as lymphocytes, phagocytes, and dendritic cells are much more deeply committed to defense against pathogens than most other specialized cell types (skeletal muscle cells, for instance). Two major categories of molecules are recognized by the innate immune system: (i) microbial components and (ii) markers of tissue damage or death. Microbial molecules recognized by the innate immune system include peptidoglycan, lipopolysaccharide, or doublestranded RNA. Pathogen-Associated Molecular Patterns (PAMPs) are detected by the Pattern Recognition Receptors (PRRs) on host cells. The first-described and most important class of PRRs are the toll-like receptors (TLRs). Markers of tissue damage and death recognized by the innate immune system include tissue factor and other markers of cellular distress. Vascular damage can trigger the activation of coagulation and kinin pathways. Triggering PRRs in turn leads to a cascade of events which invoke the other two functions of the immune response. Depending on the tissue site, types of microbial structures, and category of cellular distress

41

Part I


Table 3.1

Host Effector Mechanisms

Name

Properties

Complement System

Proteolytic cascade, activated by antibody, directly by microbial components, or via PRRs.

Coagulation System Kinin System

Proteolytic cascade, activated by tissue and vascular damage. Proteolytic cascade triggered by tissue damage.

Antibodies

Antigen-specific proteins produced by B-cells. Recognize a broad range of antigens.

Monocyte/ Macrophage Dendritic Cell

Have PRRs to recognize pathogens; activated by specific T-cells and chemokines. Ingest large amounts of extracellular fluid; migrate to lymph node to present antigen to naı¨ve T-lymphocytes. Have PRRs to recognize pathogens, activated antibody and complement. Recognize antibody-coated parasites. Associated with IgE-mediated responses.

Neutrophil Eosinophil Basophil/Mast cell NK-cell

B-lymphocyte T-lymphocyte

Effector Mechanisms Soluble Effectors

Cellular Effectors

Lymphocyte lacking antigen-specific reactivity; recognize PAMPs of intracellular pathogens, activated by chemokines and by membrane proteins of infected cells. Recognize antigens presented by APCs; regulated by T-cells and chemokines. Recognize antigens presented by APCs; regulate major portions of both adaptive and innate immunity.

recognized, cells of the adaptive immune system and a broad range of effector mechanisms are recruited. Cellular recruitment is largely mediated by chemokines (peptide messengers that modulate immune cellular responses) and nonpeptide inflammatory mediators (such as prostaglandins). Antigens processed by phagocytic and nonphagocytic cells are presented to lymphocytes, which then mount an adaptive immune response. The adaptive immune response is embodied in (i) T-lymphocytes, which regulate immune responses, invoke powerful effector mechanisms, and participate directly in cytotoxic effector responses; and (ii) B-lymphocytes, which produce antibodies. Antibodies are both direct effectors of the immune response and mediators of innate and adaptive immunity. Antibodies directly neutralize some organisms, but also invoke and enhance further effector mechanisms by opsonizing microbes to direct their ingestion by phagocytes and by initiating complement activity. The essence of the adaptive immune response is somatic genetic variation which produces diverse, antigen-specific molecules (antibodies and T-cell receptors). Each lymphocyte produces only a single receptor or antibody. Lymphocytes are elaborately selected to eliminate self-reactive molecules and to favor cells making receptors or antibodies to pathogens. While this process is complex, time-consuming, and wasteful (many lymphocytes are eliminated for each clone which survives), 42

Direct destruction of pathogens via poreformation. Recruit inflammatory cells. Enhance phagocytosis and killing. Prevents blood loss. Bars access to bloodstream. Proinflammatory. Proinflammatory. Causes pain response. Increases vascular permeability to allow increased access by plasma proteins. Directly neutralize pathogens. Activate complement. Opsonize pathogens to enhance phagocytosis and killing Phagocytosis and microbial killing via multiple mechanisms. Antigen presentation. Antigen uptake, transport, and presentation to T-lymphocytes. Initiate adaptive immune response. Phagocytosis and microbial killing via multiple mechanisms. Killing of multicellular pathogens. Release of granules containing histamine and other mediators of anaphylaxis. Induce death of infected cells via membrane pores and induced apoptosis. Produce antibody. Directly kill infected cells via membrane pores and induced apoptosis. Activate macrophages. Many other functions.

the specificity of the adaptive immune response makes it a central component of the mammalian defense system. The most powerful effector mechanisms include phagocytic cells (such as neutrophils and activated macrophages), and certain soluble factors (such as complement). These effectors are directed and controlled by the antigen-specific immune response, but have the potential to cause significant damage to host tissues. A huge range of effector mechanisms limit and eliminate infection either by direct antimicrobial activity, or by creating physical or chemical barriers to microbial proliferation and spread. A partial list of effectors is provided in Table 3.1. It is important to re-emphasize that the distinction between the innate immune system, adaptive immunity, and effector mechanisms is rather arbitrary, and many cellular and humoral responses involve all three. For example, the proteins of the coagulation cascade recognize tissue damage and certain microbial components, recruit inflammatory cells, and by blocking blood flow to infected tissues, limit spread of infections. Tlymphocytes carry TLRs, which play a significant role in the activation and selection of pathogen-reactive cells; express T-cell receptors, which recognize specific pathogen antigens; recruit and activate specific effector cells; and participate directly in cell-dependent cytotoxicity to eliminate cells infected with viruses and other intracellular pathogens.

Chapter 3

REGULATION OF IMMUNITY [4,5] Because inflammatory responses are metabolically costly and capable of causing enormous damage to tissues, the immune system is tightly regulated. Soluble effector systems, such as the complement and coagulation cascades, have soluble inhibitors which usually confine these responses to the area where the initiating stimulus occurs. Cellular effectors are activated and inhibited via both chemokines and direct signaling via adhesion molecules and direct ligand-receptor interactions with regulatory cells, mostly T-lymphocytes. Adaptive immune responses undergo elaborate screening. In most cases self-reactive cells are screened out, and cells reactive to current infectious challenges are activated and proliferate. In turn, the adaptive immune system directs the activities of the innate immune system. Antibodies activate complement and direct phagocytosis, and T-cells activate macrophages and secrete chemokines that modulate innate cellular responses.

PATHOGEN STRATEGIES To evade the flexible and powerful system of host defenses, successful pathogens have evolved complex strategies. As examples, we have selected five pathogens: (i) the African trypanosomes (Trypanosoma brucei species), bloodstream-dwelling protists that evade antibody and complement via a remarkable strategy for generating antigenic diversity; (ii) Staphylococcus aureus, which employs a variety of strategies to evade, and in some cases to overload, innate and adaptive immune responses; (iii) Mycobacterium tuberculosis, an intracellular bacterium which actually proliferates inside an effector immune cell, the macrophage, by manipulating the phagosomelysosome trafficking of its vacuole; (iv) herpes simplex virus, a complex DNA virus which successfully disrupts intracellular mechanisms of viral control; and (v) human immunodeficiency virus, a small RNA virus which turns the immune system on itself, and generates enormous molecular diversity during infection of a single host to evade and subvert the immune response over a period

Table 3.2

Infection and Host Response

of years to decades. While these five organisms hardly demonstrate the incredible range of pathogen strategies of pathogenesis, they will allow for the discussion of the major aspects of immune function, in the context of meeting infectious challenges.

THE AFRICAN TRYPANOSOME AND ANTIBODY DIVERSITY: DUELING GENOMES Blood is a tissue with many functions, including transport of nutrients and oxygen, carriage of hormones and other chemical messengers, and defense against invading microbes, among others. Many of these functions are mediated by the cellular components of the blood—red blood cells, assorted types of leukocytes, and platelets. However, the acellular portion of the blood (the plasma) contains a host of molecules involved in defense. These include the proteins involved in coagulation (which prevent spread of microbes via the blood and have powerful proinflammatory effects), a variety of regulatory cytokines, as well as dedicated antimicrobial molecules such as antibodies and complement. Complement was initially described as a component of plasma which enhanced the antibacterial powers of antibodies. Hence, this activity that complemented the activity of antibodies became known as complement. Complement can be activated by antibodies (the classical pathway) or by interaction with specific molecular signatures, including the alternative and lectin pathways. Once activated, the proteases of the complement system cleave targets, many of which are also proteases, continuing the cascade of activation and propagation of the response. The activated components of complement opsonize pathogens to enhance phagocytosis, attract immune cells, and serve as co-receptors to enhance adaptive responses, and directly damage some bacteria by forming a membrane attack complex. Antibodies are a major arm of the adaptive immune response. Table 3.2 summarizes structure and major functions of the five immunoglobulin classes: IgD, IgM,

Antibody Classes and Functions

Class

Location*

Structure

Function

IgD

Surface of B-cells only Plasma

2 k or l light chains, 2 d heavy chains 2 k or l light chains, 2 m heavy chains, arranged in pentamers with 1 J chain 2 k or l light chains, 2 g heavy chains

Unknown; expressed early in differentiation along with IgM. Activates complement; first functional immunoglobulin formed in immune response.

IgM IgG IgA IgE

Widely distributed in extracellular fluid Mucosal tissues, surfaces, and secretions Bound to mast cells and basophils

2 k or l light chains, 2 a heavy chains arranged in dimers with 1 J chain 2 k or l light chains, 2 e heavy chains

Complement activation, transfer to neonate via placenta, opsonization, neutralization of viruses and other pathogens. Important in mucosal immunity, has opsonizing activity. Binds to and activates mast cells and basophils; important in defense versus parasites.

* All immunoglobulin classes are found on B-cells as antigen receptors.

43

Part I


A

B

Figure 3.1 Trypanosoma brucei in the blood. The African trypanosome is typically seen in peripheral blood smears from infected patients. In the bloodstream, this extracellular parasite is exposed to complement, antibody, and white cells, but survives to produce a persistent infection (Wright-Giemsa stain, 1000x).

IgG, IgA, and IgE. Antibodies can be produced in large amounts, with extraordinary affinity and selectivity for specific pathogens. Antibodies function to activate complement, direct effector cells to the pathogen, neutralize, and sequester microbes. Thus, the bloodstream is an extremely hostile environment for microbes. Yet the agents of African sleeping sickness, Trypanosoma brucei (b.) rhodesiense and T. b. gambiae, establish and maintain extracellular, bloodstream infections that can last weeks, months, and occasionally years. Figure 3.1 shows trypanosomes in the blood.

Generation of Antibody Diversity: Many Ways of Changing [6,7] An antigenic stimulus is required to induce B-lymphocytes to produce antibody, but the mere presence of antigen is insufficient to induce a robust response. Co-stimulation, either by helper T-cells or by particular antigens (which induce T-cell independent antibody production via interaction with a pattern-recognition receptor) is required. Binding of complement to antigens activates co-receptors which markedly enhance the response. A complex series of stimulation, selection, and differentiation events result in maturation of the B-cell into a mature antibody-producing plasma cell. Structurally, antibodies are divided into variable and constant regions. The constant regions determine the antibody class: IgD, IgM, IgG, IgA, or IgE. The different classes of antibodies have different effector functions and different destinations, as described in Table 3.2. The genome is not large enough to contain a separate gene for each antibody needed to respond to any antigen that the host might encounter. Thus, antibody diversity is generated by five different mechanisms (Figure 3.2): (i) the inherent diversity of the variable44

region sequences, (ii) the genetic recombination of those regions into functional immunoglobulins, (iii) the combination of different heavy and light chain variable regions to form a functional antigen-binding site, (iv) junctional diversity introduced during the joining process, and (v) somatic hypermutation of the V-region in activated B-cells. The variable regions of one heavy and one light chain combine to form the antigen-binding site of immunoglobulins (Fab). During B-cell differentiation, V (variable) gene segments are recombined with J (joining) regions and C (constant) regions to form functional immunoglobulin genes. In heavy chain differentiation, a D region is also included. As B-cell differentiation proceeds, genetic rearrangements attach an antibody class-specific C region to each V-J or V-D-J region to produce genes for IgD, IgM, IgG, IgA, or IgE. The genome contains substantial diversity of variable regions. Table 3.3 lists the numbers and combinations. In theory, the genetic diversity of the variable-region genes and their combinations can produce 1.9 106 different antigen-binding sites. In practice, it is likely that many of these combinations are useless, unstable, or even recognize self-antigens, so the true diversity of pathogen recognition sequences available from simple recombination of germ-line elements is much lower. During the genetic recombination events which join the variable regions, additional diversity is generated at the junctions. Two different mechanisms add nucleotides at the V-J and V-D junctions. In the first mechanism, P-nucleotides are added by a complex set of enzymatic reactions that create palindromic sequences. In the second mechanism, N-nucleotides are added randomly by terminal deoxynucleotide transferase. Another, less well-characterized mechanism may remove nucleotides. In combination, these mechanisms add diversity in a semi-random way. Finally, somatic hypermutation of the variable regions occurs during

Chapter 3


A. Variable-region gene diversity V1

V2

V3

J2

J2

C

V3

J1

J2

C

B. Recombination of V-region segments V1

V2

V1

J2

C

C. Junctional diversity generated during recombination AAGGCTAA

V ………… AA TTAGGTC

CATTGGAGG

CC …… J

CGGTACC ……………

J

V ………… ..TTCCGATT

V ………… ..TT AATCCAG

GTAACCTCC GG …… J

GCCATGG ……………

J

V …………

D. Somatic hypermutation

ACGTG T CTTAAC A GAAG A CTAA

ACGTGCCTTAACGGAAGGCTAA

B-CELL ACTIVATION

TGCACGGAATTGCCTTCCGATT

TGCAC A GAATTG T CTTC T GATT

5 V

7

3 V

V

C

C

C

C

C

V

7

3

1

C

C

V5

2 V

V

1

1

C

V

V

V

1

V

C

C

C

C

C

C

C

V

C

V2

2

V2

V

1

V1

E. Combinations of heavy and light chain regions

Figure 3.2 Mechanisms of generating antibody diversity. C regions and sequences are in shades of purple; J regions and sequences are in shades of green, and V regions and sequences are in shades of red. Altered or mutated sequences are in yellow. Designations of sequences (V1, etc.) are arbitrary and not meant to represent the actual arrangement of specific elements. (A) The inherent germline diversity of V and J regions provides some recognition diversity. (B) The combinations of V and J regions (V, D, and J in heavy-chains) provide additional diversity. (C) The V-J junctions undergo semirandom alterations during recombination, generating more variants. (D) In activated B-cells, the variable regions are hypermutated. (E) V regions of both light and heavy chains combine to form the antigen-recognition zone of the antibody. They can combine in different ways to provide still more variety of antigen recognition. Table 3.3

Variable-region Gene Diversity

Immunoglobulin Class

Region

# of Genes

l Light chains 120 total combinations

V J

30 4

k Light chains 200 total combinations

V J

40 5

Heavy chains 6,000 total combinations

V D J

40 25 6

Overall; 1.9 106 combinations

proliferation of activated B-cells. Point mutations are introduced into the variable regions at a very high rate. This requires transcriptional activation, but other factors must be involved to target mutations to the variable regions. During maturation, the antibody serves as the B-cell antigen receptor. The processes of stimulation, co-stimulation, and clonal deletion eliminate self-reactive cells and select for high-affinity receptors. The mechanisms for generating diversity, and for selecting high-affinity receptors combine to produce an immune response of high specificity and of increasing efficacy. 45

Part I


Trypanosoma brucei and Evasion of the Antibody Response: Diversity Responds to Diversity [8–10] African trypanosomes are unicellular, flagellate parasites carried by the tsetse fly (Glossina species). The fly injects the infectious metacyclic form of the parasite into the host. Subsequently, the parasite invades the subcutaneous tissues, then the regional lymph nodes, and finally the bloodstream. One of the salient characteristics of the infectious trypanosome is a homogeneous glycophosphatidylinositol (GPI)-linked surface protein called the variant surface glycoprotein (VSG). VSG is proinflammatory. As an antigen, VSG is recognized by B-cells and T-cells, and an antibody response is effectively generated. Most (but not all) trypanosomes are destroyed by antibody, complement, and phagocytosis. A subpopulation of organisms manages to change its coat protein to a new VSG that is structurally similar but antigenically distinct from the original VSG. Again, the immune system responds to the antigen by producing an antibody. Once again, most of the flagellates are destroyed, but a few produce still another variation of the coat protein and the cycle continues. In experimental trypanosome infections, hundreds of cycles have been observed. In patients, parasitemia can persist for months or even years. This ability to change surface proteins as rapidly as the host immune system can generate new antibodies is the fruit of a set of genetic mechanisms hauntingly similar to the mechanisms which generate the antibody diversity the parasite is successfully evading. On a genomic level, the trypanosome contains hundreds of VSG genes and pseudogenes, only one of which is expressed in a particular cell at a particular time. VSGs are transcribed as parts of polycistronic mRNAs from telomeric regions of the chromosome known as expression sites (ES). There are roughly

20 ES per cell. Most of the VSG genes not part of an ES (called silent VSGs) are found at the telomeres of roughly 100 minichromosomes of 50–150 kb each. These minichromosomes most likely evolved specifically to expand the accessible VSG repertoire of the organism. Finally, a few VSG genes and large numbers of pseudogenes (which are truncated, containing frameshift or in-frame stop-codon mutations, or lacking the biochemical properties of expressed VSGs) are found in tandem-repeat clusters in subtelomeric locations. The structure of the VSG genes is depicted in Figure 3.3A. There is only one active ES per cell, but several mechanisms can lead to expression of a new VSG, as depicted in Figure 3.3B. These mechanisms include (i) activation of a new ES (there are roughly 20 per genome) with inactivation of the original ES in situ, (ii) recombination of a VSG gene into the active ES via homologous recombination and telomere exchange, and (iii) segmental gene conversion of a portion or portions of VSG gene or genes into the ES VSG. Complex chimeric VSG containing elements of one or more silent VSG genes or pseudogenes may be produced. The regulation of the ES in the living trypanosome is still mysterious. Transcription of VSGs is performed by RNA polymerase I, the RNA polymerase normally associated with ribosomal RNA production, rather than by RNA polymerase II, which is typically associated with production of mRNA. The ES promoter appears to be constitutively active and unregulated. Control of gene expression is mediated through post-transcriptional RNA processing and elongation. The active ES is located in a specialized nuclear region known as the expression site body. The molecular mechanisms underlying activation and inactivation of a given ES are not yet understood, but are hypothesized to involve a competition for transcription factors.

a. ES-related VSG, expressed and unexpressed; roughly 20 ESAG

ESAG

VSG1

ESAG

ESAG

VSG2

b. Telomeric VSG on minichromosomes; 100-200 VSG3

VSG4

VSG52

VSG93

VSGn VSGn

c. SubTelomeric VSG in Clusters; 1250+ pVSG

pVSG

VSGn

pVSG

ES, Including VSG

A Figure 3.3A Mechanisms for generating variant surface glycoprotein diversity in trypanosomes: VSG genome structure. VSG sequences are in shades of red, others are purple. Silent VSG genes are dark red; expressed VSG genes are bright red, and VSG pseudogenes are pink. The large dots at the end of the chromosome represent telomeres. Green arrows are VSG promoters. ESAG are Expression Site Associated Genes, non-VSG genes, which are part of the polycistronic transcript driven by the VSG promoter. Designations of sequences (VSG1, etc.) are arbitrary and not meant to represent the actual arrangement of specific elements. 46

Chapter 3


a. ES Switching – Post-transcriptional ESAG

ESAG

VSG1

ESAG

ESAG

VSG2

ESAG

ESAG

VSG1

ESAG

ESAG

VSG2

b. Recombination and Telomere Exchange ESAG

ESAG

VSG1

ESAG

ESAG

VSG7

VSG7

VSG1

c. Gene Conversion Events VSG1

pVSG

pVSG

VSGn

pVSG

VSGn

pVSG

VSG1a pVSG

pVSG

etc. VSG1b

VSGn+1

B Figure 3.3B Mechanisms for generating variant surface glycoprotein diversity in trypanosomes: Expressing new VSG. VSG sequences are in shades of red, others are purple. Silent VSG genes are dark red; expressed VSG genes are bright red, and VSG pseudogenes are pink. The large dots at the end of the chromosome represent telomeres. Green arrows are VSG promoters. The Xs represent recombination or gene conversion events. ESAG are Expression Site Associated Genes, non-VSG genes which are part of the polycistronic transcript driven by the VSG promoter. Designations of sequences (VSG1, etc.) are arbitrary and not meant to represent the actual arrangement of specific elements. a. Post-transcriptional regulation causes different VSGs, located in alternative telomeric ESs, to be expressed. b. Recombination can switch a VSG gene from a minichromosome or other telomere to an ES. c. Gene conversion events can alter the sequence of VSGs located at ESs or elsewhere, drawing upon the sequence diversity not only of the silent VSGs but also of the VSG pseudogene pool.

If switching between VSGs were simply random, one would expect an initial wave of parasites and then a second wave containing all the possible VSG variants which would overwhelm the host. However, this does not occur. There appears to be a hierarchy of switching mechanisms, so the more probable switching events occur early in infection, and VSGs generated by less probable mechanisms occur later in the infection. After switching between ESs, recombination of VSGs into an active ES is the next most commonly observed

mechanism, followed by more-complex gene conversion and recombination events. The product of these genetic mechanisms is a semiprogrammed progression of surface coats in the population of organisms infecting a single host, which allows for prolonged parasitemia, and an expanded period of time in which the organism can be picked up by an insect vector for transmission to a new host. Perhaps not coincidentally, these mechanisms also contribute to variation over historical and evolutionary time of the parasite’s VSG repertoire, as new sequences 47

Part I


are assembled from the diverse genetic repertoire of potential VSG elements. Trypanosomes are not the only organisms to utilize antigen switching or antigenic variation to evade immune responses. Borrelia burgdorferi, Plasmodium, Neisseria gonorrhoeae, and other organisms have various mechanisms of changing their antigenic constituents, but the mechanisms employed by the African trypanosome are the most spectacular.

The Trypanosomacidal Serum Factor Story: Host Adaptations to Specific Pathogens and Pathogen Response [11] Trypanosoma brucei rhodesiensae (which causes a uniformly fatal human disease) and Trypanosoma brucei brucei (which is nonpathogenic for humans but causes disease in cattle) are extremely closely related. However, normal human serum lyses T. b. brucei, while T. b. rhodesiensae is unharmed, although it quickly loses this serum resistance if passaged in vitro without serum. The substance in serum associated with trypanosomal lysis, Trypanosomal Lytic Factor (TLF), is associated with HDL, and has been identified as apolipoprotein L-I (apoL-I). This is a human-specific apolipoprotein of relatively recent evolutionary origin (probably from a gene duplication and divergence event) that exerts its lytic activity after endocytosis into the trypanosomal lysosome. The protein associated with serum resistance in T. b. rhodesiensae (Serum Resistance Associated protein—SRA) is coded by a highly modified VSG gene which binds to and inactivates apoL-I. Highly prevalent pathogens which cause severe illness exert powerful selective pressure on host populations. Specific host genetic adaptations to particular pathogens are widely known. Sickle-cell trait as a defense against falciparum malaria is the best documented [12]. In their turn, microbes adapt to the novel host environments that they encounter.

STAPHYLOCOCCUS AUREUS: THE EXTRACELLULAR BATTLEGROUND Staphyloccus aureus (S. aureus) is a Gram-positive extracellular bacterium that is part of our commensal flora, living on the mucosal surfaces of humans and other mammals (Figure 3.4). It is a versatile pathogen in both community-acquired and hospital-acquired infections that range from superficial infections of skin and soft tissue to potentially life-threatening systemic disease. The first lines of defense against S. aureus are the recognition molecules and effector cells of the innate immune system; but S. aureus engages a multitude of mechanisms to subvert the innate immune response of the host.

The Innate Immune System: Recognition of Pathogens [13] After S. aureus breaches intact skin or mucosal lining, which constitutes the border by which the human body shields inside from outside, it first encounters resident 48

Figure 3.4 Staphylococcus aureus and neutrophils. A Gram-stained smear from a patient with S. aureus pneumonia. Staphylococci are located both extracellularly and within neutrophils (Gram stain, 1000x).

macrophages. These are long-lived phagocytic cells that reside in tissue and participate in both innate and adaptive immunity. The macrophage expresses several receptors that are specific for bacterial constituents, such as LPS (endotoxin) receptors, TLR (see Table 3.4), mannose receptors, complement receptor C3R, glucan receptors, and scavenger receptors. After bacteria or bacterial constituents (such as free bacterial DNA with CpG-rich oligonucleotide sequences, lipopolysaccharide, or peptidoglycan) bind to their receptors, the macrophage engulfs them. The phagosome fuses with the lysosome to form the phagolysosome, degradative enzymes and antimicrobial substances are released, and the content of the phagolysosome is digested, then the fragments presented to the adaptive immune system via MHC class II. Activation of TLRs kicks off a common intracellular signal transduction pathway that involves an adaptor protein called MyD88 and the interleukin-1 receptor associated kinase (IRAK) complex. Ultimately, the transcription factor NFkB translocates to the nucleus of the macrophage and induces expression of inflammatory cytokines. Important cytokines that are secreted by macrophages in response to bacterial products include IL-1, IL-6, tumor necrosis factor a (TNFa), the chemokine CXCL8, and IL-12. These molecules have powerful effects and start off the local inflammatory response (Figure 3.5). A critical task of the macrophages is to recruit neutrophils to the site of infection in an attempt to keep the infection localized. As killers of bacteria, macrophages pale in comparison with neutrophils, which are short-lived, dedicated phagocytes circulating in the blood, awaiting a call from the macrophage to enter infected tissue. They are plentifully supplied with antimicrobial substances and mechanisms, stored in their granules and elsewhere, and themselves programmed to die, on average within days after being released from the bone marrow. Neutrophils have receptors on their surfaces for inflammatory mediators derived both from the human host

Chapter 3

Table 3.4

Recognition of Microbial Products Through Toll-like Receptors Microorganisms Recognized

Receptor

Ligands

TLR-2 (TLR-1, -6) heterodimers TLR-3 homodimer TLR-4 homodimer TLR-5 homodimer

Peptidoglycan, bacterial lipoprotein and lipopeptide, porins, yeast mannan, lipoarabinomannan, glycophosphatidylinositol anchors Double-stranded RNA Lipopolysaccharide (LPS) Flagellin

Viral RNAs Gram-negative bacteria Gram-negative bacteria

TLR-9 homodimer

DNA with unmethylated CpG motifs

Bacteria

IL-1β

Activates vascular endothelium

Activates lymphocytes

Activates lymphocytes

Increases antibody production

Local tissue destruction Systemic

Gram-positive bacteria, mycobacteria, Neisseria, yeast, trypanosomes

TNF-α

IL-6

Local

Fever IL-6


IL-12

Notes Carried on macrophages

Carried on macrophages Carried on intestinal epithelium; interacts directly with ligand Intracellular receptor

CXCL8

effects

Activates vascular endothelium

Activates Natural killer (NK) cells

Increases vascular permeability

CD4+ cells TH1 cells

Chemotactic factor Recruits neutrophils, basophils, and T cells

effects Fever Acute-phase Proteins ≠

Fever Shock

Figure 3.5 Chemokines secreted by macrophages in response to bacterial challenge. Chemokines secreted by macrophages have both local and systemic effects which mobilize defenses to infection, but may have unfortunate consequences as well.

(CXCL8 from activated macrophages, C3a and C5a during complement activation) and from the bacteria themselves (for instance, bacteria-specific formylated peptides). Neutrophils home to sites of infection along the gradient of these chemoattractants.

The complement system is also part of the innate immune system. In the presence of microorganisms, the spontaneous low-level hydrolysis of complement factor C3 to iC3 is increased and leads to activation of C3, which ultimately leads to deposition of C3b on 49

Part I


the microbial surface. This represents the alternative pathway of complement activation, and serves two purposes. First, C3b covalently bound to microbial surfaces tags them for more efficient phagocytosis since phagocytic cells have complement receptors. Second, the accumulation of C3b on the bacterial cell surface changes the specificity of the C3 convertase of the alternative pathway, Bb-C3b, to cleave C5, which then harbors the terminal complement proteins to form the lytic membrane attack complex consisting of C5b-C9. Gram-negative bacteria, but not Gram-positive bacteria such as S. aureus, are successfully lysed by the pore-forming membrane attack complex [14]. Table 3.5

Most infections are efficiently cleared by the ubiquitous and induced responses of innate immunity described. Once an infectious agent escapes innate mechanisms and spreads from the point of entry, it faces the adaptive immune response that is characterized by an extensive process in the draining lymph node in which pathogen-specific lymphocyte clones are selected, expanded, and differentiated. S. aureus is such a successful pathogen because it expresses a multitude of virulence genes (Table 3.5) that act together to evade and subvert the three main axes of the innate immune responses: (i) recruitment and actions of inflammatory cells, (ii) antimicrobial peptides, and (iii) complement activation.

Examples of Virulence Factors Responsible for Immune Evasion by Staphylococcus aureus (Modified after [10])

Name of Factor

Abbrev.

Function

Chemotaxis inhibitory protein of S. aureus Staphylococcal complement inhibitor

CHIPS

Binds to C5aR and formylated protein receptor (FPR) Stabilizes C2a-C4b and Bb-C3b convertases

Staphylococcal superantigen-like protein-5 Staphylococcal superantigen-like protein-7 b-hemolysin g-hemolysin Panton-Valentine leukocidin Leukocidins D, E, M Exotoxins with superantigen activity enterotoxins Toxic shock syndrome toxin-1

SCIN

Anti-inflammatory Peptides

Toxins

Inhibits complement

Binds to P-selectin glycoprotein ligand-1 (PSGL-1)

Inhibits neutrophil recruitment

SSL-7

Binds to complement C5; binds to IgA

Inhibits complement

Hlb Hlg PVL

Lysis of cytokine-containing cells Lysis of erythrocytes and leukocytes Stimulates and lyses neutrophils and macrophages

LukD, LukE, LukM

Lysis of erythrocytes and leukocytes

Cytotoxicity Cytotoxicity Change in gene expression of staphylococcal proteins; important in necrotizing pneumonia Cytotoxicity

Se

Food poisoning when ingested; septic shock when systemic

TSST-1 Coa

Extracellular adherence protein

Eap

Extracellular fibrinogen binding protein

Efb

Bridge MHC-II-TCR without antigen presentation; confer nonspecific T-cell activation and/or T-cell anergy; downregulate chemokine receptors

Secreted Expanded Repertoire Adhesive Molecules Activates prothrombin and binds fibrin Binds to endothelial cell membrane molecules, binds to ICAM-1 and T-cell receptors Binds to fibrinogen; binds to complement factors C3 and inhibits its deposition on the bacterial cell surface

Antiphagocytic

Blocks neutrophil and T-cell recruitment; inhibits T-cell proliferation Inhibits complement activation beyond C3b, thereby blocking opsonophagocytosis; binds to platelets and blocks fibrinogeninduced platelet aggregation

Microbial Surface Components Recognizing Adhesive Matrix Molecules ClfA Spa

Binds to fibrinogen Binds to Fc portion of IgG and TNF receptor 1

Catalase

CatA

Inactivates free hydrogen peroxide

Staphylokinase

Sak

Plasminogen activator

Capsular polysaccharide type 1, 5, and 8

CPS 1, CPS 5, CPS 8

Masks complement C3 deposition

50

Blocks chemotaxis

SSL-5

Coagulase

Clumping factor A S. aureus protein A

Interference with Host Response

Extracellular Enzymes

Capsular Polysaccharides

Antiphagocytic Antiopsonic, antiphagocytic; modulates TNF signaling

Required for survival, persistence, and nasal colonization Antidefensin; cleaves IgG and complement factors Antiphagocytic effect

Chapter 3

Inhibition of Inflammatory Cell Recruitment and Phagocytosis While the macrophage and other primary defenses are sending messages about the presence of a pathogen, which recruit neutrophils and other inflammatory cells to the site of infection, S. aureus is busy blocking, scrambling, or subverting those messages. S. aureus contains an arsenal of antiadhesive and antimigratory proteins that specifically interfere with every step of host inflammatory cell recruitment. Staphylococcal chemotaxis inhibitory protein of S. aureus (CHIPS), present in approximately 60% of S. aureus strains, blocks neutrophil stimulation and chemotaxis by competing with the physiologic ligands at the complement receptor C5aR and formylated peptide receptor (FPR). Once near the site of infection, neutrophils must leave blood vessels through the vascular endothelium to reach the site of infection. This process starts with the rolling of leukocytes on activated endothelial cells by sticking to P-selectin expressed on the endothelial cell surface. Staphylococcal superantigen-like protein-5 (SSL-5) blocks this interaction. The next steps are adhesion to and transmigration through the endothelium, mediated in part by ICAM-1, the intercellular adhesion molecule-1 expressed on

b

a


endothelial cells. S. aureus answers with production of extracellular adherence protein (Eap) that binds to ICAM-1, thereby interfering with extravasation of neutrophils at the site of infection [15,16]. Once a neutrophil manages to get close to a S. aureus cell, the bacterium still has means to evade phagocytosis. S. aureus expresses surface-associated antiopsonic proteins and a polysaccharide capsule that compromise efficient phagocytosis by neutrophils (Figure 3.6a). Protein A is a wall-anchored protein of S. aureus that binds the Fc portion of IgG and coats the surface of the bacterium with IgG molecules that are in the incorrect orientation to be recognized by the neutrophil Fc receptor (Figure 3.6c). Clumping factor A (ClfA) is a fibrinogen-binding protein present on the surface of S. aureus that binds to fibrinogen and coats the surface of the bacterial cells with fibrinogen molecules, additionally complicating the recognition process (Figure 3.6e).

Inactivation of Antimicrobial Mechanisms One of the cardinal features of S. aureus is its ability to secrete several cytolytic toxins (hemolysins, leukocidins—see Table 3.5) that damage the membranes of host

Capsule Cell wall

Sak Plasminogen

e ClfA binding fibrinogen

Plasmin

IgG C3b

c Protein A binding IgG

d

C3b Efb

C3

C3a

Figure 3.6 Mechanisms by which Stapylococcus aureus evades opsonophagocytosis. The figure illustrates (a) the capsular polysaccharide, which can compromise neutrophil access to bound complement and antibody; (b) the extracellular staphylokinase (Sak), which activates cell-bound plasminogen and cleaves IgG and C3b; (c) protein A with 5 immunoglobulin G (IgG) Fc-binding domains; (d) fibrinogen-binding protein (EfB), which binds complement factor C3 and blocks its deposition on the bacterial cell surface. Complement activation beyond C3b attachment is prevented, thereby inhibiting opsonization. (e) Clumping factor A (ClfA), which binds the g–chain of fibrinogen. Reprinted by permission from Nature Publishing Group, Nature Reviews Microbiology, Volume 3, copyright 2005, page 952.

51

Part I


cells. They contribute to the development of abscesses with pus formation by direct killing of neutrophils. If S. aureus is successfully engulfed by a neutrophil, its end has not yet come. It is well endowed with surface modifications and other mechanisms to help it survive in the phagosome. Transcriptional microarray analysis of mRNA from S. aureus following ingestion by neutrophils revealed a large number of differentially regulated genes [16]. Many known stress-response genes, including superoxide-dismutases, catalase, and the leukotoxin Hlg, were upregulated immediately after ingestion. S. aureus is able to interfere with endosome fusion and the release of antimicrobial substances. Two superoxide dismutase enzymes help S. aureus to avoid the lethal effects of oxygen free radicals that are formed during the respiratory burst of the neutrophil. Modifications to the cell wall teichoic acid and other cell wall components change the cell surface charge such that the affinity of cationic, antimicrobial defensin peptides is reduced. Staphylokinase binds defensin peptides, and the extracellular metalloprotease aureolysin cleaves and inactivates certain defensin peptides [14,15].

Inhibition of Complement Activation: You Can’t Tag Me! The prerequisite for complement activation is cleaving C3 into a soluble C3a and covalent attachment of C3b to the surface of S. aureus. This is either carried out by the C3 convertase C4bC2a (classical and lectin pathway) or C3bBb (alternative pathway). S. aureus secretes a protein called Staphylococcus complement inhibitor (SCIN) that stabilizes both C3 convertases and renders them less active. Similarly, the extracellular fibrinogen-binding protein Efb blocks C3 deposition on the bacterial surface (Table 3.6d). The effect is reduced opsonization and hence reduced phagocytosis. However, S. aureus not only prevents complement factor deposition, but is also capable of eliminating bound C3b and IgG through a very clever mechanism. Host plasminogen that is attached to the bacterial cell surface is activated by the S. aureus enzyme staphylokinase to plasmin, which then cleaves surface-bound C3b and IgG, resulting in reduced phagocytosis by neutrophils (Table 3.6b).

Staphylococcal Toxins and Superantigens: Turning the Inflammatory Response on the Host One of the most serious, life-threatening infections with S. aureus is toxic shock syndrome. It is caused by secreted exoenzymes and exotoxins (Table 3.5). Enterotoxins cause a fairly common, short-lived, benign gastroenteritis (food poisoning) when ingested, but act as a superantigen in systemic infections. The potent immunostimulatory properties of superantigens are a direct result of their simultaneous interaction with the Vb domain of the T-cell receptor and the MHC class II molecules on the surface of an antigen-presenting cell. Superantigens derive their name from the fact that they are able to polyclonally activate a large fraction of the T-cell population (2–20%) at 52

picomolar concentrations, compared to a normal antigen-induced T-cell response where 0.001–0.0001% of the body’s T-cells are activated. They bind to the variable part of the b chain of the T-cell receptor and to MHC class II molecules present on antigen-presenting cells without the need to be presented by antigen-presenting cells and cause an immune response that is not specific to any particular epitope on the superantigen. The cross-linking of MHC II molecule and TCR induces a signaling pathway that leads to proliferation of T-cells and a massive release of cytokines. This systemic cytokine storm causes extravasation of plasma and protein, resulting in decreased blood volume and low blood pressure. Activation of the coagulation cascade leads to disseminated intravascular coagulation (DIC), which further compromises perfusion of end organs and eventually results in multiorgan failure and death. It is ironic that in toxic shock most of the deleterious effects on the host tissue are not related to actions of the bacteria, but the exaggerated host immune response [16]. After all, it is usually not in the interest of S. aureus to kill the host.

MYCOBACTERIUM TUBERCULOSIS AND THE MACROPHAGE Mycobacterium tuberculosis is an extremely successful pathogen, and is one of the most important causes of worldwide morbidity and premature death. The mycobacteria are also known as the acid-fast bacilli (AFB). The staining property of acid-fastness is mediated by the thick, lipidrich cell wall of the organisms. The unique cell wall structure of the mycobacteria is involved in management of the host cell. Spread by the aerosol route from person to person, organisms in droplet nuclei are deposited in the alveoli, where they encounter – and enter – their first immunological barrier, the alveolar macrophages. Many pathogens utilize the intracellular compartment to evade host responses. While the intracellular lifestyle avoids many host defenses, such as complement and neutralizing antibody, other mechanisms of immunity operate intracellularly. In order to thrive intracellularly, pathogens must enter the cell. Utilization of the phagocytic pathway of entry carries the risk of fusion with lysosomes and destruction. Utilization of other pathways is more energy-intensive for the microbe, limits the potential for the parasite to exploit cellular mechanisms of transport and trafficking of endosomes, and may expose the microbe to cytoplasmic pattern-recognition receptors which will activate other defenses. After entering the cell, pathogens must survive and reproduce within whichever compartment is entered. This may require inhibition of lysosomal fusion, surviving constitutive intracellular inhibitory or killing mechanisms, transport of nutrients, and exploiting other aspects of host cell physiology. Next intracellular pathogens must limit exposure to the cell-mediated immune system. Professional phagocytes are specifically equipped to present antigen via MHC class II, but most nucleated cells can present antigen via MHC class I pathways, which are specifically designed to initiate immune responses to intracellular pathogens by stimulating cytotoxic CD8þ T-cells. Finally, intracellular pathogens must prevent destruction of the host cell and pass successfully to another.

Chapter 3

While tubercle bacilli are quite capable of extracellular growth and proliferation, in the early stages of infection this does not occur for long, since alveolar macrophages rapidly phagocytose them. The initial interaction between M. tb and the macrophage takes place in the absence of adaptive immunity. The mycobacterial surface appears to contain a rich array of TLR agonists that drive uptake of the organism and recruitment of inflammatory cells to the site of infection. For most microbes, that would be the end of the line; shortly after phagocytosis phagosome-lysosome fusion occurs, regulated by an elaborate array of proteins and glycolipds that control trafficking of membrane-bound organelles, and a variety of killing mechanisms are invoked. Acid pH, reactive oxygen and nitrogen intermediates, degradative enzymes, and toxic peptides kill and digest the invading pathogens. However, Mycobacterium tuberculosis survives and reproduces within the macrophage. Infected macrophages, though initially incapable of killing mycobacteria, nonetheless secrete chemokines which recruit other inflammatory cells to the area [3].

Mycobacterium and Macrophage: The Pathogen Chooses Its Destiny [17,18] The mycobacterial manipulation of the macrophage begins on uptake, and some of the mechanisms utilized by the pathogen are shown in Figure 3.7. In phagocytic cells, different receptors drive different processing of the phagosome. Thus, pathogens can control their


intracellular fate by choosing the receptor that recognizes them. In the case of mycobacteria, multiple receptors may be involved, and the details of their interaction in vivo are not yet known. However, one of the major receptors is complement receptor type 3 (CR3), a pathway which prevents macrophage activation, in contrast with phagocytosis driven by other receptors. Once internalized in a phagosome, several mycobacterial molecules actively interfere with phagosomelysosome fusion, and cellular processes regulated by phosphorylation and dephosphorylation signals are controlled through modification of normal signals. Phosphatidylinositol-3-phosphate (PI3P), a molecule synthesized by host phosphatidylinositol-3-kinase (PI3K), serves to direct proteins involved in the fusion process to the endosomal membrane. M. tuberculosis inhibits PI3K and secretes an acid phosphatase that degrades PI3P. In addition, other secreted phosphatases interfere with endosome trafficking. A mycobacterial protein kinase, PknG, is required for survival in macrophages. Dominant-negative mutants for this protein kinase are killed secondary to lysosomal fusion. PknG is secreted from mycobacteria and enters the host cell cytosol. Its most likely role there is to phosphorylate a host protein involved in endosome trafficking, preventing fusion of the mycobacterial compartment. Mycobacterial cell wall lipoarabinomannan (LAM) also blocks phagosomelysosome fusion through an unknown mechanism. Phagosome-lysosome fusion also involves calciumdependent signaling. The calcineurin inhibitors cyclosporine A and tacrolimus, which are used clinically as

M. tuberculosis CR3 Phagosome Other Receptors LAM? PI3K X

SapM

PknG X Coronin 1 ?

Phagosome

Macrophage activation

PI3-P X

X

X

Phagolysosome

Phagolysosome

Figure 3.7 Mycobacterium tuberculosis and the macrophage. Gray arrows are host endosome processing pathways; the pink lines are mycobacterial mechanisms. Fusion of mycobacteria into mature phagolysosomes usually leads to death of the organism, so mycobacteria select their endocytotic pathway and interfere with mechanisms designed to result in phagosome-lysosome fusion. 53

Part I


immunosuppressants, paradoxically prevent mycobacterial proliferation in macrophages. A host protein, coronin 1, responsible for activation of calcineurin, appears to associate selectively with phagosomes containing living mycobacteria. A coronin-dependent calcium influx activates calcineurin, which blocks fusion. How mycobacteria invoke this pathway is still unknown. Despite all these mechanisms, M. tuberculosis have very little ability to block phagosome-lysosome fusion in activated macrophages stimulated via cytokines and TLRs. Probably the most important cytokines in activating macrophages to kill mycobacteria are interferon-g and TNFa. Both in animal models and in humans, suppression of these pathways by drugs or mutations results in vulnerability to tuberculosis. A number of M. tuberculosis components inhibit elements of the activation pathway. LAM and its glycosylated derivatives can modulate signaling pathways initiated by interferon-g and by TLRs, and can block mitogen-activated-protein-kinase (MAPK) pathways within the network of activities that lead to activation. However, the macrophage is not entirely a passive host to the tubercle bacillus. The most effective response to this infection involves secretion of chemokines to recruit the adaptive immune system and other inflammatory cells, and to present mycobacterial antigen to T-cells.

The Adaptive Response to M. tuberculosis: Containment and the Granuloma [19] Antigens from intracellular pathogens located in the endosomal compartment are primarily presented on class II MHC molecules and recognized by CD4 T-cells. This is not an exclusive arrangement since some antigen from the endosomal compartment is transported to the cytosol and presented to CD8 T-cells via MHC class I. Processing of antigen for class II requires acid pH and active acid proteases typically found in lysosomes; evidently not all M. tuberculosis succeed in

A

inhibiting phagosome maturation and fusion. In addition to MHC class I and II, the membrane protein CD1 also binds antigen for presentation to T-cells. CD1 is specialized for presentation of hydrophobic molecules, such as the rich cell wall lipid and glycolipid components of mycobacteria, and is recognized by T-cells which express neither CD4 nor CD8. CD4 T-cells mature into several populations of effector T-cells after extensive differentiation and selection. The best-known division is into Th1 and Th2 type cells. Th2-type CD4 T-cells express cytokines which activate and induce class-switching in B-cells, resulting in an immune response centered around antibody production; opsonization; and handling of extracellular bacteria, viruses, and parasites. In contrast, the major activity of Th1-type cells is to activate macrophages via interferon-g, IL-2, TNFa, and other cytokines. Differentiation of CD4 T-cells into the Th1 and Th2 lineages is controlled by the cytokines they encounter during the early stages of activation. Interferon-g, secreted by macrophages and dendritic cells, induces differentiation toward the Th1 phenotype. Since interferon-g is a major cytokine produced by Th1-type cells, the Th1-type immune response is self-enforcing and tends to be stable unless other influences perturb the balance [3–5]. Activated macrophages are capable of killing ingested mycobacteria. The lesion that results from the effective immune response to M. tuberculosis infection is the granuloma, shown in Figure 3.8. Structurally, a tuberculous granuloma consists of a central area of necrosis, surrounded by macrophages (both activated and nonactivated), then a mixture of lymphocytes, macrophages, tissue cells, and fibroblasts. The lymphocytes are mainly Th1-type CD4 cells, though CD8 cells are present and seem to have a role in immunity to tuberculosis. The granuloma structure is effective in containing, but typically not in eradicating, the mycobacteria.

B

Figure 3.8 A mycobacterial granuloma. H&E stained sections of a mycobacterial granuloma. Central necrosis and an inflammatory response consisting of macrophages, lymphocytes, and fibroblasts are apparent. A large multinucleated giant cell, characteristic of the granulomatous reaction, is also present. 54

Chapter 3

Persisting bacteria may remain viable for the life of the host, either within the necrotic center of the granuloma or in dynamic equilibrium within the inflammatory region of the lesion, or both. Under conditions of waning or suppressed immunity, the persisting mycobacteria can proliferate, spread, cause disease, and also escape, typically via the airborne coughedout route, to a new host. Mycobacterium tuberculosis exploits the intracellular compartment to maintain itself in the host. Antibody responses to tuberculosis infection are weak, not protective, and possibly harmful. Instead, cell-mediated immune responses leading to macrophage activation, directed primarily by CD4 T-cells, lead to an at least partially protective response. A rather delicate balance of factors works in the interest of the pathogen. It is able to maintain itself for prolonged periods of time in a single host, awaiting an opportunity for transmission.

HERPES SIMPLEX VIRUS: TAKING OVER Herpes Simplex Virus (HSV) types 1 and 2 are ubiquitous DNA viruses that cause a broad spectrum of disease, from painful oral and genital lesions to life-threatening brain and systemic infections. HSV is responsible for both acute and reactivation disease. Once infected, a person usually harbors latent HSV for life.


Defense Against Viruses: Subversion and Sacrifice [2,3,20,21] Viruses present unique challenges to the immune system. Typically, viruses enter host cells and then utilize the host protein-synthetic and other apparatus to assemble new viral particles. Entry into cells is rarely by phagocytosis until a mature immune response produces opsonized viral particles. Instead, viruses recognize and enter host cells via pathways that place them directly into the cytoplasm. Mechanisms by which viruses damage cells are illustrated in Figure 3.9. In response to viral infection, the immune system has mechanisms for recognizing and managing viruses. There are pattern-recognition receptors which recognize the molecular signatures of viruses. In particular, TLR-3 recognizes double-stranded RNA, TLR-7 recognizes single-stranded RNA, and TLR-9 recognizes unmethylated CpG-containing DNA. The mannosebinding protein CD 206 recognizes some viral glycoproteins, including one HSV protein. Double-stranded RNA is also recognized by the cytoplasmic proteins RIG-1 and MDA-5. Recognition of viral components by TLR-3, RIG-1, or MDA-5 causes activation of the interferon-regulatory factors IRF3 and IRF7 and the nuclear translocation of regulatory factor NFkB, which induces a range of proinflammatory mechanisms, most

Virus Receptor

Entry, uncoating

Viral genome replication, mRNA synthesis

Viral protein synthesis

Viral inclusions

Reduced host cell DNA, RNA, protein synthesis

VIRAL PROTEINS

Virus assembly

Metabolic derangements Cell lysis or fusion Neoplastic transformation Viral antigens

Host T cell–mediated injury

Figure 3.9 How viruses damage cells. Mechanisms by which viruses cause injury to cells. Reprinted by permission from Elsevier Saunders. Robbins and Cotran: Pathologic Basis of Disease, 7th edition, copyright 2004, page 357. 55

Part I


importantly, production of the antiviral chemokines interferon (IFN) a and b. IFNa/b induces a series of events which form a primary defense against viral infections. Via a series of protein phosphorylation events triggered by the Janusfamily kinase linked to the interferon receptor, a number of antiviral activities are induced. These include (i) 20 –50 oligoadenylate synthetase, an enzyme that produces 20 –50 -linked polyadenylates, which activate ribonuclease L to digest viral RNAs; and (ii) dsRNAdependent protein kinase R (PKR), which modifies eukaryotic initiation factor 2a, leading to arrest of translation. In addition to the intracellular activities of IFNa/b which target viral replication, other activities include upregulation of IFNa/b synthesis (a positive feedback loop); (ii) alteration of the proteasome, the protein degradation system of the cell, to favor production of peptides for presentation via MHC class I; (iii) upregulation of MHC class I expression and antigen presentation; and (iv) activation of macrophages, dendritic cells, and NK cells. Cytoplasmic antigens, such as most viral peptides, are exported from the cytosol to the endoplasmic reticulum. The heterodimeric proteins responsible for transport are called Transporters associated with Antigen Processing 1 and 2 (TAP1 and TAP2). TAP1 and TAP2 are induced by interferons, as are the MHC class I molecules which bind the antigen. After transport to the plasma membrane, MHC class I presents antigen to cytotoxic CD8 T-cells. The final defense of virally infected cells is apoptosis. Cells activate a cascade of events which lead to programmed cell death through both induction by cytotoxic T-cells (with appropriate co-stimulus by dendritic cells and CD4 T-cells) and via other mechanisms triggered by viral infection. Apoptosis is an energy-requiring, deliberate, highly regulated process. Two major signaling pathways trigger apoptosis: (i) via extrinsic death receptors, such as the TNFa receptor, and (ii) via intracellular signals. In each case, a series of proteases called caspases are activated, and destroy the critical infrastructure of the cell in a systematic way.

Herpes Simplex Virus on the High Wire: A Delicate Balancing Act [22,23,24,25,26] HSV has a large genome for a virus, consisting of ~150 kb, with at least 74 genes. An image of an HSV infection is shown in Figure 3.10. While fewer than half the genes are required for replication in cell cultures, viruses isolated from human hosts almost always have the full complement. Those accessory genes not required for growth in vitro are mainly involved in evading or inhibiting host responses. A protein known as vhs (viral host shutoff) is an RNAse that degrades mRNA. Cellular responses to viral infection typically involve activation of response genes, and vhs globally inhibits such responses. Because interferons play such a central role in defense against viral infection, a number of HSV proteins inhibit components of the IFNa/b response system (Table 3.6). US11 binds directly to PKR, 56

Figure 3.10 Histopathology of a herpes simplex lesion. Herpesvirus blister in mucosa. High-power view shows host cells with glassy intranuclear herpes simplex inclusion bodies. Reprinted by permission from Elsevier Saunders. Robbins and Cotran: Pathologic Basis of Disease, 7th edition, copyright 2004, page 366.

preventing it from shutting off translation. US11 is actually trafficked intercellularly, and acts on adjacent uninfected but interferon-stimulated cells as well as the infected cell, priming them for infection. Meanwhile, ICP 34.5 activates host protein phosphorylase 1a, which dephosphorylates and reactivates initiation factor 2a should it have been inactivated by PKR. HSV protein ICP0 acts in the nucleus to inhibit IRF3 and IRF7, as well as several other interferon-response nuclear proteins. In the cytoplasm, ICP0 appears to block the activity of ribonuclease L. A latency-associated transcript (LAT) locus directly inhibits expression of interferon in neurons. HSV also acts to reduce presentation of antigen to the adaptive immune system. ICP47 blocks entry of peptides to the ER via binding to TAP. The activities that inhibit interferon actions also inhibit the interferon-mediated increase in MHC class I expression. In addition, HSV exerts broad inhibitory activities when it invades dendritic cells, inducing downregulation of co-stimulatory surface proteins, adhesion molecules, and class I MHC. Since dendritic cells play a central role in antigen presentation and control of the adaptive response, this inhibition, mediated in part by the US3 protein kinase, most likely slows the response to HSV infection. HSV proteins even exert control over apoptosis. Infection with HSV initially makes cells resistant to apoptosis by either the extrinsic or intrinsic pathways. A number of viral proteins seem to be involved, and the complete pathway has yet to be determined. Two essential viral genes appear to be regulatory elements that control expression of several other viral genes, and some host proteins are also involved. However, later in infection in some cell types, apoptosis is induced by HSV. The pathogen appears to create a delicate balance between inhibition of apoptosis early in infection, prior to production of virions, and induction of apoptosis late in the infective cycle.

Chapter 3

Table 3.6


Interferon Actions and HSV Reactions

Mechanism

Effect

Activation of ribonuclease L ds-RNA-dependent phosphorylation of ribosomal initiation factor (PKR)

Digest viral RNAs Arrest protein synthesis

Alteration of proteasome to favor production of peptides for class I MHC Upregulation of MHC class I and associate mechanisms Activation of antigen-presenting and effector cells Upregulation of interferon synthesis

HSV Response

Activities That Inhibit Viral Gene Expression

ICP0 inhibits ribonuclease L Block the kinase responsible for phosphorylation; increase activity of phosphorylase which restores activity

Activities That Enhance Inflammatory Responses Increase presentation of antigen to adaptive immune system

Unknown

Increase presentation of antigen to adaptive immune system Accelerate antibody and cell-mediated immune responses; induce apoptosis in infected cells Positive-feedback loop to limit infectability of nearby cells

Block TAP transport of antigen, which in turn limits externalization of MHC class I Infection of these cell types leads to downregulation of response elements, especially in dendritic cells vhs globally inhibits host gene expression; ICP0 blocks multiple transduction mechanisms of IFN signaling

HSV is an extremely prudent pathogen. It fails to completely inhibit the immune response, and local control of HSV infection is achieved relatively rapidly, usually with minimal lasting damage. Before this occurs, however, the virus has invaded neurons and entered a latent stage of infection, with only a small number of genes being transcribed at a low level. Neurons express low levels of MHC class I, which is further downregulated by HSV. Periodically, viral replication is turned on and viral particles are transported down the axon to its terminal near a mucosal surface, where the virus can invade epithelial cells and initiate a lesion, with more opportunities for transmission to a new host.

HIV: THE IMMUNE GUERILLA By evolution, our immune system has developed several strategies to fight viral infections. In most chronic viral infections, both virus-specific T helper cells and cytotoxic T-lymphocytes (CTL) are required to effectively eliminate an infected cell. In turn, viruses have evolved numerous ways to evade the host immune system. Since the early 1980s, a new infectious disease of epidemic proportion has successfully emerged and spread around the globe: Acquired Immune Deficiency Syndrome (AIDS). For more than two decades, the human immunodeficiency virus (HIV) has infected millions of people worldwide each year, mainly through mucosal transmission during unprotected sexual intercourse. In 2007, an estimated 33 million people lived with HIV globally, 2.5 million people were newly diagnosed with HIV infection, and 2.1 million patients died from AIDS. Since 1981, more than 25 million people have died from AIDS as a result of HIV infection (http:// www.unaids.org/) [27]. HIV is special in that this virus not only evades the immune response, but directly attacks the very effector cells that play a pivotal role in the fight against viruses, namely T-lymphocytes, macrophages, and dendritic

cells. One of the paradoxes of HIV infection is that the virus elicits a broad immune response that is not completely protective, while it causes immune dysfunction on several levels [28]. HIV infection is rarely successfully terminated by the immune system, but nearly always continues for many years and slowly progresses to AIDS and death if left untreated. Since the discovery of HIV in 1981, there has been an explosion of research aimed at deciphering the mechanism of infection, understanding why it cannot be controlled by our immune system, and at developing an effective vaccine.

Structure and Transmission of HIV—Small But Deadly The human immunodeficiency virus is a human retrovirus belonging to the lentivirus group. Two genetically distinct forms exist, HIV-1 and HIV-2, but they cause similar syndromes and elicit the same host response. HIV is an RNA virus that utilizes reverse transcriptase (RT) and other enzymes to convert its genome from RNA into an integrated proviral DNA. Its viral core contains the major capsid protein p24, nucleocapsid proteins, two copies of viral RNA, and three viral enzymes (protease, reverse transcriptase, and integrase). The viral particle is covered by a lipid bilayer that is derived from the host cell membrane [29]. Two glycoproteins protrude from the surface: glycoproteins (gp)120 and gp41, which are critical for HIV infection of cells (Figure 3.11). In contrast with the 150 kb HSV genome, HIV has to accomplish all its tasks with a genome of only 9.8 kb. The mode of transmission of HIV is mainly through close contact such as sexual intercourse: viral particles contained in semen enter the new host via microscopic lesions. Parenteral transmission, through blood products, sharing needles among drug users, or vertical transmission from mother to baby, are also important routes of transmission. 57

Part I


gp41

p17 matrix

gp120

p24 capsid Lipid bilayer Integrase Protease RNA Reverse transcriptase

Figure 3.11 The structure of the HIV virion. Schematic illustration of an HIV virion. The viral particle is covered by a lipid bilayer that is derived from the host cell. Reprinted by permission from Elsevier Saunders. Robbins, and Cotran: Pathologic Basis of Disease, 7th edition, copyright 2004, page 247.

Invasion of Cells by HIV: Into the Lion’s Den [21] The high affinity receptor that is used by HIV to enter host cells is the CD4 receptor, hence the major target for HIV is lymphoid tissue—more specifically, CD4þ T lymphocytes, macrophages, and dendritic cells (Figure 3.12). The first encounter between HIV and the naı¨ve host takes place in the mucosa and draining lymph node [30]. Dendritic cells play an important role in the infectious process. They are not only primary target cells, but also powerful professional antigen-presenting cells that are infected either directly or via capture of virus on their stellate processes. They can present antigens via MHC class I and class II molecules, stimulating both T-helper and CTL responses. The presence of CD4 on host cells is not sufficient to mediate infection. The receptor needs to be accompanied by the presence of one of two chemokine receptors used as co-receptors: either CXCR4 or CCR5. R4 viruses utilize CXCR4 as co-receptor which is expressed on lymphocytes, but not on macrophages. Hence, these viruses are called lymphocyte-tropic or T-tropic viruses. R5 viruses utilize CCR5 as co-receptor which is expressed on monocytes/macrophages, lymphocytes, and dendritic cells. R5 viruses are called macrophage-tropic or M-tropic viruses despite the fact that they can infect several cell types. Viruses that can use both CXCR4 and CCR5 as co-receptors are called dual tropic viruses. In the early phase of HIV infection, R5 (M-tropic) viruses dominate, but over the course of the infection the tropism often changes due to mutations in the viral genome, and R4 (lymphocyte-tropic) viruses increase in numbers. 58

The initial step in infection of any of the CD4þ cells is the binding of gp120 to CD4 molecules, which leads to a conformational change of the viral protein which now recognizes the co-receptor CCR5 or CXCR4. This interaction then triggers conformational change of gp41, which is noncovalently bound to pg120, and fusion of the viral bilayer with the host cell membrane. The HIV genome enters the host cell and reverse transcribes its RNA genome into cDNA (proviral DNA). In quiescent host cells, HIV cDNA may remain in the cytoplasm in linear form. In dividing host cells, the cDNA enters the nucleus and is then integrated in the host genome. In the case of infected T-cell, proviral DNA may be transcribed, virions formed in the cytoplasm, and complete viral particles bud from the cell membrane. If there is extensive viral production (productive infection), the host cell dies. Alternatively, the HIV genome may remain silent, either in the cytoplasm or integrated as provirus into human chromosomes, for months or even years (latent infection). Since macrophages and dendritic cells are relatively resistant to the cytopathic effect of HIV, they are likely important reservoirs of infection. Clinically, the patient is asymptomatic or has flu-like symptoms during this first phase of HIV infection, also called the acute HIV syndrome. Approximately 40– 90% of patients develop self-limiting symptoms (sore throat, myalgias, fever, weight loss, and a rash) 3–6 weeks after infection. This phase is characterized by widespread seeding of the lymphoid tissues, loss of activated CD4þ T-cells, and the highest level of viremia at any time during infection—unfortunately with high infectivity exactly when the infection is usually undiagnosed. The initial infection is readily controlled

Chapter 3

Primary infection of cells in blood, mucosa


Dendritic cell

CD4+ T cell

Drainage to lymph nodes, spleen

Infection established in lymphoid tissue, e.g., lymph node

Acute HIV syndrome, spread of infection throughout the body

Immune response

Viremia

Anti-HIV antibodies

HIV-specific CTLs Partial control of viral replication

Provirus

Clinical latency Latent infection

Low-level infection

Other microbial infections; cytokines (e.g., TNF) Extensive viral replication and CD4+ cell lysis

AIDS

Destruction of lymphoid tissue: depletion of CD4+ T cells

Figure 3.12 Pathogenesis of HIV-1 infection. Pathogenesis of HIV-1 infection. Initially, HIV-1 infects T cells and macrophages directly or is carried to these cells by Langerhans cells. Viral replication in the regional lymph nodes leads to viremia and widespread seeding of lymphoid tissue. The viremia is controlled by the host immune response, and the patient then enters a phase of clinical latency. During this phase, viral replication in both T cells and macrophages continues unabated, but there is some immune containment of virus. Ultimately, CD4+ cell numbers decline due to productive infection and other mechanisms, and the patient develops clinical symptoms of full-blown AIDS. Reprinted by permission from Elsevier Saunders. Robbins, and Cotran: Pathologic Basis of Disease, 7th edition, copyright 2004, page 248.

59

Part I


by the development of an HIV-specific cytotoxic Tlymphocyte (CTL) response and humoral response with antibodies raised against the envelope glycoproteins (Figure 3.12), and the patient again becomes asymptomatic. However, the antibody response is ineffective at neutralizing the virus. Thus, the role that antibodies play in controlling HIV disease is unclear. The level of viremia and the viral load in the lymphoid tissue at the end of the acute HIV syndrome define the so-called set point, which differs between individual patients and has prognostic implications. It is the result of a multifactorial process that is not yet clearly understood. During the following clinical latency phase (also called the middle or chronic phase of HIV infection), the immune system is relatively intact. However, individual T-cells throughout the body, when activated by antigen contact or HIV itself, release intact virions and undergo apoptosis. Thus, it is misleading to talk about a latent infection in the context of HIV, since the definition of latency in the viral world implies a lack of viral replication. In the case of HIV, there is continuous HIV replication, predominantly in the lymphoid tissues, which may last for years. This means that HIV infection lacks a phase of true microbiological latency. Indeed, the latent phase of HIV infection is a dynamic competition between the actively replicating virus and the immune system. In a twist of fate, the life cycle in latently infected T-cells comes to completion (and usually leads to cell lysis) at the very moment when the T-cell is needed most—upon activation. On the molecular level this is achieved by sharing the transcription factor NFkB. After T-cells are activated by antigen or cytokines (such as TNFa, IL-1), signal transduction results in translocation of NFkB into the nucleus and upregulation of the expression of several cytokines. Flanking regions of the HIV genome also contain similar kB sites that are triggered by the same signal transduction molecule. Thus, the physiologic response of the T-cell stimulates virus production and leads ultimately to cell lysis and death of the infected cell. In addition, CD4þ T-cell loss is caused by mechanisms other than the direct cytopathic effect of the virus. Infected T-cells are killed by CTL cells that recognize HIV antigen presented on their cell surface. Even uninfected CD4þ T-cells, so-called innocent bystanders, are killed. Chronic activation of the immune system starts them down the pathway to apoptosis (programmed cell death), in this case activation-induced. The last phase of HIV infection is progression to full-blown AIDS. A vicious cycle of increasingly productive viremia, loss of CD4þ cells, increased susceptibility to opportunistic infections, further immune activation, and progression of cell destruction develops. The clinical picture is characterized by a breakdown of host defense, a dramatic increase in circulating virus, and clinical disease. Patients present usually with longlasting fever, fatigue, weight loss, and diarrhea [29]. The onset of certain opportunistic infections such as invasive candidiasis, mycobacteriosis, or pneumocystosis (Figure 3.13), secondary neoplasms, or HIV-associated encephalitis marks the beginning of AIDS. Prior to the 60

Figure 3.13 Opportunistic pathogen in AIDS. Cluster of Pneumocystis jirovecii cysts in bronchoalveolar lavage of an HIV-positive patient stained with toluidin blue (oil immersion, magnification 1000x).

highly active antiretroviral therapy (HAART) era, AIDS was a death sentence, but treatment with several antiviral drugs has changed the fate of HIV-infected patients greatly. Care has to be taken to avoid the development of drug resistance, which is due to the extreme plasticity of the HIV genome. Even early on during the infection, mutations are frequent due to error-prone replication by HIV and the structural flexibility of the viral envelope. Mutation and variation both in viral antigens and in viral physiology play an important role in the pathogenesis of HIV disease. This is also one reason why the quest for an HIV vaccine has remained elusive [31]. The devastating clinical course of AIDS and the unique pathologic features of HIV infection, with significant viremia persisting for years, demonstrate the essential role of the CD4 T-cell in adaptive immunity (Table 3.7). While most CD4 T-cells have relatively modest effector function, they are the central regulators of the immune response. CD4 T-cells are essential for maturation and development of B-cells and CD8þ cytotoxic T-cells, as well as for activation of macrophages. Patients with late-stage HIV infection become vulnerable to a host of opportunistic pathogens because they suffer from deteriorating antibody production, cellmediated immunity, and decreased production and altered function of every kind of immune cell.

PERSPECTIVES The five pathogens discussed in detail here do not begin to cover the breadth of microbial interactions with the host. In fact, these comparatively short discussions fail to cover the breadth of the interactions these few organisms have. Microbes, for the most part, do not enter the forbidding interior of mammalian hosts with a single, general-purpose toxin or strategy for

Chapter 3

Table 3.7

Immune Dysfunction in AIDS (Modified after [22])

Altered Monocyte/Macrophage Functions Decreased chemotaxis and phagocytosis Decreased HLA class II antigen expression Decreased antigen presentation capacity Increased secretion of IL-1, IL-6, and TNFa

Altered T-cell Functions in vivo Preferential loss of memory T-cells Susceptibility to opportunistic infections Susceptibility to neoplasms

Altered T-cell Functions in vitro Decreased Decreased Decreased Decreased

proliferate response to antigens specific cytotoxicity helper function for B-cell Ig synthesis IL-2 and IFN-g production

Polyclonal B-cell Activation Hypergammaglobulinemia and circulating immune complexes Inability to mount antibody response to new antigen Refractoriness to normal B-cell activation in vitro

causing disease. Instead, they come equipped with a variety of very specific molecular tools, each with a particular target, which allow them to survive, replicate, and be transmitted to a new host. It’s difficult to overestimate the subtlety of the interactions of pathogens with the host on the molecular level. Pathogens rarely eradicate an immune response. Rather, because of cross-talk and redundancy on a molecular level between elements of the immune system, they attenuate, misdirect, and delay the host response. Overall, the complexity and flexibility of the interaction benefits both the host and the pathogen. The pathogen benefits because, even if it is ultimately eliminated from the host, it survives and proliferates long enough and well enough to be transmitted. The host benefits because a temperate response is less likely to result in severe collateral tissue damage. In addition, if host responses were so rigid and forceful that the pathogen was forced to kill the host or die itself, the microbes, ultimately, would win, due to their rapid evolution. The mammalian immune system, for all its extraordinary complexity and power, is a compromise between metabolic cost and efficacy, between elimination and containment of pathogens, and is able to live with what it cannot destroy.

REFERENCES


3. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 10]. 4. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 6]. 5. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 7]. 6. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 3]. 7. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 9]. 8. Taylor JE, Rudenko G. Switching trypanosome coats: What’s in the wardrobe? Trends Genetics. 2006;22:614–620. 9. Pays E. Regulation of antigen gene expression in Trypanosoma brucei. Trends Parasitology. 2005;21:517–520. 10. Pays E, Vanhamme L, Perez-Morga D. Antigenic variation in Trypanosoma brucei: Facts, challenges and mysteries. Current Opinion Microbiology. 2004;7:369–374. 11. Vanhamme L, Pays E. The trypanosome lytic factor of human serum and the molecular basis of sleeping sickness. International J Parasitology. 2004;34:887–898. 12. Smith TG, Ayi K, Serghides L, et al. Innate immunity to malaria caused by Plasmodium falciparum. Clinical Invest Medicine. 2002; 25:262–272. 13. Parham P. The Immune System. New York: Garland Science; 2005. 14. Chavakis T, Preissner KT, Herrmann M. The anti-inflammatory activities of Staphylococcus aureus. TRENDS Immunology. 2007; 28:408–418. 15. Foster TJ. Immune evasion by staphylococci. Nature Reviews. 2005;3:948–958. 16. Voyich JM, Braughton KR, Sturdevant DE, et al. Insights into mechanisms used by Staphylococcus aureus to avoid destruction by human neutrophils. J Immunology. 2005;175:3907–3919. 17. Houben EN, Nguyen L, Pieters J. Interaction of pathogenic mycobacteria with the host immune system. Current Opinion Microbiology. 2006;9:76–85. 18. Pieters J. Mycobacterium tuberculosis and the macrophage: Maintaining a balance. Cell Host Microbe. 2008;3:399–407. 19. Russell DG. Who puts the tubercle in tuberculosis? Nature Reviews Microbiology. 2007;5:39–47. 20. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 5]. 21. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 8]. 22. Mori I and Nishiyama Y. Accessory genes define the relationship between the herpes simplex virus and its host. Microbes and Infection. 2006;8;2556–2562. 23. Mguyen ML and Blaho JA. Apoptosis during herpes simplex virus infection. Advances in Virus Research. 2007;69;67–97. 24. Gill N, Davies EJ, and Ashkar AA. The role of Toll-like receptor ligands/agonists in protection against genital HSV-2 infection. American Journal of Reproductive immunology. 2008;59;35–43. 25. Finberg RW, Knipe DM, and Kurt-Jones EA. Herpes simplex virus and Toll-like receptors. Viral Immunology. 2005;18;457–465. 26. Cunningham AL, Diefenbach RJ, Miranda-Saksena M, et al. The cycle of herpes simplex virus infection: virus transport and immune control. Journal of Infectious Disease. 2006;194;S11–18. 27. HIV-1. UNAIDS. 2007 AIDS epidemic update. 2008. http://www. unaids.org/en/ accessed July 11, 2008. 28. Johnston MI, Fauci AS. An HIV vaccine—Evolving concepts. N Engl J Med. 2007;356:2073–2081. 29. Abbas AK. Diseases of immunity. In: Kumar V, Abbas A, Fausto N, eds. Robbins and Cotran Pathologic Basis of Disease. Philadelphia: Elsevier Saunders; 2004:245–258. 30. Hladik F, Sakchalathorn P, Ballweber L, et al. Initial events in establishing vaginal entry and infection by human immunodeficiency virus type-1. Immunity. 2007;26:257–270. 31. Walker BD, Burton DR. Toward an AIDS vaccine. Science. 2008; 320:760–764

1. Murphy K, Travers P, Walport M. Janeway’s Immunobiology. 7th ed. New York: Garland Science; 2008 [Chapter 1]. 2. Murphy K, Travers P, Walport M. Janeway’s Immunobiology, 7th ed. New York: Garland Science; 2008 [Chapter 2].

61


C h a p t e r

4 Neoplasia William B. Coleman

INTRODUCTION Cancer does not represent a single disease. Rather, cancer is a collection of myriad diseases with as many different manifestations as there are tissues and cell types in the human body, involving innumerable endogenous or exogenous carcinogenic agents, and various etiological mechanisms. What all of these disease states share in common are certain biological properties of the cells that compose the tumors, including unregulated (clonal) cell growth, impaired cellular differentiation, invasiveness, and metastatic potential. It is now recognized that cancer, in its simplest form, is a genetic disease or, more precisely, a disease of abnormal gene expression. Recent research efforts have revealed that different forms of cancer share common molecular mechanisms governing uncontrolled cellular proliferation, involving loss, mutation, or dysregulation of genes that positively and negatively regulate cell proliferation, migration, and differentiation (generally classified as proto-oncogenes and tumor suppressor genes). The molecular mechanisms associated with neoplastic transformation and tumorigenesis of specific cell types is beyond the scope of this chapter. Rather, in the discussion that follows, we will introduce basic and essential concepts related to neoplastic disease as a foundation for more detailed treatment of the molecular carcinogenesis of major cancer types provided elsewhere in this book. In this chapter, we provide an overview of cancer statistics and epidemiology, highlighting cancer types of importance to human health in the United States and worldwide, with a brief review of risk factors for the development of cancer. Subsequently, we discuss the classification of neoplasms, focusing on the general features of benign and malignant neoplasms, with an overview of nomenclature for human neoplasms, a description of preneoplastic conditions, and consideration of special subsets of neoplastic disease (cancers of childhood, hematopoietic neoplasms, and hereditary cancers). Next, we discuss in some detail the distinguishing characteristics of benign and malignant neoplasms, with a focus on anaplasia and cellular Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

Tara C. Rubinas

differentiation, rate of growth, local invasiveness, and metastasis. We conclude with a discussion of the clinical aspects of neoplasia, including an overview of cancer-associated pain, cancer cachexia, paraneoplastic syndromes, and methods for grading and staging of cancer.

CANCER STATISTICS AND EPIDEMIOLOGY Cancer Incidence Cancer is an important public health concern in the United States and worldwide. Due to the lack of nationwide cancer registries for all countries, the exact numbers of the various forms of cancer occurring in the world populations are unknown. Nevertheless, estimations of cancer incidence and mortality are generated on an annual basis by several domestic and world organizations. Estimations of cancer incidence and mortality for the United States are provided annually by the American Cancer Society (ACS) and the National Cancer Institute’s Surveillance, Epidemiology, and End Results (SEER) program. Global cancer statistics are provided by the International Agency for Research on Cancer (IARC) and the World Health Organization (WHO). Monitoring of long-range trends in cancer incidence and mortality among different populations is important for investigations of cancer etiology. Given the long latency for formation of a clinically detectable neoplasm (up to 20–30 years) following initiation of the carcinogenic process (exposure to carcinogenic agent), current trends in cancer incidence probably reflect exposures that occurred many years (and possibly decades) before. Thus, correlative analysis of current trends in cancer incidence with recent trends in occupational, habitual, and environmental exposures to known or suspect carcinogens can provide clues to cancer etiology. Other factors that influence cancer incidence include the size and average age of the affected population. The average age at the time of cancer diagnosis for all tumor sites is 63

Part I


approximately 67 years [1]. As a higher percentage of the population reaches age 60, the general incidence of cancer will increase proportionally. Thus, as the life expectancy of the human population increases due to reductions in other causes of premature death (due to infectious and cardiovascular diseases), the average risk of developing cancer will increase.

General Trends in Cancer Incidence The American Cancer Society estimates that 1,437,180 new cases of invasive cancer were diagnosed in the United States in 2008 [2]. This number of new cancer cases reflects 745,180 male cancer cases (52%) and 692,000 female cancer cases (48%). The estimate of total new cases of invasive cancer does not include carcinoma in situ occurring at any site other than in the urinary bladder, and does not include basal and squamous cell carcinomas of the skin. In fact, basal and squamous cell carcinomas of the skin represent the most frequently occurring neoplasms in the United States, with an estimated occurrence of >1 million total cases in 2008 [2]. Likewise, carcinoma in situ represents a significant number of new cancer cases with 67,770 newly diagnosed breast carcinomas in situ and 54,020 new cases of melanoma carcinoma in situ [2]. Estimated site-specific cancer incidence for both sexes combined are shown in Figure 4.1. Cancers of

the reproductive organs represent the largest group of newly diagnosed cancers in 2008 with 274,150 new cases. This group of cancers includes prostate (186,320 new cases), uterine corpus (40,100 new cases), ovary (21,650 new cases), and uterine cervix (11,070 new cases), in addition to other organs of the genital system (vulva, vagina, and other female genital organs; testis, penis, and other male genital organs). The next most frequently occurring tumors originated in the digestive tract (271,290 new cases), respiratory system (232,270 new cases), and breast (184,450 new cases). The majority of digestive system tumors involved colon (108,070 new cases), rectum (40,740 new cases), pancreas (37,680 new cases), stomach (21,500 new cases), liver and intrahepatic bile duct (21,370 new cases), and esophagus (16,470 new cases), in addition to the other digestive system organs (small intestine, gallbladder, and others). Most new cases of cancer involving the respiratory system affected the lung and bronchus (215,020 new cases), with the remaining cases affecting the larynx or other components of the respiratory system. Other sites with significant cancer burden include the urinary system (125,490 new cases), lymphomas (74,340 new cases), skin (67,720 new cases), leukemias (44,270 new cases), and the oral cavity and pharynx (35,310 new cases). Among men, cancers of the prostate, respiratory system (lung and bronchus), and digestive system (colon

Other and Unspecified Primary Sites Other and Unspecified Primary Sites Leukemia Oral Cavity and Pharynx Oral Cavity and Pharynx Multiple Myeloma Leukemia Lymphoma Multiple Myeloma Endocrine System Lymphoma Brain and Endocrine System Other Nervous Brain and Other Nervous Eye and Digestive Digestive Orbit System System Urinary Urinary System System Respiratory System

Reproductive Organs

Reproductive Organs

Breast Breast

Incidence

Bones and Joints Soft Tissue Skin Skin Soft Tissue Bones and Joints

Respiratory System

Deaths

Figure 4.1 Cancer incidence and mortality by site for both sexes (United States, 2008). The relative contributions of the major forms of cancer to overall cancer incidence and cancer-related mortality (both sexes combined) were calculated from data provided by Jemal et al. [2]. Cancers of the reproductive organs include those affecting the prostate, uterine corpus, ovary, uterine cervix, vulva, vagina, testis, penis, and other organs of the male and female genital systems. Cancers of the digestive system include those affecting esophagus, stomach, small intestine, colon, rectum, anus, liver, gallbladder, pancreas, and other digestive organs. Cancers of the respiratory system include those affecting the lung, bronchus, larynx, and other respiratory organs. 64

Chapter 4

and rectum) occur most frequently [2]. Together, these cancers account for 62% of all cancers diagnosed in men. Prostate is the leading site, accounting for 186,320 new cases and 25% of cancers diagnosed in men. Among women, cancers of the breast, respiratory system (lung and bronchus), and digestive system (colon and rectum) occur most frequently [2]. Cancers at these sites combine to account for 59% of all cancers diagnosed in women. Breast is the leading site for tumors affecting women, accounting for 182,460 new cases and 26% of all cancers diagnosed in women.

General Trends in Cancer Mortality in the United States Mortality attributable to invasive cancers produced 565,650 cancer deaths in 2008 [2]. This reflects 294,120 male cancer deaths (52% of total) and 271,530 female cancer deaths (48% of total). Estimated numbers of cancer deaths by site for both sexes are shown in Figure 4.1. The leading cause of cancer death involves tumors of the respiratory system (166,280 deaths), the majority of which are neoplasms of the lung and bronchus (161,840 deaths). The second leading cause of cancer deaths involve tumors of the digestive system (135,130 deaths), most of which are tumors of the colorectum (49,960 deaths), pancreas (34,290 deaths), stomach (10,880 deaths), liver and intrahepatic bile duct (18,410 deaths), and esophagus (14,280 deaths). Together, tumors of the respiratory and digestive systems account for 53% of cancer deaths. Trends in cancer mortality among men and women mirror in large part cancer incidence. Cancers of the prostate, lung and bronchus, and colorectum represent the three leading sites for cancer incidence and cancer mortality among men [2]. In a similar fashion, cancers of the breast, lung and bronchus, and colorectum represent the leading sites for cancer incidence and mortality among women [2]. While cancers of the prostate and breast represent the leading sites for new cancer diagnoses among men and women (respectively), the majority of cancer deaths in both sexes are related to cancers of the lung and bronchus. Tumors of the lung and bronchus are responsible for 31% of all cancer deaths among men and 26% of all cancer deaths among women. The age-adjusted death rate for lung cancer among men has increased dramatically over the last 60–70 years, while the death rates for other cancers (like prostate and colorectal) have remained relatively stable. The lung cancer death rate for women has increased in an equally dramatic fashion since about 1960, becoming the leading cause of female cancer death in the mid-1980s after surpassing the death rate for breast cancer [2].

Global Cancer Incidence and Mortality The IARC GLOBOCAN project estimates that 10,862,496 new cancer cases were diagnosed worldwide in 2002 [3]. This number of new cases represents 5,801,839 male cancer cases (53%) and 5,060,657

Neoplasia

female cancer cases (47%). Mortality attributed to cancer for the same year produced 6,723,887 deaths worldwide. This reflects 3,795,991 male cancer deaths (56%) and 2,927,896 female cancer deaths (44%). The leading sites for cancer incidence and mortality worldwide in 2002 included tumors of the lung, stomach, prostate, breast, colorectum, esophagus, and liver. Lung cancer accounted for the most new cancer cases and the most cancer deaths during this period of time, with 1,352,132 new cases and 1,178,918 deaths for both sexes combined. The leading sites for cancer incidence among males included lung (965,241 new cases), prostate (679,023 new cases), stomach (603,419 new cases), colorectum (550,465 new cases), and liver (442,119 new cases) [3]. Combined, cancers at these five sites account for 44% of all cancer cases among men. The leading causes of cancer death among men included tumors of the lung (848,132 deaths), stomach (446,052 deaths), liver (416,882 deaths), colorectum (278,446 deaths), and esophagus (261,162 deaths) [3]. Deaths from these cancers account for 59% of all male cancer deaths. The leading sites for cancer incidence among females included breast (1,151,298 new cases), cervix uteri (493,243 new cases), colorectum (472,687 new cases), lung (386,891 new cases), and stomach (330,518 new cases) [3]. Combined, cancers at these five sites account for 56% of all cancer cases among women. The leading causes of cancer death among females directly mirrors the leading causes of cancer incidence: breast (410,712 deaths), lung (330,786 deaths), cervix uteri (273,505 deaths), stomach (254,297 deaths), and colorectum (250,532 deaths) [3]. Combined, these five cancer sites account for 52% of female cancer deaths.

Risk Factors for the Development of Cancer Risk factors for cancer can be considered anything that increases the chance that an individual will develop neoplastic disease. Individuals who have risk factors for cancer development are more likely to develop the disease at some point in their lives than the general population (lacking the same risk factors). However, having one or more risk factors does not necessarily mean that a person will develop cancer. It follows that some people with recognized risk factors for cancer will never develop the disease, while others lacking apparent risk factors for cancer will develop neoplastic disease. While certain risk factors are clearly associated with the development of neoplastic disease, making a direct linkage from a risk factor to causation of the disease remains very difficult and often impossible. Some risk factors for cancer development can be modified, while others cannot. For instance, cessation of cigarette smoking reduces the chance that an individual will develop cancer of the lung, bronchus, or other tissues of the aerodigestive tract. In contrast, a woman with an inherited mutation in the BRCA1 gene carries an elevated lifetime risk of developing breast cancer. In general, risk factors for cancer include age, sex, family medical history, exposure to 65


60−64

65−69

70−74

75−79

80−84

84+

60−64

65−69

70−74

75−79

80−84

84+

55−59

50−54

45−49

20−24

55−59

Colorectal Cancer (Total) Incidence Deaths

50−54

80−84

75−79

70−74

65−69

60−64

55−59

50−54

45−49

40−44

35−39

30−34

25−29

20−24

84+ 84+

80−84

75−79

70−74

65−69

60−64

55−59

50−54

45−49

40−44

35−39

30−34

25−29

Lung Cancer (Total) Incidence Deaths

20−24

Age-specific Rate Per 100,000 Population

450 400 350 300 250 200 150 100 50 0

40−44

500 450 400 350 300 250 200 150 100 50 0

0

45−49

200

35−39

400

40−44

600

35−39

800

Breast Cancer (Female) Incidence Deaths

30−34

1000

500 450 400 350 300 250 200 150 100 50 0

25−29

1200

Prostate Cancer Incidence Deaths

30−34

Age-specific Rate Per 100,000 Population

1400

25−29

Cancer is predominantly a disease of old age. Thus, advancing age is the most important risk factor for cancer development for most people [4,5]. In fact, most malignant neoplasms are diagnosed in patients over the age of 65. According to the National Cancer Institute SEER Statistics (http://seer.cancer.gov/index. html) the median age at diagnosis for cancer of the lung/bronchus is 71 years old (1 [87]. A mediator of the proteasomal degradation of E2F-1, the S phase kinase-associated protein 2 (Skp2) F-box protein accumulates in high-grade NE carcinomas (86%), and its overexpression has been associated with advanced stage and nodal metastasis in pulmonary NE tumors [88]. In the high-grade NE tumors, Skp2 appears 319

Part IV


to interact with E2F-1 and stimulate its transcriptional activity toward the cyclin E promoter [87,88]. Telomeres play an important role in the protection of chromosomes against degradation. Telomerases, the enzymes that synthesize telomeric DNA strands, serve to counterbalance losses of DNA during cell divisions. High telomerase activity has been noted in over 80% of SCLCs and LCNECs [89–91] versus 14% or fewer typical carcinoids [91,92]. Expression of human telomerase mRNA component (hTERC) and human telomerase reverse transcriptase (hTERT) mRNA were reported, respectively, in 58% and 74% of typical carcinoids; and in 100% and 100% of atypical carcinoids, LCNECs and SCLCs, and telomere length alterations in LCNECs and SCLCs were greater than in typical carcinoids [92]. Aberrant methylation of cytosine-guanine (CpG) islands in promoter regions of malignant cells is an important mechanism for silencing of TSGs (epigenetic inactivation). Methylation of DNA involves the transfer of a methyl group, by a DNA methyltransferase, to the cytosine of a CpG dinucleotide [93]. RASSF1A is a potential TSG that undergoes epigenetic inactivation in virtually all SCLCs and a majority of NSCLCs through hypermethylation of its promoter region [94,95]. NE tumors have lower frequencies of methylation of p16, APC, and CDH13 (H-cadherin) than NSCLCs [95]. SCLCs have higher frequencies of methylation of RASSF1A, CDH1 (E-cadherin), and RARb than carcinoids [95]. Promoter methylation of CASP8, which encodes the apoptosis-inducing cysteine protease caspase 8, was also found in 35% of SCLCs, 18% of carcinoids, and no NSCLCs, suggesting that CASP8 may function as a TSG in NE lung tumors [96]. Although histologically defined precursors for SCLC are lacking, a higher incidence of genetic abnormalities is found in the normal or hyperplasic airway epithelium of patients with SCLC than NSCLC [97]. By extension, it has been suggested that SCLC may arise directly from histologically normal or mildly abnormal epithelium, rather than evolving through a sequence of recognizable histologic intermediary changes [11]. Relatively little is known about molecular abnormalities in precursors of carcinoids. Although carcinoids have been viewed as arising from tumorlets, 11q13 (int-2) allelic imbalance is significantly more common in carcinoids (73%) than in tumorlets (9%), and may represent an early event in carcinoid tumor formation [98]. The int-2 gene lies in close proximity to MEN1, a tumor suppressor gene frequently mutated in NE tumors [98]. The molecular pathology of DIPNECH remains to be elucidated.

neoplasms. Pulmonary inflammatory myofibroblastic tumor (IMT) is a lesion composed of myofibroblastic cells, collagen, and inflammatory cells that primarily occurs in individuals less than 40 years of age, and is the most common endobronchial mesenchymal lesion in childhood (Figure 18.21) [99]. Synovial sarcoma is usually a soft tissue malignancy, but uncommonly arises in the pleura or the lung and often takes an aggressive course [100]. Pulmonary hamartomas are benign neoplasms consisting of mixtures of cartilage, fat, connective tissue, and smooth muscle, which present as coin lesions on chest radiographs and are excised in order to rule out a malignancy (Figure 18.22).

Figure 18.21 Inflammatory myofibroblastic tumor. The tumor consists of a proliferation of cytologically bland spindle cells in a background of collagen, with abundant lymphocytes and plasma cells.

Mesenchymal Neoplasms Mesenchymal neoplasms included in the WHO classification scheme (Table 18.1) encompass a spectrum of malignant and benign proliferations that show differentiation along multiple lineages. Overall, these tumors are much less common in the lung than are epithelial neoplasms. Information about molecular pathogenesis has emerged for some of the mesenchymal 320

Figure 18.22 Hamartoma. A hamartoma typically includes the components of mature cartilage, adipose tissue, and myxoid or fibrous tissue, all of which are shown here.

Chapter 18

Molecular Pathogenesis Many IMTs demonstrate clonal abnormalities with rearrangements of chromosome 2p23 and the anaplastic lymphoma kinase (ALK) gene [101]. The rearrangements involve fusion of tropomyosin (TPM) N-terminal coiled-coil domains to the ALK C-terminal kinase domain, producing two ALK fusion genes, TPM4–ALK and TPM3–ALK, which encode oncoproteins with constitutive kinase activity [102]. Like their soft tissue counterparts, more than 90% of pulmonary and pleural synovial sarcomas demonstrate a chromosomal translocation t(X;18) (SYT-SSX) [103,104]. Detection of this translocation can be very helpful for confirming the diagnosis of synovial sarcoma in this unusual location. Most pulmonary hamartomas show abnormalities of chromosomal bands 6p21, 12q14–15, or other regions [105], corresponding to mutations of high-mobility group (HMG) proteins, a family of nonhistone chromatin-associated proteins that serve an important role in regulating chromatin architecture and gene expression [106].

Pleural Malignant Mesothelioma Clinical and Pathologic Features Malignant mesothelioma (MM) is an uncommon, aggressive tumor arising from mesothelial cells on serosal surfaces, primarily the pleura and peritoneum, and less often the pericardium or tunica vaginalis. The most important risk factor for MM is exposure to the subset of asbestos fibers known as amphiboles (crocidolite and amosite) [107]. The incidence of this tumor in the United States peaked in the early to mid-1990s, and appears to be declining, likely related to decreases in the use of amphiboles since their peak period of importation in the 1960s [107]. These tumors are characterized by long latency periods between asbestos exposure and clinical presentation of the tumor, with a mean of 30– 40 years [108]. Radiation, a nonasbestos fiber known as erionite, and potentially other processes associated with pleural scarring have also been implicated in the causation of smaller numbers of cases of malignant mesothelioma [108], and a role for Simian virus 40 (SV40) in the genesis of this tumor has been suggested by some, but remains controversial [109,110]. Pleural MM most commonly arises in males over the age of 60. Presenting features typically include a hemorrhagic pleural effusion associated with shortness of breath and chest wall pain. Weight loss and malaise are common. By the time the tumor is discovered, patients usually have extensive involvement of the pleural surfaces. With progression, the tumor typically invades the lung, chest wall, and diaphragm. Lymph node metastasis can cause superior vena caval obstruction, and cardiac tamponade, subcutaneous nodules, and contralateral lung involvement can also occur. From the time of diagnosis, the median survival is 12 months [110]. Treatment may include surgery, chemotherapy, radiotherapy, immunotherapy, or other treatments, often in combination [110]. The intent of surgery is usually palliative. Whether extrapleural pneumonectomy with

Molecular Basis of Pulmonary Disease

chemotherapy and radiotherapy can lead to cure is unclear [111]. New agents are currently under investigation for their potential to improve the life expectancy and quality of life in patients with this aggressive malignancy. Gross pathologic features of MM include pleural nodules which grow and coalesce to fill the pleural cavity and form a thick rind around the lung. A firm tan appearance is common, and occasionally the tumor can have a gelatinous consistency (Figure 18.23). Extension along the interlobar fissures and invasion into the adjacent lung, diaphragm, and chest wall are characteristic. Further spread can occur into the pericardial cavity and around other mediastinal structures, and distant metastases can also develop. Histologically, MM manifests a wide variety of histologic patterns. The major histologic categories include epithelioid mesothelioma, sarcomatoid mesothelioma, desmoplastic mesothelioma, and biphasic mesothelioma [108]. Epithelioid mesothelioma consists of round, ovoid, or polygonal cells with eosinophilic cytoplasm and nuclei that are usually round with little cytoatypia (Figure 18.24). These cells most often form sheets, tubulopapillary structures, or gland-like arrangements, and some tumors can have a myxoid appearance due to production of large amounts of hyaluronate. Sarcomatoid mesothelioma is composed of malignant-appearing spindle cells occasionally accompanied by mature sarcomatous components (osteosarcoma, chondrosarcoma, others). Desmoplastic mesothelioma can be a diagnostic challenge due to its frequently bland appearance and resemblance to organizing pleuritis. It consists of variably atypical spindle cells in a dense collagenous matrix (Figure 18.25). Helpful features for separating

Figure 18.23 Malignant mesothelioma. The tan/white tumor involves the entire pleura surrounding and compressing the underlying parenchyma, which appears congested but relatively unremarkable. 321

Part IV


Figure 18.24 Malignant mesothelioma, epithelioid. This neoplasm consists of sheets of polygonal cells with pleomorphic nuclei and also forms some papillary structures (left).

this tumor from organizing pleuritis include invasion of chest wall muscle or adipose tissue and necrosis. Biphasic mesotheliomas include both epithelioid and sarcomatoid elements, each comprising at least 10% of the tumor [108]. Pathologic diagnosis of MM has been greatly assisted by the expanded availability of antibodies for use in immunohistochemistry [112]. Mesothelial differentiation can be supported by immunoreactivity with cytokeratin 5/6, calretinin (Figure 18.26), HBME-1, D2–40, and other antibodies. Histologic distinction of epithelioid

Figure 18.26 Malignant mesothelioma (immunohistochemical stain for calretinin). The tumor demonstrates cytoplasmic and nuclear staining (brown) for calretinin, which is expressed by many epithelioid malignant mesotheliomas.

mesotheliomas from metastatic ACs is a common need in practice, and a panel approach using calretinin and cytokeratin 5/6, with other antibodies reactive with ACs (CEA, MOC-31, Ber-EP4, leu M1, B72.3, and others) will usually be successful. Electron microscopy can also be helpful in difficult cases by demonstrating long thin microvilli in many MMs with an epithelioid component. Pan-cytokeratin staining is helpful for supporting a diagnosis of sarcomatoid or desmoplastic MM as opposed to sarcoma, since most (but not all) sarcomas will not stain for pan-cytokeratin. Other mesothelial and mesenchymal markers can also be useful for assisting in the differentiation of MM from histologically similar sarcomas. Precursor lesions for MM have not been clearly defined from a histologic standpoint, although it is likely that an in situ stage exists [108]. The term atypical mesothelial hyperplasia has been recommended for surface (noninvasive) proliferations of mesothelial cells of uncertain malignant potential [108].

Molecular Pathogenesis

Figure 18.25 Malignant mesothelioma, desmoplastic. Abundant dense collagen is characteristic of this tumor, and is shown in the upper right. Tumor cells are spindle shaped and relatively cytologically bland. The slit-like spaces observed in the dense collagen are another frequent feature. The tumor infiltrates adipose tissue, which is helpful in confirming that the tumor is a mesothelioma, as opposed to organizing pleuritis. 322

Exposure to asbestos fibers is believed to trigger the pathobiological changes leading to the majority of MMs. Currently, it is believed that asbestos may act as an initiator (genetically) and promoter (epigenetically) in the development of MMs [113]. The degree to which tumorigenesis results from direct interactions of the fibers with the mesothelial cells, or through other mechanisms involving oxidative stress (or both), is unresolved [113,114]. Multiple chromosomal alterations are often noted in MMs, and inactivation of TSGs plays an important part in the pathogenesis of MM [113]. A variety of genetic abnormalities have been reported including deletions of 1p21–22, 3p21, 4p, 4q, 6q, 9p21, 13q13–14, 14q, and proximal 15q, monosomy 22, and gains of 1q, 5p, 7p, 8q22–24, and 15q22–

Chapter 18

25 [108,115]. The most common genetic abnormality in MM is a deletion in 9p21 encompassing the CDKN2A locus encoding the tumor suppressors p16INK4a and p14ARF, which participate in the p53 and Rb pathways and inhibit cell cycle progression (Figure 18.2) [113,116]. Recent studies have shown that SV40 large T antigen (present in some MMs) inactivates the TSG products Rb and p53, raising the possibility that asbestos and SV40 could act as co-carcinogens in MM and suggesting that perturbations of Rb- and p53-dependent growth-regulatory pathways may be involved in the pathogenesis of MM [115]. Other common findings include inactivating mutations with allelic loss in the TSG neurofibromin 2 (NF2), found at chromosome 22q12 [117], and inactivation of CDKN2A/p14ARF and GPC3 (another TSG) by promoter methylation [108]. Loss of CDKN2A/ p14ARF also results in MDM2-mediated inactivation of p53 [116]. However, in MMs, unlike many other epithelial tumors, mutations in the TP53, RB, and RAS genes are rare [118]. The Wnt signal transduction pathway is also abnormally activated in MMs and appears to play a role in pathogenesis [119]. Activation of the pathway leads to accumulation of b-catenin in the cytoplasm and its translocation to the nucleus. Interactions with TCF/ LEF transcription factors promote expression of multiple genes including c-myc and Cyclin D. The mechanism of activation does not appear to involve mutations in the b-catenin gene, but may instead involve more upstream components of the pathway, such as the disheveled proteins [119]. Recent evidence also suggests that the phosphatidylinositol 3-kinase (PI3–K/AKT) pathway is frequently activated in MMs, and that inhibition of this pathway can increase sensitivity to a chemotherapeutic agent [120]. The Wilms’ tumor gene (WT1) is also expressed in most MMs, but its role in the pathogenesis of MM is unclear [114]. Finally, EGFR signaling in MMs has recently become a focus of greater attention, and there are some data showing that the EGFR is an early cell membrane target of asbestos fibers and is linked to activation of the MAPK cascade [113]. Unfortunately, a Phase II clinical trial of gefitinib treatment in patients with MMs did not show effectiveness, despite EGFR overexpression in over 97% of cases [121]. Another study found that common EGFR mutations conferring sensitivity to gefitinib are not prevalent in human malignant mesothelioma [122]. Further investigation continues into new, potentially efficacious agents for the treatment of MM.

NON-NEOPLASTIC LUNG DISEASE Non-neoplastic pulmonary pathology comprises inflammatory and fibrosing diseases of the conducting airways, alveoli, vessels, and lymphoid tissue. This pathology may be localized or diffuse, may either have an obvious etiology or be idiopathic, and may cause injury that is reparable or irreparable. Most importantly, an understanding of non-neoplastic lung pathology plays a vital role in the clinical management of these diseases. This section covers the major types of obstructive and interstitial


diseases, the vascular lesions, the pneumonias, the occupational diseases, the major histiocytic conditions, and the most common developmental anomalies. This list does not include all of the non-neoplastic diseases that can affect the lung, but it represents those that are responsible for the majority of illness. Also, the conditions highlighted within each of these categories are those about which we best understand the molecular biology of the disease mechanisms.

OBSTRUCTIVE LUNG DISEASES Obstructive lung diseases are characterized by a reduction in airflow due to airway narrowing. This airflow reduction occurs, in general, by two basic mechanisms: (i) inflammation and injury of the airway, resulting in obstruction by mucous and cellular debris within and around the airway lumen; and (ii) destruction of the elastin fibers of the alveolar walls, causing loss of elastic recoil and subsequent premature collapse of the airway during the expiratory phase of respiration. There are four major obstructive lung diseases: asthma, emphysema, chronic bronchitis, and bronchiectasis.

Asthma Clinical and Pathologic Features Asthma is a chronic inflammatory disease of the airways that affects more than 150 million people worldwide. The prevalence of disabling asthma has increased over 200% since 1969, ranging from as low as 1% in rural Ethiopia to over 20% among children in parts of Central and South America [123]. In the United States, asthma affects approximately 8%–10% of the population and is the leading cause of hospitalization among children less than 15 years of age [123]. Clinically, the disease is defined as a generalized obstruction of airflow with a reversibility that can occur spontaneously or with therapy. It is characterized by recurrent wheezing, cough, or shortness of breath resulting from airway hyperactivity and mucus hypersecretion. The hyperresponsiveness is a result of acute bronchospasm and can be elicited for diagnostic purposes using histamine or methacholine challenges. The key feature of these symptoms is that they are variable—worse at night or in the early morning, and in some people worse after exercise. It has previously been assumed that these symptoms are separated by intervals of normal physiology. However, evidence is now accumulating that asthma can cause progressive lung impairment due to chronic morphologic changes in the airways. The treatment strategies for this complex disease are myriad. In atopic individuals, allergen avoidance should be the primary therapy. For example, in children, reducing exposure to house dust mites early in life decreases sensitization and the incidence of disease. For those who do develop the disease, avoidance of allergens later in life improves symptom control. Established treatments for asthma flairs include inhaled corticosteroids, and short-acting and long323

Part IV


acting b2-adrenoceptor agonists. Phosphodiesterase (PDE) inhibitors such as theophylline have been used for decades to treat asthmatic bronchoconstriction, but both cardiac and central nervous systems side effects have limited their use. Newer PDE inhibitors without side effects include non-xanthine drugs such as rofumilast. The pathologic changes to the airways in asthma are very similar to those seen in chronic bronchitis. They consist of a thickened basement membrane with epithelial desquamation, goblet cell hyperplasia, and subepithelial elastin deposition. In the wall of the airway, smooth muscle hypertrophy and submucosal gland hyperplasia are also present (Figure 18.27). In acute asthma exacerbations, a transmural chronic inflammatory infiltrate with variable amounts of eosinophilia may be present, resulting in epithelial injury and desquamation that can become quite pronounced. One sees clumps of degenerating epithelial cells mixed with mucin in the lumen airway. These aggregates of degenerating cells are referred to as Creola bodies and can be seen in expectorated mucin from these patients. Also present in these sputum samples are Charcot-Leyden crystals, rhomboid-shaped structures that represent breakdown products from eosinophil cytoplasmic granules (Figure 18.28). The changes seen in the walls of these airways represent long-term airway remodeling caused by prolonged inflammation. This remodeling may play a role in the pathophysiology of asthma. The amount of airway remodeling is highly variable from patient to patient, but remodeling has been found even in patients with mild asthma. Currently, the effect of the treatment on this chronic pathology is unclear [124].

Molecular Pathogenesis The pathogenesis of asthma is complex, and most likely involves both genetic and environmental components. Most experts now see it as a disease in which an insult initiates a series of events in a genetically susceptible

G

Figure 18.27 Asthma. The bronchial wall from a patient with asthma shows marked inflammation with eosinophils, mucosal goblet cell hyperplasia (G), and an increase in the smooth muscle. 324

Figure 18.28 Asthma. Charcot-Leyden crystals are rhomboid-shaped structures within a mucous plug from an airway of an asthmatic patient. In addition, there are abundant eosinophils. These crystals are made of breakdown products of eosinophils, including major basic protein.

host. No single gene accounts for the familial component of this disease. Genetic analysis of these patients reveals a prevalence of specific HLA alleles, polymorphisms of Fc ERiB, IL-4, and CD14 [125,126]. Asthma can be classified using a number of different schema. Most commonly, asthma is divided into two categories: atopic (allergic) and nonatopic (nonallergic). Atopic asthma results from an allergic sensitization usually early in life and has its onset in early childhood. Nonatopic asthma is late-onset and, though the immunopathology has not been as well studied, probably has similar mechanisms to atopic asthma. Although this nosology is convenient for purposes of understanding the mechanisms of the disease, most patients manifest a combination of these two categories with overlapping symptoms. Th0 pathogenetic mechanisms of both types encompass a variety of cells and their products. These include airway epithelium, smooth muscle cells, fibroblasts, mast cells, eosinophils, and T-cells. The asthma response includes two phases: an early response comprising an acute bronchospastic event within 15–30 minutes after exposure, and a late response that peaks approximately 4–6 hours and that can have prolonged effects. If one wants to understand this complex response, it is best to divide it into three components: (i) a type 1 hypersensitivity response, (ii) acute and chronic inflammation, and (iii) bronchial hyperactivity. Type 1 Hypersensitivity In general, human asthma is associated with a predominance of Type 2 helper cells with a CD4þ phenotype. These Th2-type cells result from the uptake and processing of viral, allergen, and environmental triggers that initiate the episode. The processing includes the presentation of these triggers by the airway dendritic cells to naive T-cells (Th0), resulting in their differentiation into populations of Th1 and Th2. The Th2 differentiation is a result of IL10 release by the dendritic cells, and the Th2 cells then

Chapter 18

Y

further propagate the inflammatory reaction in two ways. First, they release a variety of cytokines such as IL-4, IL-5, and IL-13 that mediate a wide variety of responses. IL-4 and IL-13 stimulate B-cells and plasma cells to produce IgE, which, in turn, stimulates mast cell maturation and the release of multiple mediators, including histamine and leukotrienes. Second, these Th2 cells secrete IL-5 that, together with IL-4, also stimulates mast cells to secrete histamine, tryptase, chymase, and the cysteinyl leukotrienes causing the bronchoconstrictor response that occurs rapidly after the exposure to the allergen. IL-5 from these lymphocytes also recruits eosinophils to the airways and stimulates the release of the contents of their granules, including eosinophil cationic protein (ECP), major basic protein (MBP), eosinophil peroxidase, and eosinophil-derived neurotoxin. These compounds not only induce the bronchial wall hyperactivity but are also responsible for the increased vascular permeability that produces the transmural edema in the airways. The cells can differentiate into Th1 cells as a result of IL-12 produced by dendritic cells. These Th1 cells produce interferon-gamma (IFN-g), IL-2, and lymphotoxin, which play a role in macrophage activation in delayedtype hypersensitivity reactions as seen in diseases such as rheumatoid arthritis and tuberculosis [123]. These Th1 cells are predominantly responsible for defense against intracellular organisms and are more prominent in normal airways and in airways of patients with emphysema than in asthmatics. However, in severe forms of asthma, Th1 cells are recruited and have the capacity to secrete tumor necrosis factor (TNF)-a and IFN-g, which may lead to the tissue-damaging immune response one sees in these airways (Figure 18.29) [127,128]. Y

Y

B Cell Plasma Cell

Y IgE


Acute and Chronic Inflammation The role of acute and chronic inflammatory cells, including eosinophils, mast cells, macrophages, and lymphocytes, in asthma is evident in the abundance of these cells in airways, sputum, and bronchoalveolar samples from patients with this disease. The number of eosinophils in the airways correlates with the severity of asthma and the amount of bronchial hyperresponsiveness. Proteins released by these cells including ECP, MCP, and eosinophil-derived neurotoxin cause at least some of the epithelial damage seen in the active form of asthma. Neutrophils are prominent in the more acute exacerbations of asthma and are probably recruited to these airways by IL-8, a potent neutrophil chemoattractant released by airway epithelial cells [123]. These cells also release proteases, reactive oxygen species (ROS), and other proinflammatory mediators that, in addition to the epithelial damage, also contribute to the airway destruction and remodeling that occurs in the more chronic forms of this disease. The susceptibility of the epithelium in asthma to this oxidant injury may be increased due to decreased antioxidants such as superoxide dismutase in these lungs [129]. Finally, mast cells are activated to release an abundance of mediators through the binding of IgE to FceRI, high-affinity receptors on their surface. Allergens bind to IgE molecules and induce a cross-linking of these molecules, leading to activation of the mast cell and release of a number of mediators, most notably histamine, tryptase, and various leukotrienes, including leukotriene D4 (LTD4), and interact with the smooth muscle to induce contraction and the acute bronchospastic response [130].

Y

Y

FcεR1

Y Y

Allergen Histoamines Leukotrienes Allergic Cytokines Asthma Basic proteins Prostaglandins

Mast Cell Basophil

IL-4 IL-13

Y

Y

IL-5

Antigen-presenting Cell

Th2 Cell

Eosinophil

Figure 18.29 Inflammation in asthma. Inflammatory cascade in allergic asthma involves presentation of the allergen by an antigen-presenting cell to Th2 cells. This causes a release of multiple cytokines that lead to the recruitment of eosinophils, macrophages, and basophils [adapted from 128]. 325

Part IV


Bronchial Hyperactivity The cornerstone of asthma is the hyperactive response of the airway smooth muscle. The mechanism by which this occurs combines neural pathways and inflammatory pathways. As stated, the inflammatory component of this response comes predominantly from the mast cells. The major neural pathway involved is the nonadrenergic noncholinergic (NANC) system. Although cholinergic pathways are responsible for maintaining the airway smooth muscle tone, it is the NANC system that releases bronchoactive tachykinins (substance P and neurokinin A) that bind to NK2 receptors on the smooth muscle and cause the constriction that characterizes the acute asthmatic response [123]. In addition to these acute mechanisms, the airway also undergoes structural alterations to its formed elements. In the mucosa, these changes include goblet cell hyperplasia and basement membrane thickening. Within the submucosa and airway wall, increased deposition of collagen and elastic fibers results in fibrosis and elastosis, and both the smooth muscle cells and the submucosal glands undergo hypertrophy and hyperplasia. These irreversible changes are a consequence of chronic inflammatory insults on the airways through mechanisms that include release of fibrosing mediators such TGFb and mitogenic mediators such as epidermal and fibroblast growth factors (EGF, FGF). The exact mechanisms by which this occurs are not clearly defined, but the similarity of these factors with those involved in branching morphogenesis of the developing lung has led to a focus on the effect of inflammation on the interaction of the epithelium with the underlying mesenchymal cells [128].

Chronic Obstructive Lung Disease (COPD) – Emphysema/Chronic Bronchitis Clinical and Pathologic Features The term chronic obstructive pulmonary disease (COPD) applies to emphysema, chronic bronchitis, and bronchiectasis, those diseases in which airflow limitation is usually progressive, but, unlike asthma, not fully reversible [131]. The prevalence of COPD worldwide is estimated at 9%–10% in adults over the age of 40 [132]. Though there are different forms of COPD with different etiologies, the clinical manifestations of the most common forms of the disease are the same. These include a progressive decline in lung function, usually measured as decreased forced expiratory flow in 1 second (FEV1), a chronic cough, and dyspnea. Emphysema and chronic bronchitis are the most common diseases of COPD and are the result of cigarette smoking. As such, they usually exist together in most smokers. Chronic bronchitis is defined clinically as a persistent cough with sputum production for at least 3 months in at least 2 consecutive years without any other identifiable cause. Patients with chronic bronchitis typically have copious sputum with a prominent cough, more commonly get infections, and typically experience hypercapnia and severe hypoxemia, giving 326

rise to the clinical moniker blue bloater. Emphysema is the destruction and permanent enlargement of the air spaces distal to the terminal bronchioles without obvious fibrosis [133]. These patients have only a slight cough, while the overinflation of the lungs is severe, inspiring the term pink puffers. The pathologic features of COPD are best understood if one considers the whole of COPD as a spectrum of pathology that consists of emphysematous tissue destruction, airway inflammation, remodeling, and obstruction [134]. The lungs of patients with COPD usually contain all of these features, but in varying proportions. The pathologic features of chronic bronchitis include mucosal pathology that consists of epithelial inflammation, injury, and regenerative epithelial changes of squamous and goblet cell metaplasia. In addition, the submucosa shows changes of remodeling with smooth muscle hypertrophy and submucosal gland hyperplasia. These changes are responsible for the copious secretions characteristic of this clinical disease, although studies have reported no consistent relationship between these pathologic features of the large airways and the airflow obstruction [135]. The pathology definition of emphysema is an abnormal, permanent enlargement of the airspaces distal to the terminal bronchioles accompanied by destruction of the alveolar walls without fibrosis [133]. The four major pathologic patterns of emphysema are defined by the location of this destruction. These include centriacinar, panacinar, paraseptal, and irregular emphysema. The first two of these are responsible for the overwhelming majority of the clinical disease. Centriacinar emphysema (sometimes referred to as centrilobular) represents 95% of the cases and is a result of destruction of alveoli at the proximal and central areas of the pulmonary acinus, including the respiratory bronchioles (Figure 18.30). It predominantly affects the upper lobes

Figure 18.30 Centrilobular emphysema. Tissue destruction in central area of the pulmonary lobule is demonstrated in this lung with a mild centrilobular emphysema. The pattern of tissue destruction is in the area surrounding the small airway where pigmented macrophages release proteases in response to the cigarette smoke.

Chapter 18


enlargement that occurs adjacent to scarring, secondary to the enhanced inflammation in the area. Though this is a common finding in a scarred lung, it is of little if any clinical significance to the patient. Though the emphysema in these lungs plays the dominant role in causing the obstruction, small airway pathology is also present. Respiratory bronchiolitis refers to the inflammatory changes found in the distal airways of smokers. These consist of pigmented macrophages filling the lumen and the peribronchiolar airspaces and mild chronic inflammation and fibrosis around the bronchioles (Figure 18.33). The pigment in these macrophages represents the inhaled particulate matter of the cigarette smoke that has been phagocytized by these cells. The macrophages in turn release proteases, which destroy the elastic fibers in the surrounding area, resulting in the loss of elastic recoil and the obstructive symptoms. Figure 18.31 Centrilobular emphysema. This sagittal cut section of a lung contains severe centrilobular emphysema with significant tissue destruction in the upper lobe and bulla forming in the upper and lower lobes.

(Figure 18.31). Panacinar emphysema, usually associated with a1-antitrypsin (aAT) deficiency, results in a destruction of the entire pulmonary acinus from the proximal respiratory bronchioles to the distal area of the acinus, and affects predominantly the lower lobes (Figure 18.32). The remaining two types of emphysema, paraseptal and irregular, are rarely associated with clinical disease. In paraseptal emphysema, the damage is to the distal acinus, the area that abuts the pleura at the margins of the lobules. Damage in this area may cause spontaneous pneumothoraces, typically in young, thin men [136]. Irregular emphysema is tissue destruction and alveolar

Figure 18.32 Panacinar emphysema. Tissue destruction in panacinar emphysema occurs throughout the lobule, producing a diffuse loss of alveolar walls unlike that of centrilobular emphysema with more irregular holes in the tissue.

Molecular Pathogenesis In general, COPD is a result of inflammation of the large airways that produces the airway remodeling characteristic of chronic bronchitis as well as inflammation of the smaller airways that results in the destruction of the adjacent tissue and consequent emphysema. The predominant inflammatory cells involved in this process are the alveolar macrophages, neutrophils, and lymphocytes. The main theories of the pathogenesis of COPD support the interaction of airway inflammation with two main systems in the lung: the protease–antiprotease system and the oxidant–antioxidant system. These systems help to protect the lung from the many irritants that enter the lung via the large pulmonary surface area that interfaces with the environment.

Figure 18.33 Respiratory bronchiolitis. Present in the lumen of the small bronchiole (B) and extending into the surrounding alveolar spaces are pigmented macrophages in a lung from a smoker. The pigment in these macrophages represents particulates from the cigarette smoke and stimulates the release of the proteases that are responsible for the tissue destruction in centrilobular emphysema. 327

Part IV


In the protease–antiprotease system, proteases are produced by a number of cells, including epithelial cells and inflammatory cells that degrade the underlying lung matrix. The most important proteases in the lung are the neutrophil elastases, part of the serine protease family, and the metalloproteinases (MMPs) produced predominantly by macrophages. These proteases can be secreted in response to invasion by environmental irritants, most notably infectious agents such as bacteria. In this setting, their role is to enzymatically degrade the organism. However, proteases can also be secreted by both inflammatory and epithelial cells in a normal lung to repair and maintain the underlying lung matrix proteins [137]. To protect the lung from unwanted destruction by these enzymes, the liver secretes antiproteases that circulate in the bloodstream to the lung and inhibit the action of the proteases. In addition, macrophages that secrete MMPs also secrete tissue inhibitors of metalloproteinases (TIMPs). A delicate balance of proteases and antiproteases is needed to maintain the integrity of the lung structure. An imbalance that results in a relative excess of proteases (either by overproduction of proteases or underproduction of their inhibitors) leads to tissue destruction and the formation of emphysema. This imbalance occurs in different ways in the two major types of emphysema: centriacinar and panacinar. In centriacinar emphysema, caused primarily by cigarette smoking, there is an overproduction of proteases primarily due to the stimulatory effect of chemicals within the smoke on the neutrophils and macrophages. Though the exact mechanism is not completely understood, most studies support that nicotine from the cigarette smoke acts as a chemoattractant, and ROS also contained in the smoke, stimulate an increased release of neutrophil elastases and MMPs from activated macrophages, leading to the destruction of the elastin in the alveolar spaces [137]. This inflammatory cell activation may come about through the activation of the transcription factor NFkB that leads to TNFa production [132]. In addition, the elastin peptides themselves may attract additional inflammatory cells to further increase the protease secretion and exacerbate the matrix destruction [137]. Unlike centriacinar emphysema, panacinar emphysema is most commonly caused by a genetic deficiency of antiproteases, usually due to alpha-1 anti-trypsin (aAT) deficiency, a condition that affects approximately 60,000 people in the United States [138]. aAT deficiency is due to a defect in the gene that encodes the protein aAT, a glycoprotein produced by hepatocytes and the main inhibitor of neutrophil elastase. The affected gene is the SERPINA1 gene (formerly known as P1), located on the long arm of chromosome 14 (14q31–32.3). The genetic mutations that occur have been categorized into four groups: base substitution, in-frame deletions, frame-shift mutations, and exon deletions. These mutations usually result in misfolding, polymerization, and retention of the aberrant protein within the hepatocytes, leading to decreased circulating levels. aAT deficiency is an autosomal codominant disease with over 100 allelic variants, of which the M alleles (M1–M6) are the most common; 328

these alleles produce normal serum levels of a lessactive protein [139]. Individuals who manifest the lung disease are usually homozygous for the alleles Z or S (ZZ and SS phenotype) or heterozygous for the 2 M alleles (MZ, or SZ phenotype) [139]. An aAT concentration in plasma of less than 40% of normal confers a risk for emphysema [140]. In individuals with the ZZ genotype, the activity of aAT is approximately one-fifth of normal [141]. The second system in the lung involved in the pathogenesis of emphysema is the oxidant–antioxidant system. As in the protease system, the lung is protected from oxidative stress in the form of ROS by antioxidants produced by cells in the lung. ROS in the lung include oxygen ions, free radicals, and peroxides. The major antioxidants in the airways are enzymes including catalase, superoxide dismutase (SOD), glutathione peroxidase, glutathione S-transferase, xanthine oxidase, and thioredoxin, as well as nonenzymatic antioxidants including glutathione, ascorbate, urate, and bilirubin [142]. The balance of oxidants and antioxidants in the lung prevents damage by ROS. However, cigarette smoke increases the production of ROS by neutrophils, eosinophils, macrophages, and epithelial cells [143]. Evidence that damage to the lung epithelium and matrix is a direct result of ROS includes the presence of exhaled H2O2 and 8-isoprostane, decreased plasma antioxidants, and increased plasma and tissue levels of oxidized proteins, including various lipid peroxidation products. In addition to this direct effect, ROS may also induce a proinflammatory response that recruits more inflammatory cells to the lung. In animal models, cigarette smoke induces the expression of proinflammatory cytokines such as IL-6, IL-8, TNFa, and IL-1 from macrophages, epithelial cells, and fibroblasts, perhaps through activation of the transcription factor NFkB [144,145] (Figure 18.34). Finally, there is some evidence that cigarette smoke further disturbs the oxidant–antioxidant balance in the lung by depleting antioxidants such as ascorbate and glutathione [132].

Bronchiectasis Clinical and Pathologic Features Bronchiectasis represents the permanent remodeling and dilatation of the large airways of the lung most commonly due to chronic inflammation and recurrent pneumonia. These infections usually occur because airway secretions and entrapped organisms cannot be effectively cleared. This pathology dictates the clinical features of the disease, which include chronic cough with copious secretions and a history of recurrent pneumonia. The five major causes of bronchiectasis are infection, obstruction, impaired mucociliary defenses, impaired systemic immune defenses, and congenital. These may produce either a localized or diffuse form of the disease. Localized bronchiectasis is usually due to obstruction of airways by mass lesions or scars from previous injury or infection. Diffuse bronchiectasis can result from defects in systemic

Chapter 18


Cigarette smoke Bronchial epithelium

Anti-Oxidants SOD Catalase Glutathione peroxidase TGF-b

IL-8

LBT4

Oxidants

Alveolar macrophage

TGF-b

LBT4 IL-8 TGF-a, IL-1

Fibroblasts

TIMPs

MMPs Neutrophil

CD8+ Lymphocyte

Inflammation

Elastases

Proteolysis

Anti-Proteolysis

Figure 18.34 Pathogenesis of chronic obstructive pulmonary disease. Inflammatory cells including alveolar macrophages, lymphocytes, and neutrophils are involved in generating inflammation, proteolysis, and oxidative stress in chronic obstructive pulmonary disease caused by cigarette smoke. Antioxidants and antiproteases help to inhibit these effects. Profibrotic mediators stimulate fibroblasts and myofibroblasts to repair and remodel the lung after this injury [adapted from 145].

immune defenses in which either innate or adaptive immunity may be impaired. Diseases due to the former include chronic granulomatous disease (CGD), and diseases due to the latter include agammaglobulinemia/hypogammaglobulinemia and severe combined immune deficiencies. Defects in the mucociliary defense mechanism that is responsible for physically clearing organisms from the lung may also cause diffuse bronchiectasis. These include ciliary dyskinesias that result in cilia with aberrant ultrastructure and cystic fibrosis (CF). Congenital forms of bronchiectasis are rare but do exist. The most common include Mounier-Kuhn’s syndrome and Williams-Campbell syndrome, the former causing enlargement of the trachea and major bronchi due to loss of bronchial cartilage, and the latter causing diffuse bronchiectasis of the major airways probably due to a genetic defect in the connective tissue [146,147]. The pathology of bronchiectasis is most dramatically seen at the gross level. One can see dilated airways

containing copious amounts of infected secretions and mucous plugs localized either to a segment of the lung or diffusely involving the entire lung as in cystic fibrosis (Figure 18.35). Microscopic features include chronic inflammatory changes similar to those of chronic bronchitis but with ulceration of the mucosa and submucosa leading to destruction of the smooth muscle, and elastic in the airway wall and the characteristic dilatation and fibrosis. These enlarged airways contain mucous plugs comprising mucin and abundant degenerating inflammatory cells, a result of infections that establish themselves in these airways following the loss of the mucociliary defense mechanism. Bacteria may be found in these plugs, most notably P. aeruginosa.

Molecular Pathogenesis The pathogenetic mechanism of bronchiectasis is complex and depends on the underlying etiology. In general, the initial damage to the bronchial epithelium is 329

Part IV


Figure 18.35 Cystic fibrosis. This sagittal cut section of a lung from a patient with cystic fibrosis demonstrates a diffuse bronchiectasis illustrated by enlarged, cyst-like airways. This is the typical pathology for cystic fibrosis. The remainder of the lung contains some red areas of congestion.

due to aberrant mucin (cystic fibrosis), dysfunctional cilia (ciliary dyskinesias), and ineffective immune surveillance (defects in innate and antibody-mediated immunity), leading to a cycle of tissue injury, repair, and remodeling that ultimately destroys the normal airway. The initial event in this cycle usually involves dysfunction of the mucociliary mechanism that inhibits the expulsion from the lungs of organisms and other foreign substances that invade the airways. This may be due to defects in the cilia or the mucin. Ciliary defects are found in primary ciliary dyskinesia, a genetically heterogeneous disorder, usually inherited as an autosomal recessive trait that produces immotile cilia with clinical manifestations in the lungs, sinuses, middle ear, male fertility, and organ lateralization [148]. Over 250 proteins make up the axoneme of the cilia, but mutations in 2 genes, DNAI1 and DNAH5, which encode for proteins in the outer dynein arms, most frequently cause this disorder [149]. In CF the main defect affects the mucin. In patients with this autosomal recessive condition, there is a low volume of airway surface liquid (ASL) causing sticky mucin that inhibits normal ciliary motion and effective mucociliary clearance of organisms. This is due to a defect in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, located on chromosome 7 that encodes a cAMP-activated channel which regulates the flow of chloride ions in and out of cells and intracellular vacuoles, helping to maintain the osmolality of the mucin. This protein is present predominantly on the apical membrane of the airway epithelial cells, though it is also involved in considerable subapical, intracellular trafficking and 330

recycling during the course of its maturation within these cells. This genetic disease manifests in multiple other organs that depend on chloride ion transport to maintain normal secretions, including the pancreas, intestine, liver, reproductive organs, and sweat glands [150]. The genetic mutations in CF influence the CFTR trafficking in the distal compartments of the protein secretary pathway, and various genetic mutations produce different clinical phenotypes of the disease. Over 1600 mutations of the CFTR gene have been found. However, only four of these mutations occur at a frequency of greater than 1%. These mutations are grouped into five classes according to their functional deficit: Group I, CFTR is not synthesized; Group II, CFTR is inadequately processed; Group III, CFTR is not regulated; Group IV, CFTR shows abnormal conductance; Group V, CFTR has partially defective production or processing. Approximately 70% of CF patients are in Group II and have the same mutation, F508D CFTR, a deletion of phenylalanine at codon 508 [154]. In these patients, most of the CFTR protein is misfolded and undergoes premature degradation within the endoplasmic reticulum, though a small amount of the CFTR protein is present on the apical membrane and does function normally. CF patients may have a combination of genetic mutations from any of the five groups. However, those patients with the most severe disease involving both the lungs and pancreas usually carry at least two mutations from Group I, II, or III [151]. Systemic immune deficiencies cause bronchiectasis through the establishment of persistent infection and inflammation. There are four major categories of immune deficiencies. The first category consists of a number of genetic diseases that cause either agammaglobulinemia or hypogammaglobulinemia. These include Xlinked agammaglobulinemia (XLA) and common variable immunodeficiency (CVI). XLA is caused by a mutation of the Bruton’s tyrosine kinase (BTK) gene that results in the virtual absence of all immunoglobulin isotypes and of circulating B lymphocytes. In CVI there is a marked reduction in IgG and IgA and/or IgM, associated with defective antibody response to protein and polysaccharide antigens. As expected, both of these diseases increase susceptibility to infections from encapsulated bacteria. The second category of immune deficiency is hyper-IgE syndrome, a disease with markedly elevated serum IgE levels that is characterized by recurrent staphylococcal infections. The third category is chronic granulomatous disease (CGD), a genetically heterogeneous group of disorders that have a defective phagocytic respiratory burst and superoxide production, inhibiting the ability to kill Staphylococcus spp. and fungi such as Aspergillus spp. Finally, severe combined immune deficiency (SCID) comprises a group of disorders with abnormal T- cell development and B-cell and/or natural killer cell maturation and function, predisposing these patients to Pneumocystis jiroveci and viral infections [152]. After the initial insult, the subsequent steps in the development of bronchiectasis include destruction of the epithelial cells and bronchial wall connective tissue matrix by the proteases and ROS secreted by the neutrophils.

Chapter 18

This proinflammatory milieu is produced by multiple factors. First, infections can persist in these lungs due to defective host immune systems and mechanisms certain organisms have developed to evade these immune defenses. For example, Pseudomonas aeruginosa, changes from a nonmucoid to a mucoid variant and also releases virulence factors to protect against phagocytosis [153]. Second, in the case of cystic fibrosis, neutrophils are directly recruited by proinflammatory cytokines, such as interleukin-8 (IL-8), released from the bronchial epithelial cells as a result of the defective CGFT protein [154]. Finally, the necrotic cellular debris and other breakdown products act as chemoattractants that recruit more inflammatory cells to the airway wall, further exacerbating the damage. The final phase of the repair and remodeling begins when macrophages invade and recruit fibroblasts that secrete collagen, leading to the fibrosis seen in the pathology. However, in the absence of effective airway clearance mechanisms, these ectatic airways remain a reservoir of infection that continues the cycle of inflammation and tissue destruction.

INTERSTITIAL LUNG DISEASES Idiopathic Interstitial Pneumonias – Usual Interstitial Pneumonia Clinical and Pathology Features The idiopathic interstitial pneumonias (IIPs) comprise a group of diffuse infiltrative pulmonary diseases with a similar clinical presentation characterized by dyspnea, restrictive physiology, and bilateral interstitial infiltrates on chest radiography [155]. Pathologically, these diseases have characteristic patterns of tissue injury with chronic inflammation and varying amounts of fibrosis. By recognizing these patterns, a pathologist can classify each of these entities and predict prognosis. However, the pathologist cannot establish the etiology, since these pathologic patterns can be seen in multiple clinical settings. The pathologic classification of these diseases, originally defined by Liebow and Carrington in 1969 [156], has undergone important revisions over the past 35 years with the latest revision by the American Thoracic Society/European Respiratory Society in 2003 [157]. The best known and most prevalent entity of the IIPs is idiopathic pulmonary fibrosis (IPF), which is known pathologically as usual interstitial pneumonia (UIP). UIP is a histologic pattern characterized by patchy areas of chronic lymphocytic inflammation with organizing and collagenous type fibrosis. These patients usually present with gradually increasing shortness of breath and a nonproductive cough after having had symptoms for many months or even years. Imaging studies usually reveal bilateral, basilar disease with a reticular pattern [155]. Therapy begins with corticosteroids, advancing to more cytotoxic drugs such as methotrexate and cytoxan, but most current therapies are not effective in stopping the progression of the disease. The current estimates are that 20/100,000 males


and 13/100,000 females have the disease, most of whom progress to respiratory failure and death within 5 years [158]. The pathology is characterized by a leading edge of chronic inflammation with fibroblastic foci that begin in different areas of the lung at different times. These processes produce a variegated pattern of fibrosis, usually referred to as a temporally heterogenous pattern of injury [159]. Because it occurs predominantly in the periphery of the lung involving the subpleura and interlobular septae, the gross picture is one of more advanced peripheral and basilar disease (Figure 18.36). The progression from inflammation to fibrosis includes interstitial widening, epithelial injury and sloughing, fibroblastic infiltration, and organizing fibrosis within the characteristic fibroblastic foci. Deposition of collagen by fibroblasts occurs in the latter stages of repair. The presence of the abundant collagen produces stiff lungs that are unable to clear the airway secretions, leading to recurrent inflammation of the bronchiolar epithelium with eventual fibrosis and breakdown of the airway structure. This remodeling produces mucousfilled ectatic spaces giving rise to the gross picture of honeycomb spaces, which is seen in the advanced pathology (Figure 18.36) [160].

Molecular Pathogenesis Theories of the pathogenesis of IPF have evolved over the past decade. Early theories favored a primary inflammatory process, while current theories favor the concept that the fibrosis of the lung proceeds independently of inflammatory events and develops from aberrant epithelial and epithelial-mesenchymal responses to injury to the alveolar epithelial cells (AECs) [161]. The AECs consist of two populations: the type 1 pneumocytes and the type 2 pneumocytes. In normal lungs, type 1 pneumocytes line 95% of the alveolar wall, and type 2 pneumocytes line the remaining 5%. However, in lung injury, the type 1 cells, which are exquisitely fragile, undergo cell death, and the type 2 pneumocytes serve as progenitor cells to regenerate the alveolar epithelium [162]. Though some studies have suggested that repopulation of the type 2 cells depends on circulating stem cells, this concept remains to be fully proven. According to current concepts, the injury and/or apoptosis of the AECs initiates a cascade of cellular events that produce the scarring in these lungs. Studies of AECs in lungs from patients with IPF have shown ultrastructural evidence of cell injury and apoptosis as well as expression of proapoptotic proteins. Further, inhibition of this apoptosis by blocking a variety of proapoptotic mechanisms such the Fas-Fas ligand pathway, angiotensin, and TNFa production, and caspase activation can stop the progression of this fibrosis [163]. The result of the AEC injury is the migration, proliferation, and activation of the fibroblasts and myofibroblasts that leads to the formation of the characteristic fibroblastic foci of the UIP pathology and the deposition and accumulation of collagen and elastic fibers in the alveoli (Figure 18.37). This unique pathology 331

Part IV


A

B

Figure 18.36 Usual interstitial pneumonia. A sagittal cut of a lung involved by usual interstitial pneumonia reveals the peripheral and basilar predominance of the dense, white fibrosis (A). A higher power view of the left lower lobe highlights the remodeled honeycomb spaces in the area of the lung with the endstage disease (B).

A

B

Figure 18.37 Usual interstitial pneumonia. The microscopic features of UIP lungs are characterized by inflammation and fibrosis that demonstrate the temporally heterogenous pattern of pathologic injury with normal, inflamed, and fibrotic areas of the lung, all seen at a single lower power view. (A) The leading edge of inflammation is represented by deposition of new collagen in fibroblastic foci. These consist of fibroblasts surrounded by collagen containing mucopolysaccharides highlighted in blue by this connective tissue stain (B).

may be a result of the increased production of profibrotic factors such as transforming growth factor-a (TGFa) and TGFb, fibroblastic growth factor-2, insulin-like growth factor-1, and platelet-derived growth factor. An alternative pathway might involve overproduction of inhibitors of matrix degradation such as TIMPs (tissue inhibitors of matrix production) [164]. In support of the former mechanism, fibroblasts isolated from the lungs of IPF patients exhibit a profibrotic secretory phenotype [165]. 332

Multiple factors, such as environmental particulates, drug or chemical exposures, and viruses may trigger the initial epithelial injury, but genetic factors also play a role. Approximately 2%–20% of patients with IPF have a family history of the disease with an inheritance pattern of autosomal dominance with variable penetrance. Two genetic mutations have been implicated in this familial form of IPF. One large kindred has been reported with a mutation in the gene encoding surfactant protein C, and six probands have been

Chapter 18


reported with heterozygous mutations in genes hTERT or hTR, encoding telomerase reverse transcriptase and telomerase RNA, respectively, resulting in mutant telomerase and short telomeres [166].

Diffuse Alveolar Damage Clinical and Pathology Features Adult respiratory distress syndrome (ARDS) represents a constellation of clinical, radiologic, and physiologic features in patients with acute respiratory failure that can occur after a variety of insults. ARDS is defined by clinical criteria that include a rapid onset of severe hypoxemia that is refractory to oxygen therapy, the presence of abnormal chest radiographs with evidence of bilateral alveolar filling and collapse, increased pulmonary artery occlusion pressure, and a resistance to improved oxygenation regardless of mechanical ventilation therapy [167]. Treatment of ARDS includes eliminating the underlying cause, protective ventilation strategies that improve oxygenation, and supportive treatment that may include administration of corticosteroids. The pathology of ARDS is diffuse alveolar damage (DAD), whose histologic picture is one of inflammation and fibrosis that diffusely involves all of the structures of the alveolus and is similar throughout the affected areas of the lung [168]. DAD is divided into three major phases that follow each other chronologically after the original insult. These are exudative, proliferative, and fibrotic DAD. The initial injury primarily involves the epithelium of the alveolar wall and the endothelium in the capillary, causing the destruction and sloughing of the type 1 pneumocytes into the alveolar space and a breakdown of the tight junctions of the endothelium. In combination, these two events result in the loss of the epithelial-endothelial barrier of the alveolus and leakage of plasma from the capillary into the alveolar space. This flooding of the airspace with fluid markedly decreases oxygen exchange and causes the hypoxia that these patients experience. In addition, acute inflammatory changes of the endothelium also cause thrombi to form in vessels, adding to a decreased amount of blood circulating through the lung and further compromising gas exchange. As air is brought into the alveoli, the positive pressure within the alveolar space forces the plasma against the alveolar wall, producing a membranous morphology referred to as hyalin membranes characteristic of the first phase of DAD, referred to as exudative DAD (Figure 18.38). This initial injury is followed by a sequence of events that represent the lung’s efforts to repair itself. First, type 2 pneumocytes undergo hyperplasia and re-epithelialize the alveolar wall after the loss of the type 1 cells. This re-establishes the epithelial barrier and, because these cells secrete surfactant, results in increased surfactant production, which lowers the surface tension of the alveolus and inhibits its collapse. Because of the increased numbers of type 2 pneumocytes, this is known as the proliferative phase of DAD (Figure 18.38). In the

Figure 18.38 Diffuse alveolar damage. This microscopic image reveals both the exudative (right side) and proliferative (left side) phases of diffuse alveolar damage. The eosinophilic hyaline membranes outline the alveolar space (AS), and Type 2 pneumocytes are present on the surface of the adjacent alveolar walls (TY2).

final phase of DAD, fibrotic DAD, fibroblasts migrate in from the adjacent interstitium to the alveolar space and produce organizing and irreversible fibrosis within both the alveolar space and the interstitium. In addition to this mechanism, fibrosis may also occur in those areas where alveolar walls collapse when surfactant is decreased during the initial insult. The histopathologic picture during this fibrotic phase is one of thickened alveolar septa, intra-alveolar granulation tissue, microcyst formation, and areas of irregular alveolar scarring. In rare cases, these microcysts progress to large cysts, an adult equivalent of bronchopulmonary dysplasia.

Molecular Pathogenesis The cellular events of DAD are complex and incompletely understood. In general, the disease can be broken down into two phases. In the first, a large influx of neutrophils and plasma enter the alveolar space. The role the neutrophils play in the initial cellular injury and death is unclear, but it is known that they are necessary for this injury to occur. In addition, clinical studies have shown that within the peripheral blood and bronchoalveolar lavages (BAL) of these patients, neutrophils are present along with a myriad of proinflammatory cytokines, such as IL-8, IL-1, and TGFa, all of which are capable of recruiting them to the lung. Also present in these fluids are mediators that recruit fibroblasts such as TGFb. All of these mediators are probably the result of upregulation of NFkB, a proinflammatory transcription factor, in alveolar macrophages. The adherence of neutrophils to the capillary endothelium in the lung occurs through adhesion molecules such as selectin, integrin, and immunoglobulins. Neutrophil adherence and subsequent transmigration through the endothelium of the lung capillaries may cause some endothelial damage. However, most speculate that ROS and reactive nitrogen 333

Part IV


species (RNS) secreted by the neutrophils modulate the majority of this injury [169]. This is supported by the finding that patients with ARDS have products of oxidative damage such as hydrogen peroxide (H2O2) in the exhaled breath and myeloperoxidase and oxidized aAT in the BAL. The cell injury and death of the type 1 pneumocytes most likely occurs via two mechanisms: lipopolysaccharide (LPS)-induced caspase-dependent apoptosis and hyperoxia-induced cell death through apoptosis and nonapoptotic mechanisms [170]. In the former, LPS, an immunogenic component of the outer membrane of gram-negative bacteria, may trigger innate immune and inflammatory responses via toll-like receptors that bind Fas-associated death domain protein and caspase-9, leading to epithelial cell death. In hyperoxia-induced cell death, hyperoxia may induce the expression of angiopoietin 2 (Ang2) in lung epithelial cells. Ang2 is an angiogenic growth factor that can activate caspase pathways and lead to apoptotic cell death [170]. Cell death in ARDS is not limited to these mechanisms, and further study of many of pathways by which this can occur is needed.

Lymphangioleiomyomatosis Clinical and Pathologic Features Lymphangioleiomyomatosis (LAM) is a rare systemic disease of women, usually in their reproductive years (average age of 35 years), that is characterized by a proliferation of abnormal smooth muscle cells giving rise to cysts in the lungs, abnormalities in the lymphatics, and abdominal tumors, most notably in the kidneys. In addition to sporadic cases (denoted as SLAM), LAM also affects 30% of women with tuberous sclerosis (denoted as TSC-LAM), a genetic disorder with variable penetrance associated with seizures, brain tumors, and cognitive impairment [171,172]. Global estimates indicate that TSC-LAM may be as much as 5-fold to 10-fold more prevalent than S-LAM, though at least some suggest that TSC-LAM may have a milder clinical course than S-LAM [172]. Clinically, LAM patients usually present with increasing shortness of breath on exertion, obstructive symptoms, spontaneous pneumothoraces, and chylous effusions or with abdominal masses consisting of either angiomyolipomas and/or lymphangiomyomas. Chest imaging studies characteristically reveal hyperinflation with flattened diaphragms and thin-walled cystic changes. Mortality at 10 years from the onset of symptoms is 10%–20% [173]. LAM appears as small, thin-walled cysts (0.5–5.0 cm) randomly throughout both lungs [174] (Figure 18.39). Microscopically, LAM lungs contain a diffuse infiltration of smooth muscle cells, predominantly around lymphatics, veins, and venules. Most notably, one finds smooth muscle cells in the subpleural with hemosiderin-laden macrophages in the adjacent field, and the macrophages are also seen on bronchoalveolar lavage specimens from these patients. The hemosiderin pigment in these lungs is thought to be secondary to microhemorrhages from the obstruction of the veins 334

Figure 18.39 Lymphangioleiomyomatosis. The sagittal section of an upper lobe from an explanted lung from a patient with LAM demonstrates cystic features of the red/ brown lung parenchyma that are characteristic of this disease.

Figure 18.40 Lymphangioleiomyomatosis. The microscopic view of the LAM lung reveals cysts lined by spindled smooth muscle cells (SM). Scattered macrophages surrounding these cysts contain brown hemosiderin pigment.

(Figure 18.40) [175]. The smooth muscle cells in LAM react to antibodies to HMB-45, a premelanosomal protein. Other melanosome-like structures are also found in LAM cells, suggesting that these cells have characteristics of both smooth muscle and melanosomes [176].

Molecular Pathogenesis The lesional cells in LAM are smooth muscle-like with both spindled and epithelioid morphology [177]. These cells are the same in both S-LAM and TSC-LAM

Chapter 18

and are a clonal population although they lack other features of malignancy [178]. Molecular studies reveal that the abnormal LAM cell proliferation is caused by mutations in one of two genes linked to tuberous sclerosis: tuberous sclerosis complex 1 or 2 (TSC1 or TSC2). These two genes control cell growth and differentiation through the Akt/mammalian target of rapamycin (mTOR) signaling pathway [172]. In this pathway, a growth factor receptor (such as insulin or PDGF receptors) becomes phosphorylated when an appropriate ligand binds, resulting in activation of downstream effectors and ultimately Akt. The gene products of TSC1 and TSC2 are hamartin and tuberin, which act as dimers to maintain Rheb (a member of the Ras family) in a GDP-loaded state via statins, acting as a break to the Akt/mTOR pathway, thereby retarding protein synthesis and cell growth. In LAM cells, loss-of-function mutations in these two genes remove this inhibition, leading to enhanced Rheb activation, mTOR activation (with raptor), and subsequent phosphorylation of downstream molecules which result in uncontrolled cell growth, angiogenesis, and damage to the lung tissue (Figure 18.41) [179]. The abnormal proliferation of LAM cells is thought to damage the lung through overproduction of matrix metalloproteinases (MMPs), which degrade the connective tissue of the lung architecture, destroy the alveolar integrity, and result in cyst formation with air trapping [179]. These destructive capabilities of the LAM cells are enhanced by their secretion of the angiogenic factor VEGF-C, which is thought to cause the proliferation of lymphatic channels throughout the lung [179].

Sarcoidosis Clinical and Pathologic Features Sarcoidosis is a multisystemic disease that involves the lung in over 90% of the cases [180]. It is most common in the 20–40-year age group and among females. In the United States, African Americans are more commonly affected than Caucasians [181]. The clinical picture of sarcoidosis is variable, but most patients present with systemic symptoms including fatigue, weight loss, and fever. The most common finding on chest imaging studies is bilateral hilar lymph node enlargement and reticular, reticulonodular, and focal alveolar opacities within the lung parenchyma [182]. Pulmonary sarcoidosis is characterized by granulomas which consist of activated histiocytes, called epithelioid histiocytes that form nodules ranging in size from 15–20 microns (Figure 18.42) [183]. Unlike infectious granulomas that usually contain areas of central necrosis, the granulomas in pulmonary sarcoidosis are predominantly non-necrotizing [184]. Also, the granulomas in sarcoidosis follow a distribution along the lymphatics, which includes the area in the subpleural, along the interlobular septae and around the bronchovascular area containing the bronchiole and branch of the pulmonary artery (Figure 18.42). The granulomas occur much more commonly in the


upper lobes, leading to the predominant upper lobe fibrosis and bronchiectasis that can be seen in longstanding sarcoidosis [185].

Molecular Pathogenesis Despite over 50 years of research on sarcoidosis, the etiology remains unknown. Most agree that the disease is probably a result of environmental triggers acting on a genetically susceptible host [186,187]. A genetic basis of sarcoidosis has been suggested by studies that demonstrate familial clustering and racial variation [188,189]. Further, complex inheritance patterns for the disease suggest that more than one gene may be involved [190]. Several genes of the major histocompatibility complex (MHC) region of the genome have been implicated. Most are clustered on the short arm of chromosome 6 that encompasses the human leukocyte antigen (HLA) domain. The HLA class I MHC molecules associated with sarcoidosis are the HLA-B7 and HLA-B8 class I alleles [191,192]. HLA Class II molecules implicated in susceptibility include the HLA-DR alleles [193,194]. Genes other than MHC genes thought to regulate the susceptibility to sarcoidosis include those for chemokines such as macrophage inflammatory protein-1a and RANTES (CCR5 and CCR3) [195,196]. Environmental factors that have been implicated are those that are aerosolized. Therefore, these environmental agents have a mode of entry into the lungs and can cause granulomas in the lung, similar to sarcoidosis. These factors can be divided into two major categories, which include infectious and noninfectious agents. The mycobacteria have been the most extensively studied organisms. However, their role in this disease remains controversial due to the difficulty in identifying them by either culture or histochemical stains in sarcoid tissue. Recently, molecular techniques have been able to demonstrate mycobacterial nucleic acid in sarcoid tissue [197,198]. However, even studies using this technology have not produced consistent results, and the role of these organisms in the disease requires further study. The immune response in sarcoidosis has two major features: (i) the initial event leading to granuloma formation and (ii) the progression of this granulomatous response to either resolution or fibrosis [199]. The formation of the granulomas, triggered by activation of Tcells and antigen-presenting dendritic histiocytes, results in a release of proinflammatory cytokines and chemokines, and recruitment, activation, and proliferation of mononuclear cells, predominantly T-cells. These activated T-cells are predominantly CD4-expressing T-helper (Th) cells, which release IFN-g and IL-2. Alveolar macrophages at the site release TNFa, IL-12, IL-16, and other growth factors. This results in the granuloma formation and alveolitis, the characteristic morphologic features of the disease [200]. The second phase of this immunologic response that leads to either resolution of the disease or persistence of the granulomas and fibrosis is less well characterized. Ongoing granuloma formation and inflammation may be a result of the persistent presence of antigens, the excessive synthesis of chemotactic factors, or the 335

Part IV


LIGAND Cell Membrane PDK1

PIP3 GROWTH FACTOR RECEPTOR

PI3K Akt

ACTIN CYTOSKELETON REORGANIZATION

P-

AMPK PTEN

ERM Rho NF-L

Hamartin

AMP Tuberin

Tuberin

Hamartin Statins FT Inhibitors

MK2 Tuberin

P- Tuberin Rheb

Rheb

Erα 14-3-3

GDP

GTP

Estrogen Tuberin CaM

Ca2+

AA

mTOR

Tamoxifen

Raptor

? Sirolimus 4E-BP1

GENOMIC AND NON-GENOMIC EFFECTS

PROTEIN SYNTHESIS

CELL GROWTH

S6K1

Figure 18.41 Signal transduction pathways involving the TSC1 and TSC2 gene products, hamartin and tuberin. Arrowheads indicate activating or facilitating influences; flat-headed lines indicate inhibitory influences. The harmartintuberin dimer maintains Rheb in a GDP-loaded state, thereby preventing activation of mTOR, which requires activated Rheb-GTP. Growth and energy signals tend to inhibit this function of the hamartin-tuberin complex, permitting mTOR activation. The sites of action of several drugs with therapeutic potential in LAM are indicated in gray-shaded boxes. AA, amino acids; FT, farnesyltransferase. (Reprinted with kind permission from Juvet, SC, McCormack FC, Kwiatkowski DJ, Downey GP. (2007). Molecular pathogenesis of lymphangioleiomyomatosis: lesson learned from orphans. Am J Respir Cell Mol Biol, 398–408 [179]).

336

Chapter 18


IS

BV

Figure 18.42 Sarcoidosis. (A) The distribution of granulomas in sarcoidosis follows the lymphatics in the lung, which includes within the subpleural (SP), along the interlobular septae (IS), and around the bronchovascular areas (BV). (B) The granulomas are composed of activated “epithelioid” histiocytes, usually containing multinucleated giant cells and surrounded by a rim of T-lymphocytes.

persistence of the mononuclear cells within the granulomas. Importantly, the role of the T-cells in these granulomas is to secrete cytokines that attract, stimulate, and ultimately deactivate the fibroblasts that are responsible for the fibrosis that is seen in the chronic disease. The balance between the profibrotic mediators such as TGFb, insulin-like growth factor-I, platelet-derived growth factor (PDGF), and the antifibrotic mediators, such as IFN-g, probably dictates the natural history of sarcoidosis in the lung [201]. Genes involved in macrophage-derived cytokines, chemokines, and mediators of fibrosis are all possible candidates for the underlying genetic cause of this complicated disease.

with malignancies, most commonly hematologic malignancies such as myelogenous leukemia [207,208]. Chest imaging studies in both the idiopathic and secondary forms most commonly show fine, diffuse, feathery nodular infiltrates, centered in the hilar areas, sparing the peripheral regions [206]. On chest computerized tomographs, the infiltrates may have a geometric-type shape, sometimes referred to as crazy paving [209]. The most prominent microscopic feature of both idiopathic and secondary PAP is the filling of the alveoli with finely granular period acid-Schiff-positive diastaseresistant (PASD) acellular material (Figure 18.43). The

Pulmonary Alveolar Proteinosis Clinical and Pathologic Features Pulmonary alveolar proteinosis (PAP) is a rare disease of the lungs characterized by accumulation of surfactant in the alveolar spaces. The names alveolar proteinosis, lipoproteinosis, or perhaps most accurately phospholipoproteinosis, apply equally to this entity. PAP takes three forms clinically: (i) congenital (2%), (ii) secondary (5%–10%), and (iii) idiopathic or primary (88%–93%) [202–204]. PAP arises in previously healthy adults with the median age at diagnosis of approximately 40 years and a male-to-female ratio of 2.7:1. The clinical presentation is variable and usually includes an insidious onset of slowly progressive dyspnea, a dry cough, and other symptoms of respiratory distress, including fatigue and clubbing. However, almost one-third of patients are asymptomatic and are found clinically by abnormal chest X-rays [205,206]. The secondary form of PAP can be found in patients with environmental exposures, including fine silica, aluminum, titanium dioxide, and kaolin dust [206]. Also, secondary PAP may be found in patients

Figure 18.43 Pulmonary alveolar proteinosis. The microscopic features of this disease reveal a Periodic acidSchiff positive surfactant-like substance filling the alveoli that otherwise show only a minimum of inflammatory changes. 337

Part IV


material consists of phospholipids (90%); surfactant proteins A, B, C, and D (10%); and carbohydrate (15 but 5000 polyps. Mutation at codon 1309 is associated with profuse polyposis and earlier onset of disease. I1307K represents a mutation common in the Ashkenazi Jewish population. Adapted from [316,317,329].

correlation between upper gastrointestinal tumors and specific mutations has not been established, although there are data to suggest that some specific mutations are associated with a higher rate of these lesions, including mutations beyond codon 1395, those beyond codon 934, and within codons 564 to 1465. CHRPE is associated with mutations falling between codons 311 and 1444 (Figure 19.9). Well-established methodologies are in place for screening patients in whom a diagnosis of FAP is a consideration. Recommendations for indications and approach have been suggested by the American Gastroenterological Association, and the primary indications include clinically high suspicion for FAP (>100 colorectal adenomas), first-degree relatives of FAP patients, >20 cumulative colorectal adenomas (suspected AFAP), and first-degree relatives of patients with AFAP [322]. In de novo cases or in cases in which a family mutation is unknown, there are several high-throughput approaches to conduct the mutational analysis [331]. Sequencing of the entire coding region is the gold standard for

diagnosis, although other methods such as protein truncation tests and mutation scanning approaches can be used. In some settings, initial targeting of common mutational hotspots is the preferred method for initial screening, followed by more extensive sequence analysis if the common mutations are not identified. Once a mutation is identified, targeted genetic testing can be carried out for potentially affected family members. Additionally, there is a growing use of such targeted genetic testing as part of preimplantation genetic diagnosis [332]. In a subset of patients, a discrete APC mutation is not identified using first-line approaches to diagnosis. In some cases, adjusting the approach to screen individual alleles of APC yields a diagnostic mutation or, in some cases, large exonic or entire gene deletions [333]. However, in other cases, these approaches do not identify a discrete APC mutation. An alternative target for genetic testing has recently been identified as MUTYH, in which biallelic mutations are detected in a significant minority of APC mutation negative cases of polyposis, and is 385

Part IV


correlated to cases of attenuated FAP (AFAP) [171]. There have been a number of approaches for identifying the underlying molecular changes in APC mutation negative cases not resolved by the evaluation of individual alleles or MUTYH gene, including examination of epigenetic regulation of the APC gene, evaluation of genes encoding other proteins involved in the b-catenin pathway such as Axin, evaluation of allelic mRNA ratios, and evaluation of somatic APC mosaicism [334]. Germline hypermethylation of the APC gene has been shown not to be a significant cause of FAP in APC mutation negative cases [335]. One study has shown unbalanced APC allelic mRNA expression in cases in which no other discrete mutation was identified. Interestingly, in the tumor specimens from these cases, there was loss of the remaining wild-type allele, indicating that the reduced dosage of APC and unbalanced APC allelic mRNA expression may create a functional haploinsufficiency that engenders the same predisposition to colorectal carcinogenesis [336]. The mechanism of unbalanced allelic mRNA expression is unclear. Mutations in AXIN2 have also been rarely identified in APC mutation negative FAP. Surveillance of those affected by FAP begins early in life with annual sigmoidoscopy or colonoscopy, beginning at age 10 to 12, followed by prophylactic colectomy, usually by the time the patient reaches his or her early 20s. Additionally, regular endoscopy with full visualization of the stomach, duodenum, and peri-ampullary region has been recommended; however, the optimal timing of these screening evaluations is not well established and is generally managed based on the severity of upper gastrointestinal disease burden. Additional recommendations are based on extra-colonic manifestations which have the propensity for morbidity and mortality. These include annual palpation of the thyroid, with some advocating a low threshold for referral for ultrasound examination and serum AFP levels and abdominal palpation every 6 months in young children in FAP families to detect hepatoblastoma.

REFERENCES 1. World Health Organization. Burden of disease-mortality (as appeared in the 1999 World Health Report): Mortality by sex, cause, and WHO region, estimates for 1998. Available at: http://www-net.who.int/whosis/statistics/burden_whr/burden_ whr_mortality_process.cfm/; 1998 Accessed October 3, 2000. 2. Parkin DM, Bray F, Ferlay J, et al. Global cancer statistics, 2002. CA Cancer J Clin. 2005;55:74–108. 3. Pickle LW, Hao Y, Jemal A, et al. A new method of estimating United States and state-level cancer incidence counts for the current calendar year. CA Cancer J Clin. 2007;57:30–42. 4. Correa P. Helicobacter pylori and gastric carcinogenesis. Am J Surg Pathol. 1995;19:S37–S43. 5. Sipponen P, Kekki M, Haapakoski J, et al. Gastric cancer risk in chronic atrophic gastritis: Statistical calculations of cross-sectional data. Int J Cancer. 1985;35:173–177. 6. Kimura K. Gastritis and gastric cancer. Asia. Gastroenterol Clin North Am. 2000;29:609–621. 7. Dixon MF, Genta RM, Yardley JH, et al. Classification and grading of gastritis. The updated Sydney system. International workshop on the histopathology of gastritis, Houston 1994. Am J Surg Pathol. 1996;20:1161–1181.

386

8. La Vecchia C, Negri E, Franceschi S, et al. Family history and the risk of stomach and colorectal cancer. Cancer. 1992;70:50–55. 9. Zanghieri G, Di Gregorio C, Sacchetti C, et al. Familial occurrence of gastric cancer in the 20-year experience of a population-based registry. Cancer. 1990;66:2047–2051. 10. Brenner H, Arndt V, Sturmer T, et al. Individual and joint contribution of family history and Helicobacter pylori infection to the risk of gastric carcinoma. Cancer. 2000;88:274–279. 11. Palli D. Epidemiology of gastric cancer: An evaluation of available evidence. J Gastroenterol. 2000;35(Suppl 12):84–89. 12. Sriamporn S, Setiawan V, Pisani P, et al. Gastric cancer: The roles of diet, alcohol drinking, smoking and Helicobacter pylori in Northeastern Thailand. Asian Pac J Cancer Prev. 2002;3: 345–352. 13. Brenner H, Arndt V, Bode G, et al. Risk of gastric cancer among smokers infected with Helicobacter pylori. Int J Cancer. 2002;98:446–449. 14. Gologan A, Graham DY, Sepulveda AR. Molecular markers in Helicobacter pylori-associated gastric carcinogenesis. Clin Lab Med. 2005;25:197–222. 15. Sepulveda AR, Dore MP, Bazzoli F. Chronic gastritis (http:// www.emedicine.com/med/topic852.htm). Emedicine. 2007;2. 16. Warren JR, Marshall B. Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet. 1983;1:1273–1275. 17. Marshall BJ. Helicobacter pylori: The etiologic agent for peptic ulcer. JAMA. 1995;274:1064–1066. 18. International Agency for Research of Cancer. Shistosomes, liver flukes and Helicobacter pylori. IARC Monogr Eval Carcinog Risks Hum. 1994. 19. Parsonnet J, Friedman GD, Vandersteen DP, et al. Helicobacter pylori and the risk of gastric carcinoma. N Eng J Med. 1991;325:1127–1131. 20. Huang JQ, Sridhar S, Chen Y, et al. Meta-analysis of the relationship between Helicobacter pylori seropositivity and gastric cancer. Gastroenterology. 1998;114:1169–1179. 21. Helicobacter and Cancer Collaborative Group. Gastric cancer and Helicobacter pylori: A combined analysis of 12 case control studies nested within prospective cohorts. Gut. 2001;49:347–353. 22. Sipponen P, Marshall BJ. Gastritis and gastric cancer. Western countries. Gastroenterol Clin North Am. 2000;29:579–592, v–vi. 23. Uemura N, Okamoto S, Yamamoto S, et al. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med. 2001;345:784–789. 24. Whiting JL, Sigurdsson A, Rowlands DC, et al. The long term results of endoscopic surveillance of premalignant gastric lesions. Gut. 2002;50:378–381. 25. Sepulveda AR, Coelho LG. Helicobacter pylori and gastric malignancies. Helicobacter. 2002;7(Suppl 1):37–42. 26. Watanabe T, Tada M, Nagai H, et al. Helicobacter pylori infection induces gastric cancer in Mongolian gerbils. Gastroenterology. 1998;115:642–648. 27. Sugiyama A, Maruta F, Ikeno T, et al. Helicobacter pylori infection enhances N-methyl-N-nitrosourea-induced stomach carcinogenesis in the Mongolian gerbil. Cancer Res. 1998;58:2067–2069. 28. Honda S, Fujioka T, Tokieda M, et al. Development of Helicobacter pylori-induced gastric carcinoma in Mongolian gerbils. Cancer Res. 1998;58:4255–4259. 29. Shimizu N, Inada K, Nakanishi H, et al. Helicobacter pylori infection enhances glandular stomach carcinogenesis in Mongolian gerbils treated with chemical carcinogens. Carcinogenesis. 1999;20:669–676. 30. Houghton J, Stoicov C, Nomura S, et al. Gastric cancer originating from bone marrow-derived cells. Science. 2004;306: 1568–1571. 31. Uemura N, Mukai T, Okamoto S, et al. Effect of Helicobacter pylori eradication on subsequent development of cancer after endoscopic resection of early gastric cancer. Cancer Epidemiol Biomarkers Prev. 1997;6:639–642. 32. Fukase K, Kato M, Kikuchi S, et al. Effect of eradication of Helicobacter pylori on incidence of metachronous gastric carcinoma after endoscopic resection of early gastric cancer: An open-label, randomised controlled trial. Lancet. 2008;372:392–397. 33. Wong BC, Lam SK, Wong WM, et al. Helicobacter pylori eradication to prevent gastric cancer in a high-risk region of China: A randomized controlled trial. JAMA. 2004;291:187–194.

Chapter 19 34. Goodman KJ, Correa P. The transmission of Helicobacter pylori. A critical review of the evidence. Int J Epidemiol. 1995;24:875–887. 35. Sipponen P. Helicobacter pylori gastritis—Epidemiology. J Gastroenterol. 1997;32:273–277. 36. Malfertheiner P, Megraud F, O’Morain C, et al. Current concepts in the management of Helicobacter pylori infection: The Maastricht III Consensus Report. Gut. 2007;56:772–781. 37. Chey WD, Wong BC. American College of Gastroenterology guideline on the management of Helicobacter pylori infection. Am J Gastroenterol. 2007;102:1808–1825. 38. Asaka M, Sugiyama T, Nobuta A, et al. Atrophic gastritis and intestinal metaplasia in Japan: Results of a large multicenter study. Helicobacter. 2001;6:294–299. 39. Robinson K, Argent RH, Atherton JC. The inflammatory and immune response to Helicobacter pylori infection. Best Pract Res Clin Gastroenterol. 2007;21:237–259. 40. Wilson KT, Crabtree JE. Immunology of Helicobacter pylori: Insights into the failure of the immune response and perspectives on vaccine studies. Gastroenterology. 2007;133:288–308. 41. Anonymous. Live flukes and Helicobacter pylori. IARC Working group on the Evaluation of Carcinogenic Risks to Humans. Lyon. 7–14 June 1994. IARC Monogr Eval Carcinog Risks Hum. 1994;61:1–241. 42. Nomura A, Stemmermann GN, Chyou PH, et al. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N Engl J Med. 1991;325: 1132–1136. 43. Dixon MF. Histological responses to Helicobacter pylori infection: Gastritis, atrophy and preneoplasia. Baillieres Clin Gastroenterol. 1995;9:467–486. 44. Correa P, Houghton J. Carcinogenesis of Helicobacter pylori. Gastroenterology. 2007;133:659–672. 45. Giannakis M, Chen SL, Karam SM, et al. Helicobacter pylori evolution during progression from chronic atrophic gastritis to gastric cancer and its impact on gastric stem cells. Proc Natl Acad Sci USA. 2008;105:4358–4363. 46. Katoh M. Dysregulation of stem cell signaling network due to germline mutation, SNP, Helicobacter pylori infection, epigenetic change and genetic alteration in gastric cancer. Cancer Biol Ther. 2007;6:832–839. 47. Hamilton RS, Aaltonen LA. Pathology and Genetics of the Digestive System. World Health Organization Classification of Tumors. IARC Press, Lyon, France, 2000:38–52. 48. Greene F, Page D, Fleming I, et al. eds. AJCC Cancer Staging Manual. 6th ed. New York: Springer-Verlag; 2002. 49. Lauren P. The two histological main types of gastric carcinoma: Diffuse and so-called intestinal-type carcinoma: An attempt at a histo-clinical classification. Acta Pathol et Microbiol Scandinav. 1965;64:31–49. 50. Sepulveda AR, Wu L, Ota H, et al. Molecular identification of main cellular lineages as a tool for the classification of gastric cancer. Hum Pathol. 2000;31:566–574. 51. Correa P. Human gastric carcinogenesis: A multistep and multifactorial process—First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 1992; 52:6735–6740. 52. Cassaro M, Rugge M, Gutierrez O, et al. Topographic patterns of intestinal metaplasia and gastric cancer. Am J Gastroenterol. 2000;95:1431–1438. 53. Recavarren-Arce S, Leon-Barua R, Cok J, et al. Helicobacter pylori and progressive gastric pathology that predisposes to gastric cancer. Scand J Gastroenterol Suppl. 1991;181:51–57. 54. Kodama K, Sumii K, Kawano M, et al. Gastric juice nitrite and vitamin C in patients with gastric cancer and atrophic gastritis: Is low acidity solely responsible for cancer risk? Eur J Gastroenterol Hepatol. 2003;15:987–993. 55. Sepulveda A, Peterson LE, Shelton J, et al. Histological patterns of gastritis in H. pylori-infected individuals with a family history of gastric cancer. Am J Gastroenterol. 2002;97:1365–1370. 56. Shimada T, Watanabe N, Hiraishi H, et al. Redox regulation of interleukin-8 expression in MKN28 cells. Dig Dis Sci. 1999; 44:266–273. 57. Handa O, Naito Y, Yoshikawa T. CagA protein of Helicobacter pylori: A hijacker of gastric epithelial cell signaling. Biochem Pharmacol. 2007;73:1697–1702. 58. Peek RM Jr, Moss SF, Tham KT, et al. Helicobacter pylori cagAþ strains and dissociation of gastric epithelial cell proliferation

59. 60.

61. 62. 63. 64.

65. 66. 67. 68. 69. 70.

71.

72.

73. 74.

75. 76.

77.

78. 79. 80.

81.

Molecular Basis of Diseases of the Gastrointestinal Tract from apoptosis [see comments]. J Natl Cancer Inst. 1997;89: 863–868. Moss SF, Calam J, Agarwal B, et al. Induction of gastric epithelial apoptosis by Helicobacter pylori. Gut. 1996;38:498–501. Shirin H, Sordillo EM, Kolevska TK, et al. Chronic helicobacter pylori infection induces an apoptosis-resistant phenotype associated with decreased expression of p27(kip1). Infect Immun. 2000;68:5321–5328. Farinati F, Cardin R, Degan P, et al. Oxidative DNA damage accumulation in gastric carcinogenesis. Gut. 1998;42:351–356. Yao Y, Tao H, Park DI, et al. Demonstration and characterization of mutations induced by Helicobacter pylori organisms in gastric epithelial cells. Helicobacter. 2006;11:272–286. El-Omar EM, Carrington M, Chow WH, et al. Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000;404:398–402. El-Omar EM, Rabkin CS, Gammon MD, et al. Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology. 2003;124:1193– 1201. El-Omar EM. Role of host genes in sporadic gastric cancer. Best Pract Res Clin Gastroenterol. 2006;20:675–686. Machado JC, Figueiredo C, Canedo P, et al. A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology. 2003;125:364–371. Farinati F, Cardin R, Bortolami M, et al. Oxidative DNA damage in gastric cancer: CagA status and OGG1 gene polymorphism. Int J Cancer. 2008;123:51–55. Kang GH, Lee S, Kim JS, et al. Profile of aberrant CpG island methylation along the multistep pathway of gastric carcinogenesis. Lab Invest. 2003;83:635–641. Kang GH, Lee S, Cho NY, et al. DNA methylation profiles of gastric carcinoma characterized by quantitative DNA methylation analysis. Lab Invest. 2008;161–170. Chan AO, Chu KM, Huang C, et al. Association between Helicobacter pylori infection and interleukin 1beta polymorphism predispose to CpG island methylation in gastric cancer. Gut. 2007;56:595–597. Qian X, Huang C, Cho CH, et al. E-cadherin promoter hypermethylation induced by interleukin-1beta treatment or H. pylori infection in human gastric cancer cell lines. Cancer Lett. 2008;263:107–113. Fu S, Ramanujam KS, Wong A, et al. Increased expression and cellular localization of inducible nitric oxide synthase and cyclooxygenase 2 in Helicobacter pylori gastritis. Gastroenterology. 1999;116:1319–1329. Li CQ, Pignatelli B, Ohshima H. Coexpression of interleukin-8 and inducible nitric oxide synthase in gastric mucosa infected with cagAþ Helicobacter pylori. Dig Dis Sci. 2000;45:55–62. Grisham MB, Jourd’heuil D, Wink DA. Review article: Chronic inflammation and reactive oxygen and nitrogen metabolism— implications in DNA damage and mutagenesis. Aliment Pharmacol Ther. 2000;14(Suppl 1):3–9. Plummer SM, Hall M, Faux SP. Oxidation and genotoxicity of fecapentaene-12 are potentiated by prostaglandin H synthase. Carcinogenesis. 1995;16:1023–1028. Verhulst ML, van Oijen AH, Roelofs HM, et al. Antral glutathione concentration and glutathione S-transferase activity in patients with and without Helicobacter pylori. Dig Dis Sci. 2000;45:629–632. Hahm KB, Lee KJ, Choi SY, et al. Possibility of chemoprevention by the eradication of Helicobacter pylori: Oxidative DNA damage and apoptosis in H. pylori infection. Am J Gastroenterol. 1997;92:1853–1857. Shiao YH, Rugge M, Correa P, et al. p53 alteration in gastric precancerous lesions. Am J Pathol. 1994;144:511–517. Kolodner RD, Marsischky GT. Eukaryotic DNA mismatch repair. Curr Opin Genet Dev. 1999;9:89–96. Flores-Rozas H, Kolodner RD. The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations. Proc Natl Acad Sci USA. 1998;95: 12404–12409. Lipkin SM, Wang V, Jacoby R, et al. MLH3: A DNA mismatch repair gene associated with mammalian microsatellite instability. Nat Genet. 2000;24:27–35.

387

Part IV


82. Umar A. Lynch syndrome (HNPCC) and microsatellite instability. Dis Markers. 2004;20:179–180. 83. Kim JJ, Tao H, Carloni E, et al. Helicobacter pylori impairs DNA mismatch repair in gastric epithelial cells. Gastroenterology. 2002;123:542–553. 84. Leung WK, Kim JJ, Kim JG, et al. Microsatellite instability in gastric intestinal metaplasia in patients with and without gastric cancer. Am J Pathol. 2000;156:537–543. 85. Kashiwagi K, Watanabe M, Ezaki T, et al. Clinical usefulness of microsatellite instability for the prediction of gastric adenoma or adenocarcinoma in patients with chronic gastritis. Br J Cancer. 2000;82:1814–1818. 86. Ling XL, Fang DC, Wang RQ, et al. Mitochondrial microsatellite instability in gastric cancer and its precancerous lesions. World J Gastroenterol. 2004;10:800–803. 87. Semba S, Yokozaki H, Yamamoto S, et al. Microsatellite instability in precancerous lesions and adenocarcinomas of the stomach. Cancer. 1996;77:1620–1627. 88. Hamamoto T, Yokozaki H, Semba S, et al. Altered microsatellites in incomplete-type intestinal metaplasia adjacent to primary gastric cancers. J Clin Pathol. 1997;50:841–846. 89. Ottini L, Palli D, Falchetti M, et al. Microsatellite instability in gastric cancer is associated with tumor location and family history in a high-risk population from Tuscany. Cancer Res. 1997;57:4523–4529. 90. Fang DC, Jass JR, Wang DX, et al. Infrequent loss of heterozygosity of APC/MCC and DCC genes in gastric cancer showing DNA microsatellite instability. J Clin Pathol. 1999;52:504–508. 91. Kobayashi K, Okamoto T, Takayama S, et al. Genetic instability in intestinal metaplasia is a frequent event leading to well-differentiated early adenocarcinoma of the stomach. Eur J Cancer. 2000;36:1113–1119. 92. Wu MS, Lee CW, Shun CT, et al. Clinicopathological significance of altered loci of replication error and microsatellite instability-associated mutations in gastric cancer. Cancer Res. 1998;58:1494–1497. 93. Wu MS, Lee CW, Shun CT, et al. Distinct clinicopathologic and genetic profiles in sporadic gastric cancer with different mutator phenotypes. Genes Chromosomes Cancer. 2000;27:403–411. 94. Park TJ, Han SU, Cho YK, et al. Methylation of O(6)-methylguanine-DNA methyltransferase gene is associated significantly with K-ras mutation, lymph node invasion, tumor staging, and disease free survival in patients with gastric carcinoma. Cancer. 2001;92:2760–2768. 95. Sepulveda AR, Tao H, Carloni E, et al. Screening of gene expression profiles in gastric epithelial cells induced by Helicobacter pylori using microarray analysis. Aliment Pharmacol Ther. 2002;16(Suppl 2):145–157. 96. Meireles SI, Cristo EB, Carvalho AF, et al. Molecular classifiers for gastric cancer and nonmalignant diseases of the gastric mucosa. Cancer Res. 2004;64:1255–1265. 97. Meireles SI, Carvalho AF, Hirata R, et al. Differentially expressed genes in gastric tumors identified by cDNA array. Cancer Lett. 2003;190:199–211. 98. Baek MJ, Kang H, Kim SE, et al. Expression of hMLH1 is inactivated in the gastric adenomas with enhanced microsatellite instability. Br J Cancer. 2001;85:1147–1152. 99. Fleisher AS, Esteller M, Tamura G, et al. Hypermethylation of the hMLH1 gene promoter is associated with microsatellite instability in early human gastric neoplasia. Oncogene. 2001;20: 329–335. 100. Edmonston TB, Cuesta KH, Burkholder S, et al. Colorectal carcinomas with high microsatellite instability: Defining a distinct immunologic and molecular entity with respect to prognostic markers. Hum Pathol. 2000;31:1506–1514. 101. Umar A, Boland CR, Terdiman JP, et al. Revised Bethesda Guidelines for hereditary nonpolyposis colorectal cancer (Lynch syndrome) and microsatellite instability. J Natl Cancer Inst. 2004;96:261–268. 102. Kim SS, Bhang CS, Min KO, et al. p53 mutations and microsatellite instabilities in the subtype of intestinal metaplasia of the stomach. J Korean Med Sci. 2002;17:490–496. 103. Abraham SC, Park SJ, Lee JH, et al. Genetic alterations in gastric adenomas of intestinal and foveolar phenotypes. Mod Pathol. 2003;16:786–795.

388

104. Lee JH, Abraham SC, Kim HS, et al. Inverse relationship between APC gene mutation in gastric adenomas and development of adenocarcinoma. Am J Pathol. 2002;161:611–618. 105. Hayden JD, Martin IG, Cawkwell L, et al. The role of microsatellite instability in gastric carcinoma. Gut. 1998;42: 300–303. 106. Strickler JG, Zheng J, Shu Q, et al. p53 mutations and microsatellite instability in sporadic gastric cancer: When guardians fail. Cancer Research. 1994;54: 4750–4755. 107. Sepulveda AR, Santos AC, Yamaoka Y, et al. Marked differences in the frequency of microsatellite instability in gastric cancer from different countries. Am J Gastroenterol. 1999;94:3034–3038. 108. Yamamoto H, Sawai H, Perucho M. Frameshift somatic mutations in gastrointestinal cancer of the microsatellite mutator phenotype. Cancer Res. 1997;57:4420–4426. 109. Shinmura K, Tani M, Isogaki J, et al. RER phenotype and its associated mutations in familial gastric cancer. Carcinogenesis. 1998;19:247–251. 110. Myeroff LL, Parsons R, Kim SJ, et al. A transforming growth factor beta receptor type II gene mutation common in colon and gastric but rare in endometrial cancers with microsatellite instability. Cancer Research. 1995;55:5545–5547. 111. Chung YJ, Park SW, Song JM, et al. Evidence of genetic progression in human gastric carcinomas with microsatellite instability. Oncogene. 1997;15:1719–1726. 112. Kim JJ, Baek MJ, Kim L, et al. Accumulated frameshift mutations at coding nucleotide repeats during the progression of gastric carcinoma with microsatellite instability. Lab Invest. 1999;79:1113–1120. 113. Kim HS, Woo DK, Bae SI, et al. Microsatellite instability in the adenoma-carcinoma sequence of the stomach. Lab Invest. 2000;80:57–64. 114. Correa P, Shiao Y-H. Phenotypic and genotypic events in gastric carcinogenesis. Cancer Research. 1994;54(Suppl):1941–1943. 115. Nakatsuru S, Yanagisawa A, Furukawa Y, et al. Somatic mutations of the APC gene in precancerous lesion of the stomach. Hum Mol Genetics. 1993;2:1463–1465. 116. Maesawa C, Tamura G, Suzuki Y, et al. The sequential accumulation of genetic alterations characteristic of the colorectal adenoma-carcinoma sequence does not occur between gastric adenoma and adenocarcinoma. J Pathol. 1995;176:249–258. 117. Imatani A, Sasano H, Asaki S, et al. Analysis of p53 abnormalities in endoscopic gastric biopsies. Anticancer Res. 1996;16: 2049–2056. 118. Lee HS, Choi SI, Lee HK, et al. Distinct clinical features and outcomes of gastric cancers with microsatellite instability. Mod Pathol. 2002;15:632–640. 119. Hunt JD, Mera R, Strimas A, et al. KRAS mutations are not predictive for progression of preneoplastic gastric lesions. Cancer Epidemiol Biomarkers Prev. 2001;10:79–80. 120. Toyota M, Ahuja N, Suzuki H, et al. Aberrant methylation in gastric cancer associated with the CpG island methylator phenotype. Cancer Res. 1999;59:5438–5442. 121. Kang GH, Shim YH, Jung HY, et al. CpG island methylation in premalignant stages of gastric carcinoma. Cancer Res. 2001; 61:2847–2851. 122. To KF, Leung WK, Lee TL, et al. Promoter hypermethylation of tumor-related genes in gastric intestinal metaplasia of patients with and without gastric cancer. Int J Cancer. 2002;102:623–628. 123. Waki T, Tamura G, Sato M, et al. Promoter methylation status of DAP-kinase and RUNX3 genes in neoplastic and nonneoplastic gastric epithelia. Cancer Sci. 2003;94:360–364. 124. Lee JH, Park SJ, Abraham SC, et al. Frequent CpG island methylation in precursor lesions and early gastric adenocarcinomas. Oncogene. 2004;23:4646–4654. 125. Kang GH, Lee HJ, Hwang KS, et al. Aberrant CpG island hypermethylation of chronic gastritis, in relation to aging, gender, intestinal metaplasia, and chronic inflammation. Am J Pathol. 2003;163:1551–1556. 126. Mikata R, Yokosuka O, Fukai K, et al. Analysis of genes upregulated by the demethylating agent 5-aza-20 -deoxycytidine in gastric cancer cell lines. Int J Cancer. 2006;119:1616–1622. 127. Hippo Y, Taniguchi H, Tsutsumi S, et al. Global gene expression analysis of gastric cancer by oligonucleotide microarrays. Cancer Res. 2002;62:233–240.

Chapter 19 128. Lee S, Baek M, Yang H, et al. Identification of genes differentially expressed between gastric cancers and normal gastric mucosa with cDNA microarrays. Cancer Lett. 2002;184:197–206. 129. Kim B, Bang S, Lee S, et al. Expression profiling and subtypespecific expression of stomach cancer. Cancer Res. 2003;63: 8248–8255. 130. Wu MS, Lin YS, Chang YT, et al. Gene expression profiling of gastric cancer by microarray combined with laser capture microdissection. World J Gastroenterol. 2005;11:7405–7412. 131. Kim SY, Kim JH, Lee HS, et al. Meta- and gene set analysis of stomach cancer gene expression data. Mol Cells. 2007;24:200–209. 132. Myllykangas S, Junnila S, Kokkola A, et al. Integrated gene copy number and expression microarray analysis of gastric cancer highlights potential target genes. Int J Cancer. 2008;123:817–825. 133. Hasegawa S, Furukawa Y, Li M, et al. Genome-wide analysis of gene expression in intestinal-type gastric cancers using a complementary DNA microarray representing 23,040 genes. Cancer Res. 2002;62:7012–7017. 134. Boussioutas A, Li H, Liu J, et al. Distinctive patterns of gene expression in premalignant gastric mucosa and gastric cancer. Cancer Res. 2003;63:2569–2577. 135. Jinawath N, Furukawa Y, Hasegawa S, et al. Comparison of gene-expression profiles between diffuse- and intestinal-type gastric cancers using a genome-wide cDNA microarray. Oncogene. 2004;23:6830–6844. 136. Chan SH, Wu CW, Li AF, et al. miR-21 microRNA expression in human gastric carcinomas and its clinical association. Anticancer Res. 2008;28:907–911. 137. Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci USA. 2006;103:2257–2261. 138. Guilford P, Hopkins J, Harraway J, et al. E-cadherin germline mutations in familial gastric cancer. Nature. 1998;392: 402–405. 139. Guilford PJ, Hopkins JB, Grady WM, et al. E-cadherin germline mutations define an inherited cancer syndrome dominated by diffuse gastric cancer. Hum Mutat. 1999;14:249–255. 140. Barber M, Fitzgerald RC, Caldas C. Familial gastric cancer— Aetiology and pathogenesis. Best Pract Res Clin Gastroenterol. 2006;20:721–734. 141. Lichtenstein P, Holm NV, Verkasalo PK, et al. Environmental and heritable factors in the causation of cancer—Analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med. 2000;343:78–85. 142. Rogers WM, Dobo E, Norton JA, et al. Risk-reducing total gastrectomy for germline mutations in E-cadherin (CDH1): Pathologic findings with clinical implications. Am J Surg Pathol. 2008;32:799–809. 143. Gayther SA, Gorringe KL, Ramus SJ, et al. Identification of germ-line E-cadherin mutations in gastric cancer families of European origin. Cancer Res. 1998;58:4086–4089. 144. Kaurah P, MacMillan A, Boyd N, et al. Founder and recurrent CDH1 mutations in families with hereditary diffuse gastric cancer. JAMA. 2007;297:2360–2372. 145. Keller G. Hereditary aspects of gastric cancer. Pathologica. 2002;94:229–233. 146. Yoon KA, Ku JL, Yang HK, et al. Germline mutations of Ecadherin gene in Korean familial gastric cancer patients. J Hum Genet. 1999;44:177–180. 147. Caldas C, Carneiro F, Lynch HT, et al. Familial gastric cancer: Overview and guidelines for management. J Med Genet. 1999;36:873–880. 148. Shinmura K, Kohno T, Takahashi M, et al. Familial gastric cancer: Clinicopathological characteristics, RER phenotype and germline p53 and E-cadherin mutations. Carcinogenesis. 1999;20:1127–1131. 149. Aarnio M, Salovaara R, Aaltonen LA, et al. Features of gastric cancer in hereditary non-polyposis colorectal cancer syndrome. Int J Cancer. 1997;74:551–555. 150. Heinimann K, Muller H, Weber W, et al. Disease expression in Swiss hereditary non-polyposis colorectal cancer (HNPCC) kindreds. Int J Cancer. 1997;74:281–285. 151. Giardiello FM, Welsh SB, Hamilton SR, et al. Increased risk of cancer in the Peutz-Jeghers syndrome. N Engl J Med. 1987;316:1511–1514.

Molecular Basis of Diseases of the Gastrointestinal Tract

152. Boardman LA, Thibodeau SN, Schaid DJ, et al. Increased risk for cancer in patients with the Peutz-Jeghers syndrome. Ann Intern Med. 1998;128:896–899. 153. Wallace MH, Phillips RK. Upper gastrointestinal disease in patients with familial adenomatous polyposis. Br J Surg. 1998;85:742–750. 154. Kim IJ, Park JH, Kang HC, et al. A novel germline mutation in the MET extracellular domain in a Korean patient with the diffuse type of familial gastric cancer. J Med Genet. 2003;40:e97. 155. Figer A, Irmin L, Geva R, et al. The rate of the 6174delT founder Jewish mutation in BRCA2 in patients with noncolonic gastrointestinal tract tumours in Israel. Br J Cancer. 2001;84:478–481. 156. Berx G, Staes K, van Hengel J, et al. Cloning and characterization of the human invasion suppressor gene E-cadherin (CDH1). Genomics. 1995;26:281–289. 157. Brooks-Wilson AR, Kaurah P, Suriano G, et al. Germline E-cadherin mutations in hereditary diffuse gastric cancer: Assessment of 42 new families and review of genetic screening criteria. J Med Genet. 2004;41:508–517. 158. Pharoah PD, Guilford P, Caldas C. Incidence of gastric cancer and breast cancer in CDH1 (E-cadherin) mutation carriers from hereditary diffuse gastric cancer families. Gastroenterology. 2001;121:1348–1353. 159. Oliveira C, Moreira H, Seruca R, et al. Role of pathology in the identification of hereditary diffuse gastric cancer: Report of a Portuguese family. Virchows Arch. 2005;446:181–184. 160. Grady WM, Willis J, Guilford PJ, et al. Methylation of the CDH1 promoter as the second genetic hit in hereditary diffuse gastric cancer. Nat Genet. 2000;26:16–17. 161. Takeichi M. Cadherin cell adhesion receptors as a morphogenetic regulator. Science. 1991;251:1451–1455. 162. Jou TS, Stewart DB, Stappert J, et al. Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc Natl Acad Sci USA. 1995;92: 5067–5071. 163. Kallakury BV, Sheehan CE, Winn-Deen E, et al. Decreased expression of catenins (alpha and beta), p120 CTN, and E-cadherin cell adhesion proteins and E-cadherin gene promoter methylation in prostatic adenocarcinomas. Cancer. 2001;92: 2786–2795. 164. Caldeira JR, Prando EC, Quevedo FC, et al. CDH1 promoter hypermethylation and E-cadherin protein expression in infiltrating breast cancer. BMC Cancer. 2006;6:48. 165. Hirohashi S. Molecular aspects of adhesion-epigenetic mechanisms for inactivation of the E-cadherin-mediated cell adhesion system in cancers. Verh Dtsch Ges Pathol. 2000;84:28–32. 166. Birchmeier W. E-cadherin as a tumor (invasion) suppressor gene. Bioessays. 1995;17:97–99. 167. Bremm A, Walch A, Fuchs M, et al. Enhanced activation of epidermal growth factor receptor caused by tumor-derived E-cadherin mutations. Cancer Res. 2008;68:707–714. 168. American Cancer Society. Estimated New Cancer Cases and Deaths by Sex for All Sites, US. http://www.cancer.org/downloads/MED/Page4.pdf/; 2004 Accessed November 7, 2004. 169. SEER. http://seer.cancer.gov/csr/1975_2005/results_single/ sect_01_table.01.pdf/. 170. Lynch HT, Lanspa SJ, Boman BM, et al. Hereditary nonpolyposis colorectal cancer—Lynch syndromes I and II. Gastroenterol Clin North Am. 1988;17:679–712. 171. Nielsen M, Hes FJ, Nagengast FM, et al. Germline mutations in APC and MUTYH are responsible for the majority of families with attenuated familial adenomatous polyposis. Clin Genet. 2007;71:427–433. 172. Torlakovic E, Snover DC. Sessile serrated adenoma: A brief history and current status. Crit Rev Oncog. 2006;12:27–39. 173. Iwabuchi M, Sasano H, Hiwatashi N, et al. Serrated adenoma: A clinicopathological, DNA ploidy, and immunohistochemical study. Anticancer Res. 2000;20:1141–1147. 174. East JE, Saunders BP, Jass JR. Sporadic and syndromic hyperplastic polyps and serrated adenomas of the colon: Classification, molecular genetics, natural history, and clinical management. Gastroenterol Clin North Am. 2008;37:25–46. 175. Lindblom A. Different mechanisms in the tumorigenesis of proximal and distal colon cancers. Curr Opin Oncol. 2001;13: 63–69.

389

Part IV


176. Tsushimi T, Noshima S, Oga A, et al. DNA amplification and chromosomal translocations are accompanied by chromosomal instability: Analysis of seven human colon cancer cell lines by comparative genomic hybridization and spectral karyotyping. Cancer Genet Cytogenet. 2001;126:34–38. 177. Goel A, Arnold CN, Niedzwiecki D, et al. Characterization of sporadic colon cancer by patterns of genomic instability. Cancer Res. 2003;63:1608–1614. 178. Charames GS, Bapat B. Genomic instability and cancer. Curr Mol Med. 2003;3:589–596. 179. Whitehall VL, Wynter CV, Walsh MD, et al. Morphological and molecular heterogeneity within nonmicrosatellite instabilityhigh colorectal cancer. Cancer Res. 2002;62:6011–6014. 180. Grady WM. CIMP and colon cancer gets more complicated. Gut. 2007;56:1498–1500. 181. Goel A, Nagasaka T, Arnold CN, et al. The CpG island methylator phenotype and chromosomal instability are inversely correlated in sporadic colorectal cancer. Gastroenterology. 2007;132: 127–138. 182. Kern SE, Fearon ER, Tersmette KW, et al. Clinical and pathological associations with allelic loss in colorectal carcinoma [corrected]. JAMA. 1989;261:3099–3103. 183. Lengauer C, Kinzler KW, Vogelstein B. Genetic instability in colorectal cancers. Nature. 1997;386:623–627. 184. Grady WM. Genomic instability and colon cancer. Cancer Metastasis Rev. 2004;23:11–27. 185. Rhyu MG, Park WS, Jung YJ, et al. Allelic deletions of MCC/ APC and p53 are frequent late events in human gastric carcinogenesis. Gastroenterology. 1994;106:1584–1588. 186. Fearon ER, Cho KR, Nigro JM, et al. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science. 1990;247:49–56. 187. Kikuchi-Yanoshita R, Konishi M, Fukunari H, et al. Loss of expression of the DCC gene during progression of colorectal carcinomas in familial adenomatous polyposis and non-familial adenomatous polyposis patients. Cancer Res. 1992;52:3801– 3803. 188. Suraweera N, Duval A, Reperant M, et al. Evaluation of tumor microsatellite instability using five quasimonomorphic mononucleotide repeats and pentaplex PCR. Gastroenterology. 2002;123:1804–1811. 189. Jen J, Powell SM, Papadopoulos N, et al. Molecular determinants of dysplasia in colorectal lesions. Cancer Res. 1994;54: 5523–5526. 190. Miyaki M, Konishi M, Kikuchi-Yanoshita R, et al. Characteristics of somatic mutation of the adenomatous polyposis coli gene in colorectal tumors. Cancer Res. 1994;54:3011–3020. 191. Vogelstein B, Fearon ER, Hamilton SR, et al. Genetic alterations during colorectal-tumor development. N Engl J Med. 1988;319:525–532. 192. Hedrick L, Cho KR, Fearon ER, et al. The DCC gene product in cellular differentiation and colorectal tumorigenesis. Genes Dev. 1994;8:1174–1183. 193. Baker SJ, Fearon ER, Nigro JM, et al. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science. 1989;244:217–221. 194. Kikuchi-Yanoshita R, Konishi M, Ito S, et al. Genetic changes of both p53 alleles associated with the conversion from colorectal adenoma to early carcinoma in familial adenomatous polyposis and non-familial adenomatous polyposis patients. Cancer Res. 1992;52:3965–3971. 195. Soussi T, Asselain B, Hamroun D, et al. Meta-analysis of the p53 mutation database for mutant p53 biological activity reveals a methodologic bias in mutation detection. Clin Cancer Res. 2006;12:62–69. 196. Pruitt K, Der CJ. Ras and Rho regulation of the cell cycle and oncogenesis. Cancer Lett. 2001;171:1–10. 197. Takayama T, Ohi M, Hayashi T, et al. Analysis of K-ras, APC, and beta-catenin in aberrant crypt foci in sporadic adenoma, cancer, and familial adenomatous polyposis. Gastroenterology. 2001;121:599–611. 198. Losi L, Ponz de Leon M, Jiricny J, et al. K-ras and p53 mutations in hereditary non-polyposis colorectal cancers. Int J Cancer. 1997;74:94–96.

390

199. Toyota M, Ahuja N, Ohe-Toyota M, CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci USA. 1999;96:8681–8686. 200. Samowitz WS, Holden JA, Curtin K, et al. Inverse relationship between microsatellite instability and K-ras and p53 gene alterations in colon cancer. Am J Pathol. 2001;158:1517–1524. 201. Young J, Simms LA, Biden KG, et al. Features of colorectal cancers with high-level microsatellite instability occurring in familial and sporadic settings: Parallel pathways of tumorigenesis. Am J Pathol. 2001;159:2107–2116. 202. Yashiro M, Carethers JM, Laghi L, et al. Genetic pathways in the evolution of morphologically distinct colorectal neoplasms. Cancer Res. 2001;61:2676–2683. 203. Hadjihannas MV, Bruckner M, Jerchow B, et al. Aberrant Wnt/ beta-catenin signaling can induce chromosomal instability in colon cancer. Proc Natl Acad Sci USA. 2006;103:10747–10752. 204. Herman JG, Umar A, Polyak K, et al. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc Natl Acad Sci USA. 1998;95:6870–6875. 205. Kuismanen SA, Holmberg MT, Salovaara R, et al. Genetic and epigenetic modification of MLH1 accounts for a major share of microsatellite-unstable colorectal cancers. Am J Pathol. 2000;156:1773–1779. 206. Deng G, Chen A, Hong J, et al. Methylation of CpG in a small region of the hMLH1 promoter invariably correlates with the absence of gene expression. Cancer Res. 1999;59:2029–2033. 207. Lynch HT, Boman B, Fitzgibbons Jr RJ, et al. Hereditary nonpolyposis colon cancer: (Lynch syndrome I and II). A challenge for the clinician. Nebr Med J. 1989;74:2–7. 208. Lynch HT, Drouhard T, Lanspa S, et al. Mutation of an mutL homologue in a Navajo family with hereditary nonpolyposis colorectal cancer. J Natl Cancer Inst. 1994;86:1417–1419. 209. Lynch HT, Lynch JF. 25 years of HNPCC. Anticancer Res. 1994;14:1617–1624. 210. Peltomaki P. DNA mismatch repair and cancer. Mutat Res. 2001;488:77–85. 211. Liu B, Nicolaides C, Markowitz S, et al. Mismatch repair defects in sporadic colorectal cancers with microsatellite instability. Nature Genetics. 1995;9:48–55. 212. Calistri D, Presciuttini S, Buonsanti G, et al. Microsatellite instability in colorectal-cancer patients with suspected genetic predisposition. Int J Cancer. 2000;89:87–91. 213. Yamamoto H, Min Y, Itoh F, et al. Differential involvement of the hypermethylator phenotype in hereditary and sporadic colorectal cancers with high-frequency microsatellite instability. Genes Chromosomes Cancer. 2002;33:322–325. 214. Wheeler JM, Loukola A, Aaltonen LA, et al. The role of hypermethylation of the hMLH1 promoter region in HNPCC versus MSIþ sporadic colorectal cancers. J Med Genet. 2000;37:588– 592. 215. Lynch JP, Hoops TC. The genetic pathogenesis of colorectal cancer. Hematol Oncol Clin North Am. 2002;16:775–810. 216. Gologan A, Sepulveda AR. Microsatellite instability and DNA mismatch repair deficiency testing in hereditary and sporadic gastrointestinal cancers. Clin Lab Med. 2005;25:179–196. 217. Gologan A, Krasinskas A, Hunt J, et al. Performance of the revised Bethesda guidelines for identification of colorectal carcinomas with a high level of microsatellite instability. Arch Pathol Lab Med. 2005;129:1390–1397. 218. Alexander J, Watanabe T, Wu TT, et al. Histopathological identification of colon cancer with microsatellite instability. Am J Pathol. 2001;158:527–535. 219. Dolcetti R, Viel A, Doglioni C, et al. High prevalence of activated intraepithelial cytotoxic T lymphocytes and increased neoplastic cell apoptosis in colorectal carcinomas with microsatellite instability. Am J Pathol. 1999;154:1805–1813. 220. Greenson JK, Bonner JD, Ben-Yzhak O, et al. Phenotype of microsatellite unstable colorectal carcinomas: Well-differentiated and focally mucinous tumors and the absence of dirty necrosis correlate with microsatellite instability. Am J Surg Pathol. 2003;27:563–570. 221. Samowitz WS, Albertsen H, Herrick J, et al. Evaluation of a large, population-based sample supports a CpG island methylator phenotype in colon cancer. Gastroenterology. 2005;129:837–845.

Chapter 19 222. Ogino S, Cantor M, Kawasaki T, et al. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterized by quantitative DNA methylation analysis and prospective cohort studies. Gut. 2006;55:1000–1006. 223. Matsumura S, Oue N, Ito R, et al. The promoter methylation status of the DNA repair gene O6-methylguanine-DNA methyltransferase in ulcerative colitis. Virchows Arch. 2003;443:518–523. 224. Petko Z, Ghiassi M, Shuber A, et al. Aberrantly methylated CDKN2A, MGMT, and MLH1 in colon polyps and in fecal DNA from patients with colorectal polyps. Clin Cancer Res. 2005;11:1203–1209. 225. Weisenberger DJ, Siegmund KD, Campan M, et al. CpG island methylator phenotype underlies sporadic microsatellite instability and is tightly associated with BRAF mutation in colorectal cancer. Nat Genet. 2006;38:787–793. 226. Samowitz WS, Slattery ML, Sweeney C, et al. APC mutations and other genetic and epigenetic changes in colon cancer. Mol Cancer Res. 2007;5:165–170. 227. Kawasaki T, Nosho K, Ohnishi M, et al. Correlation of betacatenin localization with cyclooxygenase-2 expression and CpG island methylator phenotype (CIMP) in colorectal cancer. Neoplasia. 2007;9:569–577. 228. Ogino S, Kawasaki T, Nosho K, et al. LINE-1 hypomethylation is inversely associated with microsatellite instability and CpG methylator phenotype in colorectal cancer. Int J Cancer. 2008;122:2767–2773. 229. O’Brien MJ, Yang S, Mack C, et al. Comparison of microsatellite instability, CpG island methylation phenotype, BRAF and KRAS status in serrated polyps and traditional adenomas indicates separate pathways to distinct colorectal carcinoma end points. Am J Surg Pathol. 2006;30:1491–1501. 230. Yang S, Farraye FA, Mack C, et al. BRAF and KRAS Mutations in hyperplastic polyps and serrated adenomas of the colorectum: Relationship to histology and CpG island methylation status. Am J Surg Pathol. 2004;28:1452–1459. 231. Hawkins NJ, Ward RL. Sporadic colorectal cancers with microsatellite instability and their possible origin in hyperplastic polyps and serrated adenomas. J Natl Cancer Inst. 2001;93:1307–1313. 232. Munkholm P. Review article: The incidence and prevalence of colorectal cancer in inflammatory bowel disease. Aliment Pharmacol Ther. 2003;18(Suppl 2):1–5. 233. Harpaz N, Talbot IC. Colorectal cancer in idiopathic inflammatory bowel disease. Semin Diagn Pathol. 1996;13:339–357. 234. Itzkowitz SH, Harpaz N. Diagnosis and management of dysplasia in patients with inflammatory bowel diseases. Gastroenterology. 2004;126:1634–1648. 235. Boland CR, Luciani MG, Gasche C, et al. Infection, inflammation, and gastrointestinal cancer. Gut. 2005;54:1321–1331. 236. Karrasch T, Jobin C. NF-kappaB and the intestine: Friend or foe? Inflamm Bowel Dis. 2008;14:114–124. 237. Rose-John S, Scheller J, Elson G, et al. Interleukin-6 biology is coordinated by membrane-bound and soluble receptors: Role in inflammation and cancer. J Leukoc Biol. 2006;80: 227–236. 238. Rabe B, Chalaris A, May U, et al. Transgenic blockade of interleukin 6 transsignaling abrogates inflammation. Blood. 2008;111:1021–1028. 239. Vivanco I, Sawyers CL. The phosphatidylinositol 3-kinase AKT pathway in human cancer. Nat Rev Cancer. 2002;2:489–501. 240. Stenson WF. Prostaglandins and epithelial response to injury. Curr Opin Gastroenterol. 2007;23:107–110. 241. Itzkowitz SH. Molecular biology of dysplasia and cancer in inflammatory bowel disease. Gastroenterol Clin North Am. 2006;35:553–571. 242. Maia L, Dinis J, Cravo M, et al. Who takes the lead in the development of ulcerative colitis-associated colorectal cancers: Mutator, suppressor, or methylator pathway? Cancer Genet Cytogenet. 2005;162:68–73. 243. Aust DE, Terdiman JP, Willenbucher RF, et al. The APC/betacatenin pathway in ulcerative colitis-related colorectal carcinomas: A mutational analysis. Cancer. 2002;94:1421–1427. 244. Redston MS, Papadopoulos N, Caldas C, et al. Common occurrence of APC and K-ras gene mutations in the spectrum of colitis-associated neoplasias. Gastroenterology. 1995;108:383–392.


245. Tomlinson I, Ilyas M, Johnson V, et al. A comparison of the genetic pathways involved in the pathogenesis of three types of colorectal cancer. J Pathol. 1998;184:148–152. 246. Greenwald BD, Harpaz N, Yin J, et al. Loss of heterozygosity affecting the p53, Rb, and mcc/apc tumor suppressor gene loci in dysplastic and cancerous ulcerative colitis. Cancer Res. 1992;52:741–745. 247. Burmer GC, Rabinovitch PS, Haggitt RC, et al. Neoplastic progression in ulcerative colitis: Histology, DNA content, and loss of a p53 allele. Gastroenterology. 1992;103:1602–1610. 248. Yin J, Harpaz N, Tong Y, et al. p53 point mutations in dysplastic and cancerous ulcerative colitis lesions. Gastroenterology. 1993;104:1633–1639. 249. Brentnall TA, Crispin DA, Rabinovitch PS, et al. Mutations in the p53 gene: An early marker of neoplastic progression in ulcerative colitis. Gastroenterology. 1994;107:369–378. 250. Hussain SP, Amstad P, Raja K, et al. Increased p53 mutation load in noncancerous colon tissue from ulcerative colitis: A cancer-prone chronic inflammatory disease. Cancer Res. 2000;60:3333–3337. 251. Holzmann K, Klump B, Borchard F, et al. Comparative analysis of histology, DNA content, p53 and Ki-ras mutations in colectomy specimens with long-standing ulcerative colitis. Int J Cancer. 1998;76:1–6. 252. Meek DW. The p53 response to DNA damage. DNA Repair (Amst). 2004;3:1049–1056. 253. Fleisher AS, Esteller M, Harpaz N, et al. Microsatellite instability in inflammatory bowel disease-associated neoplastic lesions is associated with hypermethylation and diminished expression of the DNA mismatch repair gene, hMLH1. Cancer Res. 2000;60:4864–4868. 254. Chang DK, Goel A, Ricciardiello L, et al. Effect of H(2)O(2) on cell cycle and survival in DNA mismatch repair-deficient and -proficient cell lines. Cancer Lett. 2003;195:243–251. 255. Hofseth LJ, Khan MA, Ambrose M, et al. The adaptive imbalance in base excision-repair enzymes generates microsatellite instability in chronic inflammation. J Clin Invest. 2003;112: 1887–1894. 256. Souza RF, Lei J, Yin J, et al. A transforming growth factor beta 1 receptor type II mutation in ulcerative colitis-associated neoplasms [see comments]. Gastroenterology. 1997;112:40–45. 257. Takahashi T, Shigematsu H, Shivapurkar N, et al. Aberrant promoter methylation of multiple genes during multistep pathogenesis of colorectal cancers. Int J Cancer. 2005; 258. Schulmann K, Mori Y, Croog V, et al. Molecular phenotype of inflammatory bowel disease-associated neoplasms with microsatellite instability. Gastroenterology. 2005;129:74–85. 259. Hsieh CJ, Klump B, Holzmann K, et al. Hypermethylation of the p16INK4a promoter in colectomy specimens of patients with long-standing and extensive ulcerative colitis. Cancer Res. 1998;58:3942–3945. 260. Issa JP, Ahuja N, Toyota M, et al. Accelerated age-related CpG island methylation in ulcerative colitis. Cancer Res. 2001;61: 3573–3577. 261. Sato F, Shibata D, Harpaz N, et al. Aberrant methylation of the HPP1 gene in ulcerative colitis-associated colorectal carcinoma. Cancer Res. 2002;62:6820–6822. 262. Azarschab P, Porschen R, Gregor M, et al. Epigenetic control of the E-cadherin gene (CDH1) by CpG methylation in colectomy samples of patients with ulcerative colitis. Genes Chromosomes Cancer. 2002;35:121–126. 263. Konishi K, Shen L, Wang S, et al. Rare CpG island methylator phenotype in ulcerative colitis-associated neoplasias. Gastroenterology. 2007;132:1254–1260. 264. Aust DE, Haase M, Dobryden L, et al. Mutations of the BRAF gene in ulcerative colitis-related colorectal carcinoma. Int J Cancer. 2005;115:673–677. 265. Benhattar J, Saraga E. Molecular genetics of dysplasia in ulcerative colitis. Eur J Cancer. 1995;31A:1171–1173. 266. Itzkowitz SH, Present DH. Consensus conference: Colorectal cancer screening and surveillance in inflammatory bowel disease. Inflamm Bowel Dis. 2005;11:314–321. 267. Riddell RH, Goldman H, Ransohoff DF, et al. Dysplasia in inflammatory bowel disease: Standardized classification with provisional clinical applications. Hum Pathol. 1983;14:931–968.

391

Part IV


268. Peltomaki P. Deficient DNA mismatch repair: A common etiologic factor for colon cancer. Hum Mol Genet. 2001;10:735–740. 269. Terdiman JP. HNPCC: An uncommon but important diagnosis. Gastroenterology. 2001;121:1005–1008. 270. Llor X, Pons E, Xicola RM, et al. Differential features of colorectal cancers fulfilling Amsterdam criteria without involvement of the mutator pathway. Clin Cancer Res. 2005;11: 7304–7310. 271. Leach FS, Nicolaides NC, Papadopoulos N, et al. Mutations of a mutS homolog in hereditary nonpolyposis colorectal cancer. Cell. 1993;75:1215–1225. 272. Bronner CE, Baker SM, Morrison PT, et al. Mutation in the DNA mismatch repair gene homologue hMLH1 is associated with hereditary non-polyposis colon cancer. Nature. 1994; 368:258–261. 273. Nicolaides NC, Papadopoulos N, Liu B, et al. Mutations of two PMS homologues in hereditary nonpolyposis colon cancer. Nature. 1994;371:75–80. 274. Berends MJ, Wu Y, Sijmons RH, et al. Molecular and clinical characteristics of MSH6 variants: An analysis of 25 index carriers of a germline variant. Am J Hum Genet. 2002;70:26–37. 275. Kariola R, Raevaara TE, Lonnqvist KE, et al. Functional analysis of MSH6 mutations linked to kindreds with putative hereditary non-polyposis colorectal cancer syndrome. Hum Mol Genet. 2002;11:1303–1310. 276. Buttin BM, Powell MA, Mutch DG, et al. Penetrance and expressivity of MSH6 germline mutations in seven kindreds not ascertained by family history. Am J Hum Genet. 2004; 74:1262–1269. 277. Lin KM, Shashidharan M, Thorson AG, et al. Cumulative incidence of colorectal and extracolonic cancers in MLH1 and MSH2 mutation carriers of hereditary nonpolyposis colorectal cancer. J Gastrointest Surg. 1998;2:67–71. 278. Kolodner R. Biochemistry and genetics of eukaryotic mismatch repair. Genes & Development. 1996;10:1433–1442. 279. Genschel J, Littman SJ, Drummond JT, et al. Isolation of MutSbeta from human cells and comparison of the mismatch repair specificities of MutSbeta and MutSalpha. J Biol Chem. 1998;273:19895–19901. 280. Umar A, Risinger JI, Glaab WE, et al. Functional overlap in mismatch repair by human MSH3 and MSH6. Genetics. 1998;148:1637–1646. 281. Palombo F, Gallinari P, Iaccarino I, et al. GTBP, a 160-kilodalton protein essential for mismatch-binding activity in human cells. Science. 1995;268:1912–1914. 282. Marsischky GT, Filosi N, Kane MF, et al. Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 1996;10:407–420. 283. Sia EA, Kokoska RJ, Dominska M, et al. Microsatellite instability in yeast: Dependence on repeat unit size and DNA mismatch repair genes. Mol Cell Biol. 1997;17:2851–2858. 284. Lu A-L. Biochemistry of Mammalian DNA Mismatch Repair. Totowa: Humana Press; 1998. 285. Leung WK, Kim JJ, Wu L, et al. Identification of a second MutL DNA mismatch repair complex (hPMS1 and hMLH1) in human epithelial cells. J Biol Chem. 2000;275:15728–15732. 286. Raschle M, Marra G, Nystrom-Lahti M, et al. Identification of hMutLbeta, a heterodimer of hMLH1 and hPMS1. J Biol Chem. 1999;274:32368–32375. 287. Liu B, Parsons R, Papadopoulos N, et al. Analysis of mismatch repair genes in hereditary non-polyposis colorectal cancer patients. Nature Medicine. 1996;2:169–174. 288. Peltomaki P. Role of DNA mismatch repair defects in the pathogenesis of human cancer. J Clin Oncol. 2003;21:1174–1179. 289. Vasen HF, Watson P, Mecklin JP, et al. New clinical criteria for hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) proposed by the International Collaborative group on HNPCC. Gastroenterology. 1999;116:1453–1456. 290. Jass JR. Pathology of hereditary nonpolyposis colorectal cancer. Ann N Y Acad Sci. 2000;910:62–73. 291. De Jong AE, Morreau H, Van Puijenbroek M, et al. The role of mismatch repair gene defects in the development of adenomas in patients with HNPCC. Gastroenterology. 2004;126:42–48. 292. Vasen HF, den Hartog Jager FC, Menko FH, et al. Screening for hereditary non-polyposis colorectal cancer: A study of 22 kindreds in The Netherlands. Am J Med. 1989;86:278–281.

392

293. Lindgren G, Liljegren A, Jaramillo E, et al. Adenoma prevalence and cancer risk in familial non-polyposis colorectal cancer. Gut. 2002;50:228–234. 294. Jarvinen HJ, Aarnio M, Mustonen H, et al. Controlled 15-year trial on screening for colorectal cancer in families with hereditary nonpolyposis colorectal cancer. Gastroenterology. 2000;118: 829–834. 295. Rijcken FE, Hollema H, Kleibeuker JH. Proximal adenomas in hereditary non-polyposis colorectal cancer are prone to rapid malignant transformation. Gut. 2002;50:382–386. 296. Iino H, Simms L, Young J, et al. DNA microsatellite instability and mismatch repair protein loss in adenomas presenting in hereditary non-polyposis colorectal cancer. Gut. 2000;47: 37–42. 297. Bettstetter M, Dechant S, Ruemmele P, et al. Distinction of hereditary nonpolyposis colorectal cancer and sporadic microsatellite-unstable colorectal cancer through quantification of MLH1 methylation by real-time PCR. Clin Cancer Res. 2007;13:3221–3228. 298. Bessa X, Balleste B, Andreu M, et al. A prospective, multicenter, population-based study of BRAF mutational analysis for Lynch syndrome screening. Clin Gastroenterol Hepatol. 2008;6:206–214. 299. Vasen HF, Mecklin JP, Khan PM, et al. The International Collaborative Group on Hereditary Non-Polyposis Colorectal Cancer (ICG-HNPCC). Dis Colon Rectum. 1991;34:424–425. 300. Boland CR, Thibodeau SN, Hamilton SR, et al. A National Cancer Institute Workshop on Microsatellite Instability for cancer detection and familial predisposition: Development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res. 1998;58:5248–5257. 301. Syngal S, Fox EA, Eng C, et al. Sensitivity and specificity of clinical criteria for hereditary non-polyposis colorectal cancer associated mutations in MSH2 and MLH1. J Med Genet. 2000;37:641–645. 302. Umar A, Risinger JI, Hawk ET, et al. Testing guidelines for hereditary non-polyposis colorectal cancer. Nat Rev Cancer. 2004;4:153–158. 303. Lindor NM, Rabe K, Petersen GM, et al. Lower cancer incidence in Amsterdam-I criteria families without mismatch repair deficiency: Familial colorectal cancer type X. JAMA. 2005; 293:1979–1985. 304. Guillem JG, Wood WC, Moley JF, et al. ASCO/SSO review of current role of risk-reducing surgery in common hereditary cancer syndromes. J Clin Oncol. 2006;24:4642–4660. 305. Lindor NM, Petersen GM, Hadley DW, et al. Recommendations for the care of individuals with an inherited predisposition to Lynch syndrome: A systematic review. JAMA. 2006;296: 1507–1517. 306. Grady WM. Genetic testing for high-risk colon cancer patients. Gastroenterology. 2003;124:1574–1594. 307. Akiyama Y, Sato H, Yamada T, et al. Germ-line mutation of the hMSH6/GTBP gene in an atypical hereditary nonpolyposis colorectal cancer kindred. Cancer Res. 1997;57:3920–3923. 308. MSH2 and MLH1 mutations. http://www.insight-group.org/; Accessed September 2004. 309. Lipton L, Tomlinson I. The genetics of FAP and FAP-like syndromes. Fam Cancer. 2006;5:221–226. 310. Schulmann K, Pox C, Tannapfel A, et al. The patient with multiple intestinal polyps. Best Pract Res Clin Gastroenterol. 2007;21:409–426. 311. Bulow S, Berk T, Neale K. The history of familial adenomatous polyposis. Fam Cancer. 2006;5:213–220. 312. Bodmer WF, Bailey CJ, Bodmer J, et al. Localization of the gene for familial adenomatous polyposis on chromosome 5. Nature. 1987;328:614–616. 313. Kinzler KW, Nilbert MC, Su LK, et al. Identification of FAP locus genes from chromosome 5q21. Science. 1991;253:661–665. 314. Groden J, Thliveris A, Samowitz W, et al. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 1991;66:589–600. 315. Lynch HT, Boland CR, Rodriguez-Bigas MA, et al. Who should be sent for genetic testing in hereditary colorectal cancer syndromes? J Clin Oncol. 2007;25:3534–3542. 316. Galiatsatos P, Foulkes WD. Familial adenomatous polyposis. Am J Gastroenterol. 2006;101:385–398.

Chapter 19 317. Rustgi AK. The genetics of hereditary colon cancer. Genes Dev. 2007;21:2525–2538. 318. Lynch HT, Smyrk T, McGinn T, et al. Attenuated familial adenomatous polyposis (AFAP). A phenotypically and genotypically distinctive variant of FAP [see comments]. Cancer. 1995;76:2427–2433. 319. Hofgartner WT, Thorp M, Ramus MW, et al. Gastric adenocarcinoma associated with fundic gland polyps in a patient with attenuated familial adenomatous polyposis. Am J Gastroenterol. 1999;94:2275–2281. 320. Ahnen DJ, Axell L. Clinical Features and Diagnosis of Familial Adenomatous Polyposis. Waltham, MA; 2008. 321. Ahnen DJ. The genetic basis of colorectal cancer risk. Adv Intern Med. 1996;41:531–552. 322. Bonis PA, Ahnen DJ, Axell L. Screening Strategies in Patients and Families with Familial Colon Cancer Syndromes. Waltham, MA; 2008. 323. Polakis P. The many ways of Wnt in cancer. Curr Opin Genet Dev. 2007;17:45–51. 324. Aoki K, Taketo MM. Adenomatous polyposis coli (APC): A multi-functional tumor suppressor gene. J Cell Sci. 2007;120: 3327–3335. 325. Schneikert J, Behrens J. The canonical Wnt signalling pathway and its APC partner in colon cancer development. Gut. 2007;56:417–425. 326. Senda T, Iizuka-Kogo A, Onouchi T, et al. Adenomatous polyposis coli (APC) plays multiple roles in the intestinal and colorectal epithelia. Med Mol Morphol. 2007;40:68–81. 327. Abdel-Rahman WM, Peltomaki P. Molecular basis and diagnostics of hereditary colorectal cancers. Ann Med. 2004;36:379–388.


328. Segditsas S, Tomlinson I. Colorectal cancer and genetic alterations in the Wnt pathway. Oncogene. 2006;25:7531–7537. 329. Nieuwenhuis MH, Vasen HF. Correlations between mutation site in APC and phenotype of familial adenomatous polyposis (FAP): A review of the literature. Crit Rev Oncol Hematol. 2007;61:153–161. 330. Rozen P, Macrae F. Familial adenomatous polyposis: The practical applications of clinical and molecular screening. Fam Cancer. 2006;5:227–235. 331. Hegde MR, Roa BB. Detecting mutations in the APC gene in familial adenomatous polyposis (FAP). Curr Protoc Hum Genet. 2006; Chapter 10: Unit 10 18. 332. Spits C, De Rycke M, Van Ranst N, et al. Preimplantation genetic diagnosis for cancer predisposition syndromes. Prenat Diagn. 2007;27:447–456. 333. Michils G, Tejpar S, Thoelen R, et al. Large deletions of the APC gene in 15% of mutation-negative patients with classical polyposis (FAP): A Belgian study. Hum Mutat. 2005;25:125–134. 334. Hes FJ, Nielsen M, Bik EC, et al. Somatic APC mosaicism: An underestimated cause of polyposis coli. Gut. 2008;57:71–76. 335. Romero-Gimenez J, Dopeso H, Blanco I, et al. Germline hypermethylation of the APC promoter is not a frequent cause of familial adenomatous polyposis in APC/MUTYH mutation negative families. Int J Cancer. 2008;122:1422–1425. 336. Renkonen ET, Nieminen P, Abdel-Rahman WM, et al. Adenomatous polyposis families that screen APC mutation-negative by conventional methods are genetically heterogeneous. J Clin Oncol. 2005;23:5651–5659.

393


C h a p t e r

20 Molecular Basis of Liver Disease Satdarshan P. Singh Monga

T his book chapter is dedicated to Dr. Pramod Behari, a pioneering neurosurgeon and wonderful

father and to Dr. Gurdarshan Singh Monga, a loving father and a deeply caring and highly respected family physician.

INTRODUCTION Liver diseases are a cause of global morbidity and mortality. While the predominance of a specific liver disease varies with geographical location, the breadth of hepatic diseases affecting the underdeveloped, developing, and developed countries is phenomenal, with diseases ranging from infectious diseases of the liver to neoplasia and obesity-related illnesses. This chapter will apprise readers of the progress made toward unraveling the molecular aberrations of several liver diseases that has led to a better understanding of the disease biology with the hope of eventually yielding improved diagnostic, prognostic, and therapeutic tools. Just as in other tissues and organs, identification of molecular basis of normal liver growth and development has been important in identification of aberrations in the pathological states of the liver. We will provide a concise background on the molecular mechanism of liver development and regeneration and briefly summarize additional aspects of hepatic biology. Next, we will discuss the molecular basis of hepatic pathologies with emphasis on alcoholic liver disease, nonalcoholic fatty liver disease, and the benign and malignant tumors of the liver.

MOLECULAR BASIS OF LIVER DEVELOPMENT Embryonic liver development is characterized by very timely and precise regulatory signals that enable hepatic competence of the foregut endoderm, hepatic specification, and induction followed by hepatic morphogenesis. Clearly, the preceding events are governed by molecular Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

Jaideep Behari

signals that are highly temporal, cell specific, and tightly regulated (Figure 20.1). Liver in mouse begins to arise from the definitive gut endoderm at the embryonic day 8.5 (E8.5) or the 7–8 somite stage [1,2]. At this time the Foxa family of transcription factors specifies the endoderm to express hepatic genes in the process of hepatic competence [2,3]. Next, fibroblast growth factor 1 (FGF1) and FGF2, which originate from the cardiac mesoderm, initiate the expression of liver-specific genes in the endoderm [4]. FGF8, which is important for the morphogenetic outgrowth of the liver, is also expressed during this stage [4]. The hepatic bud next migrates into the septum transversum mesenchyme under the direction of bone morphogenic protein 4 (BMP4) signaling, which is essential for hepatogenesis [5]. One should be reminded that the earliest indicators of successful liver induction are the observed thickening of the hepatic bud endoderm along with albumin mRNA expression by E9.0 in the mouse [6]. This stage is followed by the phase of embryonic liver growth characterized by the expansion and proliferation of the resident cells within the hepatic bud. Several transcription factors including Hex, Gata6, and Prox1 are the earliest known mediators of this phase (Figure 20.1) [7–10]. Once the hepatic program is in full swing, the liver growth continues and is now labeled as the stage of hepatic morphogenesis. The epithelial cells at this stage are now considered the hepatoblasts, or the bipotential progenitors, which means that they are capable of giving rise to both major lineages of the liver, the hepatocytes, and the biliary epithelial cells [11]. Hepatoblasts will be undergoing expansion while maintaining their dedifferentiated state during this stage. While distinct from the traditionally known stem cell renewal, this event marks the expansion of a lineage-restricted progenitor population. Several key players at this stage include the HGF/ c-Met, b-catenin, TGFb, embryonic liver fodrin (Elf), FGF8, FGF10, Foxm1b, and Hlx, which are regulating the proliferation and survival of resident cells as well as regulating their survival [12–23]. Additional factors at 395

Part IV


Figure 20.1 Summary of molecular signaling during liver development in mouse. Abbreviations: FGF—Fibroblast growth factor; BMP—Bone morphogenic protein; AFP—a-fetoprotein; Alb—Albumin; HGF—Hepatocyte growth factor; HNF—Hepatocyte nuclear factor; C/EBPa—CCAAT enhancer binding protein-alpha.

this stage have also been identified although the mechanisms are less clear. These include components of NFkB, c-jun, XBP1, K-ras, and others [24–28]. At this time the general architecture of the liver is beginning to be established, including the formation of sinusoids and the development of hepatic vasculature [2,29]. The final stage is characterized by the differentiation of hepatoblasts to mature functional cell types: the hepatocytes and the biliary epithelial cells. For maturation into the hepatocytes, a huge change in cell morphology is observed from earlier stages to E17, when the resident epithelial cells acquire a cuboidal morphology with definitive cell polarity and clear cytoplasm after losing their blast characteristics such as the high nuclear to cytoplasmic ratio (Figure 20.2). At the center of the hepatoblast to hepatocyte differentiation process are

A

B

the liver-enriched transcription factors such as hepatocyte nuclear factor (HNF4a) transcription factors and CCAAT enhancing binding protein-a (C/EBPa) [30,31]. HNF4a is essential for differentiation toward a hepatocyte phenotype, as well as formation of the parenchyma [32]. The liver-enriched transcription factors enable functioning of the fetal hepatocytes by directing the expression of various genes that are classically associated with hepatocyte functions at this stage, including the cytochrome P450s, metabolic, and synthetic enzymes [33]. The hepatocytes at this stage clearly show glycogen accumulation and have been shown to exhibit many functions of adult hepatocyte including xenobiotic metabolism. Again several signaling pathways have been shown to play a role in regulating hepatocyte maturation by regulating the expression of liver-enriched

C

Figure 20.2 H&E of developing mouse livers. (A) Several hematopoietic cells (arrow) are seen interspersed among hepatoblasts (arrowhead), which display large nuclei and scanty cytoplasm, in an E14 liver section. (B) Fewer hematopoietic cells (arrow) are observed among the hepatocytes (arrowhead) which begin to show cuboidal morphology and large clear cytoplasm as well as begin to display polarity, in an E17 liver section. (C) Similar cuboidal morphology of hepatocytes (arrowhead) is seen in an E19 mouse liver. 396

Chapter 20

transcription factors. Some of these pathways include HGF, EGF, FGFs, Wnt/b-catenin signaling, and others. While the signals involved in lineage commitment of hepatoblasts to biliary epithelium are not fully understood, there is evidence of the involvement of HNF6 (One-cut-1; OC-1), HNF1b, OC-2, TGFb, and activin [34–36]. HNF6 promotes hepatocyte over biliary development by activating HNF1b, which in turn attenuates early biliary cell commitment. It has been shown that HNF6 and OC-2 double knockouts display cells with both biliary and hepatocyte programs activated, suggesting their role in segregating the two lineages [34]. They do so by regulating TGFb/activin signaling gradient in developing livers by controlling expression of TGFb, TGFb receptor type II (TBRII), activin B, a2-macroglobulin (TGFb-antagonist), and follistatin (activin antagonist). At E12.5, TGFb activity is high in vicinity of portal vein, where hepatoblasts differentiate into biliary cells. While lineage specification begins at E12.5, bile duct differentiation becomes apparent at E15.5, where biliary cells are organized around branches of portal veins and express cytokeratins, show basal lamina (lamininpositive) toward the portal side of the ductal plate, and lack HNF4a. HNF6 is required for bile duct morphogenesis at this stage. Notch signaling pathway is also known to play a role in the development of biliary epithelia [35–37]. Various results support the fact that Jagged/ Notch interactions may activate a cascade of events involving HNF6, HNF1b, and Pkhd1 gene encoding the ciliary protein polyductin or fibrocystin. Additional roles of Foxm1b and Wnt/b-catenin signaling have also been reported in biliary differentiation, although the mechanism is less clear. This somewhat simplistic outline of embryonic liver development does not take into account the complexity involved in the expression of these growth and transcription factors. Liver development is clearly not a linear process. Rather, there is a significant overlap between gene expression patterns that blur the lines between one stage of liver development and the next. Additionally, activation of one gene may initiate a feedback mechanism that regulates cross-talk between different cell populations. For example, the HNFs are capable of autoregulating their own expression as well as cross-regulating the transcription of other liver-specific genes [11]. Finally, timing remains critical since certain pathways can act at different stages to inhibit or stimulate certain stages or processes of the hepatic development. A classic example is the Wnt/ b-catenin pathway, which needs to be initially repressed to induce hepatic program in the foregut endoderm, but immediately following that stage, it becomes indispensable [15,16,20,38,39]. Also, the same pathway plays a role in hepatoblast expansion and survival, but a later stage is indispensable for its maturation into hepatocyte, at the same time playing an early role in biliary differentiation [23,40]. The significance of understanding the molecular basis of hepatic development is really 2-fold. First, this would be critical for the fields of hepatic tissue engineering, stem cell differentiation, and hepatic regenerative medicine. This is highly pertinent as efforts in multiple laboratories across the world are ongoing to identify alternate

Molecular Basis of Liver Disease

sources of hepatocytes due to scarcity of organs for orthotopic liver transplantation. For successful, persistent, and reproducible derivation of functioning hepatocytes from sources such as ES cells, mesenchymal stem cells, hematopoietic stem cells, or stem cells derived from skin, adipose tissue, and placenta, it will be critical to identify precise signaling pathways that need to be temporally turned on or off. This mandates a careful study of relevant events as liver development where a perfect and precise control of various signaling molecules results in successful liver formation. Second, many of the molecular signaling pathways that are associated with normal liver development have also been shown to play key roles in hepatocarcinogenesis. Thus, studying regulation of liver development might disclose physiological ways to tame the oncogenic pathways through identification of novel cross-talks and negative regulators of such pathways.

MOLECULAR BASIS OF LIVER REGENERATION Liver is a unique organ with an innate ability to regenerate, and rightfully so, since it is the gatekeeper to a variety of absorbed materials (both nutrients and toxins) through the intestines [41]. Thus, with an overwhelming ongoing assault on a daily basis, liver must regenerate as and when necessary in order to continue its functions of synthesis, detoxification, and metabolism. This capacity of regeneration is ascertained by activation of multiple signaling pathways as evidenced in many animal models and studies where surgical loss of liver mass triggers the process of regeneration [42]. This ensures proliferation and expansion of all cell types of the liver to enable restoration of lost hepatic mass. It is imperative to identify the various pathways that form the basis of initiation, continuation, and termination of the regeneration process to understand the dysregulation that is often seen in aberrant growth in benign and malignant liver tumors. Additionally, examining the process of liver regeneration for changes in various cytokines and growth factors would allow us to identify novel regulatory loops among several of these pathways, providing novel antitumor therapeutic opportunities to suppress certain oncogenic proteins or booster inhibitory factors. Simultaneously, understanding such a complex mechanism would be critical for regenerative medicine, stem cell transdifferentiation, hepatic tissue engineering, and cell-based therapies. The list of factors independently shown to play important roles in hepatocyte proliferation during regeneration is exhaustive and will be discussed concisely henceforth [43–46]. Partial hepatectomy triggers a sequence of events that proceed in an orderly fashion to restore the lost mass within 7 days in rats, 14 days in mice, and 8–15 days in humans [41]. Following these periods, the liver lobules become larger, and the thickness of hepatocyte plates is doubled as compared to the prehepatectomy livers. However, over several weeks there is gradual lobular and cellular reorganization, leading to an unremarkable and undistinguishable liver histology from a normal liver [47]. Immediately following the hepatectomy, when twothirds of the hepatic mass is resected, there is a dramatic 397

Part IV


change in the hemodynamics of the liver, especially since the same volume of portal blood would need to traverse through only one-third of the original tissue mass. Additionally, hypoxic state might be playing a role since portal blood has lower pO2 when compared to the arterial blood flow that remains relatively unaltered during regeneration. While very few studies conclusively address a role of these changes in initiation of regeneration, there are reports of the impact of such changes on activation of HGF, a major initiator of regeneration, as is discussed in the forthcoming paragraphs [48]. Within minutes, there are specific changes in the gene expression as well as at post-translational levels, which complement each other and lead to a well-orchestrated event of regeneration, during which time the hepatocyte functions are maintained for the functioning of the animal. More than 95% of hepatocytes will undergo cell proliferation during the process of regeneration [41]. The earliest known signals involve both the growth factors and cytokines. While it is difficult to lay out the exact chronology of events, it is important to say that many events are concomitant, ensuring proliferation and maintaining liver functions at the same time. The earliest events observed include activation of uPA enabling activation of plasminogen to plasmin, which induces matrix remodeling that leads to, among other events, activation of HGF from the bound hepatic matrix [49,50]. HGF is a known hepatocyte mitogen that acts through its receptor c-Met, a tyrosine kinase and is a master effector of hepatocyte proliferation and survival both in vitro and in vivo [51]. Similarly EGF, which is continually present in the portal circulation, is also assisting in hepatocyte proliferation [52]. Other factors activated at this time include the Wnt/b-catenin pathway [53–56], Notch/Jagged pathway [57,58], norepinephrine [59], serotonin [60], and TGFa [61,62]. These factors are working in autocrine and paracrine fashion, and cell sources of various factors include the hepatocytes, Kupffer cells, stellate cells, and sinusoidal endothelial cells. Concurrently, the TNFa [63–65] and IL-6 [66,67] are being released from the Kupffer cells and have been shown to be important in normal liver regeneration through genetic studies. These pathways are known to act through NFkB and Stat3 activation. Bile acids have also been shown to play a vital role in normal liver regeneration through activation of transcription factors such as FoxM1b [68] and cmyc, necessary for cell cycle transition as well, and decreased hepatocyte proliferation after partial hepatectomy was observed in animals depleted for bile acids with the use of cholestyramine or in the FXR-null mice [69]. The eventual goal of these changes is to initiate cell cycle in hepatocytes with a successful G1 to S phase transition dependent on the key cyclins such as A, D, and E to ensure DNA synthesis and mitosis [41,44]. Additional growth factors such as FGF, PDGF, and insulin are important in regeneration and might be playing an important role in providing homeostatic support to the regenerating liver (reviewed in [41]). During the process of regeneration, active matrix remodeling is ongoing as well. Regulation of this process is complex and involves key molecules such as metalloproteinases, TIMPs, and others [70–73]. Additionally, 398

the matrix is a source of matrix-bound growth factors such as HGF, additional glycosylated proteins, hyaluronic acid, decorin, syndecan, and others, which modulate the activity of many mitogenic (HGF, TNFa, EGF) and mitoinhibitory (TGFb) factors. Thus, active matrix remodeling might be both a cause and an effect of regenerative response after hepatectomy and is again critical for optimal regeneration as demonstrated by genetic models such as MMP9-deficient mice [73]. In liver regeneration, while the hepatocytes are the main cell type undergoing proliferation, division of all cells native to the liver is observed at specific times after partial hepatectomy. The peak hepatocyte proliferation in rats is observed at 24 hours after hepatectomy followed by a peak proliferation of the biliary epithelial cells at 48 hours, Kupffer and stellate cells at 72 hours, and sinusoidal endothelial cells at 96 hours [45]. Several growth factors have been shown to be mitogenic for these cell types and work in an autocrine as well as paracrine manner, since several of these factors are produced by one or more cells within the regenerating liver. Factors such as HGF, PDGF, VEGF, FGFs, and angiopoietins are important for Kupffer cells and endothelial cell proliferation and homeostasis during regeneration (reviewed in [41]). Neurotrophins and nerve growth factors have been shown to be important in regeneration and survival of stellate cells during regeneration [74,75]. How does the liver know when to stop? This is complex and incompletely understood. While the liver mass is restored after 14 days in mice and 7 days in rats, it may exceed its original mass, when transient apoptosis occurs and the overall liver mass matches the prehepatectomy liver mass [67]. Based on the mitoinhibitory action of TGFb on the hepatocytes, it has been suggested to be the terminator of regeneration. However, changes in TGFb (produced by stellate cells) expression mimics that of many proproliferation factors during regeneration and begins at 2–3 hours after hepatectomy in rats and remains elevated until 72 hours [76]. However, the receptors for TGFb are downregulated during regeneration, and hence the hepatocytes are resistant to excess TGFb presence [77,78]. In addition, during regeneration, TGFb protein is lost first periportally and then gradually toward the central vein [79]. Just behind the leading edge of loss of TGFb is the wave of hepatocyte mitosis, suggesting that somehow TGFb is balancing the act of quiescence and proliferation even during regeneration to perhaps keep the growth regulated and to maintain a certain number of hepatocytes in a nonproliferative and differentiated state, to continue their functions necessary for the animal’s survival. However, whether TGFb is the final cytokine that enables termination of the regenerative process has not been shown convincingly and still remains an open-ended question. As can be appreciated, multiple cytokines and growth factors are activated in response to partial-hepatectomy where two-thirds of the liver is surgically resected [80]. No single signal transduction pathway’s suppression has led to the complete abolition of liver regeneration after partial hepatectomy in rodents. Genetic ablation or other modality-mediated suppression of certain growth factors

Chapter 20

such as EGFR, TGFa, Jagged/Notch, Wnt/b-catenin and of cytokines such as TNFa, IL-6, and of additional modulators such as bile acids, norepinephrine, serotonin, and components of hepatic biomatrix, components of the complement, all show a modest to severe decrease in liver regeneration, but not a complete loss. Interference with the HGF/Met signaling pathway appears to cause the most profound but not complete interference with the regenerative process. Liver regeneration is guided by a significant signaling redundancy, which is paramount to inducing the much-needed cell proliferation within the regenerating liver. In addition, when all else fails, additional cell types such as the oval cells can be called upon to restore hepatocytes [43]. These cells are the facultative hepatic progenitors or transient amplifying progenitor cells that originate from the biliary compartment and appear in the periportal areas when the hepatocytes are unable to proliferate [81–84]. These cells become hepatocytes and rescue the regenerative process. Recent studies have also shown that hepatocytes can transdifferentiate into biliary cells and rescue biliary repair when cholangiocytes are unable to carry it out by themselves [85,86]. Overall, the redundancy in liver regenerative processes, at the level of signaling and at the level of cells, ensures the health of this indispensable Promethean organ.

ADULT LIVER STEM CELLS IN LIVER HEALTH AND DISEASE Despite the liver’s capacity to regenerate and the presence of redundant signaling enabling regeneration on most occasions, there is sometimes a need for stem cell activation in the liver [80]. This term is often used to depict appearance and expansion of the hepatic progenitors in the liver. The basal presence of these facultative stem cells or oval cells or transiently amplifying hepatic progenitors in a normal liver remains debated [41,43,87]. Under certain circumstances in rodents, there is a clear activation of oval cells. This occurs when an injury to the hepatocytes and/or bile ducts in rodents coexists with the presence of an inhibitor of hepatocyte proliferation. This creates a necessity for the regeneration of the injured cells at the same time blocking the proliferation of hepatocytes, allowing for the appearance of the facultative stem cells that stem from the terminal biliary ductular cells in the canal of Herring. These oval cells proliferate and expand and have been shown to be the precursors of both hepatocytes and biliary epithelial cells, based on the type of cell injury [43,88,89]. Based on the ability of hepatocytes and biliary epithelial cells to transdifferentiate into each other, it is quite possible that the oval cells can arise from not just the bile duct cells, but also certain subset of hepatocytes [41,85,86]. Classically, the activation of adult stem cells is observed as atypical ductular proliferation, which can go on to differentiate into polygonal or intermediate hepatocytes and finally mature into hepatocytes. The oval cell response is typically dictated by the kind of injury (biliary versus hepatocytic versus mixed), which in turn determines the proportion of ductular response to intermediate hepatocytes observed [89].


In rodents, various models have been optimized to induce activation of stem cells. The basic premise behind these models is the presence of an injury to the hepatocytes after disabling the proliferative capacity of the hepatocytes. This is classically attained in rats by acetylaminofluorene (AAF), which crosslinks DNA in hepatocytes, followed by two-thirds partial hepatectomy, and leads to appearance of oval cells (Figure 20.3) [90,91]. In mice, the models are more complicated since AAF does not work well. Alternatives used are the administration of diet containing 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) or the choline-deficient, ethionine-supplemented (CDE) diet [84,92]. However, DDC primarily causes a biliary injury that also leads to periportal hepatocyte injury, and this model has been recently characterized as a mouse model of PBC and PSC [93]. Hence, the phenotype observed is a typical and predominant biliary reaction or atypical ductular proliferation (Figure 20.3). While polygonal intermediate hepatocytes are a minor subset observed in this model, it is unclear whether this is differentiation of atypical ductules toward hepatocytes or dedifferentiation of hepatocytes toward biliary cells, since the injury is predominantly biliary. CDE diet has been used successfully in rats and mice to induce oval cell activation [92,94]. It should also be emphasized that remarkable heterogeneity was identified between the oval cells observed in response to specific protocols and at least partly could be explained by the differences in the kind of injury that directs oval cell activation towards hepatocyte or biliary differentiation, for the maintenance of liver function, while on these protocols [95]. Various markers have been applied to detect these oval cells. By histology, these cells are smaller than the hepatocytes and possess high nuclear to cytoplasmic ratio and typically are seen in the periportal region. These cells are concomitantly positive for biliary (CK19, CK7, A6, OV6), hepatocyte (HepPar-1, albumin), and fetal hepatocyte markers (a-fetoprotein) (reviewed in [89]). However, at any given time, only a subset of these cells are positive for all markers. This reflects the different stages of differentiation occupied by the cells or the basic heterogeneity of these cell populations. Reactive ducts are also positive for neural cell adhesion molecules (NCAM) or vascular cell adhesion molecules (VCAM) [93,96,97]. Additional surface markers for the oval cells have been identified in rodent studies, which gives an advantage of cell sorting [98]. The six unique markers include CD133, claudin-7, cadherin 22, mucin-1, Ros1 (oncogene v-ros), and g-aminobutyrate, type A receptor p (Gabrp). Using these models, several pathways have been shown to play an important role in the appearance, expansion, and differentiation of stem cells. As can be appreciated, several pathways known to play important roles in liver development and regeneration are also known to be important in oval cell activation and their differentiation. These factors include HGF/ c-met, interleukin-6, TGFa, TGFb, EGF, Wnt/b-catenin pathway, PPARs, IGF, and others [99–110]. These signaling pathways function in an autocrine or paracrine manner to induce oval cell activation. 399

Part IV


A

B

Figure 20.3 H&E demonstrating the activation of oval cells or facultative adult liver stem cells in experimental models. (A) Several oval cells with oval shape, smaller size, and higher cytoplasmic to nuclear ratio (arrows) are observed around the portal triad (PT) in rat livers after AAF/PHx. Several intermediate hepatocytes (arrowheads) are evident as these oval cells undergo progressive differentiation. (*) shows normal hepatocytes adjoining the ongoing oval cell activation, expansion, and differentiation. (B) Mouse liver after DDC administration for 2 weeks displays atypical ductular hyperplasia (arrows) equivalent of oval cell activation and adjoining normal hepatocytes (*).

Progenitor cell activation has been seen in patients after various forms of hepatic injury. This is an attempt by the diseased liver to restore the lost cell type in order to maintain hepatic functions. An acute ductular reaction is observed in the setting of submassive necrosis due to hepatitis, drugs, alcohol, or cholestatic disease, which is subtle during the early stages. These cells expand in numbers and show hepatocytic differentiation with passage of time as revealed by limited studies from serial liver biopsies from these patients [97,111]. In some instances, bone marrow-derived stem cells have been observed in these livers, albeit at an extremely low frequency. This has been shown to be due to fusion of a bone marrow-derived stem cell to a hepatocyte, although transdifferentiation of bone marrow-derived stem cells into hepatocytes has not been completely ruled out [112–115]. Noteworthy hepatic progenitor activation has been observed in alcoholic and nonalcoholic fatty liver disease (ALD and NAFLD) patients as well. These scenarios are associated with increased lipid peroxidation, generation of reactive oxygen species, and additional features of elevated oxidative stress, which is a known inhibitor of hepatocyte proliferation [116,117]. The inability of hepatocytes to proliferate in these clinical scenarios might be an impetus for the oval cell activation, especially since high numbers of polygonal and intermediate hepatocytes are observed in both ALD and NAFLD. A positive correlation between the oval cell response and the stage of hepatic fibrosis and the fatty liver disease has been identified [116]. In viral hepatitis also, oval cell activation is observed. This is classically seen at the periportal site and is usually proportional to the extent of inflammatory infiltrate. Moderate to severe inflammation is often associated with higher oval cell response that is composed of intermediate hepatocytes [118]. Based on these findings, a paracrine mechanism of oval cell activation triggered by the inflammatory cells has been proposed. These scenarios also bring into 400

perspective the progenitor or oval cell origin of a subset of hepatocellular cancers (HCC). HCC occurs more frequently in the backgrounds of cirrhosis observed in ALD, NAFLD, and hepatitis than nondiseased liver [119,120]. There are established advantages of stem cells being a target of transformation [121,122]. It is feasible that the oval cell activation in the pathologies as discussed previously, while providing a distinct advantage of maintenance of hepatic function, might also serve as a basis of neoplastic transformation in the right microenvironmental milieu. This Jekyll and Hyde hypothesis is supported by the observation that several early HCC lesions possess hepatic progenitor signatures at genetic and protein levels [123]. However, conclusive studies to this end are still missing.

MOLECULAR BASIS OF HEPATOCYTE DEATH Hepatocyte death is a common hallmark of much hepatic pathology. This is often seen as diffuse or zonal hepatocyte death and dropout. In many cases the hepatocyte death occurs due to death receptor activation, which leads to hepatocyte apoptosis and ensuing liver injury. These mechanisms of liver injury have been identified in hepatitis, inflammatory hepatitis, alcoholic liver disease, ischemia reperfusion injury, and cholestatic liver disease. Hepatocytes express the typical death receptors that belong to the TNFa receptor superfamily. These include (i) Fas also called Apo 1/CD95 or Tnf receptor superfamily6 (Tnfrsf6), (ii) TNF-receptor 1 (TNF-R1) also called CD120a or Tnfrsf10a, and (iii) TRAIL-R1 or Tnfrsf10A and TRAIL-R2 or Tnfrsf10B. The ligands for these receptors are the Fas ligand (FasL) also called CD178 or Tnfsf6, TNFa or Tnfsf2, and TRAIL or Apo 2L or Tnfsf10, respectively (reviewed in [124]). While the

Chapter 20

former two subgroups of death receptors and their ligands are known to be associated with the aforementioned liver diseases, TRAIL/TRAIL-R have not yet been identified as a mechanism of hepatic injury pertinent to a liver disease.

Fas-Activation Induced Liver Injury This mode of death is known to be associated with liver diseases such as viral hepatitis, inflammatory hepatitis, Wilson’s disease, cholestasis, and alcoholic liver disease. FasL, present on inflammatory cells or Fas-activating agonistic antibodies such as Jo-2 injection (in experimental models), leads to Fas activation resulting in massive hemorrhagic liver injury with extensive hepatocyte apoptosis and necrosis (Figure 20.4) [125]. Most mice die within 4–6 hrs after Jo-2 injection. Upon activation, homotrimeric association of Fas receptors occurs, which recruits Fas-associated death domain protein (FADD) adapter molecule, and initiator caspase-8 [126]. This complex, or the death-inducing signaling complex (DISC), requires mitochondrial involvement and cytochrome c release, which is inhibited by antideath Bcl-2family proteins (Bcl-2 and Bcl-xL) [127–129]. Cytochrome c stimulates the activation of caspase-9 and then caspase-3, inducing cell death. Interestingly, pro-death


Bcl-2 family proteins Bid, Bax, and Bak are also needed for hepatocyte death induced by Fas [130–132]. In fact, Bid is cleaved by caspase-8 after Fas activation, and cleaved Bid translocates to mitochondria. This in turn activates Bax or Bak on the mitochondria to stimulate the release of apoptotic factors such as cytochrome c. At the same time Bid also induces mitochondrial release of Smac/DIABLO, which inactivates the inhibitors of apoptosis (IAP). The role of IAPs is at the level of caspase-3 activation, which occurs in two steps. The first step is caspase-8-induced severance of larger subunit of caspase-3. The second step is the removal of the prodomain by its autocatalytic activity, which is essential for caspase-3 activation and inhibited by IAPs [133]. While caspase-8 can directly activate caspase-3, bypassing the mitochondrial involvement, the execution of the entire pathway ensures the process of death in the hepatocytes [134]. Thus, overall it has been suggested that relative expression and activity levels of caspase-8, Bid, and other modulators of this pathway, such as inhibitors of apoptosis (IAPs) and Smac/DIABLO, would finally determine whether Fas-induced hepatocyte apoptosis will or will not utilize mitochondria to induce cell death. A recent discovery unveils another important regulatory step in the Fas-mediated cell death [135]. Under normal circumstances, Fas receptor was shown to be

A

B

C

D

Figure 20.4 H&E and TUNEL immunohistochemistry exhibiting apoptotic cell death after Fas- and TNFa-mediated liver injury. (A) H&E shows massive cell death 6 hours after Jo-2 antibody administration. (B) Several TUNEL-positive apoptotic nuclei (arrowheads) are evident in the same liver. (C) H&E shows massive cell death 7 hours after D-Galactosamine/LPS administration in mice. (D) Several TUNEL-positive apoptotic nuclei (arrowhead) are evident in the same liver. 401

Part IV


sequestered with c-Met, the HGF receptor, in hepatocytes. This makes Fas receptor unavailable to the Fas-ligand. Upon HGF stimulation, this complex was destabilized and hepatocytes became more sensitive to Fas-agonistic antibody. On the contrary, transgenic mice overexpressing extracellular domain of c-Met stably sequestered Fas receptor and hence were resistant to anti-Fas-induced liver injury. Recently, lack of this Fas antagonism by Met was identified in fatty liver disease [136]. While this explains how HGF could be pro-death at high doses or in combination with other death signals, a paradoxical effect of HGF on promoting cell survival is also observed, albeit at lower doses. This effect is usually also observed with other growthpromoting factors such as TGFa and are mediated by elevated expression of Bcl-xL that inhibits mitochondrial release of cytochrome c and inhibits Bid-induced release of Smac/DIABLO [137,138].

TNFa-Induced Liver Injury This mode of hepatocyte death is commonly observed in ischemia-perfusion liver injury and alcoholic liver disease. In mice, TNFa is induced by bacterial toxin administration such as lipopolysaccharide (25–50 mg/kg LPS) [139]. Since it was identified that LPS alone initiates NFkB-mediated protective mechanisms, an inhibitor of transcription (D-Galactosamine) or translation (Cycloheximide) is used before the LPS injection, for successful execution of cell death [140]. This induced massive hepatocyte death due to apoptosis, as seen by TUNEL immunohistochemistry (Figure 20.4). TNFa binds to the TNFa-R1 on hepatocytes to induce receptor trimerization and DISC formation. DISC is composed of TNFa-R1 and TNFR-associated death domain (TRADD), which can recruit FADD and caspase-8 via an unknown mechanism, to further activate caspase-3 [141,142]. The significance of additional mechanisms is relatively unknown in liver biology (reviewed in [124]). However, one additional mechanism that deserves mention and is relevant to liver injury is that TNFa-R1 engagement also induces Cathepsin B release from lysozyme, which induces cytochrome c release from mitochondria [143]. However, how much effect of TNFa on apoptosis is mediated via the mitochondrial pathway components including Bcl-2, Bcl-xL, and Bid in TNFa-mediate apoptosis remains debated, but it is believed that some effects are via this intrinsic pathway. One of the important effects of TNFa stimulation is the unique and concomitant activation of the NF-kB pathway as a protective mechanism. How this occurs is not fully understood, but is relevant as an ongoing protective mode for maintaining hepatic homeostasis. The TNFa-R1 engagement leads to the recruitment of TRADD, which can further induce recruitment of TNF Associated Factor 2 (TRAF2) and Receptor interacting protein (RIP) [144]. This can further recruit and activate IKK complex containing I-kB kinase 1 (IKKa) and IKKb that lead to the phosphorylation of I-kB and its degradation. This allows for the release and activation of NF-kB p50 and p65 dimers, inducing 402

the phosphorylation of p65, and their nuclear translocation to direct transcriptional activation of cytoprotective genes such as IAP [145,146], iNOS [147], Bcl-xL [148], and others. In addition, it is important to mention that several additional regulators of NFkB exist and also regulate its transcriptional activity. These include glycogen synthase kinase-3 (GSK3) [149] and TRAF2-associated kinase (T2K) [150]. GSK3-knockout embryos die at around E13–E15 stage as a result of massive liver cell death due to TNFa toxicity [27,149,151].

MOLECULAR BASIS OF NONALCOHOLIC FATTY LIVER DISEASE Accumulation of triglycerides in the liver in the absence of significant alcohol intake is called nonalcoholic fatty liver disease (NAFLD) [152]. The term NAFLD encompasses a spectrum of liver disease ranging from simple steatosis to steatosis with inflammation called nonalcoholic steatohepatitis (NASH). The latter condition can progress to fibrosis, cirrhosis, and hepatocellular cancer. While NAFLD has been associated with many drugs, genetic defects in metabolism, and abnormalities in nutritional states, it is most commonly associated with the metabolic syndrome [153]. The metabolic syndrome is a group of related clinical features linked to visceral obesity, including insulin resistance (IR), dyslipidemia, and hypertension [154]. NAFLD is strongly associated with and considered the hepatic manifestation of the metabolic syndrome. The prevalence of the metabolic syndrome, and therefore also of NAFLD, has been increasing in parallel with the obesity and diabetes epidemic, and NAFLD is now the most common cause of abnormal liver enzyme elevation in the United States [155]. While simple steatosis has a benign course, NASH represents the progressive form of the disease. NASH is characterized by necroinflammatory activity, hepatocellular injury, and progressive fibrosis. The pathogenesis of NAFLD/NASH is incompletely understood, although significant strides have been made in recent years to unravel its underlying molecular processes (Figure 20.5). A two-hit hypothesis has been proposed to explain the pathogenesis of NAFLD and the progression of simple steatosis to NASH that occurs in a subset of patients with steatotic livers [156]. The first hit consists of triglyceride deposition in hepatocytes. A second hit consisting of another cellular event then leads to inflammation and hepatocyte injury and the subsequent manifestations of the disease.

Factors Leading to the Development of Hepatic Steatosis: The First Hit The accumulation of triglycerides in the liver is the essential characteristic of NAFLD/NASH and can be observed in patients as well as experimental models (Figure 20.6). It results from aberration in metabolic processes in the liver, as well as extrahepatic tissue

Chapter 20


Figure 20.5 Molecular basis of nonalcoholic steatohepatitis. Insulin resistance results in decreased insulin-induced inhibition of hormone-sensitive lipase (HSL) activity in adipocytes resulting in high rates of lipolysis and increased plasma free fatty acid (FFA) levels. High plasma FFA levels increase FFA flux to the liver. In myocytes, insulin resistance results in decreased glucose uptake and high plasma glucose and insulin levels. In the liver, hyperinsulinemia activates SREBP-1c, leading to increased transcription of lipogenic genes. High plasma glucose levels simultaneously activate ChREBP, which activates glycolysis and lipogenic genes. SREBP-1c and ChREBP ct synergistically to convert excess glucose to fatty acids. Increased FFA flux and increased lipogenesis increases the total hepatic FFA pool. The increased hepatic FFA pool can either be converted to triglycerides for storage or transport out of the liver as very low density lipoprotein, or undergo oxidation in mitochondria, peroxisomes, or endoplasmic reticulum. Increased reactive oxygen species generated during fatty acid oxidation causes lipid peroxidation, which subsequently increases oxidative stress, inflammation, and fibrosis.

A

B

Figure 20.6 Fatty liver disease along with hepatic fibrosis. (A) Patient with NAFLD shows significant macrovesicular (arrowhead) and microvesicular steatosis (blue arrowhead) in a representative H&E stain. (B) Masson trichrome staining of liver from mouse on methionine and choline-deficient diet for 4 weeks reveals hepatic fibrosis (arrow) along with macrovesicular steatosis (arrowheads).

such as skeletal muscle and adipose tissue that is mediated by insulin resistance (IR). Normally, insulin acts on the insulin receptor of myocytes to tyrosine phosphorylate insulin receptor substrate (IRS). IRS,

in turn, activates phosphatidyl inositol 3-kinase and protein kinase B, and results in translocation of the glucose transporter to the plasma membrane with resultant rapid uptake of glucose from the blood into 403

Part IV


the myocyte. The net effect is decreased blood glucose and therefore decreased insulin secretion from the pancreas [157]. In the setting of obesity, fat-laden myocytes become resistant to the signaling effects of insulin. This inability of skeletal muscle to take up glucose from the circulation on insulin stimulation leads to elevated blood glucose levels and increased insulin secretion from the pancreas, with metabolic consequences in the liver as described in the following text. Besides skeletal muscle, IR also causes increased blood glucose via decreased insulin action in the liver. Normally, the liver plays an important role in maintaining blood glucose levels regardless of the nutritional state. In the fasting state, gluconeogenesis in the liver results in hepatic glucose production that maintains blood glucose level. However, in the fed state when blood glucose levels are elevated, glucose is converted to pyruvate via glycolysis, which then enters the Krebs cycle to form citrate and ultimately acetyl-CoA, which is utilized for fatty acid biosynthesis. This process is normally activated by insulin, which is also a potent inhibitor of hepatic glucose production. However, in the setting of IR, insulin is unable to suppress hepatic glucose production, which, along with decreased myocyte glucose uptake, leads to high blood glucose levels and high circulating insulin levels [158,159]. The net effect of these changes is increased hepatic lipogenesis and triglyceride accumulation mediated by the synergistic action of two transcription factors: carbohydrate response element binding protein (ChREBP) and sterol regulatory element-binding protein-1c (SREBP-1c). There is evidence from both animal experiments and human studies to support the conclusion that there is increased hepatic fatty acid synthesis in the setting of IR [160,161]. ChREBP is a member of the basic helix-loop-helixleucine zipper (b-HLH-Zip) transcription factor that after activation by glucose translocates from the cytosol into the nucleus and binds to the E-box motif in the promoter of liver-type pyruvate kinase (L-PK), an important glycolytic enzyme [162,163]. L-PK catalyzes the formation of pyruvate, which enters the Krebs cycle and generates citrate and ultimately acetyl-CoA, which is then utilized for the de novo synthesis of fatty acids. Studies with ChREBP knockout mice also revealed that ChREBP also independently stimulates the transcription of fatty acid synthetic enzymes [162,164]. Therefore, in the setting of IR and hyperglycemia, ChREBP mediates the conversion of glucose to fatty acids by upregulating both glycolysis as well as lipogenesis. Besides glucose, insulin can also regulate de novo hepatic fatty acid synthesis via a second transcription factor, SREBP-1c, also a member of the b-HLH-Zip family of transcription factors [165]. There are three SREBP isoforms, but the SREBP-1c isoform is the major isoform in the liver that can activate expression of fatty acid biosynthetic genes and stimulate lipogenesis [166,167]. The important role of SREBP-1c in development of hepatic steatosis was established by the demonstration that transgenic mice overexpressing SREBP-1c have increased lipogenesis and develop fatty liver [168]. Furthermore, in the ob/ob mouse model of genetic obesity and insulin 404

resistance, disruption of the Srebp-1 gene caused a reduction in hepatic triglyceride accumulation [169]. Since SREBP-1c is activated by insulin, it would be expected to be inactive in the setting of IR. Surprisingly, the protein is activated by insulin even when there is IR, resulting in increased fatty acid biosynthesis in the liver [170]. A third process that favors hepatic steatosis results from IR in the adipose tissue. In the fat-laden adipocytes in obese individuals, IR causes defective insulinmediated inhibition of hormone-sensitive lipase and therefore increased lipolysis and increased free fatty acid (FFA) release into the circulation [171,172]. Increased FFA uptake into the liver from the circulation also favors the development of hepatic steatosis and inflammation. Interestingly, recent studies have shown that high FFA levels in the liver may contribute to lipotoxicity, and triglyceride accumulation in the liver might be a protective response [173]. When diacylglycerol acyltransferase 2, the final step in hepatocyte triglyceride biosynthesis, was inhibited by antisense oligonucleotides in a murine model of steatohepatitis, there was decrease in hepatic steatosis, but increased hepatic FFAs, and increase in makers of inflammation and hepatocyte injury and fibrosis. Besides SREBP-1c and ChREBP, a transcription factor belonging to the nuclear hormone receptor family, peroxisome-proliferator activated receptor-g (PPAR-g) may also contribute to hepatic steatosis. While normal hepatic expression of PPAR-g is low, increased expression of the transcription factor has been noted in animal models of steatosis [174,175]. Furthermore, in the ob/ob mouse model of insulin resistance, deletion of PPAR-g from the liver markedly decreases hepatic steatosis, suggesting an important role for PPAR-g in the development of NAFLD. Once hepatic steatosis is established, outcomes are variable. In some patients with NAFLD there is no further damage to the liver and prognosis in terms of liver-related mortality is good. However, in some patients there is hepatic necrosis, inflammation, hepatocyte apoptosis, and fibrosis. The reason some patients develop NASH is not understood, but several mechanisms have been postulated, as described in the next section.

Progression of Steatosis to NASH: The Second Hit Absence of noninvasive biomarkers to differentiate NASH from simple steatosis and lack of animal models that completely recapitulates the pathophysiology of human NASH have limited research into the processes that promote this condition. However, several important insights have been gained in recent years on the pathogenesis of NASH and include oxidative stress, lipid peroxidation, mitochondrial dysfunction, inflammatory cytokines and adipokines, and activation of pathways of cell death.

Oxidative Stress and Lipid Peroxidation Reactive oxygen species (ROS) refers to several shortlived, pro-oxidant chemicals including hydroxyl radical,

Chapter 20

singlet oxygen molecules, hydrogen peroxide, and superoxide anions. These pro-oxidant molecules lead to oxidative damage to macromolecules in the cell when they overwhelm the protective antioxidant mechanisms of the cell [176]. Functional inactivation of essential cellular biomolecules causes either cell death or production of inflammatory mediators via redox-sensitive transcription factors such as Nrf-1 and NFkB [177,178]. Studies have shown increased serum markers of oxidative stress, and markers of oxidative damage for DNA, and proteins besides lipid peroxides in NASH [179–181]. Additionally, antioxidant factors such as glutathione S-transferase and catalase are reduced [182]. Polyunsaturated fatty acids (PUFAs) in the cell can undergo peroxidation by ROS, resulting in the formation of malondialdehyde (MDA) and trans-4hydroxy-2-nonenal (4–HNE) byproducts [183]. Lipid peroxides contribute to liver injury by increasing production of TNFa, increasing the influx of inflammatory cells, impairing protein and DNA synthesis, and depleting levels of protective cellular antioxidants like glutathione [184–187].

Mitochondrial Dysfunction Several lines of evidence suggest that hepatic mitochondrial dysfunction has a role in the pathogenesis of NASH. Ultrastructural studies have shown the presence of hepatocyte megamitochondria with paracrystalline inclusions in patients with NASH [179,188]. Functional differences include impaired ability to synthesize ATP after a fructose challenge, which causes transient liver ATP depletion and lower expression levels of mitochondrial DNA-encoded proteins and lower activity of complexes of the mitochondrial respiratory chain in patients with NASH [189–191]. The mechanisms leading to mitochondrial dysfunction are incompletely understood, but a contributory role may be played by increased mitochondrial oxidation of fat that increases respiratory chain electron delivery. In this setting, mitochondrial respiratory chain dysfunction causes interruption in electron flow and the electrons are then transferred to molecular oxygen, giving rise to hydrogen peroxide and superoxide radicals [192,193]. With progressive decrease in mitochondrial fatty acid oxidation, alternative pathways of fatty acid oxidation, peroxisomal b-oxidation, and microsomal o-oxidation become active and contribute to the generation of ROS by transfer of electrons to molecular oxygen and a vicious cycle of increasing mitochondrial dysfunction [194–196]. Mitochondrial dysfunction is also worsened by activation of cytochrome P450 2E1, cytochrome P450 4A10, and cytochrome P450 4A14mediated microsomal o-oxidation via generation of dicarboxylic acids that uncouple oxidative phosphorylation and add to oxidative stress [197].

Role of Signaling Pathways of Inflammation, Proinflammatory Cytokines, and Adipokines Inflammation in NASH results from cross-talk between hepatocytes and nonparenchymal cells (activated


Kupffer cell, stellate cells, and sinusoidal endothelial cells) mediated by soluble factors, as well as proinflammatory molecules released from visceral adipose tissue. The NFkB pathway has been extensively studied for its role in steatohepatitis and is upregulated in NASH patients and in animal models of the disease [198]. However, its role in pathogenesis of NASH is complex, and while activation of NFkB signaling in liver cells induces inflammation and steatosis, its inactivation also causes steatohepatitis and liver cancer in a mouse model [199,200]. Deletion of the JNK1 isoform of c-Jun N-terminal kinase (JNK), a mediator of TNFinduced apoptosis, is protective in a mouse model of steatohepatitis, suggesting that JNK signaling is important in the pathogenesis of NASH [201]. Proinflammatory cytokines TNFa and IL-6 are increased in NASH patients [202,203]. In animal models of steatohepatitis, decreasing TNFa expression causes decreased hepatic steatosis, cell injury, and inflammation, suggesting a role of this cytokine in the pathogenesis of NASH [204]. However, targeted disruption of TNFa or its receptor TNFR1 does not protect against lipid peroxidation and hepatocyte injury in diet-induced steatohepatitis. Since inactivation of NFkB, of which TNFa is an effector, does protect hepatocytes in this setting, TNFa may represent one of many inflammatory mediators of steatohepatitis. Adipose tissue, particularly visceral fat, plays an important role in the pathogenesis of IR and development of NASH. Visceral adipocytes overexpress 11 b-hydroxysterol dehydrogenase and more readily mobilize fat and are less mature than subcutaneous adipocytes [205]. In addition, adipocytes are hormonally active and produce several adipokines that affect insulin action and metabolic processes in the liver. Among the important adipokines are leptin and adiponectin [206]. Leptin levels are increased in the plasma of patients with NAFLD [207]. However, leptin has an antisteatotic role and is protective. Therefore, it has been suggested that NAFLD may be associated with leptin resistance and a defective response to leptin. Adiponectin levels, on the other hand, are low in patients with NASH, and lower levels are associated with more severe liver injury [208,209]. Adiponectin has been shown to increase insulin sensitivity, regulate FFA metabolism, and inhibit gluconeogenesis [210,211]. Adiponectin also has strong anti-inflammatory effects that are mediated by suppressing TNFa levels and activity [212].

Cell Death Hepatocytes express the membrane receptor Fas, but do not induce apoptosis in their neighboring cells because they do not produce the Fas ligand (FasL). However, patients with NASH have increased hepatocyte FasL expression that can trigger apoptosis [213]. When FasL interacts with Fas, it activates caspase-8, which in turn activates the Bid protein by truncating it. Bid then activates the protein Bax, which forms a complex with Bak and forms a channel in the outer mitochondrial membrane [214]. The resulting increase in permeability of 405

Part IV


the mitochondrial membrane releases cytochrome c from the inner membrane space and blocks the mitochondrial respiratory chain and increases formation of ROS in the mitochondria. ROS increase permeability and cause rupture of the mitochondrial outer membrane and release of proapoptotic molecules, which activate caspase-9 and caspase-3 and perpetuate a vicious cycle of apoptosis [215].

MOLECULAR BASIS OF ALCOHOLIC LIVER DISEASE The histological spectrum of alcohol-induced liver disease spans simple steatosis, to steatohepatitis (characterized by inflammatory cell infiltration, hepatocyte ballooning, apoptosis, and necrosis in addition to fat accumulation), fibrosis, and cirrhosis. Steatosis is mainly macrovesicular and most prominent in the centrilobular region. Early stages of alcohol-induced liver injury are reversible, and prevention of steatosis in experimental models has been shown to prevent development of inflammation and fibrosis [216,217].

Pathways of Alcohol Metabolism in the Liver There are three enzymatic pathways of ethanol metabolism in the liver, and all three contribute to ethanolinduced liver injury [218]. First, oxidation of ethanol occurs through the cytosolic alcohol dehydrogenase (ADH) isoenzymes that produce acetaldehyde, which is then converted into acetate, and these reactions result in the reduction of nicotinamide adenine dinucleotide (NAD) to NADH, its reduced form. Excessive ADH-mediated hepatic NADH generation has multiple important metabolic effects due to inability of hepatocytes to maintain redox homeostasis [219]. This redox imbalance results in inhibition of the Krebs cycle and fatty acid oxidation, which promotes hepatic steatosis. However, with chronic ethanol consumption, the redox state is normalized. Instead, alterations in regulation of lipid metabolism genes appear to be important in this setting. Second, alcohol is metabolized by the microsomal ethanol oxidizing system (MEOS), of which cytochrome P450 2E1 (Cyp2E1) is the key enzyme, although other cytochrome P450 enzymes such as Cyp1A2 and Cyp3A4 also play a role [218– 220]. Cyp2E1 is induced by chronic ethanol consumption, and its induction is responsible for the metabolic tolerance to alcohol in alcohol-dependent individuals. Induction of Cyp2E1 plays a role in alcohol-induced liver injury through the production of reactive oxygen species that can overwhelm the cellular defense systems leading to mitochondrial injury, and further exacerbation of oxidative stress [221]. Finally, ethanol is also metabolized via a nonoxidative pathway by fatty acid ethyl ester (FAEE) synthase. The product of this reaction, fatty acid ethyl esters (FAEEs), accumulates in the plasma, lysosomal, and mitochondrial membranes and can interfere with their functioning and with cellular signal-transduction pathways [222]. 406

Changes in Expression of Genes Involved in Lipid Metabolism on Chronic Alcohol Exposure Recent studies suggest that the development of alcoholic and nonalcoholic steatohepatitis (NASH) share many common pathogenic mechanisms [223]. Insight into the molecular mechanisms of alcoholic-induced steatohepatitis has been obtained through the investigation of pathways and regulatory molecules involved in lipid homeostasis that have previously been shown to play a role in development of NASH. Chronic ethanol consumption affects both oxidation of fatty acids and increases de novo lipogenesis, thereby causing accumulation of fat in the liver. Peroxisome proliferators-activated receptor-a (PPARa), a member of the nuclear hormone receptor superfamily, is the master regulator of genes involved in free fatty acid transport and oxidation [224]. PPARa forms a dimer with retinoid X receptor (RXR) and binds to the peroxisome proliferators response element (PPRE) in the promoter regions of its target genes [225]. PPARa targets include mitochondrial and peroxisomal fatty acid oxidation pathway genes, apolipoprotein genes, and the membrane transporter, carnitine palmityl-transferase I (CPT I), which allows long-chain acyl-CoAs to enter mitochondria to initiate b-oxidation. PPARa also regulates CPT I activity and therefore fatty acid oxidation indirectly via regulation of the enzyme malonyl-CoA decarboxylase, which degrades malonyl-CoA, an allosteric regulator of CPT I. Both in vitro in primary hepatocyte cultures and hepatoma cells, and in vivo, ethanol has been shown to decrease b-oxidation of fatty acids by interfering with PPARa DNA binding and transcription-activation [226,227]. Decreased oxidation of fatty acids by ethanol leads to accumulation of fat in the liver [228]. The second mechanism by which ethanol causes steatosis is by increasing the rate of fat synthesis in the liver by increasing expression levels of lipogenic enzymes that are regulated by the transcription factor SREBP. There are three isoforms of SREBP, called SREBP1a, SREBP1c, and SREBP2 [228,229]. The isoform SREBP1a is mainly expressed in cultured cells, SREBP1c regulates fatty acid synthesis in the liver, and SREBP2 regulates cholesterol synthesis. SREBPs are synthesized as precursor proteins and are attached to the endoplasmic reticulum and nuclear membranes. When the protein is activated, there is proteolytic cleavage of the NH2-terminal fragment (called the mature form of the protein), which then enters the nucleus and binds to target genes via the sterol response elements (SREs) [229]. Recent studies have shown that ethanol-fed mice have increased SREBP1 expression; increase in the amount of mature SREBP1 in the liver; and corresponding upregulation of expression of SREBP-target genes, such as fatty acid synthase, stearoyl-coA desaturase, and ATP citrate lyase, in the fatty acid biosynthetic pathway [166,230,231]. The third critical metabolic regulatory molecule in the liver affected by ethanol is AMP-activated protein kinase (AMPK), which is a metabolic switch regulating pathways of hepatic triglyceride and cholesterol synthesis. AMPK can regulate SREBP1 expression at the transcriptional

Chapter 20

and post-transcriptional levels [232,233]. Ethanol has been shown to inhibit hepatic AMPK activity, and treatment with AMPK activators partially blocks ethanolmediated increase in expression of SREBP-dependent genes in vitro [234]. Furthermore, adiponectin, a hormone derived from adipocytes that is an activator of AMPK, has been shown to alleviate both alcoholic and nonalcoholic fatty liver disease in mice [235].

Inflammatory Cytokines and Role of Kupffer Cells Besides altering metabolic pathways, chronic ethanol feeding results in altered expression of several inflammatory mediators, including reactive oxygen species, cytokines, and chemokines [217,236]. An important source of inflammatory mediators from alcohol consumption is hepatic Kupffer cells which produce TNFa, an important mediator of the inflammatory response in mammals. Administration of TNFa to mice causes development of fatty liver, activation of SREBP, and increased fatty acid synthesis [237]. Other studies have shown lipopolysaccharide-mediated increased reactive oxygen species production by Kupffer cells with chronic alcohol feeding and normalization of this response by adiponectin [238,239]. Activation of NFkB by alcohol has been shown in experimental models as well as in livers of patients with alcoholic hepatitis. NFkB activation and its target gene expression play an important role in inflammatory response to bacterial endotoxin and in the activation of the innate immune system in response to necrotic cells [240,241]. In isolated Kupffer cells, chronic ethanol feeding has been shown to increase NFkB binding to the TNFa promoter on LPS stimulation [242].

MOLECULAR BASIS OF HEPATIC FIBROSIS AND CIRRHOSIS Chronic liver injury is often associated with a wound healing process in the liver that is commonly referred to as liver fibrosis, which in the advanced stage is termed as cirrhosis. Liver cirrhosis can range in its presentation from being asymptomatic to liver failure. Hepatic fibrosis sets in many pathological scenarios including but not limited to alcoholic liver disease, NAFLD, viral hepatitis, autoimmune disorders, Wilson’s disease, cholestatic liver disease, and others. The process of fibrosis entails excessive deposition of extracellular matrix in the liver, especially collagen (Figure 20.6). This compromises the hepatic architecture leading eventually to cirrhosis and hepatic failure. The fundamental cell type involved in the process of hepatic fibrosis is the hepatic stellate cell (HSC). Chronic insult to the liver leads to the activation of hepatic stellate cells. The process of HSC activations entails increased DNA synthesis and proliferation, activation of profibrotic target genes and increased cell contractility (reviewed in [243,244]). The end result of this process is hepatic fibrosis and eventually cirrhosis. It should be mentioned that the overall impact of the fibrosis is not only due to excessive deposition of


extracellular matrix and loss of functional hepatocyte compartment, but also indirect effects on circulation secondary to constriction of sinusoids. How do HSCs undergo activation? A multitude of insults converge onto this cell type, which upon activation, bring about the fibrotic phenotype owing to downstream genetic changes. Broadly speaking, the two major insults, including ASH and NASH, both seem to be mediating HSC activation through increased oxidative stress, albeit via unique mechanisms. Alcohol, which is the leading cause of hepatic fibrosis in Western countries, has been shown to elevate oxidative stress after being metabolized by CYP2E1 to generate reactive oxygen species that are known to directly interact with HSC [245,246]. In addition, alcohol is also metabolized to acetaldehyde, which in turn has been shown to be fibrogenic [247,248]. Lastly, Kupffer cells, an additional nonparenchymal cell in the liver, are also involved in the generation of both acetaldehyde and alcohol-induced lipid peroxidation products in alcoholic liver disease [249]. Around 20%–40% of NASH patients also progress to hepatic fibrosis and have been shown to also be secondary to elevated oxidative stress [250]. However, this increase is mediated via production of ROS secondary to PPAR-a mediated increased free fatty acid oxidation that occurs in turn due to excessive high fat intake, experimentally or otherwise [251]. It is worth noting that activation of HSC can very well be secondary to stimuli produced by other cell types present during the injury, including the hepatocytes, Kupffer cells, sinusoidal endothelial cells, and the circulating inflammatory cells. What signaling mechanisms induce the HSC activation and in turn induce the target gene expression in HSC? Several relevant pathways have been identified, and the most prominent ones include the PDGF axis and TGFb/Smad signaling pathway. PDGF is a potent mitogen for HSC, and its cognate receptor PDGFR expression goes up during HSC activation [252]. PDGF activation has also been shown to stimulate PI3 kinase, which also induces HSC proliferation [253]. In addition, recruitment of Ras to PDGF receptor also leads to ERK activation via sequential activation of Raf-1, MAPK-1/2, ERK-1, and ERK-2. Nuclear ERK can regulate target genes responsible for proliferation of HSCs. Additionally JNK activation has been shown to positively regulate HSC proliferation [254]. TGFb is a potent profibrogenic cytokine and is known to be produced by variety of cells including HSC, hepatocytes, and others [255]. TGFb signaling eventually leads to target gene expression, and several of these targets are the hallmark signatures of HSC activation. TGFb has been shown to stimulate synthesis of collagens, decorin, elastin, and others. Increased expression of KLF6, a transcription factor and a tumor suppressor, which acts as a chaperone for collagen has also been reported to be increased during HSC activation [256]. Some relevant targets of KLF6 include collagen 1a, TGF-b1 and its receptors, and urokinase plasminogen activator (uPA), which activates latent TGF-b1. Also, connective tissue growth factor (CTGF), which is regulated by TGFb, is also upregulated during HSC activation, as well as in chronic 407

Part IV


viral hepatitis, bile duct ligation, and other related scenarios [257,258]. It is also important to mention that decrease in PPAR-g has been associated with HSC activation [259–262]. In fact PPAR-g ligands have been shown to inhibit HSC proliferation and activation in cell cultures. Thus, sustained basal expression of PPAR-g in HSC has been suggested to maintain their quiescence. It is also relevant to mention the phenotype of a quiescent and activated HSC. Quiescent HSCs are typically characterized by the presence of perinuclear lipid droplets containing vitamin A or retinoid [263,264]. These droplets are lost following activation of HSC, when the retinoid is released as retinol. While the causal relationship of this event to HSC activation is unclear, increasing focus is shifting on retinoic acid receptors in the nuclei including RAR and RXR. It is important to point out that decrease in RXR and PPAR-g receptor is associated with HSC activation, and the converse has been reported in HSC quiescence [265,266]. Once HSC activation occurs, several relevant genes have been shown to be upregulated (reviewed in [244]). The most pertinent include the extracellular matrix genes such as type I collagen (a1 and a2), type III collagen, laminin, and fibronectin, and proteoglycans such as decorin, hyaluronan, heparin sulfate, and chondroitin sulfate. In addition, several genes that are essential for matrix remodeling such as MMP-2, MMP-9, and TIMP-1 have also shown to be elevated. Lastly, genes such as ICAM-1 and a-SMA are upregulated as well. In addition, several studies have reported a genome-wide analysis and either strengthened the existing findings or identified additional aberrations, which would, in the years to come, be exploited for understanding the biology and in turn devising novel therapies for hepatic fibrosis and eventually cirrhosis. Cirrhosis is often defined as the advanced stage of hepatic fibrosis, which is accompanied by development of regenerative nodules amidst the fibrous bands and follows a chronic liver injury. This pathology leads to vascular distortions, impaired parenchymal flow leading to portal hypertension, and end-stage liver disease. Thus, the molecular pathology of cirrhosis is a continuum of the hepatic fibrosis. An interesting point to remember is that initially during the process of hepatic fibrosis, increased fibrogenesis is being counterbalanced by factors negatively regulating ECM deposition (reviewed in [267]). However, as chronic insult to the liver continues, the process of fibrogenesis, observed as continued activation of myofibroblasts derived from HSC and perivascular fibroblasts, exceeds fibrinolysis. It remains a conundrum to be able to successfully predict the risk of developing cirrhosis in patients with same hepatic pathology. The most promising advances that are being reported include the identification of genetic polymorphisms that are able to predict the risk of progression of hepatic fibrosis. Studies reporting single nucleotide polymorphisms (SNPs) as predictors of progression of fibrosis are beginning to trickle in [268,269]. Recently, cytokine SNPs were identified in successfully predicting disease progression [268]. Similarly SNPs in the DDX5 gene successfully predicted fibrosis progression in Hepatitis C patients as well [269]. 408

Understanding the molecular pathology of hepatic fibrosis and cirrhosis also enables the possibility of prophylactic and therapeutic intervention. To this end, various steps of HSC activation are being investigated, both preclinically and clinically. Broadly speaking, such agents range from general anti-inflammatories to selective biologicals and chemical inhibitors targeting signal transduction components that have been discussed in the preceding sections to play a role in HSC activation [244,267]. In addition, since oxidative stress is implicated in HSC activation, use of antioxidants is also under investigation. Additional drugs being developed include agents regulating ECM deposition, vasoactive modulators, cytokine antagonists, and factors promoting hepatocyte survival and growth.

MOLECULAR BASIS OF HEPATIC TUMORS Primary liver tumors presenting as hepatic masses are classified based broadly as benign or malignant. The common benign tumors in the liver include hemangiomas, focal nodular hyperplasia (FNH), and liver cell adenoma or hepatic adenoma (HA). Malignant tumors are usually classified based on the lineage of transformed cells and various clinicopathological characteristics. Broadly, the tumors originating from hepatic progenitors or hepatoblasts are referred to as hepatoblastoma (HB) and the tumors originating from more mature hepatocytes are referred to as hepatocellular cancer (HCC).

Benign Liver Tumors Hemangioma Cavernous hemangioma tops the list of the benign tumors of the liver [270]. These lesions are usually less than 5 cm and can range from 1–20 cm. These tumors are most common in adult women although they can affect any sex and any age. Most of these tumors occur in the right lobe underneath the capsule and are usually well circumscribed, compressible, and with a darker color. The patients are mostly asymptomatic unless there is an associated complication such as necrosis, thrombosis, infarction, or hemorrhage. The tumor arises from the endothelial cells that line the blood vessels within the liver and is thought to entail ectasia rather than hypertrophic or hyperplastic events. The tumor is composed of large vascular channels lined by endothelial cells and collagen lining and separated by connective tissue septa. These endothelial cells have been shown to possess immunocytochemical properties of vascular rather than sinusoidal endothelial cells [271]. A significant number of the larger tumors are reported to taper into dilated vascular spaces before transitioning to normal hepatic architecture suggesting irregular borders rather than being well circumscribed [272]. The tumors derive their blood supply from the hepatic artery. The pathogenesis of this tumor is poorly understood. Because of its

Chapter 20

preponderance in adult females, and accelerated growth of tumors observed in high estrogen states such as puberty, pregnancy, and oral contraceptive use, a hormonal mechanism has been suggested, although the reports on the presence of estrogen receptors on a subset of these tumors are conflicting [270,272].

Focal Nodular Hyperplasia Focal nodular hyperplasia (FNH) are benign hepatic tumors next only to hemangiomas in incidence. These tumors occur at a higher frequency in females and occur between the ages of 20 and 50 [273]. The tumor is usually multinodular, composed of a few hepatocytethick plates, and is thought to occur as a hyperplastic response to either a pre-existing developmental arterial malformation or to increased blood flow, thus leading to cellular hyperplasia. There is well-known association of FNH with vascular disorders such as Rendu-Osler-Weber syndrome or hereditary telangiectasia. The molecular basis of FNH remains largely obscure. However, it is clear that FNH is polyclonal in nature in a significant subset of cases with only a minor subset composed of monoclonal tumor cells. Recently, transcriptome analysis of FNH identified activation of Wnt/b-catenin pathway without any mutations in b-catenin gene [274]. While the significance of these findings is unclear, especially since these tumors are thought to be a result of vascular disturbances, these observations might be a result of alternate mechanisms of b-catenin activation such as growth factor-dependent activation [275,276]. Also, levels of genes encoding for angiopoietin 1 and 2 are altered in FNH, with levels of ANGPT1/ANGPT2 ratio being greater in all FNH cases examined [277]. Thus, while the exact molecular basis of FNH remains obscure, aberrations in some pathways are becoming apparent, and additional genetic and proteomic studies would further assist in this endeavor. It should be mentioned that there are no major complications associated with this pathology, and malignant transformation is not known to occur.

Hepatic Adenoma Hepatic adenomas (HA) are benign liver tumors that occur in greater frequency in females and are observed as benign proliferation of hepatocytes in an otherwise normal liver [273]. These monoclonal tumors have been classically associated with the use of estrogencontaining oral contraceptives or androgen-containing steroid anabolic drugs. Such tumors are usually observed as solitary masses and are asymptomatic. Additionally, glycogen storage diseases, especially Type I (von Gierke) and Type III, are also known risk factors for the development of hepatic adenoma. However, in these circumstances, HAs oftentimes occur as multiple lesions with a greater propensity to undergo malignant transformation. Macroscopically, HAs present as solitary, yellowish masses due to lipid accumulation and give a pseudo-encapsulated appearance because of the compression of adjacent hepatic tissue and can


range from 0.5–15 cm in diameter. Some of the histological features include areas of fatty deposits and hemorrhage, cord-like or plate-like arrangements of larger hepatocytes containing excessive glycogen and fat, sinusoidal dilatation (the result of the effects of arterial pressure, as these tumors lack a portal venous supply), absent bile ductules, and presence of few and nonfunctioning Kupffer cells [278] (Figure 20.8). The extensive hypervascularity and lack of a true capsule make this tumor prone to hemorrhage. The tumors can regress in size following discontinuation of inciting factors such as oral contraceptives, while at other times they continue to exhibit a stable or progressive disease. However, the risk of associated hemorrhage and neoplastic transformation is always present. In view of these risks, surgical resection is often recommended. However, performance of surgery is influenced by the multiplicity or size of the tumors and associated symptoms on one hand and surgical risk to the patient on the other. The molecular basis of the tumors is being increasingly understood [273,279]. Significant subsets of hepatic adenomas display inactivating mutations in HNF1a or TCF1 gene. It should be noted that HNF1aknockout mice develop fatty liver and hepatocyte dysplasia supporting a clear role of this protein in lipid metabolism [280,281]. Biallelic inactivating mutations in TCF1 genes were identified in around 50% of HA. The tumors in this scenario display marked steatosis and excess glycogen accumulation. These observations were explained by the role of HNF1a in regulating liver fatty acid-binding protein (L-FABP), which plays a role in fatty acid trafficking in hepatocytes, and glucose-6-phosphate increase, respectively [282]. HA with HNF1a inactivation display an extremely low risk of malignant transformation. In another subset of HAs, Wnt/b-catenin activation is observed secondary to mutations in CTNNB1 gene that eventually effect the degradation of b-catenin protein. These adenomas can range from 15% to 46%, but the numbers might be closer to the lower percentage when only CTNNB1 mutations as a mechanism of b-catenin activation are taken into account [279,283]. These tumors show frequent cytological abnormalities and pseudo-glandular formation and have been shown to occur at abnormally higher frequency in males. Most importantly, these HAs have been shown to possess a higher propensity for malignant transformation. There is also yet another group of HAs that display acute phase inflammation, histologically [273]. The true molecular basis of these HAs remains unknown, but they are seen in patients with high body mass index and excessive alcohol intake. b-catenin activation has also been observed in some of these HAs. Such tumors show sinusoidal dilatation, inflammatory infiltrates, and vessel dystrophy.

Malignant Liver Tumors Hepatoblastoma Hepatoblastoma (HB) is a rare primary tumor of the liver (incidence is 1 in 1,000,000 births), but is the 409

Part IV


A

C

B

D

E

Figure 20.7 Histology and immunohistochemistry for b-catenin in pediatric hepatoblastomas. (A) H&E displaying embryonal pattern of hepatoblastoma. (B) H&E displaying small cell embryonal hepatoblastoma. (C) H&E displaying fetal hepatoblastoma. (D) Nuclear and cytoplasmic localization of b-catenin in an embryonal hepatoblastoma. (E) Nuclear localization of b-catenin along with some membranous staining in a fetal hepatoblastoma.

most frequent liver tumor in children under the age of 3 years [284,285]. This tumor is classified based on cellular composition and differentiation. The epithelial group of tumors comprises fetal, embryonal, mixed (embryonal and fetal), macrotrabecular, and small cell undifferentiated subtypes (Figure 20.7). Mixed epithelial-mesenchymal HBs, in addition to containing any of the preceding epithelial cell types, also contain mesenchymal components such as myofibroblastic, chondroid, and osteoid tissues. In addition, teratomatous HBs contain derivatives of all three germ layers. Most HB are sporadic but have been reported as a component of the Beckwith-Wiedemann syndrome (BWS), where its incidence is higher than the general population or in the familial adenomatous polyposis (FAP), which occurs due to germline mutation in the adenomatous polyposis coli (APC) gene [286,287]. To discuss the genetic abnormalities in HB, we need to refer to cytogenetic studies that have identified various frequent chromosomal aberrations [288]. Most of these involved chromosomes 2, 20, 1, and 8 and included trisomies and unbalanced translocations. Another important relevant finding is the lack of significant similarity between the molecular cytogenetics by comparative genomic hybridization of HB and HCC [288]. HB typically displayed lower rate of chromosomal imbalances with a small subset showing none, versus HCCs showing multiple chromosomal aberrations ranging from 5–16 per tumor. These studies have suggested tumor genes located in the specific loci to be part of the pathogenetic process, but additional functional studies are lacking. However, by far 410

the most relevant molecular aberration in the HB is anomalous activation of Wnt/b-catenin signaling, also referred to as the canonical Wnt signaling pathway [289]. As discussed previously in the section on liver development, Wnt/b-catenin signaling plays an indispensable role in normal liver development [290,291]. Sequence analysis of b-catenin gene (CTNNB1) has revealed missense mutations or interstitial deletions in a significant subset in up to 90% of HBs [292– 295]. In addition to mutations in CTNNB1, mutations in AXIN and APC have also been reported in HBs, with the latter being reported in familial cases [294,296]. These events lead to nuclear and/or cytoplasmic accumulation of b-catenin in HB as identified by immunohistochemistry and coincide with upregulation of several targets of the Wnt pathway, such as cyclinD1 (Figure 20.7). While immunohistochemistry for b-catenin has been attempted to classify HB for prognosis as well as histological subtypes, a more mechanistic insight will be necessary to dissect out the innocent from the inciting b-catenin redistribution. Since b-catenin activation has been implicated in the pathogenesis of a greater subset of HB, it is being discussed as a potential therapeutic target demonstrating efficacy in preclinical setup [297–300].

Hepatocellular Cancer Hepatocellular cancer (HCC) is the most common primary tumor of the liver, accounting for 85% of all primary malignant tumors. It is the fifth most common malignancy worldwide and third most common cause

Chapter 20

of death related to cancers [119,301]. Common risk factors of HCC include hepatitis, chronic alcohol abuse, toxins such as aflatoxins, and nonalcoholic fatty liver disease (NAFLD). This disease, which used to be a common malignancy in underdeveloped or developing countries, is now on the rise in developed countries [120,302]. The increasing incidence of HCC in developed countries is attributed to increasing incidence of hepatitis C and hepatitis B, as well as of NAFLD. HCC afflicts three times more men than women and overall incidence increases with age, especially in Western world, although trends are now changing. In fact peak incidence of HCC in a recent study was between the ages of 45 and 60 years [119]. Much of the HCC occurs in the background of cirrhosis. In fact most of the chronic liver insults eventually lead to cirrhosis. During this process, liver function is ascertained by the presence of regenerating nodules, which are a function of the regenerative capacity of surviving hepatocytes [303]. However, some of these nodules evolve into low-grade and high-grade dysplastic nodules, which then lead to HCC [304]. Similarly, a minor subset of HAs proceeds to evolve into HCC (Figure 20.8). Histologically, HCC may be well differentiated to poorly differentiated, depending


on degree of nuclear atypia, anaplasia, and nucleolar prominence, and the tumor cells usually arrange in a trabecular pattern composed of uneven layers of hepatocytes, with occasional mitosis (Figure 20.8). Thus, overall, there is a progression of the preneoplastic events into neoplasia, and clearly, understanding the molecular basis of this evolution will have strong clinical implications. The possibility of a cancer stem cell origin of some of the HCC is also being entertained. Cancer stem cells are formed by mutations in the normal existing stem cells or a progenitor cell within a tissue. It has also been suggested that perfectly mature cells such as hepatocytes can dedifferentiate into progenitor-like cells and also be targets of mutations [305]. Dysplastic lesions within liver have been shown to have preneoplastic precursors. In addition, a subset of HCCs exhibit mixed hepatocholangiocarcinoma phenotype that might represent bipotential stem cell origin of these tumors [306]. In addition, some early HCCs have been shown to harbor smaller proliferating oval cells or stem cells. In fact, the pathways that are known to regulate stem cell renewal such as the Wnt, Hedgehog, and Notch have been shown to play a role in oval cell activation as well as in a subset of HCCs [305].

A

B

C

D

Figure 20.8 Histology of hepatic adenoma and HCC in mouse model of chemical carcinogenesis and HCC in patients. (A) A hepatic adenoma (*) is evident on H&E in mice 6 months after diethylnitrosamine (DEN) injection. (B) HCC (*) is evident in mouse liver 9 months after DEN injection. (C) H&E show abnormal trabecular pattern (arrowheads) in HCC patient. (D) H&E showing fibrolamellar variant of HCC in a patient with lamellar fibrosis (arrowhead) pattern surrounding large tumor cells (arrows). 411

Part IV


During the process of hepatocarcinogenesis, multiple genetic alterations have been identified to impart a proliferating and cell survival phenotype to the tumor cells. Accumulations of these changes over time are necessary for tumor initiation and progression. While the precise nature of such genetic alterations and chronology of such aberrations, whether stereotypic or heterogeneous from one patient to another, are not known, several alterations ranging from point mutations in individual genes to gain or loss of chromosome arms have been reported [304]. Several candidate genes include c-myc (8q), Cyclin-A2 (4q), Cyclin-D1 (11q), Rb1 (13q), AXIN1 (16p), p53 (17p), IGFR-II/M6PR (6q), p16 (9p), E-Cadherin (16q), SOCS (16p) and PTEN (10q). The most frequently mutated genes in HCC include p53, PIK3CA, and CTNNB1 (b-catenin gene). All these changes lead to loss of tumor suppressor gene function, gain of oncogene function, or activation of signal transduction pathways that play critical roles in tumor biology, giving the cells stemness, proliferative, and survival advantages, and eventually, invasive and metastatic potential. Various signaling pathways that become aberrantly active in HCC include the Wnt/b-catenin, EGFR, TGFa, VEGFR, IGF, and HGF/Met pathways [120,304]. Various preclinical and clinical studies have shown some advantages of targeting these pathways in HCC, although several studies are preliminary at this stage. Similarly, after any of the preceding factors (excluding Wnt signaling) activate the receptor tyrosine kinases, the signal is transduced via Ras/MAPK, PI3kinase, or Jak/Stat pathways [120,304]. Success of Sorafenib in HCC is attributable to identification of such molecular aberrations in HCC [307,308]. Various agents that are implicated in HCC pathogenesis have shown some preference for the pathways they inflict. Aflatoxins are toxins from the fungi Aspergillus flavus and Aspergillus parasiticus, which infect foods that are improperly stored in hot and humid conditions and are particularly common in Asia and Africa. Aflatoxins, once ingested, are metabolized by cytochrome P450 to form an active metabolite, which leads to DNA adduct formation that induces hepatocyte transformation [309]. One of the major downstream effects is mutation in a widely studied tumor suppressor gene p53. Highest p53 somatic mutations in fact are noted in HCCs that occur secondary to aflatoxin exposure. Separate studies have shown up to 56% of HCCs due to aflatoxin exposure having p53 mutations [310]. In Western countries, the p53 mutations are mostly observed in advanced stages of HCC, suggesting loss of p53 to be a late event in hepatocarcinogenesis [304]. Additionally, it should be noted that, other than aflatoxins, high rate of p53 mutations is observed only in hemochromatosis-related HCC [311]. The three leading causes of HCC in the Western world (HCV, HBV, and alcoholic liver disease) mostly employ common molecular and genetic pathways for tumorigenesis. These include the Rb1, p53, and Wnt pathways. Especially HCC originating in chronic alcoholic liver disease patients display frequent alterations in Rb1 and p53, including loss of 412

Rb1 due to promoter methylation, p16 methylation, and cyclin-D1 amplification [312]. p16 inhibits cyclindependent kinases (cdk4/6), which repress G1 cell cycle progression. This occurs secondary to dephosphorylation of retinoblastoma protein, which bind sand inactivates E2F1. Although the mechanism remains unclear, HCV patients demonstrate a high rate of b-catenin gene mutations as well as b-catenin stabilization [313,314]. The mutations typically occur in the exon-3 of CTNNB1, which contains serine and threonine sites necessary for GSK3b-mediated and Casein kinase-mediated phosphorylation and eventual proteosomal degradation of b-catenin by ubiquitination. Several known target genes of this pathway such as glutamine synthetase, Cyclin-D1, fibronectin, c-myc, p-450s, and others are upregulated in HCC and might contribute to tumor cell phenotype in HCC. Fibrolamellar HCC One of the uncommon variants of HCC that deserves a mention is the fibrolamellar HCC (FL-HCC). This usually occurs in younger patients (5–35 years) and in a noncirrhotic hepatic background [315]. The histology is characterized by lamellar pattern of fibrosis surrounding larger tumor cells that contain abundant granular cytoplasm and prominent nucleoli (Figure 20.8). While initially thought to have better prognosis, FL-HCC appears to be equally aggressive with a 45% 5-year survival [316,317]. In fact the improved prognosis appears to be due to absence of cirrhosis in FL-HCC as compared to existing cirrhosis in the conventional HCC cases. The molecular basis of this variant of HCC remains largely obscure. Due to rarity of these tumors, lesser studies are available that have characterized molecular and genetic aberrations in FL-HCC. One study has reported four frequent alterations in FL-HCC than in other tumor types, including gain of chromosome 4q and loss of chromosomes 9p, 16p, and Xq [318]. Another CGH study identified gains of chromosome arm 1q in six out of seven FL-HCCs [319]. This region, which is also preferentially amplified in 58% of conventional HCCs, may contain an essential proto-oncogene commonly implicated in liver carcinogenesis. Recently, increased EGFR protein expression has also been identified in significant numbers of FL-HCC, and this increase appeared to be secondary to gains of chromosome 7 [320]. Thus, EGFR antagonists and other receptor tyrosine kinase inhibitors might have a useful role in treatment of FL-HCC.

REFERENCES 1. Duncan SA. Mechanisms controlling early development of the liver. Mech Dev. 2003;120:19–33. 2. Zaret KS. Regulatory phases of early liver development: Paradigms of organogenesis. Nat Rev Genet. 2002;3:499–512. 3. Lee CS, Friedman JR, Fulmer JT, et al.The initiation of liver development is dependent on Foxa transcription factors. Nature. 2005;435:944–947. 4. Jung J, Zheng M, Goldfarb M, et al. Initiation of mammalian liver development from endoderm by fibroblast growth factors. Science. 1999;284:1998–2003.

Chapter 20 5. Rossi JM, Dunn NR, Hogan BL, et al. Distinct mesodermal signals, including BMPs from the septum transversum mesenchyme, are required in combination for hepatogenesis from the endoderm. Genes Dev. 2001;15:1998–2009. 6. Gualdi R, Bossard P, Zheng M, et al. Hepatic specification of the gut endoderm in vitro: Cell signaling and transcriptional control. Genes Dev. 1996;10:1670–1682. 7. Keng VW, Yagi H, Ikawa M, et al. Homeobox gene Hex is essential for onset of mouse embryonic liver development and differentiation of the monocyte lineage. Biochem Biophys Res Commun. 2000;276:1155–1161. 8. Martinez Barbera JP, Clements M, Thomas P, et al. The homeobox gene Hex is required in definitive endodermal tissues for normal forebrain, liver and thyroid formation. Development. 2000;127:2433–2445. 9. Sosa-Pineda B, Wigle JT, Oliver G. Hepatocyte migration during liver development requires Prox1. Nat Genet. 2000;25:254–255. 10. Zhao R, Watt AJ, Li J, et al. GATA6 is essential for embryonic development of the liver but dispensable for early heart formation. Mol Cell Biol. 2005;25: 2622–2631. 11. Duncan SA. Transcriptional regulation of liver development. Dev Dyn. 2000;219:131–142. 12. Berg T, Rountree CB, Lee L, et al. Fibroblast growth factor 10 is critical for liver growth during embryogenesis and controls hepatoblast survival via beta-catenin activation. Hepatology. 2007;46: 1187–1197. 13. Hentsch B, Lyons I, Li R, et al. Hlx homeo box gene is essential for an inductive tissue interaction that drives expansion of embryonic liver and gut. Genes Dev. 1996;10:70–79. 14. Krupczak-Hollis K, Wang X, Kalinichenko VV, et al. The mouse Forkhead Box m1 transcription factor is essential for hepatoblast mitosis and development of intrahepatic bile ducts and vessels during liver morphogenesis. Dev Biol. 2004;276:74–88. 15. Micsenyi A, Tan X, Sneddon T, et al. Beta-catenin is temporally regulated during normal liver development. Gastroenterology. 2004;126:1134–1146. 16. Monga SP, Monga HK, Tan X, et al. Beta-catenin antisense studies in embryonic liver cultures: Role in proliferation, apoptosis, and lineage specification. Gastroenterology. 2003;124:202–216. 17. Schmidt C, Bladt F, Goedecke S, et al. Scatter factor/hepatocyte growth factor is essential for liver development. Nature. 1995;373: 699–702. 18. Sekhon SS, Tan X, Micsenyi A, et al. Fibroblast growth factor enriches the embryonic liver cultures for hepatic progenitors. Am J Pathol. 2004;164:2229–2240. 19. Stenvers KL, Tursky ML, Harder KW, et al. Heart and liver defects and reduced transforming growth factor beta2 sensitivity in transforming growth factor beta type III receptor-deficient embryos. Mol Cell Biol. 2003;23:4371–4385. 20. Suksaweang S, Lin CM, Jiang TX, et al. Morphogenesis of chicken liver: Identification of localized growth zones and the role of beta-catenin/Wnt in size regulation. Dev Biol. 2004;266:109–122. 21. Tang Y, Katuri V, Dillner A, et al. Disruption of transforming growth factor-beta signaling in ELF beta-spectrin-deficient mice. Science. 2003;299:574–577. 22. Weinstein M, Monga SP, Liu Y, et al. Smad proteins and hepatocyte growth factor control parallel regulatory pathways that converge on beta1-integrin to promote normal liver development. Mol Cell Biol. 2001;21:5122–5131. 23. Tan X, Yuan Y, Zeng G, et al. beta-Catenin deletion in hepatoblasts disrupts hepatic morphogenesis and survival during mouse development. Hepatology. 2008;47:1667–1679. 24. Beg AA, Sha WC, Bronson RT, et al. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature. 1995;376:167–170. 25. Hilberg F, Aguzzi A, Howells N, et al. c-jun is essential for normal mouse development and hepatogenesis. Nature. 1993; 365: 179–181. 26. Johnson L, Greenbaum D, Cichowski K, et al. K-ras is an essential gene in the mouse with partial functional overlap with Nras. Genes Dev. 1997;11:2468–2481. 27. Li Q, Van Antwerp D, Mercurio F, et al. Severe liver degeneration in mice lacking the IkappaB kinase 2 gene. Science. 1999;284:321–325.


28. Reimold AM, Etkin A, Clauss I, et al. An essential role in liver development for transcription factor XBP-1. Genes Dev. 2000;14: 152–157. 29. Spear BT, Jin L, Ramasamy S, et al. Transcriptional control in the mammalian liver: Liver development, perinatal repression, and zonal gene regulation. Cell Mol Life Sci. 2006;63:2922–2938. 30. Darlington GJ, Wang N, Hanson RW. C/EBP alpha: A critical regulator of genes governing integrative metabolic processes. Curr Opin Genet Dev. 1995;5:565–570. 31. Odom DT, Zizlsperger N, Gordon DB, et al. Control of pancreas and liver gene expression by HNF transcription factors. Science. 2004;303:1378–1381. 32. Parviz F, Matullo C, Garrison WD, et al. Hepatocyte nuclear factor 4 alpha controls the development of a hepatic epithelium and liver morphogenesis. Nat Genet. 2003;34:292–296. 33. Monga SP, Hout MS, Baun MJ, et al. Mouse fetal liver cells in artificial capillary beds in three-dimensional four-compartment bioreactors. Am J Pathol. 2005;167:1279–1292. 34. Clotman F, Jacquemin P, Plumb-Rudewiez N, et al. Control of liver cell fate decision by a gradient of TGF beta signaling modulated by Onecut transcription factors. Genes Dev. 2005;19:1849–1854. 35. Clotman F, Lannoy VJ, Reber M, et al. The one cut transcription factor HNF6 is required for normal development of the biliary tract. Development. 2002;129:1819–1828. 36. Coffinier C, Gresh L, Fiette L, et al. Bile system morphogenesis defects and liver dysfunction upon targeted deletion of HNF1beta. Development. 2002;129:1829–1838. 37. Lorent K, Yeo SY, Oda T, et al. Inhibition of Jagged-mediated Notch signaling disrupts zebrafish biliary development and generates multi-organ defects compatible with an Alagille syndrome phenocopy. Development. 2004;131:5753–5766. 38. McLin VA, Rankin SA, Zorn AM. Repression of Wnt/betacatenin signaling in the anterior endoderm is essential for liver and pancreas development. Development. 2007;134:2207–2217. 39. Ober EA, Verkade H, Field HA, et al. Mesodermal Wnt2b signalling positively regulates liver specification. Nature. 2006;442: 688–691. 40. Decaens T, Godard C, de Reynies A, et al. Stabilization of betacatenin affects mouse embryonic liver growth and hepatoblast fate. Hepatology. 2008;47:247–258. 41. Michalopoulos GK. Liver regeneration. J Cell Physiol. 2007;213: 286–300. 42. Higgins GM and Anderson RM. Experimental pathology of the liver. I. Restoration of the white rat following partial surgical removal. Arch Pathol. 1931;12:186–202. 43. Fausto N. Liver regeneration and repair: Hepatocytes, progenitor cells, and stem cells. Hepatology. 2004;39:1477–1487. 44. Fausto N, Campbell JS, Riehle KJ. Liver regeneration. Hepatology. 2006;43:S45–53. 45. Michalopoulos GK, DeFrances MC. Liver regeneration. Science. 1997;276:60–66. 46. Taub R. Liver regeneration: From myth to mechanism. Nat Rev Mol Cell Biol. 2004;5:836–847. 47. Wagenaar GT, Chamuleau RA, Pool CW, et al. Distribution and activity of glutamine synthase and carbamoylphosphate synthase upon enlargement of the liver lobule by repeated partial hepatectomies. J Hepatol. 1993;17:397–407. 48. Marubashi S, Sakon M, Nagano H, et al. Effect of portal hemodynamics on liver regeneration studied in a novel portohepatic shunt rat model. Surgery. 2004;136:1028–1037. 49. Mars WM, Liu ML, Kitson RP, et al. Immediate early detection of urokinase receptor after partial hepatectomy and its implications for initiation of liver regeneration. Hepatology. 1995;21:1695–1701. 50. Pediaditakis P, Lopez-Talavera JC, Petersen B, et al. The processing and utilization of hepatocyte growth factor/scatter factor following partial hepatectomy in the rat. Hepatology. 2001;34:688–693. 51. Stolz DB, Mars WM, Petersen BE, et al. Growth factor signal transduction immediately after two-thirds partial hepatectomy in the rat. Cancer Res. 1999;59:3954–3960. 52. Skov Olsen P, Boesby S, Kirkegaard P, et al. Influence of epidermal growth factor on liver regeneration after partial hepatectomy in rats. Hepatology. 1988;8:992–996. 53. Monga SP, Pediaditakis P, Mule K, et al. Changes in WNT/betacatenin pathway during regulated growth in rat liver regeneration. Hepatology. 2001;33:1098–1109.

413

Part IV


54. Sekine S, Gutierrez PJ, Lan BY, et al. Liver-specific loss of betacatenin results in delayed hepatocyte proliferation after partial hepatectomy. Hepatology. 2007;45:361–368. 55. Sodhi D, Micsenyi A, Bowen WC, et al. Morpholino oligonucleotide-triggered beta-catenin knockdown compromises normal liver regeneration. J Hepatol. 2005;43:132–141. 56. Tan X, Behari J, Cieply B, et al. Conditional deletion of betacatenin reveals its role in liver growth and regeneration. Gastroenterology. 2006;131:1561–1572. 57. Croquelois A, Blindenbacher A, Terracciano L, et al. Inducible inactivation of Notch1 causes nodular regenerative hyperplasia in mice. Hepatology. 2005;41:487–496. 58. Kohler C, Bell AW, Bowen WC, et al. Expression of Notch-1 and its ligand Jagged-1 in rat liver during liver regeneration. Hepatology. 2004;39:1056–1065. 59. Cruise JL, Knechtle SJ, Bollinger RR, et al. Alpha 1-adrenergic effects and liver regeneration. Hepatology. 1987;7:1189–1194. 60. Lesurtel M, Graf R, Aleil B, et al. Platelet-derived serotonin mediates liver regeneration. Science. 2006;312:104–107. 61. Mead JE, Fausto N. Transforming growth factor alpha may be a physiological regulator of liver regeneration by means of an autocrine mechanism. Proc Natl Acad Sci USA. 1989;86: 1558–1562. 62. Russell WE, Dempsey PJ, Sitaric S, et al. Transforming growth factor-alpha (TGF alpha) concentrations increase in regenerating rat liver: Evidence for a delayed accumulation of mature TGF alpha. Endocrinology. 1993;133: 1731–1738. 63. Akerman P, Cote P, Yang SQ, et al. Antibodies to tumor necrosis factor-alpha inhibit liver regeneration after partial hepatectomy. Am J Physiol. 1992;263:G579–585. 64. Yamada Y, Kirillova I, Peschon JJ, et al. Initiation of liver growth by tumor necrosis factor: Deficient liver regeneration in mice lacking type I tumor necrosis factor receptor. Proc Natl Acad Sci USA. 1997;94:1441–1446. 65. Yamada Y, Webber EM, Kirillova I, et al. Analysis of liver regeneration in mice lacking type 1 or type 2 tumor necrosis factor receptor: Requirement for type 1 but not type 2 receptor. Hepatology. 1998;28:959–970. 66. Cressman DE, Greenbaum LE, DeAngelis RA, et al. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science. 1996;274:1379–1383. 67. Sakamoto T, Liu Z, Murase N, et al. Mitosis and apoptosis in the liver of interleukin-6-deficient mice after partial hepatectomy. Hepatology. 1999;29:403–411. 68. Wang X, Kiyokawa H, Dennewitz MB, et al. The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc Natl Acad Sci USA. 2002;99:16881–16886. 69. Huang W, Ma K, Zhang J, et al. Nuclear receptor-dependent bile acid signaling is required for normal liver regeneration. Science. 2006;312:233–236. 70. Kim TH, Mars WM, Stolz DB, et al. Expression and activation of pro-MMP-2 and pro-MMP-9 during rat liver regeneration. Hepatology. 2000;31:75–82. 71. Mohammed FF, Khokha R. Thinking outside the cell: Proteases regulate hepatocyte division. Trends Cell Biol. 2005;15:555–563. 72. Mohammed FF, Pennington CJ, Kassiri Z, et al. Metalloproteinase inhibitor TIMP-1 affects hepatocyte cell cycle via HGF activation in murine liver regeneration. Hepatology. 2005;41: 857–867. 73. Olle EW, Ren X, McClintock SD, et al. Matrix metalloproteinase9 is an important factor in hepatic regeneration after partial hepatectomy in mice. Hepatology. 2006;44:540–549. 74. Asai K, Tamakawa S, Yamamoto M, et al. Activated hepatic stellate cells overexpress p75NTR after partial hepatectomy and undergo apoptosis on nerve growth factor stimulation. Liver Int. 2006;26:595–603. 75. Passino MA, Adams RA, Sikorski SL, et al. Regulation of hepatic stellate cell differentiation by the neurotrophin receptor p75NTR. Science. 2007;315:1853–1856. 76. Jakowlew SB, Mead JE, Danielpour D, et al. Transforming growth factor-beta (TGF-beta) isoforms in rat liver regeneration: Messenger RNA expression and activation of latent TGF-beta. Cell Regul. 1991;2:535–548. 77. Chari RS, Price DT, Sue SR, et al. Down-regulation of transforming growth factor beta receptor type I, II, and III during liver regeneration. Am J Surg. 1995;169:126–131; discussion 131–122.

414

78. Houck KA, Michalopoulos GK. Altered responses of regenerating hepatocytes to norepinephrine and transforming growth factor type beta. J Cell Physiol. 1989;141:503–509. 79. Jirtle RL, Carr BI, Scott CD. Modulation of insulin-like growth factor-II/mannose 6-phosphate receptors and transforming growth factor-beta 1 during liver regeneration. J Biol Chem. 1991;266:22444–22450. 80. Stoick-Cooper CL, Moon RT, Weidinger G. Advances in signaling in vertebrate regeneration as a prelude to regenerative medicine. Genes Dev. 2007;21:1292–1315. 81. Alison M, Golding M, Lalani EN, et al. Wholesale hepatocytic differentiation in the rat from ductular oval cells, the progeny of biliary stem cells. J Hepatol. 1997;26: 343–352. 82. Evarts RP, Hu Z, Omori N, et al. Precursor-product relationship between oval cells and hepatocytes: Comparison between tritiated thymidine and bromodeoxyuridine as tracers. Carcinogenesis. 1996;17:2143–2151. 83. Golding M, Sarraf CE, Lalani EN, et al. Oval cell differentiation into hepatocytes in the acetylaminofluorene-treated regenerating rat liver. Hepatology. 1995;22:1243–1253. 84. Preisegger KH, Factor VM, Fuchsbichler A, et al. Atypical ductular proliferation and its inhibition by transforming growth factor beta1 in the 3,5-diethoxycarbonyl-1,4-dihydrocollidine mouse model for chronic alcoholic liver disease. Lab Invest. 1999;79:103–109. 85. Michalopoulos GK, Barua L, Bowen WC. Transdifferentiation of rat hepatocytes into biliary cells after bile duct ligation and toxic biliary injury. Hepatology. 2005;41:535–544. 86. Michalopoulos GK, Bowen WC, Mule K, et al. Hepatocytes undergo phenotypic transformation to biliary epithelium in organoid cultures. Hepatology. 2002;36:278–283. 87. Walkup MH, Gerber DA. Hepatic stem cells: In search of. Stem Cells. 2006;24:1833–1840. 88. Forbes S, Vig P, Poulsom R, et al. Hepatic stem cells. J Pathol. 2002;197:510–518. 89. Roskams TA, Libbrecht L, Desmet VJ. Progenitor cells in diseased human liver. Semin Liver Dis. 2003;23:385–396. 90. Sell S, Leffert HL. An evaluation of cellular lineages in the pathogenesis of experimental hepatocellular carcinoma. Hepatology. 1982;2:77–86. 91. Tatematsu M, Ho RH, Kaku T, et al. Studies on the proliferation and fate of oval cells in the liver of rats treated with 2-acetylaminofluorene and partial hepatectomy. Am J Pathol. 1984;114:418–430. 92. Akhurst B, Croager EJ, Farley-Roche CA, et al. A modified cholinedeficient, ethionine-supplemented diet protocol effectively induces oval cells in mouse liver. Hepatology. 2001;34:519–522. 93. Fickert P, Stoger U, Fuchsbichler A, et al. A new xenobioticinduced mouse model of sclerosing cholangitis and biliary fibrosis. Am J Pathol. 2007;171:525–536. 94. Yaswen P, Thompson NL, Fausto N. Oncodevelopmental expression of rat placental alkaline phosphatase. Detection in oval cells during liver carcinogenesis. Am J Pathol. 1985;121:505–513. 95. Jelnes P, Santoni-Rugiu E, Rasmussen M, et al. Remarkable heterogeneity displayed by oval cells in rat and mouse models of stem cell-mediated liver regeneration. Hepatology. 2007;45:1462–1470. 96. Roskams T, De Vos R, Desmet V. ‘Undifferentiated progenitor cells’ in focal nodular hyperplasia of the liver. Histopathology. 1996;28:291–299. 97. Roskams T, De Vos R, Van Eyken P, et al. Hepatic OV-6 expression in human liver disease and rat experiments: Evidence for hepatic progenitor cells in man. J Hepatol. 1998;29:455–463. 98. Yovchev MI, Grozdanov PN, Joseph B, et al. Novel hepatic progenitor cell surface markers in the adult rat liver. Hepatology. 2007;45:139–149. 99. Apte U, Thompson MD, Cui S, et al. Wnt/beta-catenin signaling mediates oval cell response in rodents. Hepatology. 2008;47:288–295. 100. Fu XX, Su CY, Lee Y, et al. Insulinlike growth factor II expression and oval cell proliferation associated with hepatocarcinogenesis in woodchuck hepatitis virus carriers. J Virol. 1988;62: 3422–3430. 101. Hu M, Kurobe M, Jeong YJ, et al. Wnt/beta-catenin signaling in murine hepatic transit amplifying progenitor cells. Gastroenterology. 2007;133:1579–1591. 102. Hu Z, Evarts RP, Fujio K, et al. Expression of hepatocyte growth factor and c-met genes during hepatic differentiation and liver development in the rat. Am J Pathol. 1993;142:1823–1830.

Chapter 20 103. Hu Z, Evarts RP, Fujio K, et al. Expression of transforming growth factor alpha/epidermal growth factor receptor, hepatocyte growth factor/c-met and acidic fibroblast growth factor/ fibroblast growth factor receptors during hepatocarcinogenesis. Carcinogenesis. 1996;17:931–938. 104. Isfort RJ, Cody DB, Richards WG, et al. Characterization of growth factor responsiveness and alterations in growth factor homeostasis involved in the tumorigenic conversion of mouse oval cells. Growth Factors. 1998;15:81–94. 105. Knight B, Yeap BB, Yeoh GC, et al. Inhibition of adult liver progenitor (oval) cell growth and viability by an agonist of the peroxisome proliferator activated receptor (PPAR) family member gamma, but not alpha or delta. Carcinogenesis. 2005;26:1782–1792. 106. Matthews VB, Klinken E, Yeoh GC. Direct effects of interleukin-6 on liver progenitor oval cells in culture. Wound Repair Regen. 2004;12:650–656. 107. Nagy P, Bisgaard HC, Santoni-Rugiu E, et al. In vivo infusion of growth factors enhances the mitogenic response of rat hepatic ductal (oval) cells after administration of 2-acetylaminofluorene. Hepatology. 1996;23:71–79. 108. Park DY, Suh KS. Transforming growth factor-beta 1 protein, proliferation and apoptosis of oval cells in acetylaminofluoreneinduced rat liver regeneration. J Korean Med Sci. 1999;14: 531–538. 109. Yeoh GC, Ernst M, Rose-John S, et al. Opposing roles of gp130mediated STAT-3 and ERK-1/2 signaling in liver progenitor cell migration and proliferation. Hepatology. 2007;45:486–494. 110. Zhang N, Siegel K, Odenthal M, et al. The role of insulin-like growth factor II in the malignant transformation of rat liver oval cells. Hepatology. 1997;25:900–905. 111. Fujita M, Furukawa H, Hattori M, et al. Sequential observation of liver cell regeneration after massive hepatic necrosis in auxiliary partial orthotopic liver transplantation. Mod Pathol. 2000;13:152–157. 112. Dorrell C, Grompe M. Liver repair by intra- and extrahepatic progenitors. Stem Cell Rev. 2005;1:61–64. 113. Grompe M. Bone marrow-derived hepatocytes. Novartis Found Symp. 2005;265:20–27. 114. Krause DS. Engraftment of bone marrow-derived epithelial cells. Ann NY Acad Sci. 2005;1044:117–124. 115. Petersen BE, Bowen WC, Patrene KD, et al. Bone marrow as a potential source of hepatic oval cells. Science. 1999;284: 1168–1170. 116. Roskams T, Yang SQ, Koteish A, et al. Oxidative stress and oval cell accumulation in mice and humans with alcoholic and nonalcoholic fatty liver disease. Am J Pathol. 2003;163: 1301–1311. 117. Sell S. Comparison of liver progenitor cells in human atypical ductular reactions with those seen in experimental models of liver injury. Hepatology. 1998;27:317–331. 118. Libbrecht L, Desmet V, Van Damme B, et al. Deep intralobular extension of human hepatic ‘progenitor cells’ correlates with parenchymal inflammation in chronic viral hepatitis: Can ‘progenitor cells’ migrate? J Pathol. 2000;192:373–378. 119. El-Serag HB. Hepatocellular carcinoma: Recent trends in the United States. Gastroenterology. 2004;127:S27–34. 120. McKillop IH, Moran DM, Jin X, et al. Molecular pathogenesis of hepatocellular carcinoma. J Surg Res. 2006;136:125–135. 121. Sell S. Stem cell origin of cancer and differentiation therapy. Crit Rev Oncol Hematol. 2004;51:1–28. 122. Zhang M, Rosen JM. Stem cells in the etiology and treatment of cancer. Curr Opin Genet Dev. 2006;16:60–64. 123. Lee JS, Heo J, Libbrecht L, et al. A novel prognostic subtype of human hepatocellular carcinoma derived from hepatic progenitor cells. Nat Med. 2006;12:410–416. 124. Yin XM, Ding WX. Death receptor activation-induced hepatocyte apoptosis and liver injury. Curr Mol Med. 2003;3:491–508. 125. Ogasawara J, Watanabe-Fukunaga R, Adachi M, et al. Lethal effect of the anti-Fas antibody in mice. Nature. 1993;364:806–809. 126. Ashkenazi A, Dixit VM. Death receptors: Signaling and modulation. Science. 1998;281:1305–1308. 127. de la Coste A, Fabre M, McDonell N, et al. Differential protective effects of Bcl-xL and Bcl-2 on apoptotic liver injury in transgenic mice. Am J Physiol. 1999;277:G702–708. 128. Lacronique V, Mignon A, Fabre M, et al. Bcl-2 protects from lethal hepatic apoptosis induced by an anti-Fas antibody in mice. Nat Med. 1996;2:80–86.


129. Rodriguez I, Matsuura K, Khatib K, et al. A bcl-2 transgene expressed in hepatocytes protects mice from fulminant liver destruction but not from rapid death induced by anti-Fas antibody injection. J Exp Med. 1996;183:1031–1036. 130. Eskes R, Antonsson B, Osen-Sand A, et al. Bax-induced cytochrome C release from mitochondria is independent of the permeability transition pore but highly dependent on Mg2þ ions. J Cell Biol. 1998;143:217–224. 131. Li H, Zhu H, Xu CJ, et al. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell. 1998;94:491–501. 132. Wei MC, Lindsten T, Mootha VK, et al. tBID, a membranetargeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev. 2000;14:2060–2071. 133. Deveraux QL, Reed JC. IAP family proteins—Suppressors of apoptosis. Genes Dev. 1999;13:239–252. 134. Stennicke HR, Jurgensmeier JM, Shin H, et al. Pro-caspase-3 is a major physiologic target of caspase-8. J Biol Chem. 1998;273: 27084–27090. 135. Wang X, DeFrances MC, Dai Y, et al. A mechanism of cell survival: Sequestration of Fas by the HGF receptor Met. Mol Cell. 2002;9:411–421. 136. Zou C, Ma J, Wang X, et al. Lack of Fas antagonism by Met in human fatty liver disease. Nat Med. 2007;13:1078–1085. 137. Kanda D, Takagi H, Toyoda M, et al. Transforming growth factor alpha protects against Fas-mediated liver apoptosis in mice. FEBS Lett. 2002;519:11–15. 138. Kosai K, Matsumoto K, Nagata S, et al. Abrogation of Fasinduced fulminant hepatic failure in mice by hepatocyte growth factor. Biochem Biophys Res Commun. 1998;244:683–690. 139. Freudenberg MA, Keppler D, Galanos C. Requirement for lipopolysaccharide-responsive macrophages in galactosamine-induced sensitization to endotoxin. Infect Immun. 1986;51: 891–895. 140. Leist M, Gantner F, Bohlinger I, et al. Murine hepatocyte apoptosis induced in vitro and in vivo by TNF-alpha requires transcriptional arrest. J Immunol. 1994;153: 1778–1788. 141. Harper N, Hughes M, MacFarlane M, et al. Fas-associated death domain protein and caspase-8 are not recruited to the tumor necrosis factor receptor 1 signaling complex during tumor necrosis factor-induced apoptosis. J Biol Chem. 2003;278:25534–25541. 142. Hsu H, Xiong J, Goeddel DV. The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell. 1995;81:495–504. 143. Guicciardi ME, Deussing J, Miyoshi H, et al. Cathepsin B contributes to TNF-alpha-mediated hepatocyte apoptosis by promoting mitochondrial release of cytochrome c. J Clin Invest. 2000;106:1127–1137. 144. Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death Differ. 2003;10:45–65. 145. Biswas DK, Martin KJ, McAlister C, et al. Apoptosis caused by chemotherapeutic inhibition of nuclear factor-kappaB activation. Cancer Res. 2003;63:290–295. 146. LaCasse EC, Baird S, Korneluk RG, et al. The inhibitors of apoptosis (IAPs) and their emerging role in cancer. Oncogene. 1998;17:3247–3259. 147. McDonald MC, Mota-Filipe H, Paul A, et al. Calpain inhibitor I reduces the activation of nuclear factor-kappaB and organ injury/dysfunction in hemorrhagic shock. Faseb J. 2001;15:171– 186. 148. Lee HH, Dadgostar H, Cheng Q, et al. NF-kappaB-mediated upregulation of Bcl-x and Bfl-1/A1 is required for CD40 survival signaling in B lymphocytes. Proc Natl Acad Sci USA. 1999;96:9136–9141. 149. Hoeflich KP, Luo J, Rubie EA, et al. Requirement for glycogen synthase kinase-3 beta in cell survival and NF-kappaB activation. Nature. 2000;406:86–90. 150. Bonnard M, Mirtsos C, Suzuki S, et al. Deficiency of T2K leads to apoptotic liver degeneration and impaired NF-kappaBdependent gene transcription. Embo J. 2000;19:4976–4985. 151. Doi TS, Marino MW, Takahashi T, et al. Absence of tumor necrosis factor rescues RelA-deficient mice from embryonic lethality. Proc Natl Acad Sci USA. 1999;96:2994–2999. 152. Neuschwander-Tetri BA, Caldwell SH. Nonalcoholic steatohepatitis: Summary of an AASLD Single Topic Conference. Hepatology. 2003;37:1202–1219.

415

Part IV


153. Angulo P. Nonalcoholic fatty liver disease. N Engl J Med. 2002; 346:1221–1231. 154. Marchesini G, Bugianesi E, Forlani G, et al. Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome. Hepatology. 2003;37:917–923. 155. Clark JM, Brancati FL, Diehl AM. The prevalence and etiology of elevated aminotransferase levels in the United States. Am J Gastroenterol. 2003;98:960–967. 156. Day CP, James OF. Steatohepatitis: A tale of two "hits"? Gastroenterology. 1998;114:842–845. 157. Shepherd PR, Kahn BB. Glucose transporters and insulin action—Implications for insulin resistance and diabetes mellitus. N Engl J Med. 1999;341:248–257. 158. Bugianesi E, Gastaldelli A, Vanni E, et al. Insulin resistance in non-diabetic patients with non-alcoholic fatty liver disease: Sites and mechanisms. Diabetologia. 2005;48:634–642. 159. Seppala-Lindroos A, Vehkavaara S, Hakkinen AM, et al. Fat accumulation in the liver is associated with defects in insulin suppression of glucose production and serum free fatty acids independent of obesity in normal men. J Clin Endocrinol Metab. 2002;87:3023–3028. 160. Araya J, Rodrigo R, Videla LA, et al. Increase in long-chain polyunsaturated fatty acid n - 6/n - 3 ratio in relation to hepatic steatosis in patients with non-alcoholic fatty liver disease. Clin Sci (Lond). 2004;106:635–643. 161. Shimomura I, Shimano H, Korn BS, et al. Nuclear sterol regulatory element-binding proteins activate genes responsible for the entire program of unsaturated fatty acid biosynthesis in transgenic mouse liver. J Biol Chem. 1998;273:35299–35306. 162. Kawaguchi T, Osatomi K, Yamashita H, et al. Mechanism for fatty acid "sparing" effect on glucose-induced transcription: Regulation of carbohydrate-responsive element-binding protein by AMP-activated protein kinase. J Biol Chem. 2002;277:3829– 3835. 163. Yamashita H, Takenoshita M, Sakurai M, et al. A glucose-responsive transcription factor that regulates carbohydrate metabolism in the liver. Proc Natl Acad Sci USA. 2001;98:9116–9121. 164. Iizuka K, Bruick RK, Liang G, et al. Deficiency of carbohydrate response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis. Proc Natl Acad Sci USA. 2004;101:7281– 7286. 165. Brown MS, Goldstein JL. The SREBP pathway: Regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell. 1997;89:331–340. 166. Horton JD, Goldstein JL, Brown MS. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest. 2002;109:1125–1131. 167. Horton JD, Shah NA, Warrington JA, et al. Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci USA. 2003;100:12027–12032. 168. Shimano H, Horton JD, Shimomura I, et al. Isoform 1c of sterol regulatory element binding protein is less active than isoform 1a in livers of transgenic mice and in cultured cells. J Clin Invest. 1997;99:846–854. 169. Yahagi N, Shimano H, Hasty AH, et al. Absence of sterol regulatory element-binding protein-1 (SREBP-1) ameliorates fatty livers but not obesity or insulin resistance in Lep(ob)/Lep (ob) mice. J Biol Chem. 2002;277:19353–19357. 170. Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP-1c associated with fatty livers in two mouse models of diabetes mellitus. J Biol Chem. 1999;274:30028–30032. 171. Gastaldelli A, Miyazaki Y, Pettiti M, et al. The effect of rosiglitazone on the liver: Decreased gluconeogenesis in patients with type 2 diabetes. J Clin Endocrinol Metab. 2006;91:806–812. 172. Utzschneider KM, Kahn SE. Review: The role of insulin resistance in nonalcoholic fatty liver disease. J Clin Endocrinol Metab. 2006;91:4753–4761. 173. Yamaguchi K, Yang L, McCall S, et al. Inhibiting triglyceride synthesis improves hepatic steatosis but exacerbates liver damage and fibrosis in obese mice with nonalcoholic steatohepatitis. Hepatology. 2007;45:1366–1374. 174. Chao L, Marcus-Samuels B, Mason MM, et al. Adipose tissue is required for the antidiabetic, but not for the hypolipidemic, effect of thiazolidinediones. J Clin Invest. 2000;106:1221–1228.

416

175. Edvardsson U, Bergstrom M, Alexandersson M, et al. Rosiglitazone (BRL49653), a PPARgamma-selective agonist, causes peroxisome proliferator-like liver effects in obese mice. J Lipid Res. 1999;40:1177–1184. 176. Robertson G, Leclercq I, Farrell GC. Nonalcoholic steatosis and steatohepatitis. II. Cytochrome P-450 enzymes and oxidative stress. Am J Physiol Gastrointest Liver Physiol. 2001;281:G1135–1139. 177. Schwabe RF, Brenner DA. Nuclear factor-kappaB in the liver: Friend or foe? Gastroenterology. 2007;132:2601–2604. 178. Xu Z, Chen L, Leung L, et al. Liver-specific inactivation of the Nrf1 gene in adult mouse leads to nonalcoholic steatohepatitis and hepatic neoplasia. Proc Natl Acad Sci USA. 2005;102:4120–4125. 179. Sanyal AJ, Campbell-Sargent C, Mirshahi F, et al. Nonalcoholic steatohepatitis: Association of insulin resistance and mitochondrial abnormalities. Gastroenterology. 2001;120:1183–1192. 180. Seki S, Kitada T, Yamada T, et al. In situ detection of lipid peroxidation and oxidative DNA damage in non-alcoholic fatty liver diseases. J Hepatol. 2002;37:56–62. 181. Sumida Y, Nakashima T, Yoh T, et al. Serum thioredoxin levels as a predictor of steatohepatitis in patients with nonalcoholic fatty liver disease. J Hepatol. 2003;38:32–38. 182. Yesilova Z, Yaman H, Oktenli C, et al. Systemic markers of lipid peroxidation and antioxidants in patients with nonalcoholic fatty liver disease. Am J Gastroenterol. 2005;100:850–855. 183. Esterbauer H, Schaur RJ, Zollner H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991;11:81–128. 184. Gardner HW. Oxygen radical chemistry of polyunsaturated fatty acids. Free Radic Biol Med. 1989;7:65–86. 185. Infante JP, Huszagh VA. Secondary carnitine deficiency and impaired docosahexaenoic (22:6n-3) acid synthesis: A common denominator in the pathophysiology of diseases of oxidative phosphorylation and beta-oxidation. FEBS Lett. 2000;468:1–5. 186. Pan M, Cederbaum AI, Zhang YL, et al. Lipid peroxidation and oxidant stress regulate hepatic apolipoprotein B degradation and VLDL production. J Clin Invest. 2004;113:1277–1287. 187. Wagner BA, Buettner GR, Burns CP. Free radical-mediated lipid peroxidation in cells: Oxidizability is a function of cell lipid bis-allylic hydrogen content. Biochemistry. 1994;33: 4449–4453. 188. Caldwell SH, Swerdlow RH, Khan EM, et al. Mitochondrial abnormalities in non-alcoholic steatohepatitis. J Hepatol. 1999;31: 430–434. 189. Cortez-Pinto H, Chatham J, Chacko VP, et al. Alterations in liver ATP homeostasis in human nonalcoholic steatohepatitis: A pilot study. JAMA. 1999;282:1659–1664. 190. Perez-Carreras M, Del Hoyo P, Martin MA, et al. Defective hepatic mitochondrial respiratory chain in patients with nonalcoholic steatohepatitis. Hepatology. 2003;38:999–1007. 191. Pessayre D. Role of mitochondria in non-alcoholic fatty liver disease. J Gastroenterol Hepatol. 2007;22(Suppl 1):S20–27. 192. Garcia-Ruiz C, Colell A, Morales A, et al. Role of oxidative stress generated from the mitochondrial electron transport chain and mitochondrial glutathione status in loss of mitochondrial function and activation of transcription factor nuclear factor-kappa B: Studies with isolated mitochondria and rat hepatocytes. Mol Pharmacol. 1995;48:825–834. 193. Hensley K, Kotake Y, Sang H, et al. Dietary choline restriction causes complex I dysfunction and increased H2O2 generation in liver mitochondria. Carcinogenesis. 2000;21:983–989. 194. Berson A, De Beco V, Letteron P, et al. Steatohepatitis-inducing drugs cause mitochondrial dysfunction and lipid peroxidation in rat hepatocytes. Gastroenterology. 1998;114:764–774. 195. Johnson EF, Palmer CN, Griffin KJ, et al. Role of the peroxisome proliferator-activated receptor in cytochrome P450 4A gene regulation. Faseb J. 1996;10:1241–1248. 196. Kersten S, Seydoux J, Peters JM, et al. Peroxisome proliferatoractivated receptor alpha mediates the adaptive response to fasting. J Clin Invest. 1999; 103:1489–1498. 197. Tonsgard JH, Getz GS. Effect of Reye’s syndrome serum on isolated chinchilla liver mitochondria. J Clin Invest. 1985; 76:816–825. 198. Dela Pena A, Leclercq I, Field J, et al. NF-kappaB activation, rather than TNF, mediates hepatic inflammation in a murine dietary model of steatohepatitis. Gastroenterology. 2005;129:1663–1674.

Chapter 20 199. Cai D, Yuan M, Frantz DF, et al. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NFkappaB. Nat Med. 2005;11:183–190. 200. Luedde T, Beraza N, Kotsikoris V, et al. Deletion of NEMO/IKKgamma in liver parenchymal cells causes steatohepatitis and hepatocellular carcinoma. Cancer Cell. 2007;11:119–132. 201. Schattenberg JM, Singh R, Wang Y, et al. JNK1 but not JNK2 promotes the development of steatohepatitis in mice. Hepatology. 2006;43:163–172. 202. Crespo J, Cayon A, Fernandez-Gil P, et al. Gene expression of tumor necrosis factor alpha and TNF-receptors, p55 and p75, in nonalcoholic steatohepatitis patients. Hepatology. 2001;34: 1158–1163. 203. Haukeland JW, Damas JK, Konopski Z, et al. Systemic inflammation in nonalcoholic fatty liver disease is characterized by elevated levels of CCL2. J Hepatol. 2006;44:1167–1174. 204. Li Z, Yang S, Lin H, et al. Probiotics and antibodies to TNF inhibit inflammatory activity and improve nonalcoholic fatty liver disease. Hepatology. 2003;37:343–350. 205. Choudhury J, Sanyal AJ. Insulin resistance in NASH. Front Biosci. 2005;10:1520–1533. 206. Diehl AM, Li ZP, Lin HZ, et al. Cytokines and the pathogenesis of non-alcoholic steatohepatitis. Gut. 2005;54:303–306. 207. Chitturi S, Farrell G, Frost L, et al. Serum leptin in NASH correlates with hepatic steatosis but not fibrosis: A manifestation of lipotoxicity? Hepatology. 2002;36:403–409. 208. Kaser S, Moschen A, Cayon A, et al. Adiponectin and its receptors in non-alcoholic steatohepatitis. Gut. 2005;54:117–121. 209. Musso G, Gambino R, Biroli G, et al. Hypoadiponectinemia predicts the severity of hepatic fibrosis and pancreatic Beta-cell dysfunction in nondiabetic nonobese patients with nonalcoholic steatohepatitis. Am J Gastroenterol. 2005;100:2438–2446. 210. Bugianesi E, McCullough AJ, Marchesini G. Insulin resistance: A metabolic pathway to chronic liver disease. Hepatology. 2005;42:987–1000. 211. Vettor R, Milan G, Rossato M, et al. Review article: Adipocytokines and insulin resistance. Aliment Pharmacol Ther. 2005;22 (Suppl 2):3–10. 212. Maeda N, Shimomura I, Kishida K, et al. Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nat Med. 2002;8:731–737. 213. Feldstein AE, Canbay A, Angulo P, et al. Hepatocyte apoptosis and fas expression are prominent features of human nonalcoholic steatohepatitis. Gastroenterology. 2003;125:437–443. 214. Nechushtan A, Smith CL, Lamensdorf I, et al. Bax and Bak coalesce into novel mitochondria-associated clusters during apoptosis. J Cell Biol. 2001;153:1265–1276. 215. Feldmann G, Haouzi D, Moreau A, et al. Opening of the mitochondrial permeability transition pore causes matrix expansion and outer membrane rupture in Fas-mediated hepatic apoptosis in mice. Hepatology. 2000;31:674–683. 216. Chedid A, Mendenhall CL, Gartside P, et al. Prognostic factors in alcoholic liver disease. VA Cooperative Study Group. Am J Gastroenterol. 1991;86:210–216. 217. Sass DA, Shaikh OS. Alcoholic hepatitis. Clin Liver Dis. 2006;10:219–237. 218. Lieber CS. Alcohol and the liver: Metabolism of alcohol and its role in hepatic and extrahepatic diseases. Mt Sinai J Med. 2000;67:84–94. 219. Lieber CS, Schmid R. The effect of ethanol on fatty acid metabolism; stimulation of hepatic fatty acid synthesis in vitro. J Clin Invest. 1961;40:394–399. 220. Thurman RG. II. Alcoholic liver injury involves activation of Kupffer cells by endotoxin. Am J Physiol. 1998;275:G605–G611. 221. Dey A, Cederbaum AI. Alcohol and oxidative liver injury. Hepatology. 2006;43:S63–74. 222. Lieber CS. Cytochrome P-4502E1: Its physiological and pathological role. Physiol Rev. 1997;77:517–544. 223. Tilg H, Diehl AM. Cytokines in alcoholic and nonalcoholic steatohepatitis. N Engl J Med. 2000;343:1467–1476. 224. Reddy JK, Rao MS. Lipid metabolism and liver inflammation. II. Fatty liver disease and fatty acid oxidation. Am J Physiol Gastrointest Liver Physiol. 2006;290:G852–858. 225. Li J, Hu W, Baldassare JJ, et al. The ethanol metabolite, linolenic acid ethyl ester, stimulates mitogen-activated protein kinase

226. 227. 228. 229.

230. 231. 232.

233. 234.

235. 236. 237. 238.

239.

240.

241.

242.

243. 244. 245.

246. 247.


and cyclin signaling in hepatic stellate cells. Life Sci. 2003;73: 1083–1096. Desvergne B, Michalik L, Wahli W. Transcriptional regulation of metabolism. Physiol Rev. 2006;86:465–514. Michalik L, Auwerx J, Berger JP, et al. International Union of Pharmacology. LXI. Peroxisome proliferator-activated receptors. Pharmacol Rev. 2006;58:726–741. Rao MS, Reddy JK. Peroxisomal beta-oxidation and steatohepatitis. Semin Liver Dis. 2001;21:43–55. Galli A, Pinaire J, Fischer M, et al. The transcriptional and DNA binding activity of peroxisome proliferator-activated receptor alpha is inhibited by ethanol metabolism. A novel mechanism for the development of ethanol-induced fatty liver. J Biol Chem. 2001;276:68–75. Horton JD, Shimomura I. Sterol regulatory element-binding proteins: Activators of cholesterol and fatty acid biosynthesis. Curr Opin Lipidol. 1999;10:143–150. You M, Fischer M, Deeg MA, et al. Ethanol induces fatty acid synthesis pathways by activation of sterol regulatory elementbinding protein (SREBP). J Biol Chem. 2002;277: 29342–29347. Ji C, Chan C, Kaplowitz N. Predominant role of sterol response element binding proteins (SREBP) lipogenic pathways in hepatic steatosis in the murine intragastric ethanol feeding model. J Hepatol. 2006;45:717–724. Ji C, Kaplowitz N. Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol-fed mice. Gastroenterology. 2003;124:1488–1499. Shklyaev S, Aslanidi G, Tennant M, et al. Sustained peripheral expression of transgene adiponectin offsets the development of diet-induced obesity in rats. Proc Natl Acad Sci USA. 2003;100:14217–14222. Zhou G, Myers R, Li Y, et al. Role of AMP-activated protein kinase in mechanism of metformin action. J Clin Invest. 2001;108:1167–1174. You M, Matsumoto M, Pacold CM, et al. The role of AMP-activated protein kinase in the action of ethanol in the liver. Gastroenterology. 2004;127:1798–1808. Xu A, Wang Y, Keshaw H, et al. The fat-derived hormone adiponectin alleviates alcoholic and nonalcoholic fatty liver diseases in mice. J Clin Invest. 2003; 112:91–100. Kang L, Chen X, Sebastian BM, et al. Chronic ethanol and triglyceride turnover in white adipose tissue in rats: Inhibition of the anti-lipolytic action of insulin after chronic ethanol contributes to increased triglyceride degradation. J Biol Chem. 2007;282:28465–28473. Lawler Jr JF, Yin M, Diehl AM, et al. Tumor necrosis factoralpha stimulates the maturation of sterol regulatory element binding protein-1 in human hepatocytes through the action of neutral sphingomyelinase. J Biol Chem. 1998;273:5053–5059. Thakur V, Pritchard MT, McMullen MR, et al. Adiponectin normalizes LPS-stimulated TNF-alpha production by rat Kupffer cells after chronic ethanol feeding. Am J Physiol Gastrointest Liver Physiol. 2006;290:G998–1007. Thakur V, Pritchard MT, McMullen MR, et al. Chronic ethanol feeding increases activation of NADPH oxidase by lipopolysaccharide in rat Kupffer cells: Role of increased reactive oxygen in LPS-stimulated ERK1/2 activation and TNF-alpha production. J Leukoc Biol. 2006;79:1348–1356. Li M, Carpio DF, Zheng Y, et al. An essential role of the NFkappa B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J Immunol. 2001;166:7128–7135. Hui AY, Friedman SL. Molecular basis of hepatic fibrosis. Expert Rev Mol Med. 2003;5:1–23. Tsukada S, Parsons CJ, Rippe RA. Mechanisms of liver fibrosis. Clin Chim Acta. 2006;364:33–60. Albano E, Clot P, Morimoto M, et al. Role of cytochrome P4502E1dependent formation of hydroxyethyl free radical in the development of liver damage in rats intragastrically fed with ethanol. Hepatology. 1996;23:155–163. Knecht KT, Bradford BU, Mason RP, et al. In vivo formation of a free radical metabolite of ethanol. Mol Pharmacol. 1990;38:26–30. Anania FA, Potter JJ, Rennie-Tankersley L, et al. Effects of acetaldehyde on nuclear protein binding to the nuclear factor I

417

Part IV

248. 249. 250.

251.

252. 253. 254. 255. 256. 257. 258. 259. 260. 261. 262.

263.

264.

265.

266. 267. 268. 269. 270. 271.


consensus sequence in the alpha 2(I) collagen promoter. Hepatology. 1995;21:1640–1648. Pares A, Potter JJ, Rennie L, et al. Acetaldehyde activates the promoter of the mouse alpha 2(I) collagen gene. Hepatology. 1994;19:498–503. Kono H, Rusyn I, Yin M, et al. NADPH oxidase-derived free radicals are key oxidants in alcohol-induced liver disease. J Clin Invest. 2000;106:867–872. Starkel P, Sempoux C, Leclercq I, et al. Oxidative stress, KLF6 and transforming growth factor-beta up-regulation differentiate non-alcoholic steatohepatitis progressing to fibrosis from uncomplicated steatosis in rats. J Hepatol. 2003;39:538–546. Svegliati-Baroni G, Candelaresi C, Saccomanno S, et al. A model of insulin resistance and nonalcoholic steatohepatitis in rats: Role of peroxisome proliferator-activated receptoralpha and n-3 polyunsaturated fatty acid treatment on liver injury. Am J Pathol. 2006;169:846–860. Pinzani M, Marra F. Cytokine receptors and signaling in hepatic stellate cells. Semin Liver Dis. 2001;21:397–416. Pinzani M. PDGF and signal transduction in hepatic stellate cells. Front Biosci. 2002;7:d1720–1726. Schnabl B, Bradham CA, Bennett BL, et al. TAK1/JNK and p38 have opposite effects on rat hepatic stellate cells. Hepatology. 2001;34:953–963. Friedman SL. Cytokines and fibrogenesis. Semin Liver Dis. 1999;19:129–140. Ratziu V, Lalazar A, Wong L, et al. Zf9, a Kruppel-like transcription factor up-regulated in vivo during early hepatic fibrosis. Proc Natl Acad Sci USA. 1998;95:9500–9505. Abou-Shady M, Friess H, Zimmermann A, et al. Connective tissue growth factor in human liver cirrhosis. Liver. 2000;20:296–304. Paradis V, Dargere D, Bonvoust F, et al. Effects and regulation of connective tissue growth factor on hepatic stellate cells. Lab Invest. 2002;82:767–774. Kon K, Ikejima K, Hirose M, et al. Pioglitazone prevents earlyphase hepatic fibrogenesis caused by carbon tetrachloride. Biochem Biophys Res Commun. 2002;291:55–61. Sun K, Wang Q, Huang XH. PPAR gamma inhibits growth of rat hepatic stellate cells and TGF beta-induced connective tissue growth factor expression. Acta Pharmacol Sin. 2006;27:715–723. Tsukamoto H. Adipogenic phenotype of hepatic stellate cells. Alcohol Clin Exp Res. 2005;29:132S–133S. Xu J, Fu Y, Chen A. Activation of peroxisome proliferatoractivated receptor-gamma contributes to the inhibitory effects of curcumin on rat hepatic stellate cell growth. Am J Physiol Gastrointest Liver Physiol. 2003;285:G20–30. Imai K, Sato M, Kojima N, et al. Storage of lipid droplets in and production of extracellular matrix by hepatic stellate cells (vitamin A-storing cells) in Long-Evans cinnamon-like colored (LEC) rats. Anat Rec. 2000;258:338–348. Senoo H, Imai K, Matano Y, et al. Molecular mechanisms in the reversible regulation of morphology, proliferation and collagen metabolism in hepatic stellate cells by the three-dimensional structure of the extracellular matrix. J Gastroenterol Hepatol. 1998;13(Suppl):S19–32. Marra F, Efsen E, Romanelli RG, et al. Ligands of peroxisome proliferator-activated receptor gamma modulate profibrogenic and proinflammatory actions in hepatic stellate cells. Gastroenterology. 2000;119:466–478. Ohata M, Lin M, Satre M, et al. Diminished retinoic acid signaling in hepatic stellate cells in cholestatic liver fibrosis. Am J Physiol. 1997;272:G589–596. Schuppan D, Afdhal NH. Liver cirrhosis. Lancet. 2008;371: 838–851. Falleti E, Fabris C, Toniutto P, et al. Genetic polymorphisms of inflammatory cytokines and liver fibrosis progression due to recurrent hepatitis C. J Interferon Cytokine Res. 2007;27:239–246. Huang H, Shiffman ML, Cheung RC, et al. Identification of two gene variants associated with risk of advanced fibrosis in patients with chronic hepatitis C. Gastroenterology. 2006;130: 1679–1687. Choi BY, Nguyen MH. The diagnosis and management of benign hepatic tumors. J Clin Gastroenterol. 2005;39:401–412. Duff B, Weigel JA, Bourne P, et al. Endothelium in hepatic cavernous hemangiomas does not express the hyaluronan receptor for endocytosis. Hum Pathol. 2002;33: 265–269.

418

272. Kim GE, Thung SN, Tsui WM, et al. Hepatic cavernous hemangioma: Underrecognized associated histologic features. Liver Int. 2006;26:334–338. 273. Rebouissou S, Bioulac-Sage P, Zucman-Rossi J. Molecular pathogenesis of focal nodular hyperplasia and hepatocellular adenoma. J Hepatol. 2008;48:163–170. 274. Rebouissou S, Couchy G, Libbrecht L, et al. The beta-catenin pathway is activated in focal nodular hyperplasia but not in cirrhotic FNH-like nodules. J Hepatol. 2008;49:61–71. 275. Chen YW, Jeng YM, Yeh SH, et al. P53 gene and Wnt signaling in benign neoplasms: Beta-catenin mutations in hepatic adenoma but not in focal nodular hyperplasia. Hepatology. 2002;36:927–935. 276. Monga SP, Mars WM, Pediaditakis P, et al. Hepatocyte growth factor induces Wnt-independent nuclear translocation of betacatenin after Met-beta-catenin dissociation in hepatocytes. Cancer Res. 2002;62:2064–2071. 277. Bioulac-Sage P, Rebouissou S, Sa Cunha A, et al. Clinical, morphologic, and molecular features defining so-called telangiectatic focal nodular hyperplasias of the liver. Gastroenterology. 2005;128:1211–1218. 278. Monga SP. Hepatic adenomas: Presumed innocent until proven to be beta-catenin mutated. Hepatology. 2006;43:401–404. 279. Zucman-Rossi J, Jeannot E, Nhieu JT, et al. Genotype-phenotype correlation in hepatocellular adenoma: New classification and relationship with HCC. Hepatology. 2006;43:515–524. 280. Lee YH, Sauer B, Gonzalez FJ. Laron dwarfism and non-insulindependent diabetes mellitus in the Hnf-1alpha knockout mouse. Mol Cell Biol. 1998;18:3059–3068. 281. Shih DQ, Bussen M, Sehayek E, et al. Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism. Nat Genet. 2001;27:375–382. 282. Rebouissou S, Imbeaud S, Balabaud C, et al. HNF1alpha inactivation promotes lipogenesis in human hepatocellular adenoma independently of SREBP-1 and carbohydrate-response elementbinding protein (ChREBP) activation. J Biol Chem. 2007;282: 14437–14446. 283. Torbenson M, Lee JH, Choti M, et al. Hepatic adenomas: Analysis of sex steroid receptor status and the Wnt signaling pathway. Mod Pathol. 2002;15:189–196. 284. Weinberg AG, Finegold MJ. Primary hepatic tumors of childhood. Hum Pathol. 1983;14:512–537. 285. Perilongo G, Shafford EA. Liver tumours. Eur J Cancer. 1999;35:953–958; discussion 958–959. 286. DeBaun MR, Tucker MA. Risk of cancer during the first four years of life in children from The Beckwith-Wiedemann Syndrome Registry. J Pediatr. 1998;132:398–400. 287. Giardiello FM, Offerhaus GJ, Krush AJ, et al. Risk of hepatoblastoma in familial adenomatous polyposis. J Pediatr. 1991;119: 766–768. 288. Buendia MA. Genetic alterations in hepatoblastoma and hepatocellular carcinoma: Common and distinctive aspects. Med Pediatr Oncol. 2002;39:530–535. 289. Laurent-Puig P, Zucman-Rossi J. Genetics of hepatocellular tumors. Oncogene. 2006;25:3778–3786. 290. Nejak-Bowen K, Monga SP. Wnt/beta-catenin signaling in hepatic organogenesis. Organogenesis. 2008;4. 291. Thompson MD, Monga SP. WNT/beta-catenin signaling in liver health and disease. Hepatology. 2007;45:1298–1305. 292. Blaker H, Hofmann WJ, Rieker RJ, et al. Beta-catenin accumulation and mutation of the CTNNB1 gene in hepatoblastoma. Genes Chromosomes Cancer. 1999;25:399–402. 293. Koch A, Denkhaus D, Albrecht S, et al. Childhood hepatoblastomas frequently carry a mutated degradation targeting box of the beta-catenin gene. Cancer Res. 1999;59:269–273. 294. Taniguchi K, Roberts LR, Aderca IN, et al. Mutational spectrum of beta-catenin, AXIN1, and AXIN2 in hepatocellular carcinomas and hepatoblastomas. Oncogene. 2002;21:4863–4871. 295. Udatsu Y, Kusafuka T, Kuroda S, et al. High frequency of betacatenin mutations in hepatoblastoma. Pediatr Surg Int. 2001;17:508–512. 296. Giardiello FM, Petersen GM, Brensinger JD, et al. Hepatoblastoma and APC gene mutation in familial adenomatous polyposis. Gut. 1996;39:867–869. 297. Behari J, Zeng G, Otruba W, et al. R-Etodolac decreases betacatenin levels along with survival and proliferation of hepatoma cells. J Hepatol. 2007;46:849–857.

Chapter 20 298. Kuroda T, Rabkin SD, Martuza RL. Effective treatment of tumors with strong beta-catenin/T-cell factor activity by transcriptionally targeted oncolytic herpes simplex virus vector. Cancer Res. 2006;66:10127–10135. 299. Sangkhathat S, Kusafuka T, Miao J, et al. In vitro RNA interference against beta-catenin inhibits the proliferation of pediatric hepatic tumors. Int J Oncol. 2006;28:715–722. 300. Zeng G, Apte U, Cieply B, et al. siRNA-mediated beta-catenin knockdown in human hepatoma cells results in decreased growth and survival. Neoplasia. 2007;9:951–959. 301. Parkin DM, Bray F, Ferlay J, et al. Global cancer statistics, 2002. CA Cancer J Clin. 2005;55:74–108. 302. Bergsland EK, Venook AP. Hepatocellular carcinoma. Curr Opin Oncol. 2000;12:357–361. 303. Friedman SL. Mechanisms of hepatic fibrogenesis. Gastroenterology. 2008;134:1655–1669. 304. Villanueva A, Newell P, Chiang DY, et al. Genomics and signaling pathways in hepatocellular carcinoma. Semin Liver Dis. 2007;27:55–76. 305. Sell S, Leffert HL. Liver cancer stem cells. J Clin Oncol. 2008;26:2800–2805. 306. Tsuneyama K, Kaizaki Y, Doden K, et al. Combined hepatocellular and cholangiocarcinoma with marked squamous cell carcinoma components arising in non-cirrhotic liver. Pathol Int. 2003;53:90–97. 307. Furuse J. Growth factors as therapeutic targets in HCC. Crit Rev Oncol Hematol. 2008;67:8–15. 308. Llovet JM, Di Bisceglie AM, Bruix J, et al. Design and endpoints of clinical trials in hepatocellular carcinoma. J Natl Cancer Inst. 2008;100:698–711. 309. Smela ME, Currier SS, Bailey EA, et al. The chemistry and biology of aflatoxin B1: From mutational spectrometry to carcinogenesis. Carcinogenesis. 2001;22:535–545. 310. Shimizu Y, Zhu JJ, Han F, et al. Different frequencies of p53 codon-249 hot-spot mutations in hepatocellular carcinomas in Jiang-su province of China. Int J Cancer. 1999;82:187–190.


311. Vautier G, Bomford AB, Portmann BC, et al. p53 mutations in British patients with hepatocellular carcinoma: Clustering in genetic hemochromatosis. Gastroenterology. 1999;117:154–160. 312. Edamoto Y, Hara A, Biernat W, et al. Alterations of RB1, p53 and Wnt pathways in hepatocellular carcinomas associated with hepatitis C, hepatitis B and alcoholic liver cirrhosis. Int J Cancer. 2003;106:334–341. 313. Huang H, Fujii H, Sankila A, et al. Beta-catenin mutations are frequent in human hepatocellular carcinomas associated with hepatitis C virus infection. Am J Pathol. 1999;155:1795–1801. 314. Street A, Macdonald A, McCormick C, et al. Hepatitis C virus NS5A-mediated activation of phosphoinositide 3-kinase results in stabilization of cellular beta-catenin and stimulation of beta-catenin-responsive transcription. J Virol. 2005;79: 5006–5016. 315. Craig JR, Peters RL, Edmondson HA, et al. Fibrolamellar carcinoma of the liver: A tumor of adolescents and young adults with distinctive clinico-pathologic features. Cancer. 1980;46:372–379. 316. El-Serag HB, Davila JA. Is fibrolamellar carcinoma different from hepatocellular carcinoma? A US population-based study. Hepatology. 2004;39:798–803. 317. Katzenstein HM, Krailo MD, Malogolowkin MH, et al. Fibrolamellar hepatocellular carcinoma in children and adolescents. Cancer. 2003;97:2006–2012. 318. Terracciano L, Tornillo L. Cytogenetic alterations in liver cell tumors as detected by comparative genomic hybridization. Pathologica. 2003;95:71–82. 319. Marchio A, Pineau P, Meddeb M, et al. Distinct chromosomal abnormality pattern in primary liver cancer of non-B, non-C patients. Oncogene. 2000;19:3733–3738. 320. Buckley AF, Burgart LJ, Kakar S. Epidermal growth factor receptor expression and gene copy number in fibrolamellar hepatocellular carcinoma. Hum Pathol. 2006;37:410–414.

419


C h a p t e r

21 Molecular Basis of Diseases of the Exocrine Pancreas Matthias Sendler

ACUTE PANCREATITIS Acute pancreatitis presents clinically as a sudden inflammatory disorder of the pancreas, and is caused by premature intracellular activation of pancreatic proteases leading to (i) self-destruction of acinar cells and (ii) autodigestion of the organ. Necrotic cell debris resulting from this process produces a systemic inflammatory reaction, which may lead to multiorgan failure in due course. The incidence of acute pancreatitis differs regionally from 20 to 120 cases per 100,000 population. Acute pancreatitis varies considerably in severity and can be categorized into two forms of the disease. The majority of cases (85%) present with a mild form of disease, classified as edematous pancreatitis, with absent or only transient extrapancreatic organ failure. In the remaining minority of cases (15%), pancreatitis follows a severe course accompanied by sustained multiorgan failure. This latter form of pancreatitis is commonly referred to as severe or necrotizing pancreatitis. Severe necrotizing pancreatitis is associated with high mortality (10%–20%) and may lead to long-term complications such as the formation of pancreatic pseudocysts or impairment of exocrine and endocrine function of the pancreatic gland. In many patients (approximately 50%) the underlying cause of acute pancreatitis is the migration of a gallstone resulting in obstruction of the pancreatic duct at the papilla of Vater. Development of acute pancreatitis is frequently triggered by alcohol abuse. In 25%–40% of acute pancreatitis patients, increased or excess alcohol consumption is regarded as the cause of the disease. Removal of the underlying disease-causing agent results in complete regeneration of the pancreas and preserved exocrine and endocrine function in the majority of cases. Recurrent attacks of the disease can result from chronic alcohol abuse, repeated gallstone passage, genetic predispositions, sphincter dysfunction, metabolic disorders, or pancreatic duct strictures. All of these factors can contribute to the development of Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

Julia Mayerle

n

Markus M. Lerch

chronic pancreatitis as well. In the remaining cases (10%–20%), no apparent clinical cause or etiology of the disease can be identified. These cases are referred to as idiopathic pancreatitis. It became clear during the last decade that previously unknown genetic factors play a major role in these cases. The initial cellular mechanism causing acute pancreatitis is probably independent of the underlying etiology of the disease [1].

Early Events in Acute Pancreatitis and the Role of Protease Activation Acute pancreatitis is an inflammatory disorder whose pathogenesis is not well understood. The pancreas is known as the enzyme factory of the human organism, producing and secreting large amounts of potentially hazardous digestive enzymes, many of which are synthesized as pro-enzymes known as zymogens. Under physiological conditions the pancreatic digestive enzymes are secreted in response to hormonal stimulation [2]. Activation of the pro-enzymes (or zymogens) requires hydrolytic cleavage of their activation peptide by protease enzymes. After entering the small intestine, the pancreatic zymogen trypsinogen is first activated to trypsin by the intestinal protease enterokinase (or enteropeptidase). Trypsin then proteolytically processes other pancreatic enzymes to their active forms. Under physiological conditions pancreatic proteases remain inactive during synthesis, intracellular transport, secretion from acinar cells, and transit through the pancreatic duct. They are activated only upon reaching the lumen and brush-border of the small intestine (Figure 21.1). More than a century ago, Hans Chiari proposed that the underlying pathophysiological mechanism for the development of pancreatitis was autodigestion of the exocrine pancreatic tissue by proteolytic enzymes [3]. Today, this theory is well accepted. Nevertheless, this theory suggests that disease results 421

Part IV


Figure 21.1 Activation of pancreatic proteases under normal conditions and in disease. (A) The protease activation cascade in the duodenum. Enterokinase activates trypsinogen by proteolytic cleavage of the trypsin activation peptide (TAP), and autoactivation contributes to this process. Trypsin then activates other digestive pro-enzymes in a cascade-like fashion. (B) Within acinar cells, premature activation of trypsinogen by cathepsin B is involved in the setting of the proteolytic cascade. Intracellular trypsin may also activate other digestive pro-enzymes, in spite of presence of the trypsin inhibitor SPINK-1 and the trypsin-degrading enzyme chymotrypsin C.

from the premature intracellular activation of zymogens and that this occurs in the absence of enterokinase. Furthermore, this theory suggests that protease inactivation takes place despite several physiological defense mechanisms, including the synthesis of endogenous protease inhibitors and the storage of proteases in a membrane-confined compartment of zymogen granules. Much of our current knowledge regarding the onset of pancreatitis was not gained from studies involving the human pancreas or patients with pancreatitis, but from animal or isolated cell models [4]. There are several reasons why these models have been used: (i) the pancreas is a rather inaccessible organ because of its anatomical location in the retroperitoneal space (unlike in the colon or stomach, biopsies of human pancreas are difficult to obtain for ethical and medical reasons), and (ii) patients who are admitted to the hospital with acute pancreatitis have usually progressed beyond the initial stages of the disease where the 422

triggering early events could have been studied. Particularly, the autodigestive process that characterizes this disease has remained a significant impediment for investigations that address initiating pathophysiological events. Therefore, the issue of premature protease activation has mostly been studied in animal models of the disease and before randomized placebo-controlled trials to evaluate antiproteolytic therapeutic concepts in humans could be performed. Experimental models are now irreplaceable tools in studying etiological factors, pathophysiology, new diagnostic tools, and treatment options for acute pancreatitis [5]. Data from various animal models suggest that after the initial insult a variety of pathophysiological factors determine disease onset. These include (i) a block in secretion, (ii) the co-localization of zymogens with lysosomal enzymes, (iii) the activation of trypsinogen and other zymogens, and (iv) acinar cell injury. In vitro and in vivo studies have demonstrated the importance of premature zymogen activation in the pathogenesis

Chapter 21

of pancreatitis since the inception of the hypothesis by Chiari [6]. The activation of trypsinogen and other pancreatic zymogens can be demonstrated in pancreatic homogenates from experimental animals and this zymogen activation appears to be an early event. Trypsin activity is detected as early as 10 minutes after supramaximal stimulation with the cholecystokinin-analogue cerulein in rats and increases over time. The activation of trypsinogen requires the hydrolytic cleavage of a 7–10 amino acids propeptide called trypsin activation peptide (TAP) on the N-terminus of trypsinogen. Measuring an increase of immunoactive TAP after cerulein-induced pancreatitis in rats showed trypsinogen activation in the secretory compartment of acinar cells [7]. Furthermore, TAP was detected in serum and urine of patients with pancreatitis [8], and the amount of TAP appears to correlate with the severity of the disease [9]. Not only the activity of trypsin increases in the early phase in acute experimental pancreatitis, but also elastase activity [10]. In addition to the activation peptide of trypsinogen (TAP), the activation peptide of carboxypeptidase A1 (PCA1) can also be identified in serum at an early stage of pancreatitis [11]. Premature activation of these proenzymes leads to the development of necrosis and to autodigestion of pancreatic tissues [12–20]. Recent studies defining the localization of early activation of proenzymes suggest that these processes, which lead to pancreatitis and pancreatic tissue necrosis, originate in acinar cells (Figure 21.1) [6,21,22]. Additional evidence for the association between premature protease activation and severity of pancreatitis resulted from experiments with serine-protease inhibitors, where cell injury could be significantly reduced compared to controls [23,24]. On the other hand, protease inhibitors have a protective effect for the prevention of acute pancreatitis only [25]. Therapeutic application of protease inhibitors after the initial disease phase does not result in a significant beneficial effect on survival or severity of the disease [26]. In conclusion, premature intracellular activation of zymogens to active proteases in the secretory compartment of acinar cells results in acinar necrosis and contributes to the onset of pancreatitis. As a direct result of cellular injury, the acinar cells release chemokines and cytokines which initiate the later events in pancreatitis, including recruitment of inflammatory cells into the tissue. Trypsin seems to be the key enzyme in the process of activating other digestive pro-enzymes prematurely, and one of the crucial questions in understanding the pathophysiology of acute pancreatitis is to identify the mechanism which prematurely activates trypsinogen inside acinar cells. However, it must be noted that the term trypsin, as defined by the cleavage of specific synthetic or protein substrates, comprises a group of enzymes whose individual role in the initial activation cascade may differ considerably.

The Mechanism of Zymogen Activation One hypothesis for the initiation of the premature activation of trypsinogen suggests that during the early

Molecular Basis of Diseases of the Exocrine Pancreas

stage of acute pancreatitis, pancreatic digestive zymogens become co-localized with lysosomal hydrolases. Recent data show that the lysosomal cysteine proteinase cathepsin B may play an important role for the activation of trypsinogen. Many years ago in vitro data demonstrated activation of trypsinogen by cathepsin B [27–29]. Most lysosomal hydrolases are synthesized as inactive pro-enzymes, but in contrast to digestive zymogens, they are activated by post-translational processing in the cell. During protein sorting in the Golgi system, lysosomal hydrolases are sorted into prelysosomes, whereas zymogens are packaged into condensing vacuoles. The sorting of lysosomal hydrolases depends on a mannose-6-phosphate-dependent pathway [30], which leads to a separation of lysosomal hydrolases from other secretory proteins and to the formation of prelysosomal vacuoles. However, this sorting is incomplete. Under physiological conditions, a significant fraction of hydrolases enter the secretory pathway [31–34]. It has been suggested that these mis-sorted hydrolases play a role in the regulation of zymogen secretion [35]. In acute pancreatitis the separation of digestive zymogens and lysosomal hydrolases is impaired. This leads to further co-localization of lysosomal hydrolases and zymogens within cytoplasmic vacuoles of acinar cells [36]. This co-localization has also been shown in electron microscopy [37], as well as in subcellular fractions isolated by density gradient centrifugation [38]. The redistribution of cathepsin B from the lysosome-enriched fraction was noted within 15 minutes of the start of pancreatitis induction, and trypsinogen activation was observed in parallel [39–41]. There are two main theories trying to explain the colocalization of cysteine and serine proteases: (i) fusion of lysosomes and zymogen granules [42] or (ii) incorrect sorting of zymogens and hydrolases in the process of vacuole maturation [37]. Wortmannin, a phosphoinositide3-kinase inhibitor, prevents the intracellular mis-sorting of hydrolases and zymogens, and subsequently prevents trypsinogen activation to trypsin during acute pancreatitis [43]. Further experiments focused on cathepsin B as the main enzyme driving the intracellular activation of trypsinogen. Cathepsin B is the most abundant lysosomal hydrolase in acinar cells. Pretreatment of rat pancreatic acini with E64d, a cell-permeable cathepsin B inhibitor, leads to complete inhibition of cathepsin B and completely abrogates trypsinogen activation [44,45]. Final evidence that cathepsin B is involved in activation of trypsinogen during cerulein-induced experimental pancreatitis comes from experiments in cathepsin B knockout mice. In these animals, after induction of experimental pancreatitis, trypsin activity was reduced to less than 20% compared to wild-type animals and the severity of the disease was markedly ameliorated [46]. These data showed unequivocally the importance of cathepsin B for the pathogenesis of acute pancreatitis (Figure 21.1) [47]. The cathepsin B theory implies one further critical point—that trypsinogen is expressed and stored in the presence of different potent intrapancreatic trypsin inhibitors. To activate trypsinogen, cathepsin B 423

Part IV


needs to override these defensive mechanisms to initiate the premature intracellular activation cascade [18]. Recently, it has become clear that cathepsin B cannot only activate cationic and anionic trypsinogen, but also mesotrypsinogen [48]. Mesotrypsin, the third trypsin isoform expressed in the human pancreas, is resistant against trypsin inhibitors like SPINK-1 or soybean trypsin inhibitor (SBTI) [49]. Moreover, mesotrypsin is able to degrade trypsin inhibitors. Under physiological conditions, mesotrypsin is activated in the duodenum by enterokinase, where it degrades exogenous trypsin inhibitors to ensure normal tryptic digestion. Mesotrypsin rapidly inactivates trypsin inhibitors like SPINK-1 by proteolytic cleavage in vitro [48,50]. Therefore, activation of trypsins by cathepsins might not only trigger a proteolytical cascade, but also involve the removal of trypsin inhibitors such as SPINK-1 via the activation of mesotrypsin. The role of cathepsin B in chronic pancreatitis was recently addressed by an Indian group from Hyderabad. In 140 patients suffering from tropical pancreatitis, they found a significant difference between patients and controls for the C76G polymorphism in the CTSB gene [51]. Unfortunately, these data could not be confirmed in a Caucasian cohort [52]. Thus, the role of CTSB in human pancreatitis remains inconclusive. Taken together, these experimental observations represent compelling evidence that cathepsin B can contribute to premature, intracellular zymogen activation and the initiation of acute pancreatitis not only through co-localization with trypsinogen, but also through activation of mesotrypsin, rendering endogenous pancreatic protease inhibitors inactive.

The Degradation of Active Trypsin During the early phase of pancreatitis, trypsinogen and other zymogens are rapidly activated, while later in the disease course their activity declines to physiological levels, suggesting degradation of the active enzymes. This phenomenon has been termed autolysis or autodegradation. Since this process self-limits autoactivation of trypsinogen, it is regarded as a safety mechanism to counteract premature zymogen activation. One theory to possibly explain how uncontrolled trypsinogen activation can be antagonized is based on the existence of a serine protease that is capable of trypsin degradation. In 1988 Heinrich Rinderknecht discovered an enzyme which rapidly degrades active cationic and anionic trypsin and named this protease enzyme Y [53]. Recent in vitro data suggest that the autodegradation of trypsin is a very slow process and that most of trypsin degradation is not mediated by trypsin itself but by another enzyme. Chymotrypsin C has the capability to proteolytically cleave cationic trypsin at Leu81–Glu82 in the Ca2þ binding loop. This leads to rapid autodegradation and catalytic inactivation of trypsin by additional cleavage at the Arg122– Val123 [54]. Thus, chymotrypsin C has the capability to induce trypsin-mediated trypsin autodegradation during pancreatitis and is most likely identical with the enzyme Y that Rinderknecht proposed in 1988. 424

However, chymotrypsin C has also the ability to induce trypsin-mediated trypsinogen autoactivation by proteolytic cleavage at the Phe18–Asp19 position of cationic trypsinogen [55]. The balance between autoactivation and autodegradation of cationic trypsin mediated by chymotrypsin C is regulated via the Ca2þ concentration. In the presence of 1 mM Ca2þ, degradation of trypsin is blocked and autoactivation of trypsinogen is induced. Under physiological conditions in the duodenum, high Ca2þ concentrations facilitate the activation of trypsinogen to promote digestion. In the absence of high Ca2þ concentrations, chymotrypsin C degrades active trypsin and protects against premature activation of trypsin (Figure 21.2).

Calcium Signaling The second messenger calcium plays an important role in multiple different intracellular processes such as metabolism, cellular secretion, cell differentiation, and cell growth. Under physiological conditions, pancreatic acinar cells maintain a Ca2þ gradient across the plasma membrane with low intracellular concentration and high extracellular concentration of calcium. In response to hormonal stimulation, Ca2þ is released from intracellular stores to regulate signalsecretion coupling. In pancreatic acinar cells, acetylcholine (ACh) and cholecystokinin (CCK) regulate the secretion of digestive enzymes via the generation of repetitive local cytosolic Ca2þ signals [56]. In response to secretagogue stimulation with ACh or CCK, Ca2þ is initially released from intracellular stores near the apical pole of acinar cells [57]. This induces the fusion of zymogen granules with the apical plasma membrane [58], and activation of Ca2þ dependent Cl- channels in the apical membrane [59]. The pattern of intracellular calcium signal in response to secretagogues stimulation is dependent on the neurotransmitter or hormone concentration. ACh at physiological concentrations elicits repetitive Ca2þ spikes and oscillation of Ca2þ concentrations, but these oscillations are restricted to the secretory pole of the cell. High concentrations of cholecystokinin lead to shortlasting spikes followed by longer Ca2þ transients that spread to the entire cell. Each oscillation is associated with a burst of exocytotic activity and the release of zymogen into the duct lumen [60]. In contrast, supramaximal stimulation of acinar cells induces a completely different pattern of Ca2þ signals. Instead of oscillatory activity observed with physiological doses of cholecystokinin, there is a much larger rise followed by a sustained elevation associated to a block of enzyme secretion and premature intracellular protease activation [56,61,62]. Ca2þ is released from the endoplasmatic reticulum (ER) in response to stimulation. The ER is located in the basolateral part of the acinar cell with extensions in the apical part enriched with zymogen granules. While the entire ER contains Ca2þ, release of Ca2þ in response to cholecystokinin or ACh occurs only at the apical pole due to the higher density of Ca2þ release channels at the apical pole of

Chapter 21


Figure 21.2 Chymotrypsin C has different functions in the processing of trypsin or trypsinogen. The major role in pancreatitis is degrading active trypsin. This function is disturbed by mutations within the CTRC gene or by high levels of Ca2þ. The activation of trypsinogen to trypsin can also be mediated by chymotrypsin C. Trypsin itself has the capability to autoactivate or to self-degrade. The R122H mutation results in the decreased autolysis of active trypsin.

the ER [63]. Two types of Ca2þ channels are expressed in the ER of acinar cells, inositol-triphosphate-receptors (IP3) and ryanodine receptors. Both of these channels are required for apical Ca2þ peaks. ACh activates phospholipase C (PLC) and initiates the Ca2þ release via the intracellular messenger IP3 [64,65], whereas cholecystokinin does not activate PLC but increases the intracellular concentration of nicotinic acid adenine dinucleotide phosphate (NAADP) in a dose-dependent manner [66]. The higher density of Ca2þ channels in the apical part of the ER explains the initiation of Ca2þ signals in the granule part of the cytoplasm. The apical, zymogen granule-enriched part of the acinar cell is surrounded by a barrier of mitochondria which absorb released calcium and prevent higher Ca2þ concentrations from expanding beyond the apical part of acinar cells [67]. The spatially limited release of Ca2þ at the apical pole also prevents an unregulated chain reaction across gap junctions, which would affect neighboring cells. The mitochondrial Ca2þ uptake leads to increased metabolism and generation of ATP [68,69]. ATP is required for the reuptake of Ca2þ in the ER via the sarcoplasmatic endoplasmatic reticulum calcium ATPase (SERCA), and for exocytosis across the apical membrane [70]. Thus, Ca2þ homeostasis plays a crucial role for maintaining signal-secretion coupling in pancreatic acinar cells (Figure 21.3). Elevated Ca2þ concentrations in the extracellular compartment or within acinar cells is known to be a risk factor for the development of acute pancreatitis [71– 74]. Disturbances in the Ca2þ homeostasis of pancreatic acinar cells occur early in the secretagogue-induced model of pancreatitis. An attenuation of Ca2þ elevation in acinar cells results from exposure to the cytosolic Ca2þ chelator BAPTA-AM, which also prevents zymogen activation, proving that Ca2þ is essential for zymogen activation. The sustained elevation that follows the

initial intracellular Ca2þ spike induced by supramaximal concentrations of cerulein is also attenuated in the complete absence of intracellular calcium and appears to depend on extracellular Ca2þ. In the absence of extracellular Ca2þ, the activation of trypsinogen induced by supramaximal doses of cerulein is also attenuated, suggesting that the initial and transient rise in Ca2þ caused by the release of calcium from the internal stores is not sufficient to permit trypsinogen activation. In contrast, interference with high calcium plateaus by the natural Ca2þ antagonist magnesium or a Ca2þ chelator in vivo abolishes trypsinogen activation as well as pancreatitis [62,75–77]. Acute pancreatitis is characterized by the pathologic activation of zymogens within pancreatic acinar cells. The process requires a rise in cytosolic Ca2þ from undefined intracellular stores. Zymogen activation is thereby mediated by ryanodine receptor-regulated Ca2þ release, and early zymogen activation takes place in a supranuclear compartment that overlaps in distribution with the ryanodine receptor. Furthermore, in vivo inhibition of the ryanodine receptor results in a loss of zymogen activation. Therefore, Ca2þ release from the ryanodine receptor mediates zymogen activation but not enzyme secretion [78]. Recent reports have shown that metabolites of alcohol metabolism can have a pathological effect on acinar cell Ca2þ homeostasis, suggesting a possible pathogenic mechanism in alcoholic pancreatitis. Nonoxidative metabolites like fatty acid ethyl esters (FAEE) and fatty acids (FA) can cause Ca2þ-dependent acinar cell necrosis [79]. It was previously demonstrated that FAEEs are generated in acinar cells incubated with clinically relevant concentrations of ethanol [79]. FAEEs activate the IP3 receptor after which Ca2þ is released from the ER [80]. In contrast, FAs do not activate Ca2þ channels but decrease ATP levels in the cytoplasm, which results 425

Part IV


Figure 21.3 Calcium signaling in acinar cells. Intracellular Ca2þ homeostasis regulates the secretion of zymogens and fluid. Acetylcholine (ACh) regulates via the second messenger inositol-3-phosphate the apical Ca2þ influx from intracellular stores (ER). Choleocystekinin leads to the production of nicotinic acid adenine dinucleotide phosphate (NAADP), which interacts with ryanodine receptor in the ER membrane and also regulates the apical Ca2þ influx. The plasma membrane calcium ATPase (PMCA) or the sarcoplasmatic endoriticulum calcium ATPase (SERCA) regulates cytoplasmatic Ca2þ decrease. A mitochondrial barrier inhibits a global Ca2þ increase by absorbing free Ca2þ from the apical zymogen-enriched part of the acinar cell. Interferences in the calcium homeostasis lead to a global Ca2þ increase in the cytoplasm, which results in premature activation of zymogens.

in impaired Ca2þ reuptake into the ER. Subsequently, increased intracellular Ca2þ levels contribute to premature zymogen activation. Ca2þ not only is an important second messenger, but has a direct effect on the activation, activity, and degradation mechanisms of trypsin. Experiments with purified human anionic and cationic trypsinogen in the absence of Ca2þ show markedly reduced autoactivation compared to high Ca2þ concentration [81]. Moreover, in cytoplasmic vacuoles developing upon supramaximal cholecystokinin stimulation in acinar cells, Ca2þ concentrations decreases rapidly to levels 426

which are much lower than optimal for trypsinogen autoactivation [82]. This mechanism could represent a protective mechanism of the endosomes to prevent damage from premature trypsinogen activation.

CHRONIC AND HEREDITARY PANCREATITIS Chronic pancreatitis is clinically defined as recurrent bouts of a sterile inflammatory disease characterized by persistent and often progressive and irreversible

Chapter 21

morphological changes, typically causing pain and permanent impairment of pancreatic function. Chronic pancreatitis histologically represents a transformation of focal necrosis into perilobular and intralobular fibrosis of the parenchyma, pancreatic duct obstruction by pancreatic stones and tissue calcification, and the development of pseudocysts. In the course of the disease, progressive loss of endocrine and exocrine function can be monitored. It should be noted that the clinical distinction between acute and chronic pancreatitis is becoming pathophysiologically ever more blurred, and similar or identical onset mechanisms may play a role. These mechanisms include premature and intracellular activation of digestive proteases. Much of our present knowledge about this process has been generated since a genetic basis for pancreatitis was first reported in 1996. Hereditary pancreatitis represents a genetic disorder associated with mutations in the cationic trypsinogen gene and presents with a disease penetrance of up to 80%. Patients with hereditary pancreatitis suffer from recurrent episodes of pancreatitis which do progress in the majority to chronic pancreatitis. The disease usually begins in early childhood, but onset can vary from infancy to the sixth decade of life [83].

Mutations Within the PRSS1 Gene Hereditary pancreatitis is associated with genetic mutations in the cationic trypsinogen gene, suggesting that mutations in a digestive protease (such as trypsin) can cause the disease. Hereditary pancreatitis typically follows an autosomal dominant pattern of inheritance with an 80% disease penetrance. The gene coding for cationic trypsinogen (PRSS1) is approximately 3.6 kb in size, is located on chromosome 7, and contains 5 exons. The precursor of cationic trypsinogen is a 247 amino acid protein, the first 15 amino acids of which represent the signal sequence; the next 8 amino acids, the activation peptide; and the remaining 224 amino acids form the backbone and catalytic center of the digestive enzyme. Presently, there are two known mutations within the same codon in the PRSS1 gene: (i) His-122-trypsinogen shows increased autoactivation, and (ii) Cys-122 trypsinogen has reduced activity. The first of these mutations was discovered in 1996, exactly one century after Chiari proposed his theory on autodigestion of the pancreas as a pathogenic mechanism of pancreatitis. Whitcomb et al. reported a mutation in exon 3 of the cationic trypsinogen gene (PRSS1) on chromosome 7 (7q36) [84–86] that was strongly associated with hereditary chronic pancreatitis. This single point mutation (CGC to CAC) causes an arginine to histidine (R to H) substitution at position 22 of the cationic trypsinogen gene (R122H). The amino acid exchange is located in the hydrolysis site of trypsin and can prevent the autodegradation of active trypsin [87] (Figure 21.2). Once trypsin has been activated intracellularly, the R122H mutation interferes with the elimination of active trypsin by autodegradation [88]. This conclusion was derived


from in vitro data using recombinant R122H mutated trypsinogen. Using the same E. coli based system, Sahin-Toth and coworkers showed that the R122H mutation leads to an increase in trypsinogen autoactivation [89]. Therefore, the R122H mutation represents a dual gain of function mutation which facilitates intracellular trypsin activity and results in a higher stability of R122H-trypsin [88,90]. The direct pathogenic role of the R122H mutations for the development of pancreatitis was confirmed by the group of Bar-Sagi. These investigators generated a transgenic mouse in which the expression of the murine PRSS1 mutant R122H (R122H_mPRSS1) was targeted to pancreatic acinar cells by fusion to the elastase promoter. Pancreata from transgenic mice displayed early-onset acinar cell injury and inflammatory cell infiltration. With progressing age, the transgenic mice developed areas of pancreatic fibrosis and displayed acinar cell dedifferentiation [91,92]. Interestingly, no increased trypsin activity was found in these animals under experimental supramaximal stimulation. Shortly after the identification of the R122H mutation a second mutation was reported in kindreds with hereditary pancreatitis. The R122C mutation is a single amino acid exchange affecting the same codon as the R122H mutation [93,94]. In contrast to the R122H mutation, the R122C mutation causes a decreased trypsinogen autoactivation, and biochemical studies demonstrated a 60%–70% reduced activation in the Cys-122 trypsinogen mutant induced by either enterokinase or cathepsin B activation. The amino acid exchange of the R122C mutation leads to altered cysteine-disulfide bonds and consequently a misfolded protein structure with reduced catalytic activity. In recent years several other attempts have been made to elucidate the pathophysiological role of trypsinogen in the onset of pancreatitis, but the issue is still a matter of intense research [95]. Since the initial discovery, several other mutations (24 to date) in the trypsinogen gene have been reported, but the R122H mutation is still the most common. In addition to the R122H mutation, five other mutations in different regions of the PRSS1 gene associated with hereditary pancreatitis have been biochemically characterized: A16V [96], D22G [97], K23R [98], E79K [99], and N29I [100]. It has been suggested that these mutations may have different structural effects on the activation and activity of trypsinogen. The nucleotide substitution from A-T in exon 2 of the PRSS1 gene (AAC to ATC) in codon 29 of cationic trypsinogen results in an asparagine to isoleucine amino acid change (N29I). This amino acid substitution affects the protein structure of trypsinogen, and seems to stabilize the enzyme [101]. The N29I mutation does not affect the autoactivation of trypsinogen but impairs enzyme degradation in vivo [102,103]. The N29I mutation causes a slightly milder course of hereditary pancreatitis compared to the R122H mutation, the onset of disease occurs somewhat later, and the need for in-hospital treatment is lower [83,104]. 427

Part IV


The A16V mutation results in an amino acid exchange from alanine to valine in the signal peptide of trypsinogen. This mutation is rare [96] and in contrast to R122H and N29I mutations, which are burdened with an 80% penetrance for chronic pancreatitis, develops only in one out of seven carriers of the A16V mutation. Two other mutations were found in the signal peptide of cationic trypsinogen, D22G and K23R. Both mutations result in an increase of autoactivation of trypsinogen [105] but are resistant to cathepsin B activation [106]. Furthermore, in contrast to wild-type trypsinogen, expression of active trypsin and mutated trypsinogens (D22G, K23R) reduced cell viability of AR4–2J cells [107]. This suggests that mutations in the activation peptide of trypsinogen play an important role in premature protease activation, but the biochemical mechanisms remain unsolved. The EUROPAC-1 study compared genotype to phenotype characteristics of hereditary pancreatitis patients. This study confirmed the importance of PRSS1 mutations associated with chronic pancreatitis. In a multilevel proportional hazard model employing data obtained from the European Registry of Hereditary Pancreatitis, 112 families in 14 countries (418 affected individuals) were collected [83]: 58 (52%) families carried the R122H mutation, 24 (21%) carried the N29I mutation, and 5 (4%) carried the A16V mutation, while 2 families had rare mutations, and 21 (19%) had no known PRSS1 mutation. The median time to the start of symptoms for the R122H mutation is 10 years of age (8 to 12 years of age, 95% confidence interval), 14 years of age for the N29I mutation (11 to 18 years of age, 95% confidence interval), and 14.5 years of age for mutation negative patients (10 to 21 years of age, 95% confidence interval; P ¼ 0.032). The

Table 21.1

cumulative risk at 50 years of age for exocrine pancreas failure was 37.2% (28.5%–45.8%, 95% confidence interval), 47.6% for endocrine failure (37.1%–58.1%, 95% confidence interval), and 17.5% for pancreatic resection for pain (12.2%–22.7%, 95% confidence interval). Time to resection was significantly reduced for females (P < 0.001) and those with the N29I mutation (P ¼ 0.014). Pancreatic cancer was diagnosed in 26 (6%) of 418 affected patients (Table 21.1). The remaining Prss1 mutations are very rare and are for the most part detected only in a single family or a single patient. Mutations like P36R, K92N, or G83E were each found in only one patient with idiopathic chronic pancreatitis [108]. The biochemical consequences of these mutations do not result in increased stability or autoactivation of trypsinogen compared to the R122H or N29I mutations [109]. This observation causes difficulties explaining the underlying pathogenic mechanism for these rare mutations.

Mutations Within the PRSS2 Gene The fact that mutations in the PRSS1 gene encoding for cationic trypsinogen are associated with hereditary pancreatitis could suggest that genetic alterations of the anionic trypsinogen gene (PRSS2) could also be associated with chronic pancreatitis. The E79K mutation (related to a G to A mutation at codon 237) reduces autoactivation of cationic trypsinogen by 80%–90% but leads to a 2-fold increase in the activation of anionic trypsinogen, suggesting a potential role of PRSS2 [99]. A direct link between the development of chronic pancreatitis and mutations in the PRSS2 gene was not established until 2006 [110]. Genetic analysis of the PRSS2 gene in 2466 chronic pancreatitis patients and 6459 healthy individuals revealed an increased rate of a rare

Most Common Mutations Associated with Pancreatitis

Gene

Mutation

Comments

Frequency

PRSS1

R122H

increased autoactivation and decreased autolysis of cationic trypsin decreased autoactivation of trypsinogen, decreased autolysis of trypsin also decreased trypsin activity increased autoactivation of trypsinogen

most common mutation (>500) 5 affected carriers

R122C N29I A16V D22G K23R E79K SPINK1

CTRC CFTR

428

N34S R65Q G48E D50E Y54H R67C L14P and L14R R254W K247_R254del A37T various >1000

increased autoactivation of trypsinogen increased autoactivation of trypsinogen increased autoactivation of trypsinogen increased activation of anionic trypsinogen decreased autoactivation of trypsinogen no functional defect reported 60% loss of protein expression nearly complete loss of protein expression nearly complete loss of protein expression nearly complete loss of protein expression nearly complete loss of protein expression rapid intracellular degradation of SPINK1 decreased activity of chymotrypsin C loss of function of chymotrypsin C decreased trypsin degradation of chymotrypsin C decreased fluid secretion from acinar cells

second most common mutation (>160) 25 affected carriers rare, 2 carriers rare, 2 carriers 8 affected carriers

Chapter 21

mutation in the anionic trypsinogen gene in control subjects. A variant of codon 191 (G191R) was present in 220/6459 (3.4%) control subjects, but in only 32/ 2466 (1.3%) affected individuals [111]. Biochemical analysis of the recombinantly expressed G191R protein showed a complete loss of tryptic function after enterokinase or trypsin activation, as well as a rapid autolytic proteolysis of the mutant. This was the first report of a loss of trypsin function (in PRSS2) that has a protective effect on the onset of pancreatitis.

Mutations in the Chymotrypsin C Gene Because trypsin degradation is thought to represent a protective mechanism against pancreatitis, Sahin-Toth and coworkers hypothesized that loss-of-function variants in trypsin-degrading enzymes would increase the risk of pancreatitis. Since they knew that chymotrypsin can degrade all human trypsins and trypsinogen isoforms with high specificity, they sequenced the chymotrypsin C gene (CTRC) in a German cohort suffering from idiopathic and hereditary pancreatitis. They detected two variants in the CTRC gene in association with hereditary and idiopathic chronic pancreatitis. Mutation of codon 760 (C to T) resulted in an R254W variant form of the protein that occurred with a frequency of 2.1% (19/901) in affected individuals compared to 0.6% (18/2804) in healthy controls. In addition, a deletion mutation (c738_761del24) resulting in a K247–R254del variant protein was found in 1.2% of affected individuals compared to 0.1% in controls [112]. In a confirmative cohort of different ethnic background, the authors detected a third mutation in affected patients with a frequency of 5.6% (4/71) compared to 0% (0/84) in control individuals. This mutation leads to an amino acid exchange at the position 73 (A73T) resulting from a G to A mutation at codon 217. The assumed pathogenic mechanism of CTRC mutations is based on lowered enzyme activity in the R254W variant and a total loss of function in the deletion mutation (K247–R254del) and the A73T variant (Figure 21.2). Thus, chymotrypsin C is an enzyme that can counteract the diseasecausing effect of trypsin, and loss of function mutations impair its protective role in pancreatitis by letting prematurely activated trypsin escape its degradation.

Mutations in Serine Protease Inhibitor Kazal-Type 1 Shortly after the identification of mutations in the trypsinogen gene in hereditary pancreatitis, another important observation was made by Witt et al. [113]. This group found that mutations in the SPINK-1 gene (the pancreatic secretory trypsin inhibitor or PSTI, OMIM 167790) can be associated with idiopathic chronic pancreatitis in children. SPINK-1 mutations can be frequently detected in cohorts of patients who do not have a family history but also have none of the classical risk factors for chronic pancreatitis


[114,115]. The most common mutation is found in exon 2 of the SPINK-1 gene (AAT to AGT), which leads to an asparagine to serine amino acid change (N34S) [114]. Homozygote and heterozygote N34S mutations were detected in 10%–20% of patients with pancreatitis compared to 1%–2% of healthy controls, suggesting that SPINK-1 is a disease-modifying factor [116–118]. Tropical pancreatitis is a common form of pancreatitis in Africa and Asia. This form of pancreatitis is characterized by abdominal pain, intraductal pancreatic calculi, and diabetes mellitus in young nonalcoholic patients. Tropical pancreatitis is associated with an even higher frequency of N34S mutations in the SPINK-1 gene, representing up to 30% of affected individuals [119]. Structural modeling of SPINK-1 predicted that the N34S region near the lysine41 residue functions as the trypsin-binding pocket of SPINK-1 [120] and that the N34S mutation changes the structure of the trypsin-binding pocket of SPINK-1, resulting in decreased inhibitory capacity of SPINK-1. In contrast to the computer-modeled prediction, in vitro experiments using recombinant N34S SPINK-1 and wild-type SPINK-1 demonstrated identical trypsin inhibitory activities [116]. To study the role of SPINK-1 in vivo, experimenters generated a knockout mouse mode. The murine SPINK-3 is the functional homolog to human SPINK-1. SPINK-3-deficient mice show a perturbed embryonic development of the pancreas and die within 2 weeks after birth [121]. No increase in trypsin activity was observed in SPINK3-/mice. This suggests that other yet unknown disease factors are involved in the antiprotease/protease balance, contributing to the disease phenotype, or that trypsinSPINK-1 interactions differ between murine and human isoforms. Nevertheless, targeted expression of PSTI in pancreas of transgenic mice increased endogenous trypsin inhibitor capacity by 190% (P < 0.01) compared to control mice. Cerulein administration to transgenic PSTI mice produced significantly reduced histologic severity of pancreatitis. There was no difference in trypsinogen activation between ceruleintreated transgenic and wild-type mice. However, trypsin activity was significantly lower in transgenic mice receiving cerulein compared with nontransgenic mice [122]. Recently, two novel SPINK-1 variants affecting the secretory signal peptide have been reported. Seven missense mutations occurring within the mature peptide of PSTI associated with chronic pancreatitis were analyzed for their expression levels. The N34S and the P55S mutation neither results in a change of PSTI activity nor in a change of expression. The R65Q mutation involves substitution of a positively charged amino acid by a noncharged amino acid, causing 60% reduction of protein expression. G48E, D50E, Y54H, and R67C mutations, all of which occur in strictly conserved amino acid residues, cause nearly complete loss of PSTI expression. As the authors had excluded the possibility that the reduced protein expression may have resulted from reduced transcription of unstable mRNA, they concluded that these missense mutations probably cause intracellular retention of their respective mutant proteins [123]. In addition, two novel 429

Part IV


mutants have been described recently. A disease associated codon 41 T to G alteration was found in two European families with an autosomal dominant inheritance pattern, whereas a codon 36 G to C variant was identified as a frequent alteration in subjects of African descent. L14R and L14P mutations resulted in rapid intracellular degradation of the protein and thereby abolished SPINK-1 secretion, whereas the L12F variant showed no such effect [124]. The discovery of SPINK-1 mutations in humans provides additional support for a role of active trypsin in the development of pancreatitis. SPINK-1 is believed to form the first line of defense in inhibiting prematurely activated trypsinogen in the pancreas.

CFTR Mutations: A New Cause of Chronic Pancreatitis Cystic fibrosis is an autosomal-recessive disorder with an estimated incidence of 1 in 2500 individuals and is characterized by pancreatic exocrine insufficiency and chronic pulmonary disease. The extent of pancreatic involvement varies between a complete loss of exocrine and endocrine function, to nearly unimpaired pancreatic function. In 1996, Ravnik-Glavac et al. were the first to report mutations in the cystic fibrosis gene in patients with hereditary chronic pancreatitis [125]. Analysis of larger cohorts revealed recurrent episodes of pancreatitis in 1%–2% of patients with cystic fibrosis and normal exocrine function, and rarely in patients with exocrine insufficiency as well. Compared to an unaffected population, 17%–26% of patients who suffer from idiopathic pancreatitis carry mutations in CFTR. Chronic pancreatitis now represents, in addition to chronic lung disease and infertility due to vas deferens aplasia, a third disease entity associated with mutations in the CFTR gene. It is important to note that pancreatic exocrine insufficiency in patients with cystic fibrosis is a different disease entity and not to be confused with chronic pancreatitis in the presence of CFTR mutations [126–130]. CFTR is a chloride channel, regulated by 30 ,50 -cAMP and phosphorylation [131,132] and is essential for the control of epithelial ion transport. The level of executable protein function determines the type and the severity of the disease phenotype. CFTR knockout mice show a more severe form of experimental pancreatitis induced by supramaximal cerulein stimulation compared with wild-type animals. The underlying hypothesis of the CFTR-related pancreatic injury is a disrupted fluid secretion, which leads to impaired secretion of pancreatic digestive enzymes in response to stimulation [133]. Today more than 1000 mutations within the CFTR gene are known, and several of them have been reported in direct association with chronic pancreatitis [126,127]. For healthy subjects who are heterozygous carriers of CFTR mutations, the risk of developing pancreatitis is about 2-fold [134].

SUMMARY Recent advances in cell biological and molecular techniques have permitted investigators to address 430

the intracellular pathophysiology and genetics underlying pancreatic diseases in a much more direct manner than was previously considered possible. Studies that have employed these techniques have changed our knowledge about the disease onset. Pancreatitis has long been considered an autodigestive disorder in which the pancreas is destroyed by its own digestive proteases. Under physiological conditions, pancreatic proteases are synthesized as inactive precursor zymogens and stored by acinar cells in zymogen granules. Independent of the pathological stimulus that triggers the disease, the pathophysiological events that eventually lead to tissue destruction begin within the acinar cells and involve premature intracellular activation of proteases. Cell injury subsequently induces a systemic inflammatory response. Much of our present understanding of the underlying pathogenic mechanism comes from genetic studies, which support a crucial role of trypsinogen activation. Different mutations within the PRSS1 gene (like the R122H mutation), in genes coding for endogenous inhibitors of active trypsin (such as SPINK-1), or in trypsindegrading enzymes (such as CTRC), have all been found in association with different varieties of pancreatitis. Nevertheless, the molecular mechanisms that regulate the balance between proteases and antiproteases, as well as the role of individual digestive enzymes in the proteolytic cascades that precede cell injury, still need to be defined by further experimental studies.

REFERENCES 1. Mayerle J, Hlouschek V, Lerch MM. Current management of acute pancreatitis. Nat Clin Pract Gastroenterol Hepatol. 2005;2:473–483. 2. Youngs G. Hormonal control of pancreatic endocrine and exocrine secretion. Gut. 1972;13:154–161. ¨ ber Selbstverdauung des menschlichen Pankreas. 3. Chiari H. U Z Heilkd. 1896;17:69–96. 4. Saluja AK, Lerch MM, Phillips PA, et al. Why does pancreatic overstimulation cause pancreatitis? Annu Rev Physiol. 2007;69: 249–269. 5. Lerch MM, Adler G. Experimental animal models of acute pancreatitis. Int J Pancreatol. 1994;15:159–170. 6. Kruger B, Lerch MM, Tessenow W. Direct detection of premature protease activation in living pancreatic acinar cells. Lab Invest. 1998;78:763–764. 7. Bialek R, Willemer S, Arnold R, et al. Evidence of intracellular activation of serine proteases in acute cerulein-induced pancreatitis in rats. Scand J Gastroenterol. 1991;26:190–196. 8. Hurley PR, Cook A, Jehanli A, et al. Development of radioimmunoassays for free tetra-L-aspartyl-L-lysine trypsinogen activation peptides (TAP). J Immunol Methods. 1988;111:195–203. 9. Neoptolemos JP, Kemppainen EA, Mayer JM, et al. Early prediction of severity in acute pancreatitis by urinary trypsinogen activation peptide: A multicentre study. Lancet. 2000;355: 1955–1960. 10. Luthen R, Niederau C, Grendell JH. Intrapancreatic zymogen activation and levels of ATP and glutathione during caerulein pancreatitis in rats. Am J Physiol. 1995;268:G592–604. 11. Schmidt J, Fernandez-del Castillo C, Rattner DW, et al. Trypsinogen-activation peptides in experimental rat pancreatitis: Prognostic implications and histopathologic correlates. Gastroenterology. 1992;103:1009–1016. 12. Lerch MM, Kruger B, Tessenow W, et al. [Role of protease activation in pathophysiology of acute pancreatitis]. Langenbecks Arch Chir Suppl Kongressbd. 1998;115:421–426.

Chapter 21 13. Scheele G, Bartelt D, Bieger W. Characterization of human exocrine pancreatic proteins by two-dimensional isoelectric focusing/sodium dodecyl sulfate gel electrophoresis. Gastroenterology. 1981;80:461–473. 14. Dartsch H, Kleene R, Kern HF. In vitro condensation-sorting of enzyme proteins isolated from rat pancreatic acinar cells. Eur J Cell Biol. 1998;75:211–222. 15. Palade G. Intracellular aspects of the process of protein synthesis. Science. 1975;189:347–358. 16. Klumperman J, Kuliawat R, Griffith JM, et al. Mannose 6-phosphate receptors are sorted from immature secretory granules via adaptor protein AP-1, clathrin, and syntaxin 6-positive vesicles. J Cell Biol. 1998;141:359–371. 17. Rinderknecht H. Activation of pancreatic zymogens. Normal activation, premature intrapancreatic activation, protective mechanisms against inappropriate activation. Dig Dis Sci. 1986; 31:314–321. 18. Arias AE, Boldicke T, Bendayan M. Absence of trypsinogen autoactivation and immunolocalization of pancreatic secretory trypsin inhibitor in acinar cells in vitro. In Vitro Cell Dev Biol. 1993; 29A:221–227. 19. Lampel M, Kern HF. Acute interstitial pancreatitis in the rat induced by excessive doses of a pancreatic secretagogue. Virchows Arch A Pathol Anat Histol. 1977;373:97–117. 20. Kruger B, Weber IA, Albrecht E, et al. Effect of hyperthermia on premature intracellular trypsinogen activation in the exocrine pancreas. Biochem Biophys Res Commun. 2001;282:159–165. 21. Lerch MM, Saluja AK, Dawra R, et al. Acute necrotizing pancreatitis in the opossum: Earliest morphological changes involve acinar cells. Gastroenterology. 1992;103: 205–213. 22. Grady T, Mah’Moud M, Otani T, et al. Zymogen proteolysis within the pancreatic acinar cell is associated with cellular injury. Am J Physiol. 1998;275:G1010–1017. 23. Niederau C, Grendell JH. Intracellular vacuoles in experimental acute pancreatitis in rats and mice are an acidified compartment. J Clin Invest. 1988;81:229–236. 24. Keck T, Balcom JH, Antoniu BA, et al. Regional effects of nafamostat, a novel potent protease and complement inhibitor, on severe necrotizing pancreatitis. Surgery. 2001;130:175–181. 25. Tsujino T, Kawabe T, Omata M. Antiproteases in preventing post-ERCP acute pancreatitis. Jop. 2007;8:509–517. 26. Niederau C, Crass RA, Silver G, et al. Therapeutic regimens in acute experimental hemorrhagic pancreatitis. Effects of hydration, oxygenation, peritoneal lavage, and a potent protease inhibitor. Gastroenterology. 1988;95:1648–1657. 27. Greenbaum LM, Hirshkowitz A, Shoichet I. The activation of trypsinogen by cathepsin B. J Biol Chem. 1959;234:2885–2890. 28. Lerch MM, Halangk W, Kruger B. The role of cysteine proteases in intracellular pancreatic serine protease activation. Adv Exp Med Biol. 2000;477:403–411. 29. Halangk W, Kruger B, Ruthenburger M, et al. Trypsin activity is not involved in premature, intrapancreatic trypsinogen activation. Am J Physiol Gastrointest Liver Physiol. 2002;282: G367–374. 30. Brown WJ, Farquhar MG. Accumulation of coated vesicles bearing mannose 6-phosphate receptors for lysosomal enzymes in the Golgi region of I-cell fibroblasts. Proc Natl Acad Sci USA. 1984;81:5135–5139. 31. Willemer S, Bialek R, Adler G. Localization of lysosomal and digestive enzymes in cytoplasmic vacuoles in caerulein-pancreatitis. Histochemistry. 1990;94:161–170. 32. Hirano T, Saluja A, Ramarao P, et al. Apical secretion of lysosomal enzymes in rabbit pancreas occurs via a secretagogue regulated pathway and is increased after pancreatic duct obstruction. J Clin Invest. 1991;87:865–869. 33. Kukor Z, Mayerle J, Kruger B, et al. Presence of cathepsin B in the human pancreatic secretory pathway and its role in trypsinogen activation during hereditary pancreatitis. J Biol Chem. 2002;277:21389–21396. 34. Lerch MM, Saluja AK, Runzi M, et al. Luminal endocytosis and intracellular targeting by acinar cells during early biliary pancreatitis in the opossum. J Clin Invest. 1995;95: 2222–2231. 35. Rinderknecht H, Renner IG, Koyama HH. Lysosomal enzymes in pure pancreatic juice from normal healthy volunteers and chronic alcoholics. Dig Dis Sci. 1979;24:180–186.


36. Steer ML, Meldolesi J, Figarella C. Pancreatitis. The role of lysosomes. Dig Dis Sci. 1984;29:934–938. 37. Watanabe O, Baccino FM, Steer ML, et al. Supramaximal caerulein stimulation and ultrastructure of rat pancreatic acinar cell: Early morphological changes during development of experimental pancreatitis. Am J Physiol. 1984;246:G457–467. 38. Saluja A, Hashimoto S, Saluja M, et al. Subcellular redistribution of lysosomal enzymes during caerulein-induced pancreatitis. Am J Physiol. 1987;253:G508–516. 39. Hofbauer B, Saluja AK, Lerch MM, et al. Intra-acinar cell activation of trypsinogen during caerulein-induced pancreatitis in rats. Am J Physiol. 1998;275:G352–362. 40. Grady T, Saluja A, Kaiser A, et al. Edema and intrapancreatic trypsinogen activation precede glutathione depletion during caerulein pancreatitis. Am J Physiol. 1996;271:G20–26. 41. Hirano T, Saluja A, Ramarao P, et al. Effects of chloroquine and methylamine on lysosomal enzyme secretion by rat pancreas. Am J Physiol. 1992;262:G439–444. 42. Koike H, Steer ML, Meldolesi J. Pancreatic effects of ethionine: Blockade of exocytosis and appearance of crinophagy and autophagy precede cellular necrosis. Am J Physiol. 1982;242:G297–307. 43. Singh VP, Saluja AK, Bhagat L, et al. Phosphatidylinositol 3kinase-dependent activation of trypsinogen modulates the severity of acute pancreatitis. J Clin Invest. 2001;108:1387–1395. 44. Saluja AK, Donovan EA, Yamanaka K, et al. Cerulein-induced in vitro activation of trypsinogen in rat pancreatic acini is mediated by cathepsin B. Gastroenterology. 1997;113:304–310. 45. Van Acker GJ, Saluja AK, Bhagat L, et al. Cathepsin B inhibition prevents trypsinogen activation and reduces pancreatitis severity. Am J Physiol Gastrointest Liver Physiol. 2002;283:G794–800. 46. Halangk W, Lerch MM, Brandt-Nedelev B, et al. Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest. 2000;106:773–781. 47. Lerch MM, Halangk W. Human pancreatitis and the role of cathepsin B. Gut. 2006;55:1228–1230. 48. Szmola R, Kukor Z, Sahin-Toth M. Human mesotrypsin is a unique digestive protease specialized for the degradation of trypsin inhibitors. J Biol Chem. 2003;278:48580–48589. 49. Rinderknecht H, Renner IG, Abramson SB, et al. Mesotrypsin: A new inhibitor-resistant protease from a zymogen in human pancreatic tissue and fluid. Gastroenterology. 1984; 86:681–692. 50. Sahin-Toth M. Human mesotrypsin defies natural trypsin inhibitors: From passive resistance to active destruction. Protein Pept Lett. 2005;12:457–464. 51. Mahurkar S, Idris MM, Reddy DN, et al. Association of cathepsin B gene polymorphisms with tropical calcific pancreatitis. Gut. 2006;55:1270–1275. 52. Weiss FU, Behn CO, Simon P, et al. Cathepsin B gene polymorphism Val26 is not associated with idiopathic chronic pancreatitis in European patients. Gut. 2007;56:1322–1323. 53. Rinderknecht H, Adham NF, Renner IG, et al. A possible zymogen self-destruct mechanism preventing pancreatic autodigestion. Int J Pancreatol. 1988;3:33–44. 54. Szmola R, Sahin-Toth M. Chymotrypsin C (caldecrin) promotes degradation of human cationic trypsin: Identity with Rinderknecht’s enzyme Y. Proc Natl Acad Sci USA. 2007;104:11227– 11232. 55. Nemoda Z, Sahin-Toth M. Chymotrypsin C (caldecrin) stimulates autoactivation of human cationic trypsinogen. J Biol Chem. 2006;281:11879–11886. 56. Petersen OH. Ca2þ signalling and Ca2þ-activated ion channels in exocrine acinar cells. Cell Calcium. 2005;38:171–200. 57. Kasai H, Augustine GJ. Cytosolic Ca2þ gradients triggering unidirectional fluid secretion from exocrine pancreas. Nature. 1990;348:735–738. 58. Maruyama Y, Inooka G, Li YX, et al. Agonist-induced localized Ca2þ spikes directly triggering exocytotic secretion in exocrine pancreas. Embo J. 1993;12:3017–3022. 59. Park MK, Lomax RB, Tepikin AV, et al. OH. Local uncaging of caged Ca(2þ) reveals distribution of Ca(2þ)-activated Cl(-) channels in pancreatic acinar cells. Proc Natl Acad Sci USA. 2001;98:10948–10953. 60. Maruyama Y, Petersen OH. Delay in granular fusion evoked by repetitive cytosolic Ca2þ spikes in mouse pancreatic acinar cells. Cell Calcium. 1994;16:419–430.

431

Part IV


61. Matozaki T, Goke B, Tsunoda Y, et al. Two functionally distinct cholecystokinin receptors show different modes of action on Ca2þ mobilization and phospholipid hydrolysis in isolated rat pancreatic acini. Studies using a new cholecystokinin analog, JMV-180. J Biol Chem. 1990; 265:6247–6254. 62. Kruger B, Albrecht E, Lerch MM. The role of intracellular calcium signaling in premature protease activation and the onset of pancreatitis. Am J Pathol. 2000;157:43–50. 63. Lee MG, Xu X, Zeng W, et al. Polarized expression of Ca2þ channels in pancreatic and salivary gland cells. Correlation with initiation and propagation of [Ca2þ]i waves. J Biol Chem. 1997;272:15765–15770. 64. Ashby MC, Tepikin AV. Polarized calcium and calmodulin signaling in secretory epithelia. Physiol Rev. 2002;82:701–734. 65. Saluja AK, Dawra RK, Lerch MM, et al. CCK-JMV-180, an analog of cholecystokinin, releases intracellular calcium from an inositol trisphosphate-independent pool in rat pancreatic acini. J Biol Chem. 1992;267:11202–11207. 66. Yamasaki M, Thomas JM, Churchill GC, et al. Role of NAADP and cADPR in the induction and maintenance of agonist-evoked Ca2þ spiking in mouse pancreatic acinar cells. Curr Biol. 2005;15:874–878. 67. Park MK, Ashby MC, Erdemli G, et al. Perinuclear, perigranular and sub-plasmalemmal mitochondria have distinct functions in the regulation of cellular calcium transport. Embo J. 2001; 20:1863–1874. 68. McCormack JG, Halestrap AP, Denton RM. Role of calcium ions in regulation of mammalian intramitochondrial metabolism. Physiol Rev. 1990;70:391–425. 69. Voronina S, Sukhomlin T, Johnson PR, et al. Correlation of NADH and Ca2þ signals in mouse pancreatic acinar cells. J Physiol. 2002;539:41–52. 70. Petersen OH, Sutton R, Criddle DN. Failure of calcium microdomain generation and pathological consequences. Cell Calcium. 2006;40:593–600. 71. Ward JB, Petersen OH, Jenkins SA, et al. Is an elevated concentration of acinar cytosolic free ionised calcium the trigger for acute pancreatitis? Lancet. 1995;346:1016–1019. 72. Mithofer K, Fernandez-del Castillo C, Frick TW, et al. Acute hypercalcemia causes acute pancreatitis and ectopic trypsinogen activation in the rat. Gastroenterology. 1995;109:239–246. 73. Klonowski-Stumpe H, Schreiber R, Grolik M, et al. Effect of oxidative stress on cellular functions and cytosolic free calcium of rat pancreatic acinar cells. Am J Physiol. 1997;272: G1489–1498. 74. Nicotera P, Bellomo G, Orrenius S. Calcium-mediated mechanisms in chemically induced cell death. Annu Rev Pharmacol Toxicol. 1992;32:449–470. 75. Saluja AK, Bhagat L, Lee HS, et al. Secretagogue-induced digestive enzyme activation and cell injury in rat pancreatic acini. Am J Physiol. 1999;276:G835–842. 76. Mooren FC, Turi S, Gunzel D, et al. Calcium-magnesium interactions in pancreatic acinar cells. Faseb J. 2001;15:659–672. 77. Mooren F, Hlouschek V, Finkes T, et al. Early changes in pancreatic acinar cell calcium signaling after pancreatic duct obstruction. J Biol Chem. 2003;278:9361–9369. 78. Husain SZ, Prasad P, Grant WM, et al. The ryanodine receptor mediates early zymogen activation in pancreatitis. Proc Natl Acad Sci USA. 2005;102: 14386–14391. 79. Criddle DN, Sutton R, Petersen OH. Role of Ca2þ in pancreatic cell death induced by alcohol metabolites. J Gastroenterol Hepatol. 2006;21(Suppl 3):S14–17. 80. Criddle DN, Murphy J, Fistetto G, et al. Fatty acid ethyl esters cause pancreatic calcium toxicity via inositol trisphosphate receptors and loss of ATP synthesis. Gastroenterology. 2006;130: 781–793. 81. Kukor Z, Toth M, Sahin-Toth M. Human anionic trypsinogen: Properties of autocatalytic activation and degradation and implications in pancreatic diseases. Eur J Biochem. 2003;270:2047–2058. 82. Sherwood MW, Prior IA, Voronina SG, et al. Activation of trypsinogen in large endocytic vacuoles of pancreatic acinar cells. Proc Natl Acad Sci USA. 2007;104:5674–5679. 83. Howes N, Lerch MM, Greenhalf W, et al. Clinical and genetic characteristics of hereditary pancreatitis in Europe. Clin Gastroenterol Hepatol. 2004;2:252–261.

432

84. Whitcomb DC, Preston RA, Aston CE, et al. A gene for hereditary pancreatitis maps to chromosome 7q35. Gastroenterology. 1996;110:1975–1980. 85. Whitcomb DC, Gorry MC, Preston RA, et al. Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet. 1996;14:141–145. 86. Ellis I, Lerch MM, Whitcomb DC. Genetic testing for hereditary pancreatitis: Guidelines for indications, counselling, consent and privacy issues. Pancreatology. 2001;1:405–415. 87. Sahin-Toth M. Human cationic trypsinogen. Role of Asn-21 in zymogen activation and implications in hereditary pancreatitis. J Biol Chem. 2000;275:22750–22755. 88. Sahin-Toth M, Graf L, Toth M. Trypsinogen stabilization by mutation Arg117–->His: A unifying pathomechanism for hereditary pancreatitis? Biochem Biophys Res Commun. 1999;264:505–508. 89. Sahin-Toth M, Toth M. Gain-of-function mutations associated with hereditary pancreatitis enhance autoactivation of human cationic trypsinogen. Biochem Biophys Res Commun. 2000;278:286–289. 90. Kukor Z, Toth M, Pal G, et al. Human cationic trypsinogen. Arg (117) is the reactive site of an inhibitory surface loop that controls spontaneous zymogen activation. J Biol Chem. 2002; 277:6111–6117. 91. Archer H, Jura N, Keller J, et al. A mouse model of hereditary pancreatitis generated by transgenic expression of R122H trypsinogen. Gastroenterology. 2006;131:1844–1855. 92. Simon P, Weiss FU, Zimmer KP, et al. Spontaneous and sporadic trypsinogen mutations in idiopathic pancreatitis. JAMA. 2002;288:2122. 93. Simon P, Weiss FU, Sahin-Toth M, et al. Hereditary pancreatitis caused by a novel PRSS1 mutation (Arg-122 –-> Cys) that alters autoactivation and autodegradation of cationic trypsinogen. J Biol Chem. 2002;277:5404–5410. 94. Pfutzer R, Myers E, Applebaum-Shapiro S, et al. Novel cationic trypsinogen (PRSS1) N29T and R122C mutations cause autosomal dominant hereditary pancreatitis. Gut. 2002;50:271–272. 95. Ruthenburger M, Mayerle J, Lerch MM. Cell biology of pancreatic proteases. Endocrinol Metab Clin North Am. 2006;35:313–331. 96. Witt H, Luck W, Becker M. A signal peptide cleavage site mutation in the cationic trypsinogen gene is strongly associated with chronic pancreatitis. Gastroenterology. 1999;117:7–10. 97. Teich N, Ockenga J, Hoffmeister A, et al. Chronic pancreatitis associated with an activation peptide mutation that facilitates trypsin activation. Gastroenterology. 2000;119:461–465. 98. Ferec C, Raguenes O, Salomon R, et al. Mutations in the cationic trypsinogen gene and evidence for genetic heterogeneity in hereditary pancreatitis. J Med Genet. 1999;36:228–232. 99. Teich N, Le Marechal C, Kukor Z, et al. Interaction between trypsinogen isoforms in genetically determined pancreatitis: Mutation E79K in cationic trypsin (PRSS1) causes increased transactivation of anionic trypsinogen (PRSS2). Hum Mutat. 2004;23:22–31. 100. Gorry MC, Gabbaizedeh D, Furey W, et al. Mutations in the cationic trypsinogen gene are associated with recurrent acute and chronic pancreatitis. Gastroenterology. 1997;113:1063–1068. 101. Sahin-Toth M. Hereditary pancreatitis-associated mutation asn (21) –-> ile stabilizes rat trypsinogen in vitro. J Biol Chem. 1999;274:29699–29704. 102. Gaboriaud C, Serre L, Guy-Crotte O, et al. Crystal structure of human trypsin 1: Unexpected phosphorylation of Tyr151. J Mol Biol. 1996;259:995–1010. 103. Chen JM, Ferec C. Molecular basis of hereditary pancreatitis. Eur J Hum Genet. 2000;8:473–479. 104. Nishimori I, Kamakura M, Fujikawa-Adachi K, et al. Mutations in exons 2 and 3 of the cationic trypsinogen gene in Japanese families with hereditary pancreatitis. Gut. 1999;44:259–263. 105. Chen JM, Kukor Z, Le Marechal C, et al. Evolution of trypsinogen activation peptides. Mol Biol Evol. 2003;20:1767–1777. 106. Teich N, Bodeker H, Keim V. Cathepsin B cleavage of the trypsinogen activation peptide. BMC Gastroenterol. 2002;2:16. 107. Gaiser S, Ahler A, Gundling F, et al. Expression of mutated cationic trypsinogen reduces cellular viability in AR4–2J cells. Biochem Biophys Res Commun. 2005;334:721–728. 108. Chen JM, Piepoli Bis A, Le Bodic L, et al. Mutational screening of the cationic trypsinogen gene in a large cohort of subjects with idiopathic chronic pancreatitis. Clin Genet. 2001;59:189–193.

Chapter 21 109. Sahin-Toth M. Biochemical models of hereditary pancreatitis. Endocrinol Metab Clin North Am. 2006;35:303–312, ix. 110. Idris MM, Bhaskar S, Reddy DN, et al. Mutations in anionic trypsinogen gene are not associated with tropical calcific pancreatitis. Gut. 2005;54:728–729. 111. Witt H, Sahin-Toth M, Landt O, et al. A degradation-sensitive anionic trypsinogen (PRSS2) variant protects against chronic pancreatitis. Nat Genet. 2006;38:668–673. 112. Rosendahl J, Witt H, Szmola R, et al. Chymotrypsin C (CTRC) variants that diminish activity or secretion are associated with chronic pancreatitis. Nat Genet. 2007. 113. Witt H, Luck W, Hennies HC, et al. Mutations in the gene encoding the serine protease inhibitor, Kazal type 1 are associated with chronic pancreatitis. Nat Genet. 2000;25:213–216. 114. Weiss FU, Simon P, Witt H, et al. SPINK1 mutations and phenotypic expression in patients with pancreatitis associated with trypsinogen mutations. J Med Genet. 2003;40:e40. 115. Witt H, Simon P, Lerch MM. [Genetic aspects of chronic pancreatitis]. Dtsch Med Wochenschr. 2001;126:988–993. 116. Hirota M, Kuwata K, Ohmuraya M, et al. From acute to chronic pancreatitis: The role of mutations in the pancreatic secretory trypsin inhibitor gene. Jop. 2003;4:83–88. 117. Threadgold J, Greenhalf W, Ellis I, et al. The N34S mutation of SPINK1 (PSTI) is associated with a familial pattern of idiopathic chronic pancreatitis but does not cause the disease. Gut. 2002;50:675–681. 118. Bhatia E, Balasubramanium K, Rajeswari J, et al. Absence of association between SPINK1 trypsin inhibitor mutations and Type 1 or 2 diabetes mellitus in India and Germany. Diabetologia. 2003;46:1710–1711. 119. Bhatia E, Choudhuri G, Sikora SS, et al. Tropical calcific pancreatitis: Strong association with SPINK1 trypsin inhibitor mutations. Gastroenterology. 2002;123:1020–1025. 120. Pfutzer RH, Barmada MM, Brunskill AP, et al. SPINK1/PSTI polymorphisms act as disease modifiers in familial and idiopathic chronic pancreatitis. Gastroenterology. 2000;119:615–623. 121. Ohmuraya M, Hirota M, Araki M, et al. Autophagic cell death of pancreatic acinar cells in serine protease inhibitor Kazal type 3-deficient mice. Gastroenterology. 2005;129:696–705. 122. Nathan JD, Romac J, Peng RY, et al. Transgenic expression of pancreatic secretory trypsin inhibitor-I ameliorates secretagogue-induced pancreatitis in mice. Gastroenterology. 2005;128: 717–727.


123. Boulling A, Le Marechal C, Trouve P, et al. Functional analysis of pancreatitis-associated missense mutations in the pancreatic secretory trypsin inhibitor (SPINK1) gene. Eur J Hum Genet. 2007;15:936–942. 124. Kiraly O, Boulling A, Witt H, et al. Signal peptide variants that impair secretion of pancreatic secretory trypsin inhibitor (SPINK1) cause autosomal dominant hereditary pancreatitis. Hum Mutat. 2007;28:469–476. 125. Ravnik-Glavac M, Glavac D, di Sant’ Agnese P, et al. Cystic fibrosis gene mutations detected in hereditary pancreatitis. Pflugers Arch. 1996;431:R191–192. 126. Cohn JA, Friedman KJ, Noone PG, et al. Relation between mutations of the cystic fibrosis gene and idiopathic pancreatitis. N Engl J Med. 1998;339:653–658. 127. Sharer N, Schwarz M, Malone G, et al. Mutations of the cystic fibrosis gene in patients with chronic pancreatitis. N Engl J Med. 1998;339:645–652. 128. Rich DP, Anderson MP, Gregory RJ, et al. Expression of cystic fibrosis transmembrane conductance regulator corrects defective chloride channel regulation in cystic fibrosis airway epithelial cells. Nature. 1990;347:358–363. 129. Kristidis P, Bozon D, Corey M, et al. Genetic determination of exocrine pancreatic function in cystic fibrosis. Am J Hum Genet. 1992;50:1178–1184. 130. Durie PR. Pathophysiology of the pancreas in cystic fibrosis. Neth J Med. 1992;41:97–100. 131. Berger HA, Anderson MP, Gregory RJ, et al. Identification and regulation of the cystic fibrosis transmembrane conductance regulator-generated chloride channel. J Clin Invest. 1991;88: 1422–1431. 132. Picciotto MR, Cohn JA, Bertuzzi G, et al. Phosphorylation of the cystic fibrosis transmembrane conductance regulator. J Biol Chem. 1992;267:12742–12752. 133. Dimagno MJ, Lee SH, Hao Y, et al. A proinflammatory, antiapoptotic phenotype underlies the susceptibility to acute pancreatitis in cystic fibrosis transmembrane regulator (-/-) mice. Gastroenterology. 2005;129:665–681. 134. Weiss FU, Simon P, Bogdanova N, et al. Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls. Gut. 2005;54:1456–1460.

433


C h a p t e r

22 Molecular Basis of Diseases of the Endocrine System Alan Lap-Yin Pang Malcolm M. Martin Arline L.A. Martin Wai-Yee Chan n

n

INTRODUCTION In the practice of medicine, it has long been recognized that endocrine disorders were caused by too much or too little hormone. However, the etiology of the hormonal excess or deficiency was not known. The advent of molecular biology has made it possible to elucidate many of the steps involved in hormone synthesis, hormone function, and target response, furthering our understanding of some of the causes of endocrine disorders. The endocrine system is extremely complex and affects all human activities. This chapter will limit its attention to several wellestablished hormonal systems. There are a large number of genes whose mutations are now known to be the cause of or be associated with endocrine disorders, and we will direct our attention to the more common ones. A number of books and reviews devoted to the molecular genetics of endocrine disorders have been published in recent years [1–21]. Our discussion will build on this literature.

THE PITUITARY GLAND The pituitary gland is located at the base of the brain. Despite its small size, it is one of the most important organs of the body. The pituitary gland functions as a relay between the hypothalamus and target organs by producing, storing, and releasing hormones that affect different target organs in the regulation of basic physiological functions (such as growth, stress response, reproduction, metabolism, and lactation). Anatomically, the pituitary gland is composed of two compartments. The anterior pituitary, the largest part of the gland, is composed of distinct types of hormone-secreting cells: growth hormone (GH) by the somatotrophs, thyroid-stimulating hormone (TSH) by the thyrotrophs, adrenocorticotrophin (ACTH) by the corticotrophs, follicle-stimulating


n

hormone (FSH) and luteinizing hormone (LH) by the gonadotrophs, prolactin (PR) by the lactotrophs, and melanocyte-stimulating hormone (MSH) by the melanotrophs. The posterior pituitary stores and releases hormones (such as antidiuretic hormone and oxytocin) produced by the hypothalamus. The ontogenesis of the anterior pituitary gland begins during early embryonic development. In humans, it can be identified by the third week of pregnancy [22–24]. The nascent pituitary (Rathke’s pouch) is formed under the influence of morphogenetic factors and signaling molecules expressed in the adjacent ventral diencephalon. The expression of early homeodomain transcription factors triggers the expansion of Rathke’s pouch by promoting cell proliferation. As Rathke’s pouch expands, a signaling gradient is formed that leads to the activation of specific transcription factors for the terminal differentiation of endocrine cells. The function of the pituitary gland is regulated by the hypothalamus. Secretion of anterior pituitary hormones (except prolactin) is stimulated or suppressed by specific hypothalamic releasing or inhibiting factors, respectively. The release of these factors is regulated by feedback mechanisms from hormones produced by the target organs as exemplified by the hypothalamuspituitary-thyroid axis shown in Figure 22.1. The same feedback mechanism also acts on the pituitary to finetune the production of pituitary hormones. At the molecular level, secretion of a specific pituitary hormone is triggered by binding of the respective hypothalamic releasing hormone to the corresponding membrane receptors on specific hormone-producing cells in the anterior pituitary. The pituitary hormone is released into the bloodstream, and its binding to the cell surface receptors in target organs triggers hormone secretion to carry out the relevant physiological functions. Therefore, malformation of the pituitary gland can be caused directly by intrinsic deficits of the

435

Part IV


Hypothalamus T3

TRH

Pituitary T3

TSH

TSHR Thyroid

Iodide

Iodide

NIS

gland or indirectly by disturbance in any part of the hypothalamic-pituitary-target organ axis. Pituitary disorders are caused by either hyposecretion (hypopituitarism) or hypersecretion. Hypopituitarism is the deficiency of a single or multiple pituitary hormones. Target organs usually become atrophic and function abnormally due to the loss of their stimulating factors from the pituitary. Hypopituitarism can be acquired by physical means, including traumatic brain injury, tumors that destroy the pituitary or physically interfere with hormone secretion, vascular lesions, and radiation therapy to the head or neck. In contrast, congenital hypopituitarism is caused mainly by abnormal pituitary development. Mutations in genes encoding transcription factors controlling Rathke’s pouch formation, cellular proliferation, and differentiation of cell lineages have been identified. These mutants generally result in combined pituitary hormone deficiency (CPHD), which is characterized by pituitary malformation and a concomitant or sequential loss of multiple anterior pituitary hormones. Isolated pituitary hormone deficiency (IPHD) is caused by mutations in transcription factors controlling the differentiation of a particular anterior pituitary cell line, or mutations affecting the expression or function of individual hormones or their receptors. Pituitary hypersecretion disorders are usually caused by ACTH (Cushing’s syndrome) and GH (gigantism or acromegaly).

TPO TG

MIT,DIT TPO T3, T4

T3, T4

Combined Pituitary Hormone Deficiency A number of genes have been shown to cause CPHD. Among these are the homeobox expressed in ES cells 1 (HESX1), LIM homeobox protein 3 and 4 (LHX3/ LHX4), prophet of pit-1 (PROP1), POU domain class1, transcription factor 1 (POU1f1), and zinc finger protein Gli2 (GLI2).

Homeobox Expressed in ES Cells 1 Peripheral cells

Figure 22.1 The hypothalamus-pituitary-thyroid axis. Hypothalamic thyrotropin-releasing hormone (TRH) stimulates pituitary thyroid-stimulating hormone (TSH) secretion. TSH binds to TSH receptors (TSHR) in the thyroid gland (target organ) to trigger thyroid hormone (T3 and T4) secretion. Thyroid hormones are released into bloodstream and elicit their physiological functions in peripheral cells through receptor-mediated mechanism. Meanwhile, thyroid hormones inhibit further hypothalamic TRH and pituitary TSH secretion through negative feedback. A steady circulating level of thyroid hormones is thus achieved. The example shown reflects the principal mode of regulation of the hypothalamus-pituitary-target organ axis. + indicates stimulation, ‘ indicates inhibition. NIS: sodium iodide symporter; TPO: thyroid peroxidase; TG: thyroglobulin; MIT: mono-iodotyrosyl; DIT: di-iodotyrosyl.

436

HESX1 is a paired-like homeobox transcriptional repressor essential to the early determination and differentiation of the pituitary. It is one of the earliest markers of the pituitary primordium. HESX1 is localized on chromosome 3p14.3. Both autosomal recessive and autosomal dominant inheritance have been suggested in HESX1 deficiency. Mutations in HESX1 are associated with familial cases of septo-optic dysplasia, which is characterized by variable combinations of pituitary abnormalities, midline forebrain defects, and optic nerve hypoplasia. They are also associated with CPHD and IPHD. Thirteen mutations of HESX1 have been reported. Five mutations are found in homozygous individuals, including mutations resulting in p.I26T and p.R160C, and an insertional mutation at nucleotide 385 (c.385_386ins315bp), a deletion mutation at nucleotide 449 (c.449_450delAC), and IVS2þ2T>C. Eight mutations are found in heterozygotes, including p.Q6H, p.Q117P, p.E149K, p.S170L, p.K176T, p.T181A, g.1684delG, and an insertion at nucleotide 306 (c.306_307insAG). Heterozygotes mostly demonstrate

Chapter 22

incomplete penetrance and milder phenotypes compared to homozygotes [23–26]. The mutated proteins display diminished DNA binding capacity or impaired recruitment of co-repressor molecules. In two cases (g.1684delG and p.E149K), the ability of HESX1 mutants to interact with PROP1 (an opposing transcription factor to HESX1) is altered. The change in balance between HESX1 on PROP1 is believed to disrupt the normal timing of PROP1-dependent pituitary program, which consequently leads to hypopituitarism.

LIM Homeobox Protein 3 and 4 LHX3 and LHX4 are LIM-homeodomain transcription factors important to early pituitary development and maintenance of mature anterior pituitary cells. LHX3 gene is located on chromosome 9q34.3, and LHX4 is located on 1q25.2. Nine mutations of LHX3, including missense mutation, nonsense mutation, small deletion with frameshift, and partial and complete gene deletion, have been identified [27–29]. Inheritance of LHX3 deficiency syndrome follows an autosomal recessive pattern. Accordingly, all individuals with these mutations are homozygous and have CPHD, but in most cases display normal ACTH levels. A hypoplastic pituitary is commonly observed. An enlarged anterior pituitary or microadenoma may be found in some patients. Except for gene deletion, the described mutations cause a change in amino acid residues or removal of the LIM domains and/or homeodomains. When translated, the mutant proteins display compromised DNA binding ability and variable loss of gene transactivation capacity. Six heterozygous mutations have been reported in LHX4. The inheritance pattern of LHX4 deficiency syndrome is autosomal dominant. The first identified mutation is derived from a familial case with complex disease phenotype including CPHD associated with a hypoplastic pituitary. The patients display an intronic G!C transversion at the splice-acceptor site preceding exon 5 [30], which abolishes normal LHX4 splicing and potentially generates two LHX4 mutant proteins that possess altered DNA binding capacity. The other five mutations are all located in the coding region [31–33]. All mutations are associated with CPHD and/or IPHD, and affected patients show anterior pituitary hypoplasia. The LHX4 mutant proteins show reduced or complete loss of DNA binding and transactivation properties on target gene promoters.

Prophet of Pit-1 PROP1 is a paired-like transcription factor restricted to the developing anterior pituitary. PROP1 is required for the determination of somatotrophs, lactotrophs, and thyrotrophs, and differentiation of gonadotrophs. As reflected by its name, PROP1 expression precedes and is required for PIT-1 (now called POU1F1) expression. In humans, PROP1 mutations are the leading causes of CPHD, accounting for 30%–50% of familial cases. Nevertheless, the presentation of deficiencies (disease onset and severity) is variable. Some patients also display evolving ACTH/cortisol deficiency. The

Molecular Basis of Diseases of the Endocrine System

majority of patients have a hypoplastic or normal anterior pituitary. However, a hyperplastic pituitary with subsequent involution has also been reported. PROP1 is located on chromosome 5q35.3. Seventeen mutations of PROP1 have been reported, including 6 missense mutations, 6 nonsense mutations, 4 insertion/deletion frameshift mutations, 1 splicing mutation, and 1 complete gene deletion [23,34–40]. Most mutations were found in homozygous and compound heterozygous patients. However, three of the mutations, namely IVS2–2A>T, c.301_302delAG, and p.R120C, are identified in heterozygotes even though the inheritance of the disorder caused by PROP1 mutation follows an autosomal recessive mode. Among these mutations, the c.301_302delAG (also known as c.296_297delGA) deletion, which leads to p.S109X, is the most frequently encountered mutation. The single point (IVS2–2A>T) mutation represents the first case of PROP1 mutation that resides outside the coding region. With the exception of p.W194X mutation, all PROP1 mutations affect the DNA-binding homeodomain, which lead to a reduced or abolished DNA binding and/or gene transactivation activity of the transcription factor.

POU Domain, Class 1, Transcription Factor 1 POU1F1, also known as PIT-1, encodes a POU domain protein essential to the terminal differentiation and expansion of somatotrophs, lactotrophs, and thyrotrophs. It functions as a transcription factor that regulates the transcription of itself and other pituitary hormones and their receptors, including GH, PRL, TSH beta subunit (TSHb), TSH receptor (TSHR), and growth hormone releasing hormone receptor (GHRHR). POU1F1 is localized on chromosome 3p11. Mutations of POU1F1 have been shown to be responsible for GH, PRL, and TSH deficiencies. The inheritance and presentation of deficiencies are variable. Both autosomal recessive and autosomal dominant inheritance have been suggested, and both normal and hypoplastic anterior pituitaries have been observed. Twenty-four mutations, including 14 missense mutations, 5 nonsense mutations, 3 insertion/deletion frameshift mutations, 1 splicing mutation, and 1 gene deletion have been found in homozygous or compound heterozygous patients, while 6 distinct mutations (p.P14L, p.P24L, p.K145X, p.Q167K, p.K216E, p.R271W) were found in heterozygotes [3,23,41–44]. Compound heterozygous patients appear to have a more severe disease phenotype. The POU1F1 mutations are mainly found in the POU-specific and POU-homeodomains, which are important interfaces for high-affinity DNA binding on GH and PRL genes and protein-protein interaction with other transcription factors. Consequently, DNA-binding and/or gene transactivation capacity is impaired. In some cases the mutant proteins act as dominant inhibitors of gene transcription.

Zinc Finger Protein Gli2 GLI family of transcription factors is implicated as the mediators of Sonic hedgehog (Shh) signals in vertebrates. In humans, Shh signaling is associated with 437

Part IV


the forebrain defect holoprosencephaly. GLI2 gene is localized on chromosome 2q14. GLI2 deficiency phenotype follows an autosomal dominant inheritance pattern. Four heterozygous mutations (c.2274del1, p.W113X, p.R168X, and IVS5þ1G>A) were identified in 7 of 390 holoprosencephaly patients who also displayed malformed anterior pituitary and pan-hypopituitarism [45]. All mutations were shown or predicted to lead to premature termination of GLI2 protein.

Growth Hormone GH1 is a 191 amino acid (22 kDa) single-chain polypeptide hormone synthesized and secreted by somatotrophs in the anterior pituitary. It is the major player in many physiological processes related to growth and metabolism. For instance, GH1 displays lactogenic, diabetogenic, lipolytic, and protein anabolic effects, and promotes salt and water retention. Thus, its action affects multiple organs. GH1 is considered to affect some tissues directly, but its major effect is mediated by insulin-like growth factor 1 (IGF1). IGF1 is generated predominantly in the liver, and acts through its own receptors to stimulate cell proliferation and maturation in cartilage, bone, muscle, and other tissues. GH deficiency leads to growth retardation in children and GH insufficiency in adults. The incidence of growth hormone deficiency (isolated or in combination with other pituitary hormone deficiencies) varies from 1 in 4,000 to 1 in 10,000 individuals. Isolated growth hormone deficiency (IGHD) refers to the conditions associated with childhood growth failure owing to the absence of GH action, and not associated with other pituitary hormone deficiencies or organic lesion. Newborns with IGHD are usually of normal length and weight. However, the growth velocity of affected children eventually falls behind progressively with age. Skeletal and dental maturation are delayed in proportion to height, and the appearance is that of a much younger person (dwarfism). Spontaneous puberty is delayed, sometimes well into adulthood, as is epiphyseal fusion. With advancing age, the skin of patients becomes wrinkled and atrophic. While there are many causes of IGHD, familial clustering in some instances has suggested a genetic basis for the disorder. Based on the presence or absence of GH secretion, clinical characteristics, and inheritance patterns, familial IGHD is classified into four types: IGHD type 1a and 1b, type 2, and type 3. IGHD type 1 is characterized by its autosomal recessive mode of transmission. IGHD type 1a is the most severe form of IGHD, with affected individuals developing severe growth retardation by 6 months of age. Anti-GH antibodies often develop in patients undergoing GH replacement therapy. The phenotype of IGHD type 1b is milder but more variable than type 1a. Patients with IGHD type 1a show no detectable serum GH, whereas low but detectable levels of GH are observed in type 1b patients, and they usually respond well to GH treatment. IGHD type 2 is inherited in an autosomal 438

dominant mode. Affected patients do not always show marked growth retardation. Disease phenotypes vary according to the type of the GH1 mutation. IGHD type 3 is an X-linked recessively inherited disorder with a highly variable disease phenotype. The precise genetic lesion that causes IGHD type 3 is still unknown.

GHRH-GH-IGF1 Axis The GHRH-GH-IGF1 axis plays a central role in the regulation of somatic growth. Consequently, genetic lesions affecting any component of the axis usually lead to GHD. The hormones and receptors along the axis represent the hot spots for GHD.

Growth Hormone Releasing Hormone Receptor (GHRHR) Mutation of GHRH is extremely rare, probably because of its small molecular size (44 amino acids). Mutation of its receptor GHRHR is more prevalent. GHRHR is a G-protein coupled receptor (GPCR) expressed specifically in somatotrophs. It is essential to the synthesis and release of GH in response to GHRH, and the expansion of somatotrophs during the final stage of pituitary development. GHRHR is localized on chromosome 7p14. Biallelic mutation in GHRHR is a frequent cause of IGHD type 1b. Patients generally display pituitary hypoplasia owing to the lack of somatotroph development. At least 14 different inactivating mutations are found in different parts of the gene, including the promoter, introns, or exons [46–53]. The mutant receptors are unable to bind to their ligands or elicit cyclic AMP (cAMP) responses after GHRH treatment. These mutations are identified in homozygous and compound heterozygous patients in accordance with an autosomal recessive mode of inheritance. However, heterozygous mutant alleles have also been reported. In vitro studies show that mutated GHRHR display dominant negative effect on wild-type GHRHR functions. Patients with homozygous mutations tend to display a more severe GHD, but the overall disease phenotype is variable.

Growth Hormone Human GH1 resides on chromosome 17q24.2. This chromosomal region contains a cluster of GH-like genes arising from gene duplication (namely GH1, CSHP, CSH1, GH2, and CSH2). The highly homologous nature of the intergenic and coding regions makes the GH locus susceptible to gene deletions arising from homologous recombination. Both autosomal dominant and autosomal recessive inheritance have been suggested for IGHD type 1a. The severity of disease phenotype due to GH1 mutation varies, with heterozygous mutations giving a milder phenotype than homozygotes. The disorder typically results from deletion or inactivating mutation of GH1. At least 5 different large deletions, 37 point mutations and small deletions, and 1 insertion mutation of GH1 have been

Chapter 22

reported [1,47,54,55]. A large number of these mutations were found in heterozygous patients. However, the most frequent GH1 mutations involve the donor splice site of intron 3, which leads to the skipping of exon 3. Mutations resulting in exon 3 skipping were also identified in exon or intron splice enhancer elements. The exon skipping event leads to an internal deletion of amino acid residues 32–71 and the production of a smaller (17.5 kDa) GH. This smaller GH inhibits normal GH secretion in a dominant negative manner. Five missense mutations, namely p.C53S (homozygous mutation), p.R103C, p.D112G, p.D138G, and p.I179M (heterozygous mutations), lead to the production of a biologically inactive GH that can counteract GH action, impair GHR binding and signaling, or prevent productive GHR dimerization [56].

GH Receptor GHR is localized on chromosome 5p12–13 and encodes a single transmembrane domain glycoprotein belonging to the cytokine receptor superfamily. In mature form, GHR encodes 620 amino acid residues, with the first 246 residues (encoded by exons 3 to 7) constituting the extracellular domain for GH binding and receptor dimerization, the middle 24 residues representing the transmembrane domain (exon 8), and the last 350 residues (exon 9 and 10) forming the intracellular domain for GH signaling. GHR is predominantly expressed in liver. The binding of GH triggers receptor dimerization and activation of downstream signaling process leading to IGF-1 production. The absence of GHR activity causes an autosomal recessive disorder called Laron’s syndrome. Affected patients display clinical features similar to IGHD but are characterized by a low level of IGF-I and an increased level of GH. Over 50 GHR mutations which affect the coding region and splicing of GHR transcripts have been identified [47,57–62]. A vast majority of them impact the extracellular domain of GHR. The mutated GHRs display reduced affinity to GH. In other cases, GHR mutations lead to defective homodimer formation and thus defective GH binding. The intracellular domain of GHR is lost in certain splice site mutants. The truncated receptor, which carries only the extracellular domain, is unable to anchor to the cell membrane. Although they can bind GH, these GHR mutants fail to activate downstream signaling processes; and they can deplete the binding sites from functional GHRs in a dominant negative manner.

Insulin-Like Growth Factor 1 IGF1, originally called somatomedin C, is a 70-amino acid polypeptide hormone encoded by a gene localized on chromosome 12q22–23. IGF1 is the major mediator of prenatal and postnatal growth. It is produced primarily in liver and serves as an endocrine (as well as paracrine and autocrine) hormone mediating the action of GH in peripheral tissues such as muscle, cartilage, bone, kidney, nerves, skin, lungs, and the liver itself. In the circulation IGF1 exists in a complex with IGF binding protein 3 (IGFBP3) and an acid-labile subunit (ALS).


IGF1 deficiency follows an autosomal recessive mode of transmission. It can be the result of molecular defects that affect any of the upstream components of the GHRH-GH-IGF1 axis and IGF1 itself. Currently, only four IGF1 mutations have been described. The first case is a homozygous deletion of 181 nucleotides including exons 4 and 5 of IGF1. In patients with this mutation, the translated product of IGF1 is totally absent. Another case was found in a patient with low circulating IGF1: a homozygous T!A transversion was found at the 3’UTR of IGF1. The mutation disrupts the consensus sequence for mRNA polyadenylation so that the E-domain of IGF1 precursor, which is essential to IGF maturation, is altered. In two homozygous missense mutations, the V44M mutant shows a severely reduced affinity to IGF1 receptor. The other mutant, which has a homozygous Arg-to-Gln substitution at the C domain, displays a partial loss of affinity for the receptor [63].

GH Hypersecretion Excessive production of GH causes IGF1 overproduction leading to gigantism in children and acromegaly in adults. In general, the patients display an abnormally increased somatic growth and distorted body proportions. Affected children show delayed puberty, thickened facial features, muscle weakness, double vision or impaired peripheral vision. In adults, headache and visual impairment are common. Facial features are coarse. Systemic manifestations are seen in a variety of tissues, notably the skin, connective tissue, cartilage, and bone where it causes acral overgrowth. There is frontal bossing, prognathism, large tongue, large hands and feet, as well as thickened fingers and toes. There is generalized organomegaly. Complications are insulin resistance leading to diabetes mellitus and impairment of cardiovascular function that contribute significantly to morbidity and mortality [4]. Almost all GH hypersecretion syndromes are caused by benign pituitary GH-secreting adenomas, either as isolated disorders or associated with other genetic conditions such as multiple endocrine neoplasia (MEN1), McCune Albright’s syndrome, neurofibromatosis, or Carney’s complex. In rare cases, it can be attributed to a hypothalamic tumor or carcinoid that ectopically secretes GHRH. Activating mutation of the gene encoding G-protein subunit Gsa and inactivating mutations of GHR, which lead to overactivation of GHRHR and impaired negative feedback on GH production, respectively, are identified in GH-secreting pituitary tumors [64]. A recent report suggests that an inactivating mutation of the gene encoding aryl hydrocarbon receptor-interacting protein may predispose to formation of pituitary adenoma [65].

THE THYROID GLAND The thyroid, one of the largest endocrine glands, is composed of two types of secretory elements: the follicular and parafollicular cells. The former are responsible for 439

Part IV


thyroid hormone production, and the latter elaborate calcitonin. The factors that control thyroidal embryogenesis and account for the majority of cases of thyroid agenesis or dysgenesis are presently poorly understood. Although the thyroid is capable of some independent function, thyroid hormone production is regulated by the hypothalamic-pituitary-thyroid axis (Figure 22.1). Hypothalamic tripeptide thyrotropin-releasing hormone (TRH) stimulates pituitary TSH production. TSH in turn stimulates the thyroid follicular cells to secrete prohormone thyroxine (T4) and its active form triiodothyronine (T3). Since thyroid hormone has a profound influence on metabolic processes, it plays a key role in normal growth and development.

Hypothyroidism Impaired activity of any component of the hypothalamic-pituitary-thyroid axis will result in decreased thyroid function. Hypothyroidism leads to a slowing of gross metabolic rates. The common causes are faulty embryogenesis, inflammation (most often autoimmune thyroiditis: Hashimoto’s thyroiditis), or a reduction in functioning thyroid tissue due to prior surgery, radiation damage, and cancer. Congenital hypothyroidism is the most common congenital endocrine disorder with an incidence of about 1 in 3500 births. The majority of cases (85%) are nongoitrous and are due to faulty embryogenesis (athyreosis, agenesis, or dysembryogenesis). A small number are goitrous, the result of enzyme defects in hormone biosynthesis (dyshormonogenesis). The molecular causes of athyreosis are not well understood. Clinically congenital hypothyroidism often presents within the first few days of life with constipation, poor feeding, umbilical hernia, decreased activity, or prolonged physiological jaundice. Childhood onset (juvenile) hypothyroidism is characterized by thyroid enlargement, slow growth, delayed neuromuscular development, delayed tooth eruption, slow speech, dry skin, hoarse voice, coarse facial features, and retarded bone age. Pubertal development may be early or late depending on age of onset and severity of the hormonal deficiency. The majority of cases of juvenile hypothyroidism are due to chronic lymphocytic (Hashimoto’s) thyroiditis. Hypothyroidism in the adult is most often seen in middle age. Females are 8 times more likely to develop this disease than males. It is most common in individuals with a family history of thyroid disease. Hashimoto’s thyroiditis is an autoimmune disorder directed against the thyroid gland. The onset of the disease is slow, and it may take months or even years before it is detected. It may occasionally be seen in association with other endocrinopathies and in polyglandular syndromes. Symptoms vary widely depending on the severity and progression of the deficiency. The most common complaints are thyromegaly, increased sensitivity to cold, constipation, pale dry skin, hoarse voice, elevated blood cholesterol, unexplained weight gain, muscle aches and stiffness, weakness, heavier than normal menstrual periods, and frequent depression which 440

worsens with time. Hypothyroidism in the elderly is associated with an increased risk of heart disease and hypertension. The genes responsible for the development of thyroid follicular cells include thyroid transcription factor 1 (TIF1, also known as TITF1, NKX21, or T/EBP), thyroid transcription factor 2 (TTF2, also known as TITF2, FOXE1, or FKHL15), paired box transcription factor 8 (PAX8), TSH, and TSHR. Mutation of these genes accounts for about 5% of hypothyroidism patients. TITF1, TITF2, and PAX8 mutations give rise to nonsyndromic congenital hypothyroidism, while mutations of TSH and TSHR cause syndromic congenital hypothyroidism. Most past work had been devoted to the understanding of the molecular genetics of syndromic congenital hypothyroidism. The presence of congenital goiter (which accounts for the remaining 15% of the cases) has been linked to hereditary defects in the enzymatic cascade of thyroid hormone synthesis. Mutations in sodium iodide symporter (NIS), pendrin (PDS, also known as SLC264A), thyroid peroxidase (TPO), thyroid oxidase 2 (THOX2, also known as dual oxidase DUOX2, LNOX2), and thyroglobulin (TG) affect organification of iodide and have been linked to congenital hypothyroidism [66]. Etiologically, three types of congenital hypothyroidism can be distinguished: (i) central congenital hypothyroidism including hypothalamic (tertiary) and pituitary (secondary) hypothyroidism, (ii) primary hypothyroidism (impairment of the thyroid gland itself), and (iii) peripheral hypothyroidism (resistance to thyroid hormone).

Central Congenital Hypothyroidism Central hypothyroidism may be caused by pituitary or hypothalamic diseases leading to deficiency of TSH or TRH. Except for a single case of inactivating mutation of the TSH-releasing hormone (TRH), the majority of cases of central congenital hypothyroidism are caused by TSH mutations. The action of TRH is mediated by its cell surface receptor in the pituitary. TRH receptor mutation is very rare [67]. The majority of cases of congenital isolated TSH deficiency are characterized by low levels of thyroid hormone and low TSH unresponsive to administration of TRH. Prevalence of this condition is estimated to range from 1 in 30,000 to 1 in 50,000 individuals. Thyroid-Stimulating Hormone. TSH is a heterodimeric glycohormone sharing a common a chain with FSH, LH, and choriogonadotropin (CG). The gene encoding the a chain is on chromosome 6. The gene encoding b chain of TSH is localized on chromosome 1p22. It has 3 exons. Transmission of congenital isolated TSH deficiency follows an autosomal recessive pattern. Patients with homozygous and compound heterozygous mutations in TSHb have been identified in different ethnic populations. Seven different mutations have been identified, with 6 of them located in exon 2 or exon 3 of the gene and the other one affects the donor splice site of intron 2. The most common mutation is a single base deletion

Chapter 22

in exon 3, resulting in the substitution of cysteine-105 for valine and a frameshift with the appearance of a premature stop codon at position 114 (p.C105fs114X). Cysteine105 is a mutation hot spot in TSHb [5,68,69]. Different mutations have different effects on TSHb. Nonsense mutations lead to a truncated TSHb subunit, while other mutations may cause a change in conformation. Thus, mutated TSHb may be immunologically active but biologically inactive, depending on how significant the mutation is on the structure of the protein. There is also variability in the clinical presentation of patients carrying different mutations. TSH Receptor–Inactivating Mutations. The effects of TSH on thyroid follicular cells are mediated by TSHR, a cell surface receptor which, together with the receptor for FSH (FSHR) and the receptor for LH and CG (LHR), forms a subfamily of the GPCR family. This subfamily of glycohormone receptors is characterized by the presence of a large amino-terminal extracellular domain (ECD) involved in hormone-binding specificity. The signal of hormone binding is transduced by a transmembrane domain (TMD) containing 7 a-helices. The intracytoplasmic C-terminal tail (ICD) of the receptor is coupled to Gsa. Binding of hormone to the receptor causes activation of Gsa and the adenylyl cyclase cascade resulting in augmented synthesis of cAMP. The receptor is also coupled to Gq and activates the inositol phosphate cascade. TSHR is located on chromosome 14q31 and is composed of 10 exons. A subgroup of patients with familial congenital hypothyroidism due to TSH unresponsiveness has homozygous or compound heterozygous loss-of-function mutations in TSHR. A total of 39 mutations of TSHR have been identified [67,70–76]. These mutations are distributed throughout the receptor with no obvious mutation hot spot. Monoallelic heterozygous inactivating mutations have been reported. In these cases, the other TSHR allele is probably inactivated by unrecognized mutations in the intronic, 50 -noncoding region, or 30 -noncoding region, because there is no evidence to support a dominant negative effect of an inactivating TSHR mutation. Depending on where the mutation is located, the effects can be defective receptor synthesis due to premature truncation, accelerated mRNA or protein decay, abnormal protein structure, abnormal trafficking, subnormal expression on cell membrane, ineffective ligand binding, and altered signaling. All mutant TSHRs are associated with defective cAMP response to TSH stimulation. There is good correlation between phenotype of resistant patients observed in vivo with receptor function measured in vitro. These mutated TSHRs result in a wide spectrum of both structural and functional thyroid abnormalities. Thyroid hormone levels in these patients range from hypothyroidism to normal. Variability in the manifestation of TSH abnormalities depends on the degree of TSHR impairment. A good correlation between phenotype and genotype was demonstrated; patients with mutated TSHR with residual activities are less severely affected than those with activity void mutated TSHR.


Thyroid Dyshormonogenesis Iodide is accrued from the blood into thyroidal cells through sodium/iodide symporter (NIS). It is attached to tyrosyl residue of TG through the action of thyroid peroxidase (TPO) in the presence of hydrogen peroxide (H2O2). Two iodinated TG couple with di-iodotyrosyl (DIT) to form T4; one DIT and one TG couple with mono-iodotyrosyl (MIT) to form T3. The coupling reaction is also catalyzed by TPO. TG molecules that contain T4 and T3 upon complete hydrolysis in lysosomes yield the iodothyroxines, T4 and T3. Disorders resulting in congenital primary hypothyroidism have been identified in all major steps in thyroid hormonogenesis. Sodium Iodide Symporter. A homozygous or compound heterozygous mutation of NIS causes an iodide transport defect and an uncommon form of congenital hypothyroidism characterized by a variable degree of hypothyroidism and goiter. It also results in low or no radioiodide uptake by the thyroid and other NISexpressing organs, and a low saliva-to-plasma iodide ratio. NIS is localized on chromosome 19p12–13.2 with 15 exons. Eleven mutations, including missense mutation, nonsense mutation, splicing mutation leading to shifting of reading frame and in-frame deletion, of NIS have been reported. The majority of the patients are homozygous, and about half of them are products of consanguineous marriage. These mutations cause inactivation of NIS resulting in abnormal uptake of iodide by the thyroid [77]. Pendrin. Pendred’s syndrome is an autosomal recessive disorder first described in 1896 and characterized by the triad of deafness, goiter, and a partial organification defect. Sensorineural hearing loss is the hallmark of this syndrome. Thyromegaly is the most variable component of the disorder among families and even within the same family, with some individuals developing large goiters, while others present with minimal to no enlargement. While many patients with Pendred’s syndrome are euthyroid, others have subclinical or overt hypothyroidism. The variability in clinical expression may be influenced by dietary iodide intake. In 1996, Pendred’s syndrome was mapped to chromosome 7q22–31. The candidate gene, PDS, also known as SLC26A4, was cloned in the following year and mutations were identified. PDS is a member of the solute carrier family 26A. It encodes a 780 amino-acid protein pendrin which is predominantly expressed in thyroid, inner ear, and kidney. More than 100 different mutations of PDS have been described (http://www.medicine.uiowa.edu/pendredandbor) in patients with classical Pendred’s syndrome. The majority of PDS mutations are missense mutations, and some of these mutant proteins appear to be retained in the endoplasmic reticulum. Other forms of mutations include nonsense mutation, splicing mutation, partial duplication, as well as insertion and deletion leading to shifting of reading frame. Individuals with Pendred’s syndrome from consanguineous families are usually homozygous for PDS mutations, while sporadic 441

Part IV


cases typically harbor compound heterozygous mutations [6,78–80]. At the thyroid level, the role of pendrin has not been defined. In thyroid follicular cells, pendrin is inserted into the apical membrane and acts as an iodide transporter for apical iodide efflux. Abnormality of pendrin affects iodide transport and may lead to iodide organification defects. This is often mild or absent, leading to the hypothesis that an as-yet-undefined mechanism may compensate for the lack of pendrin. Thyroid Peroxidase. Thyroid peroxidase (TPO) is a key enzyme in thyroid hormone biosynthesis. It catalyzes both iodination and coupling of iodotyrosine residues in TG. Human TPO is located on chromosome 2p25, with 17 exons. The mRNA is about 3 kb encoding a thyroid-specific glycosylated hemoprotein of 110 kDa bound at the apical membrane of thyrocytes. The majority of patients with congenital hypothyroidism have defects in the synthesis or iodination of TG that are attributable to TPO deficiency. Subnormal or absence of TPO activities result in thyroid iodide organification giving rise to goitrous congenital hypothyroidism. Total iodide organification defect (TIOD) as defined by perchlorate discharge test is inherited in an autosomal recessive mode. The literature of the molecular genetics of TPO is confused by the apparent mixing use of two numbering systems of the TPO mRNA, resulting in an ambiguity of the location of identified mutations [81–90]. Some laboratories numbered mutations from the beginning of the coding sequence, while others numbered mutations counting the beginning of the structural gene as nucleotide 1, consequently adding 90 more nucleotides to the former numbering system [91]. Making matters worse, some reports [81] referred to the literature without recognizing the differences between the two numbering systems. Table 22.1 lists all TPO mutations with the first nucleotide of the coding sequence as number 1 and the first amino acid of the encoded polypeptide as residue 1. TPO mutations are one of the most frequent causes of thyroid dyshormonogenesis. The clinical spectrum of the resulting phenotypes ranges from mild to severe goitrous hypothyroidism. Mutations of TPO have also been identified in follicular thyroid carcinoma and adenoma. There are 60 mutations of TPO identified in patients with congenital goitrous hypothyroidism (Table 22.1). Many patients with TPO mutation are not products of consanguineous marriage. There is no geographical or ethnic prevalence. All forms of mutations have been reported including missense mutations, nonsense mutation, frameshift due to insertion or deletion, and splicing mutations due to deletion of intronic sequences or mutation of nucleotide at intron-exon junctions. Among the 17 exons of TPO, mutations have been found in all except the first and the last exon, with exons 8 and 9 sharing the largest number of reported mutations. This is not surprising since exons 8 to 10 encode the catalytic site of the enzyme, and any mutation in these exons will cause enzyme inactivation. Mutations affecting protein 442

folding, such as the c.1429_1449 deletion which removes seven amino acids, will disturb the structure of the enzyme. The fact that TPO is glycosylated suggests that any mutation affecting a potential glycosylation site (NX-S/T), such as the missense mutation at nucleotide 391 which causes the replacement of Ser131 by Pro and disturbs the glycosylation site at Asn129, may alter TPO activity. Exons 15–17 encode the membrane spanning region and the cytoplasmic tail of TPO. Mutations affecting the membrane spanning region will disturb the insertion of the enzyme into plasma membrane. Frameshift mutations in these exons cause premature truncation of the protein, resulting in improper membrane anchoring. A heterozygous 10 bp deletion at the intron 15-exon 16 boundary identified in a patient presumably causes error in splicing and affects proper membrane insertion of the protein [84]. In another case, a homozygous 10 bp deletion in exon 16 detected in a child of consanguineous parents deletes codon 908 and causes frameshift with the addition of 36 amino acids to the carboxy terminal of the protein. The carboxy terminal of the protein is severely altered. Interestingly, this change appears to affect neither the stability of the protein nor the splicing of the mRNA [86]. Presumably, the observed phenotype is caused by abnormal cellular distribution or cellular trafficking of the protein mutant. Most cases of congenital hypothyroidism are caused by homozygous or compound heterozygous mutations of TPO. Carrier parents of affected individuals have normal thyroid function. There are examples of congenital hypothyroidism due to uniparental disomy for chromosome 2p or monoallelic expression of the mutant allele [90]. In these cases, the genetic defect is confined to the affected patient and is not inherited. TIOD is often associated with inactivating mutations in TPO. Mutant TPO alleles with residual activities are associated with milder thyroid hormone insufficiency or partial iodide organification defects (PIOD). There are also individuals with PIOD in whom only one mutated allele of TPO was identified. In such cases, the other TPO allele may have a mutation located in intronic sequences or in a distal region of the gene to affect transcription. Another possibility could be an inactivating mutation in thyroid oxidase 2 (THOX2) which has been described in patients with iodide organification defects. Thyroid Oxidase 2. THOX2 generates H2O2 which is used by TPO in the oxidation of iodine prior to iodination of the tyrosyl residues of TG. Human THOX2 is located on chromosome 15q15.3. There are two highly homologous THOX genes, namely THOX1 and THOX2, which are 16kb apart. Even though both THOX genes are expressed in thyroid glands, THOX2 is preferentially expressed in thyroid while THOX1 is preferentially expressed in airway epithelium and skin. THOX1 is not, but THOX2 is involved in H2O2 generation in the thyroid. THOX2 has 34 exons with the first exon being noncoding. The mRNA encodes a protein of 1548 amino acids, 26 of which comprise a signal peptide that is cleaved off to give the mature protein. The mature protein is glycosylated. The N-terminal segment of THOX2 is homologous to peroxidases, while the C-terminal

Chapter 22

Table 22.1


Inactivating Mutations of Thyroid Peroxidase (TPO). The First Base of the Coding Sequence Is Assigned Nucleotide Number 1, and the First Amino Acid of the Encoded Polypeptide Is Denoted as Residue Number 1

Exon

Mutation and Nucleotide Position

Amino Acid Position and Effect on Protein

2 3 3 4 5 5 6 7 8 8 8 8 8 8 8 8 8 8 8 8 9 9 9 9 9 9 9 9 9 9 9 9 10 10 10 10 10 10 11 11 11 11 11 12 12 13 13 13 13 14 14 14 14 14 14 15 15 15 16 16

c.51dup20bp c.157 G > C c.215delA c.349 G > C c.387delC c.391 T > C c.523 C > T c.718 G > A c.843delC c.875 C > T c.920 A > C c.976 G > A c.1066 G > A c.1132 G > A c.1152 G > T c.1159 G > A c.1183_1186insGGCC c.1242 G > T c.1274 A > G c.1297 G > A c.1335delC c.1339 A > T c.1357 T > G c.1373 T > C c.1429_1449del c.1477 G > A c.1496 C > T c.1496delC c.1567 G > A c.1581 G > T c.1597 G > T exon/intron 9 þ1G > T c.1618 C > T c.1690 C > A c.1708 C > T c.1718_1723del c.1768 G > A, AG/gt to AA/gt intron 10, GA þ1, AG/gt to AG/at c.1955insT c.1978 C > G c.1993 C > T c.1994 G > A c.1999 G > A c.2077 C > T c.2153_2154delTT c.2243delT c.2268insT c.2311 G > A c.2386 G > T c.2395 G > A c.2413delC c.2415insC c.2422 T > C c.2422delT c.2512 T > A c.2579 G > A c.2647 C > T Intron 15-exon 16 boundary, g.10delccacaggaca c.2722delCGGGCCGCAG c.2748 G > A

fsX92 p.A53P p.Q72fsX86 GG/gt to GC/gt p.N129fsX208 p.S131P p.R175X p.D240N p.Q252fsX309 p.S292F p.N307T p.A326T p.A326T p.E378K p.Q384D p.G387R p.N396fsX472 p.Q384D p.N425S p.V433M p.A445, fsX472 p.I447F p.Y453D p.L458P p.A477_N483del p.G453S p.P499L p.P499fsX501 p.G453S p.W527C p.G533C

domain is highly homologous to NADPH oxidases. Thus THOX2 is also known as dual oxidase 2 (DUOX2). Defects in THOX2 result in a lack or shortage of H2O2 and consequently hypothyroidism. A total of 13

p.R540X p.L564I p.R540X p.D574_L575del p.F653fsX668 p.Q660E p.R655W p.R665Q p.G667S p.R693W p.fsF718X p.fsX831 p.E756fsX756 p.G711R p.D796Y p.E799K p.fsX831 p.fsX879 p.C808R p.C808fsX831 p.C838S p.G860R p.P883S p.R908fxX969 AG/gt to AA/gt

mutations in THOX2 have been identified (Table 22.2) [92–94]. These include missense and nonsense mutations, splicing mutations leading to exon skipping, and small deletions leading to reading frameshift and 443

Part IV


Table 22.2

Mutations of Thyroid Oxidase 2 (THOX2) CH Stands for Congenital Hypothyroidism. Numbering System Is the Same as Stated in Table 22.1

Mutation c.108 G>C, p.Q36H/ c.2895_2898delGTTC, p.S965fsX994 c.602insG, skip exon 5, p.fsX254 c.602insG, skip exon 5, p.fsX254/ c.1516 G>A, p.D506N c.1126 C>T, p.R376W/ c.2524 C>T, p.R842X c.1253delG, p.G418fsX482/ g.IVS19–2A>C c.1300 C >T, p.R434X c.2056 C>T, p.Q686X c.2101 C>T, p.R701X c.2895_2898delGTTC,p.S965fsX994 c.3329 G>A, p.R1110Q p.Q1026X

Genotype

Perchlorate Discharge b

CH Phenotype

Comp heterozygous

46%, PIOD

Permanent, mild

Heterozygous Comp heterozygous

n.d.a n.d.a

n.d.a n.d.a

Comp heterozygous

28%, PIODb

Permanent, mild

Comp heterozygous Homozygous Heterozygous Heterozygous Heterozygous

68%, PIODb 100%, TIODc 66%, PIODb 41%, PIODb 40% PIODb 20%–63% 72.8%, PIODb 20%–63%, PIODb n.d.a

Permanent, Permanent, severe Transient, mild Transient, mild Transient, mild n.d.a Permanent, mild

Homozygous Heterozygous

a

n.d.: Not determined Partial iodide organification defect as defined by the perchlorate discharge test. c Total iodide organification defect as defined by the perchlorate discharge test. b

premature truncation of the encoded protein. In one patient, genomic DNA sequencing reveals a G-insertion at position 602 in exon 5. This insertion predicts shifting of the reading frame producing a stop at codon 300. However, sequencing of the cDNA shows that in the mutant allele, exon 5 is skipped. This abnormal splicing leads to a shift of the reading frame beginning at codon 172 and producing a premature stop codon at position 254 [92]. All THOX2 mutations were identified as congenital hypothyroidism in childhood. The exception is the p.R1110Q mutation which was found in a homozygous adult woman whose thyroid function remained almost normal until the age of 44 [93]. Homozygous and compound heterozygous inactivating mutations in THOX2 lead to complete disruption of thyroid hormone synthesis and are associated with severe and permanent congenital hypothyroidism. Compound heterozygotes with one or both mutant alleles having residual activity have permanent but mild (subclinical) hypothyroidism, while heterozygotes are associated with milder, transient hypothyroidism, as illustrated in Table 22.2 [93,94]. It is unusual that a genetic defect results in a transient phenotype at a younger age. This can be due to a changing requirement of thyroid hormone with age. Thyroglobulin. TG is the most abundant protein in the thyroid. It serves the storage of iodine. Some of its tyrosine residues are iodinated by the action of TPO, and the iodinated tyrosines are coupled to form T3 and T4. TG is produced by thyroid follicular cells and secreted into the follicular lumen. Mutations of gene encoding factors responsible for the development and growth of thyroid follicular cells, such as TTF1, TTF2, PAX8, and TSHR, cause dysgenetic congenital hypothyroidism [5]. Patients present with a congenital goiter, hypothyroidism, high iodide I [131] uptake, normal organification of iodide, 444

elevated serum TSH with simultaneous low or normal serum T4 and T3, and low serum TG concentration in relation to the degree of TSH stimulation [7]. A rarer cause of congenial goitrous hypothyroidism is mutation of TG resulting in structural defects of the protein. TG is encoded by a gene which spans 270 kb on chromosome 8q24.2–24.3, composed of 48 exons, and encodes a protein of 2768 amino acids of which the N-terminal 19amino acids constitute a signal peptide. So far 38 inactivating mutations in human TG have been reported, with 22 being missense mutations, 8 splice site mutations, 5 nonsense mutations, 2 single nucleotide deletions, and 1 single nucleotide insertion resulting in shifting of the reading frame and premature truncation of the protein [7,95]. These mutations are found in exons and introns. Four mutations are the most frequently reported (p.R277X, p.C1058R, p.C1245R, and p.C1977S). Most mutations alter the folding, stability, or intracellular trafficking of the mature protein. Interestingly, some nonsense mutations, such as p.R277X, cause the production of a smaller peptide which is sufficient for the synthesis of T4 in the N-terminal domain. This results in a milder phenotype. TG deficiency is transmitted in an autosomal recessive mode. Affected individuals are either compound heterozygous or homozygous. The patient phenotypes range from mild to severe goitrous hypothyroidism. No clear phenotype-genotype correlation has been observed.

Resistance to Thyroid Hormone Resistance to thyroid hormone is characterized by reduced clinical and biochemical manifestations of thyroid hormone action relative to the circulating hormone levels. Patients have high circulating free thyroid hormones, reduced target tissue responsiveness, and an inappropriately normal or elevated TSH [5,8].

Chapter 22

The thyroid hormones, T3 and T4, exert their target organ effects via nuclear thyroid hormone receptors (TR). After entering target cells, T4 undergoes deiodination to T3, which enters the nucleus and binds to TR. Upon T3 binding, the conformation of TR changes, causing the release of co-repressors and the recruitment of co-activators resulting in the activation or repression of target gene transcription.

Thyroid Hormone Receptor There are two TR genes, TRa and TRb, located on chromosomes 17 and 3, respectively. Both genes produce two isoforms, TRa1 and TRa2 by alternative splicing, and TRb1 and TRb2 by utilization of different transcription start sites. TR binds as a monomer, or with greater affinity as homodimers or heterodimers, to thyroid hormone response elements (TREs) in target genes to regulate gene expression. The TR protein has a central DNA binding domain; the carboxy-terminal portion of TR contains the T3-ligand binding domain, the transactivation, and the dimerization domains. Unlike the other TRs, TRa2 does not bind thyroid hormone. TRs are expressed at different levels in different tissues and at different stages of development. The biological effects of different TRs are compensatory to some degree. However, some thyroid hormone effects are TR isoform specific. Thyroid hormone resistance is associated with heterozygous autosomal dominant mutations in the TRb. No TRa mutation has been reported, and 10% of families with thyroid hormone hyposensitivity do not have TRb mutation. One hundred twenty-seven different mutations of TRb have been identified in RTH families [8,96–98]. These mutations are located in the ligand binding domain and its adjacent hinge domain that encompass exons 7–10. The vast majority of these mutations cluster within three CpG-rich hot spots, namely amino acids 234–282 (hinge domain), amino acids 310–353, and amino acids 429–460 (ligand-binding domain) [99]. Many of the mutations are found in different families, and the most common of all TRb mutations is p.R338W. Most mutated receptors display reduced T3 binding or abnormal interaction with one of the cofactors involved in thyroid hormone action. Somatic TRb mutations have been identified in TSH-producing pituitary adenomas. Dimerization of TRs results in dominant negative effects of mutant TRbs. Besides impairing gene transactivation, the mutant receptors also interfere with the function of wild-type receptor by dimerizing with it, resulting in resistance to thyroid hormone. On the other hand, individuals expressing a single wild-type TRb allele are normal despite the fact they lost the other allele due to deletion. Mutations in the hinge domain of TRb do not interfere with T3 binding and translocation into the nucleus but cause impairment of transactivation function and resistance to thyroid hormone. Differences in the degree of hormonal resistance in different tissues are due to the absolute and relative levels of TRb and TRa expression.


Thyroid Hormone Cell Transporter Thyroid hormone action requires transport of the hormone from the extracellular compartments across the cell membrane, which is mediated by the protein encoded by monocarboxylate transporter gene 8 (MCT8). Clinical features of patients with MCT8 mutations are those of Allan-Herndon-Dudley syndrome (AHDS) [9,100,101]. Affected males show a homogeneous neurological phenotype with episodic involuntary movements and absence of development of speech. These patients have unusual combination of high concentration of active thyroid hormone and low level of an inactive metabolite (reverse T3). The severity of the disease is variable among families. In a few families, psychomotor and speech development are less impaired. No clear correlation of phenotype with genotype has been found. Human MCT8 is located on chromosome Xq13.2. It has 6 exons. It belongs to the family of genes officially named SLC16, the products of which catalyze the proton-linked transport of monocarboxylates, such as lactate, pyruvate, and ketone bodies. MCT8 is also known as SLC16A2 (solute carrier family 16, member 2). MCT8 encodes two putative proteins of 613 and 539 amino acids, respectively, by translation from two in-frame start sites. It is unknown whether there are two human MCT8 proteins expressed in vivo [9,101]. MCT8 contains 12 transmembrane domains with both the amino-terminal and carboxyl-terminal peptides located within the cell. It is expressed in a number of tissues, in particular liver and heart. In the pituitary, it is expressed in folliculostellate cells rather than TSH-producing cells. Twenty-two mutations of MCT8 have been identified [9,102–104]. They are distributed throughout the coding region of the gene without any obvious mutation hot spot. Mutations of MCT8 are variable, ranging from missense and nonsense mutations to deletion of a single base-pair, a triplet codon, an entire exon, and several exons. There is also insertion of a triplet codon as well as insertion of a single nucleotide resulting in shifting of reading frame and production of truncated protein. Besides these mutations, there is a family with a missense mutation affecting the putative translational start codon (c.1 A>T, p.M1L). This mutation is present in the patient as well as his healthy brother whose T3 level is normal, indicating that it is not pathogenic. This finding implies that another methionine at amino acid position 75 can serve as the translational start of a functional MCT8 protein [102]. In another family, a single nucleotide deletion in the second to last codon results in a frameshift and bypassing of the natural stop codon until another stop is encountered 195 nucleotide downstream. This mutation leads to an extension of the MCT8 protein by 65 amino acids [104]. In a female patient with full-blown AHDS clinical features, MCT8 was disrupted at the X-breakpoint of a de novo translocation t(X:9)(q13.2;p24). A complete loss of MCT8 expression was observed in cultured fibroblasts from the patient [102]. The majority of the mutations, including a number of missense mutations, result in complete loss of 445

Part IV


MCT8 transporter function, which can be due to reduced protein expression, impaired trafficking to plasma membrane, or reduced substrate affinity. Missense MCT8 mutations (such as p.S194F, p.V235M, p.R271H, p.L434W, and p.L568P) show residual activities when compared with wild-type MCT8 protein. Individuals with these mutations may have a milder phenotype. There is no clearcut phenotype-genotype correlation with MCT8 mutations. The only consistent feature among mutated MCT8 is elevated level of serum T3 [105].

Familial Nonautoimmune Hyperthyroidism Patients with a family history of thyrotoxicosis with early disease onset typically have thyromegaly, absence of typical signs of autoimmune hyperthyroidism and recurrence after medical treatment. A number of germline constitutive-activating mutations of the TSHR have been identified in patients with nonautoimmune hyperthyroidism (Table 22.3) [10,70,106–109]. The inheritance of the trait follows an autosomal dominant pattern. The majority of these mutations are located in exon 10 of TSHR, encoding the transmembrane and intracellular domains. So far only two amino acid residues with 3 different mutations (p.R183K, p.S281N, and p.S281I) which occur outside exon 10 and in exons encoding the extracellular domain have been identified. The majority of the mutations are found in the sixth and seventh transmembrane (TM) helices. In approximately 70% of the activating mutations, a purine is exchanged for a pyrimidine nucleotide, in particular, guanine for cytosine or adenosine for thymidine [10,70]. Aside from germline activating mutations, a number of sporadic mutations have also been identified in patients with nonautoimmune hyperthyroidism (Table 22.3). Germline TSHR mutations usually present later in life with milder clinical manifestation, while sporadic TSHR mutations cause severe thyrotoxicosis and goiter with neonatal or infancy onset. Missense mutations in one codon resulting in different amino acid exchanges have been observed for several gain-of-function mutations, including codons 281, 505, 568, 597, 631. Mutation hot spots include p.Ala623 and p.Phe631 [10,70,106]. Biological activities of the mutant TSHRs differ in terms of adenylyl cyclase and inositol phosphate pathway activation. Most mutations cause only constitutive activation of the cAMP pathway, whereas a few mutants activate both cAMP and phospholipase C cascades [107]. The expressivity of the activating mutations may be affected by environmental factors such as iodine uptake. Even among cases with the same mutation of TSHR, phenotypic expression can be quite variable with respect to the age of onset and severity of hyperthyroidism and thyroid growth [107,108,110]. At least in one report, there is apparent anticipation of disease onset across generations, presumably due to increased iodine supplementation in the area where the patient family resides [110]. Somatic activating mutations of the TSHR have been identified as the cause of solitary toxic adenomas 446

Table 22.3

Amino Acid Position p.R183K p.S281N p.S281I P.N372T p.A428V p.G431S p.M453T p.M463V p.A485V p.S505R p.S505N p.V509A p.L512Q p.I568V p.I568T p.V597L p.V597F p.D617Y p.A623V p.M626I p.L629F p.F631L p.F631S p.T632I p.M637R p.P639S p.N650Y p.N670S p.C672Y

Activating Mutations of TSHR in Familial Nonautoimmune Hyperthyroidism. Numbering System Is the Same as Stated in Table 22.1

Germline X X X X X X X X X X X X X X X X X X X X X X X

Sporadic

Somatic

X X X

X X X X X

X

X

X X

X X

and multinodular goiter and thyroid carcinomas, though less frequently. About 80% of toxic thyroid adenomas (hot nodules) exhibit TSHR gain-of-function mutations. An overlap of somatic and germline phenotype has only been observed in 3 (p.M453T, p.L629F, and p.P639S) of 23 known germline activating mutations. This has been ascribed to the fact that hereditary mutations cause a less severely affected phenotype, with a marginal effect on reproductive fitness. Among the 10 sporadic mutations, only 2 occur as somatic mutations in toxic adenomas.

THE PARATHYROID GLAND Histologically, the parathyroid glands comprise two types of cells: chief cells and oxyphil cells; each type may appear in clusters or occasionally mixed. Chief cells have a pale staining cytoplasm with centrally placed nuclei. The cytoplasm contains elongated mitochondria and two sets of granules: secretory granules that take a silver stain and others that stain for glycogen. The oxyphil cells are fewer in number, larger than the chief cells, and their cytoplasm has more

Chapter 22

mitochondria. The oxyphil cells do not appear until after puberty and their function is unclear. Parathyroid hormone (PTH) is secreted by the chief cells of the parathyroid glands. It is encoded by a gene located on the short arm of chromosome 11. It has 3 exons encoding a mature peptide of 84 amino acids and a signal peptide of 25 amino acids. The hormone has two main targets: bones and kidneys. In bone, PTH activates lysosomal enzymes in osteoclasts to mobilize calcium; in kidneys it promotes calcium resorption and phosphate and bicarbonate excretion by activating the cAMP signaling pathway. The synthesis and secretion of PTH is regulated by serum ionized calcium concentration.

Calcium Homeostasis The level of calcium in the blood is kept within a very narrow range between 2.2 and 2.55 mM and is present in three forms: (i) bound, (ii) complexed, and (iii) free. About 30% is bound to protein, mainly albumin; 10% is chelated, mostly to citrate; and the remaining 60% is free or ionized. In humans, the regulation of the ionized fraction of serum calcium depends on the interaction of PTH and the active form of vitamin D-1,25-dihydroxycholecalciferol [1,25(OH)2D]. Vitamin D is a prohormone which requires hydroxylation for its conversion to the active form. Vitamin D from food (ergocalciferol, D2) is absorbed in the proximal gastrointestinal tract and is also produced in the skin by exposure to ultraviolet light (cholecalciferol, D3.). It is carried by a vitamin-D binding protein to the liver where it is hydroxylated to form 25-hydroxyvitamin D. The latter equilibrates with a large stable pool, and the serum concentration of 25-hydroxyvitamin D is the best clinical measure of nutritional vitamin-D status. The 25-hydroxy-Vitamin D is then further hydroxylated in kidneys to 1,25(OH)2D under the influence of PTH to become the physiologically active hormone. Decreasing serum ionized calcium, acting via a transmembrane G-protein coupled calcium-sensing receptor, stimulates PTH secretion. PTH in turn acts on osteoclasts to release calcium from bones and inhibits calcium excretion from kidneys. PTH, hypocalcemia, and hypophosphatemia furthermore augment the formation of 1,25(OH)2D which stimulates absorption of calcium from the gut and aids PTH in mobilizing calcium from bone, while at the same time inhibiting 24-hydroxylation. The reverse occurs when calcium levels rise, and PTH secretion is inhibited. Whereas 24-hydroxylation is induced, 21-hydroxylation is inhibited, resulting in a shift to the inactive metabolite of vitamin D. Movement of calcium from bone and gut into the extracellular fluid compartment ceases, so does renal reabsorption, thereby restoring serum calcium to its normal physiological concentration. Any disturbance in this regulation may result in hypocalcemia or hypercalcemia. Symptoms and signs may vary from mild, asymptomatic incidental findings to serious life-threatening disorders depending on the duration,


severity, and rapidity of onset. Hypocalcemia is the result either of increased loss of calcium from the circulation or insufficient entry of calcium into the circulation; and hypercalcemia, the reverse. Since PTH is the main player in this scenario, its influence is central.

Hypoparathyroidism Hypoparathyroidism is characterized by levels of PTH insufficient to maintain normal serum calcium concentration. The clinical manifestations of hypoparathyroidism are those of hypocalcemia with increased neuromuscular irritability characterized by numbness, tingling, and paresthesia in the fingertips in mild cases. Facial twitching, tetany, and finally convulsions may occur in more severe cases. Alkalosis, hypokalemia, and hypomagnesemia aggravate the symptoms of hypocalcemia, whereas acidosis ameliorates them. The most common cause of hypoparathyroidism is injury to the parathyroid glands during head and neck surgery or due to autoimmunity (either isolated or as a polyglandular syndrome). Familial forms of congenital and acquired hypoparathyroidism are relatively rare. Both familial isolated hypoparathyroidism and familial hypoparathyroidism accompanied by abnormalities in multiple organ systems have been described.

Familial Isolated Hypoparathyroidism Several forms of familial isolated hypoparathyroidism with autosomal dominant, autosomal recessive, and X-linked recessive inheritance have been described [11]. Mutations affecting the signal peptide of prepro-PTH have been reported in families with hypoparathyroidism following an autosomal recessive or autosomal dominant inheritance pattern. A patient with a single base substitution resulting in the replacement of Cys18 by Arg, which affects the processing of the mutant pre-pro-PTH, manifested autosomal dominant hypoparathyroidism. In another family with autosomal recessive hypoparathyroidism, a single base substitution gave rise to the replacement of Ser23 by Pro. The mutant pre-pro-PTH cannot be cleaved, resulting in the degradation of mutant peptide in endoplasmic reticulum. A third mutation that occurs at the exon 2-intron 2 boundary results in the skipping of exon 2 and splicing of exon 1 to exon 3. This causes the loss of the initiation codon and signal peptide, and gives rise to autosomal recessive isolated hypoparathyroidism. Glial cells missing (GCM) belongs to a small family of key regulators of parathyroid gland development. There are two forms: GCMA and GCMB. The mouse homolog of GCMB, Gcm2, is expressed exclusively in parathyroid glands. Five different homozygous mutations of GCMB (two missense mutations, p.R47L and p.G63S; an intragenic microdeletion removing exons 1–4; and two single nucleotide deletions leading to frameshift, c.1389delT and c.1399delC) have been identified in patients with isolated hypoparathyroidism. These mutations either disrupt the DNA binding domain or remove the 447

Part IV


transactivation domain of GCMB, leading to inactivation of the protein. The heterozygous carriers of these mutations are asymptomatic. Thus, this disorder follows an autosomal recessive mode of inheritance [11,111]. Aside from mutations of PTH and GCMB, X-linked recessive hypoparathyroidism due to mutation of a gene localized to chromosome Xq26-q27 has been reported in two multigenerational kindreds. The candidate gene has not been cloned yet.

Familial Hypoparathyroidism as Part of a Complex Congenital Defect Hypoparathyroidism may be part of a polyglandular autoimmune disorder or associated with multiple organ abnormalities. Because of the involvement of multiple organs in these disorders, it is likely the abnormalities are not intrinsic to the parathyroid gland but consequential to other abnormalities. Hypoparathyroidism occurs in HAM syndrome (Hypoparathyroidism, Addison’s Disease, Mucocutaneous Candidiasis, also known as Polyglandular Failure Type 1 syndrome or Autoimmune PolyendocrinopathyCandidiasis-Ectodermal Dystrophy (APECED). This syndrome is caused by mutations of AIRE1 (autoimmune regulator type 1) [11]. Cells destined to become parathyroid glands emerge from the third and fourth pharyngeal pouches. Failure of development of the derivatives of these two pouches results in absence or hypoplasia of the parathyroids and thymus and gives rise to DiGeorge syndrome (DGS). Most cases of DGS are sporadic, but autosomal dominant inheritance of DGS has been observed. The vast majority of cases display imbalanced translocation or microdeletion of 22q11.2 [11,112]. So far, there is no consensus on the gene(s) whose mutation(s) is(are) responsible for DGS. The broad spectrum of abnormalities in DGS patients and the large genomic region in the deletion suggest the possibility of involvement of multiple genes. Similarly, abnormality of PTH is excluded in familial Hypoparathyroidism, sensorineural Deafness, and Renal dysplasia (HDR syndrome), which is inherited in an autosomal dominant mode [11]. Deletion analyses of HDR patients indicate the absence of GATA3 is responsible for HDR. GATA3 is a member of the GATA-binding family of transcription factors, encoded by a gene with 6 exons located on chromosome 10q14. The protein has 44 amino acids with two transactivation domains and two zinc finger domains. GATA3 is expressed in the developing parathyroid gland, inner ear, kidney, thymus and central nervous system. Thus, GATA3 mutations will affect parathyroid development. So far, 20 mutations of GATA3 have been identified [113,114], including 5 missense mutations, 1 in-frame deletion of 4 codons, 3 nonsense mutations, 9 insertions or deletions leading to frameshifts generating premature stop codons, 1 donor splice site mutation, and whole gene deletion. These mutations affect DNA-binding, mRNA and protein stability, or reduced protein synthesis. The pathogenic mechanism responsible for HDR syndrome is believed to be GATA3 haploinsufficiency. Other 448

diseases with hypoparathyroidism but with no genetic abnormality of PTH include several mitochondrial disorders, Kenney-Caffey and Sanjad-Sakati syndrome, Barakat syndrome, and Blomstrand’s disease [11].

Hyperparathyroidism Primary hyperparathyroidism is a genetically heterogeneous disorder, and usually occurs as a sporadic disorder. It may occur at any age, but is most common in the 60þ age group and more common in females. It results when PTH is secreted in excess due to a benign parathyroid adenoma, parathyroid hyperplasia, multiple endocrine neoplasia (MEN1 or MEN2A), or cancer. An elevated serum calcium together with low serum phosphorus is suggestive of hyperparathyroidism and becomes diagnostic when supported by increased urinary calcium excretion and elevated PTH level.

Familial Isolated Hyperparathyroidism Familial isolated hyperparathyroidism (FIHP) is a rare disorder characterized by single or multiple glandular parathyroid lesions without other syndromes or tumors. FIHP has been reported in 16 familial hyperparathyroidism patients from 14 families [12]. The mode of transmission is autosomal dominant [115]. Most FIHP kindreds have unknown genetic background. Studies of 36 kindreds reveal that a few families are associated with multiple endocrine neoplasia gene 1 (MEN1), with inactivating calcium-sensing receptor (CaSR) mutations, or DNA markers near the Hyperparathyroidism-Jaw Tumor (HPT-JT) syndrome locus at 1q25-q32.

Multiple Endocrine Neoplasia Type 1 Multiple Endocrine Neoplasia Type 1 (MEN1) is an autosomal dominant disorder with a high degree of penetrance. Over 95% of patients develop clinical manifestations by the fifth decade. The most common feature of MEN1 is parathyroid tumors which occur in about 95% of patients. Tumors of the pancreas and anterior pituitary also occur in a significant, albeit smaller percentage of patients. MEN1 is caused by germline mutations of MEN1 which is located on chromosome 11q13. The gene has 10 exons and encodes the 610 amino acid protein menin, a tumor suppressor and a nuclear protein that participates in transcriptional regulations, genome stability, cell division, and proliferation. MEN1 tumors frequently have loss of heterozygosity (LOH) of the MEN1 locus. Somatic abnormalities of MEN1 have been reported in MEN1 and non-MEN1 endocrine tumors [11,12,115,116]. There are a total of 565 different MEN1 mutations among the 1336 mutations reported, with 459 being germline and 167 being somatic (61 mutations occur both as germline and somatic), scattered throughout MEN1. Among these mutations, 41% are frameshift deletions or insertions, 23% are nonsense mutations, 20% are missense mutations, 9% are splicing mutations,

Chapter 22

6% are in-frame deletions or insertions, and 1% represent whole or partial gene deletion. Somatic missense mutations occur more frequently than germline missense mutations. The majority of these mutations (>70%) are predicted to give rise to truncated or destabilized proteins. Four mutations, namely c.249_252delGTCT (deletion at codons 83–84), c.1546–1547insC (insertion at codon 516), c.1378C>T (R460X), and c.628_631delACAG (deletion at codons 210–211), account for 12.3% of all mutations and are potential mutation hot spots. No phenotype-genotype correlations have been observed in MEN1 [116]. In fact, similar MEN1 mutations have been observed in FIHP and MEN1 patients. The reason for these altered phenotypes is not known. Between 5% and 10% of MEN1 patients do not harbor mutations in the coding region of MEN1.

Multiple Endocrine Neoplasia Type 2 Multiple Endocrine Neoplasia Type 2 (MEN2) describes the association of medullary thyroid carcinoma, pheochromocytomas, and parathyroid tumors. There are three clinical variants of MEN2, the most common of which is MEN2A, which is also known as Sipple’s syndrome. MEN2A is inherited in an autosomal dominant manner. All MEN2A patients develop medullary thyroid carcinoma (MTC), 50% develop bilateral or unilateral pheochromocytoma, and 20%– 30% develop primary hyperparathyroidism. Primary hyperparathyroidism can occur by the age of 70 in up to 70% of patients. MEN2A is caused by activating point mutations of the RET proto-oncogene. RET encodes a tyrosine kinase receptor with cadherin-like and cysteine-rich extracellular domains, and a tyrosine kinase intracellular domain. In 95% of patients, MEN2A is associated with mutations of the cysteinerich extracellular domain, and missense mutation in codon 634 (Cys to Arg) accounts for 85% of MEN2A mutations [11,12,115]. The second clinical variant is MEN2B. These patients exhibit a relative paucity of hyperparathyroidism and development of marfanoid habitus, mucosal neuromas, and intestinal ganglioneuromatosis. Of these patients, 95% present with mutation in codon 918 (Met to Thr) of the intracellular tyrosine kinase domain of RET proto-oncogene. The third clinical variant of MEN2 is MTC-only. This variant is also associated with missense mutation of RET in the cysteinerich extracellular domain, and most mutations are in codon 618. The precise mechanism of the genotypephenotype relationship in the three clinical variants is unknown [11,12].

Hyperparathyroidism-Jaw Tumor Syndrome Hyperparathyroidism-jaw tumor syndrome (HPT-JT syndrome) is an autosomal dominant disorder characterized by the development of parathyroid adenomas and carcinomas and fibro-osseous jaw tumors. The gene causing the syndrome, HRPT2, is located on chromosome 1q25. It consists of 17 exons and


encodes a ubiquitously expressed 531 amino acid protein called parafibromin. HRPT2 is a tumor-suppressor gene. Its inactivation is directly involved in the predisposition to HPT-TJ syndrome and in the development of some sporadic parathyroid tumors. The function of the gene has not been elucidated. To date, 13 different heterozygous inactivating mutations that predict truncation of parafibromin have been reported [11,12].

Calcium-Sensing Receptor and Related Disorders Extracellular ionized calcium concentration regulates the synthesis and secretion of PTH as well as parathyroid cell proliferation. The action of calcium is mediated by the calcium-sensing receptor (CaSR). Human CaSR is located on chromosome 3q13.3–21. It is composed of 6 exons encoding a protein of 1078 amino acids. CaSR is a member of Family CII of the GPCR superfamily. The protein has a large extracellular domain with 612 amino acids, a transmembrane domain of 250 amino acids containing 7 transmembrane helices, and an intracellular domain of 216 amino acids. The receptor is heavily glycosylated, which is important for normal cell membrane expression. CaSR forms homodimers via intramolecular disulfide linkages within the extracellular domain. The extracellular domain is responsible for calcium binding. However, the stoichiometry between CsSR and calcium ions is unknown. The transmembrane domain is responsible for transducing the signal of calcium binding, while the intracellular domain interacts with Gai or Gao and activates different signal transducing pathways, depending on the cell line. The critical pathway(s) through which CaSR mediates its biological effects has not been defined [11,13,14]. CaSR is expressed in parathyroid cells, kidneys, bones, along the gastrointestinal tract, and in other tissues that are not directly involved in calcium homeostasis. However, the highest cell surface expression of CaSR is found in parathyroid cells, C-cells of the thyroid, and kidneys. Parathyroid cells are capable of recognizing small perturbation in serum calcium and respond by altering the secretion of PTH. Mutations of CaSR can result in loss-of-function or gain-of-function of the receptor. Heterozygous mutations of the CaSR are the cause of a growing number of disorders of calcium metabolism, which typically manifest as asymptomatic hypercalcemia or hypocalcemia, with relative or absolute hypercalciuria or hypocalciuria. On the other hand, homozygous or compound heterozygous inactivating mutations produce a severe and sometimes lethal disease if left untreated.

Disorders Due to Loss-of-Function Mutations of CaSR There are two hypercalcemic disorders caused by inactivating mutations in CaSR: familial hypocalciuric hypercalcemia and neonatal severe primary hyperparathyroidism. 449

Part IV


Familial Hypocalciuric Hypercalcemia. A disorder that must be recognized as distinct from primary hyperparathyroidism is familial hypocalciuric hypercalcemia (FHH), also known as familial benign hypercalcemia (FBH). The hypercalcemia is usually mild and asymptomatic, and is associated with a reduction rather than an increase in urinary calcium excretion. In the majority of cases the cause appears to be an autosomal dominant loss-of-function mutation in CaSR. The mutation in FHH reduces the receptor sensitivity to calcium. In the parathyroid glands, this defect means that a higher than normal serum calcium concentration is required to reduce PTH release. In the kidney, this defect leads to an increase in tubular calcium and magnesium resorption. The net effect is hypercalcemia, hypocalciuria, and frequently hypermagnesemia, as well as normal or slightly higher serum PTH concentration. About two-thirds of the FHH kindreds studied have unique heterozygous mutations [11,13]. The inactivating mutations include 59 missense mutations, 6 nonsense mutations, 7 insertions and/or deletions, including an Alu element insertion, and 1 splice mutation. These mutations are described in the CaSR mutation database (http://www.casrdb.mcgill.ca). Some of these mutations cause a more severe hypercalcemia by inhibiting the wildtype CaSR in mutant-wild-type heterodimers [13]. There are 30% of FHH patients without an identifiable mutation. Linkage analyses have linked FHH in some of these patients to the long and short arms of chromosome 19 [11,13,14,117]. Neonatal Severe Primary Hyperparathyroidism. Neonatal severe primary hyperparathyroidism (NSHPT) represents the most severe expression of FHH. Symptoms manifest very early in life with severe hypercalcemia, bone demineralization, and failure to thrive. Most NSHPT patients have either homozygous or compound heterozygous CaSR inactivating mutations. There are also three cases of NSHPT in which de novo mutation was found in the extracellular domain of CaSR. The patients have only one copy of CaSR mutated, and no CaSR mutations are found in the parents. There are also asymptomatic patients with homozygous CaSR inactivating mutations. Thus, the severity of symptom may be affected by factors other than mutant gene dosage [117].

Disorders Due to Gain-of-Function Mutation of the CaSR There are two hypocalcemic disorders associated with gain of CaSR function due to activating mutations of the receptor. These mutated receptors are more sensitive to extracellular calcium required for PTH secretion and cause reduced renal calcium resorption. The two disorders are Autosomal Dominant Hypocalcemia (ADH) and Bartter syndrome type V. Autosomal Dominant Hypocalcemia. ADH is a familial form of isolated hypoparathyroidism characterized by hypocalcemia, hyperphosphatemia, and normal to hypoparathyroidism. Inheritance of the disorder follows an autosomal dominant mode. The patients are generally 450

asymptomatic. A significant fraction of cases of idiopathic hypoparathyroidism may in fact be ADH. More than 80% of the reported ADH kindreds have CaSR mutations. There are 44 activating mutations of CaSR reported in the literature. These mutations produce a gain of CaSR function when expressed in in vitro systems [13,117]. The majority of the ADH mutations are missense mutations within the extracellular domain and transmembrane domain of CaSR. In addition, a deletion in the intracellular domain, p.S895_V1075del, has also been described in an ADH family. The mechanism of CaSR activation by these mutations is not known. Worthwhile noting is that almost every ADH family has its own unique missense heterozygous CaSR mutation [117]. Most ADH patients are heterozygous. The only deletion-activating mutation occurs in a homozygous patient in an ADH family. However, there is no apparent difference in the severity of the phenotype between heterozygous and homozygous patients. Bartter Syndrome Type V. In addition to hypocalcemia, patients with Bartter syndrome type V have hypercalciuria, hypomagnesemia, potassium wasting, hypokalemia, metabolic alkalosis, elevated renin and aldosterone levels, and low blood pressure. Four different activating mutations of CaSR (p.K29E, p.L125P, p.C131W, and p.A843E) have been identified in patients with Bartter syndrome type V. Functional analyses show that these CaSR mutations result in a more severe receptor activation when compared to the other activating mutations described [13].

THE ADRENAL GLAND The adrenal glands are two crescent-shaped structures located at the superior pole of each kidney. Each gland is composed of two separate endocrine tissues, the inner medulla and the outer cortex, which have different embryonic origins. The adrenal medulla is responsible for the production of the catecholamines, epinephrine and norepinephrine, which are involved in fight-orflight responses. The adrenal cortex produces a number of steroid hormones that regulate diverse physiological functions. Despite the difference in origin and physiology, the hormones produced by the medulla and cortex often act in a concerted manner. The adrenal cortex is composed of three distinct cell layers: (i) the zona glomerulosa, (ii) fasciculata, and (iii) reticularis. The outermost layer (zona glomerulosa) secretes mineralocorticoids, the most important of which is aldosterone. Aldosterone primarily affects the distal renal tubular sodium-potassium exchange mechanism to promote sodium resorption, thereby regulating circulatory volume and having a major impact on cardiac function. The synthesis and release of aldosterone is influenced by angiotensin II, derived from angiotensin I under control of the enzyme renin. Renin is made by the juxtaglomerular cells of the renal cortex in response to variations in renal blood flow. To a lesser extent, the production of aldosterone is also influenced by adrenocorticotropic hormone (ACTH).

Chapter 22

The middle layer of the adrenal cortex (zona fasciculata) secretes glucocorticoids. The most important glucocorticoid is cortisol. Its action affects almost every organ and tissue in the body, by maintaining blood glucose level and blood pressure, and modulating stress and inflammatory responses. Secretion of cortisol is regulated by the hypothalamus-pituitary-adrenal axis. The hypothalamic corticotropin-releasing hormone (CRH) stimulates ACTH secretion by the pituitary corticotrophs through ligand-receptor mediated mechanism. ACTH triggers cortisol production in adrenocortical cells by binding to melanocortin receptor 2 (MC2R, which is the ACTH receptor). A series of enzymatic reactions is initiated to mediate the uptake of cholesterol and the biosynthesis of cortisol. The circulating cortisol feeds back to the pituitary and hypothalamus to suppress further ACTH secretion. The innermost layer of the adrenal cortex (zona reticularis) produces adrenal androgens. The production of adrenal androgens is also regulated by ACTH. In the fetal adrenal cortex (during weeks 7–12 of gestation), androgens are secreted and regulate the differentiation of male external genitalia. However, in adults the contribution of androgens from adrenal glands is quantitatively insignificant.

Congenital Primary Adrenal Insufficiency As with other endocrine glands, both hypo-function and hyper-function of the adrenal are associated with significant disorders. Adrenal insufficiency is generally referred to an inadequate production of cortisol by the adrenal. It may be primary or secondary. Primary adrenal insufficiency is caused by defects of the adrenals themselves. The most frequent cause is the destruction of adrenal cortex due to autoimmunity. Otherwise, it can result from inflammation, infection, surgical adrenal removal, or neoplasia spreading from other parts of the body. Congenital primary adrenal insufficiency is caused by inactivating mutations of genes responsible for normal adrenal development or cortisol production. Depending on the severity, a deficiency of cortisol alone or with other adrenal steroids would occur.

Adrenal Hypoplasia Congenita Adrenal hypoplasia congenita (AHC) is the underdevelopment of adrenal glands that typically results in adrenal insufficiency during early infancy. Two forms of AHC are known: (i) an autosomal recessive miniature adult form and (ii) an X-linked cytomegalic form. Patients affected by the latter display low or absent glucocorticoids, mineralocorticoids, and androgens and do not respond to ACTH stimulation. The adrenals are atrophic and structurally disorganized, with no normal zona formation in cortex. Impaired sexual development, owing to hypogonadotropic hypogonadism, manifests in affected males who survive childhood. The cytomegalic form of AHC is an X-linked disorder due to deletion or inactivating mutation of NR0B1,


which encodes DAX1 (dosage sensitive sex reversalAHC critical region on the X chromosome gene 1). As a result, females are unaffected carriers and males only are affected by NR0B1 mutation. DAX1 is indispensable to the development of adrenal glands, gonads, and kidneys. It encodes an orphan nuclear receptor that interacts with SF1 (Steroidogenic Factor 1; encoded by NR5A1). Binding of DAX1 inhibits SF1-mediated transactivation of genes involved in the development of hypothalamus-pituitary-adrenal-gonad axis and biosynthesis of steroid hormones. More than 100 mutations of NR0B1, affecting the DNA-binding or ligand-binding domain of DAX1, have been described [118]. The genetic lesions (mostly frameshift, nonsense, and missense mutations) are translated into truncated DAX1 proteins that lose the ability to repress SF1 transactivation activity. Phenotypic heterogeneity, in terms of severity and onset of disorder, is observed in patients with different or even the same DAX1 mutations [119,120], suggesting that other genetic, epigenetic, or environmental factors may be involved in AHC. Alternatively, the presence of residual activity in DAX1 mutants (positional effect of mutations) may determine the extent of phenotypic variation. The expression of a novel NR0B1 splice variant in the adrenal glands is also suspected to influence AHC phenotype. Similar to DAX1, SF1 is also an orphan nuclear receptor essential to normal adrenogonadal development, besides its pivotal role in steroidogenesis. However, inactivating mutation of NR5A1 does not always associate with adrenal insufficiency. The cause of such variability is still unknown.

Congenital Adrenal Hyperplasia Congenital adrenal hyperplasia (CAH) is one of the most common autosomal recessive disorders in humans. It is the result of inborn metabolic errors in adrenal steroid biosynthesis (Figure 22.2). Cholesterol is transported from the cytoplasm into mitochondria in adrenocortical cells by steroidogenic acute regulatory protein (StAR), and is first converted to pregnenolone, the common precursor of all adrenal steroids, by rate-limiting cholesterol side-chain cleavage enzyme P450scc (encoded by CYP11A1). Adrenal steroids are produced under the action of various cytochrome P450s, with some of them participating in more than one steroidogenic pathway. Depending on the enzymatic defect, an impaired production of glucocorticoids (and mineralocorticoids or androgens) can occur starting in utero. The feedback to the pituitary is undermined such that ACTH production becomes excessive. Consequently, the adrenals are overstimulated and hyperplastic. The overproduced steroid precursors are shunted to the androgen biosynthetic pathway, leading to androgen overproduction. Genital ambiguity in newborn females (owing to excessive fetal exposure in utero) and precocious pseudopuberty in both sexes are commonly observed in CAH patients. In severe cases, salt-wasting CAH occurs with life-threatening vomiting and dehydration within the first few weeks of life. 451

Part IV


Cholesterol

StAR P450scc

17α-Hydroxylase

Pregnenolone 3β-Hydroxysteroid dehydrogenase Progesterone 21-Hydroxylase Deoxycorticosterone 11β-Hydroxylase

17, 20-Lyase

17-OH Pregnenolone 3β-Hydroxysteroid dehydrogenase 17-OH Progesterone

Dehydroepiandrosterone 3β-Hydroxysteroid dehydrogenase Androsterone

Estrone

Testosterone

Estradiol

21-Hydroxylase 11-Deoxycortisol 11β-Hydroxylase

Corticosterone

Cortisol

18-OH Corticosterone

Cortisone

Dihydrotestosterone

Aldosterone zona glomerulosa

Mineralocorticoids

zona fasciculata

zona reticularis

Glucocorticoids

Sex Steroids

Figure 22.2 Pathways of adrenal steroidogenesis. The three classes of adrenal steroids are shown in bold. Enzymes or proteins that cause CAH when defective are shown in gray boxes. The 17a-hydroxylase and 17,20-lyase activities are encoded by the same enzyme (CYP17A1).

21-Hydroxylase Deficiency. The most frequent CAH variant is 21-hydroxylase deficiency (21-OHD), caused by inactivating mutations or deletion of CYP21A2, and accounts for 95% of classical CAH. In many cases the term CAH refers to 21-OHD. The failure of conversion of progesterone and 17-hydroxyprogesterone leads to their accumulation and shunting to the androgen biosynthetic pathway. Over 100 mutations, most of which are missense mutations, have been described [121]. Based on the severity of enzyme defect, three clinical forms of 21-OHD CAH are recognized: the most severe classical salt-wasting form (due to aldosterone insufficiency and androgen excess), the moderately severe classical simple-virilizing form (due to androgen excess), and the least severe nonclassical form. 11b-Hydroxylase Deficiency. The second most common cause of CAH is 11b-hydroxylase deficiency (11bOHD). The enzyme, 11b-hydroxylase (encoded by CYP11B1), catalyses the conversion of deoxycorticosterone and 11-deoxycortisol to corticosterone and cortisol, respectively (Figure 22.2). Similar to 21-OHD, the enzymatic defect leads to virilizing CAH due to accumulation of immediate steroid precursors. The accumulation of deoxycorticosterone also causes salt retention and 452

hypertension. More than 50 inactivating CYB11B1 mutations have been identified; most of them completely abolish the enzymatic activity [122]. A variant form of CAH related to 11b-OHD is caused by chimeric gene formation due to unequal crossingover. CYP11B2, which is >95% identical to and is located 40 kb upstream of CYP11B1, encodes an aldosterone synthase that is exclusively expressed in zona glomerulosa to catalyze the conversion of deoxycorticosterone to corticosterone. The high degree of homology renders the two isoforms susceptible to crossing-over during DNA replication, with regulatory sequence from one fused to the coding region of the other. Use of CYP11B2 promoter leads to no production of chimeric CYP11B2/B1 protein in zona fasciculata because the promoter is inactive in this region of the adrenal. Thus, carriers of this mutation display 11b-OHD. Conversely, the CYP11B1 promoter-driven expression of CYP11B1/B2 chimera, which retains aldosterone synthase activity, leads to overproduction of mineralocorticoids and results in an autosomal dominant disorder called glucocorticoidsuppressible hyperaldosteronism (or familial hyperaldosterone type 1) [123]. A rare case of salt-wasting CAH with 11-OHD due to homozygous internal deletion of the CYP11B2/B1 chimera has also been reported.

Chapter 22

Other Less Common Steroidogenic Enzyme Deficiency in CAH. The key enzyme in steroid hormone biosynthesis is 3b-hydroxysteroid dehydrogenase (3b-HSD). It catalyzes the conversion of progesterone, 17-OH progesterone, and androstenedione from their respective △5 steroid precursors. As a result, inactivation of 3b-HSD leads to incomplete genital development and impaired aldosterone synthesis due to a deficiency of all classes of adrenal steroids. In humans, HSD3B2 is the isoform expressed specifically in the adrenals and gonads. At least 36 inactivating HSD3B2 mutations, mostly missense mutations, have been reported. Aside from complete loss of enzymatic activity, some of the mutated enzymes display impaired stability [124,125]. CYP17A1 encodes an enzyme with dual (17ahydroxylase and 17,20-lyase) activities, mediating the biosynthesis of cortisol and sex steroid precursors (Figure 22.2). Inactivating mutations of the gene frequently produce combined enzyme deficiencies, displaying hypertension, hypokalemia, and sexual infantilism. Despite its rarity in causing CAH, more than 70 inactivating mutations of CYP17A1 have been identified [126]. Most of the reported mutations alter the enzyme structure or generate truncated products and thus completely abolish both enzymatic activities. Isolated 17,20-lyase deficiency also occurs when lyase activity is selectively impaired by mutations of amino acid residues (such as p.R347 or p.R358) that are crucial to the interaction between CYP17A1 and its redox partners (P450 oxidoreductase and cytochrome b5) in the P450-electron donor complex. Although uncommon, Lipoid Congenital Adrenal Hyperplasia (LCAH) represents the most severe form of CAH. Life-threatening mineralocorticoid and glucocorticoid deficiencies are common in infants and children. Male infants are undervirilized, and puberty is delayed in both sexes. The enlarged adrenals are filled with lipid globules. Similar damage is observed in the gonads. LCAH results from defective cholesterol to pregnenolone conversion, the first step in steroidogenesis, mediated by P450scc. So far only 5 CYP11A1 mutations have been described [127]. Most of the genetic lesions actually stem from defective cholesterol transport into the mitochondria by inactivating mutation of StAR. The lack of substrate leads to adrenal steroid deficiency and absence of feedback for ACTH suppression. The elevated level of ACTH excessively stimulates cholesterol uptake and adrenal cell growth, resulting in adrenal hyperplasia. At least 48 inactivating mutations of StAR, most of which are missense and frameshift mutations, are known [128]. In all cases, the activity of the mutated StARs, in terms of ligand binding and cholesterol-to-pregnenolone conversion, is severely impaired or totally lost.

ACTH Resistance Syndromes ACTH resistance syndromes represent a group of disorders that lead to unresponsiveness to ACTH in the production of glucocorticoid by adrenal cortex. The disorders can occur in patients with familial glucocorticoid deficiency or Triple A syndrome.


Familial Glucocorticoid Deficiency. Familial Glucocorticoid Deficiency (FGD) is a rare autosomal recessive disease characterized by cortisol deficiency, but without mineralocorticoid deficiency and pituitary structural defects. It is usually diagnosed during neonatal period or early childhood with symptoms like hypoglycemic seizures, failure to thrive, collapse and coma, and recurrent infections. Specifically, FGD patients show an extremely high plasma ACTH level, which indicates a resistance to ACTH action. They almost always develop hyperpigmentation. Adrenarche is absent in children with FGD. Tall stature is observed in some patients. FGD is caused by defects of MC2R. Based on gene mutations, FGD is subdivided into two types. FGD type 1 is caused by inactivating mutations of MC2R. The mutated receptors are completely inactive or display subnormal cortical response to ACTH stimulation. At least 38 MC2R mutations have been reported [129– 131], most of them are missense mutations in the coding region. Nucleotide substitution at the promoter region is also associated with a lower cortisol response to ACTH stimulation and results in FGD in conjunction with a frameshift mutation in the other allele [132]. FGD type 2 is caused by inactivating mutations of the MC2R accessory protein (MRAP). MRAP assists the trafficking and expression of MC2R at cell surface. So far only 9 MRAP mutations, all leading to the production of severely truncated proteins, are identified [133]. Genetic defects of MC2R and MRAP account for 45% of FGD cases, suggesting that more genes may be involved in the etiology of FGD. Triple A Syndrome. Triple A syndrome is a complex disorder characterized by adrenal failure, alacrima, and achalasia. Not all patients exhibit adrenal failure, but of those with adrenal failure 80% will have isolated glucocorticoid deficiency. Mutations of the causative gene, AAAS, are identified in patients with the syndrome [134]. However, defects in AAAS do not account for all cases of Triple A syndrome, and the expression pattern of the gene correlates poorly to pathology.

Secondary Adrenal Insufficiency Secondary adrenal insufficiency can be attributed to a lack of ACTH. The adrenal glands become atrophic and cortisol, but not aldosterone, production is extremely low or undetectable. For acquired cases, ACTH deficiency may result from pituitary tumor or other physical lesions that prevent ACTH secretion. Meanwhile, congenital cases are caused by disorders of the hypothalamus-pituitary axial components that control ACTH production. ACTH secretion is regulated by the hypothalamic corticotropin-releasing hormone (CRH). The 41 amino acid neuropeptide binds to CRH receptor (CRHR) on pituitary corticotrophs to stimulate ACTH production through enzymatic cleavage of its precursor propiomelanocortin (POMC) under the action of prohormone convertase 1 (PC-1). Malfunctioning of any of these genes can lead to ACTH deficiency. POMC deficiency syndrome, owing to recessive 453

Part IV


inactivating mutations of POMC, was described in 7 patients [135,136], and 2 cases of compound heterozygous mutations of PC-1 were reported [137]. No CRH or CRHR mutation is known. The small number of mutations reflects the rarity of these genetic defects in the etiology of ACTH deficiency. In contrast, mutations of TPIT, which encodes a T-box transcription factor important to POMC expression and the terminal differentiation of pituitary POMC-expressing cells, cause adrenal insufficiency more frequently [138].

Generalized Glucocorticoid Resistance/Insensitivity Generalized glucocorticoid resistance is a rare genetic condition characterized by generalized partial target tissue insensitivity to glucocorticoid. Patients show increased levels of ACTH and cortisol, resistance of the hypothalamus-pituitary-adrenal axis to dexamethasone suppression, but no clinical sign of hypercortisolism. Production of mineralocorticoids and androgens is increased as a result of excessive ACTH, which is reflected by symptoms such as hypertension, hypokalemic alkalosis, ambiguous genitalia, and gonadotropin-independent precocious puberty. The disorder is caused by inactivation of the glucocorticoid receptor-a isoform (GRa), which is the classical GR that functions as a ligand-dependent transcription factor. Almost all known mutations are heterozygous, implying that a complete loss of the receptor is incompatible with life. Besides one case of a small deletion at the exon-intron 6 boundary, the remaining 9 GRa mutations are missense mutations [139]. All mutations impair one or multiple actions of glucocorticoid, ranging from defective nucleocytoplasmic shuttling, reduction of gene transactivation activity and affinity for ligands, to partial or complete loss of interaction with coactivators. In some cases, the mutated receptors display a dominant negative effect on wild-type receptors.

Hypercortisolism (Cushing’s Syndrome) Excessive hormone production by the adrenal cortex may result from abnormal pituitary ACTH stimulation, pituitary tumors, ectopic ACTH produced by a neoplasm, or pathology within the adrenals themselves. The clinical picture resulting from hypersecretion of cortisol, androgens, and deoxycorticosterone is variable, depending on the etiology. The manifestations, nevertheless, are those of glucocorticoid excess. Cushing’s syndrome is caused by excessive circulating cortisol, which affects 10–15 in every million people at age 20–50. The affected individuals are characterized by moon faces and buffalo hump, with central obesity, severe fatigue, high blood pressure and glucose levels, depression, and gonadal dysfunction commonly observed. The cause of Cushing’s syndrome is mostly iatrogenic, resulting from prolonged steroid ingestion (such as from glucocorticoid drug hormone medication). Cushing’s syndrome is primarily caused by 454

ACTH-secreting pituitary adenoma (also known as Cushing’s disease) which accounts for 70% of all cases of ACTH-dependent Cushing’s syndrome. Other causes include adrenal hyperplasia or neoplasia (the second most common genetic cause) and ectopic ACTH production by other tumors (including small cell lung cancer and carcinoid tumors). All defects result in adrenal gland overgrowth and cortisol overproduction. The elevated level of cortisol promotes protein catabolism, wasting of muscles, thinning of skin, and conversion to fat without weight gain, which leads to the characteristic appearance. ACTH-independent Cushing’s syndrome constitutes the remaining subgroup of the disorder. It is well known to be caused by adrenocortical tumors or inherent endocrine tumor forming-diseases such as MEN1 and primary pigmented nodular adrenocortical disease. Recently, an activating mutation of MC2R (p.F278C) was shown to be associated with the disorder and adrenal hyperactivity [140]. Other endocrine factors emerge to play a role in disease etiology. For instance, LHR was shown to be present in adrenocortical cells, and LH/hCG is involved in adrenal hyperfunctions [141].

PUBERTY Puberty refers to the physical changes by which a child becomes an adult capable of reproduction. The maturation of the reproductive system is very complex, involves almost the entire endocrine system, and occurs in a phasic manner. During fetal development, neuroendocrine cells appear in the rostral forebrain, whence they migrate to an area in the hypothalamus to become the gonadotropin-releasing hormone (GnRH) pulse generator. During infancy, gonadotropin secretion is inhibited centrally by a sensitive negative feedback control, which keeps the reproductive system quiescent. The onset of puberty is contingent upon maturation of the central pulse generator and disinhibition and reactivation of the hypothalamic-pituitary-gonadal axis. Temporal and developmental changes in GnRH pulse frequency have differential effects on FSH and LH. Slow GnRH pulse frequencies preferentially stimulate FSH synthesis and release, whereas higher frequencies preferentially stimulate LH production. The pulsatile LH secretion promotes growth and maturation of the gonads (ovaries and testes), sex hormone production, and development of secondary sex characteristics. As puberty progresses, there is an increase in the amplitude and frequency of LH pulses, leading eventually to adult steroid production and gametogenesis. The sex hormones stimulate growth as well as function and transformation of the brain, bones, muscle, and skin in addition to the reproductive organs. Growth accelerates at the onset of puberty and stops at its completion. Before puberty, the body differences between the sexes are mainly confined to the genitalia. During puberty, major differences of size, form, shape, composition, and function develop. Puberty is accompanied

Chapter 22

by psychological, behavioral, and cultural changes, referred to as adolescence. The time of onset and subsequent course of hormonal and physical changes during puberty are highly variable and influenced by genetic makeup, nutrition, and general health. Breast budding in girls and testicular enlargement in boys are usually the first signs of puberty. Detailed studies of the progression of the physical changes with puberty (Tanner) demonstrate peak growth velocity in girls early in puberty before menarche, whereas in boys it occurs later (in the second half of puberty). The time interval between breast budding and menarche is on average 2½ years, and the average age at menarche is between 2½ and 13 years. During the first 2 years, menstrual cycles are often irregular and nonovulatory. In addition to the striking changes brought about by activation of the pituitary-gonadal axis, secretion of androgens by the adrenal gland also increases. However, gonadal and adrenal androgen production (adrenarche) is not causally related temporally, and discordance in the two is seen in a number of situations. Adrenarche occurs in response to rising adrenal androgen secretion, usually precedes the pubertal rise in gonadotropins and sex steroids by about 2 years, and is associated with differentiation and growth of the adrenal zona reticularis. The major adrenal androgens are androstenedione and epiandrosterone. They are weak androgens, which in the female, directly or by peripheral conversion, account for about 50% of serum testosterone and are largely responsible for female sexual hair development. Unlike the major gonadal sex steroids, adrenal androgens do not play an important role in the adolescent growth spurt. Any disturbance in the integrity of the brain, the hypothalamic-pituitary axis, or the peripheral endocrine system may interfere with normal puberty, whether it is developmental, inflammatory, genetic, neoplastic, or functional. Absence of one or more trophic or pituitary hormones interferes with hormonal effectiveness or end organ response, which may be on a genetic or acquired basis. Lack of signs of puberty in a female 13 years of age or a male 14 years of age becomes a concern and deserves evaluation.

Delayed Puberty The most common cause of failure of pubertal development in the female is gonadal dysgenesis, a disorder of the X chromosome. Short stature and a variety of congenital anomalies associated with elevated serum gonadotropins readily confirm the diagnosis. The exact chromosomal abnormality is established by the karyotype. Primary amenorrhea after some pubertal development may indicate an abnormality of Mu¨llerian development. The most common cause of delay in the onset of puberty in boys is constitutional. It is often diagnosed in retrospect if boys initiate puberty spontaneously before the age of 18. There is frequently a positive family history. Short stature, a younger appearance, and a


delayed bone age are common findings. In the absence of signs of puberty on physical examination, a serum testosterone level >50 mcg/dl foreshadows testicular hormone production and suggests cautious inaction and follow-up. If serum testosterone is C) of LHb have been described in 4 men and 1 woman [19,146]. All patients are homozygous carriers of the mutation. The missense mutations either interfere with the formation of active heterodimers or affect the interaction with LH receptor (LHR). The splicing mutation produces a truncated LHb subunit and abrogates LH secretion. Male homozygotes are normally masculinized at birth but lack postnatal sexual differentiation, are hypogonadal with delayed pubertal development, absence of mature Leydig cells, spermatogenic arrest, and absence of circulating LH and testosterone. The only woman with the homozygous splicing mutation has normal pubertal development, secondary amenorrhea, and infertility. All heterozygotes are fertile and have normal basal gonadotropin and sex-steroid levels.

Hypergonadotropic Hypogonadism Hypergonadotropic hypogonadism and infertility/subfertility in both sexes are the result of gonadotropin resistance caused by inactivating mutations in receptors of the two gonadotropins, LH and FSH. Both LHR and FSHR are members of GPCR family. The ECDs of the receptors convey ligand specificity and are different among the receptors, while the TMD is highly homologous between species and among the glycohormone receptors.


Leydig Cell Hypoplasia (LCH)—Inactivating Mutations of LHR. LHR is shared between LH and CG, thus the name LH/CG receptor. CG exerts its effect during early embryogenesis to induce Leydig cell maturation. LH also promotes steroidogenesis by Leydig cells, especially around the period of puberty. Inactivating mutations of LHR are recessive in nature. In males with homozygous or compound heterozygous inactivating mutations, a loss of LHR function causes resistance to LH stimulation, resulting in failure of testicular Leydig cell differentiation. This gives rise to Leydig Cell Hypoplasia (LCH), also called Leydig Cell Agenesis. A number of features distinguish LCH from other forms of male pseudohermaphroditism. LCH patients are genetic males with a 46 XY karyotype. The hormonal profile of them shows elevated serum LH level, normal to elevated FSH level, and low testosterone level, which is unresponsive to CG stimulation. Clinical presentation of LCH is variable, ranging from hypergonadotropic hypogonadism with microphallus and hypoplastic male external genitalia to a form of male pseudohermaphroditism with female external genitalia. In between are patients with variable degree of masculinization of the external genitalia. LCH patients show no development of either male or female secondary sexual characteristics at puberty. In females, LHR inactivation causes hypergonadotropic hypogonadism and primary amenorrhea with subnormal follicular development and ovulation, and infertility. LHR is located on human chromosome 2p21. It has 11 exons. The first 10 exons encode the ECD, while the last exon encodes a small portion of the ECD, the TMD, and the ICD. Currently, 23 inactivating mutations, distributed throughout LHR, have been identified in LCH patients [20,21,147,148]. The majority (17/23) of them are single base substitutions leading to either missense mutations (13/23) or nonsense mutations (4/23). All single base substitutions affect highly conserved amino acids. Both in-frame and out-of-frame loss-of-function insertion mutations have been identified. A 33-bp in-frame insertion has been found as heterozygous as well as homozygous mutation in kindreds with male pseudohermaphrodites. The insertion occurs between amino acid residues 18 and 19, immediately upstream of the signal peptide cleavage site. Partial gene deletions (deletion of exon 8 or exon 10) and minor deletion (6 nucleotides) mutations have also been identified. The majority of the inactivating mutations are found in homozygous patients. In spite of the identification of 23 mutations, there are a number of LCH kindreds in which LHR mutations have not been identified, indicating that inactivating mutations are very heterogeneous or that LCH is caused by mutation of LHR as well as other gene(s). Effect of the different mutations on LHR activity is variable. Depending on the location of the mutation in the receptor protein, it can cause diminished hormone binding, reduced surface expression, abnormal trafficking, or reduced coupling efficiency, all of which result in reduction or abolition of signal transduction 457

Part IV


triggered by hormone binding. Clinical presentation of LCH patients can be correlated with the amount of residual activity of the mutated receptor. Mutated LHRs of patients with the most severe phenotype, i.e., male pseudohermaphroditism, have zero or minimal signal transduction activity. On the other hand, patients with male hypogonadism have mutated LHRs with reduced, but not abolished, signal transduction. Ovarian Dysgenesis—Inactivating Mutation of FSHR. FSHR mediates the action of FSH. In females, FSH function is essential for ovarian follicular maturation. In male, FSH regulates Sertoli cell proliferation before and at puberty, and participates in the regulation of spermatogenesis. Loss-of-function mutations of FSHR are thus expected to be found in connection with hypergonadotropic hypogonadism associated with retarded follicular maturation and anovulatory infertility in women, and small testicles and impaired spermatogenesis in normally masculinized males. FSHR is located on chromosome 2p, next to LHR. Nine inactivating mutations of FSHR are known, all of which are missense mutations found in the ECD and TMD. The inheritance of these mutations follows an autosomal recessive mode [19,21,149]. The most frequently detected mutation is p.A198V. Female patients homozygous with this mutation present with ovarian dysgenesis that includes hypergonadotropic hypogonadism, primary or early onset secondary amenorrhea, variable pubertal development, hypoplastic ovaries with impaired follicle growth, high gonadotropin and low estrogen levels. Compound heterozygous female patients with totally or partially inactivating FSHR mutations have less prominent phenotypes. The male phenotype of inactivating FSHR mutations is less assuring. The five male subjects with homozygous p.A198V mutation are normally masculinized, with moderately or slightly decreased testicular volume, normal plasma testosterone, normal to elevated LH but high FSH levels, and variable spermatogenic failure. In some cases fertility is maintained, suggesting that FSH action is not compulsory for spermatogenesis. There is good correlation between the phenotype and the degree of receptor inactivation, as well as the site of mutation and its functional consequences. All mutations in the ECD cause a defect in ligand binding and targeting of FSHR to the cell membrane. In the TMD, the mutations have minimal effect on ligand binding but impair signal transduction to various extents.

Precocious Puberty Pubertal development is considered precocious if it occurs before 7 or 8 years of age in girls, or 9 years in boys. It is more common in girls and is mostly idiopathic. In contrast, precocious puberty in boys is due to some underlying pathology in half of the cases. Precocious pubertal development that results from premature activation of the hypothalamic-pituitarygonadal axis, and hence gonadotropin dependent, is termed central precocious puberty (CPP). Precocious sexual development that is not physiological, not 458

gonadotropin dependent, but the result of abnormal sex hormone secretion, is termed sexual precocity or gonadotropin-independent precocious puberty (also called pseudo-puberty or PPP). CPP is not uncommon in otherwise normal healthy girls. Clinically, the earliest sign of puberty in girls is breast enlargement (thelarche) in response to rising estrogen secretion, which usually precedes but may accompany or follow the growth of pubic hair. The earliest sign of puberty in boys is an increase in the size of testes and in testosterone production, followed by penile and pubic hair growth. Precocious thelarche and adrenarche may need to be considered but are readily differentiated from true precocious puberty.

Gonadotropin-Dependent Precocious Puberty A recent study of 156 children with idiopathic central precocious puberty indicates 27.5% of it to be familial. Segregation analysis reveals autosomal dominant transmission with incomplete sex-dependent penetrance [150]. Studies of a girl with CPP show a heterozygous single base substitution leading to the replacement of Arg386 by Pro (c.G1157C) in the carboxy-terminal tail of GPR54. This mutation leads to prolonged activation of intracellular signaling pathways in response to kisspeptin [151]. The kisspeptin-GPR54 signaling complex has been proposed as a gatekeeper of pubertal activation of GnRH neurons and the reproductive axis. Whether mutations affecting the kisspeptin-GPR54 duet are the genetic causes of gonadotropin-dependent precocious puberty need further study.

Gonadotropin-Independent Precocious Puberty Familial Male-Limited Precocious Puberty (FMPP)— Activating Mutations of LHR. Gain-of-function mutations, resulting in constitutive activation of LHR, cause luteinizing hormone releasing hormone (LHRH)-independent isosexual precocious puberty in boys. Constitutive activity of LHR leads to stimulation of testicular Leydig cells in the fetal and prepubertal period in the absence of the hormone, resulting in autonomous production of testosterone and pubertal development at a very young age. This autosomal dominant condition is termed familial male-limited precocious puberty (FMPP) or testotoxicosis. Signs of puberty usually appear by 2–3 years of age in boys with FMPP. These patients have pubertal to adult levels of testosterone, while the basal and LHRH-stimulated levels of gonadotropins are appropriate for age, i.e., prepubertal. There is also lack of a pubertal pattern of LH pulsatility. Activating mutations of LHR have no apparent effect on female carriers. All activating mutations of the LHR identified in FMPP patients are single base substitutions. Sixteen activating mutations in exon 11 of LHR have been identified among over 120 kindreds with FMPP [19,20]. These mutations affect 13 amino acids. Half of the mutations are located in transmembrane helix VI (transmembrane VI), which represent 67.5% of all mutations identified in FMPP patients. The most

Chapter 22

frequently mutated amino acid is Asp578, with >55% of all activating mutations affecting this amino acid. The most common mutation is the c.T1733G transition, which results in the replacement of Asp578 by Gly. This mutation represents >51% of all mutations identified in FMPP patients so far. With the exception of the replacement of Ile542 by Leu in transmembrane V, all mutations result in the substitution of amino acids which are conserved among the glycohormone receptors. LHR is prone to mutation. Among the kindreds of FMPP with confirmed molecular diagnoses, over 25% are caused by new mutations. There is no difference in clinical manifestation between familial and new mutations. Rare mutations occur more often in patients of non-Caucasian ethnic background. Detection of LHR mutations is unsuccessful in about 18% of patients diagnosed to have FMPP. All FMPP mutations reside in the TMD. Agonist affinity of the mutated receptors is largely unchanged, while cell surface expression is either the same or reduced when compared to the wild-type receptor. All FMPP mutations have been shown to confer constitutive activity to the mutated LHR by in vitro expression studies. There is no consensus on the phenotype-genotype correlation in FMPP. However, mutations that give the highest basal level of cAMP in in vitro assays are associated with an earlier age of pubertal development. Besides the germline mutations found in FMPP patients, a somatic activating mutation of LHR (p.D578H) has also been identified in tumor tissue of a number of patients with testicular neoplasia. Even though a couple of FMPP patients developed testicular neoplasia, the p.D578H mutation has never been found as a germline mutation in any FMPP patient. Its presence is confined to patients with testicular neoplasia. Activating Mutation of FSHR. FSHR is not prone to mutation. So far, there is only one gain-of-function FSHR mutation identified in a single case. The patient had been previously hypophysectomized but maintained normal spermatogenesis in spite of undetectable gonadotropins. He has a heterozygous activating mutation p.D578G in the third intracytoplasmic loop of FSHR. In vitro expression of the mutated receptor shows elevated basal activity of the receptor [149]. Ovarian Hyperstimulation Syndrome. Ovarian hyperstimulation syndrome (OHSS) is an iatrogenic complication of ovulation-induction therapy. In its most severe form, this syndrome involves massive ovarian enlargement and the formation of multiple ovarian cysts and can be fatal. OHSS can arise spontaneously during pregnancy owing to a broadening of the specificity of FSHR for hCG at high concentration of the hormone. So far, 6 missense mutations affecting 4 amino acids (p.S128Y, p.T449I, p.T449A, p.I545T, p.D567N, and p.D567G) have been identified in OHSS patients [149,152]. All except one of the mutations are found in the TMD of FSHR. The transmission of these mutations follows an autosomal dominant mode. Patients analyzed so far are heterozygous for these mutations. These mutations relax


the ligand specificity of the receptor in such a way that it also binds and becomes activated by hCG. Response of the receptor to TSH was also found for mutations that are located in the TMD. It is possible the promiscuous stimulation of follicles during the first trimester of pregnancy by hCG results in excessive follicular recruitment observed in this disorder.

Acknowledgment This work was supported in part by the Intramural Research Program of the NIH, Eunice Kennedy Shriver National Institute of Child Health and Human Development.

REFERENCES 1. Mullis PE. Genetics of growth hormone deficiency. Endocrinol Metab Clin North Am. 2007;36:17–36. 2. Jameson JL, ed. Principles of Molecular Medicine. Humana Press, Inc., New Jersey: Totowa; 1998. 3. Cohen LE, Radovick S. Molecular basis of combined pituitary hormone deficiencies. Endocr Rev. 2002;23:431–442. 4. Ayuk J, Sheppard MC. Growth hormone and its disorders. Postgrad Med J. 2006;82:24–30. 5. Winter WE, Signorino MR. Review: Molecular thyroidology. Ann Clin Lab Sci. 2001;31:221–244. 6. Glaser B. Pendred syndrome. Pediatr Endocrinol Rev. 2003;1(suppl 2):199–204; discussion 204. 7. Rivolta CM, Targovnik HM. Molecular advances in thyroglobulin disorders. Clin Chim Acta. 2006;374:8–24. 8. Refetoff S, Dumitrescu AM. Syndromes of reduced sensitivity to thyroid hormone: Genetic defects in hormone receptors, cell transporters and deiodination. Best Pract Res Clin Endocrinol Metab. 2007;21:277–305. 9. Visser WE, Friesema EC, Jansen J, et al. Thyroid hormone transport in and out of cells. Trends Endocrinol Metab. 2008; 19:50–56. 10. Duprez L, Parma J, Van Sande J, et al. TSH receptor mutations and thyroid disease. Trends Endocrinol Metab. 1998;9:133–140. 11. Thakker RV. Genetics of endocrine and metabolic disorders: Parathyroid. Rev Endocr Metab Disord. 2004;5:37–51. 12. Ferris RL, Simental AA, Jr. Molecular biology of primary hyperparathyroidism. Otolaryngol Clin North Am. 2004;37:819–831. 13. Egbuna OI, Brown EM. Hypercalcaemic and hypocalcemic conditions due to calcium-sensing receptor mutations. Best Pract Res Clin Rheumatol. 2008;22:129–148. 14. D’Souza-Li L. The calcium-sensing receptor and related diseases. Arq Bras Endocrinol Metabol. 2006;50:628–639. 15. Layman LC. Hypogonadotropic hypogonadism. Endocrinol Metab Clin North Am. 2007;36:283–296. 16. Bhagavath B, Layman LC. The genetics of hypogonadotropic hypogonadism. Semin Reprod Med. 2007;25:272–286. 17. Cadman SM, Kim SH, Hu Y, et al. Molecular pathogenesis of Kallmann’s syndrome. Horm Res. 2007;67:231–242. 18. de Roux N. GnRH receptor and GPR54 inactivation in isolated gonadotropic deficiency. Best Pract Res Clin Endocrinol Metab. 2006;20:515–528. 19. Huhtaniemi IT, Themmen AP. Mutations in human gonadotropin and gonadotropin-receptor genes. Endocrine. 2005;26:207–217. 20. Chan WY. Disorders of sexual development caused by luteinizing hormone receptor mutations. Beijing Da Xue Xue Bao. 2005;37:32–38. 21. Huhtaniemi I, Alevizaki M. Gonadotrophin resistance. Best Pract Res Clin Endocrinol Metab. 2006;20:561–576. 22. Scully KM, Rosenfeld MG. Pituitary development: Regulatory codes in mammalian organogenesis. Science. 2002;295:2231–2235. 23. Reynaud R, Saveanu A, Barlier A, et al. Pituitary hormone deficiencies due to transcription factor gene alterations. Growth Horm IGF Res. 2004;14:442–448.

459

Part IV


24. Zhu X, Lin CR, Prefontaine GG, et al. Genetic control of pituitary development and hypopituitarism. Curr Opin Genet Dev. 2005;15:332–340. 25. Coya R, Vela A, Perez de Nanclares G, et al. Panhypopituitarism: Genetic versus acquired etiological factors. J Pediatr Endocrinol Metab. 2007;20:27–36. 26. Kelberman D, Dattani MT. Hypothalamic and pituitary development: Novel insights into the aetiology. Eur J Endocrinol. 2007;157(suppl 1):S3–S14. 27. Bhangoo AP, Hunter CS, Savage JJ, et al. Clinical case seminar: A novel LHX3 mutation presenting as combined pituitary hormonal deficiency. J Clin Endocrinol Metab. 2006;91:747–753. 28. Pfaeffle RW, Savage JJ, Hunter CS, et al. Four novel mutations of the LHX3 gene cause combined pituitary hormone deficiencies with or without limited neck rotation. J Clin Endocrinol Metab. 2007;92:1909–1919. 29. Rajab A, Kelberman D, de Castro SC, et al. Novel mutations in LHX3 are associated with hypopituitarism and sensorineural hearing loss. Hum Mol Genet. 2008;17:2150–2159. 30. Machinis K, Pantel J, Netchine I, et al. Syndromic short stature in patients with a germline mutation in the LIM homeobox LHX4. Am J Hum Genet. 2001;69:961–968. 31. Tajima T, Hattori T, Nakajima T, et al. A novel missense mutation (P366T) of the LHX4 gene causes severe combined pituitary hormone deficiency with pituitary hypoplasia, ectopic posterior lobe and a poorly developed sella turcica. Endocr J. 2007;54:637–641. 32. Castinetti F, Saveanu A, Reynaud R, et al. A novel dysfunctional LHX4 mutation with high phenotypical variability in patients with hypopituitarism. J Clin Endocrinol Metab. 2008;93:2790–2799. 33. Pfaeffle RW, Hunter CS, Savage JJ, et al. Three novel missense mutations within the LHX4 gene are associated with variable pituitary hormone deficiencies. J Clin Endocrinol Metab. 2008;93:1062–1071. 34. Vieira TC, Dias da Silva MR, Cerutti JM, et al. Familial combined pituitary hormone deficiency due to a novel mutation R99Q in the hot spot region of Prophet of Pit-1 presenting as constitutional growth delay. J Clin Endocrinol Metab. 2003;88:38–44. 35. Reynaud R, Barlier A, Vallette-Kasic S, et al. An uncommon phenotype with familial central hypogonadism caused by a novel PROP1 gene mutant truncated in the transactivation domain. J Clin Endocrinol Metab. 2005;90:4880–4887. 36. Abrao MG, Leite MV, Carvalho LR, et al. Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion. Clin Endocrinol (Oxf). 2006;65:294–300. 37. Nose O, Tatsumi K, Nakano Y, et al. Congenital combined pituitary hormone deficiency attributable to a novel PROP1 mutation (467insT). J Pediatr Endocrinol Metab. 2006;19:491–498. 38. Fofanova O, Takamura N, Kinoshita E, et al. Compound heterozygous deletion of the PROP-1 gene in children with combined pituitary hormone deficiency. J Clin Endocrinol Metab. 1998;83:2601–2604. 39. Parks JS, Brown MR, Hurley DL, et al. Heritable disorders of pituitary development. J Clin Endocrinol Metab. 1999;84:4362– 4370. 40. Voutetakis A, Maniati-Christidi M, Kanaka-Gantenbein C, et al. Prolonged jaundice and hypothyroidism as the presenting symptoms in a neonate with a novel Prop1 gene mutation (Q83X). Eur J Endocrinol. 2004;150:257–264. 41. Rainbow LA, Rees SA, Shaikh MG, et al. Mutation analysis of POUF-1, PROP-1 and HESX-1 show low frequency of mutations in children with sporadic forms of combined pituitary hormone deficiency and septo-optic dysplasia. Clin Endocrinol (Oxf). 2005;62:163–168. 42. Miyata I, Vallette-Kasic S, Saveanu A, et al. Identification and functional analysis of the novel S179R POU1F1 mutation associated with combined pituitary hormone deficiency. J Clin Endocrinol Metab. 2006;91:4981–4987. 43. Snabboon T, Plengpanich W, Buranasupkajorn P, et al. A novel germline mutation, IVS4þ1G>A, of the POU1F1 gene underlying combined pituitary hormone deficiency. Horm Res. 2008;69:60–64. 44. McLennan K, Jeske Y, Cotterill A, et al. Combined pituitary hormone deficiency in Australian children: Clinical and genetic correlates. Clin Endocrinol (Oxf). 2003;58:785–794.

460

45. Roessler E, Du YZ, Mullor JL, et al. Loss-of-function mutations in the human GLI2 gene are associated with pituitary anomalies and holoprosencephaly-like features. Proc Natl Acad Sci USA. 2003;100:13424–13429. 46. Salvatori R, Fan X, Phillips JA, 3rd, et al. Isolated growth hormone (GH) deficiency due to compound heterozygosity for two new mutations in the GH-releasing hormone receptor gene. Clin Endocrinol (Oxf). 2001;54:681–687. 47. Baumann G. Genetic characterization of growth hormone deficiency and resistance: Implications for treatment with recombinant growth hormone. Am J Pharmacogenomics. 2002;2:93–111. 48. Salvatori R, Fan X, Mullis PE, et al. Decreased expression of the GHRH receptor gene due to a mutation in a Pit-1 binding site. Mol Endocrinol. 2002;16:450–458. 49. Salvatori R, Fan X, Veldhuis JD, et al. Serum GH response to pharmacological stimuli and physical exercise in two siblings with two new inactivating mutations in the GH-releasing hormone receptor gene. Eur J Endocrinol. 2002;147:591–596. 50. Carakushansky M, Whatmore AJ, Clayton PE, et al. A new missense mutation in the growth hormone-releasing hormone receptor gene in familial isolated GH deficiency. Eur J Endocrinol. 2003;148:25–30. 51. Alba M, Hall CM, Whatmore AJ, et al. Variability in anterior pituitary size within members of a family with GH deficiency due to a new splice mutation in the GHRH receptor gene. Clin Endocrinol (Oxf). 2004;60:470–475. 52. Haskin O, Lazar L, Jaber L, et al. A new mutation in the growth hormone-releasing hormone receptor gene in two Israeli Arab families. J Endocrinol Invest. 2006;29:122–130. 53. Hilal L, Hajaji Y, Vie-Luton MP, et al. Unusual phenotypic features in a patient with a novel splice mutation in the GHRHR gene. Mol Med. 2008;14:286–292. 54. Rojas-Gil AP, Ziros PG, Kanetsis E, et al. Combined effect of mutations of the GH1 gene and its proximal promoter region in a child with growth hormone neurosecretory dysfunction (GHND). J Mol Med. 2007;85:1005–1013. 55. Iughetti L, Sobrier ML, Predieri B, et al. Complex disease phenotype revealed by GH deficiency associated with a novel and unusual defect in the GH-1 gene. Clin Endocrinol (Oxf). 2008;69:170–172. 56. Hernandez LM, Lee PD, Camacho-Hubner C. Isolated growth hormone deficiency. Pituitary. 2007;10:351–357. 57. Rosenfeld RG. Molecular mechanisms of IGF-I deficiency. Horm Res. 2006;65(suppl 1):15–20. 58. Fassone L, Corneli G, Bellone S, et al. Growth hormone receptor gene mutations in two Italian patients with Laron Syndrome. J Endocrinol Invest. 2007;30:417–420. 59. Gennero I, Edouard T, Rashad M, et al. Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome. J Pediatr Endocrinol Metab. 2007;20:825–831. 60. Ying YQ, Wei H, Cao LZ, et al. Clinical features and growth hormone receptor gene mutations of patients with Laron syndrome from a Chinese family. Zhongguo Dang Dai Er Ke Za Zhi. 2007;9:335–338. 61. Fang P, Girgis R, Little BM, et al. Growth hormone (GH) insensitivity and insulin-like growth factor-I deficiency in Inuit subjects and an Ecuadorian cohort: Functional studies of two codon 180 GH receptor gene mutations. J Clin Endocrinol Metab. 2008;93:1030–1037. 62. Yamamoto H, Kouhara H, Iida K, et al. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome). Growth Horm IGF Res. 2008;18:136–142. 63. Walenkamp MJ, Wit JM. Genetic disorders in the growth hormone—insulin-like growth factor-I axis. Horm Res. 2006;66:221–230. 64. Asa SL, Digiovanni R, Jiang J, et al. A growth hormone receptor mutation impairs growth hormone autofeedback signaling in pituitary tumors. Cancer Res. 2007;67:7505–7511. 65. Georgitsi M, Raitila A, Karhu A, et al. Molecular diagnosis of pituitary adenoma predisposition caused by aryl hydrocarbon receptorinteracting protein gene mutations. Proc Natl Acad Sci USA. 2007;104:4101–4105. 66. Park SM, Chatterjee VK. Genetics of congenital hypothyroidism. J Med Genet. 2005;42:379–389.

Chapter 22 67. Beck-Peccoz P, Persani L, Calebiro D, et al. Syndromes of hormone resistance in the hypothalamic-pituitary-thyroid axis. Best Pract Res Clin Endocrinol Metab. 2006;20:529–546. 68. Partsch CJ, Riepe FG, Krone N, et al. Initially elevated TSH and congenital central hypothyroidism due to a homozygous mutation of the TSH beta subunit gene: Case report and review of the literature. Exp Clin Endocrinol Diabetes. 2006;114:227–234. 69. Miyai K. Congenital thyrotropin deficiency—From discovery to molecular biology, postgenome and preventive medicine. Endocr J. 2007;54:191–203. 70. Fuhrer D, Lachmund P, Nebel IT, et al. The thyrotropin receptor mutation database: Update 2003. Thyroid. 2003;13: 1123–1126. 71. Kanda K, Mizuno H, Sugiyama Y, et al. Clinical significance of heterozygous carriers associated with compensated hypothyroidism in R450H, a common inactivating mutation of the thyrotropin receptor gene in Japanese. Endocrine. 2006;30:383–388. 72. Jeziorowska A, Pniewska-Siark B, Brzezianska E, et al. A novel mutation in the thyrotropin (thyroid-stimulating hormone) receptor gene in a case of congenital hypothyroidism. Thyroid. 2006;16:1303–1309. 73. Camilot M, Teofoli F, Gandini A, et al. Thyrotropin receptor gene mutations and TSH resistance: Variable expressivity in the heterozygotes. Clin Endocrinol (Oxf). 2005;63:146–151. 74. Tsunekawa K, Onigata K, Morimura T, et al. Identification and functional analysis of novel inactivating thyrotropin receptor mutations in patients with thyrotropin resistance. Thyroid. 2006;16:471–479. 75. Tonacchera M, Di Cosmo C, De Marco G, et al. Identification of TSH receptor mutations in three families with resistance to TSH. Clin Endocrinol (Oxf). 2007;67:712–718. 76. Grasberger H, Van Sande J, Hag-Dahood Mahameed A, et al. A familial thyrotropin (TSH) receptor mutation provides in vivo evidence that the inositol phosphates/Ca2þ cascade mediates TSH action on thyroid hormone synthesis. J Clin Endocrinol Metab. 2007;92:2816–2820. 77. Szinnai G, Kosugi S, Derrien C, et al. Extending the clinical heterogeneity of iodide transport defect (ITD): A novel mutation R124H of the sodium/iodide symporter gene and review of genotype-phenotype correlations in ITD. J Clin Endocrinol Metab. 2006;91:1199–1204. 78. Fugazzola L, Cirello V, Dossena S, et al. High phenotypic intrafamilial variability in patients with Pendred syndrome and a novel duplication in the SLC26A4 gene: Clinical characterization and functional studies of the mutated SLC26A4 protein. Eur J Endocrinol. 2007;157:331–338. 79. Brownstein ZN, Dror AA, Gilony D, et al. A novel SLC26A4 (PDS) deafness mutation retained in the endoplasmic reticulum. Arch Otolaryngol Head Neck Surg. 2008;134:403–407. 80. Palos F, Garcia-Rendueles ME, Araujo-Vilar D, et al. Pendred syndrome in two Galician families: Insights into clinical phenotypes through cellular, genetic, and molecular studies. J Clin Endocrinol Metab. 2008;93:267–277. 81. Nascimento AC, Guedes DR, Santos CS, et al. Thyroperoxidase gene mutations in congenital goitrous hypothyroidism with total and partial iodide organification defect. Thyroid. 2003;13:1145– 1151. 82. Kotani T, Umeki K, Kawano J, et al. Partial iodide organification defect caused by a novel mutation of the thyroid peroxidase gene in three siblings. Clin Endocrinol (Oxf). 2003;59:198–206. 83. Rivolta CM, Esperante SA, Gruneiro-Papendieck L, et al. Five novel inactivating mutations in the thyroid peroxidase gene responsible for congenital goiter and iodide organification defect. Hum Mutat. 2003;22:259. 84. Tajima T, Tsubaki J, Fujieda K. Two novel mutations in the thyroid peroxidase gene with goitrous hypothyroidism. Endocr J. 2005;52:643–645. 85. Rodrigues C, Jorge P, Soares JP, et al. Mutation screening of the thyroid peroxidase gene in a cohort of 55 Portuguese patients with congenital hypothyroidism. Eur J Endocrinol. 2005;152:193– 198. 86. Pfarr N, Musholt TJ, Musholt PB, et al. Congenital primary hypothyroidism with subsequent adenomatous goiter in a Turkish patient caused by a homozygous 10-bp deletion in the thyroid peroxidase (TPO) gene. Clin Endocrinol (Oxf). 2006;64:514–518.


87. Rivolta CM, Louis-Tisserand M, Varela V, et al. Two compound heterozygous mutations (c.215delA/c.2422T-->C and c.387delC/c.1159G-->A) in the thyroid peroxidase gene responsible for congenital goitre and iodide organification defect. Clin Endocrinol (Oxf). 2007;67:238–246. 88. Tenenbaum-Rakover Y, Mamanasiri S, Ris-Stalpers C, et al. Clinical and genetic characteristics of congenital hypothyroidism due to mutations in the thyroid peroxidase (TPO) gene in Israelis. Clin Endocrinol (Oxf). 2007;66:695–702. 89. Avbelj M, Tahirovic H, Debeljak M, et al. High prevalence of thyroid peroxidase gene mutations in patients with thyroid dyshormonogenesis. Eur J Endocrinol. 2007;156:511–519. 90. Deladoey J, Pfarr N, Vuissoz JM, et al. Pseudodominant inheritance of goitrous congenital hypothyroidism caused by TPO mutations: Molecular and in silico studies. J Clin Endocrinol Metab. 2008;93:627–633. 91. Kimura S, Hong YS, Kotani T, et al. Structure of the human thyroid peroxidase gene: Comparison and relationship to the human myeloperoxidase gene. Biochemistry. 1989;28:4481–4489. 92. Pfarr N, Korsch E, Kaspers S, et al. Congenital hypothyroidism caused by new mutations in the thyroid oxidase 2 (THOX2) gene. Clin Endocrinol (Oxf). 2006;65:810–815. 93. Ohye H, Fukata S, Hishinuma A, et al. A novel homozygous missense mutation of the dual oxidase 2 (DUOX2) gene in an adult patient with large goiter. Thyroid. 2008;18:561–566. 94. Moreno JC, Visser TJ. New phenotypes in thyroid dyshormonogenesis: Hypothyroidism due to DUOX2 mutations. Endocr Dev. 2007;10:99–117. 95. Caputo M, Rivolta CM, Esperante SA, et al. Congenital hypothyroidism with goitre caused by new mutations in the thyroglobulin gene. Clin Endocrinol (Oxf). 2007;67:351–357. 96. Kim JH, Park TS, Baek HS, et al. A newly identified insertion mutation in the thyroid hormone receptor-beta gene in a Korean family with generalized thyroid hormone resistance. J Korean Med Sci. 2007;22:560–563. 97. Kim JY, Choi ES, Lee JC, et al. Resistance to thyroid hormone with missense mutation (V349M) in the thyroid hormone receptor beta gene. Korean J Intern Med. 2008;23:45–48. 98. Sato H, Koike Y, Honma M, et al. Evaluation of thyroid hormone action in a case of generalized resistance to thyroid hormone with chronic thyroiditis: Discovery of a novel heterozygous missense mutation (G347A). Endocr J. 2007;54:727–732. 99. Maraninchi M, Bourcigaux N, Dace A, et al. A novel mutation (E333D) in the thyroid hormone beta receptor causing resistance to thyroid hormone syndrome. Exp Clin Endocrinol Diabetes. 2006;114:569–576. 100. Refetoff S. Resistance to thyroid hormone: One of several defects causing reduced sensitivity to thyroid hormone. Nat Clin Pract Endocrinol Metab. 2008;4:1. 101. Visser WE, Friesema EC, Jansen J, et al. Thyroid hormone transport by monocarboxylate transporters. Best Pract Res Clin Endocrinol Metab. 2007;21:223–236. 102. Frints SG, Lenzner S, Bauters M, et al. MCT8 mutation analysis and identification of the first female with Allan-HerndonDudley syndrome due to loss of MCT8 expression. Eur J Hum Genet. 2008;16:1029–1037. 103. Jansen J, Friesema EC, Kester MH, et al. Functional analysis of monocarboxylate transporter 8 mutations identified in patients with X-linked psychomotor retardation and elevated serum triiodothyronine. J Clin Endocrinol Metab. 2007;92:2378–2381. 104. Friesema EC, Jansen J, Heuer H, et al. Mechanisms of disease: Psychomotor retardation and high T3 levels caused by mutations in monocarboxylate transporter 8. Nat Clin Pract Endocrinol Metab. 2006;2:512–523. 105. Jansen J, Friesema EC, Kester MH, et al. Genotype-phenotype relationship in patients with mutations in thyroid hormone transporter MCT8. Endocrinology. 2008;149:2184–2190. 106. Gozu HI, Mueller S, Bircan R, et al. A new silent germline mutation of the TSH receptor: Coexpression in a hyperthyroid family member with a second activating somatic mutation. Thyroid. 2008;18:499–508. 107. Akcurin S, Turkkahraman D, Tysoe C, et al. A family with a novel TSH receptor activating germline mutation (p.Ala485Val). Eur J Pediatr. 2008;167:1231–1237.

461

Part IV


108. Nishihara E, Nagayama Y, Amino N, et al. A novel thyrotropin receptor germline mutation (Asp617Tyr) causing hereditary hyperthyroidism. Endocr J. 2007;54:927–934. 109. Nishihara E, Fukata S, Hishinuma A, et al. Sporadic congenital hyperthyroidism due to a germline mutation in the thyrotropin receptor gene (Leu 512 Gln) in a Japanese patient. Endocr J. 2006;53:735–740. 110. Ferrara AM, Capalbo D, Rossi G, et al. A new case of familial nonautoimmune hyperthyroidism caused by the M463V mutation in the TSH receptor with anticipation of the disease across generations: A possible role of iodine supplementation. Thyroid. 2007;17:677–680. 111. Mannstadt M, Bertrand G, Muresan M, et al. Dominant-negative GCMB mutations cause an autosomal dominant form of hypoparathyroidism. J Clin Endocrinol Metab. 2008;93:3568–3576. 112. Al-Jenaidi F, Makitie O, Grunebaum E, et al. Parathyroid gland dysfunction in 22q11.2 deletion syndrome. Horm Res. 2007;67:117–122. 113. Hernandez AM, Villamar M, Rosello L, et al. Novel mutation in the gene encoding the GATA3 transcription factor in a Spanish familial case of hypoparathyroidism, deafness, and renal dysplasia (HDR) syndrome with female genital tract malformations. Am J Med Genet A. 2007;143:757–762. 114. Chiu WY, Chen HW, Chao HW, et al. Identification of three novel mutations in the GATA3 gene responsible for familial hypoparathyroidism and deafness in the Chinese population. J Clin Endocrinol Metab. 2006;91:4587–4592. 115. Brandi ML, Falchetti A. Genetics of primary hyperparathyroidism. Urol Int. 2004;72(suppl 1):11–16. 116. Lemos MC, Thakker RV. Multiple endocrine neoplasia type 1 (MEN1): Analysis of 1336 mutations reported in the first decade following identification of the gene. Hum Mutat. 2008;29:22–32. 117. Raue F, Haag C, Schulze E, et al. The role of the extracellular calcium-sensing receptor in health and disease. Exp Clin Endocrinol Diabetes. 2006;114:397–405. 118. Phelan JK, McCabe ER. Mutations in NR0B1 (DAX1) and NR5A1 (SF1) responsible for adrenal hypoplasia congenita. Hum Mutat. 2001;18:472–487. 119. Laissue P, Copelli S, Bergada I, et al. Partial defects in transcriptional activity of two novel DAX-1 mutations in childhood-onset adrenal hypoplasia congenita. Clin Endocrinol (Oxf). 2006;65:681–686. 120. McCabe ER. DAX1: Increasing complexity in the roles of this novel nuclear receptor. Mol Cell Endocrinol. 2007;265– 266:179–182. 121. Nimkarn S, New MI. Prenatal diagnosis and treatment of congenital adrenal hyperplasia owing to 21-hydroxylase deficiency. Nat Clin Pract Endocrinol Metab. 2007;3:405–413. 122. Bhangoo A, Wilson R, New MI, et al. Donor splice mutation in the 11beta-hydroxylase (CypllB1) gene resulting in sex reversal: A case report and review of the literature. J Pediatr Endocrinol Metab. 2006;19:1267–1282. 123. Nimkarn S, New MI. Steroid 11beta- hydroxylase deficiency congenital adrenal hyperplasia. Trends Endocrinol Metab. 2008;19:96–99. 124. Simard J, Ricketts ML, Gingras S, et al. Molecular biology of the 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase gene family. Endocr Rev. 2005;26:525–582. 125. Welzel M, Wustemann N, Simic-Schleicher G, et al. Carboxylterminal mutations in 3-beta-hydroxysteroid dehydrogenase type II cause severe salt-wasting congenital adrenal hyperplasia. J Clin Endocrinol Metab. 2008;93:1418–1425. 126. Biason-Lauber A, Kempken B, Werder E, et al. 17-alpha-hydroxylase/17,20-lyase deficiency as a model to study enzymatic activity regulation: Role of phosphorylation. J Clin Endocrinol Metab. 2000;85:1226–1231. 127. Kim CJ, Lin L, Huang N, et al. Severe combined adrenal and gonadal deficiency caused by novel mutations in the cholesterol side chain cleavage enzyme, P450scc. J Clin Endocrinol Metab. 2008;93:696–702. 128. Fujieda K, Okuhara K, Abe S, et al. Molecular pathogenesis of lipoid adrenal hyperplasia and adrenal hypoplasia congenita. J Steroid Biochem Mol Biol. 2003;85:483–489.

462

129. Artigas RA, Gonzalez A, Riquelme E, et al. A novel adrenocorticotropin receptor mutation alters its structure and function, causing familial glucocorticoid deficiency. J Clin Endocrinol Metab. 2008;98:3097–3105. 130. Chan LF, Clark AJ, Metherell LA. Familial glucocorticoid deficiency: Advances in the molecular understanding of ACTH action. Horm Res. 2008;69:75–82. 131. Mazur A, Koehler K, Schuelke M, et al. Familial glucocorticoid deficiency type 1 due to a novel compound heterozygous MC2R mutation. Horm Res. 2008;69:363–368. 132. Tsiotra PC, Koukourava A, Kaltezioti V, et al. Compound heterozygosity of a frameshift mutation in the coding region and a single base substitution in the promoter of the ACTH receptor gene in a family with isolated glucocorticoid deficiency. J Pediatr Endocrinol Metab. 2006;19:1157–1166. 133. Rumie H, Metherell LA, Clark AJ, et al. Clinical and biological phenotype of a patient with familial glucocorticoid deficiency type 2 caused by a mutation of melanocortin 2 receptor accessory protein. Eur J Endocrinol. 2007;157:539–542. 134. Collares CV, Antunes-Rodrigues J, Moreira AC, et al. Heterogeneity in the molecular basis of ACTH resistance syndrome. Eur J Endocrinol. 2008;159:61–68. 135. Krude H, Biebermann H, Schnabel D, et al. Obesity due to proopiomelanocortin deficiency: Three new cases and treatment trials with thyroid hormone and ACTH4–10. J Clin Endocrinol Metab. 2003;88:4633–4640. 136. Farooqi IS, Drop S, Clements A, et al. Heterozygosity for a POMC-null mutation and increased obesity risk in humans. Diabetes. 2006;55:2549–2553. 137. Jackson RS, Creemers JW, Farooqi IS, et al. Small-intestinal dysfunction accompanies the complex endocrinopathy of human proprotein convertase 1 deficiency. J Clin Invest. 2003;112:1550–1560. 138. Vallette-Kasic S, Couture C, Balsalobre A, et al. The TPIT gene mutation M86R associated with isolated adrenocorticotropin deficiency interferes with protein: Protein interactions. J Clin Endocrinol Metab. 2007;92:3991–3999. 139. Charmandari E, Kino T, Ichijo T, et al. Generalized glucocorticoid resistance: Clinical aspects, molecular mechanisms, and implications of a rare genetic disorder. J Clin Endocrinol Metab. 2008;93:1563–1572. 140. Swords FM, Baig A, Malchoff DM, et al. Impaired desensitization of a mutant adrenocorticotropin receptor associated with apparent constitutive activity. Mol Endocrinol. 2002;16:2746– 2753. 141. Carlson HE. Human adrenal cortex hyperfunction due to LH/ hCG. Mol Cell Endocrinol. 2007;269:46–50. 142. Salenave S, Chanson P, Bry H, et al. Kallmann’s syndrome: A comparison of the reproductive phenotypes in men carrying KAL1 and FGFR1/KAL2 mutations. J Clin Endocrinol Metab. 2008;93:758–763. 143. Albuisson J, Pecheux C, Carel JC, et al. Kallmann syndrome: 14 novel mutations in KAL1 and FGFR1 (KAL2). Hum Mutat. 2005;25:98–99. 144. Pedersen-White JR, Chorich LP, Bick DP, et al. The prevalence of intragenic deletions in patients with idiopathic hypogonadotropic hypogonadism and Kallmann syndrome. Mol Hum Reprod. 2008;14:367–370. 145. Bedecarrats GY, Kaiser UB. Mutations in the human gonadotropin-releasing hormone receptor: Insights into receptor biology and function. Semin Reprod Med. 2007;25:368–378. 146. Lofrano-Porto A, Barra GB, Giacomini LA, et al. Luteinizing hormone beta mutation and hypogonadism in men and women. N Engl J Med. 2007;357:897–904. 147. Leung MY, Steinbach PJ, Bear D, et al. Biological effect of a novel mutation in the third leucine-rich repeat of human luteinizing hormone receptor. Mol Endocrinol. 2006;20:2493–2503. 148. Bruysters M, Christin-Maitre S, Verhoef-Post M, et al. A new LH receptor splice mutation responsible for male hypogonadism with subnormal sperm production in the propositus, and infertility with regular cycles in an affected sister. Hum Reprod. 2008;23:1917–1923. 149. Meduri G, Bachelot A, Cocca MP, et al. Molecular pathology of the FSH receptor: New insights into FSH physiology. Mol Cell Endocrinol. 2008;282:130–142.

Chapter 22 150. de Vries L, Kauschansky A, Shohat M, et al. Familial central precocious puberty suggests autosomal dominant inheritance. J Clin Endocrinol Metab. 2004;89:1794–1800. 151. Teles MG, Bianco SD, Brito VN, et al. A GPR54-activating mutation in a patient with central precocious puberty. N Engl J Med. 2008;358:709–715.


152. De Leener A, Caltabiano G, Erkan S, et al. Identification of the first germline mutation in the extracellular domain of the follitropin receptor responsible for spontaneous ovarian hyperstimulation syndrome. Hum Mutat. 2008;29:91–98.

463


C h a p t e r

23 Molecular Basis of Gynecologic Diseases Samuel C. Mok Kwong-kwok Wong Karen Lu Karl Munger Zoltan Nagymanyoki n

n

n

INTRODUCTION Gynecologic diseases in general are diseases involving the female reproductive tract. These diseases include benign and malignant tumors, pregnancy-related diseases, infection, and endocrine diseases. Among them, malignant tumor is the most common cause of death. In recent years, the etiology of some of these diseases has been revealed. For example, human papilloma virus (HPV) infection has been shown to be one of the major etiological factors associated with cervical cancer. Inactivation of tumor suppressor gene BRCA1 has been implicated in hereditary ovarian cancer. In spite of these findings, the molecular bases of most of the diseases remain largely unknown. In this chapter, we will focus on discussing benign and malignant tumors of female reproductive organs as well as pregnancy-related diseases, which have relatively wellunderstood molecular bases.

BENIGN AND MALIGNANT TUMORS OF THE FEMALE REPRODUCTIVE TRACT Cervix Infections of the genital mucosa with human papillomaviruses represent the most common virus-associated sexually transmitted disease, and at age 50 approximately 80% of all females will have acquired a genital HPV infection sometime during their life [1]. At present, approximately 630 million individuals worldwide have a genital HPV infection, with an incidence of approximately 30 million new infections per year [2]. Currently in the United States there are in excess of 20 million people with genital HPV infections, with an estimated annual incidence of 6.2 million new infections [3,4]. Genital HPV infections are particularly prevalent in sexually active younger individuals Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

[5]. Most of these infections are transient and may not cause any overt clinical disease or symptoms. Nonetheless, the total annual cost of clinical care for genital HPV infections exceeds $3 billion in the United States alone [6].

HPVs Associated with Cervical Lesions and Cancer [5] Human papillomaviruses are members of the Papillomaviridae family. They have a tropism for squamous epithelial cells and cause the formation of generally benign hyperplastic lesions that are commonly referred to as papillomas or warts (reviewed in [7]). Papillomaviruses contain closed circular doublestranded DNA genomes of approximately 8,000 base pairs that are packaged into 55 nm nonenveloped icosahedral particles. Their genomes consist of three regions; the early (E) region encompasses up to 8 open reading frames (ORFs) designated E followed by a numeral, with the lowest number designating the longest ORF, and the late (L) region encodes the major and minor capsid proteins, L1 and L2, respectively. Only one of the two DNA strands is actively transcribed, and early and late ORFs are encoded on the same DNA strand. A third region, referred to as the long control region (LCR), the upstream regulatory region (URR), or the noncoding region (NCR), does not have significant coding capacity and contains various regulatory DNA sequences that control viral genome replication and transcription (Figure 23.1A) (reviewed in [7]). In excess of 100 HPV types have been described [6]. HPVs are classified as genotypes based on their nucleotide sequences. A new HPV type is defined when the entire genome has been cloned and the sequence of the L1 open reading frame (ORF), the most conserved ORF among papillomaviruses, is less than 90% identical 465

Part IV


E6

R

NC

P97

E7

P670

L1

E1

HPV Infection and Life Cycle

HPV16 7905 bp

E2

E4

L2

A

E5

NCR

E6

E7

E6/E7 E6*/E7

B Figure 23.1 The HPV genome. (A) Schematic representation of the HPV16 genome. The double-stranded circular DNA genome is represented by the central circle. Early (E) and late (L) genes are all transcribed from one of the two DNA strands in each of the three possible reading frames. The noncoding region (NCR) does not have extensive coding potential but contains the viral origin of replication (designated by the black circle) as well as the major early promoter, P97, designated by an arrow. The differentiation specific late promoter, P670, is contained within the E7 ORF. See text for details. (B) Structure of the minimal HPV16 genome fragment that is consistently retained after integration into a host chromosome. The major E6/E7 transcripts are shown underneath. See text for details.

to a known HPV type. HPVs with higher sequence identity are referred to as subtypes (90% to 98% identity) or variants (>98% identity) [8]. Approximately 30 HPV types infect mucosal epithelia, and these viruses are further classified as low risk or high risk depending on the propensity for malignant progression of the lesions that they cause. Low-risk HPVs, such as HPV6 and HPV11, cause genital warts, whereas high-risk HPVs, such as HPV16 and HPV18, cause intraepithelial neoplasia that can progress to frank carcinoma. Harald zur Hausen’s group discovered the association of HPVs with anogenital tract lesions and isolated HPVs from genital warts [9]. Using these sequences as hybridization probes under low stringency conditions, they succeeded in detecting HPV sequences in cervical carcinomas [10]. The most abundant high-risk HPVs are HPV16 and HPV18, which are detected in approximately 50% and 20% of 466

all cervical carcinomas, respectively. HPV18 appears to be frequently associated with adenocarcinomas, whereas HPV16 is mostly detected in squamous cell carcinomas (reviewed in [11]). The following sections are focused on a review of mucosal high-risk HPVs and their contributions to cervical lesions and cancers.

The HPV life cycle is closely linked to the differentiation program of the infected squamous epithelial host cell. HPVs infect basal cells, a single layer of actively cycling cells in the squamous epithelium. Basal cells are not readily accessible for viral infection, as they are protected by several layers of differentiated cells that have withdrawn for the cell division cycle. These cell layers are essential for the mechanical stability of the skin and shield the proliferating basal cells from environmental genotoxic insults. HPVs can gain access to basal cells through microabrasions caused by mechanical trauma. Basal-like cells at the cervical squamocolumnar transformation zone in the cervix, however, are particularly accessible and vulnerable to HPV infection. It has been postulated that within the cervical transformation zone, reserve cells, which can give rise to squamous or columnar epithelia, may be physiologically relevant targets for HPV infection [12–14]. The mechanisms of viral entry remain relatively poorly understood but are thought to involve initial binding to heparin sulfate on the cell surface followed by receptor binding and viral uptake, although there is controversy regarding the identity of the virus receptor (reviewed in [15]). Following infection, HPV genomes are maintained at a low copy number in the nuclei of infected cells and can persist in basal epithelial cells for decades. The productive phase of the viral life cycle, which includes HPV genome amplification, production of capsid proteins, and packaging of newly synthesized genomes, however, occurs exclusively in the terminally differentiated layers of the infected tissue. HPVs are nonlytic, and infectious viral particles are sloughed off with the terminally differentiated, denucleated scales where they remain infectious over extended periods of time (reviewed in [16]). HPVs encode two proteins, E1 and E2, which directly contribute to viral genome replication. The E1 origin-binding protein is the only virally encoded enzyme and has intrinsic ATPase and helicase activities [17]. E1 forms a complex with the E2 protein, the major HPV-encoded transcriptional regulatory protein. E2 binds with high affinity to specific DNA sequences ACCN6GGT in the viral regulatory region, whereas E1 binds to the AT-rich replication origin sequences with relatively low affinity. The origin sequence is often flanked by E2 binding sites resulting in high-affinity binding of the E1/E2 complex to the origin of replication [18]. With the exception of the E1/E2 origin-binding complex, HPVs do not encode enzymes that are necessary for viral genome replication and co-opt the host DNA synthesis machinery. Since high-copy number

Chapter 23

HPV genome replication and viral progeny synthesis is confined to terminally differentiated cells, which are growth arrested and thus intrinsically incompetent for DNA replication, a major challenge for the viral life cycle is to maintain and/or re-establish a replicationcompetent milieu in these cells. The HPV E7 protein contributes to induction and/or maintenance of S-phase competence in differentiating keratinocytes through several mechanisms. Perhaps most importantly, HPV E7 proteins bind to the retinoblastoma tumor suppressor protein pRB and the related p107 and p130 pocket proteins. These proteins have been implicated in regulating G1/S phase transition through members of the E2F family of transcription factors. The G1 specific pRB/E2F complex is a transcriptional repressor that inhibits S-phase entry. In normal cells, pRB is phosphorylated by cyclin/cdk complexes in late G1, the pRB/E2F complex dissociates, and DNA-bound E2Fs act as transcriptional activators. The pRB/E2F complex re-forms when pRB is dephosphorylated at the end of mitosis. This regulatory loop is subverted by HPV E7 proteins, which can associate with pRB and abrogate the inhibitory activity of pRB/E2F complexes. E7 proteins encoded by low-risk HPV associate with pRB with lower affinity than high-risk HPV E7 proteins. Additionally, high-risk HPV E7 proteins induce proteasome-mediated degradation of pRB. Moreover, E7 proteins abrogate the action of cyclin-dependent kinase inhibitors (CKIs) p21CIP1 and p27KIP1, which regulate cell cycle withdrawal during epithelial cell differentiation, thereby uncoupling epithelial cell differentiation and cell cycle withdrawal. This leads to the formation of hyperplastic lesions, warts, and is necessary for production of progeny virus (reviewed in [19]).

Detection of HPV-Associated Lesions Papanicolaou tests (also known as Pap tests) are named after their inventor, Georgios Papanicolaou, and serve to detect HPV-associated lesions in the cervix. Upon implementation, this relatively inexpensive test dramatically reduced the incidence and mortality rates of cervical cancer. In the United States the current recommendation is for women to have a Pap test performed at least once every 3 years, and in 2003 approximately 65.6 million Pap tests were performed [20]. The current test involves collecting exfoliated epithelial cells from the outer opening of the cervix and either directly smearing the cells on a slide, or immediately preserving and storing the cells in fixative liquid medium followed by automated processing into a monolayer. In either format, cells are stained and examined for cytological abnormalities. Liquid-based monolayer cytology appears to have a reduced rate of false-positivity presumably due to standardized specimen preparation and immediate fixation of the sampled cells [21,22]. While nuclear features are currently used for diagnoses, attempts are under way to identify new biomarkers for high-risk HPV-associated cervical lesions. The most promising biomarker is p16INK4A, an inhibitor of cdk4/cdk6 cyclin D complexes [23], although the molecular basis of p16INK4A overexpression in cervical cancer is currently unknown.

Molecular Basis of Gynecologic Diseases

The American Cancer Society (ACS) and the American College of Obstetricians and Gynecologists (ACOG) also recommend that women over the age of 30 be tested for the presence of HPV DNA [20]. The only currently FDA-approved HPV testing method is based on nucleic acid hybridization and can distinguish between absence and presence of the most frequent low-risk or high-risk HPV types but does not allow identification of individual HPV types. A number of different PCR-based HPV typing methods have been developed for research purposes, but these are currently not FDA approved. While some studies have suggested that HPV testing may be more effective in identifying cervical lesions than Pap smears, this issue clearly requires additional study [24].

Diagnosis and Treatment Genital warts are a frequent manifestation of low-risk mucosal HPV infections and are diagnosed based on appearance. Such lesions have a very low propensity for malignant progression, and they often regress spontaneously. However, patients generally insist on their removal. No HPV-specific antivirals currently exist for such applications (reviewed in [25]). Standard therapeutic modalities include surgical excision, laser therapy, cryotherapy, topical administration of various caustic chemicals, or immunomodulating agents (reviewed in [7]). In rare cases, low-risk HPV infections of the genital tract can also cause serious disease. One example is the giant condyloma of Buschke-Lowenstein that is caused by infection with low-risk HPVs. In such patients, the immune system is unable to control and/or clear the infection. Although these are slow-growing lesions, they are highly destructive to adjacent normal tissue and eventually can form local and distant metastases (reviewed in [26,27]). Cytological abnormalities detected by Pap tests are classified according to the Bethesda system as atypical squamous cells (ASC) or squamous intraepithelial lesions (SIL). ASC are further classified as Atypical Squamous Cells of Undetermined Significance (ASCUS) or Atypical Squamous Cells, cannot exclude High-grade squamous intraepithelial lesions (ASC-H), whereas SILs are designated low-grade (LSIL) or high-grade (HSIL) (reviewed in [18]). LSILs are followed up by additional Pap tests, whereas HSILs require analysis by colposcopy. The procedure involves application of an acetic acid-based solution to the cervix whereupon lesions appear as white masses upon evaluation with a colposcope. When lesions are detected, a biopsy is performed and the tissue is examined histologically. Lesions are classified as cervical intraepithelial neoplasias (CIN), carcinoma in situ, or invasive cervical carcinoma. Treatments for CIN include cryotherapy, laser ablation, or loop electrosurgical excision, whereas carcinomas are treated by surgery and/or chemotherapy (reviewed in [11]).

Prevention and Vaccines Condoms reduce, but do not negate, the risk of infections with HPVs [29,30]. In addition, preclinical studies 467

Part IV


in a mouse model suggest that the polysaccharide carrageen greatly inhibits HPV transmission, whereas the spermicidal compound nonoxynol-9 appears to increase HPV transmission [31], but these studies await confirmation by clinical studies in humans. The first generation prophylactic HPV vaccines consist of recombinant HPV L1 proteins that self-assemble into virus-like particles (VLPs). GardasilW was developed by Merck and has been FDA approved for use in girls and young women of 9 to 26 years of age. It is a quadrivalent formulation that contains VLPs of the most prevalent low-risk (HPV6 and HPV11) and high-risk HPVs (HPV16 and HPV18). It is administered as three doses over the course of 6 months and promises to be highly efficacious in providing typespecific protection from new infections with these HPV types. As such, this vaccine has the potential to reduce the burden of cervical carcinoma and genital warts by up to 70% (reviewed in [32]). Since these prophylactic vaccines lead to the development of humoral immune responses, they are not predicted to affect potential HPV infections at the time of vaccination. Given that cervical cancer generally develops decades after the initial infection, it has been estimated that incidence and mortality rates of cervical cancer will not decrease for 25 to 40 years (reviewed in [33]). Moreover, it is not clear whether other nonvaccine high-risk HPV types will become more prevalent as HPV16 and HPV18 are removed from the biological pool. Hence, recommendations for cervical cytology screening (Pap smears) remain unchanged for vaccinated individuals. The minor capsid protein L2 contains linear, crossneutralizing epitopes that may afford more general protection from HPV infections and appears to be an excellent candidate for development of second-generation vaccines (reviewed in [34]).

Molecular Mechanisms of High-Risk HPV-Mediated Cellular Transformation The transforming activities of high-risk HPVs reflect the necessity of the virus to establish and/or maintain a replication-competent cellular milieu in terminally differentiated keratinocytes. Three high-risk HPV proteins—E5, E6, and E7—have been shown to exhibit transforming activities in cellular and animal systems. Only E6 and E7 are regularly expressed in cervical carcinoma where the HPV genome is frequently integrated into a host chromosome. The integration event is relatively nonspecific with respect to the host chromosome [35]. Integration frequently involves common fragile sites [36], and in some cases HPVs integrate in the vicinity of cellular proto-oncogenes such as c-myc [37]. However, integration of high-risk HPV genomes often causes disruption and/or deletion of the E2 ORF, which encodes a transcriptional repressor of E6/E7 expression [38, 39]. Moreover, HPV16 E6/E7 mRNAs are more stable when expressed from integrated copies as compared to episomal HPV16 genomes [40]. Thus, E6/E7 oncoprotein expression is dysregulated in cervical carcinomas (Figure 23.1B). Ectopic expression of HPV E6 and E7 in primary 468

human epithelial cells facilitates cellular immortalization, and when high-risk HPV E6/E7 expressing cells are grown under conditions where they can form multilayered, skin-like structures, they exhibit cellular abnormalities that are reminiscent of high-grade premalignant cervical lesions [41]. Nonetheless, lowpassage high-risk HPV immortalized cells are nontumorigenic in immune-deficient mice but can undergo full transformation upon prolonged passaging [42] or when additional oncogenes such as ras or fos are expressed [43,44]. As such, this mimics the situation in vivo, where high-risk HPV-associated cervical lesions progress to cervical cancer after long-term persistent infection (reviewed in [11]). Cervical cancers show hallmarks of chromosomal instability and are generally aneuploid [45]. Cervical cancers that arise upon expression of HPV16 E6/E7 in basal epithelial from a keratin K14 promoter in transgenic animals require chronic treatment with low doses of estrogen, further supporting the notion that additional genomic aberrations are necessary for cancer development [46]. Nonetheless, high-risk HPV E6/E7 oncoproteins directly contribute to malignant progression through induction of genomic instability (reviewed in [47]). Moreover persistent HPV E6/E7 expression is necessary for the maintenance of the transformed phenotype of HPV positive cervical cancer cell lines (reviewed in [48]).

Biological and Biochemical Activities of High-Risk HPV E7 Oncoproteins Among the high-risk HPV-encoded E7 oncoproteins, HPV16 E7 has been most thoroughly studied. It is a 98 amino acid phosphoprotein that is actively transported to the nucleus [49], but has been detected both in the nucleus and the cytoplasm. HPV16 E7 lacks any known intrinsic enzymatic activities and does not specifically associate with DNA sequences. Rather, it functions by associating with and functionally modifying host cellular regulatory protein complexes. Given its subcellular localization, HPV16 E7 has been shown to associate with nuclear as well as cytoplasmic cellular target proteins. HPV16 E7 shares sequence similarity to a small portion of conserved region 1 (CR1), as well as the entire CR2 of the adenovirus (Ad) E1A oncoprotein. The CR2 homology domain contains the pRB tumor suppressor core-binding site, LXCXE (L, leucine; C, cysteine; E, glutamic acid; X, any amino acid residue), as well as a casein kinase II phosphorylation site. The carboxyl terminus consists of two CXXC motifs separated by a 29 amino acid spacer region that forms a novel zinc binding structure [50,51] (Figure 23.2). Unlike Ad E1A and SV40 TAg, which target pRB through a stoichiometric mechanism, HPV16 E7 inactivates this tumor suppressor protein through ubiquitinmediated proteasomal degradation, and sequences within the HPV16 E7 CR1 homology domain that do not contribute to pRB binding are necessary for this activity. These HPV16 E7 sequences serve as a binding site for a cullin 2 containing ubiquitin ligase complex, which contributes to pRB degradation [52]. In addition

Chapter 23


1 HPV16 E6

HPV16 E7

−X29−

CXXC

1

148 151

128

CR1

15/16

CR2

CXXC

−X29−

CXXC

CXXC E6AP binding

98

37/38

LXCXE

PDZ binding

CXXC

−X29−

CXXC

pRB binding Figure 23.2 HPV16 E6 (top) and E7 (bottom) oncoproteins. The positions of the binding sites for E6AP and PDZ proteins on E6 are indicated by black boxes. The amino terminal domains of HPV16 E7 that are similar to a portion of conserved region (CR1) and to CR2 of the Adenovirus E1A protein are indicated. The CR2 domain contains the LXCXE core pRB binding site, which is indicated by a black box that is not to scale. See text for details and references.

the CR1 homology domain also contains a binding site for the N-end rule ubiquitin ligase p600 [53,54], which appears to play an important role in regulating anoikis, a form of apoptosis that is induced upon detachment of cells from a substratum [55–57]. The carboxyl terminus of HPV16 E7 contains additional sequences that are necessary for transformation [48]. While a large number of putative cellular targets, including histone modifying enzymes, that bind to carboxyl terminal sequences have been identified, it is not clear which of these interactions, if any, contribute to cellular transformation (reviewed in [48]). HPV16 E7 has been shown to associate with pyruvate kinase and modulate the activity of alpha glucosidase and induce a metabolic switch from oxidative phosphorylation to glycolysis, reminiscent of the Warburg effect [59,60]. In addition, HPV16 E7 expression causes aberrant activation of the survival kinase AKT in differentiating keratinocytes, which has been linked to increased cell motility [61,62]. HPV16 E7 has also been shown to cooperate with E6 to induce expression of proteins that modulate angiogenesis [63,64].

Biological and Biochemical Activities of High-Risk HPV E6 Oncoproteins Like HPV16 E7, HPV16 E6 is a relatively small protein of 151 amino acids that lacks intrinsic enzymatic and specific DNA-binding activities and functions by subverting host cellular protein complexes. HPV16 E6 consists of two zinc-binding motives, each of which consists of 2 CXXC sequences separated by 29 amino acids that each are related to the carboxyl terminal domain of E7 (Figure 23.2). The best known activity of HPV16 E6 is the ability to associate with p53 and the ubiquitin ligase E6-AP, which leads to the ubiquitin-mediated proteasomal degradation of the p53 tumor suppressor. The p53 tumor suppressor senses cellular stress including aberrant S-phase entry induced by expression of the HPV E7 oncoprotein. Activation of p53 results in transcriptional induction of abortive cellular programs such as G1 growth arrest and/or apoptosis, which have been

collectively referred to as the trophic sentinel response (Figure 23.3). Inactivation of p53 by the E6 protein presumably serves to abrogate this response, thereby allowing for persistent S-phase competence in differentiated pRB/E2F G1/S Restriction

E7 Cul2

Aberrant Proliferation

p53 Trophic Sentinel Response

E6 E6AP

Extended Proliferation

Telomere Erosion Replicative Senescence

Cellular Immortalization

E6

hTERT

E6

Genomic Destabilization E7 Cellular Transformation

Figure 23.3 Schematic depiction of some of the major biochemical and biological activities of high-risk HPV oncogenes and how they may cooperate in the development of cervical disease and cancer. 469

Part IV


cells. HPV E6 expression also increases transcription of the catalytic subunit of telomerase, hTERT, which contributes to cellular immortalization of primary human epithelial cells (Figure 23.3). High-risk HPV E6 proteins contain a short peptide sequence (S/T)-X-V-I-L at their carboxyl termini which mediates association with cellular PDZ proteins [65, 66] (Figure 23.2). The integrity of the PDZ binding sequence on E6 is important for the HPV viral life cycle [39], as well as the transforming activities of E6 [65,68]. Many PDZ proteins act as molecular scaffolds and regulate a number of important processes including cell polarity. It is not clear whether high-risk HPV E6 proteins associate with one single PDZ protein or whether they can target multiple family members, since a number of different candidates have been reported. Since PDZ protein and E6AP binding on E6 are not mutually exclusive, E6-associated PDZ proteins can be targeted for ubiquitination by E6AP (reviewed in [69]). Many papillomavirus E6 proteins associate with paxillin, and association with E6 leads to disruption of paxillin’s association with the focal adhesion proteins vinculin and focal adhesion kinase (FAK). This causes defects in the cellular actin cytoskeleton, as is typically observed in transformed cells [70–73].

Contributions of HPV Oncoproteins to Induction of Genomic Instability Cervical cancers generally develop years or decades after the initial infection, and these tumors have suffered a multitude of genomic aberrations. The acquisition of some of these genomic alterations appears to define certain stages of disease progression [74,75]. The action of the high-risk HPV E6 and E7 oncoproteins on telomerase activity and the p53 and pRB tumor suppressors are sufficient to lead to extended uncontrolled proliferation and cellular immortalization, but acquisition of additional host genome mutations is necessary for malignant progression (Figure 23.3). A defining biological activity of high-risk HPV E6/E7 proteins is their ability to subvert genomic integrity [76, 77]. Hence, high-risk HPV E6/E7 oncoproteins not only contribute to initiation but also play a key role in malignant progression. There are two principal mechanisms that lead to genomic instability. Subversion of cell cycle checkpoint mechanisms and DNA repair pathways can lead to perpetuation of mutations induced by environmental triggers such as UV irradiation or exposure to chemical compounds that cause DNA damage. Alternatively, genomic instability can be triggered by active mechanisms that cause genomic destabilization, which have been collectively referred to as a mutator phenotype. Expression of HPV E6/E7 oncoproteins causes genomic instability by both of these mechanisms. HPV16 E7 has activities of a mitotic mutator and its expression in primary human epithelial cells causes several types of mitotic abnormalities. These include induction of supernumerary centrosomes, lagging chromosomes, and anaphase bridges. Of these, induction 470

of supernumerary centrosomes has been studied in greatest detail. Centrosome-associated multipolar mitoses are a histopathological hallmark of high-risk HPV-associated cervical lesions. HPV16 E7 induces centrosome abnormalities through multiple, cooperating pathways. HPV16 E7 expression causes aberrant activation of cdk2 through several mechanisms, including E2F-mediated transcriptional activation of expression of the cdk2 catalytic subunits cyclins E and A as a consequence of pRB/p107/p130 degradation and inactivation of the cdk2 inhibitors p21CIP1 and p27KIP1. Induction of supernumerary centrosomes by HPV16 E7 is strictly dependent on cdk2 activity [78,79]. In addition, HPV16 E7 associates with the centrosomal regulatory protein gamma-tubulin and inhibits its loading on centrosomes [80]. As a consequence, the process of centrosome duplication is uncoupled from the cell division cycle [81], resulting in the synthesis of multiple daughter centrioles from a single maternal centriole template [82]. Whereas expression of HPV16 in primary cells effectively induces centrosome overduplication, E6 co-expression is necessary for induction of multipolar mitoses [83]. HPV16 E7 expression also causes a higher incidence of DNA double strand breaks, which can lead to breakage fusion bridge cycles and chromosomal translocations. Specific recurrent chromosomal translocations are well-documented drivers of hematological malignancies and, more recently, similar translocations have also been documented to contribute to the genesis of human solid tumors [84,85]. Chromosomal translocations are regularly detected in cervical cancer specimens [45], and it will be interesting to determine whether some of these directly contribute to cervical carcinogenesis. The mechanistic basis of the formation of mitoses with lagging chromosomal material still awaits full investigation. Fanconi anemia (FA) patients frequently develop squamous cell carcinomas, and it has been reported that oral cancers arising in FA patients are more frequently HPV-positive than in the general population [86]. The FA pathway, which is normally activated by DNA crosslinking and stalled replication forks (reviewed in [87]), is triggered in response to HPV16 E7 expression, and HPV16 E7 induces DNA double strand breaks more efficiently in FA patient-derived cell lines [88]. Hence, the increased incidence of HPV-associated carcinomas in FA patients may be related to more potent induction of genomic instability by the HPV E7 protein. The ability of the HPV16 E6 protein to contribute to genomic destabilization is to a large part based on its ability to inactivate the p53 tumor suppressor. As a consequence, the DNA damage-induced G1/S checkpoint is nonfunctional [89], and HPV16 E6-expressing cells also exhibit mitotic checkpoint defects [90,91]. HPV16 E6-mediated p53 degradation also causes subversion of a postmitotic checkpoint that is specifically triggered in cells when they re-enter a G1-like state after a failed mitosis. Such cells have a tetraploid rather than the normal diploid set of chromosomes and contain two centrosomes rather than one. Cells with p53 defects will disregard this checkpoint, re-enter S-phase, and may

Chapter 23

eventually undergo tetrapolar mitosis, which can lead to generation of aneuploid progeny. Consistent with this model, HPV16 E6 expressing cells show marked nuclear abnormalities [77,92,93]. In addition to passive mechanisms of cell cycle checkpoint subversion, HPV16 E6 may also contribute to genomic destabilization through active mutator mechanisms. HPV16 E6 has been shown to associate with single-strand DNA break repair protein XRCC1 [94] and induce degradation of O6-methylguanineDNA methyltransferase [95], which is also involved in single-strand DNA break repair. It has also been reported that HPV16 E6 expression decreases the fidelity of DNA end joining [96]. Moreover, while HPV16 E6 expression does not induce centrosome overduplication, it greatly increases the incidence of multipolar mitoses in cells that contain supernumerary centrosomes due to HPV16 E7 expression [83].

Concluding Remarks High-risk HPVs contribute to the genesis of almost all human cervical carcinomas and have also been associated with a number of other anogenital malignancies including vulvar, anal, and penile carcinomas. In addition approximately 20% of oral carcinomas are also associated with high-risk HPV infections, and oral sex practices have been implicated in transmission of the virus [97,98]. HPV-associated cervical cancers are quite unique in that they represent the only human solid tumor for which the initiating carcinogenic agent has been identified at a molecular level. The fact that the high-risk HPV E6 and E7 oncoproteins contribute to initiation as well as progression and that they are necessary for the maintenance of the transformed phenotype of cervical cancer cells suggests that these proteins and/or the processes that they regulate should provide targets for intervention.

Uterine Corpus The uterine corpus represents the second common site for malignancy of the female reproductive tract. These neoplasms can be divided into epithelial, mesenchymal tumors, and trophoblastic tumors.

Epithelial Tumors Uterine cancer is the most common gynecologic cancer in the United States. In 2008, the American Cancer Society estimates that there will be 40,100 new cases of uterine cancer, as compared to 21,650 new cases of ovarian cancer and 11,070 new cases of cervix cancer [99]. Most uterine cancers are adenocarcinomas and develop from the endometrium, the inner lining of the uterus. They are therefore referred to as endometrial cancers. Risk factors for the development of endometrial cancer include obesity, unopposed estrogen use, polycystic ovary syndrome, insulin resistance and diabetes, and estrogen-secreting ovarian tumors [100]. Given the spectrum of risk factors, the development


of endometrial cancer has been strongly associated with an excess of systemic estrogen and a lack of progesterone. This hyperestrogenic state is presumed to result in endometrial hyperproliferation and endometrial cancer. Since the early 1990s, there has been increased research into understanding the molecular pathogenesis of endometrial cancer. Endometrial cancer can be broadly divided into Type I and Type II categories, based on risk factors, natural history, and molecular features. Women with Type I endometrial cancers have the classic risk factors as stated previously, have tumors with low-grade endometrioid histology, frequently have concurrent complex atypical hyperplasia, and typically present with early stage disease. Molecular features important in Type I endometrial cancers include presence of ER and PR receptors, microsatellite instability (MSI), PTEN mutations, KRAS mutations, and Beta catenin mutations. Women with Type II endometrial cancers are typically older, nonobese, have tumors with serous and clear cell histologies as well as high-grade endometrioid histology, and may present with more advanced stage disease. In general, Type II tumors have a poorer clinical prognosis, in part due to their propensity to metastasize even with minimal myometrial invasion. The molecular alterations commonly seen in Type II cancers include p53 mutations and chromosomal aneuploidy. While not all tumors fall neatly into these categories, the classification is helpful to broadly define endometrial cancers. A number of investigators are working toward developing more specific and rational targeted therapies. This section will focus on defining the molecular changes that have been described for endometrial hyperplasia, as well as for Type I and Type II endometrial cancers, with an emphasis on therapeutic relevance. Endometrial Hyperplasia . Endometrial hyperplasia is a proliferation of the endometrial glands without evidence of frank invasion. According to the World Health Organization (WHO), there are four categories of endometrial hyperplasia: (i) simple hyperplasia, (ii) simple hyperplasia with atypia, (iii) complex hyperplasia, and (iv) complex hyperplasia with atypia. Complex hyperplasia with atypia, or complex atypical hyperplasia (CAH), is considered a precursor lesion to endometrial cancer. Simple hyperplasia is characterized by proliferating glands of irregular size, separated by abundant stroma. Cytologically, there is no atypia. Simple hyperplasia with atypia is characterized by mild architectural changes in the proliferating glands and cytologic atypia, but is rarely found in clinical practice. Complex hyperplasia is characterized by more densely crowded and irregular glands, although intervening stroma is present. Cytologically, there is no atypia. CAH is characterized by densely crowded and irregular glands with intervening stroma, as well as cytologic atypia based on enlarged nuclei, irregular nuclear membranes, and loss of polarity of the cells. From a clinical standpoint, only CAH is associated with a substantial risk of developing endometrial cancer. Kurman et al. estimated that the risk of progression 471

Part IV


to endometrial cancer is 1% for simple hyperplasia, 3% for complex hyperplasia, and 28.6% for CAH [101]. In a study by Horn et al., complex hyperplasia without atypia had a 2% risk of progression, and CAH had a 51.8% risk of progression [102]. Lacey et al. performed a nested case-control study of 138 patients with endometrial hyperplasia and found that simple hyperplasia and complex hyperplasia without atypia had minimal (relative risk of 2 and 2.8, respectively) risk of progression to cancer. However, CAH had a substantial (relative risk of 14) risk of progression [103]. Recently a Gynecologic Oncology Group study (GOG 167) demonstrated that in 289 cases of community diagnosed CAH, 123 (43%) cases had a concurrent Grade I endometrial cancer [104]. Of the 123 cases of endometrial cancer, 38 (31%) had some degree of invasion into the myometrium. In addition, there was substantial discrepancy between the community-diagnosed CAH and subsequent pathologic review by gynecologic pathologists, with both under- and overdiagnosis. Finally, even when a panel of expert gynecologic pathologists reviewed cases of CAH, there was only modest reproducibility with a kappa value of 0.28 [105]. The current clinical management of CAH is simple hysterectomy and bilateral salpingooophorectomy. In young women who desire future fertility, progestins (including megestrol acetate) have been used to successfully reverse CAH. An initial dilatation and curettage with careful pathologic evaluation is necessary prior to initiating treatment. In addition, an MRI to rule out an invasive process can also be helpful. Close surveillance with every 3 month endometrial sampling is also recommended. Risk factors for CAH and Type I endometrial cancers are the same, including obesity, diabetes and insulin resistance, unopposed estrogen use, and polycystic ovarian syndrome. Certain, but not all, molecular features are shared. PTEN mutations, KRAS mutations, and MSI have all been identified in complex endometrial hyperplasias and likely represent early molecular alterations in the pathogenesis of endometrioid endometrial cancer [106,107]. A novel estrogen-regulated gene, EIG121, shows similar increase in expression in CAH and grade I endometrial cancers [108]. IGFI-R is also increased and activated in both CAH and grade I endometrial cancers [109]. Endometrioid Endometrial Cancer. Endometrioid endometrial cancer accounts for approximately 70%– 80% of newly diagnosed cases of endometrial cancer [110], and these cancers are considered Type I. Risk factors for the development of endometrioid endometrial cancer are associated in general with an excess of estrogen and a lack of progesterone. The most common genetic changes in endometrioid endometrial cancers include mutations in PTEN, MSI, mutations in K-RAS, and beta-catenin. Somatic mutations in the PTEN tumor suppressor gene are the most common genetic defect in endometrioid endometrial cancers and have been reported to occur in approximately 40%–50% of cancer cases [111,112]. PTEN is a tumor suppressor gene located on chromosome 10. It 472

encodes a lipid phosphatase that acts to negatively regulate AKT. The importance of PTEN inactivation in endometrial carcinogenesis has been also demonstrated in a PTEN heterozygous mouse model [113]. In this model, 100% of the heterozygote mice will develop endometrial hyperplasia by 26 weeks of age, and approximately 20% will develop endometrial carcinoma. In a study by Vilgelm et al. of this mouse model, phosphorylation of AKT followed by activation of ERa was demonstrated in the mouse endometrium. Reduction of endometrial ERa levels and activity reduced the development of endometrial hyperplasia and cancer [114]. In humans, germline PTEN mutations are the underlying genetic defect in individuals with Cowden’s syndrome, which is a hereditary syndrome characterized by skin and gastrointestinal hamartomas and increased risk of breast and thyroid cancers. Women with Cowden’s syndrome also are at increased risk for endometrial cancer. In addition to PTEN mutations, mutation and inactivation of other components of the PIK3CA/AKT/ mTOR pathway have been described. In a study by Hayes et al., mutations in the oncogene phosphatidylinositol-3-kinase (PIK3CA) were found in 39% of endometrial carcinomas, but only 7% of CAH cases [115]. Oda et al. reported a 36% rate of mutations in PIK3CA and found that there was a high frequency of tumors with both PIK3CA and PTEN mutations [116]. Our group described loss of TSC2 and LKB1 expression in 13% and 21% of endometrial cancers, with the subsequent activation of mTOR [117]. A heterozygous LKB1 mouse model has been described recently that develops highly invasive endometrial adenocarcinomas [118]. In humans, germline LKB1 mutations are responsible for Peutz-Jeghers syndrome. It has not previously been reported that women with Peutz-Jeghers syndrome are at increased risk for endometrial cancer. Clearly, somatic abnormalities in the components of the PTEN/AKT/TSC2/MTOR pathway have been identified in a substantial number of endometrial cancers. Currently, clinical trials are either underway or recently completed examining mTOR inhibitors, including CCI-779 and RAD-001. Further investigation of whether specific alterations in the pathway correlates to response to therapy will be necessary. Approximately 30% of sporadic endometrioid endometrial cancers demonstrate MSI. MSI identifies tumors that are prone to DNA replication repair errors. Microsatellites are well-defined short segments of repetitive DNA (example: CACACA) scattered throughout the genome. Tumors that demonstrate gain or loss of these repeat elements at specific microsatellite loci, when compared to normal tissue, are considered to have MSI. MSI occurs in approximately 30%–40% of all endometrioid endometrial cancers, but rarely in Type II endometrial cancers [119]. In addition, MSI also occurs in approximately 20% of all colon cancers. The mechanism of MSI is due to either a somatic hypermethylation or silencing of the MLH1 promoter or an inherited defect in one of the mismatch repair genes (MSH1, MSH2, MSH6, PMS2). An inherited defect in one of the mismatch repair genes is the cause

Chapter 23

of Lynch syndrome, a hereditary cancer predisposition syndrome. Individuals with Lynch syndrome are at increased risk for colon and endometrial cancer, as well as cancers of the stomach, ovary, small bowel, and ureters. Women with Lynch syndrome have a 40%– 60% lifetime risk of endometrial cancer, which equals or exceeds their risk of colon cancer [120,121]. While the risk of endometrial cancer is high in these women, overall Lynch syndrome accounts only for approximately 2%–3% of all endometrial cancers [122]. Endometrial cancers that develop in women with Lynch syndrome almost uniformly demonstrate MSI. Somatic hypermethylation of MLH1 and MSI occurs in approximately 30% of all endometrioid endometrial cancers and is an early event in the pathogenesis. MSI has been identified in CAH lesions. It is presumed that MSI specifically targets tumor suppressor genes, resulting in the development of cancer. Reported target genes include FAS, BAX, IGF, the insulin-like growth factor 2 receptor (IGFIIR), and transforming growth factor b receptor type 2 (TGFbRII) [123]. Studies focusing on the clinical significance of MSI have been mixed. While some investigators have found an association of MSI with a more aggressive clinical course, a more recent study examining only endometrioid endometrial cancers found no difference in clinical outcome between tumors demonstrating MSI and those without [124,125]. The microsatellite instability assay, as well as immunohistochemistry (IHC) for MSH1, MSH2, MSH6, PMS2, can be very useful as a screening tool to identify women with endometrial cancer as having Lynch syndrome [122]. While collecting and interpreting a family history is helpful, these molecular tools can be useful in targeting certain populations that may be at higher risk for Lynch syndrome, such as women under the age of 50 [126,127]. KRAS mutations have been identified in 20%–30% of endometrioid endometrial cancers. There is a higher frequency of KRAS mutations in cancers that demonstrate MSI. Mutations in beta-catenin have been seen in approximately 20%–30% of endometrioid endometrial cancers [128]. These mutations occur in exon 3 and result in stabilization of the beta catenin protein as well as nuclear accumulation. Nuclear betacatenin plays an important role in transcriptional activation. One study demonstrated that PTEN, MSI, and KRAS mutations frequently co-exist. However, beta catenin alterations usually are not seen in these other abnormalities [129]. Beta catenin mutations have been identified in CAH, suggesting that this is an early step in the pathogenesis of endometrial cancer. Type II Endometrial Cancers. Type II endometrial cancers have a more aggressive clinical course and include poorly differentiated endometrioid tumors as well as papillary serous and clear cell endometrial cancers. Patients with Stage I papillary serous endometrial cancer have a 5-year overall survival of 74%, significantly lower than the 90% 5-year overall survival for women with endometrioid endometrial cancer [110]. The average age of diagnosis of patients with papillary serous endometrial cancers is 68 years, and risk factors


typically associated with Type I endometrial cancers are not present [130]. In addition, the genetic alterations seen in Type I endometrial cancers, as described previously, are not frequently found in papillary serous endometrial cancers [111,112,131]. Microarray studies examining Type 1 versus Type 2 cancers have shown a distinct set of genes that are up- and downregulated in Type 1 versus Type 2 cancers [111,112]. TP53 gene mutations are common in uterine papillary serous carcinomas [132]. Her-2/neu overexpression by immunohistochemistry (IHC) was observed in 18% of uterine papillary serous carcinomas [130,133]. Of note, fewer tumors that demonstrated Her-2/neu overexpression by IHC showed Her-2/neu gene amplification. Several studies have reported that Her-2/neu overexpression is associated with a poor overall survival for UPSC [134,135]. Interestingly, one study reported that overexpression of Her-2/neu in uterine papillary carcinoma occurs more frequently in African American women. Mesenchymal Tumors. Endometrial mesenchymal tumors are derived from the mesenchyme of the corpus composed of cells resembling those of proliferative phase endometrial stroma. Among them, uterine fibroids are the most common mesenchymal tumors of the female reproductive tract, which represent benign, smooth muscle tumors of the uterus. Recent studies have shown that the lifetime risk of fibroids in a woman over the age of 45 years is >60%, with incidence higher in African-Americans than in Caucasians [136]. The course of fibroids remains largely unknown and the molecular basis of this disease remains to be determined. Recent molecular and cytogenetic studies have revealed genetic heterogeneity in various histological types of uterine fibroids [137]. Chromosome 7q22 deletions are common in uterine leiomyoma, the most common type of uterine fibroids [67]. Several candidate genes, including ORC5L and LHFPL3, have been identified, but their roles in the pathogenesis of the disease have not been elucidated [138]. Loss of a portion of chromosome 1 is common in the cellular form of uterine leiomyomata. Endometrial stromal sarcoma is the most common malignant mesenchymal tumor of the uterus. They often arise from endometriosis [139]. Genetic studies suggested that abnormalities of chromosomes 1, 7, and 11 may play a role in tumor initiation or progression in uterine sarcomas [140]. Fusion of two zinc fingers (JAZF1 and JJAZ1) by translocation t(7;17) has also been described [141].

Ovary and Fallopian Tube Multiple benign and malignant diseases have been identified in the ovary and the fallopian tube. The most common ones are polycystic ovary syndrome (PCOS), and benign and malignant tumors of the ovary. While molecular studies in all these diseases have revealed changes in multiple genes, the etiology of most of these diseases remains largely unknown. 473

Part IV


Polycystic Ovary Syndrome Polycystic ovary syndrome (PCOS) is a common heterogeneous endocrine disorder associated with amenorrhoea, hyperandrogenism, hirsutism, insulin resistance, obesity, and a 5–10-fold increased risk of type 2 diabetes mellitus [142]. It is a leading cause of female infertility. The inherited basis of this disease was established by epidemiologic studies demonstrating an increased prevalence of PCOS, hyperandrogenemia, insulin resistance, and altered insulin secretion in relatives of women diagnosed with PCOS [143]. From these pathways, several genes have been studied, including genes involved in steroid hormone biosynthesis and metabolism (StAR, CYP11, CYP17, CYP19 HSD17B1-3, HSD3B1-2), gonadotropin and gonadal hormone actions (ACTR1, ACTR2A-B, FS, INHA, INHBA-B, INHC, SHBG, LHCGR, FSHR, MADH4, AR), obesity and energy regulation (MC4R, OB, OBR, POMC, UCP2-3), insulin secretion and action (IGF1, IGF1R, IGFBPI1-3, INS VNTR, IR, INSL, IRS1-2, PPARG), and others [34,144–152]. PCOS appears to be associated with the absence of the four-repeat-units allele in a polymorphic region of the CYP11A gene, which encodes cytochrome P450scc [153]. Alteration of serine phosphorylation also seems to be involved in the posttranslational regulation of 17,20-lyase activity (CYP17) [146]. About 50 genes have been demonstrated to have association with PCOS. Linkage and association studies identified a hotspot of candidate genes on chromosome 19p13.3, but to date, no genes are universally accepted as important in the pathogenesis of PCOS [154,155]. Further confirmatory and functional studies are needed to identify key genes in the pathogenesis of PCOS.

Benign Ovarian Cysts Benign ovarian cysts are a very common condition in premenopausal women. During normal ovulation each month, the follicle (or cyst) created by the ovaries bursts harmlessly. For unknown reasons, this normal physiologic process may sometimes go wrong. The follicle may continue to swell with fluid without releasing its egg, or hormones secreting tissue (corpus luteum) that prepare for pregnancy may persist even though the egg has not been fertilized. Subsequently, a cyst (or fluid-filled sac), which may be as small as a grape or as large as a tennis ball, is formed [156]. Mutation of the FOXL2 gene has been found in a patient with a large ovarian cyst [157]. Such a cyst is usually benign and disappears within a couple of months. However, if such a cyst persists after several months, it may become a benign semisolid cyst. The most common semisolid cyst is a dermoid cyst, so-called because it is made up of skin-like tissue and can be removed by laparoscopic surgery [158].

Borderline Tumors Borderline tumors account for 15%–20% of epithelial ovarian tumors, and was first recognized by Howard 474

Taylor in 1929 [159]. He described a group of women of reproductive age with large ovarian tumors whose course was rather indolent [159]. In the early 1970s, the Federation of Gynecologists and Obstetricians defined these so-called semi-malignant tumors as borderline ovarian tumors (BOTs) [160]. Later on, at the 2003 World Health Organization workshop, the term low malignant potential (LMP) became an accepted synonym for BOTs [161]. Borderline tumors with different cell types (serous, mucinous, endometrioid, clear cell, transitional, and mixed epithelial cells) have been reported. However, the serous and mucinous are the most common types. Mutational analyses have identified several gene mutations (Table 23.1) in borderline tumors. Both BRAF and KRAS mutations are very common in borderline serous tumor. However, BRAF mutation has not been found in borderline mucinous tumors. Moreover, the frequency of KRAS mutation is higher in borderline mucinous tumor than in serous tumors. On the other hand, CTNNB1 and PTEN mutations have been found in borderline endometrioid tumors. The difference in mutation spectrum indicates different pathogenic pathways for these histological subtypes. Whether serous BOT (SBOT) will progress to invasive carcinoma is still controversial [162]. In a recent review of the clinical outcome of 276 patients with SBOTs, approximately 7% of the patients had recurrent disease as invasive low-grade serous carcinoma [163]. In another report, when patients with SBOTs were followed-up for a longer period, over 30% of the patients had recurrent disease as low-grade carcinoma over a period of 3 to 25 years [164]. Studying genetic changes in different types of ovarian tumors provides insight into the pathogenic pathways for ovarian cancer. Mutations in KRAS have been found in 63% of mucinous BOTs and 75% of invasive mucinous ovarian cancers. These data suggest that KRAS mutations are involved in the development of mucinous BOTs and support the notion that mucinous BOTs may represent a phase of development along the pathologic continuum between benign and malignant mucinous tumors [165]. However, KRAS mutation rate in serous BOTs is significantly higher than that in serous invasive cancers. These data suggest that serous BOTs and invasive carcinomas may have different pathogenic pathways, and only a small percentage of serous BOTs may progress to invasive cancers. A mucinous cystadenoma would give rise to a mucinous borderline ovarian tumor (BOT), a subset of which may progress to invasive low-grade and perhaps high-grade mucinous carcinomas. A serous cystadenoma would give rise to a serous BOT, in which benign and borderline features are rare, in contrast to their frequent presence in mucinous BOTs.

Malignant Tumors Ovarian cancer is a general term that represents a diversity of cancers that are believed to originate in the ovary. Over 20 microscopically distinct types can be identified, which can be classified into three major

Chapter 23

hundreds of rare mutations have also been identified (http://www.sanger.ac.uk/genetics/CGP/cosmic/). Besides genetic analysis, other high-throughput methods have been exploited to understand the pathogenic pathways in ovarian cancer [166,167]. It is hypothesized that most ovarian tumors develop from ovarian inclusion cysts arising from the OSE. In most cases of serous cancer, the majority of serous BOTs develop directly from ovarian inclusion cysts, without the cystadenoma stage. Alternatively, the epithelial lining of the cyst develops into a mucinous or serous cystadenoma by following one of two distinct pathogenic pathways. Our recent expression profiling analysis of serous BOTs and serous low- and high-grade carcinomas suggested that serous BOTs and low-grade carcinomas may represent developmental stages along a continuum of disease development and progression [167]. Thus, we hypothesize that a majority of highgrade serous carcinomas derive de novo from ovarian

groups, epithelial cancers, germ cell tumors, and specialized stromal cell cancers. These three groups correspond to the three distinct cell types of different functions in the normal ovary: (i) the epithelial covering may give rise to the epithelial ovarian cancers, (ii) the germ cells may give rise to the germ cell tumors, and (iii) the steroid-producing cells may give rise to the specialized stromal cell cancers. Epithelial Ovarian Tumors. The majority of malignant ovarian tumors in adult women are epithelial ovarian cancer. Based on the histology of the tumor cells, they are classified into different categories: serous, mucinous, endometrioid, clear cell, transitional, squamous, mixed, and undifferentiated. From the Sanger Center’s Catalogues of Somatic Mutations in Cancer (COSMIC) database, we have extracted the most frequently identified mutations for each histological subtype (Table 23.1). In addition to these common mutations,

Table 23.1

Common Somatic Mutations in Human Sporadic Ovarian Tumors Number of Samples Screened

Number of Positive Samples

KRAS BRAF BRCA1 BRCA2 PIK3CA

152 59 13 9 8

15 3 0 0 0

9% 5% 0% 0% 0%

BRAF KRAS ERBB2 PIK3CA CDKN2A KRAS CDKN2A SMAD4 BRAF BRCA1 CTNNB1 PTEN KRAS

191 141 21 23 15 5 10 5 28 5 9 8 8

80 37 2 1 0 4 3 1 0 0 8 1 0

41% 26% 9% 4% 0% 80% 30% 20% 0% 0% 88% 12% 0%

KRAS CDKN2A BRCA1 BRAF PIK3CA KRAS CDKN2A PTEN PIK3CA AATK KRAS CDKN2A PIK3CA BRCA2 BRAF CTNNB1 PTEN BRAF KRAS PIK3CA

447 227 246 250 230 143 60 36 30 2 119 23 20 5 53 240 92 107 176 67

38 14 11 6 5 62 12 6 2 2 10 5 5 2 1 65 23 22 12 10

8% 6% 4% 2% 2% 43% 20% 16% 6% 100% 8% 21% 25% 40% 1% 27% 25% 20% 6% 14%

Gene Name Ovarian adenoma

Borderline tumors Serous

Mucinous

Endometrioid Carcinomas Serous

Mucinous

Clear cell

Endometrioid


Percent Mutated

475

Part IV


cysts or ovarian endosalpingiosis. This hypothesis is consistent with the two-tier system recently proposed for the grading serous carcinomas [168,169]. Loss of heterozygosity (LOH) studies have been widely used to identify minimally deleted chromosomal regions where tumor suppressor genes may reside. We previously identified several common loss regions by using 105 microsatellite markers to perform detailed deletion mapping on chromosomes 1, 3, 6, 7, 9, 11, 17, and X in BOTs, invasive ovarian cancers, and serous surface carcinoma of the ovary. Except at the androgen receptor (AR) locus on the X chromosome [170], BOTs showed significantly lower LOH rates (0%–18%) than invasive tumors at all loci screened, suggesting that the LOH rate at autosomes is less important in the development of BOTs than more advanced tumors. Based on these and other results, the importance of LOH at the AR locus in BOTs and invasive cancers remains undetermined. However, several studies have found differences in LOH rates on other chromosomes. LOH at the p73 locus on 1p36 was found in both high-grade and low-grade ovarian and surface serous carcinomas, but not in borderline ovarian tumors. In one study, LOH rates at 3p25, 6q25.1–26, and 7q31.3 were significantly higher in high-grade serous carcinomas than in low-grade serous carcinomas, mucinous carcinomas, and borderline tumors [171–173]. In another study, LOH rate at a 9cM region on 6q23-24 were significantly higher in surface serous carcinomas than in serous ovarian tumors [174]. In addition, multiple minimally deleted regions have been identified on chromosomes 11 and 17. LOH at a 4-cM region on chromosome 11p15.1 and an 11-cM region on chromosome 11p15.5 were found only in serous invasive tumors, and the LOH rates in 11p15.1 and 11p15.5 were significantly higher in high-grade than low-grade serous tumors [175]. Similarly, significantly higher LOH rates were identified at the TP53 locus on 17p13.1 and the NF1 locus on 17q11.1 in high-grade serous carcinomas than in lowgrade and borderline serous tumors and all mucinous tumors [176]. LOH at the region between THRA1 and D17S1327, including the BRCA1 locus on 17q21, was found exclusively in high-grade serous tumors [173]. In general, the fact that LOH rates at multiple chromosomal sites were significantly higher in serous than in mucinous tumor subtypes suggests that serous and mucinous tumors may have different pathogenic pathways. Since tumor suppressor genes are implicated to be located in chromosomal regions demonstrating LOH, further analysis of the genes located in the minimally deleted regions may provide insights into genes that may be important for the pathogenesis of serous and mucinous ovarian tumors. Studying genetic changes in endometriosis, endometrioid, and clear cell ovarian cancer also provides insights into pathogenic pathways in the development of these tumor types. Endometriosis is highly associated with endometrioid and clear cell carcinomas (28% and 49%, respectively), in contrast to its very low frequency of association with serous and mucinous carcinomas of the ovary (3% and 4%, respectively) [177]. This fact 476

furnishes strong evidence that endometriosis is a precancerous lesion for both endometrioid and clear cell carcinomas. Obata et al. [178] showed that endometrioid but not serous or mucinous epithelial ovarian tumors had frequent PTEN/MMAC mutations. In addition, the loss of PTEN immunoreactivity has been reported in a significantly higher percentage of clear cell and endometrioid ovarian cancers than cancers of other histologic types [179]. Dinulescu et al. [180] demonstrated that the expression of oncogenic KRAS or conditional PTEN deletion within the OSE induces preneoplastic ovarian lesions with an endometrioid glandular morphology. Furthermore, the combination of the two mutations in the ovary led to the induction of invasive and widely metastatic endometrioid ovarian adenocarcinomas. These data further suggest that tumors with different histologic subtypes may arise through distinct developmental pathways. Germ Cell Cancer. The ovarian germ cell tumors commonly occur in young women and can be very aggressive. Fortunately, chemotherapy is usually effective in preventing it from recurring. The pathogenesis of these tumors is not well understood. Several subtypes exist, which are dysgerminoma, yolk sac tumor, embryonal carcinoma, polyembryoma, choriocarcinoma, immature teratoma, and mixed GCTs. A recent study has identified c-KIT mutation and the presence of Y-chromosome material in dysgerminoma [181]. Furthermore, DNA copy number changes were detected by comparative genomic hybridization in dysgerminomas. The most common changes in DGs were gains from chromosome arms 1p (33%), 6p (33%), 12p (67%), 12q (75%), 15q (42%), 20q (50%), 21q (67%), and 22q (58%) [182]. However, overexpression or mutation of p53 was not observed in ovarian germ cell tumors [183]. Stromal Cancer. The specialized stromal cell tumors (granulose cell tumors, thecal cell tumors, and Sertoli-Leydig cell tumors) are uncommon [184]. One interesting characteristic of these tumors is that they can produce hormones. Granulosa and thecal cell tumors are frequently mixed and can produce estrogen, which will result in premature sexual development and short stature if the tumors are developed in young girls. Sertoli-Leydig cell tumors produce male hormones, which will cause defeminization. Subsequently, male pattern baldness, deep voice, excessive hair growth, and enlargement of the clitoris will develop in patients with Sertoli-Leydig cell tumors. Overexpression of the BCL2 gene in Sertoli-Leydig cell tumor of the ovary has been reported [185]. Fortunately, these specialized stromal cell cancers are usually not aggressive cancers and involve only one ovary. Tumors of the Fallopian Tube. The fallopian tubes are the passageways that connect the ovaries and the uterus. Fallopian tube cancer is very rare. It accounts for less than 1% of all cancers of the female reproductive organs. Only 1,500 to 2,000 cases have been reported worldwide, primarily in postmenopausal women. There is some evidence that women who

Chapter 23

inherit a mutation in the BRCA1 gene, a gene already linked to breast and ovarian cancer, seem to have an increased risk of developing fallopian tube cancer. In one recent analysis of several hundred women who were carriers of the BRCA1 gene mutation, the incidence of fallopian tube cancer was increased more than 100-fold [186]. Likewise, a substantial proportion of women with the diagnosis of fallopian tube cancer test positively for either the BRCA1 or BRCA2 gene mutation. Recent recommendations suggest that any woman with a diagnosis of fallopian tube cancer be tested for the BRCA mutations. Based on the pathological study of fallopian tubes from BRCA1 carrier, another hypothesis is being proposed that some serous ovarian tumors may be developed from the secretory fimbrial cells of the tube [187].

Vagina and Vulva Vaginal intraepithelial neoplasia and squamous cell carcinoma are the most common tumor types affecting the vagina. Persistent infection with high-risk HPV (such as HPV16 and HPV18) is a major etiological factor for both diseases [188,189]. Overexpression of p53 and Ki67 has been identified in 19% and 75% of vaginal cancer cases, respectively [190]. Similar to vaginal malignancies, squamous cell carcinoma is the most common form of neoplasia in the vulva. Precursor lesions include vulvar intraepithelial neoplasia (VIN), the simplex (differentiated) type of VIN, lichen sclerosis, and chromic granulomatous. While vaginal carcinomas and VIN have been shown to be associated with HPV, usually of type 16 and 11, the simplex form of VIN and other precursor lesions are not HPV-associated [191]. Genetic studies identified both TP53 and PTEN mutations in VIN, as well as in carcinomas, suggesting that these molecular changes are early events in the pathogenesis of vulvar cancers [192,193]. Other genetic changes including chromosome losses of 3p, 4p, 5q, 8p, 22q, Xp, 10q, and chromosome gains of 3q, 8p, and 11q have been reported [194–196]. In addition, high frequencies of allelic imbalances have been found in both HPV-positive and HPV-negative lesions at multiple chromosomal loci located on 1q, 2q, 3p, 5q, 8p, 8q, 10p, 10q, 11p, 11q, 15q, 17p, 18q, 21q, and 22q [197]. Other less common epithelial malignancies of the vulva include Paget disease and Bartholin gland carcinoma. Nonepithelial vulvar malignancies include malignant melanomas, which accounts for 2%–10% of vulvar malignancies [198]. The molecular basis of most of these diseases remains largely unknown.

DISORDERS RELATED TO PREGNANCY Conception, maintenance of the pregnancy, and delivering of a baby are the most important functions of the female reproductive tract. Proper implantation of the embryo is a crucial step in a healthy pregnancy. Failure of this process can compromise the life of the fetus and the mother. During implantation, trophoblast


cells basically invade into the endometrium in a controlled fashion and transform the spiral arteries to supply the growing fetus with oxygen and nutrition. Failure of this process results in fetal hypoxia and growth retardation, which might lead to complications like abortion, preeclampsia, and preterm delivery. On the other hand, uncontrolled invasion can lead to deep implantation (placenta accreta, increta, percreta), or in gestational trophoblastic diseases, it can result in persistent disease, metastases, and development of neoplasia. The trophoblast invasion is regulated by at least three factors: (i) the endometrial environment (including adhesion molecules and vascularization at the implantation site), (ii) the maternal immune system, and (iii) the invasive and proliferative potentials of the trophoblast cells. Complications following normal conceptions are mainly due to the failure of the maternal endometrium or immune system, whereas complications following genetically abnormal conceptions are most often the result of abnormal trophoblastic cell function. Preeclampsia and gestational trophoblastic diseases represent serious conditions that can lead to maternal death. This fact has put these diseases into the focus of clinical and molecular researchers. The molecules discussed here may also play a role in other implantation-related diseases, such as unsuccessful IVF cycles, recurrent spontaneous abortions, preterm deliveries, and others. In gestational trophoblastic diseases (GTD), the problem is the overly aggressive behavior of the trophoblastic cells. The trophoblast cells in GTD are hyperplastic and have much more aggressive behavior than in normal pregnancy. Trophoblast cells might invade into the myometrium and persist after evacuation, which, without adequate chemotherapy, can compromise the life of the mother. Trophoblast hyperplasia in GTD also can result in true gestational trophoblastic neoplasia (GTN). In preeclampsia, hypertension and vascular dysregulation are the indirect results of the inadequate placentation due to different combinations of the previously mentioned factors. To date, the primary mechanisms that account for failure of trophoblast cells to invade and transform the spiral arteries are still unknown. However, the mechanisms and factors leading to the classic symptoms after fetal stress seem to be identified, and clinical trials have been started to control these factors to prevent preeclampsia.

Gestational Trophoblastic Diseases Gestational trophoblastic disease is a broad term covering all pregnancy-related disorders in which the trophoblast cells demonstrate abnormal differentiation and hyperproliferation. Molar pregnancies are the most common gestational trophoblastic diseases, which are characterized by focal (partial mole) or extensive (complete mole) trophoblast cell proliferation on the surface of the chorionic villi. Gestational trophoblastic neoplasms, like gestational choriocarcinoma, can arise from molar pregnancies (5%–20%) and on very rare occasions from normal pregnancies (0.01%) [199]. 477

Part IV


Partial molar pregnancy is a result of the union of an ovum and two sperms. Therefore, the genetic content of the fetus is imbalanced with overrepresentation of paternal genetic material. Since the maternal chromosomes are present, the embryo can develop to a certain point. The complete mole is the result of a union between an empty ovum and generally two sperms. Rarely, the conception happens with one sperm, and the genetic content of the sperm doubles in the ovum. In this case, the maternal chromosomes are not present. Therefore, no embryo develops [200]. Fisher et al. also have described familial recurrent hydatidiform molar pregnancies where balanced biparental genomic contribution could be found. In these cases, gene mutation is suspected on the long arm of chromosome 19, but to date the responsible gene has not been identified [201].

Epigenetic Changes in Trophoblastic Diseases Due to unbalanced conception, gene expression in molar pregnancy differs greatly from that of a normal pregnancy. The gene expression differences can partly be explained by the lack or excess of chromosome sets, but more importantly epigenetic parental imprinting has a substantial role in the modification of the gene expression profile. Maternally imprinted genes are normally expressed from one set of paternal chromosomes, while in molar pregnancies these genes are expressed from two or more sets of paternal chromosomes. On the other hand, paternally imprinted genes are normally expressed only from the maternal allele, but in complete moles these genes cannot be expressed at all due to the lack of maternal chromosomes in complete gestational trophoblastic diseases. Complete molar pregnancy, as a unique uniparental tissue, is in the focus of epigenetic studies of placental differentiation [202]. Several imprinted genes (P57kip2, IGF-2, HASH, HYMAI, P19, LIT-1) have been investigated in complete moles, and paternally imprinted p57kip2 is now used as a diagnostic tool to differentiate complete mole from partial mole and hydropic pregnancy by detecting maternal gene expression [203]. Table 23.2 shows the known parentally imprinted genes and their functions that are associated with hydatidiform mole.

Table 23.2

Immunology and Trophoblastic Diseases As partial and complete moles are foreign tissues in the maternal uterus, vigorous immune response would be expected from the mother’s side [209]. On the other hand, trophoblast cells express several immunosuppressive factors to attenuate the maternal immune response to protect the semiallogeneic fetus. Trophoblast cells, unlike other human cells, lack class I major histocompatibility complexes (MHC). Instead, they express atypical MHCs like human leukocyte antigen (HLA) G, E, and F [210,211]. The atypical HLAs do not present antigens to the immune cells, but they are still able to inactivate the natural killer (NK) cells. Thus, these atypical HLAs protect the semiallogeneic fetus from the immune cells [212]. The expression of immunosuppressive factors shows significant differences between normal and molar trophoblast cells. Table 23.3 lists the molecules which may play a role in the development of systematic and local gestational immunosuppression. In gestational trophoblastic diseases, the hyperproliferation of the trophoblast results in an even higher level of immunosuppressive factors in the mother. Furthermore, some of the immunosuppressive factors in GTD and GTN are elevated not only because of the higher number of hyperplastic trophoblast cells, but also due to overexpression of these factors by the trophoblast cells. For example, soluble and membrane bound HLA-G was shown to be overexpressed in molar pregnancies and gestational trophoblastic neoplasms [213]. Besides, molar villous fluid effectively suppressed the cytotoxic T-cells in vitro [214]. Shaarawy et al. also found that the soluble IL2 receptor level was significantly higher in the serum of mothers who subsequently developed persistent gestational trophoblastic disease [215].

Oncogene and Tumor Suppressor Gene Alterations in Trophoblastic Diseases As molar pregnancies and especially gestational trophoblastic neoplasms demonstrate excessive trophoblast cell proliferation, extensive studies were undertaken to characterize the expression of tumor suppressor and oncogenes. Fulop et al. demonstrated that both complete mole and choriocarcinoma were

Imprinted Genes in Embryonic Development Associated with Hydatidiform Moles

Gene

Transcribed From

p57kip2 IGF-2

Maternal allele Paternal allele

HYMAI H19 LIT-1

Maternal allele Maternal allele Maternal allele

Function Negatively regulates cell proliferation by binding G1 cyclin complexes [204] Increases the expression of passive amino acid transporters on trophoblast cells; increases trophoblast invasiveness [205] Associated with transient neonatal diabetes mellitus [206] Necessary for muscular differentiation; associated with Wilms’ tumor [205; 207] LIT-1 is required for p57kip2 expression and specific deletion results in BWS [208]

IGF-2—Insulin-like growth factor 2; HYMAI—hydatidiform mole-associated imprinted gene; LIT-1—long QT intronic transcript; BWS— Beckwith-Wiedemann syndrome.

478

Chapter 23

Table 23.3

Immunosuppressive Molecules Secreted by Trophoblast Cells (Adapted from [216])

HLA molecules (C,G,E,F) Soluble HLA G Fas L Cytokines (TGFb, IL-10, IL-4, IL-6) Indoleamine 2,3-dioxygenase DAF, MCP, CD59 PI-9 hCG


Increases the Expression

Ligand

Immune Cell or System Affected

Function

IL-10

KIR

NK

Inhibition

IL-10 Th2 cytokines and hCG Unknown

KIR Fas

Tc cell Tc cell

Apoptosis Apoptosis

g-INF

Cytokine receptors L-tryptophan

Th cells, Tc cells, NK, Trophoblast cells T-cell, Complement system

Unknown Unknown Unknown

Multiple Granzyme B hCG receptor

Complement system Tc cell, NK cell killing Trophoblast Immune cells

Suppression HLA G, E, F overexpression Inhibition of T-cell maturation by tryptophan depletion, Complement inhibition MAC inhibition Granzyme B inhibitor Fas L overexpression hCG ! Progesterone!PIBF

IL—interleukin; HLA—Human leukocyte antigen; Fas L—Fas ligand; DAF—Decay accelerating factor; MCP— Membrane cofactor protein; INF—interferon; KIR—Killer inhibitor receptor; NK—natural killer; Tc—cytotoxic T cells; Th—Helper T-cells; MAC— membrane attack complex; PIBF—Progesterone-induced blocking factor.

characterized by overexpression of p53, p21, and Rb tumor suppressor genes and c-myc, c-erbB-2, and bcl-2 oncogenes, while partial mole and normal placenta generally do not strongly express these molecules [217–219]. p53 and Rb molecules are mainly found in the nuclei of cytotrophoblastic cells, while p21 could be seen in syncytiotrophoblast cells. DOC-2/hDab2 tumor suppressor gene expression, on the other hand, was significantly stronger in normal placenta and partial mole compared to complete mole and choriocarcinoma [217]. Kato et al. have compared hydatidiform mole gene expression profile to normal placenta gene expressions by microarray method and identified 508 differentially expressed gene [220]. Most of these genes are members of MAP-RAS kinase, Wnt, and Jak-STAT5 pathways. Some other genes, like versican, might have a role in cell migration or drug interactions [220]. These findings provide important insight into the development of the GTN. However, to date it is not clear which gene has the primary role to develop gestational trophoblastic disease or neoplasia.

Molecular Mechanisms in Trophoblast Invasion The process of the trophoblast invasion involves the enzymatic degradation of the extracellular matrix of the endometrium. Extracellular proteinases are thought to be important factors in modifying cellmatrix interactions and in the degradation of the extracellular structures [218]. Different types of matrix degrading proteases have been found to be involved in the process of trophoblast invasion, like serine proteinases and matrix metalloproteinases (MMPs). MMPs are regulated by tissue inhibitors of metalloproteinases (TIMPs) [221]. MMP1 and MMP2 have been found to be overexpressed in choriocarcinoma cells compared to molar and normal placental syncytiotrophoblast

cells. On the contrary, TIMP-1 has been shown to be downregulated in choriocarcinoma [222]. Therefore, MMPs and their inhibitors may have an effect in the aggressiveness of trophoblastic cells. Table 23.4 and Table 23.5 show the known stimulatory and inhibitory factors regulating trophoblast invasion. Most of these mechanisms have been shown to be altered in gestational trophoblastic diseases.

Detection of Trophoblastic Diseases Gestational trophoblastic neoplasms are mostly known as chemosensitive malignancies. Human choriogonadotropin (hCG) follow-up is used in every case to diagnose persistent disease or GTN before applying chemotherapy [240]. Several studies have tried to identify a reliable molecular or histologic marker which could predict persistent disease at the time of evacuation, but to present date none of them seems to be sensitive and specific enough to change the current prognostic scoring and hCG follow-up in clinical practice. However, some promising results may help to diagnose GTN and predict prognosis in the future. Cole et al. recently demonstrated that hyperglycosylated hCG (hCG-H) appears to reliably identify active trophoblastic malignancy, but unfortunately hCG-H alone is unable to predict persistence at the time of primary evacuation [241]. Serum IL-2 and soluble IL2 receptor levels at the time of evacuation have been demonstrated to have association with the clinical outcome and persistence [215]. IL-1, EGFR, c-erbB-3, and antiapoptotic MCL-1 staining on trophoblast cells also significantly correlated with the development of persistent postmolar gestational trophoblastic neoplasia [242–244]. Further studies of potential molecules are needed to find a reliable marker or marker panel to predict persistent gestational trophoblastic diseases. 479

Part IV


Table 23.4

Stimulatory Factors Involved in the Regulation of EVT Invasion Expression Site

Stimulatory Factors

Trophoblast

Decidua

Mechanism

Syncytiotrophoblasts, Hofbauer cells Villous cytotrophoblasts, extravillous trophoblast (EVT) Not expressed

NK cells, macrophages Not expressed

Upregulation of MMP-2, MMP-9, and uPA [223] IGF-II actions mediated by IGF-R II [224]

Decidual cells

Activin*

ST, villous trophoblast (VT), and EVT Cytotrophoblast, EVT

Blood vessel, endothelium Decidual cells

Heparin bindingEGF, EGF, TGFa*

EGF and receptors expressed on villous cytotrophoblast, EVT

Decidual cells

MMP-2, MMP-9*

EVT, villous cytotrophoblast

Not expressed

uPA

EVT, cytotrophoblast, syncytiotrophoblast VT Cytotrophoblast, EVT

Decidual cells

Interaction with Arg-Gly-Asp (RGD)-binding sites of EVT surface a5b1 [224] Binding with ET-1 receptor expressed on EVT [225, 226] Induce cytotrophoblast differentiation, upregulation of MM9, MMP-2, and anti–TGFb [227, 228] Inducing cytotrophoblast to EVT differentiation; induce integrin phenotype switching (a6b4 to a1b1) on EVT [229] Proteolysis, remodeling, and invasion to type IV collagen [230] Cell-bound proteolysis [231]

IL-1b* IGF-II* IGFBP-1* ET-1

OPN* LR1*

Decidual cells Decidual cells, macrophages

Binds to integrins and CD44 [232] Changes the conformation of laminin [233]

*Indicates different levels of expression between normal pregnancy and gestational trophoblastic diseases.

Table 23.5

Inhibitory Factors Involved in the Regulation of EVT Invasion. Expression Site

Inhibitory Factors

Trophoblast

Decidua

Mechanism

TGF-b1–3*

All types of trophoblasts No expression

Secreted by NK and macrophage Decidual products

Melanoma cell adhesion molecule (Mel-CAM)*

EVT

TIMP-1, TIMP-2* PAI-1, PAI-2*

All trophoblast Syncytiotrophoblast, chorionic villi Trophoblast in vitro culture EVT from cell columns and interstitial trophoblast

Not expressed, but uterine smooth muscle expressed the ligand Decidual stromal cells Endothelial cells, decidual cells NK cells, macrophages

Upregulates TIMP and PAI; downregulates MMP-2, MMP-9, uPA [234] Interacts with fibronectin with decorin core protein, impedes locomotion of EVTs on their natural substrate [235] Mel-CAM interacts with ligand on uterine smooth muscle to inhibit EVT migration [236]

Decorin*

TNFa* IFN-g*

Hypoxia

Macrophages, vascular endothelial cells

Inhibits the activity of MMP-2 and MMP-9 [230] Inhibits the activity of uPA and trophoblast migration [230] Upregulates PAI-1 [237] Induces trophoblast apoptosis; upregulates HLA-C and HLA-G on the surface of EVTs; promotes Th1-reaction (antitumor effects) [238, 239] Interferes with trophoblast proliferation, fibronectin synthesis, a5 integrin, and MMP-2; increases expression of TNF-a [227].

*Indicates different levels of expression between normal pregnancy and gestational trophoblastic diseases.

Molecular Basis of Preeclampsia In preeclampsia most of the factors in Table 23.2, Table 23.3, and Table 23.4 might also have a role in the etiology of the disease. To date, the etiology of the disease is not known. In preeclampsia, the failure 480

of the trophoblast implantation indirectly leads to serious consequences. The implantation is sufficient enough to supply the embryo to a certain point, but the capacity of the not completely transformed spiral arteries is limited. Therefore, the fetus and the placenta suffer from hypoxic injury. Preeclampsia is

Chapter 23

characterized by endothelial dysfunction, which produces altered quantities of vasoactive mediators resulting in general vasoconstriction. Recent studies demonstrated that soluble fms-like tyrosine kinase-1 (sFlt-1 or sVEGFR-1) might have a crucial role in developing hypertension and proteinuria in pregnant women [245,246]. sFlt-1 is a tyrosine kinase protein which disables proteins that cause blood vessel growth. sFlt-1 prevents the effect of VEGF and placental growth factor (PLGF) on vascular structures. In women developing preeclampsia, the serum level of sFlt-1 is significantly elevated, and the levels of VEGF and PLGF are markedly decreased compared to normotensive women [247]. The sFlt-1 level starts to rise 5 weeks before the onset of preeclampsia [248]. In animal studies, exogenous application of sFlt-1, similar to anti-VEGF bevacizumab, result in hypertension and proteinuria in pregnant rats [249]. Together with sFlt-1, endoglin serum level correlates with the progression and severity of preeclampsia [250]. Endoglin is a soluble transforming growth factor b (TGFb) coreceptor. Endoglin impairs binding of TGF-b1 to its receptors and downstream signaling, including effects on activation of eNOS and vasodilation, suggesting that endoglin leads to dysregulated TGFb signaling in the vasculature [251]. These molecules might also serve as diagnostic tools for preeclampsia. Salahuddin et al. demonstrated that sFlt-1 and endoglin are useful tools to differentiate preeclampsia from other types of hypertension in pregnancy [252]. These findings also hold the possibility of developing a new medical therapy for preeclampsia targeting angiogenic factors.

11. 12. 13.

14. 15. 16.

17. 18.

19. 20. 21. 22. 23.

REFERENCES

24.

1. Myers ER, McCrory DC, Nanda K, et al. Mathematical model for the natural history of human papillomavirus infection and cervical carcinogenesis. Am J Epidemiol. 2000;151:1158–1171. 2. Scheurer ME, Tortolero-Luna G, Adler-Storthz K. Human papillomavirus infection: biology, epidemiology, and prevention. Int J Gynecol Cancer. 2005;15:727–746. 3. Cates W, Jr. Estimates of the incidence and prevalence of sexually transmitted diseases in the United States. American Social Health Association Panel. Sex Transm Dis. 1999;26:S2–S7. 4. Koutsky L. Epidemiology of genital human papillomavirus infection. Am J Med. 1997;102:3–8. 5. Weinstock H, Berman S, Cates W, Jr. Sexually transmitted diseases among American youth: incidence and prevalence estimates, 2000. Perspect Sex Reprod Health. 2004;36:6–10. 6. Chesson HW, Blandford JM, Gift TL, et al. The estimated direct medical cost of sexually transmitted diseases among American youth, 2000. Perspect Sex Reprod Health. 2004;36:11–19. 7. Howley PM, Lowy DR. Papillomaviruses. In: Knipe DM, Howley PM, eds. Fields Virology, 5th ed., Vol. 2. Philadelphia: Lippincott Williams & Wilkins; 2007:2299–2354. 2 vols. 8. de Villiers EM, Fauquet C, Broker TR, et al. Classification of papillomaviruses. Virology. 2004;324:17–27. 9. de Villiers EM, Gissmann L, zur Hausen H. Molecular cloning of viral DNA from human genital warts. J Virol. 1981;40: 932–935. 10. Durst M, Gissmann L, Ikenberg H, et al. A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy

25. 26. 27.

28. 29. 30. 31. 32. 33. 34.


samples from different geographic regions. Proc Natl Acad Sci U S A. 1983;80:3812–3815. Schiffman M, Castle PE, Jeronimo J, et al. Human papillomavirus and cervical cancer. Lancet. 2007;370:890–907. Martens JE, Arends J, Van der Linden PJ, et al. Cytokeratin 17 and p63 are markers of the HPV target cell, the cervical stem cell. Anticancer Res. 2004;24:771–775. Smedts F, Ramaekers F, Troyanovsky S, et al. Basal-cell keratins in cervical reserve cells and a comparison to their expression in cervical intraepithelial neoplasia. Am J Pathol. 1992;140: 601–612. Tsutsumi K, Sun Q, Yasumoto S, et al. In vitro and in vivo analysis of cellular origin of cervical squamous metaplasia. Am J Pathol. 1993;143:1150–1158. Streeck RE, Selinka HC, Sapp M. Viral entry and receptors. In: Garcea RL, DiMaio D, eds. The Papillomaviruses. New York: Springer; 2007:89–108. Lee C, Laimins LA. The differentiation-dependent life cycle of human papillomaviruses in keratinocytes. In: Garcea RL, DiMaio D, eds. The Papillomaviruses. New York: Springer; 2007:45–68. Hughes FJ, Romanos MA. E1 protein of human papillomavirus is a DNA Helicase/ATPase. Nucleic Acids Res. 1993;21:5817–5823. Mohr IJ, Clark R, Sun S, et al. Targeting the E1 replication protein to the papillomavirus origin of replication by complex formation with the E2 transactivator. Science. 1990;250: 1694–1699. Munger K, Baldwin A, Edwards KM, et al. Mechanisms of human papillomavirus-induced oncogenesis. J Virol. 2004;78: 11451–11460. Solomon D, Breen N, McNeel T. Cervical cancer screening rates in the United States and the potential impact of implementation of screening guidelines. CA Cancer J Clin. 2007;57:105–111. Selvaggi SM. Implications of low diagnostic reproducibility of cervical cytologic and histologic diagnoses. Jama. 2001;285: 1506–1508. Uyar DS, Eltabbakh GH, Mount SL. Positive predictive value of liquid-based and conventional cervical Papanicolaou smears reported as malignant. Gynecol Oncol. 2003;89:227–232. Klaes R, Friedrich T, Spitkovsky D, et al. Overexpression of p16(INK4A) as a specific marker for dysplastic and neoplastic epithelial cells of the cervix uteri. Int J Cancer. 2001;92:276–284. Mayrand MH, Duarte-Franco E, Rodrigues I, et al. Human papillomavirus DNA versus Papanicolaou screening tests for cervical cancer. N Engl J Med. 2007;357:1579–1588. Phelps WC, Barnes JA, Lobe DC. Molecular targets for human papillomaviruses: prospects for antiviral therapy. Antivir Chem Chemother. 1998;9:359–377. Rhea WG, Jr., Bourgeois BM, Sewell DR. Condyloma acuminata: a fatal disease? Am Surg. 1998;64:1082–1087. Frega A, Stentella P, Tinari A, et al. Giant condyloma acuminatum or buschke-Lowenstein tumor: review of the literature and report of three cases treated by CO2 laser surgery. A long-term follow-up. Anticancer Res. 2002;22:1201–1204. Solomon D, Davey D, Kurman R, et al. The 2001 Bethesda System: terminology for reporting results of cervical cytology. Jama. 2002;287:2114–2119. Hippelainen MI, Hippelainen M, Saarikoski S, et al. Clinical course and prognostic factors of human papillomavirus infections in men. Sex Transm Dis. 1994;21:272–279. Winer RL, Hughes JP, Feng Q, et al. Condom use and the risk of genital human papillomavirus infection in young women. N Engl J Med. 2006;354:2645–2654. Roberts JN, Buck CB, Thompson CD, et al. Genital transmission of HPV in a mouse model is potentiated by nonoxynol-9 and inhibited by carrageenan. Nat Med. 2007;13:857–861. Barr E, Tamms G. Quadrivalent human papillomavirus vaccine. Clin Infect Dis. 2007;45:609–7. Frazer IH. Prevention of cervical cancer through papillomavirus vaccination. Nat Rev Immunol. 2004;4:46–54. Lin YY, Alphs H, Hung CF, et al. Vaccines against human papillomavirus. Front Biosci. 2007;12:246–264.

481

Part IV


35. Ziegert C, Wentzensen N, Vinokurova S, et al. A comprehensive analysis of HPV integration loci in anogenital lesions combining transcript and genome-based amplification techniques. Oncogene. 2003;22:3977–3984. 36. Thorland EC, Myers SL, Persing DH, et al. Human papillomavirus type 16 integrations in cervical tumors frequently occur in common fragile sites. Cancer Res. 2000;60:5916–5921. 37. Durst M, Croce CM, Gissmann L, et al. Papillomavirus sequences integrate near cellular oncogenes in some cervical carcinomas. Proc Natl Acad Sci U S A. 1987;84:1070–1074. 38. Bernard BA, Bailly C, Lenoir M-C, et al. The HPV18 E2 gene product is a repressor of the HPV18 regulatory region in human keratinocytes. J Virol. 1989;63:4317–4324. 39. Thierry F, Yaniv M. The BPV-1 E2 trans-acting protein can be either an activator or repressor of the HPV-18 regulatory region. EMBO J. 1987;6:3391–3397. 40. Jeon S, Lambert PF. Integration of human papillomavirus type 16 DNA into the human genome leads to increased stability of E6 and E7 mRNAs: Implications for cervical carcinogenesis. Proc Natl Acad Sci U S A. 1995;92:1654–1658. 41. McCance DJ, Kopan R, Fuchs E, et al. Human papillomavirus type 16 alters human epithelial cell differentiation in vitro. Proceedings of the National Academy of Sciences USA. 1988;85: 7169–7173. 42. Hurlin PJ, Kaur P, Smith PP, et al. Progression of human papillomavirus type 18-immortalized human keratinocytes to a malignant phenotype. Proceedings of the National Academy of Sciences USA. 1991;88:571–574. 43. Pei XF, Meck JM, Greenhalgh D, et al. Cotransfection of HPV-18 and v-fos DNA induces tumorigenicity of primary human keratinocytes. Virology. 1993;196:855–860. 44. Durst M, Gallahan D, Jay G, et al. Glucocorticoid-enhanced neoplastic transformation of human keratinocytes by human papillomavirus type 16 and an activated ras oncogene. Virology. 1989;173:767–771. 45. Mitelman F, Johansson B, Mertens F. Mitelman Database of Chromosome Aberrations in Cancer. http://cgap.nci.nih.gov/Chromosomes/Mitelman; 2007. 46. Arbeit JM, Mu¨nger K, Howley PM, et al. Progressive squamous epithelial neoplasia in k14-human papillomavirus type 16 transgenic mice. J Virol. 1994;68:4358–4368. 47. Duensing S, Munger K. Mechanisms of genomic instability in human cancer: insights from studies with human papillomavirus oncoproteins. Int J Cancer. 2004;109:157–162. 48. Munger K, Howley PM, DiMaio D. Human Papillomavirus E6 and E7 Oncogenes. In: Garcea R, DiMaio D, eds. The Papillomaviruses. New York: Springer Verlag; 2007:195–251. 49. Angeline M, Merle E, Moroianu J. The E7 oncoprotein of highrisk human papillomavirus type 16 enters the nucleus via a nonclassical Ran-dependent pathway. Virology. 2003;317:13–23. 50. Liu X, Clements A, Zhao K, et al. Structure of the human Papillomavirus E7 oncoprotein and its mechanism for inactivation of the retinoblastoma tumor suppressor. J Biol Chem. 2006; 281:578–586. 51. Ohlenschlager O, Seiboth T, Zengerling H, et al. 2006;Solution structure of the partially folded high-risk human papilloma virus 45 oncoprotein E7. Oncogene. 52. Huh K, Zhou X, Hayakawa H, et al. Human papillomavirus type 16 E7 oncoprotein associates with the cullin 2 ubiquitin ligase complex, which contributes to degradation of the retinoblastoma tumor suppressor. J Virol. 2007;81:9737–9747. 53. Nakatani Y, Konishi H, Vassilev A, et al. p600, a unique protein required for membrane morphogenesis and cell survival. Proc Natl Acad Sci U S A. 2005;102:15093–15098. 54. Tasaki T, Mulder LC, Iwamatsu A, et al. A family of mammalian E3 ubiquitin ligases that contain the UBR box motif and recognize N-degrons. Mol Cell Biol. 2005;25:7120–7136. 55. Huh KW, DeMasi J, Ogawa H, et al. Association of the human papillomavirus type 16 E7 oncoprotein with the 600-kDa retinoblastoma protein-associated factor, p600. Proc Natl Acad Sci U S A. 2005;102:11492–11497. 56. DeMasi J, Chao MC, Kumar AS, et al. Bovine papillomavirus E7 oncoprotein inhibits anoikis. J Virol. 2007;81:9419–9425.

482

57. DeMasi J, Huh KW, Nakatani Y, et al. Bovine papillomavirus E7 transformation function correlates with cellular p600 protein binding. Proc Natl Acad Sci U S A. 2005;102: 11486–11491. 58. Helt AM, Funk JO, Galloway DA. Inactivation of both the retinoblastoma tumor suppressor and p21 by the human papillomavirus type 16 E7 oncoprotein is necessary to inhibit cell cycle arrest in human epithelial cells. J Virol. 2002;76: 10559–10568. 59. Zwerschke W, Mannhardt B, Massimi P, et al. Allosteric activation of acid alpha-glucosidase by the human papillomavirus E7 protein. J Biol Chem. 2000;275:9534–9541. 60. Zwerschke W, Mazurek S, Massimi P, et al. Modulation of type M2 pyruvate kinase activity by the human papillomavirus type 16 E7 oncoprotein. Proc Natl Acad Sci U S A. 1999;96: 1291–1296. 61. Charette ST, McCance DJ. The E7 protein from human papillomavirus type 16 enhances keratinocyte migration in an Aktdependent manner. Oncogene. 2007;26:7386–7390. 62. Menges CW, Baglia LA, Lapoint R, et al. Human papillomavirus type 16 E7 up-regulates AKT activity through the retinoblastoma protein. Cancer Res. 2006;66:5555–5559. 63. Toussaint-Smith E, Donner DB, Roman A. Expression of human papillomavirus type 16 E6 and E7 oncoproteins in primary foreskin keratinocytes is sufficient to alter the expression of angiogenic factors. Oncogene. 2004;23:2988–2995. 64. Chen W, Li F, Mead L, et al. Human papillomavirus causes an angiogenic switch in keratinocytes which is sufficient to alter endothelial cell behavior. Virology. 2007;367:168–174. 65. Kiyono T, Hiraiwa A, Fujita M, et al. Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumor suppressor protein. Proc Natl Acad Sci U S A. 1997;94:11612–11616. 66. Lee SS, Weiss RS, Javier RT. Binding of human virus oncoproteins to hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumor suppressor protein. Proc Natl Acad Sci U S A. 1997;94:6670–6675. 67. Lee C, Laimins LA. Role of the PDZ domain-binding motif of the oncoprotein E6 in the pathogenesis of human papillomavirus type 31. J Virol. 2004;78:12366–12377. 68. Nguyen ML, Nguyen MM, Lee D, et al. The PDZ ligand domain of the human papillomavirus type 16 E6 protein is required for E6prime;s induction of epithelial hyperplasia in vivo. J Virol. 2003;77:6957–6964. 69. Thomas M, Glaunsinger B, Pim D, et al. HPV E6 and MAGUK protein interactions: determination of the molecular basis for specific protein recognition and degradation. Oncogene. 2001;20:5431–5439. 70. Chen JJ, Hong Y, Rustamzadeh E, et al. Identification of an alpha helical motif sufficient for association with papillomavirus E6. J Biol Chem. 1998;273:13537–13544. 71. Tong X, Howley PM. The bovine papillomavirus E6 oncoprotein interacts with paxillin and disrupts the actin cytoskeleton. Proc Nat Acad Sci USA. 1997;94:4412–4417. 72. Tong X, Salgia R, Li JL, et al. The bovine papillomavirus E6 protein binds to the LD motif repeats of paxillin and blocks its interaction with vinculin and the focal adhesion kinase. J Biol Chem. 1997;272:33373–33376. 73. Vande Pol SB, Brown MC, Turner CE. Association of Bovine Papillomavirus Type 1 E6 oncoprotein with the focal adhesion protein paxillin through a conserved protein interaction motif. Oncogene. 1998;16:43–52. 74. Heselmeyer K, Macville M, Schrock E, et al. Advanced-stage cervical carcinomas are defined by a recurrent pattern of chromosomal aberrations revealing high genetic instability and a consistent gain of chromosome arm 3q. Genes Chromosomes Cancer. 1997;19:233–240. 75. Heselmeyer K, Schrock E, du Manoir S, et al. Gain of chromosome 3q defines the transition from severe dysplasia to invasive carcinoma of the uterine cervix. Proc Natl Acad Sci U S A. 1996;93:479–484. 76. Hashida T, Yasumoto S. Induction of chromosomal abnormalities in mouse and human epidermal keratinocytes by the

Chapter 23

77.

78.

79.

80. 81.

82.

83.

84. 85. 86.

87. 88.

89.

90. 91. 92.

93. 94. 95.

96.

human papillomavirus type 16 E7 oncogene. Journal of General Virology. 1991;72:1569–1577. White AE, Livanos EM, Tlsty TD. Differential Disruption of Genomic Integrity and Cell Cycle Regulation in Normal Human Fibroblasts by the HPV Oncoproteins. Genes Dev. 1994;8:666–677. Duensing A, Liu Y, Tseng M, et al. Cyclin-dependent kinase 2 is dispensable for normal centrosome duplication but required for oncogene-induced centrosome overduplication. Oncogene. 2006;25:2943–2949. Duensing S, Duensing A, Lee DC, et al. Cyclin-dependent kinase inhibitor indirubin-30 -oxime selectively inhibits human papillomavirus type 16 E7-induced numerical centrosome anomalies. Oncogene. 2004;23:8206–8215. Nguyen CL, Eichwald C, Nibert ML, et al. Human papillomavirus type 16 E7 oncoprotein associates with the centrosomal component gamma-tubulin. J Virol. 2007;81:13533–13543. Duensing S, Duensing A, Crum CP, et al. Human papillomavirus type 16 E7 oncoprotein-induced abnormal centrosome synthesis is an early event in the evolving malignant phenotype. Cancer Res. 2001;61:2356–2360. Duensing A, Liu Y, Perdreau SA, et al. Centriole overduplication through the concurrent formation of multiple daughter centrioles at single maternal templates. Oncogene. 2007;26:6280– 6288. Duensing S, Lee LY, Duensing A, et al. The human papillomavirus type 16 E6 and E7 oncoproteins cooperate to induce mitotic defects and genomic instability by uncoupling centrosome duplication from the cell division cycle. Proc Natl Acad Sci U S A. 2000;97:10002–10007. Kim JH, Dhanasekaran SM, Mehra R, et al. Integrative analysis of genomic aberrations associated with prostate cancer progression. Cancer Res. 2007;67:8229–8239. Tomlins SA, Laxman B, Dhanasekaran SM, et al. Distinct classes of chromosomal rearrangements create oncogenic ETS gene fusions in prostate cancer. Nature. 2007;448:595–599. Kutler DI, Wreesmann VB, Goberdhan A, et al. Human papillomavirus DNA and p53 polymorphisms in squamous cell carcinomas from Fanconi anemia patients. J Natl Cancer Inst. 2003;95:1718–1721. Kennedy RD, D’Andrea AD. The Fanconi Anemia/BRCA pathway: new faces in the crowd. Genes Dev. 2005;19:2925–2940. Spardy N, Duensing A, Charles D, et al. The human papillomavirus type 16 E7 oncoprotein activates the Fanconi Anemia (FA) pathway and causes accelerated chromosomal instability in FA cells. J Virol. 2007;81:in press. Kessis TD, Slebos RJ, Nelson WG, et al. Human papillomavirus 16 E6 expression disrupts the p53-mediated cellular response to DNA damage. Proceedings of the National Academy of Sciences USA. 1993;90:3988–3992. Thompson DA, Belinsky G, Chang TH, et al. The human papillomavirus-16 E6 oncoprotein decreases the vigilance of mitotic checkpoints. Oncogene. 1997;15:3025–3035. Thomas JT, Laimins LA. Human papillomavirus oncoproteins E6 and E7 independently abrogate the mitotic spindle checkpoint. J Virol. 1998;72:1131–1137. Duensing S, Munger K. The human papillomavirus type 16 E6 and E7 oncoproteins independently induce numerical and structural chromosome instability. Cancer Res. 2002;62: 7075–7082. Havre PA, Yuan J, Hedrick L, et al. p53 inactivation by HPV16 E6 results in increased mutagenesis in human cells. Cancer Res. 1995;55:4420–4424. Iftner T, Elbel M, Schopp B, et al. Interference of papillomavirus E6 protein with single-strand break repair by interaction with XRCC1. EMBO J. 2002;21:4741–4748. Srivenugopal KS, Ali-Osman F. The DNA repair protein, O(6)methylguanine-DNA methyltransferase is a proteolytic target for the E6 human papillomavirus oncoprotein. Oncogene. 2002;21:5940–5945. Shin KH, Ahn JH, Kang MK, et al. HPV-16 E6 oncoprotein impairs the fidelity of DNA end-joining via p53-dependent and -independent pathways. Int J Oncol. 2006;28:209–215.


97. Gillison ML, D’Souza G, Westra W, et al. Distinct risk factor profiles for human papillomavirus type 16-positive and human papillomavirus type 16-negative head and neck cancers. J Natl Cancer Inst. 2008;100:407–420. 98. Gillison ML, Koch WM, Capone RB, et al. Evidence for a causal association between human papillomavirus and a subset of head and neck cancers. J Natl Cancer Inst. 2000;92: 709–720. 99. (2008). Cancer Facts and Figures 2008 (Society AC, ed.). 100. Brinton LA, Berman ML, Mortel R, et al. Reproductive, menstrual, and medical risk factors for endometrial cancer: results from a case-control study. Am J Obstet Gynecol. 1992;167: 1317–1325. 101. Kurman RJ, Malkasian GD, Jr., Sedlis A, et al. From Papanicolaou to Bethesda: the rationale for a new cervical cytologic classification. Obstet Gynecol. 1991;77:779–782. 102. Horn LC, Schnurrbusch U, Bilek K, et al. Risk of progression in complex and atypical endometrial hyperplasia: clinicopathologic analysis in cases with and without progestogen treatment. Int J Gynecol Cancer. 2004;14:348–353. 103. Lacey JV, Jr., Ioffe OB, Ronnett BM, et al. Endometrial carcinoma risk among women diagnosed with endometrial hyperplasia: the 34-year experience in a large health plan. Br J Cancer. 2008;98:45–53. 104. Trimble CL, Kauderer J, Zaino R, et al. Concurrent endometrial carcinoma in women with a biopsy diagnosis of atypical endometrial hyperplasia: a Gynecologic Oncology Group study. Cancer. 2006;106:812–819. 105. Zaino RJ, Kauderer J, Trimble CL, et al. Reproducibility of the diagnosis of atypical endometrial hyperplasia: a Gynecologic Oncology Group study. Cancer. 2006;106:804–811. 106. Levine RL, Cargile CB, Blazes MS, et al. PTEN mutations and microsatellite instability in complex atypical hyperplasia, a precursor lesion to uterine endometrioid carcinoma. Cancer Res. 1998;58:3254–3258. 107. Mutter GL, Lin MC, Fitzgerald JT, et al. Altered PTEN expression as a diagnostic marker for the earliest endometrial precancers. J Natl Cancer Inst. 2000;92:924–930. 108. Deng L, Broaddus RR, McCampbell A, et al. Identification of a novel estrogen-regulated gene, EIG121, induced by hormone replacement therapy and differentially expressed in type I and type II endometrial cancer. Clin Cancer Res. 2005;11:8258–8264. 109. McCampbell AS, Broaddus RR, Loose DS, et al. Overexpression of the insulin-like growth factor I receptor and activation of the AKT pathway in hyperplastic endometrium. Clin Cancer Res. 2006;12:6373–6378. 110. Kosary CL. Chapter 15: Cancer of the Corpus Uteri. In: Ries LAB YJ, Keel GE, Eisner MP, Lin YD, Horner MJ, ed., SEER Survival Monograph: Cancer Survival Among Adults:U.S. SEER Program, 1988–2001, Patient and Tumor Characteristics. Vol. NIH Pub. No. 07-6215. Bethesda, MD: National Cancer Institute, SEER Program; 2007. 111. Risinger JI, Hayes K, Maxwell GL, et al. PTEN mutation in endometrial cancers is associated with favorable clinical and pathologic characteristics. Clin Cancer Res. 1998;4: 3005–3010. 112. Risinger JI, Maxwell GL, Chandramouli GV, et al. Microarray analysis reveals distinct gene expression profiles among different histologic types of endometrial cancer. Cancer Res. 2003;63:6–11. 113. Stambolic V, Tsao MS, Macpherson D, et al. High incidence of breast and endometrial neoplasia resembling human Cowden syndrome in ptenþ/- mice. Cancer Res. 2000;60:3605–3611. 114. Vilgelm A, Lian Z, Wang H, et al. Akt-mediated phosphorylation and activation of estrogen receptor alpha is required for endometrial neoplastic transformation in Ptenþ/- mice. Cancer Res. 2006;66:3375–3380. 115. Hayes MP, Wang H, Espinal-Witter R, et al. PIK3CA and PTEN mutations in uterine endometrioid carcinoma and complex atypical hyperplasia. Clin Cancer Res. 2006;12:5932–5935. 116. Oda K, Stokoe D, Taketani Y, et al. High frequency of coexistent mutations of PIK3CA and PTEN genes in endometrial carcinoma. Cancer Res. 2005;65:10669–10673.

483

Part IV


117. Lu KH, Wu W, Dave B, et al. Loss of tuberous sclerosis complex-2 function and activation of Mammalian target of rapamycin signaling in endometrial carcinoma. Clin Cancer Res. 2008;14:2543–2550. 118. Contreras CM, Gurumurthy S, Haynie JM, et al. Loss of Lkb1 provokes highly invasive endometrial adenocarcinomas. Cancer Res. 2008;68:759–766. 119. MacDonald ND, Salvesen HB, Ryan A, et al. Frequency and prognostic impact of microsatellite instability in a large population-based study of endometrial carcinomas. Cancer Res. 2000;60:1750–1752. 120. Dunlop MG, Farrington SM, Carothers AD, et al. Cancer risk associated with germline DNA mismatch repair gene mutations. Hum Mol Genet. 1997;6:105–110. 121. Aarnio M, Sankila R, Pukkala E, et al. Cancer risk in mutation carriers of DNA-mismatch-repair genes. Int J Cancer. 1999;81:214–218. 122. Hampel H, Frankel W, Panescu J, et al. Screening for Lynch syndrome (hereditary nonpolyposis colorectal cancer) among endometrial cancer patients. Cancer Res. 2006;66: 7810–7817. 123. Duval A, Reperant M, Compoint A, et al. Target gene mutation profile differs between gastrointestinal and endometrial tumors with mismatch repair deficiency. Cancer Res. 2002;62: 1609–1612. 124. Boyd J. Genetic basis of familial endometrial cancer: is there more to learn? J Clin Oncol. 2005;23:4570–4573. 125. Zighelboim I, Goodfellow PJ, Gao F, et al. Microsatellite instability and epigenetic inactivation of MLH1 and outcome of patients with endometrial carcinomas of the endometrioid type. J Clin Oncol. 2007;25:2042–2048. 126. Lu KH, Schorge JO, Rodabaugh KJ, et al. Prospective determination of prevalence of lynch syndrome in young women with endometrial cancer. J Clin Oncol. 2007;25:5158–5164. 127. Berends MJ, Wu Y, Sijmons RH, et al. Toward new strategies to select young endometrial cancer patients for mismatch repair gene mutation analysis. J Clin Oncol. 2003;21:4364–4370. 128. Fukuchi T, Sakamoto M, Tsuda H, et al. Beta-catenin mutation in carcinoma of the uterine endometrium. Cancer Res. 1998;58:3526–3528. 129. Mirabelli-Primdahl L, Gryfe R, Kim H, et al. Beta-catenin mutations are specific for colorectal carcinomas with microsatellite instability but occur in endometrial carcinomas irrespective of mutator pathway. Cancer Res. 1999;59:3346–3351. 130. Slomovitz BM, Burke TW, Eifel PJ, et al. Uterine papillary serous carcinoma (UPSC): a single institution review of 129 cases. Gynecol Oncol. 2003;91:463–469. 131. Koul A, Willen R, Bendahl PO, et al. Distinct sets of gene alterations in endometrial carcinoma implicate alternate modes of tumorigenesis. Cancer. 2002;94:2369–2379. 132. Sherman ME, Bur ME, Kurman RJ. p53 in endometrial cancer and its putative precursors: evidence for diverse pathways of tumorigenesis. Hum Pathol. 1995;26:1268–1274. 133. Slomovitz BM, Broaddus RR, Burke TW, et al. Her-2/neu overexpression and amplification in uterine papillary serous carcinoma. J Clin Oncol. 2004;22:3126–3132. 134. Diaz-Montes TP, Ji H, Smith Sehdev AE, et al. Clinical significance of Her-2/neu overexpression in uterine serous carcinoma. Gynecol Oncol. 2006;100:139–144. 135. Santin AD, Bellone S, Van Stedum S, et al. Amplification of c-erbB2 oncogene: a major prognostic indicator in uterine serous papillary carcinoma. Cancer. 2005;104:1391–1397. 136. Okolo S. Incidence, aetiology and epidemiology of uterine fibroids. Best Pract Res Clin Obstet Gynaecol. 2008;22:571–588. 137. Hodge JC, Quade BJ, Rubin MA, et al. Molecular and cytogenetic characterization of plexiform leiomyomata provide further evidence for genetic heterogeneity underlying uterine fibroids. Am J Pathol. 2008;172:1403–1410. 138. Ptacek T, Song C, Walker CL, et al. Physical mapping of distinct 7q22 deletions in uterine leiomyoma and analysis of a recently annotated 7q22 candidate gene. Cancer Genet Cytogenet. 2007;174:116–120. 139. Bishara M, Scapa E. [Stromal uterine sarcoma arising from intestinal endometriosis after abdominal hysterectomy and salpingo-oophorectomy]. Harefuah. 1997;133:353–355, 415.

484

140. Laxman R, Currie JL, Kurman RJ, et al. Cytogenetic profile of uterine sarcomas. Cancer. 1993;71:1283–1288. 141. Hennig Y, Caselitz J, Bartnitzke S, et al. A third case of a lowgrade endometrial stromal sarcoma with a t(7;17)(p14 approximately 21;q11.2 approximately 21). Cancer Genet Cytogenet. 1997;98:84–86. 142. Pelusi B, Gambineri A, Pasquali R. Type 2 diabetes and the polycystic ovary syndrome. Minerva Ginecol. 2004;56:41–51. 143. Givens JR. Familial polycystic ovarian disease. Endocrinol Metab Clin North Am. 1988;17:771–783. 144. Fowler DJ, Nicolaides KH, Miell JP. Insulin-like growth factor binding protein-1 (IGFBP-1): a multifunctional role in the human female reproductive tract. Hum Reprod Update. 2000;6:495–504. 145. Ibanez L, Ong KK, Mongan N, et al. Androgen receptor gene CAG repeat polymorphism in the development of ovarian hyperandrogenism. J Clin Endocrinol Metab. 2003;88: 3333–3338. 146. Nelson-Degrave VL, Wickenheisser JK, Hendricks KL, et al. Alterations in mitogen-activated protein kinase kinase and extracellular regulated kinase signaling in theca cells contribute to excessive androgen production in polycystic ovary syndrome. Mol Endocrinol. 2005;19:379–390. 147. Roberts VJ, Barth S, el-Roeiy A, et al. Expression of inhibin/ activin system messenger ribonucleic acids and proteins in ovarian follicles from women with polycystic ovarian syndrome. J Clin Endocrinol Metab. 1994;79:1434–1439. 148. Sorbara LR, Tang Z, Cama A, et al. Absence of insulin receptor gene mutations in three insulin-resistant women with the polycystic ovary syndrome. Metabolism. 1994;43:1568–1574. 149. Villuendas G, Botella-Carretero JI, Roldan B, et al. Polymorphisms in the insulin receptor substrate-1 (IRS-1) gene and the insulin receptor substrate-2 (IRS-2) gene influence glucose homeostasis and body mass index in women with polycystic ovary syndrome and non-hyperandrogenic controls. Hum Reprod. 2005;20:3184–3191. 150. Witchel SF, Kahsar-Miller M, Aston CE, et al. Prevalence of CYP21 mutations and IRS1 variant among women with polycystic ovary syndrome and adrenal androgen excess. Fertil Steril. 2005;83:371–375. 151. El Mkadem SA, Lautier C, Macari F, et al. Role of allelic variants Gly972Arg of IRS-1 and Gly1057Asp of IRS-2 in moderate-tosevere insulin resistance of women with polycystic ovary syndrome. Diabetes. 2001;50:2164–2168. 152. Cisternino M, Dondi E, Martinetti M, et al. Exaggerated 17hydroxyprogesterone response to short-term adrenal stimulation and evidence for CYP21B gene point mutations in true precocious puberty. Clin Endocrinol (Oxf). 1998;48: 555–560. 153. Gaasenbeek M, Powell BL, Sovio U, et al. Large-scale analysis of the relationship between CYP11A promoter variation, polycystic ovarian syndrome, and serum testosterone. J Clin Endocrinol Metab. 2004;89:2408–2413. 154. Goodarzi MO. Looking for polycystic ovary syndrome genes: rational and best strategy. Semin Reprod Med. 2008;26:5–13. 155. Urbanek M, Woodroffe A, Ewens KG, et al. Candidate gene region for polycystic ovary syndrome on chromosome 19p13.2. J Clin Endocrinol Metab. 2005;90:6623–6629. 156. Ovarian disorders. Benign cysts. Harv Womens Health Watch. 1999;6:4–5. 157. Raile K, Stobbe H, Trobs RB, et al. A new heterozygous mutation of the FOXL2 gene is associated with a large ovarian cyst and ovarian dysfunction in an adolescent girl with blepharophimosis/ptosis/epicanthus inversus syndrome. Eur J Endocrinol. 2005;153:353–358. 158. Yamada T, Okamoto Y, Kasamatsu H, et al. Laparoscopicassisted surgery for benign ovarian cyst in a young girl. J Am Assoc Gynecol Laparosc. 2001;8:295–298. 159. Taylor HC. Malignant and semimalignant tumors of the ovary. Surgery, Gynecology & Obstetrics. 1929;48:206–230. 160. FIGO. International Federation of Gynecology and Obstetrics. Classification and staging of malignant tumours in the female pelvis. Acta Obstet Gynecol Scand. 1971;50:1–7.

Chapter 23 161. Bell DA, Longacre TA, Prat J, et al. Serous borderline (low malignant potential, atypical proliferative) ovarian tumors: workshop perspectives. Hum Pathol. 2004;35:934–948. 162. Wong KK, Gershenson D. The continuum of serous tumors of low malignant potential and low-grade serous carcinomas of the ovary. Dis Markers. 2007;23:377–387. 163. Longacre TA, McKenney JK, Tazelaar HD, et al. Ovarian serous tumors of low malignant potential (borderline tumors): outcome-based study of 276 patients with long-term (> or =5-year) follow-up. Am J Surg Pathol. 2005;29:707–723. 164. Gershenson DM, Sun CC, Lu KH, et al. Clinical behavior of stage II-IV low-grade serous carcinoma of the ovary. Obstet Gynecol. 2006;108:361–368. 165. Mok SC, Kwong J, Welch WR, et al. Etiology and pathogenesis of epithelial ovarian cancer. Dis Markers. 2007;23:367–376. 166. Thompson ER, Herbert SC, Forrest SM, et al. Whole genome SNP arrays using DNA derived from formalin-fixed, paraffinembedded ovarian tumor tissue. Hum Mutat. 2005;26:384–389. 167. Bonome T, Lee JY, Park DC, et al. Expression profiling of serous low malignant potential, low-grade, and high-grade tumors of the ovary. Cancer Res. 2005;65:10602–10612. 168. Shih Ie M, Kurman RJ. Ovarian tumorigenesis: a proposed model based on morphological and molecular genetic analysis. Am J Pathol. 2004;164:1511–1518. 169. Malpica A, Deavers MT, Lu K, et al. Grading ovarian serous carcinoma using a two-tier system. Am J Surg Pathol. 2004;28:496–504. 170. Edelson MI, Lau CC, Colitti CV, et al. A one centimorgan deletion unit on chromosome Xq12 is commonly lost in borderline and invasive epithelial ovarian tumors. Oncogene. 1998;16: 197–202. 171. Edelson MI, Scherer SW, Tsui LC, et al. Identification of a 1300 kilobase deletion unit on chromosome 7q31.3 in invasive epithelial ovarian carcinomas. Oncogene. 1997;14:2979–2984. 172. Colitti CV, Rodabaugh KJ, Welch WR, et al. A novel 4 cM minimal deletion unit on chromosome 6q25.1-q25.2 associated with high grade invasive epithelial ovarian carcinomas. Oncogene. 1998;16:555–559. 173. Tangir J, Loughridge NS, Berkowitz RS, et al. Frequent microsatellite instability in epithelial borderline ovarian tumors. Cancer Res. 1996;56:2501–2505. 174. Huang LW, Garrett AP, Muto MG, et al. Identification of a novel 9 cM deletion unit on chromosome 6q23-24 in papillary serous carcinoma of the peritoneum. Hum Pathol. 2000;31:367–373. 175. Lu KH, Weitzel JN, Kodali S, et al. A novel 4-cM minimally deleted region on chromosome 11p15.1 associated with high grade nonmucinous epithelial ovarian carcinomas. Cancer Res. 1997;57:387–390. 176. Wertheim I, Tangir J, Muto MG, et al. Loss of heterozygosity of chromosome 17 in human borderline and invasive epithelial ovarian tumors. Oncogene. 1996;12:2147–2153. 177. Russell P. The pathological assessment of ovarian neoplasms. III: The malignant "epithelial" tumours. Pathology. 1979;11: 493–532. 178. Obata K, Morland SJ, Watson RH, et al. Frequent PTEN/ MMAC mutations in endometrioid but not serous or mucinous epithelial ovarian tumors. Cancer Res. 1998;58:2095–2097. 179. Hashiguchi Y, Tsuda H, Inoue T, et al. PTEN expression in clear cell adenocarcinoma of the ovary. Gynecol Oncol. 2006;101:71–75. 180. Dinulescu DM, Ince TA, Quade BJ, et al. Role of K-ras and Pten in the development of mouse models of endometriosis and endometrioid ovarian cancer. Nat Med. 2005;11:63–70. 181. Biermann K, Goke F, Nettersheim D, et al. c-KIT is frequently mutated in bilateral germ cell tumours and down-regulated during progression from intratubular germ cell neoplasia to seminoma. J Pathol. 2007;213:311–318. 182. Kraggerud SM, Szymanska J, Abeler VM, et al. DNA copy number changes in malignant ovarian germ cell tumors. Cancer Res. 2000;60:3025–3030. 183. Hutson R, Ramsdale J, Wells M. p53 protein expression in putative precursor lesions of epithelial ovarian cancer. Histopathology. 1995;27:367–371.


184. Colombo N, Parma G, Zanagnolo V, et al. Management of ovarian stromal cell tumors. J Clin Oncol. 2007;25:2944–2951. 185. Truss L, Dobin SM, Rao A, et al. Overexpression of the BCL2 gene in a Sertoli-Leydig cell tumor of the ovary: a pathologic and cytogenetic study. Cancer Genet Cytogenet. 2004; 148:118–122. 186. Callahan MJ, Crum CP, Medeiros F, et al. Primary fallopian tube malignancies in BRCA-positive women undergoing surgery for ovarian cancer risk reduction. J Clin Oncol. 2007;25: 3985–3990. 187. Jarboe E, Folkins A, Nucci MR, et al. Serous carcinogenesis in the fallopian tube: a descriptive classification. Int J Gynecol Pathol. 2008;27:1–9. 188. Bergeron C, Ferenczy A, Shah KV, et al. Multicentric human papillomavirus infections of the female genital tract: correlation of viral types with abnormal mitotic figures, colposcopic presentation, and location. Obstet Gynecol. 1987;69:736–742. 189. Frega A, French D, Piazze J, et al. Prediction of persistent vaginal intraepithelial neoplasia in previously hysterectomized women by high-risk HPV DNA detection. Cancer Lett. 2007;249:235–241. 190. Koyamatsu Y, Yokoyama M, Nakao Y, et al. A comparative analysis of human papillomavirus types 16 and 18 and expression of p53 gene and Ki-67 in cervical, vaginal, and vulvar carcinomas. Gynecol Oncol. 2003;90:547–551. 191. Yang B, Hart WR. Vulvar intraepithelial neoplasia of the simplex (differentiated) type: a clinicopathologic study including analysis of HPV and p53 expression. Am J Surg Pathol. 2000;24:429–441. 192. Milde-Langosch K, Albrecht K, Joram S, et al. Presence and persistence of HPV infection and p53 mutation in cancer of the cervix uteri and the vulva. Int J Cancer. 1995;63:639–645. 193. Holway AH, Rieger-Christ KM, Miner WR, et al. Somatic mutation of PTEN in vulvar cancer. Clin Cancer Res. 2000;6: 3228–3235. 194. Jee KJ, Kim YT, Kim KR, et al. Loss in 3p and 4p and gain of 3q are concomitant aberrations in squamous cell carcinoma of the vulva. Mod Pathol. 2001;14:377–381. 195. Worsham MJ, Van Dyke DL, Grenman SE, et al. Consistent chromosome abnormalities in squamous cell carcinoma of the vulva. Genes Chromosomes Cancer. 1991;3:420–432. 196. Teixeira MR, Kristensen GB, Abeler VM, et al. Karyotypic findings in tumors of the vulva and vagina. Cancer Genet Cytogenet. 1999;111:87–91. 197. Pinto AP, Lin MC, Sheets EE, et al. Allelic imbalance in lichen sclerosus, hyperplasia, and intraepithelial neoplasia of the vulva. Gynecol Oncol. 2000;77:171–176. 198. Raber G, Mempel V, Jackisch C, et al. Malignant melanoma of the vulva. Report of 89 patients. Cancer. 1996;78:2353–2358. 199. Berkowitz RS, Goldstein DP. Chorionic tumors. N Engl J Med. 1996;335:1740–1748. 200. Paradinas F. In: Hancock BW, NE, Berkowitz RS, eds. Gestational Trophoblastic Disease. London: Chapman & Hall; 1997. 201. Fisher RA, Hodges MD, Newlands ES. Familial recurrent hydatidiform mole: a review. J Reprod Med. 2004;49:595–601. 202. El-Maarri O, Seoud M, Coullin P, et al. Maternal alleles acquiring paternal methylation patterns in biparental complete hydatidiform moles. Hum Mol Genet. 2003;12:1405–1413. 203. Genest DR, Dorfman DM, Castrillon DH. Ploidy and imprinting in hydatidiform moles. Complementary use of flow cytometry and immunohistochemistry of the imprinted gene product p57KIP2 to assist molar classification. J Reprod Med. 2002;47: 342–346. 204. Matsuoka S, Edwards MC, Bai C, et al. p57KIP2, a structurally distinct member of the p21CIP1 Cdk inhibitor family, is a candidate tumor suppressor gene. Genes Dev. 1995;9: 650–662. 205. Wake N, Arima T, Matsuda T. Involvement of IGF2 and H19 imprinting in choriocarcinoma development. Int J Gynaecol Obstet. 1998;60(Suppl 1):S1–S8. 206. Arima T, Wake N. Establishment of the primary imprint of the HYMAI/PLAGL1 imprint control region during oogenesis. Cytogenet Genome Res. 2006;113:247–252.

485

Part IV


207. Rachmilewitz J, Goshen R, Ariel I, et al. Parental imprinting of the human H19 gene. FEBS Lett. 1992;309:25–28. 208. Niemitz EL, DeBaun MR, Fallon J, et al. Microdeletion of LIT1 in familial Beckwith-Wiedemann syndrome. Am J Hum Genet. 2004;75:844–849. 209. Nagymanyoki Z, Callahan MJ, Parast MM, et al. Immune cell profiling in normal pregnancy, partial and complete molar pregnancy. Gynecol Oncol. 2007;107:292–297. 210. King A, Allan DS, Bowen M, et al. HLA-E is expressed on trophoblast and interacts with CD94/NKG2 receptors on decidual NK cells. Eur J Immunol. 2000;30:1623–1631. 211. Morales PJ, Pace JL, Platt JS, et al. Placental cell expression of HLA-G2 isoforms is limited to the invasive trophoblast phenotype. J Immunol. 2003;171:6215–6224. 212. Ponte M, Cantoni C, Biassoni R, et al. Inhibitory receptors sensing HLA-G1 molecules in pregnancy: decidua-associated natural killer cells express LIR-1 and CD94/NKG2A and acquire p49, an HLA-G1-specific receptor. Proc Natl Acad Sci U S A. 1999;96:5674–5679. 213. Rebmann V, Busemann A, Lindemann M, et al. Detection of HLA-G5 secreting cells. Hum Immunol. 2003;64: 1017–1024. 214. Fulop V, Feinberg BB, Steller MA, et al. Molar villous fluid suppresses mononuclear cell cytotoxicity. Gynecol Oncol. 1992;47: 311–316. 215. Shaarawy M, Darwish NA, Abdel-Aziz O. Serum interleukin-2 and soluble interleukin-2 receptor in gestational trophoblastic diseases. J Soc Gynecol Investig. 1996;3:39–46. 216. Wang X, Fu S, Freedman RS, et al. Immunobiology of gestational trophoblastic diseases. Int J Gynecol Cancer. 2006;16:1500–1515. 217. Fulop V, Colitti CV, Genest D, et al. DOC-2/hDab2, a candidate tumor suppressor gene involved in the development of gestational trophoblastic diseases. Oncogene. 1998;17:419–424. 218. Fulop V, Mok SC, Berkowitz RS. Molecular biology of gestational trophoblastic neoplasia: a review. J Reprod Med. 2004;49:415–422. 219. Fulop V, Mok SC, Genest DR, et al. c-myc, c-erbB-2, c-fms and bcl-2 oncoproteins. Expression in normal placenta, partial and complete mole, and choriocarcinoma. J Reprod Med. 1998;43:101–110. 220. Kato HD, Terao Y, Ogawa M, et al. Growth-associated gene expression profiles by microarray analysis of trophoblast of molar pregnancies and normal villi. Int J Gynecol Pathol. 2002;21:255–260. 221. Vegh GL, Selcuk Tuncer Z, Fulop V, et al. Matrix metalloproteinases and their inhibitors in gestational trophoblastic diseases and normal placenta. Gynecol Oncol. 1999;75: 248–253. 222. Okamoto T, Niu R, Yamada S, et al. Reduced expression of tissue inhibitor of metalloproteinase (TIMP)-2 in gestational trophoblastic diseases. Mol Hum Reprod. 2002;8: 392–398. 223. Karmakar S, Das C. Regulation of trophoblast invasion by IL1beta and TGF-beta1. Am J Reprod Immunol. 2002;48:210–219. 224. Han VK, Bassett N, Walton J, et al. The expression of insulinlike growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 1996;81:2680–2693. 225. Hamilton GS, Lysiak JJ, Han VK, et al. Autocrine-paracrine regulation of human trophoblast invasiveness by insulin-like growth factor (IGF)-II and IGF-binding protein (IGFBP)-1. Exp Cell Res. 1998;244:147–156. 226. Cervar M, Huppertz B, Barth S, et al. Endothelin A and B receptors change their expression levels during development of human placental villi. Placenta. 2000;21:536–546. 227. Caniggia I, Mostachfi H, Winter J, et al. Hypoxia-inducible factor-1 mediates the biological effects of oxygen on human trophoblast differentiation through TGFbeta(3). J Clin Invest. 2000;105:577–587. 228. Mohan A, Asselin J, Sargent IL, et al. Effect of cytokines and growth factors on the secretion of inhibin A, activin A and

486

229.

230. 231.

232. 233. 234. 235.

236. 237.

238. 239. 240. 241. 242.

243. 244.

245. 246.

247.

248.

follistatin by term placental villous trophoblasts in culture. Eur J Endocrinol. 2001;145:505–511. Leach RE, Kilburn B, Wang J, et al. Heparin-binding EGF-like growth factor regulates human extravillous cytotrophoblast development during conversion to the invasive phenotype. Dev Biol. 2004;266:223–237. Isaka K, Usuda S, Ito H, et al. Expression and activity of matrix metalloproteinase 2 and 9 in human trophoblasts. Placenta. 2003;24:53–64. Floridon C, Nielsen O, Holund B, et al. Does plasminogen activator inhibitor-1 (PAI-1) control trophoblast invasion? A study of fetal and maternal tissue in intrauterine, tubal and molar pregnancies. Placenta. 2000;21:754–762. Batorfi J, Fulop V, Kim JH, et al. Osteopontin is down-regulated in hydatidiform mole. Gynecol Oncol. 2003;89:134–139. Nagymanyoki Z, Callahan MJ, Parast MM, et al. Overexpression of laminin receptor 1 on decidual cells in partial and complete mole. Gynecol Oncol. 2008;108:121–125. Simpson H, Robson SC, Bulmer JN, et al. Transforming growth factor beta expression in human placenta and placental bed during early pregnancy. Placenta. 2002;23:44–58. Xu G, Guimond MJ, Chakraborty C, et al. Control of proliferation, migration, and invasiveness of human extravillous trophoblast by decorin, a decidual product. Biol Reprod. 2002;67: 681–689. Shih IM, Kurman RJ. Expression of melanoma cell adhesion molecule in intermediate trophoblast. Lab Invest. 1996;75: 377–388. Bauer S, Pollheimer J, Hartmann J, et al. Tumor necrosis factoralpha inhibits trophoblast migration through elevation of plasminogen activator inhibitor-1 in first-trimester villous explant cultures. J Clin Endocrinol Metab. 2004;89:812–822. Yui J, Garcia-Lloret M, Wegmann TG, et al. Cytotoxicity of tumour necrosis factor-alpha and gamma-interferon against primary human placental trophoblasts. Placenta. 1994;15:819–835. Liu Z, Chen Y, Yang Y, et al. The effect on MHC class II expression and apoptosis in placenta by IFNgamma administration. Contraception. 2002;65:177–184. Feltmate CM, Batorfi J, Fulop V, et al. Human chorionic gonadotropin follow-up in patients with molar pregnancy: a time for reevaluation. Obstet Gynecol. 2003;101:732–736. Cole LA, Butler SA, Khanlian SA, et al. Gestational trophoblastic diseases: 2. Hyperglycosylated hCG as a reliable marker of active neoplasia. Gynecol Oncol. 2006;102:151–159. Prabha B, Molykutty J, Swapna A, et al. Increased expression of interleukin-1 beta is associated with persistence of the disease and invasion in complete hydatidiform moles (CHM). Eur J Gynaecol Oncol. 2001;22:50–56. Fong PY, Xue WC, Ngan HY, et al. Mcl-1 expression in gestational trophoblastic disease correlates with clinical outcome: a differential expression study. Cancer. 2005;103:268–276. Tuncer ZS, Vegh GL, Fulop V, et al. Expression of epidermal growth factor receptor-related family products in gestational trophoblastic diseases and normal placenta and its relationship with development of postmolar tumor. Gynecol Oncol. 2000;77: 389–393. Davison JM, Homuth V, Jeyabalan A, et al. New aspects in the pathophysiology of preeclampsia. J Am Soc Nephrol. 2004;15: 2440–2448. Brockelsby J, Hayman R, Ahmed A, et al. VEGF via VEGF receptor-1 (Flt-1) mimics preeclamptic plasma in inhibiting uterine blood vessel relaxation in pregnancy: implications in the pathogenesis of preeclampsia. Lab Invest. 1999;79:1101–1111. Smith GC, Crossley JA, Aitken DA, et al. Circulating angiogenic factors in early pregnancy and the risk of preeclampsia, intrauterine growth restriction, spontaneous preterm birth, and stillbirth. Obstet Gynecol. 2007;109:1316–1324. Levine RJ, Maynard SE, Qian C, et al. Circulating angiogenic factors and the risk of preeclampsia. N Engl J Med. 2004;350: 672–683.

Chapter 23 249. Sane DC, Anton L, Brosnihan KB. Angiogenic growth factors and hypertension. Angiogenesis. 2004;7:193–201. 250. Tjoa ML, Levine RJ, Karumanchi SA. Angiogenic factors and preeclampsia. Front Biosci. 2007;12:2395–2402. 251. Venkatesha S, Toporsian M, Lam C, et al. Soluble endoglin contributes to the pathogenesis of preeclampsia. Nat Med. 2006;12:642–649.


252. Salahuddin S, Lee Y, Vadnais M, et al. Diagnostic utility of soluble fms-like tyrosine kinase 1 and soluble endoglin in hypertensive diseases of pregnancy. Am J Obstet Gynecol. 2007;197:28 e1–e6.

487


C h a p t e r

24 Molecular Pathogenesis of Prostate Cancer: Somatic, Epigenetic, and Genetic Alterations Carlise R. Bethel Angelo M. De Marzo William G. Nelson n

n

INTRODUCTION Prostate cancer is one of the most common malignancies in Western men, and risk factors include age, race, inherited genes, and environmental factors such as diet [1–4]. Although the precise molecular mechanisms underlying carcinogenesis and progression are currently unknown, histological studies indicate a multistage developmental progression. The existence of premalignant lesions has been demonstrated in the prostate based on shared histological and molecular features with adenocarcinoma, as well as prevalence and severity [5,6]. Ample evidence supports the hypothesis that prostate cancer can progress from intraepithelial neoplasia to invasive carcinoma [7], and ultimately metastasis and androgen-independent lethal disease. Prostatic intraepithelial neoplasia (PIN) is a term currently used to describe the closest precursor lesion to carcinoma [7,8]. Histologically, the transition from normal epithelium to PIN involves nuclear atypia, epithelial cell crowding, and some component of basal cell loss [9,10]. Autopsy studies suggest that PIN lesions precede the appearance of carcinoma [11]. High-grade PIN lesions are often spatially associated with carcinoma and may exhibit molecular alterations similar to those found in prostate tumor cells [8,10] . Glandular atrophy is frequently observed in aging male prostates [12]. Histologically, luminal spaces appear dilated with flattened epithelial linings. Atrophic lesions in the prostate consist of a number of histological variants, and some of these have also been proposed to be potential precursors to prostate cancer Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

based in part on their frequent occurrence in proximity to carcinoma [5,13–15]. Proliferative inflammatory atrophy (PIA), a term used to describe a range of these morphologies, includes simple atrophy and postatrophic hyperplasia [5]. PIA lesions are highly proliferative and often associated with inflammation [5,16]. Epithelial cells within PIA foci express both luminal and basal markers [17]. The lesions likely result from cellular injury initiated by inflammation and/or carcinogen insult, and at times show evidence of transition to high-grade PIN and, rarely, to carcinoma [14]. Given the intermediate phenotype of these cells and the characteristic expression of stressassociated genes, PIA lesions are considered to be the morphological manifestation of prostate epithelial damage and regeneration [17]. Some of the genetic and epigenetic alterations observed in PIN and adenocarcinoma have also been found in PIA lesions, albeit to a lesser degree [15,18–21]. These findings suggest a potential link between a subset of atrophic lesions and adenocarcinoma. We have proposed a multistep progression model that leads from normal epithelium to focal prostatic atrophy to PIN and then to carcinoma [2,4,5]. In this model, ongoing injury to the prostate epithelium, as a result of inflammation and/or carcinogen exposures, results in cell damage and cell death. Cell regeneration ensues, and this is manifest morphologically as prostatic atrophy. These atrophic cells may then undergo somatic genome alterations during self-renewal, including methylation of the GSTP1 promoter, telomere shortening, activation of MYC, leading to neoplastic transformation. 489

Part IV


Prostate cancer arises from the accumulation of genetic and epigenetic alterations [22]. Cytogenetic analyses have demonstrated the prevalence of chromosomal aberrations associated with prostate tumorigenesis, and many genes that map to deleted or amplified regions have been investigated for their roles in disease progression. In recent years, genome-wide profiling of prostate tumors has led to the identification of a number of biomarkers and pathways that are altered in prostate cancer, some of which may be potential molecular targets for therapy. Despite the advancing knowledge of genes altered in prostate adenocarcinoma, the precise molecular pathways, their combinatorial relation, and the ordering of events utilized in the development of preneoplastic lesions and adenocarcinoma are still being refined. To elucidate mechanisms and to begin to test new therapies and preventative strategies for human prostate cancer, a number of groups have been developing novel animal models of prostate cancer. These models will help to define many aspects of the molecular and cellular pathogenesis of prostate cancer, such as the role of inflammation, angiogenesis, and stromal-epithelial interactions. In light of previous reviews that extensively address our current knowledge of molecular alterations in prostate tumor progression [2,4,22–28], the primary objectives of this chapter will be to highlight recent advances in our understanding of the molecular pathology of prostatic adenocarcinoma and the latest developments in mouse prostate cancer models.

HEREDITARY COMPONENT OF PROSTATE CANCER RISK Prostate cancer is known to have a hereditary component, and a large effort has been devoted to uncovering familial prostate cancer genes. A limited set of germline polymorphisms and mutations have been associated with increased prostate cancer risk. Based on linkage analysis, the inherited susceptibility locus Hereditary prostate cancer 1 (HPC1), which encodes Ribonuclease L (RNASEL), was mapped to chromosomal region 1 [26,29,30]. Germline mutations in the Macrophage Scavenger Receptor 1 (MSR1) locus have also been linked to prostate cancer risk [31]. The MSR1 gene is located at chromosomal region 8p22 and is expressed in infiltrating macrophages [4]. Many other loci have been implicated as well, and further characterization of these genes in the etiology of prostate cancer is warranted [32]. Most recently several groups have used Genome Wide Association Studies (GWAS) to show a number of SNPs at novel loci related to prostate cancer risk, several of which map to chromosome 8q24 [33–42].

telomere shortening [22,43,44]. Inactivation of classical tumor suppressors, for example, TP53 and Retinoblastoma (RB), has been found in prostate tumors and cancer cell lines [26]. However, these alterations are far more common in advanced hormone-refractory and/or metastatic cancers. As with other epithelial cancers, cytogenetic studies using fluorescence in situ hybridization (FISH) and comparative genomic hybridization (CGH) have identified chromosomal regions frequently gained and lost in prostate cancer. The most common chromosomal abnormalities are losses at 8p, 10q, 13q, and 16q, and gains at 7p, 7q, 8q, and Xq [4,28,45–51].

MYC MYC protein functions as a nuclear transcription factor that impacts a wide range of cellular processes including cell cycle progression, metabolism, ribosome biogenesis, and protein synthesis [52]. The MYC oncogene maps to chromosome 8q24, and this region is amplified in a number of human tumors [52]. The complexity of MYC-regulated transcriptional networks has been under intense study since the late 1990s, yet the precise role of the MYC oncogene during neoplastic transformation and its direct molecular targets in prostate tumorigenesis remain largely unknown. Initial reports of increased MYC gene expression in PIN lesions and 30% of tumors [53,54], combined with the correlation of 8q24 amplification with high Gleason grade and metastatic carcinoma, suggested that alterations in MYC were associated with advanced disease [55,56]. This was in contrast to increased levels of MYC mRNA detected in most prostate cancers, including low-grade cases [57,58]. However, recent evidence from our group suggests that MYC upregulation at the protein level is an early and common event in primary prostate cancer cases. Using an improved antibody for immunohistochemical analyses on tissue microarrays, nuclear MYC staining was increased in the luminal epithelial cells of PIN, PIA, and carcinoma lesions compared to benign tissues [19]. Interestingly, FISH analysis revealed a positive correlation between gain of 8q24 and Gleason grade, but not overall MYC protein levels. These findings in conjunction with the fact that human MYC overexpression is able to initiate prostate cancer in transgenic mice suggest a key role for MYC upregulation in the initiation of prostate tumorigenesis that is likely independent of gene amplification. Indeed, further investigations of the mechanisms that underlie MYC overexpression in prostate cancer progression are warranted.

NKX3.1 SOMATIC ALTERATIONS IN GENE EXPRESSION Acquired somatic gene alterations in prostate cancer cells include cytosine methylation alterations within CpG dinucleotides, point mutations, deletions, amplifications, and 490

NKX3.1 is one of several candidate tumor suppressor genes located on chromosome 8p. The NKX3.1 gene encodes a homeodomain transcription factor that is the earliest known marker of prostate epithelium during embryogenesis [59,60]. Its expression persists in the epithelial cells of the adult gland and is required

Chapter 24

Molecular Pathogenesis of Prostate Cancer: Somatic, Epigenetic, and Genetic Alterations

for maintenance of ductal morphology and the regulation of cell proliferation [61–64]. Human NKX3.1 maps within the minimal deletion interval of chromosomal region 8p21. Loss of heterozygosity at 8p21 has been observed in 63% of high-grade PIN foci and up to 70% of prostate tumors, although this percentage may be significantly less according to recent findings [18,65,66]. Methylation of CpG dinucleotides upstream of the NKX3.1 transcriptional start site and the existence of germline variants within the homeodomain have been reported [67]. However, the order of occurrence relative to 8p21 loss and prostate cancer initiation is unknown. In loss of function analyses, NKX3.1 homozygous mutant mice do not develop invasive carcinoma. However, epithelial hyperplasia and PIN lesions are observed with age in these mice [61,62,64]. These phenotypes are also observed in heterozygous mice, albeit to a lesser extent. When taken together, human and mouse studies support the notion that haploinsufficiency of NKX3.1 plays a role in prostate cancer development. Several studies have analyzed NKX3.1 expression by immunohistochemistry in human prostate cancer specimens. In studies of PIN and carcinoma, both decreased intensity and loss of NKX3.1 protein staining compared to benign tissue have been reported [18,67–71]. Decreased expression correlated with high Gleason score, advanced tumor stage, the presence of metastatic disease, and hormone-refractory disease [18,68]. Recently, our immunohistochemical analyses with a novel NKX3.1 antibody revealed a dramatic decrease in the level of NKX3.1 in PIA lesions [18]. As NKX3.1 is thought to regulate cell proliferation [63,72], loss of expression in atrophic epithelial cells may contribute to increased proliferative capacity. This may serve to amplify any genetic changes that may occur in epithelial cells within these regenerative lesions. Consistent with previous reports, NKX3.1 staining intensity was also significantly diminished in PIN and carcinoma lesions. Diminished NKX3.1 protein expression correlated with 8p loss in high-grade tumors, but not PIN or PIA [18,73]. Intriguingly, the levels of NKX3.1 mRNA and protein were found to be discordant in 7 of 11 carcinoma cases, confirming previous reports and suggesting that multiple mechanisms underlie sporadic loss of NKX3.1 for tumor progression. Although the precise transcriptional targets of NKX3.1 are largely unknown, microarray analyses suggest that lack of NKX3.1 results in increased oxidative DNA damage by controlling expression of antioxidant enzymes [74]. A limited set of proteins has been identified to physically interact with NKX3.1, including Serum Response Factor (SRF) and Prostate-derived Ets transcription factor [75,76]. The serine-threonine kinase CK2 and the ubiquitin ligase TOPORS have recently been shown to regulate the stability of NKX3.1 in prostate cancer cells in vitro [77,78]. The functional significance of these interactions in precursor and cancer lesions has yet to be elucidated. It is hoped that with the recent advances in mouse prostate cancer models and the application of high-resolution genomic tools, the mechanisms of NKX3.1 loss will be uncovered.

PTEN The Phosphatase and tensin homologue (PTEN ) gene is a well-characterized tumor suppressor that maps to chromosomal region 10q23 [79] and acts as a negative regulator of the phosphatidylinositol 3-kinase/AKT (PI3K/AKT) signaling, used for cell survival [80–83]. PTEN inhibits growth factor signals sent through PI3 kinase by dephosphorylating the PI3K product, phosphatidylinositol 3,4,5-trisphosphate (PIP3). Loss of PTEN expression results in the downstream activation (phosphorylation) of AKT, an inhibitor of apoptosis and promoter of cell proliferation. Aberrant PTEN expression has been implicated in numerous cancers, including metastatic prostate cancers, which at times exhibit homozygous deletion of PTEN [26,43,79]. However, the majority of primary prostate cancer cases with genetic alterations in PTEN harbor loss of heterozygosity at the PTEN locus without mutations in the remaining allele [84–86]. That PTEN is a haploinsufficient tumor suppressor in the prostate is evident by prostate-specific disruption of PTEN in mice, which results in PIN lesions, followed by invasive carcinoma and/or metastasis with age [87,88]. Cooperativity exists between NKX3.1 and PTEN in prostate tumorigenesis, as compound NKX3.1 and PTEN heterozygous mice rapidly develop invasive carcinoma and androgen-independent disease [89–91].

Androgen Receptor The role of AR is central to prostate pathobiology, as the prostate is dependent on androgens for normal growth and maintenance. AR is a nuclear steroid hormone receptor with high expression in the luminal epithelial cells and little expression in basal epithelial cells. In the absence of ligand, AR is inactive and bound to heat shock chaperone proteins [92]. Upon binding of the active form of testosterone (dihydrotestosterone, DHT), AR is released from heat shock proteins and translocates to the nucleus where it physically associates with cofactors to regulate target gene transcription. AR activity is essential for the development of prostate cancer, and AR expression is evident in high-grade PIN and most adenocarcinoma lesions [93]. Androgen ablation, through the use of antiandrogens, castration, or gonadotropin superagonists is the mainline therapy for advanced, metastatic carcinoma. While the majority of patients respond to this treatment, it eventually fails and the tumors become androgen independent. As tumors progress from androgen dependence to a hormone refractory state, AR can be amplified at the Xq12 region or mutated to respond to a range of ligands for androgen-independent activation and tumor growth [94,95]. In recent years, AR has been reported to engage in crosstalk with other mitogenic signaling pathways such as PI3K/AKT and MAPK as a means of enhancing androgen-independent tumor progression [96,97].

491

Part IV


TMPRSS2-ETS Gene Fusions Ets-related gene-1 (ERG) is an oncogenic transcription factor upregulated in the majority of primary prostate cancer cases [98]. Evidence of recurrent chromosomal rearrangements in prostate cancer was first reported by Tomlins et al. [99]. Through use of a bioinformatic approach to analyze DNA microarray studies, gene fusions between the promoter/enhancer region of the androgen-responsive TMPRSS2 gene and members of the ETS family, including ERG and ETV1, were found in 90% of prostate tumors with known overexpression of ERG. This discovery has fueled efforts to characterize the functional implications of aberrant chromosomal fusions on tumor progression and clinical outcome. Presently, there are conflicting data regarding the presence of TMPRSS-Erg gene fusions and clinical outcome [100–106]. While initial studies suggested these fusions were not present in PIN lesions, it has become clear that some PIN lesions indeed harbor fusions, and this suggests that gene fusion may lead to neoplastic transformation itself and not specifically to the invasive phenotype [107,108]. Additionally, overexpression of ERG in the transgenic mouse prostates results in basal cell loss and PIN lesions [109,110], although this latter finding is controversial. These studies demonstrate that upregulation of ERG may contribute to transformation of prostate epithelial cells but is insufficient to initiate prostate cancer.

p27 The cyclin-dependent kinase inhibitor p27kip1 is a candidate tumor suppressor encoded by the CDKN1B gene. To prevent cell cycle progression, p27kip1 binds to and inhibits cyclin E/CDK2 and cyclin A/CDK2 complexes [111]. Although mutations are rare, loss of p27kip1 expression results in hyperplasia and malignancy in many organs, including the prostate [112– 115]. In normal and benign prostate tissues, p27kip1 is expressed highly in most luminal epithelial cells, and much more variably in basal cells [116]. However, p27kip1 expression is decreased in most high-grade PIN and carcinoma lesions [113,116–119]. Several studies have shown decreased p27kip1 to be positively correlated with increased proliferation, PSA relapse, high tumor grade, and advanced stage [113,116,119–122]. The molecular mechanism by which p27 protein is decreased in prostate cancer has not been clarified, although post-transcriptional regulation of p27kip1 is evident in carcinoma cases which express high levels of p27kip1 mRNA but lack protein expression [117]. Additional support for p27kip1 as a tumor suppressor comes from loss of function analyses in mice. Prostates from p27kip1-deficient animals exhibit hyperplasia and increased size [117]. Given the cooperativity observed between NKX3.1 and PTEN in tumorigenesis, the relationship between NKX3.1 and p27 loss has also been investigated [123]. Both genes have been shown to exhibit haploinsufficiency for tumor suppression

492

[61,91,124]. Anterior prostates of 36-week-old double mutant mice displayed epithelial hyperplasia and dysplasia that was more severe than that observed in the single p27 mutant mice. However, combined loss of p27kip1, PTEN, and NKX3.1 in bigenic and trigenic mouse models results in prostate hyperplasia followed by tumor development [125,126]. These findings suggest that prostate tumor progression is sensitive to p27 dosage and support the hypothesis that downregulation of p27kip1 is an early event in prostatic neoplasia. Expression of these three genes is known to decrease in clinical samples, providing further evidence of their cooperation in tumor progression.

Telomeres Telomeres are specialized structures composed of repeat DNA sequences at the ends of chromosomes that are complexed with binding proteins and required for maintenance of chromosomal integrity [127]. In cells lacking sufficient levels of the enzyme telomerase, telomeres progressively shorten with cell division as a result of the end replication problem and/or oxidant stress. The enzyme telomerase can add new repeat sequences to the ends of chromosomes, which stabilizes the telomeres and ensures proper telomere length. Excessive shortening can lead to improper segregation of chromosomes during cell division, genomic instability, and the initiation of tumorigenesis. Mice double mutant for telomerase and p53 display increased epithelial cancer incidence, suggesting a role for short telomeres in cancer initiation [128]. The majority of high-grade PIN and prostate cancer cases have abnormally short telomeres exclusively in the luminal cells. This supports the notion that cells in the luminal compartment may be the target of neoplastic transformation [129]. Oxidative damage can result in telomere shortening, and this may go along with the proposed inflammation-oxidative stress model of prostate cancer progression [2].

MicroRNAs MicroRNAs (miRNAs) are small noncoding RNA molecules that negatively regulate gene expression by interfering with translation. They are initially generated from primary transcripts (pri-mRNAs) and processed by the RNase III endonucleases Drosha and Dicer to produce the mature miRNA molecule [130,131]. In the cytoplasm, the mature miRNA associates with the RNA-induced silencing complex (RISC) and binds to the 30 UTR of its target mRNA, leading to degradation or transcriptional silencing [132]. Since their discovery over a decade ago, miRNAs have been shown to play key roles in development, and there is increasing evidence of their widespread dysregulation in cancer [133]. Recently, a limited number of studies have reported a predominant decrease in the levels of miRNAs in prostate carcinoma, including let-7, miR-26a, miR-99, and miR-125-a-b [134–136]. Although a prostate

Chapter 24


cancer-specific miRNA signature has not emerged from these small-scale studies, greater knowledge of miRNA expression patterns and target genes may reveal the role of miRNAs in the etiology of prostate cancer. MiRNAs that are consistently dysregulated in prostate tumorigenesis and have a strong relationship with disease progression may potentially serve as novel biomarkers for prognosis.

EPIGENETICS Epigenetic alterations in prostate carcinogenesis include changes in chromosome structure through abnormal deoxycytidine methylation of wild-type DNA sequences and histone modifications (acetylation, methylation). Epigenetic events occur earlier in prostate tumor progression and more consistently than recurring genetic changes. However, the mechanisms by which these changes arise are poorly understood. Silencing of genes through aberrant methylation may occur as a result of altered DNA methyltransferase (DNMT) activity. DNMTs establish and maintain the patterns of methylation in the genome by catalyzing the transfer of methyl groups to deoxycytidine in CpG dinucleotides. Several genes that are silenced by epigenetic alterations have been identified.

GSTP1 Glutathione S-transferases are enzymes responsible for the detoxification of reactive chemical species through conjugation to reduced glutathione. The GSTP1 gene, encoding the pi class glutathione S-transferase, was the first hypermethylated gene to be characterized in prostate cancer [137]. GSTP1 is thought to protect prostate epithelial cells from carcinogen-associated and/ or oxidative stress-induced DNA damage, and loss of GSTP1 may render prostate cells unprotected from such genomic insults. As an example, in LNCaP prostate cancer cells, devoid of GSTP1 as a result of epigenetic gene silencing, restoration of GSTP1 function affords protection against metabolic activation of the dietary heterocyclic amine carcinogen 2-amino1-methyl-6-phenylimidazo [4,5–b] pyridine (PhIP), known to cause prostate cancer when ingested by rats [138,139]. The loss of enzymatic defenses against reactive chemical species encountered as part of dietary exposures or arising endogenously associated with epigenetic silencing of GSTP1 provides a plausible mechanistic explanation for the marked impact of the diet and of inflammatory processes in the pathogenesis of human prostate cancer. The most common genomic DNA mark accompanying epigenetic gene silencing in cancer cells is an accumulation of 5-meC bases in CpG dinucleotides clustered into CpG islands encompassing transcriptional regulatory regions. Hypermethylation of these CpG island sequences directs the formation of repressive heterochromatin that prevents loading of RNA polymerase and transcription of hnRNA that can be

processed for translation into protein. For GSTP1, the 5-meCpG dinucleotides begin to appear in the gene promoter region of rare cells in PIA lesions, with more dense CpG island methylation changes emerging as PIA lesions progress to PIN and carcinoma [21]. The proliferative expansion of cells with hypermethylated GSTP1 CpG island sequences as PIA lesions progress hints at some sort of selective growth advantage, though how loss of GSTP1 can be selected during prostatic carcinogenesis has not been established. In addition to GSTP1, many other critical genes undergo epigenetic silencing during the pathogenesis of prostate cancer [22]. The mechanisms by which epigenetic defects arise in prostate cancer cells, or in other human cancer cells, have not been discerned. However, the consistent appearance of such changes in inflammatory precancerous lesions and conditions, including PIA lesions, inflammatory bowel disease, chronic active hepatitis, and others, supports the contribution of inflammatory processes to some sort of epigenetic or DNA methylation catastrophe [22].

APC The Adenomatous polyposis coli (APC) protein is a component of the Wnt/b-catenin signaling pathway that negatively regulates cell growth. APC is typically found in a complex with Glycogen synthase kinase-3 (GSK3) and Axin. This complex is responsible for targeting free cytosolic b-catenin for ubiquitin-mediated degradation. The pathway is activated by the binding of the Wnt protein to the Frizzled family of seven transmembrane receptors and LRP5/6, followed by downregulation of GSK3b, which allows accumulation of b-catenin and subsequent translocation of b-catenin to the nucleus. Once inside the nucleus, b-catenin is able to activate transcription of Wnt target genes. Indirect support of the concept that APC inactivation may be mechanistically tied to prostate cancer progression comes from studies showing frequent hypermethylation of its promoter region and that the extent of methylation correlates with stage, grade, and biochemical recurrence [140–142]. Activating mutations occur in approximately 5% of prostate cancers, and aberrant nuclear localization of b-catenin appears to occur only somewhat more frequently [143]. The latter finding suggests that if APC is functioning as a tumor suppressor in prostate adenocarcinoma, then its primary role in the prostate may not relate to nuclear translocation of b-catenin. More direct support for the notion that APC may be a tumor suppressor in prostate cancer comes from a mouse model in which prostate-specific deletion of APC in adult mice resulted in carcinoma induction [144]. Whether APC is involved in prostate cancer formation or progression or not, the methylation of its promoter may become a useful biomarker in prostate cancer diagnosis since this methylation may be detectable in bodily fluids such as urine or blood [145,146].

493

Part IV


ADVANCES IN MOUSE MODELS OF PROSTATE CANCER The human prostate is an encapsulated organ composed of the central, peripheral, and transitional zones. In contrast, the mouse prostate is composed of four individual lobes: designated dorsal, lateral, ventral, and anterior. Despite the organizational differences between the mouse and human prostate glands, rodent prostate cancer models provide the unique opportunity to study prostate cancer development and progression including molecular alterations and histopathology [147]. In recent years, the validity of a subset of mouse models as predictable and valid representations of human disease has been demonstrated. A number of models of prostate cancer have been developed in mice using gain of function approaches to force expression of known oncogenes in the prostate [147,148]. The most widely used mouse model is the Transgenic Adenocarcinoma Mouse Prostate (TRAMP) model, which utilizes the androgenregulated rat probasin promoter to target expression of the Simian Virus 40 (SV40) large and small T antigens to the prostate at the onset of sexual maturity [149,150]. This model has been particularly favored since cancers develop quickly and often metastasize to distant sites. At the genetic level, disease progression in the TRAMP model exhibits some similarities to human prostate cancer. It has been demonstrated that somatic AR mutations present in primary human prostate tumors [151] are also found in similar regions of the AR gene in TRAMP mice [152]. Increased expression of IGF-I and Prostate Stem Cell Antigen (PSCA) and downregulation of NKX3.1 and E-cadherin are associated with human cancer progression, and similar, albeit more dramatic, changes are found in TRAMP tumors [149,153–155]. This model and other transgenic lines that express the SV40 early region transforming sequences in the prostate have significant limitations in terms of relevance to human disease. This stems from the increasing realization that the aggressive, poorly differentiated lesions in these models represent small cell, neuroendocrine carcinoma, and not adenocarcinoma as demonstrated by standard histopathology, as well as molecular markers revealed by immunohistochemical staining [156,157]. For example, these lesions often display an absence of, or near absence of, androgen receptor expression, whereas the majority of lethal, metastatic prostate cancers in humans retain high AR expression [158,159], and the poorly differentiated tumors also diffusely express markers of neuroendocrine differentiation such as synaptophysin. Other models of prostate neoplasia have targeted overexpression of growth factors, hormone receptors, and cell cycle regulators to the prostate. However, most of these models fail to progress to invasive carcinoma and result in hyperplasia and mouse PIN lesions [147,160,161]. Recently, several models have been developed through targeted deletion of tumor suppressors or overexpression of oncogenes relevant to prostate

494

cancer progression. These animals recapitulate the early phases of human cancer and provide useful reagents to uncover potential synergism between genes involved in prostate cancer progression. Since excellent reviews exist regarding most of these models [147,148,160,162,163], we will focus on a small number of them that are either most commonly used or are particularly interesting in light of our knowledge of the human disease.

Conditional Loss of Tumor Suppressor Gene Expression in the Prostate The prostate-specific PTEN deletion model was derived using the inducible loxP/Cre recombinase system to cause homozygous loss of PTEN expression in the epithelial cells of the prostate [88,164,165]. Conditional PTEN knockout mouse prostates develop hyperplasia by 4 weeks and PIN by the age of 6 weeks. Adenocarcinoma, followed by metastases in the lymph nodes and lungs, was observed in mice one year of age or older [88]. This model mimics the loss of PTEN expression observed in some human prostate cancers, and cDNA microarray analyses performed with PTEN null prostates have demonstrated similar alterations as those found in human prostate cancers, including downregulated NKX3.1 [88]. Loss of PTEN, NKX3.1, and p27 in mice has been shown to cooperate in tumor progression in triple heterozygotes 6 months of age and younger that exhibit increased incidence of high-grade PIN and cancer lesions [126]. These findings suggest that prostate tumor progression is sensitive to p27 dosage. Expression of these three genes is known to decrease in early prostate tumors, providing further evidence of their cooperation in tumor progression. PTEN regulates the stability of p53, and p53 can activate PTEN transcription [166,167]. Complete loss of PTEN in the prostate of knockout mice results in invasive cancer. However, tumor growth is slow, and there is an increase in p53 expression and cellular senescence [168]. The complex relationship between cellular senescence and PTEN loss in the prostate tumorigenesis has been elucidated through prostatespecific conditional inactivation of Trp53 and PTEN in transgenic mice [169]. Animals with loss of PTEN alone displayed high-grade PIN lesions at 10 weeks and eventually developed prostate cancer after 4–6 months. Prostates with homozygous loss of PTEN exhibited diminished proliferative capacity and increased expression of p53 and cell senescence markers, including SA-beta galactosidase staining and p21 expression. Pathological changes were not detected in Trp53 mutants. However, combined homozygous loss of PTEN and Trp53 resulted in invasive prostate carcinoma in 50% of mice as early as 10 weeks [169]. These results demonstrate that tumor progression in PTEN mutant mice is enhanced by loss of Trp53 and may explain why human prostate tumors select loss of only one PTEN allele to escape senescence [169].

Chapter 24


To address the role of APC downregulation in prostate cancer progression, Cre-mediated deletion of APC in the prostate was carried out using a transgenic line that expressed floxed APC alleles [165,170]. Preneoplastic lesions were observed in Pb-Creþ;Apcflox/flox mice as early as 4.5 weeks, and accumulation of b-catenin was evident in hyperplastic regions [144]. Deletion of APC resulted in enlargement of all four lobes, and within 7 months of age, all mice developed adenocarcinoma lesions with focal areas of inflammation and reactive stroma. As b-catenin has been implicated in the regulation of AR [171–173], this model provides a valuable resource with which to dissect the role of Wnt signaling in prostate cancer progression.

Loss of RB Allelic loss or reduced expression of pRB has been reported to occur in 20%–30% of primary human prostate carcinomas [174–176]. However, loss of pRB is more frequent in advanced stage tumors [177]. Conditional knockout of RB in the mouse prostate epithelium results in hyperplasia, indicating that loss of RB alone cannot initiate PIN or prostate cancer development. To determine if this lack of cancer formation resulted from compensation by the other RB family members, p107 and p130, researchers recently generated transgenic animals that expressed the amino terminus of the SV40 large T antigen in the prostate. The truncated form of T antigen is known to inactivate the RB family of proteins, and these mice develop PIN by 12 weeks and microinvasive carcinoma at 30 weeks of age [178]. Apoptosis was unaffected by loss of p53; however, heterozygous loss of PTEN reduced apoptosis by 50% and increased the onset of disease [178]. Although metastatic disease is not observed in these animals, the study sheds light on the role of tumor suppressor haploinsufficiency in prostate tumor progression in the context of RB deficiency.

Overexpression of Oncogenes in the Prostate Given that MYC is overexpressed in human prostate cancers, a number of mice that overexpress Myc in the prostate have been produced using either the C3 [179] or different versions of the rat probasin promoter to drive expression of the human MYC gene in prostate epithelial cells [180]. Ellwood-Yen et al. [180] characterized two different mouse strains. LoMYC mice were generated using the rat probasin promoter, and Hi-MYC mice were generated using a modified form of this. Lo-MYC mice were shown to develop PIN lesions by 4 weeks and progress to invasive adenocarcinoma by one year. No metastases were found. Disease progression occurred more rapidly in the Hi-MYC mice, with invasive adenocarcinoma by 3 to 6 months, and some animals eventually developed micrometastatic disease [180]. Additionally, cDNA microarray analyses of aged transgenic animals revealed loss of NKX3.1 and upregulation of the Pim-1

kinase, which interacts with Myc in other malignancies [28]. Although metastasis is rare in this model, aspects of its pathobiology are similar to the human disease and demonstrate the usefulness of this model for preclinical applications [162,180].

Overexpression of Mutated AR Expression of AR is often increased in hormone refractory prostate cancer cases [181]. However, mice that overexpress the wild-type AR in the prostate develop focal PIN lesions with age, suggesting that increased levels of AR may be permissive, but insufficient to drive tumorigenesis [182]. Recently, a mouse prostate cancer model using probasin promoter-driven expression of the AR mutation E231G (AR-E231G) was described [183]. This missense mutation, located in the N-terminal domain of the AR, results in increased responsiveness to coactivators in TRAMP cell lines [152]. Prostates of transgenic mice that overexpressed wild-type AR (AR-WT) or a ligand-binding domain AR mutation (AR-T857A) appeared normal, while AR-E231G mice rapidly developed PIN and invasive adenocarcinoma in the ventral lobe of the prostate. Inflammation accompanied invasive lesions, and metastases were detected in the lungs of AR-E231G transgenic mice after one year [183]. This model is the first to provide in vivo evidence of AR as an oncogenic factor. Since increased AR signaling is thought to contribute to tumor progression [23], further biochemical analyses of this model may provide critical insight into the effects of increased AR-coactivator interactions in prostate tumor progression.

Hepsin According to multiple microarray studies, hepsin is one of the most frequently upregulated genes in prostate cancer [184]. Hepsin is a type II transmembrane serine protease of unknown physiological function, and its correlation with disease progression has been investigated. Hepsin mRNA and protein expression has been shown to increase with higher tumor grade and metastasis [185–188]. However, one study reported decreased hepsin mRNA levels in hormone refractory tumors compared to localized prostate cancer [189]. To assess the functional role of hepsin in prostate cancer progression, Klezovitch and colleagues [190] used the modified probasin promoter (ARR2–PB) to drive expression of hepsin in the ventral prostate of transgenic mice. Increased epithelial expression of hepsin disrupted stromal-epithelial interactions in the basement membrane, but cell proliferation and death remain unaffected [190]. When PB-hepsin mice were mated to the nonmetastatic LPB-Tag prostate cancer model [191], offspring developed invasive carcinoma and metastases of the liver, lung, and bone. These metastatic lesions displayed neuroendocrine differentiation, and the authors concluded that hepsin overexpression enhances cancer progression and the development of

495

Part IV


neuroendocrine metastases, which may be intrinsic to the SV40 T antigen [190]. Therefore, it would be of great interest to examine the upregulation of hepsin in the context of a non-T-antigen derived prostate cancer model.

CONCLUSION Mouse models of prostate cancer have shed light on critical molecular events in the development of adenocarcinoma. However, greater relevance to human disease progression requires that these models be further refined to reflect key pathological features of prostatic adenocarcinoma. As tumorigenesis is a multifactorial process, the field of prostate cancer models must continue the use of combinatorial approaches to study the effects of multiple players in prostate cancer development. These models provide the unique opportunity to explore the complex interplay between tumor suppressors and/or oncogenes in the context of an intact immune system and epithelial-stromal interactions.

ACKNOWLEDGMENTS NIH/NCI Specialized Program in Research Excellence (SPORE) in Prostate Cancer #P50CA58236 (Johns Hopkins), NIH/NCI #R01 CA070196, and The Patrick C. Walsh Foundation.

REFERENCES 1. Chan JM, Giovannucci EL. Vegetables, fruits, associated micronutrients, and risk of prostate cancer. Epidemiol Rev. 2001;23:82–86. 2. De Marzo AM, Platz EA, Sutcliffe S, et al. Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007;7:256–269. 3. Kolonel LN. Fat, meat, and prostate cancer. Epidemiol Rev. 2001;23:72–81. 4. Nelson WG, De Marzo AM, Isaacs WB. Prostate cancer. N Engl J Med. 2003;349:366–381. 5. De Marzo AM, Marchi VL, Epstein JI, et al. Proliferative inflammatory atrophy of the prostate: Implications for prostatic carcinogenesis. Am J Pathol. 1999;155:1985–1992. 6. McNeal JE, Bostwick DG. Intraductal dysplasia: A premalignant lesion of the prostate. Hum Pathol. 1986;17:64–71. 7. Bostwick DG, Brawer MK. Prostatic intra-epithelial neoplasia and early invasion in prostate cancer. Cancer. 1987;59:788–794. 8. McNeal JE, Bostwick DG, Kindrachuk RA, et al. Patterns of progression in prostate cancer. Lancet. 1986;1:60–63. 9. Abate-Shen C, Shen MM. Molecular genetics of prostate cancer. Genes Dev. 2000;14:2410–2434. 10. Bostwick DG, Qian J. High-grade prostatic intraepithelial neoplasia. Mod Pathol. 2004;17:360–379. 11. Sakr WA, Haas GP, Cassin BF, et al. The frequency of carcinoma and intraepithelial neoplasia of the prostate in young male patients. J Urol. 1993;150:379–385. 12. McNeal JE. Anatomy of the prostate and morphogenesis of BPH. Prog Clin Biol Res. 1984;145:27–53. 13. Franks LM. Atrophy and hyperplasia in the prostate proper. J Pathol Bacteriol. 1954;68:617–621. 14. Putzi MJ, De Marzo AM. Morphologic transitions between proliferative inflammatory atrophy and high-grade prostatic intraepithelial neoplasia. Urology. 2000;56:828–832.

496

15. Shah R, Mucci NR, Amin A, et al. Postatrophic hyperplasia of the prostate gland: Neoplastic precursor or innocent bystander? Am J Pathol. 2001;158:1767–1773. 16. Ruska KM, Sauvageot J, Epstein JI. Histology and cellular kinetics of prostatic atrophy. Am J Surg Pathol. 1998;22:1073–1077. 17. van Leenders GJ, Gage WR, Hicks JL, et al. Intermediate cells in human prostate epithelium are enriched in proliferative inflammatory atrophy. Am J Pathol. 2003;162:1529–1537. 18. Bethel CR, Faith D, Li X, et al. Decreased NKX3.1 protein expression in focal prostatic atrophy, prostatic intraepithelial neoplasia, and adenocarcinoma: Association with Gleason score and chromosome 8p deletion. Cancer Res. 2006;66:10683–10690. 19. Gurel B, Iwata T, Jenkins RB, et al. Nuclear c-Myc protein overexpression as an early and prevalent marker of prostate carcinogenesis. Mod Pathol. 2008;21:1156–1167. 20. Macoska JA, Trybus TM, Wojno KJ. 8p22 loss concurrent with 8c gain is associated with poor outcome in prostate cancer. Urology. 2000;55:776–782. 21. Nakayama M, Bennett CJ, Hicks JL, et al. Hypermethylation of the human glutathione S-transferase-pi gene (GSTP1) CpG island is present in a subset of proliferative inflammatory atrophy lesions but not in normal or hyperplastic epithelium of the prostate: A detailed study using laser-capture microdissection. Am J Pathol. 2003;163:923–933. 22. Nelson WG, Yegnasubramanian S, Agoston AT, et al. Abnormal DNA methylation, epigenetics, and prostate cancer. Front Biosci. 2007;12:4254–4266. 23. Balakumaran BS, Febbo PG. New insights into prostate cancer biology. Hematol Oncol Clin North Am. 2006;20:773–796. 24. Bastian PJ, Yegnasubramanian S, Palapattu GS, et al. Molecular biomarker in prostate cancer: The role of CpG island hypermethylation. Eur Urol. 2004;46:698–708. 25. De Marzo AM, Nelson WG, Isaacs WB, et al. Pathological and molecular aspects of prostate cancer. Lancet. 2003;361:955–964. 26. Karayi MK, Markham AF. Molecular biology of prostate cancer. Prostate Cancer Prostatic Dis. 2004;7:6–20. 27. Nelson WG, DeWeese TL, DeMarzo AM. The diet, prostate inflammation, and the development of prostate cancer. Cancer Metastasis Rev. 2002;21:3–16. 28. Tomlins SA, Rubin MA, Chinnaiyan AM. Integrative biology of prostate cancer progression. Annu Rev Pathol. 2006;1:243–271. 29. Nelson WG, De Marzo AM, DeWeese TL. The molecular pathogenesis of prostate cancer: Implications for prostate cancer prevention. Urology. 2001;57:39–45. 30. Palapattu GS, Sutcliffe S, Bastian PJ, et al. Prostate carcinogenesis and inflammation: Emerging insights. Carcinogenesis. 2005;26:1170–1181. 31. Xu J, Zheng SL, Komiya A, et al. Germline mutations and sequence variants of the macrophage scavenger receptor 1 gene are associated with prostate cancer risk. Nat Genet. 2002;32:321–325. 32. Gillanders EM, Xu J, Chang BL, et al. Combined genome-wide scan for prostate cancer susceptibility genes. J Natl Cancer Inst. 2004;96:1240–1247. 33. Croce CM. Oncogenes and cancer. N Engl J Med. 2008;358:502– 511. 34. Gudmundsson J, Sulem P, Manolescu A, et al. Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24. Nat Genet. 2007;39:631–637. 35. Gudmundsson J, Sulem P, Rafnar T, et al. Common sequence variants on 2p15 and Xp11.22 confer susceptibility to prostate cancer. Nat Genet. 2008;40:281–283. 36. Gudmundsson J, Sulem P, Steinthorsdottir V, et al. Two variants on chromosome 17 confer prostate cancer risk, and the one in TCF2 protects against type 2 diabetes. Nat Genet. 2007;39:977– 983. 37. Ma L, Weinberg RA. MicroRNAs in malignant progression. Cell Cycle. 2007;7:570–572. 38. Sun J, Lange EM, Isaacs SD, et al. Chromosome 8q24 risk variants in hereditary and non-hereditary prostate cancer patients. Prostate. 2008;68:489–497. 39. Yeager M, Orr N, Hayes RB, et al. Genome-wide association study of prostate cancer identifies a second risk locus at 8q24. Nat Genet. 2007;39:645–649.

Chapter 24


40. Zanke BW, Greenwood CM, Rangrej J, et al. Genome-wide association scan identifies a colorectal cancer susceptibility locus on chromosome 8q24. Nat Genet. 2007;39:989–994. 41. Zheng SL, Sun J, Cheng Y, et al. Association between two unlinked loci at 8q24 and prostate cancer risk among European Americans. J Natl Cancer Inst. 2007;99:1525–1533. 42. Zheng SL, Sun J, Wiklund F, et al. Cumulative association of five genetic variants with prostate cancer. N Engl J Med. 2008; 358:910–919. 43. Dong JT. Chromosomal deletions and tumor suppressor genes in prostate cancer. Cancer Metastasis Rev. 2001;20:173–193. 44. Meeker AK, Hicks JL, Platz EA, et al. Telomere shortening is an early somatic DNA alteration in human prostate tumorigenesis. Cancer Res. 2002;6405–6409. 45. Chang BL, Liu W, Sun J, et al. Integration of somatic deletion analysis of prostate cancers and germline linkage analysis of prostate cancer families reveals two small consensus regions for prostate cancer genes at 8p. Cancer Res. 2007;67:4098–4103. 46. Gonzalgo ML, Isaacs WB. Molecular pathways to prostate cancer. J Urol. 2003;170:2444–2452. 47. Joshua AM, Evans A, Van der Kwast T, et al. Prostatic preneoplasia and beyond. Biochem Biophys Acta. 2007;1785:156–181. 48. Liu W, Chang B, Sauvageot J, et al. Comprehensive assessment of DNA copy number alterations in human prostate cancers using Affymetrix 100K SNP mapping array. Genes Chromosomes Cancer. 2006;45:1018–1032. 49. Liu W, Chang BL, Cramer S, et al. Deletion of a small consensus region at 6q15, including the MAP3K7 gene, is significantly associated with high-grade prostate cancers. Clin Cancer Res. 2007;13:5028–5033. 50. Shand RL, Gelmann EP. Molecular biology of prostate-cancer pathogenesis. Curr Opin Urol. 2006;16:123–131. 51. Sun J, Liu W, Adams TS, et al. DNA copy number alterations in prostate cancers: A combined analysis of published CGH studies. Prostate. 2007;67:692–700. 52. Dang CV, O’Donnell KA, Zeller KI, et al. The c-Myc target gene network. Semin Cancer Biol. 2006;16:253–264. 53. Nesbit CE, Tersak JM, Prochownik EV. MYC oncogenes and human neoplastic disease. Oncogene. 1999;18:3004–3016. 54. Qian J, Jenkins RB, Bostwick DG. Detection of chromosomal anomalies and c-Myc gene amplification in the cribriform pattern of prostatic intraepithelial neoplasia and carcinoma by fluorescence in situ hybridization. Mod Pathol. 1997; 10:1113–1119. 55. Jenkins RB, Qian J, Lieber MM, et al. Detection of c-Myc oncogene amplification and chromosomal anomalies in metastatic prostatic carcinoma by fluorescence in situ hybridization. Cancer Res. 1997;57:524–531. 56. Sato K, Qian J, Slezak JM, et al. Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma. J Natl Cancer Inst. 1999;91:1574–1580. 57. Buttyan R, Sawczuk IS, Benson MC, et al. Enhanced expression of the c-Myc protooncogene in high-grade human prostate cancers. Prostate. 1987;11:327–337. 58. Fleming WH, Hamel A, MacDonald R, et al. Expression of the cMyc protooncogene in human prostatic carcinoma and benign prostatic hyperplasia. Cancer Res. 1986;46:1535–1538. 59. Bieberich CJ, Fujita K, He WW, et al. Prostate-specific and androgen-dependent expression of a novel homeobox gene. J Biol Chem. 1996;271:31779–31782. 60. He WW, Sciavolino PJ, Wing J, et al. A novel human prostate-specific, androgen-regulated homeobox gene (NKX3.1) that maps to 8p21, a region frequently deleted in prostate cancer. Genomics. 1997;43:69–77. 61. Abdulkadir SA, Magee JA, Peters TJ, et al. Conditional loss of NKX3.1 in adult mice induces prostatic intraepithelial neoplasia. Mol Cell Biol. 2002;22:1495–1503. 62. Bhatia-Gaur R, Donjacour AA, Sciavolino PJ, et al. Roles for NKX3.1 in prostate development and cancer. Genes Dev. 1999;13:966–977. 63. Magee JA, Abdulkadir SA, Milbrandt J. Haploinsufficiency at the NKX3.1 locus. A paradigm for stochastic. dosage-sensitive gene regulation during tumor initiation. Cancer Cell. 2003;3:273–283. 64. Schneider A, Brand T, Zweigerdt R, et al. Targeted disruption of the NKX3.1 gene in mice results in morphogenetic defects of

65. 66.

67. 68. 69. 70.

71.

72. 73.

74. 75.

76. 77. 78. 79. 80. 81. 82. 83. 84. 85.

86. 87.

minor salivary glands: Parallels to glandular duct morphogenesis in prostate. Mech Dev. 2000;95:163–174. Emmert-Buck MR, Vocke CD, Pozzatti RO, et al. Allelic loss on chromosome 8p12–21 in microdissected prostatic intraepithelial neoplasia. Cancer Res. 1995;55:2959–2962. Vocke CD, Pozzatti RO, Bostwick DG, et al. Analysis of 99 microdissected prostate carcinomas reveals a high frequency of allelic loss on chromosome 8p12–21. Cancer Res. 1996;56:2411–2416. Asatiani E, Huang WX, Wang A, et al. Deletion, methylation, and expression of the NKX3.1 suppressor gene in primary human prostate cancer. Cancer Res. 2005;65:1164–1173. Bowen C, Bubendorf L, Voeller HJ, et al. Loss of NKX3.1 expression in human prostate cancers correlates with tumor progression. Cancer Res. 2000;60:6111–6115. Korkmaz CG, Korkmaz KS, Manola J, et al. Analysis of androgen regulated homeobox gene NKX3.1 during prostate carcinogenesis. J Urol. 2004;172:1134–1139. Ornstein DK, Cinquanta M, Weiler S, et al. Expression studies and mutational analysis of the androgen regulated homeobox gene NKX3.1 in benign and malignant prostate epithelium. J Urol. 2001;165:1329–1334. Voeller HJ, Augustus M, Madike V, et al. Coding region of NKX3.1, a prostate-specific homeobox gene on 8p21, is not mutated in human prostate cancers. Cancer Res. 1997;57:4455– 4459. Lei Q, Jiao J, Xin L, et al. NKX3.1 stabilizes p53, inhibits AKT activation, and blocks prostate cancer initiation caused by PTEN loss. Cancer Cell. 2006;9:367–378. Zheng SL, Ju JH, Chang BL, et al. Germ-line mutation of NKX3.1 cosegregates with hereditary prostate cancer and alters the homeodomain structure and function. Cancer Res. 2006;66:69–77. Ouyang X, DeWeese TL, Nelson WG, et al. Loss-of-function of NKX3.1 promotes increased oxidative damage in prostate carcinogenesis. Cancer Res. 2005;65:6773–6779. Carson JA, Fillmore RA, Schwartz RJ, et al. The smooth muscle gamma-actin gene promoter is a molecular target for the mouse bagpipe homologue, mNkx3–1, and serum response factor. J Biol Chem. 2000;275:39061–39072. Chen H, Nandi AK, Li X, et al. NKX-3.1 interacts with prostatederived Ets factor and regulates the activity of the PSA promoter. Cancer Res. 2002;62:338–340. Guan B, Pungaliya P, Li X, et al. Ubiquitination by TOPORS regulates the prostate tumor suppressor NKX3.1. J Biol Chem. 2008;283:4834–4840. Li X, Guan B, Maghami S, et al. NKX3.1 is regulated by protein kinase CK2 in prostate tumor cells. Mol Cell Biol. 2006;26:3008– 3017. Wang SI, Parsons R, Ittmann M. Homozygous deletion of the PTEN tumor suppressor gene in a subset of prostate adenocarcinomas. Clin Cancer Res. 1998;4:811–815. Di Cristofano A, Pandolfi PP. The multiple roles of PTEN in tumor suppression. Cell. 2000;100:387–390. Maehama T, Dixon JE. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem. 1998;273:13375–13378. Majumder PK, Sellers WR. Akt-regulated pathways in prostate cancer. Oncogene. 2005;24:7465–7474. Myers MP, Stolarov JP, Eng C, et al. P-TEN, the tumor suppressor from human chromosome 10q23, is a dual-specificity phosphatase. Proc Natl Acad Sci USA. 1997;94:9052–9057. Feilotter HE, Nagai MA, Boag AH, et al. Analysis of PTEN and the 10q23 region in primary prostate carcinomas. Oncogene. 1998;16:1743–1748. Hermans KG, van Alewijk DC, Veltman JA, et al. Loss of a small region around the PTEN locus is a major chromosome 10 alteration in prostate cancer xenografts and cell lines. Genes Chromosomes Cancer. 2004;39:171–184. Muller M, Rink K, Krause H, et al. PTEN/MMAC1 mutations in prostate cancer. Prostate Cancer Prostatic Dis. 2000;3:S32. Ratnacaram CK, Teletin M, Jiang M, et al. Temporally controlled ablation of PTEN in adult mouse prostate epithelium generates a model of invasive prostatic adenocarcinoma. Proc Natl Acad Sci USA. 2008;105:2521–2526.

497

Part IV


88. Wang S, Gao J, Lei Q, et al. Prostate-specific deletion of the murine PTEN tumor suppressor gene leads to metastatic prostate cancer. Cancer Cell. 2003;4:209–221. 89. Abate-Shen C, Banach-Petrosky WA, Sun X, et al. NKX3.1; PTEN mutant mice develop invasive prostate adenocarcinoma and lymph node metastases. Cancer Res. 2003;63:3886–3890. 90. Gao H, Ouyang X, Banach-Petrosky WA, et al. Emergence of androgen independence at early stages of prostate cancer progression in NKX3.1; PTEN mice. Cancer Res. 2006;66:7929–7933. 91. Kim MJ, Cardiff RD, Desai N, et al. Cooperativity of NKX3.1 and PTEN loss of function in a mouse model of prostate carcinogenesis. Proc Natl Acad Sci USA. 2002;99:2884–2889. 92. Prescott J, Coetzee GA. Molecular chaperones throughout the life cycle of the androgen receptor. Cancer Lett. 2006;231:12–19. 93. Ruizeveld de Winter JA. Immunocytochemical localization of androgen receptor with polyclonal antibody in paraffinembedded human tissues. J Histochem Cytochem. 1994;42:125– 126. 94. Dehm SM, Tindall DJ. Ligand-independent androgen receptor activity is activation function-2-independent and resistant to antiandrogens in androgen refractory prostate cancer cells. J Biol Chem. 2006;281:27882–27893. 95. Visakorpi T, Hyytinen E, Koivisto P, et al. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat Genet. 1995;9:401–406. 96. Kaarbo M, Klokk TI, Saatcioglu F. Androgen signaling and its interactions with other signaling pathways in prostate cancer. Bioessays. 2007;29:1227–1238. 97. Wang Y, Kreisberg JI, Ghosh PM. Cross-talk between the androgen receptor and the phosphatidylinositol 3-kinase/Akt pathway in prostate cancer. Curr Cancer Drug Targets. 2007;7:591–604. 98. Petrovics G, Liu A, Shaheduzzaman S, et al. Frequent overexpression of ETS-related gene-1 (ERG1) in prostate cancer transcriptome. Oncogene. 2005;24:3847–3852. 99. Tomlins SA, Rhodes DR, Perner S, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005;310:644–648. 100. Attard G, Clark J, Ambroisine L, et al. Duplication of the fusion of TMPRSS2 to ERG sequences identifies fatal human prostate cancer. Oncogene. 2008;27:253–263. 101. Demichelis F, Fall K, Perner S, et al. TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort. Oncogene. 2007;26:4596–4599. 102. Lapointe J, Kim YH, Miller MA, et al. A variant TMPRSS2 isoform and ERG fusion product in prostate cancer with implications for molecular diagnosis. Mod Pathol. 2007;20:467–473. 103. Mehra R, Tomlins SA, Shen R, et al. Comprehensive assessment of TMPRSS2 and ETS family gene aberrations in clinically localized prostate cancer. Mod Pathol. 2007;20:538–544. 104. Nam RK, Sugar L, Yang W, et al. Expression of the TMPRSS2: ERG fusion gene predicts cancer recurrence after surgery for localised prostate cancer. Br J Cancer. 2007;97:1690–1695. 105. Wang J, Cai Y, Ren C, et al. Expression of variant TMPRSS2/ ERG fusion messenger RNAs is associated with aggressive prostate cancer. Cancer Res. 2006;66:8347–8351. 106. Winnes M, Lissbrant E, Damber JE, et al. Molecular genetic analyses of the TMPRSS2–ERG and TMPRSS2–ETV1 gene fusions in 50 cases of prostate cancer. Oncol Rep. 2007; 17:1033–1036. 107. Mosquera JM, Perner S, Genega EM, et al. Characterization of TMPRSS2–ERG fusion high-grade prostatic intraepithelial neoplasia and potential clinical implications. Clin Cancer Res. 2008;14:3380–3385. 108. Perner S, Mosquera JM, Demichelis F, et al. TMPRSS2–ERG fusion prostate cancer: An early molecular event associated with invasion. Am J Surg Pathol. 2007;31:882–888. 109. Klezovitch O, Risk M, Coleman I, et al. A causal role for ERG in neoplastic transformation of prostate epithelium. Proc Natl Acad Sci USA. 2008;105:2105–2110. 110. Tomlins SA, Laxman B, Varambally S, et al. Role of the TMPRSS2–ERG gene fusion in prostate cancer. Neoplasia. 2008;10:177–188. 111. Denicourt C, Dowdy SF. Cip/Kip proteins: More than just CDKs inhibitors. Genes Dev. 2004;18:851–855.

498

112. Ferrando AA, Balbin M, Pendas AM, et al. Mutational analysis of the human cyclin-dependent kinase inhibitor p27kip1 in primary breast carcinomas. Hum Genet. 1996;97:91–94. 113. Guo Y, Sklar GN, Borkowski A, et al. Loss of the cyclin-dependent kinase inhibitor p27(Kip1) protein in human prostate cancer correlates with tumor grade. Clin Cancer Res. 1997;3:2269–2274. 114. Kawamata N, Seriu T, Koeffler HP, et al. Molecular analysis of the cyclin-dependent kinase inhibitor family: p16(CDKN2/ MTS1/INK4A), p18(INK4C) and p27(Kip1) genes in neuroblastomas. Cancer. 1996;77:570–575. 115. Ponce-Castaneda MV, Lee MH, Latres E, et al. p27kip1: Chromosomal mapping to 12p12-12p13.1 and absence of mutations in human tumors. Cancer Res. 1995;55:1211–1214. 116. De Marzo AM, Meeker AK, Epstein JI, et al. Prostate stem cell compartments: Expression of the cell cycle inhibitor p27kip1 in normal, hyperplastic, and neoplastic cells. Am J Pathol. 1998;153:911–919. 117. Cordon-Cardo C, Koff A, Drobnjak M, et al. Distinct altered patterns of p27kip1 gene expression in benign prostatic hyperplasia and prostatic carcinoma. J Natl Cancer Inst. 1998;90:1284– 1291. 118. Fernandez PL, Arce Y, Farre X, et al. Expression of p27/Kip1 is down-regulated in human prostate carcinoma progression. J Pathol. 1999;187:563–566. 119. Yang RM, Naitoh J, Murphy M, et al. Low p27 expression predicts poor disease-free survival in patients with prostate cancer. J Urol. 1998;159:941–945. 120. Kato JY, Matsuoka M, Polyak K, et al. Cyclic AMP-induced G1 phase arrest mediated by an inhibitor (p27kip1) of cyclindependent kinase 4 activation. Cell. 1994;79:487–496. 121. Sanchez-Beato M, Saez AI, Martinez-Montero JC, et al. Cyclindependent kinase inhibitor p27kip1 in lymphoid tissue: p27kip1 expression is inversely proportional to the proliferative index. Am J Pathol. 1997;151:151–160. 122. Tsihlias J, Kapusta LR, DeBoer G, et al. Loss of cyclindependent kinase inhibitor p27kip1 is a novel prognostic factor in localized human prostate adenocarcinoma. Cancer Res. 1998;58:542–548. 123. Gary B, Azuero R, Mohanty GS, et al. Interaction of NKX3.1 and p27kip1 in prostate tumor initiation. Am J Pathol. 2004; 164:1607–1614. 124. Fero ML, Randel E, Gurley KE, et al. The murine gene p27kip1 is haplo-insufficient for tumour suppression. Nature. 1998;396:177–180. 125. Di Cristofano A, De Acetis M, Koff A, et al. PTEN and p27kip1 cooperate in prostate cancer tumor suppression in the mouse. Nat Genet. 2001;27:222–224. 126. Gao H, Ouyang X, Banach-Petrosky W, et al. A critical role for p27kip1 gene dosage in a mouse model of prostate carcinogenesis. Proc Natl Acad Sci USA. 2004;101:17204–17209. 127. Blackburn EH. Structure and function of telomeres. Nature. 1991;350:569–573. 128. Artandi SE, Chang S, Lee SL, et al. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature. 2000;406:641–645. 129. Meeker AK. Telomeres and telomerase in prostatic intraepithelial neoplasia and prostate cancer biology. Urol Oncol. 2006;24:122–130. 130. Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–297. 131. Meister G, Tuschl T. Mechanisms of gene silencing by doublestranded RNA. Nature. 2004;431:343–349. 132. Sontheimer EJ. Assembly and function of RNA silencing complexes. Nat Rev Mol Cell Biol. 2005;6:127–138. 133. Wiemer EA. The role of microRNAs in cancer: No small matter. Eur J Cancer. 2007;43:1529–1544. 134. Lu J, Getz G, Miska EA, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435:834–838. 135. Ozen M, Creighton CJ, Ozdemir M, et al. Widespread deregulation of microRNA expression in human prostate cancer. Oncogene. 2008;27:1788–1793. 136. Porkka KP, Pfeiffer MJ, Waltering KK, et al. MicroRNA expression profiling in prostate cancer. Cancer Res. 2007;67:6130– 6135.

Chapter 24


137. Lee WH, Morton RA, Epstein JI, et al. Cytidine methylation of regulatory sequences near the pi-class glutathione S-transferase gene accompanies human prostatic carcinogenesis. Proc Natl Acad Sci USA. 1994;91:11733–11737. 138. Nelson CP, Kidd LC, Sauvageot J, et al. Protection against 2-hydroxyamino-1-methyl-6-phenylimidazo[4,5-b]pyridine cytotoxicity and DNA adduct formation in human prostate by glutathione S-transferase P1. Cancer Res. 2001;61:103–109. 139. Shirai T, Sano M, Tamano S, et al. The prostate: A target for carcinogenicity of 2-amino-1-methyl-6-phenylimidazo[4,5-b] pyridine (PhIP) derived from cooked foods. Cancer Res. 1997;57:195–198. 140. Henrique R, Ribeiro FR, Fonseca D, et al. High promoter methylation levels of APC predict poor prognosis in sextant biopsies from prostate cancer patients. Clin Cancer Res. 2007;13:6122– 6129. 141. Jeronimo C, Henrique R, Hoque MO, et al. A quantitative promoter methylation profile of prostate cancer. Clin Cancer Res. 2004;10:8472–8478. 142. Yegnasubramanian S, Kowalski J, Gonzalgo ML, et al. Hypermethylation of CpG islands in primary and metastatic human prostate cancer. Cancer Res. 2004;64:1975–1986. 143. Yardy GW, Brewster SF. Wnt signalling and prostate cancer. Prostate Cancer Prostatic Dis. 2005;8:119–126. 144. Bruxvoort KJ, Charbonneau HM, Giambernardi TA, et al. Inactivation of Apc in the mouse prostate causes prostate carcinoma. Cancer Res. 2007;67:2490–2496. 145. Roupret M, Hupertan V, Catto JW, et al. Promoter hypermethylation in circulating blood cells identifies prostate cancer progression. Int J Cancer. 2008;122:952–956. 146. Roupret M, Hupertan V, Yates DR, et al. Molecular detection of localized prostate cancer using quantitative methylationspecific PCR on urinary cells obtained following prostate massage. Clin Cancer Res. 2007;13:1720–1725. 147. Pienta KJ, Abate-Shen C, Agus DB, et al. The current state of preclinical prostate cancer animal models. Prostate. 2008;68:629–639. 148. Kasper S. Survey of genetically engineered mouse models for prostate cancer: Analyzing the molecular basis of prostate cancer development, progression, and metastasis. J Cell Biochem. 2005;94:279–297. 149. Gingrich JR, Barrios RJ, Morton RA, et al. Metastatic prostate cancer in a transgenic mouse. Cancer Res. 1996;56:4096–4102. 150. Greenberg NM, DeMayo F, Finegold MJ, et al. Prostate cancer in a transgenic mouse. Proc Natl Acad Sci USA. 1995;92:3439–3443. 151. Tilley WD, Buchanan G, Hickey TE, et al. Mutations in the androgen receptor gene are associated with progression of human prostate cancer to androgen independence. Clin Cancer Res. 1996;2:277–285. 152. Han G, Foster BA, Mistry S, et al. Hormone status selects for spontaneous somatic androgen receptor variants that demonstrate specific ligand and cofactor dependent activities in autochthonous prostate cancer. J Biol Chem. 2001;276:11204– 11213. 153. Bethel CR, Bieberich CJ. Loss of NKX3.1 expression in the transgenic adenocarcinoma of mouse prostate model. Prostate. 2007;67:1740–1750. 154. Dubey P, Wu H, Reiter RE, et al. Alternative pathways to prostate carcinoma activate prostate stem cell antigen expression. Cancer Res. 2001;61:3256–3261. 155. Kaplan PJ, Mohan S, Cohen P, et al. The insulin-like growth factor axis and prostate cancer: Lessons from the transgenic adenocarcinoma of mouse prostate (TRAMP) model. Cancer Res. 1999;59:2203–2209. 156. Chiaverotti T, Couto SS, Donjacour A, et al. Dissociation of epithelial and neuroendocrine carcinoma lineages in the transgenic adenocarcinoma of mouse prostate model of prostate cancer. Am J Pathol. 2008;172:236–246. 157. Huss WJ, Gray DR, Tavakoli K, et al. Origin of androgeninsensitive poorly differentiated tumors in the transgenic adenocarcinoma of mouse prostate model. Neoplasia. 2007;9:938– 950. 158. Roudier MP, True LD, Higano CS, et al. Phenotypic heterogeneity of end-stage prostate carcinoma metastatic to bone. Hum Pathol. 2003;34:646–653.

159. Shah RB, Mehra R, Chinnaiyan AM, et al. Androgen-independent prostate cancer is a heterogeneous group of diseases: Lessons from a rapid autopsy program. Cancer Res. 2004;64:9209–9216. 160. Kasper S, Smith JA, Jr. Genetically modified mice and their use in developing therapeutic strategies for prostate cancer. J Urol. 2004;172:12–19. 161. Park JH, Walls JE, Galvez JJ, et al. Prostatic intraepithelial neoplasia in genetically engineered mice. Am J Pathol. 2002; 161:727–735. 162. Roy-Burman P, Wu H, Powell WC, et al. Genetically defined mouse models that mimic natural aspects of human prostate cancer development. Endocr Relat Cancer. 2004;11:225–254. 163. Shappell SB, Thomas GV, Roberts RL, et al. Prostate pathology of genetically engineered mice: Definitions and classification. The consensus report from the Bar Harbor meeting of the Mouse Models of Human Cancer Consortium Prostate Pathology Committee. Cancer Res. 2004;64:2270–2305. 164. Lesche R, Groszer M, Gao J, et al. Cre/loxP-mediated inactivation of the murine PTEN tumor suppressor gene. Genesis. 2002;32:148–149. 165. Wu X, Wu J, Huang J, et al. Generation of a prostate epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation. Mech Dev. 2001;101:61–69. 166. Freeman DJ, Li AG, Wei G, et al. PTEN tumor suppressor regulates p53 protein levels and activity through phosphatasedependent and -independent mechanisms. Cancer Cell. 2003;3:117–130. 167. Stambolic V, MacPherson D, Sas D, et al. Regulation of PTEN transcription by p53. Mol Cell. 2001;8:317–325. 168. Salmena L, Carracedo A, Pandolfi PP. Tenets of PTEN tumor suppression. Cell. 2008;133:403–414. 169. Chen Z, Trotman LC, Shaffer D, et al. Crucial role of p53dependent cellular senescence in suppression of PTENdeficient tumorigenesis. Nature. 2005;436:725–730. 170. Shibata H, Toyama K, Shioya H, et al. Rapid colorectal adenoma formation initiated by conditional targeting of the Apc gene. Science. 1997;278:120–123. 171. Terry S, Yang X, Chen MW, et al. Multifaceted interaction between the androgen and Wnt signaling pathways and the implication for prostate cancer. J Cell Biochem. 2006;99:402–410. 172. Truica CI, Byers S, Gelmann EP. Beta-catenin affects androgen receptor transcriptional activity and ligand specificity. Cancer Res. 2000;60:4709–4713. 173. Willert K, Jones KA. Wnt signaling: Is the party in the nucleus? Genes Dev. 2006;20:1394–1404. 174. Brooks JD, Bova GS, Isaacs WB. Allelic loss of the retinoblastoma gene in primary human prostatic adenocarcinomas. Prostate. 1995;26:35–39. 175. Ittmann MM, Wieczorek R. Alterations of the retinoblastoma gene in clinically localized, stage B prostate adenocarcinomas. Hum Pathol. 1996;27:28–34. 176. Phillips SM, Morton DG, Lee SJ, et al. Loss of heterozygosity of the retinoblastoma and adenomatous polyposis susceptibility gene loci and in chromosomes 10p, 10q and 16q in human prostate cancer. Br J Urol. 1994;73:390–395. 177. Tricoli JV, Gumerlock PH, Yao JL, et al. Alterations of the retinoblastoma gene in human prostate adenocarcinoma. Genes Chromosomes Cancer. 1996;15:108–114. 178. Hill R, Song Y, Cardiff RD, et al. Heterogeneous tumor evolution initiated by loss of pRb function in a preclinical prostate cancer model. Cancer Res. 2005;65:10243–10254. 179. Zhang X, Lee C, Ng PY, et al. Prostatic neoplasia in transgenic mice with prostate-directed overexpression of the c-Myc oncoprotein. Prostate. 2000;43:278–285. 180. Ellwood-Yen K, Graeber TG, Wongvipat J, et al. Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell. 2003;4:223–238. 181. Stanbrough M, Bubley GJ, Ross K, et al. Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer. Cancer Res. 2006; 66:2815–2825. 182. Stanbrough M, Leav I, Kwan PW, et al. Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proc Natl Acad Sci USA. 2001;98:10823– 10828.

499

Part IV


183. Han G, Buchanan G, Ittmann M, et al. Mutation of the androgen receptor causes oncogenic transformation of the prostate. Proc Natl Acad Sci USA. 2005;102:1151–1156. 184. Wu Q, Parry G. Hepsin and prostate cancer. Front Biosci. 2007;12:5052–5059. 185. Riddick AC, Shukla CJ, Pennington CJ, et al. Identification of degradome components associated with prostate cancer progression by expression analysis of human prostatic tissues. Br J Cancer. 2005;92:2171–2180. 186. Stamey TA, Warrington JA, Caldwell MC, et al. Molecular genetic profiling of Gleason grade 4/5 prostate cancers compared to benign prostatic hyperplasia. J Urol. 2001;166:2171– 2177. 187. Stephan C, Yousef GM, Scorilas A, et al. Hepsin is highly over expressed in and a new candidate for a prognostic indicator in prostate cancer. J Urol. 2004;171:187–191.

500

188. Xuan JA, Schneider D, Toy P, et al. Antibodies neutralizing hepsin protease activity do not impact cell growth but inhibit invasion of prostate and ovarian tumor cells in culture. Cancer Res. 2006;66:3611–3619. 189. Fromont G, Chene L, Vidaud M, et al. Differential expression of 37 selected genes in hormone-refractory prostate cancer using quantitative taqman real-time RT-PCR. Int J Cancer. 2005;114:174–181. 190. Klezovitch O, Chevillet J, Mirosevich J, et al. Hepsin promotes prostate cancer progression and metastasis. Cancer Cell. 2004;6:185–195. 191. Kasper S, Sheppard PC, Yan Y, et al. Development, progression, and androgen-dependence of prostate tumors in probasin-large T antigen transgenic mice: A model for prostate cancer. Lab Invest. 1998;78:i–xv.

C h a p t e r

25 Molecular Biology of Breast Cancer Natasa Snoj Phuong Dinh Christos Sotiriou n

n

Philippe Bedard

n

INTRODUCTION

Histopathological Features of Breast Cancer

Breast cancer is the most common cancer among women with a yearly incidence of 109.8 per 100,000 individuals. It is also the second leading cause of cancer-related death [1]. Since the late 1980s, breast cancer-related deaths have significantly declined, partly due to screening and prevention and partly due to improvements in systemic therapy. With the widespread implementation of screening programs, the increasing frequency of screen-detected invasive cancers and noninvasive lesions has shifted the profile of tumor characteristics seen in breast cancer today toward smaller tumors. Furthermore, breast cancer is increasingly being recognized as a biologically heterogeneous disease entity, with distinct subtypes demonstrating different natural history and clinical outcomes. Many of these differences are attributable to the heterogeneity that exists at the molecular level, and as a result, the discovery and development of molecular markers have recently taken center stage. These markers are being investigated for their potential to serve as better predictors of prognosis and response to treatment. Clinically useful biomarkers that can better select patients for tailored clinical trials, according to molecular characteristics, can ultimately lead to individualized treatment for breast cancer patients.

The histopathological features of breast cancer are the foundation of traditional breast cancer pathology. They consist of (i) histological type, (ii) grade, and (iii) vascular invasion. Histopathological features provide clinicians with essential information for decision making regarding prognosis and treatment.

TRADITIONAL BREAST CANCER CLASSIFICATION Breast cancer has traditionally been classified according to histopathological type, with its anatomical extent is reflected by the TNM classification. For many years, this breast cancer classification was the only tool available to asses the risk of relapse after local therapy and to base decisions on whether or not chemotherapy should be given. Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

Histological Type In the past, breast cancer was divided into lobular and ductal carcinoma according to the common belief that lobular carcinomas emanated from the lobules and ductal carcinomas from the ducts. Today, after demonstration that most breast cancers arise from the same location—the terminal duct lobular unit— these histomorphological differences are regarded as a manifestation of their distinct molecular profiles. The predominant type of breast cancer is ductal carcinoma in situ (DCIS). Some breast lesions not classified as breast cancer are also described here, as they are closely related to breast cancer in terms of histopathology, in their expression of molecular markers, and in their clinical presentation. Lobular Neoplasia. Lobular neoplasia can be classified as (i) lobular intraepithelial neoplasia, (ii) lobular carcinoma in situ, and (iii) invasive lobular carcinoma. Lobular intraepithelial neoplasia and lobular carcinoma are commonly named in situ lobular neoplasia. Lobular neoplasia (in situ lobular neoplasia and invasive lobular carcinoma) is characterized by a population of small aberrant cells with small nuclei, individual private acini, and a lack of cohesion between cells [2]. The distinctive molecular feature of lobular neoplasia (in situ and invasive) is the loss of E-cadherin (CDH1) which can be demonstrated by immunohistochemistry. Since ductal carcinomas can also be E-cadherin negative, it should 501

Part IV


not be considered pathognomic for lobular neoplasia. Other molecular characteristics of lobular carcinomas are epidermal growth factor receptor 1 (EGFR-1) and HER-2 negativity; and positivity for antibody 34b E12 (cytokeratins 1, 5, 10, and 14), ER, and PR. These markers, while helpful, are also not pathognomic, with the pleomorphic variant often described as ER, PR negative, and HER-2 positive. Therefore, such molecular markers, while able to add an extra level of diagnostic information, still need to be correlated with the classical histopathological findings. The diagnosis of in situ lobular neoplasia is often made following surgical excision of a suspicious nodule. It is often bilateral and in 50%–70% of cases is multicentric. There is a high frequency (10%–15% over a 10 year period and lifetime risk of up to 50%) of subsequent invasive ductal carcinoma in patients with a prior in situ lobular neoplasia, for reasons that are not well understood. Invasive lobular carcinoma is the second most common invasive breast cancer and represents 10%–20% of all invasive breast cancers. Ductal Carcinoma in situ. DCIS is characterized by the proliferation of malignant cells within the ducts without invasion of the surrounding stromal tissue. The European Organisation for Research and Treatment of Cancer (EORTC) grading system, based on cytonuclear pattern, distinguishes well-differentiated from intermediately-differentiated and poorly differentiated DCIS. For the purpose of screening programs, this has been modified into groups based on low, intermediate, and high grade. Compared with normal epithelium, the potential of growth of DCIS is 10 times greater, and its apoptosis rate is increased 15-fold. Comedo type DCIS is typically necrotic in the center of the ducts and has a higher risk of recurrence. Most ductal carcinomas are diffusely positive for luminal cell markers (CK8, CK18, CK19), but negative for basal cell markers (CK5/6 and CK14) [3]. In contrast, benign ductal hyperplasia may show a mosaic staining pattern for any of these markers, indicating a heterogeneous underlying cell population. DCIS is multifocal in 30% of the cases, often in the same breast. In 2%–6% of cases, axillary lymph node invasion is found at pathological examination, and this is thought to occur as a result of an unidentified invasive component. In the era of widespread mammographic screening, DCIS is more frequently detected and represents 25% of screen-detected breast cancers [4]. The treatment of DCIS is based on the extent of disease within the breast [5]. In patients with extensive or multifocal DCIS, mastectomy with sentinel node biopsy is indicated, with the possibility of reconstruction. Sentinel lymph node biopsy is also indicated when microinvasion is found within DCIS. If breastconserving surgery is undertaken, additional local irradiation has documented benefit in terms of lowering the incidence of subsequent noninvasive relapse and the progression to frankly invasive disease. Those patients with estrogen receptor positive DCIS may also benefit from adjuvant systemic treatment with 502

tamoxifen in addition to radiotherapy after breast-conserving surgery [6]. However, our understanding of the biology of DCIS remains crude, and further clinical trials are necessary to optimize local and systemic treatment modalities. Invasive Ductal Carcinoma. Invasive ductal carcinoma is the most common invasive carcinoma of the breast, as it represents roughly 70% of all cases. Invasive lobular carcinoma is the second most common histopathological type representing 10%–20% of all breast malignancies. The other 10%–20% consists mostly of (i) medullary carcinoma (characterized by sharp tumor borders and lymphoid infiltration), (ii) mucoid carcinoma (with large amounts of extracellular mucous), (iii) papillary carcinoma (with well-differentiated papillary structure), and (iv) inflammatory carcinoma which occurs in 1%–2% of all cases. Inflammatory carcinomas typically mimic the clinical presentation of benign inflammatory disease although, histologically, they are characterized by extensive invasion of the lymphatic vessels within the dermis. Other types of rare invasive breast cancer include (i) adenoid cystic carcinoma, (ii) apocrine carcinoma, and (iii) carcinoma with squamous metaplasia. Another distinct histopathological entity of breast cancer is Paget’s disease of the nipple. It is a variant of DCIS, where malignant cells infiltrate the ducts without invasion of the baseline membrane and extend to the major ducts of the nipple and the epidermis of the areola. An invasive component is present in proximally 90% of all cases. There are other malignant diseases of the breast that can resemble breast cancer, including phyllodes tumor, sarcoma, and malignant lymphoma. Often the distinction between invasive and noninvasive carcinoma is difficult, as carcinoma cells can be found in both lesions and there are no reliable markers that differentiate between invasive and noninvasive cells. E-cadherin is often helpful in distinguishing malignant disease, as it is mostly positive in ductal carcinomas, but negative in lobular carcinomas. Invasive ductal carcinoma may express a variety of markers that have been extensively evaluated. Other breast lesions, such as benign papillomas, are characterized by the expression of myoepithelial markers (alpha-SMA, myosin, calponin, p63, CD10), although myoepithelial markers may also be present in intraductal papillary carcinomas. Preservation of the myoepithelial layer is the distinguishing characteristic of benign sclerosing lesions, including carcinoma with pseudoinvasive structures. Given their overlapping molecular profiles, comparison with histopathological findings using hematoxylin and eosin is essential to make proper diagnosis.

Vascular Invasion The term vascular invasion refers to the invasion of lymphatic and blood vessels with tumor cells. It is assessed in hematoxylin-eosin stained slides. Lymphovascular invasion is routinely included in the

Chapter 25

pathological evaluation and reporting of all breast cancers, although its interpretation is often difficult. In breast cancer, vascular invasion is a poor prognostic factor and predicts for increased local failure and reduced overall survival [7]. Whether lymphatic or hematogenous invasion plays a more dominant role in prognosis determination is still unknown [8]. Lymphovascular invasion by tumor cells is found in approximately 15% of invasive ductal carcinoma of the breast and is present in 10% of tumors without axillary lymph node invasion.

Perineural Invasion The independent prognostic significance of perineural invasion is not clear, as it has only been assessed in combination with lymphovascular invasion [9].

Histological Grading The histological grading of malignancy is the classical evaluation method for prognostication in breast cancer patients, and it is the simplest method, requiring only hematoxylin-eosin staining. Histological grading of breast cancer typically consists of three factors: tubule formation, mitotic count, and nuclear atypia. These three factors are all important in identifying patients at high risk of recurrence, although the relative importance of each feature is unclear. In addition, intratumoral heterogeneity and interobserver variation add to the difficulty of accurate prognostication based upon grading. In a review of the prognostic significance of histological grading, only nuclear atypia was correlated with the rate of recurrence [10]. A grading system consisting of mitotic count and nuclear atypia (without tubule formation) was more strongly related to the risk of recurrence than a system using all three factors. Therefore, tubule formation is often excluded from the overall grading system even though it has the lowest heterogeneity within the primary tumor, compared with the other two. Cells in the mitotic phase can be counted using light microscopy. However, the duration of mitotic phase is often variable, especially in aneuploid tumors, so the number of mitoses is not linearly correlated with cellular proliferation. The recommendation for standardized counting of the mitotic activity index (MAI) includes assessment at 400 magnification in an area of 1.6 mm2 in the highest proliferative invasive area at the periphery of the tumor [11]. MAI is not affected by fixation delay, it may impair morphological assessment. Ideally, mitoses should be counted before chemotherapy, but the mitotic index retains prognostic value even after chemotherapy. Mitoses should preferably be counted on excisional biopsies or mastectomies to avoid sampling error. Often underestimated in core biopsies, the MAI has a limited role in the decision of whether neoadjuvant chemotherapy should be given or not. Nonetheless, in several retrospective and prospective studies, the MAI has proven to be a very strong, independent

Molecular Biology of Breast Cancer

prognostic factor and, subsequently, is regarded as a category I prognostic factor for breast cancer by the College of American Pathologists.

TNM Prognosis estimation has traditionally been based on grouping patients according to the anatomical extent of their disease. Incorporating primary tumor size, lymph node involvement, and distant metastases the TNM system combines these three factors into a stage grouping, with clinical and pathological variants. The TNM system is the most widely used tumor staging system [12], adopted by both the Union International Contre le Cancer (UICC) and the American Joint Committee (AJC). Although still clinically relevant, this system has limitations because it does not incorporate other important biological features that can influence the overall prognosis of the patient. Other important biological features include steroid hormone receptor content, HER-2 overexpression, tumor grade, indices of tumor proliferation, the presence or absence of vascular or lymphatic vessel invasion [13].

BIOMARKERS Molecular analyses of cancer have led to the discovery of oncogenes and tumor suppressor genes. In practice, pathologists look for protein products (biomarkers) of the genes mainly through immunohistochemistry or immunocytochemistry. Biomarkers are potentially helpful in distinguishing between various histopathological types of breast cancer, as well as in assessing prognosis and predicting for a response to specific systemic therapy. Biomarkers typically have continuous values, and cutoff points are arbitrarily established used to simplify the clinical decision-making. An important requirement for a cutoff point in this context is that it should not identify too large or too small a subset of patients for further therapy, as this would lead to overtreatment of one group and undertreatment of the other group.

Estrogen Receptor Estrogen receptors (ER) are members of a large family of nuclear transcriptional regulators that are activated by steroid hormones, such as estrogen [14]. ERs exist as two isoforms, a and b, that are encoded by two different genes [15]. Although both isoforms are expressed in the normal mammary gland, it appears that only ER-a is critical for normal gland development [16]. However, there is growing evidence that ER-b may antagonize the function of ER-a, and that high levels of ER-b are associated with a more favorable response to tamoxifen treatment [17]. Most research on the biology of ER has focused on its function as a nuclear transcription factor [classical ER-a function, or nuclear-initiated steroid signaling 503

Part IV


(NISS)], but there is also mounting evidence that estrogen can bind to ER located in or near the plasma membrane to activate other signaling pathways [nongenomic function, or membrane-initiated steroid signaling (MISS)] [18]. With NISS, ER functions as a hormone-regulated nuclear transcription factor that can induce expression of specific genes in the nucleus [19]. Upon estrogen ligand binding, ER binds to estrogen response elements (ERE) in target genes, recruits a coregulator complex, and regulates specific gene transcription [20]. This ER action is controlled by a number of coregulatory proteins, termed coactivators and corepressors, that recruit enzymes to modulate chromatin structure to facilitate or repress gene transcription [21,22]. It has been postulated that the cellular environment of coregulators may indeed influence whether selective estrogen receptor modulators (SERMS) are agonistic or antagonistic in action [23,24]. Whether levels of coregulators are associated with prognosis and hormone resistance in breast cancer is unknown, but has been the focus of several studies [21,25]. Estrogen can therefore affect many processes, such as cell proliferation, the inhibition of apoptosis, invasion, and angiogenesis. Indeed, c-Myc, vascular endothelial growth factor, bcl-2, insulin-like growth factor (IGF-1), insulin receptor substrate-1, transforming growth factor-a, cyclin-D1, and IGF-2 have all been shown to be regulated by estrogen [26–30]. It has long been recognized that estrogen is also capable of inducing other cellular effects with a much more rapid onset than would be possible via changes imposed by gene transcription through NISS [31]. Such nongenomic effects have been attributed to MISS, involving membrane-bound or cytoplasmic ER. Indeed, ER has been localized outside of the nucleus by biochemical analyses and by direct visualization using immunocytochemistry or more sophisticated microscopy [32,33]. In fact, non-nuclear ER has been shown to exist in complexes with such signaling molecules as the IGF-1 receptor (IGF-1R) [34] and the p85 subunit of phosphatidylinositol-3-OH kinase [35]. While these membrane and non-nuclear ER functions have been well described in experimental model systems, they must still be confirmed in clinical breast cancer.

Targeting the ER—Tamoxifen Therapy There is a significant body of evidence to suggest that steroid hormones, particularly estrogen, play a major role in the development of breast cancer. Approximately 75% of all breast cancers express estrogen receptors (ERþ) [36]. ER expression has a high negative predictive value but a suboptimal positive predictive value for the efficacy of endocrine manipulation. Patients with ER negative (ER) tumors derive no benefit from endocrine therapy, while for ERþ tumors, estrogen signaling blockade is an important therapeutic strategy that can lead to improved outcomes, including increasing cure rates in early breast cancer, improving response rates and disease control 504

in advanced disease, and reducing breast cancer incidence with prevention. Tamoxifen is a selective modulator of ER that competitively impedes the binding of estradiol and, in doing so, disrupts a series of mechanisms that regulate cellular replication [37] and proliferation. Tamoxifen has been used in clinical trials since the 1970s, with initial nonselective use across the entire breast cancer population. In these unselected patients, tamoxifen can produce responses of up to 30% [38,39]. In ERþ disease, responses of up to 80% have been observed, while in ER disease, less than 10% may derive benefit [40].

Testing for ER The introduction of routine ER testing in the early 1990s changed the way in which endocrine therapy is prescribed, particularly in preventing unnecessary tamoxifen-related toxicity for patients with ER disease. However, the treatment of individual ERþ patients is less clearcut, largely because of the ambiguity created by varying methodologies and cutoffs employed by different laboratories for ER testing. Indeed, responses have been demonstrated in tumors with as few as 1%–10% of cells positive for ER by immunohistochemistry (IHC) [41]. It is therefore more clinically important to distinguish between ER absent disease from measurable, but low-level ER expression, variably reported as either ERþ or ER, depending on which cutoff values are used. Quantitative ER as a continuous variable has been demonstrated in metastatic studies to be proportionally correlated to the response to hormonal therapy [40]. In the adjuvant setting, a large meta-analysis has shown a similar relationship between tumoral ER expression and tamoxifen efficacy [42], and in the neoadjuvant setting, for tumor response to both tamoxifen and letrozole [43]. Nevertheless, quantitative ER is still an imprecise predictive tool because even tumors in the highest strata of ER-expression can be endocrine-resistant (de novo resistance). Furthermore, a significant proportion of ERþ patients who initially respond to endocrine therapy will eventually fail treatment (acquired resistance). Although this resistance is not fully understood, several mechanisms have been hypothesized to be responsible for the development of resistance, including (i) loss of ER in the tumor, (ii) selection clones with ER mutations, (iii) deregulation of cellcycle components including ER-regulatory proteins, and (iv) cross-talk between ER and other growth factor receptor pathways [44]. Given the limitations of ER assessment, the development of other molecular tools, reflecting the complex biology of these tumors, is needed to improve treatment for patients with ERþ disease.

Progesterone Receptor The progesterone receptor (PR) gene is an estrogenregulated gene. PR mediates the effect of progesterone in the development of the mammary gland and breast cancer [45]. In the 75% of breast cancers that express ER, more than half of these tumors also

Chapter 25

express PR [46]. It has been hypothesized that PR levels in breast cancer may be a marker of an intact ER signal transduction pathway and that PR levels may therefore add independent predictive information. Emerging laboratory and clinical data also suggest that among ERþ tumors, PR status may predict differential sensitivity to antiestrogen therapy. Although the etiology of ERþPR disease some studies have shown that this phenotype may evolve through the loss of PR, while other studies suggest that they reflect a distinct molecular origin [49], with unique epidemiologic risk factors when compared with ERþPRþ disease [50]. Patients with ERþPRþ tumors appear to derive greater benefit from adjuvant tamoxifen than patients with ERþPR tumors, as shown in a retrospective analysis [51]. The same analysis also suggested that loss of PR was predictive of outcome independent of quantitative ER levels. These findings have been observed in other smaller studies [52–56]. Apart from being generally predictive for diminished responsiveness to tamoxifen, absence of PR has also been suggested to be predictive of increased responsiveness to aromatase inhibitors. However, this remains controversial, as there have been conflicting results from retrospective analyses of several large adjuvant aromatase inhibitors studies [57–62]. In particular, the initial report of the ATAC [57] trial suggested a greater benefit from aromatase inhibitors compared to tamoxifen for ERþPR disease based upon local pathology reporting. A subsequent central pathology review of a subset of tumors enrolled in ATAC failed to show a differential benefit for ERþPR disease.

The HER-2 Receptor Following the discovery of ER, HER-2 has more recently emerged as an important molecular target in the treatment of breast cancer. Much of the recent success with anti-HER-2 therapy has been a direct result of being able to properly select the right patient subpopulation for targeted treatment. HER-2 belongs to the human epidermal growth factor receptor family of tyrosine kinases consisting of EGFR (HER-1; erbB1), HER-2 (erbB2, HER-2/neu), HER-3 (erbB3), and HER-4 (erbB4). All of these receptors have an extracellular ligand-binding region, a single membrane-spanning region, and a cytoplasmic tyrosinekinase-containing domain. This intracellular kinase domain is non-function in HER-3. Ligand binding to the extracellular region results in homodimer and heterodimer activation of the cytoplasmic kinase domain and phosphorylation of a specific tyrosine kinase [62]. This leads to the activation of various intracellular signaling pathways, such as the mitogen-activated protein kinase (MAPK) and the phosphatidylinositol 3-kinase (P13K)-AKT pathways [63] involved in cell proliferation and survival. HER signaling can become dysregulated via a number of mechanisms [64], including overexpression of a ligand; overexpression of the normal HER receptor;


overexpression of a constitutively activated, mutation of the HER receptor; and defective HER receptor internalization, recycling, or degradation. HER-2 was first identified as an oncogene activated by a point mutation in chemically induced rat neuroblastomas [65]. Soon afterward, it was found to be amplified in breast cancer cell lines [66]. Early studies suggested that as many as 30% of breast cancers demonstrate HER-2 overexpression, which is associated with a more aggressive phenotype and a poorer disease-free survival [67–70]. Furthermore, HER-2 positivity appears to be associated with a relative, but not an absolute, resistance to endocrine therapy [71] and resistance to certain chemotherapeutic agents [72–74]. Most importantly, HER-2 status is predictive for benefit from anti-HER-2 therapies, such as trastuzumab.

Identifying the HER-2 Receptor For the various reasons described above, the accurate determination of HER-2 status is vitally important because it is such a useful marker for therapeutic decision making. Currently, two different methods of determining for HER-2 are routinely available: (i) immunohistochemistry (IHC) and (ii) fluorescence in situ hybridization (FISH). IHC is a semiquantitative method that identifies HER-2 receptor expression on the cell surface using a grading system (0, 1þ, 2þ, and 3þ), where an IHC result of 3þ is regarded as HER-2 overexpression. It is the most widely used technique, performed on paraffin tumor blocks. While fairly easy to perform and relatively low cost, results can vary depending on different fixation protocols, assay methods, scoring systems, as well as the selected antibodies. FISH is a quantitative method measuring the number of copies of the HER-2 gene present in each tumor cell and is reported as either positive or negative. It is a more reproducible test but is comparatively more time-consuming and expensive. Concordance between IHC and FISH has been extensively studied. In a study done by Yaziji et al. [75] conducted in 2963 samples using FISH as the standard method, the positive predictive value of an IHC 3þ result was 91.6%, and the negative predictive value of an IHC 0 or 1þ result was 97.2%. They also found that FISH had a significantly higher failure rate (5% versus 0.08%), was more costly, and required more time for testing (36 versus 4 hours) and interpretation (7 minutes versus 45 seconds) than IHC. Another problem with HER-2 testing is the poor reproducibility between laboratories, even when the same technique is used. When the concordance between local and central evaluation in the NCCTGN9831 adjuvant trastuzumab trial was examined [76], FISH concordance was 88.1% compared to an IHC concordance of 81.6%. This high rate of discordance was attributed to methodologic factors, such as inadequate quality-control procedures. In recognizing the importance of accurate HER2 testing, guidelines from the American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) 505

Part IV


for HER-2 testing have recently been published [77]. In these guidelines, recommendations for HER-2 evaluation are provided using an algorithm for positive, equivocal, and negative results: 1. HER-2 positive—IHC staining of 3þ (uniform, intense membrane staining of >30% of invasive tumor cells, a FISH result of more than 6.0 HER-2 gene copies per nucleus, or a FISH ratio (HER2 gene signals to chromosome 17 signals) of more than 2.2; 2. HER-2 negative—IHC staining of 0 or 1þ FISH result of less than 4.0 HER-2 gene copies per nucleus, or FISH ratio of less than 1.8; and 3. HER-2 equivocal—IHC 3þ staining of 30% or less of invasive tumor cells or 2þ staining, a FISH result of 4 to 6 HER-2 gene copies per nucleus, or FISH ratio between 1.8 to 2.2. Importantly, the Guidelines strongly recommended [77] “validation of laboratory assay or modifications, use of standardized operating procedures, and compliance with new testing criteria to be monitored with the use of stringent laboratory accreditation standards, proficiency testing, and competency assessment.”

adjuvant trastuzumab produced significant benefit in reducing recurrence and mortality. Updated analyses for most of these trials have recently been presented, including that of another small trial PACS-04 [94] which, in contrast, failed to show a benefit for adjuvant trastuzumab for reasons that are not well understood (Table 25.1). Despite differences in patient population and trial design, including chemotherapy regimen, the timing of trastuzumab initiation, and the schedule and duration of trastuzumab administration, remarkly consistent results were reported across these studies: a 33%–58% reduction in the recurrence rate and a 30% reduction in mortality. This degree of benefit in early breast cancer is the largest reported since the introduction of tamoxifen for estrogen receptors positive (ERþ) disease. There are many other novel drugs being developed for use following failure of trastuzumab, either because of de novo or acquired resistance. A particular focus of research is in the dual inhibition of EGFR and HER-2, with promising results using drugs such as lapatinib, pertuzumab, and HKI-272.

Targeting HER-2: Trastuzumab

Proliferative Biomarkers

The HER family of receptors is an ideal target for anticancer therapy. To date, two main therapeutic strategies have been developed to target the HER-2 receptor: monoclonal antibodies and small molecule kinase inhibitors. Trastuzumab (Herceptin; Genentech, South San Francisco) is a recombinant, humanized anti-HER-2 monoclonal antibody and was the first clinically active anti-HER-2 therapy to be developed. Trastuzumab exerts its action through several mechanisms, including (i) induction of receptor downregulation/degradation [78], (ii) prevention of HER-2 ectodomain cleavage [79], (iii) inhibition of HER-2 kinase signal transduction via ADCC [80], and (iv) inhibition of angiogenesis [81]. In metastatic breast cancer (MBC), trastuzumab monotherapy produces response rates ranging from 12% to 34% with a median duration of disease control of 9 months [82,83]. Preclinical studies have also shown additive or synergistic interactions between trastuzumab and multiple cytotoxic agents, including platinum analogues, taxanes, anthracyclines, vinorelbine, gemcitabine, capecitabine, and cyclophosphamide [84]. The use of trastuzumab combined with chemotherapy can further increase response rates (RR), time to progression (TTP), and overall survival (OS) [85,86]. Encouraged by the highly reproducible antitumor activity of trastuzumab in the metastatic setting, four major international studies with enrollment of over 13,000 women were launched in 2000–2001 to investigate the role of trastuzumab in the adjuvant setting: HERA [87,88], the combined North American trials NSABPB31 and NCCTG/N9831 [89,90], and BCIRG 006 [91,92]. In 2005, the initial results of these four trials, alongside a smaller Finnish trial [93], demonstrated that

A high proliferative rate is associated with poor breast cancer survival in untreated patients, but it is also associated with favorable response to chemotherapy [95]. It is still unknown whether some of these proliferative biomarkers also predict better response to specific chemotherapy regimens. Although many proliferative biomarkers are under investigation, none of these are regularly used in clinical practice. The main obstacles lie in the (i) poor standardization of detection methods, (ii) vaguely defined cutoff values, and (iii) requirement for fresh-frozen tissue.

506

Measurement of Cells in S Phase Most studies that used fresh or frozen material with sufficient number of patients found an association between S phase fraction and unfavorable prognosis. But several studies done to assess the prognostic value of DNA flow cytometry lacked standardized procedures, sufficient power, and predefined cutoff values. Moreover, the study populations were not controlled for adjuvant treatment. There is also high intratumor heterogeneity of the S phase fraction [95]. Therefore, it cannot be recommended for routine prognostic assessment [96]. Another disadvantage of this method is that it requires a large quantity of tumor material making it inappropriate for smaller tumors identified through mammographic screening. 3

H-Thymidine Labeling Index

3

H-thymidine labeling index (TLI) was one of the first markers of proliferation used in breast cancer. The number of cells undergoing DNA synthesis is measured by 3H-thymidine uptake using autoradiography for visualization. TLI represents the ratio between the number

Chapter 25

Table 25.1

Local Laboratory Reference Laboratory


Methods of HER-2 Screening in Different Adjuvant Trastuzumab Trials HERA [88, 89]

B-31/N9831 [90, 91]

IHC/FISH 2þ/3þ or FISHþ sent to reference lab IHC for 3þFISH for 2þRepeat FISH for FISHþ

IHC/FISH 3þ or FISHþ sent to reference lab IHC for 3þ FISH for 2þ

of labeled and all counted cells. A similar approach uses IHC technique and halogenated analogue bromodeoxyuridine (BrdU). Limitations of these techniques are the requirement for fresh frozen tissue, the time required to complete the assay, and the use of radioactive tracers [95]. TLI has never been accepted as a standard prognostic marker, although several retrospective studies have shown that it is correlated with poor clinical outcome in terms of relapse-free survival, disease-free survival, distant disease-free survival, and overall survival. Similarly, despite the fact that prospective clinical trials confirmed a benefit for TLI in chemotherapy prediction, it has not been widely adopted in clinical practice [96].

Thymidine Kinase Thymidine kinase (TK) activity is measured by radioenzymatic assay. TK is an enzyme that catalyses the phosphorylation of deoxythymidine to deoxythymidine monophosphate. Its activity is highest in G1-S translation checkpoint and then declines rapidly in the G2 phase of the cell cycle. In breast cancer, the fetal isoform of TK is present in high levels in the cytoplasm and is cell-cycle regulated [95]. Conflicting data exist for its predictive role, and therefore, TK should not be used for this purpose in clinical practice [96].

Ki67 Ki67 is a nuclear antigen present in mid G1, S, G2, and the entire M phase of the cell cycle, characterized by immunohistochemistry. Although it has been extensively studied, its precise cellular function is still unknown. Most of the studies that have investigated the prognostic significance of Ki67 have shown that overexpression of Ki67 correlates with poor metastasesfree survival and overall survival. As with all biomarkers with continuous values, the cutoff value differentiating high Ki67 from low Ki67 tumors is somewhat arbitrary. It has been suggested that the optimal cutoff value for Ki67 is 15% [97]. Nevertheless, routine use of this marker in clinical practice is not recommended because of a lack of adequate reproducibility [96].

MIB1 Similar to Ki67, MIB1 is a nuclear antigen that can be labeled using immunohistochemistry. It can be performed on formalin-fixed and paraffin-embedded

BCIRG 006 [92, 93] No role FISH for all samples

FinHer [94] IHC (any)2þ/3þ sent to reference lab CISH for all samples

blocks. A good correlation between Ki67 and MIB1 assessment has been demonstrated. However, MIB1 is not recommended yet for use in routine clinical practice [95].

Cyclin A Cyclins are proteins that regulate the cell cycle. Consequently, their concentrations rise and fall throughout the cell cycle, as they are synthesized and degraded at specific stages of the cell cycle. Cyclin A is expressed in the late S, G2, and M phases of the cell cycle and has been associated with poor prognosis in some studies. Other studies have failed to confirm this observation, mainly because of the lack of consensus concerning methodology and cutoff values [97].

Cyclin E Cyclin E regulates G1 phase progression and entry into S phase. There are two different proteins, cyclin E1 and cyclin E2, that are coded by two different genes with 47% homology. Several splice variants of cyclin E1 not present in normal cells have been identified and these seem to stimulate cells to progress through the cell cycles more than wild-type cyclin E1. The most frequently used determination method for cyclin E1 is IHC, although western blot allows for assessment of total as well as isoform-specific expression. Cyclin E mRNA can also be measured by reverse transcription polymerase chain reaction (RT-PCR). Elevated levels of both cyclin Es are more frequently found in ER negative tumors. Many retrospective studies have demonstrated an association between high levels of cyclin E and an increased risk of breast cancer-related death, although this finding has not been seen across all the trials. Furthermore, lack of standardization regarding evaluation methods and scoring systems limits its use as a prognostic factor. There is even less evidence for the use of cyclin E as a predictive tool [95].

Cyclin D1 The family of cyclin D consists of at least three different cyclins that regulate progression into G1 phase. The gene CCND1 that codes for the cyclin D1 protein is located on chromosome 11q13. The function of cyclin D1 is to bind to cyclin-dependent kinases (Cdks) 4 and 6 and phosphorylate downstream proteins such 507

Part IV


as pRb. These complexes can sequester Cdk inhibitors (p21 and p27). Cyclin D1 acts as a co-factor for ERa in a ligand-independent manner. The concentration of cyclin D1 in the cell is the highest during mid-G1 phase and then gradually declines. Overexpression of cyclin D1 has been found in many human tumors and is believed to promote cell proliferation and differentiation by shortening the G1/S transition. In breast cancer, amplification of the cyclin D1 gene is found in 15% of tumors and overexpression of cyclin D1 at mRNA and protein levels has been observed in up to 50% of tumors, largely those that are ER positive and well differentiated. The most common assessment method of cyclin D1 expression is IHC [95]. The prognostic role of cyclin D1 was evaluated in several retrospective studies. The majority of these studies reported strong correlation between cyclin D1 expression and ER positivity. However, it has not been found to be a strong prognostic marker. One retrospective study suggested that it was predictive for tamoxifen response, as only patients with low and intermediate levels of cyclin D1 benefited from tamoxifen treatment.

p27 p27 is a Cdk inhibitor that acts in the nucleus. It binds to cyclin E-Cdk2 and cyclin A-Cdk2 complexes early in the G1 phase and facilitates the entry of cyclin D1-Cdks complex into the nucleus. It is sequestered through binding to Cdk4 or Cdk6 during periods of cell proliferation. It is mobilized by antiproliferative signals, such as cell-to-cell contact and transforming growth factor b (TGFb) signaling. It can be assessed using IHC technique with p27-positive cells displaying nuclear staining. The cut-off between low and high p27 expression is set at 50%. In some retrospective analyses of adjuvant clinical trials, low levels of p27 were found to be a predictor for worse clinical outcome, although this was not a universal finding in other trials. Furthermore, in the majority of studies, p27 was positively correlated with ER expression as well as inversely correlated to grade. There is also some evidence that low levels of p27 correlated with HER-2 overexpression and cyclin E expression, whereas high levels correlated with expression of cyclin D1. In BRCA1/2 mutated tumors, low levels of p27 have also been found. There are preliminary data to suggest that p27 is predictive for greater benefit from chemotherapy, although this requires further validation [95].

Topoisomerase IIa Topoisomerases II (topo II) are DNA-binding enzymes with nuclease, helicase, and ligase activity. They control and modify topological states of DNA. Two forms of topo II exist: (i) topo IIa is a product of a gene located at 17q21, and (ii) topo IIb is a product of a gene located at 3p. While topo IIb is not cell-cycle dependent and its function remains unknown, the concentration of topo 508

IIa is cell-cycle dependent and is highest in the G2/M transition. Topo IIa produces a double-strand nick on the cleaved DNA that enables the passage of a second DNA through the break and religation of the cleaved one, resulting in reduced DNA supercoiling and twisting. Topo II also regulates chromosome segregation and condensation of newly formed chromosome pairs in dividing cells. High levels of topo II are found in exponentially growing cells and low levels in quiescent cells. Topo II concentration can be downregulated by the growth of cells in high density and in serum-free conditions. As a result, topo II levels can be regarded as a marker of proliferation [95]. Additionally, different topo II isoforms can differ in their sensitivity to antineoplastic drugs with topo IIa acting as a target for drugs like anthracyclines, epipodophyllotoxins, actinomycin, and mitoxantrone. The topo IIa gene (TOPO2A) is located near the HER-2 oncogene on chromosome 17, although the exact mechanism for the concordance between TOPO2A aberration and HER-2 amplification is not known. Tumors with HER-2 amplification may have deletion of topo IIa or coamplification of the two genes. Those with TOPO2A deletion are associated with low levels of the topo IIa protein, while those with coamplification of TOPO2A and HER-2 appear to be associated with increased sensitivity to anthracyclines. Many studies are currently under way to evaluate the role of topo II in selecting patient subgroups that may or may not benefit from anthracycline therapy. Some evidence also exists to suggest that topo IIa is a prognostic marker for poor disease-free survival and overall survival independent of therapy.

uPA and PAI-1 Central to the process of cancer invasion are matrixdegrading proteases that regulate the tissue scaffold breakdown. Urokinase plasminogen activator (uPA) and plasminogen activator inhibitor (PAI-1), together with receptor for uPA and other inhibitors (PAI-2, PAI-3), are part of the urokinase plasminogen activating system that contributes to this enzymatic degradation system [98]. Apart from invasion, this system has also been shown to be associated with angiogenesis and metastasis. The IHC assay for detection of uPA and PAI-1 is not specific, and ELISA on a minimum of 300 mg of fresh or frozen breast cancer tissue is recommended [96]. A pooled analysis [99] of uPA/PAI-1 data of breast cancer patients and the first interim report of a prospective trial using uPA and PAI-1 levels to stratify node negative patients [100] confirmed the strong association of uPA and PAI-1 levels with recurrence and survival. Some uncontrolled studies also suggest uPA and PAI-1 may serve as a predictor of sensitivity to hormone therapy or specific types of chemotherapy. Apart from histological grade, uPA and PAI-1 are the only proliferative markers with level I evidence to support their use as prognostic markers recommended by the American Society of Clinical Oncology (ASCO).

Chapter 25

GENE EXPRESSION PROFILING Historically, the classification of breast cancers has been based on histological type, grade, and expression of hormone receptors, but the advent of microarray technology has since demonstrated significant heterogeneity occurring also at the transcriptome level. Through their ability to interrogate thousands of genes simultaneously, microarray studies have allowed for a comprehensive molecular and genetic profiling of tumors. Not only have these studies changed the way in which we have traditionally classified breast cancer, the results of these studies have also yielded molecular signatures with the potential to significantly impact on clinical care by providing a molecular basis for treatment tailoring.

Microarray Technology Gene expression profiling, using microarray technology, relies on the accurate binding, or hybridization, of DNA strands with their precise complementary copies where one sequence is bound onto a solid-state substrate. These are hybridized to probes of fluorescent cDNAs or genomic sequences from normal or tumor tissue. Through analysis of the intensity of the fluorescence on the microarray chip, a direct comparison of the expression of all genes in normal and tumor cells can be made [101]. At present, there are multiple microarray platforms that use either cDNA-based or oligonucleotide-based microarrays. cDNA-based microarrays have double-stranded PCR products amplified from expressed sequence tag (EST) clones and then spotted onto glass slides. These have inherent problems with frequent hybridization among homologous genes, alternative splice variants, and antisense RNA [102]. Oligonucleotide-based microarrays are shorter probes with uniform length. Shorter oligonucleotides (25 bases) may be synthesized directly onto a solid matrix using photolithographic technology (Affymetrix), and for longer oligonucleotides (55–70 bases), they may be either deposited by an inkjet process or spotted by a robotic printing process onto glass slides [82]. In the past, there has been much skepticism regarding the reliability and reproducibility of microarray technology. However, the overall reproducibility of the microarray technology has been found to be acceptable, as shown by the MicroArray Quality Control (MAQC) project [103] conducted by the U.S. Food and Drug Administration (FDA). They found that similar changes in gene abundance were detected, despite using different platforms. Furthermore, this reproducibility appears comparable to that of other diagnostic techniques, for example, with immunohistochemical analysis for hormone receptors in breast cancer [104,105].


new classification has not only furthered our understanding of tumor biology, but it has also altered the way that physicians and clinical investigators conceptually regard breast cancer—not as one disease, but a collection of several biologically different diseases. Four main molecular classes of breast cancers have been consistently distinguished by gene expression profiling. Based upon the original classification described by Perou et al., these subtypes are [106] (i) basal-like breast cancers, (ii) HER-2þ breast cancers, (iii) luminal-A breast cancers, and (iv) luminal-B breast cancers. In the basal-like subtype, there is a high expression of basal cytokeratins 5/6 and 17 and proliferationrelated genes, as well as laminin and fatty-acid binding protein 7. In the HER-2þ subtype, there is a high expression of genes in the erbb2 amplicon, such as GRB7. The luminal cancers are ER-positive. Luminal A is characterized by a higher expression of ER, GATA3, and X-box binding protein trefoil factor 3, hepatocyte nuclear factor 3 alpha, and LIV-1. Luminal B cancers are generally characterized by a lower expression of luminal-specific genes. Beyond differing gene expression profiles, these molecular subtypes appear to have distinct clinical outcomes and responses to therapy that seem reproducible from one study to the next. The basal-like and HER-2þ subtypes are more aggressive with a higher proportion of Major Gene Expression Signatures TP53 mutations [107,108] and a markedly higher likelihood of being grade III (P < 0.0001, and P ¼ 0.0002) than luminal A tumors. Despite a poorer prognosis, they tend to respond better to chemotherapy including higher pathologic complete response rates after neo-adjuvant therapy [109]. On the other hand, fewer than 20% of luminal subtypes have mutations in TP53 and these tumors are often grade I [110]. They tend to be more sensitive to endocrine therapy, less responsive to conventional chemotherapy, and demonstrate overall clinical outcomes. Despite differences in testing platforms, the collective results of these studies suggest that ER expression is the most important discriminator. Beyond ER expression, distinct expression patterns can also be differentiated, perhaps reflecting distinct cell types of origin [91–93]. However, this molecular classification is not without its inherent limitations, with up to 30% of breast cancers not falling into any of the four molecular categories [111]. Exactly how many true molecular subclasses of breast cancer exist remains uncertain, and it is plausible that the molecular classification will evolve with new technological platforms, with the availability of larger data sets, as well as with improved understanding of tumor biology.

Molecular Classification of Breast Cancer

Gene Expression Signatures to Predict Prognosis

One of the most important discoveries stemming directly from microarray studies has been the reclassification of breast cancer into molecular subtypes. This

Traditional prognostic factors based on clinical and pathological variables are unable to fully capture the heterogeneity of breast cancer. Guidelines like the 509

Part IV


National Comprehensive Cancer Network (NCCN) [112] used in the United States and the International St. Gallen Expert Consensus [13] used in Europe to guide treatment decisions take into account relapse risk based traditional anatomical and pathological assesment. These guidelines cannot accommodate for the substantial variability that can exist between patients with similar stages and grades of disease. Using microarray technology, several independent groups have conducted comprehensive gene expression profiling studies with the aim of improving on traditional prognostic markers used in the clinic. Using the top-down approach, where gene expression data are correlated with clinical outcome without a prior biological assumption, a group of researchers from Amsterdam identified a 70-gene prognostic signature, using the Agilent platform, in a series of 78 systemically untreated node-negative breast cancer patients under 55 years of age [113]. This signature included mainly genes involved in the cell cycle, invasion, metastasis, angiogenesis, and signal transduction. Validated on a larger set of 295 young patients [114], including both node-negative and node-positive disease as well as treated and untreated patients, the 70-gene signature was found to be the strongest predictor for distant metastases-free survival, independent of adjuvant treatment, tumor size, histological grade, and age. Using the same top-down approach, another group in Rotterdam identified a 76-gene signature [115], using the Affymetrix technology which considered ERpositive patients separately from ER-negative patients. These 76 genes were mainly associated with cell cycle and cell death, DNA replication and repair, and immune response. In a training set of 115 patients and a multicentric validation set of 180 patients [116], they were able to demonstrate comparable discriminative power in predicting the development of distant metastases in untreated patients in all age groups with node-negative breast cancer. Both the Amsterdam and Rotterdam gene signatures have been independently validated by TRANSBIG, the translational research network of the Breast International Group (BIG) [117,118]. Despite having only three genes in common, both signatures were able to outperform the best validated tools to assess clinical risk. In particular, these signatures were both superior in correctly identifying the low-risk patients but were limited in identifying the high-risk patients, as half of those identified in this category did not, in fact, relapse. This suggests that the highest clinical utility for these molecular signatures may be in potentially reducing overtreatment of low-risk patients. Also using the top-down approach, Paik et al. [119], in collaboration with Genomic Health Inc., developed a recurrence score (RS) based on 21 genes that appeared to accurately predict the likelihood of distant recurrence in tamoxifen-treated patients with node-negative, ER-positive breast cancer. A final panel of 16 cancer-related genes and 5 reference genes forms the basis for the Oncotype DXTM Breast Cancer Assay. 510

The RS classifies patients into three risk groups, based on cutoff points from the results of the NSABP trial B-20: high risk of recurrence is assigned if RS >31; intermediate risk if RS is 18–30; and low risk if RS 25 : CT þ HT

differing histopathological characteristics identified mainly by the microscope. Current practice guidelines based on histopathology have been important as risk stratification tools for therapy selection, but these guidelines are limited in the tailoring of treatment for the individual patient. Indeed, it has long been observed that among patients with anatomic and pathological risk profiles, there can be substantial variability in both the natural history and response to treatment. Novel molecular technologies and a better understanding of the tumor biology of breast cancer have resulted in significant advances in recent years. Previous emphasis on refining the traditional histopathologic criteria, on developing indices of proliferation (S-Phase fraction, Ki67), on understanding genomic instability (e.g., DNA ploidy), and on analyzing single gene expression profiles (p53 expression) have shifted dramatically to molecular profiling, reflecting the expression of many thousands of genes. With new knowledge, new challenges emerge. The excitement that comes with each new biomarker must be matched by the scientific rigor of prospective validation with each biomarker being assessed for clinical and economic utility. The challenge also remains how to best integrate multiple new sources and levels of prognostic data with the existing histopathological model. Therefore, it should be with cautious optimism that we move forward in this era of unraveling the mystery behind the many molecules and mutations of this disease.

REFERENCES 1. Pestalozzi BC, Luporsi-Gely E, Jost LM, et al. ESMO Guidelines Task Force. ESMO minimum clinical recommendations for diagnosis, adjuvant treatment and follow-up of primary breast cancer. Annals of Onctology. 2005;16(Suppl 1):7–9. 2. Hanby AM, Hughes TA. In situ and invasive lobular neoplasia of the breast. Histopathology. 2008;52:58–66. 3. Moriya T, Kasajima A, Ishida K, et al. New trends of immunohistochemistry for making differential diagnosis of breast lesions. Medical Molecular Morphology. 2006;39:8–13. 4. Irvine T, Fentiman IS. Biology and treatment of ductal carcinoma in situ. Expert Review of Anticancer Therapy. 2007;7:135–145.

513

Part IV


5. Patani N, Cutuli B, Mokbel K. Current management of DCIS: a review. Breast Cancer Research and Treatment. 2007;(epub ahead of print) 6. Fisher B, Digman J, Wolmark N, et al. Tamoxifen in treatment of intraductal breast cancer: National Surgical Adjuvant Breast and Bowel Project B-24 randomised controlled trial. Lancet. 1999;252:1993–2000. 7. Hoda SA, Hoda RS, Merlin S, et al. Issues relating to lymphovascular invasion in breast carcinoma. Advances in Anatomic Pathology. 2006;13:308–315. 8. Mohammed RA, Martin SG, Gill MS, et al. Improved methods of detection of lymphovascular invasion demonstrate that it is the predominant method of vascular invasion in breast cancer and has important clinical consequences. The American Journal of Surgical Pathology. 2007; 31:1825–1833. 9. McCready DR, Chapman JA, Hanna WM, et al. Factors affecting distant disease-free survival for primary invasive breast cancer: Use of a log-normal survival model. Ann Surg Oncol. 2000;7: 416–426. 10. Komaki K, Sano N, Tangoku A. Problems in histological grading of malignancy and its clinical significance in patients with operable breast cancer. Breast Cancer. 2006;13:249–253. 11. van Diest PJ, van der Wall E, Baak JPA. Prognostic value of proliferation in invasive breast cancer: A review. Journal of Clinical Pathology. 2004;57:675–681. 12. Sobin LH, Wittekinf C. TNM Classification of Malignant Tumour. New York: UICC, Wiley-Liss; 2002. 13. Goldhirsch A, Wood WC, Gelber RD, et al. Progress and promise: Highlights of the international expert consensus on the primary therapy of early breast cancer 2007. Annals of Oncology. 2007;18: 1133–1144. 14. Parker MG. Steroid and related receptors. Current Opinion in Cell Biology. 1993;5:499–504. 15. Mosselman S, Polman J, Kijkema R. Identification and characterization of a novel human estrogen receptor. FEBS Letters. 1996;392:49–53. 16. Bocchinfuso WP, Korach KS. Mammary gland development and tumorigenesis in estrogen receptor knockout mice. Journal of Mammary Gland Biology and Neoplasia. 1997;2:323–334. 17. Hopp TA, Weiss H, Parra I, et al. Low levels of estrogen receptor beta protein predict resistance to tamoxifen therapy in breast cancer. Clin Cancer Res. 2004;10: 7490–7499. 18. Nemere I, Pietras RJ, Blackmore PF. Membrane receptors for steroid hormones: Signal transduction and physiological significance. Journal of Cellular Biochemistry. 2003;88:438–445. 19. Horwitz KB, McGuire WL. Estrogen control of progesterone receptor in human breast cancer. The Journal of Biological Chemistry. 1978;253:2223–2228. 20. Beato M. Gene regulation by steroid hormones. Cell. 1989; 56:335–344. 21. Dobrzycka KM, Townson SM, Jiang S, et al. Estrogen receptor corepressors: A role in human breast cancer? Endocrine-Related Cancer. 2003;10:517–536. 22. Smith CL, O’Malley BW. Coregulator function: A key to understanding tissue specificity of selective receptor modulators. Endocrine Reviews. 2004;25:45–71. 23. Smith CL, Nawaz Z, O’Malley BW. Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-hydroxytamoxifen. Mol Endocrinol. 1997;11:657–666. 24. Shang Y, Brown M. Molecular determinants for the tissue specificity of SERMs. Science. 2002;295:2465–2468. 25. Xu J, Li Q. Review of the in vivo functions of the p160 steroid receptor coactivator family. Mol Endocrinol. 2003;17:1681–1692. 26. Schiff R, Massarweh S, Shou J, et al. CK. Breast cancer endocrine resistance: How growth factor signalling and estrogen receptor coregulators modulate response. Clin Cancer Res. 2003;9: 447S–454S. 27. Nicholson RI, McClelland RA, Robertson JF, et al. Involvement of steroid hormone and growth factor cross-talk in endocrine response in breast cancer. Endocrine-Related Cancer. 1999;6: 373–387. 28. Huynh H, Yang X, Pollak M. Estradiol and antiestrogens regulate a growth inhibitory insulin-like growth factor binding protein 3 autocrine loop in human breast cancer cells. The Journal of Biological Chemistry. 1996;271:1016–1021.

514

29. Lee AV, Cui X, Oesterreich S. Cross-talk among estrogen receptor, epidermal growth factor, and insulin-like growth factor signalling in breast cancer. Clin Cancer Res. 2001;7:4429s–4435s. 30. Klinge CM. Estrogen receptor interaction with estrogen response elements. Nucleic Acids Research. 2001;29:2905–2919. 31. Levin ER. Cellular functions of the plasma membrane estrogen receptor. Trends in Endocrinology and Metabolism: TEM. 1999;10: 374–377. 32. Razandi M, Pedram A, Greene GL, et al. Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ERalpha and ERbeta expressed in Chinese hamster ovary cells. Mol Endocrinol. 1999;13:307–319. 33. Pappas TC, Gametchu B, Watson CS. Membrane estrogen receptors identified by multiple antibody labeling and impeded-ligand binding. FASEB J. 1995;9:404–410. 34. Kahlert S, Nuedling S, van Eickels H, et al. Estrogen receptor alpha rapidly activates the IGF-1 receptor pathway. The Journal of Biological Chemistry. 2000;27:18447–18453. 35. Simoncini T, Hafezi-Moghadam A, Brazil DP, et al. Interaction of oestrogen receptor with the regulatory subunit of phosphatidylinositol-3-OH kinase. Nature. 2000;407: 538–541. 36. Nadji M, Gomez-Fernandez P, Ganjei-Azar P, et al. Immunohistochemistry of oestrogen and progesterone receptors reconsidered: Experience with 5,993 breast cancers. American Journal of Clinical Pathology. 2005;123:21–27. 37. Jordan VC, Dowse LJ. Tamoxifen as an anti-tumor agent: Effect on oestrogen binding. J Endocrinol. 1976;68:297–303. 38. Buzdar AU, Hortobagyi G. Update on endocrine therapy for breast cancer. Clin Cancer Res. 1998;4:527–534. 39. Ravdin PM, Green S, Dorr TM, et al. Prognostic significance of progesterone receptor levels in estrogen receptor-positive patients with metastatic breast cancer treated with tamoxifen: Results of a prospective Southwestern Oncology Group study. J Clin Oncol. 1992;10:1284–1291. 40. Bezwoda WR, Esser JD, Dansey R, et al. The value of estrogen and progesterone receptor determinations in advanced breast cancer. Estrogen receptor level but not progesterone receptor level correlates with response to tamoxifen. Cancer. 1991;68: 867–872. 41. Harvey JM, Clark GM, Osborne CK, et al. Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant endocrine therapy in breast cancer. J Clin Oncol. 1999;17:1474–1481. 42. Early Breast Cancer Trialists’ Collaborative Group. Tamoxifen for early breast cancer; An overview of the randomized trials. Lancet. 1998;351:1451–1467. 43. Ellis MJ, Rosen E, Dressman H, et al. Neoadjuvant comparisons of aromatase inhibitors and tamoxifen: Pretreatment determinants of response and on-treatment effect. The Journal of Steroid Biochemistry and Molecular Biology. 2003;86:301–307. 44. Milano A, Dal Lago L, Sotiriou C, et al. What clinicians need to know about antiestrogen resistance in breast cancer therapy? Eur J Cancer. 2006;42:2692–2705. 45. Conneely OM, Jericevic BM, Lydon JP. Progesterone receptors in mammary gland development and tumorigenesis. Journal of Mammary Gland Biology and Neoplasia. 2003;8:205–214. 46. McGuire WL. Hormone receptors: Their role in predicting prognosis and response to endocrine therapy. Seminars in Oncology. 1978;5:428–433. 47. Gross GE, Clark GM, Chamness GC, et al. Multiple progesterone receptor assays in human breast cancer. Cancer Research. 1984;44: 836–840. 48. Balleine RL, Earl MJ, Greenberg ML, et al. Absence of progesterone receptor associated with secondary breast cancer in postmenopausal women. British Journal of Cancer. 1999;79: 1564–1571. 49. Colditz GA, Rosner BA, Chen WY, et al. Risk factors for breast cancer according to estrogen and progesterone receptor status. Journal of the National Cancer Institute. 2004;96:218–228. 50. Potter JD, Cerhan JR, Sellers TA, et al. Progesterone and estrogen receptors and mammary neoplasia in the Iowa Women’s Health Study: How many kinds of breast cancer are there? Cancer Epidemiological Biomarkers and Prevention. 1995;4:319–326. 51. Bardou VJ, Arpino G, Elledge RM, et al. Progesterone receptor status significantly improves outcome prediction over estrogen

Chapter 25

52.

53.

54. 55. 56.

57.

58.

59.

60.

61.

62. 63. 64. 65. 66. 67.

68.

69.

70. 71.

receptor status alone for adjuvant endocrine therapy in two large breast cancer databases. J Clin Oncol. 2003;21:1973–1979. Ferno M, Stal O, Baldetorp B, et al. Results of two or five years of adjuvant tamoxifen correlated to steroid receptor and S-phase levels: South Sweden Breast Cancer Group, and South-East Sweden Breast Cancer Group. Breast Cancer Research and Treatment. 2000;59:69–76. Lamp PJ, Pujol P, Thezenas S, et al. Progesterone receptor quantification as a strong prognostic determinant in postmenopausal breast cancer women under tamoxifen therapy. Breast Cancer Research and Treatment. 2002;76:65–71. Bloom ND, Robin EH, Schreibman B, et al. The role of progesterone receptor in the management of advanced breast cancer. Cancer. 1980;45:2992–2997. Osborne CK, Yochmowitz MG, Knight WA, et al. The value of estrogen and progesterone receptors in the treatment of breast cancer. Cancer. 1980;46:2884–2888. Ellis MJ, Coop A, Singh B, et al. Letrozole is more effective neoadjuvant endocrine therapy than tamoxifen for ErbB-1 and/or ErbB-2 positive primary breast cancer: Evidence from a phase III randomized trial. J Clin Oncol. 2001;19:3808–3816. Dowsett M, Cuzick J, Wale C, et al. Retrospective analysis of time to recurrence in the ATAC trial according to hormone receptor status: A hypothesis-generating study. J Clin Oncol. 2005;23:7512–7517. Viale G, Regan MM, Maiorano E, et al. Prognostic and predictive value of centrally reviewed expression of estrogen and progesterone receptors in a randomized trial comparing letrozole and tamoxifen adjuvant therapy for postmenopausal early breast cancer: BIG 1–98. J Clin Oncol. 2007;25:3846–3852. Coombes RC, Kilburn LS, Snowdon CF, et al. Intergroup Exemestane Study. Survival and safety of exemestane versus tamoxifen after 2–3 years’ tamoxifen treatment (Intergroup Exemestane Study): A randomized controlled trial. Lancet. 2007;369:559–570. Dowsett M, Allred DC, on behalf of the TransATAC Investigators. Relationship between quantitative ER and PgR expression and HER status with recurrence in the ATAC trial. Breast Cancer Research and Treatment. 2006;100(suppl 1; abstr 48):S21. Goss PE, Ingle JN, Martino S, et al. National Cancer Institute of Canada Clinical Trials Group MA.17. Efficacy of letrozole extended adjuvant therapy according to estrogen receptor and progesterone receptor status on the primary tumor. J Clin Oncol. 2007;25:2006–2011. Yarden, Y. The EGFR family and its ligands in human cancer: Signalling mechanisms and therapeutic opportunities. Eur J Cancer. 2001;37:S3–S8. Schlessinger J. Common and distinct elements in cellular signalling via EGF and FGF receptors. Science. 2004;306:1506–1507. Yarden Y, Sliwkowski M. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2001;2:127–137. Schechter AL, Stern DF, Vaidyanathan L, et al. The neu oncogene: An erb-B-related gene encoding a 185,000-M, tumour antigen. Nature. 1984;312:513–516. King CR, Kraus MH, Aaronsen SA. Amplification of a novel v-erb-related gene in a human mammary carcinoma. Science. 1985;229:974–976. Depowski P, Mulford D, Minot P. Comparative analysis of HER2/neu protein overexpression in breast cancer using paraffinembedded tissue and cytologic specimens. Mod Pathol. 2002; 15:70A. Joensuu H, Isola J, Lundin M, et al. Amplification of erbB2 and erbB2 expression are superior to estrogen receptor status as risk factors for distant recurrence in pT1N0Mo breast cancer: A nationwide population-based study. Clin Cancer Res. 2003;9: 923–930. Press MF, Bernstein PA, Thomas LF, et al. HER-2/neu gene amplification characterized by fluorescence in situ hybridization: Poor prognosis in node-negative breast carcinomas. J Clin Oncol. 1997;15:2894–2904. Slamon DJ, Clark GM, Wong SG, et al. Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science. 1987;235:177–182. Konecny G, Pauletti G, Pegram M, et al. Quantitative association between HER-2/neu and steroid hormone receptors in

72.

73.

74. 75. 76.

77.

78. 79.

80. 81. 82.

83.

84.

85.

86.

87.

88.

89. 90.


hormone receptor-positive primary breast cancer. Journal of the National Cancer Institute. 2003;95:142–153. Muss HB, Thor AD, Berry DA, et al. c-erbB-2 expression and response to adjuvant therapy in women with node-positive early breast cancer. The New England Journal of Medicine. 1994;330: 1260–1266. Paik S, Bryant J, Park C, et al. erbB-2 and response to doxorubicin in patients with axillary lymph node-positive, hormone receptor-negative breast cancer. Journal of the National Cancer Institute. 1998;90:1361–1370. Thor AD, Berry DA, Budman DR, et al. erbB-2, p53, and efficacy of adjuvant therapy in lymph node-positive breast cancer. Journal of the National Cancer Institute. 1998;90:1346–1360. Yaziji H, Goldstein L, Barry T, et al. HER-2 testing in breast cancer using parallel tissue-based methods. JAMA. 2004;291:1972–1977. Perez EA, Suman VJ, Davidson NE, et al. HER-2 testing by local, central and reference laboratories in specimens from the North Central Cancer Treatment Group N9831 Intergroup Adjuvant Trial. J Clin Oncol. 2006;24:3032–3038. Wolff AC, Hammond EH, Schwartz JN, et al. American Society of Clinical Oncology; College of American Pathologists. American Society of Clinical Oncology / College of American Pathologists Guideline Recommendations for Human Epidermal Growth Factor Receptor 2 testing in breast cancer. J Clin Oncol. 2007; 25:118–145. Klapper L, Waterman H, Sela M, et al. Tumor-inhibitory antibodies to HER-2/ErbB-2 may act by recruiting c-Cbl and enhancing ubiquitination of HER-2. Cancer Research. 2000;60:3384–3388. Molina MA, Codony-Servat J, Albanell J, et al. Trastuzumab (Herceptin), a humanized anti-HER-2 receptor monoclonal antibody, inhibits basal and activated HER-2 ectodomain cleavage in breast cancer cells. Cancer Research. 2001;61:4744–4749. Clynes RA, Towers TL, Presta LG, et al. Inhibitory Fc receptors modulate in vivo cytotoxicity against tumor targets. Nature Medicine. 2000;6:443–446. Izumi Y, Xu L, di Tomaso E. Tumour biology: Herceptin acts as an anti-angiogenesis cocktail. Nature. 2002;416:279–280. Baselga J, Tripathy D, Mendelsohn J, et al. Phase II study of weekly intravenous recombinant humanized anti-p185HER-2 monoclonal antibody in patients with HER-2/neu-overexpressing metastatic breast cancer. J Clin Oncol. 1996;14:737–744. Vogel CL, Cobleigh MA, Tripathy D, et al. Efficacy and safety of trastuzumab as a single agent in first-line treatment of HER-2overexpressing metastatic breast cancer. J Clin Oncol. 2002; 20:719–726. Pegram MD, Konecny GE, O’Callaghan C, et al. Rational combinations of trastuzumab with chemotherapeutic drugs used in the treatment of breast cancer. Journal of the National Cancer Institute. 2004;96:739–749. Marty M, Cognetti F, Maraninchi D, et al. Randomized phase II trial of the efficacy and safety of trastuzumab combined with docetaxel in patients with human epidermal growth factor receptor 2-positive metastatic breast cancer administered as first-line treatment: The M77001 study group. J Clin Oncol. 2005;23: 4265–4274. Slamon DJ, Leyland-Jones B, Shak S, et al. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. The New England Journal of Medicine. 2001;344:783–792. Piccart-Gebhart MJ, Procter M, Leyland-Jones B, et al. Herceptin Adjuvant (HERA) Trial Study Team. Trastuzumab after adjuvant chemotherapy HER2-positive breast cancer. The New England Journal of Medicine. 2005;353:1659–1672. Smith I, Procter M, Gelber RD, et al. HERA study team. 2-year follow-up of trastuzumab after adjuvant chemotherapy in HER2 positive breast cancer: A randomized controlled trial. Lancet. 2007;369:29–36. Romond EH, Perez EA, Bryant J, et al. Trastuzumab plus adjuvant chemotherapy for operable HER2-positive breast cancer. The New England Journal of Medicine. 2005;353:1673–1684. Perez EA, Romond H, Suman VJ, et al. NCCTG/NSABP. Updated results of the combined analysis of NCCTG N9831 and NSABP B-31 adjuvant chemotherapy with / without trastuzumab in patients with HER2-positive breast cancer. J Clin Oncol. 2007;25:512.

515

Part IV


91. Slamon D, Eiermann W, Robert N. Phase III randomized trial comparing doxorubicin and cyclophosphamide followed by docetaxel (ACT) with doxorubicin and cyclophosphamide followed by docetaxel and trastuzumab (AC TH) with docetaxel, carboplatin and trastuzumab (TCH) in HER2 positive early breast cancer patients: BCIRG 006 study. Breast Cancer Res Treat. 2005; 94(suppl 1):Session 5 abstract 1. 92. Slamon D, Eiermann W, Robert N. BCIRG 006: 2nd interim analysis phase III randomized trial Phase III comparing doxorubicin and cyclophosphamide followed by docetaxel (AC-T) with doxorubicin and cyclophosphamide followed by docetaxel and trastuzumab (AC-TH) with docetaxel, carboplatin and trastuzumab (TCH) in HER2 positive early breast cancer patients. Breast Cancer Res Treat. 2006;100:General Session 2, abstract S2. 93. Joensuu H, Kellokumpu-Lehtinen PL, Bono P, et al. FinHer Study Investigators. Adjuvant docetaxel or vinorelbine with or without trastuzumab for breast cancer. The New England Journal of Medicine. 2006;354:809–820. 94. Spielmann M, Roche H, Humblet Y. 3-year follow-up of trastuzumab following adjuvant chemotherapy in node positive HER2-positive breast cancer patients: Results of the PACS-04 trial. San Antonio Breast Cancer Symposium. 2007;abstract 72. 95. Colozza M, Azambuja E, Cardoso F, et al. Proliferative markers as prognostic and predictive tools in early breast cancer: Where are we now? Annals of Oncology. 2005;16:1723–1739. 96. Harris L, Fritsche H, Mennel R, et al. American Society of Clinical Oncology 2007 update of recommendations for the use of tumor markers in breast cancer. J Clin Oncol. 2007; 25:5287–5312. 97. Ahlin C, Aaltonen K, Amini RM, et al. Ki67 and cyclin A as prognostic factors in early breast cancer. What are the optimal cut-off values? Histopathology. 2007;51:491–498. 98. Stephens RW, Bru¨nner N, Ja¨nicke F, et al. The urokinase plasminogen activator system as a target for prognostic studies in breast cancer. Breast Cancer Research and Treatment. 1998; 52:99–111. 99. Look MP, van Putten WLJ, Duffy MJ, et al. Pooled analysis of prognostic impact of urokinase-type plasminogen activator and its inhibitor PAI-1 in 8377 breast cancer patients. Breast Cancer Research and Treatment. 1998;52:99–111. 100. Ja¨nicke F, Prechtl A, Thomssen C, et al. German N0 Study Group Randomized adjuvant chemotherapy trial in high-risk, lymph node-negative breast cancer patients identified by urokinase-type plasminogen activator and plasminogen activator inhibitor type 1. Journal of the National Cancer Institute. 2001;93:913–920. 101. Barrett JC, Kawasaki K. Microarrays: The use of oligonucleotides and cDNA for the analysis of gene expression. Drug Discovery Today. 2003;8:134–141. 102. Cronin M, Pho M, Dutta D, et al. Measurement of gene expression in archival paraffin-embedded tissues: Development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay. The American Journal of Pathology. 2004; 164:35–42. 103. MAQC Consortium. The MicroArray Quality Control (MAQC) project shows inter and intraplatform reproducibility of gene expression measurements. Nature Biotechnology. 2006;24:1151–1161. 104. Layfield LJ, Goldstein N, Perkinson KR, et al. Interlaboratory variation in results from immunohistochemical assessment of estrogen receptor status. The Breast Journal. 2003;9:257–259. 105. Rhodes A, Jasani B, Barnes DM, et al. Reliability of immunohistochemical demonstration of oestrogen receptors in routine practice: Interlaboratory variance in the sensitivity of detection and evaluation of scoring systems. Journal of Clinical Pathology. 2000;53:125–130. 106. Perou CM, Sorlie T, Eisen MB, et al. Molecular portraits of human breast tumors. Nature. 200;406:747–752. 107. Sorlie T, Perou CM, Tibshirani R, et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc Natl Acad Sci USA. 2001;98: 10869–10874. 108. Carey LA, Perou CM, Dressler LG. Race and the poor prognosis basal-like breast cancer (BBC) phenotype in the populationbased Carolina Breast Cancer Study. J Clin Oncol. 2004;suppl: abstract 9510.

516

109. Rouzier R, Anderson K, Hess KR. Basal and luminal types of breast cancer defined by gene expression patterns respond differently to neoadjuvant chemotherapy. San Antonio Breast Cancer Symposium. 2004;abstract 1026. 110. Sotiriou C, Neo SY, McShane LM, et al. Breast cancer classification and prognosis based on gene expression profiles from a population-based study. Proc Natl Acad Sci USA. 2003; 100(18):10393–10398. 111. Pusztai L, Mazouni C, Anderson K, et al. Molecular classification of breast cancer: Limitations and potential. The Oncologist. 2006;11:868–877. 112. National Comprehensive Cancer Network (NCCN) guidelines. www.nccn.org; 2007. 113. van’t Veer LJ, Dai H, van de Vijver MJ, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature. 2002;415:530–536. 114. van de Vijver MJ, He YD, van’t Veer LJ, et al. A gene-expression signature as a predictor of survival in breast cancer. Nature. 2002;347:1999–2009. 115. Wang Y, Klijn JG, Zhang Y, et al. Gene-expression profiles to predict distant metastases of lymph-node-negative primary breast cancer. Lancet. 2005;365:671–679. 116. Foekins JA, Atkins D, Zhang Y, et al. Multicenter validation of a gene expression-based prognostic signature in lymph nodenegative primary breast cancer. J Clin Oncol. 2006;24:1665–1671. 117. Buyse M, Loi S, van’t Veer L, et al. TRANSBIG Consortium. Validation and clinical utility of a 70-gene prognostic signature for women with node-negative breast cancer. Journal of the National Cancer Institute. 2006;98:1183–1192. 118. Desmedt C, Piette F, Loi S. Strong time-dependency of the 76-gene prognostic signature for node-negative breast cancer patients in the TRANSBIG multi-centre independent validation series. 2006; Late breaking abstract, Fifth European Breast Cancer Conference. 119. Paik S, Shak S, Tan G, et al. A multigene assay to predict recurrence of tamoxifen-treated, node-negative breast cancer. The New England Journal of Medicine. 2004;351:2817–2826. 120. Paik S, Shak S, Tang G. Multi-gene RT-PCR assay for predicting recurrence in node-negative breast cancer patients—NSABP studies B-20 and B-14. Breast Cancer Research and Treatment. 2003;82(Suppl 1):S10 abstract 16. 121. Sotiriou C, Wirapati P, Loi S, et al. Gene expression profiling in breast cancer: Understanding the molecular basis of histologic grade to improve prognosis. Journal of the National Cancer Institute. 2006;98:262–272. 122. Miller LD, Smeds J, George J, et al. An expression signature for p53 status in human breast cancer predicts mutation status, transcriptional effects, and patient survival. Proceedings of National Academy of Science USA. 2005;102:13550–13555. 123. Glinsky GV, Berezovska O, Glinskii AB. Microarray analysis identifies a death-from-cancer signature predicting therapy failure in patients with multiple types of cancer. J Clin Invest. 2005;115:1503–1521. 124. Chang HY, Sneddon JB, Alizadeh AA, et al. Gene expression signature of fibroblast serum response predicts human cancer progression: Similarities between tumors and wounds. PLoS Biology. 2004;2:E7. 125. Liu R, Wang X, Chen G, et al. The prognostic role of a gene signature from tumorigenic breast-cancer cells. The New England Journal of Medicine. 2007;356:217–226. 126. Sotiriou C, Wirapati P, Kunkel S, et al. Integrative meta-analysis of gene-expression profiles in breast cancer: Toward a unified understanding of breast cancer sub-typing and prognosis signatures. Breast Cancer Research and Treatment. 2007;106(Suppl 1): S56–57. 127. Kang Y, Siegel PM, Shu W, et al. A multigenic program mediating breast cancer metastasis to bone. Cancer Cell. 2003;3:537–549. 128. Minn AJ, Kang Y, Serganova I, et al. Distinct organ-specific metastatic potential of individual breast cancer cells and primary tumour. J Clin Invest. 2005;115:44–55. 129. Minn AJ, Gupta GP, Siegel PM, et al. Genes that mediate breast cancer metastasis to lung. Nature. 2005;436:518–524. 130. Jansen MP, Foekens J, Dirkzwager-Kiel MM, et al. Molecular classification of tamoxifen-resistant breast carcinomas by gene expression profiling. J Clin Oncol. 2005;23:732–740.

Chapter 25 131. Ma XJ, Isakoff SJ, Barmettler A, et al. A two-gene expression ratio predicts clinical outcome in breast cancer patients treated with tamoxifen. Cancer Cell. 2004;5:607–616. 132. Ma XJ, Ding L, Sgroi DC, et al. The HOXB13:IL17BR expression index is a prognostic factor in early-stage breast cancer. J Clin Oncol. 2006;24:4611–4619. 133. Jansen MP, Sieuwerts AM, Look MP, et al. HOXB13-to-IL17BR expression ratio is related with tumor aggressiveness and response to tamoxifen of recurrent breast cancer: A retrospective study. J Clin Oncol. 2006;25:662–668. 134. Oh DS, Troester MA, Usary J, et al. Estrogen-regulated genes predict survival in hormone receptor-positive breast cancers. J Clin Oncol. 2006;24:1656–1664. 135. Symanns WF, Hatzis C, Sotiriou C, et al. The Microarray-based Endocrine Prediction Collaboration. Ability of a 200-gene endocrine sensitivity index (SET) to predict survival for patients who receive adjuvant endocrine therapy or for untreated patients. Proceedings of ASCO 2007 Breast Cancer Symposium. 2007;abstract 25. 136. Folgueira MA, Patraõ DF, Barbosa EM, et al. Gene expression profile associated with response to doxorubicin-based therapy in breast cancer. Clin Cancer Res. 2005;11:7434–7443. 137. Hannemann J, Oosterkamp HM, Bosch CA, et al. Changes in gene expression associated with response to neoadjuvant chemotherapy in breast cancer. J Clin Oncol. 2005;23:3331–3342. 138. Chang JC, Wooten EC, Tsimelzon A, et al. Gene expression profiling for the prediction of therapeutic response to docetaxel in patients with breast cancer. Lancet. 2003;362:362–369. 139. Chang JC, Wooten EC, Tsimelzon A, et al. Patterns of resistance and incomplete response to docetaxel by gene expression profiling in breast cancer patients. J Clin Oncol. 2005;23: 1169–1177.


140. Iwao-Koizumi K, Matoba R, Ueno N, et al. Prediction of docetaxel response in human breast cancer by gene expression profiling. J Clin Oncol. 2005;23:422–431. 141. Bertucci F, Finetti P, Rougemont J, et al. Gene expression profiling for molecular characterization of inflammatory breast cancer and prediction of response to chemotherapy. Cancer Research. 2004;64:8558–8565. 142. Andre F, Mazouni C, Hortobagyi GN, et al. DNA arrays as predictors of efficacy of adjuvant/neoadjuvant chemotherapy in breast cancer patients: Current data and issues on study design. Biochimica et Biophysica Acta. 2006;1766:197–204. 143. Rouzier R, Rajan R, Wagner P, et al. Microtubule-associated protein tau: A marker of paclitaxel sensitivity in breast cancer. Proc Natl Acad Sci USA. 2005;102:8315–8320. 144. Gianni L, Zambetti M, Clark K, et al. Gene expression profiles in paraffin-embedded core biopsy tissue predict response to chemotherapy in women with locally advanced breast cancer. J Clin Oncol. 2005;23:7265–7277. 145. Hess KR, Anderson K, Symmans WF, et al. Pharmacogenomic predictor of sensitivity to preoperative chemotherapy with paclitaxel and fluorouracil, doxorubicin, and cyclophosphamide in breast cancer. J Clin Oncol. 2006;24:4236–4244. 146. Bild A, Yao G, Chang JT, et al. Oncogenic pathway signatures in human cancers as a guide to targeted therapies. Nature. 2006;439:353–357. 147. Potti A, Dressman HK, Bild A, et al. Genomic signatures to guide the use of chemotherapeutics. Nature Medicine. 2006; 12:1294–1300. 148. Sotiriou C, Piccart MJ. Taking gene-expression profiling to the clinic: When will molecular signatures become relevant to patient care? Nature Reviews. Cancer. 2007;7:545–553.

517


C h a p t e r

26 Molecular Basis of Skin Disease Vesarat Wessagowit

INTRODUCTION Skin is the most visible organ and one which is readily amenable to molecular dissection. Recent studies have therefore been able to provide fascinating new insight into the development and maintenance of healthy skin and into the range of molecular pathology that underlies a spectrum of inherited and acquired skin diseases. The new information is helpful in establishing better and more accurate diagnoses of skin disorders as well as providing new opportunities to develop more specific therapies that target key molecular events relevant to the pathogenesis of particular diseases. This chapter highlights some of the recent discoveries on the molecular pathology of skin disorders. The focus is on new findings that may have a significant impact on the clinical management of patients. It is evident that an improved understanding of the molecular pathology of the skin is fundamental to making clinical advances in dermatology.

SKIN DISEASES AND THEIR IMPACT Of all the organs of the human body, the skin is the largest—in a 70 kg individual, the skin weighs over 5 kg and covers a surface area approaching 2 m2. Skin diseases are numerous and common, with the vast majority of work performed by dermatologists in clinical practice being managing common skin conditions, including eczema, psoriasis, acne, tinea, warts, and in some countries skin cancer, and in others, skin infections. Nearly 30% of all consultations with primary care physicians involve skin symptoms or signs and yet fewer than 50% of people seek advice from medical practitioners, with pharmacists being the most common of the other sources of advice. Skin diseases are not only frequent, but they are very costly [1]. In the United States, spending on skin disease (excluding cosmetic applications) has increased more than 2-fold since the late 1990s, and the medical cost Molecular Pathology # 2009, Elsevier, Inc. All Rights Reserved.

n

John A. McGrath

of the top 20 skin conditions exceeds $40 billion US in annual expenditure. The most expensive skin disease categories include skin ulcers, wounds, melanoma, acne, nonmelanoma skin cancer, and atopic dermatitis. Many skin diseases, although not fatal, can be chronic and cause considerable morbidity; hence, their effects on quality of life can be even more pronounced than other medical conditions. Impact on quality of life measured by willingness to pay for relief from skin conditions is comparable to that of other serious medical conditions. Many symptoms that patients experience are not only burdensome but can be debilitating, both physically and psychologically. Several studies have shown that skin diseases such as psoriasis can reduce physical and mental functioning to levels comparable to those seen in cancer, arthritis, hypertension, heart disease, diabetes, and depression. In children, skin diseases such as atopic dermatitis or urticaria have been shown to have a greater impact on a child’s quality of life than conditions such as epilepsy or diabetes mellitus. The burden of skin disease, given its high prevalence and personal and social cost, is considerable. Prevention of skin disease is consequently an important goal, and in recent years considerable new knowledge has emerged in improving the understanding of molecular and cellular mechanisms relevant to maintaining healthy skin.

MOLECULAR BASIS OF HEALTHY SKIN A key role of skin is to provide a mechanical barrier against the external environment (Figure 26.1). The cornified cell envelope and the stratum corneum restrict water loss from the skin, while keratinocytederived endogenous antibiotics provide innate immune defense against bacteria, viruses, and fungi. Clues to the importance of the skin barrier have recently been highlighted by the findings of very common loss of function mutations in the profilaggrin gene (FLG), 519

Part IV


Figure 26.1 Light microscopic appearances of normal human skin (hematoxylin and eosin; bar ¼ 50 mm).

which encodes a key skin barrier component, filaggrin, expressed in the granular layer of the skin [2;3]. Mutations in FLG are the cause of the semidominant condition ichthyosis vulgaris (OMIM146700) and are a major risk factor for the development of atopic dermatitis as well as asthma associated with atopic dermatitis and systemic allergies. These discoveries demonstrate the importance of maintaining an effective skin barrier to minimize and prevent cutaneous inflammation as well as systemic pathology. They also highlight that

maintaining an effective functional skin barrier in children may have long-term benefits in reducing atopic asthma and systemic allergies in subsequent years. Normal skin has also been shown to have a very effective defense system against microbes (Figure 26.2). In the stratum corneum there is an effective chemical barrier maintained by the expression of S100A7 (psoriasin) [4]. This antimicrobial substance is very effective at killing E. coli. Subjacent to this in the skin there is another class of antimicrobial peptides such as RNASE7, which is effective against a broad spectrum of micro-organisms, especially Enterococci. RNASE7 serves as a protective minefield in the superficial skin layers and helps destroy invading organisms [5]. Below this in the living layers of the skin are other antimicrobial peptides such as a b-defensins [6]. The antimicrobial activity of most peptides occurs as a result of unique structural properties to enable them to destroy the microbial membrane while leaving human cell membranes intact. Some may play a specific role against certain microbes in normal skin, whereas others act only when the skin is injured and the physical barrier is disrupted. As well as direct protection against micro-organisms, some peptides have additional roles in signaling host responses through chemotactic, angiogenic, growth factor, and immunosuppressive activity. These peptides are known as alarmins [7]. For example, some alarmins not only kill bacteria, but also stimulate expression of factors such as Syndecan 1–4 in dermal fibroblasts, which are critical to the process of wound healing. Alarmins may also stimulate parts of the host

MICRO-ORGANISMS

STRATUM CORNEUM

UPPER EPIDERMIS

INFLAMMATORY CELLS CONSTITUTIVE ANTI-MICROBIAL PEPTIDES (PSORIASIN) INDUCIBLE ANTI-MICROBIAL PEPTIDES (b-DEFENSINS, RNASE7, LL-37) PRO-INFLAMMATORY CYTOKINES (IL-1, TNFa etc) Figure 26.2 Immune defense system in human skin. Microorganisms that breach the human epidermis are faced with a constitutive antimicrobial system, for example, psoriasin. Further protection is also provided by inducible antimicrobial peptides, such as the b-defensins RNASE7 and LL-37. Microorganisms may also be targeted by proinflammatory cytokines. 520

Chapter 26

defense system, such as barrier repair and recruitment of inflammatory cells. Antimicrobial peptides such as defensins and cathelicidins also greatly increase after infection, inflammation, or injury. Some skin diseases, including atopic dermatitis or rosacea, show altered expression of antimicrobial peptides, partially explaining the pathophysiology of these diseases. Certain antimicrobial peptides can also influence host cell responses in specific ways. The human cathelicidin peptide LL-37 can activate mitogen-activated protein kinase (MAPK), an extracellular signal-related kinase in epithelial cells, and blocking antibodies to LL-37 hinder wound repair in human skin equivalents [8]. Defensins and cathelicidins have immunostimulatory and immunomodulatory capacities as catalysts for secondary host defense mechanisms, and can be chemotactic for distinct subpopulations of leukocytes as well as other inflammatory cells. Human b-defensins (hBDs) 1–3 are chemotactic for memory T-cells and immature dendritic cells—hBD2 attracts mast cells and activated neutrophils, whereas hBD3–4 is also chemotactic for monocytes and macrophages. Cathelicidins are chemotactic for neutrophils, monocytes/macrophages, and CD4 T-lymphocytes. In addition, antimicrobial peptides can also induce keratinocyte proliferation and migration, which involves epidermal growth factor receptor signaling and STAT activation [9]. Skin immunity is also provided by a distinct population of antigen-presenting cells in the epidermis known as Langerhans cells (Figure 26.3). These are dendritic cells of a form similar to melanocytes, but free from pigment and are DOPA-negative. Without stimulation,

Molecular Basis of Skin Disease

Langerhans cells can exhibit a unique motion, which has been termed Dendrite Surveillance Extension And Retraction Cycling Habitude (dSEARCH) [10]. This is characterized by rhythmic extension and retraction of dendritic processes between intercellular spaces. When Langerhans cells are exposed to antigen, there is greater dSEARCH motion and also direct cell-to-cell contact between adjacent Langerhans cells. Thus, Langerhans cells function as intraepidermal macrophages, phagocytosing antigens among keratinocytes. Langerhans cells then leave the epidermis and migrate via lymphatics to regional lymph nodes. In the paracortical region of lymph nodes, the Langerhans cell (or interdigitating reticulum cell as it is then known) expresses protein on its surface to present to a T-lymphocyte that can then undergo clonal proliferation. Langerhans cells contribute to several skin pathologies, including infections, inflammation, and cancer; thus, they play a pivotal role in regulating the balance between immunity and peripheral tolerance. Langerhans cells have characteristics that are different from dendritic cells, in that they are more likely to induce Th-2 responses than the Th-1 responses that are usually necessary for cellular immune responses against pathogens. Langerhans cells, or a subset thereof, may also have immunoregulatory properties that counteract the proinflammatory activity of surrounding keratinocytes. Besides the antigen detection and processing role of epidermal Langerhans cells, cutaneous immune surveillance is also carried out in the dermis by an array of macrophages, T-cells, and dendritic cells (Figure 26.4). These immune sentinel and effector cells can provide

INFECTION

LANGERHANS CELLS MATURATION

LANGERHANS CELLS MIGRATION IMMUNITY

T-CELL ACTIVATION

Figure 26.3 The function of Langerhans cells in human skin. The photomicrograph (top left) shows the dendritic appearances of Langerhans cells in human epidermis (image kindly supplied by Dr. Rachel Mohr, University of Toledo, TX). Antigenic material from invading peptides or bacteria are phagocytosed and processed by Langerhans cells within the epidermis. These Langerhans cells then mature and migrate to regional lymph nodes. Antigen is presented to T-cells which are then activated, proliferate, and allow for adaptive immune responses. 521

Part IV


PATHOGENS

LC

EPIDERMIS

CD1a+ Langerin+

TIP-DC

IL-3Rα+ BDCA-2+ CD45RA+ PDC

DERMIS

M1

MACROPHAGE

DDC

LPS IFN-γ

CD14+ CD68+ CD14+

BDCA-1+ CD1a+/DC-SIGN+

IL-4 IL-10

M2

CD16+ CD32+ CD64+

CD163+ FXIIIa+ MR+ RM3/1+

BLOOD VESSEL MONOCYTE Figure 26.4 Diversity of immune sentinels in human skin. These include CD1aþ Langerinþ Langerhans cells located in the epidermis and various subtypes of dendritic cells and macrophages in the dermis. This figure illustrates some of the recent immunophenotypic and functional findings of these immune sentinels. The macrophage population expressing CD68 and CD14 can be further subdivided into classically activated macrophages (M1) and alternatively activated macrophages (M2), which develop under the influence of IL-4 and IL-10. Several cells have self-renewing potential under conditions of tissue homeostasis. Under inflammatory conditions, circulating blood-derived monocytes are potential precursors of Langerhans cells, dermal dendritic cells, and macrophages (based on an original figure by [86]).

rapid and efficient immunologic backup to restore tissue homeostasis if the epidermis is breached. The dermis contains a very large number of resident T-cells. Indeed, there are approximately 2 1010 resident T-cells, which is twice the number of T-cells in the circulating blood. Dermal dendritic cells vary in their functionality. Some have potent antigen-presenting capacities, whereas others have potential to develop into CD1a-positive and Langerin-positive cells, while some are proinflammatory. A recent addition to the family of skin immune sentinels is type 1 interferon-producing plasmacytoid predendritic cells, which are rare in normal skin but which can accumulate in inflamed skin [11]. A further component of the dermal immune system is the dermal macrophage. Dermal immune sentinels exhibit flexibility or plasticity in function. Depending on microenvironmental factors and cues, they may acquire an antigenpresenting mode, a migratory mode, or a tissue-resident phagocytic mode. Inflammation in the skin also has an impact on patients’ perception of skin diseases and their overall 522

well-being. Indeed, inflammatory responses have been shown to have an important role in the pathophysiology of depression [12]. Proinflammatory cytokines, acute phase proteins, chemokines, cellular adhesion molecules, and indeed therapeutic administration of the cytokine interferon-a can all lead to stress and depression. Much of this has a molecular basis, in that proinflammatory cytokines can interact with many of the pathophysiological processes that characterize depression, including neurotransmitter metabolism, neuroendocrine function, synaptic plasticity, and behavior. Stress associated with skin disease can also promote inflammatory responses through effects on sympathetic and parasympathetic nervous system pathways. Targeting proinflammatory cytokines and their signaling pathways, therefore, through greater understanding of the molecular mechanisms involved in skin inflammation may lead to novel treatment strategies to improve skin conditions and the patients’ biological response to their disease, including its effects on their personal well-being and quality of life.

Chapter 26

SKIN DEVELOPMENT AND MAINTENANCE PROVIDE NEW INSIGHT INTO THE MOLECULAR MECHANISMS OF DISEASE As skin develops during embryogenesis, a single basal layer of primitive epithelium covers the inner and outer surface of the embryo. As embryogenesis progresses, those epithelia that will be subject to mechanical stress require further multiple layers to offer better protection against the environment. The development of a stratified epithelium such as the skin requires a detailed architecture of maintaining an inner layer of proliferating cells, but that can also give rise to multiple layers of terminally differentiating cells that extend to the body surface and which are subsequently shed. A detailed understanding of this process that generates a selfperpetuating barrier to keep microbes out and essential

2

body fluids in is becoming clearer, and this improved understanding is providing new insights into skin maintenance as well as the pathogenesis and molecular mechanisms underlying certain developmental disorders. One fundamental issue has been trying to provide an explanation for how epithelial progenitor cells retain a self-renewing capacity. In 1999, it was shown that mice lacking the transcription factor p63 had thin skin and abnormal skin renewal [13]. p63 is an evolutionary predecessor to the p53 protein, part of a family of transcriptional regulators of cell growth differentiation and apoptosis. While p53 is a major player in tumorigenesis, p63 and another family member, p73, appear to have pivotal roles in embryonic development (Figure 26.5) [14]. p73-deficient mice have neurological and inflammatory pathology, whereas p63 knockout mice have major defects in epithelial limb and craniofacial development. These observations suggest that p63 has a crucial role in tissue morphogenesis and maintenance of epithelial stem

ΔNp63

TAp63

1


3

3⬘

γ

4

TAp63α

5

6

7

TA 1

ECTRODACTYLY ECTODERMAL DYSPLASIA CLEFTING (EEC) SYNDROME

142

10

26

87

11

12

13 β

ISO

SAM 357

508

342

453

ISO 266 298

14

α

321 353

DNA binding

TA2 1

9

DNA binding 61

ΔNp63α

8

TID

565 568

SAM

15

641

TID

510 513

586

ANKYLOBLEPHARON ECTODERMAL DYSPLASIA CLEFTING (AEC) SYNDROME

Figure 26.5 Genomic and functional domain organization of the transcription factor p63. At least 6 different isoforms can be generated by use of alternative translation initiation sites or alternative splicing. The main isoform expressed in human skin is DNp63a. Autosomal dominant mutations in the DNA binding domain of the p63 gene lead to ectrodactyly, ectodermal dysplasia, and clefting (EEC) syndrome. In contrast, autosomal dominant mutations in the SAM domain result in ankyloblepharon, ectodermal dysplasia, and clefting (AEC) syndrome. A number of other ectodermal dysplasia syndromes may also result from mutations in the p63 gene. 523

Part IV


cell compartments. Lack of p63 compromises skin formation either by creating an absence of lineage commitment and an early block in epithelial differentiation or by causing skin failure through a defect in epithelial stem cell renewal. p63 has been linked to several important signaling pathways such as epidermal growth factor (EGF), fibroblast growth factor (FGF), bone morphogenic protein (BMP), and Notch/Wnt/hedgehog signaling [15]. p63 also directly regulates expression of extracellular matrix adhesion molecules, including the a6b4 basal integrins and desmosomal proteins such as PERP, all of which are essential for epithelial integrity. The human p63 gene consists of 16 exons, located on chromosome 3q28. There are 2 different promoter sites and 3 different splicing routes, which create at least 6 different protein isoforms. Several functional domains have been identified (Figure 26.5). These include a central DNA binding domain and an isomerization domain, which are present in all p63 isoforms. The amino-terminal ends are called Transcription Activation (TA) and DN. The DN isoforms also contain an amino-terminal transactivation domain, denoted TA2. At the carboxy terminal end a, b, and g termini can be synthesized. The carboxy-terminal end has 2 additional domains: (i) the Sterile Alpha Motif (SAM) domain and (ii) a Transactivation Inhibitory (TI) domain. Both of these domains are present in the longest carboxy terminal variant, known as p63a. A further understanding of the role of p63 in skin development has been gleaned from studies on naturally occurring mutations in this gene. Heterozygous mutations cause developmental disorders, displaying various combinations of ectodermal dysplasia, limb malformations, and oro-facial clefting. Thus far, 7 different disorders have been linked to mutations in the p63 gene. These conditions may have overlapping genotypic features, but there are some distinct genotype/phenotype correlations [16]. The most common p63-associated ectodermal dysplasia is EEC syndrome (ectrodactyly, ectodermal dysplasia, and cleft/lip palate, OMIM604292). It is characterized by 3 major clinical signs of cleft lip and/or palate, ectodermal dysplasia (abnormal teeth, skin, hair, nails, and sweat glands, or combinations thereof), and limb malformations in the form of split hand/foot (ectrodactyly), and/or fusion of fingers/toes (syndactyly). Another group of p63-linked patients are those with RappHodgkin syndrome (OMIM129400) or AEC/Hay-Wells syndrome (OMIM106260). These syndromes fulfill the criteria of ectodermal dysplasia and oro-facial clefting, but do not have the severe limb malformation(s) seen in EEC syndrome. The features of these syndromes may include eyelid fusion (ankyloblepharon filiform adnatum), severe erosions at birth, and abnormal hair with pili torti or pili canaliculi. The p63 mutations in EEC syndrome are clustered in the DNA-binding domain and most likely alter the DNA-binding properties of the protein. By contrast, mutations in Rapp-Hodgkin or AEC syndromes are clustered in the SAM and TI domains in the carboxy-terminus of p63a. The SAM domain is involved in protein-protein interactions, whereas the TI domain is combined intra-molecularly to the TA 524

domain, thereby inhibiting transcription activation. All p63-associated disorders are inherited in an autosomal dominant manner, and mutations are thought to have either dominant-negative or gain of function effects. The epidermis contains a population of epidermal stem cells that reside in the basal layer, although it is not clear how many cells within the basal layer have a stem cell capacity (Figure 26.6) [17]. Stem cells are proposed to express elevated levels of b1 and a6 integrins and differentiate by delamination and upward movement to form the spinous layer, a granular layer, and the stratum corneum. The proliferation of epidermal stem cells is regulated positively by b1 integrin and transforming growth factor a, and negatively by transforming growth factor b signaling. Stem cells are also found in sebaceous glands—the latter contain a small number of progenitors that express the transcriptional repressor Blimp1 which reside near or at the base of the sebaceous gland. The proliferative progeny of the cells differentiate into lipid-filled sebocytes. Hair follicle stem cells reside in the bulge compartment below the sebaceous gland. These stem cells are slow cycling and express the cell surface molecules CD34 and VdR as well as the transcription factors TCF3, Sox9, Lhx2, and NFATc1. These bulge area stem cells generate cells of the outer root sheath, which drive the highly proliferative matrix cells next to the mesenchymal papillae. After proliferating, matrix cells differentiate to form the hair channel, the inner root sheath, and the hair shaft. The mechanisms that control the stem cell proliferation and differentiation in the skin also provide new insight into skin homeostasis. Epidermal proliferation is controlled by a multitude of transcription factors, including c-Myc and p63 [18]. Differentiation of epidermal cells is controlled by Notch signaling and the transcription factors PPARa, AP2 a/g, and C/ EBPa/b. Proliferation of bulge cells in the hair follicle is positively controlled by Wnt signaling and negatively controlled by BMP signaling, and the transcription factors, NFATc1 and PTEN. Differentiation of the inner root sheath is controlled by Notch and BMP signaling and the transcription factor CDP and GATA3. Hair shaft differentiation is controlled by Wnt signaling and its downstream transcription factor Lef1. Hair matrix cells are controlled by Msx1/2, Ovo1, Foxn1, and Shh. Sebaceous gland stem cells are positively regulated by c-Myc and Hedgehog signaling and negatively regulated by the transcription factor Blimp1 and Wnt signaling. Differentiation of sebocytes is directed by PPARg expression [19].

MOLECULAR PATHOLOGY OF MENDELIAN GENETIC SKIN DISORDERS There are approximately 5000 single gene disorders, of which nearly 600 have a distinct skin phenotype. Many of these disorders have also been characterized at a molecular level. Most inherited skin disorders are transmitted either by autosomal dominant, autosomal recessive, X-linked dominant, or X-linked recessive modes of inheritance. However, understanding the precise

Chapter 26


Markers of interfollicular stem cells EPIDERMIS

α6 integrin β1 integrin p63 SEBOCYTE STEM CELLS

EPIDERMAL STEM CELLS

Marker of sebocyte stem cells Blimp1

HAIR SHAFT SEBACEOUS GLAND

INNER ROOT SHEATH OUTER ROOT SHEATH

Markers of hair follicle bulge stem cells

BULGE STEM CELLS

DERMAL PAPILLA

A

B

DNA label retention CD34 NFATc1 Vitamin D receptor TCF3 Fox9 Lhx2

Figure 26.6 (A) Localization of stem cells in human epidermis. Stem cells are located within the basal layer of interfollicular epidermis, as well as at the base of sebocytes and also in the bulge area of hair follicles. (B) These epidermal stem cells are associated with a number of cellular markers.

pattern of inheritance is essential for accurate genetic counseling. For example, the connective tissue disorder pseudoxanthoma elasticum (OMIM264800) was for many years thought to reflect a mixture of autosomal dominant and autosomal recessive genotypes. However, it has been shown that all forms of pseudoxanthoma elasticum are in fact autosomal recessive and that the disease is caused by mutations in the ABCC6 gene, as the earlier reports of autosomal dominant inheritance were actually pseudo-dominant inheritance in consanguineous pedigrees [20]. Understanding the molecular pathology of pseudoxanthoma elasticum has also identified similar autosomal recessive inherited skin diseases that have an overlapping phenotype, but in which there are subtle clinical differences. For example, a pseudoxanthoma elasticum-like disease with cutis laxa skin changes and coagulopathy (OMIM610842) has been shown to result from mutations in the GGCX gene [21]. In both conditions, there is progressive accumulation of calcium phosphate in tissue, resulting in ocular and cardiovascular complications. The knowledge that these conditions are autosomal recessive helps with genetic counseling, prognostication, and management of families with affected members. Moreover, understanding the precise molecular pathology allows for more careful clinical monitoring and patient follow-up. One of the principal functions of human skin is to provide a mechanical barrier against the external environment. The structural integrity of the skin depends on several proteins. These include intermediate filaments inside keratinocytes, intercellular junctional proteins between keratinocytes, and a network of adhesive macromolecules at the dermal-epidermal junction (Figure 26.7).

Since the late 1980s, several Mendelian genetic disorders resulting from autosomal dominant or autosomal recessive mutations in structural proteins in the skin have provided fascinating insights into skin structure and function. In addition, determining the key roles of particular proteins has provided a plethora of new clinically and biologically relevant data. One of the best characterized groups of disorders is epidermolysis bullosa (EB), a group of skin fragility disorders associated with blister formation of the skin and mucous membranes that occurs following mild trauma. EB simplex is the commonest form of inherited EB and affects approximately 40,000 people in the United States. Transmission is mainly autosomal dominant, but recessive patients (OMIM 601001) have also been reported. Ultrastructurally, the level of split is through the cytoplasm of basal cells, often close to the inner hemidesmosomal plaque. In dominant forms of EB simplex, there may be disruption of keratin tonofilaments or aggregation of keratin filaments into bundles (Figure 26.8). However, sometimes transmission electron microscopy may show only very subtle or indiscernible morphological changes in intermediate filaments. The molecular defects that cause EB simplex lie in either the keratin 5 gene (KRT5) or the keratin 14 gene (KRT14), or, in cases of the autosomal recessive EB simplex-muscular dystrophy, in the plectin gene (PLEC1) [22–24]. The molecular pathology of keratin gene mutations provides some insight into genotype/phenotype correlation. Notably mutations in the helix initiation/helix termination motifs in helices 1A and 2B of the keratin genes result in more severe subtypes. Clinically, EB simplex patients have the mildest skin lesions and scarring is not frequent. 525

Part IV


Keratins 5 & 14

EB simplex with muscular dystrophy Junctional EB with pyloric atresia

EB simplex

Plectin 230-kDa BP Ag α6β4 integrin

Dominant & recessive dystrophic EB

Type XVII collagen

Laminin-332

Non-Herlitz junctional EB

Herlitz & non-Herlitz junctional EB

Type VII collagen

Figure 26.7 Illustration of the integral structural macromolecules present within hemidesmosome-anchoring filament complexes and the associated forms of clinical epidermolysis bullosa that result from autosomal dominant or autosomal recessive mutations in the genes encoding these proteins.

Basal Keratinocyte nucleus

Clumped Keratin filaments

Blister

A

B

Dermal-epidermal junction

Figure 26.8 Clinicopathological consequences of mutations in the gene encoding keratin 14 (KRT14), the major intermediate filament protein in basal keratinocytes. (A) The clinical picture shows autosomal dominant Dowling-Meara epidermolysis bullosa simplex. (B) The electron micrograph shows keratin filament clumping and basal keratinocyte cytolysis (bar ¼ 1 mm).

Extracutaneous involvement is rare, apart from cases with plectin pathology. The mildest clinical subtype of EB simplex is the Weber-Cockayne variant (OMIM131800) in which blistering occurs mainly on the palms and soles (Figure 26.9). The molecular pathology involves autosomal dominant mutations that occur mainly outside the critical helix boundary motifs. In some forms of EB simplex, such as the Ko¨bner subtype, the disease is more generalized than the Weber-Cockayne variant, although 526

there is considerable overlap. The most severe form of EB simplex is the Dowling-Meara type (OMIM131760). This often presents with generalized blister formation shortly after birth, and it can be fatal in neonates. A characteristic of this condition in later childhood is the grouping of lesions in a herpetiform clustering arrangement (Figure 26.7). This form of EB simplex is associated with the greatest disruption of keratin tonofilaments. Another autosomal dominant form of EB

Chapter 26

A

B

C Figure 26.9 Spectrum of clinical abnormalities associated with dominant mutations in keratin 5 (KRT5). (A) Missense mutations in the nonhelical end domains result in the most common form of EB simplex, which is localized to the hands and feet (Weber-Cockayne variant). (B) A specific mutation in keratin 5, p.P25L, is the molecular cause of epidermolysis bullosa simplex associated with mottled pigmentation. (C) Heterozygous nonsense or frameshift mutations in the KRT5 gene leads to Dowling-Degos disease.

simplex is one associated with mottled skin pigmentation (OMIM131960). Apart from blisters, there is diffuse speckled hyperpigmentation as well as keratoderma of the palms and soles. The hypermelanotic macules are most evident in the axillae, limbs, and lower abdomen. The underlying molecular pathology in all reports is the same heterozygous proline to leucine substitution at codon 25 in the nonhelical V1 domain of the KRT5 gene. This proline residue is expressed on the outer part of polymerized keratin filaments and, when mutated, may result in abnormal interactions with melanosomes or other keratinocyte organelles.


Collectively, these naturally occurring mutations have provided valuable insight into mechanisms of adhesion in human skin as well as the functional and clinical consequences of mutations in individual components. Nevertheless, molecular analysis of other Mendelian disorders has demonstrated that these skin structural proteins may also be mutated in other inherited skin diseases—known as allelic heterogeneity. For example, heterozygous nonsense mutations in the KRT14 gene have been shown to result in the Naegeli-FranceschettiJadassohn form of ectodermal dysplasia (OMIM161000) [25]. In addition, heterozygous loss of function mutations in the KRT5 gene have been shown to underlie the autosomal dominant disorder Dowling-Degos disease (OMIM179850) [26]. This is characterized by clustered skin papules, the histology of which shows seborrheic keratosis-like morphology (Figure 26.9). Junctional EB is an autosomal recessive condition in which the molecular pathology involves loss of function mutations in any one of at least 6 different genes encoding structural proteins within the hemidesmosome or lamina lucida at the cutaneous basement membrane zone. Clinical features include blistering, atrophic scarring, nail dystrophy, and defective dental enamel as well as other abnormalities affecting the hair, eyes, and genito-urinary tract. Ultrastructurally, the level of split is mainly through the lamina lucida of the basement membrane zone, but blistering may also occur just above the basal keratinocyte plasma membrane as a focal observation in biopsies from patients with junctional EB-associated with pyloric atresia. The most severe type of junctional EB is the Herlitz subtype (OMIM226700). There is typically widespread blistering with mucosal involvement in the mouth and upper respiratory tract. Many affected infants die from overwhelming secondary infection. In later infancy, patients may develop wounds with exuberant granulation tissue, particularly around the mouth, nose, and nails. Dystrophic nails with paronychia and swollen fingertips are frequent findings, and most cases die in early infancy. The underlying molecular pathology involves homozygous or compound heterozygous loss of function mutations in any of the 3 genes that encode the laminin-332 polypeptide: LAMA3 or LAMB3 or LAMC2 (Figure 26.10) [27–29]. Some forms of junctional EB are termed non-Herlitz (OMIM226650). In these cases there may be extensive blisters at birth, but the disease typically lessens in severity with time, although atrophic wounds, abnormal dentition, and nail dystrophy persist, and alopecia is very common. This type of junctional EB is genetically heterogeneous. It may result from mutations in either the LAMA3, LAMB3, or LAMC2 genes (the subcomponents of laminin-332) or alternatively due to loss of function mutations on both alleles of the geneencoding type XVII collagen, COL17A1 [30]. The range of COL17A1 gene mutations includes missense, nonsense, frameshift, or splice-site mutations, but usually there is total ablation of type XVII collagen protein. Another subtype of junctional EB is associated with a further extracutaneous abnormality, namely pyloric atresia. Affected pregnancies are usually complicated 527

Part IV


α3

β3

A

γ2

B

C Figure 26.10 Laminin-332 mutations result in junctional epidermolysis bullosa. (A) Laminin-332 consists of 3 polypeptide chains: a3, b3, and g2. (B) Immunogold electron microscopy shows laminin-332 staining at the interface between the lamina lucida and lamina densa subjacent to a hemidesmosome (bar ¼ 50 nm). (C) Loss of function mutations in any one of these genes encoding the 3 polypeptides chains results in Herlitz junctional epidermolysis bullosa, which is associated with a poor prognosis, usually with death in early infancy.

by polyhydramnios, as fetuses with pyloric atresia cannot swallow amniotic fluid. Postnatally, feeding results in nonbilious vomiting. The severity of blistering in neonates is variable, but all cases involve molecular pathology in the a6b4 integrin complex [31,32]. Most patients have mutations in the gene encoding b4 integrin, ITGB4. Severe cases usually have nonsense or frameshift mutations, but some missense mutations at conserved amino acid regions or involving critical cysteine residues have been shown to underlie often lethal cases. Mutations in the ITGA6 gene are also usually associated with a more severe phenotype, but genotype/phenotype correlation can be difficult. Dystrophic EB represents a third type of inherited skin blistering, which may be inherited by autosomal dominant or autosomal recessive transmission (Figure 26.11). Ultrastructurally, the level of split is below the lamina densa, and the underlying molecular defect in all types of dystrophic EB involves mutations in the type VII collagen gene (COL7A1) [33]. Transmission electron microscopy reveals abnormalities in the number and/or morphology of anchoring fibrils, which 528

are principally composed of type VII collagen. Dominant forms of dystrophic EB are usually caused by heterozygous glycine substitution mutations within the type VII collagen triple helix [34]. These result in dominant-negative interference and disruption of anchoring fibril formation. Affected individuals have mild traumainduced blisters, mainly on skin overlying bony prominences such as the knees, ankles, or fingers. Blistering is followed by scarring and milia formation. Nail dystrophy is common. There are several variants of dominant dystrophic EB that may be distinguishable at a clinical level, including transient bullous dermolysis of the newborn (OMIM131705), pretibial dystrophic EB (OMIM131850), and EB pruriginosa (OMIM604129). It is clear that the COL7A1 pathology alone cannot account for the phenotypic variability of dystrophic EB and that other modifying genes or environmental factors may play a role. The most severe form of dystrophic EB is the autosomal recessive Hallopeau-Siemens subtype (OMIM226600). Blister formation in affected individuals starts from birth or early infancy, and the skin is very fragile. Wound healing is often poor, leading to chronic ulcer formation with exuberant granulation tissue formation, repeated secondary infection, and frequent scar formation. Mucous membranes are extensively affected, and esophageal involvement causes dysphagia and obstruction due to stricture. Affected individuals also have an increased risk of squamous cell carcinoma, particularly in areas of scarring or chronic ulceration (Figure 26.12) [35]. At least 50% of patients with Hallopeau-Siemens subtype die from squamous cell carcinoma by the age of 40 years [36]. The molecular pathology involves loss of function mutations on both alleles of the COL7A1 gene, leading to markedly reduced or completely absent type VII collagen expression at the dermal-epidermal junction. The reason for the increased risk of malignancy is not clear. In part, it may reflect a response to chronic scarring and protracted tissue injury, but at a molecular level critical domain interactions between type VII collagen and other molecules such as laminin-332 may be relevant to the promotion of malignancy. Less disruptive mutations in COL7A1 lead to non-HallopeauSiemens recessive dystrophic EB or other variants including dystrophic EB inversa (OMIM226450). Overall, genotype/phenotype correlation suggests that in recessive dystrophic EB the amount of type VII collagen that is expressed at the dermal-epidermal junction is inversely proportional to clinical severity in terms of scarring and extent of blistering. To maintain the structural function of the epidermis, a number of intercellular junctions exist, including desmosomes, tight junctions, gap junctions, and adherens junctions. Mutations in these junctional complexes result in several Mendelian inherited skin diseases. Desmosomes are important cell-cell adhesion junctions found predominantly in the epidermis and the heart. They consist of 3 families of proteins: the armadillo proteins, cadherins, and plakins (Figure 26.13). Mutations in desmosomal proteins result in skin, hair, and heart phenotypes (Figure 26.14). Armadillo proteins contain several 42 amino acid repeat domains and are homologous to the drosophila armadillo protein. They bind to other

Chapter 26


Blister

B

C

A

Normal anchoring fibrils

Figure 26.11 Clinicopathological abnormalities in the dystrophic forms of epidermolysis bullosa. (A) This form of epidermolysis bullosa is associated with variable blistering and flexion contraction deformities, here illustrated in the hands. (B) The disorder results from mutations in type VII collagen (COL7A1 gene), the major component of anchoring fibrils at the dermal-epidermal junction. This leads to blister formation below the lamina densa (lamina densa indicated by arrow). (C) In contrast, in normal human skin there is no blistering, and the sublamina densa region is characterized by a network of anchoring fibrils.

A

B

Figure 26.12 Squamous cell carcinoma (SCC) in recessive dystrophic epidermolysis bullosa. (A) Affected individuals have a 70-fold increased risk of developing SCC, here illustrated on the mid-back. (B) Light microscopy revealsa moderately differentiated SCC.

proteins through their armadillo domains and play a variety of roles in the cell, including signal transduction, regulation of desmosome assembly, and cell adhesion. Mutations in the plakophilin 1 gene (PKP1) result in autosomal recessive ectodermal dysplasia-skin fragility syndrome (OMIM604536) [37]. Affected individuals have a combination of skin fragility and inflammation and abnormalities of ectodermal development, such as scanty hair, keratoderma, and nail dystrophy. Pathogenic

PKP1 mutations are typically splice-site or nonsense mutations. Mutations in the plakophilin 2 gene (PKP2) result in autosomal dominant familial arrhythmogenic ventricular dysplasia 9 (OMIM609040), but without a skin phenotype. Autosomal dominant and recessive mutations have also been described in the plakoglobin gene (JUB). A recessive mutation results in Naxos disease (OMIM601214), a genodermatosis frequently seen on Naxos Island in the Mediterranean where approximately 529

DESMOGLEIN

DESMOCOLLIN

PLAKOGLOBIN

PLAKOPHILIN

DESMOPLAKIN

KERATIN

Figure 26.13 Protein composition of the desmosome linking two adjacent keratinocytes a moderately differentiated SCC. The major transmembranous proteins are the desmogleins and the desmocollins. Several desmosomal plaque proteins, including desmoplakin, plakophilin, and plakoglobin provide a bridge that links binding between the transmembranous cadherins and the keratin filament network within keratinocytes.

B

A

C

D

E

Figure 26.14 Clinical abnormalities associated with inherited gene mutations in desmosome proteins. (A) Recessive mutations in plakophilin 1 result in nail dystrophy and skin erosions. (B) Woolly hair is associated with several desmosomal gene abnormalities, particularly mutations in desmoplakin. (C) Recessive mutations in plakophilin 1 can result in extensive neonatal skin erosions, particularly on the lower face. (D) Recessive mutations in desmoplakin can lead to skin blistering. (E) Autosomal dominant mutations in desmoplakin do not result in blistering but can lead to striate palmoplantar keratoderma. 530

Chapter 26

1 in 1000 individuals is affected with clinical features of arrhythmogenic right ventricular dysplasia, diffuse palmar keratoderma, and woolly hair [38]. Autosomal dominant mutations in plakoglobin can also result in cardiomyopathy. The cadherins comprise a group of desmogleins and desmocollins, transmembranous glycoproteins that are present between keratinocytes. Heterozygous mutations in the desmoglein 1 gene (DSG1) result in autosomal dominant striate palmoplantar keratoderma (OMIM148700) [39]. The molecular pathology in this disorder results from desmoglein 1 haploinsufficiency. Autosomal dominant mutations in the desmoglein 2 gene (DSG2) give rise to arrhythmogenic ventricular dysplasia 10 (OMIM609160), but no skin phenotype. Mutations in desmoglein 3 have not been described in humans, but are known to result in the naturally occurring mouse balding phenotype. Mutations in the desmoglein 4 gene (DSG4) result in localized autosomal recessive hypotrichosis (OMIM607903) in which affected individuals have hypotrichosis restricted to the scalp, chest, arms, and legs, but sparing of axillary or pubic hair [40]. Papules on the scalp show atrophic curled-up hair follicles and shafts with marked swelling of the precortical region. Recessive mutations in desmoglein 4 may also underlie some cases of autosomal recessive monilethrix. Mutations in desmocollin 2 (DSC2) have been shown to result in autosomal dominant arrhythmogenic ventricular dysplasia 11 (OMIM610476), but there is no skin phenotype. Plakins comprise a family of proteins that cross-link the cytoskeleton to desmosomes. They include desmoplakin, envoplakin, periplakin, plectin, bullous pemphigoid antigen 1, corneodesmosin, and microtubule actin cross-linking factor. Mutations in the desmoplakin gene (DSP) result in a variable combination of skin, hair, and cardiac abnormalities [41,42]. These can be autosomal dominant or recessive. The phenotype in autosomal dominant cases ranges from cutaneous striate palmoplantar keratoderma to cardiac arrhythmogenic ventricular dysplasia 8 (OMIM607450). The phenotype in autosomal recessive patients ranges from skin fragility-woolly hair syndrome (OMIM607655) to other syndromes in which the skin and heart may be abnormal, such as dilated cardiomyopathy with woolly hair and keratoderma (OMIM605676). Some recessive DSP mutations may just result in a cardiac phenotype. Compound heterozygous mutations that almost completely ablate the desmoplakin tail have recently been demonstrated to produce the most severe clinical subtype known as lethal acantholytic epidermolysis bullosa [43]. Autosomal dominant mutations in the corneodesmosin gene (CDSN) result in hypotrichosis of the scalp (OMIM146520) [44]. Collectively, mutations in desmosomal genes give rise to variable abnormalities in skin, hair, and heart. Understanding the molecular pathology of these disorders and the precise phenotypic consequences of specific mutations provides insight into the clinical features in affected individuals and also allows for accurate diagnosis, improved genetic counseling, and more rigorous clinical follow-up to assess potential complications.


MOLECULAR PATHOLOGY OF COMMON INFLAMMATORY SKIN DISEASES Atopic dermatitis and psoriasis represent two of the most common inflammatory skin dermatoses. Traditional views on their pathologies usually reflect differing and varying contributions from primary abnormalities in keratinocytes or in immunocytes. However, recent molecular insights are now providing new ideas about disease susceptibility and pathogenesis. These discoveries have direct relevance to the classification of inflammatory skin diseases and to the design of future therapies based on specific molecular pathology. Atopic dermatitis is a chronic itching skin disease that results from a complex interplay between strong genetic and environmental factors [45]. Recent genetic studies suggest that a major abnormality is a generalized dysfunction of the epidermis manifesting as a compromised skin barrier and failure to protect adequately against microbial insults and antigens. The term atopic dermatitis encompasses a chronic pruritic inflammatory skin condition that is most common in early childhood and that predominantly affects the skin flexures. The identification and characterization of the pathophysiologic abnormalities in atopic dermatitis are important because of the substantial increase in the prevalence of the disease in industrialized countries where it affects 10%–20% of children and 1%–3% of adults. Atopic dermatitis is also known to be associated with other atopic conditions, including asthma and allergic rhinitis, known as the atopic triad. Of children with severe atopic dermatitis, about 60% have asthma and 35% have allergic rhinitis. There is strong evidence for a genetic contribution to the pathogenesis of atopic dermatitis—with enhanced phenotypic concordance in monozygotic relative to dizygotic twins. The atopic state is typically characterized by positive skin prick test responses to common environmental allergens, the presence of allergenspecific IgE in sera, an increase in total serum IgE levels, or a combination thereof. There are two forms of atopic dermatitis: the extrinsic and intrinsic forms. The former is associated with IgE-mediated sensitization, whereas the latter is characterized by a normal total serum IgE level and the absence of specific IgE responses to aero-allergens and food-derived allergens. Phenotype-based classifications, however, share several pathological features, including CD4 positive T-cell infiltration and disease histology. Although IgE sensitization is a not a necessary prerequisite for the development of atopic dermatitis, a number of primary immunologic abnormalities can be identified [46]. Compared to extrinsic forms of atopic dermatitis, the intrinsic variants tend to display different pathologic abnormalities, including reduced dermal infiltrate of eosinophils and eosinophil granular proteins, and a more moderate enhancement of lesional cytokine expression, including IL-13, eotaxin, and reduced surface expression of highaffinity receptor for IgE (FcZRI) on epidermal dendritic cells. These observations suggest that the molecular 531

Part IV


paths of intrinsic disease, therefore, may differ from the extrinsic form, and perhaps genetic influences might contribute in accounting for the dissimilarities. With regards to genetics, parent of origin effects may be relevant. The first evidence for atopy-related maternal inheritance was obtained in the early 1990s when a linkage peak influencing IgE responsiveness was mapped to chromosome 11q through the maternal cell line. Subsequently, mutations in the gene encoding the serine protease inhibitor, Kazal type 5 (SPINK5), have also been associated with atopic dermatitis when inherited from maternally derived alleles. A number of genome-wide linkage screens in atopic dermatitis have been described, and these report linkage to chromosomes 1q, 3q, 3p, and 17q. When phenotypes are combined, additional loci have been matched for atopic dermatitis and asthma to 20p; atopic dermatitis with increased allergen-specific IgE levels to 3p, 4p, and 18q; and atopic dermatitis with total serum IgE level to 16q. Linkage studies have also been complemented by direct candidate gene studies in a bid to explain the molecular pathology of atopic dermatitis. These include the b subunit of the high-affinity (FcZRIb) on 11q12–13 and the cytokine gene cluster located on chromosome 5q31–33. The latter includes several interleukins, GM-CSF, the CD14 antigen, T-cell immunoglobulin domain, mucin protein 1, and SPINK5. However, considerable recent work has focused on genes within the epidermal differentiation complex. To dermatologists, the association between atopic dermatitis and the monogenic disorder ichthyosis vulgaris (OMIM146700) has been evident for many years, given that several patients with ichthyosis vulgaris also have atopic dermatitis. Histopathologically, many cases of ichthyosis vulgaris are associated with abnormal (diminished) keratohyalin granules within the granular layer, and there is reduced immunohistochemical labeling for filaggrin in ichthyosis vulgaris skin. Filaggrin is the major component of keratohyalin granules. Filaggrin is a composite phrase for filament aggregating proteins, repeat units of complex polypeptides derived from profilaggrin that help aggregate keratin filaments in the formation of the epidermal barrier. Filaggrin expression has also been shown to be reduced in atopic dermatitis skin. Ichthyosis vulgaris has been mapped to the epidermal differentiation complex on chromosome 1q21, one of the loci that atopic dermatitis also maps to. Expression of the filaggrin gene in atopic dermatitis skin has also been shown to be reduced. In 2006, it was shown that ichthyosis vulgaris results from loss of function mutations in the FLG gene [2]. Ichthyosis vulgaris is a semidominant condition with heterozygotes displaying no phenotype or just mild ichthyosis, whereas homozygotes or compound heterozygotes have a more severe form of ichthyosis vulgaris with skin barrier defects. Filaggrin mutations are very common in the general population, occurring in approximately 10% of Europeans. Subsequently, it has been shown that filaggrin gene mutations are a major primary predisposing risk factor for atopic dermatitis (Figure 26.15) [3]. Atopic dermatitis is present at high frequency in carriers of filaggrin mutations with a relative risk (odds ratio) 532

for atopic dermatitis in heterozygotes of >3. A strong clinical indicator of filaggrin mutations in atopic dermatitis is palmar hyperlinearity. It is evident that approximately 50% of all cases of severe atopic dermatitis harbor mutations in the filaggrin gene. It has also been shown that the presence of filaggrin mutations is also a risk factor for asthma, but only for asthma in combination with atopic dermatitis, and not for asthma alone. This finding suggests that asthma in individuals with atopic dermatitis is secondary to allergic sensitization which develops because of the defective epidermal barrier that allows allergens to penetrate the skin to make contact with antigenpresenting cells. Filaggrin is not expressed in respiratory epithelium, and therefore the new data on filaggrin mutations offer an intriguing new concept that atopic asthma may be initiated as a result of a primary cutaneous (rather than respiratory) abnormality in some individuals. The hypothesis of a defective epidermal barrier underlying asthma, and indeed allergic sensitization, has been verified in several studies which have shown an association between filaggrin gene mutations and extrinsic atopic dermatitis associated with high total serum IgE levels and concomitant allergic sensitizations (Figure 26.16). Primary defects in filaggrin, however, are not the entire basis of the molecular pathology of atopic dermatitis. It is likely that genes in several other factors, particularly in milder cases of atopic dermatitis, are also important. These factors could include other skin barrier genes, genes affecting protease activity or Langerhans cell function, IgE receptors, mast cell activation, Th-2 cell biology, and cytokines (such as IL-31). It has also been shown that certain cytokines such as IL-4 or IL-12, which may be overexpressed in lesional atopic dermatitis skin, may also lead to secondary reductions in filaggrin protein expression, thereby providing a different route for the same defective skin barrier formation. The molecular pathology of atopic dermatitis is complex, but the recent focus on abnormalities of the epidermal barrier is providing fascinating new insights into understanding the nature and etiology of atopic dermatitis and perhaps novel treatments. The relevance of these findings, in the near future, is that atopic dermatitis is likely to be subdivided into specific subtypes based on a clearer understanding of the actual pathophysiologic changes. Aside from a structured reclassification of atopic dermatitis, the presence of filaggrin gene mutations is also set to influence and accelerate the design of new treatments that restore filaggrin expression and skin barrier function, given the new evidence that restoration of an intact epidermis may prevent both atopic dermatitis and cases of atopic dermatitis-associated asthma as well as systemic allergies. One of the common mutations in filaggrin is a nonsense mutation (R501X), which may represent an attractive drug target for small molecule approaches that modify post-transcriptional mechanisms designed to increase read-through of nonsense mutations and thereby stabilize mRNA expression. Other approaches that involve drug library screening or in silico methods to identify compounds capable of

Chapter 26


External allergens

Stratum corneum

Keratohyalin granules composed of filaggrin

Granular layer

Spinous layer

Basal layer

DermalEpidermal junction

A

Melanocyte

B

Langerhans cell

Figure 26.15 Clinicopathological abnormalities in atopic dermatitis. (A) Clinically, there is inflammation in the antecubital fossa with erythema erosions and lichenification. (B) Genetic or acquired abnormalities that lead to reduction in filaggrin expression in the granular layer disrupt the skin barrier permeability, which allows penetration of external allergens and presentation to Langerhans cells. Reduced filaggrin in skin may be a major risk factor for atopic dermatitis and increases susceptibility to atopic asthma and systemic allergies.

Are the cause of ichthyosis vulgaris

Are a major risk factor for atopic dermatitis Are associated with atopic dermatitis persisting into adulthood

May cause hyperlinearity of the palms

Occur in ~10% of some (European) populations

Loss-of-function mutations in the FLG gene

Are a major risk factor for asthma with atopic dermatitis Are associated with increased severity of atopic asthma

Are not associated with psoriasis or non-atopic asthma Can modify clinical expression of other diseases

Are implicated in the development of systemic allergies

Figure 26.16 Loss of function mutations in the filaggrin gene result in several common disease associations or susceptibilities. 533

Part IV


increasing filaggrin expression in the epidermis are also likely to lead to new evidence-based topical preparations suitable for the treatment of atopic dermatitis and ichthyosis vulgaris. Therefore, finding filaggrin mutations in ichthyosis vulgaris and atopic dermatitis represents one of the most significant recent discoveries in dermatologic molecular pathology. Psoriasis is a common and complex disease affecting approximately 2%–3% of the world’s population. It may manifest with inflammation in the skin as well as the nails and joints of patients. Historically, the pathogenesis of psoriasis has been weighted in favor of either primary pathology in keratinocytes or in the immune system. However, in recent years considerable evidence has emerged for specific patterns of immunologic abnormalities and for the critical role of certain cytokines and chemokine networks in psoriasis, findings that may be relevant to the design of new molecular therapies (Figure 26.17). There is overwhelming evidence that psoriasis has an important genetic component, in that there is a higher incidence among first and second degree relatives of patients than unaffected control subjects and there is a higher concordance in monozygotic compared to dizygotic twins [47]. The risk of a child developing psoriasis has been estimated to be approximately 15% if one

parent is affected, approximately 40% if both parents are affected, and approximately 6% if one sibling is affected, compared to 2% when no parent or sibling is affected. The disease has a bimodal distribution of age of onset, with an early peak between 16 and 22 years and a later one between 57 and 60 years. Linkage studies have identified several genetic loci. These include PSORS1 at 6p21.3, PSORS2 at 17q, PSORS3 at 4q, PSORS4 at 1q, PSORS5 at 3q, PSORS6 at 19q, PSORS5 at 3q, PSORS6 at 19q, PSORS7 at 1p, and PSORS8 at 16q. Early-onset psoriasis has been linked to the PSORS1 locus, which contains HLA-Cw6. Aside from genetic risk factors, environmental risk factors include trauma (the Ko¨bner phenomenon at sites of injury), infection (including Streptococcal bacteria and human immunodeficiency virus infections), drugs (lithium, antimalarials, b-blockers, and angiotensinconverting enzymes), sunlight (in a minority), and metabolic factors (such as high dose estrogen therapy and hypocalcemia). Other factors including psychogenic stress, alcohol, and smoking have also been implicated. Initial immunologic research in psoriasis focused on the role of prostaglandins and leukotrienes as key mediators of the inflammatory process. Subsequently, emphasis switched from arachidonic acid derivatives to cytokines and chemokines, small proteins that are

EPIDERMIS

3

4 PDC

1 IFN-α

TNF-α IFN-γ IL-17

T CELL

DDC DERMIS

1

5

TNF-α IL-23 2 ECM

Figure 26.17 Abnormalities and therapeutic potential for inflamed skin in psoriasis. There is increasing evidence for a role of tissue-resident immune cells in the immunopathology of psoriasis. New therapies may be developed by (1) antagonizing local cytokines and chemokines, such as IFN-a; (2) blocking of adhesion molecules (e.g., integrins) and co-stimulatory molecules within the tissue; (3) modification of keratinocyte proliferation and differentiation (e.g., use of corticosteroids or vitamin D preparations); (4) blocking of entry of dermal T-cells into the epidermis, and (5) modification of the microenvironment, including the extracellular matrix (based on original figure published by [87]). 534

Chapter 26

produced by almost every activated cell in the body and which regulate cell/cell interactions in immune responses and other processes such as wound healing, angiogenesis, hematopoiesis, and tissue remodeling. Cytokines and chemokines may interact with specific receptors and can influence cells in autocrine, juxtacrine, and paracrine fashions. Psoriatic plaques have been shown to contain cytokines such as TNFa, IFN-g, IL-1, IL-2, IL-6, IL-8, IL-15, IL-17, IL-18, IL-19, IL-20, and IL-23, as well as chemokines and chemokine receptors, including CCL2, CCL3, CCL4, CCL5, CCL17, CCL19, CCL20, CCL27, CXCL1, CXCL8, CXCL9, and CXCL10. A detailed knowledge of cytokine expression has helped define whether psoriasis is a Th-1 or Th-2 disorder. Th-1 diseases are typically associated with production of IL-2, IFN-g, and TNFa, which promote a T-cell mediated reaction. Conversely in the Th-2 cytokine network response, the immune signals include IL-3, IL-4, IL-5, and IL-10 which contribute to a humoral or B-cell-mediated immune reaction. Psoriasis has traditionally been considered as a Th-1 disease, based on the identification of IFN-g and TNFa in the lesions with little or no detection of IL-4, IL-5, or IL-10. More recently, other cytokines including IL-18, IL-19, IL-22, and IL-23 have been identified as being upregulated in psoriatic lesions. With relevance to the molecular pathology of psoriasis, one of the first clues came from the observation of clearing of psoriasis in renal transplant patients given the immunosuppressant cyclosporin A. In psoriatic skin that resolved in these individuals, there were reductions in levels of several cytokines, indicating a connection between immunocytes, cytokines, and maintenance of psoriatic plaques. Attempts were then made to therapeutically administer Th-2-type cytokines, such as IL-10, IL-4, or IL-11, to psoriatic patients. However, none of these therapies had any sustained clinical benefits. Nevertheless, the effects of neutralizing a single cytokine can be extremely helpful, particularly with the use of anti-TNFa therapy, a treatment that was initially developed for patients with sepsis. TNFa blockers or receptor blockers are beneficial in patients with psoriasis, but it is unclear if the improvement of psoriatic plaques and arthritis with these agents is due to local or systemic effects. Intriguing new ideas, however, have recently been gleaned from specific mouse models, in which prepsoriatic skin is grafted onto a special type of immunodeficient mouse known as an AGR mouse (which lacks type I or IFN-a receptors and lacks type II or IFN-g receptors, and is RAG deficient). In such mice, psoriatic plaques develop spontaneously. However, if these mice receive injections of anti-TNFa agents, psoriasis does not develop. This demonstrates that resident immunocytes, contained within pre-psoriatic skin, are necessary and sufficient to trigger psoriasis and that the local production of TNFa is critically important in the generation of skin lesions. A pertinent finding from this AGR mouse model is the lack of recirculation or recruitment of cells from the bloodstream necessary to create a psoriatic lesion. Thus, it may not be therapeutically advantageous to try to block trafficking


of immunocytes at inflammatory sites by targeting endothelial cell adhesion molecules or chemotactic polypeptides generated in the dermis. For example, clinical trials targeting endothelial cell leukocyte adhesion molecule 1 did not result in clinical benefit in psoriatic patients. Two recent findings have provided intriguing new insight into the molecular pathology of psoriasis. One observation involves the finding that the innate immune response b cathelicidin molecule LL-37 may be capable of modifying DNA to form an autoantigen. The other discovery is that investigators are now exploring other possible cytokines besides TNFa and IFN-g and are making promising advances by focusing on the IL-12/IL-23-mediated pathway [48]. A new area of investigation in the field of chronic inflammation centers around a possible inflammatory axis in which IL-12/IL-23 influence levels of a cytokine known as IL-17. This has led to a new paradigm through which Th-17-type T-cells contribute to autoimmunity and chronic inflammation. Thus, besides a Th-1 or Th-2 type immune system, there is also a cytokine network dominated by a Th-17 type response. IL-17 may be important in psoriasis because it can promote accumulation of neutrophils and can affect skin barrier function by inducing release of proinflammatory mediators by keratinocytes. Understanding the molecular role of IL-17 in psoriatic skin may provide new insights for developing novel therapies. However, at present it is unclear whether the primary cellular target within psoriatic plaques involves keratinocytes, macrophages, dendritic cells, T-cells, mast cells, neutrophils, fibroblasts, or endothelial cells, but a clearer understanding of cytokines and chemokine networks in psoriasis is unraveling the molecular pathology of this common inflammatory disease, and this may have potential benefits for patients in the not-too-distant future.

SKIN PROTEINS AS TARGETS FOR INHERITED AND ACQUIRED DISORDERS The integrity of the skin as a mechanical barrier depends, in part, on adhesive complexes that link cellto-cell and cell-to-basement membrane. Two key junctional complexes in this task are the hemidesmosomes and the desmosomes. Key insight into the contribution individual components of hemidesmosomes and desmosomes make to skin adhesion has been determined from a variety of in vitro knockdown studies and in vivo animal models as well as a range of naturally occurring human gene mutations that lead to a diverse group of skin fragility disorders. Defects in many desmosomal or desmosomal proteins also lead to other clinical abnormalities (including extracutaneous involvement) or other cell biologic abnormalities (such as changes in cell proliferation or differentiation). However, in addition to genetic diseases, other clues to the function of hemidesmosomal and desmosomal proteins have been derived from animal models or human diseases, in which the same structural proteins can be targeted and disrupted by autoantibodies (Figure 26.18). Thus, 535

Part IV


A

C

B

Figure 26.18 Clinical pathology resulting from autoantibodies against desmosomes or hemidesmosomes. (A) Pemphigus vulgaris resulting from antibodies against desmoglein 3; (B) Bullous pemphigoid associated with antibodies against type XVII collagen; (C) Mucous membrane pemphigoid associated with antibodies to laminin-332.

pemphigoid, a chronic vesiculo-bullous disease that usually affects the elderly. Histology shows subepidermal blisters with eosinophils, and the pathogenic antibodies are usually directed against a particular epitope (within the NC16A domain) in the first noncollagenous extracellular part of type XVII collagen. IgG1 subclass autoantibodies are found in patients with active

several hemidesmosomal and desmosomal proteins may serve as target antigens for both inherited and acquired disorders (Figure 26.19) [49]. One of the main transmembranous hemidesmosomal proteins is type XVII collagen, also known as the 180 kDa bullous pemphigoid antigen. Autoantibodies against this protein typically result in bullous

Keratins 5 & 14

Bullous Pemphigoid -like Bullous Pemphigoid -like

EB acquisita

Bullous Pemphigoid

Plectin 230-kDa BP Ag α6β4 integrin

Type XVII collagen

Laminin 332

Mucous Membrane pemphigoid Mucous Membrane pemphigoid

Type VII collagen

Bullous SLE

Figure 26.19 Illustration of hemidesmosomal structural proteins and the autoimmune diseases associated with antibodies directed against these individual protein components. 536

Chapter 26

skin lesions, whereas IgG4 autoantibodies are found in patients in remission. Besides bullous pemphigoid, other blistering conditions may also have autoantibodies against type XVII collagen. For example, pemphigoid gestationis, which is an acute, pruritic vesiculo-bullous eruption, is seen in pregnant women. Patients produce autoantibodies against the same epitope of type XVII collagen. It has been proposed that this disease is initiated by the aberrant expression of major histocompatibility complex type II antigens of a paternal haplotype within the placenta. IgA autoantibodies against the NC16A domain of type XVII collagen give rise to two different skin diseases: chronic bullous disease of childhood and linear IgA bullous dermatosis. Chronic bullous disease of childhood usually presents in young children with clustered tense bullae, often in the perioral or perineal regions. Clinical manifestations can mimic bullous pemphigoid or dermatitis herpetiformis. In chronic bullous disease of childhood and linear IgA disease, histology shows subepidermal collections of neutrophils with linear IgA deposition at the dermal-epidermal junction. A further disease with autoantibodies against type XVII collagen is lichen planus pemphigoides. Patients typically have lichen planus lesions mixed with tense blisters, either on lichen planus lesions or on normal skin. Autoantibodies react with epitopes within the NC16A domain, but the precise epitope is different from bullous pemphigoid. Autoantibodies to type VII collagen, the major component of anchoring fibrils, give rise to two different conditions: epidermolysis bullosa acquisita and bullous systemic lupus erythematosus. Patients with epidermolysis bullous acquisita have subepidermal blisters. In some patients, the blistering phenotype can resemble bullous pemphigoid, but in others the inflammation leads to scarring and milia formation at trauma-prone sites, more


reminiscent of an inherited form of skin blistering such as dystrophic epidermolysis bullosa. In both epidermolysis bullosa acquisita and bullous systemic lupus erythematosus, there is linear deposition of IgG at the dermalepidermal junction. However, a useful technique in immunodermatology to distinguish epidermolysis bullosa acquisita from bullous pemphigoid is indirect immunofluorescence using 1 M sodium chloride split-skin (Figure 26.20). Incubation of normal skin in saline results in a split within the lamina lucida. Thus, certain skin antigens such as type XVII collagen map to the roof of the split, whereas others such as type VII collagen map to the base. This means that in bullous pemphigoid and epidermolysis bullosa acquisita, labeling with sera from patients with these conditions on salt-split skin can permit an accurate diagnosis to be made. Specifically, if the IgG maps to the roof of the split, the diagnosis is bullous pemphigoid, whereas if it maps to the base, this is epidermolysis bullous acquisita. The salt-split technique can sometimes be used on skin biopsies taken from patients to see whether in vivo bound IgG maps to the roof or base. However, in most laboratories using patient sera on normal salt-split skin is the more widely practiced technique. Another autoimmune blistering condition that targets hemidesmosomal components is mucous membrane pemphigoid (previously known as cicatricial pemphigoid). This is a chronic progressive autoimmune subepithelial disease characterized by erosive lesions of the skin and mucous membranes that result in scarring. Lesions commonly affect the ocular and oral mucosa. Direct immunofluorescence studies show IgG and/or IgA autoantibodies at the dermal-epidermal junction. Salt-split indirect immunofluorescence can show epidermal, dermal, or roof and base labeling patterns, which reflects the different autoantigens seen in this disease. In most cases, the target epitope is part of the extracellular domain of type XVII collagen,

Keratins 5 and 14 Plectin α6β4 integrin

230-kDa BP antigen Type XVII collagen

Laminin-332 Type IV collagen

Type VII collagen

Figure 26.20 Salt-split skin technique to diagnose immunobullous disease. Incubation of normal human skin in 1M NaCl overnight at 4 C results in cleavage through the lamina lucida. This results in separation of some proteins to the roof of the split and some to the base (above and below pink line on the schematic). In the skin labeling shown, immunoglobulin from a patient’s serum binds to the base of salt-split skin. Further analysis revealed that the antibodies were directed against type VII collagen. This technique is useful in delineating bullous pemphigoid from epidermolysis bullosa acquisita, both of which are associated with linear IgG at the dermal-epidermal junction in intact skin. 537

Part IV


although this differs from the epitope associated with bullous pemphigoid. A minority of patients with mucous membrane pemphigoid display antibodies against laminin-332. This is an important subset of patients to identify since there is association with certain solid tumors, particularly malignancies of the upper aero-digestive tract (Figure 26.21) [50]. Cases of mucous membrane pemphigoid with antibodies to b4 integrin tend to have only ocular involvement and may therefore be referred to as ocular mucous membrane pemphigoid [51]. Although many of the immunobullous diseases that target hemidesmosomal proteins involve immunopathology in which antibodies are initially directed against critical epitopes on individual proteins, it has been shown that in many cases there may be several antigens targeted by humoral immunity. This phenomenon is known as epitope spreading and reflects chronic inflammation that may alter the immunogenicity of other neighboring proteins involved in adhesion [52]. Epitope spreading can involve the generation of antibodies to further epitopes on the same protein or to other epitopes on different structural proteins. It may be an immunologic observation with no clinical sequelae, but in some patients epitope spreading can lead to transition from one autoimmune disease to another. Published examples include transition from mucosal dominant pemphigus vulgaris to mucocutaneous pemphigus vulgaris, pemphigus foliaceus to pemphigus vulgaris, bullous pemphigoid to epidermolysis bullosa acquisita, dermatitis herpetiformis to bullous pemphigoid, pemphigus foliaceus to bullous pemphigoid, and concurrent bullous pemphigoid with pemphigus foliaceus. Antibodies to the plakin protein, desmoplakin, which are characteristically found in paraneoplastic pemphigus, have also been detected in pemphigus vulgaris as well as oral and genital lichenoid reactions. In epidermolysis bullosa acquisita, antibodies

Anti-type XVII collagen auto-antibodies

MUCOUS MEMBRANE PEMPHIGOID

Anti-laminin-332 auto-antibodies

Figure 26.21 Mucous membrane pemphigoid may be associated with autoantibodies against either type XVII collagen or laminin-332. Distinction between the two may have clinical relevance since antilaminin-332 antibodies in mucous membrane pemphigoid can be associated with malignancy (especially of the upper aero-digestive tract) in some patients. 538

to laminin-332 may be found in addition to the typical type VII autoantibodies. In bullous systemic lupus erythematosus, multiple autoantibodies against type VII collagen, bullous pemphigoid antigen 1, laminin-332, and laminin-311 have been reported. The phenomenon of epitope spreading is perhaps best exemplified in paraneoplastic pemphigus, which is characteristically associated with autoantibodies against many desmosomal and hemidesmosomal proteins, including desmogleins, plakins, bullous pemphigoid antigen 1, plectin, and plakoglobin. In addition to hemidesmosomal proteins, the structural components of desmosomes may also be targets for autoimmune diseases. The skin blistering disease pemphigus is associated with autoantibodies against desmosomal cadherins, principally desmoglein 3 and desmoglein 1. However, the intraepithelial expression patterns of desmoglein 1 and desmoglein 3 differ between the skin and mucous membranes, giving rise to different clinical manifestations when patients have antibodies against different desmogleins. In the skin, desmoglein 1 is expressed throughout the epidermis but more so in superficial parts, as opposed to desmoglein 3, which is predominantly expressed in the basal epidermis. In the oral mucosa, both types of desmogleins are expressed throughout the epithelium, but desmoglein 1 is expressed at a much lower level than desmoglein 3. When there is co-expression of desmoglein 1 and desmoglein 3, these proteins may compensate for each other, but when expressed in isolation, specific pathology can arise when those proteins are targeted by autoantibodies [53]. For example, when there are only desmoglein 1 antibodies in the skin, blisters appear in the superficial epidermis, a site where there is no co-expression of desmoglein 3, whereas in the basal epidermis, the presence of desmoglein 3 can compensate for the loss of function of desmoglein 1. In the oral epithelium, keratinocytes express desmoglein 3 at a much higher level than desmoglein 1, and despite the presence of desmoglein 1 antibodies, no blisters form. Therefore, sera containing only desmoglein 1 antibodies cause superficial blisters in the skin without mucosal involvement, and the clinical consequences are pemphigus foliaceus and its localized form, pemphigus erythematosus. Desmoglein 1 is also the target antigen in endemic pemphigus, known as fogo selvagem. Desmoglein autoantibodies result in skin with very superficial blisters, such that crust and scale are the predominant clinical features. Desmoglein 1 may also be targeted in a different manner—not by autoantibodies, but by bacterial toxins (Figure 26.22). Specifically, exfoliative toxins A-D which are produced by Staphylococcus aureus, specifically cleave the extracellular part of desmoglein 1 [54]. This leads to bullous impetigo and Staphylococcal scalded skin syndrome with superficial blistering in the epidermis, findings that are histologically similar to pemphigus foliaceus associated with autoantibodies to the extracellular part of desmoglein 1. When the sera of a patient contains only desmoglein 3 autoantibodies, co-expressed desmoglein 1 can compensate for the impaired function of desmoglein 3, resulting in no or only limited skin lesions. However, in the mucous membranes, oral erosions

Chapter 26


B

A

C

Figure 26.22 Clinical consequences of disruption of desmoglein 1 in human skin. (A) Staphylococcal toxins cleave the extracellular part of desmoglein 1 and result in staphylococcal scalded skin syndrome. (B) Inherited autosomal dominant mutations in desmoglein 1 can result in striate palmoplantar keratoderma. (C) Autoantibodies against desmoglein 1 result in pemphigus foliaceus, which is associated with superficial blistering and crusting in human skin.

predominate, as desmoglein 1 cannot compensate for the impaired desmoglein 3 function because of its low expression. Therefore, the patient typically has painful oral ulcers without much initial skin involvement. This accounts for the clinical phenotype in patients with the mucosal dominant type of pemphigus vulgaris. However, when sera contain antibodies to both desmoglein 1 and desmoglein 3, as seen in the mucocutaneous type of pemphigus vulgaris, patients have extensive blisters, mucosal erosions and skin blisters, because the function of both desmogleins is disrupted. Intercellular autoantibodies in pemphigus are typically composed of IgG isotypes, although some patients with superficial blistering may have intercellular autoantibodies of the IgA subclass. There are two clinical subtypes of IgA pemphigus. One is a subcorneal pustular dermatosis subtype (although this should not be confused with the nonautoimmune Snedden-Wilkinson syndrome), and this is associated with flaccid vesicopustules with clear fluid and pus arranged in an annular/ polycyclic configuration. Indirect immunofluorescence studies show IgA autoantibodies reacting against the superficial epidermis. These antibodies usually recognize epitopes within the desmosomal cadherin, desmocollin 1. In contrast, IgA pemphigus patients may have a different phenotype known as the intraepidermal neutrophilic subtype that presents with a sunflower-like configuration and pustules and vesicles with indirect immunofluorescence showing IgA intercellular autoantibodies throughout the entire thickness of the epidermis. As well as spontaneous onset cases of pemphigus, certain drugs such as D-penicillamine can lead to drug-

induced pemphigus. Most patients have autoantibodies against the same target epitopes as pemphigus patients. In paraneoplastic pemphigus, the clinical presentation involves progressive blistering and erosions on the upper trunk, head, neck, and proximal limbs with an intractable stomatitis. Erythema multiforme-like lesions on the palms and soles can help distinguish the condition from ordinary pemphigus. Indirect immunofluorescent studies on rat bladder, an organ rich in transitional epithelial cells, demonstrate IgG intercellular autoantibodies consistent with autoimmunity against plakin proteins although numerous antigenic targets are usually present. Collectively, these autoimmune diseases that target hemidesmosomal or desmosomal proteins illustrate the clinical and biologic consequences of targeting specific proteins through autoimmune assault. There may be some similarities to the inherited mechanobullous diseases in which there are fundamental mutations in the genes that encode these same proteins, but clearly super-added inflammation results in some clinical differences. Nevertheless, the inherited and acquired diseases that target skin proteins do provide new insight into how specific skin proteins contribute to maintaining skin integrity.

MOLECULAR PATHOLOGY OF SKIN CANCER Skin cancer is very common. Nonmelanoma skin cancers, which include basal cell carcinomas (BCCs) and squamous cell carcinomas (SCCs), are the most 539

Part IV


common forms of human neoplasia, affecting about 1 million Americans each year [36]. Of these, BCCs alone account for 750,000 new cases per year. It is estimated that 1:3 Caucasians born in the United States after 1994 will develop at least one BCC in their lifetime. Likewise, the incidence of melanoma has been increasing since the mid-1990s at an annual rate of 3%–7% for Caucasian populations. For those Americans born in 2000, there is a lifetime risk of 1:75 of developing melanoma. Currently, approximately 60,000 new melanomas will be diagnosed in the United States each year [55]. However, recent insight into the molecular pathology of both nonmelanoma skin cancer and melanoma is providing new opportunities to understand how and why these tumors occur, as well as providing a basis for molecular target-based chemo-prevention and novel therapeutic management of skin cancer. The main risk factor for skin neoplasia is environmental exposure to ultraviolet irradiation. The ultraviolet component of sunlight can be divided into 3 energy subtypes: UVC (100–280 nm), UVB (280–315 nm), and UVA (315– 400 nm). The action spectra for UVB and UVC closely match the absorption spectrum of DNA, resulting in the formation of pyrimidine dimers, involving nucleotides, thiamine (T), and/or cytosine (C). In contrast, UVA is absorbed by other cellular chromophores, thereby generating oxygen-reactive species such as hydroxyl radicals. These can result in DNA strand breaks and chromosome translocations. Of the ultraviolet light that reaches the earth, UVC is completely absorbed by stratospheric ozone, whereas UVA accounts for more than 90%, and UVB approximately 10%. Most UVB-induced mutations are located almost exclusively at dipyrimidine nucleotide sites (TT, CC, CT, and TC). Approximately 70% of observed mutations are C-to-T transitions and 10% are CC-to-TT, the latter representing an ultraviolet signature mutation [56]. A few other mutagens are known to involve tandem bases. Cellular mechanisms of DNA repair are not always effective, and these ultraviolet B-induced mutations can proceed unchecked, becoming permanent and subsequently inherited by all the progeny of the mutated cell, thereby allowing expression of the aberrant gene/protein function. Aside from ultraviolet radiation inducing DNA point mutations and small deletions, it may also result in gross chromosomal changes. Both UVA and UVB irradiation can induce formation of micronuclei which are cytogenic indicators of chromosomal damage. These round particles of genetic material are believed to result from DNA double-strand breaks, which form as a result of DNA repair of ultraviolet-induced pyrimidine dimers and/or free radical formation. Collectively, these genetic/chromosomal changes initiate and promote cancer formation as well as the increased genomic instability and loss of heterozygosity (LOH) frequently observed in nonmelanoma skin cancer. Cytogenic analysis has enabled the identification of a number of chromosomal abnormalities associated with nonmelanoma skin cancer and has implicated certain regions containing oncogenes and tumor suppressor genes that may be involved in their development. For example, in BCCs, early LOH 540

studies identified regions on chromosome 9q22 as a common observation specific to these tumors. These regions harbor the Patched tumor suppressor gene (PTCH), which is a transmembrane receptor involved in the regulation of hedgehog signaling (Figure 26.23). Subsequently, the discovery of mutations that are known to activate hedgehog signaling pathways, including PTCH, Sonic hedgehog (Shh), and Smoothened (Smo), implicates hedgehog signaling as a fundamental transduction pathway in skin tumor development [57]. Shh is responsible for several important functions during embryogenesis, including neural tube patterning and the development of left-right symmetry, limb polarization, and the morphogenesis of various organs including the axial skeleton, limbs, lungs, skin, hair, and teeth. In skin, the Shh pathway is crucial for maintaining the stem cell population and regulating the development of hair follicles and sebaceous glands. Although key embryonic developmental signaling pathways may be switched off during adulthood, aberrant activation of these pathways in adult tissue is often oncogenic. The Shh pathway may be activated in many neoplasms, including BCCs, medulloblastoma, rhabdomyosarcoma, and abnormalities in Shh signaling pathway components—such as Shh, PTCH1, Smo, GLI1, and GLI2—are major contributing factors in the development of BCCs. The function of PTCH1 is to repress Smo signaling. This function is impaired when PTCH1 is mutationally inactivated or when stimulated by Shh binding: both of these lead to uncontrolled Smo signaling. Downstream of Smo are the GLI transcription factors. Overexpression of GLI1 or GLI2 can lead to BCC development, and GLI1 can also activate PDGF-a, the expression of which may be increased in BCCs. The roles of other Smo target molecules such as the suppressor of fused Su(Fu) and protein kinase A (PKA) in the development of BCC are not fully understood. Other components of the pathway include a putative antagonist of Smo signaling, known as hedgehog interacting protein (HIP), and an actin binding protein, missing in metastases (MIM), which is an Shh responsive gene. MIM is a part of the GLI/Su(Fu) complex and potentiates GLI-dependent transcription using domains distinct from those used for monomeric actin binding. Alterations in Shh regulate cell proliferation and associated cell cycle events. Shh overexpression leads to epidermal hyperplasia, accompanied by the proliferation of normally growth-arrested cells. Shh-expressing cells fail to exit the S and G2/M phases in response to calcium-induced differentiation signals and are unable to block the p21CIP1/WAF1/induced growth arrest in skin keratinocytes. Furthermore, PTCH1 protein interacts with phosphorylated cyclin B1 and blocks its translocation to the nucleus. The Shh/GLI pathway also upregulates expression of the phosphatase CDC25b, which is involved in G2/M-transition. Thus, the loss of regulation of cell cyclin control is associated with the development of epithelial cancers, including BCCs. Patients with the autosomal dominant disorder known as nevoid basal cell carcinoma syndrome or Gorlin syndrome (OMIM109400) have substantially

Part IV


SHH

SHH mutations in ~1% of sporadic BCCs

SHH mutations in ~20% of BCCs in patients with Xeroderma pigmentosum

PTCH

Gorlin syndrome: Germinal mutations Loss of heterozygosity In BCCs PTCH mutations in 10-40% of sporadic BCCs

SMO

SMO mutations in 5-15% of sporadic BCCs

SMO mutations in ~30% of BCCs in patients with Xeroderma pigmentosum

PTCH mutations in ~70-90% of BCCs in patients with Xeroderma pigmentosum

C Figure 26.23—Cont’d (C) Mutations in SHH or PTCH or SMO may be associated with basal cell carcinomas, both in sporadic tumors as well as in certain genodermatoses, such as xeroderma pigmentosum, that are associated with an increased risk of BCC. Germinal mutations in the PTCH gene underlie Gorlin’s syndrome. (Based on original figures published by [88]).

increased susceptibility to BCCs and other tumors, including medulloblastomas, meningiomas, fibromas, rhabdomyomas, and rhabdomyosarcomas. They may also manifest jaw cysts and ectopic calcification, spina bifida, rib defects, palate abnormalities, coarse facies, hypertelorism, microcephaly, and skeletal abnormalities with bony and soft tissue overgrowth. Affected individuals develop BCCs on any part of the body, particularly in sun-exposed skin. These patients have heterozygous germline mutations in the PTCH gene [58]. The BCCs in these individuals retain a mutant germline and lose the wild-type allele as a second hit. Mutations in the PTCH gene have also been demonstrated in up to 40% of sporadic BCCs, emphasizing that PTCH gene mutations are important in the development of BCCs. Other sporadic BCCs which do not have mutations in PTCH may carry mutations in the Smo gene [59]. An understanding of the mutations that lead to activation of hedgehog signaling has thus expanded our knowledge of the genetic basis of BCCs. Although most therapy for BCC is straightforward, involving local surgery, cryotherapy, radiotherapy, or topical chemotherapy, insight into the molecular pathology of BCC has led to development of a number of animal models that may be useful in developing chemo-prevention strategies, as well as confirming specific contributions from hedgehog signaling pathway components. For example, drugs such as cyclopamine are known to be a specific inhibitor of Shh signaling. 542

Other possible chemo-prevention strategies might involve small molecule hedgehog signaling inhibitors or immunosuppressive agents such as rapamycin, which is an inhibitor of GLI1. Overall, the molecular dissection of the Shh pathway has provided novel insight into the molecular pathology of BCCs as well as other cancers. It is likely that this information will lead to the development of various agonists and antagonists of the pathway that can have clinically relevant regulatory or curative roles. Development of small molecules that have specific agonist or antagonist pharmacologic functions might therefore be exploited to develop new therapeutics for the treatment of skin cancers and other tumors that are associated with aberrant activity of this pathway. Like BCC, melanoma is another tumor that may be entirely curable by early recognition and therapeutic intervention. Nevertheless for patients with advanced metastatic melanoma, the 5-year survival is currently estimated at only 6% with a median survival time of 6 months [60]. It is important, therefore, to try to understand the molecular pathology of melanoma to determine which patients are most at risk and which tumors will exhibit the most aggressive biology. Dissection of the melanoma genome has revealed a number of driver mutations (those that probably influence the growth of tumors) and passenger mutations (those that do not specifically promote tumor growth). One important pathway is the RAS/Mitogen-activated

Chapter 26

protein kinase (MAPK) pathway, which regulates cell proliferation and survival in several cell types (Figure 26.24) [61,62]. Activating cell mutations in NRAS and BRAF have a combined prevalence of approximately 90% in melanoma and in benign melanocytic lesions, suggesting that activation of the MAPK pathway is an early essential step in melanocytic proliferation. Activating somatic NRAS mutations occur in 10%–20% of melanomas. Of note, 3 highly recurrent NRAS missense changes represent over 80% of all mutations in this gene. NRAS mutations are more common on chronically sunexposed sites and appear to occur early in tumorigenesis as well as being common in congenital nevi. Downstream of NRAS, activating mutations in BRAF have been identified, including a common missense mutation at valine 600. This mutation is equally prevalent in benign nevi and in melanoma, suggesting that BRAF activation is necessary for melanocytic proliferation, but not for tumorigenesis. To date, there has been no correlation between BRAF mutations, disease progression, and clinical outcome. A proto-oncogene, KIT, encodes the stem cell factor receptor tyrosine-kinase found on numerous cell types,


including melanocytes. Oncogenic mutations and increases in copy number of KIT appear to be more prevalent in rarer types of melanoma, such as those occurring at acral or mucosal sites. c-KIT signals via the MAPK pathway, and a downstream target is microphthalmia transcription factor (MITF), which is a critical regulator of melanocyte function. MITF regulates the development and differentiation of melanocytes and maintains melanocyte progenitor cells. MITF has a clear role in melanocyte survival, and one of its transcriptional targets is the apoptosis antagonist and proto-oncogene BCL-2. Apart from MAPK signaling, another pathway, the V-RAS/ phosphatidylinositol-3 kinase (PIK3) pathway, may also be activated in certain melanomas. Although PIK3 itself is not mutated in melanoma, several downstream components may have a role in melanoma tumorigenesis, including PTEN and Akt. PTEN has a tumor suppressor role in melanomas, and its expression has been shown to be reduced or lost in some primary or metastatic melanomas. Restoration of PTEN in PTEN-deficient melanoma can reduce melanoma tumorigenicity and metastases. Changes in PTEN expression are not usually due to mutations, but involve epigenetic inactivation of both

c-KIT

Imatinib mesylate

0-40% mutated

Farnesyltransferase inhibitors NRAS Sorafenib

BRAF

PTEN 20% mutated

PI3K

60% mutated CI-1040 PD-0325901 AZD6244 Anthrax LT

MEK

CELL SURVIVAL

AKT

Deletion, epigenetic changes or mutation in 50%

Amplification or activation in 60%

ERK Bcl-2 RNAi

Oblimersen mTor

MITF

Amplification In 20%

TRANSCRIPTION

Rapamycin CCI-779 RAD-001

Figure 26.24 Potential for targeted therapies in melanoma. Recent improvement in defining the genetics of melanoma has led to the development of targeted therapeutic agents that are directed at specific molecular aberrations involved in tumor proliferation and resistance to chemotherapy. (Based on an original figure published by [89]). 543


Understanding the molecular pathology of skin diseases has the potential to bring about several clinical and translational benefits for patients. Molecular data are helpful in diagnosing both inherited and acquired skin diseases and also contribute to improved disease classification, prognostication, clinical management, and the feasibility for designing and developing new treatments for patients. In many infectious diseases, the gold standard for diagnosis is identification of infectious agents by culture and species identification. However, material yield can be unsatisfactory, and the process can take several weeks, or months, before a pathogen is identified. Indeed, certain diseases can be caused by different micro-organisms, and these may have different responses to antimicrobial agents. For example, subcutaneous mycosis with lymphangiotic spread is typically caused by the mold Sporothrix schenckii, but lymphatic sporotrichoid lesions can be caused by diverse pathogens. These include other nontuberculous mycobacteria, most typically Mycobacterium marinum, a common pathogen for fish tank granuloma in people who keep tropical fish. Infections by other mycobacteria, other than tuberculosis, that cause the same phenotype include M. chelonae, M. fortuitum, and M. abscessus. Lymphangiotic sporotrichoid-like lesions can also result from infection by bacteria such as Nocardia species, and therefore, precise identification of species is very important in the optimal clinical management of such infections. Mycetoma is another chronic localized skin 544

Polyclonal Smear

Clonal Bands

Blood

MOLECULAR DIAGNOSIS OF SKIN DISEASE

infection caused by different species of fungi or actinomycetes. Grains from the lesions contain pathogenic organisms, but final organism identification can be protracted. Nevertheless, molecular biology is able to help since sequence-based identification of large ribosomal subunits specific to particular organisms can be used to identify and characterize certain organisms that contribute directly to disease pathogenesis [65]. PCR and sequencing approaches are also useful in identifying subsets of human papilloma virus [66]. For example, epidermodysplasia verruciformis is a rare genodermatosis characterized by profound susceptibility to cutaneous infection with certain human papilloma virus subtypes. Approximately 50% of the patients develop nonmelanoma skin cancers on sun-exposed areas in the 4th or 5th decades of life. The cancer associated viral subtypes are HPV-5, HPV-8, and HPV-14d, and therefore molecular identification of these viruses in susceptible individuals can be helpful in promoting more vigorous surveillance of at-risk patients. Molecular profiling has also proved to be useful in the identification and classification of cutaneous malignancies. Notably, T-cell receptor gene rearrangements, which arise as a result of variability in the V-J segment, provide important information relevant to the diagnosis and prognosis of cutaneous T-cell lymphoma (Figure 26.25) [67]. The presence of clonality usually (but not always) is associated with the presence

Skin

functional alleles. Akt is an important kinase in melanoma survival and progression. Akt3 is the main Akt isoform that is activated in melanomas. Strong expression of Phospho-Akt is found in several melanomas, suggesting a direct role of Akt in tumor progression. Phosphorylation of Akt is associated with increased PIK3 activity. Knowledge of these pathways is important if new treatments are to be developed for advanced melanoma, since it is clear that alterations in survival and growth signaling pathways in melanoma tumor cells can lead to increased tumorigenesis and resistance to chemotherapy. A detailed knowledge of the molecular pathology of melanomas may also have other therapeutic relevance. For example, it may be possible to render melanoma cells more sensitive to existing forms of chemotherapy, to enhance apoptosis, or to restrict the proliferation of the oncogene-driven cells by targeting these aberrant pathways. New drugs such as Oblimersen (antisense oligonucleotide targeted to the antiapoptotic protein BCL-2) and Sorafenib (a small molecule inhibitor of BRAF that induces apoptosis) are giving some encouraging results, especially when used in combination with traditional chemotherapy [63;64]. Further investigation into the molecular pathology of melanoma is likely to disclose novel therapeutic targets and allows more selective administration of existing therapies to benefit specific patient subgroups.

Skin

Part IV

Figure 26.25 Clonal T-cell expansion in a patient with mycosis fungoides (cutaneous T-cell lymphoma). The clinical stage of the patient is Stage 1b. This figure shows single-strand conformational polymorphism (SSCP) analysis and demonstrates an identical clonal T-cell receptor gene rearrangement in two lesional skin biopsies. The matched blood sample is polyclonal.

Chapter 26

of malignancy. Thus, in many cases, a T-cell receptor gene rearrangement can be helpful in distinguishing a malignant from a benign lymphocytic infiltrate, especially when clinical and histologic features are inconclusive. Clonality can also influence prognosis. For example, Se´zary syndrome patients with T-cell clonality are more likely to die from lymphoma/leukemia than their nonclonal counterparts. DNA microarray profiling has also been used in patients with diffuse large B-cell lymphoma. Specific gene signatures have been linked to certain subtypes (such as prominent germinal center B-cell profile or activated B-cell profile), which can be directly associated with different prognoses [68]. Molecular pathologies have also been used to identify specific viral signatures associated with human disease, for example, using sequence and bioinformatics data in the identification of specific polyoma virus sequence in Merkel cell carcinoma [69]. The recent characterization of the molecular basis of the acquired immunobullous diseases has also led to new diagnostic tests. For example, antigen-specific ELISA kits for desmogleins 1 and 3 are now commercially available for the assessment of serum samples from patients with pemphigus [70]. It is known that autoantibodies react against specific desmogleins— type 1 in pemphigus foliaceus or type 3 in mucosal dominant pemphigus vulgaris. These ELISA tests are more sensitive and specific than immunofluorescence microscopy when used in diagnosing pemphigus. More importantly, the titers have been shown to correlate with disease activity, and thus, it is possible to modify a patient’s immunosuppressive medication in advance of any clinical change in the status of his or her blistering disease. ELISA tests for the NC16A domain of type XVII collagen are useful in the diagnosis of bullous pemphigoid, although the link to clinical status is less clear than with pemphigus. For inherited skin blistering diseases, several clinical subtypes can have similar phenotypes, and routine light microscopy is not usually able to assist diagnosis or help determine prognosis. Nevertheless, antibodies to structural components at the dermalepidermal junction are now commercially available, and these can be helpful in diagnosing recessive forms of epidermolysis bullosa. Testing may involve labeling of skin sections with antibodies to type VII collagen, laminin-332, integrin-a6 and b4, plectin, or type XVII collagen. In many recessive forms of epidermolysis bullosa, immunostaining with one of these antibodies is reduced or undetectable [71]. This immunohistochemical approach is therefore a useful prelude to determining the candidate gene that can then be sequenced and used to identify the pathogenic mutations. Molecular pathology can also provide insight into other genodermatoses that conventional microscopy is unable to provide. For example, in some cases of hereditary leiomyomas, lesions may be multiple, and there can be an autosomal dominant mode of inheritance. In such families, skin leiomyomas usually appear in adolescence or early adulthood (Figure 26.26). Some cases, however, may be complicated by the


subsequent development of uterine leiomyomas, usually in the early 20s. The molecular pathology may involve mutations in the fumarase (FH) gene [72], and identification of such cases through molecular diagnosis can have important clinical implications. For example, if an FH gene mutation is identified in a woman with hereditary multiple leiomyomas who plans to have children at some stage, it may be prudent to advise her to consider having her children at an early age (when she is in her mid to late 20s) before the onset of uterine fibroids (usual onset late 20s or early 30s), which may substantially reduce fertility and the chance of conception. Diagnosis of FH gene mutations in hereditary multiple leiomyomas may also have other prognostic significance, in that a subset of patients may be at risk from developing aggressive type II papillary renal cell carcinomas. Understanding the molecular pathology of inherited skin diseases has also changed clinical practice by allowing the development of newer techniques for prenatal diagnosis for certain disorders (Figure 26.27). Over the past 3 decades the techniques used for prenatal testing have changed from being heavily reliant on the analysis of fetal skin biopsy samples acquired during the second half of the mid-trimester to the examination of fetal DNA from first trimester chorionic villus samples [73]. Advances in fetal medicine have led to further advances in which the molecular pathology of inherited skin diseases can be used to develop new techniques for prenatal testing. These include pre-implantation genetic diagnosis and pre-implantation genetic haplotyping [74]. Further technical advances are likely to lead to the development of less invasive forms of fetal screening, such as the analysis of free fetal DNA in the maternal circulation. Thus, on many levels, understanding the molecular pathology of a wide variety of skin conditions, including infections, malignant, acquired, and inherited diseases, has given rise to a plethora of new diagnostic tests that have a broad and significant impact on clinical practice.

NEW MOLECULAR MECHANISMS AND NOVEL THERAPIES A detailed understanding of the molecular mechanisms of skin pathology is starting to have significant clinical benefits. New molecular technologies have the potential to increase diagnostic accuracy and to provide important prognostic information. New molecular data also provide a platform to develop novel biological and cytotoxic drugs as well as monoclonal antibodies and other specific forms of immunotherapy. Thus, understanding the molecular pathology of skin diseases can have important implications that benefit patients. Two groups of dermatological diseases that are benefiting from new molecular-based therapies are the chronic autoinflammatory diseases as well as cutaneous T-cell lymphoma. The autoinflammatory diseases include familial Mediterranean fever, tumor necrosis 545

Part IV


Multiple Cutaneous Leiomyomas

A Detection of Fumarate Hydratase (FH) gene mutations

Multiple Cutaneous and Uterine Leiomyomas(MCUL)

B

Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)

Implications for fertility and renal cancer risk

C Figure 26.26 Impact of molecular diagnostics on clinical management. (A) Clinical appearances of multiple cutaneous leiomyomas. (B) Light microscopic appearances show a spindle cell tumor within the dermis (bar ¼ 100 mm). (C) Immunostaining with smooth muscle actin identifies the dermal tumor as a leiomyoma (bar ¼ 100 mm). In patients with multiple cutaneous leiomyomas and an autosomal dominant family history, detection of fumarate hydratase (FH gene mutations) may indicate a diagnosis of specific syndromes that can have implications for fertility as well as the risk of developing rare forms of renal cancer.

B

A

C

Figure 26.27 Options for prenatal testing for severe inherited skin diseases. (A) Chorionic villus samples taken at 10– 12 weeks; (B) Preimplantation genetic diagnosis, here illustrating single cell extraction from a 72-hour-old embryo; (C) Fetal skin biopsy performed at 16–22 weeks gestation, here showing the appearances of normal human fetal skin at 18 weeks (bar ¼ 25 mm). 546

Chapter 26

factor receptor-associated periodic syndrome, hyperimmunoglobulinemia D with periodic fever syndrome, pyogenic arthritis, pyoderma gangrenosum-acne syndrome, and 3 cryopyrinopathy syndromes, namely neonatal onset multisystem inflammatory disease/chronic infantile neurologic cutaneous and arthropathy syndrome, familial cold autoinflammatory syndrome, and Muckle-Wells syndrome. These conditions are complex and clinically difficult to manage. Nevertheless, new insights into molecular mechanisms are leading to immediate therapeutic benefits. The cryopyrinopathies represent a spectrum of diseases associated with mutations in the cold-induced autoinflammatory syndrome 1 (CIAS1) gene that encodes cryopyrin. Cryopyrin and pyrin (the protein implicated in familial Mediterranean fever) belong to the family of pyrin domain containing proteins. Mutations in the gene that encodes for the CD2 binding protein 1 (CD2BP1), which binds pyrin, are associated with pyogenic arthritis, pyodermic gangrenosum, and acne syndrome (OMIM604416). Common to all these diseases is activation of the interleukin-1b pathway, and this finding has been translated into direct benefits for patients. Specifically, the recombinant human interleukin-1 receptor antagonist, Anakinra, has proved to be helpful and in some cases results in a quick and dramatic treatment for these chronic autoinflammatory diseases [75]. The CIAS1 gene mutations result in increased cryopyrin activity. Cryopyrin is expressed in granulocytes, dendritic cells, B- and T-lymphocytes, and also monocytes and epithelial cells lining the oral and genital tracts. It is part of a multiprotein complex termed the NALP3 inflammasone which plays an important role in the regulation of intracellular host defense in response to various signals such as bacterial toxins. Cryopyrin regulates interleukin-1b production, and therefore, targeting the receptor represents a fundamental disease-modifying approach. The clinical response of affected individuals to Anakinra has been nothing short of remarkable, with almost immediate cessation of symptoms and prolonged clinical and biochemical improvements. Although the autoinflammatory diseases are rare disorders, this therapeutic approach represents one of the most selective and specific immunologic interventions and reveals the considerable impact of understanding the detailed molecular pathology to clinical management, particularly in reducing use of other immunosuppressive therapies, such as oral corticosteroids, which lack the target specificity. Management of the cutaneous T-cell lymphomas is also set to improve following a more detailed understanding of the molecular pathology of these disorders (Figure 26.28) [76]. The most common forms of cutaneous T-cell lymphoma are mycosis fungoides and Se´zary syndrome. Mycosis fungoides usually presents in a skin with erythematous patches, plaques, and sometimes tumors. Se´zary syndrome is a triad of generalized erythroderma, lymphadenopathy, and the presence of circulating malignant T-cells with cerebriform nuclei (known as Se´zary cells). Recent studies have identified a number of changes in various tumor suppressor and apoptosis-related genes in patients with mycosis fungoides and Se´zary syndrome. These


include Nav3, Fas ligand, Fas, JunB, p16 (INK4a), p15 (INK4b), p14 (ARF), PTEN, p53, and HLA-G [77,78]. Discovery of specific gene abnormalities and patterns of altered gene expression have diagnostic and prognostic value but also offer new insight into developing treatments that transform a malignant disease into a less aggressive chronic illness. The pathogenesis of mycosis fungoides and Se´zary syndrome is unclear, but may include chronic antigen stimulation from skin-associated microbes, such as Staphylococcus aureus or Chlamydia species. Affected patients also have a higher frequency of specific HLA Class II alleles, lending support to the antigen stimulation hypothesis. Viruses such as human T-cell lymphotrophic virus-1, cytomegalovirus, and Epstein-Barr virus have also been implicated. With respect to treatment, there are accumulating data regarding specific immune and genetic abnormalities in these diseases that might lead to new therapies that block the trafficking or proliferation of malignant T-cells. Of note, immunophenotyping suggests that mycosis fungoides and possibly Se´zary cells are derived from CLA-positive effector memory cells. The malignant cells demonstrate altered cytokine profiles with IL-7 and IL-18 being upregulated in the plasma and skin of affected individuals. Loss of T-cell diversity is also a feature of these conditions, and antigen-presenting dendritic cells can have an important role in the pathogenesis of the disorders, especially in maintaining the survival of proliferating malignant T-cells. Specific chemokine receptors are associated with mycosis fungoides and Se´zary syndrome, and these are directly relevant to skin tropism of malignant T-cells. Given these abnormalities, new treatments are being developed that go beyond current combinations of nitrogen mustard, corticosteroids, and radiotherapy. The overproduction of Th-2 cytokines suggests that cytokines which promote a Th-1 phenotype might be clinically useful. Indeed, interleukin-12 has shown clinical benefit. Interleukin-12 is a Th-1-promoting cytokine synthesized by phagocytic cells and antigen-presenting cells. It enhances cytolytic T-cell and natural killer cell functions and is necessary for interferon-g production by activated T-cells. Recombinant IFN-a and IFN-g can also shift the balance from a Th-2 toward a Th-1 phenotype and may have clinical relevance. Other approaches using antibodies to CD4 (Zanolimumab) and CD52 (Alemtuzumab) also broadly target T-cells and may help in relieving certain symptoms such as erythroderma and pruritus in Se´zary syndrome [79,80] although the immunosuppression may result in complications such as Mycobacterium and herpes simplex infections [81]. Vaccine therapy for mycosis fungoides and Se´zary syndrome is another intriguing but somewhat preliminary approach [82]. This is due to the scarcity of target antigens, but identifying T-cell receptor sequences expressed by malignant lymphocytes should be technically feasible and may provide targets for immunotherapy. In similar fashion, loading autologous dendritic cells with tumor cells treated with Th-1priming cytokines is another approach. Vaccination of patients with mimotopes (such as synthetic peptides that stimulate antitumor CDA-positive T-cells) is also a promising clinical option. Specific molecular targeting 547

Part IV


3 EPIDERMAL CHEMOKINES

INHIBITION OF APOPTOSIS

2

APOPTOSIS

ACTIVATION

CCL17 CCL27

4

CCR7 1

CHEMOKINEANTIGEN

HOMING

5 CCR6

CHEMOKINE-TOXIN DENDRITIC CELL

EXPRESSION BY MYCOSIS FUNGOIDES CELLS CXCR4 CCR7 CCR4 CCR10

BLOOD VESSEL

Figure 26.28 Roles for chemokine receptors and possible therapeutic manipulation in cutaneous T-cell lymphoma. Chemokine receptors may have important roles in enabling malignant T-cells to enter and survive in the skin. (1) Homing: Activation of T-cell integrins permits T-cell adhesion to endothelial cells in the skin and subsequent binding to extracellular matrix proteins. T-cells can then migrate along a gradient of chemokines, e.g., CCL17 and CCL27 to the epidermis. (2) Activation: chemokine receptors allow T-cells to interact with dendritic cells such as Langerhans cells, leading to T-cell activation and release of inflammatory cytokines. (3) Inhibition of apoptosis: chemokine receptor engagement can lead to upregulation of PI3K and AKT, which are prosurvival kinases. T-cells can therefore survive and proliferate in the skin. (4) Chemokine-antigen fusion proteins can be used to target tumor antigens from cutaneous T-cell lymphoma cells to CCR6þ presenting dendritic cells that can stimulate host antitumor immunity. (5) Chemokine toxin molecules can also target specific chemokine receptors found on cutaneous T-cell lymphoma cells to mediate direct killing. (Based on an original figure published by [76]).

can also be attempted using histone deacetylase inhibitors such as Depsipeptide and Verinostat. These drugs induce growth arrest in conjunction with cell differentiation and apoptosis and have been shown to improve erythroderma and pruritus and to reduce the number of circulating Se´zary cells in some patients with Se´zary syndrome. Drugs such as Imiquimod, a toll-like receptor agonist, can also benefit cutaneous T-cell lymphoma by inducing IFN-a. Other toll-like receptor agonists may have clinical utility, such as TLR9, which recognizes unmethylated CpG-containing nucleotide motifs that are present in most bacteria and DNA viruses. Treatment with CpG oligodeoxynucleotides leads to plasmacytoid dendritic cell upregulation of co-stimulatory molecules and migratory receptors that subsequently generate type 1 interferons and promote a strong Th-1 immune response and enhance cellular immunity. These drugs may therefore represent a useful adjuvant in immunotherapy or addition to cytotoxic drugs. 548

Another approved drug for use in cutaneous T-cell lymphoma is Bexarotene [83]. This is a retinoid that modulates gene expression through selective binding to retinoid receptors. These receptors form either homodimers or heterodimers with other nuclear receptors that then act as transcription factors. Bexarotene therapy may also be combined with new treatments such as Denileukin diftitox, which is a fusion molecule containing the IL-2 receptor binding domain and the catalytically active fragment of diphtheria toxin [84]. This targets the high-affinity IL-2 receptor present on activated T- and B-cells. A newer compound which probably works by the same mechanism is anti-Tac (Fv)-PE38 (LMB-2), which is an anti-CD25 recombinant immunotoxin [85]. Another molecular therapy that is currently in clinical practice is extra-corporeal photochemotherapy, a form of light treatment in which leukocytes are treated with psoralen and exposed to UVA light as they pass through a narrow chamber ex vivo. The precise mechanism of therapeutic benefit is unclear, but it is

Chapter 26

thought that psoralen-treated malignant T-cells exposed to light selectively undergo apoptosis and are then engulfed by dendritic cells upon re-infusion in patients. The antigen load of dendritic cells might then trigger a host response against the malignant T-cells, as well as potentially inducing tolerance via the induction of antigen-specific T-regulatory cells. This therapy may therefore trigger vaccine-like effects and induce T-regulatory cells that blunt proliferation of malignant T-cells. Overall, these new insights into the pathophysiology of cutaneous T-cell lymphoma are providing opportunities to therapeutically target specific aspects of the molecular pathology. These approaches, in which more selective therapy is the goal, are starting to have benefits for patients that result in better survival and fewer side effects.

REFERENCES 1. Bickers DR, Lim HW, Margolis D, et al. The burden of skin diseases: 2004 a joint project of the American Academy of Dermatology Association and the Society for Investigative Dermatology. J Am Acad Dermatol. 2006;55:490–500. 2. Smith FJ, Irvine AD, Terron-Kwiatkowski A, et al. Loss-offunction mutations in the gene encoding filaggrin cause ichthyosis vulgaris. Nat Genet. 2006;38:337–342. 3. Palmer CN, Irvine AD, Terron-Kwiatkowski A, et al. Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nat Genet. 2006;38:441–446. 4. Lee KC, Eckert RL. S100A7 (Psoriasin)—Mechanism of antibacterial action in wounds. J Invest Dermatol. 2007;127:945–957. 5. Harder J, Schroder JM. RNase 7, a novel innate immune defense antimicrobial protein of healthy human skin. J. Biol. Chem.,. 2002;277:46779–46784. 6. Schroder JM, Harder J. Human beta-defensin-2. Int J Biochem Cell Biol. 1999;31:645–651. 7. Oppenheim JJ, Tewary P, de la RG, et al. Alarmins initiate host defense. Adv Exp Med Biol. 2007;601:185–194. 8. Frohm M, Agerberth B, Ahangari G, et al. The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders. J. Biol. Chem.,. 1997;272:15258–15263. 9. Schauber J, Gallo RL. Antimicrobial peptides and the skin immune defense system. J. Allergy Clin. Immunol. 2008;122: 261–266. 10. Nishibu A, Ward BR, Jester JV, et al. Behavioral responses of epidermal Langerhans cells in situ to local pathological stimuli. J Invest Dermatol. 2006;126:787–796. 11. Meyer T, Stockfleth E, Christophers E. Immune response profiles in human skin. Br. J Dermatol. 2007;157(Suppl 2):1–7. 12. Raison CL, Capuron L, Miller AH. Cytokines sing the blues: Inflammation and the pathogenesis of depression. Trends Immunol. 2006;27:24–31. 13. Mills AA, Zheng B, Wang XJ, et al. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature. 1999; 398:708–713. 14. Levrero M, De LV, Costanzo A, et al. The p53/p63/p73 family of transcription factors: Overlapping and distinct functions. J Cell Sci. 2000;113:1661–1670. 15. Vigano MA, Mantovani R. Hitting the numbers: The emerging network of p63 targets. Cell Cycle. 2007;6:233–239. 16. Rinne T, Hamel B, van BH, et al. Pattern of p63 mutations and their phenotypes—update. Am. J. Med. Genet. A. 2006;140: 1396–1406. 17. Tumbar T, Guasch G, Greco V, et al. Defining the epithelial stem cell niche in skin. Science. 2004;303:359–363. 18. Fuchs E, Horsley V. More than one way to skin. Genes Dev. 2008;22:976–985. 19. Fuchs E. Skin stem cells: Rising to the surface. J Cell Biol. 2008;180:273–284.


20. Ringpfeil F, McGuigan K, Fuchsel L, et al. Pseudoxanthoma elasticum is a recessive disease characterized by compound heterozygosity. J Invest Dermatol. 2006;126:782–786. 21. Vanakker OM, Martin L, Gheduzzi D, et al. Pseudoxanthoma elasticum-like phenotype with cutis laxa and multiple coagulation factor deficiency represents a separate genetic entity. J Invest Dermatol. 2007;127:581–587. 22. Chen MA, Bonifas JM, Matsumura K, et al. A novel three-nucleotide deletion in the helix 2B region of keratin 14 in epidermolysis bullosa simplex: Delta E375. Hum Mol Genet. 1993;2:1971–1972. 23. Chan YM, Yu QC, Fine JD, et al. The genetic basis of WeberCockayne epidermolysis bullosa simplex. Proc. Natl. Acad. Sci. USA. 1993;90:7414–7418. 24. Smith FJ, Eady RA, Leigh IM, et al. Plectin deficiency results in muscular dystrophy with epidermolysis bullosa. Nat Genet. 1996;13:450–457. 25. Lugassy J, Itin P, Ishida-Yamamoto A, et al. Naegeli-Franceschetti-Jadassohn syndrome and dermatopathia pigmentosa reticularis: Two allelic ectodermal dysplasias caused by dominant mutations in KRT14. Am J Hum Genet. 2006;79:724–730. 26. Betz RC, Planko L, Eigelshoven S, et al. Loss-of-function mutations in the keratin 5 gene lead to Dowling-Degos disease. Am J Hum Genet. 2006;78:510–519. 27. Pulkkinen L, Christiano AM, Gerecke D, et al. A homozygous nonsense mutation in the beta 3 chain gene of laminin 5 (LAMB3) in Herlitz junctional epidermolysis bullosa. Genomics. 1994;24:357–360. 28. Pulkkinen L, Christiano AM, Airenne T, et al. Mutations in the gamma 2 chain gene (LAMC2) of kalinin/laminin 5 in the junctional forms of epidermolysis bullosa. Nat Genet. 1994;6: 293–297. 29. Kivirikko S, McGrath JA, Baudoin C, et al. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa. Hum. Mol. Genet. 1995;4:959–962. 30. McGrath JA, Gatalica B, Christiano AM, et al. Mutations in the 180-kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal transmembrane collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa. Nat Genet. 1995;11:83–86. 31. Ruzzi L, Gagnoux-Palacios L, Pinola M, et al. A homozygous mutation in the integrin alpha6 gene in junctional epidermolysis bullosa with pyloric atresia. J Clin Invest. 1997;99: 2826–2831. 32. Vidal F, Aberdam D, Miquel C, et al. Integrin beta 4 mutations associated with junctional epidermolysis bullosa with pyloric atresia. Nat Genet. 1995;10:229–234. 33. Christiano AM, Greenspan DS, Hoffman GG, et al. A missense mutation in type VII collagen in two affected siblings with recessive dystrophic epidermolysis bullosa. Nat Genet. 1993;4: 62–66. 34. Christiano AM, Ryynanen M, Uitto J. Dominant dystrophic epidermolysis bullosa: Identification of a Gly-->Ser substitution in the triple-helical domain of type VII collagen. Proc. Natl. Acad. Sci. USA. 1994;91:3549–3553. 35. Wetteland P, Hovding G. Squamous-cell carcinoma in dystrophic epidermolysis bullosa. Acta Derm Venereol. 1956;36:27–36. 36. Miller DL, Weinstock MA. Nonmelanoma skin cancer in the United States: Incidence. J Am Acad Dermatol. 1994;30:774–778. 37. McGrath JA, McMillan JR, Shemanko CS, et al. Mutations in the plakophilin 1 gene result in ectodermal dysplasia/skin fragility syndrome. Nat Genet. 1997;17:240–244. 38. McKoy G, Protonotarios N, Crosby A, et al. Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease). Lancet. 2000;355:2119–2124. 39. Hunt DM, Rickman L, Whittock NV, et al. Spectrum of dominant mutations in the desmosomal cadherin desmoglein 1, causing the skin disease striate palmoplantar keratoderma. Eur J Hum Genet. 2001;9:197–203. 40. Kljuic A, Bazzi H, Sundberg JP, et al. Desmoglein 4 in hair follicle differentiation and epidermal adhesion: Evidence from inherited hypotrichosis and acquired pemphigus vulgaris. Cell. 2003;113:249–260. 41. Armstrong DK, McKenna KE, Purkis PE, et al. Haploinsufficiency of desmoplakin causes a striate subtype of palmoplantar keratoderma. Hum Mol Genet. 1999;8:143–148.

549

Part IV


42. Norgett EE, Hatsell SJ, Carvajal-Huerta L, et al. Recessive mutation in desmoplakin disrupts desmoplakin-intermediate filament interactions and causes dilated cardiomyopathy, woolly hair and keratoderma. Hum Mol Genet. 2000;9: 2761–2766. 43. Jonkman MF, Pasmooij AM, Pasmans SG, et al. Loss of desmoplakin tail causes lethal acantholytic epidermolysis bullosa. Am J Hum Genet. 2005;77:653–660. 44. Levy-Nissenbaum E, Betz RC, Frydman M, et al. Hypotrichosis simplex of the scalp is associated with nonsense mutations in CDSN encoding corneodesmosin. Nat Genet. 2003;34:151–153. 45. Morar N, Willis-Owen SA, Moffatt MF, et al. The genetics of atopic dermatitis. J Allergy Clin Immunol. 2006;118:24–34. 46. Homey B, Steinhoff M, Ruzicka T, et al. Cytokines and chemokines orchestrate atopic skin inflammation. J Allergy Clin Immunol. 2006;118:178–189. 47. Elder JT, Nair RP, Guo SW, et al. The genetics of psoriasis. Arch Dermatol. 1994;130: 216–224. 48. Lowes MA, Bowcock AM, Krueger JG. Pathogenesis and therapy of psoriasis. Nature. 2007;445:866–873. 49. Hashimoto T. Skin diseases related to abnormality in desmosomes and hemidesmosomes—Editorial review. J Dermatol Sci. 1999;20:81–84. 50. Gibson GE, Daoud MS, Pittelkow MR. Anti-epiligrin (laminin 5) cicatricial pemphigoid and lung carcinoma: Coincidence or association? Br J Dermatol. 1997;137:780–782. 51. Tyagi S, Bhol K, Natarajan K, et al. Ocular cicatricial pemphigoid antigen: Partial sequence and biochemical characterization. Proc. Natl. Acad. Sci. USA. 1996;93:14714–14719. 52. Fairley JA, Woodley DT, Chen M, et al. A patient with both bullous pemphigoid and epidermolysis bullosa acquisita: An example of intermolecular epitope spreading. J Am Acad Dermatol. 2004;51:118–122. 53. Hanakawa Y, Matsuyoshi N, Stanley JR. Expression of desmoglein 1 compensates for genetic loss of desmoglein 3 in keratinocyte adhesion. J Invest Dermatol. 2002;119:27–31. 54. Hanakawa Y, Schechter NM, Lin C, et al. Molecular mechanisms of blister formation in bullous impetigo and staphylococcal scalded skin syndrome. J Clin Invest. 2002;110:53–60. 55. Geller AC, Swetter SM, Brooks K, et al. Screening, early detection, and trends for melanoma: Current status (2000– 2006) and future directions. J Am Acad Dermatol. 2007;57: 555–572. 56. Young AR, Chadwick CA, Harrison GI, et al. The similarity of action spectra for thymine dimers in human epidermis and erythema suggests that DNA is the chromophore for erythema. J Invest Dermatol. 1998;111:982–988. 57. Toftgard R. Hedgehog signalling in cancer. Cell Mol Life Sci. 2000;57:1720–1731. 58. Hahn H, Wicking C, Zaphiropoulous PG, et al. Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell. 1996;85:841–851. 59. Xie J, Murone M, Luoh SM, et al. Activating smoothened mutations in sporadic basal-cell carcinoma. Nature. 1998;391:90–92. 60. Barth A, Wanek LA, Morton DL. Prognostic factors in 1,521 melanoma patients with distant metastases. J Am Coll Surg. 1995;181:193–201. 61. Fecher LA, Amaravadi RK, Flaherty KT. The MAPK pathway in melanoma. Curr Opin Oncol. 2008;20:183–189. 62. Dahl C, Guldberg P. The genome and epigenome of malignant melanoma. APMIS. 2007;115:1161–1176. 63. Moreira JN, Santos A, Simoes S. Bcl-2-targeted antisense therapy (Oblimersen sodium): Towards clinical reality. Rev Recent Clin Trials. 2006;1:217–235. 64. Pratilas CA, Solit DB. Therapeutic strategies for targeting BRAF in human cancer. Rev Recent Clin Trials. 2007;2:121–134. 65. Borman AM, Linton CJ, Miles SJ, et al. Molecular identification of pathogenic fungi. J Antimicrob Chemother. 2008;61(Suppl 1): i7–i12. 66. de KM, Struijk L, Feltkamp M, et al. HPV DNA detection and typing in inapparent cutaneous infections and premalignant lesions. Methods Mol Med. 2005;119:115–127.

550

67. Wood GS. T-cell receptor and immunoglobulin gene rearrangements in diagnosing skin disease. Arch Dermatol. 2001;137:1503– 1506. 68. Alizadeh AA, Eisen MB, Davis RE, et al. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature. 2000;403:503–511. 69. Feng H, Shuda M, Chang Y, et al. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–1100. 70. Amagai M, Komai A, Hashimoto T, et al. Usefulness of enzymelinked immunosorbent assay using recombinant desmogleins 1 and 3 for serodiagnosis of pemphigus. Br J Dermatol. 1999;140: 351–357. 71. Fine JD, Eady RA, Bauer EA, et al. Revised classification system for inherited epidermolysis bullosa: Report of the Second International Consensus Meeting on diagnosis and classification of epidermolysis bullosa. J Am Acad Dermatol. 2000; 42:1051–1066. 72. Tomlinson IP, Alam NA, Rowan AJ, et al. Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat Genet. 2002;30:406–410. 73. McGrath JA, Handyside AH. Preimplantation genetic diagnosis of severe inherited skin diseases. Exp Dermatol. 1998;7:65–72. 74. Fassihi H, Renwick PJ, Black C, et al. Single cell PCR amplification of microsatellites flanking the COL7A1 gene and suitability for preimplantation genetic diagnosis of Hallopeau-Siemens recessive dystrophic epidermolysis bullosa. J Dermatol Sci. 2006; 42:241–248. 75. Hoffman HM, Rosengren S, Boyle DL, et al. Prevention of coldassociated acute inflammation in familial cold autoinflammatory syndrome by interleukin-1 receptor antagonist. Lancet. 2004;364:1779–1785. 76. Hwang ST, Janik JE, Jaffe ES, et al. Mycosis fungoides and Sezary syndrome. Lancet. 2008;371:945–957. 77. Karenko L, Hahtola S, Paivinen S, et al. Primary cutaneous T-cell lymphomas show a deletion or translocation affecting NAV3, the human UNC-53 homologue. Cancer Res. 2005;65: 8101–8110. 78. Whittaker S. Molecular genetics of cutaneous lymphomas. Ann NY Acad Sci. 2001;941:39–45. 79. Kim YH, Duvic M, Obitz E, et al. Clinical efficacy of zanolimumab (HuMax-CD4): Two phase 2 studies in refractory cutaneous T-cell lymphoma. Blood. 2007;109:4655–4662. 80. Lundin J, Hagberg H, Repp R, et al. Phase 2 study of alemtuzumab (anti-CD52 monoclonal antibody) in patients with advanced mycosis fungoides/Se´zary syndrome. Blood. 2003;101: 4267–4272. 81. Nosari A, Tedeschi A, Ricci F, et al. Characteristics and stage of the underlying diseases could determine the risk of opportunistic infections in patients receiving alemtuzumab. Haematologica. 2008;93:e30–e31. 82. Seo N, Furukawa F, Tokura Y, et al. Vaccine therapy for cutaneous T-cell lymphoma. Hematol Oncol Clin North Am. 2003;17: 1467–1474. 83. Duvic M, Hymes K, Heald P, et al. Bexarotene is effective and safe for treatment of refractory advanced-stage cutaneous T-cell lymphoma: Multinational phase II-III trial results. J Clin Oncol. 2001;19:2456–2471. 84. Carretero-Margolis CD, Fivenson DP. A complete and durable response to denileukin diftitox in a patient with mycosis fungoides. J Am Acad Dermatol. 2003;48:275–276. 85. Foon KA. Monoclonal antibody therapies for lymphomas. Cancer J. 2000;6:273–278. 86. Nestle FO, Nickoloff BJ. Deepening our understanding of immune sentinels in the skin. J Clin Invest. 2007;117:2382– 2385. 87. Boyman O, Conrad C, Tonel G, et al. The pathogenic role of tissue-resident immune cells in psoriasis. Trends Immunol. 2007;28:51–57. 88. Daya-Grosjean L, Couve-Privat S. Sonic hedgehog signaling in basal cell carcinomas. Cancer Lett. 2005;225:181–192. 89. Singh M, Lin J, Hocker TL, et al. Genetics of melanoma tumorigenesis. Br J Dermatol. 2008;158:15–21.

C h a p t e r

27 Molecular Pathology: Neuropathology Joshua A. Sonnen C. Dirk Keene Robert F. Hevner Thomas J. Montine n

n

ANATOMY OF THE CENTRAL NERVOUS SYSTEM The central nervous system (CNS) is composed of cellular components organized in a complex structure that is unlike other organ systems. Broadly, its cellular components can be divided into neuroepithelial and mesenchymal elements. Neuroepithelial elements derive from the primitive neural tube and include neurons and glia. The mesenchymal elements include blood vessels and microglia. Microglia are a bone marrow-derived population of scavenger cells that play a central role in CNS inflammation. At the macroscopic level, the parenchyma of the CNS can be categorized into 2 structurally and functionally unique components: gray and white matter. Gray matter is the location of most neurons and is the site of the integration of neural impulses by neurotransmitters across synapses between neurons. White matter functions to conduct these impulses efficiently and quickly between neurons in different gray matter regions.

Microscopic Anatomy Gray Matter Macroscopically, gray matter forms a ribbon of cortex in the human cerebrum and cerebellum as well as the mass of the deep nuclei. Microscopically, it is composed of cells forming and embedded in a finely interdigitating network of cellular processes. This network, referred to as neuropil, is sufficiently dense that individual cellular processes cannot be distinguished. Indeed, under the microscope, neuropil appears as a homogenous matrix surrounding neurons and other cells. Because of this, it was not until 1889 and the work of Santiago Ramoń-y-Cajal that the neuron theory was fully applied to the brain, 50 years after cellular theory was proposed by Theodore Schwann [1].


n

The cellular constituents of gray matter include neurons, glia, endothelium, and perivascular cells of blood vessels and microglia (Figure 27.1). Neurons are the electrically active cells of the brain. A neuron is composed of slender branching dendrites on which other neurons synapse and propagate action potentials, a body or soma where the metabolic and synthetic processes of the neuron are orchestrated, an axonal hillock where electrochemical impulses are integrated, an axon along which the integrated electrochemical impulse is conducted, and an axonal terminal where the electrochemical signal is passed to another neuron’s dendrites or an effector cell across a synapse. The soma of neurons is easily identifiable by routine histologic stains. Neurons have generally round nuclei with a prominent nucleolus and open chromatin. The cytoplasm of neurons is remarkable in that it generally contains abundant rough endoplasmic reticulum called Nissl substance that is demonstrable by numerous histologic techniques. Loss of Nissl substance is a sign of early neuronal injury and is seen in a variety of conditions including axonal transection and hypoxia/ischemia. The neuron’s axons and dendrites are major components of neuropil. Neurons require a constant supply of oxygen and glucose, and even short interruptions can cause neuronal death. Neurons are the most susceptible to most forms of CNS injury and are the first cells lost to necrosis or apoptosis under stressful conditions. Further, for reasons that are not fully understood, populations of neurons have differential susceptibilities to different types of stress. Cells in one region of the hippocampus may become necrotic in response to hypoxia, while neurons in other regions are spared; this pattern of injury may be reversed in hypoglycemia. Glia, from Latin for glue, form the bulk of the CNS parenchyma and outnumber neurons on the order of 1000 to 1. The primary glial cell of gray matter is the star-shaped astrocyte. Astrocytes maintain a variety of

551

Part IV


antigens, unlike other scavenger cells. However, in response to injury, microglia replicate and migrate. They produce MHC I/II antigen, activate inflammatory and cytotoxic signaling, and can phagocytize material and process it for antigen presentation to T-cells.

White Matter

A

B

Figure 27.1 (A) Schematic of the microanatomy of gray matter, (B) Photomicrograph of the microanatomy of gray matter. (A). A neuron (N) contains a prominent nucleus with open chromatin, a conspicuous nucleolus and cytoplasmic Nissl substance that is composed of abundant rough endoplasmic reticulum. The neuron elaborates numerous apical and lateral dendrites that are decorated with many receptors. Electrochemical impulses are generated at dendrites and integrated across the neuron’s body at the axonal hillock (h) and transmitted along the axon (a1). Oligodendrocytes (O) envelop the axon within a segmented myelin (m) sheath allowing more rapid and efficient conduction of impulses. An endothelial cell (E) forms a small capillary space surrounded by a resting microglial cell (M). A nearby astrocyte (*) has numerous cytoplasmic processes, some of which rest foot processes (f) on the vessel, helping to maintain the blood-brain barrier. An axon (a2) from a distant neuron forms an axonal terminal (t) on a dendrite of the pictured neuron, forming a synapse and releasing neurotransmitters to the receptors on the dendrite. (B). Section of frontal cortex stained with hematoxylin and eosin (H&E) and Luxol fast blue (LFB).

supportive functions including structure, metabolic support for neurons, management of cellular waste products, uptake and release of neurotransmitters, regulation of extracellular ion concentration, interactions with the vasculature including helping to maintain the blood-brain barrier and responding to injury. Normally, astrocytes have irregular, potato-shaped nuclei and numerous fine cellular processes that are indistinct within the neuropil. In response to noxious stimuli, astrocytes increase production of their characteristic intermediate filament, glial fibrillary acidic protein (GFAP). The astrocyte’s soma swells and becomes prominent. This process is known as gliosis and is analogous to scar formation outside the CNS. A second population of glia in gray matter is the oligodendrocytes; these will be discussed in more detail later under white matter. Microglia are a population of bone marrow-derived scavenger cells. Usually unobtrusive, the quiescent microglia have small rod-shaped nuclei and inapparent cytoplasm. Ramified (quiescent) microglia do not express major histocompatibility complex (MHC) I/II 552

White matter is composed of numerous axonal processes (from neurons whose bodies reside in gray matter), glia, blood vessels, and microglia (Figure 27.2). The axons are insulated in segments by layers of myelin, and this insulation allows more rapid and efficient conduction of electrochemical signals along the axon. Myelin is composed of concentric proteolipid membranes which are extensions of cytoplasmic processes of the primary glia of white matter, the oligodendrocyte. Oligodendrocytes have small round nuclei with condensed chromatin and indistinct cytoplasm. A single oligodendrocyte myelinates numerous passing axons. Because oligodendrocytes are responsible for the maintenance of a large amount of myelin, they have relatively high metabolic demands and are consequently relatively sensitive to injury compared to other white matter elements. Injury to oligodendrocytes causes local loss of myelin; this is discussed further in the section on demyelination. Astrocytes and microglia are minority populations within white matter and are less sensitive to injury than oligodendrocytes. Tissue response to noxious stimuli is mediated through astrocytic gliosis and microglial activation as in gray matter.

A

B

Figure 27.2 (A) Schematic of the microanatomy of white matter, (B) Photomicrograph of the microanatomy of white matter (H&E/LFB). Numerous axons (a) from distant neurons pass through white matter conducting nerve impulses. Oligodendroglia (O) are the most common cells and myelinate many adjacent segments of passing axons. The insulating myelin (m) allows rapid and efficient conduction of nerve impulses. Oligodendrocytes have high metabolic needs, and endothelium (E) form numerous capillaries. In the absence of disease, astrocytes (*) and microglia (M) are inconspicuous.

Chapter 27

Cerebrospinal Fluid and the Ventricular System Within the brain there are interconnected fluid-filled chambers called ventricles. The ventricles are lined by specialized glial cells called ependyma. The ependymal cells form a membrane with tight junctions between cells and microvilli on their apical membrane. The ventricles are filled with cerebrospinal fluid (CSF). Most CSF is produced by a specialized organ within the ventricles called the choroid plexus. The choroid plexus is a network of large capillaries and glia with a specialized epithelial lining. The vessels of the choroid plexus contain fenestrations and produce the CSF filtrate through active ion secretion and passive water flow. The epithelial cells have apical microvilli and cilia and, along with the ependyma, gently push the CSF through the ventricular system. CSF exits the brain through apertures between the base of the cerebellum and brainstem, filling a compartment surrounding the brain known as the arachnoid. CSF surrounding the brain acts as a cushion for the brain and spinal cord. CSF is taken back up into the venous circulation, and the entire volume of CSF (150 ml) turns over 4 to 5 times a day.

Gross Anatomy The CNS can be divided into a number of anatomic regions, each with specific neurologic or cognitive functions. Disease or damage to these regions produces neurologic or cognitive deficits that correlate with the anatomic location and extent of disease. There are several ways to divide these structures. The main divisions are the cerebrum, cerebellum, brainstem, and spinal cord. The cerebrum is covered by a folded layer of gray matter called the cortex and is generally believed to be

Molecular Pathology: Neuropathology

the location of conscious thought. The folding allows greater surface area to fit within the confines of the skull. The folds themselves are called gyri and are characteristic of normal cortical development in humans. Lesions of the cortex cause deficits of cognition and conscious movement or sensation. The cortex can be further divided into lobes which subserve different cognitive domains or neurologic functions (Figure 27.3). The frontal lobes anteriorly are involved in executive function (self-control, planning) and personality. Damage to this region produces personality changes and socially inappropriate behavior. Posteriorly, the frontal lobe houses the primary motor cortex which controls voluntary movement for the opposite side (contralateral) of the body. Damage causes contralateral weakness or paralysis. The parietal lobe contains the primary sensory cortex for the contralateral half of the body, and damage causes anesthesia and neglect. The temporal lobe is involved in the conscious processing of sound, but also contains the hippocampus that is integral to the formation of new memories. Damage to the hippocampus produces memory dysfunction, and in cases where both hippocampi are damaged, severe anterograde amnesia wherein the unfortunate individual is incapable of forming new memories. The occipital lobe contains the primary visual cortex for the field of vision on the opposite side of the body, and damage causes partial or complete loss of conscious perception of visual stimuli. The white matter underlying and connecting these cortical regions may also be damaged and produces deficits related to the regions connected. The cerebrum also contains deeply situated gray matter nuclei. The most often implicated of these in disease are the basal ganglia (Figure 27.4). These nuclei form important inhibitory circuits on the cerebrum, and disease causes movement disorders and well as disorders of cognition. Somatosensory strip

Motor strip

Parietal

Frontal

Occipital

Temporal

Cerebellum

Pons Medulla Figure 27.3 Lateral view of the central nervous system. 553

Part IV


Gray matter

Choroid plexus Cortex

White matter

Basal ganglia

Ventricles

Caudate Putamen

Substantia nigra Hippocampus

Figure 27.4 Coronal section of cerebrum through the deep gray matter nuclei.

The cerebellum is involved in coordination and balance. The brainstem has 3 primary functional domains. First, it contains white matter tracks that connect the cerebrum to the spinal cord and carries information between these 2 structures. Second, numerous autonomic functions are coordinated by nuclei within the brainstem that serve as integrative centers. Third, the cranial nerve nuclei reside in the brainstem which control motor function of the head and neck and receive sensory input from these same structures. The spinal cord is primarily involved in the transmission of nerve impulses to and from the peripheral nervous system along its abundant white matter tracks, but it also contains central gray matter nuclei that regulate autonomic functions and reflexes.

Summary The anatomy of the CNS is complex. The correlation between structure and function illuminates an underlying order. Knowledge of the location or cellular target of injury can give great insight into the deficits present and vice versa.

NEURODEVELOPMENTAL DISORDERS Developmental neuropathology encompasses a broad variety of cerebral malformations and functional impairments caused by disturbances of brain development, manifesting during ages from the embryonic period through adolescence and young adulthood. 554

The neurologic and psychiatric manifestations of neurodevelopmental disorders range widely depending on the affected neural systems and include such diverse manifestations as epilepsy, mental retardation, cerebral palsy, breathing disorders, ataxia, autism, and schizophrenia. In terms of morbidity and mortality, the spectrum is extremely broad: the mildest neurodevelopmental disorders can be asymptomatic, while the worst malformations often lead to intrauterine or neonatal demise. This section will focus on genetic disorders of brain development, caused by mutations of gene loci or chromosomal regions with important neurodevelopmental functions. Excluded from consideration here are other categories of developmental neuropathology caused by general metabolic disorders (such as storage diseases and amino acidopathies), disruptions (amniotic web disruption sequence), environmental insults (hypoxia-ischemia or toxic exposure), infection, and neoplasia. More extensive coverage of these categories can be found in other specialized texts, some of which are listed at the end of this chapter. Current systems for classifying neurodevelopmental malformations emphasize the underlying developmental processes that are perturbed. Recent advances in human genetics and developmental neurobiology have largely substantiated this practical approach, but at the same time have also demonstrated that even single gene mutations (as well as chromosomal alterations) rarely affect one single mechanism in development. Rather, single genes or chromosomal loci often have pleiotropic effects, controlling multiple aspects of brain development. Conversely, each developmental

Chapter 27

process is controlled by multiple genes. Accordingly, mutations in one gene may cause several different malformations, and the same malformation may be caused by many different genes or other etiologies. Holoprosencephaly, for example, can be caused by mutations in several genes or by toxic exposure [4]. Further complications arise from the modifying effects of genetic background, mosaicism, X chromosome inactivation, and epigenetic effects (imprinting). In practical terms, this means that many neurodevelopmental disorders are genetically heterogeneous and may require additional tests (karyotyping, array hybridization, sequencing) along with family history to gain a clear understanding of the disease. To understand the pathogenesis of neurodevelopmental disorders, one must first acquire at least a rudimentary knowledge of brain and spinal cord development, including underlying cellular mechanisms and interactions. A brief review of processes highlighting recent progress will be the starting point for subsequent consideration of selected specific brain malformations.

Gastrulation and Neurulation: Neural Tube Defects Development of the brain and spinal cord begins with gastrulation, when the neural plate forms and differentiates into distinct regional subdivisions along the rostrocaudal and mediolateral axes. As morphogenesis continues, the processes of neurogenesis, gliogenesis, synaptogenesis, and myelination are initiated sequentially, and these processes then continue concurrently with broad overlap. Brain development is mostly complete by the end of adolescence, although neurogenesis continues at decreasing levels in the hippocampus and olfactory system throughout adulthood. In this sense, brain development continues until death.

Organizing the Central Nervous System: Signaling Centers and Regional Patterning The central nervous system begins as the neural plate, which folds along the midline and closes dorsally to form the neural tube. From its formation, the neural plate is patterned along the rostrocaudal and mediolateral axes in a grid-like fashion by gradients and boundaries of gene expression. HOX genes, for example, are differentially expressed along the rostrocaudal axis and play an important role in specifying segmental organization of the spinal cord and hindbrain. Such differences of gene expression are programmed by both the intrinsic developmental history of each region, and by extracellular factors produced in signaling centers that define positional information through interactions with developing neural tissue. Gene expression gradients, compartments, boundaries, and signaling centers continue to be important throughout the embryonic period until each brain subdivision has been generated and acquired its specific identity.


Neural Tube Closure and Wnt-PCP Signaling Neural tube closure is a key early event in brain and spinal cord development, in which the planar epithelium of the neural plate folds at the midline along the anteroposterior axis, and the lateral edges of the neural plate move dorsally, contact each other, and fuse dorsally to form the neural tube (Figure 27.5). Dorsal fusion first occurs in the region of the cervical spinal cord primordium, followed by separate closure events at midbrain and rostral telencephalic points. The exact location and number of dorsal fusion events varies between and within species. From each of these sites, fusion proceeds rostrally and caudally in a zipperlike mode until closure is complete (primary neurulation) from the rostral end (anterior neuropore) to the caudal (posterior neuropore). Interestingly, this mode of primary neural tube closure does not quite extend the full caudal length of the spinal cord, but ends around the lumbosacral region. More caudal regions (mainly sacral) appear to develop by a distinct mechanism involving cavitation of the caudal eminence (tail bud) mesenchyme, known as secondary neurulation. A schematic of this process is shown in Figure 27.6. Primary neurulation depends on deformation of the neural plate due to convergent extension, a process of cell migration within the plane of the neuroepithelium. At the molecular level, convergent extension utilizes the Wnt-planar cell polarity (Wnt-PCP) signaling pathway for cell adhesion and polarity. Many details remain to be elucidated, but this pathway is essential for cells to distinguish mediolateral and anteroposterior directions

Ectoderm Notochord Neural “roof” plate Floor plate Neural crest Hinge region

Figure 27.5 Neural tube formation. In cross-section, the neural tube first derives from a planar (two-dimensional) epithelium with mediolateral organization and transforms to a tubular (three-dimensional) with both mediolateral and dorsoventral axes. 555

Part IV


Figure 27.6 Simplified schematic of the sequence of neural tube fusion. After the neural tube begins closure from rostral and posterior cerebral sites, closure propagates anteriorly and posteriorly. The locations of the neuropores are potential sites for defects of neural tube closures. Although 2 initiation sites of primary neural tube fusion are shown here, this has not been rigorously proven in humans, and other mammals may have more initiation sites. Adapted from [6].

within the neuroepithelium, and thus migrate in the correct directions. Studies of mutant mouse strains, notably loop-tail (Lp), have shown that mutations of several Wnt-PCP genes (such as Vangl2 in Lp) cause craniorachischisis, a severe form of open neural tube defect extending from brain to spinal cord. The incidence of neural tube defects (NTD) has recently declined in developed countries due to dietary supplementation with folate, but the molecular mechanism of this effect remains unknown. Polymorphisms in enzyme genes involved in folate metabolism are known to confer risk for NTD. One polymorphism of 5,10-methylene tetrahydrofolate reductase (MTHFR) is thermolabile and, if present in fetus or mother, confers increased risk of NTD. Environmental and toxic exposures have also been implicated in the pathogenesis of NTD. A large number of physical agents ranging from X-irradiation to alcohol to folate antagonists have been associated with NTD in epidemiologic studies and can cause NTD in animal models. Maternal health status, including diabetes, obesity, infections, and toxic exposures, also is associated with NTD in humans [6]. Importantly, the process of neurulation transforms the axes of the developing CNS neuroepithelium from a planar to a tubular coordinate system. The planar (two-dimensional) neural plate is defined by rostrocaudal and mediolateral axes, while the tubular (threedimensional) neural tube is defined by rostrocaudal, mediolateral, and dorsoventral axes. During this reorganization process, the lateral edge of the neural plate becomes the dorsal midline (roof plate) of the neural

556

tube, and the medial edge (midline) of the neural plate becomes the ventral midline (floor plate) of the neural tube (Figure 27.5). The new axes become the substrate for further patterning and remain important throughout later development, although additional axial transformations occur locally in the developing brain. Finally, neural tube closure is essential for subsequent development of posterior tissues including the vertebral arches and cranial vault, paraspinal muscles, and posterior skin of the head and back. In some cases, neural tube closure proceeds normally, but the overlying skin and mesodermal structures fail to cover the posterior neural tube. It is unknown whether these malformations (such as encephalocele, myelocele, and sacral agenesis) are caused by primary defects of neural tube closure (as frequently assumed in the neuropathology literature) or mesodermal and ectodermal development.

Human Neural Tube Defects The most severe neural tube defect, characterized by the complete failure of neural tube closure along the entire craniospinal axis, is called craniorachischisis (Figure 27.7A). This lethal malformation corresponds to the severe form of neural tube defect found in Lp mice, described previously, and is probably caused by defects of Wnt-PCP signaling during convergent extension. Closure defects limited to the cranial region result in anencephaly, a severe, lethal defect (Figure 27.7B). In anencephaly, extensive destruction

Chapter 27


Rostrocaudal and Dorsoventral Patterning of the Neural Tube: Holoprosencephaly

Figure 27.7 Neural tube defects. (A) Craniorachischisis. (B) Anencephaly. (C) Myelomeningocele with Chiari type II malformation. The spinal cord with open lumbosacral myelomeningocele is shown at left; the medial view of brain with hydrocephalus, tectal beaking, and herniation of the medulla over the spinal cord is shown at right.

of the brain tissue is secondary to direct exposure to amniotic fluid: initially, the cerebral tissue proliferates and grows outside the surrounding skull base, a transient stage known as exencephaly. The most common human neural tube defects are limited to the lumbosacral region, sites of posterior neuropore closure and secondary neurulation. Typically, the spinal tissue has a ragged interface with mesodermal and ectodermal derivatives and is exposed externally. This appearance is called myelomeningocele (Figure 27.7C), somewhat erroneously because there is usually no cele or closed sac. Less often, malformations with a closed skin surface and sac are also seen. In the great majority of cases, lumbosacral myelomeningocele is accompanied by a malformation of the midbrain, hindbrain, and skull base known as Chiari type II malformation, historically called the Arnold-Chiari malformation (Figure 27.7C).

A program of segmental, compartmentalized gene expression begins to define rostrocaudal subdivisions of the CNS during neural plate stages, and this process accelerates with neurulation. Morphologically, the spinal cord is partitioned into cervical, thoracic, lumbar, and sacral segments associated with mesodermal somites. Morphological development of the brain is more complicated (Figure 27.8), as it is initially divided into 3 vesicles (prosencephalon/forebrain, mesencephalon/midbrain, rhombencephalon/hindbrain), and then further subdivided into 5 vesicles (telencephalon, diencephalon, mesencephalon, metencephalon, myelencephalon). Key molecular players in spinal and hindbrain segmentation are the HOX genes, which encode transcription factors expressed in nested patterns. The HOX gene family and their functions are highly conserved in evolution: their roles in rostrocaudal segmentation were initially discovered in the fruit fly, Drosophila melanogaster, and have been confirmed in other vertebrate and invertebrate species. More rostral segments of the CNS (forebrain and midbrain) also show segment-like subdivisions and nested gene expression patterns, but HOX genes are not involved. Instead, these brain areas are patterned by distantly related transcription factors with homologous DNA-binding domains (homeobox), along with other families of transcription factors, expressed in complex tissue patterns that interact with several signaling centers in the embryonic brain. The latter include the isthmus at the midbrain-hindbrain junction and the zona limitans intrathalamica at the junction of rostral and caudal thalamic subdivisions. Concurrently with rostrocaudal segmentation, the neural tube is patterned along the dorsoventral axis by a different set of molecules and signaling centers. Important ventral signaling centers include the notochord (primordium of vertebral body nucleus pulposus), a mesodermal structure located ventral to the spinal cord and hindbrain; the prechordal plate mesendoderm, located ventral to the forebrain and midbrain; and the floor plate of the neural tube, a specialized neuroepithelial structure in the ventral midline of spinal cord and brain. All three of these ventral signaling centers produce Sonic hedgehog (Shh), a small, post-translationally modified, secreted protein with potent ventralizing activity on neural structures. The key dorsal signaling center is the roof plate, a specialized neuroepithelial structure in the dorsal midline that ultimately develops into choroid plexus. The roof plate, characterized by high-level expression of ZIC genes, produces secreted morphogens belonging to the bone morphogenetic protein (BMP) and Wnt families, with potent dorsalizing activity. The balance of antagonistic ventralizing and dorsalizing signals patterns the neural tube into basal and alar subdivisions associated with motor and sensory pathways, respectively. Accordingly, the ventral spinal primordium generates motor neurons, while the

557

Part IV


A

Diencephalon

Mesencephalon

Rhobencephalon

Mesencephalon

Diencephalon

Mesencephalon

B

Myelencephalon

Telencephalon

Figure 27.8 Segmentation and cleavage of the developing brain. (A) After fusion of the neural tube, the anterior-most portion forms swellings that will become the cerebrum (diencephalon), the midbrain (mesencephalon), and hindbrain (rhombencephalon). (B) Following this, proliferation of the cortical neuroepithelium forms telecephalic vesicles and will become the majority of the brain’s paired hemispheres, and the rhombencephalon divides into the metencephalon and myelencephalon, which will become the pons and cerebellum and medulla, respectively.

dorsal spinal primordium generates sensory relay neurons. Sensory and motor distinctions become more subtle in the midbrain and forebrain. For example, most of the forebrain is composed of alar (sensory) plate neuroepithelium, including such ventral (anatomically speaking) structures as the neural retina and optic pathways. In contrast, the neurohypophysis (ventral hypothalamus) may be considered a motor pathway, inasmuch as hormone-producing neurons generate somatic responses and behaviors.

of dorsal midline and ventrolateral forebrain structures, the essential underlying mechanisms of hemispheric separation. Overall proliferation is severely reduced in holoprosencephaly, and the brain is invariably small.

Holoprosencephaly

Because of its significance for human cognition and awareness, cerebral cortex development has been a subject of great interest in basic research and the findings serve as a paradigm for mechanisms of regional patterning. The cerebral cortex develops as a dorsal outpouching of the alar plate, with midline separation into right and left hemispheres. Early in cortical development, the cleavage of telencephalon into right and left hemispheres depends on dorsoventral patterning, such that proliferation is initially enhanced in lateral cortical regions (away from the dorsal and ventral midline), while apoptosis is enhanced in the dorsal midline (roof plate). Differential growth of the telencephalic roof plate (slow) and lateral telencephalon (rapid) causes growth of the hemispheric neuroepithelium accompanied by relative reduction of the dorsal midline, leading to formation of the interhemispheric fissure. Accordingly, defective dorsal or ventral patterning (due to mutations in SHH, ZIC2, and other

The best characterized and most common defect of dorsoventral patterning in humans is holoprosencephaly, defined as complete or partial failure of cerebral hemispheric separation. Holoprosencephaly exhibits a spectrum of severity. The mildest forms (lobar holoprosencephaly) show some development of the interhemispheric fissure with continuity of cortex across the midline. Forms with intermediate severity (semilobar holoprosencephaly) show partial development of the interhemispheric fissure, and severe forms (alobar holoprosencephaly) show complete absence of the interhemispheric fissure, with a single forebrain ventricle (Figure 27.9). The defective midline structures in holoprosencephaly result from abnormalities of ventral or dorsal patterning molecules, including Shh and Zic2. Dorsoventral patterning is essential for differential proliferation and apoptosis 558

Signaling Centers and Transcription Factor Gradients in the Cerebral Cortex: Thanatophoric Dysplasia

Chapter 27

Figure 27.9 Alobar holoprosencephaly in a 23-week gestational age fetus. (A) Anterior view: the single “holosphere” exhibits shallow sulci but no deep interhemispheric fissure. (B) Posterior view: cortex is continuous across the midline and the posteriorly open (due to disrupted delicate membranes) single forebrain ventricle is visible.

genes) results in a failure of separation between the hemispheres. Even as the cerebral hemispheres begin to separate, patterning of the cortical areas within each hemisphere is already being initiated along the rostrocaudal and mediolateral axes, through the elaboration of additional signaling centers, and their production of secreted morphogens. Principal signaling centers that pattern the cerebral cortex include the commissural plate (rostral signaling center), cortical hem (dorsomedial signaling center), and cortical antihem (ventrolateral signaling center). These signaling centers, located at edges of the cortical neuroepithelium, secrete morphogens that regulate regional growth and identity along diffusion gradients that, by differential activation of receptors, encode positional information in the cortical neuroepithelium. The commissural plate, for example, produces fibroblast growth factor-8 (FGF-8), which specifies frontal lobe identity near the FGF-8 source, and parietal lobe more distally. Remarkably, ectopic expression of FGF-8 in caudal regions of embryonic mouse cortex induces the formation of a duplicate, mirror-image frontoparietal cortex (as indicated by molecular and cytoarchitectonic markers) at the occipital pole. The cortical hem, located at the medial edge


of embryonic cortex, produces Wnt and BMP family molecules that specify hippocampus, medial temporal, and medial parietal cortex. Animal research indicates that FGF-8, Wnt family members, and other signaling molecules specify cortical arealization by inducing the expression of developmental transcription factors in progenitor cells, even before most cortical neurons are produced. Gradients of EMX1, PAX6, COUP-TF1, and other transcription factor gene expression have been detected along rostrocaudal and mediolateral axes in rodents and appear to create a molecular coordinate system in which cortical areas are determined by a combinatorial code of transcription factor expression. Some transcription factors (such as PAX6) control both regional identity and growth of cortical areas, thus coordinating these processes. Other transcription factors seem to regulate either identity or growth preferentially. The distinct roles of different signaling molecules and transcription factors provide tremendous flexibility in determining not only the overall size of cerebral cortex, but also the relative size of sensory, motor, and multimodal specific areas. These findings suggest that the size of human cortical areas may depend on the interplay of signaling centers and transcription factor gradients during embryonic development. This would further imply that aspects of mature human cognitive abilities may be determined by small variations of patterning signals during cortical development. According to this model, the unusual gyral pattern of Albert Einstein’s parietal cortex, thought to possibly explain his mathematical gifts, could have arisen by gene interactions or developmental noise during the first trimester of intrauterine development!

Thanatophoric Dysplasia FGF signaling plays a major role in regulating cortical arealization and proliferation. FGF receptor 3 (FGFR3) is one of four tyrosine kinase receptors for FGF signaling and is highly expressed in the embryonic cerebral cortex in a high caudal–low rostral gradient. Constitutive activating mutations of FGFR3 have been linked to thanatophoric dysplasia, a severe form of achondroplastic dwarfism in which the brain is enlarged and exhibits aberrant, prematurely forming sulci in temporal and occipital lobes (Figure 27.10). The cortical surface area and overall mass are also markedly increased in thanatophoric dysplasia, illustrating the coordinate regulation of cortical surface area growth and areal patterning even in a pathological condition.

Compartmentalization of Embryonic Neurogenesis Mature brain and spinal regions contain a mixture of excitatory and inhibitory cell types that utilize different neurotransmitters. The principal excitatory neurotransmitter at central synapses is L-glutamate, and the principal inhibitory neurotransmitter is g-aminobutyric acid 559

Part IV


Figure 27.10 Thanatophoric dysplasia in a midgestational fetal brain (inferior view). Aberrant, prematurely formed sulci are present in the medial temporal and occipital lobes, radiating from the hindbrain and cerebellum (with small subarachnoid hemorrhage) in a “bear claw” configuration.

(GABA). Recently, it has been shown that developmental patterning of the brain and spinal cord plays a fundamental role in defining neurotransmitter types at very early stages, prior to the genesis of postmitotic neurons. Moreover, it has been shown that many distinct regions of the developing brain are patterned to produce either excitatory (glutamatergic) neurons or inhibitory (GABAergic) neurons. Thus, the production of different types of neurons is compartmentalized, and mature circuits are assembled by postmitotic neuronal migrations. Important examples of compartmentalized neurogenesis have been discovered in development of the cerebral cortex and cerebellum, the two largest brain structures in humans. In the cerebral cortex, it has been shown that glutamatergic (pyramidal) cells, which account for 75%–80% of cortical neurons, are produced locally within the cortical neuroepithelium. In contrast, GABAergic interneurons are produced in subcortical progenitor compartments called the medial, caudal, and lateral ganglionic eminences that have long been known as basal ganglia progenitor regions. The interneurons then migrate long distances tangentially into the developing cortex and integrate into the circuitry along with the locally generated glutamatergic neurons. The compartmentalization of neurogenesis implies that different genes may control the development of pyramidal cells and interneurons, and indeed this is the case. In mice, the cortical and subcortical compartments express different transcription factors, including EMX family homeobox genes and TBR family T-box genes in the cortex, and DLX family homeobox genes in the subcortical regions. Mutations of these transcription factors selectively interfere with the development of the predicted set of neurons in mice, although this remains to be confirmed in humans. In the cerebellum, glutamatergic and GABAergic neurogenesis are likewise compartmentalized, but in contrast to cortex, glutamatergic neurons migrate 560

tangentially and GABAergic neurons migrate radially. Cerebellar GABAergic neurons (Purkinje cells and inhibitory interneurons) are produced in the cerebellar ventricular neuroepithelium, while glutamatergic neurons (deep nuclei projection neurons, granule cells, and excitatory interneurons) are produced in a specialized compartment known as the rhombic lip, which surrounds the roof of the fourth ventricle, and its derivative, the external granular layer, produced by progenitor migration from the rhombic lip over the entire surface of the cerebellar primordium. Transcription factors play a prominent role in defining the neurogenic regions, such as Ptf1a (also known as cerebelless), a basic helix-loop-helix (bHLH) transcription factor, in GABAergic progenitors, and Math1, another bHLH family transcription factor, in rhombic lip glutamatergic progenitors. This view of cerebellar neurogenesis has been established in mice but remains to be confirmed in human brain [5]. No malformations ascribed specifically to one type of neurotransmitter differentiation have been described as yet.

Proliferation, Progenitors, and Apoptosis: Micrencephaly The overall and relative sizes of the brain and spinal cord, and their component regions, are determined in large part by the balance of proliferation by progenitor cells, and apoptosis by progenitors and postmitotic cells. Cell size also plays a significant role in determining nervous system size. In recent years, there has been tremendous progress in identifying various types of progenitor cells that differ in morphology, proliferative potential, neuronal or glial commitment, and maturation sequences. The analysis of progenitors has been highly stimulated by the discovery of adult neurogenesis and by the explosion of research on stem cells. Likewise, patterns of apoptosis have also been carefully examined throughout CNS development and key molecular regulators identified. Tight control over proliferation and apoptosis is essential not only for determining brain size, but also for preventing neoplasia. Both neurogenesis and gliogenesis are functions of neural progenitor cells that are heterogeneous and, as a group, undergo progressive maturation and specialization from early to late stages. Timing has great significance, as different types of neurons and glia are produced sequentially according to consistent timetables. In the cortex, for example, deep-layer neurons are produced first, followed by superficial-layer neurons, and then glial cells.

Neuroepithelial Cells and Radial Glia The nervous system begins as a true epithelium, with apical and basal surfaces that correspond to the ventricular and pial surfaces, respectively. Accordingly, the earliest progenitor cells, which have elongated morphology with processes that span the epithelium, are designated as neuroepithelial cells. Generally, neuroepithelial cells are capable of producing neurons,

Chapter 27

astrocytes, and oligodendrocytes and have virtually unlimited self-renewal proliferative potential, and thus qualify as a type of neural stem cells. Neuroepithelial cells and other neural stem cells express characteristic markers, such as Nestin (an intermediate filament), although none of these markers are completely specific. With further maturation, the progenitors show evidence of astrocytic differentiation while maintaining their elongated (radial) morphology. These astrocyte-like cells are known as radial glia, and they serve both as progenitors and as a scaffold for the developing nervous system. Radial glia generally have high proliferative potential, but heterogeneous properties of molecular expression and fate commitment (neurogenic or gliogenic). Neuroepithelial cells and radial glia both divide at the apical (ventricular) surface, which may serve to limit their proliferation as well as maintain apical-basal polarity of the pseudostratified neuroepithelium.

Intermediate Neuronal Progenitors


olfactory bulb where they incorporate into its circuitry. Interestingly, adult neurogenesis involves stages of progenitor maturation and molecular expression that highly resemble those in embryonic development of the hippocampus and olfactory bulb.

Gliogenesis Glial cells include astrocytes, oligodendrocytes, microglia, and possible new types such as NG2-positive cells. Generally, gliogenesis follows neurogenesis with relatively little temporal overlap. Astrocytes appear to be produced directly from radial glia, and by continued division of astrocytes and glial progenitors that maintain the potential to proliferate throughout life. In terms of progenitor lineages and molecular expression, oligodendroglia in most regions are more closely related to neurons than to astrocytes. NG2-positive cells are poorly understood glia with some progenitor properties that probably are generated concurrently with other glial types.

Intermediate neuronal progenitors, also known as transient amplifying cells, are produced from neuroepithelial cells and radial glia, but unlike them, do not contact the ventricular or pial surfaces. Instead, they have short or no processes and divide away from the apical surface; for this reason, they have also been called basal progenitors. Intermediate neuronal progenitors have a very limited proliferative potential, amounting to no more than 1–3 mitotic cycles, perhaps because they are detached from the ventricular surface and thus lack the constraints posed by attachment. Intermediate neuronal progenitors appear to produce only neurons (not glia), and their molecular and morphologic characteristics vary among brain regions. In the cerebral cortex, intermediate progenitors specifically express Tbr2/Eomes, a T-box transcription factor. The role of intermediate neuronal progenitors appears to be expansion of neuronal subsets from limited numbers of neuroepithelial cells or radial glia.

Apoptosis

Adult Neurogenesis

Small brain size (micrencephaly) is caused by defective proliferation of cortical progenitors. Commonly, it is associated with other malformations, such as holoprosencephaly and lissencephaly. Less often, it occurs in the absence of other malformations. This form of micrencephaly has been linked in some cases to mutations in ASPM, a gene encoding an essential protein for the mitotic spindle.

Whereas it was long believed that neurogenesis did not occur in mature animals, studies in experimental animals and humans have demonstrated that, in fact, neurogenesis continues at robust levels in two brain regions: the subgranular zone in the dentate gyrus of hippocampus, and the subventricular zone adjacent to striatum. The hippocampal subgranular zone contains Nestin-positive, neural stem-like cells (“like” because they may not have unlimited self-renewal capacity) that produce new glutamatergic neurons that incorporate anatomically and functionally into the dentate gyrus, presumably to subserve new memory formation, although the functional impact of adult hippocampal neurogenesis is still not clear. The striatal subventricular zone likewise contains Nestinpositive, neural stem-like cells that produce new GABAergic (and some glutamatergic) neurons, which migrate along the rostral migratory stream into the

Programmed cell death, or apoptosis, occurs as a normal and essential part of brain development that functions to eliminate unnecessary, excess progenitors and neurons. In fact, apoptosis is most active and important in progenitor compartments. Gene targeting to inactivate (or knockout) genes that are required for apoptosis in mice causes hyperplasia of some neuroepithelial regions, especially the developing cerebral cortex. In mice, the result is a dramatic increase of cortical surface area with aberrant formation of gyri. Unlike humans, mice have smooth-surfaced or lissencephalic brains that normally lack gyri. Apoptosis of postmitotic neurons also does occur, but at lower levels. Here apoptosis may cull excess neurons produced at the end of neurogenesis that fail to integrate into the CNS circuitry.

Micrencephaly

Neuronal Migration and Differentiation: Lissencephaly Postmitotic Events and Integration into Neural Circuits Much evidence suggests that fundamental aspects of neuronal fate (including positional or laminar fate, neurotransmitter type, axonal connections, and molecular expression) are determined during the last 561

Part IV


mitotic cycle, when the neuron is produced or born. Thus, newly generated neurons are born with their missions already defined. In order to accomplish its mission, the new neuron must (i) differentiate by expression of general neuronal genes and neuronal subtype-specific genes; (ii) migrate to the correct location; (iii) grow axons and dendrites and make appropriate synaptic connections; (iv) refine connections with other neural elements according to critical environmental stimuli; and (v) acquire glial contacts (myelination and astrocytic contacts) that enhance neuronal function.

Neuronal Differentiation The vast numbers of distinct neuron types in the brain (numbering in the hundreds) express different combinations of general neuronal genes, as well as neuronal subtype-specific genes. In the cerebral cortex, for example, each cortical layer contains multiple distinct types of glutamatergic (pyramidal) neurons and multiple distinct types of GABAergic (inhibitory) neurons. In general, the specific properties of each neuron type are largely specified by the combinatorial and sequential expression of transcription factors. Initial specification of neuronal fates begins in progenitors by the expression of neurogenic genes, such as Neurogenin1, a bHLH transcription factor. Following mitosis, a different set of bHLH transcription factors is activated, belonging to the neuronal differentiation group (such as Neurod1). Further differentiation into neuronal subtypes involves other transcription factors belonging to a great variety of families.

Neuronal Migration Virtually all new neurons migrate from their sites of production in progenitor zones, to sites of integration in postmitotic neural structures. Migrations are remarkably diverse among various brain regions: they may traverse relatively short or long distances, may be mainly radial or tangential or both, and may involve multiple sequential phases (for instance tangential followed by radial migration). One example of a long-range, mainly tangential migration was given previously, in reference to the migration of interneurons from subcortical forebrain into the developing cortex. Indeed, migrations are particularly robust in the cerebral cortex and in the cerebellum, and these regions are hardest hit by mutations that perturb cell migration. Neuronal migration requires the coordinated activity of numerous molecules belonging to several categories. First, the direction of migration is selected by a leading process with a distal specialization or growth cone where guidance receptors from a variety of families may be expressed (such as Eph family tyrosine kinase receptors). Second, the leading process must grow in the indicated direction, a process that requires actin and microtubule cytoskeletal dynamics, as well as membrane turnover (mediated by endocytic vesicles). Third, the nucleus must be pulled toward the leading process by a network of microtubules oriented from 562

the centrosome. Using these mechanisms, neurons migrate in a phasic rather than continuous manner, with repeated cycles of leading process growth and nuclear translocation. Whereas neuronal migration appears highly sensitive to disturbances in the underlying cellular machinery, it is also clear that the mechanisms of cell migration have a great deal of overlap with axon guidance (likewise mediated by a growth cone), membrane recycling, and cellular proliferation. Accordingly, neuronal migration disorders in humans often display associated abnormalities of axon pathways and brain growth. Studies of the genetics of human and murine neuronal migration disorders have led to the identification of many key molecules guiding or promoting neuronal migration. In mice, one of the prototypical neuronal migration disorders was found in the spontaneous mutant strain reeler, in which the cerebral cortex and cerebellum show severe abnormalities of cellular organization. Further studies revealed that the disorder resulted from deficiency of a large secreted protein encoded by the reeler gene. The cognate protein, Reelin, was found to be highly localized in the cortical marginal zone, and in specific locations within the developing cerebellum, suggesting that it might function as a guidance molecule for migrating neurons. Further studies have supported this interpretation, as receptors for Reelin and downstream intracellular signaling molecules have been identified. A human counterpart of the mouse disorder has been identified in patients with lissencephaly and cerebellar hypoplasia, found to have mutations in the human RELN gene. Other genetic studies of human patients with lissencephaly or periventricular heterotopia have identified several additional critical genes, notably including DCX (Doublecortin), LIS1 (Lissencephaly-1), FLNA (Filamin A), and ARFGEF2 (a vesicular trafficking molecule). These molecules are important for microtubule dynamics or membrane dynamics, and critical for cellular mechanisms of either nuclear translocation within migrating cells (microtubule dynamics) or addition of membrane to the leading process (membrane trafficking).

Lissencephaly, Periventricular Heterotopia, and Polymicrogyria Lissencephaly, periventricular heterotopia, and polymicrogyria are the classic disorders of neuronal migration described in human neuropathology. Lissencephaly is an abnormality of cortical development which, in humans, produces a thickened cortical gray matter layer without normal folding (gyri). Lissencephaly may be divided into type I (smooth surface) and type II (cobblestone surface), which have distinct mechanisms. Type I lissencephaly is a primary defect of neuronal proliferation and migration (Figure 27.11A), while type II lissencephaly is a primary defect of basal lamina integrity at the pial surface, in which basal lamina breakdown leads to neuronal migration through the basal lamina defects and, ultimately, disorganization of the cortical structure. Mutations of cell migration molecules such as LIS1 and DCX are the cause of type I lissencephaly,

Chapter 27


from progenitor compartments (ventricular zone and subventricular zone) to the cortical plate, polymicrogyria involves defective laminar organization of neurons within the cortical plate. Hereditary forms of polymicrogyria have been linked to mutations in GPR56, a G-protein coupled receptor of unknown function. On the basis of the genes identified so far, polymicrogyria may be caused by defects in distinct classes of molecules from lissencephaly and periventricular heterotopia.

Axon Growth and Guidance: Agenesis of the Corpus Callosum The cellular complexity of the human brain is exceeded only by its extraordinary connectional complexity. Axonal pathways develop concurrently with neuronal migrations and are mediated by numerous large families of axon guidance molecules, among them the Eph receptors, ephrin ligands, Semaphorins, neuropilins, plexins, Robo receptors, Slit ligands, diverse cell adhesion molecules, secreted morphogens, and extracellular matrix molecules and their receptors. Studies in experimental animals have shown that, in order to effectively navigate long distances, axon growth and guidance typically involve stepwise progression from one intermediate target to another. Hundreds of axon guidance phenotypes have been identified in mice and other experimental animals (fruit flies, worms, zebrafish) with mutations in axon guidance molecules, and this is an area of intense research. Somewhat surprisingly, only a few axon guidance disorders have been found in humans. This likely reflects the difficulty of tracing axon pathways in the human brain, where it is obviously impossible to inject actively transported axon tracers during life.

Agenesis of the Corpus Callosum Figure 27.11 Defects of cortical differentiation or migration. (A) Lissencephaly (type I) in Miller-Dieker syndrome (lateral view). The sulci are extraordinarily shallow, lending the brain surface a smooth surface appearance. (B) Polymicrogyria affecting lateral frontal cortex. (C) Periventricular heterotopia in the occipital horn of the lateral ventricle.

while mutations in glycosylation enzyme genes (essential for basal lamina integrity) are the cause of type II lissencephaly. Periventricular heterotopia, abnormally localized gray matter islands abutting the ventricular surfaces (Figure 27.11B), can be caused by FLNA mutations, chromosome abnormalities, and other unknown molecular or tissue abnormalities. Polymicrogyria, abnormally organized cortex with numerous small gyri (Figure 27.11C), is a heterogeneous disorder with variable lobar, unilateral, or bilateral distribution, and genetic as well as nongenetic causes (such as fetal hypoxia-ischemia). Different histological varieties of polymicrogyria have also been described, including fourlayered and unlayered types. Whereas lissencephaly and periventricular heterotopia involve defective migration

Agenesis of the corpus callosum, a relatively common disorder (1 per 1000), can be asymptomatic, and is believed to be due to a failure of axon guidance. It has been linked in X-linked pedigrees to mutations of L1 cell adhesion molecule. Often, the callosal axons that fail to cross the midline instead form an aberrant tangle of fibers adjacent to the midline, called a Probst bundle (Figure 27.12).

Synaptogenesis, Refinement, and Plasticity: Autism and Schizophrenia Synaptogenesis, refinement, and plasticity, relatively late stages of neuronal development, are essential for proper CNS functioning, but not morphogenesis. Thus, perturbations of critical molecules for these processes cause complex cognitive, sensory, or motor disorders without obvious malformations. Human diseases related to these processes are thought to include forms of autism, schizophrenia, and mental retardation. However, these disorders are genetically and phenotypically complex, and remain poorly understood in relation to developmental neurobiology. 563

Part IV


mechanisms are not exclusive to any neurologic disease but are commonly proposed to contribute to varying degrees to the pathogenesis of stroke, neurodegeneration, and neurotoxicant injury. The adult CNS has limited regenerative ability, as noted previously. The natural history of CNS damage is that cells vulnerable to injury become necrotic or apoptotic and their debris removed by scavenger cells. The overall mass of the effected region is reduced and shrinks in a state called atrophy. The residual neuroepithelial cells, usually astrocytes and microglia, respond by gliosis.

Excitotoxicity

Figure 27.12 Agenesis of the corpus callosum. (A) Medial view: the corpus callosum is absent and the cingulate gyrus and sulcus are malformed. (B) Coronal slice: Probst bundles are visible dangling below the malformed cingulate cortex, indicating growth toward the midline but failure to cross.

Summary Molecular expression changes due to genetic mutations are a frequent cause of cerebral and spinal malformations. Progress in developmental neurogenetics has transformed developmental neuropathology by providing a mechanistic understanding of malformations, by improving prognostic accuracy, and by providing insights that may one day allow for more effective treatments of these often devastating conditions.

NEUROLOGICAL INJURY: STROKE, NEURODEGENERATION, AND TOXICANTS Basic Mechanisms of Injury Before we embark on a discussion of specific types of nervous system injury, it is first worthwhile to consider a few basic mechanisms of damage to the nervous system and the nervous system’s response. The following 564

L-glutamate is the most abundant excitatory amino acid (EAA) neurotransmitter in the CNS. It and its cell surface ligand-activated ion channels, such as AMPA and NMDA receptors, participate in a wide array of neurological functions. Figure 27.13A depicts normal activity at an excitatory synapse. The glutamatergic presynaptic terminal releases glutamate upon depolarization into the synapse that then can bind to postsynaptic AMPA receptor to initiate influx of Naþ into the postsynaptic element that has a potential gradient across its membrane generated primarily by the action of Naþ/Kþ-ATPase. Glutamate also binds to the NMDA receptor, but unless the postsynaptic membrane is sufficiently depolarized, flow of cations, including Ca2þ, is blocked by Mg2þ. Glutamate is removed from the synapse by a number of transporters on neurons and astrocytes; astrocytic glutamate can enter the glutamine cycle to replenish neurotransmitter pools. Excitatory neurotransmission can be subverted to contribute to several neurologic diseases. Indeed, drugs that target excitatory neurotransmission are currently approved for use in patients with Alzheimer’s disease and remain a focus of those interested in limiting damage from ischemia or multiple sclerosis. Excessive EAA receptor stimulation sets in motion a cascade of events that can contribute to neuronal injury through a process called excitotoxicity. Broadly, there are two types of excitotoxicity: direct and indirect. Figure 27.13B depicts events in direct excitotoxicity. The key initiator in direct excitotoxicity is increased synaptic concentration of EAAs either by release from the presynaptic terminal (shown in red in Figure 27.13), decreased reuptake, or exposure to excitatory neurotoxicants like domoic acid in algal blooms or as occurs in lathyrism. Extensive activation of AMPA receptors sufficiently depolarizes the postsynaptic membrane to relieve the Mg2þ block of the NMDA receptor. Rapid injury and lysis can follow this depolarization-dependent increase in ion influx. Delayed toxicity can develop even after EAA has been removed secondary to increased intraneuronal Ca2þ levels with subsequent inappropriate activation of calcium-dependent enzymes, mitochondrial damage, increased generation of free radicals, and transcription of proapoptotic genes. Indirect excitotoxicity is depicted in Figure 27.13C. In distinction from direct excitotoxicity, the key event

Chapter 27

Glu

Gln Gln

Glu Glu

Na Glu Glu

Glu Glu

Rcpt Glu AMPA + Rcpt Na+

Na+ ATPase

Glutamatergic presynaptic T terminal

K+ T

T

Glu Glu

ATP

Glu

Glutamatergic presynaptic T terminal

K+ T

Glu

ROS cytochrome C

Glu NMDA Ca2+ Ca2+ Rcpt Glu Glu AMPA Na+ Rcpt Glu Glu AMPA Na+ Rcpt Glu Na+ Na+ ATP ATPase

Glu Glu

AMPA

Na+ Glu Glu

Glu Glu

T

Glu NMDA Ca2+ Mg2+ Rcpt

Glu Glu

T

Gln

Glu

Glu

Glu

Gln T

T


Astrocyte process

K+ T

T

K+ T

Astrocyte process B

A

Glu

Gln

T

Gln T

Glu NMDA

Glu Glu

Ca2+

Glu Glu

Glu Glu

Ca2+

Rcpt AMPA

Na+

Glu Glu

Glu Glu

Glu

Glu

ROS cytochrome C

Rcpt Glu AMPA Na+ Rcpt Na+

Na+

ATP

ATPase Glutamatergic presynaptic T terminal

C

K+ T

T

K+ T

Astrocyte process

Figure 27.13 Excitotoxicity. Diagrams show excitatory neurotransmission (A), direct excitotoxicity (B), and indirect excitotoxicity (C).

is impaired mitochondrial function with reduced ATP generation. One consequence is reduced activity of Naþ/Kþ-ATPase with partial depolarization of the postsynaptic membrane that, when combined with normal levels of glutamate release, are sufficient to relieve the Mg2þ block of NMDA-mediated ion conductance. This again leads to increased intraneuronal Ca2þ with consequences similar to those described for direct excitotoxicity.

Mitochondrial Dysfunction That neuronal mitochondrial dysfunction leads to neuron damage and death is clearly established by toxicants, perhaps the best studied being 1-methyl-4-phenyl-tetrahydropyridine (MPTP). Interrupting electron transport, diminishing the proton gradient, or inhibition of complex V all can result in reduced ATP production and lead to stressors like those described previously. 565

Part IV


limited by its own diffusion. Hydroxyl radical is formed from O2– and H2O2 by the Haber-Weiss reaction (Figure 27.14, Reaction 2) or from H2O2 by the Fenton reaction (Figure 27.14, Reaction 3). Several metal ions may participate in the Fenton reaction, including Fe(II), Cu(I), Mn(II), Cr(V), and Ni(II). Nitric oxide (.NO), a free radical product of nitric oxide synthase-catalyzed oxidation of L-arginine to citrulline, initiates a cascade of reactive nitrogen species (RNS). .NO has several physiologic functions including vasodilator and neuromodulator. .NO reacts with O2.- to produce peroxynitrite (ONOO-), a potent oxidant that can modify cellular macromolecules (Figure 27.14, Reaction 4). In turn, reaction of ONOO- with ubiquitous CO2 forms nitrosoperoxy carbonate that spontaneously cleaves to form a nitrating agent, nitrogen dioxide radical, and an oxidant, carbonate anion radical (Figure 27.14, Reaction 5). Finally, ONOO- may decompose to nitrous oxide and .OH upon protonation. Carbon-centered free radicals are generated during the metabolism of some toxicants, like carbon tetrachloride, and also are produced on fatty acyl chains during lipid peroxidation.

The contribution of mitochondrial dysfunction to neuron injury likely extends far beyond toxicants to include some unusual diseases caused by inherited mutations in the mitochondrial genome or genes encoded in the nucleus whose protein products are incorporated into mitochondria, and perhaps some neurodegenerative diseases like Huntington’s disease and Parkinson’s disease.

Free Radical Stress Free radicals are normal components of second messenger signaling pathways. However, excess or uncontrolled free radical production is detrimental to cells either by direct damage to macromolecules or liberation of toxic byproducts. A number of sites for free radical generation exist in the nervous system. A major source appears to be oxidative phosphorylation in mitochondria. Other sources of free radicals may become significant during pathological states. These include excitotoxicity, enzymes such as cyclooxygenase, lipoxygenase, myeloperoxidase, NADPH oxidase, and monoamine oxidase, autoxidation of catechols such as dopamine, and amyloid b peptides. Research in biological systems has focused on oxygen-, nitrogen-, and carbon-centered free radicals with oxygen-centered free radicals being the most extensively studied. During the sequential four electron reduction of molecular oxygen to water (Figure 27.14, Reaction 1), two free radicals, superoxide anion (O2.-) and hydroxyl radical (.OH), are produced along with hydrogen peroxide (H2O2). Since H2O2 is not a radical, these three molecules are collectively referred to as reduced oxygen species (ROS). Both O2– and H2O2 are signaling molecules under normal physiological conditions. On the other hand, hydroxyl radical is the most reactive and is capable of oxidizing lipids, carbohydrates, proteins, and nucleic acids at a rate

O2–

H2O2

Molecular Oxygen

Superoxide Anion

Hydrogen Peroxide

+

H2O2 •NO Nitric Oxide

ONOO–

566

Free radical-mediated damage to polyunsaturated fatty acids, termed lipid peroxidation, differs from other forms of free radical damage to macromolecules because it is a self-propagating process that generates neurotoxic byproducts (Figure 27.15). Lipid peroxidation begins with abstraction of a hydrogen atom from a fatty acyl chain (LH), typically a polyunsaturated fatty acid (PUFA), because the carbon-hydrogen bond is made more acidic by the adjacent carbon-carbon double bond. This leaves a lipid radical (L.) that rearranges to a conjugated diene that can accept

O2

O•2–

Figure 27.14

Lipid Peroxidation

H2O2 Me+

+

+

O•2–

+

O2 OH–

•OH

OH–

+

+

H2O

Hydroxyl Radical

•OH

•OH

+

+

(2)

Me++

ONOO– Peroxynitrite

CO2

ONOOCO2– Nitrosoperoxy Carbonate

(1)

Water

(3)

(4)

•NO

+ 2 Nitrogen Dioxide

(5) CO3• Carbonate Anion radical

Reactions in the generation of reduced oxygen species (ROS) and reduced nitrogen species (RNS).

Chapter 27

H H H3C

.

R’ R

PUFA (LH)

OH O

R’ H

hydrogen abstraction

R lipid hydroperoxide (LOOH)

• R

lipid radical (L •) 1. conjugation 2. O2 insertion

L’H

L’

H

H3C

O•

.

H3C

H


hydrogen abstraction

O

H

H3C

R

lipid peroxyl radical (LOO •)

Fenton reaction

H3C

O• H

fragmentation

H3C OH

R

O

H2C lipid alkoxyl radical (LO •)

Figure 27.15

O two products of many: 4-hydroxy-2-nonenal & acrolein

Diagram of reactions in lipid peroxidation.

molecular oxygen to form a peroxyl radical (LOO.) that in turn can propagate the reactions by abstracting a hydrogen atom to generate a lipid hydroperoxide (LOOH). Lipid hydroperoxides are reactive molecules that can participate in many reactions, including the Fenton reaction to generate fragmentation products. Thus, there are two deleterious outcomes to lipid peroxidation: (i) structural damage to membranes and (ii) generation of bioactive secondary products. Membrane damage derives from the generation of fragmented fatty acyl chains, lipid-lipid crosslinks, and lipidprotein crosslinks. In addition, lipid peroxyl radicals can undergo endocyclization to produce novel fatty acid esters that may disrupt membranes. Fragmentation of lipid hydroperoxides, in addition to producing abnormal fatty acid esters, liberates a number of diffusable products, some of which are potent electrophiles; the most abundant are chemically reactive aldehydes such as acrolein and 4-hydroxy-2-nonenal. There are now many studies that highlight the potential of these numerous toxins to damage neurons and potentially contribute to neurodegenerative disease.

Carbonyl Stress Analogous to protein adduction by reactive carbonyls generated by lipid peroxidation, non-enzyme-catalyzed post-translational modification of protein by reducing sugars, a process termed glycation, also is associated with some forms of neurodegeneration. Subsequent irreversible rearrangements, fragmentations, dehydrations, and condensations yield a complex mixture of protein-bound products termed advanced glycation endproducts (AGEs). Like reactive aldehydes from lipid peroxidation, AGEs can modify structural proteins and

enzymes and render them inactive or dysfunctional. AGEs also can be redox active and may themselves generate oxidative stress. In addition to these deleterious biochemical reactions, AGE-modified proteins may bind to an AGE receptor (RAGE) that exists on several cell types, including neurons and glia. One role of RAGE is thought to be incorporation of AGE-modified proteins for degradation. However, binding of ligands, including Ab peptides, to RAGE on neurons in culture stimulates production of ROS, and binding to RAGE on microglia in culture leads to their activation.

Innate Immune Activation Activation of innate immune response in brain, primarily mediated by microglia, is a feature shared by several neurodegenerative diseases. Moreover, microglial-mediated phagocytosis of potentially neurotoxic protein aggregates (vide infra) might be an important means of neuroprotection. Indeed, while some aspects of the innate immune activation are an appropriate response to the stressors presented by neurodegenerative diseases, other facets of glial activation, especially when protracted, may contribute to neuronal damage. This balance between beneficial and deleterious actions of immune activation is well appreciated by students of pathology in other organs and is currently an area of very active investigation among neuroscientists with the goal of promoting neurotrophic or neuroprotective actions while suppressing paracrine damage to neurons. Key elements in paracrine neurotoxicity from activated glia appear to include IL-1b, TNFa, and prostaglandin E2, among others with activation of COX2, iNOS, and NADPH oxidase that interface with excitotoxicity and free radical stress. 567

Part IV


Catechol Metabolites Catechols such as dopamine and norepinephrine are vulnerable to oxidations, rearrangements, and condensations under physiological conditions. Within synaptic vesicles, high concentrations of antioxidants and metal ion chelators stabilize catechols. However, conditions in extracellular fluid and cytosol are more favorable for chemical transformation of the catechol nucleus. Several products from catechols have been proposed to participate in dopaminergic neurodegeneration; these include dopamine quinone, 6-hydroxydopamine, and isoquinolines.

Vascular Disease and Injury Disease in the cerebrovasculature can lead to compromised perfusion of regions of the brain or spinal cord, a process called vascular brain injury. The most common types of vascular diseases are atherosclerosis and arteriolosclerosis. The most common forms of vascular brain injury are ischemia and hemorrhage.

Ischemia The clinical consequences of acute ischemic stroke are dramatic and critically dependent on the precise regions of CNS involved. The pathologic consequences of ischemia assume one of three general forms depending on the severity of the insult (Figure 27.16). The first is a complete infarct with necrosis of all parenchymal elements. The second form of injury, an incomplete infarct, occurs when ischemia is less severe, producing necrosis of some cells, but not all tissue elements. Incomplete infarcts demonstrate that neurons and, to

Figure 27.16 Diagram of varying levels of damage and reaction in vascular brain injury. 568

a lesser degree, oligodendroglia are more vulnerable than other cells in the CNS to ischemia. The ultimate tissue manifestation of an incomplete infarct resembles the edge of a complete infarct; that is, neuronal and oligodendroglial depopulation, myelin pallor, astrogliosis, and capillary prominence. The final form of ischemic injury results in damage and dysfunction, but without death of parenchymal elements. Although necrotic brain is essentially irretrievably lost, it is important to realize that the zones with incomplete infarction or damage without necrosis hang in the balance between vulnerability to further injury and salvage or perhaps even regeneration. Indeed, some functional recovery typically occurs in the days, weeks, and even months following an ischemic stroke, in part from resolution of reversible stressors, post-stroke neurogenesis in at least some regions of CNS, and functional reorganization of surviving elements. The balance of deleterious versus beneficial glial and immune responses in these surviving but damaged regions is thought to be key to optimal clinical outcome and is an area of intense investigation. Regardless of the cause, CNS infarcts share a common evolution of coagulative necrosis, leading to liquefaction that culminates in cavity formation. Although death of cells occurs in CNS tissue within minutes of sufficient ischemia, the earliest structural sign of damage is not apparent until 12 to 24 hours following the ictus, when it takes the form of coagulative necrosis of neurons, or red neuron formation (Figure 27.17). The histologic hallmarks of this process are neuronal karyolysis and cytoplasmic hypereosinophilia. Infarcts become macroscopically apparent about 1 day after onset as a poorly delineated edematous lesion (Figure 27.18). Subsequent evolution of infarcts is dictated by the inflammatory cell infiltrate. Around 1 to 2 days after infarction, the lesion is characterized by disintegration of necrotic neurons, capillary prominence, endothelial cell hypertrophy, and

Figure 27.17 Red neuron. Photomicrograph of H&Estained section of cerebellum shows Purkinje neuron with changes of coagulative necrosis, aka “red neuron” (black arrow).

Chapter 27

Figure 27.18 Coronal section of cerebrum shows acute infarct in the territory supplied by the left anterior cerebral artery (blue arrow heads).

a short-lived influx of neutrophils that are rapidly replaced by macrophages. Initially, macrophages may be difficult to discern in the inflamed and necrotic tissue, but within several days they accumulate to very high density and become enlarged with phagocytized material; this is the phase of liquefaction. These debris-laden macrophages ultimately return to the bloodstream. When their task is completed, the solid mass of necrotic tissue that characterized the acute infarct has been transformed into a contracted, fluidfilled cavity that is traversed by a fine mesh of atretic vessels but does not develop a collagenous scar that is typical of other organs (Figure 27.19). Usually, the cavitated infarct is surrounded by a narrow zone of astrogliosis and neuron loss that abuts with histologically normal brain parenchyma. Distal degeneration of fiber tracts is also a late manifestation of infarction in the CNS. The type of vessel occluded leads to characteristic patterns of regional ischemic damage to CNS

Figure 27.19 Coronal section of cerebrum shows remote infarct in the territory supplied by the left middle cerebral artery.


(Table 27.1). Territorial infarcts describe regions of necrotic tissue secondary to occlusion of an artery, such as the anterior cerebral artery (Figure 27.18). A common mechanism for obstruction of large arteries is complicated atherosclerosis with thrombus formation (Figure 27.20A and Figure 27.20B). Some will progress to hemorrhage as the obstruction is lysed and the necrotic regions reperfused. The intraparenchymal large arterioles that arise from arteries at the base of the brain are vulnerable to processes that produce arteriolosclerosis such as hypertension and diabetes mellitus (Figure 27.21). The two major complications of arteriolosclerosis in brain are smaller infarcts (10 year median survival, grade II if they are not curable by resection alone and have 5–10 year median survival, grade III for 2–3 years median survival, and grade IV if they have 200

CGG Repeat Number

Figure 28.1 Schematic representation of the CGG repeat in exon 1 of FMR1 and associated alleles. A CGG-repeat number less than or equal to 45 is normal. A CGG-repeat number of 46 to 54 is in the gray zone and has been reported to expand to a full mutation in some families. A CGG-repeat number of 55 to 200 is considered a premutation allele and is prone to expansion to a full mutation during female meiosis. A CGG-repeat number in excess of 200 is considered a full mutation and is diagnostic of fragile X syndrome.

obtained by multiple determinations of the same sample during a single run of samples and by analyzing the same sample on multiple runs, followed by determining the mean and the standard deviation. These terms are referred to as within-run and between-run precision.

Postanalytical Considerations Interpretation of FMR1 sizing analysis depends on the clinical considerations for ordering the test. These may be (i) diagnosis, (ii) screening, (iii) predictive within a family with affected members, or (iv) risk assessment. For example, a diagnostic application would include determining whether an individual with the characteristic phenotype has FRS, and depends on the sex of the patient. A male, having a single X chromosome, should have a single band following PCR amplification, with a normal number of CGG repeats (5–44 repeats). One of the limitations of the PCR procedure is the size of the CGG repeat region. Depending on the PCR primers and amplification conditions, the maximum number of CGG repeats that can be amplified is 100 repeats. Thus, a fully amplified CGG region of >200 repeats would not produce a discernable PCR product. However, a female, with two X chromosomes, with a full expansion would still have an unaffected X chromosome, resulting in a single band following PCR amplification, representing the normal-sized allele. Another limitation with females is that both alleles may be the same size, resulting in a single band following amplification. For females, any analysis which yields a single band following PCR, and with the absence of a band in a male, Southern blot analysis would be necessary, as this analysis is not limited by 594

the constraints of PCR amplification. Thus, Southern blot analysis should detect fully expanded alleles. Screening applications may involve newborn screening in the future. However, methodological constraints are considerable at this time. If an affected family member has been identified, carrier determination can be performed, exemplifying a predictive use of this testing. However, another level of complexity involves risk assessment of female premutation carriers. These individuals have between 55 and 200 repeats, not large enough for full mutations, but sufficient for the associated conditions mentioned previously (premature ovarian failure, FXTAS, and others), in addition to increased risk of passing on a fully expanded allele to offspring (the risk is proportional to the number of CGG repeats). Note that individual alleles between 45 and 54 repeats are considered intermediate and may carry an increased risk for being permutation carriers, but not for passing on full mutations. No data exist on the risk of these individuals for ovarian dysfunction or FXTAS. Obviously, knowing the precision and accuracy of the assay is paramount in interpreting the number of CGG repeats.

Benefit/Risk Assessment (Clinical Utility) Since defining clinical utility takes considerable clinical experience with newer assays, it is difficult, if not impossible, to assess clinical utility before setting up an LDT, as advocated by some of the regulatory agencies. For example, FMR1 sizing assays demonstrate the evolving nature of clinical utility. When Southern blot analysis was the only molecular method available, the clinical utility was based on the contribution of

Chapter 28

Molecular Diagnosis of Human Disease

Figure 28.2 Southern blot analysis for the diagnosis of fragile X syndrome. Patient DNA is simultaneously digested with restriction endonucleases EcoR1 and Eag1, blotted to a nylon membrane, and hybridized with a 32P-labeled probe adjacent to exon 1 of FMR1 (see Figure 28.1). Eag1 is a methylation-sensitive restriction endonuclease that will not cleave the recognition sequence if the cytosine in the sequence is methylated. Normal male control DNA with a CGG-repeat number of 22 on his single X chromosome (lane 1) generates a band about 2.8 kb in length corresponding to Eag1-EcoR1 fragments (see Figure 28.1). Normal female control DNA with a CGG-repeat number of 20 on one X chromosome and a CGG-repeat number of 25 on her second X chromosome (lane 5) generates two bands, one at about 2.8 kb and a second at 5.2 kb. EcoR1-EcoR1 fragments approximately 5.2 kb in length represent methylated DNA sequences characteristic of the lyonized chromosome in each cell that is not digested with restriction endonuclease Eag1. DNA in lane 2 contains an FMR1 CGG-repeat number of 90 and is characteristic of a normal transmitting male. The banding pattern observed in lane 3 is representative of a mosaic male with a single X chromosome with a full mutation (>200 repeats). However, the full mutation in some cells is unmethylated; in other cells, the full mutation is fully methylated, hence the term mosaic. In those cells in which the full mutation is unmethylated, digestion by both Eag1 and EcoR1 occurs, and in those cells in which the full mutation is fully methylated, digestion of the DNA by Eag1 is inhibited. The banding pattern observed in lane 4 is diagnostic of a male with fragile X syndrome, illustrating the typical expanded allele fully methylated in all cells. Lane 6 is characteristic of a female with a normal allele and a CGG-repeat number of 29 and a larger gray zone allele with a CGG-repeat number of 54. Lane 7 is the banding pattern observed from a premutation carrier female with one normal allele having a CGG-repeat number of 23 (band at about 2.8 kb) and a second premutation allele with CGG repeats of 120 to about 200 (band at about 3.1 kb). In premutation carrier females, in cells in which the X chromosome with the premutation allele is lyonized, the normal 5.2 kb EcoR1-EcoR1 band is larger because of the increased CGG-repeat number and is about 5.5 kb in length. Lane 8 is diagnostic of a female with fragile X syndrome with one full expansion mutation allele that is completely methylated and transcriptionally silenced on one X chromosome but with a second normal allele with a CGG-repeat number of 33.

the FMR1 assay to the diagnosis of FRS. However, by this method, limited information was available for assessing the premutation carrier status. With the development of FMR1 sizing assays, more accurate assessment of the permutation allele could be made, and the clinical utility for ovarian dysfunction and FXTAS could be assessed. Thus, improvements in methodology can affect the clinical utility of an analyte.

Infectious Diseases Enteroviral Disease Enteroviruses (EV) are a general category of singlestranded, positive-sense, RNA viruses of the Picornaviridae family, which includes the subgroups enteroviruses, polioviruses, coxsackieviruses (A and B), and echoviruses [1,2]. Rhinoviruses are closely related members of the Picornaviridae family that are a major cause of the common cold. Most EV infections are asymptomatic. Symptomatic EV infections affect many different organ systems. Diseases of the central nervous system

include poliomyelitis, aseptic meningitis, and encephalitis. Diseases of the respiratory system include the common cold, herpangina, pharyngitis, tonsillitis, and pleurodynia. Diseases of the cardiovascular system include myocarditis and pericarditis. EV infections also cause febrile exanthems, conjunctivitis, gastroenteritis, and a sepsis-like syndrome in neonates. EV infections peak during the first month of life and cause the majority of aseptic meningitis worldwide [3,4]. Until recently, a diagnosis of EV infection was based on clinical presentation and the isolation of virus in cell culture from throat, stool, blood, or cerebrospinal fluid (CSF) specimens. EV detection by culture methods is insensitive and takes too long to be useful in clinical management decisions. By contrast, reverse transcriptionPCR (RT-PCR) is more rapid and sensitive and has been used to detect EV RNA in CSF, throat swabs, serum, stool, and muscle biopsies [5]. EV RNA detection by molecular methods is now considered the gold standard for the diagnosis of enteroviral meningitis. At the time of validation, several ASRs were available for the detection of enteroviral RNA from CSF specimens. 595

Part V


Validation of LightCycler-Based, RT-PCR Assay for Enterovirus We developed a real-time PCR assay using the LightCycler platform (LC-PCR) [6] because our molecular diagnostics laboratory has extensive experience with this technology. In addition, others had demonstrated the utility of this approach [7]. For rapid detection of EV RNA in CSF specimens, we established a qualitative semi-nested LC-PCR method based on EV RNA isolation and cDNA synthesis followed by PCR amplification with primers that target the highly conserved 50 noncoding region (50 -NCR) [9]. To improve sensitivity and specificity, we used a second round of semi-nested PCRs. The semi-nested PCR uses two different viral subgroup-specific forward primers (one for polioviruses and one for coxsackieviruses), and a common reverse primer that generates 85 bp to 87 bp amplicons depending on the viral subgroup. The amplicons bind the EV-TaqMan probe which allows for real-time fluorometric detection and excludes cross-hybridization with rhinoviral sequences. Viral RNA is isolated from infected CSF using either the MagNA Pure total Nucleic Acids Extraction Kit (Roche Diagnostics, Indianapolis, Indiana) or the High Pure Viral RNA Kit (Roche Diagnostics). The extracted nucleic acids are subjected to RT-PCR in the LightCycler using the LC RNA Master Hybridization Probes Kit (Roche Diagnostics). Amplicons are diluted with sterile water, and subsequent semi-nested PCR is carried out in the LightCycler with the EV-TaqMan probe using the LC Fast Start DNA Master Hybridization Probes Kit (Roche Diagnostics). QC materials include external positive and negative controls and a no template control (water blank). An appropriate internal positive control was not available at the time of assay development. Therefore, a technical failure cannot be ruled out when a patient sample is negative. The crossing-thresholds for known positive samples were determined during the validation set by a limiting dilution approach using negative CSF samples spiked with known amounts of cell culture grown EVs. A minimum cycle threshold (Ct) of 30 cycles was established. Limits of detection for several EVs were determined and compared to results from a reference lab for the same specimen control. In the validation set, the sensitivity of the MagNA Pure RNA extraction was compared to the High Pure Column RNA extraction method. The number and type of controls need to be re-evaluated periodically after the implementation of a new assay. For example, the development of a molecular EV assay that uses internal positive controls to confirm negative results for patient samples is needed and once this is available it should be integrated into the assay.

Preanalytical Considerations A semi-nested RT-PCR method is especially susceptible to contamination by nucleases or unrelated nucleic acids, which cause false negative or false positive results, respectively. Laboratory organization and 596

equipment should be designed to avoid contamination, and specimens should be handled with gloves in a biosafety cabinet to prevent contamination with fingertip RNases and biohazard exposures, as described [8]. The quality of viral RNA in CSF depends on what happens to the specimen before RNA sample extraction occurs. Therefore, only 0.5 mL or greater volumes of CSF specimens collected in the appropriate sterile plastic containers are accepted. The EV virion is very stable and protects the viral RNA from degradation. Sample stabilization is not required as long as specimens are dispatched to the laboratory within hours of acquisition. If there will be a delay in specimen dispatch, then the specimen should be refrigerated or placed on ice. If the delay will be more than 24 hours, then the specimen should be stored frozen and kept frozen until RNA extraction. Neonatal serum or plasma specimens for suspected EV sepsis require approval of the laboratory director and may be acceptable if handled properly. Plasma should be collected in K2EDTA or ACD tubes [9]. Heparin should be avoided, since it inhibits RT and PCR reactions, as described in [10]. Heparin inhibition of RT-PCR reactions can be reversed using lithium chloride if necessary [11]. The suitability of this approach was validated during assay development. Samples that have been frozen before dispatch and arrive in the state of thawing out should be rejected.

Postanalytical Considerations Fluoresence signal detected above background before the 30th cycle of the semi-nested EV LC-PCR is diagnostic of EV infection. Ct values that are equal to or greater than 30 cycles are negative. In a patient with the clinical signs and symptoms of viral meningitis, a positive result is consistent with a diagnosis of EV meningitis. Interpretation of a negative result is more difficult due to the absence of an internal positive control for the RT-PCR. A negative result could indicate a technical failure with the RT or PCR steps in the method. Alternatively, the sample may not contain EV RNA. Thus, a negative result does not exclude EV infection and needs to be communicated in the report to the ordering physician. In addition the pediatricians who will be ordering this test most often need to be made aware of the meaning of a negative result. Finally, because EV is a reportable disease to the state health department, a positive result must be called to the physician and reported to hospital epidemiology.

Benefit/Risk Assessment (Clinical Utility) The distinction between EV and bacterial infections in neonates can be difficult, and patients are usually treated empirically with antibiotics until an EV infection is confirmed, at which point supportive care is the treatment choice. Therefore, a rapid molecular method for detecting EV RNA has clinical utility if available daily. Several studies have suggested that the use of molecular EV testing in the pediatric patient population can lead to cost savings by reducing the length of hospital

Chapter 28

stay, reducing antibiotic use, and reducing imaging studies [12]. A positive molecular EV test helps to exclude bacterial or other etiologies that may require longer hospitalization for treatment. A negative EV test is not very useful clinically because it does not rule out EV meningitis.

Hepatitis C Viral Genotype Approximately 4 million people in the United States are chronically infected with HCV, and many are unaware that they are infected. Recent studies estimate that, in the United States, 30,000 individuals per year are newly infected with HCV, and approximately 10,000 people will die annually from the sequelae of hepatitis C. HCV is also the most frequent indication for liver transplant in adults in the United States. Since the outcome of HCV infection depends on both the viral load and HCV genotype, the determination of HCV genotype provides important clinical information regarding the duration and type of antiviral therapy used for a given HCV-infected patient [13]. In addition, the genotype is an independent predictor of the likelihood of sustained HCV clearance after therapy [14]. There are more than 11 genotypes and more than 50 subtypes of HCV. In the United States, genotypes 1a, 1b, 2a/c, 2b, and 3a are most common. Genotypes 4, 5, 6, and 7 are endemic to Egypt, South Africa, China, and Thailand, respectively, and are rarely found in the United States. Since patients infected with HCV genotype 1 may benefit from a longer course of therapy, and genotypes 2 and 3 are more likely to respond to combination interferonribavirin therapy, the clinically relevant distinction among the affected population of the United States


is between genotype 1 and nontype 1. Not enough data currently exists to determine the likelihood of therapeutic response for HCV genotypes 4, 5, 6, and 7. Therefore, it has been recommended that infections with genotypes 4, 5, 6, or 7 be treated similar to patients infected with HCV type 1. In addition to viral load, HCV genotype is important clinically. Line-probe and sequencing-based methods are available for HCV genotyping, but are expensive, time consuming, and provide more information than is currently needed by clinicians for patient management decisions. With this in mind, we developed a rapid HCV genotyping assay for the LightCycler to differentiate HCV type 1 from nontype 1 infections.

Validation of HCV Genotyping The determination of HCV genotype is based on isolation of HCV viral RNA and cDNA synthesis followed by PCR amplification of the 50 untranslated region (50 UTR). Viral RNA is isolated from infected serum after HCV viral load determination using the MagNA Pure Total Nucleic Acids Extraction Kit or the Qiagen EZ1 BioRobot. The extracted nucleic acids are subjected to RT-PCR using primers specific for 50 UTR sequence that is conserved among all known HCV genotypes. The RT-PCR step is performed using an Applied Biosystems GeneAmp 9600 PCR System (block cycler). A second PCR amplification using a seminested pair of primers is carried out in the LightCycler in the presence of a pair of FRET oligonucleotide probes. The FRET detection probe allows the discrimination of HCV genotypes 1a/b, 2a/c, 2b, 3a, and 4 during melting curve analysis (Figure 28.3), because it hybridizes with differential affinity to a region of

Figure 28.3 HCV genotyping assay. Comparison of samples from patients infected with HCV genotypes 1b, 2a/c, 2b, and 3a. Shown are genotype-specific melting transitions for four samples in 2 mM MgCl2. Data were obtained by monitoring the fluorescence of the LCRed640-labeled FRET sensor probe during heating from 40 to 80 C at a temperature transition rate of 0.1 C/s. 597

Part V


the 50 UTR that varies among the different HCV genotypes. Magnesium concentration was critical for optimal genotype discrimination. Primer and probe design and PCR details have been described [15]. For method validation, patient samples analyzed by an independent reference laboratory were used. Positive QC materials were pooled patient serum samples of previously determined genotype (genotypes 1, 2a/c, 2b, and 3a). Negative QC material was pooled patient serum samples previously determined to be HCV negative. A water blank is also always included with each run. A serial limiting dilution of positive patient samples with known viral titers was used to determine the limits of detection. The semi-nested method described will fail when viral titers are less than 12,600 IU per mL. A more sensitive fully nested PCR method was developed and is able to genotype specimens with 130 IU per mL. The fully nested PCR method uses the freshly extracted RNA and the same RT and first PCR steps used for the semi-nested approach. The second PCR step uses a new set of nested primers and is done in the block cycler. The products of this reaction are subjected to melting curve analysis in the LightCycler to determine genotype using the same set of FRET probes described for the semi-nested genotyping method. The fully nested approach is rarely needed because patients usually have high viral loads upon initial presentation, and this is the ideal time to assess the HCV genotype.

Statistical Analysis In addition to determination of the accuracy of the genotyping assay, melting point precision was determined within run and between runs using QC materials. An analysis of assay performance after 18 months showed no assay failures for 70 runs with 411 patient samples using 3 different LightCyclers operated by 6 different technicians. The genotype-specific melting temperatures remained nonoverlapping with coefficients of variation that were less than 1% for all genotypes [16]. Melting temperatures are continuously monitored to assure assay performance.

Preanalytical Considerations The semi-nested or a nested RT-PCR method is especially susceptible to contamination by RNases, previously amplified DNA, or unrelated nucleic acids. Unidirectional flow of samples through physically separated preamplification and postamplification areas should be maintained to prevent contamination of reagents or specimens with amplified DNA. Equipment, reagents, plasticware, and specimens should be handled with gloves to prevent contamination with fingertip RNases or cross-contamination of specimens. The use of plastic microfuge tube cap openers instead of gloved fingertips is recommended to prevent cross-contamination. Samples should be added one at a time, first followed by positive QC, negative QC, and finally the water blank. The only known 598

interference to this procedure is heparin, which may inhibit the RT-PCR reaction. Evaluation of isolation of nucleic acid by the MagNA Pure system has shown that heparin is removed during the isolation of nucleic acid by this method. A minimum of 500 microliters of serum is the required sample type for this method. Whole blood samples should be centrifuged, and serum should be separated within 6 hours of collection. HCV is an enveloped RNA virus and is labile to repeated freeze-thaw cycles. Viral titers will drop upon storage at –20 C. Therefore, fresh samples are preferred. Since aqueous solutions of RNA are unstable and susceptible to spontaneous hydrolysis even at –20 C, it is best to perform the RT-PCR step on the same day as RNA extraction. MagNA Pureextracted nucleic acid samples should be stored at –80 C if the RT-PCR step cannot be performed on the day of isolation.

Postanalytical Considerations Interpretation of HCV genotype is reported as type 1, type 2, type 3, type 4, or none detected if negative. Both early viral load measurements and viral genotype are used to determine likelihood of clinical response and influence management decisions during combination antiviral therapy. Therefore, these tests should be ordered together during the initial workup of a patient with viral hepatitis. Reflexive genotyping of patients who are positive for HCV with sufficiently high viral loads and no prior genotype should be considered. Once the genotype is determined, there is no need for additional genotyping unless there is clinical suspicion of a second infection with a different HCV genotype. The HCV LC-PCR assay is able to detect two genotypes in one patient sample. One limitation with this assay is the inability to detect some rare genotypes that may occur in the United States, such as genotypes 5 or 6. Thus, the detection of a novel melting temperature could indicate an infection with a non-1, -2, -3, or -4 HCV genotype. This specimen would be sent out for sequencing by a reference laboratory. Similarly a specimen with a high viral load but no detectable genotype indicates a technical failure or a novel genotype and would also be sent to a reference laboratory for sequencing.

Benefit/Risk Assessment (Clinical Utility) HCV genotyping assays are an essential component of an evolving clinical decision tree used to determine the duration of therapy and the likelihood of sustained virological response (SVR) to this therapy. Absolute viral load, log decline in viral load from baseline, and viral genotype are clinically useful in predicting SVR and nonsustained virological response (NSVR) to treatment [17]. The NIH Consensus Development Conference Statement, Management of Hepatitis C:2002, stresses the importance of early prediction of SVR and NSVR in patient management in the first 12 weeks of therapy [18]. Combination interferon plus ribavirin therapy is given for 24 or 48 weeks, depending on viral

Chapter 28

genotype and viral load. The therapy is expensive and difficult for patients to tolerate due to side effects. HCV genotype and viral loads are used to predict the likelihood of SVR or NSVR. The likelihood of SVR and NSVR is useful for clinicians and patients when making decisions about the duration of therapy. Nontype 1 genotypes have a much greater rate of SVR than genotype 1 infected patients. HCV type 1 with a high viral load requires a longer course of therapy than nontype 1 infections. HCV genotype determination is clinically useful in risk assessment and making therapeutic decisions instead of making a diagnosis.

Oncology B-Cell and T-Cell Clonality B-cell and T-cell clonality assays are based on the detection of a predominant antigen receptor gene rearrangement that represents the outgrowth of a predominant lymphocyte clone. In the correct clinical and pathologic context, the presence of a predominant clonal lymphocyte population is consistent with lymphoma or lymphoid leukemia. Southern blots were traditionally the method used to detect a predominant antigen receptor gene rearrangement. Multiplex PCRbased B-cell and T-cell clonality assays are replacing Southern-blot-based assays because they are robust, faster to perform, and easier to interpret. Unlike Southern blots, PCR-based assays are amenable to formalin-fixed, paraffin-embedded (FFPE) tissues. PCRbased assays amplify the DNA between primers that target the conserved framework (FR) and joining (J) sequence regions within the lymphoid antigen receptor genes. These conserved regions flank the V-J gene segments that randomly rearrange during the maturation of B-lymphocytes and T-lymphocytes. Random genetic rearrangement of the V-J segments occurs in the immunoglobulin heavy chain gene (IGH) and the kappa and lambda immunoglobulin light chain genes in prefollicular center B-cells. Random genetic rearrangement of the V-J segments also occurs in the alpha (TCRA), beta (TCRB), gamma (TCRG), and delta (TCRD) T-cell receptor genes during thymic T-cell development. Antigen receptor gene rearrangement occurs in a sequential fashion one allele at a time. If the first allele fails to successfully recombine (produces a nonfunctional protein product), then the other allele will undergo rearrangement. It is important to remember that the nonfunctional rearrangement can still be detected by the clonality assay. Because of the sequential manner in which these genes rearrange, a mature lymphocyte may carry one (mono-allelic clone) or two (bi-allelic clone) rearranged antigen receptor genes of a given type. Each maturing B-cell or T-cell has either one or two gene-specific V-J rearrangements unique in both sequence and length. Therefore, when the V-J region is amplified, one or two unique amplicons will be produced per cell. If the population of lymphocytes being examined is a lymphoma, then one or two unique amplicons will dominate the population. In contrast, if the population is a


normal polyclonal lymphoid infiltrate, then there will be a Gaussian distribution of many different sized amplicons centered around a statistically favored, averagesized rearrangement (Figure 28.4). Because the antigen receptors are polymorphic and subject to mutagenesis as part of the normal rearrangement process, multiple primer sets are used to increase the ability of the assay to detect the majority of possible V-J rearrangements. Each set of multiplex primers has a defined valid amplicon size range. After antigen exposure, germinal center B-cells undergo somatic hypermutation of the V regions, and this may affect the binding of the V-region specific (FR) primers and prevent the detection of lymphoma clones arising from the germinal center or postgerminal center B-cell compartments. Primer sets that target IGH D-J rearrangements are less susceptible to somatic hypermutation and allow the detection of more terminally differentiated B-cell malignancies.

Validation of B-Cell and T-Cell Clonality Assays PCR-based clonality assays are routinely used by many laboratories. However, prior to 2004, referral lab PCRbased clonality assays used nonstandardized, lab-specific PCR primer sets and methods, making proficiency testing and lab performance comparisons difficult. In addition, many of these institution-specific B-cell and T-cell clonality assays are not comprehensive and target a limited number of possible V-J rearrangements. To address this concern, we used the optimized InVivoScribe (IVS) multiplex PCR primer master mixes. The IVS master mixes have been standardized and extensively validated by testing more than 400 clinical samples using the WHO Classification scheme. The validation was done at more than 30 prominent independent testing centers throughout Europe in a collaborative study known as the BIOMED-2 Concerted Action [19]. The TCRG locus is on chromosome 7 (7q14) and includes 14 V gene segments divided into 4 subgroups. Six of the 14 V segments are functional, 3 are open reading frames, and 5 are pseudogenes. The 200 kilobase pair TCRG region also contains 5 J segments and 2 C genes. Although most mature T-cells express the alpha/beta TCR, the gamma/delta TCR genes rearrange first and are carried by almost all alpha/beta T-cells. The IVS TCRG assay uses only 2 master mixes and is able to detect 89% of all T-cell lymphomas tested in the BIOMED-2 Concerted Action. Mastermix tube A targets the V gamma 1–8 þ 10 and most J gamma gene segments. Mastermix tube B targets V gamma 9 þ 11 and most J gamma segments. The included positive and negative kit controls are used to assess each of the master mixes. The specimen control size standard is a separate master mix included with the kit that evaluates each patient DNA sample by targeting six different housekeeping genes potentially producing amplicons of 84, 96, 200, 300, 400, and 600 base pairs. Under ideal conditions and using capillary electrophoresis to analyze the amplicons, the TCRG assay can resolve a 1% clonal population in a polyclonal background. 599

Part V


60

90

120

150

180

210

240

G1

B1

G2

B2

270

300

330

360

390

420

4500 4000 3500 3000 2500 2000 1500 1000 500

A 0 60

80

100 120 140 160 180 200 220 240 260 280 300 320 340 360 380 400

7000 6000 5000 4000 3000 2000 1000 0

B

Dye/Sample Peak G, 1

Minutes 16.02

Size 170.59

Peak Height

Peak Area

8065

66810

Data Point 4369

Figure 28.4 T-cell receptor gamma chain PCR assay for clonality. (A) polyclonal reactive T-cell proliferation pattern. A polyclonal population of T-cells with randomly rearranged T-cell receptor gamma chain genes produces a normal or Gaussian distribution of fluorescently labeled PCR products from each primer pair in the multiplex reaction. This produces 4 “bell-shaped curves” that represent the valid size range for an individual primer pair. Two of the valid size ranges are green and two are blue; G1, B1, G2, B2. The red peaks represent size standards. (B) clonal T-cell proliferation pattern. A clonal T-cell proliferation results in a relative dominance of a single T-cell receptor gamma chain gene producing a predominant spike of a discrete size on the corresponding electropherogram. Data were obtained using an ABI 3100 capillary electrophoresis system and ABI Prism Software.

The IGH locus is on chromosome 14 (14q32.3) and includes more than 66 V, 27 D, and 6 J gene segments. The IVS IGH assay uses 5 master mixes and is able to detect 92% of all B-cell lymphomas tested in the BIOMED-2 Concerted Action validation study. Master mixes A, B, and C target the framework (FR) 1, 2, and 3 regions of the V gene segments, respectively, and all J gene segments. Master mixes D and E target the D and J regions. The IGH locus rearranges the D and J segments first during maturation, followed by the addition of a random V segment to the previously rearranged D-J fusion product. In addition, the D segments are less likely to be mutated by somatic mutation during postgerminal center development. 600

Because the primers in tubes D and E target D-J regions, these tubes are more likely to detect clonal IGH rearrangements in lymphoma cells that arose either very early or late in B-cell ontogeny. Positive, negative, and specimen extraction controls are included and run on each master mix and specimen, respectively. The specimen control size standard is used to assess the integrity of the DNA extracted from the specimen and is identical to the specimen control size standard described previously for the TCRG kit. The specimen control master mix is useful in determining the amount of DNA target molecule degradation that has occurred during fixation and DNA extraction. Capillary electrophoresis (CE) using the

Chapter 28

ABI 3100 Avant Genetic Analyzer was better at determining the size of predominant amplicons than both agarose and polyacrylamide gel systems during method development. Under ideal conditions and using CE to analyze the amplicons, the IGH assay can resolve a 1% clonal population in a polyclonal background. Genomic DNA is isolated from whole blood, body fluids, fresh tissues, and formalin-fixed paraffinembedded tissue blocks, using the appropriate Qiagen DNA isolation protocol. A slightly modified Qiagen DNA isolation protocol for FFPE samples was selected after a comparison to three other DNA isolation protocols during validation. After DNA isolation, multiple dilutions are tested for beta-globin amplification by PCR to assess DNA quality prior to analysis using the IVS system. Samples that fail to amplify beta-globin at any concentration are quantified by UV spectrophotometry. Approximately 100 to 200 ng of input DNA are ideal for TCRG or IGH PCR reactions. Samples that are undetectable by UV spectrophotometry and fail beta-globin PCR should be reported as quantity insufficient and retested by increasing the amount of starting material by 2- to 3-fold if possible. Samples that fail beta-globin PCR but contain sufficient quantities of DNA are most likely nonamplifiable due to inhibitors and should be reported as nonamplifiable due to PCR inhibitors in the sample. Additional dilutions could be retested by beta-globin PCR if desired. The least dilute DNA that gives a strong beta-globin signal should be used for the InVivoScribe B-cell or T-cell clonality assay. Each of the products of the IVS PCR is combined with 0.5 mL ROX400HD size standards, denatured at 95 C in formamide and electrophoresed through a capillary that contains the POP4 matrix. The amplified fragments are detected by the 6FAM, HEX, or NED fluorescent labels on the conserved, downstream IGH or TCRG J-region PCR primers. The size standards are detected by the ROX label. After assay validity is confirmed by checking all controls, the results are analyzed and a report is generated. After the method was established, a variety of clinically and histopathologically diagnostic cases of B-cell and T-cell lymphomas were used to evaluate the performance of the method. This laboratory modified method was able to detect 92% of B-cell lymphomas and 85% of T-cell lymphomas used in the validation set. An ideal QC control material is not available for this assay. The ideal QC material would consist of a high and low positive FFPE QC and a negative FFPE QC. FFPE QC material would control for the DNA extraction in addition to the PCR and interpretation phases of this method. The currently available QC and PT control materials do not assess the DNA extraction phase of this test.

Preanalytical Considerations Special considerations regarding specimen type and handling are important for this method. One of the most common specimens submitted for IGH or TCRG gene rearrangements is FFPE tissue blocks. PCR


inhibitors are commonly found with this specimen type. Xylene, heme, and excessive divalent cation chelators are also inhibitory and need to be removed during DNA extraction procedures. The fixative used prior to paraffin embedment is critical for optimum results because formalin of inferior quality can introduce PCR inhibitors or prevent the extraction of amplifiable DNA. Fresh, high-quality, 10% neutralbuffered formalin is acceptable, and this should be communicated to the pathologists who will be submitting specimens for gene rearrangement studies. Fixatives that contain heavy metals such as Hg (Zenkers and B5) should not be used for PCR. Decalcified bone marrow biopsy specimens are unacceptable as are specimens that were fixed with strong acid-based fixatives like Bouin’s solution. Tissues should be fixed at room temperature using proper histologic standards. Fixation depends on formaldehyde-mediated cross-linking of proteins and nucleic acids. Excessive cross-linking will inhibit DNA extraction and shorten the average size of the recovered DNA molecules; therefore, overfixation should be avoided. Fixation using the approved fixatives at room temperature progresses at a rate of approximately 1 mm/hour. Typical 0.5 mm thick tissue sections should fix for a minimum of 6 hours and a maximum of 48 hours. After 48 hours in fixative, tissues can be stored in 50% ethanol for up to 2 weeks prior to processing and embedding. The volume of fixative used should be at least 10 times the volume of tissue to achieve optimal results. Some laboratories use razor blades to gouge tissue out of the block, but this destroys the block and prevents any additional studies that may be necessary in the future. The best way to obtain FFPE samples for PCR is to cut 4 micron thick sections on the microtome. Histotechnologists should cut the sections for PCR first thing in the morning with a fresh microtome blade and new water. Several initial sections are discarded to remove any possible contaminating DNA on the surface of the block. One to five sections are obtained, depending on the size and type of tissue sample and the relative proportion of the tissue that is involved by the suspicious lymphoid infiltrate. PCR of lymphoid infiltrates in FFPE skin or brain tissue blocks are somewhat refractory to PCR analysis and require more sections for analysis. Skin tissues are more likely to be overfixed and yield more fragmented DNA. Brain tissues could be problematic due to the higher lipid content than most tissues submitted for lymphocyte gene rearrangement studies. To snap freeze fresh tissues, one should cut them into 1 mm3 to 3 mm3 pieces, place them into an appropriately labeled cryovial, snap freeze them in liquid nitrogen, and then store them frozen at –70 C until processed. Specimens snap frozen at a different location should be shipped on dry ice to arrive during normal business hours and be stored at –70 C until processed. Whole blood specimens should be at least 200 mL EDTA or citrated blood, stored at 4 C for up to 3 days before DNA extraction. Bone marrow aspirates should be at least 200 mL EDTA or citrated bone marrow, stored at 4 C for up to 3 days before DNA extraction. 601

Part V


CSF specimens should be at least 200 mL depending on cellularity. All CSF samples should be collected in an appropriate sterile container and stored at 4 C for up to 24 hours or at –20 C for long-term storage. Other sample types, such as stained or unstained tissue on slides, may be accepted with the approval of the laboratory director. Extracted DNA samples should be stored at –20 C for a minimum of 2 months after analysis is complete.

Postanalytical Considerations The results of this test must be interpreted in the context of the other clinicopathologic data for the specimen. The detection of a clonal lymphoid proliferation in a tissue sample does not necessarily indicate a diagnosis of lymphoma or leukemia. On the other hand, the failure to detect a clonal lymphoid proliferation does not necessarily rule out a lymphoma/leukemia. The test is one puzzle piece that must be integrated with other clinicopathologic data before rendering a diagnosis. The molecular B-cell and T-cell clonality assay is an adjunct ordered by pathologists for cases that are suspicious but not obviously lymphoma/leukemia, and the results of this test do not stand alone. Although helpful guidelines for the interpretation of results are provided by the manufacturer, this assay is not an out-of-the-box assay. After method development, an important part of validation is the development of interpretive guidelines that are appropriate for the established method, specimen types, and the patient population. An important consideration is how the results will be interpreted by the ordering group of pathologists and oncologists. Specimen handling, DNA extraction procedures, and fragment analysis procedures will affect the final results from this assay, and this will affect the ability to detect a clonal proliferation in a polyclonal background. Our laboratory has established a set of interpretive guidelines that include a required minimum peak height for positive peaks and positive peak to background peak ratio values that are appropriate for our method and reduce the number of false positives. The details of our interpretive guidelines are beyond the scope of this chapter and are described in [20–22]. Results are interpreted and reported to the ordering pathologist in an interpretive report (CoPath) format. The results are interpreted as (i) Positive for a clonal lymphoid proliferation; (ii) Suspicious but not diagnostic for a clonal lymphoid proliferation (with a recommendation to repeat the assay if clinical concerns persist); (iii) Oligoclonal reactive pattern (commonly seen in the peripheral blood of elderly patients with rheumatologic disease or viral infections); (iv) Polyclonal lymphoid population; (v) Insufficient material/Inadequate quality. The reports also contain information on the pertinent clinical and laboratory history, the specimen submitted for PCR, and the relevant surgical pathology case if appropriate. Suspicious results are usually repeated for confirmation, especially TCRG studies.

602

Benefit/Risk Assessment (Clinical Utility) In many cases of atypical lymphoid proliferations suspicious for lymphoma, the morphologic, immunohistochemical, flow cytometric, or clinical features are equivocal or contradictory. Detection of a predominant antigen receptor gene rearrangement (detection of a T-cell or B-cell clone) can support a diagnosis of lymphoma. Early diagnosis and appropriate treatment of lymphoma can prolong patient survival and in many cases result in a complete remission or cure. Because the morphology of many lymphomas is indistinguishable from benign lymphoid hyperplasia, ancillary tests that demonstrate an atypical clonal lymphocyte proliferation are essential in early diagnosis and subsequent treatment of many lymphoma cases. Multiplex PCR assays for clonality have become the standard of practice in lymphoma diagnosis and may eventually be used on all cases of atypical lymphoid proliferations to either rule in or rule out lymphoma earlier. For those cases that are obviously lymphoma, molecular characterization of the specific lymphoma cell clone may also prove useful in patient follow-up after treatment to screen for residual or recurrent disease. In addition many of the morphologic subtypes of lymphoma have not been extensively characterized from the molecular diagnostics standpoint. For example, for biopsy cases that are suspicious but not diagnostic for lymphoma, detection of a clonal B-cell or T-cell population predicts lymphoma behavior or patient outcome. The diagnostic tools that allow these types of correlative studies have only recently become available, and this assay represents one of the assays that will allow these kinds of questions to be considered. In the future, B-cell and T-cell clonality assays will become a standard part of a lymphoma workup and may alter clinical outcomes by providing a more comprehensive earlier diagnosis of lymphoma and preventing unnecessary treatment of nonlymphomas. Another important consideration is the improved performance and diagnostic utility of the newer generation of multiplex PCR assays since 2004. Many descriptions on the utility of PCR-based clonality assays refer to multiplex PCR assays that cannot detect all possible IGH or TCRG gene rearrangements because of suboptimal primer sets. This can increase the number of false negatives because the PCR primers that could recognize the clonal gene rearrangement are missing. In addition, oligoclonal reactive proliferations may appear to be clonal because a limiting number of primers may not detect all of the members of the oligoclonal proliferation. To address this issue, we have initiated an investigation of the diagnostic utility of the IVS assay at our institution over the past 4 years [23].

FUTURE APPLICATIONS Beyond the predictable advancements in technology, several new areas of molecular applications have appeared in the past year which are indicative of increased emphasis on molecular techniques in clinical medicine: (i) array-based comparative genomic hybridization (aCGH),

Chapter 28

(ii) gene expression profiling, and (iii) quantitative reverse-transciptase PCR (qRT-PCR). Additional applications that deserve mention include (a) tissue-based pharmacogenomics, (b) detection of fetal DNA markers in maternal serum, and (c) personalized medicine. All of these developments are dependent on the appropriate balance between regulatory control and reimbursement issues, without falling victim to regulatory stagnation.

Array-Based Comparative Genomic Hybridization Molecular cytogenetics has evolved since fluoresence in situ hybridization (FISH) became a routine clinical procedure. Recently, a research technique, called comparative genomic hybridization (CGH), has been modified using microarray technology to create array-based CGH. Without extensive details, a CGH scans the entire genome for imbalances, including duplications, deletions, and copy-number variants, creating another molecular cytogenetic tool. Traditional karyotypic studies, limited by the resolution of all microscopic procedures, are complemented and sometimes replaced by microarrays which increase resolution by 1000-fold or greater. The impact of this technology on both constitutional and tissue cytogenetics cannot be overestimated.

Gene Expression Profiling RNA expression can be assessed in tissue by an arraybased technique. While the information can be overwhelming, sophisticated software has been applied to arrays that assess 25,000 genes. For example, breast cancer samples have been profiled and reveal specific gene expression profiles that correlate with prognosis and/or response to specific therapies. Once these specific genes are identified, unique quantitative reversetranscriptase PCR assays replace the expression arrays and provide useful quantitative data which similarly predict disease progression and therapeutic responses at a significantly reduced cost. Currently, gene expression studies are performed by commercial or clinical research laboratories.

Tissue-Based Pharmacogenomics Pharmacogenomics refers to using specific genomic data to predict response to therapeutic drugs. When applied to tissue, particularly malignant tissue, similar predictions can be made. For example, inactivating members of the epidermal growth factor receptor (EGFR) family is a new approach to treating epithelial malignancies. One example involves the Her-2 oncogene and response to Herceptin, a monoclonal antibody directed against Her-2 and used to treat breast cancer patients. Patients with amplified Her-2 were found to respond more favorably to Herceptin than patients without amplification. Another example involves Erbitux, a monoclonal antibody to EGFR used


to treat gastrointestinal adenocarcinomas. In this case, mutations in the kRAS oncogene predict a less favorable response, particularly in patients with colorectal adenocarcinoma. Molecular tests can be used to evaluate these oncogenes and predict therapeutic outcomes.

Fetal DNA in Maternal Serum Prenatal diagnosis conventionally involves obtaining fetal cells by either amniocentesis or chorionic villus sampling. These invasive techniques are associated with some risk to the developing fetus and discomfort to the mother. Through examination of maternal serum, fetal DNA can be detected that provides similar information, without the fetal risk or maternal discomfort. Analytical procedures have been reported for detection of trisomy 21 (Down syndrome), trisomy 18, and trisomy 13. Commercial laboratories are currently evaluating these procedures.

Personalized Medicine Many of the new applications discussed in the preceding sections are collectively referred to as personalized medicine. In broad terms, personalized medicine uses genomic and/or gene expression data to predict outcome or select specific therapeutic modalities. Of course, this information must be interpreted with patient and family history and other clinical and laboratory data. An extension of personalized medicine is the storage of biological material, including sperm, cord blood, and DNA, where applicable, for future considerations or comparisons between normalcy and disease.

REFERENCES 1. Romero JR. Reverse-transcription polymerase chain reaction detection of the enteroviruses. Arch Pathol Lab Med. 1999;123: 1161–1169. 2. Ruckert R. Picornaviridae and their replication. In: Fields BN and Knipe DM, eds. Fields Virology, 2nd ed. New York: Raven Press; 1990. 3. Rotbart HA, Sawyer MH, Fast S, et al. Diagnosis of enteroviral meningitis by using PCR with a colorimetric microwell detection assay. J Clin Microbiol. 1994;32:2590–2592. 4. Young PP, Buller RS, Storch GA. Evaluation of a commercial DNA enzyme immunoassay for detection of enterovirus reverse transcription-PCR products amplified from cerebrospinal fluid specimens. J Clin Microbiol. 2000;38:4260–4261. 5. Pozo F, Casas I, Tenorio A, et al. Evaluation of a commercially available reverse transcription-PCR assay for diagnosis of enteroviral infection in archival and prospectively collected cerebrospinal fluid specimens. J Clin Microbiol. 1998;36:1741–1745. 6. Wittwer CT, Ririe KM, Andrew RV, et al. The LightCycler: A microvolume multisample fluorimeter with rapid temperature control. Biotechniques. 1997;22:176–181. 7. Watkins-Riedel T, Woegerbauer M, Hollemann D, et al. Rapid diagnosis of enterovirus infections by real-time PCR on the LightCycler using the TaqMan format. Diagn Microbiol Infect Dis. 2002; 42:99–105. 8. Neumaier M, Braun A, Wagener C. Fundamentals of quality assessment of molecular amplification methods in clinical diagnostics. International Federation of Clinical Chemistry Scientific Division Committee on Molecular Biology Techniques. Clin Chem. 1998;44:12–26.

603

Part V


9. Haverstick DM. Specimen collection and processing. In: Bruns DE, Ashwood ER, Burtis CA, eds. Fundamentals of Molecular Diagnostics. St. Louis, MO: Elsevier Saunders; 2007. 10. Beutler E, Gelbart T, Kuhl W. Interference of heparin with the polymerase chain reaction. Biotechniques. 1990;9:166. 11. Jung R, Lubcke C, Wagener C, et al. Reversal of RT-PCR inhibition observed in heparinized clinical specimens. Biotechniques. 1997;23:24, 26, 28. 12. Bruns DE, Ashwood ER, Burtis CA, eds. Fundamentals of Molecular Diagnostics. St. Louis, MO: Elsevier Saunders; 2007. 13. Shindo M, Di Bisceglie AM, Cheung L, et al. Decrease in serum hepatitis C viral RNA during alpha-interferon therapy for chronic hepatitis C. Ann Intern Med. 1991;115:700–704. 14. Germer JJ & Zein NN. Advances in the molecular diagnosis of hepatitis C and their clinical implications. Mayo Clin Proc. 2001; 76:911–920. 15. Bullock GC, Bruns DE, Haverstick DM. Hepatitis C genotype determination by melting curve analysis with a single set of fluorescence resonance energy transfer probes. Clin Chem. 2002; 48:2147–2154. 16. Haverstick DM, Bullock GC, Bruns DE. Genotyping of hepatitis C virus by melting curve analysis: Analytical characteristics and performance. Clin Chem. 2004;50:2405–2407. 17. Terrault NA, Pawlotsky JM, McHutchison J, et al. Clinical utility of viral load measurements in individuals with chronic hepatitis C infection on antiviral therapy. J Viral Hepat. 2005;12:465–472. 18. NIH. National Institutes of Health Consensus Development Conference Statement: Management of hepatitis C 2002 (June 10–12, 2002). Gastroenterology. 2002;123:2082–2099.

604

19. van Dongen JJ, Langerak AW, Bruggemann M, et al. Design and standardization of PCR primers and protocols for detection of clonal immunoglobulin and T-cell receptor gene recombinations in suspect lymphoproliferations: Report of the BIOMED-2 Concerted Action BMH4–CT98–3936. Leukemia. 2003;17: 2257–2317. 20. Bullock GC, SK, Haverstick DM, et al. Technical validation and adaptation of the InVivoScribe TCR-gamma and IgH gene rearrangement assays for detection of clonal lymphoid populations (Abstract). Mod Pathol. 2006;19(suppl 1):217A. 21. Chute DJ, Cousar JB, Mahadevan MS, et al. Detection of immunoglobulin heavy chain gene rearrangements in classic Hodgkin lymphoma using commercially available BIOMED-2 primers. Diagn Mol Pathol. 2008;17:65–72. 22. Mikesh LM, Crowe SE, Bullock GC, et al. Celiac disease refractory to a gluten-free diet? Clin Chem. 2008;54:441–444. 23. Shumaker NR, BG, Silverman LM, Cousar JB. The clinical utility of PCR-based clonality assessment in diagnostic hematopathology. (Abstract). Modern Pathology. 2008;21:274A. 24. Wilson JA, et al. Consensus characterization of 16 FMR1 Reference Materials: A consortium study. Journal of Molecular Diagnostics. 2008;10:2–12. 25. Jennings L, Van Deerlin VM, Gulley MA. Principles and Practice for Validation of Clinical Molecular Pathology Tests. Archives of Pathology and Laboratory Medicine. [in press]. 26. Fu YH, Kuhl DP, Pizzuti A, et al. Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell 1991;67:1047–1058.

C h a p t e r

29 Molecular Assessment of Human Disease in the Clinical Laboratory Joel A. Lefferts

n

INTRODUCTION New technologies that were once labeled For Research Use Only have made a rapid transition into the clinical laboratory as user-developed assays (UDAs), analytespecific reagents (ASRs), or FDA-cleared/approved diagnostic assays. Molecular diagnostics has spanned the entire spectrum of applications that will be performed on a routine clinical basis in most hospital laboratories. While the ability for clinical laboratories to detect human genetic variation has historically been limited to a rather small number of traditional genetic diseases where no clinical laboratory testing was ever available, our current understanding of many disease processes at a molecular level has expanded our testing capabilities to both human and nonhuman applications. The identification of numerous new genes and disease-causing mutations, as well as benign polymorphisms that may influence a specific phenotype, has created a rapid demand for molecular diagnostic testing. There is a growing need for clinical laboratories to provide high-quality nucleic acid-based tests that have significant clinical relevance, excellent performance characteristics, and shortened turnaround-times. This need was initially driven by the completion of the Human Genome Project, which identified thousands of genes, millions of human single nucleotide polymorphisms (SNPs) and culminated in disease associations. An unprecedented demand has now been placed on the clinical laboratory community to provide increased diagnostic testing for rapid and accurate identification and interrogation of genomic targets. Molecular technologies first entered the clinical laboratories in the early 1980s as manual, labor-intensive procedures that required a working knowledge of chemistry and molecular biology, as well as an exceptional


Gregory J. Tsongalis

skill set. Testing capabilities have moved very quickly away from labor intense, highly complex, and specialized procedures to more user-friendly, semiautomated procedures [1]. This transition began with testing for relatively high-volume infectious diseases such as Chlamydia trachomatis, HPV, HIV-1, HCV, and others. Much of this was championed by the availability of FDA-cleared kits and higher throughput, semiautomated instruments such as the Abbott LCX and Roche Cobas Amplicor systems. These two instruments that were based on the ligase chain reaction (LCR) and polymerase chain reaction (PCR), respectively, fully automated the detection steps of the assays with manual specimen processing and amplification reactions. In the early 1980s, the Southern blot was the routine method used in the few laboratories performing clinical testing for a variety of clinical applications, even though the turnaround time was in excess of 2–3 weeks. The commercial availability of restriction endonucleases and various agarose matrices helped in making this technique routine. The PCR revolutionized blotting technologies and detection limits by offering increased sensitivity and the much-needed shortened turnaround time for clinical result availability. Initial PCR thermal cycling occurred in different temperature waterbaths, until the discovery of Taq polymerase, the first commercially available thermostable polymerase. Programmable thermal cyclers with reaction vessels containing all of the amplification reagents have gone through several generations to current instrumentation. Many modifications to the PCR have been introduced, but none as significant as real-time capability [2–5]. The elimination of post-PCR detection systems and the ability to perform the entire assay in a closed vessel had significant advantages for the clinical laboratory. Various detection chemistries for

605

Part V


real-time PCR were rapidly introduced, and many of the older detection methods (including gel electrophoresis, ASO blots, and others) vanished from the laboratory. More recently, real-time PCR has become a method of choice for most molecular diagnostics laboratories. This modification of the traditional PCR allows for the simultaneous amplification and detection of amplified nucleic acid targets for both qualitative and quantitative applications. The main advantages of real-time PCR are the speed with which samples can be analyzed, as there are no post-PCR processing steps required, and the closedtube nature of the technology that helps to prevent contamination. The analysis of results via amplification curve and melt curve analysis is very simple and contributes to its being a much faster method for delivering PCR results. DNA sequencing technologies, fragment sizing, and loss of heterozygosity studies have benefited from automated capillary electrophoresis instrumentation. Several forms of microarrays are currently available as post-PCR detection mechanisms for multiplexed analysis of SNPs, gene expression, and pathogen detection. Today, molecular diagnostic laboratories are well equipped with various instruments and technologies to meet the challenges set forth by molecular pathology needs (Table 29.1). This chapter will introduce the new molecular diagnostic paradigm and several new directions for the molecular assessment of human diseases.

THE CURRENT MOLECULAR INFECTIOUS DISEASE PARADIGM Since early molecular technologies began entering the clinical laboratory, clinical applications were few in number, techniques were labor intense, and turnaround times were in excess of 2 weeks. Table 29.1

Current Technologies Being Used in the Molecular Pathology Laboratory at the Dartmouth Hitchcock Medical Center

Technology

Platform/Instrument

DNA/RNA extraction

Manual Spin column Qiagen EZ1 robot Hybrite oven Molecular imaging system Siemens System 340 Digene HCII System Cepheid GeneXpert ABI 7500 Cepheid Smartcycler Roche Taq48 Beckman CEQ Beckman Vidiera MJ Research DNA Engines Luminex Superarray Nanosphere

Fluorescence in situ hybridization (FISH) bDNA Hybrid capture Real-time PCR

Capillary electrophoresis Traditional PCR Microarray

606

Nonetheless, there was significant clinical utility for Southern blot transfer assays such as the IgH and TCR gene rearrangements, Fragile X Syndrome, and linkage analysis. These studies were qualitative interrogations of specific genetic sequences to determine the presence or absence of a disease-associated abnormality, directly or indirectly. It was not until molecular applications for infectious disease testing were being developed that the need for quantitative and resistance testing became apparent. Molecular infectious disease testing posed the first comprehensive testing paradigm using molecular techniques. That is, clinical applications of molecular diagnostics to infectious diseases included the molecular trinity: qualitative testing, quantitative testing, and resistance genotyping [6–10]. This paradigm spanned the spectrum of current molecular capabilities and has provided significant insight to the nuances of molecular testing for other disciplines (Table 29.2). Molecular diagnostic testing for infectious disease applications continues to be the highest volume of testing being performed in clinical laboratories (Table 29.3). While accurate and timely diagnosis of infectious diseases is essential for proper patient management, traditional testing methods for many pathogens did not allow for rapid turnaround time. Prompt detection of the microbial pathogen would allow providers to institute adequate measures to interrupt transmission to a susceptible hospital or community population and/or to begin proper therapeutic management of the patient. Unlike traditional microbial techniques, molecular techniques offered higher sensitivity and specificity with turnaround times that were unprecedented once amplified technologies were introduced to the clinical laboratory. However, a qualitative test to identify the presence or absence of an organism did not meet all of the necessary clinical needs, especially when trying to monitor therapeutic efficacy. Clinically, it was more useful to identify how much of an organism was present versus if it was or was not present. This would not only allow for the use of the assay as a therapeutic monitoring tool, but also help distinguish a clinically significant infection from a latent or resolving infection. Quantitative assays, initially for viral load testing in HIV-1 infected patients, were developed to monitor the success of newly introduced

Table 29.2

Nuances of Molecular Diagnostic Testing

Preanalytical

Analytical

1. Specimen type

1. Technology 1. LIS used 2. Type of 2. Result reporting and assay: interpretation qualitative vs quantitative 3. Controls 3. Consultation

2. Specimen collection device 3. Specimen transport 4. DNA vs RNA

4. Quality assurance

Postanalytical

4. Standardization

Table 29.3

Chapter 29

Molecular Assessment of Human Disease in the Clinical Laboratory

Molecular Infectious Disease Tests That Are Currently FDA Cleared and Being Performed in Clinical Laboratories

our better understanding of human disease processes, advanced technologies, and expansion of the molecular trinity—qualitative, quantitative, and resistance genotyping—for more common diseases such as cancer. Human cancer represents a complex set of abnormal cellular processes that culminates in widespread systemic disease. Add to this the rapid identification of new biomarkers, introduction of novel therapeutics and progressive management strategies, and human cancer now becomes a model for the new molecular diagnostic paradigm demanding the three phases of testing (qualitative, quantitative, and resistance genotyping) capabilities of the clinical laboratory.

Bacteria

Viruses

Bacillus anthracis Candida albicans Chlamydia trachomatis Enterococcous faecalis Francisella tularensis

Avian flu Cytomegalovirus Enterovirus HBV (quantitative) Hepatitis C virus (qualitative and quantitative) HIV drug resistance

Gardnerella, Trichomonas, and Candida spp. Group A Streptococci Group B Streptococci Legionella pneumophila Methicillin-resistant Staphylococcus aureus Mycobacterium tuberculosis Mycobacterium spp. Staphylococcus aureus

HIV (quantitative) HBV/HCV/HIV blood screening assay Human Papillomavirus Respiratory viral panel West Nile virus

protease and reverse transcriptase inhibitors. This application for HIV-1 viral load testing also represented the first true need for a companion molecular diagnostic assay, not in the sense of prescribing a therapeutic but rather in monitoring its efficacy effectively. To do so, PCR became quantitative, and other quantitative chemistries such as branched DNA (bDNA), transcriptionmediated amplification (TMA), and nucleic acid sequenced-based amplification (NASBA) were born. More recently, real-time PCR capabilities have been further developed and routinely include more accurate methods for quantification of target sequences. HIV-1 once again became the poster child for a novel molecular-based application when it was realized that the virus often mutated in response to therapy. The need to detect viral genome mutations also represented the first major routine application of sequencing methods in the clinical laboratory. These assays would predict response to regimens of antiretroviral therapy and help guide the practitioner’s choices of therapy. In this sense, HIV-1 resistance testing also represented the first routine application of personalized medicine. This application resulted in the need to address the implementation and maintenance of accurate databases as well as deal with specimens co-infected with different mutant viruses. From a single disease moiety, AIDS, a molecular paradigm evolved that would set the stage and expectations for all future molecular diagnostic applications.

A NEW PARADIGM FOR MOLECULAR DIAGNOSTIC APPLICATIONS Our ability to test individuals for many types of human and nonhuman genetic alterations in a clinical setting is expanding at an enormous rate. This is in part due to

Phase I: Qualitative Analysis Qualitative testing results in the determination of presence or absence of a particular genetic sequence. This target can be associated with an infectious agent, can be some human genomic alteration associated with a clinical phenotype, or some benign polymorphism associated with personalized medicine traits. Using the numerous tools available to the Molecular Pathology Laboratory, performing this testing has become routine for many applications, including such targets as parvovirus B19, mutation screening for cystic fibrosis, and CYP2D6 genotyping (Table 29.4). One such oncology target is the JAK2 V617F mutation. V617F is a somatic point mutation in a conserved region of the autoinhibitory domain of the Janus kinase 2 tyrosine kinase that is associated with chronic myeloproliferative diseases (CMPD) [11–13]. The G>T mutation results in a substitution of phenylalanine for valine at position 617. This single point mutation leads to loss of JAK2 autoinhibition and constitutive activation of the kinase. CMPD is a group of hematopoietic proliferations characterized by increased circulating red blood cells, extramedullary hematopoiesis, hyperplasia of hematopoietic cell lineages, and bone marrow dysplasia and fibrosis. CMPDs include chronic myelogenous leukemia, polycythemia vera, essential thrombocythemia, and chronic idiopathic myelofibrosis [13]. The diagnosis of a CMPD is made from clinical and morphologic features which can often be confounded by the stage of disease. Numerous molecular methods have been developed for identifying this mutation including PCR-RFLP, allele-specific PCR, DNA sequencing, and real-time PCR (Figure 29.1). Identification of the JAK2 V617F mutation in CMPD provides a significant molecular biomarker as it is found in almost all cases of polycythemia vera and can be used to rule out other CMPDs [14]. Due to the lack of accurate diagnostic tests for the CMPDs, the utilization of the JAK2 mutation assay has increased significantly and has in many cases become part of a testing algorithm for the CMPDs.

Phase II: Quantitative Analysis Quantitative molecular testing refers to our ability to enumerate the target sequence(s) present in any given tissue type. As with infectious diseases, this application 607

Part V


Qualitative Molecular Diagnostic Tests that are Routinely Performed in the Dartmouth Molecular Pathology Laboratory

Table 29.4

Genetics

Hematology

Infectious

Oncology

Personalized Medicine

AAT ApoE CFTR Factor II Factor V HFE MTHFR SNCA Rep1

BCL-2 FLT3 IGH JAK2 TCR

B. holmesii B. parapertussis B. pertussis Brucella sp. GBS HHV6 HPV MRSA Parvo B19

BRAF MSI SLN

CYP2C9 CYP2D6 EGFR GSTP1 HCV Genotype K-ras UGT1A1 VKORC1

SNP Genotyping Assay RFLP Vic (fluorescence)

V617F

5

WT WT

Homozygous mutant

Heterozygous

4 3 2 Homozygous normal

1 0 0

Figure 29.1

3

Detection of the JAK2 V617F mutation using PCR-RFLP (left) and real-time PCR allelic discrimination (right).

has resulted mainly from the need to monitor therapy and determine eligibility for therapy. Commonly performed quantitative molecular assays are listed in Table 29.5. Typical of the diagnosis of a human cancer is the identification of numerous protein targets through immunohistochemical techniques that help pathologists in their diagnostic decision making. In addition, molecular markers have become part of this armamentarium not so much for the diagnosis of disease, but more so for the selection and monitoring of therapies. The first example of this type of application was the quantitative detection of ERBB2 (v-erb-b2

Table 29.5

Quantitative Molecular Diagnostic Tests That are Routinely Performed in the Dartmouth Molecular Pathology Laboratory

Hematology

Infectious

BCR-ABL Chimerism t(15;17)

BKV HCV HIV

608

1 2 Fam (fluorescence)

Personalized Medicine HER2

erythroblastic leukemia viral oncogene homolog 2) in human breast cancers. The human epidermal growth factor receptor 2 (ERBB2, commonly referred to as HER2) gene had been recognized as being amplified in breast cancers for many years [15,16]. In fact, this gene is amplified in up to 25% of all breast cancers. Amplification of the HER2 gene is the primary mechanism of HER2 overexpression that results in increased receptor tyrosine kinase activity (Figure 29.2). HER2-positive breast cancers have a worse prognosis and are often resistant to hormonal therapies and other chemotherapeutic agents. Trastuzumab (Herceptin), the first humanized monoclonal antibody against the HER2 receptor, was approved by the FDA in 1998. The availability of a therapeutic now made it necessary for laboratories to determine HER2 gene copy number or protein overexpression before patients would be eligible for treatment. Several FDA-cleared tests for immunohistochemical detection of HER2 protein and fluorescence in situ hybridization (FISH) detection of gene amplification are commercially available and approved as companion diagnostics for Herceptin (Figure 29.3). Recently, the American Society of Clinical Oncology and the College of American Pathologists published guidelines for performing and interpreting HER2 testing [17]. These guidelines attempt to standardize HER2 testing by addressing preanalytical, analytical, and postanalytical variables that could lessen result variability

Chapter 29


Amplification/Overexpression

Normal HER-2/neu receptor protein

3

HER-2/neu mRNA 2 1 4 Cytoplasm

HER-2/neuDNA Nucleus

Cytoplasmic membrane 1 = ↑ gene copy number 2 = ↑ mRNA transcription 3 = ↑ cell surface receptor protein expression 4 = ↑ release of receptor extracellular domain Figure 29.2 Schematic diagram of the HER2 amplification process in normal and tumor breast epithelial cells.

Figure 29.3 HER2 amplification as detected by FISH analysis (orange signal, LSI HER2; green signal, CEP17).

due to technical and interpretative subjectivity. While many laboratories have adopted an algorithm for screening breast cancer cases by immunohistochemical staining and reflexing equivocal results for FISH analysis, others have gone to a primary FISH screen for HER2 gene amplification.

Phase III: Resistance Testing With respect to resistance genotyping, our infectious disease experience has taught us that this can be attributed to identification of subtypes of organisms such as

in Hepatitis C virus (HCV) or in actual mutations of the viral genome as in the HIV-1 virus. It is well known that tumor cells develop resistance to therapeutic agents via multiple mechanisms and, more importantly, are sensitive to newer therapeutic modalities if certain genetic abnormalities are or are not present in the tumor cells. For example, significant improvements have been made in the response rates, progression-free survival, and overall survival for colorectal cancers, the second leading cause of cancer death in the United States, in the last decade. This has been due to new combinations of chemotherapeutic agents and new small molecule targeted therapies [18–20]. The overall efficacy of traditional chemotherapeutic agents for treating cancer has been extremely low. More modern targeted therapies hope to improve on this. Selecting patients most likely to benefit from molecularly targeted therapies, however, has been challenging. Recently, K-ras mutations have been shown to be an independent prognostic factor in patients with advanced colorectal cancer who are treated with Cetuximab [21]. Cetuximab is known to be active in metastatic colorectal cancer patients which are resistant to irinotecan, oxaliplatin, and fluoropyrimidine. In these studies, K-ras mutation has also been identified as a marker of tumor cell resistance to Cetuximab. Amado et al. have also associated the presence of wild-type K-ras sequences with panitumumab (a humanized monoclonal antibody against the epidermal growth factor receptor) efficacy in patients with metastatic disease [22]. These data demonstrate the need for identifying resistant mutations in other genes, as well as identifying the presence of the target for these novel therapies. K-ras mutations are present in >30% of colorectal cancers and play a critical role in the pathogenesis of 609

Part V


this disease. K-ras is a member of the guanosine-50 -triphosphate (GTP)-binding protein superfamily. Stimulation of a growth factor receptor by ligand binding results in activated K-ras by binding to GTP. This results in downstream activation of pathways such as RAF/MAP kinase, STAT, and PI3K/AKT, that in turn results in cellular proliferation, adhesion, angiogenesis, migration, and survival [23–25]. While the association of K-ras mutations and cancer had been known for quite some time, the association of mutated K-ras with a response to a novel and expensive therapeutic has made its interrogation a prerequisite to receiving therapy. It is now estimated that all colorectal cancer patients who will receive these therapies will first be tested for K-ras mutations.

per year, and it accounts for about 20% of all adult cases of leukemia [28,29]. Typically, the disease progresses through three clinical phases: (i) a chronic phase (which may be clinically asymptomatic), (ii) an accelerated phase, and (iii) a blast phase or blast crisis. Most patients are diagnosed with the disease during the chronic phase by morphologic, cytogenetic, and molecular genetic techniques. The (9;22)(q34;q11) translocation, which results in the BCR-ABL fusion gene, is a defining feature of this disease [30–32]. BCR-ABL analysis warrants the three phases of the presented paradigm for qualitative diagnostic testing, quantitative monitoring, and resistance mutation analysis. CML has traditionally been diagnosed and monitored by cytogenetics, FISH, and Southern blot analysis (Figure 29.4). Conventional cytogenetics, such as bone marrow karyotyping that is performed on 30–50 cells, can be used to visualize the translocation by G-banding analysis. FISH, typically performed on 100–1000 cells in interphase or metaphase, allows the visualization of the translocation through the use of fluorescently labeled probes (Figure 29.4). These techniques are limited in sensitivity and cannot detect more than a 2-log reduction in residual CML cells and have increased turnaround times [33].

BCR-ABL: A MODEL FOR THE NEW PARADIGM Chronic myelogenous leukemia (CML) is considered one of the diseases in the group of myeloproliferative disorders. These are clonal hematopoietic malignancies characterized by the proliferation and survival of one or more of the myeloid cell lineages [26,27]. CML has an estimated 5,000 newly diagnosed cases

“ph”

‹ 11 ‹ 12 ‹ 19

‹ 24 9

22

22

9

der (9)

9

22

9

t(9;22)

22

600

Positive for BCR-ABL

Fluorescence

500 400 300 Internal Control BCR-ABL

200 100 0 Cycles

Figure 29.4 Testing methods for the detection of the BCR-ABL translocation. Traditional cytogenetic karyotyping, Southern blot transfer analysis, FISH, and real-time PCR. 610

Chapter 29


Real-time reverse transcriptase quantitative PCR (qPCR) has become the preferred method for monitoring the second phase of the paradigm, minimal residual disease in CML patients treated with imatinib (Figure 29.4) [33–39]. The major advantage of qPCR is that it has a sensitivity on the order of one CML cell per 105 normal cells, thus achieving a 3-log improvement in sensitivity compared to cytogenetics and FISH. Novel instrumentation now allows clinical laboratories the ability to provide quantitative analysis using realtime PCR in under 2 hours (Figure 29.5) [40,41]. The detection of low levels of disease in CML patients is critical to the proper management of these patients. Studies have shown that a rapid 3-log quantitative reduction in BCR-ABL transcript predicts risk of progression in CML patients being treated with imatinib [38,39]. Similarly, a significant increase in BCR-ABL transcript in a patient being treated with imatinib may indicate an acquired mutation which confers resistance to treatment. Molecular analysis of the transcript is performed to identify mutations that confer therapeutic resistance, the third phase of the paradigm. It has been recommended that patients who fail to achieve a 3-log reduction in BCR-ABL transcript levels after 18 months of imatinib therapy have an increase in their dose in an attempt to achieve a major molecular response [39]. The recognition of the role of BCR-ABL kinase activity in CML has provided an attractive target for the development of therapeutics. Although interferon therapy and stem cell transplantation were previously the first-line treatments of choice, tyrosine kinase inhibitors such as imatinib mesylate (GleevecW; Novartis, Basel, Switzerland), and dasatinib (SPRYCELW;

Bristol-Myers Squibb, New York, NY) have now become first- and second-line therapies. Imatinib binds to the inactive form of the wild-type Bcr-Abl protein, preventing its activation. However, acquired mutations in the BCR-ABL kinase domains prevent imatinib binding. Dasatinib binds to both the inactive and active forms of the protein, and also binds to all imatinib-resistant mutants except the threonine to isoleucine mutation at amino acid residue 315 (T315I). The introduction of more efficacious therapeutics such as imatinib and dasatinib has redefined the therapeutic responses that are achievable in the CML patient (Table 29.6). CML now represents a molecular oncology paradigm similar to HIV-1 whereby qualitative, quantitative, and resistant genotyping can be performed routinely.

Therapeutic Goals for the CML Patient

Table 29.6

Therapeutic Goal

Therapeutic Response

Hematologic response Cytogenetic response 1. complete 2. partial 3. minor

Normal peripheral blood valves, normal spleen size Reduction of Phþ cells in blood or bone marrow 1. 0% Phþ cells 2. 1%–35% Phþ cells 3. 36%–95% Phþ cells Reduction or elimination of BCR-ABL mRNA in peripheral blood or bone marrow

Molecular response

Fluorescence

300

200

Negative

100

0

10

20 Cycles

30

40

30

40

Legend Target #1; FAM; Primary SPC #1: TxR; Primary

700

Fluorescence

600 500

Positive

400 300 200 100 0

10

20 Cycles

Legend Target #1; FAM; Primary SPC #1: TxR; Primary

Figure 29.5 GeneXpert real-time PCR system and cartridge for quantification of the BCR-ABL transcript. 611

Part V


CONCLUSION Numerous genes and mutations have been identified for many human diseases, including cancer. Yet little of this knowledge has made it into the clinical laboratory as validated diagnostic tests. This is beginning to change with our increased medical and biological knowledge of these diseases. Genomics and proteomics in the clinical context of diagnostic testing are progressing at record speeds. Technology, as is typical in the clinical laboratory, has far outpaced proven clinical utility. Routine applications of information from the “omics-era” are currently being performed for a new paradigm in molecular diagnostic testing that consist of qualitative, quantitative, and resistance genotyping for various clinical conditions.

REFERENCES 1. Tsongalis GJ, Coleman WB. Clinical genotyping: The need for interrogation of single nucleotide polymorphisms and mutations in the clinical laboratory. Clin Chim Acta. 2006;363:127–137. 2. Wilhelm J, Pingoud A. Real-time polymerase chain reaction. Chembiochem. 2003;4:1120–1128. 3. Wittwer CT, Herrmann MG, Moss AA, et al. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques. 1997;22:130–131, 134–138. 4. Parks SB, Popovich BW, Press RD. Real-time polymerase chain reaction with fluorescent hybridization probes for the detection of prevalent mutations causing common thrombophilic and iron overload phenotypes. Am J Clin Pathol. 2001;115:439–447. 5. Wittwer CT, Reed GH, Gundry CN, et al. High-resolution genotyping by amplicon melting analysis using LCGreen. Clin Chem. 2003;49:853–860. 6. Ratcliff RM, Chang G, Kok T, et al. Molecular diagnosis of medical viruses. Curr Issues Mol Biol. 2007;9:87–102. 7. Tsongalis GJ. Branched DNA technology in molecular diagnostics. Am J Clin Pathol. 2006;126:448–453. 8. Yang S, Rothman RE. PCR-based diagnostics for infectious diseases: Uses, limitations, and future applications in acute-care settings. Lancet Infect Dis. 2004;4:337–348. 9. Tan TY. Use of molecular techniques for the detection of antibiotic resistance in bacteria. Expert Rev Mol Diagn. 2003;3:93–103. 10. Versalovic J, Lupski JR. Molecular detection and genotyping of pathogens: More accurate and rapid answers. Trends Microbiol. 2002;10:S15–S21. 11. James C, Ugo V, Le Coue´dic JP, et al. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythemia vera. Nature. 2005;434:1144–1148. 12. Kralovics R, Passamonti F, Buser AS, et al. A gain of function mutation of JAK2 in myeloproliferative disorders. N Engl J Med. 2005;352:1779–1790. 13. Levine RL, Wadleigh M, Cools J, et al. Activating mutation in the tyrosine kinaase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell. 2005;7:387–397. 14. Steensma DP. Jak2 V617F in myeloid disorders: Molecular diagnostic techniques and their clinical utility. J Molec Diagn. 2006;8:397–411. 15. Moasser MM. The oncogene HER2: Its signaling and transforming functions and its role in human cancer pathogenesis. Oncogene. 2007;26:6469–6487. 16. Moasser MM. Targeting the function of the HER2 oncogene in human cancer therapeutics. Oncogene. 2007;26:6577–6592. 17. Wolff AC, Hammond ME, Schwartz JN, et al. American Society of Clinical Oncology; College of American Pathologists. American Society of Clinical Oncology/College of American Pathologists

612

18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34.

35. 36.

37.

38. 39.

40. 41.

guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. J Clin Oncol. 2007;25:118–145. de Gramont A, Figer A, Seymour M, et al. Leucovorin and fluorouracil with or without oxaliplatin as first-line treatment in advanced colorectal cancer. J Clin Oncol. 2000;18:2938–2947. Saltz LB, Cox JV, Blanke C, et al. Irinotecan plus fluorouracil and leucovorin for metastatic colorectal cancer. Irinotecan Study Group. N Engl J Med. 2000;343:905–914. Cunningham D, Humblet Y, Siena S, et al. Cetuximab monotherapy and cetuximab plus irinotecan in irinotecan-refractory metastatic colorectal cancer. N Engl J Med. 2004;351:337–345. Lie`vre A, Bachet JB, Boige V, et al. KRAS mutations as an independent prognostic factor in patients with advanced colorectal cancer treated with cetuximab. J Clin Oncol. 2008;26:374–379. Amado RG, Wolf M, Peeters M, et al. Wild-type KRAS is required for panitumumab efficacy in patients with metastatic colorectal cancer. J Clin Oncol. 2008;26:1626–1634. Krause DS, Van Etten RA. Tyrosine kinases as targets for cancer therapy. N Engl J Med. 2005;353:172–187. Nguyen H, Tran A, Lipkin S, et al. Pharmacogenomics of colorectal cancer prevention and treatment. Cancer Invest. 2006; 24:630–639. Mendelsohn J, Baselga J. Epidermal growth factor receptor targeting in cancer. Semin Oncol. 2006;33:369–385. Tefferi A, Gilliland DG. Oncogenes in myeloproliferative disorders. Cell Cycle. 2007;6:550–566. Delhommeau F, Pisani DF, James C, et al. Oncogenic mechanisms in myeloproliferative disorders. Cellul Molec Life Sci. 2006; 63:2939–2953. Schiffer CA. BCR-ABL tyrosine kinase inhibitors for chronic myelogenous leukemia. N Engl J Med. 2007;357:258–265. Quintas-Cardama A, Cortes JE. Chronic myeloid leukemia: Diagnosis and treatment. Mayo Clinic Proc. 2006;81:973–988. Sawyers CL. Chronic myeloid leukemia. N Engl J Med. 1999; 340:1330–1340. Ben-Neriah Y, Daley GQ, Mes-Masson AM, et al. The chronic myelogenous leukemia-specific P210 protein is the product of the bcr/abl hybrid gene. Science. 1986;233:212–214. Ren R. Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukemia. Nature Rev Cancer. 2005;5:172–183. Goldman J. Monitoring minimal residual disease in BCR-ABLpositive chronic myeloid leukemia in the imatinib era. Curr Opin Hematol. 2005;12:33–39. Martinelli G, Iacobucci I, Soverini S, et al. Monitoring minimal residual disease and controlling drug resistance in chronic myeloid leukaemia patients in treatment with imatinib as a guide to clinical management. Hematol Oncol. 2006;24:196–204. Hughes T, Branford S. Molecular monitoring of BCR-ABL as a guide to clinical management in chronic myeloid leukaemia. Blood Rev. 2006;20:29–41. Marin D, Kaeda J, Szydlo R, et al. Monitoring patients in complete cytogenetic remission after treatment of CML in chronic phase with imatinib: Patterns of residual leukaemia and prognostic factors for cytogenetic relapse. Leukemia. 2005;19:507–512. van der velden VHJ, Hochhaus A, Cazzaniga G, et al. Detection of minimal residual disease in hematologic malignancies by real time quantitative PCR: Principles, approaches, and laboratory aspects. Leukemia. 2003;17:1013–1034. Hochhaus A, La Rosee P. Imatinib therapy in chronic myelogenous leukemia: Strategies to avoid and overcome resistance. Leukemia. 2004;18:1321–1331. Baccarani M, Saglio G, Goldman J, et al. Evolving concepts in the management of chronic myeloid leukemia: Recommendations from an expert panel on behalf of the European Leukemia Net. Blood. 2006;108:1809–1820. Dufresne SD, Belloni DR, Levy NB, et al. Quantitative assessment of the BCR-ABL transcript using the Cepheid Xpert BCR-ABL Monitor assay. Arch Pathol Lab Med. 2007;131:947–950. Winn-Deen ES, Helton B, Van Atta R, et al. Development of an integrated assay for detection of BCR-ABL RNA. Clin Chem. 2007;53:1593–1600.

C h a p t e r

30 Pharmacogenomics and Personalized Medicine in the Treatment of Human Diseases Hong Kee Lee

n

INTRODUCTION In 2001, the first draft of the Human Genome Project was simultaneously published by two groups [1,2]. This was the beginning of an era that promised better diagnostic and prognostic testing that would lead to preventive medicine and more personalized therapy. As part of this promise, the ability to select and dose therapeutic drugs through the use of genetic testing has become a reality. Pharmacogenomics represents the role that genes play (pharmacogenetics) in the processing of drugs by the body (pharmacokinetics) and how these drugs interact with their targets to give the desired response (pharmacodynamics) (Figure 30.1). While other environmental factors also play a role in this selection, an individual’s genetic makeup provides new insights into the metabolism and targeting of commonly prescribed as well as novel targeted therapies [3–5]. The importance of implementing this knowledge into clinical practice is highlighted by the more than 2 million annual hospitalizations and greater than 100,000 annual deaths in the United States due to adverse drug reactions [6]. Current medical practices often utilize a trial-anderror approach to select the proper medication and dosage for a given patient (Figure 30.2). Pharmacogenetics (PGx) utilizes our knowledge of genetic variation to assess an individual’s response to therapeutic drugs, and when interpreted in the context of the entire being, pharmacogenomics can result in better personalized medicine. This application of human genetics is our attempt to more accurately and


Gregory J. Tsongalis

efficaciously determine genomic sequence variations and expression patterns involved in response to the absorption, distribution, metabolism, and excretion of therapeutic drugs at a systemic level [3,7–9]. A second component to this application of genomics is in the identification of target genes for novel therapies at the cellular level, as well as acquired mutations in genes of specific pathways that may result in a better or worse response to a novel therapy. The overall aim of PGx testing is to decrease adverse responses to therapy and increase efficacy by ensuring the appropriate selection and dose of therapy. Numerous genetic variants or polymorphisms in genes that code for drug metabolizing enzymes, drug transporters, and drug targets that alter response to therapeutics have been identified (www.pharmgkb. org/) (Table 30.1). Classification of these enzymes includes specific nomenclature, CYP2D6*1, such that the name of the enzyme (CYP) is followed by the family (for example, 2), subfamily (for example, D), and gene (for example, 6) associated with the biotransformation. Allelic variants are indicated by an asterisk (*) followed by a number (for example, *1). The technologies that are currently available in clinical laboratories and are employed to routinely test for these variants are shown in Table 30.2 [10]. Single nucleotide polymorphisms (SNPs) in these genes may result in no significant phenotypic effect, change drug metabolism by >10,000-fold, or alter protein binding by >20-fold [11]. More than 3.5 million SNPs have been identified in the human genome (www.hapmap.org), making analysis quite challenging. As shown in Table 30.1, different genes can

613

Part V


Table 30.1

Environment

PD

PK PGx

Examples of Enzymes and Their Designated Polymorphic Alleles

Enzyme

Alleles

Cytochrome P450 2D6 (CYP2D6)

*2, *3, *4, *5, *6, *7, *8, *11, *12, *13, *14, *15, *16, *18, *19, *20, *21, *38, *40, *42, *10, *17, *36, *41 *1, *2, *3, *4, *5, *6

Cytochrome P450 2C9 (CYP2C9) Cytochrome P450 2C19 (CYP2C19) UGT1A1

Figure 30.1 Venn diagram of pharmacogenomics showing the interactions of pharmacogenetics (PGx), pharmacokinetics (PK), and pharmacodynamics (PD), along with other environmental factors that affect drug response.

contain various numbers of SNPs that alter the function of the coded protein. It is important to clearly differentiate these benign polymorphisms (present in greater than 1% of the general population) from rare disease-causing mutations that are present in less than 1% of the general population. The SNPs associated with pharmacogenetics do not typically result in any form of genetic disease. We do know that these SNPs may be used to evaluate individual risk for adverse drug reactions (ADRs) so that we may decrease ADRs, select optimal therapy, increase patient compliance, develop safer and more effective drugs, revive withdrawn drugs, and reduce time and cost of clinical trials [6,12]. In addition to the genotype predicting a phenotype, drug metabolizing enzyme activity can be induced or inhibited by various drugs. Induction leads to the production of more enzyme within 3 or more days of exposure to inducers [13]. Enzyme inhibition by commonly prescribed drugs can be an issue in polypharmacy and is usually the result of competition between two drugs for metabolism by the same enzyme. A better understanding of drug metabolism has led to a number of amended labels for commonly prescribed drugs (Table 30.3).

*2, *3 *6, *28, *37, *60

Historical Perspective Friedrich Vogel was the first to use the term pharmacogenetics in 1959 [14]. However, in 510 BC, Pythagoras recognized that some individuals developed hemolytic anemia with fava bean consumption [15]. In 1914, Garrod expanded on these early observations to state enzymes detoxify foreign agents so that they may be excreted harmlessly, but some people lack these enzymes and experience adverse effects [16]. Hemolytic anemia due to fava bean consumption was later determined to occur in glucose-6-phosphate dehydrogenase deficient individuals [17,18]. Through the early 1900s PGx evolved as investigators combined Mendelian genetics with observed phenotypes. In 1932, Snyder performed the first global study of ethnic variation and deduced that taste deficiency was inherited. As such, the phenylthiourea non-taster phenotype was an inherited recessive trait, and the frequency of occurrence differed between races [19]. Similarly, polymorphisms in the N-acetyl transferase enzyme also segregate by ethnicity [20]. Shortly thereafter other genetic differences such as aldehyde dehydrogenase and alcohol dehydrogenase deficiencies were discovered. In 1956, it was recognized that variants of glucose-6-phosphate dehydrogenase caused primaquine-induced hemolysis [21]. It was shown that the metabolism of nortriptyline and desipramine was highly variable among individuals, and two phenotypes were identified in 1967 [22]. Subsequently, genetic deficiencies in other enzyme

Current Reactive Medical Care Model Diagnosis

Select Therapeutic

Switch Therapeutic

Switch Therapeutic

Switch Therapeutic

The Personalized Medicine Paradigm Predisposition Screening

Diagnosis and Prognosis

“Right” Drug and Right Dose

Monitoring

Figure 30.2 Schematic diagram illustrating current medical practice and the changes that occur in a personalized medicine model. 614

Chapter 30

Table 30.2

Pharmacogenomics and Personalized Medicine in the Treatment of Human Diseases

Genotyping Methodologies Currently in Use in the Clinical Laboratory

Technology

Methodology*

Company*

Gel electrophoresis Real-time PCR

Southern blot PCR-RFLP* Allele-specific PCR Allelic discrimination

DNA Sequencing

Sanger—fluorescent detection

Arrays

Liquid beads Microarray Microfluidic

Generic equipment Applied Biosystems Biorad Cepheid Roche Molecular Applied Biosystems Beckman Coulter Pyrosequencing Autogenomics Luminex Nanosphere Roche Molecular

*Representative examples. **PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism analysis.

Genotyping Technologies

Examples of Therapeutic Drugs That Include PGx Information or Have Had Labels Amended Due to New Knowledge of Metabolism

Atomoxetine Thioridazine Voriconazole 6-mercaptopurine Azathioprine Irinotecan Warfarin

4 3 2 1 0

We currently have the means to successfully and accurately genotype patients for polymorphisms and mutations on a routine basis [10] (Table 30.2). Genotyping involves the identification of defined genetic variants that give rise to the specific drug response phenotypes [27]. Genotyping methods are easier to perform and more cost effective than the more traditional phenotyping methods. Because an individual’s genotype is not expected to change over time, most genotyping applications need be performed only once in an individual’s lifetime. The exception to this is for the acquired genetic variants that occur in certain disease conditions such as cancer where variants of tumor cells may change during the course of the disease. While a single genotype can determine responses to numerous

Table 30.3

5 Vic (fluorescence)

systems were documented and shown that metabolism of drugs played a critical role in a patient’s response as well as risk for development of ADRs [23–26]. The central dogma for assessing human diseases at a molecular level, DNA ! RNA ! protein, became the model for moving the newly discovered knowledge base and technologies forward at the molecular level.

StratteraW MellarilW VfendW PurinetholW ImuranW CamptosarW CoumadinW

0

1 2 Fam (fluorescence)

3

Figure 30.3 Allelic discrimination using real-time PCR and Taqman probes to identify individuals who are homozygous or heterozygous (circle) for a particular SNP.

therapeutic drugs, it is worth noting that patients and providers will need to refer back to genotype information on numerous occasions. Early genotyping efforts utilized conventional procedures such as Southern blotting and the polymerase chain reaction (PCR) followed by restriction endonuclease digestion to interrogate human gene sequences for polymorphisms [27,28]. The introduction of realtime PCR to clinical laboratories has resulted in assays which can be performed much faster and in a multiplexed fashion so that more variants are tested for at the same time [29] (Figure 30.3). Direct sequencing reactions have been developed on automated capillary electrophoresis instruments to detect specific base changes that result in a variant allele. More recently, platforms utilizing various array technologies for genotyping have been introduced into the clinical laboratory. Roche Molecular was the first to introduce an FDA-cleared microarray, AmpliChip CYP450 test, for PGx testing on an Affymetrix platform which detects 31 known polymorphisms in the CYP2D6 gene, including gene duplication and deletion, as well as two variations in the CYP2C19 615

Part V


gene [30]. Other array platforms being introduced into the clinical laboratory are the AutoGenomics INFINITI™ [31], Luminex 100 and 200 microbeadarray technologies [32], and the Nanosphere Verigene system [10].

PGx and Drug Metabolism Most of the enzymes involved in drug metabolism are members of the cytochrome P450 (CYP450) superfamily [33–35]. CYP450 enzymes are mainly located in the liver and gastrointestinal tract and include greater than 30 isoforms [33]. The most polymorphic of these enzymes responsible for the majority of biotransformations are the CYP3A, CYP2D6, CYP2C19, and CYP2C9. Benign genetic variants or polymorphisms in these genes can lead to the following phenotypes: poor, intermediate, extensive, and ultrarapid metabolizers. Poor metabolizers (PM) have no detectable enzymatic activity; intermediate metabolizers (IM) have decreased enzymatic activity; extensive metabolizers (EM) are considered normal and have at least one copy of an active gene; ultrarapid metabolizers (UM) contain duplicated or amplified gene copies that result in increased drug metabolism. The following are several examples of polymorphic drug metabolizing enzymes that can affect response to therapy.

CYP2D6 CYP2D6 is an example of one of the most widely studied members of this enzyme family. It is highly polymorphic and contains 497 amino acids. The CYP2D6 gene is localized on chromosome 22q13.1 with two neighboring pseudogenes, CYP2D7 and CYP2D8 [36,37]. More than 50 alleles of CYP2D6 have been described, of which alleles *3, *4, *5, *6, *7, *8, *11, *12, *13, *14, *15, *16, *18, *19, *20, *21, *38, *40, *42, and *44 were classified as nonfunctioning and alleles *9, *10, *17, *36, and *41 were reported to have substrate-dependent decreased activity [38]. CYP2D6 alone is responsible for the metabolism of 20%–25% of prescribed drugs (Table 30.4). Screening for CYP2D6*3, *4, and *5 alleles identifies at least 95% of poor metabolizers in the Caucasian population. Based on the type of metabolizer, an individual can determine the response to a therapeutic drug.

CYP2C9 A more specific example of CYP450 metabolizing enzyme polymorphisms and drug metabolism is demonstrated by CYP2C9 and warfarin. In the past six years, there has been tremendous interest in studying the effect of genetics on warfarin dosing [39]. CYP2C9 polymorphisms (CYP2C9*2 and CYP2C9*3) were first found to reduce the metabolism of S-warfarin, which can lead to dosing differences [40,41]. Soon after, the identification of a polymorphism in the vitamin K epoxide reductase (VKORC1) gene proved that drug target polymorphisms are also important in 616

Table 30.4

Some Therapeutic Drugs Metabolized by CYP2D6 Cytochrome P450 2D6

Amitriptyline Aripiprazole Atomoxetine Carvedilol Chlorpromazine Clomipramine Codeine Desipramine Dextromethorphan Duloxetine Flecainide Fluoxetine Fluvoxamine Haloperidol Imipramine

Lidocaine Metoclopramide Metoprolol Nortriptyline Oxycodone Paroxetine Propafenone Propranolol Risperidone Tamoxifen Thioridazine Timolol Tramadol Venlafaxine Zuclopenthixol

warfarin dosing [42,43]. Since then, several warfarin dosing algorithms that take into consideration patient demographics, CYP2C9 and VKORC1 polymorphisms, and concurrent drug use have been developed [44–48]. In August 2007, the FDA announced an update to the warfarin package insert to include information on CYP2C9 and VKORC1 testing [49].

UGT1A1 The uridine diphosphate glucuronosyltransferases (UGT) superfamily of endoplasmic reticulum-bound enzymes is responsible for conjugating a glucuronic acid moiety to a variety of compounds, thus allowing these compounds to be more easily eliminated. It is a member of this family that catalyzes the glucuronidation of bilirubin, allowing it to be excreted in the bile. As irinotecan therapy for advanced colorectal cancers became more widely used, it was observed that patients who had Gilbert syndrome (defects in UGT leading to mild hyperbilirubinemia) suffered severe toxicity [50]. Irinotecan is converted to SN-38 by carboxylesterase-2, and SN-38 inhibits DNA topoismoerase I activity [51,52]. SN-38 is glucuronidated by uridine diphosphate glucuronosyl-transferase (UGT), forming a watersoluble metabolite, SN-38 glucuronide, which can then be eliminated [53] (Figure 30.4). The observation made in Gilbert syndrome patients revealed that SN-38 shares a glucuronidation pathway with bilirubin. The decreased glucuronidation of bilirubin and SN-38 can be attributed to polymorphisms in the UGT1A1 gene. The wild-type allele of this gene, UGT1A1*1, has six tandem TA repeats in the regulatory TATA box of the UGT1A1 promoter. The most common polymorphism associated with low activity of UGT1A1 is the *28 variant, which has seven TA repeats. In August 2005, the FDA amended the irinotecan (CamptosarW) package insert to recommend genotyping for the UGT1A1 polymorphism and suggested a dose reduction in patients homozygous for the *28 allele.

Chapter 30


CH3

CH3

N O

N O

HO

O

O

CES

N

N O HO

HO

H3C

O

Irinotecan

HO

O

O

O N

HO

O H3C

UGT1A1

N

N

CH3

O

OH

N

OH

O HO

O

SN-38

H3C

O

SN-38G

Figure 30.4 Schematic diagram of irinotecan metabolism.

PGx and Drug Transporters Although the genes that code for drug metabolizing enzymes have received more attention in recent years as markers for PGx testing, the genes that code for proteins used to transport drugs across membranes also need to be considered when discussing PGx. These drug transporter proteins move substrates across cell membranes, bringing them into cells or removing them from cells. These proteins are essential in the absorption, distribution, and elimination of various endogenous and exogenous substances including pharmaceutical agents. Several groups of drug transporters that may be significant in the field of pharmacogenomics exist, including multidrug resistance proteins (MDRs), multidrug resistance-related proteins (MRPs), organic anion transporters (OATs), organic anion transporting polypeptides (OATPs), organic cation transporters (OCTs), and peptide transporters (PepTs). ABCB1 (MDR1) is a member of the multidrug resistance protein family and is one example of a drug transporter protein important in the field of PGx.

ABCB1 ABCB1 is a member of the ATP-binding cassette (ABC) superfamily of proteins. Also known as P-glycoprotein (P-gp) or MDR1, it is a 170 kDa glycosylated membrane protein expressed in various locations including the liver, intestines, kidney, brain, and testis [54–56]. Generally speaking, ABCB1 is located on the membrane of cells in these locations and serves to eliminate metabolites and a wide range of hydrophobic foreign substances, including drugs, from cells by acting as an efflux transporter [57,58]. Due to the localization of ABCB1 on specific cells, ABCB1 aids in eliminating drugs into the urine or bile and helps maintain the blood-brain barrier [56]. Like other eukaryotic ABC proteins, the ABCB1 protein is composed of two similar halves, each half containing a hydrophobic membrane binding domain and a nucleotide-binding domain. The membrane binding domains are each composed of six hydrophobic transmembrane helices, and the two hydrophilic nucleotide-binding domains are located on the intracellular side of the membrane where they bind ATP [59–61].

ABCB1 was first identified in cancer cells that had developed a resistance to several anticancer drugs because of an overexpression of the transporter. When expressed at normal levels in noncancerous cells, ABCB1 has been shown to transport other classes of drugs out of cells including cardiac drugs (digoxin), antibiotics, steroids, HIV protease inhibitors, and immunosuppressants (cyclosporin A) [61]. Genetic variations in the ABCB1 gene expressed in normal cells have been shown to have a role in interindividual variability in drug response [62,63]. Although many polymorphisms have been detected in the ABCB1 gene, correlations between genotype and either protein expression or function have been described for only a few of the genetic variants. Most notable among these is the 3435 C>T polymorphism, found in exon 26, which has been found to result in decreased expression of ABCB1 in individuals homozygous for the T allele. These results, however, have been found to be slightly controversial [62,64–67]. The possible importance of the 3435 C>T is particularly interesting considering the mRNA levels are not affected by this polymorphism, which is found within a coding exon. Although the correlation between the 3435 C>T polymorphism and ABCB1 protein levels may be due to linkage of this polymorphism to others in the ABCB1 gene, a recent study showed that this polymorphism alone does not affect ABCB1 mRNA or protein levels but does result in ABCB1 protein with an altered configuration. The altered configuration due to 3435 C>T is hypothesized to be caused by the usage of a rare codon which may affect proper folding or insertion of the protein into the membrane, affecting the function, but not the level of ABCB1 [68]. Genetic variations affecting the expression or function of drug transporter proteins, such as ABCB1, could drastically alter the pharmacokinetics and pharmacodynamics of a given drug.

PGx and Drug Targets Most therapeutic drugs act on targets to elicit the desired effects. These targets include receptors, enzymes, or proteins involved in various cellular events such as signal transduction, cell replication, and others. Investigators have now identified polymorphisms in these targets that render them resistant to the particular therapeutic agent. While these polymorphisms in receptors may not show 617

Part V


dramatic increases or decreases in drug activity as the drug metabolizing enzymes, biologically significant effects occur frequently [3,15,33]. The human m-opioid receptor gene (OPRM1) and FLT3 are two examples of the effects of polymorphisms on drug targets.

OPRM1 The human m-opioid receptor, coded by the OPRM1 gene, is the major site of action for endogenous bendorphin, and most exogenous opioids. Forty-three SNPs have been discovered in the OPRM1 gene, but the 118A>G SNP is the most well studied [69]. The allele frequency of OPRM1 118A>G SNP in Caucasians is 10%–30% [69,70]. This SNP causes an increased affinity of the m-opioid receptor for b-endorphin, which improves pain tolerance in humans [71,72]. However, the effect of this SNP is controversial in people taking exogenous opioids. Studies showed that 118G allele carriers required an increased dose of morphine in patients with acute and chronic pain [73,74], but a decreased dose of fentanyl in patients requiring epidural or intravenous fentanyl for pain control during labor [75]. The exact mechanism of how this happens is still unknown.

FLT3 FLT3 is a receptor tyrosine kinase expressed and activated in most cases of acute myeloid leukemia (AML), which has a relatively high relapse rate due to acquired resistance to traditional chemotherapies. An internal tandem duplication (ITD) mutation in the FLT3 gene is found in up to 30% of AML patients, while point mutations have been shown to account for approximately 5% of refractory AML. The FLT3-ITD induces activation of this receptor and results in downstream constitutive phosphorylation in STAT5, AKT, and ERK pathways. This mutation in FLT3 is a negative prognostic factor in AML. Recently, a novel multitargeted receptor tyrosine kinase inhibitor, ABT-869, has been developed to suppress signal transduction from constitutively expressed kinases such as a mutated FLT3 [76].

Cancer patients exhibit a heterogeneous response to chemotherapy with only 25%–30% efficacy. PGx can improve on chemotherapeutic and targeted therapy responses by providing a more informative evaluation of the underlying molecular determinants associated with tumor cell heterogeneity. In the cancer patient, PGx can be used to integrate information on drug responsiveness with alterations in molecular biomarkers. Thus, as with previous examples of PGx testing, therapeutic management of the cancer patient can be tailored to the individual patient or tumor phenotype.

Estrogen Receptor One of the first and most widely used parameters for a targeted therapy is the evaluation of breast cancers for expression of the estrogen receptor (ER) (Figure 30.5). ER-positive breast cancers are then treated with hormonal therapies that mimic estrogen. One of these estrogen analogues is Tamoxifen (TAM), which itself has now been shown to have altered metabolism due to CYP450 genetic polymorphisms [77,78]. TAM is used to treat all stages of estrogen receptor-positive breast cancers [79]. TAM and its metabolites compete with estradiol for occupancy of the estrogen receptor, and in doing so inhibit estrogen-mediated cellular proliferation. Conversion of TAM to its active metabolites occurs predominantly through the CYP450 system [80] (Figure 30.6). Conversion of TAM to primary and secondary metabolites is important because these metabolites can have a greater affinity for the estrogen receptor than TAM itself. For example, 4-OH Ndesmethyl-TAM (endoxifen) has approximately 100 times greater affinity for the estrogen receptor than tamoxifen. Activation of tamoxifen to endoxifen is primarily due to the action of CYP2D6 [81]. Therefore, patients with defective CYP2D6 alleles derive less benefit from tamoxifen therapy than patients with functional copies of CYP2D6 [82]. The most common null allele among Caucasians is CYP2D6*4, a splice site mutation (G1934A) resulting in loss of enzyme activity [83] and, therefore, lack of conversion of TAM to endoxifen. This

PGx Applied to Oncology Cancer represents a complex set of deregulated cellular processes that are often the result of underlying molecular mechanisms. While there is recognized interindividual variability with respect to an observed chemotherapeutic response, it is also apparent that there is considerable cellular heterogeneity within a single tumor that may account for this lack of efficacy. It is becoming clear that molecular genetic variants significantly contribute to an individual’s response to a particular therapy of which some is due to polymorphisms in genes coding for drug-metabolizing enzymes. However, in the cancer patient the acquired genetics of the tumor cell must also be taken into account. Unlike traditional PGx testing, those tests for the cancer patient must be prepared to identify acquired or somatic genetic alterations that deviate from the underlying genome of the individual. 618

Figure 30.5 Immunohistochemical staining for the estrogen receptor in breast cancer.

Chapter 30


Tamoxifen CYP3A4/3A5

CYP2D6

4-OH Tamoxifen

N-desmethyl Tamoxifen

CYP3A4/3A5 Endoxifen

Anti-estrogenic effect in tumor cell

Figure 30.6 Simplified schematic diagram showing metabolism of tamoxifen by CYP450 enzymes with the resulting production of the active metabolite endoxifen.

would result in significantly decreased response to this commonly used antihormonal therapy. Common polymorphisms such as this make it feasible to accurately genotype patients so that treatments may be optimized.

HER2 The human epidermal growth factor receptor 2 (ERBB2 or HER2) gene is amplified in up to 25% of all breast cancers. While this gene can be expressed in low levels in a variety of normal epithelia, amplification of the HER2 gene is the primary mechanism of HER2 overexpression that results in increased receptor tyrosine kinase activity. HER2 status has been implemented as an indicator of both prognosis as well as a predictive marker for response to therapy such that HER2-positive breast cancers have a worse prognosis and are often resistant to hormonal therapies and other chemotherapeutic agents [84–86]. As a predictive marker, HER2 status is utilized to determine sensitivity to anthracycline-based chemotherapy regimens. Determination of HER2 status is also recognized as the first FDA-approved companion diagnostic since Trastuzumab (Herceptin), the first humanized monoclonal antibody against the HER2 receptor, was approved by the FDA in 1998 [87,88]. Introduction of this therapeutic into routine use made it necessary for laboratories to determine the HER2 status in breast cancer cells before patients would be eligible for treatment (Figure 30.7). Several FDA-cleared tests for immunohistochemical detection of HER2 protein and fluorescence in situ hybridization (FISH) detection of gene amplification are commercially available and approved as companion diagnostics for Herceptin therapy [89]. Recently, the American Society of Clinical Oncology and the

College of American Pathologists published guidelines for performing and interpreting HER2 testing [90]. These guidelines attempt to standardize HER2 testing by addressing preanalytical, analytical, and postanalytical variables that could lessen result variability due to technical and interpretative subjectivity.

TPMT Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that inactivates thiopurine drugs such as 6-mercaptopurine and azathioprine through methylation. Thiopurines are frequently used to treat childhood acute lymphoblastic leukemia [91]. Variability in activity levels of TPMT enzyme function exists between individuals, and it has been found that this variability can be attributed to polymorphisms of the TPMT gene [92,93]. The most common variant alleles, TPMT*2, TPMT*3A, and TPMT*3C, account for 95% of TPMT deficiency [94]. Molecular testing is a relatively convenient method for assessment of TPMT enzyme function in patients before treatment with thiopurines. Low TPMT activity levels could put a patient at risk for developing toxicity, since too much drug would be converted to 6-thioguanine nucleotides (6-TGNs), the cytotoxic active metabolite incorporated into DNA. On the other hand, a patient with high TPMT activity levels would need higher than standard doses of a thiopurine drug to respond well to the therapy, since a large amount of the drug is being inactivated before it can be converted to 6-TGNs [95].

EGFR The epidermal growth factor receptor (EGFR or HER1) is a member of the ErbB family of tyrosine kinases that also includes HER2. Once the ligand binds to the receptor, the receptor undergoes homodimerization or heterodimerization. This activation via phosphorylation initiates signaling to downstream pathways such as PI3K/AKT and RAS/RAF/MAPK which in turn regulates cell proliferation and apoptosis. EGFR is expressed in some lung cancers and is the target of newly developed small molecule drugs, including gefitinib and erlotinib. It has been shown that tumors that respond to these tyrosine kinase (TK) inhibitors (TKIs) contain somatic mutations in the EGFR TK domain [96–98]. Up to 90% of mutations in nonsmall cell lung cancers (NSCLC) can be attributed to two mutations, an inframe deletion of exon 19 and a single point mutation in exon 21 (T2573G). While these mutations are associated with a favorable response to the new TKIs, other mutations are associated with a poor response and potential resistance to these therapeutics (for example, in-frame insertion at exon 20 confers resistance). Mutation analysis in the EGFR represents a new application for molecular diagnostics as some mutations confer a favorable response, while others are not so favorable. It becomes critical to the management of the NSCLC patient that the clinical molecular diagnostics laboratory be able to identify such mutations on a routine basis. 619

Part V


A

B

Figure 30.7 (A) Determination of HER2 status in breast cancer cells using immunohistochemistry and (B) fluorescence in situ hybridization (FISH).

CONCLUSION Our knowledge base of PGx and clinical applications of such testing are progressing at record speeds. Technology is allowing us to perform these tests routinely in the clinical laboratory. Currently, PGx testing can be performed to detect polymorphisms in the genes for metabolizing enzymes and some drug targets. Clearly, one growing application in cancer patients is to detect polymorphisms and mutations associated with responses to newly developed small molecule targeted therapies. The ultimate goal of these efforts is to truly provide a “personalized medicine” approach to patient management for the purpose of eliminating ADRs, selecting more efficacious therapeutics, and improving the overall well-being of the patient.

11.

REFERENCES

17.

1. Lander ES, Linton LM, Birren B, et al. Initial sequencing and analysis of the human genome. Nature. 2001;409:860–921. 2. Venter JC, Adams MD, Myers EW, et al. The sequence of the human genome. Science. 2001;291:1304–1351. 3. Evans WE, McLeod HL. Pharmacogenomics—Drug disposition, drug targets, and side effects. N Engl J Med. 2003;348:538–549. 4. Kirchheiner J, Fuhr U, Brockmoller J. Pharmacogenetics-based therapeutic recommendations—Ready for clinical practice. Nat Rev Drug Discov. 2005;4(8):639–647. 5. Long RM. Planning for a national effort to enable and accelerate discoveries in pharmacogenetics: The NIH Pharmacogenetics Research Network. Clin Pharmacol Ther. 2007;81(3):450–454. 6. Shastry BS. Pharmacogenetics and the concept of individualized medicine. Pharmacogenomics J. 2006;6(1):16–21. 7. Bailey DS, Bondar A, Furness LM. Pharmacogenomics—It’s not just pharmacogenetics. Curr Opin Biotechnol. 1998;9(6):595–601. 8. de Leon J, Armstrong SC, Cozza KL. Clinical guidelines for psychiatrists for the use of pharmacogenetic testing for CYP450 2D6 and CYP450 2C19. Psychosomatics. 2006;47(1):75–85. 9. Weinshilboum R, Wang L. Pharmacogenomics: Bench to bedside. Nat Rev Drug Discov. 2004;3(9):739–748. 10. Tsongalis GJ, Coleman WB. Clinical genotyping: The need for interrogation of single nucleotide polymorphisms and mutations

620

12. 13.

14. 15. 16.

18.

19. 20. 21. 22. 23. 24. 25.

in the clinical laboratory. Clin Chim Acta. 2006;363(1–2): 127–137. Nebert DW, Ingelman-Sundberg M, Daly AK. Genetic epidemiology of environmental toxicity and cancer susceptibility: Human allelic polymorphisms in drug-metabolizing enzyme genes, their functional importance, and nomenclature issues. Drug Metab Rev. 1999;31(2):467–487. Lazarou J, Pomeranz BH, Corey PN. Incidence of adverse drug reactions in hospitalized patients: A meta-analysis of prospective studies. JAMA. 1998;279(15):1200–1205. Lee HK, Lewis LD, Tsongalis GJ, et al. Negative urine opioid screening caused by rifampin-mediated induction of oxycodone hepatic metabolism. Clin Chim Acta. 2006;367(1–2): 196–200. Vogel F. Moderne probleme der Humangenetik. Ergeb Inn Med Kinderheilkd. 1959;12:52–125. Nebert DW. Pharmacogenetics and pharmacogenomics: Why is this relevant to the clinical geneticist. Clin Genet. 1999;56 (4):247–258. Weber WW. Populations and genetic polymorphisms. Mol Diagn. 1999;4(4):299–307. Mager J, Glaser G, Razin A, et al. Metabolic effects of pyrimidines derived from fava bean glycosides on human erythrocytes deficient in glucose-6-phosphate dehydrogenase. Biochem Biophys Res Commun. 1965;20(2):235–240. Podda M, Fiorelli G, Ideo G, et al. In-vitro-effect of a fava bean extract and of its fractions on reduced glutathione in glucose-6phosphate dehydrogenase deficient red cells. Folia Haematol Int Mag Klin Morphol Blutforsch. 1969;91(1):51–55. Snyder L. Studies in human inheritance. The inheritance of taste deficiency in man. Ohio J Sci. 1932;32:436–468. Evans DA. N-acetyltransferase. Pharmacol Ther. 1989;42(2): 157–234. Alving AS, Carson PE, Flanagan CL, et al. Enzymatic deficiency in primaquine-sensitive erythrocytes. Science. 1956;124(3220): 484–485. Hammer W, Sjoqvist F. Plasma levels of monomethylated tricyclic antidepressants during treatment with imipramine-like compounds. Life Sci. 1967;6(17):1895–1903. Evans WE, Relling MV. Pharmacogenomics: Translating functional genomics into rational therapeutics. Science. 1999;286 (5439):487–491. Hughes HB, Biehl JP, Jones AP, et al. Metabolism of isoniazid in man as related to the occurrence of peripheral neuritis. Am Rev Tuberc. 1954;70:266–273. Kalow W. Familial incidence of low pseudocholinesterase level. Lancet. 1956;211:576–577.

Chapter 30


26. Weinshilboum R. Inheritance and drug response. N Engl J Med. 2003;348(6):529–537. 27. Linder MW, Prough RA, Valdes R, Jr. Pharmacogenetics: A laboratory tool for optimizing therapeutic efficiency. Clin Chem. 1997;43(2):254–266. 28. Schur BC, Bjerke J, Nuwayhid N, et al. Genotyping of cytochrome P450 2D6*3 and *4 mutations using conventional PCR. Clin Chim Acta. 2001;308(1–2):25–31. 29. Lucas T, Losert D, Allen M, et al. Combination allele-specific real-time PCR for differentiation of beta 2-adrenergic receptor coding single-nucleotide polymorphisms. Clin Chem. 2004;50 (4):769–772. 30. Jain KK. Applications of AmpliChip CYP450. Mol Diagn. 2005;9 (3):119–127. 31. Vairavan R. AutoGenomics, Inc. Pharmacogenomics. 2004;5(5): 585–588. 32. Bortolin S, Black M, Modi H, et al. Analytical validation of the tag-it high-throughput microsphere-based universal array genotyping platform: Application to the multiplex detection of a panel of thrombophilia-associated single-nucleotide polymorphisms. Clin Chem. 2004;50(11):2028–2036. 33. Gardiner SJ, Begg EJ. Pharmacogenetics, drug-metabolizing enzymes, and clinical practice. Pharmacol Rev. 2006;58(3):521–590. 34. Ingelman-Sundberg M. Pharmacogenetics of cytochrome P450 and its applications in drug therapy: The past, present and future. Trends Pharmacol Sci. 2004;25(4):193–200. 35. Ingelman-Sundberg M. Genetic polymorphisms of cytochrome P450 2D6 (CYP2D6): Clinical consequences, evolutionary aspects and functional diversity. Pharmacogenomics J. 2005;5(1):6–13. 36. Heim MH, Meyer UA. Evolution of a highly polymorphic human cytochrome P450 gene cluster: CYP2D6. Genomics. 1992;14(1): 49–58. 37. Ledesma MC, Agundez JA. Identification of subtypes of CYP2D gene rearrangements among carriers of CYP2D6 gene deletion and duplication. Clin Chem. 2005;51(6):939–943. 38. Andersson T, Flockhart DA, Goldstein DB, et al. Drug-metabolizing enzymes: Evidence for clinical utility of pharmacogenomic tests. Clin Pharmacol Ther. 2005;78(6):559–581. 39. D’Andrea G, D’Ambrosio R, Margaglione M. Oral anticoagulants: Pharmacogenetics relationship between genetic and nongenetic factors. Blood Rev. 2008;22(3):127–140. 40. Higashi MK, Veenstra DL, Kondo LM, et al. Association between CYP2C9 genetic variants and anticoagulation-related outcomes during warfarin therapy. JAMA. 2002;287(13):1690–1698. 41. Sanderson S, Emery J, Higgins J. CYP2C9 gene variants, drug dose, and bleeding risk in warfarin-treated patients: A HuGEnet systematic review and meta-analysis. Genet Med. 2005;7(2):97–104. 42. Li T, Chang CY, Jin DY, et al. Identification of the gene for vitamin K epoxide reductase. Nature. 2004;427(6974):541–544. 43. Rost S, Fregin A, Ivaskevicius V, et al. Mutations in VKORC1 cause warfarin resistance and multiple coagulation factor deficiency type 2. Nature. 2004;427(6974):537–541. 44. Gage BF, Eby C, Johnson JA, et al. Use of pharmacogenetic and clinical factors to predict the therapeutic dose of warfarin. Clin Pharmacol Ther. 2008;84(3):326–331. 45. Sconce EA, Khan TI, Wynne HA, et al. The impact of CYP2C9 and VKORC1 genetic polymorphism and patient characteristics upon warfarin dose requirements: Proposal for a new dosing regimen. Blood. 2005;106(7):2329–2333. 46. Wu AHB. Use of genetic and nongenetic factors in warfarin dosing algorithms. Pharmacogenomics. 2007;8(7):851–861. 47. Wu AHB, Wang P, Smith A, et al. Dosing algorithm for warfarin using CYP2C9 and VKORC1 genotyping from a multi-ethnic population: Comparison with other equations. Pharmacogenomics. 2008;9(2):169–178. 48. Zhu Y, Shennan M, Reynolds KK, et al. Estimation of warfarin maintenance dose based on VKORC1 (-1639 G>A) and CYP2C9 genotypes. Clin Chem. 2007;53(7):1199–1205. 49. Thompson CA. FDA encourages genetics-aided warfarin dosing. Am J Health Syst Pharm. 2007;64(19):1994–1996. 50. Wasserman E, Myara A, Lokiec F, et al. Severe CPT-11 toxicity in patients with Gilbert’s syndrome: Two case reports. Ann Oncol. 1997;8(10):1049–1051. 51. Hartmann JT, Lipp HP. Camptothecin and podophyllotoxin derivatives: Inhibitors of topoisomerase I and II — mechanisms

52. 53. 54. 55.

56. 57. 58.

59. 60.

61. 62.

63. 64.

65.

66.

67.

68. 69. 70. 71.

72.

of action, pharmacokinetics and toxicity profile. Drug Saf. 2006;29(3):209–230. Humerickhouse R, Lohrbach K, Li L, et al. Characterization of CPT-11 hydrolysis by human liver carboxylesterase isoforms hCE-1 and hCE-2. Cancer Res. 2000;60(5): 1189–1192. Maitland ML, Vasisht K, Ratain MJ. TPMT, UGT1A1 and DPYD: Genotyping to ensure safer cancer therapy. Trends Pharmacol Sci. 2006;27(8):432–437. Borst P, Schinkel AH, Smit JJ, et al. Classical and novel forms of multidrug resistance and the physiological functions of P-glycoproteins in mammals. Pharmacol Ther. 1993;60(2):289–299. Kusuhara H, Suzuki H, Sugiyama Y. The role of P-glycoprotein and canalicular multispecific organic anion transporter in the hepatobiliary excretion of drugs. J Pharm Sci. 1998;87(9): 1025–1040. Tanigawara Y. Role of P-glycoprotein in drug disposition. Ther Drug Monit. 2000;22(1):137–140. Ambudkar SV, Dey S, Hrycyna CA, et al. Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu Rev Pharmacol Toxicol. 1999;39:361–398. Urquhart BL, Tirona RG, Kim RB. Nuclear receptors and the regulation of drug-metabolizing enzymes and drug transporters: Implications for interindividual variability in response to drugs. J Clin Pharmacol. 2007;47(5):566–578. Higgins CF, Callaghan R, Linton KJ, et al. Structure of the multidrug resistance P-glycoprotein. Semin Cancer Biol. 1997;8(3): 135–142. Rosenberg MF, Callaghan R, Ford RC, et al. Structure of the multidrug resistance P-glycoprotein to 2.5 nm resolution determined by electron microscopy and image analysis. J Biol Chem. 1997;272(16):10685–10694. Sakaeda T, Nakamura T, Okumura K. MDR1 genotype-related pharmacokinetics and pharmacodynamics. Biol Pharm Bull. 2002;25(11):1391–1400. Hoffmeyer S, Burk O, von Richter O, et al. Functional polymorphisms of the human multidrug-resistance gene: Multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci USA. 2000;97(7):3473–3478. Jamroziak K, Robak T. Pharmacogenomics of MDR1/ABCB1 gene: The influence on risk and clinical outcome of haematological malignancies. Hematology. 2004;9(2):91–105. Jamroziak K, Balcerczak E, Cebula B, et al. No influence of 3435C>T ABCB1 (MDR1) gene polymorphism on risk of adult acute myeloid leukemia and P-glycoprotein expression in blast cells. Ther Drug Monit. 2006;28(5):707–711. Schaich M, Soucek S, Thiede C, et al. MDR1 and MRP1 gene expression are independent predictors for treatment outcome in adult acute myeloid leukaemia. Br J Haematol. 2005;128(3): 324–332. van der Holt B, Van den Heuvel-Eibrink MM, Van Schaik RH, et al. ABCB1 gene polymorphisms are not associated with treatment outcome in elderly acute myeloid leukemia patients. Clin Pharmacol Ther. 2006;80(5):427–439. van der Kolk DM, de Vries EG, Noordhoek L, et al. Activity and expression of the multidrug resistance proteins P-glycoprotein, MRP1, MRP2, MRP3 and MRP5 in de novo and relapsed acute myeloid leukemia. Leukemia. 2001;15(10):1544–1553. Kimchi-Sarfaty C, Oh JM, Kim IW, et al. A "silent" polymorphism in the MDR1 gene changes substrate specificity. Science. 2007;315 (5811):525–528. Rollason V, Samer C, Piguet V, et al. Pharmacogenetics of analgesics: Toward the individualization of prescription. Pharmacogenomics. 2008;9(7):905–933. Landau R, Cahana A, Smiley RM, et al. Genetic variability of muopioid receptor in an obstetric population. Anesthesiology. 2004;100(4):1030–1033. Bond C, LaForge KS, Tian M, et al. Single-nucleotide polymorphism in the human mu opioid receptor gene alters betaendorphin binding and activity: Possible implications for opiate addiction. Proc Natl Acad Sci USA. 1998;95(16):9608–9613. Fillingim RB, Kaplan L, Staud R, et al. The A118G single nucleotide polymorphism of the mu-opioid receptor gene (OPRM1) is associated with pressure pain sensitivity in humans. J Pain. 2005;6(3):159–167.

621

Part V


73. Janicki PK, Schuler G, Francis D, et al. A genetic association study of the functional A118G polymorphism of the human mu-opioid receptor gene in patients with acute and chronic pain. Anesth Analg. 2006;103(4):1011–1017. 74. Oertel B, Lotsch J. Genetic mutations that prevent pain: Implications for future pain medication. Pharmacogenomics. 2008;9(2): 179–194. 75. Landau R. Pharmacogenetics and obstetric anesthesia. Anesthesiol Clin. 2008;26(1):183–195, 8–9. 76. Shankar DB, Li J, Tapang P, et al. ABT-869, a multitargeted receptor tyrosine kinase inhibitor: Inhibition of FLT3 phosphorylation and signaling in acute myeloid leukemia. Blood. 2007;109 (8):3400–3408. 77. Goetz MP, Rae JM, Suman VJ, et al. Pharmacogenetics of tamoxifen biotransformation is associated with clinical outcomes of efficacy and hot flashes. J Clin Oncol. 2005;23(36):9312–9318. 78. van Schaik RH. CYP450 pharmacogenetics for personalizing cancer therapy. Drug Resist Updat. 2008;11(3):77–98. 79. Group E. Tamoxifen for early breast cancer: An overview of the randomised trials. Early Breast Cancer Trialists’ Collaborative Group. Lancet. 1998;351(9114):1451–1467. 80. Poon GK, Chui YC, McCague R, et al. Analysis of phase I and phase II metabolites of tamoxifen in breast cancer patients. Drug Metab Dispos. 1993;21(6):1119–1124. 81. Klein TE, Chang JT, Cho MK, et al. Integrating genotype and phenotype information: An overview of the PharmGKB project. Pharmacogenetics Research Network and Knowledge Base. Pharmacogenomics J. 2001;1(3):167–170. 82. Jin Y, Desta Z, Stearns V, et al. CYP2D6 genotype, antidepressant use, and tamoxifen metabolism during adjuvant breast cancer treatment. J Natl Cancer Inst. 2005;97(1):30–39. 83. Sachse C, Brockmoller J, Bauer S, et al. Cytochrome P450 2D6 variants in a Caucasian population: Allele frequencies and phenotypic consequences. Am J Hum Genet. 1997;60(2):284–295. 84. Press MF, Bernstein L, Thomas PA, et al. HER-2/neu gene amplification characterized by fluorescence in situ hybridization: Poor prognosis in node-negative breast carcinomas. J Clin Oncol. 1997;15(8):2894–2904. 85. Slamon DJ, Godolphin W, Jones LA, et al. Studies of the HER-2/ neu proto-oncogene in human breast and ovarian cancer. Science. 1989;244(4905):707–712. 86. Tandon AK, Clark GM, Chamness GC, et al. HER-2/neu oncogene protein and prognosis in breast cancer. J Clin Oncol. 1989; 7(8):1120–1128.

622

87. Jones SE. Metastatic breast cancer: The treatment challenge. Clin Breast Cancer. 2008;8(3):224–233. 88. Moasser MM. Targeting the function of the HER2 oncogene in human cancer therapeutics. Oncogene. 2007;26(46):6577–6592. 89. Laudadio J, Quigley DI, Tubbs R, et al. HER2 testing: A review of detection methodologies and their clinical performance. Expert Rev Mol Diagn. 2007;7(1):53–64. 90. Wolff AC, Hammond ME, Schwartz JN, et al. American Society of Clinical Oncology/College of American Pathologists guideline recommendations for human epidermal growth factor receptor 2 testing in breast cancer. J Clin Oncol. 2007;25(1):118–145. 91. Lennard L, Rees CA, Lilleyman JS, et al. Childhood leukaemia: A relationship between intracellular 6-mercaptopurine metabolites and neutropenia. 1983. Br J Clin Pharmacol. 2004;58(7):S867– 871; discussion S872–874. 92. Salavaggione OE, Wang L, Wiepert M, et al. Thiopurine S-methyltransferase pharmacogenetics: Variant allele functional and comparative genomics. Pharmacogenet Genomics. 2005;15(11):801–815. 93. Weinshilboum RM, Sladek SL. Mercaptopurine pharmacogenetics: Monogenic inheritance of erythrocyte thiopurine methyltransferase activity. Am J Hum Genet. 1980;32(5):651–662. 94. Yates CR, Krynetski EY, Loennechen T, et al. Molecular diagnosis of thiopurine S-methyltransferase deficiency: Genetic basis for azathioprine and mercaptopurine intolerance. Ann Intern Med. 1997;126(8):608–614. 95. Lennard L, Lilleyman JS, Van Loon J, et al. Genetic variation in response to 6-mercaptopurine for childhood acute lymphoblastic leukaemia. Lancet. 1990;336(8709): 225–229. 96. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 2004;350 (21):2129–2139. 97. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: Correlation with clinical response to gefitinib therapy. Science. 2004;304(5676):1497–1500. 98. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci USA. 2004;101(36):13306–13311.

Index

A ABCB1, polymorphisms and drug transport, 617 aCML, see Atypical chronic myelogenous leukemia Acquired immunodeficiency syndrome (AIDS), 300–301 ACTH, see Adrenocorticotropic hormone Acute lymphoblastic leukemia/lymphoma (ALL), 280–283 Acute myeloid leukemia (AML) ambiguous lineage, 279 t(15:7) translocation, 212–213 therapy-related disease alkylating agent induction, 279 topoisomerase II inhibitor induction, 279 types 11q23 abnormalities, 278 acute promyelocytic leukemia, 277–278 FLT3 mutation, 278 inv(16)(p13q22), 271–279 multilineage dysplasia, 278–279 not otherwise categorized, 279, 279t overview, 276–279 t(8:21)(q22:q22), 277 t(16:16)(p13q22), 277 Acute pancreatitis calcium signaling, 424–426, 426f clinical features, 421–426 pathophysiology, 421–423, 422f trypsin degradation, 424, 425f zymogen activation, 423–424 Acute promyelocytic leukemia (APL), 277–278 Adaptive immunity overview, 295–296 respiratory tract infection, 343 Adenovirus, respiratory infection, 349f Adrenal adenoma, 72f Adrenal gland anatomy, 450–454 congenital primary insufficiency, 451–453 hypercortisolism, see Cushing’s syndrome secondary insufficiency, 453–454 steroidogenesis pathways, 452f Adrenal hypoplasia congenita (AHC), 451 Adrenocorticotropic hormone (ACTH) Cushing’s syndrome, 454 resistance syndromes familial glucocorticoid deficiency, 453 triple A syndrome, 453 secondary adrenal insufficiency, 453 secretion regulation, 453 Adrenoleukodystrophy, 584

Adult respiratory distress syndrome, see Diffuse alveolar damage AHC, see Adrenal hypoplasia congenita AIDS, see Acquired immunodeficiency syndrome Akt, activation in melanoma, 543 ALL, see Acute lymphoblastic leukemia/ lymphoma All-trans retinoic acid (ATRA), acute myeloid leukemia management, 212–213 Alzheimer’s disease, 574, 574f AML, see Acute myeloid leukemia Anaplastic astrocytoma, 579f Androgen receptor, prostate cancer expression alterations, 491 transgenic mouse overexpression model, 495 Anemia, 271 Aneurysm, molecular pathogenesis, 235–236 Angelman syndrome, epigenetics, 153 Antibody, see also specific immunoglobulins classes and functions, 43t diversification mechanisms, 44–45, 45f, 45t structure and function, 292–294, 293f Anticipation, genetic, 100 Antithrombin, deficiency, 261–262 Aortic stenosis, calcified, 238, 238t APC mutation, see Familial adenomatous polyposis prostate cancer epigenetic changes, 493 APL, see Acute promyelocytic leukemia Apoptosis micrencephaly, 561 steatosis progression to nonalcoholic steatohepatitis, 405–406 Apoptosis Bcl2 family of proteins, 16f caspase types, 13t definition, 3 endoplasmic reticulum signals, 18 extrinsic pathway, 18 functions, 12–13 lysosome functions, 18–19 mitochondria cytochrome c release, 15 pathway regulation, 17 necrosis shared pathways, 16f, 19 signaling, 14–15, 14f, 15f structural features, 4, 4t, 5f survival pathways, 17–18 Arrhythmogenic right ventricular cardiomyopathy (ARVC), 241–242 Arteriosclerosis, central nervous system, 570f ARVC, see Arrhythmogenic right ventricular cardiomyopathy Asbestosis, 354, 354f

Aspergillus fumigatus, respiratory infection, 350, 351f Asthma bronchial hyperactivity, 326 clinical and pathologic features, 323–324, 324f inflammation, 325, 325f molecular pathogenesis, 324–326 type I hypersensitivity, 324–325 Atherosclerosis overview, 232–234 plaque composition, 234t rupture, 234t risk factors, 232t stages adaptation stage, 234 clinical stage, 234 plaque initiation and formation, 233–234 Atopic dermatitis clinical features, 531 clinicopathologic abnormalities, 533f forms, 531 linkage analysis, 532 molecular pathology, 532 ATRA, see All-trans retinoic acid Atypical chronic myelogenous leukemia (aCML), 273–274 Autism, 564 Autoimmune disease celiac disease, 303–304 diabetes type I, 302–303 multiple sclerosis, 303 systemic lupus erythematosus, 302 tolerance, 301–304 types, 303t Autosomal dominant hypocalcemia, 450 Autosomal dominant inheritance, 96 Autosomal recessive inheritance, 96–98 Axon guidance, 137–146, 563

B Bartter syndrome, type V, 450 Base excision repair (BER), DNA, 95 B-cell clonality assays clinical utility, 602 overview, 599–602 postanalytical considerations, 602 preanalytical considerations, 601–602 validation, 599–601 functional overview, 291 inflammation regulation, 33–34 neoplasms, 280–287, 281t

623

Index BCL2 expression in follicular lymphoma, 284 family of proteins, 16f BCR-ABL fusion diagnostic testing, 610–611, 610f, 611f, 611t leukemia, 273, 274, 274f Beckwith-Wiedemann syndrome (BWS), epigenetics, 153–154 BER, see Base excision repair Bernard Soulier Syndrome (BSS), 257 Bioinformatics data mining interpretation, 223 Orange, 223 R, 222–223 Weka, 223 database resources, 221–222 DNA microarrays, see DNA microarray overview, 220 Blastomyces dermatitidis, respiratory infection, 350, 350f Bleeding disorders, see Coagulation: Platelet disorders: Thrombophilia BMP, see Bone morphogenetic protein Bone morphogenetic protein (BMP), signaling, 340f BRAF, sporadic colorectal cancer mutations, 376 BRCA, mutations in breast and ovarian cancers, 77, 118–119 Breast cancer biomarkers estrogen receptor functions, 503–504 tamoxifen targeting, 504 testing, 504 HER-2 overview, 505 testing, 505–506, 507t trastuzumab targeting, 506 progesterone receptor, 504–506 proliferation biomarkers cyclin A, 507 cyclin D1, 507–508 cyclin E, 507 flow cytometry of S phase cells, 506 Ki67, 507 MIB1, 507 p27, 508 plasminogen activator inhibitor-1, 508 thymidine kinase, 507 topoisomerase II, 508 tritiated thymidine labeling, 506–507 urokinase plasminogen activator, 508 BRCA mutations, 77, 118–119 epidemiology, 501 gene expression profiling DNA microarray analysis and clinical outcomes, 142–146, 143f, 144f, 145f molecular classification of breast cancer, 509 principles, 509 prognosis prediction, 509–510 prospects, 512–513, 513t signatures, 511t site of recurrence prediction, 510–512 therapy response prediction, 512

624

histological type ductal carcinoma in situ, 502 invasive ductal carcinoma, 502 lobular neoplasia, 501, 502 histological grading, 503 perineural invasion, 503 preneoplastic lesions, 74f progression, 76f TNM classification, 503 vascular invasion, 502–503 Bronchial atresia/sequestration, 356, 356f Bronchiectasis clinical and pathologic features, 328–329 molecular pathogenesis, 329–331 Bruton’s disease, 298 BSS, see Bernard Soulier Syndrome Bullous pemphigoid, 536f Burkitt lymphoma, 285 BWS, see Beckwith-Wiedemann syndrome

C CAA, see Cerebral amyloid angiopathy Cachexia, cancer, 82 CADASIL, see Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukencephalopathy CAH, see Congenital adrenal hyperplasia Calcium homeostasis and parathyroid hormone, 447 signaling in acute pancreatitis, 424–426, 426f Calcium-sensing receptor (CaSR) gain-of-function mutations autosomal dominant hypocalcemia, 450 Bartter syndrome type V, 450 gene structure and expression distribution, 449–450 loss-of-function mutations familial hypocalciuric hypercalcemia, 450 neonatal severe primary hyperparathyroidism, 450 Calretinin, staining in malignant mesothelioma, 322f Cancer, see also specific cancers cellular differentiation and anaplasia, 78–79 classification of neoplastic diseases benign neoplasm, 71–72 childhood cancers, 75–76 hematopoietic neoplasms, 76–77 hereditary cancers, 77–78 malignant neoplasm, 72–73 mixed cell neoplasms, 73, 73f overview, 70–78 preneoplastic lesions, 74–75 terminology confusion, 73–74 clinical aspects cachexia, 82 grading and staging, 83 pain, 82 paraneoplastic syndromes, 82–83 epigenetics DNA hypomethylation, 154–155 histone modifications, 156

histone-modifying enzyme aberrations, 156–157, 157t microRNA epigenetic regulation, 156 tumor suppressor gene hypermethylation, 155f, 156 incidence and trends, 63–65, 64f, 66f local invasion, 80 metastasis, 80–82, 81f mortality, 64f, 65, 66f rate of growth, 79–80 risk factors age, race, and sex, 66–67 environmental and occupational exposure, 69 family history, 67 infectious agents, 68–69 lifestyle exposures, 69–70 overview, 65–70 Candidate gene approach, disease-related gene identification, 114 Capillary electrophoresis, FMR1 sizing analysis, 593, 594f Carbonyl stress, neuronal injury, 567 Cardiomyocyte, structure and function, 238–239 Cardiomyopathy arrhythmogenic right ventricular cardiomyopathy pathogenesis, 241–242 cardiomyocyte structure and function, 238–239 cytoskeletal defects, 240–241 dilated cardiomyopathy, 240 hypertrophic cardiomyopathy, 239–240 noncompaction cardiomyopathy pathogenesis, 242 sarcomeric defects, 241 Cardiovascular disease aneurysm, 235–236 atherosclerosis overview, 232–234 plaque composition, 234t rupture, 234t risk factors, 232t stages adaptation stage, 234 clinical stage, 234 plaque initiation and formation, 233–234 cardiomyopathy arrhythmogenic right ventricular cardiomyopathy pathogenesis, 241–242 cardiomyocyte structure and function, 238–239 cytoskeletal defects, 240–241 dilated cardiomyopathy, 240 hypertrophic cardiomyopathy, 239–240 noncompaction cardiomyopathy pathogenesis, 242 sarcomeric defects, 241 cells cardiac stem cell, 231–232 leukocytes, 229 overview, 228t progenitor/stem cells, 229–231

Index valve endothelial cell, 228 valve interstitial cell, 228–229, 228f, 230f, 230t vascular endothelial cell, 227–228 vascular smooth muscle cell, 228 channelopathies, 242 general molecular principles, 227 ischemic heart disease, 235, 235t lymphatic circulation, 242–243 valvular heart disease calcified aortic stenosis, 238, 238t connective tissue disorders, 236 mitral valve prolapse, 236 pathogenesis, 239f transforming growth factor-b dysregulation, 237–238, 237f vasculitis, 236 Caspase, types, 13t CaSR, see Calcium-sensing receptor Catechols, neuronal injury, 568 Cathepsin B, pancreatitis role, 423, 424 CBL, see Chronic basophilic leukemia cDNA, see Complementary DNA CEL, see Chronic eosinophilic leukemia Celiac disease, 303–304 Central nervous system (CNS) adult neurogenesis, 561 anatomy gross anatomy, 553, 553f microanatomy cerebrospinal fluid and ventricular system, 553 gray matter, 551–552, 552f white matter, 552, 552f compartmentalization of neurogenesis in embryo, 560 corpus callosum agenesis, 563, 564f injury carbonyl stress, 567 catechols, 568 excitotoxicity, 564–565, 565f free radical stress, 566, 566f innate immunity activation, 568 lipid peroxidation, 138f, 566 mitochondrial dysfunction, 565–566 intracranial hemorrhage, 571, 571t, 572f lissencephaly, 562, 563f micrencephaly apoptosis, 561 gliogenesis, 561 intermediate neural progenitor, 561 molecular pathology, 561 neuroepithelial cell, 560 radial glia, 560 myelin disorders demyelination acquired metabolic demyelination, 585 experimental autoimmune encephalitis, 585, 585t Marchiafava-Bignami disease, 586 multiple sclerosis, 584, 584f neuromyelitis optica, 585 progressive multifocal leukecephalopathy, 586, 586f leukodystrophies, 583–584 metabolism, 583f

neoplasia circumscribed glioma, 581 diffuse astrocytoma–glioblastoma sequence, 577–581, 578f, 579f, 580f diffuse glioma, 582–583 lymphoma, 583 medulloblastoma, 582, 582f metastasis, 583 oligodendroma, 581, 581f staging, 577 types, 578t neural differentiation, 561 neural tube defects, 556, 557f, 559–560 formation, 555–556, 555f, 556f holoprosencephaly, 557–558, 558f neurodegeneration diseases, 573–574, 573t etiology, 572 pathogenesis, 572–574, 573f neuronal migration, 562 neurotoxicants axonotoxicants, 576 domoic acid, 577 MPTP, 576, 576f neuropathology, 575 signaling centers and regional patterning, 555 stroke, 568–571, 568f, 569t, 570f synaptogenesis, refinement, and plasticity, 563 thanatophoric dysplasia, 558–560, 560f Cerebral amyloid angiopathy (CAA), 571, 572f Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukencephalopathy (CADASIL), 570, 570f Cerebrospinal fluid, 553 Cervical cancer epidemiology, 465–471 human papillomavirus association, 68, 465–466 oncoprotein activities E6, 469–470, 469f E7, 468–469, 469f genomic instability induction, 470–471 Pap smear of lesions, 467 progression, 68f, 468 CF, see Cystic fibrosis CFTR, see Cystic fibrosis CGD, see Chronic granulomatous disease CGH, see Comparative genomic hybridization Channelopathies, 242 Charcot-Leyden crystals, asthma, 324f CHARGE syndrome, epigenetics, 158 Chediak-Higashi syndrome, 258 Chemokines functional overview, 295 inflammation mediation, 27 innate immunity, 49f psoriatic plaques, 535 Chlamydia, respiratory infection, 346 Chronic basophilic leukemia (CBL), 276 Chronic bronchitis, see Chronic obstructive pulmonary disease

Chronic eosinophilic leukemia (CEL), 275–276 Chronic granulomatous disease (CGD), 299 Chronic idiopathic myelofibrosis (CIMF), 275 Chronic idiopathic neutropenia (CIN), 281 Chronic lymphocytic leukemia (CLL), 283–284 Chronic myeloid leukemia (CML) BCR-ABL fusion diagnostic testing, 610–611, 610f, 611f molecular pathology, 274, 274f therapeutic goals, 611t Chronic myelomonocytic leukemia (CMML), 273, 274f Chronic neutrophilic leukemia (CNL), 274–275 Chronic obstructive pulmonary disease (COPD) bronchiectasis clinical and pathologic features, 328–329 molecular pathogenesis, 329–331 emphysema/chronic bronchitis clinical and pathologic features, 326–327, 326f, 327f molecular pathogenesis, 327–328 pathogenesis, 329f Chronic pancreatitis clinical features, 426–430 gene mutations CFTR, 428t, 430 CTRC, 428t, 429 PRSS1, 427–428, 428t PRSS2, 428–429 SPINK1, 428t, 429–430 Churg-Strauss syndrome (CSS) clinical and pathologic features, 341, 342f molecular pathogenesis, 341–342 CIMF, see Chronic idiopathic myelofibrosis CIN, see Chronic idiopathic neutropenia Circumscribed glioma, 581 Cirrhosis, alcoholic liver disease mechanisms, 407–408 CJD, see Creutzfeldt-Jakob disease CLIA, see Clinical Laboratory Improvement Amendments Clinical Laboratory Improvement Amendments (CLIA), 591 CLL, see Chronic lymphocytic leukemia Clotting factor disorders, see Coagulation CLS, see Coffin-Lowry syndrome Cluster analysis, microarray data, 135–136 CML, see Chronic myeloid leukemia CMML, see Chronic myelomonocytic leukemia CNL, see Chronic neutrophilic leukemia CNS, see Central nervous system Coagulation cascade, 247–249, 248f, 249f clotting factor disorders clinical features, 250t factor V deficiency, 252 factor VII deficiency, 252–253 factor X deficiency, 253 factor XI deficiency, 253–254 factor XII deficiency, 254 factor XIII deficiency, 254

625

Index Coagulation (Continued ) fibrinogen abnormalities, 251 hemophilia types A and B, 253 high molecular weight kininogen deficiency, 254 multiple clotting factor deficiencies, 254–255 overview, 249–256 prekallikrein deficiency, 254 prothrombin deficiency, 251–252 von Willebrand disease, 255–256, 255t Web sites, 251t fibrinolysis disorders, 256 hemostatic levels and biochemical features of clotting factors, 252t Coccidiodes immitis, respiratory infection, 350–352, 350f Cockayne syndrome, epigenetics, 158 Coffin-Lowry syndrome (CLS), epigenetics, 159 COL17A1 molecular testing, 545 mutation in epidermolysis bullosa, 528, 529f target antigen in skin disease, 536, 538 Colorectal cancer familial cancers, see Familial adenomatous polyposis: Hereditary nonpolyposis colorectal cancer inflammatory bowel disease neoplasia diagnosis and management, 378 molecular mechanisms of progression, 376–378, 377f natural history, 376 sporadic cancer progression, 71f, 372–376, 373f, 374f, 375f Combined pituitary hormone deficiency (CPHD), gene mutations GLI2, 437–438 HESX1, 436–437 LHX3, 437 LHX4, 437 POUIF1, 437 PROP1, 437 Common variable immunodeficiency (CVID), 299 Comparative genomic hybridization (CGH), 603 Complement deficiency, 299 functional overview, 292, 293f inflammation mediation, 27 Staphylococcus aureus inhibition, 52 Complementary DNA (cDNA) libraries and data mining, 124 microarray analysis, see DNA microarray subtraction, 124, 125f Congenital adrenal hyperplasia (CAH) clinical features, 451 CYP17A1 mutations, 453 11b-hydroxylase deficiency, 442, 452 21-hydroxylase deficiency, 452 3b-hydroxysteroid dehydrogenase deficiency, 453 lipoid congenital adrenal hyperplasia, 453 Congenital amegakaryocytic thrombocytopenia, 257

626

Congenital pulmonary airway malformations (CPAM) clinical and pathologic features, 356 molecular pathogenesis, 356–357 Consanguinity, 101 COPD, see Chronic obstructive pulmonary disease Corpus callosum, agenesis, 563, 564f CPAM, see Congenital pulmonary airway malformations CPHD, see Combined pituitary hormone deficiency Creutzfeldt-Jakob disease (CJD), 572–574, 573f, 574f CSS, see Churg-Strauss syndrome CTRC, pancreatitis mutations, 428t, 429 Cushing’s syndrome, 454 Cutaneous T-cell lymphoma, molecular pathology and novel therapies, 545–549, 548f CVID, see Common variable immunodeficiency Cyclin A, breast cancer proliferation biomarker, 507 Cyclin D1, breast cancer proliferation biomarker, 507–508 Cyclin E, breast cancer proliferation biomarker, 507 CYP2C9, polymorphisms and drug metabolism, 616 CYP2D6, polymorphisms and drug metabolism, 616, 616t CYP17A1, mutations in congenital adrenal hyperplasia, 453 Cystic fibrosis (CF) cystic fibrosis transmembrane conductance regulator abnormal function, 214–215 function, 214 gene mutations, 117–118, 330 pancreatitis mutations, 428t, 430 diagnosis, 214 genetic testing, 102 gross features of lung, 330f pathophysiology, 215–216 Cytochrome c, release in apoptosis, 15 Cytokines, see also specific cytokines functional overview, 294 inflammatory cytokines in alcoholic liver disease, 407 psoriatic plaques, 535 Cytomegalovirus, respiratory infection, 349f

D DAD, see Diffuse alveolar damage DC, see Dendritic cell DCU, see Deep cortical unit Deep cortical unit (DCU), lymph node, 279 Delayed type hypersensitivity (DTH), 297 Dendritic cell (DC), functional overview, 292 Desmin, defects in cardiomyopathy, 240 Desmocollin, mutation in skin disease, 527–528 Desmoglein enzyme-linked immunosorbent assay, 550 mutation in skin disease, 529, 539f target antigen in skin disease, 538

Desmoplakin, mutation in skin disease, 530–538 Diabetes type I, 302–303 Diauxic shift, DNA microarray analysis in yeast, 137–146, 138f, 139f Diffuse alveolar damage (DAD) clinical and pathologic features, 333, 333f molecular pathogenesis, 333–334 Diffuse astrocytoma, 578–581, 578f, 579f, 580f, 581f Diffuse glioma, 582–583 Diffuse large B-cell lymphoma (DLBCL), 284–285 Dilated cardiomyopathy, molecular pathogenesis, 240 DLBCL, see Diffuse large B-cell lymphoma DNA gene structure, 90 inheritance modes, 96–101 mutation and genetic variation, 92–94 organization, 89, 90f, 109–111 repair, 95–96 replication, 94–95, 94t structure, 90, 91f, 110 transcription, 91–92 DNA methylation, see Epigenetics DNA microarray applications cancer pathogenesis and diagnosis, 139–141, 141t subtypes, 141–142, 142f diauxic shift in yeast, 137–146, 138f, 139f gene signatures, 146, 147f, 148f serum response in human cell culture, 138–139, 140f breast cancer gene expression profiling DNA microarray analysis and clinical outcomes, 142–146, 143f, 144f, 145f molecular classification of breast cancer, 509 principles, 509 prognosis prediction, 509–510 prospects, 512–513, 513t signatures, 511t site of recurrence prediction, 510–512 therapy response prediction, 512 data analysis challenges, 133–134 classification, 133–135, 134f cluster analysis, 135–136 cross-validation, 134 differential gene expression detection, 131–133 functional profiling, 136, 136f gene selection, 134 normalization, 131 plots, 131, 132f, 133f preprocessing, 131 visualization, 134–135 databases, 137 hybridization for two-color experiment, 128–130, 130f image analysis and data processing, 130 microarray production, 126–127 systems biology, 187, 187f

Index target RNA preparation laser microdissection, 127, 127f quality control, labeling, and target amplification, 127–128, 128f, 129f tumor tissue preparation, 127–128, 127f workflow, 126, 126f, 131f Domoic acid, neuropathology, 577 Double-strand break, DNA repair, 95 DTH, see Delayed type hypersensitivity Duncan’s syndrome, 300

E EAE, see Experimental autoimmune encephalitis EB, see Epidermolysis bullosa EBV, see Epstein-Barr virus EGFR, see Epidermal growth factor receptor Ehler-Danlos syndrome, mitral valve prolapse, 236 ELA2, mutations in neutropenia, 281 Emphysema clinical and pathologic features, 326–327, 326f, 327f molecular pathogenesis, 327–328 Endometrial cancer, see Uterine cancer Endoplasmic reticulum (ER), apoptosis signals, 18 Endothelium function, 229t shear stress-regulated factors, 229t valve endothelial cell, 228 vascular endothelial cell, 227–228 Enterovirus, reverse-transcriptase-polymerase chain reaction for diagnosis clinical utility, 596–597 hybridization probes kit, 596 overview, 595–597 postanalytical considerations, 596 preanalytical considerations, 596 validation, 596 Epidermal growth factor receptor (EGFR), see also specific receptors combination therapy targeting, 170, 171 lung cancer mutations, 313 therapeutic targeting, 309t oncology pharmacogenomics, 619 Epidermolysis bullosa (EB), 525, 526f, 527, 527f, 528f, 529f Epigenetics cancer colorectal cancer, 376 DNA hypomethylation, 154–155 Helicobacter pylori gastric cancer induction, 368–369 histone modifications, 156 histone-modifying enzyme aberrations, 156–157, 157t microRNA epigenetic regulation, 156 prostate cancer APC, 493 GSTP1, 493 tumor suppressor gene hypermethylation, 155f, 156

diseases aberrant epigenetic genes, 158 aberrant epigenetic profiles, 157–158 DNA methylation-associated diseases, 159 histone modification alteration, 159–160 environmental influences, 160 gestational trophoblastic diseases, 478, 478t Human Epigenetic Project, 151–152 imprinting diseases, 153–154 gene regulation, 152 overview, 98–99 Epstein-Barr virus (EBV) cancer association, 68 lymphocytosis, 280 ER, see Endoplasmic reticulum: Estrogen receptor Erdheim-Chester disease clinical and pathologic features, 353–354 molecular pathogenesis, 354 Essential thrombocythemia (ET), 275 Estrogen receptor (ER) breast cancer tamoxifen targeting, 504 testing, 504 functions, 503–504 oncology pharmacogenomics, 618–619, 618f ET, see Essential thrombocythemia Etiology, definition, 197 Excitotoxicity, neuronal injury, 564–565, 565f Experimental autoimmune encephalitis (EAE), 585, 586t

F Factor V, deficiency, 252 Factor V Leiden, 261 Factor VII, deficiency, 252–253 Factor X, deficiency, 253 Factor XI, deficiency, 253–254 Factor XII, deficiency, 254 Factor XIII, deficiency, 254 Fallopian tube cancer, 476 Familial adenomatous polyposis (FAP) clinical and pathologic features, 382–383 diagnosis and management, 383–386 genetics, 382 molecular mechanisms, 382–383, 384f, 385f natural history, 382–383 Familial glucocorticoid deficiency, 453 Familial hypocalciuric hypercalcemia (FHH), 450 Familial isolated hyperparathyroidism, 448 Familial isolated hypoparathyroidism, 447–448 Familial nonautoimmune hyperthyroidism, thyroid-stimulating hormone receptor activating mutations, 446, 446t FAP, see Familial adenomatous polyposis Fas, liver injury role, 401–402, 401f FDC, see Follicular dendritic cell FGF, see Fibroblast growth factor FHH, see Familial hypocalciuric hypercalcemia

Fibrinogen, abnormalities, 251 Fibrinolysis, disorders, 256 Fibroblast growth factor (FGF), receptor mutations in thanatophoric dysplasia, 559–560 Fibrolamellar hepatocellular cancer, 412 Fibrosis alcoholic liver disease mechanisms, 407–408 transforming growth factor-b mediation, 35t Filaggrin, skin disease role, 532, 533f FLI1, mutations in platelet disorders, 257 FLT3 mutation in acute myeloid leukemia, 278 polymorphisms, 618 FMR1, see Fragile X syndrome FNH, see Focal nodular hyperplasia Focal nodular hyperplasia (FNH), 409 Follicle-stimulating hormone (FSH) isolated deficiency, 457 receptor mutations activating mutations in precocious puberty, 459 ovarian dysgenesis, 458 Follicular dendritic cell (FDC), lymph node, 279 Follicular lymphoma, 284 Fragile X syndrome, FMR1 analysis for diagnosis overview, 593–595 sizing analysis capillary electrophoresis, 593, 594f clinical utility, 594–595 postanalytical considerations, 594 statistical analysis, 593–594 Southern blot analysis, 595f FSH, see Follicle-stimulating hormone Fumarase, mutation in skin disease, 545 Functional gene cloning, disease-related gene identification, 114, 115f

G Gastric cancer Helicobacter pylori induction epigenetic changes, 368–369 evidence, 365–366 gastritis and mucosal changes in carcinoma progression, 366, 367f gene expression changes and mutations, 368–369, 369–370, 370f hereditary diffuse gastric cancer genetic testing, 371–372 genetics, 370–371 management, 371–372 molecular mechanisms, 371 natural history, 371 pathology, 371 preneoplastic lesions, 74f GATA-1, mutations in platelet disorders, 257 GATA3, parathyroid development role, 448 GBM, see Glioblastoma multiforme Gene deletion, 117 duplication, 117–119 inversion, 116–117 structure, 90, 90f

627

Index Gene expression profiling breast cancer DNA microarray analysis and clinical outcomes, 142–146, 143f, 144f, 145f molecular classification of breast cancer, 509 principles, 509 prognosis prediction, 509–510 prospects, 512–513, 513t signatures, 511t site of recurrence prediction, 510–512 therapy response prediction, 512 complementary DNA libraries and data mining, 124 subtraction, 124, 125f differential display polymerase chain reaction, 125 DNA microarray applications breast cancer clinical outcomes, 142–146, 143f, 144f, 145f cancer pathogenesis and diagnosis, 139–141, 141t cancer subtypes, 141–142, 142f diauxic shift in yeast, 137–146, 138f, 139f gene signatures, 146, 147f, 148f serum response in human cell culture, 138–139, 140f data analysis challenges, 133–134 classification, 133–135, 134f cluster analysis, 135–136 cross-validation, 134 differential gene expression detection, 131–133 functional profiling, 136, 136f gene selection, 134 normalization, 131 plots, 131, 132f, 133f preprocessing, 131 visualization, 134–135 databases, 137 hybridization for two-color experiment, 128–130, 130f image analysis and data processing, 130 microarray production, 126–127 target RNA preparation laser microdissection, 127, 127f quality control, labeling, and target amplification, 127–128, 128f, 129f tumor tissue preparation, 127–128, 127f workflow, 126, 126f, 131f early studies, 123–124 molecular diagnostics, 603 serial analysis of gene expression, 125–126 Gene networks, disease, 192, 193f Genetic testing, see also Molecular diagnostics benefits, 103 diagnostic versus predictive, 101–102 familial adenomatous polyposis, 384f hereditary diffuse gastric cancer, 371–372 hereditary nonpolyposis colorectal cancer, 379–382, 381f

628

interpretation, 105–107 mutation scanning, 105 risks, 103 specific mutation detection, 104–105, 104t test selection considerations, 103–104 Genome Human Genome Project disease-related gene identification, 113–115 findings and status, 112–113 objectives and strategy, 112 overview, 111–113 timeline, 112f structure chromosomal organization, 110–111 overview, 110 subchromosomal organization, 111 variation sources, 115–116, 116f Genotyping hepatitis C virus, see Hepatitis C virus systems biology, 187–188 techniques, 615–616, 615f GH, see Growth hormone GHRH, see Growth hormone-releasing hormone Glanzmann thromboblasthenia, 257 GLI2, mutation in combined pituitary hormone deficiency, 437–438 Glioblastoma diffuse astrocytoma–glioblastoma sequence, 578–581, 578f, 579f, 580f genetic alterations, 579f molecular pathways in gliomagenesis, 580f Glioblastoma multiforme (GBM), pathology, 219, 220 Glucocorticoids, generalized resistance/ insensitivity, 454 Glycoprotein VI, deficiency, 258 GnRH, see Gonadotropin-releasing hormone Gonadotropin-releasing hormone (GnRH), receptor mutations and isolated hypogonadotropic hypogonadism, 456 Gorlin syndrome, 540 GPS, see Gray platelet syndrome Grading, cancer, 83 Granulocyte, functional overview, 292 Gray platelet syndrome (GPS), 258 Growth hormone (GH) hypersecretion, 439 isolated deficiency, 438–439 receptor mutations, 439 Growth hormone-releasing hormone (GHRH), receptor mutations, 438 GSTP1, prostate cancer epigenetic changes, 493

H Haemophilus influenzae, respiratory infection, 306 Hamartin, signaling, 336f Hamartoma, lung, 320f HAX-1, mutations in neutropenia, 281 HBV, see Hepatitis B virus

HCC, see Hepatocellular cancer HCV, see Hepatitis C virus HD, see Huntington disease HDGC, see Hereditary diffuse gastric cancer Helicobacter pylori, gastric cancer induction epigenetic changes, 368–369 evidence, 365–366 gastritis and mucosal changes in carcinoma progression, 366, 367f gene expression changes and mutations, 368–369, 369–370, 370f Hemangioma, liver, 408–409 Hematopoiesis cell types, 267f differentiation and signaling, 268–269, 269f hematopoietic stem cell, 265, 268f overview, 266f transcription factors, 265–268 Hemolytic uremic syndrome (HUS), 259 Hemophilia, types A and B, 253 Heparin-induced thrombocytopenia (HIT), 260 Hepatic adenoma, 409 Hepatic steatosis, see Nonalcoholic fatty liver disease Hepatic stellate cell (HSC), fibrosis/cirrhosis mechanisms, 407–408 Hepatitis B virus (HBV), liver cancer risks, 68 Hepatitis C virus (HCV) clinical course, 211 discovery, 209–210 genotyping clinical utility, 598–599 overview, 597–599 postanalytical considerations, 598 preanalytical considerations, 598 statistical analysis, 591–593 validation, 597–598 liver cancer risks, 68 pathogenesis, 210 risk factors, 210 strains, 210 testing for infection, 210–211 treatment guided treatment, 211–212 interferon, 211 ribavirin, 211 Hepatoblastoma, 409–412, 410f Hepatocellular cancer (HCC), 410–412, 411f Hepsin, prostate cancer in transgenic mouse overexpression model, 495–496 HER-2 amplification detection, 608, 609f breast cancer biomarker overview, 505 testing, 505–506, 507t trastuzumab targeting, 506 oncology pharmacogenomics, 619, 620f Hereditary diffuse gastric cancer (HDGC) genetics, 370–371 genetic testing, 371–372 management, 371–372 molecular mechanisms, 371 natural history, 371 pathology, 371

Index Hereditary nonpolyposis colorectal cancer (HNPCC) clinical and pathologic features, 379 diagnosis and management, 379–382, 381f gene mutations, 119, 378–382 molecular mechanisms, 379 natural history, 379 Heredity anticipation, 100 consanguinity, 101 genetic testing benefits, 103 diagnostic versus predictive, 101–102 interpretation, 105–107 mutation scanning, 105 risks, 103 specific mutation detection, 104–105, 104t test selection considerations, 103–104 Mendelian inheritance autosomal dominant inheritance, 96 autosomal recessive inheritance, 96–98 overview, 96–98, 97t X-linked dominant inheritance, 98 X-linked dominant male lethal inheritance, 98 X-linked recessive inheritance, 98 Y-linked inheritance, 98 mosaicism, 142–146 non-Mendelian inheritance imprinting, 98–99 mitochondrial DNA, 99 multifactorial inheritance, 99 sporadic inheritance, 99 penetrance, 99–100, 102t pleiotropy, 100 preferential marriage between affected individuals, 101 sex-influenced disorders, 100 sex-limited disorders, 100 variable expressivity, 100 Hermansky-Pudlak syndrome, 258 Herpes simplex virus (HSV) immune system evasion strategies, 55–57 inherited susceptibility to herpes encephalitis, 300 interferon response, 57t lesion histopathology, 56f respiratory infection, 349f HESX1, mutation in combined pituitary hormone deficiency, 436–437 HGP, see Human Genome Project High molecular weight kininogen (HK), deficiency, 254 Histone, see Epigenetics Histoplasma capsulatum, respiratory infection, 349–350, 350f Histotechnology, historical perspective of pathology, 206–207 HIT, see Heparin-induced thrombocytopenia HIV, see Human immunodeficiency virus HK, see High molecular weight kininogen HNPCC, see Hereditary nonpolyposis colorectal cancer Hodgkin’s lymphoma, 286–287, 286f Holoprosencephaly, 557–558, 558f, 559f

HPV, see Human papillomavirus HSC, see Hepatic stellate cell HSV, see Herpes simplex virus Human Epigenetic Project, 151–152 Human Genome Project (HGP) disease-related gene identification, 113–115 findings and status, 112–113 objectives and strategy, 112 overview, 111–113 timeline, 112f Human immunodeficiency virus (HIV) acquired immunodeficiency syndrome, 300–301 cell invasion, 58–60 immune system dysfunction, 61t evasion strategies, 57–60 molecular diagnostics, 606, 607 opportunistic infection, 60f pathogenesis, 59f structure, 57, 58f Human papillomavirus (HPV) cervical cancer association, 68, 465–466 diagnosis and treatment of lesions, 467 genome, 466f infection and life cycle, 466–467 oncoprotein activities E6, 469–470, 469f E7, 468–469, 469f genomic instability induction, 470–471 Pap smear of lesions, 467 prophylaxis, 467–468 transformation mechanisms, 468 Huntington disease (HD), genetic testing, 102 HUS, see Hemolytic uremic syndrome 11b-Hydroxylase, deficiency in congenital adrenal hyperplasia, 442, 452 21-Hydroxylase, deficiency in congenital adrenal hyperplasia, 452 3b-Hydroxysteroid dehydrogenase, deficiency in congenital adrenal hyperplasia, 453 Hyper-IgM syndrome, 298–299, 299t Hyperparathyroidism familial isolated hyperparathyroidism, 448 jaw tumor syndrome, 449 multiple endocrine neoplasia type 1, 448–449 type 2, 449 Hypersensitivity reactions overview, 296–297, 296t type I, 296–297 type II, 297 type III, 297 type IV, 297 Hypertrophic cardiomyopathy, molecular pathogenesis, 239–240 Hypoparathyroidism familial isolated hypoparathyroidism, 447–448 syndrome association, 448 Hypothyroidism central congenital hypothyroidism, 440–441 congenital disease, 440–444 thyroid dyshormonogenesis, 441–444

I IAPs, see Inhibitor of apoptosis proteins ICAM-1, see Intracellular adhesion molecule-1 ICF syndrome, see Immunodeficiencycentromeric instability-facial anomalies syndrome Ichthyosis vulgaris, 532 IGF1, see Insulin-like growth factor-1 IL-10, see Interleukin-10 IL-13, see Interleukin-13 Immune system adaptive immunity, 295–296 antibody classes and functions, 43t, 294t components antibody structure and function, 292–294, 293f B-cell, 291 chemokines, 295 complement, 292, 293f cytokines, 294 dendritic cell, 292 granulocyte, 292 macrophage, 292 major histocompatibility complex, 294 natural killer cell, 292 T-cell, 291–292 Toll-like receptor, 295 disorders, see Autoimmune disease: Hypersensitivity reactions: Immunodeficiency innate immunity, 295 pathogen evasion strategies herpes simplex virus, 55–57 human immunodeficiency virus, 57–60 Mycobacterium tuberculosis, 52–55 overview, 43, 60–61 Staphylococcus aureus, 48–52 trypanosome, 43–48 regulation of immunity, 43 structure of immune response, 41–42, 42t T-cell receptor, 294 Immunodeficiency acquired immunodeficiency syndrome, 300–301 infections, 298t primary immunodeficiency Bruton’s disease, 298 chronic granulomatous disease, 299 common variable immunodeficiency, 299 complement deficiency, 299 Duncan’s syndrome, 300 hyper-IgM syndrome, 298–299, 299t inherited susceptibility herpes encephalitis, 300 tuberculosis, 300 overview, 298–300 severe combined immunodeficiency, 299t, 300 Immunodeficiency-centromeric instabilityfacial anomalies (ICF) syndrome, epigenetics, 159 Immunoglobulin E, allergy role, 33 Immunology, historical perspective of pathology, 201–203

629

Index Imprinting diseases, 153–154 gene regulation, 152 overview, 98–99 Indel definition, 94 diseases, 116–117 Inflammation acute inflammation disease pathogenesis, 28 regulation, 31–32 asthma, 325, 325f chronic inflammation B-cell regulation, 33–34 chronic disease exacerbation, 34 diseases, 32 T-cell regulation, 32–33, 32f leukocytes chemoattractants, 27–28 endothelial adhesion molecules, 25–26 pattern recognition receptors cytoplasmic pathogen receptors, 30, 30f, 31f pathologic consequences, 30–31 Toll-like receptors, 29, 29f steatosis progression to nonalcoholic steatohepatitis, 405 tissue remodeling in disease interleukin-10, 37 interleukin-13, 36–37 overview, 34–37, 35f transforming growth factor-b, 35–36 tumor necrosis factor-a, 36, 36t Inflammatory bowel disease, neoplasia diagnosis and management, 378 molecular mechanisms of progression, 376–378, 377f natural history, 376 Inhibitor of apoptosis proteins (IAPs), types and functions, 17 Innate immunity activation in neuronal injury, 567 overview, 295 respiratory tract infection, 342–343 Insulin-like growth factor-1 (IGF1) deficiency, 439 growth regulation, 439 Interferons hepatitis C virus management, 211 herpes simplex virus response, 57t Interleukin-10 (IL-10) anti-inflammatory activity, 31 tissue remodeling in inflammatory disease, 37 Interleukin-13 (IL-13), tissue remodeling in inflammatory disease, 36–37 Intermediate neural progenitor, 561 apoptosis, 561 gliogenesis, 561 Interstitial lung disease diffuse alveolar damage clinical and pathologic features, 333, 333f molecular pathogenesis, 333–334 lymphangioleiomatosis clinical and pathologic features, 334–335, 334f molecular pathogenesis, 334–335

630

pulmonary alveolar proteinosis clinical and pathologic features, 337–338, 337f, 339f molecular pathogenesis, 338 sarcoidosis clinical and pathologic features, 335, 337f molecular pathogenesis, 335–337 usual interstitial pneumonia clinical and pathologic features, 331, 332f molecular pathogenesis, 331–333 Intracellular adhesion molecule-1 (ICAM-1), leukocyte–endothelial adhesion, 25 Intracranial hemorrhage, 571–572, 571t, 571f Ironotecan, metabolism, 617f Ischemia/reperfusion injury mitochondrial permeability transition in pH-dependent reperfusion injury, 8 necrosis, 8 Ischemic heart disease, molecular pathogenesis, 235, 235t

J JAM-A, leukocyte–endothelial adhesion, 26 JMML, see Juvenile myelomonocytic leukemia JUB, mutation in skin disease, 529 Juvenile myelomonocytic leukemia (JMML), 273

K Kallmann’s syndrome autosomal dominant syndrome and KAL2 mutations, 456 X-linked syndrome and KAL1 mutations, 455 Keratin, gene mutations, 525, 526, 526f, 527f Ki67, breast cancer proliferation biomarker, 507 KIT, melanoma mutations, 543 Klebsiella pneumoniae, respiratory infection, 346 KRAS, lung cancer mutations, 313 endometrial cancer mutations, 473 sporadic colorectal cancer mutations, 375

L Lacunar infarct, 570f LAM, see Lymphangioleiomatosis Lamin A/C, defects in cardiomyopathy, 241 Laminin, gene mutations, 527, 528f Laser capture microdissection (LCM) DNA microarray samples, 127, 127f principles, 167f protein microarray samples, 165–174 Late-onset Alzheimer’s disease (LOAD), 574 LCM, see Laser capture microdissection LEF-1, deficiency in neutropenia, 281 Legionella pneumophila, respiratory infection, 345, 345f Leukemia antigen profiles in diagnosis, 282f signaling pathways, 268–269, 269f

Leukocytes, inflammation chemoattractants, 27–28 endothelial adhesion molecules, 25–26 Leukotrienes, inflammation mediation, 27 Leydig cell hypoplasia, luteinizing hormone receptor mutations, 457 LH, see Luteinizing hormone LHX3, mutation in combined pituitary hormone deficiency, 437 LHX4, mutation in combined pituitary hormone deficiency, 437 Li-Fraumeni syndrome, tumors, 77 Lipid peroxidation, neuronal injury, 138f, 567 Lipoid congenital adrenal hyperplasia, 453 Lissencephaly, 561–563, 563f Liver adult stem cells, 399–400, 400f alcoholic liver disease alcohol metabolism, 406–407 fibrosis/cirrhosis mechanisms, 407–408 inflammatory cytokines, 407 lipid-metabolizing gene expression changes with chronic exposure, 406–407 benign tumors focal nodular hyperplasia, 409 hemangioma, 408–409 hepatic adenoma, 409 development, 395–397, 396f hepatocyte death Fas-activation-induced liver injury, 401–402, 401f tumor necrosis factor-a-induced liver injury, 402 malignant tumors hepatoblastoma, 409–412, 410f hepatocellular cancer, 410–412, 411f nonalcoholic fatty liver disease hepatic steatosis development, 402–404, 403f overview, 402–406 steatosis progression to nonalcoholic steatohepatitis apoptosis, 405–406 inflammation, 405 mitochondrial dysfunction, 405 oxidative stress, 404–405 regeneration, 397–399 LOAD, see Late-onset Alzheimer’s disease Lower respiratory tract infection, see Respiratory tract infection Lung cancer adenocarcinoma clinical and pathologic features, 311–313, 312f, 313f gross features, 311f molecular pathogenesis, 313–314, 314t classification, 305, 306t epidemiology, 305 evaluation, 306 large cell carcinoma clinical and pathologic features, 317, 317f molecular pathogenesis, 317 malignant mesothelioma, pleural clinical and pathologic features, 321–322, 322f gross features, 321f molecular pathogenesis, 322–323

Index mesenchymal neoplasm, 320–321 neuroendocrine neoplasms clinical and pathologic features, 317–319, 318f, 319f molecular pathogenesis, 319–320 oncogenic pathways and targeted therapies, 308–311, 308f, 309t, 310f squamous cell carcinoma clinical and pathologic features, 314–316 gross features, 315f histologic and molecular changes in oncogenesis, 316f invasive carcinoma, 315f, 316f molecular pathogenesis, 316–317 staging and prognosis, 307, 307t Luteinizing hormone (LH) isolated deficiency, 457 receptor mutations activating mutations in precocious puberty, 458, 459 Leydig cell hypoplasia, 457 Lymphadenopathy, 280 Lymphangioleiomatosis (LAM) clinical and pathologic features, 334–335, 334f molecular pathogenesis, 334–335 Lymphatic circulation, diseases, 242–243 Lymph node, structure and function, 269–271, 270f Lymphocyte disorders acute lymphoblastic leukemia/lymphoma, 280–283 Burkitt lymphoma, 285 chronic lymphocytic leukemia, 283–284 diffuse large B-cell lymphoma, 284–285 follicular lymphoma, 284 Hodgkin’s lymphoma, 286–287, 286f lymphadenopathy, 280 lymphocytosis, 280 lymphopenia, 279–280 multiple myeloma, 285–286 neoplasms, 280–287, 281t Lymphocytosis, 280 Lymphoma antigen profiles in diagnosis, 274f central nervous system, 583 Lymphopenia, 279–280 Lynch syndrome, see Hereditary nonpolyposis colorectal cancer

M Macrophage functional overview, 292 Mycobacterium tuberculosis interactions, 53–54, 53f MADCAM1, leukocyte–endothelial adhesion, 26 Major histocompatibility complex (MHC), 294 Marchiafava-Bignami disease, 586 Marfan syndrome, 236 Mass spectrometry (MS) multiple reaction monitoring, 178, 179f protein biomarker discovery and validation, 177–180 proteomics analytical workflow, 178f

Matrix metalloproteinases (MMPs), tissue remodeling in inflammatory disease, 35 MCT8, mutations in thyroid resistance, 445 MDA5, inflammation role, 30 MDS, see Myelodysplastic syndromes Medulloblastoma, 582–583, 582f Melanoma familial disease, 77 molecular pathology, 542, 543, 544 targeted therapies, 543f MEN, see Multiple endocrine neoplasia Mendelian inheritance autosomal dominant inheritance, 96 autosomal recessive inheritance, 96–98 overview, 96–98, 97t X-linked dominant inheritance, 98 X-linked dominant male lethal inheritance, 98 X-linked recessive inheritance, 98 Y-linked inheritance, 98 Metachromic leukodystrophy, 583 Metastasis brain, 583 features, 80–82, 81f MGUS, see Monoclonal gammopathy of undetermined significance MHC, see Major histocompatibility complex MIB1, breast cancer proliferation biomarker, 507 Micrencephaly apoptosis, 561 gliogenesis, 561 intermediate neural progenitor, 561 molecular pathology, 561–562 neuroepithelial cell, 561 radial glia, 561 Microarray, see DNA microarray: Protein microarray MicroRNA epigenetic regulation, 156 gastric cancer role, 370 lung cancer oncogenesis role, 311 prostate cancer and dysregulation, 492–493 Microscopic polyangiitis (MPA), pulmonary vasculitides, 341 Microscopy, historical perspective of pathology, 200 Mismatch repair (MMR), DNA, 95 Missense mutation, definition, 94 Mitochondria apoptosis cytochrome c release, 15 pathway regulation, 17 mitochondrial DNA inheritance, 99 necrosis injury and ATP depletion, 7, 7f permeability transition, 8–10, 9f, 10f uncoupling, 7 neuronal injury and dysfunction, 564 permeability transition pore models, 9f steatosis progression to nonalcoholic steatohepatitis, 405 Mitral valve prolapse, molecular pathogenesis, 236 MMPs, see Matrix metalloproteinases MMR, see Mismatch repair

Molecular diagnostics, see also Genetic testing BCR-ABL fusion diagnostic testing, 610–611, 610f, 611f, 611t Clinical Laboratory Improvement Amendments, 591 enterovirus disease reverse-transcriptasepolymerase chain reaction diagnosis clinical utility, 596–597 hybridization probes kit, 596 overview, 595–597 postanalytical considerations, 596 preanalytical considerations, 596 validation, 596 fragile X syndrome and FMR1 analysis overview, 593–595 sizing analysis capillary electrophoresis, 593, 594f clinical utility, 594–595 postanalytical considerations, 594 statistical analysis, 593–594 Southern blot analysis, 595f hepatitis C virus genotyping clinical utility, 598–599 overview, 597–599 postanalytical considerations, 598 preanalytical considerations, 598 statistical analysis, 591–593 validation, 597–598 historical perspective, 605–606 infectious disease, 606–607, 607t, 608t lymphocyte clonality assays clinical utility, 602 overview, 599–602 postanalytical considerations, 602 preanalytical considerations, 601–602 validation, 599–601 method validation, 592 phases qualitative analysis, 607, 608f quantitative analysis, 607–609, 608t resistance testing, 609–610 proficiency testing, 592 prospects, 602–603 quality assurance and control, 592 regulatory agencies, 591–592 Monoclonal gammopathy of undetermined significance (MGUS), 285 Mosaicism, 142–146 MPA, see Microscopic polyangiitis MPTP, neuropathology, 576, 576f MS, see Mass spectrometry: Multiple sclerosis Mucous membrane pemphigoid, 537, 538f Multiple endocrine neoplasia (MEN) type 1, 448–449 type 2, 449 Multiple myeloma, 285–286 Multiple sclerosis (MS), 303, 584, 584f MYC, prostate cancer expression alterations, 490 transgenic mouse overexpression model, 495 Mycobacterium tuberculosis adaptive immunity, 54–55, 54f immune system evasion strategies, 52–55 macrophage interactions, 53–54, 53f respiratory infection, 346–347, 347f

631

Index Mycoplasma pneumoniae, respiratory infection, 346 Myelodysplastic syndromes (MDS), 272–273 Myelodysplastic/myeloproliferative disease, unclassifiable, 273–274 Myeloid disorders acute myeloid leukemia ambiguous lineage, 279 therapy-related disease alkylating agent induction, 279 topoisomerase II inhibitor induction, 279 types 11q23 abnormalities, 278 acute promyelocytic leukemia, 277–278 FLT3 mutation, 278 inv(16)(p13q22), 271–279 multilineage dysplasia, 278–279 not otherwise categorized, 279, 279t overview, 276–279 t(16:16)(p13q22), 277 t(8:21)(q22:q22), 277 anemia, 271 myelodysplastic/myeloproliferative diseases atypical chronic myelogenous leukemia, 273–274 chronic basophilic leukemia, 276 chronic eosinophilic leukemia, 275–276 chronic idiopathic myelofibrosis, 275 chronic myeloid leukemia, 274, 274f chronic myelomonocytic leukemia, 273, 274f chronic neutrophilic leukemia, 274–275 essential thrombocythemia, 275 juvenile myelomonocytic leukemia, 273 myelodysplastic/myeloproliferative disease, unclassifiable, 273–274 overview, 273–276 polycythemia vera, 275 stem cell leukemia-lymphoma syndrome, 276 systemic mastocytosis, 276 unclassified myeloproliferative disorder, 276 myelodysplastic syndromes, 272–273 neutropenia, 271–272 MYH9, mutations in platelet disorders, 256 Myocardial infarction, healing stages, 235t

N NAFLD, see Nonalcoholic fatty liver disease NAIT, see Neonatal alloimmune thrombocytopenia Nanotechnology, cancer early diagnosis and drug delivery, 180–181, 180f Natural killer (NK) cell, functional overview, 292 Necrosis, see also Oncotic necrosis apoptosis shared pathways, 16f, 19 definition, 3, 11f metastable state preceding cell death, 5–7, 6f

632

mitochondria injury and ATP depletion, 7, 7f permeability transition, 8–10, 9f, 10f uncoupling, 7 plasma membrane injury, 12 poly(ADP-ribose) polymerase role, 10 structural features, 3, 4f, 4t, 5f Neonatal alloimmune thrombocytopenia (NAIT), 259 Neonatal severe primary hyperparathyroidism (NSHPT), 450 Neoplasia, see Cancer NER, see Nucleotide excision repair Neural tube defects, 556, 557f, 559–560 formation, 555–556, 555f, 556f holoprosencephaly, 557–558, 558f, 559f Neuroblastoma, childhood, 75, 76f Neurodegeneration, see Central nervous system Neuroepithelial cell, 560 Neuromyelitis optica, 585 Neutropenia, 271–272 Neutrophil, Staphylococcus aureus association and inhibition, 48f, 51 NIS, thyroid dyshormonogenesis mutations, 441 NK cell, see Natural killer cell NKX3.1, prostate cancer and expression alterations, 490–491 Nocardia asteroides, respiratory infection, 346, 346f Nod receptors, inflammation role, 30 Nonalcoholic fatty liver disease (NAFLD) hepatic steatosis development, 402–404, 403f overview, 402–406 steatosis progression to nonalcoholic steatohepatitis apoptosis, 405–406 inflammation, 405 mitochondrial dysfunction, 405 oxidative stress, 404–405 Noncompaction cardiomyopathy, pathogenesis, 242 Nonsense mutation, definition, 94 Nontuberculous mycobacteria, respiratory infection, 347–348, 348t Normalization, microarray data, 131 NOTCH, signaling, 281, 283f NRAS, melanoma mutations, 543 NSHPT, see Neonatal severe primary hyperparathyroidism Nucleotide excision repair (NER), DNA, 95

O OHSS, see Ovarian hyperstimulation syndrome Oligodendroma, 581–582, 581f Oncosis, see Oncotic necrosis Oncotic necrosis definition, 3 structural features, 3, 4f, 4t, 5f OPRM1, polymorphisms, 618 Orange, data mining, 223

Organic chemistry, historical perspective of pathology, 200–201 Ovarian cancer borderline tumors, 474 epithelial ovarian tumors, 475, 476 fallopian tube cancer, 476 gene mutations in sporadic tumors, 475t germ cell cancer, 476 stromal cancer, 476 Ovarian cysts, benign, 474 Ovarian hyperstimulation syndrome (OHSS), 459 Oxidative stress iron-catalyzed free radical generation, 12f necrosis role, 9 neuronal injury carbonyl stress, 567–568 free radical stress, 566–567, 566f innate immunity activation, 567 lipid peroxidation, 138f, 566 steatosis progression to nonalcoholic steatohepatitis, 404–405

P p27kip1 breast cancer proliferation biomarker, 508 prostate cancer and expression alterations, 492 p53, cell cycle regulation, 310f p63, skin development role, 523, 523f, 524 PAI-I, see Plasminogen activator inhibitor-1 Pain, cancer, 82 Pancreatic cancer, malignant neoplasm, 72f Pancreatitis, see Acute pancreatitis: Chronic pancreatitis PAP, see Pulmonary alveolar proteinosis Paraneoplastic syndromes, 82–83 Parathyroid gland calcium homeostasis regulation, 447 calcium sensing, see Calcium-sensing receptor cells, 446–450 Parathyroid hormone, see Hyperparathyroidism: Hypoparathyroidism PARP, see Poly(ADP-ribose) polymerase Pathology definition, 197 diagnostics, 197, 198, 198f historical perspective of approach to disease cellular pathology and infectious pathogens, 200 current practice, 203–206 histotechnology, 206–207 immunology, 201–203 microscopy, 200 natural product chemistry, 202–203 organic chemistry, 200–201 pre-scientific revolution, 198–199 scientific revolution, 199–200 prospects computer-based prognosis, 206 drug metabolism, 207 nucleic acid sequencing and RNA abundance screening, 206

Index rapid cytogenetics, 206 reference databases, 206–207 serum biomarkers, 207 transplant patients, 206 PCA, see Principal components analysis PCOS, see Polycystic ovary syndrome PCR, see Polymerase chain reaction PECAM1, leukocyte–endothelial adhesion, 26 Pemphigus vulgaris, 536f Pendred’s syndrome, 441, 442 Pendrin, thyroid dyshormonogenesis mutations, 441, 442 Penetrance, 99–100, 102t Peptidome, see Proteomics Periventricular heterotopia, 562, 563f Personalized medicine, see also Pharmacogenomics paradigm compared with current medical practice, 614f prospects, 603 Pharmacogenomics ABCB1 transporter polymorphisms, 617 drug target polymorphisms FLT3, 618 OPRM1, 618 drug-metabolizing enzyme polymorphic alleles CYP2C9, 616 CYP2D6, 616, 616t overview, 614t uridine diphosphate glucuronosyltransferases, 616 genotyping techniques, 615–616, 615f historical perspective, 614–615 oncology pharmacogenomics epidermal growth factor receptor, 619 estrogen receptor, 618–619, 618f HER2, 619, 620f thiopurine S-methyltransferase, 619 overview, 613–619, 614f tissue-based techniques, 603 Phenylketonuria (PKU), gene mutations, 118 Pituitary, see also Combined pituitary hormone deficiency: specific hormones hypopituitarism, 436 ontogenesis, 435 PKP1, mutation in skin disease, 529, 530f PKP2, mutation in skin disease, 529 PKU, see Phenylketonuria Plaque, see Atherosclerosis Plasminogen activator inhibitor-1 (PAI-I), breast cancer proliferation biomarker, 508 Platelet disorders destruction disorders antibody-mediated destruction, 259 heparin-induced thrombocytopenia, 260 thrombotic microangiopathies, 259–260 function disorders adhesion, 257 aggregation, 257–258 alpha granules, 258 dense granules, 258–259 Scott syndrome, 259 secretion, 258

MYH9 mutations, 256 thrombocytopenia, 257 transcription factor mutations FLI1, 257 GATA-1, 257 RUNX1, 257 PLCH, see Pulmonary Langerhans cell histiocytosis Pleomorphism, dysplasia, 75, 75f, 79f PML, see Progressive multifocal leukecephalopathy PML-RARa fusion, acute myeloid leukemia, 212–213 Pneumocystis jirovecci, respiratory infection, 351, 352f Pneumonia, see Respiratory tract infection Poly(ADP-ribose) polymerase (PARP) degradation in apoptosis, 4, 18 necrosis role, 10 Polycythemia vera (PV), 275 Polycystic ovary syndrome (PCOS), 474 Polymerase chain reaction (PCR) differential display polymerase chain reaction, 125 enterovirus and reverse-transcriptasepolymerase chain reaction diagnosis clinical utility, 596–597 hybridization probes kit, 596 overview, 595–597 postanalytical considerations, 596 preanalytical considerations, 596 validation, 596 Polymicrogyria, 563, 563f Positional candidate gene approach, disease-related gene identification, 114–115, 115f Positional gene cloning, disease-related gene identification, 114, 114f, 115t Post-transfusion purpura, 259 POUIF1, mutation in combined pituitary hormone deficiency, 437 PR, see Progesterone receptor Prader-Willi syndrome, epigenetics, 153 Precocious puberty, 458–459 Preeclampsia, genetic basis, 480–481 Pregnancy gestational trophoblastic diseases epigenetic changes, 478, 478t immunology, 478, 479t neoplasia detection, 479 oncogene/tumor suppressor gene alterations, 478–479 overview, 477–479 preeclampsia genetic basis, 480–481 trophoblast invasion, 477, 479, 480t Prekallikrein, deficiency, 254 Prenatal diagnosis, fetal DNA in maternal serum, 603 Principal components analysis (PCA), DNA microarray analysis, 135f Prion disease, 572–574, 573f, 574f Progesterone receptor (PR), breast cancer biomarker, 504–506 Progressive multifocal leukecephalopathy (PML), 586, 586f PROP1, mutation in combined pituitary hormone deficiency, 437

Prostate cancer epigenetic changes APC, 493 GSTP1, 493 gene expression alterations androgen receptor, 491 MYC, 490 NKX3.1, 490–491 p27kip1, 492 PTEN, 491 telomerase, 492 TMPRSS2-ETS gene fusion, 492 heredity, 490 microRNA dysregulation, 492–493 mouse models androgen receptor overexpression, 495 hepsin overexpression, 495–496 MYC overexpression, 495 overview, 494–496 PTEN knockout mouse, 494–495 RB knockout mouse, 495 progression, 489–490 Protein kinase G, mitochondria permeability transition protection, 10 Protein microarray combination therapy investigations, 170–173 forward phase array, 169, 170 molecular network analysis of cancer, 170 patient-tailored therapy, 168–170, 169f pre-analytical variables, 172f reverse phase array, 169, 170 tissue dynamics, 173, 173f Proteomics clinical practice and patient care challenges, 166t prospects in cancer, 181 laser capture microdissection, 165–174, 167f mass spectrometry analytical workflow, 178f peptidome hypothesis, 175–176, 176f protein markers bias in discovery, 177 discovery and validation, 177–180 formalin fixation limitations, 173–174 phosphoprotein stability, 174 physiologic roadblocks to biomarker discovery, 176 requirements for diagnostics, 176–177 stability, 171, 172 protein microarray combination therapy investigations, 170–173 forward phase array, 169, 170 molecular network analysis of cancer, 170 patient-tailored therapy, 168–170, 169f pre-analytical variables, 172f reverse phase array, 169, 170 tissue dynamics, 173, 173f serum proteomics for early cancer detection, 174–175 systems biology, 188 two-dimensional gel electrophoresis, 167 Prothrombin, deficiency, 251–252

633

Index PRSS1, pancreatitis mutations, 427–428, 428t PRSS2, pancreatitis mutations, 428–429 Pseudomonas aeruginosa, respiratory infection, 345–346, 345f Pseudoxanthoma elasticum, 525 Psoriasis clinical features, 533 molecular pathology, 535 risk factors, 534 therapeutic targets, 534f PTCH, mutation in basal cell carcinoma, 540, 541f, 542 PTEN, prostate cancer expression alterations, 491 knockout mouse model, 494–495 Puberty delayed puberty hypergonadotropic hypogonadism, 457–458 hypogonadotropic hypogonadism, 455–457 hormonal changes, 454–459 precocious puberty, 458–459 Pulmonary alveolar proteinosis (PAP) clinical and pathologic features, 337–338, 337f, 339f molecular pathogenesis, 338 Pulmonary disease, see also Asthma: Chronic obstructive pulmonary disease: Cystic fibrosis: Interstitial lung disease: Lung cancer: Pulmonary hypertension: Respiratory tract infection developmental abnormalities bronchial atresia/sequestration, 356, 356f congenital pulmonary airway malformations clinical and pathologic features, 356 molecular pathogenesis, 356–357 surfactant dysfunction disorders clinical and pathologic features, 357 molecular pathogenesis, 357–358 histiocytic diseases, see Erdheim-Chester disease: Pulmonary Langerhans cell histiocytosis occupational disease, see Asbestosis: Silicosis vasculitides clinical and pathologic features, 341, 341f, 342f molecular pathogenesis, 341–342 Pulmonary hypertension classification, 338 clinical and pathologic features, 338–339, 339f molecular pathogenesis, 339–341 Pulmonary Langerhans cell histiocytosis (PLCH) clinical and pathologic features, 352–353, 353f molecular pathogenesis, 353 PV, see Polycythemia vera

Q Quebec platelet syndrome, 258

634

R R, data mining, 222–223 Radial glia, 560 Rb, see Retinoblastoma protein Reactive oxygen species, see Oxidative stress Red neuron, 568f Reed-Sternberg cell, 286, 286f Regeneration, liver, 397–399 Regulatory T-cell (Treg), 302 Respiratory tract infection adaptive immunity, 343 anatomic defenses, 342 clinical and pathological features Aspergillus fumigatus, 350, 351f Blastomyces dermatitidis, 350, 350f Chlamydia, 346 Coccidiodes immitis, 350–352, 350f Haemophilus influenzae, 306 Histoplasma capsulatum, 349–350, 350f Klebsiella pneumoniae, 346 Legionella pneumophila, 345, 345f Mycobacterium tuberculosis, 346–347, 347f Mycoplasma pneumoniae, 346 Nocardia asteroides, 346, 346f nontuberculous mycobacteria, 347–348, 348t Pneumocystis jirovecci, 351, 352f Pseudomonas aeruginosa, 345–346, 345f Staphylococcus aureus, 306, 344f clinical overview, 343–344 granuloma, 343 innate immunity, 342–343 soluble mediators, 342 viruses, 348, 348t, 349f Retinoblastoma protein (Rb) cell cycle regulation, 310f function, 115f knockout mouse as prostate cancer model, 495 Rett syndrome, epigenetics, 159 Ribavirin, hepatitis C virus management, 211 RIG-I, inflammation role, 30 RNA microarray analysis, see DNA microarray transcription, 91–92 translation, 92 types, 91t RSTS, see Rubinstein-Taybi syndrome Rubinstein-Taybi syndrome (RSTS), epigenetics, 159 RUNX1 mutations myelodysplastic syndromes, 281 platelet disorders, 257

S SAGE, see Serial analysis of gene expression Sarcoglycan, defects in cardiomyopathy, 241 Sarcoidosis, lung clinical and pathologic features, 335, 337f molecular pathogenesis, 335–337 Schimke immunoosseous dysplasia (SIOD), epigenetics, 158 Schizophrenia, 563

SCID, see Severe combined immunodeficiency SCLL, see Stem cell leukemia-lymphoma syndrome SCN, see Severe chronic neutropenia Scott syndrome, 259 Semantic Web, systems biology, 189 Serial analysis of gene expression (SAGE), 125–126 Severe chronic neutropenia (SCN), 281 Severe combined immunodeficiency (SCID), 299t, 300 Sex-influenced disorders, 100 Sex-limited disorders, 100 Shh, see Sonic hedgehog Silent mutation, definition, 94 Silicosis clinical and pathologic features, 355–356, 355f molecular pathogenesis, 355–356 Single nucleotide polymorphism (SNP), see also Pharmacogenomics cytochrome P450 polymorphic alleles, 614t definition, 92 genotyping, 187–188 SIOD, see Schimke immunoosseous dysplasia Skin barrier function, 519–522, 520f burden of disease, 519 immune sentinels, 522f Langerhans cell function, 521, 521f molecular diagnosis of disease, 544–545, 546f molecular pathology inflammatory skin disease, 531–535 Mendelian genetic disorders, 525–531 p63 in development, 523, 523f, 524 stem cells, 524, 525, 525f target antigens, 535–539 Skin cancer epidemiology, 539 melanoma molecular pathology, 542, 543, 544 targeted therapies, 543f PTCH mutation in basal cell carcinoma, 540, 541f, 542 risk factors, 534 Sonic hedgehog signaling, 540, 541f SLE, see Systemic lupus erythematosus SM, see Systemic mastocytosis SNP, see Single nucleotide polymorphism Sonic hedgehog (Shh), signaling, 540, 541f Sotos syndrome, epigenetics, 160 Southern blot, FMR1 analysis, 595f SPINK1, pancreatitis mutations, 428t, 429–430 Spleen, function, 269 SREBP, alcohol effects in liver, 406 Staging cancer, 83 lung cancer, 307, 307t Staphylococcus aureus complement inhibition, 52 cytolytic toxins, 51–52 immune system evasion strategies, 48–52 innate immunity, 48–50

Index neutrophil association and inhibition, 48f, 51 superantigens, 52 virulence factors, 50t Staphylococcus aureus, respiratory infection, 306, 344f Stem cell leukemia-lymphoma syndrome (SCLL), 276 Stroke, 568–571, 568f, 569t, 570f Surfactant dysfunction disorders clinical and pathologic features, 357 molecular pathogenesis, 357–358 Synaptophysin, lung carcinoid staining, 319f Systemic lupus erythematosus (SLE), 302 Systemic mastocytosis (SM), 276 Systems biology data generation DNA microarrays, 187, 187f genotyping, 187–188 proteomics, 188 transcriptomics, 187 data integration, 188–189 disease implications gene networks, 192, 193f personalized medicine, 191–192 redefining diseases, 191 modeling systems, 189–190, 190f overview, 185–186 paradigm shift, 186

T Tamoxifen breast cancer management, 504 metabolism, 619f TAR, see Thrombocytopenia with absent radii T-cell clonality assays clinical utility, 602 overview, 599–602 postanalytical considerations, 602 preanalytical considerations, 601–602 validation, 599–601 functional overview, 291–292 inflammation regulation, 32–33, 32f neoplasms, 280–287, 281t receptor, 294 regulatory T-cell, 302 Telomerase, 492 TG, see Thyroglobulin TGF-b, see Transforming growth factor-b a-Thalassemia X-linked mental retardation syndrome (ATRX), epigenetics, 158 Thanatophoric dysplasia, 558–560, 560f Thiopurine S-methyltransferase (TPMT), oncology pharmacogenomics, 619 THOX2, see Thyroid oxidase-2 Thrombocytopenia with absent radii (TAR), 257 Thrombophilia antithrombin deficiency, 261–262 factor V Leiden, 261 protein C deficiency, 260 protein C/S pathway, 260–261 protein S deficiency, 261 Thrombosis, central nervous system, 569f

Thrombotic thrombocytopenic purpura (TTP), 259 Thymidine kinase (TK), breast cancer proliferation biomarker, 507 Thymus, function, 269 Thyroglobulin (TG), thyroid dyshormonogenesis mutations, 444 Thyroid, see also Hypothyroidism familial nonautoimmune hyperthyroidism, 446, 446t functional overview, 439–446 hypothalamic-pituitary-thyroid axis, 436f Thyroid hormone dyshormonogenesis mutations NIS, 441 pendrin, 441, 442 thyroglobulin, 444 thyroid oxidase-2, 442, 443, 443t, 444, 444t thyroid peroxidase, 442, 443t resistance receptor mutations, 445 transporter mutations, 445–446 Thyroid oxidase-2 (THOX2), thyroid dyshormonogenesis mutations, 442, 443, 444, 444t Thyroid peroxidase (TPO), thyroid dyshormonogenesis mutations, 442, 443t Thyroid-stimulating hormone (TSH) mutations, 440 receptor activating mutations in familial nonautoimmune hyperthyroidism, 446, 446t inactivating mutations, 441 Thyroid transcription factor-1 (TTF-1), staining in lung adenocarcinoma, 313, 314f TK, see Thymidine kinase TLR, see Toll-like receptor TMPRSS2-ETS, gene fusion in prostate cancer, 492 TNF-a, see Tumor necrosis factor-a Tolerance, autoimmune disease, 301–304 Toll-like receptor (TLR) chronic disease exacerbation, 34 functional overview, 295 inflammation role, 29, 29f types, 29, 49t virus recognition, 55 Topoisomerase II breast cancer proliferation biomarker, 508 inhibitors and acute myeloid leukemia induction, 279 TPMT, see Thiopurine S-methyltransferase TPO, see Thyroid peroxidase Transcriptomics, systems biology, 187 Transforming growth factor-b (TGF-b) anti-inflammatory activity, 31 fibrosis mediation in disease, 35t tissue remodeling in inflammatory disease, 35–36 valvular heart disease dysregulation, 237–238, 237f Translation, protein, 92 Trastuzumab, breast cancer management, 506 Treg, see Regulatory T-cell

Triple A syndrome, 453 Trophoblastic diseases, see Pregnancy Trypanosomes blood smear, 44f immune system evasion strategies, 43–48 serum resistance factors, 48 surface glycoprotein diversity, 46–48, 46f, 47f TSG, see Tumor suppressor gene TSH, see Thyroid-stimulating hormone TTF-1, see Thyroid transcription factor-1 TTP, see Thrombotic thrombocytopenic purpura Tuberculosis, inherited susceptibility, 300 Tuberin, signaling, 336f Tumor necrosis factor-a (TNF-a) cancer cachexia role, 82 liver injury role, 402 tissue remodeling in inflammatory disease, 36, 36t Tumor suppressor gene (TSG) hypermethylation in cancer, 155f, 156 therapeutic targeting in lung cancer, 309t

U UMPD, see Unclassified myeloproliferative disorder Unclassified myeloproliferative disorder (UMPD), 276 uPA, see Urokinase plasminogen activator Uridine diphosphate glucuronosyl transferases, polymorphisms and drug metabolism, 616 Urokinase plasminogen activator (uPA), breast cancer proliferation biomarker, 508 Usual interstitial pneumonia clinical and pathologic features, 331, 332f molecular pathogenesis, 331–333 Uterine cancer classification, 471 endometroid endometrial cancer, 472, 473 epidemiology, 471 hyperplasia, 471, 472 mesenchymal tumors, 473 Type II endometrial cancers, 473

V Vaginal carcinoma, 477 Valvular heart disease calcified aortic stenosis, 238, 238t cells endothelial cell, 228 interstitial cell, 228–229, 228f, 230f, 230t leukocytes, 229 connective tissue disorders, 236 mitral valve prolapse, 236 pathogenesis, 239f transforming growth factor-b dysregulation, 237–238, 237f Variable number of tandem repeats (VNTRs), definition, 92 Vascular cell adhesion molecule-1 (VCAM-1), leukocyte–endothelial adhesion, 25

635

Index Vascular endothelial growth factor (VEGF), therapeutic targeting in lung cancer, 308f, 309t, 311 Vasculitides, pulmonary clinical and pathologic features, 341, 341f, 342f molecular pathogenesis, 341–342 Vasculitis, molecular pathogenesis, 236 VCAM-1, see Vascular cell adhesion molecule-1 VEGF, see Vascular endothelial growth factor VIN, see Vulvar intraepithelial neoplasia Vinculin, defects in cardiomyopathy, 241 VNTRs, see Variable number of tandem repeats

636

von Willebrand disease, 255–256, 255t Vulvar intraepithelial neoplasia (VIN), 477

W Wegener’s granulomatosis (WG) clinical and pathologic features, 341, 341f molecular pathogenesis, 341–342 Weka, data mining, 223 WG, see Wegener’s granulomatosis Wiskott-Aldrich syndrome, 257 Wnt familial adenomatous polyposis signaling, 384f neural tube formation role, 555

X X-linked agammaglobulineia, see Bruton’s disease X-linked dominant inheritance, 98 X-linked dominant male lethal inheritance, 98 X-linked proliferative disease, see Duncan’s syndrome X-linked recessive inheritance, 98

Y Y-linked inheritance, 98

Molecular Pathology: The Molecular Basis of Human Disease

Molecular Basis of Human Nutrition

Molecular Basis Of Human Nutrition

Molecular Basis Of Human Nutrition

Molecular basis of health and disease

Molecular Basis of Health and Disease

Molecular Basis of Hematopoiesis

Principles of Molecular Pathology

Molecular Basis of Symbiosis

Molecular Basis of Hematopoiesis

Principles of molecular pathology

Principles of Molecular Pathology

Molecular Pathology of the Prions

The molecular basis of cancer

The Molecular Basis of Cancer

Molecular Pathology of the Prions

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular pathology of the pituitary

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases (Molecular Pathology Library)

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases, Volume 1 (Molecular Pathology Library)

Molecular Pathology of Liver Diseases (Molecular Pathology Library, Volume 5)

Basic Concepts of Molecular Pathology (Molecular Pathology Library)

Molecular Pathology of Endocrine Diseases, Volume 3 (Molecular Pathology Library)

Molecular Pathology Protocols

Molecular Endocrinology (Human Molecular Genetics)

Molecular Genetic Pathology

Molecular Pathology Protocols

Molecular Pathology of Gynecologic Cancer

Molecular Pathology: The Molecular Basis of Human Disease

Molecular Basis of Human Nutrition

Molecular Basis Of Human Nutrition

Molecular Basis Of Human Nutrition

Molecular basis of health and disease

Molecular Basis of Health and Disease

Molecular Basis of Hematopoiesis

Principles of Molecular Pathology

Molecular Basis of Symbiosis

Molecular Basis of Hematopoiesis

Principles of molecular pathology

Principles of Molecular Pathology

Molecular Pathology of the Prions

The molecular basis of cancer

The Molecular Basis of Cancer

Molecular Pathology of the Prions

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular pathology of the pituitary

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases (Molecular Pathology Library)

Molecular Pathology of Hematolymphoid Diseases (Molecular Pathology Library)

Molecular Pathology of Lung Diseases, Volume 1 (Molecular Pathology Library)

Molecular Pathology of Liver Diseases (Molecular Pathology Library, Volume 5)

Basic Concepts of Molecular Pathology (Molecular Pathology Library)

Molecular Pathology of Endocrine Diseases, Volume 3 (Molecular Pathology Library)

Molecular Pathology Protocols

Molecular Endocrinology (Human Molecular Genetics)

Molecular Genetic Pathology

Molecular Pathology Protocols

Molecular Pathology of Gynecologic Cancer

Recommend Documents