MOLECULAR GENETIC PATHOLOGY
MOLECULAR GENETIC PATHOLOGY Edited by
LIANG CHENG, MD Professor of Pathology and Urology...
213 downloads
2560 Views
62MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
MOLECULAR GENETIC PATHOLOGY
MOLECULAR GENETIC PATHOLOGY Edited by
LIANG CHENG, MD Professor of Pathology and Urology Director of Molecular Pathology Laboratory Chief of Genitourinary Pathology Division Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School of Medicine, Indianapolis, IN
DAVID
Y. ZHANG, MD, PhD, MPH
Associate Professor of Pathology Director, Molecular Pathology Laboratory Department of Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY
,\1',
"'1\'
Humana Press
Preface
We have had the opportunity to witness both the beginning and the subsequent growth of an exciting specialty that combines both pathology and medical genetics, a field commonly referred to as molecular genetic pathology. The birth of this specialty took place in 1988 when Kari Mullis developed a new DNA amplification technology called the polymerase chain reaction (PCR). Within a few years, this technology was no longer being used exclusively in research laboratories. The technique had found numerous new applications in clinical medicine as a tool for diagnosis and diseases monitoring. The use of PCR technology has greatly expanded the specialties of anatomic and clinical pathology and has increased the availability of genetic testing in the clinical setting. We expect that such advances as the completion of the Human Genome Project, the maturation of pharmacogenomics, the growth of proteomics, and the rapidly growing field of molecular genetic pathology will lead to a new era of personalized and customized patient care. More recently, the American Board of Pathology (ABP), in conjunction with the American Board of Medical Genetics (ABMG), established a new subspecialty, molecular genetic pathology. Fellowship training for molecular genetic pathology is approved by the Accreditation Council for Graduation Medical Education (ACGME). Many pathologists and medical geneticists are applying for advanced training in this growing subspecialty. Training in molecular pathology is also becoming a required element in pathology residency curricula. To meet these demands, a team of more than 50 leading experts has compiled this quick reference book for medical students, general practitioners, medical technologists, pathologists, and medical geneticists . We also hope that residents or fellows who are training in pathology and medical genetics will find this book helpful in their preparation for board examinations . Molecular Genetic Pathology contains two parts. Part I covers general molecular genetic pathology and technology, including principles of clinical molecular biology, principles
of clinical cytogenetics, diagnostic methodology and technology, tissue microarrays and biomarker validation, laser capture microdissection, clinical flow cytometry, conceptual evolution in cancer biology, clinical genomics in oncology, clinical proteomics, clinical pharmacogenomics, clonality analysis in surgical pathology, fluorescence in situ hybridization (FISH), conventional cytogenetics for hematology and oncology diagnosis, instrumentation, genetic inheritance and population genetics, and genetic counseling . Part II provides disease-based information, including prenatal diagnosis, familial cancer syndromes, molecular testing for solid tumors, molecular pathology of the central nervous system, molecular virology, molecular bacteriology, mycology and parasitology, molecular testing for coagulopathies, molecular hemoglobinopathies, molecular diagnostics of lymphoid malignancies, molecular diagnostics of myeloid leukemias, HLA system and transfusion medicine (molecular approach), molecular forensic pathology, gene therapy, ethical and legal issues in molecular testing, and quality assurance and laboratory inspection. Each chapter begins with a detailed Table of Contents for easy reference. Assembling this diverse guidebook has truly been a team effort, cutting across many traditional specialty boundaries . We are most grateful for all the contributors who made this project possible. Our special thanks go to Mr. Ryan P. Christy from the Multimedia Education Division of the Department of Pathology at Indiana University, who has edited the illustrations for the book. We would like to thank the staff at Humana Press/Springer, including Ms. Mary Jo Casey, Mr. Paul Dolgert, Mr. Richard Hruska, and Mr. David Casey for their assistance in the development and editing of this text, and in particular Ms. Amy Thau, without whose outstanding work this book would have been an impossible achievement.
Liang Cheng, MD David Y. Zhang, MD, PhD, MPH
v
...
Contents
Preface Contributors
v ix
11
Part I General Sections 1 Principles of Clinical Molecular Biology Shaobo Zhang, Darrell D. Davidson, David Y. Zhang, Jodi A. Parks, and Liang Cheng 2 Principles of Clinical Cytogenetics Stuart Schwartz
1
33
3 Diagnostic Methodology and Technology Josephine Wu, Tao Feng, Ruliang Xu, Fei fe, Bruce E. Petersen, Liang Cheng, and David Y. Zhang 65 4 Tissue Microarrays and Biomarker Validation Martina Storz and Holger Moch
133
5 Laser Capture Microdissection Matthew Kuhar and Liang Cheng
141
6 Clinical Flow Cytometry Magdalena Czader
155
7 Conceptual Evolution in Cancer Biology Shaobo Zhang, Darrell D. Davidson, and Liang Cheng 185 8 Clinical Genomics in Oncology Hugo M. Horlings and Marc van de Vijver 9 Clinical Proteomics David H. Geho, Virginia Espina, Lance A. Liotta, Emanuel F. Petricoin, and Julia D. Wulfkuhle
10 Clinical Pharmacogenomics Catalina Lopez-Correa and LawrenceM. Gelbert
209
231
Clonality Analysis in Modem Oncology and Surgical Pathology Liang Cheng, Shaobo Zhang, Timothy D. Jones, and Deborah E. Blue
241
261
12 Fluorescence In Situ Hybridization (FISH) and Conventional Cytogenetics for Hematology and Oncology Diagnosis Vesna Najfeld
303
13 Instrumentation Bruce E. Petersen, Josephine Wu, Liang Cheng, and David Y. Zhang
365
14 Genetic Inheritance and Population Genetics Tatiana Foroudand Daniel L. Koller
393
15 Genetic Counseling Kimberly A. Quaid and Lisa J. Cushman
405
Part II Disease-Based Sections 16 Molecular Medical Genetics Lisa Edelmann, Stuart Scott, and Ruth Kornreich
415
17 Prenatal Diagnosis Nataline Kardon and Lisa Edelmann
441
18 Familial Cancer Syndromes Michelle P. Eliefj, Antonio Lopez-Beltran, Rodolfo Montironi, and Liang Cheng ..... 449
vii
Contents llIiJltEii
19 Molecular Testing for Solid Tumors Neal I. Lindeman and Paola Dal Cin
467
20 Molecular Pathology of the Central Nervous System Eyas M. Hattab and Brent T. Harris
497
21 Molecular Virology Josephine Wu, Mona Sharaan, and David Y. Zhang
533
22 Molecular Bacteriology, Mycology and Parasitology Mona Sharaan, Josephine Wu, Bruce E. Petersen, and David Y. Zhang
viii
689
28 Molecular Forensic Pathology P. Michael Conneally and Stephen R. Dlouhy
703
and Clinical Applications 717
581
623
30 Ethical and Legal Issues in Molecular Testing Kimberly A. Quaid
731
31 Quality Assurance and Laboratory Inspection Carol L. Johns and Liang Cheng
737
637
25 Molecular Diagnostics of Lymphoid Malignancies Francisco Vega and Dan M. Jones
rr
27 The HLA System and Transfusion Medicine: Molecular Approach S. Yoon Choo
Kenneth Cornetta
24 Molecular Hemoglobinopathies Jodi A. Parks, Tina Y. Fodrie, Shaobo Zhang, and Liang Cheng
21M I
675
29 Gene Therapy: Vector Technology
23 Molecular Testing for Coagulopathies Veshana Ramiah and Thomas L. Ortel
lU l U
26 Molecular Diagnostics of Myeloid Leukemias C. Cameron Yin and Dan M. Jones
Appendix
Liang Cheng and Shaobo Zhang 655
m1ttt lllTJrr_wn
Index
751 767
Contributors
DEBORAH E . BLUE, MD Assistant Professor of Pathology Associate Director, Molecular Pathology Laboratory Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School ofMedicine Indianapolis, IN LIANG CHENG, MD Professor of Pathology and Urology Director ofMolecular Pathology Laboratory Chief, Genitourinary Pathology Division Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School of Medicine Indianapolis, IN S.
Yo ON CHOO, MD Associate Professor of Pathology and Medicine Director of HLA Laboratory, Associate Medical Director of Blood Bank Departments of Pathology and Medicine Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY
P. MICHAEL CONNEALLY, PhD Distinguished Professor Emeritus, Medical and Molecular Genetics and Neurology Department of Medical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN KENNETH CORNETIA, MD Joe C. Christian Professor and Chairman Department ofMedical and Molecular Genetics Indiana University School ofMedicine Indianapolis, IN LISA 1. CUSHMAN, PhD Certified Genetic Counselor Department of Medical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN
MAGDALENA CZADER, MD, PhD Assistant Professor of Pathology Director of Clinical Flow Cytometry Laboratory Department of Pathology and Laboratory Medicine Indiana University School of Medicine Indianapolis, IN PAOLA DAL ON, PhD Associate Professor of Pathology Cytogenetics Laboratory Department of Pathology Brigham and Women's Hospital and Harvard Medical School Boston, MA DARRELL D . DAVIDSON, MD, PhD Assistant Professor of Pathology Department of Pathology and Laboratory Medicine Indiana University School of Medicine Indianapolis, IN STEPHEN R. DLOUHY, PhD Associate Research Professor Department ofMedical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN LISA EDELMANN, PhD Assistant Professor Department of Genetics and Genomic Sciences Director, Molecular Cytogenetics Co-Director, Genetic Testing Laboratory Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY MICHELLE P. EUEFF, MD Staff Pathologist Diagnostic Pathology Services, Inc. Nampa, ID
JltW
ix
Contributors mUI
VIRGINIA ESPINA, MS Research Professor The Center for Applied Proteomics and Molecular Medicine George Mason University Manassas, VA TAO FENG, MS, MP (ASCP) Research Assistant Department of Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY TINA Y. FODRIE, BS, MT, MP (ASCP) Supervisor, Department of Molecular Pathology Indiana University School of Medicine and VA Medical Center Indianapolis, IN TATIANA FOROUD, PhD Professor ofMedical and Molecular Genetics Department of Medical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN DAVID H. GEHO, MD, PhD Associate Director of Imaging Merck and Company, Inc. West Point, PA LAWRENCE M. GELBERT, PhD Research Advisor Eli Lilly and Company Indianapolis, IN BRENT T. HARRIS, MD, PhD Assistant Professor of Pathology Department of Pathology Dartmouth Medical School Lebanon, NH EYAS M. HATIAB, MD Associate Professor of Pathology Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School of Medicine Indianapolis, IN
_ _ _ _ _.....
HUGO M. HORLINGS, MD Department of Pathology The Netherlands Cancer Institute/Antoni van Leeuwenhoek Hospital Amsterdam, The Netherlands CAROL L. JOHNS, PhD Supervisor and Technical Coordinator Clarian Molecular Pathology Laboratory Indiana University School of Medicine Indianapolis, IN DAN M . JONES, MD, PhD Professor of Pathology Department of Hematopathology Medical Director, Molecular Diagnostics Laboratory The University of Texas M. D. Anderson Cancer Center Houston, TX TIMOTHY D . JONES, MD Staff Pathologist Department of Pathology Floyd Memorial Hospital and Health Services New Albany, IN NATALINE KARDON, MD Associate Professor Director of Prenatal Cytogeneti cs Laboratory Department of Genetics and Genomic Science s Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY DANIEL L. KOLLER, PhD Research Assistant Professor Department of Medical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN RUTH KORNREICH, PhD Research Assistant Professor ofHuman Genetics Co-Director Genetic Testing Laboratory Department of Human Genetics Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY MATIHEW KUHAR, MD Resident Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School of Medicine Indianapolis, IN ... Jjl...
J'M"iG.~~ll!il"'_1f:Jrn!1 ~
... ··. ·.,. f
•
If'l!!W1!¥_M'''RW'''' .t tti'''' ·~
IU!
x
_
Contributors NEAL I. LINDEMAN, MD Associate Pathologist, Clinical Chemistry Associate Pathologist, Molecular Diagnostics Brigham and Women 's Hospital Assistant Professor of Pathology Harvard Medical School Boston , MA
JODI A. PARKS, MD Visiting Lecturer, Clinical Chemistry Department of Pathology and Laboratory Medicine and Clarian Pathology Laboratory Indiana University School of Medicine Indianapolis, IN BRUCE E. PETERSEN, MD Molecular Genetic Pathology Fellow Department of Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY
LANCE A. LIOTIA, MD, PhD Director, The Center for Applied Proteomics and Mole cular Medicine Professor of Life Scien ces George Mason University Manassas, VA
EMANUEL F. PETRICOIN, PhD Professor of Life Sciences Director, The Center for Applied Proteomics and Molecular Medicine Chair, Department of Molecular and Microbiolog y George Mason University Manassas, VA
ANTONIO LOPEZ-BELTRAN, MD, PhD Professor of Pathology Department of Pathology and Surgery Cordoba University Medical School Cordoba, Spain CATALINA LOPEZ-CORREA, MD, PhD Principal Research Scientist Eli Lilly and Company Indianapolis, IN
KIMBERLY A. QUAID, PhD Professor of Medical and Molecular Genetics Department of Medical and Molecular Genetics Indiana University School of Medicine Indianapolis, IN
HOLGER MOCH, MD Professor and Chairman Institute of Surgical Pathology Department of Pathology University Hospital Zurich Zurich, Switzerland
VESHANA RAMIAH, MD Hematology/Oncology Fellow Duke University Medical Center Durham, NC
RODOLFO MONTIRONI, MD, FRCPath Professor of Pathology Institute of Pathological Anatomy and Histopathology Polytechnic University of the Marche Region (Ancona) School of Medicine United Hospitals Ancona, Italy
STUART SCHWARTZ, PhD, FACMG Professor of Human Genetics Department of Human Genetics University of Chicago Chicago,IL
VESNA NAJFELD, PhD Professor of Pathology and Medicine Director, Tumor Cytogenetics, and Oncology, Molecular and Cellular Tumor Markers Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY THOMAS L. ORTEL, MD, PhD Associate Professor of Medicine and Pathology Hemostasis and Thrombosis Center Duke University Medical Center Durham , NC
""'
STUART SCOTT, PhD Clinical Molecular Genetics Fellow Department of Human Genetics Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY MONA SHARAAN, MD Molecular Genetic Pathology Fellow Department of Pathology Mount Sinai School of Medi cine and the Mount Sinai Medical Center New York, NY
AU
XI
Contributors MARTINA STORZ, BS
Directorof TMA Core Facility Institute ofSurgical Pathology Departmentof Pathology University Hospital Zurich Zurich, Switzerland
RULIANG XU, MD, PhD
Associate Professor of Pathology Departmentof Pathology New York University School of Medicine New York, NY FEI YE, PhD
MARC VAN DE VIJVER, MD, PhD
Professor of Pathology Department of Pathology The Netherlands Cancer Institute/Antoni van Leeuwenhoek Hospital Amsterdam, The Netherlands
Assistant Professor Departmentof Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY
C. CAMERON YIN, MD, PhD FRANCISCO VEGA, MD, PhD
Assistant Professor of Pathology Departmentof Hematopathology The University of Texas M. D. Anderson Cancer Center Houston, TX
Assistant Professor of Pathology Departmentof Hematopathology The University of Texas M. D. Anderson Cancer Center Houston, TX DAVID Y. ZHANG, MD, PhD, MPH
JOSEPHINE WU, DDS, CLSp(MB), CLDir
Assistant Professor Departmentof Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY JULIA D. WULFKUHLE, PhD
Research Professor The Centerfor Applied Proteomics and Molecular Medicine George Mason University Manassas, VA
RID
xii
Associate Professorof Pathology Director, Molecular Pathology Laboratory Departmentof Pathology Mount Sinai School of Medicine and the Mount Sinai Medical Center New York, NY SHAOBO ZHANG, MD
Associate Research Professor Departmentof Pathology and LaboratoryMedicine Indiana University School ofMedicine Indianapolis, IN
sr.
-
we
w
I.
Part I General Sections
1
Principles of Clinical Molecular Biology Shaobo Zhang,
MD,
Darrell D. Davidson, MD, PhD, David Y. Zhang, Jodi A. Parks, MD, and Liang Cheng, MD
MD, PhD, MPH,
CONTENTS I. Deoxyribonucleic Acid (DNA) Overv iew Types of DNAs DNA Repli cation DNA Mutation DNA Mutation and Disease Factors Related to DNA Aberrations DNA Repair Mechanisms
II . Genes Overview Gene Components Functional Categories of Genes Cancer- Related Genes Regulation of Gene Expression Signal Tran sduction
III. Chromosomes Overview Chromatin
1-4 1-4 1-5 1-7 1-8 1-9 1-9 1-12
1-13 1-13 1-13 1-13 1-14 1-14 1-19
1-19 1-19 1-19
Chromosomes
IV. RNA and Proteins Overview Types of RNA Ribosome and Ribozyme mRNA Processing Protein Translation
V. Mitochondrial DNA Overview mtDNA Inheritance Characteristics of mtDNA Mitochondrial Genes and Gene Expression mtDNA Replication mtDNA Damage, Mutations, and Repair Mitochondrial Disease
VI. Suggested Reading
1-19
1-22 1-22 1-23 1-23 1-24 1-27
1-28 1-28 1-28 1-28 1-28 1-29 1-30 1-31
1-32
3
1-4
Molecular Genetic Pathology
DEOXYRIBONUCLEIC ACID (DNA)
Overview
- Nucleotide is made up of a phosphate group, a pentose sugar (deoxyribose), and a nitrogenous base (Figure 1)
• Definition - DNA is a large nucleic acid polymer arranged in chromosomes for storage, expression and transmission of genetic information - The genetic information is encoded by a sequence of nucleotides • Components of DNA - Bases are molecules containing carbon-nitrogen rings in DNA • Purines: adenine (A) and guanine (G) have two joined carbon-nitrogen rings • Pyrimidines: thymine (T) and cytosine (C) have one carbon-nitrogen ring - Nucleoside is made up of a five-carbon sugar (deoxyribose) and a base - Deoxyribose is the same sugar found in RNA, but with oxygen removed from the 2' carbon position
Adenine
Guanine
• The phosphodiester bond • The phosphate group is bond to the nucleoside at the hydroxyl group of the 5' carbon atom of deoxyribose • Phosphodiester bonds are strong covalent bonds between phosphate groups connecting the 5' carbon of one deoxyribose to the 3' carbon of the next deoxyribose of the adjacent nucleotide nucleotide (Figure 2) • The phosphodiester bond determines DNA chain polarity (ends designated as either 5' or 3') • DNA sequence refers to the order of the nucleotides in a DNA strand, which code for unique sets of genetic information, both proteins and regulatory segments
Cytosine
Thymine
N j'N=C ~) NH2
I
HOf>°""I ~H HO H
'\ N
HOf> 0",,1
~H HO
Cytidine
2-Deoxyribose
N
H
Adenosine
I Nucleoside
Fig. 1. There are four bases in DNA: Adenine (A), guanine (G), thymine (T), and cytosine (C). Adenine and guanine are purines and thymine and cytosine are pyrimidines. Deoxyribose is the sugar in DNA. The carbon atoms are numbered as indicated. Note there is no oxygen on site 2 of deoxyribose. A nucleoside molecule is composed of a base and deoxyribose. When a phosphate group is added to nucleoside, the complex becomes a nucleotide . Nucleotides are the basic building blocks of DNA.
4
Principles of Clinical Molecular Biology
1-5
5 CH2
Base
l /o~ 1
4C
C
HI'
I\HI H
I
3'--1 o
H
2
H
I
O=p-O-
I
o 5
I
CH2
o
Base
c/~l HI' \1 1 '\ H
H
C--C
I
o
H
I
H
Fig . 2. 3'5' Phosphodiester bonds joint by the unit of the repetitive sugar-phosphate chain. Each nucleotide is linked by the 3' carbon atom of upstream ribose to the 5' carbon of the downstream ribose. Phosphodiester bonds are central to all life on earth, as they make up the backbone of DNA and RNA strands in every organism.
- The deoxyribonucleotides in DNA differ only in the bases they carry, so the DNA sequence is denoted by a base sequence (e.g., -ATTGCAT-) - Base sequence is presented from 5' to 3' - DNA strands are pairs of complementary molecules, which entwine each other in an antiparallel direction - Two strands of DNA wind around each other to form a double helix (Figure 3) • Deoxyribose-phosphate backbone is on the exterior of the DNA double helix • The interior of the DNA is formed by paired bases attached to each other by hydrogen bounds. G (Guanine) pairs with C (Cytosine) via three hydrogen bonds, and A (Adenine) pairs with T (Thymine) via two hydrogen bonds inside the double helix. Note that the three hydrogen bonds joining G to C (GC bond) are stronger than the two hydrogen bonds joining A to T (AT bond) (Figure 4) - DNA has two DNA chains; one is oriented 5' ~3' while the other strand is oriented 3' ~5' direction (antiparallel) • Sense is a DNA strand that could be transcribed. Sense strand has a sequence similar to its RNA transcript • Antisense is the complimentary strand of sense. Antisense works as template for the RNA transcript
• A DNA fragment appears to have a unique function, either structural , regulatory, or coding
Types of DNAs • Single copy DNA is a specific DNA sequence that is present only once in the genome • Repetitive DNA is a DNA segment with a specific DNA sequence that is repeated multiple times in the genome • Moderately repetitive DNA refers to 10-10 5 copies of the sequence per genome - Moderate repeated DNA is found primarily in noncoding sequences • Highly repetitive DNA describes DNA sequence present in greater than 105 copies per genome - Highly repeated DNA is found primarily in centromere and telomere regions as tandem repeats • Tandem repeat DNA contains a variable number of short DNA sequences repeated many times in series . The number of repeats is unique to each individual , and can be used for relationship testing - The tandem repeat pattern may vary from one base repeats (mononucleotide repeat) to several IOOO-bp repeat sequences
5
1-6
Molecular Genetic Pathology
3'end 5'
3'
3' end
3'
5'
5'end
Fig. 3. Human genomic DNA contains two polynucleotide chains wound around each other to form a double-stranded helix . The two chains are "antiparallel,' one running 5'-3' and the other running 3'-5' direction . The DNA strands are synthesized and read out by RNA polymerase in the 5'-3' direction . The purine or pyrimidine attached to each deoxyribose project s into the center of the helix. Base A pairs with T and a G pairs with C through hydrogen bonds in the central axis.
- These segments of DNA are satellite DNA because of the experimental observation that they often form a minor satellite band near the major centrifugation fraction when DNA is separated by density gradient - Clusters of such repeats are scattered on many chromosomes. Each variant is an allele that is inherited co-dominantly - Megasatellite DNAs are tandem repeat DNA segments with a length greater than 1000 bp (1 kbp) repeated 50-400 times - Satellite DNAs comprise about 15% of human DNA. The repeated sequence ranges from 5 to 170 bp and the complex is about 100 kbp in length - Minisatellite DNAs are repeated sequence s ranging from 14 to 500 bp in length . The repeat complex is 0.1-20 kbp in length. Minisatellite DNA is present in telomere region
6
- Microsatellite DNAs are sequences ~
, '\.~. I .
,. ~
., ., '. . .. .
\
' ••
,
I.
# /.
I
\
.. -
Fig. 17. Aneuploidy is a condition in which the number of chromosomes is not a multiple of the haploid set due to gaining or losing chromosomes. The figure shows a fluorescent probe chromosome painting of tumor cell chromosomes featuring a series of chromosome gains and loses.
Fig. 18. Monosomy is a type of aneuploidy with loss of one chromosome from a pair in the cell's diploid chromo some set. Fluorescence in situ hybridization shows the loss of one chromosome in these cells indicated by having only one signal present in each nucleus.
17
1-18
Molecular Genetic Pathology
• Structural alterations of chromosomes (see details in Chapter 2) - Inversion occurs when a chromosome segment is flipped end to end. Inversion is designated by the symbol inv Reciprocal translocation is a chromosomal rearrangement caused by the interchange of chromosome segments between non-homologous chromosomes . Reciprocal translocations are denoted by the symbol t followed by parentheses showing the exchanged chromosome breakpoints separated by a semicolon Isochromosome is a chromosome which has lost one set of its arms, either p or q, and replaced them with an exact copy of the other arms. Isochromosomes thus have four identical arms , either p or q. Isochromosome is denoted by the symbol i
- Ring chromosome is a chromosome that is formed when the telomeres have been lost, and the ends of arms fuse together to form a ring. A ring chromosome is denoted by the symbol r • Fragile sites are chromosome regions that are poorly connected to the rest of the chromosome - Fragile sites are often rich in CGG or CGC repeats and are inherited like a gene and break away frequently - Double chain breaks in fragile sites lead to the loss of genetic material - Fragile sites are especially prone to breakage when cells are cultured under conditions that inhibit DNA replication or repair Selected tumors with chromosomal anomalies (Table 2)
Table 2. Selected Tumors with Commonly Found Chromosomal Anomalies Tumor
Common chromosome anomalies
Genes involved
Epithelial tumors Basal cell carcinoma
9q22 .3
PTCH
Clear cell renal carcinoma
3p25-26
VHL
Translocation renal cell carcinoma
t(X; I)(p 11.2;q21)
PRCC-TFE3
t(X; 17)(p11.2-q25)
ASPL-TFE3
t(X ;I)(p 11.2;p34)
PSF-TEFJ
Papillary renal cell carcinoma
Gain 7, 17, loss Y, and 4
-
Hereditary papillary renal cell cancer
7q31
c-MET
Breast cancer
Iq
-
17q21
BRCA1, Her-2/neu
13ql2
BRCA2
del(l6q)
-
del(l7p)
TP53
12p
Ras
3pl4
FH1T
5q21-22
APC
18q21
DCC, SMAD4
del(3p)
FH1T
13q
RB
9p21
P16
17p
TP53
Colorectal cancer
Lung cancer
(Continued)
18
Principles of Clinical Molecular Biology
1-19
Table 2. (Continued) Tumor Prostate cancer
Bladder transitional cell carcinoma
Common chromosome anomalies
Genes involved
t(21 ;2 1)(p22.2;q22.3)
TMPRSS2-EGR
del(8pI2-2l)
NKX3.1
lq24
HPCI
Xq27-28
HPCX
Xqll
AR
del(lOq24)
PTEN
Trisomy 7
-
Loss ofY
-
gain 3,7, 17,del(9p21)
P53, Pl6
(UroVysion panel) Medullary thyroid carcinoma
lOql1.2
RET
Papillary thyroid carcinoma
IOqll-q13
RET
inv(1)
NTRKI-TPM3 (TRK)
Mesothelioma
del(3p21)
CTNNBI
Ovarian papillary cystadenocarcinoma
t(6;14)
-
Granulosa cell tumor and Brenner tumor
trisomy 12
-
i(12p)
-
i(12p)
-
12p overrepresentation
-
del(1 lpI3)
WTI
Alveolar soft-part sarcoma
t(X; 17)(p II ;q25)
TFE3-ASPL
Alveolar rhabdomyosarcoma
t(2; 13)(q35;q 14),
PAX3-FKHR,
t(1; 13)(p36;q 14)
PAX7-FKHR
Clear cell sarcoma (melanoma of soft part)
t(12 ;22)(q 13;q12)
EWS-ATFI
Dermatofibrosarcoma protuberans and giant cell fibroblastoma
t(17 ;22)(q22 ;q13)
COLlAI-PDGFB
Myxoid chondrosarcoma
t(9;22)(q22 ;q12)
EWS-CHN
Lipoma
t(3; 12)(q27;q 13)
HMGIC-LPP
Lipoblastoma
8q rearrangement
-
Myxoid liposarcoma
t(12;16)(q13 ;pll)
CHOP-FUS
t(12;22)(q 13;q12)
EWS-CHOP
Ring chromosome 12
-
Testicular germ cell tumors
Wilm's tumor
Soft tissue tumors
Well-differentiated liposarcoma
(Continued)
19
Molecular Genetic Pathology
1-20
Table 2. (Continued) Tumor
Genes involved
Common chromosome anomalies t(l i ;22)(q24;q 12),
EWS-FLl l,
t(21;22)(q22;q 12)
EWS-ERG
Desmoplastic small round cell tumor
t(li ;22)(p 13;q 12)
EWS-WTl
Synovial sarcoma
t(X;18)(pll ;qI I)
SIT-SSXl
t(X;20 )
-
Infantile fibrosarcoma and congenital mesoblastic nephroma
t(l2;l5 )(p 13;q25)
ETV6-NTRK3
Inflammatory myofibroblastic tumor
t( I ;2)(q22 ;p23)
TPM3-ALK
t(2;I9 )(p23 ;p 13)
TPM4-ALK
Gastrointestinal stromal tumor
4qll -2l
c-kit exon II
Hemangiopericytoma
t(l2;19)
-
Uterine leiomyoma
t(l 2;14)(q l3 -I5 ;q24.I )
HMG1C
Endometrial stromal sarcoma
t(7;17)(p l5-p2I ;q 12-q2I )
JAZFl-JJAZI
Leiomyosarcoma
del(l p)
-
Pleomorphic adenoma
t(3;8)(p I2 ;q 12)
FGFR1-FlM
Aneury smal bone cyst
I7p rearrangement
-
Desmoplastic fibrobla stoma and fibroma of tendon sheath
t(2; II )
-
Melanoma
del(9p21)
CDKN2
I2qI4
CDK4
del(22q)
-
Acoustic neuroma
22qI2.2
NF2
Schwan noma
deI(22qI3)
NF2
Meningioma
del(22q II-q 13)
NF2
Mono somy 22
-
Trisomy 7 Monosomy 10, 22 t(lO ;19)(q24;qI3)
(7pII )
del(lOq)
PTEN and DMBTl (l Oq)
i(l7q)
-
del( 17p13.2)
-
Trisomy 8
-
2p del( Ip31-32)
N-Myc amplification
Ewing's sarcoma/primitive neuroe ctodermal tumor
Neural/neuroendocrine tumors
Gliobl astoma multiforme
Medulloblastoma
Neuroblastoma
EGFR gene amplification
(homogenous staining region and double minute s) (Continu ed )
20
Principles of Clinical Molecular Biology
1-21
Table 2. (Continued)
Tumor
Common chromosome anomalies
Genes involved
del(lp36)
TP73
del(l9q13)
PEG3
Retinoblastoma
del(l3qI4)
RB
Pheochromocytoma
del(22q13)
SLCI
del(lp11-36)
RIZI
t(8; 14)(q24;q32),
c-myc-IgH
t(8;22)(q24 ;qll)
c-myc-IgL
t(2;8)(p 12q24)
c-myc-IgK
Follicular lymphoma
t( 14;18)(q32;q21)
IgH-BCL2
Mantle cell lymphoma
t(lI;14)(qI3;q32)
IgH-BCLl (cyclin 01)
llq
ATM mutation or deletion
del(l3q14)
-
Trisomy 12
-
del(l7p)
-
Mucosa-associated lymphoid tissue (MALT) lymphoma
t(ll; 18)(q21;q21) Trisomy 3
API2-MALTl
Diffuse large cell lymphoma
t(l4;18)(q32;q2l)
IgH-BCL2
t(3; 14)(q27;q32)
BCL6-1gH
Anaplastic large cell lymphoma
t(2;5)(p23;q35)
NPM-ALK
Lymphoplasmacytic lymphoma
t(9;14)(p13;q32)
PAX5
Myelodysplastic disorder
del(5q)
-
Trisomy 8
-
Monosomy 7
-
del(7q)
-
del(l7p)
-
del(20q)
-
Chronic myelogenous leukemia
t(9;22)(q34;q11)
BCR-ABL
Acute myelogenous leukemia (AML)-M2
t(8;2l )(q22;q22)
AMLl-ETO
Acute promyelocytic leukemia -M3
t(l5 ;17)(q22;q2l)
PML-RARa
AML-M4eo
inv(l6)(p13;p22)
MYHII-CBFB
AML-M4,M5
t(l1 ;19)
MLL-ENL
llq23
MLL
Oligodendroglioma
Lymphomas/leukemia Burkett's lymphoma
(Continued)
21
Molecular Genetic Pathology
1-22
Table 2. (Continued) Tumor
Common chromosome anomalies
Genes involved
AML-M5
t(9;II)(p22 ;q23)
MLL-AF9
PediatricAML
translocation involving IIq23
MLL-AF9
AML-M7
t(l ;22)
-
Pre-B ALL
t(l ;19)
E2A-PBXl
B-ALL
t(l2 ;21)
TEL-AMLl
InfantileALL
t(4;II )
AF4-MLL
ALL
t(l2;21) (most common translocation in ALL)
TEL-AMLl
Chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL)
del (l3q) del (llq) del (l7p)
-
trisomy 12q
-
t(lI ;14)(q13;q32)
-
Monosomy or partial deletion of 13 (I3q)
IgH-BCLl (cyclin Dl)
t(lI ;14)(qI3;q32)
-
Multiple myeloma
19H-BCLl (cyclin DI)
RNA AND PROTEIN Overview • What is RNA? - RNA is a single-stranded nucleic acid polymer consisting of nucleotide monomers - The five-carbon sugar in RNA is ribose (contains a 3' hydroxyl group) inste ad of deoxyribose -
Bases in RNA are A (adenine), G (guanine), C (cytosine), and U (uracil), which takes the place ofT (thymine) in DNA
-
RNA folds back on itself to form hair pin or loop structures via intramolecular hydrogen bonds (Table 3)
• What is protein? - Proteins are chains of amino acids joined by peptide bond s - The peptide bond forms when the carboxyl group of one amino acid residue is joined to the amino group of the next amino acid residue • Synthesis of RNA in cell s - In transcription a DNA sequence is enzymatically copied by an RNA polymerase in a process analogous to DNA chain duplication. In RNA
22
transcription, A from DNA template determines U in RNA instead of T (Figure 19) - RNA polymerases are a group of nucleotidyltransferases that polymerize ribonucleotides in accordance with the information present in DNA • RNA polymerase I transcribes genes encoding ribosomal RNA (rRNA) • RNA polymerase II transcribes genes encoding proteins (mRNA) and certain small nuclear RNAs (snRNA) • RNA polymerase III transcribes genes encoding transfer RNA (tRNA) and other small RNAs (5SRNA in ribosomes) • Primase catalyzes the synthesis of the short RNA primers on single -stranded DNA templates used by DNA polymerase to initiate the synthesis of Okazaki fragments on the lagging strand • Prima se is an essential enzyme in all wellcharacterized systems of DNA replication because no DNA polymerase can initiate DNA synthesis without an RNA primer • The enzyme is required for synthesis of the lagging strand
1-23
Principles of Clinical Molecular Biology
• mRNA constitutes about 5% of the total cellular RNA
Table 3. The Differences Between DNA and RNA
mRNA components • Exons are sequences in mRNA that encode an amino acid sequence
DNA
RNA
Bases
A,G,C,T
A,G,C,U
Strand
Double stranded
Single stranded
Structure
Antiparallel helix
Hairpin and loops
Sugar
Deoxyribose
Ribose
Location
Nuclear or mitochondrial
Nuclearor cytoplasmic
Lifetime
Long
Short
Process
Transcription
Translation
Types
Nuclear DNA, mtDNA
mRNA, tRNA, rRNA, miRNA, siRNA, ribozyme
• Introns are non-coding sequences between exons, which are spliced out of mRNA by exonucleases prior to translation (see mRNA Processing section and Gene Components section) • Codons are a set of 3-base "words" conveying genetic information to be translated into amino acid sequences • Polyadenylation is the covalent linkage of 50-250 adenosine ribonucleotide units to the 3' end of mRNA at the polyadenylation signal (AAUAA). This structure is known as the polyadenosine (poly-A) tail
RNA
~ DNA
-
-
-
polymerase
-
3' ...L.L.............L.L........... _
• Poly (A) stabilizes mRNA and protects the mRNA molecule from exonucleases • Poly-A is important for transcription termination and for export of the mRNA from the nucleus to the cytoplasm
Coding strand
5' -
• Adding Poly (A) is one of the steps for producing mature mRNA required for translation
-
-
-
- 3' 5'
~.LLL.LJ..LL.J...
• 5' UTR (5' untranslated region) is a particular section of mRNA located between the cap site and the start codon at the 5' end
• It is not translated • It affects the mRNA stability • It regulates gene expression in response to iron
Direction of polymerization
mRNA
•
Transcription bubble
Fig. 19. Transcription is the process through which a DNA sequence is copied by RNA polymerase II to produce a complementary RNA chain. The RNA polymerase II proceeds along one chain of DNA moving in the 3' ~5' direction and assembles ribonucleotides into a strand of RNA. Synthesis of the mRNA product continues in the 5' ~3' direction until it reaches the stop codon.
Types of RNA • mRNA is transcribed from a DNA template to carry sequence information from the nucleus to the cytoplasm • Transcription is the process of copying sequence information from DNA to RNA. Translation is the process of converting mRNA sequence information into a protein chain
• It facilitates the initiation of translation
• 3' UTR (3' untranslated region) is a particular section of mRNA located between the stop codon and the poly-A tail at the 3' end • It contains a polyadenylation signal sequence, usually AAUAAA, or a slight variant
• It is a binding site for proteins that may affect the mRNA stability or local concentration in the cell • It contains binding sites for microRNAs (miRNAs) • tRNA is an amino acid-specific adaptor molecule containing an anticodon at the 3' end of an RNA molecule containing three hairpin loops, one of which binds a particular amino acid - tRNA constitutes about 10% of the total cellular RNA - tRNA transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation (Figure 20) - Anticodon refers to the unit in a tRNA molecule made up of the three nucleotide sequence that is complementary to the three bases of the codon
23
1-24
Molecular Genetic Pathology
5'
AUG
-----TrAGG -CUC-~~~
- A U G - U G G 7 r 3'
UAC
N terminus Met
~~ A r g - Leu
+c}eUo Trp
Fig. 20. tRNA transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation. It has a site for amino acid attachment and a three-base region called the anticodon that recognizes the corresponding three-base codon region on mRNA via complementary base pairing.
- tRNA molecules are encoded by RNA genes of nuclear and mtDNA
Ribosome and Ribozyme • rRNA is the RNA component of a ribosome - rRNAs in eukaryotes include 5S, 5.8S, 18S, and 28S RNA subcomponents essential for ribosome structure and function - rRNA is the most abundant and stable RNA species in the cell and constitutes about 50% of the total cellular RNA - Ribosomes are the protein manufacturing machinery of all living cells • Ribosomes are composed of rRNA and ribosomal proteins • Ribosomes translate mRNA into polypeptide chains • Ribozyme is an RNA molecule that catalyzes a chemical reaction - Natural ribozymes catalyze their own cleavage or the cleavage of other RNAs - They also catalyze the aminotransferase reaction of the ribosome - Ribozyme consists of a conserved catalytic core motif which is required for trans-cleavage of a phosphodiester bond within an RNA target - Ribozyme-based cancer therapy uses specially designed ribozymes to knock down oncogene mRNA
(Figure 21) • Non-coding RNA - Many RNA genes encode RNA that is not translated into protein • The human nuclear genome contains about 3000 unique RNA genes (35 years old develop it
Principles of Clinical Cytogenetics
• Overlap of phenotypic feature s with the general population - Most features in trisomy 21 can be found in individual s in the general population - The phenotypic feature s are especially important when all of the features are grouped together • For example-single palmer crease
• Limbs abnormalities • Clenched hands • Overlapping fingers • Absent distal flexion creases • Rocker bottom feet • Genitalia abnormalities
• In 50 % of the cases of Down syndrome
• Cryptorchidism
• Seen in 2-3%-general population
• Clitoral hypotrophy
• Trisomy 21-chromosome findings - 95% are due to an extra free trisomy 21 (resulting from a meiotic error) - 3-4% result from a Robert sonian translocation -
2-11
1-2% result from mosaicism (resulting from a mitotic error)
• Trisomy 21-recurrence risk - This risk is related to maternal age • Approximately 11100-1/200
Trisomy 18 • Trisomy IS-Edward syndrome - The frequency of this syndrome is about 115000-I/SOOO - The sex ratio at birth is approximately 4 femalell male - Overall survival of affected individuals • 30% die within first month • 50% die within 2 months • 90% die within I year - Phenotypic information • General features • Many pregnancies demonstrate postmaturity with delivery at 42 weeks • Low birthweight with severe growth retardation • Hypoplasia of skeletal muscle • Newborns can be wither hypotonic or hypertonic • Affected individual s have severe mental retardation • Craniofacial dysmorphology • Dolichocephaly • Protuberant occiput • Protuberant nose • Short palpebral fissures • Low set malformed ears • Micrognathia • Neck, thorax, and abdomen abnormalities • Short neck, exces s skin • Short sternum • Narrow pelvis
• Hypoplasia of the labia majora • Other malformations are seen in >95% of patients including : • Cardiac malformations o This is often responsible for death • Gastrointestinal malformations • Renal malformations
Trisomy 13 • Trisomy 13-Patau syndrome - The frequency of this syndrome is about 1/10000-1115000 Overall survival of affected individuals • 30% die within first month • 50% die within 2 months • 90% die within I year - Phenotypic information • General features • Newborns have failure to thrive • Seizures • Newborns are usually hypotonic • Affected individuals have severe mental retardation • Craniofacial dysmorphology • Holoprosencephaly • Microcephaly • Micropthalmia • Iris colobomata • Cleft lip andlor palate • Hemangiomas • Neck, thorax, and abdomen abnormalities • The last rib is either hypoplastic or absent • Limbs abnormalities • Hexadactyly • Rocker bottom feet • Genitalia abnormalities • Cryptorchidism • Scrotal abnormalities
43
2-12
Molecular Genetic Pathology
Meiosis
Reduction Division
Similar to Mitotic Division
I
I
\
MI
I
Mil
Each gamete has half the normal number (n=23) of chromosomes after meiosis
Fig. 10. A diagram of normal meiosis demonstrating normal segregation of chromosomes. • Clitoral hypertrophy • Bicornuate uterus and double vagina • Other malformations seen • Cardiac malformations • Digestive malformations • Ocular malformations o Micropthalmia o
Anopthalmia
• Visceral malformations • Cerebral malformations o Holoprosencephaly • Urinary malformations o Polycystic kidneys
Aneuploidy-Causes • Causes of aneuploidy - Non-disjunction • Can be either meiotic or mitotic
44
• Failure of paired chromosomes to separate (disjoin) at meiosis I • Failure of paired sister chromatids to disjoin at meiosis II or mitosis • Conjoined chromosomes/chromatids migrate to one pole • The other pole has no chromosome - Anaphase lag • Failure of incorporation of a chromosome into one of the daughter nuclei following cell division • Occurs due to delayed movement of the chromosome during anaphase and chromosome is subsequently lost - Meiosis (Figure 10) • This is the process where the diploid count is halved • From 46 to 23 chromosomes (and becomes haploid) • Occurs only at the final division of gamete maturation • This is a two-step process and involves two cell divisions
Principles of Clinical Cytogenetics
- Meio sis I • Referred to as the stage of reduction division, because the chromosome number is halved • Propha se I • Homologous chromosomes pair • Crossing over (recombination) occurs between non-sister chromatids • Prophase I is relatively lengthyconsisting of five stages o
Leptotene
o
Zygotene
o Synaptonemal complexes are formed o
Pachytene
o Pairs of homologous chromosomes o Bivalents formed o Crossing over occur s o
Diplotene
o Chromosomes separate o The chromosomes are attached by chiasma o
Diakenesis
o Separation of the chromo somes proceed s • Metaphase I • Chromosomes are attached to spindle • Anaphase I • Chromosomes separate and go to opposite poles • Telophase I • Two new daughter cells are formed - Meio sis II • This is essentially similar to mitotic division • Each chromosome (pair of chromatids) • Becomes aligned along equatorial plate • Forms two new daughter gametes • What are the consequences of meiosis? - Two major objecti ves are achieved • The diploid number of chromosomes is halved • Haploid • Meiosis provides extraordinary potential for generat ing genetic diversity • Compari son between mitosis and meiosis - Location • Mitosis: all tissues • Meiosis: only in testis and ovary - Product s • Mitosis: diplo id somatic cells • Meiosis: haploid sperm and egg cells - DNA replication and cell division • Mitosis : normally one round of replication per cell division
2-13
• Meiosis: only one round of replication (in meiosis I); but two cell divisions - Length in prophase • Mitosis: short (- 30 minutes in human cells) • Meiosis: long and complex in meiosis I; can take years to complete - Pairing of homolog s • Mitosis: none • Meiosis: yes (in meiosis I) - Recombination • Mitosis: rare and abnorm al • Meiosis: normally at least once for each pair of homologs - Relationship between daughter cells • Mitosis : genetically identical • Meiosis: different (recombination and independent assortment of homolog s) • What are the causes of anueploid? - Anueploidy results from non-disjunction • Failure of chromo somes to separate normally during cell division • In either meiosis or mitosis - Parental origin of non-disjunction • Origin of non-disjunction determined by parental polymorphisms • Chromosomal heteromorphisms have been used • DNA markers used now o For example, microsatellite markers • Origin of non-disjunction • Trisomy 21 o Maternal-88% of time o Paternal-8% o Mitotic-3 % • Trisomy 13 o Maternal-95 % o Paternal-5 % • Trisomy 18 o Maternal-89% o Paternal-O% o Mitotic-II %
Non-Disjunction (Figure 11) • Two major causes of non-di sjunction - Advanced maternal age • Primary oocyte can remain in a state of suspended inactivity for up to 50 years • Stays in dictyotene stage • Well-documented association between advanced maternal age and non-di sjunction • No association with advanced paternal age
45
Molecular Genetic Pathology
2-14
Nondisjunction Meiosis II
Nondisjunction Meiosis I
@ / @ iill Errorhere
~
(])
/ \ Trisomy
/
Meiosis I
/ \
Meiosis II
CD Trisomy
Monosomy
Monosomy
Normal
Normal
Trisomy
Trisomy
Chromosome Constitution of Zygote after Fertilization . Fig. II. An example of non-disjunction resulting in monosomic, euploid, and trisomic gamete s. - Altered recombination
10,------------------,
- Association of advanced maternal age and increased risk of non-disjunction (Figure 12)
"'Ol
€E
.-
0 '0
CD~
Ole:
>>.
Maternal age
Risk of non-disjunction
:J (/) 5 -e:
~~
riio
20 year old
1/1500
25 year old
1/1350
30 year old
11900
35 year old
11400
40 year old
1/100
45 year old
1/30
~.J::
Q):!:
a.::
o 25
30
40
35
45
Age
Fig. 12. A maternal age curve showing the increase in the percent of livebirths with Down syndrome with increasing maternal age.
STRUCTURAL REARRANGEMENTS-I NTRACHROMOSOMAL • Interchromosomal - Reciprocal translocations
- Inversion - Dicentric, acentri c
- Robertsonian translocations • Intrachromosomal (Figure 13) -
46
Deletion Ring Isochromosome Duplication Insertion
Intrachromosomal Rearrangements Deletions (Figure 14) • Involves loss of part of a chromosome Results in monosomy of that segment of the chromosome - Large deletions will be incompatible with survival to term
Principles of Clinical Cytogenetics
2-15
Terminal Deletion
-
-
Interstitial Deletion
Duplication
Ring
Isochromosome
Fig. 13. Diagrammatic representation of several different structural abnormalities including a terminal deletion, inter stitial deletion, duplication, isochromosome, and ring .
-
Any deletion of a loss of >2 % of the haploid genome will usually be lethal
• Types of deletions (I) - Deletions visualized under the microscope • Wolf-Hirschhorn syndrome • Cri-du-Chat syndrome - Microdeletions, contiguous gene deletions • Prader-Willi syndrome • Velocardiofacial syndrome • Types of deletions (II) - Terminal deletion • Single break • Acentric terminal fragment lost
-
Del(4p), del(5p), del(9p), del(ll p), del(ll q), del(l3q), del(l8p), and del(l8q)
-
Wide variability in phenotypes
5p Deletion • Deletion (5p)-general - Cri-du-Chat syndrome Delet ion-short arm of chromosome 5 (pI4pI5) -
- First reported-Lejeune et al. in 1963 • Deletion (5p)-phenotype - General • Cry-mewing of a kitten • Craniofacial dysmorphism
• Telomeres? • May be reattached or reformed
• Microcephaly • Moon-like face
- Interstitial deletion
• Hypertelorism
• Two breaks • Telomere retained • Interstitial acentric fragment lost • Deletions-phenotypes - Deletions seen in most chromosome arms - Certain deletions are seen more frequently
Frequency-1I45,OOO-1I50,OOO
• Micrognathia • Malformations rare -
Larynx • Laryngealmalasia, laryngeal stridor • Distinctive cry
47
Molecular Genetic Pathology
2-16
• Defects in closure of scalp • Cleft lip and/or palate • Coloboma • Cardiac defects (SO%) -
Mental retardation • Very pronounced • IQ 24 hours. Freezing blood or bone marrow specimens without prior red blood cell lysis causes contamination with heme, which can inhibit PCR amplification . Leukocyte pellets can be stored for up to I year at -20°C or for greater than 1 year at -80°C • Anticoagulants - Ethylenediamine tetra acetic acid (EDTA) (lavender topped tubes) • Preferred specimen collection type
Cervical Cells • Can be stored at room temperature for up to 2 weeks and longer when refrigerated • Fixed cytologic preparations can also be used for nucleic acid isolation
Hair Root • Useful in forensic testing , when other tissue is unavailable
Paraffin-Embedded Tissue • The most common fixative is neutral buffered formalin. When exposed to nucleic acid , formalin causes the formylation of free nucleotide amino groups, methylene bridging of bases, and cross-linking of nucleic acid with protein, resulting in increased nucleic acid fragmentation • With increasing fixation time, the amount of recoverable nucleic acid is progressively reduced . Tissue fixation in formalin for an extended period of time may reduce the yield of nucleic acid • Although RNA can be isolated, it is usually degraded ; also, formalin may inhibit subsequent reverse transcriptase-polyrnerase chain reactions (RT-PCR) • Not suitable for Southern blot techniques
- EDTA (pearl-topped tubes) • Contain the same anticoagulant as the Lavendertopped tubes in addition to a polyester material that separates most of the erythrocytes and granulocytes, and some of the lymphocytes and monocytes away from the supernatant upon centrifugation • This "Plasma Preparation Tube" is a convenient, safe, single tube system for the collection of whole blood and the separation of plasma. It can be used for certain viral load testing, i.e., HIV, HCV, and cytomegalovirus (CMV) • May contain a higher concentration of platelets than found in whole blood - Citrate (yellow topped tubes) • Acid citrate dextrose • Acceptable for molecular testing; provides a good yield of nucleic acids with>70% of the original high-molecular weight DNA - Heparin (green-topped tubes) • Least preferred specimen collection tube • Heparin concentrations as low as 0.05 U per reaction volume may cause inhibition of enzymes, i.e., DNA polymerase and Taq polymerase and prevent amplification
67
3-4
Molecular Genetic Pathology
• Attempts to remove heparin activity, for example , ethanol precipitation, boiling and filtration, pH modificiation with gel filtration, or titration with protamine sulfate do not appear to eliminate inhibition. Serial washing of the buffy coat with saline prior to DNA extraction may be helpful • Heparinase treatment of extracted DNA may also be helpful, but is expensive and not suitable for RNA due to its RNase activity. Alternatively, heparin-free RNA may be precipitated with lithium chloride
Fresh Tissue Should be collected in a sterile container (microcentrifuge tube) and frozen immediately in liquid nitrogen or in OCT and stored at -80°C. For travel of short distances, specimens should be placed in sterile gauze pre-wet with sterile saline to prevent drying . If longer distance transportation is required, specimens should be frozen immediately and transported in dry-ice.
Paraffin-Embedded Tissue Can be stored at room temperature. However, the longer the duration of storage, the more DNA degradation.
DNA Extraction Methods
Puregene •
150 IlL-20 mL of whole blood or bone marrow collected in common anticoagulants (EDTA, citrate, or heparin)
• The PUREGENE kit works (Gentra Systems , Inc., Minneapolis, MN) via alcohol and salt precipitation. The first step is to lyse cells with an anionic detergent in the presence of a DNA stabilizer that inhibits DNase activity, after which RNA is digested • The proteins are digested and removed along with other contaminants by salt precipitation. The DNA is then alcohol precipitated and dissolved in a DNA stabilizer • 25-60 minutes are required to process a sample • DNA yield is 35 ug/ml, of blood
Versagene (Gentra) • Employs high-capacity, glass fiber mini-columns, and proprietary non-chaotropic reagent s to produce high yields of highly concentrated, double- stranded genomic DNA, free of RNA, protein and other contaminants, and suitable for the most sensitive downstream analyses • Blood kits are available for whole blood samples ranging from 0.05 to 0.4 mL. In 60 minute s or less, VERSAGENE DNA can obtain up to 600 ug of DNA from 10 mL whole blood. Sample s from 0.05 to 0.4 mL can be completed in 30 minutes or less
Manual QIAamp®(Qiagen, Valencia, CAy DNA Blood Mini Kit
• Recovery rates are 60-90%
• The QIAamp DNA Blood Mini Kit (Qiagen ; Hilden, Germany, Valencia, California) simplifies isolation of DNA from blood and related body fluids with fast spincolumn or vacuum procedures. No phenol-chloroform extraction is required
Automated Systems
• The following samples can be processed: fresh and frozen whole blood (with common anticoagulants such as citrate , EDTA, and heparin) ; plasma; serum ; buffy coat; bone marrow; lymphocytes; platelets; body fluids • Typical yield from 200 ul, of blood is 4-12 ug with a processing time of 20-40 minute s • DNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through. PCR inhibitors such as divalent cations, and proteins are completely removed in two efficient wash steps, leaving pure nucleic acid to be eluted in either water or a buffer provided with the kit • Optimized buffers lyse samples, stabilize nucleic acids, and enhance selective DNA adsorption to the QIAamp membrane. Alcohol is added and Iysates loaded onto the QIAamp spin column. Wash buffers are used to remove impurities and pure, ready-t o-use DNA is then eluted in water or low-salt buffer • The complete proces s require s 20 minutes of handling time (lysis times differ according to the sample source) • With the QIAamp DNA Blood Mini Kit, blood can be processed via a vaccum manifold instead of centrifugation, for greater speed and convenience in DNA purification
68
• For blood , 50 kb fragment s are typical
• Various automated systems are available for the extraction and purification of nucleic acids (see Chapter 13)
RNA Extraction Methods GeneralConsiderations • Adequate homogenization of cells or tissues is an essential step in RNA isolation to prevent RNA loss and degradation. The method of homogenization is best tailored to the particular cell or tissue type, i.e., vortexing in a cell lysis solution for cultured cells or more rigorou s disruption technique s such as enzymatic digestion for animal tissues, plant tissues, yeast, and bacteria for maximum recovery of RNA • Endogenous RNases must be inactivated immediately upon tissue harvesting to prevent RNA degradation. This can be effectively accompli shed by - Homogenizing samples immediately after harvesting in a chaotropic-based cell lysis solution (e.g., containing guanidinium) - Flash freezing small tissue sample s (homogenized) in liquid nitrogen - Utilization of an aqueou s, non-toxic collection reagent (e.g., RNAlater® (Ambion, Foster City, California), an RNA stabilization solution) that stabilizes and protect s cellular RNA in intact, unfrozen tissue and cell
3-5
Diagnostic Methodology and Technology
samples when samples cannot be immediately processed. However, tissue samples must be in thin pieces (0.5 em) so that the RNAlater (Ambion, Foster City, California) can quickly permeatethe tissue before RNases destroy the RNA. Cells or tissues can be harvested into RNAlater and stored at room temperature for up to 1 week, at 4°C for up to 1 month, or at -20°C indefinitely • RNA is an unstable molecule and requires maintaining RNase-free laboratory conditions and diethylpyrocarbonate (DEPC)-treated glassware and water
Ambion Total RNA Isolation • LeukoLOCK® (Ambion, Foster City, California) Total RNA Isolation System - Method for cellular fractionation of whole blood, total RNA stabilization, and extractionof RNA from the leukocytes (includingT and B-cells, neutrophils, eosinophils, basophils, monocytes, and other less abundant cell types) Used for molecular detection of infection, inflammation, and autoimmune diseases The LeukoLOCK System employs filter-based leukocyte-depletion technology to isolate leukocytes from whole bloodand stabilize the cellson a filter. Anticoagulated bloodis passed through a LeukoLOCK filter, which captures the total leukocyte population while eliminating red bloodcells (including reticulocytes), platelets, and plasma. Afterrinsing withphosphatebuffered saline, the filter is flushed with RNAlater to stabilize the RNA in the captured leukocytes. The RNA can be isolated immediately, or stabilized cellscan be maintained for several days at room temperature, or for longer periods at -20°C or -80°C Purification of the RNA is accomplished by disrupting the capturedcells in a guanidinium thiocyanate-based solution releasing RNA while simultaneously inactivating nucleases. The cell lysate is collected and briefly treated with Proteinase K. RNA is then purified from the lysateusingAmbion's MagMAXTM magnetic bead-based technology for washing, followed by DNase treatment (with TURBODNase™) and final clean-up 10-20 ug of RNA is isolated per 9-10 mL of whole blood - RNA recovered using this method contains less than Ill0th the amount of reticulocyte-derived (X - and ~-globin mRNAs commonly present in RNA samples derived from unfractionated whole blood impurities, which can interfere with downstream expression profiling applications - mRNAs present in typical RNA samples from unfractionated whole blood • MagMAXTM AUND Viral RNA Isolation Kit, total RNA isolation
- Ambion's MagMAX system utilizes magnetic bead technology to isolate RNA from cells and viral RNA from cell-free samples, such as serum, plasma, swabs, and cell culture media. With this technology RNA is bound more efficiently than with glass fiber filter methods, resulting in higher and more consistent RNA yields. The MagMAX magnetic bead technology eliminatesfilter clogging from cellular particulates and allows the end user to concentrate RNA from large, dilute samples - As few as 10 copies of viral RNA from 100 to 400 ul, sample can be recovered - Typical viral RNA recovery exceeds 50% - Ideal when working with low viral concentrations - Extraction procedure takes approximately 30 minutes to complete
mRNA Isolation • Poly(A) RNA (mRNA) makes up between 1 and 5% of total cellular RNA • mRNA isolation procedures are used in - Detection and quantitation of extremely rare mRNAs - Synthesis of probes for array analysis - The construction of random-primed cDNA libraries, where the use of total RNA would generate rRNA templates that would significantly dilute out cDNAs of interest. Removal of ribosomal RNA (rRNA) and transfer RNA (tRNA) results in up to a 30-fold enrichmentof a specific message • Poly(A)purist® Kit (Ambion, Foster City, California) - Isolation of high-quality mRNA requires efficient removal of rRNA and specific recovery of poly(A) RNA. Yield estimates based solely on mass are not indicative of the quality or quantity of mRNA recovered since contamination from rRNA can add significant contribution to the mass - rRNA contamination is caused by non-specific adsorption to the oligo(dT) matrix and binding to/copurifying with mRNA. Ambion's poly(A) purist kit minimizes this unwanted interaction while promoting efficient oligo(dT) selection - The poly(A)purist kits are available in two formats, one that uses oligo(dT) cellulose-based selection (poly[A]purist kit and micropoly[A]purist kit), and one that utilizes oligo(d'T) magnetic bead-based purification (poly[A]purist magnetic bead based purification method [MAG] kit) • Oligo(dT) cellulose-based selection-the oligo(dT) cellulose based kits (poly[A]purist and micropoly[A]purist) utilize batch binding of RNA to premeasured aliquots of oligo(d'I') cellulose to avoid the problems of slow flow rates and clogged columns often experienced during conventional, gravity-driven chromatography. A spin cartridge is used in the wash and elution steps for speed and
69
3-6
Molecular Genetic Pathology
convenience. Furthermore, time savings are realized becau se a single round of selection with poly(A) purist kits is comparable with two or three rounds of selection using conventional technology • The poly(A) purist kit contain s reagent s for 6 isolations, each for up to 2 mg total mRNA, while the micropoly(A) purist kit contain s reagents for 20 isolations, each for 2-400 ug total mRNA • Magnetic bead-b ased selection employed in the poly(A) purist MAG Kit delivers the benefits of increa sed processing speed, ease of handling, and scalability. Using the same hybridization and wash system as the cellulose-based Poly(A) Purist Kits, but with magnetic particle technology, the entire selection procedure can be completed in as little as 45 minutes. In addition , the reactions are completely scalable, allowing efficient selection from samples smaller than 100 ug of total mRNA to very large (I mg) total mRNA samples • The Poly(A) Purist MAG Kit contains reagents for up to 80 isolations, each from 100 ug of total mRNA, or for 8 large preps from as much as I mg of total mRNA
Versagene/Purescript (Gentra) • This is a simple and effective technology for isolating pure RNA from blood, animal tissue , or cultured cell samples • Convenient, easy-to-use kits come complete with premixed reagents, eliminating the need to prepare reagents before beginning purification • Kits do not contain any harsh organic solvents, foulsmelling reducing agents, or reactive cyanide salts, so hazardou s waste dispo sal is not necessary • Sampl es can be processed at room temperature on the lab bench, without a fume hood
Purescript Total RNA Purification Kits (Gentra) • These kits utilize a modified salt precipitation procedure in combination with highly effective inhibitors of RNase activity • Sample s may be whole blood or bone marrow, from 200 ul, to 30 mL, collected in common anticoagulants (EOTA, citrate , or heparin ) • Sample s are processed in 60 minutes
completely removed in two efficient wash steps, leaving pure RNA to be eluted in either water or a buffer provided with the kit • Extract s total cellular RNA from fresh whole blood and other sample sources ready to use in RT-PCR and blotting procedures. The typical yield is 1-5 ug RNA per mL healthy blood or up to 100 ug RNA from tissue • Red blood cells are selectively lysed and white cells collected by centrifugation. White cells are then lysed using highly denaturing conditions, which immediately inactivate RNases. After homogenization using the QfAshredder'" spin column, the sample is applied to the QIAamp spin column. Total RNA binds to the QIAamp membrane and contaminants are washed away, leaving pure RNA to be eluted in 30-100 ul, RNase-free water (provided with the kit) for direct use in any downstream application
Quality and Quantity Assessment Analysi s of the quality, quantit y/concentration, and size of nucleic acid used is critical for the success of all aspect s of molecular testing . The following method s can be utilized to determine nucleic acid characteri stics: spectrophotometry, fluorescent dyes, and electrophoresis. • Spectrophotometry - This is the simplest and most rapid method to evaluate purity, quantity, and quality of nucleic acids - DNA and RNA demonstrate maximum absorption at approximately 260 nm. Protein absorbs at 280 nm, while background scatter absorb s at 320 nm. Protein absorption is primarily the result of the aromatic amino acids phenylalanine, tyrosine, and tryptophan - DNA and RNA quality or purity can be measured by analysis of the optical density (00) at 260 nm and 280 nm, (00 260 - 00320)/(00280 - 00320), A ratio of 1.7-2.0 is indicative of good quality nucleic acid. Less than 1.7 indicate s too much protein or the presence of other contaminants, for example , organic solvents - DNA and RNA quantit y can be measured by 00260 reading. An 00260 reading of 1.0 corre sponds to 50 ug/rnl, of double- stranded DNA, 40 ug/ml, of single stranded RNA, or 35 ug/ml, single stranded DNA. Concentrations are calculated as follows: • dsONA (ug/ml.) = (0 0 260 - 00320) x dilution factor x 50 ug/ml,
• RNA yield is 2-7 ug/rnl, of blood
• ssRNA (ug/ml.) = (0 0260 - 00 320) x dilution factor x 40 ug/rnl,
QIAamp®RNA Blood Mini Kit
• ssONA (ug/rnl.) = (0 0 260 - 00 320) x dilution factor x 35 ug/ml,
• Simplifie s isolation of RNA from blood with a fast spincolumn procedure. No phenol-chloroform extraction is required • RNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through . PCR inhibitors such as divalent cations, and proteins are
70
• Fluore scent dye - Alternative method to assess purity, quantity, and quality of nucleic acids - The following fluore scent dyes bind nucleic acids: ethidium bromide (EB), acridine orange,
Diagnostic Methodology and Technology
Storage period Storage conditions
3-7
7 years • 4
4
-70°C
I
• 4
Recommended for long-term storage
•
I
Recommended for indefinite storage
Fig. 1. Recommended conditions for DNA storage .
diaminobenzoic acid (DABA), and propidium iodide. The most commonly used of these is EB
• Concentrate dilute nucleic acid using ethanol precipitation
- EB can be used in quantitative assays. The intensity of fluorescence is dependent on the ratio of EB to nucleic acid
• Repeat isolation from any residual specimen, modifying sample volume to compensate for possible low cell number or poor specimen handling
- Can reliably detect as little as 5-10 ng of DNA • Electrophoresis - Small agarose gels (minigels) offer an easy method to determine size and quantity of nucleic acid Molecular-weight ladders (e.g., 100 bp marker) provide a reference standard for size determination - Nucleic acid in samples can be quantified by extrapolation from a standard curve. The standard curve is produced by performing serial dilutions of samples with known nucleic acid concentrations
- Too much nucleic acid yield • Dilute sample and remeasure OD reading within instrument range - Poor nucleic acid quality • For degradation, repeat isolation from residual specimen • For protein or other contamination, purify specimen by reisolation - Band smearing
- Band smearing indicates DNA degradation or too much DNA loaded • Agilent 2100 bioanalyzer (Agilent Technologies Inc., Santa Clara, California) - This system is an alternative to traditional gel-based analysis that integrates the quantitation of RNA samples with quality assessment in one quick and simple assay - First commercially available microfluidics instrument to provide detailed information about the condition of RNA samples - When used in coordination with the RNA 6000 LabChip®(a registered trademark of Caliper Technologies Corporation [Caliper Life Science Inc., Hopkinton, Massachusetts]), as little as I ~L of 10 ng/~L RNA is required per analysis - In addition to assessing RNA integrity, this automated system also provides a good estimate of RNA concentration and purity (i.e., rRNA contamination in mRNA preparations) in a sample - Concentration, integrity, and purity can be simultaneously analyzed in a single 5 ng sample and displayed as a gellike image, an electropherogram, or tabular formats • Troubleshooting - No or low nucleic acid yield • Ensure that ample time is allowed for resuspension/rehydration of specimen
• Due to poor DNA qualitylDNA degradation • Due to poor quality of DNA synthesis
Nucleic Acid StoragelHandling General Considerations • Nucleic acid samples are best stored as multiple aliquots in separate tubes in order to prevent degradation and damage from successive freeze-thaw events. Aliquotted tubes also minimize the potential for accidental contamination, for example, by DNase, RNase, specimen, or amplicon • To prevent amplicon contamination, exposed surfaces (bench space/work hoods, instruments, and floors) should be decontaminated with 10% bleach solution followed by 70% ethanol after use • To reduce the likelihood of exposure to ambient RNases , all laboratory surfaces, including pipetors , benchtops, glassware, and gel equipment should be decontaminated with a surface decontamination solution . RNase-free tips, tubes, and solutions should always be used and gloves should be changed frequently
DNA • Purified DNA should be stored in TE buffer at 4 DC for 10Mb (10,000 kb)
Fig. 26. Mechanism of DGGE and an example of its application (analysis of sequence variation in the second internal transcribed spacer (ITS-2) of ribosomal DNA of strongyloid nematodes). Schematic representation of heteroduplex formation and principle ofDGGE (A). Mutant homoduplexes (lane M) melt at a lower denaturant concentration than non-mutant homoduplexes (lane N) and are consequently retarded at a higher position in the gel. Heteroduplexes (lane N+M) melt at even lower denaturant concentrations. DGGE analysis of sequence variation within ITS-2 PCR products (350 bp in size including the GC-clamp) amplified from single adults of the nematode Haemonchus contortus originating from a natural population. (B) Each bright (homoduplex) band in DGGE represents an enriched clonal sequence type of ITS-2 as determined by direct sequencing of excised bands. Bands in the
102
• Principle - The theory behind PFGE is controversial. In general, DNA molecules greater than 30-50 kb migrate with the same mobility regardless of size during continuous field electrophoresis; thus they are seen in the gel as a single large diffuse band. Multiple fragments of DNA in such a band can be separated from each other if an electric field is applied to change direction of electrophoresis. With each reorientation of the electric field relative to the gel, smaller-sized DNA will begin to move in a new direction more quickly than the larger DNA, thereby leaving the larger DNA fragments behind. This provides a separation of long strands of DNA based upon size
upper third of the gel represent heteroduplex molecules produced during PCR. (Reprinted from Gasser and Zhu, Parasitol Today 1999;215(11):462-465 . (© 1999 with permission from Elsevier)
3-39
Diagnostic Methodology and Technology
FIGE
rn
- Cloning large DNA using yeast artificial chromosomes (YAC's) and PI cloning vectors
A-
Detecting in vivo chromosome breakage and degradation - Epidemiologic studies, e.g., to establish the degree of relatedness among different strains of the same specie s +
RGE
B+
A-
CHEF
•••••
B-
.·W·. +
·LJ • •·
B+
•
••
A+
Fig. 27. Electrode configurations of commonly used pulsed field gel electrophoresis units .
• Advantages - Ability to separate and characterize large DNA fragment s, for example, chromosomes of microorganisms - Ability to examine the elongated and oriented configuration of large DNA molecules in agarose gels at finite field strengths - High sensitivity and reproducibility. It is one of the most reliable techniques for determining strain genetic similarity in many bacteria • Limitations - Intact DNA is required . Special care must be taken not to shear or damage the DNA - Faulty results may arise due to
- PFGE instrumentation can be generally categorized into four different types (Figure 27): • Field inversion gel electrophoresis (FIGE) works by periodically inverting the polarity of the electrodes during electrophoresis • The other type of instrumentation functions to reorient the DNA at smaller oblique angle, to move the DNA fragment s forward in a zigzag pattern down the gel. This type of instrumentation includes transverse-alternating field gel electrophoresis (TAFE), contour-clamped homogeneous electric field (CHEF) and rotating gel electrophoresis (RGE) - PFGE special equipment consists of a gel box, a chiller and pump, a switch unit, a programmable highvoltage power supply, and computer software • Procedure - Prepare intact or unsheared DNA by embedding intact cells in agaro se plugs and digesting away the proteins in the plugs using enzymes to avoid shearing of large DNA fragments - Digest intact DNA in the plugs with a rare-cutting restriction endonuclease - Separate DNA fragments by gel electrophoresis using PFGE special equipment - Detect and interpret the banding patterns • Applications (Figure 28) - Identifying RFLP's and fingerprinting - Determining the number and size of chromosomes (electrophoretic karyotype) from fungi and parasites such as Leishmania, Plasmodium, and Trypanosoma - Gene mapping and construction of physical maps of the chromosomes of human and prokaryotic organisms
• Easy contamination of the agarose plugs with DNases by accidental introduction of non-specific DNA-degrading enzymes • Incomplete (partial) digestion of DNA by the restriction enzyme that generates unusually large fragments Methodology is complicated, time consuming - High cost
Single-Strand Conformational Polymorphism (SSCP) • General information - An electrophoretic technique introduced by Sunnucks et al. in 1989 and used to separates ssDNA or RNA based on mutation-related conformational differences • Principle (Figure 29): - Single-stranded DNA molecules assume unique conformations that depend on their nucleotide sequences under non-denaturing conditions and reduced temperature. Subtle differences in sequence, often a single base pair variation , may cause a different secondary structure by altering intrastrand base pairing, resulting in a measurable difference in electrophoretic mobility. Small or tightly packed molecules migrate more quickly through the gel than large or loosely packed molecules Most SSCP protocols are designed to analyze the polymorphism at a single locus using a specific pair of PCR primers bracketing the target region . The target ssDNA is amplified by asymmetric PCR, in which one primer is present in exces s over the other. After the low-concentration primer supply is exhausted, continued PCR only allows amplification of the target ssDNA
103
3-40
Molecular Genetic Pathology
2
3
4
5
6
7
8
9
10
11
12
13
14
15
---------------
-
-
-
-
--
Fig. 28. PFGE of group B Streptococcus (GBS) strains isolated from college women with urinary tract infections and their most recent sex partner. Lane 1 is a DNA ladder. Lanes 2-3 and 14-15 represent rectal and vaginal GBS isolates from two different women. Lanes 4-6 are two urine isolates and one rectal isolate from one woman and lanes 7 and 8 are the urine and rectal isolate from her sex partner, respectively. Lanes 9-11 represent a female vaginal isolate and her sex partner's urine and rectal isolate. (Adapted from Manning, SD, Frontiers Biosci. 2003;(Review)8: sl-18)
• Procedure - Prepare DNA fragments by digesting genomic DNA with restriction endonucleases and/or PCR amplification of the target ssDNA fragment or peR amplification of the dsDNA followed by denaturation into single strands - Denature DNA samples in an alkaline (basic) solution - Separate DNA fragments by neutral PAGE - Stain the gel or transfer DNA onto a nylon membrane followed by hybridization with probes - Compare the mobility of control with unknown DNA sample fragments - Confirm identity of mutations by DNA sequencing
- Limited sensitivity. Under optimal conditions, approximately 80-90% of the potential base exchanges are detectable by SSCP. Changing the pH and adding glycerol may increase sensitivity - No information provided for the position of the change - A constant temperature is required during the electrophoresis for best results, because ssDNA mobilities are temperature-dependent • Applications: - Detection of DNA polymorphisms and mutations at multiple sites in DNA fragments - Serving as genetic markers because they are allelic variants similar to RFLPs
• Advantages: - Simple procedure - Inexpensive equipment - No need for precise knowledge of the sequence polymorphism
RFLP Analysis
• Limitations: Limited size range of DNA fragments (150-300 bp) for optimal separation results . Adding certain reagents such as glycerol to the gel may increase the size limit. RNA-SSCP electrophoresis may allow for separation of larger-sized fragments
• General information - RFLP analysis is a methodology that combines restriction enzymatic digestion and conventional gel electrophoresis to separate and anlyze the DNA fragments. The resolved DNA fragments can either be visualized with EB or by Southern blot
104
-
Use in molecular genetics with modifications, such as heteroduplex analysis, ribonuclease protection assay, SNP techniques
3-41
Diagnostic Methodology and Technology
A
MST II
Wild-type (W)
...
dsDNA
..-
..
ssDNA
QIJ--
MST II
L
Hemoglobin S
_r······. ·.
PCR
t
t
MST II
_ r ···················..···j._ _ Probe
MST II
.A()
1.15 kb
Hemoglobin A
1.35 kb
MST II
··············;·i···············1. JJ
Annealing
Heterozygous Homozygous Homozygous
B Polymorphism or mutant (M)
= ...= ::,:::=;:
dsDNA
PCR ssDNA
t
t
D
- - t- -
C Gel electrophores is dsDNA W M
AlS Electrophoresis
~
Annealing
ssDNA W M
----
Fig. 29. SSCP principle. Wild-type (A) and polymorphism or mutant (B) double-stranded DNA molecules have equal lengths , but their corresponding single-stranded fragments show different conformations. The banding results after gel electrophoresis of both double-stranded and ssDNA fragments is shown (C) . The migration patterns of the doublestranded fragments are indistinguishable. However, three single-stranded fragments display different migration patterns, or mobilities , according to their conformations.
- Differences in the size and/or number of restriction fragments result from sequence changes (base substitutions, additions, deletions, and so on) that involve restriction enzyme recognition site(s) - The term "RFLP" also refers to these sequence changes (polymorphisms) themselves - Special types of RFLPs include • Minisatellites, detecting hypervariable RFLP loci (variable number tandem repeat loci) • Restriction landmark genomic scanning , 2D RFLP analysis • Principle : Each restriction enzyme recognizes a specific sequence (4--6 bp, or occasionally 8 bp in length). Any change of this
sequence (e.g., by mutation, insertion, or deletion) results in loss of the splice site due to lack of recognition by the enzyme. Digestion of a DNA sample by restriction enzymes produces a collection of DNA fragments of precisely defined length (restriction fragments), which can be resolved by gel
1.35 kb
_
1.15kb
-
AlA
-
-
SIS
Fig. 30. Schematic presentation of RFLP (an example of detecting a missing site (for MstII) in hemoglobin S). Hemoglobin S produces a longer DNA fragment (1.35 kb) than hemoglobin A (U5 kb) after MstII restriction enzyme digestion due to mutation at an MstII cleavage site (upper panels). Gel electrophoresis can separate the two types of hemoglobin genes based upon the different sizes of their corresponding restriction fragments (lower panel).
electrophoresis. RFLPs can represent normal variation or be associated with disease. • Procedure (Figure 30) - Isolate and purify genomic DNA with or without PCR amplification - Digest DNA with restriction enzyme(s) - Separate DNA fragments according to their sizes by gel electrophoresis - Detect DNA bands by staining the gel or blotting DNA onto a membrane followed by hybridization using a labeled probe (Southern blot) • Applications - Genetic testing or screening of human DNA for the presence of potentially deleterious mutations - Forensic DNA testing or fingerprinting - Genetic epidemiology or population studies - Molecular microbiology to identify related species • Advantages - No prior sequence information required - Inexpensive • Limitations - RFLP sites recognized by enzymes must be present in association with known mutations - The informativeness is limited. Polymorph isms are only detected if they affect restriction sites - It requires a large amount of DNA with high integrity - Sensitivity is variable - Difficult to standardize - Time-consuming and laborious
105
3-42
Molecular Genetic Pathology
SEQUENCING OF NUCLEIC ACIDS
General Information • DNA sequencing is the process of determining the nucleotide order of a given DNA fragment. Currently, almost all DNA sequencing is performed using the chain termination method developed by Frederick Sanger. This technique uses sequence-specific termination of DNA synthesis reactions using modified nucleotide substrates • Another method was developed by A Maxam and W Gilbert, hence called Maxam and Gilbert sequencing. This method utilizes a base-specific chemical modification followed by cleavage of modified DNA. This method is no longer used for routine DNA sequencing because the reagents are toxic and the procedure is not amenable to automation. However, it is still valuable in special applications such as assaying protein and DNA interactions known as "footprinting" • Other technologies, such as Pyrosequencing, SNaPshot, and Invader, are also being used for sequencing and SNP detection
Sanger Sequencing • Principle : In chain terminator sequencing (Sanger sequencing) extension is initiated at a specific site on the template DNA by using a short oligonucleotide primer complementary to the template at that region. The oligonucleotide primer is extended using a DNA polymerase. Included with the primer and DNA polymerase are the four deoxynucleotides (dATP, dCTP, dGTP, dTTP) along with a low concentration of a chain terminating nucleotide (most commonly a di-deoxynucleotide, ddNTP). Limited incorporation of the chain terminating nucleotide by the DNA polymerase results in a series of related DNA fragments that are terminated only at positions where that particular nucleotide is used. Four separate DNA polymerase reactions, each using a different one of the four di-deoxynucleotides are carried out. The products of these reactions are then sizeseparated by electrophoresis in separate lanes of a slab polyacrylamide gel, or more commonly now, by CEo • Procedures - The DNA sequencing reactions are somewhat analogous to PCR (see Amplification Methods section) • The reaction mix includes the template DNA, free nucleotides, an enzyme (usually a variant of Taq polymerase) and a "primer"-a short piece of ssDNA about 20-30 nt long that can hybridize to one strand of the template DNA • For detection purposes, the primers are labeled with 32S radioisotope • DNA needs to be purified to remove unincorporated nucleotides and primers, which can interfere with the sequencing reaction and results (see below) The Sanger technique utilizes 2', 3'-di-deoxynucleotide triphospates (ddNTPs) , molecules that differ from
106
deoxynucleotides by having a hydrogen atom attached to the 3' carbon rather than an OH group (Figure 31) • These molecules terminate DNA chain elongation because they cannot form a phosphodiester bond with the next deoxynucleotide - The sequencing reaction is conventionally performed in four separate sequencing reactions choosing a different ddNTP of interest for each reaction • For example, a mixture of a particular ddNTP (such as ddCTP) with its normal dNTP (dCTP in this case), and the other three dNTPs (dATP, dGTP, and dTTP). The concentration of ddCTP should be 1% of the concentration of dCTP. The logic behind this ratio is that after DNA polymerase is added, the polymerization will take place and will terminate whenever a ddCTP is incorporated into the growing strand
• If the ddCTP is only 1% of the total concentration of dCTP, a whole series of labeled strands will result (Figure 32). Note that the lengths of these strands are dependent on the location of the base relative to the 5' end. These reactions can be done as PCR to improve the sensitivity and specificity - When these reactions are completed, PAGE is performed. The products of each reaction are loaded into separate lanes for a total of four lanes (Figure 33) • The DNA is transferred to a nitrocellulose filter. Autoradiography is performed so that only bands containing DNA with radioactive label will appear - In PAGE, the shortest fragments will migrate the farthest. Therefore, the bottom-most band indicates the particular di-deoxynucleotide that was added first to the labeled primer. In Figure 33, for example, the product that migrated the farthest was from the ddTTP reaction mixture . Thus , ddTTP must have been added first to the primer, and its complementary base, thymine, must have been the base present on the 3' end of the sequenced strand. One can continue reading in this fashion . Note in Figure 33 that if one reads the bases from the bottom up, one is reading the 5' to 3' sequence of the strand complementary to the sequenced strand. The sequenced strand can be read 5' to 3' by reading top to bottom the bases complementary to those on the gel
Dye Terminator Sequencing • An alternative to labeling of the primer is to label the terminators instead, commonly called "dye terminator sequencing". The major advantage of this approach is that the complete sequencing set can be performed in a single reaction, rather than the four needed with the labeled primer approach. This is accomplished by labeling each of the dideoxynucleotide chain-terminators with a differently colored fluorescent dye
3-43
Diagnostic Methodology and Technology
Structures of nucleic acids
DNA NH2
0 N
o
-0 P
C
C
H C N
C
H2 C / 0 " ,
dAMP
N C H2
N
N C N C
H
H H N C
N
N
ddAMP
C H2
H\~1H H
C
*
C CH3
H
dTMP
0 0
C
H C
2C/""
0
-0 P
o
P
-0
H\H_ 1H --. 0
NH2
0
C H
N
H,c( ' " H
~iH
--.
0
-0
P
H
~iH
- - . HO
N
C
N
C
C N
H
C
NH2
H C
0
H'C~O", H
0
N
dGMP
H
Fig. 31. Comparison of normal nucleotide structure with the structure of a chain terminating dideoxynucleotide. Asterisk indicates the absence of a hydroxyl group at the 3' position of the dideoxynucleotide that prevents formation of DNA. Red arrow highlights hydroxyl group position.
• Products of the sequencing reaction are separated by capillary or slab gel electrophoresis. Laser detection is used to identify the bases at each position. The sequence is "read" from the bottom up, using a key where "A" is green, "C" is blue, "G" is yellow, and "T" is red. Using software provided by the manufacturers of sequencing machines , the signal/noise ratios of the dyes is determined for each position so that the proper base can be "called". The order of the bases is displayed in a format known as a "chromatogram," "electropherograrn," or "trace" file (Figure 34) • This method is easier and quicker than the dye primer approach, but may produce more uneven data peaks (different heights), due to a template-dependent difference in the incorporation of the large dye chain terminators. This problem has been significantly reduced with the introduction of new enzymes and dyes that minimize incorporation variability. Nonetheless, the context of a given nucleotide has a significant influence on peak height (Figure 35) . This feature may be useful in the interpretation of a trace, since artifactual peaks have no effect on the heights of adjacent peaks
• Common artifacts in dye-terminator sequencing traces include "dye blobs" (Figure 36) and large peaks that occur if bubbles are present in the capillary (Figure 37) • This method is now used for the vast majority of sequencing reactions as it is both simpler and cheaper. The major reason for this is that the primers do not have to be separately labeled (which can be a significant expense for a single-use custom primer), although this is less of a concern with frequently used "universal" primers
RNA Sequencing • As RNA is generated by transcription from DNA, the information is already present in the cell's DNA. Therefore, RNA sequence can be deduced from the coding DNA sequence • However, it is sometimes desirable to sequence RNA molecules. In particular, in eukaryotes RNA molecules are not necessarily co-linear with their DNA template , as introns are excised • To sequence RNA, the usual method is first to reverse transcribe the sample to generate DNA fragments . The
107
3-44
Molecular Genetic Pathology
---
A ATTCGACGGCAGTATGCCTAGC ATTCGACGGCAGTATGCC ATTCGACGGCAGTATG~
ATTCGACGGC ATTCGAC ATTC
Fig. 32. Schematic diagram of one lane of a sequencing gel containing products of a sequencing reaction using ddCTP. The position of the chain-terminating dideoxynucleotide in each strand is underlined.
DNA can then be sequenced as described above (Sanger or dye terminator sequencing)
C
G T
- -- - - --- - --- - - Fig. 33. Conventional sequencing gel. Sequence output: 5' TACGTACACGTGACACGTACTTAC 3' .
Applications • Gene sequencing • Detection of SNP
Limitations of DNA Sequencing • Usually can only read out 500-700 nucleotides accurately. Therefore, one needs to break the DNA into several fragments for sequencing if the sequence is too long • Limited sensitivity for SNP detection, if the SNP is present in 300 I1g of total protein) then proteins can be excised from the gel, subjected to in-gel proteolysis and analyzed by MS • Advantages: - The main advantage of using 2D electrophoresis is the large mass range and the amount of proteins that can be analyzed at anyone time. 2D electrophoresis is particularly effective in the analysis of proteins within the mass range of 20-250 kDa and pI of 3-8, and can separate 2000-3000 proteins in one gel - 2D electrophoresis is the single best method for resolving highly complex protein mixtures • Limitations: - It is difficult to isolate proteins with isoelectric points outside of the range of 3.0-8.0. This is due to problems associated with creating stable pH gradients outside that range - 2D electrophoresis is a low-throughput, timeconsuming process (3-4 days per run) that involves many steps and requires a high level of laboratory skill to obtain good results
3-61
- 2D electrophoresis has diminished utility in the analysis of extremely acidic, basic, or hydrophobic proteins such as membrane-bound proteins, and also in the analysis of smaller proteins and peptides (· . . :',"": ,:.' . ,
«
10°
10°
10°
10 1 I( -FITC
10 2
10 3
10°
10 1 I(-FITC
10 2
10 3
Fig. 18. Surface Ig light chain expression in reactive and malignant B cells. (A) Reactive B cells show heterogeneous (polyclonal) expression of x and A. (B) Mature B cell neoplasms are monoclonal with the entire lymphoma population expressing only one type of Ig light chain . • Gating based on SSC/FSC characteristics is most commonly used • On FSC/SSC dot plots, neoplastic lymphoid cells are seen in the area of small or large lymphocytes. In large cell lymphomas or hairy cell leukemia, the neoplastic population may overlap with the monocyte region • The display of SSC vs CD45 is not typically used for gating of lymphomas as most mature lymphoid malignancies display high-density CD45 antigen. Only rare cases of lymphoma show slightly dimmer CD45 , or even more infrequently, are negative for the CD45 antigen as in lymphoma with plasmablastic differentiation • The designation "clonal" implicates that the entire lymphoma population is derived from a single lymphoid cell that underwent malignant transformation. Thus, all neoplastic cells should demonstrate similar genetic and immunophenotypic features . The clonality is best represented as an expression of uniform (monoclonal) surface light chain or TCR. This stands in stark contrast to the highly variable, polyclonal immunophenotype of normal lymphocytes, which reflects a random receptor gene rearrangement and a subsequent response to a variety of antigenic stimuli
Mature B Cell Neoplasms • Normal precursor B cells randomly rearrange Ig heavyand light chains. As a result, mature B cells show a polyclonal pattern of Ig heavy and light chains (Figure 18A). In contrast, a monoclonal surface light chain expression (exclusively x or A) is seen in the majority of B cell lymphomas (Figure 18B)
174
• The light chain monoclonality along with the expression of pan-B cell markers is diagnostic of B-cell lymphoma. The sub-classification is based on the presence and specific density of selected lymphoid markers • Rarely, mature lymphoid neoplasms lose their surface Igs, a feature not commonly seen in normal mature B cells • On the contrary, neoplastic plasma cells typically lack surface Igs and show only cytoplasmic expression of K or A
Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma (CLUSLL) • CLL and SLL are derived from re-circulating CD5+, IgM+, IgD±, B cells normally present in the peripheral blood (Figure 19) • The WHO classification considers CLL and SLL as one entity with different presentations. The diagnosis is based on the predominant site of involvement (bone marrow/peripheral blood vs lymphoid organs) • CLLlSLL is positive for pan-B cell antigens including CDI9 and C020 (dim expression, Figure 19B and C) • In addition, the expression of CD5, C023, and weak surface monoclonal (x or A) light chain is seen • The absence of FMC? and cyclin DI, and presence of CD23 are features distinguishing CLLlSLL from mantle cell lymphoma (MCL) • Currently, two groups of CLLlSLL are recognized: - One, corresponding to the pre-germinal center phenotype (naive, showing no mutations in the variable region ofIg heavy chain [VH ] gene) - The second type is derived from memory B cells (post-germinal center, mutated VH gene)
6-21
Cl in ical Flow Cytometry
A
103
B
C'l C\l
0
, ,
, '
. ,.
~
:
,
102
, '
. ..... .--: . .. ... .
0
en en
a:
~
~
"
.
• .. ,
d> 10 '
0
~
,
~.
'.
- ...
~
,~
U
.., 10°
"
'
j. i;", ..:
•
.... ,". • •• =-" r,
.'
.. ,
,.
, "
"0°
d
0
0
1023
C
0
103
102
102 ~
III
U
U f-
. ..
a.. c1:>
10'
III
+
~
o
~
o
.. ., :.
..
"
10'
0
o
." :~:.:.~'~l"=1......~......~........f--. .--tlt--...- t1- - - • Inactive gene
• Maternal effect is the phenomenon in which the genotype of the mother is expressed unaltered in the phenotype of the offspring. This generally occurs when maternal mRNA or mitochondrial DNA influences early stages of embryonic development • Pathologic epigenetic changes are non-sequence-based alterations, which interrupt gene function and cause disease. Examples include: - Hypermethylation of promoter regions for tumorsuppressor genes
Fig. 4. Epigenetic effects are stable changes in gene expression not due to genomic mutation. One important epigenetic process is gene silencing, the phenomenon of gene "switching off" by any mechanism other than genetic mutation. DNA methylation is the most frequent mechanism for gene silencing. This process impedes transcription by adding a methyl group (purple dots) to cytosine (larger blue dots) in the promoter region of a gene to eliminate its expression.
Other Epigenetic Processes • Paramutation is an interaction between two allele s of a single locus, resulting in a heritable change of one of the allele s. Thi s phenomenon, which violates Mendel' s law of independent transmi ssion of traits , allows for varying penetrance or continuous variation of a monogenetic trait • Bookmarking is an epigenetic mechanism for transmitting cellular memory of gene expression pattern to daughter cells. This biologic phenomenon causes daughter cells to maintain the phenotype of a cell lineage • Imprinting causes a subset of all the genes to be expressed according to their parental origin • X-chromosome inactivation is a DNA methylation process causing one of the two X-chromo somes in a female mammal to be randomly inactivated. This compensates for the gene dose doubling of X-chromosome genes in females • Position effect is the expression effect of gene location in a chromosome. Expression is often changed by translocation • Reprogramming refers to demethylation and reestablishment of DNA methylation during mammalian fetal development • Transvection is an epigenetic interaction between an allele on one chromosome and the corresponding allele on the homologous chromosome. This interaction may lead to either gene activation or repression
- Hypomethylation of promoter switches on oncogenes - Histone modification causing heterochromatin in regions of tumor-suppressor gene loci - Loss of gene imprinting is associated with many pediatric tumors. Loss of IGF2 imprinting accounts for half of all Wilms' tumors • Epigenetic carcinogens are not mutagenic but result in increased incidence of tumors . Many of these have previously been classified as chemical carcinogen promoters . Examples include diethylstilbestrol , arsenite, hexachlorobenzene, and nickel compounds • Teratogens influence fetal development by epigenetic mechanisms - Reversibility of epigenetic changes expo ses pathologic epigenetic change s to possible cure by targeted therapy • Examples of "epigenetic therapy" include : - DNA methyltran sferase inhibitors • Nucleoside analogs with a modified cytosine ring that is resistant to DNA methylation • Non-nucleoside analogs that inhibit DNA methylation by binding to the catalytic region of the methyltransferase enzyme - Histone deacetylase inhibitors • Short-chain fatty acids that inhibit cell growth and induce apoptosis by inhibiting histone deacetylase • Hydroxamic acids (R-CONHOH) are potent inhibitors of histone deacetylase. They induce cell differentiation and inhibit proliferation • Cyclic tetrapeptides are irreversible histone deacetylase inhibitors • Benzamides are anti-tumor agents that bind to the catalytic region of histone deacetylase - Epigenetic therapies may be applicable whenever aberrant heterochromatic regions in tumor chromosomes involve tumor-suppressor genes or other critical regulatory genes
191
Molecular Genetic Pathology
7-8
DNA METHYLATION Overview • DNA methylation is an epigenetic chemical modification of DNA which impedes transcription of a gene. Methyl groups are added to the number 5 carbons of cytosine pyrimidines in a CpG island (Figure 5) • CpG islands are DNA regions with frequent cytosineguanosine dinucleotide pairs in the 5/-3/ direction. CpG islands mark the start of about 50% of human exons • Only cytosines in CpG dinucleotides are methylated - Only I % of DNA bases are subject to DNA methylation
• However, an overall methyl deficit is observed in tumor cells consistent with global hypomethylation of tumor cell DNA and increased expression of many nonsuppressor genes - This occurs despite high levels of DNA methyltransferase expression - Hypomethylation leads to increased gene transcription, frequently causing increased expression of oncogenes - Hypomethylation induces chromosomal instability (CIN)
In adult somatic tissues, DNA methylation typically occurs only in CpG dinucleotide pairs
• Hypermethylation and hypomethylation are frequently found in promoter regions of genes in cancer cell
Non-CpG methylation is prevalent in ESCs
• Changes of global level and regional methylation patterns are among the most frequent and earliest events to occur in cancer
When a CpG site is methylated, it is methylated on both strands In many disease processes, including familial cancers, gene repression due to promoter hypermethylation is a heritable trait
DNA Methylation Enzymes • In humans , the process of DNA methylation may be carried out by one of three isoenzymes: - DNA methyltransferase 1 (DNMTl) - DNA methyltransferase 3a (DNMT3a) - DNA methyltransferase 3b (DNMT3b)
DNA Methylation and Genetic Regulation • DNA methylation is an important contributor to gene silencing - Methylation of DNA may itself physically impede the binding of transcriptional proteins to the gene, blocking initiation of transcription The methylated DNA binds proteins known as methyl-CpG-binding domain proteins (MBDI), which recruit additional proteins to the promoter and silence transcription DNA methylation also affects histone modification and chromosome structure, which can alter gene expression
DNA Methylation and Cancer • Many tumor-suppressor genes in cancer cells are silenced by hypermethylation of CpG islands • The high incidence of C-to-T transitions found in the p53 tumor-suppressor gene is attributed to the spontaneous deamination of 5-methylcytosine residues (Figure 6) • Observations linking DNA methylation to cancer also suggest a model in which there is a high rate of mutation
192
at CpG dinucleotides due in part to methyltransferasefacilitated deamination
• Both mutational and epigenetic changes alter DNA methylation and have a direct impact on neoplastic transformation
Methylation and Potential Clinical Interventions • One of the most characteristic features of cancer is the inactivation of tumor-suppressor genes by hypermethylation of the CpG islands located in their promoter regions • Compounds with DNA-demethylating capacity have potential for treatment of cancer • Discovery of DNA-demethylating capacity was a decisive event in the clinical trials that has merited the approval of 5-azacytidine by the US Food and Drug Administration for the treatment of myelodysplastic syndrome
Methods for DNA Methylation Analysis Polymerase Chain Reaction-Based Methods • Methylation-specific polymerase chain reaction (PCR) is a frequently used method for studying DNA methylation (Figure 7) - Genomic DNA is modified using sodium bisulfite to deaminate non-methylated cytosine to uracil prior to PeR - The methylated cytosine in genomic DNA cannot be converted - Methylation-specific primers are designed according to non-convertible sequences - Only methylated sequences can be amplified by methylation-specific primers • PCR amplifies bisulfite-modified genomic DNA using strand-specific primers and the PCR product is sequenced to determine the uracil content that represents nonmythylated cytosine
7-9
Conceptual Evolution in Cancer Biology
Thymine
5-Methylcytosine 5' - CpG -
3'
Fig. 6. Spontaneou s deamination of 5-methylcytosine is responsible for the high incidence of C-to-T transitions found in the p53 tumor-suppressor gene in malignancy. When an amino group is removed from 5-methylcytosine, the base changes from cytosine to thymine. In DNA, this reaction cannot be corrected by the DNA repair mechanisms.
3' - G pC - 5'
Fig. 5. DNA methylation is a chemical modification of cytosine pyrimidines in a CpG island in which a methyl group is added to the number 5 carbon of the base. Methylated DNA generally is "turned off" and does not undergo transcription.
A
Genomic DNA isolation
,...
+ + +
Bisulfite treatment
PCR amplification with either U or M primers
+ +
-
Bisulfite treatment
NNNNNNNG UGUGGN UGNGN UG (Converted genomic DNA)
4
Methylated primers(M) design CH3C H3
I I
CH3
I
CH3
I
NNNNNNNGCGCGGNCGNGN CG (Methylated genomic DNA)
Gel electrop horesis
Normal U M
NNNNNNNGCGCGGNCGNGN CG (Non-methylated geno mic DNA)
!
I I
Primer design
Non-methylated primers(U) design
!
Bisulfite treatment
NNNNNNNGCGCGGN CGNGN CG (Non-convertible genomic DNA)
Tumor U M
-
B
Cytosine
Uracil
Fig. 7. Methylation- specific PCR is a comm only used method for DNA methylation analysis. Genomi c DNA is extracted from tissue. Chemi cal conversion of any unme thylated cytosine to uracil (U) by hydroquinone and sodium bisulfite, through which all non-methylated cytosine bases can be identified (panel B). Methylation specific primers are designed according to the uracilcontaining sequences after bisulfite conversion. Methylcytosine resists deamination by sodium bisulfite, so any methylcytosine bases are unchanged in the reaction mixture . All the non-methylated cytosine would be converted into Uracil. Therefore, specific primers for methyl ation of non-methylated sequences are designed (right panel A). Specific primers for non-methyl ated sequence cannot amplify methylated (non-convertible) DNA; and the primer for methylated sequence cannot amplify converted (nonmethylated) sequences. The gel electroph oresis shows the different methylation states of tissue. In the example, normal tissue exhibits a non-meth ylated (U) PCR product whereas the tumor tissue shows a methylated (M) PCR product (panel A).
193
Molecular Genetic Pathology
7-10
• Bisulfite PCR followed by restriction analysis - The amplified bisulfite-modified region contains sites that are cleaved by restriction enzymes specific for uracil-guanosine-containing sequences • Real-time PCR allows quantitative analysis of DNA methylation using methylation-specific primers • Methylation-sensitive single-strand conformation analysis - Methylated and unmethylated sequences form different secondary structures and have different electrophoretic mobility
Non-peR-Based Methods • Single nucleotide primer extension uses internal primers to hybridize bisulfite-modified DNA amplicon in the
presence of a special DNA polymerase. The internal primer is extended only if the appropriate deoxynucleotide triphosphate has been added • DNA melting analysis based on melting properties of DNA in solution. Bisulfite modification changes the DNA sequence and lowers the DNA melting temperatures when a significant number of methylcytosines have been converted to uracil • Enzymatic regional methylation assay is a quantitative method for determining the methylation density of DNA region • Methylation-specific oligonucleotide array uses bisulfite-modified DNA hybridized to a methylationspecific microarray to analyze multiple methylation sites
MICROSATELLITE INSTABILITY (MSI) Overview
Implications of MSI
• MicrosateIIites are short repeated nucleotide sequences virtually unique for each individual
• The type of microsateIIite change can be detected only if many cells are affected
• The repeating sequences are usually only 4 or 5 nucleotides in length
• Detectable MSI is thus an indicator of clonal expansion typical of neoplasia
• The length of microsateIIites is also individual-specific and constant within an individual's normal somatic cells
Bethesda Panel for MSI
• DNA repair defects cause the number of repeats to vary in abnormal or transformed cells
• A 1997 National Cancer Institute consensus workshop recommended a 5 microsatellite marker panel for the detection of MSI
Definition and Mechanisms of MSI
• The panel recommended loci include (BAT)-25, (BAT)-26, D2Sl23, D5S346, and Dl7S250
• MSI is the condition of having longer or shorter microsateIIite regions than normal cells of the individual - Alteration in the length of microsatellites due to deletion or insertion of single nucleotides or repeating units is found in tumor DNA when compared with normallgermline DNA from the same locus The DNA instability is due to failure of the mismatch repair (MMR) system to correct errors in the transcription of microsatellite short sequence repeats, mistakes normally fixed by proofreading enzymes Defective MMR genes produce enzymes that cannot correct nucleotide mismatches due to insertion, deletion, or misincorporation of bases during DNA replication
DNA MMR Enzymes and Regulation Factors • Inactivation of the MMR genes, including hMLH1, hMSH2, hMSH6, hPMS, and hPMS2, results in MSI • Epigenetic inactivation of hMLH1 by promoter methylation is also one of the major causes of MSI • Tumors with MSI respond differently to treatments than those without MSI
194
• The tumors were divided into three subgroups according to the MSI status - MSI-high (MSI-H): samples with instability in two or more of five markers. The majority of MSI-H tumors are near-diploid and have few karyotypic abnormalities - MSI-low (MSI-L): cancers show instability in only one of the five microsateIIite markers - MSI-stable (MSI-S): cancers show no MSI in any of the five markers. Tumors with abnormal cytogenetic analysis are frequently MSI-S • Interpretation of the Bethesda panel - Many colorectal cancers show MSI-H • MSI-H is associated with HNPCC • MSI-H is also found in 15-20% of sporadic colorectal cancers • The presence of MSI-H is associated with a more favorable prognosis - MSI-L cancers mayor may not represent a biologically distinct category • MSI-L cancers have a worse prognosis in some, but not all studies - Cancers with MSI have a significantly better prognosis than those with intact MMR (MSI-S)
7-11
Conceptual Evolution in Cancer Biology
MSI in Hereditary Non-Polyposis Colorectal Cancer (HNPCC) (See Chapter 18 for Detailed Description)
N
T1
T2
• HNPCC is a hereditary cancer syndrome associated with increased risk for cancer, predominantly colorectal cancers • Defects in the DNA MMR system result in accelerated accumulation of mutations affecting critical genes that lead to malignant progression • The syndrome is caused by germline mutation in hMLHI and hMSH2 in 90% of cases - Mutation in one DNA MMR gene allele is inherited in the germline - MSI follows only if there is inactivation of the other MMR allele - MSI also occurs in the absence of germline MMR mutation as the result of epigenetic inactivation of MMR genes by promoter methylation • Tumors in MMR mutation carriers typically exhibit MSI. These are called MSI-H tumors if MSI is detected in multiple microsatellite markers • 85-90% of HNPCC-associated colorectal cancers are characterized by MSI • MSI status is useful for prognosis and therapeutic decision-making - Many studies have demonstrated improved prognosis for MSI-H cancer relative to the MSI-stable cancer - MSI-positive colorectal cancers are less responsive to fluorouracil (5FU)-based adjuvant chemotherapy
Methods for MSI Analysis • PCR-gel electrophoresis uses isotope-labeled nucleotides and primers designed to amplify microsatellite markers from genomic DNA of normal and tumor cells (Figure 8)
Fig. 8. MSI is the condition of having longer or shorter microsatellite regions than the normal cells of the individual. Alteration in the length of microsatellites due to deletion or insertion of repeating units is found in tumor DNA when compared with normallgermline DNA from the same locus. The figure illustrates a typical MSI pattern. N, normal control; T I, T2 are different tumors from same patient. The figure shows a lengthened upper allele of Tl and a shortened upper allele of T2. MSI does happen in cases with non-informative normal control, since double bands in tumor samples indicate microsatellite alteration of an allele .
- False-negative results are caused mainly by contamination from non-cancer cells. For a reliable MSI analysis at least 70% of the cells examined should be tumor cells • Fluorescence-based methods use labeled primers for coamplification of multiple markers subsequently separated by capillary electrophoresis • Denaturing high-performance liquid chromatography uses high-performance liquid chromatography instead of gel electrophoresis to analyze PCR amplified microsatellite DNA from tumor and normal cells • Real-time PCR followed by melting point analysis reveals alterations in the length of repetitive sequences within 2 hours
CHROMOSOMAL INSTABILITY (CIN)
Overview • CIN is a state of continuous new chromosome structure formation at a rate higher than in normal cells • CIN is not synonymous with aneuploidy • Neither cytogenetic complexity nor cytogenetic heterogeneity per se is conclusive evidence for CIN • CIN describes mutation at the gross chromosomal level, including structural and numerical instability
Mechanisms of CIN • CIN involves the number and structure of chromosomes, including chromosomal losses, gains, and rearrangements
• Structural rearrangement is caused by DNA damage and recombination - DNA double-strand breaks can result in a number of different structural rearrangements, including translocations, inversions, ring chromosome formation, insertions, and deletions - Downregulation or inactivation of cell cycle checkpoint systems, such as p53 and p21, allow a cell with damaged DNA to escape from apoptosis - Since telomere caps normally prevent crossing over of chromosome ends with chromosome mid-portions , telomere dysfunction results in segmental gains or losses of chromosomes by telomeric fusion between chromosomes
195
7-12
Molecular Genetic Pathology
• Break-fusion-break cycle structural abnormalities - Dicentric chromosomes have two centromeres, so they are pulled apart by the spindle during mitosis, producing two chromosome fragments with uncapped ends - The two broken chromosome ends often fuse into novel dicentrics and rings, which break again at the next cell division - Concurrent breaks in two different chromosomes may give rise to either translocations or dicentrics - Centromere malfunctions lead to numerical instability (aneuploidy) with gains or losses of entire chromosomes (Figure 9) • Asymmetrical segregation of chromosomes at the metaphase-anaphase transition - Abnormal number, structure , or function of the centrosome, consisting of the spindle apparatus and centrioles, leads to asymmetrical segregation of the chromosomes - An abnormal number of centrosomes or mitotic spindles causes uneven distribution of the chromosomes during mitosis - Failure of the centromere to bind the mitotic spindle leads to permanent loss of the chromosome in the next cell division • Inactivation of genes that control the timing of mitotic chromosome segregation results in some chromosomes being "left behind" • Failure of genome surveillance machinery, such as BRCAl-associated genome surveillance complex, allows cells with gain or loss of large genetic segments to escape apoptosis
Clinical Implications of CIN • Tumors with CIN tend to be aneuploid • Tumors with CIN are mostly microsatellite stable • Most malignant tumors show structural and numerical chromosome abnormalities • CIN and cancer - Almost all cancer cells have gains or losses of chromosomes with frequent rearrangements. However, scientists have argued for nearly a century about whether this abnormality is the cause of cancer or merely collateral damage - In most cancers tumor cells share similar cytogenetic abnormalities, indicating a stepwise accumulation of chromosomal changes has occurred during tumor growth - CIN appears to be both an epiphenomenon and a cause of cancer - CIN produces other traits favoring genomic variation, and inviting rapid selection for deathless phenotype
196
Fig. 9. CIN is a state of continuous chromosome addition , deletion, or rearrangement at a rate higher than normal cells. CIN is mutation at the gross chromosomal level, including both structural and numerical instability. The figure shows a typical picture of multiple gains and losses by chromosomal painting. Chromosomes with different color bands or arms have had insertions or translocations from other chromosomes. Color coding allows the cytogenetecist to quickly identify pairs of chromosomes. If paired chromosomes have different lengths, there has been a deletion from the shorter chromosome resulting from chromosome instability.
CIN Syndromes • CIN syndromes are a group of inherited conditions associated with CIN and breakage. Each is associated with a tendency to develop certain types of malignancy - Ataxia-telangiectasia is a primary immunodeficiency disorder characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, progressive cerebellar dysfunction, and recurrent pulmonary infections . About 20% develop cancer, usually acute lymphocytic leukemia or lymphoma Bloom syndrome is a rare inherited disorder characterized by CIN because of a mutation in the BLM gene which codes for a DNA heIicase protein essential for maintaining genomic stability during DNA unwinding for replication. Affected individuals have a 150--300 times increased risk of malignancy, usually acute leukemia, lymphoma, or gastrointestinal cancer - Nijmegen breakage syndrome is a recessive syndrome characteri zed by CIN due to mutations in the complex that manages double strand DNA breaks. It is characteri zed by microcephaly, short stature, immunodeficiency, radi ation sensitivity, and a strong predisposition to lymphoid malignancy
7-13
Conceptual Evolution in Cancer Biology
- Fanconi anemia is an autosomal recessive condition associated with bone marrow failure and high sensitivity to DNA cross-linking chemicals . About 10% of patients develop leukemia, 6% myelodysplastic syndrome , and 10% solid malignancies of liver, esophagus, and vulva - Xeroderma pigmentosum is a defect in the nucleotide excision repair gene that renders these individuals exquisitely sensitive to ultraviolet radiation. They have a lOoo-fold increase in non-melanoma skin cancer. After coauthoring the original article describing this syndrome in 1874, Kaposi went on to name the condition in 1882 for the dry, pigmented skin changes usually seen from infancy in persons with this genetic syndrome
Methods for CINAnalysis • Metaphase karyotype analysis. Dividing cells with condensed chromosomes are swollen in hypotonic solution and gently burst open to deposit the chromosomes together on a slide • Banding karyograrn analysis. The chromosomes may be studied in greater detail by enzymatic digestion and special stains to reveal condensed and loose bands of the chromosomes • Fluorescence in situ hybridization (FISH) chromosome painting. A cocktail of fluorescent-labeled probes incubated with the chromosomes allows even more specific identification of specific chromosome segments, even if misplaced on the wrong chromosome • Comparative genomic hybridization. Equal amounts of normal and tumor DNA tagged with different fluorescent dye-binding molecules are allowed to hybridize. Special computer software detects zones of mismatch in the chromosomes after painting (Figure 10)
Fig . 10. The figure is a typical comparative genomic hybridization of tumor DNA . Chromosome spreads from a normal individual are painted with one color fluorescent probe (usually red). Tumor DNA painted with a different color probe mixture (usually green) is layered over the normal chromosomes and allowed to hybridize. DNA with neither red nor green probe painting binds a blue fluorescent dye. Loss of tumor DNA yields more red color, whereas amplification of tumor DNA results in more green color. When red and green are about equal, the net color appears yellow. Computer software is used to quantitatively analyze the gains and losses for each chromosome region. This technique is complementary to chromosome painting or banding, since it fails to show inversions, reciprocal translocations, or changes without gain or loss of DNA.
GENE IMPRINTING
Overview • Gene imprinting is an epigenetic phenomenon that results in a functional difference between homologous mammalian chromosomal regions based on their parental origin • Establishment of imprinting at a locus requires that the two alleles be differentially marked in oogenesis and spermatogenesis • The imprinting process is controlled by other genes , named imprinting centers, typically located on the same chromosome near the imprinted genes • Parental allele-specific expression involves a small subset «100 genes) of all the genes (about 30,000 genes) in the genome expressed according to their parent of origin
• The pattern of parental allele-specific expression is stably transmitted during cell division . Some imprinted genes are expressed from a maternally inherited chromosome and silenced on the paternal chromosome; while other imprinted genes show the opposite expression pattern • Hypermethylation on one of the two parental alleles is the major mechanism for most imprinting. Differential methylation of CpG island promoters causes one parentderived allele to have higher expression than the other, based on arrival through ovum or sperm • Selective gene silencing by hypermethylation of CpG island promoters or by RNAi directed toward one parental allele now explains some patterns of inheritance which were formerly difficult to classify
197
7-14
Molecular Genetic Pathology
Gametes
I
Erase of old imprint
Male
New imprint
I Gametes
Male
A· B
Fig. II . Gene imprinting is an epigenetic phenomenon that causes a functional difference between homologous mammalian chromosomal regions based on their parental origin. Maternal and paternal genomes are differentiall y marked and must be properly reprogrammed every time they pass through the germline to restore full maternal or paternal marking in the gametes . During gametogenesis the primordial germ cell s must have their original biparental DNA methylation patterns erased and re-established based on the sex of the transmitting parent. This process is referred to as reprogramming.
• Currently Gly) 27 (GIn -> Glu) 164 (Thr- >Ile)
Decreased response to P2-agonists Reduced bronchial responsiveness Potentiall y decreased response to P2-agonists
ALOX5
lOql1.12
Number of tandem (VNTR) Sp-l and Egr-l binding sites in promoter region
Decreased response to the ALOX5 inhibitors
Leukotriene synthesis
Polymorphism
Associated phenotype
These examples must be consideredin the light that until recently PGx studies were limited in scope and considered only a verysmall subset of variations in a few genes. These examples show the wide range of genomic variants that might influence drug response
or wild-type allele. However, there is some discrepan cy in the data published so far with some articles indicating that the mutant VNTR is associated with increase gene expression and increase leukotriene B4 production and inflammation • The distribution of the VNTR rare allele s varies; it is present in 6% of the North American population, and has been shown to vary across different ethnic group s with higher prevalence among Asians (19.4%), blacks (24%) than among Hispanic (3.6%), and non-Hispanic whites (3.1%). This variability in allele distribution indicate s that response to ALOX5 inhibitors will not be the same in all the human populations
• This example highlights the importance of the variation in the regulatory (promoter) region of genes , in addition to the coding regions of the gene itself, and of the differences in human populations • The complexity in understand ing drug response to leukotriene inhibitors is illu strated by the fact that onl y 6% of asthma patients carry the rare VNTR alleles at the ALOX5 promoter locu s, but >6 % of asthmatic patients do not respond to leukotriene inhibitors. Thu s, there are likely other genetic variant s in this pathway, yet to be identified, that playa role in leukotriene regulation
PGx OF CARDIOVASCULAR DISORDERS
• Cardio vascular disease is one of the leading causes of morbidity and mortality, and drug therapy is a major modality to attenuate its burden. At present, conditions such as hypertension, lipid disorder s, and heart failure are pharmacologically managed with an empirical trial-and-error approach. However, this approach fails to adequately addre ss the therapeutic needs of many patients, and pharmacogenetics has been explored as a tool to enhance patient-specific drug therapy • There are a number of studies in the published literature that provide proof of concept that genetic variation contributes to the variable respon se that is observed on administration of cardiovascular drugs. Some of these examples are discussed here, mainly focusing on the PD aspects (genetic variants in drug targets)
Hypertension • Hypertension is the most common chronic disease in the western world. Even with the large number of drugs from which to choose therapy, only 34% of North American s respond to these treatments • The renin-angiotensin system plays an important role in blood pressure (BP) regulation , and previous studie s have reported that response to anti-hypertensive medications is influenced by genetic variation in the renin-angiotensin-aldosterone system
Angiotensin-Converting Enzyme (ACE) • ACE is essential for the production of angiotensin II and for the degradation of bradykinin, two peptides involved in vascular physiology and regulating BP. ACE inhibitors reduce peripheral vascular resistance and therefore reduce BP
253
10-14
Molecular Genetic Pathology
• Several studies have associated an insertion/deletion (lnJDel) polymorphism of the ACE gene with the occurrence of cardiovascular diseases, myocardial infarction and drug response to ACE inhibitors. The ACE lID polymorphism results from the presence or absence of a 287-bp DNA fragment in intron 16 of the ACE gene on chromosome 17. This intronic variation shows tight LD with the clinical phenotype, but the causative (functional) variant has not yet been determined • The D allele has a frequency of approximately 0.53 in Caucasian populations and has been associated with higher levels of ACE activity. Some studies have shown that individuals homozygous deletion (Del/Del) appear to have a highest response to ACE inhibitors whereas individuals homozygous for the insertion (InJIn) genotype show a lower response. Differences in plasma ACE activity associated with the ACE genotype that affect the therapeutic response of ACE inhibitors explain in the inter-individual variability in cardiovascular or renal response to equivalent doses of ACE inhibitors • However, clear patterns of association with the ACE InJDel polymorphism have failed to emerge, with as many studies pointing to the increased response of 1allele carriers as studies pointing to D-allele carriers. Other studies have found no pharmacogenetic effect of the InJDel polymorphism and ACE inhibitors on BP and related outcomes. These divergent results suggest other genetic and environmental factors are associated with response to ACE inhibitors
Angiotensinogen (AGT) Gene • A polymorphism in the AGT gene, M235T, wherein the T allele is associated with higher plasma AGT has been linked to elevated blood pressure (BP) and myocardial infarction . However, neither the M235T nor the Tl74M polymorphisms, both in exon 2, seem to affect function, secretion, or metabolism of AGT ~-Blockers
• ~-Blockers (e.g., atenolol and bisoprolol fumarate) are a first-line treatment for hypertension . Several studies have found significant pharmacogenetic effects with ~-blockers, including studies that reported an association
in the ~-l-adrenergic receptor Arg389 variant and response to ~-blockers. Other polymorphisms have been described but most of them have not been confirmed in independent populations • Pharmacogenetic studies of ~-blockers have been complicated by relatively small sample size and had variable durations of treatment. However, in aggregate they suggest that variants in the ~-l-adrenergic receptor gene may play a future role in determining response to ~-blockers
PGx of Lipid-Lowering Agents • The prevention of cardiovascular disease has been greatly facilitated by lipid-lowering therapy including 3-hydroxymethyl-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitors (statin drugs, including pravastatin and atorvastatin) and cholesterol absorption inhibitors. These drugs are generally well tolerated but severe adverse effects occurs in a small number of patients and there is also a subset of patients that do not respond • Studies have shown that SNPs in HMG-CoA are significantly associated with reduced efficacy of pravastatin . Individuals heterozygous for variants in the HMG-CoA reductase gene may experience significantly smaller reductions of cholesterol (22% lower reduction of total cholesterol and 19% lower reduction of low-density lipoprotein) when treated with pravastatin . However, these initial results have not yet been confirmed in other populations
Emerging Trends in Cardiovascular Pharmacogenetics • Although numerous polymorphisms in several genes have been associated with drug response to ~-blockers, ACEinhibitors , and statins, additional studies are required to translate the PGx of cardiovascular disorders into clinical practice . Future studies are required that use adequately sized patient cohorts, reduce variability in methodology, and assess complexity of the larger biologic organization (e.g., gene networks and pathways) Additional challenges include the applicability of pharmacogenetic findings across specific population groups as a number of report show differences in cardiovascular disorders and severity among different racial categories
PGx OF NEUROPSYCHIATRIC DISEASES
• Impressive advances have been made in the genetics of neuropsychiatric diseases . Synergies between genetic studies, elaboration of intermediate phenotypes, and novel applications in neuroimaging are revealing the effects of positively associated disease alleles on aspects of neurologic function
254
• Genetic and pharmacogenomic studies suggest that the sub-categorization of individuals based on various sets of susceptibility alleles, could make the treatment of neuropsychiatric more predictable and effective • Much of the pharmacogenomic and pharmacogenetic data available today has come from psychiatric disorders as
10-15
Clinical Pharmacogenomics
well as from neurologic conditions often resulting in psychiatric sequelae (e.g., Alzheimer's and Parkinson's disease), and these areas will be the focus of this chapter
Alzheimer's Disease • Genetic polymorphi sms in the apolipoprotein E (APOE) gene are associated with predicting response to therapy for Alzheimer 's disease as well as for lipid-lowering drugs • There are numerous allelic variants of the human APOE gene (e.g., APOEe2, APOE£3, APOEe4, and so on), which contain one or more SNPs that alter the amino acid sequence of the encoded protein • Studies with tacrine (a cholinesterase inhibitor) to treat Alzheimer's disease have shown that 83% of patients lacking the APOEe4 allele had a positive response to tacrine as compared with 40% of the patients with at least one APOEe4 allele . However, the greate st improvement was observed in a patient with a single APOEe4 allele , the unfavorable genotype, illustrating that a single gene will not always predict the respon se to a given treatment • Follow-up studies indicate that the prognostic value of APOE genotype for tacrine treatment was stronge st in female patient s, suggesting that additional genes and other factors may be involved in the response to tacrine treatment • Other studies have suggested that patient s not carrying the APOEe4 allele respond to PPARyagonist rosiglitazone (cognitive and functional improvement), whereas APOEe4 allele carriers showed no improvement • Analysis of APOE has shown association between APOE genotype and susceptibility to Alzheimer's and response to treatment. However, prospective clinical evaluation with robust clinical end point s and sufficient sample size are needed to define better the usefulne ss of the clinical implementation of an APOE pharmacogenetics test
Parkinson's Disease • More than 50% of Parkinson's disease (PD) patients treated with L-DOPA develop L-DOPA-induceddyskinesias (LIDs). Some patients exhibit severe dyskinesia soon after starting low doses of L-DOPA, whereas other patients remain free of this disabling complication despite long-term treatment. Avoiding or delaying the appearance of LIDs is a major issue in the management of PD • Some studies have associated several genetic polymorphisms with the risk of developing LIDs, including variation in the dopamine receptors 2, 3, and 5 • Genetic predisposition to LIDs is likely to involve several distinct genes (or multiple allele s), each producing a small effect that might increase the risk of developin g LIDs by two- to threefold
Major Depression • Serotonergic activity is thought to play an important role in the regulation of mood, motor activity, and sleep
patterns. Serotonin re-uptake is controlled by the serotonin transporter gene (SERT or SLC6A4)
• SERT displays an lID polymorphi sm in its promoter region (5-HTILPR), which is the presence or absence of a 44-bp insertion. This variant results in a bi-allelic polymorphism designated long (I) and short (s). The shorter variant of the promoter is associated with reduction in the transcriptional efficiency of the gene resulting in decreased gene expression • Anti-depressant efficacy of selective serotonin re-uptake inhibitors (SSRls) has been shown to depend on this functional promoter polymorphism. It has been reported that carriers of the short allele have a poor outcome after treatment with SSRls and a higher rate of adverse effects whereas individuals homozygous for the long variant have two times more efficient response to SSRls and might have a better long-term outcome when treated with anti-depressants • However, contradictory results that might be explained by interethnic difference s, or differences in haplotypes, have been reported. Therefore, sufficiently large and wellplanned, controlled randomized studies are needed to finally prove that anti-depressant therapy might benefit from SERT genotype diagno sis
Schizophrenia • There is substantial unexplained inter-individual variability in the drug treatment of schizophrenia with an important proportion of patient s that respond inadequately to anti-psychotic drugs, and many experience limiting side effects. Converging data suggest that the identification of the molecul ar variants that influence anti-psychotic drug response and adverse effects may soon be feasible • For the most part , the pharmacogenomic studies in schizophrenia have focu sed on the secondary effects of the new atypical anti-psychotic agents . One of the most studied of such secondary effects is weight gain associated with those agents. Weight gain appears to be a serious side effect encountered during treatment with many anti-psychotic drugs. Although the propensitie s of induc ing weight gain vary con siderably between agents, this adverse effect is mostly obser ved with administration of atypical anti-psychotic drugs • A specific SNP in the 5-hydroxytryptam ine 2C (5-HT2c) receptor has been associated with weight gain across diverse samples. Several recent reports have linked a -759Crr polymorphi sm of the 5HT2C receptor gene with chlorpromazine, risperidone, and clozapineinduced weight gain • Aside from adverse effects some studies have suggested that variation in the gene that codes for the dopamine D2 receptor may significantly influence the clinical efficacy of a number of typical and atypical anti-psychotic drugs. Some of these polymorphi sms are the -141C In/Del
255
10-16
Molecular Genetic Pathology
polymorphism and the TaqI polymorphism. Although several advances have been made, particularly in understanding the pharmacogenetics of some limiting
side effects, genetic prediction of drug response remains elusive and more studies with larger and better-defined populations are needed
CANCER PGx
• Tumorigenesis is a multi-step process whereincells acquire somatic genetic alterations followed by clonal expansion of those carrying alterations providinga growth advantage. This results in a tumor that has a genotype unique from the normal tissue which it was derived. Thus, cancer is a genetic disease, which makes it ideally suited for the use of genetic assays for tumor classification/outcomes and POx • The use of POx in cancer is further driven by the narrow margin of safety (MOS-the ratio the toxic dose/ therapeutic doses)for cancer cytotoxic drugs, and the emergence of targeted therapies such as trastuzumab (Herceptin"), imatinib (Gleevec"), and gefitinib (Iressa'") that have efficacy only in tumor harboring specific genetic alterations. The first widespread use of a pharmacogenomic companion diagnostic to assess drug targetstatus was for trastuzumab • Detailed descriptions of cancer POx are provided in other chapters. Here, we will provide a brief historical overview and frame the current status of pharmacogenomic applications
Monogenic Cancer Pharmacogenetics; TPMT • Thiopurine drugs are used to treat leukemia (acute myelogenous leukemia and acute lymphoblastic leukemia), autoimmune diseases (inflammatory bowel disease, systemic lupus erythematosus, and rheumatoid arthritis), and organ transplantpatients. This class of drugs includes 6-MP, 6-thioguanine, and azathioprine (6-MP prodrug). Myelosuppression is the primary toxicity observed with this class of drugs • TPMT is a cytosolic enzyme that catalyzes the S-methylation of these drugs using S-adenosyl-L-methionine (SAM) as a methyl donor (Figure 6). Inherited variation in TPMT was first reported in 1980 by Weinshilboum and Sladek. Measuring TPMT enzymatic activity in red blood cells of unrelated adults and in families, they showed a distribution of TPMT that conformedto Hardy-Weinberg prediction for codominant autosomal alleles for high and low activity, and suggested inherited variation TPMT was responsible in part for the clinical response/adverse events of thiopurines. Approximately 89% Caucasian and AfricanAmericans have high activity, II % intermediate, and
Fig . I. Clonal proliferation is the hallm ark of cancer. Normal stem cell s renew themselves through asymmetric division to maintain the stem cell population and generate more differentiated cell populations. Carcinogenetic factors can affect stem cell s in its self-renewal process, causing epigenetic and geneti c alterations and transform the stem cell s into cancer stem cells. Cancer stem cells are the cellular source of cancer. These cells divide to expand the cancer cell population, forming a clonal cancer. The modern carcinogenesis theory suggests that cancer develops from a cancer stem cell; whereas, the traditional carcinogenesis theory suggests that cancer can develop from any cell type , even differentiated cell s as indicated by the dashed line.
(Figure 1) • Unregulated cell growth in tumors results from disruption of the regulatory mechanism of stem cell self-renewal • Thus, cancer is a regulatory disorder in stem cells and not simply an augmentation of proliferation signals • Only stem cells or progenitor cells are targets of carcinogenesis and possess the capacity for selfrenewal (see also Chapter 7) • The genetic change is inheritable and shared by the entire population of cancer cells that are derived from the same stem cell origin
Thmorigenesis Models Monoclonal Tumor Model • Genetic damage or epigenetic alterations play critical roles in carcinogenesis • Carcinogenesis is a multi-step process at both the phenotypic and genetic levels • Many tumors have been reported to result from the clonal expansion of a single stem cell founder (cancer stem cell); thus, the tumor is composed of a clonal population of tumor cells
263
11-4
Molecular Genetic Pathology
Physiological Condition Regulatory element
-
C£roteiV
Abnormal Condition Regulatory element
Non-related gene
- ~
- ~ -
Fig. 2. Proto-oncogenes are functional genes in physiologic conditions. Normal proto-oncogenes are expressed in a wellcontrolled way and produce normal amounts of protein product (aqua coded oval). An oncogene is a modified proto-oncogene, which produces either an increased amount of normal protein (aqua) or a mutated form of the protein (orange), which is involved in cancer development. Upregulation of oncogene expression can be induced by mutation of the regulatory fragment or by incorporation of viral DNA, which may provide a stronger promoter and increased expression of a normal form of oncoprotein (aqua). Also if the coding sequence is linked to another gene sequence by a chromosomal translocation, a fusion protein may result (blue and green) .
• The monoclonal cancer theory is appealing in that it agrees with many known molecular events in tumorigenesis • Somatic mutations and/or epigenetic alterations acquired by cancer stem cells can accumulate and be transferred from the cancer stem cell into daughter cells to form a tumor clone with the same genotype and phenotype among all cells • Because the mutations acquired by the cancer stem cell are stably passed to its progeny, the presence of these mutations could be used as clonal markers • The clonal tumor cells exhibit a concordant pattern of somatic mutations and/or epigenetic alterations • Activation of an oncogene or deletion/inactivation of a tumor suppressor gene in a cancer stem cell and its progeny are common pathways in carcinogenesis (Figure 2) • Activation of anti-apoptosis genes or inactivation/loss of apoptosis genes are also characteristics shared by clonal cancers - Simultaneous upregulation of anti-apoptosis genes and downregulation of apoptosis genes results in a selective kinetic advantage and the expansion of a dominant clone
264
• Epigenetic disorders alter the expression levels of related genes during carcinogenesis - The epigenetic status is often consistent among a clonal population of cells and can, thus, be used in clonality analysis - The most important epigenetic process is mediated through DNA methylation, which silences genes
Multi-Step Carcinogenesis • In 1997, Kinzler and Vogelstein proposed the concept of two different types of carcinogenetic genes, gatekeepers and caretakers (Figure 3) - Gatekeepers are genes that directly regulate the growth of tumors by inhibiting cell growth or promoting cell death. Known gatekeeper genes include APe, ~-catenin, Rb, NF J, VHL, and others • A specific cell type has only a few gatekeepers. Inactivation of specific gatekeeper leads to a specific cancer • In the gatekeeper pathway only one additional mutation, which inactivates the remaining allele, is needed to initiate a cancer
Clonality Analysis in Modern Oncology and Surgical Pathology
Normal cells
Epigenetic alterations
Loss of tumor suppressor gene allele
Genetic mutations of gatekeeper and carekeeper genes
11-5
Tumor progression
Fig. 3. Multi-step carcinogenesis theory involves several epigenetic and genetic alterations. Epigenetic alterations and loss of tumor suppressor gene alleles are thought to be important initial steps in carcinogenesis. The accumulation of genetic mutation s involving gatekeeper and caretaker genes will eventually initiate cancer development and eventually lead to a more advanced malignancy.
- Caretakers are genes that maintain the integrity of the genome. Mutation of these genes can promote tumor initiation indirectly • Three subsequent somatic mutations are required to initiate a cancer: mutation of the normal caretaker allele, and mutations of both gatekeeper alleles • Caretakers include nucleotide excision repair genes , mismatch repair genes , ATM genes, BRCAJ and BRCA2 genes - Cancer incidence increases with age, supporting the theory of multi-step carcinogenesis • Multi- step carcinogenesis is a progressive event in which the sequential accumulation of somatic mutations transforms the stem cell into a cancer stem cell, which clonally expands into a cancer • Along with the accumulations of mutations, the affected cells also experience a morphologic transition from normal histology to hyperplastic/dysplastic lesions , and finally to cancer • The genetic changes are inheritable and shared by the entire population of cancer cells that are derived from the same stem cell origin
Polyclonal Tumor Model Field Cancerization Theory • The concept of field cancerization was first introduced by Slaughter et al. in 1953 - Slaughter proposed that the multi-centric origin and high probability of cancer recurrence in the oral mucosa suggests a microscopically invisible "field" where genetically altered pre-cancerous cells exist
Distinct X chromosomal inactivation patterns and discordant patterns of genomic mutations in the same tumor (or in separate tumors in the same patient) provides supporting evidence for the hypothesis • The theory explains the development of multiple primary tumors and of locally recurrent tumors Field cancerization generates multi-focal areas of cancer development from multiple genetically distinct clones due to carcinogenic events (Table 1) - Each cancer clone originates from a different cancer stem cell and bears different genetic alterations - The cancer clone can form tumors synchronously or metachronously within the field • Many organ systems have been studied including oral cavity, lung, esophagus, breast, skin, urinary bladder, vulva, and colon - Molecular findings have supported this field cancerization model in that genetic alterations can be detected in many field s in which the cells acquire genetic alterations and grow to form a patch (see Patch Phenomenon section) - External carcinogens cause independent genetic alterations at different sites leading to the development of multiple , genetically unrelated tumors • The important implication is that some effects of the carcinogens in the field remain after the primary cancer is removed and may lead to new cancers • Field carcinogenesis assumes a multi-step process in which neoplastic changes evolve over a period of time due to the accumulation of somatic mutations in a single cell lineage
265
11-6
Molecular Genetic Pathology
Table 1. Monoclonal vs Polyclonal Origin Theories of Tumorigenesis
Monoclonal origin
Polyclonal origin
Founder
Single transformed cancer stem cell
Multiple transformed cells in the field
Tumor clone
Single
Multiple
Somatic mutations
Similar mutations in all cancer cells
Different mutations
Multifocal development
Implantation, migration
Locally transformed
Mechanism of carcinogenesis
Monoclonal proliferation
Field cancerization
- One of the important effects of field cancerization is that genetic alterations are often found within the morphologically normal cells surrounding the tumor in the same field - These morphologically normal cells adjacent to the tumor occupy an intermediate step in the transformation from biologically normal to a dysplastic epithelium • Separate origination of multiple tumors suggests a concept of generalized carcinogenesis, through which a larger area or even the whole organ is affected by the carcinogens • Although multiple tumor clones may exist during the carcinogenetic process, one clone may develop an additional growth advantage, becoming dominant and resulting in a pseudomonoclonal appearance on clonality analyses • The genetic alterations may be found long before histologic evidence of cancer development, and the cells bearing the alterations mayor may not themselves be precursors of cancer
Random Collision Theory • Collision tumors have been reported in various organs and they represent a co-existence of two adjacent but histologically distinct tumors (without histologic admixture) in an organ • Random collision theory proposes the possibility that two distinct tumor types initiated in a close proximity can result in a polyclonal neoplasm that may be recognized clinically as a single tumor • Collision tumors have been reported in the stomach, lung, esophagus, ovary, and intestine • Collision tumors are polyclonal and display different genetic alterations in each component
266
Patch Phenomenon • Patch phenomenon is a concept introduced by Schmidt and Mead in the 1990s through the use of X chromosome inactivation analysis A patch is generally regarded as a group of cells which are derived from a common stem cell, sharing common genetic characteristics and having inactivation of the same X chromosome in female individuals (Figure 4) - Patch size varies. The patch size in bladder and stomach is up to 1 ern? and in hair follicle is 0.2-1.0 cm-. In other tissues, the patch size is about 0.2-0.3 ern? - Some patches correspond to anatomic boundaries such as an intestinal crypt or breast duct-lobular unit; however, some do not follow anatomic boundaries, such as patches in the liver - Because of potentially large patch sizes, cells isolated for X chromosome inactivation analysis may come from a single patch. A multiple site cell isolation technique, in which much larger areas can be sampled, may be helpful in achieving more accurate results in these clonality analyses • The terminal lobuloductular unit of breast often lies entirely within one patch; therefore, a polyclonal origin of breast tumors may be difficult to demonstrate unless a proper normal control is used • Because of the large patch sizes in colon epithelium, X chromosome inactivation studies are heavily biased toward monoclonal results • Patch phenomenon in field carcinogenesis - In field carcinogenesis, many stem cells in the field acquire somatic mutations and divide to form genetically altered cell clusters as patches
Clonality Analysis in Modern Oncology and Surgical Pathology
11-7
Fig. 4. A patch is a cluster of cells derived from the same founder cell. Cells in female tissues demonstrate a mosaic pattern of methylated X chromosomes (from either maternal or paternal origin). In this illustration, the red and blue cells represent cells with inactivated X chromosomes of maternal and paternal origin , respectively. Sometimes the cells can grow in clusters, remaining adjacent to one another as a result of clonal growth in a discrete territory referred to as a patch. The cells in a patch share identical genetic characteristics. The cluster of blue cells in the left lower comer constitutes a patch, all of which show inactivation of the paternally derived X chromosome.
- These altered cells in the patch mayor may not be morphologically recognizable but all have identical genomic changes • These patches can be recognized on the basis of genetic mutations such as TP53 mutations or abnormal epigenetic processes such as non-random X chromosome inactivation
- A single patch may be formed from the progeny of one or several stem cells that show the same genetic alteration pattern • The cells in these patches are monophenotypic but mayor may not be monoclonal • The patch proliferation-malignant transformation model is one basis for multi-focal, multi-clonal carcinogenesis (i.e., more than one genetically unrelated primary tumor)
• The cells in a patch may be more susceptible to carcinogens and to undergoing malignant transformation as somatic mutations accumulate
• To truly demonstrate monoclonality, postulated somatic genetic changes have to be directly demonstrated rather than inferred on the basis of apparent X chromosome inactivation data
X CHROMOSOME-LINKED CLONALITY ANALYSIS
Principle and Implication of X Chromosome Inactivation • X chromosome inactivation (also called lyonization) is a process proposed by Mary Lyon in 1961. It is a process
of chromosome-wide epigenetic gene silencing by which one of the two copies of the X chromosome present in female mammals is randomly and permanently inactivated (for purposes of dosage compensation)
267
11-8
Molecular Genetic Pathology
Fig. 5. X chromosomes of female cells are of paternal (P, green) and maternal (M, red) origin. In early embryogenesis, the paternally and maternally derived X chromosomes are both in an activated state. One of the X chromosomes in each cell becomes randomly inactivated after early embryogenesis (inactivated X chromosomes are gray). Normal female tissues are composed of a mosaic of cells having either the maternal or paternal X chromosome inactivated (red and green cells in lower box represent cells having an active maternal or paternal X chromosome, respectively). Theoretically, 50% of cells will have an inactivated paternal X chromosome and 50% of cells will have an inactivated maternal X chromosome. The X chromosome that is inactivated in a cell will be stably passed to its progeny, allowing this feature to be used as a clonal marker.
• The inactive X chromosome is methylated, followed by histone deacetylation, resulting in compaction of the chromatin into repressive heterochromatin, forming a Barr body (also called sex chromatin) • X chromosome inactivation occurs in early embryogenesis (blastocyst stage) and is permanent (Figure 5). The process is random, and either the maternally or paternally derived X chromosome is inactivated
268
• Once established, the same inactivated X chromosome is stably maintained and passed to daughter cells through all subsequent cell divisions • Analysis of the differential methylat ion (inactivation) of X chromosomes forms the basis of clonality analysis in women • Cells derived from a common progenitor share the same inactivated X chromosome in all progeny
Clonality Analysis in Modern Oncology and Surgical Pathology
A
B
• . ... .: ... ,....... .:< :... • •• Normal
Tumor
•• • •••• : N
T
+
+
11-9
- The process is initiated by transcription and cis-localization of the non-coding Xist RNA, which then recruits much of the epigenetic machinery associated with maintenance of constitutive heterochromatin and silencing of genes on the inactivated X chromosome (e.g., histone modifications and DNA methylation) - The Xist gene transcribes a large RNA, which coats the inactivated chromosome. The non-inactivated X chromosome is not RNA coated - X chromosomes which lack the Xist gene cannot be inactivated. Artificially placing and expressing the Xist gene on another chromosome leads to silencing of that chromosome - The Tsix RNA is transcribed antisense to Xist
Fig. 6. Tumor cells are derived from a common progenitor cell and, therefore, share the same X chromosome inactivation pattern. Panel A is a schematic illustration showing random (normal) and non-random (tumor) X chromosome inactivation. Panel B shows a gel picture of X chromosome inactivation analysis. N designates normal control and T designates tumor. + and - indicate with or without HhaI methylation sensitive restriction enzyme digestion. The upper allele of tumor could not be amplified after HhaI digestion, indicating a non-random X chromosome inactivation pattern. Two bands are seen in normal tissue after HhaI digestion, consistent with randomly inactivated X chromosomes in the constituent cells.
- The Tsix gene overlaps the Xist gene and is transcribed on the opposite strand of DNA from the Xist gene. Thus, Tsix is a negative regulator of Xist • Inactivated X chromosomes have high levels of DNA methylation, low levels of acetylated isoforms of histone H4, low levels of histone H3 lysine-4 methylation, and high levels of histone H3 lysine-9 methylation
Human Androgen-Receptor Gene X Chromosome Inactivation Analysis • HUMARA X chromosome inactivation analysis is based on methylation sensitive restriction enzyme can only cut non-methylated restriction site (Figure 7) - The HUMARA is located at Xq11.2-12
• X chromosome inactivation is normally a random process with approximately equal numbers of maternally and paternally derived X chromosomes being inactivated in the female • As a consequence, normal tissues are composed of cellular mosaics with random X chromosome inactivation patterns. In contrast, a clonal expansion of cells, such as that present in tumors , exhibits a non-random pattern of X chromosome inactivation in all cells. Tumors in a female arising from a single progenitor cell have the same inactive X chromosomes (Figure 6)
X Chromosome Inactivation Control Mechanisms • The X-inactivation center (XIC) is located at Xq12-13 on the X chromosome and it is necessary and sufficient to cause X chromosome inactivation • The XIC contains two non-translated RNA genes, X inactivation-specific transcript (Xist) and Tsix (full-length RNA product, which is complementary to Xist RNA), which are involved in X chromosome inactivation. The XIC also contains binding sites for both known and unknown regulatory proteins
- A highly variable region of CAG trinucleotide repeats is located within the first exon of the gene . The repeats are in close proximity to differential methylation sites and to methylation-sensitive restriction endonuclease (HhaI or HpaII) cutting sites • Brief procedures: - Genomic DNA is extracted from microdissected normal and cancer tissues - Polymerase chain reaction (PCR) amplification of HUMARA locus on methylation-sensitive restriction endonuclease-digested genomic DNA to generate the allele fragments - The methylated (inactivated) X chromosome cannot be digested by methylation-sensitive restriction enzymes HhaI or Hpall - The digested (active) X chromosome cannot be amplified - The PCR products are subjected to electrophoresis • Interpretation of the X chromosome inactivation analysis results - Clonality analysis of a cell population can be interpreted correctly only in relation to the clonality of surrounding normal tissue of the same embryologic origin
269
11-10
Molecular Genetic Pathology
Methylated CAG polymorphic site
/\ Hhal
PCR primer
Hhal
Allele 1
Unmethylated
/\
Hhal
Hhal
Allele 2
+--- PCR primer
1 -/+ Hhal digestion
PCR amplif ication
Electrophresis
1 Normal
+
Allele 1 Allele 2
--
Tumor
+
--
Fig. 7. Schematic illustration showing the HUMARA X chromo some inactivation assay. Genomic DNA is isolated from normal tissue and from tumor and is subjected to methylation-sensitive restriction enzyme HhaI digestion. Allele I (blue) and allele 2 (purple) are from different parental origins. Allele I is methylated and cannot be digested; allele 2 is non-methylated and, thus, can be digested. Digested (+) and non-digested (-) DNA is PCR-amplified and separated by gel electrophore sis. The digested normal tissue shows a double band pattern since its X chromosomes are randomly inactivated. The digested tumor DNA shows only one band since its X chromo somes are non-randoml y inactivated. The X chromo some inactivation pattern is shared among the cells in the clonal population . - Informative case: two allelic bands were present after PCR amplification without methylationsensitive restriction enzyme digestion in normal control samples
270
- Non-informative case: only one allelic band was present after PCR amplification without enzyme digestion in normal control samples
Clonality Analysis in Modern Oncology and Surgical Pathology
Tumor 1
11-11
Tumor 2
DNA extraction
1
- /+ Hhal enzyme digest ion
PCR amplification
1
Gel electrophoresis with
"",o"'df"""'
T1
- +
Allele 1 - . Allele 2 - .
1=-
T2
Normal - +
- +
T1
+
+
T2
-
+
=-1 Pattern A
N
T1
-
Pattern B
T2
+
T1
+
+
T2
+
+
Fig. 8. X chromosome inactivation analysis can be used to analyze clonal relation ships of separate tumors . Genom ic DNAs from a normal control and from two separate tumors are isolated and subjected to a methylation sensitive restriction enzyme digestion followed by PCR amplification and gel electrophoresis. In pattern A the two tumors (TJ and T2) display an opposite pattern s of non-random X chromosome inactivation, indicating different clonal origin s. Pattern B shows identical pattern s of non-random X chromosome inactivation in each tumor, indicating a commo n clonal origin . As expected , normal control tissue (N) displays a random pattern of X chromosome inactivation with two bands present on gel electrophoresis before and after methylation sensitive enzyme digestion. - In informative cases, the PCR product s from digested normal control tissue show a double band on electrophoresis (random X chromo some inactivation), while digested clonal tumor DNA shows only one band (non-random X chromosome inactivation ) - A non-random X chromosome inactivation pattern indicates clonal proliferation; a random
X chromo some inactivation pattern indicate s a polyclonal process (mosaic cell populations) - Identical X-inactivation pattern s in two distinct tumors (with either upper or lower bands dimini shed) suggests a possible monoclonal origin (Figure 8)
27 1
11-12
Molecular Genetic Pathology
- Opposite X-inactivation patterns, such as loss of upper band in one tumor and loss of lower band in another tumor support an independent origin for each tumor
Advantages and Limitations of HUMARA X Chromosome Inactivation Clonality Analysis • Advantages: - X chromosome inactivation is the most consistently informative marker of clonal proliferation in women - 90% of female s are heterozygous and suitable for X chromosome inactivation analysis - A highly variable region of CAG trinucleotide repeats is located within the first exon of the HUMARA gene - The proximity of differentially methylated restriction sites to the loci of genes allows for the use of these techniques on fragmented DNA (the size of PCR products is about 200-280 bp) - The method is simple and the result is stable • Limitations: - X chromosome inactivation is only applicable to women - Inherited or acquired unbalanced methylation (skewed, non-random pattern of X chromosome inactivation) and abnormal patterns of DNA methylation in malignancies can complicate the interpretation of results - Strict dosage compensation may not be necessary for all genes in the X chromosome • 15% of X-linked genes escape inactivation and an additional 10% of X-linked genes show variable patterns of inactivation - X-linked clonal ity analysis only distinguishes random and non-random X chromosome inactivation - Not all clonal proliferations are neoplastic. Clonal processes are not equivalent to neoplastic processes
Table 2. Mechanisms of Skewed X-Chromosome Inactivation in Normal Tissue Inherited Dysregulation, mutation, or deletion of XIC at Xq12-13 Xq28 deletion Xist mutation
XCE human equivalent of mutant murine Xce Decreasedprecursorpool size • Monozygotic twinning • Confinedplacental mosaicism Carrier state of X-linkeddiseases • Agammaglobulinemia • Severecombinedimmunodeficiency • Wiskott-Aldrich syndrome • Adrenoleukodystrophy • Incontinentia pigmenti type II
• u-Thalassemia with mental retardation syndrome • Duchenemuscular dystrophy • HPRTdeficiency • Facial dermal hypoplasia • Dyskeratosis congenital
Acquired Selection and growth advantage Aging process Tissue-specific (e.g., hematopoietic cells) Artifact
Technical Considerations Skewed DNA Methylation • The process of X chromosome inactivation is usually random , producing tissues with equal mixtures of cells having active X chromosomes of either maternal or paternal origin • However, skewed X-inactivation patterns can occur and this skewing can be inherited or acquired and can result from complex mechanisms of action during the early phase of embryonal life (Table 2) • Skewed methylation is an asymmetric distribution of inactivated maternally or paternally derived X chromosomes (Figure 9) • X chromosome inactivation with a 3: I ratio of inactivated Xp:Xm or vice versa, is accepted as skewed X chromosome inactivation
272
- Artificial allelic dropout • Reduction of DNA template quantity • Damagedor salt-contaminated DNA - Different laboratory criteria for skewing
• Primary skewed methylation patterns are related to the limited number of stem cells present at the time of random X chromosome inactivation during embryogenesis - Asymmetric division of stem cells is another cause of skewed methylation due to loss of some stem cells through terminal differentiation - Decreased precursor pool size contributes to skewed X chromosome inactivation
Clonality Analysis in Modern Oncology and Surgical Pathology
® X>- @~."~
00
Zygo"
II --
11-13
.a::. ...... .....
• ear
Random inactivation
v~ Ciuill
Gametes
4'.0,%. I/)[)
\1
•
--It ,:iI--
Skewed inactivation
Fig. 9. Schematic illustration of a mechanism for a skewed methylation pattern . The random inactivation of an X chromosome in each cell of a female occurs during early embryogenesis. If equal splitting of cells with an inactivated maternal or paternal X chromosome occurs during the early X chromosome inactivation process, the tissues will be composed of a cellular mosaic . If there is unequal splitting of stem cells at this time, the stem cells with inactivated paternal (green) and maternal (red) X chromosomes will be in unequal number, resulting in a skewed pattern of X chromosome inactivation .
- Monozygotic twins have an excessive skewing rate which may be related to the twinning process . The twinning process reduces the number of cells contributing to the embryo • Skewed methylation patterns can be influenced by hereditary factors and can be genetically transmitted. Family concentrations of highly skewed methylation patterns with preferential activation of one parental X chromosome has been reported • Mutation or abnormal imprinting of the Xist gene can result in skewed inactivation • Dysregulation of XIC or physical deletion of Xq28 (pseudoautosomal region) could cause skewing of X chromosome inactivation • Xist mutations are also directly related to skewing of X chromosome inactivation • Several X-linked disorders are known to cause skewing of X chromosome inactivation (Table 2) • Acquired skewing of X chromosome inactivation may also be related to selection and the aging processing - Age has been shown to have a direct influence on inactivation. A much higher incidence of extremely unbalanced X-inactivation patterns are seen in elderly women. There is depletion of stem cells through the aging process - Somatic selection occurs in the aging process . A small growth advantage may preferentially affect certain cell populations or clones. Such selection is variable among different tissues • X chromosome inactivation patterns in different tissues in the same female may vary, a phenomenon which is referred to as tissue-specific X-inactivation pattern
- Skewed methylation is low in gastrointestinal mucosa and thyroid but significantly higher in blood cells - Hematopoietic cells are particularly subject to the selection process due to short life spans and high turnover. Depending upon the definition and the quantitative accuracy of the measurement, up to 20% of such specimens may have skewed X chromosome inactivation - Before a clonal population of cells can be demonstrated with X chromosome inactivation analysis, the pattern of X chromosome inactivation observed in a tissue sample must be interpreted with reference to that seen in normal tissue of the same lineage. If a hematologic malignancy is being studied, an alternative method of clonality analysis should be considered because of the high incidence of skewed methylation in blood cells • Methodology divergence may also cause skewed results on X chromosome inactivation analysis. For example , artificial allelic dropout due to insufficient PCR amplification, reduction of DNA template quantity due to tissue preservation and processing, damaged or saltcontaminated DNA, and different laboratory criteria for skewing
Patch Phenomenon • Patch size can be large or small in normal tissues (see previous discussion). A patch can contain 200 or more cells and have a diameter of 2-3 mm or greater in some tissues - For example, there have been reports that the patch size in bladder epithelium could be about 120 mm? and composed of 2 x 106 cells
273
11-14
- Monoclonal patch size of normal human thyroid tissue is between 48 and 128 mm'', containing 4 x 105 cells. In fact, when 20 normal thyroids were microdissected and subjected to X chromosome inactivation analysis, 70% demonstrated monoclonality, a likely reflection of large patch size • X chromosome inactivation analysis cannot discriminate between a monoclonal proliferation and a patch • Without considering the patch factor, X chromosome inactivation studies in human tissue, especially when applied to epithelial neoplasms, cannot readily answer questions about clonality A microdissection area of >2 mm? or multiple site cell harvesting could be helpful in differentiating between a normal patch and an abnormal clonal proliferation
res Bias • PCR bias is the phenomenon in which PCR can preferentially amplify one of two heterozygous alleles • Differential methylation of androgen receptor gene, HUMARA, permits identification of non-random X-inactivation in a monoclonal tumor • Co-amplification of two alleles in a heterozygote generates PCR products in different sizes • Under optimized conditions the amplification efficiency of two alleles is equivalent yielding equal band intensities • Highly imbalanced PCR products of heterozygous alleles may be present with preferential amplification of lower molecular weight alleles - PCR bias can be caused by different factors - Biased amplification consistently favors the lower allele - Regional secondary structure of DNA is another factor leading to PCR bias. Titrating the melting temperature is necessary to solve this issue - Adequate genomic DNA quantities are essential for a consistent allelic amplification. Five nanogram or more of genomic DNA can generate consistent amplifications - The quality of genomic DNA is critical when DNA is extracted from paraffin-embedded tissues. A report suggests that using 7-deaza-2'-dGTP could adjust the upper band coefficient by fourfold
Persistence of Biallelic Bands in Tumor Samples (Table 3) • Up to 40% of cancers may have a random X chromosome inactivation patterns • The loss of X chromosome inactivation may be related to loss of the XIC located at Xq13 • Contamination with normal tissue is one of the major causes of loss of sensitivity. Precise microdissection may be required for accurate interpretation
274
Molecular Genetic Pathology
Table 3. Persistence of Biallelic Bands in Tumor Samples Possible explanations • Deletion of XIC • Contamination with normal tissue • Incomplete DNA digestion • X chromosome aneuploidy • Co-existence of multiple tumor subclones of independent origin • Variable methylation patterns at the HUMARA locus • Reactivation of inactive X chromosome • Others
• Incomplete DNA digestion leads to the amplification of non-methylated alleles, which will greatly reduce the sensitivityby showing a pseudorandom inactivation • Methodology divergence, including different laboratory criteria for allelic loss, PCR conditions, and assay method selection, are also among reasons for persistence of biallelic patterns • X chromosomeaneuploidy - X chromosome inactivation mechanisms result in only one active X chromosome. The other is subject to inactivation even in the setting of X chromosome aneuploidy such as XXX, XXY, or XXXX Multiple X chromosomes from paternal and maternal origin may be inactivated and show falsely random inactivation in clonality analysis. Pseudorandom X chromosome inactivation should be excluded through other techniques, such as fluorescence in situ hybridization (FISH) • Co-existence of multiple tumor clones of independent origin may show false random X chromosome inactivation representing more than one clonal tumor. Precise small area microdissection of tumor cells may be helpful in solving this problem • Variable methylation patterns at the HUMARA locus can be seen in neoplastic and non-neoplastic cells - About 15% of X-linked genes escape inactivation to some degree, and the proportion of genes escaping inactivation differs dramatically between different regions of the X chromosome - The incidence of variable X chromosome inactivation in healthy females varies from 4 to 33%, which may be related to tissue-specific X chromosome inactivation patterns
Clonality Analysis in Modern Oncology and Surgical Pathology
11-15
Table 4. Commonly Used Clonalitv Analysis Techniques X chromosome-linked methods • DNA-based : - DNA methylation
• Human androgen receptor locus (HUMARA) • M27~ probe for DXS255 locus - Restriction fragment length polymorphism (RFLP) • Glucose-6-phosphate dehydrogenase (G6PD) locus • Hypoxanthine phosphoribosyl transferase (HPRT) • Phosphoglycerate kinase (PGK) locus • RNA-based : - Palmitoylated membrane protein p55 gene locus - Iduronate-2-sulfatase (IDS) gene locus • Protein-based: - Glucose-6-phosphate dehydrogenase (G6PD) isoenzyme
Non-X chromosome-linked method • Loss of hetero zygosity • Somatic mutation (e.g., p53) • Gene rearrangement (e.g., T cell receptor and immunoglobin rearrangement for lymphom a work-up) • Restriction fragment length polymorphism (RFLP) • Cytogenetics and fluorescen ce in situ hybridi zation (e.g., FISH for il2p) • DNA methylation • Microsatellite instability • Viral integration analysis (e.g., EBV, HBV, HCV, HPV) • Comparative genomic hybridization (CGH) • Microarray-based cionality analysis • MicroRNA fingerprint • Protein based analysis (e.g., OCT4, TfFI) EBY, Epstein-Barr virus; HBY, Hepatiti s B virus; HCY, Hepatit is C virus ; HPY, human papillomavirus
• Age-related reactivation of inactivated X chromosomes. This may be related to the loss of a critical methylation sites on the X-linked genes
Other X Chromosome-Linked Clonality Analyses (Table 4) • Various methods have been used in the past, essentially all of which have been gradually replaced by HUMARA X chromosome inactivation analysis . The reader may refer to specific articles for more detailed discussions • M27~ probe for DXS255 locus - Locus DSX255 on the X chromosome is consistently differentially methylated and can be analyzed directly to assess X chromosome inactivation status
- The M27~ probe is hybridized to electrophoretically separated DNA - The polyclonal tissue shows two equal bands and the monoclonal tumor shows a pattern of unequal bands • Gluco se-6-phosphate dehydrogenase (G6PD) , hypoxanthine phosphoribosyl transferase (HPRT), and phosphoglycerate kinase gene s - These are restriction fragment length polymorphism (RFLP)-based analyses - DNA from tumor and control are extracted and purified and then peR amplified - The amplified DNA is cut into restriction fragments using suitable endonucleases, which only cut the DNA molecule at a specific recognition sequence
275
Molecular Genetic Pathology
11-16
- The restriction fragments are then separated by agarose gel electrophoresis - Clonal and non-clonal populations show different band patterns accordingly • Palmitoylated membrane protein p55 gene locus - Human p55, located at Xq28, encodes an abundantly palmitoylated phosphoprotein of the erythroid membrane - The allele on the inactivated X chromosome is silenced - mRNA is extracted and reverse transcribed using random primers . cDNAs are amplified with specific primer sets for two round s - Two bands are seen when X chromosome inactivation is random but cells with non-random X chromosome inactivation show a single band • Iduronate -2-sulfatase (IDS) gene locus - IDS clonality analysis is an mRNA analysis for a functional silencing of the gene - mRNA is extracted and reverse transcribed by random primers . PCR and primer extension analysis are carried out for IDS - Two bands are seen when X chromosome inactivation is random • G6PD isoenzyme analysis - This is a classic tool that has be used to study X chromosome inactivation status and clonality since the 1970s - Protein is extracted from cells and the G6PD fraction is collected and then separated by electrophoresis - The protein bands are compared with known heterozygous blood cells - A clonal cell population will show only one isoenzyme band
Selected Applications Defines the Monoclonal Nature of the Lesion • Renal angiomyolipoma is a benign neoplasm composed of blood vessels, smooth muscle, and adipose tissue. Whether renal angiomyolipoma is a hamartoma or a neoplastic process has long been debated. It is also uncertain which components of angiomyolipoma represents clonal growths and if various components share the same clonal origin. Cheng et al. (2001) found the smooth muscle cells and the adipose tissue to have differing pattern s of non-random X chromosome inactivation, indicating that both are monoclonal and probably originate from independent clones (Figure 10)
Defines the Clonal Relationship of Separate Tumors • Two proliferative cell populations (e.g., two separate tumors) that share the same non-random X chromosome
276
N
+
8M
AT
+
+
BV
+
Fig. 10. A representative gel picture of X chromosome inactivation analysis of the various components of a renal angiomyolipoma. N, normal; SM, smooth muscle; AT, adipose tissue; and BV, blood vessel. - and + indicate that DNA is non-digested or digested with methylation sensitive restriction enzyme . In SM and AT, opposite patterns of nonrandom X chromo some inactivation indicate that the lesions are clonal proliferations with each component having a different clonal origin. BV shows a random X chromosome inactivation pattern (two allelic bands).
inactivation patterns have a 50% probability of being derived from a common progenitor cell (monoclonal) since the chance of either paternal or maternal origin of the inactivated X chromosome is 50% • Different patterns of non-random X chromosome inactivation in separate tumors support independent origin • With a larger number of cell populations analyzed, results of clonality assessments become more meaningful. The probability of different cell populations with the same pattern of X chromosome inactivation representing a polyclonal process (i.e., unique genetic origin) decreases as the sample number (n) of cell populations increases [probability =(0.5)n] • For example, patients with ovarian papillary serous tumor of low malignant potential (LMP) may have peritoneal "implants" of histologically identical tumors. Gu et al. (2001) studied a group of women with advanced-stage ovarian papillary serous tumors of LMP using X chromosome inactivation. Most of the patients with peritoneal and ovarian tumors showed different X-inactivation patterns, suggesting that peritoneal tumors asso ciated with ovarian LMP tumors may arise independently from their own primary tumor clones rather than through an "implantation" process. Some patients with bilateral ovarian tumors of LMP showed different X chromosome inactiv ation patterns in tumors of each ovary, indicating that the patients had bilateral primary tumors instead of one ovarian tumor with metastasis to the oppo site ovary (Figure 11)
Defines the Clonal Relationship of Different Components of the Same Tumor • The identification of components of different biologic aggressivenes s within a single neoplasm is a common finding in pathology. These variable components are
Clonalitv Analysis in Modern Oncology and Surgical Pathology
N
LO
+
OM
+
11-17
SBS
+
PN
+
+
Fig. 11. X chromosome inactivation analysis of multi-focal ovarian papillary serous tumors of LMP. Tumor locations are as follows : La, left ovary; OM, right ovary; SBS, peritoneum; and PN, pelvic lymph node. N represents normal. - and + indicates that DNA is non-digested or digested with methylation sensitive restriction enzyme . The tumor from the LO and SBS share the same X chromosome inactivation pattern, both showing loss of the upper alleles after digestion . This is suggestive of a common clonal origin. However, tumor from the PN shows a different clonal origin . The allele from the right ovary shows a reduced upper allele but does not reach the cutoff value and thus is interpreted as negative.
thought to result from tumor cell dedifferentiation or transformation, with the subsequent evolution of different sub-populations of tumor cells, a concept that is exemplified by the co-existence of small cell and urothelial carcinoma of the bladder. Cheng et al. (2005) found a concordant pattern of non-random X chromosome inactivation between small cell cancer and co-existing urothelial carcinoma, suggesting that both tumor components originate from the same progenitor cells in the urothelium. These findings may provide new insights into the treatment of small cell carcinoma of the urinary bladder
Defines the Clonal Relationship Between Precursors (Such as Intra-Epithelial Neoplasia) and Cancer • Guo et al. (2000) studied cervical intra-epithelial neoplasia with co-existing invasive cancers using X chromosome inactivation. The authors found that
pre-cancerous lesions and co-existing cervical cancers were clonally related. Carcinogenesis of cervical cancers involves selection of sub-clones from originally polyclonal precursors
Defines the Clonal RelationshipsBetween Primary and Metastatic Tumors • Evidence of genetic heterogeneity and tumor sub-clones within urothelial carcinoma of the bladder has raised questions about the clonal origin of urothelial carcinoma and its metastases . Jones et al. (2005) investigated female patients who underwent radical cystectomy for urothelial carcinoma. The X chromosome inactivation analysis showed identical non-random inactivation patterns in primary bladder cancer and pelvic lymph node metastases, suggesting that the capacity for metastasis arises in only a single clonal population in the primary tumor
LOSS OF HETEROZYGOSITY (LOH) AS A CLONAL MARKER Overview • Microsatellites are polymorphic loci that consist of repeating units of 2-6 bp that repeat 10-100 times without interruption. There are approximately 200,000 rnicrosatellite loci in the human genome • The polymorphism of microsatellites is the basis for rnicrosatellite analysis • Slipped strand rnispairing is the primary mechanism for polymorphism, which leads to deletion or insertion of the microsatellite repeat unit - Slipping is caused by regional non-pairing, which forms a "bubble" containing one or more repeat units.
If the slippage involves a newly synthesized strand it is called "backward slippage;" if it involves the parental strand it is called "forward slippage" - 5'-3' slipping (backward slippage) causes insertion of a repeat unit and 3'-5'-slipping (forward slippage) causes deletion of a repeat unit • In a heterozygote, peR amplification using rnicrosatellite locus-specific primers will result in two distinct bands, representing maternally and paternally derived alleles • LOH represents the loss of one parent's contribution to the cellular genome . (Figure 12)
277
11-18
Molecular Genetic Pathology
N
N
T
••• ••• • • -.+- - - -
•••••• • • • ••
! . . ...... ..
!
....
.. ..
I ••
N
T
. :
DNA extraction
~
....
peR amplification
/
~
A Fig. 12. LOH in a cell represents the loss of one parent's contribution of microsatellite DNA to a cell's genome . It often indicates the presence of tumor suppressor gene loss adjacent to the microsatellite locus. An informative locus is the one that the maternal and paternal alleles are different in repeat numbers . Specific primers (green) are used to amplify the alleles . For normal (N) cells, both alleles are intact and, thus, can be amplified. When the tumor cells (T) have lost a segment of its DNA, the lost allele (boxed) cannot be amplified . Two allelic bands are seen in normal control DNA; whereas, tumor DNA shows loss of the lower allele (LOH). • LOH often indicates the presence of a tumor suppressor gene in the lost region
- If LOH occurs at a selected polymorphic region that is related to a known tumor suppressor gene, it is highly suggestive of deletion of the corresponding gene as this also explains the growth advantage of the tumor cells carrying that genetic alteration . LOH can result in haploinsufficiency of a specific allele - LOH has been considered an early event during carcinogenesis. Often, the remaining copy of the tumor suppressor gene will be inactivated by mutations during cancer progression - LOH is inheritable and can be passed to the cellular derivatives. The presence of a uniform and nonrandom alteration of a tumor suppressor gene as demon strated by LOH analysis in all cells of a tumor confirms a clonal origin - LOH is related to chromosomal instability. A cell with chromosomal instability carries mutations that result in an increased rate of LOH • A number of mechani sms can lead to LOH, including local deletion, non-disjunction of chromo somes, mitotic recombination, gene conversion , double-strand break resulting in loss of a chromosome arm, or whole chromosome loss • The principle of LOH clonality analysis is that the clonal expanding cells share a common set of allelic losses
278
- -- - - I
Gel electrophoresis
Allele1-' 1Allele 2-.
B _
Pattern X
~
Normal tissue
A
B
Pattern Y
Fig. 13. An LOH-based clonality test compares the allelic banding patterns between tumors and normal tissue . Pattern X shows an opposite allelic loss pattern in two separate tumors (A and B), suggesting a different clonal origin. Pattern Y shows the same allelic loss pattern in each tumor, suggesting a common clonal origin. Normal tissue shows double alleles indicating that the patient is heterozygous (informative) at the locus .
Evaluation and Interpretation of the LOH Analysis Results • LOH can be identified by detecting the presence of heterozygosity in germline DNA and the absence of heterozygosity at the same locus in the tumor DNA • LOH can be used as a clonal marker. Tumor cells derived from the same progenitor cells will share the same LOH patterns at multiple microsatellite loci • Brief procedures (Figure 13): - Genomic DNA is extracted from microdissected normal and cancer tissues - PCR amplification of microsatellite loci from tumors and normal control DNA is performed - The PCR products are subjected to electrophoresis. Microsatellite patterns of normal and tumor samples are compared • Informative case: - Two alleles are present after PCR amplification in normal control samples - Informative is a synonym for the heterozygous state - Microsatellite loci with a relatively high heterozygous rate should be selected for the study • Non-informative case: - Only one allelic band is present in normal control DNA after PCR amplification
Clonality Analysis in Modern Oncology and Surgical Pathology
- This is due to the identical size of two alleles which could not be distinguished, as seen in the homozygous state • LOH clonality analysis results are based on the comparison of band patterns in tumor and normal control DNA. A non-informative case cannot be analyzed by this method • Identical allelic loss patterns shared among separate tumors suggests a common clonal origin; different or opposite allelic loss patterns in two separate tumors suggests a different clonal origin (Figure 13)
Advantages and Limitations of LOH Analysis • Advantages: - Unlike X chromosome inactivation, this technique is applicable to both men and women - LOH is a sensitive marker for morphologically normal pre-cancerous cells - Many microsatellite loci have high LOH rates in different malignancies - In analysis of multiple tumors, LOH analysis generally uses multiple microsatellite markers ; thus, decreasing the likelihood of random matches (see discussion below) - The clonal population of cells may be recognizable even during sub-clone evolution in tumorigenesis • Limitations: - Accurate interpretation of results requires a pure population of target cells . Tissue microdisssection is often required to avoid contamination - Selection of appropriate microsatellite loci for specific applications may be difficult - For formalin-fixed, paraffin-embedded tissue, a long PCR microsatellite fragment is difficult to amplify (PCR product of 5 million criminal justice DNA profiles are in the database . The random match probability for each allele locus ranges from 8 x 10-4to 7.2 X 10- 19 depending on the polymorphism and number of repeats at each locus • Commercially available microsatellite panel kits and automated systems such as the ABI3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) allow the screening of multiple short tandem repeat (STR) loci in one run. With proven high specificity and sensitivity, CODIS markers have become the most commonly used loci in identity testing. Small screening panels can confirm an identity at a specified level of confidence • Brief procedures for microsatellite identity analysis (Figure 21): - The tissues are harvested separately from known host tissue or suspected contaminating tissue using tissue microdissection; genomic DNA is isolated. Patient blood DNA, if available, is also extracted as a reference - The DNA from different tissue origins is amplified using microsatellite locus-specific primers. The PCR products are separated by polyacrylamide gel electrophoresis or capillary electrophoresis - The allelic patterns from the known patient DNA sample and from the suspected contamination DNA are compared - If the tissues are derived from the same patient, both DNA samples will show identical band patterns (also
289
11-30
Molecular Genetic Pathology
• i
Contam ination?
I
LOH , MSI
~
. 1Il.@'2IDji1illr~@ii1 . Inconclusive results
Fig. 20. Diagnostic strategies for identifying tissue contamination or patient identity mismatches. FISH for sex chromosomes is usually the first test used to distinguish sex-mismatched samples. When the suspected contaminating tissue displays the same pattern of sex chromosomes as the patient control tissue, microsatellite markers may be employed to assess for contamination (identity mismatch). CODIS loci are usually used for microsatellite profiling. There are three possible outcomes: the suspected contaminating tissue may display a different microsatellite profile, consistent with specimencontamination; the suspected contaminant may display an identical microsatellite profile, rulingout specimencontamination; or the testmay yield inconclusive resultsdue to LOH or MSI in tumorsamples. In this latter situation, stromalcell DNA can be tested to resolvethe issue. HLA genotyping may also be employed in these cases.
identical to that of the patient blood DNA reference); simultaneous detection of different allele patterns over multiple loci strongly suggests that the tissues are from different individuals
290
• HLA genotyping is useful in tests of identity mismatch or tissue contamination - The HLA system is a group of genes that reside on chromosome 6, which encode cell-surface
Clonality Analysis in Modern Oncology and Surgical Pathology
11-31
A
xx
B
Patient's tissue /
® p e R Amplification .
Suspected contamination
~
XX
~
/'
t
Locus 1
Locus 2
Locus 1
Locus 2
ps
ps
p s
ps
1== ==11= I
•
~ ---+
-
@ ~
==1 II
•
P Panent'a tissue
S : Suspectedccn taminanon
o : X chromosome 0 'Y
chromosome
Histopathology-+FISH-+ONA extraction I peR -+ Microsatellite profiling
Fig. 21. Molecular identity testing is based on the principle that cells from the same individual share a common set of genetic characteri stics. FISH testing for sex chromo somes will distinguish sex-mismatched cases (A). However, there is a 50% chance that the suspected contaminating tissue is from a same gender individual. Microsatellite profiling can be used to differentiate the tissues (B). Genomic DNA is extracted from the tissues and PCR amplified followed by gel electrophoresis. Schematic allelic patterns are shown in the box on the right. P and S designate patient and suspected contaminating tissues, respectively. (I) Concordant allelic pattern s indicating the tissue is from the same individual; (II) discordant allelic patterns indicating that the tissue is from different individuals. Only informative loci are shown here for illustrative purposes. antigen-pre senting proteins and many other proteins. The chan ce of unrelated individuals having identical HLA genotypes is very low; therefore, the HLA genotype can be used as a clonal marker (see Chapter 27 for more details) - A commercial kit can be used to amplify and distinguish 21 different genotypes at a polymorphic HLA locus - Brief procedure s • DNA is extracted from a tissue section, then PCR is amplified against the HLA DQ-ulocus (6p21.3), followed by hybridization to nylon membrane strips with allele-specific HLA-DQ-u probes
• The pattern of signal dots indicates the homology to the HLA-DQ-u alleles, which reflects the genotype • Different genotypes indicate that tissue samples are from different individuals
Caveats • The ability of a single microsatellite marker to distinguish between individuals depend s on the degree of polymorphism the marker exhibits. The reported rate ranges from 59 to 91%, but absolute matching requires several polymorphic microsateIlite markers
291
Molecular Genetic Pathology
11-32
Table 5. The Combined DNA Index System Locus
Repeats
Location
Fragment size
TPOX
5-14
2p23-pter
102-138
O3S1358
8-20
3p21
99-147
FGA
12-51
4q28
308-464
05S818
7-16
5q21-31
133-169
CSFIPO
6-16
5q33-34
281-321
07S820
5-15
7q
205-234
08S1179
7-19
8q24.1-24.2
157-205
THO I
3-14
IIp15
146-190
vWA
10--25
12p-pter
122-182
013S317
5-16
13q22-31
157-201
016S539
5-15
16q22-24
141-173
018S51
7-27
18q21.3
262-342
021S11
24-38
21q21.1
186-244
• Since most of the analyzed materials are from formalinfixed and paraffin-embedded tissue, the rate of detectable amplification products declines with increasing amplicon length. Shorter fragments, preferably I0% of cases
Mantle Cell Lymphoma • All cases of mantle cell lymphoma (5-7% of all NHL), showing CD5 +/CD23- B-cell phenotypes, exhibit t(ll; 14)(q13;q32) abnormality (Figure 38C, left bottom row)
• The most frequent monosomies include -13, -14, and -15
• The prognosis of mantle cell lymphoma is the worst among all B-celllymphomas, and there is no therapy that can be considered as standard
• A complex karyotype may have an adverse impact on prognosis
• t(ll; 14)(q 13;q32) is also found in a wide variety of other B-cell malignancies including MM, splenic lymphoma
353
12-52
with villous lymphocytes, and B-cell prolymphocytic leukemia • Most breakpoints on IIql3 are dispersed over a region of about 130 kb centromeric to the eye/in D (CCNDI) gene. At the molecular level, the BCLl locus (CCND I) on chromo some II q13 is juxtaposed to an enhancer sequence within the immunoglobulin heavy chain UGH) gene on 14q32 leading to overexpression of the eye/in D gene, which is not expre ssed in normal B- and T-cells, nor in other malignant lymphomas • The consequence of this translocation is overexpre ssion of eye/in D, a gene involved in control of the cell cycle • Each method for detection of t( II; 14) including cytogenetics, Southern blot, and PCR analyses has limitations. Cytogenetics is hampered by a low mitotic index of neopla stic B-cell s. Southern blot and PCR analyses for IIq13 rearrangements are positive in only S0-60% of patients with mantle cell lymphoma becau se the breakpoints within II q 13 are scattered along a I30-kb distance • Dual color FISH has proved to be the most sensitive assay for detection of lGH/CCNDl fusions, which was found in 100% of cases. Furthermore, the CCNDl fusion rearrangement can be detected in formalin-fixed , paraffinembedded samples making this method rapid, reliable , independent of cell cycle and applicable to all cases of mantle cell lymphoma A gain of 3q, 7p, and I2q and loss of II q 14-23 and 17p are the most frequent numeri cal changes, and unlike other lymphomas, in mantle cell lymphoma DNA amplifications of several chromosomal regions appear to be associated with a blastoid variant.
Molecular Genetic Pathology
chimeric transcript consists of S'-APl2 and 3'-MALTI located on the der(18) • Cytogenetic studies of low-grade MALT B cell lymphomas also show a recurrent (rare) t(l;I4)(p22;q32) abnormality. On the molecular level a recurrent breakpoint upstream of the promoter of BCLl 0 at Ip22 was identified in these patients
Lymphoplasmacytoid Lymphoma (LPL) • LPL is a small lymphoc ytic lymphoma with plasmacytoid differentiation (CDS- ICD I0%) characterized by t(9;14)(pI3;q32) in approximately SO% of cases. As a result of this translocation the PAX5 gene (paired homeobox S) on 9pI3 moves to the lGH locus on der(14) causing dysregulation of PAX5 • Molecular characterization of the t(9;14) revealed that the coding region of the PAX5 gene , remains intact in some patient s. In those individuals the t(9; 14) should be considered as a regulatory mutation, whereb y the PAX5 gene is brought under the control of the lGH locus. In other cases, molecular studies of the t(9;14) revealed that the breakpoint has occurred upstream of the PAX5 promoter leading to insertion of the lGH enhancer upstream of the PAX 5 gene. The PAX5 gene encode s a B-cell-specific transcription factor and PAX5 -1- mice display maturation arrest at the CD43 pro-B-cell stage with defective Ig rearrangement
Waldenstrom Macroglobulinemia • Waldenstrom macroglobulinemia is a plasma cell dyscrasia characterized by a CD I 38/CD19 phenotype with a Iympho/plasmacytic clonal expansion in the bone marrow
Marginal Zone B-cell Lymphoma (MZBCL) and Mucosa-Associated Lymphoid Tissue (MALT) Lymphoma
• The biological nature is different from LPL because these patients do not display t(9;14)(p 13;q32)
• MZBCL and B cell lymphoma of MALT are the commonest form of extranodal NHL and may be either high or low grade . An etiological link between low-grade gastric Malt lymphoma and the lymphoid reaction associated with Helioba cter pylori infection , has been demonstrated
Hodgkin's Disease (HD)
• By interphase FISH analy sis, trisomy 3 or trisomy 18 were found in 60-80% of the analyzed cases. The pathogenic role of trisomy 3 is not known, but BCL6 residing at 3q27 is rearranged in some MZBCL, although more frequently in large B cell lymphomas • The most frequent and specific aberration occurring in MZBCL and MALT lymphomas is t(lI ;18)(q21;q21.1 ) (Figure 38D, right middle row). It is the only recurrent translocation that doe s not involve IG genes even though it present s as a B cell lymphoma. As a consequence of t( II ;18), APl2 gene on Ilq21, encoding an inhibitor of apopto sis (aka IAP2, HlAPland MIHC) and a novel gene MALTl on I8q21, characterized by several Ig-like C2-type domains , are often rearranged. The resultant
354
• There has not been much progress in delineating recurrent chromo somal abnormalities in HD. Classical HD has emerged as the term for HD characterized by the CD IS+, CD30+ phenotype • Less than I% of the cells in HD are Reed-Sternberg cells (most likely of B-cell origin). Therefore, the sparcity of dividing tumor cells for karyotype analysis has represented a major obstacle for conventional cytogenetics • With simultaneous fluore scence immunophenotyping and interpha se FISH (FICTION) all 30 HD patients studied had numerical aberrations of CD30+ • The most specific chromosomal abnormalities in HD are hyperdiploidy/tetraploidy with tremendous variations in the chromo some number indicating heterogeneity from patient to patient. Even with the use of nine different centromeric probes no specific numerical chromosomal abnormality has been identified • Deletion s of Ip, 4q, 6q, and 7q are recurrent
12-53
FISH and Conventional Cytogenetics
T-CELL LEUKEMIA AND LYMPHOMA T-Cell Lymphoproliferative Diseases • T-cell ALL • T-cell CLLIPML as well as a group of indolent or small T-cell disorders • Large granular lymphocyte leukemia • NK leukemia/lymphoma • Anaplasic large cell lymphoma The common theme in T lymphoid malignancies is the juxtaposition of T-cell receptor genes (TCR) adjacent to a variety of transcription factors located at or near breakpoints on the partner chromosome. The chromosomal bands most frequently involved are 14q II, where TCRA and TCRD are located , 7q3S, the site of TCRB as well as 7p1S, the site of the TCRG gene. The rearrangements of TCRB and TCRG are relatively rare while 14qll rearrangements involving both TCRA and TCRD are frequent in T-Iymphoid neoplasms.
T-Cell ALL
patients with T cell ALL. It is associated with excellent outcome • The complete remission rate is 100% with a median disease-free survival of 46 months. More than 7S % of patients have a 3-year disease-free survival • The t(lO;14) , seen in about 4-7% ofT-ALL, fuses the homeobox-containing gene HOXll (TCL3) with the TCRD gene. The coding regions of HOX 11 are not disturbed by the translocation. In the variant translocation t(7; I0)(q3S;q24) HOXll is juxtaposed to the TCRB gene, which results in overexpression of normal HOXll mRNA by bringing HOXll under the influence of TCR promoter sequences
TCR Rearrangements • Table 17 shows the frequency of TCR rearrangements in T-ALL • Conventional cytogenetics may not recognize about half of the TCR~ and about one third of TCRaJo rearrangements
• In children, the overall frequency of T-cell ALL translocations is 40-S0% but there is no specific karyotype abnormality associated with T-ALL
t(5;14)(q35;q32) or t(5;14)(q34;qll)
• Three transcription factor gene s share more than 8S% homology in their basic HLH motif and they include :
• Neither of these abnormalities are recognized by conventional cytogenetics
- The TAL 1 (or SCL ) gene, located on the Ip32, is found in t(l ;14) (p32;q II) and t(l ;7)(p32;q3S). TAL 1 gene rearrangements are observed in about 3% of patients with T-ALL but are more frequent in pediatric than in adult ALL. In about 30% of these patients TALl rearrangements are not detected by conventional cytogenetics . Other rare translocations involving the TALl locus are t(1;3)(p32;p21) and t(l ;S)(p32;q3l). Another consistent rearrangement observed in 12-26% of individuals with T-cell ALL is a site-specific deletion of about 90-100 kb DNA affecting TALl and SIL genes - The TAL 2, residing at 9q32, is detected in t(7;9)(q34;q32) - LYLl gene , residing at 19p13, is identified in t(7; 19)(q24 ;p13)
• Two other genes, LMOl(RBTNl or TTGl) and LM02 (RBTN2 or TTG2) , belonging to LMO family of genes that contain two additional genes, are found at the breakpoint of rare but consistent chromosomal translocations in T cell ALL. LMO1, located at II p IS, is involved in the t(l1; 14)(p1S;qll), and LM02, located at II p 13, is involved in the t(ll; 14)(p 13;qII) and t(7;II)(q3S ;p13). As an oncogenic transcription regulator, LM02 overexpression in erythroid and T cells leads to differentiation arrest, which is a prerequisite for development of T cell malignancies
• Almost 20% of childhood T-ALL demonstrated a HOXI 1L2 (t Sq3S) gene translocations by FISH • Other variant rearrangements include inv(l4)(qllq32) as well as del(l4)(qll)
T-Cell CLL and PLL T-Cell CLUPLL • The most common chromosomal changes include inv(l4)(qllq32.1), t(l4;14)(qll;q32.1), and t(7;14)(q3S;q32.1). A TCLl (T cell leukemia I) gene, isolated from patients showing 14q32.1 rearrangements, is found to be dysregulated in these patients
Adult T-Cell LeukemiaILymphoma (ATLL) • In ATLL associated with human T-celllymphotropic virus type I (HTLV-I ) the most frequent genetic lesions include altered expression of CDKN2 (cyclin-dependent kinase inhibitor) gene on 9p21 (1S-20%) and loss of heterozygosity (LOH) at 6q1S-21
Natural Killer (NK) LymphomalLeukemia
t(lO;14)(q25;qll)
• A group of highly aggressive hemato-Iymphoid malignancies of natural killer cell lineage (CD2+ ,CD3-,CDS6+, TCR-) having a strong association with Epstein-Barr virus showed chromosomal rearrangements in over 80% by conventional karyotyping
• According to the French collaborative study, the t(10;14) is the most frequent chromosomal translocation in
• The most frequent abnormalities include del(6)(q21-23) and gain of the X chromosome. FISH, CGH, and spectral
355
Molecular Genetic Pathology
12-54
Table 17. Frequency of TCR Rearrangements Using Conventional Cytogenetics vs FISH FISH (%) Total
Locus
Coventional cytogenetics %
Abnormal karyotype
TCRaO
9.S
17.4
24.7
TCR~
3.1
19
26.9
TCRy
0
0
a
Q
Q
aModified from reference Cauwe/ier et a/., 2006
karyotyping confirmed the presence of del(6) in the CD3-,CD56+ tumor cells • Other less common but non-random karyotypic changes include isochromosome lq, 6p, and 17q, as well as del(llq),13q, and 17p, and trisomy 8
Anaplastic Large Cell Lymphoma (ALCL)ALK-Positive Lymphoma • ALCL is a relatively infrequent lymphoma occurring in about 2% of all adults and 13% of children with lymphoma • The molecular basis of the anaplastic large cell group of lymphomas (CD30+), defined recently as ALK-positive or "ALKoma" is the result of t(2;5)(p23;q35), which fuses part of the NPM gene on 5q35 with part of the ALK receptor tyrosine kinase gene (anaplastic lymphoma kinase-ALK) on 2p23 to produce a chimeric NPM-ALK gene. This encodes a chimeric NPM-ALK protein, which has a constitutively activated kinase
• ALK is thought to playa direct role in the malignant transformation of lymphoid cells probably by aberrant phosphorylation of intracytoplasmic substrates because accumulation of the ALK protein is only observed in cytoplasm • The t(2;5) is detected by cytogenetics in 50-70% of patients with ALCL • t(2;5) is readily identified by FISH (Figure 38 right bottom row) and the RT-PCR assay, which has been establi shed and used for detection of the chimeric gene • Overall, 43% of ALCL have NPM-ALK: 83% among pediatric and 31% among adult patients • The other cases of ALCL have variant translocations and they include rearrangements involving 2p23 region: t(1;2) (q25;p23), t(2;5)(q37;q31), t(2;19) (p23 ;p13), and inv(2)(p23q35) all associated with ALK gene expression, and those affecting 5q35 region: t(1;5)(q32;q35), t(3;5)(qI2;q35), and t(3;5) (q25 ;q34-35) • As a result of these variant rearrangements, three new fusion genes have been identified : AT/C-ALK is a fusion gene resulting from inv(2)(p23q35), which fuses ALK and 5-aminoimidazole-4-carboxamide ribonucleotide fonnyltransferase/lMP cyclohydrolase (AT/C). This molecular variant is detected by RT-PCR and is the most common ALK variant. TFG-ALK is a consequence of t(2;3)(p23 ;q21), which fuses TRK-fused gene (TFG) with ALK at the same breakpoint as found in t(2;5). In t(1;2)(q25;p23) the TPM3 gene on chromosome 1, which encodes non-muscular tropomysin, is fused to ALK, to produce the TPM3-ALK fusion gene. Molecular variants also showed chimeric protein localization in cytoplasm. Prognosis of patients with t(2;5) or variant translocations is excellent but is clearly different from ALK-negative ALCA. The true nature of ALK-negative ALCA remains obscure
SOLID TUMORS HER2 in Breast Cancer • Overexpression and/or amplification of HER2 (HER21neu or c-erbB-2Ineu), occurring in 25-30% of patients with breast cancer, is associated with poor clinical outcome, decreased responsiveness to nonanthacyline containing cytotoxic and hormonal therapie s, and shortened survival • Trastuzumab (herceptin), a recombinant monoclonal antibody that specifically targets the HER2 receptor, is a proven therapy for patients showing HER2 amplification
• HER2 status is used for select ion of patients for Trastuzumab immunotherapy
356
- The HER2 oncogene encodes a protein with a molecular weght of 150,000 daltons (pI85). The gene product is a transmembrane tirosine kinase receptor belonging to a family of epidermal grow factor receptors. The ligand for HER2 has not been identified . Therefore, it has been hypothesized that the main role of HER2 may be to dimerize with the other members of HER2 family of receptors
HER2Assays • Three groups of assays are used to determine HER2 status in formalin-fixed, paraffin-embedded tissue sections and they include :
FISH and Conventional Cytogenetics
12-55
Fig. 39. Breast biopsy tissue after hybridization with HER2 (red) and CEP17 (green) (top panel) . Cells showed a normal hybridization pattern with disomy for both loci. In contrast, three isolated cells (bottom row) from three different biopsy preparations showed disomy for CEPl 7 and numerous copies, amplification for HER2.
- Immunocytochemistry (IHC) , which measures protein overexpression - FISH method, which evaluated gene copy ampl ification - Serum ELISA test, which measure s the levels of the shed extracellular domain of the HER2 receptor protein
The IHe Method • The US FDA approved two IHC methods: - Hecepte st (Dako, Carpintera, CA) and - PATHWAY (Ventana Medical Systems Inc, Tuscon, AR) • HercepTest is currently recommended IHC method with scoring range from 0-3+. Samples scoring 3+ are regarded as unequivocally positive and Oil + as negative. Borderline 1+12+ and 2+ require FISH
confirmation as recommended by the NCCN task force. Tumors that are 2+ with a normal gene copy should be regarding as true false-positive that will not benefit from Trastuzumab therapy • Many factors may contribute to false-positive results and they include the type of fixative that preserves antigenic integrity, prolonged storage of tissue blocks, the type of antibody used in the assay, and the scoring system
The FISH Methods • FDA approved FISH tests include: - PathVysion (Vysis, AbbottIMolecular, Des Plains , IL) (Figure 39) - INFORM (Ventana Medical Systems Inc.) - HER2FISH PharmaDx (Dako)
357
12-56
• PathVysion depend on scoring the exact number of HER2 hybridization signals and internal control, and centromere 17 hybridization signals per nucleus. The ratio between the two is called amplification ratio (AR). The PathVysion uses AR less than 1.8 as negative result, AR greater than 2.2 as positive result, while AR between 1.8 and 2.2 must be interrelated with caution • The INFORM HER2 assay uses the absolute number of HER2 signals and
Molecular Genetic Pathology
the value recalculated. The manufacturer recommends also that AR result of 1.9 should be reported as no amplification and for a ratio of 2.1 the results should be reported as amplification. This recommendation underscores the need for standardization and consensus for interpretation of borderline category results since accurate determination of HER2 gene status will eliminate treatment of inappropriate patents
considers ~5 .0 gene copies of HER2 as amplified
Bladder Cancer
• The HER2 FISH pharrnaDx considers ~2.0 HER2/Centromere 17 amplified
• Each year between 50,000 and 60,000 new cases of urothelial carcinoma (UC) are diagnosed in the United States. Bladder cancer is the fourth most prevalent cancer in males and the eight most prevalent Cancer in females
Concordance Between IHC and FISH • Numerous studies have compared degree of concordance between IHC and FISH as well as intra- and interlaboratory reproducibility of FISH and IHC. In the study of 2535 patients with breast cancer enrolled in North Central Cancer Treatment Group trial N9831, between 2001 and 2005, concordance of ISH and FISH findings were compared with the central testing laboratory. Concordance between the local and central laboratories to establish IHC3+ overexpression status, using HecepTest, was confirmed in 81.6%. FISH was used to detect the HER2 status in 813 patients, and conformation by central laboratory was achieved in 88.1% (85.6-90.2%, 95% CI) • FISH concordance between local and central laboratory testing was greater than IHC concordance between the local and central laboratory (P < 0.001) • Reproducibility of FISH HER testing for negative and amplified results between laboratories was also confirmed by the College of American Pathology surveys conducted between 2000 and 2004 in over 100 laboratories • When discordant cases (18.4% for IHC and 11.9% by FISH) in the North Central Cancer Treatment Group N9831 study were retested at a reference laboratory, concordance between the central and local laboratories showed a high level of agreement: 94.3% for ICH (0, I+ and 2+) and 95.2% for FISH (not amplified) • False-positive and false-negative HER2 test results can partly be attributed to the lack of concordance between IHC and FISH • IHC2+ category is most likely to be discordant when compared with FISH method because agreement rates for other IHC categories were 97% for ICH 0, 93% for IHCl+, and 89% for ICH3+ . Polysomy 17 may be one of the reasons responsible for overexpression of HER2 protein as measured by IHC method. Since Herceptinbased therapy for IHC2+ remains to be determined, an IHC2+ test result is potentionally unreliable indicator of HER2 status . The variability in definition and use of a borderline interpretation may be partly explained by inter-observer variability and different interpretation for critical cutoff values. When Pathvysion is used, the manufacturer recommends that in case of tumors showing AR of 1.8-2.2 additional 20 nuclei should be scored and
358
• UC, also known as transitional cell carcinoma, arises from urothelial cells that line the bladder, ureters, renal pelvis, and proximal urethra • Two main types of UC are recognized: flat UC (20%), also termed carcinomas in situ (CIS) and more frequent, papillary UC (75-80%). Papillary tumors tend to recur but not progress, while CIS tend to recur and progress to invasive UC • UC and bladder cancer, like most epithelial tumors, derive from a step-wise progression of genetic and chromosomal events
UroVysion™, FDA-Approved Assay • The only FDA-approved test is Urovysion" FISH tests from Vysis/Abbott Molecular, which utilize centromere enumeration probes for chromosomes 3, 7, and 17 and locus specific 9p21, because these chromosomes as well as 9p21 locus were found to be the most frequently altered in UC. The multi-target, multi-colored set of probes are labeled in four different colors and are used simultaneously on voided urine specimens. The UroVysion™ kit is used for both, the diagnosis and recurrence of UC (Figure 40)
Protocol for UroVysion™ assay • The detailed protocol for UroVysion ™ is included in the Vysis/Abbott molecular package insert. It includes the following steps: - Voided urine specimen is collected in the ThinPrep urine collection kit (Cytic Corporation, Boxbourough, MA) and transported to the lab within 24 hours - Cells are pretreated in 2X SSC, protease, and PBS - Fixation of cells is in 1% formaldehyde followed by PBS wash - Co-denaturation (2 min) of target DNA (urocytes) and probes and hybridization with set of probes: CEP3 (red), CEP7 (green) , locus-specific probe 9p21 (aqua),and CEPl7 (gold) for 18-24 hours using Thermabrite
FISH and Conventional Cytogenetics
12-57
Fig. 40. A morphologically abnormal urocyte after in situ hybridization with a set of 4 probes . Note eight copies of chromosome 3 (red), six copies of chromosome 7 (green), six copes of chromosome 17 (aqua), and no gold hybridization signals with 9p21 locus. Homozygous deletion of 9p21 is associated with recurrence but not necessarily aggressiveness or progression of disease.
- Post-hybridization washing includes O.4X SSC/O.3% NP-40 and 2X SSC/O.l % NP-40 followed by counterstaining with DAPI - Interpretation of hybridization signals : • If 4 or more of the 25 evaluated cells show gain for 2 or more chromosomes (3,7, or 17) in
the same cell the results are considered abnormal • If 12 or more of the 25 evaluated cells showed zero 9p21 signal the results are considered abnormal • If abnormal cells are not identified among 25 scored cells by two individuals the entire slide and/or sample has to be evaluated
359
Molecular Genetic Pathology
12-58
Results Obtained with Uro Vysion™
Classification of Gliomas
• A multi-centered, prospective, blinded trial to compare the sensitivity of multi-target FISH assay with that of voided cytology in 473 patients with gross and microscopic hematuria demonstrated that Urovysion" is significantly more sensitive than voided cytology for all grades and stages. Based on these data, UroVysion™ was FDA approved for the use in patients with hematuria
• According to the WHO histopathologic criteria, glial tumors are classified into three major types:
• The application of UroVysion TM FISH assay for UC recurrence showed, in compilation of published literature, the overall sensitivity of cytology in 48% and the overall sensitivity of FISH in 74%. More specifically, for grade 1 comparative studies showed sensitivity of cytology compared with FISH in 19% vs 58%, for grade 2, 50% vs 77%, and for grade 3, 71% vs 96% • When sensitivity of cytology was compared with FISH sensitivity, according to the stage the cumulative literature data showed for Ta: 35% vs 65%, for Tl, 66% vs 83% ,and for muscle-invasive carcinoma, 75% vs 94% • In CIS, cytology detected only 67% abnormalities vs 100% detected by FISH • Unlike conventional urine cytology and cytoscopy, which depend on subjective visible microscopic or macroscopic changes, FISH allows identification of chromosomal abnormalities associated with malignant development before phenotypic expression of those alterations
Chromosomal Abnormalities and Prognosis • Patients with homozygous 9p21 deletion are more likely to have recurrence but not necessarily aggressiveness or progression • Patients with aneuploidy of any combination for chromosomes 3, 7, and 17 as well as 9p21, suggests the possibility of both tumor recurrence and progression
- Astrocytoma - Oligodendrogliomas - Oligoastrocytomas (mixed gliomas) • Oligodendroglial tumors, comprising oligodendroglioma and mixed ologocytomas, are estimated to account for 5-18% of all gliomas and are divided into low grade (grade II and high grade [grade III])
Genetics of Oligodendroglial Tumors • The genetic hallmark of oligodendroglial tumors is the combined LOH on chromosomal arms 1p and 19q • Approximately 80% of oligodendrogliomas and 50% of oligoastrocytomas have LOH of 1p and 19q • More specifically, chromosomal regions involved are 1p36.22-p36.31 and 19q13.3 • Loss of 1p and 19q is very rare in astrocytic tumors • The -1p/-19q genotype is associated with better response to therapy and longer survival, whether therapy was given to grade II or III tumors or whether primary or recurrent
Tissue Processing • In the routine clinical molecular cytogenetics laboratory, specimen for FISH examination is paraffin-embedded brain biopsy • Tissue cells are processed the same way as other paraffinembedded tissue except, pre-treatment kit III is recommended for better hybridization due to the density of tissue • Set of 4 probes are used: dual color 1p36 and internal controllq25 and dual color 19q with 19p being an internal control. Only cells that show both signals are being scored
Anticipatory Positive (AP) Results • AP results is the term used in a setting of a FISH-positive result in the absence of concurrent detectable malignancy. In prospective investigation of such patients recurrent UC developed in 62% of 55 patients with AP results, which were 12 cases of lowgrade UC and 22 cases of high-grade Uc. In contrast, recurrent UC developed in only 5% of 155 patients of the microscopically negative, FISH negative cases
Gliomas • Gliomas are most common primary brain tumors, representing 50-70% of all adult brain tumors and constitute a heterogenous group of neoplasms with respect to morphologic appearance, biologic behavior, genetic alterations, response to therapy, and clinical outcome
360
Neuroblastoma • Neuroblastoma is the most common extracranial solid tumor in infants and children. It is derived from primordial neural crest that ultimately populate s the sympathetic ganglia and adrenal medulla • The prevalence is about one case in 7000 live birth, which corresponds to approximately 700 new cases per year in the United States • Overall mortality approaches 30-60%, even with the most aggressive treatments. Although prognosis is highly variable depending on the age at diagnosis, stage of the disease , and a variety of genetic variables that might predict the clinical behavior • The current Children's Oncology Group risk stratification criteria are based on stage, age at diagnosis, MYCN gene amplification status, DNA index, and histology
12-59
FISH and Conventional Cytogenetics
Table 18. Chromosomal Translocations and Gene Rearrangements in Soft Tissue Sarcoma and Available Probes for their Detection Tumor type
Chromosomal abnormality
Genes invo l ved
Available probes
t(11;22)(q24;q12)
EWSR1-FLll
EWSRI BA
t(21;22)(q22;q12)
EWSR1-FRG
EWSRI BA
t(7;22)(q33;q12)
EWSR1-ETVl
EWSRI BA
t(2;22)«q 13;q12)
EWSR1-FEV
EWSRI BA
t(17;22)(qI2;qI2)
EWSR1-E1AE
EWSRI BA
inv(22)
EWSR1-ZSG
EWSRI BA
Desmoplastic small round cell tumor
t(11;22)(p13;q12)
EWSRI-WTl
EWSRI BA
Extraskeletal myxoid chondrosarcoma
t(9;22)(q22;q12)
EWSR1-CHN
EWSRI BA
t(9;17)(q22;q11)
RBP56-CHN
t(9;15)(q22;q21)
CHN-TCFl2
Clear cell sarcoma
t(12;22)(q13;q12)
EWSRl-ATFl
Alveolar rhabdomyosarcoma
t(2;l3)(q35;q14)
PAX3-FKHR
t(1;13)(p36;q14)
PAX7-FKHR
t(12;16)(q13;p13)
CHOP-FUS
FUS BA
t(12;22)(q13;q12)
EWSR1-CHOP
EWSRI BA
t(X;18)(p11.2;q11.2)
SSXl-SYT
SYTBA
SSX2-SYT
SYTBA
Ewing SarcomaIPNET
Myxoid liposarcoma
Synovial sarcoma
EWSRI BA
Alveaolarsoft part sarcoma
t(X;17)(p11.2;q25)
ASPL-TFE3
Dermatofibrosarcoma protubrans (and giant cell fibroblasoma)
t(17;22)(q22;q 13)
COLlAI -PDGFB
Low grade fibromixoid sarcoma
t(17;16)(q32-34;pll)
FUS-CREB3L2
FUSBA
Angiomatoid fibrous histiocytoma
t(12;16)(q13;pll)
FUS-ATFl
FUSBA
t(12;22)(q13;q12)
EWSR1-ATFl
EWSRI BA
Congenital fibrosarcoma and mesoblastic nephroma
t(12;15)(p13;q25)
ETV6(TEL)-NTRK3
ETV6(TEL) BA
Endometrial stromal sarcoma
t(7;17)(p15;q21)
JAZF1-BAZl
Inflamatory myofibroblastic tumor
t(2p23)
ALK, multiple fusion partners
ALK
*Modified from Reference Lazar et al. 2006 PNET ind icates primitive neuroectodermal tumor BA indicates "breakapart" probe strategy
• The best characterized genetic aberrations in neuroblastoma are: - MYCN amplification - Loss of hetrozygosity at Ip36 and - Gain of 17q region
Amplification of MYCN Gene • The amplification of the MYCN gene is the most unfavorable prognostic factor in neuroblastoma. Approximately 20-30% of all patients presenting with at advanced stages show an amplification of the MYCN gene
361
Molecular Genetic Pathology
12-60
• Children less than 12 months at diagnosis with stage 4 or MYCN-amplified stage 3 tumors have approximately 60% mortality rate • The genes dosage is usually examined by Southern blot method, FISH, or semiquantitative PCR. Detection of MYCN by FISH is performed on tumor cells and the results are available within 2 days • The amplification of the MYCN is strongly correlated with all prognostic factors and rapid tumor progression. In contrast, the expression level of MYCN is not significantly correlated with any prognostic factor • Tumors with non-amplified MYCN gene have variable clinical behaviors that generally correlates with the patient's age at diagnosis • Children 12-18 months old with metastatic neuroblastoma have favorable outcome with high-dose therapy if their tumors were hyperdiploid and lacked MYCN amplification
• MYCN amplification is a statistically significant marker of higher risk disease within both the diploid and hyperdiploid subgroups of children
rosette structures. Ewing sarcoma does not have these structures
t(l1;22)(q24;q12) • Approximately 90% of Ewing family tumors exhibit a specific translocation t(11 ;22)(q24;q 12), which results in the expression of EWSR I-FLII chimeric protein • In a small fraction of tumors, EWSRI gene on chromosome 22 has alternative gene partners on chromosomes 2, 7, and 17 • The EWSRI gene on 22ql2 plays a recurrent major role in several other tumors such as desmoplastic small round cell tumor, clear cell tumor, and rarely in myxoid liposarcoma • The EWSRI gene spans 40 kb and has 17 exons and nearly 80% of breakpoints are found within introns 7 and 8 • Detection of the EWSRI gene rearrangements, irrespective of the fusion partner, is easily identified with interphase FISH technology in fresh specimens, frozen sections, or paraffin-embedded tissue blocks
Synovial Sarcoma
Gain of 17q • A gain of I7q region, specifically 17q21-terminal part of chromosome 17, has been shown to be correlated with the aggressiveness of neuroblastoma using either CGH or FISH • Gene dosage of Survivin gene on 17q was reported to be significantly associated with all prognostic factors
Sarcoma • Many soft tissue sarcomas have a high incidence of specific translocations as shown in Table 18.
• Synovial sarcoma is most prevalent in adolescents and young adults • In general, synovial sarcomas are highly aggressive tumors that metastasize primarily to the lungs
t(x;18)(pl1.2;qll.2) • The genetic feature of synovial sarcoma is the presence of t(X ;18)((p II ;q II). It may be detected by conventional cytogenetics of tumor tissue after a short-term culture
• The tumor is composed of undifferentiated primitive mesenchimal cells
• On the molecular level t(X ;18) result in the formation of a distinct chimeric gene SYT-SSX. The Xp II region contains closely related SSXI-SSX5 genes . The breakpoint on the X chromosome typically involves two of these genes, most frequently SSXI and SSX2 that map to Xp 11.23 and Xp 11.21, respectively. SSX1 is involved in the SYT-SSX fusion almost twice as often as the SSX2 gene
• Those Ewing sarcoma family of tumors that exhibit features of primitive neuroectodermal differentiation are classified as PNET. They have clearly recognizable
• FISH technology is used as the first line diagnostic modality for detection of SYT gene rearrangements on 18q II in synovial sarcoma
Ewing SarcomalPNET • Ewing sarcoma is a small cell cancer that occurs predominantly in the long bones of children and young adults
CONCLUSIONS AND FUTURE DIRECTIONS The analysis of cytogenetic abnormalities and FISH technology is more than a prognostic tool. Over the past 10 years it has become clear that such studies provide a better understanding of the molecular biology of leukemia and some solid tumors . Although the exponential increase of complex,
362
often unrelated proteins, implicated in leukemias, lymphomas, and some solid tumors may, at first sight, appear to have little in common, the emerging scenario is that multiple genes have a common pathway. They include oncogenes, putative tumor suppressor genes, genes that act as
FISH and Conventional Cytogenetics
12-61
transcnpnon regulating factors, and genes involved in the regulation of the cell cycle, apoptosis, and differentiation. The answer to the question of how the initial genetic damage in a hematopoietic stem cell or other stem cells causes a cascade
of other genetic events leading to development of malignancy is still unresolved. Such understanding is crucial for the design of therapeutic agents specifically targeted to arrest this process.
NOMENCLATURE p = Short arms
inv = inversion
q = Long arms
i = isochromosome
+ = When placed before the chromosome, denotes a gain of a
mar = marker chromosome
whole chromosome (e.g., +8)
con
= connected
- = When placed before the chromosome, indicates a loss of a whole chromosome (e.g., -7); in rare situations, when placed after the chromosome, as in 5q-, it indicates loss of a part of the long arms of chromosome 5
nuc ish = denotes nuclear in situ hybridization
t = translocation
nuc ish 9q34(ABLx2),22qll .2(BCRx2)(ABL con BCRxl) indicates that there are two ABL and two BCR loci, but one of each loci is juxaposed on one chromosome as a result of t(9;22) .
del = deletion der = derivative
nuc ish 21q22 (D21S65X2) indicates two copies of D21S65 DNA segment on chromosome 21
SUGGESTED READINGS Karger S. An International System for Human Cytogenetic Nomenclature . In: Shaffer LG, Tommerup N, eds, Basel in Collaboration with
Cytogeneticsand Genome Research 2005. Ayton PM, Cleary ML. MLL in normal and malignant hematopoiesis . In: Ravid K, Licht lD . Transcription Factors. Willey-Liss, Inc 2001;25:447--463. Boveri T. Uber mehrpolige mitozen als mittel zur analyse dez zellkerus.
Verhand Physik-Med Ges Wurzurg. 1902;35:67-90. Carlson RW, Moench NJ, Hammond ME, et aI. HER2 testing in breast cancer : NCCN Task Force report and recommendations. J Nat Compr Cancer Netw. 2006;Supp13:SI-22; quiz S23-24. Cauwelier B, Dastieve N, Cools J, et aI. Molecular cytogenetic study of 126 unselected T-ALL cases reveals high incidence of TCRB rearrangements and putative new Tcell oncogenes . Leukemia 2006;20:1238-1244. Dewald GW, Thiemeau T, Lee YK, et aI. Relationship of patient survival and chromosome anomalies detected in metaphase and/or interphase cells at diagnosis of myeloma. Blood 2005; I06:3553-3558. Dohner H, Stilgenbauer S, Benner A, et aI. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med. 2000;343 :1910-1916. Druker BJ, Tamura S, Buchdunger E, et aI. Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl-positive cells. Nat Med. 1996;2:561-566. George RE, London WB, Cohn SL, et aI. Hyperdiploidy plus nonamplified MYCN confers a favorable prognosis in children 12 to 18 months old with disseminated neuroblastoma : A Pediatric Oncology Group Study. J Clin Oncol. 2005;23:6466-6473.
Greaves M. Molecular genetics, natural history and the demise of childhood leukemia. EuropeanJ Cancer 1999;35:473--485. Greenberg P, Cox C, Le Beau MM, et aI. International Scoring system for evaluating prognosis in myelodysplastic syndromes. Blood 1997;89:2079-2088. Grimwade D, Walker H, Olivier F, et aI. The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. Blood 1998;92:2322-2333. Hiddemann W, Spiekermann K, Biske C, et al. Towards a pathogenesis oriented therapy of acute myeloid leukemia. Crit Rev Oncol Hematol. 2005;56(2) :235-245. Lazar A, Abruzzo LV, Pollock RE, Lee S, Czerniak B. Molecular diagnosis of sarcomas. Chromosomal translocations in sarcomas . Arch Pathol Lab Med. 2006; 130:1199-1207. Melnick A, Licht JD. The role of RARa and its fusion partners in acute promyelocytic leukemia. In: Ravid K, Licht 1, eds. Transcription Factors. Willey-Lyss 2001;20:327-378. Mittelman F, Johansson B, Mertens F. Mitelan Database of Chromosomes Aberrations in Cancer. http://cgap.nci.nih.gov/ ChromosomeslMitelman. Mrozek K, Hereema NA, Bloomfield CD. Cytogenetics in acute leukemia.
Blood Rev. 2004;18(2):115-136. Najfeld V, Montella L, Scalise A, Fruchtman S. Exploring polycythemia vera with FISH: additional cryptic 9p is the most frequent abnormality detected . Br J Haematol. 2002;119:558-566.
363
12-62
Nowell PC, Hungerford DA. A minute chromosome in human chronic granulocytic leukemia. Science 1960;132:1497. Perez EA, Suman VJ, Davidson NE, et al. HER2 testing by local, central, and reference laboratories in specimens from the North Central Cancer Treatment Group N9831 intergroup adjuvant trial. J Clin Oncol. 2006;24:3032-3038. Raskind WH, Steinmann L, Najfeld V. Clonal development of myeloproliferative disorders: clues to hematopoietic differentiation and multistep pathogenesis of cancer. Leukemia 1998;12:I08-116.
Molecular Genetic Pathology
Sarsody MF, Kahn PR, Ziffer MD, et al. Use of a multitarget fluoresence in situ hybridization assay to diagnose bladder cancer in patients with hematuria . J Urol. 2006;176:44-47. Schwaenen C, et al. Automated array-based genomic profiling in chronic lymphocytic leukemia : development of a clinical tool and discovery of recurrent genomic alterations . PNAS2004;101 :1039-1044. Tkachuk DC, Westbrook CA, Andreeff M, et al. Detection of bcr-abl fusion in chronic myelogenous leukemia by in situ hybridization . Science 1990;250:559-562.
Reifenberger G, Louis DN. Oligodendroglioma: toward molecular definitions in diagnostic neuro-oncology . J Neuropathol Exp Neural. 2003;62(2) :111-126.
Varella-Garcia M. Cytogenetics in solid tumors. Laboratorial tool for diagnosis , prognosis and therapy. The Oncologist 2003;8:45-58.
Rowley JD. A new consistent chromosomal abnormality in chronic myelogenous leukemia identified by quinicrine fluorescence and Giemsa staining . Nature 1973;243:290-293.
Willis TG, Dyer MJS. The role of immunoglobulin translocations in the pathogenesis of B-cell malignancies. Blood 2000;96:808-822.
364
13 Instrumentation Bruce E. Petersen,
Josephine Wu, DDS, CLSp(MB), CLDir, Liang Cheng, and David Y. Zhang, MD, PhD, MPH
MD,
MD,
CONTENTS I. Nucleic Acid Extraction and Purification COBAS®Ampliprep MagNA Pure'" LC Instrument (Roche Diagno stics) MagNA Pure Compact Instrument (Roche Diagnostics) AUTOPURE LS (Qiagen/Gentra Systems; Netherlands) BioRobot M96 (Qiagen)
II. Spectrophotometers NanoDrop® ND-IOOO
13-2 13-2 13-2 13-3 13-3 13-5
13-5 13-5
peR
13-6
GeneAmp" PCR System 9600 GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA) COBAS AMPLICOR® Analyzer (Roche Diagno stics)
.13-6
COBAS TaqMan 48 Analyzer (Roche Diagnostics) LightCycler
V. DNA Microarray Platforms Genet.hip" System 3000Dx Nanot.hip'" 400
VI. xMAP@ Technology
13-15 13-15
13-17 13-17 13-19
13-21
Luminex '" 100 IS System and Luminex 200 System (Luminex Corporation) ........13-21
VII. Capillary Electrophoresis Applied Biosystems 3730 and 3730 XL
III. Thermocyclers for Conventional
IV. Real-Time PCR Instruments
LightCycler 2.0 (Roche Applied Science) Genexpert'" Dx System
VIII. Gel Imaging Systems
13-23 13-23
13-24
Bio-Rad Gel DOC™ EQ, ChemiDoc™ EQ, and Chemifroc" XRS 13-24
13-7
IX. Luminometers 13-7
13-9 13-9 13-11
Digene Microplate Luminometer (DML2000)
X. Fluorescence Microscope XI. Suggested Reading
13-26 13-26
13-27 13-28
365
13-2
Molecular Genetic Pathology
The following is a brief overview of representative instruments and categories of instruments central to the practice of molecular diagnostics and related fields. Some of these instruments have been introduced in other
chapters. While a comprehensive survey of all such equipment is beyond the scope of this book, more extensive information is readily available from manufacturers' websites and brochures.
NUCLEIC ACID EXTRACTION AND PURIFICATION COBAS® Ampliprep • General information: - The COBAS ampliprep (Roche Diagnostics, Basel, Switzerland) instrument (Figure 1) uses solution-phase magnetic bead capture in the automated extraction of nucleic acids - It is appropriate for large-scale preparation of DNA and RNA samples • Principles of operation: - Processing of each sample takes place in a separate, selfcontained, single-use, disposable sample processing unit - Sample volume can range from 250-1000 ul, - All stages of nucleic acid separation are automated, including: decapping, pipeting, lysis, magnetic bead capture, washing/purification of captured nucleic acid, and resuspension/release of purified nucleic acid from beads • Procedure: - Startup procedures are performed - Reagents are loaded onto instrument - Samples are removed from storage - Consumables are loaded onto instrument - Orders are created - Samples are transferred to sample tubes (input S-tubes), which are held in a sample rack - Sample racks are loaded onto instrument Run is initiated - After completion of run, processed samples and used consumables are removed • Applications: - High-throughput extraction and purification of nucleic acids • Advantages: High throughput • Capable of continuous operation • 72 sample capacity • First 24 samples are processed in 2 hours • Each subsequent set of 24 samples can be processed in 1 hour • Can process up to 144 samples per 8 hour shift • Samples can be run overnight (20 hour on-board stability)
366
Fig. I. The COBAS Ampliprep instrument (Roche Diagnostics, used with permission). - Can automatically add polymerase chain reaction (PCR) master mix and internal control/quantitation standard (IC/QS) - Manual steps are minimized (loading and unloading only) - Machine has automated decapper, thus capped specimens may be loaded, decreasing risk of contamination - Reagents are loaded as a unit (no mixing of lots, increased reproducibility) - Continuous access for loading additional samples, reagents, and disposables - On board bar code scanner reads reagent and sample barcodes, eliminating transcription errors - Pipeting error is minimized by pipeting integrity check and clot detection - Instrument can directly load K-tubes for analysis on COBAS TaqMan® analyzers - Instrument inventories reagents and disposables prior to run • Limitations: - Only for use with plasma or serum samples - Limited to total nucleic acid extraction
MagNA Pure® LC Instrument (Roche Diagnostics) • General information: The MagNA Pure LC instrument (Figure 2) is an automated system for purification of nucleic acids following prior cell lysis.
Molecular Genetic Pathology
13-4
Fig. 3. The MagNA Pure Compact Instrument (Roche Diagnostics, used with permis sion).
(. , lI l r.'
......--... -
.
Fig. 4. The AUTOPURE LS instrument (Qiagen; Gentra System s, used with permission). • Principles of operation: - Performs cell lysis and all steps of DNA purification. (see Chapter 3 for discussion of PUREGENE chemi stry) Automated steps for blood , buffy coat, and packed cell protocol s are as follows: • Instrument reads bar codes and weighs samples (to ensure sufficient quantity) • RBCs are lysed • RBC lysate is removed • White blood cells are lysed; protein s and impurities are precipitated • Precipitate is centrifuged down ; supernatant is transferred to output tubes • DNA is precipitated using 100% isopropanol • DNA is centrifuged down; supernatant is removed • Pellet is washed with 70% ethanol • DNA hydration solution is dispensed
368
- 96 samples of whole blood , or 80 samples of 150 million cultured cells, can be processed in 8 hours - The system includes a PC workstation and software • Monitors validation steps • Perform s sample tracking • Produce s rack reports (includes sample ID, protocol description, processing run information, logged errors, and so on) • Information from rack reports can be printed , stored on CDs, and/or directly transferred to a laboratory information system - Custom protocol s can be designed for processing difficult or unusual specimen types • Procedure (for blood, buffy coat, and packed cell protocols): - Log in, select protocol and number of samples - Scan sample barcode s; transfer samples to input tubes; cap tubes - Scan barcode s on input tube caps; load input tubes into rack - Scan barcodes on output tubes; load output tubes into rack - Load rack into instrument - Initiate run After completion of processing, unload rack Rehydrate DNA by incubating at 65°C for 1-2 hours, then gently rocking at room temperature overnight • Applications: - highly purified DNA suitable for PCR, Southern blotting , archiving - Sample types : • Buccal swabs and mouthwash • Tissue homogenates • Amniotic fluid • Blood, buffy coat, and packed cells • Blood spots • Bone marrow • Cultured cells • Advantages: - Accommodate s a wide range of sample types (see above under applications) - Sample size can vary from 1-10 mL (whole blood) - High throughput High yields (typically >80%) - Extraction product is of high purity (A260/A280 ratios consistentl y 1.7-2.0) and has excellent stability (can be stored for 12+ years without degradation ) - Purified DNA is of high-molecular weight (100-200 kb) - Complete sample tracking with barcodes minimizes clerical errors and provides complete chain of custody for sample tube, input tube, output tube, and storage tube • Limitations: Restricted to total DNA extraction - Will only output to QUBESTM (50-mL polypropylene tubes), not to other containers
13-5
Instrumentation
BioRobot M96 (Qiagen) • General : - The BioRobot M96 workstation provides walk-away automation of sample preparation for applications in clinical laboratories. - The instrument performs nucleic acid isolation from blood and cell-free body fluids for 96 samples, in parallel. • Principles of Operation: Purification is performed by magnetic separation - Pipet tips function as separation chambers Up to 96 samples can be processed per run, eight samples at a time - The workstation has high-precision positioning for accurate liquid handling through eight channels and uses disposable filter-tips to eliminate carryover - Automated vacuum processing eliminates centrifugation steps, allowing walk-away automation and fast sample processing - A sample tracking system identifies and tracks bar-code-Iabeled labware for fully traceable results
- The BioRobot M96 is supplied with ready-to-run QIAamp (Qiagen) protocols as well as capability for user designed isolation of genomic DNA from blood and viral DNA and RNA from plasma and serum - Optional formats are available for laboratories with small specimen volumes: BioRobot M48, for up to 48 samples and BioRobot EZl , for up to 6 samples - The yield is about 30-60 ug DNA from I mL of blood - Built-in UV light can be used for decontamination between runs The pipetor head contains 8 high-precision syringe pumps, which operate simultaneously to allow aspiration or dispensing of small volumes of liquid (25-1000 ~L) through the disposable filter-tips. The pipetor head is also equipped with a tip guard to ensure cross-contaminationfree pipeting. The BioRobot M96 workstation is supplied with ready-torun MagAttract'" protocols that are easy to use and require minimal operator interaction, improving safety by reducing contact with potentially infectious samples.
SPECTROPHOTOMETERS NanoDrop® ND-lOOO • General information: - The NanoDrop ND-lOOO Spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE) (Figure 5) is one of many spectrophotometer instruments available from a range of manufacturers. Spectrophotometers are used in the quantification of nucleic acid, protein, and cell suspension concentrations, as well as determination of DNA and protein purity. Models differ in terms of sample volume required, recoverability of the sample, and range of linearity . Nonetheless, these instruments all operate on the basis of common principles of spectrophotometry (see Chapter 3).
where A = absorbance; E = extinction coefficient (Iiter/mol-cm); b = path length, c = molarity • Nucleic acid concentration is calculated using a modified form of the Beer-Lambert equation: c = Aelb, where e =extinction coefficient (ng-cm/ul.) • Procedure: - Blanking cycle is performed, prior to running test samples, using the same solvent or buffer solution that is present in the test samples - 1-2 ~L of sample is pipeted onto a measurement pedestal, which houses a fiber optic cable
• Principles of operation: - Light source: xenon flash lamp - Detector: 2048-element linear silicon charge-coupled device (CCD) array - Wavelength range : 220-750 nm - Absorbance of each sample is measured at two different path lengths (0.2 mm, 1.0 mm) allowing for a very wide range of detection (2-3700 ng/~L dsDNA) without dilution (Figure 6) - Absorbance calculation: Absorbance = -log (Intens ity [sample]/lntensity [blank]) - Concentration calculation: • Fluorescent dye concentration is calculated using the general form of the Beer-Lambert equation: A =Ebc,
Fig. 5. The NanoDrop ND-lOOO instrument (Nanodrop Technologies Inc., used with permission).
369
13-6
Molecular Genetic Pathology
- After measurement is completed, the sample arm is raised and surfaces that were in contact with the sample are wiped clean . The sample may be recovered with a pipet • Applications: - Measurement of nucleic acid concentration and purity - Measurement of fluorescent dye labeling density of nucleic acid microarray samples - Analysis of the purity of protein, up to 100 mg/mL (BSA) - Expanded spectrum measurement and quantitation of fluorescent dye-labeled proteins , conjugates, and metalloproteins - Bradford assay analysis of protein - Bicinchoninic acid CBCA) assay analysis of protein - Lowry assay analysis of protein - Cell density measurements - General UV and visible light-range spectrophotometry • Advantages: - Requires very small sample volume (1-2 ilL) Fig. 6. A minute (1-2 ul.) droplet of sample material is held by surface tension between a pedestal and a movable arm. Light is projected through the droplet and absorbance is measured at two different path lengths (1.0 mm and 0.2 mm) (Nanodrop Technologies Inc., used with permission).
- The sample arm is manually lowered over the sample - Measurement is initiated by command from an attached PC
- Very wide dynamic range (see principles of operation above) • Limitations - Micro-volume samples are subject to rapid evaporation; replicate measurements require reloading of fresh sample - There is risk of sample carryover if the instrument is not adequately cleaned between samples DNA samples must be homogeneous; due to microvolume sampling , heterogeneity will substantially affect reproducibility
THERMOCYCLERS FOR CONVENTIONAL PCR PCR is a process, which employs a heat stable DNA polymerase (Taq DNA polymerase) in the exponential amplification of a target DNA sequence. Three temperature dependent steps (denaturation, annealing of sequence specific primers, and elongation) are repeated in a series of cycles. Theoretically, the copy number of the target sequence doubles with each cycle . The process is described in detail in chapter 3. A thermocycler instrument produces the nece ssary temperature changes between denaturation, annealing, and elongation phase s in a series of pre-programmed steps. Reaction tubes, containing target nucleic acid and all PCR reagents, are fitted within a temperature-controlled block. In order to verify reliable operation, the temperature of each well within the block should be tested at least twice per year, using an external probe that has been calibrated again st a temperature standard.
370
The original PCR instrument was developed by Cetus Instrument Systems in 1985. Since then, various modifications have been made to increase amplification efficiency, specificity, and sensitivity. Currently many manufactures produce PCR machines, all of which are based upon the same fundamental principles. Representative instruments are described as follows .
Geneamp" peR System 9600 • General information : - The GeneAmp PCR System 9600 (Applied Biosystems; Foster City, CA), although no longer in production , remains one of the most widely used thermocycler instruments for conventional PCR applications.
Instrumentation
• Principles of operation: - The instrument contains a programmable heating and cooling block designed to heat and cool up to 96 PCR samples in a rapid and uniform manner Temperature range of block: 4.Q-99.9°C • Displayed sample temperature matches average true temperature +/-0.75 °C A heated cover is positioned over the sample block • Ensures tubes fit tightly into wells • Prevents condensation on top surface of tubes Coolant flows through 17 holes within the block • Eight are used for rapid cooling of the block (ramp cooling) • Nine are used for cold biasing the system Rapid heating is provided by a kapton heater beneath the block • Power density at the edges is greater than at the center in order to compensate for heat loss at the periphery - A key pad is used for creating, storing, editing, and running PCR programs - Indicator lights show when block is heating, hot, or cooling - The instrument can be configured for use with an optional printer • Procedure: - 0.2-mL MicroAmp reaction tubes are placed in a 96position sample tray (MicroAmp Tray) - Each tube is filled with PCR reaction mixture and all tubes are then capped - The sample tray is placed in the temperaturecontrolled block - The heated cover is secured in position - PCR program is run - After completion of PCR, sample tubes containing amplified product are removed
13-7
• Limitations: - Product detection requires post-PCR processing , which is often lengthy and increases the potential for contamination - Since PCR reactions are generally carried through to the plateau stage of amplification, accuracy of original product quantification is limited
GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA) This instrument (Figure 7) offers many of the features of the GeneAmp PCR System 9600, but has the added advantages of a smaller footprint and interchangeable blocks. Networking software is available for single-source control of multiple instruments.
COBAS AMPLICOR@ Analyzer (Roche Diagnostics) • General information: - The COBAS AMPLICOR Analyzer (Figure 8) is an automated batch analyzer system combining conventional PCR with post-PCR product detection on a single instrument. - It is used widely for molecular testing in microbiology. • Principles of operation : - The instrument incorporates five components • Thermocyclers (two thermocycler units: TCA and TCB) • Automatic pipetor • Incubator • Washer
• Applications: - DNA amplification for sequencing, genotyping (allele specific PCR, restriction fragment-length polymorphism analysis, microsateIlite studies), identification of viral and bacterial pathogens, downstream cloning applications Reverse transcription PCR (RT-PCR) for expression analysis - Multiplex PCR reactions (use of multiple primer sets to simultaneously amplify multiple targets) • Advantages: - Reproducibility of cycle times - Uniformity of PCR yields - Thin-walled reaction tubes allow efficient heat transfer - Rapid heating and cooling - Oil-free operation - Low cost
Fig. 7. The GeneAmp PCR System 9700 (Applied Biosystems, used with permission).
371
Molecular Genetic Pathology
13-8
Fig. 8. The COBAS AMPLICOR Analyzer (Roche Diagnostics, used with perm ission).
• Photometer • Reads signal s at a single wavelength: 660 nm • Light source: pulsed-l ight-emitting diode (LED) • Detector: photodiode - PCR is performed using biotin-labeled primers - Amplification is followed by alkaline denaturation of the amplicon, followed by hybridization with oligonucleotide capture probes bound to magnetic microparticles, and then multiple washing steps. During washing, the microparticles are held in place by a magnet - Colorimetric detection • Bound amplicons react with avidin -conjugated horseradish peroxidase, taking advantage of the extremely high affinity between avidin and biotin molecules • Additional washing is performed • Reaction with tetramethylbenzidine sub strate produces color • Photometer performs absorbance readings at 660 nm - 48 sample capacity per run - Multiplexing capability: up to 6 different detections per sample - Incorporation of dUTP and Amplirasev (uracil-Nglycosylase) in reaction mixture prevents contamination by produ cts of previou s PCR reaction s - Results calculation • Qualitative: test result is reported as absorbance value corrected for reagent blank (Test result [A660] = A660 sample - A660 reagent blank)
372
• Test result is compared with a pre-programmed test-specific absorbance range • Result may be positive, negative, or equi vocal (gray zone ) • Quantitative: titer can be calculated on the basis of a quantitation standard • Procedure: - Nucleic acid extraction and purification steps must be performed separately, prior to loading - Samples are transferred to amplification tubes (A-tubes), along with master mix - PeR ready samples and reagents are loaded on the system - Work list data and commands are entered by operator - First test results are available 3 hours after beginning operation - Subsequent results are obtained at a rate of 50 detections per hour • Applications: - Available tests: • Human immunodeficiency virus-I • Hepatitis C virus (HCY) detection and quantitation • Hepatiti s B virus (HBY) • Cytomegalovirus (CMY) • Chlamydia trachomatis • • • •
Neis seria gonorrhoeae Mycobacterium tuberculo sis Mycobacterium avium Mycobacterium intracellulare
I nstru mentation
13-9
• Advantages : - Fully automated system - High throughput (up to 144 tests per day) - Specimens do not have to be handled manually for post-PCR processing
• Increases efficiency of procedure • Less opportunity for sample contamination • Limitations: Endpoint detection ; limited accuracy of quantitative results
REAL-TIME peR INSTRUMENTS In real-time PCR, product detection and quantitation is based on measurements made during the amplification process. This differs from conventional PCR, in which products are detected in separate steps following the completion of amplification. The general features of realtime PCR , as well as its applications and advantages, are discussed above (see Chapter 3). Real-time PCR methodologies rely on the use of fluorescent reporter molecules to produce detectable signals, the intensity of which is quantitatively related to amplicon production. Fluorescent molecules employed in real-time PCR are described above (Chapter 3) and include SYBR green, hybridization probes, and hydrolysis probes (e.g., TaqMan probes). Real-time PCR instruments generally have specific calibration protocols specified by the manufacturers.
CODAS TaqMan 48 Analyzer (Roche Diagnostics) • General information: - The COBAS TaqMan 48 Analyzer is a homogeneous real-time PCR-based system for the amplification, detection, and quantitation of DNA or RNA from clinical specimens (Figure 9) Detection is based on hydrolysis probes, which exploit the inherent 5' exonuclease activity of Taq polymerase. The mechanism of TaqMan probes is briefly summarized as follows (see Chapter 3 for detailed description) • A target-specific oligonucleotide probe conjugated with a fluorescent reporter dye and closely adjoining quencher dye (dual fluorescence-labeled probe) hybridizes with a target DNA sequence or internal standard sequence between the forward and reverse primers during the annealing phase of PCR. The probe is blocked at the 3' end to prevent extension • As a consequence of fluorescent resonance energy transfer (FRET) between the reporter and quencher dyes, the intact probe produces little fluorescent signal. However, during PCR amplification, the probe undergoes hydrolysis due to Taq polymerase 5' exonuclease activity; this causes
separation of the reporter dye from the quencher dye, and a corresponding increase in fluorescence • Fluorescence intensity progressively increases with subsequent cycles of amplification. With successive measurements of fluorescence intensity during each annealing phase, an amplification curve is produced • The original product concentration can be determined on the basis of comparing cycle threshold of the target sequence with that of an internal standard - Inclusion of Uracil-N-glycosylase (AmpErase) and dUTP as components of the PCR master mix prevents carry-over contamination from previous reactions. - TaqMan methodology may be used in the quantification of RNA; however, since RNA is not an efficient substrate for Taq DNA polymerase, amplification must be preceded by a reverse transcription step in order to generate a cDNA sequence from the target RNA strand • Principles of operation : - Thermocyclers: the COBAS TaqMan 48 Analyzer utilizes two independently controlled thermocyclers (TCA and TCB), each of which can process 24 samples
Fig. 9. The TaqMan instrument, with computer work station (Roche Diagnostics , used with permission).
373
13-10
Molecular Genetic Pathology
Excitation filter wheel with four filters
TCA
<J)
Halogen lamp
(T
<J)
~ ([>T
<J)
~
([>r=
titer maximum • Invalid result
• Amplification and detection of multiple target sequences in the same K-tube can be performed • Detection is achieved using multiple probes, one specific to each target sequence, each labeled with different dyes • Dyes must be chosen carefully to minimize spectral overlap • Fluorescence signals can be separated using different filter combinations • Multiplex capacity allows for measurement of signal from internal standard - Results calculation • Pre-check • • • • •
Raw data acquired Baseline slope corrected Spikes removed Step correction Assigned Fluorescence Level determined
• Assigned fluorescence level =critical threshold line: level of detection at which a reaction reaches statistically significant increase in fluorescence over background • Threshold cycle (Ct value, crossing point, or "elbow"): fractional cycle number at which fluorescence reaches assigned fluorescence level • Ct value indicates beginning of exponential growth phase • Ct value is used for titer calculation • Assuming 100% amplification efficiency, a ten fold change in concentration changes Ct value by 3.3 cycles • Internal QS: • A synthetic construct of DNA or RNA designed to closely resemble the length and sequence content of the actual target, and therefore amplify with the same efficiency as the target • Has sufficient sequence differences from the target such that it hybridizes to a separate probe with a distinctive fluorescence signal • Incorporated into each sample in a precisely known amount, in quantitative assays • Carried through the sample preparation, and amplification/detection steps along with the target nucleic acid sequence • The difference between Ct values of QS and target is used in determination of target quantity • Can also correct for instrument, chemistry, and sample variances • Five possible results: • No target detected
• Procedure: - Computer, analyzer, and software are started - Sample and control orders are entered Sample and control orders are assigned to K-tube - K-tubes are loaded into K-carriers - Master mix and sample nucleic acid is manually pipeted into K-tubes - K-tubes are capped - K-carriers are loaded into one or both thermocyclers - Thermocycler lids are closed and run is initiated - Carriers are unloaded after completion of run - Results are reviewed • Applications: - Detection of viral, bacterial, and parasitic pathogens -
Determination of viral DNA copy number Monitoring drug therapy
- Quality control/assay validation - Quantitation of gene expression - Genotyping/detection of single nucleotide polymorphisms using allele-specific probes - Verification of microarray results • Advantages: - See chapter 3 for advantages of real-time PCR over conventional PCR • Limitations: - High cost of instrument and reagents in comparison with conventional PCR
LightCycier • General information: - The LightCycler (Roche Applied Science, Indianapolis, IN) (Figure 11) is a real-time PCR instrument with three fluorescence detection channels. - This system is compatible with SYBR Green I experiments, as well as single or dual color hybridization probe experiments. - The LightCycler instrument consists of a thermocycler component and a fluorimeter component. • Principles of operation (Figures 12 and 13): - Thermocycler • Samples and reagents are contained within glass capillaries, which are loaded into a carousel; the carousel fits into a thermal chamber • The carousel can accommodate up to 32 capillaries, thus the instrument can process a maximum of 32 samples per run
375
13-12
Molecular Genetic Pathology
• Signal is focused onto individual glass capillaries as they are sequentially positioned over the fluorimeter optics by rotation of the carousel • Fluorescence detection • Dichroic mirrors divert light emitted from sample into one of 3 detection channels • Each channel is equipped with an interference filter with specific bandpass Emission maxima of relevant dyes
Channels
Bandpass (nm)
Channell
530 +/-20 nm
SYBRGreenl (521 nm) Fluorescein (525 nm)
Channel 2
640+/-20 nm
LightCycler-Red 640 (640 nm)"
Channel 3
710 +/-20 nm
LightCycler-Red 705 (705 nm)"
aUghtCycler-Red 640 and UghtCycler-Red 705 are FRET partners of fluorescein
Fig. 11. The LightCycler instrument (Roche Applied Science, used with permission).
• Reaction temperature is regulated by circulation of heated or ambient air through the thermal chamber; air temperature is determined by the voltage across a heating coil • The temperature is graphically displayed with LightCycler software • An auto correction function compensates for differences in heat capacity between air and water • A small reaction volume (10-20 ilL) and very high surface area to volume ratio of capillaries ensures rapid thermal transfer, allowing for fast temperature transition times, with about 15-20 seconds required for each cycle. Use of air as the heat transfer medium also facilitates high-speed cycling - Fluorimeter • Excitation signal • Energy source: blue LED • Signal passes through interference filter • Median wavelength of excitation signal: 470 nm o Fluorescein absorbance peak (maximum excitation) =493 nm o SYBR Green I absorbance peak (maximum excitation) = 497 nm
376
• Signal is received by photohybrid-type detectors • 32 capillaries can be measured in approximately 5 seconds • Fluorescence acquisition modes • Single: fluorescence is measured once per sample at end of selected temperature segment o SYBR Green I format: measurement at end of elongation phase o Hybridization probes format: measurement at end of annealing phase • Continuous: fluorescence of all samples is measured continuously from first sample to last o Used for melting curve analysis • Step: fluorescence of all specimens is measured between stepwise changes in temperature o Used for melting curve analysis • Dual color detection • Simultaneous detection of two target sequences in one sample • Two different acceptor dyes (LC-Red 640 and LC-Red 705) • Fluorescein serves as the FRET donor dye for both LC-Red 640 and LC-Red 705 • Dual color detection is used in the analysis of internal controls, interpretation of duplex PCR runs, and extended mutation analysis • Crosstalk between channels occurs due to overlap between emission spectra of LC-Red 640 and LC-Red 705 o Crosstalk is corrected by color compensation function
I nstru mentation
13-13
Air heating and cooling for rapid temperature ramping
---, \ ~
,, .,,., , .,,, ., , .,, , . .,, . ,,
Heating coil - - - - - - - - -
-+----
Carousel with capacity for 32 samples Stepper motor to position fluorimeter
Fan ---;:=~~=---+--E==::::J
Fig . 12. Schematic diagram of thennocycler and fluorimeter components of the LightCycler instrument (Roche Diagnostics, used with permission).
,U ~--t-----
Carousel with capacity for 32 samples Stepper motor to position fluorimeter
Therman chamber Stepper motor to position samples over optics
Fan - - --*=d --'
Filters Photohybrids Maintenance-free LED light source
Microvolume fluorimeter with rodenstock quality optics
Fig. 13. Detailed diagram of the LightCycler fluorimeter (Roche Diagnostics, used with permission).
377
13-14
Molecular Genetic Pathology
• SYBR Green I • Fluore scence is measured at the end of each elongation phase • Melting curve analysi s increases sensitivity and specificity • Sequence-specific hybridization probes (introduced in chapter 3) • Very sensitive and specific • Can detect single copy sequences in complex DNA templates • Two separate dye-labeled probes are used • The upstream probe has a fluorescence energy donor dye bound to the 3' end (fluore scein) • The downstream probe has an acceptor dye bound to the 5' end (LC-RED 640 or LC-RED 705) • While in solution, the distance between the probe s disallows energy transfer between them • When both probe s hybridize with the target in head to tail fashion, the donor and acceptor dyes are brought into close proximity permitting energy transfer from donor to acceptor dye (FRET), with emission of a specific fluorescent signal from the acceptor dye
o
The second derivative maximum method is preferred for most runs The fit points method is preferred for runs with few standard s or irregular standards
• Melting curve analysis • Useful for: o Product identification (SYBR Green 1 experiments) o
Identification of unwanted byproducts (e.g., primer dimers)
o
Mutation detection in hybridization probe experiments (a single point mutation can drastically alter melting temperature)
o
Distinguishing between wild-type, homozygous mutant s and heterozygotes
• Two separate mutation sites can be analy zed in one reaction using a dual probe assay • A polynomial, rather than linear method is recommended for all melting curve analyses • Procedure: - Program experiment protocol - Prepare master mix
• Measured fluorescence signal is proportional to the amount of product present in the reaction
- Place capillaries into adaptors that have been precooled in cooling block
• Fluorescence signal is acquired with each annealing phase
- Pipet master mix into capillaries
• Probes are displaced by Taq polymera se during elongation • The 3' end of the acceptor probe is phosphorylated to prevent extension • Determination of copy number • A standard curve is used in the determination of original copy number o The standard curve can be generated on the basis of standards, of known concentration, included with each run o Alternately, one can import an external standard curve produced in a previous run o Standard curve data points derive from the crossing points of each standard, which are plotted against the original copy number. (The "crossing point" is the first cycle at which fluorescence measurement significantly exceeds background level; this occurs in early log phase amplification ) o
o
The crossing point of a sample is related to sample concentrat ion, as determined by the standard curve The higher the original copy number, the lower the crossing point value
• The standard curve is calculated by either fit points method or second derivative maximum method
378
o
- Add sample DNNRNA to capillaries - Seal capillaries with stoppers - Centrifuge adaptors with capillaries (700g) briefly - Load capillaries into carousel - Close lid - Begin the run • Procedure modifications: - Carry over prevention with uracil DNA glyco sylase (UNG)/AmpErase • UNG and dUTP can be incorporated into reaction mix to minimize carry over of contaminants from previous reactions - Hot start • Minimizes primer dimer formation • Kits are available containing heat-activable Fastxtart" Taq DNA polymerase
• Anti-Taq polymerase antibody can also be employed in the hot-start technique - RT-PCR • With the appropriate kit, one-step RT-PCR can be performed using SYBR Green I or sequence-specific hybridization probes • Application s: - Kits for diagno stic use • Factor V Leiden (Roche Diagnostics)
13-15
Instrumentation
Fig. 14. The GeneXpert instrument (right) , shown with computer and bar code scanner (Cepheid, used with permis sion).
• Prothrombin mutation (Roche Diagnostics) -
Kits for research use: numerous kits and analyte specific reagents are available from Roche Diagnostics for research applications in microbiology, oncology, hematology, and pharmaco-genetics, including assays for detection of single nucleotide polymorphisms (SNPs)
• Advantages: - See chapter 3 for advantages of real-time PCR over conventional PCR - Short run time (20-30 minutes) - Melting curve analysis in hybridization probe assays is exquisitely sensitive for detection of single base pair mutations • Limitations: - High cost of instrument and reagents in comparison with conventional PCR - SYBR-Green I : when there is a low number (1-100) of target sequences, signal may be barely measurable above background
• Ability to accommodate either 20 J!L capillary tubes or 100 J!L capillary tubes • Improved fan design for efficient heating and cooling of larger (100 J!L) capillary tubes with minimal increase in run time • Upgraded software
Genexpert" Dx System • General information: - The GeneXpert Dx System (Cepheid, Sunnyvale, CA) (Figure 14) integrates automated sample preparation and real-time PCR on one platform. All extraction, purification, amplification, and detection processes are performed within a single disposable cartridge (Figure 15). - This high level of integration permits largely hands-off operation with extremely rapid turnaround times . The system include s the GeneXpert instrument, personal computer, and preloaded software. • Principles of operation:
LightCycler 2.0 (Roche Applied Science) • General information: - The LightCycler 2.0 instrument is an upgraded version of the original LightCycler instrument with several added features • Six (versus three) detection channels (530 nm, 560 nm, 610 nm, 640 nm, 670 nm, 705 nm)
- Instrument • The instrument contains multiple (up to 16) "amplification modules " • Each module is independently controlled • Each module contains a dedicated fluorimeter with 4 excitation channels and 4 detection channels o Multiplexing capability
379
13-16
Molecular Genetic Pathology
Processing , , .......... chambers contain reagents . filters, and capture technologi es necessary to extract. purify, and amplify target nucleic acids
Optical windows enable real time optical detection
,,
,,
Reaction tube thin chamber enables very rapid therma l cycling
Valve" enables fluid transfer from chamber to chamber; may conta in nucle ic acids lysis and filtration comp onents
Fig. 15. Components of disposable cartridge for use with the GeneXpert system (Cepheid, used with permission).
• Each module performs continuous optical monitoring o Reaction is automatically stopped when target is detected
o Shortens time to results - Cartridges • Are self-contained, single-use • Can handle a range of volumes • Cartridges contain PCR reagents • Primers, probes, dNTPs , polymerase, and buffer components • Additional reagents must be introduced prior to use; e.g., washing, elution, and lysis reagents • Components of each cartridge:
380
• Syringe drive • Rotary drive • Sonic hom o Produces ultrasonic energy, which lyses cells in raw specimen • Processing chambers o Contain reagents, filters, and capture mechanisms for washing, purifying, and concentrating nucleic acids • Reaction chamber (for amplification and detection) o Thin chamber facilitates efficient heat exchange for rapid thermocycling o Optical window s permit real-time 4-color detection
I nstru mentation
13-17
- Many analyte specific reagent products are also available
• Procedure: - Preparing the cartridge • Cartridge and reagents are removed from package • Reagents and sample are introduced into designated chambers of the cartridge Performing the run • Computer, then the instrument, is turned on • System software is started • Cartridge bar code is scanned and sample identification information is entered • Command to start test is entered • Cartridge is inserted into module • Cartridge is removed at completion of test • Results are reviewed and interpreted • Applications: - Food and Drug Administration (FDA)-cleared assays • Group B Streptococcus • Methicillin-resistant Staphylococcus aureus
• Advantages: - Rapid turnaround time (test results from raw sample may be available in 31
-
;?:32
SCA3/MJD
CAG
ATXN3
Coding region
:::;47
48-51
53-86
SCA6
CAG
CACNA1A
Coding region
:::;18
19
20-32
OM I, myotonic dystrophy type 1; Hl), Huntington disease; SCA, spinocerebellar ataxia; MJo, Machado-Joseph disease
- SCA1: ATXNl, 6p23
Diagnosis
- SCA2: ATXN2, 12q24.1
• Very difficult to distinguish from other hereditary ataxias; requires molecular genetic testing to detect an abnormal CAG trinucleotide repeat expansion in the coding region of the ataxin 2 (ATXN2) gene (Figure 4 and Table 4)
- SCA3/Machado-Joseph disease (MJD): ATXN3, 14q24.3-q32.2 - SCA6: CACNAIA, 19pI3.2-pI3.I - SCA7 : ATXN7, 3p2U-p12
ATXN2
- SCA8 : KLHLlAS, 13q21
• Normal alleles have up to 31 repeats • Affected individuals have at least one allele with 32 or more CAG repeats • Most common disease-causing alleles contain 37-39 repeats • The CAG repeat is normally interrupted by CAA trinucleotides, which may enhance the meiotic stability of the repeat; expanded alleles that lack the CAA interruption have increased risk of disease anticipation to subsequent generations • CAG trinucleotide expansion results in polyglutamine expansion in the ATXN2 protein; however, the normal function of the ATXN2 protein is unknown
- SCAIO: ATXNlO, 22q13.31 - SCAI2: PPP2R2B, 5q31-q33 - SCAI4: PRKCG, 19q13.4 - SCAI7: TBP,6q27 • Majority of CAG trinucleotide repeat ataxias exhibit disease anticipation • Molecular testing is clinically useful for diagnosis, prenatal diagnosis, and predictive testing
Prevalence • Estimated world wide prevalence is 11100,000 • Prevalence of individual subtypes varies by geographical area • SCA2, SCA3/MJD, and SCA6 are the most common forms of AD ataxia:
SCA2 Distinctive Clinical Attributes • Age of onset is typically in the fourth decade • Variable findings include nystagmus, slow saccadic eye movements, and occasionally ophthalmoparesis and dementia
Prevalence • Accounts for approximately 15% of all SCA
428
Molecular Genetic Testing • PCR amplification of the ATXN2 trinucleotide repeat region followed by gel electrophoresis • Alleles with> 100 repeats may not be detectable by PCR • Individuals with a single allele size as detected by PCR should also be analyzed by Southern blot • Combination of PCR and Southern blot detects nearly 100% of SCA2 cases
SCA3/M]D Distinctive Clinical Attributes • Age of onset varies but is typically in the second to fourth decade
Molecular Medical Genetics
A
16-13
M13 pUC18 sequencing ladder
CAG Repeats: 16/16 24/41 20/42 15/18 16/19 I'¢.: ~~.,
'176' "'7
B ~=Il-
.,
.._' '"--'
CAG Repeats:
. '":-,... ,
16/19
'~~~. --------_r....
16/19
,00
21/39 o
"
.... ft o_·,_IV~~
.~o ~ 16/28 .....v,...>r-,---- ----z·oV.~-
~~,T--------~~Q;~----__zl,~
,..,
......
21/39
o~g~a----~"-":Ao-~--- -z,~ , ...., 26/40 o- - 1tIr--- -JJ.Ir,----~~~---__z,Gtr_, ..... 26/40
"'"
"'" o---4,b--- - - - - - - - -- - - - - - -i"
L "'"
Size markets
Fig. 5. Molecular genetic testing of HD. (A) An autoradiograph of radiolabeled PCR products that encompass the HD CAG repeat following acrylamide gel electrophoresis. The number of individual CAG repeats is calculated by comparison to an M13 sequencing ladder and are noted below the gel. (B) Acrylamide electrophoresis of fluorescently labeled PCR products that encompass the HD CAG repeat detected by an automated sequencer. The number of individual CAG repeats is calculated by compari son with standard size markers and are noted to the right of the graphical output. (Images courtesy of M Galvez, P Scott, and D Rosenblatt, McGill University Health Centre, Division of Medical Genetics, Montreal , Canada .)
• Variable findings include pyramidal and extrapyramidal signs, nystagmus, amyotrophy fasciculations, and sensory loss
Prevalence • Accounts for approximately 20% of all SCA
Diagnosis • Very difficult to distinguish from other hereditary ataxias ; requires molecular genetic testing to detect an abnormal CAG trinucleotide repeat expansion in the coding region of the ataxin 3 (ATXN3) gene (Figure 4 and Table 4)
ATXN3 • Normal alleles have up to 47 repeats • Unlike SCA2 , phenotypically normal individuals can have intermediate allele s that contain 48-51 repeats; can result in pathologic expansion in subsequent generations • Affected individuals have at least one allele with 53-86 CAG repeats • Increase in disease severity has been observed in individuals homozygous for expanded ATXN3
429
Molecular Genetic Pathology
16-14
• CAG trinucleotide expansion results in polyglutamine expansion in the ATXN3 protein; however, the normal function of the ATXN3 protein is unknown
Molecular Genetic Testing • PCR amplification of the ATXN3 trinucleotide repeat region followed by gel electrophoresis • Detects nearly 100% of SCA3 cases
SCA6 Distinctive Clinical Attributes • Characterized by adult onset, typically in the fifth to sixth decade • Variable findings include very slow progression, dysarthria, nystagmus, and occasionally diplopia • Can present with episodic ataxia
Prevalence • Accounts for approximately 15% of all SCA
Diagnosis • Very difficult to distinguish from other hereditary ataxias ; requires molecular genetic testing to detect an abnormal CAG trinucleotide repeat expansion in the coding region of the calcium channel, voltage-dependent, o-I A subunit (CACNAJA) gene (Figure 4 and Table 4)
• The combination of PCR and mutation scanning detects nearly 100% of SCA6 cases • CACNAJA mutation disorders (AD)
- G293R causes a disorder similar to SCA6 but with a more severe clinical presentation - Episodic ataxia Type 2 - Familial hemiplegic migraine
Friedreich Ataxia (FRDA)-AR • Very unique among the nucleotide expansion ataxias as is most commonly caused by an unstable expansion of a GAA trinucleotide repeat, inherited in an AR fashion • Is not associated with disease anticipation
Distinctive Clinical Attributes • Characterized by onset in the first to second decade; however, atypical cases presenting beyond 25 years of age have been observed • Associated with depressed tendon reflexes, dysarthria, Babinski responses, and loss of position and vibration senses
Prevalence • It is the most common hereditary ataxia with an estimated prevalence of 1-2/50,000 • Carrierfrequency is 1/60-1/100
CACNAIA
Diagnosis
• Has multiple transcript variants • Short form variants: the CAG repeat is located within the 3' UTR and is not associated with any disease
• Requires molecular genetic testing to detect an abnormal GAA trinucleotide repeat expansion in the first intron of the frataxin (FXN) gene, located at 9q 13-q21.1
• Long form variant:
• >96% of FRDA individuals have FXN GAA expansion; approximately 4% of FRDA individuals are compound heterozygous for the GAA expansion and another deleterious FXN gene mutation
- Normal alleles have up to 18 repeats - Intermediate alleles with 19 repeats have unclear clinical significance - Affected individuals have at least one allele with 20-32 CAG repeats - Unlike many other AD ataxias , anticipation of SCA6 is not observed, as expansions of CACNAJA from parent to child rarely occur
FXN • Normal alleles have 5-33 repeats • Phenotypically normal individuals can have intermediate alleles that contain 34-65 repeats; can result in pathologic expansion in subsequent generations
• CAG trinucleotide expansion results in polyglutamine expansion in the CACNAIA protein
• Full penetrance alleles contain 66-1700 GAA repeats • Other inactivating mutations of FXN include nonsense and missense mutations • Encodes a mitochondrial protein, which belongs to the frataxin family; regulates mitochondrial iron transport and respiration
Molecular Genetic Testing
Molecular Genetic Testing
• PCR amplification of the CACNAJA trinucleotide repeat region followed by gel electrophoresis • As missense mutations in the CACNAIA gene cause disorders with phenotypic overlap to SCA6, mutation scanning is available • Mutation scanning typically involves the entire coding region
• PCR amplification of the FXN trinucleotide repeat region followed by gel electrophoresis • Alleles with> 100 repeats may not be detectable by PCR • Individuals with a single allele size as detected by PCR should also be analyzed by Southern blot • Individuals who fulfill the clinical diagnostic criteria of FRDA but who are heterozygous for a pathogenic
• CACNAJA encodes for the n-IA subunit of voltage-
dependent calcium ion channels, which are involved in muscle contraction and hormone/neurotransmitter release; expressed predominantly in neuronal tissue
430
16-15
Molecular Medical Genetics
expanded allele should be tested for inactivating mutations by sequencing of the FXN coding region
• G380R has been shown to result in constitutively activated FGFR3
• Combination of PCR, Southern blot, and mutation scanning detects nearly 100% of FRDA cases
• As the FGFR3 pathway normally exerts a negative growth control, FGFR3 mutations result in gain-of-function
Skeletal and Connective Tissue Disorders
Molecular Genetic Testing
Achondroplasia
• Targeted G380R mutation analysis (Figure 6) and/or DNA sequencing of select exons
An AD disorder characterized by short-limb dwarfism.
Clinical • Affected individuals exhibit short stature with disproportionate arms and legs, characteristic faces with frontal bossing and midface hypoplasia, exaggerated lumbar lordosis, limitation of elbow extension, genu varum, and trident hand • Intelligence and life span are usually normal; however, spinal cord and upper airway abnormalities increase risk of infant death • In the majority of individuals it is caused by a sporadic G380R mutation in the fibroblast growth factor receptor-S (FGFR3) gene, located at 4p16.3 • Rare homozygous achondroplasia (ACH) has distinct radiologic findings and results in neurologic abnormalities and early death
• Sequence analysis of remaining exons is recommended when the two common G380R mutations are not found and ACH is suspected based on clinical and radiographic findings • Combination of G380R mutation analysis and FGFR3 exon sequencing detects nearly 100% of ACH cases • Other phenotypes associated with FGFR3 mutations: - Hypochondroplasia - Thanatophoric dysplasia - Severe ACH with developmental delay and acanthosis nigricans dysplasia - FGFR-related craniosynostosis
FGFR-Related Craniosynostosis Syndromes
• Is the most common form of inherited disproportionate short stature , occurring in approximately 1126,000
An AD spectrum of disorders comprised of Pfeiffer syndrome, Apert syndrome, Crouzon syndrome, BeareStevenson syndrome, FGFR2-related isolated coronal synostosis, Jackson-Weiss syndrome, Crouzon syndrome with acanthosis nigricans, and Muenke syndrome.
Diagnosis
Clinical
• Based on characteristic clinical and radiographic findings; molecular testing is available for atypical cases and those too young to diagnose with certainty
• Majority of syndromes are characterized by bicoronal craniosynostosis or cloverleaf skull, distinctive facial features, and variable hand and foot findings
• Molecular testing is clinically useful for prenatal diagnosis and confirmatory diagnostic testing
• Muenke syndrome and FGFR2-related isolated coronal synostosis are characterized only by uni- or bicoronal craniosynostosis
Prevalence
FGFR3 • Penetrance of mutated FGFR3 is 100% • Majority of affected individuals have one of two point mutations resulting in the same amino acid substitution (G380R) - Major mutation (-98% of affected individuals): ll38G > A - Minor mutation (-1 % of affected individuals): 1138G>C • Affected individuals with G375C and G346E mutations have been reported • Mature FGFR3 protein is a receptor tyrosine kinase • FGFRs have highly conserved amino acid sequences, differing from one another in their ligand affinities and tissue distribution • Interacts with fibroblast growth hormone resulting in receptor dimerization, autophosphorylation, and signal transduction, ultimately modulating bone development and maintenance
• Abnormal skull may be detected by ultrasound prenatally or not until later infancy • Each syndrome has specific clinical features; however, most share common characteristics: hypertelorism, midfacial hypoplasia with proptosis, down-slanting palpebral fissures, high-arched palate , developmental delay/mental retardation, hydrocephalus, hearing loss, and visual impairment • Caused by mutations in the FGFRJ (8pll.2-plLl), FGFR2 (lOq26), and FGFR3 (4pI6.3) genes
Prevalence • Overall incidence for all forms of craniosynostosis is 112,000-112,500 live births
Diagnosis • Typically diagnosed based on clinical findings • Molecular testing of FGFRJ, FGFR2, and FGFR3 assists the diagnosis of suspected craniosynostosis
431
16-16
Molecular Genetic Pathology
- S252W and P253R account for 71 and 26% of Apert syndrome individuals, respectively
----
- Identical FGFR2 mutations have been reported in Pfeiffer, Crouzon, and Jackson-Weiss syndromes Cysteine residues 278 and 342 are common mutation sights for Pfeiffer and Crouzon syndromes
-----
-
Sic I (G>A)
--
Mspl (G>C)
Fig. 6. Molecular genetic testing of ACH. The G380R FGFR3 mutation results from either the 1138G > A or the 1138G > C nucleotide substitution, which create Sid or MspI restriction sites, respectively. The image depicts gel electrophoresis of PCR products that encompass the G380R mutation site and which are digested with either Sid or MspI. In this illustration, the pro-band is heterozygous for the more common 1138G > A mutation given the presence of the Sid restriction fragments (arrows).
• FGFR3 - P252R: is diagnostic for Muenke syndrome - A391E: majority of individuals with Crouzon syndrome with acanthosis nigricans
- FGFR3 mutations also cause ACH, hypochondroplasia, thanatophoric dysplasia, and severe ACH with developmental delay and acanthosis nigricans • Molecular Genetic Testing - Involves initial analysis of recurrent mutations followed by selective gene sequencing
- FGFRJ- and FGFR3-targeted mutation analysis and sequencing of select exons
- FGFR2-targeted mutation analysis, sequencing of select exons, and mutation scanning of entire coding region
Mar/an Syndrome An AD systemic disorder characterized by ocular, skeletal, and cardiovascular abnormalities.
• Molecular testing is available for prenatal diagnosis, yet does not yield informative prognosis
FGFRs • A family of four tyrosine kinase receptors that nonspecifically bind FGFs-a family of signaling molecules that regulate cell proliferation, differentiation, and migration • FGFR sequence differences effect ligand binding specificity
• FGFR4 is not involved in craniosynostosis syndromes • Normal function is likely to restrain limb growth • Mutations cause excessive activity • FGFR amino acids 252-253 are located within an extracellular "linker region" and are common mutation sites believed to alter ligand binding
• FGFRJ - Approximately 5% of individuals with Pfeiffer syndrome Type 1 (mild form) have a P252R mutation
• FGFR2 - Most mutations are missense ; however, deletions, insertions, and splice site mutations have been reported - Mutations identified in Pfeiffer, Apert, Crouzon, Beare-Stevenson, and Jackson-Weiss syndromes
432
Clinical • Affected individuals show a very broad phenotypic spectrum • Symptoms may be present at birth or appear in childhood or adulthood • The four major diagnostic findings include dilation or dissection of the aorta at the level of the sinuses of Valsalva, ectopia lentis, dural ectasia, and four of eight typical skeletal features • Typical skeletal features : bone overgrowth, joint laxity, long extremities, pectus excavatum or carinatum, scoliosis, high arched palate, positive wrist and thumb signs, reduced upper to lower segment, arm span to height ratio> 1.05, and flat feet • Primarily caused by a mutation in the fibrillin -l (FBNl) gene, located at 15q21.1 • Approximately 75% of affected individuals have an affected parent; remaining have a de novo FBN J mutation
Prevalence • One of the most common connective tissue disorders , occurring in approximately 1-2/1 0,000
Diagnosis • Diagnosis of Marfan syndrome (MFS) is based on family history and characteristic clinical findings in multiple organ systems
16-17
Molecular Medical Genetics
• Requires "major" manifestations in at least two body systems, with "minor" involvement of a third body system; if a positive family history is established, diagnosis requires "major" manifestation in one body system with "minor" involvement of a second • Molecular testing is clinically useful for prenatal diagnosis, predictive testing, and confirmatory diagnostic testing
FBN] • Penetrance of mutated FBN] is 100% with variable expressivity • >500 FBN] mutations have been reported in MFS individuals • No definitive genotype-phenotype correlations have been observed; however, mutations associated with severe and rapidly progressive MFS intermittently cluster between exons 24 and 32 • No common mutation exists in any population • Is found in elastic and non-elastic connective tissues of the body • Wild-type FBNI protein is an important component of extra-cellular microfibrils • Participates in the formation and homeostasis of elastic matrix and matrix-cell attachments
- Familial ectopia lentis - Shprintzen-Goldberg syndrome
Osteogenesis Imperfecta A primarily AD group of bone formation disorders characterized by low bone mass and propensity to fracture.
ClinicaL • Affected individuals also may exhibit blue sclera, dentinogenesis imperfecta, skin hyperlaxity, joint hypermob ility, and hearing loss • Fractures are most common in extremities but can occur in any bone • Is a broad clinical entity but is artificially classified into seven types (I-VII) based on clinical presentation, radiographic findings, mode of inheritance, and molecular genetics • Severity: - Type I: mild - Type II: perinatal lethal - Type III: severe - Type IV: moderate-to-mild - Types V-VII: moderate • In the majority of individuals is caused by a mutation in the collagen, Type I, n-I (COLlAl), or COLlA2 genes, located at 17q21.33 and 7q22.1, respectively
• Mutant FBN] is believed to be dominant-negative as MFS individuals typically have reduced FBNI protein expression below that which would be expected from the remaining wild-type allele
• COLlA] and COLlA2 mutations are found in Types I-IV; loci for Types V-VII have not been accurately mapped
MoLecuLar Genetic Testing
PrevaLence
• Mutation scanning of the FBN] gene is available ; includes denaturing high-performance liquid chromatography (DHPLC) and direct sequencing of all exons using genomic DNA
• Overall incidence for all forms of osteogenesis imperfecta (01) is 6-71100,000; Types I and IV account for over half of all 01
• If a specific mutation is known within a family, targeted mutation analysis by bidirectional DNA sequencing is recommended • Mutation scanning of the FBN] gene by cDNA sequencing is available ; given the large size of FBN] , it is more efficient than genomic DNA sequencing • Linkage analysis may be used to determine if an individual has inherited an FBNI allele associated with MFS in multiple family members - Markers are highly informative and are within the FBN] gene - Not independently conclusive, as locus heterogeneity has not been definitively excluded in MFS • Mutations are detected in 70-93% of MFS individuals • Other phenotypes associated with FBN] mutations: - Mitral valve prolapse, Aortic root diameter at upper limits , stretch marks of the skin, skeletal conditions similar to MFS (MASS) phenotype - Mitral valve prolapse syndrome
Diagnosis • Based on characteristic clinical and radiographic findings, family history , and biochemical and molecular testing • Molecular testing is clinically useful for prenatal diagnosis and confirmatory diagnostic testing
eOLlAI and eOLlA2 • >200 structural mutations have been identified • Encode Type I pro-collagen chains containing repeating sequences of uninterrupted Gly-X- Y that are essential for proper chain folding • Two pro-a-l(I) chains and one pro-a-2(I) chain form a triple helix from carboxy to amino terminus • Pro-collagen is secreted and terminal peptides removed forming Type I collagen molecules, which are then assembled into collagen fibrils • Major protein in bone, connective tissue, and cartilage • 01 Type I is associated with heterozygous truncating COLlA] mutations resulting in haploinsufficiency
433
16-18
Molecular Genetic Pathology
• 01 Types II-IV are associated with heterozygous triple helix domain COLlAl and COLlA2 mutations, resulting in glycine substitution and abnormal procollagen folding • Biochemical analysis is typically performed in vitro on cultured dermal fibroblast s by assaying the structure and quantity of synthesized Type I collagen
Molecular Genetic Testing • Mutation scanning of the COLlAl and COLlA2 genes is available using both genomic DNA and cDNA for sequence analysis
• If a specific mutation is known within a family, targeted mutation analysis by bidirectional DNA sequencing is recommended • Combination of targeted mutation and COLlA I and COLlA2 coding region sequence analysis detects nearly 100% of 01 Types I and II, and approximately 60-80% Types III and IV • Other phenotypes associated with COLlAl and COLlA2 mutations: - Ehlers-Danlos syndrome (classic and arthrochalasia types) - Osteoporosis - Arterial dissection
X-LINKED INHERITANCE
Fragile X Syndrome Fragile X syndrome (FGLX) is the leading cause of Xlinked mental retardation among males. The disorder was named for the cytogenetically visible fragile site (FRAXA) at band Xq27.3 that in some cases was heritable.
Clinical • Mental impairment, ranging from learning disabilities to mental retardation with delay of milestones in infancy • Attention deficit and hyperactivity • Anxiety and unstable mood • Autistic-like behaviors • Large head, long face, large ears, and flat feet • Macro-orchidism • Hyperextensible joints, especially fingers • Seizures (epilepsy) affect about 25% of people with fragile X • Sex-specific differences - Boys are typically more severely affected than girls - While most boys have mental retardation, only onethird to one-half of girls have significant intellectual impairment; the rest have either normal IQ or learning disabilities
Prevalence • Prevalence of 1 in 4000 affected males with 1/2 as many affected females • Prevalence of female pre-mutation carriers was estimated at I in 259 in one study (possibly higher in specific populations)
Inheritance • Pre-mutation carrier females, but not males, are at risk for transmitting full mutation alleles to both male and female offspring
434
• Many families transmit pre-mutation fragile X mental retardation-l (FMRI) alleles for generations with little or no presentation of clinical symptoms until a full mutation is produced , resulting in an affected individual
The FMRI Gene • The FMRl gene is located at Xq27.3, contains 17 exons, and spans 38 kb • FMRl encodes an mRNA-binding protein of 632 amino acids-fragile X mental retardation protein (FMRP) • FMRP is thought to shuttle select mRNAs between the cytosol and nucleus and playa role in synaptic maturation and function • FMRl is highly expressed in the brain, testes, ovaries, esophageal epithelium, thymus, eye, and spleen • Mechanism of expansion (>99% of cases) - Expansion of CGG repeat located in 5' UTR region of FMRl gene (Figure 7) - Expansion of CGG leads to methylation of promoter CpG of FMRl gene, silencing the gene and resulting in lack of protein product-FMRP - In full mutation females, methylation of FMRl full mutation is independent of X-inactivation • Characterization of repeat size - Normal alleles : ~4 repeat s-with 29 and 30 repeats most common - Normal "gray zone" alleles: 45-54 repeat s-these alleles can exhibit instability, but have never been observed to expand to full mutation - Pre-mutation alleles: 55-230 repeats-these alleles exhibit instability and are at risk for expansion to full mutation • 59 repeats is the smallest pre-mutation allele observed to expand to a full mutation. The ACMG recommends using 55 repeats as smallest premutation to account for inter-laboratory differences in size standards
16-19
Molecular Medical Genetics
A
FMR1 (4362 bp)
5 - 40
B Premutation
Gray zone
c Normal
5.2 kb
2.8 kb 2.4 kb 123 456
2
3
4
5
6
Fig. 7. (A) Schematic of FMRI gene trinucleotide repeat in the 5' UTR. Ranges for normal, gray zone, pre-mutation, and full mutations are shown. 54 repeats is the ACMG cut off for gray zone alleles and 55 repeats is now considered a pre-mutation (see text). (B) Example of fragile X PCR products run on a 6% denaturing polyacrylamide gel. (Lane 1) Full mutation male with no apparent PCR product; (lane 2) normal male with 24 repeats; (lane 3) pre-mutation male with 59 repeats, and (lane 4) normal female with 29 and 30 repeats. (Lane 5) female with one normal allele of 19 repeats and a gray zone allele of 47 repeats , (lane 6) female with one normal allele of 30 repeats and a gray zone allele of 46 repeats . (C) Example of a fragile X Southern blot with genomic DNA that was digested with both EcoRI and XhoI (methylation sensitive). The 5.2 kb band represents the methylated alleles, unable to digest with XhoI, whereas the 2.8 kb and 2.4 kb bands represent unmethylated alleles that were cut with Xhol. (Lane 1) normal female, (lane 2) pre-mutation male, (lane 3) normal male, (lane 4) normal female, (lane 5) pre-mutation female , and (lane 6) full mutation male . • Pre-mutation carriers are at risk for additional adult onset disorders • Premature ovarian failure in 20% of premature carriers • Fragile X tremor ataxia syndrome-higher penetrance in males Full mutation alleles: >230-2000 repeats-these alleles cause FGLX - Mosaicism for full mutation can complicate the analysis and may not be detectable if low level
Diagnosis • Cytogenetic analysis of the fragile site (FRAXA) is not an acceptable method of diagnosis • PCR of CGG repeat is performed to determine allele sizes with use of appropriate control samples or size ladder (Figure 7B) - PCR cannot distinguish a homozygous female from one with a non-amplifiable second allele - PCR is not adequate for the detection of mosaic individuals with both pre-and full mutations
435
16-20
• Southern blot used with double enzyme digestion with a second enzyme that is internal to the first and is methylation sensitive (Figure 7C) - Females will have an undigested methylated (inactive X or full mutation) allele and digested unmethylated allele (active X) - Males will have digested allele only unless full mutation is present - Southern blot can detect pre-mutation/full mutation mosaics - Prenatal analysis of chorionic villus sampling can be problematic • Methylation is absent or incomplete in this tissue at time of procedure • Full mutations, which are unstable and may have mosaic repeat size, are difficult to interpret on Southern blot • Follow up amniocentesis may be necessary
X-Linked Muscular Dystrophy (DMD and BMD) Dystrophinopathies are a spectrum of X-linked muscle diseases that include Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and DMD-related dilated cardiomyopathy (DCM) .
Prevalence and Inheritance • 1 in 5600 live male births • 2/3 are inherited by mother and 1/3 are new mutations • 75% of female carriers have no signs or symptoms • Risk for female carrier to have an affected male child is 25% with each pregnancy • Germline mosaicism is present in approximately 15% of carrier mothers, complicating risks to siblings
Clinical • Characterized by a spectrum of muscle disease that ranges from mild to severe • DMD is most severe and rapidly progressive and presents in early childhood - Presents with delayed milestones (I8 months-8 years) - Progressive muscle weakness that is symmetrical (proximal> distal) - Generalized motor delay, delay in sitting, standing , and walking -
436
Gait problems including flat footedness Wheelchair bound by 13 years old Cardiac involvement in 90% of patients Approximately 80% of females show no signs or symptoms, but when present usually milder than males, later onset muscle weakness and cramps
Molecular Genetic Pathology
• BMD is characterized by later-onset skeletal muscle weakness - Progressive muscle weakness (proximal> distal) If wheelch air bound, after 18 years old - Activity induced cramping - Cardiac involvement in 90% of patients Approximately 80% of females show no signs or symptoms, but when present usually milder than males, later onset muscle weakness and cramps, dilated cardiomyopathy in some • DCM shows no evidence of skeletal muscle disease - Dilated cardiomyopathy with congestive heart failure - Males present at ages death
2~0
with rapid progression to
- Females present later in life with slower disease progression
DMDGene • The DMD gene spans 2.4 Mb of DNA on Xp21.2 and contains 79 exons (largest human gene known) • Encodes a membrane associated protein, dystrophin, present in muscle cells and some neurons - Part of a complex that links the cytoskeleton with cell membrane and bridges the cytoskeleton with the extracellular matrix - Full length protein is 427 kDa, but many different isoforms identified • Mutations - 6-10% of males with DMD or BMD have duplication of one or more exons - 25% of males with DMD and 5-10% of males with BMD have small insertions/deletions, point mutations, or splicing mutations - Mutations that obliterate or severely disrupt dystrophin function cause DMD, whereas mutations that affect the quantity of dystrophin or truncate the protein in frame, result in BMD - DCM results from mutations that effect the expression or function of dystrophin in cardiac muscle (exon 1 and muscle specific promoter mutations)
Diagnosis • Serum creatine phosphokinase levels are elevated to > lOX in all DMD males and >5X in all BMD males • Creatine phosphokinase levels are also elevated from 2X to lOX in approximately 50% of female carriers • Muscle biopsy with immunohistochemistry for dystrophin is informative in males and some females • Molecular analysis of DMD mutation status - Mutations found in 100% of DMD patients and 85% of BMD patients
Molecular Medical Genetics
16-21
- Multiple x PCR, Southern blotting , and MLPA are used to detect deletion s - Quantitati ve PCR and MLPA can be used to detect duplications - Mutation scanning method s, such as DHPLC and sequencing are used to screen for small insertion s/deletion and point mutation s
X-linked Adrenoleukodystrophy (X-ALD) X-ALD is the most common of the peroxisomal disorders. It is a severe, often fatal disease that manifests in a progressive demyelination of the central nervous system, dysfunction of the adrenal cortex, and testicular dysfunction in hemizygous males.
Clinical • Most common form has early onset that appears at 4-8 years of age resulting in a progre ssive irreversible dementia and death • Less severe presentations include adrenomyeloneuropathy with a later age of onset, adrenal insufficiency, and neurologic complications limited to spinal cord and peripheral nerves
Prevalence • Incidence of all variant forms is I in 15,DOO-most common genetic determinant of peroxi somal disease
The X-ALD Gene • ATP-binding cassette , subfamily 0 , memberl (ABe D I) is located on Xq28 , contains 10 exons, and spans 21 kb • Encodes a protein of 745 amino acids-ALD protein (ALDP) • Mutation analysis - Whole gene sequencing of exons and exon/intron boundaries performed as well as other mutation scanning techniques, such as DHPLC. - Potential compl ications with PCR amplification because of paralogous gene segments exons 7-10 on chromosomes 2pll, 10pll, l6pll , and 22qll - Over 250 different lesions have been found in the ABCDI gene - Mutations in all 10 exons have been reported - Vast majority are point mutation s (58.4%), although frameshift s and nonsense, and exon deletion s have also been identified (http://www.x-ald.nV) - Two base pair AG deletion in exon 5 found in 10.3% of families with X-ALD (most common mutation identified) - No genotype-phenotype correlations are apparent and wide phenotypic variation has been reported within familie s - 70% of missense mutation s result in absent or reduced ALDP, indicating that most mutation s in ABCD I result in complete loss of protein function
Diagnosis
Inheritance • X-linked with males affected and up to 20% of carrier female s with late onset neurologic symptoms similar to adrenomyeloneuropathy • >93% of X-ALD patients inherit mutation s from their mothers with remaining 7% carrying de novo mutation s
• Primary biochemical defect-impaired peroxisomal ~-oxidation with accumulation of very long chain fatty acids-mostly C26 in plasma and tissues • In hemizygous males (99%) and 85% of carrier female s, plasma concentration of very long chain fatty acids are elevated-used as a diagno stic marker for the disease
MITOCHONDRIAL DISORDERS A clinically heterogeneous group of disorders that arise from mitochondrial respiratory chain dysfunction. Caused by mutations of mitochondrial (mtD NA) or nuclear DNA (nONA). Clinical symptoms are first seen in tissues with high energy demand s or low thresholds for energy deficiency ; central nervous system and muscles often involved. • Prevalence - Including both mtDNA and nONA mutations in children and adults, prevalence is approximately 1/5000
The Mitochondrion • An essential cytoplasmic organelle present in all eukaryotic cells that provides majority of cell energy • Typical human cells have several hundred mitochondria; 1000-2000 in a single liver cell
• Energy-generating apparatu s is the oxidati ve phosphorylation pathway (OXPHOS), compo sed of electron transport chain and ATPase (Figure 8): - Is located in the inner membrane and employs five multi-polypeptide enzyme complexes and two electron carriers - Main function is coordinated transport of electron s and protons and production of ATP - Majority of OXPHOS complex proteins are nONA encoded and imported from cytosol • Has its own 16.5-kb double- stranded circular genome that contains two rRNA genes, 22 tRNA genes, and 13 structural genes, which encode OXPHOS subunits (for illustration, see http://www.mitomap.org/)
437
16-22
Molecular Genetic Pathology
Intermembrane space Compl ex
V Mitochondrial matrix
Succinate
Fumarate
H+
Fig. 8. The respiratory chain system in the inner membrane of the mammalian mitochondria. Electrons (e) are transferred from complex I and II to coenzyme Q (CoQ). There they are transferred via complex III and cytochrome c (Cyt c) to complex IV, where oxygen is reduced to water. The movement of H+ from the matrix to the inter-membrane space is coupled with energy release from the electrons. The proton gradient is used for the production of ATP by complex V. Mutations in nDNA-which encodes for OXPHOS subunits or proteins involved in respiratory chain homeostasis-and in mtDNA leads to mitochondrial disease. • mtDNA genome: - Both strands are transcribed from a single promoter - Does not contain introns - Some differences in genetic code between mtDNA and nDNA - l G-I? times faster mutation rate than nDNA - Is maternally inherited - Each cell has 103-104 mtDNA molecules • Homoplasmy-the state in which all mtDNA molecules are identical • Heteroplasmy-the presence of more than one type of mtDNA molecule within a cell • New mtDNA mutations are multiplied by replication and randomly divided into daughter mitochondria during cell division ; leads to differences in level of heteroplasmy between tissues • Penetrance of pathogenic mutation is increased with the degree of mutant heteroplasmy • Tissue phenotype is normal until threshold level of mutant heteroplasmy is exceeded • Organs with greatest ATP requirements are most sensitive to mtDNA mutations • Mitochondrial disorders grouped into two major categories, those due to defects of mtDNA and those due to defects in nDNA • All inheritance models are possible in connection with mitochondrial disorders • Mitochondria dysfunction is also observed in late-onset neurodegenerative disorders and aging • Majority of patients with enzymatically verified mitochondrial deficiency have an unidentified mutation
Diseases Resulting From mtDNA Mutation • Phenotypes of diseases vary between mtDNA mutations and between individuals with same mutation
438
• Probability of disease increases with age and diseases are often progressive
mtDNA Rearrangements • Deletions vary in size and location but a 5-kb common deletion has been observed in some sporadic disorders: • Pearson syndrome-typically early onset; sideroblastic anemia, and exocrine pancreatic failure ; often fatal • Kearns-Sayre syndrome (KSS)-onset 20 years of age; similar to KSS, bilateral ptosis • Duplications of mtDNA have been observed in patients with KSS and diabetes mellitus with deafness • Deletions/duplications usually encompass several essential coding and/or tRNA genes, which impairs mitochondrial protein synthesis
mtDNA PointMutations • Most are transition mutations occurring in tRNNrRNA genes or respiratory chain subunit genes • Are maternally inherited
tRNA Mutation Disorders • Mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes-characterized by recurrent vomiting, headache, and stroke-like episodes causing cortical blindness, hemiparesis, or hemianopia - Usually present in children or young adults after normal early development - Most common mutation: A3243G in tRNALeu(UUR) - Other less common mutations have been reported • Myoclonus epilepsy with ragged redfiberscharacterized by mycoclonus, seizures, mitochondrial myopathy, and cerebellar ataxia
Molecular Medical Genetics
- Less common signs include hearing loss and dementia - Most common mutations: A8344G, T8356C, G8363A in tRNALys
• Non-syndromic sensorineural deafness-most common mutation: A7445G in tRNASer(UCN)
rRNA Mutation Disorders • Aminoglycoside-induced non-syndromic deafness-most common mutation: AI555G in mitochondrial 12S rRNA gene
Protein-Encoding Mutation Disorders • Neurogenic weakness, ataxia, and retinitis pigmentosacharacterized by late childhood or adult onset, ataxia, pigmentary retinopathy, and dementia - Less common signs include sensorimotor neuropathy - Most common mutation : T8993G/C (heteroplasmy -70%) • Maternally inherited leigh syndrome-characterized by early onset, devastating encephalopathy, hypotonia, cerebellar, and brain-stem signs - Less common signs include ophthalmoplegia and respiratory depression - Most common mutation: T8993G/C (heteroplasmy -90%) • Leber's hereditary optic neuropathy-characterized by young adult visual loss due to bilateral optic atrophy with a bias toward males - Less common signs include cardiac dysrhythmia and dystonia - Most common mutations: G3460A, G 11778A, Tl4484C, and A 14495G - Other less common mutations have been reported
Diseases Resulting From Nuclear DNA Mutation • Most of the respiratory chain subunits are encoded by the nDNA • Structure and function of the respiratory chain requires many steps, which are largely encoded by the nDNA • nDNA mutation disorders can follow AR, AD, and X-linked reces sive (XLR)-inheritance patterns
Structural Respiratory Chain Defects • Complex 1 deficiency:
- Leigh and Leigh-like syndrome-(AR)-NDUFS4 (5ql1.1), NDUFS7 (l9pI3 .3) , and NDUFS8 (llqI3) - Hypertrophic cardiomyopathy and encephalomyopathy -(AR)-NDUFS2 (lq23) - Macrocephaly, leukodystrophy, and myoclonic epilepsy-(AR)-NDUFVl (llq13)
16-23
• Complex II deficiency:
- Leigh and Leigh-likesyndrome-(AR)-SDHA (5pI5)
Non-Structural Respiratory Chain Defects • Intergenomic communication defects:
- Mitochondrial neurogastrointestinal encephalomyopathy-(AR)-TP (22q 13.33) - Dominant PEO-(AD)-ANTl (4q35) • Complex I assembly defects :
- Early onset progressive encephalopathy(AR)-BJ7.2L (5qI2.l) • Complex III assembly defects:
- Metabolic acidosis, tubulopathy. encephalopathy, and liver failure-(AR)-BCSlL (2q33) • Complex IV assembly defects:
- Leigh syndrome-(AR)-SURFJ (9q34.2) - Cardioencephalomyopathy-(AR)-SC02 (22q13.33) - Neonatal-onset hepaticfailure and encephalopathy(AR)-SCOJ (I7pI2-p13) Leigh and de Toni-Fanconi-Debre syndrome-(AR)COXlO (I7pI2-17pl1.2) Early-onset hypertrophic cardiomyopathy-(AR)COXJ5 (lOq24) - French-Canadian Leigh syndrome-(AR)-LRPPRC (2p2l) • Complex V assembly defects:
- Early-onset encephalopathy, lactic acidosis-(AR)ATPAF2 (17p 11.2) • Homeostasis and import:
- Freidreich's ataxia-(AR)-FXN (9q13-q21.1) - Hereditary spastic paraplegia-(AR)-SPG7 (I6q24.3) - mtDNA depletion myopathy-(AR)-TK2 (16q 22-q23.1) - Hepatocerebral mtDNA depletion-(AR)-DGUOK (2p13) - Wilson disease-(AR)-ATP7B (I6q24.3) - PEO-(AD or AR)-ANTl (4q35), POLG (I5q25) - Dominant optic atrophy-(AD)-OPAI (3q28-q29) - Deafness-dystonia syndrome-(XLR)-TIMM8A (Xq22.1) - Anemia, sideroblastic, and SCA-(XLR)-ABCB7 (Xq12-q13) - Barth syndrome-(XLR)-TAZ (Xq28)
Diagnostic Evaluation • Some individuals have a clear characteristic phenotype of a specific disorder; can be confirmed by biochemical and molecular genetic testing
439
16-24
Molecular Genetic Pathology
• Metabolic testing and muscle biopsy (respiratory chain activity) are useful for diagnosis • Family history and inheritance evaluation is essential in directing molecular genetic testing • Prenatal diagnosis is available for AR nDNA mutations • Genetic counseling is complex based on the dual contribution of mtDNA and nDNA to the respiratory chain and the general characteristics of mitochondrial genetics • Molecular genetic testing
Performed on DNA from blood (suspected nDNA mutations) or skeletal muscle (suspected mtDNA mutations) Targeted mutation analysis of a panel of genes Southern blot analysis may detect mtDNA rearrangements If no recognized point mutation is identified, entire mtDNA sequencing and/or mutation scanning is available
SUGGESTED READING Boehm CD, Cutting GR, Lachtermacher MB, Moser HW, Chong 55. Accurate DNA-based diagnostic and carrier testing for X-linked adrenoleukodystrophy. Mol Genet Metab . 1999;66:128-136. Boileau C, Iondeau G, Mizuguchi T, Matsumoto N. Molecular genetics of Marfan syndrome . Curr Opin Cardiol. 2005;20:94-200. Beutler E. Hemochromatosis: genetics and pathophysiology . Annu Rev Med.2oo6;57:331-347. Brandon MC, Lott MT, Nguyen KC, et al. MITOMAP: a human mitochondrial genome database-2004 update. Nucleic Acids Res. 2oo5;33(Database Issue):D611--613. URL: http://www.mitomap.org. Chace DH, Kalas TA, Naylor EW. The application of tandem mass spectrometry to neonatal screening for inherited disorders of intermediary metabolism . Annu Rev Genomics Hum Genet. 2002;3:17-45 . Cohen MM, Jr. Some chondrodysplasias with short limbs: molecular perspectives. Am J Med Genet. 2002;112:304-313 . DiMauro 5. Mitochondrial diseases. Biochim Biophys Acta. 2004;1658:80-88.
Maddalena A, Richards CS, McGinniss MI, et al. Technical standards and guidelines for fragile X: the first of a series of disease-specific supplements to the Standards and Guidelines for Clinical Genetics Laboratories of the American College of Medical Genetics. Quality Assurance Subcommittee of the Laboratory Practice Committee . Genet Med. 2001;3:200-205 . Muntoni F,Torelli S, Ferlini A. Dystrophin and mutations : one gene, several proteins, multiple phenotypes. Lancet Neurol. 2003;2:731-740. Ogino S, Wilson RB. Spinal muscular atrophy : molecular genetics and diagnostics . Expert Rev Mol Diagn. 2004;4:15-29. Paulson HL, Fischbeck, KH. Trinucleotide repeats in neurogenetic disorders . Annu Rev Neurosci. 1996;19:79-107. Qaseem A, Aronson M, Fitterman N, Snow V, Weiss KB, Owens OK. Screening for hereditary hemochromotosis: a clinical practice guideline from the American College of Physicians . Ann Intern Med. 2005;143:517-521 .
Graff C, Bui TH, Larsson NG . Mitochondrial diseases. Best Pract Res Clin Obstet Gynaecol. 2002;16:715-728.
Sherman 5, Pletcher BA, Driscoll DA. Fragile X syndrome: diagnostic and carrier testing Genet Med. 2005;7:584-587 .
Gregersen N, Andresen BS, Corydon MJ, et al. Mutation analysis in mitochondrial fatty acid oxidation defects : exemplifed by acyl-CoA dehydrogenase deficiencies, with special focus on genotype phenotype relationship . Hum Mutat, 2001;18:169-189.
Smeitink J, van den Heuvel L, DiMauro S. The genetics and pathology of oxidative phosphorylation . Nat Rev Genet. 2001;2:342-352.
Grody WW, Cutting GR, Klinger KW, Richards CS, Watson M5, Desnick RI. Subcommittee on Cystic Fibrosis Screening, Accreditation of Genetic Services Committee, ACMG. Laboratory standards and guidelines for population-based cystic fibrosis carrier screening. Genet Med. 2001;3:149-154. Kemp 5, Pujol A, Waterham HR, et al. ABCDI mutations and the X-linked adrenoleukodystrophy mutation database : role in diagnosis and clinical correlations. Hum Mutat. 2001;18:499-515.
440
Timchenko LT, Caskey CT. Trinucleotide repeat disorders in humans: discussions of mechanisms and medical issues. FASEB J. 1996;10:1589-1597. Watson MS, Cutting GR, Desnick RI, et al. Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel. Genet Med. 2004;6:387-391. Zinberg RE, Kornreich R, Edelmann L, Desnick RI. Prenatal genetic screening in the Ashkenazi Jewish population . Clin Perinatol. 2001;28:367- 382.
17 Prenatal Diagnosis Nataline Kardon, MD and Lisa Edelmann, PhD
CONTENTS
I. General II.
Prenatal Testing Modalities Amniocentesis Methodology Benefits Limitations Laboratory Methodology In Situ Clonal Analysis Chorionic Villus Sampling (CVS) Methodology Benefits Limitations Laboratory Methodology Percutaneous Umbilical Blood Sampling Methodology Benefits Limitations Laboratory Methodology Fetal Skin Biopsy Methodology Benefits Limitations
III. Indications for Prenatal Testing Advancing Maternal Age Ultrasound Findings Abnormal Screening Results
Parental Chromosome Abnormality Previous Pregnan cy with Cytogenetic Abnormality
17-2 17-2 17-2 17-2 17-2 17-2 17-2 17-2 17-2 17-2 17-2 17-3 17-3 17-3 17-3 17-3 17-3 17-3 17-3 17-3 17-3
17-3 17-3 17-3 .17-3
17-4 17-4
IV. Fetal Abnormalities and Outcome
17-4
Aneuploidy Structural Rearrangements Supernumerary Marker Chromosomes Uniparental Disomy
17-4 17-5 .17-5 17-6
V. Fluorescence In Situ Hybridization in Prenatal Testing
17-6
FISH on Direct Specimens to Screen for Common Aneuploidies 17-6 Subtelomere FISH Probes can be Used to Examine Fetal Chromosomes When Deletion or Duplication is Suspected ..........17-6 Locus Specific FISH Probes can be Used to Examine Fetal Chromosomes 17-6
VI.
Chromosomal Microarray Comparative Genomic Hybridization in Prenatal
Diagnosis Constitutional Arrays are Used for Specific Genomic Gains and Losses
VII. Suggested Reading
17-7 17-7
17-7
441
17-2
Molecular Genetic Pathology
GENERAL • Cytogenetic prenatal diagnosis involves examination of the fetal chromosome complement • Cells are obtained by various modalities during the first or second trimester and are subsequently established in tissue culture
• Short term in situ tissue culture methods produce sufficient cells for metaphase analysis • Chromosome preparations are banded and analyzed microscopically • Digitized images are submitted for diagnosis
PRENATAL TESTING MODALITIES Amniocentesis Methodology • Performed during second trimester between 16 and 18 weeks gestation • 20 cc of amniotic fluid is withdrawn from the amniotic sac transabdominally under ultrasound guidance - The first 1-3 cc are discarded to remove maternal cells • Amniocytes, which are similar to fibroblasts grow in tissue culture
to a harvesting procedure utilizing a robotic harvester - Cell division is arrested by Colcemid - Chromosomes are swollen by hypotonic treatment - Preparation is fixed on cover slip by acetic acid/ methanol fixative • Cover slips are transferred and fixed on slides • Metaphase preparations are stained by a Giemsa-Trypsin protocol and are then analyzed under the microscope
• Primary care obstetrician can perform procedure
Chroionic Villus Sampling (CVS) Methodology
• Outpatient procedure in physician's office
• Performed during first trimester at 10-12 weeks gestation
• Procedure risk is 1 in 200 or 0.5%
• Chorionic villi are gently aspirated by catheter transvaginally or by needle aspiration transabdominally
Limitations
• Placental tissue is dissected and enzymatically digested with a mixture containing Trypsin and Collagenase.
Benefits
• Chromosome preparations cannot be synchronized so high-resolution chromosome analysis is not possible • Tum around time is 6-10 days • Results not available until end of second trimester • Interpretation is dependent upon the degree of chromosome band resolution
Benefits • Results are available by the end of the first trimester • Tum around time is 4-7 days with adequate specimens • Direct analysis produces preliminary results in 8-24 hours
Laboratory Methodology In Situ ClonalAnalysis • Amniotic fluid specimen is centrifuged in order to obtain the fibroblast cells
Limitations
• The cell pellet is suspended in tissue culture medium
• Tum around time is dependent upon the size of the initial sample
• The suspension is placed on a sterile cover slip that is inside a small Petri dish
• Long technically proficient learning curve requiring specialist to perform procedure
• The culture is placed in a 5% CO 2 incubator at 37°C
• Procedure risk is 1-2% • Interpretation is dependent upon the degree of chromosome band resolution and high-resolution analysis is not possible
• Culture medium is added after 24 hours and then on a specified culture regimen • After 5 days in culture, the cover slip is examined to determine if there is sufficient clonal activity for harvest, which occurs at 7 days • When there is sufficient activity to produce adequate metaphases for analysis, the culture is subjected
442
• Separation of villi from maternal decidua is critical for analysis -
1-2% risk for maternal cell contamination
• 1-2% incidence of confined placental mosaicism
Prenatal Diagnosis
17-3
Laboratory Methodology
• Procedure risk comparable with CVS
• Cell pellet is obtained after above digestion
• Late second trimester diagnosis
• Cells are suspended in media
Laboratory Methodology
• The same methodology as amniotic fluid cells (see Amniotic Fluid Laboratory Methodology section) is employed to produce adequate metaphases for analysis
• Note: the tissue does not produce individual clones and generally the cultures are ready to be processed after 3-5 days
See Chapter 2 Red Blood Chromosomes Analysis section.
Fetal Skin Biopsy Methodology • A full thickness skin biopsy is obtained from the fetus under ultrasound guidance or fetoscopy
Percutaneous Umbilical Blood Sampling Methodology
• Performed during second or third trimester depending upon diagnosis
• Needle is inserted into fetal umbilical vessel under ultrasound guidance
• Requires specialist to do procedure
• Performed at 18-20 weeks gestation • Requires maternal fetal medicine specialist to do procedure
• Specific diagnoses are made by electron microscopy or immunohistochemical analysis of the tissue
Benefits • No other methods can be used to make the diagnosis of rare dermatologic genetic disorders
Benefits • Chromosome analysis results in 48-72 hours
- Some examples are erythemolysis bullosa, congenital icthyosis, and oculocutaneous albinism
• Direct fetal lymphocyte diagnosis • High-resolution chromosome analysis may be possible
Limitations • Most invasive procedure
Limitations
• Useful for specialized diagnoses only
• Technically proficient specialist performs procedure • Risk of maternal blood contamination
• Less invasive procedures are utilized for cytogenetic and molecular genetic diagnoses
INDICATIONS FOR PRENATAL TESTING
Advancing Maternal Age
Abnormal Screening Results
• ACOG recommendation over the age of 35 - Some practitioners present option as a consideration over the age of 30
• First trimester screening - Pregnancy-associated plasma protein-A
• Risk of having a chromosome abnormality at 35 is I in 200
-
Free ~-human chorionic gonadotropin
-
Nuchal fold translucency measurements with crown rump length to establish gestational age
- Gradually increasing risk as age advances • Risklbenefit analysis determines patient preference methodology
• Combined screen -
Above three values plus maternal age
Ultrasound Findings
- False-positive rate is 5%
• Structural abnormalities - Single or multiple congenital abnormalities
-
- 25% of structural defects are associated with a chromosome abnormality • Nuchal fold translucency Cystic hygroma - Increased measurements of fetal neck
Detection rate 80-90%
• Second trimester screening -
n-fetoprotein
-
Unconjugated estriol
- Inhibin-A - Chorionic gonadotropin
443
17-4
Molecular Genetic Pathology
• Integrated screen - Results from first and second trimester screen plus maternal age - False-positive rate 2- 3% - Detection rate 80-90%
Parental Chromosome Abnormality • Structural abnormality
• Viability is possible depending upon what chromosomes are involved • Small pericentric inversions have been noted as population variants, particularly involving chromosomes 2 and 9 • No clinical consequences in these cases - Paracentric inversion carrier • During meiosis acentric and dicentric chromosomes may result • Associated with early pregnancy loss
- Balanced translocation carrier • Can produce unbalanced offspring • Viability determined by nature of translocation and reproductive history • Risks dependent on mechanism of meiotic separation - Robert sonian translocation carrier • Involves chromosomes 13, 14, 15,21, and 22 • Most common transloc ation i.e., 13114 associated with multiple miscarriages • Combinations with chromosome 21 results in translocation or familial Down syndrome • May be at risk for uniparental disomy (see Fetal Abnormal ities and Outcome section) if translocation involves chromosomes 14 and 15
• No risk for an abnormal live born • Mosaicism - Constitutional mosaicism • Different percent of normal vs aneuploid cell lines in different tissues • Phenotypic effects determined by percentage of aneuploid cells - Gonadal mosaici sm • Mosaic cell line is present only in gonadal tissue • Gamete production affected • Risk of abnormal offspring is based on percentage of mosaicism in gonad s • All other tissues are normal • No phenot ypic consequen ces
- Pericentric inversion carrier • Unbalanced recombinant chromo somes may result from crossing over in a recombinant loop during meiosis
Previous Pregnancy with Cytogenetic Abnormality
• More likely to occur if the loop is large due to greater chromosome distance
• Previou s trisomy 21, 18, or sex chromosome aneuploid y - Recurrence risk 1-2%
• Duplication or deficiency of chromosomal material will produce phenotype effects
• Balanced de novo rearrangement - Sporadic recurrence unless gonadal mosaici sm
FETAL ABNORMALITIES AND OUTCOME
Aneuploidy • Most common trisomie s identified, which may survive to term delivery Trisomy 2 I-Down syndrome • Mental retardation • Clinical history of hypoton ia • Prominent occiput • Characteristic facies consisting of oblique palpebral fissures, epicanthal folds, low set ears, flat nose bridge , and large protruding tongue • Congenital heart disease, i.e., A-V canal • Duodenal atresia • Bilateral simian creases
444
- Trisomy 18-Edward syndrome • Intrauterine growth retardation • Mental retardation • Micrognathia • Low set ears • Congenital heart disease, i.e., ventricular septal defect (VSD). • Contractures with characteristic hand position , i.e.. 2nd digit over 3rd and 5th over 4th • Rockerbottom feet - Trisomy 13-Patau syndrome • Mental retardation
Prenatal Diagnosis
• Characteristic craniofacial abnormalities consisting of bilateral cleft lip and palate and holoprosencephaly
17-5
• May be picked up at time of CVS • Survival similar to double aneuploidy
• Polydactyly • Polycystic kidneys
Structural Rearrangements
• Congental heart disease, i.e., ASD, VSD
• Known familial rearrangement - Parental balanced translocation (see Parental Chromosome Abnormality section)
• Sex chromosome aneuploidies - Klinefelter syndrome-XXY Tall stature • Small sclerotic post-pubertal testes • Azoospermia • Gynecomastia • Clinical history of learning disabilities - Triple-X syndrome-XXX • Variable clinical history of spontaneous abortions • Normal phenotype • Clinical history of severe learning disabilities - XYY
- Parental pericentric inversion (see Parental Chromosome Abnormality section) - Parental paracentric inversion • May have history of reproductive loss • Balanced inversion progeny can survive and have similar reproductive history as parent • De novo rearrangement - May be associated with Multiple Congenital Anomaly/Mental Retardation (MCAlMR) syndromes. - Risk reported as high as 10% - Cannot determine if completely balanced
• Tall stature
• Limitation dependent upon microscopic resolution
• Prominent metopic suture
• Molecular techniques may define possibility of balanced rearrangement
• Clinical history of learning disabilities • Clinical history of behavior problems • Monosomy - Turner syndrome-45, X • Believed to be due to a paternal meiotic error • High incidence in spontaneous abortions • Of those that survive to term, phenotype consists of: • Short stature • • • •
Webbed neck Triangular facies Coarctation of the aorta (20%) Structural kidney abnormalities
• Cafe au lait spots • Clinical history of learning disabilities (spatial) • Ovarian dysgenesis • Double aneuploidy - Identified in very early pregnancies May be picked up at time of Chorionic villus Sampling (CVS) . - Very few survive to term - Frequent finding in spontaneous abortions - Involves both autosome and sex chromosomes • Triploidy/tetraploidy - Three or four sets of chromosomes • Chromosome number 69 or 92 • Results from dispermy event or reabsorption of one polar body • Identified in very early pregnancies
• Time limitations • Molecular limitations
Supernumerary Marker Chromosomes • Variable size - Some may be "dot"-like • Banding patterns cannot be determined by routine staining - Nucleolar organizing region (NOR) staining or molecular probes to determine whether satellites present - C-banding to determine amount of heterochromatin • Origin usually dependent on molecular studies - Fluorescence in situ hybridization (FISH) panel for most common derivatives • Prognosis for chromosome 15 markers • 50% of all markers • Known syndrome of mental retardation when Prader-Willi Syndrome (PWS) region is present - Comparative genomic hybridization useful in nonmosaic cases • Even if origin is determined may not be able to predict outcome and prognosis since there is a limited pool of data - Unknown phenotype for the majority of cases except for PWS with chromosome 15. • Familial markers Parental marker may seem to be the same by routine staining and if so, then the risk for abnormality is reduced However, molecular subtelomere studies recently have shown that parental marker is balanced and proband marker is not
445
17-6
Molecular Genetic Pathology
Uniparental Disomy (UPD) • Arises when an individual inherits both copies of a chromosome from one parent - Loss of a chromosome in a trisomic zygote (trisomy rescue) - Duplication of a chromosome in a monosomic gamete (monosomy rescue) - Fertilization with two copies of a chromosome in one gamete and no copies of the chromosome in the other gamete (nullisomic and disomic gametes) • Associated with clinical phenotypes only for chromosomes that contain imprinted genes, which are genes that are expressed from either the maternally or the paternally inherited chromosome but not both • One copy of an imprinted gene is silenced whereas the other is active • A maternally imprinted gene is not expressed from the maternally inherited chromosome and vice versa - Chromosome 15 • Paternal UPD-Angelman syndrome • Maternal UPD-Prader-Willi syndrome
- Chromosome 7 • Maternal UPD-Russell-Silver syndrome and IUGR - Chromosome II • Maternal UPD-Beckwith-Wiedemann syndrome - Chromosome 14 • Maternal UPD 14-Intrauterine Growth Retardation (IUGR) and mild dysmorphic features • Paternal UPD I4-hypotonia, thoracic dystrophy, and developmental delay - Chromosome 6 • Paternal UPD 6-transient neonatal diabetes mellitus - Chromosome 16 • Maternal UPD I6-IUGR and congenital anomalies • UPD testing should be offered - When mosaic or non-mosaic trisomy for any of the above chromosomes is observed on CVS specimen, if follow-up amniocentesis is chromosomally normal, UPD testing should be offered - When Robertsonian translocation involving chromosomes 14 or 15 is observed in the fetal karyotype
FISH IN PRENATAL TESTING FISH on Direct Specimens to Screen for Common Aneuploidies • Rapid analysis on interphase nuclei of direct amniocytes or chorionic villi (8-24 hours) - Follow-up for abnormal ultrasound findings • Cystic hygroma-abnormality most commonly associated with aneuploidy - Follow-up for abnormal first or second trimester biochemical screen - In cases of advanced maternal age or previous aneuploid pregnancy • Enumeration of most common autosomal (13, 18, 21) and sex chromosome (X, Y) aneuploidies (Figure 1) • Used in conjunction with standard karyotype analysis • Limitations - Difficulty interpreting mosaic findings - Maternal blood in specimens may confound results - Direct CVS specimen (trophoblast) represents different population of cells than cultured cells (villus stroma); therefore, placental mosaicism may yield FISH results that conflict with karyotype - Does not detect all aneuploidies
446
Subtelomere FISH Probes can be Used to Examine Fetal Chromosomes When Deletion or Duplication is Suspected • When parent is a carrier of a cryptic balanced translocation - Risk for partial monosomy and partial trisomy in unbalanced fetuses due to adjacent -I segregation • When de novo translocation involving at least one telomere is identified in fetal karyotype to assess whether it is balanced
Locus Specific FISH Probes can be Used to Examine Fetal Chromosomes • Ultrasound abnormality indicative of a specific microdeletionlduplication syndrome - Cardiac defects and 22qll FISH probe (e.g., Tuple I or N25) - Lissencephaly and 17p13.3 FISH probe (e.g., Lis 1) • Parent is a carrier of a microdeletion (50% chance of transmission) • For couples with a previous child with a microdeletion/duplication syndrome in case of gonadal mosaicism in one parent (rare)
Prenatal Diagnosis
17-7
X(green)
Y(red)
Disomy 21 female
21 (orange) Trisomy 21 male
Fig. 1. FISH on interphase nuclei from amniotic fluid FISH results using a probe mix containing the X centromere sequences fluorescentIy labeled in green, the Y centromere sequences fluorescentiy labeled in red, and the chromosome 21 locus-specific probe at 21q22 fluorescentIy labeled in orange. The left side is a FISH image from a female fetus with a normal hybridization pattern for chromosome 21. The right side is a FISH image from a male fetus with a hybridization pattern for chromosome 21 consistent with trisomy 21.
CHROMOSOMAL MICROARRAY COMPARATIVE GENOMIC HYBRIDIZATION IN PRENATAL DIAGNOSIS Constitutional Arrays are Used For Specific Genomic Gains and Losses
+
+ +
BAC and PAC clones are printed onto glass slides to create array More than 40 genomic disorders and all subtelomeric regions are represented Detects rearrangements not visible by standard karyotype analysis
+ Limitations - Not a whole chromosome array-targeted regions of the genome Will not detect balanced rearrangements - Copy number polymorphisms can confound results so parents may need to be tested Positives must be confirmed by FISH
SUGGESTED READING Cheung SW, Shaw CA, Yu W, et al, Development and validation of a CGH microanray for clinical cytogenetic diagnosis. Genet Med. 2005;7:422-432 . Crolla JA. FISH and molecular studies of autosomal supernumerary marker chromosomes excluding those derived from chromosome 15: n. Review of the literature . Am J Med Genet. 1998;75(4):367-381. Evans MI, Wapner RJ. Invasive prenatal diagnostic procedures 2005. Semin Perinatol. 2005 ;29(4):215-218. Gardner RJM, Sutherland GR. Chromosome Abnormalities and Genetic Counseling. 3rd ed. New York, NY: Oxford University Press; 2004; p. 311-335,p. 392-432.
Knight SJ, Lese CM, Precht KS, et al, An optimized set of human telomere clones for studying telomere integrity and architecture . Am J Hum Genet. 2000;67:320-332.
Ledbetter DH, Engel E. Uniparental disomy in humans: development of an imprinting map and its implications for prenatal diagnosis. Hum Mol Genet. 1995;4:1757-1764. Randolph LM . Prenatal Cytogenetics. In: Gersen SL, Keagle MB, eds. The Principles of Clinical Cytogenetics. Totowa: Human a Press ; 2005 ;267-321 .
447
17-8
ShafTer LG. Risk estimates for uniparental disomy following prenatal detection of a nonhomologous Robertsonian translocation. Prenat Diagn. 2006;26:303-307. Tepperberg J, Pettenati MJ, Rao PN. Prenatal diagnosis using interphase fluorescence in situ hybridization (FISH), 2-yearmulti-center retrospective studyand review of the literature. Prenat Diagn. 2001 ;21:293-301.
448
Molecular Genetic Pathology
Warburton D. De novobalanced chromosome rearrangements and extra markerchromosomes identified at prenatal diagnosis: clinical significance and distribution of breakpoints. Am J Hum Genet. 1991 ;49(5):995-1013. Wenstrom KD. Evaluation of Downsyndrome screening strategies. Semin Perinatol. 2005;29(4):219-224.
18 Familial Cancer Syndromes Michelle P. Elieff, MO, Antonio Lopez-Beltran, MO, PhD, Rodolfo Montironi, MD, FRCPath, and Liang Cheng, MO
CONTENTS
I. Overview II. Retinoblastoma
18-2
VI.
Syndromes
18-2
III. Li-Fraumeni Syndrome
18-5
IV. Hereditary Breast and Ovarian Cancers BRCAI BRCA2
18-6 18-6 18-7
V. Hereditary Gastrointestinal Cancers Overview Hereditary Non-Polyposis Colorectal Cancer (HPNC, Lynch Syndrome) Familial Adenomatous Polypo sis (FAP) MYH-Associated Polyposi s Syndrome Peutz-Jegher Syndrome Juvenile Polyposis Syndrome Hereditary Diffuse Gastric Cancer
VII. Von Hippel-Lindau Syndrome VIII. Genodermatoses Hereditary Melanoma Birt-Hogg-Dube Syndrome Carney Complex PTEN-Associated Multiple Hamartoma Syndrome (Cowden Syndrome) Nevoid Basal Cell Carcinoma Syndrome (Gorlin Syndrome)
18-7 18-7 18-7
IX. .18-7 18-9 18-10 18-10 18-10 18-11
18-11
MEN Type 1 18-11 MEN Type 2A and 2B Familial Medullary Thyroid Cancer (MTC) 18-12
Cell Cycle Checkpoint Kinase 2
(CHEK2)
Hereditary Endocrine Tumor
18-13 18-13 18-14 18-15 18-15 18-15
Neurofibromatosis Type 1 (Von Recklinghausen Syndrome) ..18-16
X. Neurofibromatosis Type 2 XI.
18-12
Tuberous Sclerosis Complex
XII. Suggested Reading
18-17 18-17 18-17
449
Molecular Genetic Pathology
18-2
OVERVIEW In 2006, about 1.4 million new cancers were diagnosed in the United States. This includes 1 million non-melanomatous skin cancers. Almost 10 million Americans are alive today with a diagnosis of cancer. The likelihood that any given person has a family history of cancer is, therefore, quite high. The majority of these cases are due to complex environmental factors or chance . However, in 5-10% of cases this is due to a heritable familial cancer syndrome • Clues that suggest familial cancer syndrome - Cancer diagnosed at significantly earlier age than is epidemiologically typical - Multiple different non-skin primary cancers in the same person - Two or more first- or second-degree relatives with the same cancer - An extremely high number of cancers within genetically related individuals in a family, not due to chance or environmental causes - Pedigree that suggests a specific inheritance pattern (autosomal dominant, autosomal recessive) - Membership in certain ethnic groups • Caveats in exploring a suspected inherited cancer syndrome: - Sometimes a family history will appear negative due to early death or failure to diagnose the disease in a parent. - Patient information can be inaccurate and confirmation of important cancer diagnoses from the medical
record, if possible, should be attempted to accurately assess risk and need for genetic counseling. A proband reporting that three close relatives had "throat cancer" is vague, learning that all three had medullary thyroid carcinoma, however, can provide a first step towards risk assessment and guide further medical interventions -
Assessment of a patient's or family's risk of cancer from a suspected inherited syndrome is dynamic. The clinician must evaluate each case mindfully, with an understanding of how the accuracy of provided medical information, new diagnoses of cancers within a family, new research findings, and the limits of molecular testing will impact the patient Many sporadic human carcinomas share the same mutations as hereditary forms. A positive test result for a mutation must be interpreted in the context of accurate clinical information and a thorough genetic work-up
• When to offer molecular testing The patient (or client) can give full, informed consent - There is a significant family history or personal risk of disease - Test results are accurate and can be meaningfully interpreted in the context of the particular patient - Results impact the patient's management Education, support, and appropriate follow-up are adequate
RETINOBLASTOMA • Overview - Most common intraocular malignancy in children, affecting 1 in 20,000 Usually diagnosed before age four 60% of patients have unilateral and 40% bilateral disease Bilateral disease occurs earlier (mean age 5 months) than unilateral disease (mean age 2 years) and is more likely to be due to a germline mutation The disease is the model for carcinoma due to loss of a tumor suppressor gene • Knudson's "two-hit" hypothesis • Retinoblastoma occurs in cells that have diseasecausing mutations in both copies of the gene • In retinoblastoma due to somatic mutations in both alleles, retinoblastoma is unilateral and not hereditary • If a first mutation occurs in germline, retinoblastoma is heritable and tumors are multifocal and bilateral
450
• Clinical features - Children present early (sometimes at birth) with eukocoria (white eye) on indirect ophthalmoscopy - Bilateral and "trilateral" (with intracranial neuroblastoma or pineoblastoma) - 400% increase risk of developing mesenchymal tumors (oesteosarcoma, fibrosarcoma, and so on) - Second primary tumors in 25% (up to 50% after external beam radiation) • Brain tumors • Melanoma • Leukemia • Osteosarcoma • Fibrosarcoma • Adrenocortical carcinoma • Lung, breast, and prostate • Genetics (Table 1) - Large gene (RBi) with 27 exons, located on chromosome l3q 14; codes for retinoblastoma-associated protein
Familial Cancer Syndromes
18-3
Table 1. Genes Associated with Common Syndromes Syndrome
Gene
Chromosome
Retinoblastoma
Rbl
13ql4
Retinoblastoma Pineoblastoma
Li-Fraumen i
TP53
17pl3.1
Adrenal Breast Brain Soft tissue sarcomas Bone sarcomas
Hereditary breast
BRCA l
17pI2-21
BRCA2
I3q12 -13
CHEK2
13q21
Breast cancer Ovarian cancer Prostate cancer Breast cancer in men and women Prostate cancer Ovarian cancer Breast cancer Colon cancer Brain tumors Sarcomas
Hereditary non-Polyp osis colon cancer
MLHl MSH2 MHS6 PMS2
3p21-23 2p21 2pl6 7p22
Colorectal cancer with MSI Gastric cancer Small intestinal cancer Ovarian and endometrial cancers
Familial adenomatous polyposis (FAP)
APC
5q21-22
Multiple polyps with high risk of colorectal cancer Duodenal or ampullary adenomas/carcinomas Desmoid Congenital retinal epithelial hypertrophy
Peutz-Jegher
LKBl/ STKll
19p13.3
Multiple GI hamartomas Pigmented oraUlabial macules Breast, colon, gastric, and ovarian cancer Sex cord tumors with annular tubules
Hered itary diffuse gastric carcinoma
CDH-l
16q22.1
Diffuse signet ring gastric cancer Lobular breast cancer in women
Wermer syndrome
MENl
llql3
Pituitary adenoma Parathyroid hyperpla sia Pancreatic neuroendo crine tumors
Multiple endocrine neoplasin, MEN 2A
RET
IOql1.2
Medullary thyroid cancer (MTC) Hyperparathyroidism Pheochromocytoma
Multiple endocrine neoplasin, MEN 2B
RET
IOql1.2
Medullary thyroid cancer (MTC) Marfanoid habitus GangliomaslNeurom as Pheochrom ocytoma
Von Hippel Lindau
VHL
3p25
Endolymphatic sac papillary adenocarc inoma CNS hemang ioblastomas Renal and pancreat ic cysts Pancreatic endocrine tumors Pheochromocytomas
Hereditary papillary renal cell Carcinoma
MET
7q31
Mutations cause the transmembrane receptor to function as an activate tyrosine kinase in the absence of hepatocyte growth factor
Key clin ical features
(Continued)
451
18-4
Molecu lar Genetic Pathology
Table 1. (Continued) Syndrome
Gene
Chromosome
Key clinical features
Hereditary prostate cancer
HPC I HPCX BRCAI BRCA2
Iq24-25 Xq27-2 8 17pl2 13qI2-13
Early onset prostate cancer
Carney complex
PRKARIA
7q23-24
Cutaneous pigmented lesions Cutaneous, breast and cardiac myxomas Psammomatous melanotic schwannomas Large cell calcifying Sertoli cell tumors of the testis Primary pigmented nodule adrenocortical disease Thyroid carcinoma Breast adenomas
Cowden syndrome
PTEN
lOq22-23.3
Macroceph aly Mental retardation Multiple gastrointestinal hamartom as Hyperkeratotic oral papules, facial trichilemmomas, acral keratosis Cerebell ar gangliocytic tumors Endometrial cancer Thyroid follicular tumors Breast fibroadenom as and carcinomas
Gorlin syndrome
PTCH
9q22.3
Multiple basal cell carcinomas Basal cell nevi Palmar or plantar pits Odontogenic keratocyst Ectopic calcifications Skeletal abnormalities including bifid, fused or absent ribs or vertebrae Macrocephaly (>97%ile) Ovarian fibroma Medulloblastoma Cleft lip or palate Polydactyly
Von Recklingh ausen syndrome
NFl
2p22-21
Plexiform neurofibroma Multiple neurofibromas Cafe au-Iait spots Melanocytic iris hamartomas (Lisch nodules) Axillary or inguinal freckling Optic nerve glioma Specific bone abnormalities
Neurofibromatosis Type 2
NF2
22q 12.2
Acoustic schwannomas Meningiomas Ependymomas Astrocytomas
Tuberous sclerosis
TSCI TSC2
9q34 16p13.3
Cortical tubers Subepend ymal glial nodules Cardiac rhabdomyomas Subependymal giant cell astrocytomas Renal angiomyolipomas Periungual fibromas, Hypopigmented macules, Shagreen patch Retinal hamartomas, Iymphan giomatosis
452
Famil ial Cancer Syndromes
18-5
- Acts as cell cycle (entry into S phase) and transcriptional regulator - Activated by phosphorylation during cell cycle progres sion - Complexes with E2F and prevents it from stimulating the transcription of DNA replication genes - Most germline mutations are single nucleotide substitutions - New mutations typically affect paternal allele • Diagnos is Depends on clinical presentation • In patients with family history of bilateral retinoblastoma • DNA sequencing analysis is performed on peripheral blood to identify single nucleotide substitutions (detect s 75% of mutations) • Fluorescence in situ hybridization (FISH) to detect partial or complete deletion of RB gene (detect about 10% of mutations) • In patients with bilateral retinoblastoma, without family history • DNA sequencing analysi s and/or FISH is performed using peripheral blood
• If no mutation identified from peripheral blood DNA, tumor DNA can be tested by DNA sequencing analysis , loss of heterozygosity, and aberrant DNA methylation. Once mutations are detected in tumor DNA samples, peripheral blood DNA should be checked again for verification. • In patients with unilateral disease, but without family history • Tests are initially performed on tumor samples to identify specific mutations, followed by testing on peripheral blood • Management - Goal is to preserve life and sight through early diagnosis and treatment - In a patient with a family history of retinoblastoma, testing for germline mutation can be performed even prenatally - In patients with germline mutations in retinoblastoma gene, eye examination every 4 weeks for the first year of life and then less frequently thereafter - Photocoagulation, cryotherapy, and enucleation used in treatment
LI-FRAUMENI SYNDROME
• Overview - Autosomal dominant syndrome in which affected individuals are at great risk of developing multiple primary cancers at a young age - Rare , if classic syndrome criteria used for definition - Highly penetrant with a 90% lifetime risk of cancer • Clinical and pathologic feature s - Half will develop cancer by age 30 and 90% by age 60 - Tumors include soft tissue and bone sarcomas, adrenal cortical tumors , brain tumors, hematopoietic malignancies, colon , and breast cancer • Genetics - TP53 on chromosome l7p13.I most common (70%) - Gene product p53 is gatekeeper • Regulates cell cycle • Halts replication for repair • Induces apoptosis - Mutations • Mostly missen se • Exons 4-9 most common region
• Diagnosis - Classic syndrome criteria: • Proband younger than 45 diagnosed with sarcoma, plus • First-degree relative with a Li-Fraumeni tumor (breast, brain, sarcoma, leukemia, adrenal) diagnosed before age 45, plus • Another first or second degree relative with any cancer before age 45 or a sarcoma at any age - Diagnosis suspected on the basis of clinical criteria is then confirmed by molecular testing. Direct DNA sequencing of the gene is the most accurate (detects -98%) but time consuming. DNA sequence analysis of exons 4-9 is more common and can detect 95% of mutations in the 70% of kindreds known to have a p53 mutation • Management - Genetic testing offered to those at risk - Ethical consideration is that minors are at risk for many of the malignancies-should testing be offered? - Increased surveillance for those at risk, including physical examination, earlier mammography, colonoscopy
453
Molecular Genetic Pathology
18-6
HEREDITARY BREAST AND OVARIAN CANCERS • Overview Breast cancer • Breast cancer is most common cancer in women (11% lifetime risk) with an average age at diagnosis of 60 years • Breast cancer incidence is 200,000 cases per year • Over 15,000 cases associated with hereditary predisposition (5-7%) • Often younger age • Higher grade • Multifocal and bilateral • Clustering in certain ethnic groups (Eastern European Jewish ancestry) • 80-90% of familial breast cancers due to BRCAI or BRCA2 mutations • Other syndromes associated with increased risk of breast cancer:
• 40% lifetime risk of ovarian carcinoma, usually papillary serous carcinoma (reported to have a possible better prognosis than for sporadic ovarian cancer) - Men have increased risk of prostate cancer (both BRCAI and BRCA2) - Highest level of expression seen in thymus and testis (both BRCAI and BRCA2) • Clinical and pathologic features High-grade invasive ductal carcinomas of breast with associated Iymphoplasmacytic inflammation - Less likely to have associated in situ components (ductal carcinoma in situ) - Triple negative tumors (unlike BRCA2) • Estrogen receptor negative • Progesterone receptor negative • HER2/neu negative
• Cowden syndromes • Li-Fraumeni syndrome
Overexpression of p53 , MIB-l (high proliferation), and cyclin E
• Ataxia-telangioectasia
- Medullary carcinomas more common
• Hereditary non-polyposis colorectal cancer (Lynch Syndrome) (with MLHI gennline mutations)
- Controlled for stage and grade, prognosis is similar to sporadic breast cancer
• Hereditary melanoma • Peutz-Jeghers syndrome • Others Ovarian cancer • Fifth most common cancer in women • Frequently presents late at high stage • 50% 5-years survival • 10% of ovarian cancer due to familial predi spos ition
• Genetics
- BRCAI is a tumor suppressor gene on chromosome 17p12-21 - Large gene with 24 exons (22 encode the mRNA gene product), 1863 amino acids
-
BRCAI
-
• Overview - Autosomal dominant hereditary breast cancer
-
Gene frequency varies depending on population (1/150-1/1000) Accounts for about 50% of hereditary breast cancers and 80% of hereditary ovarian cancers Carriers have 50-80% lifetime risk of breast cancer (risk depends on particular mutationlkindred), in comparison to 10% lifetime risk in general population Presence of a BRCAI mutation • 18-20% risk of breast cancer before age 40 • 60% risk of developing breast cancer before age 50 • 20% risk of ovarian cancer before age 50
454
• Exon II is the largest region, encodes 60% of the protein, accounts for 555 of all mutations BRCAI gene product involved in DNA repair and transcription regulation, acts as a "caretaker gene" Complexes with RAD51, a protein involved in the repair of dsDNA breaks N-tenninal region contains a zinc-biding RING finger domain Gennline mutations usually truncate protein and lead to loss-of-function of the BRCAI carboxy-terminus domain
- Over 500 mutations; most mutations unique to a kindred, some common in a particular group • Management - Earlier screening mammography - Prophylactic mastectom y Prophylactic oophorectomy yields 50% reduction in breast cancer risk Annual or semiannual transvaginal ultrasound and CA-125
Familial Cancer Syndromes
BRCA2 • Overview - Autosomal dominant with an incidence between 8/100 and 1/1000 - Account s for about 25% of hereditary breast cancers - Carriers have 40-70% lifetime risk of breast cancer 20% lifetime risk of ovarian carcinoma • Usually papillary serous carcinoma - Men have increased risk of breast cancer (6%) , over 100 increases over general population (not seen with BRCAl carrier) - Increased risk of prostate cancer (seen in both BRCAl and BRCA2 carrier)
18-7 • Test results most meaningful for patient risk assessment and treatment - Population specific mutation analysis • Ashkenazi Jewish ancestry • BRCAI 185deiAG (1/100 carriers) and 5382insC • BRCA2 6 I74deiT
• Mutation analysis identifie s 90% of mutation s in this population • Dutch populations • Specific deletion in exon 13 of BRCAl • Specific mutation in exon 22 of BRCA 1
• Clinical and pathologic feature s - Histology and prognosis similar to sporadic breast cancer
• Europeans • BRCAl duplication in exon 13, deletion in exons 8-9 and 14-20 - Full gene sequencing
• Genetic s - Large tumor suppressor gene on chromosome 13q12-13, 27 exons
• Costly • Difficult to interpret, may detect non-pathogenic variations
- BRCA2 gene product involved in DNA repair and transcription regulation
- Germline mutation s usually truncate protein and lead to loss of function - Common mutations • 6174deiT has 8/100 carrier frequency in Ashkenazi Jews • 999del5 common in Iceland - Sequencing can be done to detect carriers • Management - Similar to BRCAl with added attention to screening in males (prostate and breast) • Strategies for the molecular diagnosi s of BRCAl and BRCA2 mutations - Test for specific mutation in kindred , if known • Most cost effective
Cell Cycle Checkpoint Kinase 2 (CHEK2) • Overview and clinical feature s - Breast cancer, colon cancer, brain tumors, and mesenchymal tumors - About 5% of inherited breast cancers - Carriers of mutation have I in 5 lifetime risk of developing breast cancer • Genetic s - Tumor suppressor gene on chromosome 13q21 - Possibly dominant inheritance with other factors involved in expression - Gene product is a kina se involved in DNA damage repair Gene acts in association with other proteins including p53 to halt cell division during damage
HEREDITARY GASTROINTESTINAL CANCERS
Overview • Colon cancer is most common internal organ malignancy in developed countries • About 5% of colorectal cancers due to single gene mutations - Most are autosomal dominant Often earlier age of onset Risk of other systemic malignancies
Hereditary Non-Polyposis Colorectal Cancer (HPNCC, Lynch Syndrome) • Overview - Autosomal dominant syndrome involving cancers of many organs, especially the gastrointestinal tract - Responsible for up to 3.5% of colorectal cancers - Incidence is about I in 1000
455
Molecular Genetic Pathology
18-8
• Clinical features - Carriers have 80% risk of colorectal cancer Diagnosis around age 4()...45 Increased risk of upper GI (small bowel and gastric) , biliary, gynecologic (ovary and endometrium), and upper urinary tract (urether and renal pelvis) transitional cell carcinoma Patients with MLHI germline mutation especially at risk of developing breast cancer No increased risk of lung cancer Muir-Torre syndrome • Colorectal carcinomas • Multiple sebaceous tumors • Gastric , small intestinal, gynecologic, and kidney cancers • MSH2 and MLH1 mutations - MMR (mismatch repair gene)-associated Turcot Syndrome
• MSH6 at 2p16 (10%) • PMSI at 2q • PMS2 at 7p22 • Others - Mutation in DNA mismatch repair (replication error repair) gene • Results in incorrect base-base pairing • Results in insertion deletion loops in microsatellite regions • Diagnosis - Microsatellite instability (MSI) (also see Chapter 1) • Tumor available • Tumor testing for MSI using microsatellite markers o
Microsatellites have different number of repeats in tumor vs patient DNA
o
A 1997 National Cancer Institute consensus workshop recommended a 5 microsatellite marker panel for the detection of MSI including BAT25, BAT26, D2S123, D5S346, and D17S250 (Bethesda panel)
• Colorectal carcinoma • Glioblastoma • MLHI and PMSI mutations • Pathologic features - 2/3 of cancers in proximal colon (right-sided) - Mucinous or poorly differentiated carcinomas more frequent - Prominent Crohn's-like lymphocytic inflammatory response - Risk of synchronous or metachronous tumors (tumor multifocality) - Stage for stage have better prognosis than patients with sporadic colorectal cancer with fewer lymph node metastasis • Diagnostic screening criteria - Amsterdam I criteria • Three relatives with histologically verified colorectal cancer, one of whom is a first-degree relative of the other two • Two generations affected • One person diagnosed before age 50 • Likelihood of mutation in patients meeting criteria is 40-60% - Amsterdam II criteria • Less restrictive • Includes HPNCC-associated cancers (GI, GYN, skin, and urothelial carcinomas) • Likelihood of mutation in patients is about 20% • Genetics - Due to mutations in one of several DNA mismatch repair genes (MMR) • MLHI at 3p21-23 (3()...40%) • MSH2 at 2p21 (3()...40%)
456
BAT25
Mononucleotide repeats
BAT26
Mononucleotide repeats
D2S123
Dinucleotide repeats
D5S346
Dinucleotide repeats
DI7S250
Dinucleotide repeats
o
If ~2/5 loci show instability, then-tumor is considered MSI-H and gene sequencing is done
o
MSI-Low (MSI-L): cancers show instability in only one of the five microsatellite markers
o
MSI-Stable (MSI-S): cancers show no microsatellite instability in any of the five markers
• Immunohistochemistry for mismatch repair proteins o
Better for identification of MSH6 mutation , which does not cause MSI
o
Guides which gene to sequence, therefore reducing cost for work-up
• Tumor not available • Direct gene sequencing • Start with MSH2 and MLHI • Caveat: microsatellite instability is identified in 15% of all colon cancers. A positive test of MSI must be interpreted in the appropriate clinical context • Management - Earlier and more intense surveillance - Prophylactic colectomy
Familial Cancer Syndromes
18-9
Fig. 1. Familial adenomatous polyposis (FAP). Numerous tubular adenomas are present in the colon resection specimen.
Familial Adenomatous Polyposis (FAP) • Overview - Autosomal dominant syndrome conferring increased risk of gastrointestinal and other carcinomas - Near 100% penetrance Incidence of 1 in 5000 to 1 in 12,000 - One fourth of cases due to new germline mutation • Clinical features - Diagnosis clinically defined as > 100 polyps in the colon, or T:A transversions - Y165C and G382D mutations seen in 85% of Europeans affected • Diagnosis
458
- Direct mutation analysis - Gene sequencing • Management - Similar to FAP
Peutz-Jegher Syndrome • Overview Autosomal dominant, rare syndrome with an incidence of up to 1 in 25,000 - Half of cases are due to new mutations • Clinical and pathologic features - Early onset of multiple hamartomatous gastrointestinal polyps - Increased risk of GI bleed and intussusception - Pigmented macules of the lips - Increased risk of cancer (90% lifetime risk) • Including : breast (50%), colon (40%), gastric (30%), and ovarian (20%) cancer • Sex cord tumors with annular tubules • Genetics - Due to a mutation in LKBI (STKII) tumor suppressor gene at chromosome 19p13.3 in over half of patients
LKBI (or STKIl) gene product is a serine-threonine kinase , functions as a tumor suppressor gene • Diagnosis - Clinical criteria • Characteristic freckling and two or more hamartomatous polyps • Family history of Peutz-Jegher syndrome and either freckles or hamartomatous polyps - Molecular testing • Sequencing of LKBI gene • Pathologic mutations detected in only 70% of patients with clinical diagnosis • If kindred mutation is one of the 70% that are detectible, absence of mutation can spare family members from costly screening • Management - Earlier screening schedules for gastrointestinal, breast, and testicular cancer
Juvenile Polyposis Syndrome • Overview - Juvenile polyps (retention, hamartomatous, cystic) are the most common type of gastrointestinal polyp in children - The presence of more than three polyps may be a clue to polyposis syndrome
18-11
Familial Cancer Syndromes
• Clinical and pathologic features - Rare autosomal dominant syndrome with increased risk of gastrointestinal cancers Triad of diarrhea, GI bleeding, and protein-losing enteropathy Increase risk of colon, stomach, small intestinal, and pancreatic cancers SMAD4 mutations especially linked to pancreatic cancer - Up to 70% risk of colon cancer by age 60 - Multiple hamartomatous polyps of the GI tract • Genetics - Two gene mutations characterized
• SMAD4IDPC4 at chromosome lSq21 • BMPRJAIALK3 at chromosome IOq22 - 25% of cases are due to a new mutation
- SMAD4 gene is involved in signaling related to TGF~II receptor, the gene mutations is also involved in sporadic colon cancer
• Diagnosis - Diagnosis can be made on clinical grounds in patients exhibiting features of the classic syndrome or by molecular methods - Genetic testing via sequence analysis for both genes available
Hereditary Diffuse Gastric Cancer
- Rare autosomal dominant disorder characterized by diffuse, poorly differentiated gastric carcinoma • Clinical and pathologic features - Gastric cancer around age 40 years -
10% 5-years survival Increased risk of lobular breast cancer in women
- Diffuse signet ring histology - Difficult to detect the cancer endoscopically • Genetics
- CDH-J at chromosome 16q22.l (50%) - Has 16 exons - Mutation in e-cadherin gene, a cell-cell adhesion molecule • Diagnosis - Clinical • Two or more first- or second-degree relatives, one diagnosed before age 50 • Three or more first- or second-degree relatives with diffuse gastric carcinoma, any age - Molecular • Sequence analysis of CDH-J gene • Mutations detected in 30% of patients who fit the clinical criteria • Management - Close endoscopic surveillance - Prophylactic gastrectomy
• Overview
HEREDITARY ENDOCRINE TUMOR SYNDROMES
Multiple Endocrine Neoplasia, Type 1 (Wermer Syndrome) • Overview - Rare autosomal dominant syndrome with incidence between 1110,000 and 1/50,000 - Characterized by multiple endocrine tumors • Clinical features Pituitary adenomas (mainly prolactinoma) (-50%) Parathyroid • Adenomas (90%) • Hyperparathyroidism (hyperfunction) - Pancreaticoduodenal neuroendocrine tumors (gastrinomas and insulinomas) (50-75 %) • Genetics - MEN1 tumor suppressor on chromosome 11q13
- Gene product menin interacts with transcription factors (e.g., lunD), functions as tumor suppressor gene • Diagnosis - Direct DNA sequencing • Mutations seen in S0-90% • Very labor intensive - Test selectively for mutation, if known
- If no mutation identified, can do linkage analysis • Management - Screen with special clinical attention to endocrine system - Lab tests for hormone production, gluco se, and calcium - Imaging of pituitary
459
18-12
Molecular Genetic Pathology
Multiple Endocrine Neoplasia, Type 2 MEN2A (Sipple Syndrome), MEN2B, and Familial Medullary Thyroid Cancer (MTC) • Overview - Autosomal dominant-related group of syndromes with an incidence of 1130,000 - Chara cterized by medullary thyroid carcinoma and other features
- Binding of ligands leads to dimerization of the receptors and activation of tyrosine kinase - Oncogene-activating point mutations lead to gain-offunction by cell membrane receptor tyrosine kinase (able to phosphoryl ate tyrosine in the absence of binding by GDNF or neurturin ) - Interestingly, 25% of patient s with Hirschesprung disease have germline mutation s in RET gene, leading to loss of protein function • Diagno sis - Genetic Testing by direct gene sequencing
• Clinical and pathologic feature s MEN2A
- Targeted mutation analysis
MTC
• MEN2A mutation
• Hyperparathyroidism • Pheochromocytoma • Phenotype seen at young age (- 30 years) - MEN2B
• Usually located around I of 5 cysteine residues in the extracellular domain between amino acids 609-634 • Exon s 10, II often involved
• MTC • Marfanoid habitus
• MEN2B mutation • M918T substitution in tyrosine kinase region of exon 16 (ATG to ACG at codon 918 ) (95%)
• GangliomaslNeuromas
• A883F in exon 15 recently characterized
• Pheochromocytoma • Phenotype seen at young age (30 years), maybe even younger than MEN 2A patients - Familial MTC • MTC • Tumor occurs at slightly older age than MEN2 • Genetic s - Due to mutation in RET protooncogene on chromosome IOq11.2 - RET product is a cell membrane receptor tyrosine kinase Ligands include glial cell lined-derived neurotrophic factor (GDNF) and neurturin
• MTC mutation • Usually around one of 5 cysteine residues in the intracellular regions at amino acids 768 and 804 in exons 10, II, similar to MEN2A - Linkage analy sis • Used when RET mutation not identified • Required at least two affected family members • Accuracy of over 95% • Management - Prophylactic thyroidectomy before age 5 - Urine or plasma catecholamine screening - Abdominal imaging
VON HIPPEL-LiNDAU SYNDROME • Overview - Tumor syndrome characterized by multiple vascularrich tumors - Autosomal dominant with nearly 100% penetrance - Incidence is about 1135,000 - Decreased life-expectancy (50 years ), with renal cell carcinoma most common cause of death • Clinical and pathologic features - Endolymphatic sac papillary adenocarcinoma (10%) (it may cause deafness) - Central nervou s system (CNS) hemangioblastomas (cerebellum, spinal cord, and retina), most common presenting symptom (40%)
460
- Clear cell renal cell carcinoma - Renal and pancreatic cysts - Pancreatic endo crine tumors Pheochromocytomas Papillary cystadenoma of the epididymi s or broad ligament of the uterus - Retinal angiomas • Genetics - 98% of cases due to inherited mutation in VHL gene ; 2% due to new mutation - VHL tumor suppressor gene at chromosome 3p25, consisting of 3 exons
Familial Cancer Syndromes
18-13
- VHL gene product has two form s, each produced by alternative splicing, which block elongation during transcription; both function as tumor suppressor gene - VHL gene product forms complex with elongin Band C to get rid of hypoxia induced factor-I a - With mutation in VHL, hypoxia induced factor-la builds up and induces production of vascular endothelial growth factor - Missense mutations are often associated with pheochromocytoma (VHL type 2) • Diagnosis - Von Hippel-Lindau can be diagnosed clinically or by molecular methods
Clinical Diagnostic Criteria
• For a diagnosis of vHL, patient must have: - One feature from category A and one from category B - Two features from category A - A family history of vHL and one feature from category A or B When the clinical criteria are not met and there is strong suspicion for the disease, genetic sequencing may be used . This is extremely accurate and detects small mutations. • Management In individuals at risk, molecular testing is recommended to identify the presence of mutations. Those found to be negative could avoid costly screening . - Annual physical, including eye examination - CNS magnetic resonance imaging
Category A
Category B
-
Abdominal ultrasound, beginning in the mid-teens
Retinal hemangioblastomas
Pheochromocytomas
- Urine or plasma catecholamines
Cerebellar hemangioblastomas
Pancreatic cysts
- Annual imaging of pancreas and kidneys
Spinal hemangioblastomas
Epididymal cystadenoma Renal cysts Renalcarcinoma (clear cell)
GENODERMATOSES Hereditary Melanoma • Significance - Genetic predisposition is very heterogeneous - Accounts for 10% of melanoma - About 3000 of the 30,000 diagnosed cases each year are due to increased susceptibility within families (i.e., environment plus multiple genetic risk factors) - Smaller percentage due to familial melanoma! dysplastic nevus syndromes - The majority of these familial melanoma syndromes are autosomal dominant • Clinical and pathologic features - Up to 2/3 may develop melanoma by age 80 - Some kindreds have increa sed risk of other cancers • Breast • Pancreas - Multiple dysplastic nevi - Melanoma • Genetics - CDKN2A gene (pI6, INK4A) on chromosome 9p21
• Mutations in CDKN2A are found in about 50% of cases • Gene products are p 14 and p 16 proteins • p 16 tumor suppressor inhibits cyelin D lIcdk4 and stops cell cycle at G /S • pl4 complexes with p53 or pRb to lead to cell cycle arrest at G I or G, • pl4 also binds to mdm2 to prevent p53 destruction • mdm2 facilitates transport of p53 from nucleus to the cytoplasm where p53 was degraded - CDK4 on chromosome 12ql3 • CDK4 phosphorylates pRB, which leads to release of the pRB-bound transcription factor, E2F • Diagnosis - Mainly on clinical grounds - Genetic testing • Limited predictive value • Available but difficult to assess due to genetic heterogeneity • Management - Increased surveillance - Avoid sun exposure
461
18-14
Molecular Genetic Pathology
Birt-Hogg-Dube Syndrome • Overview - The first description of an affected family was provided by Birt, Hogg, and Dube in 1977 - Birt-Hogg-Dube (BHD) syndrome is a rare genetic disorder characterized by inherited predisposition to hamartomatous skin lesions (cutaneous fibrofolliculomas), spontaneous pulmonary cysts, and renal carcinoma, and transmitted in an autosomal dominant fashion • Clinical - BHD is a rare autosomal dominant syndrome characterized by a triad: • Cutaneous lesion tend to appear in the third or fourth decade of life as a group of three skin tumors-the fibrofolliculoma, trichodiscoma, and acrochordon • Fibrofolliculoma is characterized by multiple perifollicular fibromas on the face, neck, and trunk . It is consisted of a circumscribed proliferation of collagen and fibroblasts surrounding distorted hair follicles from which basaloid cells protrude into the surrounding fibromucinous stroma. Whether these lesions are neoplastic or a result of hair follicle malformation is uncertain • Trichodiscoma is consisted of interwoven fascicles of fine fibrillar collagens embedded in alcian blue-positive mucinous ground substance. It is generally considered a hamartoma • Acrochordon (skin tag) is a benign skin lesion which consists of a benign skin that projects from the surrounding skin. The lining epidermis may display hyperkeratosis, acanthosis, and papillomatosis. The stroma may be edematous, vascular or fibrotic. • Renal tumors • Kidney tumors in BHD syndrome occur earlier than sporadic tumors, and are usually multiple and bilateral • Most commonly oncocytomas and chromophobe renal cell carcinomas (39%) • Clear cell and type I papillary renal cell carcinoma also common (10%) • Hybrid oncocytic tumors which are characterized by histologic features similar to both chromophobe renal cell carcinoma and oncocytoma (50%) • Pneumothorax • The incidence of pulmonary cysts or spontaneous pneumothorax in BHD syndromeaffected individuals is about 90% but only a fifth will have spontaneous pneumothorax
462
• The typical morphology of pulmonary cyst is characterized by thin walled cystic dilatation of alveolar spaces lined by cuboidal epithelium, ranging from microscopic foci to a few millimeters in diameter with no obvious fibrous or smooth muscle tissue in the wall • Pneumothorax may develop when cysts rupture under pressure • Patients may also suffer from colonic polyps and colorectal cancer - Clinical manifestations usually begin in 20-30's The male-to-female ratio is 2: I • Genetics - BHD gene (also known as FLCN) was located to chromosome 17p12q11.2 in 2001. A the 579-amino acid BHD gene product, folliculin was cloned later - All FLCN/BHD germline mutations identified in BirtHogg-Dube (BHD) patients are predicted to truncate the mutant protein, including frameshift (insertions/deletions), nonsense and splice-site mutations - Cytosine insertions or deletions in a mononucleotide repeat tract containing 8 cytosines within exon II , which result in an abnormally small, non-functional folliculin protein, are the most frequent constitutional mutations found, being detected in approximately 50% of BHDS families - Other mutations located elsewhere in the coding sequence are heterogeneous. Overall , point mutations in th BHD gene are found in approximately 80% of BHD cases • Diagnosis - Clinical criteria using classic features included the skin fibrofolliculomas, trichodiscomas, and acrochordons together with an increased risk of renal tumors and spontaneous pneumothoraces - Skin biopsy is necessary to confirm the diagnosis of characteristic skin lesions seen in BHD patients (trichodiscomas, fibrofolliculomas, and perifollicular fibromas) . Adults with a positive skin biopsy result should also undergo renal ultrasound, abdominal CTIMRI, chest x-ray and colonoscopy to determine if there are additional diseases - FLCN (BHD) is the only gene known to be associated with Birt-Hogg-Dube syndrome. Sequence analysis detects mutations in the FLCN gene in 84% of affected individuals and is available in few laboratories • Management - There is no specific treatment for this syndrome - Laser ablation of tissue lessions results in substantial improvement, but relapse usually occurs
18-15
Familial Cancer Syndromes - Nephron-sparing surgery is the treatment of choice when possible for renal tumors but nephrectomy may be necessary in some cases
PTEN-Associated Multiple Hamartoma Syndrome (Cowden Syndrome)
- Surveillance for renal cell carcinoma is especially important for at-risk individuals and relatives
• Overview - Autosomal dominant multiple hamartomatous syndrome with almost 100% penetrance
- Use of molecular genetic testing for early identification of at-risk family members improves diagnostic accuracy and reduces costly screening procedures
- Incidence of 11200,000 • Clinical and pathologic features - Phenotypic expression both within and between kindreds is extremely variable
Carney Complex
- Majority of those affected show features by age 20
• Overview Very phenotypically heterogeneous
- Macrocephaly in 30%
Autosomal dominant syndrome with early age of onset, often infancy - The majority of the neoplasms associated with the syndrome are benign, but life-expectancy is decreased
- Mental retardation in 10% - Multiple gastrointestinal hamartomas - Skin lesions • Include hyperkeratotic oral papules, facial trichilemmomas, acral keratosis - Risk for certain tumors
- Cardiac complications most common cause of death and may result in sudden death
• Cerebellar gangliocytic tumors • Endometrial cancer
• Clinical and pathologic features - Cutaneous pigmented lesions
• Thyroid follicular tumors • Breast
• Blue nevi
• Fibroadenomas
• Lentigines
• Carcinomas (25-50%)
- Cutaneous, breast, and cardiac myxomas • 5-10% of cardiac myxomas may be due to Carney complex - Psammomatous melanotic schwannomas (benign or malignant) • Gastrointestinal • Paraspinal - Large cell calcifying Sertoli cell tumors of the testis - Endocrine disorders • Primary pigmented nodule adrenocortical disease • Thyroid carcinoma • Pituitary tumors - Breast adenomas • Genetics - Mutation in PRKARIA gene on chromosome 7q23-24 seen in 50% - RKAR IA binds cAMP and regulates protein kinase A • Diagnosis - Clinical features - Mutational analysis of PRKAR IA gene • Management - Cardiac echo starting in infancy - Endocrine tests including cortisol, growth hormone - Thyroid and testicular ultrasound
• Genetics - Phosphatase and tensin homolog gene (PTEN) is a tumor suppressor gene on chromosome IOq22-23.3 - PTEN protein acts as a dual-specificity protein and lipid phosphatase • Converts PIP3 to PIP2 • Dephosphorylates tyrosine and serine/threonine - Mutation results in unchecked cell cycling - Most common area for mutation is in exon 5 • Diagnosis - Clinical criteria -
PTEN gene sequencing
• Management - Increased surveillance
Nevoid Basal Cell Carcinoma Syndrome (Gorlin Syndrome) • Overview Autosomal Dominant syndrome with almost 100% penetrance and variable expression - Incidence of about 1150,000 • Clinical features Diagnostic criteria: two major criteria or one major and two minor criteria
463
18-16
Molecular Genetic Pathology
• Major criteria • Family history of the disease • Multiple basal cell carcinomas • Basal cell nevi • Palmar or plantar pits • Odontogenic keratocyst • Ectopic calcifications • Minor criteria • Skeletal abnormalities including bifid, fused or absent ribs or vertebrae • Macrocephaly (>97%ile) • Ovarian fibroma • Medulloblastoma • Cleft lip or palate • Polydactyly
• Genetics - PTCH gene on chromosome 9q22.3 - Gene product is a transmembrane receptor for signaling b the hedgedog molecule
- Involved in cell growth, gene also has role in DNA maintenance and mutations lead to chromosomal instability Mutations are usually truncations • Diagnosi s - Based mainly on clinical features above - Molecular testing via linkage or sequencing • Management Increased and earlier surveillance Avoid radiation therapy in treatment of associated tumors due to increased risk of secondary tumors (controversial)
NEUROFIBROMATOSIS TYPE 1 (VON RECKLINGHAUSEN SYNDROME) • Overview - Relatively common autosomal dominant inherited disorder with a high degree of penetrance - Half of all cases are due to a new mutation Incidence is I in 3000 -
I in 200 mentally handicapped patients have the disorder
• Clinical and pathologic features The phenotypic expression is variable. Clinical features include the diagnostic criteria below and are often accompanied by learning difficulties or mental retardation. - Clinical diagnosis criterias, at least 2 of the following : • One plexiform neurofibroma or 2 neurofibromas • Six or more cafe au-lait spots • Two or more melanocytic iris hamartomas (Lisch nodules) • Axillary or inguinal freckling • Optic nerve glioma • Specific bone abnormalities • Family history of NF • Up to 5% can develop malignant peripheral nerve sheath tumors
464
• Slightly increased risk of childhood myelodysplastic syndromes, chronic myelogenous leukemia (CML) • Genetics - Mutation in the NFl tumor suppressor gene on chromosome 2p22-p21 - Gene product is neurofibromin, a GTPase-activating protein • Normally regulate RAS-like G protein • Loss-of-function leads to accumulation of ras-GTP • Diagnosi s - Mainly based on clinical criteria - Molecular methods • Sequence analysis • Targeted mutation analysis • Linkage analysis • FISH - Prenatal testing available • Management - Supportive - Surgery when needed - Monitoring for malignant transformation
Familial Cancer Syndromes
18-17
NEUROFIBROMATOSIS TYPE 2 • Clinical - Autosomal dominant condition affecting I in 40,000 - Characterized by acoustic schwannomas, meningiomas, ependymomas, and (rarely) astrocytoma s • Genetics - Due to mutations of NF2 gene on chromosome 22ql2 - Gene product is neurofibromin 2 (merlin) , related to a family of cytokeratin-membrane protein and tyrosine kinase
- Functions as tumor suppressor gene in maintaining cellular integrity • Diagnosis Clinical - Mutation analysis • Treatment - Close surveillance and surgery
TUBEROUS SCLEROSIS COMPLEX • Overview - Autosomal dominant complex with markedly variable expression resulting in tumors of multiple organs including the CNS , skin, kidney, and heart - Relatively common with an incidence of up to I in 6000 - 2/3 of cases of TS are due to new mutations in one of two genes - CNS disease is the leading cause of death - 80% of patients have seizures and 50% have developmental delay • Clinical - Major criteria • • • • • •
Cortical tubers (70% of patients) Subependymal glial nodules (90%) Cardiac rhabdomyomas (50%) Subependymal giant cell astrocytomas (10%) Renal angiomyolipomas Other findings include periungual fibromas, hypopigmented macules, Shagreen patch , multiple retinal hamartomas, Iymphangiomatosis
- Minor criteria • Non-renal hamartomas • Renal cysts
• Dental enamel pits • Gingival fibromas • Genetics
- TSCI on chromosome 9q34 produces protein hamartin
TSC2 on chromosome 16p13.3 produces protein tuberin - Both TSCI and TSC2 are large genes with a high mutation frequency Hamartin and tuberin form a dimer that functions in b-catenin, calmodulin, mitogen-activated protein kinase (MAPK), and other signaling pathways • Diagnosis Based on clinical criteria - Due to heterogeneity of expression of disease, molecular diagnosis via sequence analysis or FISH can be attempted • Very complicated • Large genes • Multiple small mutations • Management CNS imaging in diagnosed patients Anticonvulsants Abdominal imaging for renal tumors
SUGGESTED READING GeneTests-www.genetests.org. Online Mendelian Inheritance in man (OMIN)-www.ncbi.nlm.nih.gov. August 15, 2007
Abdel-Rahman WM, Mecklin JP, Peltomaki P. The genetics of HNPCC: application to diagnosis and screening. Crit Rev OneolHematol. 2006;58: 208-220.
Abdel-Rahman WM, Peltomaki P. Molecular basis and diagnosis of hereditary colorectal cancers. Ann Med. 2004;36:379-388.
Bornstein SR, Glmenez-Roqueplo AP. Genetic testing in pheochromocytoma: increasing importance for clinical decision making. Ann NY Aead Sci. 2006;1073:94-103 .
465
18-18
Molecular Genetic Pathology
Carney JA. Familial multiple endocrine neoplasia : the first 100 years . Am J Surg Pathol. 2005;29:254--274.
Lackner C, Hoefler G. Critical issues in the identificationand management of patients with hereditary non-polyposiscolorectal cancer. Eur J Gastroenterol
Frank TS, Deffenbaugh AM, Reid JE, et al. Clinical characteristics of individuals with germline mutations in BRCA I and BRCA2 : analysis of 10,000 individuals. J Clin Oneol. 2002;20:1480-1490.
Lindor NM, Greene MH. The concise handbook of family cancer syndromes. Mayo Familial Cancer Program. J Natl CancerInst. 1998;90:1039-1071.
Garber J, Offit K. Hereditary cancer predisposition syndromes. J ClinOneol. 2005;23:276-292. Hemminki K, Eng C. Clinical genetic counselling for familial cancers requires reliable data on familial cancer risks and general action plans . J Med Genet. 2004;41 :80 1- 807. Kaz AM, Brentnall TA. Genetic testing for colon cancer. Nat Clin Pract
Gastroenterol Hepatol. 2006;3:670-679. Khoury-Collado F, Bombard AT. Hereditary breast and ovarian cancer: what the primary care physician should know. Obstet GynecolSurv. 2004; 59:537-542. Lenz HJ. First Amsterdam, then Bethesda, now Melbourne? J Clin Oncol. 2005;23:6445- 6449.
466
Hepatol. 2005;17:317-322.
Lux MP, Fasching PA, Beckmann MW. Hereditary breast and ovarian cancer: review and future perspectives. J Mol Med. 2006;84:16-28 . Nagy R, Sweet K, Eng C. Highly penetrant hereditary cancer syndromes.
Oncogene 2004;23:6445-6470. Roach ES, Sparagana SP. Diagnosis of tuberous sclerosis complex. J Child
Neurol. 2004;19:643-649. Woodward ER, Maher ER. Von Hippel-Lindau disease and endocrine tumour susceptibility. Endocr Relat Cancer 2006;13:415-425. Zbar B, Glenn G, Merino M, et aI. Familial renal carcinoma: clinical evaluation,clinical subtypes and risk of renal carcinoma development.J Urol. 2007;177:461-465.
19 Molecular Testing for Solid Tumors Neal I. Lindeman,
MD and
Paola Dal Cin,
PhD
CONTENTS
I. General Concepts Clinical Features Molecular Genetic Pathology Molecular Diagnostics Test Indications Gener al Technical Considerations Basic Methodologies
II . Specific Sarcomas Alveolar Rhabdomyosarcoma Alveolar Soft Part Sarcoma Clear Cell Sarcoma (Melanoma of Soft Parts) Congenital (Infantile) Fibrosarcoma Dermatofibrosarcoma Protuberans Desmoplastic Round Cell Tumor Endometrial Stromal Tumors Ewing Sarcoma Inflammatory Myofibroblastic Tumors Low-Grade Fibromyxoid Sarcoma
19-2 19-2 19-3 19-4 19-4 19-4 19-5
19-8 19-8 19-10 19-10 19-11 19-11 19-12 19-13 19-14 19-15 19-16
Extraske1etal Myxoid Chondrosarcoma Myxoid Liposarcoma Synovial Sarcoma
III. Specific Carcinomas
19-17 19-18 19-18
19-20
Breast Cancer Bladder Cancer Cervical Cancer Colorectal Cancer Lung Cancer Other Carcinomas Renal Cancer Thyroid Cancer
19-20 19-21 19-22 19-23 19-25 19-27 19-27 19-27
IV. Other Solid Tumors
19-27
Gastrointestinal Stromal Tumor (GIST) Oligodendroglioma
V. Suggested Reading
19-27 19-28
19- 28
467
19-2
Molecular Genetic Pathology
GENERAL CONCEPTS
Table 1. Specific Chromosomal Translocations in Sarcomas Tumors
Translocation
Molecular event"
Alveolar rhabdomyosarcoma
t(2;13)(q35;q 14) t(l; 13)(p36;q 14)
PAX3-FKHRb PAX7-FKHRb
Alveolar soft part sarcoma
t(X;17)(p11 .2;q25)
ASPL-TFE3
Clear cell sarcoma
t(l2;22)(q 13;q12) t(2;22)(q34;q12)
CREBI-EWSb
Congenital fibrosarcoma
t(l2 ;15)(p13;q25)
bETV6-NTRK3
Dermatofibrosarcoma protuberans
t(l7;22)(q22;q13)
COLlAI-PDGFB
Desmoplastic round cell tumor
t(ll ;22)(p13;q12)
WTI-EWSb
Endometrial stromal sarcoma
t(7;l7)(p15;q2l) t(6;7)(p21;pI5) t(6;1O)(p21;pll)
JAZFI-JJAZI PHFI-JAZFI PHFI-EPCI
Ewing sarcoma/PNETc
t(ll ;22)(q24;q12) t(21 ;22)(q22;q12)
bEWS-FLIl bEWS-ERG
Inflammatory myofibroblastic tumor"
t(2;19)(p23;pI3.1) t(l ;2)(q22-23;p23)
bALK-TPM4 TPM3-ALKb
Low-gradefibromyxoid sarcoma
t(7;16)(q33;pll) t(lI ;16)(pll ;pll)
bFUS-CREBL2 CREB3Ll-FUSb
Myxoid chondrosarcoma, extraskeletal
t(9;22)(q22;q12) t(9;17)(q22;qII) t(9;15)(q22;q21)
CHN-RBP56 CHN-TCFI2
Myxoid liposarcoma
t(12;16)(q13;pll) t(l2 ;22)(q13;q12)
bFUS-CHOpb bEWS-CHOpb
Synovial sarcoma
t(X;18)(pll ;qll)
bSYT-SSXI bSYT-SSX2
ATFI-EWSb
CHN-EWSb
"Gene nomenclature changes more rapidly than pathological terminology bOual color, break apart probes available commercially 90%) homology to one another. Rare cases of SSX4-SIT fusions have also been reported • Chromosomal variant: a single case of t(X;20)(pll ;qI3), with an SSXI-SSI9Ll fusion being reported
Molecular Diagnostics • Indications for molecular genetic testing : - Establish diagnosis: classic biphasic lesions are generally straightforward to diagnose, but monophasic and poorly differentiated lesions may require cytogenetic and/or molecular tests - Prognosis: this is controversial, as early studies suggested that SIT-SSXI fusions have significantly worse prognosis (survival-40% vs -80% for SIT-SSX2),
but more recent data has shown that there is no association between fusion type and outcome when a three-part histologic grading scheme is used • Additional technical considerations: - Karyotype : rare variant translocation or marker chromosomes can occur - FISH: commercial breakapart probe for SIT is available (Abbott Molecular/Vysis Inc.), but cannot distinguish SIT-SSXI from SIT-SSX2 - RT-PCR is required to distinguish SIT-SSXI from SIT-SSX2 transcripts (see Figure 17) • Additional interpretive considerations: - Biphasic tumors have, almost exclusively, SIT-SSXI fusions - Monophasic tumors can have either fusion , but SITSSX2 fusions are more likely - Any synovial tumor with abnormal karyotype without a t(X;18) needs to be further investigated by FISH and molecular techniques - Cases have been reported of tumors with co-existing SIT-SSXI and SIT-SSX2 transcripts detected by RT-PCR
485
19-20
Mo lecular Genetic Pathology
'2
'2
N
N
CD
CD
:0-
:0x
CD
~
~
g
a.
CD
a.
CD
a.
a.
en
en
en
en
('II
E co
E co
,,
E.('II
CD
E co
,,
'2
'2
N
N
CD
CD
CD
:0-
:0-
g
CD
CD
~
~
~
a.
CD
a.
CD
a.
a.
en
en
en
en
E co
E co
CD
('II
E co
('II
CD
CD
E co
E co
~
-.
-
·:~••'·i .. ~
SSX2-SYT
SSX1-SYT
Fig. 17. RT-PCR of synovial sarcomas. The two gels show RT-PCR analysis of two cases (I and 2), using paired reactions for the
SSXI-SYJ and SSX2-SYJ fusion transcripts, from both frozen and formalin-fixed paraffin-embedded tissues. All samples were tested in duplicate. The frozen sample s each showed RT-PCR amplification of fusion transcripts with one set of primers, indicating which variant of translocation was present, but amplification failed for paraffin-embedded tissues from the same cases. It is not uncommon for fixed tissue sections to show poor amplification in RT-PCR assays, presumabl y due to degradation of RNA.
SPECI FIC CARCI NOMAS A comprehensive review of all molecular genetic alterations in carcinomas is beyond the scope of this text, and the interested reader is referred to several excellent texts on the subject. What follows is a selected list designed to highlight the variety of abnormalities and techniques employed in molecular diagnosis of carcinomas.
Breast Cancer Basic pathology: malignant neoplasms of the cuboidal mammary gland epithelium, seen frequently in women but rarely in men. Approximately 80% are invasive ductal carcinoma, with several variants, but basic pattern is formation of lumen-bearing tubular or ductular structures by the cancer cells, bereft of basal myoepithelium, with varying degrees of central necrosis and solid filling of the luminal spaces. Invasive lobular carcinoma accounts for approximately 10% of cases, and characteristically infiltrates the stroma as single-file lines of cells. • Clinical feature s: - The most common malignant neopla sm in women : approximately 1 in 8 American women will develop breast cancer in their lifetime, and risk increa ses with age (mean age - 60) - Most (- 95%) case s are spor adic, although some are associated with hereditary syndromes, particularly in younger women and in males - Palpable, non-mobile, firm mass in the breast , or can be detected in asymptomatic patients during routine screening mammography
486
- Treatment (and prognosis) is variable, depending on histologic subtype, grade, stage, and clinical variables, but can include simple surgical excision, radical excision with lymph node dissection, radiation, chemotherapy, hormonal therap y, and targeted therapy for specific molecular alteration • Molecu lar genetic pathology : numerous molecular genetic alterations occur in breast cancer, two of which will be discussed here : amplification of ERBB2 (HER2 , NEU) , and mutation in BRCAI and BRCA2 - ERBB2 (HER2, NEU) gene (at 17q21) • Receptor tyrosine kinase involved in growth signaling, related to epiderma l growth factor receptor (EGFR/HERI ) • Gene amplification and protein overexpression, leading to oncogenic activation, is seen in approximately 30% of invasive ductal carcinomas • Amplification/overexpre ssion of ERBB2 is associated with aggressive clinical course, resistance to Taxol chemotherapy, lack of estrogen receptor expression , resistance to anti-estrogen therapy, and favorable respon se to targeted therap y (Herceptin; trastuxumab) against the ERBB2 receptor protein - BRCAI (at 17q21) and BRCA2 (at 13qI2.3) • Probable TSGs, who se functions are still being determined , but appear to include transcriptional regulation , apoptosi s, and DNA repair
Molecular Testing for Solid Tumors
• Gennline mutations are found in most (-95%) patients with hereditary breast and/or ovarian cancer syndromes. BRCAI mutations are found in approximately 80% of families with breast/ovarian cancer. BRCA2 mutations are found in approximately 15% of families with breast/ovarian cancer, but in 75% of families with both male and female breast cancer • Somatic BRCAI and BRCA2 mutations are very rarely found in sporadic breast carcinomas • Over 300 mutations have been reported in BRCAI, a 70 kb gene, with 22 exons encoding a 7.8 kb mRNA. Over 100 mutations have been reported in BRCA2, a 70 kb gene with 26 exons encoding an 11-12 kb mRNA • Although no mutations account for more than approximately 10% of mutations, a few recurrent mutations have been described in restricted populations: I85de1AG, 5382insC (BRCAl), and 6 I74deiT (BRCA2) in Ashkenazi • 999del5 (BRCA2) in Icelanders • Most (-75%) BRCAI and BRCA2 mutations lead to •
truncated protein, by diverse mechanisms (nonsense , frameshift, microdeletionlinsertion, splice variant). Missense mutations are of uncertain significance • Women with BRCAI mutations have an approximately 60-90% lifetime risk of breast cancer and approximately 20-60% lifetime risk of ovarian cancer; risks of cancer in patients with BRCA2 mutations are comparable, or slightly lower. Men with BRCAI mutations are at increased risk of prostate cancer • Other molecular abnormalities in breast cancer: - Ras proteins are overexpressed in approximately 60%, but mutations are only seen in approximately 6% - TP53 mutations are seen in approximately 40% of cases - RBI underexpression is seen in approximately 10-45% of cases, with loss of heterozygosity (LOH) in approximately 25%
- CCNDI (Cyclin DI) amplification is seen in approximately 15-20% of cases
- PTEN is rarely mutated in breast cancer outside of Cowden's syndrome
Molecular Diagnostics • ERBB2: - Test indications: therapeutic selection, as patients with amplificationloverexpression of ERBB2 are treated with trastuxumab (Herceptin), a formulation of antibody directed against the ERBB2 receptor - Additional technical considerations: • Immunohistochemistry is more sensitive and technically simpler, but prone to errors due to
19-21
subjective interpretation and cross-reactivity of antibodies • FISH/CISH is more specific, but technically more challenging, and controversy exists concerning the means of scoring/interpretation • Real-time PCR is not commonly performed
• BRCAI and BRCA2: - Test indications: risk assessment in patients with familial breast/ovarian cancer syndromes; some patients choose to undergo prophylactic surgery after learning that they carry a BRCAI/2 mutation - Additional technical considerations: BRCAI and BRCA2 are the intellectual property of Myriad Genetics (Salt Lake City, UT) who performs direct sequence-based testing for these mutations
Bladder Cancer Basic pathology: malignant neoplasia of the transitional epithelium of the urinary bladder. 95% of American bladder cancers are transitional cell (urothelial) carcinomas. Biopsy samples are generally straightforward, as are high-grade cytology samples, but cytologic diagnosis of low-grade cancers is extremely challenging. • Clinical features: - Fourth most common cancer in men, 10th in women, with approximately 50,000 new cases/year in the United States - Risk factors include tobacco smoke, occupational exposure to aromatic amines, and possibly, caffeine and artificial sweeteners - Most common presentation is painless hematuriaeither gross or microscopic - 80% of cases are superficial and non-invasive: these cancers are treated transurethrally, with local fulguration or excision, and intravesical adjuvant therapies including chemotherapy and attenuated Bacille Calmette-Guerin; prognosis is very good for noninvasive cancers, although a field effect is assumed, and recurrence by re-seeding of other sites on the bladder mucosa is common and requires frequent monitoring - Invasive bladder cancers require surgical resection, and metastatic cancer is treated with chemotherapy • Molecular genetic pathology: - Homozygous deletion of the TpI6(pI6{INK4]COKN2) tumor suppressor gene at 9p21 is a very common , early finding in bladder cancers, particularly in non-invasive papillary lesions - Progression of bladder cancer is characterized by genomic instability and aneuploidy, which commonly includes polysomies of chromosomes 3, 7, 9, 11, and 17
Molecular Diagnostics • Test indications: minimal disease testing - Monitoring patients with non-invasive bladder cancer for intravesical relapse . Molecular diagnostic testing of
487
19-22
urine is more sensitive than cytology, particularly for low-grade cancers - General population screening has not gained widespread acceptance • Additional technical considerations: - UroVysion(Abbott Molecular/Vysis Inc.) is an Food and Drug Administration (FDA)-approved commercial kit that enables FISH analysis of 9p21 and the centromeres of chromosomes 3, 7, and 17 - Evaluate 25 morphologically atypical cells on slide; a positive result is 5 or more cells with >2 copies of chromosomes 3, 7, or 17, or >12 cells with homozygous 9p21 deletion • Additional interpretive considerations: - Aneuploidy may be seen in rare single cells in normal urine, particularly single-chromosome monosomies and trisomies. Hemizygous deletion of 9p21 is also seen in normal urine - Specificity is increased if: • Higher-order polysomy (4+ copies) is observed • Involving several chromosomes • In several (>5) cells • And only homozygous deletion of 9p21 is interpreted as positive - Polysomy of chromosome 7 is most sensitive for carcinoma in situ and invasive cancer, while 9p2l deletion is most sensitive for non-invasive papillary carcinoma
Cervical Cancer
Molecular Genetic Pathology
are treated with combinations of surgery, radiation, and chemotherapy, depending on the stage of disease and other clinical conditions • Molecular genetic pathology: HPV genome is found in essentially all (>99%) cases of squamous cervical cancer • HPV has a double-stranded, circular, 8 kb DNA genome, with> I00 different genotypes based on sequence variation in LJ gene, which encodes the major capsid protein; about 30 genotypes have tropism for the anogenital mucosa • Different genotypic strains of HPV have differing abilities to transform infected host cells, based upon their ability to integrate into the host genome • High-grade lesions typically have integration of the HPV genome into the host genome, and highrisk strains (e.g., HPV-16, 18,31,33, and 45) are better able to integrate into the host • Low-grade lesions typically have HPV genomes that remain in the cytoplasm as circular episomes, and low-risk strains (e.g., HPV-6, II) are not able to integrate into the host • Integration disrupts the HPV open reading frame, leading to continued expression of E6 and E7 oncogenes: • HPV E7 oncoprotein binds activated pRb tumor suppressor protein, releasing inhibited downstream transcription factors and stimulating cell cycle progression. E7 from low risk strains has lower binding affinity for pRb • HPV E6 oncoprotein binds p53 tumor suppressor protein, initiating its ubiquitination and subsequent degradation in the proteasome, leading to a stimulation of the cell cycle and inhibition of apoptosis. E6 from low-risk strains has low affinity for p53 and does not target it for ubiquitin-mediated destruction
Basic pathology: dysplasia/neoplasia of squamous epithelium of the uterine cervix, usually due to venereal infection with human papillomavirus (HPV) . Cytologic diagnosis of exfoliated cells (Pap smear) is straightforward for advanced lesions, but subtle lesions (atypical squamous cells of uncertain significance) have features indeterminate between early dysplasia and benign reactive change, and present a diagnostic and management dilemma.
Molecular Diagnostics
• Clinical features: Second most common cancer in women worldwide, but much less common in America due to general population screening (Pap smear) and early intervention
• Test indications: - Classification of morphologically indeterminate lesions (i.e., atypical squamous cells of uncertain significance)
Common presentation in the United States is as a premalignant epithelial change detected by routine screening in an asymptomatic woman - Risk factors include sexual intercourse at a young age, intercourse with multiple partners, intercourse with partners who engage in high-risk sexual behavior, and other venereal infections - Pre-malignant lesions and in situ carcinoma are treated with local excision, observation, and hysterectomy if childbearing is not desired and local excision fails to establish long-term disease control. Malignant lesions
488
- Universal screening is controversial: quality is less operator-dependent than cytology, but cost is higher • Additional technical considerations: - Several commercial products are available, including PCR-based methods and non-PCR-based methods; many labs use various "homebrew" methods as well - As of January 2006, Digene 's Hybrid Capture Assays are only FDA-approved methods. These assays use a cocktail of RNA probes to hybridize to different strains of HPV DNA from the clinical sample, and the resulting RNA:DNA hybrids are subsequently
Molecular Testing for Solid Tumors
19-23
characterized primarily by either genomic instability (-85 %) or defective DNA repair (-15%) APCtruncation
~--==:r---'
K-Ras mutation~~=::r---'
DCC deletion
TP53 inactivationl---
--i ICarcinomal
Fig . 18. Schematic representation of sequential genetic alterations in the progression from adenoma to carcinoma of the colon .
captured on a solid phase and visualized with labeled antibodies, in a manner analogous to an enzymelinked immunosorbent assay • Additional interpretive considerations: - There are many genotypes of HPV, and the sensitivity of different molecular methods is impacted not only by technical considerations, but also by the breadth of genotypes analyzed
Colorectal Cancer Basic pathology: adenocarcinoma of columnar epithelial cells that proliferate and invade adjacent tissues in neoplastic glandular acini or solid sheets. Tumors almost exclusivel y arise in the colon or rectum ; small intestinal adenocarcinoma is exceptionally rare. Tumor cells express CK20. • Clinical features : - Fourth most common cancer in the United States : approximately 130,000 new cases/year and approximately 55,000 deaths/year - Peak at age 75; colorectal cancer before 40 is uncommon except in hereditary cancer syndromes - Risk factors include adenomatous polyps, ulcerative colitis, family history of colorectal cancer, and several familial syndromes. Many dietary risk factors have been suggested, including low fiber and high fat, but none have been established - Asymptomatic patients detected by screening colonoscopy or stool occult blood. Symptomatic patients present with GI bleeding/anemia, constitutional symptoms, or bowel obstruction - Treatment (and prognosis) depends on stage and grade , and includes surgery, radiation , and chemotherapy • Molecular genetic pathology: there appear to be two different molecular pathways to colon cancer,
Colorectal Carcinoma ArisingFrom Genomic/Genetic Instability • Molecular pathogenesis of these colorectal carcinomas has been extensively studied by Bert Vogelstein and colleagues at Johns Hopkins, resulting in establishment of a paradigm of sequential carcinogenic alterations that have come to be known, colloquially, as "Vogelgrams" (see Figure 18) • Many of these alteration s were discovered as chromosomal or sub-chromosomal abnormalities (i.e., LOH), but subsequent studies have shown smaller genetic alterations (i.e., point mutations) as well • APC gene (at 5q2l)
- Tumor suppressor protein that interacts with ~ catenin, an adherens junction protein involved in mediating intercellular adhesion as well as mediating transcription through several intracellular signaling pathways. Colorectal carcinomas that lack APC mutation often have amplification or activating mutation of ~-catenin (CTNNB) - APC mutation is believed to be a very early event in carcinogenesis because APC mutations are found with
comparable frequency in benign adenomas and invasive carcinomas, and also in microscopic foci of epithelial dysplasia - Germline mutations in APC are a consistent finding in the familial adenomatous polyposis (FAP) syndromes, with phenotype predicted by genotype : • Classic FAP: mutations between codons 169 and 1600 • Attenuated FAP: mutation s in N-terminu s, before codon 157 • Congenital hypertrophy of the retinal pigment epithelium (CHRPE) variant: truncating mutations between codons 463 and 1387 • Extracolonic manifestations: mutations between codons 1403 and 1387 - APC mutations are also very common (-80%) in sporadic colorectal carcinomas • Generally, both allelesare mutated in colorectal carcinoma,or the wild type allele may be deleted (LOH) • Many different mutations are seen, but most (>95%) lead to protein truncation , usually by nonsense point mutation (40%), frameshift due to small deletion (40%) or insertion (12%), or rare splice mutations (7%)
• KRAS gene (at l2p12) Ras molecules (K-Ras, N-Ras, H-Ras) are GTPbinding proteins involved in growth receptor signal transduction, and activating mutations lead to increased cell proliferation by the mitogen activator protein-kinase pathway
489
19-24
- KRAS mutations are seen in approximately 40% of colorectal carcinomas and large adenomas with foci of in situ carcinoma, but rarely in early adenomas, suggesting that they are associated with an intermediate stage of progression from adenoma to carcinoma - Most (80%) KRAS mutations are codon 12 point mutations (GGT to GAT/GTT); most of the rest involve point mutations in codon 13 or 61 of KRAS • DCC gene (at 18q21) - Locus 18q21 is frequently deleted in sporadic colorectal carcinoma (-75%) and late adenomas (-50%), but rarely in early adenomas, suggesting a role late in progression from adenoma to carcinoma
Molecular Genetic Pathology
- 30% have MLHI mutation • The defect in DNA repair is manifested as microsatellite instability (MSI), in which errors made during replication of small repeat sequences are not repaired, leading to diversification of the numbers of repeats seen in different cells; expansion of these repeats may lead to gene inactivation • Germline mutation in one of these genes is associated with increased risk of colorectal cancer (-80%), and of endometrial cancer in women • These mutations are common, seen in approximately 0.1-0.5% of the general population, and in approximately 3% of all colorectal carcinomas
- Several putative TSGs reside in this locus, of which DCC most frequently shows mutation in the nondeleted allele
• MSI is more frequent in colorectal carcinoma than are mutations in the known DNA repair genes, however, and is seen approximately 15% of all colorectal carcinomas
- DCC is believed to playa role in intercellular adhesion due to its sequence homology to the cell adhesion molecule NCAM
Molecular Diagnostics
• TP53 gene (at 17p13)
- p53 is a tumor suppressor protein with critical roles in basic cellular processes, including cell cycle progression and apoptosis TP53 mutation is very common in cancers of many different types TP53 mutations are very common (-70%) in sporadic
colorectal cancers, but rare in adenomas, suggesting that TP53 mutation is a late event in the progression from adenoma to carcinoma Germline TP53 mutation is seen in Li-Fraumeni syndrome, which has many associated cancers , but not colorectal carcinoma TP53 may be inactivated by many different mechanisms in cancer, including large deletion, truncating mutation, missense mutation, viral oncogene-mediated suppression, and activation of upstream oncogenic regulators "Hotspots" are in exons 4 through 8, especially codons 175, 245, 248, 273, and 282
Colorectal Carcinoma Arising in a Setting of Defective DNA Repair • Basic discoveries were made in patients with hereditary non-polyposis colon cancer (HNPCC) syndromes, which is a bit of a misnomer: patients with HNPCC can have polyps, they don 't have thousands of polyps, as in the polyposis syndromes • Mutation seen in one of six genes (MLH1, MSH2, MSH3, MSH6, PMSI, PMS2) whose proteins are involved in repairing errors made during DNA replication - 60% have MSH2 mutation
490
• Test indications: - Early detection of cancers associated with genomic/genetic instability: Multiplexed analysis for common genes altered in the adenoma-carcinoma sequence has been advocated for screening asymptomatic patients, either as an adjunct to, or in lieu of, fecal occult blood testing Hereditary risk assessment for cancers associated with DNA repair defects : relatives of patients with HNPCC are at risk for colon cancer and require routine colon surveillance. Molecular diagnosis is an adjunct to clinical criteria aimed at detecting HNPCC cases among seemingly sporadic colorectal carcinomas • "Bethesda criteria" used to determine at-risk individuals: • Colorectal cancer in a patient age 65%) and observed in >60% of grade II astrocytomas
o
TP53 mutations are observed in -25 % of primary (de novo) glioblastomas The underlying mechanisms for TP53 mutations in primary vs secondary gioblastomas appear different
• Tuberous sclerosis (TS [TSCJ: 9q34 ; TSC2: 16p13]) • Neurofibromatosis type 1 (NF l ): chromosome 17qll • Neurofibromatosis type 2 (NF2): chromosome 22ql2 • Retinoblastoma (RB): chromosome l3ql4 • Multiple enchondromatosis (Maffucci/Ollier disease) - Genetic alterations implicated in the pathogenesis of diffuse astrocytomas: • Tumor suppressor genes:
498
o
20-3
Molecular Pathology of the eNS
o
TP53 mutations correlate with younger age and a giant cell phenotype in glioblastomas
o
p53 induces the overexpression of p21 (cell cycle regulator), which causes growth arrest
o
The immunohistochemical expression of p53 does not necessarily imply the presence of a mutation (74% concordance)
• pI6 (CDKN2A) andpI5 (CDKN2B) gene: o Both CDKN2A and CDKN2B genes map to chromosome 9p21 o
CDKN2A and CDKN2B encode pl6 and p15, respectively
o
p 16/p 15 act as negative regulators of the cell cycle by inhibiting cyclin-dependent kinases (CDK [CDK4/CDK6])/cyclin D complexes and their ability to phosphorylate the pRBl
o
Subsequently, homozygous deletion of CDKN2A results in uncontrolled cell proliferation
o
CDKN2A homozygous deletion and hypermethylation can be found in anaplastic astrocytoma and glioblastoma
o
RBI and CDNK2A alterations in primary
• MDM2 gene : o
Mouse double minute (MDM2) gene maps to chromosome 12q 14.3-qI5
o
Encodes a transcription factor that binds to p53 protein , inhibits its activity and promotes its degradation
o
Under normal circumstances, MDM2 gene transcription is induced by wild-type p53 creating an autoregulatory feedback loop
o
MDM2 amplification and immunohistochemical overexpression in primary glioblastomas is observed at a rate of 10% and 50%, respectively
o
o
MDM2 overexpression has been found to be a negative prognostic indicator in some studies
MDM4 gene shows similar characteristics to MDM2 but maps to chromosome lq32 • pI4ARF gene: o
o
o o
Similar to CDKN2A and CDKN2B genes, p I4 ARF maps to chromosome 9p21 pI4ARF is an inhibitor of MDM2 p I4 ARF homozygous deletion or
o
• Phosphatase and tensin homology (PTEN) gene : o
hypermethylation deregulates p53 function in the absence of TP53 mutation o
p14ARF is negatively regulated by p53
o
pI4ARF homozygous deletion and
o
hypermethylation can be found in diffuse astrocytoma and glioblastoma (50% primary and 75% secondary)
• RB gene (RBI) : o
Maps to chromosome 13q14
o
The RB protein (retinoblastoma or pRB 1) acts as a nuclear phosphoprotein involved in cell cycle regulation (prevents uncontrolled cell proliferation)
o
CDKN2A and CDKN2B alterations (see below) may inhibit the pRB 1 phosphorylation resulting in uncontrolled cell proliferation
o
RBI hypermethylation was seen more frequently in secondary glioblastoma (43%) than in primary glioblastoma (14%). It was not detected in low-grade or anaplastic astrocytoma (late event)
gliomas are inversely correlated CDK4/CDK6 amplification, cyclin Dl overexpression, and/or RBI mutations show similar consequences to CDKN2A1CDNK2B mutations and appear to be mutually exclusive. Gene inactivation in the CDNK2A1CDK4/RBI pathway occurs at an overall frequency of 40-50% in both primary and secondary glioblastomas The pI6/pI5/CDK4/CDK6/RB pathway may provide for a candidate target gene therapy strategies
o
PTEN, also known as mutated in multiple advanced cancers (MMACI), or TGF-~ regulated and epithelial cell enriched phosphatase (TEP1) gene is mapped to chromosome lOq23.3 PTEN gene products possess protein tyrosine phosphatase, and 3' phosphoinositol phosphatase activities, which are essential in regulating cell migration and invasion as well as cell proliferation and survival Implicated in glioma formation and progression
PTEN mutation s are observed in 15-40% of glioblastomas, particularly primary glioblastoma o PTEN alterations also characterize oligodendroglioma progression and have been identified in meningiomas and a number of extracran ial neoplasms • Deleted in malignant brain tumors 1 (DMBTI) gene: o Maps to chromosome IOq25-26 o Homozygously deleted in (-30%) of glioblastomas o
499
20-4
Molecular Genetic Pathology
o
Usually co-deleted with PTEN in glioblastomas
o
while its tyrosine kinase receptor PDGFR-~ is expressed on endothelial cells
• Chromosome 10: o In addition to PTEN, and DMBTl, the long arm of chromosome lOis believed to harbor at least one more tumor suppressor locus o
o
o
Astrocytomas may overexpress both PDGF ligands and receptors
o
PDGFR-a gene amplification is only detected
in a small subset of glioblastomas
• Proto-oncogenes: o
EGFR is a transmembrane tyrosine kinase receptor encoded by a gene mapped to chromosome 7pll
o
EGFR-amplified cells appear to facilitate
• Vascular endothelial growth factor (VEGp): o
VEGF family is comprised of a group of growth factors (VEGF A-D) that exert their angiogenic and lymphangiogenic effects through the activation of three tyrosine kinase receptors, VEGFR-I, VEGFR-2, and VEGFR-3, which are normally expressed by endothelial cells, monocytes/macrophages, and haematopoietic precursors
o
VEGF is the most important regulator of vascular functions in glioma-induced angiogenesis
o
In glioblastoma, VEGF is expressed by astrocytic tumor cells while its tyrosine kinase receptors 1 and 2 are expressed on endothelial cells
o
In addition to inducing angiogenesis, VEGF and its receptors (VEGFR) cause vascular permeability and may also be responsible for breakdown of the blood-brain barrier and peritumoral edema in glioblastoma
o
VEGF is upregulated in perinecrotic pseudopalisading cells of glioblastoma VEGF production can be stimulated by hypoxia
tumor infiltrationlinvasion o
EGFR gene is the most commonly amplified
gene in astrocytic tumors o
Amplified in >40 % of primary glioblastoma, but rarely in secondary glioblastoma
o
EGFR amplification correlates with older age
and a small cell phenotype in glioblastomas o
EGFR gene amplification induces structural
alterations producing several truncated variants of EGFR; the most common of which is delta EGFR (EGFRvIII), present in up to 50% of amplified glioblastomas o
EGFR point mutations are infrequent (3-5%)
in glioblastomas o
Mutant EGFR increases tumor cell proliferation and has an anti-apoptotic effect. Subsequently, overexpression of mutant EGFR in glioma cells confers resistance to chemotherapeutic agents
o
CDK4 and CDK6:
Mutant EGFR may be therapeutically targeted by tyrosine kinase inhibitors to reverse its anti-apoptotic effect
•
o
Additional therapeutic modalities currently under study include immunotherapy using monoclonal antibodies against mutant EGFR and vaccination
o
EGFR upregulation can also be assessed immunohistochemically
Both are CDKs (cyclin-dependent kinases), which promote G /S phase progression o CDK41CDK6 amplificationloverexpression is identified in about 15% of high-grade gliomas , particularly in those without p16 (CDKN2A) deletion • CCND 1 and CCND3 : o Cyclin D1 and cyclin D3 map to chromosomes IIql3 and 6p21, respectively o Similar to CDK4ICDK6, they are cell cycle regulators that promote G /S phase progression
o
• Platelet-derived growth factor (PDGF): o
Platelet-derived growth factor receptor (PDGFR) PDGFR is a tyrosine kinase receptor encoded by a gene that maps to chromosome 4q 12
o
PDGF has three known ligands and two cellsurface receptor kinases (PDGFR-a and PDGFR-~)
500
PDGF ligands and receptors are expressed
almost equally among various grades of astrocytoma and are therefore implicated in the early stages of astrocytoma formation
Overall, LOH on chromosome 10 regions or complete loss of chromosome 10 are perhaps the most common (60-95 %) genetic alterations in glioblastomas but far less common in lower grade astrocytomas
• Epidermal growth factor receptor (EGFR):
PDGF is expressed by astrocytic tumor cells
o
CDK4 maps to chromosome 12ql3 while CDK6 maps to chromosome 7q21-q22
o
o
CCND 1ICCND3 amplificationloverexpression is identified in primary glioblastoma
Molecular Pathology of the eNS
• Promoter hypermethylation: • Recently, several genes that show promoter hypermethylation in astrocytic gliomas, particularly glioblastomas, have been identified. These include:
20-5
- Radiographically appears as a poorly defined, non-contrast enhancing solid lesion • Pathologic features: - Low to moderate cellularity - Ill-defined infiltrative borders
o
Cell cycle regulatory genes (CDKN2A, CDKN2B, RBI, p14ARF, and TP53)
- Nuclear atypia is usually mild to moderate
o
Apoptosis-associated genes such as APAFI
- Mitoses are rare or absent and vascular proliferation and necrosis are universally lacking
o
MGMT gene, which encodes the DNA repair 0 6- Methy lguanine-DNA methyltransferase (MGMT) that protects cells against alkylating agents. MGMT promoter methylation is frequently present in glioblastoma (45-75%). Its presence has been linked to longer survival of glioblastoma patients treated with temozolomide.
o
Promoter methylation of the MGMT, RBI, pI4ARF , TlMP-3 and TP53 genes are common in glioblastoma, with higher frequency in secondary than primary glioblastoma
o
RASSFIA tumor suppressor gene
o
TFP 12 and genes, whose proteins inhibit invasion and migration
sun
• Approximately 40% of glioblastomas demonstrate hypermethylation and transcriptional downregulation of the carboxylterminal modulator protein (CTMP) gene, which encodes an inhibitor of protein kinase B/Akt • Current data suggest that aberrant methylation of genes is more prevalent than genetic alterations, in particular in low-grade astrocytomas • Other genes : • Deleted in colorectal cancer (DCC): o Located on chromosome 18q21; encodes a cell surface receptor o Induces apoptosis and G/M cell cycle arrest in tumor cells o The immunohistochemical loss of DCC expression increases during glioma progression (late event in secondary glioblastoma) o Less frequently implicated in primary glioblastoma
Low-Grade Fibrillary Astrocytoma • Definition: - A well-differentiated (World Health Organization [WHO] grade II), diffusely infiltrative glial neoplasm comprised of fibrillary neoplastic astrocytes • Clinical features: - Children and young adults - Occurs anywhere in the white matter of cerebrum, cerebellum, brain stem, or spinal cord
• Genetic findings : - TP53 mutations (>60% of cases) - LOH on 17p with complete absence of a wild-type gene is seen in most cases with TP53 mutation - Gains on chromosome 7, usually as trisomy/ polysomy, and 8q amplification, constitute the most common chromosomal abnormalities (>50% of cases) detected by comparative genomic hybridization (CGH) - PDGFR-a overexpression; (not amplification) preferentially in tumors with LOH on 17p
- Losses of chromosome 6, lOp, 13q, 22q, and sex chromosome - p14ARF and MGMT promotor methylation in approximately 30% and 50% of cases, respectively
Gemistocytic Astrocytoma • Definition: - A diffusely infiltrative astrocytoma in which gemistocytic astrocytes comprise at least 20% of the tumor cells • Clinical features: - Similar to diffuse fibrillary astrocytoma • Pathologic features: - Usually WHO grade II; grade III if showing signs of anaplasia - Gemistocytic astrocytes are characterized by large, glassy, eosinophilic cytoplasm with an arborizing network of randomly oriented processes. The nuclei are eccentrically placed with small nucleoli • Genetic findings : - TP53 mutations are more common (up to 80% of cases) than the typical grade II astrocytoma - Otherwise, similar alterations to WHO grade II diffuse astrocytoma
Protoplasmic Astrocytoma • Definition: - A superficially located, diffuse astrocytoma of low cellularity characterized by prominent microcyst formation (WHO grade II) • Clinical features : - Superficial location
501
20-6
Molecular Genetic Pathology
- Otherwise, similar to diffuse fibrillary astrocytoma • Pathologic features: - Protoplasmic astrocytes are small cells with little cytoplasm and scant GFAP immunoreactivity - Mucoid degeneration - Microcyst formation • Genetic findings: - Little information exists on the molecular genetics of protoplasmic astrocytoma; however, it is believed that the molecular events are comparable with those seen in other low-grade diffuse astrocytomas
AnaplasticAstrocytoma • Definition: - A diffuse astrocytoma exhibiting cellular atypia and mitotic activity (WHO grade III) • Clinical features: - Predominantly adults; older than patients with lowgrade astrocytomas and younger than those with glioblastomas Preferentially involves the cerebral hemispheres - May involve brainstem and thalamus in children Male:Female ratio of 1.8:1 - Often demonstrates focal or patchy radiographic enhancement • Pathologic features: - Wide spectrum of histologic appearance that features the presence of one or more of the following in focal or diffuse patterns: • Increased cellularity • Cytologic atypia • Mitotic activity • High proliferative activity (>4%) - Necrosis and vascular proliferation are usually absent • Genetic findings : - Similar to WHO grade II diffuse astrocytoma, there is high frequency of TPS3 mutations, LOH l7p and chromosome 7 gains - Deletion s of pI6 (CDKN2A) (30%), pI4ARF , and pIS (CDKN2B) (all on chromosome 9p)
- CDK4 amplification and overexpression (10%), preferentially in tumors without CDKN2A deletion or mutation
- RBI alterations (25%) in tumors lacking CDK4 and CDKN2A abnormalities - PTENIMMACI mutations are less frequent (18-23 %). than glioblastoma. PTEN mutation implies a poor prognosis - EGFR amplification is rare (10%) compared to glioblastoma
502
- Deletions on chromosome 6 (30%), 10q (30-60%), II P (30%), 19q (40%), and 22q (30%)
Glioblastoma • Definition: - A highly malignant (WHO grade IV), poorly differentiated, diffuse astrocytoma that may be primary (de novo) or secondary (from a lower-grade glial neoplasm) • Clinical features : - Mostly adults in their 6th, 7th, or 8th decades - Preferentially involves the cerebral hemispheres - Male:Female ratio of 1.5: I - Typically demonstrates ring-like enhancement radiographically • Pathologic features (Figure 1): - Highly cellular - High degree of cytologic and nuclear anaplasia - Highly mitotic, including atypical forms - High proliferative activity - Vascular proliferation, sometimes glomeruloid - Geographic and palisading necrosis • Genetic findings: - Glioblastoma is as genetically heterogeneous as it is phenotypically. Much of the genetic heterogeneity can be attributed to the two distinct pathways through which glioblastoma evolves ; primary 95% vs secondary 5%. It is now well accepted that de novo (primary) glioblastoma shows different genetic alterations from secondary glioblastoma - Nevertheless , the functional consequences of the different genetic alteration s are similar since they result in alterations of the same pathways (TPS3, RBI PTENlphosphatidylinositol 3-kinaselAkt, and mitogenPTEN activated protein kinase) - Chromo some loss is more widespread in glioblastoma than anapla stic astrocytoma - LOH on chromosome 10 occurs at a high frequency in all types of glioblastomas, regardless of age (adult vs pediatric) and regardles s of their evolution pathway (primary vs secondary) - Immunohistochemical detection of p53 protein occurs at a higher frequency than TPS3 mutations in both primary and secondary glioblastomas High-grade gliomas demon strate loss of p27 (cell cycle regulator) expres sion (expressed in 44% of grade II astrocytomas compared with only 2% of glioblastomas) - Primary glioblastoma (older age of onset and an aggressive clinical course): • Higher frequency of: • EGFR amplification and immunohistochemical overexpression (-40% and 60%, respectively)
Molecular Pathology of the eNS
20-7
Fig. I. Glioblastoma: a hypercellular glial neoplasm with large hyperchromatic irregular nuclei. Note the high degree of nuclear pleomorphism and the area of palisading necrosis toward the center.
• Homozygous deletion of p16 (CDKN2A) (-40%) and p14ARF •
CDK4 amplification
• MDM2/MDM4 amplification: MDM2 gene
amplification and immunohistochemical overexpression in approximately 10% and 50%, respectivel y • RB 1 mutationlhomozygous deletion •
10q loss/monosomy 10 (70%)
• PTEN mutation (largely restricted to primary
glioblastoma • In primary glioblastoma, LOH 10 usually manifests as loss of the entire chromosome (LOH lOp and IOq) with IOq loss being especially associated with the small cell phenotype of glioblastoma • Nearly all glioblastomas with EGFR amplification show simultaneous loss of chromosome 10 (LOH lOp and 10q) • TP53 mutations are less frequent (10-30%) than secondary glioblastoma. However, the p53
pathway is altered in more than two-thirds of primary glioblastomas, due to either TP53 mutation, p14 ARF alteration, or MDM2/MDM4 amplification
• TP53 mutations, p16 (CDKN2A) deletion, EGFR amplification and PTEN mutations are inversely
associated with each other, except for a positive correlation between p16 (CDKN2A) deletion and EGFR amplification • MDM2 overexpression/amplification and TP53
inactivation are mutually exclusive events as MDM2 protein binds to p53 and inhibits its activity • p16 (CDKN2A) deletions and RBI alterations are
also mutually exclusive • LOH 19q is rare «10%) but has been implicated in malignant progression of astrocytic lesions. In addition, chromosome 19 alteration is a feature shared by all three types of diffuse gliomas (astrocytomas oligodendrogliomas, and ependymomas) • Gain of chromosome 7 • LOHI7 • Chromosome 3 alterations - Secondary glioblastoma (younger age of onset and a more protracted clinical course) : • TP53 mutations and LOH 10q are among the most
common genetic abnormalities (65% and 63%, respectively)
503
20-8
Molecular Genetic Pathology
• EGFR gene amplification is absent or exceedingly
rare in secondary glioblastoma but its protein may be detected immunohistochemically in a minority of cases • In secondary glioblastoma, LOH 10 is usually limited to the long arm of chromosome 10 (LOH IOq; >60%) • p16 (CDKN2A) deletions, amplification of EGFR, MDM2 or MDM4 and PTEN mutations are rare
• Loss of RB function and CDK4 amplification are common alterations • PDGFR-a gene amplification is much less frequent
than lower grade astrocytomas (50%) • Loss of immunohistochemical expression of DCC is common (-50) - LOH 1P is equally detectable in primary and secondary glioblastoma while LOH 22q is significantly more frequent in secondary glioblastoma. - While the vast majority of pediatric glioblastomas arise de novo, their genetic alterations more closely resemble those seen in adult secondary glioblastomas, albeit with less frequency of TP53 mutations and LOH l7q. Unlike adult primary glioblastomas, they show a low rate of EGFR amplification, and PTEN and CDKN2 deletions as well as absence of MDM2 amplification
• Possible prognostic implications : - The prognostic significance of EGFR amplification and overexpression status in glioblastoma is highly controversial with some studies reporting significantly shorter survival periods, others showing no significant correlation while some reports claiming a favorable clinical outcome. Clinical trials examining the role of anti-EGFR targeted immunotherapy in glioblastoma are underway The prognostic value of TP53 mutations remains an unsettled issue Most studies point to 10q loss/monosomy 10 as an independent predictor of shorter patient survival MDM2 amplifications correlated with poor outcome in both uni-variate and multi-variate analysis MGMT promoter methylation has been linked to longer survival of glioblastoma patients treated with temozolomide Losses involving p 16, 19q, and p27 are alterations that all have shown promise as potential prognostic markers in adult astrocytoma
Pilocytic Astrocytoma • Definition : - A relatively benign (WHO grade I), slowly growing form of localized astrocytoma that has a propensity to involve children and young adults and occurs predominantly in the infratentorium
- Giant cell glioblastoma is a rare variant of glioblastoma clinically characterized by wellcircumscribed, superficially located cortical lesions in patients of a slightly younger age group than is typical for glioblastoma. Histologically, they show predominance of giant bizarre-shaped and multinucleated astrocytes embedded in a reticulin-rich stroma. Their genetic alterations are a mixture of what is found in primary and secondary glioblastomas. They demonstrate high frequency of TP53 (-90%) and PTEN (-30%) mutations, but generally lack EGFR amplification and p16 CDKN2A and p14 ARF deletions
• Clinical features: - May occur at any age; however, it is most common in children and young adults (1st and 2nd decades) - Pilocytic astrocytoma is by far the most common glioma in children - Has been reported throughout the eNS, but occurs at a disproportionally higher frequency in the posterior fossa. Other preferred sites include the optic nerve and chiasm, thalamus/hypothalamus, and brainstem - Clinical presentation is largely dependent on site of involvement and includes signs of increased intracranial pressure, visual disturbances, and cerebellar symptoms - Radiographically appears as well-circumscribed, contrast-enhancing lesions. Those outside the brainstem and thalamic/hypothalamic axis frequently show cyst formation . A classic cerebellar pilocytic astrocytoma shows a large solitary cyst with an enhancing mural nodule
- Gliosarcoma is another uncommon variant of glioblastoma characterized by a distinctly biphasic pattern of glial and mesenchymal areas. Its genetic alterations are very similar to those of primary glioblastoma except for less frequent or absent EGFR amplification and overexpression. It has been shown that both gliosarcoma components are monoclonal
• Pathologic features: - Biphasic pattern showing alternating compact and loose areas (Figure 2) - The compact areas are made up of bundles of spindled astrocytic cells characterized by elongated bland nuclei and bipolar wispy cytoplasm . These piloid cells show intense GFAP reactivity. Rosenthal fibers are usually abundant in these areas
- The small cell glioblastoma phenotype typically shows EGFR amplification, p16 (CDKN2A) homozygous deletion , PTEN mutations and LOH 10q
504
Molecular Pathology of the eNS
20-9
Fig. 2. Pilocytic astrocytoma: the characteristic biphasic pattern of relatively compact eosinophilic component made up of bipolar cells with elongated nuclei (right side) and loose hypocellular component with more stellate appearing tumor cells (left side). Note the scattered Rosenthal fibers (arrows).
- The loose hypocellular areas may show prominent microcyst formation and deposition of eosinophilic granular bodies. The tumor cells have bland round to oval nuclei, pale cytoplasm, and short cobweb-like processes. GFAP is weakly immunoreactive - Oligodendroglial-like areas may be seen - Pilocytic astrocytomas are vascular tumors that may show vascular proliferation, including glomeruloid pattern . Unlike diffuse astrocytomas, the presence of vascular proliferation bears no prognostic significance. The same holds true for necrosis - Mitoses are rare but degenerative nuclear atypia may be prominent • Genetic findings : Pilocytic astrocytoma is the most common CNS tumor as part of the NFl complex. Optic nerve involvement is classic. Most NFl-associated pilocytic astrocytomas carry allelic losses at the NFl tumor suppressor gene locus at 17q11.2 resulting in constitutive RAS activation - Sporadic pilocytic astrocytomas, on the other hand, rarely demonstrate allelic losses at the NFl locus. In fact, neither NFl mutations nor loss of NFl mRNA expression were found in sporadic pilocytic astrocytomas, arguing against an important role of NFl in the tumorigenesis of sporadic pilocytic astrocytomas
Pilocytic astrocytomas show immunohistochemical overexpression of neurofibromin, the NFl gene product - No consistent genetic abnormality has been identified. However, gain and loss of genetic material from a number of chromosomes, including chromosomes 5, 7, 8, 11, 12, 15, 17, 19,20 and 22 have been reported -
TP53 mutations and aberrant PDGF signaling are
usually absent but TP53 protein immunohistochemical expression is occasionally present
Pleomorphic Xanthoastrocytoma (PXA) • Definition: - PXA is a rare form of localized, typically noninfiltrative astrocytoma of somewhat favorable outcome that occurs in superficial cortical locations in children and young adults. Most PXAs are thought to conform to WHO grade II tumors ; however, grade III PXAs are not uncommon • Clinical features: - Children and young adults (lst-3rd decades) - Almost invariably cerebral, predominantly involving the superficial temporal lobe with frequent meningeal involvement - Most patients present with seizures
505
20-10
Molecular Genetic Pathology
Fig. 3. Pleomorphic xanthoastrocytoma: large bizarre-shaped astrocytes, one with nuclear pseudoinclusion (arrow), are scattered in a background of low-grade astrocytes. - Frequently shows radiographic cyst formation with an enhancing mural nodule • Pathologic features : - Grossly, the xanthomatous change may impart a yellowish discoloration - Relatively discreet tumor of moderate cellularity - Morphologically variable showing areas of spindled, reticulin-rich, and intensely GFAP-positive astrocytic cells admixed with areas comprised of large polygonal, lipid-rich astrocytes - Some of the tumor cells are characteristically highly pleomorphic with large bizarre, multi-nucleated nuclei and nuclear pseudoinclusions (Figure 3). Mitoses are typically infrequent but when increased (>5/10 high-power fields [hpf]) signify an anaplastic change (WHO grade III) - Eosinophilic granular bodies and perivascular lymphocytes are present • Genetic findings : - No specific genetic findings exist - TP53 mutations have been reported in a small subset of PXAs (5%) - Typically, oligodendrogliomas are not reactive for GFAP; however, they occasionally may contain two types of GFAP-positive tumor cells :
oligodendrogliomas and constitutes a unique "genetic signature" -
Ipl19q co-deletion is associated with enhanced survival and favorable response to chemotherapy and/or radiation therapy
- LOH 19q is the most common genetic alteration (50-80% of all oligodendroglial tumors). The loss usually involves the entire arm due to an unbalanced t( 1;19) (q1O;pI0) translocation. Partial deletions are rare
The mechanism through which 1pl19q status influences therapeutic sensitivity in oligodendrogliomas is unknown. It remains unclear whether the Ip or 19q chromosomal arm harbors relevant tumor suppressor genes or any oligodendroglioma-specific genes for that matter - Ip/19q co-deletion has been shown by some to correlate with chemo-responsiveness, irrespective of tumor morphology - Commercial laboratory testing for 1pl19q co-deletion is readily available using FISH, LOH, and quantitative micro satellite analysis, though dual-color FISH has emerged as the method of choice in many laboratories - Ipl19q co-deletion has been reported in a small percentage of astrocytic tumors « 1%)
LOH 1P is the second most common genetic alteration. The loss also involves the entire chromosomal arm due to an unbalanced t( I; 19) (q lO;p10) translocation. Partial deletions are rare - LOH Ip is almost always associated with LOH 19q - Co-deletion of chromosomal arms I p and 19q as identified by LOH, and FISH is found in 50-90% of
- In pediatric oligodendrogliomas, co-deletion Ipl19q is found at a much lower frequency (27%) compared with their adult counterparts. Deletions of p16 (CDKN2A) and IOq were reported in 45 % and 18% of cases, respectively. Interestingly, these molecular alterations including Ip/19q status have not been shown to correlate with biological behavior
• Those resembling small gemistocytes (mini-gemistocytes) • Gliofibrillary oligodendrocytes, which are otherwise histologically identical to oligodendroglioma cells • Genetic finding s (Figure SB,C):
508
Molecular Pathology of the eNS
- Unlike astrocytic neoplasms, loss of 17p, TP53 mutation and p53 expression are uncommon (-10-20%). Their presence is mutually exclusive to Ip/19q deletion and shows no prognostic significance - EGFR immunohistochemical expression, not amplification, is common (-50%) in grades II and III. However, both EGFR amplifications and IOq deletions are said to be extremely uncommon in pure oligodendrogliomas - PTEN alteration s have been implicated in oligodendroglioma progression to anaplasia and worsened survival primarily in those with intact lp and 19q
MGMT promoter hypermethylation and reduced expression is particularly common among Ipi 19q-deleted oligodendrogliomas. Aberrant promoter methylation of a number of tumor suppressor genes (CDKN2A, CDKN2B, RBJ, pI4ARF, TP53, ESRI (estrogen receptor 1) and DAPKJ (death-associated protein kinase I) is also common - PDGF and its receptors are expressed in the vast majority of cases - Overexpression of VEGF and decreased expression of p27 are seen in a subset of oligodendrogliomas, being inversely associated with tumor grade. However, their prognostic significance remains unclear - Anaplastic oligodendrogliomas demonstrate a higher frequency of multiple chromosomal deletions including gains on 7 and l5q and losses on 4q, 6, 9p, 10q, II, 13q, 18 and 22q - Chromosomes 9p and 10 abnormalities, including CDKN2A gene (encoding pJ(iNK4A and pJ4ARF) deletions , are more frequent in anaplastic oligodendroglioma (-30% and 10%, respectively) suggesting a role in oligodendroglial tumor progression paralleling that observed in malignant astrocytic tumors . The presence of these deletions is predictive of shortened survival. pJ(iNK4A deletions occur in oligodendrogliomas, irrespective of their Ip/19q status
Mixed Oligoastrocytoma • Definition: - An infiltrative glial neoplasm that is comprised of two types of cells morphologically resembling those seen in oligodendroglioma and diffuse astrocytoma. The concept of mixed oligoastrocytoma has been widely endorsed by most neuropathologists over the past two decades . Grading of mixed oligodendrogliomas (MOAs) is identical to that of oligodendrogliomas • Clinical features: Indistinguishable from those of pure oligodendrogliomas and pure diffuse astrocytoma, though their preferential involvement of the cerebral hemispheres is more closely aligned with oligodendrogliomas
20-13
- Extremely rare in the brainstem, cerebellum, and spinal cord • Pathologic features : - According to the WHO, MOAs are divided into biphasic (compact) and intermingled (diffuse) variants - The intermingled (diffuse) variant is the most frequent and shows both components intimately admixed . This variant often contains nuclei intermediate between those of oligodendroglioma and diffuse astrocytoma - The biphasic (compact) variant shows two distinct components displaying oligodendroglial and astrocytic differentiation - Anaplastic features include frequent mitotic activity, nuclear pleomorphism, microvascular proliferation, and high proliferative index • Genetic findings : - MOAs are monoclonal neoplasms arising from a single progenitor cell, i.e., showing the same genetic alterations throughout the tumor regardless of morphologic component. Nevertheless, MOAs are genetically heterogeneous and may assume genetic features similar to those of either oligodendrogliomas or diffuse astrocytomas -
10-50% of MOAs show co-deletion of Ip/19q
- Loss of 19q alone is particularly common in MOAs, often associated with a favorable outcome - 30% of MOAs showed genetic alterations common to astrocytic tumors (TP53 mutationslLOH 17p, EGFR gene amplification, chromosome 10 abnormalities, pJ6 deletions, and so on) and these patients had significantly shortened survival
Ependymoma • Definition: - A relatively well-circumscribed glial neoplasm arising from the ependymal cells lining the ventricles and the spinal canal. Except for the myxopapillary variant (WHO grade I), ependymomas are either WHO grade II or grade III (anaplastic ependymoma) • Clinical features : - May occur at any age but shows two age peaks ; 0-16 years for infratentorial ependymomas and 30-40 years for spinal cord ependymomas - Third most common brain tumor in children - May occur at any site, including occasionally outside the ventricular system; most common in posterior fossa (children) and spinal cord (adults) - Most common glioma of the spinal cord - Presentation highly dependent on primary location . Obstructive hydrocephalus is frequent for intraventricular ependymomas - Radiographically appear as well-circumscribed, variably contrast-enhancing lesions. Cystic change and
509
20-14
Molecular Genetic Pathology
Fig. 6. Ependymoma: this WHO grade II ependymoma shows a moderately cellular tumor consisting of monomorphic population of cells with oval nuclei . Note the characteristic perivascular pseudorosettes toward the center of the image.
syrinx are common in supratentorial and spinal locations, respectively. Spinal examples are intra-axial, sausage -shaped lesions • Pathologic features (Figure 6): - Sharp demarcation from adjacent parenchyma - Moderately cellular tumors made up of sheets of cells interrupted by perivascular pseudorosettes and occasionally true ependymal rosettes/canals - Ependymal cells show round to oval nuclei with small nuclei and rare mitoses - GFAP is usually positive, but highly variable, in processes converging on blood vessels. Epithelial membrane antigen (EMA) positivity is seen in a minority of cases - Characteristic ultrastructure: intracytoplasmic lumina, cilia/microvilli, long intercellular junctions, and intermediate filaments - In addition to conventional ependymoma (WHO grade II), several histologic variants exist: • Myxopapillary ependymoma (WHO grade I) : Almost exclusively seated in the area of the filum terminale in young adults, this variant is characterized by prominent, hyalinized papillae embedded in a mucoid background
510
• Cellular ependymoma (WHO grade II) • Papillary ependymoma (WHO grade II) • Tanycytic ependymoma (WHO grade II) • Clear cell ependymoma (WHO grade III) - Anaplastic features include hypercellularity, increased mitotic activity, and microvascular proliferation • Genetic findings: - Ependymomas appear to be genetically distinct from other glioma s as they lack genetic alterations of astrocytomas and oligodendrogliomas, except for chromosome 19 alteration There is increasing evidence that spinal and intracranial ependymomas represent two distinct tumor subsets, both clinically and genetically About 40% of ependymomas show no detectable genetic alterations Spinal ependymomas are a manifestation of NF2 syndrome with NF2 gene mutations (22qI2) almost exclusively found in spinal ependymomas Overall, 30% of adult ependymomas show chromo some 22 abnormalities (deletions, translocations, monosomy) , showing an association with a spinal location
Molecular Pathology of the eNS
- Uncommon chromosomal aberrations include gain of lq and losses involving chromosomes 6q, 9, 10, 13, and 17p in pediatric intracranial ependymomas and gain of chromosome 7 in spinal ependymomas - Deletions involving DAL-I (4.lB) and/or monosomy 18 have been detected in up to 67% of clear cell ependymomas . The latter may also demonstrate gains of chromosome lq, and loss of chromosomes 9, 3, and 22q - Chromosome lq gains and loss of 9 and 13 appear to correlate with progression to anaplasia
Subependymoma • Definition : - A benign, well-circumscribed intra- or subventricular glial neoplasm comprised of sparsely cellular clusters of ependymal-like cells embedded in a fibrillary matrix with microcyst formation. Subependymomas are WHO grade I lesions • Clinical features : - May occur at any age; most common in adults - The fourth ventricle, followed by the lateral ventricles, is the most frequent site. Uncommon in the spinal cord - Usually asymptomatic and incidentally detected - Radiographically appear as sharply-demarcated, nonenhancing, nodular intraventricular masses. May occasionally calcify and hemorrhage • Pathologic features : - Sharp demarcation from underlying parenchyma - Tumor is made up of microscopic islands and clusters of ependymal-like cells embedded in a background rich in fibrillary matrix - Prominent microcyst formation - Bland, round to oval nuclei with no significant nuclear pleomorphism and absent or rare mitoses - Examples of mixed ependymoma/subependymoma exist • Genetic findings : - Consistent genetic alterations have not been identified
Astroblastoma • Astroblastoma is a rare glial tumor of uncertain origin. It usually manifests in children and young adults as a well-circumscribed, contrast-enhancing solid or cystic hemispheric mass . Histologically, it combines ependymal features (perivascular pseudorosettes) with astrocytic differentiation (GFAP-positive cells with broad, non-tapering processes). Vascular hyalinization
20-15
is prominent. No WHO grade has been assigned to astroblastoma yet, but they may be qualified as low- or high-grade • Consistent genetic alterations have not been identified
Chordoid Glioma of the Third Ventricle • This is a rare, low-grade (WHO grade II) glioma of the third ventricle of adults that is histologically characterized by cords and clusters of epithelioid, GFAPpositive cells embedded in a mucin-rich background containing Iymphoplasmacytic infiltrate • No sufficient genetic information available
Mixed Glioneuronal Neoplasms Ganglion Cell Tumors • These include ganglioglioma and gangliocytoma. Ganglioglioma (WHO grade I or II) is the prototypical mixed glioneuronal neoplasm in which a wellcircumscribed neoplastic glial component (pilocytic or fibrillary astrocytoma) contains dysmorphic ganglion cells either in clusters or individual cells (Figure 7). Gangliocytoma (WHO grade I) occurs when the tumor is made up predominantly of clusters of large dysmorphic ganglion cells in a background of non-neoplastic glial elements • Consistent genetic alterations have not been identified, though gains of chromosome 7 were the most recorded
Dysembryoplastic Neuroepithelial Tumor (DNET) • DNET is a benign (WHO grade I) intracortical glioneuronal neoplasm that preferentially affects children and young adults often with a protracted history of seizure disorder • Consistent genetic alterations have not been identified
Desmoplastic Infantile Astrocytoma/Ganglioglioma (DIG) • Desmoplastic infantile astrocytoma and desmoplastic infantile ganglioglioma are benign (WHO grade I) glial neoplasms of infants as they are in grade I meningiomas -
NF2 gene mutations are much less frequent (-25%) in
meningothelial meningiomas
Choroid Plexus Thmors
- Allelic losses on chromosome 22 point to NF2 as the major tumor suppressor gene in meningiomas
• Definition: - These are intraventricular, papillary epithelial neoplasms derived from the choroid plexus epithelium. They may be benign (papilloma; WHO grade I) or malignant (carcinoma; WHO grade III)
- Chromosome 22 loss; usually in the form of monosomy 22 is most common
• Clinical features: - Most common in children, may be congenital
- Meningiomas with NF2 gene mutations show loss of expression of its protein product merlin (schwannomin)
- In addition to merlin , two other membrane-associated proteins of the Protein 4.1 family have been implicated in meningioma tumorigenesis: Protein 4.1B (DAL-l) and Protein 4.lR - Tumor suppressor in lung cancer 1 (TSLC-I) has also been implicated in meningioma tumorigenesis - Atypical and anaplastic meningiomas show additional allelic losses involving chromosomes lp, 6q, 9q, 109, 14q, 17p, and 18q. IP deletions and the combined deletion of I pll4q have been shown to correlate with increased risk of recurrence and shorter progressionfree survival - Atypical and anaplastic meningiomas show chromosomal gains involving lq, 9q, 12q, 15q, 17q, and 20q -
TP53 gene alterations are very infrequent but
immunohistochemical expression of TP53 protein may be detected in a small percentage of higher grade meningiomas -
PTEN mutations are occasionally encountered
Clonality studies suggest that multiple meningiomas are usually monoclonal - FISH studies for 22ql2 (NF2) , 18ql1.3 (4.JB), Ip36 (4.lR), and 14q status may be useful in supporting the diagnosis of anaplastic meningioma or ruling out other malignancies
516
- Overall, papillomas are much more common than carcinomas; however, carcinomas occur with higher frequency in children - Most common in the lateral and third ventricles in children and fourth ventricle in adults - Patients present with signs and symptoms of increased intracranial pressure - Radiographically appear as solid, homogeneous, contrast-enhancing, intraventricular masses, often accompanied by hydrocephalus • Pathologic features : - Choroid plexus papillomas (CPP) are composed of delicate papillary fronds covered by a layer of welldifferentiated columnar epithelium characterized by uniform oval to round basal nuclei and absent or rare mitoses - Choroid plexus carcinomas (CPC) on the other hand may lack conspicuous papillary areas and be entirely solid. Their cells typically show high-grade features with frequent mitoses and necrosis - Choroid plexus tumors are generally positive for, S 100, synaptophysin, and keratin • Genetic findings: - CPP rarely occurs in association with Aicardi's syndrome (psychomotor retardation, infantile spasm, corpus callosum agenesis, chorioretinal abnormalities)
Molecular Pathology of the eNS
20-21
Fig. 10. Craniopharyngioma: adamantinomatous craniopharyngioma is characterized by palisaded squamous epithelium, wet keratin, and calcification.
- CPP may also occur in the setting of Li-Fraumeni syndrome in which case TP53 germline mutations have been detected - CPP demonstrates hyperploidy with gains on chromosomes 7, 9, 12, 15, 17, and 18 CPC exhibits LOH lp, lq , 3p, 5q, 9q, IOq, 13q, 18q, and 22q
Suprasellar and Sellar Thmors Craniopharyngioma • Craniopharyngioma is a relatively benign (WHO grade I) epithelial neoplasm of the sellar region that is thought to arise from Rathke's pouch remnants. Two histological subtypes are recognized : adamantinomatous and papillary. The former is more common in children and is usually partially cystic while the latter occurs predominantly in adults in the region of the third ventricle. Compared with their papillary counterpart, adamantinomatous craniopharyngiomas are additionally characterized by the presence of wet keratin, calcifications, and cholesterol clefts (Figure 10) • No consistent genetic alterations reported
Pineal Parenchymal Thmors • Pineal parenchymal tumors encompass a rare group of pineal region tumors that are thought to arise from pineocytes. These have a wide histological spectrum :
- Pineocytomas are relatively benign (WHO grade II) tumors of adults characterized by sheets or lobules of well-differentiated cells forming the distinctive "pineocytomatous" rosettes. The tumor cells have round nuclei with open chromatin pattern - Pineal parenchymal tumors of intermediate differentiation generall y lack the "pineocytomatous" rosette formation and show higher degree of cellularity and atypia than pineocytomas. However, they are less cellular and less primitive looking than pineoblastoma - Pineoblastomas are highly malignant (WHO grade IV) tumors of children characterized by primitive embryonal morphology with rosettes of either the neuroblastic (Homer-Wright) or the retinoblastic (Flexner-Wintersteiner) type • Apart from the rare pineoblastoma associated with familial bilateral RBs in the so-called "trilateral retinoblastoma syndrome" no consistent genetic alterations have been reported
Germ Cell Thmors • Definition : - Germ cell tumors of the CNS are rare, preferentially midline tumors of children and young adults that show similar characteristics to those arising in the gonads • Clinical features : - Children and young adolescents are most affected
517
20-22
Molecular Genetic Pathology
- Germinomas are by far the most common subtype (Figure 11A) • Genetic findings: Similar to testicular germ cell tumors, most CNS germinomas show overrepresentation of chromosome 12p, often manifesting as isochromosome 12p (Figure 11B) Patients with Klinefelter syndrome and Down syndrome appear to be more susceptible to develop germ cell tumors, including those of the CNS, than the average individual
Hemangioblastoma • Definition: - A benign (WHO grade 1), richly vascular tumor of uncertain histogenesis • Clinical features : - Sporadic cases occur in adults while those associated with VHL tend to involve younger patients - Sporadic cases are largely limited to the cerebellum but those associated with VHL syndrome may be multiple and additionally manifest in the brainstem and spinal cord - Most show the characteristic radiographic appearance of a cyst with a contrast-enhancing mural nodule. "Flow voids" may be encountered • Pathologic features : - These are discrete neoplasms made up of a variable mixture of small capillaries and large vacuolated or lipidized stromal cells Fig . 11. Germinoma: (A) nests of polygonal tumor cells characterized by clear cytoplasm and large round nuclei with prominent nucleoli are decorated by thin fibrous septa-rich in lymphocytes. (B) Isochromosome 12p is a common finding in CNS germinoma (2 green 12p signals closely juxtaposed to I red centromeric probe signal, see arrow). Midline intracranial structures are most commonly involved (vast majority occur in the pineal and suprasellar regions) , though they have been reported throughout the CNS
- The stromal cells' nuclei may show hyperchromasia and nuclear pleomorphism but mitoses are infrequent - Often cystic but occasionally solid - Mast cells may be a diagnostically helpful finding • Genetic findings: - Approximately 25% of hemangioblastomas occur in the setting of VHL syndrome - A minority of sporadic hemangioblastomas show mutations or deletions of the VHL gene - EGFR, VEGF, and VEGF receptors are expressed at high levels in the stromal cells
- Pineal region tumors show male predominance - Pineal region tumors usually present with signs and symptoms of increased intracranial pressure while those of the suprasellar region may manifest due to visual symptoms or disturbances along the hypothalamichypophyseal axis (e.g., diabetes insipidus) • Pathologic features : - Morphologically identical to their gonadal and other extragonadal counterparts
518
Schwannoma • Definition: - A benign (WHO grade 1) slowly growing tumor that occurs throughout the peripheral nervous system but intracranially involves the vestibular division of the eighth cranial nerve. Only schwannomas of the CNS are discussed next
Molecular Pathology of the eNS
• Clinical features: - Bilateral vestibular schwannomas are the hallmark of
NF2 - The vestibular division of the eighth cranial nerve is the most common intracranial location. Rare intracerebral and intramedullary examples have been reported - Patient s may present with tinnitus, hearing difficulties, or facial paresthesias - Radiographically appear as well-circumscribed , often cystic, homogenously contrast-enhancing masses • Pathologic features : - Encapsulated tumors of moderate to low cellularity - Biphasic architecture: • Antoni A areas : comp act, elongated cells arranged in alternating fascicles, sometimes forming distinctive nuclear palisades (Verocay bodies) • Antoni B areas: loosely textured less cellular areas with more stellate looking cells - Thick hyalinized blood vessels with hemosiderin-laden macrophages - Aggregates of lipid-laden cells - Degenerative atypia in the form of nuclear pleomorphism is common but mitoses are infrequent
20-23
- Prominent pericellular reticulin Intensely and diffusely immunoreactive for S I00 - Histologic variants include cellular, plexiform , and melanotic schwannomas • Genet ic findings: - The vast majority of schwannomas are sporadic Schwannomas may arise in the setting of NF2 or schwannomatosis (multiple peripheral schwannomas) About 50 % of psammomatous melanotic schwannomas are found in patients with Carney 's complex (autosomal dominant disorder with lentiginous facial pigmentation, cardiac myxoma, endocrine overactivity, and calcifying Sertoli cell tumors) Inactivating mutations of the NF2 gene are identified in about 60% of schwannomas Some schwannomas may show loss of chromosome 22q in the absence of detectable NF2 gene mutations Loss of the immunohi stochemical expression of the NF2 gene product (merlin/schwannomin) is identified in the vast majority of schwan nomas regardless of NF2 gene mutations
MOLECULAR PATHOLOGY OF NEURODEGENERATIVE DISEASES Overview • The ravages of advanced age affect both mind and body, and perhaps nowhere do we recognize this more so than with the degenerative diseases of the nervous system. Combined now with the gross and microscopic changes that have been known for >50 years for many of the neurodegenerative ailments are a vast and rapidly expanding array of genetic and molecular data that have transformed how we look at and classify these diseases. Many of these disorders have both sporadic and familial
forms, providing clues to the pathogenetic basis of these diseases. Some of these diseases have unique populations of cells affected and unique cytopathic changes , though overlapping neuropathological feature s are also common . Neuropathological examination at autopsy is still the gold standard for diagnosing most neurodegenerative diseases. Described in this section are some of the more prevalent and better studied, although unfortunately, still not fully understood or treatable disorders with an emphasis on the essential molecular pathological changes involved
GENERAL MOLECULAR/CELLULAR MECHANISMS OF NEURODEGENERATION • Protein aggregation and transport dysfunction - Misfolding and aggregation of proteins is a hallmark of many neurodegenerative diseases, though it is still not known in many cases whether these phenomena are central to the pathogenesis, secondary injury, or perhaps even protective to the cell
- Aggregates that form are multimeric but often have a predominant protein and tend to affect certain neuronal or glial cells in different diseases (Table 2) - Aggregates can form intracellularly in cytosol, nucleus, or neuritic processes or extracellularly with diverse cellular pathological consequences often including cell death
519
20-24
Molecular Genetic Pathology
Table 2. Neurodegenerative Diseases and Their Associated Protein Aggregate Pathology
Neurologic disease
Primary cell type affected
Anatomical region affected
Protein aggregation
Alzheimer's disease
Neurons
Neocortex, hippocampus, entorrhinal cortex
Neurofibrillary tangles and amyloid plaques
Parkinson's disease
Neurons
Substantia nigra, nucleus basalis, locus ceruleus
Lewy bodies
Lewy body disease
Neurons
Substantia nigra, neocortex
Cortical Lewy bodies
Amyotrophic lateral sclerosis
Upper and lower motor neurons
Motor cortex, lower motor neurons anterior hom of spinal cord
Bunina bodies, skein-like aggregates
Corticobasal degeneration
Neurons and glia
Basal ganglia and cerebral cortex
Tau inclusionscytoplasmic and processes
Multi-systematrophy
Glia and neurons (less)
Brainstem, midbrain, cerebellum, striatum
Synuclein/ubiquitin inclusions
Prion diseases
Neurons
Variable and diffuse dependingon subtype
Amyloid and prion plaques
Frontotemporal dementias
Neurons
Hippocampus, frontal and temporal cortices
Tau tangles/pretangles (Pick bodies in Pick's disease)
Huntington's disease
Neurons
Caudate, putamen, and cerebral cortex
Polyglutamine tract inclusions in neurites and nuclei
Progressivesupranuclear palsy
Neurons and glia
Globus pallidus, midbrain, pons, subthalamic nucleus
Globose neurofibrillary tangles (neurons) Coiled bodies (oligos) Tufted and thorn (astrocytes)
- Molecular motors within neuritic processes consist of a network of cytoskeletal elements known as kinesins and dyneins - When aggregates are found in neuritic processes the major pathological defect is to these molecular motors and retrograde and anterograde transport, essential processes that allow the movement of organelles and molecules crucial to cell function along the processes -
The histological finding when neuritic transport is disrupted is spheroid formation (also termed axonal swellings or axonal bulbs)
• Mitochondria dysfunction - Mitochondria are the energy producing (in the form of oxidative phosphorylation and ATP production) organelles of all cells in the nervous system Mitochondrial proteins are encoded by both nuclear DNA and mitochondrial DNA. Mutations in genes from both sources become more numerous with age and have been suggested to playa role in organelle dysfunction and neurodegenerative diseases -
520
Damaged mitochondria leads to increased accumulation of oxidative molecules including reactive oxygen species, which can injure other organelles and induce apoptosis and/or necrosis
-
High levels of oxidants can also be very deleterious to mitochondria inducing a state called mitochondrial permeability transition, with an uncoupling of oxidative phosphorylation often leading to cell death • Neuroinflammation - An emerging field of inquiry thought to playa part in many neurodegenerative diseases ; though unknown whether it serves both a primary and secondary role Astrocytes and microglia serve as the local resident cells in the CNS-mediating inflammation - Circulating immune cells (B cells, T cells, and monocyte/macrophage) and autoantibodies may also playa yet to be defined role in neurodegenerative processes; their importance in multiple sclerosis, infectious disease, and trauma are better established - The major cytokines and chemokines involved include: tumor necrosis factor-a, granulocyte macrophage colony stimulating factor (GM-CSF), interleukin (IL)Ia, IL-I B, IL-2, IL-4, IL-6, interferon-y, IL-IO, IL-12, IL-18, tumor growth factor-B. macrophage inflammatory protein (MIP-I), macrophage chemotactic protein (MCP-I) -
Inflammatory mediators may alter the blood-brain barrier, synapse function, apoptosis, edema, protein
Molecular Pathology of the eNS
20-25
Fig. 12. Histological hallmarks of Alzheimer's disease . Immunohistochemistry against tau protein highlights neurofibrillary tangles (arrows) and Alzheimer's type plaques (*).
aggregation, mitochondrial function, and cell-to-cell communication (glial and/or neuronal) • Survival vs apoptosis factors - Neurons are continuously signaled throughout life by autocrine, paracrine, and endocrine factors to varying degrees, which promote survival and prevent programmed cell death apoptosis Polypeptide factors known as neurotrophins influence survival, differentiation, proliferation, and apoptosis of both neuronal and glial cells Examples include : nerve growth factor, brain-derived neurotrophic factor, glial-derived neurotrophic factor, ciliary neurotrophic factor, insulin-like growth factor Secreted neurotrophins can be taken up at nerve terminals and retradely transported to the cell body to exert their effect or act as secreted ligands with action on specific cell surface receptors, which activate second messenger cascades Pathological conditions such as hypoxia/ischemia, electrolyte abnormalities, trauma, neuroinflammation, toxic exposures, and genetic abnormalities can all induce apoptosis through a variety of pathways in the central and peripheral nervous systems (CNS/PNS)
Alzheimer's Disease (AD) • ClinicallEpidemiology - AD is the most common of the neurodegenerative diseases with an increasing incidence every decade of life - Slight female over male prevalence - World wide disease affecting all races
- The prevalence roughly doubles every 5 years, starting from a level of 1% for the 60- to 64-year-old population and reaching 40% or more for some 85- to 89-year-old cohorts - Disturbances in recent memory formation, difficulties carrying out activities of daily living, language impairment, deficits in spatial ability and orientation, and alterations in mood and behavior are the clinical hallmarks of AD - AD progresses with much variability in individuals with an average of 1-3 years of early symptoms before diagnosis, 1-3 years from diagnosis until need for more intensive care from family or nursing home, and then 1-3 years before death • Gross and histological neuropathology - Brains show variable cerebral atrophy with hippocampi and adjacent temporal cortices showing consistent diminution in size - Frontal and parietal lobes also often show diffuse atrophy with narrowed gyri and widened sulci, and occipital lobes are less affected - Coronal slices invariably display thinned cortical gray matter strips and enlarged ventricular system underscoring the widespread neuronal loss - The microscopic hallmarks of this disease are amyloid plaques, neurofibrillary tangles, neuronal loss, and reactive glial changes (Figure 12) - AD plaques can be visualized with Congo Red stain and are composed of A~ protein deposits forming amyloid surrounded by degenerating neuritic processes - The majority of AD brains also show amyloid angiopathy Neurofibrillary tangles are intracellular inclusions of a variety of shapes composed of several proteins with
521
Molecu lar Genetic Pathology
20-26
Table 3. Genes Associated with Alzheimer's Disease Protein
Disease onset; transmission
Gene
Chromosome
APP
Chrom 2 1q2 1
Amyloid P-(A4) precur sor protein
Early onset; autosomal dominant
PSENJ
Chrom 14q24.3
Presenilin I
Early onset; autosomal dom inant
PSEN2
Chrom Iq31-q4 2
Presenilin 2
Early onset; autosomal dominant
ApoE (risk factor gene)
Chrom 19q13.2
Apolipoprotein E
Late onset; sporadic increased risk of AD (104 allele) decreased risk AD (102 allele)
the microtubule-associated protein tau being the predominant; they are best seen with silver stains such as Bodian or Bielschowski or immunohistochemistry against tau
-
Mutations in APP, PSENJ , or PSEN2lead to accumulations of atypical Ap-peptide, which makes up the major protein component of amyloid plaques
-
Tau mutations have been identified in frontotemporal dementias (see below in the section on Tauopathies), a group of disorders that are thought to exi st in a spectrum with AD
-
The "taucentric" and "amyloidocentric" view points of AD neurodegeneration may converge at the level of PSEN:
• Genes associated with sporadic and famili al AD (Table 3) -
-
-
Approximately 75% of AD cases are thought to be sporadic, 25% hereditary with the latter group showing either early or late onsets Mutations in Pre senilin ([PSEN], PSENJ, PSEN2), or am yloid precursor protein (APP) genes account for the majority of early onset familial AD, but there exi sts a wide spectru m of mutations in these genes as well as variable clinical and pathologic presentations
amyloid plaques • PSEN is a core component of the y-secretase responsible for the accurate cleavage of the Ap-peptide
Individuals with trisomy 21 who survive beyond 45 years of age nearl y all de velop AD changes A genetic susceptibility gene for the apolipoprotein E (ApoE) protein has been identified in sporadic AD
-
• PSEN mutations lead to both tau tangles and
ApoE has 3 alleles: ApoE £2, ApoE £3, and ApoE £4. Individuals that produce the £4 form are at a greater risk for developing AD , while those that have the £2 have decreased risk
-
Polymorphisms in the Ap oE isoforms may also confer variable susceptibility
-
Gen etic testing for the ApoE alleles is not generally done out side of the research setting, as the beneficial/detrimental effects are not absolute
-
Investigators are acti vely looking for other risk factorassociated genes using link age analys is
-
• Diagnosis -
An increa sed number of plaques and tangles combined with the appropriate clini cal course are used to make the post-mortem diagnosis of AD
-
Mo st pathologists will follow diagnostic guidelines of the NIA-Reagan and Con sortium to Establi sh a Registry for AD criteria
-
Pre-mortem diagnosis of spora dic AD relie s on clinical history combined with clinica l, cognitive, and laboratory ex amin ation s to help rule in AD and rule out other form s of dementias
• Possible mole cular mechani sms of pathogenesis of AD - Controversy over the relati ve importance of the plaques vs tangles in the pathogenesis of AD has exi sted for many years in the neuroscience research community of "tauists and PAPPtists" -
-
522
Prior head trauma predi sposes to AD , with the proposed mechanism being a "sensitization" of glia and the neuroimmune respon se, though the exact molecular triggers are not known
Genetic anal ysis in famil ial AD with appropriate genetic counseling is available for PSENJ, but because of the small number of families with mutations in PSEN2 and APP, testin g for these genes is currently only done in research lab s
Plaques are extracellular deposits of fibril s and am orphous aggregates of amyloid p-peptide (Figure 13)
-
Neurofibrillary tangles are intr acellular fibrillar aggregates of tau that exhibit hyperphosphorylation and oxidative changes
Imaging modalities to look for hydrocephalus and generalized cortical and hippocampal atrophy may complement the clinical dia gno sis
-
"Functional" imaging studies such as positron em ission tomography (PET) , functional magnetic resonance
20-27
Molecular Pathology of the eNS
Senile plaque
APP
Extracellular
Cell membran e I
I
!"
! '
Intracellular
I I I
C83
I I
I
J
Cgg
Fig . 13. APP processing and Ap-accumulation. Mature APP (center, inside dashed box) is metabolized by 2 competing pathw ays, the n-secretase pathway that generates sAPPa and C83 and the p-secretase pathway that generates sAPPP and C99 . Some p-secretase cleavage is displaced by 10 amino acid residues and generates sAPPp' and C89 . All carboxyterminal fragments (C83 , C99) are substrates for y-secretase, generating the APP intracellular domain, and respectively, Ap , among others. Ap aggregates into small multimers (dimers, trimers, and so on) known as oligomers. Oligomers appear to be the most potent neurotoxins, while the end stage senile plaque is relatively inert. (Adapted from Gandy, S. 2005 ; used with permission from J. Clin. Invest.)
imaging, and radioligands used for identifying AD pathology are under investigation
-
Lewy bodies (LB) : round and eosinophilic cytoplasmic inclusions surrounded by a pale halo, found within the neurons of the substantia nigra (Figure 14), locus ceruleus, nucleus basalis of Meynert, medulla, and thalamus (less frequently in numerous other nuclei)
-
Lewy neurites (LN): dystrophic neurites found in similar distribution but also in amygdale and hippocampus
Parkinson's Disease (PD) • Clinical/Epidemiology - PD affects approximately 1% of population over 65 -
-
Disease onset for sporadic PD varies from 20 to 80 years of age but is most common from 55 to 65; familial forms may occur much early Found throughout the world but with variable prevalence in different race s and countries
LB and LN immunostain positively with antibodies against e-synuclein and ubiquitin -
- Slightly higher prevalence in males over females - Hallmark clinical findings are bradykinesia, resting tremor, rigidity, and postural instability
• Gene s associated with PD
- Some patients also have overlapping symptoms (and pathology) with AD - Autonomic, cognitive, and psychiatric disturbances affect some patients • Gross and histologic neuropathology -
Pallor of substantia nigra and locus ceruleus grossly
Loss of dopaminergic nigrostriatal neurons and noradrenergic neurons in the substantia nigra and locus ceruleus, respectively, leads to the clinical manifestations of PD Monogenic linkages to PD have only been discovered in the last 10 years , though recognition of familial genetic component has been known for much longer
-
A diverse set of 10 or more genes is now known to lead to dopaminergic neuron degeneration and PD or related disorders (Table 4)
523
20-28
Molecular Genetic Pathology
Fig. 14. Neuromelanin-containing neurons of the substantia nigra with center neuron displaying a Lewy body.
Table 4. Loci and Genes Associated with Familial PD or Implicated in Sporadic PD
Locus PARKI and PARK4
Chromosome location
Inheritance pattern
Gene
4q2l-q23
ti-Synu clein
AD
Earlier onset , features of DLB common
Parkin
Usually AR
Earlier onset with slow progre ssion
Typical phenotype
PARK2
6q25 .2-q27
PARK3
2pl3
unknown
AD,IP
Classic PD, sometimes dementia
PARK5
4pl4
UCH-Ll
Unclear
Classic PD
PARK6
Ip35-p36
PINKI
AR
Earlier onset with slow progre ssion
PARK7
Ip36
DJ-I
AR
Earlier onset with slow progression
PARK8
l2p 11.2-q 13.1
LRRK2
AD
Classic PD
PARK9
lp36
ATP13A2
AR
Juven ile parkinsonism plus multisystem involvement
PARK 10
lp32
unknown
Unclear
Classic PD
PARK11
2q36-q37
unknown
Unclear
Classic PD
Synphilin- J
Unclear, ?AD
Classic PD
NR4A2
Unclear, ?AD
Classic PD
NA
5q23 .l-q23.3
NA
2q22-q23
Abbreviations: NA, not assigned; AD, autosomal dominant; AR, autosomal recessive; Ip, incomplete penetrance; oLB, dementia with Lewy bodies Adapted from Moore OJ, et al., 2005
- a-Synuclein was the first gene identified with mutations associated with familial PD; polymorphisms in the promoter region may be associated with increase risk of sporadic PD
524
-
10% of all early onset familial PD cases are due to a wide variety of mutation s in the parkin gene, which encodes for a protein important in the ubiquitination pathway
Molecular Pathology of the eNS
20-29
mtDNA alterations
-----Oxidative stress
--+
~
I I
1"
+~ " par~
/'
"
I
\
I I
I
PINK1
DJ-1
¥"
I
,/
~CH-L1
Oxidative ~ ~ ..J.- ;. , / stress - - - . u -Synuclein \ / aggrega tion - - - - - ,
t
DA oxidatio n
t
n -Synuclein . - - -
---+
DA UPS
Fig. 15. Common pathways underlying PO pathogenesis. Mutations in five genes encoding ti-synuclein, parkin, UCH-Ll , PINKl, and DJ-l are associated with familial forms of PO through pathogenic pathways that may commonly lead to deficits in mitochondrial and ubiquitin-proteosornal system function. Mitochondrial and ubiquitin-proteosomal system dysfunction, oxidative stress, and u-synuclein aggregation ultimately contribute to the demise of OA neurons in PO. Red lines indicate inhibitory effects, green arrows depict defined relationships between components or systems, and blue-dashed arrows indicate proposed or putative relationships. (Adapted from Moore, OJ., et al.; used with permission from Annual Reviews .)
• Possible molecular mechanisms of pathogenesis of PO - Mitochondrial dysfunction and oxidative stress are thought to be important contributors to neuronal death in PO - Complex I deficits are found in mitochondria from sporadic and familial PO patients -
Pesticides and toxins such as l-methyl-4-phenylI,2,3,6-tetrohydropyridine (MPTP) can affect complex I function and have been implicated in PO
-
MPTP is a contaminant in synthetic opiate production that was accidentally injected by a group of individuals who then developed PO-like syndrome • o-Synuclein • The physiologic role of a-synuclein is unknown, but it is associated with lipid rafts, which may be important in synaptic vesicles and synapse formation and function • a-Synuclein fibrils are important components of LB and LN, and mutations in the gene promote increased fibrillar aggregations • Overexpression of normal n-synuclein in sporadic AD may occur and increase LB/LN formation • Oxidative damage may playa role in the aggregation of u-synuclein in sporadic PO, and
mutant a-synuclein can interact with mitochondria to increase sensitivity to mitochondrial toxins
• c-Synuclein may interact with tau or amyloidogenic proteins to increase aggregation • The important role for a-synuclein in both forms of familial PD as well as all sporadic PD place PD as the most prominent diseases known as "synucleinopathies" • Dementia with LB also called diffuse Lewy body disease is also a synucleinopathy associated with cognitive decline, hallucinations, and Parkinsonism and neuropathology showing n-synuclein aggregates in classical LB and diffuse cortical LB • Multiple system atrophy is a sporadic, adult onset neurodegenerative disease with unknown cause, clinically characterized by variable Parkinsonism cerebellar and pyramidal signs, and autonomic failure; histologically characterized by n- synuclein-positive glial cytoplasmic inclusions • Parkin • Parkin function s as an E3 ubiquitin protein ligase import for ubiquitination of proteins targeted for proteosomal degradation (Figure 15)
525
Molecular Genetic Pathology
20-30
• Parkin may also function as a neuroprotectant molecule by interacting with mitochondria and preventing apoptosi s
Amyotrophic Lateral Sclerosis (ALS) or Motor Neuron Disease (MND)
• Mutations cause a loss of function of this ubiquitin-proteosomal system and accumulation of neurotoxic proteins and/or loss of the neuroprotectant function
• Clinical - ALS is a disease with patients presenting both upper and lower motor neuron signs, which leads to paralysis and death usually within 2-5 years
• Parkin and PINKI have been shown to act in a common genetic pathway • Ubiquitin carboxyl-terminal hydrolase Ll (UCH-Ll) • UCH-Ll is a highly abundant, neuron-specific protein that belongs to a family of deubiquitinating enzymes that are responsible for hydrolyzing polymeric ubiquitin chains to free ubiquitin monomers
• It may also function as an ubiquitin protein ligase • UCH-Ll can be found in LB in sporadic PD • How mutated UCH-Ll contributes directly to PD is not known • PINKI • Phosphatase and tensin homologue (PTEN) induced kinase-l physiologic function is not currently known • PINKI has a mitochondrial targeting sequence and a conserved domain similar to Calciumcalmodulin kinase family • Mutations are thought to cause a loss of function in the putative kinase activity leading to mitochondrial dysfunction and PD • OJ-I • Ubiquitously expressed protein in neurons and glia belonging to the OJ-trhiJlPfpI superfamily • DJ-I does not colocalize in LB but is found associated within a number of neurodegenerative tauopathies and with a-synuclein-positive glial inclusions in multiple system atrophy • Insoluble forms are increased in brains of sporadic PD patients • Physiologic function of OJ-I is unclear but it may function as an anti-oxidant protein or as a sensor of oxidative stress • DJ-l may be a component of the ubiquitinproteosomal system and may confer protection by functioning as a molecular chaperone or protease to refold or promote degradation of misfolded proteins • Diagnosis - Clinical diagnosis relies on history, observation of clinical manifestations, and initial responsiveness to dopaminergic agonist therapy - Neuropathological exam ination at autopsy is required to confirm diagnosis
526
- Generally affects older individuals (50-70 years) with an annual incidence of 1-2/100,100 and overall lifetime risk of 11800 - Slight male to female preponderance (1.3:1-1.6:1) - There is patient-to-patient variability in terms of muscle areas affected initially and the pattern of progressive spread to eventually most muscle groups - Some patients present with prominent bulbar symptoms secondary to early and more extensive loss of cranial nerve motor neurons - Upper motor neuron signs include: clonus and hyperreflexia - Lower motor neuron signs include: muscle atrophy, weakness , and fasciculations - The cause is unknown with 90% of cases being sporadic and 10% familial - Some epidemiological studies suggest the incidence is increasing • Gross and histological neuropathology - Gross changes are not usually noted in the brain, though in long-term surviving patient's, atrophy of the precentral gyrus can be seen - Spinal cord anterior motor nerve roots are notably thinned compared with posterior sensory nerve roots - Depletion of upper (corticospinal, Betz cells) and lower motor neurons as well as cranial nerve motor neurons are the histological hallmarks of ALS - The lateral and anterior medial corticospinal tracts are depleted (lateral sclerosis) - Skeletal muscle deprived of innervation shows grouped atrophy, small acutely angulated fibers, and fiber-type grouping - Skein-like inclusions and Bunina bodies are cytoplasmic inclusion s that are often found in motor neurons of ALS patients - Reactive astrocyte s and microglia are found in the anterior horns of the spinal cord and motor cortex of the cerebrum • Genes associated with and possible molecular mechanisms of pathogenesis of ALS - Familial ALS represents about 10% of cases (Table 5), and within this group there is significant phenotypic and genotypic heterogeneity - While genetic loci have been identified for many of the familial cases of ALS, the function of these genes and their relationship to ALS pathogenesis is largely unknown
Molecular Pathology of the eNS
20-31
Table 5. Genes Associated with Familial ALS/MND Reported FALS/MND loci Adult onset dominant typical ALS ALSl a ALS3 ALS6 ALS7 Adult onset dominant atypical ALS ALS with frontotemporal dementia ALS with dementiaJParkinsonism Progressive LMN disease ALS8 Juvenile onset dominant ALS ALS4 Juvenile onset recessive ALS ALS2 ALS5
Gene
Chromosomal location
SODl
21q22,1 l8q2l l6ql2 20ptel-pl3
MAPT DCTN] VAPB
9q21-q22 l7q21.1 2pl3 20q13.3
SETX.
9q34
ALS2
2q33 l5qI5.1-q21.1
ALS, amyotrophic lateral sclerosis; LMN, lower motor neuron; MND, motor neuron disease; SOD I , superoxide dismutasel ; MAPT, microtubule associated protein tau; DCTNI, dynactin pl50 subunit; VAPB, Vesicle associated membrane protein; SETX, senataxin " Note that both dominant and recessive linked-SOD I mutations have been reported. (modified from Gros-Louise, et al. 2006)
- The search is on for modifier genes and polymorphisms in sporadic ALS - Small studies of sporadic ALS patients have identified possible altered genes/polymorphisms that need to be confirmed in larger studies: VEGF, EAAT2, GluR2, ciliary neurotrophic factor, SMN], SMN2, ApoE, and NEFH -
• The exact mechanism by which mutated SOD] causes ALS is not known despite its discovery >13 years ago • A dominant negative toxic gain of function mechanism is thought to be involved in SOD] pathogenesis
Epigenetic and genetic causes have been postulated to bring about a number of cytotoxic phenotypes, though direct links are not well established (Figure 16)
• Recent animal studies have suggested that mutant SOD] expression must be in both glial as well as neuronal cell s for the ALS -like disease to manifest
• SOD]
•
• Copper-Zinc superoxide dismutase-I was the first gene identified for familial ALS, and mutations account for 20 % of familial cases •
Ubiquitously expressed cytoplasmic protein that detoxifies the reactive molecule superoxide to oxygen and H20 2 , which can be then be cleared by catalase and glutathione peroxidase
• > I00 mutations have been identified, but the phenotypic variability even in families with the same mutation suggests that other genes and/or environmental factors are important •
Rodent transgenic model s with human SOD] mutations display similar clinical and pathological features and have been important research tools
Hypothesized mechanisms for SOD] toxicity include: excitotoxicity, oxidative stress, mitochondrial dysfunction, inflammation, axonal transport defect, and/or toxic aggregation with likely some combination of the above
• TDP-43 • Tran s-activating region (TAR) DNA-binding protein-43, a newly identified protein that aggregates with ubiquitin and other proteins in frontotemporal dementias and many cases of ALS •
Interestingly, initial reports show that it is found only in sporadic ALS cases and not SOD] familial cases, suggesting possible different modes of degen eration in familial and sporadic ALS
527
20-32
Molecular Genetic Pathology
Activated astroglial cell Decreased glutamate uptake by astroglial cell because of loss of EAAT2 receptor
Modulation by growth factors , e.g., VEGF,IGF
Activat ion of caspases 1 and 3 Activated microglia
Motor neuron
Fig. 16. Molecular and cellular processes possibly implicated in pathogenesis of ALS. (Adapted and used with permission from Bruijn L. et al., 2004; used with permission from Annual Reviews.)
• Normal physiological function and role in the pathophysiology of ALS remain to be elucidated • Diagnosis - Patients are diagnosed with ALS based on the EI Escorial criteria that categorizes patients as clinically definite, probable, or possible for ALS based on degree of upper and lower motor neuron findings - Less commonly muscle biopsies are performed (often to rule out other diseases) - SOD] genetic testing is available and should be considered in the setting of familial ALS with appropriate genetic counseling - Autopsy findings confirm the diagnosis
Tauopathies • General comments: - Tau is a microtubule-associated protein that binds microtubules and promotes microtubule assembly, essential components of the cytoskeleton Tau is abundantly expressed in the CNS and exists in six isoforms created by alternative mRNA splicing of a single gene The different isoforms have either 3 or 4 microtubulebinding repeat sequences with similar ratios of either 3 or 4 repeat isoforms normally expressed; varying this ratio appears to confer susceptibility to some neurodegenerative disease later in life
528
- Tau is also a major component of atypical protein aggregates found in paired helical filaments in AD and in a number of other neurodegenerative diseases collectively thought of as tauopathies - Mutations in the tau gene and/or altered phosphorylation states have been identified in many of these diseases
FTDP-17T • Frontotemporal dementia and Parkinsonism linked to chromosome 17 associated with tau gene mutations • Adult onset, slowly progressive neurodegenerative disease • Clinically characterized by variable cognitive, behavioral, and motor dysfunction • Diffuse deposition of tau aggregates in neurons and glia can be identified with silver stains and tau immunohistochemistry • Mutations have been identified in multiple sites (exonic and intronic) of the tau gene • Autosomal dominant transmission
Progressive Supranuclear Palsy • Multi-system degeneration characterized by symptoms of Parkinsonism and supranuclear ophthalmoplegia • Slowly progressive disease affecting middle- and lateaged individuals • No established genetic or epigenetic etiologies and most (if not all) cases are sporadic
20-33
Molecular Pathology of the eNS
Fig. 17. Gross image of superior surface of a brain from a patient with Pick's type frontotemporal dementia. Note the widely spaced, so-called "knife-edge" gyri in the frontal lobes.
• Polymorphisms in the tau gene have been identified, and sporadic cases are associated with a homozygous HI haplotype and overexpression of the 4 repeat tau isoform • Neurofibrillary tangles, neuropil threads, and glial fibrillary tangles can be identified in multiple areas but tend to concentrate in substantia nigra, basal ganglia, subthalamic nucleus, and brainstem • Kinase/phosphatase dysregulation may be involved in the pathogenesis of progressive supranuclear palsy
Corticobasal Degeneration • Adult onset, neurodegenerative disease with focal pathology and corresponding clinical phenotype of primary apha sia, dementia, visual inattention, or rapidly progressive mutism • Neuropathology consists of focal cortical or deep gray matter degeneration with tau-positive neurons and glia • Most cases are sporadic; several familial cases have been reported, though they share overlapping pathology and genetics with tau mutations similar to FTDP-17 • Sporadic cases are associated with a homozygous HI haplotype and overexpression of the 4 repeat tau isoform • The histological hallmark of corticobasal degeneration is swollen or "balloon" neurons in the affected area • Balloon neurons, neuropil threads, as well as occasional other neurons and glia contain tau-positive aggregates within their cytoplasm
Pick's Disease • Frontotemporal degeneration with 3 clinical patterns: behavioral syndrome referred to as frontotemporal
dementia, progressive non-fluent aphasia, and semantic dementia • Majority of cases are sporadic • Familial cases with defined tau mutations have been reported and called "atypical Pick's disease" but may be better recognized as some other tauopathy distinct from Pick's • The sporadic form is not related to HI or H2 haplotypes and appears to be a 3 repeat tau disorder • Gross neuropathology shows variable marked atrophy ("knife-edge" atrophy) of the frontal , temporal, and parietal lobes with consi stently preserved pre-central gyrus and posterior two-three of the superior temporal gyrus (Figure 17) • Pick bodies, round cytoplasmic fibrillar inclusions, are consistently found in the fascia dentata of the hippocampus and less common in other nuclei and cortical neurons • Pick bodies are highlighted with silver stains or tau or ubiquitin immunohistochemistry • Extensive neuronal loss, gliosis, and occasionally ballooned neurons are seen in affected areas
Tri-Nucleotide Repeat Diseases • General comments: - These disorders are caused by expanding triplet repeat of nucleotides and affect primarily the CNSIPNS (Table 6) - Generally the larger the number of repeats the more severe the disease - "Anticipation," a key genetic feature in these diseases, is the earlier age of onset in successive generations within a family
529
Molecular Genetic Pathology
20-34
Table 6. Triplet Repeat Disorders Affecting the Nervous System Symptoms
Gene
Locus
FXN
9q13--q21.1
Fragile X syndromeA Fragile X syndrome E Dystrophia myotonica I Spinocerebellar ataxia 8 Spinocerebellar ataxia 12
Ataxia, weakness, sensory loss Mental retardation Mental retardation Weakness, myotonia Ataxia Ataxia
FMRI FMR2 DMPK Antisenseto KLHLl PPP2R2B
Xq27.3 Xq28 19q13 13q21 5q31--q33
Huntington disease-like2
Chorea, dementia
lPH3
16q24.3
AR
Xq13--q21
Disease Non-coding repeats Friedreichataxia
Polyglutamine disorders Spinal and bulbar muscular atrophy Huntington disease Dentatorubralpallidoluysian atrophy Spinocerebellarataxia I Spinocerebellarataxia 2 Spinocerebellarataxia 3 (Machado-Joseph disease) Spinocerebellarataxia 6 Spinocerebellar ataxia 7 Spinocerebellarataxia 17 Polyalaninedisorders Oculopharyngeal dystrophy Congenital central hypoventilation syndrome Infantile spasms Synpolydactyly
Weakness
Protein
Frataxin Fragile X mental retardation I protein Fragile X mental retardation 2 protein Dystrophiamyotonica protein kinase Undetermined Regulatory subunitof the protein phosphatase PP2A Junctophilin 3 Androgen receptor
Chorea, dementia Ataxia, myoclonic epilepsy, dementia Ataxia Ataxia Ataxia
ITI5 DRPLA
4p16.3 12p13.31
Huntingtin Atrophin I
SCAl SCA2 SCA3/MJD
6p23 12q24.1 14q32.l
Ataxin I Ataxin 2 Ataxin 3
Ataxia
CACNAIA
19p13
Ataxia Ataxia
SCA7 rBP
3p12-p13 6q27
channel subunit Ataxin 7 TATA box binding protein
Weakness
PABPNI
14q11.2--q13
Poly(A)-binding protein 21
Respiratory difficulties
PHOX2B
4pl2
Mental retardation, epilepsy ARX Limb malformation HOXD13
Xp22.13 2q31--q32
a-I a voltage-dependent calcium
Paired-like homeobox 2B Aristaless-related homeobox, X-linked Homeobox D13
Adapted from Di Prospero and Fischbeck, 2005
-
A variety of modes of inheritance exist including : AR, AD, X-linked
- Pathogenesis is not well understood, but likely involves loss of function and/or toxic gains of function of affected proteins
Huntington's Disease (HD) • Clinical - Autosomal dominant transmitted disease with near complete penetrance characterized by chorea and progressive cognitive and behavioral disorders - Mean age of onset: 40 years
530
- Prevalence of 5-10/1 00,000 • Gross and histologic neuropathology Classic gross appearance of the brain on coronal section is widened lateral ventricles and atrophied , flattened caudate and putamen nuclei - Advanced cases show global brain atrophy Neuronal loss and reactive astrocytosis in affected areas Polyglutamine expanded repeats cause an accumulation of the abnormal protein and formation of nuclear inclusions within cells of the striatum and cortex Atrophy and neuronal loss correlate with severity of clinical disease
20-35
Molecular Pathology of the eNS
• Genes associated with HD - Autosomal dominant form of disease (90% cases; 10% occur de novo) caused by expanded CAG repeats (>36) coding for polyglutamines in the HD gene (lTI5) product huntingtin • Possible molecular mechani sms of pathogenesis of HD - Huntingtin's normal function s are thought to include roles in transport, transcription, and neurogene sis - The abnormal mutated form of huntingtin with increased glutamines in the amino terminus can form protein aggregates with other proteins including ubiquitin - How the inclusions lead to cellular dysfunction and degeneration is not known - Energy depletion, increased apoptosis, impairment of the proteosome-ubiquitin system, oxidative stre ss, and excitotoxicity of susceptible neurons have all been hypothesized to be involved in the pathogenesis ofHD • Diagno sis - Based on a thorough clinical history, physical and cognitive examination CT scanning to look for striatal atrophy can be helpful Geneti c testing for the mutation s of the ITJ5 gene can be done in affected individuals and family members
- Slow progress with loss of ambulation in about 5-15 years - Patients have loss of deep sensation and deep tendon reflexes and cerebellar signs including an ataxic speech disorder - Cardiomyopathy is frequent and can lead to cardiac failure - Adult onset diabete s in 10-32% • Gross and histological neuropathology Spinal cord and dorsal roots are atrophic - Loss of large myelinated axons and dorsal root ganglion cells - Degeneration of dorsal column tracts and spinocerebellar tracts - Cerebellum shows white matter gliosis and dentate nucleus degeneration - Polyglutamine expanded repeats cause an accumulation of the abnormal protein and formation of nuclear inclusions within cells of the striatum and cortex • Gene s associated with FA Homozygous GAA-repeat expan sion within the first intron of the frataxin gene - Repeats in FA can range from 67 to 1700 (normal
6-34) • Possible molecular mechanisms of pathogene sis of FA
Genetic counseling is essential Fetal genetic testing and in vitro fertilization with pre-implantation screening can be performed at some medical centers
Friedrich's Ataxia (FA) • Clinical - Most common inherited ataxia with world wide distribution - European prevalence of 1129,000 and carrier status of 1:85 - Autosomal recessive - 85% have onset before age 20; late adult onset is also seen less commonly
- Frataxin is a mitochondrial protein involved in iron metabolism - Increased repeats lead to decrea sed frataxin levels and iron accumulation - Increased iron is thought to contribute to increa sed oxidative stress, decreased oxidative phosphorylation, and reduced activity of mitochondrial enzyme complexes containing iron-sulfur clusters • Diagnosis - Based on satisfying major and minor clinical criteria with emphasis on early onset, progressive ataxia , and sensory dysfunction Genetic testing is widely available to support clin ical diagnosis; especially helpful in atypical presentation s
SUGGESTED READING
CNSThmors Fuller CE , Perry A. Molecular diagnostics in central nervous system tumors. Adv Anat Pathol. 2005 ;12(4):180-1 94. Hartmann C, Mueller W, von Deimling A. Pathology and molecular genetics of oligodendroglial tumors. J Mol Med. 2004 ;82( I0):638-655.
Hartmann C, Mueller W, Lass U, Kamel-Reid S, von Deimling A. Molecular genetic analysis of oligodendroglial tumors. J Neuropathol Exp Neurol. 2005;64(1) :10-14. Houillier C, Lejeune J, Benouaich-Amlel A, et at. Prognostic impact of molecular markers in a series of 220 primary glioblastomas. Cancer 2006 ; I06( I0):2218-2223.
531
20-36
Ichimura K, Ohgaki H, KJeihues P, Collins VP. Molecular pathogenesis of astrocytic tumours. J Neurooncol. 2004;70(2):137-160. Kelley TW, Tubbs RR, Prayson RA. Molecular diagnostic techniques for the clinical evaluation of gliomas. DiagnMol Pathol. 2005;14(I):1-8. Louis DN, Ongaki H, Wiestler OD, Cavenee WK. International Agency for Research on Cancer (IARC). WHO Classification of Tumors of the CentralNervousSystem. Lyon : IARC; 2007.
Molecular Genetic Pathology
Bruijn LI, Miller TM, Cleveland DW. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci. 2004;27:723-749. Cookson MR. The biochemistry of Parkinson's disease. Annu Rev
Biochem. 2005;74:29-52. Di Prospero NA, Fischbeck KH. Therapeutics development for triplet repeat expansion diseases. Nat Rev Genet. 2005;6(10):756-765.
Melean G, Sestini R, Ammannati F, Papi L. Genetic insights into familial tumors of the nervous system. Am J Med Genet C Semin Med Genet. 2004;129(I):74-84.
Dickson D. Neurodegeneration: the Molecular Pathology of Dementia and Movement Disorders. Basel, Switzerland: International Societyof
Ohgaki H, KJeihues P. Population-based studies on incidence, survival rates, and genetic alterations in astrocytic and oligodendroglial gliomas. J Neuropathol Exp Neurol. 2005;64(6):479-489.
Gray F, De Girolami D, Poirier J. Escourolle & Poirier manual of basic neuropathology. 4th ed. Philadelphia; Butterworth: Heinemann; 2004 .
Perry A, Gutmann DH, Reifenberger G. Molecular pathogenesis of meningiomas. J Neurooncol. 2004;70(2):183-202 .
Ores-Louis F, Gaspar C, Rouleau GA. Genetics of familial and sporadic amyotrophic lateral sclerosis. Biochim BiophysActa. 2006; 1762(11-12) :956-972.
Reifenberger G, Collins VP. Pathology and molecular genetics of astrocytic gliomas. J Mol Med. 2004;82(10):656-670. Rickert CH. Prognosis-related molecular markers in pediatric central nervous system tumors. J Neuropathol Exp Neurol. 2004;63(12):1211-1224. Rickert CH, Paulus W. Comparative genomic hybridization in central and peripheral nervous system tumors of childhood and adolescence. J Neuropathol Exp Neurol. 2004;63(5):399-417.
Neurodegenerative Diseases Armstrong RA, Lantos PL, Cairns NJ. Overlap between neurodegenerative disorders. Neuropathology 2005;25(2):111-124 . Beal MF. Mitochondria take center stage in aging and neurodegeneration.
Ann Neurol. 2005;58(4):495-505. Bertram L, Tanzi RE. The genetic epidemiology of neurodegenerative disease. J Clin Invest. 2005;115(6):1449-1457.
532
Neuropathology; 2003
Josephs KA, Petersen RC, Knopman DS, et al, Clinicopathologic analysis of frontotemporal and corticobasal degenerations and PSP.
Neurology 2006;66(1):41-48. Marchetti B, Abbracchio MP. To be or not to be (inflamed)-is that the question in anti-inflammatory drug therapy of neurodegenerative disorders? Trends Pharmacol Sci. 2005;26( I0):517-525. Mattson MP. Pathways towards and away from Alzheimer's disease.
Nature 2004;430(7000):631-639. Moore DJ, West AB, Dawson VL, Dawson TM . Molecular pathophysiology of Parkinson's disease. Annu Rev Neurosci. 2005;28:57-87. Roy S, Zhang B, Lee VM, Trojanowski JQ. Axonal transport defects: a common theme in neurodegenerative diseases. Acta Neuropathol (Berl). 2005;109(1):5-13.
21
Molecular Virology Josephine Wu, DDS, CLSp(MB), CLDir, Mona Sharaan, and David Y. Zhang, MD, PhD, MPH
MD,
CONTENTS
I. General Limitation and Pitfalls Specimen Types Assay Performance Analysis
II. Human Immunodeficiency Virus (HIV) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Clinical Utility
III. Hepatitis C Virus (HCV) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Pitfalls Clinical Utility
IV. Hepatitis B Virus (HBV) General Characteristics Clinical Presentation Diagno stic Method s Specimens Conventional Tests and Problems Molecular Methods Pitfalls Clinical Utility
21-3 21-3 21-3 21-3
21-4 21-4 21-4 21-5 21-5 21-5 21-7 21-11
21-11 21-11 21-11 21-13 21-13 21-13 21-13 21-15 21-15
21-16 21-16 21-16 21-17 21-17 21-17 21-18 21-19 21-19
V. Cytomegalovirus (CMV) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests Molecular Methods Clinical Utility Laboratory Methods for Anti-viral Susceptibility Testing of CMV Isolates
VI. Epstein-Barr Virus (EBV) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
VII. Herpes Simplex Virus (HSV) General Characteristics Clinical Presentation Diagnostic Methods Specimen s Conventional Tests and Problems Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
21-20 21-20 21-20 21-20 21-20 21-20 21-21 21-22
21-22
21-25 21-25 21-25 21-26 21-26 21-26 21-27 21-28 21-28 21-28
21-28 21-28 21-28 21-29 21-29 21-29 21-29 21-30 21-30 21-30
533
Molecular Genetic Pathology
21-2
VIII. Varicella Zoster (VZV) General Characteristics Clinical Presentation Diagnostic Methods Specimens (Molecular Tests) Conventional Tests and Problems Molecular Methods Pitfalls Clinical Utility
IX. Human Papilloma Virus (HPV) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Pitfalls Clinical Utility
X. Influenza A, B, and
c.
General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
XI. Avian Influenza (Bird) Influenza (Flu) A Viruses General Characteristics Clinical Presentation Diagnostic Methods Culture Serologic Test Molecular Test Limitation
XII.
Adenovirus General Characteristics Clinical Presentation Diagnostic Methods Specimens (Molecular Test) Conventional Tests and Problems Molecular Methods
534
Pitfalls Clinical Utility
21-31 21-31 21-31 21-31 21-31 21-31 21-32 21-32 21-32
XIII. Respiratory Syncitial Virus (RSV) General Characteristics Clinical Presentation Diagno stic Methods Specimens Conventional Tests and Problems Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
21-32 21-32 21-33 21-34 21-34 21-34 21-34 21-37 21-37
XIV. Severe Acute Respiratory Syndrome (SARS) General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
21-37 21-37 21-38 21-38 21-38 21-38 21-38 21-38 21-39 21-39
21-39 21-39 21-40 21-40 21-40 21-40 21-40 21-40
21-40 21-40 21-40 21-42 21-42 21-42 21-42
xv.
Enterovirus General Characteristics Clinical Presentation Diagnostic Method s Specimens Conventional Tests and Problems Molecular Method s Sensitivity and Specificity Pitfalls Clinical Utility
XVI.
JC/BKVirus General Characteristics Clinical Presentation Diagnostic Methods Specimens Conventional Tests and Problems Molecular Methods Sensitivity and Specificity Pitfalls Clinical Utility
XVII. Suggested Reading
21-42 21-42
21-42 21-42 21-42 21-43 21-43 21-43 21-43 21-43 21-43 21-43
21-43 21-43 21-44 21-44 21-44 21-44 21-44 21-44 21-44 21-44
21-45 21-45 21-45 21-45 21-45 21-45 21-45 21-46 21-46 21-46
21-46 21-46 21-46 21-46 21-46 21-46 21-47 21-47 21-47 21-47
21-47
Molecular Virology
21-3
GENERAL
Limitation and Pitfalls • Traditional viral isolation by cell culture assays and conventional serological methods have been previou sly used to detect and identify various virus infections • More recently, however, molecular methods, i.e., hybridization and amplification techniques, have been developed that more accurately and rapidly detect viral organisms with improved sensitivity and specificity. Also, these advanced techniques provide laboratories with decreased hands-on time and shorter time to results • However, the routine implementation of nucleic acid (both DNA and RNA) amplification and hybridization methodologies is associated with limitations, particularly in the clinical laboratory. The se limitations and pitfalls include, but are not limited to: - Increased cost/test due to expensive instrumentation and reagents - Amplification carryover contamination - Standardization of positive and negative assay controls - Integrated co-amplified internal DNA control to demonstrate absence of polymerase (PCR) inhibitors and amplification - Prevention of false-positive and false-negative report s due to antigenic and pathogen nucleic acid sequence drift and accurate interpretation of data and software analyses
Specimen Types • Specimens: collection of adequate specimen material is important for molecular diagnosis of viruses - Whole blood : 3-5 mL collected in an ethylenediamine tetra acetic acid (EDTA) (lavender top) tube. Store at 4-25 °C. Do not freeze - Plasma: Collect 7-10 mL of whole blood in EDTA, acid citrate dextrose (ACD) solution A, or plasma preparation tubes (PPT) (Becton Dickinson, Franklin Lakes, NJ) sterile tube . Store whole blood at room temperature (18-30°C) for no >4 hours . Remove plasma from cells within 4 hours of collection by centrifugation at 1000g for 10-15 minutes. Do not clarify by filtration or further centrifugation. Store plasm a at -60 to -80°C within 30 minutes of separation. Plasma may also be stored at -20°C in hours if colder non-frost-free freezer for up to freezer is not available. Ship on dry ice for overnight delivery. The minimum volume of specimen is 2 mL of plasma - Urine: first 10-20 mL of void urine collected in a sterile urinalysis container (l5-mL sterile screw-cap tube preferred). Store at 4-25 °C for 6 months after initial infection
21-17
Molecular Virology
Sphe re
Dane particle 47 nm
preS1 22 nm
preS2
S
\/ L
M
S
/\ Filament
Variable length
Fig. 13. HBV viral particle and antigens. (Courtesy of Stephan Urban and Stefan Seitz University of Heidelberg Dept. of Molecular Virology). - Small percentage may develop chronic-persistent hepatitis with sequence fibrosis and cirrhosis - Incidence of hepatocellular carcinoma is increased with the viral genome found integrated in the cellular DNA in 75% of cases - May be associated with polyarteritis and cryoglobulinemia
Diagnostic Methods Specimens • Whole blood, serum, or plasma
Conventional Tests and Problems • Serological studies Viral antigens and particles (Figure 13) • Dane particle • dsDNA bilayered sphere • 42 mm diameter; 22 nm core • Rarely identified in infectious serum • Thought to be infectious virus particle
• HBsAg • Indicative of prior HBV exposure • Located on surface of Dane particle • Previously known as Australia antigen • HBcAg • Represents acute or chronic infection • 28 nm core of the Dane particle • HBeAg • Marker of HBV infection • Present in HBsAg-positive patients • Strong correlation with large serum concentrations of Dane particle and HbsAg • HBeAg is associated with high infectivity - Antibodies (Figure 14) • Anti-HBs • Antibody to surface antigen • Detected after disappearance of HbsAg • Protective properties • Anti-HBc
549
Molecular Genetic Pathology
21-18
ALT
IgG anti-HBc
~
a>
HBsAg
>
~
Qi
HBeAg
a:
HBV DNA
2
3
4
5
6
12
Months after infection
Fig. 14. Time course for appearance of viral antigens and antibodies in acute hepatitis B infection.
• Antibody to core antigen • Detected after appearance of HbsAg
- Equally amplifies genotypes A-E and reduces amplification of genotype F and G
• Used to confirm HBV infection when HBsAg and Anti-HBs are absent (window phase)
- Quantitative range : 1OO~O,OOO,OOO copies/mL
• Anti-HBe • Antibody to HBeAg antigen-brotective broperties
• Real-time PCR-LightCycler®(Roche Applied Science, Indianapolis, IN)/FRET hybridization probes
• Associated with low risk of infectivity in presence of HBsAg
Molecular Methods Qualitative • Cobas AmpliScreen HIV-l/HCV/HBV Tests (Roche Molecular Diagnostics) It detects HBV DNA in human plasma - It is intended to be used to screen donors for HBV DNA - LOD is 100 copies/mL - It targets the S gene
Quantitative • Used to establish baseline viral load (prior to therapy) and to monitor changes in viral load during therapy • Digene HBV DNA hybrid capture II (Digene Corporation, Gaithersburg, MD) Detection and quantitation of HBV DNA in serum - LOD : 4700 HBV DNA copies/mL - Quantitative range : 1.4 x 105 and 1.7 x 109 HBV copies/mL • PCR-Amplicor HBV Monitor and its semi-automated Cobas HBV Amplicor Monitor test (Roche) - Detection and quantitation of HBV DNA in serum or plasma - Uses the primers HBV-104UB and HBV-l04D to amplify a l04-bp sequence within the highly conserved pre-core/core region of the HBV genome
550
- LOD : 200 copies/mL
- It targets 259-bp fragment of S gene - Quantitative range : 250-5 x 108 copies/mL • Real-time PCR-Roche TaqMan Assay - Utilizes FRET technology and probes based on the detection of amplicon during temperature cycling -
It targets S gene
- LOD : 50 copies/mL - Quantitative range : 5-200,000,000 HBV IV/mL (3.0 x 107 copies/mL; 1 IV = 5.26 copies) • bDNA assay-(Versant Hepatitis B Virus DNA 3.0 Assay) (Bayer Corporation) - signal amplification directed to the 5' NC region and core regions of the HCV genome - Microwell plate format - LOD : 2000 copies/mL - Quantitative range: 2.0 x 103 to 1.0 X 108 HBV DNA copies/mL - Equivalent detection of genotypes A through F
Genotyping and Mutation Analysis • Currently used mainly for epidemiological purposes, rarely needed for clinical purposes - Line probe assay-LiPA ; INNO-LiPA HBV Genotyping assay, (Innogenetics N.V., Ghent, Belgium) • This method is based on the reverse hybridization principle, such that biotinylated amplicons hybridize to specific oligonucleotide probes that are
Molecular Virology
21-19
Quantitative assays HBsaAg
Serology and biochem istry
Digene r monitor
bONA 3.0 RealArt HBV
Sequence analysis
HBV variants HBV resistance
Immunohistochemistry histology DNA/RNA analysis
HBV cccDNA , Total DNA HBV pgRNA
Fig. 15. An outlines of the HBV assays available for testing of serum and liver biopsy samples.
immobilized as parallel lines on membrane-based strips . The amplified region analyzed overlaps the sequence encoding the major hydrophilic region of HbsAg - TRUGENE HBV Genotyping Kit (Bayer Corporation): • Sequencing and phylogenetic analysis of the preS IIpre-S2 region of the HBV genome • Identify HBV genotype, drug-resistance mutations, and anti-HBs escape mutations based on comparison of DNA sequence
Pitfalls • The analytical sensitivity and specificity of current realtime PCR assays allow for accurate quantification over a range of approximately 7-8 logs. They are not sufficient to quantify the very high HBV DNA levels that can be found in certain HBV-infected patients, which necessitates retesting these samples after dilution, a factor of quantification errors • Equal quantification of all HBV genotypes and robustness of quantification in the case of nucleotide polymorphisms has not been validated for the current commercial real-time PCR assays • Lack of standardized HBV DNA reportable units (such as copies/mL or genome equivalents/mL or IU/mL) • Not all assays are currently registered for use with plasma and serum • Precise cut-off thresholds for HBV DNA have not been established to guide medical decisions
Clinical Utility • Viral load testing is used for assessing and monitoring therapy response in HIBV infections (Figure 15) • In HBV carriers with active liver disease, HBV DNA loads are measured not only to assess patients regarding the need for either interferon-a or lamivudine (a DNA polymerase inhibitor) anti-viral therapy but also to monitor their effectiveness • An increase in HBV viral load is also used as a marker of the emergence of lamivudine-resistant viral mutants • Active chronic infections with HBV treated with lamivudine require surveillance for the emergence of lamivudine-resistant viral mutants . During lamivudine monotherapy point mutations at the active site of the polymerase gene (YMDD variants , i.e., specific amino acid motifs, Y =tyrosine, M =methionine, D =aspartate) occur with a frequency of 14-32% after I year in phase III studies, and in 42% and 52% of Asian patients after 2 and 3 years of therapy, respectively. The emergence of lamivudine resistance is detected by a rise in HBV viral load and confirmed by sequencing the active site of the DNA polymerase gene • The presence of HBV pre-core mutants may cause active liver disease despite the absence of HBeAg, the common marker for active hepatitis in hepatitis B infection . This may be due to either a premature stop codon point mutation in the pre-core gene (G1896A) or a mutation in the basal core promoter region downregulating HBeAg production, both of which can only be reliably detected genotypically
551
21-20
Molecular Genetic Pathology
CYTOMEGALOVIRUS (CMV)
General Characteristics • Member of Herpes family (type 5) characterized by 230-bp double-stranded linear DNA virus (Figure 16) with 162 hexagonal protein capsomeres surrounded by three distinct layers : a matrix or tegument , a capsid, and an outer envelope • CMV can reside latent in the salivary glands cells, endothelium, macrophages, and lymphocytes. CMV infection is asymptomatic in immunocompetent patients • The virus acts by blocking cell apoptosis via the mitochondrial pathway and causing massive cell enlargement, which is the source of the virus name • Clinically symptomatic patients are infants and immunocompromised adults . For infants, the mode of transmission is from the mother via the placenta, during delivery or during breast feeding • For adults, CMV transmission occurs from close contact with individuals excreting virus in saliva, urine, and other bodily fluids . Transmission of CMV has been reported from blood transfusion and organ transplant • By the age of thirty, approximately 40% of individuals are infected by CMV; by the age of 60, 80-100% of the population has been exposed to the virus
Clinical Presentation • CMV elicits both humoral and cellular immune responses . CMV presents as primary, latent, reactivated, and reinfection • Infectiou s CMV may be shed in the bodily fluids of any previously infected person, and thus may be found in urine, saliva, blood , tears, semen, and breast milk. The shedding of virus may take place intermittently, without any detectable signs • The incidence of primary CMV infection in pregnant women in the United States varies from 1-3%. Healthy pregnant women are not at special risk for disease from CMV infection. When infected with CMV, most women have no symptoms and very few have a disease resembling mononucleosis. It is their developing unborn babies that may be at risk for congenital CMV disease. CMV remains the most important cause of congenital viral infection in the United States • In infants and young children, typical features of the infection include hepatosplenomegaly, extramedullary cutaneous erythropoiesis, and thrombocytopenia and petechial hemorrhages. Encephalitis often leads to severe mental and motor retardation • For immunocompromised patients, CMV disease is an aggres sive condition. CMV hepatitis can cause fulminant liver failure . CMV infection can also cause CMV retinitis and CMV coliti s
552
Diagnostic Methods Specimens • Whole blood , urine, CSF, amniotic fluid, bone marrow, and biopsies
Conventional Tests • Histology and cytology with the use of IHC studies - General : • Cytomegalic intranuclear (owl's eye) inclusions in tissue are pathognomonic for CMV infection Advantage: • Specific and Definitive diagnosis • Confirm end organ disease along with virus infection diagnosi s Pitfalls • Invasive procedure required • Insensitive • Viral culture Conventional culture • Human embryo lung fibroblasts are most commonly used • The specimen is inoculated into human embryo lung (HEL) cells and kept for 28 days with a blind passage at 14 days. CMV produces a typical focal viral cytopathic effect (CPE) • Advantages: • Gold standard test for CMV detection • Able to recoverother viruses from the same specimen • Pitfalls: • Low sensitivity compared with PCR and nucleic acid probe • Lack of quantitation • Long turnaround time • Sensitivity and specificity: overall sensitivity (59%) and specificity (80%) • • • •
Urine sensitivity/0.37, specificity/0.85 Saliva sensitivity/0.48, specificity/0.81 Blood sensitivity/0.45, specificity/0.92 Any sensitivity/0 .69, specificity/O.77
• TAT: 7-21 days - Schell vial assay • Shell vial culture with immunofluorescent antibodie s (IFA) staining is a method used for the early diagnosis of CMV infection • In immunocompromised patients, a reported sensitivity of 78 % and a specificity of 100% have been claimed • The shell vials are centrifuged at a low speed and placed in an incubator. After 24 and 48 hours, the cell culture medium is removed and the cells are stained
Molecular Virology
21-21
IRs
MIE major IE locus
TR s
U s--o
UL 122/ UL123
IE
IE1
IE2
~'-----4
~'--------5
Fig. 16. CMV genome. MIEP-major IE promotor, UL' unique long region ; Us' unique short region; TR, terminal repeat sequence; IR, inverted repeat sequence. using a fluorescein-labeled anti-CMV antibody. The cells are read under a fluorescent microscope • Advantages: • Higher sensitivity than conventional methods (68-100%) • May be quantitative • Pitfalls: • May need large amount of biomass for virus recovery • TAT: up to 48 hours • Serological studies Immunoassay • CMV immunoglobulin M (lgM) antibodies are detected in primary infection and lasts 3-4 months • It is not detectable in recurrent infection except in immunocompromised patients where it is detectable in about a third of the cases • CMV IgG is produced early in primary infection and persists lifelong. The detection of CMV IgG is useful as an "immune status screen" (seropo sitive individuals are not protected from reactivation or reinfection) • CMV IgG avidity test to distinguish primary CMV infection from past or recurrent infection (reactivation or reinfection). CMV IgG avidity is low «30%) in primary infection • Prenatal diagnosis of congenital CMV infection is performed only in the case of primary maternal infection as transplacental transmission of CMV is higher in 40% of primary maternal CMV infection.
Whereas, transplacental CMV transmission is low in the case of recurrent infection 1-4% - CMV antigenemia test • This test is based upon the detection of pp65, a structural protein expressed on the surface of infected polymorphonuclear lymphocytes • The number of infected leukocytes present has been correlated to the severity of infection • Commercial assay : • CMV Brite Turbo Kit (Biotest Diagnostics Corp ., Danville, NJ). FDA approved assay • Advantages: • Inexpensive kits are commercially available • May be able to detect CMV before development of symptoms • Pitfalls : • Labor-intensive • Requires skilled personnel • Subjective interpretation • Requires immediate processing within 6-8 hours of specimen collection • Poor sensitivity in urine samples. The assay is adversely affected by low leukocyte counts • TAT: 8-24 hours
Molecular Methods Qualitative • Nucleic acid hybridization - CMV hybrid capture assay (Digene): FDA cleared
553
Molecular Genetic Pathology
21-22
• Unlabeled CMV probes hybridize with viral DNA, then immobilized on a solid phase before being measured by conjugated anti-hybrid antibody • Detection range (1400-6000 copies/mL) • TAT: 6-48 hours • bDNA probe assay (Chiron, Emeryville, CA): use artificial molecule to amplify the signal of the bound probe • TAT: > 18 hours • LOD-900 CMV copies per 106 leukocytes • It requires large number of polymorphonuclear leukocyte (PMN), which limits the result of patients with low leukocytes count • Direct measurement of viral replication - NucliSens CMV pp67 Assay (Organon Teknika Inc., Durham, NC), FDA cleared: • NucliSens CMV pp67 measures replication of CMV in blood. Using NASBA RNA amplification technology • This assay detects messenger RNAs coding for the matrix tegument protein pp67 of CMV, a true late protein , which is only expressed during viral replication • The NASBA technology selectively amplifies RNA in a DNA background and allows direct testing in whole blood
• It is a direct route for diagnosing an active CMV infection and monitoring treatment efficacy Advantages • Small amount is required (100
~L
blood)
• Specimens may be stored long-term Pitfalls • Many steps involved TAT: 6-8 hours
Quantitative • PCR - Advantages: • Rapid • Assay sensitivity allows detection of virus before symptoms develop • Less expensive - Pitfalls: • False-positive • Contamination must be prevented - Amplicor CMV Monitor test (Roche Molecular Systems) is a quantitative microtiter-based PCR assay • CMV viral DNA was quantitated by coamplifying a region of the CMV DNA polymerase gene in the presence of a known quantity of quantitative standard
554
• Primers specific for the CMV polymerase gene amplify a 362-bp gene fragment • An internal QS is added at a known concentration during specimen processing so that extraction and recovery of DNA, in addition to amplification and detection, can be monitored • The lower limit of sensitivity of the assay is 400 copies/mL of plasma. The linear range of the assay is 400-400,000 copies of CMV DNA per mL • The inherent sensitivity of molecular detection of CMV poses a problem since latent CMV genomes, present in most seropositive individuals, may be detected. Therefore, it is critical to adjust the sensitivity of the PCR so that latent genomes are not detected - TAT: next day (6-48 hours) • Real-time PCR - Real-time TaqMan PCR (Prism 7700, Applied Biosystems). Various home-brew methods have been described. (Table 4) lists some examples of such methods - Real-Time LightCycler PCR. Various home-brew methods have been described. (Table 5) lists some examples of such methods - Pitfalls • False-positive results due to contamination (detected by negative control) • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
Clinical Utility • Quantitative PCR determination of CMV viral load in solid organ transplant recipients can predict CMV disease and relapse (Table 6), as well as for initiating anti-viral therapy • Viral load testing in patients with HIV infection is currently used to predict CMV disease (Table 6) and to monitor the efficacy of treatment
Laboratory Methods for Anti-Viral Susceptibility Testing of CMV Isolates • Phenotypic methods (Table 7) Plaque reduction assay • The gold standard for anti-viral susceptibility testing of CMV • In this assay, a standardized inoculum of a stock virus is inoculated into cultures and incubated in the presence of the anti-viral agent • The cultures are then observed for the presence of viral plaques
Molecular Virology
21-23
Table 4. Various Real-Time TaqMan "Home-Brew" Methods for Quantitation of CMV Reference
Specimen
Target
Bonemarrow transplant; bloodsamples from patients and healthy volunteer
USI7 gene
Range: 10-107 CMV DNA copies/well
Copies of CMV DNN500 mgof DNA (blood), copies CMV DNNIOO ilL plasma
Plasma; bone marrow transplant patients
Major immediateearlygene
Copies CMV genome/mL plasma
2000
Peripheral blood leucocytes, plasma
Immediateearlygene
As a positive control, a plasmid containing the target sequence from the target gene was used with101-107 plasmids/assay Range from 6 to > I06 copies of CMV DNA. Plasmid containing the IE gene usedto develop a standard curve for quantitative results
Gault et aI.
Blood (peripheral blood
UL83 (pp65 gene)
Plasmid containing one copy of UL83 target sequence usedas a quantitative standard plasmid containing human genomic DNA (albumin gene) coamplified with specimen DNA
Copies CMV DNA/2 xl leucocytes
Machida et al. 2000
Nitsche et al. 2000
Tanaka et al.
2001
leucocytes)
Quantitative standard
Reporting units
Copies CMV DNNI06 cells
as
Adapted from Clin Microbial Rev. 2006; 19(1):165-256
Table 5. Various Real-Time LightCycier PCR "Home Brew" Methods for Quantitation of CMV References
Specimen
Target
Quantitative standard
Keams et al. 200 I
Blood
Glycoprotein B gene
Range: 10- >2 X 105 CMV DNA copies. EcoRI plasmid quantified and linearized and used as quantitative standard
Ando et al. 2002
Aqueous humor; patients with clinical retinitis
Glycoprotein B gene
Range: 101-104 copies/ul,
Keams et al. 2002
Urine and respiratory samples
Glycoprotein B gene
Range: 2 x 103-5 X 108 CMV DNA copies/pl.
Reporting units DNA copies/ul.
-
DNA copies/ul,
Adapted from Clin Microbial Rev. 2006;19(1):165-256
• The ICso of the agent for the isolate is defined as the concentration of agent causing a 50% reduction in the number of plaques produced • Plaque reduction assays are labor-intensive • Plaque reduction assays are limited by the excessive time required to complete the assay (4-6 weeks) and the lack of a standardized method validated across different laboratories • In addition, repeated passage of isolates to prepare viral stocks may influence the results of assays by
selecting CMV strains that are not representative of the original population of the viruses - DNA hybridization assay • Whole genomic DNA is extracted and transferred by capillary action onto negatively charged nylon membranes after incubation with a specific agent • The membranes are hybridized to a 125I-Iabelled human CMV probe (Diagnostic Hybrids,Athens, OH), rinsed, washed, and counted in a gamma counter
555
21-24
Molecular Genetic Pathology
Table 6. Quantative peR Thresholds and Outcomes in Different Patient Settings Setting Renal transplant
References Fox et al. Kuhn et al.
103 58
Cope et al.
196
Toyodaet al. Liver transplant
Number of patients
Cope et al.
Cardiac transplant
Toyoda et al.
Allogenic marrow transplant
Zaia et al.
>I06.5 copies/mLof urine >1000DNA copies/l06 copies of cellular DNA. Each 0.25 loglO increase in baseline CMV DNA load in urine
25
>500 DNA copies per I ug of total DNA
162
Each 0.25 loglO increase in baseline CMV DNA load in whole blood 104.75_105.25 DNA copies/mL
95 110
Gor et al.
HIV
Breakpoints
or associations
Outcome Higherassociation withCMVdisease Highly predictive for CMV disease
2.8-fold increase in CMVdisease risk Increasedrisk of CMV disease 2.7-fold increase in CMV disease
Increaseddisease probability
>500 DNA copies per I ug of total DNA
Increasedrisk of CMV disease
>I04 DNA copies/mL of plasma >104 DNA copies/mLof whole blood >105 DNA copies/mL of whole blood
Increasedrisk of CMV disease after 100post-transplant Odds ratio for disease, 6.46 (95% confidence interval 1.5-27.4) Odds ratio for disease, 10.66 (95% confidence interval 1.8-60.5) High predictive values for CMV disease Sustained level associated with CMV retinitis l.37-fold increase in risk in CMV disease
Shinkai et al.
94
>I00 DNA copies/ul, of plasma
Rasmussen et al.
75
Bowenet al.
97
Spector et al.
201
>320 copies/ug of DNA >32 copies per 25 J.l.L of plasma Each 0.25 loglO increase in baseline CMV DNA load in whole blood Each loglO increase in baseline CMV DNA load in plasma
3. I-fold increase in risk in CMV disease 2.2-fold increase in mortality
Adapted from Clin Microbial Rev. 1998;11 (3) 533-554
• Mean hybridization values (in counts per minute [cpm]) for each concentration of anti-viral agent are calculated and expressed as a percentage of the cpm in control cultures • The ICso is defined as the concentration of antiviral agent resulting in a 50% reduction in viral nucleic acid hybridization values (i.e., DNA synthesis) compared with the hybridization values of controls • Disadvantage of DNA hybridization assays is that they require the use of radiolabeled probes • DNA hybridization assays have the advantage over plaque reduction assays of eliminating the variation due to subjective errors resulting from plaque counting by different individuals
556
- Other phenotypic methods: viral production is measured by using IFA-, immunoperoxidase-, ELISA-, or flow cytometry-based methods for detection and quantitation of cells expressing CMV antigens (immediate-early, early, or late) • Genotypic methods - The mutation of the viral phosphotransferase gene (UL97) coding sequence, which may confer resistance only to ganciclovir - UL97 mutation occurs at three specific sites, within a 700-nucleotide region at the 3' end of the gene, including point mutations within codon 460 and 520 and either point mutations or deletions within the codon range 590-607
Molecular Virology
21-25
Table 7. Ganciclovir, Foscarnet, and Cidofovir IC50s Used in Clinical Studies to Define Resistant CMV Isolates
Method Plaque reduction assay
Ganciclovir
Foscarnet
Cidofovir
ICso (~M)
ICso (~M)
ICso (~M)
~9 ~9
~300
~8
~324
~12
~400
zz.:
~12
~6
DNA hybridization assay
Fivetimes higher than IC50 for AD 169 >6 >6
~400
~2
>400
~2
Adapted from Clin Microbial Rev. 1999;12(2): 286-297
- The more rare mutation s in the viral polymerase gene (UL54) may confer resistance to any or all of the three most commonly used drug s (ganciclovir, foscarnet , or cidofovir); occur in region s between codons 300 and 1000 - Mutations in UL54 are often accompanied by mutations in UL97, showing higher levels of resistance to ganciclovir with possible cross-resistance to foscarnet and/or cidofovir - Detection of mutations is based on PCR amplification of the specific region of the genome followed by restriction enzyme analysi s or direct sequencing of the amplification product • Pitfalls - Using restriction enzyme analysis , not all of the presently confirmed resistance mutations are
accompanied by alteration of known restriction enzyme recognition sites, which lead to false-negative results. In addition , base changes not associated with drug resistance can produce new restriction sites, which lead to false-positive results - PCR assays are not standardized and variation s in sample handling and laboratory methods can affect the sensitivity of the assay - Well-defined CMV DNA standards are needed to avoid variation of viral load values obtained with commercial and home-brew assays • Clinical utility - The standardization of automated sequencing methods and the characterization of mutations associated with drug resistance will offer routinely genotypic-resistance testing in a time frame that impacts clinical care
EPSTEIN-BARR VIRUS (EBV) General Characteristics
• Remains latent in B lymphocytes, affecting >95% of population
• Member of Herpe s Family (type 4) characterized by dsDNA , icosahedral capsid , and a glycoproteincontaining envelope
• Critical viral target genes: EBV nuclear antigen (EBNAJ) , latent membrane protein (LMPl), and LMP2 (Figure 17)
• The genome has been sequenced: 172,282 bp of DNA encoding for 80 genes
Clinical Presentation
• Most common mode of transmission of EBV is through exposure to infected saliva from asymptomatic individuals. Virus is relatively fragile and does not survive long outside the human host fluids
• EBV is a ubiquitou s virus, which causes persistent, latent infection that can be reactivated. >90% of the adult population is estimated to demonstrate serologic evidence of prior exposure with EBV
557
Molecular Genetic Pathology
21-26
A
EBER1
EBER2
;-+~
EBV genome: latent gene s
I I
I
I " II I I I I I I
EBNA-LP
/
EBNA3B
B
\ EBNA3A
Open reading frames for the EBV latent proteins oriP Nhet
\ TR
a
CW W W W W W Y H
F Q U
,WWWZWW'\ EBNA -LP
EBNA2
pol
S
e1-e3 Z R
MIL
E\ I/./K
7~
EBNA3A
EBNA3B
Nhet
cbT d B
G
ovl/xvl I t-IH-HI I
EBNA3C
EBNA1
/
A
TR
LMP1
Fig. 17. EBV genome structure. (Adapted from Paul G. Murrayal and Lawrence S. Young: Epstein-Barr virus infection: basis of malignancy and potential for therapy.)
• Primary infection in young children is often asymptomatic or cause s non-specific minor illness • For adolescents and adults , primary infection is typically manifested as infectious mononucleosis (1M), usually a self-limiting condition characterized by fever, sore throat, myalgias, lymphadenopathy, and hepatosplenomegaly • A strong association between EBV and Burkitt's lymphoma in children of Central AfricalNew Guinea and nasopharyngeal carcinoma among Chinese males • EBV is associated with a variety of disorders in the AIDS population, i.e., oral hairy leukoplakia and CNS lymphoma • Patients undergoing transplantation are prone to develop post-transplant Iymphoproliferative disease
558
Diagnostic Methods Specimens • Whole blood, plasma, CSF, and biopsy
Conventional Tests • Serologic Antibody • Heterophile antibody • Present in 90% of adults during the course of illness • Non-specific serologic response to EBV infection • Classic Paul-Bunnell test • Measures agglutination of sheep RBCs by patient serum; limited by false-positive agglutins in sera
Molecular Virology
21-27
EBNA IgM
_00_"-
EA-DIgG
.
VCA IgG - ' - ' - 'EBNA IgG - - - - - - -
VCA IgM
_.- '-' _.- ." _.-'- '
........ ... • :
I
"
,
• •••••
I
"I''''
··f:.
.~" ....
_._ ._ .- .... . _._ ."
"
"
.,...., .j ". ,. ' ~. ':-..
/ r
.
I
\.,\.
/
...... \
/
/
.....'"' ,I' .... .."'-" .....''\, '
"- .. 2
4
6
8
10
12
Months after infection
Fig. 18. Time course for appearance of antibodies in EBV infection. of normal individuals (Forssman agglutins) and patients with serum sickness. • Monospot test: agglutination of horse red blood cells on exposure to heterophile antibodies • Viral capsid antigen antibody (Figure 18) • IgM-indicates recent infection, lasts only 4-8 weeks • IgG-peaks during week 3-4 of infection, can persist for> 1 year or entire lifetime • Early antigen antibody, Anti-D • Diffusely nuclear and cytoplasmic staining of infected cells • Present in 40% of 1M patients • Persists for 3-6 months • Detected in patients with nasopharyngeal carcinoma • Early antigen antibody, Anti-R • Stains cytoplasmic aggregates • Found in atypical protracted cases of 1M • Found in patients with African Burkitt's lymphoma • Epstein Barr nuclear antigen antibody • Appears 3-4 weeks after infection • Persistent for life • Found in patients with Burkitt's lymphoma
Molecular Methods In situ Hybridization (Biogenex, San Ramon, CA) • Used for tissue biopsy
• The EBV (EBER) EBV-encoded RNA probe is specific for EBER RNA transcripts and is intended for the detection of latent EBV infection • The EBV Not IIPst I DNA probe is specific for the Not IIPst I repeat sequence of EBV and is intended for the detection of active EBV infection
Quantitative-Competitive PCR • Specific primers are specifically designed to the EBV viral latent membrane protein 2a (LMP2a) and internal competitor DNA (ssDNA) that is confirmed against a known number of Namalwa cells (B-ce1llymphoma cell line containing two integrated copies of the EBV viral genome per cell) • Four separate PCR reaction tubes each containing internal competitor DNA (8 copies/ul., 40 copies/ul., 200 copies/ul., or I 000 copies/ul.) are placed in competition with EBV-specific primers for amplification of patient DNA • PCR amp li cons are examined by electrophoresis through a 2% agaro se gel and visualized using a gel-imaging documentation system . The band densities are quantitatively measured using Bio-Rad's (Hercules, CA) Quantity One software and used to calculate EBV copies
Real-Time PCR (Roche LightCycler analyte specific reagent [ASRJ) • Detection of LMP gene of EBV viral genome • EBV is amplified with specific primers in a PCR reaction. The amplicon is detected by fluorescence using a specific pair of hybridization probes • A melting curve analysis is performed after the PCR run to differentiate positive samples from non-EBV species, i.e., other Herpes virus family
559
21-28
Molecular Genetic Pathology
• The internal control is added already to the lysed sample before the purification step and co-purified/amplified with the EBV DNA from the specimen in the same PCR reaction (dual color detection)
Sensitivity and Specificity • LOD for real-time LC PCR is 75-100 copies/mL. The linear range is 100-105 copies/mL • Quantitative competitive PCR (QC-PCR) is a semiquantitative method and approximately lO-fold less sensitive than real-time PCR
Pitfalls • QC-PCR requires analysis of absolute lymphocyte count, which inversely affects viremia; real-time PCR does not
• It is important to note that the EBV real-time PCR assay requires sequential analysis of run data prior
to result reporting to prevent false-positives i.e., pseudoamplification and amplification of non-EBV species and false-negatives , i.e., shifted melting curve for EBV variants • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
Clinical Utility • Serial viral load testing can be used to monitor disease burden and assess efficacy of immunosuppressive therapy in post-transplant patients • Detection of EBV in tissue biopsy assists the diagnosis of EBV-related malignancies, including lymphoma and nasopharyngeal carcinoma
HERPES SIMPLEX VIRUS (HSV)
General Characteristics
Clinical Presentation
• Family of enveloped icosahedral nucleocapsid viruses with total nine members
• Primary infection usually occurs with 2-20 days incubation period
• HSV type I and type 2 demonstrate an 83% DNA homology in protein-coding regions
• Cutaneous vesicles characterized by ulcers that eventually pustulate, dry, and crust ; mucosal vesicles appear as shallow punctuate ulcers that often coalesce
• The genetic map of the two viruses is colinear and the genomes are of approximately the same size, HSV-I of 152 kbp and HSV-2 of 155 kbp • Humans are the only known reservoir • Direct contact with lesion or secretions is necessary for transmission. After direct exposure to infectious material (i.e., saliva and genital secretions), initial viral replication occurs at either the skin or mucous membrane entry site, typically of epithelial cells • HSV I and HSV 2 are most common. HSV I, acquired early in life, is usually associated with oral lesions. HSV 2, acquired after onset of sexual activity, is associated with genital lesions . Both viral types can cause oral-facial and genital infections and maybe clinically indistinguishable • Risk of transmission of HSV from HSV-infected mother during vaginal delivery to infant is 50%, estimated to be between I in 2000 and I in 5000 births • Beyond the neonatal period, most childhood HSV infections are caused by HSV-I. The seroprevalence of HSV-I antibodies increases with age and is 20% by age 5 years . No increase occurs until age 20-40 years, when 40-60% of individuals are HSV-I seropositive • A stimulus (e.g., physical or emotional stress, fever, and ultraviolet light) causes reactivation of the virus in the form of skin vesicles or mucosal ulcers, with symptoms less severe than primary infection. Latent HSV can be reactivated from the trigeminal, sacral, and vagal ganglia
560
• Primary herpetic gingivostomatitis/pharygotonsillitis (HSV I): most cases are asymptomatic. Most cases are between 6 months and 5 years. Characterized by generalized malaise , fever, linear gingivitis, and lymphadenopathy • Primary herpes genitalis (HSV 2): genital HSV-2 infection is twice as likely to reactivate and recurs 8-10 times more frequently than genital HSV-I infection . A classic vesicular rash may be noted; or progressive lesions (pustules or painful ulcerative lesions). Lesions may persist for as many as 3 weeks . Painful inguinal lymphadenopathy, dysuria, and vaginal discharge are frequent complaints. Most primary genital HSV infections are asymptomatic, and 70-80% of seropositive individuals have no history of symptomatic genital herpes. HSV can be transmitted in the presence or absence of symptoms • Primary cutaneous herpetic infections can occur in wrestlers and rugby players with contaminated abrasions (herpetic gladiatorum or scrumpox) • HSV keratitis presents with an acute onset of pain, blurring of vision, chemosis, conjunctivitis, and characteristic dendritic lesions of the cornea • HSV meningitis - 1-7% of all cases of aseptic meningitis - Frequency : HSV-2» HSV-I - 20-45% with meningitis have recurrent episodes
Molecular Virology
HSV accounts for 10-20% of all cases of sporadic viral encephalitis in the United States . The clinical hallmark of HSV encephalitis has been the acute onset of fever and focal neurologic (especially temporallobe) symptoms. Clinical differentiation of HSV encephalitis from other viral encephalitides, focal infections, or non-infectious processes is difficult - Neonates «6 weeks) have the highest frequency of visceral and/or CNS infection of any HSV-infected patient population • HSV infection of visceral organs usually results from viremia, and multiple-organ involvement is common • Recurrent infection at sites of primary infection - Activation of latent virus form neurons of cervical ganglia (herpes labialis, HSV 1) or sacral ganglia (HSV 2) - Self-inoculation of fingers and thumbs (herpetic whitlow) can occur in children with orofacial herpes, although less common - Anti-viral prophylaxis recommended for persistent recurrent cases - Some cases of erythema multiforme are believed to represent an allergic response to recurrent HSV infection
Diagnostic Methods Specimens • Vesicular fluid , ulcerated lesions, pharyngeal and throat swabs, urine , CSF, autopsy and biopsy material, ocular exudates, and vaginal swabs • Specimen is best collected within the first 3 days after appearance of lesion but not>7 days
Conventional Tests and Problems • Viral culture Conventional • Cell culture requires the collection of live virus samples that require special care in transport to the laboratory to retain viability. When viable samples are used, culture can be highly specific (if typing is performed) and positive results are generally reliable • The sensitivity of culture declines rapidly as lesions begin to heal and for this reason frequently non-positive result can be falsely negative. Type-specific serology tests should be used in these cases to confirm a clinical diagnosis of genital herpes • Many commercial cell lines are used (A-549, RK, ML, HNK, MRC-5, and so on) • Diagnosed by observation of CPE induced by virus, which usually occurs in I week after initial inoculation
21-29
- Schell vial assay • A centrifugation-enhanced culture technique used to obtain rapid culture results . Generally less sensitive than conventional culture • The test can detect HSV in shell-vial cultures (MRC5 cells) before the development of CPE (pre-CPE) • IF staining of shell vial for viral detection and typing • Cytology - Intranuclear inclusion bodies - Multinucleated, molded giant cells - Margination of nuclear chromatin • Serological studies ELISA • Performed on fluids or other samples using HSVspecific antibody that is bound to a solid surface • Antibody captures antigen to which anti-HSV antibodies labeled with enzymes are added. These attach to the bound antigen and cause a color change IF and immunoperoxidase assays • Detect HSV antigen in smears or tissues. HSVspecific antibodies are labeled with fluorescent dyes or enzymes (peroxidase) • Labeled antibodies are incubated with the specimen and bind to HSV antigens in the specimen, if present • Attached fluorescent dye or enzyme can be visualized in appropriate regions of infected cells under a microscope • Used in conjunction with shell vial culture - Enzyme-Linked Virus Inducible System (ELVIS). ELVIS is a method, with no specific manufacturer. • Technique combines cell culture amplification with HSV-activated reporter genes • The test produces results that are equal to conventional culture
Molecular Methods Polymerase Chain Reaction • Most home-brew methods design primers to the thymidine kinase gene. Due to the lack of standardization, variation of the sensitivity and specificity is observed
Real-time PCR (LightCycler-HSV 1/2 Detection Kit, Roche) • Detection and differentiation of HSV type I and type 2 (HSV 1/2) • HSV 1/2 is amplified with specific primers in a PCR reaction. The amplicon is detected by fluorescence using a specific pair of hybridization probes • A melting curve analysis is performed after the PCR run to differentiate positive samples for HSV I or HSV 2. Melting points for HSV I and HSV 2 are significantly different (HSV-I at 53.9°C, whereas HSV-2 at 67.1 0c), and allows clear determination of the HSV type (Figure 19)
561
21-30
Molecular Genetic Pathology
.07
!!.I 0.07 0.065 0.06
ASC-US Any HPV results
Colposcopy
~~ Both negative
+ Routine screen ing 3 years
Cytology ASC-US HPV negat ive
+ Rescreen with both tests at 12 months
Cytology > ASC -US HPV negat ive
+
Any cytological results and HPV positive
+
Colposcopy
Colposcopy
Fig. 23. Proposed management scheme of atypical squamous cells of undetermined significance based on cytology and/or HighRisk HPV DNA test. (Adapted from Wright et. aI. HPV testing as adjunct to cytology, Obstet Gynecol. 2004;103(2):304-309; (American College of Obstetricians and Gynecologists). - Assay utilizes an internal control for human a-actin to assure DNA quality and quantity in each reaction
Genotyping • Roche linear array (Figure 22) - Qualitative test that utilizes amplification of HPV target DNA by PCR and nucleic acid hybridization bases on four major steps:
568
• Sample preparation • PCR amplification of target DNA using HPVspecific complementary primers • Hybridization of the amplified products to oligonucleotide probes • Colorimetric detection of the probe-bound amplified products
Molecular Virology
-
21-37
Uses a pool of biotinylated primers to define a sequence of nucleotides for the Ll region of the HPV genome designed to amplify HPV DNA from 37 HPV genotypes, including 13 high-risk genotypes (16, 18, 31, 33, 35, 39,45, 51, 52, 56, 58, 59, and 68)
- B-globulin gene is concurrently isolated and ensures adequacy of cellularity, extraction, and amplification for each processed sample
Sensitivity and Specificity • Overall, the sensitivity for cytology for detecting high grade squamous intraepitheliallesion (HGSIL) ranges from 50-70% and specificity 86-98%
- Limited sensitivity (l pg/mL) - Mixed high- and low-risk probes, cannot distinguish specific HPV types
- It is labor intensive
Clinical Utility • To screen patients with atypical squamous cells of undetermined significance. Pap smear results to determine the need for referral to colposcopy. The results of this test are not intended to prevent women from proceeding to colposcopy
Pitfalls
• In women 30 years and older the hc2 high-risk HPV DNA test can be used with Pap smear to adjunctively screen to assess the presence or absence of high-risk HPV types. This information, together with the physician's assessment of cytology history, other risk factors, and professional guidelines, may be used to guide patient management
• Digene hybrid capture assay
• Recently, a new test scheme was proposed (Figure 23)
• Overall, the sensitivity of HPV DNA test for detecting HGSIL is about 80-98% and specificity 64-95% • However, the sensitivity and specificity is influenced by the age and prevalence (Table 8)
INFLUENZA A, H, AND C General Characteristics • Influenza is part of the Orthomyxoviridae family and can be classified into three basic types, influenza A, B, or C (Table 9). Each Influenza virus-type is an enveloped single-stranded RNA virus that shares structural and biological similarities but differs antigenically. Type A influenza virus, which causes pandemic is found in a variety of warm-blooded animals. Types A and B are predominantly human pathogens. Type C is found in humans and pigs • Influenza viruses have a segmented RNA genome (Figure 24). Influenza A and B contain 8 distinct segments and are covered with surface glycoproteins, hemaglutinin (HA), neuraminidase (NA), and matrix 2. Influenza C has seven segments and one surface glycoprotein. The viruses are typed based on these proteins. For example, influenza A (H3N2) expresses HA 3 and NA 2 • Influenza is a dynamic virus that may evolve in two different ways via antigenic drift and antigenic shift resulting in genetic diversity. Antigenic shift occur when two different strains of influenza viruses combine with antigenically different HA and NA by reassortment of viral RNA segments; this process occurs every 10-40 years. Antigenic drift occurs by random point mutation in viral RNA leading to amino acid substitutions in HA glycoproteins. Influenza type A viruses undergo both antigenic shift and drift; influenza type B viruses undergo antigenic drift • Each influenza RNA segment is further encapsidated by nucleoproteins to form ribonucleotide-nucleoprotein complexes surrounded by matrix proteins
• Influenza virus infections rank as one of the most common infectious diseases in humankind. However, influenza may potentially cause severe epidemics and kills an average of 20,000 individuals in the United States • The most common prevailing human influenza A subtypes are HlNl and H3N2 . Each year, the distributed vaccine contains A strains from HlNl and H3N2, along with an influenza B strain
Table 9. Comparison of Influenza A, H, and C Type A
Type B
Type C
Severity of illness
++++
+
+
Animal reservoir
Yes
No
No
Human pandemics
Yes
No
No
Human epidemics
Yes
Yes
No (sporadic)
Antigenic changes
Shift, drift
Drift
Drift
Segmented genome
Yes
Yes
Yes
Amantadine, rimantidine
Sensitive
No effect
No effect
Zanamivir (relenza)
Sensitive
Sensitive
2
2
Surface glycoproteins
(I)
569
21-38
Molecular Genetic Pathology
--I --I --1 --I --I --I --I --I
~
HA NA
NP M NS
f-
PA
t-
PBJ
f-
PB2
f~
ff-
Fig. 24. Influenza virus genome: the virus contains 7-8 singlestranded RNAs (Influenza A and B contains 8 RNAs and influenza C contains 7 RNA). The RNAs cod for 9-11 viral proteins: HA, hemaglutinin; NA, neuraminidase; PA, PB I and PB2, polymerase complex; NP, nucleoprotein; M, matrix protein ; NS, non-structural protein. PCR primers usually target HA and NA consensus region .
• Influenza virus infection occurs after transmission of respiratory secretions from an infected individual to a person who is immunologically susceptible
Clinical Presentation • Although the presentation of influenza virus infection is variable, typical symptoms may include the following: fever, sore throat, myalgia, headache, rhinitis, fatigue , and coughing. Onset of illness may be abrupt • Patients with a pre-existing immunity or received vaccination may have mild and less severe symptoms • Acute encephalopathy has recently been described to be associated with influenza A virus. Clinical features included altered mental status, coma, seizures, and ataxia
The criterion standard for diagnosing influenza A and B is via viral propagation in embryonated hens' eggs or Madin-Darby canine kidney cells Laboratory diagnosis of influenza is establi shed once specific CPE is observed or hemad sorption testing findings are positive After culture isolation, final identification via immunoassays or IF - Staining the infected cultured cell lines with fluorescent antibody confirms the diagnosis - The viral culture process requires 3-10 days to complete - Primary method for vaccine production • Direct IF testing - The technique is more rapid (24 hours) to result; it is less sensitive than culture methods - This technique can distinguish between influenza A and B • Serologic studies - Two samples should be collected per person . One sample within the first week (acute) of symptoms and a second sample (convalescent) 2-4 weeks later. If antibody levels increase from the first to the second sample, influenza infection likely occurred - Because of the length of time needed for a diagnosis of influenza by serologic testing, other diagnostic testing should be used if a more rapid diagnosis is needed - Inability to differentiate between current and previous infection. Cannot be used for rapid diagnosis • Rapid testing (Table 10) - Fastest method of currently available diagnostic tools. Result may be obtained in VI
Fig. 25. Structure of adenovirus. (Adapted from W. C. Russell: Update on adenovirus and its vectors, J. Gen. Viral. 2000;81: 2573-2604.) IV 100Kd ,33Kd ,pVIII ---I~~ L4
pVI ,II,Pr --.~~ L3
MLP
E1B
III,pVII,V
55Kd ,19Kd
-.
--.~~ L2
E3 12.5Kd ,6.7Kd,gp019Kd , ADP,RIDa~ ,14 .7Kd ~
-.
VA RNAs 1&2
o
20
I
I
IX
lila
+
E1A 243R ,289R
....
~ L5
-..
40
60
I
80
100
I
I
E2A
..-
DBP ~
IVa2
E2B
..
E4 oris 1-6/7 ~
pTP
Pol ~
Fig. 26. Transcription of the adenovirus genome . The early transcripts are outlined in green , the late in blue. Arrows indicate the direction of transcript ion. The gene locations of the VA RNAs (non-translated RNAs) are denoted in brown. MLP, major late promoter. (Adapted from W. C. Russell: Update on adenovirus and its vectors, J. Gen. Viral. 2000;81 :2573-2604 .)
573
Molecular Genetic Pathology
21-42
Diagnostic Methods Specimens (Molecular Tests)
Molecular Methods
• Respiratory, stool, and blood
• Marked improvement in sensitivity when compared with viral culture
Conventional Tests and Problems
• Additionally, the TaqMan technology allows for quantitation of viral load and targets hexon gene
Polymerase Chain Reaction
• Viral culture - Many adenovirus serotypes can be isolated in cell culture lines commonly used in diagnostic virology laboratories; however, others fail to grow. Primary human embryonic kidney cells support growth of many fastidious adenovirus serotypes, but the additional cost may be prohibitive in some settings. Adeno-associated virus has also been known to contaminate this cell line. Other cell line s may not support the growth of ocular strains well, may be less sensitive , or may not be maintainable to support slower-growing strains • Serologic studies - Seroreactivity to adenovirus is common. Positive adenovirus titer s occur in 50% of individuals >4 years old - Serology is less useful in the acute clinical setting - For a serologic diagnosis, serum should be obtained as early as possible in the clinical course, followed by a second titer 2-4 weeks later. A fourfold rise in acute titers to convalescent titers is diagnostic • IF - Indirect IF assays may be used for direct examination of tissue. It uses a mouse antibody against an adenovirus group-specific hexon antigen
Real-Time PCR • Real-time-LightCycler, targets hexon gene • Real-time-SmartCycler, targets hexon gene • Sensitivity was demonstrated to 93.4% sensitivity/>96.7% specificity) - Low sensitivity observed in urine (42.3% in asymptomatic men, 64.8% in women) - The use of an internal amplification control enables the laboratory to determine the presence of inhibitors • Transcription-mediated amplification (TMA) (APTIMA Assay, Gen-Probe) - FDA-cleared (approved) collection sites: endocervical and male urethral swab specimens, female and male urine specimens
AMPLIFICATION METHODS
- Target gene-16S rRNA.
• Polymerase chain reaction (PCR) (Amplicor, Roche Diagnostic Systems [Roche Molecular Diagnostics, Pleasanton, CA])
- Transport swab specimens to the laboratory and store at 2-25°C until tested
- FDA-cleared (approved) collection sites: urine from males and females, endocervical swab specimens, male urethral swab specimens (symptomatic or asymptomatic) - The target for the Roche Amplicor test for C. trachomatis is a 207 bp segment of the cryptic plasmid DNA sequence - This test utilizes PCR nucleic acid amplification and nucleic acid hybridization
584
- Urine specimens can be stored at 2-8°C for up to 7 days from collection - Urine and swab specimens should be assayed within 7 days of collection - Sensitivity/specificity (92.8-94.1 %/97.6-99.4%) in endocervical swabs, (95.5%/97.5%) in male urethral swabs, and (97.9%/98 .5%) in urine • Strand displacement amplification (SDA)-(BD ProbeTee ET System , Becton Dickinson [Becton, Dickinson & Company, Sparks, MD])
Molecular Bacteriology, Mycology, and Parasitology
piiA
22-5
ppk
gpdhC gnd porS gpdh pyrD
Pgi2 aroA gInA
Neisseria gonorrhea genome 2,153,944 bp
pdhC
Fig. 2. Location of 18 housekeeping genes and porB on chromosomal map of N. gonorrhoeae strain FA 1090.
- FDA-cleared (approved) collection sites: endocervical swabs, male urethral swabs, and male and female urine specimens
Neisseria gonorrhoeae
- Multi-copy cryptic plasmid
• Sexually transmitted, or vertically transmitted during parturition
- Swab must be stored and transported to the laboratory and/or test site at 2-27°C within 4-6 days of collection - Urine is stable for 4-6 days at 2-8°C and 2 days at 15-27°C - Sensitivity/specificity: (92.8%/98.1 %) in endocervical swabs and (92.5%/96.4%) in male urethral swabs PITFALLS OF MOLECULAR DIAGNOSTICS IN TESTING FOR
C. TRACHOMATIS
• False-positive results due to contamination (detected by negative control) • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay CLINICAL UTILITY OF MOLECULAR DIAGNOSTICS IN TESTING FOR
C. TRACHOMATIS
• Convenient and acceptable samples such as initial stream urine and self-collected vaginal specimens are used in molecular tests, which increase the compliance with testing • Improved performance in early detection of the organism
General Characteristics
• Gram-negative coccus • Usually in pairs (diplococci) with flattened adjacent sides, immotile, cell envelope is present • Aerobic or facultatively anaerobic, very sensitive to drying, chilling, and pH change • Iron required for growth • Best grown in environment with 2-8% CO 2 • Chocolate agar will support primary isolation from usually sterile sites • Thayer-Martin medium (chocolate agar plus vancomycin, colistin, and nystatin) permits isolation in otherwise contaminated specimen • Speciation is based on carbohydrate metabolism; N. gonorrhoeae produces acid from glucose only • The N. gonorrhoeae genome is circular (Figure 2), consists of 2,153,922 bp and contains 2002 proteinencoding genes
Clinical Manifestations • Gonorrhea (genital) in males: acute anterior urethritis, urethral stricture , epididymitis, and prostatitis • Gonorrhea (genital) in females: 20-80% asymptomatic, but complications include pelvic inflammatory disease and generalized peritonitis • Proctitis
585
22-6
Molecular Genetic Pathology
• Bacteremia/disseminated disease - Arthritis-dermatitis syndrome - Subacute bacterial endocarditis
- Specimens (endocervical) can be shipped at room temperature and are stable when stored at room temperature for 14 days or at -20°C for up to 3 months
- Meningitis • Ophthalmia neonatorum
AMPLIFICATION METHODS
• Neonatal gonococcal arthritis
• PCR (Amplicor, Roche Diagnostic Systems) - FDA-cleared (approved) collection sites: urine from males, endocervical swab specimens, male urethral swab specimens - The target for the Roche Amplicor test for N. gonorrhoeae is cytosine methyltransferase gene homologue - This test utilizes PCR nucleic acid amplification and nucleic acid hybridization
• Vulvovaginitis in pre-pubescent female s
Diagnostic Methods Specimens • Urethral swab, cervical swab, conjunctival discharge, skin lesion scrapings, synovial fluid, pharyngeal swab, rectal swab, and blood • For best results , store/transport at 20-30°C or refrigerated at 2-8°C and process within 7 days of collection
Conventional Methods • Identification of the organism by Gram stain or in culture (Thayer-Martin chocol ate agar from infectiou s material) • Confirmatory biochemical identification tests: Acid production from gluco se only - Chromogenic enzyme substrate test(hydroxyprolylaminopeptidase production) • Immunologic methods for culture confirmation: - Fluorescent-antibody tests - Specimen types : urethral (males), cervical (females), rectal (symptomatic), conjunctival (symptomatic), and nasopharyngeal specimens (symptomatic) - Turnaround time: 1-2 days - Sensitivity of the test for detection of genital disease can range from 60-100%
Molecular Techniques NUCLEIC ACID HYBRIDIZATION METHODS
• PACE 2 Assay System (Gen-Probe) - Uses a ssDNA probe with a chemiluminescent label that is complementary to the ribosomal RNA of the target organism (l6S rRNA) Stable DNA:RNA hybrid is formed - The labeled DNA:RNA hybrid is isolated and measured in a Gen-Probe Leader luminometer - Turnaround time: 1-3 days - The only assay approved for use with conjunctival specimens. Rapid turnaround time (3-5 hours) for results Sensitivity (97.8%) and specificity (98.9%) • Hybrid Capture 2 CT/GC DNA Test (Digene) - The test is FDA cleared (approved) for endocervical, male urethral, and vaginal swab specimen s and in male and female urine specimens - Sensitivity (92.6-95.2%) and specificity (98.5-98.9%)
586
- Urine specimens are stable for 24 hours, swab specimens are stable for I hour at room temperature, urine can be stored at -20°C for 30 days and swabs can be stored at 2-8°C for 7 days - Highly sensitive in swab specimens from symptomatic and asymptomatic women and men (>96.4 % sensitivity1>97.9% specificity) - Low sensitivity was observed in urine (42.3 %) from asymptomatic men - Higher sensitivities and specificities in other genital specimen types (>92.4 % sensitivity/98% specificity) • TMA (APTIMA Assay, Gen-Probe) - FDA-cleared (approved) collection sites: endocervical and male urethral swab specimens and female and male urine specimens - Target gene-16S rRNA - Transport swab specimens to the laboratory and store at 2-25°C until tested - Store urine specimens at 2-8°C for up to 7 days from collection - Urine and swab specimens should be assayed within 7 days of collection - Sensitivity/specificity (98.6-99.2%/98.7-99.8%) in endocervical swabs, (99.1 %/97.8%) in male urethral swabs, and (98.5%/99.6%) in urine • SDA-(BD ProbeTec ET System, Becton Dickinson) - FDA-cleared (approved) collection sites: endocervical swabs, male urethral swabs, and male and female urine specimens - Swab must be stored and transported to the laboratory and/or test site at 2-27°C within 4-6 days of collection - Storage up to 4 days has been validated with clinical specimen s - SDA is currently not FDA cleared (approved) for testing asymptomatic males for N. gonorrhoeae - Targets the multi-copy chromosomal pilin gene - Urine is stable for 4-6 days at 2-8°C and 2 days at 15-27°C
Molecular Bacteriology, Mycology, and Parasitology
- Sensitivity/specificity (96.6%/99.5%) in endocervical swabs and (98 .5%/96.5%) in male urethral swabs PITFALLS OF MOLECULAR DIAGNOSTICS IN
N.
GONORRHOEAE TESTING
• False-positive results due to contamination (detected by negative control) • False-positive due to cross-reactivity with nongonoccocal Neisseria sp. that rarely cause genital disea se • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay CLINICAL UTILITY OF MOLECULAR DIAGNOSTICS IN
N.
GONORRHOEAE TESTING
22-7
Borrelia burgdorferi General Characteristics • Spirochete; etiologic agent of Lyme disease, transmitted by ticks:
- Ixodes dammini - Amblyomma americanum • Ten different Borrelia species have been described within the B. burgdorferi sensu lato complex: B. burgdorferi sensu stricto, B. garinii, B. ofzelii; B. japonica, B. andersonii, B. valaisiana, B. lusitaniae, B. tanukii, B. turdi, and B. bissettii • Only B. burgdorferi sensustricto, B. garinii, and B. ofzelii are implicated in human disease • B. burgdorferi has a genome of 910,725 bp, with at least 17 linear and circular plasmids with a combined size of more than 533,000 bp • Morphology: coarse, irregular coils • Visualized by Wright or Giemsa stains
• Convenient and acceptable samples such as initial stream urine and self-collected vaginal specimens are used in molecular tests, which has increased testing compliance with testing
• Difficult to culture
• Improved performance in early detection and medical intervention of N. gonorrhoeae
• Stage 1 (erythema chronicum migrans)
Anti-microbial Susceptibility Tests for N. gonorrhoeae
Clinical Presentation (Lyme Disease) -
Red macule at site of tick bite, progressing to annular erythema with central clearing (Figure 3)
CONVENTIONAL METHODS
- Can appear at sites other than the intial bite location
• Nitrocefin method-liquid reagent or treated diskdetects ~-Iactamase production
- Fades in 3-6 weeks
- Disk diffusion Neis seria gonorrhoeae (GC) agarincubated for 20-24 hours - Minimum inhibitory concentrations (MIC) detected by: • Agar dilution-reference method-eomplex to perform • E-test (MIC on a strip) MOLECULAR TECHNIQUES
• Non-amplification method (probe and hybridization): not commonly used due to limited sensitivity • Amplification methods (PCR) - Detects mutated gyrA and parC genes in bacteria with high resistance to quinolones (chromosomal resistance) - Detects mutated mtr and penB, which reduces susceptibility to penicillin (chromosomal resistance) - Detects tetM in bacteria with high resistance to tetracycline (plasmid-borne resistance) PITFALLS
• Resistance can be due to multiple genetic changes, for which there is no single probe • New mutations affecting the level of resistance are being continually discovered
- Constitutional syndrome-fever, headache, malaise, adenopathy, and mild meningeal irritation • Stage 2 Neurologic disease-follows rash, associated with severe headaches and cranial nerve palsies , resolves after several months - Cardiac disease-fluctuating cardiac arrhythmias, resolves after several weeks, can recur • Stage 3 - Arthritis - Chronic central nervous system (CNS) disease
Diagnostic Methods Specimens • Cerebrospinal fluid (CSF) , urine , whole blood, serum , joint fluid, ticks, or skin biopsy • Storage instructions: refrigerate CSF, urine, synovial fluids , and blood • Sample collection and storage for molecular studie s: - Bacterial culture-grow in 7 mL Barbour-Stoner-Kelly (BSK) H medium in screw-cap tubes at 32°C - Ticks-identify Ixodes ticks: live ticks are suitable for all methods, store dead ticks in 70% alcohol
587
Molecular Genetic Pathology
22-8
Fig. 3. Erythema migrans as seen in Lyme disease . (Courtesy of Bottone, Edward 1. An Atlas of the Clinical Microbiology of Infectious Diseases, Volume I, Bacterial Agents. New York, Parthenon, 2004). - CSF-2 mL or more in sterile tubes. Store aliquots at -20°C until use - Joint fluid-2 mL or greater in a red-top tube (no anticoagulant) or a lavender-top tube Ethylenediaminetetraacetic (EDTA additive). Store aliquots at -20°C - Whole blood-5 - 10 mL in a purple-top tube. Store at 4°C and process as soon as possible after receipt - Serum-l - 3 mL in sterile tube. Store aliquots at 20°C until use - Urine-use 15 mL preferably collected prior to antibiotic therapy. Store at -70°C or add equal volume of 95% ethanol prior to storage - Tissue-use a single-standard 3-5-mm skin punch biopsy or equivalent-sized tissue specimen. Stored at -70°C
Conventional Tests • Warthin-Starry silver stain-tissue sections • Acridine orange or Giemsa-blood and CSF • Culture : culture through inoculation into a tube of modified Kelly's medium (BSK H)-yield is low - On skin biopsies from confirmed erythema migrans, the success rate is 40-70% - On blood samples from confirmed Lyme disease cases, the sensitivity is 38°C)
i.v, Penicillin during labor
No treatment is indicated
Fig. 4. Algorithm for GBS prophylaxis. (Adapted from Revised guidelines from CDC, prevention of perinatal GBS disease, August 16, 2002).
• Depending on the stage of the disease and type of tissue, sensitivity and specificity range from 84 to 100% for skin biopsy to 28% and 100% for CSF specimens
• Possible sexual transmission (controversial)
Pitfalls
• Pregnant women who are colonized require antibiotic prophylaxis (Figure 4)
• False-positive results due to contamination (detected by negative control) • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation
• Vertical transmission can occur in utero, or during parturition
ClinicalPresentations • Early-onset (first 5 days of life) neonatal infection ; bacteremia
• PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
• Late-onset (7 days-3 months of age) neonatal infection; bacteremia, fulminant meningitis, osteomyelitis, and septic arthritis
• Reactive PCR does not represent active disease
• Postpartum women-endometritis, cesarean section wound infection, and bacteremia
Clinical Utility • Rapid primary diagnosis for efficient and early medical treatment • Improved performance of nucleic acid assays permits early detection and medical intervention for meningitis
Group B Streptococci-Streptococcus agalactiae General Characteristics • Encapsulated, ~-hemolytic streptococci • Frequently colonizes vagina, gastrointestinal (GI) tract
• Immune compromised hosts-pyelonephritis, pneumonia, tracheobronchitis, cellulitis, septic arthritis, meningitis , endocarditis, and bacteremia
Diagnostic Methods Specimens • CSF, amniotic fluid, whole blood, vaginal, and rectal swab - Specimens (for molecular studies): must be tested within 24 hours if at room temperature. Specimens stored between 2 and 8°C are stable for up to 6 days
589
Molecular Genetic Pathology
22-10
Conventional Methods • Culture - Selective culture of Group B Streptococci (GBS)broth medium (Todd-Hewitt: broth supplemented either with colistin and nalidixic acid or with gentamicin and nalidixic acid) - Optimal culturing technique includes culturing both vaginal and anal samples (combined) at 35-37 weeks of gestation - Sensitivity and specificity, 77% and 97%, respectively • Confirmatory biochemical identification tests: - Hippurate and Christie, Atkins, Munch-Peterson (CAMP) tests-positive - Pyroglutamyl aminopeptidase (PYR)-negative • Immunologic method-latex agglutination tests: not sufficiently sensitive for direct detection of GBS from clinical samples
Molecular Methods NUCLEIC ACID HYBRIDIZATION METHODS(DNA, GEN-PROBE)
• Culture identification test • Nucleic acid hybridization to specific ribosomal RNA sequences unique to S. agalactiae • The test offers a rapid, non-subjective method for the definitive identification of GBS • Sensitivity and specificity: 97.7 and 99.1%, respectively AMPLIFICATION METHODS
• Standard PCR ("home brew" assay) - Sample : CSF, amniotic fluid, whole blood, vaginal, and rectal swabs - Sensitivity, specificity, and positive and negative predictive values of 96.0%, 99.4%, 88.9%, and 99.8%, respectively - Targets 16S rRNA, 16S-23S spacer region, or cjb gene, which encodes the CAMP factor • Real-time PCR - IDI-Strep B Test (Cepheid, Sunnyvale, CA)-the only FDA-cleared replacement for standard culture testing • Sensitivity 94% and specificity 96% • Automated DNA amplification and real-time detection in a single step • Test results in I colony, isolate is considered methicillin resistant • Latex agglutination test based on detection of PBP2a by agglutination with latex particles coated with monoclonal antibodies to PBP2a
Phenotypic Methods • Disk diffusion (I ug oxacillin disk on Mueller Hinton agar plate) - Breakpoints for determining MRSA are: susceptible (13 mm), intermediate (11-12 mm), and resistant (10 mm) - Plates require full 24 hours incubation • MIC detected by: - Broth dilution or agar dilution - Requires incubation for a full 24 hours - Breakpoints for determining MRSA are: susceptible «211g/mL) and resistant (>411g/mL) • E-test • Automated instruments (Vitek, Microscan), detects bacterial growth and metabolic reactions in the microwells of plastic test cards by measuring fluorescence
594
Genotypic Methods • Conventional PCR: detects mecA gene (Figure 7) • Real-time PCR: SmartCycler (Cepheid)-FDA approved - Detects mecA in S. aureus - Multiplex Pt.R amplifies a target that links the SCC mec and a sequence from the orjX gene that is unique to S. aureus (Figure 8) - Sensitivity of 92.5%, and specificity of 96.4% • Real-time PCR-ABI Prism 7700 (TaqMan probes [Roche Molecular Diagnostics])-targets mecA andfemA genes • Real-time PCR-LightCycler (SYBR Green I and dual FRET hybridization probes)-targets mecA and sa442 genes • LightCycler-SeptiFast test (Roche Diagnostics) - Targets mecA in S. aureus
22-15
Molecular Bacteriology, Mycology, and Parasitology
A
B
C
- -_
+--
femB
+--
mecA
A and B: bacter ia isolates with mecA gene C: bacteria isolate with mecA and femB genes
Fig. 7. Lanes A and B: bacterial isolate s with mecA gene. Lane C: bacterial isolate with mecA and/emB genes.
Staphylococcus aureus chromosomal orfX
SSCmec
\
-=~----_ . _
.. _
. . _
..- -. . - .
. . _
.. _
/
I------r-:===-::-~--~
----,
. . L - - - - - - -4.
I 1
~
SSCmec primers
S. aureus
S. aure us specific primer
specif ic probes
Fig. 8. Primer- and probe-binding sites for real-time PCR detection of mec.
- Quick and highly sensitive - Direct detection from the blood sample
Advanced Molecular Diagnostic Methods of MRSA Rapid detection of known single nucleotide polymorphisms (SNPs) associated with antibiotic resistance phenotype: • Pyrosequencing-detennines the actual sequences of short DNA fragments and defines precise mutations including novel SNPs • Denaturating high-performance liquid chromatographyinvestigates longer DNA fragments and identifies novel SNPs • Nucleic acid analysis by mass spectrometry
PitfaLLs of Molecular Testing for MRSA
Clinical Utility of Molecular Testing for MRSA • Rapid detection of MRSA permits early institution of appropriate antibiotic therapy and control measures
Legionellaceae General Characteristics • Previously undescribed human pathogenic bacteria until major outbreak of fulminant pneumonia in 1976 in Philadelphia, PA • Twenty-four specie s of Legionella and six serotypes of Legionella pneumophila are recognized • Widely distributed in environment, particularly water towers, lakes, water supplies , in association with algae
• False-positive results due to contamination (detected by negative control) • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation
• Faint Gram-negative motile rods; do not stain by hematoxylin and eosin
• PCR assay s are not standardized and variation s in sample handling and laboratory methods can affect the sensitivity of the assay
• Charcoal yeast extract agar buffered with N-(2acetamide)-2-aminoethane sulfonic acid best for primary isolat ion
• Best identified in tissue with the Dieterle silver impregnation method, seen both intracellularly and extracellulary
595
Molecular Genetic Pathology
22-16
Table 3. Diagnostic Tests for Legionella Infection
Test
Turnaround time
Sample type
Sensitivity
Specificity
(%)
(%)
Comments
Culture
3-7 days
LRT" Blood
90
No commercially available assay for testing clinical samples; detects all species and serogroups
Serum Urine
30-50 46-86
>90 >90
Serologic testing 3-10 weeks
PCR
128 is considered diagnostic . Sensitivity: 40-60%; specificity: 96-99%
22-17
- Cross-reactive antibody formation among members of the family of Legionellaceae and non-Legionella bacteria can make it difficult to determine the infecting species
Molecular Methods • Conventional PCR with gel identification (home brew or commercial kit provided by Minerva Biolabs [Berlin, Germany])-and targets 16S rRNA, 5S rRNA, or mip gene • Conventional PCR and reverse dot blot hybridization to probes immobilized on nylon membranes with biotinylated primers (home brew) • LightCycler (Roche) real-time PCR-targets mip gene or 16S rRNA • Real-Time PCR-(AB! prism 7700)-targets 16S rRNA or 23S-5S spacer region • SDA with an energy transfer (ET) detection method(BD ProbeTec ET~leared by FDA-targets mip gene
Pitfalls • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
Clinical Utility • The urine antigen test combined with Legionella PCR is the best initial testing strategy that will detect Legionella species and provide results within a short time frame
PARASITOLOGY
Malaria General Characteristics • Malaria is an infection caused by protozoa of the genus Plasmodium. Four species are known to infect humansPlasmodiumfalciparum, P. vivax, P, ovale, and P. malariae • 300-500 million cases are reported each year world wide, with> 1 million deaths annually. Approximately 1300 cases of malaria are diagnosed in the United States annually • The majority of cases reported in the United States are among immigrants and travelers returning from malariarisk areas, for example, sub-Saharan Africa, Southeast Asia, and the Indian subcontinent • Transmission of malaria is via a bite from an infected female Anopheles mosquito. Sporozoite-stage parasites develop in the mosquito GI tract, then migrate to the mosquito salivary glands. When the mosquito takes a blood meal, sporozoites mix with the saliva and are injected into the human host • Once in the blood stream, sporozoites travel to the liver and enter hepatocytes, where extensive intracellular multiplication occurs. Hepatocytes then rupture, releasing
merozoite-stage parasites into the circulation. The merozoites invade red blood cells, within which they develop into ring trophozoites, then into schizonts (which contain new merozoites) . Rupture of schizonts releases the new generation of merozoites into the bloodstream. Some merozoites differentiate into male and female gametocytes. The gametocytes may then be transmitted to Anopheles mosquitos as they feed. In the mosquito midgut, male and female gametocytes fuse, forming a zygote which matures, producing a new generation of sporozoites • In the human host, P. jlaciparum, P. vivax, and P. ovale have a 48 hour life cycle; P. malariae has a 72 hour life cycle • The P. falciparum genome has been sequenced - The nuclear genome contains 14 chromosomes - Chromosomes range from 0.643 to 3.29 Mb - Chromosomes exhibit extensive-size polymorphism - The mitochondrial genome is small (about 6 kb) and encodes no tRNAs - A chloroplast-like structure known as the "apicoplast" harbors a 35-kb genome, which encodes 30 proteins. The apicoplast synthesizes fatty acids, isoprenoids, and heme
597
Molecular Genetic Pathology
22-18
Fig. 9. P. Falciparum infection, peripheral blood smear. (Courtesy to Bottone, Edward J. An Atlas of the Clinical Microbiology of Infectious Diseases, Volume 2, Viral, Fungal & Parasitic Agents. Taylor & Francis, New York, 2006).
ClinicalPresentation
Diagnostic Methods
• Typically, clinical symptoms begin 10 days to 4 weeks after infection but the infected person may feel ill as early as 7 days or as late as 1 year later
Specimens
• Toxins released during rupture of the erythrocytes cause the typical fever, chills, and flu-like malaria symptoms, i.e., sweats, headaches, malaise , and muscles aches
Conventional Tests and Problems
• Gastric involvement may also cause nausea, cramping, diarrhea, hematemesis, epigastric pain, and vomiting • Malaria can very rapidly become a severe and lifethreatening disease • Patients usually die from cerebral involvement (confusion, disorientation, and coma), renal involvement (albuminuria, hemoglobinuria, and oliguria), or pulmonary edema • Two kinds of malaria, P. vivax and P. ovale, can relapse. In P. vivax and P. ovale infections, some parasites can remain dormant in the liver for several months up to about 4 years after a person is bitten by an infected mosquito
598
• Peripheral blood (most common) , CSF
• Conventional microscopy - Gold standard for diagnostic confirmation. However, accurate interpretation is often dependant on highquality reagents, microscope, and laboratorian experience Thick blood film: unfixed blood sample is stained with Field's stain, diluted Wright's stain, or Giemsa stain. The thick film provides enhanced sensitivity and can be used to detect relatively low levels of parasitemia Thin blood film (Figure 9): methanol-fixed blood sample is stained with diluted Giemsa or Wright's stain. Greater specificity than thick film (morphologic features of the parasite are easier to identify, facilitating speciation)
Molecular Bacteriology, Mycology, and Parasitology
22-19
• Fluorescence microscopy: acridine orange and benzothiocarboxypurine are fluorochromes that label the parasite nucleus, permitting sensitive and rapid detection. However, inability to see red blood cell morphology can create difficulty in speciation of the organism • Antigen detection: immunochromatographic dipstick assays are available for rapid detection of malarial antigens such as histidine-rich protein 2 present in P. falciparum, and parasite-specific lactate dehydrogenase (pLDH), which is found in all Plasmodium spp. Limitations of histine-rich protein 2 assays include inability to detect malaria species other than P. falciparum, as well as false-positives due to persistence of the antigen after clinical resolution, and cross-reactivity with rheumatoid factor. pLDH assays may be useful in monitoring therapy, as decreased pLDH levels correlate with clearance of parasites from blood films • Antibody detection: antibodies against malaria parasites are produced by nearly all individuals within 1-14 days of initial infection by any of the four malaria spp. that cause human disease. These antibodies remain detectable for months to years after clearance of the organism, thus their presence is not always indicative of clinical or subclinical disease. Methods of detection include indirect IFA test (IFAT), and EIA
Leishmania General Characteristics
MolecularMethods
Clinical Presentation
GENERAL
• Various PCR-based methods have been developed for detection of malaria nucleic acids. These include RTPCR, nested PCR, and real-time PCR assays (described later) REALART MALARIA LC PCR ASSAY (ARTUS GMBH, HAMBURG, GERMANY)
• Kit for use with the LightCycler instrument (Roche Diagnostics) • Target is l8 s rRNA gene • Detects Plasmodium spp. in blood • Cannot distinguish between species • 99.5% sensitive and 100% specific in comparison with nested PCR method • Quantitation has low to moderate correlation with extent of parasitemia as determined by microscopy REAL-TIME PCR: LABORATORy-DEV ELOPED ASSAYS
• LightCycler assay using LC Red 640 and melting curve analysis - Comparable with microscopy in ability to detect and speciate Plasmodium spp. • Other assays have been developed using SYBR green and TaqMan (Roche Molecular Diagno stic s) formats
• Leishmaniasis consists of a spectrum of human disease and affects nearly 12 million people world wide in 88 countries, primarily in Latin America, Asia, Europe, and Africa • Leishmania is an obligatory, intracellular, haemoflagellate protozoan parasite of genus Leishman ia (family trypanosomatidae). Leishmania is transmitted to humans by an infected sand fly (genus Lutzomyia ) • The diploid chromosomes of Leishmania species are linear, and range between 200--4000 kb in length. Chromosome size variability is characteristic of some Leishmania species. Leishmania genes are often organized in tandem arrays, which may be transcribed polycistronically • kDNA 00-20% of total DNA) represents the mitochondrial DNA (mtDNA) of the kinetoplastida, a network of concatenated circular DNA, divided into two classes: the homogenous maxicircles (- 25- 50 molecules of 20 kb) and the heterogeneous minicircles (- 0.8 kb), which have many copies (- 104) . The maxicircle is the functional counterpart of the mitochondrial DNA; the minicircles encode guide RNAs (gRNA) for editing of cytochrome oxidase subunit III mRNA.
• Risk factors for Leishmaniasis include malnutrition, immunosuppressive drugs, and HIV • Leishmania infections can have two general clinical presentations: cutaneous leishmaniasis and visceral leishmaniasis - Cutaneous leishmaniasis (Figure lO)-is further categorized as three distinct clinicopathologic entities: tropical sore (Baghdad boil) developing near the vicinity of the fly bite, mucocutaneous leishmaniasis (espundia and nasopharyngeal leishmaniasis), and disseminated anergic cutaneous leishmaniasis (keloid/leproid leishmaniasis) - Visceral leishmaniasis or kala-azar-occurs in South America, Africa, the Mediterranean, and Asia. Cardinal features of the disease are hepatosplenomegaly, lymphadenopathy, pancytopenia, fever, and cachexia
Diagnostic Methods Specimens • Blood (most common), CSF, biopsy
Conventional Tests and Problems • Microscopy - Blood smear on microscope slide is stained with Giemsa or Wright stain for detection of the parasite
599
Molecular Genetic Pathology
22-20
Fig. 10. Leishmaniasis. (Courtesy to Bottone, Edward 1. An Atlas ofthe Clinical Microbiology of Infectious Diseases, Volume 2, Viral, Fungal & Parasitic Agents. Taylor & Francis, New York, 2006).
- For negative smears , tissue or bone marrow biopsy may be necessary for confirmation Reticulum staining may accentuate the nucleus and associated kinetoplast to aid in the diagnosis. However, this finding is not necessary for identification Although a simple and inexpensive method, microscopy has low sensitivity (50-85%) and inability to distinguish between various Leishmania spp. • Serologic studies - Several antigens have been used for serologic diagnosis, including: gp36 (36-kDa glycoprotein), A2 (recombinant antigen), and rK39 (kinesis-like recombinant protein) Direct agglutination test (OAT) • Semi-quantitative; expressed in end-point titers • Uses whole, stained promastigotes in suspension or freeze-dried form • Direct agglutination test may continue to be positive following cure and has not proven to have prognostic value - Indirect IFAT
600
• Utilizes Leishmania promastigotes as the antigen • Provides low specificity, time-consuming, and expensive - ELISA • Most common method • Uses soluble promastigote antigen, purified antigens, synthetic peptides, or recombinant antigens • May have cross-reactivity between different Leishmania species and other parasite s • Antigen detection - "KATEX" polyclonal antibody-based latex agglutination test has 100% specificity and 68-100% sensitivity for detection of leishmanial antigens in urine specimen s from patients with visceral leishmaniasis • Leishmanin skin test (Montenegro reaction) - A delayed -type hypersensitivity assay for diagnosis - A bolus of 0.5 mL of phenol-killed Leishmania parasites (5 x 107) is injected into the forearm . After 48-72 hours , the size of induration is compared with a simultaneously inoculated phenol-saline control of the contralateral forearm
22-21
Molecular Bacteriology, Mycology, and Paras itology
- Cannot distinguish current from past infection
Toxoplasmosis
- Some cross-reactivity with glandular tuberculosis (TB) and lepromatous leprosy
General Characteristics
Molecular Methods
DNA PROBES • For maximum sensitivity, the kDNA, kinetoplast minicircle is used due to high copy number providing multiple targets and conserved region of at least 120 bp • Ribosomal RNA gene s, miniexon-derived RNA, or genomic repeats are also targeted
peR • Targets same gene segments as DNA probes as well as small subunit ribosomal genes or gp36
• The causative organism of toxoplasmosis is Toxoplasma gondii. The word "toxon" is derived from the Greek language meaning bow or arc and refers to the crescent or lunar form of the organism and not to a toxic property • Toxoplasmosis infects a wide variety of mammals and birds and is transmitted when eating meat from chronically infected animals or ingesting oocysts deposited in soil, sand, or litterpans of cats. Transmission may also occur via organ transplantation and vertically from maternal infection • The prevalence of serologic positivity is highest in warm and humid climates (e.g., the lowlands of Guatamala), and in regions with a high prevalence of cats
• Offers improved sensitivity particularly in small amounts of starting material, allows for assessment of treatment and simultaneous detection and typing of parasite
Clinical Presentation
• Reliable diagnostic tool for detection of Leishmania in a variety of clinical samples
• Most patients experience asymptomatic infections, although are seropositive
• Can detect parasitemia prior to development of signs and symptoms
• Toxoplasmosis can manifest with several clinical presentations:
• Sensitivity can be further enhanced by using nested PCR protocols
- Acute febrile disease with evidence of pneumonia, myocarditis, and hepatiti s
• Multiplex PCR and other PCR-based techniques can be used in species and strain identification
- Lymphadenopathy
• Real-time PCR - Detection and quantitation in one assay - Costly method SENSITIVITY AND SPECIFICITY
- Asymptomatic maternal infections with transmission to infant (vertical transmission) - Neonatal disease with jaundice or encephalitis - Acute or chronic encephalitis in the immunosuppressed host (Figure 11) - Uveitis, particularly chorioretinitis
• DNA probes, although directed against repetitive sequences, have a low sensitivity in clinical samples, and therefore are not widely used
Diagnostic Methods
• PCR demonstrates 70-90% sensitivity in various specimen types , for example, blood , lymph node, and bone marrow aspirates
• Isolation and smears - Blood, body fluids, and tissue
PITFALLS
• PCR positive blood results are typically associated with clinical disease . However, a negative result on blood must always be followed by PCR analysis on lymph node and/or bone marrow material for confirmation • Although molecular methods provide increased sensitivity, they have not been widely adopted due to high cost and lack of trained, skilled personnel in field conditions. As a result, use of these tests remains largely for epidemiologic purposes
Clinical Utility • Molecular methods, with their high sensitivity and specificity, can potentially provide improved diagnosis and management over traditional methods • PCR allows patient follow-up and assessment of successful treatment, particularly in visceral leishmaniasis
Specimens
• Serology and immunoperoxidase - Serum • PCR - Amniotic fluid, peripheral blood , CSF, urine-for newborns suspicious for congenital infection - Vitreous or aqueous fluid-for patients with atypical retinal lesions and recalcitrant infections or immunocompromised states - Huffy coat, affected body fluids (bronchial lavage, CSF, ascities, peritoneal , and ocular fluids), bone marrow aspirate, or tissue-for immunocompromised patients
Conventional Tests and Problems • Isolation - Inoculat ion of mice or cell cultures with blood, body fluid, or tissues
601
Molecular Genetic Pathology
22-22
Fig. 11. Toxoplasmosis: ring enhancing lesions as seen by CT. (Courtesy to Bottone, Edward J. An Atlas of the Clinical Microbiology of Infectious Diseases, Volume 2, Viral, Fungal & Parasitic Agents. Taylor & Francis , New York, 2006) .
- Technique has low sensitivity, requiring live parasite for detection - Highly accurate for strain typing • Microscopy - Blood smear on microscope slide is stained with Giemsa stain to demonstrate the parasite • Serologic studies - IgG antibodies should be performed in pregnant women and immnocompromised patients . Lack of IgG during early pregnancy identifies women at risk for infection . Presence of IgG identifies immunocompromised patients at risk for reactivation of latent infection
602
- IgG may be detected by the Sabin-Feldman dye test, IFAT, ELISA, IgG avidity test, or agglutination test - Antibodies may be detected 1-2 weeks after infection and persist for the remainder of the patient's life span. Maternal antibodies may be present for up to 6 months in infants -
Avidity testing • Standard method to distinguish between recently acquired and past infections using IgG antibodies
• High avidity antibodies reflect recent infection (3-4 months) and low avidity antibodies reflect past infection (>3 months) - Immunosorbant agglutination assay
22-23
Molecular Bacteriology, Mycology, and Parasitology
• Immunosorbant agglutination assay detection of IgM is highly sensitive and specific for the diagnosis of congenital infection in neonates • Testing for IgM and IgA will identify 75% of infected babies
Sensitivity and Specificity • Sensitivity of PCR ranges from 64 to 98.8% due to laboratory variation
Pitfalls
• Neonates positive for IgG, but negative for IgM/IgA should be tested for IgGlIgM via Western blotting of the mother and infant • Agglutination testing has also been demonstrated to be helpful in differentiation of acute and chronic infection
• Sensitivity may be limited due to prior exposure of patient to anti-T gondii specific drugs • Some PCR methods have demonstrated a lack of technical specificity in molecular diagnosis with coamplification of human DNA
Molecular Methods
Clinical Utility
POLYMERASE CHAIN REACTION
• PCR provides early detection of congenital toxoplasmosis, avoiding more invasive procedures during pregnancy
• Significantly improves prenatal diagnosis of congenital toxoplasmosis and acute disease in immunocompromised patients • For detection of T. gondii in bodily fluids and tissues, the most common target sequence is the BJ gene (of which there are 35 copies in the organism's genome) REAL-TIME PCR
• Amplifies B J genes or other genes, for example, AF/46527 (which has 200-300 copies in the genome)
• The diagnosis of infection in the neonate is based on persistent or rising IgG titers and/or a positive IgM antibody at any titer after birth in the absence of a placental leak • In cases of pregnant women with primary Toxoplasma infection and negative amniotic fluid PCR results, spiramycin prophylaxis, ultrasonographic follow-up, and postnatal follow-up must be instituted, as this does not rule out congenital infection (sensitivity may be as low as 64%)
MYCOLOGY
Candidiasis
- Myeloperoxidase deficiency
General Characteristics of Candida spp.
- Chronic granulomatous disease
• Ovoid yeast forms with single or multiple buds and pseudohyphae • Forms smooth white glistening colonies • Grows well in vented blood culture bottles, does not require special fungal media for cultivation • More than 80 species, but species of primary human importance include : Candida albicans, C. glabrata,
C. tropicalis, C. parapsilosis, C. stellatoidea, C. guilliermondii, C. krusei, C. pseudotropicalis, C. lusitaniae, and C. rugosa • Normal inhabitants of mucocutaneous body surfaces, soil, hospital environment, and food • Pre-disposing conditions for invasive disease - Diabetes mellitus/immunosuppression - Mucosal damage due to instrumentation, drugs, or tumors - Steroids and antibiotics - Disruption of skin integrity (e.g., due to indwelling catheters) • Defects of phagocytic cell function are associated with candidiasis
Clinical Presentations • Cutaneous - Usually involves skin folds (intertrigo) or nails • Oropharyngeal - Discrete or confluent white patches - May cause deep tongue fissures
.GI - May colonize normal persons but can cause disease in persons who are malnourished, immunocompromised, or who undergo prolonged intra-abdominal surgical procedures - Diffuse ulcerative and erosive esophagitis - Gastritis - Multiple superficial ulcerations of small and large intestine • Vaginal - Associated with discharge and intense pruritis • Invasive, disseminated - GI tract probably most common portal of entry
603
22-24
Molecular Genetic Pathology
Table 4. Antibody Response to C. albicans Cell Wall Proteins and Mannoprotein Component Carbohydrates Mannan HMW-MP (high -molecular mass-mannoproteins) Blood group-I-related antigens Proteins SAP Hsp90
Immunoglobulin isotype
Epitope
IgA, IgE, IgG, IgM O-linked and B-l,2 linked IgG3
Multiple
IgM
Carbohydrate other than mannose
IgG,lgA IgG,IgM
Unknown Unknown (antibodies are negative in healthy human) Unknown Polysaccharide Unknown (antibodies are not detected in healthy human) Unknown (positive in patients with only systemic candidiasis)
Hsp70 Heat shock mannoprotein Enolase
IgG IgA IgG,IgE
Mp58
IgG,IgM
Unknown
Adapted from Martinez Jf, Gil ML, Lopez-Ribot JL, et al. Serological response to cell wall mannoproteins and proteins of Candida albicans. Clin Microbial Rev
- Manifests as fever, shock, and hypotension
ConventionaL Tests and Problems
- Renal-usually from hematogenous spread, may result in renal failure
• Fungal culture - Candida spp. readily grow in culture at 37°C on common isolation media , such as Sabouraud's agar - Germ tube test-positive for C. albicans - Cornmeal agar-for observation of blastoconidia arrangement • Wet mount-skin scrapings mounted in KOH on a slide and examined directly under the microscope
- Myocarditis - Skin-may produce macronodular skin lesions - Endophthalmitis-white, cotton ball-like, chorioretinal in origin, and rapidly progressing to involve vitreous humor • Candidal endocarditis - Common in heroin addicts, patients who have had cardiac surgery, or patients with prolonged intravenous catheterization - Usually associated with large valvular vegetation and major embolic episodes • Primary localized infection - Renal CNS - Pneumonia - Peritonitis - Suppurative thrombophlebitis
Diagnostic Methods Specimens • Whole blood, culture, swab, and tissue • Volume-5 mL whole blood in EDTA or acid citrate dextrose (ACD-yellow top tube) tube, >250 mg tissue
604
• Microscopy - Organism can be identified using periodic acid-Schiff (PAS) or Grocott's Methenamine Silver (GMS) (silver) stain • Biochemical tests: the pattern of fermentation of various carbohydrates can be used to speciate Candida spp. • Serologic studies - Antigen detection • ELISA, EIA, dot immunobinding assay, and latex agglutination • Can detect cell wall mannan, 47-kDa cytoplasmic antigen, ~-glucan, or 48-KDa antigen (enolase) • Antigen detection is likely to become the main method for serodiagnosis of systemic candidiasis - Antibody detection (Table 4) • Immunodiffusion and more sensitive tests such as counter immunoelectrophoresis (CIE), ELISA, and radioimmunoassay
22-25
Molecular Bacteriology, Mycology, and Parasitology
CALB 1 CGL 1 CPA1 CTR1
-...
CGU1 CKRU1 CNS
IT81 188 rONA
IT82 5.88 rONA
288 rONA ~
CA LB2 CGL 2 CPA2 CTR2 CN4
..-CGU2 CKRU2
Fig. 12. Specific primer sites of several candida species for real-time PCR. (Adapted from Min- Chih Hsu et al. Species identification of medically important fungi by use of real-time LightCycler PCR. J. Med Microbial. 2003;52 : 1071-1078,2003).
• These are often negative in the immunocompromised patient, especially at the beginning of an infection • Antibody detection in patients with candidiasis is of limited usefulness because colonization by Candida spp. of the GI tract or other sites can elicit antibody responses in uninfected individuals. Also, antibody responses may be undetectable in immunocompromised patients
Molecular Methods • DNA amplification methods - Nested-PCR
• The sensitivity of the assay is approximately 10 genomes for both C. albicans and C. dubliniensis - Other molecular techniques : • Comparison of DNA sequence and polymorphism • RFLP analysis • Southern blotting • Typing methods such as random amplification of polymorphic DNA (RAPD)
Sensitivity and Specificity
• Targets 18S rRNA Semi-nested PCR
• The LightCycler probe system can detect as few as 5 CFUlmL reproducibly
• Targets 3' end of 5.8S rONA and 5' end of 28S rDNA including ITS2 Real-time PCR-LightCycier (Roche) • Targets I8S rRNA, 5.8S rRNA, or ITS region (Figure 12)
• The use of PCR-ELISA has been shown to be 100% specific at a sensitivity level of 5 CFU/mL of blood • Both C. albieans and C. dubliniensis could easily be differentiated by using the SmartCycier with detection levels of approximately 20 CFU/mL of blood for both species
Real-time PCR-ABI 7700 TaqMan • Targets ITS2 or erg11 Nucleic acid sequence-based amplification • Targets I8S rRNA PCR-ELISA: digoxigenin (DIG) detection kit (Boehringer, Mannheim, Germany) • The targets used for DNA amplification are six of the C. albicans-secreted aspartic proteinase (SAP) genes Real-time PCR: SmartCycler (Cepheid)-blood samples • Primers were selected for their ability to specifically amplify a tefl (elongation factor-l-n) gene fragment from two Candida spp. (c. albieans and C. dubliniensis) • Within the tefl amplicon, a region differentiating C. albicans and C. dubliniensis was selected and used to design two molecular beacon probes
Pitfalls • False-positive results due to contamination (detected by negative control) • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
Clinical Utility • PCR amplification of ribosomal genes and their internal spacers showed a higher sensitivity than culture-based methods • Real-time PCR has the advantage of the possible quantification of fungal presence in tissues and minimizes the samples' contamination risk • Early detection of invasive candidiasis and improved patient management
605
Molecular Genetic Pathology
22-26
Cryptococcosis General Characteristics
- India ink preparations are useful for identification of the organism based on its negative staining characteristics
• Etiologic agent is Cryptococcus neoformans. The organism is usually 4-6 11m in diameter, but in the encapsulated form it can be up to 30 11m
- Alcian blue and mucicarmine are the other two stains used to detect the polysaccharide capsule of yeasts in tissue
• Relatively uncommon fungal condition in the immunocompetent individual. However, C. neoformans can be devastating in the immunocompromised patient • Global distribution due to soil contaminated with pigeon excrement, as C. neoformans can survive in the GI system of pigeons without harm to the host • Transmission is via inhalation of C. neoformans spores • C. neoformans produces a prominent mucoploysaccharide capsule that provides protection from host immune defenses
Clinical Presentation • Two varieties of C. neoformans with different virulence have been identified: C. neoformans var neoformans consisting of serotypes A and D, which cause disease in patients with immune suppression and C. neoformans var gatti consisting of serotypes Band C that cause disease in normal hosts • Primary pulmonary cryptococcal infection is often asymptomatic. However, patients may experience a mild flu-like illness and complain of productive cough, chest pain, fever, and malaise • Most patients with cryptococcosis have a significant predisposing condition, for example, systemic corticosteroid therapy, cancer chemotherapy, malignancy, or AIDS. Disseminated infection is common in immunocompromised patients and most frequently involves the meninges, skin, bone, and prostate gland - Cryptococcal meningitis is characterized by headache, fever, vomiting, and neck stiffness - Cutaneous involvement occurs in 10-20% of individuals with disseminated disease and presents as erythematous papules or pustules that may ulcerate, discharging a pus-like material rich in C. neoformans
• Antigen detection - Latex agglutination is performed on CSF samples for diagnosis of cryptococcal meningitis - Cryptococcal antigen detection tests are not useful in monitoring the course of therapy. Although serum antigen levels tend to decrease over time with therapy, antigen titers may remain high despite negative culture and good clinical response . However, patients with lower titers «1:8 in either serum or CSF) have better cure rates - Persistently high or unchanging antigen titers and a positive India ink preparation during the course of treatment or after, may suggest therapeutic failure or a relapse depending on the patient's clinical status
Molecular Methods • DNA amplification methods - Nested-PCR • Targets 18S rRNA - LightCycler PCR (Roche) • Targets 18S rRNA, 5.8S rRNA, or ITS region
Pitfalls of Molecular Diagnostic Methods • False-positive results due to contamination (detected by negative control) • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay • False-positive results due to cross-reaction with phylogenetically related fungi
Clinical Utility of Molecular Diagnostic Methods • Early detection of disease , especially cryptococcal meningitis, leading to improved patient management
• Most common life-threatening opportunistic fungal infection in AIDS patients
• Monitoring clearance of the organism during therapy for acute cryptococcosis
Diagnostic Methods
Histoplasmosis General Characteristics
Specimens (Molecular Methods) • CSF and tissue
Conventional Tests • Fungal culture - The organism grows in blood agar or chocolate agar within 3-5 days • Microscopy - Cytologic examination (Papanicolaou stain) of sterile body fluids like CSF
606
• Histoplasmosis is a systemic disease caused by the fungal organism Histoplasma capsulatum. The infection can be caused by two varieties, H. capsulatum var. capsulatus (classical histoplasmosis) and H. capsulatum var. duboisii (African histoplasmosis) • The most common systemic fungal infection in the United States, histoplasmosis, primarily occurs in the Ohio and Mississippi river valleys, humid areas with soil enriched by bird or bat excrement. The infection is also endemic in parts of South America, Asia, India, and Africa
Molecular Bacteriology, Mycology, and Parasitology
• H. capsulaturn is dimorphic, growing as a yeast in the human host and as a mold in the environment • Transmission is via inhalation of airborne spores. The inhaled spores then germinate in the lungs
Clinical Presentation
22-27
- Organism can be identified using PAS or GMS silver staining but may be easily confused with other fungal pathogens • Serologic studies - Improved sensitivity and specificity over culture methods Rapid turnaround time
• The expression of disease corresponds to the quantity of spores inhaled and the immune status of the host
Immunodiffusion • Detection of precipitins for H (B-glucosidase) and M (catalase) antigens
• Most healthy individuals exposed to H. capsulaturn are asymptomatic or experience mild flu-like symptoms for 2 weeks
• Widely available • 70-90% sensitivity
• Clinical manifestations can be categorized as acute, chronic, or disseminated histoplasmosis -
Complement fixation testing
Acute histoplasmosis
• 70-90% sensitivity
• Self-limited pulmonary infection that occurs in approximately 1% of individuals exposed to low numbers of spores
• Less specific (70-80%) than immunodiffusion Latex agglutination • False-positives occur in patients with TB
• However, as many as 50-100% of individuals exposed to high spore levels experience acute symptoms, i.e., fever, headache, myalgia, nonproductive cough, and anorexia
Antigen detection • Utilized in immunocompromised patients with disseminated infection who do not manifest an immune response
• Hilar lymph node calcification may be detected
Antibody detection
- Chronic histoplasmosis
• Potential for cross-reactivity
• Much less common than the acute form and primarily affects elderly, emphysematous, or immunosuppressed patients
-
• Western blot • ELISA
• Patients exhibit cough, weight loss, fever, dyspnea, chest pain, hemoptysis, weakness, and fatigue
Molecular Methods
• Chest radiographs may reveal upper lobe infiltrates and cavitation
• Accuprobe H. capsulaturn culture identification test (Gen-Probe)
Disseminated histoplasmosis • Much less common than acute or chronic forms . Occurs in elderly, debilitated, or immunosuppressed (e.g., AIDS) patients • Characterized by progressive spread of infection to extrapulmonary locations such as spleen, adrenal glands, liver, lymph nodes, GI tract, CNS, and kidneys
Diagnostic Methods
NUCLEIC ACID HYBRIDIZATION
-
Rapid (I hour) DNA probe test that utilizes nucleic acid hybridization for the identification of H. capsulaturn isolated from culture Colonies may be tested as soon as growth is visible, but should be no more than 1 week old The method is based on the ability of complementary nucleic acid strands to specifically align and associate to form stable double-stranded complexes
Specimens (Molecular Methods)
Uses a ssDNA probe with a chemiluminescent label that is complementary to the ribosomal RNA of
• Whole blood, BAL fluid, CSF, urine, or tissue
H. capsulaturn
Conventional Tests • Fungal isolation - Definitive diagnosis Time consuming, up to 15 days -
Most effective with high fungal burden, i.e., chronic or disseminated disease; poor sensitivity with low-level exposure
- Insensitive method for sub-acute and acute disease • Microscopy - Granulomatous inflammation
The labeled DNA :RNA hybrids are measured in a Gen-Probe luminometer. A positive result is a luminometer reading equal to or greater than the cutoff. A value less than this cutoff is a negative result Test results are evaluated using fresh growth from agar plates and from broth cultures. The performance of this test has not been demonstrated on direct clinical specimens (e.g., respiratory specimens or CSF) DNA AMPLIFICATION METHODS
• Nested-PCR - Targets a 100 KDa protein gene, or 18S rRNA
607
Molecular Genetic Pathology
22-28
• Semi-nested PCR - Targets H antigen gene
Table 5. Sensitivity and Specificity of DNA-Based Techniques for the Diagnosis of Histoplasmosis on Clinical Specimens
• LightCycler PCR (Roche) - Targets 18S rRNA, or ITS region
Sensitivity and Specificity Sensitivity
Specificity
Molecular methods
(%)
(%)
Pitfalls of Molecular Assays
Accuprobe
100
100
• Requires additional culture step. The direct use of specimens has not been validated
Nested-PCR 100 KDa protein gene 18S rRNA
69 90
100 62
100
100
• Sensitivity and specificity of molecular assays are markedly improved compared with conventional method s (Table 5)
• Further studies may be required to validate various populations in different geographical regions
Semi-nested PCR H antigen gene
Clinical Utility of Molecular Assays • Improved time to result with molecular technique for early detection of disease
Adapted from Guimeriies Al, Nosanchuk lD, ZencopeOliveira RM. Diagnosis of histoplasmosis. Braz J Microbiol. 2006;37:1-13
• Improved patient management
MYCOBACTERIOLOGY Mycobacterium tuberculosis GeneralCharacteristics • Acid fast, non-spore-forming rod • True branching occurs in vitro under special culture conditions • Stains poorly by Gram stain but usually considered Gram-positive • Cell wall backbone contains two polymers, peptidoglycan and arabinogalactan, covalently linked by phosphodiester bonds • Cell wall lipids account for 60% of dry weight of cell wall - Mycolic acids - Cord factor - WaxD • Obligate aerobe • Slow growing , requiring 10-20 days at 37°C before colonies can be visualized • Primary isolation requires complex media containing either egg-potato base or serum-agar base • Glycerol is preferred carbon and energy source • Catalase and peroxidase are present • Iron assim ilation via one hydroph ilic and one lipophilic transport system • Mycobacteriophages - Double-strand DNA phages, unassociated with virulence • Highly resistant to drying
608
• The M. tuberculosis genome has been sequenced - First major pathogen to be sequenced 4,411,522 bp 3924 Open reading frame s GC content of 65.6% +/-70% of the genes can be identified at this stage, the remainder are unique and encode proteins with unknown functions 59% of genes are transcribed in the same direction as chromosomal replication
ClinicalPresentation • 85% cases are pulmonary • Symptoms of active TB disease include: chronic fatigue, a bad cough that lasts longer than 2 weeks, chest pain, hemoptysis, increased sputum production, loss of weight, loss of appetite, chills, fever, and night sweats (Figure 13) • Non- specific constitutional symptoms • In disseminated disease (miliary TB) lesions may develop in any organ, with corresponding organ-specific symptom s
Diagnostic Methods Specimens • Sputum, respiratory specimens, CSF, blood, urine, and other non-respiratory specimens • Sputum specimens should be collected early in the morning on three occasion s
Molecular Bacteriology, Mycology, and Parasitology
22-29
Fig. 13. TB exten sively involving lung. (Courtesy of Bottone, Edward 1. An Atlas of the Clinical Microbiology of Infectious
Diseases, Volume I, BacterialAgents. New York, Parthenon , 2004) .
• Mid-stream urine specimens should be collected in a sterile plastic container on three early mornings • CSF requires a high volume of aspirate s, at least 5 mL • Specimens should be sent to the laboratory within 24 hours after collection and can be stored at 2-8°C for up to 7 days before processing
growth , fluore scence is detected using 365-nm ultraviolet transilluminator • Bactec system (Becton-Dickinson) radiometric and non-radiometric. It uses the same fluore scence quenching-based oxygen sensor as the MGIT (Becton-Dickinson) system to detect growth - Non-automated (manual)
Conventional Methods
• Septi-check blood cultures
• Staining and microscopy: 50% sensitive:
• Isolator tube
- Traditional Ziehl Neelsen
• Biochemical tests for M. tuberculosis
- Kinyoun 's cold procedure
- Positive for niacin accumulation
- Auramine-rhodamine fluorochrome stain
- Positive for nitrate reduction - Growth inhibited by thiophene-2-carboxylic hydrazide
• Mycobacterial culture media: - Selective and non-selective media - Solid media, egg based (Lowenstein-Jensen)
Molecular Methods
- Solid media, agar based (Middlebrook)
NUCLEIC ACID HYBRIDIZATION
- Broth-based (liquid) media , gold standard • Mycobacterial culture systems: 80% sensitivity; 98% specificity; can detect 10 viable organism s/mL - Automated or semiautomated: • MB/BacT (Organon Teknika Corp., Durham, NC) . It is fully automated, non-radiometric system. Carbon dioxide is released into the medium by activel y metabolizing microorganisms and is detected by a gas-permeable sensor. Color changes are monitored by a refle ctometric detection unit • Mycobacteria growth indicator tube (MGIT). It cont ains a modified Middlebrook 7H9 broth in conjunction with fluorescence quenching-based oxygen sensor to detect the growth of mycobacteria. In the presence of mycobacterial
• Hybridization protection assay (HPA) (AccuProbes, Gen Probe Inc. ) - Nucleic acid probes for culture confirmation Sonication lyses microbe s, releases 16S rRNA ssDNA probes labeled with acridinium-ester are added for hybridization When DNA-rRNA hybrid forms, light is emitted and detected by a luminometer Sensitivity-99.2%; specificity- 99.0% DNA AMPLIFICATION M ETHODS
• PCR (Amplicor, Roche Molecular Diagnostics) - It is a colorimetric method and is FDA-approved for acid fast bacilli (AFB) smear-positive respiratory specimen s - The target is a 584-bp segment of the gene encoding 16S rRNA
609
22-30
- The sensitivity and specificity for AFB smear positive specimens are 97%, and 100%, respectively; and for smear negative specimens are 40-80%, and 99.5%, respectively
- It can detect >20 organisms/reaction • TMA Mycobacterium tuberculosis direct (MTD, GenProbe) - A chemiluminescent method, FDA approved for AFB smear-positive and smear-negative respiratory samples - Autocatalytic, isothermal synthesis of RNA - RNA target: 16S rRNA - >1 billion copies of RNA amplicon are produced - The amplicon is detected by the HPA - The sensitivity for AFB smear-positive specimens is 91-100%, for smear-negative specimens sensitivity is 40.0-92.9%. Specificity is 100% • SDA (Becton Dickinson) - Isothermal amplification and chemiluminescence detection. It is FDA approved - The assay targets IS61lO (an insertion sequence) - The sensitivity for AFB smear-positive specimens (98.4%) is higher than for smear-negative specimens (40.3%) • PCR-RFLP (research only) - The assay targets IS61lO
Molecular Genetic Pathology
Clinical Utility of Molecular Tests (Figure 14) • Early diagnosis of TB and determination of drug resistance is important for the initiation of treatment and interruption of the chain of transmission • Can easily distinguish M. tuberculosis from non-tuberculous mycobacteria (NTM)
Techniques for Drug Susceptibility Testing of TB • Drug susceptibility tests must be performed in the following circumstances: - All initial isolates of M. tuberculosis - Isolates from patients who remain culture-positive after 3 months of treatment - Isolates from patients who are clinically failing treatment - An initial isolate from a patient relapsing after previously successful TB treatment
Conventional Methods • Direct method-solid media, either egg- or agar-baseda set of drug-containing and drug-free media is inoculated directly with concentrated specimen
- 0-25 copies of IS6110 are found in most strains of
• Indirect method-egg-based Lowenstein-Jensen medium or agar-based 7HII medium-pure culture is inoculated into drug-containing and drug-free slants
M. tuberculosis - It requires a large amount of high-quality DNA
Phenotypic Methods
- Poor discrimination of isolates that contain less than six copies of IS6110 • Conventional PCR (home brew) - Targets include IS6110, MPB64, and 16S rRNA - Sensitivity (84.2-100%) and specificity (83-100%) • Real-time PCR - Different probe formats are used, which include TaqMan probe, molecular beacons, and FRET probes - Sensitivity (71.6-98.1 %) and specificity is 100% • DNA microarrays - Quick examination of multiple DNA targets in a single hybridization step - Oligonucleotide probes recognize 16S rRNA, DNA gyrase subunit B (gyrB), or rpoB genes
Pitfalls of Molecular Tests • False-positive results due to contamination (detected by negative control) • Lack of knowledge on the viability of the pathogen • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation • PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
610
• Absolute concentration method-uses a standardized inoculum grown on drug-free media containing graded concentrations of the drug to be tested. Resistance is expressed in terms of the lowest concentration of the drug that inhibits growth; MIC • Resistance ratio method-compares the growth of unknown strain of tubercle bacilli with that of a standard laboratory strain. Resistance is expressed as the ratio of the MIC of the test strain to the MIC of the standard strain in the same set • Proportion method-enables a precise estimation of the proportion of mutants resistant to a given drug. For each drug tested, several dilutions of standardized inoculums are inoculated onto control and drugcontaining agar media. The extent of growth in the absence or presence of drug is compared and expressed as a percentage. If growth at the critical concentration of a drug is > 1%, the isolate is considered clinically resistant. Many rapid tesing methods are used to determine drug susceptibility of M. tuberculosis: BACTEC 460 , MOlT 960 , MBlBacT system, and ES II system • Radiometric method-uses liquid medium containing 14°C-labeled growth substrate . Growth is indicated by the amount of 14°C-labeled-carbon dioxide (C0 2) released, as measured by the BACTEC 460 instrument. This method is rarely used in clinical laboratories
Molecular Bacteriology, Mycology, and Parasitology
22-31
------l.~
Specimen
Culture for confirmation
~
------------.
AFS smear
If +
~
~
NAT
--...
NAT
~
+
+
+/-
Low
High
High
Moderate
Non-MTS
MTS
MTS
Inconclusive
Index of suspicion Presumptive dx
10Consult and 3 sp
Low Negative
Fig. 14. Clinical settings and applications of nucleic acid test (NAT) for TB diagnosis . (Adapted from Molecular diagnosis of tuberculosis: current clinical validity and future perspectives. Eur Respir J. 1997;10:1877-1891).
Table 6. Gene Loci Conferring Resistance in M. tuberculosis Drug
Gene
Gene product/functional role
Cellular target
Rifampicin
rpoB
B sub-unit of RNA polymerase/transcription
Nucleic acids
Isoniazid
KatG OxyR-ahpCKas A
Catalase-peroxidase/activation of pro-drug Alkyl-hydro-reductase ~-ketoacyl acyl carrier protein
Cell wall
INH-Ethiona mide
inhA
Enoyl-ACP reductase/Synthase; Mycolic acid biosynthesis
Cell wall
Streptomycin
rpsL rrs
Ribosomal protein S 12/translation 16s rRNNtranslation
Protein synthesis
Fluoroquinolone
gyrA
DNA gyrase
Nucleic acids
Pyrazinamide
pncA
Amidase/activation of pro-drug
Unknown
Ethamutol
embCAB
Arabinosyl transferase/arabinan; polymerase
Cell wall
Adapted from ICMR Bulletin, September, 2002 ; Vol. 32, No.9
Genotypic Methods (Tables 6 and 7) • Automated DNA sequencing-DNA sequencing of PCRamplified products is the most widely used genotypic method and is becoming the gold standard for susceptibility testing • PCR SSCP-based on the property of ssDNA to fold into a tertiary structure whose shape depends on its sequence
• LiPA (Solid-phase hybridization assay)-based on the hybridization of amplified DNA from the cultured strains or clinical specimens to 10 probes encompassing the core region of the rpoB gene of M. tuberculosis • RFLP-IS61lO-based DNA strain typing • DNA Microarray-used for rapid detection of mutations associated with TB drug resistance • Real-Time peR
611
Mol ecul ar Genet ic Path ol ogy
22- 32
Table 7. Some Proposed Methods for Detecting Mutations in peR-Amplified rpoB Genes of M. tuberculosis Major equipment requirements (in addition to PCR)
Reported sensitivity and specificity
Method
Principle
SSCP
Mutations alterelectrophoretic Acrylamide gel 96-97% Sensitivity mobility of amplified rpoB electrophoresis 92-100% Specificity fragments
Line-probe assays
Solid-phase hybridization to oligonucleotide array on membrane filter
DNA chip
Solid-phase hybridization to Microarray chipsand 93%Sensitivity oligonucleotide array computerized reader 100% Specificity
Potentially as powerful as direct sequencing
Molecular beacon
Liquid-phase hybridization to Fluorimeter fluorescently labeled oligonucleotides specific to wild-typeor mutant sequences
100% Sensitivity 100% Specificity
All steps occurin a single sealed tube
RNAIRNA mismatch
Liquid-phase RNA-RNA Agarose gel hybridization and RNAse electrophoresis cleavage at positions of base mismatch
96% Sensitivity 100% Specificity
Specially designed probes combined with commercial kit(mismatch detect, assay; Ambion, Austin, TX)
None
92-98% Sensitivity 100% Specificity
Comments Well-studied method
Commercial kit (Inno-LiPA Rif. TB.)
SSCp, single-strand conformation polymorphism
Non-Tuberculous Mycobacteria General Characteristics • No known primary animal host; usually present in the soil • No evidence for human-to-human transmission
Clinical Presentation Clinical presentation and general features associated with different species of NTM (Table 8). • M. avium complex - Includes two established species M. avium and M. intracellulare
Isolated from water, soil, plants, house dust, and dairy products - Causes pulmonary disease - Clustering of cases in AIDS patients; also associated with emphysema - Highly resistant to anti-tuberculous drugs • M. ulcerans Produces chronic ulcerating skin disease in the tropics, near rivers and swamps
612
- Usually on legs and arms - Treatment requires wide excision • M. kansasii - Tap water is a major reservoir of M. kansasii associated with human disease
- Causes pulmonary or disseminated disease • M. xenopi - Almost exclusively from hot water and hot water taps within hospitals
- Causes pulmonary disease • M. marinum - Salt water, water tanks, and swimming pools are major reservoirs
- Causes cutaneous ulcers • M. fortuitum-M. chelonae complex Isolated from natural water sources and tap water as well as from soil and dust
Requires temperatures of about 28-30°C for primary isolation - Rapid growers - Causes cutaneous ulcers and lymphadenopathy
22-33
Molecular Bacteriology, Mycology, and Parasitology
Table 8. NTM Recovered From Humans Clinical disease
Common etiologic species
Pulmonarydisease
M. avium complex M. kansaeii M. abscesesus M. xenopi M. malmoense
Slow growth, not pigmented Pigmented Rapid growth, no pigment Slow growth, pigmented Slow growth, not pigmented
Lymphadenitis
M. avium complex M. malmonense M. scrofulaceum
Slow growth, not pigmented Slow growth, not pigmented Pigmented
Cutaneous disease
M. marinum
Photochromogen requires low temperatures (28-30°C) for isolation Rapid growth, no pigment Rapid growth, no pigment Rapid growth, no pigment Slow growth, not pigmented
Morphologic features
M. fortuitum M. cheloneae M. abscesesus M. ulcerans Disseminated disease
M. avium complex M. kansaeii M. cheloneae M. haemophilum
Slow growth, not pigmented Photochromogen Not pigmented Not pigmented,requires hemin, low temperature, and CO2 to grow
Adapted from Guidelines for Tuberculosis Control in New Zealand 2003
Diagnostic Methods
• Colony morphology and pigmentation can be examined
Specimens • Sputum, respiratory specimens, CSF, blood, and other non-respiratory specimens • Specimens are best collected in sterile plastic containers and stored at 2-8°C (for up to 7 days) until processed
• Biochemical tests can be performed if warranted (Table 9) • Mycobacterial culture systems -
Automated or semi-automated:
Conventional Methods
• Methods include MBlBacT, Bactec system, MOlT, and so on (see M. tuberculosis section)
• Staining and Microscopy: - Traditional Ziehl Neelsen
• Sensitivity, specificity, advantages, and disadvantages:
-
Auramine-rhodamine fluorochrome stain (preferred)
-
High specificity, but sensitivity as low as 22-78% compared with culture
-
• MGIT system has better recovery rate than BACTEC 460 TB system regarding the M. avium complex and other NTM (86% vs 72%, and 69% vs 50%, respectively)
Kinyoun's cold procedure
• Reduced chance for cross-contamination of cultures, no need for needles, no radioactivity, and no special instrumentation other than the ultraviolet light is required
Organisms may be difficult to distinguish from M. tuberculosis on microscopic examination
• Mycobacterial Culture Media: -
Selective and non-selective media
-
Solid media, egg based (Lowenstein-Jensen)
-
Solid media, agar based (Middlebrook 7H 10 and 7H II )-preferred for NTM
-
Broth-based (liquid) media, gold standard
-
•
Disadvantages include a greater rate of contamination and masking of fluorescence with bloody specimens
• High-performance liquid chromatography -
Detects the spectrum of mycolic acids present in the cell wall by comparing with in-house databases
Advantages of solid media
-
Rapid direct testing
• Growth can be quantified
- Inexpensive cost of consumables
613
22-34
Molecular Genetic Pathology
Table 9. Identifying features of Different Categories of Mycobacteria Mycobacterial group
Key biochemical tests
M. tuberculosis complex
Niacin, nitrate reduction, susceptibility to TCH if M, bovis is suspected
Photochromogens
Tween-80 hydrolysis, nitrate reduction, pyrazinamidase, l4-day arylsulfatase, urease, niacin
Scotochromogens
Permissive growth temperature (M. xenopi: optimal growth 45C), Tween-80 hydrolysis, nitrate reduction, semi-quantitative catalase, urease, l4-day arylsulfatase
Non-photochromogens
Heat-resistant and semi-quantitative catalase activity, nitrate reduction, Tween-80 hydrolysis, urease, l4-day arylsulfatase, tellurite reduction, acid phosphataseactivity
Rapidly growing
Growth on MacConkey agar, nitrate reduction,Tween-80 hydrolysis, 3-day arylsulfatase, iron uptake
- Not as sensitive as nucleic acid amplification -
Requires experienced technician
-
Large amount of biomass required
-
Expensive instrumentation
Molecular Methods
Table 10. Sensitivity and Specificity of HPA Assay for Various Mycobacterium Species Mycobacterial identification
Sensitivity
Specificity
(HPA)
(%)
(%)
M. avium
99.3
100
M. intracellulare
100
100
M. avium complex
99.9
100
M. gordonae
98.8
99.7
When DNA-rRNA hybrid forms, light is emitted and detected in a luminometer
M. kansasii
92,8
100
FDA approved for some common species of NTM , including M. kansasii, M. avium complex (M. avium and M. intracellulare), and M. gordona e
HPA, hybridization protection assay
• Sputum-20 mL, CSF-5 mL-minimal volume NUCLEIC ACID HYBRIDIZATION
• Nucleic acid probes for culture confirmation-HPA (AccuProbes, Gen Probe Inc.) -
Sonication lyses microbes, releasing 16S rRNA ssDNA probes labeled with acridinium-ester are added for hybridization
Sensitivity and specificity (Table 10) Pitfalls
-
Amplicons are detected by the HPA method
• May not be sensitive enough for direct detection on clinical specimens. Repeat or seek confirmation by an alternate method if results are not consistent with other microbiologic or clinical findings
-
Sensitivity and specificity • With genus-specific screening probe, sensitivity is 78.5 % and specifi city is 93 .5% in both respiratory and non-respiratory specimens
• Mis-identification of M. celatum as M. tuberculosis
• The use of probes for common potentially pathogenic mycobacteria may improve sensitivity to 89% while maintaining specificity of 93.9%
• Cross-reactivity has also occurred with M. terrae complex • No commercial probe for majority of NTM NUCLEIC ACID AMPLIFICATION METHODS
• TMA (MTD, GenProbe) - A chemiluminescent method, FDA approved for AFB smear-positive and smear-negative respiratory samples - Autocatalytic, isothermal synthesis of RNA - Target is 16s rRNA
- > I billion copies of RNA amplicon are produced 614
-
Pitfalls • Genus-specific probe may give rise to "falsepositive" results in presence of clinically nonsign ificant NTM • Only available for detecting M. tuberculosis, M. avium, and M. Kansasii or Mycobacterium species
• PCR (Amplicor, Roche Molecular Diagnostics) It is a colorimetric method and is FDA-approved for AFB smear-positive respiratory specimens
22-35
Molecular Bacteriology, Mycology, and Parasitology
16S
c
.----- _ ....) V
23S
'----------.,
!
Gene space ITS (Internal transcribed spacer )
16S sequenc ing
M. abscessus, M. simiae from M. genavense, or M. kansasii from M. gordonae - High expense
Amplif ied
Fig. 15. l6S-23S rDNA ITS.
- The method amplifies specific DNA segments (IS61lO, l6S rRNA gene, or 65kDa heat shock protein gene) • Inno-LiPA Mycobacteria assay (Innogenetics N.Y., Ghent, Belgium) - PCR targets the 16S-23S DNA spacer region of
peR-RESTRICTION ENDONUCLEASE ANALYSIS
• Targets heat shock protein 65 (hsp65) gene • Pitfalls : mis-identification due to intraspecies genetic variability • May be overcome by targeting at l6S-23S DNA spacer region and the rpoB gene of Mycobacterium DNA MICROARRAY
DNA microarray is also used for the speciatron of Mycobacteria (82 unique 16S rRNA sequences correspond to 54 phenotypical species)
Pitfalls of Molecular Techniques
Mycobacterium (Figure 15) - Based on hybridi zation of biotinylated PCR DNA products of the target region
• False-positive results due to contamination (detected by negative control)
- Advantages-simultaneous detection of species in mixed cultures; straight-forward interpretation
• Lack of knowledge on the viability of the pathogen • False-negative results due to amplification inhibition (detected by internal control) or due to a loss of bacteria during specimen preparation
- Pitfall s-not able to differentiate M. tuberculosis from other members of the complex or M. chelonae from
M. abscessus
• PCR assays are not standardized and variations in sample handling and laboratory methods can affect the sensitivity of the assay
GENOTYPINGIFINGERPRINTING
• Overview : of limited clinical value • Targets: RFLP assays targeting the insertion elements IS/245. ISl3ll, and IS9 • Differentiates exogenous reinfection from relapse caused by inadequate therapy • Identifie s laboratory cross-contamination • Useful for determination of outbreak source • Differentiates M. bovis and M. microti, which are difficult for conventional methods to identify • Requires experienced technicians • Dependence on successful isolation of bacteria • Expen sive instrumentation DNA SEQUENCING (MICRO SEQ
500
SYSTEM,
PE-ApPLIED BIOSYSTEMS)
• Based on determination of species-specific nucleotide sequences by comparing with known sequences of in-house or commercially available databases • Targets most commonly 16s rRNA region, alternate assays target rpoll, gyrB, hsp65, and 32-kDa protein genes or the l6S-23S rRNA gene spacer • Targets: a portion (-500 bp) of the 16S rRNA gene • Advantages: fast, and enables identification of new NTM species • Pitfalls : - Problematic identification if no matching sequence found in known database - Unable to differentiate M. tuberculosis from the other species in the complex, M. chelonae from
Clinical Utility of Molecular Techniques • Early diagno sis of infection and determination of drug resistance is important for the initiation of treatment and interruption of the chain of transmission • Improved performance of nucleic acid amplification (NAA) in early detection and medical intervention of disseminated disease patients with AIDS • Identifies many different NTM species
Techniques for Drug Susceptibility Testing of NTM Susceptibility testing of NTM is a controversial issue. There are no data to show that drug susceptibility test results predict clinical outcome for many NTM infection s. NCCLS has recently released recommendations to standardize the performance of NTM drug susceptibility tests: • Indications for c1arithromycin susceptibility testing of Mycobacterium avian complex (MAC) - Clinically significant isolate from a patient who has received previous macrolide therapy (i.e., c1arithromycin or azithromycin) - Patients who have developed MAC bacteraemia on macrolide preventative therapy - Patients failing or relapsing on macrolide therapy - Baseline isolates from significant MAC infections may also be tested (or stored and tested retrospectively if the patient does not respond to treatment)
• M. kansasii - All initial isolates of M. kansasii should be tested against rifampicin
615
Molecular Genetic Pathology
22-36
- For patient s failing or relapsing on treatment and - For rifampicin-resistant isolates, the following antibiotics should be tested: isoniazid, ethambutol , rifabutin, clarithromycin, ciprofloxacin, streptomycin, and co-trimoxazole • Rapidly growing NTM - All clinically significant rapid growers should be subjected to tests again st: amikacin , cefoxitin,
ciprofloxacin, clarithromycin, doxycycline , imipenem, and a sulphonamide. Tobramycin should also be tested for M. chelonae isolates only • Conventional methods: • See section on M. tuberculosis • Phenot ypic method s: • See section on M. tuberculosis
EPIDEMIOLOGY
General • Molecular epidemiology is the use of molecular method s to conduct epidemic investigation of bacterial outbreak s, including the recognition that a problem exists, establishment of a case-control definition, confirmation of cases, and completion of the case finding s The technologies most commonly used for analysi s of bacterial DNA are RFLP-based assay s, DNA repeatbased assays (ribotyping and variable number tandem repeat [VNTR]), PCR-based assays (multiplex PCR and RAPD analy sis), and sequencing-based assays (multi-locus sequence). RFLP-PFGE is considered the current "gold standard" for typing bacteria - Molecular epidemiology is used to investigate environmental and hospital-based (nosocomial) outbreaks. Establi shing clon ality of pathogens can aid in the identification of the source (environmental or personnel) of organi sms, distinguish infectious from non-infectious strains , and distinguish relapse from reinfection. Information from molecular epidemiologic studies facilitates the design of rational pathogen control methods • Nosocomial infections are an important source of morbidity and mortality in hospital settings - An estimated 2 million patient s in the United States are affected each year - Accounts for approximately 5% of hospitalized patient s - Result s in an estimated 88,000 death s annuall y - 4.5 billion USDs in excess healthcare costs - Bacterial agents remain the most commonly recognized cause of hospital-acquired infection s - Multi-drug-resistant pathogens represent a major problem , including: • Gram-positive nosocomial pathogen s: glycopeptide (vancomycin)-resistant enterococci, MRSA , and more recently, glycopeptide-intermediate and resistant S. aureus • Gram-negative bacilli : extended-spectrum-plactamase-producing strains of Escherichia coli
616
and Klebsiella pneumoniae and fluoroquinoloneresistant strain s of Pseudomonas aeruginosa and E. coli • The foundation of molecular epidemiology is based on establishing clonality of microorganisms and understanding the distribution and relatedness of microorganisms - There are a number of key factors that are essential in an epidemic investigation , including the recognition that a problem exists, establishment of a case-control definition, confirm ation of cases, and completion of the case finding s - There are a number important attributes for successful typing scheme s: the methodologies should be standardized, sensitive, specific, and objective - All typing systems can be characterized in terms of typeability, reproducibility, discriminatory power, ease of performance and interpretation, and cost (in terms of time and money) - Typeability-the ability of a technique to assign an unambiguous result (type) to each isolate - Reproducibility-the ability to yield the same result upon repeat testing of a bacterial strain. Poor reproducibility may reflect technical variation in the method or biologic variation occurring during in vivo or in vitro passage of the organisms - Discriminatory power-the ability to differentiate among epidemiologically unrelated isolates - Most molecular method s require costly material s and equipment but are relatively easy to learn and are applicable to a variety of species
Typing by RFLP • RFLP-PFGE: considered the gold standard method because of its good discrimination power and reproducibility • Principle: - Chromosomal DNA is digested with restriction enzymes, resulting in a series of fragments of different sizes that form different patterns (i.e., DNA fingerprinting) when analyzed by agarose gel electrophoresis
Molecular Bacteriology, Mycology, and Parasitology
Enzyme Sma I Xbal
22-37
Sequences 5'-CCClGGG-3' 3'-GGGICCC-5' 5'·TICTAGA-3' 3'-AGATCIT-5'
Fig. 16. Recognition sequences of restriction endonucleases SmaI and XbaI.
- Differences in these pattern s are referred to as RFLPs. Usually 6 nucleotide cutters (Figure 16), such as SmaI, XbaI, and San are used to digest DNA in order to generate relatively few DNA fragment for analy sis The product is usually analyzed by PFGE, which allows the separation of DNA molecule s of 20-1000 kbp in length by periodically changing the direction of the electrical field. Field inversion gel electrophoresis utilizes a conventional electrophoresis chamber in which the orientation of the electric field is periodically inverted by 180 0 • Contour-clamped homogeneous electric field electrophoresis uses a more complex electrophore sis chamber with multiple electrode s (24) to achieve highly efficient electric field condition s for separation; typically the electrophoresis apparatu s reorients the DNA molecules by switching the electric fields at 1200 angles • Contour-clamped homogeneous electric field comb ined with a programmable autonomously controlled electrode gel electrophoresis (Bio-Rad, Hercules, CA) is the most common pulsed-field method used for DNA typing Analysis ofPFGE pattern s is done using a software program such as BioNumerics (Applied Maths, Kortrijk, Belgium), Molecular Analyst Fingerprinting version 1.0 (Bio-Rad), or other programs that are available for the analysis of DNA fingerprint data - The typical phylogenie output is the dendrogram, which provides a visual representation of strain lineages and of genetic similarities and differences between group s (Figure 17) • Assay procedure (Figure 18): - Bacterial cells are embedded in gel block - Cell lysis and release of intact chromosomal DNA by soaking the gel block in lysis solution, usually lysozyme, which digests cell wall - Restriction endonuclease digestion of chromo somal DNA in gel block - Gel block is mounted in agaro se gel and DNA fragments are separated by PFGE at 14°C for 22 hours
------Fig. 17. Analysi s of RFLP-PFGE results using a computer program (bottom) and groupin g of isolates of Acinetoba cter by dendrogram (top).
- Gel is stained by ethidium bromide - Analysis of DNA RFLP is performed using a computer program • Genetic change s or events that alter RFLP pattern s include point mutation s, insertion s, deletion s, and rearrangements of DNA that change the number and/or location s of restriction sites (Figures 19-21) - Each bacterial clone will have a specific restriction profile, thus differenti ate a particular clone from others. This correlation depend s on the number of genetic events in bacterial DNA required to generate the observed pattern variation
617
Molecular Genetic Pathology
22-38
- However, random genetic events, such as point mutations or insertions and deletions of DNA that can alter the restriction profile obtained during the course of an outbreak can occur
Embed cells in 2% agarose plug
+ +
Lyse cell walls with lysozyme
- Single genetic events, such as those that may alter or create a new restriction endonuclease site or change DNA fragment size by insertions/deletions can occur unpredictably even within the time span of a welldefined outbreak (1-3 months)
1 hour at 3?OC
Digest cellular protein with proteinase K
+
16-20 hours at 50°C
Cut DNA with restr iction enzyme
• The purpose of interpretative criteria is to establish a guide for distinguishing true differences in strains from random genetic polymorphisms that may occur over the time of a given nosocomial outbreak (Table 11). Appropriate interpretative criteria provide consistent, objective guidelines for correlating restriction pattern variations observed between individual isolates and the putative outbreak strain and provide an estimate of the likelihood that the isolate is part of the outbreak, or "identical/related" to the outbreak strain
+ +
Load plugs in agarose gel
Run gel on pulsed field electrophoresis At 14°C
+
20 hours at 100-135 mA
Stain gel and view under UV
Fig. 18. Flow chart for bacterial genotyping using PFGE.
Bacterial Chromosomal DNA
'"
(
,
~ ···90 % of the chromosome (the sum of the restriction fragment sizes), but it has only moderate sensitivity, since minor genetic changes may go undetected. The most common problem associated with this assay is incomplete digestion , resulting in difficulty in the interpretation of band patterns
22-39
Molecular Bacteriology, Mycology, and Parasitology
No change in the number of restriction sites
A
B
C
Ins
Del
Re
2 Bands
o Band
Changes in the number of restriction sites
D
E
F
G
epidem ic
Ins
Del
Re
1 2 Bands
3 Bands
3 Bands
4 Bands
Fig. 20. Schematic representation of genetic alteration of restriction sites, number of DNA fragments, and DNA fragment mobility on electrophoresis.
A. 1377
3483 2082 2448
2674 2715 2077
1211 2303
1009
2197 3487 0600 A.
Fig. 21. RFLP-PFGE to detect VRE: schematic representation of genetic alteration of restriction sites, number of DNA fragments, and DNA fragment mobility on electrophoresis.
Ribotyping with Southern Blot Analysis • Ribotyping is a method that can identify and classify microorganisms based upon differences in rRNA genes. Variations among bacteria in both the position and
intensity of rRNA bands can be used for their classification and identification. Ribotyping generates a highly reproducible and precise fingerprint that can be used to classify bacteria from the genus through and beyond the species level • Procedure: - Bacterial DNA is digested using a frequent-cutting restriction enzyme. The resulting DNA fragments are then separated by agarose gel electrophoresis, and transferred (blotted) onto a nitrocellulose or nylon membrane - Next, a labeled (colorimetric or radioactive) oligonucleotide complementary to the target rRNA gene is used to probe the membrane - Under the appropriate conditions, the probe hybridizes to a complementary base pair, and the banding patterns are resolved through the detection of the probe label - The discriminatory power of this method is related to the copy numbers of the targeted genetic elements in the bacterial genome and their distribution among the restriction fragments following electrophoresis. Variations in the number and sizes of fragments detected are used to type the microorganisms • The limitation of ribotyping is that the discriminatory power is less than that of PFGE or some PeR-based methods . A potential benefit of ribotyping is that it can be automated, reducing the technologist time and limiting user variability
619
22-40
Molecu lar Genetic Pathology
Table 11. Interpretative Criteria for RFLP-PFGE Number of genetic diff
Number of band diff
Identical
0
0
Closely related
I
1-3
Is probably part of the epidemic
Possibly related
2
4-5
Less likely to be part of the epidemic
~3
>6
Not part of the epidemic
Category
Different
Interpretation Is part of the epidemic
At least 10 fragments from each isolates are needed for adequate interpretation
Typing by peR
Amplified Fragment Length Polymorphism
• General information:
Amplified fragment length polymorphism is a typing method that utilizes a combination of restriction enzyme digestion and PCR.
- PCR is commonly used for typing organisms due to the ease of the assay and its good discriminatory power. Several PCR methods have been developed for this purpo se The high discriminatory power of PCR-based assays is due to their capacity to detect single nucleotide changes (e.g., addit ions and deletion s) In contrast, RFLP-PFGE analysi s provide s a relatively global chromosomal overview, scanning >90% of the chromosome (the sum of the restriction fragment sizes), but has only moderate sensitivity, since minor genetic changes may go undetected
Multiplex PCR Multiple sets of primers are included in a single reaction tube to generate multiple fragments . Because the amplification products are noticeably different in their sizes; the products can be resolved on agarose gel. The band pattern s can be used to discriminate the clones.
Arbitrarily Primed PCR Arbitrarily primed PCR and the RAPD DNA assay are variations of the PCR technique in which a random primer, which is not targeted to amplify any specific bacterial DNA sequence, is used for amplific ation. The primers bind to target randomly, generating various length DNA fragment s, which are specific for the particular clone. • Although the method is much faster than many of the other typing method s, it is much more susceptible to technical variation than most other method s. Slight variations in the reaction conditions or reagents can lead to difficulty in reproducibility of results and to differences in the band pattern s generated. Therefore, trying to make comparisons among potential outbreak strains by interpretation of band patterns can be very problematic
620
- The DNA is digested with two different restriction endonucleases, usually chosen so that one cuts more frequentl y than the other. This restriction strategy generates a large number of fragments - An adapter sequence where PCR primers bind is then linked to the ends of the restriction fragment s. Following PCR, the reaction products are separated by gel electrophoresis and their banding pattern s can be resolved - The method utilizes the benefits of RFLP analysis with the increased sensitivity of PCR to generate profiles that are reproducible and relatively easy to interpret
Variable Number Tandem Repeat VNTR typing employs amplification of short, repetitive tandem sequences present in many bacterial genomes. The copy number of these VNTR sequences often varies among unrelated strains and can be used for genotyping. Often , fluore scently labeled PCR primers are designed to amplify the whole repeat region . Following amplification, the PCR products are separated by capillary electrophoresis and sized to determine the number of repeats pre sent. Typically, multiple repeat region s are analyzed to determine the genotype.
Typing by Sequencing Analysis • Sequence-based molecular epidemiology is attractive in offering the promise of reproducible typing profiles that are highly amenable to standardization, uniform interpretation, and database cataloging, since they are based on simple quaternary data (A, T, G, and C) • Sequence variation in a specific gene (i.e., a gene for virulence, pathogenicity, drug resistance, and so on) at single-nucleotide level or short repeats can be resolved
Molecular Bacteriology, Mycology, and Parasitology
by sequencing analysis. Therefore, the sequence datafor specific loci/genes from different strains of the same species can be used for molecular epidemiologic applications
Single-Locus Sequence Typing Single-locus sequence typing involves analysis of a particular region of the staphylococcal protein A gene (spa), whichis polymorphic due to 24-bprepeatsequences that may varyin both the numberof repeats and the overall sequence of the polymorphic X or short sequence repeat region. typing appears to be veryrobust, with benefits in throughput, ease of use, and interpretation • It has a lowerlevel of epidemiologic discrimination than that of established genotypic methods suchas RFLP-PFGE •
spa
Multi-Locus Sequence Typing (MLST) MLSTutilizes a larger, and potentially morerepresentative, portion of the genome.
22-41
• MLSTcompares the nucleotide sequences of internal 4QO-500-bp regions of a series of housekeeping genes (typically seven or more), which are present in all isolates of a particular species • For each gene fragment, genetic polymorphisms in sequences are considered distinct alleles. Each isolate is defined by the alleles at each of the sequenced housekeeping loci, which together comprise the allelic profile or sequence type • Because there are many potential alleles at each of the loci, it is unlikely that identical allelicprofiles will occur by chance. Thus, isolates with the sameallelic profileare assigned as members of the same clone • In contrast to single-locus sequence typing, it is currently difficult to envision MLST in a real-time clinical setting due to the expense, labor, and time involved in surveying multiple (often seven or eight) genes (corresponding to -2500 bp of sequence) that must be analyzed to differentiate among multiple isolates
SUGGESTED READING Archer GL, Bosilevac JM. Signaling antibiotic resistance in Staphylococci . Science 2001;291(5510):1915-1916. Attar ZJ, Chance ML, el-Safi S, et aI. Latex agglutination test for the detection of urinary antigens in visceral leishmaniasis . Acta Trop.
2001;78:11-16. Bergeronand MG, Ke D. New DNA-based PCR approaches for rapid realtime detection and prevention of group B streptococcal infections in newborns and pregnant women. Expert Rev Mol Med. 2001 ;3:1-14 . Bialek R. Detection of Cryptococcus neoformans DNA in tissue samples by nested and real-time PCR assays. Clin Diagn Lab Immunol .
2002;9(2):461-469. Black CM. Current methods of laboratory diagnosis of Chlamydia trachomatis infections . Clin Microbiol Rev. 1997;10(1):160-184. Brown DFJ, Edwards DI, Hawkey PM, et al. Guidelines for the laboratory diagnosis and susceptibility testing of methicillin resistant Staphylococcus aureus (MRSA) . J Ant imicrob Chemother.
2005;56(6):1000-1018.
by the Board of Directors, March 1997. Medical Section of the American Lung Association . Espy MJ, Uhl JR, Sloan LM, et aI. Real-time PCR in clinical microbiology : applications for routine laboratory testing. Clin Microbiol Rev. 2006;19(1):165-256. Gardner MJ, Hall N, Fung E, et aI. Genome sequence of the human malaria parasite Plasmodium falciparum . Nature 2002;419:498-511 . Guimariies AJ, Nosanchuk JD, Zancope-Ollveira RM. Diagnosis of histoplasmosis . Braz J Microbiol . 2006;37:1-13. Kaatz GW, Moudgal VV, Seo SM, et aI. Phenothiazines and Thioxanthenes Inhibit Multidrug Efflux Pump Activity in Staphylo coccus aureus, Antimicrobial Agents and Chemotherapy 2003 ;47(2):719-726. Kaul KL _Molecular Detection of Mycobacterium tuberculosis : impact on patient care. Clin Chem. 2001;47:1553-1558. Ke D. Development of conventional and real-time PCR assays for the rapid detection of group B Streptococci. Clin Chem. 2000 ;46:324-331 .
Brown-Elliott BA, Griffith DE, Wallace RJ, Jr. Diagnosis of nontuberculous mycobacterial infections. Clin Lab Med. 2002;22(4):911-925.
Makoto Kuroda et al, Whole genome sequencing of methicillin-resistant Staphylococcus aureus, The Lancet 2001;357(9264):1225-1240.
Canadian External Quality Assessment Advisory Group for Antibiotic Resistance . Guidelines for the Testing and Reporting of Antimicrobial Susceptibilities of Vancomycin Resistant Enterococci; 1998.
Martinez JP, Gil ML, Lopez-Ribot JL, et al. Serological response to cell wall mannoproteins and proteins of Candida albicans, Clin Microbiol Rev. 1998;11(1):121-141.
Cetinkaya Y, Falk P, Mayhall CG. Vancomycin-resistant enterococc i. Clin Microbiol Rev. 2000 ;13(4):686-707.
Mendez-Alvarez S, Perez-Hernandez X, Claverie-Martin F. Glycoprotein resistance in enterococci .lnt Microbiol. 2000 ;3:71-80.
Chemlal, Karim, Portaels, Francoise. Molecular diagnosis of nontuberculous mycobacteria, Curr Opin Infect Dis. 2003 ;16:77-83.
Min-Chih Hsu, Chen KW, Lo HJ, et aI. Species identification of medically important A. Rapid diagnostic tests for malaria parasites . Clin Microbiol Rev. 2002;5(1):66-78.
Cockerill III FR, Smith TF. Response of the clinical microbiology laboratory to emerging (new) and reemerging infectious diseases. J Clin Microbiol . 2004;42(6) :2359-2365. Diagnosis and treatment of disease caused by nontuberculous mycobacteria. This official statement of the American Thoracic Society was approved
Montoya JG, Liesenfeld O. Toxoplasmosis. Lancet 2004;363:1965-1976. Morris A, Harrison A. Non-Tuberculosis Mycobacteria , in Guidelines for Tuberculosis Control in New Zealand 2003. Wellington, New Zealand, Ministry of Health, 2002, pp. 1-24.
621
22-42
Persing DH, Smith TF, Tenover FC, et a!' Diagnostic molecular microbiology principles and applications. (PCR detection of Borrelia burgdorferi by Paul N. Rys) Washington: American society for microbiology. Reller LB. Diagnosis of Legionella infection. Clin Infect Dis. 2003;36:64-69.
Molecular Genetic Pathology
Singh S, Dey A, Sivakumar R. Applications of molecular methods for Leishmania control. Expert Rev Mol Diagn. 2005;5(2):251-265. Soini H, Musser JM. Molecular diagnosis of mycobacteria. Clin Chem. 200 1;47:809-8 14. Stevens DA. Diagnosis of fungal infections: current status. J Antimicrob Chemother. 2oo2;49:5uppl 1;5 11- 519.
Romand S, Wallon M, Franck J , Thulliez P, Peyron F, Dumon H. Prenatal diagnosis using polymerase chain reaction on amniotic fluid for congenital toxoplasmosis. Obstet Gynecol. 200 1;97(2):296-300.
Tavares CA, Fernandes AP, Melo MN. Molecular diagnosis of leishmaniasis. Expert Rev Mol Diagn. 2003;3:657-6 67.
Roth A. Molecular diagnosis of tuberculosis: current clinical validity and future perspectives. Eur Respir 1. 1997; I0:1877-1 891.
Tilton RC. Laboratory aids for the diagnosis of Borrelia burgdorferi infection. Journal of Spirochetal and TIck-Borne diseases 1994;Vol.l :No.1.
Ruzlc-Sabljic E. Microbiolog ical diagnosis of Lyme borreliosis. Acta dermatovenerologica 2001 ;10(4):1-7. Schmidt BL. PCR in laboratory diagnosis of human Borrelia burgdorferi infections. Clin Microbiol Rev. 1997;10(1):1 85-201. Seed CR, Kitchen A, Davis TME. The current status and potential of laboratory testing to prevent transfusion-transmitted malaria. Transfusion Med Rev. 2005;19(3):229-240. Singh A, Goering RV, Simjee S, et al, Application of molecular techniques to the study of hospital infection. Clin Microbiol Rev. 2006;19(3):512-530.
622
Valsamakis Alexandra. Molecular testing for Chlamydia trachomatis and Neisseria gonorrhoeae from Molecular Diagnostics: for the clinical laboratorian . 2nd edition . Wheat LJ. Current diagnosis of histoplasmosis. Trends Microbiol . 2003; II :488-494. Woods GL. The mycobacteriology laboratory and new diagnostic technique s. Infect Dis Clin North Am . 2002;16( I):127-144 . Yeo SF. Current status of nonculture methods for diagnosis of invasive fungal infections. Clin Microbiol Rev. 2002; 15(3):465-484.
23 Molecular Testing for Coagulopathies Veshana Ramiah,
MD
and Thomas L. Ortel,
MD, PhD
CONTENTS
I. Normal Hemostasis Primary Hemostasis Secondary Hemostasis Natural Anticoagulant Proteins Fibrinolysis
II. Factor V Leiden General Clinical Manifestations Acquired Risk Factors for Venous Thrombosis Prevalence Differential Diagnosis Genetics and Biochemistry Relative Risk Functional Testing Molecular Testing Indications for Factor V Leiden DNA Test Benefits and Limitations of APC-Resistance Testing and DNA Testing Testing not Indicated in the Follow ing Situations Management of Homozygotes with Thrombosis Management of Heterozygotes with Thrombosis Management of Asymptomatic Carriers
23-3
Functional Testing Molecular Testing Testing Not Indicated in the Following Situations Management of Homozygotes with Thrombosis Management of Heterozygotes with Thrombosis Management of Asymptomatic Carriers
23-3 23-3 23-3 23-3
23-4 23-4 23-4 23-5 23-5 23-5 23-5 23-5 23-5 23-5 23-6
23-8 23-9 23-9 23-9
IV. Methylenetetrahydrofolate Reductase (MTHFR) C677T Thermolabile
23-6 23-6
Polymorphism
23-9
General Clinical Manifestations Prevalence Genetic s Relative Risk Diagnostic Assays for Homocysteine Who Should be Tested for Hyperhomocysteinemia? Molecular Testing Management
23-9 23-10 23-IO 23-10 23-10 23-10 23-10 23-10 23-10
23-6 23-6 23-7
V. Plasminogen Activator Inhibitor-l (PAI-l) 4G/5G Polymorphism Clinical Manifestations Genetics Functional Testing Molecular Testing Management
III. Prothrombin G20210A Mutation General Clinical Manifestations Acquired Risk Factors for Venous Thrombosis Prevalence Genetics and Biochemistry Relative Risk
23-8 23-8
23-7 23-7 23-8 23-8 23-8 23-8
VI.
Platelet Surface Glycoprotein iliA (Human Platelet Antigen 1A and 2A) General
23-10 23-10 23-10 23-11 23-11 23-11
23-11 23-11
623
Molecular Genetic Pathology
23-2
Clinical Manifestations Prevalence Genetics Antigenic Testing Molecular Testing Management
VII. Hemophilia Mutations General Clinical Manifestations Prevalence
624
23-11 23-11 23-11 23-11 23-12 23-12
23-12 23-12 23-12 23-12
Differential Diagnosis Genetics Functional Testing Molecular Testing Indications for Testing Management
23-12 23-12 23-12 23-12 23-13 23-13
VIII. Other Coagulation Factor
Mutations
23-14
IX. Suggested Reading
23-14
23-3
Molecular Testing for Coagulopathies
NORMAL HEMOSTASIS Sudden and severe loss of blood can lead to shock and death. When blood vessels are damaged, Hemostasi s (clot formation ) will arrest bleeding . This process is divided into primary and secondary hemostasis.
- Extrinsic pathway • Is initiated with material outside of or "extrinsic" to the blood • Damaged tissue release s tissue factor
Primary Hemostasis
• Tissue factor activates factor VII (calcium dependent step)
• Vascular phase - Cutting or damaging blood vessels leads to vascular spasm of the smooth muscle in the vessel wall
• Factor VII activates factor X-(calcium dependent step)
- This produces a vasoconstriction which will slow or even stop blood flow. This response will last up to 30 minutes and is localized to the damaged area • Platelet phase - Damaged endothelial cells lining the blood vessel release von Willebrand's Factor. This substance makes the surfaces of the endothelial cells "sticky" - This condition may, by itself, be enough to close small blood vessels - In larger blood vessels , platelets begin to stick to the surfaces of endothelial cells. This effect is called platelet adhesion - Platelet adhesion is mediated by subendothelial von Willebrand factor (VWF) binding to platelet surface receptor glycoprotein Ib and subendothelial collagen binding to platelet collagen receptors - The platelets that adhere to the vessel walls now begin to secrete Adenosine diphosphate, which is released from "stuck" platelets. This material causes the aggregation of nearby free platelets, which attach to the fixed platelets and each other - Platelet aggregation is mediated by fibrinogen and VWF binding to a second platelet receptor, glycoprotein IIbflIIa - This aggregation of platelets leads to the formation of a platelet plug
Secondary Hemostasis • Begins 30 seconds to several minutes after primary hemostasis starts • The overall process involves the formation of the insoluble protein fibrin from the plasma protein fibrinogen through the action of the enzyme thrombin • Fibrin forms a network of fibers, which traps blood cells and platelets forming a thrombus or clot • This process depends on the presence in the blood of II different clotting factors and calcium • Ultimately, these factors will generate the production of factor X • Depending on the initial trigger for the clotting reactions, there are two pathways leading to the formation of the thrombus; the extrinsic pathway and the intrinsic pathway
- Intrinsic pathway • Is initiated by the blood coming in contact with exposed collagen in the blood vessel wall • Factor XII is activated by making contact with exposed collagen underlying the endothelium in the blood vessel wall • Factor XII activates factor XI • Factors XII and XI jointly activate factor IX • Factor IXa converts factor X to factor Xa • Factor Xa generates factor IIa (thrombin) from factor II (prothrombin) • It should be noted that both pathways lead to the same reaction , namely, the activation of factor X • From this point on, both pathways follow the same course to Fibrin formation • For this reason the steps from factor X activation to fibrin formation are referred to as the common pathway - Common pathway • Factor X (active) engages in a series of reactions with factor V, calcium ions, and phospholipids derived from platelets. This composite of clotting factors and their reactions is referred to as the factor V complex • Factor V complex initiates the conversion of prothrombin to active form of the enzyme thrombin • Thrombin accelerates the formation of fibrin threads from fibrinogen (Figure 1)
Natural Anticoagulant Proteins • These proteins counter balance the pro-coagulant protein cascade and prevent excessive, unregulated fibrin production • All these protein s are synthesized in the liver • Antithrombin-inhibits factors XIIa, XIa, IXa, Xa, IIa (thrombin) • Protein C-activated form inactivates cofactors Villa and Va • Protein S-required as a protein C cofactor • Tissue factor pathway inhibitor-inhibits TFNIIalXa
Fibrinolysis • Tissue-type plasminogen activator and urokinase-type plasminogen activator convert plasminogen to plasmin
625
Molecular Genetic Pathology
23-4
Cell surface
~ -~,f'---
Antithro!l!lIilJIIlII.Ig,h eparan
Factor lIa
Fibrinogen
Plasminogen
.. - - - . . . Plasm in u-PA t-PA
Th rombomodulin Protein S Protein C
Fig. 1. Coagulation pathway. (Rosenberg, R. D. et al. N Engl J Med 1999;340:1555-1564.) • Once generated, plasmin proteolytically degrades fibrin. Patients with hemorrhagic and/or thromboembolic disorders may have either inherited and/or acquired defects in normal hemostasis, natural anticoagulant pathways, or
fibrinolysis . An increasing number of inherited risk factors, particularly for thrombosis, can be tested with molecular diagnostic strategies
FACTOR V LEI DEN General • Factor V is a cofactor in the activation of prothrombin to thrombin by factor Xa • Factor V is activated to factor Va by thrombin and is inactivated by activated protein C • Factor V Leiden is a common hereditary hypercoagulable syndrome resulting from a single point mutation (R506Q) in the factor V gene, which results in arginine (R) being replaced
626
by glutamine (Q) at residue 506. This mutant glutamine renders the factor V protein resistant to cleavage by activated protein C (referred to as "APC [Activated Protein CAPl resistance"), resulting in a longer half-life of this cleavageresistant factor V, leading to a hypercoagulable state
Clinical Manifestations • Deep vein thrombosis (DVT)
23-5
Molecular Testing for Coagulopathies
• Pulmonary embolism
Genetics and Biochemistry
• Indications of an inherited hypercoagulable syndrome: - Recurrent thrombotic episodes
• The gene for factor V is located on chromosome 1
Thrombosis at a young age «50 years) Thrombosis at unusual anatomic sites (cerebral, mesenteric, portal, or hepatic veins)
• Factor V Leiden is caused by a well-conserved point mutation in the gene for coagulation factor V • The G to A transition at nucleotide 1691 replaces an arginine (R) with glutamine (Q) at residue 506 (R506Q) (Figure 2)
Pregnancy-related venous thrombosis (or in association with oral contraceptives or hormone replacement therapy)
• Normal factor V protein is cleaved by APC at arginine 506
Family history
• Mutant glutamine (Q) 506 is cleaved much less efficiently byAPC
Acquired Risk Factors for Venous Thrombosis
• Cleavage-resistant factor V has longer half-life, resulting in a hypercoagulable state
• The following acquired conditions can work synergistically to increase the risk of thrombosis in a patient with the factor V Leiden mutation:
Relative Risk
- Pregnancy - Long periods of immobility - Post-surgical state - Use of oral contraceptive - Use of hormone replacement therapy - Trauma
• Factor V Leiden heterozygotes have a 4-10 fold increased risk of venous thrombosis • Although the factor V Leiden mutation predisposes the carrier to increased thrombosis, most factor V Leiden heterozygotes remain asymptomatic • Factor V Leiden homozygotes have an 80-fold increased risk of spontaneous venous thrombosis
- Cancer - Smoking - Obesity
Prevalence • Factor V Leiden is the most common cause of inherited thrombophilia in Caucasians • Heterozygosity for factor V Leiden is found in 3-8% of the US population, and the incidence varies by ethnicity. Homozygosity for factor V Leiden is found in I in 5000 Caucasians (Table 1) • Factor V Leiden is found in 15-20% of patients experiencing their first episode of DVT • Factor V Leiden is found in 50-60% of patients with recurrent or estrogen-related thrombosis
Differential Diagnosis • Of patients with APC resistance, 5% do not have the factor V Leiden mutation, a condition referred to as "acquired" APC resistance • Acquired APC resistance can be seen in certain situations, including pregnancy or in the presence of a lupus anticoagulant
Functional Testing • Assays testing for APC resistance can be used as screening tests prior to DNA testing: - Ratio of activated partial thromboplastin times (aPTT) measured in the presence and absence of exogenous APC (aPTT+APC/aPTT- APC) - Normal APC resistance ratio may be approximately 2 or greater, depending on assay configuration - Failure of added APC to prolong the aPTT indicates APC resistance. Factor V Leiden homozygotes may have an APC ratio as low as 1.0-1 .5 • Of patients with APC resistance, 90-95% will have the factor V Leiden mutation (heterozygous or homozygous) • Factors which may cause APC resistance in the absence of the factor V Leiden mutation include heparin, lupus anticoagulants, or elevated factor VIII levels
Molecular Testing • Direct DNA testing for factor V Leiden mutation is now the gold standard
• Acquired APC resistance also appears to be associated with an increased thrombotic risk, even in the absence of factor V Leiden
• May be performed by the polymerase chain reaction with restriction fragment length polymorphism (PCR-RFLP) (Figure 3) or with fluorescence resonance energy transfer (PCR-FRET) (Figure 4), or by other methods. Assays used include the Invader assay shown in Figure 4 as well as other including the Lighu.ycler'" assays (Roche, Indianapolis, IN)
• Venous thromboembolism can also be caused by other inherited thrombophilic disorders, such as the prothrombin G20210A mutation, or inherited deficiencies in protein C, protein S, and antithrombin
• Pseudo homozygosity has been described in patients with coinheritance of factor V Leiden for one allele, and a mutation resulting in the loss of expression of factor V on the second allele
627
Molecular Genetic Pathology
23-6
Table 1. Ethnic and Racial Distribution of Common Inherited Thrombophilic Disorders Analyzed by Molecular Diagnostic Testing Ethnic
or racial group
Caucasian
Hispanic American
African American
Native American
Asian American
African or Asian
(%)
(%)
(%)
(%)
(%)
(%)
FactorV Leiden
4.8
2.21
1.23
1.25
0.45
0.05
Prothrombin G 20210A
2.7
-
-
-
-
0.06
MTHFRC677T
56
52
10
32
40
-
MTHFRA1298C
42
38
-
-
-
-
PAl-I 4G/5Ga
49
24
-
-
-
Platelet GP-IIIb PIAl/pIA2b
98
-
92
-
99
-
Thrombophilic disorder
Frequency of the heterozygous state for each specific disorder in normal individuals from each of the individual ethnic
or racial groups is provided aFrequency provided is for the 4G haplotype bFrequency provided for the PIAl haplotype
Arg-506
Factor V
t t
-- Ca 2+
t - -
APC
• Functional test can be inaccurate in cases of prolonged baseline aPTT (assay needs to be modified by using factor V-deficient plasma) • DNA test is more definitive and results are unambiguous. Specificity and sensitivity are 100% for the presence of the genetic mutation • DNA testing alone may miss 5-10% of APC resistance due to other, acquired causes
-Ser-arg-ser-Ieu -asp -arg-arg-gly- ile-gln-
Factor V Leiden
~
-Ser-arg-ser-Ieu-asp-arg-gln-gly-ile-gln-
Fig. 2. Factor V Leiden .
Testing Not Indicated in the Following Situations • As general population screen • As a routine initial test during pregnancy • As a routine initial test before or during oral contraceptive use, hormone replacement therapy, or serum estrogen receptor modifier
Indications for Factor V Leiden DNA Test • Confirm molecular diagnosis in patients with APC resistance • Evaluate patients with personal history of thrombophilia • Evaluate asymptomatic family members of patients with the factor V Leiden mutation, if clinically indicated
Benefits and Limitations of APC-Resistance Testing and DNA Testing • APC-resistance test is less costly and is relatively widely available
628
Management of Homozygotes with Thrombosis • Treat acute thrombotic episode with heparin (or low molecular weight heparin), followed by warfarin • Recommendation for long-term treatment and prophylaxis with warfarin to prevent recurrent thrombo sis
Management of Heterozygotes with Thrombosis • Those with first DVT event and presence of another reversible risk factor (pregnancy, oral contraceptives, and immobility) generally do not need long-term warfarin
23-7
Molecular Testing for Coagulopathies
FV MnL1
MnL1*
t
t Normal 82 bp
I
I 104 bp
37 bp
G1691A 82 bp
Normal
141 bp
Heterozygous
Homozygous
141 bp
104 bp 82 bp
37bp
Fig . 3. RFLP analysis for G 1691A mutation in factor V.
• For those with a first DVT and no obvious risk factor, consider undetermined additional genetic risk factor(s) and consider long-term warfarin therapy • Patients with recurrent thrombotic events usually require long-term anticoagulation therapy and prophylaxis • Patients should be counseled to avoid high-risk thrombotic situations and to get prophylactic
anticoagulants before exposure to oral contraceptives, immobility, surgery, or pregnancy
Management of Asymptomatic Carriers • Controversial, but some recommend thromboprophylaxis in high-ri sk situations (e.g., post-operative state ; extended plane flights)
PROTHROMBIN G20210A MUTATION
General • Prothrombin (factor II) is the precursor of thrombin, the final enzyme of the coagulation cascade, which converts fibrinogen to fibrin • Prothrombin is a vitamin K-dependent protein, which is synthesized in the liver and circulates with a half-life of approximately 3-5 days • The prothrombin G20210A mutation is in the 3'untranslated region of prothrombin and is associated with increased levels of prothrombin in the circulation
• Increased prothrombin levels are associated with an increased risk of thrombosis
Clinical Manifestations • DVT • Pulmonary embolism • Arterial thromboembolic complications are rare • Indications of an inherited hypercoagulable syndrome are the same as for factor V Leiden
629
Molecular Genetic Pathology
23-8
A
B Structure: invasive complex forms (one bast Invasion)
Structure : no Invasive complex forms ; WT probe and Mut target are not complementary at base of interest
i
5~ ' ~~ No cleavage
c Result : cleavage
(
Invader oligonucleotide 5' 3'1 Mut target
'WT
probe 13'
T
15'
Result: no cleavage
Released flap
1
IGI
~Si~ of cleavage
"l1li__'
p1 IGI Released_ifiiila.• • • •
Result: cleavage and detection Fluorescence forWT
Fig. 4. Schematic outline of the invader assay for FVL.
Acquired Risk Factors for Venous Thrombosis
Relative Risk
• These are the same conditions that are described for factor V Leiden
• Prothrombin gene heterozygotes have a 3-fold increase risk of venous thrombosis
Prevalence • 1-3% in Caucasians, uncommon in individuals of Asian or African descent (Table 1) • Threefold increased risk of venous thrombosis in heterozygotes • Polymorphism present in 5-18% of patients with spontaneous venous thromboembolism
Genetics and Biochemistry • The gene for factor II (prothrombin) is located on chromosome 11 • Prothrombin G20210A gene polymorphism is located in the 3'-untranslated region of the prothrombin gene • The polymorphism is a single base pair substitution at position 20210 of a guanine (G) for an adenine (A) nucleotide • This polymorphism results in increased levels of prothrombin, which is associated with increased risk of venous thrombosis
630
• Risk of thrombosis substantially increased in patients with additional genetic risk factors including factor V Leiden, hyperhomocysteinemia, antithrombin III deficiency, protein C deficiency, and/or protein S deficiency
Functional Testing • Functional or antigenic assays are not useful to detect the prothrombin G20210A polymorphism
Molecular Testing • Direct DNA testing via PCR using either PCR-RFLP (Figure 5) or PCR-FRET • Indications for prothrombin G20210A testing include: - Patients with a personal history of thrombophilia - Asymptomatic family members of patients with the prothrombin G20201A , if clinically indicated
Testing Not Indicated in the Following Situations • As general population screen • As a routine initial test during pregnancy
23-9
Molecular Testing for Coagulopathies
PT
Normal 345bp
~
HIND 111*
I
G20210A 322 bp
Normal
23 bp
Heterozygous
Homozygous
345 bp 322 bp
Fig. 5. RFLP analysis for G202lA mutation in prothrombin gene. • As a routine initial test before or during oral contraceptive use, hormone replacement therapy, or serum estrogen receptor modifier therapy
• First DVT and no obvious risk factor-consider undetermined genetic risk factor and consider long-term warfarin
Management of Homozygotes with Thrombosis
• Patients with recurrent thrombotic events usually require long term anticoagulation therapy and prophylaxis
• Treat acute thrombotic episodes with heparin or lowmolecular weight heparin , followed by warfarin • Consider long-term treatment and prophylaxis with warfarin to prevent recurrent thrombosi s
Management of Heterozygotes with Thrombosis • Those with first DVT event and presence of another reversible risk factor (pregnancy, oral contraceptives, and immobility) may not need long-term warfarin
• Patient s should be counseled to avoid high risk thrombotic situations and to get prophylactic anticoagulants before exposure to oral contraceptives, immobility, surgery, or pregnancy
Management of Asymptomatic Carriers • Controversial, but similar to recommendations for asymptomatic carriers of factor V Leiden
METHYLENETETRAHYDROFOLATE REDUCTASE (MTHFR) C677T THERMOLABILE POLYMORPHISM General • Homocysteine is an amino acid, derived from methionine and may be converted to cysteine • Homocysteine metabolic pathways require vitamins B 12, B6, and folate; elevated homocysteine levels may be hereditary
(due to mutations in these pathways) or acquired (due to deficiencies of vitamins B 12, B6, or folate, renal failure, carcinoma, hypothyroidism, or medications) • Elevations in homocysteine are associated with increased risk of arterial and venous thrombosis and atherosclerosis, based on retrospective case control studies; prospective studies
631
Molecular Genetic Pathology
23-10
show a weak positive association with arterial thrombosis, and no definite association for venous thrombosis • Homozygosity or heterozygosity for the C677T mutation in the MTHFR gene , which is involved in homocysteine metabolic pathway, does not appear to be an independent risk factor for thrombosis. However, homozygosity for the C677T mutation may be significant in folate-deficient patients
Diagnostic Assays for Homocysteine • Both high performance liquid chromatography and immunoassay are acceptable methods for measurement of plasma homocysteine levels • Gender and local population-specific reference ranges are strongly recommended • Samples drawn in EDTA should be kept on ice if not analyzed within 30 minutes
Clinical Manifestations
• Homocysteine levels may remain elevated for several months following myocardial infarction or stroke
• Severe MTHFR deficiency is a rare cause of homocystinuria
• Secondary causes of hyperhomocysteinemia such as B I2 deficiency should be considered
• The thermolabile polymorphism for MTHFR can result in mild-to-moderate elevations in the homocysteine level
Who Should be Tested for Hyperhomocysteinemia?
• Moderate hyperhomocysteinemia typically manifests when folate levels are in lower end of normal range. Usually result of low intake of folate, B6 , or B 12
• Patients with documented atherosclerotic disease (coronary artery, cerebrovascular, or peripheral vascular disease)
Prevalence
• Controversial whether testing is indicated in patients with venous thromboembolism
•
• Routine screening for hyperhomocysteinemia in asymptomatic individuals is not recommended
12% of US population is homozygous for the MTHFR C677T mutation (Table 1)
Genetics
Molecular Testing
• Gene for MTHFR is located on chromosomal 1, at region Ip36
• Direct DNA testing via PCR with RFLP or FRET analysis
• Thermolabile MTHFR variant has reduced activity at 37°C and increased lability at 46°C • The C677T mutation is due to a C to T substitution at nucleotide 677, which encodes a change in alanine to valine • Another common polymorphism in MTHFR is A1298C, which encodes for a change in glutamic acid to alanine
Relative Risk • Controversial whether elevated homocysteine is a risk factor for venous thromboembolism • No evidence that C677T or Al298C heterozygosity is a risk factor for venous or arterial thrombotic disease • Homozygosity for C677T mutation in MTHFR is associated with higher plasma homocysteine levels, but is not, in itself, an independent risk factor for thrombosis
• Genotyping for either 677 or 1298 mutations in MTHFR is generally not recommended in subjects without first testing for elevated homocysteine
Management • Still not clear regarding benefit of homocysteine lowering therapy (i.e., with vitamin B I2 or B6 therapy) • Selected patients (i.e., those with history of or at high risk for premature cardiovascular disease, stroke, or venous thromboembolism) may benefit from detection and treatment of hyperhomocysteinemia • Treatment with either folic acid (0.4-1.0 mg/day) or vitamin B I2 (0.5-1.0 mg/day), or both is relatively inexpensive and safe • Goal to maintain plasma total homocysteine level .
N
(0
Ci ...... :J
"0
o
:J
0-
3 o o
C10
(0
I
c Ci -..
(0 (")
o
Molecu lar Genetic Pathology
24-6
HEMOGLOBINOPATHIES
General
• RBCs are more prone to lysis due to the instabilit y of the Hb tetramer s
• Disorders of Hb caused by mutation s
• Hundred s of clinically significant variants exist
• Most are autosomal recessive (Table 2) • Subdivided into three categories based on the effects of mutation - Qualitati ve or structural (alteration of amino acid sequence in one or more of the globin chain s) - Quantitative (reduced synthesis of one or more of the globin chains) - Hereditary Persistence of Fetal Hb (HPFH)
• Hb has increased or decre ased affinity for oxygen • Usually caused by a point mutation (single nucleotide substitution)
• HbD
• ~-Thalassemia • Complex ~-thalassemia • HPFH
Hb
Composition
HbA
(~~2)
Normal adult
HbA 2
(~()2)
Normal level 2.5%
HbF
(~Y2)
Fetal period
HbH
(P2)
Biologic condition
Inheritance
Hb S polymerizes under low oxygen tension-scells sickle-svascular occlusion
AR
Hb C crystallizes within RBCs; cells less deformable, tend to fragment-ehernolysis
AR
SC
Compound heterozygotes have mild sickle cell disease symptoms
AR
E
Abnormal RNA splicing -edecreased synthesis and mild thalassemia
AR
C
• HbC
Table 3. Hbs Compositions and Biologic Conditions
Table 2. Hb Structural Variants
S
• HbS
• a.-Thalas semia
• Changes in globin structure do not affect the rate of its synthesis
Effect of mutation
Types of Hemoglobinopathies (Table 3)
• HbE • Hb Constant Spring
General Characteristics
Hb
• Hb has increased or decreased oxygen affinity
AR, autosomal recessive
a-Chain limitation
Hb Gower 1
(~2t2)
Embryonic stage
Hb Gower 2
(a 2t 2)
Embryonic stage
Hb Portland
(~2Y2)
Embryon ic stage
Hb Bart
(Y2)
a-Thalassemia fetus
HbS
(~~S2)
Sickle cell disease
HbC
(~PC2)
Hb C disease
HEMOGLOBIN S General
• First molecular disease to be recognized
• Most common Hb variant • Hb S differs from normal adult Hb A only by a single amino acid substitution at the sixth position of the ~-globin chain - Autosomal recessive trait
• Molecular pathogenesis is well-characterized, but still not completely understood
642
• Hb composition in the Hb S-related disease s: - Hb S >80 %, Hb F 90
• ~-thalassemia minor (trait) (~o/~) - Mild or no anemia - Normal-to-increased RBC counts • Microcytosis • Electrophoresis - Mild increase in Hb F - Increase in Hb A2
Genotype
Hb F (%) Mild increase
• ~-thalassemia intermedia (~+ ~+) - Wide spectrum of disease - Moderate to severe anemia (Hb 6-10 g/dL) Growth retardation with bony abnormalities (secondary to bone marrow hyperplasia)
647
Molecular Genetic Pathology
24-12
- Hb F 20-40%, increased Hb A2
- If the mutation involves either the 5' -GT or the 3'-AG (e.g., at a splice junction of an intron), splicing cannot occur (this particular type of mutation is seen in African Americans)
• p-thalassemia major (PO/PO) - Also called Cooley's anemia - Microcytic, hypochromic anemia (Hb 2-3 g/dL) - Hepatosplenomegaly (secondary to lysed RBCs) - Bony abnormalities, failure to thrive
- Mutations within an exon or intron may also create a cryptic splice site (very similar in sequence to the true splice site)
- Hb F >90%, Hb A2 3-8% - Patient is transfusion-dependent, susceptible to iron overload • Most patients have simple p-thalassemia, in which only the production of P-globin chains is affected - Decreased synthesis of P-globin chains disturbs the balance between the two chains and a-chains precipitate - The a-chains bind to the RBC membranes producing membrane damage • Complex thalassemia involves deletion of both the P-globin gene and one or more of the other genes at the P-globin locus
Cryptic splice sites occur frequently and can be anywhere within the gene; the amount of normal mRNA present depends upon how often splicing takes place at the true site vs the cryptic site - This mechanism often underlies P+ thalassemia, because the true splice site is still utilized to some extent • Defects in post-transcriptional modification: A single nucleotide substitution at the 5' cap site of mRNA (A-C) or in the 3' polyadenylation sequence (T-C) render mRNA susceptible to degradation - Nonsense and frameshift mutations can both lead to the production of truncated mRNA, while a frameshift can also elongate mRNA; resulting in instability in both cases
Prevalence • The frequency of different types of mutations is specific to geographical location and ethnic group
- Single nucleotide point mutation halts translation at codon 39 (CAG or glutamine changed to UAG or stop) of the P-globin chain-e pothalassemia (Mediterranean)
Clinical Symptoms
-
• Patients do not become symptomatic until Hb F synthesis wanes at about 2 years of age • Depending on the form of p-thalassemia acquired
Molecular Pathogenesis • Due to mutations in the P-globin gene on chromosome II • Overwhelming majority of p-thalassemias arise from point mutations in the ~-globin gene (over 100 are known) • Sequence deletions are also recognized, for instance, a 619-bp deletion within the P-globin gene is common in patients of Indian heritage • mRNA splicing error are the most common mutation - >24 have been identified - The examination of the mutant mRNAs has yielded a great deal of data indicating which sequences are crucial to proper RNA processing
COMPLEX • These forms of thalassemia are, fortunately, much less common • Involve large deletions from the P-globin gene cluster • If at least one of the y genes is still intact, Hb F will persist after birth
648
Alternatively, a single base pair deletion at position 16 alters reading frame; translational apparatus encounters a stop codon too scon-e pothalassemia (Indian)
• Promoter mutations - In the Japanese population, a single nucleotide change within the ATA box (promoter sequence) leads to P+ thalassemia
Common Laboratory Findings • Morphology : microcytic RBCs, although the number of RBCs present would be within normal range
Molecular Testing • Refer to Molecular Techniques section
Miscellaneous Testing • Refer to Traditional Laboratory Techniques Used to Aid in Diagnosis section
p.THALASSEMIA • For molecular and other laboratory tests available refer to Molecular Techniques section and Traditional Laboratory Techniques Used to Aid in Diagnosis section
24-13
Molecular Hemoglobinopathies
HEREDITARY PERSISTENCE OF FETAL Hb
General • Fetal Hb (Hb F) is the main oxygen transport protein in the fetus during the last 7 months of development • Hb F binds oxygen with greater affinity than the adult form • Hb F is nearly completely replaced by Hb A by approximately the 12th week of postnatal life • Decreased ~-globin chain synthesis is compensated for by the production of y-globin • Homozygotes have 100% Hb F • Heteroz ygotes have 70 % Hb A and 30% Hb F
Clinical Symptoms • HPFH clinically similar to ~-thalassemia but milder
Molecular Pathogenesis • Point mutations in the promoter region of one or another y-globin gene alters interactions between various transcription factors and the promoter
• A 27-kb deletion in the ~-globin gene brings normally distant cis-acting factors into the vicinity of the genes, deregulating normal development
Molecular Testing • Refer to Molecular Technique s section
Miscellaneous Laboratory Testing • Kleihauer-Betke or acid elution test: red cells are fixed in alcohol and treated with buffered citric acid; the cells are then stained with eosin - Cells that contain Hb F will stain bright red (this Hb remains within the cells under these conditions) - Cells that contain Hb A will not stain (this Hb elutes out of the cells) - This test can be performed to assess the extent of fetomaternal hemorrhage in Rh-negative women to determine Rhogam dosage or to detect HPFH • Flow cytometry: Hb F identified by fluorescently labeled murine monoclonal antibodies in an instrument, which utilizes RBC gating parameters
TRADITIONAL LABORATORY TECHNIQUES FOR DIAGNOSIS
Clinical Indications for Testing • Patient 's clinical history may be suspicious • Abnormalities noted in complete blood count • Screening programs: all newborns born in the United States are screened for variant Hbs
Complete Blood Count • • • • • •
Hb concentration: determined by cyanoHb method Hematocrit (Hct): MCV x RBC (or roughly 3 x Hb) Mean corpuscular volume (MCV) : HctJRBC Mean corpuscular Hb (MCH): Hb/RBC Mean corpuscular Hb concentration (MCHC): Hb/Hct x 100 Absolute number of RBC - Absolute number of red cells : if this number is normal but cells are microcytic-epossible ~-thalassemia minor • RBC distribution width: indicates range of RBC sites microcytosis • RBC morphology - Anisocytosis: variation in size (microcytosis and macrocytosis) - Poikilocytosis: variation in shape (target cells, sickle cells, etc.) - Inclusions
• Hb H • In a thalassemia (deletion of three a gene s), excess ~-globin chains precipitate, forming Hb H inclusions • These inclusions, also called H bodies, are visible only with supravital staining (cannot be seen on standard Wright -Giemsa staining) • Appear within red cells in a regular distribution , like dimples on a golf ball (golf ball cells) • May be present in fewer than 50% of erythrocytes • H bodies (and a-inclusion bodies, in ~-thalassemia) are not Heinz bodies; must be distinguished on supravital staining • Heinz bodies • Compo sed of precipitated Hb molecules, rather than globin chains • Can result from exposure of normal Hb to oxidant drugs or from the precipitation of unstable Hb • Heinz bodies are larger, less numerous, irregularly distributed, and exhibit more variation in size than do H bodies
649
24-14
Molecular Genetic Pathology
• More common to see both H bodies and Heinz bodies in patients who have had splenectomies • HbC • Tends to forms crystals
Hb Electrophoresis • Method of choice for traditional laboratories for qualitative and quantitative analysis
Isoelectric Focusing • Sensitive enough to separate Hb variants with isoelectric points that differ by as little as 0.02 pH • Performed on agarose gel and employed to reveal Hb fractions, variants, and globin chains (polyacrylamide gel can be used for greater resolution) • Combination with capillary electrophoresis has shown improved resolution and more accurate quantification
• Used to examine globin chain composition and globin synthesis ratio
High-Performance Liquid Chromatography (HPLC)
• RBC lysate analyzed • Cellulose acetate electrophoresis performed at pH 8.6
• Widely used for Hb quantification and to screen for Hb variants
• Citrate agar or agarose gel electrophoresis performed at pH 6.0-6.2
• Separates Hb based on charge (porous cation-exchange column)
• Urea-triton gel electrophoresis (allows the rapid analysis of small quantities of Hb)
• Has replaced Hb electrophoresis in primary screening for clinically significant Hbs and acts as an adjunct for the detection of Hb variants
• Hb separates into bands that migrate based on charge • Acidic and alkaline gels yield different sets of bands. If two bands migrate together both gels are needed • The quantity of each Hb is determined with a densitometer (a spectrophotometer that measures the intensity of the stain taken up by each Hb fraction ; the uptake is proportional to the Hb present) • Advantages: very simple and fully automated • Disadvantages: poor precision and accuracy of Hb quantitation by densitometer
• Types: - Microcolumn chromatography: sensitive method for Hb A z quantitation Cation-exchange HPLC: method of choice to quantify the Hb fractions Reverse-phase HPLC: used to quantitate y-chain levels; more sensitive and higher resolution than electrophoresis Disadvantages: the presence of a Hb variant could alter the quantification result
MOLECULAR TECHNIQUES
• Targets different levels of Hb expression at genomiclDNA, RNA, and protein levels • Advantages: assays are very specific and are widely used in clinical settings
Clinical Indications for Testing
Direct DNA Tests Southern Blot • Best method to determine if there is a deletion • Applies RFLP to demonstrate a mutant allele (Table 6)
• Patient's clinical history may be suspicious
• Genomic DNA digested and then separated by electrophoresis
• Abnormalities noted in complete blood count
• Separated DNA is then blotted on a membrane
• Screening programs: all newborns born in the United States are screened for variant Hbs
• DNA probes hybridize to the target DNA if they are complementary
Sample Requirements
• Advantage: ideal for screening for large deletions or rearrangements
• Whole blood in ethylenediamine tetra-acetic acid • Fetal DNA collected from the chorionic villi, amniotic fluid, or maternal circulation
650
• Disadvantage and limitations - The disease causing mutations could only be identified through the genomic DNA library of affected individuals
24-15
Molecular Hemoglobinopathies
Table 6. Hb Genotypes Profiles Identified by Restriction Endonuclease Digestion Mnll fragments Genotype
Lost one Mnll site
Cuts with Ddel
produced
Dde 1 fragments
AA
No
Yes
107,61,21 ,16
149,56
AS
A no; S yes
A yes; S no
107,77,61 ,21 , 16
205,149,56
AC
A no; C yes
A yes; C yes
107,77, 61, 21, 16
149,56
SS
Yes
No
107,77,21
205
SC
S yes; C yes
S no; C yes
107, 77, 21
205, 149,56
CC
Yes
Yes
107,77,21
149,56
Direct Sequence Analysis ofAmplified DNA • Best method for definitive identification of mutations • Sequencing is automated • There are well-established protocols for the globin chain variants • Disadvantage and limitations - DNA sequencing should always be coupled with a mutation screen method - Great caution should be exerci sed when working on the sequences with homologs, such as HBAl/HBA2 and HBG l/HBG2
Denaturing Gradient Gel Electrophoresis • Identification (screening) for unknown globin gene sequence mutations • Denaturing gradient gels are used to detect non-RFLP polymorphisms • The small genomic restriction fragments are run on a low-to-high denaturing gradient acrylamide gel • The fragments initially move according to molecular weight, but as they progress into higher denaturing conditions, each reaches a point where the DNA begins to "melt" • The "melting" is due to the breaking of the weakest intrastrand bonding • The structural changes in the DNA severely retards the progress of the molecule in the gel, and a change in mobility is observed • Minor differences in genetic sequence can cause significant mobility shifts • By comparing the melting behavior of the polymorphic DNA fragments side by side on denaturing gradient gels, it is possible to detect fragments that have mutations
Single-Stranded Conformation Polymorphism • Single- stranded conformation polymorphism is defined as conformational difference of single-stranded nucleotide
sequences of identical length as induced by differences in the sequences under certain experimental conditions • This property allows the ability to distinguish the sequences by means of gel electrophoresis, which separates the different conformations • Previously used as a tool to discover new DNA polymorphisms apart from DNA sequencing • Can detect homozygous individuals of different allelic states, as well as heterozygous individuals , which demonstrate distinct pattern s in electrophoresis • Disadvantages and limitations - Must be coupled with DNA sequencing to demonstrate the mutation
PeR-Based Test • PCR is used to amplify specific regions of DNA, a gene or gene fragment • DNA primers flank the region of interest at the 5' and 3' ends and are used to amplify the fragment • The amplified DNA fragment is then further proces sed for electrophoresis, restriction enzyme digestion, sequencing, or hybridiz ation • Advantage s - Can be adapted to any type of mutation - Needs very little DNA - Relatively less time consuming
Allele-Specific Priming or Amplification Refractory Mutation System • Amplification is achieved by employing a primer which perfectly matches the 3' terminal nucleotide • Target DNA amplified in two reactions - Common forward primer - Second primer is either complementary to the wildtype or the mutant
651
Molecular Genetic Pathology
24-16
- Can now be done in a single tube : tetra primer allelespecific priming or amplification refractory mutation system-PCR - Co-amplify an unrelated sequence to serve as an internal control
• Disadvantages and limitations: - The method is not suited for screening populations carrying a large number of different mutations, since each mutation requires a separate hybridization and washing step
• False-negatives avoided by using internal control • Advantage: can potentially detect any known mutation
Reverse Dot-Blot Analysis
RFLPAnalysis
• The reverse dot-blotting technique allows detection of mutations with a single hybridization reaction
• Used to detect mutations of the ~-globin gene, which is associated with Hbs Sand C (Figures 3A and 3B)
• DNA is bound to a nylon membrane strip with dots or slots
• The mutation region is amplified using PCR • The amplified product contains restriction endonuclease sites; the number of cutting sites is dependent on the presence or absence of the point mutation
• Labeled amplified genomic DNA is then hybridized to the filter
• After enzyme digestion (both Mnll and Dde1 are used) the PCR products are analyzed by gel electrophoresis (Figure 4) - Various Hb genotypes can be identified by characteristic restriction fragment lengths of DNA (Table 6)
• This procedure may require the use of several filters, the first will detect more frequent mutations observed in the patient's ethnic group and the others to less frequent abnormalities • There are thalassemia detection strips commercially available , which correspond to the most frequent mutations observed in the various regions of the world
Allele-Specific Oligonucleotide (ASO) Hybridization or Dot-Blot Analysis
Gap-PeR
• The dot-blotting method requires binding the PCR amplified target DNA sequence to a nylon membrane
• , Applications: HPFH , o~-thalassemia, and common a-thalassemia deletions/rearrangements
• The DNA fixed to the membrane is then hybridized to the ASO probes that are labeled either with 32P-labeled deoxynucleoside triphosphates, biotin, horseradish peroxidase, or a fluorescent marker at the 5' end
• Pair of primers is employed; they are complementary to the flanking regions of the wild-type DNA sequence
• For mutation screening, a panel of ASO probes must be adapted to the mutations found in the ethnic group of the individual, which is tested
• A third primer is complementary to the DNA sequence produced by a deletion (control) • Wild-type PCR product larger than mutant , differentiate by electrophoresis
• For genotyping homozygous patients and for prenatal diagnosis, two oligonucleotide probes are required for each mutation - One complementary to the mutant DNA sequence - The other complementary to the normal gene sequence at the same position
PeR-Fluorescence Resonance Energy Transfer Probes
• The patient's genotype is determined by the presence or absence of the hybridization signal of the mutationspecific and/or normal probe
• The genotype is determined by comparing the melting curve s against normal reference
• Method is based on the fluore scence-labeled probes that are specifically designed for each mutation • The probe yields a melting curve
Fig. 3. (Opposite page) The DNA fragments are the result of PCR amplification and digestion with the enzymes Mnll (panel A) and DdeI (panel B). In the lanes labeled AA (homozygous normal), Mnll produces four fragments or bands (107, 61, 21, and 16 bp), but the 16- and 21-bp fragments are too small to be visualized. DdeI (panel B) produces two bands (149 and 56 bp). In the lanes marked AS (sickle cell trait or heterozygous mutant), Mnll produces five bands (107, 77, 61, 21, and 16 bp). Ddel digestion leads to three bands (205, 149, and 56 bp). In a person homozygous for S (lane SS, homozygous mutant), Mnll. produces three fragments (107, 77, and 21 bp). Ddel does not cleave this DNA, since its site is lost (1 band, 205 bp). In SC disease (lane SC, double heterozygous), Mnll produces three bands (107, 77, and 21 bp), while DdeI also yields three (205, 149, and 56 bp, identical to AS). In Hb C disease (homozygous) Mnn yields three bands (107, 77, and 21) and DdeI produces two bands (149 and 56 bp).
652
24-17
Molecular Hemoglobinopathies
. .
..
A
Mnl1
Hb A (Normal)
1 107 bp
1
Mn11' Mnl1
l--:-l 16 bp
61 bp
..I
Mnl1 Hb Sand Hb C
I 107 bp
HbAA
21 bp
.1
1
Mnl1
77bp
21 bp
I
HbSS, HbCC, or Hb SC
Hb SA or HbCA
107 bp 77 bp 61 bp
21 bp 16 bp Mnl 1 digestion
.
B
Dde l'
Hb A and Hb C
Hb S
If-----------+-----I 56 bp 149 bp
I r - - - - - - - - - - - - - -.. . 205 bp
HbAA HbCC
Hb SA or HbSC
Homozygous HbSS
205 bp
149 bp
56 bp Dde 1 digestion
653
Molecular Genetic Pathology
24-18
Size Molecular AA (bp) marker Mnl 1 Ode 1
SS
AS Mnl1
Ode 1
Mnl1
SC
Ode 1
Mnl1
Ode 1
AC Mnl 1
Ode 1 No ONA
Fig. 4. Electrophoresis gel of PCR product after restriction enzyme digestion. The DNA fragments are the result of PCR amplification and digestion with the restriction endonucleases MnlI and DdeI. Lane 1 on the far left contains a DNA molecular marker whereas lane 12 to the far right is a no DNA control. In lanes 2 and 3, labeled AA, (normal genotype), MnlI produces four DNA fragments or bands, (107, 61, 21, and 16 bp). The 21- and 16-bp fragments are too small to be seen. Digestion with DdeI produces two bands (149 and 56 bp). In lanes 4 and 5 labeled AS, (sickle cell trait genotype), MnlI produces five bands (107, 77, 61, 21, and 16 bp). Digestion with DdeI produces three bands (205, 149, and 56 bp). In lanes 6 and 7 labeled SS (sickle cell anemia genotype) MnlI digestion produces three fragments (107, 77, and 21 bp). The cleavage site for DdeI is lost in the S allele, leaving one band 205-bp long. In lanes 8 and 9 labeled SC (SC disease genotype), MnlI produce s three bands (107, 77, and 21 bp) whereas digestion with DdeI yields 3 (205, 149, and 56 bp). Lanes 10 and 11 are labeled AC (Hb C trait genotype), digestion with MnlI yields five bands (107, 77, 61, 21, and 16 bp). Digestion with DdeI produce s two bands (149 and 56).
• Real-time PCR-fluorescence resonance energy transfer allows quick assigning of heterozygosity or homozygosity for the gene alleles • Amplified DNA does not need more manipulations
• Disadvantage and limitations - Expensive - Specific probes are required , therefore sequence must be known
SUGGESTED READING Alii NA. Acquired Hemoglobin H disease. Hematology 2005;I0:413-418. Chui DH, Hardison RC, Riemer C, et aI. An electronic database of human hemoglobin variantson the WorldWide Web. Blood 1998;91 :2643- 2644. Clark BE, Thein SL. Molecular diagnosis of haemoglobindisorders. Clin Lab Haematol. 2004;26:159-176. Gu X, Zeng Y. A review of the molecular diagnosis of thalassemia. Hematology 2002;7:203-209. Higgs DR, Garrick 0, Anguita E, et al. Understanding alpha-globin gene regulation: aiming to improve the managementof thalassemia. Ann N Y Acad Sci. 2005;1054:92-102. Pauling L, Itano HA, Singer SJ, Wells IC. Sickle cell anemia: a moleculardisease. Science 1949;II 0:543-548.
654
Papasavva T, Kalakoutis G, Kalikas I, et aI. Noninvasive prenatal diagnostic assay for the detection of beta-thalassemia. Ann NY Acad Sci. 2006;1075:148-153. Patrinos GP, Panagoula K, Papadakis MN. Molecular diagnosis of inherited disorders: lessons from hemoglobinopathies. Hum Mutat. 2005;26:399-412. Patrinos GP, Panagoula K, Papadakis MN. Moleculardiagnosis of inherited disorders: Lessons from Hemoglobinopathies. Hum Murat 2005;26(5):399-412. Paulin L, ltano HA, Singer SJ, et aI. Sickle cell anemia, a molecular disease. Science 1949;110:543-548. Sadelain M, Lisowski L, Samakoglu S, Rivella S, May C, Riviere I. Progress toward the genetic treatmentof the beta-thalassemias. Ann N Y Acad Sci. 2005;1054:78-91.
25 Molecular Diagnostics of Lymphoid Malignancies Francisco Vega,
MD, PhD
and Dan M. Jones,
MD, PhD
CONTENTS I. Overview of the Molecular Biology of Lymphocytes Differentiation and Maturation of B-cells Ig Gene Rearrangements in B-cells Differentiation and Maturation of T-cells TCR Gene Rearrangement in T-cells Natural Killer (NK) Cells
II. Practical Molecular Diagnostics of Lymphoid Malignancies General Principles How Lymphoma Specimens are Handled The Core Technologies Used in Lymphoma Diagnostics B-cell and T-cell Clonality by Southern Blot B-cell and T-cell Clonality by PCR
III. Clinical and Molecular Genetic Features of Specific Lymphoid Malignancies Immature B-cell and T-cell LeukemialLymphomas
Lymphoblastic LeukemialLymphoma (ALLILBL) Burkitt Lymphoma Mature B-cell Lymphomas Chronic Lymphocytic Leukemia (CLL)/ Small Lymphocytic Lymphoma (SLL) Mantle Cell Lymphoma (MCL) Follicular Lymphoma (FL) Marginal Zone Lymphoma (MZL) Diffuse Large B-Cell Lymphoma Plasma Cell Myeloma (PCM) Mature T-cell Lymphoma Anaplastic Large Cell Lymphoma (ALCL) Mycosi s Fungoides Enteropathy-Type Intestinal Lymphoma Mature T-cell Leukemias T-Cell Prolyrnphocytic Leukemia T-Cell Large Granular Lymphocytic Leukemia Adult T-Cell LeukemialLymphoma NK-cell Lymphoma Hodgkin Lymphoma (HL)
25-2 25-2 25-3 25-4 25-5 25-5
25-5 25-5 25-6 25-6 25-6 25-6
25-9 25-9
IV.
Suggested Reading
25-9 25-9 25-IO
25-11 25-11 25-13 25-13 25-17 25-18 25-18 25-18 25-18 25-19 25-19 25-19 25-19 25-19 25-19 25-19
25-20
655
25-2
Molecular Genetic Pathology
OVERVIEW OF THE MOLECULAR BIOLOGY OF LYMPHOCYTES
Differentiation and Maturation of B-cells • The stepwise differentiation and maturation of B-cells includes: - Commitment to the B-celliineage: Multi-step process that occurs in the bone marrow -
-
V(D)J immunoglobulin (Ig) gene rearrangement: DNA recombination event occurring in bone marrow that ultimately generates a unique antibody molecule in each precursor B-cells and its progeny Progressive phenotypic maturation: stepwise maturation of pro-B, pre-B, and mature, naive B-cells with different surface markers lost and gained at each stage (Figure 1) Antigen recognition: through surface Ig (aka B-cell receptor), and processed antigen presented on the surface of an antigen presenting cells (APC) in association with Class II major histocompatibility antigens (MHC)
Plasma cell C019 (var) C038 CD4S (var) CD138 Cyto-Ig
Memory B-cell C019 C020 CD22 brigh C027 C04Sbrighi
CentroblastlGC-cell
-
Antigen selection: triggered by antigen binding to the surface Ig • Antigen-stimulated B-cells move into the germinal center (GC) where a process of targeted mutagenesis (somatic hypermutation) introduces changes into the VH gene, particularly in complementaritydetermining regions (CDR)-1 and-2 • The mutated Ig are functionally tested for improved antigen binding in the GC, a process termed affinity
maturation • A subset of B-cells undergo shift from slgD and slgM expression to expression of secreted IgG, IgA , or IgE by a second DNA recombination event known as class switch - Terminal B-cell differentiation and antibody production: • B-cells leave the GC following termination of antigen selection and mature into long-lived antibody-producing plasma cells, which reside in the medullary areas of lymph node and the bone marrow
Naive B-cell
cos (neg) C0 10 C019 C020 BCL-6/lgV H Somatic hypermutation (VH & BCL6) Class switch surface IgM+/O+ to cytoplasmic/secreted IgGllgAllgE
cos (neg) C0 19 CD20 CD27 (neg) IgM/lgO
Mature B-cells
Fig 1. Normal B cell development. Progenitor B cells expresses intranuclear TdT and the B cell lineage-associated antigen CD22. At the pro- B cell stage, cells lose CD34 and express CD 10, CD20, and cytoplasmic (cyto) ~ heavy chains without light chains. The immature or naive pre-B cells acquire surface (s)-IgM. The mature B cell is a small lymphocyte that expresses CD 19, CD20, CD22, CD45, and sIgM. The terminally differentiated plasma cells lacks most B cell markers including CD20 and CD22 and express CD38 and CD138.
656
25-3
Molecular Diagnostics of Lymphoid Malignancies
IGH (14q32)
n ", 120 genes VH1 VH2 VH3 5'
o
VHn
CJ.I c s
DHl - 3
Cy3 Cy1 c « 1
Cy2 Cy4
C£ Cu2
0 0 1/0.//--n ", 30 genes
IGK (2p11-12)
n =25-50 genes
v.. 5'
0
V'"2
V330 Bases ITO mutant I'---_ -'--=..:::..::... = _ ++_ >330 = Bases
60
120
160 ,
240 ,
1 '
8000 6000
-...._~
ITO :::: ....
8000 0835 6000 4000
1
2000o
300
EcoRV digest
I Wild -type
80 Bases
1~
129 Bases
I 0835 mutan t
1~
150 Bases
I Undigest ed
!
360 ,
'-
420
480 ,
540 ,
~
-.L
_
I
+ L...-
_
Fig. 4. Mutational analysis of FLT3. Lower panel show capillary electrophoretic trace of PCR products with unmutated FLT3 and lTD (arrow, top) and the larger-sized PCR product with a D835 FLT3 point mutation (arrow, bottom) that prevents the complete cutting of the PCR product.
• PTD of MLL gene spanning exons 2-6 or exons 2-8, and are caused by homologous recombination between Alu elements within the involved introns • Can be detected by PCR/sequencing, RT-PCR/sequencing, or Southern blot • Since MLL PTD may occur in normal individuals at low levels, caution should be used when interpreting results of RT-PCR assays
- N-terminal mutations are usually nonsense mutations leading to expression of truncated CEBPA - C-terminal mutations are usually in-frame mutations (del, ins, dup) resulting in CEBPA mutants with decreased DNA-binding potential • CEBPA may also be dysregulated by post-transcriptional mechanisms in t(8;21) and inv(l6) AML
Nucleophosmin (NPMI) Mutations CEBPA (CCAAT/Enlumcer-Binding Protein) Mutations Seen in approximately 7% of AML, most commonly FAB M2, predict favorable prognosis in AML of intermediate risk/normal cytogenetics. • CEBPA is a DNA-binding protein that belongs to basic region leucine zipper (bZIP) family that is essential for granulocyte differentiation • Mutations at a large number of sites within the protein contribute to a differentiation block specific to AML (dominant-negative effect)
684
NPM is found to be mutated and mislocalized to the cytoplasm of AML cells in approximately 35% of patients. • NPM is normally a nucleolar protein that interacts with ARF and targets it to the nucleus (ARF-MDM2-p53 pathway) • Frame-shift mutations in exon 12 affect intracellular NPM trafficking - Immunohistochemistry to detect abnormally localized NPM may be an efficient tool to screen for NPMI mutations
Molecular Diagnostics of Myeloid Leukemias
26-11
Table 8. NewerTherapeutic Modalities in MDS and AML Class of drugs
Genes targeted
Examples
Angiogenesis inhibitors
VEGF VEGFR
Thalidomide, revlimid, bevacizumab SU5416, PTK787, As20 J
Anti-cytokine agents
TNFR TNF
Etanercept, infliximab
Famesyl transferase inhibitors
Ras pathway
Tipifamib, Lonafamib
Small moleculekinase inhibitors
FLT3, KIT
CEP701 , PKC412, MLN518, SUI 1248
Hypomethylating agents
p15/INK4b
Decitabine, 5-azacytidine
Histone deacetylase inhibitors
MLL, CEBPA, AMLI-ETO, CBFb-MYHII
Valproic acid, SAHA, MS275
Proteasomeinhibitors
NFKB
Bortezomib
Nuclearreceptor ligands
PML-RARA
ATRA
• NPM 1 mutations in AML cosegregate with normal karyotype, CD34 negativity, high frequency of FLT3lTD mutations, and good response to induction therapy in preliminary studies
EVIl Activation EVIl encodes a zinc-finger-containing transcription factor on chromosome 3q26 and is activated by fusion transcripts in approximately 8% of AML, MDS, or blast phase of chronic myeloid leukemia (CML). • Activation occurs through inv(3)(q21q26), t(3;3)(q21q26), and t(3;21)(q26;q22) • Leads to complex chimeric transcripts between AMLl at 21q22 and any combination of three genes at 3q26: EAP, MDS1, and EVIl • t(3;2l)(q26;q22) defines an aggressive syndrome of myeloid blast transformation usually following antimetabolite therapy
Methylation Profiling Many genes have CpG islands in their promoter region that can be methylated at the 5' position of cytosine, which silences expression of these genes. • For example, pI5/INK4b, a cyclin-dependent kinase inhibitor, is frequently methylated in MDS/AML • Methylation-based PCR or sequencing is done following exposure of tumor DNA to bisulfite, which converts unmethylated C to T, to determine the levels of methylation at each promoter CpG • Promoter methylation analysis may also be useful in monitoring response to demethylating agents such as decitabine (Dacogen) and azacytidine (Vidaza), which are becoming commonly used in AML and MDS
Newer Therapeutic Agents for AML and MDS Insights into the molecular pathogenesis of MDS and AML have led to the development of new classes of therapeutic agents (Table 8). To date, most of these therapies have had limited efficacy as single agents but are now being tested in combination as with the standard cytotoxic chemotherapy regimens. Classes of new agents include: • Angiogenesis inhibitors : dysregulation of angiogenesis by abnormal secretion of angiogenic cytokines and growth factors is essential for apoptosis of marrow progenitor cells - Small molecule inhibitors of angiogenic agents and receptors, such as vascular endothelial growth factor (VEGF) and its receptors have been developed - Thalidomide and the related FDA-approved revlimid are anti-VEGF agents that also have immunomodulatory and anti-tumor necrosis factor (TNF)-a effects - Bevacizumab is a recombinant anti-VEGF monoclonal antibody and also inhibits bone marrow production of TNF-a • Farnesyl transferase inhibitors : activating point mutations in the farnesylated proteins NRAS and KRAS are detected in 5-15% of AML and 50% ofCMML - Farnesylation of C-terminal consensus sequences by farnesyl transferase is the rate-limiting posttranslational modification of Ras proteins - Famesyl transferase inhibitors, including tipifarnib and lonafarnib, represent a novel class of potent inhibitors of Ras activation that are able to modulate multiple signaling pathways implicated in the pathogenesis of MDS andCMML • FLT3 inhibitors: FLT3 tandem duplications and activating point mutations cause constitutive activation of the
685
26-12
receptor tyrosine kinase and lead to signaling through the Ras, MAPK, and STAT5 pathways, contributing to the development of leukemias in mouse models - PKC412, CEP701, MLN518, and SUll248 are FLT3 inhibitors currently in clinical trials - Given the wide expression of FLT3, it remains unclear whether AML with FLT3 genetic alterations are the appropriate cases for treatment with these kinase inhibitors • DNA methyltransferase inhibitors: abnormalities of cytosine methylation constitute the most common epigenetic changes in AML and MDS and represent a potentially reversible method that lead to altered gene expression - DNA methylatransferase inhibitors decitabine and 5-azacytidine are both approved by Food and Drug Administration (FDA) for the treatment of AML/MDS • Histone deacetylase (HDAC) inhibitors and proteosome inhibitors: post-translational modification of histones by dynamic acetylation and deacetylation is mediated by histone acetyltransferase (a transcriptional coactivator) and HDACs (a transcriptional corepressor) - HDACs are associated with transcriptionally inactive chromatin (heterochromatin) - HDAC inhibitors (HDACi) modulate chromatin structure and gene expression by inducing histone hyperacetylation. They also induce growth arrest, cell differentiation, and apoptosis of tumor cells - Certain leukemia-associated fusion proteins, such as RUNXI2-RUNXITl and PML-RARA, specifically recruit nuclear corepression complexes including HDACs and silence groups of differentiation-related genes • HDACi may be utilized to specifically reverse the transcriptional repression induced by the fusion proteins • The proteosome inhibitor bortezomib has demonstrated to have preclinical synergistic activity with HDACi, as well as potential single-agent activity in MDS/AML
Chronic Myeloid Leukemia (CML) • Clinical features : a common leukemia that affects a wide age range, presents with marked leukocytosis, prominent basophilia, and splenomegaly - As currently defined, all cases of CML must have the BCR-ABL gene fusion, usually through the t(9;22)(q34;qll) chromosomal translocation known as the Philadelphia chromosome (Ph) - Cases of BCR-ABL-negativelPh-negative chronic myeloproliferative neoplasms are no longer classified asCML - Standard therapy for CML is continuous daily oral imatinib, a small molecule inhibitor, which is selective for the ABU, PDGFR, and KIT tyrosine kinases
686
Molecular Genetic Pathology
• Pathologic features: peripheral blood shows a range of myeloid elements including basophils - Bone marrow is markedly hypercellular Increased basophils (>20%) and blasts (> I0-19%) are features of accelerated phase. Blasts greater than 20% constitute blast phase • Immunologic features: routine phenotyping is not done in CML - In blast phase, tumor cells are usually immature myeloid (CD34+, CD13+) but can be lymphoid or biphenotypic in 10% of cases • Molecular features: detection of BCR-ABL gene fusion at time of diagnosis can be accomplished by cytogenetic analysis, dual fusion FISH, or RT-PCR for the BCR-ABL fusion transcript - Standard monitoring for therapy effectiveness in CML is BCR-ABL qRT-PCR every 3-6 months while on imatinib therapy. Effective therapy is associated with a 3-log reduction in BCR-ABL transcript levels from baseline values - Complete disappearance of the BCR-ABL transcript is unusual with imatinib therapy but is the goal following stem cell transplantation - Resistance to imatinib is due to emergence of CML clones with point mutations in the ABL I kinase domain, BCR-ABL gene amplification (extra Ph copies), and/or clonal evolution - Karyotypic analysis of bone marrow aspirate is typically done at the time of disease progression. Cytogenetic changes associated with clonal evolution besides extra Ph (der22q) include isochromosome 17q (TP53 gene deletion), trisomy 8, and trisomy 19 - Acquisition of AML-type translocations involving core-binding transcription factors (e.g., t[8;21] or inv[ 16]) is a feature associated with sudden blast crisis
The JAK2-mutated Group of Chronic Myeloproliferative Neoplasms • Clinical features : three chronic myeloproliferative neoplasms with overlapping clinical features, essential thrombocythemia (ET), polycythemia vera (PY), and agnogenic myeloid metaplasia/primary myelofibrosis (PMF) have been shown in the majority of cases to share a common molecular pathogenesis, namely JAK2 point mutation • Pathologic features : the features of each of these neoplasms are overlapping, and both PY and ET can progress to myelofibrosis - Primary myelofibrosis is characterized by a hypercellular marrow with thickened bony trabeculae, and marrow fibrosis with patent marrow sinuses containing abnormal megakaryocytes. In the spent phase, the marrow is hypocellular and the bony trabeculae markedly thickened
Molecular Diagnostics of Myeloid Leukemias
- All 3 tumors progre ss through an accelerated phase to a blast crisis, analogous to CML, with progres sion to AML most frequent in PMF • Molecular feature s: a single point mutation (GTC to TIC) in codon 617 of JAK2 changing Val to Phe is seen in 30-50% of ET, 40-60% of PMF, and 70-95% of PV, depending on the diagno stic criteria used - This mutation results in autoactivation of the JAK2 kinase and hypersensitivity to a group of JAKISTATlinked cytokine receptor s, including granulocyticmonocyte colony stimulating factor, erythropoietin and thrombopoietin - Three patterns of JAK2 mutation are seen: mutation of one JAK2 allele, mutation of both alleles or mutation at one allele and gene deletion at the other allele • Homozygous mutation of JAK2 is more common in PV and may contribute to higher hemoglobin levels and a more aggressive disease course - The molecular events mediating transformation of the PV, ET, and PMF lacking JAK2 mutation are not yet known - Although most cases are diploid by conventional karyotyping, del13q is the most commonly detected cytogenetic change seen in both JAK2-mutated and unmutated cases of PV, ET, and PMF
Mast Cell Disease (MCD) • Clinical features : a relatively common disorder with a cutaneous-type (urticaria pigmentosa) and systemic forms with both skin and bone marrow involvement - Mixed myeloproliferative-MCD tumors are common in systemic cases • Pathologic features : mast cells in MCD commonly have a spindled appearance and form marrow aggregates with prominent fibrosis. Such cases may be confused with lymphoma - Diffuse patterns of MCD marrow infiltration and a leukemic form also occur • Immunologic features : neoplastic mast cells can have a variety of immunophenotypic features, with bright
26-13
CD 117/KIT and C02 coexpre ssion commonly used to gate on mast cells for flow cytometric analysis - CD25 expression is seen in MCD tumor cells but not in normal mast cells • Molecular feature s: the majorit y of systemic MCD cases have an activation point mutation (D8 16V) in the KIT tyro sine kinase/CD 117, which is the receptor for stem cell factor - The frequent finding of low levels of mast cells in marrow require s a sensitive approach to mutation detection
Hypereosinophilic Syndrome (HES) • Clinical features: a heterogeneous disorder diagnosed when persistent elevated eosinophilia has no second ary etiology - Parasitic infection, Hodgkin lymphoma, and T-cell malignancies represent the most common secondary etiologies that need to be excluded Mixed MCD-HES cases and eosinophili c leukemia represent aggressive variants of HES • Pathologic feature s: diagno stic criteria for HES include persistent eosinophil ia greater than 1.5 x 109/L on two occasions at least 6 months apart, and evidence of end organ damage , including histologic evidence of tissue infiltration by eosinophil s • Immunologic features: immunophenoytyping is rarely used for characterization of eosinophil s, given their characteristic morphologi c appearance • Molecular features: a subset of HES show PDGFRA FIPJLJ gene fusion that results from an interstitial deletion of chromosome 4q 12 - Diagnosis of this fusion is by FISH for loss of the CHIC2 gene in the intervening deleted chromo somal segment, or by RT-PCR - Fusion produce s constitutive activation of the PDGFRA tyrosine kinase that can be effectively blocked with imatinib (Gleevec)
SUMMARY OF KEY POINTS IN THE MOLECULAR DIAGNOSIS OF MYELOID LEUKEMIAS • The current leukemia classification combines morphologic, immunophenotypic, and conventional cytogenetic data - Molecular diagnosis has a major role in MRD detection for those leukemias with defining fusion transcripts (e.g., CML, APL, and t(8;21) or inv(l6) AML) Gene expression profiling by DNA microarray technology or high-throughput mutational analyses and proteomic approaches represent alternative strategies for leukemia classification that may emerge in the future
• FISH is a robu st method for initial diagnosis of nearly all leukemias with characteristic chromosomal tran slocations since false-negative results can occur by PCR due to the heterogeneity of chromosomal breakpoints - Some common leukemia-associated cytogenetic abnormalities are relatively commonly missed by conventional karyotyping, including inv(16)(p13q22), t(l5 ;17)(q22 ;q21), and l1q23 abnormalities
687
Molecular Genetic Pathology
26-14
• Reliable and clinically validated methods of molecular MRD detection are not yet available for most MDS and AML patients Qualitative PCR may detect leukemia-associated translocations in normal individuals, including MLL rearrangements and t(12;21)
Qualitative PCR may also be too sensitive for other leukemia types, particularly t(8;21) to provide meaningful predictive value Quantitative PCR for Wilms tumor gene I (WTl) transcript levels shows promise as a general strategy for AML MRD testing in the future
SUGGESTED READING Brunning RD, Bennett JM, F1andrinG, et al, Myelodysplastic syndromes. In: JaffeES, Harris NL,Stein H, Vardiman JW. World Health Organization Classification of Tumors: Pathology and Genetics of Tumours of Haematopoietic and Lymphoid TIssues. Lyon, France: !ARCPress; 2001 :63-73. Brunning RD, Matutes E, Harris NL, et al, Acutemyeloid leukemia. In: Jaffe ES, Harris NL, Stein H, Vardiman Jw. World Health Organization Classification of Tumors: Pathology and Genetics of Tumours of Haematopoietic and LymphoidTIssues. Lyon, France: IARCPress; 2001 :75-107.
688
Frohling S, SchoU C, Gilliland DG, Levine RL. Genetics of myeloid malignancies: pathogenetic and clinical implications. J Clin Oncol. 2005;23:6285-6395. Hofmann WK, Koerner HP. Myelodysplastic syndrome. Ann Rev Med. 2005;56:1-16. Tallman MS, Gilliland DG, RoweJM. Drug therapy for acute myeloid leukemia. Blood 2005;106:1154-1163.
27 The HLA System and Transfusion Medicine Molecular Approach
s. Yoon Choo, MD CONTENTS I. The Human Leukocyte Antigen (HLA)
System
27-2
Genomic Organization of the Human MHC ..27-2 HLA Haplotypes 27-2 Expression of HLA 27-2 Structure and Polymorphism of HLA Genes and Molecules 27-2 Functional Implications of the HLA Polymorphism 27-3 Clinical HLA Testing 27-4 27-4 Serologic Typing of HLA Antigens 27-5 Molecular Typing of HLA Alleles HLAAntibody Screening and Lymphocyte Crossmatch 27-5 The HLA System and Transplantation 27-5 Solid Organ Transplantation 27-6 Allogeneic Hematopoietic Stem Cell Transplantation 27-6 Unrelated Donor Transplantation 27-6 The Human Minor Histocompatibility Antigens 27-7 The HLA System in Transfusion Medicine 27-7 Transfusion-AssociatedGraft-vs-Host Disease 27-7
HLA and DiseaseAssociation Hereditary Hemochromatosis Parentage HLA Testing HLA in Anthropologic Studies
27-8 27-8 27-8 27-8
II. Transfusion Medicine 27-8 Human Blood Group Systems 27-8 Terminology for the Blood Group Systems 27-9 Hemolytic Disease of the Newborn 27-9 Prenatal Determination of RhD-Type of Fetus 27-9 Human PlateletAntigen (HPA) System 27-9 Neonatal Alloimmune Thrombocytopenia (NAIT) 27-9 Human Neutrophil Antigen (HNA) System..27-10 Blood Donor Screeningfor Infectious Diseases 27-11 III. Post-Transplant Chimerism Study Quantification of Chimerism IV. Suggesting Reading
27·11
27-12
27-14
689
27-2
Molecular Genetic Pathology
THE HUMAN LEUKOCYTE ANTIGEN (HLA) SYSTEM • The genetic loci involved in the rejection of foreign organs are called the major histocompatibility complex (MHC), and highly polymorphic cell surface molecules are encoded by the MHC
molecule, and the DPAI and DPBl products form DP molecules • The non-classical class II gene, HLA-DO and HLA-DM, may playa role during antigen processing and presentation
• The human MHC is called the Human Leukocyte Antigen (HLA) system because these antigens were first identified and characterized using alloantibodies against leukocytes
The Class III Region
• The HLA system has been well known as transplantation antigens, but the primary biologic role of HLA molecules is in the regulation of immune response
• Does not encode HLA molecules , but contain s genes for complement components (C2, C4, and factor B), 2 l-hydroxylase, and tumor necrosis factors
Genomic Organization of the Human MHC
HLA Haplotypes
• The human MHC maps to the short arm of chromosome 6 (6p21) and spans approximately 3600 kb of DNA. The human MHC is divided into three regions. The class I region is located at the telomeric end of the complex, the class II region at the centromeric end, and the class III region in the center (Figure 1)
• HLA loci are closely linked and the entire MHC is inherited as an HLA haplotype in a Mendelian fashion from each parent. Recombination within the HLA system occurs with a frequency 65 % of cases
Parentage HLA Testing
HLA and Disease Association • Certain diseases , especially of autoimmune nature, are associated more frequently with particular HLA types. However, the association level varies among diseases and there is generall y a lack of a strong concordance between the HLA phenotype and the disease. Thus, definite diagnosi s or assessing risk for most disease cannot be made by HLA tying alone. The exact mechanisms underlying the HLA-di sease association are not well understood , and other genetic and environmental factors may play roles as well • The degree of association between a given HLA type and a disease is often described in terms of relative risk, which is a measure of how much more frequently a disease occurs in individuals with a specific HLA type when compared with individuals not having that HLA type • Among the most prominent associations are ankylosing spondylitis with HLA-B27, narcolepsy with HLADQBJ *0602/HLA-DRBJ*J50J, and celiac disease with HLA-DQBJ*02. The HLA-AI , B8, DR3 haplotype is frequently involved in autoimmune disorder s. Rheumatoid arthritis is associated with a particular sequence of the amino acid positions 66 to 75 in the DRB 1 chain that is common to the major subtype s of DR4 and DR\. Type 1 diabete s mellitus is associated with DR3, 4 heterozygotes, and the absence of asparagine
• In parentage testing , genetic markers of a child, biologic mother, and alleged father are compared to determine exclusion or non-exclu sion of the alleged father. An alleged father would be excluded if he does not share an HLA haplotype with the child . Conversely, a man who has one haplotype identical to the child 's would not be excluded and the probability of being a biologic father varies with the frequency of that particular haplot ype in the population • There are some advantage s of using HLA types in parentage testing. The HLA system is inherited in a Mendelian manner and is extensively polymorphic; its recombination rate is low; mutation has not been observed in family studies; and antigen frequencies are known for many different ethnic groups • However, the HLA system does not provide a high exclusion probability when the case involves a paternal HLA haplotype that is common in the particular ethnic group. Molecular techniques using non-HLA genetic systems are now widely used, and there is decrea sing use of HLA typing for paternity testing
HLA in Anthropologic Studies • HLA typing is an invaluable tool in the study of the evolutionary origin s and migration of human populations
TRANSFUSION MEDICI NE Human Blood Group Systems • A blood group system includes those antigens that are encoded by alleles at a single genetic locus or those produced by a complex of two or more very closely linked homologous genes with virtually no or extremely rare recombination (crossing over) occurring between them
696
(e.g., three of the systems, MNS, Rh, and ChidolRogers, comprise at least two loci each, so closely linked that recombination between them is extremely rare) • In some systems the gene codes directly for the blood group determinants (protein determinants), whereas in others, where the antigen is carbohydrate in nature, the
The HLA System and Transfusion Medicine
gene encodes a glycosyltranferase enzyme, which catalyzes biosynthesis of the carbohydrate determinants
27-9
• Fetal RhD genotyping by PCR amplification: RhD gene is absent in most RhD-negative chromosome Ip34-p36
• Some antigens are detected only on red cells (e.g., Rh), whereas others throughout the body (e.g., ABO)
- Amniocyte DNA typing from ammniocentesis as early as 10 weeks gestation
• The biologic function of most blood group antigens is mostly unknown
- Chorionic-villus biopsy samples in first trimester
• The polymorphism in blood group antigens can be detected by - Serologic method: blood group antigens are defined by antibodies, which occur either naturally or as a result of alloimmunization by human red cells by blood transfusion or pregnancy - Molecular detection: DNA analysis to detect alletic polymorphism • The clinical significance of the blood group system relates to the capacity of alloantibodies to cause destruction of transfused incompatible blood cells (hemolytic transfusion reaction), or to cross the placenta (IgO antibodies are capable of crossing the placenta) and destroy incompatible fetal red cells (hemolytic disease of the newborn [HDN])
Terminology for the Blood Group Systems • Defined by the International Society of Blood Transfusion (lSBT) Working Party on Terminology for Red Cell Surface Antigens • A numerical terminology for red cell surface antigens. By definition, these antigens must be defined serologically by the use of a specific antibody (Table 3)
Hemolytic Disease of the Newborn • Maternal IgO antibodies against red cell antigens from alloimmunization from transplacental fetomaternal hemorrhage or transfusions can cross placenta and coat the fetus red cells causing accelerated destruction (immune hemolysis) and resulting anemia • During any pregnancy a small amount of the fetus blood can enter the mother's circulation. Fetal red cells possessing paternal antigen foreign to mother can cause alloimmunization. Obstetrical events that increase the risk of transplacental hemorrhage include spontaneous abortion, therapeutic abortion, ectopic pregnancy, amniocentesis, intrauterine surgery, abdominal trauma, and hemorrhage in the peripartum • Antigens involved in HDN - D antigen of the Rh blood group system is best known, but many others are implicated: Rh blood group system (c, C, e, and E), Kell, Duffy, Kidd, and Ss systems
Prenatal Determination of RhD-Type of Fetus • Early and safe prenatal diagnosis of RhD status of fetus is advantageous for the management of pregnancies at risk of HDN due to RhD alloimmunization
• PCR-based amplification assays have been also developed to determine other Rh, K, Fy, and Jk genotypes
Human Platelet Antigen (HPA) System • The HPA system is expressed specifically on platelets. These platelet-specific antigen specificities are determined by platelet glycoproteins (Table 4) • HPA alloantibodies are responsible for the following clinical conditions: neonatal alloimmune thrombocytopenia, post-transfusion purpura, and refractoriness to platelet transfusions
Neonatal Alloimmune Thrombocytopenia (NAIT) • NAIT develops as a result of maternal alloimmunization during pregnancy against fetal platelet antigens inherited from the father and absent in the mother. Anti-platelet IgO antibodies cross the placenta and cause fetal and neonatal immune thrombocytopenia. The major risk of severe thrombocytopenia is intracranial hemorrhage, which leads to death or neurologic sequelae. About half of cases involve the first child . NAIT is considered to be the platelet counterpart of the HDN • Different HPA are implicated in NAIT of different races. The antigens most frequently implicated in NAIT are HPA-Ia (78%) and HPA-5a (19%) in Caucasians and HPA-4a (80%) and HPA-3a in Asians (15%) • Platelet-specific antigens are generally weak immunogens, and genetic factors may influence whether HPA-I a-negative women will develop antiHPA-I a antibody. Individuals with certain HLA haplotypes with HLA-DRB3 *OlOl allele are more likely to develop antibodies against HPA-I a antigen. The incidence is estimated approximately 1/1000 live births • Diagnosis is confirmed when a maternal anti-platelet alloantibody is demonstrated to be directed against a paternal antigen present in the fetus or newborn. Platelet typing of the newborn and parents are performed either by phenotyping or genotyping • Platelet antigen genotyping - peR using sequence-specific primers (PCR-SSP) is currently the most widely used technique for HPA genotyping - The risk of a subsequent pregnancy being affected is 100% if the father is homozygous for the implicated antigen, and 50% if heterozygous • Management of severe thrombocytopenia involves transfusion of antigen-negative platelets. Frequently
697
Molecular Genetic Pathology
27-10
Table 3. Blood Group Systems Number
System name
System symbol
Gene name(s)
Chromosomal location
001
ABO
ABO
ABO
9q34.2
002
MNS
MNS
GYPA, GYPB, GYPE
4q31.21
003
P
PI
Pi
22q11.2--qter
004
Rh
RH
RHD, RHCE
Ip36.11
005
Lutheran
LU
LU
19q13.32
006
Ken
KEL
KEL
7q34
007
Lewis
LE
FUTJ
19p13.3
008
Duffy
FY
DARC
Iq23.2
009
Kidd
JK
SLCi4Ai
18q12.3
010
Diego
Dl
SLC4Ai
17q21.31
Oil
Yt
YT
ACHE
7q22.1
012
Xg
XG
XG, MiC2
Xp22.33
013
Scianna
SC
ERMAP
Ip34.2
014
Dombrock
DO
ART4
12p12.3
015
Colton
CO
AQPi
7p14.3
016
Landsteiner-Wiener
LW
iCAM4
19p13.2
017
ChidolRodgers
CHIRG
C4A, C4B
6p21.3
018
H
H
FUTl
19q 13.33
019
Kx
XK
XK
Xp21.1
020
Gerbich
GE
GYPC
2q14.3
021
Cromer
CROM
CD55
Iq32.2
022
Knops
KN
CRi
Iq32.2
023
Indian
IN
CD44
IIpl3
024
Ok
OK
BSG
19p13.3
025
Raph
RAPH
CDi5i
Ilp15.5
026
John Milton Hagen
JMH
SEMA7A
15q24.1
027
I
I
GCNT2
6p24.2
028
Globoside
GLOB
B3GALTJ
3q26.1
029
Gil1
GIL
AQP3
9p13.3
washed (to remove antibodies ) maternal platelets are used for transfusion support
Human Neutrophil Antigen (HNA) System • The number of well-characterized neutrophil-specific antigen systems is limited (Table 5). The detection of neutrophil antigens and antibodies is less well established
698
• Clinical significance of HNA - Neutrophil al1oantibodies are known to cause neonatal alloimmune neutropenia, immune neutropenia after hematopoietic stem cell transplantation, refractoriness to granulocyte transfusion s, febrile non-hemolytic transfusion reactions, and transfusion-related acute lung injury
The HLA System and Transfusion Medicine
27-11
Table 4. HPA System System HPA-l
Antigen
Clycoproteins
HPA-la
GPIIla
Antigen frequency (%) 98
HPA-lb HPA-2
29
HPA-2a
GPIb
97
HPA-2b HPA-3
15
HPA-3a
GPIIb
88
HPA-3b HPA-4
54
HPA-4a
GPIIIa
>99
HPA-4b HPA-5