Handbook of Vertebrate Immunology

HANDBOOK OF VERTEBRATE IMMUNOLOGY This Page Intentionally Left Blank HANDBOOK OF VE RTE B RATE IMMUNOLOGY Edited by...

Author: Paul-Pierre Pastoret | Philip Griebel | HervÃ© Bazin | AndrÃ© Govaerts

190 downloads 1678 Views 60MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

HANDBOOK OF VERTEBRATE IMMUNOLOGY

This Page Intentionally Left Blank

HANDBOOK OF VE RTE B RATE IMMUNOLOGY Edited by Paul-Pierre Pastoret

Faculty of Veterinary Medicine, University of Liege, Belgium

Philip Griebel

Veterinary Infectious Disease Organization, Saskatoon, Canada

Herve Bazin

European Commission and Faculty of Medicine, University of Louvain, Belgium

Andr~ Govaerts

Faculty of Medicine, University of Brussels, Belgium

Academic Press

San Diego London Boston New York Sydney Toyko Toronto

This book is printed on acid-free paper Copyright 9 1998 by ACADEMIC PRESS All Rights Reserved No part of this publication may be reproduced or transmitted in any form or by any means electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher. Academic Press 525 B Street, Suite 1900, San Diego, California 92101-4495, USA http://www.apnet.com Academic Press Limited 24-28 Oval Road, London NW1 7DX, UK http://www.hbuk.co.uk/ap/ ISBN 0-12-546401-0 Library of Congress Cataloging-in-Publication Data Handbook of vertebrate immunology/edited by Paul Pierre Pastoret... [et al.]. p. cm. Includes index. ISBN 0-12-546401-0 (alk. paper) 1. Vertebrates--Immunology--Handbooks, manuals, etc. 2. Veterinary immunology--Handbooks, manuals, etc. I. Pastoret, Paul-Pierre. QR181.H277 1996 591.9'6196--dc21 97-45873 CIP A catalogue record for this book is available from the British Library

Typeset by Past0n Press Ltd, Loddon, Norfolk Printed in Great Britain by The Bath Press, Bath, 98

99

00

01

02

03

BP

9

8

7

6

5

4

3

2

1

CONTENTS List of Section Editors

List of Contributors

xiii

Preface

xix

INTRODUCTION P P Pastoret, P Griebel, H. Bazin, A. Govaerts

I

II

1.

2.

3. 4.

5. 6. 7. 8.

9. 10. 11. 12. 13. 14. 15. 16. 17. 18.

xi

IMMUNOLOGY OF FISHES C.McL. Press Introduction C. McL. Press, T . Jmgensen Lymphoid organs and their anatomical distribution

C. McL. Press Leukocytes and their markers N. W. Miller Leukocyte traffic and associated molecules A . E. Ellis Cytokines B. Robertsen T-cell receptor 1. Hordvik, J . Charlemagne Immunoglobulins L. Pilstrom Major histocompatibility complex ( M H C ) antigens 0. Lie, U . Grimholt Red blood cell antigens D . C. Morizot, T . J . McConnell Ontogeny of the immune system A. E. Ellis Passive transfer of immunity M . F . Tutner Nonspecific immunity G. A. lngram Complement system C. Koch Mucosal immunity J . H . W. M . Rombout, E. P . H . M . Joosten Acquired immunodeficiencies J . S. Lumsden Tumors of the immune system J . S. Lumsden Conclusions C. McL. Press, T . J ~ r g e n s e n References

111

1. 2. 3. 4.

1

3

63

(MHC)

67 68 69 70 70 70

9.

Immunobiology of T and B cells Ontogeny of the immune response Tumors of the immune system Conclusion References

1.

AVIAN IMMUNOLOGY J. M. Sharma Introduction

5. 6. 7. 8.

3

IMMUNOLOGY OF AMPHIBIANS J. Charlemagne, A. Tournefier Introduction Lymphoid organs and lymphocytes Lymphocyte antigen-specific receptors T h e major histocompatibility complex

63 63 65

3 IV

6

2. 11 3.

Lymphoid organs and their anatomical distribution 0. J . Fletcher, H . J . Barnes Leukocyte markers in the chicken S. H . M . Jeurissen, 0. Vainio,

73 81

M . J . H . Ratcliffe

15 4.

23

73

J . M . Sharma

9

13

73

5.

25 6.

26 30

7.

31

8.

T-cell receptors W. T . McCormack Cell surface and secreted immunoglobulins in B cell development S. L. Demaries, M . J , H . Ratcliffe Major histocompatibility complex (MHC) antigens K . Hala, J . Plachy, J . Kaufman Cytokines S. Rautenschlein, J . M . Sharma Complement

87

89

92 95 99

T . L. Koppenheffer 36 39

9. 10.

40

11. 41 12. 41

13. 43

Ontogeny of the immune system

101

T . P. Arstila, P. Toivanen Immunocompetence of the embryo and the newly-hatched chick P. S. Wakenell Mucosal gut immunity H. S. Lillehoj, S . B. Jakowlew Tumors of the immune system K . A. Schat Autoimmunity in avian model systems

M. H . Kaplan

104 105 108 111

vi

CONTENTS

14.

Effect of viruses on immune functions

4.

113

15.

Concluding remarks

113

J . M . Sharma 16.

References

Leukocyte traffic and associated molecules

230

S. Sharar, C. Ramamoorthy, J . Harlan, R . Winn

T . L. Pertile, J . M . Sharma 5.

Cytokines

233

R. G. Mage

117 6.

T-cell receptor (TCR)

233

A. Seto V

IMMUNOLOGY OF THE RAT F; G. M. Kroese Introduction

VI

1.

IMMUNOLOGY OF LAGOMORPHS R. G. Mage Introduction

223

223

R. G. Mage 2.

Lymphoid organs, their anatomical distribution and ontogeny of the immune system

223

P. D. Weinstein, A. 0.Anderson 3.

Rabbit leukocyte markers

K . L. Knight, D. Lanning

Immunoglobulins

235

R. G. Mage

137 F . G. M . Kroese 2. Lymphoid organs: their anatomical distribution 137 and cell composition P. Nieuwenhuis 3. Rat cluster of differentiation (CD) antigens 142 F. G. M . Kroese, N . A . Bos 142 4. Leukocyte traffic and associated molecules R. Pabst, J . Westermann 1.50 5 . Cytokines and their receptors P. van der Meide, M . N . Hylkema 150 6. T-cell development H. Groen 162 7. T h e T-cell receptor N . E. Torres-Nagel, T . Hermann, T . Hunig 168 8. B-cell development F . G. M. Kroese, G. J . Deenen 171 9. Rat immunoglobulins H . Bazin 173 10. Rat Ig variable region genes N . A . Bos, P. M . Dammers 177 11. B lymphoid tumors and immunocytomas H. Bazin 179 12. T h e major histocompatibility complex J . Rozing, H. Groen 183 13. Nonspecific immunity C. D. Dijkstra, T . K . uan den Berg 14. Components of the mucosal immune system 187 E. P. uan Rees 190 15. T h e complement system M . R . Daha, R. H. van den Berg 192 16. Models of immunodeficiency in the rat J . Rozing 17. Autoimmunity 194 D. L. Greiner, B. J . Whalen 198 18. References

1

7.

137

226

8.

M H C antigens

238

N . Sittisombut 9.

Rabbit blood groups

242

L. S. Rodkey, R . G. Tissot 10.

11.

Passive transfer of immunity R. G. Mage Nonspecific immunity

243 243

R. G. Mage 12. 13. 14.

Complement system M . Komatsu Mucosal immunity P. D. Weinstein, A. 0.Anderson Immunodeficiencies

243 245 248

15.

R. G. Mage, B. Hague Tumors of the immune system B. Hague

248

16.

Autoimmune diseases

248

B. Albini 17.

Conclusions

250

R . G. Mage 18. VII

1.

References

25 1

IMMUNOLOGY OF THE DOG I? J. Felsburg Introduction

261

P. Felsburg 2. Lymphoid organs and their anatomical distribution H. Hogenesch 3. Leukocytes and their antigens P. J . Felsburg 4. Leukocyte traffic and associated molecules P. J . Felsburg 5. Cytokines H. Hogenesch 6. T-cell receptor P. J . Felsburg 7. Immunoglobulins P. J . Felsburg 8. Major histocompatibility complex ( M H C ) antigens J . L. Wagner 9. Red blood cell antigens U . Giger 10. Ontogeny of the immune system G . S. Krakowka 11. Passive transfer of immunity P. J . Felsburg

261

26 1 263 264 267 268 268

268 270 27 1 27 1

vii

CONT-ENTS

12.

Neonatal immune responses

272

IX

P. J . Felsburg 13. 14. 15.

16. 17. 18. 19. 20.

Vlll

1.

2.

Nonspecific immunity P. J . Felsburg Complement system J . A. Winkelstein, R . Ameratunga Mucosal immunity H . Hogenesch Immunodeficiencies P. J . Felsburg Tumors of the immune system J . F . Modiano, S. C . Helfand Autoimmunity P. J . Felsburg Conclusions P. J . Felsburg References

IMMUNOLOGY OF THE CAT H. Lutz Introduction H . Lutz Lymphoid organs and their anatomical position

S. W . Huttner Leukocyte differentiation antigens B. J . Willett Cytokines H. Lutz, C . Leutenegger T h e major histocompatibility complex B. J . Willett Red blood cell antigens U . Giger 7. Immunoglobulins M . Suter 8. Passive transfer of maternal immunity R. Pu, J . K . Yamamoto 9. Neonatal immune responses J . K . Levy, M . B. Tompkins 10. Nonspecific immunity in the cat J . W . Ritchey, W . A. F . Tompkins 11. T h e complement system C. K . Grant 12. Ontogeny of the immune system C. R. Stokes, D . A. Harbour 13. Mucosal immunity C . R. Stokes, D . A. Harbour 14. Immunological diseases N . C. Pedersen 15. Immunodeficiency diseases N . C . Pedersen 16. Tumors of the immune system M . Reinacher 17. Conclusions H . Lutz 18. References

273

1. 2. 3. 4. 5. 6. 7. 8. 9.

274 275 277 278 278 282

1. 2. 3. 4. 5.

282

290

6. 7. 8. 9. 10. 11.

290 294

12.

297 301

XI

303

1.

304

2.

305 308 309 311 313 313 315 321 325 327 327

IMMUNOLOGY OF MUSTELIDAE H. Tabel Introduction Badger Ferret River otter Sea otter Skunk Mink Conclusions References

IMMUNOLOGY OF HORSES AND DONKEYS D. I? Lunn, D. Hannant, D. W Horohov Introduction Leukocytes and their antigens Immunoglobulins Cytokines Major histocompatibility complex (MHC) antigens Innate immunity Development of equine immunity Disorders of the immune system Tumors of the immune system Reproductive immunology Conclusions References IMMUNOLOGY OF THE PIG M. D. Pescovitz Introduction M . D . Pescovitz Lymphoid organs and their anatomical distribution

R. Pabst, H. J . Rothkotter 3. Leukocytes and their markers M . D . Pescovitz 4. Leukocyte traffic and associated molecules R . Pabst, H . J . Rothkotter 5 . Cytokines and interferons M . P. Murtaugh, D. L. Foss 6. T-cell receptor M . D. Pescovitz 7. Immunoglobulins J . E . Butler 8. Major histocompatibility complex ( M H C ) antigens J . Lunney 9. Red blood cell antigens P. Vogeli, D. Llanes 10. Ontogeny of the immune system 1. Trebichavsky, H. Tlaskalova-Hogenova, B. Cukroswska, J . Sinkora 11. Passive transfer of immunity C. Stokes, M . Bailey

337 337 337 337 337 338 338 338 340 340

343 343 343 347 350 353 354 355 356 359 359 361 361

373 373

373 374 377 379 383 3 84

387 389 394

395

CONTENTS

viii

~

12.

Neonatal immune responses

9.

397

I. Trebichavsky, H . Tlaskalova-Hogenova 13.

Nonspecific immunity

398

10.

400

11.

Complement system Mucosal immunity

Nonspecific immunity

466

Complement system

469

H . Tabel

K . H ~ g d s e nB. , P. Morgan 15.

464

J . Roth, D. Desmecht

M . Bailey, C. R . Stokes 14.

Passive transfer of immunity

A. Husband

402

12.

References

47 1

M . Bailey, C. R . Stokes 16.

Immunodeficiencies

405

M . D. Pescovitz 17.

Tumors of the immune system

405

XIV


Autoimmunity

406

1.


Conclusions

406

2.

M . D. Pescovitz 20. XI1

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. Xlll

1.

References

407

IMMUNOLOGY OF CAMELS AND LLAMAS R. Hamers, S.Muyldermans Introduction Lymphoid organs and their anatomical distribution Leukocytes and their markers Immunoglobulins Phylogeny of the camelid immune system Ontogeny of the immune system Passive transfer of immunity Blood groups Nonspecific immunity Complement system Immunodeficiencies Tumors of the immune system Conclusions Acknowledgements References

421

IMMUNOLOGY OF CATTLE B. Goddeeris Introduction

439

42 1 422 422 423 429 430 430 432 432 432 432 434 434 43s 435

3. 4. 5.

6. 7. 8.

9. 10.

11.

12. 439

B. Goddeeris 2.

Lymphoid organs

439

13.

444

14.

447

15.

454

16.

456

17.

D. McKeever, N . MacHugh, B. Goddeeris 3.

T h e leukocytes and their markers

C . Howard, P. S o p p 4.

Cytokines

B. Mertens 5.

T h e T-cell receptor

N . Ishiguro 6.

Immunoglobulins

J . Naessens 7.

Major histocompatibility complex ( M H C ) antigens

18. 459

H . Lewin 8.

Red blood cell antigens

E . Tucker

462

19. 20.

SHEEP IMMUNOLOGY AND GOAT PECULIARITIES P J. Griebel Introduction

P. J . Griebel Lymphoid organs and their anatomical distribution T . Landsverk Leukocytes and their markers P. J . Griebel Leukocyte migration A. J . Young Sheep cytokines A . D. Nash, R . J , Hawken, A. E . Andrews, J , F . Maddox, H . M . Martin T-cell receptors W . R . Hein, E . Peterhans Immunoglobulins W . R. Hein Ovine major histocompatibility complex antigens (Ovar) J . F. M a d d o x Sheep red blood cell antigens T . C . Nguyen Ontogeny of the immune system W . R. Hein Transmission of passive immunity in the sheep D. Watson T h e neonatal immune system W . G . Kimpton, C . Cunningham, R . N.P. Cahill Innate immune mechnisms in the sheep D. Haig, E . Peterhans Complement P. J . Griebel Mucosal immunity S. McClure Immunodeficiencies B. Blacklaws Tumors of the immune system A. van den Broeke Experimental investigation of autoimmunity in the sheep P. P. McCullagh Conclusions References

485

485

485 489 493 496

so0 503

505 509 510

513 515

518 522 523 528 530

53 1 533 533

CONTENTS

xv 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.

ix

IMMUNOLOGY OF THE BUFFALO S. D. Carter

555

Introduction Lymphoid organs Leukocytes and their markers Leukocyte traffic Cytokines T-cell receptor Major histocompatibility complex ( M H C ) antigens Immunoglobulins Passive transfer of immunity Neonatal immmunity Nonspecific immunity Complement Immunomodulation Tumors of the immune system References

555 555 556 557 557 558 558 558 559 560 560 560 560 561 561

2. 3. 4. 5. 6.

7. 8.

XVlll

1. 2. 3.

XVI

I. 2.

3. 4. 5. 6. XVll

THE MOUSE MODEL M. P Defresne

563

Introduction M. P. Defresne T h e lymphoid organs E . Heinen, M. P. Defresne Immunoglobulins M . Brait, J . Urbain Cellular immunology M. P. Defresne Murine models of immunodeficiency M. P. Moutschen References

563

THE SCID MOUSE MUTANT: DEFINITION AND POTENTIAL USE AS A MODEL FOR IMMUNE DISORDERS J. Y Cesbron, I/: Leblond, N. Delhem

1.

Introduction

4. 5. 6. 7.

563 570 586 589

8. 9. 10. XIX

T h e SCID mouse T h e SCID model of human immune responses T h e SCID ‘leaky’ phenotype and new immune deficient murine strain SCID model of normal and neoplastic human haematopoiesis Use of the SCID model without reconstitution Acknowledgements References

603 604 607 608 610 611 61 1

XENOTRANSPLANTATION I? Gianello, M. Soares, D. Latinne, H. Bazin

619

Introduction Hyperacute and delayed discordant xenograft rejection Human circulating xenoreactive natural antibodies T h e xenoantigens Complement activation Endothelial cell activation Tolerance and endothelial cell accommodation Therapeutic approaches: future trends Conclusions References

619

626 626 629 629

CONCLUSIONS

635

GLOSSARY

637

INDEX

661

620 620 623 623 624

594

603

603

A four page colour plate section appears between pages 428 and 429


LIST OF SECTION EDITORS Herv~ Bazin European Commission and Experimental Immunology, Faculty of Medicine, University of Louvain, Belgium

Dominique Latinne Transplantation Immunology, Faculty of Medicine, University of Louvain, Belgium

Stuart D. Carter Department of Veterinary Pathology, University of Liverpool, United Kingdom

V&onique Leblond Department of Haematology, H6pital Piti&Salp&ri&e, CNRS, Paris, France

Jean-Yves Cesbron Institut Pasteur, Faculty of Medicine, Lille, France Jacques Charlemagne Groupe d'Immunologie Compar&, Universit~ Pierre et Marie Curie, Paris, France Marie-Paule Defresne Laboratory of Pathology, Faculty of Medicine, University of Li&ge, Belgium Nadirah Delhem Institut Pasteur, Lille, France Peter J. Felsburg Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA Pierre Gianello Experimental Surgery, Faculty of Medicine, University of Louvain, Belgium Bruno Goddeeris Laboratory of Animal Physiology and Immunology, Catholic University of Leuven, Belgium Andr~ Govaerts Immunology-Immunopathology, Faculty of Medicine, University of Brussels, Belgium Philip J. Griebel Veterinary Infectious Disease Organization, Saskatoon, Canada Raymond Hamers Institute of Molecular Biology, University of Brussels, Belgium

Hans Lutz Department of Internal Veterinary Medicine, University of Z~irich, Switzerland Rose G. Mage Laboratory Immunology, Molecular Immunogenetics Section, NIH, Bethesda, MD, USA Serge Muyldermans Institute of Molecular Biology, University of Brussels, Belgium Paul-Pierre Pastoret Department of Immunology-Vaccinology, Faculty of Veterinary Medicine, University of Li&ge, Belgium Mark D. Pescovitz Departments of Surgery and Microbiology/Immunology, Indiana University, Indianapolis, IN, USA Charles McL. Press Department of Morphology, Genetics and Aquatic Biology, Norwegian College of Veterinary Medicine, Oslo, Norway Jagdev M. Sharma Department of Veterinary PathoBiology, College of Veterinary Medicine, University of Minnesota, St Paul, MN, USA Miguel Soares Experimental Immunology, Faculty of Medicine, University of Louvain, Belgium

Duncan Hannant Animal Health Trust,.Newmarket, United Kingdom

Henry Tabel Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, Canada

Frans G. M. Kroese Department of Histology and Cell Biology, Immunology Section, University of Groningen, The Netherlands

A. Tournefier Laboratoire d'Immunologie Compar&, Universit~ de Bourgogne, Dijon, France


LIST OF CONTRIBUTORS B. Albini Department of Microbiology, State University of New York, Buffalo, NY, USA

M. Brait Laboratory of Animal Physiology, Faculty of Sciences, University of Brussels, Belgium

B. Adler Institute of Veterinary Virology, University of Berne, Switzerland

J. E. Butler

H. Adler Institute of Veterinary Virology, University of Berne, Switzerland

R. N. P. Cahill Laboratory for Foetal and Neonatal Immunology, School of Veterinary Science, The University of Melbourne, Cnr. Park Dr, Parkville, Victoria, Australia

R. Ameratunga Department of Pediatrics, School of Medicine, Johns Hopkins University, Baltimore, MD, USA A. O. Anderson US AMRIID, Frederick, MD, USA A. E. Andrews Centre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Parkville, Australia T. P. Arstila Department of Medical Microbiology, Turku University, Finland M. Bailey Division of Molecular and Cellular Biology, University of Bristol, United Kingdom H. J. Barnes

College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA

Department of Microbiology, University of Iowa, Iowa City, IA, USA

S. D. Carter Department of Veterinary Pathology, University of Liverpool, United Kingdom J.-Y. Cesbron Institut Pasteur, Faculty of Medicine, Lille, France J. Charlemagne Groupe d'Immunologie Compar&, Universit~ Pierre et Marie Curie, Paris, France B. Charley Institut National de la Recherche Agronomique, Virologie et Immunologie Mol&ulaires, Centre de Recherches de Jouy-en-Josas, France C. Cunningham Laboratory for Foetal and Neonatal Immunology, School of Veterinary Science, The University of Melbourne, Flemington Road, Parkville, Victoria, Australia

European Commission and Experimental Immunology, Faculty of Medicine, University of Louvain, Belgium

B. Cukrowska Division of Immunology and Gnotobiology, Institute of Microbiology, Czech Academy of Sciences, Praha, Czech Republic

G. Bertoni Institute of Veterinary Virology, University of Berne, Switzerland

M. R. Daha Department of Renal Diseases, University of Leiden, The Netherlands

B. Blacklaws Department of Clinical Veterinary Medicine, University of Cambridge, United Kingdom

P. M. Dammers Department of Histology and Cell Biology, University of Groningen, The Netherlands

N. A. Bos Department of Histology and Cell Biology, University of Groningen, The Netherlands

G. J. Deenen Department of Histology and Cell Biology, University of Groningen, The Netherlands

H. Bazin

xiv

LIST OF CONTRIBUTORS

M. P. Defresne Laboratory of Pathology, Faculty of Medicine, University of Li+ge, Belgium

D. L. Greiner Department of Medicine, University of Massachusetts, Worcester, MA, USA

N. Delhem Institut Pasteur, Lille, France

P. J. Griebel Veterinary Infectious Disease Organization, Saskatoon, Canada

S. L. Demaries Department of Microbiology and Immunology, McGill University, Montreal, Canada D. Desmecht Department of Pathology, Faculty of Veterinary Medicine, University of Liege, Belgium C. D. Dijkstra Department of Cell Biology and Immunology, Free University, Amsterdam, The Netherlands A. E. Ellis DAF Marine Laboratory, Aberdeen, United Kingdom R. Fatzer Institute of Animal Neurology, University of Berne, Switzerland P. J. Felsburg Department of Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA O. J. Fletcher College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA A. Fluri Institute for Animal Breeding, University of Berne, Switzerland D. L. Foss Department of Veterinary Pathobiology, University of Minnesota, St Paul, MN, USA P. Gianello Experimental Surgery, Faculty of Medicine, University of Louvain, Belgium U. Giger The School of Veterinary Medicine, University of Pennsylvania, Philadelphia, PA, USA B. Goddeeris Laboratory of Animal Physiology and Immunology, Catholic University of Leuven, Belgium

U. Grimholt Department of Morphology, Genetics and Aquatic Biology, Norwegian College of Veterinary Medicine, Oslo, Norway H. Groen Department of Histology and Cell Biology, University of Groningen, The Netherlands B. Hague Laboratory of Immunogenetics, NIAID, Rockville, MD, USA D. Haig Moredun Research Institute, Edinburgh, United Kingdom

K. Hala Institute for General and Experimental Pathology, University of Innsbruck Medical School, Innsbruck, Austria R. Hamers Institute of Molecular Biology, University of Brussels, Belgium R. J. Hanken Centre for Animal Biotechnology, School of Veterinary Science, The University of Melbourne, Parkville, Australia D. Hannant Animal Health Trust, Newmarket, United Kingdom D. A. Harbour Division of Molecular and Cellular Biology, University of Bristol, Bristol, United Kingdom J. Harlan Harborview Medical Center, Anesthesiology, Seattle, WA, USA R. J. Hawken Centre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Australia W. R. Hein Basel Institute for Immunology, Basel, Switzerland E. Heinen Faculty of Medicine, University of Liege, Belgium

A. Govaerts Immunology-Immunopathology, Faculty of Medicine, University of Brussels, Belgium

S. C. Helfand Department of Medical Sciences, School of Veterinary Medicine, University of Wisconsin, Madison, WI, USA

C. K. Grant Custom Monoclonals International, Sacramento, CA, USA

T. Hermann Institute of Virology and Immunobiology, University of W/irzburg, Germany

LIST OF C O N T R I B U T O R S

xv

K. Hogfisen Institute of Immunology and Rheumatology, University of Oslo, Norway

T. W. Jungi Institute of Biochemistry and Medical Chemistry, University of Innsbruck, Austria

H. Hogenesch Department of Veterinary Pathobiology, School of Veterinary Medicine, Purdue University, West Lafayette, GA, USA

M. H. Kaplan The Walther Oncology Center, Indiana University School of Medicine, Indianapolis, IN, USA

I. Hordvik Department of Fish and Marine Biology, High Technology Centre, Bergen University, Norway D. W. Horohov Department of Veterinary Microbiology and Parasitology, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA, USA C. Howard AFRC Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom T. H/.inig Institute of Virology and Immunobiology, University of W/irzburg, Germany A. Husband Department of Veterinary Pathology, The University of Sydney, Australia

J. Kaufman AFRC Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom W. G. Kimpton Centre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Australia K. L. Knight Department of Microbiology, Loyola University Medical Center, Maywood, IL, USA C. Koch Statens Seruminstitut, Copenhagen, Denmark M. Komatsu Department of Animal Breeding and Genetics, National Institute of Animal Industry, Ibaraki, Japan T. L. Koppenheffer Department of Biology, Trinity University, San Antonio, TX, USA

S. W. H~ittner Department of Internal Veterinary Medicine, University of Z~irich, Switzerland

G. S. Krakowka Department of Veterinary Biosciences, College of Veterinary Medicine, The Ohio State University, Columbus, OH, USA

M. N. Hylkema Department of Histology and Cell Biology, University of Groningen, The Netherlands

F. G. M. Kroese Department of Histology and Cell Biology, Immunology Section, University of Groningen, The Netherlands

G. A. Ingram Department of Biological Sciences, University of Salford, Salford, United Kingdom

T. Landsverk Department of Pathology, Norwegian College of Veterinary Medicine, Oslo, Norway

N. Ishiguro Department of Veterinary Public Health, Obihiro University of Agriculture and Veterinary Medicine, Japan

D. Lanning Department of Microbiology, Loyola University Medical Center, Maywood, CA, USA

S. B. Jakowlew Immunology and Disease Resistance Laboratory, US Department of Agriculture, Beltsville, MD, USA S. H. M. Jeurissen Department of Immunology, ID-DLO, Lelystad, The Netherlands E. Joosten Wageningen Agricultural University, Wageningen, The Netherlands T. J;3rgensen Norwegian Fisheries College, Tromso University, Tromso, Norway

D. Latinne Transplantation Immunology, Faculty of Medicine, University of Louvain, Belgium V. Leblond Department of Haematology, H6pital Piti6-Salp&ri&e, CNRS, Paris, France C. Leutenegger Department of Internal Veterinary Medicine, University of Z/irich, Switzerland J. K. Levy Department of Microbiology, Pathology and Parasitology, College of Veterinary Medicine, North Carolina State University, NC, USA

xvi

H. Lewin Department of Animal Sciences, University of Illinois, IL, USA O. Lie Department of Morphology, Genetics and Aquatic Biology, Norwegian College of Veterinary Medicine, Oslo, Norway H. S. Lillehoj US Department of Agriculture, Protozoan Disease Laboratory, Poultry Science Institute, Beltsville, MD, USA D. Llanes Departmento de Genetica, Universidad de Cordoba, Spain J. S. Lumsden Department of Veterinary Pathology and Public Health, Faculty of Veterinary Science, Massey University, Palmerston North, New Zealand D. P. Lunn School of Veterinary Medicine, University of Wisconsin, Madison, WI, USA


D. McKeever ILRI, Nairobi, Kenya B. Mertens ILRI, Nairobi, Kenya N. W. Miller Department of Microbiology, University of Mississippi, Jackson, MS, USA J. F. Modiano Department of Veterinary Pathobiology, College of Veterinary Medicine, Texas A and M University, College Station, TX, USA B. P. Morgan Department of Medical Biochemistry, University of Wales College of Medicine, Cardiff, United Kingdom D. C. Morizot M. D. Anderson Cancer Center, University of Texas, Smithville, TX, USA M. P. Moutschen Faculty of Medicine, University of Lii~ge, Belgium

J. Lunney US Department of Agriculture, Immunology and Disease Resistance, Beltsville, MD, USA

M. P. Murtaugh Department of Veterinary Pathobiology, University of Minnesota, St Paul, MN, USA

H. Lutz Department of Internal Veterinary Medicine, University of Z~irich, Switzerland

S. Muyldermans Institute of Molecular Biology, University of Brussels, Belgium

N. MacHugh ILRI, Nairobi, Kenya

J. Naessens ILRI, Nairobi, Kenya

J. F. Maddox Centre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Australia

A. D. N ash Centre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Australia

R. G. Mage Laboratory Immunology, Molecular Immunogenetics Section, NIH, Bethesda, MD, USA

T. C. Nguyen Laboratoire de G~n&ique Biochimique, INRA, Jouy-enJosas, France

H. M. Martin Centre for Animal Biotechnology, School of Veterinary Science, The University of Melbourne, Parkville, Australia

P. Nieuwenhuis Department of Histology and Cell Biology, University of Groningen, The Netherlands

S. McClure CSIRO, McMaster Laboratory, Blacktown, Australia

G. Obexer-Ruff Institute for Animal Breeding, University of Berne, Switzerland

T. J. McConnell Department of Biology, East Carolina University, Greenville, NC, USA

R. Pabst Center of Anatomy, Medical School of Hannover, Germany

W. T. McCormack Department of Pathology, Immunology and Laboratory Medicine, Center for Mammalian Genetics, University of Florida College of Medicine, Gainesville, FL, USA

P. P. Pastoret Department of Immunology-Vaccinology, Faculty of Veterinary Medicine, University of Li+ge, Belgium

P. P. McCullagh Development Physiology Group, Australian National University, Canberra City, Australia

N. C. Pedersen Department of Medicine and Epidemiology, School of Veterinary Medicine, University of California, CA, USA


xvii

T. L. Pertile Department of Veterinary Pathobiology, University of Minnesota, College of Veterinary Medicine, St Paul, MN, USA

j. Roth Department of Microbiology, Immunology and Preventive Medicine, College of Veterinary Medicine, Iowa State University, IA, USA

M. D. Pescovitz Departments of Surgery and Microbiology/Immunology, Indiana University, Indianapolis, IN, USA

H. J. Rothk6tter Center of Anatomy, Medical School of Hannover, Germany

E. Peterhans Institute of Veterinary Virology, University of Berne, Switzerland

J. Rozing Department of Histology and Cell Biology, University of Groningen, The Netherlands

L. Pilst6m Department of Medical Immunology and Microbiology, Uppsala University, Uppsala, Sweden

K. A. Schat Department of Avian and Aquatic Animal Medicine, College of Veterinary Medicine, Cornell University, Ithaca, NY, USA

J. Plachy Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Praha, Czech Republic C. McL. Press Department of Morphology, Genetics and Aquatic Biology, Norwegian College of Veterinary Medicine, Oslo, Norway R. Pu Department of Pathobiology, College of Veterinary Medicine, University of Florida, FL, USA

C. Ramamoorthy Harborview Medical Center, Anesthesiology, Seattle, WA, USA M. J. H. Ratcliffe Department of Microbiology and Immunology, McGill University, Montreal, Quebec, Canada S. Rautenschlein Department of Veterinary PathoBiology, University of Minnesota, College of Veterinary Medicine, St Paul, MN, USA M. Reinacher Institute for Veterinary Pathology, University of Leipzig, Germany J. W. Ritchey Department of Microbiology, Pathology and Parasitology, College of Veterinary Medicine, North Carolina State University, NC, USA

A. Seto Department of Microbiology, Shiga University of Medical Science, Japan S. Sharar Department of Anesthesiology, Harborview Medical Center, Seattle, WA, USA J. M. Sharma Department of Veterinary PathoBiology, College of Veterinary Medicine, University of Minnesota, St Paul, MN, USA J. Sinkora Division of Immunology and Gnotobiology, Institute of Microbiology, Czech Academy of Sciences, Praha, Czech Republic N. Sittisombut Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai, Thailand M. Soares Experimental Immunology, Faculty of Medicine, University of Louvain, Belgium P. Sopp AFRC Institute for Animal Health, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom C. R. Stokes Division of Molecular and Cellular Biology, University of Bristol, United Kingdom

B. Robertsen Norwegian Fisheries College, Tromso University, Tromso, Norway

M. Suter Institute for Veterinary Virology, University of Z~irich, Switzerland

L. S. Rodkey Department of Pathology, University of Texas Medicine School, Houston, TX, USA

H. Tabel Department of Veterinary Microbiology, University of Saskatchewan, Saskatoon, Canada

J. H. W. M. Rombout Wageningen Agricultural University, Wageningen, The Netherlands

M. F. Tatner Division of Infection and Immunity, IBLS, University of Glasgow, Glasgow, United Kingdom

xviii

R. G. Tissot Department of Pathology, Monroe, WI, USA


M. Vandevelde Institute of Animal Neurology, University of Berne, Switzerland

H. Tlaskalovfi-Hogenovfi Division of Immunology and Gnotobiology, Institute of Microbiology, Czech Academy of Sciences, Praha, Czech Republic

E. P. van Rees Department of Cell Biology and Immunology, Free University, Amsterdam, The Netherlands

P. Toivanen Department of Medical Microbiology, Turku University, Finland

P. V6geli Department of Animal Science, Swiss Federal Institute of Technology, Ztirich, Switzerland

M. B. Tompkins Department of Microbiology, Pathology and Parasitology, College of Veterinary Medicine, North Carolina State University, NC, USA

J. L. Wagner Fred Hutchinson Cancer Research Center, University of Washington School of Medicine, Seattle, WA, USA

E. Tucker Lucy Cavendish College, Cambridge, United Kingdom

B. J. Whalen Department of Medicine, University of Massachussetts, Worcester, MA, USA

P. S. Wakenell W. A. F. Tompkins Department of Preventive Medicine, University of Department of Microbiology, Pathology and Parasitology, California, Davis, CA, USA College of Veterinary Medicine, North Carolina State ,D. Watson University, NC, USA CSIRO, Pastoral Research Laboratory, Armidale, N. E. Torres-Nagel Australia Institute of Virology and Immunobiology, University of P. D. Weinstein Wfirzburg, Germany Dedham, MA, USA A. Tournefier E. R. Werner Laboratoire d'Immunologie Compar~e, Universitfi de Institute of Biochemistry and Medical Chemistry, Bourgogne, Dijon, France University of Innsbruck, Austria I. Trebichavsky J. Westermann Division of Immunology and Gnotobiology, Institute of Department of Anatomy, School of Medicine, University Microbiology, Czech Academy of Sciences, Praha, Czech of Hannover, Germany Republic

J. Urbain Laboratory of Animal Physiology, Faculty of Sciences, University of Brussels, Belgium O. Vainio Department of Medical Microbiology, Turku University, Finland R. H. van den Berg Department of Renal Diseases, University of Leiden, The Netherlands T. K. van den Berg Department of Cell Biology and Immunology, Free University, Amsterdam, The Netherlands A. van den Broeke Department of Molecular Biology, University of Brussels, Belgium P. van der Meide Biomedical Primate Research Center, Rijswijk, The Netherlands

B. J. Willett Department of Veterinary Pathology, University of Glasgow, United Kingdom J. A. Winkelstein Department of Pediatrics, School of Medicine, Johns Hopkins University, Baltimore, ME)', USA R. Winn

Harborview Medical Center, Anesthesiology, Seattle, WA, USA J. K. Yamamoto Department of Pathobiology, College of Veterinary Medicine, University of Florida, FL, USA A. J. Young Basel Institute for Immunology, Switzerland A. Zurbriggen Institute of Animal Neurology, University of Berne, Switzerland

PREFACE Immunology is not restricted to the study of mouse and human immune systems. Historically, immunological studies on other animal species have greatly contributed to the development of immunology. Rabbits have been largely used for studies on immunoglobulin isotypes, allotypes and idiotypes, sheep for in vivo demonstration of lymphocyte recirculation and poultry for bursal differentiation of immunoglobulin secreting plasma cells. However, there has been no single comprehensive book available until now with a description of the immune system of various vertebrate species. The Handbook of Vertebrate Immunology is the first comprehensive source of comparative immunology in which fully updated data about the immunology of more than 20 vertebrate animal species is available. An understanding of the immune systems of animals other than mice and primates has several essential aspects: (1) in domestic animals it has obviously important applications in veterinary medicine (diagnosis, vaccinations, immune diseases or immunodeficiencies); (2) animal health and animal products quality, which benefit from immunology, are now of primary importance for human health; (3) animals also represent unique models for medical studies; (4) comparative immunology constitutes another way to revisit and to increase our knowledge of immune systems; (5) the possible future use of xenografts clearly implies a thorough immunological description of

the animal tissues to be grafted (Charley and Wilkie, 1994; Hein, 1995; Charley, 1996). For all these reasons, it has been necessary to summarize in a comprehensive way all available data, to identify gaps in our knowledge, to provide researchers, teachers and students, in biology, medicine and veterinary science, with both basic and practical information. These objectives have been fulfilled by this volume. The editors have succeeded in organizing the book following a constant format, each chapter including many of the same sections. In addition, useful basic and practical information is presented in concise, tabular form, including available reagents, accession numbers of sequences, species-specific data, etc. B. Charley Veterinary Immunology Committee of the International Union of Immunological Societies, INRA, Jouy-en-Josas, France References

Charley, B. (1996). The immunology of domestic animals- its present and future. Vet. Immunol. Immunopathol. 54, 3-6. Charley, B. and Wilkie, B. N. (1994). Why study the immunology of domestic animals. The Immunologist 2, 103-105. Hein, W. R. (1995). Sheep as experimental animals for immunological research. The Immunologist 3, 12-18.


INTRODUCTION Rabbits come out of the brush to sit on the sand in the evening, and the damp fiats are covered with the night tracks of "coons" and with the spread pads of the dogs from the ranches, and with the split-wedge tracks of the deer that come to drink in the dark.

John Steinbeck Of Mice and Men

The recent development of modern immunology has been primarily a story of 'Mice and Men'. Nevertheless, other species have played a crucial role in illuminating our understanding of the basic features of the structure and function of the immune system. The rabbit has contributed much to studies of humoral immune responses, sheep have provided an essential model for the study of lymphocyte trafficking, and birds have contributed to an understanding of lymphocyte lineages and B-cell differentiation in the Bursa of Fabricius. In 1986, Bruce Wilkie organized the First International Veterinary Immunology Symposium at the University of Guelph, Canada, to gather together scientists interested in the immune system of vertebrates other than mouse and man. This Symposium represented a real milestone in the development of comparative and veterinary immunology. There is a tremendous wealth of knowledge on the immune systems of both wild and domestic animals and it was timely to gather this information, which is scattered throughout numerous scientific journals, in the format of a Handbook. This Handbook is intended to provide the first comprehensive source of comparative immunology for students and researchers in comparative medicine, animal health, and biology. The choice of species and subjects to be included in the Handbook was based on three main criteria: first, the importance of a species in public and animal health sectors; second, the importance of a species for comparative research; and third, the level of available immunological knowledge. For comparative purposes, chapters on selected features of the mouse immune system and the SCID mouse model were also included. A growing interest in xenografts also justified a separate chapter on this topic. All chapters devoted to descriptions of the immune system of individual species have been organized with a similar format. This format includes a broad range of

Handbook of Vertebrate Immunology

ISBN 0-12-546401-0

topics that are presented in a consistent order and style. Whenever possible, the available knowledge for a topic is presented in concise tabular format and primary references provided. This organization is intended to facilitate interspecies comparisons, allow rapid identification of information gaps, and reveal species-specific aspects of immune system structure or function. Furthermore, the careful referencing of information will enable interested researchers to pursue knowledge to a much greater depth. Gathering this wealth of information would not have been possible without the commitment and dedication of Section editors and the generous participation of a large number of contributors. We are greatly indebted to their massive amount of work and their willingness to set aside other priorities for this project. The staff at Academic Press have shown enthusiasm and support from the beginning of this project and they frequently provided useful guidance. We are especially grateful to Tessa Picknett, Sarah Stafford and Duncan Fatz. Christina Espert Sanchez and Lucie Karelle Bui Thi coordinated communication among Section editors and the Handbook editors, and worked diligently to integrate the edited manuscripts into a coherent and comprehensive reference book. The editors hope that the H a n d b o o k o f Vertebrate I m m u n o l o g y provides a valuable tool for all interested in immunology. Our greatest wish is that this Handbook not only facilitates research through the knowledge presented but that it also stimulates further research in those species and areas of immunology about which little is presently known. Mouse and Man have been the source of much immunological knowledge during the last 20 years. However, we believe that a full understanding of the immune system will be acquired only through a comparative analysis of its structure, function, and physiology in a multitude of species.

Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved


II 1.

IMMUNOLOGY OF FISHES Introduction

The fishes are the largest vertebrate class and constitute over 20 000 species (Nelson, 1994). Broadly, the fishes can be divided into the jawless fish, represented by the lamprey and hagfish, and the jawed fish that can be further divided into the cartilaginous fishes, such as the sharks and rays, and the bony fishes. Of the modern bony fishes, the teleosts are by far the major grouping (for overview of taxa see Figure II.7.1). The evolution of fishes and the tetrapods diverged from each other about 300 million years ago and it is natural that fishes should be the subject of investigation of the evolution of lymphoid tissues and the development of the immune system. Considerable research has been performed on unravelling the phylogenetics of immunoglobulin and major histocompatibility genes and mapping the evolution of immunologically important ,raits associated with the appearance of cell mediated and humoral immunity. However, in addition to comparative investigations, fish also represent potential experimental models for vertebrate immunology as a whole. The zebrafish is, for example, increasingly being used as a vertebrate model for the study of the activation and regulation of gene expression in general and recently for the expression of immune genes. Extensive studies of various fish species have shown that the basic mechanisms of acquired immunity in fish and mammals are surprisingly similar (Faisal and Hetrick, 1992). Differences exist but there are similarities in macrophage function, lymphocyte stimulation and characterized humoral factors such as antibodies. A body of information has emerged over the last 10 years on the structure and organization of immune-related genes in fish. The genes coding for immunoglobulins, T-cell receptors and major histocompatibility complex (MHC) molecules have been cloned and sequenced and these data provide a tantalizing insight into the evolution of vertebrate genes. Fish and their immune system may also represent an important scientific tool in the monitoring of environmental quality, particularly of immunotoxic environmental pollutants. Fish occupy a variety of ecological niches in the aquatic environment and so changes in the immune parameters of fish have the potential to be a sensitive gauge of environmental deterioration (Wester et al., 1994). Finally, the rapid expansion of aquaculture as an industry and the disease problems that the industry has Handbook of Vertebrate Immunology

ISBN 0-12-546401-0

encountered have intensified the study of immunology of fishes. The practical need to produce effective vaccines against a number of bacterial diseases has led to a better understanding of the piscine immune system and the factors that influence its function. It can be claimed, at least for part of the international aquaculture industry, that without effective vaccines, fish farming would not be feasible, either biologically or economically. The object of this chapter is to provide an overview of the active areas of research on immunology of fishes. Many of the contributing authors have drawn attention to the meagerness of data available on some aspects of the piscine immune system, and in highlighting the hindrances and challenges to our understanding, they all emphasize the need for more research on this vast, diverse group of vertebrates.

11

Lymphoid Organs and their Anatomical Distribution

Studies on the immune system of fishes have focused on a relatively small number of species, principally among the teleosts. This summary will be confined mainly to the description of the major lymphoid organs in the teleosts, while the lymphoid organs in some other fishes will be mentioned briefly.

Fish lack a b o n e m a r r o w and lymph n o d e s

Fish do not possess lymph nodes or bone marrow and instead the major lymphoid organs in the teleosts are the thymus, kidney, spleen and gut-associated lymphoid tissues (Figure II.2.1). A brief summary of the cell populations, life history and immune functions of the lymphoid organs is presented in Table II.2.1. The ontogeny of the lymphoid organs and immune responsiveness and detailed descriptions of leukocytes are presented elsewhere in this chapter. In teleosts, it is widely accepted that a lymphatic system is differentiated from the blood vascular system. The cartilaginous fishes possess a hemolymph system, in which vessels contain blood and lymph in various proportions. Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved

4

IMMUNOLOGY OF FISHES

Figure 11.2.1 The major lymphoid tissues of the elasmobranchs (shark) and the teleosts.

Epigonal organ

SHARK

Leydigorgan

Spleen

Spiral valve.

Head kidn%

TELEOST

Bodykidney Spleen Hindgut

Table 11.2.1 The major lymphoid organs of fishes a Organ

Cells

Life history

Epigonal organ b

Predominantly granulocytes, also lymphocytes

Granulopoiesis

Intestines, hind gut

Lymphocytes, macrophages

Intestines, spiral valve

Lymphoid cells, macrophages

Early development, before spleen, Leydig's or epigonal organ

Kidney

Head kidneyb: lymphocytes, granulocytes, macrophages, melanomacrophages, reticular cells Body kidney: lymphomyeloid and excretory tissue

Possesses pluripotent hemopoietic stem cells; lymphohemopoiesis

Leydig's organ b


Granulopoiesis

Meninges, cranial cavity b Chondrostei (sturgeons)

Granulocytes, lymphocytes

Predominantly granulopoiesis

Immune responsive?

Pericardia/tissue b Chondrostei (sturgeons)

Granulocytes, lymphocytes

Lymphohemopoiesis

Immune responsive?

Periorbital and subcranial tissue b


Lymphohemopoiesis

Immune responsive?

Spleen

Often predominantly red pulp Lymphoid populations White pulp: lymphocytes, appear late in development; macrophages, lymphohemopoiesis melanomacrophages

Blood-filtering organ Antigen trapping and immune responsive organ

Thymus

Lymphocytes, macrophages, myoid cells, mast cells, epithelial cells

Lymphopoiesis Direct involvement in immune response?

Cartilaginous fishes (sharks, rays)

Cartilaginous fishes (sharks, rays) (lymphoid tissue absent from the kidney of mdst elasmobranchs)

Cartilaginous fishes (sharks, rays)

Holocephali (Chimaeras)

All fishes except the jawless fish?

All fishes except the jawless fish

Immune function

Mucosal immunity

Site of first appearance of lymphocytes; involutes with age (not in some species)

aData from Zapata and Cooper (1990) and applicable mainly for the teleosts. bCompared with mammalian bone marrow.

Blood-filtering organ Antigen trapping and immune responsive organ


Wardle (1971) described a well-developed lymph system in teleosts and lymph collected from these vessels was devoid of erythrocytes and contained leukocytes in about the same proportion as in blood but in smaller numbers (Ellis and de Sousa, 1974). However, in some teleost species, the existence of a true lymphatic system has now been challenged and a secondary vascular system has been described (Vogel and Claviez, 1981; Steffensen and Lomholt, 1992). This system constitutes a separate, parallel circulatory system that originates from systemic arteries via tiny arterioarterial anastomoses, which form secondary arteries and supply their own capillary networks, and return to the systemic venous system. The secondary capillary beds have been demonstrated in the skin of the body surface, the fins, the surfaces of the mouth and pharynx and the peritoneum. It is proposed that a process of plasma skimming accounts for the paucity of cells in the secondary vessels (Steffensen and Lomholt, 1992). The tendency for cells to concentrate in the central stream of a vessel allows the relatively cell-free plasma flowing along the vessel wall to drain off into small side branches. Plasma skimming thus results in a lower hematocrit in the side branches than in the parent vessel.

Thymus The thymus is well developed in both cartilaginous fish and bony fish but is absent in the jawless fish. No uniformity exists in thymic histology of the various species, but in general, the thymus is a paired organ present in the dorsolateral region of the gill chamber and is delineated by a connective tissue capsule that projects trabecula within the thymic parenchyma. In the cartilaginous fish, the thymus is a multilobulate bilateral organ located near the gills but the teleostean thymus consists of a pair of lobes located on each side of the gill cavity at the superior edge of the gill cover towards the opercular cavity. The thymus is intraepithelial in teleos~ts (see Figure II.10.1) and the stroma is coml~osed of epithelial-reticular cells that form a three-dimensional framework for the thymocytes and other free mese,nchymal cells such as macrophages and myoid cells. A well-differentiated cortex and medulla are lacking in most teleosts but up to four layers have been reported in some species. Lymphocytes are the major cellular component but there are limited data on intrathymic cellular kinetics and migratory patterns. There is also only limited information on the possible functions of epithelial cells in the maturation of thymocytes and the acquisition of T cell specificities via the production of thymic factors (Chilmonczyk, 1992). Blood vessels are the only system known to connect the thymus with other fish organs and in rainbow trout there is some evidence for a blood-thymus barrier of variable permeability (Chilmonczyk, 1983). Thymic involution is ..,

8

not a general rule in fish and the thymus persists in many older fish. Involution may occur in association with aging and sexual maturity and may be induced by stress, season and hormones. A direct involvement of the thymus in defense mechanisms is suggested by several lines of evidence, including the appearance of plasma cells and plaque-forming cells after immunization (Ortiz-Muniz and Sigel, 1971; Sailendri and Muthukkaruppan, 1975; Chilmonczyk, 1992).

Kidney In teleosts, the kidney is a paired retroperitoneal organ that extends as a sheet of tissue dorsal in the body cavity in close contact with the osseous vertebral spine (Zapata, 1979). The kidney consists of two segments: an anterior segment (cephalic or head kidney) that contains predominantly hemopoietic tissue (renal activity is absent); and a middle and posterior segment (body or trunk kidney) that is dominated by renal tissue but also contains lymphohemopoietic tissue (Zapata and Cooper, 1990). The kidney parenchyma, which is supported by a connective tissue capsule and a framework of reticular cells, is dispersed between an extensive system of sinusoids. The sinusoidal cells, which include endothelial cells and adventitial cells, form a barrier between the hemopoietic tissue and blood received from the renal portal vein (Ellis et al., 1989). Macrophages are prominent, particularly melanomacrophages, and lymphocytes and plasma cells tend to be dispersed, although small clusters can occur (Meseguer et al., 1991; Press et al., 1994). The head kidney also contains granulocytes and nonspecific cytotoxic cells (Graves et al., 1984; Bayne, 1986; Evans and Jaso-Friedmann, 1992). Endocrine tissues are present in the kidney including the corpuscles of Stannius and interrenal (adrenal) tissue. In addition to its role as a major site of production of erythroid, lymphoid and myeloid cells (Smith et al., 1970; Zapata, 1979; Zapata, 1981b), the kidney is important in the trapping of antigens and the production of antibody (Ellis, 1980; Zapata and Cooper, 1990).

Spleen The spleen is a dark red to black organ located usually ventral and caudal to the stomach. The teleost spleen has a fibrous capsule and small trabeculae extend into the parenchyma, which can be divided into a red and white pulp. The red pulp, which may occupy the majority of the organ (Grace and Manning, 1980; Secombes and Manning, 1980), consists of a reticular cell network supporting blood-filled sinusoids that hold diverse cell populations including macrophages and lymphocytes. The white pulp is often poorly developed but may be divided into two

6

IMMUNOLOGY OF FISHES

....

!"!

i

"

....

"

'

,

"

"

................

....

"...... ..i..!

~ i

l.

~ ,

.

Figure 11.2.2 Lymphoid tissue in the teleost spleen (Halibut, Hippoglossus hippoglossus L.). The white pulp (W) contains melanomacrophage centers (M) and ellipsoids (E) and is surrounded by extensive areas of red pulp (R). The melanomacrophage centers and lymphoid tissue are associated with arterioles (a) and venous sinuses (v).

compartments: the melanomacrophage centers and the ellipsoids (Figure II.2.2).

Melanomacrophage centers Melanomacrophage centers are aggregations of closely packed macrophages that contain heterogeneous inclusions, the most frequent of which are melanin, hemosiderin and lipofuscin (Agius and Agbede, 1984). These aggregations of pigment-containing cells are present in the hemopoietic tissues of spleen and kidney, and in the periportal areas of the liver (Roberts, 1975) but their degree of organization varies between species. In many species, the centers are bound by a thin argyrophilic capsule, surrounded by white pulp and associated with thin-walled, narrow blood vessels (Agius, 1980; Herraez and Zapata, 1986; Ellis et al., 1989). However, in salmonids, the accumulations of melanomacrophages are less well-defined and lack a capsule, but the association with blood vessels and lymphocytes is retained (Press et al., 1994). Melanomacrophage centers have been considered metabolic dumps but their ability to retain antigens for long periods, possibly in the form of immune complexes, has drawn comparisons with germinal centers in higher vertebrates (Ellis and de Sousa, 1974; Ferguson, 1976; Agius, 1980). However, follicular dendritic cells have not been demonstrated in fish, nor have splenic memory B cells in rainbow trout shown evidence of features associated with memory cells derived from germinal centers in higher vertebrates (Arkoosh and Kaattari, 1991).

Ellipsoids The ellipsoids are terminations of arterioles with a narrow lumen that run through a sheath of reticular fibers, reticular cells and macrophages (Zapata and Cooper, 1990; Espenes et al., 1995a). Ellipsoids appear to have a specialized function for the trapping of bloodborne substances, particularly immune complexes (Ellis, 1980; Secombes and Manning, 1980; Espenes et al., 1995b), which are taken up by the rich population of macrophages in the ellipsoidal wall. The subsequent migration of laden macrophages to melanomacrophage centers has been described (Ellis et al., 1976; Ferguson, 1976; Ellis, 1980).

G u t - a s s o c i a t e d l y m p h o i d tissue

The teleosts lack organized gut-associated lymphoid tissue such as the Peyer's patches of mammals but, in species such as the carp, the lamina propria and epithelium of the hind gut contain significant populations of leukocytes. The participation of the hind gut and other organs in a mucosal immune system is discussed elsewhere in this chapter.

E l a s m o b r a n c h s - s h a r k s and rays

The main lymphoid organs in the elasmobranchs are the thymus and the spleen, which are well developed and possess many structural similarities to these organs in higher vertebrates (Zapata, 1980). Lymphomyeloid structures, which are mainly granulopoietic, are located in the esophagus (Leydig's organ) and in the gonads (epigonal organ) (Zapata, 1981a) (Figure II.2.1). Leydig's organ occupies a dorsal and ventral position in the gut submucosa extending from the oral cavity to the stomach. The epigonal organs occupy the parenchyma of the ovary and testis. Many elasmobranchs possess both Leydig's and epigonal organs but others have only one of these structures. Diffuse infiltrations with lymphocytes may also be found in the gut, especially in the spiral valve (F/inge, 1982; Hart et al., 1986).

3.

Leukocytes and their Markers

Introduction

All vertebrate immune responses are mediated by leukocytes and, therefore, an understanding of immunology must be based upon an understanding of leukocyte function. Hence, to assess function unambiguously, it is important not only to identify but also to isolate the cells of interest. In recent years, the identification and functional characterizations of subpopulations of human and


7

murine leukocytes have been greatly facilitated by the development and use of numerous monoclonal antibodies (mAbs) specific for differentially expressed cell surface markers. These mAb-defined markers on human and murine leukocytes are known as clusters of differentiation (CD) antigens; there are currently more than 130 known CD antigens for human leukocytes, with the list growing continuously (Janeway and Travers, 1996). Fish, like mammals, possess leukocytes that can be classified as lymphocytes, monocytes/macrophages, and granulocytes based on morphology, ultrastructure, and cytochemical staining (Rowley et al., 1988). However, in contrast to mammals, there is currently a paucity of cell surface markers that can be used to identify and to study fish leukocyte subpopulations functionally. As a result, little is

currently known about fish leukocyte development and function. The purpose of this section is to highlight the known leukocyte markers in fish (see Tables II.3.1 and II.3.2) and to summarize how these have been used to define functionally various leukocyte subpopulations.

Lymphocytes

The existence of B cells has been directly demonstrated in many teleost species through the use of monoclonal antibodies specific for fish immunoglobulin (Ig) (Table II.3.1) and by the identification of Ig heavy and light chain genes (reviewed by Wilson and Warr, 1992; Warr, 1995; Pilstr6m and Bengten, 1996). Much of our current understanding of

Table 11.3.1 Monoclonal antibodies to fish immunoglobulin Fish species

mAb

Reactivity

References

Atlantic cod

1 F1 Several 2A2

H chain H chain L chain

Pilstr6m and Petersson (1991) Israelsson et al. (1991) Pilstr6m and Petersson (1991)

Atlantic salmon

Several 1206, 202 G2H3

H chain H chain H chain

Killie et al. (1991) Magnadottir et al. (1996) Pettersen et aL (1995)

Carp

WCI 4, WCI 12 WCI M

H chain H chain

Secombes et al. (1983) Rombout et al. (1993b)

Channel catfish

Several 9E1 1G7, 3F12


Lobb and Clem (1982), Lobb and Olson (1988) Sizemore et al. (1984), Miller et al. (1987) Lobb et al. (1984)

European eel

WE11 WE12

H chain L chain

Van der Heijden et al. (1995) Van der Heijden et al. (1995)

Rainbow trout

1.14 Several Several 2A1,2H9

H chain H chain H chain L chain

DeLuca et al. (1983) Thuvander et al. (1990) Sanchez et al. (1993a) Sanchez and Dominguez (1991)

Red drum Sea bass

RDG013, RDG048 3B5, 6E11 DLIg3


MacDougal et al. (1995) Romestand et aL (1995) Scapigliati et al. (1996)

Sea bream

WSI 5

L chain

Navarro et al. (1993)

Turbot

Several

H chain

Navarro et al. (1993)

Table 11.3.2 Monoclonal antibodies for fish non-B cells Fish species

mAb

Reactivity

References

Atlantic salmon

E3D9

PMN leukocytes (70 kDa?)

Pettersen et al. (1995)

Catfish

13C10 13C5 C3-1,51A 5C6 CfT1 1H5

Ig- leukocytes (150 kDa) Neutrophils Neutrophils NCC (40-41 kDa) T cells (35 kDa) Leukocytes (180 and 90 kDa)

Miller et al. (1987) Bly et al. (1990) Ainsworth et al. (1990) Evans et al. (1988) Passer et al. (1997) Yoshida et al. (1995)

Sea bass

DLT15

T cells? (170 kDa)

Scapigliati et al. (1995)

8

fish lymphocyte function has been obtained through the coupling of cell separation techniques, employing anti-Ig mAb, with immunologically relevant in vitro assay systems (reviewed by Clem et al., 1991; Vallejo et al., 1992). Studies, using mitogens, have revealed that Igpositive cells from a variety of fish are responsive to lipopolysaccharide (LPS, a known mammalian B-cell mitogen) but not Concanavalin A (Con A, a known mammalian T cell mitogen); in contrast, fish Ig negative cells are responsive to Con A but not LPS (DeLuca et al., 1983; Sizemore et al., 1984; Miller et al., 1987; Ainsworth et al., 1990). The results of in vitro antibody studies have demonstrated that the generation of anti-hapten antibody responses to a T-independent antigen (as defined in mammals) in the channel catfish requires only surface Igpositive cells and monocytes, whereas anti-hapten responses to a T-dependent antigen require not only surface Ig-positive cells and monocytes but also surface Ig-negative cells (Miller et al., 1985, 1987). Other in vitro studies have shown that fish Ig-negative lymphocytes: (1) are the responding population in a mixed leukocyte reaction (Miller et al., 1986); (2) produce a macrophage activating-like factor(s) upon stimulation with Con A and phorbol myristate acetate (Graham and Secombes, 1990a); (3) specifically proliferate in response to processed and presented antigen (Vallejo et al., 1991a). All of these cell separation studies clearly show that fish have the functional equivalents of B and T cells. However in contrast to B cells, fish T cells have been indirectly defined as surface Ig-negative cells due to the lack of unambiguous cell surface markers. As a result, very few studies that give direct evidence for functional T cell markers in fish have been conducted. For example, in the channel catfish mAb13C10 was found to react with a large percentage of Ig-negative, but not Ig-positive leukocytes and tl~e 13C10 reactive cells were shown to have T cell functions. However, this mAb reacted not only with catfish T cells, but also with other cell types including neutrophils and thrombocytes, and hence could not be considered T cell specific (Miller et al., 1987). In the sea bass, mAb DLT15 was described that reacted with a majority of thymocytes and a low percentage Of lymphoid ceils from the blood, spleen and kidney (Scapigliati et al., 1995). Based upon this differentihl pattern of reactivity, the authors suggested that this mAb reacted with a subpopulation of T cells. However, no functional data were given to support this contention. A recent study in the channel catfish describes a mAb (CfT1) that defines a single chain protein of Mr 35 000 expressed on most thymocytes and a subpopulation of lymphoid cells in the blood, spleen and head kidney, but not expressed on B cells, granulocytes, macrophages, thrombocytes or erythrocytes (Passer et al., 1997). In addition, in vitro stimulation of PBLs with Con A resulted in an increased presence of CfT1 positive cells. Based on these findings, it appears that CfT1 defines a T lineagespecific marker in the channel catfish. However, definitive evidence will be obtained only when CfTl-positive cells

IMMUNOLOGY OF FISHES are shown to express T-cell receptor gene products. In this regard, the recent identification of T-cell receptor genes in rainbow trout (Partula et al., 1995) and channel catfish (Wilson et al., 1998) should allow for the development of mAb to the T-cell receptor through use of recombinant proteins. It is also important to note that immortal clonal T and B cell lines, which express T cell receptor ~/fl and Ig genes, respectively, have been developed in the channel catfish (Miller et al., 1994; Wilson et al., 1998). The use of such cell lines should be of great value for developing reagents to other functionally important lymphocyte markers.

Natural cytotoxic cells (NCC) Fish possess natural cytotoxic cells (NCC) which are functionally similar to mammalian natural killer (NK) cells, i.e. they kill certain types of xenogeneic target cells, including a number of pathogenic protozoa, without the requirement for previous exposure (reviewed by Evans and McKinney, 1991; Evans and Jaso-Friedmann, 1992). Fish NCC, unlike mammalian NK cells, are small agranular lymphocytes and exhibit diminished capacity to recycle lytic functions (Evans et al., 1984a; Greenlee et al., 1991). A mAb (5C6) has been developed that defines a cell surface marker of 40-41 kDa on catfish NCC (Evans et al., 1988; Evans and Jaso-Friedmann, 1992). This marker appears to be an important function-associated antigen in that it is involved in cell target recognition, conjugate formation and cellular activation. Functional reactivity of this monoclonal antibody with human and rat NK cells has led to the speculation that NCC may be the teleost equivalent of mammalian NK cells. It should be noted that NCC are not the only type of NK-like effector cells present in fish. For example, recent studies have shown that non-immune channel catfish peripheral blood possesses potent cytotoxic effector cells for both allogeneic and virus-infected autologous cells, and these cytotoxic cell do not express the NCC 5C6 surface marker (Stuge et al., 1995; Y~6shida et al., 1995; Hogan et al., 1996). Currently there are no markers available that functionally define these non-NCC, NK-like effector cells from the Catfish. However, cytotoxic activity of these effector cells ~ 95%); MR= moderately resistant (regression of tumors by approximately 50%); S = susceptible (progression of tumors ~> 95%); HS=highly susceptible (progression of tumors 100%, rapid growth), a,b = significant (P < 0.05) differences in the regression time. Chickens of all genotypes are highly susceptible to primary challenge with BH-D. Data according to Plachy (1988) and Plachy et al. (1992). S p e c i e s - s p e c i f i c a s p e c t s of M H C g e n e t i c s or p r o t e i n s t r u c t u r e and f u n c t i o n The MHC of the chicken exhibits some significant departures in organization, appears to be simpler and smaller than the MHC of mammals, and it may contain only the 'minimal essential' number of genes that is required for the function of an MHC (Kaufman et al., 1995b). Chicken MHC (B) harbours a large family of highly polymorphic B-G genes with a unique structure comprising an immunoglobulin-like domain of the variable region type (Ig V-like), a transmembrane domain, and intracytoplasmic heptad domains. These genes are only distantly related to butyrophilin and myelin-oligodendrocyte glycoprotein that are encoded by genes at the periphery of the human and mouse MHC (Kaufman et al., 1991). All of the class II fi, class I ~ and fi2m, that have been

sequenced are very small, with many introns around 100 bp. Some portions of these genes are extremely G + C rich. In most MHC haplotypes, unlike in mammals, only one class I molecule is highly expressed at the protein level in blood and spleen cells. Further difference is in the distribution of antigens- both class I and IV are expressed on erythrocytes. A second MHC gene cluster (Rfp-Y) with two class I and two class II fl genes was described. Rfp-Y segregates independently of the MHC (B) but could be located on the same microchromosome. A 'hot spot' of recombination between these two complexes has been suggested, perhaps being the very large and repetitive, and therefore recombinogenic, NOR. Nonclassical class I genes have been found outside the MHC in mammals, but the Rfp-Y complex represents a novel type of gene organization with a combination of both class I and class II genes in an independent gene cluster (Miller et al., 1994). An interesting difference in evolution of class II beta genes of birds and mammals has been described recently (Edwards et al., 1995). The evolutionary tree of avian class II fl genes reveals that orthologous relationships have not been retained as in placental mammals and that genes in songbirds and chickens have had very recent common ancestors within their respective groups.

Acknowledgment This work was supported in part by the grants from the Austrian Ministry of Science and Research (AustrianCzech Cooperation Program) and from the Agency of the Czech Republic (Project No. 523/96/0670).

7.

Cytokines

Cytokines are soluble proteins that are involved in diverse physiological and pathological processes and in regulating immunity. In mammals, a large number of cytokines with well-defined biological functions have been identified and characterized. The genes coding for many of these cytokines have been cloned and expressed. Although many biological equivalents of mammalian cytokines have been identified in birds, only a few avian cytokines have been purified and characterized. In recent years, genes coding for some of the avian cytokines and their receptors have been cloned. These include chicken types I and II IFN, TGF-fi, cMGF, 9E3/CEF4 (chicken IL-8), IL-2, IL-1 receptor and the a-chain of the IL-2 receptor. Recently, the gene for turkey type I IFN was also cloned. With the exception of TGF-fi, there is little sequence homology between the genes of mammalian and avian cytokines. In general, mammalian and avian cytokines show little cross-species biological activity. In this section, we have tabulated (see Tables IV.7.1-

96

AVIAN I M M U N O L O G Y

Table IV.7.1 Avian cytokines ATH (avian thymic hormone)

Homology Source Target Activity

80% with human c~-parvalbumin (Brewer et aL, 1989, 1991) at the amino acid level Chicken thymus (Barger et aL, 1991), chicken muscle (Brewer et aL, 1991) Chicken bone marrow cells (Murthy et aL, 1984) Promotes maturation (Murthy et aL, 1984)

Bursin (bursapoietin)

Source Target Activity

Chicken B cells (Guellati et aL, 1991 ; Jankovic, 1987) Chicken hypothalamo-hypophysial-adrenocortical axis (Guellati et aL, 1991) Restoration of immune abilities (Audhya et aL, 1986) and adrenocorticotropic abilities (Guellati et aL, 1991)

FGF-2 (fibroblast growth factor):


Human recombinant (Hossain et aL, 1996) Chicken sensory neurons, cochleovestibular ganglion of chicken embryos (Hossain et aL, 1996) Increased explant growth, increased neuroblast migration, increased neurite outgrowth (Hossain et aL, 1996)

G-CSF (granulocyte stimulating factor)


Chicken macrophage cell line (HD11) (Leutz et aL, 1988, 1989), chicken serum (Byrnes et aL, 1993b) Chicken myeloblasts (Leutz et aL, 1988, 1989), chicken bone marrow cells (Byrnes et aL, 1993b) Increased colony formation (Byrnes et aL, 1993b; Leutz et aL, 1988, 1989)

IL- 1 (interleukin- 1)

Source

Target Activity

Chicken macrophages (Hayari et aL, 1982; Klasing and Peng, 1990; Bombara and Taylor, 1991 ; Byrnes et aL, 1993a), chicken splenocytes (Brezinschek et aL, 1990) Chicken thymocytes (Hayari et aL, 1982; Klasing and Peng, 1990; Bombara and Taylor, 1991 ; Byrnes et aL, 1993a) Co-mitogen (Hayari et aL, 1982; Klasing and Peng, 1990; Bombara and Taylor, 1991 ; Byrnes et aL, 1993a) corticosterone upregulation in chickens in vivo (Brezinschek et aL, 1990)

IL-2 (interleukin-2, T-cell growth factor)


23.8% identical and 46.2% similar to bovine IL-15; 24.5% identical and 44.1% similar to bovine IL-2; 25% identity and 44% similarity to the genetic sequence of bovine IL-15 (Sundick and Gill-Dixon, 1997) Chicken peripheral blood lymphocytes, spleen cells (Vaino et aL, 1986; Fredericksen and Sharma, 1987; Myers et aL, 1992) Chicken lymphocytes (Vaino et aL, 1986; Fredericksen and Sharma, 1987; Myers et aL, 1992) and T cell blasts (Sundick and Gill-Dixon, 1997) Mitogenic (Vaino et aL, 1986; Fredericksen and Sharma, 1987; Myers et aL, 1992; Sundick and Gill-Dixon, 1997)

IL-3 (interleukin-3)


Human recombinant (Chang et aL, 1990) Chicken intestine (Chang et aL, 1990) Anion secretion (Chang et aL, 1990)

IL-6 (interleukin-6)


Duck monocytes (Higgins et aL, 1993), chicken ascites (Rath et aL, 1995) Murine cell line (7TD) (Higgins et aL, 1993) and B9-hybridoma (Rath et aL, 1995) Induction of cell proliferation (Higgins et aL, 1993; Rath et aL, 1995)

IL-8 (interleukin-8, 9E3/CEF4)


51% to mammalian IL-8 at the amino acid level, 45% to melanoma growth-stimulatory activity (Stoeckle and Barker, 1990) Chicken blood lymphocytes (Barker et aL, 1993), chicken fibroblasts (Rot, 1991 ; Gonneville et aL, 1991 ; Barker et aL, 1993) Chicken heterophils (Barker et aL, 1993), chicken monocytes (Gonneville et aL, 1991) Chemotaxis (Rot, 1991 ; Barker et aL, 1993)

Type I IFN (type I interferon)


Chicken type I IFN has at the amino acid/nucleic acid level homology with mammalian IFN: ~ (24/23%), /~ (20/24%), ~o(23/42%), ~ (20/43%), 7 (3/31%) and flatfish IFN (16/35%) (Sekellick et aL, 1994) Chicken spleen cells (Fredericksen and Sharma, 1987; Dijkmans et aL, 1990), recombinant chicken IFN (Sekellick et aL, 1994), recombinant turkey IFN (Suresh et aL, 1995) Chicken spleen cells (Dijkmans et aL, 1990; Sekellick et aL, 1994), chicken embryo fibroblasts (Fredericksen and Sharma, 1987), turkey embryo fibroblasts (Suresh et aL, 1995) Antiviral (Fredericksen and Sharma, 1987; Dijkmans et aL, 1990; Sekellick et aL, 1994; Suresh et aL, 1995) (continued)

Cytokines

97

Table IV.7.1 Continued IFN-7 (interferon-7, macrophage activating factor) Homology 35% with equine and 32% with human IFN-7; 15% with type I chicken IFN (Digby and Lowenthal, 1995) at the protein level Source ChickenT-cell line (Lowenthal et aL, 1995), recombinant chicken IFN-~ (Digby and Lowenthal, 1995) Target Chickenmacrophages (Kaspers et aL, 1994; Digby and Lowenthal, 1995; Lowenthal et aL, 1995) Activity Induction of nitric oxide production (Digby and Lowenthal, 1995; Lowenthal et aL, 1995); upregulation of MHC class II expression (Kaspers et aL, 1994) cMGF (chicken myelomonocytic growth factor) Homology 41% to human IL-6 (Leutz et aL, 1988, 1989), 56% to human G-CSF (Sterneck et aL, 1992) at the amino acid level Source Chickenmacrophages (Amrani et aL, 1986), chicken fibroblasts (Samad et aL, 1993), human recombinant (Amrani, 1990), chicken recombinant (Leutz et aL, 1988, 1989) Target Chickenhepatocytes (Amrani et aL, 1986; Amrani, 1990; Samad et aL, 1993) Activity Increasedfibrinogen synthesis (Amrani et aL, 1986; Amrani, 1990), increased fibronectin synthesis (Samad et aL, 1993) MIF (migration inhibitory factor) Homology Similarin physicochemical properties to human MIF (Joshi and Glick, 1990) Source Chickenlymphocytes (Joshi and Glick, 1990), embryonic chicken lens (Wistow et aL, 1993) Target Chickenperipheral blood lymphocytes (Joshi and Glick, 1990) Activity Decreasedmacrophage migration (Joshi and Glick, 1990) PDGF (platelet-derived growth factor) Source Recombinant human PDGF (Sieweke et aL, 1990) Target Chickenfibroblasts (Sieweke et aL, 1990) Activity Mitogenic (Sieweke et aL, 1990) TGF-~ (transforming growth factor-~) Activity Regulationof proliferation and differentiation of a variety of cells (Roberts and Sporn, 1990), mitogenic (Sieweke et aL, 1990) TGF-~ 1 Homology


Identical to human TGF-/~I, 71% identity to amino acid sequences of processed human TGF-/~2, 78% and 80% to chicken TGF-~s 3 and 4, respectively (Jakowlew et aL, 1988a) Chicken chondrocytes (Jakowlew et aL, 1988b) Chicken fibroblasts (Jakowlew et aL, 1988b) Mitogenic (Jakowlew et aL, 1988b)

TGF-~2 Source

Chicken embryonic fibroblasts (Burt and Paton, 1991)

TGF-#3 Homology

Source TGF-fl4 Homology

Source

76% with human TGF-#I, 79% with human TGF-/~2 (Jakowlew et aL, 1988b; Sieweke et aL, 1990) at the amino acid level Chicken chondrocytes, chicken embryo fibroblasts, Rous sarcoma virus-transformed chicken embryonic fibroblasts (Jakowlew et aL, 1988b), chicken ascites (Rath et aL, 1995) 81%, 64% and 71% to human TGF-/~I, human TGF-/~2 and chicken TGF-/~3, respectively (Jakowlew et aL, 1988c) at the amino acid level Chicken embryo chondrocytes (Jakowlew et aL, 1988c), chicken embryo fibroblasts (Burr and Paton, 1991)

TNF-~ (tumor necrosis factor) Source Chickenmacrophages (Klasing and Peng, 1990; Qureshi et aL, 1990; Byrnes et aL, 1993a; Zhang et aL, 1995), chicken neurons (Gendron et aL, 1991) Target Chickenand mouse cell lines (Klasing and Peng, 1990; Qureshi et aL, 1990; Byrnes et aL, 1993a; Zhang et aL, 1995) Activity Cytolysis (Klasing and Peng, 1990; Qureshi et aL, 1990; Byrnes et aL, 1993a; Zhang et aL, 1995) Thymulin Homology To synthetic mammalian thymulin (Chang and Marsh, 1993),thymulin-like activity of avian sera (Marsh et aL, 1991) Source Chickenthymus (Marsh and Scanes, 1993) Target ChickenT cells (Marsh and Scanes, 1993) Activity Induction of maturation (Marsh and Scanes, 1993) Thrombocyte colony stimulatory factor Source Spleen-conditioned medium (Nicolas-Bolnet et aL, 1995) Target Late thrombocyte progenitors (Nicolas-Bolnet et aL, 1995) Activity Colony formation (Nicolas-Bolnet et aL, 1995)

98

Table IV.7.2

AVIAN IMMUNOLOGY

Avian cytokine genes Gene structure cloned

Primer sequence used

Reference

Cytokine

Protein size

Cross-species activity

9E3/CEF4

11 kDa

Turkey

cDNA

Not published

Sugano et al. (1987), Suresh et al. (1995)

clFN type l

193 aa

Turkey

cDNA

Sense: 5'-TTGGCCATCTATGAGA TGCTCCAGMANATHTT-3' Antisense: 5'-CGGACCACTGTCCA NGCRCA-3'

Sekellick et aL (1994)

tlFN type l

162 aa

Chicken

cDNA

Sense: 5'-ATGGCTGTGCCTGC AAGCCCA-3' Antisense: 5'-AGTGCGCGTGTTGC CTGTGA-3'

Suresh et al. (1995)

IFN-7

145 aa

cDNA

Not published

Digby and Lowenthal (1995)

IL-2

121 aa (mature protein)

cDNA

Not published

Sundick and Gill-Dixon (1997)

cMGF

24 kDa

cDNA

Not published

Leutz et al. (1989)

MIF

115 aa

cDNA

5'-CAG GATCCCGATG-I-I CA(TC)C(GA)TA(AC) ACACCAA-3' (5064) 5'-TAGTCGACGGT (GATC)GA(GA)'I-I(GA)I-ICCA(GC)CC-3' (5065)

Wistow et al. (1993)

10 kDa

TGF-/~I

25 kDa dimer

cDNA

Human cDNA-probe

Jakowlew et aL (1988a)

TGF-/~2

112 aa monomer

Genomic DNA

Simian TGF-/~ 2 cDNAprimer: TCCATCTACAA CAGCACCAGGGACI-I GCTCCAGGAGAAG Chicken cDNA-TGF-/~2primer: CGAGACCC GCGCC-I-I-TGAGTT

Burt and Paton (1991)

TGF-/~3

112 aa monomer

cDNA

Human cDNA-probe

Jakowlew et aL (1988a, c)

TGF-/~4

114 aa monomer

cDNA

Human cDNA-probe

Jakowlew et aL (1988b)

Table IV./.3

Avian cytokine receptors characterized

Receptor

Expressing cells

Immunological reagent

Reference

CD25 (a-chain of IL-2)

Thymocytes, peripheral T cells

Monoclonal antibody INN-CH-16

Hala et al. (1986); Schauenstein et aL (1988); Fedecka-Bruner et aL (1991 )

IL-1 (type I)

Chicken embryo fibroblasts

Guida et al. (1992)

Complement

99

Table IV.7.4 Methods used to detect avian cytokines Cytokine

Bioassay

TNF-~

Cytotoxicity assay

Immunoassay

Immunocytochemistry Western blot

Susceptible cells/commercially available immunoreagents

Reference

L929 mouse cells CU-25 MDTC-RP-9 CHCC OU-2 Polyclonal rabbit-anti mouse TNF-~ (Genzyme) Monoclonal rat-anti mouse TNF-= (Endogen Inc./UBI Inc.)

Byrnes et al. (1993a, b) Qureshi and Miller (1991) van Ostade et al. (1991) Zhang et al. (1995) Wride and Sanders (1993)

Thymocytes

IL-1

IL-1 proliferation assay

Human fibroblasts

Weiler and von Bulow (1987) Loppnow et al. (1989)

Type llFN

Antiviral IFN-assay

Chicken embryo-fibroblasts

Sekellick et al. (1994)

IFN-?

Nitrite assay

Chicken macrophages (HD11)

Lowenthal et aL (1995)

Thymulin

Thymulin assay

IL-2

T cell proliferation assay

Coudert et aL (1979) Marsh et aL (1991)

Immunoassay T cell blasts

Spleen blast cell proliferation assay TGF-fl

Radioreceptor assay on A549 cells Mink lung epithelial cell inhibition assay

IL-6

Wakefield (1987) Neutralizing ab, also against TGF-fl

Danielpour et al. (1989)

hlL-6 ELISA (Intertest 6 x human IL-6 Elisa B9 hybridoma proliferation assay 7TD-1 hybridoma proliferation assay

cMGF

Colony formation

Kit)

Polyclonal antiserum

IV.7.4) the data on avian cytokines and cytokine receptors. Excellent summaries of the data on avian cytokines were published by Klasing (1994) and Lillehoj (1993). There is considerable current interest in avian cytokines and new findings are imminent.

8.

Vaino et al. (1986), Kaplan et al. (1993) Kaplan et al. (1992), Sundick and Gill-Dixon (1997)

Complement

Introduction Lytic complement (C) activity in avian sera was first reported in the early part of the century (Muir, 1911). More recently it has been demonstrated that the sera of avian species contain macromolecules that structurally and/or functionally resemble mammalian C components.

Rath et al. (1995) 7TD-1 murine cell line

Higgins et al. (1993)

E26-transformed myeloblasts, bone marrow granulocytes

Leutz et al. (1984)

Because both birds and mammals encounter a battery of comparable pathogens, these observations would appear to suggest that these groups have evolved C systems that are similar: indeed, in some respects they are. However, although the avian C system is not as well understood as that of mammals, there are indications that the C systems of species in these groups might possess fundamental differences. This section presents information on individual components, activation pathways, and the ontogeny of the avian C system, and also provides comparisons between the C systems of birds and mammals.

Avian complement components The molecular properties of avian C components which have been characterized are listed in Table IV.8.1. Chicken

100

AVIAN IMMUNOLOGY

Table IV.8.1 Molecular properties of avian complement components

Component

Species

Whole molecule (kOa)

C3

Chicken

185 180

Factor B CIq

Quail

183

Chicken Chicken

95 504

Separate chains (kOa) 118 68 116 67 110 73 6 x 25.9 6 x 24.8 6 x 24.8

Approximate serum concentration (l~g/ml)

Reference Laursen and Koch (1989) Mavroidis et al. (1995)

500

Kai et al. (1983) Koch (1986b) Yonemasu and Sasaki (1986)

50-100 a 50-70

a Estimated from data in Koch (1986b).

and quail C3 are similar in size to their counterparts in other vertebrates; they also possess a reactive thiolester bond, and upon activation are cleaved into fragments that resemble mammalian C3a and C3b (Kai et al., 1983; Laursen and Koch, 1989). The cDNA sequence of chicken C3 has recently been reported (Mavroidis et al., 1995) and the primary structure deduced from it shows identity with human C3 and those of other species in several functionally important regions. When chicken factor B is activated it is cleaved at sites identical to those in mammalian factor B, producing 37 kDa and 60 kDa fragments (Koch, 1986b). This component also exhibits genetic polymorphism, but does not appear to be linked to the MHC, as is the case in mammals (Koch, 1986c). Chicken and human Clq are also similar. Both are large macromolecules containing six subunits with each subunit composed of three distinct polypeptide chains (Yonemasu and Sasaki, 1986). These Clq molecules also resemble one another in carbohydrate, hydroxyproline, and hydroxylysine content, as well as in their susceptibility to degradation by collagenase. C4 activity has been detected in chicken serum using human and guinea pig reagents (Barta and Hubbert, 1978) and in pigeon serum using C4-deficient guinea pig serum (Koppenheffer and Russell, 1986). Because the activity measured in both instances was very low, it is uncertain whether avian C4 is only minimally compatible with mammalian C reagents or whether these avian sera contain low amounts of this component. It is also possible that the putative C4 activity might be a result of interactions between C components other than avian C4. Nevertheless, Wathen et al. (1987) found that chicken plasma contains a protein that cross-reacts with an antihuman C4 antiserum. After electrophoresis, plasma of adult females exhibited three bands while that of immature birds and adult males exhibited two bands. This, together with the low levels of C4 activity detected in chicken and pigeon sera, suggests the possibility that avian species possess a functional C4 component.

Immunoelectrophoretic and hemolytic tests were used to detect C6 activity in a seabird, the manx shearwater (Whitehouse, 1988). Interestingly, this component was found to be highly polymorphic with seven distinct allelic variants. Additional studies have demonstrated that enzymes present in chicken plasma possess cleavage activity equivalent to that of mammalian factor I and its cofactor (factor H) (Kaidoh and Gigli, 1987). This is not surprising in view of the studies on quail (Kai et al., 1983) and chickens (Laursen and Koch, 1989) which showed that C3 of these species is degraded by serum enzymes, and the finding that factor I cleavage sites are conserved in chicken C3 (Mavroidis et al., 1995). The presence in chicken serum of the factor B-activating enzyme, the serine esterase factor D, has been inferred by the loss of C3-activating capacity which occurs in serum depleted of low molecular weight substances by gel filtration chromatography (Jensen and Koch, 1991).

Complement

activation

Table IV.8.2 lists a number of properties exhibited by avian C. As in other vertebrate species, avian antibodyindependent alternative complement pathway (ACP) activity has been demonstrated with the use of heterolo-

Table IV.8.2

Characteristics of avian complement

9 Antibody-independent ACP activity is demonstrable in vitro 9 Microbial parasites activate the ACP in vivo 9 The ACP is activated by avian antibodies 9 Hemagglutinating levels of Ab produce maximum lysis 9 CCP activity is difficult to demonstrate 9 Both the ACP and CCP might utilize factor B 9 Cobra venom factor does not uniformly activate avian C 9 The level of hemolytic C in chickens is MHC-linked

Ontogeny of the Immune System

101

gous erythrocytes (Ohta et al., 1984). It is responsible for day embryos (Kai, 1985). In chickens, Gabrielsen et al. the bactericidal activity of turkey and chicken plasma (1973b) showed that sera of 13-day embryos possessed C (Snipes and Hirsh, 1986; Wooley et al., 1992), and has activity. In both species, C activity increased rapidly also been shown to provide protection in both embryos during the first week after hatching, and following a and chicks against infection by a strain of fowl pox virus plateau, it increased steadily for several weeks until adult (Ohta et al., 1984), as well as natural resistance against levels were attained. infection by a protozoan parasite in chickens (Kierszenbaum et al., 1976). An interesting feature of avian Abs is their ability to Summary and conclusions activate homologous C by a pathway which exhibits characteristics of the ACP (Koch, 1986a; Koppenheffer Several key avian C components have been characterized and Russell, 1986). It is important to note that in several and shown to resemble their mammalian counterparts. studies which employed hemolytic tests, dilutions of avian While the avian ACP appears to function in a manner antisera or antibodies that produced maximal lysis caused similar to that of other vertebrates, the nature of the C marked agglutination of target cells (Gewurz et al., 1966; pathways activated by avian antibodies remains uncertain. Gabrielsen et al., 1973a; Koppenheffer and Russell, 1986). The gene(s) encoding chicken factor B is not linked to the Whether similar levels of target cell sensitization occur in MHC, although linkage has been demonstrated between vivo is questionable, thus raising the possibility that hemolytic C levels and the MHC in this species. Birds activation of the ACP by avian antibodies may have little show evidence of C activity during embryonic developphysiological significance. This is puzzling in light of the ment, and a similar ontogenic pattern of hemolytic C fact that activation of an avian classical complement activity occurs in chickens and quail. Cellular C receptors pathway (CCP) by homologous antibodies has not been have been given little attention since the work of Thunold demonstrated, although mammalian antibodies have been (1981) and there is no information available concerning shown to activate chicken Clq (Yonemasu and Sasaki, the biological activities of the small C-cleavage fragments. 1986) as well as a lytic pathway that requires both Ca 2+ Moreover, useful information about the avian C system and Mg 2+ (Barta and Barta, 1975; Koch, 1 9 8 6 a ) - a has been obtained from a limited number of species. It is characteristic of the vertebrate CCP. Moreover, in the evident that much work remains to be done in order to latter studies by Koch (1986a) depletion of factor B better understand this important immune effector system abolished lytic activity, leading to the suggestion t h a t in birds. chicken factor B participates in both the CCP and ACP. This idea is consistent with the recent finding that the chicken factor-B cleavage fragment, Ba, has a similar degree of amino acid sequence identity with Ba and the 9. Ontogeny of the Immune System low molecular weight C2 fragment in the human and mouse (Kjalke et al., 1993). However, it cannot explain -Introduction the observation that cobra venom factor (CVF) depletes ACP activity in this species, while the activity of the CCP, Chicken has long been a favorite model of both developas measured by the lysis of RBC sensitized with rabbit mental biologists and immunologists. It is therefore not antibodies, is unaffected (Ohta et al., 1984). The latter surprising that many of the key insights into the ontogeny finding suggests that a component unique to the chicken of immune system have come from studies on the chicken. ACP is inactivated by CVF, and thus the existence of two One obvious reason is the accessibility of the avian embryo distinct C pathways cannot be ruled out. to manipulation and study at any stage of development. Another advantage is the clear dichotomy of lymphoid development in the chicken. Both T and B cells develop in MHC and ontogeny distinct organs, thymus and the bursa of Fabricius, respectively (Table IV.9.1). This contrasts with mammals, in While no regions of the avian MHC have been identifed which B cell development is spread to fetal liver and that are homologous to those which encode mammalian C multiple sites of bone marrow. Combined, these two components, linkage has been demonstrated between features have guaranteed the appeal of chicken as an hemolytic C levels and the chicken MHC (Chanh et al., experimental animal. In recent years many of the mole1976; Shen et al., 1984). A dominant gene appears to cules important in the immune system have been characcontrol high serum C levels, but neither the locus nor terized on both genetic and protein level, producing tools gene product responsible for producing this effect has yet with which to probe the development of the immune been identified. system with increasing accuracy. These studies have C activity has been detected early in avian development. shown that while many of the developmental pathways In Japanese quail, hemolytic C activity was demonstrated are similar to mammalian species, some aspects are unique in 10-day embryos and C3 was found to be present in 7- to the chicken. In this section we review the development

102

AVIAN IMMUNOLOGY

Table IV.9.1 Ontogeny of the main cell lineages of the immune system

Cell type

Main origin

First observed

Notes

B cells

Bursa of Fabricius

Lymphoid follicles in bursa develop from ED8

Rearrangement of Ig genes occurs prebursally. Diversification takes place within bursa by somatic gene conversion

T cells

Thymus

75 thymocytes, ED12 ~/Vpl thymocytes, ED15 ~/V~2 thymocytes, ED 18

Thymus is seeded in three waves. Unlike the Ig genes, diversification of TCR genes results from recombination and junctional variation

Phagocytes

Bone marrow

Phagocytic activity in yolk sac on ED3, in liver on ED4

Main phagocytic cell types are monocytes/macrophages and heterophils

NK cells

Bone marrow

In spleen, ED8

NK cells are thymus-independent, characterized by cytoplasmic CD3

of avian immune s y s t e m - both its common and unique features.

Early precursors Early hematopoiesis in the chicken begins in yolk sac on embryonic day (ED) 1-2 and probably plays an important role in embryonic erythropoiesis (Martin et al., 1978). It is unlikely that cells originating in the yolk sac participate in the generation of lymphoid precursors. Intra-embryonic hematopoiesis begins on ED4. Hematopoietic stem cells in the early embryo localize first to intra-aortic cell clusters and at a later stage to para-aortic mesenchyme, ventrally of the aorta (Lassila et al., 1978; Dieterlen-Lievre and Martin, 1981; Cormier et al., 1986; Toivanen and Toivanen, 1987; Cormier and Dieterlen-Lievre, 1988). At present, the stem cells can only be identified functionally. When transferred into irradiated hosts, cells from paraaortic mesenchyme are able to generate both B and T cells of the donor type. During normal development these stem cells seed the primary lymphoid organs and thus generate the various lymphocyte populations. Bone marrow is also seeded by the stem cells and, after hatching, becomes a major site of hematopoiesis. Its role in lymphopoiesis, however, is less clear in the chicken than in mammals, especially during embryonic period (Toivanen and Toivanen, 1987).

B-cell development The bursa of Fabricius develops as an outgrowth of cloacal epithelium and is seeded between ED8 and ED14 by stem cells originating in the para-aortic area (Toivanen and Toivanen, 1973; Houssaint et al., 1976). In irradiated hosts, these stem cells are capable of reconstituting the entire B-cell lineage. These cells can first be found in embryonic spleen, from which they migrate to bursa and

give rise to lymphoid follicles. The rearrangement of immunoglobulin genes occurs prior to the entry into the bursa, e.g., in yolk sac, spleen, blood and bone marrow (Ratcliffe et al., 1986; Weill et al., 1986; Mansikka et al., 1990a). Unlike mammalian species, however, rearrangement in chickens does not generate significant diversity in the immunoglobulin genes. Because the chicken only has one functional V and J gene segment in both the heavy and light chain locus, each of the B-cell precursors expresses practically identical immunoglobulins (Reynaud et al., 1985). It has been suggested that when expressed on cell surface, this prototype immunoglobulin molecule can bind to an as yet unknown self ligand, triggering proliferation and further differentiation (Masteller and Thompson, 1994). The bursa has an essential role in B-cell development because it is the site of immunoglobulin gene diversification and, in bursectomized animals, only oligoclonal antibodies are observed (Weill et al., 1986; Reynaud et al., 1987; Mansikka et al., 1990b). The precursors entering bursa give rise to lymphoid follicles that start with only a few precursors but after proliferation contain approximately 100000 cells each (Pink et al., 1985). Within these follicles the developing B cells undergo gene conversion, a process in which parts of nonfunctional pseudogenes are copied into the rearranged immunoglobulin gene (Weill et al., 1986; Reynaud et al., 1987). The heterogeneity of the developing B cells within the follicles increases from ED 15 onwards, and almost all of the immunoglobulin gene diversity in the chicken is due to gene conversion. Although rearrangement is clearly independent of primary lymphoid organs, gene conversion only takes place in the bursa. Similar to mammals, the primary lymphoid organs of chicken are sites of extensive cell death (Motyka and Reynolds, 1991; Neiman et al., 1991). In the bursa, it has been estimated that only 5 % of the total cell numbers survive to form the mature B-cell population (Lassila, 1989). It has been reported that bursal cells undergoing

Ontogeny of the Immune System

apoptotic cell death down-modulate the expression of surface immunoglobulin (Paramithiotis et al., 1995). It is thus probable that one reason leading to cell death is inability to express a functional immunoglobulin. Other possible reasons may include expression of autoreactive antigen receptor, but details of the B-cell repertoire selection are poorly understood. The minority of cells which survive start to emigrate out of bursa around hatching.

T-cell development It is currently held that practically all T-cell development in the chicken is thymus-dependent (Dunon et al., 1993a, b). Thus, unlike in the mouse, in which extrathymic T-cell populations have been described, in chicken all T cells, including the intestinal intraepithelial T cells, originate in thymus from which they emigrate to form the peripheral cell pool. Thymus is seeded in three waves of blood-borne precursors (Jotereau et al., 1980). The first wave starts to arrive in thymus on ED6, the second on ED 12 and the third on ED 18. Each of these waves gives rise to all T-cell subsets. The first T-cell receptor-expressing thymocytes are 78 T C R § first observed on ED12. ~fl TCR § thymocytes expressing Vf~l family TCR genes develop next, on ED15, and Vp2-TCR § thymocytes on ED18 (Bucy et al., 1990b; Cooper et al., 1991). The mature T cells probably emigrate to periphery in distinct waves, as well. The first peripheral TCR § cells can be observed in spleen, on ED15. These cells express the 78 TCR, ~fi T cells appear 3 days later. The genes encoding the TCR chains in the chicken have been described, and their main characteristics resemble the mammalian genes (Tjoelker et al., 1990; G6bel et al., 1994b; Kubota et al., 1995; Six et al., 1995; Chen et al., 1996). Thus, they consist of multiple gene segments which can, on the basis of sequence comparison, be divided into families. As in mammals, and unlike in the avian immunoglobulin genes, diversity of the TCR genes resul.ts mainly from rearrangement and junctional variation. The mechanism determining the segregation of thymocytes to either 78 or ~fi T-cell lineage is unclear. It has been suggested that ~fl thymocytes may represent those cells which fail to express 78 TCR (de Villartay et al., 1988). In these cells the TCR 8 locus, situated within the ~ locus, is deleted during rearrangement. Support for this scenario is provided by studies of chicken ~fi T cell lines, in which 8 locus was shown to be deleted from both alleles (Kubota et al., 1995). In contrast, the TCR 7 genes have been reported to be frequently rearranged and transcribed in ~fl T-cell lines (Chen et al., 1996), which argues against the model of transcriptional silencing of 7 genes being the determinative factor. Studies in mouse have shown that during the maturational process within the thymus T cells are subjected to negative and positive selection (Nossal, 1994; von

103

Boehmer, 1994). These events result in the death of most of the thymocytes and modify the repertoire of the surviving cells to imprint MHC restriction and self tolerance. Data obtained in the chicken suggest that ~fl T cells develop through a similar pathway (George and Cooper, 1990; Cooper et al., 1991). They pass from CD4/CD8 double-negative stage to a double-positive stage in the thymic cortex, and thereafter one of the coreceptors is down-modulated. The ~fi TCR is first expressed at low levels, and at a certain stage the cells are susceptible to TCR down-modulation triggered by receptor crosslinking with mAb. It is less clear what kind of selection, if any, the 78 TCR + thymocytes are subject to (George and Cooper, 1990; Cooper et aI., 1991). They express high levels of TCR immediately and appear to pass quickly through the thymus. Cross-linking of 7c~ TCR has no effect on its expression, and cyclosporin A treatment, which arrests the development of ~fi T cells, does not affect 78 T-cell development. After thymic maturation both ~fl and 78 T cells emigrate to all lymphoid tissues in the periphery. An interesting exception is the homing pattern of ~fi T cells expressing TCR V/32-gene family (Lahti et al., 1991). These cells are very rare or absent in the intestinal epithelium and perhaps because of this cannot provide help for antibody responses of the IgA class (Cihak et al., 1991). The reasons for this difference between the two ~fl T cell lineages are not known.

Other cell types Nonlymphoid cells participating in immune function are also similar to those described in mammals (Powell, 1987b). The main phagocytic cells are monocytes/macrophages and, in analogy to mammalian neutrophils, heterophils. These cells are bone marrow derived and are continuously released to circulation. Such macrophagelike cells as Kupffer cells of liver and osteoclasts, although originally from bone marrow, may also divide locally. Natural killer cells are a distinct lymphoid lineage, characterized in the chicken as cells expressing at least some components of CD3 in cytoplasm but not on the cell surface (G6bel et al., 1996a). First observed in spleen on ED8, the NK cells probably share a common precursor with T and B cells, but their development is thymusindependent.

Concluding remarks Although a significant part of what is known about the ontogeny of immune system has been obtained from studies in the chicken, many aspects remain unclear. Lack of suitable markers for the hematopoietic stem cells is a major obstacle to understanding the early events of lymphopoiesis. B-cell precursors entering the bursa have already rearranged their immunoglobulin

104

AVIAN IMMUNOLOGY

genes, but for T-cell precursors the degree of lineage commitment prior to reaching thymus remains a matter of speculation. The developmental pathways within the primary lymphoid organs and the formation of mature lymphocyte repertoire remain areas for further study. The development of 75 T cells is of considerable interest because the chicken is a species with a very high frequency of these cells. The recent characterization of genes encoding the TCR chains and the growing list of molecules defined by monoclonal antibodies will undoubtedly bring new insights. In this way, the chicken continues to contribute to the understanding of developmental immunology in general.

10.

Immunocompetence of the Embryo and the Newly-Hatched Chi~k

Physiology

The microenvironment of the bursa of Fabricius is required for the generation of antibody diversity (gene conversion) and thus for the development of the humoral immune response (Huang and Dreyer, 1978; Weill and Reynaud, 1987; Ratcliffe, 1989; Benatar et al., 1992; Vainio and Imhof, 1995). Gene conversion starts between embryonation days (ED) 15 and 17 and continues until approximately 6'weeks old. Mature lymphocytes from th:e bursa then seed secondary lymphoid organs just prior to and post hatching. If the bursa is destroyed before the majority of gene conversion events have occurred, serum antibody levels may approach normal levels but the antibodies will be essentially nonfunctional (Granfors et al., 1982). In the chicken, the bursa loses it's critical role around 3 weeks, although involution does not occur until sexual maturity. The thymus is the primary organ for production and maturation of T cells. By the time of hatch most peripheralization of T cells has been accomplished and thymectomy post hatching does n6t destroy cell-mediated immunity (Cooper et al., 1991). Thymopoetin is a polypeptide that is secreted by thymic epithelial cells, probably thymic nurse cells, and it selectively induces the differentiation of committed precursor cells to early T cells (Tempelis, 1988). This action is mediated by an intracellular cAMP signal. Thymic nurse cells employ positive or negative (deletion or inactivation of self-reactive T cells) selection of immature T-cells by engulfing the thymocytes in vacuoles lined by epithelial cell membranes (Rieker et al., 1995). The number of thymocytes entering a single nurse cell appears to be species specific and is limited to four in the chicken. Normal embryos also have suppressor T-cells that suppress both humoral and cell mediated immunity (Tempelis, 1988). These cells are lost shortly after hatch.

Spleen germinal center formation is age dependent and reaches a maximum number at 4-5 weeks old. Lymphoid aggregates in the intestine (Peyer's patches) are absent at hatch, become visible at days 1-2 post hatching (PH), reach maximal numbers at around 16 weeks old and almost completely disappear by 52 weeks old (Lillehoj and Trout, 1996). In addition, the distribution of various T-cell subpopulations in the intestine do not reach adult proportions until 4-5 weeks PH (Lillehoj, 1991; Lillehoj and Trout, 1996). It is unclear how the differing distribution of T-cells in the early post hatching period affects the capability of the chick to mount an effective cellular immune response. Although early reports suggested that chicks in the first 2 weeks post hatching lack adequate immunologic responsiveness (Droege, 1971, 1976; Seto, 1981), the recent success of embryo vaccination indicates that the immunological immaturity of the late embryo may not have a major practical implication. Factors that can impact the developing bursa and thymus include genetics, infectious agents, nutrition, environment and chemical and/or hormonal interventions. The influence of the MHC on diseaseresistance has been well documented in the chicken (Dietert et al., 1991). The MHC may also exert an influence on the developing immune organs. Both the size of the bursa and the thymus and the number of mature lymphocytes produced by these organs are influenced by the number of MHC copies found in each cell. In research using MHC dosage mutants (disomi.c, trisomic and tetrasomic birds), Hemendinger et al. (1992), found that the greater the number of MHC copies per cell, the greater the cellular expression of MHC class II antigens and the more severe the ~reduction in bursal and thymic organ weights and T- and B-lymphocyte numbers. Infectious agents that can impact the developing immune system are numerous and include infectious bursal disease virus (IBDV) (Sail, 1991), chicken infectious anemia virus (Pope, 1991), Marek's disease virus (MDV) (Rivas and Fabricant, 1988), hemorrhagic enteritis (HE) virus (Sharma, 1991) and mycotoxins (Corrier, 1991). Many of these agents are acquired vertically or horizontally within the first week of life, often causing permanent immunosuppression. Early lymphoid organ development can be impacted by nutritional deficiencies. Marsh et al. (1986) demonstrated that experimentally induced dietary deficiencies of vitamin E and selenium can impair bursal development. Environmental factors that affect immunocompetence have recently been reviewed by Dietert and Golemboski (1994). Of particular importance to the young chick is the amount of time spent in the hatcher. Wyatt et al. (1986) reported that holding chicks in the hatcher for 30 h post hatching had significant detrimental effects on both bursa and spleen weights and increased the severity of vaccine reactions. Finally, experimentally induced immunosuppression by cyclophosphamide (Misra and Bloom, 1991) and testosterone (Olah et al., 1986) have been well documented.

Mucosal Gut Immunity Nonspecific immune defenses Although no specific markers for NK cells have been identified in the chicken, numerous reports state that cells possessing NK-like activity do exist (Fleischer, 1980; Leibold et al., 1980; Sharma and Okazaki, 1981; Chai and Lillehoj, 1988). These cells have been isolated from the intestine, bursa, spleen, thymus and peripheral blood. NK-like activity increases with age and does not reach adult levels until approximately 6 weeks post hatching, depending upon the genetic lineage (Lillehoj and Chai, 1988). Yamada and Hayami (1983) reported that ~-fetoprotein in quail or chicken amniotic fluid stimulated suppressor cells which then reduced NK activity. In another report, injection of thymulin caused a reduction in NK activity in chickens that were infected with MDV (Quere et al., 1989). NK cell activity may be important in the resistance to MDV (Sharma, 1981), a disease commonly acquired in the early post hatching period. Cells of the monocyte/macrophage lineage form early in the development of the embryo, around day 3 (Comeir et al., 1986; Dieterlen-Lievre, 1989) and exhibit enough function to respond to some bacterial pathogens during the second week of incubation (Klasing, 1991). The availability of specific antibody and/or complement can be a limiting factor in early embryonic macrophage responsiveness, and the rapid immunologic response to certain pathogens immediately post hatching has been associated with an increase in complementavailability (Powell, 1987; Klasing, 1991).

Embryo vaccination Chicken embryo vaccination is unique as it is the first widespread commercial use in any species of prenatal vaccination. The concept was initially devised by Sharma and Burmester (1982) to protect chicks from virulent MDV exposure that occurred too early for adequate protection by conventional at-hatch vaccination. Vaccination of 18day-old embryos with turkey herpesvirus (HVT) protected 80-90% of chicks from challenge-exposure to virulent MDV at 3 days post hatching compared with 16-22% of chicks vaccinated at hatch with HVT. No deleterious effect on hatching was observed in these trials. Timing of vaccination was critical because embryos inoculated with HVT prior to ED 16 sustained extensive embryonic and extraembryonic tissue damage (Longenecker et al., 1975; Sharma et al., 1976). Embryo vaccination also has the additive benefits of ensuring the precise delivery of vaccines to each individual and of labor savings via automation of the delivery system. Experimental vaccination in chickens has been successful for infectious bronchitis virus (Wakenell and Sharma, 1986) and IBDV (Sharma, 1985) alone or in combination with HVT, and HE and Newcastle disease virus (NDV) in turkeys (Ahmad and Sharma,

105

1993). The commercial use of embryo vaccination for protection against MDV (Sharma et al., 1995) is widespread, with 75-80% of all commercial broilers being vaccinated embryonically.

Maternal antibodies IgM and IgA are located in the amniotic fluid, thus swallowing by the embryo corresponds to colostrum ingestion in mammals (Rose et al., 1974), although minimal transfer occurs. IgG is found in the yolk and begins to be absorbed in the late stages of embryonic development until shortly after hatch (Kowalczyk et al., 1985; Powell, 1987). Failure of absorption can affect transfer of maternal immunity and results in an immunocompromised chick. Chick IgG half-life is approximately two times that of the adult bird in order to compensate for the time it takes to fully absorb the yolk. Serum IgA appears at approximately 10 days old and IgM at 4 days old. The amount of antibody transferred from hen to chick can vary with the age of the hen and the point of time in lay, and also with the titer level in the hen's serum. Increasing a hen's serum titer will not necessarily stimulate a corresponding degree of increase in titer in the embryo (P. S. Wakenell, unpublished data). Although maternal antibodies provide variable degrees of protection against pathologic organisms (Powell, 1987), interference with certain embryonic or at-hatch vaccines can be substantial. Of particular importance to the commercial industry is IBDV infection where vaccination of hens results in transfer of high levels of maternal antibodies to their progeny (Wyeth and Cullen, 1976; Wood et aI., 1981; Naqi et al., 1983). Although these antibodies are fairly effective in protecting the chick until approximately 21 days post hatching, interference with initial vaccination will often completely prevent development of active immunity; therefore predicting the timing of IBDV vaccination can be difficult (Solano et al., 1986).

11.

Mucosal Gut Immunity

Introduction In chickens, as in mammalian systems, there exists a separate mucosal immune system that exhibits a number of unique features, including antigen-presenting cells, immunoregulatory cells, and effector cell types, that are distinct from their counterparts in the systemic immune system (reviewed in Lillehoj, 1996). It is now widely accepted that the common mucosal immune system consists of two separate but interconnected compartments: mucosal inductive sites, which include the nasal-associated and gut-associated lymphoid tissues strategically located where they encounter environmental antigens, and

106

AVIAN IMMUNOLOGY

mucosal effector sites, which include the lamina propria (LP) of the intestine and the upper respiratory tract (reviewed by McGhee et al., 1989).

Table IV.11.1 Percentage composition of intestinal intraepithelial and caecal tonsil lymphocytes of 6- to 8-week-old White Leghorn chickens

The gut-associated immune system

Cell a type

Intraepithelial and lamina propria lymphocytes The gut-associated lymphoid tissue (GALT) in chickens include organized lymphoid structures such as the bursa of Fabricius, cecal tonsils (CT), Peyer's patches (PP), Meckel's diverticulum and lymphocyte aggregates scattered along the intraepithelium and LP of the gastrointestinal tract. The bursa of Fabricius, a hollow oval sac located dorsally to the cloaca, is the central lymphoid organ for Bcell lymphopoiesis and lymphocyte maturation, where generation of antibody diversity occurs (reviewed by Ratcliffe, 1989). The CT are discrete lymphoid nodules located at the proximal ends of the ceca near the ileocoIonic junction (Befus et al., 1980). The CT contain central crypts, diffuse lymphoid tissues, and germinal centers (Glick et al., 1981). Both T and B cells are present in the germinal centers; plasma cells expressing surface IgM, IgG and IgA are also located in the CT (Jeurissen et al., 1989). The function of CT is unknown, but active uptake of orally administered carbon particles has been shown, suggesting a role in antigen sampling (Befus et al., 1980). The PP are lymphoid aggregates in the intestine which possess a morphologically distinct lymphoepithelium with microfold (M) cells, follicles and a B-cell-dependent subepithelial zone and a T-cell-dependent central zone; they possess no goblet cells (Owens and Jones, 1974; Befus et al., 1980). The PP represent the major inductive site for IgA responses to pathogenic microorganisms and ingested antigens in the gastrointestinal tract. The PP and CT of chickens are easily identified at 10 days post hatching (Befus et al., 1980). As the birds age, the intestinal lymphoid aggregates undergo involution such that by 20 weeks, the lymphoid follicles become less distinct and fewer in number and there appear to be a relative depopulation of the subepithelial zone in both the CT and PP. The PP can be identified in the intestine by day I or 2 and increase to a maximum at 5-16 weeks old. Their number then decreases through morphological involution and at 52 and 58 weeks old, only a single PP is evident in the ileum anterior to the ileocecal junction. The Meckel's diverticulum is a remnant of the yolk on the small intestine, and usually persists as a discrete structure for the lifetime of the chickens. The exact function of this lympho-epithelial structure is not known but it contains germinal centers with B cells and macrophages (Befus et al., 1980). Within the gastrointestinal mucosa, intestinal lymphocytes are present in two anatomic compartments: the epithelium (intra-epithelial lymphocytes, IEL) and the lamina propria (lamina propria lymphocytes, LPL). The

~fiTCR 75TCR CD3

CD8 CD4

Intraepithelial lymphocytes b (percentage) Duodenum

Jejunum

Caeca

33 32 72 37 ND

33 33 69 25 7

37 19 62 28 ND

apercentage refers to positive cells compared with total number of viable lymphocytes. bCells were isolated by treating intestinal tissue segments with dithiothreitol followed by EDTA in Ca 2+ and Mg2+ free Hanks balanced salt solution.

composition oflEL and CT is shown in Tables IV.11.1 and IV.11.2. The predominant subset of IEL T lymphocytes expresses the CD3 polypeptides (7, 6, ~, and ~') noncovalently associated with the ~,6 chain receptor heterodimer of the antigen specific T cell receptor (TCR) (Bucy et al., 1988). Another subset of T lymphocytes expresses the CD3 polypeptide chains in association with the ~fl chain receptor. Among the 85% of blood T cells that are CD3 +, 16% are TCR76 + (Sowder et al., 1988). TCR76 + cells in the blood and the thymus lack both CD4 and CD8 molecules and most of the TCR76 + cells, which are localized in the splenic sinusoids and in the intestinal epithelium, express the CD8 homologue (Bucy et al., 1988). The changes in Tlymphocyte subpopulations in the intestine reflect agerelated maturation of the GALT (Lillehoj and Chung, 1990). The ratios of TCR76 to TCR~fl cells in intraepithelium and the lamina propria in SC chickens were 0.96 and 1.23 respectively at 8 weeks and 4.29 and 2.15 respectively at 12 weeks. Jejunum CD8 + IEL increase gradually until 4-6 weeks old and subsequently decline as chickens age. CD4 + cells represented a minor subpopulation among the IEL. The percentages of TCR76 + to TCR0~fi + T cells in

Table IV.11.2 caecal tonsil

Percentage of lymphocyte subpopulation in

Caecal tonsil b (percentage)

Cell a type

3 weeks

7 weeks

75TCR ~,6TCR CD3

11-13 37-50 51-54

CD4

23-29

13-14 48-52 47-60 24-26 24-31

CD8

19-29

apercentage refers to positive cells compared with total number of viable lymphocytes. bCells were prepared by gentle homogenization through a stainless steel mesh.

Mucosal Gut Immunity

newborn and adult White leghorn chickens showed that the numbers of these cells in IEL do not reach adult levels until 4-5 weeks after hatching (Lillehoj and Chung, 1990). The composition of various T-cell subpopulations in the intestine depended upon host age, the regions of the gut examined and host genetic background. Germinal centers seen in the cecal tonsil contain scattered TCR0~fl+, CD4 + cells, but no TCR78 + cells (Bucy et al., 1988). Neither subset is present in the intestinal mucosa at hatching, and only occasional TCR78 + or TCR~fi + cells are seen in the intestine of 3-day-old chicks. By 6 days post hatching, both subsets are present and the number of these cells reach adult levels by 1 month old. A third type of cell mediating intestinal immunity is the NK cell. NK cells constitute a population of non-T, non-B, nonmacrophage mononuclear cells with characteristic morphology that are capable of spontaneous cytotoxicity against a wide variety of syngeneic, allogenic, and xenogeneic target cells (Herberman, 1978). NK cell activity has been demonstrated in the spleen and peripheral blood, thymus, bursa and intestine (Chai and Lillehoj, 1988; Lillehoj and Chai, 1988). Great variability in cytotoxic potential has been observed among NK cells from different lymphoid organs. Furthermore, a substantial strain variation in NK cell activity has also been demonstrated (Chai and Lillehoj, 1988). NK cell activity increases with their age and their cytotoxic potential is not fully developed until 6 weeks after hatching (Lillehoj and Chai, 1988). There is much confusion about the phenotypic characterization of chicken leukocytes mediating natural cytotoxicity. A unique IEL subpopulation, termed TCR0 cells, showing cytoplasmic CD3 and lacking surface TCR/CD3 complex, which was detected mainly in the intra-epithelium where most express CD8 antigen (Bucy et al., 1990), show cytotoxicity against NK susceptible target cells in chickens (reviewed by Kasahara et al., 1994).

Cytokines in the intestine Growth stimulatory and growth inhibitory autocrine growth factors are potential modulators of intestinal epithelial cell growth. Transforming growth factor-beta (TGF-fl) has been shown to potently inhibit normal epithelial cell growth and modulate differentiation in several cell types, including bronchial epithelial cells, osteoblasts, adrenocortical cells and myoblasts, among others (reviewed by Roberts and Sporn, 1990; Massague, 1990; Sporn and Roberts, 1990). Three different isoforms of TGF-fi including TGF-fi2, 3 and 4 have been identified in the chicken (Jakowlew et al., 1988a, 1988b, 1990). Expression of the mRNAs for TGF-fl2, 3 and 4 can be detected in the intestine by day 8 of embryogenesis, and expression of TGF-fl4 mRNA, in particular, appears to increase steadily with development of this tissue. Because expression of TGF-fl4 protein detected by immunohistochemical staining is prominent in the tips of intestinal

107

villus by day 19 of embryogenesis, it is possible TGF-fl4 may play a role in modulating growth of the intestinal villus. Further studies will be necessary to investigate biological relevance of the TGF-fl mRNAS in the embryonic development of intestine in the chicken. Effector functions associated with GALT The roles of various components of GALT in host defense against microbial infections has been extensively studied (Brandzaeg et al., 1987). Three general functions of gutassociated immune system include: (1) processing and presentation of antigen, (2_)production of local antibodies, and (3) activation of cell-mediated immunity. In chickens, IgA and IgM are the predominant immunoglobulins in the external intestinal secretions. Although IgG is found in the gut, it is believed to be derived from the circulation or leaked from the lymphatics following permeability changes which occur during infection. Secretory IgM, which is pentameric, is effective in elimination of microbes. However, several distinctive features are important for IgA to function as a secretory antibody. One is the ability of IgA monomer to polymerize. Other properties of secretory IgA are its ability to associate with a 15 kDa peptide-joining (J) chain and a 70 kDa protein, the secretory component (SC) produced by epithelial cells. The IgA-SC complex is internalized in endocytic vesicles, transported across the cytoplasm and exocytozed onto the external surface of the epithelium. A functional homologue of mammalian SC has been described in chickens (Parrard et al., 1983). A minor source of IgA in secretions is derived from blood via the hepatobiliary IgA transport system. In contrast to the transepithelial IgA pathway, hepatocytes express a specific receptor for blood IgA (Allen et al., 1987). Polymeric IgA injected into the blood was cleared into the bile in less than 3 h (Sanders and Case, 1977). The major functions of secretory IgA (slgA) include prevention of environmental antigen influx into internal body compartments, neutralization of viruses and microbial toxins and prevention of adherence to, and colonization of mucosal surfaces by microbial pathogens. Secretory antibodies may bind to the pathogen's surface and prevent binding to the epithelium by direct blocking, by steric hindrance, by induction of conformational changes or by reduction of motility. In this manner, microorganisms would be susceptible to the natural cleaning functions of the mucosae. Animals infected with Eimeria spp. produce parasite-specific antibodies in both the circulation and mucosal secretions (Trees et al., 1985; Lillehoj, 1987). Circulating antibodies consist of IgM, IgG, and IgA (Trees et al., 1985; Lillehoj and Ruff, 1986) whereas secretory IgA has been detected in bile and gut washings of infected animals (Lillehoj and Ruff, 1986). Challenge infection with Eimeria tenella or Eimeria acervulina did not elicit an anamnestic SIgA response (Lillehoj, 1987). Although antibodies are produced, in

108

vivo studies using hormonal and chemical bursectomy (Giambrone et al., 1981; Lillehoj, 1987) clearly indicated

that antibodies play a minor role in protection against coccidiosis (Lillehoj, 1987) and leukocytozoan parasites (Isobe et al., 1989). Cell-mediated immune responses include both antigenspecific and antigen nonspecific activation of various cell populations, including T lymphocytes, NK cells and macrophages. Although CTL activity has been demonstrated in the intestine of mammals, MHC-restricted IEL CTL activity has yet to be shown in chickens. The importance of T cells in immune responses to coccidia has been well documented (reviewed by Lillehoj and Trout, 1993, 1994). The number of duodenal IELs expressing the CD8 antigen increases in SC and TK chickens following primary infection with E. acervulina (Lillehoj, 1994). Following secondary infection, a significantly greater number of CD8 + IEL were observed in the SC chickens which showed a lower level of oocyst production compared with TK chickens. SC chickens showed increased TCR~fl +CD8 + cells following shortly after challenge infection with E. acervulina (Trout and Lillehoj, 1995). Furthermore, depletion of either CD8 + cells or TCR~fl + cells resulted in substantial increases in oocyst production following challenge E. acervulina infection in chickens (Trout and Lillehoj, 1996). These results suggest that a significant increase in TCR~fl +CD8 + IEL in SC chickens may reflect enhanced acquired immune status in these chickens compared with TK chickens. The observation that chicken intestinal IEL contain NK cells that mediate spontaneous cytotoxicity (Chai and Lillehoj, 1988) suggests that NK cells may play an important role in local defense. Positive correlations between NK cell activity and genetically determined disease resistance to coccidia (Lillehoj, 1989) have been noted. TGF-fll has been shown to inhibit the proliferation of T-lymphocytes (Kehrl et al., 1986). After infection with the coccidian parasite, expression of TGF-fi4 mRNAs increased in chicken intestinal intra-epithelial lymphocytes (Jakowlew et al., 1997). This increase in expression of TGF-fl4 in response to infection with the coccidian parasite is similar to the induction of TGF-fll in the mouse following infection with the protozoan parasites Leishmania braziliensis and T r y p a n o s o m a cruzi. In these parasitic infections, TGF-fll has been shown to influence the replication of these parasites in macrophages and acts to increase the intracellular replication of these parasites, thus providing a mechanism for these parasites to escape the immune protection system (Silva et al., 1991; BarralNetto and Barral, 1994; Barral et al., 1994). Whether TGFfl plays a similar role in coccidiosis may be determined in further studies. Cytokines and lymphokines have been shown to influence coccidial infections. Cell culture supernatant from Con A-stimulated lymphocytes was capable of inhibiting the replication of Eimeria parasites in MDBK cell cultures and reduced oocyst production following E. acervulina

AVIAN IMMUNOLOGY

and E. tenella infections in chickens (Lillehoj et al., 1989). Sporozoites and merozoites of E. tenella induced in vitro TNF-like factor production by normal peripheral blood derived macrophages (Zhang et al., 1995). Treatment of chickens with anti-TNF antibody resulted in a partial abrogation of E. tenella-induced body weight-loss in SC chickens but not in TK chickens (Zhang et al. 1995). Lymphocytes from Eimeria-infected chickens produced higher level of 7-IFN when induced with Con A compared with lymphocytes from uninfected chickens (Martin et al., 1994). Strain differences in Eimeria-induced 7-IFN production was observed (Martin et al., 1994). Although the exact role of these cytokines in coccidiosis needs to be further elucidated, this result may explain the severity of clinical signs associated with coccidial infection.

Conclusions

Intestinal immune responses to enteric pathogens that lead to protective immunity involve the complex interplay of soluble factors, leukocytes, epithelial cells, endothelial cells, and other physiological factors of the GALT. Different effector mechanisms may be involved depending on the type of enteric pathogens and on whether a primary or secondary response occurs. It is likely that these complex interactions have contributed to the difficulties in developing an effective vaccine against enteric pathogens. In contrast to mammals, limited information is available about the intestinal immune system of chickens. However, recent technical advances in molecular and cellular immunology will facilitate our understanding of the ontogeny, structure, and function of the GALT and may lead to new approaches to vaccination against enteric pathogens.

12.

Tumors of the Immune System

Introduction

Tumors involving lymphocytes and other cells of the avian immune system are frequently caused by viral agents. Five groups of viruses are associated with these tumors in domesticated birds (Table IV.12.1). Marek's disease (MD), caused by Marek's disease herpesvirus (MDV), and lymphoid leukosis (LL), caused by avian leukosis virus (ALV), are diseases of great economic importance for the poultry industry. Detailed information on the pathology, pathogenesis and virology of MD and LL is available in recent review articles by Calnek and Witter (1991, 1997), Payne and Purchase (1991) and Payne and Fadly (1997). Acute defective leukemia viruses (DLV) are of minor economic importance, but are of interest because they contain different onc genes (Enrietto and Hayman, 1987). Reticuloendotheliosis virus (REV) has recently


109

Table IV.12.1 Viral etiology of tumors of the immune system in domesticated birds Virus family

Virus

Serotypes/ subgroups

References

Herpesviridae

Marek's disease virus Marek's disease virus Herpesvirus of turkeys Avian leukosis virus (ALV)

Serotype 1 (MDV-1) Serotype 2 (MDV-2) a Serotype 3 (HVT)a (A) Exogenous, subgroups A-D, J

Acute defective leukemia virus (DLV)

(B) Endogenous, subgroup E a Several subgroups

Calnek and Witter (1991) Calnek and Witter (1991) Calnek and Witter (1991) Payne and Purchase (1991) Payne et al. (1991a, b) Payne and Purchase (1991) Payne and Purchase (1991) Enrietto and Hayman (1987) Biggs (1991)

Retroviridae

Lymphoproliferative disease retrovirus Unknown (LPDV) Reticuloendotheliosis virus (REV) (A) Nondefective (B) Defective

Witter (1991) Witter (1991)

aThese viruses are nononcogenic.

become an economically important pathogen in chickens; REV-induced diseases have recently been reviewed by Witter (1991, 1997). Lymphoproliferative disease virus (LPDV) is the cause of a lymphoproliferative disorder in turkeys (Biggs, 1991).

Natural and experimental hosts

Tables IV.12.2 and IV.12.3 list the natural and experimental hosts in which virally induced tumors of the immune system have been described.

Table IV.12.2 Phenotypic characterization of Marek's disease virus-induced lymphoid tumors in avian species Avian species

Natural/experimental infection

Target cells for transformation

References

Chicken

Natural

CD4+CD8-TCR~fi + and some other T cell subsets a

Japanese quail

Natural

Lymphocytes (T cells?)

Turkey

Experimental

CD4§ T cells, B cells

Calnek and Witter (1991) Schat et al. (1991) Pradhan et al. (1987) Imai et al. (1991) Nazerian et al. (1982) Powell et al. (1984) Schat et al. (1988)

aSee text for details.

Table IV.12.3 Mechanism of transformation and phenotypic characterization of immune cells transformed by avian retroviruses Virus

Host

Target cells

References

Transformation mechanism (Ref)

ALV

Chickens

Immature,/~+ B cells

Payne and Purchase (1991)

DLV LPDV

Chickens Turkeys Chickens Chickens Japanese quail Turkeys Duck species Pheasants Geese

Myelocytes Many cell types Pleomorphic cells Pleomorphic cells a Many cell types Pleomorphic cells Lymphoblastoid cells Lymphoblastoid cells Lymphoblastoid cells B cells (?)

Payne et aL (1991 b) Enrietto and Hayman (1987) Biggs (1991) lanconescu et aL (1983) See text Schat et al. (1976) McDougall et aL (1978) Li et al. (1983) Dren et aL (1983) Dren et al. (1988)

c-myc activation (Kung and Maihle, 1987) c-onc activation v-onc genes Unknown (Sarid et al., 1994) Unknown Defective REV: v-re/ Nondefective REV: c-myc activation (Swift et aL, 1985)

REV

a

Only after experimental infection.

110

AVIAN IMMUNOLOGY

T a r g e t cells for t r a n s f o r m a t i o n and pathogenesis

Target cells for transformation by MDV All MDV-transformed lymphocytes are T cells expressing class I and class II major histocompatibility complex (MHC) antigens, CD3, and TCR~fll or TCR~fl2. MD cell lines have also been established from C D 4 - C D 8 - or C D - C D 8 + T cells expressing CD3 + TCR~fil or TCR~fi2 (see below).

Pathogenesis of MD The pathogenesis of MD is summarized in Figure IV.12.1 (Calnek, 1985, 1986; Schat, 1987). The following sequential events lead to tumor formation in genetically susceptible strains of chickens: (1) cytolytic infection of B cells provokes inflammation and immune responses, including

MDV-infected cell (or "carrier" macrophoge ?)

/~

Infection of B-ceils but not

~~'~

( ~

T-cells become activated in response to early cytolytic infection

B(~ - ~

"

~

Cytolytic Phase

~

,~

.~~

.(•/-%

T-cells susceptible to MDV, undergo cytolytic

Activated

infection

a ,, ~o_l,--J

.

Latent Phase

.

.

from/cytolytic to infection

Jlatent

.

~ ~ /// ./ ~.

Unknownevent (viral DNA

~

.,,

_

Target cells for transformation by avian retroviruses In contrast to ALV, nondefective REV can transform both IgM-bearing B cells (Witter et al., 1981) and T cells (Witter et al., 1986) in chickens. The target cells for transformation by REV are poorly defined in species other than chickens, mainly because monoclonal antibodies (mAb) are not available for differentiation antigens on lymphoid cells in these species. Defective REV can transform many subsets of B and T cells and also cells from the myeloid series (Beug et al., 1981; Lewis et al., 1981; Chen et al., 1988; Barth et al., 1990; Schat et al., 1992; Marmor et al., 1993). DLV can also transform many different cells of the immune system, depending on the onc gene that is present in a specific DLV strain (Enrietto and Hayman, 1987).

Pathogenesis of retrovirus-induced tumors

Host response ( CMI ?) I wk PI.+/-- Causes switch

_~_

activation of T cells which then also become infected; (2) latency develops in both B and T cells coincident with early immune responses, perhaps due to the production of cytokines (Buscaglia and Calnek, 1988); (3) proliferation of latently infected T cells leads to an undefined change in the virus-host cell relationship which causes neoplastic transformation of the cell; and (4) permanent immunosuppression coincides with the second phase of cytolytic infection, impairing surveillance mechanisms and allowing tumor development. Activation of T cells by inoculation with MDV-infected, allogenic chick kidney cells results in transformation of additional subpopulations of T cells (Calnek et al., 1989). The MDV genome has not yet been completely sequenced and, as a consequence, the molecular basis for transformation by MDV has not yet been elucidated.

.~!ntegration ?)-~t.u~ causes neoplastic transformation

& proliferation

Figure IV.12.1 Schematic representation of sequential events in lymphocyte infections with MDV leading to the formation of tumors. From Calnek, B. W. (1985). Pathogenesis of Marek's disease- a review. In International Symposium on Marek's Disease (eds Calnek, B. W., Spencer, J. L.), pp. 374-390. AAAP, Kennett Square, PA, USA. Reproduced with permission of the American Association of Avian Pathologists.

Two mechanisms of transformation are used by avian re'troviruses to transform cells. Defective viruses carry an onc gene, which replaces one or more of the genes required for viral replication. As a consequence these viruses require a helper virus for their replication. The v - o n c gene is inserted into the genomic DNA under control of the viral long-terminal repeat (LTR), and the v - o n c protein is directly involved in the transformation of the cell. Tumors usually develop after a short incubation period, especially after inoculation with the defective REV-T strain. The v-rel oncogene of REV-T is a repressor of the NF-tcB transcription factor complex and probably functions by a direct nuclear blockade of the tcB enhancer (Walker et al., 1992). The nondefective ALV and REV transform lymphoid cells by insertion of the viral LTR in the c - m y c region (Kung et al., 1992). The 3' LTR is responsible for the transcription of c - m y c in B-cell lymphomas (Boerkool and Kung, 1992). Retrovirus LTRs contain many enhancer and promoter elements, some of which can be influenced by infection with MDV-2 (Table IV.12.1), leading to

Autoimmunity in Avian Model Systems

Table IV.12.4 REV a

111

Effects of viral replication (R) or tumor cells (T) on immune functions in chickens infected with MDV, ALV, or

Virus

R or T

T cells

B cells, and antibodies (Ab)

MDV

R

Thymic atrophy

Bursa atrophy Ab production

T R/T R/T

Mitogen responses (MR): transient MR: permanent .UTolerance to ALV proteins c MR: g

ALV REV

See above Tolerance to ALV proteins c Ab production 4~ Tolerance to REV proteins c

Macrophages

NK cells

Suppressor macrophages 1}

Lysis of LSCC-RP9 1~

-Suppressor macrophages 1} (?)

Lysis of LSCC-RP9 4~b

aFor references see Schat (1996). b Probably caused by c~-fetal protein or chicken fetal antigens. CAfter in ovo infection or infection of immunoincompetent chicks. 1}, increased activity; 45, decreased activity.

enhanced transcription (reviewed by Ruddell, 1995). This enhanced transcription could explain the augmentation of LL in chickens infected with the MDV-2. The pathogenesis of tumor development has been reviewed by Neiman (1994). Briefly, 4-8 weeks post infection bursal follicles containing preneoplastic stem cells can be observed. These cells have an increased expression of m y c and will give rise to bursal lymphomas, which will eventually migrate from the bursa causing metastatic tumors.

Effects of t u m o r s on the i m m u n e function

The effect of tumors on the immune functions have been examined mostly in chickens (reviewed by Schat, 1996). Table IV.12.4 summarizes the immunosuppressive effects of infection and tumor development on immune functions. Unfortunately, there is a paucity of detailed information on the functional consequences of subsets of lymphoid cells affected by the tumors. There is also a lack of knowledge on the mechanism(s) causing immunosuppression at the molecular level.

Table IV.13.1

13.

Autoimmunity in Avian Model Systems

Autoimmunity arises when the immune system inappropriately begins to react to self. In chickens, as in humans, many independent genetic and environmental factors must be present for severe disease to develop. Primarily, the immune system must be capable of reacting against an autoantigen. Tolerance is maintained through several mechanisms including clonal deletion in the thymus and clonal inactivation both in the thymus and in the periphery. Thus, MHC haplotype and any deviation in the regulation of lymphoid development can contribute to the activation of autoreactive cells. In the case of organ specific autoimmunity, there are very often defects in the target tissue which facilitate immune infiltration. Three spontaneous models of autoimmune disease in chickens exemplify this paradigm (Kaplan et al., 1991; Table IV.13.1). The Obese strain (OS) chicken develops an autoimmune thyroiditis which in many ways is similar to Hashimoto's disease in humans. UCD line 200 chickens develop a condition which resembles scleroderma. Finally, the Smyth-DAM (delayed amelanosis) line chicken has a progressive loss of retinal and feather pigmentation similar to vitiligo. These three strains have been studied exten-

Defects associated with avian autoimmune diseases

Strain

Immune defect

Target organ/pathology associated defect

Obese strain

T-cell hyperactivity Anti-thyroglobulin antibodies T-cell hypoactivity Deficiency in thymic architecture Antibodies to Ig, ssDNA, type II collagen B-cell hyperactivity Antimelanocyte antibodies

Sensitivity to iodine-mediated thyroid infiltration

UCD line 200 Smyth-DAM line

Hyperactive fibroblast Hyperactive melanocyte

112

sively for their utility in understanding the genesis of autoimmune attack, something that cannot be done using induced models. The OS chicken thyroiditis is characterized by extensive mononuclear cell infiltration of the thyroid three to five weeks after hatching (Wick et al., 1970a, b). By 7 weeks the thyroid is completely destroyed. Immune attack is accompanied by high titers of antithyroglobulin antibodies (Polley et al., 1981; Bagchi et al., 1985). While transfer of these antibodies can affect disease severity (Jaroszewski et al., 1978), infiltration is mediated by T cells (Pontes de Carvalho et al., 1981). The infiltrate is composed of activated ~/3 TCR-positive T cells, plasma cells and macrophages (Kr6mer et al., 1985; Cihak et al., 1995) and have a higher percentage of CD8-positive cells than is seen in the periphery (Bagchi et al., 1995). Several genetic lesions which affect immune responses have been found in OS chickens. OS lymphocytes are hyperactive in response to the T-cell mitogen concanavalin A, and demonstrate increased T-cell growth factor secretion and surface expression of activated T-cell markers (Livezey et al., 1981; Schauenstein et al., 1985). OS birds also have increased levels of corticosterone-binding globulin, which results in decreased levels of circulating corticosterone and could contribute towards increased immune responses in vivo (F~issler et al., 1988). Furthermore, OS chickens fail to show a transient increase in corticosterone following immunization- a defect which maps to the hypothalamohypophyseal axis (Schauenstein et al., 1987). However, none of these defects strictly correlate with disease occurence in breeding analysis (Neu et al., 1985, 1986; Kr6mer et al., 1989). There has also been some suggestion of a generalized defect in thymic development in the OS chicken, although this has not been studied extensively (Welch et al., 1973; Jakobisiak et al., 1976). Analysis of OS thyroid function showed a decreased susceptibility to thyroxine-mediated suppression of radioiodide uptake and organification (Sundick et al., 1979). This thyroid-stimulating hormone (TSH) autonomy is shared with the Cornell strain (CS) chicken, which develops mild thyroiditis at a low frequency compared with the OS. TSH autonomy is not due to thyroid-stimulating antibodies (Sundick and Wick, 1974). Additional studies of embryonic thyroid cells demonstrated that OS cells had decreased proliferation and function in culture, which likely result from a lack of autocrine growth factor secretion (Truden et al., 1983). It is not clear, however, that either of these phenotypes has a relationship to disease. In contrast, there is a definitive role for iodide in disease progression. Large population studies of CS chickens correlated increased dietary iodide with increased disease incidence, severity and autoantibody production (Bagchi et al., 1985). Thyroidal iodine is also crucial for the development of OS thyroiditis. A treatment regimen consisting of potassium perchlorate (to inhibit active transport of iodine) and mononitrotyrosine (to promote the loss of iodotyrosines) starting in ovo and continued

AVIAN IMMUNOLOGY

past hatching, decreased thyroid infiltration to 2% of control levels and decreased antithyroglobulin antibody titers for as long as 9 weeks (Brown et al., 1991). Other antithyroid drugs such as propylthiouracil and aminotriazole also decreased disease severity. This suggests that iodine is important for the immunogenicity of thyroglobulin (Tg), which is the target of autoimmune attack. Indeed, highly iodinated Tg is a better immunogen (Sundick et al., 1987). However, OS chickens make Tg with a slightly lower than normal iodide content and their autoantibodies to Tg react equally well with high or low iodide Tg (Sundick et al., 1987). Since iodination of other proteins in the OS thyroid cannot be detected (Sundick et al., 1991), it is likely that iodine plays an additional role distinct from the generation of an autoimmune epitope. In support of this, studies have shown that treatment of OS birds with antioxidants decreases disease severity and can inhibit initial immune infiltration (Bagchi et al., 1990). The potential role of iodide or oxygen-free radicals which specifically lead to disease in the OS are currently being studied. The University of California, Davis (UCD) line 200 chicken develops a scleroderma like syndrome with symptoms very similar to those seen in human scleroderma (Gershwin et al., 1981). Between 3 and 5 weeks after hatching birds develop comb lesions, polyarthritis and dermal lesions (Gershwin et al., 1981). There is also a high rate of mortality in this line. Dermal pathology shows an intense mononuclear infiltrate composed largely of activated T cells (van de Water et al., 1989) which are skewed towards CD8 cells. During infiltration, small vessels proliferate and fibroblasts migrate into the dermis leading to extensive collagen deposition, which in turn causes thickening and occlusion of blood vessels (Gershwin et al., 1981). A large percentage of the flock characteristically has rheumatoid factor and autoantibodies to type II collagen, ssDNA and additional nuclear and cytoplasmic antigens by six months of age (Gershwin et al., 1981; Haynes and Gershwin, 1984). In contrast to the OS chicken, the UCD line 200 birds have a hyporesponsive immune system. Lymphocytes show a decreased response to T-cell growth factor, concanavalin A and anti-CD3 (van de Water et al., 1990; Wilson et al., 1992). Within the thymus there is evidence of a developmental defect in subcapsular thymic epthelium and increased MHC class II expression, particularily in the thymic cortex (Boyd et al., 1991). Identifying target organ defects is difficult in this system because many of the autoantigens are widely distributed in the organism. Furthermore, the skin is a diverse organ and many defects could contribute towards autoimmune attack. It has been shown that fibroblasts from UCD line 200 birds are activated and secrete increased amounts of collagen and glucosaminoglycan (Duncan et al., 1992). This phenotype is dependent on factors secreted by T cells in the dermal infiltrate and is probably responsible for a considerable portion of disease pathology (Duncan et al., 1995).

Concluding Remarks

The Smyth-DAM line chicken has a high incidence of feather and retinal pigmentation loss which is phenotypically similar to the human disease vitiligo (Smyth et al., 1981). DAM autoimmunity is strongly correlated with both T- and B-cell activity. B-cell hyperactivity has been documented following immunization (Lamont et al., 1982). Furthermore, there is a correlation between levels of antimelanocyte antibody and disease incidence (Lamont and Smyth, 1981; Austin et al., 1992). T cells with a low CD4:CD8 ratio are found infiltrating the feather pulp (Erf et al., 1995). Treatment of DAM chickens with immunosuppresive agents such as cyclosporin A decreases amelanosis (Pardue et al., 1987), although the condition was shown to worsen following discontinuation of the treatment. Pathogenesis in this model appears to be mediated by specific destruction of melanocytes in the feathers and retinas of the birds (Austin et al., 1992). Indeed, a melanocyte-specific defect has been identified. DAM melanocytes display hypermelanogenesis and have increased tyrosinase activity (Boissy et al., 1986). This is of specific interest because DAM autoantibodies detect a tyrosinase related protein (Austin and Boissy, 1995). DAM sera also detect both cell surface and cytoplasmic antigens from isolated melanocytes (Austin et al., 1992; Searle et al., 1993). However, it has not been demonstrated directly that these antibodies are the cause of the disease. These systems create a novel view of autoimmunity. One trend that appears is the role for a specific T-cell subset in disease pathology. Studies of all three strains show increased percentages of CD8 cells at the sites of infiltration compared with peripheral blood and that CD4:CD8 ratios skew even further towards CD8 as disease progresses. Furthermore, these T cells are ~fi TCR-positive, despite a large percentage of ~;8 T cells in chicken peripheral blood. Whether these cells are specific for autoantigens and how they play a role in disease pathogenesis remains to be determined. Despite evidence of immune dysregulation in all three strains, autoimmunity is limited to specific target sites. Attempts to induce autoimmunity in organs other than the normal site of pathology have shown no significant differences in tissue infiltration between normal and autoimmune-prone chickens. Thus, the presence of immune dysregulation itself is not sufficient for the development of a tissue-specific autoimmune condition. These systems establish the requirement for multiple genetic defects in the development of autoimmune disease in chickens.

14.

Effect of Viruses on Immune Functions

The intensive rearing conditions of commercial poultry operations provides an environment conducive to the selection and spread of infectious agents. Numerous

113

viruses, many of which are highly virulent, are endemic in most of the world's poultry-producing areas. In the face of these virulent viruses, routinely used vaccines are often ineffective in providing an acceptable level of protection against clinical disease, death, and virus shedding. In addition to these direct effects of virus infection, a number of avian viruses are capable of causing immunosuppression. Immunosuppression has great economic significance for the commercial poultry industry because affected flocks are susceptible to opportunistic infections, respond poorly to vaccines, and generally perform less well than unaffected flocks. This section attempts to summarize information on some common immunosuppressive viruses in poultry and it is not intended to be a comprehensive summary of the literature.

Effect of viruses on immune functions

See Tables IV.14.1 and IV.14.2.

15.

Concluding Remarks

Availability of reagents particularly monoclonal antibodies that can identify antigens in avian cells and cell products have facilitated significant advances in the knowledge of avian immunology. The avian immune system conforms to the basic immunologic mechanisms identified in mammals. As in mammals, chicken T cells have two antigen-binding receptors, i.e., TCR~fl and TCRTdi. There is a higher frequency of ~;ST cells in birds than in mammals. Further, in the chicken, the TCRfl locus has two V fl families recognized by two different monoclonal antibodies. The TCR2 antibody recognizes V~I family and TCR3 antibody recognizes Vfi2 family. Chicken B cells produce IgM, IgG (or IgY) and IgA. The mechanism of attaining diversity in the variable region of Ig is different from that in mammals. In the chicken, rearrangement does not generate adequate diversity because both heavy and light chains of Ig have only one functional V and J gene segment. Much of the diversity is attained by somatic gene conversion by incorporating copies of regions from nonfunctional pseudogenes into rearranged Ig genes. The molecular mechanism(s) of gene conversion needs to be elucidated. The process of gene conversion and hence acquisition of Ig diversity occurs in the bursa. Thus, the bursa, an organ that is unique to birds, is essential for normal ontogeny of the B-cell system. Studies on the characteristics and functions of the cells of the monocyte/macrophage lineage have lagged behind those conducted on lymphocytes and await the development of appropriate reagents. The MHC in chickens is designated as B complex, which consists of three major loci, i.e., B-F (equivalent of class I MHC), B-L (equivalent of class II MHC) and B-G

114

AVIAN IMMUNOLOGY

Table IV.14.1 Immunosuppressiveviruses

Lymphoid organs

Bursa

Thymus Spleen B-cell functions

Number Antibody production

T-cell functions

Number CD4:CD8 ratio

In vitro proliferation

Cutaneous hypersensitivity Graft rejection Tumor rejection Natural killer cell functions

Activity

Soluble mediator production

Interferon Interleukin-2 Suppressor factors Suppressor cell induction

Response to extraneous vaccines Secondary infection susceptibility

Marek's disease virus (DNA)

Hemorrhagic enteritis virus (DNA)

Atrophy (Adldinger and Calnek, 1973; Payne and Rennie, 1973; Frazier, 1974) Atrophy (Adldinger and Calnek, 1973; Payne and Rennie, 1973; Frazier, 1974) Splenomegaly (Adldinger and Calnek, 1973; Payne and Rennie, 1973; Frazier, 1974) Cytolytic and latent infection of B cells (Shek et aL, 1983; Calnek et aL, 1984) Reduced (Zhonggui et aL, 1996)

Splenomegaly (Gross and Dommermuth, 1975)

Reduced (Purchase et aL, 1968; Burg et aL, 1971; Evans etaL, 1971; Jakowski, 1973; Payne et aL, 1976; Yamamoto et aL 1995; Cui and Qin, 1996) Decreased (Zhonggui et aL, 1996) Reduced (Yamamoto et aL 1995; Morimura et aL, 1996); Increased (Lessard et aL, 1996) Reduced (Burg et aL, 1971 ; Aim et aL, 1972; Lu and Lapen, 1974; Theis et aL, 1975; Lee et aL, 1978a; Schat et aL, 1978; Powell, 1980; Theis, 1981; Liu and Lee, 1983; Quere, 1992; Lessard et aL, 1996; Morimura et al., 1996; Zhonggui et aL, 1996) Reduced (Rusov et al., 1996)

Reduced due to lytic infection (Suresh and Sharma, 1995, 1996) Reduced (Nagaraja et aL, 1982b)

Unchanged (Suresh and Sharma, 1995) Increased in acute infection, decreased in chronic infection (Suresh and Sharma, 1995) Reduced in acute infection (Nagaraja et al., 1982a, 1985)

Delayed (Purchase et aL, 1968) Delayed (Calnek et aL, 1975, 1978) Reduced by the presence of tumor cells (Heller and Schat, 1985) Enhanced (Lessard et aL, 1996) Enhanced in resistant chickens and reduced in susceptible chickens (Sharma, 1981) Enhanced at the site of the tumor (Sharma, 1983) Induced (Sharma, 1989) Reduced (Zhonggui et aL, 1996) Present (Bumstead et aL, 1985; Bumstead and Payne, 1987) Reduced embryonal suppressor cells (Sharma, 1988) Macrophages (Lee et aL, 1978a, b; Theis, 1981) Suppressor or transformed T cells (Theis et aL, 1975; Theis, 1977, 1981; Quere, 1992) Enhanced early/reduced late (Lessard et aL, 1996) Increased (Biggs et aL, 1968)

Reduced NDV efficacy (Nagaraja et aL, 1985) Increased incidence of colibacillosis (Domermuth and Larsen, 1984; Sponenberg et aL, 1985; van den Hurk et aL, 1994)

Concluding Remarks

115

Table IV.14.2 Immosuppressive viruses Chicken anemia (DNA)

Infectious bursal disease (RNA)

Reovirus (RNA)

Bursa

Atrophy (Goyro et aL, 1989; Lucio et aL, 1990; Cloud et aL, 1992a)

Transient atrophy (Montgomery et aL, 1986)

Thymus

Atrophy (Goyro et aL, 1989; Lucio et aL, 1990; Cloud et aL, 1992a; Jeurissen et aL, 1992a, b)

Atrophy and lymphocyte depletion (Helmboldt and Garner, 1964; MQIler et aL, 1979; Ley et aL, 1983; Ezeokoli et al., 1990; Ramm et aL, 1991) Atrophy (Cheville, 1967; Mazariegos et aL, 1990; Sharma et aL, 1993; Inoue et al., 1994)

Lymphoid organs

Spleen B-cell functions

Number

Unchanged (Cloud et al., 1992a)

Antibody production

Unchanged (Goodwin et aL, 1992)


Increased in spleen, decreased in peripheral blood (Cloud et al., 1992b)

T-ceil functions

Number

Decreased cytotoxic T cell number in spleen and thymus (Cloud et aL, 1992a; Bounous et aL, 1995)

CD4:CD8 ratio

Increased in spleen and thymus (Cloud et al., 1992a) Reduced in acute infection (Adair et aL, 1991 ; Cloud et al., 1992b; Bounous et aL, 1995)


Graft rejection

Reduced due to lytic infection (Hudson et aL, 1975; Hirai et al., 1979; Hirai and Calnek, 1979; Nakai and Hirai, 1981 ; Sivanandan and Maheswaran, 1981 ; MQIler, 1986; Becht and Meller, 1991 ; Rodenberg et aL, 1994) Reduced (Ivanji, 1975; Ivanji and Morris, 1976; Hirai et aL, 1979; Hopkins et aL, 1979; Sharma et al., 1989; Craft et aL, 1990) Reduced (Sivanandan and Maheswaran, 1980b)

Unchanged (Hirai et al., 1979; Cloud et al., 1992a; Rodenberg et aL, 1994). Reduced if birds infected prior to 3 weeks old, enhanced if infected after 3 weeks old (Sivanandan and Maheswaran, 1980a) Unchanged (Rodenberg et aL, 1994) Reduced in acute infection (Sivanandan and Maheswaran, 1980b; Confer et aL, 1981 ; Confer and MacWilliams, 1982; Sharma and Lee, 1983; Montgomery et aL, 1986; Sharma and Fredrickson, 1987; Nusbaum et al., 1988) Increased time (Panigrahy et aL, 1977) or unchanged (Hudson et al., 1975; Giambrone et aL, 1977)

Transient atrophy (Montgomery et aL, 1986) Splenomegaly (Kerr and Olson, 1969; Tang et al., 1987a, b)

Reduced (Rinehart and Rosenberger, 1983)

Unchanged in spleen/reduced in peripheral blood in acute infection (Pertile, 1995)

Unchanged (Pertile, 1995) Reduced in acute infection (Rinehart and Rosenberger, 1983; Montgomery et aL, 1986; Sharma et al., 1994; Pertile et aL, 1995, 1996)

(continued)

116

AVIAN IMMUNOLOGY

Table IV.14.2 Continued Chicken anemia

Infectious bursal disease

Reovirus

Natural killer cell functions

Number

Activity

Reduced in acute infection (Bounous et aL, 1995)

Macrophage functions

Number

Nitric oxide production Phagocytosis Bactericidal activity Fc expression

Reduced (McConnell et aL, 1993a, b) Reduced (McConnell et aL, 1993a, b) Reduced (McConnell et aL, 1993a, b)

Soluble mediator production

Interferon

Elevated early/decreased late (Adair et aL, 1991; McConnell et aL, 1993a, b)

Interleukin-1

Reduced (McConnell et aL, 1993a, b) Reduced in acute infection (Adair et aL, 1991 ; McConnell et aL, 1993b)

Interleukin-2 Suppressor factor(s) Suppressor cell induction Response to vaccines

Secondary infection susceptibility

Reduced protection by MDV, NDV and ILT vaccines (Box et aL, 1988; Otaki et aL, 1989; Cloud et al., 1992a)

Unchanged (Sharma and Lee, 1983) Increased in spleen (Kerr and Olson, 1969; Tang et aL, 1987a, b; Pertile et aL, 1995) Increased (Sharma et aL, 1994; Pertile et aL, 1995, 1996) Reduced (Santivatr et aL, 1981) Unchanged (Pertile et aL, 1995)

Induced (Gelb et aL, 1979)

Produced (Sharma and Fredrickson, 1987) Suppressor macrophages (Sharma and Lee, 1983) Reduced vaccine efficacy (Allan et aL, 1972; Faragher et aL, 1974; Hirai et aL, 1974; Pejkovski et aL, 1979; Sharma, 1984; Ezeokoli et aL, 1990; Mazeriegos et aL, 1990; Higashihara et aL, 1991 ; Cloud et aL, 1992b) Increased (Cho, 1970; Wyeth, 1975; Fadley et aL, 1976; Anderson et aL, 1977; Rosenberger and Gelb, 1978; Pejokovski et aL, 1979; Yuasa et aL, 1980; Santivatr et aL, 1981 ; Sharma, 1984; Moradin et aL, 1990)

Enhanced production by attenuated virus/no change with pathogenic virus (Ellis et al., 1983a, b) Induces in vitro production by chicken embryo fibroblasts (Winship and Marcus, 1980) Reduced production by mitogen stimulated spleen cells/normal following macrophage removal (Pertile et al., 1996) Reduced, but normal following macrophage removal (Pertile et aL, 1996) Produced (Pertile, 1995) Suppressor macrophages (Pertile et aL, 1996) Reduced MDV vaccine efficacy (Rinehart and Rosenberger, 1983)

References

which does not have a mammalian equivalent. The function of the B-G locus in the chicken is not known. The chicken B complex participates in immune functions much like mammalian M H C and has been shown to influence disease resistance, tumor regression and immune responsiveness against certain antigens. Advances are being made in defining the molecular structure of the B complex. There is much current interest in avian cytokines. Although the genes for only a few avian cytokines have been cloned and expressed, a number of cytokines have been identified by their biological activity. The avian cytokines appear to be biological equivalents of mammalian cytokines and engage in similar immunologic and physiologic functions. The interest in avian cytokines results from their possible prophylactic and therapeutic use in poultry. Because commercial poultry populations receive multiple vaccinations against infectious disease, it is hoped that immunomodulating cytokines may enhance vaccinal protection and reduce the negative impact of immunosuppression. Cytokine genes vectored into fowl pox or herpes viruses are being tested for beneficial immunomodulatory effects. Vaccine delivery in commercial chicken populations is undergoing a dramatic change. Conventionally, the vaccines are administered in hatched chickens but now certain vaccines are being injected into embryonated eggs several days before hatch. Laboratory and field data have shown that the vaccine-exposed embryos develop protective immunity before they hatch. These observations indicate that embryos are more immunologically competent than previously estimated. In ovo vaccination in poultry may lead the way for prenatal immunization in mammals. Immunosuppression and accompanying poor performance of birds is a major problem in the poultry industry. In addition to environmental stresses associated with intensive rearing conditions, a number of immunosuppressive agents, particularly viruses have been identified. Many of these viruses are endemic in poultry-producing areas. The mechanism by which the viruses cause immunosuppression has not been well defined and is probably unique for each immunosuppressive virus. It is hoped that improved understanding of the avian immune system will unravel strategies for improved management of viral immunosuppression.

16.

References

Adair, B. M., McNeilly, F., McConnell, C. D., Todd, D., Nelson, R. T., McNulty, M. S. (1991). Effects of chicken anemia agent on lymphokine production and lymphocyte transformation in experimentally infected chickens. Avian Dis. 35,783-792. Adldinger, H. K., Calnek, B. W. (1973). Pathogenesis of Marek's disease: early distribution of virus and viral antigens in infected chickens. J. Natl Cancer Inst. 50, 1287-1298. Abroad, J., Sharma, J. M. (1993). Protection against hemorrhagic

117

enteritis and Newcastle disease in turkeys by embryo vaccination with monovalent and bivalent vaccines. Avian Dis. 37, 485-491. Allan, W. H., Faragher, J. T., Cullen, G. A. (1972). Immunosuppression by the infectious bursal agent in chickens immunized against Newcastle disease. Vet. Rec. 90, 511-512. Allen, P. M., Matsueda, G. R., Evans, R. J., Dunbar Jr, J. B., Marshall, G., Unanue, E. R. (1987). Identification of the T-cell and Ia contact residues of a T-cell antigenic peptide. Nature 327, 713-715. Aim, G. V., Siccardi, F. J., Peterson, R. D. (1972). Impairment of the lymphocyte response to phytohemagglutinin in chickens with Marek's disease. Acta Pathol. Microbiol. Scand. [A] 80, 109-114. Amrani, D. L. (1990). Regulation of fibrinogen biosynthesis: glucocorticoid and interleukin-6 control. Blood Coagulation Fibrin. 1,443-446. Amrani, D. L., Mauzy-Melitz, D., Mosesson, M. W. (1986). Effect of hepatocyte-stimulating factor and glucocorticoids on plasma fibronectin levels. Biochem. J. 238,365-371. Anderson, W. I., Reid, W. M., Lukert, P. D., Fletcher, O. J. (1977). Influence of infectious bursal disease on the development of immunity to Eimeria tenella. Avian Dis. 21,637-641. Arstila, T. P., Lassila, O. (1993). Androgen-induced expansion of the peripheral blood 78 T cell population in the chicken. J. Immunol. 151, 6627-6633. Arstila, T. P., Toivanen, P., Lassila, O. (1993). Helper activity of CD4 + ~fi T cells is required for the avian 78 T cell response. Eur. J. Immunol. 23, 2034-2037. Arstila, T. P., Vainio, O., Lassila, O. (1994). Evolutionarily conserved function of CD28 in ~fl T cell activation. Scand. J. Immunol. 40, 368-371. Audhya, T., Kroon, D., Heavner, G., Viamontes, G., Goldstein, G. (1986). Tripeptide structure of bursin, a selective B cell differentiating hormone of the bursa of Fabricius. Science 231, 997-999. Austin, L. M., Boissy, R. E. (1995). Mammalian tyrosinaserelated protein-1 is recognized by autoantibodies from vitiliginous Smyth chickens. An avian model for human vitiligo. Am. J. Pathol. 146, 1529-1541. Austin, L. M., Boissy, R. E., Jacobson, B. S., Smyth Jr, J. R. (1992). The detection of melanocyte autoantibodies in the Smyth chicken model for viti!igo. Clin. Immunol. Immunopathol. 64, 112-120. Baba, T., Masumoto, K., Nishida, S., Kajikawa, T., Mitsui, M. (1988). Harderian gland dependency of immunoglobulin A production in the lacrimal fluid of chicken. Immunology 65, 67-72. Baba, T., Kawata, T., Masumoto, K., Kajikawa, T. (1990). Role of the Harderian gland in immunoglobulin A production in chicken lacrimal fluid. Res. Vet. Sci. 49, 20-24. Bacon, L. D. (1987). Influence of the major histocompatibility complex on disease resistance and productivity. Poult. Sci. 66, 802-811. Bacon, L. D., Kite Jr, J. H., Rose, N. R. (1974). Relation between the major histocompatibility (B) locus and autoimmune thyroiditis in obese chickens. Science 186, 274-275. Bacon, L. D., Witter, R. L., Fadly, A. M. (1989). Augmentation of retrovirus-induced lymphoid leukosis by Marek's disease herpesviruses in white leghorn chickens. J. Virol. 63, 504512. Bagchi, N., Brown, T. R., Urdanivia, E., Sundick, R. S. (1985).

118

Induction of autoimmune thyroiditis in chickens by dietary iodine. Science 230, 325-327. Bagchi, N., Brown, T. R., Herdegen, D. M., Dhar, A., Sundick, R. S. (1990) Antioxidants delay the onset of thyroiditis in obese strain chickens. Endocrinology 127, 1590-1595. Bagchi, N., Brown, T. R., Sundick, R. S. (1995). Thyroid cell injury is an initial event in the induction of autoimmune thyroiditis by iodine in obese strain chickens. Endocrinology 136, 5054-5060. Balcarova, J., Hala, K., Hraba, T. (1973). Differences in antibody formation to the dinitrophenol group in inbred lines of chickens. Folia Biol. (Prague) 19, 19-24. Bang, B. G., Bang, F. B. (1968). Localized lymphoid tissues and plasma cells in paraocular and paranasal organ systems in chickens. Am. J. Path. 53,735-751. Barger, B., Pace, J. L., Ragland, W. L. (1991). Purification and partial characterization of an avian thymic hormone. Thymus 17, 181-197. Barker, K. A., Hampe, A., Stoeckle, M. Y., Hanafusa, H. (1993). Tranformation-associated cytokine 9E3/CEF4 is chemotactic for chicken peripheral blood mononuclear cells. J. Virol. 67, 3528-3533. Barral, A., Barral-Netto, M., Yong, E. C., Brownell, C. E., Twardzik, D. R., Reed, S. G. (1994). Transforming growth factor-/3 as a virulence mechanism for Leishmania Braziliensis. Proc. Natl Acad. Sci. USA 90, 3442-3446. Barral-Netto, M., Barral, A. (1994). Transforming growth factor/3 in tegumentary leishmaniasis. Brazilian J. Med. Biol. Res. 27, 1-9. Barta, D., Barta, V. (1975). Chicken (Gallus gallus) hemolytic complement: optimal conditions for its titration. Immunol. Communication 4, 337-351. Barta, D., Hubbert, N. L. (1978). Testing of hemolytic complement components in domestic animals. Am.J. Vet. Res. 39, 1303-1308. Barth, C. F., Ewert, D. L., Olson, W. C., Humphries, E. H. (1990). Reticuloendotheliosis virus REV-T (REV-A)-induced neoplasia: development of tumors within the T-lymphoid and myeloid lineages. J. Virol. 64, 6054-6062. Becht, H., Muller, H. (1991). Infectious bursal disease-B cell dependent immunodeficiency syndrome in chickens. Behring Inst. Mitt. 89, 217-225. Befus, A. D., Johnston, N. Leslie, G. A., Bienenstock, J. (1980). Gut-associated lymphoid tissue in the chicken. I. Morphology, ontogeny, and some fundamental characteristics of Peyer's patches. J. Immunol. 125, 2626-2632. Benatar, T., Iacampo, S., Tkalec, L., Ratcliffe, M. J. H. (1991). Expression of immunoglobulin genes in the avian embryo bone marrow revealed by retroviral transformation. Eur. J. Immunol. 21, 2529-2536. Benatar, T., Tkalec, L., Ratcliffe, M. J. H. (1992). Stochastic rearrangement of chicken immunoglobulin variable region genes in chicken B-cell development. Proc. Natl Acad. Sci. USA 89, 7615-7619. Benedict, A. A., Pollard, L. W., Morrow, P. R., Abplanalp, H. A., Maurer, P. H., Briles, W. E. (1975). Genetic control of immune responses in chickens. I. Responses to terpolymer of poly (Glu6~176 1~ associated with major histocompatibility complex. Immunogenetics 2, 313-324. Bernot, A., Auffray, C. (1991). Primary structure and ontogeny of an avian CD3 transcript. Proc. Natl Acad. Sci. USA 88, 25502554.

AVIAN IMMUNOLOGY

Bernot, A., Zoorob, R., Auffray, C. (1994). Linkage of a new member of the lectin supergene family to chicken MHC genes. Immunogenetics 39, 221-229. Beug, H., M/iller, H., Grieser, S., Doederlein, G., Graf, T. (1981). Hematopoietic cells transformed in vitro by REVT avian reticuloendotheliosis virus express characteristics of very immature lymphoid cells. Virology 115,295-309. Bienenstock, J., Johnson, N., Perey, D. Y. E. (1973). Bronchial lymphoid tissue I. Morphologic characteristics. Lab. Invest. 28, 686-692. Biggs, P. M. (1957). The association of lymphoid tissue with the lymph vessels in the domestic chicken (Gallus domesticus). Acta Anat. 29, 36-47. Biggs, P. M. (1991). Lymphoproliferative disease of turkeys. In Diseases of Poultry, 9th edn (eds Calnek, B. W., Barnes, H. J., Beard, C. W., Reid, W. M., Yoder Jr, H. W.), pp. 456-459. Iowa State University Press, Ames, IA, USA. Biggs, P. M., Long, P. L., Kenzy, S. G., Rootes, D. G. (1968). Relationship between Marek's disease and coccidiosis. II. The effect of Marek's disease on the susceptibility of chickens to coccidial infection. Vet. Rec. 83,284-289. Blauer, M., Tuohimaa, P. (1995). Activin beta-A and beta-B subunit expression in the developing chicken bursa of Fabricius. Endocrinology 136, 1482-1487. Bloom, S., Bacon, L. (1985). Linkage of the major histocompatibility (B) complex and the nucleolar organizer region in the chicken. J. Heredity 76, 146-154. Boerkoel, C. F., Kung, H.-J. (1992). Transcriptional interaction between retroviral long terminal repeats (LTRs): mechanism of 5' LTR suppression and 3' LTR promoter activation of cmyc in avian B-cell lymphomas. J. Virol. 66, 4814-4823. Boissy, R. E., Moellmann, G., Trainer, A. T., Smyth Jr, J. R., Lerner, A. B. (1986). Delayed amelanotic (DAM or Smyth) chicken: melanocyte dysfunction in vivo and in vitro. J. Invest. Dermatol. 86, 149-156. Bombara, C. J., Taylor, R. L. (1991). Signal transduction events in chicken interleukin-1 production. Pouh. Sci. 70, 13721380. Bounous, D. I., Goodwin, M. A., Brooks, R. L., Lamichhane, C. M., Campagnoli, R. P., Brown, J., Snyder, D. B. (1995). Immunosuppression and intracellular calcium signaling in splenocytes from chicks infected with chicken anemia virus, CL-1 isolate. Avian Dis. 39, 135-140. Bowen, M. A., Patel, D. D., Li., X., Modrell, B., Malacko, A. R., Wang, W. C., Marquardt, H., Neubauer, M., Pesando, J. M., Francke, U., Haynes, B. F., Aruffo, A. (1995). Cloning, mapping~ and characterization of activated leucocyte-cell adhesion molecule (ALCAM), a CD6 ligand. J. Exp. Med. 181, 2213-2220. Box, P. G., Holmes, H. C., Bushell, A. C., Finney, P. M. (1988). Impaired response to killed Newcastle disease vaccine in chickens possessing circulating antibody to chicken anemia agent. Avian Pathol. 17, 713-723. Boyd, R. L., Ward, H. A. (1984). Lymphoid antigenic determinants of the chicken: ontogeny of bursa-dependent lymphoid tissue. Immunol. 8, 149-167. Boyd, R. L., Wilson, T. J., Ward, H. A., Mitrangas, K. (1990). Phenotypic characterization of chicken bursal stromal elements. Dev. Immunol. 1, 41-51. Boyd, R. L., Wilson, T. J., van de Water, J., Haapanen, L. A., Gershwin, M. E. (1991). Selective abnormalities in the thymic microenvironment associated with avian scleroderma, an

References

inherited fibrotic disease of L200 chickens. J. Autoimmun. 4, 369-380. Boyd, R. L., Wilson, T. J., Bean, A. G., Ward, H. A., Gershwin, M. E. (1992). Phenotypic characterization of chicken thymic stromal elements. Dev. Immunol. 2, 51-66. Brandtzaeg, P., Baklien, K., Bjerke, K., Rognum, T. O., Scott, H., Valnes, K (1987). Nature and properties of the human gastrointestinal immune system. In Immunology of the Gastrointestinal Tract (eds Miller, K., Nicklin, S.), pp. 1-85. CRC Press, Boca Raton, FL, USA. Brewer, J. M., Wunderlich, J. K., Kim, D. H., Carr, M. Y., Beach, G. G., Ragland, W. L. (1989). Avian thymic hormone (ATH) is a parvalbumin. Biochem. Biophys. Res. Commun. 160, 1155-1161. Brewer, J. M., Arnold, J., Beach, G. G., Ragland, W. L., Wunderlich, J. K. (1991). Comparison of the amino acid sequences of tissue-specific parvalbumins from chicken muscle and thymus and possible evolutionary significance. Biochem. Biophys. Res. Commun. 181,226-231. Brezinschek, H. P., Faessler, R., Klocker, H., Kroemer, G., Sgonc, R., Dietrich, H., Jakober, R., Wick, G. (1990). Analysis of the immune-endocrine feedback loop in the avian system and its alteration in chickens with spontaneous autoimmune thyroiditis. Eur. J. Immunol. 20, 2155-2159. Briles, W. E. (1962). Additional blood group systems in the chicken. Ann. N Y Acad. Sci. 97, 173-183. Briles, W. E., Krueger, W. F. (1955). The effect of parental B blood group genotypes on hatchability and livability in Leghorn inbred lines. Poult. Sci. 34, 1182 (abstract). Briles, W. E., Briles, D. L., Pollock, D. L., Pattison, M. (1980). Marek's disease resistance in chickens affected by complementation of B alloalleles in a cross of commercial parent stocks. Anim. Blood Groups Biochem. Genet. 2 (Suppl. 1), 2728. Brown, T. R., Sundick, R. S., Dhar, A., Sheth, D., Bagchi, N. (1991). Uptake and metabolism of iodine is crucial for the development of thyroiditis in obese strain chickens. J. Clin. Invest. 88, 106-111. Bucy, R. P., Chen, C. H., Cihak, J., L6sch, U., Cooper, M. D. (1988). Avian T cells expressing 78 receptors localize in the splenic sinusoids and the intestinal epithelium. J. Immunol. 141, 2200-2205. Bucy, R. P., Coltey, M., Chen, C. H., Char, D., LeDouarin, N. M., Cooper, M. D. (1989). Cytoplasmic CD3 § surface CD8 § lymphocytes develop as a thymus-independent lineage in chick-quail chimeras. Eur. J. Immunol. 19, 1449-1455. Bucy, R. P., Chen, C. H., Cooper, M. D. (1990a). Development of cytoplasmic CD3 § cell receptor-negative cells in the peripheral lymphoid tissues of chickens. Eur. J. Immunol. 20, 1345-1350. Bucy, R. P., Chen, C. H., Cooper, M. D. (1990b). Ontogeny of T cell receptors in the chicken thymus. J. Immunol. 144, 11611168. Bulloch, K. (1988). A comparative study of the autonomic nervous system innervation of the thymus in the mouse and chicken. Int. J. Neurosci. 40, 129-140. Bumstead, J. M., Payne, L. N. (1987). Production of an immune suppressor factor by Marek's disease lymphoblastoid cell lines. Vet. Immunol. Immunopathol. 16, 47-66. Bumstead, J. M., Flack, I. H., Payne, L. N. (1985). Studies on the role of prostaglandin E2 in Marek's disease. In International Symposium on Marek's Disease (eds Calnek, B. W., Spencer,

119

j. L.), pp. 268-285. American Association of Avian Pathologists, Kennett Square, PA, USA. Burg, R. W., Feldbush, T., Morris, C. A., Maag, T. A. (1971). Depression of thymus and bursa dependent immune systems of chicks with Marek's disease. Avian Dis. 15, 662671. Burt, D. W., Paton, I. R. (1991). Molecular cloning and primary structure of the chicken transforming growth factor-fl2 gene. D N A Cell Biol. 10, 723-734. Buscaglia, C., Calnek, B. W. (1988). Maintenance of Marek's disease herpesvirus latency in vitro by a factor found in conditioned medium. J. Gen. Virol. 69, 2809-2818. Byrnes, S., Eaton, R., Kogut, M. (1993a). In vitro interleukin-1 and tumor necrosis factor-alpha production by macrophages from chickens infected with either Eimeria maxima or Eimeria tenella. Int. J. Parasitol. 23,639-645. Byrnes, S., Emerson, K., Kogut, M. (1993b). Dynamics of cytokine production during coccidial infections in chickens: colony-stimulating factors and inferferon. FEMS Microbiol. Immunol. 6, 45-52. Calhoun, M. L. (1954). Microscopic Anatomy of the Digestive System of the Chicken. Iowa State University Press, Ames, IA, USA. Calnek, B. W. (1985). Pathogenesis of Marek's disease- a review. In International Symposium on Marek's Disease (eds Calnek, B W., Spencer, J. L.), pp. 374-390. American Association of Avian Pathologists, Kennett Square, PA, USA. Calnek, B. W. (1986). Marek's disease- a model for herpesvirus oncology. CRC Crit. Rev. Microbiol. 12, 293-320. Calnek, B. W., Witter, R. L. (1991). Marek's disease. In Diseases of Poultry, 9th edn (eds Calnek, B. W., Barnes, H. J., Beard, C. W., Reid, W. M., Yoder Jr, H. W.), pp. 342-385. Iowa State University Press, Ames, IA, USA. Calnek, B. W., Witter, R. L. (1997). Marek's disease. In Diseases of Poultry, 10th edn (eds C~lnek, B. W., Barnes, H. J., Beard, C. W., McDougald, L. R., Saif, Y. M.), pp. 369-413. Iowa State University Press, Ames, IA, USA. Calnek, B. W., Higgins, D. A., Fabricant, J. (1975). Rous sarcoma regression in chickens resistant or susceptible to Marek's disease. Avian Dis. 19, 473-481. Calnek, B. W., Fabricant, J., Schat, K. A., Murthy, K. K. (1978). Rejection of a transplantable Marek's disease lymphoma in normal vs. immunologically deficient chickens. J. Natl Cancer Inst. 60, 623-630. Calnek, B. W., Schat, K. A., Ross, L. J. N., Shek, W. R., Chen, C.-L. H. (1984). Further characterization of Marek's disease virus-infected lymphocytes. I. In vivo infection. Int. J. Cancer 33,289-298. Calnek, B. W., Lucio, B., Schat, K. A., Lillehoj, H. S. (1989). Pathogenesis of Marek's disease virus-induced local lesions. 1. Lesion characterization and cell line establishment. Avian Dis. 33,291-302. Carlson, L. M., Oettinger, M. A., Schatz, D. G., Masteller, E. L., Hurley, E. A., McCormack, W. T., Baltimore, D., Thompson, C. B. (1991). Selective expression of RAG-2 in chicken B cells undergoing immunoglobulin gene conversion. Cell 64, 201208. Chai, J. Y., Lillehoj, H. S. (1988). Isolation and functional characterization of chicken intestinal intra-epithelial lymphocytes showing natural killer cell activity against tumour target cells. Immunology 63,111-117. Chan, M. M., Chen, C.-L. H., Ager, L. L., Cooper, M. D. (1988).

120

Identification of the avian homologues of mammalian CD4 and CD8 antigens. J. Immunol. 140, 2133-2138. Chang, E. B., Musch, M. W., Mayer, L. (1990). Interleukins 1 and 3 stimulate anion secretion in chicken intestine. Gastroenterology 98, 1518-1524. Chang, W. P., Marsh, J. A. (1993). The effect of synthetic thymulin on cell surface marker expression by avian T cell precursors. Dev. Comp. Immunol. 17, 85-96. Chanh, T. C., Benedict, A. A., Abplanap, H. (1976). Association of serum hemolytic complement levels with the major histocompatibility complex in chickens. J. Exp. Med. 144, 555561. Char, D., Sanchez, P., Chen, C. H., Bucy, R. P., Cooper, M. D. (1990). A third sublineage of avian T cells can be identified with a T cell receptor-3-specific antibody. J. Immunol. 145, 3547-3555. Chen, C.-L. H., Cooper, M. D. (1987). Identification of cells surface molecules on chicken lymphocytes with monoclonal antibodies. In Avian Immunology: Basis and Practice, Vol. I (eds Toivanen, A., Toivanen, P.), pp. 137-154, CRC Press, Boca Raton, FL, USA. Chen, C. H., Lehmeyer, J. E., Cooper, M. D. (1982). Evidence for an IgD homologue on chicken lymphocytes. J. Immunol. 129, 2580. Chen, C.-L. H., Chanh, T. C., Cooper, M. D. (1984). Chicken thymocyte-specific antigen identified by monoclonal antibodies: ontogeny, tissue distribution and biochemical characterization. Eur. J. Immunol. 14, 385-391. Chen, C. H., Ager, L. L., Gartland, G. L., Cooper, M. D. (1986). Identification of a T3/T cell receptor complex in chickens. J. Exp. Med. 164, 375-380. Chen, C. H,, Cihak, J., L6sch, U., Cooper, M. D. (1988a). Differential expression of two T cell receptors, TCR1 and TCR2, on chicken lymphocytes. Eur. J. Immunol. 18, 539543. Chen, L., Lim, M. Y., Bose Jr, H., Bishop, J. M. (1988b). Rearrangements of chicken immunoglobu!in genes in lymphoid cells transformed by the avian retroviral oncogene v-rel. Proc. Natl Acad. Sci. USA 85,549-553. Chen, C. H., Sowder, J. T., Lahti, J. M., Cihak, J., L6sch, U., Cooper, M. D. (1989). TCR3: a third T cell receptor in the chicken. Proc. Natl Acad. Sci. 86, 2351-2355. Chen, C. L. H., Bucy, R. P., Cooper, M. D. (1990). T cell differentiation in birds. Semin. Immunol. 2, 79-86. Chen, C. H., Pickel, J. M., Lahti, J. M., Cooper, M. D. (1991). Surface markers on avian immune cells. In Avian Cellular Immunology (ed. Sharma, J. M.), pp. 1-22. CRC Press, Boca Raton, FL, USA. Chen, C. H., G6bel, T. W. F., Kubota, T., Cooper, M. D. (1994). T cell development in the chicken. Poult. Sci. 73, 1012-1018. Chen, C. H., Six, A., Kubota, T., Tsuji, S., Kong, F.-K., G6bel, T. W. F., Cooper, M. D. (1996). T cell receptors and T cell development. Curr. Topics Microbiol. Immunol. 212, 37-53. Cheville, N. F. (1967). Studies on the pathogenesis of Gumboro disease in the bursa of Fabricius, spleen, and thymus of the chicken. Am. J. Pathol. 51,527-551. Cheville, N. F., Beard, C. W. (1972). Cytopathology of Newcastle disease. The influence of bursal and thymic lymphoid systems in the chicken. Lab. Invest. 27, 129-143. Cheville, N., Sato, S. (1977). Pathology of adenoviral infection in turkeys (Meleagris gallopavo) with respiratory disease and colisepticemia. Vet. Pathol. 14, 567-581.

AVIAN IMMUNOLOGY

Chi, D. S., Galton, J. E., Thorbecke, J. (1981). Role of T cells in immune responses of the chicken. In Avian Immunology (eds Rose, M. E., Payne, L. N., Freeman, B. M.), pp. 102-134. Clark Constable Limited, Edinburgh, UK. Cho, B. R. (1970). Experimental dual infections of chickens with infectious bursal and Marek's disease agents. I. Preliminary observation on the effect of infectious bursal agent on Marek's disease. Avian Dis. 14, 665-675. Chow, L. M., Ratcliffe, M. J., Veillette, A. (1992). tkl is the avian homolog of the mammalian Ick tyrosine protein kinase gene. Mol. Cell. Biol. 12, 1226-1233. Chung, K. S., Lillehoj, H. S., Jenkins, M. C. (1991). Avian leukocyte common antigens: molecular weight determination and flow cytometric analysis using new monoclonal antibodies. Vet. Immunol. Immunopathol. 28, 259-273. Cihak, J., Ziegler-Heitbrock, H. W., Trainer, H., Schranner, I., Merkenschlager, M., L6sch, U. (1988). Characterization and functional properties of a novel monoclonal antibody which identifies a T cell receptor in chickens. Eur. J. Immunol. 18, 533-538. Cihak, J., Hoffmann-Fezer, G., Ziegler-Heibrock, H. W. L., Stein, H., Kaspers, B., Chen, C. H., Cooper, M. D., L6sch, U. (1991). T cells expressing the V/31 T-cell receptor are required for IgA production in the chicken. Proc. Natl Acad. Sci. USA 88, 10951-10955. Cihak, J., Hoffmann-Fezer, G., Koller, A., Kaspers, B., Merkle, H., Haiti, K., Wick, G., L6sch, U. (1995). Preferential TCR V beta 1 gene usage by autoreactive T cells in spontaneous autoimmune thyroiditis of the obese strain chicken. J. Autoimmun. 8, 507-520. Cloud, S. S., Rosenberger, J. K., Lillehoj, H. S. (1992a). Immune dysfunction following infection with chicken anemia agent and infectious bursal disease virus. I. Kinetic alterations of avian lymphocyte subpopulations. Vet. Immunol. Immunopathol. 34, 337-352. Cloud, S. S., Rosenberger, J. K., Lillehoj, H. S. (1992b). Immune dysfunction following infection with chicken anemia agent and infectious bursal disease virus. II. Alterations of in vitro lymphoproliferation and in vivo immune responses. Vet. Immunol. Immunopathol. 34, 353-366. Collins, W. M., Briles, W. E., Zsigray, R. M., Dunlop, W. R., Corbet, A. C., Clark, K. K., Marks, J. L., McGrail, T. P. (1977). The B locus (MHC) in the chicken: association with the fate of RSV-induced tumors. Immunogenetics 5, 333343. Coltey, M., Bucy, R. P., Chen, C. H., Cihak, J., L6sch, U., Char, D., LeDouarin, N. M., Cooper, M. D. (1989). Analysis of the first two waves of thymus homing stem cells and their T cell progeny in chick quail chimeras. J. Exp. Med. 170, 543-557. Confer, A. W., MacWilliams, P. S. (1982). Correlation of hematological changes and serum monocyte inhibition with the early suppression of phytohemagglutinin stimulation of lymphocytes in experimental infectious bursal disease. Can. J. Comp. Med. 46, 169-175. Confer, A. W., Springer, W. T., Shane, S. M., Conovan, J. F. (1981). Sequential mitogen stimulation of peripheral blood lymphocytes from chickens inoculated with infectious bursal disease virus. Am.J. Vet. Res. 42, 2109-2113. Cooper, M. D., Chen, C. H. (1993). Avian T cell development and the 78/~fl T cell connection. In Proc. Xth World Vet. Poultry Assoc. Congress, Sydney, pp. 27-31. Cooper, M. D., Peterson, R. D. A., South, M. A., Good, R. A.

References

(1966). The functions of the thymus system and the bursa system in the chicken. J. Exp. Med. 123, 75-102. Cooper, M. D., Cain, W. A., Van Alten, P. J., Good, R. A. (1969). Development and function of the immunoglobulin producing system. I. Effect of bursectomy at different stages of development on germinal centers, plasma cells, immunoglobulin, and antibody production. Int. Arch. Allergy 35,242-252. Cooper, M. D., Chert, C. H., Bucy, R. P., Thompson, C. B. (1991). Avian T cell ontogeny. Adv. Immunol. 30, 87-117. Corbel, C., Bluestein, H. G., Pourquie, O., Vaigot, P., Le Douarin, N. (1992). An antigen expressed by avian neuronal cells is also expressed by activated T lymphocytes. Cell. Immunol. 141, 99-110. Cormier, F., Dieterlen-Lievre, F. (1988). The wall of the chick embryo aorta harbors M-CFC, G-CFC and BFU-E. Development 102, 279-285. Cormier, F., de Paz, P., Dieterlen-Lievre, F. (1986). In vitro detection of cells with monocytic potentiality in the wall of the chick embryo aorta. Dev. Biol. 118, 167-175. Corrier, D. E. (1991). Mycotoxicosis: mechanisms of immunosuppression. Vet. Immunol. Immunopathol. 30, 73-87. Cortes, A., Fonfria, J., Vicente, A., Varas, A., Moreno, J., Zapata, A. G. (199~5). T-dependent areas in the chicken bursa of Fabricius: an immunological study. Anat. Rec. 242, 91-95. Coudert, F., Cauchy, L., Dambrine, G. (1979). Evidence for a thymic factor in sera of chickens. Folia Biol. (Prague) 25,317318. Craft, D. W., Brown, J., Lukert, P. D. (1990). Effects of standard and variant strains of infectious bursal disease virus on infections of chickens. Am. J. Vet. Res. 51, 1192-1197. Cui, Z., Qin, A. (1996). Immunodepressive effects of the recombinant 38KD phosphorylated protein of Marek's disease virus on chicks. Proc. 4th Int. Symp. Marek's Disease, p. 35. Dahan, A., Reynaud, C. A., Weill, J. C. (1983). Nucleotide sequence of a chicken /~ heavy chain mRNA. Nucl. Acids Res. 11, 5381-5389. Danielpour, D., Kim, K. Y., Dart, L. L., Watanabe, S., Roberts, A. B., Sporn, M. B. (1989). Sandwich enzyme-linked immunosorbent assays (SELISAs) quantitate and distinguish two forms of transforming growth factor-beta (TGF-beta 1 and TGF-beta 2) in complex biological fluids. Growth Fact. 2, 6171. de Villartay, J.-P., Hockett, R. D., Coran, D., Korsmeyer, S. J., Cohen, D. I. (1988). Deletion of the human T cell receptor ~gene by a site-specific recombination. Nature 335, 170-174. Del-Cacho, E., Gallego, M., Bascuas, J. A. (1992). Ultrastructural localization of a soluble antigen in the chicken Harderian gland. Immunol. 16, 209-219. Del-Cacho, E., Gallego, M., Sanz, A., Zapata, A. (1993). Characterization of distal lymphoid nodules in the chicken caecum. Anat. Rec. 237, 512-517. Del-Cacho, E., Gallego, M., Arnal, C., Bascuas, J. A. (1995). Localization of splenic cells with antigen-transporting capability in the chicken. Anat. Rec. 241,105-112. Dieterlen-Li~vre, F, (1989). Development of the compartments of the immune system in the avian embryo. Dev. Comp. Immunol. 13, 303-311. Dieterlen-Li~vre, F., Martin, C. (1981). Diffuse intraembryonic hemopoiesis in normal and chimeric avian development. Dev. Biol. 85,180-191. Dietert, R. R., Golemboski, K. A. (1994). Environment-immune interactions. Poult. Sci. 73, 1062-1076.

121

Dietert, R. R., Taylor, R. L., Dietert, M. F. (1991). Biological function of the chicken major histocompatibility complex. CRC Crit. Rev. Poult. Biol. 3, 111-129. Digby, M. R., Lowenthal, J. W. (1995). Cloning and expression of the chicken interferon-7-gene. J. Interferon Cytok. Res. 15, 933-938. Dijkmans, R., Creemers, J., Billiau, A. (1990). Chicken macrophage activation by interferon: do birds lack the molecular homologue of mammalian interferon-y? Vet. Immunol. Immunopathol. 26, 319-332. Doehring, C., Riegert, P., Salomonsen, J., Skjoedt, K., Kaufman, J. (1993). The extracellular Ig V-like regions of the polymorphic B-G antigens of the chicken MHC lack structural features expected for antibody variable regions. In Avian Immunology in Progress (ed. Coudert, F.), pp 145-152. Inst. Nat. de la Rech. Agronomique, les Colloques no. 62, Paris, France. Dolfi, A., Bianchi, F., Lupetti, M., Michelucci, S. (1989). The significance of the intestinal flow in the maturing of B lymphocytes and the chicken antibody response. J. Anat. 166, 233-242. Domermuth, C. H., Larsen, C. T. (1984). Vaccination against hemorrhagic enteritis of turkeys: an update. J. Am. Vet. Med. Assoc. 185,337. Dr~n, C. N., Sighy, E., Gllvits, R., Ritz, F., Ping, J., Sztojkov, V. (1983). Lymphoreticular tumour in pen-raised pheasants associated with a reticuloendotheliosis-like virus infection. Avian Pathol. 12, 55-71. DrSn, C. N., N~meth, I., Siri, I., Ritz, F., Gllvits, R., Somogyi, P. (1988). Isolation of a reticuloendotheliosis-like virus from naturally occurring lymphoreticular tumours of domestic goose. Avian Pathol. 17, 259-277. Droege, W. (1971). Amplifying and suppressive effect of thymus cells. Nature 234, 549-551. Droege, W. (1976). The antigen-inexperienced thymic suppressor cells: a class of lymphocytes in the young chicken thymus that inhibits antibody production and cell-mediated immune responses. Eur. J. Immunol. 6, 279-287. Duncan, M. R., Wilson, T. J., van de Water, J., Berman, B., Boyd, R., Wick, G., Gershwin, M. E. (1992). Cultured fibroblasts in avian scleroderma, an autoimmune fibrotic disease, display an activated phenotype. J. Autoimmun. 5, 603-615. Duncan, M. R., Berman, B., van de Water, J., Boyd, R. L., Wick, G., Gershwin, M. E. (1995). Mononuclear cells from fibrotic skin lesion in avian scleroderma constitutively produce fibroblast-activating cytokines and immunoglobulin M. Int. Arch. Aller. Immunol. 107, 519-526. Dunon, D., Imhof, B. A. (1996). T cell migration during ontogeny and T cell repertoire generation. Curr. Topics Microbiol. Immunol. 212, 79-93. Dunon, D., Cooper, M. D., Imhof, B. A. (1993a). Thymic origin of embryonic intestinal y8 T cells. J. Exp. Med. 177, 257-263. Dunon, D., Cooper, M. D., Imhof, B. A. (1993b). Migration patterns of thymus-derived y~ T cells during chicken development. Eur. J. Immunol. 23, 2545-2550. Dunon, D., Schwager, J., Dangy, J. P., Cooper, M. D., Imhof, B. A. (1994). T cell migration during development: homing is not related to TCR Vfll repertoire selection. EMBO J. 13, 808815. Dunon, D., Schwager, J., Dangy, J. P., Imhof, B. A. (1995).

122

Ontogeny of TCR V/31 expression revealed novel invariant alternative transcripts. J. Immunol. 154, 1256-1264. Edwards, S. V., Wakeland, E. K., Potts, W. K. (1995). Contrasting histories of avian and mammalian MHC genes revealed by class II beta sequences from songbirds. Proc. Natl Acad. Sci. USA 92, 12200-12204. Eerola, E., Veromaa, T., Toivanen, P. (1987). Special features in the structural organization of the Avian lymphoid system. In Avian Immunology: Basis and Practice (eds Toivanen, A., Toivanen, P.), pp. 9-21. CRC Press Boca Raton, FL, USA. Eisenbarth, G. S., Walsh, F. S., Nirenberg, M. (1979). Monoclonal antibody to a plasma membrane antigen of neurons. Proc. Natl Acad. Sci. USA 76, 4913-4917. Ellis, M. N., Eidson, C. S., Brown, J., Kleven, S. H. (1983a). Studies on interferon induction and interferon sensitivity of avian reoviruses. Avian Dis. 27, 927-936. Ellis, M. N., Eidson, C. S., Fletcher, O. J., Kleven, S. H. (1983b). Viral tissue tropisms and interferon production in White Leghorn chickens infected with two reovirus strains. Avian Dis. 27, 644-651. Enrietto, P. J., Hayman, M. J. (1987). Structure and virusassociated oncogenes of avian sarcoma and leukemia viruses. In Avian Leukosis (ed. de Boer, G. F.), pp. 29-46. Martinus Nijhoff Publishing, Dordrecht, The Netherlands. Erf, G. F., Trejo-Skalli, A. V., Smyth Jr, J. R. (1995). T cells in regenerating feathers of Smyth line chickens with vitiligo. Clin. Immunol. Immunopathol. 76, 120-126. Evans, D. L., Beasley, J. N., Patterson, L. T. (1971). Correlation of immunological competence with lesions in selected lymphoid tissues from chickens with Marek's disease. Avian Dis. 15,680-687. Ewert, D. L., Munchus, M. S., Chen, C. H., Cooper, M. D. (1984). Analysis of structural properties and cellular distribution of avian Ia antigen by using monoclonal antibodies to monomorphic determinants. J. Immunol. 132, 2524-2530. Ezeokoli, C. D., Ityondo, E. A., Nwannenna, A. I., Umoh, J. U. (1990). Immunosuppression and histopathological changes in the bursa of Fabricius associated with infectious bursal disease vaccination in chicken. Comp. Immunol. Microbiol. Infect. Dis. 13, 181-188. Fadley, A. M., Winterfield, R. W., Olander, H. J. (1976). Role of the bursa of Fabricius in the pathogenicity of inclusion body hepatitis and infectious bursal disease virus. Avian Dis. 20, 467-477. Fagerland, J. A., Arp, L. H. (1993a). Structure and development of bronchus-associated lymphoid tissue in conventionally reared broiler chickens. Avian Dis. 37, 10-18. Fagerland, J. A., Arp, L. H. (1993b). Distribution and quantitation of plasma cells, T cells, lymphocyte subsets, and B lymphocytes in bronchus-associated lymphoid tissue of chickens. Region. Immunol. 5, 28-36. Faragher, J. T., Allan, W. H., Wyeth, C. J. (1974). Immunosuppressive effect of infectious bursal agent on vaccination against Newcastle disease. Vet. Rec. 95,385-388. F~issler, R., Dietrich, H., Kr6mer, G., Schwarz, S., Brezinschek, H. P., Wick, G. (1988). Diminished glucocorticoid tonus in Obese strain (OS) chickens with spontaneous autoimmune thyroiditis: increased plasma levels of a physicochemically unaltered corticosteroid binding globulin but normal total corticosterone plasma concentration and normal glucocorticoid receptor contents in lymphoid tissue. J. Steroid Biochem. 30, 375-379.

AVIAN IMMUNOLOGY

Fedecka-Bruner, B., Penningers, J. Vaigot, p., Lehmann, A., Martlnez A. C., Kroemer, G. (1991). Developmental expression of IL-2-receptor light chain (CD25) in the chicken embryo. Dev. Immunol. 1,237-242. Fix, A. S., Arp, L. H. (1991). Morphologic characterization of conjunctiva-associated lymphoid tissue in chickens. Am. J. Vet. Res. 52, 1852-1859. Fleischer, B. (1980). Effector cells in avian spontaneous and antibody-dependent cell-mediated cytotoxicity. J. Immunol. 125, 1161-1166. Frazier, J. A. (1974). Ultrastructure of lymphoid tissue from chicks infected with Marek's disease virus. J. Natl Cancer Inst. 52, 829-837. Fredericksen, T. L., Sharma, J. M. (1987). Purification of avian T cell growth factor and immune interferon using gel filtration high resolution chromatography. In Avian Immunology (eds Weber, W. T., Ewert, D. L., Liss, A. R.), p. 145. Academic Press, New York, USA. Fulton, J. E., Thacker, E. L., Bacon, L. D., Hunt, H. D. (1995). Functional analysis of avian class I (BFIV) glycoproteins by epitope tagging and mutagenesis in vitro. Eur. J. Immunol. 25, 2069-2076. Gabrielsen, A. E., Pickering, R. J., Good, R. A. (1973a). Haemolysis in chicken serum I. The ionic environment. Immunology 25, 167-177. Gabrielsen, A. E., Pickering, R. J., Linna, T. J., Good, R. A. (1973b). Haemolysis in chicken serum. II. Ontogenetic development. Immunology 25,179-184. Gallego, M., Del-Cacho, E., Arnal, C., Bascuas, J. A. (1992a). Local immune response in the chicken Harderian gland to antigen given by different ocular routes. Res. Vet. Sci. 52, 3843. Gallego, M., Del-Cacho, E., Felices, C., Bascuas, J. A. (1992b). Immunoglobulin classes synthesized by the chicken Harderian gland after local immunization. Res. Vet. Sci. 52, 4447. Gallego, M., Del-Cacho, E., Arnal, C., Felices, C., Lloret, E., Bascuas, J. A. (1992c). Immunocytochemical detection of dendritic cells by S-100 protein in the chicken. Eur. J. Histochem. 36, 205-213. Gallego, M., Del-Cacho, E., Bascuas, J. A. (1995). Antigenbinding cells in the cecal tonsil and Peyer's patches of the chicken after bovine serum albumin administration. Poult. Sci. 74, 472-479. Gavora, J. S. (1990). Disease genetics. In Poultry Breeding and Genetics (ed. Crawford, R. D.), pp 805-846. Elsevier Science Publ., B.V., Amsterdam, The Netherlands. Gelb, J., Eidson, C. S., Fletcher, O. J., Kleven, S. J. (1979). Studies on interferon induction by infectious bursal disease virus (IBDV). II. Interferon production in White Leghorn chickens infected with an attenuated or pathogenic isolate of IBDV. Avian Dis. 23,634-645. Gendron, R. L., Nestel, F. P., Lapp, W. S. (1991). Expression of tumor necrosis factor alpha in the developing nervous system. Int. J. Neurosci. 60, 129-136. George, J. F., Cooper, M. D. (1990). ~,/8 T cells and ~//3 T cells differ in their developmental patterns of receptor expression and modulation requirements. Eur. J. Immunol. 20, 21772181. Gershwin, M. E., Abplanalp, H., Castles, J. J., Ikeda, R. M., van de Water, J., Eklund, J., Haynes, D. (1981). Characterization of a spontaneous disease of White Leghorn chickens resem-

References

123

bling progressive systemic sclerosis (scleroderma). J. Exp.

globulins and specific antibodies. Clin. Immunol. Immuno-

Med. 153, 1640-1659.

pathol. 23,549-569.

Gewurz, H., South, M. A., Good, R. A. (1966). The ontogeny of complement activity. Complement titers in the developing chick embryo during graft-vs.-host reactions. Proc. Soc. Exp. Biol. Med. 23,718-721. Giambrone, J. J., Donahoe, J. P., Dawe, D. L., Eidson, C. S. (1977). Specific suppression of the bursa-dependent immune system of chicks with infectious bursal disease virus. Am. J. Vet. Res. 38, 581-583. Giambrone, J. J., Klesius, P. H., Eckamn, M. K., Edgar, S. A. (1981). Influence of hormonal and chemical bursectomy on the development of acquired immunity to coccidia in broiler chickens. Poult. Sci. 60, 2612-2618. Glick, B. (1978). The immune response in the chicken: lymphoid development of the bursa of Fabricius and thymus and an immune response role for the gland of Harder. Poult. Sci. 57, 1441-1444.

Glick, B. (1995). Embryogenesis of the bursa of Fabricius: stem cell, microenvironment, and receptor-paracrine pathways. Poult. Sci. 74, 419-426. Glick, B., Rosse, C. (1981). Cellular composition of the bone marrow in the chicken: II. The effect of age and the influence of the bursa of Fabricius on the size of cellular compartments. Anat. Rec. 200, 471-479. Glick, B., Chang, T. S., Japp, R. G. (1956). The bursa of Fabricius and antibody production. Poult. Sci. 35, 224225. Glick, B., Holbrook, K. A., Olah, I., Perkins, W. D., Stinson, R. (1981). An electron and light microscopy study of caecal tonsil. Dev. Comp. Immunol. 5, 95-104. G6bel, T. W. F., Chen, C. H., Shrimpf, J., Grossi, C. E., Bernot, A., Bucy, R. P., Auffray, C., Cooper, M. D. (1994a). Characterization of avian natural killer cells and their intracellular CD3 protein complex. Eur. J. Immunol. 24, 1685-1691. G6bel, T. W. F., Chen, C. H., Lahti, J. M., Kubota, T., Kuo, C. L., Aebersold, R., Hood, L., Cooper, M. D. (1994b). Identification of T cell receptor a-chain genes in the chicken. Proc. Natl Acad. Sci. USA 91, 1094-1098. G6bel, T. W. F., Chen, C. H., Cooper, M. D. (1996a). Avian natural killer cells. Curr. Topics Microbiol. Immunol. 212, 107-117. G6bel, T. W. F., Chen, C. H., Cooper, M. D. (1996b). Expression of an avian CD6 candidate is restricted to 0~fiT cells, splenic CD8 + 78 T cells and embryonic NK cells. Eur. J. Immunol. 26, 1743-1747. Gonneville, L, Martins, T. J., BSdard, P.-A. (1991). Complex expression pattern of the CEF-4 cytokine in transformed and mitogenically stimulated cells. Oncogene 6, 1825-1833. Goodwin, M. A., Brown, J., Smeltzer, M. A., Girshick, T., Miller, S. L., Dickson, T. G. (1992). Relationship of common avian pathogen antibody titers in so-called chicken anemia agent (CAA)-antibody-positive chicks to titers in CAA-antibody negative chicks. Avian Dis. 36, 356-358. Goryo, M., Suwa, T., Umemura, T., Hakura, C., Yamashiro, S. (1989). Histopathology of chicks inoculated with chicken anemia agent (MSB1-TK 5803 strain). Avian Pathol. 18, 7389. Granfors, K., Martin, C., Lassila, O., Suvitaival, R., Toivanen, A., Toivanen, P. (1982). Immune capacity of the chicken bursectomized at 60 h of incubation: production of immuno-

Gross, W. B., Domermuth, C. H. (1975). Spleen lesions of hemorrhagic enteritis of turkeys. Avian Dis. 20, 455-466. Guellati, M., Ramade, F., Le Nguyen, D., Ibos, F., Bayle, J. D. (1991). Effects of early embryonic bursectomy and opotherapic substitution on the functional development of the adrenocorticotropic axis. J. Dev. Physiol. 15,357-363. Guida, S., Heguy, A., Melli, M. (1992). The chicken IL-1 receptor: differential evolution of the cytoplasmic and extracellular domains. Gene 111,239-243. Guillemot, F., Auffray, C. (1989). The molecular biology of the chicken major histocompatibility complex. CRC Critical Rev. Poult. Biol. 2, 255-275. Guillemot, F., Turmel, P., Charron, D., Le Douarin, N., Auffray, C. (1986). Structure, polymorphism and biosynthesis of chicken MHC class II (B-L) antigens and associated molecules. J. Immunol. 137, 1251-1257. Guillemot, F., Billault, A., Pourquie, O., Behar, G., Chausse, A.-M., Zoorob, R., Kreiblich, G., Auffray, C. (1988). A molecular map of the chicken major histocompatibility complex: the class II beta genes are closely-linked to the class I genes and the nucleolar organizer. EMBO J. 7, 27752785. Guillemot, F., Billault, A., Auffrey, C. (1989). Physical linkage of a guanine nucleotide-binding protein related gene to the chicken major histocompatibility complex. Proc. Natl Acad. Sci. USA 86, 4594-4598. G~inther, E., Balcarova, J., Hala, K., Ruede, E., Hraba, T. (1974). Evidence for an association between immune responsiveness of chickens to (T,G)-A-L and the major histocompatibility system. Eur. J. Immunol. 4, 548-553. Hfila, K. (1977). The major histocompatibility system of the chicken. In The Major Histocompatibility System in Man and Animals (ed. Goetze, G.), pp. 291-312. Springer-Verlag, Berlin, Heidelberg, New York. Hfila, K., Boyd, R., Doick, G. (1981). Chicken major histocompatibility complex and disease. Scand. J. Immunol. 14, 607616. H~la, K., Schauenstein, K., Neu, N., Kroemer, G., Wolf, H., Boeck, G., Wick, G. (1986). A monoclonal antibody reacting with a membrane determinant expressed on activated chicken T lymphocytes. Eur. J. Immunol. 16, 1331-1336. Hansen, M. P., Law, G. R. J., van Zandt, J. N. (1967). Differences in susceptibility to Marek's disease in chickens carrying two different B locus blood group alleles. Poult. Sci. 46, 1268 (abstract). Haury, M., Kasahara, Y., Schaal, S., Bucy, R. P., Cooper, M. D. (1993). Intestinal T lymphocytes in the chicken express an integrin-like antigen. Eur. J. Immunol. 23,313-319. Hayari, Y., Schauenstein, K., Globerson, A. (1982). Avian lymphokines, IL: interleukin-1 activity in supernatants of stimulated adherent splenocytes of chickens. Dev. Comp. Immunol. 6, 785-788. Haynes, D. C., Gershwin, M. E. (1984). Diversity of autoantibodies in avian scleroderma: an inherited fibrotic disease of White Leghorn chickens. J. Clin. Invest. 73, 1557-1568. Heller, E. D., Schat, K. A. (1985). Inhibition of natural killer activity in chickens by Marek's disease transformed cell lines. In International Symposium on Marek's Disease (eds Calnek, B. W., Spencer, J. L.), pp. 286-294. American Association of Avian Pathologists, Kennett Square, PA, USA.

124

Helmboldt, C. F., Garner, E. (1964). Experimentally induced Gumboro disease (IBA). Avian Dis. 8, 561-575. Hemendinger, R. A., Putnam, J. R., Bloom, S. E. (1992). MHC dosage effects on primary immune organ development in the chicken. Dev. Comp. Immunol. 16, 175-186. Herberman, R. B., Holden, H. T. (1978). Natural cell-mediated immunity. Adv. Can. Res. 27, 305-377. Higashihara, M., Saijo, K., Fujisaki, Y., Matumoto, M. (1991). Immunosuppressive effect of infectious bursal disease virus strains of variable virulence for chickens. Vet. Microbiol. 26, 241-248. Higgins, D. A., Cromie, R. L., Srivastava, G., Herzbeck, H., Schltiter, C., Gerdes, J. Diamantstein, T., Flad, H.-D. (1993). An examination of the immune system of the duck (Anas platyrhynchos) for factors resembling some defined mammalian cytokines. Dev. Comp. Immunol. 17, 341-355. Hippelainen, M., Naukkarinen, A., Alhava, E., Sorvari, T. E. (1987). Immunization of chickens via the bursa of Fabricius isolated from the rest of the gut-associated lymphoid tissue using four surgical techniques. Poult. Sci. 66, 514-520. Hirai, K., Calnek, B. W. (1979). In vitro replication of infectious bursal disease virus in established lymphoid cells lines and chicken B lymphocytes. Infect. Immun. 25,964-970. Hirai, K., Shimakura, S., Kawamoto, E., Taguchi, F., Kim, S. T., Change, C. N., Iritani, Y. (1974). The immunodepressive effect of infectious bursal disease virus in chickens. Avian Dis. 18, 50-57. Hirai, K., Kunihiro, K., Shimakura, S. (1979). Characterization of immunosuppression in chickens by infectious bursal disease virus. Avian Dis. 23,950-965. Hodges, R. D. (1974). The Histology of the Fowl. Academic Press, NY, USA. Hopkins, I. G., Edwards, K. R., Thornton, D. H. (1979). Measurement of immunosuppression in chickens caused by infectious bursal disease vaccines using Brucella abortus strain 19. Res. Vet. Sci. 27, 260-261. Hoshi, H., Mori, T. (1973). Identification of the bursa-dependent and thymus-dependent areas in the Tonsilla cecalis of chickens. Japan. J. Exp. Med. 111,309-322. Hossain, W. A., Zhou, X., Rutledge, A., Baier, C., Morest, D. K. (1996). Basic fibroblast growth factor affects neuronal migration and differentiation in normotypic cell cultures from the cochleovestibular ganglion of the chick embryo. Exp. Neurol. 138, 121-1-43. Houssaint, E., Belo, M., Le Douarin, N. M. (1976). Investigations on cell lineage and tissue interactions in the developing bursa of Fabricius through interspecific chimeras. Dev. Biol. 53, 250-264. Houssaint, E., Diez, E., Jotereau, F. V. (1985). Tissue distribution and ontogenic appearance of a chicken T lymphocyte differentiation marker. Eur. J. Immunol. 15,305-308. Houssaint, E., Tobin, S., Cihak, J., L6sch, U. (1987). A chicken leukocyte common antigen: biochemical characterization and ontogenetic study. Eur. J. Immunol. 17, 287-290. Houssaint, E., Mansikka, A., Vainio, O. (1991). Early separation of B and T lymphocyte precursors in chick embryo. J. Exp. Med. 174, 397-406. Huang, H. V., Dreyer, W. M. (1978). Bursectomy in ovo blocks the generation of immunoglobulin diversity. J. Immunol. 121, 1738-1747. Hudson, L., Pattison, H., Thantrey, N. (1975). Specific B lymphocyte suppression by infectious bursal agent

AVIAN IMMUNOLOGY

(Gumboro disease virus) in chickens. Eur. J. Immunol. 5, 675-679. Huffnagle, G. B., Ratcliffe, M. J. H., Humphries, E. H. (1989). Bu-2, a novel avian cell surface antigen on B cells and a population of non-lymphoid cells, is expressed homogeneously in germinal centers. Hybridoma 8,589-604. Ianconescu, M., Yaniv, A., Gazit, A., Perk, K., Zimber, A. (1983). Susceptibility of domestic birds to lymphoproliferative disease virus (LPDV) of turkeys. Avian Pathol. 12, 291-302. Imai, K., Yuasa, N., Furuta, K., Narita, M., Banba, H., Kobayasi, S., Horiuchi, T. (1991). Comparative studies on pathogenical, virological and serological properties of Marek's disease virus isolated from Japanese quail and chicken. Avian Pathol. 20, 57-65. Inoue, M., Fukuda, M., Miyano, K. (1994). Thymic lesions in chicken infected with infectious bursal disease virus. Avian Dis. 38, 839-846. Isobe, T., Kohno, M., Suzuki, K., Yoshihara, S. (1989). Leucocytozoon caulleryi infection in bursectomized chickens. In Coccidia and Intestinal Coccidiomorphs (ed. INRA), pp. 7985. INRA, Tours, France. Ivanyi, J. (1975). Immunodeficiency in the chicken. II. Production of monomeric IgM following testosterone treatment of infection with Gumboro disease. Immunology 28, 10151021. Ivanyi, J. (1981). Functions of the B-lymphoid system in chickens. In Avian Immunology (eds Rose, M. E, Payne, L. N., Freeman, B. M.), pp. 63-101. Clark Constable Limited, Edinburgh, UK. Ivanyi, J., Morris, R. (1976). Immunodeficiency in the chicken. IV. An immunologic study of infectious bursal disease. Clin. Exp. Immunol. 23,154-165. Jakobisiak, M., Sundick, 1~. S., Bacon, L. D., Rose, N. R. (1976). Abnormal response to minor histocompatability antigens in Obese strain chickens. Proc. Natl Acad. Sci. USA 73, 28772880. Jakowlew, S. B., Dillard, P. j., Sporn, M. B, Roberts, A. B. (1988a). Nucleotide sequence of chicken transforming growth factor-beta 1 (TGF-beta 1). Nucl. Acids Res. 16, 8730. Jakowlew, S. B., Dillard, P. J., Sporn, M. B., Roberts, A. B. (1988b). Complementary deoxyribonucleic acid cloning of a messenger ribonucleic acid encoding transforming growth factor 4 from chicken embryo chondrocytes. Mol. Endocrinol. 2, 1186-1195: Jakowlew, S. B., Dillard, P. J., Kondaiah, P., Sporn, M. B, and Roberts, A. B. (1988c). Complementary deoxyribonucleic acid cloning of a novel transforming growth factor-beta messenger ribonucleic acid from chick embryo chondrocytes. Mol. Endocrinol. 2, 747-755. Jakowlew, S. B., Dillard, P. J., Sporn, M. B., Roberts, A. B. (1990). Complementary deoxyribonucleic acid cloning of an mRNA encoding transforming growth factor-fl2 from chicken embryo chondrocytes. Growth Factors 2, 123-133. Jakowlew, S. B., Mathias, A., Lillehoj, H.S. (1997). Transforming growth factor-fi isoforms in the developing chicken intestine and spleen: increase in transforming growth factorf14 with coccidia infection. Vet. Immunol. Immunopathol. 55, 321-339. Jakowski, R. M., Fredrickson, T. N., Luginbuhl, R. E. (1973). Immunoglobulin response in experimental infection with cellfree and cell-associated Marek's disease virus. J. Immunol. 111,238-248.

References

Jankovic, B. D. (1987). Neuroimmune interactions: experimental and clinical strategies. Immunol. Lett. 16, 341-354. Jaroszewski, M., Sundick, R. S., Rose, N. R. (1978). Effects of antiserum containing thyroglobulin antibody on the chicken thyroid gland. Clin. Immunol. Immunopathol. 10, 95-103. Jensen, L. B., Koch, C. (1991). An assay for complement factor B in species at different levels of evolution. Develop. Comp. Immunol. 15,173-179. Jeurissen, S. H. M. (1993). The role of various compartments in the chicken spleen during an antigen-specific humoral response. Immunology 80, 29-33. Jeurissen, S. H., Janse, E. M., Ekino, S., Nieuwenhuis, P., Koch, G., de Boer, G. F. (1988a). Monoclonal antibodies as probes for defining cellular subsets in the bone marrow, thymus, bursa of Fabricius, and spleen of the chicken. Vet. Immunol. Immunopathol. 19, 225-238. Jeurissen, S. H. M., Janse, E. M., Koch, G., de Boer, G. F. (1988b). The monoclonal antibody CVI-ChN1-68.1 recognizes cells of the monocyte-macrophage lineage in chickens. Dev. Comp. Immunol. 12, 855-864. Jeurissen, S. H. M., Janse, E. M., Koch, G., de Boer, G. F. (1989). Postnatal development of mucosa-associated lymphoid tissue in chickens. Cell Tissue Res. 258, 119-124. Jeurissen, S. H., Claassen, E., Janse, E. M. (1992). Histological and functional differentiation of non-lymphoid cells in the chicken spleen. Immunology 77, 75-80. Jeurissen, S. H., Janse, M. E., Van Roozelaar, D. J., Koch, G., de Boer, G. F. (1992a). Susceptibility of thymocytes for infection by chicken anemia virus is related to pre- and posthatching development. Dev. Immunol. 2, 123-129. Jeurissen, S. H., Wagenaar, F., Pol, J. M., van der Eb, A. J., Noteborn, M. H. (1992b). Chicken anemia virus causes apoptosis of thymocytes after in vivo infection and of cell lines after in vitro infection. J. Virol. 66, 7383-7388. Joshi, P., Glick, B. (1990). Lymphocyte inhibitory and chemotactic factors produced by bursal and thymic lymphocytes. Poult. Sci. 69, 249-258. Jotereau, F. V., Houssaint, E., Le Douarin, N. M. (1980). Lymphoid stem cell homing to the early thymic primordium of the avian embryo. Eur. J. Immunol. 10, 620-627. Kai, C., Yoshikawa, Y., Yamanouchi, K., Okada, H. (1983). Isolation and identification of the third component of complement of Japanese quails. J. Immunol. 130, 2814-2820. Kai, C., Yoshikawa, Y., Yamanouchi, K., Okada, H., Morikwawa, S. (1985). Ontogeny of the third component of complement of Japanese quails. Immunology 54, 463-470. Kaidoh, T., Gigli, I. (1987). Phylogeny of C4b-C3b cleaving activity: similar fragmentation patterns of human C4b and C3b produced by lower animals. J. Immunol. 139, 194201. Kaplan, M. H., Sundick, R. S., Rose, N. R. (1991). Autoimmune diseases. In Avian Cellular Immunology (ed. Sharma, J. M.), pp. 183-197. CRC Press, Boca Raton, FL, USA. Kaplan, M. H., Dhar, A., Brown, T. R., Sundick, R. S. (1992). Marek's disease virus-transformed chicken T-cell lines respond to lymphokines. Vet. Immunol. Immunopathol. 34, 63-79. Kaplan, M. H., Smith, D. I., Sundick, R. S. (1993). Identification of G protein coupled receptor induced in activated T cells. J. Immunol. 151,628-636. Kasahara, Y., Chen, C. H., Cooper, M. D. (1993). Growth requirements for avian 78 T cells include exogenous cyto-

125

kines, receptor ligation and in vivo priming. Eur. J. Immunol. 23, 2230-2236. Kasahara, Y., Chen, C. H., Gobel, T. W. F., Bucy, R. P., Cooper, M. D. (1994). Intraepithelial lymphocytes in birds. In Advances in Host Defense Mechanisms (eds Gallin, J. I., Fauci, A. S.), pp. 163-174. Raven Press, New York, USA. Kasai, K., Nakayama, A., Ohbayashi, M., Nakagawa, A., Ito, M., Saga, S., Asai, J. (1995). Immunohistochemical characteristics of chicken spleen ellipsoids using newly established monoclonal antibodies. Cell Tissue Res. 281,135-141. Kaspers, B., Lillehoj, H. S., Lillehoj, E. P. (1993). Chicken macrophages share a common cell surface antigen defined by a monoclonal antibody. Vet. Immunol. Immunopathol. 36, 333-346. Kaspers, B., Lillehoj, H.S., Jenkins, M.C., Pharr, G.T. (1994). Chicken interferon-mediated induction of major histocompatibility complex class II antigens on peripheral blood monocytes. Vet. Immunol. Immunopathol. 44, 71-84. Katz, D., Kohn, A., Arnon, R. (1974). Immunoglobulins in the airway washings and bile secretions of chickens. Eur. J. Immunol. 4, 494-499. Kaufman, J., Skjoedt, K., Salomonsen, J. (1991). The B-G multigene family of the chicken major histocompatibility complex. Crit. Rev. Immunol. 11,113-143. Kaufman, J., Andersen, R., Avila, D., Engberg, J., Lambris, J., Salomonsen, J., Welinder, K., Skjoedt, K. (1992). Different features of the MHC class I heterodimer have evolved at different rates: chicken B-F and beta2-microglobulin sequences reveal invariant surface residues. J. Immunol. 148, 1532-1546. Kaufman, J., Bumstead, N., Miller, M., Riegert, P., Salomonsen, J. (1995a). The chicken class II alpha gene is located outside of the B complex. In Advances in Avian Immunology Research (eds Davison, T. F., Bumstead, N., Kaiser, P.), pp. 119-127. Carfax, Abingdon, UK. Kaufman, J., Voelk, H., Walny, H.-J. (1995b). A 'minimal essential MHC' and an 'Unrecognized MHC': two extremes in selection for polymorphism. Immunol. Rev. 143, 6388. Kehrl, J. H., Wakefield, L. M., Roberts, A. B., Jakowlew, S. B., Alvarez-Mon, M., Derynck, R., Sporn, M. B., Fauci, A. S. (1986). Production of transforming growth factor fl by human' T lymphocytes and its potential role in the regulation of T cell growth. J. Exp. Med. 163, 1037-1050. Kerr, K. M., Olson, N. O. (1969). Pathology of chickens experimentally inoculated or contact-infected with an arthritisproducing virus. Avian Dis. 13,729-745. Kierszenbaum, F., Ivanyi, J., Budzko, D. (1976). Mechanisms of natural resistance to trypanosomal infection. Immunology 30, 1-6. Kimijima, T., Hashimoto, Y., Kitagawa, H., Kon, Y., Sugimura, M. (1990). Localization of immunoglobulins in the chicken oviduct. Jap. J. Vet. Sci. 52, 299-306. Kincade, P. W., Cooper, M. D. (1971). Development and distribution of immunoglobulin-containing cells in the chicken: an immunofluorescent analysis using purified antibodies/~, 7, and light chains. J. Immunol. 106, 371-382. Kittner, Z., Olah, I. (1980). Contribution of chicken's central lymphoid organs to the cellular composition of the gland of Harder. Acta Biol. Acad. Sci. Hung. 31,177-185. Kjalke, M., Welinder, K. G., Koch, C. (1993). Structural analysis of chicken factor B-like protease and comparison with roam-

126

malian complement proteins factor B and C. J. Immunol. 151, 4147-4152. Klasing, K. C. (1991). Avian inflammatory response: mediation by macrophages. Poult. Sci. 70, 1176-1186. Klasing, K. C. (1994). Avian leukocytic cytokines. Poult. Sci. 73, 1035-1043. Klasing, K. C., Peng, R. K. (1990). Monokine-like activities released from a chicken macrophage line. Anim. Biotech. 1, 107-120. Knabel, M., Loesch, U. (1993). Characterization of new monoclonal antibodies identifying avian T lymphocyte antigens. Immunology 188, 415-429. Knabel, M., Cihak, J., L6sch, U. (1993). Characterization of new monoclonal antibodies identifying avian T lymphocyte antigens. Immunobiology 188,415-429. Koch, C. (1986a). Complement system in avian species. In Avian Immunology: Basis and Practice (eds Toivanen, A., Toivanen, P.), pp. 43-55. CRC Press, Boca Raton, FL, USA. Koch, C. (1986b). The alternative complement pathway in chickens. Purification of factor B and production of a monospecific antibody against it. Acta Path. Microbiol. Immunol. Scand., Se. C 94, 253-259. Koch, C. (1986c). A genetic polymorphism of the complement component factor B in chickens not linked to the major histocompatibility complex (MHC). Immunogenetics 23, 364-367. Koch, G., Jongenelen, I. M. C. A. (1988). Quantification and class distribution of immunoglobulin-secreting cells in the mucosal tissues of the chicken. In Histophysiology of the Immune System (eds Fossum, S., Rolstad, B.), pp. 633-639. Plenum Publishing, New York, USA. K6hler, G., Milstein, C. (1975). Continuous cultures of fused cells secreting antibody of defined specificity. Nature 256, 495-497. Kondo, T., Hattori, M., Kodama, H., Onuma, M., Mikami, T. (1990). Characterization of two monoclonal antibodies which recognize different subpopulations of chicken T lymphocytes. Japan. J. Vet. Res. 38, 11-18. Kon-Ogura, T., Kon, Y., Onuma, M., Kondo, T., Hashimoto, Y., Sugimura, M. (1993). Distribution of T cell subsets in chicken lymphoid tissues. J. Vet. Med. Sci. 55, 59-66. Koppenheffer, T. L., Russell, B. (1986). Unusual complement activation properties of serum immunoglobulins of the pigeon Columba livia. Immunology 57, 473-478. Kornfeld, S., Beug, H., Doderlein, G., Graf, T. (1983). Detection of avian hemopoietic surface antigens with monoclonal antibodies to myeloid cells: their distribution, on normal and leukemic cells of various lineages. Exp. Cell Res. 143, 383394. Kowalczyk, K., Daiss, J., Halpern, J., Roth, T. F. (1985). Quantitation of maternal-fetal IgG transport in the chicken. Immunology 54, 755-762. Kroemer, G., Zoorob, R., Auffray, C. (1990). Structure and expression of a chicken MHC class I gene. Immunogenetics 31,405-409. Kr6mer, G., Sundick, R. S., Schauenstein, K., Halfi, K., Wick, G. (1985). Analysis of lymphocytes infiltrating the thyroid gland of Obese strain chickens. J. Immunol. 135, 2452-2457. Kr6mer, G., Neu, N., Kuehr, T., Dietrich, H., F~issler, R., Haiti, K., Wick, G. (1989). Immunogenetic analysis of spontaneous autoimmune thyroiditis of Obese strain chickens. Clin. Immunol. ImmunopathoI. 52, 202-213. Kubota, T., Chen, C. H., Hockett, R., G6bel, T. W. F., Cooper,

AVIAN IMMUNOLOGY

M. D. (1995). Conservation of the T cell receptor 0~/6 locus in chickens. FASEB J. 9, 4736. Kung, H.-J., Maihle, N. J. (1987). Molecular basis of oncogenesis by non-acute avian retroviruses. In Avian Leukosis (ed. de Boer, G. F.), pp. 77-99. Martinus Nijhoff Publishing, Dordrecht, The Netherlands. Kung, H.-J., Boerkoel, C., Carter, T. H. (1992). Retroviral mutagenesis of cellular oncogenes: a review with insights into the mechanisms of insertional activation. Curr. Topics Microbiol. Immunol. 171, 1-26. Lahti, J. M., Chen, C. H., Tjoelker, L. W., Pickel, J. M., Schat, K. A., Calnek, B. W., Thompson, C. B., Cooper, M. D. (1991). Two distinct 0~fl T-cell lineages can be distinguished by the differential usage of T-cell receptor Vfl gene segments. Proc. Natl Acad. Sci. USA 88, 10956-10960. Lamont, S. J., Smyth Jr, J. R. (1981). Effect of bursectomy on development of a spontaneous postnatal amelanosis. Clin. Immunol. Immunopathol. 21,407-411. Lamont, S. J., Boissy, R. E., Smyth Jr, J. R. (1982). Humoral immune response and expression of spontaneous postnatal amelanosis in DAM line chickens. Immunol. Commun. 11, 121-127. Lamont, S. J., Bohn, C., Cheville, N. (1987). Genetic resistance to fowl cholera is linked to the major histocompatibility complex. Theor. Appl. Genet. 25,284-289. Lassila, O. (1989). Emigration of B cells from chicken bursa of Fabricius. Eur. J. Immunol. 19, 955-958. Lassila, O., Eskola, J., Toivanen, P. (1978). The origin of lymphoid stem cells studied in chicken yolk-sac-embryo chimaeras. Nature 272, 353-354. Lassila, O., Lefkovits, I., Alanen, A. (1989). Immunoglobulin diversification in bursal duct-ligated chickens. Eur. J. Immunol. 19, 1343-1345. Laursen, I., Koch, C. (1989). Purification of chicken C3 and a structural and functional characterization. Scand. J. Immunol. 30, 529-538. Lawn, A. M., Rose, M. E., Bradley, J. W., Rennie, M. C. (1988). Lymphocytes of the intestinal mucosa of chickens. Cell. Tissue Res. 252, 189-195. Lee, L. F., Sharma, J. M., Nazerian, K., Witter, R. L. (1978a). Suppression and enhancement of mitogen response in chickens infected with Marek's disease virus and the herpesvirus of turkeys. Infect. Immun. 21,474-479. Lee, L. F., Sharma, J. M., Nazerian, K., Witter, R. L. (1978b). Suppression of mitogen-induced proliferation of normal spleen cells by macrophages from chickens inoculated with Marek's disease virus. J. Immunol. 120, 1554-1565. Lee, T. H., Tempelis, C. H. (1992). A possible 110-kDa receptor for interleukin-2 in the chicken. Dev. Comp. Immunol. 16, 463-472. Leibold, W., Janotte, G., Peter, H. H. (1980). Spontaneous cell mediated cytotoxicity (SCMC) in various mammalian species and chickens: selective reaction pattern and different mechanisms. Scand. J. ImmunoI. 11,203-222. Leslie, G. A., Stankus, R. P., Martin, L. N. (1976). Secretory immunological system of fowl. V. The gallbladder: an integral part of the secretory immunological system of fowl. Int. Arch. Allergy Appl. Immunol. 51,175-185. Lessard, M., Hutchings, D. L., Spencer, J. L., Lillehoj, H. S., Gavora, J. S. (1996). Influence of Marek's disease virus strain AC-1 on cellular immunity in birds carrying endogenous viral genes. Avian Dis. 40, 645-653.

R

e

f

e

r

e

n

c

Leutz, A., Beug, H., Graf, T. (1984). Purification and characterization of cMGF, a novel chicken myelomonocytic growth factor. EMBO J. 3, 3191-3197. Leutz, A., Beug, H., Walter, C., Graf, T. (1988). Hematopoietic growth factor glycosylation: multiple forms of chicken myelomonocytic growth factor. J. Biol. Chem. 263, 39053911. Leutz, A., Datum, K., Sterneck, E., Kowenz, E., Ness, S., Frank, R., Gausepohl., H., Pan, Y.-C., Smart, J., Hayman, M., Graf, T. (1989). Molecular cloning of chicken myelomonocytic growth factor (cMGF) reveals relationship to interleukin 6 and granulocyte colony stimulating factor. EMBO J. 8, 175181. Lewis, R. B., McClure, J., Rup, B., Niesel, D. W., Garry, R. F., Hoelzer, J. D., Nazerian, K., Bose Jr, H. R. (1981). Avian reticuloendotheliosis virus: identification of the hematopoietic target cell for transformation. Cell 25,421-431. Ley, D. H., Yamamotao, R., Bickford, A. A. (1983). The pathogenesis of infectious bursal disease: serologic, histopathologic, and clinical chemical observations. Avian Dis. 27, 1060-1085. Li, J., Calnek, B. W., Schat, K. A., Graham, D. L. (1983). Pathogenesis of reticuloendotheliosis virus infection in ducks. Avian Dis. 27, 1090-1105. Lillehoj, H. S. (1987a). Effects of immunosuppression on avian coccidiosis: cyclosporin A but not hormonal bursectomy abrogates host protective immunity. Infec. Immun. 55, 16161621. Lillehoj, H. S. (1987b). Secretory IgA response in SC and FP chickens experimentally inoculated with Eimeria tenella and acervulina. In Recent Advances in Mucosal Immunology (eds McGhee, J. R., Bienenstock, J., Orga, P. L.), pp. 977-980. Plenum Publishing Corp., New York, USA. Lillehoj, H. S. (1989). Intestinal intraepithelial and splenic natural killer cell responses to Eimerian infections in inbred chickens. Infec. Immun. 57, 1879-1884. Lillehoj, H. S. (1991a). Cell-mediated immunity in parasitic and bacterial diseases. In Avian Cellular Immunology (ed. Sharma, J. M.), pp. 155-181. CRC Press, Boca Raton, FL, USA. Lillehoj, H. S. (1991b). Lymphocytes involved in cell-mediated immune responses and methods to assess cell-mediated immunity. Poult. Sci. 70, 1154-1164. Lillehoj, H. S. (1993). Avian interleukin-2 and interferon. Avian Immunology in Progress, Tours (France), August 31-September 2, pp. 105-111. Lillehoj, H. S. (1994). Analysis of Eimeria acervulina-induced changes in intestinal T lymphocyte subpopulations in two inbred chickens showing different levels of disease susceptibility to coccidia. Res. Vet. Sci. 56, 1-7. Lillehoj, H. S., Chai, J. Y. (1988). Comparative natural killer cell activities of thymic, bursal, splenic and intestinal intraepithelial lymphocytes. Dev. Comp. Immunol. 12, 629-643. Lillehoj, H. S., Cheung, K. S. (1992). Postnatal development of T lymphocyte subpopulations in the intestinal intraepithelium and lamina propria in chickens. Vet. Immunol. Immunopathol. 31,347-360. Lillehoj, H. S., Ruff, M. D. (1986). Comparison of disease susceptibility and subclass specific antibody response in SC and FP chickens experimentally inoculated with E. tenella, E. acervulina or E. maxima. Avian Dis. 31,112-119. Lillehoj, H. S., Trout, J. M. (1993). Coccidia: a review of recent

e

s

1

2

7

advances in immunity and vaccine development. Avian Pathol. 22, 3-21. Lillehoj, H. S., Trout, J. M. (1994). CD8 + T cell coccidia interactions. Parasit. Today 10, 10-14. Lillehoj, H. S., Trout, J. M. (1996). Avian gut-associated lymphoid tissues and intestinal immune responses to Eimeria parasites. Clin. Microbiol. Rev. 9, 349-360. Lillehoj, H. S., Lillehoj, E. P., Weinstock, D., Schat, K. A. (1988a). Functional and biochemical characterization of Avian T lymphocyte antigens identified by monoclonal antibodies. Eur. J. Immunol. 18, 2059-2066. Lillehoj, H. S., Kim, S., Lillehij, E. P., Bacon, L. D. (1988b). Quantitative differences in Ia antigen expression in the spleens of 15I-5-B congenic and inbred chickens as defined by a new monoclonal antibody. Poult. Sci. 67, 1525-1535. Lillehoj, H. S., Kang, S. Y. Keller, L, Sevoian, M. (1989). Eimeria tenella and E. acervulina: lymphokines secreted by an avian T cell lymphoma or by sporozoite-stimulated lymphocytes protect chickens against avian coccidiosis. Exper. Parasitol. 69, 54-64. Lillehoj, H. S., Isobe, T., Weinstock, D. (1993). Tissue distribution and cross-species reactivity of new monoclonal antibodies detecting chicken T lymphocytes and macrophages. In Avian Immunology in Progress (ed. Coudert, F.), pp. 37-42. INRA editions, Paris, France. Liu, X., Lee, L. F. (1983). Kinetics of phytohemagglutinin response in chickens infected with various strains of Marek's disease virus. Avian Dis. 27, 660-666. Livezey, M. D., Sundick, R. S., Rose, N. R. (1981). Spontaneous autoimmune thyroiditis in chickens: II. Evidence for autoresponsive thymocytes. J. Immunol. 127, 1469-1472. Longenecker, B. M., Pazderka, F., Stone, H. S., Gavora, J. S., Ruth, R. F. (1975). In ovo assay for Marek's disease virus and turkey herpesvirus. Infec. Immun. 11,922-931. Loppnow, H., Flad, H.-D., Dtirrbaum, I., Musehold, G., Fetting, R., Ulmer, A. J., Herzbeck, H., Brandt, E. (1989). Detection of interleukin 1 with human dermal fibroblasts. Immunobiology 179, 283-291. Lowenthal, J. W., Digby, M. R., York, J. J. (1995). Production of interferon- 7 by chicken T cells. J. Interferon Cytok. Res. 15, 933-938. Lu, Y.-S., Lapen, R. L. (1974). Splenic cell mitogenic response in Marek's disease: comparison between noninfected tumorbearing and nontumor-bearing infected chickens. Am. J. Vet. Res. 35,977-980. Lucio, B., Schat, K. A., Shivaprasad, H. L. (1990). Identification of the chicken anemia agent, reproduction of the disease, and serological survey in the United States. Avian Dis. 34, 146153. Luhtala, M., Salomonsen, J., Hirota, Y., Onodera, T., Toivanen, P., Vainio, O. (1993). Analysis of chicken CD4 by monoclonal antibodies indicates evolutionary conservation between avian and mammalian species. Hybridoma 12, 633-646. Luhtala, M., Koskinen, R., Toivanen, P., Vainio, O. (1995). Characterization of chicken CD8-specific monoclonal antibodies recognizing novel epitopes. Scand. J. Immunol. 42, 171174. Lupetti, M., Dolfi, A., Giannessi, F., Bianchi, F., Michelucci, S. (1990). Reappraisal of histogenesis in the bursal lymphoid follicle of the chicken. Am. J. Anat. 187, 287-302. Maccubin, D. L., Schierman, L. W. (1986). MHC restricted cytotoxic response of chicken T cells: expression, aug-

128.

mentation and clonal characterisation. J. Immunol. 136, 12-16. Mansikka, A. (1992). Chicken IgA H chains. Implications concerning the evolution of H chain genes. J. Immunol. 149, 855861. Mansikka, A., Veromaa, T., Vainio, O., Toivanen, P. (1989). Bcell differentiation in the chicken: expression of immunoglobulin genes in the bursal peripheral lymphocytes. Scand. J. Immunol. 29, 325-332. Mansikka, A., Sandberg, M., Lassila, O., Toivanen, P. (1990a). Rearrangement of immunoglobulin light chain genes in the chicken occurs prior to colonization of the embryonic bursa of Fabricius. Proc. Natl Acad. Sci. USA 87, 9416-9420. Mansikka, A., Jalkanen, S., Sandberg, M., Granfors, K., Lassila, O., Toivanen, P. (1990b). Bursectomy of chicken embryos at 60 h of incubation leads to an oligoclonal B cell compartment and restricted Ig diversity. J. Immunol. 145, 3601"3609. Marmor, M. D., Benatar, T., Ratcliffe, M. J. H. (1993). Retroviral transformation in vitro of chicken T cells expressing either ~/fl or 7/8 T cell receptors by reticuloentheliosis virus strain T. J. Exp. Med. 177, 647-656. Marsh, J. A. (1993). The humoral activity of the avian thymic microenvironment. Poult. Sci. 72, 1294-1300. Marsh, J. A., Scanes, C. G. (1994). Neuroendocrine-immune interactions. Poult. Sci. 73, 1049-1061. Marsh, J. A., Combs Jr, G. F., Whitacre, M. E., Dietert, R. R. (1986). Effect of selenium and vitamin E dietary deficiencies on chick lymphoid organ development. Proc. Soc. Exp. Biol. Med. 182, 425-436. Marsh, J. A., Johnson, E., Safieh, B., Kendall, M., Dardenne, M., Scanes, C. G. (1991). Assessment of thymulin activity in Cornell K and SLD chickens. Poult. Sci. 70 (Suppl. 1), 24. (abstract). Martin, A., Lillehoj, H. S., Kasper, B., Bacon, L. D. (1994). Mitogen-induced lymphocyte proliferation and interferon production induced by coccidia infection. Avian Dis. 38, 262-268. Martin, C., Beaupain, D., Dieterlen-Lievre, F. (1978). Developmental relationships between vitelline and intraembryonic haematopoiesis studied in avian yolk sac chimeras. Cell Differ. 7, 115-130. Maslak, D. M., Reynolds, D. L. (1995). B cells and T lymphocyte subsets of the head-associated lymphoid tissues of the chicken. Avian Dis. 39, 736-742. Massague, J. (1990). The transforming growth factor-fl family. Annu. Rev. Cell Biol. 6, 597-641. Mast, J., Cooper, M. D. (1995). Monoclonal antibodies reactive with the chicken monocyte/macrophage lineage. In Advances in Avian Immunology Research (eds Davison, T. F., Bumstead, N., Kaiser, P.), pp. 39-48. Abingdon, Oxfordshire, UK. Masteller, E. L., Thompson, C. B. (1994). B cell development in the chicken. Poult. Sci. 73,998-1011. Masteller, E. L., Larsen, R. D., Carlson, L. M., Pickel, J. M., Nickoloff, B., Lowe, J., Thompson, C. B., Lee, K. P. (1995). Chicken B cells undergo discrete development changes in surface carbohydrate structure that appear to play a role in directing lymphocyte migration during embryogenesis. Development 121, 1657-1667. Matsuda, H., Inoue, M., Negoro, Murata, M. (1990). A monoclonal antibody against chicken monocytic leukemia cell line. Jap. J. Vet. Sci. 52, 1285-1288. Mavroidis, M., Sunyer, J., Lambris, J. D. (1995). Isolation,

AVIAN I M M U N O L O G Y

primary structure, and evolutiorr of the third component of chicken complement and evidence for a new member of the ~2-macroglobulin family. J. Immunol. 154, 2164-2174. Mazariegos, L. A., Lukert, P. D., Brown, J. (1990). Pathogenicity and immunosuppressive properties of infectious bursal disease 'intermediate' strains. Avian Dis. 34, 203-208. McConnell, C. D., Adair, B. M., McNulty, M. S. (1993a). Effects of chicken anemia Virus on cell-mediated immune function in chickens exposed to the virus by a natural route. Avian Dis. 37, 366-374. McConnell, C. D., Adair, B. M., McNulty, M. S. (1993b). Effects of chicken anemia virus on macrophage function in chickens. Avian Dis. 37, 358-365. McCormack, W. T., Thompson, C. B. (1990). Chicken IgL variable region gene conversions display pseudogene donor preference and 5' to 3' polarity. Genes Dev. 4, 548-558. McCormack, W. T., Tjoelker, L. W., Carlson, L. M., Petryniak, B., Barth, C. (1989). Chicken IgL gene rearrangement involves deletion of a circular episome and addition of single nonrandom nucleotides to both coding segments. Cell 56, 785-791. McCormack, W. T., Tjoelker, L. W., Thompson, C. B. (1991a). Avian B-cell development: generation of an immunoglobulin repertoire by gene conversion. Annu. Rev. Irnmunol. 9, 219241. McCormack, W. T., Tjoelker, L. W., Stella, G., Postema, C., Thompson; C. B. (1991b). Chicken T-cell receptor fl-chain diversity: an evolutionarily conserved Dfl-encoded glycine turn within the hypervariable CDR3 domain. Proc. Natl Acad. Sci. USA 88, 7699-7703. McDougall, J. S., Biggs, P. M., Shilleto, R. W. (1978). A leukosis in turkeys associated with infection with reticuloendotheliosis virus. Avian Pathol. 7, 557-568. McGhee, J. R., Mestecky, J., Elson, C. O., Kiyono, H. (1989). Regulation of IgA synthesis and immune response by T cells and interleukins. J. Clin. Imrnunol. 9, 175-199. McNagny, K. M., Lim, F., Grieser, S., Graf, T. (1992). Cell surface proteins of chicken hematopoietic progenitors, thrombocytes and eosinophils detected by novel monoclonal antibodies. Leukemia 6, 975-984. Miller, M. M., Pink, J. R. L. (1986). Chick embryonic erythrocyte antigen-tissues sharing expression. Exp. Cell Res. 167, 295310. Miller, M. M., Goto, R., Bernot, A., Zoorob, R., Auffray, C., Bumstead, N., Briles, W. E. (1994). Two MHC class I and two MHC class II genes map to the chicken Rfp-Y system outside the B complex. Proc. Natl Acad. Sci. USA 91, 4397-4401. Misra, R. R., Bloom, S. E. (1991). Roles of dosage, pharmacokinetics, and cellular selectivity to damage in selective toxicity of cyclophosphamide towards B and T cells in development. Toxicology 66, 239-256. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., Papaioannou, V. E. (1992). RAG-1 deficient mice have no mature T and B lymphocytes. Cell 68, 869-877. Montgomery, R. D., Villegas, P., Dowe, D. L., Brown, J. (1986). A comparison between the effect of avian reoviruses and infectious bursal disease virus on selected aspects of the immune system of the chicken. Avian Dis. 30, 298-308. Moore, M. A. S., Owen, J. J. T. (1966). Experimental studies on the development of the bursa of Fabricius. Dev. Biol. 14, 4051. Moradian, A., Thorsen, J., Julian, R. J. (1990). Single and combined infections of specific-pathogen-free chickens with

References

infectious bursal disease virus and an intestinal isolate of reovirus. Avian Dis. 34, 63-72. Morimura, T., Ohashi, K., Hattori, M., Sugimoto, C., Onuma, M. (1996). Apoptosis and nonresponsiveness of T cells in chickens infected with Marek's disease virus. Proc. 4th Int. Symp. Marek's Disease, p. 55. Motyka, B., Reynolds, J. D. (1991). Apoptosis is associated with extensive B cell death in the sheep ileal Peyer's patch and the chicken bursa of Fabricius: a possible role in B cell selection. Eur. J. Immunol. 21, 1951-1958. Muir, R. (1911). Relationships between the complements and immune bodies of different animals: the mode of action of immune body. J. Path. Bact. 16, 523-524. M~ller, H. (1986). Replication of infectious bursal disease virus in lymphoid cell. Arch. Virol. 87, 191-203. Mfiller, R., Kaufer, I., Reinacher, M., Weiss, E. (1979). Immunofluorescent studies of early virus propagation after oral infection with infectious bursal disease virus (IBDV). Zentralbl. Veterinaermed. Reihe B 26, 345-352. Murthy, K. K., Beach, F. G., Ragland, W. L. (1984). Expression of T cell markers on chicken bone marrow precursor cells incubated with an avian thymic hormone. In Thymic Hormones and Lymphokines (ed. Goldstein, A. L.), pp. 375-82. Plenum Press, New York, USA. Myers, T. J., Lillehoj, H. S., Fetterer, R. H. (1992). Partial purification and characterization of chicken interleukin-2. Vet. Immunol. Immunopathol. 34, 97-114. Nagaraja, K. V., Emery, D. A., Patel, B. S., Pomeroy, B. S., Newman, J. A. (1982a). In vitro evaluation of B-lymphocyte function in turkeys infected with hemorrhagic enteritis virus. Am. J. Vet. Res. 43,502-504. Nagaraja, K. V., Patel, B. L., Emery, D. A., Pomeroy, B. A., Newman, J. A. (1982b). In vitro depression of the mitogenic response of lymphocytes from turkeys infected with hemorrhagic enteritis virus. Am. J. Vet. Res. 43, 134-136. Nagaraja, K. V., Kang, S. Y., Newman, J. A. (1985). Immunosuppressive effect of virulent strain of hemorrhagic enteritis virus in turkeys vaccinated against Newcastle disease. Poult. Sci. 64, 588-590. Nakai, T., Hirai, K. (1981). In vitro infection of fractionated chicken lymphocytes by infectious bursal disease virus. Avian Dis. 25,831-838. Naqi, S. A., Marquez, B., Sahin, N. (1983). Maternal antibody and its effect on infectious bursal disease immunization. Avian Dis. 27, 623-631. Naukkarinen, A. (1982). Transport of colloidal carbon from the lymphoid follicles to other tissue compartments in the chicken bursa of Fabricius. J. Reticuloendothel. Soc. 31,423-432. Naukkarinen, A., Hippelainen, M. (1989). Development of the peripheral immune function in the chicken. A study on the bursa of Fabricius isolated from the rest of the gut-associated lymphoid tissue (GALT). APMIS 97, 787-792. Naukkarinen, A., Sorvari, T. E. (1982). Morphological and histochemical characterization of the medullary cells in the bursal follicles of the chicken. Acta Pathol. Microbiol. Immunol. Scand. 90, 193-199. Naukkarinen, A., Sorvari, T. E. (1984). Involution of the chicken bursa of Fabricius: a light microscopic study with special reference to transport of colloidal carbon in the involuting bursa. J. Leukoc. Biol. 35,281-290. Naukkarinen, A., Syrjanen, K. J. (1984). Effects of anti-T lymphocyte serum on immunological reactivity and on the T

129

cell area of the cloacal bursa in the chicken. Acta Pathol. Microbiol. Immunol. Scand. 92, 145-152. Nazerian, K., Elmubarak, A., Sharma, J. M. (1982). Establishment of B-lymphoblastoid cell lines from Marek's disease virus-induced tumors in turkeys. Intl. J. Cancer 29, 63-68. Neiman, P. E. (1994). Retrovirus-induced B cell neoplasia in the bursa of Fabricius. Adv. Immunol. 56, 467-484. Neiman, P. E., Thomas, S. J., Loring, G. (1991). Induction of apoptosis during normal and neoplastic B cell development in the bursa of Fabricius. Proc. Natl Acad. Sci. USA 88, 58575861. Neu, N., Hala, K., Dietrich, H., Wick, G. (1985). Spontaneous autoimmune thyroiditis in Obese strain chickens: a genetic analysis of target organ abnormalities. Clin. Immunol. Immunopathol. 37, 397-405. Neu, N., Hal~, K., Dietrich, H., Wick, G. (1986). Genetic background of spontaneous autoimmune thyroiditis in the Obese strain of chickens studied in hybrids with an inbred line. Int. Arch. Allergy Appl. Immun. 80, 168-173. Nicolas-Bolnet, C., Johnston, P. A., Kemper, A. E., Ricks, C., Petitte, J. N. (1995). Synergistic action of two sources of avian growth factors on proliferative differentiation of chick embryonic hematopoietic cells. Poult. Sci. 7"4, 1102-1116. Nossal, G. J. V. (1994). Negative selection of lymphocytes. Cell 76, 229-239. Noteborn, M. H. M., de Boer, G. F., van Roozelaar, D. J., Karreman, C., Kranenburg, O., Vos, J. G., Jeurissen, S. H., Hoeben, R. C., Zantema, A., Koch, G. (1991). Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. J. Virol. 65, 3131-3139. Nusbaum, K. E., Lukert, P. D., Fletcher, O. J. (1988). Experimental infection of one-day-old poults with turkey isolates of infectious bursal disease virus. Avian Pathol. 17, 51-62. Odend'hal, S., Breazile, J. E. (1980). An area of T cell localization in the cloacal bursa of White Leghorn chickens. Am. J. Vet. Res. 41,255-258. Ohta, H., Yoshikawa, Y., Kai, C., Yamanouchi, K., Okada, H. (1984). Lysis of horse red blood cells mediated by antibodyindependent activation of the alternative pathway of chicken complement. Immunology 52, 437-443. Olah, I., Glick, B. (1978). The number and size of the follicular epithelium and follicles in the bursa of Fabricius. Poult. Sci. 57, 1445-1450. Olah, I., Glick, B. (1984). Lymphopineal tissue in the chicken. Dev. Comp. Immunol. 8, 855-862. Olah, I., Glick, B. (1992). Non-lymphoid cells produce IgA-like substance in the corticomedullary zone of the chicken thymus. Thymus 19, 105-110. Olah, I., Glick, B. (1995). Dendritic cells in the bursal follicles and germinal centers of the chicken's caecal tonsil express vimentin but not desmin. Anat. Rec. 243,384-389. Olah, I., Glick, B., Taylor Jr, R.L. (1985). Effect of surgical bursectomy on the ellipsoid, ellipsoid-associated cells, and periellipsoid region of the chicken's spleen. J. Leukoc. Biol. 38, 459-469. Olah, I., Glick, B., Toro, I. (1986). Bursal development in normal and testosterone-treated chick embryos. Poult. Sci. 65, 574588. Olson, W. C., Ewert, D. L. (1990). Markers of B lymphocyte differentiation in the chicken. Hybridoma 9, 331-350. Olson, W. C., Ewert, D. L. (1994). A novel multilineage cell-

130

surface antigen expressed on terminally differentiated chicken B cells in mucosal tissues. Ceil. Immunol. 154, 328-341. Otaki, Y., Nunoya, T., Tajima, M., Kato, A., Nomura, Y. (1988). Depression of vaccinal immunity to Marek's disease by infection with chicken anemia agent. Avian Pathol. 17, 333-347. Owen, R. L., Jones, A. L. (1974). Epithelial cell specialization within human Peyer's patches: an ultrastructural study of intestinal lymphoid follicles. Gastroenterology 66, 189203. Palladino, M. A., Gilmour, D. G., Scafuri, A. R., Stone, H. A., Thorbecke, G. J. (1977). Immune response differences between two inbred chicken lines identical at the major histocompatibility complex. Immunogenetics 5,253-259. Palojoki, E., Toivanen, P., Jalkanen, S. (1993). Chicken B cells adhere to the CS-1 site of fibronectin throughout their bursal and postbursal development. Eur. J. Immunol. 23,721-726. Panigrahy, B., Misra, L. K., Naqi, S. A., Hall, C. F. (1977). Prolongation of skin allograft survival in chickens with infectious bursal disease virus. Poult. Sci. 56, 1745. Paramithiotis, E., Ratcliffe, M. J. H. (1993). Bursa-dependent subpopulations of peripheral B lymphocytes in chicken blood. Eur. J. Immunol. 23, 96-102. Paramithiotis, E., Ratcliffe, M. J. H. (1994). Survivors of bursal B cell production and emigration. Poult. Sci. 73,991-997. Paramithiotis, E., Ratcliffe, M. J. H. (1996). Evidence for phenotypic heterogeneity among B cells emigrating from the bursa of Fabricius: a reflection of functional diversity? Curr. Top. Microbiol. Immunol. 212, 29-36. Paramithiotis, E., Tkalec, L., Ratcliffe, M. J. H. (1991). High levels of CD45 are expressed coordinately with CD4 and CD8 on avian thymocytes. J. Immunol. 147, 3710-3717. Paramithiotis, E., Jacobsen, K. A., Ratcliffe, M. J. H. (1995). Loss of cell surface immunoglobulin expression precedes B cell death by apoptosis in the bursa of Fabricius. J. Exp. Med. 181,105-113. Pardue, S. L., Fite, K. V., Bengston, L., Lamont, S. J., Boyle III, M. L., Smyth Jr, J. R. (1987). Enhanced integumental and ocular amelanosis following the termination of cyclosporine administration. J. Invest. Dermatol. 88,758-761. Parrard, J. V., Rose, M. E., Hesketh, P. (1983). A functional homologue of mammalian SC exists in chickens. Eur. J. Immunol. 13,566-570. Parvari, R., Avivi, A., Lentner, F., Ziv, E., Tel-Or, S., Burnstein, I., Schecter, I. (1988). Chicken immunoglobulin 7-heavy chains: limited VH gene repertoire, combinatorial diversification by D segments and evolution of the heavy chain locus. EMBO J. 7, 739-744. Payne, A. P. (1994). The Harderian gland: a tercentennial review. J. Anat. 185, 1-49. Payne, L. N. (1971). The lymphoid system. In Physiology and Biochemistry of the Domestic Fowl (eds Bell, D J., Freeman, B. M.), pp. 985-1038. Academic Press, NY, USA. Payne, L. N., Fadly, A. M. (1997). Leukosis/sarcoma group. In Diseases of Poultry, 10th edn (eds Calnek, B. W., Barnes, H. J., Beard, C. W., McDougald, L. R., Saif, Y. M.), pp. 414-466. Iowa State University Press, Ames, IA, USA. Payne, L. N., Purchase, H. G. (1991). Leukosis/sarcoma group. In Diseases of Poultry, 9th edn. (eds Calnek, B. W., Barnes, H. J., Beard, C. W., Reid, W. M., Yoder Jr, H. W.), pp. 386-439. Iowa State University Press, Ames, IA, USA. Payne, L. N., Rennie, M. (1973). Pathogenesis of Marek's disease

AVIAN IMMUNOLOGY

in chicks with and without maternal antibody. J. Natl Canc. Inst. 51, 1559-1573. Payne, L. N., Frazier, J. A., Powell, P. C. (1976). Pathogenesis of Marek's disease in chicks with and without maternal antibody. Int. Rev. Exp. Pathol. 16, 59-154. Payne, L. N., Brown, S. R., Bumstead, N., Howes, K., Frazier, J. A., Thouless, M. E. (1991a). A novel subgroup of exogenous avian leukosis virus in chickens. J. Gen. Virol. 72, 801-807. Payne, L. N., Gillespie, A. M., Howes, K. (1991b). Induction of myeloid leukosis and other tumours with the HPRS-103 strain of ALV. Vet. Rec. 129, 447-448. P~ault, B., Chen, C. H., Cooper, M. D., Barbu, M., Lipinski, M., LeDouarin, N. M. (1987). Phylogenetically conserved antigen on nerve cells and lymphocytes resembles myelin-associated glycoprotein. Proc. Natl Acad. Sci. USA 84, 814-818. Pejkovski, C., Davelaar, F. G., Kouwenhoven, B. (1979). Immunosuppressive effect of infectious bursal disease virus on vaccination against infectious bronchitis. Avian Pathol. 8, 95-106. Pertile, T. L. (1995). Cellular immune functions in chickens infected with avian reovirus. PhD thesis, University of Minnesota, Minneapolis, MN, USA. Pertile, T. L., Sharma, J. M., Walser, M. M. (1995). Reovirus infection in chickens primes splenic adherent macrophages to produce nitric oxide in response to T cell-produced factors. Cell. Immunol. 164, 207-216. Pertile, T. L., Karaca, K., Walser, M. M., Sharma, J. M. (1996). Suppressor macrophages mediate depressed lymphoproliferation in chickens infected with avian reovirus. Vet. ImmunoI. Immunopathol. 53,129-145. Pickel, J. M., Chen, C. H., Cooper, M. D. (1990). An avian Blymphocyte protein associated with beta 2-microglobulin. Immunogen. 32, 1-7. Pink, J. R. L., Lassila, O. (1987). B cell commitment and diversification in the bursa of Fabricius. In Current Topics in Microbiology and Immunology, Vol. 135 (eds Paige, C. J., Gisler, R. H.), pp. 57-64. Springer-Verlag, Heidelberg, Germany. Pink, J. R., Rijnbeek, A.-M. (1983). Monoclonal antibodies against chicken lymphocyte surface antigens. Hybridoma 2, 287-296. Pink, J. R. L., Droege, W., Hala, K., Miggiano, V. C., Ziegler, A. (1977). A three-locus model for chicken major histocompatibility complex. Immunogenetics 5,203-216. Pink, J. R., Vainio, O., Rijnbeek, A. (1985). Clones of B lymphocytes in individual follicles of the bursa of Fabricius. Eur. J. Immunol. 15, 83-87. Plachy, J. (1988). An analysis of the response of recombinant congenic lines of chickens to RSV challenge provides evidence for further complexity of the genetic structure of the chicken MHC(B). Folia Biol. (Prague) 34, 170-181. Plachy, J., Hala, K., Benda, V. (1979). Regression of tumours induced by RSV in different inbred lines of chickens. Folia Biol. (Prague) 25,335-336. Plachy, J., Pink, J. R. L., Hala, K. (1992). Biology of the chicken MHC (B complex). Crit. Rev. Immunol. 12, 47-79. Pleiman, C. M., D'Ambrosio, D., Cambier, J. C. (1994). The Bcell antigen receptor complex: structure and signal transduction. Immunol. Today 15,393-399. Polley, C. R., Bacon, L. D., Rose, N. R. (1981). Spontaneous autoimmune thyroiditis in chickens: I. The effect of bursal reconstitution. J. Immunol. 127, 1465-1468.

References

Pontes de Carvalho, L. C., Wick, G., Roitt, I. M. (1981). Requirement of T cells for the development of spontaneous autoimmune thyroiditis in the Obese strain (OS) chickens. J. Immunol. 126, 750-753. Pope, C. R. (1991). Chicken anemia agent. Vet. Immunol. Immunopath. 30, 51-65. Pourqui& O., Corbel, C., le Caer, J.-P., Rossier, J., le Douarin, N. M. (1992). BEN, a surface glycoprotein of the immunoglobulin superfamily, is expressed in a variety of developing systems. Proc. Natl Acad. Sci. USA 89, 5261-5265. Powell, P. C. (1980). In vitro stimulation of blood lymphocytes by phytohemagglutinin during the development of Marek's disease. Avian Pathol. 9, 471-475. Powell, P. C. (1987a). Immune mechanisms in infections of poultry. Vet. Immunol. Immunopathol. 15, 87-113. Powell, P. C. (1987b). Macrophages and other nonlymphoid cells contributing to immunity. In Avian Immunology: Basis and Practice (eds Toivanen, A., Toivanen, P.), pp. 195-212. CRC Press, Boca Raton, FL, USA. Powell, P. C., Howes, K., Lawn, A. M., Mustill, B. M., Payne, L. N., Rennie, M., Thompson, M. A. (1984). Marek's disease in turkeys: the induction of lesions and the establishment of lymphoid cell lines. Avian Pathol. 13,201-214. Pradhan, H. K., Mohanty, G. C., Mukit, A., Pattnaik, B. (1987). Experimental studies on Marek's disease in Japanese quail (Coturnix coturnix japonica). Avian Dis. 31,225-233. Purchase, H. G., Chubb, R. C., Biggs, P. M. (1968). Effect of lymphoid leukosis and Marek's disease on the immunological responsiveness of the chickens. J. Natl Cancer Inst. 40, 583592. Quere, P. (1992). Suppression mediated in vitro by Marek's disease virus-transformed T-lymphoblastoid cell lines: effect on lymphoproliferation. Vet. Immunol. Immunopathol. 32, 149-164. Quere, P., Dambrine, G., Bach, M. A. (1989). Influence of thymic hormone on cell-mediated and humoral immune responses in Marek's disease. Vet. Microbiol. 19, 53-59. Qureshi, M. A., Miller, L. (1991). Signal requirements for the acquisition of tumoricidal competence by chicken peritoneal macrophages. Poult. Sci. 70, 530-538. Qureshi, M. A., Miller, L., Lillehoj, H. S., Ficken, M. D. (1990). Establishment and characterization of a chicken mononuclear cell line. Vet. Immunol. Immunopathol. 26, 237-250. Ramm, H. C., Wilson, T. J., Boyd, R. L., Ward, H. A., Mitrangas, K., Fahey, K. J. (1991). The effect of infectious bursal disease virus on B lymphocytes and bursal stromal components in specific pathogen-free (SPF) White Leghorn chickens. Dev. Comp. Immunol. 15,369-381. Rast, J. P., Litman, G. W. (1994). T cell receptor gene homologs are present in the most primitive jawed vertebrates. Proc. Natl Acad. Sci. USA 91, 9248-9252. Ratcliffe, M. J. H. (1989). Development of the avian B cell lymphocyte lineage. CRC Crit. Rev. Poultry Biol. 2, 207-234. Ratcliffe, M. J. H. (1996). Chicken immunoglobulin isotypes and allotypes. In Handbook of Experimental Immunology, 5th edn. (eds Weir, D. W., Herzenberg, L. A.), pp. 24.1-24.15. Blackwell Scientific Publications, Oxford, UK. Ratcliffe, M. J. H., Jacobsen, K.A. (1994). Rearrangement of immunoglobulin genes in chicken B cell development. Semin. Immunol. 6, 175-184. Ratcliffe, M. J. H., Tkalec, L. (1990). Cross-linking of the surface immunoglobulin on lymphocytes from the bursa of Fabricius

131

results in second messenger generation. Eur. J. Immunol. 20, 1073-1078. Ratcliffe, M. J. H., Lassila, O., Pink, J. R. L., Vainio, O. (1986). Avian B cell precursors: surface immunoglobulin expression is an early, possibly bursa-independent event. Eur. J. Immunol. 16, 129-133. Ratcliffe, M. J. H., Boyd, R., Chen, C., Vainio, O. (1993). Avian CD nomenclature workshops: Montreal, June 1992., Budapest, August 1992 and Tours, September 1992. Vet. Immunol. Immunopathol. 38,375-386. Ratcliffe, M. J. H., Paramithiotis, E., Coumidis, A., Sayegh, C., Demaries, S. L., Martinez, O., Jacobsen, K. A. (1996). The bursa of Fabricius and its role in avian B lymphocyte development. In Poultry Immunology (eds Davison, T. F., Morris, T. R., Payne, L. N.), pp. 11-30. Carfax Publishing Co., Abingdon, UK. Rath, N. C., Huff, W. E., Bayyari, G. R., Balog, J. M. (1995). Identification of transforming growth factor-beta and interleukin-6 in chicken ascites fluid. Avian Dis. 39, 382-389. Reynaud, C. A., Anquez, V., Dahan, A., Weill, J. C. (1985). A single rearrangement event generates most of the chicken immunoglobulin light chain diversity. Cell 40, 283-291. Reynaud, C. A., Anquez, V., Grimal, H., Weill, J. C. (1987). A hyperconversion mechanism generates the chicken light chain pre-immune repertoire. Cell 48,379-388. Reynaud, C. A., Dahan, A., Anquez, V., Weill, J.-C. (1989). Somatic hyperconversion diversifies the single VH gene of the chicken with a high incidence in the D region. Cell 59, 171183. Reynaud, C. A., Anquez, V., Weill, J.-C. (1991). The chicken D locus and its contribution to the immunoglobulin heavy chain repertoire. Eur. J. Immunol. 21, 2661-2670. Reynaud, C. A., Imhof, B. A., Anquez, V., Weill,' J. C. (1992). Emergence of committed B lymphoid progenitors in the developing chicken embryo. EMBO. J. 11, 4349-4358. Reynaud, C. A., Bertocci, B., Dahan, A., Weill, J.-C. (1994). Formation of the chicken B-cell repertoire: ontogenesis, regulation of Ig gene rearrangement, and diversification by gene conversion. Adv. Immunol. 57, 353-378. Riddell, C. (1987). Avian Histopathology 1st edn. American Association of Avian Pathologists, Kennett Square. Riegert, P., Andersen, R., Bumstead, N., Doehring, C., Dominguez-Steglich, M., Enberg, J., Salomonsen, J., Schmidt, M., Skjoedt, K., Schwager, J., Kaufman, J. (1996). The chicken beta2-microglobulin gene is located on a non-MHC microchromosome: a small, G + C rich gene with X and Y boxes in the promoter. Proc. Nat. Acad. Sci. USA 93, 12431248. Rieker, T., Penninger, J., Romani, N., Wick, G. (1995). Chicken thymic nurse cells: an overview. Dev. Comp. Immunol. 19, 281-289. Rinehart, C. L., Rosenberger, J. K. (1983). Effects of avian reovirus on the immune responses of chickens. Poult. Sci. 62, 1488-1489. Rivas, A. L., Fabricant, J. (1988). Indications of immunodepression in chickens infected with various strains of Marek's disease virus. Avian Dis. 32, 1-8. Roberts, A. B. (1988). Complementary deoxyribonucleic acid cloning of a novel transforming growth factor-fi messenger ribonucleic acid from chick embryo chondrocytes. Mol. Endocrinol. 2, 747-755. Roberts, A. B., Sporn, M. B. (1990). The transforming growth

132

factor-fls. In Handbook of Experimental Pharmacology. Peptide Growth Factors and Their Receptors, Vol. 95/I (eds Sporn, M. B., Roberts, A. B.), pp. 419-472. Springer-Verlag, Heidelberg, Germany. Rodenberg, J., Sharma, J. M., Belzer, S. W., Nordgren, R. M., Naqi, S. (1994). Flow cytometric analysis of B cell and T cell subpopulations in specific-pathogen-free chickens infected with infectious bursal disease virus. Avian Dis. 38, 16-21. Romppanen, T. (1982). Postembryonic development of the chicken bursa of Fabricius: a light microscopic histoquantitao tive study. Poult. Sci. 61, 2261-2270. Rose, M. E. (1981). Lymphatic system. In Form and Function in Birds, Vol. 2 (eds King, A. S., McLelland, J.), pp. 341-384. Academic Press, NY, USA. Rose, M. E., Orlans, E., Buttress, N. (1974). Immunoglobulin classes in the hen's egg: their segregation in yolk and white. Eur. J. Immunol. 4, 521-523. Rosenberger, J. K., Gelb, J. (1978). Response to several avian respiratory viruses as affected by infectious bursal disease virus. Avian Dis. 22, 95-105. Rot, A. (1991). Chemotactic potency of recombinant human neutrophil attractant/activation protein-1 (interleukin-8) for polymorphonuclear leukocytes of different species. Cytokine 3, 21-27. Rothwell, L., Gramzinski, R. A., Rose, M. E., Kaiser, P. (1995). Avian coccidiosis: changes in intestinal lymphocyte populations associated with the development of immunity to Eimeria maxima. Parasite Immunol. 17, 525-533. Ruddell, A. (1995). Transcription regulatory elements of the avian retroviral long terminal repeat. Virology 206, 1-7. Ruff, M. D., Bacon, L. D. (1984). Coccidiosis in 15.B congenic chicks. Poult. Sci. 63 (Suppl. 1), 172-173. Rusov, C., Miljkovic, B., Jojic-Malicevic, L., Zivkovic, R. (1996). Immunosuppressive effect of oncogenic Marek's disease virus on cutaneous hypersensitivity to phytohemagglutinin in young chickens. Proc. 4th Int. Symp. Marek's Disease, p. 56. Saif, Y. M. (1991). Immunosuppression induced by infectious bursal disease virus. Vet. Immunol. Immunopathol. 30, 4550. Salant, E. P., Pink, R. L., Steinberg, C. M. (1989). A model of bursal colonization. J. Theor. Biol. 139, 1-16. Samad, F., Bergtrom, G., Eissa, H., Amrani, D. L. (1993). Stimulation of chick hepatocyte fibronectin production by fibroblast-conditioned medium is due to interleukin 6. Biochim. Biophys. Acta 1181, 207-213. Sanders, B. G., Case, W. L. (1977). Chicken secretory immunoglobulin: chemical and immunological characterization of chicken IgA. Comp. Biochem. Physiol. 56B, 273-278. Santivatr, D. S., Maheswaran, S. K., Newman, J. A., Pomeroy, B. S. (1981). Effect of infectious bursal disease virus infection on the phagocytosis of Staphylococcus aureus by mononuclear phagocytic cells of susceptible and resistant strains of chickens. Avian Dis. 25,303-311. Sarid, R., Chajut, A., Gak, E., Kim, Y., Hixson, C. V., Oroszlan, S., Tronick, S. R., Gazit, A., Yaniv, A. (1994). Genome organization of a biologically active molecular clone of the lymphoproliferative disease virus of turkeys. Virology 204, 680-691. Sarma, G., Greer, W., Gildersleeve, R. P., Murray, D. L., Miles, A. M. (1995). Field safety and efficacy of in ovo administration of HVT + SB-1 bivalent Marek's disease vaccine in commercial broilers. Avian Dis. 39, 211-217.

AVIAN IMMUNOLOGY

Schat, K. A. (1987). Marek's disease: a model for protection against herpesvirus induced tumours. Cancer Surveys 6, 137. Schat, K. A. (1996). Immunity to Marek's disease, lymphoid leukosis and reticulodenotheliosis. In Poultry Immunology, Poultry Symposium Series Vol. 24 (eds Davison, F., Morris, T. R., Payne, L. N.), pp. 209-234. Carfax, Abingdon, UK. Schat, K. A., Gonzalez, J., Solorzano, A., Avila, E., Witter, R. L. (1976). A lymphoproliferative disease in Japanese Quail. Avian Dis. 20, 153-161. Schat, K. A., Schultz, R. D., Calnek, B. W. (1978). Marek's disease: effect of virus pathogenicity and genetic susceptibility on responses of peripheral blood |ymphocytes to concanavalin A. In Advances in Comparative Leukemia Research (eds Bentvelzen, P., Hilgers, J., Yohn, D. S.), pp. 183-186. Elsevier/ North-Holland, Amsterdam, The Netherlands. Schat, K. A., Chen, C.-L., Lillehoj, H., Calnek, B. W., Weinstock, D. (1988). Characterization of Marek's disease cell lines with monoclonal antibodies specific for cytotoxic and helper T cells. In Advances in Marek's Disease Research, Proc. 3rd Int. Symp. on Marek's Disease (eds Kato, S., Horiuchi, T., Mikami, T., Hirai, K.), pp. 220-226. Osaka, Japan. Schat, K. A., Chen, C.-L. H., Calnek, B. W., Char, D. (1991). Transformation of T-lymphocyte subsets by Marek's disease herpesvirus. J. Virol. 65, 1408-1413. Schat, K. A., Pratt, W. D., Morgan, R., Weinstock, D., Calnek, B. W. (1992). Stable transfection of reticuloendotheliosis virus-transformed lymphoblastoid cell lines. Avian Dis. 36, 432-439. Schauenstein, K., Kr6mer, G., Sundick, R. S., Wick, G. (1985). Enhanced response to Con A and production of TCGF by lymphocytes of Obese strain (OS) chickens with spontaneous autoimmune thyroiditis. J. Immunol. 134, 872-879. Schauenstein, K., F~issler, R., Dietrich, H., Schwarz, S., Kr6mer, G., Wick, G. (1987). Disturbed immune-endocrine communication in autoimmune disease: lack of corticosterone response to immune signals in Obese strain chickens with spontaneous autoimmune thyroiditis. J. Immunol. 139, 18301833. Schauenstein, K., Kr6mer, G., Hfila, K., B6ck, G., Wick, G. (1988). Chicken-activated-T-lymphocyte-antigen (CATLA) recognized by monoclonal antibody INN-CH-16 represents the IL-2 receptor. Dev. Comp. Immunol. 12, 823-831. Schierman, L. W., Fletcher, O. J. (1980). Genetic control of Marek's disease virus-induced transient paralysis: association with the major histocompatibiliuty complex. In Resistance and Immunity to Marek's Disease (ed. Biggs, P. M.), pp 429440. ECSC-EEC-EAEC, Brussels, Belgium. Schierman, L. W., Watanabe, D. H., McBride, R. A. (1977). Genetic control of Rous sarcoma regression in chickens: linkage with the major histocompatibility complex. Immunoglobulins 5,325-332. Scott, T. R., Savage, M. L., Olah, I. (1993). Plasma cells of the chicken Harderian gland. Poult. Sci. 72, 1273-1279. Searle, E. A., Austin, L. M., Boissy, Y. L., Zhao, H., Nordlund, J. J., Boissy, R. E. (1993). Smyth chicken melanocyte autoantibodies: cross-species recognition, in vivo binding and plasma membrane reactivity of the antiserum. Pigment Cell Res. 6, 145-157. Sekellick, M. J., Ferrandino, A. F., Hopkins, D. A., Marcus, P. I. (1994). Chicken interferon gene: cloning, expression and analysis. J. Interferon Res. 14, 71-79.

References

Seto, F. (1981). Early development of the avian immune system. Poult. Sci. 60, 1981-1995. Sharma, J. M. (1981). Natural killer cell activity in chickens exposed to Marek's disease virus: inhibition of activity in susceptible chickens and enhancement of activity in resistant and vaccinated chickens. Avian Dis. 25,882-893. Sharma, J. M. (1983). Presence of adherent cytotoxic cells and nonadherent natural killer cells in progressive and regressive Marek's disease tumors. Vet. Immunol. Imrnunopathol. 5, 125-140. Sharma, J. M. (1984). Effect of infectious bursal disease virus on protection against Marek's disease by turkey herpesvirus vaccine. Avian Dis. 28,629-640. Sharma, J. M. (1985). Embryo vaccination with infectious bursal disease virus alone or in combination with Marek's disease vaccine. Avian Dis. 29, 1155-1169. Sharma, J. M. (1988). Presence of natural suppressor cells in the chicken embryo spleen and the effect of virus infection of the embryo on suppressor cell activity. Vet. Immunol. Immunopathol. 19, 51-66. Sharma, J. M. (1989). In situ production of interferon in tissues of chickens exposed as embryos to turkey herepesvirus and Marek's disease virus. Xm. J. Vet. Res. 50, 882-886. Sharma, J. M. (1991). Hemorrhagic enteritis of turkeys. Vet. Immunol. Immunopathol. 30, 67-71. Sharma, J. M., Burmester, B. R. (1982). Resistance to Marek's disease at hatching in chickens vaccinated as embryos with the turkey herpesvirus. Avian Dis. 26, 134-149. Sharma, J. M., Fredrickson, T. L. (1987). Mechanism of T cell immunodepression by infectious bursal disease virus of chickens. In Avian Immunology, pp. 283-294. Alan R. Liss, New York, USA. Sharma, J. M., Lee, L. F. (1983). Effect of infectious bursal disease on natural killer cell activity and mitogenic response of chickens lymphoid cells: role of adherent cells in cellular immune suppression. Infect. Immun. 42, 747-754. Sharma, J. M., Okazaki, M. (1981). Natural killer cell activity in specific pathogen-free chickens. J. Natl Cancer Inst. 63,527531. Sharma, J. M., Dohms, J. E., Metz, A. L. (1989). Comparative pathogenesis of serotype 1 and variant serotype 1 isolates of infectious bursal disease virus and the effect of those viruses on humoral and cellular immune competence of specific pathogen free chickens. Avian Dis. 33, 112-124. Sharma, J. M., Dohms, J., Walser, M., Snyder, D. B. (1993). Presence of lesions without virus replication in the thymus of chickens exposed to infectious bursal disease virus. Avian Dis. 37, 741-748. Sharma, J. M., Karaca, K., Pertile, T. (1994). Virus-induced immunosuppression in chickens. Poult. Sci. 73, 10821086. Shek, W. R., Calnek, B. W., Schat, K. A., Chen, C.-L. H. (1983). Characterization of Marek's disease virus-infected lymphocytes: discrimination between cytolytically and latently infected cells. J. Natl Cancer Inst. 70, 485-491. Shen, P. F., Smith, E. J., Bacon, L. D. (1984). The ontogeny of blood cells, complement, and immunoglobulins in 3- to 12week old 151s-B congenic White Leghorn chickens. Poult. Sci. 63, 1083-1093. Shinkai, Y., Rathburn, G., Lam, K. P., Oltz, E. M., Stewart, V., Medelsohn, M., Charron, J., Datta, M., Young, F., Stall, A. M., Alt, F. W. (1992). RAG-2 deficient mice lack mature

133

lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 855-867. Sieweke, M. H., Thompson, N. L., Sporn, M. B., Bissell, M. J. (1990). Mediation of wound-related Rous sarcome virus tumorigenesis by TGF-fi. Science 248, 1656-1660. Silva, J. S., Twardzik, D. R., Reed, S. G. (1991). Regulation of trypanosoma cruzi infections in vitro and in vivo by transforming grpwth factor fl (TGF-fi)..J. Exp. Med. 174, 539545. Simonsen, M., Kolstad, N., Edfors-lilja, I., Liledahl, L. E., Sorensen, P. (1982). Major histocompatibility genes in egglaying hens. Am. J. Reprod. Immunol. 2, 148-152. Sivanandan, V., Maheswaran, S. K. (1980a). Immune profile of infectious bursal disease: I. Effect of infectious bursal disease virus on peripheral blood T and B lymphocytes of chickens. Avian Dis. 24, 715-725. Sivanandan, V., Maheswaran, S. K. (1980b). Immune profile of infectious bursal disease: II. Effect of IBD virus on pokeweedmitogen stimulated peripheral blood lymphocytes. Avian Dis. 24, 734-742. Sivanandan, V., Maheswaran, S. K. (1981). Immune profile of infectious bursal disease: III. Effect of infectious bursal disease virus on the lymphocyte responses to phytomitogens and on mixed lymphocyte reaction of chickens. Avian Dis. 25, 112120. Six, A., Rast, J. p., Li, Y., Cooper, M. D., Chen, C. H., Litman, G. W. (1995). Identification of the chicken T cell receptor 78 genes. FASEB J. 9, 4737. Smith, E. J. (1987). Endogenous avian leukemia viruses. In Avian Leukosis (ed. de Boer, G. F.), pp. 101-120. Martinus Nijhoff, Dordrecht, The Netherlands. Smyth Jr, J. R., Boissy, R. E., Fite, K. V. (1981). The DAM chicken: a spontaneous postnatal cutaneous and ocular amelanosis. J. Hered. 72, 150-156. Snipes, K. P., Hirsh, D. C. (1986). Association of complement sensitivity with virulence of Pasteurella multocida isolated from turkeys. Avian Dis. 30, 500-504. Solano, W., Giambrone, J. J., Williams, J. C., Lauerman, L. H., Panangala, V. S., Garces, C. (1986). Effect of maternal antibody on timing of initial vaccination of young White Leghorn chickens against infectious bursal disease virus. Avian Dis. 30, 648-652. Sowder, J. T., Chen, C. H., Ager, L. L., Chan, M. M., Cooper, M. D. (1988). A large subpopulation of avian T cells express a homologue of the mammalian T ~8 receptor. J. Fxp. Med. 167, 315-322. Sponenberg, D. P., Domermuth, C. H., Larsen, C. T. (1985). Field outbreaks of colibacillosis of turkeys associated with hemorrhagic enteritis virus. Avian Dis. 29, 838-842. Sporn, M. B., Roberts, A. B. (1990). The multifunctional nature of peptide growth factors. In Handbook of Experimental Pharmacology. Peptide Growth Factors and Their Receptors, Vol. 95/I (eds Sporn, M. B., Roberts, A. B.), pp. 3-15. Springer-Verlag, Heidelberg, Germany. Steadham, E. M., Lamont, S. J. (1993). Gene complementation in biological crosses for humoral immune response to glutamic acid-alanine-tyrosine. Poult. Sci. 72, 76-81. Sterneck, E., Blattner, C., Graf, T., Leutz, A. (1992). Structure of the chicken myelomonocytic growth factor gene and specific activation of its promotor in avian myelomonocytic cells by protein kinases. Mol. Cell. Biol. 12, 1728-1735. Stoeckle, M. Y., Barker, K. A. (1990). Two burgeoning families

134

of platelet factor 4-related proteins: mediators of inflammatory responses. New Biologist 2, 313-323. Sugano, S., Stoeckle, M. Y., Hanafusa, H. (1987). Transformation by Rous sarcoma virus induces a novel gene with homology to a mitogenic platelet protein. Cell 49, 321-328. Sugimura, M., Suzuki, Y., Atojo, Y., Hashimoto, Y. (1987). Accumulation of Kupffer cells within lymphocyte aggregates in the livers of chickens injected with colloidal carbon and erythrocytes. Jap. J. Vet. Sci. 49, 771-778. Sundick, R. S., Gill-Dixon, C. (1997). A cloned chicken lymphocyte homologous to both mammalian IL-2 and IL-15. J. Immunol. 159, 720-725. Sundick, R. S., Wick, G. (1974). Increased 131-I uptake by the thyroid glands of Obese strain (OS) chickens derived from non-protomone supplemented hens. Clin. Exp. Immunol. 18, 127-139. Sundick, R. S., Bagchi, N., Livezey, M. D., Brown, T. R., Mack, R. E. (1979). Abnormal thyroid regulation in chickens with autoimmune thyroiditis. Endocrinol. 105,493-498. Sundick, R. S., Herdegen, D., Brown, T. R., Bagchi, N. (1987). The incorporation of dietary iodine into thyroglobulin increases its immunogenicity. Endocrinology 120, 20782084. Sundick, R. S., Herdegen, D., Brown, T. R., Dhar, A., Bagchi, N. (1991). Thyroidal iodine metabolism in obese strain chickens before immune-mediated damage. J. Endocrinol. 128, 239244. Suresh, M., Sharma, J. M. (1995). Hemorrhagic enteritis virus induced changes in the lymphocyte subpopulations in turkeys and the effect of experimental immunodeficiency on viral pathogenesis. Vet. Immunol. Immunopathol. 45, 139-150. Suresh, M., Sharma, J. M. (1996). Pathogenesis of type II avian adenovirus infection in turkeys: in vivo immune cell tropism and tissue distribution of the virus. J. Virol. 70, 30-36. Suresh, M., Karaca, K., Foster, D., Sharma, J. M. (1995). Molecular and functional characterization of turkey interferon. J. Virol. 69, 8159-8163. Survashe, B. D., Aitkin, I. D. (1977). Removal of the lacrimal gland and ligation of the Harderian gland duct in the fowl (Gallus domesticus): procedures and sequelae. Res. Vet. Sci. 22, 113-119. Swift, R. A., Shaller, E., Witter, R. L., Kung, H.-J. (1985). Insertional activation of c-myc by reticuloendotheliosis virus in chicken B lymphoma: nonrandom distribution and orientation of the provirus. J. Virol., 54, 869-872. Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H., Kurosaki, T. (1994). Tyrosine kinases Lyn and Syk regulate B cell receptor-coupled Ca 2§ mobilization through distinct pathways. EMBO J. 13, 1341-1349. Tang, K. N., Fletcher, O. J., Villegas, P. (1987a). Comparative study of the pathogenicity of avian reoviruses. Avian Dis. 31, 577-583. Tang, K. N., Fletcher, O. J., Villegas, P. (1987b). The effect on newborn chicks of oral inoculation of reovirus isolated from chickens with tenosynovitis. Avian Dis. 31,584-590. Tempelis, C. H. (1988). Ontogeny and regulation of the immune response in the chicken. Prog. Vet. Microbiol. Immun. 4, 120. Theis, G. A. (1977). Effects of lymphocytes from Marek's disease infected chickens on mitogen response of syngeneic normal chicken spleen cells. J. Immunol. 118, 887-894. Theis, G. A. (1981). Subpopulations of suppressor cells in

AVIAN IMMUNOLOGY

chickens infected with cells of a transplantable lymphoblastic leukemia. Infec. Immun. 34, 526-534. Theis, G. A., McBride, R. A., Scierman, L. W. (1975). Depression of in vitro responsiveness to phytohemagglutinin in spleen cells cultured from chickens with Marek's disease. J. Immunol. 115,848-853. Thompson, C. B., Neiman, P. E. (1987). Somatic diversification of the chicken immunoglobulin light chain gene is limited to the rearranged variable gene segment. Cell 48, 369-378. Thorpe, K. L., Abdulla, S., Kaufman, J., Trowsdale, J., Beck, S. (1996). Phylogeny and structure of the RING3 gene. Immunogenetics 44, 391-396. Thunold, S., Schauenstein, K., Wolf, H., Thunold, K. S., Wick, G. (1981). Localization of IgG Fc and complement receptors in chicken lymphoid tissue. Scand. J. Immunol. 14, 145-152. Tjoelker, L. W., Carlson, L. M., Lee, K., Lahti, J., McCormack, W. T., Leiden, J. M., Chen, C. H., Cooper, M. D., Thompson, C. B. (1990). Evolutionary conservation of antigen recognition: the chicken T cell receptor fl chain. Proc. Natl Acad. Sci. USA 87, 7856-7860. Toivanen, A., Toivanen, P. (1987). Stem cells of the lymphoid system. In Avian Immunology: Basis and Practice (eds Toivanen, A., Toivanen, P.), pp. 23-37. CRC Press, Boca Raton, FL, USA. Toivanen, A., Toivanen, P., Eskola, J., Lassila, O. (1981). Ontogeny of the chicken lymphoid system. In Avian Immunology (eds Rose, M. E., Payne, L. N., Freeman, B. M.), pp. 45-62. Clark Constable Limited, Edinburgh, UK. Toivanen, P., Toivanen, A. (1973). Bursal and post-bursal stem cells in the chicken. Functional characteristics. Eur. J. Immunol. 3,585-595. Tonegawa, S. (1983). Somatic generation of antibody diversity. Nature 302, 575-581. Trees, A. J., Crozier, S. J., McKellar, S. B., Wachira, T. M. (1985). Class-specific circulating antibodies in infections with Eimeria tenella. Vet. Parasitol. 18, 349-357. Tregaskes, C. A., Kong, F., Paramithiotis, E., Chen, C.-L. H., Ratcliffe, M. J. H., Davison, T. F., Young, J. R. (1995). Identification and analysis of the expression of CD80~0r and CD8~fl isoforms in chickens reveals a major TCR-78 CD8~fl subset of intestinal intraepithelial lymphocytes. J. Immunol. 154, 4485-4494. Tregaskes, C. A., Bumstead, N., Davison, T. F, Young, J. (1996). Chicken B-cell marker ChB6 (Bu-1) is a highly glycosylated protein of unique structure. Immunogenetics 44, 212-217. Trembicki, K. A., Qureshi, M. A., Dietert, R. R. (1986). Monoclonal antibodies reactive with chicken peritoneal macrophages: identification of macrophage heterogeneity. Proc. Soc. Exp. Biol. Med. 183, 28-41. Trout, J. M., Lillehoj, H. S. (1995). Eimeria acervulina: evidence for the involvement of CD8 § T lymphocytes in sporozoite transport and host protection. Poult. Sci. 74, 1117-1125. Trout, J. M., Lillehoj, H. S. (1996). T lymphocyte roles during Eimeria acervulina and E. tenella infections. Vet. Immunol. Immunopathol. 53,163-172. Truden, J. L., Sundick, R. S., Levine, S., Rose, N. R. (1983). The decreased growth rate of Obese strain (OS) chicken thyroid cells provides in vitro evidence for a primary organ abnormality in chickens susceptible to autoimmune thyroiditis. Clin. Immunol. Immunopathol. 29, 294-305. Tsuji, S., Baba, T., Kawata, T., Kajikawa, T. (1993). Role of

References

Harderian gland on differentiation and proliferation of immunoglobulin A-bearing lymphocytes in chicken. Vet Immunol. Immunopathol. 37, 271-283. Tsuji, S., Illges, H., Kubota, T., Char, D., Bucy, P., Simonsen, M., Chen, C. H., Cooper, M. D. (1995). Donor 0~fi T cell clones recruit host 73 T cells in acute GVH reactions. 9th Intl. Congress Immunol., p. 251, abstract 1486. Vainio, O., Imhof, B. A. (1995). The immunology and developmental biology of the chicken. Immunol. Today 16, 365-370. Vainio, O., Imhof, B.A. (1996). Immunology and developmental biology of the chicken. Curr. Topics Immunol. Microbiol. 212, 263-274. Vainio, O., Koch, C., Toivanen, A. (1984). B-L antigens (class II) of the chicken major histocompatibility complex control T-B cell interaction. Immunogenetics 19, 131-140. Vainio, O., Ratcliffe, M. J. H., Leanderson, T. (1986). Chicken T-cell growth factor: use in the generation of a long-term cultured T-cell line and biochemical characterization. Scand. J. Immunol. 23, 135-142. Vainio, O., Veromaa, T., Eerola, E., Toivanen, P., Ratcliffe, M. J. H. (1988). Antigen-presenting cell-T cell interaction in the chicken is MHC class II antigen restricted. J. Immunol. 140, 2864-2868. Vaino, O., Riwar, B., Brown, M. H., Lassila, O. (1991). Characterization of the putative avian CD2 homologue. J. Immunol. 147, 1593-1599. Vainio, O., Dunon, D., Aissi, F., Dangy, J. P., McNagny, K. M., Imhof, B. A. (1996). HEMCAM, an adhesion molecule expressed by c-kit § hemopoietic progenitors. J. Cell Biol. 135, 1655-1668. van den Hurk, J., Allan, B. J., Riddell, C., Watts, T., Potter, A. A. (1994). Effect of infection with hemorrhagic enteritis virus on susceptibility of turkeys to Escherichia coli. Avian Dis. 38, 708-716. van de Water, J., Haapanen, L., Boyd, R., Abplanalp, H., Gershwin, M. E. (1989). Identification of T cells in early dermal infiltrates in avian scleroderma. Arthritis Rheum. 32, 1031-1040. van de Water, J., Wilson, T. J., Haapanen, L. A., Boyd, R. L., Abplanalp, H., Gershwin, M. E. (1990). Ontogeny of T cell development in avian scleroderma. Clin. Immunol. Immunopathol. 56, 169-184. van Ostade, X., Tavernier, J., Prange, T., Fiers, W. (1991). Localization of the active site of human tumour necrosis factor (hTNF) by mutational analysis. EMBO J. 10, 827-836. Veromaa, T., Vainio, O., Eerola, E., Toivanen, P. (1988). Monoclonal antibodies against chicken Bu-la and Bu-lb alloantigens. Hybridoma 7, 41-48. von Boehmer, H. (1994). Positive selection of lymphocytes. Cell 76, 219-228. Wakefield, L. M. (1987). An assay for type-beta transforming growth factor receptor. Methods Enzymol. 146, 167-173. Wakenell, P. S., Sharma, J. M. (1986). Chicken embryonal vaccination with avian infectious bronchitis virus. Am. J. Vet. Res. 47, 933-938. Walker, W. H., Stein, B., Ganchi, P. A., Hoffman, J. A., Kaufman, P. A., Ballard, D. W., Hannink, M., Greene, W. C. (1992). The v-rel oncogene: insights into the mechanism of transcriptional activation, repression, and transformation. J. Virol. 66, 5018-5029. Warner, N. L., Szenberg, A., Burnet, F. M. (1962). The immunological role of different lymphoid organs in the chicken. I.

135

Dissociation of immunological responsiveness. Aust. J. Exp. Biol. Med. 40, 373-387. Wathen, L. K., Leblanc, D., Warner, C. M., Lamont, S. J., Noroskog, A. W. (1987). A chicken sex-limited protein that crossreacts with the fourth component of complement. Poult. Sci. 66, 162-165. Weiler, H., von Bulow, V. (1987). Development of optimal conditions for lymphokine production by chicken lymphocytes. Vet. Immunol. Immunopathol. 14, 257-262. Weill, J. C., Reynaud, C. A. (1987). The chicken B cell compartment. Science 238, 1094-1098. Weill, J. C., Reynaud, C. A., Lassila, O., Pink, J. R. L. (1986). Rearrangement of chicken immunoglobulin genes is not an ongoing process in the embryonic bursa of Fabricius. Proc. Natl Acad. Sci. USA 83, 3336-3340. Weill, J. C., Leibowitch, M., Reynaud, C. A. (1987). Questioning the role of the embryonic bursa in the molecular differentiation of B lymphocytes. In Current Topics in Microbiology and Immunology, Vol. 135 (eds Paige, C. J., Gisler, R. H.), pp. 111-124. Springer-Verlag, Heidelberg, Germany. Welch, P., Rose, N. R., Kite Jr, J. H. (1973). Neonatal thymectomy increases spontaneous autoimmune thyroiditis. J. Immunol. 110, 575-577. White, R. G. (1981). The structural organization of Avian lymphoid tissues. In Avian Immunology (eds Rose, M. E., Payne, L. N., Freeman, B. M.), pp. 21-44. Clark Constable Limited, Edinburgh, UK. Whitehouse, D. B. (1988). Genetic polymorphisms of animal complement components. Exper. Clin. Immunogenet. 5, 143164. Wick, G., Kite Jr, J. H., Cole, R. K., Witebsky, E. (1970a). Spontaneous thyroiditis in the Obese strain of chicken: Ill. The effect of bursectomy on the development of disease. J. Immunol. 104, 45-53. Wick, G., Kite Jr, J. H., Witebsky, E. (1970b). Spontaneous thyroiditis in the Obese strain of chicken: IV. The effect of thymectomy and thymo-bursectomy on the development of disease. J. Immunol. 104, 54-62. Wight, P. A. L., Burns, R. B., Rothwell, B., MacKenzie, G. M. (1971). The Harderian gland of the domestic fowl. I. Histology, with reference to the genesis of plasma cells and Russell bodies. J. Anat. 110, 307-315. Wilson, T. J., van de Water, J., Mohr, F. C., Boyd, R. L., Ansari, A., Wick, G., Gershwin, M. E. (1992). Avian scleroderma: evidence for qualitative and quantitative T cell defects. J. Autoimmun. 5,261-276. Winship, T. R., Marcus, P. I. (1980). Interferon induction by viruses. VI. Reovirus: virion genome dsRNA as the interferon inducer in aged chick embryo cells. J. Interferon Res. 1,155167. Wistow, G. J., Shaughnessy, M. P., Lee, D. C., Hodin, J., Zelenka, P. S. (1993). A macrophage migration inhibitory factor is expressed in the differentiating cells of the eye lens. Proc. Natl Acad. Sci. USA 90, 1272-1275. Witter, R. L. (1991). Reticuloendotheliosis. In Diseases of Poultry, 9th edn (eds Calnek, B. W., Barnes, H. J., Beard, C. W., Reid, W. M., Yoder Jr, H. W.), pp. 439-456. Iowa State University Press, Ames, IA, USA. Witter, R. L. (1997). Reticuloendotheliosis. In Diseases of Poultry, 10th edn (eds Calnek, B. W., Barnes, H. J., Beard, C. W., McDougald, L. R., Saif, Y. M.), pp. 467-484. Iowa State University Press, Ames, IA, USA.

AVIAN IMMUNOLOGY

Witter, R. L., Smith, E. J., Crittenden, L. B. (1981). Tolerance, viral shedding, and neoplasia in chickens infected with nondefective reticuloendotheliosis viruses. Auian Dis. 25, 3 7 4 394. Witter, R. L., Sharma, J. M., Fadly, A. M. (1986). Nonbursal lymphomas induced by nondefective reticuloendotheliosis virus. Auian Pathol., 15,467-486. Wood, G. W., Muskett, J. C., Thornton, D. H. (1981). The interaction of live vaccine and maternal antibody in protection against infectious bursal disease. Auian Path. 10, 365373. Wooley, R. E., Spears, K. R., Brown, J., Nolan, L. K., Fletcher, 0. J. (1992). Relationship of complement resistance and selected virulence factors in pathogenic avian Escherichia coli. Avian Dis. 36,679-684. Wride, M. A,, Sanders, E. J. (1993).Expression of tumor necrosis factor-cc (TNF-x)-cross-reactive proteins during early chick embryo development. Dev. Dynamics 198,225-239. Wyatt, C. L., Weaver Jr, W. D., Beane, W. L., Denbow, D. M., Gross, W. B. (1986). Influence of hatcher holding times on several physiologic parameters associated with the immune system of chickens. Poult. Sci. 65,2156-2164. Wyeth, P. J. (1975). Effect of infectious bursal disease on the response of chickens to S. typhimurium and E. coli infections. Vet. Rec. 96,238-243. Wyeth, P. J., Cullen, G. A. (1976). Maternally derived antibodyeffect on susceptibility of chicks to infectious bursal disease. Avian Path. 5, 253-260. Yamada, A., Hayami, M . (1983). Suppression of natural killer cell activity by chicken alpha-fetoprotein in Japanese quails. J. Natl Cancer Inst. 70,735-738.

Yamamoto, H., Hattori, M., Ohashi, K., Sugimoto, C., Onuma, M. (1995). Kinetic analysis of T cells and antibody production in chickens infected with Marek's disease virus. J . Vet. Med. Sci. 57, 945-946. Yonemasu, K., Sasaki, T. (1986). Purification, identification and characterization of chicken Clq, a subcomponent of the first component of complement. J . Immunol. Meth. 88, 245253. Young, J. R., Davison, T . F., Tregaskes, C. A., Rennie, M. C., Vainio, 0. (1994). Monomeric homologue of mammalian CD28 is expressed on chicken T cells. 1. Immunol. 152, 3848-3851. Yuasa, N., Taniguchi, T., Noguchi, T., Yoshida, I. (1980). Effect of infectious bursal disease virus infection on incidence of anemia by chicken anemia agent. Avian Dis. 24, 202209. Zhang, S., Lillehoj, H. S., Ruff, M. D. (1995). Chicken tumor necrosis-like factor. I. In uitro production by macrophages stimulated with Eimeria tenella or bacterial lipopolysaccharide. Poult. Sci. 74, 13041310. Zhonggui, L., Qingzhang, L., Rong, G., Yun, L., Shimin, Z., Zhiyong, Z . (1996). Immunosuppressive mechanism of chicken Marek's disease. Proc. 4th Int. Symp. Marek's Disease, p. 45. Zoorob, R., Behar, G., Kroemer, G., Auffray, C. (1990). Organization of a functional chicken class I1 B gene. Immunogenetics 31, 179-187. Zoorob, R., Bernot, G., Renoir, D. M., Choukri, F., Auffray, C. (1993). Chicken major histocompatibility complex class I1 B genes: analysis of interallelic and interlocus sequence variance. Eur. J. Immunol. 23,1139-1145.

V 1.

IMMUNOLOGY OF THE RAT Introduction

The rat is undoubtedly one of the most commonly used animals in experimental biological and medical research. There are two species of rats, the brown rat, Rattus norvegicus, and the black rat, Rattus rattus, which both originate from South East Asia (India and China). Together with animals such as the mouse and guinea pig, rats belong to the largest order of mammals, the Rodentia. The laboratory rat has been developed from R. norvegicus, at the beginning of the twentieth century and most laboratory rat strains originate from animals held at the Wistar Institute of Anatomy and Biology at Philadelphia, PA, USA. A large number of genetically well-defined inbred laboratory rat strains are now available for experimental research (Festing, 1979). Rats are very strong animals that do not have many requirements with respect to their food and housing; they are easy to handle and to maintain, breed well in captivity, have a limited lifespan and are economic in their usage as experimental animals. Importantly, although rats are small animals they are big enough to carry out a wide variety of experimental manipulations relatively easily (for an overview refer to e.g. van Dongen et al., 1990; Waynforth and Flecknell, 1992). Over the years much became known about their physiology, anatomy, histology, genetics and, traditionally, also about their behaviour. Many disease models have been developed in this species, further establishing their firm position as experimental animals in both fundamental and applied medicine. Likewise, rats are also useful in immunological research and are the second most frequently used animal (after the mouse) in this field. Although rats contribute significantly to all aspects of immunology, their larger size offer unique possibilities for the application of microsurgical techniques (van Dongen et al., 1990; Waynforth and Flecknell, 1992). Both well-established microsurgical techniques such as thoracic duct cannulation and novel techniques such as vascular thymus transplantation (Kampinga et al., 1990, 1997) are easier in rats than in mice, and have proven their value to address fundamental immunological issues. For this reason, these animals are often the first choice for transplantation studies and it is therefore not surprising that recent technology to induce indefinite allogenic graft survival by intrathymic injection of allo-antigen was first developed in rats (Klatter et al., 1995; Posselt et al., 1990). Handbook of Vertebrate Immunology ISBN 0-12-546401-0

A variety of congenic, mutant and recombinant rat strains of immunological interest have been developed during recent years, further expanding the possibilities of experimentation. Furthermore, excellent autoimmune disease models are available for rats. These diseases develop either spontaneously as in the case of, for example, the diabetes-prone BB rat strain (Chappel and Chappel, 1983) or can be induced by autoantigen administration, resulting in autoimmune diseases varying from the widely used model of experimental autoimmune encephalomyelitis (EAE) (Swanborg, 1995) to the more recently developed model of antimyeloperoxidase-associated proliferative glomerulonephritis (Brouwer et al., 1993). In this chapter an overview is given of our expanding knowledge of the immune system of the laboratory rat, R. norvegicus. Information about the immune system of second rat species, the black rat, R. rattus, is very scarce and is beyond the scope of this chapter.

11

Lymphoid Organs: Their Anatomical Distribution and Cell Composition

The rat lymphoid system As in other mammals, the rat lymphoid system can be distinguished in two parts: (1) a central and (2) a peripheral part (Figure V.2.1). Central part Essentially, the major role of the central part is to provide the peripheral p a r t - via the circulation- with appropriate immunologically competent cells (ICC), i.e. T and B cells. To this end, B cells and precursor T cells are continuously generated, derived from hemopoietic stem cells in the bone marrow. B-cell production and maturation takes place mainly inside the bone marrow. Precursor T cells (prothymocytes), once released into the circulation, gain access to the thymic parenchyma, where, through processes of proliferation, maturation and selection, newly formed T cells are eventually generated, which, as recent thymic emigrants, enter into the circulation, where further maturation and differentiation may take place. Copyright 9 1998Academic Press Limited All rights of reproduction in any form reserved

138

IMMUNOLOGY OF THE RAT

Central

Peripheral

*immunol.oaica!reactions

*c~tl~mdu~k)n

Thymus o :3 "0 0 ,w, 0

!6

.

or 0

0 J:: 4,,$

"" ~Ag

~ (

TB Bonemarrow ~

......................................

............................................................

B cells cells

V

"~"

T

' "

......

" :~:

TB

Circulation |1

:

- " ........

~ ~ .....................................

Ag !

Spleen Figure V.2.1 Schematic representation of central and peripheral components of the rat lymphoid system. In the centralpart, T and B cells are formed, which, upon entering the circulation can enter peripherallymphoid organs like spleen, lymph nodes and MALT. From here Tand B cells, after a short interval of hours or days, will re-enter the circulation, either directly (spleen) or indirectly, through efferent lymphatics (lymph nodes, MALT). LN, lymph node; MALT, mucosa associated lymphoid tissue; Ag, antigen; T, Tcells; B, B cells.

Peripheral part In the peripheral part, the T and B cells home to the respective lymphoid organs, from where, after a short period of time (hours/days) they re-enter the circulation, either directly (spleen) or indirectly through efferent lymphatics (e.g. lymph nodes). In these lymphoid organs highly specialized microenvironments exist that allow the interaction between antigen (brought there by means of antigen presenting cells, APC) and these recirculating cells so as to perform their respective immunological functions (cellular immunity, humoral immunity, immunological memory) in an antigen-specific way. Through this recirculation process naive cells, effector cells and memory cells are continuously redistributed all over the body (surveillance function). In the peripheral part most lymphoid structures are lymph-associated (lymphatic system) apart from the spleen, which is essentially blood-associated.

The Lymphatic System A major purpose of the lymphatic system is to collect surplus tissue fluid (resulting from the capillary filtration process and incomplete protein reabsorption at the venous side) and to transport this back to the circulation so as to avoid stagnation of tissue fluid (seen in pathological conditions as edema) (Yoffey and Courtice, 1956). In addition, these channels are used to transport antigens (either as such or processed by APCs) that have penetrated

either the skin or the mucosal lining of the respective tracts (digestive, respiratory, urogenital) to the local draining lymph nodes (the 'meeting point' of antigen/APC and ICC). Focusing on this lymphatic system and the source of the lymph contained within, one can make the following distinctions: (Figure V.2.2)

Skin-draining lymph nodes: (e.g. axillary, popliteal and inguinal lymph nodes). Here, primary lymph is collected from dermal and subcutaneous connective tissue, which under normal circumstances will be virtually antigen free. Accordingly, immune reactivity in these nodes is usually low, except for the normal (physiological) recirculation of T and B cells through these nodes. These nodes usually have multiple afferent lymphatics, but only one efferent lymphatic through which the collected lymph is transported to a subsequent station (secondary lymph node or major lymph vessel).

Mucosa-draining, lymph nodes (e.g. mesenteric lymph nodes, hilar lymph nodes, cervical lymph nodes). Because the mucosal lining of the respective tracts is under constant threat of penetration by all types of bacteria and viruses (and, for example, in the small intestine translocation of bacteria is a normal daily phenomenon) the draining lymph nodes usually show a high degree of immune reactivity, among others witnessed by the occurrence of numerous germinal centres (GC) inside B-lym-


ALN

HLN

II th~ d

l

a

p

k MLN

~

h

duct

~

I chyli

~ ~ ~ "

ILN

f

Figure V.2.2 Lymphatic system of the rat. ALN, axillar lymph nodes; CLN, cervical lymph nodes; CLN, celiac lymph node; HLN, hilar lymph nodes; ILN, inguinal lymph node; LLN, lumbar lymph nodes; MLN, mesenteric lymph nodes; PLN, popliteal lymph node; PTLN, parathymic lymph node; RLN, renal lymph node; SMLN, submandibular lymph node. After Greene (1935), Anatomy of the Rat, in Trans. Am. Phil. Soc., New Series, vol. XXVII, p. 330.

phocyte follicles. Like skin draining lymph nodes, they have multiple afferent and only a single efferent lymphatic. In addition to these mucosa-draining lymph nodes the mucosa itself may contain organized lymphoid structures that are either genetically predetermined (like Peyer's patches) or reactive by nature (solitary nodules). Together, these structures are referred to as MALT (mucosa associated lymphoid tissue). Examples of MALT are:

9for the digestive tract: NALT (nasal associated lymphoid tissue) (Spit et al., 1989; Kuper et al., 1990), Peyer's patches and PCLT (proximal colonic lymphoid tissue) (Crouse et al., 1989; de Boer et al., 1992); the last two collectively referred to as GALT (gut associated lymphoid tissue). 9 for the respiratory tract: BALT (bronchus associated lymphoid tissue) (Plesch et al., 1982, 1983). No predetermined structures have been identified for the urogenital tract.

139

MALT can be considered as a lymph node situated immediately underneath the mucosal lining without, however, afferent lymphatics. Antigen transport across the mucosal lining is mediated by antigen sampling membranous epithelial cells (M-cells) (Owen et al., 1986). Thus the antigen content of the associated lumen is constantly sampled and, accordingly, these structures usually show a high degree of immune reactivity, again indicated, for example, by the occurrence of numerous GC in these structures (absent in germfree animals). Organ/tissue-draining lymph nodes. In addition to the above-mentioned lymphoid structures, which are all associated with the body's outer epithelial lining, some organs have their own associated lymph nodes as in the CLN (celiac lymph nodes) for the liver, RLN (renal lymph node, kidney) and PTLN (parathymic lymph node, thymus). In general, all the lymph produced in any organ, gland, muscular tissue, connective tissue, bone marrow, etc., usually passes through one (or more) lymph nodes before entering into the two major lymph-draining vessels (right and left thoracic duct) before gaining access to the circulation again. Because the lymph derived from these organs/ tissues generally will be antigen free, immune reactivity in the draining lymph nodes is accordingly rather low.

Morphological and functional aspects of respective lymphoid organs Central lymphoid organs The bone m a r r o w Rat bone marrow has a fairly high content of lymphoid cells, especially B-cell progenitors in various stages of differentiation. From 12.5 x 107 nucleated cells isolated from one femur about 25% belong to the B-cell lineage, as determined by the monoclonal antibody HIS24 (Deenen et al., 1987). During B-cell development in the bone marrow, both cell proliferation and cell loss (through apoptosis?) occur in the various compartments of differentiating cells in such a way that from the daily production of 650 x 106 cells (total bone marrow compartment) only 165 x 106/ day turn into newly formed B cells (NFB) of which only 16 x 106 cells/day gain access to the pool of mature B cells. As the total B cell pool in the periphery has been estimated to be approximately 1 x 109 cells, daily renewal rate (turnover) has been estimated to be approximately 1-2% (Deenen and Kroese, 1993). B-cell development in rat bone marrow will be described in more detail in section 8. B-cell differentiation in the rat bone marrow occurs in a centripetal way, the more immature forms being detected in the periphery of the marrow cavity immediately adjacent to the endosteum. Moreover, early B-cell formation appears to occur as a clonal event, presumably associated with specialized local microenvironments (Hermans and Opstelten, 1991).

140

No quantitative data are available on the production of T cell precursors. However, when young adult rats were treated with a single dose of Adriamycin, resulting in total depletion of all nucleated cells in the bone marrow (except for the stem cells) and thymus, it took from 15 days (Albino Oxford (AO) rats) to 22 days (Brown Norway (BN) rats) before early thymocyte progenitors could be detected again in the thymus (P. Nieuwenhuis, unpublished data). Using an in vitro culture system Prakapas et al. (1993) have identified a 10% lymphoid subset in the bone marrow with thymus repopulating activity which did not express B-lymphocyte associated antigens. The thymus The rat thymus is situated in the upper part of the mediastinum anterius just behind the sternum, with two small tips extending upwards lying along the carotid arteries. The thymus has no afferent lymphatics. Lymph formed in its capsule (and trabeculae) and in the medulla drain through an efferent lymphatic to reach the parathymic lymph nodes. The thymus parenchyma is made up of a reticulum of epithelial cells among which T cells in various stages of differentiation are situated. Epithelial cells can be recognized by various monoclonal antibodies and can thus be distinguished in various subtypes, a major distinction being between cortical and medullary (Kampinga et al., 1989). Both cortical and medullary epithelial cells express MHC class II determinants. In addition, the medulla contains MHC class II positive dendritic cells, randomly dispersed between the epithelial cells with a tendency to concentrate at the corticomedullary junction. In the experiments using Adriamycin (see the Bone Marrow, above) thymus regeneration (starting at days 15 and 22, respectively) took approximately 1 and 2 weeks, respectively, for a qualitatively and quantitatively normal medullary T-cell population to reappear. From experiments using vascular thymus transplantation turnover of the total T cell population in the thymus has been estimated to take ___28 days (Kampinga et al., 1990a). From X-ray irradiation and bone marrow reconstitution experiments turnover time for dendritic cells was found to be in the same order of magnitude. Cortical macrophages, however, turn over rather slowly (Kampinga et al., 1990b). Studies on the blood-thymus barrier in the rat indicate that, although cortical capillaries are indeed impenetrable for Ig molecules, these molecules may leave the capsular capillaries (having a fenestrated endothelium) to reach the outer cortical zone (subcapsular zone) from where, along with a flux of tissue fluid, these molecules are transported in a centripetal way through the meshes of the cortical parenchyma towards the corticomedullary junction, from where they are drained into the efferent lymph vessels. Thus the cortical parenchyma, despite the presence of a blood-thymus barrier at the level of the cortical capil-


laries, is accessible for a substantial proportion of serum proteins, up to a certain molecular weight (Nieuwenhuis et al., 1988; Nieuwenhuis, 1990). For details of the innervation of the rat thymus see Kendall and A1-Shawaf (1991).

Peripheral lymphoid organs The spleen The rat spleen is composed of two compartments designated white pulp and red pulp. The white pulp contains all the lymphoid elements and is essentially associated with the branching arterial/arteriolar system. Small arterioles are surrounded by the PALS (peri-arteriolar lymphocyte sheath), mainly containing T cells (and interdigitating dendritic cells, IDCs), onto which numerous B cells containing follicular structures (also containing follicular dendritic cells, FDCs) are attached (van Ewijk and Nieuwenhuis, 1985). These follicles may or may not show GC activity. A major feature of these follicular structures in the rat is the presence of a well-developed marginal zone containing a peculiar subset of B cells not to be found in other lymphoid tissues (lymph nodes, MALT)" MZ B cells are predominantly ~hi81~ cells in contrast to recirculating follicular B cells which are /,l~ (Kroese et al., 1995). Presumably, these cells play a role in the T-cell independent humoral immunity against bacterial capsular antigens (polysaccharides). However, very little is known about the actual function of this cell type and its origin. MZ B cells do not recirculate although they may develop from thoracic duct B lymphocytes. Presumably owing to the presence of this population the T/B cell ratio in the spleen is significantly lower than in the blood or in lymph nodes (Table V.2.1). T cell areas consist of a mixture of CD4 + and CD8 + T cells (average ratio ___2:1). In GCs a particular subset of T cells can be found which are CD4 +/ER3 + and presumably play a role in regulating memory B cell production (Kroese et al., 1985). The red pulp consists of cords of Billroth interspersed with venous sinuses draining the blood that enters these spaces from the perifollicular marginal sinus and the terminal arteriolar branches (penicillary arterioles). Up to the age of 12-20 weeks areas of extensive erythropoiesis as well as numerous megakaryocytes may be found in the red pulp. In contrast to mice no cells from the myeloid series (like PMNs) are formed in the rat spleen, apart from under pathological conditions. Stem cell content of the rat spleen, also in contrast to mice, is usually negligible. Lymph nodes As outlined above, three types of lymph node can be distinguished. However, in cell composition, one type of lymph node stands out against the other two with an on average lower T/B cell ratio (see Table V.2.1, cervical and mesenteric lymph nodes). These lymph nodes are all of the


141

Table V.2.1 Absolute numbers of total lymphoid cells and percentages of lymphoid subsets in various lymphoid organs of the adult male Lewis rat a Organ

Absolute number x 10- 6

%B

%T

% CD4

% CD8

T/B ratio

Bone marrow Thymus Blood Spleen Peripheral lymph node Cervical lymph node Mesenteric lymph node Peyer's Patches

9950 1450 140 310 130 100 230 100

15.1 0.14 19.3 42.9 20.0 28.5 30.5 64.4

2.1 94.6 67.7 44.1 73.1 67.4 61.6 15.5

4.6 94.3 57.9 39.0 58.4 51.1 53.1 14.3

1.9 94.4 22.6 19.8 21.5 19.9 17.4 4.5

0.14 831.0 3.6 1.0 3.8 2.5 2.0 0.3

a

After Westermann et al. (1989).

mucosa-associated type and, as a result of continuous antigen exposure, these lymph nodes invariably show numerous GC in their cortical area, thereby increasing their content of B cells and thus lowering the T/B cell ratio. The peripheral lymph nodes from Table V.2.1 (representing mostly skin-associated lymph nodes but the same also holds for the other organ-associated type) have virtually the same T/B cell ratio as that in the blood, suggesting that entry into and transit times for both T and B cells in these nodes are within the same order of magnitude and constitute a stochastic process. However, for thoracic duct lymph, draining both skin-associated and mucosa-associated lymph nodes below the level of the diaphragm, faster transit times for T cells compared with B cells have been found (12-18 h versus 24-36 h, respectively). In the paracortex (T-cell area) high endothelial venules (HEVs) are a common feature through which both T and B cells have been shown to enter into these nodes (Nieuwenhuis and Ford, 1976). In the paracortex a special type of antigen-presenting cell (interdigitating or dendritic cells) has been described by Veldman et al. (1970). Later, these cells were found to be part of the ubiquitous dendritic cell system (Nieuwenhuis, 1996), containing all dendritic cells, wherever located, with the sole exception of the follicular dendritic cells. Mucosa-associated l y m p h o i d tissues Essentially, all the various components such as NALT, Peyer's patches, PCLT and BALT have the same general structure, i.e. rows of B-cell follicular structures invariably showing high GC activity, interspersed by interfollicular areas, populated by T cells, where HEVs may be found. The domes of the follicular structures are situated immediately underneath the epithelial lining containing M cells. The T/B cell ratio is rather low as a result of GC being a dominant feature of these structures. From the present data there is no indication that any of these lymphoid structures has a central lymphoid function comparable to the bursa of Fabricius in the chicken. In

contrast to man the rat has no tonsils, although Waldeyer's ring-equivalent lymphoid tissue resembling the pharyngeal tonsil of man has been described (Koornstra et al., 1991). In contrast to man the BALT is relatively well developed. Blood In Table V.2.1 the T/B cell ratio for blood (in Lewis rats) is given as 3.6. Within the T cell compartment CD4 + T cells outnumber CD8 + T cells by a factor of 2.6. Lewis rats are generally considered to be typical TH1 responders, which is reflected in their susceptibility to the induction of EAE (a THl-mediated autoimmune disease) but not to the induction of HgC12-induced immune complex glomerulonephritis (ICGN) (a TH2-mediated autoimmune disease). In contrast, BN rats are highly susceptible for the induction of ICGN but not for EAE (Table V.2.2). When we analysed BN blood for the respective T-cell subsets it appeared not only that they had a quite different ratio of proposed TH2 over proposed TH1 cells (28) (see also Section 6) but also a quite different CD4/CD8 ratio (5.7- almost double the value for Lewis rats; in our stock 2.9). Consequently we set out to determine these ratios for various other rat strains and tried to correlate these data with the (known) susceptibility for either type of autoimmune disease. Data are shown in Table V.2.2 (Groen et al., 1993). The most striking observations were (1) that the CD4/ CD8 ratio can differ over a wide range (from 19 to 1.1) and (2) that the TH2/TH1 ratio was also found to vary between 28 and 0.5, apparently quite independently from the CD4/ CD8 ratio. There appeared to be no correlation with M H C haplotype and available data do not allow any conclusion as to a correlation between inducibility of respective types of autoimmune disease and MHC haplotype, CD4/CD8 ratio or TH2/TH1 ratio. These data thus are difficult to reconcile with the notion of TH2 versus TH1 respondership and susceptibility to respective types of autoimmune disease. Clearly, other as yet unknown aspects will have to be taken into account to establish what makes a certain strain susceptible or not to the induction of a particular form of autoimmune disease.

142


Table V.2.2

Variability in CD4/CD8- and TH2/THI-ratios in blood of various rat strains

Strain

MHC

CD4

DPBB MAXX BN LewxBN PVG U DA Lew DZB AO Buff WF LOU AO1 p

u n n I/n c u a I u u b u u ullu

95 88 85 82 80 79 76 72 70 63 62 58 52 51

CD8 5 9 15 17 20 19 23 25 28 36 34 39 45 " 45

CD4/CD8

TH2/TH1

ICGN

EAE

19 9.7 5.7 4.8 4 4.2 3.3 2.9 2.5 1.8 1.8 1.5 1.2 1.1

0.1 3 28 0.5? 8 3.4 1.5 0.9 3.1 3.1 2 3.7 4.9 2.8

? +++ +++ +++ ++ ? ?

(diab.) 9

+++ + ? ? ?

+++ ++ (RA) +++ 9 +++ 9 ? 9

ICGN, Immune Complex Glomerulo-Nephritis; EAE, Experimental Allergic Encephalomyelitis; (diab.), spontaneous autoimmune diabetes; (RA), rheumatoid arthritis. After H. Groen et aL (1993).

I

Rat Cluster of Differentiation (CD) Antigens

For over two decades many monoclonal antibodies to rat antigens have been developed. Originally, these antigens were described independently by each individual investigator. The First International Workshop on Human Leukocyte Differentiation Antigens (HLDA) in 1982 designed a unifying Cluster of Differentiation (CD) nomenclature for humans. This proved very useful and was extended at the 6th HLDA workshop in November 1996 in Kobe, Japan to bring the number of CD antigens to 166 (Kishimoto et al., 1997). The database of the 6th HLDA workshop is accessible at http://mol.genes.nig. ac.jpn./hlda/. Molecules of significant function are relatively conserved and many CD homologues of rat origin have been reported. The advancement of new molecular biological techniques has rapidly expanded the number of rat CD homologues. Claims of equivalence are supported by many parameters of homology such as cDNA sequence, protein homology, antigen distribution and function. While many rat molecules exhibit great similarity with their human homologues, some rat antigens differ in protein sequence, antigen distribution and perhaps function. For example, the restricted expression of alternative splicing variants of the CD45 molecule is distributed differently in rat T-cell subsets compared with human T cells. Another example is the expression of CD5 where both in humans and in mice a distinct subset of CD5 § B cells (with possibly unique functions) can be found, while in rats such a subset cannot be discriminated on the basis of CD5 expression (Vermeer et al., 1994). In both humans and rats many new antigens are being discovered and this has encouraged to find their respec-

tive homologues in the other species. For example, biologically important antigens such as CD40 and CD95 (Fas, APO-1) were first discovered in humans and now rat homologues are being cloned on the basis of sequence homology (P. M. Dammers and F. G. M. Kroese, unpublished data). On the other hand the OX-40 antigen (belonging to the TNFR/NGR family) was first characterized in rats and has now been officially assigned as CD134 at the sixth HLDA workshop. Another future candidate for the CD cluster nomenclature is the rat RT6 molecule which is present on subsets of T cells which might be involved in the regulation of tolerance (Greiner et al., 1988). The human homologue gene has been cloned, but was shown to be a pseudogene. Whether other human molecules have taken over the function of RT6 is presently unknown. Table V.3.1 is an extension of a previously published chart (Lai et al., 1997) and has been updated (to March 1997). We realize that an overview of this still rapidly expanding field will always be incomplete but, hopefully, it will provide a basis for further exploration of biologically important molecules in the rat immune system. This rat database will also be made accessible on the World Wide Web.

I

Leukocyte Traffic and Associated Molecules

Introduction

Lymphocytes are unique among leukocytes with respect to their continuous traffic through the body, using the blood and lymph as routes to connect the lymphoid and non-


143

Table V.3.1 Rat cluster of differentiation (CD) homologues. This chart was originally published in Lai et aL (1997) and is reproduced here in modified and extended form with the permission of the publisher (Blackwell Science Inc.) Cluster of differentiation (CD)

Alternative names

CDld

CD2

LFA-2; sheep red blood cell receptor

Reduced molecular mass (kDa); molecular structure

Reported cellular distribution

Known or proposed function

45 kDa type I transmembrane associated with/32 microglobulin

Liver, intestine, kidney, heart, thymus, lymph node, spleen

50 kDa type I transmembrane

Tcells, thymocytes, NKcells, macrophages

Name of clone

References

Antigen-presentation; FcRbinding

Gene cloned, polyclonal Ab; crossreactive mAb 1H1,3C11

Burke et aL (1994), Ichimiya eta/. (1994)

T-cellactivation

OX-34, OX-53, OX-54, OX-55

Jefferies et aL (1985), Williams et aL (1987), Clark et aL (1988)

Signal transduction; T-cell receptor complex assembly

G4.18; 1F4

Tanaka et aL (1989), Itoh et a/. (1993), Nicolls eta/. (1993)

CD3

Tcells Multichain complex associated with TCR; eta (22 kDa) and zeta (16 kDa) gene cloned; epsilon (24 kDa)

CD4

53 kDa

Thymocytes, T-cell subsets, monocytes, subpopulation macrophages

MHC class II co-receptor

W3/25, OX-35, OX-36, OX-37, OX-38, ER2, RIB 5/2

Williams et aL (1977), Webb et aL (1979), Jefferies eta/. (1985), Joling et al. (1985), Lehmann eta/. (1992)

67-69 kDa type l transmembrane

Thymocytes, T cells; no distinct CD5 expressing B cell subset found

Regulation of cell activation

OX-19, HIS47, R1-3B3

Dallman et aL (1984), Matsuura et aL (1984), Vermeer eta/. (1994)

CD8a

32-34 kDa homodimer (CD8a/CD8a) or heterodimer (CD8a/CD8b)

Most thymocytes, T-cell subset, NK cells; intraepithelial lymphocytes

MHC class I co-receptor

OX-8, G28, G41, G162, N42

Brideau eta/. (1980), Thomas and Green (1983), Torres-Nagel eta/. (1992)

CD8b

32-34 kDa heterodimer (CD8a/CD8b)

Most thymocytes, T-cell subset, intraepithelial lymphocytes; not on fresh NK cells

MHC class I co-receptor

341

Torres-Nagel eta/. (1992)

CD9

26 kDa

Neural system; epithelia, haematopoeitic cells

Intercellular signalling

ROCA2

Tole and Patterson (1993)

CD5

Ly-1; Lyt-1

CD10

CALLA; neutral endopeptidase (NEP)

94-100 kDa

Epithelial cells

Neutral endopeptidase

Gene cloned, mAb not found; some antihuman mAb crossreact

Malfroy et aL (1987), Mahendran eta/. (1989), Helene et aL (1992)

CD11a

LFA-1 = chain

160-170 kDa; noncovalently pairs with CD18 to form LFA-1 integrin

All leukocytes, except for peritoneal macrophages

Adhesion to ICAM-1

TA-3, WT.1

Tamantani et aL (1991), Issekutz and Issekutz (1992)

CD11b

Mac-1 ~ chain; CR3 ~ chain

140-160 kDa noncovalently pairs with CD18 to form Mac-1 integrin

Myeloid progenitors, monocytes, macrophages, granulocytes

Adhesion to ICAM-1

OX-42, WT.5, ED7, ED8, 1B6C

Robinson et aL (1986), Damoiseaux et al. (1989), Tamantani eta/. (1991), Huitinga et al. (1993), Mulligan et aL (1993)

CD11 c

C3bi-receptor

120-130 kDa; noncovalently pairs with CD18 to form p150,95 integrin

Monocytes, granulocytes, macrophages

Adhesion to iC3b

OX-42 recognizes a shared epitope on CD1 lb and CD1 lc

Robinson eta/. (1986), Tamantani eta/. (1991)

CD13

Aminopeptidase N

140 kDa transmembrane glycoprotein

Kidney, lung

Zinc metalloproteinase

Gene cloned, mAb not Watt and Yip (1989) found

CD14

LPS receptor

58 kDa transmembrane protein

Macrophages, granulocytes, monocytes, glial cells

LPS receptor

ED9

Damoiseaux et aL (1989), Tracy and Fox (1995), Galea et aL (1996)

MMA

Reifenberger et aL (1987)

CD16

FcTRIII

Multiple isoforms, Pl-linked transmembrane protein

NK, monocytes, neutrophils, B cell lymphoma

Low-affinity IgG receptor

Genes cloned, mAb not found

Farber and Sears (1991), Farber et al. (1993)

CD18

/J2 integrin,/~ chain of LFA-1 family

90-100 kDa; pairs with CD11a, b, c

Leukocytes: see alpha partner for distribution

Adhesion; pairs with CD11 a, b,c

NG2B12, WT.3, 1F12, CL-26

Tamantani etaL (1991), Bautista et al. (1993), Mulligan et aL (1993), Pavlovic et al. (1994)

CD23

Fc~RII

45 kDa type II transmembrane glycoprotein

Alveolar macrophages, B cells

Low-affinity IgE receptor

Polyclonal R b 5 ; crossreactive antihuman mAb BB10

Mencia-Huerta et aL (1991), Flores-Romo et aL (1993)

CD24

Heat-stable antigen

PI-anchored transmembrane glycoprotein

B cells and B-cell progenitors

HIS50

Kroese et aL (1991), Tong et al. (1993), Hermans et aL (1997)

CD25

IL-2R ~ chain, TAC

55 kDa type I integral membrane

Broad: activated T cells, B cells, NK cells, and macrophages; upregulated upon activation

ART-18, ART-65, ART35, ART-38, ART-75, ART-94, OX-39, NDS61, NDS63, NDS66

Osawa and Diamantstein (1983), Mouzaki and Diamantstein (1987), Mouzaki et aL (1987), Paterson et aL (1987), Tellides et a/. (1989), Page and Dallman (1991), Wood et a/. (1992)

Brain

CD15

Receptor for IL-2, Tcell activation and proliferation

(continueo)

144


Continued

Table V.3.1 Cluster of differentiation (CD)

Alternative names




Name of clone

References

CD26

Dipeptidyl peptidase IV

220 kDa homodimer

Thymocytes, B and T cells, epithelial cells and certain endothelial cells

Ectopeptidase; cell activation

OX-61, F2/8A18

Ronco et al. (1984), McCaughan et al. (1990), Gorrell et aL (1991)

CD28

Tp44; Receptor for B7 family

45 kDa disulfide-linked homodimer

All ~,/~Tcells, most ~,6 T cells, half of NK cells, immature Tcells

Co-stimulation; ligand for B-7

JJ319, JJ316

Clarke and Dallman (1992), Mitnacht et aL (1995), Tacke et aL (1995)

CD29

Integrin ~1 chain

130 kDa; forms heterodimer with integrin ~ subunit (CD49)

Broad, including lymphocytes, endothelia, smooth muscle cells, epithelia

Adhesion

Ha2/5, Ha2/11

Mendrick and Kelly (1993)

CD31

PECAM-1

130 kDa type l membrane

Endothelia; weak on lymphocytes, neutrophils

Adhesion and migration

Polyclonal antibody

Vaporciyan et aL (1993), Wakelin et al. (1996)

CD32

FcTRII

Type I transmembrane protein

Granulocytes, mast cells

Low-affinity Fc receptor for aggregated immunoglobulin, immune complexes

Gene cloned, mAb not found

Bocek and Pecht (1993), Isashi et aL (1995)

CD35

CR1; C3b receptor

200 kDa type l transmembrane

B cells, monocytes, granulocytes, macrophages

Phagocytosis

Polyclonal crossreactive

Quigg et al. (1993)

CD36

Platelet GPIV

85 kDa palmitoylated transmembrane protein

Adipocytes

Broad

mAb not found

Jochen and Hays (1993)

CD38

Gene cloned, mAb not Tomlinson and Wright (1996) found

Transmembrane 4 superfamily

CD37 T10

34 kDa type II transmembrane protein

CD40 100 kDa highly sialylated transmembrane membrane protein

Pancreas, brain, duodenum, heart (RNA analysis)

ADP-ribosyl cyclase; hydrolase; cell activation


Koguma etaL (1994)

B cells

Co-stimulation in B cell activation


Dammers et aL (1998)

Broad and varied: stem cells, hematopoietic precursor cells; thymocytes, Tcells, plasma cells; monocytes

Adhesion

W3/13, HIS17, ER1, OX-56, OX-57, OX-58, OX-74, OX-75, 5H4, 8B8, 5G7

Williams etaL (1977), Joling et aL (1985), Kroese et al. (1985),Killeen et aL (1987), Cyster et aL (1991), Cyster and Williams (1992), Howell et al. (1994)

Varied and broad; all leukocytes, increased after activation; connective tissue

Adhesion; homing

OX-49, OX-50

Paterson et aL (1987), Wirth et al. (1993), Westermann et aL (1994)

CD43

Leukosialin; sialophorin

CD44

Pgp-1; H-CAM

CD44r

CD44v

120-200 kDa; splice variants of standard CD44

Epithelia

Adhesion, metastasis

1.1ASML

GQnthert et aL (1991), Seiter et al. (1993), Wirth et al. (1993)

CD45

Leukocyte common

Multiple isoforms: 180, 190, 200,220 240 kDa

Broad and varied expression on leukocytes; not on mature erythrocytes

Cell differentiation/activation; tyrosine phosphatase

OX-1, OX-28, OX-29, OX-30

Sunderland et al. (1979), Thomas et aL (1985), Woollett et al. (1985)

Hematopoietic precursor cells; all leukocytes

NDS58, BC84

Newton et al. (1986), Mojcik et aL (1987), Kampinga et aL (1990)

HIS41,8G6.1

Mojcik et al. (1987), Kampinga et al. (1990)

RTS-1

Nagoya et al. (1991)

HIS24

Kroese et al. (1987, 1990)

antigen CD45.1

RT7.1

190 kDa on thymocytes; expressed on rat strains ACI, AO, BN, DA, DZB, LEW, MAXX, PVG, SHR, WAG

CD45.2

RT7.2

Expressed on rat strains BUF, Hematopoietic precursor LOU and WF cells; all leukocytes

CD45R

Restricted LCA

CD45R

B220; restricted LCA

205 kDa

Pro- and pre-B cells, B cells, weak on marginal zone B cells, small subset of Tcells

CD45RA/B

Restricted LCA; exon A or A/B dependent

240 kDa

B cells

Signal transduction

OX-33

Woollett et al. (1985)

CD45RC

Restricted LCA; exon C dependent

190, 200, 220 kDa

Subset of thymocytes, CD8+ Tcells, subset of CD4+ T cells, B cells, NK cells

Signal transduction

OX-22, OX-31, OX-32, HIS25

Spickett et aL (1983), Kroese et aL (1985), Woollett et aL (1985), Law et al. (1989), Powrie and Mason (1989), McCall et aL (1992), Nagai et al. (1993)

CD46

Membrane cofactor protein (MCP)

Polyclonal antihuman crossreactive

Yang et al. (1993)

CD48

BCM-1; BLAST-1

OX-45, OX-46

Arvieux et al. (1986), Van der Merwe et al. (1993, 1994)

Subset of CD8§ Tcells

Inhibition of antibody production

Neonatal astrocytes

43-45 kDa member GPIlinked Ig superfamily

Mature hematopoietic cells and their bone marrow precursors, vascular endothelium and some connective tissue

Adhesion; costimulation; counter receptor of CD2 (rats)

(continued)


145

Table V.3.1 Continued Cluster of differentiation (CD)

Alternative names




Name of clone

References

CD49a

Integrin ~1 chain; =1 chain of VLA-1

180-200 kDa transmembrane glycoprotein; non-covalently pairs with CD29 to form VLA-1

Broad

Laminin/collagen receptor

3A3, 1B1, Ha31/8

Turner et aL (1989), Mendrick et al. (1995)

CD49b

Integrin ~2 chain; ~2 chain of VLA-2

160 kDa transmembrane glycoprotein; non-covalently pairs with CD29 to form VLA-2

Activated lymphocytes, epithelial cells, platelets

Laminin/collagen receptor

Hal/29

Mendrick and Kelly (1993), Mendrick et aL (1995)

CD49d

Integrin =4 chain; ~4 chain of VLA-4

150 kDa transmembrane Broad, B and T cells, glycoprotein; associates non- monocytes, thymocytes, covalently with integrin/~1 mast cells subunit (CD29) to form VLA-4 (or LPAM-2) or With integrin f17 subunit to form LPAM-1

Adhesion; VLA-4 is ligand for VCAM-1 (CD106) and LPAM1 is ligand for MacCam-1

TA-2, MRs4-1; crossreactive anti human mAb HP2/1

Issekutz and Wykretowicz (1991), Molina et al. (1994), Yasuda et al. (1995)

CD49e

Integrin c~5 chain; ~5 chain of VLA-5

Non-covalently pairs with integrin/71 subunit (CD29) to form VLA-5

Peripheral B cells, peritoneal mast cells, endothelium

Fibronectin receptor

HM~5-1

Yasuda et al. (1995)

CD51

chain of vitronectin receptor; osteoclast functional antigen (OFA)

Forms complex with f13 (CD61) chain to form vitronectin receptor

Osteoclasts

Crossreactive antihuman mAb 23C6

Horton et al. (1991)

CD53

OX-44 antigen

43 kDa, transmembrane 4 superfamily

All myeloid cells and peripheral lymphoid cells and their precursors; only a small subset of thymocytes

OX-44, 2D1,6E2, 7D2

Paterson et aL (1987), Bellacosa etaL (1991), Bell et aL (1992), Tomlinson et al. (1993)

CD54

ICAM-1

85 kDa type I glycoprotein; Ig superfamily

Broad; endothelial cells, Cell adhesion mediated by including high endothelial LFA-1 (CD11/CD18) venules; lymphocytes, epithelial cells, subpopulation of macrophages

1A29, 6A22, 10A25, 10A56

Tamatani and Miyasaka (1990), Colic and Drabek (1991), Kanagawa et al. (1991), Tamantani et al. (1991), Kita et al. (1992), Christensen et al. (1993)

CD55

Decayaccelerating factor (DAF)

Astrocytes

Polyclonal antibody

Yang et aL (1993)

CD59

Rat inhibitory protein (RIP)

21 kDa Pl-linked glycoprotein

Broad; erythrocytes, widely expressed in kidney

Inhibition of membrane attack complex (MAC) of complement; interaction with C-8 and C-9

6D1, TH9

Hughes et al. (1992, 1993), Rushmere et al. (1994)

CD61

/?3 chain of ~llb (CD41) and ~v (CD51)

100 kDa; non-covalently pairs with CD51 to form the vitronectin receptor and CD41

Platelets, megakaryocytes and osteoclasts, mast cells

Extracellular adhesion

F4, F11, HM/~ 3-1

Helfrich et aL (1992), Yasuda et aL (1995)

CD62E

E-selectin; ELAM

60 kDa

Endothelium

Endothelial-leukocyte interaction

ARE-5; cross-reactive antihuman mAbs; CL-3 and CL-37

Mulligan etaL (1991), Fries et al. (1993), Billups et al. (1995), Misugi et al. (1995)

CD62L

L-selectin; LECAM-1 ; A.11

65 kDa on lymphocytes; 62 kDa on neutrophils

Most peripheral lymphocytes and neutrophils; small subpopulation of thymocytes

Endothelial-leukocyte interaction

HRL1, HRL2, HRL3, HRL4, OX-85

Saoudi et al. (1986), Watanabe et ai. (1992), Tamatani et al. (1993a, b), Westermann et aL (1994), Sackstein et aL (1995)

CD62P

P-selectin; GMP-140; PADGEM

140 kDa type I transmembrane glycoprotein

Platelets, endothelial cells

Endothelial-leukocyte interaction; interaction of platelets and neutrophils

Crossreactive antihuman mAbs PB1.3, (CY1747), PNB1.6 and LYP20

Mulligam et aL (1992), Winocour et aL (1992), Auchampach et aL (1994), Chignier et al. (1994), Zimmerman et aL (1994), Papayianni et al. (1995)

CD63

AD1 antigen; ME491

50-60 kDa; transmembrane 4 Mast cells, bone marrow, superfamily glycoprotein platelets

Secretory process/signal transduction

AD1

Kitani et aL (1991), Nishikata et al. (1992)

CD66a

BGP.1; ectoATPase

Multiple isoforms 105 and 110 kDa

Liver cells, epithelia in gastrointestinal tract, liver, some secretory glands, vagina, kidney and lung, granulocytes

L-form (105 kDa)involved in adhesion

362.50

Hixson etaL (1985), Odin and Obrink (1987), Lin et aL (1991), Culic etaL (1992), Cheung et aL (1993)

CD66e

CEA

350 kDa

Carcinoma cell-line RCA-1

Adhesion

5B1

Kim and Abeyounis (1988, 1990)

90-110 kDa, intracellular protein

Monocytes, macrophages

ED1

Dijkstra et al. (1985), Damoiseaux et aL (1994)

CD68

Signal transduction

(continueo)

146



Continued Alternative names


CD71

Transferrin receptor

95 kDa homodimeric type II membrane protein

Proliferating cells, activated T Activation, iron metabolism and B cells, endothelium, neuronal cells, epithelial cells

CD73

Ecto-5'nucleotidase

67-68 kDa

Broad, including kidney; B and Tcell subsets

CD74

li, MHC class II invariant (~) chain

Gene cloned

CD75

Alpha 2,6sialyltransferase (SiaT-1)

Gene cloned

CD77

Globotriaosylceramide

CD79a

Ig alpha; mb-1

38 kDa type I glycoprotein, subunit of B-cell antigen receptor complex

B cells

CD79b

Ig beta; B29

36 kDa type I glycoprotein, subunit of B-cell antigen receptor complex

CD80

B7/BB1; B7-1

CD81



Name of clone

References

OX-26

Jefferies et aL (1984, 1985), Giometto et al. (1990)

Ecto-5'-nucleotidase activity

5NE5, 5NH3, 5N4-2, B5

Siddle et aL (1981), Bailyes et aL (1984), Carvalho et aL (1987), Dawson et al. (1989), Gandhi et al. (1990)

MHC class II positive cells

Intracellular sorting of class II molecules


McKnight et aL (1989), Neiss and Reske (1994)

Liver, kidney

Alpha 2,6-sialyltransferase activity

Gene cloned, mAb not O'Hanlon etaL (1989) found BGR23

Kotani et aL (1994)

Signal transduction

Crossreactive mAb HM57

Jones et aL (1993)

B cells

Signal transduction

Crossreactive mAb B29/123

Jones et aL (1993)

80-90 kDa type I transmembrane protein; Ig superfamily

Activated B cells, T cells, dendritic cells, macrophages

Counter-receptor of CE)28/ CD152 (CTLA-4); cell activation; co-stimulation

3H5

Judge et aL (1995), Maeda et aL (1997)

Target of antiproliferative antibody (TAPA-1)

Tetramembrane spanning protein

Astrocytes

Regulation of mitotic activity

AMP1

Geisert et aL (1996)

CD86

B7-2

90-100 kDa type I transmembrane protein; Ig superfamily

T cells, macrophages

Counter-receptor of CD28/ CD152 (CTLA-4); cell activation; co-stimulation

24F

Maeda et aL (1997)

CD90

Thy-1

18 kDa Pl-linked Ig superfamily

Broad and varied; subset T cells; precursor and immature B cells; stem cells; brain

Tcell activation, signal transduction; apoptosis

OX-7, HIS51, ER4

Mason and Williams (1980), Campbell et al. (1981), Bukovsky et aL (1983), Joling et aL (1985), Hermans and Opstelten (1991), Kroese et aL (1995)

CD91

c~2 macroglobulin receptor (A2MR); lipoprotein receptor-related protein (LRP)

600 kDa membrane protein

M onocytes/macrophages, liver, adipocytes

Multifunctional: lipoprotein metabolism, hemostasis, proteinase inhibition

Phage antibody scFv7; polyclonal Ab

Kowal et aL (1989), Meilinger et aL (1995), Hodits et aL (1995)

CD95

Fas; APO-1

Gene cloned

Heart myocytes; variant form in liver; B cells

Apoptosis

Gene cloned, mAb not found; polyclonal available

Kimura et aL (1994), Tanaka et aL (1994), Dammers et aL (1998)

CD95L

Fas ligand

Type II membrane protein

Activated lymphocytes, CTLs

Apoptosis

Gene cloned, mAb not found; polyclonal available

Mita etaL (1994)

CD103

HML-1

Heterodimer of 100 and 120 kDa

Intraepithelial lymphocytes

RGL-1

Cerf-Bensussan et aL (1986)

CD106

VCAM-1

Gene cloned

High endothelium, inflamed blood vessels

CD107a

LAMP-l, Igp120

107 kDa lysosomal membrane sialoglycoprotein

Liver

Gene cloned, mAb not found; polyclonal Ab

Howe et aL (1988), Himeno et aL (1989), Akasaki et aL (1993)

CD107b

LAMP-2

96 kDa lysosomal membrane sialoglycoprotein

Liver


Noguchi et aL (1989), Akasaki et al. (1993)

CDl15

M-CSFR; CSF1R; c-fms

Gene cloned

Macrophages, myoblasts

Signal transduction; cell differentiation


Raivich et al. (1991), Borycki et al. (1992)

CDl17

c-kit; stem cell factor receptor

Gene cloned

Broad (brain, liver, testis, pancreas)

Tyrosine kinase

Gene cloned, mAb not Tsujimura etal. (1991), Fujio et aL (1996), Oberg-Welsh found; polyclonal and Welsh (1996) available

CD120a

TNF R, type I

48 kDa

Binds TNF-~ and TNF-/t


Himmler et aL (1990)

CD121a

II-IR, type l

80 kDa

Binds IL-1

Gene cloned, crossreactive antihuman mAb

Hart et aL (1993), Sutherland et al. (1994), Mugridge et aL (1995), Scherzer et al. (1996)

Intestinal epithelium and capillary endothelium

Broad

Adhesion molecule, ligand for 5F10 VLA-4 (CD49d/CD29)

Williams et aL (1992), May et aL (1993)

(continuee)



147

Continued

Alternative names


CD121b

IL-1 R, type II; p68

CD122



60 kDa Ig superfamily glycoprotein

Broad

IL-2R ~ chain; p75

85-100 kDa hematopoietin receptor family

CD124

IL-4R

CDw130

Name of clone

References

Binds IL-I" ? not involved in signaling

Gene cloned, crossreactive antihuman mAb; ALVA 42

Luheshi et aL (1993), Bristulf et al. (1994), Mugridge et aL (1995), Scherzer et al. (1996)

NK cells and Tcells; upregulated upon activation

Signalling; high IL-2 binding; pairs with CD25 and 7c chains to form high affinity receptor

L316

Page and Dallman (1991), Park et al. (1996)

Cytokine receptor superfamily

Tcells

IL-4 receptor


Richter et aL (1995)

IL-6R

Gene cloned

Broad

IL-6 receptor

Gene cloned, mAb not found; crossreactive antimouse mAb

Baumann et aL (1990), Schobitz et aL (1993), Greenfield et aL (1995)

CDw131

Common fl chain

Pairs with = chain of IL-3R, IL-5R and GM-CSFR

Microglia

Signal transducing subunit of receptor for IL-3, IL-5 and GM-CSF


Appel etaL (1995)

CD134

OX-40

50 kDa, transmembrane protein, member of TNF receptor/nerve growth receptor superfamily

Activated CD4 § T cell blasts

OX-40

Paterson et aL (1987), Mallett et al. (1990)

CD138

Syndecam-1

Transmembrane proteoglycan

Broad


Cizmeci-Smith etaL (1992), Carey et aL (1994), Kovalsky et al. (1994)

CD140a

Platelet-derived growth factor receptor (PDGFR) alpha

Gene cloned, member of the receptor tyrosine kinase family

Endothelial cells; brain


Lee et aL (1990), Lindner and Reidy (1995)

CD140b

Platelet-derived growth factor receptor (PDGFR) beta

Endothelial cells, lipocytes, lung

Gene cloned, mAb not found; crossreactive antihuman mAb; polyclonal Ab

Sarzani et aL (1992), Wong et al. (1994), Liu et al. (1995)

CD141

Thrombomodulin

Endothelial cells

mAb not found; polyclonal Ab

Sabolic et aL (1992), Arai et aL (1995)

CD143

Angiotens~.~. converting enzyme (ACE)

160 kDa

Endothelial cells

~-ACE3.1.1, A10-E3, F9-F9, A24; crossreactive antihuman mAb 9B9

Auerbach etal. (1982), Moore et aL (1984), Strittmatter and Snyder (1984), Danilov et al. (1989)

CD147

Neurothelin, basignin, OX-47, CE-9

40-68 kDa type I membrane glycoprotein

Broad, including spleen and thymus; levels increase on lymphocytes on activation

OX-47

Paterson et aL (1987), Fossum etal. (1991), Nehme et al. (1993, 1995)

CD148

HPTP-eta

180-220 kDa transmembrane protein

Endothelial cells, megakaryocytes, smooth muscle cells, platelets

Adhesion; protein tyrosine phosphatase activity


Borges etaL (1996)

CD152

CTLA-4

Gene cloned

Tcells

Co-stimulation


Oaks etaL(1996)

CD157

BST-1

Gene cloned

Islets of Langerhans


Furuya etaL(1995)

lymphoid organs of the body. Granulocytes, in contrast, enter a tissue, die, and never return to the blood. Very little is known about the kinetics of monocytes. This is probably due to the problem of labeling monocytes for trafficking experiments without activating them, which would affect their migratory routes. Data on normal rather than the pathological conditions is discussed in this section. The recruitment of lymphocytes to one specific organ or its compartments depends on the interaction of adhesion molecules on leukocytes and endothelial cells (entry into the tissue), the migration through the parenchyma of an organ (transit), and mechanisms to exit the organ (exit), e.g. via efferent lymphatics in lymph nodes or via the venous blood in the spleen. In the transit phase lympho-

cytes can be activated and they start to proliferate or they die, e.g. by apoptosis. Thus, recruitment is the net effect of all these aspects. Quantitatively, many more lymphocytes migrate daily to organs without high endothelial venules (HEVs), such as the spleen, lung and liver, than to those with HEVs, e.g. lymph nodes and Peyer's patches (Pabst and Westermann, 1997). Most studies have focused on the entry phase in organs with high endothelial venules (HEV), that is the interaction between endothelial cells and lymphocytes mediated by different adhesion molecules. There is a certain preferential migration of lymphocytes to peripheral lymph nodes rather than to Peyer's patches but not an exclusive migration to one organ only. The preferential accumulation of lymphoblasts in the rat,

148


e.g. gut-derived blasts migrating to the lamina propria of the small intestine and Peyer's patches as well as other mucosal organs such as the lung, is summarized by Smith and Ford (1983).

Species-specific aspects in leukocyte traffic The rat was the experimental animal used in most of the early experiments documenting the recirculation of lymphocytes which were performed by Gowans and others in the early 1960s (for review see Ford, 1980). The rat has several advantages as an experimental model for lymphocyte migration studies compared with other small laboratory animals such as mouse, hamster and guinea pig, or larger animals such as rabbit, pig, sheep and monkey. 1. As in mice, there are a series of inbred strains that enable leukocyte transfers, nude rats lacking T lymphocytes, and congenic strains in which lymphocyte transfers without any in vitro labeling are possible when an antibody against the other strain is used, e.g. leukocyte common antigen (RT7.1 and RT7.2). 2. Physiologically migrating lymphocytes can be obtained much more easily in the rat than in the mouse, e.g. by taking the blood or lymph from the thoracic duct. Mesenteric lymph nodes can be removed in the rat and later lymphocytes derived directly from the gut wall can be obtained and used for lymphocyte traffic experiments. In the mouse, mainly cell suspensions from the spleen or lymph nodes are used but these contain many nonmigratory lymphocytes which might also be damaged by the separation procedure. Repeated blood samples can be obtained from individual rats and long term intravenous (i.v.) infusions and thoracic duct cannulations for kinetic experiments can be carried out for up to 7 days (Westermann et al., 1994a).

Table V.4.1.

3. Organs, e.g. the lung, can be transplanted and used as models for transplantation immunology and also for study of the basic mechanisms of lymphocyte traffic (Westermann et al., 1996a) or the effects of blocking antibodies against adhesion molecules in preventing reperfusion injuries. 4. Intravital videomicroscopy has been used to study the interaction of lymphocytes with the vessel wall in rat Peyer's patches (Miura et al., 1995), which would not be possible in larger animals owing to the size of the organs. 5. Some basic molecular mechanisms of the role ofiadhesion molecules on leukocytes and endothelial cells can best be studied in in vitro tests. The adhesion of lymphocytes to HEV on frozen sections was first established on rat tissues (Stamper and Woodruff, 1976, 1977) and later improved in this species (Willftihr et al., 1990a). Endothelial cells from HEV of rat lymph nodes have successfully been cultured (reviewed in Ager, 1994). 6. Tamatani and Miyasaka (1990) and Tamatani et al. (1991, 1993) described monoclonal antibodies (mAbs) against rat ICAM-1, CD11/CD18 and L-selectin and Issekutz and Wykretowicz (1991) described mAbs against VLA-4. Details of the expression of adhesion molecules on lymphocyte subsets and different vessels in the rat are compiled in Tables V.4.1 and V.4.2. All these reagents enable detailed studies on lymphocyte traffic in rats. In general, the functions of the adhesion molecules are similar to those described for mice and humans. 7. In rats a large number of models for human disease have been established. They have been used to interfere with lymphocyte traffic by applying antibodies against adhesion molecules, e.g. in models for inflamed skin (Issekutz et al., 1991) or rheumatoid arthritis (Issekutz et al., 1996).

Constitutive expression of adhesion molecules involved in the traffic of blood leukocyte subsets a

Adhesion molecules b L-selectin (CD62L)

Subsets B lymphocytes T lymphoc~e~s CD8 CD4 NK cells d Monocytes e Granulocytes ~

(15%) c (65%) (15%) (50%) (5%) (5%) (10%)

. 85% 95% 75% 90% 70% 60% 15%

~4-integrins (CD49d)

LFA- 1 (CD 1 la/18)

ICAM- 1 (CD54)

LFA-2 (CD2)

Pgp- 1 (CD44)

40% 30% 15% 20% 10% 95% 15%

65% 75% 60% 60% 100% 100% 95%

95% 15% 30% 5% 80% 95% 25%

5% 100% 95% 100% 75% 25% 35%

45% 100% 100% 100% 100% 100% 100%

aThe references are summarized in Westermann et aL (1994b, 1996b) and Klonz et aL (1996). b Percentage of adhesion molecule positive cells in each subset. CThe data in brackets indicate the frequency of the subset among all blood leukocytes. d Identified with the antibody 3.2.3. e Identified by low CD4 expression and high forward-scatter characteristics. qdentified by forward and side-scatter characteristics.


Table V.4.2.

149

Expression of adhesion molecules on various types of endothelial cells

Adhesion Endothelial cells Arterial Capillary Postcapillary flat high lymph node Peyer's patches Venous

molecules a

ICAM- 1 (CD54)

VCAM- 1 (CD 106)

E-selectin (CD62E)

P-selectin (CD62P)

PECAM- 1 (CD31)

GlyCAM- I b

(+) +

nd

1"

nd T

+ nd

nd nd

+ + + +

1" + nd -

nd nd nd 1"

1" nd nd nd

nd nd nd +

nd + nd

+, constitutively expressed; [, expressed on stimulation; (+), weakly expressed; - , not expressed; nd, not determined. NO antibodies for rat MadCAM-1 are available. The references for the adhesion molecules described are summarized in Mulligan et aL (1991), May et al. (1993), Seekamp et al. (1993), Tamatani et al. (1993), Vaporciyan et al. (1993), Yamazaki et al. (1993), Matsuo et al. (1994), van Oosten et al. (1995), Tipping et al. (1996). b Identified by the ability to bind L-selectin (CD62L). a

The combination of these advantages makes the rat a valuable model for many basic and applied experiments on lymphocyte migration. The large litter size, easy breeding, low costs and genetic characterizations are all advantages of using the rat as an experimental animal rather than larger animals such as the rabbit, pig or sheep. In addition to adhesion molecules, an additional class of molecules, the chemokines (formerly called chemoattractant cytokines) and their receptors, are of increasing interest because of the effects on lymphocyte migration but also on T-cell activation and hematopoiesis (Prieschl et al., 1995; Mackay, 1996). In contrast to the mouse and humans, little is known about these molecules in the rat. Examples of these chemokines are the macrophage inflammatory protein-2 (MIP-2) (Wu et al., 1995; Schmal et al., 1996), the monocyte chemoattractant protein-1 (MCP-1) (Berman et al., 1996) and the cytokine-induced neutrophil chemoattractant (CINC) (Wu et al., 1995). The role of chemokines in the rat has been studied in respect to the recruitment of neutrophils. There are no data about effects of chemokines on leukocyte migration kinetics or potential differential effects on lymphocyte subsets. It is probable that many more functions of chemokines in rat leukocyte traffic will be published. Based on the advantages of the rat for studies on lymphocyte traffic some concepts of lymphocyte migration, which had been generalized as valid for all species, have been questioned or modified by data obtained in the rat. Some examples of lymphocyte traffic experiments only performed in the rat so far are also given in the following paragraphs. Several years ago it was proposed that B lymphocytes migrate prefentially to Peyer's patches and T lymphocytes to peripheral lymph nodes. When physiologically migrating lymphocytes were used no such preference could be found in vitro or in vivo (Westermann et al., 1992; Walter et al., 1995). Mackay (reviewed in 1993) proposed the concept that memory T-lymphocytes migrate to tissues such as the skin and arrive at the regional lymph nodes via

afferent lymphatics and 'virgin' lymphocytes enter lymph nodes via HEVs when the expression of the CD45R isoforms is taken as a marker for memory and naive lymphocytes. In the rat, however, neither in vitro nor in vivo did traffic experiments support this concept (reviewed in Westermann and Pabst, 1996). The effects of different cytokines on the expression of adhesion molecules of endothelial cells have been studied in detail in vitro, but much less is known about the effects in vivo. In the rat, the effect of interferon 7 on lymphocyte kinetics has been studied. While the number of lymphocytes in the blood were unaffected by continuous IFN-? infusions, the recirculation into the thoracic duct was greatly reduced with different effects on lymphocyte subsets (Westermann et al., 1993, 1994a). Recently, Anderson and Shaw (1993) summarized data from rats to formulate a new concept: cytokines, which reach a lymph node by the afferent lymphatics, are transported by a fibroblastic reticular cell conduit system to the HEV, the entry site for lymphocytes into a lymph node. Not only the interaction of lymphocytes with endothelial cells regulates lymphocyte traffic but the transit through the organs might be of even greater importance. The route of B and T lymphocytes through the different compartments of the spleen and lymph node have been studied in great detail only in the rat. Different labeling techniques have been combined with morphometry and immunohistology to document the route of lymphocyte subsets and the total numbers per compartment (Willftihr et al., 1990b; Blaschke et al., 1995). Combining the use of purified T-lymphocyte subsets from the thoracic duct with surface markers such as CD45RC and blocking antibodies against the 0~4 integrin resulted in surprising results, e.g. mature recirculating CD45RC-CD4 + T lymphocytes enter the thymus by 0~4 integrin-VCAM-1 interaction (Bell et al., 1995). Thus, the rat is an important species in challenging those hypotheses of lymphocyte migration which generalize a phenomenon described only in the mouse as valid for all other species.

150

5.


Cytokines and their Receptors

Molecular cloning techniques have revolutionized the large scale production of a wide variety of prokaryotic and eukaryotic proteins including cytokines. These latter (glyco)proteins have received much attention in recent years mainly because of their potential clinical value. The term 'cytokine' denotes to a diverse group of glycoproteins which affect various cell functions and have a myriad of biological activities. Originally, cytokines were named according to cell source or earliest identified biological activity. However, designations as lymphokines, monokines, interferons and growth factors have lost much of their meaning because subsequent studies have shown that these glycoproteins could be produced by numerous cell types and exert overlapping and often similar regulatory actions. At present, more than 50 genes encoding for different cytokine/receptor combinations have been identified, cloned and thoroughly characterized; new cytokines are still discovered with such frequency that it is difficult to maintain an overall picture. A major problem in cytokine research is the species specificity, which means that human cytokines show little if any biological activity in animal systems. Even between closely related animal species, such as mice and rats, interchangeable use is sometimes not possible. In this section, we have summarized available data from literature describing the isolation, characterization and expression of chromosomal and cDNA genes encoding rat cytokines and their specific cell-surface receptors. The data are presented in tabular form (Tables V.5.1 and V.5.2) and provide the reader with a brief overview of the present state of affairs of rat cytokines and their receptors at both the nucleotide and protein level. We have chosen to review the most important chemical properties and biological activities of the different recombinant proteins. Detailed information on gene structure, amino acid sequences and other biophysical and biological aspects can be found in the references provided. It is possible that we may have missed a number of papers with crucial data on this subject and apologize for any unintentional omission of important contributions. In general, information on rat cytokines is fragmented and incomplete. This is quite different from mouse and human cytokines, which have always been the cytokines of choice for many research groups all over the world. Numerous human and mouse cytokine genes have been thoroughly characterized and most of them have been expressed in high yield in either prokaryotic or eukaryotic cells. That rat cytokines have always been a 'changeling' in the field of cytokine research is not surprising. High cross-species reactivity of mouse cytokines in the rat system has always been an argument against the need of cloning and expressing rat cytokines. However, it is realized more and more that for in vivo studies, homologous cytokines are preferable. This is because of the possible antigenicity of hetero-

logous cytokines upon long-term in vivo administration. Although a relatively low number of rat cytokine genes have been isolated and characterized to date, there is a clear growing interest in rat cytokines, which can be expected to increase in the coming years. At present, a relatively low number of cytokines are expressed in appropriate host/vector systems for large-scale production. Consequently, the biological activities in the tables have not all been established with the recombinant proteins themselves but adopted from bioactivities exerted by mouse and/or human cytokine analogues. We do not think that this adaptation depreciate the information provided because of the high degree of functional conservation between rat, mouse and human cytokines. There are also a number of gaps in the table which may indicate that this information is not available, or resides in laboratory journals somewhere, but has not appeared in scientific papers, or the experiments have simply not been performed. Originally, we also planned to include immunoassays and bioassays in this survey. However, it was discovered that, with some notable exceptions, bioassays specific for mouse cytokines can often be used to measure the biological activity of rat cytokines and these assays are described elsewhere in this book. The list of immunoassays (particularly ELISAs) specific for rat cytokines is growing rapidly and can be found in the catalogues of numerous biotechnological firms. For that reason, we have omitted this information from the tables.

6.

T-Cell Development

Intra-thymic T-cell d e v e l o p m e n t In terms of TCR, CD2, CD4, and CD8 expression, thymocyte differentiation in the rat largely resembles that in the mouse (Aspinall et al., 1991). In addition, some markers more or less unique for the rat have been used in thymocyte differentiation studies, MRC OX-44 (Paterson and Williams, 1987; Paterson et al., 1987a,c), MRC OX-22 (anti-CD45RC) (Law et al., 1989), ER3 (Joling et al., 1985), HIS44 (Aspinall et al., 1991) and HIS45 (Kampinga et al., 1990). OX-44 was shown to label virtually all C D 4 - 8 - double negative (DN) cortical and mature CD4 or CD8 single positive (SP) medullary thymocytes. Thymopoietic potency, as demonstrated by intrathymic injection and proliferation upon allogenic or mitogenic stimulation are accounted for by OX-44 + DN thymocytes (Paterson et al., 1987a). Regeneration of the thymic cortex after irradiation, however, occurs mainly by proliferation of C D 4 - 8 § thymocytes (Paterson and Williams, 1987). CD45RC is expressed by ~ 60% of DN thymocytes, and these thymocytes have thymus regenerative capacity, whereas CD45RC- DN thymocytes have not (Law et al., 1989). Proliferation, as measured by BrdU incorporation is identical among CD45RC § and CD45RC- DN thymo-

T-Cell Development

cytes (Law et al., 1989). The ER3 determinant was shown to label virtually all cortical thymocytes and CD8 SP medullary thymocytes (Joling et al., 1985). The mAbs HIS44 and HIS45 recognize cortical and medullary thymocytes respectively (Kampinga and Aspinall, 1990b; Aspinail et al., 1991). A discrepancy with mouse data is the fact that rat T C R - / C D 4 - 8 - thymocytes do not appear to express IL-2R~ (CD25) or other IL-2-binding proteins (Paterson and Williams, 1987; Takacs et al., 1988). This has raised some debate on the issue of whether IL-2 is an essential growth factor for thymocytes in the DN preselectional stage of differentiation (Aspinall et al., 1991; Kroemer and Martinez, 1991; Kampinga, 1991). Another feature in which rat intrathymic T-cell development appears to differ from that in mouse and humans is that most immature TCRI~ § § thymocytes in the rat express little or no CD28, whereas CD28 expression on T C R intermediate and T C R high thymocytes is high (Tacke et al., 1995). CD28 and other cell interaction molecules (CD2, CD5, CD53 and, to a lesser extent, CD11a and CD44) on selectable rat thymocytes were found to be rapidly upregulated upon TCR ligation in vitro. Their kinetics and cell distribution were elegantly demonstrated by Mitnacht et al. (1995). An outline of fetal rat thymocyte development is given in Figure V.6.1.

Post-thymic T-cell development Much of the study on phenotypic peripheral T-cell development in the rat involves the markers CD4, CD8, Thy-1, RT6, and CD45RC. As in mice and humans, except for a small (3-5%) subset, most rat peripheral T cells show mutually exclusive expression of CD4 and CD8, identifying two functionally different T-cell subsets (Brideau et al., 1980). The presence or absence of the remaining three markers has been found to represent differences in maturational stage, but also in function of peripheral T cells in the rat. In adult rats, Thy-1 is expressed by a subset of bone marrow cells, all thymocytes and a small population of peripheral leukocytes, including a small subset of T lymphocytes (Ritter et al., 1978; Crawford and Goldschneider, 1980). In neonatal rats Thy-1 is expressed by the vast majority of peripheral T cells (Thiele et al., 1987), and, after adult thymectomy the percentage of Thy-1 + T cells in the periphery rapidly declines (Hosseinzadeh and Goldschneider, 1993; Groen et al., 1995). From these and other findings it was concluded that Thy-1 expression is lost during the early stages of post-thymic T-cell development. In terms of T-cell function, it was found that Thy1 + T cells in the rat exhibit delayed allograft rejection (Yang and Bell, 1992). The alloantigen RT6 is expressed on 5 0 - 8 5 % (depending on age and strain) of peripheral CD4 + and CD8 + T

151

cells in the rat (Greiner et al., 1982; Mojcik, 1988, 1991), on a subset of intraepithelial lymphocytes (Fangmann et al., 1990), a subset of NK cells (Wonigeit, 1996), but not on thymocytes and bone marrow cells (Mojcik, 1988). RT6 § T cells have been shown to play an important regulatory role in the prevention of autoimmunity (see Section 17). These cells suppress mixed lymphocyte reactivity, and cytotoxic reactions have been documented to be mediated by their (CD8 § R T 6 - counterparts (Greiner et al., 1988). Acquisition of RT6 expression on T cells occurs almost simultaneously with the loss of Thy-1 (Thiele et al., 1987; Groen et al., 1996b). In the rat, CD45RC is expressed by all B cells, two-third of CD4 § and ~90% of CD8 § T cells (Spickett et al., 1983). CD4 § § T cells provide primary B-cell help in vivo, proliferate vigorously in MLR, produce high amounts of IL-2 and IFN-? and are associated with cellular autoimmunity (Powrie and Mason, 1990b; reviewed by Fowell et al., 1991) and the prevention of humoral autoimmunity (Mathieson et al., 1993). The expression and loss of CD45RC on T cells has been shown to be cyclic and to reflect changes in the state of activation of T cells (Bell and Sparshott, 1990; Sparshott and Bell, 1994). With respect to phenotypic development of rat T cells, two studies examining the combined expression of Thy-1, RT6 and CD45RC are of particular interest. Hosseinzadeh and Goldschneider (1993) used the intra-thymic FITC injection technique, and Kampinga et al. (1992, 1997) used the technique of vascular thymus transplantation in RT7 congeneic PVG rats to study phenotypic changes in developing rat peripheral T cells. These studies demonstrated that recent thymic migrants/emigrants (RTM or RTE, respectively) in the rat can unequivocally be identified by the expression of Thy-1 and the absence of both RT6 and CD45RC. In diabetes-prone BB (DPBB) rats, both RT6 § and CD45RC § T cells are severely underrepresented (Greiner et al., 1986; Groen et al., 1989), whereas percentages of Thy-1 + T cells are over-represented (Groen et al., 1995). A relatively high proportion of T cells in these rats is of the Thy-1 + / R T 6 - / C D 4 5 R C phenotype (Groen et al., 1996b). A high frequency of these immature peripheral T cells is in agreement with a short life span observed for a majority of T cells in these rats (Groen et al., 1996a). Upon the loss of Thy-1 expression during peripheral maturation in normal rats, RT6 expression is acquired and, slightly later, CD45RC expression also. The phenotype thus acquired ( T h y - 1 - / R T 6 + / CD45RC § represents the bulk of peripheral T cells in the rat and these cells were therefore termed common peripheral T cells (CPT). In addition, Kampinga et al. (1996) showed that, secondarily, both RT6 and CD45RC are lost from a small subset of formerly T h y - 1 - / R T 6 + / CD45RC + T cells, leaving them T h y - 1 - / R T 6 - / CD45RC-, T h y - 1 - / R T 6 - / C D 4 5 R C § or T h y - 1 - / RT6 § Since RT6 and CD45RC have separately been shown to be lost upon activation (Hunt and Lubaroff, 1987; Powrie and Mason, 1990a), and since the

152


Table V.5.1.

Recombinant rat cytokines: cloning, expression and characteristics

Amino acid content (mature protein)

Potential glycosylation sites (mature protein)

Molecular mass Cysteine residues (kDa)(mature (mature protein) protein)

1

5

Abbreviations

Cytokine

Alternative name

Expression system

Chromosomal gene structure

IFN-c~

Interferon alpha

Type I/leukocyte IFN

Escherichia coil Baculovirus

Multiple copies, no introns

169

IFN-/~

Interferon beta

Type I/fibroblast IFN

CHO cells

Single copy, no introns

163

16-40 (heavily glycosylated)

IFN-7

Interferon gamma

Type II/immune IFN

CHO cells

Single copy, three introns

137

14-25 glycosylated

IL-I~

Interleukin-1 alpha

Catabolin, tumorinhibitory factor-2, lymphocyte activating factor

COS-1 E. coil

Not reported

156

Not reported

IL-2

Interleukin-2

T-cell growth factor

CHO

Not reported

135

One putative O-glycosylation site

IL-3

Interleukin-3

Multi-colonystimulating factor (multi-CSF)

COS-1

Four introns

IL-4

Interleukin-4

B-cell growth factor-I, B-cell stimulatory factor-1 (BSF-1)

CHO

IL-5

Interleukin-5

B cell growth factor-2, T cell replacement factor, eosinophil differentiation factor (EDF)

IL-6

Interleukin-6

IL-10

Interleukin- 10

18-19

~17 (nonglycosylated)

Not reported

~ 17

140

4

22.5-26

Single copy, three introns

123

7

17-20

Retroviral expression in T88M cells

Three introns, single copy gene

132

Not reported

IFN-/~2, B cell stimulatory factor-2, B cell differentiation factor

Transection of murine L cells and human HeLa cells with rat IL-6 cDNA; E. coil(produced as a fusion protein)

Four introns, single copy gene

187

None

Cytokine synthesis inhibitory factor (CSIF), B-cell derived T-cell growth factor

COS-7 cells, E. coil (fusion protein)

Not reported

160

2

14.5 (predicted)

5

~22

/> 18.6 (predicted)

T-Cell Development

153

Abbreviations

Amino acid sequence homology with cytokine counterparts of other species (mature protein)

Nucleotide sequence data (GenBank/ EMBL Accession numbers)

IFN-~

Mouse: 81%

Not reported

No activity on human cells

IFN-fl

Mouse: 76% Human: 46%

Not reported

IFN-7


IL-I~

Major cell source or location

Main biological activities

Other characteristics

References

Various cell types, most prominently macrophages

Exerts antiviral activity; has antiproliferative properties; induces MHC class I expression; influences lymphocyte traffic; augments NK activity

Acid stable

Dijkema et aL (1984), van der Meide et al. (1986a), Spanjaard et al. (1989), P. H. van der Meide et aL, unpublished data

Approximately 10% antiviral activity on human cells

Fibroblasts, macrophages, epithelial cells

Similar to IFN-=

Acid stable, heat labile

Ruuls et aL (1996), P. H. van der Meide et aL, unpublished data

M29315-17

Full activity on mouse cells; no activity on human cells

Tcells, NK cells

Activates monocytes/ macrophages; induces MHC class I and II molecules on various cell types; exerts antiviral activity

Acid labile

Dijkema et al. (1985), van der Meide et al. (1986b)

Mouse: 83% Human: 65% (including precursor region)

Not reported

Active on human cells (G IF activity)

Monocyte/ macrophages endothelial cells, glial cells, Tand B cells, NK cells, fibroblasts

Stimulates synthesis of acute phase proteins; activates resting 1-cells; stimulates growth fibroblasts and astrocytes; stimulates CRF release; augments PGE and collagenase synthesis

Nishida et al. (1989)

IL-2


M 22899

High crossreactivity on mouse cells

T cells

Growth factor for activated T cells; activates cytotoxic lymphocytes; stimulates production of secondary cytokines; stimulates proliferation of B lymphocytes

McKnight et al. (1989), McKnight and Classon (1992)

IL-3

Mouse: 54%

Not reported

No or poor crossspecies activity on human and mouse cells, respectively

Tcells, mast cells, macrophages, microglial cells

Suppor:s growth of pluripotent bone marrow cells; growth factor for mast cells; synergistic activity with other hematopoietic growth factors; survival factor for cholinergic neurons

Cohen et al. (1986), Kamegai et al. (1990), Gebicke-Haerter et aL (1994)

IL-4

Mouse: 57-61% Human: 42%

X 16058

No biological activity on mouse and human cells; mouse IL-4 also fails to act on rat cells

Tcells, mast cells, B cells, basophils

Growth factor for activated B and resting T cells; promotes TH2 development; induces MHC class II expression on B cells; promotes IgE production from B cells; upregu ates the expression of CD23

IL-5


X54419

Strong biological activity on mouse cells

T cells (TH2-type), mast cells, eosinophils

Stimul~Ltes growth and differentiation of eosinophils; stimulates B cell differentiation

IL-6


M 26744 and M 26745

Full activityon mouse cells

Tcells, monocytes/ macrophages, fibroblasts, endothelial cells, B cells, synovial cells, keratinocytes, astrocytes

Induces terminal differentiation of activated B cells into Ig-secreting plasma cells; stimulates production of acute phase proteins by hepatocytes; acts as a hybridoma/plasmocytoma growth factor; acts in synergy with IL-3 to support proliferation of cultured mutlipotential hemopoietic progenitor cells

A unique property of the rat IL-6 gene is the presence of two different mRNA species differing by 1.2 Kb in their 3'nontranslated regions

Fey et al. (1989), Northemann et aL (1989), Frorath et al. (1992)

IL-10

Mouse: 83% Human: 75% Rabbit: 71%

X 60675

Active on mouse cells

Tcells, B cells, macrophages

Inhibition of cytokines released by TH1 cells; autocrine inhibition of antigen-presenting functions by monocytes and macrophages

Striking homology with cDNA and protein sequence of BCRF1, a gene encoded by the Epstein-Barr virus genome

Goodman et al. (1992a), Feng et al. (1993)


Acts as a monomer

Leitenberg and Feldbush (1988), Richter et al. (1990), McKnight et al. (1991), McKnight and Classon (1992)

0berla et al. (1991)

(continued)

154


Table V.5.1.

Continued

Amino acid content (mature protein)

Potential glycosylation sites (mature protein)

Molecular mass Cysteine residues (kDa)(mature (mature protein) protein)

Abbreviations

Cytokine

Alternative name

Expression system


IL-13

Interleukin-13

P600 (mouse)

Baculovirus and E. coil

Not reported

111

4

TNF-~

Tumor necrosis factor alpha

Cachectin

CHO

Not reported

156

Not reported

2

17-22

SCF

Stem cell factor

Steelfactor, mast cell growth factor, kit ligand

COS-1 E. coil

At least five introns

164-165

FiveN-linked and numerous O-linked carbohydrate attachment sites

Not reported

18.5 (deglycosylated CSF)

CNTF

Ciliary neurotrophic factor

Not reported

Not applicable

One intron

200

Not reported

Not reported

TGF-/~3

Transforming growth factor beta-3

None

Not applicable

Not reported

410

Not reported

14.

TGF-~

Transforming growth factor alpha

No

Not applicable

Five introns

50

Not reported

5.5 (predicted)

EGF

Epidermal growth factor

No

Not applicable

More than one copy

Not reported

5.8 (predicted)

KGF

Keratinocyte growth factor

Heparin-binding growth factor type 7

Not applicable

Not reported

Not reported

21.3 (predicted)

HB-EGF

Heparinbinding epidermal growth factorlike growth factor

No

Not applicable

Not reported

One O-linked glycosylation site

9.5 (predicted)

194

12.1 a (predicted from cDNA sequence)

45 (predicted)

T-Cell Development

Abbreviations


155






References

T cells (TH2 type), mast cells

Downregulates cytotoxic and inflammatory functions of monocytes and macrophages; induces IL-4independent IgE synthesis, shares many of its biological actions with IL-4 and IL-10

Does not share any significant amino acid homology with rat IL-4

Lakkis and Cruet (1993), F. G. Lakkis, unpublished data

IL-13


Not reported

TNF-=

Mouse: 91% (P. H. van der Meide, unpublished data)

M 98820

Full biological activity on mouse cells

Tcells, monocytes/ macrophages, fibroblasts astrocytes, microglial cells

Inductor acute phase responses; selective cytotoxic activity; various effects on different cell types by modulating gene expression for other cytokines, acute phase proteins, etc.

Contiguous genetic arrangement of TNF-~ and TNF-fl

Chung and Benveniste (1990), Rothe et aL (1992), Appel et al. (1995a), P. H. van der Meide et aL, unpublished data

SCF

Not reported

Not reported

Strong cross-species activity on human and mouse cells

Bone marrow stromal cells, endothelial cells

Augments proliferation of both myeloid, erythroid and lymphoid hematopoietic progenitors in bone marrow cultures. SCF acts in synergy with other factors such as IL-7, GM-CSF, C-CSF, IL-3, IL-6 and erythropoietin; this suggests that SCF stimulate stem cells in combination with a variety of other cytokines

Natural SCF is heavily glycosylated; in addition the molecule is very acidic and acts as a dimer under nondenaturating conditions. SCF is analogous to PDGF and CSF-1

Martin et aL (1990), Zsebo et al. (1990)

CNTF

Not reported

Not reported

Not reported

Schwann cells, subpopulation of type 1 astrocytes

Promotes survival and maturation of cultured oligodendrocytes; induces cholinergic properties in sympathetic neurons; induces acute-phase protein expression in hepatocytes

The expression of CNTF is restricted to the postnatal period

StSckli et al. (1991), Carroll et aL (1993)

TGF-fl3

Mouse: 99%

Not reported

Not reported

Fetal lung fibroblasts

Suppresses both basal and estradiol-induced prolactine release

TGF-=

Human: 92%

M 31076

Not reported

Tumor cells and various transformed cells

Autocrine growth regulator (EGF-related cytokine)

Synthesized as a transmembrane glycoprotein precursor of 159 or 160 amino acids

Blasband et aL (1990)

EGF

Human: 68%

M 63585

Not reported

Kidney, small intestine, mammary gland

EGF stimulates proliferation and differentiation of cells of ectodermal and mesodermal origin and may play a crucial role in early tissue development

Synthesized as a precursor (ppEGF) of 1133 amino acids

Saggi et aL (1992), Abraham et al. (1993)

KGF

Human: 92%

X 56551

Not reported

Candidate for a stromal-derived growth factor that acts in strictly a paracine mode of action

Supports the compensatory growth of epithelial cells in a variety of tissues

Belongs to the heparin-binding (fibroblast) growth factor (HBGF/FGF) family

Yan et al. (1991)

HB-EGF

Mouse: 87% Human:76% Monkey:76%

L 05489

Not reported

Transcript expression in multiple tissues, particularly lung, skeletal muscle, brain and heart

Mitogen for smooth muscle cells, fibroblasts and keratinocytes

Belongs to the EGF protein family. The secreted HB-EGF is derived from a 208residue precursor that includes a 23 amino acid signal peptide, a 86 amino acid mature HB-EGF polypeptide and a transmembrane domain of 24 amino acids

Abraham et al. (1993)

Wang et al. (1995)

(continued)

156


Table V.5.1.

Continued

Amino acid Potential content glycosylafion (mature sites (mature protein) protein)

Cysteine residues (mature protein)

Molecular mass (kDa)(mature protein)

Not reported

4

16 (predicted)

Abbreviations

Cytokine

Alternative name

Expression system


bFGF

Basic fibroblast growth factor

No

Not applicable

One putative intron

145

CINC-1

Cytokineinduced neutrophil chemoattractant-1

Rat GRO Rat KC

E. coil

Single-copy gene, three introns

72

0

4

8

CINC-2~

Cytokineinduced neutrophil chemoattractant-2c~

No

E coil

Single copy gene, three introns

69

0

4

8

ClNC-2fl

Cytokineinduced neutrophil chemoattractant-2/~

No

E coil

Single copy, four introns

68

0

4

8

CINC-3

Cytokineinduced neutrophil chemoattractant-3

Macrophage inflammatory protein-2 (MIP-2)

E. coil

69

0

4

8

IL-12 (p40)

Interleukin-12 p40 chain

No

Not applicable

Probably identical to mouse

Not reported

Not reported

Not reported

Not reported

vgr

Vegetal related cytokine

TGF-fl related cytokine

Not applicable

Not reported

133

Not reported

7

Not reported

IGF-II

Insulin-like growth factor II

Somatomedin

Not applicable

Single copy gene. Transcription is initiated from two alternative promotors, which produce at least four different mRNA species ranging in size from 1 to 4.6 Kb. There are three protein-coding exons

,

Not reported

7.5

T-Cell Development

157

Abbreviations



bFGF

Human: 97%

Not reported

CINC-1





References

Probably high; there are only five conservative amino acid substitutions and one amino acid deletion between rat and human sequences

Brain cortex, hypothalamus

A potent mitogen for various cell types of mesodermal or neuroectodermal origin

bFGF may be stored in a biononavailable form

Kurokawa et al. (1988), Shimasaki et al. (1988)

Human IL-8: 47% M 86536 Human GRO-~: 68% Mouse KC: 92% Mouse MIP-2:71%

Not reported

Macrophages, fibroblasts and probably various other cell types

Not reported Human IL-8: 44% Human GRO-=: 57% Mouse KC: 62% Mouse MIP-2: 78%

Not reported

CINC-2#

Human IL-8: 43% Not reported Human GRO-~: 59% Mouse KC: 65% Mouse MIP-2:81%

Not reported

Member of the proinflammatory 'chemokine' superfamily of chemotactic cytokines; all CINCs are counterparts of human GRO. CINC2~ and CINC-2fl are isoforms; the former is produced as a major chemokine by rat macrophages and in rat inflammation in vivo. CINC-2# differ from CINC-2= in the terminal three amino acids

Watanabe et aL (1989), Huang et al. (1992), Konishi et aL (1993), Zagorski and DeLarco (1993), Nakagawa et al. (1994)

CINC-2=

Plays a decisive role in the activation and the infiltration of neutrophils into inflammatory sites; the neutrophil chemotactic activities of all CINCs in vitro are quite similar

CINC-3

Human IL-8: 49% RNIMIP-2, Human GRO-~: 64% X 65647 Mouse KC: 65% Mouse MIP-2: 90%

Not reported

Macrophages, fibroblasts and probably various other cell types

Plays a decisive role in the activation and infiltration of neutrophils into inflammatory sites

As described for CINC-1, -2~ and -2fl

Nakagawa et aL (1994, 1996b), Shibata et aL (1995)

IL-12 (p40)

94% identity with predicted amino acid sequence of mouse IL-12 p40

M 86771 (IL-12p35: M 86672)

Not known

Monocytes/ macrophages

Functions as a heterodimeric (p35 and p40 chains) cytokine; promotes the development of TH1 -type of immune responses

A partial cDNA clone of the p40 subunit has been analyzed

Mathieson and Gillespie (1996)

vgr

Human: 98% Mouse: 98%

X 58830

High

Constitutively expressed in the CNS

Suggested to have trophic effects on cells of the nervous system and to play a role in inflammatory and degenerative diseases of the CNS

This cytokine belongs to a subfamily of TGF-# related cytokines that are believed to play a regulatory role in embryonic development and organogenesis

Sauermann et al. (1992)

IGF-II

Not reported

J 02637

Not reported

Fetal or neonatal tissues in all of the developmental stages

IGF-II is a mitogenic polypeptide that has structural similarity to proinsulin. It plays an important role in fetal development and in the function of the CNS. Serum levels are increased at birth and decrease upon aging

The chromosomal gene encodes a precursor protein (pre-pro-IGF-II) that comprises 179 amino acids consisting of a signal peptide (23 amino acids), the mature IGF-II (67 amino acids) and a trailer polypeptide of 89 residues. The gene is located on chromosome I and linked to the insulin gene

Frunzio et aL (1986), Soares et al. (1986), Chiariotti et al. (1988)

Nakagawa et aL (1994, 1996a, b), Shibata et aL (1995, 1996)

Nakagawa et aL (1994, 1996b)

Table V.5.2.

Recombinant rat cytokine receptors and binding proteins: cloning, expression and characterization

Amino acid Cytokine Chromosomal content (mature receptor Cytokine receptor gene abbreviation name structure protein)

Potential Molecular glycosylat~on mass (kDa) sites (mature (mature protein) protein)

Amino acid sequence homology with receptors of otherspecies Human: 92%

72 (predicted)

Expression in vivo

Nucleotide sequence data (GenBanWEMBL Accession numbers) Molecular structure

aFGF bFGF

Lung and kidney

M 91599

Human: 92% Mink: 91%

TGF-8

Ovary, lung and kidney

Human: 97%

aFGF KGF

Ligand(s)


References

Two potential immunoglobulin-like domains, 21 hydrophobic amino acids encoding a potential transmembrane domain and a split tyroslne kinase motlf

FGFR4 belongs to the lglike superfamiliesof hormone receptors. The cloned cDNA lacks a slgnal sequence and acidic box and may represent an intracellularform of the FGFR4 receptor

Horlick eta/. (1992)

L 09653

A cystelne-r~chextracellular domain (136 amino acids), a transmembranedomain of 30 amino acids and an ~ntracellularprotein kinase domain of 378 amino aclds

12 cysteine res~duesin mature Drotein

Tsuchida eta/. (1993)

Parathyroidcells

Z 35138 and Z 35139

Two isoforms: a receptor molecule wlth 2 Ig-like domains (a) and one w ~ t h3 Ig-like domains (b). Both isoforms contain a transmembranedomain and two tyrosine kinase domains

lsoform b has three possible glycosam~noglycanattachment sites; there are 19 cysteine residues In the mature isoform b

Takagi et al. (1994)

Various cell

X 69903

The receptor conslsts of an extracellulardoma~nof 207 amlno acids, a transrnembrane region of 24 amino acids and a cytoplasm~cdomain of 544 ammo acids

26 cysteine residues; for signalling, the IL-4R Interact w~ththe y chain inlt~ally identified for the IL-2 receptor

Richter et al. (1995)

FGFR4

Fibroblast growth factor receptor subtype 4

Not reported

650

Not reported

TGF-PIIR

Transforming growth factor-/l type ll receptor

Not reported

544

2

KGFR

Keratinocyte growth factor receptor

Not reported

822 (isoform b)

10 (isoform a and b)

130-150

Interleuk~n-4 receptor

Not reported

775

5

Not reported Mouse: 78% Human: 52%

IL-4

IL-2Rx

Interleukin-2 receptor alpha cha~n

Not reported

267

2

Not reported Human: 60% Mouse: 82% Bovine: 52%

IL-2

Activated T, B and NK cells

M 55049

Extracellulardomain of 214 amino acids, a transmembraneregion of 19 amino acids and a cytoplasm~ctail of 13 amino acids

12 cystelne res~duesout of 14 are conserved between human, mouse, rat and bovine species; redundant in IL-2-medlated signaling

Page and Dallman (1991)

IL-2R/j

Interleukin-2 receptor beta chain

Not reported

51 1

4

: 80

IL-2

Tand NK cells

M 55050

Extracellular domain of 213 amino ac~ds,a transmembraneregion of 28 ammo acids and a cytoplasmic domain of 270 amino acids

Essential for signal transduction; less than 10% of IL-2RB+ cells co-express the IL-2Rz chain; a strong TCR-mediated stlmulus leads to induction of IL-2R/l chain which combines with the: chain to form a functional IL-2R in the absence of IL-2Rx

Page and Dallman (1991), Park eta/ (1996)


types

IL-3RP

Interleuk~n-3 receptor beta chaln (/Jc)

Stngle gene

874

4

Not reported 77.7% (AICPA) and 79.5% (AIC2B) wlth mouse oc (two IL-3R/Jsubunits in the mouse)

The Y-subunlt binds IL-3; association between the Y and [isubunit results in a high-affinity receptor for IL-3; [ic functions as s~gnaltransducer. GM-CSF and IL-5 may also use [Ic as transducer

Rapid induct~on Not reported of /Ic mRNA In mlcrogl~acells located in various rat brain regions after systemtc adm~nistrat~on of LPS

A transmembranereglon of 26 amlno acids

Transduclng subun~tof the IL-3 high-affinity receptor; thls subunit IS most ltkely the rat equivalent of the human IL-3Rp-subunit;the signal peptide of the gene product consists of 22 amino acids; the external domain contains elght conserved cysteine residues; no kinase domain was found In the cytoplasmic region.

Appel eta[ (1995b)

IL-3R mRNA Y-and /Isubun~tsdetected In Isolated microglial cells G proteln coupled receptor related to the human somastatln receptor (SSTR)

No introns

Transforming growth factor type /i mask~ng protein (large subun~t) or Transforming growth factor type [J, binding protein

Not known

IL-1RI

Interleukin-1 receptor type l

Not reported

IL-1RII

Interleukin-1 receptor type ll

IL-1ra

Interleukin-1 receptor antagonist

GPR14

TGF-0-MP.

or TGF-11,-BP

386

841

Not reported

3

Not reported Overall amino Most lhkely a IS pept~dergicligand a c ~ d~dent~ty approximately 27% wlth human SSTR4

Not known

110-120 (Mr)

Shares ldentlty with the somatostatin and opioid

receptors; signaling function for an as yet un~dent~f~ed peptidergic l~gand

TGF-/, and TGF-/I2

Varlous tlssues

M 55431

The large latent TGF-/I, complex (isolated from platelets) IS composed of the TGF-0, molecule noncovalentlyassoc~ated w ~ t ha mask~ngproteln. the mask~ngproteln conslsts of a dlsulf~debonded complex of a dlmer of the N-term~nal propeptlde of the TGF-/I, precursor and a thlrd component denoted TGFP,-BP (~dentlcal to TGF-/JMP,,) TGF-/J,-BP does not b~nd d~rectlyto actlve TGF-

80.5

Hlgh degree of homology with both the human and mouse type I IL-1R

IL-lx,/i

Var~ouscell types. Rarely co-expressed w~thIL-1RII

Not reported

A cytoplasmic domaln of approximately 215 ammo ac~ds

Dissociation constant ( K d ) o f 1 . 2 ~ 1 0' O ~ o n r a t eptthel~alcells. Partial cDNA sequence analysed; high degree of homology with both mouse and human type I IL-1R; >92% with mouse IL-1R and > 82% with human IL-1R

2 68


IL-lz, /J

Varlous cell types Including insullnomacells

222812

An extracellular domain of 342 amino acids, a transmembraneof region of 26 ammo acids and a cytoplasmic tall of 35 amlno acids

Eight conserved cysteine res~dues;an endogenously produced soluble form of IL-1RII may act as a physiological IL-1 antagonist glucocorticoids upregulate IL-1RIIon polymorpho-nuclearcells

16.7 (predicted)

IL-1 receptor

Monocytesf macrophages

Not reported


Blocks the b~ndingof both IL-1%and IL-111to the IL-1 receptor without Inducing a slgnal of its own

/il

Three introns

152

Not reported

One

TSUJIetal. (1990) TGF-/I,-BP may play a role in the activation mechanism of the latent TGF-[I, rather than in masking the activity of TGF-11,; the full-length cDNA encodes a prepro-precursor of 1712 amino aclds, a proprecursor of 1692 amino acids and a mature protein of 841 ammo acids; the mature protein is acidstable, endoglycosydase Hsens~tiveand contains 13 EGF-like domains and two cysteine-rich internal repeats

Human: 90%

91.6 (calculated M,)

Not reported

Marchese et aL (1995)

Hart ef a1 (1993), Sutherland etal. (1994)

Eisenberg etal. (1991)

160

IMMUNOLOGY

.

CORTEX I I i

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

.

OF THE

~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

MEDULLA . .. . . . ..

.......................................................................

Immature cortical thymocyte

I Mature I cortical

C o m m o n cortical thymocyte

Ithymocyte

Immature

I CD2 CD8

I

X44, ~X44 X44 X44 X44 t"!44 H44 H44

.

X44 X44 X44 X44 X44 - I . H44 H44 H44 H44 H44 H44 H44 H44 H44 CD2 CD2 CD2 CD2 CD2 CD2 CD2 CD21CD2 CD8 CD8 CO8 CDS CD8 C D a l C D 8 ER3 ER3 ER3 ER3 ER3 EGBc 1G8 c ITCRc I CD4

I I

H44 CD2 CDII ER3 TCRc CD4 CD5

.

H44 CD2 CD8 ER3 TCRc CD4 CD5

. CD2 CO8 ER3 TCRc CD4 CD5

. CD2 CD8 ER3 TCRc CD4 CD5

CD2 COS ER3 TCRc CD4 CD5

cmlH44

cDzH44 CD2H44 cD2H44 CD8 CD8 CD8 CD8 | ER3 ER3 ER3 ER3 TCRc TCRc TCRb TcRbl CD4 CD4 CD4 CD4 1 COS CD5 CD5 CDS H ~

|1 LI

I .

I 15/16 ! . . . . .

.

.

.

17 . .

.

.

.

.

.

.

.

CD2

CO5 H45

H44 CD2

H44 H44

CD2 CD2 CD8 CD8 ER3 E I ~ TCRb TCR b

.

I medullary I thymocyte

...............,.,.,.,.,,.,.. ,......'r'.".'.

X44 -

I I

X44

.

1 .

.

18 . . .

.

.

.

.

.

19

X44

-

CD2 i CD2 CD2 CD8 CD8 CD8 ER3 I ER3 ER3 TcRb I TCR b I G B c

cos cos C~l H45

,,,,,

Mature

-

cos I I I

c~

1-145 1-145

x44 x44 x44 1 x44 x44 H44 H44 c~ cm c;21 c~ c~ "

~

"

I

~

TCRb TCR b TCR b TCR b TCR b I TCR b I CD4 CO4 CD4 CI)4 CO4 I CD4 CDS CD5 CD5 CD5 CD5 CDS

I

! 14 . . . .

TcRb TcRb ~ I CD5

I

(13

CD2 CD8

I

medullary thymocyte ZL41~ X44

I

RAT

H4s H4S 20

"

CD4 CDS

I H4S H45

I I

.... 21/22

Figure V.6.1 This scheme of thymocyte differentiation in the fetal rat is based on immunohistochemical analysis of frozen sections of rat thymus taken at different stages of gestation. Changes in phenotype between two successive stages are underlined and high expression of a molecule is marked in bold. The antibody against the TCR-~fi detects a determinant expressed first in the cytoplasm (TCRC), then both on the surface and in the cytoplasm (TCR b) and later only on the surface (TCRS). The days of gestation are shown at the bottom of the diagram and an attempt to fit the stages of differentiation into a possible scheme of events in the adult thymus is shown. The terms 'mature' and 'immature' refer to phenotype and not to function. The different compartments are not to scale: in the adult thymus ~ 80% of thymocytes is found in the population of 'common' cortical thymocytes, with the immature and mature populations of cortical thymocytes each containing < 5% of the cortical population. The mature and immature medullary thymocyte populations contain ~ 5% and ~ 8%, respectively, of the total number of thymocytes (Groen et aL, 1996a). H and X represent the antibody nomenclature prefixes HIS and MRC-OX respectively. This figure was reproduced with permission of Kampinga and Aspinall (1990a).

Thy-1-/RT6-/CD45RCsubset was substantially increased in an antigen-rich environment, such as Peyer's patches, it was suggested that activation renders T cells negative for both RT6 and CD45RC. Recent experiments, however, show that loss of RT6 and CD45RC does not occur within 48 h after in vitro mitogenic stimulation for a majority of T cells, which is when all T cells in culture have upregulated CD25 expression and most have downregulated quiescent cell antigen-1 (QCA-1, see below) expression (H. Groen, unpublished data). The remaining T h y - 1 - / R T 6 - / C D 4 5 R C + and T h y - 1 - / RT6+/CD45RC - T-cell subsets were, based on their relative increase after adult thymectomy, marked as postCPT stages of development, and are likely to be resting memory T cells. Based on the properties and cytokine profiles of these two subsets (Fowell et al., 1991; Fowell and Mason, 1993; Beijleveld et al., 1996), and the association between inducibility of cellular versus humoral autoimmune diseases on one side, and balances between the two subsets mentioned on the other (Groen et al., 1993), T h y - 1 - / R T 6 - / C D 4 5 R C + and T h y - 1 - / R T 6 + / CD45RC- CD4 + T cells were suggested to be TH1 and TH2 resting memory subsets. This suggestion was supported by the fact that cellular autoimmunity is associated with CD4 + / T h y - 1 - / R T 6 - / C D 4 5 R C + T cells (Beijleveld

et al., 1996) and can be prevented with CD4 + / T h y - 1 - /

RT6+/CD45RC - T cells (Fowell and Mason, 1993). Conversely, the BN rat, having high basic levels of IgE and a high percentage of IL-4-producing T cells, and being susceptible to autoantibody-mediated mercury-chlorideinduced glomerulonephritis (Aten et al., 1991; van der Meide et al., 1995), has high percentages of CD4 +/Thy1-/RT6+/CD45RC - T cells (Groen et al., 1993). Mercury-induced autoimmunity was found to be suppressed by CD4 +/CD45RC + T lymphocytes (Mathieson et al., 1993). The phenotypic changes mentioned above are depicted in Figure V.6.2 for both CD4 + and CD8 + T cells. It can be seen in the figure that the proposed routes for phenotypic development of CD4 + and CD8 + T cells are virtually identical. Percentages of peripheral blood T cells expressing Thy-1, RT6 or CD45RC of a number of rat strains are listed in Table V.6.1. Percentages of CD4 + and CD8 + T cells and the balances between the proposed TH1 and TH2 resting memory subsets are listed in Section 2. Other markers of interest for T cell developmental and functional studies in the rat are the ones recognized by the MRC OX-39, OX-40 and HIS45 monoclonal antibodies. MRC OX-39 recognizes CD25, the IL-2-receptor (Paterson et al., 1987b). The OX-40 marker (CD134) is expressed only by CD4 + T blasts (Paterson et al.,

T-Cell Development Table V.6.1

161

Percentages of Thy-l§

RT6 § and CD45RC § T cells in blood of 20-week-old rats of different strains

Strain

MHC

Thy- 1

RT6.1

RT6.2

CD45RC

AO AOlp DPBB BN BUF DZB LEW LOU MAXX PVG WF

u ullu u n b u I u n c u

14.7 21.2 38.3 14.4 12.7 16.3 13.1 14.4 14.3 6.0 14.8

--9.6 + 0.3 -76.1 + 1.2 -71.9 + 0.8 --75.8 + 1.5 -

79.3 78.3 -83.2 -85.9 -79.3 86.8 75.7

67.4 68.2 16.0 41.0 67.9 75.6 70.6 67.4 68.5 65.4 64.0

+ 0.5 +_ 1.3 + 1.8 + 0.7 + 1.6 + 0.9 + 1.0 + 1.9 + 1.4 + 0.3 + 2.1 -

-

1987b), whereas the HIS45 mAb (where T cells are concerned) recognizes a 43-47 kDa protein expressed by resting T cells only (Kampinga et al., 1990). Mitogenic stimulation of T cells causes the loss of the HIS45 epitope, which is why it was called quiescent cell antigen-1 (QCA-

+ 1.7 _+ 0.6 + 3.3 + 1.5 + 1.7 + 1.9

_

+ 1.5

+ 1.3 _+ 3.0 + 4.7 + 2.1 + 0.3 + 0.7 + 2.6 + 1.3 + 2.8 + 1.1 + 1.5

m

1). QCA-1 is expressed by medullary thymocytes and also by the vast majority (> 95%) of Thy-1 § RTMs. Peripheral T cells not expressing QCA-1 are mostly found among the mature Thy-1- phenotype (H. Groen, unpublished data).

Per iphery

Thymus

Intermediate staqe

Early stage Immature T cells

Mature T cells

Naive T cells Thymic Migrants Recent

Late

Late stage

Antigen-experienced T cells C o m m o n peripheral T cells and

Post-thymic Precursors

Antigen activated T cells

I Reactivated and I

I

chronically

I

I I

activated T cells

I I

I

Th0-1ike ~ ~

f

I

I

I

,4..c "/ i

I

!

,

Thy-1

i .'"I

Resting

memory T cells

-

im

~/

I

4g

Th2-1ike

I

__~

1

I I I I

I I

I

I

Figure V.6.2 A concept of development of peripheral CD4 + and CD8 + Tcells in the rat. The sequence of events depicted in the diagram was deduced from the vascular thymus transplantation studies described by Kampinga et aL (1996).

162

7.


The T-cell Receptor

T-cell r e c e p t o r s e q u e n c e s

Available rat TCR sequences reveal a high degree of similarity to the homologous mouse gene segments. In Tables V.7.1 and V.7.2, V, (D) and J sequences of the Tcra and Tcrb loci are compiled and ordered according to their similarity to mouse sequences. With the exception of the few genomic sequences available (see table footnotes), cDNA sequences are given. Note that the homologous mouse sequences are given in the new official T C R V nomenclature (Arden et al., 1995). JA and JB nomenclatures follow those developed by Koop et al. (1994) and by Gascoigne (1995), repectively.

Table V.7.1

Most homologous mouse segment b AC c A VIS2 A VIS3

A VIS5 AVIS8

A V2S1 A V2S3 A V3S2 AV3S5 A V3? AV4S1

A V4S2

A V4S3 or A V4SIO

To date, a total of 63 VA, 46 JA, 25 VB and 12 JB functional rat TCR segments have been identified, suggesting a degree of complexity similar to that in mice. As in that species, there is one T C R A C and two TCRBC loci. Genomic deletions of TCR segments, as observed in some mouse strains, have not been described in the rat. With few exceptions, all known T C R A sequences were derived from the LEW strain (Table V.7.1). Although not yet shown by sequence, the rat Tcra locus is at least dimorphic, as indicated by the lack of reactivity of certain TCRV~-specific monoclonal antibodies (mAbs) with Tcells and thymocytes of the LEW but not of the DA background (N. Torres-Nagel et al., unpublished data). There are two major Tcrb haplotypes. Table V.7.2 lists all currently available sequences, including different

Sequences of LEW a T-cell receptor ~ (Tcra) segments

Rat clone name or designation

Accession No. (EMBL/GenBank)

TRA29 a TRA29 a T48a2 rVA 14 rVA48 rVA32 rVA16 rVA46 rVA23 rVA33 rVA56 rVA83 510 rVA37 rVA41 rVA68 rVA04 rVA22 rVA27 4.12 d 4.13 d 4.14 d rVA52 4.22 d 4.23 d 4.25 d 4.26 d 4.27 d P2.3

M18853 M 18853 X62325 L37959 L11034 L11029 L37961

4.32 d 4.33 d 4.34 d 4.35 d 4.36 d

X81311 X81312 X81313 X81314 X81315

L11025 L37963 L37966 L37973 X14318 L11030 L11033 L37970 L37957 L11024 L11021 X81302 X81303 X81304 L11036 X81305 X81306 X81308 X81309 X81310 X75647

Homology with mouse at nucleotide (amino acid) level 84 ND 82 86.6 86.1 88.6 88.6 85.2 87.7 87.0 90.9 84 (77) 88.9 90.8 88.8 82.9 88.7 86.2 ND ND ND 89.8 ND ND ND ND ND 90.1 90.1 ND ND ND ND ND

Source

Current numbering (family.member) n

1 1 1 1 1 1 1 1 1 1 1 2 2 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 (continued)

The T-cell Receptor

Table V.7.1

Most homologous mouse segment b AV4S11 A V5S1 A V6S1 ADV7S1 A V8S2 A V8S4 A vasIo

Avas11

AVIOS1

A V 10S2 AV11S2 AV11S3 AV12S1 AV15S1 AV17S1

AV? A V20S 1

A V21 AJ2 A J4 A J5 A J6 A J7 A J9 A J11 AJ12 A J13 A J15 AJ16 A J17 A J18 A J21 A J22 AJ23 A J24 A J26 A J27 A J28 A J30 A J31

163

Continued



4.41 d rVA24 rVA30 Q4a12 rVA03 8.4 d 8.2 d DP15

X81316 L11026 Ll1027 X62324 L37956 X80511 X80509 Y09187 X80512 X80513 X80514 Y09185 Y09186 X80510 L37960 X62328 X62330 L37968 X62329 L37971 L37962 Ll1031

8.5 d

8.6 d 8.7 d DP10 DP118 8.3 d rVA15 T48a3 T48a5 rVA60 Q4a13 rVA69 rVA26 rVA38 rVA 12 rVA10 rVA31 rVA66 rVA47 rVA39 rVA51 Q4a23 rVA59 VA8s2F10 rVA27 rVA68 VA8s2 F 15 VA8S2F23 rVA59 rVA48 VA8s2A2 rVA83 rVA12 rVA47 rVA44 rVA64 rVA37 T48a5 rVA04 VA8s2F39 rVA25 TRA29 a rVA60 VA8s2A16 rVA33

Ll1019 L11028 L37969 L37965 L11032 L11035 X62327 L37967 Y09175 Ll1021 L37970 Y09176 Y09177 L37967 L11034 Y09174 L37973 L37965 L37964 L11030 X62330 L37957 Y09178 L11020 M 18853 L37968 Y09170 L37963

Homology with mouse at nucleotide

(amino acid)

level

89.2 82.5 86.0 92 82.1 (88.6) (92.0) (90.9)

(86.0)

(87.2)

(82.5) (88.6)

(89.8) (88.6) 88.6 90.5 87.1 87.1 92 85.1 90.0 84.5 89.8 91.9 91.0 90.3 88.3 85.9 84.7

Source

Current numbering (family.member) 4 5 5 6 7 8.4 8.2 8.5 8.6 8.7

8.3 10 10.1 10.2 10 11 12 12 13 16 16 16 15 23 23

m

59 92.4 93.2 87.1 84.9 78.3 82.1 93.1 86.8 85.7 78.3 87.7 79.0 90.6 85.7 ND 96.5 90.6 87.9 ND 87.9 84.0 83.9

24 4 5

8 9 11 12 13 14 15 16 18 20 22 24 (continued)

164 Table V.7.1

IMMUNOLOGY OF THE RAT Continued

Most homologous mouse segment b A J32 A J33 AJ34 AJ37 AJ38 AJ39 A J40 AJ42 AJ43 AJ44 A J45 A J47 AJ48 AJ49 AJ50 AJ52 A J53 AJ56 AJ57 AJ58 A J62 A J63



Homology with mouse at nucleotide (amino acid) level

VA8s2F5 rVA14 VA8s2A41 VA8s2F22 rVA30

Y09179 L37959 Y09171 Y09181 L11027

89.6 100 74.5 89.6 95.1

7 4 7 7 4

-26 --31

T48a2 rVA74 Q4a21 VA8s2F57 510 VA8s2 L73 VA8s2 F13 rVA51 rVA16 rVA19 rVA03 VA8s2L90 VA8s2DP47 VA8s2F32 rVA52 rVA39 rVA66 VA8s2F6 VA8s2 L15

-L37972 Y09182 X14318 Y09168 Y09183 L11035 L37961 L11022 L37956 Y09169 Y09172 Y09184 L11036 L11032 L37969 Y09180 Y09173

ND 93.3 ND 86.8 ND 81.1 87.7 94.5 88.9 90.4 87.9 86.8 80.2 86.8 83.9 89.2 89.1

3 4 3 7 2 7 7 4 4 4 4 7 7 7 7 4 4 7 7

-33 -----37 39 40 41 ---47 48 49 ---

Source

Current numbering (family.member)

Sources: 1, Morris et aL (1988); 2, Burns et aL (1989); 3, Hinkkanen et aL (1993); 4, Shirwan et aL (1995); 5, Stangel et aL (1994); 6, Giegerich et aL (1995); 7, N. Torres-Nagel et aL, unpublished data. a A l l but the three sequences labelled are derived from LEW. a labelled sequences are from AO strain. BWHO-IUIS nomenclature (Arden et aL, 1995). cAC LEW sequence has been published by Burns et aL (1989). dGenomic sequences.

alleles, together with the strains of origin. Very little sequence information is available about Tcrg and Tcrd loci. Table V.7.3 lists the four cDNA sequences currently available, along with the gene segments from which they are presumed to be derived (mouse nomenclature according to Garman et al. (1986)).

TCR associated proteins and accessory molecules involved in TCR signalling

mAbs to rat TCR

Ontogeny of the rat TCR repertoire

mAbs identifying rat TCR are listed in Table V.7.4. They cover about 30% of the V/3 repertoire but only about 5% of that of the V~. One subset (Vv?) specific mAb to 78 TCR as well as mAbs to constant determinants of the ~/3- and 78TCR are available.

In fetal life, 7/STCR § cells are first detected in the thymus at day 16 of gestation (K~ihnlein et al., 1995), followed by the appearance of ~//3TCR l~ cells around day 20 and of 0~//3TCRhigh cells at birth (about day 23 of gestation, with strain variations) (Lawetzky et at., 1991). The early

Available evidence indicates that the components of the TCR signal transduction complex, which has been studied in greater detail in mice and humans (see the corresponding chapters) are also present in the rat. Table V.7.5 lists only those components and their interactions that have been identified in the rat.

The T-cell Receptor

Table V.7.2

Sequences of T-cell receptor/%chain (Tcrb) segments. Genomic location: chromosome 4 (Dissen et aL, 1993)

Most homologous mouse segment a

Rat clone name or designation/rat strain

BC 1

(C/~1) b/LEW

BC2 BVISA 1 BV2S1 BV3SIA 1 BV4S1 BV5S1 BV5S2A 1 BV6S1 BV7S1 BV8S1

BV8S2A 1

BVSS3

BV9S1 BVIOS1 BV11S1 BV12S1 BV13S1 BV14S1

BV15S1 BV16S1 BV17SIA 1

165

(C/~l)b/DAC (C/~I)/LER c TRB4/AO (CI~2)b/DA c V/~I/LEW V#2/LEW V/~3.1/LEW V/~4/LEW TRB70/AO V/~5.1/LEW V/~5.2/LEW V/,~6/LEW TRB4/A0 V/37/LEW V/~8.1/LEW V/~8.6/LOU/M V~8.2/LEW Tcrb-V8.2a/DA c V/~8.2/LER c Tcrb-V8.41/LEW (pseudogen) Tcrb-V8.2F344/ F344/DA c (functional) V/~8.4/LER c 510E/LEW (variant of Tcrb-V8.41 ?) 510C (Pseudogen) V138.3/LEW 510D/LEW V/~8.5(LOU/M) V/~8.5/DA c V/~8.3/LER c V/~9/LEW CTRB39/DA V/~10/LEW TRB12/AO V/~I 1/LEW V/~12/LEW TRB100/AO V/~I 3/LEW V/~14/LEW CTRB188/DA TRB15/AO V/,~I 5/LEW CTRB29/DA c V/~16/LEW (allele in BN) V/~I 7/LEW CTRB3/DA

Accession No. (EMBL/GenBank) X 14319 M65136 M63793


Source

-M18843 --X80525 M18845 --M58628 X14973 X98251 X97672

-(89.6) (87.4) -92 (88) -86 (78) 94 (92) 91 (84) 88 (85) 88 (85) 88 (85) 92 (91) 90 (84) 90 (84) 88 (84) 88 (80.6) 90 (84) 87.2 (80.6) --89 (83)

6 6 7 8 9 10 9

X77995

89 (83)

11

U06104

--

10 12

U06102 M58627 U06103 ----M23887 -M18839 -X80522 M18841

86 -87 87 --88 88 91 91 91 92 92 87 86 86 86 88 -88 -88 88

M18854 M63794 ---

--

X80523 M23889 M18842 -M23885 ---M23882

(88) (85) (85)

(78) (78) (84) (84) (88) (87) (87) (72) (81) (81) (81) (79) (87) (77) (77)

1 2 2 3 4 5 6 6 6 6 4 6 6 4, 6, 18

13 6 13 14 15 10 6 16 6 4 6 6, 18 6 6, 18 16 4 6 16 6 17 6 16

Current numbering (family. member)

1 2 3.1 4 5.1 5.2 6 7 8.1 (8.6) 8.2

8.4

--

-8.3 (8.5)

9 10 11 12 13 14

15 16 17 (continued)

166

Table V.7.2


Continued

Most homologous mouse segment a

Rat clone name or designation~rat strain

BV18S1 BV19S1

-M23883 --X80524 X14973 M63793 M 18846 -M63793 -M63793 M18848 -M63793 X80525 M63793 M18847 -M63793 M74472 M63794 M18849 X97672 M63794 M18850 M74473 M63794 -M63974 X80523 M63974

BD1

V/~l 8/LEW V~I 9/LEW CTRB4/DA c V,820/LEW CTRB9/DA c V~3.3/LEW J/~1.1/LEW J,81.1 b/DAC TR64/A0 c J,81.2/LEW J/~1.2C/DA J,81.3/LEW J,~1.3b/DA TRB91/AO J/~1.4/LEW J~1.4b/DA c J~1.5/LEW J~1.5b/DA c TRB77/AO J/~1.6/LEW J/~1.6b/DA c J~2.1/LEW J/~2.1 b/DA TRB67/AO c J~2.2/LEW J/~2.2b/DA TRB89 J/~2.3/LEW J~2.3b/DA J~2.4/LEW J#2.4/DA b J/~2.5/LEW J/32.5b/DA c (Pseudogene) TRB 100/AO J~2.6/LEW J~2.6b/DA TRB9 (J~2.7)/AO D/~I b/DA

BD2

D/~2b/DA

M63794

BV20S1 BV22P BJIS1

BJIS2 BJIS3

BJlS4 BJIS5

BJIS6 BJ2S1

BJ2S2

BJ2S3 BJ2S4 BJ2S5

BJ2S6

Accession No. (EMBL/Gen Bank)

M 18841 X80522 M63974 M 18851 M63793


92 88 -88 -91 93 --93 -88 --90 -78 --98 -92 92 -98 98 98 85 85 92 92 92 --

(89) (79) (92) (75) (100)

(87) (88)

(94) (73)

(100) (88) (88) (100) (100) (100) (69) (69) (94) (94) (94)

92 (94) 92 (94) 92 (94) 92 (94) 100 (100) 1 bp shorter 100 (100) 1 bp longer

Source

6 6 16 6 16 6, 18 6, 8 16 3 6 5 5 4 3 6 5 6, 18 5 4 6 5 6, 7 5 4 6, 9 5 4 6, 7 5 6 5 6, 18 5 4 6, 7 5 4 5

Current numbering (family.member)

18 19 20 3.3 1.1

1.2 1.3

1.4 1.5

1.6 2.1

2.2

2.3 2.4 2.5

2.6(2.7)

5

Sources: 1, Burns et aL (1989); 2, Blankenhorn et al. (1992); 3, Blankenhorn et al. (1991); 4, Morris et aL (1988); 5, Williams et aL (1991); 6, Smith et aL (1991); 7, Offner et aL (1991); 8, Chluba et al. (1989); 9, AsmuB et aL (1996); 10, Blankenhorn et aL (1995); 11, Herrmann et al. (1994); 12, Zhang et aL (1994); 13, Zhang and Heber-Katz (1992); 14, Hashim et aL (1991); 15, Gold et al. (1994); 16, Williams and Gutman (1989); 17, Smith et aL (1992); 18, Gold et aL (1995). aWHO-IUIS nomenclature for BV segments (Arden et aL, 1995), nomenclature for BJ segments according to Gascoigne (1995). b Genomic sequence. c Protein difference from LEW sequence.

The T-cell Receptor

167

Table V.7.3 Sequences of cDNA clones encoding 7 and 8 chains. Putative genomic location of Tcrg on chromosome 17 (Yasue et aL, 1992)

Rat clone name

Rat clone name (designation)a/ rat strain


Homology to mouse at nucleotide (amino acid) level

RG4 RG7 DETC~, DETCa

Vr2/J.~1/Cr1/F344 V.~1.1/JJCr4/F344 V73/J~,1/LEW Va1/J a2/Da2/LEW

$75435 $75437 ---

(87)/(79)/(91) (78)/(84)/(76) 88 (95) 88 (92)

Reference

Kinebuchi et aL (1994) Kinebuchi et aL (1994) K0hnlein et al. (1996) K0hnlein et al. (1996)

aNomenclature according to Garman et aL (1986).

Table V.7.4

Monoclonal antibodies to rat T-cell receptors

mAb

Specificity a

References

G99 G 177 R73 R78

At least two V=4 family members (clones P2.3 and 4.36) V=8.2 C# V/~8.2lb and V/~8.4ab

B73 G101 HIS42 V65 V45

V#8.3 (V#8.5) V#10 V#16 Pan 75 TCR Subset of 7/5 TCR

Stangel et al. (1994), Torres-Nagel et al. (1994a) Torres-Nagel et aL (1994a) H0nig et al. (1989) Torres-Nagel et al. (1993), Herrmann et al. (1994), AsmuB et al. (1996) Torres-Nagel et al. (1993) Torres-Nagel et aL (1993) Kampinga et al. (1989), Torres-Nagel et al. (1993) K0hnlein et aL (1994) K0hnlein et al. (1996)

aAccording to current numbering (see Tables V.7.1 and V.7.2).

bDetects the V/~8.2allele of LEW but not of DA and the V#8.4 allele of DA. Vf~8.4LEW is a pseudogene.

Table V.7.5

Molecular interactions identified in the rat TCR complex

Molecule

Associations/comments

Reference

CD2

Coprecipitated in mild detergents, mechanism of association unknown and ~ components identified. Non-covalently associated with TCR Via associated p56 ~ck Via associated p56 ~ck Coprecipitated in mild detergents, mechanism of association unknown Interaction with CD4, CD8 and TCR/CD3 complex shown. Coprecipitated in mild detergents.

Beyers et aL (1992)

CD3 CD4 CD8 CD5 p56 Ick p59fYn

'waves' of 7/8TCR with restricted diversity have not yet been identified in rats, but the presence of thymus-dependent dendritic epidermal T cells with a canonical 7/(5 TCR highly homologous to that of mice suggests similarities in 7/(5 T-cell development (K~ihnlein et al., 1996). Both in ontogeny and during adult T-cell development, C D 3 - 4 - 8 - thymocytes progress through an immature C D 4 - 8 + stage which contains the direct precursors of

Tanaka et aL (1989), Lawetzky et aL (1990), Beyers et al. (1992) Beyers et al. (1992) Beyers et aL (1992) Beyers et aL (1992) Beyers et al. (1992) Beyers et al. (1992)

CD4+8 + thymocytes (Paterson and Williams, 1987; Lawetzky et al., 1991) from which the mature CD4 + 8 - and C D 4 - 8 + ~/fl T-cell subsets are selected. The branchpoint for the ~/fi versus 7/(5 lineage decision has not been exactly defined, but the absence of TCRGC mRNA from CD4+8 + thymocytes and its presence in their direct precursors, the immature C D 4 - 8 + thymocytes suggests that it can occur up to that stage (H. J. Park and T. Htinig,


168

unpublished data). Immature C D 4 - 8 + thymocytes also contain T C R B C but not T C R A C mRNA (H. J. Park and T. Htinig, unpublished data), and exhibit weak cell surface reactivity with the TCRfl-specific mAbs R73 (H~inig, 1988). Presumably, the TCR detected on these cells is the pre-TCR consisting of a mature fi and a pre-T~ chain(s). When C D 4 - 8 + immature thymocytes progress to the CD4 +8 + stage in vitro, RAG-1 expression is reinitiated and T C R A C mRNA appears (H. J. Park and T. Hfinig, unpublished data). CD4+8 + cells express ~flTCR at their surface at approximately 1/5 of the density of mature T cells (Htinig et al., 1989). Thymic selection of the TCR repertoire has been shown in terms of both MHC classspecific and allele-specific 'overselection' of V/~ and V~ segments (Torres-Nagel et al., 1994b). No evidence for thymic negative selection by endogenous superantigens has been obtained, although the specificity of rat V/~ segments for mouse m t v - e n c o d e d and bacterial superantigens has been defined (Herrmann et al., 1994; Surh et al., 1994). Athymic rats contain reduced numbers of ~fl T-cells which increase with age. Similar, to the situation in mice, the interindividual variation of V-gene usage indicates that the extrathymic TCR repertoire is oligoclonal. This also holds true for 0~flTCR + intestinal intraepithelial lymphocytes (ilEL), although the extrathymic origin of these cells has not been formally proven (N. Torres-Nagel et al., unpublished data).

Distribution and phenotype of ~/~ and 7~ T-cell populations ~fl T cells 0~fl T cells are present in peripheral lymphoid organs and blood in frequencies and CD4/8 ratios comparable to those found in mice and humans (Htinig et al., 1989). In contrast to mice but as in humans, activated CD4 T-cells can express CD80~0~ (Torres-Nagel et al., 1992) and MHC II (Broeren et al., 1995; Seddon and Mason, 1996). A small subset coexpresses the NK cell activation receptor NKRPl (Brisette-Storkus et al., 1994). ~fi T cells predominate among ilEL where most of them lack CD2 (Fangman et al., 1991) and CD8fi (Torres-Nagel et al., 1992), and CD4 + C D 8 ~ cells are a major subset (Torres-Nagel et al., 1992). 2& T cells 7& T cells are a small minority in thymus, peripheral lymphoid organs, blood and (in contrast to mice, where they are much more frequent) also among ilEL (Lawetzky et al., 1990; Ktihnlein et al., 1994, 1995). Whereas in lymph nodes and spleen, 90% are CD2 + CD4-CD8~fi + CD5 +, those of the gut epithelium are C D 2 - C D 4 - C D 8 ~ + f i C D 5 - (Ktihnlein et al., 1994). In the skin, thymus-

dependent dendritic epidermal T cells (DETC) express a canonical receptor highly homologous to that of mice (Ktihnlein et al., 1996). This cell type is not found in humans (Elbe et al., 1996).

8.

B-Cell Development

B-cell generation in adult bone marrow As in other mammalian species, most if not all generation of new, virgin (or naive) B cells in the rat takes place in the bone marrow (BM). At this location surface IgM + cells are formed in extremely large numbers from pluripotent hemopoietic stem cells, through a series of steps that include proliferation and differentiation of precursor cells. During these steps immunoglobulin heavy and light chain genes are rearranged and expressed followed by selection of functional B cells. Rat pluripotent hemopoietic stem cells express high levels of Thy-1 antigen (CD90) and CD43 (leukosialin, sialophorin) only weakly; they lack the leukocyte common antigen (L-CA)/CD45R molecules detected by mAbs OX-22 and HIS24 (Goldschneider et al., 1978; Hunt, 1979; McCarthy et al., 1987). Various stages of B-cell development can be distinguished phenotypically in rat BM (Hunt et al., 1977; Opstelten et al., 1986; Kroese et al., 1990, 1995; McKenna and Goldschneider, 1993; McKenna et al., 1994; Hermans et al., 1997). A model of virgin B-cell development is shown in Figure V.8.1. All B-lymphoid precursor cells express CD45R/ HIS24 and Thy-1. The heat-stable antigen (HSA)/CD24, recognized by mAb HIS50 (Hermans et al., 1997) is expressed on all B-lineage cells in the BM, except for the earliest B-cell precursors, the pre-pro-B cells. Pre-pro-B cells thus are Thy-1 + CD45R+HSA- cells and represent less than 2% of total nucleated BM cells. These cells are thought to give rise to Thy-1 + CD45R + HSA + cells (pro-B cells; 5% of all nucleated BM cells) which still have no detectable levels of cytoplasmic or surface Ig # chains. Approximately half of the Thy-1 + CD45R + HSA + (but #chain-) cells in the BM expresses detectable levels of the nuclear enzyme terminal deoxynucleotidyl transferase (TdT) which plays a role during immunoglobulin gene rearrangements and contributes to the diversity of Ig V regions. Conversely, more than 95% of the TdTexpressing cells have this phenotype (Thy1 + CD45R + HSA + # - ) . The next stage of B lymphopoiesis is represented by the pre-B cells (20% of all nucleated BM cells). These cells are also Thy-1 + CD45R + HSA + but are characterized by the presence of free #-chains in their cytoplasm only. Finally (small) pre-B cells differentiate to newly formed (immature) B cells (NF-B cells), which express high levels of surface IgM, but little or no surface IgD (slgD) (and still are Thy-1 + CD45R + HSA +) (Crawford and Goldschneider, 1980; Kroese et al., 1990, 1995; Deenen and Kroese, 1993; Soares et al., 1996; Hermans et

B-Cell Development

169

Bone marrow

Blood

Spleen

I

recirculating cells

I

i

2%

4%

20%

3%

I

I

3%

3%

5%

22%

9%

CD45R/HIS24 HSAJHIS50

Thy-1

slgM slgD

~~

high expression levels low expression levels

Figure V.8.1 A model of virgin B-cell development in the rat. For explanation see text. Numbers represent proportion of cells relative to total nucleated cells (bone marrow) or lymphoid cells (blood, spleen) in PVG rats.

al., 1997). These cells leave the BM and enter the blood circulation. The total number of cells produced by the precursor B cell compartment (CD45R+slgM-) is approximately 650 million cells per day (Deenen et al., 1987, 1990). Most cells are produced in the compartment of (large) pre-B cells (approximately 320 million cells per day). The sum of all peripheral B cells per rat is in the order of 10 9 cells (Gray, 1988). Together with the notion that mature B cells turn over slowly (1-2% per day) (Gray, 1988; Chan and MacLennan, 1993; Deenen and Kroese, 1993; Kroese et al., 1995), the observed production rate of B cells in the BM is far beyond the need to supply the animal with new mature cells. Indeed, the entire peripheral B-cell pool is reconstituted in a few days in B-cell depleted (anti-IgM treated) rats (Bazin et al., 1985). In physiological situations most B cells produced in the BM never reach their final stage and die owing to nonproductive rearrangements or selection mechanisms leading to apoptosis. Information about the molecular events that take place during B-cell generation in rat BM is extremely limited. Some evidence suggests that rat pre-B cells (and part of the TdT + cells) may have already rearranged both their heavy chains and ~c light chains, albeit that ~c chains are not yet expressed as proteins (Opstelten et al., 1985; Hunt et al., 1988). Recent studies have shown that the homolog of the murine 25 gene also exists in the rat (Dammers et al., unpublished data). This gene encodes for part of the surrogate light chain and plays a decisive role in B cell development (Melchers et aI., 1993). Similar to mice, the rat 25 equivalent is expressed (mRNA) in pre- and pro-B cells but not in mature B cells. B-cell genesis takes place within the meshes of the threedimensional network of stromal elements of the BM. Immunohistological analysis of rat BM reveals that the

subendosteal area is enriched in Thy-1 + cells, pre-B cells and TdT + cells (Hermans et al., 1989; Hermans and Opstelten, 1991), suggesting that most B-cell genesis occurs in the peripheral parts of the BM, giving rise to a progeny that differentiates and migrates to more centrally located areas of the BM to exit via the endothelium of the sinus walls. Studies in chimeric rats have shown that once formed, B cells rapidly disperse through the BM (Hermans et al., 1992).

B-cell generation in fetal liver During fetal and neonatal life B cells are also generated in the liver (Veldhuis and Opstelten, 1988). Pre-B cells appear by day 17 of gestation followed by IgM § B cells which are first detected 2 days later. B-cell genesis in fetal and neonatal rat liver proceeds, similar to mice, without expression of TdT. Fetal liver B-cell lymphopoiesis may represent a developmental pathway, distinct from adult Bcell development in the BM (Lain and Stall, 1994).

Peripheral virgin B-cell differentiation The majority of mature, resting B cells are recirculating follicular B cells (RF-B) which express high levels sIgD and low levels slgM, recirculate through the body and are located in follicles of lymphoid organs (Bazin et al., 1982; Gray et al., 1982; MacLennan et al., 1982; Kroese et aI., 1990). In ral;s, mature B cells lack Thy-I/CD90 expression, which distinguishes them from their Thy-1 § immature predecessors (Crawford and Goldschneider, 1980; Deenen and Kroese, 1993; Soares et al., 1996). Two subsets of immature, Thy-1 § B cells can be distinguished in the

170

IMMUNOLOGY

periphery on the basis of relative levels of slgM and slgD: newly formed B cells (NF-B cells) (Thy-l+IgM brightIgD dull) and early recirculating B cells (ERF-B cells) (Thy-l+IgMd"l]IgDbright). These subsets probably represent two sequential stages of B-cell differentiation towards mature (Thy-1-) B cells (Kroese et al., 1995) (see Figure V.8.1). NF-B cells are probably not yet fully immunocompetent (Whalen and Goldschneider, 1993) and have only a limited capability to recirculate, as illustrated by their absence from thoracic duct lymph and lymph nodes. Recent BM emigrants have restricted capacity to enter follicles of secondary lymphoid organs (Lortan et al., 1987). Most likely, NF-B cells differentiate subsequently to a second immature Thy-1 § B-cell subset (ERF-B cells), which start to recirculate (as witnessed by their presence in all lymphoid organs, blood and thoracic duct lymph) and become IgMd"llIgDbright, similar to mature, RF-B cells, giving them their name. Finally, ERF-B cells are thought to mature further, downregulate Thy-1 expression, and become mature RF-B cells (Thy-l-IgM'tUl]IgDbright). Differentiation from pre-B cells to mature RF-B cells proceeds without cell divisions (Kroese et al., 1995). In terms of absolute numbers of cells significant cell loss is observed at the transition of the NF-B cell stage in the BM and those in the periphery, probably reflecting antibody repertoire selection mechanisms (see Figure V.8.2). At later stages of their differentiation towards mature RF-B cells relatively few cells die. At the level of VH gene usage there is no evidence for extensive selection between ERF-B cells and RF-B cells (Vermeer, 1995). Once cells reach the RF-B cell stage they become relatively long-lived with a lifespan in the order of months and a turnover rate of only 1-2% per day (Chan and MacLennan, 1993; Deenen and Kroese, 1993; Kroese et al., 1995).

Marginal

zone B cells

In addition to follicles, a significant proportion of splenic B cells is located in 'marginal zones' (MZs), which surround lymphoid follicles and T-cell areas in spleen. MZs are absent in peripheral lymph nodes and Peyer's patches. In rats in particular, MZ can be distinguished easily and are

330 milllon/day .................

I

i

I__. . . . . . . .

t

320 million/day

. . . . . . . . . . . .

?

1

OF T H E RAT

prominently present in their spleens (MacLennan et al., 1982). Rat MZ-B cells are slightly larger cells, are IgMbrightlgD d"l] and Thy-1- and characteristically express low levels of the CD45R determinant recognized by monoclonal antibody HIS24 (Bazin et al., 1982; Gray et al., 1982; Kroese et al., 1985, 1990, 1995) (see Figure V.8.1). They also express CD21 (CR2, C3d receptor) and CD35 (CR1, C3b receptor) (Gray et al., 1984). A newly developed mAb, HIS57, reacts strongly with MZ-B cells and only weakly with a minor proportion of RF-B cells, but not with other B-lineage cells (Deenen et al., 1997). MZ-B cells are sessile cells and some (circumstantial) evidence indicates that they may play a role in antibody responses to TI-2 antigens (MacLennan et al., 1982; Lane et al., 1986). In addition to virgin (i.e. antigen-inexperienced) MZ-B cells, memory cells also appear to be present in splenic MZ (Liu et al., 1988, 1991). The origin of (virgin) MZ-B cells is incompletely known. It has been speculated that they may belong to a distinct lineage of B cells (Bazin et al., 1982; MacLennan et al., 1982). However, there is evidence indicating that (virgin) MZ-B cells are directly derived from RF-B cells (Kumamaratne and MacLennan, 1981; Kroese et al., 1986; Lane et al., 1986; MacLennan and Gray, 1986; De Boer, 1994).

B - 1 c e l l s in t h e r a t ?

In the mouse a minor, but important, subpopulation of B cells is constituted by the B-1 cells (also called Ly-1 B cells or CD5 + B cells). These cells differ from the main population of BM-derived conventional B cells (or B-2 cells) in many respects (for review see Kantor and Herzenberg, 1993). B-1 cells of the mouse are strongly enriched in peritoneal and pleural cavities and have a distinct phenotype, being IgM6rightlgD't"HCD43 + C D l l b +. Part of them expresses CD5 (B-la cells) and another part bears no detectable CD5 (B-lb or 'sister' cells). B-1 cells might well be a distinct B-cell lineage: they arise during ontogeny from progenitor cells located in fetal omentum and fetal liver, while in the adult animal they are largely selfreplenishing and not significantly produced by the BM. Antibodies produced by B-1 cells tend to have a low

57-165 milllon/dayyj I 4420 . million/day!.._.] ,L [5: {! v. I m

[ 1 6 milllon/day ]

[m!.ion/day:m..on/aay] [ 10 ay .........................................

Figure V.8.2 Model of B (precursor) cell dynamics in bone marrow and periphery in the rat. B (precursor) cells are defined by HIS24 (B220/CD45R), TdT, cytoplasmic # chains, slgM, slgD and Thy-1 (see text for explanation of subsets and differentiation pathway). Pro-B cells and large pre-B cells are cycling cells, whereas the other B (precursor) cells are non-dividing. The model shows that most of the generated B cells die at the transition between the stage of the small pre-B cells and the stage of the Newly Formed (NF) B cells. Data are obtained from Deenen et aL (1987, 1990), Deenan and Kroese (1993) and Kroese et aL (1995), and represent production rate in the cycling compartments and renewal rates in the non-dividing compartments.

Rat Immunoglobulins

171

affinity, are muhireactive and are frequently directed to autoantigens and bacteria-related determinants. To date, no B-1 cells have been unequivocally detected in rats (Kroese et al., 1990; De Boer et al., 1994; Vermeer et al., 1994). In adult rats a distinct subpopulation of CD5 expressing (sIgM § cells appears to be absent, while in neonatal rat spleen all B cells express low amounts of CD5, which decrease gradually with age. In marked contrast with mice, only ~ 1 % of cells recovered from the rat peritoneal cavity are B cells, which hampers detection of B-1 lineage cells in the rat. This relative absence of B cells in the peritoneal cavity of the rat is not due to intrinsic properties of rat lymphoid cells since transfer of rat fetal liver cells into SCID mice (Surh and Sprent, 1991) results in high numbers of rat B cells in the peritoneal cavity of the chimera (Deenen et al., 1997). A significant proportion of peritoneal B cells in these xenogeneic chimeras have a unique phenotype not detected elsewhere. These cells resemble MZ-B cells being IgMhighlgDl~ HIS24 l~ HIS57 high, but differ from them in their high expression levels of Thy-I (Deenen et al., 1997). This newly identified B cell subset might be a candidate for the homologue of B-1 cells in the mouse.

cells may be either short-lived or long-lived (Ho et al., 1986). As in other species, rat germinal centers arise in Bcell follicles as a cluster of proliferating (antigen-specific) B blasts between the meshes of the long and slender processes of immune complex trapping follicular dendritic cells (Liu et al., 1991). Studies in rats were the first to demonstrate that de n o v o germinal centers develop oligoclonally from one to three precursor cells (Kroese et al., 1987b). Rat germinal center B-cells have a distinct phenotype and are characterized by the absence of sIgD and CD45R/HIS22 and their expression of CD45R/HIS24 and HSA/HIS50 (Bazin et aI., 1982; Kroese et al., 1985; Hermans et al., 1997). There is evidence that the germinal center precursor cells may be found both among sIgD § (Seijen et al., 1988) and sIgD- (Vonderheide and Hunt, 1991) B-cell populations. Virtually nothing is known about the molecular events such as somatic hypermutation, isotype switching, selection and apoptosis that are thought to take place during the germinal center reaction and the formation of memory B cells in rats.

In vivo humoral immune response

Nomenclature

In vivo antigenic stimulation of mammals leads to two

Grabar and Courcon (1958) and Escribano and Grabar (1962), using the newly discovered immunoelectrophoretic analysis described the first data on the rat serum proteins. Two lines of precipitation were identified in the gammaglobulin area and were supposed to be rat immunoglobulins. Arnason et al. (1963, 1964) later identified three proteins with antibody activities and called them IgM, IgX and IgG. The IgM protein was characterized by its susceptibility to cysteine and its molecular weight. In these publications (Arnason et al., 1963, 1964), two other antibody isotypes were shown, IgX and IgG, which were later called IgA and IgG (Arnason et al., 1964). As in the mouse species, the present IgG1 isotype was misnamed and called IgA. Attention must be paid to publications of that time, in which the IgG1 isotype has the wrong appellation of IgA (see Table V.9.1). Finally, the various IgG subisotypes were correctly identified, IgG1 (Jones, 1969), IgG2a and

types of humoral immune responses in their secondary lymphoid organs: (1) the generation of antibody-secreting plasma cells (i.e. plasmacellular reaction), and (2) the generation of germinal centers for memory B-cell production (i.e. germinal center reaction). In rats, antigen (hapten)-specific antibody-forming cells have been detected in lymphoid tissues by a few days after immunization through the appropriate route both with T-cell dependent and T-cell independent antigens (van der Brugge-Gamelkoorn et al., 1986; Claassen et al., 1986; Liu et al., 1991; van der Dobbelsteen et al., 1992). Initially, these antibody-forming cells are located in the interdigitating cell-rich areas of the T-cell zones, and later they are predominantly found in red pulp of the spleen or medulla of the lymph nodes. Rat plasma cells lack CD45R/HIS24 but are CD43 + positive (Kroese et al., 1987a) and these

9.

Rat Immunoglobulins

Table M.9.1 Historicalnomenclature of the rat immunoglobulin (sub)isotypes Reference

Arnason et al. (1963) Arnason et al. (1964) Binaghi and Sarando de Merlo (1966) Jones (1969) Bazin et al. (1973) Bazin et aL (1978) a

Synonyms(old usage)are given in brackets.

IgM a

(TM,71M, fl2M)

IgA (fi2A,71A,~A)

IgD (TD)

IgE

IgM IgM ~/M IgM

7A IgA

IgD

IgE

IgG1

IgG2a IgG2b (7S~,7ss, or 7G)

IgX IgA

IgG IgG

7S71 IgG1

IgGa

IgGb 7S72 IgG2a IgG2b

IgG2c

IgG2c

172


IgG2b and IgG2c (Bazin et al., 1974a). IgA was recognized by a cross reaction between rat serum and a strong polyclonal antimouse IgA (Nash et al., 1969) and then shown to have the main physicochemical and biological properties of human or mouse IgA. IgE was distinguished by the reaginic properties of immunized rats which were similar to those of man. Stechschulte et aI. (1970) and Jones and Edwards (1971) published a rat immunoglobulin equivalent to human IgE. This result was confirmed by Bazin et al. (1974b) with the help of IgE myeloma protein from the LOU rat strain. The first indication of a rat IgD isotype was given by the binding between a chicken serum antihuman IgD and the membrane of rat lymphocytes (Ruddick and Leslie, 1977). Rat IgD was fully characterized with the help of LOU rat IgD monoclonal immunoglobulins (Bazin et al., 1978). According to the recommendation of the committee of immunoglobulin nomenclature of the World Health Organization (1973), the two initial letters 'Ig' must be adopted for all immunoglobulin isotypes and all species. All the letters must also be written on the same line, thus IgG1 and not IgG1. The division of IgG isotype into subisotypes (or subclasses) based on their electrophoretic mobility, can be maintained even at the present stage of knowledge. The rat IgM, IgD, IgG, IgA and IgE isotypes are the equivalent of their human or mouse homologues, at least, most of their physicochemical and biological properties are similar. Rat light chains were characterized by Querinjean et al. (1972, 1975) who established the presence of/c and 2 chains as described for other species (Hood et al., 1967). However, if most of the physicochemical and biological properties of the five immunoglobulin isotypes are common to all mammal species in which they have been studied (Bazin et al., 1990), it is difficult to give an exact correlation between the IgG subclasses from different species (Figure V.9.1). From work by Der Balian et al. (1980) and Nahm et al. (1980) on biological properties, by Brfiggemann et al. (1988) on sequence homology, and Bazin et al. (unpublished data) on antigenic crossreactivity, rat IgG2c and mouse IgG3 immunoglobulins

MouseIgG subclasses

Rat IgG subclasses

are clearly equivalent. Other IgG subisotypes are more difficult to correlate. Bazin (1967a, b) showed that when thymodependent antigens such as human serum albumin or horse ferritin are given to mice by the intraperitoneal route, antibodies of the IgG1 isotype appear first followed by IgG2. Similarly, thymodependent antigen (mouse monoclonal antibody antirat IgD) injected to rats gives predominantly antibodies of the IgG1 isotype (Soares et al., 1996), which indicates that T-dependent immune response, both in mice and rats, produces mostly IgG1 antibodies. Molecules of the same immunoglobulin isotype (or subisotype) may have different amino acid sequences and may express different antigenic determinants. They can present two or more antigenic forms which are called allotypes in the Oudin terminology (1956), and individuals of the same species may be divided into as many allotypic groups as antigenic forms. Each individual expresses one allotype. Allotypic specificities correspond to structural differences determined by genes which are inherited as Mendelian characters. Immunoglobulin genes are codominant and, as such, always expressed in a heterozygote; however every cell expresses only one of the allelic genes. Four allotypes have been identified in the rat species. The first rat allotype discovered was reported by Barabas and Kelus (1967) immunizing, 'black and white hooded rats' with Wistar immunoglobulins. Later, Wistar (1969) showed the presence of an allotypic difference in rat light chain immunoglobulins. This difference was confirmed by others (Armeding, 1971; Gutman and Weisman, 1971; Humphrey and Santos, 1971). Rocklin et al. (1971) suggested that this marker was located on the/c light chains, which was confirmed by Beckers et al. (1974) and Nezlin et al. (1974) using monoclonal and polyclonal purified/c light chains, respectively. A common nomenclature adopted by the scientists working in the field (Gutman et al., 1983) defines an allotype called IgK-1 and two alleles, IgK-la (reference strain, LOU/C) and IgK-lb (reference strain, DA). The differences between the two alleles were studied by Gutman et al. (1975) who described one sequence gap and many amino acid substitutions

|

Ig.G1

IgG2a~91---IP~lgG2b

IgG1-91--IP-IgG2a

|

IgG2b

IgG3

IgG2c

Figure V.9.1 Correlation between mouse and rat IgG subclasses (Bazin et aL, 1990). The various homologies are respectively supported: (1) antigenic cross-reactions (Carter and Bazin, 1980) and sequence homology (Br0ggemann et aL, 1986; Br0ggemann, 1988); (2) homocytotropic antibodies and sequence homology (Br0ggemann et aL, 1986; Br0ggemann, 1988); (3) antigenic crossreaction (H. Bazin, unpublished data) and sequence homology (Br0ggemann, 1988); (4) sequence homology (Br0ggemann et aL, 1986; Br0ggemann, 1988); (5) sequence homology (OIio et aL, 1981; Br0ggeman, 1988); (6) sequence homology (Br0ggeman, 1988); (7) homologies based on physicochemical and biological properties (Der Balian et aL, 1980; Nahm et aL, 1980; Br0ggeman, 1988; Br0ggemann et aL, 1988).

Rat Ig Variable Region Genes

Table V.9.2

173

AIIotypic markers in normal and congenic rat strains

AIIotypic markers Rat strains

Genetic background

Number of backcrosses

LOU/C LOU/Ca. Ig K - 1 b(O KA) LOU/C.IgH-2b(OKA) OKA PVG- 1 a b PVG-1 b

LOU/C LOU/C LOU/C OKA PVG/c PVG/c

-12 12 --15

DA

DA

--

IgK-1

IgH-1

IgH-2

a b a b a b b

a a

a a

b b

b b

aFrom H. Bazin and A. Beckers (1976) Molecular and BiologicalAspects of the Acute Allergic Reaction, p. 125. With permission. b Hunt and Gowans, personal communication.

between the tc chains of the Lewis and DA rat strains. Bazin et al. (1974c) described another allotype located on the rat ~ heavy-chain of immunoglobulins. This allotype is now called IgH-1 with two alleles: IgH-la (reference strain, LOU/C) and IgH-nonla (reference strain, OKA). The IgH-la determinant is located on 100% of the ~ chains from LOU/C rats. Beckers and Bazin (1975) described an antigenic difference for the rat 72b heavy chains (IgH-2) with two alleles IgH-2a (reference strain, LOU/C) and IgH-2b (reference strain, OKA), according to the commonly adopted nomenclature (Gutman et al., 1983). A third allotype of rat immunoglobulin heavy chains has been associated with the rat IgG2c subisotype (Leslie, 1984) and designated IgH-3 with two alleles- IgH-3a on the heavy chain of COP, F344, BN, DA and IgH-3b on Wistar/Fu, LOU and SHR rat strains. IgH-1 and IgH-2 loci are linked to each other (Beckers and Bazin, 1975) but not to the IgK-1 locus (Beckers et al., 1974). The heavy chain genes are not linked to the gene(s) coding for sex, coat pattern and color and eye color (Bazin et al., 1974c). The IgK-1 locus is not linked to the major histocompatibility complex and three coat-color genes (Gutman and Weissman, 1971). Congenic strain rats for kappa Ig allotypes have been developed as shown in Table V.9.2 and can be used as markers for B cells.

10.

Rat Ig Variable Region Genes

G e n e r a t i o n of i m m u n o g l o b u l i n d i v e r s i t y

As in other mammalian species, in rats the diversity of the B-cell receptor is generated by recombination of many different genetic elements before the complete antibody is expressed. Diversity is generated by the combination of heavy and light chains, each consisting of a variable and a constant region. The variable region of a heavy chain is constituted from a variable (VH), diversity (D) and joining (JH) gene segment, while the variable region of a light chain is a combination of only a variable (VL) and joining

(JL) gene segment. The constant regions encode the different isotypes. In rats the isotypes IgM, IgD, IgG1, IgG2a, IgG2b, IgG2c, IgA and IgE are identified (Bazin et al., 1974). The constant regions encoding the IgM, IgG1, IgG2a, IgG2b, IgA and IgE molecules have been (partly) sequenced (Hellman et al., 1982a, b; Br~iggemann et al., 1986; Br~iggemann, 1988), and the constant genes for the kappa and lambda light chains are also known (Querinjean et al., 1975; Sheppard and Gutmann, 1981, 1982). Genomic sequence data have shown that there are at least three rat 2-like constant region genes, of which only Ig2C2 seems to be functional (Steen et al., 1987; Frank and Gutman, 1988). During early B-cell development the heavy-chain genes are first rearranged, first by D-J joining, after which the V-DJ joining is completed. The different recombination signals (RSS) necessary in this process are heptamer and nonamer sequences which are either separated by 12 or 23 base pair spacers. In the rat, we recently confirmed the presence of such RSS signals at the 5' end of nonfunctionally rearranged D-J genes (Vermeer, 1995). The RSS sequences at both sides of the JH gene segment and of the most 3' DQ52 element have also been completely described at the genomic level (Br~iggemann et al., 1986; Lang and Mocikat, 1991). After complete assembly of the heavy chain, it is first combined with a surrogate light chain protein encoded by a combination of 25 and V-preB genes. Recently, the rat 25 gene was cloned and sequenced (Dammers et al., 1998a). After successful expression of these proteins, the light chain genes are rearranged and either lambda or kappa light chains are combined with the heavy chain to complete the expression of the B cell receptor. The accessory and fi (CD79a and b) proteins that accompany the membrane Ig molecule in the mouse and in humans have not yet been described in the rat.

Ig h e a v y - c h a i n v a r i a b l e region s e q u e n c e s

Available rat heavy chain variable region (VH) sequences reveal a high degree of similarity to the homologous mouse

174

Table V.10.1


Rat variable heavy chain genes

VH gene family

Clone name or designation

3609

ERF2.21 ERF2.67 11-160 53R-1 56R-3 53R-4 56R-9 ALN/9/94 ERF1.25 ERF1.72 ERF2.13 ERF2.37 GK1.5

PVG/E PVG/E CBH/Cbi

GLVH6 GLVH7 GLVH9 GLVH17 GLVH18 GLVH19 GLVH28 MEC6

PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E DZB

IgM

X86661 X86667 X86665 X86678 X86663 X86664 X86668 X78893

MEC7

DZB

IgM

X68782

RNIGVHL RNIGVIL TDL31 YFC51.1.1 ERF3.23 ERF1.1 ERF1.82 ERF1.83 ERF2.4 ERF2.12 ERF2.29 ERF2.52 ERF2.74 ERF3.8 GLVH4 GLVH10 GLVH11 GLVH12 GLVH15 GLVH16 GLVH20 GLVH21 GLVH24 GLVH25 GLVH26 GLVH27 HC4A

BN BN PVG/E DA PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E Lewis

G G R R R R R R R R R R R R G G G G G G G G G G G G R

Hg12

BN

R

J558

J606 PC7183

Strain

Configuration

Isotype

IgM IgM IgG2b IgG2a IgG2a IgG2a IgG1 IgG2b IgM IgM IgM IgM

CBH/Cbi PVG/E PVG/E PVG/E PVG/E Lewis

m

m

IgM

Accession number

Z93360 Z93368 X91994 L07396 L07398 L07397 L07400 X91996 Z93350 Z93355 Z93359 Z93363 M84149

L07403 L07404 a

IgG2a

M87787 Z93370 Z93349 Z93356 Z93357 Z93364 Z93358 Z93362 Z93366 Z93369 Z93371 X86672 X86680 X86670 X86674 X86673 X86671 X86658 X86662 X86669 X86676 X86677 X86675 L22652

IgE

Z75897

IgM IgM IgM IgM IgM IgM IgM IgM IgM IgM

Source

Vermeer (1995) Vermeer (1995) L6ger et al. (1995) Karp (1993) Karp (1993) Karp (1993) Karp (1993) L6ger et al. (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) A. Rashid et aL (unpublished data) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Aten et al. (1995), Dammers et al. (1998c) Aten et al. (1995), Dammers et al. (1998c) Karp (1993) Karp (1993) Vermeer (1995) Sims et aL (1991) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) M. A. Agius and S. Bharati (unpublished data) Hirsch et al. (1986), Varga et al. (1995), Dammers et al. (1998c) (continued)

Rat

Ig Variable

Region

Genes

175

Table V.10.1 Continued VH gene family


Strain

Configuration

Isotype

Accession number

PC7183

Hg15

BN

R

IgG1

Z75898

Hg16

BN

R

IgG1

Z75899

Hg17

BN

R

IgG1

Z75900

Hg33

BN

R

IgE

Z75903

MEC1

DZB

R

IgG2a

Z75904

MEC2

DZB

R

IgG1

Z75905

MEC3

DZB

R

IgM

X78897

MEC8

DZB

R

IgM

X78895

NC1/34HL PC3 PC4 PC6 PC9 PC10 PC11 PC12 PC13 PC17 PC18 PC19 PC20 TDL5 TDL14 TDL15 TDL21 TDL27 TDL28 TDL30 VHHAR1/VH1.1 Y13-259

PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E Lewis

G G G G G G G G G G G G R R R R R R R R

R

IgG

M62827 A002461 A002462 A002463 A002464 A002465 A002466

--

YNB46.1.8 SG2B1.19 YTH906.9.21 Q52

--

a

A002467 A002468 A002471 A002469 A002472

R

IgM IgM IgM IgM IgM IgM IgM IgM IgG

$81282 X55179

PVG

R

IgG2a

M61885

--

R

--

R

--

R

57R-1 57R-2 Alpha D11

Sprague-Dawley

R

Alpha D11

Sprague-Dawley

R

ERF1.5 ERF1.30 ERF1.49 ERF2.27 ERF2.49 ERF2.59

PVG/E PVG/E PVG/E PVG/E PVG/E PVG/E

R R R R R R

a a a a

a a a

M87783 IgG2a IgG1 m

L07401 L07402 L17077 L17079

IgM IgM IgM IgM IgM IgM

Z93354 Z93351 Z93353 Z93361 Z93365 Z93367

Source

Hirsch et al. (1984), Gu6ry et al. (1990), Dammers et al. (1998c) Guery et al. (1990), Dammers et al. (1998c) Guery et al. (1990), Dammers et al. (1998c) Hirsch et al. (1986), Varga et al. (1995), Dammers et al. (1998c) Aten et al. (1995), Dammers et al. (1998c) Aten et al. (1995), Dammers et aL (1998c) Aten et al. (1995), Dammers et al. (1998c) Aten et al. (1995), Dammers et al. (1998c) Piccioli et aL (1991) Dammers et al. (1998b) Dammers et aL (1998b) Dammers et al. (1998b) Dammers et al. (1998b) Dammers et al. (1998b) Dammers et al. (1998b) Dammers et aL (1998b) Dammers et aL (1998b) Dammers et aL (1998b) Dammers et aL (1998b) Dammers et aL (1998b) Dammers et al. (1998b) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Furth et al. (1982), Werge et al. (1990) Mathieson et al. (1990), Gorman et aL (1991) A. P. Lewis (unpublished data) Karp (1993) Karp (1993) Cattaneo et al. (1988), Ruberti et al. (1994) Cattaneo et aL (1988), Ruberti et al. (1994) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) Vermeer (1995) (continued)

176

IMMUNOLOGY

Table V.10.1 VH gene family

$107

VGAM3.8 VH10 VH11

X24

aAccession

OF T H E RAT

Continued Accession number


Strain

Configuration

Isotype

GLVH5 GLVH13 Hg18

PVG/E PVG/E BN

G G R

---

IgM

RNIGVJL TDL24 TDL34 132A

BN PVG/E PVG/E Lewis

G R R R

-IgM IgM IgG2a

YTH 34.5HL

DA

R

IgG2a

ERF1.34 56R-7 MEC4

PVG/E -DZB

R R R

IgM IgG1 IgG2a

X60290; X07387 Z93352 L07399 X78894

MEC5

DZB

R

IgG1

X78896

YTH655 (5)6

--

a

--

M87785

Hg32

BN

R

IgE

Z75902

X86660 X86659 Z75901 L07405 a a

L22654

Source Vermeer (1995) Vermeer (1995) Guery et aL (1990), Dammers et al. (1998c) Karp (1993) Vermeer (1995) Vermeer (1995) M.A. Agius and S. Bharati (unpublished data) Reichmann et al. (1988), Foote and Winter (1992) Vermeer (1995) Karp (1993) Aten et aL (1995), Dammers et al. (1998c) Aten et aL (1995), Dammers et al. (1998c) J. Shearin (unpublished data) Hirsch et aL (1986), Varga et al. (1995), Dammers et al. (1998c)

numbers will be available soon.

gene segments. In Table V.10.1 VH sequences are compiled and classified according to the homologous mouse VH gene family names, together with their references. Of the 105 sequences known at present, 80 were recently derived at our laboratories; 36 are germline derived, while from the remainder the cDNA sequence of the rearranged VDJ is given. Pseudogenes were excluded from the list. The D sequences are not very well described at the genomic level, except for the most 5' DQ52 (Brfiggemann et al., 1986), but some can be deduced from both functional and nonfunctional D-J joinings sequenced. The rat JH locus is completely cloned and sequenced and confirms the existence of four functional JH sequences (JH1-4) and one pseudo J-gene located upstream of JH1 (Lang and Mocikat, 1991).

Complexity

o f t h e Ig V H l o c u s

On the basis of sequence homology all the known rat VH genes can be divided into Vvt gene families, as in the mouse. The existence of rat VH gene families, named after the mouse homologue has been confirmed for the J558, PC7183, X24, J606, Q52, x24, $107, VH10, vw11, VGAM3.8 and 3609 families (Table V.10.1). Members of the VH12, VH13 and VH14 are n o t (yet) described. Southern blotting analysis of EcoRI digested genomic DNA suggest the complexity of the VH gene locus is of the

same size as in the mouse (Table V.10.2), although the hybridization with the probes specific for the mouse VH gene families VGAM3.8 and VH12 was very weak (unpubTable V.10.2

Complexity of rat V H genes Complexity a

VH gene family J558 Q52 VGAM3.8 PC7183 3609 J606 3660 $107 X24

Number of hybridized EcoRI RF

% VH genes

VH11 VH12 VH13 VH14

16 14 5 18 10 13 6 9 18 11 11 4 4 1

11 10 4 13 7 9 4 6 13 8 8 3 3 1

Total

140

100

MR10

a Complexity is defined as the maximal number of different restriction fragments that can be found after hybridization of Ecorl-digested rat liver DNA (AO, LOU, PVG/E, BN strains) to mouse VH gene familyspecific probes (Vermeer, 1995).

B Lymphoid Tumors or Immunocytomas

lished data). The number of VH genes within the different families is however different between the rat and the mouse. While in the mouse the J558 VH gene family is by far the largest family, containing approximately 50% of all the mouse VH genes, in the rat this VH gene family contains about 20% of the VH genes. Conversely, the small mouse X24 family (two members) shows at least 18 bands with Southern blotting. The PC7183 family also appears larger in the rat, which has been confirmed at the genomic sequence level, because, currently, 55 different VH genes are described at the sequence level of which at least 24 are germline derived, while the mouse PC7183 family contains only 18 members (Carlsson et al., 1992). In mice, the VH gene locus show many differences in numbers and sizes of hybridizing fragments between different mouse strains. When we analyzed the rat strains AO, Louvain, PVG and BN, little polymorphism was detected. The only strain in which some differences could be detected was the BN strain (Vermeer, 1995). Because fewer bands were observed in the VH gene families PC7183, J606, $207 and X24 in BN rats compared with the other strains, it could mean that the BN rat has a partial deletion of the VH gene locus. Whether this observation has any relevance to the observed sensitivity to develop antibody-mediated autoimmune diseases, e.g. HgC12-induced immune complex glomerulonephritis in this rat strain, is presently unknown (Aten et al., 1988).

Ig light-chain sequences There are only a limited number of rat light chain variable region sequences available, both for the ~c and for the 2 locus. The few available are compiled in Table V.10.3. Most of them are all cDNA derived sequences. The 2 locus consists of at least 10-15 gene segments, representing at least four distantly related subfamilies (Aguilar and Gutman, 1992). All V~ gene segments analyzed use only J~2 and C~2, which appears to be the only functional constant lambda gene (Steen et al., 1987). In total 18 V~ genes have been described (Table V.10.3), of which two are germline derived. The V~ genes are not defined as subgroups as described in the mouse. The J~ locus has been well described and consist of six functional J~ genes and one pseudogene (Sheppard and Gutmann, 1982).

Development of Ig repertoire Whenever a complete Ig is expressed on newly formed (NF) B cells, these cells are subject to both positive and negative selection. Kinetic studies have shown that many cells are lost between the NF-B cells in the bone marrow and those in the spleen (Deenen et al., 1990). Early recirculating B cells (ERF-B) that just have left the bone marrow can be recognized due to the presence of Thy-1, in contrast to the normal recirculating, follicular B cells

177 (RF-B) (Deenen and Kroese, 1993; Kroese et al., 1995). Analysis of usage of VH genes in spleen-derived ERF-B and RF-B cells from the ductus thoracticus suggests that both populations have undergone a selection process, since the usage of VH gene families is nonrandom according to the complexity of the VH gene families. Members from the PC7183 VH gene family are more frequently used than would be expected, while members from the VH gene families $104, X24, VH10 and VH11 are underrepresented (Vermeer, 1995). This nonrandom usage is stronger in RF-B than in ERF-B cells, suggesting an ongoing process of selection of B cells on the basis of the repertoire utilized.

11.

B Lymphoid Tumors or Immunocytomas

Major progress in the studies of immunoglobulins has been made by using monoclonal immunoglobulins or myeloma proteins (or paraproteins) synthesized by B lymphoid tumor cells. The most studied were those of men (McIntyre, 1950) and mice (Dunn, 1975). These spontaneous cell growths were rather rare and were called myeloma tumors, plasmacytomas or immunocytomas according to their origins and their main characteristics. The first model of immunoglobulin secreting tumors was developed by Potter et al. (1957), in BALB/c mice. Lymphoid tumors arising in the ileocaecal area of rats have been reported in the scientific literature since the 1930s (Curtis and Dunning, 1940; Roussy and Gu&in, 1942; Dunning and Curtis, 1946; Gu&in, 1954). Some or all these growths were immunocytomas, some of them probably secreting monoclonal immunoglobulins. However, none of these observations indicated an incidence greater than 3%. In the late 1950s, Maisin and his colleagues, working in the Faculty of Medicine of the University of Louvain, Belgium, described a special type of lymphoid tumors appearing in the ileocaecal area of their rats (Maisin et aI., 1957; Maldague et al., 1958). Some of these tumors secreted monoclonal immunoglobulins (Maisin et al., 1964). In 1970, Bazin and Beckers started breeding rats from different rat nuclei at the University of Louvain. They bred 28 different and distinct lines. The line presenting the highest incidence of malignant immunocytoma was chosen as histocompatibility reference and called LOU/C. Immunocytomas appeared spontaneously in the ileocaecal lymph node(s) (Moriam(~ et al., 1977) of 8month-old LOU/C rats or older. Their incidence was up to 34% in males and 17% in females (Bazin et al., 1972). These tumors were rapid growing and killed their hosts within the month following their detection by abdomen palpation. Ascitic fluids were sometimes present. Metastases were often found in the mediastinal lymph nodes or in the pleural cavity. The histological aspect of these tumors has been described by Maldague et al. (1958). The

178


Table V.10.3

Rat variable light chain genes

Light chain isotype


Strain

2

RLV007 RLV010 RLV031 RLV052 RLV070 RLV086 RLV100 RLV118 RLV124 RLV130 RLV144 RLV154 RLV155 RLV163 RLV191 11/160 21/61 132A

DA DA DA DA DA DA DA DA DA DA DA DA DA DA DA CBH/Cbi Louvain Lewis

K

53R-1 53R-4 56R-3 56R-7 57R-1 Alpha D11 GK1.5

Sprague-Dawley Lewis

HC4A

Lewis

IR2 IR162 RNIGKVFL RNIGKVGL Y3-Ag 1.2.3. Y13-259 YNB46.1.8SG2 B1.19 YTH 34.5HL

LOUC/Wsl LOUC/Wsl

m

I/2 gene subfamily

Vl V2 V2 Vl V2 V2 V2 V2 V2 V2 Vl V4 V2 V2 V2

m

m

m

m

m

m

m

m

m

m

-Louvain

m

m

u

PVG

m

DA

secreting tumor cells could not be described as plasma cells but exhibited a marked uniformity in size, a granular nucleus with relatively small nucleoli, and a rim of deeply basophilic and pyroniphilic cytoplasm (Bazin et al., 1972, 1973). Around 80-90% of these tumors secreted monoclonal immunoglobulins with or without Bence-Jones proteins. Most, if not all tumors were transplantable in histocompatible rats and some have been transplanted from animal to animal for years without any change in their immunoglobulin production. The class distribution of the various proteins is given in Table V.11.1. The LOU rats gave a very high percentage of IgE secreting tumors. This model provided the first mono-

Configuration

Accession number

R R R R R R R R R R R R R R R R R R

M77356 M77357 M77359 M77360 M77361 M77362 M77363 M77365 M77366 M77367 M77368 M77370 M77371 M77372 M77373 X91995 X75533 L22655

R R R R R R R

L07406 L07407 L07408 L07409 L07410 L17078 M84148

R

L22653

R R G G R R R

M14434 M 15402 L07411 L07412 X16129 X55180 M61884

Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Aguilar and Guttman (1992) Leger et aL (1995) KQtemeier et aL (1994) M.A. Agius and S. Bharati (unpublished data) Karp (1993) Karp (1993) Karp (1993) Karp (1993) Karp (1993) Ruberti et al. (1994) Rashid et aL (unpublished data) M.A. Agius and S. Bharati (unpublished data) Hellman et aL (1985) Hellman et aL 1985) Karp (1993) Karp (1993) Crowe et aL (1989) Werge et aL (1990) Gorman et al. (1991)

R

X60291 X07383

Reichmann et al. (1988), Foote and Winter (1992)

Source

clonal immunoglobulins of the IgE (Bazin et al., 1974a) and of the IgD (Bazin et al., 1978) isotypes in other species than humans. The model also permitted a correct nomenclature of the rat immunoglobulins and the discovery of the IgG2c subisotype in the rat species (Bazin et al., 1974b). More details of the model can be found in Bazin (1990). Mouse plasmacytomas and also Burkitt's lymphoma and rat immunocytomas carry an Ig/myc translocation which appears to play a decisive role in the genesis of these tumors, acting through the consecutive activation of myc which makes it refractory to regulation (Pear et al., 1986,

1988).

The Major Histocompatibility Complex

179

Table V.11.1 Class distribution of complete monoclonal immunoglobulins synthesized by immunocytomas appearing in LOU rats or their F1 hybrids

Immunocytomas Number Percentage a

691

--

Number of Ig-secreting immunocytomas

IgM

IgD

IgG1

440 100

13 2.95

4 0.91

167 27 37.90 6.13

IgG2a

IgG2b

IgG2c

IgE

IgA

3 0.68

20 4.54

190 13 43.18 2.95

NDa 3 0.68

Not determined.

12.


History of the rat major histocompatibility c o m p l e x (MHC)

In 1938, Lumsden made the observation that the serum of rats that rejected a transplanted sarcoma agglutinated the erythrocytes of other rats (Lumsden, 1938). Although not recognized as such, it is quite likely that this was the first indication ever for the presence of anti-MHC antibodies in these sera. It was not until 1960 that two groups of investigators, Stark and colleagues in Prague, Czechoslovakia, and Bogden and Aptekman in New York, USA, independently reported that inbred rats after tissue transplantation produced hemagglutinating antibodies specific for the major histocompatibility complex of that species. Stark and colleagues called the complex R t H - 1 (Frenzl et al., 1960), whereas the New York group designated it as Ag-B (Bogden and Aptekman, 1960). By that time several blood group antigens (Ag) had been described in the rat by a number of investigators and designated A, B, C, etc; blood group antigen B proved to be identical to the MHC. At the Second International Workshop on Alloantigenic Systems in the Rat in 1979 it was recommended that the rat MHC be designated as R T 1 .

The RT1 c o m p l e x

RT1 is located on chromosome 20 (Locker et al., 1990). The various MHC and MHC-linked loci that have been identified to date are arranged in five clusters according to the structure of the molecules they encode for: class I genes, class II genes, class III genes, loci of the grc, and genes coding for various enzymes (summarized in Table V.12.1). Class I molecules consist of two polypeptide chains. One of these, the heavy chain, which has covalently attached to it one or two carbohydrate moieties, has a comparable molecular weight in several species: 45 000 in the rat (Blankenhorn, 1978). This heavy chain consists of an intracellular, a transmembrane and an extracellular segment. This last part consists of two disulfide loops and an amino terminal segment. A light chain, fi2-microglobu-

Table V.12.1

Rat major histocompatibility complex loci

Class~region Loci

II III

grc

Other

A; K (Pa); F, E; N1, N2, N3; O; G; C; 11/35R; LW2; L; R* H; B; D TAP1, TAP2; TNF~; C2; 21-0H; C4; Bf," Hsp70 grc; rcc; ft; dw-3 GIo- 1; Acry- 1; Neu- 1

* Formerly M. The M designation is now the homologue of the H-2M locus of the mouse (K. Wonigeit et aL, unpublished data). More information about rat MHC loci can be found in Gill et aL (1995).

lin (fi2M), is noncovalently attached to the heavy chain. fl2M is a polypeptide, with a molecular weight of 12 000, which is folded in a single disulfide loop and has no direct attachment to the membrane. Class I antigens are found on all nucleated cells and on red blood cells. Class II molecules consist of two noncovalently bound polypeptides: an a-chain with a molecular weight of 31000 to 34 000 and a fi-chain with a molecular weight of 26 000-29 000 (Fukumoto et al., 1982). Class II antigens are normally found only on certain cells of the immune system (B lymphocytes, macrophages, dendritic cells, and antigen-presenting cells (APCs) in general), but can also be expressed or upregulated on other tissues during activation (Mason, 1985), especially under the influence of certain cytokines (e.g. IFN-7) (Markmann et al., 1987; Rayner et al., 1987; Steiniger et al., 1989). Class II molecules are encoded for by the RT1.B, RT1.D and RT1.H loci. Blankenhorn et al. (1983) demonstrated that the RT1.B and RT1.D loci code for I-A and I-E (mouse) like class II molecules. They are associated with a strong mixed lymphocyte reaction (MLR), i.e. the proliferation of cells that is found, when lymphocytes of two genetically different individuals are co-cultured. The control of capability to respond to small polypeptide antigens is also located in this region (Lobel and Cramer, 1981). Class I molecules provide the major stimulus for cytotoxic T-cell activity (Liebert et al., 1982, 1983). The relative chromosomal localization of the various loci is shown in Figure V.12.1 (after Gill et al., 1995). The MHC map of the rat shows a high degree of similarity with that of the mouse (Gill et al., 1995).

180

IMMUNOLOGY

Neu-1

t

C2, 21-OH

I

I

z0

II

MHC

I

3.3

I r l,311 o l

I

0

0.4

grc

I

0.

I

OF T H E RAT

103Rii,w21rqr I

I

GIC

I

1.4

I IcM

2.9

I kB 3000 -3200

Figure V.12.1 Map of MHC and MHC-linked loci in the rat: 0, classical class I (class la) antigens; ~ , non-classical class I (class Ib) antigens; e, class II antigens; ~ , transporter proteins for antigenic peptides; ~ , tumor necrosis factor c~; 9 loci of the grc (rcc, resistance to chemical carcinogenesis; ft, fertility; dw-3, body size); and G , various enzymes. Loci mapped only to a region are given above the brackets: Neu-1, neuraminidase-1; C2, C4 and Bf, complement components; 21-OH, 21-hydroxylase; Hsp-70, heat shock protein 70; N1, N2 and N3, TL-like loci; and O, Q-like locus. Adapted from Gill et aL (1995).

characteristics with other haplotypes, i.e. the RP-strain is serologically (defining class I MHC antigens) identical to other RTI" rat strains (WAG, WF), and in MLR-typing (defining class II MHC antigens) identical to other RT11 rat strains (LEW) (Vaessen et al., 1979). Because the origin of this mixture of RT1 characteristics cannot be deduced, these strains are described as 'natural' RT1 recombinant rat strains and are assigned a unique RT1 haplotype (see Table V.12.3). This contrasts with the laboratory derived RT1 recombinant rat strains (examples given in Table V.12.4). These strains and there haplotypes are derived from crosses between known parental strains, therefore the exact nature of the recombination within the MHC locus is known and can be used for comparisons with the original parental strains in studies in which the association of certain functional characteristics with certain loci of the RT1 complex is investigated.

Although most of the original work on MHC typing was done using serological (hemagglutination for class I antigens) and cellular (MLR typing for class II antigens) techniques, major progress in the study of rat MHC has been made over recent years using various molecular approaches (reviewed by Gill et al., 1995). An extensive list of monoclonal antibodies against rat alloantigens, including antibodies defining both rat MHC class I and class II antigens, was published by Butcher (1987).

Rat strains

RT1 haplotypes have been allocated based primarily on serological and cellular typing results. Representative strains for the various haplotypes are given in Table V.12.2 (Gill et al., 1995). Several of these haplotypes share Table V.12.2

RT1 haplotypes and representative strains

RT1 haplotype

Strains

RT1 haplotype

Strains

a avl b c d dvl e f g h i j

AVN DA, ACI, ACP, COP BUF, ALB AUG, PVG BDV BDIX, TAL BDVII AS2 KGH HW BI LEJ

k / Ivl m n o p q sa sb u

WKA/Hok, WKAH, KYN, OKA, SHR LEW F344 MNR BN, MAXX MR RP NIG III NSD WIN WF, TO, WAG, SDJ, YO, BB/W

More information about inbred strains can be found in Rat News Letter, No. 26, January 1992, and in Genetic Monitoring of Inbred Strains of Rats, edited by H. J. Hedrich, Gustav Fisher Verlag, New York, 1990.

The Major Histocompatibility Complex Table V.12.3

181

'Natural' RT1 recombinant rat strains

Strain

BDVII BI KGH LEJ MNR MR RP

Haplotype

MHC Typing*

e

AaL c

i g j

AnL a

AULb

m

AaL c

o p

AdL a AULI

series of RTI congenic rat strains have been developed (see Table V.12.5) and have been and still are extremely useful for studying the role of MHC-encoded proteins in a variety of physiological processes. The list given in Table V.12.5 is not complete and one should also be aware of the fact that some of these congenic strains have become extinct over the years. For further details and current availability please refer to the contacts given in the list.

AgL I

* MHC Typing was done with serological (Agglutination) and lymphocyte (Mixed Lymphocyte Reactivity) typing. More information about 'natural' RT1 recombinant strains can be found in Section 103 of Handbook of Experimental Immunology, 4th edition, edited by D. M. Weir, Blackwell Scientific Publications, Oxford, UK, 1986.

Several groups have put much effort in developing RT1 congenic rat strains, in which the MHC locus of one strain of rats (for example the RT11 haplotype of the LEW rat strain) is placed on the background of a different strain (for instance the BN rat strain) by multiple backcrossing and selection for the donor RT1 haplotype (resulting in our example in the BN.1L congenic rat strain). Several

Table V.12.4

Associations of RT1 with disease and/or immunological (dys)function Although originally recognized as a gene complex encoding for tranplantation (histocompatibility) antigens, the MHC has over the years been shown to be involved in a variety of biological functions. The most important is probably MHC-restriction as the basis for self/nonself discrimination of the immune system (Zinkernagel, 1997). It is therefore not surprising that the MHC and MHCencoded proteins exert an especially strong influence on immunologically mediated diseases and disorders. Various autoimmune models in rats display a virtually absolute

Laboratory-derived RT1 recombinant rat strains RT1 regions

Haplotype name Recombinant

A

B

D

C

Strains of origin

Carrier of recombinant haplotype

rl r2 r3 r4 r5* r6

a // a//u a u n u//a

c

c u a//u u//a n // a

c u

DA; PVG LEW. 1A(AVN); LEW. 1 U(WP) LEW. 1A(AVN); LEW. 1 U(WP) LEW. 1 U(WP); LEW. 1A(AVN) BN; LEW LEW. 1WR 1 ; LEW. 1A(AVN)

PVG.R1 LEW.1AR1 LEW.IAR2 LEW.lWR1 LEW.1N(2R)* LEW.IWR2

a u n

I a

* The r5haplotype is now extinct. More information about RT1 recombinant rat strains (R1 to R33) can be found in Section 103 of Handbook of Experimental Immunology, 4th edition, edited by D. M. Weir, Blackwell Scientific Publications, Oxford, 1986, and in Kunz et aL (1989).

Table V.12.5 Name The BN series BN.1A BN.1B BN.1C BN.1E BN.1G BN. 1H BN.11 BN. 1 K BN.1 L BN.1L BN.1U BN. 1 U

RT1 congenic rat strains Differential RT1 haplotype avl b c e g

h

i k / Iv1 u u

Donor strain

DA BUF AUG BDVII KGH HW BI WKA LEW F344 WF YOS

Developed and maintained by

Initiated by J. Palm et aL, Philadelphia, PA, USA. Continued and extended by others, particularly H. Kunz and T. Gill, Pittsburgh, PA, USA

(continued)

182

Table V.12.5


Continued

Name

Differential RT1 haplotype

Donor strain

The LEW series LEW. 1A LEW.IA LEW. 1 B LEW. 1C LEW.1C LEW. 1 D LEW.ID LEW. 1 F LEW. 1 K LEW. 1 N LEW.lW

a avl b c c d dvl f k n u

AVN DA BP AUG PVG BDV BDIX AS2 SHR BN WP

The PVG series PVG.RT1 a PVG.RT11 PVG.RT11 PVG.RT1 n PVG.RT1 ~ PVG.RT1 u

avl Iv1 I n o u

DA F344 LEW BN MR AO

The DA series DA.1D DA. 1 F DA.11 DA.1M DA.1N DA.10

d f i m n o

BDV AS2 BI MNR BN MR

The WKA series WKA.1A WKA.1A WKA. 1 B WKA.1B WKA.1C WKA. 1D WKA.1J WKA. 1 L WKA. 1 N WKA. 1 U

avl avl b b c dvl j / n u

ACI DA ALB BUF PVG BDIX LEJ LEW MAXX WF

Others AO.1P AUG.1N LOU.RT1 k W Hok. 1L W Hok. 1T W Hok. 1 U

p n k Iv1 t u

RP BN OKA F344 TO SDJ

Developed and maintained by

Initiated by P. Ivanyi, O. Stark and V. Kren in Prague, Czech Republic. Maintained and extended by O. Stark and V. Kren in Prague, Czech Republic and H. Hedrich, Hannover, Germany

Developed in part and maintained by G. Butcher, Cambridge, UK

H. Kunz and T. Gill, Pittsburgh, PA, USA

T. Natori, Sapporo, Japan

P. Nieuwenhuis and J. Rozing, Groningen, The Netherlands H. Kunz and T. Gill, Pittsburgh, PA, USA H. Bazin, Brussels, Belgium T. Natori, Sapporo, Japan

Contacts for further information on the above-mentioned congenic rat strains: H. Bazin, Experimental Immunology Unit, Faculty of Medicine, University of Louvain, Clos Chapelle aux Champs 30, 1200 Brussels, Belgium; G. Butcher, ARC Institute of Animal Physiology, Babraham, Cambridge, CB2 4AT, UK; H. Hedrich, Zentralinstitut fur VersuchtierKunde, Medische Hochschule Hannover, Postfach 610180, 30625-Hannover, Germany; V. Kren, Dept. Biology, 1st Medical Faculty, Charles University, Albertov 4, Praha 2, 12800, Czech Republic; H. Kunz and T. J. Gill III, Dept. Pathology, University of Pittsburgh, School of Medicine, Pittsburgh, PA 15261, USA; T. Natori, Dept. Pathology, Hokkaido University, School of Medicine, 060 Sapporo, Japan; P. Nieuwenhuis and J. Rozing, Dept. Histology and Cell Biology, University of Groningen, School of Medicine, Oostersingel 69/1, 9713 EZ Groningen, The Netherlands. More information on RT1 congenic rat strains can be found in Section 103 of Handbook of Experimental Immunology, 4th edition edited by D. M. Weir (Blackwell Scientific Publications, Oxford, UK), 1986.

Nonspecific Immunity Table V.12.6

183

Associations of RT1 with disease and/or immunological (dys)function

Disease/(dys)function

Strain

RT1

References

Spontaneous IDDM

DPBB

u

Thymectomy + repetitive low dose irradiation-induced IDDM Repetitive low dose streptozotocin-induced IDDM RT6-depletion-induced IDDM Adjuvant-induced arthritis Collagen-induced arthritis Acute EAE Relapsing EAE Spontaneous thyroiditis HgCI2-induced glomerulonephritis Spontaneous hypertension HY-(un)responsiveness Growth, reproduction, cancer resistance

PVG.RT1 u

u

Awata et al. (1995), Ellerman and Like (1995) Fowell et al. (1991 )

Lew, DA DRBB Lew, DA WF, DA Lew, DA BUF, WAG DPBB BN Lew.lWR2

I, a v l

u

I, a v l u, a v l I, a v l

b, u u n

WR2

a, n, (u)

grc-complex

Lukic et al. (1990) Greiner et al. (1987) Vingsbo et al. (1995) Griffiths et aL (1992) Mustafa et al. (1993) van Gelder et aL (1996) Awata et aL (1995) Aten et al. (1988, 1991) Kunes et al. (1996) Geginat et aL (1993) Gill (1996)

IDDM, insulin dependent diabetes mellitus. EAE, experimental autoimmune encephalomyelitis.

association with certain RT1 haplotypes (see Table V.12.6): The RT1 u haplotype is associated with collageninduced arthritis (Griffiths et al., 1992), relapsing experimental autoimmune encephalomyelitis (EAE) (van Gelder et al., 1996), and spontaneous thyroiditis (Awata et al., 1995). Furthermore, both the spontaneous form of insulin dependent diabetes mellitus (IDDM) (Awata et al., 1995; Ellerman and Like, 1995) and also the inducible models for IDDM using thymectomy and repetitive low-dose irradiation (Fowell et al., 1991) or RT6 depletion (Greiner et al., 1987) are uniquely associated with the RTI" haplotype. Conversely, the repetitive low-dose streptozotocininduced form of IDDM, is associated with the RT1 ~ haplotype (Lukic et al., 1990), as are adjuvant-induced arthritis (Vingsbo et al., 1995) and the acute model for EAE (Mustafa et al., 1993). These last autoimmune models are not only associated with the RT11 haplotype, but also with the RT1 avl haplotype. Severe HgC12-induced glomerulonephritis with proteinuria and linear glomerular autoantibody deposition appears to have a unique association with the RT1 n haplotype (Aten et al., 1988, 1991). However, one has to consider the fact that the RT1 n haplotype is always derived from the BN rat, implying that BN non-RT1 antigens may contribute to the susceptibility or severity of disease. The latter is suggested by the fact that the mild nonproteinuric form of glomerulonephritis observed in AO rats (RT1 ") is worsened when BN non-RT1 antigens are also present ((AOxBN)F1 and MAXX) (Aten et al., 1991). Rats with an RT1 n haplotype display strong HYresponsiveness, as do rats with the RT1 a haplotype, whereas RT1 u rats are HY-unresponsive (Geginat and G~inther, 1993). Finally, genes in the MHC, especially at the grc-locus, play an important role in the control of reproduction, growth and development, and cancer resistance (Gill, 1996).

Acknowledgments The authors express their gratitude to various authors that have gathered much of the information on RT1 used for this section in earlier publications and to Thomas J. Gill III in particular for his long-lasting contribution to this field and the provision of regular updates on the current knowledge on RT1.

13.

Nonspecific Immunity

Introduction Nonspecific immunity or innate immunity comprises defense mechanisms against pathogens that are not raised nor directed against a particular pathogen, but that exist before exposure to pathogens has occurred and that protect against a broad range of pathogens. Nonspecific immunity is not accompanied by the induction of immunological memory. Mechanical, biochemical and cellular barriers are encountered before pathogens invade a host and give rise to an immune response.

Skin and mucosa The intact epidermal and mucosal epithelia provide an important impediment for microbes to invade a potential host. An overview of the mechanical and biochemical barriers that microbes encounter are given in Table V.13.1. These epithelial cells and the glands associated with the epithelia produce secretions that contribute to this first line of defense. For example, bacteria bind to mucus in the respiratory tract and are thus removed by cilia of the

184


Table V.13.1 Natural barriers and mechanisms of defense Physical

Chemical

Microbiological

Epithelial cells of skin and mucosal surfaces Adherence of microbes to mucus, ciliar transport of mucus pH Enzymes: lysozyme, pepsin Antibacterial peptides: defensins, calprotectin complement Population of nonpathogenic, commensal flora

respiratory epithelium (Plotkowski et al., 1993). In the rat intestine the mucosal gel layer appeared to be protective against translocation of bacteria after an ischemia/ reoxygenation model (Maxson et al., 1994). The low pH of the stomach kills a wide variety of pathogens. In the upper respiratory tract and lung antimicrobial proteins are present, produced by epithelial cells and/or granulocytes and monocytes (van Iwaarden, 1992; van Golde, 1995). The colonization of pathogenic microbes is also impeded by the overgrowth of skin and epithelia by commensal, nonpathogenic microorganisms (Salminen et al., 1995). However, on certain sites of mucosal surfaces (e.g. where it is covered by M-cells) living microbes can easily enter the submucosal tissues. Bacterial products, such as endotoxin, can cause increased permeability to bacteria across ileal mucosal segments in rats (Go et al., 1995). Furthermore the integrity of skin and mucosa may be disrupted and wounds occur, allowing pathogens to enter the subepithelial tissues. In the subepithelial tissues, the pathogens encounter a second line of defense, the tissue macrophages. Inflammatory cells (PMNs, monocytes) are recruited upon epithelial damage by the production of chemokines (e.g. IL-8) by epithelial cells (Jung et al., 1995). In addition to these mechanisms to remove the microbes, processes are initiated to promote, in case of disrupted integrity of the epithelial layer, the repair of the epithelial integrity: wound healing. In the process of wound healing macrophages and cytokines (e.g. TGF-#; Shah et al., 1992) play an important role. Local GM-CSF application promotes wound healing in rats (Jyung et al., 1994). Once the pathogens have entered disrupted epithelia, adaptive immune responses are initiated by dendritic cells carrying immunogenic epitopes of the pathogens via the afferent lymph to the draining lymph node.

M a c r o p h a g e s and granulocytes

Different cell types of the immune system contribute to the innate immunity. In addition, soluble factors produced by cells of the immune system are important for the destruction of pathogens (e.g. complement). Macrophages and

granulocytes are major cell types contributing to nonspecific immunity. Eosinophils, mast cells and NK cells are beyond the scope of this section. Monocytes and granulocytes (neutrophils) originate from a common myelomonocytic precursor in the bone marrow under the influence of growth factors such as GMCSF, G-CSF and M-CSF. In addition to the myelomonocytic precursors (myeloblast, monoblast, promonocyte) mature granulocytes and macrophages are also present in the bone marrow cavity. Two types of resident macrophages are typical for the bone marrow: the osteoclasts along the bony surfaces (Sminia et al., 1986) and macrophages in the center of erythroblastic islets (Barb~ et al., 1996). Rat bone marrow can easily be obtained from the femoral medulla for histology since there are no cancellous spicules and thus there is no need for decalcification (Barb~ et al., 1997). Cell suspensions are prepared by flushing out the marrow from the femoral medulla after cutting of both ends with a pair of scissors. After maturation monocytes and granulocytes leave the bone marrow to enter the peripheral blood stream. In rats, monocytes comprise about 10% of the white blood cell count and neutrophils 20-25% (Valli et al., 1983). Scriba et al. (1996) have described a useful method to obtain 90% pure monocytes from rats, and their yield is very high: 3040 x 106 per adult (350 g) Lewis rat. Monocytes can leave the blood stream and enter the tissues and organs of the body to become tissue macrophages. Different organs and tissues have their own characteristic type(s) of macrophages (listed in Table V.13.2) (Dijkstra and Damoiseaux, 1993). Tissue macrophages exert different functions depending on their site of residence.

Local inflammation

When an infectious organism or inflammatory agent crosses the epithelial barrier and enters the tissue it is initially recognized and phagocytosed by resident macrophages. As a consequence of phagocytosis, the macrophage secretes a number of inflammatory mediators that initiate and regulate changes in vascular permeability, production of other inflammatory mediators and cytokines, increased expression of vascular adhesion molecules and, consequently, mediate the recruitment of granulocytes and monocytes from the circulation. In concert, these processes contribute to an effective elimination of the infectious agent. For the rat a variety of models have been used to study local inflammation in vivo and components of this process in vitro. The peritoneal cavity is often used in the rat as a site for administration of an inflammatory stimulus (e.g. thioglycolate). Although perhaps not representative for a local infection in the connective tissue of e.g. the skin, this method is very convenient for harvesting and analysis of infiltrated cells.

Nonspecific Immunity Table V.13.2

185

Phenotype of monocyte/macrophage populations with tissue-specific functions ED 1

ED2

ED3

CR3

MHCll

Bone marrow

Monoblasts/promonocytes Nurse cells Osteoclasts Blood

Monocytes Lung

Alveolar macrophages Interstitial macrophages Peribroncheal DC Liver

Kupffer cells Peritoneal cavity

Resident macrophages Exudate macrophages Spleen

Red pulp macrophages White pulp macrophages Marginal metallophils Marginal zone macrophages Interdigitating cells

+ +

Damoiseaux et aL (1989a), Keller et aL (1989) Barb6 et al. (1996) Smina et aL (1986a)

+

+ + + +

Reference

Damoiseaux et al. (1989a) Dijkstra et al. (1985) Dijkstra et al. (1985) Holt et al. (1987)

+ +

+

Dijkstra et al. (1985)

+ +

+/-

Beelen et aL (1987) Beelen et al. (1987)

+ + + + +

+ +

Dijkstra et al. Dijkstra et al. Dijkstra et al. Dijkstra et al. Dijkstra et aL et al. (1989b)

-I-

Lymph node

-I-

(1985) (1985) (1985) (1985) (1985), Damoiseaux

Subsinusoidal macrophages

+

Medullary macrophages

+

+/-

+

+


+

+


+ +

+ +

Robinson et aL (1986) Hickey and Kimura (1988) Hickey and Kimura (1988)

+ +

+

Connective tissue

Resident macrophages (histiocytes) Joints

Synovial lining cells

+

+

+

Dijkstra et aL (1985), Damoiseaux et al. (1989b) Dijkstra et aL (1985), Damoiseaux et al. (1989b)

Brain

Microglial cells Meningeal macrophages Perivascular macrophages Thymus

Cortical macrophages Medullary macrophages

Recognition of microorganisms and their components In order to recognize microorganisms or their components, macrophages express a number of different receptors that can mediate binding and phagocytosis. These include the mannose receptor, scavenger receptors, receptors for lipopolysaccharide (CD14), Fc receptors, and complement receptors. The mannose receptor is a member of the C-type lectin family that recognizes mannose, a carbohydrate that is highly exposed on the surface of many microorganisms

Sminia et al. (1986b) Sminia et aL (1986b)

(reviewed by Drickamer et al., 1993). For the rat, the mannose receptor can be demonstrated using mannose conjugates (Chroneos et al., 1995). It is expressed selectively by subpopulations of macrophages and is not present on monocytes. A closely related molecule, the mannose-binding protein (MBP) in plasma has been studied in detail in the rat (Weis et al., 1992; Ng et al., 1996). A different class of receptors involved in phagocytosis by macrophages are the scavenger receptors. The molecular properties of these receptors, which recognize a relatively broad range of substances, have been characterized in detail in the mouse and human systems (reviewed

186

by Krieger et al., 1994). The expression of scavenger receptors on rat macrophages has been demonstrated using standard ligands (e.g. acetylated/oxidized LDL) (Miyazaki et al., 1993). CD14 is a phosphoinositol-linked molecule expressed by monocytes, macrophages and granulocytes (reviewed by Ulevitch et al., 1995). CD14 functions as a receptor for the complex of lipopolysaccharide (LPS) and the plasma protein LPS-binding protein (LBP). Although other macrophage receptors have also been shown to bind LPS, CD14 is considered to be primarily responsible for the LPS-induced signalling that leads to the production of nitric oxide, TNF-~, IL-1 and IL-6. Although most information on the structure and function of CD14 comes from studies on the human molecule, a cDNA clone encoding rat CD14 has been reported (Galea et al., 1996), and rat macrophages respond to LPS in a way that is suggestive of CD14-mediated signalling (Stadler et al., 1993; Broug-Holub et al., 1995). Another class of receptors involved in phagocytosis are the Fc receptors. Fc receptors probably only play a significant role in phagocytosis by macrophages during the later stages of inflammation, when specific antibodies have been formed. A number of different Fc receptors with different binding affinities for different immunoglobulin classes and isotypes have been described in detail in humans (van de Winkel et al., 1993). Rat macrophages have also been demonstrated to express Fc receptors, but these have not been characterized as extensively as in human or mouse (Chao et al., 1989; Prokhorova et al., 1994). Members of the fi2-integrins, CR3 (also called MAC-1 or ~Mfl2) and p150/95 (~xfl2), function as receptors for the C3bi-fragment of complement on monocytes, macrophages and granulocytes. These receptors also interact with several other ligands, including the cellular adhesion receptor ICAM-1, which is expressed by e.g. inflammatory endothelial cells. In the rat CR3 (recognized by the mAb ED7, ED8 and OX42), and probably also p150/95, mediate the binding and ingestion of C3bi-coated particles by macrophages (Robinson et al., 1986). Anti-CR3 administration in vivo has also been shown to prevent the inflammation and clinical signs in autoimmune experimental allergic encephalomyelitis (EAE) in rats (Huitinga et al., 1993). In addition to integrins, rat Kupffer cells express a nonintegrin that appears to function as a complement receptor (Maruiwa et al., 1993).

Production of inflammatory mediators and cytokines In response to an inflammatory stimulus a number of factors can be secreted by local macrophages and other cells, that mediate the inflammatory response and its local symptoms (e.g. redness, swelling, pain, heat) as well as the systemic consequences. These factors include small inflammatory mediators, cytokines and chemokines. As for most (if not all) species, small inflammatory mediators in the rat


include eicosanoids, vasoactive peptides, reactive oxygen species (ROS) and nitric oxide (NO). Eicosanoids, which can be released by macrophages and (in the case of trauma) by platelets, cause vasodilatation and increased vascular permeability, and function as chemoattractants for phagocyticcells. Important vasoactive peptides include serotonin, histamin (both released e.g. by mast cells) and the potent platelet-activating factor (PAF) produced by macrophages. ROS are produced by macrophages and granulocytes and have important antimicrobial and tissue-destructive activity. Their action in vivo can be inhibited by injection of scavenger-enzymes (Ruuls et al., 1995). Macrophages can also produce NO radicals, which, in addition to their cytotoxic effects, have strong immunomodulatory effects; NO synthetase inhibitors have been used to study this in the rat in vivo (Ruuls et al., 1996). Activated tissue macrophages and (after infiltration into the inflamed site) monocytes are the most prominent source of the cytokines TNF-~, IL-1 and IL-6. From these TNF-0~ and IL-1 are released soon after stimulation and act on many other cells (both locally and systemically) by binding to specific surface receptors. Their effects include the stimulation of eicosanoid release by various cells, increased expression of adhesion receptors on endothelial cells, and the secretion of a special set of cytokines, called the chemokines, which orchestrate the infiltration of granulocytes and monocytes into the inflamed tissue (Schall, 1991). IL-6 is produced relatively late after macrophage activation and has profound systemic effects, which include the induction of fever and the acute phase response in the liver (see below). The production of TNF-~, IL-1, IL-6, and NO in response to stimuli such as LPS has been demonstrated for different rat macrophage populations (Stadler et al., 1993; Broug-Holub et al., 1995; van der Laan et al., 1996). Many of these cytokines (including TNF-0~, IL-1, IL-6; Nishida et al., 1989; Northemann et al., 1989) and their receptors (Baumann et al., 1990; Himmler et al., 1990) have now been cloned and recombinant proteins are available. A number of rat chemokines have also now been identified and their chemotactic potential been investigated (Nakagawa et al., 1996; Schmal et al., 1996).

Infiltration of inflammatory cells The recruitment of leukocytes (predominantly neutrophils and monocytes) from the circulation is a crucial step in the host defence against infection. In general, the accumulation of granulocytes into inflamed sites is most notable early (1-6 h), whereas mononuclear cell infiltration is typically evident in a delayed time frame (24-48 h). Such kinetics are also seen in the rat peritoneal cavity after injection of an inflammatory stimulus (Beelen et al., 1983). The immigration of cells involves attachment to the endothelium of the vessel wall and subsequent transmigration. The initial adhesion of leukocytes to the endothe-

Components of the Mucosal Immune System

lium, a process known as 'rolling', is mediated by adhesion receptors of the selectin-family, whereas the firm attachment to the vessel wall is mediated by molecules such as intercellular adhesion molecule-1 (ICAM-I) and vascular cell adhesion molecule-1 (VCAM-1) on endothelial cells and their integrin ligands on leukocytes. In the mesenteric venules of rat peritoneum the processes of rolling and firm attachment can be followed (Norman et al., 1995), and evidence for the role of many of these adhesion molecules has been obtained now (Misugi et al., 1995; Issekutz et al., 1996). Local cytokines (TNF-~, IL-1) and LPS contribute to the efficiency of the process by inducing/enhancing the expression of adhesion receptors (E-selectin, ICAM-1, VCAM-1) on the endothelium, while chemokines, eicosanoids, vasoactive peptides and chemotactic complement fragments (e.g. C3a) can further contribute to the recruitment of cells to the inflammatory site.

187 Table V,13.3

TYPE 1 (IL-6 or IL- 1/TNF-~)

TYPE 2 (IL-6)

~-Acid glycoprotein C-reactive protein Complement C3 Complement factor B Haptoglobin Hemopexin Serum amyloid A protein Serum amyloid P

1-Antichymotrypsin 1-Proteinase inhibitor c~2-Macroglobulin Ceruloplasmin Cysteine proteinase inhibitor Fibrinogen

relatively high (10-100-fold) induction of ~2-macroglobulin and cysteine protease inhibitor (Schreiber et al., 1989).

14, S y s t e m i c effects of i n f l a m m a t i o n

In addition to their local affects the cytokines TNF-~, IL-1 and IL-6 released from the site of inflammation can also have dramatic systemic effects. They act on the hypothalamus to modulate body temperature and cause fever (Dinarello, 1988; Navarra et al., 1992). IL-1 and IL-6 also act on the hypothalamus to increase corticotropin releasing hormone levels (Berkenbosch et al., 1987; Navarra et al., 1991), and they subsequently affect the pituitary gland to induce ACTH (Naitoh et al., 1988), which in turn increases glucocorticoid (in the rat, mainly corticosterone) production by the adrenal gland (Tilders et al., 1994). This hypothalamic-pituitary-adrenal (HPA) axis has been well characterized in the rat and its activity varies considerably among different rat strains (Sternberg et al., 1989, 1990). Another major target of these cytokines is the liver, where they modulate the production of a set of plasma proteins, called acute-phase proteins (APPs), by hepatocytes. APPs whose production is down-regulated include albumin and transferrin. The particular set of APPs that is upregulated varies among species. In the rat, where assays for analyzing many APPs are available (Ikawa et al., 1990), a typical acute-phase response can be induced by systemic administration of LPS, or local administration of Freund's complete adjuvant or turpentine (Geisterfer et al., 1993). The effect can be mimicked by cytokine administration in vivo (Kampschmidt et al., 1986; Geiger et al., 1988) and an optimal response requires glucocorticoids (Baumann et al., 1990). Various rat hepatocyte culture systems have been developed to study the regulation of APP and these have confirmed that some APPs (type 1) can be induced by either IL-6 or IL-1/TNF-~, whereas others (type 2) are regulated exclusively by IL-6 (and 'IL-6-1ike' cytokines oncostatin M, leukemia-inhibitory factor, and IL-11) (Schreiber et al., 1989; Baumann et al., 1991, 1993). The typical APP in the rat are listed in Table V.13.3. Particular features of the rat acute phase response include the

Rat acute-phase proteins


Introduction

At several sites in the mucosal lining organized accumulations of lymphocytes and macrophages are present directly beneath the epithelium. Together with solitary lymphoid nodules, these accumulations are the components of the mucosa-associated lymphoid tissue (MALT). The structure and development of lymphoid tissue at three separate mucosal sites have been studied in rodents: (1) the gutassociated lymphoid tissue (GALT); (2) the bronchusassociated lymphoid tissue (BALT); and (3) the nasalassociated lymphoid tissue (NALT) (Table V.14.1). The NALT is the component of MALT in the upper respiratory tract. Organized lymphoid tissue in the mucosa of the nasal cavity is present in rats on both sides of the entrance of the pharyngeal duct, closely associated with the respiratory epithelium (Spit et al., 1989). NALT in rats Table V.14.1 Characteristics of PP (GALT), NALT and BALT in Wistar rats (modified from Kuper et aL, 1992) Peyers patches (GALT)

NAL T

BAL T

Ontogeny Presence of tissue First lymphocytes Distinct T and B areas

Before birth At birth Day 4 T cells T cells B cells At day 10 At day 10 > day 21

Adult tissue Germinal centers Follicular dendritic cells Intraepithelial lymphocytes T/B ratio CD4/CD8 ratio Surface IgA+ B cells

++ + ++ 0.2 5.0 ++

+ _

4-

+ m

m

4-4-

+

0.9 2.4 +

0.7 2.6 +


188

is composed of a loose reticular network with lymphocytes and macrophages, covered by epithelium. The epithelium is infiltrated with B cells, CD4 + and CD8 + lymphocytes, and ED1 + macrophages. The B cells are IgM + or IgG + surface IgA or IgE is rare in the rat NALT (Kuper et al., 1989). NALT is present at birth as a small accumulation of mainly T lymphocytes in a meshwork of reticulum cells; distinct areas of T and B cells appear at 10 days after birth (Hameleers et al., 1989; van Poppel et al., 1993). Although it has been suggested that the NALT plays a role in the uptake and response to inhaled antigens, because it contains M cells (Spit et al., 1989), the response to intranasally applied nonviable, nonreplicating artificial antigens (i.e., TNP-KLH, TNP-LPS) is restricted to the lymph nodes of the upper respiratory tract (Hameleers et al., 1991). Conversely, inoculation with live bacteria may induce specific antibody production in the rat NALT. The lower respiratory tract in rat contains distinct units of mucosa-associated lymphoid tissue, defined as BALT (Bienenstock et al., 1973; Sminia et al., 1989). BALT is present primarily at sites between an artery and bronchus epithelium. The appearance of BALT is antigen-driven, as BALT in rat is detectable fom day 4 after birth (Plesch et al., 1983). Rats that are kept under routine laboratory conditions and rats that are kept under specific-pathogenfree (SPF) circumstances have BALT. However, the presence of BALT also varies with species, as mice that are kept conventionally usually have BALT, whereas SPF mice often have none (van Rees et al., 1996). However, the microbial status does not alter or increase the expression of class II MHC molecules or the distribution of macrophages in rat respiratory organs (Steiniger and Sickel, 1992). In rat BALT, T and B cell areas are present from 4 weeks after birth (Plesch et al., 1983), but do not have a distinct location (van der Brugge Gamelkoorn and Sminia, 1985). Among the epithelial cells covering BALT, cells bearing microfolds are present, which resemble the microfold cells (M cells) in the Peyer's patch (PP) epithelium. These cells play a pivotal role in the uptake of antigens. Intratracheal administration of antigen leads to a BALT-confined plasmacellular reaction (van der Brugge-Gamelkoorn et al., 1986). The GALT is composed of PPs, solitary follicles, lymphocytes in the lamina propria and epithelium, proximal colonic tissue (PCLT) and appendix. NALT and mesenteric lymph nodes are often also included in GALT. PPs are located in the small intestine. Each PP can be divided into three regions on both anatomical and functional bases. First, the dome that has a unique lymphoepithelium in which M-cells occur; second, the follicles or B-cell zones with prominent germinal centers; and third, the parafollicular region or T-cell dependent area. The germinal centers of PPs contain many B cells with surface IgA. PPs are important IgA-inductive sites. During ontogeny, on day 20 of gestation in rats, the gut wall has distinct spots in which villi are absent and a dome-shaped epithelium with

cuboidal epithelial cells becomes prominent, which is indicative of a developing PP (Wilders et al., 1983; van Rees et aI., 1988). Lymphoid cell aggregates are also found along the large intestine. An organized lymphoepithelial structure located at 25% of the distance from the caecum to the rectum has been termed PCLT in rat and mouse colon (Perry and Sharp, 1988; Crouse et al., 1989; De Boer et al., 1992). The general structure of these organized lymphoid tissues is comparable with PPs, and no evident phenotypical differences were found between the lymphocyte populations of PCLT and either jejunal or ileal PP (De Boer et al., 1992). Although some differences in functional aspects have been described (Perry and Sharp, 1991), PCLT in the rat appears to be a PP-like structure with some unusual features, rather than a bursa equivalent (De Boer et al., 1992).

Transport of antigens M cells play a pivotal role in transport of antigens over the epithelial layer. Although they represent a very small minority in the epithelium, M cells play a primary role in transport of antigens to the inductive arm of the mucosal immune system. Their functional significance is a consequence of their p o s i t i o n - within the epithelium covering the PP and therefore in close vicinity of lymphocytes and antigen-presenting cells. Intact liposomes are endocytosed by M cells (Childers et al., 1990). It is not known yet if specific receptors exist on the surface of M cells to facilitate the transport of macromolecules across the epithelium. It is generally believed that M cells do not modify the antigens they transport from the intestinal lumen. However, M cells from rat jejunal PP express MHC Class II determinants (Jarry et al., 1989; Allan et al., 1993) indicating that they have some capacity to present endocytosed antigens directly to lymphocytes (Allan et al., 1993). Epithelial cells that are not M cells also play a role in the uptake of antigen in the rat gut. Soluble antigen is taken up primarily through the villi outside PPs and can be traced into the lamina propria whereas particles are taken up by M cells and can be found in PPs (Sminia et al., 1991). Epithelial cells of the normal small intestine express MHC class II molecules. In adult rat jejunum class II MHC molecules have been detected in association with intracellular organelles (Mayrhofer and Spargo, 1990). Isolated enterocytes from rat small intestine can present antigen to primed T cells (Bland and Warren, 1986). However, the rate of antigen uptake through M cells varies depending on the species. Uptake via M cells in rabbits appears to be more efficient than in rat or mice (Sminia et al., 1991). It has been suggested that uptake of antigens via enterocytes is more likely to induce tolerance whereas uptake via M cells may induce specific immune responses (Biewenga et al., 1993). In support of this hypothesis, antigen presentation by enterocytes in vitro results in


CD8 stimulation rather than CD4 + proliferation (Mayer and Shlien, 1987).

Production and transport of mucosal Igs Essential components of a secretory immune system are a secretory immunoglobulin isotype (IgA or IgM) and a receptor-transporter system to facilitate transport of the IgA across the epithelium into the gut lumen or into secretions such as milk. Dimeric IgA with J chain binds to the polymeric Ig receptor (plgR) on the internal surface of the epithelial cells and is released at the luminal surface, together with secretory component (SC), derived by cleavage of the plgR. SC has been identified in rat (Vaerman and Lemaitre-Coelho, 1979; Acosta-Altamirano et al., 1980). Secretory (slgA) antibodies inhibit microbial adherence and prevent absorption of antigens from mucosal surfaces (McGhee and Mestecky, 1990). Other functions of IgA, also aimed at exclusion of pathogenic antigens, are to neutralize intracellular microbial pathogens directly within the epithelial cells, and to bind antigens in the lamina propria and excrete them through the adjacent epithelium into the lumen of the gut (Mazanec et al., 1993). After being taken up by the gut, antigen is being processed by macrophages (predominantly in the PPs) and presented to T-helper cells, leading to the activation of B cells in the PPs. The first step in IgA B-cell differentiation is an IgA-directed switch of slgM + B cells, derived from the bone marrow. The committed B cells subsequently migrate to the mesenteric lymph nodes, and enter the blood circulation via the thoracic duct. In the spleen the B cells may differentiate further, and migrate into the gut lamina propria to develop into mature IgA-producing cells. Cytokines play a central role in the generation of IgA responses. First, cytokines influence the isotype to switch to IgA, and second cytokines induce slgA + B cells to differentiate into IgA plasma cells. TGF-fi, IL-4 and IL-5 have a significant influence in this process (reviewed by Strober and Ehrhardt, 1994). In mice, B-1 cells have been described that may play an important role in mucosal IgA responses (Kroese et al., 1994). However, it is not clear whether a population with similar characteristics is present in the rat (Vermeer et al., 1994).

Passive immunity Passive transfer of immunity from mother to offspring occurs prenatally through placenta or yolk sac, and postnatally via milk. Species differ in the contribution each route makes to the transfer of immunity (Waldman and Strober, 1969). Three groups can be determined based on these differences (using either the prenatal or postnatal transfer route only, or using both routes; Renegar and

189

Small, 1994). In rats, prenatal transmission occurs via the yolk sac/placenta and the fetal gut (Waldman and Strober, 1969). However, most transport of antibody occurs postnatally via colostrum and milk (Heiman and Weisman, 1989). There is evidence that milk-borne T cells can protect the rat neonate against infectious disease. T cells (OX-19 +) make up 45% of rat milk lymphocyte population. Within T cells, the ratio CD4 +/CD8 + is 1.03, whereas in lactating dams the corresponding ratio in peripheral blood is 2.8 (Na et al., 1992). Because the percentage of NK cells in milk from infected dams (65%) is higher than that from control milk (21%), it has been suggested that NK cells are selectively passaged into rat milk (Na et al., 1992). Baby rats, suckling on a mother immune to Trichinella spiralis are protected against challenge infection (Kumar et al., 1989). Weaning in rats take place at days 21 and 22 after birth, inducing activation of the mucosal immune system of the pup. Weaning leads to intestinal maturation, as assessed by villus area, crypt length, crypt-cell production rate and disaccharidase activity (Cummins et al., 1991).

Structure of the placenta In the rat, the hemochorial uteroplacental unit is comparable to that in mice. The following description of the general histology of the term placenta starts at the maternal side of the uteroplacentar unit. The ut6rus is composed of myometrium (smooth muscle), endometrium and a pregnancy-dependent zone, the metrial gland. This zone develops in the rodent myometrium during pregnancy. The decidua basalis consists of endometrium infiltrated by fetal trophoblast; it is drained exclusively by a maternal endothelial-lined venous system. In the fetal part of the placenta, trophoblast-lined maternal blood spaces (lacunae) are present. Adjacent to the decidua basalis, in the spongiotrophoblast, only maternal blood circulates through fetal trophoblast tissue. The part which is also perfused by fetal blood has been termed the labyrinth. The exchange of fetal and maternal products is controlled at this level. Finally, the chorioallantoic plate consists of nontrophoblastic fetal connective tissue transmitting fetal blood vessels into the labyrinth. To identify the different compartments in the rat placenta, demonstration of alkaline phosphatase activity by enzyme histochemistry is useful. Alkaline phosphatase activity is abundant in the labyrinth, is present to a lesser extent in the spongiotrophoblast and absent in other fetal layers and maternal tissue (van Oostveen et al., 1992). Gestation in the rat lasts for 21 days. Throughout gestation, maternal macrophages are present in large numbers in the myometrium, the endometrium and the metrial gland. In the labyrinth, macrophages are present at early stages and are probably of fetal origin. In the spongiotrophoblast and the decidua basalis, layers of the

190


placenta containing both maternal and fetal cells, only few macrophages are present. Throughout gestation very few B and T lymphocytes are present in the placenta and are restricted mostly to the maternal compartments (van Oostveen et al., 1992). The metrial gland contains a unique cell type, the granulated metrial gland cell (GMG) in large numbers (Bulmer, 1968; Peel et al., 1983). Because these cells are bone-marrow derived (Mitchell, 1983) and since more GMG cells are present in allogeneic than in syngeneic pregnancies (Kanbour-Shakir et al., 1990), an immunological function for GMG cells has been suggested (Kanbour-Shakir et al., 1990). The monoclonal antibody ED11, raised against rat reticulum cells (van den Berg, 1989) stained fibers lining the sinuses in the spongiotrophoblast. As in this compartment of the placenta maternal blood circulates through fetal tissue, and ED11 plays a role in trapping of immune complexes (van den Berg et al., 1991), the spongiotrophoblast may be important in protecting the fetus from circulating immune complexes (van Oostveen et al., 1992).

15.

The Complement System

Introduction

The complement system, together with antibodies and phagocytes, plays an essential role in our humoral

immune defence. By binding to specific complement receptors, complement is also able to activate various cell types such as leukocytes, endothelial cells, fibroblasts, renal cells and astrocytes. The mechanisms of activation of the complement system have been elucidated in recent years; almost all molecules playing a role in the complement cascade have been cloned and a start has been made in the generation of mice with specific deletions in genes for encoding complement molecules. In this section we describe the mechanisms of complement activation followed by a section about the complement system of the rat.

Mechanisms of c o m p l e m e n t activation

During the past 40 years, extensive research has led to detailed insight in the mechanisms of complement activation. Most complement components are present in the circulation or in other body fluids in a proenzymatic, nonactive form. Evidence, obtained mainly in the early seventies, suggests that the main organ responsible for the maintenance of circulating complement levels is the liver, but recent studies in rats, employing liver transplantation models, indicate that extrahepatic synthesis of complement may be responsible for about 25% of the levels of C6 and C2 (Brauer et al., 1994; Timmerman, 1996). To appreciate the full potential of biological activities of complement the system requires activation. There are two pathways which lead to activation of the central

AL TERNA T1VE PA THWA Y

. N~N

~

~. ~

;;.~'.~Z'

' ~ . ~':,~4

CLASSICAL P A T H W A Y

Figure V.15.1 Activation of C3, the third component of complement, may occur either via the classical or the alternative pathway, leading to the generation of activated C3 and further recruitment of the terminal sequence of complement C5-C9 and assembly of the membrane attack complex (MAC). During activation of the different pathways, different biological functions of complement are expressed, such as opsonization, chemotaxis and cytolysis.

The Complement System

component of complement C3 (Figure V.15.1). The classical pathway, initiated not only by immune complexes composed of IgM and IgG antibodies but also by substances such as lipopolysaccharides and DNA, leads to binding and activation of C1, the first component of complement, and to activation of its natural substrates C4 and C2. The complex of activated C4 (C4b) and C2 (C2b) has enzymatic activity and is able to convert C3 into C3b and C3a. Like C4b, C3b possesses a labile thioester which is able to covalently attach C4b and C3b to activating surfaces or to bystander molecules, tissue and cells. Generation of C3b is the first step leading to amplification of C3 cleavage, and finally results in deposition of multiple C3b molecules on bacteria and viruses, and enhanced recognition of substances by phagocytic cells via C3 receptors. The presence of multiple C3b molecules on the activator results in recruitment of the terminal complement components and activation of complement up to C9, resulting in the generation of the membrane attack complex (MAC). Initial cleavage of C3 to C3b may also occur independently of C1, C4 and C2 via the alternative pathway. It has been shown that Gram-negative bacteria, meningococci and polymeric IgA are especially efficient activators of the alternative pathway. Recently, a third pathway of complement activation was proposed (Lu et al., 1990), initiated via mannose-binding protein (MBP). It is thought that MBP functions like Clq, and is associated with uncleaved Clr and Cls in a complex, simular to Clq in C1. The MBP pathway merges into the classical pathway at the C4 and C2 level. The generation of MAC, with its strong cytolytic potential is perhaps the best known activity of complement, however, current opinion is that opsonization of foreign pathogens and the generation of anaphylactic and chemotactic fragments may be more relevant. For example, after the recently described chemotactic chemokines, such as monocyte chemoattractant protein-1 (MCP-1) and IL-8, C5a is known as one of the most potent chemotactic agents for neutrophils and monocytes. Moreover, fragments of C4, C3 and C5 are also directly involved in enhancement of local vascular permeability. Because complement activation is enzymatic in nature, regulation of this system is essential to prevent potential depletion of complement levels. Efficient control of classical pathway activation is achieved by C1-esterase inhibitor (Cl-Inh) and C4-binding protein (C4bp). Cl-Inh inactivates activated C1 and prevents further activation of C4 and C2 and, thereby, the formation of the classical C3 convertase. C4bp binds to C4b and prevents the formation of the C4b2a enzyme. C4bp also functions as a cofactor for the serine protease factor I in the further degradation of exposed C4b. Factor I not only degrades C4b in the classical pathway C3 convertase, but also inactivates C3b, together with factor H, preventing further amplification of C3 cleavage and generation of the MAC. Fluid-phase

191

inhibitors of the MAC are vitronectin and clusterin (SP40,40). Vitronectin, previously known as S-protein, binds to C5b-C9 and prevents its insertion in biomembranes. Clusterin influences MAC function in a similar way. As mentioned above, the complement components C4 and C3 possess a thioester which, upon activation, allows these components to bind covalently to neighbouring molecules, cells and tissue. Potentially, the activated C4b and C3b fragments function as a focus for further complement activation, which might lead to damage of host cells. To prevent this, a number of membrane-bound regulators of complement activation are present on homologous cells and tissue. Decay-accelerating factor (DAF, CD55), membrane cofactor protein (MCP, CD46) and complement receptor type I (CR1) share properties with the fluidphase regulators C4bp, factor H and factor I. The encoding genes are all located in the gene cluster for 'regulators of complement activation (RCA)' on chromosome 1 q (Seya, 1995). These membrane RCA are of great importance since it has been shown that deficiencies are associated with various types of illnesses such as paroxysmal nocturnal hemoglobulinuria (PNH) and vasculitic syndromes. In this sense the membrane-bound regulator of complement, homologous restriction factor (HRF, MIRL, CD59) is also of great importance because it controls the generation of MAC on homologous tissue. Soluble forms of most of these membrane regulators of complement have also been shown to inhibit complement in the fluid phase, making them prime candidates for exogenous administration in order to downregulate complement activation during disease. Soluble CRI (sCRI) has been shown to efficiently downregulate complement activation at the C3 level under various conditions in experimental models.

The complement system of the rat While detailed procedures for the isolation, purification and measurement of most human complement components have been reported, relatively few reports are available on the isolation of rat complement proteins. Complement components can be either measured with sensitive hemolytic assays or, when antibodies are available, with various immunological techniques such as ELISA, radioimmunoassay and immunodiffusion. Using sera deficient in a single complement component it is relatively easy to assess almost every complement component of the rat, except C2 (Leenaerts et al., 1994). Complement deficient sera in single components may be obtained from patients with specific complement deficiencies or from guinea pigs (C4, C2, C3), rabbits (C6) or rats (C6). It is also possible to prepare complement-deficient reagents using immunoabsorption with specific antibodies. The most difficult rat complement component to assess is C2, which is measured using intermediates of

192


sheep erythrocytes sensitized with antibody and human C4 (Brandt et al., 1996). Methods for the purification of a number of rat complement components such as C3, C4, B, H, C9 and Clq are available (Daha and van Es, 1979, 1980, 1982; Daha et al., 1979; Wing et al., 1993; Liu et al., 1995). Furthermore the availability of antibodies against these components provides us with the possibility of measuring both classical and alternative pathway activation in vivo at both the circulation and at the tissue level (Boyers et al., 1993). However, attention must be turned to purification of missing components. The availability of purified membrane regulators of rat complement is limited. CRYY/P65 and CD59, which regulate the classical and terminal sequence respectively, have been shown to be involved in complement activation at the tissue level (Quigg et al., 1995). In contrast to, for example, guinea pigs, complement deficiencies in rats are relatively rare. In 1974, a genetic deficiency of C4 was reported in Wistar rats, but since that time no further details have been published (Arroyave et al., 1979). Recently, we described a strain of PVG/c rats with a complete deficiency of C6 and a partial deficiency of C2 (Leenaerts et al., 1994). This rat strain now provides the opportunity to analyze the role of C5-C9 in a number of experimental diseases. The appropriate size of rats for microsurgery provides us with a powerful tool for further research in fields such as xenotransplantation. To be able to generate rats with specific complement deficiencies in the near future more effort is required in the purification and cloning of the remaining key components of the rat complement system.

16.

Models of Immunodeficiency in the Rat

Introduction

This section reviews a variety of natural immunodeficient rat strains (Table V.16.1), using a rather broad definition of the term 'immunodeficient'. It does not deal with the various inducible models in which by manipulation of the immune system either by depletion with antibodies, by treatment with immunosuppressive agents or irradiation, or through (a)specific tolerance induction a state of 'immunodeficiency' can be achieved in rats. The main focus will be on rat strains exhibiting a variety of levels of immunodeficiency, ranging from complete absence of certain immune functions and/or subsets to situations in which strong skewing of the regulatory branch of the immune system results in a certain degree of immunodeficiency, as evidenced by an increased risk of these animals to develop autoimmunity. The present state of the field of genetic manipulation in rats for the generation of new models of immunodeficiency is reviewed.

N u d e rats

The nude mutation first appeared in 1953 in a rat colony at the Rowett Research Institute, Aberdeen, Scotland. The mutation was lost, but reappeared in the same colony in the 1970s (Festing, 1978). The autosomal recessive muta-

Table V.16.1 Natural immunodeficient rat strains Strain

Mutation

Defect

Consequence (phenotype)

References

Nude rat

rnu

Thymic aplasia

Nude rat

rnu nz

Thymic aplasia

Loss of T-cell dependent immunity Loss of T-cell dependent immunity

DP-BB

lyp; ??

Virtual absence of RT6 positive T cells

Festing (1978), Hougen (1991), Schuurman (1992, 1995) Berridge (1979), Douglas-Jones (1981), Marshall and Miller (1981), Schuurman (1992) Chappel (1983), Mordes (1987), Crisa (1992)

LEC

thid

BN

??

Block in differentiation from CD4+CD8 § (DP) to CD4+CD8 - (SP) thymocytes TH2-skewed

Lewis

??

THl-skewed

Lack of immune regulatory functions: high incidence of autoimmunity (diabetes, thyroiditis) Virtual absence of peripheral CD4 § T cells and associated functions (note: not true for IEL) High sensitivity for (induced) Ab-mediated autoimmunity (e.g. HgCI2-induced glomerulonephritis) High sensitivity for cell mediated immunopathology, incl. (inducible) autoimmunity (e.g. EAE)

Agui (1990, 1991), Yamada (1991) Rozing (1979), Aten (1988)

Pat Happ (1988), Mustafa (1994)

Models of Immunodeficiency

tion is designated rnu and is linked with the myeloperoxidase locus in the rat (Murakumo, 1995). Approximately at the same time, another nude mutation was observed in a rat colony maintained at the Victoria University, Wellington, New Zealand, designated n z n u or rnu "z (Berridge, 1979; Douglas-Jones, 1981; Schuurman, 1992). The most obvious phenotypical characteristic of the nude rat is its hairlessness. The main immunological feature of the nude rat is the congenital aplasia of the thymus. Owing to the absence of this primary lymphoid organ nude rats are deficient for a wide variety of thymus-dependent cell mediated immune functions measured both in vitro and in v i v o (reviewed by Hougen, 1991; Schuurman, 1992, 1995). Nude rats have been widely used for a variety of experiments, including studies on human tumor growth and treatment, xenotransplantation, extrathymic T-cell differentiation, thymus or thymus-fragment implantation, infection, toxicology, and functional studies of transferred cells (reviewed by Hougen, 1991; Schuurman, 1992, 1995). The original rnu mutation has been backcrossed to a number of strains and is commercially available from a number of breeders.

193

LEC rat

The LEC mutant rat displays a maturational arrest in the development of CD4 +CD8 + double positive (DP) into CD4 + single positive (SP), but not into CD8 + SP thymocytes (Agui, 1990, 1991). This maturation arrest is caused by a single resessive gene system defined as t h i d (T-helper immunodeficiency) (Yamada, 1991). This mutation is present in bone marrow-derived cells, but not in thymic stromal cells in the LEC rat (Agui, 1991). The maturational defect in the thymus results in a significant reduction of the number of peripheral CD4 + T cells. CD4 + T cells, however, are not completely absent, but show functional abnormalities (Sakai, 1995): they are incapable of IL-2 production upon Con A stimulation. The intrathymic maturational defect in LEC rats appears not to influence the development of CD4 + intra-epithelial lymphocytes (IEL), since normal numbers of both CD4 +CD8 + and CD4 + C D 8 - IEL can be found in LEC rats (Sakai, 1994). The LEC mutant strain is a Long Evans substrain and is kept at the Institute for Animal Experimentation, University of Tokushima, Japafi.

BN rat DP-BB rat

The BB rat was discovered in 1974 in a commercial colony of Wistar-derived rats at the Bio-Breeding Laboratories, Ottawa, Canada (Chappel, 1983). The DP-BB (Diabetes Prone) substrain develops spontaneously diabetes at high frequency between 60 and 120 days old (reviewed by Mordes, 1987; Crisa, 1992). All BB rats are descendants of the original Ottawa litters (Prins, 1991), but BB rats in various colonies vary with respect to frequency and severity of diabetes (Mordes, 1987). BB rats develop also thyroiditis spontaneously at a high frequency (Mordes, 1987; Crisa, 1992). DP-BB rats are severely lymphopenic (Crisa, 1992). They lack RT6 + T cells (Crisa, 1992). RT6 is expressed on 60-80% of peripheral T cells, both on CD4 + and CD8 + T cells (Greiner, 1987). RT6 + cells have been shown to have immunoregulatory properties (Greiner, 1987). Elimination of RT6 + cells using monoclonal antibody treatment in young nonlymphopenic nondiabetic DR-BB (Diabetes Resistant) rats (Greiner, 1987) turns such rats into diabetic animals, thereby highlighting the protective immunoregulatory role of the RT6 + T cells. The linkage between lymphopenia and the development of diabetes in DP-BB rats is nevertheless not an absolute one, since Like et al. (1986) have developed a line of BB rats that are nonlymphopenic, have normal numbers of T cells, but still are diabetic- the 'nonlymphopenic diabetic' (NLD) Wor-BB rats. The principal international resource colony of BB rats is presently kept at the University of Massachusetts Medical Center, Worcester, USA, under the aegis of the National Institutes of Health (NIH).

Brown Norway (BN) rats have generally been considered as poor immunological responders in various in v i v o and in vitro assays (Rozing, 1979). Moreover, BN rats are highly susceptible for the induction of autoimmune glomerulonephritis with a short course of HgC12 (Aten, 1988). Using phenotypical analysis with antibodies allowing a TH1/TH2-1ike distinction (Groen, 1993)in combination with cytokine profiling, it was recently shown that the CD4 + T-cell system of BN rats is skewed towards the (predominantly IL-4, IL-6 and IL-10 mediated) TH2-type (Mathieson, 1992). This TH2-type responsiveness might well explain the low responsiveness of BN rats in certain (IL-2 dependent) assay systems (Rozing, 1979), and the high sensitivity for antibody-mediated forms of autoimmunity (Aten, 1988). The 'immunodeficiency' of the BN rat is thereby merely a reflection of an unbalanced T helper system. BN rats are available from a number of commercial breeders.

Lewis rat

In contrast to BN rats Lewis rats have strong cellular immune responses (Rozing, 1979). Lewis rats, however, are skewed to THl-type cellular responses (predominantly IL-2 and IFN- 7 mediated responses) (Groen, 1993; Beijleveld, 1996). This preferential THl-response profile Lewis rats might well be involved in the high susceptibility of Lewis rats to cell-mediated immunopathology and TH1mediated inducible autoimmunity such as experimental autoimmune encephalomyelitis (EAE) (Pat Happ, 1988;

194


Mustafa, 1994). As for the BN rat, the 'immunodeficiency' of the Lewis rat is then a reflection of an unbalanced T helper system. Lewis rats are available from a number of commercial breeders.

SCID rat During backcrossing of the RP MHC locus on the Albino Oxford (AO) background at the University of Groningen, The Netherlands, a spontaneous mutation occurred with great resemblance to the SCID phenotype found in mice (defective in both the B- and T-cell system). During subsequent mating this mutation was lost. No other SCID-like rats have been reported to date.

Virus-induced/acquired immunodeficiency in the rat Although a broad spectrum of viral infections has been described in the rat, with both suppressive and stimulatory effects on the immune system of the infected animal, no virus with properties comparable with human immunodeficiency virus (HIV), resulting in a severe acquired immunodeficiency syndrome, has been described in rats to date.

Gene-targeted genetic manipulation in rats Transgenesis in the rat is now a well-established procedure for a number of specialized labs (Mullins, 1993). This technology obviously will also enable the generation of new immunodeficient rat models by silencing genes,

through homologous recombination, that code for immunologically important proteins, as has been successfully applied in a wide variety of mouse genes in knock-out (KO) mice. In order to do so, however, in vitro-growing embryonic stem (ES) cells are essential for this procedure; at present rat ES-cells are not available. At the 11th International Workshop on Alloantigenic Systems in the Rat (Toulouse, France, 1996) preliminary data on the pluripotency of isolated rat ES cells were reported by P. M. Iannaccone and colleagues (Northwestern University Medical School, Chicago, USA). The development of a new generation of immunodeficient KO rats can therefore be expected in the nearby future. Another genetic approach for creating functional knock-out animals using antisense RNA transgenesis technology has already been applied succesfully in the rat (Matsumoto, 1995).

17.

Autoimmunity

Overview The rat has been used historically as an animal model for studies of drug toxicity, transplantation, immune reactivity, tumor biology, genetic analysis and autoimmunity. The many forms of autoimmunity that have been studied in rats can be divided into three general categories: (1) spontaneous, (2) induced, and (3) transgenic. The induced models of autoimmunity have been developed using a variety of methods, including immune manipulation, immunization (Table V.17.1), chemical administration, diet manipulation or infection. The most intensively studied autoimmune disorder in the rat is the sponta-

Table V.17.1 Immunization-induced autoimmune diseases in the rat Autoimmune syndrome

Abbreviation

Immunizing antigen

Model of human disease

Adjuvant arthritis

AA

Rheumatoid arthritis

Collagen-induced arthritis Dementia Encephalomyelitis Glomerulonephritis Hepatitis Myasthenia gravis Myocarditis Nephritis Neuritis Orchitis Pinealitis

CIA EAD EAE GN EAH EAMG EAM HN EAN EAO EAP

Sialadenitis Thyroiditis Uveoretinitis

EAS EAT EAU

Incomplete Freund's adjuvant + Mycobacterium tuberculosis H37Ra Collagen in CFA High molecular weight neurofilament protein Myelin basic protein, proteolipid protein Glomerular basement membrane Liver proteins Torpedo acetylcholine receptor, AChR Myosin Renal tubular antigen Peripheral nerve myelin Rat testicular antigen Interphotoreceptor retinoid-binding protein, retinal S-antigen Salivary glands Thyroglobulin Interphotoreceptor retinoid-binding protein, retinal S-antigen

Rheumatoid arthritis Dementia Multiple sclerosis Glomerulonephritis Autoimmune hepatitis Myasthenia gravis Autoimmune myocarditis Heymann's nephritis Guillain-Barre syndrome Autoimmune orchitis Unknown Sjogren's syndrome Hashimoto's thyroiditis Autoimmune uveitis

Autoimmunity

neously diabetic BB rat model of human autoimmune insulin-dependent diabetes mellitus (IDDM). This model has been the subject for over 1400 scientific reports since its discovery in the mid 1970s (Crisfi et al., 1992; Rossini et al., 1995; Mordes et al., 1996b). Another widely studied rat model of autoimmunity is the induced model of experimental autoimmune encephalomyelitis (EAE). EAE is an animal model for human multiple sclerosis, and is the standard model for investigation of antigen-specific induced autoimmune syndromes (Swanborg, 1988; Swanborg and Stepaniak, 1996). Many of the findings obtained by investigating rat models of autoimmunity, particularly by the analysis of IDDM and EAE in rats, have general applicability, and have been translated into clinical therapeutic modalities. It is these 'general principals' that have been translated to the human autoimmune diseases that they model.

Spontaneous models of autoimmunity

The diabetes-prone bio-breeding (DP-BB) rat The DP-BB rat spontaneously develops autoimmune insulin-dependent diabetes and thyroiditis (Cris~i et al., 1992; Rossini et al., 1995; Mordes et al., 1996b). The DPBB rat was derived from a colony of outbred Wistar rats at the Bio-Breeding Laboratories (Ottawa, Canada) that were observed to spontaneously develop hyperglycemia and ketoacidosis. Affected animals at the sixth generation were used as founders of the inbred strains that are currently maintained in an international resource colony at the University of Massachusetts at Worcester which is sponsored by the National Institutes of Health (NIH). Greater than 90% of both sexes of DP-BB rats develop hyperglycemia between 50 and 90 days old which is associated with infiltration of the islets of Langerhans (insulitis) and selective destruction of the insulin-producing beta cells .(Crisfi et al., 1992; Rossini et al., 1995; Mordes et al., 1996b). This is followed by the appearance of 'end stage' islets that are small, distorted, and lack fl cells. Without exogenous insulin treatment, ketoacidosis ensues, followed rapidly by severe dehydration and death within a few days of the onset of hyperglycemia. Depending on the subline of DP-BB rats, the incidence of thyroiditis varies between 5 and 60% at 110 days old (Crisfi et al., 1992; Rossini et al., 1995; Mordes et al., 1996). The incidence of thyroiditis increases in older animals, but does not result in clinical symptoms of thyroid deficiency. Several lines of evidence support the autoimmune nature of diabetes and thyroiditis disease in the DP-BB rat. First, there is a selective inflammatory infiltrate of the islets and thyroids. Second, autoantibodies to islet and thyroid antigens are detected in the circulation. Third, the disease can be adoptively transferred by bone marrow cells, T cells, and T cell lines. Fourth, both diabetes and

195 thyroiditis can be prevented by immunosuppressive treatments such as neonatal thymectomy or treatment with immunosuppressive drugs. Finally, the disease can be prevented by adoptive transfer of T lymphocytes obtained from normal, disease-free, histocompatible strains of rats into DP-BB rats (Crisfi et al., 1992; Rossini et al., 1995; Mordes et al., 1996b). A unique immunological feature of the DP-BB rat that is not observed in humans with IDDM is a severe deficiency of mature T cells, predominately CD8 + and RT6 + T lymphocytes. CD8 + is expressed on a subset of T cells that mediate cytotoxic effector T cell function. RT6 is expressed on ~50% of CD4 + (helper/inducer) T cells and ~80% of CD8 + T cells. The deficiency of RT6 + T cells in DP-BB has been found to be particularly important in the spontaneous development of the autoimmune disorders (Greiner et al., 1987). Studies of disease pathogenesis in the autoimmune DPBB strain of rats has been complemented by studies of its induction in the congenic diabetes-resistant (DR-BB) strain. At the sixth generation, progeny resistant to diabetes were also selected for breeding, and the resistant lines are currently housed in the NIH-sponsored colony and are completely free of spontaneous disease (Crisfi et al., 1992; Rossini et al., 1995; Mordes et al., 1996). However, the diabetes and thyroiditis can be induced by a variety of interventions, including infection with Kilham rat virus (KRV), low-dose irradiation or cyclosphosamide, and in vivo depletion of RT6 + T cells with an anti-RT6.1 cytotoxic monoclonal antibody (see below). The ability to induce disease in resistant DR-BB rats, and to prevent disease in susceptible DP-BB rats, led to the formulation of a 'balance hypothesis' of autoimmune IDDM (Mordes et al., 1987, 1996a, b), a paradigm that has since been extended to many autoimmune diseases (Mordes et al., 1996a, b). This general principal postulates that the expression of autoimmunity is a function of the relative balance between autoreactive R T 6 - effector T cells and RT6 + regulatory T cells. The availability of the RT6 alloantigen expressed on the 'regulatory' T cell population and its absence of expression on the 'effector' T cell population has allowed a clear distinction between these two interactive T cell populations and intense investigation of their respective roles in the expression of autoimmunity. BBZ/Wor rat model of obese autoimmune non-insulindependent diabetes The spontaneously diabetic DP-BB rat was crossed with the obese Zucker rat, and numerous lines derived from these crosses have been characterized (Guberski et al., 1988). Of particular interest are the obese diabetic line of BBZ/Wor rats. These rats develop a non-insulindependent diabetes associated with insulitis and substantial fl cell loss, but can survive for months without the need for administration of exogenous insulin. The presence of

196

insulitis suggests an autoimmune origin to this disorder. It was also discovered that the diabetes in the obese line of rats developed earlier than in the line of lean diabetic rats, suggesting that increased fi-cell activity may allow enhanced targeting/susceptibility of the fi cells to autoimmune destruction (Guberski et al., 1993). Further characterization of this obese model of autoimmune diabetes may allow a clearer understanding of the relationship between obesity, fl-cell metabolism, autoimmune insulitis and the genetic factors that are important in autoimmunity.

The female BUF rat model of spontaneous autoimmune thyroiditis The appearance of thyroiditis in older female BUF rats led to the hypothesis that this was a spontaneous model of autoimmune thyroiditis (Rose et al., 1976). This model was investigated intensely in the early 1970s, and the presence of inflammatory thyroid infiltrates, autoantibodies to thyroglobulin, and the provocation by neonatal thymectomy or treatment with methylcholanthrene, supported an autoimmune nature of its pathogenesis. However, upon rederivation of the BUF colony into viral antibody-free (VAF) status, where potentially immunomodulatory viruses and bacteria were eliminated from the colony, the spontaneous incidence of thyroiditis has decreased dramatically, and is now extremely rare in older, unmanipulated VAF female BUF rats. BUF rats have retained their susceptibility to autoimmunity as demonstrated by the facility of simple manipulation of the immune system to increase the frequency of thyroiditis dramatically (see below).

Autoimmunity induced by immune system modulation Immune system modulation has been found to result in the expression of autoimmunity in 'normal' animals that never spontaneously develop autoimmunity. Much of this work can be interpreted in light of the balance Jlypothesis of autoimmunity that was developed in the BB rat model of IDDM. Observations across autoimmune disorders and in both normal and autoimmune-prone rat strains suggest that this paradigm may be an important component of the development and expression of autoimmunity not only in rats, but in other species as well.

Induced models of IDDM As noted above, a subpopulation of nondiabetic BB rats at the sixth generation of inbreeding were selected and bred for resistance to IDDM. These rats are now designated diabetes-resistant (DR-BB) rats, which do not spontaneously develop IDDM. DR-BB rats display normal levels of all T-cell populations, but retain their susceptibility to


IDDM induction. This is shown most dramatically by simple elimination of a subset of peripheral T cells that express the RT6 alloantigen. In conjunction with a low dose of an immune system activator, poly I:C, the incidence of diabetes approaches 100% in RT6-depleted DRBB rats. IDDM can also be induced in DR-BB rats by lowdose irradiation or cyclosphosphamide, or by high doses of poly I:C (Mordes et al., 1987, 1996a, b). Diabetes can also be induced in DR-BB rats by an infectious agent, suggesting environmental control of autoimmune expression. Upon injection of high doses of KRV, up to 30% of DR-BB rats develop diabetes (Guberski et al., 1991). When combined with either low dose poly I:C or depletion of RT6 + T cells, the incidence of diabetes in KRV-infected DR-BB rats approaches 100%. These results support the 'balance hypothesis' of autoimmunity by demonstrating that alteration of this balance by reduction of a RT6 + regulatory T cells, or by infection with an immunomodulatory virus, such as KRV, tips the balance in favor of the effector phase of autoimmunity. This paradigm has recently been extended to other rat strains that fail spontaneously to develop autoimmunity. Greater than 90% of PVG.RT1 u or LEW.WR1 (RT1 AUB/ D u C a) congenic rats infected with KRV and injected with poly I:C (Ellerman et al., 1996), and > 75% of PVG.RT1 u rats that are treated with anti-RT6-antibody plus poly I:C, express autoimmune IDDM (Whalen et al., 1997). Autoimmune diabetes can also be induced in normal PVG rats by thymectomy and irradiation (Stumbles and Penhale, 1993). Up to 34% of such manipulated animals will develop diabetes within 10 weeks of treatment. The disease in these animals appears to be mediated by a population of CD4 +CD45hi-expressing T cells, and can be prevented by a population of CD4+RT6 +CD45 ~~ expressing T cells (Fowell and Mason, 1993; Fowell et al., 1993). The protective population of CD4 + T cells expresses IL-4 and is Tv~2-1ike, suggesting that the protective regulatory T cells may mediate their immunoregulatory effects upon effector T cells through cytokine secretion.

Syngeneic graft-vs-host (GvH) reactivity A GvH like syndrome can be induced in LEW rats by irradiation, syngeneic bone marrow reconstitution, and a short-term treatment with cyclosporin A followed by withdrawal of the drug treatment (Fischer et al., 1989). Within 2 months of drug withdrawal, an autoimmune disease syndrome resembling syngeneic GvH is observed. As in HgClrinduced autoimmune glomerulonephritis (see below), LEW rats are susceptible to induction of autoimmunity using this protocol while BN rats are resistant (Ohajekwe et al., 1995). This model has also been suggested to correlate with autoimmune scleroderma in humans (Bos et al., 1989). The amount of irradiation administered alters the severity of the induced syngeneic GvH, and the autoimmune nature of the disease has been

A

u

t

o

i

m

m

u

n

demonstrated by adoptive transfer, which can be inhibited by co-administration of normal T cells (Fischer et al., 1989). Again, the data suggest that a balance exists between regulatory and effector cells in normal rats, and that alteration of this balance can lead to the expression of autoimmunity. Induced BUF rat model of thyroiditis Female BUF rats maintained under VAF conditions fail spontaneously to develop thyroiditis with aging. However, thyroiditis in these animals can be induced by neonatal thymectomy, and the incidence can be increased by administration of exogenous iodine in their food or drinking water (Allen and Braverman, 1990; Cohen et al., 1990). These observations support the concept that both immune manipulation and environmental influences can modulate the expression of autoimmunity in susceptible strains of rats.

Autoimmunity induced by immunization Multiple autoimmune diseases have been experimentally induced in rats by immunization with syngeneic tissues in complete Freund's adjuvant. The female LEW rat is the most commonly used strain to model immunizationinduced autoimmunity, and the most studied disease syndrome is experimental autoimmune encephalomyelitis (EAE). Many common principles have been elucidated using this experimental system. The role of effector cells, regulatory cells, and tolerization protocols, including orally induced tolerance, in autoimmunity have been investigated using this model system. In addition, the role of specific immunomodulatory T-cell subsets, cytokines, and autoantigen recognition have been defined in the LEW rat EAE model (Swanborg, 1988; Swanborg and Stepaniak, 1996). This model is easily studied owing to (1) its relative ease of inducibility, (2) its reproducibility, and (3) its high incidence of severe disease. It has also been used to demonstrate that two separate autoantigens, myelin basic protein (MBP) and proteolipid protein (PLP) can induce similar disease syndromes, and that the immune response to these defined autoantigens are MHC-restricted. This model is a classic example of the balance hypothesis of autoimmunity. MBP-autoreactive T cells have been demonstrated in the circulation of both susceptible and resistant strains of rats (Swanborg, 1995). This observation engendered analysis of circulating lymphocyte populations in humans, where MBP autoreactive T cells can also be demonstrated (Swanborg, 1995). The presence of these autoreactive cell populations in the absence of pathology or disease has been hypothesized to be due to the presence of immunoregulatory elements in the normal immune system that keep the autoreactive T cells in check. The mechanism by which this occurs is not known, but these observations lend support to the balance hypothesis

i

t

y

1

9

7

of autoimmunity formulated in the BB rat model of autoimmunity. Another widely used rat model of autoimmunity induced by immunization is adjuvant arthritis (van Eden et al., 1996). This disease syndrome is easily induced in rats by immunization with mycobacteria suspended in oil, while mice are generally not susceptible. Adjuvant arthritis in the rat is used to model human rheumatoid arthritis because of the lack of well-defined autoantigen targets and the generalized inflammatory nature of the disease (van Eden et al., 1996). This latter characteristic has led to extensive use of this model for testing anti-inflammatory drugs. The general observation in immunization~induced autoimmunity in rats is that almost any autoantigen emulsified in complete Freund's adjuvant can lead to induction of autoimmunity. The autoantigens encompass a wide array of cell types and tissues, and the induced autoimmune disorders have been postulated to represent many autoimmune human disorders with similar pathology (see Table V.17.1).

Chemically induced autoimmunity The rat has been used to study the immunotoxic effects of drugs, and in particular the effect of chemically-induced autoimmunity by exposure to mercury (Bigazzi, 1994; Druet, 1995). Three rat strains are susceptible to the autoimmune effects of mercury, the BN, MAXX, and DZB inbred strains, while all other strains tested to date are resistant. Following multiple low doses of HgC12, a self-limiting course of autoimmune glomerulonephritis develops, peaking at around 2 weeks, and regressing spontaneously by around 4 weeks. Continuous treatment with HgC12 fails to alter the monophasic course of disease and, following recovery, the animals are resistant to further treatment with mercury. The glomerulonephritis is characterized by proteinuria caused by the deposition of autoantibodies to epitopes of the renal glomerular basement membrane, including laminin. The disease is autoimmune in that autoantibodies are produced, and the disease can be transferred by lymphocytes to otherwise resistant strains. In addition, it has been postulated that the expression of autoimmunity following exposure to mercury is the result of a direct effect on regulatory cell activity (Kosuda et al., 1991; Druet, 1994, 1995). The level of RT6 § T cells, a population known to prevent autoimmunity in the BB strain, decreases concomitantly with the induction of glomerulonephritis in susceptible strains (Kosuda et al., 1991). Mercury exposure is postulated to induce suppressor cell activity in resistant strains such as the LEW rat. The ability of mercury to modulate autoreactive effector and regulatory cell function, and either induce or prevent autoimmunity in rats, may lead to our understanding of the divergent outcomes that are observed following exposure of humans to xenobiotics.

198

In addition to mercury, cadmium, gold salts and Dpenicillamine are also able to induce autoimmunity in BN rats (Bigazzi, 1994; Druet, 1994, 1995).

Transgenic rat models of autoimmunity Although many transgenic mouse models of autoimmunity have been developed, there are relatively few transgenic rat models available, and the only transgenic rat model of autoimmunity developed to date is the HLA-B27 transgenic rat. This transgenic animal develops a spontaneous multisystem inflammatory disease that resembles human B27-associated disease (Breban et al., 1996). The pathology includes skin lesions with marked psoriasiform dermatitis and progressive alopecia, chronic colitis resembling ulcerative colitis, joint inflammation, and male genital inflammatory lesions. The development of these systemic inflammatory lesions does not occur when the transgenic rats are maintained in a germfree state (Taurog et al., 1994). The autoimmune disease can be adoptively transferred by bone marrow or fetal liver cells that express the B27 transgene, and is T cell dependent (Breban et al., 1996). Other transgenic rats have been developed, including rat transgenic models for Charcot-Marie-Tooth disease (Sereda et al., 1996), hypertension (Wagner et al., 1996), obese non-insulin responsive glucose intolerance (Rosella et al., 1995), and many other syndromes. However, none of the other transgenic rats display diseases of an autoimmune pathogenesis.

Additional rat models of autoimmunity Additional rat models of autoimmunity include dietary induction of thyroiditis by high levels of iodine intake, (Mooij et al., 1994), and autoimmunity induced by infectious agents. These latter models include measles virusinduced autoimmune reactions against brain antigen in rats (ter Meulen and Liebert, 1993), and M y c o p l a s m a arthritidis infection, which causes severe polyarthritis and resembles human rheumatoid arthritis (Kirchhoff et al., 1989). These models demonstrate environmental influences on the induction of autoimmunity in otherwise normal strains of rats.

Conclusion The rat has been used for the study of many spontaneous and induced autoimmune syndromes. The observations obtained from these investigations have provided insights into the function of the normal immune system, and the regulatory imbalances that lead to the expression of autoimmunity. The utility of the rat models has been extensive, and has led to numerous clinical trials and the


development of many drugs for treatment of human diseases. It should be cautioned, however, that no rodent model of human autoimmunity completely parallels the human syndrome in pathogenesis, etiology or clinical outcome. However, general principals revealed in the rat models, such as the balance hypothesis of regulatory and effector T cell modulation of the expression of autoimmunity, appear to be translated across many autoimmune disorders and across many species. It is with this understanding that the rat models of autoimmunity will lead to rational and therapeutic application to human autoimmune diseases.

18.

References

Abraham, J. A., Damm, D., Bajardi, A., Miller, J., Klagsbrun, M., Ezekowitz, R. A. B. (1993). Heparin-binding EGF-like growth factor: characterization of rat and mouse cDNA clones, protein domain conservation across species, and transcript expression in tissues. Biochem. Biophys. Res. Commun. 190, 125-133. Acosta-Altamirano, G., Burranco-Acosta, C., van Roost, E., Vaerman, J. P. (1980). Isolation and characterization of secretory IgA (SIgA) and free secretory component (FSC) from rat bile. Mol. Immunol. 17, 1525-1537. Ager, A. (1994). Lymphocyte recirculation and homing: Roles of adhesion molecules and chemoattractants. Trends Cell Biol. 4, 326-333. Agui, T., Oka, M., Yamada, T., Sakai, T., Izumi, K., Ishida, Y., Himeno, K., Matsumoto, K. (1990). Maturational arrest from CD4 + 8 + to CD4 + 8- thymocytes in a mutant strain (LEC) of rats. J. Exp. Med. 172, 1615-1624. Agui, T., Sakai, T., Himeno, K., Matsumoto, K. (1991a). Bone marrow-derived progenitor T cells convey the origin of maturational arrest from CD4 + CD8 + to CD4 +CD8- thymocytes in LEC mutant rats. Eur. J. Immunol. 21, 2277-2280. Agui, T., Sakai, T., Matsumoto, K. (1991b). Ontogeny of T-cell maturation in LEC mutant rats which bear a congenital arrest of maturation from CD4 +CD8 + to CD4 +8-thymocytes. Eur. J. Immunol. 21, 2537-2541. Aguilar, B. A., Gutman, G. A. (1992). Transcription and diversity of immunoglobulin lambda chain variable genes in the rat. Immunogenetics 37, 39-48. Akasaki, K., Fukuzawa, M., Kinoshita, H., Furuno, K., Tsuji, H. (1993). Cyclin of two endogenous lysosomal membrane proteins, lamp-2 and acid phosphatase, between the cell surface and lysosomes in cultured rat hepatocytes. J. Biochem. Tokyo 114, 598-604. Allan, C. H., Mendrick, D. L., Trier, J. S. (1993). Rat intestinal M cells contain acidic endosomal-lysosomal compartments and express class II major histocompatibility complex determinants. Gastroenterology 104, 698-708. Allen, E. M., Braverman, L. E. (1990). The effect of iodine on lymphocytic thyroiditis in the thymectomized buffalo rat. Endocrinology 127, 1613-1616. Anderson, A. O., Shaw, S. (1993). T-cell adhesion to endothelium: the FRC conduit system and other anatomic and

References

molecular features which facilitate the adhesion cascade in lymph nodes. Sem. Immunol. 5,271-282. Appel, K., Honegger, P., Gebicke-Haerter, P. J. (1995a). Expression of interleukin-3 and tumor necrosis factor-fi mRNAs in cultured microglia. J. Neuroimmunol. 60, 83-91. Appel, K., Buttini, M., Sauter, A., Gebicke-Haerter, P. J. (1995b). Cloning of rat interleukin-3 receptor beta-subunit from cultured microglia and its mRNA expression in vivo. J. Neurosci. 15, 5800-5809. Arai, M., Mochida, S., Ohno, A., Ogata, A., Obama, H., Maruyama, I., Fujiwara, K. (1995). Blood coagulation equilibrium in rat liver microcirculation as evaluated by endothelial cell thrombomodulin and macrophage tissue factor. Thromb. Res. 15,113-123. Arden, B., Clark, S. P., Kabelitz, D., Mak, T. W. (1995). Mouse T-cell receptor variable gene segment families. Immunogenetics 42, 501-530. Armeding, D. (1971). Two allotypic specificities of rat immunoglobulins. Eur. J. Immunol. 1, 39-45. Arnason, B. G., de Vaux St. Cyr, C., Grabar, P. (1963). Immunoglobulin abnormalities of the thymectomized rats. Nature 199, 1199-1200. Arnason, B. G., de Vaux St. Cyr., C., Relyveld, E. H. (1964). Role of the thymus in immune reactions in rats. IV. Immunoglobulins and antibody formation. Int. Arch. Allergy Appl. Immunol. 25,206-224. Arroyave, C. M., Levy, R. N, Johnson, J. S. (1979). Genetic deficiency of the fourth component (C4) in wistar rats. Immunology 33,453-459. Arvieux, J., Willis, A. C., Williams, A. F. (1986). MRC OX-45: a leukocyte/endothelium rat membrane glycoprotein of 45,000 molecular weight. Mol. Immunol. 23,983-990. Asmut~, A., Hofmann, K., Hochgrebe, T., Giegerich, G., H~inig, T., Herrmann, T. (1996). Alleles of highly homologous rat Tcell receptor fl-chain variable segments 8.2 and 8.4. J. Immunol. 157, 4436-4441. Aspinall, R., Kampinga, J., van Den Bogaerde, J. (1991). T-cell development in the fetus and the invariant series hypothesis. Immunol. Today 12, 7-10. Aten, J., Bosman, C. B., Rozing, J., Stijnen, T., Hoedemaeker, P. J., Weening, J. J. (1988). Mercuric chloride-induced autoimmunity in the Brown Norway rat. Cellular kinetics and major histocompatibility complex antigen expression. Am. J. Pathol. 133, 127-138. Aten, J., Veninga, A., de Heer, E., Rozing, J., Nieuwenhuis, P., Hoedemaeker, P. J., Weening, J. J. (1991). Susceptibility to the induction of either autoimmune reactivity or nonspecific immunosuppression by mercuric chloride is related to the MHC class II haplotype. Eur. J. Immunol. 21, 611616. Aten, J., Veninga, A., Coers, W., Sonnenberg, A., Timpl, R., Claessen, N., van Eendenburg, J. D. H., De Heer, E., Weening, J. J. (1995). Autoantibodies to the laminin P1fragment in HgC12-induced membranous glomerulopathy. Am. J. Pathol. 146, 1467-1480. Auchampach, J. A., Oliver, M. G., Anderson, D. C., Wanning, A. M. (1994). Cloning, sequence comparison and in vivo expression of the gene encoding rat P-selectin. Gene 145, 251-255. Auerbach, R., Alby, L., Grieves, J., Joseph, J., Lindgren, C., Morrissey, L. W., Sidky, Y. A., Tu, M., Watt, S. L. (1982). Monoclonal antibody against angiotensin-converting enzyme:

199

its use as a marker for murine, bovine, and human endothelial cells. Proc. Natl Acad. Sci. USA 79, 7891-7895. Awata, T., Guberski, D. L., Like, A. A. (1995). Genetics of the BB rat: association of autoimmune disorders (diabetes, insulitis, and thyroiditis) with lymphopenia and major histocompatibility complex class II. Endocrinology 136, 5731-5735. Bailyes, E. M., Soos, M., Jackson, P., Newby, A. C., Siddle, K., Luzio, J. P. (1984). The existence and properties of two dimers of rat liver ecto-5'-nucleotidase. Biochem. J. 221,369-377. Barabas, A. Z., Kelus, A. S. (1967). Allotypic specificity of serum protein in inbred strains of rats. Nature 215, 155. Barb~, E., Huitinga, I., D6pp, E. A., Bauer, J., Dijkstra, C. D. (1996). A novel bone marrow frozen section assay for studying hemopoietic interactions in situ: the role of stromal macrophages in erythroblast binding. J. Cell Sci. 109, 29372945. Baumann, H., Gauldie, J. (1990). Regulation of hepatic acute phase plasma protein genes by hepatocyte stimulating factors and other mediators of inflammation. Mol. Biol. Med. 7, 149159. Baumann, H., Schendel, P. (1991). Interleukin-11 regulates the hepatic expression of the same plasma protein genes as interleukin-6. J. Biol. Chem. 266, 20424-20427. Baumann, M., Baumann, H., Fey, G. H. (1990). Molecular cloning, characterization and functional expression of the rat liver interleukin 6 receptor. J. Biol. Chem. 15, 19853-19862. Baumann, H., Morella, K. K., Wong, G. H. (1993). TNF-alpha, IL-1 beta, and hepatocyte growth factor cooperate in stimulating specific acute phase protein genes in rat hepatoma cells. J. Immunol. 151, 4248-4257. Bautista, A. P., Spolarics, Z., Jaeschke, H., Smith, C. W., Spitzer, J. J. (1993). Monoclonal antibody against the CD18 adhesion molecule stimulates glucose uptake by the liver and hepatic nonparenchymal cells. Hepatology 17, 924-931. Bazin, H. (1967a). Les immunoglobulines de la souris. Nouv. Rev. Fr. Hematol. 7, 507-526. Bazin, H. (1967b). Mouse immunoglobulins. II. Study of the antibodies synthesized in the various classes of immunoglobulins in response to the injection of 2 soluble protein antigens. Ann. Inst. Pasteur Paris 112, 162-172. Bazin H. (ed.) (1990). Rat Hybridomas and Rat Monoclonal Antibodies. CRC Press Inc., Boca Raton, FL, USA. Bazin, H., Beckers, A. (1976). IgE myelomas in rats. Nobel Symposium No. 33. Molecular and biological aspects of the acute allergic reaction, Stockholm (eds Johansson, S. G. O., Stranberg, K., Uvnas, B.), p. 125-152. Plenum Company, New York, USA. Bazin, H., Deckers, A., Beckers, A., Heremans, J. F. (1972). Transplantable immunoglobulin-secreting tumours in rats. I. General features of LOU/Wsl strain rat immunocytomas and their monoclonal proteins. Int. J. Cancer 10, 568-580. Bazin, H., Beckers, A., Deckers, C., Moriam~, M. (1973). Transplantable immunoglobulin-secreting tumours in rats. V. Monoclonal immunoglobulins secreted by 250 ileocecal immunocytomas of the LOU/Wsl rats. J. Natl Cancer Inst. 51, 1359-1361. Bazin, H., Beckers, A., Querinjean, P. (1974a). Three classes and four (sub)classes of rat immunoglobulins: IgM, IgA, IgE, and IgG1, IgG2a, IgG2b, IgG2c. Eur. J. Immunol. 4, 44-48. Bazin, H., Querinjean, P., Beckers, A., Heremans, J. F., Dessy, F. (1974b). Transplantable immunoglobulin-secreting tumours

200

in rats. IV. Sixty-three IgE-secreting immunocytoma tumours. Immunology 26, 713-723. Bazin, H., Beckers, A., Vaerman, J. p., Heremans, J. F. (1974c). Allotypes of rat immunoglobulins. I. An allotype at the alphachain locus. J. immunol. 112, 1035-1041. Bazin, H., Beckers, A., Urbain-Vansanten, G., Pauwels, R., Bruyns, C., Tilkin, A. F., Platteau, B., Urbain, J. (1978). Transplantable IgD immunoglobulin-secreting tumours in rats. J. Immunol. 121, 2077-2082. Bazin, H., Gray, D., Platteau, B., MacLennan, I. C. M. (1982). Distinct 8 + and 8 - B lymphocyte lineages in the rat. Ann. N Y Acad. Sci. 399, 157-174. Bazin, H., Platteau, B., MacLennan, I. C. M., Johnson, G. D. (1985). B-cell production and differentiation in adult rats. Immunology 54, 79-88. Bazin, H., Rousseaux, J., Rousseaux-Pr~vost, R., Platteau, B., Querinjean, p., Malache, J. M., Delaunay, T. (1990). Rat immunoglobulins. In Rat Hybridomas and Rat Monoclonal Antibodies (ed. Bazin, H.), pp. 5-42. CRC Press Inc., Boca Raton, FL, USA. Beckers, A., Bazin, H. (1975). Allotypes of rat immunoglobulins. III. An allotype of the gamma2b-chain locus. Immunochemistry 12, 671-675. Beckers, A., Querinjean, p., Bazin, H. (1974). Allotypes of rat immunoglobulins. II. Distribution of the allotypes of kappa and alpha chain loci in different inbred strains of rat. Immunochemistry 11,605-609. Beelen, R. H. J., Walker, W. S. (1983). Dynamics of cytochemically distinct subpopulations of macrophages in elicited rat peritoneal macrophages. Cell. Immunol. 82, 246. Beelen, R. H. J., Eestermans, I. L., D6pp, E. A., Dijkstra, C. D. (1987). Monoclonal antibodies ED1, ED2 and ED3 against rat macrophages: expression of recognized antigens in different stages of differentiation. Transpl. Proc. XIX 3, 31663170. Beijleveld, L. J. J., Groen, H., Broeren, C. M., Klatter, F. A., Kampinga, J., Damoiseaux, J. G. M. C., van Breda Vriesman, P. J. C. (1996). Susceptibility to clinically manifest cyclosporin A (CsA)-induced autoimmune disease is associated with interferon-gamma producing CD45RC + R T 6 - T helper cells. Clin. Exp. Immunol. 105,486-496. Bell, E. B., Sparshott, S. M. (1990). Interconversion of CD45R subsets of CD4 T cells in vivo. Nature 348, 163. Bell, E. B.', Sparsh0tt, S. M., Ager, A. (1995). Migration pathways of CD4 T cell subsets in vivo: the CD45RC- subset enters the thymus via 0~4integrin-VCAM-1 interaction. Int. Immunol. 7, 1861-1871. Bell, G. M., Seaman, W. E., Niemi, E. C., Imboden, J. B. (1992). The OX-44 molecule couples to signalling pathways and is associated with CD2 on rat T lymphocytes and a natural killer cell line. J. Exp. Med. 175,527-536. Bellacosa, A., Lazo, P. A., Bear, S. E., Tsichlis, P. N. (1991). The rat leukocyte antigen MRC OX-44 is a member of a new family of cell surface proteins which appears to be involved in growth regulation. Mol. Cell. Biol. 11, 2864-2872. Berkenbosch, F., van Oers, J., Del Rey, A., Tilders, F., Besedovsky, H. (1987). C~176176 factor-producing neurons in the rat activated by interleukin-1. Science 238,524526. Berman, J. W., Guida, M. P., Warren, J., Amat, J., Brosnan, C. F. (1996). Localization of monocyte chemoattractant peptide-1 expression in the central nervous system in experimental

I M M U N O L O G Y OF THE RAT

autoimmune encephalomyelitis and trauma in the rat. J. Immunol. 156, 3017-3023. Berridge, M. V., O'Kech, N., McNeilage, L. J., Heslop, B. F., Moore, R. (1979). Rat mutant (NZNU) showing 'nude' characteristics. Transplantation 6, 410-413. Beyers, A. D., Spruyt, L. L., Williams, A. F. (1992). Molecular associations between the T-lymphocyte antigen receptor complex and the surface antigens CD2, CD4, or CD8 and CD5. Proc. Natl Acad. Sci. USA 89, 2945-2949. Bienenstock, J., Johnston, N., Perey, D. Y. E. (1973). Bronchial lymphoid tissue. I. Morphologic characteristics. Lab. Invest. 28, 686-692. Biewenga, J., van Rees, E. P., Sminia, T. (1993). Induction and regulation of IgA responses in the microenvironment of the gut. Clin. Immunol. Immunopathol. 67, 1-13. Billups, K. L., Sherley, J. L., Palladino, M. A., Tindall, J. W., Roberts, K. P. (1995). Evidence for E-selectin complement regulatory domain mRNA splice variants in the rat. J. Lab. Clin. Med. 126, 580-587. Bigazzi, P. E. (1994). Autoimmunity and heavy metals. Lupus 3, 449-453. Binaghi, R., Sarando de Merlo, E. (1966). Characterization of rat IgA and its non-identity with the anaphylactic antibody. Int. Arch. Allergy AppI. Immunol. 30, 589-596. Bland, P. W., Warren, L. G. (1986). Antigen presentation by epithelial cells of the rat small intestine. I. Kinetics, antigen specificity and blocking by anti-Ia sera. Immunology 58, 1-8. Blankenhorn, E. P., Cecka, J. M., G6tze, D., Hood, L. (1978). Partial N-terminal amino acid sequence of rat transplantation antigens. Nature, 274, 90-92. Blankenhorn, E. P., Symington, F. W., Cramer, D. V. (1983). Biochemical characterization of Ia antigens encoded by the RT1.B and RT1.D loci in the rat MHC. Immunogenetics 17, 475-484. Blankenhorn, E. P., Stranford, S., Smith, P. D., Hickey, W. F. (1991). Genetic differences in the T cell receptor alleles of LEW rats and the encephalomyelitis resistant derivative, LER; and their impact on the inheritance of EAE resistance. Eur. J. Immunol. 21, 2033-2041. Blankenhorn, E., Smith, P. D., Williams, C. B., Gutman, G. A. (1992). Alleles of the rat T-cell receptor fl chain complex. Immunogenetics 35,324-331. Blankenhorn, E. P., Stranford, S. A., Martin, A.-M., Hickey, W. F. (1995). Cloning of myelin basic-protein reactive T-cells from the experimental allergic encephalomyelitis-resistant rat strain, LER. J. Neuroimmunol. 59, 173-183. Blasband, A. J., Rogers, K. T., Chen, X., Azizkhan, J. C., Lee, D. C. (1990). Characterization of the rat transforming growth factor alpha gene and identification of promoter sequences. Mol. Cell. Biol. 10, 2111-2121. Blaschke, V., Micheel, B., Pabst, R., Westermann, J. (1995). Lymphocyte traffic through lymph nodes and Peyer's patches of the rat: B- and T-cell-specific migration patterns within the tissue, and their dependence on splenic tissue. Cell Tissue Res. 282, 377-386. Bocek, P., Pecht, I. (1993). Cloning and sequence of the cDNA coding for rat type II Fc gamma receptor of mast cells. FEBS Lett. 331, 86-90. Bogden, A. E., Aptekman, P. M. (1960). The 'R-I' factor: a histocompatibility antigen in the rat. Cancer Res. 20, 1372. Bogers, W. M. J. M., van Rooijen, N., Janssen, D. J., van Es,

References

L. A., Daha, M. R. (1993). Complement enhances the elimination of soluble aggregates of IgG by rat liver endothelial cells in vivo. Eur. J. Immunol. 23,433-438. Borges, L. G., Seifert, R. A., Grant, F. J., Hart, C. E., Disteche, C. M., Edelhoff, S., Solca, F. F., Liberman, M. A., Lindner, V., Fischer, E. H., Lok, S., Bowen-Pope, D. F. (1996). Cloning and characterization of rat density-enhanced phosphatase-1, a proteintyrosine kinase phosphatase expressed by vascular cells. Circ. Res. 79, 570-580. Borycki, A. G., Guillier, M., Leibovitch, M. P., Leibovitch, S. A. (1992). Molecular cloning of CSF-1 receptor from rat myoblasts. Sequence analysis and regulation during myogenesis. Growth Factors 6, 209-218. Bos, G. M., Majoor, G. D., Willighagen, R. G., van Breda Vriesman, P. J. (1989). Chronic cyclosporine-induced autoimmune disease in the rat: a new experimental model for scleroderma. J. Invest. Dermatol. 93,610-615. Brandt, J., Pippin, J., Schulze, M., H~insch, G. M., Alpers, C. E., Johnson, R. J., Gordon, K., Couser, W. G. (1996). Role of the complement membrane attack complex (C5-C9) in mediating experimental menangio proliferative glomerulonephritis. Kidney Int. 49, 335-343. Brauer, R. B., Baldwin III, W. M., Wang, D., Hirwitz, L. R., Hess, A. D., Klein, A. S., Sanfilipo, S. (1994). Hepatic and extrahepatic biosynthesis of complement factor C6 in the rat. J. Immunol. 153, 3168-3176. Breban, M., Fernandez-Sueiro, J. L., Richardson, J. A., Hadavand, R. R., Maika, S. D., Hammer, R. E., Taurog, J. D. (1996). T cells, but not thymic exposure to HLA-B27, are required for the inflammatory disease of HLA-B27 transgenic rats. J. Immunol. 156, 794-803. Brideau, R. J., Carter, P. B., McMaster, W. R., Masson, D. W., Williams, A. F. (1980). Two subsets of rat T lymphocytes defined with monoclonal antibodies. Eur. J. Immunol. 10, 609-615. Brisette-Storkus, C., Kaufmann, C. L., Pasewitz, L., Worsey, H. M., Lakomy, R., Ildstad, S. T., Chambers, W. H. (1994). Characterization and function of the NKR-Pldim/T cell receptor-aft4- subset of rat T cells. J. Immunol. 152, 388396. Bristulf, J., Gatti, S., Malinowsky, D., Bjork, L., Sundgren, A. K., Bartfai, T. (1994). Interleukin-1 stimulates the expression of type I and type II interleukin-I receptors in the rat insulinoma cell line Rinm5F: sequencing a rat type II interleukin-1 receptor cDNA. Eur. Cytokine Netw. 5,319-330. Broeren, C. P., Wauben, M. H., Lucassen, M. A., van Meurs, M., van Kooten, P. J., Boog, C. J., Claassen, E., van Eden, W. (1995). Activated rat T-cells synthesize and express functional major histocompatibility class II antigens. Immunology 84, 193-201. Broug-Holub, E., Persoons, J. H., Schornagel, K., Kraal, G. (1995). Changes in cytokine and nitric oxide secretion by rat alveolar macrophages after oral administration of bacterial extracts, Clin. Exp. Immunol. 101,302-307. Brouwer, E., Huitema, M. G., Klok, P. A., De Weerd, H., Tervaert, J. W., Weening, J. J., Kallenberg, C. G. (1993). Antimyeloperoxidase-associated proliferative glomerulonephritis: an animal model. J. Exp. Med. 177, 905-914. Br/iggemann, M. (1988). Evolution of a rat immunoglobulin gamma heavy-chain gene family. Gene 74, 473-482. Br~iggemann, M., Free, J., Diamon, A., Hobard, J., Cobbold, S., Waldmann, H. (1986). Immunoglobulin heavy chain locus of

201

the rat: stricking homology to mouse antibody genes. Proc. Natl Acad. Sci. USA 83, 6075-6079. Br~iggemann, M., Delmastro-Galgre, P., Waldmann, H., Calabi, F. (1988). Sequence of a rat immunoglobulin gamma 2c heavy chain constant region cDNA: extensive homology to mouse gamma 3. Eur. J. Immunol. 18,317. Bukovsky, A., Presl, J., Zidovsky, J., Mancal, P. (1983). The localization of Thy-l.1, MRC OX 2 and Ia antigens in the rat ovary and fallopian tube. Immunology 48,587-596. Bulmer, D. (1968). Further studies on the granulated metrial gland cells of the pregnant rat. J. Anat. 103(3), 479-489. Burke, S., Landau, S., Green, R., Tseng, C. C., Nattakom, T., Canchis, W., Yang, L., Kaiserlai, D., Gespach, C., Balk, S., Blumberg, R. (1994). Rat cluster of differentiation molecule 1: expression on the surface of intestinal epithelial cells and hepatocytes. Gastroenterology 106, 1143-1149. Burns, F. R., Li, X., Shen, N., Offner, H., Chou, Y. K., Vandenbark, A. A., Heber-Katz, E. (1989). Both rat and mouse T cell receptors specific for the encephalitogenic determinant of myelin basic protein use similar V~ and Vfl chain genes even though the major histocompatibility complex and encephalitogenic determinants being recognized are different. J. Exp. Med. 169, 27-39. Butcher, G. W. (1987). A list of monoclonal antibodies specific for alloantigens of the rat. Immunogenetics 14, 163-176. Campbell, D. G., Gagnon, J., Reid, K. B., Williams, A. F. (1981). Rat brain Thy-1 glycoprotein. The amino acid sequence, disulphide bonds and an unusual hydrophobic region. Biochem J. 195, 15-30. Carey, D. J., Stahl, R. C., Cizmecci-Smith, G., Asundi, V. K. (1994). Syndecam-1 expressed in Schwann cells cause morphological transformation and cytoskeletal reorganization and associates with actin during cell spreading. J. Cell Biol. 124, 161-170. Carlsson, L., Overmo, C., Holmberg, D. (1992). Developmentally controlled selection of antibody genes: characterization of individual VH7183 genes and evidence for stage-specific somatic diversification. Eur. J. Immunol. 22, 71-78. Carroll, P., Sendtner, M., Meyer, M., Thoenen, H. (1993). Rat ciliary neurotrophic factor (CNTF): gene structure and regulation of mRNA levels in glial cell cultures. Glia 9, 176-187. Carter, P., Bazin, H. (1980). Immunology. In The Laboratory Rat, Vol. 2, pp. 181-212. Academic Press, New York, USA. Carvalho, G. S., Luzio, J. P., Siddle, K., Coombs, R. R. (1987). Detection of ecto-5'-nucleotidase on rat B and T lymphocyte subpopulations using a monoclonal antibody in rosetting reactions. J. Immunol. Methods 102, 119-126. Cattaneo, A., Rapposelli, B., Calissano, P. (1988). Three distinct types of monoclonal antibodies after long-term immunization of rats with mouse nerve growth factor. J. Neurochem. 50, 1003-1010. Cerf-Bensussan, N., Guy-Grand, D., Lisowska-Grospierre, B., Griscelli, C., Bhan, A. K. (1986). A monoclonal antibody specific for rat intestinal lymphocytes. J. Immunol. 136, 7682. Chan, E. Y. T., MacLennan, I. C. M. (1993). Only a small proportion of splenic B cells in adults are short-lived cells. Eur. J. Immunol. 20, 557-363. Chao, D., MacPherson, G. G. (1989). Lymph node macrophage heterogeneity: the phenotypic and functional characterization of two distinct populations of macrophages from rat lymph node. Eur. J. Immunol. 19, 1273-1261.

202

Chappel, C. I., Chappel, W. R. (1983). The discovery and development of the BB rat colony: an animal model of spontaneous diabetes mellitus. Metabolism 32, 8-10. Cheung, P. H., Thompson, N. L., Earley, K., Culic, O., Hixson, D., Lin, S. H. (1993). Cell-CAM105 isoforms with different adhesion functions are coexpressed in adult rat tissues and during liver development. J. Biol. Chem. 268, 6139-6146. Chiariotti, L., Brown, A. L., Frunzio, R., Clemmons, D. R., Rechler, M. M., Bruni, C. B. (1988). Structure of the rat insulin-like growth factor II transcriptional unit: heterogeneous transcripts are generated from two promoters by use of multiple polyadenylation sites and differential ribonucleic acid splicing. Mol. Endocrinol. 2, 1115-1126. Chignier, E., Sparagano, M. H., McGregor, L., Thillier, A., Pellecchia, D., McGregor, J. L. (1994). Two sites (23-30, 7690) on rat P-selectin mediate thrombin activated plateletneutrophil interactions. Comp. Biochem. Physiol. A. Physiol. 109, 881-886. Childers, N. K., Denys, F. R., McGee, N. F., Michalek, S. M. (1990). Ultrastructural study of liposome uptake by M cells of rat Peyer's patch: an oral vaccine system for delivery of purified antigen. Region. Immunol. 3, 8-16. Chluba, J., Steeg, C., Becker, A., Wekerle, H., Epplen, J. T. (1989). T cell receptor fl chain usage in myelin basic protein specific rat T lymphocytes. Eur. J. Immunol. 19, 279-284. Christensen, P. J., Kim, S., Simon, R. H., G.B., T., Paine, R. (1993). Differentation-related expression of ICAM-1 by rat alveolar epithelial cells. Am. J. Respir. Cell Mol. Biol. 8, 915. Chroneos, Z., Shepert, V. L. (1995). Differential regulation of the mannose receptor and SP-A receptors on macrophages. Am. J. Physiol. 269,721-726. Chung, I. Y., Benveniste, E. N. (1990). Tumor necrosis factor-0~ production by rat astrocytes. Induction by lipopolysaccharide, IFN- 7 and IL-lfi. J. Immunol. 144, 2999-3007. Cizmeci-Smith, G., Asundi, V., Stahl, R. C., Teichman, L. J., Chernousov, M., Cowan, K., Carey, D. J. (1992). Regulated expression of syndecan in vascular smooth muscle cells and cloning of rat syndecan core protein cDNA. J. Biol. Chem. 267, 15729-15736. Claassen, E., Kors, N., Dijkstra, C. D., van Rooijen, N. (1986). Marginal zone of the spleen and the development and localization of specific antibody forming cells against thymus-dependent and thymus-independent type 2 antigens. Immunology 57, 399-403. Clarke, G. J., Dallman, M. J. (1992). Identification of a cDNA encoding the rat CD28 homologue. Immunogenetics 35, 5457. Clark, S. J., Law, D. A., Paterson, D. J., Puklavec, M., Williams, A. F. (1988). Activation of rat T lymphocytes by anti-CD2 monoclonal antibodies. J. Exp. Med. 167, 1861-1872. Cohen, D. R., Hapel, A. J., Young, I. G. (1986). Cloning and expression of the rat interleukin-3 gene. Nucl. Acids Res. 14, 3641-3658. Cohen, S. B., Diamantstein, T., Weetman, A. P. (1990). The effect of T cell subset depletion on autoimmune thyroiditis in the Buffalo strain rat. Immunol. Lett. 23,263-268. Colic, M., Drabek, D. (1991). Expression and function of intercellular adhesion molecule 1 (ICAM-1) on rat thymic macrophages in culture. Immunol. Lett. 28, 251-257. Crawford, J. M., Goldschneider, I. (1980). Thy-1 antigen, and B-


lymphocyte differentiation in the rat. J. Immunol. 124, 969976. Crisfi, L., Mordes, J. P., Rossini, A. A. (1992). Autoimmune diabetes mellitus in the BB rat. Diab./Metab. Rev. 8, 9-37. Crouse, D. A., Perry, G. A., Murphy[ B. O., Sharp, J. G. (1989). Characteristics of submucosal lymphoid tissue located in the proximal colon of the rat. J. Anat. 162, 53-65. Crowe, J. S., Smith, M. A., Cooper, H. J. (1989). Nucleotide sequence of Y3-Ag 1.2.3. rat myeloma immunoglobulin kappa chain cDNA. Nucl. Acids Res. 17, 7992. Cuida, M., Brun, J. G., Tynning, T., Jonsson, R. (1995). Calprotectin levels in oral fluids: the importance of collection site. Eur. J. Oral Sci. 103, 8-10. Culic, O., Huang, Q. H., Flanagan, D., Hixson, D., Lin, S. H. (1992). Molecular cloning and expression of a new rat liver cell-CAM105 isoform. Differential phosphorylation of isoforms. Biochem. J. 285, 47-53. Cummins, A. G., Thompson, F. M., Mayrhofer, G. (1991). Mucosal immune activation and maturation of the small intestine at weaning in the hypothymic (nude) rat. J. Pediatr. Gastr. Nutr. 12, 361-368. Curtis, M. R., Dunning, W. F. (1940). Transplantable lymphosarcomata of the mesenteric lymph nodes of rats. Am. J. Cancer 40, 299-309. Cyster, J., Williams, A. (1992). The importance of cross-linking in the homotypic aggregation of lymphocytes induced by antileukosyalin (CD43) antibodies. Eur. J. Immunol. 22, 25652572. Cyster, J., Shotton, D., Williams, A. (1991). The dimension of the T lymphocyte glycoprotein leukosialin and identification of linear protein epitopes that can be modified by glycosylation. EMBO J. 10, 893-902. Daha, M. R., van Es, L. A. (1979). Isolation of the fourth component (C4) of rat complement. J. Immunol. 123, 22612264. Daha, M. R., van Es, L. A. (1980). Isolation and characterization of rat complement factor B and its interaction with cell-bound human C3. Immunology 41,849-855. Daha, M. R., van Es, L. A. (1982). Isolation, characterization, and mechanism of action of rat fllH. J. Immunol. 128, 18391843. Daha, M. R., Stuffers-Heiman, M., Kijlstra, A., van Es, L. A. (1979). Isolation and characterization of the third component of rat complement. Immunology 36, 63-70. Dallman, D. J., Thomas, M. L., Green, J. R. (1984). MRC OX19: a monoclonal antibody that labels rat T lymphocytes and augments in vitro proliverative reponses. Eur. J. Immunol. 14, 260-267. Dammers, P., De Boer, T., Deenen, G. J., Kroese, F. G. M. (1998a). Molecular cloning of rat 25 cDNA. (Manuscript in preparation). Dammers, P., Vermeer, L. A., De Vries, A. F., Bakker, R., Boonstra, A., Bos, N. A. (1998b). Molecular cloning and sequence analysis of rat germline VH genes. (Manuscript submitted). Dammers, P. M., Bun, J. C. A. M., Bellon, B., Kroese, F. G. M., Aten, J., Bos, N. A. (1998c). Isotype switched B cells in HgC12induced autoimmune glomerulopathy utilize predominantly germline VH genes. (Manuscript submitted). Damoiseaux, J. G. M. C., D6pp, E. A., Beelen, R. H. J., Dijkstra, C. D. (1989a). Rat bone marrow and monocyte cultures: influence of culture time and lymphokines on the expression

References

of macrophage differentiation antigens. J. Leukoc. Biol. 46, 246-253. Damoiseaux, J. G. M. C., D6pp, E. A., Neefjes, J. J., Beelen, R. H. J., Dijkstra, C. D. (1989b). Heterogeneity of macrophages in the rat evidenced by variability in determinants: two new anti-rat macrophage antibodies against a heterodimer of 160 and 95 kDa (CD11b/CD18). J. Leukoc. Biol. 46, 556-564. Damoiseaux, J. G., D6pp, E. A., Calame, W., Chao, D., MacPherson, G. G., Dijkstra, C. D. (1994). Rat macrophage lysosomal membrane antigen recognized by monoclonal antibody ED1. Immunology 83, 140-147. Danilov, S., Sakharov, I., Martynov, A., Faerman, A., Muzykantov, V., Klibanov, A., Trakht, I. (1989). Monoclonal antibodies to angiotensin-converting enzyme: a powerful tool for lung and vessel studies. J. Mol. Cell. Cardiol. 21 (Suppl. 1), 165-170. Dawson, T. P., Gandhi, R., Le Hir, M., Kaissling, B. (1989). Ecto5'-nucleotidase: localization in rat kidney by light microscopic histochemical and immunohistochemical methods. J. Histochem. Cytochem. 37, 39-47. de Boer, N. K. (1994). B cell lineages in the rat. Thesis, University of Groningen, The Netherlands. de Boer, N. K., Kroese, F. G. M., Sharp, J. G., Perry, G. A. (1992). Immunohistological characterization of proximal colonic lymphoid tissue in the rat. Anat. Rec. 233,569-576. de Boer, N. K., Meedendorp, B., Ammerlaan, W. A. M., Nieuwenhuis, P., Kroese, F. G. M. (1994). B cells specific for bromelain treated erythrocytes are not derived from adult rat bone marrow. Immunobiology 190, 105-115. Deenen, G. J. D., Kroese, F. G. M. (1993). Kinetics of B cell subpopulations in peripheral lymphoid tissues: evidence for the presence of phenotypically distinct short-lived and longlived B cell subsets. Int. Immunol. 5,735-741. Deenen, G. J., Hunt, S. V., Opstelten, D. (1987). A stathmokinetic study of B lymphocytopoiesis in rat bone marrow: proliferation of cells containing cytoplasmic/l-chains, terminal deoxynucleotidyl transferase and carrying HIS 24 antigen. J. Immunol. 139, 702-710. Deenen, G. J., van Balen, I., Opstelten, D. (1990). In rat B lymphocyte genesis sixty percent is lost from the bone marrow at the transition of nondividing pre-B cell to sIgM + B lymphocyte, the stage of Ig light chain gene expression. Eur. J. Immunol. 20, 557-564. Deenen, G. J., Dammers, P. M., De Boer, T., Kroese, F. G. M. (1997). Identification of a novel rat B cell subset in the peritoneal cavity of xenogeneic rat to mouse scid chimeras. Transpl. Proc. 29, 1752-1753. Der Balian, G., Slack, J., Clevinger, B., Bazin, H., Davie, J. M. (1980). Antigenic similarities of rat and mouse IgG subclasses associated with anti-carbohydrate specificities. Immunogenetics 152, 209-218. Dijkema, R., Pouwels, P., de Reus, A., Schellekens, H. (1984). Structure and expression in Escherichia coli of a cloned rat interferon-~ gene. Nucl. Acids Res. 12, 1227-1242. Dijkema, R., van der Meide, P. H., Pouwels, P. H., Caspers, M., Dubbeld, M., Schellekens, H. (1985). Cloning and expression of the chromosomal immune interferon gene of the rat. EMBO J. 4, 761-767. Dijkstra, C. D., Damoiseaux, J. G. M. C. (1993). Macrophage heterogeneity established by immunocytochemistry. Progr. Histochem. Cytochem. 27, 1-65. Dijkstra, C. D., D6pp, E. A., Joling, P., Kraal, G. (1985). The

203

heterogeneity of mononuclear phagocytes in lymphoid organs: distinct macrophage subpopulations in the rat recognized by monoclonal antibodies ED1, ED2 and ED3. Immunology 54, 589-599. Dijkstra, C. D., D6pp, E. A., Vogels, I. C. M., van Noorden, C. J. F. (1987). Macrophages and dendritic cells in antigen induced arthritis: an immunohistochemical study using cryostat sections of the whole knee joint of rat. Scand. J. Immunol. 26, 513-523. Dinarello, C. A. (1988). Biology of interleukin-1. FASEB J. 2, 108-115. Dissen, E., Hunt, S. V., Rolstad, B., Fossum, S. (1993). Localization of the rat T-cell receptor/J-chain and carboxypeptidase A1 loci to chromosome 4. Immunogenetics 37, 153-156. Douglas-Jones, A., Nelson, J., Jansen, v., Miller, T. (1981). Characterization of the nude rat (rnunz): morphological characteristics of the lymphoid system. Austr. J. Exp. Biol. Med. Sci. 59, 277-286. Drickamer, K., Taylor, M. E. (1993). Biology of animal lectins. Annu. Rev. Cell. Biol. 9, 237-264. Druet, P. (1994). Metal-induced autoimmunity. Arch. Toxicol. Suppl. 16, 185-191. Druet, P. (1995). Metal-induced autoimmunity. Human Exp. Tox. 14, 120-121. Dunn, T. B. (1975). Plasma-cell neoplasms beginning in the ileocaecal area in strain C3H mice. J. Natl Cancer Inst. 19, 371-391. Dunning, W. F., Curtis, M. R. (1946). The respective roles of longevity and genetic specificity in the occurrence of spontaneous tumors in the hybrids between two inbred lines of rats. Cancer 6, 61-81. Eisenberg, S. P., Brewer, M. T., Verderber, E., Heimdal, P., Brandhuber, B. J., Thompson, R. C. (1991). Interleukin-1 receptor antagonist is a member of the interleukin 1 gene family: evolution of a cytokine control mechanism. Proc. Natl Acad. Sci. USA 88, 5232-5236. Elbe, A., Foster, C., Stingl, G. (1996). T cell receptor 0~fland 78 T cells in rat and human s k i n - are they equivalent? Semin. Immunol. 8,341-349. Ellerman, K. E., Like, A. A. (1995). A major histocompatibility complex class II restriction for BioBreeding/Worcester diabetes-inducing T cells. J. Exp. Med. 182, 923-930. Ellerman, K. E., Richards, C. A., Guberski, D. L., Shek, W. R., Like, A. A. (1996). Kilham rat virus triggers T-cell-dependent autoimmune diabetes in multiple strains of rat. Diabetes 45, 557-562. Escribano, M. J., Grabar, P. (1962). L'analyse immuno~lectrophor&ique du s~rum de rat normal. C.R. Acad. Sci. 255,206208. Fangmann, J., Schwinzer, R., Winkler, M., Wonigeit, K. (1990). Expression of RT6 alloantigens and the T-cell receptor on intestinal intraepithelial lymphocytes of the rat. Transpl. Proc. 22, 2543-2544. Fangmann, J., Schwinzer, R., Wonigeit, K. (1991). Unusual phenotype of intestinal intraepithelial lymphocytes in the rat: predominance of T cell receptor ~/fi+/CD2- cells and high expression of the RT6 alloantigen. Eur. J. Immunol. 21,753760. Farber, D. L., Sears, D. W. (1991). Rat CD16 is defined by a family of class III Fc gamma receptors requiring co-expression of heteroprotein subunits. J. Immunol. 146, 4352-4361. Farber, D. L., Giorda, R., Nettleton, M. Y., Trucco, M., Kochan,

204

J. P., Sears, D. W. (1993). Rat class Ill Fc gamma receptor isoforms differ in IgG subclass binding specificity and fail to associate productively with rat CD3 zeta. J. Immunol, 150, 4364-4375. Feng, L., Tang, W. L., Chang, J. C. C., Wilson, C. B. (1993). Molecular cloning of rat cytokine synthesis inhibitory factor (IL-10) cDNA and expression in spleen and macrophages. Biochem. Biophys. Res. Commun. 192, 452-458. Festing, M. F. W. (1979). Inbred Strains in Biomedical Research. Macmillan, Basingstoke, UK. Festing, M. F. W., May, D., Connors, T. A., Lovell, D., Sparrow, S. (1978). An athymic nude mutation in the rat. Nature 274, 365-366. Fey, G. H., Hattori, M., Northemann, W., Abraham, L. J., Baumann, M., Braciak, T. A., Fletcher, R. C., Gauldie, J., Lee, F., Reymond, M. F. (1989). Regulation of rat liver acute phase genes by interleukin-6 and production of hepatocyte stimulating factors by rat hepatoma cells. Ann. N Y Acad. Sci. 557, 317-331. Fischer, A. C., Beschorner, W. E., Hess, A. D. (1989). Requirements for the induction and adoptive transfer of cyclosporineinduced syngeneic graft-versus-host disease. J. Exp. Med. 169, 1031-1041. Flores-Romo, L., Shields, J., Humbert, Y., Graber, P., Aubry, J. P., Gauchat, J. F., Ayala, G., Allet, B., Chavez, M., Bazin, H. (1993). Inhibition of an in vivo antigen-specific IgE response by antibodies to CD23. Science 261, 1038-1041. Foote, J., Winter, G. (1992). Antibody framework residues affecting the conformation of the hypervariable loops. J. Mol. Biol. 224, 487-499. Ford, W. L. (1980). The lymphocyte- its transformation from a frustrating enigma to a model of cellular function. In Blood, Pure and Eloquent: a Story of the Discovery of People and Ideas (ed. Wintrobe, M. M.), pp. 457-508. McGraw Hill, New York, USA. Fossum, S., Mallett, S., Barclay, A. N. (1991). The MRC OX-47 antigen is a member of the immunoglobulin superfamily with an unusual transmembrane sequence. Eur. J. Immunol. 21, 671-679. Fowell, D., Mason, D. (1993). Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes. Characterization of the CD4 § T cell subset that inhibits this autoimmune potential. J. Exp. Med. 177, 627636. Fowell, D., McKnight, A. J., Powrie, F., Dyke, R., Mason, D. (1991). Subsets of CD4 + T cells and their roles in the induction and prevention of autoimmunity. Immunol. Rev. 123, 37-64. Frank, M.-B., Gutman, G. A. (1988). Two pseudogenes among three rat immunoglobulin lambda chain genes. Molec. Immunol. 25,953-960. Frenzl, B., Kren, V., Stark, O. (1960). Attempt to determine blood groups rats. Folia Biologica Prag. 6, 121-126 Fries, J. W., Williams, A. J., Atkins, R. C., Newman, W., Lipscomb, M. F., Collins, T. (1993). Expression of VCAM-1 and E-selectin in an in vivo model of endothelial activation. Am. J. Pathol. 143,725-737. Frorath, B., Abney, C. C., Berthold, H., Scanarini, M., Northemann, W. (1992). Production of recombinant rat interleukin6 in Escherichia coli using a novel highly efficient expression vector pGEX-3T. BioTechniques, 12, 558-563. Frunzio, R., Chiariotti, L., Brown, A. L., Graham, D. E., Rech!er,


M. M., Bruni, C. B. (1986). Structure and expression of the rat insulin-like growth factor II (rIGF-II) gene. rlGF-II RNAs are transcribed from two promoters. J. Biol. Chem. 261, 1713817149. Fujio, K., Hu, Z., Evarts, R. P., Marsden, E. R., Niu, C. H., Thorgeirsson, S. S. (1996). Co-expression of stem cell factor and c-kit in embryonic and adult liver. Exp. Cell. Res. 224, 243-250. Fukumoto, T., McMaster, W. R., Williams, A. F. (1982). Mouse monoclonals against rat major histocompatibility antigens. Two Ia antigens and expression of Ia and class I antigens in rat thymus. Eur. J. Immunol. 12, 237-243. Furth, M., Davis, L., Fleurdelys, B., Scolnick, E. (1982). Monoclonal antibodies to the p21 products of the transforming gene of Harvey Murine Sarcoma virus and of the cellular ras gene family. J. Virology 43,294-304. Furuya, Y., Takasawa, S., Yonekura, H., Tanaka, T., Takahara, J., Okamoto, H. (1995). Cloning of a cDNA encoding rat bone marrow stromal cell antigen 1 (BST-1) from islets of Langerhans. Gene 165,329-330. Galea, E., Reis, D. J., Fox, E. S., Xu, H., Feinstein, D. L. (1996). CD14 mediate endotoxin induction of nitric oxide synthase in cultured brain glial cells. J. Neuroimmunol. 64, 19-28. Gandhi, R., Le Hir, M., Kaiserling, B. (1990) Immunolocalization of ecto-5'-nucleotidase in the kidney by a monoclonal antibody. Histochemistry 95,165-174. Garman, R. D., Doherty, P., Raulet, D. H. (1986). Diversity, rearrangement and expression of murine T-cell gamma genes. Cell 45,733-742. Gascoigne, N. R. J. (1995). Genomic organisation of T-cell receptor genes in the mouse. In T-cell Receptors (eds Bell, J. I., Owen, M. J., Simpson, E.), pp. 288-300. Oxford University Press, Oxford, UK. Gebicke-Haerter, P. J., Appel, K., Taylor, G. D., Schobert, A., Rich, I. N., Northoff, H., Berger, M. (1994). Rat microglial interleukin-3. J. Neuroimmunol. 50, 203-214. Geginat, G., GOnther, E. (1993). Genetic control of the cellular in vitro response to the H-Y antigen in the rat. Transplantation 56, 448--452. Geiger, T., Andus, T., Klapproth, J., Hirano, T., Kishimoto, T., Heinrich, P. C. (1988). Induction of rat acute-phase proteins by interleukin-6 in vivo. Eur. J. Immunol. 18, 717-721. Geisert, E. E. J., Yang, L., Irwin, M. H. (1996). Astrocyte growth, reactivity, and the target of the antiproliferative antibody TAPA. J. Neurosci. 16, 5478-5487. Geisterfer, M., Richards, C. D., Baumann, M., Fey, G., Gwynne, D., Gauldie, J. (1993). Regulation of IL-6 and hepatic IL-6 receptor in acute inflammation in vivo. Cytokine 5, 1-7. Giegerich, G., Stangel, M., Torres-Nagel, N. E., H~inig, T., Toyka, K. (1995). Sequence and diversity of rat T-cell receptor Tcra V8 gene segments. Immunogenetics 41, 125-130. Gill III, T. J. (1996). Role of the Major Histocompatibility Complex region in reproduction, cancer, and autoimmunity. Am. J. Reprod. Immunol. 35,211-215. Gill III, T. J., Natori, T., Salgar, S. K., Kunz, H. W. (1995). Current status of the major histocompatibility complex in the rat. Transpl. Proc. 27, 1495-1500. Giometto, B., Bozza, F., Argentiero, V., Gallo, P., Pagni, S., Piccinno, M. G., Tavolato, B. (1990). Transferrin receptors in rat central nervous system. An immunocytochemical study. J. Neurol. Sci. 98, 81-90. Go, L. L., Healey, P. J., Watkins, S. C., Simmons, R. L., Rowe,

References

M. I. (1995). Effect of endotoxin on intestinal mucosal permeability to bacteria in vitro. Arch. Surg. 130, 53-58. Gold, D. P., Surh, C. D., Sellins, K. S., Schroder, K., Sprent, J., Wilson, D. P. (1994). Rat T-cell responses to superantigens. II. Allelic differences in Vf18.2 and VflS.5 fi chains determine responsiveness to staphylococcal enterotoxin B and mouse mammary tumor virus-encoded products. J. Exp. Med. 179, 63-69. Gold, R., Giegerich, G., Hartung, H. P., Toyka, K. (1995). T-cell receptor (TCR) usage in Lewis rat experimental autoimmune encephalomyelitis: TCR beta-chain-variable-region V beta 8.2-positive T cells are not essential for induction and course of disease. Proc. Natl Acad. Sci. USA 82, 5850-5854. Goldschneider, I., Gordon, L. K., Morris, R. J. (1978). Demonstration of Thy-1 antigen on pluripotent hemopoietic stem cells in the rat. J. Exp. Med. 148, 1351-1366. Goodman, R. E., Oblak, J., Bell, R. G. (1992). Symhesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured OXS- OX22- thoracic duct T cells. Biochem. Biophys. Res. Commun. 189, 1-7. Gorman, S., Clark, M., Routledge, E., Cobbold, S. (1991). Reshaping a therapeutic CD4 antibody. Proc. Natl Acad. Sci. USA 88, 4181-4185. Gorrell, M. D., Wickson, J., McCaughan, G. W. (1991). Expression of the rat CD26 antigen (dipeptidyl peptidase IV) on subpopulations of rat lymphocytes. Cell. Immunol. 134, 205215. Grabar, P., Courcon, J. (1958). Etude des s~rums de cheval, lapin, rat et souris par l'analyse immuno~lectrophor&ique. Bull. Soc. Chim. Biol. 40, 1993-2003. Gray, D. (1988). Population kinetics of rat peripheral B cells. J. Exp. Med. 167, 805-816. Gray, D., MacLennan, I. C. M., Bazin, H., Khan, M. (1982). Migrant/~+ 8 + and static/~+ 8 - B lymphocyte subsets. Eur. J. Immunol. 12, 564-569. Gray, D., McConell, I., Kumararatne, D. S., Humphrey, J. H., Bazin, H. (1984). Marginal zone cells express CR1 and CR2 receptor. Eur. J. Immunol. 14, 47-52. Greene, E. C. (1935). Anatomy of the rat. Trans. Am. Phil. Soc., New Ser., XXVII, 1-370. Greenfield, E. M., Shaw, S. M., Gornik, S. A., Banks, M. A. (1995). Adenyl cyclase and interleukin-6 are downstream effectors of parathyroid hormone resulting in stimulation of bone resorption. J. Clin. Invest. 96, 1238-1244. Greiner, D. L., Reynolds, C., Lubaroff, D. M. (1982). Maturation of functional T-lymphocyte subpopulations in the rat. Thymus 4, 77-90. Greiner, D. L., Handler, E. S., Nakano, K., Mordes, J. P., Rossini, A. A. (1986). Absence of the RT6 T cell subset in diabetes-prone BB/W rats. J. Immunol. 136, 148-151. Greiner, D. L., Mordes, J. P., Handler, E. S., Angelillo, M., Nakamura, N., Rossini, A. A. (1987). Depletion of RT6.1* T lymphocytes induces diabetes in resistant BioBreeding/Worcester (BB/W) rats. J. Exp. Med. 166, 461-475. Greiner, D. L., Mordes, J. P., Angelillo, M., Handler, E. S., Mojcik, C. F., Nakamura, N., Rossini, A. A. (1988). Role of regulatory RT6 + T-cells in the pathogenesis of diabetes mellitus in BB/Wor rats. In Frontiers in Diabetes Research: Lessons from Animal Diabetes II (eds Shafrir, E., Renold, A. E.), pp. 58-67. John Libbey, London, UK. Griffiths, M. M., Cremer, M. A., Harper, D. S., McCall, S., Cannon, G. W. (1992). Immunogenetics of collagen-induced

205

arthritis in rats. Both MHC and non-MHC gene products determine the epitope specificity of immune response to bovine and chick type II collagens. J. Immunol. 149, 309-316. Groen, H., van der Berk, J. M. M. M., Nieuwenhuis, P., Kampinga, J. (1989). Peripheral T cells in diabetes prone (DP) BB rats are CD45R-negative. Thymus, 14, 145-150. Groen, H., Klatter, F. A., van Petersen, A. S., Pater, J. M., Nieuwenhuis, P., Kampinga, J. (1993). Composition of rat CD4 + resting memory T-cell pool is influenced by major histocompatibility complex. Transp!. Proc. 25, 2782-2783. Groen, H., Klatter, F. A., Brons, N. H. C., Wubbena, A. S., Nieuwenhuis, P., Kampinga, J. (1995). High-frequency, but reduced absolute numbers of recent thymic migrants among peripheral blood T lymphocytes in diabetes-prone BB rats. Cell. Immunol. 163, 113-119. Groen, H., Klatter, F. A., Brons, N. H. C., Mesander, G., Nieuwenhuis, P., Kampinga, J. (1996a). Abnormal thymocyte subset distribution and differential reduction of CD4 § and CD8 + T cell subsets during peripheral maturation in diabetes-prone BB rats. J. Immunol. 156, 1269-1275. Groen, H., Pater, J. M., Klatter, F. A., Nieuwenhuis, P., Rozing, J. (1996b). Expression of RT6, but not CD45RC is disturbed on immature peripheral T cells in the BB rat. Adv. Exp. Med. Biol. 419, 253-256. Guberski, D. L., Butler, L., Like, A. A. (1988). The BBZ/Wor rat: an obese animal with autoimmune diabetes. In Frontiers in Diabetes Research: Lessons from Animal Diabetes II (eds Renold, A., Shafrir, E.), pp. 182-185. John Libbey, London, UK. Guberski, D. L., Thomas, V. A., Shek, W. R., Like, A. A., Handler, E. S., Rossini, A. A., Wallace, J. E., Welsh, R. M. (1991). Induction of type 1 diabetes by Kilham's rat virus in diabetes resistant BB/Wor rats. Science 254, 1010-1013. Guberski, D. L., Butler, L., Manzi, S. M., Stubbs, M., Like, A. A. (1993). The BBZ/Wor rat: clinical characteristics of the diabetic syndrome. Diabetologia 36, 912-919. GuSrin, M. (1954). Tumeurs Spontan~es des Animaux de Laboratoire. A. Legrand et Cie, Paris, France. Gu~ry, J.-C., Druet, E., Glotz, D., Hirsch, F., Mandet, C., De Heer, E., Druet, P. (1990). Specificity and cross-reactive idiotypes of anti-glomerular basement membrane autoantibodies in HgC12-induced autoimmune glomerulonephritis. J. Immunol. 20, 93-100. G/inthert, U., Hofmann, M., Rudy, W., Reber, S., Z611er, M., Haussmann, I., Matzku, S., Wenzel, A., Ponta, H., Herrlich, P. (1991). A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 65, 13-24. Gutman, G. A., Weissman, I. L. (1971). Inheritance and strain distribution of a rat immunoglobulin allotype. J. Immunol. 107, 1390-1393. Gutman, G. A., Loh, E., Hood, L. (1975). Structure and regulation of immunoglobulins: kappa allotypes in the rat have multiple amino acid differences in the constant region. Proc. Natl Acad. Sci. USA 72, 5046-5050. Gutman, G. A., Bazin, H., Rocklin, C. V., Nezlin, R. S. (1983). A standard nomenclature for rat immunoglobulin allotypes. Transplant. Proc. 15, 1685-1686. Hameleers, D. M. H., van der Ende, M., Biewenga, J., Sminia, T. (1989). An immunohistochemical study on the postnatal development of rat nasal-associated lymphoid tissue (NALT). Cell Tissue Res. 256, 431-438. Hameleers, D. M. H., van der Ven, I., Biewenga, J., Sminia, T.

206

(1991). Mucosal and systemic antibody formation in the rat after intranasal administration of three different antigens. Immunol. Cell Biol. 69, 119-125. Hart, R. P., Liu, C., Shadiack, A. M., McCormack, R. J., Jonakait, G. M. (1993). An mRNA homologous to interleukin-1 receptor type I is expressed in cultured rat sympathetic ganglia. J. Neuroimmunol. 44, 49-56. Hashim, G., Vandenbark, A. A., Gold, D. P., Diamanduros, T., Offner, H. (1991). T cell lines specific for an immunodominant epitope of human basic protein define an encephalotigenic determinant for experimental autoimmune encephalomyelitis resistant LOU/M rats. J. Immunol. 146, 515-520. Heiman, H. S., Weisman, L. E. (1989). Transplacental or enteral transfer of maternal immunization-induced antibody protects suckling rats from type III group B streptococcal infections. Pediatr. Res. 26, 629-632. Helene, A., Milhiet, P. E., Haouas, H., Boucheix, C., Beaumint, A., Roques, B. P. (1992). Effects of monoclonal antibodies against the common acute lymhoblastic leukemic antigen on endopeptidase-24.11 activity. Biochem. Pharmacol. 43, 809814. Helfrich, M. H., Nesbitt, S. A., Horton, M. A. (1992). Integrins on rat osteoclasts: characterization of two monoclonal antibodies (F4 and Fll) to rat beta 3. J. Bone Miner. Res. 7, 345351. Hellman, L., Petterson, U., Engstr6m, A., Karlsson, T., Bennich, H. (1982a). Structure and evolution of the heavy chain from rat immunoglobulin E. Nucl. Acids Res. 10, 6041-6049. Hellman, L., Pettersson, U., Bennich, H. (1982b). Characterization and molecular cloning of the mRNA for the heavy (e) chain of rat immunoglobulin E. Immunology 79, 1264-1268. Hellman, L., Engstr6m, A., Bennich, H., Pettersson, U. (1985). Structure and expression of kappa-chain genes in two IgEproducing rat immunocytomas. Gene 40, 107-114. Hermans, M. H. A., Opstelten, D. (1991). In situ visualization of hemopoietic cell subsets and stromal elements in rat and mouse bone marrow by immunostaining of frozen sections. J. Histochem. Cytochem. 39, 1627-1634. Hermans, M. H. A., Hartsuiker, H., Opstelten, D. (1989). An in situ study of B lymphopoiesis in rat bone marrow: topographical arrangement of terminal deoxynucleotidyl transferase positive cells and pre-B cells. J. Immunol. 142, 67-73. Hermans, M. H., Wubbena, A. S., Kroese, F. G. M., Hunt, S. V., Cowan, R., Opstelten, D. (1992). The extent of clonal structure in different lymphoid organs. J. Exp. Med. 175, 1255-1269. Hermans, M., Deenen, G. J., De Boer, N., Bo, W., Kroese, F. G. M., Opstelten, D. (1997). Expression of HIS50 Ag: a rat homologue of mouse heat-stable antigen and human CD24 on B lymphoid cells in the rat. Immunology 90, 14-22. Herrmann, T., Hochgrebe, T., Torres-Nagel, N., Huber, B., H~inig, T. (1994). Control of the rat T cell response to retroviral and bacterial superantigens by class II MHC products and Tcrb-V8.2 alleles. J. Immunol. 152, 4300-4309. Hickey, W. F., Kimura, H. (1988). Perivascular microglial cells of the CNS are bone-marrow derived and present antigen in vivo. Science 239, 290-292. Himeno, M., Noguchi, Y., Sasaki, H., Tanaka, Y., Furuno, K., Kono, A., Sasaki, Y., Kato, K. (1989). Isolation and sequencing of a cDNA clone encoding 107 kDa sialoglycoprotein in rat liver lysosomal membranes. FEBS Lett. 244, 351-356.


Himmler, A., Maurer-Fogy, I., Kronke, M., Scheurich, P., Pfizenmaier, K., Lantz, M., Olsson, I., Hauptmann, R., Stratowa, C., Adolf, G. R. (1990). Molecular cloning and expression of human and rat tumor necrosis factor receptor chain (p60) and its soluble derivative, tumor necrosis factorbinding protein. DNA Cell Biol. 9, 705-715. Hinkkanen, A. E., M/i/itt/i, J., Qin, Y.-F., Linington, C., Salmi, A., Wekerle, H. (1993). Novel Tcra-V and -J transcripts expressed in rat myelin-specific T-cell lines. Immunogenetics 37, 235-238. Hirsch, F., Druet, E., Vendeville, B., Cormont, F., Bazin, H., Druet, P. (1984). Production of monoclonal anti-glomerular basement membrane antibodies during autoimmune glomerulonephritis. Clin. Immunol. Immunopathol. 33,425-430. Hirsch, F., Kuhn, J., Ventura, M., Vial, M.-C., Fournie, G., Druet, P. (1986). Autoimmunity induced by HgC12 in BrownNorway rats. J. Immunol. 136, 3272-3276. Hixson, D., McEntire, K., Obrink, B. (1985). Alterations in the expression of a hepatocyte cell adhesion molecule by transplantable rat hepatocellular carcinomas. Cancer Res. 45, 3742-3749. Ho, F., Lortan, J. E., MacLennan, I. C. M., Khan, M. (1986). Distinct short-lived and long-lived antibody-producing cell populations. Eur. J. Immunol. 16, 1297-1301. Hodits, R. A., Nimpf, J., Pfistermueller, D. M., Hiesberger, T., Schneider, W. J., Vaughan, T. J., Johnson, K. S., Haumer, M., Kuechler, E., Winter, G., Blaas, D. (1995). An antibody fragment from a phage display library competes for ligand binding to the low density lipoprotein receptor family and inhibits rhinovirus infection. J. Biol. Chem. 270, 24078-24085. Holt, P. G., Schon-Hergard, M. A. (1987). Localization of T cells, macrophages and dendritic cells in rat respiratory tract tissue: implications for immune function studies. Immunology 62, 349-356. Hood, L., Gray, W. R., Sanders, B. G., Dreyer, W. J. (1967). Light chain evolution. Cold Spring Harbor Symp. Quant. Biol. 22, 133. Horlick, R. A., Stack, S. L., Cooke, G. M. (1992). Cloning, expression and tissue distribution of the gene encoding rat fibroblast growth factor receptor subtype 4. Gene 120, 291295. Horton, M. A., Taylor, M. L., Arnett, T. R., Helfrich, M. H. (1991). Arg-Gly-Asp (RGD) peptides and the anti-vitronectin receptor antibody 23C6 inhibit dentine resorption and cell spreading by osteoclasts. Exp. Cell Res. 195,368-375. Hosseinzadeh, H., Goldschneider, I. (1993). Recent thymic emigrants in the rat express a unique phenotype and undergo post-thymic maturation in peripheral tissues. J. Immunol. 150, 1670-1679. Hougen, H. P. (1991). The athymic nude rat. Act. Pathol. Microbiol. Immunol. Scand. 99, 9-39. Howe, C. L., Granger, B. L., Hull, M., Green, S. A., Gabel, C. A., Helenius, A., Mellman, I. (1988). Derived protein sequence, oligosaccharides, and membrane insertion of the 120 kDa lysosomal membrane glycoprotein (lgp120): identification of a highly conserved family of lysosomal membrane glycoproteins. Proc. Natl Acad. Sci. USA 85, 7577-7581. Howell, D. N., Anuja, V., Jones, L., Blow, O., Saufilippo, F. P. (1994). Differential expression of CD43 (leukosialin, sialophorin) by mononuclear phagocyte populations. J. Leukoc. Biol. 55,536-544. Huang, S., Paulauskis, J. D., Kobzik, L. (1992). Rat KC cDNA

References

cloning and mRNA expression in lung macrophages and fibroblasts. Biochem. Biophys. Res. Commun. 184, 922-929. Hughes, T. R., Piddlesden, S. J., Williams, J. D., Harrison, R. A., Morgan, B. P. (1992). Isolation and characterization of a membrane protein from rat erythrocytes which inhibits lysis by the membrane attack complex of rat complement. Biochem. J. 284, 169-176. Hughes, T. R., Meri, S., Davies, M., Williams, J. D., Morgan, B. P. (1993). Immunolocalization and characterization of the rat analogue of human CD59 in kidney and glomerular cells." Immunology 80, 439-444. Huitinga, I., Damoiseaux, J. G. M. C., D6pp, E. A., Dijkstra, C. D. (1993). Treatment with anti-CR3 antibodies suppresses experimental allergy in Lewis rats. Eur. J. Immunol. 23,709715. Humphrey, R. L., Santos, G. S. (1971). Serum protein allotype markers in certain inbred rat strains. Fed. Proc. Fed. Am. Soc. Exp. Biol. 30, 248. H~inig, T. (1988). Crosslinking of the T-cell antigen receptor interferes with the generation of CD4 +8+thymocytes from their immediate CD4-8 + precursors. Eur. J. Immunol. 18, 2089-2092. H~inig, T., Wallny, H.-J., Hartley, J. K., Lawetzky, A., Tiefenthaler, G. (1989). A monoclonal antibody to a constant determinant of the rat T cell antigen receptor that induces T cell activation. J. Exp. Med. 169, 73-86. Hunt, H. D., Lubaroff, D. M. (1987). Changes in membrane antigen phenotype of T cells during lectin activation. Transpl. Proc. 19, 3179-3180. Hunt, S. V. (1979). The presence of Thy-1 on the surface of rat lymphoid stem cells and colony forming units. Eur. J. Immunol. 9, 853-859. Hunt, S. V., Mason, D. W., Williams, A. F. (1977). In rat bone marrow Thy-1 antigen is expressed on cells with membrane immunoglobulin and on precursors of peripheral B lymphocytes. Eur. J. Immunol. 7, 817-823. Hunt, S. Vo, Medlock, E. S., Greiner, D. L., Goldschneider, I., Opstelten, D. (1988). Rat immunoglobulin genes have comparable patterns of JH rearrangement in normal peripheral and in pre-B and cultured TdT + cells from bone marrow. Adv. Exp. Med. Biol, 237, 63-68. Ichimiya, S., Kikuchi, K., Matsuura, A. (1994). Structural analysis of the rat homologue of CD1. Evidence for evolutionary conservation if the CDID class and widespread transcription by rat cells. J. Immunol. 153, 1112-1123. Ikawa, M., Shozen, Y. (1990). Quantification of acute phase proteins in rat serum and in the supernatants of a cultured rat hepatoma cell line and cultured primary hepatocytes by an enzyme-linked immunosorbent assay. J. Immunol. Meth. 134, 101-106. Isashi, Y., Tamakoshi, M., Nagai, Y., Sudo, T., Murakami, M., Uede, T. (1995). The rat neutrophil low-affinity receptor for IgG: molecular cloning and functional characterization. Immunol. Lett. 46, 157-163. Issekutz, A. C., Issekutz, T. B. (1992). The contribution of LFA-1 (CDlla/CD18) and MAC-1 (CDllb/CD18) to the in vivo migration of polymorphonuclear leucocytes to inflammatory reactions in the rat. Immunology 76, 655-661. Issekutz, A. C., Ayer, L., Miyasaka, M., Issekutz, T. B. (1996). Treatment of established adjuvant arthritis in rats with monoclonal antibody to CD18 and very late activation antigen-4 integrins suppresses neutrophil and T-lymphocyte

207

migration to the joints and improves clinical disease. Immunology 88,569-576. Issekutz, T. B. (1991). Inhibition of in vivo lymphocyte migration to inflammation and homing to lymphoid tissues by the TA-2 monoclonal antibody. A likely role of VLA-4 in vivo. J. Immunol. 147, 4178-4184. Issekutz, T. B., Wykretowicz, A. (1991). Effect of a new monoclonal antibody, TA-2, that inhibits lymphocyte adherence to cytokine stimulated endothelium in the rat. J. Immunol. 147, 109-116. Issekutz, T. B., Miyasaka, M., Issekutz, A. C. (1996). Rat blood neutrophils express very late antigen 4 and it mediates migration to arthritic joint and dermal inflammation. J. Exp. Med. 183, 2175-2184. Itoh, Y., Matsuura, A., Kinebuchi, M., Honda, R., Takayama, S., Ichimya, S., Kon, S., Kikuchi, K. (1993). Structural analysis of the CD3 zeta/eta locus of the rat. Expression of zeta but not eta transcripts by rat T cells. J. Immunol. 151, 4705-4717. Jarry, A., Robaszkiewicz, M., Brousse, N., Potet, F. (1989). Immune cells associated with M cells in the follicle-associated epithelium of Peyer's patches in the rat. An electron- and immuno-electron microscopic study. Cell Tissue Res. 255, 293-298. Jefferies, W. A., Brandon, M. R., Hunt, S. V. (1984). Transferrin receptor on endothelium of brain capillaries. Nature 312, 162163. Jefferies, W. A., Brandon, M. R., Williams, A. F., Hunt, S. V. (1985a). Analysis of lymphopoietic stem cells with a monoclonal antibody to the rat transferrin receptor. Immunology 54, 333-341. Jefferies, W. A., Green, J. R., Williams, A. F. (1985b). Authentic T helper CD4 (W3/25) antigen on rat peritoneal macrophages. J. Exp. Med. 162, 117-127. Jochen, A., Hays, J. (1993). Purification of the major substrate for palmitoylation in rat adipocytes: N terminal homology with CD36 and evidence for cell surface acylation. J. Lipid Res. 34, 1783-1792. Joling, P., Tielen, F. J., Vaessen, L. M. B., Hesse, C. J., Rozing, J. R. (1985a). Intrathymic differentiation in the rat. Adv. Exp. Med. Biol. 186, 235-244. Joling, P., Tielen, F. J., Vaessen, L. M. B., Huijbregts, J. M. A., Rozing, J. (1985b). New markers on T cell subpopulations defined by monoclonal antibodies. Transpl. Proc. 17, 18571860. Jones, M., Cordell, J. L., Beyers, A. D., Tse, A. G., Mason, D. Y. (1993). Detection of T and B cells in many animal species using cross-reactive anti-peptide antibodies. J. Immunol. 150, 5429-5435. Jones, V. E. (1969). Rat 7S immunoglobulins: characterization of gamma2- and gammal-anti-hapten antibodies. Immunology 16, 589-599. Jones, V. E., Edwards, A. J. (1971). Preparation of an antiserum specific for rat reagin (rat gammaE?). Immunology 21, 383385. Judge, T. A., Liu, M., Christensen, P. J., Fak, J. J. (1995). Cloning the rat homolog of the CD28/CTLA-4 ligand B7-1; structural and functional analysis. Int. Immunol. 7, 171-178. Jung, H. C., Ecjmann, L., Yang, S. K., Panja, A., Fierer, J., Morzycka-Wroblewska, E., Kagnoff, M. F. (1995). A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Invest. 95, 55-65.

208

Jyung, R. W., Wu, L., Pierce, G. F., Mustoe, T. A. (1994). Granulocyte-macrophage colony-stimulating factor and granu!ocyte colony-stimulating factor: differential action on incisional wound healing. Surgery 115,325-334. Kamegai, M., Niijima, K., Kunishita, T., Nishizawa, M., Ogawa, M., Araki, M., Ueki, A., Konishi, Y., Tabira, T. (1990). Interleukin-3 as a trophic factor for central cholinergic neurons in vitro and in vivo. Neuron 2, 429-436. Kampinga, J. (1991). Invariant involvement of IL-2 in thymocyte differentiation (Reply). Immunol. Today 12, 246-247. Kampinga, J., Aspinall, R. (1990). Thymocyte differentiation and thymic micro-environment development in the fetal rat thymus: an immunohistological approach. In Thymus Update 3 (eds Kendall, M. D., Ritter, M. A.), pp. 149-186. Harwood Academic Publishers, London, UK. Kampinga, J., Berges, S., Boyd, R. L., Brekelmans, P., Colic, M., van Ewijk, W., Kendall, M., Ladyman, H., Nieuwenhuis, P., Ritter, M. A., Schuurman, H. J., Tournefier, A. (1989a). Thymic epithelial antibodies: immunohistological analysis and introduction of nomenclature. Summary of the Epithelium Workshop held at the 2nd Workshop on the Thymus" Histophysiology and Dynamics in the Immune System. Thymus 13,165-173. Kampinga, J., Kroese, F. G. M., Pol, G. H., Niewenhuis, P., Haag, F., Singh, P. B., Roser, B., Aspinall, R. (1989b). A monoclonal antibody to a determinant of the rat T cell antigen receptor expressed by a minor subset of T cells. Int. Immunol. 1,289-295. Kampinga, J., Schuurman, H. J., Pol, G. H., Bartels, H., Vaessen, L, M. B., Tielen, F. J., Rozing, J., Blaauw, E. H., Roser, B., Aspinall, R., Nieuwenhuis, P. (1990a). Vascular thymus transplantation in rats. Technique, morphology and function. Transplantation 50, 669-678. Kampinga, J., Nieuwenhuis, P., Roser, B., Aspinall, R. (1990b). Differences in turnover between thymic medullary dendritic cells and a subset of cortical macrophages. J. Immunol. 145, 1659-1663. Kampinga, J., Kroese, F. G. M,, Pol, G, H., Opstelten, D., Seijen, H. G., Boot, J. H., Roser, B., Nieuwenhuis, P., Aspinall, R. (1990c). RT7-defined alloantigens in rats are part of the leucocyte common antigen family. Scan. J. Immunol. 31, 699-710. Kampinga, J., Kroese, F. G. M., Pol, G. H., Meedendorp, B., van Eendenburg, J., Groen, H., van Den Bogaerde, J., Nieuwenhuis, P., Roser, B., Aspinall, R. (1990d). Inhibition of T cell responses in vitro by an antibody against a novel lymphocyte surface molecule (QCA-1). Int. Immunol. 2, 915-920. Kampinga, J., Groen, H., Klatter, F. A., Meedendorp, B., Aspinall, R., Roser, B., Nieuwenhuis, P. (1992). Postthymic T cell development in rats: an update. Biochem. Soc. Trans. 20, 191-197. Kampinga, J., Groen, H., Klatter, F. A., Pater, J. M., van Petersen, A. S., Roser, B., Nieuwenhuis, P., Aspinall, R. (1997). Postthymic T cell development in the rat. Thymus, 24, 173-200. Kampschmidt, R. F., Mesecher, M. (1985). Interleukin-1 from P388D: effects upon neutrophils plasma iron, and fibrinogen in rats, mice, and rabbits. Proc. Soc. Exp. Biol. Med. 179, 197200. Kanagawa, K., Ishikura, H., Takahashi, C., Tamatani, T., Myisaka, M., Koyanagi, T., Yoshiki, T. (1991). Identification of ICAM-1 positive cells in the nongrafted and transplanted


rat k i d n e y - an immunohistochemical and ultrastructural study. Transplantation 52, 1052-1062. Kanbour-Shakir, A., Kunz, H. W., Gill, T. J., Armstrong, D. T., MacPherson, T. A. (1990). Morphologic changes in the rat uterus following natural mating and embryo transfer. Am. J. Reprod. Immunol. 23, 78-83. Kantor, A. B., Herzenberg, L. A. (1993). Origin of murine B cell lineages. Annu. Rev. Immunol. 11,501-538. Karp, S. L., Kieber-Emmons, T., Sun, M.-J., Wolf, G., Neilson, E. G. (1993). Molecular structure of a cross-reactive idiotype on autoantibodies recognizing parenchymal self. J. Immunol. 150, 867-879. Keller, R., joller, P. w., Keist, R. (1989). Surface phenotype of rat bone marrow derived mononuclear phagocytes. Cell. Immunol. 120, 277-285. Kendall, M. D., A1-Shawaf, A. (1991). The innervation of the rat thymus. Brain Behav. Immun. 5, 9-28. Killeen, N., Barclay, A. N., Willis, A. C., Williams, A. F. (1987). The sequence of rat leukosialin (W3/13 antigen) reveals a molecule with O-linked glycosylation of one third of its extracellular amino acids. EMBO J. 6, 4029-4034. Kim, J. G., Abeyounis, C. J. (1988). Monoclonal rat antibodies to rat carcinoembryonic antigen. Immunol. Invest. 17, 41-48. Kim, J. G., Abeyounis, C. J. (1990). Isolation and characterization of rat carcinoembryonic antigen. Int. Arch. Allergy Appl. Immunol. 92, 43-49. Kimura, K., Wakatsuki, T., Yamamoto, M. (1994). A variant mRNA species encoding a truncated form of Fas antigen in the rat liver. Biochem. Biophys. Res. Commun. 198, 666-674. Kinebuchi, M., Kikuchi, K., Matsuura, A. (1994). Rat T-cell receptor 7 chain sequences- identification of conserved gene segments and a unique chimeric constant region gene, C4L. Immunogenetics 40, 449-455. Kirchhoff, H., Binder, A., Runge, M., Meier, B., Jacobs, R., Busche, K. (1989). Pathogenetic mechanisms in the Mycoplasma arthritidis polyarthritis of rats. Rheumatol. Int. 9, 193-196. Kishimoto, T., Goyert, S., Kikutani, H., Mason, D., Miyasaka, M., Moretta, L., Ohno, T., Okumura, K., Shaw, S., Springer, T. A., Sugamura, K., Sugawara, H., Von dem Borne, A. E. G. K., Zola, H., eds. (1997). Leucocyte typing VI: White Cell Differentiation Antigens, Garland Publishers (in press). Kita, Y., Takashi, T., Tamatani, T., Miyasaka, M., Horiuchi, T. (1992). Sequence and expression of rat ICAM-1. Biochim. Biophys. Acta 1131, 108-110. Kitani, S., Berenstein, E., Mergenhagen, S., Tempst, P., Siraganian, R. P. (1991). A cell surface glycoprotein of rat basophilic leukemia cells close to the high affinity IgE receptor (Fc~RI). J. Biol. Chem. 266, 1903. Klatter, F. A., Rau~, H. P., Bartels, H. L., Pater, J. M., Groen, H. G., Nieuwenhuis, P., Kampinga, J. (1995). Simultaneous transplantation and intrathymic tolerance induction. A method with clinical potential. Transplantation 60, 12081210. Klonz, A., Wonigeit, K., Pabst, R., Westermann, J. (1996). The marginal blood pool of the rat contains not only granulocytes but also lymphocytes, NK-cells and monocytes: a second intravascular compartment, its cellular composition, adhesion molecule expression and interaction with the peripheral blood pool. Scand. J. Immunol. 44, 461-469. Koguma, T., Takawasa, S., Togho, A., Karawasa, T., Furuya, Y., Yonekura, H., Okamoto, H. (1994). Cloning and char-

References

acterization of cDNA encoding rat ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase (homologue to human CD38) from islets of Langerhans. Biochim. Biophys. Acta 1223, 160162. Konishi, K., Takata, Y., Watanabe, K., Date, K., Yamamoto, M., Murase, A., Yoshida, H., Suzuki, T., Tsurufuji, S., Fujioka, M. (1993). Recombinant expression of rat and human GRO proteins in Escherichia coli. Cytokine 5,506-511. Koop, B. F., Rowen, L., Wang, K., Kuo, C. L., Seto, D., Lenstra, J. A., Howard, S., Shah, W., Deshpande, P., Hood, L. (1994). The human T-cell receptor TCRAC/TCRDC (C~/C8) region: Organization, sequence, and evolution of 97.6 Kb of DNA. Genomics 19, 478-493. Koornstra, P. J., de Jong, F. I., Vlek, L. F., Marres, E. H., van Breda-Vriesman, P. J. (1991). The Waldeyer ring equivalent in the rat. A model for analysis of oronasopharyngeal immune responses. Actas Otolaryngol. Stockholm 111,591-599. Kosuda, L. L., Wayne, A., Nahounou, M., Greiner, D. L., Bigazzi, P. E. (1991). Reduction of the RT6.2 + subset of T lymphocytes in Brown Norway rats with mercury-induced renal autoimmunity. Cell Immunol. 135, 154-167. Kotani, M., Kawashima, I., Ozawa, K., Ogura, K., Ariga, T., Tai, T. (1994). Generation of one set of murine monoclonal antibodies specific for globo-series glycolipids: evidence for differential distribution of the glycolopids in rat small intestine. Arch. Biochem. Biophys. 310, 89-96. Kovalsky, H., Gallai, M., Armbrust, T., Ramadori, G. (1994). Syndecan-1 gene expression in isolated rat liver cells (hepatocytes, Kupffer cells, endothelial cells and Ito cells). Biochem. Biophys. Res. Comm. 204, 944-949. Kowal, R. C., Herz, J., Goldstein, J. L., Esser, V., Brown, M. S. (1989). Low density lipoprotein receptor-related protein mediates uptake of cholesteryl esters derived from apoprotein Eenriched lipoproteins. Proc. Natl Acad. Sci. USA 86, 58105814. Krieger, M., Herz, J. (1994). Structures and functions of multiligand lipoprotein receptors: macrophage scavenger receptors and LDL receptor-related protein. Annu. Rev. Biochem. 63, 601-637. Kroemer, G., Martinez, A. C. (1991). Invariant involvement of IL-2 in thymocyte differentiation (Letter). Immunol. Today 12, 246. Kroese, F. G. M., Opstelten, D., Wubbena, A. S., Deenen, G. J., Aten, J., Schwander, E. H., De Leij, L., Nieuwenhuis, P. (1985a). Monoclonal antibodies to rat B lymphocyte (sub-) population. Adv. Exp. Med. Biol. 186, 81-89. Kroese, F. G. M, Wubbena, A. S., Joling, P., Nieuwenhuis, P. (1985b). T-lymphocytes in rat lymphoid follicles are a subset of T helper cells. In Advances in Experimental Medicine and Biology (ed. Klaus, G. G. B.), 186, 443. Plenum Press, New York, USA. Kroese, F. G. M., Wubbena, A. S., Nieuwenhuis, P. (1986). Germinal centre formation and follicular antigen trapping in the spleen of lethally X-irradiated and reconstituted rats. Immunology 57, 99-104. Kroese, F. G. M., Wubbena, A. S., Opstelten, D., Deenen, G. J., Schwander, E. H., De Leij, L., Vos, H., Poppema, S., Volberda, J., Nieuwenhuis, P. (1987a). B lymphocyte differentiation in the rat: production and characterization of monoclonal antibodies to B lineage-associated antigens. Eur. J. Immunol. 17, 921-928. Kroese, F. G. M., Wubbena, A. S., Seijen, H. G., Nieuwenhuis, P.

209

(1987b). Germinal centers develop oligoclonally. Eur. J. Immunol. 17, 1069-1072. Kroese, F. G. M., Butcher, E. C., Lalor, P. A., Stall, A. M., Herzenberg, L. A. (1990). The rat B cell system: the anatomical localization of flow cytometry-defined B cell subpopulations. Eur. J. Immunol. 20, 1527-1534. Kroese, F. G. M., Hermans, M. H., De Boer, N. K., Lalor, P. A., Stall, A. M., Butcher, E. C., Herzenberg, L. A. (1991). Rat B cell subsets identified by flow cytometry and their anatomical counterparts. In Lymphatic Tissues and in vivo Immune Responses (eds Ezine, S., Berrih-Aknin, S., Imhof, B.), pp. 397-402. Marcel Dekker, New York, USA. Kroese, F. G. M., Kantor, A. B., Herzenberg, L. A. (1994). The role of B-I cells in mucosal immune responses. In Handbook of Mucosal Immunology (ed. Ogra, P. L.), pp. 217-224. Academic Press, Inc., New York, USA. Kroese, F. G. M., de Boer, N. K., de Boer, T., Nieuwenhuis, P., Kantor, A. B,, Deenen, G. J. (1995). Identification and kinetics of two recently bone marrow-derived B cell populations in peripheral lymphoid tissues. Cell. Immunol. 162, 185-193. Kfihnlein, P., Park, H.-J., Herrmann, T., Elbe, A., Hfinig, T. (1994). Identification and characterization of rat ),/8 T-lymphocytes in peripheral lymphoid organs, small intestine, and skin with a monoclonal antibody to a constant determinant of the ),/8 T-cell receptor. J. Immunol. 153,979. K~ihnlein, P., Vicente, A., Varas, A., Hfinig, T., Zapata, A. (1995).),/8 T-cells in fetal, neonatal and adult rat lymphoid organs. Developmental Immunology 4, 181-188. Kfihnlein, P., Mitnacht, R., Torres-Nagel, N. E., Herrmann, T., Elbe, A., Hfinig, T. (1996). The canonical T-cell receptor of dendritic epidermal ),/8 T-cells is highly conserved between rats and mice. Eur. J. Immunol. 26, 3092-3097. Kumamaratne, D. S., MacLennan, I. C. M. (1981). Cells of the marginal zone of the spleen are lymphocytes derived from recirculating precursors. Eur. J. Immunol. 11,865-869. Kumar, S. N., Stewart, G. L., Steven, W. M., Seelig, L. L. (1989). Maternal to neonatal transmission of T-cell mediated immunity to Trichinella spiralis during lactation. Immunology 68, 87-95. Kunes, J., Kohoutova, M., Zicha, J. (1996). Major histocompatibility complex in the rat and blood pressure regulation. Am. J. Hypertens. 9, 675-680. Kunz, H. W., Cortese Hassett, A. L., Inomata, T., Misra, D. N., Gill, T. J. (1989). The RT1.G locus in the rat encodes a Qa/ TL-like antigen. Immunogenetics 30, 181-187. Kuper, C. F., Hemleers, D. M., Bruijntjes, J. P., van der Ven, I., Biewenga, J., Sminia, T. (1990). Lymphoid and non-lymphoid cells in nasal-associated lymphoid tissue (NALT) in the rat. An immuno- and enzyme-histochemical study. Cell Tissue Res. 259, 371-377. Kuper, C. F., Koornstra, P. J., Hameleers, D. M. H., Biewenga, J., Spit, B. J., Duijvestijn, A. M., van Breda Vriesman, P. J. C., Sminia, T. (1992). The role of nasopharyngeal lymphoid tissue. Immunol. Today 13,219-224. Kurokawa, T., Seno, M., Igarashi, K. (1988). Nucleotide sequence of rat basic fibroblast growth factor cDNA. Nucl. Acids Res. 16, 5201-5202. Kfitemeier, G., Hoehne, W., Werner, T., Shuh, R., Mozikat, R. (1994). Assembly of humanized antibody genes from synthetic oligonucleotides using a single-round PCR. Biotechniques 17, 242-246. Lai, L., Alaverdi, N., Chen, Z., Kroese, F. G. M., Bos, N. A.,

210

Huang, E. C. M. (1997). Monoclonal antibodies to human, mouse, and rat cluster of differentiation antigens. In The Handbook of Experimental Immunology, 5th edn (eds Weir, L. A. H. D., Herzenberg, L. A.), pp. 61.1-61.37. Blackwell Science Inc., Cambridge, MA, USA. Lakkis, F. G., Cruet, E. N. (1993). Cloning of rat interleukin-13 (IL-13) cDNA and analysis of IL-13 gene expression in experimental glomerulonephritis. Biochem. Biophys. Res. Commun. 197, 612-618. Lam, K. P., Stall, A. M. (1994). Major histocompatibility complex class II expression distinguishes two distinct B cell developmental pathways during ontogeny. J. Exp. Med. 180, 507-516. Lane, P. J. L., Gray, D., Oldfields, S., MacLennan, I. C. M. (1986). Differences of recruitment of virgin B cells into antibody responses to thymus-dependent and thymus-independent type-2 antigens. Eur. J. Immunol. 16, 719-726. Lang, P., Mocikat, R. (1991). Immunoglobulin heavy chain joining genes in the rat: comparison with mouse and human. Gene 102,261-264. Law, D. A., Spruyt, L. L., Paterson, D. J., Williams, A. F. (1989). Subsets of thymopoietic rat thymocytes defined by expression of the CD2 antigen and the MRC OX-22 determinant of the leukocyte-common antigen CD45. Eur. J. Immunol. 19, 22892295. Lawetzky, A., Tiefenthaler, G., Kubo, R., Htinig, T. (1990). Identification and characterization of rat T-cell subpopulations expressing c~/fi and 7/8 T-cell receptors. Eur. J. Immunol. 20, 343-349. Lawetzky, A., Kubbies, M., Htinig, T. (1991). Rat 'first-wave' mature thymocytes: cycling lymphoblasts that are sensitive to activation-induced cell death but rescued by interleukin 2. Eur. J. Immunol. 21, 2599-2604. Lee, K. H., Bowen-Pope, D. F., Reed, R. R. (1990). Isolation and characterization of the alpha platelet-derived growth factor from rat olfactory epithelium. Mol. Cell Biol. 10, 2237-2246. Leenaerts, P. L., Stadt, R. K., Hall, B. M., van Damme, B. J., Vanrenterghem, Y., Daha, M. R. (1994). Hereditary C6 deficiency in a strain of PVG/c rats. Clin. Exp. Immunol. 97, 1-5. L4ger, O., Jackson, E., Dean, C. (1995). Primary structure of the variable regions encoding antibody to NG2, a tumour-specific antigen on the rat chondrosarcoma HSN. Correlation of idiotypic specificities with amino acid sequences. Mol. Immunol. 32, 697-709. Lehmann, M., Sternkopf, F., Metz, F., Brock, J., Docke, W. D., Plantikow, A., Kuttler, B., Hahn, H. J., Ringel, B., Volk, H. D. (1992). Induction of long-term survival of rat skin allografts by a novel, highly efficient anti-CD4 monoclonal antibody. Transplantation 54, 959-962. Leitenberg, D., Feldbush, T. L. (1988). Lymphokine regulation of surface Ia expression on rat B cells. Cell. Immunol. 111,451460. Leslie, G. A. (1984). Allotypic determinants (Igh-3) associated with the IgG2c subclass of rat immunoglobulins. Mol. Immunol. 21,577-580. Liebert, M., Kunz, H. W., Gill III, T. J., Cramer, D. V. (1982). CML characterization of a product of a second class ! locus in the rat MHC. Immunogenetics 16, 143-155. Liebert, M., Kunz, H. W., Gill III, T. J., Cramer, D. V. (1983). Comparison of antigens in the rat MHC that act as CML determinants. Int. Arch. Allergy Appl. Immunol. 72, 279-283.


Like, A. A., Guberski, D. L., Butler, L. (1986). Diabetic BB/Wor rats need not to be lymphopenic. J. Immunol. 136, 32543258. Lin, S. H., Culic, O., Flanagan, D., Hixson, D. C. (1991). Immunochemical characterization of two isoforms of rat liver ecto-ATPase that show an immunological and structural identity with a glycoprotein cell-adhesion molecule with Mw 105,000. Biochem. J. 278, 155-161. Lindner, V., Reidy, M. A. (1995). Platelet-derived growth factor ligand and receptor expression by large vessel endothelium in vivo. Am. J. Pathol. 146, 1488-1487. Liu, Y. J., Oldfield, S., MacLennan, I. C. M. (1988). Memory B cells in T cell-dependent antibody responses colonize the splenic marginal zones. Eur. J. Immunol. 18,355. Liu, Y. J., Zhang, J., Lane, P. J. L., Chan, E. T. Y., MacLennan, I. C. M. (1991). Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cellindependent antigens. Eur. J. Immunol. 21, 2951-2962. Liu, M., Liu, J., Buch, S., Tanswell, A. K., Post, M. (1995). Antisense oligonucleotides for PDGF-B and its receptor inhibit mechanical strain-induced fetal lung cell growth. Am. J. Physiol. 269, L178-L184. Liu, L., Tornquist, E., Mattson, P., Eriksson, N. P., Persson, J. K., Morgan, B. P., Aldskogius, H., Svensson, M. (1995). Complement and clustrin in the spinal cord dorsal horn and gracile nucleus following sciatic nerve injury in the adult rat. Neuroscience 68, 167-169. Lobel, S., Cramer, D. V. (1981). Demonstration of a new genetic locus in the major histocompatibility system of the rat. Immunogenetics 13,465-473. Locker, J., Gill III, T. J., Kraus, J. P., Ohura, T., Swarop, M., Riviere, M., Islam, M. Q., Levan, G., Szpirer, J., Szpirer, C. (1990). The rat MHC and cystathione beta-synthase gene are syntenic on chromosome 20. Immunogenetics 31,271-274. Lortan, J. E., Roobottom, C. A., Oldfield, S., MacLennan, I. C. M. (1987). Newly produced virgin B cells migrate to secondary lymphoid organs but their capacity to enter follicles is restricted. Eur. J. Immunol. 17, 1311-1316. Lu, J. H., Thiel, S., Wiedeman, A., Timpl, R., Reid, K. B. (1990). Binding of the pentamer/hexamer forms of mannan-binding protein to zymosan activates the proenzyme Clr2Cs2 complex of the classical pathway of complement without involvement of Clq. J. Immunol. 144, 2287-2294. Luheshi, G., Hopkins, S. J., Lefeuvre, R. A., Dascombe, M. J., Ghiara, P., Rothwell, N. J. (1993). Importance of brain IL-1 type II receptors in fever and thermogenesis in the rat. Am. J. Physiol. 265, E585-E591. Lukic, M. L., Mostarica, M., Ejdus, L., Bonaci, B. (1990). Strain differences in alloreactivity in rats: the roles of T-cell subsets. Transpl. Proc. 22, 2549-2550. Lumsden, T. (1938). Agglutination tests in the study of tumour immunity, natural and acquired. Am. J. Cancer 32, 395-417. Mackay, C. R. (1993). Homing of naive, memory and effector lymphocytes. Curr. Opin. Immunol. 5,423-431. Mackay, C. R. (1996). Chemokine receptors and T cell chemotaxis. J. Exp. Med. 184, 1-4. MacLennan, I. C. M., Gray, D. (1986). Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91, 61-85. MacLennan, I. C. M., Gray, D., Kumararatne, D. S., Bazin, H. (1982). The lymphocytes of splenic marginal zones: a distinct B cell lineage. Immunol. Today 3,305-307. Maeda, K., Sato, T., Azuma, M., Yagita, H., Okumura, K.

References

(1997). Characterization of rat CD80 and CD86 by molecular cloning and mAb. Int. Immunol. 9, 993-1000. Mahendran, R. S., O'Hare, M. J., Ormerod, M. G., Edwards, P. A., Mcllhinney, R. A., Gusterson, B. A. (1989). A new monoclonal antibody to a cell surface antigen that distinguishes luminal epithelial cells in the mammary gland. J. Cell. Sci. 94, 545-552. Maisin, J., Maldague, P., Dunjic, A., Maisin, H. (1957). Syndromes mortels et effets tardifs des irradiations totales et subtotales chez le rat. J. Belge Radiol. 40, 346-398. Maisin, J., Maldague, P., Deckers, C., Gond-Que, P. (1964). Le leucosarcome du rat. Symp. Lymph. Tumours Afr. 1963, 341354. Maldague, P., Maisin, J., Dunjic, A., Pham-Hong-Que, Maisin, H. (1958). Le leucosarcome chez le rat. L'incidence de ce n~oplasme apr~s irradiation totale, subtotale et locale. Sang 24, 751. Malfroy, B., Shofield, P., Kuang, W. J., Seeburg, P. H., Mason, A. J., Henzel, W. J. (1987). Molecular cloning and amino acid sequence of rat enkephalinase. Biochem. Biophys. Res. Commun. 144, 59-66. Mallett, S., Fossum, S., Barclay, A. N. (1990). Characterization of the MRC OX-40 antigen of activated CD4 positive T lymphocytes: a molecule related to nerve growth factor receptor. EMBO J. 9, 1063-1068. Marchese, A., Heiber, M., Nguyen, T., Heng, H. H. Q., Saldivia, V. R., Cheng, R., Murphy, P. M., Tsui, L.-C., Shi, X., Gregor, P., George, S. R., O'Dowd, B. F., Docherty, J. M. (1995). Cloning and chromosomal mapping of three novel genes, GPR9, GPR10, and GPR14, encoding receptors related to interleukin-8, neuropeptide Y, and Somatostatin receptors. Genomics 29, 335-344. Markmann, J. F., Hickey, W. F., Kimura, H., Woehrle, M., Barker, C. F., Naji, A. (1987). Gamma interferon induces novel expression of Ia antigens by rat pancreatic islet endocrine cells. Pancreas 2, 258-261. Marshall, E., Miller, T. (1981). Characterization of the nude rat (rnunz). Functional characteristics. Aust. J. Exp. Biol. Med. Sci. 59, 287-296. Martin, F. H., Suggs, S. V., Langley, K. E., Lu, H. S., Ting, J., Okino, K. H., Morris, C. F., McNiece, I. K., Jacobson, F. W., Mendiaz, E. A., Birkett, N. C. et al. (1990). Primary structure and functional expression of rat and human stem cell factor DNAs. Cell 63,203-211. Maruiwa, M., Mizoguchi, A., Russel, G. J., Narula, N., Stronska, M., Mizoguchi, E., Rabb, H., Arnaout, M. A., Bhan, A. K. (1993). Anti-KCA-3 a monoclonal antibody reactive with a rat C3 receptor distinguishes Kupffer cells from other macrophages. J. Immunol. 150, 4019-4030. Mason, D. W. (1985). The possible role of class II major histocompatibility antigens in self tolerance. Scand. J. Immunol. 21,397-400. Mason, D. W., Williams, A. F. (1980). The kinetics of antibody binding to membrane antigens in solution at the cell surface. Biochem. J. 187, 1-20. Mathieson, P. W. (1992). Mercuric chloride induced autoimmunity. Autoimmunity 13,243-247. Mathieson, P. W., Gillespie, K. M. (1996). Cloning of a partial cDNA for rat interleukin-12 (IL-12) and analysis of IL-12 expression in vivo. Scand. J. Immunol. 44, 11-14. Mathieson, P., Cobbold, S., Hale, G., Clark, M., Oliveira, D., Lockwood, C., Waldmann, H. (1990). Monoclonal antibody

211

therapy in systemic vasculitis. New. Eng. J. Med. 323, 250254. Mathieson, P. W., Thiru, S., Oliveira, D. B. G. (1993). Regulatory role of OX22 high T cells in mercury-induced autoimmunity in the Brown Norway rat. J. Exp. Med. 177, 1309-1316. Matsumoto, K., Kakidani, H., Anzai, M., Nagata, N., Takahashi, A., Takahashi, Y., Miyata, K. (1995). Evaluation of an antisense RNA transgene for inhibiting growth hormone gene expression in transgenic rats. Dev. Genet. 16, 273-277. Matsuo, Y., Onoder, H., Shiga, Y., Shozuhara, H., Ninomiya, M., Kihara, T., Tamatani, T., Miyasaka, M., Kogure, K. (1994). Role of cell adhesion molecules in brain injury after transient middle cerebral artery occlusion in the rat. Brain Res. 656, 344-352. Matsuura, A., Ishii, Y., Yuasa, H., Narita, H., Kon, S., Takami, T., Kikuchi, K. (1984). Rat T lymphocyte antigens comparable with mouse Lyt-1 and Lyt2,3 antigenic systems: characterization by monoclonal antibodies. J. Immunol. 132, 316322. Maxson, R. T., Dunlap, J. P., Tryka, F., Jackson, R. J., Smith, S. D. (1994). The role of the mucus gel layer in intestinal bacterial translocation. J. Surg. Res. 57, 682-686. May, M. J., Entwistle, G., Humphries, M. J., Ager, A. (1993). VCAM-1 is a CS1 peptide-inhibitable adhesion molecule expressed by lymph node high endothelium. J. Cell Sci. 106, 109-119. Mayer, L., Shlien, R. (1987). Evidence for function of Ia molecules on gut epithelial cells in man. J. Exp. Med. 166, 14711483. Mayrhofer, G., Spargo, L. D. J. (1990). Distribution of class II major histocompatibility antigens in enterocytes of the rat jejunum and their association with organelles of the endocytic pathway. Immunology 70, 11-19. Mazanec, M. B., Nedrud, J. G., Kaetzel, C. S., Lamm, M. E. (1993). A three-tiered view of the role of IgA in mucosal defense. Immunol. Today 14, 430-434. McCall, M. N., Shotton, D. M., Barclay, A. N. (1992). Expression of soluble isoforms of rat CD45. Analysis by electronmicroscopy and use in epitope mapping of anti-CD45R monoclonal antibodies. Immunology 76, 310-317. McCarthy, K. F., Hale, M. L., Fehnel, P. L. (1987). Purification of rat hematopoietic stem cells by flow cytometry. Cytometry 8, 269-305. McCaughan, G. W., Wickson, J. E., Creswick, P. F., Gorell, M. D. (1990). Identification of the bile canalicular cell surface molecule GP110 as the ectopeptidase dipeptidyl peptidase IV: an analysis by tissue distribution, purification and N-terminal amino acid sequence. Hepatology 11,534-544. McGhee, J. R., Mestecky, J. (1990). In defense of mucosal surfaces. Development of novel vaccines for IgA responses protective at the portals of entry of microbial pathogens. Infect. Dis. Clin. N. Am. 4, 315-320. McIntyre, W. (1950). Case of mollities and fragilitas ossuim accompanied with urine strongly charged with animal matter. Med. Chir. Soc. Trans. 33,211. McKenna, S. D., Goldschneider, I. (1993). A selective culture system for generating terminal deoxynucleotidyl transferasepositive lymphoid precursor cells in vitro. V. Detection of stage-specific pro-B-cell stimulating activity in medium conditioned by mouse bone marrow stromal cells. Dev. Immunol. 3,181-195. McKenna, S. D., Medlock, E. S., Greiner, D. L., Goldschneider, I.

212

(1994). A selective culture system for generating terminal deoxynucleotidyl transferase-positive lymphoid precursor cells in vitro. IV. Properties and developmental relationships of the lymphoid cells in the adherent and nonadherent compartments of the culture. Exp. Hematol. 22, 1164-1170. McKnight, A. J., Classon, B. J. (1992). Biochemical and immunological properties of rat recombinant interleukin-2 and interleukin-4. Immunol. 75,286-292. McKnight, A. J., Mason, D. W., Barclay, A. N. (1989). Sequence of a rat MHC class II-associated invariant chain cDNA clone containing a 64 amino acid thyroglobulin-like domain. Nucl. Acids Res. 17, 3983-3984. McKnight, A. J., Barclay, A. N., Mason, D. W. (1991). Molecular cloning of rat interleukin-4 cDNA and analysis of the cytokine repertoire of subsets of CD4 + T cells. Eur. J. Immunol. 21, 1187-1194. Meilinger, M., Haumer, M., Szakmary, K. A., Steinbock, F., Scheiber, B., Goldenberg, H., Huettinger, M. (1995). Removal of lactoferrin from plasma is mediated by binding to low density lipoprotein receptor-related protein/alpha 2-macroglobulin receptor and transport to endosomes. FEBS Lett. 360, 70-74. Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Sakaguchi, N., Jameson, B., Rolink, A. (1993). The surrogate light chain in B-cell development. Immunol. Today 14, 60-68. Mencia-Huerta, J. M., Dugas, B., Boichot, E., Petit-Frere, C., Paul-Eugene, N., Lagente, V., Capron, M., Liu, F. T., Braquet, P. (1991). Pharmacological modulation of the antigen-induced expression of the low-affinity IgE receptor (FC epsilon receptor RII/CD23) on rat alveolar macrophages. Int. Arch. Allergy Appl. Immunol. 94, 295-298. Mendrick, D. L., Kelly, D. M. (1993). Temporal expression of VLA-2 and modulation of its ligand specificity by rat glomerular epithelial cells in vitro. Lab. Invest. 72, 367-702. Mendrick, D. L., Kelly, D. M., DuMont, S. S., Sandstrom, D. J. (1995). Glomerular epithelial and mesangial cells differentially modulate the binding of specificities of VLA-1 and VLA-2. Lab. Invest. 72, 367-375. Misugi, E., Kawamura, N., Imanishi, N., Tojo, S. J., Morooka, S. (1995). Sialyl Lewis X moiety on rat polymorphonuclear leukocytes responsible for binding to rat E-selectin. Biochem. Biophys. Res. Commun. 215,547-554. Mita, E., Hayashi, N., Iio, S., Takehara, T., Hijioka, T., Kasahara, A., Fusamoto, H., Kamada, T. (1994). Role of Fas ligand in apoptosis induced by hepatitis C virus infection. Biochem. Biophys. Res. Commun. 204, 468-474. Mitchell, B. (1983). The distribution of immune cell markers in the rat metrial gland. J. Anat. 137, 799. Mitnacht, R., Tacke, M., Hunig, T. (1995). Expression of cell interaction molecules by immature rat thymocytes during passage through the CD4 + 8 + compartment: developmental regulation and induction by T cell receptor engagement of CD2, CD5, CD28, CD 11a, CD44 and CD53. Eur. J. Immunol.

25,328-332. Miura, S., Tsuzuki, Y., Fukumura, D., Serizawa, H., Suematsu, M., Kurose, I., Imaeda, H., Kimura, H., Nagata, H., Tsuchiya, M., Ishii, H. (1995). Intravital demonstration of sequential migration process of lymphocyte subpopulations in rat Peyer's patches. Gastroenterology 109, 1113-1123. Miyazaki, A., Sakai, M., Yamagtlchi, E., Sakamoto, Y., Shichiri, M., Horiuchi, S. (1993). Two independent macrophage recep-


tors for acetylated high-density lipoprotein. Biochim. Biophys. Acta 1170, 143-150. Mojcik, C. F., Greiner, D. L., Goldschneider, I., Lubaroff, D. M. (1987). Monoclonal antibodies to RT7 and LCA antigens in the rat: cell distribution and segregation analysis. Hybridoma 6, 531-543. Mojcik, C. F., Greiner, D. L., Medlock, E., S., Komschlies, K. L,, Goldschneider, I. (1988). Characterization of RT6 bearing rat lymphocytes. I. Ontogeny of the RT6 + subset. Cell. Immunol. 114, 336-346. Mojcik, C. F., Greiner, D. L., Goldschneider, I. (1991). Characterization of RT6-bearing rat lymphocytes. II. Developmental relationships of R T 6 - and RT6 + T cells. Dev. Immunol. 1,191-201. Molina, A., Sanchez-Madrid, F., Bricio, T., Martin, A., Barat, A., Alvarez, V., Mampaso, F. (1994). Prevention of mercuric chloride-induced nephritis in the Brown Norway rat by treatment with antibodies against the alpha 4 integrin. J. Immunol. 153, 2313-2320. Mooij, P., de Wit, H. J., Drexhage, H. A. (1994). A high iodine intake in Wistar rats results in the development of a thyroidassociated ectopic thymic tissue and is accompanied by a low thyroid autoimmune reactivity. Immunology 81, 309316. Moore, M. G., Chrzanowski, R. R., McCormick, J. R., Cieplinski, W., Schwink, A. (1984). Production of monoclonal antibodies to rat lung angiotensin-converting enzyme. Clin. Immunol. Immunopathol. 33,301-312. Mordes, J. P., Desemone, J., Rossini, A. A. (1987). The BB rat. Diab./Metab. Rev. 3,725-750. Mordes, J., Bortell, R., Doukas, J., Rigby, M. R., Whalen, B. J., Zipris, D., Greiner, D. L., Rossini, A. A. (1996a). The BB/Wor rat and the balance hypothesis of autoimmunity. Diab./ Metab. Rev. 2, 103-109. Mordes, J. P., Greiner, D. L., Rossini, A. A. (1996b). Animal models of autoimmune diabetes mellitus. In Diabetes Mellitus. A Fundamental and Clinical Text (eds LeRoith, D,, Taylor, S. I., Olefsky, J. M.), pp. 349-360. Lippincott-Raven, Philadelphia, USA. Moriam~, M., Beckers, A., Bazin, H. (1977). Decrease in the incidence of malignant ileo-caecal immunocytoma in LOU/C rats after surgical removal of the ileo-caecal lymph nodes. Cancer Lett. 3, 139-143. Morris, M., Barclay, A. N., Williams, A. F. (1988). Analysis of Tcell receptor fi chains in rat thymus, and rat C0~ and Cfl sequences. Immunogenetics 27, 174-179. Mouzaki, A., Diamantstein, T. (1987). Four epitopes on the rat 55-kDa subunit of the interleukin-2 receptor as defined by newly developed mouse anti-rat interleukin-2 receptor monoclonal antibodies. Eur. J. Immunol. 17, 1661-1664. Mouzaki, A., Volk, H. D., Osawa, H., Diamantstein, T. (1987). Blocking of interleukin 2 (IL 2) binding to the IL 2 receptor is not required for the in vivo action of anti-IL 2 receptor monoclonal antibody (mAb). I. The production, characterization and in vivo properties of a new mouse anti-rat IL-2 receptor mAb that reacts with an epitope different to the one that binds to IL 2 and the mAb ART-18. Eur. J. Immunol. 17, 335-341. Mugridge, K. G., Perretti, M., Ghiara, P., Galeotti, C. L., Melli, M., Parenti, L. (1995). Gastric antisecretory and anti-ulcer actions of rat IL-1 in rat involve different IL-1 receptor types. Am. J. Physiol. 259, G763-769.

References

Mulligan, M. S., Varani, J., Dame, M. K., Lane, C. L., Smith, C. W., Anderson, D. C., Ward, P. A. (1991). Role of endothelial-leukocyte adhesion molecule 1 (ELAM-1) in neutrophil-mediated lung injury in rats. J. Clin. Invest. 88, 13961406. Mulligan, M. S., Polley, M. J., Bayer, R. J., Nunn, M. F., Paulson, J. C., Ward, P. A. (1992). Neutrophil-dependent acute lung injury. Requirement for P-selectin (GMP-140). J. Clin. Invest. 90, 1600-1607. Mulligan, M. S., Johnson, K. J., Todd, R. F., Issekutz, T. B., Miyasaka, M., Tamatani, T., Smith, C. W., Anderson, D. C., Ward, P. A. (1993). Requirements for leucocyte adhesion molecules in nephrotoxic nephritis. J. Clin. Invest. 91, 577587. Mullins, J. J., Mullins, L. J. (1993). Trangenesis in nonmurine species. Hypertension 22, 630-633. Murakumo, Y., Takahashi, M., Hayashi, N., Taguchi, M., Arakawa, A., Sharma, N., Sakata, K., Saito, M., Amo, H., Katoh, H. et al. (1995). Linkage of the athymic nude locus with the myeloperoxidase locus in the rat. Pathol. Int. 45, 261-265. Mustafa, M., Vingsbo, C., Olsson, T., Ljungdahl, A., Hojeberg, B., Holmdahl, R. (1993). The major histocompatibility complex influences myelin basic protein 63-88-induced T cell cytokine profile and experimental autoimmune encephalomyelitis. Eur. J. Immunol. 23, 3089-3095. Mustafa, M., Vingsbo, C., Olsson, T., Issazadeh, S., Ljungdahl, A., Holmdahl, R. (1994). Protective influences on experimental autoimmune encephalomyelitis by MHC class I and class II alleles. J. Immunol. 153, 3337-3344. Na, H. R., Hiserodt, J. C., Seelig, L. L. Jr (1992). Distribution of lymphocyte subsets in rat milk from normal and Trichinella spiralis-infected rats. J. Reproduct. Imm. 22, 269-279. Nagai, Y., Inobe, M., Kikuchi, K., Uede, T. (1993). Functional and phenotypical analysis of subsets of rat CD4 § T cells. Microbiol. Immunol. 37, 623-632. Nagoya, S., Kikuchi, K., Uede, T. (1991). Monoclonal antibody to a structure expressed on a subpopulation of rat CD8 T cell subsets. Microbiol. Immunol. 35,895-911. Nahm, N., Der Balian, G., Venturi, D., Bazin, H., Davie, J. M. (1980). Antigenic-similarities of rat and mouse IgG subclasses associated with anti-carbohydrate specificities. Immunogenetics 11,199-203. Naitoh, Y., Fukata, J., Tominaga, T. (1988). Interleukin-6 stimulates the secretion of adrenocorticotrophic hormone in conscious, freely moving rats. Biochem. Biophys. Res. Commun. 155, 1459-1463. Nakagawa, H., Komorita, N., Shibata, F., Ikesue, A., Konishi, K., Fujioka, M., Kato, H. (1994). Identification of cytokineinduced neutrophil chemoattractants (CINC), rat GRO/ CINC-2~ and CINC-2fl, produced by granulation tissue in culture: purification, complete amino acid sequences and characterization. Biochem. J. 301,545-550. Nakagawa, H., Shiota, S., Takano, K., Shibata, F., Komorita, N., Kato, H. (1996a). Cytokine-induced neutrophil chemoattractant (CINC)-20~, a novel member of rat GRO/CINCs, is a predominant cytokine produced by activated macrophages and granulation tissue in culture. Eur. Cytokine Netw. 7, 513 (abstract). Nakagawa, H., Shiota, S., Takano, K., Shibata, F., Kato, H. (1996b). Cytokine-induced neutrophil chemoattractant (CINC)-2 alpha, a novel member of rat GRO/CINCs, is a

213

predominant chemokine produced by lipopolysaccharidestimulated rat macrophages in culture. Biochem. Biophys. Res. Commun. 220, 945-948. Nash, D. R., Vaerman, J. P., Bazin, H., Heremans, J. F. (1969). Identification of IgA in rat serum and secretions. J. Immunol. 103, 145-148. Navarra, P., Tsagarakis, S., Faria, M. S., Rees, L. H., Besser, Grossman, A. B. (1991). Interleukins-1 and -6 stimulate the release of corticotropin-releasing hormone-41 from rat hypothalamus in vitro via the eicosanoid cyclooxygenase pathway. Endocrinology 128, 37-44. Navarra, P., Pozzoli, G., Brunetti, L., Ragazzoni, E., Besser, M., Grossman, A. (1992). Interleukin-lbeta and interleukin-6 specifically increase the release of prostaglandin E2 from rat hypothalamic explants in vitro. Neuroendocrinology 56, 6168. Nehme, C. L., Cesario, M. M., D.G., M., Koppel, D. E., Bartles, J. R. (1993). Breaching the diffusion barries that compartmentalizes the transmembrane glycoprotein CE9 to the posteriortail plasma membrane domain of the rat spermatozoon. J. Cell Biol. 120, 687-694. Nehme, C. L., Fayos, B. E., Bartles, J. R. (1995). Distribution of the integral membrane glycoprotein CE9 (MRC OX-47) among rat tissues and its induction by diverse stimuli of metabolic activation. Biochem. J. 310, 693-698. Neiss, U., Reske, K. (1994). Non-coordinate synthesis of MHC class II proteins and invariant chains by epidermal Langerhans cells derived from short-term in vitro cultures. Int. Immunol. 6, 61-71. Newton, M. R., Wood, K. J., Fabre, J. W. (1986). A new monoclonal alloantibody detecting a polymorphism of the rat leukocyte common (LC) antigen. J. Immunogenet. 13, 4150. Nezlin, R. S., Vengerova, T. I., Rockhlin, O. V., Machulla, H. K. G. (1974). Localization of allotypic markers of kappa light chains of rat immunoglobulins in the constant part of the chain. Fed. Eur. Biochem. Soc. Meet. (Proc.) 36, 93. Ng, K. K., Drickamer, K., Weis, W. I. (1996). Structural analysis of monosaccharide recognition by rat liver mannose-binding protein. J. Biol. Chem. 271,663-674. Nicolls, M. R., Aversa, C. G., Pearce, N. W., Spinelli, A., Berger, M. F., Gurley, K. E., Hall, B. M. (1993). Induction of long-term specific tolerance in rats by therapy with an anti-CD3-1ike monoclonal antibody. Transplantation 55, 459-468. Nieuwenhuis, P. (1990). Self-tolerance induction and the bloodthymus barrier. In Thymus Update III (eds Kendall, M. D., Ritter, M. A.), pp. 31-51, Harwood Academic Publ., London, UK. Nieuwenhuis, P. (1996). Histophysiology of the lymphoid system: The Thymus and T-cells, In The Physiology of Immunity (eds Marsh, J. A., Kendall, M.), 3-32, CRC Press, Boca Raton, Florida, USA. Nieuwenhuis, P., Ford, W. L. (1976). Comparative migration of B- and T-lymphocytes in the rat spleen and lymph nodes. Cell. Immunol. 23,254. Nieuwenhuis, P., Stet, R. J. M., Wagenaar, J. P. A., Wubbena, A. S., Kampinga, J., Karrenbeld, A. (1988). The transcapsular route: a new way for (self) antigens to by-pass the bloodthymus barrier? Immunol. Today 9, 372-375. Nishida, T., Nishino, N., Takano, M., Sekiguchi, Y., Kawai, K., Mizuno, K., Nakai, S., Masai, Y., Hirai, Y. (1989). Molecular

214

cloning and expression of rat interleukin-1 alpha cDNA. J. Biochern. 105,351-357. Nishikata, H., Oliver, C., Mergenhagen, S. E., Siraganian, R. P. (1992). The rat mast cell antigen AD1 (homologue to human CD63 or melanoma antigen ME491) is expressed in other cells in culture. J. Immunol. 149, 862-870. Noguchi, Y., Himeno, M., Sasaki, H., Tanaka, Y., Kono, A., Ssaki, Y., Kato, K. (1989). Isolation and sequencing of a cDNA clone encoding rat liver lysosomal cathepsin D and the structure of three forms of mature enzymes. Biochern. Biophys. Res. Comm. 164, 1113-1120. Norman, K. E., Moore, K. L., McEver, R. P., Ley, K. (1995). Leukocyte rolling in vivo is mediated by P-selectin glycoprotein ligand- 1. Blood 86, 4417-4421. Northemann, W., Braciak, T. A., Hattori, M., Lee, F., Fey, G. H. (1989). Structure of the rat interleukin-6 gene and its expression in macrophage-derived cells. J. Biol. Chem. 264, 1607216082. Oaks, M. K., Penwell, R. T., Tector, A. J. (1996). Nucleotide sequence of ACI rat CTLA-4 molecule. Irnrnunogenetics 43, 173-174. Oberg-Welsh, C., Welsh, M. (1996). Effects of certain growth factors on in vitro maturation of rat fetal islet-like structures. Pancreas 12,334-339. Odin, P., Obrink, B. (1987). Quantitative determination of the organ distribution of the cell adhesion molecule cell-CAM 105 by radioimmunoassay. Exp. Cell Res. 171, 1-15. Offner, H., Vainiene, M., Gold, D. P., Morisson, W. J., Wang, R.-Y., Hashim, G. A., Vandenbark, A. A. (1991). Protection against experimental encephalomyelitis. Idiotypic autoregulation induced by a nonencephalitogenic T-cell clone expressing a cross-reactive T cell receptor V gene. J. Immunol. 146, 41654172. Ohajekwe, O. A., James, T., Hardy, M. A., Oluwole, S. F. (1995). Prevention of cyclosporine-induced syngeneic graft-versushost disease in bone marrow transplantation by UV-B irradiated bone marrow cells. Bone Marrow Transpl. 15, 627632. O'Hanlon, T. P., Lau, K. M., Wang, X. C., Lau, J. T. (1989). Tissue-specific expression of beta galactoside alpha-2,6-sialyltransferase. Transcript heterogeneity predicts a divergent polypeptide. J. Biol. Chem. 264, 17389-17394. Ollo, R., Auffray, C., Morchamps, C., Rougeon, F. (1981). Comparison of mouse immunoglobulin gamma 2a and gamma 2b chain genes suggests that exons can be exchanged between genes in a multigenic family. Proc. Natl Acad. Sci. USA 78, 2442. Opstelten, D., Deenen, G. J., De Jong, B., Idenburg, V. J., Hunt, S. V. (1985). Ig light chain rearrangement and chromosomal abnormality in the LAMA, early B-lineage tumour in the rat. Adv. Exp. Med. Biol. 186, 27-33. Opstelten, D., Deenen, G. J., Rozing, J., Hunt, S. V. (1986). B lymphocyte associated antigens on terminal deoxynucleotidyl transferase positive-cells and pre-B cells in bone marrow of the rat. J. Immunol. 137, 76-84. Osawa, H., Diamantstein, T. (1983). The characterization of a monoclonal antibody that binds specifically to rat lymphoblasts and inhibits IL2 receptor functions. J. Irnrnunol. 130, 51-55. Oudin, J. (1956). L'allotypie de certains antig&nes prot&idiques du s&um. C.R. Acad. Sci. 242, 2606-2608. Owen, R. L., Apple, R. T., Bhalla, D. K. (1986). Morphometrical


and cytochemical analysis of lysosomes in rat Peyer's patch follicle epithelium: their reduction in volume fraction and acid phosphatase content in M cells compared to adjacent enterocytes. Anat. Rec. 216, 521-527. Pabst, R., Westermann, J. (1997). Lymphocyte traffic to lymphoid and non-lymphoid organs in different species is regulated by several mechanisms. In Adhesion Molecules and Lymphocyte Trafficking (ed. Hamann, A.), pp. 21-37. Harwood Academic Publishers, Chur, Switzerland. Page, T. H., Dallman, M. J. (1991). Molecular cloning of cDNAs for the rat interleukin 2 receptor alpha and beta chain genes: differentially regulated gene activity in response to mitogenic stimulation. Eur. J. Irnrnunol. 21, 2133-2138. Papayianni, A., Serhan, C. N., Phillips, M. L., Rennke, H. G., Brady, H. R. (1995). Transcellular biosynthesis of lipoxin A4 during adhesion of platelets and neutrophils in experimental immune complex glomerulonephritis. Kidney Int. 47, 12951302. Park, J. H., Hanke, T., Htinig, T. (1996). Identification and cellular distribution of the rat interleukin-2 receptor fl chain: induction of the IL-2R0~-fl + phenotype by major histocompatibility complex class I recognition during T cell development in vivo and by T cell receptor stimulation of CD4+8 + immature thymocytes in vitro. Eur. J. Immunol. 26, 23712375. Paterson, D. J., Williams, A. F. (1987). An intermediate cell in thymocyte differentiation that expresses CD8 but not CD4 antigen. J. Exp. Med. 166, 1603-1608. Paterson, D. J., Green, J. R., Jefferies, W. A., Puklavec, M., Williams, A. F. (1987a). The MRC OX-44 antigen marks a functionally relevant subset among rat thymocytes. J. Exp. Med. 165, 1-13. Paterson, D. J., Jefferies, w. A., Green, J. R., Brandon, M. R., Corthesy, P., Puklavec, M., Williams, A. F. (1987b). Antigens of activated rat T lymphocytes including a molecule of 50,000 Mw detected only on CD4 positive T blasts. Moi. Irnmunol. 24, 1281-1290. Pat Happ, M., Wettstein, P., Dietzschold, B., Heber-Katz, E. (1988). Genetic control of the development of Experimental Allergic Encephalomyelitis in rats. J. Immunol. 141, 14891494. Pavlovic, M. D., Colic, M., Pejnovic, N., Tamatani, T., Miyasaka, M., Dujic, A. (1994). A novel anti-rat CD18 monoclonal antibody triggers lymphocyte homotypic aggregation and granulocyte adhesion to plastic: different intracellular pathways in resting versus activated thymocytes. Eur. J. Imrnunol. 24, 1640-1648. Pear, W. S., Ingvarsson, S., Steffen, D., Munke, M., Francke, U., Bazin, H., Klein, G., Stimegi, J. (1986). Multiple chromosomal rearrangements in a spontaneously arising t(6;7) rat immunocytoma juxtapose c-myc and immunoglobulin heavy chain sequences. Proc. Natl Acad. Sci. USA 83, 7376-7380. Pear, W. S., Nelson, S. F., Axelson, H., Wahlstr6m, G., Bazin, H., Klein, G., Stimegi, J. (1988). Aberrant class switching juxtaposes c-myc with a middle repetitive element (LINE) and an IgH intron in two spontaneously arising rat immunocytomas. Oncogene 2, 499-507. Peel, S., Stewart, I. J., Bulmer, D. (1983). Experimental evidence for the bone marrow origin of granulated metrial gland cells of the mouse uterus. Cell Tissue Res. 233,647-656. Perry, G. A., Sharp, J. G. (1988). Characterization of proximal

References

colonic lymphoid tissue in the mouse. Anat. Rec. 220, 305312. Perry, G. A., Sharp, J. G. (1991). Functional and morphological aspects of proximal colonic lymphoid tissue. In Lymphatic Tissues and in vivo Immune Responses (eds Imhof, B. A., Berrih-Aknim, S., Ezine, S.), pp. 487-492. Marcel Dekker, Inc., New York, USA. Piccioli, P., Ruberti, F., Biocca, S., Di Luzio, A., Werge, T. M., Bradbury, A., Cattaneo, A. (1991). Neuroantibodies: molecular cloning of a monoclonal antibody against substance P for expression in the central nervous system. Proc. Natl Acad. Sci. USA 88, 5611-5615. Plesch, B. E. C. (1982). Histology and immunohistochemistry of bronchus associated lymphoid tissue (BALT) in the rat. In In vivo Immunology. Histophysiology of the Lymphoid System (eds Nieuwenhuis, P., van den Broek, A. A., Hanna, M. G.), pp. 491-497. Plenum Press, New York/London. Plesch, B. E. C., Gamelkoorn, G. J., Vande Ende, M. (1983). Development of bronchus-associated lymphoid tissue (BALT) in the rat, with special reference to T- and B-cells. Dev. Comp. Immunol. 7, 179-188. Plotkowski, M. C., Bakolet-Laudinat, O., Puchelle, E. (1993). Cellular and molecular mechanisms of bacterial adhesion to respiratory mucosa. Eur. Resp. J. 6, 903-916. Posselt, A. M., Barker, C. F., Tomaszewenski, J. E., Markmann, J. F., Choti, M. A., Naji, A. (1990). Introduction of donor specific unresponsiveness by intrathymic islet transplantation. Science 249, 1293-1295. Potter, M., Fahey, J. L., Pilgrim, H. J. (1957). Abnormal serum protein and bone destruction in transmissible mouse plasmacell neoplasms (multiple myeloma). Proc. Soc. Exp. Biol. Med. 94, 327-333. Powrie, F., Mason, D. (1989). The MRC OX-22-CD4 + T cells that help B cells in secondary immune responses derive from naive precursors with the MRC OX-22 + CD4 + phenotype. J. Exp. Med. 169, 653-662. Powrie, F., Mason, D. (1990a). Subsets of rat CD4 + T cells defined by their differential expression of variants of the CD45 antigen: developmental relationships and in vitro and in vivo functions. Curr. Top. Microbiol. Immunol. 159, 79-96. Powrie, F., Mason, D. (1990b). OX-22 high CD4 + T cells induce wasting disease with multiple organ pathology: prevention by the OX-22 l~ subset. J. Exp. Med. 172, 1701-1708. Prakapas, Z., Denoyelle, M., Dargemont, C., Kroese, F. G. M., Thiery, J. P., Deugnier, M.-A. (1993). Enrichment and characterization of thymus repopulating cells in stroma-dependent cultures of rat bone marrow. J. Cell Science, 104, 1039-1048. Prieschl, E. E., Kulmburg, P. A., Baumruker, T. (1995). The nomenclature of chemokines. Int. Arch. Allergy Immunol. 107, 475-483. Prins, J., Herberg, L., den Bieman, M., van Zutphen, B. F. M. (1991). Genetic characterization and interrelationship of inbred lines of diabetes-prone and non diabetes-prone BB rats. In Frontiers in Diabetes Research. Lessons from Animal Diabetes II/ (ed. Shafrir, E.), pp. 19-24. Smith-Gordon, London, UK. Prokhorova, S., Lavnikova, N., Laskin, D. L. (1994). Functional characterization of interstitial macrophages and subpopulations of alveolar macrophages from rat lung. J. Leukoc. Biol. 55, 141-146. Querinjean, P., Bazin, H., Beckers, A., Deckers, C., Heremans, J. F., Milstein, C. (1972). Transplantable immunoglobulin-

215

secreting tumors in rats. Purification of chemical characterization of four kappa chains from LOU/Wsl rats. Eur. J. Biochem. 31,354-359. Querinjean, P., Bazin, H., Kehoe, J. M., Capra, J. D. (1975). Transplantable immunoglobulin-secreting tumours in rats. VI. N-terminal sequence variability in LOU/Wsl rat monoclonal heavy chains. J. Immunol. 114, 1375-1378. Quigg, R. J., Galishoff, M. L., Sneed, A. E., Kim, D. (1993). Isolation and characterization of complement receptor type 1 from rat glomerular epithelial cells. Kidney Int. 43,730-736. Quigg, R. J., Morgan, B. P., Holers, V. M., Adler, S., Sheed, A. E., Lo, C. F. (1995). Complement regulation in the rat glomerulus: CRRY and CD59 regulate complement in glomerular mesangial and endothelial cells. Kidney Int. 48,412-421. Raivich, G., Gehrmann, J., Kreutzberg, G. W. (1991). Increase of macrophage colony-stimulating factor and granulocytemacrophage colony-stimulating factor receptors in the regenerating rat facial nucleus. J. Neurosci. Res. 30, 682-686. Rayner, D. C., Lydyard, P. M., de Assis Paiva, H. J., Bidey, S., van der Meide, P. H., Varey, A. M., Cooke, A. (1987). Interferon-mediated enhancement of thyroid major histocompatibility complex antigen expression. A flow cytometric analysis. Scand. J. Immunol. 25,621-628. Reichmann, L., Clark, M., Waldmann, H., Winter, G. (1988). Reshaping human antibodies for therapy. Nature 332, 323327. Reifenberger, G., Mai, J. K., Krajewski, S., Wechsler, W. (1987). Distribution of anti-leu-7, anti-leu-11a, and anti-leu-M1 immunoreactivity in the brain. Cell Tissue Res. 248, 305-313. Renegar, K. B., Small, P. A. (1994). Passive immunization: systemic and mucosal. In Handbook of Mucosal Immunology (ed. Ogra, P. L.), pp. 347-356. Academic Press, Inc., New York, USA. Richter, G., Blankenstein, T., Diamantstein, T. (1990). Evolutionary aspects, structure, and expression of the rat interleukin 4 gene. Cytokine 2, 221-228. Richter, G., Hein, G., Blankenstein, T., Diamantstein, T. (1995). The rat interleukin 4 receptor: co-evolution of ligand and receptor. Cytokine 7, 237-241. Ritter, M. A., Gordon, L. K., Goldschneider, I. (1978). Distribution and identity of Thy-l-bearing cells during ontogeny in rat hemopoietic and lymphoid tissues. J. Immunol. 121, 24632471. Robinson, A. P., White, T. M., Mason, D. W. (1986). Macrophage heterogeneity in the rat as delineated by two monoclonal antibodies MRC OX-41 and MRC OX-42, the latter recognizing complement receptor 3. Immunology 57, 239247. Rockhlin, O. V., Vengerova, T ~L., Nezlin, R. S. (1971). Allotypes of light chains of rat immunoglobulins. Immunochemistry 8, 525-538. Ronco, P., Melcion, C., Geniteau, M., Ronco, E., Reininger, L., Galceran, M., Verroust, P. (1984). Production and characterization of monoclonal antibodies against rat brush border antigens of the proximal convoluted tubule. Immunology 53, 87-95. Rose, N. R., Bigazzi, P. E., Noble, B. (1976). Spontaneous autoimmune thyroiditis in the BUF rat. Adv. Exp. Med. Biol. 73 Pt B, 209-216. Rosella, G., Zajac, J. D., Baker, L., Kaczmarczyk, S. J., Andrikopoulos, S., Adams, T. E., Proietto, J. (1995). Impaired glucose tolerance and increased weight gain in

216

transgenic rats overexpressing a non-insulin-responsive phosphoenolpyruvate carboxykinase gene. Molec. Endocrinol. 9, 1396-1404. Rossini, A. A., Mordes, J. P., Handler, E. S., Greiner, D. L. (1995). Human autoimmune diabetes mellitus: lessons from BB rats and NOD mice-Caveat emptor. Clin. Immunol. Immunopathol. 74, 2-9. Rothe, H., Schuller, I., Richter, G., Jongeneel, C. V., Kiesel, U., Diamantstein, T., Blankenstein, T., Kolb, H. (1992). Abnormal TNF production in prediabetic BB rats is linked to defective CD45R expression. Immunology 77, 1-6. Roussy, G., Gu~rin, P. (1942). Les lymphosarcomes du rat. Bull. Assoc. fr. Etude Cancer 30, 17-28. Rozing, J., Vaessen, L. M. B. (1979). Mitogen responsiveness in the rat. Transpl. Proc. 11, 1657-1659. Ruberti, F., Cattaneo, A., Bradbury, A. (1994). The use of the RACE method to clone hybridoma cDNA when V region primers fail. J. Immunol. Methods 173, 33-39. Ruddick, J. H., Leslie, G. A. (1977). Structure and biological functions of human IgD. XI. Identification and ontogeny of rat lymphocyte immunoglobulin having antigenic cross-reactivity with human IgD. J. Immunol. 118, 1025-1031. Rushmere, N. K., Harrison, R. A., van den Berg, C. W., Morgan, B. P. (1994). Molecular cloning of the rat analogue of human CD59: structural comparison with human CD59 and identification of a putative active site. Biochem. J. 304, 595-601. Ruuls, S. R., Bauer, J., Sontrop, K., Huitinga, I., 'T Hart, B., Dijkstra, C. D. (1995). Reactive oxygen species are involved in the pathogenesis of experimental allergic encephalomyelitis. J. Neuroimmunol. 56, 207-217. Ruuls, S. R., De Labie, M. C. D. C., Weber, K, S., Botman, C. A. D., Groenestein, R. J., Dijkstra, C. D., Olsson, T., van der Meide, P. H. (1996). The length of treatment determines whether IFN-fl prevents or aggravates experimental autoimmune encephalomyelitis in Lewis rats. J. Immunol. 157, 57215731. Sabolic, I., Culic, O., Lin, S. H., Brown, D. (1992). Localization of ecto-ATPase in rat kidney and isolated renal cortical membrane vesicles. Am. J. Physiol. 262, F217-F218. Sackstein, R., Meng, L., Xu, X. M., Chin, Y. H. (1995). Evidence of post-transcriptional regulation of L-selectin gene expression in rat lymphoid cells. Immunology 85, 198-204. Saggi, S. J., Safirstein, R., Price, P. M. (1992). Cloning and sequencing of the rat preproepidermal growth factor cDNA: comparison with mouse and human sequences. DNA and Cell Biol. 11,481-487. Sakai, T., Agui, T., Matsumoto, K. (1994). Intestinal intraepithelial lymphocytes in LEC mutant rats. Immunol. Lett. 41,185-189. Sakai, T., Agui, T., Matsumoto, K. (1995). Abnormal CD45RC expression and elevated CD45 protein tyrosine phosphatase activity in LEC rat peripheral CD4 + T cells. Eur. J. Immunol. 25, 1399-1404. Salminen, S., Isolauri E., Onnela, T. (1995). Gut flora in normal and disordered states (review). Chemotherapy 41 (Suppl. 1), 5-15. Saoudi, A., Seddon, B., Nicholson, M., Mason, D. (1986). CD4+CD8 + thymocytes that express L-selectin mediate both normal T cell function and protection of rats from diabetes upon adoptive transfer. Abstr. XIth Int. Workshop Alloantigenic Systems in the Rat, p. 21.


Sarzani, R., Arnaldi, G., De Pirro, R., Moretti, P., Schiaffino, S., Rapelli, A. (1992). A novel endothelial tyrosine kinase cDNA homologous to platelet derived growth factor receptor cDNA. Biochem. Biophys. Res. Commun. 186, 706-714. Sauermann, U., Meyermann, R., Schluesener, H. J. (1992). Cloning of a novel TGF-fi related cytokine, the vgr, from rat brain: cloning of and comparison to homologous human cytokines. J. Neuroscience Res. 33, 142-147. Schall, T. J. (1991). Biology of the RANTES/SIS cytokine family. Cytokine 3, 1-18. Scherzer, W. J., Ruutiainen-Altman, K. S., Putowski, L. T., Kol, S., Adashi, E. Y., Rohan, R. M. (1996). Detection and in vivo hormonal regulation of ovarian type I and type II interleukinI receptor mRNAs: increased expression during periovulatory period. J. Soc. Gynecol. Investig. 3, 131-139. Schmal, H., Shanley, T. P., Jones, M. L. Friedl, H. P., Ward, P. A. (1996). Role for macrophage inflammatory protein-2 in lipopolysaccarode-induced lung injury in rats. J. Immunol. 156, 1963-1972. Schobitz, B., De Kloet, E. R., Sutanto, W., Holsboer, F. (1993). Cellular localization of interleukin 6 mRNA and interleukin 6 receptor mRNA in rat brain. Eur. J. Neurosci. 5, 14261435. Schreiber, G., Tsykin, A., Aldred, A. R., Thomas, T., Fung, W. P., Dickson, P. W., Cole, T., Birch, H., De Jong, F. A., Milland, J. (1989). The acute phase response in the rodent. Ann. N Y Acad. Sci. 557, 61-85. Schuurman, H. (1995). The nude rat. Hum. Exp. Toxicol. 14, 122-125. Schuurman, H., Hougen, H. P., van Loveren, H. (1992). The rnu (Rowett Nude) and rnunz (New Zealand Nude) rat: an update. ILAR News 34, 3-12. Scriba, A., Luciano, L., Steinger, B. (1996). High yield purification of rat monocytes by combined density gradient and immunomagnetic separation. J. Immunol. Meth. 189,203-216. Seddon, B. S., Mason, D. (1996). Effects of cytokines and glucocorticoids on endogenous class II MHC antigen expression by activated rat CD4 + T cells. Mature CD4 + 8- thymocytes are phenotypically heterogeneous on activation. Int. Immunol. 8, 1185-1193. Seekamp, A., Warren, J. S., Remick, D. G., Till, G. O., Ward, P. A. (1993). Requirements for tumor necrosis factor-0~ and interleukin-1 in limb ischemia/reperfusion injury and associated lung injury. Am. J. Pathol. 143,453-463. Seijen, H. G., Bun, J. C. A. M., Wubbena, A. S., L6hlefink, K. G. (1988). The germinal center precursor cell is mu and delta positive. Adv. Exp. Med. Biol. 237, 233-237. Seiter, S., Arch, R., Reber, S., Komitowski, D., Hofmann, M., Ponta, H., herrlich, P., Matzku, S., Zoller, M. (1993). Prevention of tumor metastasis formation by anti-variant CD44. J. Exp. med. 177, 443-455. Sereda, M., Griffiths, I., Puhlhofer, A., Stewart, H., Rossner, M. J., Zimmerman, F., Magyar, J. P., Schneider, A., Hund, E., Meinck, H. M., Suter, U., Nave, K. A. (1996). A transgenic rat model of Charcot-Marie-Tooth disease. Neuron 16, 10491060. Seya, T. (1995). Human regulator of complement activation (RCA) gene family proteins and their relationship to microbiol infection. Microbiol. Immunol. 39, 295-305. Shah, M., Foreman, D. M., Ferguson, M. W. (1992). Control of scarring in adult wounds by neutralising antibody to transforming growth factor beta. Lancet 339, 213-214.

References

Sheppard, H. W., Gutmann, G. A. (1981). Allelic forms of rat kappa chain genes: evidence for strong selection at the level of nucleotide sequence. Proc. Natl Acad. Sci. USA 78, 70647068. Sheppard, H. W., Gutmann, G. A. (1982). Rat kappa chain Jsegment genes: two recent gene duplications separate rat and mouse. Cell 29, 121-127. Shibata, F., Konishi, K., Kato, H., Komorita, N., A1-Mokdad, M., Fujioka, M., Nakagawa, H. (1995). Recombinant production and biological properties of rat cytokine-induced neutrophil chemoattractants, GRO/CINC-2a, CINC-2b and CINC3. Eur. J. Biochem. 231,306-311. Shibata, F., Kato, H., Konishi, K., Okumura, A., Ochiai, H., Nakajima, K., A1-Mokdad, M., Nakagawa, H. (1996). Differential changes in the concentrations of cytokine-induced neutrophil chemoattractant (CINC)-I and CINC-2 in exudate during rat lipopolysaccharide-induced inflammation. Cytokine 8,222-226. Shimasaki, S., Emoto, N., Koba, A., Mercado, M., Shibata, F., Cooksey, K., Baird, A., Ling, N. (1988). Complementary DNA cloning and sequencing of rat ovarian basic fibroblast growth factor and tissue distribution study of its mRNA. Biochem. Biophys. Res. Commun. 157, 256-263. Shirwan, H., Barwari, L., Fuss, I., Makowka, L., Cramer, D. V. (1995). Structure and repertoire usage of rat TCR 0~-chain genes in T-cells infiltrating heart allografts. J. Immunol. 154, 1964-1972. Siddle, K., Bailyes, E., Luzio, J. (1981). A monoclonal antibody inhibiting rat liver 5'-nucleotidase. FEBS Lett. 128, 103107. Sims, M., Hassal, D., Brett, S., Rowan, W., Lockyer, M., Angel, A., Lewis, A., Hale, G., Waldmann, H., Crowe, J. (1991). A humanized CD18 antibody can block function without cell destruction. J. Immunol. 151, 2296-2308. Sminia, T., Dijkstra C. D. (1986). The origin of osteoclasts: an immunohistochemical study in embryonic rat bone. Calcif. Tiss. 39, 263-266. Sminia, T., van Asselt, A. A., van de Ende, M. B., Dijkstra, C. D. (1986). Rat thymus macrophages: an immunohistochemical study on fetal, neonatal and adult thymus. Thymus 8, 141150. Sminia, T., van der Brugge-Gamelkoorn, G. J., Jeurissen, S. H. M. (1989). Structure and function of bronchus-associated lymphoid tissue (BALT). Crit. Rev. Immunol. 9, 119-150. Sminia, T., Twisk, K., van der Ven, I., Soesatyo, M. (1991). Uptake of soluble and particulate antigen by the gut. In Lymphatic Tissues and Immune Responses (eds Imhof, B. et al.), pp. 505-508. Marcel Dekker Inc., New York, USA. Smith, L. R., Kono, D. H., Theofilopolous, A. N. (1991). Complexity and sequence identification of 24 rat V/3 genes. J. Immunol. 147, 375-379. Smith, L. R., Kono, D. H., Kammuller, M. E., Balderas, R. S., Theofilopoulos, A. N. (1992). V/3 repertoire in rats and implications for endogenous superantigens. Eur. J. Immunol. 22, 641-645. Smith, M. E., Ford, W. L. (1983). The recirculating lymphocyte pool of the rat: a systematic description of the migratory behaviour of recirculating lymphocytes. Immunology 49, 8394. Soares, M. B., Turken, A., Ishii, D., Mills, L., Episkopou, V., Cotter, S., Zeitlin, S., Efstratiadis, A. (1986). Rat insulin-like growth factor II gene. A single gene with two promoters

217

expressing a multitranscript family. J. Mol. Biol. 192, 737752. Soares, M., Havaux, X., Nisol, F., Bazin, H., Latinne, D. (1996). Modulation of rat B cell differentiation in vivo by the administration of an anti-mu monoclonal antibody. J. Immunol. 156, 108-118. Spanjaard, R. A., van Dijk, M. C. M., Turion, A. J., van Duin, J. (1989). Expression of the rat interferon-~l gene in Escherichia coli controlled by the secondary structure of the translation initiation region. Gene 80, 345-351. Sparshott, S. M., Bell, E. B. (1994). Membrane CD45R isoform exchange on CD4 T cells is rapid, frequent and dynamic in vivo. Eur. J. Immunol. 24, 2573-2578. Spickett, G. P., Brandon, M. R., Mason, D. W., Williams, A. F., Woollett, G. R. (1983). MRC OX-22, a monoclonal antibody that labels a new subset of T lymphocytes and reacts with the high molecular weight form of the leukocyte-common antigen. J. Exp. Med. 158,795-810. Spit, B. J., Hendriksen, E. G., Bruijntjes, J. P., Kuper, C. F. (1989). Nasal lymphoid tissue in the rat. Cell Tissue Res. 255, 193-198. Stadler, J., Harbrecht, B. G., Di Silvio, M., Curran, R. D., Jordan, M. L., Simmons, R. L., Billiar, T. R. (1993). Endogenous nitric oxide inhibits the synthesis of cyclooxygenase products and interleukin-6 by rat Kupffer cells. J. Leukoc. Biol. 53,165-172. Stamper, H. B., Woodruff, J. J. (1976). Lymphocyte homing into lymph nodes: in vitro demonstration of the selective affinity of recirculating lymphocytes for high-endothelial venules. J. Exp. Med. 144, 828-833. Stamper, H. B., Woodruff, J. J. (1977). An in vitro model of lymphocyte homing. I. Characterization of the interaction between thoracic duct lymphocytes and specialized highendothelial venules of lymph nodes. J. Immunol. 119, 722780. Stangel, M., Giegerich, G., Torres-Nagel, N. E., H~inig, T., Hartung, H.-P. (1994). Structural analysis of the rat T-cell receptor TCRA V4 gene family. Immunogenetics 41, 125130. Stechschulte, D. J., Orange, R. P., Austen, K. F. (1970). Immunochemical and biologic properties of rat IgE. I. Immunochemical identification of rat IgE. J. Immunol. 104, 10821086. Steen, M. L., Hellman, L., Petterson, U. (1987). The immunoglobulin lambda locus in rat consists of two C2 genes and a single V2 gene. Gene 55, 75-84. Steiniger, B., Sickel, E. (1992). Class II MHC molecules and monocytes/macrophages in the respiratory system of conventional, germ-free and interferon-gamma-treated rats. Immunobiology 184, 295-310. Steiniger, B., Falk, P., Lohmuller, M., van der Meide, P. H. (1989). Class II MHC antigens in the rat digestive system. Normal distribution and induced expression after interferongamma treatment in vivo. Immunology 68,507. Sternberg, E. M., Hill, J. M., Chrousos, G. P., Kamilaris, T., Listwak, S. J., Gold, P. W., Wilder, R. L. (1989). Inflammatory mediator-induced hypothalamic-pituitary-adrenal axis activation is defective in streptococcal cells wall arthritissusceptible Lewis rats. PNAS 86, 2374-2378. Sternberg, E. M., Wilder, R. L., Gold, P. W., Chrousos, G. P. (1990). A defect in the central component of the immune system-hypothalamic-pituitary-adrenal axis feedback loop is

218

associated with susceptibility to experimental allergic arthritis and other inflammatory diseases. Ann. N Y Acad. Sci. 594, 289-292. St6ckli, K. A., Lillien, L. E., N~iher-Noe, M., Breitfeld, G., Hughes, R. A., Raft, M. C., Thoenen, H., Sendtner, M. (1991). Regional distribution, developmental changes and cellular localization of CNTF-mRNA and protein in the rat brain. J. Cell. Biol. 115,447-459. Strittmatter, S. M., Snyder, S. H. (1984). Angiotensin-converting enzyme in the male rat reproductive system: autoradiographic visualization with [3H]captopril. Endocrinology 115, 23322341. Strober, W., Ehrhardt, R. O. (1994). Regulation of IgA B cell development (1994). In Handbook of Mucosal Immunology (ed. Ogra, P. L.), pp. 159-176. Academic Press, New York, USA. Stumbles, P. A., Penhale, W. J. (1993). IDDM in rats induced by thymectomy and irradiation. Diabetes 42, 571-578. Sunderland, C. A., McMaster, W. R., Williams, A. F. (1979). Purification with monoclonal antibody of a predominant leukocyte-common antigen and glycoprotein from rat thymocytes. Eur. J. Immunol. 9, 155-159. Surh, C. D., Sprent, J. (1991). Long-term xenogeneic chimeras. Full differentiation of rat T and B cells in SCID mice. J. Immunol. 147, 2148-2154. Surh, C. D., Gold, D. P., Wiley, S., Wilson, D. B., Sprent, J. (1994). Rat T-cell response to superantigens. I. V/~-restricted clonal deletion of rat T-cells differentiating in rat-mouse chimeras. J. Exp. Med. 179, 57-62. Sutherland, D. B., Varilek, G. W., Neil, G. A. (1994). Identification and characterization of the rat intestinal epithelial cell (IEC-18) interleukin-1. Am. J. Physiol. 266, Cl198-C1203. Swanborg, R. H. (1988). Experimental allergic encephalomyelitis. Methods Enzymol. 162, 413-421. Swanborg, R. H. (1995). Experimental autoimmune encephalomyelitis in rodents as a model for human demyelinating disease. Clin. Immunol. Immunopath. 77, 4-13. Swanborg, R. H., Stepaniak, J. A. (1996). Experimental autoimmune encephalomyelitis in the rat. In Current Protocols in Immunology (eds Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M., Strober, W.), pp. 15.2.1-15.2.14. John Wiley & Sons, New York, USA. Tacke, M., Clark, G. J., Dallman, M. J., Hunig, T. (1995). Cellular distribution and costimulatory function of rat CD28. Regulated expression during thymocyte maturation and induction of cyclosporin A sensitivity of costimulated T cell responses by phorbol ester. J. Immunol. 154, 5121-5127. Takacs, L., Ruscetti, F. W., Kovacs, E. J., Rocha, B., Brocke, S., Diamantstein, T., Mathieson, B. J. (1988). Immature, double negative (CD4-,CD8-) rat thymocytes do not express IL-2 receptors. J. Immunol. 141, 3810-3818. Takagi, Y., Shrivastav, S., Miki, T., Sakaguchi, K. (1994). Molecular cloning and expression of the acidic fibroblast growth factor receptors in a rat parathyroid cell line (PT-r). J. Biol. Chem. 269, 23743-23749. Tamatani, T., Miyasaka, M. (1990). Identification of monoclonal antibodies reactive with the rat homolog of ICAM-1, and evidence for a differential involvement of ICAM-1 in the adherence of resting versus activated lymphocytes to high endothelial cells. Int. Immunol. 2, 165-171. Tamatani, T., Kotani, M., Miyasaka, M. (1991). Characterization of the rat leukocyte integrin CD11/CD18, by the use of


LFA-1 subunit-specific monoclonal antibodies. Eur. J. Immunol. 21,627-633. Tamatani, T., Kitamura, F., Kuida, K., Shirao, M., Mochizuki, M., Suematsu, M., Schmid-Schonbein, G. W., Watanabe, K., Tsurufuji, S., Miyasaka, M. (1993a). Characterization of rat LECAM-1 (L-selectin) by the use of monoclonal antibodies and evidence for the presence of soluble LECAM-1 in rat sera. Eur. J. Immunol. 23, 2181-2188. Tamatani, T., Kuida, K., Watanabe, T., Koike, S., Miyasaka, M. (1993b). Molecular mechanisms underlying lymphocyte recirculation. III. Characterization of the LECAM-1 (L-selectin)dependent adhesion pathway in rats. J. Immunol. 150, 17351745. Tanaka, M., Ito, H., Adachi, S., Akimoto, H., Nishikawa, T., Kasajima, T., Marumo, F., Hiroe, M. (1994). Hypoxia induces apoptosis with enhanced expression of Fas antigen messenger RNA in cultured neonatal rat cardiomyocytes. Circ. Res. 75,426-433. Tanaka, T., Masuko, T., Yagita, H., Tamura, T., Hashimoto, Y. (1989). Characterization of a CD3-1ike rat T cell surface antigen recognized by a monoclonal antibody. J. Immunol. 142, 2791-2795. Taurog, J. D., Richardson, J. A., Croft, J. T., Simmons, W. A., Zhou, M., Fernandez-Sueiro, J. L., Balish, E., Hammer, R. E. (1994). The germfree state prevents development of gut and joint inflammatory disease in HLA-B27 transgenic rats. J. Exp. Med. 180, 2359-2364. Tellides, G., Dallman, M. J., Morris, P. J. (1989). Mechanism of action of interleukin-2 receptor (IL2R) monoclonal antibody (mAb) therapy: target cell depletion or inhibition of function? Transpl. Proc. 21,997-998. ter Meulen, V., Liebert, U. G. (1993). Measles virus-induced autoimmune reactions against brain antigen. Intervirology 35, 86-94. Thiele, H.-G., Koch, F., Kashan, A. (1987). Postnatal distribution profiles of Thy-1 + and RT6 + cells in peripheral lymph nodes of DA rats. Transpl. Proc. 19, 3157-3160. Thomas, M. L., Green, J. R. (1983). Molecular nature of the W3/ 25 and OX-8 marker antigens for rat T lymphocytes, comparisons with mouse and human antigens. Eur. J. Immunol. 13, 855-858. Thomas, M. L., Barclay, A. N., Gagnon, J., Williams, A. F. (1985). Evidence from cDNA clones that the rat leucocyte common antigen (T200) spans the lipid bilayer and contains a cytoplasmatic domain of 80,000 Mr. Cell 41, 83-93. Tilders, F. J. H., DeRijk, R. H., van Dam, A. M., Vincent, V. A. M., Schotanus, K., Persoons, J. H. A. (1994). Activation of the hypothalamus-pituitary-adrenal axis by bacterial endotoxins: routes and intermediate signals. Psychoneuroendocrinology 19, 209-232. Timmerman, J. J. (1996). Extrahepatic synthesis of complement component C6 is not upregulated during an LPS-induced acute phase response. Thesis, University of Leiden, The Netherlands. Tipping, P. G., Huang, X. R., Berndt, M. C., Holdsworth, S. R. (1996). P-selectin directs T lymphocyte-mediated injury in delayed-type hypersensitivity responses: studies in glomerulonephritis and cutaneous delayed-type hypersensitivity. Eur. J. Immunol. 26, 454-460. Tole, S., Patterson, P. H. (1993). Distribution of CD9 in the developingand mature rat nervous system. Dev. Dyn. 197, 94-106.

References

Tomlinson, M. G., Wright, M. D. (1996). Characterisation of mouse CD37: cDNA and genomic cloning. Mol. Immunol. 33, 867-872. Tomlinson, M. G., Williams, A. F., Wright, M. D. (1993). Epitope mapping of anti-rat CD53 monoclonal antibodies. Implications for the membrane orientation of the Transmembrane 4 Superfamily. Eur. J. Immunol. 23, 136-140. Tong, T., Hunt, S., Opstelten, D. (1993). HIS50, a rat homolog to mouse J11d/heat stable antigen and human CD24: cDNA isolation and sequence. J. Cell Biochem. 17 (Suppl.), 242. Torres-Nagel, N., Kraus, E., Brown, M. H., Tiefenthaler, G., Mitnacht, R., Williams, A. F., H~inig, T. (1992). Differential thymus dependence of rat CD8 isoform expression. Eur. J. Immunol. 22, 2841-2848. Torres-Nagel, N. E., Gold, D. P., H/inig, T. (1993). Identification of rat TCR Vfi 8.2, 8.5, and 10 gene products by monoclonal antibodies. Immunogenetics 37, 304-308. Torres-Nagel, N., Giegerich, G., Gold, D. P., H~inig, T. (1994a). Identification of rat TCRA V 4 and 8 gene products by monoclonal antibodies and cDNA sequence. Immunogenetics 39, 367-370. Torres-Nagel, N., Herrmann, T., Giegerich, G., Wonigeit, K., H6nig, T. (1994b). Preferential TCR V usage in positive repertoire selection and alloreactivity of rat T-lymphocytes. Int. Immunol. 6, 1367-1373. Tracy, T. F. J., Fox, E. S. (1995). CD14-1ipopolysaccharide receptor activity in hepatic macrophages after cholestic liver injury. Surgery 118, 371-377. Tsuchida, K., Lewis, K. A., Mathews, L. S., Vale, W. W. (1993). Molecular characterization of rat transforming growth factor-fl type II receptor. Biochem. Biophys. Res. Commun. 191,790-795. Tsuji, T., Okada, F., Yamaguchi, K., Nakamura, T. (1990). Molecular cloning of the large subunit of transforming growth factor type B masking protein and expression of the mRNA in various rat tissues. Proc. Natl Acad. Sci. USA 87, 8835-8839. Tsujimura, T., Hirota, S., Nomura, S., Niwa, Y., Yamazaki, M., Tono, T., Morii, E., Kim, H. M., Kondo, K., Nishimune, Y. E. A. (1991). Characterization of Ws mutant allele of rats: a 12-base deletion in tyrosine kinase domain of c-kit gene. Blood 78, 1942-1946. Turner, D. C., Flier, L. A., Carbonetto, S. (1989). Identification of a cell-surface protein involved in PC12 cell substratum adhesive and neurite outgrowth on laminin and collagen. J. Neurosci. 9, 3287-4690. lDberla, K., Li, W., Qin, Z., Richter, G., Raabe, T., Diamantstein, T., Blankenstein, T. (1991). The rat interleukin-5 gene: characterization and expression by retroviral gene transfer and polymerase chain reaction. Cytokine 3, 72-81. Ulevitch, R. J., Tobias, P. S. (1995). Receptor-dependent mechanisms for stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13,437-457. Vaerman, J. P., Lemaitre-Coelho, I. (1979). Transfer of circulating human IgA across the rat liver into bile. In Transmission of Proteins Through Living Membranes (ed. Hemmings, W. A.), pp. 383-398. Elsevier, Amsterdam, The Netherlands. Vaessen, L. M., Lameijer, L., D., Carpenter, C. B., Cramer, D. V., Rozing, J. (1979). The Rl-rat: a new RT1 haplotype. Transpl. Proc. 11, 1565-1567. Valli, V. E., Villeneuve, D. C., Reed, B., Barsoum, N., Smith, G. (1983). Evaluation of blood and bone marrow, rat. In Hemo-

219

poietic System (eds Jones, T. C., Ward, J. M., Hunt, R. D.), pp. 9-26. Springer Verlag, Berlin, Germany. van de Winkel, J. G., Capel, P. J. (1993). Human IgG Fc receptor heterogeneity: molecular aspects and clinical implications. Immunol. Today 14, 215-221. van den Berg, T. K., Dopp, E. A., Kraal, G., Dijkstra, C. D. (1989). The heterogeneity of rat peripheral lymphoid organs identified by monoclonal antibodies. Eur. J. Immun. 19, 17471756. van den Berg, T. K., Dopp, E. A., Kraal, G., Dijkstra, C. D. (1991). Selective inhibition of immunecomplex trapping by FDC with monoclonal antibody against rat C3. Eur. J. Immunol. 22, 957-962. van den Dobbeisteen, G. P., Brunekreef, K., Sminia, T., van Rees, E. P. (1992). Effect of mucosal and systemic immunization with pneumococcal polysaccharide type 3,4 and 14 in the rat. Scand. J. Immunol. 36, 661-669. van der Brugge-Gamelkoorn, G. J., Sminia, T. (1985). T cells and T cell subsets in rat bronchus associated lymphoid tissue (BALT) in situ and in suspension. In Microenvironments in the Lymphoid System, p. 323. Plenum Publishing Corporation. van der Brugge-Gamelkoorn, G. J., Claassen, E., Sminia, T. (1986). Anti-TNP-forming cells in bronchus associated lymphoid tissue (BALT) and paratracheal lymph node (PTLN) of the rat after intratracheal priming and boosting with TNPKLH. Immunology 57, 405-409. van der Laan, L. J. W., Ruuls, S. R., Weber, K. S., Lodder, I. J., D6pp, E. A., Dijkstra, C. D. (1996). Macrophage phagocytosis of myelin in vitro determined by flow cytometry: phagocytosis is mediated by CR3 and induces production of TNF-0~ and nitric oxide. J. Neuroimmunol. 70, 145-152. van der Meide, P. H., Dijkema, R., Caspers, M., Vijverberg, K., Schellekens, H. (1986a). Cloning, expression and purification of rat IFN-0~I. Meth. Enzymology 119, 441-453. van der Meide, P. H., Dubbeld, M., Vijverberg, K., Kos, T., Schellekens, H. (1986b). The purification and characterization of rat gamma interferon by use of two monoclonal antibodies. J. Gen. Virol., 67, 1059-1071. van der Meide, P. H., Groenestein, R. J., De Labie, M. C. D. C., Aten, J., Weening, J. J. (1995). Susceptibility to mercuric chloride-induced glomerulonephritis is age-dependent: study of the role of IFN-gamma. Cell. Immunol. 162, 131-137. van der Merwe, P. A., McPherson, D. C., Brown, M. H., Barclay, A. N., Cyster, J. G., Williams, A. F., Davis, S. J. (1993). The NHrterminal domain of rat CD2 binds rat CD48 with a low affinity and binding does not require glycosylation of CD2. Eur. J. Immunol. 23, 1373-1377. van der Merwe, P. A., Barclay, A. N., Mason, D. W., Davies, E. A., Morgan, B. P., Tone, M., Krishnam, A. K., lanelli, C., Davis, S. J. (1994). Human cell-adhesion molecule CD2 binds CD58 (LFA-3) with a very low affinity and an extremely fast dissociation rate but does not bind CD48 or CD59. Biochemistry 33, 10149-10160. van Dongen, J. J., Remie, R., Rensema, J. W., van Wunnik, G. H. J. (1990). Manual of Microsurgery on the Laboratory Rat. Techniques in the Behavioral and Neural Sciences, Vol. 4 (ed. Huston, J. P.). Elsevier Science Publishers B.V., Amsterdam, The Netherlands. van Eden, W., Wagenaar-Hilbers, J. P. A., Wauben, M. H. M. (1996). Adjuvant arthritis in the rat. In Current Protocols in Immunology (eds Coligan, J. E., Kruisbeek, A. M., Margulies,

220

D. H., Shevach, E. M., Strober, W.), pp. 15.4.1-15.4.8. John Wiley & Sons, New York, USA. van Ewijk, W., Nieuwenhuis, P. (1985). Compartments, domains and migration pathways of lymphoid cells in the splenic pulp. Experientia 41, 199-209. van Gelder, M., Kinwell-Bohre, E. P. M., Mulder, A. H., van Bekkum, D. W. (1996). Both bone marrow- and non-bone marrow-associated factors determine susceptibility to experimental autoimmune encephalomyelitis of BUF and WAG rats. Cell. Immunol. 168, 39-48. van Golde L. M. G. (1995). Potential role of surfactant proteins A and D in innate lung defense against pathogens. Biol. Neonate 67 (Suppl.), 2-17. van Iwaarden, J. J. (1992). Surfactant and the pulmonary defense system. In Pulmonary Surfactant: from Molecular Biology to Clinical Practice (eds Robertson, B., van Golde, L. M. G., Batenburg, J. J.), pp. 215-227. Elsevier Science Publishers, Amsterdam, The Netherlands. van Oostveen, D. C., van den Berg, T. K., Damoiseaux, J. G. M. C., van Rees, E. P. (1992). Macrophage subpopulations and reticulum cells in rat placenta. Cell Tissue Res. 268, 513-519. van Oosten, M., van de Bilt, E., de Vries, H. E., van Berkel, T. J. C., Kuiper, J. (1995). Vascular adhesion molecule-1 and intercellular adhesion molecule-1 expression on rat liver cells after lipopolysaccharide administration in vivo. Hepatology 22, 1538-1546. van Poppel, M. N., van den Berg, T. K., van Rees, E. P., Sminia, T., Biewenga, J. (1993). Reticulum cells in the ontogeny of nasal-associated lymphoid tissue (NALT) in the rat. Cell Tissue Res. 273,577-581. van Rees, E. P., Dijkstra, C. D., van der Ende, M. B., et al. (1988). The ontogenetic development of macrophage subpopulations and Ia-positive non-lymphoid cells in gut-associated lymphoid tissue of the rat. Immunology 63, 79-85. van Rees, E. P., Dijkstra, C. D., Sminia, T. (1996). The structure and development of the lymphoid organs. In Pathobiology of the Aging Mouse (ed. Mohr, U.), pp. 173-187. ILSI Press, Washington, USA. Vaporciyan, A. A., DeLisser, H. M., Yan, H. C., Mendiguren, I. I., Thom, S. R., Jones, M. L., Ward, P. A., Albeda, S. M. (1993). Involvement of platelet-endothelial cell adhesion molecule-1 in neutrophyl recruitement in vivo. Science 262, 1580-1582. Varga, J. M., Kalchschmid, G., Bellon, B., Kuhn, J., Druet, P., Fritsch, P. (1995). Mechanism of allergic cross-reactions. Int. Arch. Allergy Immunol. 108, 196-199. Veldhuis, G. J., Opstelten, D. (1988). B cell precursor populations in fetal and neo~aatal rat liver: frequency, topography and antigenic phenotype. Adv. Exp. Med. Biol. 237, 57-62. Veldman, J. E. (1970). Histophysiology and electron microscopy of the immune response. Acad. Thesis University of Groningen, Drukkerij van Denderen, Groningen, The Netherlands. Vermeer, L. (1995). Molecular analysis of rat B cell differentiation. Thesis, University of Groningen, Groningen, The Netherlands. Vermeer, L. A., De Boer, N. K., Bucci, C., Bos, N. A., Kroese, F. G. M., Alberti, S. (1994). MRC OX 19 recognizes the rat CD5 surface glycoprotein, but does not provide evidence for a population of CD5 bright B cells. Eur. J. Immunol. 24, 585592. Vingsbo, C., Jonsson, R., Holmdahl, R. (1995). Avridine-induced


arthritis in rats: a T cell-dependent chronic disease influenced both by MHC genes and by non-MHC genes. Clin. Exp. Immunol. 99, 359-363. Vonderheide, R. H., Hunt, S. V. (1991). Comparison of IgD+ and I g D - thoracic duct B lymphocytes as germinal center precursor cells in the rat. Int. Immunol. 3, 1273-1281. Wagner, J., Thiele, F., Ganten, D. (1996). The renin-angiotensin system in transgenic rats. [Review]. Pediat. Nephrol. 10, 108112. Wakelin, M. W., Sanz, M. J., Dewar, A., Albelda, S. M., Larkin, S. W., Boughton-Smith, N., Williams, T. J., Nourshargh, S. (1996). An anti-platelet-endothelial cell adhesion molecule-1 antibody inhibits leukocyte extravasation from mesenteric microvessels in vivo by blocking the passage through the basement membrane. J. Exp. Med. 184, 229-239. Waldman, T. A., Strober, W. (1969). Metabolism of immunoglobulins. Progr. Allergy 13, 1-110. Walter, S., Micheel, B., Pabst, R., Westermann, J. (1995). Interaction of B and T lymphocyte subsets with high endothelial venules in the rat: binding in vitro does not reflect homing in vivo. Eur. J. Immunol. 25, 1199-1205. Wang, J., Kuliszewski, M., Yee, W., Sedlackova, L., Xu, J., Tseu, I., Post, M. (1995). Cloning and expression of glucocorticoidinduced genes in fetal rat lung fibroblasts. J. Biol. Chem. 270, 2722-2728. Watanabe, K., Konishi, K., Fujioka, M., Kinoshita, S., Nakagawa, H. (1989). The neutrophil chemoattractant produced by the rat kidney epithelioid cell line NRK-52E is a protein related to the KC/gro protein. J. Biol. Chem. 264, 1955919563. Watanabe, T., Song, Y., Hirayama, Y., Tamatani, T., Kuida, K., Miyasaka, M. (1992). Sequence and expression of a rat cDNA for LECAM-1. Biochim. Biophys Acta 1131, 321-324. Watt, V. M., Yip, C. C. (1989). Amino acid sequence deduced from a rat kidney cDNA suggests it encodes the Zn-peptidase aminopeptidase N. J. Biol. Chem. 5, 5480-5487. Waynforth, H. B., Flecknell, P. A. (1992). Experimental and Surgical Technique in the Rat, 2nd edn. Academic Press, London, UK. Webb, M., Mason, D. W., Williams, A. F. (1979). Inhibition of the mixed lymphocyte response with a monoclonal antibody specific for a rat T lymphocyte subset. Nature 282, 841-843. Weis, W. I., Drickamer, K., Hendrickson, W. A. (1992). Structure of a C-type mannose binding protein complexed with an oligosaccharide. Nature 360, 127-134. Werge, T., Biocca, S., Cattaneo, A. (1990). Intracellular immunization. Cloning and intracellular expression of a monoclonal antibody to the p21 ras protein. FEBS Lett. 274, 193-198. Westermann, J., Pabst, R. (1996). How organ-specific is the migration of naive and memory T cells? Immunol. Today 17, 278-282. Westermann, J., Ronneberg, S., Fritz, F. J., Pabst, R. (1989). Proliferation of lymphocyte subsets in the adult rat: a comparison of different lymphoid organs. Eur. J. Immunol. 19, 1087-1093. Westermann, J., Blaschke, V., Zimmermann, G., Hirschfeld, U., Pabst, R. (1992). Random entry of circulating lymphocyte subsets into peripheral lymph nodes and Peyer's patches: in vivo no evidence of a tissue specific migration of B and T lymphocytes at HEV level. Eur. J. Immunol. 22, 2219-2223. Westermann, J., Persin, S., Matyas, J., van der Meide, P., Pabst, R. (1993). IFN-gamma influences the migration of thoracic

References

duct B and T lymphocyte subsets in vivo. Random increase in disappearance from the blood and differential decrease in reappearance in the lymph. J. Immunol. 150, 3843-3852. Westermann, J., Matyas, J., Persin, S., van der Meide, P., Heerwagen, C., Pabst, R. (1994a). B- and T-lymphocyte subset numbers in the migrating lymphocyte pool of the rat: the influence of IFN-gamma on its mobilization monitored through blood and lymph. Scand. J. Immunol. 39, 395-402. Westermann, J., Nagahori, Y., Walter, S., Heerwagen, C., Miyasaka, M., Pabst, R. (1994b). B and T lymphocyte subsets enter peripheral lymph nodes and Peyer's patches without preference in vivo: no correlation occurs between their localization in different types of high endothelial venules and the expression of CD44, VLA-4, LFA-1, ICAM-1, CD2 or L-selectin. Eur. J. Immunol. 24, 2312-2316. Westermann, J., Smith, T., Peters, U., Tschernig, T., Pabst, R., Steinhoff, G., Sparshott, S. M., Bell, E. B. (1996a). Both activated and nonactivated leukocytes from the periphery continuously enter the thymic medulla of adult rats: phenotypes, sources and magnitude of traffic. Eur. J. Immunol. 26, 1866-1874. Westermann, J., Walter, S., Nagahori, Y., Heerwagen, C., Miyasaka, M., Pabst, R. (1996b). Blood leucocyte subsets of the rat: expression of adhesion molecules and localization within high endothelial venules. Scand. J. Immunol. 43,297303. Whalen, B. J., Goldschneider, I. (1993). Identification and characterization of B cell precursors in rat lymphoid tissues. I. Adoptive transfer assays for precursors of TI-1, TI-2, and TD antigen-reactive B cells. Cell. Immunol. 151,168-186. Whalen, B. J., Doukas, J., Mordes, J. P., Rossini, A. A., Greiner, D. L. (1997). Induction of insulin-dependent diabetes mellitus (IDDM) in PVG.RT1 u rats. Transplant. Proc. 29, 1684-1685. Wilders, M. M., Sminia, T., Janse, E. M. (1983). Ontogeny of non-lymphoid cells in the rat gut with special reference to large mononuclear Ia-positive dendritic cells. Immunology 50, 303-314. Willffihr, K. U., Hirschfeld, U., Westermann, J., Pabst, R. (1990a). The in vitro lymphocyte/endothelium binding assay. An improved method employing light microscopy. J. Immunol. Methods 130, 201-207. WillfiJhr, K. U., Westermann, J., Pabst, R. (1990b). Absolute numbers of lymphocyte subsets migrating through the compartments of the normal and transplanted spleen. Eur. J. Immunol. 20, 903-911. Williams, A. F., Galfre, G., Milstein, C. (1977). Analysis of cell surfaces by xenogeneic myeloma-hybrid antibodies: differentiation antigens of rat lymphocytes. Cell 12, 663-673. Williams, A. F., Barclay, A. N., Clark, S. J., Paterson, D. J., Willis, A. C. (1987). Similarities in sequence and cellular expression between rat CD2 and CD4 antigens. J. Exp. Med. 165,368-380. Williams, A. F., Atkins, R. C., Fries, J. W., Gimbrone, M. A., Cybulski, M. I., Collins, T. (1992). Nucleotide sequence of rat vascular cell adhesion molecule-1 cDNA. Biochim. Biophys. Acta 1131, 214-216. Williams, C. B., Gutman, G. A. (1989). T cell receptor fl-chain genes in the rat. J. Immunol. 142, 1027-1035. Williams, C. B., Blankenhorn, E. P., Byrd, K. E., Levinson, G., Gutman, G. A. (1991). Organisation and nucleotide sequence of the rat T cell receptor fl-chain complex. J. Immunol. 146, 4406-4413.

221

Wing, M. G., Seilly, D. J., Bridgman, D. J., Harrison, R. A. (1993). Rapid isolation and biochemical characterization of rat C1 and Clq. Molle. Immunol. 30, 433-440. Winocour, P. D., Chignier, E., Parmentier, S., McGregor, J. L. (1992). A member of the selectin family (GMP-140/ PADGEM) is expressed on thrombin-stimulated rat platelets in vitro. Comp. Biochem. Physiol. A. 102, 265-271. Wirth, K., Arch, R., Somasundaram, C., Hofmann, M., Weber, B., Herrlich, P., Matzku, S., Z611er, M. (1993). Expression of CD44 isoforms carrying metastasis-associated sequences in newborn and adult rats. Eur. J. Cancer 29a, 1172-1177. Wistar, R., Jr (1969). Immunoglobulin allotype in the rat. Localization of the specificity to the light chain. Immunology 17, 23. Wong, L., Yamasaki, G., Johnson, R. J., Friedman, S. L. (1994). Induction of beta-platelet-derived growth factor in rat hepatic lipocytes during cellular activation in vivo and in culture. J. Clin. Invest. 94, 1563-1569. Wonigeit, K., Dinkel, A., Fangmann, J., Thude, H. (1996). Expression of the ectoenzyme RT6 is not restricted to resting peripheral T cells and is differently regulated in normal peripheral T cells, intestinal IEL, and NK cells. Adv. Exp. Med. Biol. 419, 257-264. Wood, M. J., Sloan, D. J., Dallman, M. J., Charlton, H. M. (1992). A monoclonal antibody to the interleukin-2 receptor enhances the survival of neural allografts: a time-course study. Neuroscience 49, 409-418. Woollett, G. R., Barclay, A. N., Puklavec, M., Williams, A. F. (1985). Molecular and antigenic heterogeneity of the rat leukocyte-common antigen from thymocytes and T and B lymphocytes. Eur. J. Immunol. 15, 168-173. World Health Organization (1973). Nomenclature of human immunoglobulins. Bull. W H O 48, 373. Wu, X., Dolecki, G. J., Lefkowith, J. B. (1995). GRO chemokines: a transduction, integration, and amplification mechanism in acute renal inflammation. Am. J. Physiol. 269, F248F256. Yamada, T., Natori, T., Izumi, K., Sakai, T., Agui, T., Matsumoto, K. (1991). Inheritance of T helper immunodeficiency (thid) in LEC mutant rats. Immunogenetics 33,216-219. Yamazaki, T., Seko, Y., Tamatani, T., Miyasaka, M., Yagita, H., Okumura, K., Nagai, R., Yazaki, Y. (1993). Expression of intercellular adhesion molecule-1 in rat heart with ischemia/ reperfusion and limitation of infarct size by treatment with antibodies against cell adhesion molecules. Am. J. Pathol. 143, 410-418. Yan, G., Nikolaropoulos, S., Wang, F., McKeehan, W. L. (1991). Sequence of rat keratinocyte growth factor (heparin-binding growth factor type 7). In vitro Cell. Dev. Biol. 27A, 437-438. Yang, C., Jones, J. L., Barnum, S. R. (1993). Expression of decayaccelerating factor (CD55), membrane cofactor protein (CD46) and CD59 in the human astroglioma cell line, D54MG, and primary rat astrocytes. J. Neuroimmunol. 47, 123132. Yang, C. P., Bell, E. B. (1992). Functional maturation of recent thymic emigrants in the periphery; development of alloreactivity correlates with the cyclic expression of CD45RC isoforms. Eur. J. Immunol. 22, 2261-2269. Yasuda, M., Hasunuma, Y., Adachi, H., Sekine, C., Sakanishi, T., Hashimoto, H., Ra, C., Yagita, H., Okumura, K. (1995). Expression and function of fibronectin binding integrins on rat mast cells. Int. Immunol. 7, 251-258.

222

Yasue, M., Serikawa, T., Kuramoto, T., Mori, M., Higashigushi, T., Ishizaki, K., Yamada, J. (1992). Chromosomal assignment of 17 structural genes and 11 related DNA fragments in rats (Rattus norvegicus) by Southern blot analysis of rat x mouse somatic cell hybrids. Genomics 12, 659-664. Yoffey, M. J., Courtice, F. C. (1956). Lymphatics, Lymph and Lymphoid Tissue, 2nd edn. Edward Arnold (Publishers) Ltd, London, UK. Zagorski, J., DeLarco, J. E. (1993). Rat CINC (cytokine-induced neutrophil chemoattractant) is the homolog of the human GRO proteins but is encoded by a single gene. Biochem. Biophys. Res. Commun. 190, 104-110. Zhang, X.-M., Heber-Katz, E. (1992). T cell receptor sequences from encephalitogenic T cells in adult Lewis rats suggests an early ontogenic origin. J. Immunol. 148, 746-752. Zhang, X.-M., Esch, T. R., Clark, L., Gregorian, S., Rostami, A.,


Otvos, L., Heber-Katz, E. (1994). Neuritogenic Lewis rat Tcells use Tcrb chains that include a new Tcrb-V8 family member. Immunogenetics 40, 266-270. Zimmerman, B. J., Paulson, J. C., Arrhenius, T. S., Gaeta, F. C., Granger, D. N. (1994). Thrombin receptor peptide-mediated rolling in rat mesenteric venules: roles of P-selectin and sialyl Lewis X. Am. J. Physiol. 267, H1049-H1053. Zinkernagel, R. M. (1997). The discovery of MHC restriction. Immunol. Today 18, 14-17. Zsebo, K. M., Wypych, J., McNiece, I. K., Lu, H. S., Smith, K. A., Karkare, S. B., Sachdev, R. K., Yuschenkoff, V. N., Birkett, N. C., Williams, L. R., Satyagal, V. N., Tung, W., Bosselman, R. A., Mendiaz, E. A., Langley, K. E. (1990). Identification, purification and biological characterization of hematopoietic stem cell factor from Buffalo rat liver conditioned medium. Cell 63, 195-201.

VI 1.

IMMUNOLOGY OF LAGOMORPHS

Introduction

The rabbit is still the animal of choice for production of many polyclonal antibodies and most commercial sources of antibodies still feature reagents produced in the rabbit. Although the mouse is used in many studies as a model for human diseases because of its smaller size and the availability of inbred, transgenic and 'knock-out' strains, it is noteworthy that studies of DNA and protein sequences suggest that lagomorphs are more closely related to primates than are rodents (Li et al., 1990). Analyses of protein sequences also showed that the order Lagomorpha is more closely related to primates than to rodents (Graur et al., 1996; Novacek, 1996). A rabbit model of human hemolytic disease of the newborn is described below in Section 9. Complement deficiencies are described in Section 12 and autoimmune diseases in Section 16. The rabbit is also useful for studies of various infectious diseases including syphilis (Sell and Hsu, 1993), tuberculosis (reviewed by Dannenberg, 1991), virus-induced papilloma, myxoma virus, HTLV1 and HIV (see also Sections 14 and 15). A useful volume on the rabbit in contemporary immunological research appeared in 1987 (Dubiski, 1987). The rabbit has been the model animal with which a number of major immunological concepts were delineated. A few of these are described below.

Major contributions of the rabbit to current immunological concepts

AIIotype suppression If developing heterozygous rabbits are exposed to antibodies to paternal allotypes (see Section 7) during fetal and/or neonatal life, expression of that type is markedly depressed for the entire life of the animal (chronic allotype-suppression, reviewed by Horng et al., 1980; Mage, 1975).

VH

Although the role of gut associated lymphoid tissues (GALT) in development of the immune system was suggested many years ago (Cooper et al., 1968), a resurgence of interest in the role of GALT has come from recent studies that suggest that primary repertoire development occurs when rabbit B lymphocytes reside in specialized tissues of the GALT (Weinstein et al., 1994a, b). This is discussed further in Sections 2, 7 and 13.

Idiotypes and network interactions in immune regulation (latent allotypes) The original descriptions of idiotypes and the production of a series of interacting idiotypes and anti-idiotypes (idiotype networks) used the rabbit model. Some observations of 'latent allotypes' may have been due to idiotypic mimicry. Excellent reviews of the field of latent allotypes have been prepared by Roux (1983) and McCartneyFrancis (1987).

Allelic exclusion 11

The expression of only one of two parental chromosomal products in individual B lymphocytes was documented in early studies using the rabbit model (Davie et al., 1971; Hayward et al., 1978; Loor and Kelus, 1978; Gathings et al., 1981, 1982). The presence of independent genes contributing to the single heavy polypeptide chain was documented genetically when recombination between VH and CH genes was observed in laboratory rabbits (Mage et al., 1971, 1982, 1992; Kelus and Steinberg, 1991; Newman et al., 1991). Handbook of Vertebrate Immunology ISBN 0-12-546401-0

gene diversification mechanisms

Lymphoid Organs, Their Anatomical Distribution and Ontogeny of the Immune System

Table VI.2.1 shows the percentage of B and T lymphocytes within rabbit lymphoid tissues. Figure IV.2.1 is a diagrammatic representation that identifies the novel aspects of the gut-associated lymphoid tissues (GALT) of the rabbit, locating three different lymphoid organs present at the distal end of the ileum and the proximal end of the caecum. The overall organization of the rabbit lymphoid Copyright 9 1998 Academic Press Limited All rights of reproduction in any form reserved

224


Table VI.2.1 Percentage of B and T lymphocytes within rabbit lymphoid tissues according to Fujiwara et al. (1974) (A) and Rudzik et al. (1975) (B) T Cells

B Cells

Cell source

A

B

A

B

Appendix BALl Bone marrow Lamina propria Lymph node PBL Peyer's patch Spleen Thymus

23.3 ND 15.5 ND 57.0 40.1 ND 37.8 94.5

ND 18.4 ND 11.1 ND 43.9 16.6 19.7 94.0

53.0 ND 37.2 ND 37.3 42.4 ND 47.4 5.0

ND 41.5 ND ND ND ND 78.7 ND ND

ND, not determined" PBL, peripheral blood lymphocytes; BALT, bronchus-associated lymphatic tissue.

Normal villi

Solitary lymphoid nodule Small intestine

Colon

Peyer's patch S accuJus rofundus

,,

--

~ .--_

Caecum. ~

Appendix

Figure Vl.2.1 Diagrammatic representation identifying the novel aspects of the gut-associated lymphoid tissues of the rabbit. From Befus and Bienenstock (1982), with permission.

system is similar to that of other mammalian species, with the exception of the appendix, which is present at the caudal end of the caecum, and the sacculus rotundus located at the ileo-caecal junction. These two GALT have functions that have been identified only in rabbit tissue. The third GALT identified in the diagram is the Peyer's patch, which is located along the small intestine. In the rabbit, there are between two and 10 Peyer's patches along the small intestine (Befus and Bienenstock, 1982). The rabbit spleen (Figure VI.2.2A) is composed of red and white pulp compartments. The red pulp comprises venous sinuses supported by a characteristic reticular meshwork (not visible at this magnification). Within the red pulp the interstitium contains clusters of mononuclear phagocytes, hematopoietic colonies and differentiated

plasma cells. The white pulp is organized centripetally around central arterioles. The periarteriolar lymphatic sheath (PALS) contains a preponderance of small T cells but other recirculating cells and antigen-presenting cells resembling interdigitating dendritic cells are also present. In the periphery of the PALS is the marginal zone and B-cell follicles. The marginal zone is separated from the PALS by a line of antigen-presenting cells. Enzymatic activities and phenotypic markers suggest that these cells differ from antigen-presenting cells in the marginal zone, and from those in PALS and germinal centers. The organization of the B-cell follicles also follows a centripetal relationship to the central arteriole. The mantle zone containing small IgM+B cells is furthest away from the arteriole. The germinal center (GC) itself is composed of two distinct regions, the light zone and the dark zone (defined by characteristic hematoxylin and eosin staining). The germinal center dark zone (containing centroblasts) rests against the border between the follicle and the PALS, and the light zone (containing centrocytes) fills in the remaining space between the mantle zone and the dark zone. Within these two zones B cells can undergo developmental changes, including DNA base pair changes as part of affinity maturation. The marginal zone, containing intermediate sized B-cells, reticulum and antigen-presenting cells forms a belt separating the white pulp from the red pulp. This reticulum is interrupted by numerous venus sinuses (marginal sinuses) supplied by vessels originating from the central arterioles. These marginal sinuses are where recirculating lymphocytes in the blood attach before migrating into the splenic white pulp. Recently, the MAdCAM-1 vascular addressin (mucosal addressin which is a ligand for ~4 f17 integrin on mouse lymphocytes) has been identified on the endothelial lining of marginal sinuses (Kraal et al., 1995). The spleen is the only peripheral lymphoid organ that does not have high endothelial venules (HEVs) supporting lymphocyte recirculation. Lyons and Parish (1995) have suggested that marginalzone macrophages in the mouse are the splenic analog of HEV, forming the port of entry of lymphocytes into the white pulp of the spleen. The rabbit lymph node (Figure VI.2.2B) is organized into compartments similar to those of most mammalian species. There is a cortex comprised of superficial cortex below the subcapsular lymphatic sinus where B-cell-follicles are present and a deep cortex where recirculating cells (T ~ B) emigrate from the blood. In the superficial cortex lymphoid follicles are organized into at least three compartments similar to those described in lymph nodes of other species such as mouse. It is interesting to note that the mantle zone is closest to the areas of antigen uptake and the GC dark zone is closest to deep cortex, where recirculating cells enter via HEVs. Below the deep cortex are areas containing B-cells in various states of maturation from lymphoblasts to plasma cells. These areas become the medullary plasma cell cords and have been termed (for the rabbit) 'follicular funnels' by Kelly et al. (1972) because

Lymphoid Organs, Their Anatomical Distribution and Ontogeny of the Immune System

A

B

Marginal Sinuses

//

225

Deep Cortex(T>B) t Medullary Cords (B Cells Plasma Cells) ;ic Sinusoidat Spaces

Superficial Corte

rteriote

olar Lymphatic Sheath

White Pulp I Germinal Center in White Pulp Venous Sinuses in Red Pulp Muscular trabecutum

C

Villus ! High Endothelial Venule i I Follicle Associated Epithelium i J J = ~ ~ Uo,,,= .ight Zone) er (Dark Zone)

I Germinal Center High Endothelial Venules

D

Germinal Center (Dark Zone) Germinal Center (Light Zone) Lymphatic sinus

egion High Endothelial Venule Mushroom Villus

Figure Vl.2.2 Haematoxylin and eosin stained sections of various rabbit lymphoid tissues. A: spleen; B: lymph node; C: Peyer's patch; D: appendix. Labels identify important features. they appear to be organized across columnar areas of cortex below individual B-cell follicles. Separating plasma cell cords are medullary lymphatic sinuses which contain lymphoid cells enroute out into efferent lymphs. Phagocytic cells anchored to reticular fibers that cross intranodal lymphatic sinuses contribute to the removal of particulates from lymph. Craig and Cebra in 1971 used the rabbit as an animal model to identify the Peyer's patch (PP) as a site for commitment of B cells to IgA production (Figure VI.2.2C). They found that B cells isolated from PP subsequently made IgA in the spleen after reinfusion into recipient rabbits. After expansion in the spleen, these B cells could circulate to a site along the intestinal tract, where they lodged and secreted antibody which was carried across epithelial cells into the gut lumen in endosomes. The organization of the rabbit PP is similar to that of other mammalian species,

with a dome region extending into the lumen of the gut and the follicle germinal center abutting the muscular wall. The dome is covered by a special epithelium containing M or microfold cells which transport antigen into the PP in endosomes. Beneath the dome is the GC. It has an easily discernible dark zone surrounding a light zone. Unlike the spleen and lymph node, the mantle zone of the PP and other GALT structures does not surround the germinal center but rests above it, filling the space defined by the dome epithelium and connecting with the interfollicular areas laterally (this is most pronounced in the appendix and sacculus rotundus and least evident in the PP). Between the dome-GC region are T-cell rich areas known as the interfollicular regions. It is within the interfollicular regions that recirculating cells enter PP via HEV. The rabbit appendix is composed of several-hundred lymphoid follicles. As shown in Figure VI.2.2D, the organi-

226

IMMUNOLOGY

zation of these follicles is similar to the PP, except that the young rabbit has GCs that are larger than those found in the corresponding PP. By adulthood, the GC of the appendix is similar in size and cellular composition to that of the PP. In addition, the villus of the appendix has a characteristic shape that is unique to the appendix and sacculus rotundus. The villi in these two GALT have been given the name mushroom villi, based on their identifiable shape.

Species-specific structure

and

aspects

of organ

those found at 6 weeks after birth. In addition, T cells can now be found dispersed throughout the formerly B-cell only zones. Most of these T cells express CD4 and are distributed throughout both the dome region and the germinal centers. CD8-expressing T cells can also be detected in the adult appendix, with most located in the interfollicular regions and just under the follicle associated epithelium (Table VI.2.2 and Figure VI.2.3). The changes seen in the appendix from the young to the adult rabbit (Figures VI.2.3 and VI.2.4) may correspond to changes in function (Crabb and Kelsall, 1940; Weinstein et al., 1994a, and unpublished results). The young rabbit appendix is involved in diversification of the B-cell antibody repertoire (Weinstein et al., 1994b). The sacculus rotundus of the 6-week-old rabbit, another GALT, which is located at the ileo-cecal junction, bears a striking resemblance to the appendix of a similar aged rabbit. The few differences between these tissues are smaller germinal centers and fewer follicles. Like the appendix, the sacculus rotundus also changes as the rabbit gets older, with the result that by adulthood it also bears a strong resemblance to a Peyer's patch. The function of the sacculus rotundus may be the same as the appendix at equivalent stages of development.

development,

function

Most lymphoid organs of the rabbit bear striking similarity in terms of organ development, structure and function to their counterparts in other mammalian species. One lymphoid tissue that does not share these characteristics with other mammalian species is the rabbit appendix, a caecal diverticulum. The rabbit appendix is about 2.5 cm long at birth and contains no organized B- or T-cell follicular regions. However, IgM, but not IgA B cells can be detected. By 6 weeks old the appendix reaches its largest size, measuring about 9 cm long and is composed of several hundred individual follicles, each characterized by several distinct morphological regions (Figure VI.2.3). B cells are located in the germinal center and dome region, the latter lying directly under the follicle associated epithelium. T cells are not found in either of these regions at 6 weeks old, but can be detected in the interfollicular region found between follicles (Table VI.2.2). Starting at 9 weeks after birth and ending at adulthood the rabbit appendix undergoes changes in gross morphology and B and T cell distribution that ultimately result in a lymphoid organ in the adult rabbit that bears little resemblance to that of the young rabbit appendix. In fact, the adult rabbit appendix appears very similar in structure and cell distribution to the Peyer's patches (Table VI.2.2 and Figure VI.2.3). The adult rabbit appendix contains germinal centers that are smaller than T a b l e V1.2.2 development

Summary

3.

Rabbit Leukocyte Markers

More than 30 surface markers have been identified for rabbit leukocytes. At present, approximately 20 of these markers can be identified with monoclonal antibodies (mAbs) and 15 of them with rabbit-specific DNA probes. Rabbit leukocyte antigens for which either mAb or DNA probes are available are listed in Table VI.3.1, along with their cellular distribution. The GenBank accession numbers are provided for all DNA probes. For some molecules, including CD4, CD5, MHC class I, and MHC class II, both mAb and DNA probes are available. Several

of IgM, IgA and C D 4 staining levels in different lymphoid regions of rabbit a p p e n d i x during

IgM FAE D 1 day

OF LAGOMORPHS

_

a

IgA

LZ

4-

.

DZ .

IF .

FAE D .

.

.

CD4

LZ .

.

DZ .

IF .

FAE D .

.

LZ

DE

IF

.

2 week

++

++

++

+

-

++

++

++

.

.

.

.

.

.

6 week

++

++

++

+

-

++

++

++

.

.

.

.

.

.

9 week

++

++

++

+

-

++

++

++

-

-

5 month

++

++

++

+

-

++

++

++

-

-

-

+

9 month

++

++

++

+

-

++

++

++

-

-

-

+

1.5

+

++

+

-

-

++

++

++

+

-

-

+

+

+

++

+

-

-

++

++

++

+

-

-

+

+

+

+

+

++

+

-

-

++

++

++

+

-

-

+

+

+

+

year

4 year Jejunal a++ =

Peyer's

patch

stains darkly;

+ =

FAE, follicle associated

stains moderately; epithelium;

_+ =

D, dome;

stains faintly;

17, light zone;

-

= no

DZ, dark

staining seen. zone,

IF, i n t e r f o l l i c u l a r .

-

+

+ + -

-

+

+

-

+

+

-

+

+

+


IgM

227

igA

IgM

IgA

Figure VI.2.3 Rabbit appendix development monitored by immunohistochemistry with B cell-specific immunoglobulin markers. Rabbit appendix tissue was taken 1 day (A, B), 2 weeks (C, D), 6 weeks (E, F), 5 months (G, H), 9 months (I, J), 1.5 years (K, L), and 4 years (M, N) after birth. Rabbit jejunal Peyer's patch (JPP) tissue was taken 6 weeks (O, P) after birth. Semi-thin (7-/~m) sections of rabbit appendix and JPP were stained with either a mouse anti-rabbit IgM (A, C, E, G, I, K, M, O) or a mouse anti-rabbit IgA (B, D, F, H, J, L, N, P). Note change in size and shape of the rabbit appendix from 6 weeks to 1.5 years. The rabbit appendix at 1.5 and 4 years (K-N) bears a strong resemblance to a JPP (O-P)in shape, immunoglobulin (Ig) staining patterns, and size. Most GC staining for IgM and IgA is in the LZ with DZ B cells expressing little surface Ig. Scale bar = 5 mm.

other rabbit leukocyte cell surface molecules have been identified by mAb (McNicholas et al., 1981; De Smet et al., 1983; Loar et al., 1986), however since the molecular specificities of these antibodies are not known, we did not include them in Table VI.3.1.

Specificity of reagents Most rabbit leukocyte mAb are produced by immunizing mice with rabbit cells, rather than with purified mole-

cules. The target of the selected mAb is usually identified by comparing the cellular distribution and the molecular weight of the immunoprecipitated molecule with known mouse and human CD molecules. We have concerns about the accuracy of this approach to determining antibody specificity. This concern is illustrated by the following example. Kotani et al. (1993a) developed the antirabbit CD5 mAb KEN-5 by immunizing mice with rabbit T cells. This mAb reacted with all rabbit T cells and with < 1% B cells. It immunoprecipitated a molecule of 67 kDa. Raman and Knight (1992) also developed

228


40O0

013o00 |

BE FAE B DOME / GC

i

O >

2000

| m

,I,,,I

n

m

(1) r~

1000

._.

2 wks

. . _

6 wks

.....

. .

.

.

4 mo

.

.

.

.

9 mo

.

.

.

.

.

1.5 y r

.

.

.

.

.

4 yr

J PP

Figure Vl.2.4 Changes in size of different rabbit appendix B-cell follicular regions. Mean weights of follicle-associated epithelium (FAE), dome region and germinal centers (GC) on photographs were measured. Note dramatic rise then fall in GC size during rabbit appendix development. By 1.5 years, the size of appendix GC were similar to those in JPP.

an antirabbit CD5 mAb; however, they cloned the rabbit CD5 gene and immunized mice with murine T cells that had been transfected with this gene. Unlike the KEN-5 mAb, the Raman and Knight anti-CD5 mAb (R-CD5) reacted with essentially all rabbit B cells. The KEN-5 mAb did not react with murine cells transfected with the rabbit CD5 gene. We conclude that the KEN-5 mAb is not directed against rabbit CD5 but instead is directed against a T-cell molecule of unknown identity. We suggest that before a mAb can be identified as reacting with the rabbit homologue of a mouse or human molecule, the specificity must be characterized by reactivity with molecules known, either by amino acid or by nucleotide sequence analysis, to be homologous to the respective mouse or human molecule. Several of the mAb used to identify rabbit cell surface molecules are cross-reacting antibodies that were developed against mouse or human CD immunogens. Although in our experience most such mAb raised against mouse or human CD molecules do not cross-react with rabbit leukocytes, we encourage investigators to test antimouse and antihuman mAb for cross-reactivity with rabbit leukocytes before developing rabbit-specific reagents. It is more likely that antihuman mAb developed in mouse, a

species phylogenetically distant from human, will crossreact with rabbit leukocytes than will the antimouse mAb developed in other rodents. We have included cross-reacting antihuman mAb in Table VI.3.1 for those rabbit leukocyte cell-surface molecules for which no rabbitspecific reagents are available.

Lymphocyte m a r k e r s

B cells can be easily identified by readily available polyclonal anti-Ig reagents, and as a result, relatively few antirabbit Ig mAbs have been developed. Although B cells can also be identified by anti-MHC class II mAb, these mAb are less reliable because they react with monocytes, macrophages, and activated T cells, as well as with B cells. No pan-B lineage-specific mAbs for molecules such as rabbit B220, CD19, or CD20 have been reported. Similarly, although several T-cell-specific mAb have been developed, notably anti-CD4 and anti-CD8, no reagents directed specifically against the rabbit T-cell specific antigen, CD3, are currently available. Two commonly used antirabbit T cell mAbs, anti-CD43 and 9AE10, are not optimal reagents because, in addition to reacting with


TableVl.3.1

229

Rabbit leukocyte antigens Monoclonal antibodies

Probe

Reference

M26249

Calabi et al. (1989)

Molecule

Cell distribution

CD1

Thymocytes, dendritic cells

CD3,

T cells

PC3/188A a

CD4

T cell subset

KEN-4

CD5

T and B cells

KEN-5 b R-CD5

CD8/3

T cell subset

12.C7

CD9

Pan-leukocyte, platelets, fibroblasts

MM2/57 a

Hornby et al. (1991), Wilkinson et al. (1992b)

CD11a (LFA-1 ~ chain)

Pan-leukocyte

NR185 KEN- 11

Blackford and Wilkinson (1993) Kotani et al. (1993a)

CD11b (MAC-l; CR3~ chain)

Neutrophils, macrophages, NK cells

198

Smet et al. (1986), Galea-Lauri et al. (1993b)

CD11c (P150,95; CR4~ chain)

Neutrophils, macrophages, NKcells

3/22

Blackford et al. (1996)

CD18 (LFA-1/~2 chain)

Pan-leukocyte

L13/64

Jackson et al. (1983) Wilkinson et al. (1984), Galea-Lauri et al. (1993a)

CD25 (IL2R~)

Activated T cells

CD28

T cells (most CD4 § some CD8 § cells)

CD43 (leukosialin)

T cells, thymocytes

Lll/135

Jackson et al. (1983), Wilkinson et al. (1992a)

CD44

Pan-leukocyte

W4/86 RPN 3/24

Jackson et al. (1983) Wilkinson et al. (1984), Galea-Lauri et aL (1993b)

1.24 L12/201 L12/27 HP1/2 a

De Smet et aL (1983) Jackson et al. (1983) Wilkinson et al. (1993) Kling et al. (1995)

Jones et al. (1993) $44055 M92840

Kotani et al. (1993a) Hague et al. (1992)

L03204

Kotani et al. (1993a) Raman and Knight (1992)

L22293

De Smet et al. (1983) Sawasdikosol et al. (1993)

RCN1/21

Kotani et al. (1993b), Sawasdikosol et al. (1993)

KEI-=I D49841

Isono and Seto (1995)

CD45

Pan-leukocyte

CD49d (VLA-4 5~4 subunit)

Monocytes, lymphocytes

CD54 (ICAM-1)

Widely distributed; many activated cells

Rb2/3

Richardson et al. (1994)

CD58 (LFA-3)

Pan-leukocyte, red blood cells, platelets

VC21

Wilkinson et al. (1992b)

CD62E (E-selectin)

Endothelial cells

9H9 14G2

Olofsson et al. (1994)

CD62L (L-selectin)

White blood cells

Dreg-200 a LAM1-3 a

Garcia et al. (1995) Ley et al. (1993)

CD80 (B7-1)

Activated B cells, macrophages, dendritic cells

D49843


CD86 (B7-2)

Activated B cells, macrophages, dendritic cells

D49842


CD106 (VCAM-1)

Endothelium (inflammatory settings); nonvascular cells

Rbl/9

Richardson et al. (1994) (continued)

230 Table Vl.3.1

IMMUNOLOGY OF LAGOMORPHS Continued

Molecule

Cell distribution

CTLA-4

Activated T cells

MHC-I

Nucleated cells

MHC-II DP=/#

B cells, macrophages

MHC II DQ=//~


MHC II DR=//~


MHC II Do~

Monoclonal antibodies

Probe

Reference

D49844


K02819

Marche et al. (1985), LeGuern et al. (1987)

M22640 (c~chain) M21465-8 (/~ chain)

Sittisombut and Knight (1986) LeGuern et al. (1985)

2C4

M15557 (c~chain)

Lobel and Knight (1984), LeGuern et al. (1986), Sittisombut and Knight (1986)

RDR34

M28161 (c~chain)

Sittisombut and Knight (1986), Laverrier et al. (1989), Spieker-Polet et al. (1990)

Epithelium of thymic medulla, B cells

M96942

Chouchane et al. (1993)

TCR~//~

T cells

M12885 (~ chain) M14576-7, D17416-26 (/~ chain)

Marche and Kindt (1986a, b) Angiolillo et aL (1985), Isono et al. (1994)

TCRT/5

T cells

L22290, D38134-44, D42090 (7 chain) L22291, D26555, D38118-21 (5 chain)

Sawasdikosol et al. (1993) Isono et al. (1995) Kim et al. (1995)

61

C7M1 a

mAb directed against immunogen of human origin. b KEN-5 mAb was made against rabbit thymocytes as immunogen (Kotani et aL, 1993a); R-CD5 was made against the product of the cloned rabbit CD5 gene (Raman and Knight, 1992).

a

T cells, anti-CD43 may react with progenitor B cells (Hardy et al., 1991) and 9AE10 reacts with neutrophils (McNicholas et al., 1981; Chen et al., 1984). These reagents can be used to distinguish T cells from B cells, but they must be used cautiously if other leukocytes are present in the cells being examined. Analysis of rabbit T cells will be simplified when a reagent specific for rabbit CD3 becomes available.

Summary The number of rabbit-specific leukocyte markers is considerably less than the number of markers available for mouse and human leukocytes. With the introduction of gene cloning methods, it is now a straightforward experiment, albeit time consuming, to clone the rabbit homologue of a mouse or human gene of interest and develop mAb against the product of the expressed gene. We anticipate that as the methods for immunization with DNA are refined, mAbs of desired specificity will be easily obtained and the number of mAbs specific for rabbit leukocytes will increase significantly.

11


Evidence for organ-specific leukocyte recruitment Rabbits have been used extensively for in vivo studies of leukocyte recruitment as a result of the species' size, availability, the availability of immunological reagents, and their apparent similarity to humans in both leukocyteendothelial adhesion pathways and leukocyte recruitment mechanisms. In the systemic microcirculation, intravital microscopy of small venules in both the abdominal mesentery and the tenuissimus muscle (Lindbom et al., 1990; Granert et al., 1994; Olofsson et al., 1994) demonstrate that leukocyte-endothelial interactions utilize a multistep adhesion cascade similar to that proposed for other species (Springer, 1995; Butcher and Picker, 1996). This cascade (see 'Molecules Involved in Leukocyte-Endothelial Interactions' and 'Molecules Involved in Leukocyte Migration' later in this section) consists of five sequential events: (1) inflammatory activation of the endothelial cell creating a proadhesive condition;


(2) random contact of circulating leukocytes with the vessel wall that precedes low affinity, adhesiondependent leukocyte rolling (selectin-mediated); (3) local activation of the proximate leukocyte resulting in firm adhesion to endothelium (131 and 132 integrinmediated); (4) leukocyte diapedesis between endothelial cells into extravascular tissue; (5) subendothelial migration of leukocytes along chemotactic gradients. Leukocyte recruitment in the heart, skin, skeletal muscle, intestine, liver, and central nervous system has been shown to be attenuated by adhesion molecule antagonists (e.g., monoclonal antibodies, soluble carbohydrates). These studies are consistent with the sequential activation of first selectin, followed by /32 integrin (CD11/CD18) adherence mechanisms (reviewed by Harlan et al., 1992; Talbott et al., 1994), as described above. However, there are organ-specific and stimulus-dependent exceptions to this standard neutrophil adhesion cascade paradigm. In the systemic circulation, intraperitoneal S. p n e u m o n i a normally elicits neutrophil emigration by a CD18-dependent mechanism that can be converted to a CD18-independent pathway by addition of macrophages to the peritoneum (Mileski et al., 1990). Similarly, early (4 h) neutrophil emigration elicited by intraperitoneal protease peptone is CD18-dependent, whereas emigration at later time points (24h) is CD18-independent (Winn and Harlan, 1993). This alternative pathway appears to require cytokine or chemokine signaling initiated by either resident or elicited peritoneal macrophages. Neutrophil emigration in the pulmonary circulation of rabbits also utilizes alternative adhesion/emigration pathways (e.g., selectin- and/or CD18-independent) (reviewed by

231

Hogg and Doershuck, 1995). In contrast to the systemic circulation where neutrophil-endothelial adherence and emigration occur in the relatively large-diameter postcapillary venules, in the pulmonary vasculature these processes occur in the capillaries themselves, where their small diameter induces neutrophil deformation and neutrophil sequestration, and may eliminate the requirement for initial neutrophil 'rolling' (low-affinity endothelial adhesion) prior to emigration (Wiggs et al., 1994; Hogg and Doershuck, 1995). Tissue-specific recruitment of leukocyte subpopulations

Cultured rabbit vascular endothelial cells have been used for the study of leukocyte-endothelial adhesion and emigration (Kume et al., 1992; Kim et al., 1994), but to a limited extent owing to technical challenges in maintaining these cell lines. In vivo studies in rabbits emphasize neutrophil (see previous subsection) and monocyte recruitment mechanisms, with scant information pertaining to lymphocytes. Neutrophil emigration is dependent on fix integrin-mediated adhesion in tissues not possessing resident macrophages, whereas mononuclear cell emigration utilizes both/31 and f12 integrin-mediated pathways (Winn and Harlan, 1993; Kling et al., 1995). Molecules involved in leukocyte-endothelial interactions

The molecular components of the leukocyte-endothelial adhesion cascade have been described in detail (Carlos and Harlan, 1994). Table VI.4.1 is generated from a variety of references and describes those adhesion molecules (left

Table V1.4.1 Leukocyte and endothelial adhesion molecules described in rabbits

Molecule

Distribution

Ligands

Regulation of expression

L-selectin (CD62L)

WBC

CE; $ Upon inflam, activation a

E-selectin (CD62E) P-selectin (CD62P)

EC P, EC

Sle x, MAdCAM-1, CD34, GlyCAM-1 Sle x, PSGL- 1, ESL- 1 Sle x, PSGL-1

L, M, neural crest cells

VCAM-1, FN

CE" not inducible

WBC PMN, M, _+L

ICAM-1, ICAM-2 ICAM-1, other?

CE; 1" Upon inflam, activation a CE; T Upon inflam, activation a

EC, M, L, EpC EC EC, WBC, P

LFA-1, Mac-1 VLA-4 PECAM-1, other?

CE; 1" Upon inflam, activation a 1" Upon inflam, activation a CE; not inducible

Selectins

1 Integrins

VLA-4 (~z4,81, CD49d/CD29)

[~2 Integrins

LFA-1 (CD11 a/CD18) Mac-1 (CD11 b/CD18)

Immunoglobulin superfamily

ICAM-1 (CD54) VCAM-1 (CD106) PECAM-1 (CD31)

[ Upon inflam, activation a 1" Upon inflam, activation b

CE = constituitively expressed' WBC = all leukocytes; EC = vascular endothelium" PMN = neutrophils; L= lymphocytes; M = monocytes; P = platelets; FN = fibronectin EpC - epithelial cells. TNF-=, IL-I~, lipopolysaccharide, b Histamine, oxidants. 1"= increased" inflamm. = inflammatory.

232

IMMUNOLOGY

Endothelial Activation

Endothelial and/or Leukocyte Activation

Endothelial and/or Leukocyte Activation

Leukocyte Activation

Firm Adhesion

Transendothelial Migration

Subendothelial Migration

Rolling

B~. B2. and B7 integdns

SLe x and olher slalylated. lucosylated structures

Leukocyte

OF LAGOMORPHS

L-selectin

PECAM-1. B~ and Bz

B~ and B2 integdns; CD44. PECAM-1

Endothelial i -. :: ~ ~~::-~ p.selectln :~:~:~: ..... L-selectin Ilgand E-s~4ectin

ICAM-I" ICAM-2; VCAM'-I; MAdCAM-1

PECAM-1 ICAM-1

.,~ ~

_

F i g u r e V1.4.1 The multistep adhesion cascade for leukocyte-endothelial adhesion and transendothelial migration (modified from S. R. Sharar, R. K. Winn and J. M. Harlan (1995). The adhesion cascade and anti-adhesion therapy: an overview. Springer Semin. ImmunopathoL 16, 359, and reproduced with permission of Springer-Verlag GmbH & Co. KG).

column) demonstrated (by flow cytometry, immunocytochemistry, or in vivo inhibition studies) to play a role in leukocyte recruitment in rabbits. Of these various adhesion molecules, rabbit-specific DNA cloning has been reported only for E-selectin (Larigan et al., 1992). The counterreceptor ligands listed in Table VI.4.1 include receptors identified in humans that presumably play a role in leukocyte-endothelial adhesion and recruitment in rabbits.

Table V1.4.2

Molecules involved in leukocyte migration The molecular components of leukocyte migration have been described in detail (Carlos and Harlan, 1994; Butcher and Acker, 1996). Figure VI.4.1 describes the generalized leukocyte adhesion/emigration cascade; please refer to the previous subsection for those components of the cascade that have been identified in rabbits.

Chemotactic molecules described in rabbits

Chemotactic molecule

Leukocytes recruited

Organ studied

Reference

C5a

G

Skin, lung, mesentery

fMLP LTB4 Histamine IL-1 c~

G G G G

Skin, peritoneum Skin Skin Skin, lung, eye

IL-1/~ IL-2 IL-8

P, M, L L, ?G G

Articular joint Skin, lung Mesentery, lung, skin, articular joint

GRO LPS

G G, M

Lung Skin, lung, eye, peritoneum

TNF-~

G

Skin

Arfors et al. (1987), Argenbright et al. (1991), van Osselaer et al. (1993), Hellewell et al. (1994) Drake (1993), van Osselaer et al. (1993) Arfors et al. (1987) Arfors et al. (1987) Rosenbaum and Boney (1993), Hellewell et aL (1994) McDonnell (1992) Ohkubo (1991), Wiebke et al. (1995) Hechtman et aL (1991), Drake and Issekutz (1993), Ley et al. (1993), Folkesson et al. (1995), Matsukawa et aL (1995) Johnson et aL 1996 Doerschuk et aL (1990), Drake and Issekutz (1993), Rosenbaum and Boney (1993) Drake and Issekutz (1993)

G = granulocytes; L = lymphocytes; LPS = lipopolysaccharide; M = monocytes.

T-cell Receptor (TCR) Chemotactic molecules and populations recruited Limited information is available describing specific chemotactic or other inflammatory molecules and their function in rabbits. A partial list of these molecules implicated by a variety of in vivo studies in rabbit species is shown in Table VI.4.2. Of these various chemotactic molecules, rabbit-specific DNA cloning has been reported for IL-8 (Yoshimura and Yuhki, 1991), MCP-1 (Yoshimura and Yuhki, 1991; Kajikawa et al., 1993), and GRO (Johnson et al., 1996). In vivo experiments in these studies suggest that the biological effects of rabbit-specific chemokines are different from those seen with human-derived chemokines when both are administered to rabbits.

Species-specific aspects of leukocyte traffic To date, no leukocyte adhesion or emigration pathways have been described that are unique to rabbit species. The overwhelming majority of in vivo and in vitro experiments in rabbits have utilized New Zealand White rabbits or their cultured vascular endothelium (see sub-section on tissue-specific recruitment of leukocytes). Watanabe rabbits with heritable hyperlipidemia (Watanabe, 1980) have also been studied to determine the role of leukocyte adhesion and emigration in the development of atherosclerosis and related lesions (Calderon et al., 1994).

5.

Cytokines

The data on cytokines in the rabbit are still incomplete and scattered. The cDNA sequences of rabbit IL-1 (GenBank accession number M26295; Cannon et al., 1989) and a partial sequence of IL-2 (GenBank accession number Z36904; A. Schock and C. McInnes, unpublished data) are in the GenBank database. A number of papers report measurements of rabbit cytokines and their roles in various disease models. Immunoassays for detection of IL-I~ and IL-lfi have been described (Clark et al., 1991) and kits based on these assays are commercially available. Although a crystal structure of rabbit IFN-7 was reported in 1991 (Samudzi et al., 1991) the full sequence is not yet available in the GenBank database.

6.

T-cell Receptor (TCR)

TCR genes, their chromosome location and homology with other species The organization of the entire TCR gene loci is much the same as that of human and mouse. There are a single gene

233

Table Vl.6.1 Rabbit TCR gene segments and their similarity to human and mouse homologues Percentage nucleotide (amino acid) identity a to Gene segment

Human

Chain Ca

75.3 (68.6) 71.5 (65)

V3(

59 (44)

fl Chain C/~1

C/~2 Chimeric C~

Mouse

75 (70)

Marche and Kindt (1986a) Marche and Kindt (1986a)

83.9 (76.3) 80.3 (76.6) Angiolillo etal. (1985) 83 (76) 81 ( 7 8 ) Marche and Kindt (1986b) Komatsu et aL (1987), Harindranath et aL (1989b)

D/~2-J/~2

74

V61 V,~2

78.7 74.5

73.7 64.8

V/~3

83.6

80.1

V~4

67.0

65.2

V/~5 V#6 V/~7 (7.1-7.3) V/~8 V/~9 V/~10 V/~11

79.7 82.8 74.5-76.2 80.4 81.8 80.7 82.7

76.1 74.1 66.4-68.6 78.7 70.4 74.3 65.2

7 Chain C;,

82.3

80.3

J71 J72 V~i1(1.1-1.5T) V72

83 82 65-72 78

74 54 66-69 61

5 Chain Ca

80.6

77.7

Val Va2T Va3T Va4 Va5

77.0 65.9 81.2 74.9 86.7

66.2 64.7 65.4 73.6 77.1

a

Reference

Harindranath et aL (1991) Lamoyi et al. (1986) Marche and Kindt (1986b) Lamoyi and Mage (1987) Lamoyi and Mage (1987)

Isono et al. (1994)

Sawasdikosol et aL (1993), Isono et aL (1995) Isono et al. (1995)

Sawasdikosol et al. (1993), Kim et al. (1994) Kim et al. (1994) Kim et al. (1995)

Per cent identity was shown for the closest counterpart.

234


segment each of Ca, C v and Ca, two tandemly arranged C/3 gene segments, and clusters of V, D (for/3 and ~ chains) and J gene segments. The structural map of these segments has not been completely determined and their chromosome location is not known. Allelic variation has been identified for C/~ and C v segments (Komatsu et al., 1987; Harindranath et al., 1989a; Isono et al., 1995), and some rabbits have a third copy of C~ gene or the chimeric gene that may have arisen by an unequal crossing-over event (Komatsu et al., 1987; Harindranath et al., 1989b). Table VI.6.1 lists TCR gene segments of published nucleotide sequences and their similarity to human and mouse homologues.

these TCRs therefore remains mostly unknown. Crossreactive antibodies to homologous molecules of other species and/or nucleotide probes for reverse-transcription polymerase chain reaction (RT-PCR) provides only limited information. The 2aT-cell population in the peripheral blood, at 23% (Sawasdikosol et al., 1993), is relatively high compared with human and mouse; V~2 and Val genes are dominantly expressed in these cells (Kim et al., 1995).

TCR-associated proteins and accessory molecules involved in TCR signaling

Species-specific aspects of the structure, function or development of the TCR and associated proteins

Table VI.6.2 lists TCR-associated proteins and accessory molecules examined with monoclonal antibody and/or whose nucleotide sequence has been determined.

TCR repertoire ontogeny: thymic dependent and thymic independent No data relating to the TCR repertoire ontogeny are available.

Distribution of ~/~ and 7~ TCR populations Antibodies against rabbit 0~fi and 2~ TCR are not yet available and the tissue distribution of T cells carrying

Comparative analysis of nucleotide sequences of TCR gene segments revealed a greater similarity of rabbit to human than to mouse. A high percentage nucleotide identity is observed in almost all gene segments and, in addition, the similarity in C v chain gene is remarkable in that the gene of both these species, and not others thus far reported, contain repetitive exons that have lost the cysteine residue involved in the interchain disulfide bond (Isono et al., 1995). Genetic similarity between human and rabbit is also reported for the absence of linkage of TCRfl chain genes to immunoglobulin CK chain genes; these genes are linked in mouse (Hole et al., 1988). T-cell costimulatory molecules also displayed greater amino acid identity to human than mouse homologues (Isono and Seto, 1995).

Table V1.6.2 Rabbit TCR-associated proteins and accessory molecules involved in TCR signaling Molecule (synonym)

Molecular mass (kDa)

CD3~ CD4

c

CD8fl

50 28

CD11 a(LFA- 1c~) CD18(LFA- 1fl)

150 90

CD28 CD45

-200

CD54(ICAM-1) CD58(LFA-3) CD80(B7) CD86(B7-2) CTLA-4

-42 ----

Monoclonal antibody a and nucleotide sequence database accession no.

Reference

PC3/188A b KEN-4 M92840 12.C7 L22293 KEN11 L13/64 RCN1/21 D49841 1.24 L12/201 R6.5 b VC21 D49843 D49842 D49844

Jones et al. (1993) Kotani et aL (1993) Hague et al. (1992) De Smet et al. (1983) Sawasdikosol et al. (1993) Kotani et al. (1993) Jackson et al. (1983) Galea-Lauri et al. (1993) Isono and Seto (1995) De Smet et al. (1983) Jackson et al. (1983) Argenbright et al. (1991) Wilkinson et al. (1992) Isono and Seto (1995) Isono and Seto (1995) Isono and Seto (1995)

Representative antibodies alone are cited. bCross-reactive antibody produced against the molecule from other species. c Not available.

a

I

m

m

TableVI.7.1

u

n

o

g

l

o

b

u

l

i

n

s

2

3

5

Rabbit immunoglobulin classes

Rabbit Ig classes

MW

IgM

800-950

x 10 - 3

Concentration in serum (mg/ml) ~1 a

Distribution

Function

Serum Lymph

Primary Immune responses Complement

Fixation

IgG

149

(~ 5-20) 5

Serum Lymph

Secondary Immune responses

IgA

158-162

(~3-4)

Mucosal secretions c and serum

Local and systemic protection

IgE

185-190 d

e

Serum

Histamine release from mast cells, IgE-mediated Anaphylaxis release of platelet Activating factor from basophils (Betz et al., 1980)

Lymph Fixed on basophils/mast cells

aThe concentration of IgM in rabbit serum may be elevated during infections. Trypanosoma equiperdum has been used to experimentally elevate IgM levels prior to isolation of IgM (Van To/et aL, 1978; Gilman-Sachs and Dray, 1985). bThe concentration of IgG in rabbit sera varies with age, tending to be elevated in older animals. Hyperimmunization with streptococcal, pneumococcal or micrococcal vaccine can cause markedly elevated IgG concentrations greater than 50 mg/ml (Krause, 1970; Haber, 1970; Mage et aL, 1977). CSpieker-Polet et al. (1993) found that there are at least 10 different IgA isotypes that are expressed (see also Table V1.7.2). mRNA corresponding to the isotype encoded by the gene that maps most 5' (C=4), was found expressed in a variety of tissues including small intestine, appendix, mesenteric lymph node, mammary tissue, salivary gland, lung, tonsil and Peyer's patches. This was the only detectable isotype in lung and tonsil. In other tissues the additional isotypes were found to be expressed at various levels. dLindqvist (1968). eThe absolute amount of IgE in rabbit sera probably varies as it does in man depending upon genetic and environmental factors. It also becomes elevated upon hyperimmunization (Kindt and Todd, 1970).

7.

Immunoglobulins

Function

The rabbit's immunoglobulin classes and some functions are summarized in Table VI.7.1. There is no definitive evidence for IgD in the rabbit. Although early studies suggested there might be another immunoglobulin on the surface of IgM § B cells that was not IgA or IgG (Wilder et al., 1979; Eskinazi et al., 1979; Sire et al., 1979), no gene encoding the 5 heavy chain has been identified in the region downstream of the Cl, gene.

locus names and accession numbers are also listed. Only germline VH that are known to be expressed are included. There are more than 100 rabbit germline VH gene (and pseudogene) or cDNA sequences containing rearranged VDJ in the GenBank database. Similarly, only some light chain germline V region sequences are included. Many of the CL cDNA sequences listed also have associated rearranged VL sequences. In addition to the GenBank, the 'Kabat Database of Sequences of Proteins of Immunological Interest' (http://immuno.bme.nwu.edu/) is another valuable resource available on the world wide web. The rabbit Ig gene sequences are tabulated and updated frequently within this compendium.

Ig g e n e loci

An extensive review of rabbit immunoglobulin genes that were originally detected serologically as allelic forms (allotypes), including descriptions of methods and reagents can be found in Roux and Mage (1996). Additional information about rabbit VH, IgM and IgA can be found in: Gilman-Sachs et al. (1969); Knight and Hanly (1975); Currier et al. (1985); Gallarda et al. (1985); Allegrucci et al. (1990) and Becker and Knight (1990). The Ig heavy-chain gene loci with some known allelic forms, heavy chain locus haplotypes, and light chain loci with some known allelic forms are summarized in Tables VI.7.2, VI.7.3 and VI.7.4 respectively. Some GenBank

A c c e s s o r y m o l e c u l e function

Information about accessory molecules on rabbit B lymphocytes is limited. Homologues of the Ig~ and Igfl components of the B-cell receptor complex have been discovered (Fitts et al., 1995). CD5 is expressed on the majority of rabbit B lymphocytes (Raman and Knight, 1992). CD5 appears to bind to the VH region of certain immunoglobulins with framework region specificity (Pospisil et al., 1996). It may thus affect selective expansion of certain subsets of B cells (Pospisil et al., 1995, 1996). Its role as a coreceptor has been suggested.

236 Table Vl.7.2

IMMUNOLOGY OF LAGOMORPHS Rabbit immunoglobulin genes: heavy chains

Heavy chain variable region (VH) VHlal a multiple amino MR1a2 acid differences Villa3 in framework regions 1 and 3 y33x32 -b

GenBank locus name

Accession number

Reference

RABIGHVXA RABIGHVXB RABIGHVXC

M93171, J04864 M93172, J04865 M93173, J04866

Knight and Becker (1990) Knight and Becker (1990) Knight and Becker (1990)

RABIGHVDBQ

M77083

Short et al. (1991 )

J00666 K01357

Bernstein et al. (1984) Bernstein et aL (1984)

RABIGCMB RABIGHAD RABIGCA

M16426 K00752, M12187 L29172, N00008

Martens et al. (1982) Bernstein et al. (1983a) Martens et al. (1984)

OCIG02 OCCALP HA 1-OCCALP HA 13

X00353 X51647, X82108-X82119

Knight et al. (1984) Burnett et aL (1989)

zb

Heavy chain constant regions (CH) IgM c The cDNA sequences RABIGHAB of one secreted/~ and RABIGHAC membrane C-terminus are available IgG 'Hinge region' between CH1 and OH2 position 225 dl 1 Met, d12 Thr OH2 domain of IgG position 309 el 4 Thr, el 5 Ala Haplotypes dl le15 d12e14 d12e15 igA c One cDNA of g75 type 13 germline genes (c~13 is g75) c~5 and c~6 are f72 all others f71

Most allelic forms were originally defined serologically. The a-locus alleles found in domestic and laboratory rabbits correspond to the genes mapping most 3' (closest to the DR and JR regions) (Knight and Becker, 1990). In most rabbit B lymphocytes this first MR1 gene is found rearranged and expressed (Becker et aL, 1990; Allegrucci et aL, 1991). The locus contains 100-200 genes. Although some other VH genes rearrange, they may primarily function as donors for 'gene conversion' of the rearranged MR1sequence (Becker and Knight, 1990; Weinstein et aL, 1994). In normal rabbits 'a-negative' Igs occur in 10 to 30% of the total IgG or Ig-bearing B cells. Their expression is elevated in mutant Alicia rabbits (Kelus and Weiss, 1986) and in allotype-suppressed rabbits (Short et aL, 1991) (see section 16). bThe germline x32 and z gene sequences are not known but several recurring cDNA sequences are probably close to the germline sequence. c Serologically defined types and haplotypes are shown in Table V1.7.3. At least 12 of the 13 Ca genes are expressed in vitro (Schneiderman et aL, 1989) and 10 in vivo (Spieker-Polet et aL, 1993). a

Ontogeny of the Ig repertoire in rabbits The newborn rabbit is born with passively acquired maternal protective immunity. Using immunoglobulin allotypic markers, it has been possible to track the disappearance of the maternal immunoglobulins and also to detect the appearance of immunoglobulins synthesized by the young rabbit that could only have been inherited from their sires (reviewed by Mage, 1967).

Repertoire generation A current working model of VH repertoire development in the rabbit is that in the fetal and neonatal period, VHDHJH and VLJL rearrangements occur in bone marrow, fetal liver, and perhaps omentum, but there is limited receptor diversity because of rearrangement and

utilization of mainly a single Vvt g e n e - VH1 that carries the VHa allotypic sequences (see Table VI.7.2). Cells from these sources seed the gut-associated lymphoid tissues. In particular, appendix follicles form, driven by gut antigens and perhaps superantigens; there is B-cell expansion. By 6 weeks of age the appendix is highly cellular and there is development of the primary high copy number repertoire, VH gene diversification by gene conversion and somatic mutation. Positive and negative selective events occur and cells that survive the selection exit to the periphery to participate in further encounters with foreign antigens.

Species specific aspects of Ig structure The rabbit (and probably other Lagomorphs) have a duplication of the entire C~ locus (Benammar and Caze-

I

m

m

u

n

o

g

l

o

b

u

l

i

n

s

2

3

7

Table V1.7.3 Rabbit immunoglobulin genes: heavy chain haplotypes VH Designation

a

A B C

1 1 1

I

1

J R2M [l(F-C)] a R6K[alF-(F-I)] a alFK

1 1 1 1

R3K F - C a E F R1M F-I a Ali F-I M

2 2 2 2

G H R4K H-I a R7K [H(ali F-I)] a R8K [a3F-(F-I)] a a3FK

x

!~ y

ms b

3 3 3 3 3 3

d

e

f

g

(81)

15 15 15 14 15 15 14 15

73 71 72 69 70 72 69 71

74 75 74 77 76 74 77 75

72 71 69 69 69 73

74 75 . 77 77 77 74

33, 30

17 17 17

(80) (80) (80)

32 32 32 32 32 32

33 33, 33, 33, 33, 33,

17 17 17 17 17 16

(80) (80) (80) (80) (80) (81)

11 12 12 12 12 12

15 15 15 14 14 15

32 32 32 32

-----

17 16 17 16

(80) (81) (80) (81)

12

15

71

75

11 12

15 14

72 69

74 77

--

2

nb

12 12 11 12 12 11 12 12

--

33, 30 33, 30 33, 30

(2)

~

------

16

17 17 17 16

17 17

(80) (80) (80) (81)

(80) (80)

12 12 12

14 14 15

69 69 71

77 77 75

aThese haplotypes were derived from recombinations that occurred during breeding of laboratory rabbits (Mage et aL, 1982, 1992; Kelus and Steinberg, 1991). The parental haplotypes from which the recombinants were derived are shown in brackets. The alFK and a3FK are the zpq_arentalhaplotypes from which R6K and R8K were derived, respectively. here are two parallel nomenclatures for/~ alleles, ms16/17 and m8d/81. Table V1.7.4 Rabbit immunoglobulin genes: light chains Comments

Allele

GenBank cDNA

Genomic DNA

References

OCIG06 (X00977) OCIG07 (X02336} OCIG08 (X02337) OCIG09 (X02338) RABIGKVA (K02131) RABIGLFUNA (M27840) RABIGLFUNB (M27841)

Heidmann and Rougeon Heidmann and Rougeon Heidmann and Rougeon Heidmann and Rougeon Leiberman et al. (1984) Hayzer and Jaton (1989) Hayzer and Jaton (1989)

Heidmann et al. (1981), Dreher et al. (1983), Emorine and Max (1983), Emorine et al. (1983), Heidmann and Rougeon (1983) Bernstein et al. (1983b), Pavirani et al. (1983), Emorine et al. (1984), Esworthy and Max (1986) Dreher et al. (1990)

Light chain variable regions V,.

Only a few germline V~ and V>~ sequences are available V~. 18a V,. 18b VK 19a V,. 19b V~20 V~ CA-1 Four alleles in domestic a n d laboratory rabbits

Originally defined serologically, the alleles have multiple amino acid sequence differences, b bas has a mutation of Klb9

b4

RABIGKAA (K10358, J00667)

RABIGKCA (K01360) RABIGKCC2 (K01362)

b5

RABIGKAB (K00751)

RABIGKCD (K01363, M29144)

b6

OCIGK1B6 (M37809)

b9

RABIGKAC (K01359)

OCIGK1B6 (M37809, M29583) OCIGK(X00674)

bbaS

OCIGKM (X03050)

(1984) (1984) (1984) (1984)

Akimeno et al. (1984), McCartney-Francis et al. (1984) Lamoyi and Mage (1985) (continued)

238

Table Vl.7.4


Continued

Comments C~2, two alleles known

In mutant Basilea and wildtype b9k rabbits-Leu is at C, position 204 Found in most laboratory strains- Pro at position 204 J~l There are different J, genes associated with each b allotype A distinct set of J~ genes are associated with the C~2 alleles

Allele

cDNA

basl

RABIGKAD (K01361)

Genomic DNA

References

Bernstein et al. (1984)

bas2

OCIG01 (V00885) OCIGK2B6 (X05800) OCIGK2B9 (X05801)

Heidmann and Rougeon (1983) Mariame et al. (1987) Mariame et al. (1987)

b4 b5

RABIGKCC1 (K01361) RABIGKCD (K01363, M29144) RABIGK1 B6 (M37809, M29583) RABIGKC01 (M14602-M14067)

Heidmann and Rougeon (1983) Esworthy and Max (1986)

b6 b9

J~2 A distinct set of J~ genes are associated with the C~2 gene. C~ Several isotypic forms- gene (c7) organization may differ in (c21) different rabbit strains. The serologically detectable types c7 and c21 appear to be products of linked C~ genes rather than truly allelic forms

OClG05 (X00232) OCIGLC7 (X57729, X57843) RAGIGLAAA (D00091, M15807, N00091) RABIGVLCLF (M17645, M25622)

16). An unusual feature of the/cl light chains of the rabbit (and probably other lagomorphs), is an extra disulphide bond that is not found in/c2 or in/c light chains of other species such as mouse, rat and man. The disulphide bond forms between the VL and CL domains of the light chains and may stabilize their structure. Interestingly, one of the four major allotypes, b9, lacks the Cys found at position 80 in VL sequences of the other allotypes and has instead a Cys in the JH region leading to another form of disulphide bonding (McCartney-Francis et al., 1983). The evolutionary and functional significance of these structural differences has been discussed (McCartney-Francis et al., 1983; Mage et al., 1987).

Akimeno et al. (1986) Emorine and Max (1983) Hayzer et al. (1990)

RABIGLCA (M12388)

Duvoisin et al. (1986), Hayzer and Jaton (1987)

RABIGLCB (M12761)

Duvoisin et al. (1984), Duvoisin et al. (1986), Hayzer et aL (1987) Duvoisin et al. (1986) Duvoisin et al. (1986)

RABIGLCC (M12762) RABIGLCD (M12763)

nave, 1982; Heidmann and Rougeon, 1983b). The second C~ gene,/c2 maps about 1 Mb from C~1 (Hole et al., 1991) and is normally expressed at very low levels. However, in a mutant rabbit strain, Basilea (Kelus and Weiss, 1977), there is a defect in the mRNA splice acceptor site required for splicing of J~ to C~ mRNA to form mature light-chain message (Lamoyi and Mage, 1985). In these mutants there is elevated expression of the/c2 light chains in addition to elevated production of 2 type light chains (see also Section

Dreher et al. (1990)

8.

MHC Antigens

The multiplicity of histocompatibility genes in rabbit, as examined through skin graft exchanges among F2 and F3 generations of the cross between the B and Y inbred rabbit lines was estimated at 19 unlinked loci (Chai, 1974). Among these, the major histocompatibility complex system, RLA, has been characterized at the level of proteins and genes (Table VI.8.1); the minor loci remain undetermined. Serologically defined RLA-A antigens were originally identified by determining the effect of matching of leukocyte alloantigens on graft survival (Tissot and Cohen, 1972). A series of leukocytotoxic antisera obtained from rabbits receiving skin grafts from donors within or between different inbreeding lines defined up to 13 distinct RLA-A alleles (Table VI.8.2). However, as the antisera are no longer available, typing of the MHC class I region in rabbit is now superseded by restriction fragment length polymorphism (RFLP) analysis (Table VI.8.2 and VI.8.3). The RLA-D locus was first defined as a genetic locus controlling in vitro mixed lymphocyte reactivity (MLR) (Tissot and Cohen, 1974), it also affected the fate of

MHC Antigens

239

Table V1.8.1 Classification of RLA genes A. Class I RLA genes

B. Class II RLA genes

Unclassified

8-12 heavy chain genes classified into 4 subfamilies. Clone 19-1 and the corresponding pR9 cDNA clone represent the first subfamily which is most abundantly expressed, a The cDNA clones, pR11 and pR27, are derived from the second and third subfamilies, respectively, b RLA-DP subregion: 2~, lfl: DP~2-DP~I-DPfl c RLA-DQ subregion: lc~, 2fi: DOfl-(DQ~-DQfl) d RLA-DR subregion: 1~, 5fl: DR~-DRfll, DRfl2-DRfi3-DRfl4, e DRfl5 2~: DF~ ~HLA-DNA homolog g

Marche et al. (1985). b Rebierre et al. (1987b). CThere is evidence for an additional RLA-DPfl-like gene located outside the RLA-DP cluster but it has not been cloned (Sittisombut et aL, 1989). dThe RLA-DQ~ and RLA-DQfl genes are closely linked (LeGuern et aL, 1985, 1987; Sittisombut and Knight, 1986). The RLA-DOfl gene is located on the same 150 kb NotI-Mlul fragment as the RLA-DQc~gene in the RLA-D1 haplotype; the distance has not yet been determined (Chouchane and Kindt, 1992; Chouchane et aL, 1993). eThe RLA-DRfi3 and RLA-DRfl4 genes are more homologous to each other than to the rest of RLA-DRfl genes (Sittisombut et aL, 1989). ~The RLA-DF~ gene is a pseudogene containing only exon 4 coding sequence but has been detected in all rabbits tested and in hare and cottontail (Marche et aL, 1991). gPreviously designated as the RLA-DP~2 gene but is unlinked to other RLA-DP genes (LeGuern et aL, 1985); may represent HLA-DNA homolog (T. J. Kindt, personal communication). a

allogeneic skin grafts because compatibility at both of the RLA-A and RLA-D loci resulted in the longest graft survival time (Cohen and Tissot, 1974). Six distinct RLAD alleles have been identified by one-way MLR assay but the assay is also replaced by RFLP analysis (Tables VI.8.2 and VI.8.4). The RLA-A and RLA-D loci are closely linked to the He blood group locus in rabbit linkage group VII (Tissot and Cohen, 1974). Antirabbit fl2-microglobulin has been used to purify and characterize fi2-microglobulin-associated molecules from

Table V1.8.2

Assignment of rabbit MHC haplotypes RLA-A haplotype

RLA haplotype

1 2 3 4 5 6 7

8

9 10 11 12 13 14 15 16 17

solubilized membrane glycoproteins of RL-5, a T-lymphocyte cell line derived from an inbred B/J rabbit (Kimball et al., 1979). Following dissociation of fl2-microglobulin with acid, analysis of the 43 kDa protein peak revealed a major protein with high level of sequence identity with HLA-B7 and H-2K b molecules. Corresponding mRNAs and their relative expression in RL-5 cells were derived by screening a cDNA library with the H-2L d probe (Tykocinski et al., 1984). Restriction enzyme analysis of randomly picked clones revealed a major group of abundantly expressed

RLA-D haplotype

SD a

RFLP b

ML C c

RFLP b

Rabbit strain d

A1 A2 A3 A4 A5 A6 A7 A8 A9 A10 A11 A12 A13 nd nd nd nd

A1 A2 A3 nd A5 A6 A7 A8 nd A7 A11 nd A13 nd A15 A16 A1

D1 D2 D3c D2 D4 D3f D4 D3 D3 D2 D31 D5 D4 D10 nd nd nd

D1 D2 D3c nd D4 D3a D7 D6 nd D2 D3a D5 D8 D10 D15 D2 D17

III/Dw, A B C na E F na na na na B/J na na III/J na na na

defined by serological typing. Haplotypes defined by RFLP analysis. CAlleles defined by mixed lymphocyte culture test. dlll/Dw, B/J and III/J are inbred strains, the others (A, B, C, E and F) are RLA homozygous rabbits maintained by selective breeding; nd, not done; na, not available. Reprinted from Sittisombut (1996), with permission. Copyright CRC Press, Boca Raton, Florida. aAlleles b

240

Table Vl.8.3


List of RLA-A haplotypes as defined by RFLP analysisa

Probe (restriction enzyme) b RLA-A haplotype

RLA-A exon 4 (19-1-3) (BamHI)

A1 A2 A3 A5 A6 A7 A8 All A13 A15 (A16)

18 c 18 18 18 18 18 25 18 18 25 18

11 6.1 11 11 11 14 18 11 11 18 14

pR27-3' (Bglll) 8.5 4.7 6.1 8.5 d 10 6.7 11 10 8.5 11 11 e

3.7 3.7 3.7 6.7 6.7 3.7 6.1 6.7 4.7 6.1 6.7

6.1 6.1 3.7 6.1 3.7 4.7 6.1 e

4.7 d 4.7

3.7 3.7

4.7

3.7

3.7

5.6 5.6 7.2 7.2 5.6 5.6 7.2 3 4.4 10 5.6

aAdapted from Marche et al. (1989) with permission.

b Probes are listed in Table V1.8.5. c Size of restriction fragment in kb. dMay be doublets. eThe status of haplotype 16 with respect to these fragments is not yet clear. Reprinted from Sittisombut (1996), with permission. Copyright CRC Press, Boca Raton, Florida.

cDNA clones and three other groups of rare and structurally atypical clones. These mRNA species are products of approximately 8-12 class I genes in the rabbit genome (Kindt and Singer, 1987). Differential hybridization with multiple cDNA and oligonucleotide probes allows subdivision of these class I RLA genes into four subfamilies (Kindt and Singer, 1987; Rebiere et al., 1987b). Allotypic variation of rabbit class I genes and corresponding pro-

Table Vl.8.4

teins is not yet known. However, RFLP patterns of all class I genes in individual rabbits correlate well with serologically defined RLA-A alleles. With B a m H I digestion, distinct patterns of bands hybridized to a class I exon 4 probe correspond to distinguishable RLA-A alleles in nine out of ten haplotypes tested (Tables VI.8.2 and VI.8.3) (Marche et al., 1989). The heterodimeric nature of RLA-D antigens and the

List of RLA-D haplotypes as defined by RFLP analysis

Locus (restriction enzyme) RLA-D haplotype

DP~ 1 (BamHI)

DP~2 (Hindlll)

DPfi (EcoRI)

DQ~ (Pvull/EcoRI)

DQ/J (Hindlll)

D1 D2 D3a D3c D4 D5 D6 D7 D8 D10 D15 D17

14 b 14 14 24 e 14 24 e 14 24 14 14 4 14

8.3 8.3 8.3 7.6 nd 8.3 nd nd nd 8.3 nd nd

[3.8, [3.8, [2.7, [3.8, nd [3.8, nd nd nd [3.8, nd nd

8/2.8 1.8/6.3 5.9/3.7 5.9/3.7 3/9.6 nd/7.8 6.3/2.8 4.7/6.3 6.3/6.3 nd/3.7 3/3.3 3.7/3.7

3.3 [5.5, [2.8, [2.8, nd 16.5 nd nd nd [2.8, nd nd

a Pattern represents all five RLA-DRfl genes.

8.5] cd 8.5] 8.5] 8.5]

8.5]

8.5]

DR~ (EcoRI)

6 5.4 4.8 4.8 6 5.6 4.8 5.4 6 8.4] ~ 4.8 6 6

6.1] 8.4] 8.4]

DR/Ja (BamHI) 2.4, 2.4, 2.4, 2.4, nd 2.4, nd nd nd 2.4, nd nd

5.2, 5.2, 4.5, 4.5,

7.4, 7.2, 7.2, 7.2,

9.2, 27.5 10.5, 12, 27.5 10.5, 12, 27.5 10.5, 12, 27.5

5.9, 7.2, 12, 27.5

4.5, 7.3, 12, 18.5

b Size of DNA fragment in kb. c[ ] Represents cleavage within an allelic form. dAdditional hybridizing band due to another DPfl-like gene is observed (Sittisombut et aL, 1989). eReported as the > 27.5 kb band by Sittisombut et aL (1989). ~Reported as the [2.9, 8.4] kb fragments by Sittisombut et aL (1989), but are likely to be identical to the [2.8, 8.4] fragments of D3 haplotypes. Reprinted from Sittisombut (1996), with permission. Copyright CRC Press, Boca Raton, Florida.

MHC A

n

t

i

g

e

n

s

linkage of corresponding genes with the RLA-D locus defined previously by MLR and classical genetic analysis were established by using polyclonal antisera directed against nonimmunoglobulin, polymorphic surface antigens of rabbit lymphoid cells (Knight et al., 1980). A monoclonal antibody (2C4), which strongly inhibited the MLR and proliferative response to soluble antigens (Lobel and Knight, 1984), precipitated from metabolically labeled spleen cell lysate multiple a-chain and fl-chain spots in two-dimensional nonequilibrium pH gradient electrophoretic gel (Knight et al., 1987). Most spots were homologous to HLA-DQa or -DQfi chains at the N-termini whereas an a-chain spot resembled the HLA-DRa chain (Knight et al., 1987). Following the cloning of the RLADRa gene and several DRfl genes (LeGuern et al., 1985; Sittisombut and Knight, 1986; Laverriere et al., 1989; Sittisombut et al., 1989), an additional monoclone (RDR34) was raised by immunization with transfected cells expressing products of the RLA-DRa and RLA-DRfl2 genes (Spieker-Polet et al., 1990). Cross hybridization with human and murine class

Table 91.8.5

2

4

1

II probes identified homologues of the HLA-DQ, DP, -DR, -DO, and -DF genes in the rabbit genome (Table VI.8.1). As shown by pulsed-field gel analysis, these genes are located within approximately 630 and 1200 kb of DNA, respectively, in the RLA-1 and -2 haplotypes in the following order: DP-DOfl-DQ-DR (Chouchane and Kindt, 1992). The RLA-A and RLA-D regions are closely linked in a few rabbits examined (Chouchane and Kindt, 1992). Comparatively higher level of allotypic variation of RFLP pattern was detected in the RLA-DQa gene (Table VI.8.4). As a group, the RLA-DRfi genes are quite polymorphic; distinct RFLP patterns of these genes also correlate with the RLA-D typing data in a limited set of animals tested (Table VI.8.4). Based on the studies of inbred rabbits and rabbits carrying known serologically defined and MLR-defined haplotypes, RFLP analysis is sufficiently sensitive to distinguish 11 RLA-A alleles and 12 RLA-D alleles with available DNA probes (Table VI.8.5) (Marche et al., 1989; Sittisombut et al., 1989). Additional RLA class I haplotypes are likely to exist in outbred colonies (Boyer et al., 1995) and

List of probes and alleles/patterns detected by RFLP analysis RFLP alleles/patterns

Locus

Probe a

Region

Enzyme

Number of alleles/ haplotypes tested

Class I R9

19-1-3' (g)

BamHI

10/10

R27

R27-3' (c)

Bglll

5/10

10 patterns of multiple fragments (see Table V1.8.3) 3, 4.4, 5.6, 7.2, 10

Class II DPc~I

Exons 6-8 (0.5 kb) b 3' UT (0.35 kb)

DP~,DP~I (g)

BamHI

3/12

4, 14, 24 d

DP~2

DP~2 (g)

Hin~ll

2/6

7.6, 8.3

DPfl

DP/~ (g)

EcoRI

2/6

[2.7, 8.5] e, [3.8, 8.5] e

DQc~

DQ~ (g)

PvLAI

6/10

1.8, 3, 4.7, 5.9, 6.3, 8

DQ/~

DQ/~ (g)

EcoRI HincAII

6/12 4/6

2.8, 3.3, 3.7, 6.3, 7.8, 9.6

DRc~

DR~ (g)

EcoRI

4/12

2.41', 4.8, 5.4, 5.6, 6

DR/~

7.1-3' (c)

BamHI

5/6

Five patterns of multiple fragments (see Table V1.8.4)

DF~

DN,RDF (g)

Bglll

4/10

2.7, 4.7, 8, 10

Exons 2, 3 c (0.6 kb) Exons 3, 4 (1.45 kb) Exon 3 (2 kb) Exons 3, 4 c (0.5 kb) Exon 3 (2 kb) Exons 3, 4 c (0.8 kb) Exon 3 and other 3' sequences (0.7 kb) Intron 4 and exon 4 (0.5 kb)

Probes were derived from either genomic clone (g) or cDNA clone (c). bSize of probe in kb. c Multiple similar probes have been employed but only the smallest probe is shown. dReported as the > 27.5 kb band by Sittisombut et aL (1989). e Represents cleavage within an allelic form. ~Present in an outbred rabbit of unknown haplotype. Reprinted from Sittisombut (1996), with permission. Copyright CRC Press, Boca Raton, Florida.

a

Alleles/patterns (kb)

[2.8, 8.4] e, 3.3, [5.5, 6.1] e, 16.5


242

wild rabbits. However, many of the putatively novel RLA class I and class II RFLP alleles/haplotypes detected in New Zealand White rabbits (Boyer et al., 1995) most likely reflect heterozygosity among outbred animals.

Expression and tissue distribution In the virally transformed RL-5 T cell line, at least four class I genes are transcriptionally active. Various mRNA species, 1.4, 1.9, 2.8 and 3.9 kb in size, are detected with a conserved exon 4 probe (Tykocinski et al., 1984; Rebierre et al., 1987a). However, protein products of only one gene, 19-1, are demonstrated by precipitation with anti-fl2microglobulin and two anti-class I monoclones (Kimball et al., 1979; Wilkinson et al., 1982). By employing the same class I exon 4 probe, the 1.4 kb and 2.8 kb mRNA species are detected in thymus whereas only the 1.4 kb form is present in lymph node and liver (Rebierre et al., 1987a). Transcripts of the unusual gene corresponding to pR27 are found in thymus but not in brain, testis, lymph node, liver or muscle (Rebierre et al., 1987a). Relatively high levels of the mRNA transcripts of RLADQ~, RLA-DQfl, RLA-DR~ and RLA-DRfl genes are present in rabbit spleen; the RLA-DP0~I, RLA-DP~2 and RLA-DPfl mRNA are much less abundant (Kulaga et al., 1987; Spieker-Polet et al., 1990). These class II mRNA are also detected in bone marrow, appendix, lymph nodes and thymus (Kulaga et al., 1987). The RLA-DOfl mRNA are found at low levels in appendix, spleen and lymph nodes (Kulaga et al., 1987). Among the class II RLA proteins, the RLA-DQ~ and RLA-DQfl chains are readily identifiable from rabbit spleen by 2C4 monoclone (Knight et al., 1987). They are also induced in RL-5 cells productively infected with HTLV-1 (Zhao et al., 1995). Expressibility of the RLADR and RLA-DP genes has been examined by transfecting corresponding genes into the A20 B-lymphoma cell line. With the RLA-DR~ and RLA-DRfi2 genes, stably transfected cells are recognized by the monoclonal antibody RDR34, which stained about 50% of rabbit spleen cells similar to 2C4 (Spieker-Polet et al., 1990). Although other RLA-DRfl genes have not yet been tested by transfection, transcripts of the RLA-DRfll and RLA-DRfl3 or RLADRfl4 genes can be found in rabbit spleen (Spieker-Polet et al., 1990) and cDNA clone derived from the -DRfl4 gene is isolated (Sittisombut, 1987). Cell surface expression of the RLA-DP proteins has not yet been observed. In the RLAD10 haplotype, this may be due to unfavorable nucleotides surrounding the first AUG codon of the RLA-DPfi mRNA (Sittisombut et al., 1988).

Disease association Regression and malignant conversion of virus-induced papilloma are associated with specific alleles of RLA

genes (Han et al., 1992). Shope cottontail rabbit papillomavirus infection in rabbits results in skin warts which may regress spontaneously or progress into malignant lesion. Regression occurs in 10-40% of papilloma-bearing domestic rabbits whereas epidermoid carcinoma develops in as high as 73% (Syverton, 1952; Kreider and Bartlett, 1981). These changes are associated with contrasting histological features and systemic immunologic responses (Okabayashi et al., 1991, 1993; Lin et al., 1993; Selvakumar et al., 1994; Hagari et al., 1995) which may reflect differential expression of viral genes (Zeltner et al., 1994). In New Zealand White rabbits, significant association between early papilloma regression and the 5.6kb (EcoRI) RLA-DR0~ allele and the 3.0 kb (PvulI) RLA-DQ0~ allele is evident (Han et al., 1992). In contrast, malignant conversion is associated with the 1.8 kb (PvuII) RLA-DQ0~ allele. The association of RLA system with papilloma progression is parallel to the linkage between HLADQw3 and carcinoma of the cervix in human (Wank and Thomssen, 1991; Helland et al., 1992; Apple et al., 1994; Gregoire et al., 1994).

Species-specific aspect The second exon of the RLD-DPfl gene in the RLA-D10 haplotype contains a complex deletion/insertion mutation (Sittisombut et al., 1988) which is absent from known HLA-DPfl alleles (Marsh and Bodmer, 1995) but resembles the ones found at similar position of the H-2Afll gene of five mouse strains (Estess et al., 1986; Acha-Orbea and McDewitt, 1987). This mutation is assumed to occur by a gene conversion-like event after speciation (Sittisombut et al., 1988), but it is possible, according to the trans-species hypothesis of MHC evolution (Klein et al., 1993), that such mutations occur in a member of the pool of ancestral class II fl genes which existed even before mammalian diversification. The RLA-DPfl allele and the H-2Afll alleles bearing a similar mutation descend from the mutant allele whereas the HLA-DPfl alleles derive from another fl allele in the same pool.

9.

Rabbit Blood Groups

The rabbit blood group system was first described by Levine and Landsteiner (1929) and the genetics of the system were first examined by Castle and Keeler (1933). From the mid-1950s to the late 1970s, numerous papers describing the serology, biochemistry and genetics of rabbit blood groups appeared authored by Carl Cohen and Robert G. Tissot. Drawing from this large body of work, Cohen (1982) summarized the cellular antigen systems, including the red cell antigens, of the rabbit. The rabbit blood group system is summarized in Table VI.9.1. To date, all markers have been identified serologically in direct hemagglutination (HA) assays using trypsintreated target red cells.

Complement

TableVl.9.1

243

Rabbit blood groups

LOCUS a

Alleles

He

H e A, N e D, He F

Hb Hc He

HbB, HbM Hc c, H c L He, he

Hh Hq Hu

Hh, hh Hq Q, Hq es, Hq s Hu u, H u Y

TableVl.9.3

Number of phenotypes

Detection method

6 3 3 2 2 3 3

Direct Direct Direct Direct Direct Direct Direct

HA HA HA HA HA HA HA

aModified from Cohen (1982).

The Hq blood group system was originally thought to consist of two alleles, Hq q and Hq s, but later studies (R. G. Tissot, unpublished data) showed that Q and S can also be found in the same haplotype. No rabbits have been found lacking both Q and S. The Hg blood group system in the rabbit was the most thoroughly studied of the seven rabbit blood groups. The Hg system has strong biochemical and genetic resemblances to the human Rh system. Twelve antisera were produced defining red cell antigens coded at the Hg locus. Five antisera were produced which recognized epitopes (I, J, T, V, and W), which presumably resulted from interactions between products of the Hg A, Hg D and/or Hg F alleles. Three antisera recognized epitopes (K, P, and R) shared between products of the Hg A, Hg D and/or Hg F alleles. The Hg blood group system is summarized in Table VI.9.2. One antiserum, defining blood group N, was produced with specificity for antigens on the red blood cells of one litter of inbred rabbits which should have been blood group Hg I), based on their parentage, but whose red cells failed to react with standard anti-Hg D typing serum. Unfortunately, this litter of rabbits failed to reproduce and the unique N blood group was never identified again. Thus, the unique twelfth Hg blood group N is not included in Table VI.9.2. Table VI.9.3 summarizes the known combinations of epitopes recognized by the five antisera which detect the 'associative' or 'interactive' epitopes which can be detected only when the appropriate combinations of epitopes are present on the red cell. In summary, seven rabbit blood groups are known. The most widely studied of these is coded at the Hg locus and Table Vl.9.2

The rabbit Hg blood group

Reactions with typing sera: antiGenotype

HgA/Hg A HgD/Hg D HgFIHg F HgA/Hg

F

HgDIHg F HgA/Hg g

A

D

F

K

P

R

+

-

_

_

+

+

--

-t-

--

-I-

--

+

_

_

+

+

+

-

+

-

+

+

+

+

+

+ +

+ -

+ +

+ +

+ +

Associative epitope summary

Antiserum

Epitope combinations detected

Anti-I Anti-J Anti-T Anti-V Anti-W

A/D K/R A/K P/D A/A

consists of three codominant autosomal allelic genes, Hg A, Hg D and Hg ~. These code for six major phenotypes (A/A, A/D, A/F, D/F, D/D, and F/F). The antigens described by Cohen (1982) using the anti-I, -J, -T, -V, and -W antisera appear to be epitopes formed by associations of the products of the Hg A, Hg D and/or Hg F alleles. Epitopes defined by the anti-K,-P, and -R antisera are shared between products of the Hg A, Hg D and/or Hg F alleles. Rabbit blood groups remain of interest for the same reason that they originally were studied: the blood groups serve as the best and most convenient small-animal model for human blood group studies, particularly for the human Rh blood group with which the rabbit Hg blood group appears to be phylogenetically analogous. Recent studies to recreate and to refine the rabbit model of hemolytic disease of the fetus/newborn based on the Hg blood groups have been successful (Moise et al., 1992, 1994, 1995a, b) and homozygous breeding stock have been reestablished. The rabbit Hg blood group recently provided the model leading to successful isolation of human Rh D antigen in a soluble, serologically active form (Yared et aI., in press).

10.

Passive Transfer of Immunity

An excellent review of the anatomy and development of fetal membranes, uterine development and implantation structure of the placenta, yolk sac, chorion, amnion and allantois, and transmission to fetal circulation can be found in Brambell (1970).

11.


Defensins, antimicrobial and cytotoxic peptides produced by mammalian cells have been studied in rabbit models of several infectious diseases (reviewed by Leherer et al., 1993).

12.

Complement

The information available on rabbit complement is summarized in Tables VI.12.1 and VI.12.2.

244


Table V1.12.1 Complement components in the rabbit Pathway Symbol

Name

ClassiGal pathway C4 C4

C2

C2

Alternative pathway C3 C3

B

Factor B

H

Factor H

Function~characteristics


A component of the C3 and 05 convertaSe of the classical pathway. Combines with C2/Thiolester-containing structural protein. Single binding specificity (human C4B-like). Incompatibility between rabbit C4 and human C2/guinea pig C2 (von Zabern, 1988)

c~92,/~78, 727 (Dodds and Law, 1990); c~90,/~75, 732 (Takata et aL, i985)

._

Genes

Upstream sequence element (USE) for the poly A site (PCR amplification) (Moreira et aL, 1995)

Cleaves C3 and C5/serine protease. Incompatibility between rabbit C2 and human C4/guinea pig C4 (von Zabern, 1988) Attaches covalently after proteolytic activation generates metastable C3b. C3b fragment is part of C3/C5 convertase. Combines with C5/ Thiolester-containing structural protein. Half life is 29 h. Functional catabolic rate is 4.3%/h (Peake et aL, 1991) Functional catabolic rate is 2.7 _+ 0.3%/h. Synthesis rate is 1.0 _+ 0.2 mg C3/kg/h (Manthei et aL, 1984). C3c~contains the binding sites for factor H, properdin, CR2, CR3 and the factor I cleavage sites. Rabbit C3 binds human factor H, CR1, CR2, and MCP (Becherer et aL, 1990). Rabbit C3 contains Con A-binding carbohydrates in both c~-and/%chains. Rabbit C3 binds human factor H, CR1, and CR2 (Alsenz et aL, 1992). Total carbohydrate content is half that of human H. Compatibility between rabbit C3b and human B (Horstman and MQIler-Eberhard, 1985). Binds to C3b forming the precursor of the C3/C5 convertase (C3b,Bb)/Bb subunit of this complex is a serine protease. Rabbit C3b,Bb enzyme resembles the human analogue with respect to half-life, control by Factor H, and stabilization by nickel ions. Compatibility between rabbit B and human D (Horstman and MQIlerEberhard, 1985)

171 (~123,/~70) (Giclas et aL, 1981); 195 (Horstman and MQIler-Eberhard, 1985); ~116,/~72 (Peake et aL, 1991); ~115,/~72 (Komatsu et aL, 1988); ~119,/~72 (Alsenz et aL, 1992) Serum C3 concentration: 880/~g/ml (range 610-1120) (Horstman and MQIlerEberhard, 1985) Plasma C3 concentration 1.23 _+ 0.3 mg/ml (Manthei et aL, 1984)

Inactivates the C3/C5 convertase by dissociating its subunits; also a cofactor for factor I/Serine protease. Total carbohydrate content is half that of the human H (Horstman and MQIlerEberhard, 1985)

155; Serum concentration is 128/~g/ml (range 83-185) (Horstman and MQIlerEberhard, 1985)

C3c~chain cDNA 2182 bp; 726 amino acid residues. This region shares 78% similarity with the human and mouse sequences with conservation of the cysteinyl residues (Kusano et aL, 1986)

85; Serum concentration is 89 #g/ml (range 68-108) (Horstman and MQIlerEberhard, 1985)

(continued)

Mucosal Immunity

245

Table V1.12.1 Continued Pathway Symbol

Name

Alternative pathway P Properdin

Effector pathway C5 C5

Function/characteristics


Regulator (positive) that enhances activation by binding to and stabilizing the C3/C5 convertase. Structural protein. The amino terminal 36 residues have 78% homology to the equivalent region of human P (Nakano et aL, 1986)

58 (Nakano et al., 1986)

Anchoring molecule for C6/Structural protein, member of the thiolester family but lacking the thiolester.

171 (~ 129, fi 88) (Giclas et aL, 1981)

Genes

C6

C6

Anchoring molecule for C7/Structural protein.

95 (Arroyave and M011erEberhard, 1971)

C8

C8

Anchoring molecule for C9/Structural protein

175 (~-;, 114, fi 61, I' 26) (Komatsu et aL, 1985) 64 (555 amino acid residues) fi 61 (536 amino acid residues) ;, 26 (182 amino acid residues) All three subunits are strikingly similar to human with regard to length, molecular weight, N-, and C-terminal residues, conserved cysteines, and overall sequence (White et aL, 1994)

C8 ~ cDNA 2070 bp C8 fi cDNA 2052 bp C8 7 cDNA 751 bp (White et aL, 1995)

C9

C9

Forms pores in the membrane/ Structural proteins

70 (Ganzler and Hansch, 1984)

C9 cDNA 2019 bp; 597 amino acid residues; 72% identity to human C9 (H0sler et aL, 1995)

C4BP

C4binding protein

Masking of C2-binding site on C4/ Structural proteins. No complex form (unlike human C4BP)

13.

Mucosal Immunity

Transport of antigens and the function of antigen-presenting cells in mucosal tissues

Transcytosis of antigen appears to be a prerequisite for mounting an effective mucosal immune response. In rabbit gut-associated lymphoid tissue (GALT), antigen is transported from the lumen of the intestine into organized

C4BP ~ cDNA 1794 bp; 597 amino acid residues; 63% identity to human C4BP; 50% identity to mouse C4BP (de Frutos and Dahlback, 1995)

lymphoid tissue by specialized follicle associated epithelium (FAE) cells known as M (membranous or microfold) cells. M cells are characterized by several features including: a pocket on their basolateral surface within which reside lymphocytes and accessory cells, lack of poly-Ig receptors on basolateral plasma membranes, and a lack of the highly organized apical brush borders and stalked, membrane anchored, hydrolases found in absorptive enterocytes (Neutra and Kraehenbuhl, 1992). The rate of

246


Table V1.12.2 Genetic complement deficiency states and induced complement deficiency by

CVF a

in rabbits

C6 deficiency

C8 ~-y deficiency

C3 hypocomplementemia

Induced complement deficiency by CVF

Hemolytic activity (CH50) Bactericidal activity Serum C3 level Other components C3 catabolism in vivo C3 inhibitor Antibody production

Absent Absent Normal Normal --Normal Diminished

27-37% of normal Diminished 10% of normal Normal Normal Absent Normal (against BSA) Diminished

12-15 % of normal

BCG skin reaction (Delayed-type hypersensitivity) Clotting time

Absent Diminished Normal Normal Normal Absent Normal (against BSA) Enhanced

Phagocytosis Immuno adherence Production of antinuclear antibody Other characteristics Immuno clearance Active Arthus reaction Passive Arthus reaction Serum sickness nephritis Membranous nephropathy Local Shwartzman reaction Endotoxin tolerance Skin allograft rejection Growth rate Reproductive activity Survival rate Molecular basis

References

a

Diminished (prolonged) Normal Normal Normal Normal Diminished Diminished Diminished Diminished Diminished Diminished Normal Normal Normal

Hammer et al. (1981), Rother (1986)

Diminished C6 1/3-1/2 of normal

Normal m

m

m

m

Absent

Present

m

Dwarf Diminished Diminished Abnormal cotranslational processing of C8~. (A mutation in an exon-intron junction of C8~) Komatsu et aL (1985, 1990, 1991 ), Kaufman et aL (1991)

Normal 1% of normal m

m

m

m

m

m

m

m

m

Normal Normal Diminished Pretranslational defect resulting from mutations within the C3 gene Komatsu et aL (1988, 1992)

m

Cochrane et aL (1970)

CVF = cobra venom factor.

antigen uptake by M cells is partly dependent on the ability of antigens to adhere to their luminal surfaces (Pappo and Ermak, 1989). M cells express surface receptors with lectin-binding activity and for binding bacterial polysaccharides, in addition to receptors with specificity for secretory IgA (Pappo, 1989). Particulate antigens in the lumen that localize to M cell apical surfaces, are engulfed by coated and uncoated pits and are shuttled in vesicles to underlying antigen-presenting cells. Antigen is not processed while it transits across FAE because of the lack of lysosomes in M cells. M cells are responsible for the transport of more than 99% of the antigens that find their way into GALT follicles (Neutra and Kraehenbuhl, 1992) with transit rates averaging 2/2m/min. In studies using fluorescent-labeled polystyrene microspheres, uptake by rabbit Peyer's patch (PP) M cells was at least one order of

magnitude greater than that observed for murine PP, with internalization of particles within 10 min of in vivo administration. The kinetics of antigen uptake by rabbit PP M cells suggests that antigen is taken up in a synchronous wave from the lumen of the intestinal tract (Pappo and Ermak, 1989; Pappo et al., 1991). The M cell content of the FAE of rabbit GALT is approximately 50%, compared with the 10% detected in murine FAE. Rabbit M cells identified by staining with either vimentin or peanut agglutinin show localization to the periphery of the FAE, with few found at the apex of the dome (Jepson et al., 1993). Within M-cell pockets antigen-processing cells, such as monocytes or immature dendritic cells, ingest and degrade antigens transcytosed for use by Ia antigen-expressing cells. Processed antigen is then disseminated throughout

Mucosal I

m

m

u

n

i

the follicular and interfollicular regions by these cells for stimulation of the mucosal B- and T-cell immune responses.

Production and transport of mucosal Igs Following stimulation of B cells in an organized mucosal lymphoid tissue with antigen taken in from the gut lumen, the expressed heavy-chain isotype changes from IgM or IgG to IgA (Weinstein and Cebra, 1991). Most of these mucosally derived IgAs have been shown to be directed against microbial surface components, which is consistent with the role of secretory IgA in recognition and aggregation of intact microorganisms on mucosal surfaces. Following the heavy-chain isotype switch and other maturation events, B cells leave and migrate to lamina propria anywhere in the body or back to an organized GALT and secrete IgA antibody. This ability of GALT B lymphoblasts to populate mucosal sites in the conjunctiva, upper respiratory tract, bronchi, mammary glands and gastrointestinal tract is regarded as 'the common mucosal immune system'. IgA antibody is the primary isotype produced at mucosal surfaces for secretion into the gastric mucosa. B cells secreting IgA are located in the Peyer's patch and laminal propria, but may also reside within the rabbit appendix and sacculus rotundus. IgA antibody produced by mucosal plasma cells is arranged tail to tail by oligomerization via the J chain. The IgA dimer then binds to the poly-Ig receptor-containing secretory component (SC) located on the basal membrane of epithelial cells lining the gut and is transported through the cell and secreted into the mucosa. In rabbits, unlike other mammalian species, the poly-Ig SC receptor may lack domains II and III, which prevents the covalent disulfide linkage formed between SC and IgA found in other mammalian species. SC of the rabbit binds the Fc portion of the IgA dimer. By binding to the IgA dimer, SC stabilizes the antibody molecules and masks the sites for protease cleavage located in the hinge region of IgA. The effect is to make the IgA dimer particularly well suited for survival in the protease-rich mucosal environment (Kraehenbuhl and Neutra, 1992).

Species-specific aspects of the structure or function of the mucosal immune system The mucosal immune system of the lagomorph serves several different functions. As in other mammalian species, the mucosal immune system is responsible for the immune response to bacteria, viruses, protozoa, or other traumatizing agents that infect the mammal by way of the gut, respiratory, or genital tract mucosa. In both the young and adult rabbit these immune responses are mediated primarily by B and T cells that reside in organized lymphoid tissues at mucosal sites such as the Peyer's

t

y

2

4

7

patch. However, the mucosal immune system of rabbits is not limited to protective functions; it also serves as a site for the generation of the rabbit's diverse antibody repertoire. B-cell development in lagomorphs is distinct from that of other mammalian species. In species such as humans, mice and rats, combinatorial assortment of B cell antibody genes in the bone marrow contributes to antibody diversity. This random combinational assortment by joining of one of many distinct germline heavy-chain variable region (VH), diversity (DH), and joining (JH) gene segments for the heavy chain; VL and JL for the light chain has been described as the generation of a high copy-number primary antibody repertoire. While B cells in the rabbit appear to rearrange their VH and VL genes in the bone marrow, the rearrangement process uses a limited number of VH genes, with one VH gene, VHI, utilized by 80-95% of B cells with productive rearrangements (Allegrucci et al., 1990; Becker and Knight, 1990; Becker et al., 1990). This limited gene usage restricts the development of a diverse antibody repertoire with specificities for the limitless number of novel antigens found in the environment. To cope with this predicament, the rabbit has developed a system similar to that found for chicken B-cell development. In chickens, with only one rearranging VH and VL gene, upstream VH and VL pseudogenes are used as DNA donors to diversify the rearranged variable region by gene conversion (Reynaud et al., 1987, 1989, 1991). Some junctional diversity and somatic hypermutation also occur. This occurs early in life within a GALT found only in avian species known as the bursa of Fabricius. In lagomorphs, a process similar to that of the chicken begins by week 6 after birth and occurs within a GALT, the appendix. The young rabbit appendix bears a striking similarity in both gross morphological and lymphoid cellular distribution to the bursa of the chicken, while sharing few of the features associated with more conventional GALT such as PPs. Rearranged VH genes from B cells of young rabbits undergo a somatic diversification process that includes both gene conversion-like and somatic hypermutation mechanisms (Weinstein et al., 1994). It is not known whether the young rabbit appendix also plays a role in protective functions. In the chicken, diversification in the bursa is a shortterm affair and is complete within 12-15 weeks after birth, at which time the bursa begins to involute and no longer appears as an organized lymphoid tissue by adulthood (Reynolds, 1983). It has not been clearly defined what the timeline of diversification is in the rabbit. Unlike the chicken bursa, the rabbit appendix does not involute, but instead goes through morphological and cellular distribution changes that result in a GALT in the adult which looks more like a PP, while bearing little resemblance to the appendix of a young rabbit (Figure VI.2.3; P. D. Weinstein, unpublished data). The change in structure of the appendix may or may not be an indicator of changes in rabbit appendix function. These new functions may


248

include antigen-specific B-cell responses within the germinal centers, leading to production of secretory IgA B cells. Further investigation will be needed to determine whether the adult rabbit appendix continues to be involved in VH diversification. Another rabbit GALT, the sacculus rotundus appears to have some of the same functions as the rabbit appendix. Included in these functions may be the diversification of the VH gene repertoire. However, at present there is little data to support this assumption. Other GALT, including the PP are similar in structure and function to those of other species such as mice. The only differences appear to be the number of follicles found in each Peyer's patch and the number of patches found along the intestinal tract.

14.

Immunodeficiencies

Mutant strains Basilea (bas) and Alicia (ali) were both discovered by Kelus and Weiss (1977, 1986). ali-Mutant rabbits with the ali trait have a deletion encompassing the VHa allotype-encoding VH1 gene (see Section 7). In heterozygotes most B cells rearrange and express the n~ormal allele, be it al, a2 or a3. In homozygous ali/ali rabbits, B cells rearrange upstream genes, including VH4, y33, x, z and perhaps others. Some of these rearranged genes undergo further changes in sequence presumed to be via somatic gene conversion (Chen et al., 1993, 1995). In the appendix of developing mutant rabbits, selection appears to favor growth and expansion of cells bearing VH genes with sequences more similar to the deleted VHla2 gene (Pospisil et al., 1995). h a s - M u t a n t rabbits with the bas trait have a defective C~1 gene derived from the b9 allotype. The acceptor site for J~ to C~ mRNA splicing is mutated (Lamoyi and Mage, 1985). Because of this splice site defect, C~l-type light chains are not produced. The homozygous mutants produce elevated levels of the C~2 gene product as well as elevated levels of 2 type light chains. In heterozygotes the product of the normal allele is expressed in the majority of B lymphocytes. Rabbits infected with human immunodeficiency virus (HIV-1) show no signs of disease that mimics the acquired immune deficiency (AIDS) disease in humans. While HIV1 infection of rabbits has been demonstrated by the detection of viral nucleic acids and proteins from primary tissues of animals injected with the virus, there have been few reports of disease associated with infection (Kulaga et al., 1989; Reina et al., 1993). However, one study found that rabbits transfused with blood from HIV-l-infected rabbits developed a CD4 § lymphocytopenia and two rabbits in this study died as a result of lymphocyte depletion in lymph nodes and thymus (Simpson et al., 1995). The myxoma virus of the poxvirus family has a profound effect on the immune system of infected rabbits. The

production of virus-encoded proteins subvert cytokine networks by mimicking various cytokine receptors and this results in immunosuppression leading to the death of infected animals (McFadden and Graham, 1994; Mossman et al., 1996). In addition, downregulation of CD4 has been demonstrated following the in vitro infection of a rabbit CD4 + cell line with myxoma virus (Barry et al., 1995).

15.


Leukemias and lymphomas are the predominant immune system tumors found in rabbits. These tumors have been found in rabbits experimentally infected with viruses or in rabbits expressing a c-myc transgene. Except for a lymphosarcoma found in the WH strain of rabbits, spontaneous tumors of the immune system have not been reported. Table VI.15.1 outlines the occurrence of immune system tumors found in rabbits, as well as the etiology and pathology of those tumors.

16.

Autoimmune Diseases

Table VI.16.1 lists some models of autoimmune diseases in the rabbit. In the following discussion we will briefly annotate one of them. In the 1950s, using rabbits, Rose and Witebsky (Rose and Witebsky, 1956; Witebsky and Rose, 1956) succeeded in producing autoantibodies to thyroid antigens and in inducing autoimmune thyroiditis. This now classical work established convincingly that Ehrlich and Morgenroth's theoretical concept of 'autoantibodies' was a realistic one, and that the histopathology of Hashimoto's thyroiditis could be reproduced rather well in an animal model by autoimmunization. T cells in autoimmune thyroiditis have been explored in both obese strain (OS) chickens and in murine autoimmune thyroiditis. A central role for T-helper cells in autoimmunization is well established, and a role for both CD4 + and CD8 + T cells in the effector limb leading to tissue injury appears likely (Charreire, 1989; Wick et al., 1989). However, over the last two decades, humoral immunity in autoimmune thyroiditis has received rather little attention. Doubts were cast early on about a primary role of antibodies in tissue damage of autoimmune thyroiditis by the discordance of antibody titers and disease severity and by the difficulties encountered in attempts to transfer the disease by antibodies into normal recipients. Nevertheless, a few reports appeared to support a major role for autoantibodies in the pathogenesis of autoimmune thyroiditis; immune complex deposits were reported in human (Kalderon and Bogaars, 1977; Weetman et al., 1989), murine (Clagett et al., 1974; Tomazic and Rose, 1975;

Autoimmune Diseases

249

Table V1.15.1 Tumors of the immune system Target population

Pathology and effects on immune function

Tumor

Etiology

Leukemia

Experimental infection with HTLV-I. Usual route is by the IV injection of HTLV-1infected cell lines. Transmission can also occur from mother to offspring.

T cells

Infection usually results in seroconversion but the rabbits remain healthy. In certain inbred strains of rabbit, disease with an ATL like pathology is observed, with cellular infiltration of organs and elevated leukocyte counts (Seto et aL, 1987). Infection with one cell line has been found to result in acute lymphoproliferative disease (Simpson et aL, 1996)

Lymphoma

Experimental infection with herpesvirus Macaca arctoides (HVMA). The route of infection was via intramscular injection of cell-free virus.

ND

Fifty per cent of the infected animals reveal a lymphoproliferative disease classified as malignant lymphoma, lymphoblastic lymphoma or lymphoid hyperplasia. In infected animals the spleen, lung, liver, kidney and suprarenal glands are infiltrated by lymphoid cells (Wutzler et aL, 1995)

Leukemia

Transgenic rabbits expressing the c-myc gene with the immunoglobulin/~ heavy chain enhancer.

Pre-B cells

Early development of leukemia (17-20 days old). Large atypical lymphocytes of oligoclonal origin with infiltration of spleen, liver, bone marrow and kidney with peripheral blood counts of 100 000500 000/mm 3 (Knight et aL, 1988)

Lymphoma

Trangenic rabbits expressing the c-myc gene with the immunoglobulin ~: light-chain enhancer.

B cells

Tumors developed at 5-11 months old. Lymph node structure consists of tumor cell aggregates. The kidneys, gastro-intestinal tract, ovaries and tissues adjacent to lymph nodes are infiltrated by lymphoid cells (Sethupathi et al., 1994)

Lymphosarcoma

Occurred in WH strain of rabbit and exhibited an autosomal recessive pattern of inheritance. Type C retrovirus induced in lymphosarcomatous tissue (Bedigian et aL, 1978).

ND

The lymphosarcoma involves visceral lymph nodes, kidneys, spleen, liver and adrenal glands. Infiltrates of lymphoid cells are found in many organs of affected rabbits (Fox et al., 1970)

Malignant lymphoma

Induced in several strains of rabbits following innoculation of rabbits with herpesvirus saimiri via several different routes (Daniel et aL, 1974).

Tcells

The type of lymphoma found varied from poorly differentiated to well differentiated. Although the spleen, lymph nodes, liver and lungs showed marked infiltration, a diffuse infiltrate was found in most organs examined (Ablashi et aL, 1980; Faggioni et al., 1982)

Vladutiu, 1990) and avian (Wick and Graf, 1972; Katz et al., 1981; Kofler et al., 1983) thyroid lesions, and potentiating (Jaroszewski et aI., 1978) and precipitating (Katz et al., 1986) effects were ascribed to autoantibodies in OS chickens, but the pathogenicity of humoral antibody-mediated mechanisms remained uncertain. Recently, additional evidence for a significant role of autoantibodies in the pathogenesis of autoimmune thyroiditis was obtained in rabbits. In the first group of animals, the superior thyroid artery was cannulated, allowing for administration of serum containing autoanti-

bodies directly to the target organ over several days (Inoue et al., 1993a). Autoimmune thyroiditis ensued in most perfused rabbits. A broad range of histopathological lesions was observed, and many animals had rather extensive cellular infiltrates, as well as IgG and C3 deposits in the follicular laminae. These results suggest that the earlier failures of transfer experiments may be explained by dilution and loss of antibodies because of a systemic administration. A second series of experiments explored the role of the late complement components in the pathogenesis of auto-

250


Table V1.16.1 Selected rabbit models of autoimmune diseases Animal model

Reference

Experimental autoimmune thyroiditis Antiglomerular basement membrane nephritis/membranous glomerulonephritis Membranous glomerulonephritis Interstitial nephritis Mercuric chloride-induced nephritis Mercuric chloride-induced systemic immune complex disease Experimental autoallergic encephalitis Galactocerebroside-induced neuritis Autoimmune hepatitis Postvasectomy autoimmune orchitis

Rose and Witebsky (1956) Lerner and Dixon (1966) Shibata et al. (1972) Klassen et al. (1971 ) Roman-Franco et al. (1976, 1978) Albini and Andres (1983) Waksman (1959) Saida (1981 ) Dienes (1995) Bigazzi et al. (1976)

immune thyroiditis (Inoue et al., 1993b). Very little was known about complement in autoimmune thyroiditis; most intriguing was a report on decreases in serum complement concentrations in Lewis rats immunized with thyroid antigens. Thus, it appeared useful to explore the ability of complement C6-deficient rabbits to develop experimental autoimmune thyroiditis. Rabbits were immunized with a crude thyroid extract of rabbit thyroids to encompass as many autoantigens as possible. Normocomplementemic and C6-deficient rabbits had the same titers of thyroid antibodies and immune deposits in the follicular laminae, but the former had much more extensive cellular infiltrates of thyroids than the latter. Intraperitoneal administration of serum from normocomplementemic rabbits into C6-deficient animals restored substantially their ability to develop extensive cellular infiltrates in their thyroids. The terminal complement components appear to influence significantly the severity of autoimmune thyroiditis in rabbits. Conversely, a 'residual' thyroiditis occurred in C6-deficient animals, suggesting the cooperation of at least two distinct effector mechanisms in tissue lesions of experimental autoimmune thyroiditis. Indirectly, the requirement for terminal complement components demonstrates also the requirement for antibodies in the development of full-blown autoimmune thyroiditis of the rabbit. Ultimately, studies on autoimmune diseases initiated by Rose and Witebsky led to the formulation of the Witebsky postulates, which still are the 'golden rule' in research on autoimmunity.

17.

Conclusions

Although the rabbit is used less frequently in studies of cellular immunology than in the past, there continues to be active research into the organization, regulated expression and diversification of the immune repertoire in the rabbit. Recent studies have renewed interest in the important role that gut-associated lymphoid tissue (GALT) plays in

development of the immune system and antibody repertoire in rabbit (Weinstein et al., 1994a, b). The mechanism of gene conversion-like alterations of VH gene sequences has yet to be described in detail. Such studies of the rabbit have also renewed interest in the extent to which the GALT plays a role in early development of the human immune system. Although the rabbit has been used extensively in studies of leukocyte traffic (see Section 4), relatively little is known about lymphocytes compared with neutrophils. The circulation and recirculation patterns of rabbit B and T lymphocytes have not been delineated in any detail. Recent evidence supports the hypothesis that self-renewal of B lymphocytes makes an important contribution to the B-lymphocyte compartment of adult rabbits as there is very little continuous B-lymphopoiesis (Crane et al., 1996). Because of the demonstrated role of GALT in repertoire development, it will be important in the future to identify the rabbit equivalent of 'post bursal stem cells'. Very little specific information and few clones of the rabbit cytokines are currently available. Neonatal immune responses have not been examined in light of modern understanding of B and T lymphocyte development. There is also relatively little specific information about nonspecific immunity and NK cells of the rabbit.

Model for d i s e a s e - r e l a t e d research

There are numerous rabbit models for diseases. Among those with immunological relevance are: various infectious diseases including syphilis (Sell and Hsu, 1993), tuberculosis (Dannenberg, 1991), virus-induced papilloma, myxoma virus, HTLV1 and HIV (see sections 14 and 15). NZW rabbits infected with rabbit papilloma virus are models for a virus-MHC connection in malignant conversion (Hart et al., 1992). A rabbit model of human hemolytic disease of the newborn was described in section 9. Complement deficiencies are described in section 12 and autoimmune diseases in Section 16.

References

48.

References

Ablashi, D., Sundar, K., Armstrong, G., Golway, P., Valerio, M., Bengali, Z., Lemp, J., Fox, R. (1980). Herpesvirus saimiriinduced malignant lymphoma in inbred strain III/J rabbits (Oryctolagus cuniculus). J. Cancer Res. Clin. Oncol. 98, 165172. Acha-Orbea, H., McDevitt, H. O. (1987). The first external domain of the nonobese diabetic mouse class II I-Aft chain is unique. Proc. Natl Acad. Sci. USA 84, 2435-2439. Akimenko, M. A., Heidmann, O., Rougeon, F. (1984). Complex allotypes of the rabbit immunoglobulin kappa light chains are encoded by structural alleles. NucI. Acids Res. 12, 4691-4701. Akimenko, M. A., Mariame, B., Rougeon, F. (1986). Evolution of the immunoglobulin kappa light chain locus in the rabbit: evidence for differential gene conversion events. Proc. Natl Acad. Sci. USA 83, 5180-5183. Albini, B., Andres, G. (1983). Autoimmune disease induced in rabbits by administration of mercuric chloride. In Immune Mechanisms in Renal Disease (eds Cummings, N. B., Michael, A. F., Wilson, C. B.), pp. 249-260. Plenum, New York. Allegrucci, M., Newman, B. A., Young-Cooper, G. O., Alexander, C. B., Meier, D., Kelus, A. S., Mage, R. G. (1990). Altered phenotypic expression of immunoglobulin heavy-chain variable-region (VH) genes in Alicia rabbits probably reflects a small deletion in the VH genes closest to the joining region. Proc. Natl Acad. Sci. USA 87, 5444-5448. Allegrucci, M., Young-Cooper, G. O., Alexander, C. B., Newman, B. A., Mage, R. G. (1991). Preferential rearrangement in normal rabbits of the 3' VHa allotype gene that is deleted in Alicia mutants: somatic hypermutation/conversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences. Eur. J. Immunol. 21,411-417. Alsenz, J., Avila, D., Huemer, H. P., Esparza, I., Becherer, J. D., Kinoshita, T., Wang, Y., Oppermann, S., Lambris, J. D. (1992). Phylogeny of the third component of complement, C3: analysis of the conservation of human CRI, CR2, H, and B binding sites, concanavalin A binding sites, and thiolester bond in the C3 from different species. Dev. Comp. Immunol. 16, 63-76. Angiolillo, A. L., Lamoyi, E., Bernstein, K. E., Mage, R. G. (1985). Identification of genes for the constant region of rabbit T-cell receptor fi chains. Proc. Natl Acad. Sci. USA 82, 44984502. Apple, R. J., Erlich, H. A., Klitz, W., Manos, M. M., Becker, T. M., Wheeler, C. M. (1994). HLA DR-DQ Associations with cervical carcinoma show papillomavirus-type specificity. Nature Genet. 6, 157-162. Arfors, K. E., Lundberg, C., Lindbom, L., Lundberg, K., Beatty, P. G., Harlan, J. M. (1987). A monoclonal antibody to the membrane glycoprotein complex CD18 inhibits polymorphonuclear leukocyte accumulation and plasma leakage in vivo. Blood 69, 338-340. Argenbright, L. W., Letts, L. G., Rothlein, R. (1991). Monoclonal antibodies to the leukocyte membrane CD18 glycoprotein complex and to intercellular adhesion molecule-1 inhibit leukocyte-endothelial adhesion in rabbits. J. Leukocyte Biol. 49, 253-257. Arroyave, C. M., M~iller-Eberhard, H. J. (1971). Isolation of the

251

sixth component of complement from human serum. Immunochemistry 8,995-1006. Barry, M., Lee, S., Boshkov, L., McFadden, G. (1995). Myxoma virus induces extensive CD4 downregulation and dissociation of p56 ick in infected rabbit CD4 + T lymphocytes. J. Virol. 69, 5243-5251. Becherer, J. D., Alsenz, J., Lambris, J. D. (1990). Molecular aspect of C3 interactions and structural/functional analysis of C3 from different species. Curr. Top. Microbiol. Immunol. 153, 45-72. Becker, R. S., Knight, K. L. (1990). Somatic diversification of immunoglobulin heavy chain VDJ genes: evidence for somatic gene conversion in rabbit. Cell 63,987-997. Becker, R. S., Suter, M., Knight, K. L. (1990). Restricted utilization of Vn and CH genes in leukemic rabbit B cells. Eur. J. Immunol. 20, 397-402. Bedigian, H., Fox, R., Meier, H. (1978). Induction of type C RNA virus from cultured rabbit lymphosarcoma cells. J. Virol. 27, 313-319. Befus, A. D., Bienenstock, J. (1982). The mucosa-associated immune system of the rabbit. In Animal Models of Immunological Processes, pp. 167-220. Academic Press, New York, USA. Benammar, A., Cazenave, P. A. (1982). A second kappa isotype. J. Exp. Med. 156, 585-589. Bernstein, K. E., Alexander, C. B., Mage, R. G. (1983a). Nucleotide sequence of a rabbit IgG heavy chain from the recombinant F-I haplotype. Immunogenetics 18,387-397. Bernstein, K. E., Skurla, R. M., Mage, R. G. (1983b). The sequences of rabbit tc light chains of b4 and b5 allotypes differ more in their constant regions than in their 3' untranslated regions. Nucl. Acids Res. 11, 7205-7214. Bernstein, K. E., Alexander, C. B., Reddy, E. P., Mage, R. G. (1984a). Complete sequence of a cloned cDNA encoding rabbit secreted/2 chain of VHa2 allotype: comparisons with Vnal and membrane bt sequences. J. Immunol. 132,490-495. Bernstein, K. E., Lamoyi, E., McCartney-Francis, N., Mage, R. G. (1984b). Sequence of a cDNA encoding Basilea kappa light chains (K2 isotype) suggests a possible relationship of protein structure to limited expression. J. Exp. Mecl. 159, 635-640. Betz, S. J., Lotner, Z., Henson, P. M. (1980). Generation and release of platelet-activating factor (PAF) from enriched preparations of rabbit basophils; failure of human basophils to release PAF. J. ImmunoI. 125, 2749-2755. Bigazzi, P. E., Kosuda, L. L., Hsu, K. C., Andres, G. A. (1976). Immune complex orchitis in vasectomized rabbits. J. Exp. Med. 143,382-404. Blackford, J., Wilkinson, J. M. (1993). A monoclonal antibody which recognises rabbit CD 1la and which inhibits homotypic T cell aggregation. Biochem. Soc. Trans. 21,198S. Blackford, J., Reid, H. W., Pappin, D. J. C., Bowers, F. S., Wilkinson, J. M. (1996). A monoclonal antibody, 3/22, to rabbit CDllc which induces homotypic T cell aggregation: evidence that ICAM-1 is a ligand for CDllc/CD18. Eur. J. Immunol. 26, 525-531. Boyer, M. I., Bowen, C. V. A., Danska, J. S. (1995). Restriction fragment-length polymorphism analysis of the major histocompatibility complex in New Zealand White rabbits. Transplantation 59, 1043-1046. Brambell, F. W. R. (1970). The transmission of passive immunity from mother to young. In Frontiers of Biology, Vol. 18 (eds

252

Neuberger, A., Tatum, E. L., Holborow, E. J.), pp. 42-79. North Holland Publishing Co., London, UK. Burnett, R. C., Hanly, W. C., Zhai, S. K., Knight, K. L. (1989). The IgA heavy-chain gene family in rabbit: cloning and sequence analysis of 13 C0~ genes. EMBO J. 8, 4041-4047. Butcher, E. C., Picker, L. J. (1996). Lymphocyte homing and homeostasis. Science 272, 60-66. Calabi, F., Belt, K. T., Yu, C. Y., Bradbury, A., Mandy, W. J., Milstein, C. (1989). The rabbit CD1 and the evolutionary conservation of the CD1 gene family. Immunogenetics 30, 370-377. Calderon, T. M., Factor, S. M., Hatcher, V. B., Berliner, J. A., Berman, J. W. (1994). An endothelial cell adhesion protein for monocytes recognized by monoclonal antibody IG9: expression of in vivo inflamed human vessels and atherosclerotic human and Watanabe rabbit vessels. Lab. Invest. 70, 836-849. Cannon, J. G., Clark, B. D., Wingfield, P., Schmeissner, U., Losberger, C., Dinarello, C. A., Shaw, A. R. (1989). Rabbit IL-I: cloning, expression, biologic properties, and transcription during endotoxemia. J. Immunol. 142, 2299-2306. Carlos, T. M., Harlan, J. M. (1994). Leukocyte-endothelial adhesion molecules. Blood 84, 2068-2101. Castle, W. E., Keeler, C. D. (1933). Blood group inheritance in the rabbit. Proc. Natl Acad. Sci. USA 19, 92-98. Chai, C. K. (1974). Genetics studies of histocompatibility in rabbits: identification of major and minor genes. Immunogenetics 1,126-132. Charreire, J. (1989). Immune mechanisms in autoimmune thyroiditis. Adv. Immunol. 46, 263-334. Chen, H., Alexander, C., Young-Cooper, G., Mage, R. (1993). VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression. J. Immunol. 150, 2783-2793. Chen, H., Alexander, C., Mage, R. (1995). Characterization of a rabbit germline VH gene that is a candidate donor for VH gene conversion in mutant Alicia rabbits. J. Immunol. 154, 6365-6371. Chen, Z., Metzger, D. W., Adler, F. L. (1984). Characterization of a monoclonal antibody reactive with rabbit T lymphocytes and neutrophils. Cell. Immunol. 85,297-308. Chouchane, L., Kindt, T. J. (1992). Mapping of the rabbit MHC reveals that class I genes are adjacent to the DR subregion and defines an insertion/deletion-related polymorphism in the class II region. J. Immunol. 149, 1216-1222. Chouchane, L., Brown, T. J., Kindt, T. J. (1993). Structure and expression of a nonpolymorphic rabbit class II gene with homology to HLA-DOB. Immunogenetics 38, 64-66. Clagett, J. A., Wilson, C. B., Weigle, W. O. (1974). Interstitial immune complex thyroiditis in mice: the role of autoantibody to thyroglobulin. J. Exp. Med. 140, 1349-1456. Clark, B. D., Bedrosian, I., Schindler, R., Cominelli, F., Cannon, J. G., Shaw, A. R., Dinarello, C. A. (1991). Detection of interleukin 10~ and 1/3 in rabbit tissues during endotoxemia using sensitive radioimmunoassays. J. Appl. Physiol. 71, 2412-2418. Cochrane, C. G., MOller-Eberhard, H. J., Aikin, B. S. (1970). Depletion of plasma complement in vivo by a protein of cobra venom: its effect on various immunologic reactions. J. Immunol. 105, 55-69. Cohen, C. (1982). The immunogenetics of cellular antigen systems of the rabbit. In Oral Immunogenetics and Tissue Transplantation (eds Riviere, G. R., Hildemann, W. H.), pp.


181-197. Elsevier North Holland, Inc., Amsterdam, The Netherlands. Cohen, C., Tissot, R. G. (1974). The effect of the RL-A locus and the MLC locus on graft survival in the rabbit. Transplantation, 18, 150-154. Cooper, M. D., Perey, D. Y., Gabrielsen, A. E., Sutherland, D. E. R., McKneally, M. F., Good, R. A. (1968). Production of an antibody deficiency syndrome in rabbits by neonatal removal of organized intestinal lymphoid tissues. Int. Arch. Allergy 33, 65-88. Crabb, E. D., Kelsall, M. A. (1940). Organization of the mucosa and lymphatic structures in the rabbit appendix. J. Morphology 67, 351-367. Craig, S. W., Cebra, J. J. (1971). Peyer's patches: an enriched source of precursors for IgA producing immunocytes in the rabbit. J. Exp. Med. 134, 188-200. Crane, M. A., Kingzette, M., Knight, K. L. (1996). Evidence for limited B-lymphopoiesis in adult rabbits. J. Exp. Med. 183, 2119-2127. Currier, S. J., Gallarda, J. L., Knight, K. L. (1988). Partial molecular genetic map of the rabbit VH chromosomal region. J. Immunol. 140, 1651-1659. Daniel, M., Melendez, L., Hunt, R., King, N., Anver, M., Barahona, H., Baggs, R. (1974). Herpesvirus saimiri: VII. Induction of malignant lymphoma in New Zealand white rabbits. J. Natl Cancer Inst. 53, 1803-1807. Dannenberg, A. M., Jr (1991). Delayed-type hypersensitivity and cell-mediated immunity in the pathogenesis of tuberculosis. Immunol. Today 12, 228-233. Davie, J. M., Paul, W. E., Mage, R. G., Goldman, M. B. (1971). Membrane-associated immunoglobulin of rabbit peripheral blood lymphocytes: allelic exclusion at the b locus. Proc. Natl Acad. Sci. 68,430-434. de Frutos, P. G., Dahlbaeck, B. (1995). cDNA structure of rabbit C4b-binding protein alpha-chain. Preserved sequence motif in complement regulatory protein modules which bind C4b. Biochem. Biophys. Acta 1261, 285-289. De Smet, W., Vaeck, M., Smet, E., Brys, L., Hamers, R. (1983). Rabbit leukocyte surface antigens defined by monoclonal antibodies. Eur. J. Immunol. 13,919-928. Dienes, H. P. (1995). Autoimmune hepatitis. Verh. Deutsch GesPathol. 79, 177-185. Dodds, A. W., Law, S. K. (1990). The complement component C4 of mammals. Biochemical J. 265,495-502. Doerschuk, C. M., Winn, R. K., Coxson, H. O., Harlan, J. M. (1990). CD18-dependent and -independent mechanisms of neutrophil emigration in the pulmonary and systemic microcirculation of rabbits. J. Immunol. 144, 2327-2333. Drake, W. T., Issekutz, A. C. (1993). Transforming growth factor-beta enhances polymorphonuclear leucocyte accumulation in dermal inflammation and transendothelial migration by a priming action. Immunology 78, 197-204. Dreher, K. L., Emorine, L., Kindt, T. J., Max, E. E. (1983). cDNA clone encoding a complete rabbit immunoglobulin kappa light chain of b4 allotype. Proc. Natl Acad. Sci. USA 80, 4489-4493. Dreher, K. L., Asundi, V., Wolf, B., Bruggeman, L. (1990). Rabbit Ig kappa 1b6 gene structure. J. Immunol. 145,325-330. Dubiski, S. (ed.). (1987). The Rabbit in Contemporary Immunological Research. Longman Scientific and Technical, Harlow, England. Duvoisin, R. M., Kocher, H. P., Garcia, I., Rougeon, F., Jaton,

References

j. c. (1984). Nucleotide sequence of a cDNA encoding the constant region of a rabbit immunoglobulin light chain of the lambda type. Eur. J. Immunol. 14, 379-382. Duvoisin, R. M., Heidmann, O., Jaton, J. C. (1986). Characterization of four constant region genes of rabbit immunoglobulin-lambda chains. J. Immunol. 136, 4297-4302. Emorine, L., Max, E. E. (1983). Structural analysis of a rabbit kappa 2 J-C locus reveals multiple deletions. Nucl. Acids Res. 11, 8877-8890. Emorine, L., Dreher, K., Kindt, T. J., Max, E. E. (1983). Rabbit immunoglobulin kappa genes: structure of a germline b4 allotype J-C locus and evidence for several b4-related sequences in the rabbit genome. Proc. Natl Acad. Sci. USA 80, 5709-5713. Emorine, L., Sogn, J. A.,Trinh, D., Kindt, T. J., Max, E. E. (1984). A genomic gene encoding the b5 rabbit immunoglobulin kappa constant region: implications for latent allotype phenomenon. Proc. Natl Acad. Sci. USA 81, 1789-1793. Eskinazi, D. P., Bessinger, B. A., McNicholas, J. M., Leary, A. L., Knight, K. L. (1979). Expression of an unidentified immunoglobulin isotype on rabbit Ig-bearing lymphocytes. J. Immunol. 122, 469-474. Estess, P., Begovich, A. B., Koo, M., Jones, P., McDevitt, H. O. (1986). Sequence analysis and structure-function correlations of murine q, k, u, s, and f haplotype I-Aft cDNA clones. Proc. Natl Acad. Sci. USA 83, 3594-3598. Esworthy, S., Max, E. E. (1986). The rabbit kappa-lb5 immunoglobulin gene: another J region gene cluster with only one functional J gene segment? J. Immunol. 136, 1107-1111. Faggioni, A., Ablashi, D., Armstrong, G., Sundar, S., Loeb, W., Martin, D., Valerio, M., Parker, G., Fox, R. (1982). Herpesvirus saimiri induced malignant lymphoma of the poorly and well differentiated types in three inbred strains of New Zealand white rabbits. In: Advances in Comparative Leukemia Research 1981 (eds Yohn, D. S., Blakeslee, J. R.). Elsevier, North Holland. Fitts, M. G., Metzger, D. W., Hendershot, L. M., Mage, R. G. (1995). The rabbit B cell receptor is noncovalently associated with unique heterotrimeric protein complexes: possible insights into the membrane IgM/IgD coexpression paradox. Mol. Immunol. 32, 753-759. Folkesson, H. G., Matthay, M. A., Hebert, C. A., Broaddus, V. C. (1995). Acid aspiration-induced lung injury in rabbits is mediated by interleukin-8-dependent mechanisms. J. CIin. Invest. 96, 107-116. Fox, R., Meier, H., Crary, D., Myers, D. O., Norberg, R., Laird, C. (1970). Lymphosarcoma in the rabbit: genetics and pathology. J. Natl Cancer Inst. 45,719-729. Fujiwara, S., Armstrong, R. M., Cinader, B. (1974). Age and organ dependent variations in the number of thymus derived RTLA bearing cells. Immun. Commun. 3,275-284. Galea-Lauri, J., Blackford, J., Wilkinson, J. M. (1993a). The expression of CD11/CD18 molecules on rabbit leucocytes: identification of monoclonal antibodies to CD18 and their effect on cellular adhesion processes. Molec. Immunol. 30, 529-537. Galea-Lauri, J., Wilkinson, J. M., Evans, C. H. (1993b). Characterization of monoclonal antibodies against rabbit CD44: evidence of a role for CD44 in modulating synoviocyte metabolism. Molec. Immunol. 30, 1383-1392. Gallarda, J. L., Gleason, K. S., Knight, K. L. (1985). Organization

253

of rabbit immunoglobulin genes. I. Structure and multiplicity of germ-line VH genes. J. Immunol. 135, 4222-4228. Ganzler, F., Hansch, G. M. (1984). Isolation of functionally active complement components from rabbit serum: purification and characterization of rabbit C9. Immunobiol. 168, 99. Garcia, N., Mileski, W. J., Lipsky, P. (1995). Differential effects of monoclonal antibody blockade of adhesion molecules on in vivo susceptibility to soft tissue infection. Infect. Immun. 63, 3816-3819. Gathings, W. E., Mage, R. G., Cooper, M. D., Lawton, A. R., Young-Cooper, G. O. (1981). Immunofluorescent studies on the expression of VHa allotypes by pre-B and B cells of homozygous and heterozygous rabbits. Eur. J. Immunol. 11, 200-206. Gathings, W. E., Mage, R. G., Cooper, M. D., Young-Cooper, G. O. (1982). A subpopulation of small pre-B cells in rabbit bone marrow expresses light chains and exhibits allelic exclusion of b locus allotypes. Eur. J. Immunol. 12, 76-81. Giclas, P. C., Keeling, P. J., Henson, P. M. (1981). Isolation and characterization of the third and fifth components of rabbit complement. Mol. ImmunoI. 18,113-123. Gilman-Sachs, A., Dray, S. (1985). Allotypic and isotypic specificities of rabbit IgM; localization to Fabll or Fc/z fragments. Molec. Immunol. 22, 57-65. Gilman-Sachs, A., Mage, R. G., Young, G. O., Alexander, C., Dray, S. (1969). Identification and genetic control of two rabbit immtlnoglobulin allotypes at a second light chain locus, the c locus. J. Immunol. 103, 1159-1167. Granert, C., Raud, J., Xie, X., Lindquist, L., Lindbom, L. (1994). Inhibition of leukocyte rolling with polysaccharide fucoidin prevents pleocytosis in experimental meningitis in the rabbit. J. Clin. Invest. 93,929-936. Graur, D., Duret, L., Gouy, M. (1996). Phylogenetic position of the order Lagomorpha (rabbits, hares and allies). Nature 379, 333-335. Gregoire, L., Lawrence, W. D., Kukuruga, D., Eisenbrey, A. B., Lancaster, W. D. (1994). Association between HLA-DQB1 alleles and risk for cervical cancer in African-American women. Int. J. Cancer 15,504-507. Haber, E. (1970). Antibodies of restricted heterogeneity for structural study. Fed. Proc. 29, 66-71. Hagari, Y., Budgeon, L. R., Pickel, M. D., Kreider, J. W. (1995). Association of tumor necrosis-alpha gene expression and apoptotic cell death with regression of Shope papillomas. J. Invest. Dermatol. 104, 526-529. Hague, B. F., Sawasdikosol, S., Brown, T. J., Lee, K., Recker, D. P., Kindt, T. J. (1992). CD4 and its role in infection of rabbit cell lines by human immunodeficiency virus type 1. Proc. Natl Acad. Sci. USA 89, 7963-7967. Hammer, C. H., Gaither, T., Frank, M. M. (1981). Complement deficiencies of laboratory animals. In Immunologic Defects in Laboratory Animals 2 (eds Gershwin, M. E., Merchant, B.), pp. 207-240. Plenum Press, New York. Han, R., Breitburd, B., Marche, P. N., Orth, G. (1992). Linkage of regression and malignant conversion of rabbit viral papillomas to MHC class II genes. Nature 356, 66-68. Hardy, R. R., Carmack, C. E., Shinton, S. A., Kemp, J. D., Hayaka, K. (1991). Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173, 1213-1225. Harindranath, N., Lamoyi, E., Mage, R. G. (1989a). Allotypes of

254

the constant region of the rabbit T cell receptor fl-2 chain. J. Immunol. 142, 3292-3297. Harindranath, N., Lamoyi, E., Mage, R. G. (1989b). Genomic sequence and organization of rabbit Tcrb constant region genes. Immunogenetics 30, 465-474. Harindranath, N., Alexander, C. B., Mage, R. G. (1991). Evolutionarily conserved organization and sequences of germline diversity and joining regions of the rabbit T-cell receptor f12 chain. Molec. Immunol. 28, 881-888. Harlan, J. M., Winn, R. K., Vedder, N. B., Doerschuk, C. M., Rice, C. L. (1992). In vivo models of leukocyte adherence to endothelium. In Adhesion: Its Role in Inflammatory Disease (eds Harlan, J. M., Liu, D. Y.), pp. 117-150. Freeman, New York, USA. Hayward, A. R., Simons, M. A., Lawton, A. R., Mage, R. G., Cooper, M. D. (1978). Pre-B and B cells in rabbits: ontogeny and allelic exclusion of kappa light chain genes. J. Exp. Med. 148, 1367-1377. Hayzer, D. J., Jaton, J. C. (1987). Nucleotide sequence of a cDNA clone encoding a rabbit immunoglobulin lambda light chain: the V lambda region differs markedly from that of other species. J. Immunol. 138, 2316-2322. Hayzer, D. J., Jaton, J. C. (1989). Cloning and sequencing of two functional rabbit germline immunoglobulin V-lambda genes. Gene 80, 185-191. Hayzer, D. J., Duvoisin, R. M., Jaton, J. C. (1987). cDNA clones encoding rabbit immunoglobulin lambda chains. Evidence for length variation of the third hypervariable region and for a novel constant region. Biochem. J. 245,691-697. Hayzer, D. J., Young-Cooper, G. O., Mage, R. G., Jaton, J. C. (1990). cDNA clones encoding immunoglobulin lambda chains from rabbit expressing the phenotype c7. Eur. J. Immunol. 20, 2707-2712. Hechtman, D. H., Cybulsky, M. I., Fuchs, H. J., Baker, J. B., Gimbrone, M. A. (1991). Intravascular IL-8: inhibitor of polymorphonuclear leukocyte accumulation at sites of acute inflammation. J. Immunol. 147, 883-892. Heidmann, O., Rougeon, F. (1983a). Diversity in the rabbit kappa variable regions is amplified by nucleotide deletions and insertions at the V-J junction. Cell 34, 767-777. Heidmann, O., Rougeon, F. (1983b). Multiplicity of constant kappa light chain genes in the rabbit genome: a b4b4 homozygous rabbit contains a kappa-bas gene. EMBO J. 2, 437441. Heidmann, O., Rougeon, F. (1984). Immunoglobulin kappa light-chain diversity in rabbit is based on the 3' length heterogeneity of germ-line variable genes. Nature 311, 74-76. Heidmann, O., Auffray, C., Cazenave, P.-A., Rougeon, F. (1981). Nucleotide sequence of constant and 3' untranslated regions of a kappa immunoglobulin light chain mRNA of a homozygous b4 rabbit. Proc. Natl Acad. Sci. USA 78, 5802-5806. Helland, A., Borresen, A. L., Kaern, J., Ronningen, K. S., Thorsby, E. (1992). HLA antigens and cervical carcinoma (correspondence). Nature 356, 23. Hellewell, P. G., Young, S. K., Henson, P. M., Worthen, G. S. (1994). Disparate role of the b2-integrin CD18 in the local accumulation of neutrophils in pulmonary and cutaneous inflammation in the rabbit. Am. J. Respir. Cell Mol. Biol. 10, 391-398. Hogg, J. C., Doershuck, C. M. (1995). Leukocyte traffic in the lung. Annu. Rev. Physiol. 57, 97-114. Hole, N. J. K., Lamoyi, E., Komatsu, M., Harindranath, N.,


Young-Cooper, G. O., Mage, R. G. (1988). Linked genetic markers of the rabbit ~clight chain are not linked to the Tcrfl chain genes. Immunogenetics 28, 99-107. Hole, N. J., Young-Cooper, G. O., Mage, R. G. (1991). Mapping of the duplicated rabbit immunoglobulin kappa light chain locus. Eur. J. Immunol. 21,403-409. Hornby, E. J., Brown, S., Wilkinson, J. M., Mattock, C., Authi, K. S. (1991). Activation of human platelets by exposure to a monoclonal antibody. PM6/248, to glycoprotein lib-Ilia. Br. J. Haematol. 79, 277-285. Horng, W. J., Gilman-Sachs, A., Dray, S. (1980). In vivo immunoglobulin allotype suppression in the rabbit. In Regulation of Function of Lymphocytes by Antibodies (eds Bona, C., Cazenave, P. A.), pp. 139-155. Wiley, New York, USA. Horstmann, R. D., Mtiller-Eberhard, H. J. (1985). Isolation of rabbit C3, factor B, and factor H and comparison of their properties with those of the human analog. J. Immunol. 134, 1094-1100. Htisler, T., Lockert, D. H., Kaufman, K. M., Sodetz, J. M., Sims, P. J. (1995). Chimeras of human complement C9 reveal the site recognized by complement regulatory protein CD59. J. Biol. Chem. 270, 3483-3486. Inoue, K., Nielsen, N., Milgrom, F., Albini, B. (1993a). Transfer of experimental autoimmune thyroiditis by in situ perfusion of thyroids with immune sera. Clin. Immunol. Immunopathol. 66, 11-17. Inoue, K., Nielsen, N., Biesecker, G., Milgrom, F., Albini, B. (1993b). Role of late complement components in experimental autoimmune thyroiditis. Clin. Immunol. Immunopathol. 66, 1-10. Isono, T., Seto, A. (1995). Cloning and sequencing of the rabbit gene encoding T-cell costimulatory molecules. Immunogenetics 42, 217-220. Isono, T., Isegawa, Y., Seto, A. (1994). Sequence and diversity of variable gene segments coding for rabbit T-cell receptor beta chains. Immunogenetics 39, 243-248. Isono, T., Kim, C. J., Seto, A. (1995). Sequence and diversity of rabbit T-cell gamma chain genes. Immunogenetics 41, 295300. Jackson, S., Chused, T. M., Wilkinson, J. M., Leiserson, W. M., Kindt, T. J. (1983). Differentiation antigens identify subpopulations of rabbit T and B lymphocytes: definition by flow cytometry. J. Exp. Med. 157, 34-46. Jaroszewski, J., Sundick, R. S., Rose, N. R. (1978). Effects of antiserum containing thyroglobulin antibody on the chicken thyroid gland. Clin. Immunol. Immunopathol. 10, 95-103. Jepson, M. A., Simmons, N. L., Hirst, G. L., Hirst, B. H. (1993). Identification of M cells and their distribution in rabbit intestinal Peyer's patches and appendix. Cell Tissue Res. 273, 127-136. Johnson, M. C., Kajikawa, O., Goodman, R. B., Wong, V. A., Mongovin, S. M., Wong, W. B., Fox-Dewhurst, R., Martin, T. R. (1996). Molecular expression of the ~-chemokine rabbit GRO in Escherichia coli and characterization of its production by lung cells in vitro and in vivo. J. Biol. Chem. 271, 10853-10858. Jones, M., Cordell, J. L., Beyers, A. D., Tse, A. G. D., Mason, D. Y. (1993). Detection of T and B cells in many animal species using cross-reactive anti-peptide antibodies. J. Immunol. 150, 5429-5435. Kajikawa, O., Goodman, R. B., Mongovin, S. M., Wong, V. A., Martin, T. R. (1993). Am. Rev. Respir. Dis. 147, A751.

References

Kalderon, A. E., Bogaars, H. A. (1977). Immune complex deposits in Graves' disease and Hashimoto's thyroiditis. Am. J. Med. 63,729-734. Katz, D. V., Kite, J. H. Jr, Albini, B. (1981). Immune complexes in tissues of Obese strain (OS) chickens. J. ImmunoI. 126, 2296-2301. Katz, D. V., Albini, B., Kite, J. H. Jr (1986). Maternoembryonally transferred antibodies precipitate autoimmune thyroiditis in Obese strain (OS) chickens. J. Immunol. 137, 542-545. Kaufman, K. M., Letson, C. S., Komatsu, M., Sodetz, J. M. (1991). Molecular basis of C8~-7 deficiency in the rabbit: identification of an abnormal leader sequence in the C8~ subunit. Complement and Inflamm. 8, 171-172. Kelly, R. H., Wolstencroft, R. A., Dumonde, D. C., Balfour, B. M. (1972). Role of lymphocyte activation products (LAP) in cell-mediated immunity. II. Effects of lymphocyte activation products on lymph node architecture and evidence for peripheral release of LAP following antigenic stimulation. Clin. Exp. Immunol. 10, 49-65. Kelus, A. S., Steinberg, C. M. (1991). Is there a high rate of mitotic recombination between the loci encoding immunoglobulin VH and CH regions in gonial cells? Immunogenetics 33,255-259. Kelus, A. S., Weiss, S. (1977). Variant strain of rabbits lacking immunoglobulin /r polypeptide chain. Nature 265, 156158. Kelus, A. S., Weiss, S. (1986). Mutation affecting the expression of immunoglobulin variable regions in the rabbit. Proc. Natl Acad. Sci. USA 83, 4883-4886. Kim, C. J., Isono, T., Tomoyoshi, T., Seto, A. (1994). Expression of T-cell receptor gamma/delta chain genes in a rabbit killer T-cell line. Immunogenetics 39, 418-422. Kim, C. J., Isono, T., Tomoyoshi, T., Seto, A. (1995). Variableregion sequences for T-cell receptor-7 and -6 chains of rabbit killer cell lines against Shope carcinoma cells. Cancer Lett. 89, 37-44. Kim, J. A., Territo, M. C., Wayner, E., Carlos, T. M., Parhami, F., Smith, C. W., Haberland, M. E., Fogelman, A. M., Berliner, J. A. (1994). Partial characterization of leukocyte binding molecules on endothelial cells induced by minimally oxidized LDL. Arterioscler. Thromb. 14, 427-433. Kimball, E. S., Coligan, J. E., Kindt, T. J. (1979). Structural characterization of antigens encoded by rabbit RLA-11 histocompatibility genes. Immunogenetics 8,201-211. Kindt, T. J., Todd, C. W. (1970). Homocytotropic antibody in primary responder and hyperimmune rabbits. J. Immunol. 104, 1491-1496. Kindt, T. J., Singer, D. S. (1987). Class I major histocompatibility complex genes in vertebrate species: what is the common denominator? Immunol. Res. 6, 57-66. Klassen, J., McCluskey, R. T., Milgrom, F. (1971). Nonglomerular renal disease produced in rabbits by immunization with homologous kidney. Am. J. Pathol. 63,333-358. Klein, J., Satta, Y., O'hUigin, C., Takahata, N. (1993). The molecular descent of the major histocompatibility complex. Annu. Rev. Immunol. 11,269-295. Kling, D., Fingerle, J., Harlan, J. M., Lobb, R. R., Lang, F. (1995). Mononuclear leukocytes invade rabbit arterial intima during thickening formation via CD 18- and VLA-4-dependent mechanisms and stimulate smooth muscle migration. Circ. Res. 77, 1121-1128.

255

Knight, K. L., Becker, R. S. (1990). Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: implications for the generation of antibody diversity. Cell 60, 963970. Knight, K. L., Hanly, W. C. (1975). Genetic control of ~ chains of rabbit IgA: allotypic specificities on the variable and the constant regions. In Contemporary Topics in Molecular Immunology (eds Inman, F. P., Mandy, W. J.), pp. 55-88. Plenum Press, New York, USA. Knight, K. L., Leary, A. L., Tissot, R. G. (1980). Identification of two Ia-like alloantigens on rabbit B lymphocytes. Immunogenetics 10, 443-453. Knight, K. L., Martens, C. L., Stoklosa, C. M., Schneiderman, R. D. (1984). Genes encoding alpha-heavy chains of rabbit IgA: characterization of cDNA encoding IgA-g subclass alpha-chains. Nucl. Acids Res. 12, 1657-1670. Knight, K. L., Johnson, A., Coligan, J. E., Kindt, T. J. (1987). Partial amino acid sequence analysis of rabbit MHC class II molecules isolated from two-dimensional polyacrylamide gels. Mol. Immunol. 24, 449-454. Knight, K. L., Spieker-Polet, H., Kazdin, D., Oi, V. (1988). Transgenic rabbits with lymphocytic leukemia induced by the c-myc oncogene fused with the immunoglobulin heavy chain enhancer. Proc. Natl Acad. Sci. USA 85, 3130-3134. Kofler, H., Kofler, R., Wolf, H., Wick, G. (1983). Immunofluorescence studies on the codistribution of immune deposits and complement in the thyroid glands of Obese strain (OS) chickens. Immunobiology 4, 390-401. Komatsu, M. (1992). Molecular biology for genetic deficiency complement components in rabbits: C8~-7 deficiency and C3 hypocomplementemia. JARQ 26, 48-54. Komatsu, M., Yamamoto, K., Kawashima, T., Migita, S. (1985). Genetic deficiency of the ~-7-subunit of the eight complement component in the rabbit. J. Immunol. 134, 2607-2609. Komatsu, M., Lamoyi, E., Mage, R. G. (1987). Genomic DNA encoding rabbit T cell receptor fi-chains: isotypes and allotypes of Cfl. J. Immunol. 138, 1621-1626. Komatsu, M., Yamamoto, K., Nakano, Y., Nakazawa, M., Ozawa, A., Mikami, H., Tomita, M., Migita, S. (1988). Hereditary C3 hypocomplementemia in the rabbit. Immunology 64, 363-368. Komatsu, M., Imaoka, K., Satoh, M., Mikami, H. (1990). Hereditary C80~-7 deficiency associated with dwarfism in the rabbit. J. Heredity 81,413-417. Komatsu, M., Yamamoto, K., Mikami, H., Sodetz, J. M. (1991). Genetic deficiency of complement component C8 in the rabbit: evidence of a translational defect in expression of the ~-7 subunit. Biochem. Genet. 29, 271-274. Kotani, M., Yamamura, Y., Tamatani, T., Kitamura, F., Miyasaka, M. (1993a). Generation and characterization of monoclonal antibodies against rabbit CD4, CD5 and CDlla antigens. J. Immunol. Methods 157, 241-252. Kotani, M., Yamamura, Y., Tsudo, M., Tamatani, T., Kitamura, F., Miyasaka, M. (1993b). Generation of monoclonal antibodies to the rabbit interleukin-2 receptor ~ chain (CD25) and its distribution in HTLV_l_transformed rabbit T cells. Jpn. J. Cancer Res. 84, 770-775. Kraal, G., Schornagel, K., Streeter, P. R., Holzmann, N., Butcher, E. C. (1995). Expression of the mucosal vascular addressin MadCAM-1 on sinus-lining cells in the spleen. Am. J. Pathol. 147, 763--771.

256

Krause, R. M. (1970). Factors controlling the occurrence of antibodies of uniform properties. Fed. Proc. 29, 59-65. Kraehenbuhl, J.-P., Neutra, M. R. (1992). Transepithelial transport and mucosal defence II: secretion of IgA. Trends Cell Biol. 2, 170-174. Kreider, J. W., Bartlett, G. L. (1981). The Shope papillomacarcinoma complex of rabbits: a model system for neoplastic progression and spontaneous regression. Adv. Cancer Res. 35, 81-110. Kulaga, H., Sogn, J. A., Weissman, J. D., Marche, P. N., LeGuern, C., Long, E. O., Kindt, T. J. (1987). Expression patterns of MHC class II genes in rabbit tissues indicate close homology to human counterparts. J. Immunol. 139, 587-592. Kulaga, H., Folks, T., Rutledge, R., Truckenmiller, M., Gugel, E., Kindt, T. (1989). Infection of rabbits with human immunodeficiency virus 1. A small animal model for acquired immunodeficiency syndrome. J. Exp. Med. 169, 321-326. Kume, N., Cybulsky, M. I., Gimbrone, M. A. (1992). Lysophosphatidylcholine, a component of atherogenic lipoproteins, induces mononuclear leukocyte adhesion molecules in cultured human and rabbit arterial endothelial cells. J. Clin. Invest. 90, 1138-1144. Kusano, M., Choi, N.-H., Tomita, M., Yamamoto, K., Migita, S., Sekiya, T., Nishimura, S. (1986). Nucleotide sequence of cDNA and derived amino acid sequence of rabbit complement component C3 e-chain. Immunol. Invest. 15,365-378. Lamoyi, E., Mage, R. G. (1985). Lack of Klb9 light chains in basilea rabbits is probably due to a mutation in an acceptor site for mRNA splicing. J. Exp. Med. 162, 1149-1160. Lamoyi, E., Mage, R. (1987). A cluster of rabbit T-cell fi-chain variable region genes. Immunogenetics 25, 55-62. Lamoyi, E., Angiolillo, A. L., Mage, R. G. (1986). An evolutionarily conserved rabbit T-cell receptor fl-chain variable region. Immunogenetics 23,266-270. Larigan, J. D., Tsang, T. C., Rumberger, J. M., Burns, D. K. (1992). Characterization of cDNA and genomic sequences encoding rabbit ELAM-I: conservation of structure and functional interactions with leukocytes. DNA Cell. Biol. 11, 149-162. Laverriere, A., Kulaga, H., Kindt, T. J., LeGuern, C., Marche, P. N. (1989). A rabbit class II MHC gene with strong similarities to HLA-DRalpha. Immunogenetics 30, 137-140. LeGuern, C., Marche, P. N., Kindt, T. J. (1985). Molecular evidence of five distinct MHC class II c~ genes in the rabbit. Immunogenetics 22, 141-148. LeGuern, C., Weissman, J. D., Marche, P. N., Jouvin-Marche, E., Laverriere, A., Bagnato, M. R., Kindt, T. J. (1987). Sequence determination of a transcribed rabbit class II gene with homology to HLA-DQc~. Immunogenetics 25, 104-109. LeGuern, A., Wetterskog, D., Marche, P. N., Kindt, T. J. (1987). A monoclonal antibody directed against a synthetic peptide reacts with a cell surface rabbit class I MHC molecule. Molec. Immunol. 24, 455-461. Lehrer, R. I., Lichtenstein, A. K., Ganz, T. (1993). Defensins: antimicrobial and cytotoxic peptides of mammalian cells. Annu. Rev. Immunol. 11, 105-128. Lerner, R. A., Dixon, F. J. (1966). Transfer of ovine experimental allergic glomerulonephritis (EAG) with serum. J. Exp. Med. 124, 431-442. Levine, P., Landsteiner, K. (1929). On immune isoagglutinins in rabbits. J. Immunol. 17, 559-565. Ley, K., Baker, J. B., Cybulsky, M. I., Gimbrone, M. A. Jr,


Luscinskas, F. W. (1993). Intravenous interleukin-8 inhibits granulocyte emigration from rabbit mesenteric venules without altering L-selectin expression or leukocyte rolling. J. Immunol. 151, 6347-6357. Li, W. H., Gouy, M., Sharp, P. M., O'hUigin, C., Yang, Y. W. (1990). Molecular phylogeny of Rodentia, Lagomorpha, Primates, Artiodactyla, and Carnivora and molecular clocks. Proc. Natl Acad. Sci. USA 87, 6703-6707. Lieberman, R., Emorine, L., Max, E. E. (1984). Structure of a germline rabbit immunoglobulin V kappa-region gene: implications for rabbit V kappa-J kappa recombination. J. Immunol. 133(5), 2753-2756. Lin, Y.-L., Borenstein, L. A., Selvakumar, R., Ahmed, R., Wettstein, F. O. (1993). Progression from papilloma to carcinoma is accompanied by changes in antibody response to papillomavirus proteins. J. Virol. 67, 382-389. Lindbom, L., Lundberg, C., Prieto, J., Raud, J., Nortamo, P., Gahmberg, C. G., Patarroyo, M. (1990). Rabbit leukocyte adhesion molecules CDI1/CD18 and their participation in acute and delayed inflammatory responses and leukocyte distribution in vivo. Clin. Immunol. Immunopathol. 57, 105119. Lindqvist, K. J. (1968). A unique class of rabbit immunoglobulins eliciting passive cutaneous anaphylaxis in homologous skin. Immunochemistry 5,525-542. Loar, L. S., Dennison, D., Sell, S. (1986). Production and characterization of monoclonal antibodies to rabbit lymphocyte subpopulations. I. Tissue immunofluorescence and flow cytometric analysis. J. Immunol. 137, 2784-2790. Lobel, S. A., Knight, K. L. (1984). The role of rabbit Ia molecules in immune functions as determined with the use of an anti-Ia monoclonal antibody. Immunology 51, 35-43. Loot, F., Kelus, A. S. (1978). Allelic exclusion in the B lineage cells of the rabbit. Eur. J. Immunol. 8,315-324. Lyons, A. B., Parish, C. R. (1995). Are murine marginal-zone macrophages the splenic white pulp analog of high endothelial venules? Eur. J. Immunol. 25, 3165-3172. McCartney-Francis, N. L. (1987). Latent allotype expression in the rabbit. In The Rabbit in Contemporary Immunological Research (ed. Dubiski, S.), pp. 134-147. Longman Scientific & Technical, Harlow, England. McCartney-Francis, N., Skurla, R., Mage, R. G., Bernstein, K. E. (1984). Kappa chain allotypes and isotypes in the rabbit: cDNA sequence of clones encoding b9 suggest an evolutionary pathway and possible role of the interdomain disulphide bond in quantitative allotype expression. Proc. Natl Acad. Sci. USA 81, 1794-1798. McDonnell, J., Hoerrner, L. A., Lark, M. W., Harper, C., Dey, T., Lobner, J., Eiermann, G., Kazazis, D., Siner, I. I., Moore, V. L. (1992). Recombinant human interleukin-1 beta-induced increase in levels of proteoglycans, stromelysin, and leukocytes in rabbit synovial fluid. Arthritis Rheum. 35,799-805. McFadden, G., Graham, K. (1994). Modulation of cytokine networks by poxvirus: the myxoma virus model. Semin. Virol. 5,421-429. McNicholas, J. M., Raffeld, M., Loken, M. R., Reiter, H., Knight, K. L. (1981). Monoclonal antibodies to rabbit lymphoid cells: preparation and characterization of a T-cellspecific antibody. Molec. Immunol. 18, 815-822. Mage, R. G. (1967). Quantitative studies on the regulation of expression of genes for immunoglobulin allotypes in hetero-

References

zygous rabbits. Cold Spring Harbor Symp. Quant. Biol. 32, 203-210. Mage, R. G. (1975). Allotype suppression in rabbits: effects of anti-allotype antisera upon expression of immunoglobulin genes. Transplant. Rev. 26, 84-99. Mage, R. G., Young-Cooper, G. O., Alexander, C. (1971). Genetic control of variable and constant regions of immunoglobulin H chains. Nature 230, 63-64. Mage, R. G., Rejnek, J., Young-Cooper, G. O., Alexander, C. (1977). Are 'hidden' genes for immunoglobulin allotypes of rabbit heavy and light chains expressed upon hyperimmunization? Eur. J. Immunol. 7, 460-468. Mage, R., Dray, S., Gilman-Sachs, A., Hamers-Casterman, C., Hamers, R., Hanly, W., Kin&, T., Knight, K., Mandy, W., Naessens, J. (1982). Rabbit heavy chain haplotypes- allotypic determinants expressed by VH--CH recombinants. Immunogenetics 15,287-297. Mage, R. G., McCartney-Francis, N. L., Komatsu, M., Lamoyi, E. (1987). Evolution of genes for allelic and isotypic forms of immunoglobulin kappa chains and of the genes for T-cell receptor beta chains in rabbits. J. Molec. Evol. 25,292-299. Mage, R. G., Young-Cooper, G. O., Alexander, C. B., Hanly, W. C., Newman, B. A. (1992). A new VH--CH recombinant in the rabbit. Immunogenetics 35, 131-135. Manthei, U., Strunk, R. C., Giclas, P. C. (1984). Acute local inflammation alters synthesis, distribution, and catabolism of the third component of complement (C3) in rabbits. J. Clin. Invest. 74, 424-433. Marche, P. N., Kin&, T. J. (1986a). Two distinct T-cell receptor 0~-chain transcripts in a rabbit T-cell line: implications for allelic exclusion in T cells. Proc. Natl Acad. Sci. USA 83, 2190-2194. Marche, P. N., Kin&, T. J. (1986b). A variable region gene subfamily encoding T cell receptor fi-chains is selectively conserved among mammals. J. Immunol. 137, 1729-1734. Marche, P. N., Tykocinski, M. L., Max, E. E., Kindt, T. J. (1985). Structure of a functional rabbit class I MHC gene: similarity to human class I genes. Immunogenetics 21, 71-82. Marche, P. N., Rebiere, M. C., Laverriere, A., English, D. W., LeGuern, C., Kindt, T. J. (1989). Definition of rabbit class I and class II MHC gene haplotypes using molecular typing procedures. Immunogenetics 29, 273-276. Marche, P. N., Laverriere, A., LeGuern, C., Kindt, T. J. (1991). A gene remnant in the rabbit MHC related to HLA-DR~. Res. Immunol. 142, 525-532. Mariame, B., Akimenko, M. A., Rougeon, F. (1987). Interallelic and intergenic conversion events could induce differential evolution of the two rabbit immunoglobulin kappa light chain genes. Nucleic Acids Res. 15(15), 6171-6179. Marsh, S. G. E., Bodmer, J. G. (1995). HLA class II region nucleotide sequences, 1995. Tissue Antigens 45,258-280. Martens, C. L., Moore, K. W., Steinmetz, M., Hood, L. E., Knight, K. L. (1982). Heavy chain genes of rabbit IgG: isolation of a cDNA encoding gamma heavy chain and identification of two genomic C-gamma genes. Proc. Natl Acad. Sci. USA 79, 6018-6022. Martens, C. L., Currier, S. J., Knight, K. L. (1984). Molecular genetic analysis of genes encoding the heavy chains of rabbit IgG. J. Immunol. 133, 1022-1027. Matsukawa, A., Yoshimura, T., Maeda, T., Ohkuwara, S., Takagi, K., Yoshinaga, M. (1995). Neutrophil accumulation and activation by homologous IL-8 in rabbits: IL-8 induces

257

destruction of cartilage and production of IL-1 and IL-1 receptor antagonist in vivo. J. Immunol. 154, 5418-5425. Mileski, W., Harlan, J., Rice, C., Winn, R. (1990). Streptococcus pneumoniae-stimulated macrophages induce neutrophils to emigrate by a CD18-independent mechanism of adherence. Circ. Shock 31,259-267. Moise, K. J., Hesketh, D. E., Belfort, M. M., Saade, G., van den Veyver, I. B., Hudson, K. M., Rodkey, L. S. (1992). Ultrasound-guided blood sampling of rabbit fetuses. Lab. An. Sci. 42, 398-401. Moise, K. J., Saade, G., Knudsen, L., Valdez-Torres, A., Belfort, M. A., Hsu, H., Harvey, S. C., Hudson, K. M., Rodkey, L. S. (1994). Ultrasound-guided cardiac blood sampling of the rabbit fetus. Fetal Diagn. Ther. 9, 331-336. Moise, K. J., Rodkey, L. S., Saade, G., Gei, A., Dure, M., Graham, A., Creech, C. (1995a). An animal model for hemolytic disease of the fetus and newborn. I. Alloimmunization techniques. Am. J. Obstet. Gynecol. 173, 51-55. Moise, K. J., Rodkey, L. S., Saade, G. R., Dure, M., Dorman, K., Mayes, M., Graham, A. (1995b). An animal model for hemolytic disease of the fetus and newborn. II. Fetal effects in New Zealand rabbits. Am. J. Obstet. Gynecol. 173, 747753. Moreira, A., Wollerton, M., Monks, J., Proudfoot, N. J. (1995). Upstream sequence elements enhance poly(A) site efficiency of the C2 complement gene and are phylogenetically conserved. EMBO J. 14, 3809-3819. Mossman, K., Nation, P., Macen, J., Garbutt, M., Lucas, A., McFadden, G. (1996). Myxoma virus M-T7, a secreted homolog of the interferon-?, is a critical virulence factor for the development of myxomatosis in European rabbits. Virology 215, 17-30. Nakano, Y., Masuda, T., Sakamoto, T., Tomita, M. (1986). Isolation and characterization of rabbit properdin of the alternative complement pathway. J. Immunol. Methods 90, 77-83. Neutra, M. R., Kraehenbuhl, J.-P. (1992). Transepithelial transport and mucosal defence I: the role of M cells. Trends Cell Biol. 2, 134-138. Newman, B. A., Young-Cooper, G. O., Alexander, C. B., Becker, R. S., Knight, K. L., Kelus, A. S., Meier, D., Mage, R. G. (1991). Molecular analysis of recombination sites within the immunoglobulin heavy chain locus of the rabbit. Immunogenetics 34, 101-109. Novacek, M. (1996). Where do rabbits and kin fit in? Nature 379, 299-300. Ohkubo, C., Bigos, D., Jain, R. K. (1991). Interleukin 2 induced leukocyte adhesion to the normal and tumor microvascular endothelium in vivo and its inhibition by dextran sulfate: implications for vascular leak syndrome. Cancer Res. 51, 1561-1563. Okabayashi, M., Angell, M. G., Christensen, N. D., Kreider, J. W. (1991). Morphometric analysis and identification of infiltrating leukocytes in regressing and progressing Shope rabbit papillomas. Int. J. Cancer 49, 919-923. Okabayashi, M., Angell, M. G., Christensen, N. D., Kreider, J. W. (1993). Shope papilloma cell and leukocyte proliferation in regressing and progressing lesions. Am. J. Pathol. 142, 489496. Olofsson, A. M., Arfors, K.-E., Ramezani, L., Wolitsky, B. A., Butcher, E. C., yon Andrian, U. H. (1994). E-selectin mediates

258

leukocyte rolling in interleukin-l-treated rabbit mesentery venules. Blood 84, 2749-2758. Pappo, J. (1989). Generation and characterization of monoclonal antibodies recognizing follicle epithelial M cells in rabbit gutassociated lymphoid tissue. Cell. Immunol. 120, 31-41. Pappo, J., Ermak, T. H. (1989). Uptake and translocation of fluorescent latex particles by rabbit Peyer's patch follicle epithelium: a quantitative model for M cell uptake. Clin. Exp. Immunol. 76, 144-148. Pappo, J., Ermak, T. H., Steger, H. J. (1991). Monoclonal antibody-directed targeting of fluorescent polystyrene microspheres to Peyer's patch M cells. Immunology 73,277-280. Pavirani, A., McCartney-Francis, N., Jacobsen, F., Mage, R. G., Reddy, P. E., Fitzmaurice, L. C. (1983). Analyses of the splenic mRNA expressed by rabbits of different immunoglobulin kappa-light chain allotypes: conserved sequences in the 3' untranslated region and allotype-specific probes. J. Immunol. 131, 1000-1006. Peak, P. W., Charlesworth, J. A., Pussell, B. A. (1991). Activation of rabbit C3: studies of the generation of cleavage products in vitro and of their metabolism in vivo. Complement Inflamm. 8, 261-270. Pospisil, R., Young-Cooper, G. O., Mage, R. G. (1995). Preferential expansion and survival of B lymphocytes based on VH framework 1 and framework 3 expression: 'Positive' selection in appendix of normal and VH-mutant rabbits. Proc. Natl Acad. Sci. USA 92, 6961-6965. Pospisil, R., Fitts, M. G., Mage, R. G. (1996). CD5 is a potential selecting ligand for B-cell surface immunoglobulin framework region sequences. J. Exp. Med. 184, 1279-1284. Raman, C., Knight, K. L. (1992). CD5 + B cells predominate in peripheral tissues of rabbit. J. Immunology 149, 3858-3864. Rebierre, M. C., Marche, P. N., Kindt, T. J. (1987a). A rabbit class I major histocompatibility complex gene with a T cellspecific expression pattern. J. Immunol. 139, 2066-2074. Rebierre, M. C., Marche, P. N., LeGuern, C., Kindt, T. J. (1987b). Molecular studies of the rabbit major histocompatibility complex. In The Rabbit in Contemporary Immunological Research (ed. Dubisky, S.), pp. 42-62. Longman Scientific, Harlow, UK. Reina, S., Markham, P., Gard, E., Rayed, F., Reitz, M., Gallo, R., Varnier, O. (1993). Serological, biological and molecular characterization of New Zealand White rabbits infected by intraperitoneal inoculation with cell-free human immunodeficiency virus. J. Virol. 67, 5367-5374. Reynaud, C. A., Anquez, V., Grimal, H., Weill, J. C. (1987). A hyperconversion mechanism generates the chicken light chain preimmune repertoire. Cell 48,379-388. Reynaud, C. A., Dahan, A., Anquez, V., Weill, J. C. (1989). Somatic hyperconversion diversifies the single VH gene of the chicken with a high incidence in the D region. Cell 59, 171183. Reynaud, C. A., Mackay, C. R., Muller, R. G., Weill, J. C. (1991). Somatic generation of diversity in a mammalian primary lymphoid organ: the sheep ileal Peyer's patch. Cell 64, 995-1005. Reynolds, J. D., Morris, B. (1983). The evolution and involution of Peyer's patches in fetal and postnatal sheep. Eur. J. Immunol. 13,627-635. Richardson, M., Kurowska, E. M., Carroll, K. K. (1994). Early lesion development in the aortas of rabbits fed low-fat,


cholesterol-free, semipurified casein diet. Atherosclerosis 107, 165-178. Roman-Franco, A. A., Turiello, M., Albini, B., Ossi, E., Milgrom, F., Andres, G. A. (1976). Anti-basement membrane antibody (A-BM Ab) and immune complexes (IC) in rabbits injected with mercuric chloride (HgC12). Kidney Int. 10, 549 (abstract). Roman-Franco, A. A., Turiello, M., Albini, B., Ossi, E., Milgrom, F., Andres, G. A. (1978). Anti-basement membrane antibodies and antigen-antibody complexes in rabbits injected with mercuric chloride. Clin. Immunol. Immunopathol. 9, 464-481. Rose, N. R., Witebsky, E. (1956). Studies on organ specificity. V. Changes in the thyroid glands of rabbits following active immunization with rabbit thyroid extracts. J. Immunol. 76, 417-427. Rosenbaum, J. T., Boney, R. S. (1993). Efficacy of antibodies to adhesion molecules CDIla or CD18 in rabbit models of uveitis. Curr. Eye Res. 12, 827-831. Rother, K. (1986). Rabbits deficient in C6. In Hereditary and Acquired Complement Deficiencies in Animals and Man (eds Rother, K., Rother, U.), Progress in Allergy, Vol. 39, pp. 192201. Karger, Basel. Roux, K. H. (1983). Rabbit latent allotypes: current status and future directions. Surv. Immunol. Res. 2, 342-350. Roux, K. H., Mage, R. G. (1996). Rabbit immunoglobulin allotypes. In Handbook of Experimental Immunology, 5th ed. (eds Weir, D. M., Herzenberg, L. A., Blackwell, C., Herzenberg, L. A.), Vol. I, Chapter 26, pp. 26.1-26.17. Blackwell Sciences Inc., Cambridge, MA, USA. Rudzik, O., Perey, D. Y. E., Bienenstock, J. (1975). Differential IgA repopulation after transfer of autologous and allogeneic rabbit Peyer's patch cells. J. Immunol. 114, 40-44. Saida, T., Saida, K., Silberberg, D. H., Brown, M. J. (1981). Experimental allergic neuritis induced by galactocerebroside. Ann. Neurol. 9 (Suppl.), 87-101. Samudzi, C. T., Burton, L. E., Rubin, J. R. (1991). Crystal structure of recombinant rabbit interferon-gamma at 2.7 resolution. J. Biol. Chem. 266, 21791-21797. Sawasdikosol, S., Hague, B. F., Zhao, T. M., Bowers, F. S., Simpson, R. M., Robinson, M., Kindt, T. J. (1993). Selection of rabbit CD4-CD8-TCR78 cells by in vitro transformation with HTLV-1. J. Exp. Med. 178, 1337-1345. Schneiderman, R. D., Hanly, W. C., Knight, K. L. (1989). Expression of 12 rabbit IgA Ca genes as chimeric rabbitmouse IgA antibodies. Proc. Natl Acad. Sci. USA 86, 75617565. Sell, S., Hsu, P-L. (1993). Delayed hypersensitivity, immune deviation, antigen processing and T-cell subset selection in syphilis pathogenesis and vaccine development. Immunol. Today 14, 577-582. Selvakumar, R., Borenstein, L. A., Lin, Y.-L., Ahmed, R., Wettstein, F. O. (1994). T cell response to Cottontail rabbit papillomavirus structural proteins in infected rabbits. J. Virol. 68, 4043-4048. Seto, A., Kawanishi, M., Matsuda, S., Ogawa, K., Miyoshi, I. (1987). Induction of preleukemic stage of adult T cell leukemia-like disease in rabbits. Jpn. J Cancer Res. 78, 1150-1155. Setupathi, P., Spieker-Polet, H., Polet, H., Yam, P., Tunyaplin, C., Knight, K. (1994). Lymphoid and non-lymphoid tumors in Ek-myc transgenic rabbits. Leukemia 8, 2144-2155. Shibata, S., Sakaguchi, H., Nagasawa, T., Naruse, T. (1972).

References

Nephritogenic glycoprotein. II. Experimental production of membranous glomerulonephritis in rats by a single injection of homologous renal glycopeptide. Lab. Invest. 27, 457-465. Short, J. A., Sethupathi, P., Zhai, S. K., Knight, K. L. (1991). VDJ genes in VHa2 allotype-suppressed rabbits. Limited germline VH gene usage and accumulation of somatic mutations in D regions. J. Immunol. 147, 4014-4188. Simpson, R., Hubbard, B., Ailing, D., Teller, R., Fain, M., Bowers, F., Kindt, T. (1995). Rabbits transfused with human immunodeficiency virus Type 1-infected blood develop immune deficiency with CD4 + lymphocytopenia in the absence of clear evidence for HIV type 1 infection. AIDS Res. Hum. Retrovirus. 11,297-305. Simpson, R., Zhao, T., Hubbard, B., Sawasdikosol, S., Kin&, T. (1996). Experimental acute T cell leukemia-lymphoma is associated with thymic atrophy in human T cell leukemia virus type I infection. Lab. Invest. 74, 696-710. Sire, J., Colle, A., Burgois, A. (1979). Identification of an IgD-like surface immunoglobulin on rabbit lymphocytes. Eur. J. Immunol. 9, 13-16. Sittisombut, N. (1987). Structure and organization of the rabbit major histocompatibility complex class II genes. Ph.D. Thesis, University of Illinois at Chicago, Chicago. Sittisombut, N. (1996). The major histocompatibility complex of the rabbit. In The Major Histocompatibility Complex Region of Domestic Animal Species (eds Shook, L. B., Lamont, S. J.), pp. 269-292. CRC Press, Boca Raton, FL, USA. Sittisombut, N., Knight, K. L. (1986). Rabbit major histocompatibility complex. I. Isolation and characterization of three subregions of class II genes. J. Immunol. 136, 1871-1875. Sittisombut, N., Mordacq, J., Knight, K. L. (1988). Rabbit MHC II. Sequence analysis of the R-DP~- and fi-genes. J. Immunol. 140, 3237-3243. Sittisombut, N., Tissot, R., Knight, K. L. (1989). Rabbit major histocompatibility complex. III. Multiple class II DRfi genes and restriction fragment length polymorphism of the Class II and fi genes. J. Immunogenet. 16, 63-75. Smet, E. G., De Smet, W., Byrs, L., De Baetselier, P. C. (1986). Mab.198: a monoclonal antibody recognizing the complement type 3 receptor (CR3) in the rabbit. Immunology 59, 419-425. Spieker-Polet, H., Sittisombut, N., Yam, P. C., Knight, K. L. (1990). Rabbit major histocompatibility complex. IV. Expression of major histocompatibility complex class II genes. J. Immunogenet. 17, 123-132. Spieker-Polet, H., Yam, P.-C., Knight, K. L. (1993). Differential expression of 13 IgA-heavy chain genes in rabbit lymphoid tissues. J. Immunol. 150, 5457-5464. Springer, T. A. (1995). Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57, 827-872. Syverton, J. T. (1952). The pathogenesis of the rabbit papillomato-carcinoma sequence. Ann. N Y Acad. Sci. 54, 1126-1140. Talbott, G. A., Sharar, S. R., Harlan, J. M., Winn, R. K. (1994). Leukocyte-endothelial interactions and organ injury: the role of adhesion molecules. New Horizons 2, 545-554. Takata, Y., Hozono, H., Takeda, J., Tanaka, E., Hong, K., Kinoshita, T., Inoue, K. (1985). Two types of rabbit C4, one of which consists of two peptide chains and the other of three chains. Complement 2, 77. Tissot, R. G., Cohen, C. (1972). Histocompatibility in the rabbit. Identification of a major locus. Tissue Antigens 2, 267-279. Tissot, R. G., Cohen, C. (1974). Histocompatibility in the rabbit.

259

Linkage between RL-A, MLC, and the He blood group loci. Transplantation 18, 142-149. Tomazic, V., Rose, N. R. (1975). Autoimmune murine thyroiditis. VII. Induction of the thyroid lesions by passive transfer of immune serum. Clin. Immunol. Immunopathol. 4, 511-518. Tykocinski, M. L., Marche, P. N., Max, E. E., Kindt, T. J. (1984). Rabbit class I MHC genes: cDNA clones define full-length transcripts of an expressed gene and a putative pseudogene. J. Immunol. 133, 2261-2269. van Osselaer, N., Herman, A. G., Rampart, M. (1993). Dextran sulphate inhibits neutrophil emigration and neutrophildependent plasma leakage in rabbit skin. Agents Actions 38, C51-53. van Tol, M., Veenhoff, E., Seijen, H. (1978). Rabbit IgM: its isolation in high yields by a convenient procedure using serum from trypanosome-infected animals. J. Immun. Methods 21, 125-131. Vladutiu, A. O. (1990). Thyroglobulin antibodies in experimental autoimmune thyroiditis. In Organ-Specific kutoimmunity (eds Bigazzi, P. E., Wick, G., Wicher, K.), pp. 241-266. Marcel Dekker, New York, USA. yon Zabern, I. (1988). Species-dependent incompatibilities. In The Complement System (eds Rother, K., Till, G. O.), pp. 196-202. Springer, Berlin Heidelberg New York. Waksman, B. H. (1959). Experimental encephalomyelitis and the autoallergic disease. Int. Arch. Allergy 14 (Suppl.), 1-87. Wank, R., Thomssen, C. (1991). High risk of squamous cell carcinoma of the cervix for women with HLA-DQw3. Nature 352, 723-725. Watanabe, Y. (1980). Serial inbreeding of rabbits with hereditary hyperlipidemia (WHHL-rabbit): incidence and development of atherosclerosis and xanthoma. Atherosclerosis 36, 261267. Weetman, A. P., Cohen, S. B., Oleesky, D. A., Morgan, B. P. (1989). Terminal complement complexes and C1/C1 inhibitor complexes in autoimmune thyroid disease. Clin. Exp. Immunol. 77, 25-30. Weinstein, P. D., Cebra, J. J. (1991). The preference for switching to IgA expression by Peyer's patch germinal center B cells is likely due to the intrinsic influence of their microenvironment. J. Immunol. 147, 4126-4135. Weinstein, P. D., Mage, R. G., Anderson, A. O. (1994a). The appendix functions as a mammalian bursal equivalent in the developing rabbit. In Proceedings of the 11th International Conference on Lymphoid Tissues and Germinal Centers (ed. Heinen, E.), pp. 249-253. Plenum Press, New York, USA. Weinstein, P. D., Anderson, A. O., Mage, R. G. (1994b). Rabbit IgH sequences in appendix germinal centers: VH diversification by gene conversion-like and hypermutation mechanisms. Immunity 1,647-659. White, R. V., Kaufman, K. M., Letson, C. S., Platteborze, P. L., Sodetz, J. M. (1994). Characterization of rabbit complement component C8: functional evidence for the species-selective recognition of C8 alpha by homologous restriction factor (CD59). J. Immunol. 152, 2501-2508. Wick, G., Graf, J. (1972). Electron microscopic studies in chickens of the Obese strain (OS) with spontaneous hereditary autoimmune thyroiditis. Lab. Invest. 27, 400-411. Wick, G., Breznischek, H. P., Hala, K., Dietrich, H., Wolf, H., Kroemer, G. (1989). The Obese strain of chickens. An animal model with spontaneous autoimmune thyroiditis. Adv. Immunol. 47, 433-450.

260

Wiebke, J. L., Quinlan, W. M., Doyle, N. A., Sligh, J. E., Smith, C. W., Doerschuk, C. M. (1995). Lymphocyte accumulation during Pseudomonas aeruginosa-induced pneumonia in rodents does not require CD11a and intercellular adhesion molecule-l. Am. J. Respir. Cell Mol. Biol. 12, 513-519. Wiggs, B. R., English, D., Quinlan, W. M., Doyle, N. A., Hogg, J. C., Doerschuk, C. M. (1994). Contributions of capillary pathway size and neutrophil deformability to neutrophil transit through rabbit lungs. J. Appl. Physiol. 77, 463-470. Wilder, R. L., Yuen, C. C., Coyle, S. A., Mage, R. G. (1979). Demonstration of a rabbit cell surface Ig that bears light chain and VH, but lacks /2-, 0~-, and 7-allotypes- rabbit IgD? J. Immunol. 122, 464-468. Wilkinson, J. M., Tykocinski, M. L., Coligan, J. E., Kimball, E. S., Kindt, T. J. (1982). Rabbit MHC antigens: occurrence of non-fl2-microglobulin-associated class I molecules. Mol. Immunol. 19, 1441-1451. Wilkinson, J. M., Wetterskog, D. L., Sogn, J. A., Kindt, T. J. (1984). Cell surface glycoproteins of rabbit lymphocytes: characterization with monoclonal antibodies. Molec. Immunol. 21, 95-103. Wilkinson, J. M., Galea-Lauri, J., Reid, H. W. (1992a). A cytotoxic rabbit T-cell line infected with a y-herpes virus which expresses CD8 and class II antigens. Immunology 77, 106-108. Wilkinson, J. M., Galea-Lauri, J., Sellars, R. A., Boniface, C. (1992b). Identification and tissue distribution of rabbit leucocyte antigens recognized by monoclonal antibodies. Immunology 76, 625-630.


Wilkinson, J. M., McDonald, G., Smith, S., Galea-Lauri, J., Lewthwaite, J., Henderson, B., Revelle, P. A. (1993). Immunohistochemical identification of leucocyte populations in normal tissue and inflamed synovium of the rabbit. J. Pathol. 170, 315-320. Winn, R. K., Harlan, J. M. (1993). CD18-independent neutrophil and mononuclear leukocyte emigration into the peritoneum of rabbits. J. Clin. Invest. 92, 1168-1173. Witebsky, E., Rose, N. R. (t956). Studies on organ specificities. IV. Production of rabbit thyroid antibodies in the rabbit. J. Immunol. 76, 408-416. Wutzler, p., Meerbach, A., Farber, I., Wolf, H., Scheibner, K. (1995). Malignant lymphomas induced by an Epstein-Barr virus-related herpesvirus from Macaca arctoides- a rabbit model. Arch. Virol. 140, 1979-1995. Yared, M. A., Moise, K. J., Rodkey, L. S. (1998). Stable solidphase Rh antigen. Transfusion Medicine (in press). Yoshimura, T., Yuhki, N. (1991). Neutrophil attractant/activation protein-1 and monocyte chemoattractant protein-1 in rabbit: cDNA cloning and their expression in spleen cells. J. Immunot. 146, 3483-3488. Zeltner, R., Borenstein, L. A., Wettstein, F. O., Iftner, T. (1994). Changes in RNA expression pattern during the malignant progression of cottontail rabbit papillomavirus-induced tumors in rabbits. J. Virol. 68, 3620-3630. Zhao, T. M., Robinson, M. A., Bowers, F. S., Kindt, T. J. (1995). Characterization of an infectious molecular clone of human T-cell leukemia virus type I. J. Virol. 69, 2024-2030.

VII 1.

IMMUNOLOGY OF THE DOG

Introduction

The dog has long been an important research model in two major areas. Dogs play an important role in the investigation of new drugs since they are one of the major models used in toxicity trials, including the effects of investigational drugs on the immune system. Historically, the dog has been a valuable model for bone marrow transplantation, with many of the advances made in the dog being directly transferrable to human clinical bone marrow transplantation protocols. More recently, the dog has become an important model in the study of primary immunodeficiency disease. For example, the determination of the immunologic defect in X-linked severe combined immunodeficient (XSCID) dogs led to the discovery of the gene responsible for XSCID. Because dogs develop many of the same immunologic diseases as humans, they represent an ideal large animal model in which to study the immunology and pathogenesis of these diseases in a compressed period of time. Previously, the major limitation of the use of the dog as an experimental model in immunological research has been the paucity of immunological reagents available to dissect the canine immune system. Over the past few years, great strides forward have been made in the development of these reagents.

11


Thymus The thymus is believed to be the main site of T cell development in the dog. It consists of two main lobes and is situated in the cranial mediastinum. A thymic anlage is observed in 25-day-old embryos (Kelly, 1963). Lymphocytes are present in the thymus of 35-day-old fetuses and Hassall's corpuscles appear at 45 days (Kelly, 1963; Snyder et al., 1993). The thymus undergoes rapid postnatal growth and reaches maximum size at 1-2 months of age as percentage of body weight, and at 6 months of age in absolute terms (Yan and Gawlak, 1989). The thymus involutes in older dogs, but remnants of thymic tissue can usually be identified even in old animals. Handbook of Vertebrate Immunology ISBN 0-12-546401-0

The thymus of 4-8-week-old dogs contains approximately 15% double negative ( C D 4 - C D 8 - ) cells, 70% double-positive (CD4 +CD8 +) cells, 12% CD4 + C D S cells, and 3% C D 4 - C D 8 § cells (Somberg et al., 1994). The thymus receives its arterial blood supply from the internal thoracic arteries, the brachiocephalic artery and the left subclavian artery (Bezuidenhout, 1993). Efferent lymph vessels drain into the cranial mediastinal and sternal lymph nodes. The thymus contains sympathetic and parasympathetic nerves.

Spleen The spleen is a boot-shaped organ in the abdominal cavity. Its exact location depends on the fullness of the stomach. It has a fibroelastic capsule that allows great distention. Trabeculae extend from the capsule into the parenchyma. A rudimentary spleen is present in 27-28-day-old embryos, but lymphocytic infiltration does not occur until gestation day 52 (Bryant and Shifrine, 1972). Germinal centers and plasma cells are not present until after birth. The white pulp consists of lymphoid follicles and periarteriolar lymphoid sheaths (PALS) surrounded by a marginal zone. The PALS contains predominantly CD5 § § T cells and fewer CD5 § CD8 § T cells (Rabanal et al., 1995). The red pulp consists of a network of reticular cells and macrophages, and venous sinuses. The splenic artery is a branch of the celiac or cranial mesenteric artery which forms 25 branches that enter the spleen via the hilus. The arteries pass through the trabeculae, forming smaller branches that enter the white pulp. These branches end in the marginal zone or form connections with the venous sinuses of the red pulp. The spleen is mainly innervated by sympathetic nerves from the celiac plexus (Bezuidenhout, 1993). The main immune function of the spleen is the response to blood-borne pathogens.

Lymph nodes The lymph nodes of the dog with their afferent and efferent lymphatics are listed in Table VII.2.1, and their distribution is illustrated in Figure VII.2.1. The lymph node can be divided into a cortex with Copyright ~ 1998 Academic Press Limited All rights of reproduction in any form reserved

262

I M M U N O L O G Y OF THE DOG

Table V11.2.1 Lymph nodes (In)in the dog and their afferent and efferent lymphatics

Lymph node

Draining area

Efferent lymphatics

Parotid

Superficial head regions caudal of eyes, external ear, eyelid, masticatory muscles Head, salivary glands Adjacent structures Parotid and mandibular lymph nodes, tongue, larynx, esophagus Superficial tissues of neck, head, thoracic limb and wall Esophagus, trachea, la.st 5-6 cervical vertebrae Superficial tissues of thoracic and ventral abdomen, mammary glands Superficial tissues of thoracic and ventral abdomen, mammary glands Thoracic wall, ventral abdominal wall, diaphragm, mediastinum, thymus Ribs, pleura, intercostal tissues, vertebrae Thymus, trachea, esophagus, heart, pleura, pulmonary In, intercostal In, tracheobronchial In Lung, thoracic viscera Lung Lumbar vertebrae, aorta, adrenal glands, kidneys, diaphragm, ovaries, uterus Pelvis, urogenital organs, deep and superficial inguinal In, left colic, sacral and hypogastric In Hindlimb, urogenital organs Rectum, genital organs Stomach, duodenum, liver, pancreas Esophagus, stomach, pancreas, spleen, liver, omentum, diaphragm Esophagus, stomach, diaphragm, peritoneum Duodenum, pancreas, omentum Jejunum, ileum, pancreas Ileum, cecum, colon Pelvic limb distal to node Medial surface of pelvic limb, knee and hock joint Abdominal wall, caudal mammae, penis, scrotum

Medial retropharyngeal In

Mandibular Lateral pharyngeal Medial retropharyngeal Superficial cervical Deep cervical Axillary Accessory axillary Sternal Intercostal Cranial mediastinal Tracheobronchial Pulmonary Lumbar Medial iliac Hypogastric iliac Sacral Hepatic Splenic Gastric Pancreatico-duodenal Jejunal Colic Popliteal Iliofemoral Superficial inguinal

follicles, a paracortex, and a medulla. The paracortical cells are mainly CD5 + T cells, 70-80% of which express CD4 and 20-30% express CD8 (Rabanal et al., 1995). The follicles are populated by B cells and a few CD4 + T cells. Medullary cords contain mostly plasma cells and macrophages. The arterial blood supply to the lymph node is variable among dogs and even among lymph nodes within an animal (Salvador et al., 1992; Belz and Heath, 1995a). In some dogs, the main artery enters the node via the hilus, as is usually the case in other species. However, in many nodes, arteries form a network that surrounds the lymph node, and from which branches penetrate the capsule. These branches may provide the bulk of the arterial blood

Medial retropharyngeal In Medial retropharyngeal In Tracheal trunks Right tracheal trunk, thoracic duct, external jugular veins Tracheal trunk, thoracic duct or mediastinal In Tracheal trunk, thoracic duct, external jugular veins Tracheal trunk, thoracic duct, external jugular veins Right lymphatic duct, thoracic duct Cranial mediastinal In Tracheal trunks, right lymphatic duct, thoracic duct Cranial mediastinal In Tracheobronchial In Lumbar trunk, cisterna chyli Lumbar trunk, lumbar In Medial iliac, lumbar trunk Medial and hypogastric iliac Intestinal trunk Intestinal trunk Intestinal trunk Intestinal trunk Intestinal trunk Intestinal trunk, medial iliac In, lumbar In Medial iliac In Medial iliac In Medial iliac In

supply to the lymph node. Venous blood leaves the lymph node via the hilus. High endothelial venules are present in the deep cortex (Belz and Heath, 1995a). Afferent lymph vessels divide into terminal lymphatics that deliver lymph into the subcapsular or trabecular sinuses (Belz and Heath, 1995b). Lymph flows through a continuous network of the subcapsular, trabecular, cortical and medullary sinuses and leaves the lymph node via the hilus. The sympathetic innervation of the mesenteric lymph node of the dog has been studied in some detail (Popper et al., 1988). The sympathetic nerves enter the lymph node via the hilus. They are present in medullary trabeculae and are associated with blood vessels in the medulla, paracortex and capsule (Popper et al., 1988). This suggests a possible role

Leukocytes and their Antigens

263

FigureVII.2.1 Distribution of lymph nodes present in the dog. The open symbols indicate superficially located

lymph nodes (In) and the filled symbols internal lymph nodes. Adapted from

Anatomy of the Dog. An Illustrated Text, Budras, K.D.,

~ _

Fricke, W., McCarthy, P. H. (1994). 1, parotid; 2, mandibular; 3, medial retropharyngeal; 4, superficial ce rvical; 5, axillaw; 6, sternal; 7, cranial mediastinal; 8, tracheobronchial; 9, lumbar; 10, medial iliac; 11, hepatic; 12, splenic; 13, gastric; 14, pancreaticoduodenal; 15, jejunal; 16, colic; 17, popliteal; 18, superficial inguinal.

1

~~"~I j

c 3~

9 o

O

10

~

Z

of sympathetic nerves in the regulation of the blood flow through the lymph node.

Tonsils

The palatine tonsils are paired lymphoid organs, located in the lateral wall of the pharynx. Smaller and less welldefined lymphoid tissues of the oropharyngeal cavity are the lingual and pharyngeal tonsils. The palatine tonsils consist of follicles populated by B cells and a few CD4 + T cells, and an interfollicular area with T cells. Squamous cell epithelium overlies the tonsils and forms crypts that extend deeply into the lymphoid tissue. The arterial blood supply comes from the tonsilar artery, a branch of the lingual artery. Numerous efferent lymphatics merge into t w o or three lymph vessels that drain into the medial retropharyngeal lymph node (Belz and Heath, 1995b).

Peyer's patches

The dog has two types of Peyer's patches (HogenEsch et al., 1987a; HogenEsch and Felsburg, 1992a). The duode-

nal and jejunal Peyer's patches are secondary lymphoid tissues presumably of importance to the mucosal immune response. The single ileal Peyer's patch has several features of a primary lymphoid organ, including predominant IgM production and early involution (HogenEsch and Felsburg, 1992b). The follicles of the ileal Peyer's patch of young dogs are large and populated by IgM B cells (HogenEsch and Felsburg, 1992a). The interfollicular areas are small. The duodenal and jejunal Peyer's patches have relatively smaller follicles and large domes and interfollicular areas. The interfollicular areas c o n t a i n predominantly T cells. The lymph vessels from the Peyer's patches form a plexus beneath the follicles from which efferent lymph vessels drain to the jejunal lymph nodes and to the hepatic lymph nodes (duodenal Peyer's patches).

3.

Leukocytes and their Antigens

In 1993, the First International Canine Leukocyte Antigen Workshop (CLAW) was held to identify monoclonal antibodies (mAb) to canine leukocyte antigens and canine equivalents of documented CD antigens (Cobbold

264

Table VII.3.1

Antigen CDla CDlc CD4 CD5 CD8~ CD11a CD11 b CD11 c CD18 CD21 CDw41 CD44 CD45 CD45RA CD49d CD54 CD62 CD90

Miscellaneous MHC class II TCR=/~ TCR75 c~d T cells B cells Granulocytes Monocytes


Monoclonal antibodies specific for canine leukocyte antigens

Other name(s)

MHC class II receptor MHC class I receptor LFA-1 Mac-l, Mo-1, CR3

/~2 integrin p150/95 GPIIb/llla Ppg-1 LCA

VLA-4 ICAM-1 P-selectin, GMP-140 Thy-1

MW

Cellular distribution

49 43 58 67 35 180 175 150 95 150

Thymocytes, Langerhans and dendritic cells Thymocytes, Langerhans and dendritic cells Thymocytes, Tcell subset, neutrophils Thymocytes, Tcells, B cell subset Thymocytes, T cell subset Leukocytes Granulocytes, monocytes Granulocytes, monocytes Leukocytes B cells, follicular dendritic cells Platelets, megakaryocytes Leukocytes, activated T cells Pan leukocytes B cells, T cell subset Thymocytes, T cells, myeloid cells Broad Platelets, megakaryocytes, endothelial cells Thymocytes, T cells

90 180-220 205, 220 130, 150 95 140 29

B cells, T cells, monocytes, dendritic cells Thymocytes, T cells Thymocytes, T cells Macrophage subset Thymocytes, pan T cells Mature B cells Granulocytes Monocytes, macrophages

28, 34 CD1 ld?

155

and Metcalfe, 1994). Nineteen groups submitted 127 mAb to the workshop; 58 of the 127 mAb were clustered within several CD designations. Table VII.3.1 lists the defined mAb in the dog (Moore et al., 1990, 1992, 1994, 1996; Sandmaier et al., 1990; Smith et al., 1991; Danilenko et al., 1992, 1995; Gebhard and Carter, 1992; Dore et al., 1993; Moore and Rossitto, 1993; Cobbold and Metcalfe, 1994). Canine monoclonal antibodies are only now becoming commercially available. Table VII.3.2 lists the canine specific monoclonal antibodies that have either been documented at the 1993 CLAW meeting or characterized in other publications. For those mAb not commercially available, the source of the antibody is listed with the reference for the antibody. Chabanne et al. (1994) recently screened a large number of human mAb for their cross-reactivity against canine leukocytes. Table VII.3.3 lists those human mAb that were shown to be cross-reactive. The cDNAs for six canine leukocyte antigens have been cloned including CD3g (Nash et al., 1991a), CD4 and CDS0~ (Gorman et al., 1994), CD28 (Pastori et al., 1994), CD34 (McSweeney et al., 1996), and CD38 (Uribe et al., 1997). Table VII.3.4 compares the canine cDNAs with those of other species.

11


No detailed studies of organ- and tissue-specific recruitment of the various leukocyte populations in the dog have been reported. Much of what is known about leukocyte trafficking in the dog is limited to the interaction of the leukocytes with the vascular endothelium (Smith et al., 1991; Spertini et al., 1991; Youker et al., 1992; Dore et al., 1993, 1995; Lefer et al., 1994; Jerome et al., 1994). Table VII.4.1 lists the canine leukocyte adhesion molecules that have been identified with their corresponding endothelial ligand. The major endothelial cell ligand, ICAM-1, has recently been cloned and shows 61% identity with human ICAM-1 (Manning et al., 1995). Endothelial cell activation by LPS, IFN-2, IL-lfi, and TNF-~ results in the upregulation of ICAM-I. Several endothelial ligands that have been identified in other species such as ICAM-2, Eselectin (ELAM-1), and VCAM-1 have yet to be identified in the dog. In vitro and in vivo studies have identified chemotactic factors that are responsible for the recruitment of leukocyte populations in the dog and are listed in Table VII.4.2 (Thomsen and Strom, 1989; Strom and Thomsen, 1990; Thomsen and Thomsen, 1990; Thomsen et al., 1991;


265

Table V11.3.2 Available canine monoclonal antibodies Antigen

mAb

Isotype

Source

CD1 a CDlc CD4

CA 9.AG5 CA 13.9H11 YKIX 302.9.3.7 LSM 12.125 LSM 8.53 DH 29A CA 13.1E4 YKIX 322.3.2 DOG 17-4-8 DH 3B DH 13A DH 14A DH 39C DH 60A YCATE 55.9.1 YCATE 60.3.9 DOG 10-1-1 LSM 1.140 LSM 4.78 CA 9.JD3 CA 11.4D3 CA 16.3E10 CA 11.6A1 CA 1.4E9 CA 16.3C10 H20A BA030A CA 2.1 D6 2F9 DOG 20-4 DOG 21-5 $5 YKIX 337.8.7 YKIX 716.13.2 DOG 23-4 DOG 32-1 CA 12.10C12 7B6 CA 4.1 D3 CA 4.5B3 CL 18.1D8 MD3 F3-20-7 DOG 13-1 DOG 14-2 DH 2A DH 24H YKIX 337.217.7 CA 1.4G8 5G2

IgG1 IgG1 Rat IgG2a IgG1 IgM IgM IgG1 Rat IgG2a Rat IgG2a IgG1 IgM IgM Ig? IgM Rat IgG 1 Rat IgG1 IgG1 IgG1 IgM IgG2a IgG1 IgG1 IgG1 IgG1 IgG1 IgG1 IgG1 IgG1 Ig? IgG2a Rat IgG2a IgG1 Rat IgG2a Rat IgG2b Rat IgG2a Rat IgG2a IgG1 IgG1 IgG1 IgG1 IgG1 IgG1 Ig? Rat IgG2a Rat IgG2a IgM Ig? Rat IgG2a IgG1 IgG2a

R Moore (CLAW) R Moore (CLAW) Biosource Custom Monoclonals, Sacramento, CA, USA D. Gebhard (CLAW) VMRD, Pullman, WA, USA R Moore (CLAW) S. Cobbold Connex, Martinsed, Germany VMRD, Pullman, WA, USA VMRD, Pullman, WA, USA VMRD, Pullman, WA, USA W. Davis (CLAW) W. Davis (CLAW) Biosource S. Cobbold (CLAW) Connex, Martinsed, Germany Custom Monoclonals, Sacramento, CA, USA Custom Monoclonals, Sacramento, CA, USA R Moore (CLAW) R Moore (CLAW) R Moore (CLAW) P. Moore (CLAW) P. Moore (CLAW) P. Moore (CLAW) VMRD, Pullman, WA, USA VMRD, Pullman, WA, USA R Moore (CLAW) S. Burnstein (CLAW) Connex, Martinsed, Germany Connex, Martinsed, Germany B. Sandmaier (CLAW) Biosource Biosource Connex, Martinsed, Germany C. Voss (CLAW) P. Moore (CLAW) R. Alejandro (CLAW) R Moore (CLAW) R Moore (CLAW) C. Smith (Smith et aL, 1991) C. Smith (Dore et aL, 1993) Biosource, Serotec Connex, Martinsed, Germany Connex, Martinsed, Germany VMRD, Pullman, WA, USA VMRD, Pullman, WA, USA Biosource R Moore (CLAW) R. Alejandro (CLAW)

YKIX 334.2.1 DOG 26-1 TGD 12 CA 2.1 C2 B1F6 CA 15.8G7 CA 20.8H1 CA 11.8H2 LSM 8.358 LSM 11.425 DOG 15-7 DH 59B

Rat IgG2a Rat IgG2a IgG2a IgG1 IgG2a IgG1 IgG2a IgG1 IgM IgG1 Rat IgG2a IgG1

Biosource Connex, Martinsed, Germany H. Grosse-Wilde (CLAW) R Moore (CLAW) R. Alejandro (CLAW) R Moore (Moore and Rossitto, 1993) P. Moore (Moore et al., 1994) R Moore (Danilenko et al., 1995) Custom Monoclonals, Sacramento, CA, USA Custom Monoclonals, Sacremento, CA, USA Connex, Martinsed, Germany VMRD, Pullman, WA, USA

CD5

CD8~

CD 11 a CD11 b CD1 lc CD18

CD21 CDw41 CD44 CD45

CD45RA CD49d CD54 CD62 CD90

Miscellaneous MHC class II

TCR~/~ TCR75 ~d T cells (pan) B cells (mature) Granulocytes Monocytes

266


Table V11.3.3 Human monocIonal antibodies that cross-react with canine leukocytes

Antigen

mAb

Isotype

Dog reactivity

Source

CD6 CD8 CD18

MT 606 MT 811 MHM 23 MCA 5O3 lOT 18 AM 18 lOB la S-B2 4B4

gG2b gG1 gG1 gG2b gG1 gG 1 gG1 IgG1 IgG1

Thymocytes, T cells Thymocytes, T cell subset Leukocytes Leukocytes Leukocytes Leukocytes B cells B cells Activated T cells

Boehringer-Mannheim Boehringer-Mannheim Dako Serotec Immunotech Biosys Immunotech Biosys Coulter

CD21 CDw29

Table VII.3.4

Cloned cDNAs for canine leukocyte antigens

Amino acid homology (%) Antigen

Predicted protein (aa)

Human

Mouse

CD3~ CD4 CD8c~ CD28 CD34 CD38

202 439 218 173 389 308

58 61 69 85 69 56

58

Rat

75

78 62 56

58

Table V11.4.1 Leukocyte-endothelial cell interactions in the dog

Endothelial ligands

Leukocyte determinants Molecule

Cell distribution

Molecule

Cell distribution

CD11b/CD18 (Mac-l)

Neutrophils, monocytes, and eosinophils Leukocytes Leukocytes Neutrophils and monocytes Leukocytes

ICAM-1

Unstimulated and activated endothelial cells Activated endothelial cells Activated endothelial cells Activated endothelial cells

CD11a/CD18 (LFA-1) L-selectin (LAM-1) Sialyl Lewis X CD44 (HCAM, Pgp- 1)

ICAM-1

?

P-selectin

9

9

Table V11.4.2 Chemotactic molecules in the dog

Molecule

Responding cells

IL-8 RANTES Macrophage chemoattractant protein (MCP-1) Leukotriene B4 Platelet activating factor (PAF) C5a IL-I~

Neutrophils Monocytes, eosinophils Monocytes Neutrophils Neutrophils Neutrophils Neutrophils

Cytokines

267

Dreyer et al., 1992; Meurer et al., 1993; van Riper et al., 1993; Zwahlen et al., 1994).

5.

Cytokines

Cytokines There are few reagents commercially available for the analysis of cytokines in canine immune responses. Several human and murine cytokines have an effect on canine cells and are presumably cross-reactive, although it is generally unknown if the canine receptor interacts with the same affinity with the heterologous cytokine as with the homologous cytokine. These include IL-lfi (Tamaoki et al., 1994), IL-2 (Helfand et al., 1992), IL-6 (Peng et al., 1994), IL-7 (P. J. Felsburg et al., unpublished data), IL-8 (Meurer et al., 1993; Zwahlen et al., 1994), IL-10 (Galkowska et al., 1995), IL-11 (Nash et al., 1995), and RANTES (Meurer et al., 1993). The cDNAs for several canine cytokines have been cloned, including IL-2 (Dunham et al., 1995; Knapp et al., 1995), IL-8 (Ishikawa et al., 1993; Matsumoto et al., 1994), IFN-), (Devos et al., 1992; Zucker et al., 1992), GM-SCF (Nash et al., 1991b), TNF-~ (Zucker et al., 1994), and stem cell factor (Shull et al., 1992). Canine specific polyclonal antibody has been generated against canine recombinant IL-8 (Massion et al., 1995) and canine specific monoclonal antibodies have been produced against canine recombinant IFN-7 (Fuller et al., 1994) and stem cell factor (Huss et al., 1995). Measurement of cytokines can be performed at the mRNA and protein level. These are complementary

approaches since there is not necessarily a good correlation between mRNA and protein expression. Reverse transcription-polymerase chain reaction (RT-PCR) is a useful procedure for the detection of cytokine mRNA. In addition to the use of canine specific primers for those cytokines that have been cloned, generic RT-PCR primers have been designed that amplify a portion of IL-2, IL-4, IL-6, IL-10, IL-12, IFN-7 and TNF-~ of various domestic species including the dog (Rottman et al., 1996). Protein-based assays include bioassays, ELISAs, and immunohistochemistry. Bioassays are available for IL-lfi (Klaich and Hauter, 1994; Yamashita et al., 1994a; Bravo et al., 1996), IL-2 (Helfand et al., 1992), IL-6 (Rivas et al., 1992; Yamashita et al., 1994a; HogenEsch et al., 1995), IFN- 7 (Zucker et al., 1993), GM-CSF (Nash et al., 1991b), and TNF-~ (Yamashita et al., 1994a). These assays appear to be relatively specific for their respective cytokines. However, it is often necessary to subject samples, especially serum samples, to treatment that removes or inactivates inhibitors (HogenEsch et al., 1995; Bravo et al., 1996). ELISAs for human or mouse cytokines generally do not detect canine cytokines with the possible exception of IL-8 and other chemokines. A dog-specific ELISA has been developed for IL-8 (Massion et al., 1995) and IFN-7 (Fuller et al., 1994). Polyclonal antisera against human cytokines have been used for in situ detection of IL-lfi, IL6 and TNF-c~ (Day, 1996) and TGF-fi (Vilafranca et al., 1995). Table VII.5.1 summarizes the currently available methods for evaluating canine cytokines.

Table V11.5.1 Currently available methods for canine cytokine analysis

Cytokine L-lfi L-2 L-4 L-6 L-7 L-8 L-10 L-11 L-12 L-15 IFN-7 GM-CSF TNF-~ TGF-fl Stem cell factor (SCF) RANTES

Cloning Yes

Yes

Detection method

Dog cross-reactivity

Bioassay, immunohistochemistry Bioassay, RT-PCRa RT-PCR Bioassay, RT-PCR, immunohistochemistry

Human Human, mouse

ELISA b, RT-PCR RT-PCR RT-PCR

Yes

Yes Yes Yes

Bioassay, RT-PCR, ELISA Bioassay, RT-PCR Bioassay, RT-PCR, immunohistochemistry Immunohistochemistry Immunohistochemistry, RT-PCR

a RT-PCR, reverse transcription polymerase chain reaction. b Enzyme-linked immunosorbent assay.

Human, mouse Human, mouse Human Human Human Human Human

Human

268


Cytokine receptors

7.

The high-affinity canine IL-2 receptor binds human IL-2. This feature has been used to detect canine IL-2 receptors on activated T cells and leukemic cells employing radioactively labeled (Helfand et al., 1995) or phycoerythrinlabeled (Somberg et al., 1992) human recombinant IL-2. The high-affinity IL-2 receptor consists of three chains, ~, fl, and 7. The ), chain of the IL-2 receptor has been cloned (Henthorn et al., 1994).

The basic characteristics of canine immunoglobulins and their concentrations in various body fluids is listed in Table VII.7.1 (Reynolds and Johnson, 1970; Heddle and Rowley, 1975; Halliwell and Gorman, 1989; Mazza and Whiting, 1994; Yang et al., 1995; Tizard, 1996). The molecular characterization of the canine immunoglobulin genes lags far behind those of other species. Only two of the canine immunoglobulin genes have been cloned - IgA and IgE (Patel et al., 1995). Table VII.7.2 summarizes the homology of the alpha and epsilon constant region genes with the human and murine. The mechanism and accessory molecules involved in B cell signaling and activation have not been studied in the dog. The pattern of immunoglobulin isotype development in the dog is similar to that of other mammalian species, including humans, as illustrated in Table VII.7.3.

6. T-cell Receptor Knowledge of the T cell receptor (TCR) in the dog is limited to the recent cloning of the constant regions of the canine TCR~ and TCRfl (Ito et al., 1993; Takano et al., 1994). Table VII.6.1 illustrates the identity of the canine TCR~-C and TCRfi-C amino acid sequences with those of other species.

11

Table VII.6.1

Cloned canine T-cell receptor cDNAs

Immunoglobulins

Major Histocompatibility Complex (MHC) Antigens

Amino acid homology (%) Compared with

TCR~-C

TCR/%C

Human Mouse Rat Bovine Sheep Rabbit Chicken

46 48 47 53 46 44

84 80 79 81 77 40

Historically, the dog has been a useful model for solid organ and hematopoietic stem cell transplantation (Deeg and Storb, 1994). While an understanding of the MHC (termed DLA for dog leukocyte antigen) is important in all of these applications, molecular analysis of the DLA has lagged behind that of the mouse and human as well as several agricultural animals. Early understanding of canine MHC involved primarily cellular, serological, and immunochemical analyses. The

Table V11.7.1 Properties of canine immunoglobulins

Property

IgG

IgM

IgA

IgE

IgD

Size (kDa) Concentration (mg/dl) Serum

180 000

900 000

360 000

200 000

180 000

700-2000 IgGl" 300-1400 IgG2" 300-1400 IgG3" < 1-200 IgG4" < 4-200 0.5-5 500-2200 10-30 90-1070 Yes Yes Yes Yes Yes No

70-270

20-150

0.7-72

?

0.5-7 70-370 10-54 50-160 No Yes Yes Yes Yes No

17-125 150-340 110-620 80-540 No No No Yes Yes No

No ? ? ? ? Yes

No ? ? ? ? No

Saliva Colostrum Milk Fecal extract Placental transfer Complement fixation Opsonization Neutralization Agglutination Reaginic activity


Table Vlh7.2 genes

Canine immunoglobulin

constant

region

Amino acid homology Gene

Chromosome

~gA

9.

CH1 CH2 CH3 Total

IgE

CH1 CH2 CH3 CH4 Total

?

Human

Mouse

57% 70% 82% 70%

52% 67% 73% 65%

59% 53% 62% 55% 57%

42% 42% 55% 56% 49%

Table V11.7.3 Age-related development of canine immunoglobulins

Serum concentrations (mg/dl) Age (weeks)

IgG

IgM

IgA

85% of humans. Another difference between canine and human patients is that dogs appear predisposed to producing autoantibodies to triiodothyronine (T3) rather than thyroxine (T4), whereas human patients show an equal distribution between the two. A genetic predisposition to the disease is suggested by the increased incidence in beagles, golden retrievers, Doberman pinschers, Shetland sheepdogs, great Danes, Irish setters and Old English sheepdogs. Additional evidence for a genetic component to the disease in dogs is that relatives of affected animals often have antithyroid antibodies.

Myasthenia gravis Myasthenia gravis is an autoimmune disease of humans and dogs that is characterized by muscle weakness due to a disorder of neuromuscular transmission. The pathogenesis of the disease in dogs is similar to that in humans with over 90% of affected dogs exhibiting antibodies to acetylcholine receptors. These autoantibodies, which bind at the postsynaptic membrane of the neuromuscular junction, interrupt transmission by producing a functional blockade to the binding of acetylcholine, increasing the endocytosis of acetylcholine receptors, and form immune complexes that bind complement, causing further destruction of the postsynaptic membrane.

Polymyositis Canine polymyositis is a generalized myositis that affects primarily large breed dogs. An autoimmune basis for the disease is suspected based upon the finding that approximately 50% of affected dogs have antinuclear antibodies and/or antisarcolemmal antibody. Histologically, there is a lymphocytic and plasma cell infiltration of involved muscle.

Autoimmune masticatory myopathy A myositis that is restricted to the muscles of mastication (masseter, temporalis, and pterygoid muscles) has been described in the dog. These muscles are derived from the mesoderm rather than myotomes from which other skeletal muscle is derived, and contain two distinct types of myofibers (1 and 2M). Affected dogs have circulating


282

antibodies to myofiber type 2M, and immunoglobulin deposition can be demonstrated in biopsies of affected muscles. Histologically, there is myofiber degeneration with atrophy and fibrosis and an infiltration of the affected area with lymphocytes and plasma cells.

19.

Conclusions

Although considerable advances have been made in recent years in the development of immunological and molecular reagents for studying the canine immune system, the availability of these reagents still lags behind those available for other species. These endeavors must remain a priority in order to be able to promote the dog as an experimental model. Perhaps the major value of the dog in immunological research is its great potential as a naturally occurring animal model for human disease. Not only will these models provide insight into the immunopathogenesis of the various disease homologues, they will also serve as valuable preclinical models in which to develop and evaluate immunological and genetic therapeutic intervention protocols for these diseases.

20.

References

Anderson, J. E., Ladiges, W. C., Giblett, E. R., Weiden, P., Storb, R. (1983). Polymorphism of the sixth component of complement (C6) in dogs. Animal Genet. 21,155-160. Andrews, G. A., Chavey, P. S., Smith, J. E. (1992). Production, characterization, and applications of a murine monoclonal antibody to dog erythrocyte antigen 1.1. J. Am. Vet. Med. Assoc. 201, 1549-1552. Atkins, A. M., Schofield, G. C. (1972). Lymphoglandular complexes in the large intestine of the dog. J. Anat. 113,169-178. Baker, J. A., Robson, D. S., Gillespie, J. H., Burgher, J., Doughty, M. F. (1959). A normograph that predicts the age to vaccinate puppies against distemper. Cornell Vet. 49, 158-167. Barta, O., Hubbert, N. L. (1978). Testing of hemolytic complement components in domestic animals. Am. J. Vet. Res. 39, 1303-1308. Bell, K. (1983). The blood groups of domestic animals. In Red Blood Cells of Domestic Animals (eds Agar, A. S., Board, P. G.), pp. 133-164. Elsevier Science Publishers, Amsterdam, The Netherlands. Belz, G. T., Heath, T. J. (1995a). Pathways of blood flow to and through superficial lymph nodes in the dog. J. Anat. 187, 413427. Belz, G. T., Heath, T. J. (1995b). Lymph pathways of the medial retropharyngeal lymph node in dogs. J. Anat. 186, 517-526. Bezuidenhout, A. J. (1993). The lymphatic system. In Miller's Anatomy of the Dog, 3rd edn. (ed. Evans, H. E.), pp. 717-757. W.B. Saunders, Philadelphia, PA, USA. Bistner, S. (1994). Allergic- and immunologic-mediated diseases of the eye and anexae. Vet. Clinics NA 24, 711-734.

Blum, J. R., Cork, L. C., Morris, J. M., Olson, J. L., Winkelstein, J. A. (1985). The clinical manifestations of a geneticallydetermined deficiency in the third component of complement in the dog. Clin. Immunol. Immunopathol. 24, 304-315. Bravo, L., Legendre, A. M., Hahn, K. A., Rohrbach, B. W., Braha, T., Lothrop, C. D. (1996). Serum granulocyte colonystimulating factor (G-CSF) and interleukin-1 (IL-1) concentrations after chemotherapy-induced neutropenia in normal and tumor-bearing dogs. Exp. Hematol. 24, 11-17. Breitschwerdt, E. B., Brown, T. T., DeBuyssher, E. V., Anderson, B. R., Thrall, D. E., Hager, E., Ananaba, G., Degen, M. A., Ward, M. D. (1987). Rhinitis, pneumonia and defective neutrophil function in the Doberman Pinscher. Am. J. Vet. Res. 48, 1054-1062. Bryant, B. J., Shifrine, M. (1972). Histiogenesis of lymph nodes during development of the dog. J. Reticulo. Soc. 12, 96-107. Bryant, B. J., Shifrine, M., McNeil, C. (1973). Cell-mediated immune response in the developing dog. Int. Arch. Allergy Appl. Immunol. 45,937-942. Bull, R. W., Vriesendorp, H. M., Cech, R., Grosse-Wilde, H., Bijma, A. M., Ladiges, W. L., Krumbacher, K., Doxiadis, I., Ejima, H., Templeton, J., Albert, E. D., Storb, R., Deeg, H. J. (1987). Joint report of the third international workshop on canine immunogenetics. II. Analysis of the serological typing of cells. Transplantation 43, 154-161. Burnett, R. C., Geraghty, D. E. (1995). Structure and expression of a divergent canine class I gene. J. Immunol. 155, 42784285. Callan, M. B., Jones, L. T., Giger, U. (1995). Hemolytic transfusion reactions in a dog with an alloantibody to a common antigen. J. Vet. Intern. Med. 9, 277-279. Carpenter, J. L., Myers, A. M., Conner, M. W., Schelling, S. H., Kennedy, F. A., Reimann, K. A. (1988). Tuberculosis in five Bassett hounds. J. Am. Vet. Med. Assoc. 192, 1563-1568. Carmichael, L. E., Robson, D. S., Barnes, F. D. (1962). Transfer and decline of maternal infectious canine hepatitis antibody in puppies. Proc. Soc. Exp. Biol. Med. 109, 677-681. Chabanne, L., Marchal, T., Kaplanski, C., Fournel, C., Magnol, J. P., Monier, J. C., Rigal, D. (1994). Screening of 78 monoclonal antibodies directed against human leukocyte antigens for cross-reactivity with surface markers on canine lymphocytes. Tissue Antigens 43,202-205. Cobbold, S., Metcalfe, S. (1994). Monoclonal antibodies that define canine homologues of human CD antigens: Summary of the First International Canine Leukocyte Antigen Workshop (CLAW). Tiss. Antigens 43, 137-154. Coiling, D. T., Saison, R. (1980a). Canine blood groups. I. Description of new erythrocyte specificities. Anim. Genet. 11, 1-12. Coiling, D. T., Saison, R. (1980b). Canine blood groups. II. Description of a new allele in the Tr blood group system. Anim. Genet. 11, 13-20. Couto, C. G. (1985). Clinicopathologic aspects of acute leukemias in the dog. J. Am. Vet. Med. Assoc. 186, 681-685. Couto, C. G., Krakowka, S., Johnson, G., Ciekot, P., Hill, R., Lafrado, L., Kociba, G. (1989). In vivo immunologic features of Weimaraner dogs with neutrophil abnormalities and recurrent infections. Vet. Immunol. Immunopathol. 23, 103-112. Danilenko, D. M., Moore, P. F., Rossitto, P. V. (1992). Canine leukocyte cell adhesion molecules (LeuCAMs): characterization of the CD1/CD18 family. Tissue Antigens 40, 13-21. Danilenko, D. M., Rossitto, P. V., der Vieren, M. V., Trong,

References

H. L., McDonough, S. P., Affolter, V. K., Moore, P. F. (1995). A novel canine leukointegrin, ~dfi2, is expressed by specific macrophage subpopulations in tissue and a minor CD8 § lymphocyte subpopulation in peripheral blood. J. Immunol. 155, 35-44. Day, M. J. (1996). Expression of interleukin-lfi, interleukin-6 and tumor necrosis factor-~ by macrophages in canine lymph nodes with mineral-associated lymphadenopathy, granulomatous lymphadenitis or reactive hyperplasia. J. Comp. Pathol. 114, 31-42. Deeg, H. J., Storb, R. (1994). Canine bone marrow transplantation models. Curr. Topics Vet. Res. 1,103-114. Deeg, H. J., Raft, R. F., Grosse-Wilde, H., Bijma, A. M., Buurman, W. A., Doxiadis, I., Kolb, H. J., Drumbacher, K., Ladiges, W. L., Losstein, K. L., Schoch, G., Westbrock, D. L., Bull, R. W., Storb, R. (1986). Joint report of the third international workshop on canine immunogenetics. I. Analysis of homozygous typing cells. Transplantation 41, 111-117. Delacroix, D. L., Furtado-Barreira, G., de Hemptinne, B., Goudswaard, J., Dive, C., Vaerman, J. P. (1983). The liver in the IgA secretory immune system. Dogs, but not rats and rabbits, are suitable models for human studies. Hepatology 3, 980-988. Delacroix, D. L., Furtado-Barreira, G., Rahier, J., Dive, C., Vaerman, J. P. (1984). Immunohistochemical localization of secretory component in the liver of guinea pigs and dogs versus rats, rabbits, and mice. Scand. J. Immunol. 19, 425434. Devos, K. F., Buerinck, F., Van Audenhove, K., Fiers, W. (1992). Cloning and expression of the canine interferon-gamma gene. J. Interferon Res. 12, 95-102. Dodds, A. W., Law, S. K. A. (1990). The complement component C4 of mammals. J. Biochem. 265,495-502. Dore, M., Hawkins, H. K., Entman, M. L., Smith, C. W. (1993a). Production of a monoclonal antibody against GMP-140 (Pselectin) and studies of its vascular distribution in canine tissues. Vet. Pathol. 30, 213-222. Dore, M., Korthuis, R. J., Granger, D. N., Entman, M. L., Smith, C. W. (1993b). P-selectin mediates spontaneous leukocyte rolling in vivo. Blood 82, 1308-1316. Dore, M., Simon, S. I., Hughers, B. J., Entman, M. L., Smith, C. W. (1995). P-selectin and CD18 mediated recruitment of canine neutrophils under conditions of shear stress. Vet. Pathol. 32, 258-268. Doxiadis, G., Schoen, W., Doxiadis, I., Deeg, H. J., O'Neill, G. J., Grosse-Wilde, H. (1987). Statement on the nomenclature of dog C4 allotypes. Immunogenetics 25, 167-170. Doxiadis, I., Krumbacher, K., Neefhes, J. J., Ploegh, H. L., Grosse-Wilde, H. (1986). Canine MHC biochemical definition of class I, class II, and class III determinants: similarities and differences to the human and murine systems. Immunobiology 173,264-265. Doxiadis, I., Krumbacher, K., Neefjes, J. J., Ploegh, H. L., Grosse-Wilde, H. (1989). Biochemical evidence that the DLA-B locus codes for a class II determinant expressed on all canine peripheral blood lymphocytes. Exp. Clin. Immunogenet. 6, 219-224. Dreyer, W. J., Michael, L. H., Nguyen, T., Smith, C. W., Anderson, D. C., Entman, M. L., Rossen, R. D. (1992). Kinetics of C5a release in cardiac lymph of dogs experiencing coronary artery ischemia-reperfusion injury. Circ. Res. 71, 1518-1524.

283

Dunham, S. P., Argyle, D. J., Onions, D. E. (1995). The isolation and sequence of canine interleukin-2. DNA Seq. 5,177-180. Eckersall, P. D., Conner, J. G. (1988). Bovine and canine acute phase proteins. Vet. Res. Comm. 12, 169-178. Eijima, H., Kurokawa, K., Ikemoto, S. (1986). Phenotype and gene frequency of red blood cell groups in dogs of various breeds reared in Japan. Jpn. J. Vet. Sci. 48,363-368. Eldridge, P. R., Hobart, M. J., Lachmann, P. J. (1983). The genetics of the sixth and seventh components of complement in the dog: polymorphism, linkage, locus duplication and silent alleles. Biochem. Genet. 21, 81-91. Facklam, N. R., Kociba, G. J. (1985). Cytochemical characterization of leukemic cells in 20 dogs. Vet. Pathol. 22, 363-369. Felsburg, P. J. (1994). Overview of the immune system and immunodeficiency diseases. Vet. Clinics NA 24, 629-653. Felsburg, P. J., Glickman, L. T., Jezyk, P. F. (1985). Selective IgA deficiency in the dog. Clin. Immunol. Immunopathol. 36, 297305. Felsburg, P. J., Somberg, R. L., Perryman, L. E. (1992). Domestic animal models of severe combined immunodeficiency: canine X-linked severe combined immunodeficiency and severe combined immunodeficiency in horses. Immunodeficiency Rev. 3, 277-303. Felsburg, P. J., Somberg, R. L., Krakowka, G. S. (1994). Acute monocytic leukemia in a dog with X-linked severe combined immunodeficiency. Clin. Diag. Lab. Immunol. 1,379-384. Fisher, D. J., Naydan, N., Werner, L. L., Moore, P. F. (1995). Immunophenotyping lymphomas in dogs: a comparison of results from fine needle aspirate and needle biopsy samples. Vet. Clin. Pathol. 24, 118-123. Fuller, L., Carreno, M., Esquenazi, V., Zucker, K., Zheng, S., Roth, D., Burke, G., Nery, J., Asthana, D., Olson, L., Miller, J. (1994). Characterization of anti-canine cytokine monoclohal antibodies specific for IFN-7: effect of anti-IFN-7 on renal transplant rejection. Tissue Ag. 43, 163-169. Galkowska, H., Wojewodzka, U., Olszewski, W. L. (1995). Cytokines and adherence molecules involved in spontaneous dendritic cell-lymphocyte clustering in skin afferent lymph. Scand. J. Immunol. 42, 324-330. Gebhard, D. H., Carter, P. B. (1992). Identification of canine T lymphocyte subsets with monoclonal antibodies. Vet. Immunol. Immunopathol. 32, 187-199. Giger, U., Boxer, L. A., Simpson, P. J., Lucchesi, B. R., Todd, R. F. (1987). Deficiency of leukocyte surface glycoproteins Mol, LFA-1 and Leu M5 in a dog with recurrent bacterial infections: an animal model. Blood 69, 1622-1630. Giger, U., Gelens, C. J., Callan, M. B., Oakley, D. A. (1995). An acute hemolytic transfusion reaction caused by dog erythrocyte antigen 1.1 incompatibility in a previously sensitized dog. J. Am. Vet. Med. Assoc. 206, 9-14. Gillespie, J. H., Baker, J. A., Burgher, J., Robson, D., Gilman, B. (1958). The immune response of dogs to distemper virus. Cornell Vet. 103-126. Gorman, N. T., McConnell, I., Lachman, P. N. (1981). Characterization of the third component of canine and feline complement. Vet. Immunol. Immunopathol. 2, 309-316. Gorman, S. D., Frewin, M. R., Cobbold, S. P., Waldmann, H. (1994). Isolation and expression of cDNA encoding the canine CD4 and CD8~ antigens. Tissue Antigens 43, 184-188. Greco, D. S., Harpold, L. M. (1994). Immunity and the endocrine system. Vet. Clinics NA 24, 765-782.

284

Grinden, C. B., Buoen, I. C. (1986). Cytogenetic analysis of leukemic cells in the dog. J. Comp. Pathol. 196, 623-635. Grinden, C. B., Stevens, J. B., Perman, V. (1986). Cytochemical reactions in cells from leukemic dogs. Vet. Pathol. 23, 103109. Grosse-Wilde, H., Doxiadis, G., Krumbacher, K., DekkersBijma, A., Kolb, H. J. (1983). Polymorphism of the fourth complement component in the dog and linkage to the DLA system. Immunogenetics 18, 537-540. Gruys, E., Obwolo, M. J., Toussaint, M. J. M. (1994). Diagnostic significance of the major acute phase proteins in veterinary clinical chemistry. Vet. Bulletin 64, 1009-1018. Halliwell, R. E. W., Gorman, N. T. (1989). Veterinary Clinical Immunology. W.B. Saunders, Philadelphia, PA, USA. Happ, G. M. (1995). Thyroiditis- A model canine autoimmune disease. Adv. Vet. Sci. Comp. Med. 39, 97-129. Harmsen, A. G., Muggenburg, B. A., Snipes, M. B., Bice, D. E. (1985). The role of macrophages in particle translocation from lungs to lymph nodes. Science 230, 1277-1280. Hart, I. R. (1979). The distribution of immunoglobulin-containing cells in canine small intestine. Res. Vet. Sci. 27, 269-274. Hebel, R. (1960). Untersuchungen uber das vorkommen von lymphotischen darmkrypten in der tunica submucosa des darmes von schwein, rind, schaf, hund und katze. Anat. Anz. 109, 7-27. Heddle, R. J., Rowley, D. (1975). Dog immunoglobulins. I. Immunochemical characterization of dog serum, parotid saliva, colostrum, milk and small bowel fluid. Immunology 29, 185-195. Helfand, S. C., Modiano, J. F., Nowell, P. C. (1992). Immunophysiological studies of interleukin-2 and canine lymphocytes. Vet. Immunol. Immunopathol. 33, 1-16. Helfand, S. C., Modiano, J. F., Moore, P. F., Soergel, S. A., MacWilliams, P. S., Dubielzig, R. D., Hank, J. A., Gelfand, E. W., Sondel, P. M. (1995). Functional interleukin-2 receptors are expressed on natural killer-like leukemic cells from a dog with cutaneous lymphoma. Blood 86, 636-645. Henthorn, P. S., Somberg, R. L., Fimiani, V. M., Puck, J. M., Patterson, D. F., Felsburg, P. J. (1994). IL-2R7 gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease. Genomics 23, 69-74. Hoenig, M. (1995). Pathophysiology of canine diabetes. Vet. Clinics NA 25,553-561. HogenEsch, H. (1989). The morphology and function of Peyer's patches in the dog. PhD. Thesis, University of Illinois, IL, USA. HogenEsch, H., Felsburg, P. J. (1990). Ultrastructure and alkaline phosphatase activity of the dome epithelium of canine Peyer's patches. Vet. Immunol. Immunopathol. 24, 177-186. HogenEsch, H., Felsburg, P. J. (1992a). Immunohistology of Peyer's patches in the dog. Vet. Immunol. Immunopathol. 30, 147-160.

HogenEsch, H., Felsburg, P. J. (1992b). Isolation and phenotypic and functional characterization of cells from Peyer's patches in the dog. Vet. Immunl. Immunopathol. 31, 1-10. HogenEsch, H., Housman, J. M., Felsburg, P. J. (1987). Canine Peyer's patches: macroscopic, light microscopic, scanning electron microscopic and immunohistochemical investigations. Adv. Exp. Med. Biol. 216A, 249-256. HogenEsch, H., Snyder, P. W., Scott-Moncrieff, J. C., Glickman, L. T., Felsburg, P. J. (1995). Interleukin-6 activity in dogs with


juvenile polyarteritis syndrome: effect of corticosteroids. Clin. Immunol. Immunopathol. 77, 107-110. Huss, R., Hong, D. S., Beckham, C., Kimball, L., Myerson, D. H., Storb, R., Deeg, H. J. (1995). Ultrastructural localization of stem cell factor in canine marrow-derived stromal cells. Exp. Hematol. 23, 33-40. Ishikawa, J., Suzuki, S., Hotta, K., Hirota, Y., Mizuno, S., Suzuki, K. (1993). Cloning of a canine gene homologous to the human interleukin-8-encoding gene. Gene 131, 305306. Ito, K., Tsunoda, M., Watanabe, K., Ito, K., Kashiwagi, N., Obata, F. (1993). Isolation and sequence analysis of cDNA for the dog T cell receptor Tcr0~ and Tcrfl chains. Immunogenetics 38, 60-63. Jacoby, R. O., Dennis, R. A., Griesemer, R. A. (1969). Development of immunity in fetal dogs: humoral responses. Am. J. Vet. Res. 30, 1503-1510. Jerome, S. N., Dore, M., Paulson, J. C., Smith, C. W., Korthuis, R. J. (1994). P-selectin and ICAM-1 dependent adherence reactions: role in the genesis of postischemic no-reflow. Am. J. Physiol. 266, H1316-H1321. Jezyk, P. F., Haskins, M. E., MacKay-Smith, W. E., Patterson, D. F. (1986). Lethal acrodermatitis in bull terriers. J. Am. Vet. Med. Assoc. 88, 833-839. Johnson, J. P., Hammer, C., Winkelstein, J. A. (1985). Purification of the third component of canine complement. Vet. Immunol. Immunopathol. 8,377-389. Johnson, J. P., McLean, R. H., Cork, L. C., Winkelstein, J. A. (1986). Genetic analysis of an inherited deficiency of the third component of complement in the dog. Am. J. Med. Genet. 25, 557-562. Jones, J. B., Lange, R. D., Jones, E. S. (1975). Cyclic hematopoiesis in a colony of dogs. J. Am. Vet. Med. Assoc. 166, 365367. Kawakami, T., Cain, G., Taylor, N. (1989). Establishment and partial characterization of a radiation-induced canine monocytic leukemic cell line (RK9ML-1). Leukemia Res. 13, 709714. Kay, P. H., Dawkins, R. L. (1984). Genetic polymorphism of complement Cr in the dog. Tissue Antigens 23, 151-155. Kay, P. H., Dawkins, R. L., Penhale, J. W. (1985). The molecular structure of different polymorphic forms of C3 and C4. Immunogenetics 21,313-319. Kelly, W. D. (1963). The thymus and lymphoid morphogenesis in the dog. Fed. Proc. 20, 600. Kemppainen R. J., Clark, T. P. (1994). Etiopathogenesis of canine hypothyroidism. Vet. Clincs NA 24, 467-476. Klaich, G. M., Hauter, P. M. (1994). Induction of dog IL-1 by free and liposomal encapsulated doxorubicin. Anticancer Drugs 5, 355-360. Klein, A. K., Dyck, J. A., Stitzel, K. A., Shimizu, M. J., Fox, L. A., Taylor, N. (1983). Characterization of canine fetal lymphohematopoiesis. Exp. Hematol. 11,263-274. Knapp, D. W., Williams, J. S., Andrisani, O. M. (1995). Cloning of the canine interleukin-2-encoding cDNA. Gene 159, 281282. Kolbjornsen, O., Press, C. M., Moore, P. F., Landsverk, T. (1994). Lymphoid follicles in the gastric mucosa of dogs. Distribution and lymphocyte phenotypes. Vet. Immunol. Immunopathol. 40, 299-312. Krakowka, S. (1992). Acquired immunodeficiency diseases. In Current Veterinary Therapy, XI: Small Animal Practice (eds

References

Kirk, R. W., Bonagura, J. D.), pp. 453-457. W.B. Saunders, Philadelphia, PA, USA. Krumbacher, K., van der Feltz, M. J. M., Happel, M., Gerlach, C., Losslein, L. K., Grosse-Wilde, H. (1986). Revised classification of the DLA loci by serological studies. Tissue Antigens 27, 262-268. Kubens, B. S., Krumbacher, K., Grosse-Wilde, H. (1995). Biochemical definition of DLA-A and DLA-B gene products by one-dimensional isoelectric focusing and immunoblotting. Eur. J. Immunogenet. 22, 199-207. Lefer, D. J., Flynn, D. M., Phillips, M. L., Ratcliffe, M., Buda, A. J. (1994). A novel sialyl Lewis analog attenuates neutrophil accumulation and myocardial necrosis after ischemia and reperfusion. Circulation 90, 2390-2401. Lewis, R. M. (1994a). Rheumatoid arthritis. Vet. Clinics NA 24, 697-701. Lewis, R. M. (1994b). Immune-mediated muscle disease. Vet. Clinics NA 24, 703-710. Lothrop, C. D. Jr, Warren, D. J. (1988). Correction of canine cyclic hematopoiesis with recombinant human granulocyte colony-stimulating factor. Blood 72, 1324-1328. Manning, A. M., Lu, H. F., Kukielka, G. L., Olivr, M. G., Ty, T., Toman, C. A., Drong, R. F., Slightom, J. L., Ballantyne, C. M., Entman, M. L., Smith, C. W., Anderson, D. C. (1995). Cloning and comparative sequence analysis of the gene encoding canine intercellular adhesion molecule-1 (ICAM-1). Gene 156, 291-295. Massion, P. P., Hebert, C. A., Leong, S., Chan, B., Inoue, H., Gratton, K., Sheppard, D., Nadel, J. A. (1995). Staphylococcus aureus stimulates neutrophil recruitment by stimulating interleukin-8 production in dog trachea. Am. J. Physiol. 268, L85-94. Matsumoto, Y., Mohamed, A., Onodera, T., Kato, H., Ohashi, T., Goitsuka, R., Tsujimoto, H., Hasegawa, A., Furusawa, S., Yoshihara, K. (1994). Molecular cloning and expression of canine interleukin 8 cDNA. Cytokine 6, 455-461. Mazza, G., Whiting, A. H. (1994). Development of an enzymelinked immunosorbent assay for the detection of IgG subclasses in the serum of normal and diseased dogs. Res. Vet. Sci. 57, 133-139. McSweeney, P. A., Rouleau, K. A., Storb, R., Bolles, L., Wallace, P. M., Beauchamp, M., Krizanac-Bengez, L., Moore, P., Sale, G., Sandmaier, B., de Revel, T., Appelbaum, F. R., Nash, R. M. (1996). Canine CD34: cloning of the cDNA and evaluation of an antiserum to recombinant protein. Blood 68, 1992-2003. Meurer, R., Van Riper, G., Feeney, W., Cunningham, P., Hora, D., Springer, M. S., MacIntyre, D. E., Rosen, H. (1993). Formation of eosinophilic and monocytic intradermal inflammatory sites in the dog by injection of human RANTES but not human monocyte chemoattractant protein 1, human macrophage inflammatory protein 1~, or human interleukin 8. J. Exp. Med. 178, 1913-1921. Miller, G. K., Benjamin, S. A. (1985). Radiation-induced quantitative alterations in prenatal thymic development in the beagle dog. Lab. Invest. 52, 224-231. Momoi, Y., Nagase, M., Okamoto, Y., Okuda, M., Sasaki, N., Watari, T., Goitsuka, R., Tsujimoto, H., Hasegawa, A. (1993). Rearrangements of immunoglobulin and T-cell receptor genes in canine lymphoma/leukemia cells. J. Vet. Med. Sci. 55,775-780.

285

Moore, P. F., Rosin, A. (1986). Malignant histiocytosis of Bermese mountain dogs. Vet. Pathol. 23, 1-10. Moore, P. F., Rossitto, P. V. (1993). Development of monoclonal antibodies to canine T cell receptor complex (TCR/CD3) and their utilization in the diagnosis of T cell neoplasia. Vet. Pathol. 30, 457. Moore, P. F., Rossitto, D. M., Danilenko, D. M. (1990). Canine leukocyte integrins: characterization of a CD18 homologue. Tissue Antigens 36, 211-220. Moore, P. F., Rossitto, P. V., Danilenko, D. M., Wielenga, J. J., Raft, R. F., Severns, E. (1992). Monoclonal antibodies specific for canine CD4 and CD8 define functional T lymphocyte subsets and high density expression of CD4 by canine neutrophils. Tissue Antigens 40, 75-85. Moore, P. F., Rossitto, P. V., Olivry, T. (1994). Development of monoclonal antibodies to canine T cell receptor 9'8 and their utilization in the diagnosis of epidermotropic cutaneous T cell lymphoma. Vet. PathoI. 31,597. Moore, P. F., Schrenzel, M. D., Affolter, V. K., Olivry, T., Naydan, D. (1996). Canine cutaneous histiocytoma is an epidermotropic Langerhans cell histocytosis that expresses CDI and specific/32 molecules. Am. J. Pathol. 148, 1699-1708. Moroff, S. D., Hurvitz, A. I., Peterson, M. E., Saunders, L., Noone, K. E. (1986). IgA deficiency in Shar-Pei dogs. Vet. Immunol. Immunopathol. 13, 181-188. Nash, R. A., Scherf, U., Storb, R. (1991a). Molecular cloning of the CD3e subunit of the T cell receptor/CD3 complex in dog. Immunogenetics 33,396-398. Nash, R. A., Schuening, F. G., Appelbaum, F. R., Hammond, W. P., Boone, T., Morris, C. F., Slichter, S. J.~ Storb, R. (1991b). Molecular cloning and in vivo evaluation of canine granulocyte-macrophage colony-stimulating factor. Blood 78, 930-937. Nash, R. A., Seidal, K., Storb, R., Slichter, S., Schuening, F. G., Appelbaum, F. R., Becker, A. B., Bolles, L., Deeg, H. J., Graham, T., Hackman, R. C., Burstein, S. A. (1995). Effects of rhlL-11 on normal dogs and after sublethal radiation. Exp. Hematol. 23,389-396. Nolte, M., Werner, M., Noke, J., Georgii, A. (1993). Different cytogenetic findings in two clinically similar leukemic dogs. J. Comp. Pathol. 108,337-342. O'Neill, G. J., Yand, S. Y., DuPont, B. (1978). Two HLA linked loci controlling the fourth component of human complement. Proc. Natl Acad. Sci. 75, 5165-5169. O'Neill, G. J., Lang, M., Neri, C., Deeg, H. J. (1984). C4 polymorphism in the dog: molecular heterogeneity of the C4 alpha and C4 gamma subunit chains. Immunogenetics 20, 649-654. Onions, D. E. (1984). A prospective survey of familial canine lymphosarcoma. J. Nat. Cancer Inst. 72, 909-912. Pastori, R. L., Milde, K. F., Alejandro, R. (1994). Molecular cloning of the dog homologue of the lymphocyte antigen CD28. Immunogenetics 39, 373. Patel, M., Selinger, D., Mark, G. E., Hickey, G. J., Hollis, G. F. (1995). Sequence of the dog immunoglobulin alpha and epsilon constant region genes. Immunogenetics 41,282-286. Peng, J., Frises, P., George, J. N., Dale, G. L., Burstein, S. A. (1994). Alteration of platelet function in dogs mediated by interleukin-6. Blood 83,398-403. Perk, K., Safran, N., Dahlberg, J. E. (1992). Propagation and characterization of novel canine lentivirus isolated from a dog. Leukemia 6, 1558-1578.

286

Pollock, R. V. H., Carmichael, L. E. (1982). Maternally derived immunity to canine parvovirus infection: transfer, decline, and interference with vaccination. J. Am. Vet. Med. Assoc. 180, 37-42. Popper, P., Mantyh, C. R., Vigna, S. R., Maggio, J. E., Mantyh, P. W. (1988). The localization of sensory nerve fibers and receptor binding sites for sensory neuropeptides in canine mesenteric lymph nodes. Peptides 9, 257-267. Prummer, O., Raghavachar, A., Werner, C., Calvo, W., Carbovonell, F., Steinbach, I., Fliedner, T. M. (1985). Fetal liver transplantation in the dog. Transplantation 39, 349-355. Rabanal, R. M., Ferrer, L., Else, R. W. (1995). Immunohistochemical detection of canine leukocyte antigens by specific monoclonal antibodies in canine normal tissues. Vet. Immunol. Immunopathol. 47, 13-23. Reynolds, H. Y., Johnson, J. S. (1970). Quantitation of canine immunoglobulins. J. Immunol. 105,698-703. Ricks, J., Roberts, M., Patterson, R. (1970). Canine secretory immunoglobulins: identification of secretory component. J. Immunol. 105, 1327-1333. Rivas, A. L., Tintle, L., Kimball, E. D., Scarlett, J., Quimby, F. W. (1992). A canine febrile disorder associated with elevated interleukin-6. Clin. Immunol. Immunopathol. 64, 36-45. Rivas, A. L., Tintle, L., Argentieri, D., Kimball, E. S., Goodman, M. G., Anderson, D. W., Capetola, R. J., Quimby, F. W. (1995). A primary immunodeficiency syndrome in Shar-Pei dogs. Clin. Immunol. Immunopathol. 74, 243-251. Roth, J. A., Lamox, L. G., Altszuler, N., Hampshire, J., Kaeberle, M. L., Shelton, M., Draper, D. D., Ledet, A. E. (1980). Thymic abnormalities and growth hormone deficiency in dogs. Am. J. Vet. Res. 41, 1256-1262. Roth, J. A., Kaeberle, M. L., Grier, R. L., Hopper, J. G., Spiegel, H. E., McAllister, H. A. (1984). Improvement in clinical condition and thymus morphologic features associated with growth hormone treatment of immunodeficient dwarf dogs. Am. J. Vet. Res. 45,1151-1155. Rottman, J. B., Tompkins, W. A. F., Tompkins, M. B. (1996). A reverse transcription-quantitative competitive polymerase chain reaction (RT-qcPCR) technique to measure cytokine gene expression in domestic mammals. Vet. Pathol. 33,242248. Salvador, A. C., Pereira, A. S., de Sa, C. M., Grande, N. R. (1992). Blood vasculature of the lymph node in the dog: anatomical evidence for participation of extrahilar arterial vessels in the blood supply of the cortex. Acta Anat. 143, 4147. Sandmaier, B. M., Storb, R., Appelbaum, F. R., Gallatin, W. M. (1990). An antibody that facilitates hematopoietic engraftment recognizes CD44. Blood 76, 630-636. Sargent, A. U., Austen, K. F. (1970). The effective molecular titration of the early components of dog complement. Proc. Soc. Exp. Biol. Med. 133, 1117-1122. Sargent, A. U., Johnson, S. B. (1980). The hemolytic equivalence of human, guinea pig, and canine complement proteins. Immunol. Comm. 9, 453-463. Sargent, A. U., Johnson, S. B., Richardson, A. K. (1976). The isolation and functional characterization of the first seven components of canine hemolytic complement. Immunochemistry 13,823-829. Sarmiento, U. M., Storb, R. (1988a). Characterization of class II alpha genes and DLA-D region allelic associations in the dog. Tissue Antigens 32, 224-234.


Sarmiento, U. M., Storb, R. (1988b). Restriction fragment length polymorphism of the major histocompatibility complex of the dog. Immunogenetics 28, 117-124. Sarmiento, U. M., Storb, R. (1989). RFLP analysis of DLA class I genes in the dog. Tissue Antigens 34, 158-163. Sarmiento, U. M., Storb, R. (1990a). Nucleotide sequence of a dog DRB cDNA clone. Immunogenetics 31,396-399. Sarmiento, U. M., Storb, R. (1990b). Nucleotide sequence of a dog class I cDNA clone. Immunogenetics 31,400-404. Sarmiento, U. M., Sarmiento, J. I., Storb, R. (1990). Allelic variation in the DR subregion of the canine major histocompatibility complex. Immunogenetics 32, 13-19. Sarmiento, U. M., DeRose, S., Sarmiento, J. I., Storb, R. (1992). Allelic variation in the DQ subregion of the canine major histocompatibility complex. I. DQA. Immunogenetics 35, 416-420. Sarmiento, U. M., DeRose, S., Sarmiento, J. I., Storb, R. (1993). Allelic variation in the DQ subregion of the canine major histocompatibility complex. II. DRQ. Immunogenetics 37, 148-152. Shibata, T., Abe, T., Tanabe, Y. (1995). Genetic polymorphism of the sixth component of complement (C6) in dogs. Animal Genet. 26, 105-106. Shifrine, M. N., Smith, J. B., Bulgin, M. S., Bryant, J. B., Zec, Y. C., Osburn, B. I. (1971). Response of canine fetuses and neonates to antigenic stimulation. J. Immunol. 107, 965-970. Shull, R. M., Suggs, S. V., Langley, K. E., Okino, K. H., Jacobsen, F. W., Martin, F. H. (1992). Canine stem cell factor (c-kit ligand) supports the survival of hematopoietic progenitors in long-term canine marrow culture. Exp. Hematol. 20, 1118-1124. Smith, C. W., Entman, M. L., Lane, C. L., Beaudet, A. L., Ty, T. I., Youker, K., Hawkins, H. K., Anderson, D. C. (1991). Adherence of neutrophils to canine cardiac myocytes in vitro is dependent on intercellular adhesion molecule-1. J. Clin. Invest. 88, 1216-1223. Snyder, P. W., Kazacos, E. A., Felsburg, P. J. (1993). Histologic characterization of the thymus in canine X-linked severe combined immunodeficiency. Clin. Immunol. Immunopathol. 67, 55-67. Somberg, R. L., Robinson, J. P., Felsburg, P. J. (1992). Detection of canine interleukin-2 receptors by flow cytometry. Vet. Immunol. Immunopathol. 33, 17-24. Somberg, R. L., Robinson, J. P., Felsburg, P. J. (1994). T lymphocyte development and function in dogs with X-linked severe combined immunodeficiency. J. Immunol. 153, 40064015. Somberg, R. L., Pullen, R. P., Casal, M. L., Patterson, D. F., Felsburg, P. J., Henthorn, P. S. (1995). A single nucleotide insertion in the canine interleukin-2 receptor gamma chain results in X-linked severe combined immunodeficiency disease. Vet. Immunol. Immunopathol. 47, 203-213. Somberg, R. L., Tipold, A., Hartnett, B. J., Moore, P. F., Henthorn, P. S., Felsburg, P. J. (1996). Postnatal development of T cells in dogs with X-linked severe combined immunodeficiency. J. Immunol. 156, 1431-1435. Spertini, O., Kansas, G. S., Reimann, K. A., Mackay, C. R., Tedder, T. F. (1991). Function and evolutionary conservation of distinct epitopes on the leukocyte adhesion molecule-1 (TQ-1, Leu-8) that regulate leukocyte migration. J. Immunol. 147, 942-949. Stellar, G. C., DeBeer, M. C., Lelias, J. M., Snyder, P. W.,

References

Glickman, L. T., Felsburg, P. J., Whitehead, A. S. (1991). Dog serum amyloid A protein. Identification of multiple isoforms defined by cDNA and protein analysis. J. Biol. Chem. 266, 3505-3510. Strandstrom, H. V., Rimaila-Pananen, E. (1979). Canine atypical malignant lymphomas. Am. J. Vet. Res. 40, 1033-1034. Strom, H., Thomsen, M. K. (1990). Effects of proinflammatory mediators on canine neutrophil chemotaxis and aggregation. Vet. Immunol. /mmunopathol. 25,209-217. Studdert, V. P., Phillips, W. A., Studdert, M. J., Hosking, C. S. (1984). Recurrent and persistent infections in related Weimaraner dogs. Aust. Vet. J. 61,261-263. Suzuki, Y., Stormont, C., Morris, B. G., Shifrine, M., Dobrucki, R. (1975). New antibodies in dog blood groups. Transplant. Proc. 7, 365-367. Swisher, S. N., Young, L. E. (1961). The blood group system of dogs. Physiol. Rev. 41,495-520. Swisher, S. N., Bull, R., Bowdler, J. (1973). Canine erythrocyte antigens. Tissue Antigens 3, 164-165. Sykes, G. P., King, J. M., Cooper, B. C. (1985). Retrovirus-like particles associated with myeloproliferative disease in the dog. J. Comp. Pathol. 95,559-564. Symons, M., Bell, K. (1992). Canine blood groups: description of 20 specificities. Anim. Genet. 23,509-515. Takano, M., Hayashi, N., Goitsuka, R., Okuda, M., Momoi, Y., Youn, H. Y., Watari, T., Tsujimoto, H., Hasegawa, A. (1994). Identification of dog T cell receptor fi chain genes. /mmunogenetics 40, 246. Tamaoki, J., Yamawakai, I., Takeyama, K., Chiyotani, A., Yamauchi, F., Konno, K. (1994). Interleukin-1 beta inhibits airway smooth muscle contraction via epithelium-dependent mechanism. Am. J. Resp. Crit. Care Med. 149, 134-137. Tamura, N., Nelson, R. A. (1968). The purification and reactivity of the first component from guinea pig, human, and canine sera. J. Immunol. 101, 1333-1345. Teske, E., Wisman, P., Moore, P. F., van Heerde, P. (1994). Histologic classification and immunophenotyping of canine non-Hodgkin's lymphoma: unexpected high frequency of T cell lymphomas with B cell morphology. Exp. Hematol. 22, 1179-1187. Thomas, J., Anderson, N. V. (1982). Interepithelial lymphocytes in the small intestinal mucosa of conventionally reared dogs. Am. J. Vet. Res. 43,200-203. Thompson, R. E., Reynolds, H. Y., Waxdal, M. J. (1975). Structural composition of canine secretory component and immunoglobulin A. Biochemistry 14, 2852-2860. Thompson, R. E., Reynolds, H. Y. (1977). Isolation and characterization of canine secretory immunoglobulin M. J. /mmunol. 118, 323-329. Thomsen, M. K., Strom, H. (1989). Biological variation in random and leukotriene B4-directed migration of canine neutrophils. Vet. Immunol. Immunopathol. 21,219-224. Thomsen, M. K., Thomsen, H. K. (1990). Effects of interleukinI~ on migration of canine neutrophils in vitro and in vivo. Vet. Immunol. Immunopathol. 26, 385-393. Thomsen, M. K., Larsen, C. G., Thomsen, H. K., Kirstein, D., Skak-Nielsen, T., Ahnfelt-Ronne, I., Thestrup-Pedersen, K. (1991). Recombinant human interleukin-8 is a potent activator of canine neutrophil aggregation, migration, and leukotriene B4 biosynthesis. Lab. Invest. 96, 260-266. Thrall, M. A. (1981). Lymphoproliferative disorders: lymphocy-

287

tic leukemia and plasma cell myelomas. Vet. Clin. NA 11, 321-347. Tizard, I. R. (1996). Veterinary Immunology, 5th edn. W.B. Saunders, Philadephia, PA, USA. Tomley, F. M., Armstrong, S. J., Mahy, B. W., Owen, L. N. (1983). Reverse transcriptase activity and particles of retroviral density in cultured canine lymphosarcoma cells. Br. J. Cancer 47, 277-284. Trowalk-Wigh, G., Hakansson, L., Johannisson, A., Nborrgren, L., Segerstad, C. H. (1992). Leukocyte adhesion protein deficiency in Irish setter dogs. Vet. Immunol. Immunopathol. 32, 261-280. Uribe, L. P., Henthorn, P. S., Grimaldi, J. C., Somberg, R., Suter, S., Moore, P., Felsburg, P. J., Weinberg, K. (1997). Cloning, sequencing and expression of the cDNA encoding the canine hematopoietic antigen, CD38. Blood, in press. Vaerman, J. P., Heremans, J. F. (1969a). The immunoglobulins of the dog. II. The immunoglobulins of canine secretions. Immunochemistry 6, 779-786. Vaerman, J. P., Heremans, J. F. (1969b). Distribution of various immunoglobulin containing cells in canine lymphoid tissue. Immunology 17, 627-633. Vaerman, J. P., Heremans, J. F. (1970). Origin and size of immunoglobulin A in the mesenteric lymph of the dog. Immunology 18, 27-38. van der Feltz, M. J. M., Ploegh, H. L. (1984). Immunochemical analysis of glycosylated and nonglycosylated DLA class I antigens. Immunogenetics 19, 95-108. van Riper, G., Siciliano, S., Fischer, P. A., Meurer, R., Springer, M. S., Rosen, H. (1993). Characterization and species distribution of high affinity GTP-coupled receptors for human Rantes and monocyte chemoattractant protein 1. J. Exp. Med. 177, 851-856. Vilafranca, M., Wohlsein, P., Borras, D., Pumarola, M., Domingo, M. (1995). Muscle fibre expression of transforming growth factor-ill and latent transforming growth factor-fl binding protein in canine masticatory myositis. J. Comp. Pathol. 112, 299-306. Von Dungern, E., Hirschfeld, L. (1910). Uber Nachweis der Vererbung biochemischer Strukturen. Z. Immunitatsforsch. 4, 531-540. Wagner, J. L., DeRose, S., Burnett, R. C., Storb, R. (1995). Nucleotide sequence and polymorphism analysis of canine DRA cDNA clones. Tissue Antigens 45,284-287. Wagner, J. L., Burnett, R. C., DeRose, S. A., Francisco, L. V., Storb, R., Ostrander, E. A. (1996a). Molecular analysis of DLA-DRBB1 polymorphism. Tissue Antigens 48,554-561. Wagner, J. L., Burnett, R. C., Storb, R. (1996b). Molecular analysis of the DLA-DR subregion. Tissue Antigens 48, 549553. Wagner, J. L., Burnett, R. C., DeRose, S. A., Francisco, L. V., Storb, R., Ostrander, E. A. (1996c). Molecular analysis and polymorphism of the DLA-DQA gene. Tissue Antigens 48, 199-204. Wagner, J. L., Burnett, R. C., DeRose, S. A., Francisco, L. V., Storb, R., Strander, E. A. (1996d). Histocompatibility testing of dog families with polymorphic microsatellite markers. Transplantation 62, 876-877. Walton, R., Modiano, J. F., Thrall, M. A., Wheeler, S. (1996). Bone marrow cytological findings in 4 dogs and 1 cat with hemophagocytic syndrome. J. Vet. Inter. Med. 10, 7-14. Wellman, M. L., Davenport, D. I., Morton, D., Jacobs, R. M.

288

(1985). Malignant histiocytosis in four dogs. J. Am. Vet. Med. Assoc. 187, 919-921.

Wellman, M. L., Krakowka, S., Jacobs, R. M., Kociba, G. J. (1988). A macrophage-monocyte cell line from a dog with malignant histiocytosis. In Vitro Cell. Dev. Biol. 24, 223-229. Wells, C. L., Maddaus, M. A., Eriandsen, S. L., Simmons, R. L. (1988). Evidence for the phagocytic transport of intestinal particles in dogs and rats. Infect. Immun. 56, 278-282. Whitbread, T. J., Batt, R. M., Garthwaite, G. (1984). Relative deficiency of serum IgA in the German shepherd dog: a breed abnormality. Res. Vet. Sci. 37, 350-352. Willard, M. D., Leid, R. W. (1981). Nonuniform horizontal and vertical distributions of immunoglobulin A cells in canine intestines. Am. J. Vet. Res. 42, 1573-1580. Winkelstein, J. A., Cork, L. C., Griffin, D. E., Griffin, J. W., Adams, R. J., Price, D. L. (1981). Genetically determined deficiency of the third component of complement in the dog. Science 212, 1169-1170. Winkelstein, J. A., Johnson, J. P., Swift, A. J., Ferry, F., Yolken, R., Cork, L. C. (1982). Genetically determined deficiency of the third component of complement in the dogs: In vitro studies of the complement system and complement-mediated serum activities. J. Immunol. 129, 2598-2602. Winkelstein, J. A., Sullivan, K. E., Colten, H. R. (1995). Genetically determined deficiencies of complement. In Metabolic Basis of Inherited Disease (eds Scriver, C. R., Beaudet, A. L., Sly, W. S., Valle, D. L.). McGraw-Hill Book Co., New York, USA. Winters, W. D. (1981). Time dependent decreases of maternal canine virus antibodies in newborn puppies. Vet. Rec. 107, 295-299. Wu, C. C., Bey, R. F., Loken, K. I. (1988). Purification and characterization of the Clq subcomponent of canine complement and its use in the 125I-Clq binding assay for detection of immune complexes. Am. J. Vet. Res. 49, 865-869. Yamashita, K., Fujinaga, T., Hagio, M., Miyamoto, T., Izumisawa, Y., Kotani, T. (1994a). Bioassay for interleukin-1,


interleukin-6, and tumor necrosis factor-like activities in canine sera. J. Vet. Med. Sci. 56, 103-107. Yamashita, K., Fujinaga, T., Miyamoto, T., Hagio, M., Izumisawa, Y., Kotani, T. (1994b). Canine acute phase response: relationship between serum cytokine activity and acute phase protein in dogs. J. Vet. Med. Sci. 56, 487-492. Yang, M., Becker, A. B., Simons, F. E. R., Peng, Z. (1995). Identification of a dog IgD-like molecule by a monoclonal antibody. Vet. Immunol. Immunopathol. 47, 215-224. Yang, T. J., Gawlak, S. L. (1989). Lymphoid organ weights and organ:body weight ratios of growing beagles. Lab. Anim. 23, 143-146. Youker, K., Smith, C. W., Anderson, D. C., Miller, D., Michael, L. H., Rossen, R. D., Entman, M. L. (1992). Neutrophil adherence to isolated adult cardiac myocytes. J. Clin. Invest. 89, 602-609. Young, L. E., Ervin, D. M., Yuile, C. L. (1949). Hemolytic reactions produced in dogs by transfusion of incompatible dog blood and plasma. Blood 4, 1218-1231. Young, L. E., O'Brien, W. A., Swisher, S. N. (1952). Blood groups in d o g s - their significance to the veterinarian. Am. J. Vet. Res. 13,207-213. Zucker, K., Lu, P., Esquenazi, V., Miller, J. (1992). Cloning of the cDNA for canine interferon-gamma. J. Interferon Res. 12, 191-194. Zucker, K., Lu, P., Asthana, D., Carreno, M., Yang, W. C., Esquenazi, V., Fuller, L., Miller, J. (1993). Production and characterization of recombinant canine interferon-gamma from E. coli. J. Interferon Res. 13, 91-97. Zucker, K., Lu, P., Fuller, L., Asthana, D., Esquenazi, V., Miller, J. (1994). Cloning and expression of the cDNA for canine tumor necrosis factor-alpha in E. coli. Lymphokine Cytokine Res. 13,191-196. Zwahlen, R. D., Spreng, D., Wyder-Walther, M. (1994). In vitro and in vivo activity of human interleukin-8 in dogs. Vet. Pathol. 31, 61-66.

ViII 1.

IMMUNOLOGY OF THE CAT

Introduction

During the past 20 to 30 years, there has been a growing interest in the cat as a companion animal. In many countries, the number of cats has exceeded that of dogs. For instance Switzerland with 1.3 million cats has about three times the number of dogs. As a consequence, veterinary immunologists in industry and academia have devoted increasing efforts in the study of the feline immune system, pursuing both applied and basic research. The applied research is devoted mainly to improving the cat's health by studying pathogenesis, immune reactions and diagnostic possibilities of various diseases and to the development and improvement of vaccines. Indeed, the numbers of vaccines for use in cats has grown tremendously during the last 10 years. In addition to the applied research from which cats profit directly, the cat has attracted much interest from basic research as a model for various human diseases. There were two events which triggered increased study of the feline immunology: the first was the discovery of the feline leukemia virus (FeLV) in Scotland by Jarrett's group (Jarrett et al., 1964) and the second was the isolation of the feline irnmunodeficiency virus (FIV) in California by Pedersen and coworkers (Pedersen et al., 1987). The discovery that FeLV caused transmissible lymphosarcomas in an outbred species was considered important for tumor genesis also in man. The event triggered a great number of studies relating to mechanisms of tumor development and epidemiology of FeLV. As a consequence of the hypothesis that the FeLV-induced feline oncornavirus associated cell membrane antigen (FOCMA) supposedly a nonvirus coded tumor specific antigen, (Essex et al., 1975) might protect cats against FeLVinduced tumors, many studies were initiated relating to the immune mechanisms that could be involved in protection against these tumors. When it became clear that cats are capable of spontaneously overcoming FeLV viremia, many groups started on the development of a vaccine against FeLV infection. Several FeLV vaccines, including a highly efficacious recombinant one, are now available to veterinarians. The discovery of FIV attracted much interest from basic researchers as FIV was immediately recognized as an important model for the study of HIV and AIDS (Gardner et al., 1991, Bendinelli et al., 1991). Many Handbook of Vertebrate Immunology ISBN 0-12-546401-0

research groups switched their interest to the study of FIV in cats. In the early days of Fiv research, few reagents existed to investigate the feline immune system during FIV infection. This soon changed in Europe with the support from the European Concerted Action on FIV Vaccination and after the first description of antifeline CD4 § antibodies (Ackley et al., 1990), a number of different antifeline leukocyte differentiation antigens are now available and the methods for their use have been established. To date, few assays exist that allow the quantification of feline cytokines on the protein level. However, sequences of most cytokines described in mice and other species have also been obtained in the feline system. It is the goal of this chapter to provide an overview on current state of knowledge of the cat's immune system and on the source of reagents available. The topics of the chapter on the immunology of the cat are listed in analogy to those of the other chapters in this handbook. Because little information is available on the T-cell receptor and on leukocyte traffic, no specific sections can be listed on these topics. Diseases of the immune system are important in the cat; therefore, a separate section on immunological diseases is included. The editor and authors of this chapter hope that the information may help researchers with previous experience or new interest in the immunology of the cat to gain a rapid overview on what has been done and can be done in feline immunology.

11

Lymphoid Organs and their Anatomical Position

The lymphoid organs can be classified as either central or peripheral. The central lymphoid organs of the cat are the thymus and the bone marrow which are identified as areas of lymphocyte development and differentiation. Lymph nodes, tonsils, spleen and Peyer's patches of the gut are classified as peripheral lymphoid organs (Vollmerhaus et aI., 1981, 1994; Gershwin et al., 1995). They are used as a platform for lymphoid cells which have achieved immune capability to come into contact with antigens. Thus, the peripheral lymphoid organs serve as sites of development for specific features of immunity. As far as known, the lymphoid organs of the cat show characteristics in development, structure and function Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved


290

similar to that of other mammals. Knowledge of topography and function of lymphatic tissue has become important in connection with feline retrovirus infections as model for HIV and AIDS in humans. Therefore, the information presented in this section should help identify lymphatic tissue which can be surgically removed without sacrificing the animal.

Central lymphoid organs Thymus The feline thymus is an elongated multilobed structure located in the thoracic mediastinum. Each thymic lobule is clearly divided into an outer cortex region and an inner medulla. The cortex is composed of dense aggregates (no follicles) of small lymphocytes (thymocytes) which are surrounded by reticular connective tissue. It can be seen by FACS analysis that 93% of thymic cells are stained by a feline pan-T cell marker (Tompkins et al., 1990b). The medulla shows a relatively low cellular density and consists of epitheloid reticulum cells, sparse lymphocyte populations and Hassall's corpuscles. The thymus weighs about 0.32-0.39 g (0.4% of bodyweight) in neonates; it increases in weight and size, and undergoes progressive involution in which the thymic tissue is successively replaced by connective and adipose tissue, starting in the fourth month post partum. Only efferent lymphatics are present in the thymus, which lead to the nodi lymphatici (nil.) mediastinales. The thymus is innervated by the vagus nerve and the truncus sympathicus (Vollmerhaus et al., 1981, 1994; K6nig, 1992; Gershwin et al., 1995).

Bone marrow The bone marrow in the central cavities of developing long bones is the source of hematopoietic cells-including immature lymphocytes (which are derived mainly from mitotic divisions of lymphoblasts or prolymphocytes) (Gershwin et al., 1995). Islands of hematopoietic cells and their stem cell precursors are surrounded by a supporting network of primitive reticulin-producing cells, fibroblasts, collagen and adipose tissues. Lymphocytes leaving the bone marrow by efferent lymphatic vessels either migrate to the spleen and lymph nodes directly if they participate in antibody production, or they pass through the thymus, and then to the lymph nodes if they are destined for cellular immunity. This cellular migration mostly occurs before birth, indicating that lymphoid tissues of the neonate are well developed (Friess et al., 1990; Gershwin et al., 1995).

Peripheral lymphoid organs Lymph node The main function of the lymph node is to filtrate the lymph and to sift out foreign antigenic material. The node consists of a capsule, a cortex region and a medulla. The cortex contains a dense mass of lymphocytes in which germinal centers are embedded. In these germinal centers bone marrow-derived B lymphocytes undergo differentiation into antibody-producing plasma cells. Mature B cells then move to the peripheral area (mantle) of the germinal center and then to the sinus areas in the medulla. The medulla contains large blood vessels that branch and form lymph cords. These are supported by a loose network of reticular tissue. Between these cords there is a loose network of lymphatic sinuses which contain macrophages, lymphocytes, and plasma cells. The paracortical, or T-cell-dependent area located between the medulla and the cortex area is involved in cellular immunity (Friess et al., 1990; K6nig, 1992; Gershwin et al., 1995). FACS-analysis of single cell suspensions obtained from feline popliteal lymph nodes reveals that up to 49% of the cells belong to the T-cell population (Tompkins et al., 1990). Size, cellular density and composition of the lymph node change during the lifespan. This is mostly due to antigenstimulation and consecutive enhanced 'trapping' of circulating lymphocytes followed by a transient shutdown in the exit rate of lymphocytes. Later, most of the cells in the node are derived from clones of these antigen-stimulated lymphocytes (Gershwin et al., 1995). The lymph enters the node via the afferent route at the capsular surface and exits via the efferent route at the hilus neighbored by venoles and arterioles. Spleen The main function of the spleen is vascular filtration of foreign material and removal of damaged or aged erythrocytes. In addition, the feline spleen is able to hold up to 16% of the total blood in order to support the general circulation. This can be actively done by contraction of smooth muscles infiltrating the capsule and the trabeculae of the organ. The feline spleen is classified as a reticular spleen as opposed to the sinusoid spleen of the dog (Friess et al., 1990; Vollmerhaus et al., 1994). The spleen is a large vascular organ located in the gastrosplenic ligament along the greater curvature of the stomach, 114-185 x 14-31mm in size, in the adult cat, depending on the amount of blood contained (K6nig, 1992; Vollmerhaus et al., 1994). The organ is surrounded by a capsule and divided by a trabecular framework into lobules. Central arterioles entering at the hilus continue in the neighborhood of the trabeculae as smaller straight arterioles and end as capillaries. These capillaries are embedded in a reticular network; this is the red pulp of

Lymphoid Organs and their Anatomical Position Table VIII.2.1

291

Palpable lymph nodes of the cat a

Lymph node

Topography

Numberb/Size

Lymphatic drainage

nil. Mandibulares

Postero-lateral to the proc. angularis of the mandibula, medial and lateral to the vena linguofacialis Behind the ear and caudal of the parotid gland along the vena auricularis caudalis In front of and below the cervical part of the musculus trapezius In the fork between vena thoracica lateralis and vena axillaris

2/12-15 x 8-10 x 6-8 mm

Lips, chin region, mouth cavity, cheek glands, eyelids

1-7/0.5-15 x 1-3 x 0.5-3 mm

Region of the ear, eye, forehead, neck and parotid gland

1-3/8-20 x 5-6 x 3-4 mm 1-2/3-6 x 4-5 x 2-4 mm

Dorsal area of the neck, shoulder and the forelimb Skin and subcutaneous region of the medial aspect of the upper and lower arm, lateral thoracic wall Skin of the inside of the upper and lower forelimbs, lumbal region, lateral and dorsal chest wall Inguinal and gluteal regions, in female cats the posterior half of the mamma

nil. Retro-pharyngei laterales nil. Cervicales superficiales dorsales c nl. Axillaris propius

nil. Axillares accessorii c

Along the vena thoracica lateralis from the level of the 3rd to 6th intercostal spaces

2-5/5-10 x 2-2 x 2-3 mm

nl. Inguinalis superficialis c

Embedded in adipose tissue between arteria and vena pudenda externa in the femoral canal Embedded in adipose tissue along arteria and vena epigastrica caudalis superficialis Subcutaneously in the flexor region of the knee beneath vena saphena lateralis

1/5-15 x 3-5 x 2-3 mm

nil. Epigastrici caudales c

nl. Popliteus superficialis

1-5/3-8 x 2-5 x 1-3 mm 1/6-7 x 4-5 x 4mm

Caudal part of the ventral abdominal wall and subcutis of the thigh Cutis, subcutis and muscles of the shank and hind foot

nl., nodus lymphaticus; nil., nodi lymphatici. aReferences: Vollmerhaus et aL, 1981, 1994; Meier, 1989. bOneach side of the cat. Cpalpable only in young and lean cats.

the spleen which has no afferent lymphatics. The white pulp is also embedded in a reticular network and is the actual lymphatic tissue of the spleen. It is composed of Malpighian bodies, representing the sites of B-lymphocyte differentiation which are present at or near the divisions of central arterioles. The areas surrounding the central arterioles consist of T lymphocytes and also belong to the white pulp as well. In the feline spleen, up to 65% of the cells are T-cells (Tompkins et al., 1990).

lymphoid nodules spread throughout the lamina of the gut. Their main function is the production of immunoglobulin A (IgA) along with other types of immunoglobulins. The epithelial cells covering areas of Peyer's patches can be identified as 'M' cells with micropinocytic properties, allowing the cells to sample antigens. Beneath this area of specialized epithelium there are aggregates of T cells, B cells and plasma cells. Lymphocytes that home to Peyer's patches show an adhesion molecule called VLA-4 (very late antigen) (Gershwin et al., 1995).

Tonsils The tonsils located in the pharynx consist both of T lymphocytes and lymph follicles containing B lymphocytes, but lack afferent lymphatics and unlike the lymph node, a definite capsule (Friess et al., 1990; Vollmerhaus et al., 1994; Gershwin et al., 1995). Peyer's patches The Peyer's patches are situated in the gut. With respect to function and morphology, they are analogous to the tonsils. However, there are, in addition, numerous solitary

Lymph nodes and lymph collecting ducts of the cat The anatomically most accessible lymphatic tissue are the lymph nodes. Therefore, many experimental studies involving the cat as an animal model for various diseases focus mainly on the immunological and pathological changes in lymph nodes. The lymphatic system of the cat was first described in particular by Sugimura et al. (1955, 1956, 1958, 1959). These first descriptions of size, number and weight of

292

feline lymph nodes were followed by adaptations and variations such as number of nodes and nomenclature (Vollmerhaus et al., 1981, 1994; Meier, 1989). The size of a lymph node depends on age and weight of the animal and presence or absence of pathological conditions. The largest sizes are seen under pathological conditions (Meier, i989). A vital condition for the immune functions of the lymphoid organs is the anatomical connection of the circulating blood system and the lymph vessels. The peripheral lymph nodes are connected with the blood stream via postcapillary venules in the cortex of the node. Lymphocytes exit into the lymph node by receptor-ligandbinding between their cell adhesion molecules, called integrins and selectins and high endothelial cell venules. L-selectin was found to be such a homing receptor on lymphocytes for peripheral nodes (Gershwin et al., 1995). While T cells circulate through the paracortical area, B cells circulate through the germinal centers of the cortex. They leave the lymph node through efferent lymph vessels leading to the next lymph node or eventually into lymph collecting ducts. These ducts finally empty into the venous blood system to complete the lymphocyte circulation (Vollmerhaus et al., 1981, 1994; Gershwin et al., 1995).


Table VIII.2.1. In addition, lymph nodes are indicated which are palpable only in young and lean cats. The diagrammatic outline of the lymph nodes listed in Table VIII.2.1 are indicated in Figure VIII.2.1. Physiologically nonpalpable lymph nodes of the cat The various lymph centers, their most important lymph nodes and the corresponding drainage areas of the nonpalpable feline lymph nodes are listed in Table VIII.2.2. Figure VIII.2.2 gives a schematic survey of most of the lymph nodes listed in Tables VIII.2.1 and VIII.2.2. Lymph collecting ducts of the cat The lymph collection ducts carry the lymph from the superficial and visceral lymph centers to the venous blood stream.

Palpable lymph nodes of the cat The feline lymph nodes which are palpable and constant in occurrence under physiologic conditions are listed in

Figure V111.2.1 Diagram of the palpable lymph nodes of the cat (1) nodi lymphatici (nil.) mandibulares; (2) nil. retropharyngei laterales; (3) nil. cervicales superficiales dorsalesa; (4) nodus lymphaticus (nl.) axillaris propius; (5) nil. axillares accessoriia; (6) nl. inguinalis superficialisa; (7) nil. epigastrici caudalesa; (8) nl. popliteus superficialis, apalpable only in young and lean cats (reproduced from J. Frewein and Vollmerhaus, 1994, with kind permission of Prof. Frewein and the publisher).

Figure V111.2.2 Diagram of the lymph nodes and lymph collecting ducts of the cat without the intestinale nodes (Av) anguius venosus; (Cc) cysterna chyli; (Dt) ductus thoracicus; (Tj) Truncus jugularis; (TI) Truncus lumbalis; (Tv) truncus visceralis. (1) nodus lymphaticus (nl.) parotideusC; (2) nodi lymphatici (nil.) mandibularese; (3) nil. mandibulares accessoriib; (4) nil. retropharyngei lateralese; (5) nl. retropharyngeus medialis; (6) nil. cervicales superficiales dorsalesd; (7) nl. cervicales superficialis ventralisb'C; (8) nl. cervicalis profundus mediusa; (9) nl. cervicalis profundus caudalisb; (10) nl. axillaris primae costaea; (11) nl. axillaris propriuse; (12); nil. axillares accessoriid; (13) nil. thoracici aorticia; nl. intercostalisa; (15) nl. sternalis craniales; (16) nl. sternalis caudalisa; (17) nl. epigastricus cranialisa; (18) nl. phrenicusa; (19) nil. mediastinales craniales; (20) nil. bifurcationis and pulmonalesa; (21) nil. lumbales aortici; (22) nil. iliaci mediales; (23) nil. sacrales; (24) nl. subiliacusa; (25) nl. iliofemoralisa; (26) nl. femoralisa; (27) nl. inguinalis superficialisd; (28) nil. epigastrici caudalesd; (29) nl. ischiadicusC; (30) nl. popliteus superficialis e. alnconsistent in occurrence; bAImost constant in occurrence; Cpalpable when pathologically enlarged; dpalpable only in young and lean cats; epalpable under physiologic conditions (reproduced from J. Frewein and Vollmerhaus, 1994, with kind permission of Prof. Frewein and the publisher).

Lymphoid Organs and their Anatomical Position

293

Table V111.2.2 Main lymph centers of the cat and their lymph nodes a

Lymphocentrum

Lymph node

Number

Lymphatic drainage

Lc. Parotideum

nl. Parotideus d

1-2

Lc. Mandibulare

nil. Mandibulares nil. Mandibulares access, b nil. Retropharyngei laterales ~ nl. Retropharyngeus medialis

2 1-4 1-7 1

nil. Cervicales superficiales dorsales e nl. Cervicales superficialis ventralis c'd nl. Cervicalis profundus medius b

1-3 1-2 1 (unilateral)

nl. Cervicalis profundus caudalis c nl. Axillaris proprius f nl. Axillaris primae costae b nil. Axillares accessorii e nil. Thoracici aortici b nl. Intercostalis b nl. Sternalis craniales nl. Sternalis caudalis b nl. Epigastricus cranialis b nl. Phrenicus b nil. Mediastinales craniales nl. Bifurcationis seu tracheobronchialis dexter nl. Bifurcationis seu tracheobronchialis sinister ni. Bifurcationis seu tracheobronchialis medius nl. Pulmonalis b nil. Lumbales aortici

1-6 1-2 1 3-7 1-5 1-2 1-5 1 1 1 2-8 1-2

Upper eyelid, parotid gland, parts of the upper half of the head Upper and lower lips, chin region, mouth cavity, cheek glands, eyelids See Table VIII.2.1; oral cavity and tongue, cervical section of the oesophagus and trachea, thyroid and mandibular gland, parotid gland See Table VIII.2.1 Ventral part of the neck, thoracic inlet Thyroid gland, cervical parts of trachea and oesophagus Trachea, oesophagus, thyroid gland See Table VII!.2.1 Lateral wall of the thorax See Table VIII.2.1 Peritoneum Pleura Ventral thoracic and abdominal wall, diaphragm, pericardium

1 2-7

nil. Lienales nil. Gastrici nil. Hepatici nl. Pancreaticoduodenalis nil. Jejunales nil. Caecales nil. Colici

1-3 1-4 2-4 1-2 2-20 1-3 3-9

nil. Mesenterici caudales

1-3

nil. Iliaci mediales

2-4 1-6

Lc. Retropharyngeum Lc. Cervicale superficiale Lc. Cervicale profundum Lc. Axillare Lc. Thoracicum dorsale Lc. Thoracicum ventrale Lc. Mediastinale Lc. Bronchale

Lc. Lumbale Lc. Coeliacum

Lc. Mesentericum craniale Lc. Mesentericum caudale Lc. Iliosacrale

nil. Sacrales Lc. Inguinale profundum Lc. Inguinale superficiale Lc. Ischiadicum

nl. Iliofemoralis b nl. Femoralis b nl. Inguinalis superficialis e nil. Epigastrici caudales nl. Subiliacus b nl. Ischiadicus d

Lc. Popliteum

nl. Popliteus superficialis ~

aReferences: Vollmerhaus et aL (1981,1994); Meier (1989). blnconsistent in occurrence. CAImost constant in occurrence. dpalpable when pathologically enlarged. epalpable only in young and lean cats. ~Palpable under physiologic conditions. Lc., lymphocentrum; nl., nodus lymphaticus; nil., nodi lymphatici.

1-2 1-2

1 1 1 1-5 1 1

Diaphragm; heart, trachea, thymus, oesophagus, pleura, pericardium Mainly the lung, but also heart, pericardium, mediastinum and diaphragm

Lungs Diaphragm, kidneys, adrenals, dorsal abd. wall, ovary, oviduct, uterus, testes Spleen, greater curvature of the stomach, left lobe of the pancreas; stomach, liver oesophagus, diaphragm, duodenum, pancreas Small intestine and body of pancreas Caecum, ileum Ileum, ascending and transverse colon, descending colon and caecum Descending colon and rectum Pelvic wall, pelvic limb, uterus, urinary bladder, sometimes oviduct or teStis Rectum, uterus, vagina, urinary bladder, ureter, wall of the pelvis, pelvic outlet, tail and hind limb Parts of the neighboring ventral abdominal wall, gluteal region, thigh Inguinal and gluteal regions, posterior half of the mamma; caudal part of the ventral abd. wall and subcutis of the thigh Skin, subcutis, fasciae of the thigh, anal region, hind limb See Table VII!.2.1.

294


The truncus jugularis collects the lymph from the lymph nodes of the head and throat and joins the venous angle. The truncus viscerales is formed by the efferent vessels of the lymph nodes of the coeliac and cranial mesenteric lymph centers. The truncus lumbalis collects the lymph from the pelvis, the nil. sacrales and the nll. iliaci mediales. The trunci viscerales and lumbales form the cysterna chyli which is 7-30 mm long and lies between the renal vessels and the crura of the diaphragm. The ductus thoracicus developed from the cysterna chyli is formed like a ropeladder and end as a single trunk into the venous angle. The diagrammatic outline of these ducts are seen in Figure VIII.2.2.

3.

Leukocyte Differentiation Antigens

Introduction

The development of antibodies recognizing feline leukocyte differentiation antigens is central to the study of the feline immune system in health and disease. However, the production of monoclonal antibodies can be a costly and time-consuming process and researchers studying the feline immune system seldom undertake monoclonal antibody pr vvvvoduction unless there is a pressing need reagent with a defined specificity. Thus, the identification of antibodies that recognize feline leukocyte differentiation antigens has tended to reflect areas of most active investigation, for example the discovery of feline immunodeficiency virus (FIV) fuelled the production of antibodies against the feline homologues of CD4 and CD8 in order that T lymphocyte subsets could be monitored in FIVinfected cats, and that the question of whether feline CD4 acts as a receptor for FIV could be addressed. The expression of leukocyte differentiation antigens in the feline immune system has been reviewed by Willet and Callanan (1995). This section will focus on recent progress in the study of feline leukocyte differentiation antigens, highlighting areas of similarity and difference from the human immune system.

T-cell antigens

The feline homologue of CD4 is perhaps the best studied of the feline leukocyte differentiation antigens, primarily because CD4 was identified as the primary binding receptor for human immunodeficiency virus and researchers sought to define the role of the feline homologue of CD4 in FIV infection. Expression of CD4 in the feline immune system resembles that of murine CD4 in that expression is restricted solely to helper T lymphocytes and their thymic precursors and is notably absent from monocytes and

macrophages (Ackley and Cooper, 1992). In contrast, CD4 expression in the human and rat immune systems extends to monocytes and macrophages. Indeed, CD4 expression in the human immune system has been studied extensively in relation to the cell tropism of human immunodeficiency virus (HIV) and it would appear to be widespread, with levels of CD4 being detected on eosinophils, follicular dendritic cells, megakaryocytes and microglia. The sole example of a non-T-lineage cell that expresses CD4 in the cat is the Langerhans cell (Tompkins et al., 1990b) although only a single anti-CD4 antibody, vpg39, has been demonstrated to recognize these cells. cDNAs encoding the feline homologue of CD4 have been cloned (Dumont-Drieux et al., 1992; Norimine et al., 1992) and have revealed that the feline CD4 molecule contains a 17-amino-acid insertion in D2. Structural studies predict that this insertion may affect the flexibility of the hinge region between D2 and D3. Feline CD4 is also unusual in that the first cysteine involved in intrasheet disulphide bridge in D2 of human CD4 (residues 130 and 159) has been replaced by a tryptophan residue, ruling out the possibility of a similar disulphide bridge forming in feline CD4. Several antibodies have been described which recognize feline CD4, including Fel7, vpg30-39 and cat 30A. The Fel7 antibody and the antibodies of the vpg30-39 series have been epitope mapped using soluble feline CD4 produced in CHO cells and recognize five distinct epitopes on the molecules. Whether the epitopes can be related to forfunctional a properties of CD4 such as MHC class II binding or a putative interaction with interleukin 16 has yet to be established, although the epitope recognized by vpg39 is polymorphic in nature and absent from PBMC of some cats (Willet et al., 1994a). Several antibodies have been described which recognize the feline homologue of CD8 (Klotz and Cooper, 1986; Tompkins et al., 1990b). As in other species, feline CD8 appears to exist as a heterodimer of ~ and ~ chains; immunoprecipitations with the FT2 and 3.357 antibodies yielded two distinct protein species and northern blotting analysis of mRNA from feline PBMC with a murine Ly-3 probe suggested the existence of CD813 in PBMC (Pecoraro et al., 1994b). A cDNA has been cloned encoding the feline CD8~ chain (Pecoraro et al., 1994a) and the expression product is recognized by the cross-species reactive antihuman CD8-antibody OKT8. Interestingly, the feline CD8 specific antibodies FT2, 3.357 and vpg9 do not recognize the a-chain cDNA clone when expressed on either CrFK or CHO cells suggesting that either they recognize the 0~//3 heterodimer or are/3-chain specific. Molecular cloning of the feline CD813-chain should confirm the reactivity of antifeline CD8 antibodies and establish whether feline CD8 exists solely as an ~//3 heterodimer or whether ~/~ homodimers/multimers exist. CD4 and CD8 positive lymphocytes together comprise the majority of T lymphocytes in the peripheral circulation. All CD4 and CD8 positive lymphocytes are recognized by the 43-Pan T antibody which recognizes a CD5-

Leukocyte Differentiation Antigens

like molecule (Ackley and Cooper, 1992). The 43-Pan T precipitates a single 72 kDa glycoprotein which is phosphorylated in both resting and activated T cells and is upregulated by stimulation of T cells with phorbol ester or phytohaemagglutinin. Moreover, addition of the 43 Pan-T antibody to cultures of Con A stimulated PBMC augments the proliferative response. The 43-Pan T antibody therefore displays many of the characteristics of the feline homologue of CD5. Although other Pan T antibodies have been described, these antibodies have still to be characterized further. In combination with the anti-CD4 and CD8 antibodies the 43-Pan T antibody can be utilized to enumerate T lymphocyte numbers in the peripheral blood or to define the T-cell compartment in lymphoid tissues. There is no evidence to suggest that the 43-Pan T ligand is expressed on a minority of B cells, as is observed with human CD5. Thymocytes express the ligand recognized by the Fel 5F4 antibody (P. F. Moore, unpublished data), a prospective antifeline CDla antibody. As with human CDla, the Fel 5F4 antibody also stains Langerhans cells, intra-epithelial dendritic cells and interdigitating dendritic cells in the lymph node (Tompkins et al., 1990b). Immunohistochemical studies of feline T lymphocyte subpopulations can be achieved using antipeptide reagents such as anti-CD3 (Dako), an example of a polyclonal serum raised against a conserved intercellular domain of a cell surface molecule that shows broad cross-species reactivity.

B-cell antigens The enumeration of feline B cells in peripheral blood has previously only been possible using reagents which recognize surface immunoglobulins. While cross-species reactive antibodies such as BE-5 (CD21), RFB4 (CD22) and BB20 (CD40) can be utilized for the enumeration of feline B cells the reliability of these antibodies is somewhat erratic. While true Pan-B-cell reagents for use in the cat have yet to be identified there are now good cross-species reactive antibodies in RA3.6B2 (CD45R) and CA2.1D6 (CD21). The anti-CD45R antibody is a rat antibody raised against murine B cells but cross-reacts with both human and feline cells. Although the principal reactivity of this antibody is with B cells, the ligand for the antibody (the high molecular weight form of leukocyte common antigen) is also present on murine NK cells and non-MHC restricted CTLs. The antibody has been used immunohistochemically to enumerate B cells in both frozen and paraffinembedded lymph node sections, and by flow cytometry to enumerate B cells in peripheral blood where less than 1.0% of RA3.6B2-positive cells were co-stained with a Pan-T antibody CF255 (Monteith et al., 1996). The data suggest that greater than 99% of the cells recognized in peripheral blood by RA3.6B2 were B lymphocytes. Whether this antibody will prove useful for the enumeration of B cells in diseased cats where subpopulations of leukocytes may

295 have undergone expansion remains to be seen. However, it has been used very successfully to immunophenotype feline lymphosarcomas (Jackson et al., 1996). The anticanine CD21 antibody CA2.1D6 cross-reacts well with feline B lymphocytes. B cells are also the principal CD21-expressing cell type, although follicular dendritic cells and some epithelial cells have been demonstrated to be CD21-positive in humans. The RFB9 antibody, an antihuman CD21 antibody, can be used to stain the dendritic cell network in the germinal centres of the feline lymph node; however, this antibody fails to recognize B cells in peripheral blood. Thus, the CA2.1D6 appears to be a true anti-B cell antibody and for flow cytometric analyses would be the reagent of choice. The utility of this antibody in the study of the feline immune system was illustrated by the studies of Dean et al. (1996b) where CD21 expression was shown to be mutually exclusive of expression of CD4 and CDS, and in those of Quackenbush et al. (1996) where CA2.1D6 was used to investigate the replication of feline leukaemia virus in B cells.

Adhesion molecules There has been relatively little research on adhesion molecules in the feline immune system, however some notable advances have been made. Cross-species reactive monoclonal antibodies recognizing antigens on the surface of endothelial cells have been described (Weyrich et al., 1995; Buerke et al., 1996). The antibodies recognizing Pselectin (PB1.3), ICAM-1 (RR1/1), E-selectin (Cy1787) will be of value in the study of neutrophil trafficking and adherence. The cross-species reactivity of several antibodies recognizing the fil-integrins has been evaluated and antibodies recognizing the feline homologues of VLA2 (CD49b), VLA4 (CD49d) and VLA6 (CD49f) identified (B. Willett, unpublished observations). These reagents will be of value in the study of lymphocyte migration and adhesion.

Nonlineage The search for the cellular receptor for FIV identified a monoclonal antibody, vpg15, which recognized the feline homologue of CD9 (Hosie et al., 1993; Willett et al., 1994a). Subsequently a cDNA encoding feline CD9 was cloned and characterized (Willett and Neil, 1995). Feline CD9 resembles CD9 from other species except for a unique sequence at the crown of the first predicted extracellular loop. The first extracellular loop of human, bovine and murine CD9 contains a putative site for N-linked glycosylation; this is absent from feline CD9 (Willett and Nell, 1995). Despite this divergence of amino acid sequence, the feline CD9 clone proved to be functional in assays of B-cell migration (Shaw et al., 1995). CD9 is expressed on

296


activated but not resting T cells and thus may be used as a marker for activation. T cell activation can also be evaluated using the 9F23 antibody which recognizes the interleukin-2 receptor alpha (IL2-R~) chain. This antibody recognizes a binding site on the IL-2R0~ distinct from the IL-2-binding site and has been used to evaluate the responsiveness of feline PBMC to mitogens in FIV-infected cats. The authors concluded that induction of IL2-R0~ expression on Con A-stimulated PBMC was significantly depressed in FIV-infected cats (Ohno et al., 1992a). A cDNA encoding feline IL-2R0~ has been cloned and expressed in CrFK cells. The expression product binds recombinant human IL-2 and is recognized by the 9F23 antibody (Goitsuka and Hasegawa, 1995). Monoclonal antibodies have been generated which define feline bone marrow erythroid (FeErl), myeloid (FeMy) and lymphoid (FeLy) cell lineages (Groshek et al., 1994). Although the identity of the antigens recognized by these antibodies remains to be established, they should prove useful reagents in the immunophenotyping of feline haemopoietic neoplasia.

NK cells

There has been a single report of the use of an antibody specific for feline NK cells. The study by Zhao et aI. (1995) utilized a cross-species reactive antihuman CD57 monoclonal antibody to evaluate LAK cells in FIV-infected cats.

CD57 is expressed by approximately 50% of resting NK cells in man, but is rapidly lost after activation. It is also expressed on a subset of T cells and it is this CD57 § T cell subset that appears to be elevated in HIV-infected individuals. A list of some of the feline leukocyte differentiation antigens identified to date is shown in Table VIII.3.1.

Conclusions

The identification of antibodies that can be used for the enumeration of feline lymphocytes has provided researchers in feline immunology with the opportunity to study the major lymphocyte subsets in the feline immune system in health and disease. However, there is clearly a pressing need for reagents specific for NK cells and monocytes. So far, screening of antibodies against leukocyte differentiation antigens of other species has failed to identify cross-species reactive antibodies. Molecular cloning of feline leukocyte differentiation antigens may provide a source of pure antigen for immunization; specificities that have proven intractable may then be obtained by either expressing the cDNA in murine cells and using the transfected cells to immunize mice, or mice may be inoculated directly with the eukaryotic expression vector DNA itself, i.e. DNA immunization. Previous studies have illustrated the similarities and differences between the immune systems of the cat and man, the species-specific patterns of CD4 expression should remind

Table V111.3.1 Feline leukocyte differentiation antigens for which specific monoclonal antibodies have been identified Specificity

Antibody

CD4

Fel7, vpg30-39, cat 30A

CD8

FT2, vpg9, 3.357, OKT8

CD5 CD9 CD10 CD18 CD21 CD25 CD29 CD35 CD49b CD49d CD49f CD45R CD54 CD62E CD62L CD62P

43 Pan-T vpgl 5, FMC56 J5 MHM23 CA2.1 D6 9F23 4B4 1o5 16B4 44H6 4F10 RA3.6B2 RR1/1 Cy1787 huDREG-200 PB1.3

Accession n u m b e r

CD8a-D16536 L35275, D30786

D16143 U27351

References

Ackley et aL (1990); Tompkins et aL (1990b); Dumont-Drieux et al. (1992); Norime et al. (1992); Willett et al. (1994a) Klotz and Cooper (1986); Tompkins et aL (1990b); Willett et al. (1993); Pecoraro et al. (1994a) Ackley and Cooper (1992) Hosie et al. (1993); Willett et al. (1994a) Horton et al. (1988) Dakopatts L t d a Dean et al. (1996b); Quackenbush et al. (1996) Ohno et al. (1992b) Coulter Immunology L t d b Aasted et al. (1988) Serotec Ltd c Serotec Ltd Serotec Ltd Pharmingen d Weyrich et al. (1995) Weyrich et al. (1995) Buerke et al. (1996) Weyrich et al. (1995)

aDako Ltd, 16 Manor Courtyard, Hughenden Avenue, High Wycombe, Bucks HP13 5RE, UK. bCoulter Electronics Ltd, Northwell Drive, Luton, Beds LU3 3RH, UK. CSerotec, 22 Bankside, Station Approach, Kidlington, Oxford OX5 1JE, UK. dpharmingen Deutschland GmbH, Flughafenstrasse54, Haus A, 22335 Hamburg, Germany.

Cytokines

researchers in immunology that we cannot simply extrapolate from the human or murine immune systems and expect the same rules to apply in other species. Even when the feline homologue of a human leukocyte differentiation antigen has been cloned and sequenced, functional studies should follow to confirm that the molecule has the same function in the cat as in man. The knowledge gained by such studies will benefit both the study of feline immunology, and the understanding of the function of the immune system in general.

4.

Cytokines

Cytokines are molecules which are produced and secreted by leukocytes and several other cells. They act as intercellular mediators similar to hormones. The many lymphokines, monokines, interleukins, interkrines, chemokines and hormones, activating or inhibiting factors, or even growth factors are now generally and collectively known and described as cytokines. These factors are important for the differentiation and division of hematopoietic stem cells, for the activation or inhibition of lymphocyte functions and lymphocyte proliferation, and for the activation of phagocytes. In addition, they can function as chemokines (chemoattractants) and as cytotoxins. They act mostly in paracrine action on cells other than those from which they originate. However, they may also regulate the cell that produces them (autocrine action). Communication between immune regulator and effector cells, between antigen-presenting cells, lymphocytes and other cells occurs not only through direct cell to cell contact but also by secreting a plethora of soluble factors, leading to an intricate network between these cells. During the last 10 years it has become clear that the activation of the cellular (T helper 1 pathway TH1) and humoral (T helper 2 pathway TH2) arms of the immune system are driven by different sets of cytokines (Mosmann and Coffman, 1989). It is mainly in this context that interest in feline cytokines, especially in connection with retrovirus and coronavirus infections, has arisen during the early 1990s. Several feline cytokines have been cloned and sequenced and some have also been expressed. However, for most feline cytokines no specific antibodies are available that can be used for the detection of the cytokines in organ sections by immunological methods or for their quantification in cell culture supernatants or in body fluids. In some cases, antibodies specific for cytokines of other species show immunological cross-reactivity that allows application in the feline system. In this section, the known feline cytokines are listed together with information on their sequence, cross-reactivity with those of other species, cell source, function and methods of detection and quantification.

297 IL-1

Goitsuka et al. (1987) were the first to describe IL-1 at the protein level in cats. They showed that IL-1 is released by LPS-stimulated alveolar macrophages and by peritoneal exudate cells collected from cats with feline infectious peritonitis (FIP). Three isoforms were described, with isoelectric points of 4.1, 4.8 and 5.3, respectively. It is unclear which of these isoforms correspond to the human IL-I~ and IL-lfl. Hasegawa and Hasegawa (1991) demonstrated by in situ hybridization IL-10~ mRNA to be produced by macrophages present in the inflammatory lesions in cats with FIP. Induction of IL-1 by LPS-stimulated macrophages was also confirmed by Daniel et al. (1993). The sequence of feline IL-1 has not been published.

IL-2

IL-2 which was originally designated T-cell growth factor (TCGF) is produced by lectin- or antigen-stimulated mature T-lymphocytes; the gene coding for IL-2 is located on the cat's chromosome B 1 (Seigel et al., 1984). Tompkins et al. (1987) described a cell culture assay that allowed quantification of feline IL-2. Recombinant human IL-2 is highly capable of stimulating feline T-lymphocytes, an observation made by many research groups but never specifically investigated and published. After systemic application, human IL-2 induced eosinophilia in cats (Tompkins et al., 1990a). Feline IL-2 has been sequenced and expressed in COS cells; it consists of 154 amino acids, including a putative signal sequence, and has 81%, 69%, 60% and 64% identity to human, bovine, murine and rat IL-2, respectively (Cozzi et al., 1993; for Accession number see Table VIII.4.1). Feline IL-2 shows a similarity of 90% with canine IL-2 (Dunham et al., 1995). Interestingly, while recombinant human IL-2 promotes proliferation of both, human and feline leukocytes, recombinant feline IL2 only promotes proliferation of feline cells, but not human cells (Cozzi et al., 1995). Around 20% of feline lymphocytes in the peripheral blood stream are positive for the IL-2 receptor (Iwamato et al., 1989); in that study, the IL2 receptor was detected by a monoclonal antibody to human IL-2 receptor cross-reacting with the feline counterpart. In feline immunodeficiency virus (FIV) infection, expression of IL-2 is markedly inhibited (Tompkins et al., 1989a; Bishop et al., 1992; Lawrence et al., 1992, 1995). In conjunction with nucleoside analogues and other cytokines, IL-2 has been used with some success to treat feline leukemia virus (FeLV) infections (Zeidner et al., 1990, 1993).

IL-4

Feline interleukin-4 has been cloned and sequenced by Schijns et al. (1995a; for EMBL Accession number see

298


Table V111.4.1 EMBL GenBank Accession numbers, characteristics and references of characterized feline cytokines Gene product

Accession no.

Length (bp)

Last update (m/y)

Reference

IL-1/~ IL-2

M92060 L25408 L19402 U39634 U82193 X87408 D 13227 L16914 U39569

804 462 (partial) 779 561 284 (partial) 521

9/93 11/94 10/93 2/97 1/97 10/95

Daniel et aL (unpublished data)

724 737

3/94 11/95

IL-4 IL-6 IL-10 IL-12 (p35) IL-12 (p40) IL-16 IFN-fl IFN-~, TNF-~ TNF-R (p80) TNF-R (p60) SCF (stem cell factor) MGF (mast cell growth factor) NGF-fl (nerve growth factor-/~)

U83184 Y07761 U83185 Y07762 AF003701 U81267 X86972 D30619 M92061 U82193 X5400 U51429 U72344 D50833 U82188 U82190

12/96 12/96 390 561 543 567 705 284 (partial) 1722 247 (partial) 542 (partial) 953 430 136

Table VIII.4.1). The IL-4 nucleotide sequence was found to be 83%, 82%, 80%, 79%, and 61% homologous to that of IL-4 from killer whale, pig, human, manatee, and rat, respectively. Dean et al. (1996a) measured the level of mRNA expression in peripheral and intestinal lymph nodes during the early phase of FIV infection and found that increased levels of IL-4 mRNA levels were paralleled by increased IL-10 mRNA expression.

IL-6

Feline IL-6, which was originally found to have a molecular weight of 30000-40000, has biological properties similar to IL-6 of human and murine origin but is not neutralized by antihuman IL-6 antiserum (Ohashi et al., 1989; Goitsuka et al., 1990). Feline IL-6 was sequenced (Bradley et al., 1993; Ohashi et al., 1993; for the EMBL Accession number see Table VIII.4.1) and was found to be 752 bp long. It shows homology of 81%, 76%, 63%, and 61% with pig, human, rat, and mouse IL-6, respectively. The predicted amino acid sequence exhibits 66%, 53%, 37%, and 30% homology with pig, human, rat, and mouse IL-6, respectively. After transfection with IL-6 cDNA, Crandell feline kidney cells (CFK) produced biologically active proteins that showed hybridoma growth-promoting activity (Ohashi et

2/97 3/96 6/96 9/93 1/97 3/93 6/96 10/96 2/97 1/97 1/97

Cozzi et al. (1993) Lerner and Elder (unpublished data) Schijns et al. (1995a) Ohashi et al. (1989) Bradley et al. (1993) Scott and O'Reilly (unpublished data) Fehr et al. (1997) Schijns et al. (1997) Fehr et al. (1997) Schijns et al. (1997) Leutenegger et al. (1998) Lyons et al. (1997) Schijns et al. (1995b) Argyle et al. (1995) Daniel et al. (1993) Lyons et al. (1997) McGraw et al. (1990) Duthie et al. (1996) Duthie et al. (1996) Dunham and Onions (1996b) Lyons et aL (1997) Lyons et al. (1997)

al., 1993). It is not clear how the difference between the

apparent molecular weight of 30000-40000 described (Ohashi et aI., 1989; Goitsuka et al., 1990) and the predicted molecular weight is explained. In humans, IL-6 is known to be important in the differentiation of activated B cells into Ig-secreting cells (Chen-Kiang, 1995). FIP and FIV infections are diseases in which B cells are greatly stimulated. The observation by Goitsuka et al. (1990) and Ohashi et al. (1992) that in cats with FCoV and FIV infection plasma IL-6 activity was significantly higher than in healthy controls, suggests that in the cat also, IL-6 plays an important role in B-cell activation. IL-6 was produced by peritoneal exudate cells collected from cats with FIP (Goitsuka et al., 1990) which suggests that macrophages might be an important origin of IL-6.

IL-IO

Feline IL-10 was recently cloned and sequenced by Scott and O'Reilly (1993; for EMBL Accession number, see Table VIII.4.1) and expressed in Escherichia coli (Leutenegger et al., 1998b). In mice, IL-10 is known to inhibit antigen-specific T-cell activation by suppressing IL-12 synthesis (D'Andrea et al., 1993). This leads to downregulation of antigen presentation and accessory cell functions of monocytes, macrophages, Langerhans cells and

Cytokines

299

Table V111.4.2 Homologies between known IL-12 sequences of different species: percentages of nucleotide (NA) and amino acids (AA) identity between the feline, canine, human, bovine, porcine and murine IL-12-p35 (top) and p40 (bottom) sequences

NA (%) AA (%)

Feline IL-12

p35 Feline IL-12 Canine IL-12 Human IL-12 Bovine IL-12 Porcine IL-12 Murine IL-12

91.5 87.8 82.0 85.3 57.9

p40 Feline IL-12 Canine IL-12 Human IL-12 Bovine IL-12 Porcine IL-12 Murine IL-12

91.5 87.8 82.0 85.3 57.9

Canine IL-12

Human IL-12

Bovine IL-12

Porcine IL-12

Murine IL-12

93.3

89.9 88.0

87.4 nd 86.9

85.8 87.4 85.8 nd

66.8 69.4 73.1 nd 67.5

85.0 81.1 83.4 55.6

93.3 85.0 81.1 83.4 55.6

83.1 84.5 60.2

89.2 59.3

89.9 88.0

87.4 nd 86.9

83.1 84.5 60.2

dendritic cells. IL-10 is considered to be a potent immunosuppressant, both in vitro and in vivo and it attracts much interest as a potentially important immunoregulatory protein in the control of inflammatory, autoimmune and other immune-mediated diseases (de Vries, 1995). No in vitro assays are available to quantify feline IL-10. When IL-10 mRNA was determined by reverse transcriptionpolymerase chain reaction (RT-PCR) in LPS stimulated alveolar macrophages, it was reported to be significantly increased in FIV infected cats (Ritchey and Tompkins, 1996). In FIV infection, production of IL-10 mRNA in different lymphnodes was found to be increased after onset of viremia (Dean et al., 1996a).

IL-12 As with other species, feline IL-12 is a heterodimeric protein consisting of 2 chains (p35 and p40) which are linked through disulfide bonds. While p35 was sequenced by Bush et al. (1994), both chains were sequenced and the sequences deposited (Fehr et al., 1998; Schijns et al., 1996; for EMBL Accession number see Table VIII.4.1). IL-12, originally known as natural killer cell stimulatory factor (NKCSF, Kobayashi et al., 1989), is a key cytokine of the TH1 pathway inducing IFN-7 (Trinchieri, 1995). Feline IL12 is closely related to the IL-12 of other species (Table VIII.4.2). Using RT-PCR, Rottmann et al. (1996) measured IL-12 and IL-10 expression in bronchial lymph nodes of FIV positive cats with experimental Toxoplasma gondii infection. After T. gondii infection, levels of IL-12 and IL10 mRNA were decreased in FIV-negative cats while FIV

89.2 59.3

59.7

85.8 87.4 85.8 nd 59.7

66.8 69.4 73.1 nd 67.5

infected cats did not show this reduction. These results suggest that in early asymptomatic FIV infection cytokine regulation is impaired.

IL-16 IL-16, formerly known as lymphocyte chemoattractant factor (LCF) is a chemoattractant factor produced by CD8 § T cells with predominant chemotactic effects for CD4 § T cells (Cruikshank and Center, 1982). Although LCF does not induce T cell proliferation in lymphocytes, the factor induces IL-2 receptor and MHC II (HLA-DR) upregulation. In vitro, IL-16 is secreted from lymphocytes after Con A, histamine or serotonin stimulation (Center et al., 1983; Laberge et al., 1995, 1996). Although mRNA for IL-16 is also detectable in CD4 § cells, the protein is translated and stored in biologically active form mostly in CD8 § cells (Theodore et al., 1986). After stimulation by histamine, IL-16 is secreted within 4 h. The T-cell specific chemoattractant factor was described as a 14 kDa protein which appears to be linked noncovalently to form a tetrameric bioactive molecule with a mass of 56 kDa (Cruikshank and Center, 1982). At that time, only IL-1 was known to exist in multimeric forms with various degrees of bioactivity (Furutani et al., 1986). The sequencing of the feline IL-16 cDNA revealed that codon 26 which is deleted in some of the human and also in some of the African green monkey genes (Bayer et al., 1995) appears to be deleted also in the feline gene (Table VIII.4.3; Leutenegger et al., 1998a).

300


Table VIII.4.3 Homologies of nucleotide (N) and amino acid (AA) sequenceS of recombinant IL-16 (Needleman and Wunsch Algorithm)

N (%) AA (%)

Human

AGM 1

Feline

Human Africa green monkey (AGM) Feline

-95.4% 84.6%

96.7% 86.9%

85.6% 88.9% --

1African green monkey.

acute phase of FIV infection, IFN-7 and IL-12 mRNAs rise transiently to very high levels; thereafter these cytokines return to baseline concentrations (Dean et al., 1996a). In contrast, while the mRNA levels of IFN- 2 and IL-12 return to the original concentrations, IL-4 and IL-10 mRNAs remain elevated. These results suggest that during early FIV infection a TH1 immune response is triggered which later switches to a TH2 type of immune response. It has to be stressed that studies dealing with expression of IL-12 and IFN-7 are based on quantification of mRNA expression: it is important that these findings are confirmed by quantification of the respective proteins.

IL-18 A novel cytokine designated interferon-y-inducing factor (IGIF) was described in the human and murine system (Okamura et al., 1995; Micallef et al., 1996; Ushio et al., 1996). This cytokine, which has also been designated ILl8, has been cloned, sequenced and expressed from a human cDNA library (Ushio et al., 1996). In synergy with IL-12, IL-18 was found to induce IFN-7 and to decrease IL10 expression. The feline counterpart of IL-18 was amplified from alveolar macrophages by RT-PCR (Argyle et al., 1996).

IFN-~ IFN-~ has not yet been sequenced. However, based on its cross-species activity, recombinant human IFN-~ has been reported to be successful for the treatment of FeLV infection (Weiss et ai., 1991).

IFN-p The feline analogue to IFN-fl was sequenced by Lyons et al. (1993; for EMBL Accession number see Table VIII.4.1). In contrast to IFN-~, IFN-fl is strictly species specific. No information is available on the effect of feline IFN-fl.

IFN-~/ Feline IFN- 7 has recently been sequenced after RT-PCR amplification (Argyle et al., 1995; Schijns et al., 1995b; for EMBL Accession number see Table VIII.4.1). At the nucleotide level, it shares 78% and 63% homology with the cDNA of human and murine IFN-2. At the amino acid level, the feline IFN- 7 shares 63% and 43% homology with human and murine homologs, respectively. For many years, IFN-7 has been known to have profound effects on the different functions of the immune system, especially on the TH1 pathway (Young and Hardy, 1995). In cats, IFN-7 activity has been studied only in FIV infection. During the

TNF-~ TNF-~ has been sequenced (McGraw et al., 1990; Daniel et al., 1993; Lyons et al., 1993; for EMBL Accession number see Table VIII.4.1) and expressed in E. coli as functional protein (Rimstad et al., 1995). The biologically active protein had a molecular mass of 17 kDa. Feline TNF-~ immunologically cross-reacts with antibodies specific for human TNF-~ (Lehmann et al., 1992; Rimstad et al., 1995). TNF-~ production is increased in FIV infected cats (Lehmann et al., 1992) probably reflecting increased production by macrophages infected by FIV (Lin and Bowman, 1993). FeLV infection of macrophages also has been reported to trigger increased TNF-~ production (Khan et al., 1993). In a L929 cytotoxic assay, TNF-~ was found to display CD50 activity at 15 ng/ml (Rimstad et al., 1995). Cats given recombinant feline (rf)TNF-~ intravenously manifested the typical biological effects of TNF-~, including fever, depression, and piloerection. The rfTNF-0~ upregulated IL-2 receptor and MHC-II antigen expression on peripheral blood mononuclear cells stimulated in vitro, but had no effect on TNF-0~ receptor and MHC I antigen expression (Rimstad et al., 1995). When BAL cells collected from cats with long-term FIV infection were stimulated by LPS or Con A and phorbol myristate acetate, less TNF-a was produced than by cells from cats not infected by FIV (Ma et al., 1995). However, in the acute phase of FIV infection, significantly more TNF-~ was produced than in noninfected cats. According to Kraus et al. (1996) expression of FIV p24 during development of viremia during the acute phase of FIV infection is closely associated with expression of TNF-~, which suggests a close interrelationship between FIV and TNF-~ expression. TNF-~ expression was detected in feline hearts shortly after endotoxin application (Kapadia et al., 1995). Ohno et al. (1993) demonstrated that TNF-~ induces apoptosis in CmFK cells chronically infected by FIV while apoptosis was not found in noninfected cells. These findings may be important in the understanding of the pathogenesis of FIV induced immunosuppression. The feline TNF-receptor was recently sequenced (Duthie et al., 1996; for EMBL Accession number see Table VIII.4.1)

The Major Histocompatibility Complex Stem cell factor Stem cell factor (SCF) has been found to be an essential hematopoietic cytokine that interacts with other cytokines to facilitate survival of hematopoietic stem and progenitor cells, to influence their entry into the cell cycle and to stimulate their proliferation and differentiation (Hassan and Zander, 1996). Two isoforms of feline stem cell factor (fSCF) have been sequenced by RT-PCR and expressed in E. coli (Dunham and Onions, 1996a,b; for EMBL Accession number see Table VIII.4.1), The two isoforms had 274 amino acids and 246 amino acids. Feline SCF shows a high degree of homology to the SCFs of other species at both the nucleic acid and protein level. In vitro, the recombinant protein was found to induce cell proliferation in different cell lines (EC50 4-40 ng/ml). When injected into specific pathogen-free (SPF) cats, SCF was found to induce neutrophilia and to increase the number of peripheral blood colony forming units (Dunham and Onions, 1996b). Feline SCF may prove to be a useful cytokine for therapy of retrovirus induced anemias and neutropenias.

Mast cell growth factor The mast cell growth factor (MGF) stimulates growth of mast cells. The sequence of feline MGF (Lyons et al., 1993; for EMBL Accession number see Table VIII.4.1) shows a 37% similarity with that of feline SCM sequenced by Dunham and Onions (1996b; for EMBL Accession number see Table VIII.4.1).

Nerve growth factor The human nerve growth factor (NGF) consists of a family of factors responsible for the survival, differentiation and functional activities of sensory and sympathetic neurons in the peripheral nervous system (Barde, 1990). It also supports the development and functional activities of cholinergic neurons in the central nervous system. The 7S form of NGF is a complex of three proteins (0~,fi and 7), The 26 kD fi subunit is a homodimer of two disulfide-bonded proteins with a length of 118 amino acids and displays the biological activity of NGF. Feline NGF-fl has been sequenced (Lyons et al., 1993; for EMBL Accession number see Table VIII.4.1). However, the biological effects of the feline NGF-fi have not been investigated thoroughly.

Acknowledgements Some of the authors own work was supported by Swiss National Science Foundation grant no. 31-42486.94. The authors are indebted to the Union Bank of Switzerland on behalf of a customer and the Winn Foundation, New Jersey, USA for financial support.

301

11


Introduction Early studies on the feline major histocompatibility complex (MHC) by Pollack et al. (1982) using in vitro lymphocytotoxicity assays suggested that cats fail to develop lymphocytotoxic antibodies in response to pregnancy or transfusion. Moreover, while immunization with foreign cells induced lymphocytotoxic antibodies, the response was not allospecific, as observed in other species. Similarly, only weak mixed lymphocyte reaction (MLR) responses were detected between unrelated cats of different breeds. The authors concluded that there may be limited polymorphism in the feline MHC. Subsequent studies by Winkler et al. (1989) investigated the development of cytotoxic antibodies in the cat following skin grafting between unrelated cats. The alloantisera generated displayed lymphocytotoxicity and permitted the identification of six clusters of overlapping feline MHC (termed FLA) specificities. Using these sera the authors were able to define FLA haplotypes and show that the specificities segregated as a single Mendelian complex.

Genetic characterization of the feline major histocompatibility complex The genetic characterization of the feline major histocompatibility complex MHC has been reviewed in detail by Yuhki (1995). The feline MHC class I and II (FLA I and FLA II) loci map to the centromeric region of chromosome B2. The FLA I molecule is encoded from a single open reading frame and gives rise to a 363 amino acid (a.a.) protein similar in structure to human HLA I. Following a 24 a.a. leader sequence there are three extracellular domains of 90 a.a. (al), 92 a.a. (a2) and 92 a.a. (a3), a 31 a.a. transmembrane domain and a 34 a.a. cytoplasmic domain. Cysteine residues at positions 101, 164, 203 and 259, and the predicted site for N-linked glycosylation (amino acids 86-88) are conserved between feline, human and murine class I molecules (Yuhki and O'Brien, 1988). Interestingly, Winkler et al. (1989) were able to identify only one transcriptionally active MHC class I locus (with two alleles), perhaps explaining previous reports suggesting limited diversity in the feline MHC. However, abundant polymorphisms were observed at both the MHC class I and class II loci. Screening of feline cDNA libraries using human MHC class II specific (DRA and DRB) probes identified three DRA and DRB equivalents and suggested the existence of at least two DRA and two DRB loci. Screening of the libraries with human MHC class II specific (DQA and DQB) probes failed to identify cross-hybridizing clones,

302

suggesting divergence at this locus. Feline MHC class II DRA molecule consists of a 25 a.a. leader sequence followed by an 84 a.a. al domain, a 107 a.a. a2 domain, a 23 a.a. transmembrane domain and a 15 a.a. cytoplasmic domain. The DRB molecule consists of a 29 a.a. leader sequence followed by a 95 a.a. bl domain, 104 a.a. b2 domain, 23 a.a. transmembrane and 16 a.a. cytoplasmic domain. Interestingly, although polymorphic residues were observed between feline MHC DRA chains, none of the mutations resided in either of the al domains, the domains of the molecule containing the antigen recognition site. In contrast, polymorphisms were observed in the b l domain of feline MHC DRB, in the region comprising the antigen recognition site (Yuhki, 1995).


(Willett et al., 1995). These antibodies were generated as a fortuitous byproduct of feline immunodeficiency virus research, both antibodies resulting from fusions of splenocytes from mice immunized with purified FIV. It has been shown that as lentiviruses bud from cells they incorporate a range of cellular proteins into the viral envelope (Arthur et al., 1992). FIV appears to incorporate a significant quantity of MHC class II molecules and several groups have reported anti-MHC class II antibodies predominating during immunization of mice with FIV. Flow cytometric analysis of feline peripheral blood mononuclear cells using the 42-3H2 antibody revealed that MHC class II molecules are expressed on the majority of T and B lymphocytes (Rideout et al., 1990). Importantly, both resting and activated T cells express MHC class II molecules, giving rise to a characteristic bimodal histogram when MHC class II expression is Biochemical characterization of feline MHC analysed on lymphocytes. The high-intensity peak conantigens sists predominately of B lymphocytes whereas the lowEarly studies by Neefjes et al. (1986) analysed the intensity peak consists predominately of T lymphocytes (Rideout et al., 1990; Willett and Callanan, 1995). In the biochemical characteristics of feline MHC molecules. FIV-infected cat higher levels of M H C class II expression Detergent extraction followed by immunoprecipitation demonstrated abundant MHC class I molecules, and low are detected on a subset of CD8 § lymphocytes which levels of MHC class II antigens in unstimulated human usually express reduced levels of MHC class II (CD8]~ PBLs. In contrast, similar analyses of feline PBLs demon- suggesting that this subpopulation may represent actistrated high levels of both M H C class I and MHC class vated CD8 + lymphocytes (Willett and Callanan, 1995). II on unstimulated PBLs. In the murine and human While Ohno et al. (1992a) reported that higher levels of immune systems M H C class II expression is restricted, MHC class II could be detected on PBMC from FIVwith predominant expression on B cells, macrophages, infected cats compared with specific pathogen-free (SPF) dendritic cells and activated T cells. In contrast, both cats, the authors did not establish whether this was due to an increase in the number of B lymphocytes or upregularesting and activated T cells express high levels of MHC class II molecules in the cat (see below). The a-chain of tion of T cell MHC class II expression. In contrast, feline MHC class II has an acidic pI and apparent Mr of Rideout et al. (1992) demonstrated that there was a 35 • 103 whereas the fl-chain has a basic pI and an persistent elevation in the percentage of CD4 § and apparent M r of 30 • 10 3 (Neefjes et al., 1986). The feline CD8 + T lymphocytes expressing MHC class II antigens MHC class I 0~-chain has an apparent Mr of approxi- shortly after FIV infection but that a similar elevation was mately 45 x 103. Interestingly immunoprecipitation of present in cats chronically infected with FeLV. The data feline MHC class I from cultured feline lymphocytes with suggest that despite a basal level of MHC class II the cross-species reactive antibody W6/32 did not yield expression on feline T cells, expression can be upregufl2-microglobulin (Neefjes et al., 1986). While this may lated following T cell activation. An early study of the feline MHC by Pollack et al. (1982) reflect exchange of fl2-microglobulin with bovine 132microglobulin from the culture medium, it is possible using a cross-reactive antimurine IE antibody suggested that W6/32 recognizes feline M H C class I in the absence that activated and resting feline T lymphocytes could be of /~2-microglobulin, as has been reported with other differentiated on the basis of expression of an IE-like molecule. Therefore, it would appear that while some species. feline MHC class II molecules are expressed on all T cells (42-3H2 and vpg3 reactive), additional MHC class II molecules are expressed only upon activation (IE-like). Expression of MHC molecules in the feline The expression of MHC class II molecules on resting T immune system cells is not unique to the cat, similar phenomena have been Several reagents have been identified with which the described in the dog, pig and horse (Thistlewaite et al., expression of MHC antigens in the feline immune system 1983; Doveren et al., 1985; Crepaldi et al., 1986). The can be studied. Early studies on the feline MHC utilized differentiation of activated T lymphocytes on the basis of cross-species-reactive antibodies such as W6/32 (anti- MHC class II expression has been observed in the horse human MHC class I) and ISCR3 (antimurine IE). Recently, where IA-like molecules are constitutively expressed on all reagents specific for feline MHC class II have been devel- T cells while IE-like molecules are restricted to activated T oped including 42-3H2 (Rideout et al., 1990) and vpg3 cells.

Red

Blood

Cell

Table VIII.6.1

Type

Antigens

303

The feline AB blood group system

Disialoganglioside (NeuNAc)2GD3 Intermediate (NeuNGc)2GD3 Alloantibodies x y

A

+

+

+

+++

B

++++

-

-

-

+ +++

AB

++

++

++

++

-

6.

Red Blood Cell Antigens

Although naturally occurring alloantibodies were recognized in cats in 1915, it was not until the second half of the twentieth century that two major feline blood types, known as type A and B, were discovered. In 1981, Auer and Bell (1981) also identified an extremely rare blood type AB that reacted with anti-A and anti-B reagents. These three blood types form the only known blood group system in cats designated as the AB system, although it is not related to the human ABO system (Bell, 1983) (Table VLII.6.1). In contrast to most blood types in other species, type-A and type-B antigens are not codominantly inherited (Giger et al., 1991a). The A allele is dominant over the B allele. Thus, all type-B cats are homozygous for the B allele (genotype B/B), whereas type-A cats can be homozygous or heterozygous for the A allele (genotype A/A or A/B). The AB allele is recessive to the A allele, but dominant over the B allele. There may be an additional genetic mechanism responsible for the inheritance of the AB blood type in cats, but they are not generally produced by breeding type-A cats to type-B cats (Griot-Wenk et al., 1996). Specific neuraminic acids on gangliosides, containing ceramide dihexoside (Galbl-4Glc-cer) as a backbone, correlate with the feline AB blood group antigens (Andrews et al., 1992; Griot-Wenk et al., 1993). Although disialogangliosides predominated, mono- and tri-sialogangliosides were also isolated. Type B cats express only Nacetyl-neuraminic acid on these gangliosides. A-type red cells express predominantly N-glycol-neuraminic acid containing gangliosides, but also some N-acetyl neuraminic acids. Equal amounts of the above two neuraminic acids containing disialogangliosides and two intermediary forms were found on type AB erythrocytes. In addition to these glycolipid patterns, differences in the glycoprotein patterns were also identified. Naturally-occurring alloantibodies have been used for blood typing cats (Bticheler and Giger, 1993). All type-B cats have very strong anti-A alloantibodies which act as strong ( > 1:64) agglutinins and hemolysins. Type-A cats have generally weak anti-B alloantibodies (1:2). Therefore, the anti-B serum has been replaced with T r i t i c u m vulgaris lectin which strongly agglutinates type B cells (Butler et al., 1991). A simple card test is now available to

Frequency Most common blood type Common in certain breeds and geographic locations Extremely rare

differentiate between type A, B, and AB cats (DMS Laboratories, 2 Darts Mill Rd, Flemington, NJ 08822; 1800-567-4367). The frequency of blood type A and B among domestic shorthair and longhair cats differs markedly between parts of the United States and other parts of the world (Giger et al., 1991a,b, 1992). The distribution of type A and B among purebred cats varies even more, although no geographic variation has been noted. Knowledge of the blood type frequency in each breed is important when estimating the risk of AB incompatibility reactions. The AB blood type has been recognized in domestic shorthair and longhair cats and purebred cats with blood type B, but occurs extremely rarely (Griot-Wenk et al., 1996). With less than 1%, type AB is not listed in Tables VIII.6.2 and VIII.6.3. Although the function of these red blood cell antigens remains unknown, they are responsible for serious blood incompatibility reactions. Owing to the fact that cats have naturally occurring alloantibodies, even a first mismatched

Table V111.6.2 Frequency of blood type A in domestic shorthair and longhair cats

Type A (%) Asia, Tokyo, Japan Australia, Brisbane Europe Austria England Finland France Germany Italy Netherlands Scotland Switzerland North America, United States Northeast North Central/Rocky Mountains Southeast Southwest West Coast South America, Argentina Type [] = 100-type A; type AB is less than 1%.

90.0 73.7 97.0 97.1 100 85.1 94.0 88.8 96.1 97.1 99.6 99.7 99.6 98.5 97.5 95.3 97.0

304


Table V111.6.3 Frequency of blood type A in purebred cats in the United States

TypeA (%) Abyssinian Birman British shorthair Burmese Cornish rex Devon rex Exotic shorthair Himalayan Japanese Bobtail Maine Coon Norwegian Forest Persian Russian blue Scottish fold Siamese Somali Sphinx Tonkinese

86 84 60 100 66 59 75 93 84 98 93 84 100 82 100 83 82 100

Type B = 100-type A; type AB frequency is less than 1%.

blood transfusion can result in life-threatening hemolytic transfusion reactions particularly when a type-B cat receives type A blood (Giger and Bficheler, 1991). Furthermore, type A and AB kittens born to queens, even when primiparous, with blood type B may develop neonatal isoerythrolysis when receiving colostrum during the first day of life (Giger, 1991; Casal et al., 1996). Kittens at risk may be blood typed at birth with cord blood and type A and AB kittens born to type B queens may be successfully foster-nursed for 24 h.

only a few amino acid differences may represent different isotypes, allotypes or Ig subclasses. To date, no data have been published analyzing genes encoding cat Ig. Therefore, the information available has been obtained by using monoclonal antibodies (mAb) specific to cat Ig and biochemical methods to analyze Ig. This information forms the basis for the discussion of cat Ig.

Cat Ig light chains Cats have two different classes of Ig light chains:/c and 2 each with a molecular mass of 25 kDa. The ratio between /c and 2 light chains expressed on Ig in various tissues and fluid has been estimated to be 1:3 (Hood et al., 1967; Klotz et al., 1985). mAb specific for/c and 2 light chains have been described (Klotz et al., 1985; Grant, 1995).

Cat Ig heavy chains

IgM Cat IgM was first analyzed by Aitken et al. (1967) by agar gel diffusion techniques. As in other mammals, there appears to be only one IgM class. Some cat IgM binds to S t a p h y l o c o c c u s aureus Protein A (SPA; Goudswaard et al., 1978; Lindmark et al., 1983). However, it cannot be excluded that variable regions representing VHIII like families (Paul, 1995) from cat bind to SpA rather than the Ig heavy chains from IgM (Sasso et al., 1991). There are mAbs specific to cat IgM (Klotz et al., 1985; Grant, 1995). The serum concentration of IgM in specific pathogen-free cats is 0.32 mg/ml (+ SD 0.27; n - 22; Grant, 1995). IgA

7.

Immunoglobulins

Introduction As with any mammalian species analyzed to date, cats have different immunoglobulin (Ig) isotypes designated IgA, IgG and IgM (Aitken, et al., 1967; Okoshi et al., 1968; Klotz et al., 1985; Grant, 1995; Paul, 1995). However, the number of subclasses identified for different Ig isotypes varies considerably from species to species. The mouse has one IgA class, human has two but the rabbit has as many as 13 different subclasses of IgA (Spieker-Polet et al., 1993). In contrast, rabbits have only one class of IgG, mice and humans have four but pigs have at least five different subclasses of IgG (Butler and Brown, 1994). The analysis of the Ig isotypes summarized above was made by analyzing the genes encoding the different Ig molecules. This has provided conclusive evidence for the structure of Igs which was not possible to elucidate otherwise because

At least one IgA isotype is present in cats but some workers have found evidence for two subclasses of IgA based on differential binding to SpA or binding to a mAb (Grant, 1995). However, different glycosylation of IgA, dimeric IgA or allotypes of IgA (Brown et al., 1995) cannot be excluded. The serum concentration of IgA in specific pathogen-free cats is 0.31 mg/ml ( • 0.24; n - 22; Grant, 1995). IgG There is evidence for at least two (Schultz et al., 1974) and possibly up to four IgG subclasses in cat named IgG1 to IgG4 based on anionic exchange chromatography (Grant, 1995), the analysis of differential binding of cat IgG to SpA using the methods of Seppala et al. (1981) and mAb to cat IgG (Klotz et al., 1985; Grant, 1995). The heavy chain of IgG has been estimated to be 50-55 kDa. There is no mAb which exclusively recognizes one of the postulated four

Passive Transfer of Maternal Immunity

IgG subclasses (Klotz et al., 1985; Grant, 1995). mAb to cat Ig, which have been described in some detail by Grant (1995) have been evaluated for cross-reactivty to human, cow, dog, goat and horse Ig. Some cross-reactivity was found among the same isotypes present in different species.

IgE Clinical evidence of type I allergies in cats associated with IgE implies that IgE is present in cats. However, although all mammalian species analyzed in any detail have IgE, no cat IgE has yet been described.

Conclusion mAb against cat 1< and 2 light chains and mAb against IgM, IgA and IgG exist (Klotz et al., 1985; Grant, 1995). There is no specific mAb against the putative subclasses of cat IgA or IgG. Ongoing analysis of Ig genes in some laboratories will improve understanding of the structure of Ig in cats.

Acknowledgements I would like to thank Dres. V. Rutten, University of Utrecht and Ch. Grant, Custom Monoclonals Sacramento Ca USA for their willingness to discuss data on cat IgG and to make mAbs available for testing. Mathias Ackerman made valuable suggestions to improve the manuscript.

11

Passive Transfer of Maternal Immunity

Introduction At birth, kittens are highly susceptible to microbial infections because of their immature immune system. During the course of maturation, kittens are protected from microbial infection mostly by humoral immunity transferred from their mothers.

Transplacental immunity The structure of the feline placenta is different from those of most domestic animals. The fetal chorionic epithelium in feline placenta is in close contact with the endothelium of maternal capillaries, and this type of placenta is called endotheliochorial placenta (Leiser and Kaufmann, 1994). This type of placentation allows a small amount (5-10%) of maternal immunoglobulins (primarily IgG) to transfer to the fetus (Scott et al., 1970; Schultz et al., 1974). The amount of immunoglobulin transferred to the fetus is very

305

difficult to determine by standard quantitative assays, such as radial immunodiffusion and immunoelectrophoresis (Schulz et al., 1974). Consequently, detection of transplacental immunoglobulins in the fetus has been demonstrated more readily by assays which detect antigenspecific antibodies in the serum of presuckling kittens, such as neutralizing antibody assay, enzyme-linked immunosorbent assay, and immunoblot analysis (Harding et al., 1961; Scott et al., 1970; Pu et al., 1995). There is no information available about transplacental cell-mediated immunity in cats.

Immunity transferred by colostrum and milk Newborn kittens receive a majority of maternal antibodies via ingestion of colostrum. During late pregnancy and under the influence of hormones, the mammary glands of queens secrete milk into mammary alveoli. The milk preformed before parturition is called colostrum. Colostrum is rich in immunoglobulins and the immunoglobulin fraction consists predominantly of IgG; IgA and IgM are present in lower concentration (Table VIII.8.1). The concentration of IgG in colostrum is two- to four-fold higher than that found in serum. A majority of IgG and a considerable portion of IgA in the colostrum are actively transported from the circulation into mammary alveoli by specific receptors on the acinar epithelial cells of the mammary glands (Gorman and Halliwell, 1989). Colostrum contains trypsin inhibitors, as well as antimicrobial factors such as lysozyme, lactoferin, and lactoperoxidase (Stabenfeldt, 1992). In addition, colostrum has high concentrations of lipids and lipid-soluble vitamins (particularly vitamin A), proteins (such as caseins and albumin), and minerals, and also low levels of carbohydrates (Reece, 1991; Stabenfeldt, 1992). All of these components are nutritionally important to newborn kittens. Milk is produced by queens immediately after the consumption of colostrum by kittens. The composition of milk is considerably different from that of colostrum. Milk has low levels of IgG and IgA and lacks IgM (Table VIII.8.1). IgG is the predominant immunoglobulin class in the milk of cats, unlike other nonruminant animals such as dogs, pigs and horses, in which IgA is the predominant class (Tizard, 1996). A majority of IgG and IgA is synthesized locally in the mammary glands, unlike colostrum which consists of immunoglobulins transported from the serum. Milk also differs from colostrum in that it contains less lipids, proteins, and minerals, and has more carbohydrates (Reece, 1991; Stabenfeldt, 1992). Within the first 24-36 h after birth, colostral immunoglobulins (IgG, IgA, and IgM) are absorbed by the intestinal epithelial cells of newborn kittens (Figures VIII.8.1 and VIII.8.2). The trypsin inhibitors present in colostrum decrease the proteolytic activity in the gastrointestinal tract of newborn kittens, thereby enabling the immunoglobulins to retain their structure and function

306


Table V111.8.1 Immunoglobulin levels (mg/dl) in serum and milk of nursing queens a Average immunoglobulin concentration (range) at postpartum (weeks) Sample

Ig Isotypes b

0

1

2

3

4

6

References

Serum

IgG

764 (420-1550) 138 (66-310) 444 (230-700)

594 (350-840) 77 (26-175) 402 (245-560)

611 (340-840) 66 (0-210) 420 (0-800)

434 (385-495) 88 (41-135) 405 (200-690)

906 (660-1450) 175 (26-500) 576 (208-800)

742 (480-920) 179 (41-260) 525 (265-750)

Pu et aL (unpublished data)

1572 (685-3150) 57 (26-127) 47 (0-280)

189 (60-400) 14 (0-35) 0

99 (0-230) 7 (0-23) 0

90 (80-120) 15 (0-26) 0

110 (60-220) 5 (0-21) 0

117 (60-200) 7 (0-21) 0

IgA IgM Milk

IgG IgA IgM

Serum

IgG IgA IgM

1375 215 116

Milk

IgG IgA IgM

4400 340 58

Serum

IgG

1894 (1171-2258) 285 (102-582) 247 (60-390)

IgA IgM

Milk

IgG IgA IgM

Pedersen (1987)

440 44 2

360 20 0

3570 (2750-4674) 254 (5O-488) 110 (31-300)

300 20 0

315 24 0

100 24 0 Gorman and Halliwell (1989)

189 (94-255) 13 (9-20) 2O (10--40)

aSpecific pathogen-free cats were used in all studies except for the study by Gorman and Halliwell (1989) which did not specify the cat source. blmmunoglobulin (Ig) isotypes were quantified using radial immunodiffusion assay plates (Bethyl Laboratories, Inc., Montgomery, Texas, USA) by Pu et aL, and unspecified methods by Pedersen (1987) and Gorman and Halliwell (1989).

(Tizard, 1996). The ingested immunoglobulins bind first to specific Fc receptors on the surface of intestinal epithelial cells. Subsequently, immunoglobulins are taken up by the epithelial cells via pinocytosis and transferred into the lacteals and then the circulation (Tizard, 1996). Once maternal immunoglobulins are absorbed into the circulation, a small portion is released back onto the mucosal surface, thereby providing the local immunity. However, a majority of maternal immunoglobulins remain in the circulation and confer systemic immunity (Tizard, 1996). In contrast, immunoglobulins present in milk remain mainly in the intestine, and consequently, provide local immunity for the gastrointestinal tract (Tizard, 1996). Upon passive transfer, the levels of serum immunoglobulins in newborn kittens approach those found in adults (Scott et al., 1970) (Figure VIII.8.1). The transferred immunoglobulins are important in protecting newborn kittens against infections, such as feline leukemia virus

(FeLV) (Jarrett et al., 1977), feline panleukopenia virus (FPV) (Scott et al., 1970) and feline immunodeficiency virus (FIV) (Pu et al., 1995). The lack of protection in some kittens may result from failure of queens to produce or transfer sufficient amounts of protective antibodies specific for pathogens encountered during this critical period (Tizard, 1996). It is still unclear whether maternal immune cells that are present in the colostrum and milk can be transferred from queens to kittens. However, studies with other domestic animals indicate that maternal immune cells can be transferred via colostrum and milk to the newborns and provide selected cell-mediated immunity (Tizard, 1996).

V a c c i n a t i o n of k i t t e n s

Vaccination of kittens should be scheduled according to the level and nature of the passive immunity received

P a s s i v e T r a n s f e r of M a t e r n a l

700 -

Immunity

307 1400 -

A

600

tara 1200 -

""

500 -

ua

1000

'J

-

m8

z ~ 8oo -~

400I,U m .-7

E r

600

-

-

_zg 300

-

-

0 O

400 200

1

0

0

2

4

6

8 WEEKS

60

50

""

a

'

-o- o~~

A 4 0

.,.

ga0
205/130 Unknown Unknown Unknown 166/155/95 16/32/> 132 32 80 226/21/190

Gene homology 65% 72% 84%

CD5 bright cells contain the rest (Saalmiiller et al., 1994b,c). Some B cells also express CD5 (SaalmiJller et al., 1994; Appleyard et al., 1998b). As opposed to other species, however, fetal IgM + liver B-cells, and newborn and adult nonactivated splenic and peripheral blood IgM + B cells did not express CD5. The relevance of this to the porcine immune response is unknown (Cukrowska et al., 1996). As with other species, porcine CD5 appears to be able to transmit an activation signal (Appleyard et al., 1998a).

CD6

Three monoclonal antibodies have been identified as reactive with porcine CD6 (Saalm~iller, 1996). CD6 is not present on B cells or monocytes. It is present on 95% of thymocytes but is only expressed by 76% of peripheral T cells (Saalm/iller et al., 1994a). All of the CD4 + peripheral T cells express CD6, whereas only a portion of the CD8 + cells express CD6. Those CD8 + cells that fail to express CD6, express CD8 at a reduced level (SaalmOller et al., 1994a). The ~/5 T-cell receptor subset also does not express CD6. Functional analysis has now demonstrated that all of the NK activity is within the C D 6 - population (Pauly et al., 1996). Putting this data together with that from CD5, it is apparent that the phenotype of porcine NK cells is C D 5 - C D 6 - CD8 dim. Variable

CD8

differences (Pescovitz et al., 1985). Of the several monoclonal antibodies reactive with porcine CD4, all react with the same or a closely related epitope (Pescovitz et al., 1994). Despite this, there is an interesting polymorphism reported in porcine CD4 (Sundt et al., 1992; Gustafsson et al., 1993). The functional significance of this substantial polymorphism that completely eliminates reactivity with any of the reported anti-CD4 reagents is unknown. CD4 mRNA is present but the epitope with which the CD4 monoclonal antibodies react has been destroyed. There does not appear to be any detectable effect on various immune parameters.

The Second International CD Workshop greatly expanded the knowledge of porcine CD8 through the development of several new reagents (Zuckermann et al., 1998b). One of these reacts only with the CD8 bright population of cells, i.e. the C D 4 - / C D 8 + cells. This indicates that the CD8 expressed on these cells is qualitatively and also quantitatively different from that expressed on the CD4/CD8 dual expressing cells. It has been suggested that the dual expressing cells have only CD8~/~ homodimers on the surface whereas the C D 4 - / C D 8 + cells express the CD8~/ fi heterodimer. This will be confirmed only when the porcine CD8 genes are cloned and sequenced.

CD5

CD44

The porcine CD5 gene has been partially sequenced and shown to have 96% DNA homology to murine and 84% to human CD5 (Appleyard et al., 1998). There are eight monoclonal antibodies which are all reactive with the same epitope of porcine CD5 (Saalm~iller, 1996). Within the thymus, the more mature cells express higher levels of CD5 (Saalm~iller et al., 1994b). Within the peripheral cell population, which is represented by three different levels of CD5 expression, the C D 5 - cells contain all of the NK activity, the CD5 dim cells contain 7/5 cells, and the

CD44 is an adhesion molecule that is involved in lymphocyte homing, T-cell activation, and intercellular interactions. Porcine CD44 was first identified in a soluble form in intestinal efferent lymph using the anti-human CD44 monoclonal antibody, Hermes-1 (Yang et al., 1993). It was characterized as 48 000 to 70 000 kDa soluble and 90 000 kDa membrane bound molecule. Porcine CD44 was subsequently purified and both polyclonal and monoclonal antibodies were generated (Yang et al., 1993). Both types of antibodies were widely species cross-reactive. The


monoclonal antibodies failed to stain porcine erythrocytes but did stain all mononuclear cells compared with the situation in humans, where red cells do express CD44. It is possible that porcine red cells also express CD44 but a distinct isoform of it (Yang et al., 1993). The level of CD44 appeared to correlate with homing capacity of the particular lymphocyte populations (Yang et al., 1993).

CD45 The CD45 marker is characterized by extensive recombination events producing different expressed proteins. These different isoforms have been associated with different states of activation and antigen exposure, and are differentially expressed among the various cell lineages. Within the pig, eight isoforms are possible, but only three have been detected at the molecular level and four at the protein level (Schnitzlein et al., 1996). The genes encoding the various isoforms have been expressed in CHO cells thereby allowing careful mapping of the various antiCD45 monoclonal antibodies to the various isoforms (Schnitzlein et al., 1998; Zuckermann et al., 1998a).

CD86 One of the current paradigms of immune activation is the requirement for a second signal in addition to that delivered through the T-cell receptor. One of these second signals is the CD28 pathway through its interaction with the B7-1 and B7-2 proteins. Because of the great interest in swine as a possible xenogeneic donor, attention has been focused on interactions between human and porcine cells, such as the vascular endothelium. It has been shown that porcine vascular endothelium cells express B7-2 (CD86), a 79 kDa protein, and that this can function as a stimulatory molecule for xenogeneic proliferation (Davis et al., 1996).

Unique features of leukocyte marker expression Although the pig generally has and expresses the same markers as found in other species, there are two features that are relatively unique to pigs. The first of these is the very high frequency of cells that were initially identified as Null cells. These have now been shown to be 7/8 T-cell receptor expressing cells. This type of cell is discussed elsewhere in this section. The other feature is the wide variety of T cells, as distinguished by the presence of CD4 and CD8. When monoclonal antibodies to CD4 and CD8 were first analyzed in the pig, a difference from other species was immediately apparent. Unlike humans and mice, where expression of CD4 and CD8 were essentially mutually exclusive on the surface of peripheral T cells, in pigs a large number, in fact sometimes the majority, of such cells express both CD4 and CD8 (Pescovitz et al.,

377

1985). This dual expressing phenotype was similar to thymic T-cells. The early hypothesis that the dual expressing cells were simply premature thymic emigrants was discounted by the presence of CD1 on thymic but not on peripheral dual-expressing cells (Pescovitz et al., 1990). More recent analysis suggests that the dual-expressing population represents a memory type of cell. This is consistent with the increased percentage of these cells present in older animals (Zuckermann and Husmann, 1996). However, there has been a suggestion that some CD4 cells may derive from the dual-expressing population by loss of CD8 (Licence et al., 1995).

11


Lymphoid cells do not migrate randomly but accumulate preferentially in the different compartments of various tissues. For example, there is a predominance of B and T cells in the follicles and the paracortex in lymph nodes, respectively. The migration of plasma cell precursors into the lamina propria of the gut wall is another well-known example of preferential lymphocyte migration into nonlymphoid tissue. In pigs, T, B and 7/8 T-cells contribute to the circulating pool of lymphoid cells. T and B cells migrate to all lymphoid and many other tissues, while Null cells are present in small numbers in lymphoid organs but are often found in nonlymphoid tissues (Pabst and Binns, 1989; Rothk6tter et al., 1990, 1993; Barman et al., 1996). The accumulation of lymphoid subsets in various tissues is a result of several mechanisms: first, the 'entry' into an organ, which is regulated by the interaction of adhesion molecules with endothelial cells and lymphocytes; second the 'transit' of lymphocytes through the parenchyma of the organ; and finally the 'exit' either directly into the blood or into lymph vessels. During the transit phase, lymphocytes can be activated to start proliferation or cells can die by apoptosis. Thus, the number of lymphocytes found at a given time in one compartment of an organ is the net effect of all these parameters and not just the result of preferential 'entry'. Cell proliferation has been observed in all lymphoid organs of the pig (see Section 2). Newly formed cells have been detected even in the epithelium and lamina propria of the intestine (Rothk6tter et al., 1994). Apoptosis of lymphocytes has not been studied in detail in the pig. Lymphoid cells enter lymphoid organs such as lymph nodes, Peyer's patches and tonsils via high endothelial venules (HEV). Although many more lymphocytes recirculate through 'non-HEV' organs, (e.g. the spleen and bone marrow; Pabst and Binns, 1989), lymphocyte migration studies have often been restricted to the regulation of lymphocyte entry via HEV into lymphoid organs. In mice and humans, many adhesion molecules and other factors

378 Table Xl.4.1

IMMUNOLOGY OF THE PIG Adhesion molecules in the pig

Adhesion molecule Integrins

CD18

CD11/CD18 (LFA-1) /~1 comparable subunit

Site of expression

Available data

Lymphocytes, natural killer cells, polymorphonuclear leukocytes

Antibody against porcine CD18a (Kim et aL, 1994; Saalm011er, 1996) Cross-reacting antibodies (Walsh et aL, 1991 ; Windsor et aL, 1993) Antibodies against porcine CD11/18 (Hildreth et aL, 1989) Molecule (King et aL, 1991)

Skin basal cells

Immunoglobulin superfamily

Endothelial cells

Cloned molecule (Tsang et aL, 1994) Cross-reacting Ab (Tsang et aL, 1994; Batten et aL, 1996)

E-selectin

Endothelial cells

Ligand of L-selectin

Endothelial cells Lymphocytes

Cloned molecule (Tsang et aL, 1995) Cross-reacting Ab (Keelan et aL, 1994: Tsang et aL, 1995) Cross-reacting antibody (Whyte et aL, 1994, 1995) Porcine Ab (Yang and Binns, 1993a, b; Saalm011er, 1996)

VCAM-1

Selectins

CD44

have been described that regulate the three steps of cell adhesion at these venules (for review see Springer, 1994). To date, only a few porcine homologues of adhesion molecules known from other species have been described on lymphoid cells and on the endothelium (reviewed by Binns and Pabst, 1994). However, interest is now focusing on the expression of adhesion molecules on other leukocytes (e.g. polymorphonuclear leukocytes) and on endothelium of larger vessels in the pig, because it serves as an animal model for many studies related to clinical problems in human medicine (Binns and Pabst, 1996). The adhesion molecules currently known in the pig are summarized in Table XI.4.1.

Aspects of adhesion molecule detection Only a limited number of adhesion molecules have been detected in the pig using cross-reacting antibodies against adhesion molecules of other species. One reason may be the differences in the distribution of saccharides on the HEV of the pig compared with other species (Whyte et al., 1993). Furthermore, the specificity of these cross-reactions is open to debate (e.g. the reaction of anti L-selectin or LAM-1 antibodies to pig HEV is controversial; Spertini et al., 1991; Whyte et al., 1994, 1995). So far, receptor-ligand pairs cannot be described in the pig in detail because of the lack of experimental data. Antibodies have been developed that may detect adhesion molecules, but the ligands detected have not yet been characterized (Haverson et al., 1994). Despite these limitations, current knowledge provides evidence that the basic mechanisms of lymphocyteHEV interactions in pigs are comparable to those in other species.

Adhesion molecules and experimental models The expression of adhesion molecules has often been examined with respect to experimental models rather than basic immunology. E-selectin and vascular cell adhesion molecule-1 (VCAM-1) have been induced by human cytokines on porcine endothelial cells (Batten et al., 1996), and also by inflammatory agents (Whyte et al., 1994; Woolley et al., 1995; Binns et al., 1996). The characterization of E-selectin expression in vivo has also been performed (Keelan et al., 1994). Anti-CD18 treatment was used in experimental models for heart surgery (Aoki et al., 1995), in a peritonitis model (Wollert et al., 1993), and in experimental sepsis (Walsh et al., 1991; Windsor et al., 1993). CD44 is involved in lymphocyte migration via HEV but the mechanism has not been resolved. In pig models, CD44 was indirectly involved in lymphocytes binding to cultured endothelial cells (Yang and Binns, 1993a). Until recently, the development of HEV in nonlymphoid organs has been described only in chronic inflammation. Binns et al. (1990, 1992b) have now documented the appearance of HEV in the skin of pigs within a day after injection of PHA, TNF-~, and IL-2. Thus, these vessels specialized for lymphocyte entry into tissues, are much more dynamic than previously thought.

Differences in lymphocyte migration in the pig There is a major difference in lymphocyte migration in the pig compared with other species. As first described 30 years ago, efferent lymph draining from pig lymph nodes contains very few lymphoid cells compared with other species (Binns and Hall, 1966). This was explained by the structure of the lymph node, which provided the functional basis for the re-entry of lymphocytes into the blood

Cytokines and Interferons via HEV within the lymph node parenchyma (Pabst and Binns, 1989; Whyte et al., 1993; Sasaki et al., 1994) and not the expression of adhesion molecules on the lymphocyte surface. This has been documented in lymphocyte tracing studies in pigs using in vitro labeled lymphocytes of sheep. The xenogeneic cells showed a migration pattern comparable to that of autologous lymphocytes (Binns and Licence, 1990). It has not been clarified whether there are distinct HEV for entry and exit or whether the HEV work as a revolving door.

Lymphoblasts It has been shown in the pig that only a certain number of lymphoblasts from different tissues accumulate in their tissue of origin, while large numbers were found in nonlymphoid organs, e.g. lung, liver and muscles (Binns et al., 1992a). It is not known whether the recirculation of these lymphoblasts is regulated by a special set of adhesion molecules. The higher expression of porcine CD44 on lymphoblasts than other lymphocytes might be such a mechanism involved in lymphoblast migration (Yang and Binns, 1993b).

Leukocyte migration in the pig Although few adhesion molecules have been described in the pig, much is known about the basic mechanisms of porcine lymphocyte migration. Porcine lymphoid cells have been labeled using radioactivity or fluorochromes. Furthermore, it is possible to use a polymorphic genetic marker in MHC-homogeneous pig strains, thus the cells of a marker-positive donor can be detected in the host using immunofluorescence or immunohistochemistry (Binns et al., 1995). There are very few species in which lymphocyte migration to so many organs has been studied. In an extensive series of experiments, lymphocytes from the peripheral blood were labeled with 51Cr and their traffic studied in different age groups from fetal to adult pigs. The different entry of migrating lymphocytes into various lymph node groups, different types of tonsils and, in particular, into the two types of Peyer's patches in the small intestine, the bone marrow and the thymus has been described (Binns and Licence, 1985; Binns and Pabst, 1988, 1996). In addition, cell labeling within the organs and surgery to collect lymph from various sites are techniques that make the pig useful for in vivo migration studies (Pabst et al., 1993).

5.

Cytokines and Interferons

Cytokines play a central role in modulation of immunological and physiological processes under both homeo-

379 static and disturbed conditions. The rapidly expanding status of cytokine reagent development in swine reflects the current interest in porcine immunology and disease pathogenesis, the potential of pigs as organ donors for xenotransplantation in humans, and the use of swine as biomedical research models. The number of cytokines cloned or described in pigs has increased dramatically since 11 were listed by Murtaugh in 1994 (Table XI.5.1). Public websites are available at the URLs h t t p : / / www.public, iastate, edu/~pigmap for genetic information and http://kbot.mig.missouri.edu: 443/cytokines/explorer.html for cytokine reagent availability. Cytokine regulation and function are largely similar in swine and other mammalian species, as exemplified by mouse and man. The following information emphasizes the aspects of cytokine biology and measurement that are relevant or unique to swine. Information on porcine cytokine assay methods is provided in Table XI.5.2 and nucleotide sequence information for polymerase chain reaction (PCR) detection and molecular cloning is provided in Table XI.5.3.

Inflammatory cytokines and chemokines The inflammatory cytokines and chemokines IL-I~, IL-lfl, IL-6, IL-8, TNF-~, TNF-fl, MCP-1, and MCP-2 are described in pigs (Table XI.5.1). Inflammatory cytokine and chemokine expression is induced principally by cell wall products of Gram-negative bacteria and activators of the transcription factor NF-/cB. However, the endotoxin of Serpulina hyodysenteriae, a Gram-negative swine enteric pathogen, is a weak or ineffective inducer of inflammatory cytokine expression (Greer and Wannemuehler, 1989; Sacco et al., 1996). Although TNF-~ appears to play a central role in the pathophysiology of septic lung injury, which resembles acute porcine pleuropneumonia (Olson, 1988; Kiorpes et al., 1990), TNF levels are not increased in the lung in response to infection with Actinobacillus pleuropneumoniae. IL-1 and IL-6, however, are present at high levels (Baarsch et al., 1995). IL-1 appears to be an important inflammatory mediator involved in the destruction of cartilage and bone that is a feature of atrophic rhinitis, erysipelas and arthritis. IL-1 localizes to inflammatory cells of affected joints (Davies et al., 1992), and it activates chondrocytes (Dingle et al., 1990), increases collagenase activity (Richards et al., 1991), and suppresses collagen synthesis (Tyler and Benton, 1988). IL-1 is assumed to play an important role in other inflammatory diseases of swine, but definitive studies require the generation of purified proteins and specific antibodies. IL-6 is induced in lymphoid cells by mitogenic stimulation, in myeloid cells by lipopolysaccharide, and in fibroblasts by inflammatory cytokines and viral RNA mimics (Scamurra et aI., 1996). In fibroblasts, IL-6 but not IL-1 or TNF secretion is induced by Pasteurella multocida toxin,

Table X1.5.1

Characteristics and properties of porcine cytokines

Cytokine

Alternative names

Species crossreactivity H + Pa H+P,B+P P*H,P-B, P-M

Principal cell source

Regulation or site of expression

Known and presumed (?) activities in pigs

Chromosome location

Macrophages Macrophages Tcells

Sites of bacterial infection, stress Sites of bacterial infection, stress Activated Tcells

Inflammation Inflammation Tcell proliferationand activation

3q1.2-q1.3 3ql .l-q1.4 8

H-P

Macrophages, Tcells

Sites of bacterial infection, stress

H+P H-P H+P

Macrophages Tcells, macrophages Macrophages, dendritic cells Tcells

Sites of bacterial infection Activation of Tcells and macrophages Activation by LPS or bacteria Activated T cells

Hematopoietic stem cell differentiation Macrophage suppression, Tcell growth and activation (?) Acute phase response, Tcell and B cell stimulus Neutrophil chemokine Macrophage suppression IFN-7 production, NK cell activation, and Th-l induction (?) 7/6Tcell proliferation and activation (?)

Macrophages

Activation by LPS or bacteria

IFNg induction (?)

Macrophages Tcells

LPS and Gram-positive bacterial toxins

lnflammation lnflammation

P++H

Lymphocytes

Constitutive in Tcells

PttH

Lymphocytes

Constitutive in Tcells

P e H

Lymphocytes

Not active

Tcells

IL-8, AMCF-I IL-10 IL-12

Tumor necrosis factor-cc Tumor necrosis factor-p Macrophage chemotactic protein I Macrophage chemotactic protein II Alveolar macrophage chemotactic factor II Transforming growth factor [j, Transforming growth factor [j2 Transforming growth factor p3 Erythropoietin Macrophage-colony stimulating factor Granulocyte macrophage-colony stimulating factor Stem cell factor Thrombopoietin lnterferon 7 lnterferon cc lnterferon p lnterferon cu Short porcine type I interferon Interleukin-1 receptor antagonist

IL-15, y/6 Tcell growth factor IL-18, IFN-;. inducing factor, IL-ly TNF-r H+P TNF-/I, lymphotoxin MCP l MCP II

Bone marrow

EPO M-CSF, CSF-1

Erythrocyte differentiation Myeloid differentiationand activation

GM-CSF

Granulocyte and macrophage differentiation and activation

SCF, c-kit ligand, MCGF TPO IFN-y IFN-cc IFN-/I IFN-o spl IFN

Hematopoietic cell precursors IL-12 on macrophages, NK cells Viral infection Viral infection

Stem cell proliferation and differentiation Megakaryocytopoiesis Macrophage activation Antiviral activity Antiviral activity Antiviral activity, reproduction Antiviral activity

Inflammatory stimuli

Inhibitor of IL-1 activity

IL-1ra

Tcells, NK cells Various Various Various Trophoblasts H-P

Macrophages

aH (human), P (pig), B (bovine), arrow indicates cytokine direction of action.

8q

Table X1.5.2 Cytokine

Known methods of cytokine detection Bioassay

-

Reference -

--

-

-

lrnrnunoassay

Reference or source

IL-1a, IL-1P D10.G4.1 cell proliferation Hopklns and Hurnphreys (1989); Winstanley and Eckersall (1992) IL-2 CTLL-2 cell proliferation lwata eta/. (1993) B9 cell proliferation Scarnurra et a/. (1996) IL-6 IL-8

Neutrophil chernotaxis

Lin et a/. (1994)

IL-10 IL-12 TNF-a

Inhibition of IFN-y activity Lyrnphoblast proliferation L929 cytotoxicity

Blancho eta/. (1995) Gately eta/. (1992) Baarsch et a/. (1991)

TNF-p M-CSF (CSF-1) IFN-;I

PK15 cytotoxicity

Pauli eta/. (1994)

MHCll induction

Le Moal et a/. (1989)

IFN-a

Antiviral activity

L'Haridon eta/. (1991)

IFN-P spl IFN

Antiviral activity Antiviral activity

Niu eta/. (1995)

Genetica

Reference

-

In situ hybridization of Baarsch eta/. (1995) rnRNA

In situ hybridization of Baarsch eta/. (1995) rnRNA In situ hybridization of Baarsch eta/. (1995) rnRNA

ELlSA

Endogen, Inc.

In situ hybridization of Baarsch eta/. (1995) rnRNA

Antihuman CSF-1 Tuo eta/. (1995) monoclonal antibody RIA, western blots Gonzalez Juarrero eta/. Single cell detection (1994); Trebichavsky eta/. (1993) Anti plFN-a L'Haridon eta/. (1991), monoclonal antibody Nowacki eta/. (1993) ELISPOT assay anti-spl serum

"PCR and Northern blot sources are not included since the information is available in Table X1.4.1

Niu eta/. (1995)

382

IMMUNOLOGY OF THE PIG

Table X1.5.30ligonucleotide primer sequences for cytokine detection using PCR Cytokine

Genbank number or reference

IL-lc~ IL-lfl IL-2

M86730 M86725, X74568 X58428, X56750, $37892

IL-3 IL-4

Yang et aL, 1996 L12991, X68330

IL-6

IL-10

M86722, M80258, M80255 M86923, X61151, M99367 L20001

IL-12

L35765 (35 kDa)

IL-8

U08317 (40 kDa) IL-15 IL-18

U58142 U68701

TNF-~ TNF-/~ MCPI MCP II RANTES AMCFII TGF-/~I

X57321, M29079, X54001, X54859 X54859 Z48479 Z48480 F14636 M99368 M23703

TGF-fl2

L08375, X70142, $48994

TG F-fl3 EPO M-CSF

X 14150 L10607 Tuo et al. (1995)

GM-CSF

U61139, D21074

SCF TPO IFN-7

L07786 Gurney et al. (1995) $63967

IFN-~ IFN-/~ IFN-~

M28623, X57191 M86726 X57194, X57195, X57196 Z22707 L38849 U32316

spl IFN IL-1 ra HPRTa a

Forward and reverse primers

Source

F AACCTCAACTCCTGCCAC R TC CFIGATAT-IqG CTGAGTCA

Y. Zhou, E A. Zuckermann and M. P. Murtaugh, unpublished

F CACAAGTGCGACATCAC R TCAACAC-I-ITGAG TA-I-ITC

Y. Zhou and M. P. Murtaugh, unpublished

F GCGACTTGI-iGCTGACCG G R GAACCFI-GGAGCAGAI I I I G p35 F CTCCCAAAATCTGCTGAAGG R CATTCTGTCGATGGTCACCG p40 F GATGCTG GCCAGTACACCTG(TCG) R (TC)CCTGATGAAGAAG CTG CT(GG)

M. P. Murtaugh et aL, unpublished Foss and Murtaugh (1997)

F GACAATTG CATCAACTI-FGTG G R GGTCTCTCTC i I i t i CACAAGC

Foss and Murtaugh (1997)

F GCCCTGGATACCAACTACTG R TCAGCTGCACTTGCAGGAAC F CG GAAGAAGCGTG C-FI-TGGATGC R GCTG CA-I-rTGCAAGAC-I-ITAC

Y. Zhou, unpublished

F ACTGTAG CCACATGA-I-TGGGA R GCCTCTCCAGAAG C-I-TC-FICT F CTGGCAGCATGTGGATGC R C I I I I GAAGGTGATAGACTGGG

Tuo et al. (1995)

F GCAGAAGAAAGGTCAGC R AG CTACCi-I-IAG GAAC CT

Y. Zhou, E A. Zuckerman and M. P. Murtaugh, unpublished

F TGAACGTcTTGCTcGAGATG R TCAAATCCAAcAAAGTCTG GC


Y. Zhou, unpublished


Hypoxanthine phosphoristosyl transferase (HPRT)is used as a control for mRNA equivalency.

suggesting a role for IL-6 in atrophic rhinitis (Rosendal et al., 1995). Administration of LPS or P n e u m o c o c c u s in vivo increases blood levels of IL-6 (Klosterhalfen et al., 1991; Ziegler-Heitbrock et al., 1992). The presence of IL-6

mRNA in the preimplantation conceptus also indicates a role in reproduction (Mathialagan et al., 1992). IL-8 is homologous to alveolar macrophage chemotactic factor-I (AMCF-I) (Goodman et al., 1992). In macro-

T-cell Receptor

383

phages the gene is exquisitely sensitive to LPS, indicating that the recruitment of neutrophils to the lung in response to bacterial infection may be due to IL-8 expression (Lin et al., 1994).

in SCID mouse recipients and the effect was enhanced by the presence of porcine GM-CSF (Yang et al., 1996).

Immune response cytokines

Four subfamilies of antiviral interferons (IFN-~,-fl,-c0 and short porcine type I (spI) and one immune interferon (IFN7) are described in pigs. IFN-co and spI IFN, in addition to possessing the classical antiviral activity of type I interferons, may be involved in maternal recognition during pregnancy since they are expressed in the conceptus and trophoblast, respectively (Mege et al., 1991; Lefevre and Boulay, 1993).

The elegant TH 1-TH2 paradigm of immune responsiveness to infection based on murine models has strongly influenced the design and interpretation of disease resistance and vaccinology studies in swine even though its essential features remain unproven in nonmurine species. In swine, it is known that IL-2 shares a high degree of sequence conservation with other mammalian IL-2 molecules (Bazan, 1992). It is secreted by mitogen-activated lymphocytes and supports the growth of lymphocytes in culture and increases natural killer activity in adult, but not newborn, animals (Charley et al., 1985; Charley and Fradelizi, 1987). Infection by viruses, including African swine fever virus, poxviruses and paramyxoviruses, induces IL-2 and killer cell activity in porcine peripheral blood mononuclear cells (Scholl et al., 1989; Steinmassl and Wolf, 1990). Various immunomodulating substances, including ACTH and imuthiol (sodium diethyldithiocarbamate) are reported to suppress IL-2 production (Flaming et al., 1988; Klemcke et al., 1990). IL-4 is active on porcine macrophages and NK cells (Knoblock and Canning, 1992; Zhou et al., 1994) but its effects on T cell proliferation and activation are not known in swine. IL-10 suppresses macrophage functions and is readily expressed in pigs (Blancho et al., 1995). IL-4 expression is exceedingly low based on reverse transcription-polymerase chain reaction (RT-PCR) assays (Y. Zhou and M. P. Murtaugh, unpublished data), and TGF-fi expression is primarily constitutive (Zhou et al., 1992), thus IL-10 may be the principal macrophage suppressor and initiator of TH2-type responses in the pig. TGF-fi has a variety of physiological effects but immunological functions have not been described in pigs (reviewed by Murtaugh, 1994). IL-12 was recently cloned but scant information is available on its role in immune responsiveness. Similarly, IL-15 and IL-18 have been cloned but no biological studies have been reported (Table XI.5.1).

Hematopoietic growth factors A variety of hematopoietic growth and differentiation factors from pigs have been cloned in E. coli as indicated in Tables XI.5.1 and XI.5.3. In so far as is known, they appear to have the same activities as their human and murine counterparts. Human and murine IL-6, IL-11, GCSF, GM-CSF, stem cell factor (SCF) and erythropoietin (Epo) induced swine progenitor colony formation to varying degrees, but IL-3 showed no effect (Emery et al., 1996). Authentic porcine IL-3 promoted pig hematopoiesis

Interferons

Future prospects Only a few cytokine receptor molecules have been cloned from the pig or are identified by monoclonal antibodies. They include the cloned receptors for TGF-fl type 3 (Genbank no. L07595) and TNF p55 (Genbank no. U19994), and the IL-2 receptor (Bailey et al., 1992), respectively. The high level of nucleotide sequence similarity between pigs and humans will facilitate PCR cloning of additional cytokines and their receptors; it will also provide the necessary information for expression of recombinant proteins, production of monoclonal antibodies and development of immunoassays. It is clear from examination of Tables XI.5.2 and XI.5.3 that the detection and localization of cytokines and their receptors is less advanced than that of the cognate mRNA molecules and is a principal obstacle to the characterization of cytokine functions in swine. Of equal importance is the need for long-term culture of swine immune cells, including myeloid cells and antigen-specific T cells and B cells, in order to elucidate cytokine regulation and function in cognate immune responses.

6.

T-cell Receptor

The study of the porcine T-cell receptor is still in its infancy with the first sequence data reported in 1993 (Thome et al., 1993). As seen with other species, there are two types of receptors composed of ~/fi and 7/fi heterodimers. Similar to immunoglobulins, the T-cell receptors are made of both variable and constant regions. The different identified porcine T-cell receptor genes and their amino acid homology to other species are shown (Table XI.6.1). Independent sequencing of the 8 chain by Grimm and Misfeldt (1994) found a slightly lower degree of homology. There are no data on the chromosomal localization of the genes. There is little data on the molecules associated with T-cell receptor. When CD3 was immunoprecipitated with antiporcine CD3 monoclonal antibody,

384 Table Xl.6.1

IMMUNOLOGY OF THE PIG Porcine T-cell receptor genes and deduced amino acid sequence homology to various species Per cent species homology

Gene

Gene number

Molecular weight

Human a

Mouse

Sheep

Cattle

c~

1 1 3 (?4) 5 1

46 47 31,35, 46 40

63.8 80.3 56.9 73.9

63.6 77.0 52.9 69.7

60.1 82.0 69.2 77.0

59.4 84.0 67.6 74.5

fl 7 5

Data presented are from Thome et al. (1993). The molecular mass is in kDa. bThe 7 chain has three identified genes of 31,35, and 35 (deduced) kDa respectively. There is a 46 kDa precipitable protein for which a gene has not been identified. a

55 kDa and 43 kDa dimers were coprecipitated. These bands are consistent with the porcine ~/fi and 7/(5 T-cell receptor proteins, respectively (Hirt et al., 1990; Yang et al., 1996; Pescovitz et al., 1998). The ontogeny and thymic dependency of particular Tcell receptor-subset positive cells is best defined for the 7/(5 cells. Binns first showed that neonatal thymectomy led to subsequent loss of the Null cell (7/(5) population (Binns et al., 1977). With use of monoclonal antibodies specific for the 7/(5 cells they recently confirmed these early findings of the Null population and demonstrated the strong thymus dependence of these cells (Licence et al., 1995). They also found a small, apparently thymic independent, population of 7/6 cells in animals followed for almost 2 years after thymectomy. The thymic nature of the 7/(5 is also supported by the ability to detect these cells within the thymus (Hirt et al., 1990). The thymus dependence/independence of the ~/fi cells is still not clear. Although overall, CD2 + (i.e. ~/fl cells) did not change after thymectomy, the phenotype of the cells with regard to CD4 and CD8 was thymic dependent. The dual expressing CD4/CD8 cells were much more common after thymectomy. These cells, which are ~/fi positive, might have developed extrathymically, while the CD4 and CD8 single expressing cells developed intrathymically (Licence et al., 1995). The ~/fi cells are present in low numbers in young pigs and increase with age (Yang et al., 1996). With the availability of antibodies to the relevant T-cell markers, it is finally possible to analyze the distribution of the various T-cell receptor populations. Within the peripheral blood, the ~/fl cells can be divided into four populations (CD4 + / C D 8 - , CD4 +/CD8 l~ CD4-/ CD8 l~ CD4-/CD8 high) while the 7/(5 cells are divided into three populations ( C D 2 - / C D 4 - / C D 8 - , CD2+/ CD4-/CD8 l~ CD2 + / C D 4 - / C D 8 - ) . These same populations occurred in the peripheral lymphoid tissue although the 7/6 cells were lower and most were either CD2 + or CD8 + (Yang et al., 1996). In addition to the expression of multiple T-cell populations, there are also several other unique characteristics of the porcine T-cell receptor (Thome et al., 1993). As opposed to human, mice, and cattle who have 2 Cfl genes, the pig appears to only have one. The pig has three identified C~ genes and four C~ proteins that are more

diverse in the hinge region than humans. Within the V6, diversity results from joining steps between four V6, three Da and one J6. This V6 diversity is the greatest of all animal T-cell receptors studied (Yang et al., 1995). The Va region also appears to have an Ig-like CDR3 region thereby suggesting that it may recognize conformational epitopes in the context of MHC.

7.

Immunoglobulins

Table XI.7.1 summarizes the immunoglobulin (Ig) classes of the swine including what is known about their concentrations in serum, colostrum and milk whey. Because antibodies that recognize the many IgG subclasses are unavailable, their distribution is unknown. However, based on transcript frequency, IgG1 appears to be the most abundant (Kacskovics et al., 1994). For the same reason, nothing is known about the biological functions of the various subclasses. The roles of IgG, IgA and IgM appear to be the same as that described for their counterparts in other well-studied species. Because body fluids other than lacteal secretions are heavily influenced by transudation, secretion rate and sampling procedures, only relative rather than absolute values are meaningful (Butler and Hamilton, 1991). In this regard, IgA (primarily as SIgA) is the major Ig in all exocrine body fluids except colostrum, alveolar fluids and some urogenital secretions. In parotid saliva, nasal and upper bronchial fluids, 80-90% of the Ig is IgA (Butler and Brown, 1994). In serum, IgA occurs as a dimer whereas colostrum contains IgA ranging in size from 6.4S to 15S with the majority being 11S SIgA (Porter, 1973). Allotypic variants of IgA and several of the IgG subclasses are known. Best described are the IgA a and IgA b Mendelian variants of IgA (Brown et al., 1995). The latter lacks most of its structural hinge owing to a splice site mutation in the first intron. Older serological data and recent molecular studies indicate that allotypic variants also occur among the various IgG subclasses, although the relationship between the older serological data and recent sequence data is unclear. The Ig genes of swine are the best studied of those among common farm animals. Information about them is

Immunoglobulins Table Xl.7.1

385

The swine Igs and their distribution in serum and lacteal secretions H-chain moL wt x 10- 3

Ig

MoL wt x 10-3

IgM dlgA d SIgA IgG (Total) IgG 1 IgG2a IgG2b IgG3 IgG4 IgE

950 320 400 150 150 150 150 150 150 200

PAGE a

AA Comp b

72 58 58 52 52 52 52 52 52

72.4 51.4 51.4 49.5 49.5 49.5 49.5 49.5 49.5 60.7

9

Concentration (mg/ml) c Serum

1.1 (4.5) 1.8 (7.3)

NDe

21.5 (88.0) 9e

Colostrum whey 9

9.1 (7.2)

21.2 (16.8) 95.6 (75.9)

Milk whey

1.4 (18)

'2

5.6 (72) 0.8 (lO)

'2

9 ?

9

'2

9

'2

'2

9

9

9

9

?

'2

9

'2 '2

Estimated from polyacrylamide gel electrophoresis (PAGE). b Based on amino acid composition. Does not include carbohydrate. Length of H-chain will vary depending on the degree of substitution in CDR3 of the VH region. CValue in parenthesis is the percentage of total Ig in that body fluid. From Butler (1995). ddlgA - dimeric IgA; SIgA = secretory IgA; concentration of IgA does not reflect differences in allotype distribution. e ND = not detectable. 9 = no data available. a

summarized in Table XI.7.2 although the most significant features of these Ig genes do not lend themselves to tabular description. Swine C, is highly conserved as it is in all mammals that have been studied. Like all swine Ig genes, it is highly homologous to the human Cl, (80% in C~,4; Sun and Butler, 1997). The greatest homology is with that of sheep. In fact, the amino acid sequence of membrane IgM (/zM) is identical between sheep and swine. Soluble IgM (Sl,) is also most homologous to human S~ although sequence data for S~ are only available for comparison from three species- human, mouse and swine. The various swine IgG subclass genes (Cr) show the greatest intersubclass homology of any species so far studied (Kacskovics et al., 1994). This fact, combined with the virtual absence of plasmacytomas in swine (see Section 17), no doubt contributed to the failure of investigators to separate the subclass proteins using biochemical separation procedures. The nomenclature used is based on order of discovery and frequency of occurrence. The Table Xl.7.2

designations have no homologous relationship to IgG subclasses in other species since subclass diversification occurred after mammalian speciation. The exception to this rule is closely-related species such as rats and mice and sheep and cattle. Like mice, the major sequence differences among the subclasses are found in the hinge and Cterminal portion of C73 domain (Kacskovics et al., 1994). Whether these differences translate into functional differences among swine IgG subclasses, has not been determined. The Ca genes of swine are most similar to human C~2 (Brown and Butler, 1994) and bovine Ca (Brown et al., 1997), since human C~1 is unusual among all species so far studied in having a 39 nucleotide (nt) hinge insertion. This insertion encodes the hinge sequence which is attacked by IgA proteases made by various human bacterial pathogens. Species homology among genes for Ct, and Ca is highest at the 3' end and lowest at the 5' end (Brown and Butler, 1994; Sun and Butler, 1997). The single exception is the

The Ig genes of swine

Ig gene

Linkage group

Homology with other species

C l, S~, Crl, C:,2a, C72b C73, Cr4 C= a, C0~b C, C~. CK MR1, MR2, VHn DR JR

7 7 7

68-75% with all mammals studied,/~M excluded Higher with human S~, than mouse S, Highest overall homology to human C:, Inter-subclass variation most similar to mouse C 7 Highest homology to human C=2 and bovine Cc~ High homology shared with human, horse and bovine Highest homology to human Highest homology to human Most homologous to VH III of human; single VH family

7 7

7 7 7

Single JH genes most homology to human JH6 and mouse JH4

386

C~2 exon, which is considered to be the ancestral sequence for the hinge of IgG and IgA. Cl,2 is variable among species as are the sequences encoding the hinges of IgG and IgA within and between species. The exact number of C v genes remains unknown, although at least eight are detectable in genomic Southern blots (Kacskovics et al., 1994). Whether these are all expressible has not been determined. Allotype variants of both Cvl and Cv2a are known from sequence analysis. There are single C~, C, and Ca genes in swine, although the two discrete allelic variants of Ca discussed above occur in most breeds studied. The variable region of the swine heavy chain locus is highly characteristic and perhaps even unique among farm animals. There are approximately 20 VH genes, all of which belong to a highly homologous (> 90%) family with homology to human VHIII (Sun et al., 1994). In addition, the swine has only a single JH segment. The number of DH segments is still unknown although newborn piglets predominately use only two, DH1 and DH 2 (Sun and Butler, 1996). Whether multiple C~ and C~ genes occur in swine and just how many V~, V~, J~ and J~ segments occur, remains unknown.

The ontogeny of the Ig repertoire Early studies indicated that Ig (IgM) could be detected in 74-day fetuses (Schultz et al., 1971) and that immunizations of fetuses in utero via laparotomy, resulted in immune responses as early as 55 days (Tlaskalova-Hogenova et al., 1994). Potent responses by fetuses immunized by in utero catheterization have been observed (Butler et al., 1986). Recently, Sun et al. (1998) showed that VDJ rearrangement is detectable by day 30 in utero and primarily four VH genes are used throughout gestation. Although VH B is the most 3' functional gene in the heavy chain locus of swine (Sun and Butler, 1996) it is not preferentially used during fetal life (Sun et al., 1998). Studies in newborn piglets reveal that swine express a very limited number of VH genes and DH segments and that these show very little somatic (point) mutation (Butler et al., 1996; Sun and Butler, 1996). During fetal life Sun et al. (1997) observed no somatic point mutation. However, newborn piglets do express hybrid VH genes which can be interpreted to mean that swine utilize somatic gene conversion in the development of their antibody repertoire. Analyses of VH sequences from adult swine reveal somatic hypermutation of the extent that germline VH and DH segment are no longer recognizable. Thus, affinity maturation and somatic mutation most likely proceed in lymph node and spleen germinal centers, as it does in mice and humans and this process begins after birth. Antibody repertoire development in swine must be viewed in relation to other species. Swine appear to follow the pattern of repertoire development that was earlier observed in chickens and rabbits and more

IMMUNOLOGY OF THE PIG

recently in ruminants. These species have been designated the C-L-A (chicken-lagomorph-artiodactyl) group (Butler, 1997). It appears that these species differ significantly from the primate-rodent (P-R) group in Ig gene organization, lymphoid anatomy and repertoire development. The latter utilize large numbers of VH genes from 7 to 14 VH families to generate a potentially large repertoire by combinatorial joining, somatic (point) mutation and life-long generation of B-cells. In contrast, swine and other C-L-A group species utilize hindgut lymphoid follicles to generate diversity from a single VH gene family by somatic gene conversion (chicken) or somatic gene conversion and somatic point mutation (sheep, cattle, swine, rabbit). In some species of the C-L-A group (cattle) extensive length polymorphism of CDR3, also appears to be important. The concept reviewed above and published elsewhere (Butler, 1997), still requires empirical support. Because ileal Peyer's patches (IPP) are important in sheep and they involute early in life, Butler suggested that the extensive development of IPP in fetal and neonatal piglets, and their subsequent involution, parallels that in sheep and most likely serves the same function. However, Reynaud et al. (1991) did not observe gene conversion but did observe point mutation in sheep. Perhaps gene conversion would be undetectable in animals of the age they studied, since somatic point mutation would probably have masked the evidence. Since gene conversion has been shown in cattle (Jackson et al., 1996) it is likely to be a common feature of all Artiodactyla. There are currently no data on Ig~ and Igfl in swine. The only Ig-associated molecules that have been studied are secretory component and J-chain. The latter is found in both polymeric IgM and polymeric IgA as in other species. Porcine J-chain has a molecular weight similar to human J-chain (15 600; Zikan, 1973). Porcine SC is apparent after reduction and alkylation of SIgA and migrates in PAGE with a molecular mass of about 68 kDa which is smaller than that seen for human and bovine SC. The poly Ig receptor of swine has not been cloned and sequenced. There are no unusual data on natural antibodies in swine. Swine no doubt have low affinity, IgM-associated antibodies to most non-self antigens as do all other species when sensitive methods of detection are employed. Gnotobiotic animals have low levels of these antibodies presumably owing to lack of stimulation of the immune system by microbial antigens, B cell superantigens, mitogens or maternal regulatory factors obtained from colostrum.

Species-specific aspects of swine Igs Information to date indicates that two features of swine Igs and Ig genes are unique. However, there are a number of features of the swine Igs that are highly characteristic, albeit shared with other members of the C-L-A group

Major Histocompatibility Complex (MHC) Antigens (Butler, 1997). Both the unique and the characteristic aspects are worthy of discussion. The swine is unique among mammals examined to date in that they have only a single JH (Butler et al., 1996); this is a feature they share with the chicken. The swine is also unique because of the occurrence of two allotypes of IgA that differ at a splice site mutation which virtually eliminates the hinge of the IgA ~ variant. Compared with species such as mice and humans, the swine Igs are highly characteristic and quite different from these two well-studied species. Swine lack a gene for IgD (Butler et al., 1996), have but a single family of VH genes (VH3), probably utilize the ileal Peyer's patch in repertoire development and both somatic gene conversion and point mutation. These are features which the swine share with ruminants, the rabbit and the chicken. However, they are 'species-specific' if the frame of reference is humans and mice. Swine have the largest number of IgG subclasses of species examined to date. Since most species have been poorly studied, this feature may be more characteristic than unique. Finally, all swine IgGs share with bovine IgG2, a four-amino acid deletion in the lower hinge. In mice and humans, this is believed important for recognition by the high affinity Fc7 receptor. This deletion is not shared by human or mouse IgGs or by bovine IgG1. The functional significance of these more compact IgGs remains to be shown.

11


The swine major histocompatibility complex (swine leukocyte antigen, SLA) located on chromosome 7 and overlapping the centromere (Smith et al., 1995), has been the subject of increased attention over the past several years. This has been both because analysis of the MHC may allow the breeding of healthy or more disease-resistant animals and because a detailed understanding of the MHC will make the species more useful as a potential xenogeneic organ donor. The current knowledge of the SLA has recently been extensively reviewed (Schook et al., 1996; Lunney and Butler, 1997). Therefore, this section will summarize the more salient features.

:387

et al., 1996; Lunney and Butler, 1997) for a complete list of

references). The last international test of alloantisera was reported by Renard et al. (1988). Monoclonal antibodies (mAb) have been produced against class I antigens but are mostly reactive against monomorphic determinants. Lunney (1994) summarized the reactivity of known mAb with cells from inbred pigs and with expressed cloned class I gene products. A few mAb reactive with specific class I gene products have been produced (Ivanoska et al., 1991) and some of these show clear reactivity with only one SLA specificity (Kristensen et al., 1992). The class I antigens have been cloned and sequenced (Singer et al., 1982, 1988) and used as probes for class I polymorphism. The high degree of polymorphism of class I genes and the limited number of expressed class I gene products makes restriction fragment length polymorphism (RFLP) analyses difficult to interpret (Singer et al., 1988; Jung et al., 1989; Shia et al., 1991; Smith et al., 1995). Class II antigens Serological methods have produced anti-class II alloantisera, but usually in the presence of class I antibodies. Using SLA-defined recombinant pigs, specific class II alloantisera can be produced and used to type these antigens (Lunney et al., 1978; Thistlethwaite et aI., 1983). The mAb generated to date have mostly shown reactivity to monomorphic determinants of class II antigens (Lunney, 1994). Because of molecular weight differences, SLA-DR can be differentiated from SLA-DQ on nonreducing gels (Schook et al., 1996). The class II genes of pigs have been defined (Sachs et al., 1988) and most genes have been cloned (Hirsch et al., 1990, 1992; Pratt et al., 1990). Using both of these porcine genes as probes, and specific human probes, enabled many labs to perform RFLP analyses of porcine class II genes (Sachs et al., 1988; Shia et al., 1991; Smith et al., 1995). More recently defined methods for PCR RFLP, have enabled scientists to clearly type SLADRB and SLA-DQB alleles quickly (Shia et al., 1995; Brunsberg et al., 1996; Komatsu et al., 1996). This is currently the best method for SLA typing outbred pigs. Class III genes

Methods to characterize MHC antigens

Early data used serologic criteria to evaluate C2, C4 and Bf levels (Lie et al., 1987; Chardon et al., 1988; Geffrotin et al., 1990). Most of the genes in the region have been defined by cloning (Peelman et al., 1995, 1996; Chardon et al., 1996).

Class I antigens

Distribution, structure, and function of MHC antigens

Serology with alloantisera has been and continues to be the most reliable method for assigning class I alleles to individuals from uncharacterized families. Panels of alloantisera have been characterized most extensively by Vaiman in France and Kristensen in Denmark (see Schook

The class I antigens are widely expressed in porcine tissues. Assays have shown expression in some embryonic tissue but it is restricted. The class II antigens show definite restricted expression. As expected, they are expressed in B cells and activated macrophages, but they are also

DMA RING3

RING? COLllAZ DPBl RING1 KE4 DPA2 DPAl

DNA

RING9 TAP1 LMP7 DOB2 LMP2 TAP2 DQA?

DMB

DOB

DOBl DOAl

DRB2

DRR9 DRA

0083

I SLA-II

t

DPB DPA

DOB TAP1

XA

RAGE G I 5 F 1 3 GI8 GI4

..

SLA-Ill

Swine -

DRA

-

...

-

.-

.:"?:)" bovine cytokines. Genes and proteins were sequenced ~..~..;;~:, :. and methods for their identification (monoclonal anti . . . . . ;_,,:. , bodies (mAb) and primers for polymerized chain reac-~ ~ tions (PCR)) and quantification (bioassays as well as . ..~:,'v. ELISA) were developed. Moreover, recombinant cytokines were produced to explore their immunomodulaFigure Xlll.2.1 Frozen section of bovine thymus stained iF ' "

.~ . . . . . .

"

tory and therapeutic use in vaccine delivery and treatment, In conclusion, bovine immunology is a rapidly evolving field of research in veterinary sciences. It is therefore most Handbook of Vertebrate Immunology

ISBN 0-12-546401-0

~

it..;.."

. . . .

"

~ "

r

"'.,~

~'

i ,~ ~ .

....

.....7,:i.-~

. . . . . .

~';

with a mAb specific for CD1. The determinant is expressed in this tissue only by cortical thymocytes and therefore clearly discriminates the lymphocyte population of the cortex (C) from the more mature cells of the medulla (M). ( x 70) Copyright 9 1998 AcademicPress Limited All rights of reproduction in any form reserved

440

IMMUNOLOGY OF CATTLE

Table X111.2.1 Probable location of leukocyte populations in bovine thymus (modified from Morrison et aL, 1988)

Population

Approximate %

Probable location

CD2-CD4-CD8CD2+CD4+CD8+ CD2+CD4-CD8 + CD2+CD4+CD8 75TCR + Interdigitating cells

10-20 50-60 5-15 5-15 5-15 ND

Small numbers in outer cortex Large numbers in cortex; absent in medulla Moderate numbers in medulla; absent in cortex Moderate numbers in medulla; absent in cortex Moderate numbers in medulla; small numbers scattered in cortex Scattered in medulla

ND,

not

done.

epithelial cells (Morrison et al., 1986). The main T cell phenotypes found in the thymus and their approximate locations within the organ are summarized in Table XIII.2.1.

Lymph node

The bovine lymph node is similar in structural organization to that of the ~mouse and man. The node is an encapsulated organ composed of an outer cortex, an inner medulla and an intervening paracortical region. The cortex has a segmented appearance as a result of a number of connective tissue trabeculae that extend in from the capsule; the capsule and trabeculae are separated from the substance of the cortex by sinuses. Lymphoid cell populations within the node are supported by a framework of reticulin that is covered by reticulum cells. The substance of the node is interspersed by sinuses, which facilitate cell migration. The lymph node cortex is dominated by follicular areas, which lie adjacent to the sinuses adjoining the capsule and trabeculae. It is in the follicles that the greater

proportion of the nodal B lymphocytes are found (Figure XIII.2.2). These areas also contain some CD4 § T cells and small numbers of CD8 § T cells. Up to 70% of follicles in lymph nodes of healthy 6-12-month-old animals contain germinal centres (Morrison et al., 1986), which are composed largely of proliferating B lymphocytes and follicular dendritic cells (FDC). It is in germinal centres that maturation of the antibody response occurs, through the interaction of specific B cells with immune complexes trapped by FDC. The interfollicular cortex and paracortex are largely populated by CD4 + and CD8 + T lymphocytes interspersed by interdigitating dendritic cells (Figure XIII.2.3). Moderate numbers of 78 T cells are found in the paracortex and this population also lines the subcapsular region of the cortex (Figure XIII.2.4). Relative proportions of T cells in these areas of the node are reflected in their phenotypic distribution in cell lymph node suspensions, as outlined in Table XIII.2.2. The lymph node medulla is composed of cord-like structures interspersed with sinuses that drain into the efferent lymphatic vessel. These sinuses contain populations of cells in transit from the node that presumably give rise to the cells of efferent lymph. Distribution of immune cell populations within the lymph node are summarized in Table XIII.2.3.

............... ~:~I: :~:`.~*

,;,f90%) derived from blood lymphocytes that have circulated through the lymph node by crossing the high endothelial venules of the paracortex

The mucosa-associated lymphoid tissue is organized in aggregations of lymphoid structures in the mucosa and submucosa of the intestine, namely the Peyer's patches (PP), in isolated nodules in the lamina propria, and in

Lymphoid Organs

isolated cells dispersed in the lamina propria and between the epithelial cells of the mucosa. The new-born calf has approximately 76 discrete PP (DPP) in the duodenum and jejunum, a single continuous PP (CPP) in the ileum, which extends proximally and terminally in the terminal jejunum and proximal cecum, respectively, and a single DPP in the proximal colon (Parsons et al., 1989, 1991). At sexual maturity (18 months) the CPP is involuted and 18-40 DPP remain visible in adult cattle. As in sheep (Reynolds and Morris, 1983), the involuting CPP appears to be a primary lymphoid organ, namely a site of B-cell generation equivalent to the bursa of Fabricius of birds, where lymphopoiesis is not dependent upon antigen. In contrast, the DPP, cecal and colonic PP(CoPP) and propria nodules of the large intestine which have similar lymphocyte compositions, appear to be secondary lymphoid organs; they enlarge with age and develop germinal centres upon antigen stimulation. The follicle-associated epithelium (FAE) and the membranous cell (M cell) The epithelium covering the PP consists of the follicleassociated epithelium (FAE) and the interfollicular epithelium (IFE). The FAE, which is devoid of goblet cells, forms with the underlying mucosa a dome over the follicle and bulges into the lumen of the intestine (domed villus) (Parsons et al., 1991). The FAE of the CPP consists of a homogeneous population of M cells with short, sparse microvilli and microfolds (Landverk, 1987). The FAE of the DPP also contains M cells, but these are scattered between absorptive enterocytes. The FAE of the proximal part of the CPP appears to be a transitional zone where the FAE of some domed villi are composed by pure M cells while others are composed of a mixture of M cells and absorptive enterocytes as in the DPP. M cells are thought to be responsible for transport of macromolecules and processed proteins towards the follicles and thus to play a role in the uptake and presentation of antigen to the underlying tissue. Indeed, it has been shown that M cells endocytose bacteria (Ackermann et al., 1988; Momotani et al., 1988) and shed 50nm carbonic anhydrase-positive membrane-bounded particles through the underlying intercellular spaces into the underlying follicles (Landverk, 1987; Parson et al., 1991). Subepithelial and intraepithelial macrophages in the domed villi containing bacilli or bacterial debris have also been demonstrated and probably take part in antigen presentation. The interfollicular areas are overlaid by the IFE which forms leaf-shaped absorptive villi, as opposed to the finger-like absorptive villi in other parts of the small intestine. The domed villi of the DPP are completely obscured by absorptive villi, while those of the CPP remain occasionally visible. In the adult, isolated follicles remain in the ileum after involution of the CPP. The FAE of these isolated follicles

443

contain clusters of M cells scattered among absorptive cells (Parsons et al., 1991). The lymphoid tissue of the large intestine comprises a single colonic DPP in the proximal colon, which extends into the cecum, and isolated propria nodules in the remaining colon, which decrease in number towards the rectum (Liebler et al., 1988a; Parsons et al., 1991). The colonic PP consists of lymphoglandular complexes with openings to deep invaginations into the submucosa and contains propria nodules with domed areas at the mucosal surface (Liebler et al., 1988a,b; Parsons et al., 1991); the FAE of the domed areas are of the CPP type while the FAE of the lymphoglandular complexes are of the DPP type. Lymphocyte distribution A detailed study of the lymphocyte distribution in the GALT of young and adult cattle was performed by Parsons et al. (1989). The DPP consists of round and pear-shaped (apex towards the lumen) B cell follicles along the intestinal mucosa, interspersed with T cell agglomerations (interfollicular T cell zones) and capped by domed villi. The CoPP have B follicles at the surface, sides and base of invaginations of the mucosa, with T cell zones between them. The jejunal and CoPP of calves are similar in B- and T-cell distribution (B/T ratio = 2:1), having characteristics of secondary lymphoid organs (Table XIII.2.6). Conversely, the CPP is a B lymphoid structure with few T cells (B/T ratio = 20:1) indicating its possible primary lymphoid organ nature (Table XIII.2.6). The CPP is characterized by a sequential accumulation of pillar-like follicles (small diameter towards lumen) along the intestine; T cells form only occasionally small T-cell agglomerations between some follicles and are scanty in the apices of the domed villi and in absorptive villi (Parsons et al., 1989). After involution of the CPP, the ileum contains single B follicles with T cells in the domed and absorptive villi. In adult animals, T cell distributions of the jejunum (DPP), colon (CoPP) and ileum become similar with :t B/T cell

Table X111.2.6 Flowcytometric analysis of lymphocyte distribution (%)a in cell suspensions of the GALT (Parsons et aL, 1989)

mlg + B cells CD2 + T cells CD4 + T cells CD8 + T cells WC1 + T cells

Jejunum/DPP

Ileum/CPP

35 19 11 12 8

40 3 2 3 2

(36) nsb (39) ~176 (28) 0.05 (10) ns (6) ns

Colon/CoPP

(24) ns 51 (29) ~17617619 (14) 0.05 9 (16) ~176 11 (15) 0.05 9

(43) ns (33) ns (22) ns (20) ns (14) ns

aNumbers without brackets are mean percentages in calves (< 1 week; n = 6), numbers in brackets refer to adult cattle (2-6 years, n = 6). bp between adult cattle and calves; nSnot significant.

444

I M M U N O L O G Y OF CATTLE

Table X111.2.7 T lymphocyte subset distribution a by image analysis of cryostat sections of the discrete Peyer's patches (DPP, jejunum), c o n t i n u o u s Peyer's patches (CPP, ileum) and C o P P (colon) (Parsons et al., 1989) DPP C D 4 + Tcells

Dome Mucosa

C D 8 + Tcells

Dome Mucosa

W C l + Tcells

Dome Mucosa

CPP

3 (21) ~176176 1 (10) ~ 1 7 6 1 7 6

CePP

2 (na) < 1 (11) ~ 1 7 6 1 7 6

2 (4) 0.05 1 (5) ~ 1 7 6 1 7 6

CoPP

2 (19) ~176 2 (2) as

< 1 (8) ~ 1 7 6 1 7 6 1 (9) ~176176

< 1 (na) 1 (9) ~176

< 1 (2) o.o5 1 (2) as

< 1 (3) ~ 1 7 6 2 (8) ~176

< 1 ( < 1)as < 1 (1) ~ 1 7 6

< 1 (na) < 1 ( < 1) as

< 1 ( < 1)ns < 1 (1) o.o5

< 1 (1)as < 1 ( < 1) as

aMean of percentages of area stained in tissue sections by lymphocyte-specific monoclonal antibodies; numbers without brackets are values for calves (< 1 week, n = 4), numbers in brackets refer to adult cattle (2-6 years, n = 4). bp between adult cattle and calves; ns not significant. na, not applicable.

ratio of 1:1, indicating an increase with age of T cells over B cells in secondary lymphoid organs (Table XIII.2.6). In adult cattle, CD4 § T cells outnumber the CD8 § T cells in the dome of the DPP and CoPP (CD4 +/CD8 + = 3:1 to 6:1) while equal or higher numbers of CD8 § T cells are observed in the mucosae (CD4 +/CD8 § - 1:1 to 1:4) (Table XIII.2.7) (Parsons et al., 1989).

3.

The Leukocytes and their Markers

The investigation and characterization of cattle leukocyte differentiation antigens has resulted in the identification of a large number of surface molecules. Differential expression of these molecules has allowed the identification of functionally distinct subpopulations of cells, enabling in vitro and in vivo studies of their roles to be made in immune responses following infection or inoculation of antigens. Three international workshops have been held to compare mAb to cattle leukocyte differentiation antigens (Howard et al., 1991; Howard and Naessens, 1993; Naessens and Hopkins, 1996). Within these it has been agreed that since investigations in a number of mammalian species have established a considerable homology between the molecules expressed on the leukocyte surface, their function and the role of the cells that they identify, where possible, the cattle nomenclature should follow that adopted for human antigens. For an antigen to be given a bovine CD (boCD to distinguish the cattle molecule from the human one if necessary) number there should be very strong evidence that the molecule recognized is the homologue of a human CD antigen. This might include similarities in Mr, cell and tissue distribution, information on its function, sequence data, and cross-reactivity with human antigens. The mAbs that

have been accepted as recognizing cattle CD antigens within the three workshops are listed in Table XIII.3.1 together with a summary of their cellular expression. The function of these molecules, in some cases, has been studied in cattle systems and shown to be the same as for their homologues in humans, in other cases it is assumed to be the same and immunological investigations with the mAb are made on this basis. Within the workshops several clusters of mAb were identified that defined the same molecule but for which no human homologue was evident. These mAb are given workshop cluster (WC) numbers prefixed with 'bo' if necessary with the addendum that if the human CD homologue is established by subsequent studies a CD number, or other notation, should be substituted, as has occurred for WC2 (TCR-1), WC3 (CD21). Of these cattle molecules, the WC1 antigen has been the most studied. Sequence analysis of a cDNA clone showed that it belonged to an ancient family of cysteine-rich proteins while Southern blotting suggested that the bovine genome contains multiple WCl-like genes (Wijngaard et al., 1992). The WC1 antigen is expressed by a majority of 75 T cells in blood, where it comprises about 25% of peripheral blood mononuclear cells in young calves, and a minor subset of gut intra-epithelial lymphocytes (Clevers et al., 1990). Subsequent studies (Wijngaard et aI., 1994) reported that the genes may be differentially expressed on subsets of WC1 § cells while more recent investigations indicate a role in 75 T cell activation (Hanby-Flarida et al., 1996). An alternative means of identifying cattle antigens has been to investigate mAbs to established human CD antigens for cross-reactivity on cattle cells. A survey of 772 mAbs submitted to the Fifth Human Leukocyte Antigen Workshop (Schlossman et al., 1995) for ability to stain bovine leukocytes showed that 8.4% of mAbs stained cattle cells. A caveat to this approach is that specificity of staining must be confirmed. Thus, in this investigation of

The Leukocytes and their Markers

445

Table X111.3.1 Antibodies to bovine cell surface antigens Antigen

CD1

Main cellular expression


mAbs

46

CC13 a, VPM5 d, TH97A c

46

SBU-20-27 g

46

CC14 a, 0020 a, 0040 a, 0090 a, CC122 a

44

CC43 a, CC118 a

SRBC, LFA-3 (CD58) receptor

58-62

T cell receptor complex T4, L3T4

12, 16, 22, 36 and 46 50

CC42 a, IL-A26 b, IL-A42 b, IL-A43 b, IL-A45 b, 16-1E 10 e , CH128A c, CH132A c, BAQ95A c, BAT18A c, BAT42A c, BAT76A c, CACT31A c, MUC2A c MM1A c

Other names

CD2

CT, IDC subset, ALVC subset CT, mono/macro, Lang, DDC, ALVC subset CT, IDC subset, ALVC subset CT, B cells, mono/ macro, DDC, ALVC subset T, thy

CD3

T

CD4

T subset (helped inducer)

CD5

T, B subset, thy

T1, Lyl

67

CD6

T subset, thy

T12

110

CD8

Tsubset (cytotoxic/ supressor)

T8, Lyt2, 3

34, 38

CD11 a

Leuk

LFA-1

180, 95

CD11b

Mono/macro, B subset, gran Mono/macro, gran Mono/macro Leuk B, ALVC subset, Alveolar macro Act T

MAC-1

170, 95

CR4 LPS receptor Integrin ~2 subunit WC3, CR2

160, 95

CDlwl CDlw2 CDlw3

CD11c CD14 CD18 CD21 CD25 CD41/CD61 CD44 CD45

Leuk, RBC, platelets Leuk

CD45R

Tsubset, B, thy subset

CD45RO

T subset mono/ macro, thy subset, gran T, B, thy, mono Tsubset, B subset, gran, mono/macro Act T, Act B, macro

CD49d CD62L CD71

CDlb

95 145

IL-2 R (p55), Tac GPII/~

55

Pgp-1

95

Leukocyte common antigen

180, 205, 220

~4 integrin, VLA-4 L-selectin Transferrin receptor, T9

205, 220

ST-4A ~, 0 0 8 a, 0026 a, 0030 a, IL-A115, IL-A125, GC50A, CACT83A c, CACT87A c, CACT138A c, GC1A1 c 8C11 h, JP1 D4 h, CC17 a, 0029 a, IL-A675, BLT-1 J, 79-5 g, SBU-25-91 g NAM3 h, 0038 a, IL-A275, IL-A285, IL-A575, BAQ82A c, BAQ91A c, CACT141A c ST-8 f, 7C2 f, CC58 a, CC63 a, IL-A515, SBU-3865 g, BAQ111A c, BAT82A c, CACT80 ~ CACT88 c, CACT130 c MD1 H11 h, IVA3~, IL-A995, CBU-72-87 g, BAQ30A c, MUC76A c CC94 a, CC104 a, CC125 a, CC126 a, IL-A155, IL-A1305, MM10 c, MM13 c NAM4 h, IL-A165, C5-B6 e, BAQ153A c CC-G33 a, VPM65 d, VPM66 d VPM67 d MF14B4 h CC21 a, CC37 a, CC51 a, CC70 a, IL-A65 b, BAQ15A c IL-A1115, CACT108A c, CACT109A c, CACT116A c IVA3d, IVA31 j, IVA38j, IVA125j, IL-A1645, IL-A1665, CAPP2A c Bufl/, IL-A1075, IL-A1085, IL-A1125, IL-A118 b, SBU-25-32 g 151 f, 2E8 i, TD14 d, TD15 d, VPM18 d, SBU-1-28 g

180

IVA95j, IVA103j, IVA112j, IVA313j, IVA352j, IVA373j, CC31 a, CC76 a, CC77 a, CC99 a, CC103 a, Bo42 m, BAG36A c, GC6A c, GS5A c, GX18A c IL-A1165

90

Clone 218 f Buf44/, IVA94j, CC32 a, BAQ92 c, Du-1-29 ~ IL-A77 b, IL-A165 b (continued overleaf)

446


Table X111.3.1 (Continued)

Antigen

Main cellular expression

Other names


TCR1

T subset

WC2, y& TCR

37, 47

WC1

Tsubset

T19

215, 300

WC4 WC5 WC6

B B, act T B, T subset, thy, ALVC B, T, thy Act T B, T subset, mono/ macro, gran

WC7 WC8 WC9

WC 10 WC11 WC13 WC14 WC15

9O 46 210-220 62, 69 150 25

T subset, act T, B, thy Leuk, platelets, RBC

39, 115

Mono/macro, gran, Tsubset, B subset RBC

150, 158

52, (74) Gran 63, 85 PBM

mAbs CACT16A c, CACT17A c, CACT18A c, CACT61A c, CACT71A c, CACTB6A c, CACTB 12A c, CACTB44A c, CACTB81A c, 86-D ~ 197 ~, NAM2 h, CC15 a, CC39 a, CC101 a, CC115 a, CC117 a, IL-A29 b, BAG25A c, BAQ4A c, BAQ89A c, BAQ90A c, BAQ128A c, BAQ159A c, B7A1 c, CACTB 1A c, CACTB7A c, CACTB15B c, CACTB31A c, CACTB32A c 0055 a, 0057 a IL-A54 b, IL-A55 b 0098 a, IL-A53 b, IL-A1145 TH1A c, TH18A c IL-A78 b, IL-A79 b, P13 b IVA31 j, IVA37 j, IVA5(Y, IVA114 j, IL-A96 b, IL-A134 b, IL-A163 b, BAQ86A c, MM41 c, RH1A c, R18A c, TH2A c 0 0 2 8 a, 0062 a, 0 0 6 9 a, IL-A56 b, CACT114A c IL-A117 b, IL-A136 b, CA26/1 m, CA17/1/6 m, 1CI0 j, BAGB27A c Co-3D1 D4 k, Bufl 3 / BT3/8.12 b, IL-A155 b IL-A135 b, IL-A137 b, IL-A138 b, IL-A160 b, ANA8 c

Abbreviations: Act, activated; ALVC, afferent lymph veiled cells; B, B cells; CT, cortical thymocytes; DDC, dermal dendritic cells; FDC, follicular dendritic cells; Gran, granulocytes; IDC, interdigitating cells; Lang, Langerhans cells; Leuk, leukocytes; Macro, macrophages; Mega, megakaryocytes; Mono, monocytes; RBC, red blood cells; T, T cells; Thy, thymocytes. alnstitute for Animal Health, Compton Laboratory, Compton, Nr. Newbury, Berkshire, RG20 7NN, England. Contact: C. J. Howard. E mail: [email protected]. Fax:++44-635-577237.*t blnternational Lifestock Research Institute, P.O. Box 30709, Nairobi, Kenya. Contact: J. Naessens, E mail: [email protected]. Fax:++254-2-631499.$ CDepartment of Veterinary Microbiology & Pathology, Washington State University, Pullman, WA 99164-7040, USA. Contact: W. C. Davis. E mail: [email protected]. Fax: ++1-509-335-8328.w dDepartment of Veterinary Pathology, University of Edinburgh, Summerhall, Edinburgh EH9 1QH, Scotland. Contact: J. Hopkins. E mail: [email protected]. Fax: ++44-31-650 6511 .* eUniversity of Wisconsin, Department of Veterinary Science, Madison, Wl 53706, USA. Contact: G. Splitter. ~Basel Institute for Immunology, Grenzacherstrasse 487, Postfach, CH-4005 Basel, Switzerland. Contact: P. Griebel. Fax: ++41-61492380.1gCentre for Animal Biotechnology, School of Veterinary Science, University of Melbourne, Parkville 3052, Victoria, Australia. Contact: A. Nash. E mail: [email protected]. Fax: ++61-3-347 4083. hFacult@s Universitaires Notre Dame de la Paix, Immunology Unit, Rue de Bruxelles 61, B-5000, Namur, Belgium. Contact: J-J. Letesson. !University of Connecticut, Department of Pathobiology, 61 N Eagleville Road, Storrs, CT 06269-3089, USA. JSIovak Academy of Sciences, Institute of Animal Biochemistry and Genetics, 900 28 Ivanka pri Dunaji, Slovakia. Contact: R. Dusinsky. E mail: [email protected]. kFacultad de Veterinaria, Departemento de Genetica, Avda. de Medina Azahara, 9, 14005 - Cordoba, Spain. E mail: e 1Ilrud@lucano. uco.es. iological Research Center, H.A.S., Institute of Genetics, POB 521, H-6701 Szeged, Hungary. Contact: I. Ando. Fax: ++36-62-433503. mlmmunology Unit, Veterinary School, Bischofsholer Damm 15, D-3000 Hannover 1, Germany. Contact: W. Leibold/H. J. Schuberth. E mail: [email protected]. Fax:++49-511-856 7685. Some of the mAbs listed from the laboratories marked *, t, $ or w (below) are available from the following depositories and commercial suppliers: *Serotec Ltd., Bankside Station Approach, Kidlington, Oxon, OX5 1JE, UK. Fax: ++44-1865-379941 (USA 1-800-265-7376) tEuropean Collection of Animal Cell Cultures, Centre for Applied Microbiology & Research, Porton Down, Salisbury, SP4 0JG, UK. http:// www.gdb.org/annex/ecacc/HTML/ecacc.html SAmerican Type Culture Collection, 12301 Parklawn Drive, Rockville, MD 20852 USA. http://www.atcc.org w Inc., P.O. Box 502, Pullman, WA 99163, USA. Tel: ++1-509-334-5815. http://www.vmrd.com

Cytokines

447

Table X111.3.2 Monoclonal antibodies to human leukocyte differentiation antigens that cross-react with bovine cells

Antigen

Main cellular expression (in humans)

Other names

mAb

CD11 a CD14

Leuk Mono/macro

LFA-1 LPS receptor

CD18 CD21

Leuk B cells, FDC

CD27 CD29 CD49a CD49b CD49d CD49e CD51 CD61a CD62L

Thy, T cells Leuk Act T, mono B, mono, platelets B, thy T subset, mono, platelets Platelets, mega Platelets, mega, macro T subset, B subset, gran, mono/macro Platelets, mega, endothelium Act platelets, mono/macro B T, B, NK, gran, all human cell lines Broad expression on haemopoietic cells

Integrin/~2 subunit C3d receptor, EBV receptor

CBR-LFA-1 a MY4, $39 a, M5E2, RPA.MI, biG10, biG12, biG13, biG14, TUK4 6.7 a, CBR-LFA-1 WEHI-B2 a, HB5C, B2, KS-8, KS-9, BL13/10B1a, BU36, BU42 M-T271 a 5D9, K20, 4B4 a, TS2/10, JB1, mAb13 1 B3.1 a, SR84

CD62P CD63 CDw78 CD98 CD100

Integrin fil subunit ~1 integrin, VLA-1 O~2 integrin, VLA-2 ~4 integrin, VLA-4 ~5 integrin, VLA-5 ~V integrin Integrin ,/~3 subunit L-selectin

5E8, G1 14 a, Gi9

5D5, 9F10, L25 a X6, SAM- 1a 13C2 a, 23C6 C5-1, LM609 a, AP6 LAMI-3 a, Dreg 56, FMC 46

P-selectin, PADGEM Ba 4F2

sz-51 a 46-4-5, 79-2-7, MOF11 a FN4 a 2F3 a

GR3

BD16 a

Abbreviations: act, activated; B, B cells; CT, cortical thymocytes; FDC, follicular dendritic cells; gran, granulocytes; IDC, interdigitating cells; Lang, Langerhans cells; leuk, leukocytes; macro, macrophages; mega, megakaryocytes; mono, monocytes; RBC, red blood cells; T, T cells; thy, thymocytes. aStudied in two colour-staining experiments on bovine cells (Sopp and Howard, 1997). A full description of mAbs and a list of suppliers is included in Leukocyte Typing V (Schlossman et aL, 1995).

the CD groups that contained cross-reacting mAbs, 18 of the groups contained mAbs that showed similar expression of the target antigen on cattle and human cells (Table XIII.3.2) and these identified new cattle CD antigens not previously recognized within the three cattle workshops (Sopp and Howard, 1997). mAbs within nine CD groups stained cattle and human cells differently, indicating either a modified cell distribution for the antigen in cattle or cross-reaction with an epitope expressed on a different antigen, mAbs to defined antigens in other animal species that cross-react with cattle can be added to the list of reagents useful for bovine studies. Expression of these leukocyte differentiation antigens has allowed the identification of the major populations of T lymphocytes and their subsets, which in some cases have distinct functional properties. Two major subpopulations comprise the ~fi TCR § T cells. These are the MHC class II restricted CD4 + T cells that provide help for B-cell responses (Baldwin et al., 1986; Howard et al., 1989) and the MHC class I restricted CD8 + T cells (Ellis et al., 1986). Within the CD4 § population subsets are evident and identified by expression of different isoforms of CD45. Cells responding in proliferation assays to soluble antigen are CD45RO § and IL-4 and IFN-7 production is evident within these cells (Bembridge et al., 1995). This memory subset recirculates preferentially to the skin and mucosa as

first described in sheep (Mackay et al., 1990). Current investigations of a TH1/TH2 bias in cattle indicate that cells which differentially synthesize cytokines are present within the CD4 + population (Estes et al., 1995). The CD8 § T cells have been shown to be cytolytic and to be central to immunity to certain virus infections (Goddeeris et al., 1986; Taylor et al., 1995). Several subsets of 78 TCR + T cells are evident in cattle. In the blood the W C I § CD2+, C D 8 - phenotype predominates but other minor subsets that are W C 1 - , CD2 + and CD8 § or C D 8 - are evident and these predominate in spleen and the gut mucosa (Clevers et al., 1990; Wyatt et al., 1994, 1996). The function of these cells has not been established but they appear to require exogenous IL-2 and a cellular signal to induce proliferation that is not via CD28 or MHC restricted (Collins et al., 1996; Howard et al., 1996; Okragly et al., 1996).

4.

Cytokines

Cytokines play a central role in immunological, physiological and pathological processes in animals. Our knowledge about bovine cytokines is increasing rapidly owing to the application of molecular cloning techniques. A better

448

TableXlll.4,1

IMMUNOLOGY OF CATTLE Cloned bovine cytokines Database accession number

Tissue or cell source

CD40L c (CD40 ligand) ENAd (epithelial-cell derived neutrophil attractant) EPO (erythropoietin)

Z48469

Lymphocytes

86149

Activates neutrophils Chemoattractant

EPOR (EPO receptor)

U61398 U61399 M35608 M97661 M13439 M13440

Monocytes Macrophages Epithelial cells Liver Kidney Spleen Bone marrow Retina Brain Pituitary Epithelial cells

Modulates the proliferation of several cell types Promotes cell survival Decreases inducible nitric oxide synthetase activity in endothelial cells

Cytokine/receptor

FGFacidica/basic b

(fibroblast growth factor)

FGFR (FGF receptor) G-CSF (granulocyte colony stimulating factor) GM-CSF (granulocyte macrophage colony stimulating factor)

L41354

Z68150 P35833

Oviduct Epithelial cells Monocytes

U22385

Monocytes

GRO d (melanoma growth stimulatory activity) ICAM (intracellular adhesion molecule) IFN-~//~ (interferon c~and/~)

U65789 L41844

IFN-~ (interferon ;,)

M29867 Z54144

T cells NK cells

IGF- l a/2 b

X15726 M60420 S76122 X53553

Liver Oviduct

(insulin-like growth factor)

> 14 entries

Monocytes Epithelial cells Mesothelial cells Endothelial cells Mammary gland Lymph node Monocytes Macrophages B and T cells Endothelial cells Fibroblasts

Biological activity

Chromosomal location

References

Mertens et al. (1995)

Stimulates proliferation and differentiation of erythroid progenitor cells

AIImann-lselin et aL (1994) 29

Agaba (1996) Suliman et al. (1996) GenBank (1996)

a7q31.3-31.2 b17

Abraham et al. (1986) Alterio et aL (1988) Goureau et al. (1995) Halley et al. (1988) Solinas-Toldo et al. (1995)

GenBank (1995) Enhances the differentiation and activation of neutrophils Growth-inducing factor for hematopoietic progenitor cells Enhances mature neutrophil functions Chemotaxis on neutrophils

Kehrli et al. (1991) Lovejoy et al. (1993) 7q23-31

Daley et al. (1993) Maliszewski et al. (1988) Reddy et al. (1990) Rogivue et al. (1995) GenBank (1996)

Antiviral activity Immunomodulating effects Regulates functional activity of macrophages and neutrophils

8q15

Stimulates macrophage activity Immunomodulating effects Increases surface expression of MHC class I and II on various cell types Stimulates cytotoxity Possible effects during ovulation Synergizes with EPO to enhance erythropoiesis

5q24.1

5q22-23 a 299

Capon et al. (1985) Chaplin et al. (1996) Eggen and Fries (1995) Hansen et al. (1991) Leung et al. (1984) Tizard (1995) Velan et aL (1985) Cerretti et al. (1986) Tizard (1995) Solinas-Toldo et al. (1995)

Brown et al. (1990) Easton et al. (1991) Fotsis et al. (1990) Li and Congote (1995) Schmidt et al. (1994) Schmutz et al. (1996)

(continued)

Cytokines

449


Cytokine/receptor

Database accession number


Biological activity

IGF-1Ra/2R b

(IGF-1 and 2 receptors) LIFe (leukemia inhibitory factor) IL-I~//Y (interleukin-1 =//~)


21 a 9q25-27 b D50337

Fibroblasts

X12497 M37210 M35589 M37211

Monocytes Macrophages Neutrophils Endothelial cells

IL-1 R type 1/11 (IL-1 receptor)

Neutrophils Fibroblasts Leukocytes T cells

IL-2 (interleukin 2)

M12791 M13204

IL-2R ~a/Tb (IL-2 receptor ~/7) IL-3

M20818 U24226 L31893

T and B cells Monocytes T cells Spleen

IL-4

M77120 U14159 U14160

T and B cells Monocytes Macrophages

IL-5 IL-6 e

Z67872 X57317 Zl1749

Lymphocytes T cells Monocytes Macrophages Endothelial cells

IL-7

X64540

IL-8 d (interleukin-8 like protein)

861479

Pro-inflammatory cytokine Induces neutrophilia and monocytosis Activates osteoclasts Synergizes with other cytokines to promote B and T cell proliferation Immunoadjuvant Induces acute phase response

Stimulates proliferation and differentiation of T lymphocytes Induces proliferation and immunoglobulin secretion by B lymphocytes Immunoadjuvant

Stimulates early stages of hematopoietic cell differentiation Synergizes with other hematopoietic growth factors to promote proliferation of hematopoietic progenitor cells Upregulates various cellsurface markers on B cells and enhances the production of immunoglobulins Inhibits proliferation of Thl and Th2-1ike clones Stimulates the production of acutephase proteins by hepatocytes Role in inflammatory reactions

Activates neutrophils Chemoattractant for neutrophils

Moody et al. (1996) Solinas-Toldo et al. (1995) GenBank (1995)

Collins and Oldham (1995) Godson et al. (1995) Lederer and Czuprynski (1995) Leong et aL (1988a,b) Maliszewski et al. (1988) Reddy et al. (1993)

11

Yoo et al. (1994)

17q26-27

Cerretti et al. (1986) Collins and Oldham (1995) Morsey et al. (1995) Reeves et al. (1986, 1987) Solinas-Toldo et al. (1995)

13q13-q14 a Xq23 b

Weinberg et al. (1988) Yoo et al. (1995, 1996b) Mwangi et al. (1995) Mertens et al. (1996)

7q15-q21

Heussler et al. (1992) Estes et al. (1995) Buitkamp et al. (1995)

4

14 Mononuclear cells Neutrophils

References

Mertens et aL (1996) Adams and Cruprynski (1995) Agaba (1996) Droogmans et al. (1992) Jian et al. (1995) Nakajima et al. (1993) Richards et al. (1995) Sterpetti et al. (1993) Agaba (1996) Cludts et al. (1992) Hassfurther et al. (1994) (continued overleaf)

450



Cytokine/receptor

Database accession number


Biological activity


References

Li et al. (1996)

IL-8R (IL-8 receptor)

U19947

IL-10

U00799

T cells Monocytes B cells

IL-12 p40/p35 (interleukin 12, subunits 40 and 35)

Ul1815 U14416

Lymphocytes Macrophages

IL-15

U42433

Macrophages B cells Lymph node

Anabolic agent for muscle cells

GenBank (1996) Quin et al. (1996)

MCP-1/2 (monocyte chemotactic protein 1 and 2) NGF c (nerve growth factor) OSM e (oncostatin M)

M84602 L32659 $67956

Monocytes Endothelial cells Seminal vesicles

Monocyte chemoattractant

Wempe et al. (1991,1994) Kakizaki et al. (1995)

Neurotrophic effects Role in ontogenesis

Eggen and Fries (1995) Meier et al. (1986)

PECAM (platelet endothelial cell adhesion molecule)

U35433

Endothelial cells

PTN (pleiotrophin)

X52945

Uterus Cartilage Brain

Induces neurite outgrowth activity Mitogenic for endothelial cells

Delbe et al. (1995) Li et al. (1990)

SCF (stem cell factor)

D28934

Bone marrow Spleen Lymph node

Mertens et al. (1997) Zhou et al. (1994)

TGF-/~b (transforming growth factor/~)

482694 M36371

Bone cells M ac rophag es Wart Mammary gland

TNF-o~a,c/~ c

(tumor necrosis factor

~//~)

Z 14137 Z48808 Z14137

M acrophages Monocytes Tand B cells Neutrophils Endothelial cells

Synergizes with other hematopoietic growth factors to stimulate myeloid and erythroid progenitor cells Inhibits growth of several cell types Induces endothelin release Mediator of the inflammatory response Wide variety of effects on diverse cell types due to modulation of gene expression of growth factors and cytokines, inflammatory mediators and acute phase proteins

VEGF (vascular endothelial growth factor)

M32976 M31836 M33750

VEGFR (VEGF receptor)

X94263

M26809

Beever et al. (1996) Brown et al. (1994b) Chitko-McKown et al. (1995) Hash et al. (1994)

Inhibits proliferation of all types of Th clones Downregulates IL2R expression and IFN-7 production Affects accessory cell function

Zarlenga et al. (1995a)

Malik et al. (1995)

$78434/5 $78487

Stewart et al. (1996)

Chemotaxin for endothelial cells Angiogenic mitogen Endothelial cells

abin column 1 refer to the chromosomal location of the genes in column 5. cCD40L, NGF, TNF-~ and TNF-~ are members of the TNF gene family. dENA, GRO and IL-8 are members of the IL-8 gene family. eLIF, IL-6 and OSM are members of the IL-6 gene family.

23 a

Kanse et al. (1991 ) Maier et al. (1991) Robey et al. (1987) van Obberghen-Schilling et aL (1987) Zurfluh et al. (1990) Agaba et al. (1996) Cludts et al. (1993) Mertens et aL (1995) Myers and Murthaugh (1995)

Koch et al. (1994) Leung et al. (1989) Tischer et al. (1989) Solinas-Toldo et al. (1995) Mandriota et al. (1996)

Cytokines

451

understanding of the role of cytokines in protective immune responses of cattle is of fundamental importance for improved health and vaccine development. A list of cloned bovine cytokines and the corresponding GenBank accession numbers is presented in Table XIII.4.1. Information on the sources, the biological activities on bovine cells and the chromosomal location of the cytokine gene is included. Currently available methods for measuring cytokine levels involve the use of nucleic acid technology, bioassays and immunoassays. The investigation of cytokine gene expression by reverse transcription-polymerase chain reaction (RT-PCR) has become a standard procedure because of the high sensitivity of the technique and the lack of bovine specific assays for detection of the

corresponding protein. Primer sequences specific for bovine cytokines are listed in Table XIII.4.2. Cytokine studies based on quantitative mRNA expression are readily performed but for each experimental system it must be shown that the level of cytokine mRNA is an accurate and reliable indicator of the cytokine protein levels. Reagents and assays available for bovine cytokines are given in Table XIII.4.3. In many cases, human cytokine reagents have been shown to cross-react with cattle and the degree of cross-reactivity is variable, depending on the cytokine. The use of the nonhomologous cytokine reagents may provide important insights into possible biological activities of the cytokine in cattle but potential differences in species specificity for the receptor and

Table X111.4.2 Bovine cytokine-specific primer sequences for RT-PCR analyses Cytokine

EPO FGF basic GM-CSF IFN-7 L-I~ L-lfl L-2 L-3 L-4 L-6 I-7 L-10 L-12 p40 SCF TGF-#I TNF-~ TNF-fi Housekeeping gene: GAPDH fl-actin

Primers: F W ( 5 - 3 ) R V (5'--3)

GCTGATG CTGTCC]qTCTGC GGGGAAAGCTGACTCTGTAC TACAAC-I-I-CAAGCAGAAGAG CAGCTCTTAGCAGACATTGG ATGTGGCTGCAGAACCTGCTI-CTCC C-FI-CTGGGCTG G-I-I-CCCAGCAGTCA GGAGTAI I I IAATGCAAGTAGCCC GCTCTCCGGCCTCGAAAGAGATT CTCTCTCAATCAGAAGTCC-FICTATG CATGTCAAATTTCACTG CCTCCTCC AAACAGATGAAGAG CTG CATCCAA CAAAG CTCATGCAGAACACCAC-I-F ACGGGGAACACAATGAAAGGAAGT GGTAGG GCTTACAAAAAGAATCT GTGACATGGAGGACTCCATA TCG CCCAAGTTCTTG-FI-CTC ATGGGTCTCACCTCCCAGCTGA GGTC-i-I-GCTTG CCAAG CTG-I-I-GA CC-FI-CACTCCA-I-I-CGCTGTC -I-I-GCGTTC-I-ITACCCACTC G GC CAGTAG CATCATCTGA-I-I-GTGA TAGTG GG-I-I-GAGC-ITCACTCAGGG CAG CAG CTGTATCCACTTG C CAAC CTCTCTTGGAGGTCACTGAAGACTC TG GTATCCTGATGCTCCTG GAG TGCTCCAAG CTGACC-FI-CTCTG CAACTGTC C-I-I-GTAAGA-I-I-FGGTTG CAACTGTCAGTCAG C-I-I-GACTG TGC-I-ICAG CTCCACAGAAAAGAAC CAGCTGCACTTGCAGGAGCGC CTCGTATGCCAATGC AGG GCGATGATCCcAAAGTAGACC AGACCCCAGCACCcAGGACTCG G GAGATGCCATcTGTGTGAGTG GATGCTGGTG CTGAGTATGTAGTG ATCCACAAcAGACACG-I-I-GGGAG ACCAAcTGGGACGAcATGGAGA AGCCATCTCCTGCTcGAAGTC

Product (bp)

References

520

Suliman et al. (1996)

282

Watson et al. (1992)

429

Ito and Kodama (1996)

387

Taylor et al. (1996)

424


394


548

Covert and Splitter (1995)

280

Mertens et al. (1997)

312

Lutje et al. (1995)

534


344

Mertens B. (unpublished data, 1996)

375


444

Mertens B. (unpublished data, 1996)

663 or 579 (2 isoforms) 320

Mertens et al. (1997) Mertens B. (unpublished data, 1995)

378

Bienhoff and Allen (1995)

361


468


456

Lutje et al. (1995)

Note: Quantification of PCR products using competitive assays have been described (Bienhoff and Allen, 1994; Zarlenga et aL, 1995b; Taylor et aL, 1996) and also multiplex PCR for bovine cytokines (McKeever et aL, 1997).

452


Table X111.4.3 Bovine cytokine reagents, cross-species reactivity and assays

Cytokine

ENA

Bovine-specific reagents

rec a

EPO FGF acidic FGF basic

pAb b

mAb c

x

GM-CSF

x

x .

IL-1Ra antagonist IL-2

IL-2R~ IL-3

anti-huENA Ab

Immunohistochemistry

AIImann-lselin et aL (1994) d,e Adrianarivo et al. (1995) Goureau et al. (1995)

rhuGM-CSF anti-huGRO Ab hulFN-~

x

x

rhulFN-7

Immunocytochemistry Antiviral neutralization assay with Vesicular stomatitis virus1 and Madin-Darby bovine kidney cells or Semliki forest virus 2 and bovine BT-6 cells Immunosorbent binding assay 3 Induction of 2-5A synthetase activity 4 bolFN-7 ELISA-kit 1 Antiviral neutralization assay (see el IFN~//~)2 Induction of 2-5A synthetase activity (see e4 IFN-~//~)3

rhulGF-2 rhulL-lc~

IGF-2 IL-I~

IL-1/~

References and sources

rhuG-CSF

GRO IFN-~//~

IFN-~,

Assays e

huEPO rhuFGFa anti-huFGFa Ab rhuFGFb

x

G-CSF

Cross-species reactivity (human reagents on bovine cells) d

x

x

x

rhulL-1/~

bolL-1/~ ELISA1 Thymocyte costimulatory assay 2 Proliferation of IL-1dependent cell line (LBRM-33) 3

hulL-1Ra X

X

rhulL-2 anti-hulL-2 Ab

Proliferation assay of bovine IL-2 dependent T cell clone (300L1) 1 Proliferation assay on bovine T cell line (99.G1.G3)(IL-2/IL-4 assay) 2 Bioassay using IL2Rc~Ab 3 Immunohistochemistry

Genzymeb; Goureau et aL (1995) d Amgena; Kehrli et aL (1991 ), Kabbur et al. (1995) d Maliszewski et al. (1988) a, VMRD c, Kabbur et aL (1995) d Rovigue et al. (1995) d'e Ciba-Geigy a, Tizard (1995) d, Brown et al. (1992) el, De Martini and Baldwin (1991 )e2, L'Haridon (1991) e3, Totte et aL (1993) e4

Ciba-Geigy a, Genentech, Wood et al. (1990) c, Letesson J-J., Kabbur et al. (1995) d, Tizard (1995), CSL el, Biosciences Li et al. (1995) Leong et al. (1988) a, Blecha (1991) d, Kabbur et al. (1995), Lederer and Czuprynski (1995) Collins and Oldham (1995) a, Yoo et al. (1995) 5, Reddy et aL (1993) c'd'el'2, VMRD c, Lederer and Czuprynski (1995) d, Werling et aL (1995) e1"3 Lederer and Czuprynski (1995) d Collins and Oldham (1995) a, Ciba-Geigy, VMRD c, Collins et aL (1994) d, Collins and Oldham (1993), Stevens and Olsen (1994) el, Brown et al. (1994a) e2, Lutje et al. (1995) e3 Naessens et al. (1992), ILRI, VMRD ILRI

(continued)

Cytokines

453


Cytokine

Bovine-specific reagents

Cross-species reactivity (human reagents on bovine cells) d

IL-4

rec a x

Assays e

References and sources

rhulL-4

Proliferation assay on bovine T cell line (99.G1 .G3)(IL2/IL4 assay)

IL-6

rhulL-6 Neutralizing antihulL-6 Ab

huELISA ~ Proliferation of IL-6 sensitive cell line (7TDI) 2 or murine hybridoma cell line B93

Estes et al. (1995) a, Letesson, j_j.c, Belgium, Olsen and Stevens (1993) d, Adler et al. (1995), Brown et al. (1994a) e Jian et al. (1995) d'e2 Sherpetti et aL (199:3)e 1, Modat et al. (1990) e3

IL-7 IL-8

rhulL-7 rhulL-8

IL-10

rhulL-10 anti-hulL-10 Ab

MCP

Neutralizing antihuMCP Ab

OSM

x

pAb b

mAb c x

x

PTN TGF-~

rhuPTN

TGF-fi

rhuTGF-fl Neutralizing antihuTGF-fl Ab

TNF-~

TNF-fl

x

x

x

rhuTNF-~ Neutralizing antihuTNF-c~ Ab

huELISA-kit Bovine neutrophil chemotactic assay

Olsen and Stevens (1993) Hassfurther et al. (1994) d'e

Brown et al. (1994b) d

Immunocytochemistry

Kakizaki et al. (1995) d'e

Inhibition of proliferation of human A375 melanoma cells and mouse M1 myeloid leukemia cells

Malik et al. (1995) a'b'd

Radioreceptor assay huELISA-kit 1 Inhibition test on CCL64 cells 2 Inhibition of IL-5 induced proliferation of TF-1 cells 3 Luciferase transfected cells 4 Radioimmunoassay 1 ELISA 2 Cytotoxity on WEHI-164 cells Cytotoxity on murine L9294 or swine PK15 cells 5 Cytotoxity on WEHI-164 cells

Delbe et al. (1995) Zurfluh et al. (1990) a'e McCarthy and Bicknell (1993) d, Kaji et aL (1994), Genzymeel, Adler et aL (1994) e2, Randall et al. (1993) e3, Kriegelstein and Unsicker (1995) e4 Ciba-Geigy a, Genentech, Ellis et al. (1993) b'c'e3, Sileghem et al. (1992) c, ILRI, Kabbur et aL (1995) d, Pauli et al. (1994) d'e5, Kenison et al. (1990) e 1, Werling etal. (1995) e 2'4 , Adler et al. (1994) e4'5 Brown et al. (1993)

See Table X111.4.1for definitions. aRecombinant protein. bpolyclonal or c mAb to the bovine cytokine, abc in the references and sources refer to the corresponding bovine-specific reagents in column 2. d Refers to cross-species reactivity in column 3. el-e5 Refers to corresponding assays in column 4. Sources: American Cyanamid and Immunex recently stopped the production of bovine specific cytokine reagents: VMRD Inc., Veterinary Medical Research and Development, Pullman, WA, USA (http:www.vmrd.com); CSL, Commonwealth Serum Laboratories, Parkville, Australia; ILRI, International Livestock Research Institute, Nairobi, Kenya ([email protected]); Prof. J.-J. Letesson, Universite de Namur, Unite de Recherche Biologie Moleculaire, Namur, Belgium; Ciba-Geigy, Basel, Switzerland. Updated databases on bovine cytokines are available through the Internet: Cytokine Explorer Database (http://kbot.mig.missouri.edu:443/ cytokines) and the home pages of several companies (Amgen, Genzyme, R&D Systems, Promega) sometimes include information on cross-species reactivities.

454


immunological responses to nonhomologous proteins may occur. However, more bovine, sheep and goat cytokine and cytokine receptor reagents are becoming available. These reagents will allow the development of more accurate assays in the next few years and will consequently lead to a better understanding of immune and inflammatory processes in cattle.

5.

The T-cell Receptor

General features of bovine TCR complexes

The TCR, which recognizes foreign antigens and MHC gene products, is assembled in the cytoplasm of T cells during their ontogeny. The TCR is composed of two disulphide-linked clonotypic heterodimer chains, ~fl and 75. The TCR complexes (TCR-CD3 complexes) contain five noncovalently associated invariant components of CD3 complexes, CD37, CD35 and CD3e, and TCR( and TCRr/chains. The bovine TCR cDNA genes for ~, fi, 7 and 6 chains have been isolated by cDNA cloning and characterized during the last 7 years (Tanaka et al., 1990; Takeuchi et al., 1992; Ishiguro et al., 1993). While the complete DNA sequences for CD37 and ~ and the TCRr/ chains have not been determined, the cDNA clones of bovine CD3e and TCR( components have been isolated from cDNA libraries by cross-hybridization with human and mouse counterpart probes (Clevers et al., 1990;

Hagens et al., 1996). However, the chromosome locations in the bovine genome map and the genomic organization for bovine TCR, CD3 and TCR-associated genes have not been analysed in detail.

Molecular structure of bovine TCR genes

The primary structure of each TCR chain can be subdivided into specific regions: a hydrophobic leader (L) segment, a variable (V) segment, a diversity (D) segment in the case of fl and 5 chains, a joining (J) segment, and a constant (C) region. Table XIII.5.1 summarizes the lengths of amino acid sequences for bovine TCR ~, fl, 7 and 6 genes deduced from their DNA sequences. The structural sequences of bovine TCR genes show striking similarities to those of the TCR genes from other species, especially in the number and site locations of the cysteine in the disulfide bond for heterodimer formation, and the potential sites for N-linked glycosylation (Ishiguro and Hein, 1994). Table XIII.5.1 also shows the sequence similarities of each bovine TCR-C region to the corresponding regions of three different species (human, mouse and sheep) at both DNA and protein levels. Bovine TCR ~fi chains One Ca (144 amino acids) and two Cfl (Cfll and Cfl2, 178 amino acids) genes were identified in cattle (Ishiguro et al.,

Table X111.5.1 The bovine TCR genes Identity (%) between DNA/protein sequences for constant regions of three different species Number of amino acids c TCR chain mRNA a (kb) L

c~

1.5

fl

1.3

7

5

1.5

2.2

V

D+J

Human C

Cl

Mouse C2

20-23 91-93 (0-2) 9

20-24 140 73/60 (0-1) (4) 18-24 C1 178 84/81 16-19 95-97 (0-2) (0) (1) C2 178 83/80 (2) 13-14 98-100 15-21 C1 222 63/48 (0) (0-1) (2) C2 211 68/51 (2) C3 194 70/53 (4) C4 210 72/56 (4) 20 93-96 23-39 155 78/65 (0-1) (0) (2)

Cl

Sheep C2

C4

68/55

Cl

C2

C3

C4

C5

90/81

83/82

76/75

78/75

96/94

95/94

95/94

83/80

80/74

79/75

94/94

94/93

94/92

66/47

71/64

70/64

62/42

76/69

91/87

68/58

68/58

64/54

64/51

65/65

65/65

62/45

81/72

91/86

70/61

76/62

65/54

70/65

56/53

63/51

65/51

73/64

69/58

94/87

71/60

66/53

67/54

65/51

66/67

64/48

97/95

81/71

73/64

79/67

65/59

76/68

aSize of mature transcript in kb. bNumber of N-linked glycosylation sites. CRegions: L (leader), V (variable), D+J (diversity and joining) and C (constant).

92/86

The T-cell Receptor

455

Table X111.5.2 EMBL Database accession numbers for bovine TCR-CD3 complexes

Bovine TCR 78 chains

TCR or CD3 components

Accession number

TCR ~ chain V= C=

D90010-D90029 D90030

TCR ~ chain V/~ C1~1 C/~2

D90121 -D90133 D90139 D90140

TCR 7 chain V. Crl C,,2 C,,3 C,4

D 13648-D 13661 D90413 D90415 D90414 X63680

TCR 8 chain Va C,~

D 13655-D 13661 D90419

CD3 components CD37 CD38 CD3e CD3~ (TCR~)

X53268 X53269 U25687, X53270 U25688

Ruminant TCR 7 chains, including those from sheep, have some unique features, especially in length and structure of the C v region. Four cDNA clones for the bovine C v gene have been identified (Ishiguro and Hein, 1994) (Table XIII.5.1). The difference in lengths for the bovine Cv gene segment results from variability (about 27-54 amino acids) in the length of the connecting peptide or hinge segment between the extracellular domain and the transmembrane domain. The C 7 gene segment contains variable numbers of repeats of a five-amino-acid motif (consensus sequence TTEPP) which could be generated by duplication or triplication of the short exon. The characteristic consensus motif is repeated four times in the Crl segment and once in the C72, and slightly altered motifs (TAEPP or TTESP) are observed in Cv2 and Cr4 gene segments. Three distinct Vv families (Vvl, Vv2 and Vv5 ) have been identified so far; the V75 family is the predominant family of the V r genes expressed in peripheral blood lymphocytes (PBL). Comparison of protein sequences for the V 7 regions from three species showed that bovine VT, genes are much more similar to sheep V v genes (22-89%) than those from human (18-53%) or mice (22-49%) genes. The DNA sequences of 12 functional Va genes which have been determined are highly similar to each other (75-97%) and are almost identical to the sheep Val family (93%), compared with the human Val family (62-69%) and the mouse Va6 family (54-61%). The EMBL database accession numbers for the TCR 7~ gene segments are given in Table XIII.5.2.

J

l

1990; Tanaka et al., 1990). The five bovine V~ families identified so far as full-length sequences show a 16-47% amino acid similarity between the families, while the amino acid similarity among nine bovine V/3 families ranged from 18 to 53%, indicating that they are quite diverse. A bovine V/3 family, termed the V/3 12-gene segment was isolated at a high frequency from a cDNA library, indicating that some V13 families may be used preferentially in T cell populations, as reported in human and mice. The EMBL database accession numbers for the TCR 0~fi gene segments are given in Table XIII.5.2. No mAb specifically recognizing the surface molecules of TCR 0~or/3 chain are available.

I n v a r i a n t c o m p o n e n t s of b o v i n e T C R

The TCR chains are noncovalently associated with invariant components of CD37, CD38, CD3g, TCR~ and TCRr/ chains. The CD3g and TCR~ chains have an important role in signal transduction (Table XIII.5.3). Both TCRassociated molecules are the targets for tyrosine kinase, such as ZAP-70, lck and fyn, which stimulates the signal-

Table X111.5.3 The bovine CD3 components and proportional identities with other species

Bovine CD3 chain

Number of amino acids (partially determined)

CD37 CD35 CD3e TCRr TCRr/

(93) (59) 192 166 ND c

aNA, not analyzed.

bData shown as proportional identity (DNA/protein). CND, not detected.

Number of amino acids for CD3 components, and proportional identity (%) of sequences between bovine and the other species Human

Mouse

Sheep

NA a NA 207 (73/62) b 168 (81/83) NA

NA NA 189 (71/60) 164 (78/72) NA

NA NA 192 (91/84) 167 (96/95) NA

456


ling pathways leading to T-cell proliferation and lymphokine secretion. The bovine CD3a and TCR~" contain one and three typical ARAM (antigen recognition activation motif) sequences, respectively, in the cytoplasmic domain. Furthermore, the bovine TCR~" chain has a GDP/GTPbinding site with a C-terminal ARAM sequence. A mAb MM1A which recognizes native bovine CD3a is available (Table XIII.3.1). The EMBL database accession numbers for the CD3 genes are given in Table Xlii.5.2.

Distribution of 0eft and "f5 TCR populations Because the mAb which recognizes the TCR ~fi chain has not been isolated, a detailed characterization of ~fi T cell ontogeny and the distribution of ~fl T cells in cattle have not been made. The number of 75 T cells in bovine PBL is usually very high, which is striking compared with the low proportion of ),5 T cells found in humans and mice (Mackay and Hein, 1989; Hein and Mackay, 1991). It is generally accepted from experiments with anti-75 mAb (for example: CACTB6A, CACTB81A and 86D) that positive proportions of 75 T cells in PBL are consistently higher in young calves (25-30%) than in older cows (310%), and that the population continues to decrease with advancing age. Why cattle have a high population of 75 T cells in PBL is unclear. The ~5 T cells are usually localized with high frequency on the epithelial surface, especially within the skin, intestine, oesophagus and tongue, compared with their distribution in small numbers in the conventional T-cell domains of the spleen and lymph nodes. The BoWC1 molecule (WC1 family: 220kDa) is the ruminant-specific differentiation antigen, which is expressed late in 75 T cell ontogeny.

6.

Immunoglobulins

Ig isotypes and physicochemical properties The nomenclature of bovine immunoglobulins follows the guidelines proposed by the nomenclature committee of IUIS (WHO, 1978). The different Ig isotypes identified in cattle are summarized in Table XIII.6.1 - four heavy chain classes (IgM, IgG, IgA and IgE), three IgG subclasses (IgG1, IgG2 and IgG3) and two light chain types (,~ and /c). The production of mAb to different bovine isotypes (van Zaane and Ijzerman, 1984; Letesson et al., 1985; Goldsby et al., 1987; Naessens et al., 1988; Tatcher and Gershwin, 1988; Estes et al., 1990; Williams et al., 1990) has allowed the establishment of isotype-specific assays. In cattle, no evidence has been found for the existence of IgD at the protein (Naessens and Williams, 1992; Naessens, 1997) or mRNA level (Butler et al., 1996). Bovine light chains are shared by all immunoglobulin classes. In contrast to primates, lagomorphs and rodents, the majority of light chains (over 90%) in cattle are of the 2 type (Hood et al., 1967). However, as no specific reagents to either 5[ or/c bovine isotypes exist, no further studies on 5[:/c ratios have been made. As in other mammals, bovine IgM exists as a pentameric form of the basic unit consisting of t w o / l heavychains and two light chains. It contains one covalently bound J-chain per molecule, which is necessary for the correct pentameric structure. The/2 heavy-chain in cattle has a higher Mr than either the mouse or human/2 chain, resulting in a larger IgM molecule. There is evidence for polymorphism on IgM as two mAbs detected an IgMspecific allotype and bound only half of the serum IgM and IgM-bearing cells in heterozygote animals (Naessens

Table X111.6.1 Physicochemical properties of the different bovine heavy chain classes

Heavy chain Mr Heavy chain, PAGE estimate (/1000) Mr Ig (1/1000) AI Iotypes Relative electrophoretic mobility S20,w $2781%, 1cm(UV-absorption) Carbohydrate (%) Mannose (%) Galactose (%) Glucose (%) Hexosamine (%) Fucose (%) Sialic acid (%) Total SH/mol

IgM

IgG1

IgG2a

IgG3a

IgE

/~ 80 1030 B5.4 IL-A50 f12 19.2-19.7 11.8-1 2.6 10-12

71 58 161-163 C 1/C2 G1 a,BA3,BA5 f12 6.5-7.2 12.1-13.7 2.8-3.1 0.53 0.37 0.62 0.9-1.72 0.10-0.26 0.28 37.5-43

72 55 150-154 A 1/A2

73 58

68

2.8-3.9 1.25 1.39 43.6

7 6.5-7.2 12.3-13.5 2.6-3.0 0.57 0.45 0.45 0.8-1.6 0.16-0.26 0.15 32.5-35

aA newly proposed nomenclature replaces the terminology IgG2a and IgG2b by IgG2 and IgG3. Based on Table I, Butler (1986) with permission from Karger, Basel.

IgA

SC

o~

6O 385-430

f12 10.8-11

f12 4.0-4.9

6-10

5.9 1.92 0.19 0.45 2.5-3.1 0.24-0.80 0.4 30.0

I

m

m

u

n

o

g

l

o

b

et al., 1988; Williams et al., 1990). No reagents for the

allele are available. Bovine IgA occurs predominantly in the dimeric form in serum, but higher polymers have been described. A J chain is associated with dimeric IgA. The genes for bovine CI, and C~ have been isolated using a rabbit Sl, probe (Knight et al., 1988). Southern blot analysis revealed one C~ gene and suggested two C l, genes. However, the latter result was probably due to a restriction polymorphism. slgA, isolated from exocrine secretions, has a M r o f 420550 • 103 because of an associated secretory component (SC). The SC can exist free or bound to polymeric immunoglobulin (pig) and the bovine molecule has been well characterized biochemically (Butler, 1986). SC is the extracellular portion of the pig receptor, which is responsible for binding and transcytosis of pIgA (and with lower efficiency, plgM) through epithelial cells of mucosal and glandular tissues. At the apical surface, in contact with external secretions, the extracellular ligand-binding portion is proteolytically cleaved releasing the SC-Ig complex. An additional function of SC may be to render pig more resistant to proteolytic cleavage in mucosal environments. The bovine cDNA sequence has been determined (Verbeet et al., 1995) and a high degree of conservation among species (60-70%) observed. A bovine IgE homologue, different from the other Ig classes, was identified in bioassays such as skin sensitization and mast cell binding (Nielsen, 1977), but the lack of an abundant source of IgE has prevented purification in sufficient quantities to acquire biochemical data. Specific antibodies have been raised (Nielsen, 1977; Gershwin and Dygert, 1983) and an ELISA test has been developed in which concentrations are measured in units, relative to a standard. One C~, gene, 5' of the Ca gene, was isolated and expressed as a heavy chain of 68 kDa in a chimeric bovine/murine Ig molecule (Knight et al., 1988). Two IgG subclasses, IgG1 and IgG2, were first identified as they eluted from an anion exchange column as two overlapping populations, with IgG1 being more tightly bound. They also had a different sensitivity for proteolysis, with IgG1 being more sensitive to pepsin, but more resistant to trypsin than IgG2. In a mixture of bovine IgG1 and IgG2, pepsin will cleave all IgG1 in F(ab')2 and pFc' fragments after 30min, while leaving most of the IgG2. Comparisons of the 71 and 72 sequences show a major difference in the hinge-CH2 region: the hinge regions are equal in length but show evolutionary divergence, and the 72 chain has a 9 bp deletion at the start of the CH2 domain (Symons et al., 1989). This may explain the different capacity of the two subclasses for Fc receptor (FcR) binding on mammary cells and transport in colostrum (see below). A motif for the receptor site for Clq of complement, located in the CH2 domain, is present in both subclasses (Mayans et al., 1995). This is in agreement with the fact that both subclasses activate homologous comple-

u

l

i

n

s

4

5

7

ment, however, only IgG1 will fix heterologous complement in vitro. While IgG1 antibodies behaved as a single subclass, heterogeneity was observed in the serological and electrophoretic behaviour of IgG2 antibodies (Butler, 1986). Subsequently, serological evidence for the existence of two isotypes among the IgG2 antibodies was demonstrated with polyclonal (Butler et al., 1987) and mAb (Estes et al., 1990). The two subclasses were tentatively called IgG2a and IgG2b. Further evidence for three subclasses came from studies in which three C:, genes were isolated using a human C v probe (Knight et al., 1988). The genes could be expressed as bovine/mouse IgG chimeras and were tested with isotype-specific antibodies. Two of the three genes corresponded to C:,1 and C72, while the third gene, C73, probably codes for the 'IgG2b' heavy chain since its IgG product was not recognized by either anti-IgG1 or anti-IgG2. According to new nomenclature proposed by the Immunoglobulin Workshop of the Veterinary Immunology Committee, chaired by J. E. Butler, Iowa, USA, the three bovine IgG subclasses will be called IgG1, IgG2 (ex-IgG2a) and IgG3 (ex-IgG2b). Bovine Co/ pseudogenes also exist (Symons et al., 1987; Knight et al., 1988). Allotypic determinants have been described on IgG1 and IgG2 subclasses (Table XIII.6.1). The best described allotypes are A1 and A2 on the IgG2 (ex-IgG2a) subclass. These will be renamed IgG2 ~ and IgG2 b according to the newly proposed nomenclature. Amino acid sequences of the two polymorphic heavy chains showed differences in four regions: (1) the region around the L-H bond, (2) the middle hinge, (3) a seven-amino-acid region at the beginning and (4) one Arg to Glu exchange at the end (position 419) of the CH3 intradomain loop (Kacskovics and Butler, 1996). Analysis of pepsin cleavage fragments located the AI allotype to the CH3 domain (Heyermann and Butler, 1987), thereby restricting the position of A1 to the two sites in CH3. The A2 allotype could not be located, and thus can be at any of the four sites. A1 is an immunodominant epitope and a majority of heterologous antibodies to IgG2 contain specificity for the A1 allotype in addition to activity for the IgG2 isotype. A heterologous antiserum made by immunization with IgG2 of the A2 allotype contains mainly activity for the isotype, although some A2 allotype activity can be found. This bias in the reagents affects the correct estimation of IgG2 concentrations (Butler et al., 1994). It should be noted that the same nomenclature for subclasses (IgG1, IgG2, etc.) among different species often leads to the mistaken belief that these subclasses are homologous and have the same major functions. While this is generally true for the five known Ig classes (IgM, IgD, IgG, IgE and IgA), this is not the case for the subclasses. Most data are consistent with the hypothesis that speciation in mammals preceded subclass evolution (Kehoe and Capra, 1974).

458

I M M U N O L O G Y OF CATTLE

Table XIII.6.2 Concentrations (mg/ml) of the Ig (sub)classes in body fluids

Bile Bronchoalveolar fluid Colostrum Intestinal fluid Mature milk Nasal secretions Saliva Seminal fluid Serum Synovial fluid Tears Urine

IgM

IgG1

IgG2

slgA

-0.03 6.77 Trace 0.086 0.04 0.006 Trace 3.05 0.37 0.176 Trace

0.10 0.13 46.4 0.25 0.58 1.56 0.034 0.13 11.2 2.02 0.32 0.009

0.09 0.24 2.87 0.06 0.005 Trace 0.016 0.11 9.2 1.20 0.01 Trace

-0.24 5.36 0.24 0.081 2.81 0.34 0.13 0.37 0.68 2.72 0.001

Reproduced from Table II, Butler 1986, with permission from Karger, Basel.

Ig i s o t y p e s : f u n c t i o n a l p r o p e r t i e s

Effector functions are associated with the presence or absence of receptor binding sites on the Fc part of the Ig molecule. The rearrangement of the VH segment with different CH regions (switch) thus allows recombination of an antigen-binding activity with different immunological functions (such as complement and Fc-receptor binding) and with dissemination in various body fluids (such as transfer through epithelial surfaces after binding to the pig receptor). Table XIII.6.2 summarizes concentrations of the different Ig classes in body fluids of normal cattle. Most of the data were collected before IgG3 was identified, so the column under IgG2 contains data for both IgG2 and IgG3. A feature of the mucosal system in ruminants is the prominence of IgG1 relative to IgA, particularly in secretions from the mammary gland (Table XIII.6.2), where IgA is associated with milk fat globule membranes (Honkanen-Buzalski and Sandholm, 1981). This suggests the existence of an additional transport mechanism for IgG1 in ruminants. Because there is no placental transfer of maternal antibodies to the fetus in ruminants, transfer of passive immunity in cattle is ensured by the accumulation of extremely high concentrations of antibodies, particularly IgG1, in the colostrum and an efficient uptake of the intact proteins by the neonatal calf (see also Section 9, Passive Transfer of Immunity). IgA is more prominent in intestinal, nasal and lacrimal secretions. In the intestine IgA is produced locally, while most of the IgG is derived from plasma. In contrast, IgA in saliva is not produced locally but is selectively transferred from blood, presumably by virtue of its pig receptor on the glandular epithelium (Lascelles et al., 1986). Homocytotropic antibodies, responsible for immediate hypersensitivity, are of the IgE class. They too are secreted

in the colostrum and, like IgE in other species, they bind mast cells and play a role in allergies (de Weck, 1995) and also in resistance to parasites, particularly worm infections (Baker and Gershwin, 1992). Other effector functions have been studied in detail for IgM, IgG1 and IgG2 only, mainly because no reagents or easy purification procedures for the others existed (data summarized in Table XIII.6.3). The two major IgG subclasses differ mainly in their ability to bind heterologous complement and to induce adherence to and phagocytosis by neutrophils and fresh monocytes. The observation that IgG2 does not fix heterologous complement, although it does fix bovine complement, may only be of relevance when testing antibodies by an in vitro complement assay. IgM is 10-20 times more effective at fixing complement than IgG, and this may explain its high concentration in serum of cattle compared with other species. Binding of Ig to FcR on phagocytic cells and subsequent ingestion and killing by the cell may be a relevant parameter for immunity (Table XIII.6.3). IgG1 is the main antibody found in colostrum and milk, but does not have a specific receptor on resting neutrophils and monocytes. Although IgM did not reveal a specific FcR on phagocytic cells when tested for adherence and phagocytosis of erythrocytes, it was the only Ig class that induced uptake of Staphylococcus aureus and Escherichia coll. Using flow cytometry, both exogenous IgM and IgG2, but not IgG1, were shown to bind to neutrophils. Binding of IgG1 could be induced by treatment of neutrophils with IFN-7 (Worku et al., 1994).

V genes

Three teams reported a number of independent VL gene sequences from genomic and cDNA (Armour et al., 1994; Parng et al., 1995; Sinclair et al., 1995). A striking feature is the extraordinarily high homology between cDNA VL sequences and between germline VL sequences. Only a small number of germline determinants were expressed and appear to be functional. The failure to find diversification of germline segments, even among the nonexpressed genes, led Sinclair et al. (1995) to conclude that light chains in bovine antibodies contribute little to recognition of antigen. Parng et al. (1995) suggested that VL pseudogenes could be potential donors for gene conversion. They also observed point mutations which increased with the age of the animal. They proposed a model based on gene conversion, followed by somatic hypermutation, to account for diversity in the bovine VL repertoire. Variation among VH sequences is also limited. Bovine VH sequences (Jackson et al., 1992; Armour et al., 1994; Sinclair and Aitken, 1995; Saini et al., 1997) show a very high nucleotide (85-90%) and amino acid (70-80%) homology, suggesting a single VH gene family. This bovine VH family has a high sequence homology with the single VH family in sheep, with murine VH Q-52 and with


459

Table X111.6.3 Biological properties of bovine heavy chain classes IgM

Binding to Protein A Binding to Protein G

m

Complement binding Bovine Guinea pig Rabbit

IgG2 a

-

weak

++

++

+

+

+

+

+

--

+

+

--

+ +

+ -

+ +

+ + + +

Passive cutaneous anaphylaxis Homologous (bovine skin) Heterologous (rat skin) Binding to Fc-receptors Rosetting Neutrophils Fresh blood monocytes Cultured monocytes Alveolar macrophages Phagocytosis by neutrophils Erythrocytes

IgG1

+

-

-

Staphylococcus aureus/Escherichia coil

+

-

-

T r y p a n o s o m a theileri

+

-

-

Mycoplasma bovis

-

-

+

+ +

+

+ ++

FcR-binding of Ig (flowcytometry) Blood neutrophils Neutrophils + IFN-7

IgG3 a

IgE

IgA

aA newly proposed nomenclature replaces the terminology IgG2a and IgG2b by IgG2 and IgG3. Most of the experiments with IgG2 antibodies were done before IgG3 was identified and probably included both subclasses.

human VH4 (Sinclair et al., 1995; Saini et al., 1997). One unique characteristic of bovine VH sequences is that most have a long CDR3 region (17 or more residues). Somatic hypermutations are an important mechanism for the generation of antibody diversity in cattle (Saini et al., 1997). Ig gene mapping

As in other species, the ~c, 2 and heavy chain loci have been mapped to three different chromosomes (Table XIII.6.4). Direct mapping of the heavy chain locus was obtained by in situ hybridization with a 7 probe (Gu et al., 1992), the other loci were indirectly mapped by linkage with known markers in synthenic groups. The locus of the pig receptor was identified by in situ hybridization. TableXlll.6.4

Bovine Ig genes

Locus

Gene

Chromosome

References

Lambda chain Kappa chain Heavy chain

IGL IGKC IGHG IGHM

17 11 21q24 21

pig-receptor

PIGR

16q13

Johnson et al. (1993) Broad et al. (1995) Gu e t al. (1992) Tobin-Janzen et aL (1992) Kulseth et al. (1994)

m


M e t h o d s to c h a r a c t e r i z e M H C antigens

Class I antigens The gene complex responsible for antigens encoded within the bovine MHC was named the bovine lymphocyte antigen (BoLA) system (Spooner et al., 1979). Polymorphism of class I antigens has been studied using the classical immunogenetic approaches: transplantation, serology, allospecific T-cells, and one-dimensional isoelectric focusing (1D-IEF). International workshops have played a vital role in the standardization of serological reagents, typing methods and nomenclature of the BoLA system (Spooner et al., 1979; Anonymous, 1982; Bull et al., 1989; Bernoco et al., 1991; Davies et al., 1994b). More than 50BoLA antigens have been recognized by the international community, nearly all of which behave as alleles of a single locus (BoLA-A). The BoLA serological specificities exhibit distinct differences in frequency in the different cattle breeds (Stear et al., 1988b; Bull et al., 1989). One-dimensional isoelectric focusing has been successfully applied to problems of antigen and haplotype definition, and for investigation of the number of expressed class I products. This technique has been most useful for

460

IMMUNOLOGY OF CATTLE G e n e t i c organization of the bovine major histocompatibility c o m p l e x

characterizing alleles not recognized by serological reagents and for defining new allelic subtypes of serologically defined antigens (Oliver et al., 1989; Davies et al., 1994b). Other class I typing techniques, such as cellmediated lympholysis (Spooner and Morgan, 1981), immunoblotting (Viuff et al., 1991) and Southern blotting (Lindberg and Andersson, 1988) have been used for demonstration of class I polymorphism. At the present time, serology remains the most universally accepted and easily performed method for class I typing.

Using HLA genes as probes, nucleic acid hybridizations were used successfully to identify orthologous MHC genes, to reveal the extensive polymorphism of the class II genes and to delineate BoLA haplotypes (Andersson et al., 1986a,b; Ennis et al., 1988; Muggli-Cockett and Stone, 1988). Determination of genomic sequences permitted the application of PCR technology to the identification of sequence variation in coding exons of BoLA genes (Sigurdard6ttir et al., 1991; van Eijk et al., 1992b). All these methods have been applied to research topics that range from MHC evolution (Andersson et al., 1991) to disease association (Lewin and Bernoco, 1986). The bovine MHC and at least 32 structural genes have been mapped to bovine autosome 23 (Figure XIII.7.1) (Fries et al., 1993). Two class II subregions have been defined on the basis of genetic mapping (Andersson et al., 1988; van Eijk et al., 1993). These two subregions are separated by a relatively large distance, spanning at least 15 centimorgans (cM) from D Y A to D R B 3 . Thus, while it may be convenient to refer to BoLA genes as a 'system' they are, in reality, independent clusters of genes. In addition to the class I and class II genes, the class III genes CYP21 (Barendse et al., 1994; Bishop et al., 1994; Gwakisa et al., 1994; van Eijk et al., 1995), BF (Teutsch et al., 1989), HSP70 (Bishop et al., 1994), C4 (Andersson et al., 1988) and T N F (Agaba et al., 1996) have also been mapped to the bovine MHC. The overall size of the class I region is no less than 770kb and probably no more than 1650kb, similar to the organization of the HLA class I genes (Bensaid et al., 1991). The D Q and D R genes are probably not more than 400 kb apart. In most haplotypes, the D Q A and D Q B genes have been duplicated (Andersson and Rask, 1988).

Class II antigens Cellular determinants detected in the mixed lymphocyte reaction (MLR) are encoded by BoLA class II antigens (Teale and Kemp, 1987). Because the MLR is difficult to replicate and standardize, this method has never become a widely-used typing tool, although it has been used for functional studies. Serological reagents for detecting class II antigens have been characterized in independent comparison tests (Lewin et al., 1991; Nilsson et al., 1991) and in the fourth and fifth international BoLA workshops (Bernoco et al., 1991; Davies et al., 1994a). Five class II specificities (DW designation) were accepted by the international community (Davies et al., 1994a). Evidence for eight others was sufficient to warrant cluster designations (Dc series). Isoelectric focusing of immunoprecipitated class II antigens clearly demonstrated class II polymorphism at the protein level (Joosten et al., 1989; Watkins et al., 1989a). Discrimination of the products of the D Q and D R genes was achieved using locus-specific mAb (Bissumbhar et al., 1994). A total of 12 IEF variants (DRBF designations) have been accepted by the international community (Davies et al., 1994a).

lli:

lh,

|

i

DB DNA DOB DYB TCP1

-

4.2

I

DQA 1 DQA2 DQB1 DQB2 DRA DFB1 DRB2

DYA LMP2 LMP7

I

IIIII

i

24

'

9

i

BoLA-B BTN C4 HSP70-1 HSP70-2 M TNF

i

PL1

t~r CYP21

PRt.

I

I

0.6

5.3

F13A

38

I

Figure XIII.7.1 The genetic map of structural genes located on bovine chromosome 23. Map distances are expressed in centimorgans and were estimated using the Illinois Reference~Resource families, a large collection of paternal half-sib families used for the construction of a bovine linkage map (Ma et al., 1996). Map positions of loci located above and away from the indicate map marker were assigned based upon studies cited in the text.


An enormous number of BoLA haplotypes is theoretically possible given the extreme polymorphism of the BoLA-A, DR and D Q loci. Haplotype discrimination was enhanced by the use of serology in combination with 1DIEF, restriction fragment length polymorphism (RFLP), polymerase chain reaction-RFLP (PCR-RFLP) and microsatellite typing techniques. At least 170 B o L A - A - D R B 3 haplotypes were identified in samples from most of the major dairy and beef breeds (Lewin, 1996). Among breeds, different haplotypic combinations are found, but certain

TableXlll.7.1

461 haplotypes appear in several breeds (ancestral haplotypes). Haplotype data make it possible to elucidate the evolutionary relationships between cattle breeds and to relate the breed origins to human migration patterns (MacHugh et al., 1994). Furthermore, haplotype discrimination has become increasingly important for dissecting MHC effects on diseases. Analysis of haplotypes in disease association studies can be helpful in mapping disease resistance and susceptibility to localized regions within the MHC (van Eijk et al., 1992a; Xu et al., 1993b). Haplotype diversity is

Disease associations BoLA

Effect

References

A14 A15 A21 DA6.2, A12 DA7 DA12.3 A6, EU28R A8 A12 and A15 A14 .and A13 DRB2*2A DRB2*IC DRB3(ER motif) DRB3(ER motif)

Late Rapid Late Rapid Resistance Susceptibility Susceptibility Resistance Susceptibility Resistance Resistance Susceptibility Resistance Resistance

Palmer et al. (1987), Lewin et al. (1988) Palmer et aL (1987) Palmer et al. (1987) Palmer et al. (1987) Lewin and Bernoco (1986) Lewin and Bernoco (1986) Stear et al. (1988a) Stear et al. (1988a) Lewin et al. (1988) Lewin et al. (1988) van Eijk et al. (1992a) van Eijk et al. (1992a) Xu et al. (1993b) Zanotti et aL (1996)

Norwegian Red

A2

Resistance

Norwegian Red Norwegian Red Swedish R & W Holstein Holstein Icelandic Simmental (S) or S x Red Holstein Danish Black Pied Danish Black Pied Holstein

A16 All DQ1A All CA42 A19 A15

Susceptibility Susceptibility Susceptibility Resistance Susceptibility Susceptibility High

Solbu et al. (1982), Solbu and Lie (1990), V&ge et al. (1992), Mejdell et al. (1994) Larsen et al. (1985) Solbu and Lie (1990) Lunden et al. (1990) Weigel et al. (1990) Mallard et al. (1995) Oddgiersson et aL (1988) Arri6ns et al. (1994)

A11 and A30 A21 and A26 A14

Low High Low

Aarestrup et al. (1995) Aarestrup et al. (1995) Weigel et al. (1990)

Belmont Red Africander x Hereford

A7, CA36 A9

Resistance Susceptibility

Stear et al. (1990) Stear et al. (1988c)

Bos indicus

class I

Parasite entry

Shaw et al. (1995)

Brahman x Shorthorn Belmont Red

A6, CA31 A19, A7

Susceptibility Resistance

Stear et al. (1989) Stear et al. (1990)

Posterior spinal paresis

Holstein

A8

Suspectibility

Park et al. (1993)

Ketosis

Norwegian Red

A2, A13

Resistance

Mejdell et al. (1994)

Retained placenta

Dutch Friesian

compatibility

Susceptibility

Joosten et al. (1991)

Disease

Breed

Enzootic bovine leukosis Seroconversion

Holstein Holstein Guernsey Guernsey PL and B-cell numbers Shorthorn Shorthorn I. Shorthorn I. Shorthorn Holstein Holstein Holstein Holstein Holstein Holstein

Mastitis Clinical mastitis

Subclinical mastitis (cell count)

California mastitistest Heminths Nematodes Protozoa

Theileria parva

Ticks

Boophilus microplus

462

also a useful measure of genetic variability and can be used for genetic management of rare breeds and endangered species (Lewin et al., 1993).

Tissue distribution, structure and function of BoLA molecules Serological studies employing alloimmune reagents support the existence of at least one major expressed class I locus. One-dimensional IEF, using mAbs to phylogenetically conserved monomorphic class I determinants, revealed the presence of more than one class I gene product expressed by lymphocytes from homozygous individuals (Joosten et al., 1988; Watkins et al., 1989b). Mouse L cells transfected with genomic DNA from a homozygous cow produced by sire-daughter mating were shown to express two distinct class I products, as detected with allospecific cytotoxic T-lymphocytes and mAb to determinants on the K N I 0 4 (African Boran class I) and AIO molecules (Toye et al., 1990). Up to six distinct cDNA have been cloned from a single heterozygous bull indicating that there are three class I genes transcribed in bovine lymphocytes (Garber et al., 1994). However, the functionality of these genes has not been clearly established. Expression of classical class II heterodimers on cattle leukocytes was identified using cross-species reactive mAb (Lewin et al., 1985a). While it is clear that distinct D R and D Q products are expressed on the cell surface, D Y, DI or D O products have not been identified. Cytoplasmic and cell-surface expression of class II antigens has been studied using immunofluorescence (Lewin et al., 1985a), antibody-dependent complementmediated cytotoxicity (Lewin et al., 1985b), flow cytometry (Lewin et al., 1985b; Davis et al., 1987), immunoprecipitation (Hoang-Xuan et al., 1982) and 1D-IEF (Joosten et al., 1989; Watkins et al., 1989a). Expression has been demonstrated on B cells (Lewin et al., 1985a), activated T cells (Lalor et al., 1986; Taylor et al., 1993), cell lines (Ababou et al., 1994), alveolar macrophages (Ohmann et al., 1986), monocytes (Taylor et al., 1993; Hughes et al., 1994) and mammary (Fitzpatrick et al., 1992) and bronchial (Spurzem et al., 1992) epithelial cells. Expression of the class II genes has been studied at the transcriptional level using Northern blot analysis (Burke et al., 1991; Stone and Muggli-Cockett, 1993), cDNA cloning (Xu et al., 1991, 1993a, 1994) and PCR-RFLP (Xu et al., 1994). The class IIa region of cattle contains the known expressed class II genes: D R A , DRB3, D Q A , DQB1 and DQB2. In at least three haplotypes with duplicated D Q genes, both D Q B genes are expressed (Xu et al., 1994). Expression of other genes in the class IIa region, DRB1 (a pseudogene), DRB2, D Q A 2 , and the class lib region genes D Y A , D Y B , DIB, and DOB, has not been demonstrated to date (Stone and Muggli-Cockett, 1993).

IMMUNOLOGY OF CATTLE Disease associations Research on the MHC of cattle is often justified in terms of using alleles or haplotypes for selection of disease-resistant animals. A synopsis of research on disease associations and immune responses can be found in Table XIII.7.1.

Unique properties of the bovine MHC The LMP2 proteosome subunit gene was mapped to the class IIb region (Shalhevet et al., 1995) and provided further evidence of the distinctive organization of the BoLA system relative to HLA and H-2. A recent study (Park et al., 1995) identified large variation in recombination rate in the class IIa-IIb interval using sperm typing: one bull had nearly double the recombination rate between D Y A and the gene for prolactin (PRL), which is 2.5-4 cM telomeric to DRB3.

8.


The first papers on bovine red cell antigens appeared in the 1940s and the fascinating history of the early developments in this field has been traced by Stormont (1978). For more recent information see Bell (1983) and International Society for Animal Blood Group Research (1985). A blood group system is defined as antigenic specificities controlled by genes at a single locus or closely linked loci. Within any one system, the antigenic determinants are often not inherited as separate entities but in groups, which behave as alleles ('multiple alleles'). The expression of the products of such multiple alleles is called a phenogroup and there has been much discussion on whether or not these are controlled by clusters of closely linked genes, since crossing over is sometimes observed. The nomenclature of cattle blood groups is confusing because research workers soon exhausted all the letters of the alphabet and had to resort to superscripts after the letters to name new factors, e.g. factors, K, K' and K" in the B system are different specificities. In addition, subtype relationships are often present where the same factor has different types of expression on the red cell membrane. These subtypes are indicated by a numerical subscript, e.g. F1 and F2. The serological test used to identify bovine blood group antigens is based on haemolysis in the presence of complement (usually rabbit). It is generally performed in 96-well microtitre plates.

Blood group systems There are two types of systems in cattle depending on whether they are identified by naturally occurring antibodies or produced by deliberate immunization. Such


463

immune (usually allo-) antibodies have to be extensively absorbed with different red cells to separate out the individual specificities which are needed to make nonspecific typing reagents. Monoclonal antibodies have been produced for blood typing purposes (Tucker et al., 1986; M&~nier et al., 1991; Honberg and Larsen, 1992) but have never replaced the normal panel of reagents used by service laboratories. The natural blood group system The J system is homologous to the R system of sheep, the J system of goats and the A system of pigs (Table XIII.8.1). Certain cattle have a 'natural' antibody, anti-J in their plasma and some very rare animals have an anti-O antibody. These two antisera are used to classify cattle within the J system. The J substance is not a true red cell antigen but is a soluble substance found in the plasma and other secretions, which only becomes attached to the red cells after birth. Some animals have J on their red cells and in their plasma (jcs) while others do not have it on their red cells but only in the plasma and secretions (js). O substance has not been detected on red cells but is present in plasma and secretions of some individuals, sometimes together with J substance (Sprague, 1958). A fourth type of animal lacks both J and O substances and is therefore a 'nonsecretor'. The secretion of J and O substances is likely to be controlled, as in sheep (Rendel, 1957), by a secretor gene at a locus separate from that of J.

Red cell antigens identified by immune antisera Ten systems have been identified in cattle and of these, nine have been assigned to particular chromosomes (Table XIII.8.1). With the exception of R', and possibly F, all systems have a silent allele. There is no comprehensive list available of alleles in the complex B and C systems which have many antigen factors. The M locus is associated with the BoLA histocompatibility locus (Hines and Ross, 1987; Honberg et al., 1995).

S t r u c t u r e of t h e red cell a n t i g e n s

Work on the chemical structure of the antigens has been sporadic and sparse. The F and V determinants of the F system appear to be surface sialoglycoproteins (Spooner and Maddy, 1971) and as such may be analogous to the MNSs blood group system of man. The J-system: J substance of the red cells is a lipid while that of the serum is composed of lipid and nonlipid fractions, the latter probably being a glycoprotein (Theile et al., 1979). The M-system M' antigen is an MHC class I-like molecule that is retained on the red cell during development (Honberg et al., 1995).

Table X111.8.1 Bovine blood group systems

System (locus symbol)

Chromosome assignment

Antigen factors

Minimum number of alleles

(a) J (EAJ) (b) A (EAA)

Chr 11 Chr 15

J; O A1, A2=A; D; H; Z'

4 11

B (EAB)

Chr 8

> 600

C (EAC)

Chr 18

F (EAF) L (EAL) M (EAM) R' (EAR') S (EAS)

Chr Chr Chr Chr

B1; B2=B; G1; G2=G; G3; K; I1; 12; O1; 02; 03; 04; PI=P; P2; Q; T1; T2; Y1; Y2; A'; B'; D'; E'I; E'2; E'3; E'4; F'I; F'2=F'; G'; I'1=1'; 1'2; J'l=J'; J'2; K'; O'1; 0'2=0'; P'I; P'2=P'; Q'; Y'; A"; B"; D"; G"; I"; J"; F"; K", 0" O1; 02; E; R1; R2; W; Xo; Xl; X2; 0'1; X'; L'; C"1; 0"2=0" F1; F2; Vl; V2; (N'; V')

Z (EA2)

T' (EAT')

3 23 16 21

Chr 10 Chr 19

Alleles J; 0 (not a simple inheritance) A1; D; H; AID; A2D, A ~H; DH; A ~DH; AD2Z;" AEDH (a = silent allele) Many

77

Many

L M1; M2=M; M' R';S' S; H'; U; U2; U'l=U'; U'2; H"; S"; U"

5 2 3 2 15

F1; F2; V1; V2; FEV2 L; /(/= silent allele) M1, ME, m (m = silent allele) R'; S' SH'; UH'; H? U;" U'U"H'; U"H'; H'H';" SS"I-I; S"H? U"; U'2U';" UU"H? H"U"H?

Zl--Z; Z 2 T'

3 2

Z; Z2; z (z = silent allele) 7-'; t(t = silent allele)

s (s = silent allele)

464


Applications and significance of red cell antigen diversity The primary reason for the early extensive research into bovine blood groups was to provide polymorphic genetic markers for parentage testing and identification of animals for pedigree registration. This is still the main objective of all the cattle blood typing service laboratories established throughout the world. With the discovery of highly polymorphic microsatellite markers, molecular biological techniques are beginning to replace those of serology and consequently blood typing research is on the decline. Very few new antigen factors have been discovered in recent years. However, in view of the exciting new findings at the molecular and biochemical level in the human blood group field, leading to discovery of structure-function relationships, it is anticipated that interest will be regenerated in farm animal species, including cattle. Soon, it may be possible to put forward explanations for the existence and maintenance of such great genetic variability within a species once the biochemical and physiological roles of the red cell antigens have been elucidated.

9.


Whereas in humans and some rodent species a haemochorial placentation facilitates molecular transport of immunoglobulins from maternal circulation to the fetus, ruminants have an epitheliochorial placentation which prevents this transport (see Table XIII.9.1). Thus, ruminants obtain no immunoglobulin prenatally from the maternal circulation and are born agammaglobulinaemic. However, large quantities of maternal IgG are selectively transported into the mammary gland just prior to parturition and these are ingested and absorbed intact into the circulation by the suckling neonate. The transport of maternal immunoglobulin into colostrum in ruminants is a highly-selective process in which immunoglobulin of the IgG1 isotype subclass is transported via a selective trans-

port mechanism from maternal circulation into mammary secretion, again via IgG1 Fc receptor-mediated transport across the mammary epithelium, ensuring that IgG1 is the predominant isotype of immunoglobulin in ruminant colostrum (Lascelles, 1969). The intestine in newborn ruminants is consequently adapted for large-scale uptake of intact immunoglobulin across the gut into the neonatal circulation. Although it has been calculated that all immunoglobulin isotypes in colostrum are absorbed across the neonatal ruminant intestine with equal efficiency (Brandon and Lascelles, 1971) the predominance of IgG1 ensures that the serum immunoglobulin profile of post-suckled ruminants is similar to that of colostrum with a high predominance of immunoglobulin of the IgG1 isotype. This absorption, however, occurs only in the first 2448 hours of life, during which time the large, palely staining vacuolated cells of the intestinal epithelium of the newborn ruminant are replaced by cells characteristic of the adult intestine (Simpson-Morgan and Smeaton, 1972) to achieve gut closure. These adaptations to enable passive transfer of maternal antibody to the neonate are reflected in relative differences in the constitution of colostrum between species adapted to prenatal versus postnatal transfer. In humans, where IgG is transported placentally, there are very low levels of IgG in colostrum but relatively higher levels of IgA, whereas in ruminants the reverse applies with high levels of IgG in colostrum and relatively low levels of IgA, although a higher ratio of IgA/IgG occurs in later lactation and in involution secretion (Table XIII.9.2). It is noteworthy that while most of the IgA in milk is locally synthesized from plasma cells underlying the mammary epithelium, because serum IgA is dimeric in ruminants there is the potential for IgA produced at remote mucosal sites, but escaping secretion, to be transported from the blood circulation into milk after binding with the polymeric immunoglobulin (pig) receptor on the mammary epithelial cells. Indeed, an inverse relationship exists between the proportion of serum-derived IgA in ruminant milk and the numbers of IgA plasma cells present in the gland, with relatively more serum-derived IgA in early

Table X111.9.1 Correlation between placentation type and mode of passive antibody transfer from mother to young in various species (adapted from Brambell, 1958) Transmission of passive immunity Prenatal

Postnatal

Species

Placentation

Proportion

Route

Proportion

Duration

Route

Cattle, sheep, goat, horse, pig Dog Mouse

Epitheliochorial Endotheliochorial Haemochorial Haemochorial Haemochorial Haemochorial Haemochorial

0 + + + +++ +++ +++

None Transplacental Transplacental Transplacental Transplacental Transplacental Transplacental

+++ ++ ++ ++ 0 0 0

36 h 10 days 16 days 20 days ----

Gut Gut Gut Gut None None None

Rat

Guinea pig Rabbit Man


465

Table X111.9.2 Concentration of immunoglobulins (mg/ml) in colostrum and milk of various species

Total IgG Species

Secretion

IgG 1

IgG2

IgA

IgM

References

Cow

Colostru m Milk Colostrum Milk (early lactaction) Milk (mid-lactation) Milk (late lactaction) Involution Colostru m Milk Colostrum Milk Colostrum Colostrum Colostru m Colostrum

75.0 0.4 60.0 NA NA NA 10.3

1.9 0.06 2.0 NA NA NA 2.0

4.4 0.05 2.0 2.3 0.7 6.5 3.1 1.7 0.06 NA 0.8 3.1 4.5 10.7 17.9

4.9 0.04 4.1 NA NA NA 4.1 3.8 0.03 NA 0.07 2.2 0.1 3.2 0.8

Mach and Pahud (1971) Mach and Pahud (1971) Pahud and Mach (1970) Sheldrake et al. (1984) Sheldrake et al. (1984) Sheldrake et al. (1984) Watson et al. (1972) Pahud and Mach (1970) Pahud and Mach (1970) Rouse and Ingram (1970) McGuire and Crawford (1972) Reynolds and Johnson (1970) Eddie et al. (1971) Porter (1969) Brandtzaeg et al. (1970)

Sheep

Goat Horse Dog Rabbit Pig Human

58.0 0.3 60.0 0.4 14.5 2.4 58.7 0.2

NA, not assayed.

lactation than during late lactation and during involution when IgA plasma cell numbers in the gland increase dramatically (Sheldrake et al., 1984). Although the reasons for the stage-dependent increase in IgA plasma cells in the gland are unknown, this phenomenon enables antibodies generated in response to antigens encountered at remote mucosal sites to be channelled into milk, especially during early lactation when local production of IgA is low (Sheldrake et al., 1984). This same principle allows IgA antibodies absorbed from colostrum by the neonate to be secreted into mucosal secretions remote from the intestine by SC-dependent mechanisms (Scicchitano et al., 1984, 1986). The increase in local production of IgA as lactation progresses parallels the decline in selective transport of serum-derived IgG1 into ruminant milk, which in turn appears to be inversely related to the synthetic activity of the mammary epithelium, although a role for hormonal factors in this phenomenon cannot be excluded (Lascelles and Lee, 1978). While antibodies in colostrum are the predominant immune effectors transferred to the ruminant neonate, cells and other soluble factors in milk play an important role in terms of passive protection. There are normally large numbers of viable cells in bovine milk, varying from 5 • 10 4 to 2 • 10 6 cells/ml, although substantially higher numbers may occur if the gland becomes infected or inflamed. These cells are predominantly T cells of ~fi TCR+, CD8 + phenotype, with memory cell characteristics ( C D 2 high, CD45R l~ (Taylor et al., 1994) and are predominantly derived from other mucosal sites (Manning and Parmely, 1980). To determine the extent to which these cells can be absorbed by the neonate Sheldrake and Husband (1985) administered radioactively labelled maternal lymphocytes intraduodenally to lambs within 14h of birth. Transport of these cells from the duodenum via lacteal lymph and mesenteric lymph nodes

was observed, indicating the potential for cells of maternal origin to have functional relevance in the passive protection of the neonate. Although the duration of their survival before elimination by the host immune response is not known, it is expected that this would be a transient event. Soluble factors other than immunoglobulins in milk are also important effectors of passive immune protection, and part of the protective capacity of milk is attributable to the nonimmunoglobulin fraction. Antibacterial substances such as lactic acid, interferon, lysozyme, lactoferrin and the complement components C3 and C4 have been demonstrated in both human and ruminant milk and have been shown to affect the establishment of pathogenic bacteria either through inherent bactericidal activity or in conjunction with specific immune responses (Butler, 1979; Goldman et al., 1982). The cytokine TGF-fl has also been identified in bovine milk and has been shown to have a powerful modulatory effect on neonatal health and development (Tokuyama and Tokuyama, 1993). Despite the beneficial effect of maternal antibody transfer, it is well-documented that maternal antibody, whether acquired prenatally by transplacental transfer or postnatally via colostrum, has a suppressive effect on the development of endogenous mucosal immune responses in the young animal. This can occur at two l e v e l s systemically through circulating acquired antibody interfering with the development of gut responses, and locally by the presence of colostral and milk immunoglobulins in the lumen of the intestine. Indeed, feeding colostrum containing high titres of Escherichia coli antibodies to young calves inhibited the development of an active E. coli mucosal immune response in these animals in the perinatal period (Logan et al., 1974). Conversely, calves deprived of colostrum have an earlier endogenous production of serum IgA (Husband and Lascelles, 1975).

466


The duration of protection provided by passively acquired maternal antibodies is short-lived. IgM and IgA antibodies are lost from the circulation more rapidly than IgG1 and IgG2 with estimates of the half-lives of the various passively acquired immunoglobulins in ruminants of 16-32 days for IgG1 and IgG2, 4 days for IgM and 2.5 days for IgA (Husband et al., 1972). The extent to which the shorter half lives of IgA and IgM are due to their selective removal from the circulation by pig receptors, enabling their secretion at mucosal surfaces, or is a true reflection of a shorter biological half life is unclear. Although the bulk of the protective effect of passively acquired immunoglobulins results from the systemic absorption of IgG in most species, there is an additional local role for colostral and milk antibody in the lumen of the intestine after its ingestion even in species that do not obtain passive antibody uptake via the gut, or in ruminants after gut closure has occurred. Antibodies of the IgA class increase in concentration as lactation progresses in ruminants and these are responsible for limiting intestinal colonization by enteric pathogens such as E. coli (Corley et al., 1977). The efficacy of passive transfer of antibody via colostrum in ruminants in protecting the neonate from specific diseases has been well documented. Calves that do not receive colostrum often succumb to disease at an early age, or, if they do survive, have restricted growth rates (Belknap et al., 1991). Deliberate passive immunization against selected diseases has been highly effective and calves fed colostral antibodies from immunized cows have been demonstrated to be resistant to specific challenge with a range of selected pathogens including rotavirus (Saif et al., 1983) and E. coli (Johnston et al., 1977).

10.

Table X111.10.1 Basic components of nonspecific immunity in cattle Physical and chemical barriers to infection Epithelial surfaces Normal indigenous microflora Normal excretory secretions and flow of body fluids Mucus on mucosal surfaces Rumen environment Acid pH in abomasum Anaerobic conditions in gastrointestinal tract Bile Molecular components of nonspecific immunity Acute phase proteins (see Table XIII. 10.2) Complement system (see Section 11) Conglutinin Iron-binding proteins Antibacterial cationic peptides (see Table XIII.10.3) Cellular components of nonspecific immunity Neutrophils Mononuclear phagocytic system (macrophages) Eosinophils Mast cells Natural killer cells

Physical and chemical barriers to infection. The major physical and chemical barriers to infection in cattle are basically similar to those in other species (Table XIII.10.1). The rumen environment provides a unique barrier to some infectious agents. The large volume, slow transit time, anaerobic environment, dense microbial flora, and high concentration of microbial digestive enzymes in the rumen inhibit the growth and survival of many pathogens.


The nonantigen-specific (or native) defence mechanisms tend to be highly conserved in vertebrates. Native defence mechanisms in cattle are basically similar to those in other species, but they have some unique aspects. Because of space limitations, the mechanism of action of native defence mechanisms will not be reviewed, instead, this chapter will emphasize those aspects of the native defence mechanisms that are unique in cattle. The basic components of the nonspecific immune system are listed in Table XIII.10.1. These native defence mechanisms are very important for keeping animals healthy. If their function is disrupted for any reason, the animal becomes more susceptible to infection. In the presence of antibodies and/or a cell-mediated immune response some of the native defence mechanisms act more rapidly or more aggressively to help control infection. This is especially true for the complement system and the cellular components of nonspecific immunity listed in Table XIII.10.1.

Molecular components of nonspecific immunity The acute phase response in cattle is triggered by proinflammatory cytokines IL-1, IL-6 and TNF, and involves many of the same components as in other species (Table XIII.10.2) (Godson et al., 1995). One major difference is that C-reactive protein, a major component of the acute phase response in other species, does not increase during the acute phase response in cattle and is therefore not considered an acute-phase protein (Conner and Eckersall,

1988). Conglutinin is a unique component of the nonspecific immune system in ruminants. Conglutinin is a large molecule found in the plasma which binds to the C3b component of complement on cell surfaces. The conglutinin molecule has multiple binding sites for C3b, therefore it clumps (conglutinates) particles coated with C3b. This is believed to facilitate the phagocytosis and removal of C3bcoated particles (see section 11).


467

Table X111.10.2 Characteristics of the bovine acute phase response (A) Plasma proteins which increase during the acute phase response and their functions Binds free hemoglobin Haptoglobin (Conner and Eckersall, 1986, 1988; Conner et aL, 1989; Hofner et aL, 1994; Godson et aL, 1995) Precursor of fibrin for coagulation Fibrinogen (Godson et al., 1995) Serum amyloid A (Boosman et aL, 1989; Horadagoda and Eckersall, 1994) Precursor of the AA class of amyloid fibril protein. Associates with high density lipoproteins in serum Copper binding protein and oxygen radical Ceruloplasmin (Conner and Eckersall, 1986, 1988; Conner et aL, 1989) scavenger Protease inhibitor ~1 Antitrypsin (Conner and Eckersall, 1986, 1988; Conner et aL, 1989) Protease inhibitor ~1 Antichymotrypsin (Conner et aL, 1989) Protease inhibitor ~2 Macroglobulin (Conner et al., 1989) Unknown function Fetuin (Dziegielewska et aL, 1996) Unknown function Seromucoid (Conner and Eckersall, 1988; Conner et aL, 1989) Transport protein ~ Acid glycoprotein (Godson et aL, 1995) (B) Other changes during the bovine acute phase response Fever (Godson et al., 1995) Decreased plasma albumin concentration (Conner and Eckersall, 1988) Decreased plasma Zinc and Iron concentration (Boosman et aL, 1989; Godson et aL, 1995) Leukocytosis (Godson et aL, 1995) or leukopenia (Boosman et aL, 1989), depending on the stimulus

Cattle have several well-defined cationic antibacterial peptides (Table XIII.10.3). Most of these peptides are found in the tertiary granules of bovine neutrophils. In addition a unique cationic antibacterial peptide has been found in the tracheal mucosa of cattle (Diamond et al., 1993). The cationic antibacterial peptides in the neutrophil granules are different from those described in other species. All of these cationic antibacterial peptides have been shown to be bactericidal for selected bacteria and are believed to be important components of native defence.

Cellular components of nonspecific immunity Neutrophils and macrophages are the major phagocytic cell types in cattle and function similarly in cattle as in other species. They are an important first line of defence against infections, especially bacterial infections, and their activity is enhanced by the presence of antibody and T-cell derived cytokines; therefore, they also play a major role in acquired immunity. Neutrophils

Table X111.10.3 Cationic antibacterial peptides in cattle Cationic antibacterial peptides

Antimicrobial activity

Neutrophil lysosomal cationic peptides Staphylococcus aureus, Bactenecin (Romeo et al., 1988) Escherichia coil Bactenecin 5 Salmonella typhimurium, Klebsiella pneumoniae, (Gennaro et aL, 1989) E. co/i, Leptospira interrogans S. typhimurium, Bactenecin 7 K. pneumoniae, E. co/i, (Gennaro et al., 1989) L. interrogans, Pseudomonas aeruginosa Indolicidin (Selsted et aL, 1992) S. aureus, E. coil fi Defensins (13 related peptides) S. aureus, E. coil (Selsted et aL, 1993) Tracheal mucosa

Tracheal antimicrobial peptide (Diamond et al., 1991, 1993)

S. aureus, K. pneumoniae, E. coli, R aeruginosa, Candida albicans

Cattle have a lower percentage of neutrophils in the peripheral blood than most species (reviewed by Roth, 1994). Healthy cattle have approximately half as many neutrophils as lymphocytes in the peripheral blood. A distinctive feature of ruminant neutrophils is the presence of a unique third granule type in the cytoplasm. These granules are larger than the azurophilic and specific granules and contain cationic antibacterial peptides (described above). The azurophilic and specific granules in bovine neutrophils contain many of the same enzymes found in neutrophils from humans and other species, but often in either higher or lower concentration. Notably, bovine neutrophils lack lysozyme, a major component of human neutrophil azurophilic granules. Bovine neutrophils are chemotactically attracted to certain products of complement activation, and arachidonic acid metabolism. They are not chemotactically attracted to several factors that are known to attract human neutrophils, including formyl peptides, Escherichia coli culture filtrates, and platelet activating factor. Bovine neutrophils are unusual in that they have Fc receptors for IgM, and IgM can serve as an effective opsonin. C3b and

468

IgG2 (but not IgG1) also serve as opsonins. Some of the stimuli which induce the oxidative metabolism burst and release of primary granule contents also differ between bovine and human neutrophils. Bovine neutrophil function has been shown to be suboptimal in young calves and in cows around the time of parturition. In addition, infectious agents, glucocorticoid therapy, stress, inadequate nutrition, and genetic defects have been associated with depressed neutrophil function and increase susceptibility to infection. Bovine neutrophil function has also been shown to be enhanced in the presence of several cytokines. In general, the cytokines are more effective at enhancing the function of neutrophils whose function was first depressed by one of the factors listed above. Bovine neutrophils have been shown to be capable of mediating antibody-dependent cell-mediated cytotoxicity (ADCC) similar to neutrophils from other species. In addition, bovine neutrophils have been shown to have the unusual ability to mediate antibody-independent cellmediated cytotoxicity (AICC) if they are activated by certain cytokines. TNF-~ is one of the cytokines capable of inducing bovine neutrophil AICC. Because TNF-~ can be released by macrophages during a nonantigen specific immune response, AICC by activated neutrophils may be a component of nonantigen specific host defence.

Macrophages Macrophages are found in most tissues of cattle. Some of the more important tissue macrophages are: Kupffer cells in the liver sinusoids, microglial cells in the brain, alveolar macrophages, dendritic cells in the skin, macrophages in lymphoid tissue and mammary macrophages (Bielefeldt Ohmann and Babiuk, 1986; Bryan et al., 1988). Cattle, like other ruminants and pigs, have high numbers of pulmonary intravascular macrophages (Winkler, 1988). These cells play a major role in clearing blood-borne bacteria and particulate material. In other species such as humans, dogs, and rats, which do not have high numbers of pulmonary intravascular macrophages, blood-borne pathogens are removed primarily in the spleen and bone marrow. Bovine macrophages are important components of the native defence mechanisms. Resting macrophages are capable of phagocytosing and killing some infectious agents. They become much more aggressive and efficient at killing when activated by cytokines during a T-cellmediated immune response. At least some of the populations of macrophages in cattle are capable of producing oxygen radicals and nitrite (NO[) for killing. An important function of macrophages in native defence is the early release of the cytokines IL-1, IL-6, and TNF-~, in response to the presence of infectious agents. These cytokines initiate the inflammatory and acute phase responses.


Mast cells Mast cells differ in a number of ways according to species and tissue sites, or even within the same tissue (Ruitenberg et al., 1982; Goto et al., 1984; Barret and Metcalfe, 1986; Gomez et al., 1987; Shanahan et al., 1987). Much of the knowledge on mast cells has come from studies comparing connective tissue mast cells and intestinal mucosal mast cells in rodents (Church, 1988). There are three specific characteristics for bovine mast cells. First, mast cell density in the normal respiratory tract of cattle is far greater than in other species (Riley and West, 1953; Hebb et al., 1968; Chen et al., 1990). The second difference was first suspected when it was established that the concentration of dopamine in the lungs of ruminants is exceptionally high (Table XIII.10.4). This dopamine was later demonstrated to be concentrated in the mast cells (Bertler et al., 1959; Coupland and Heath, 1961; Falck et al., 1964) and to be liberated during experimentally induced anaphylaxis (Eyre and Deline, 1971). Finally, the control mechanisms of mediator release appear very different in the bovine species. In other mammals investigated to date, adrenergic control of the release of mediators of mast cells appears to have a consistent pattern, namely that fl-agonists inhibit and that ~-agonists and cholinergic agents enhance the release of mediators such as histamine and leukotrienes. In the bovine species it appears that excitation of either or both c~- or //-adrenoreceptors causes inhibition of mediator release and that cholinomimetics and dopamine specifically induce enhancement (Burka and Eyre, 1976). This positive feedback may be augmenting the processes of inflammation and hypersensitivity by enhancing the liberation of other active substances. Natural killer cells Natural killer (NK) cells are lymphoid cells that mediate natural (spontaneous) non-MHC restricted cytotoxicity. In humans, most NK cells have the large granular lymphoTable X111.10.4 Dopaminecontent in the lungs of mammals

Content (t~g/g wet weight) References Cat Cow Dog Goat Guinea pig Man Mouse Rabbit Rat Sheep

0.44 11 0.24 6.4 0.22 0.59 0.15 0.30 0.50 4

Aviado and Sadavongvivad (1970b) Bertler and Rosengren (1969) Aviado and Sadavongvivad (1970b) Aviado and Sadavongvivad (1970b) Sadavongvivad (1970) Aviado and Sadavongvivad (1970b) Aviado and Sadavongvivad (1970a) Sadavongvivad (1970) Aviado and Sadavongvivad (1970b) Bertler and Rosengren (1969)

Complement System cyte (LGL) morphology. In cattle, the lymphoid cells with NK activity have been shown to be larger than average lymphocytes, but they have not been shown to have granules in their cytoplasm. Bovine NK cells are inefficient at lysing tumour target cells typically used to evaluate NK cell function in other species. They are efficient only at lysing these tumour cell targets if the NK cells are first activated by cytokines to become lymphokine activated killer (LAK) cells. In contrast nonactivated bovine NK cells have been shown to lyse efficiently various virusinfected cells, including cells infected with parainfluenza 3 virus, bovine leukaemia virus and bovine herpes virus 1. Bovine cells exhibiting NK activity have been shown to lack the CD3, CD4, CD5, CD6, and WCI (78 T cell marker) molecules on their surfaces (reviewed by Roth, 1994).

11.

Complement System

Relatively little is known about the bovine complement system compared with what is known about the human complement system. Historically, research on bovine complement started with the intent to use the gained knowledge for the development of complement-fixation tests designed for determining serum antibody levels (Rice and Crowson, 1950; Rice and Boulanger, 1952; Rice and Fuhamel, 1957; Fong et al., 1971a,b). It is not the aim of this short review to describe the complex cascades of the complement system in detail. For this, the reader should consult more comprehensive reviews (Law and Reid, 1988; Holmskov et al., 1994; Gewurz et al., 1995).

Complement components The components of the bovine complement system that have been investigated are listed in Table XIII.11.1. The relevant references are included.

Pathways of initiation The classical pathway of complement activation is initiated when antibody is binding to an antigen. A concomitant change of conformation of the antibody leads to binding of Clq to the antibody. This pathway involves C1, C2, C4 and C3 and may lead to activation of the terminal pathway including C5, C6, C7, C8, C9. A complex of the last five components can form a pore in the membrane of a target cell and lead to cell lysis. The antibody-dependent classical pathway of complement is part of the adaptive immune system. There are three known activation pathways of complement that can be ascribed as part of innate immunity. (1) Pentraxins bind, in a Ca 2+-dependent fashion, to surface

469 carbohydrates of some microorganisms and, having done so, can bind Clq and thus activate the classical pathway (Gewurz et al., 1995). (2) Mannose-binding protein (MBP), another bovine plasma protein, also can bind to some surface carbohydrates of certain microorganisms and can then, by bypassing Clq, activate the classical pathway (Holmskov et al., 1995; Epstein et al., 1996). (3) Finally, the alternative pathway of complement is activated in all mammals continuously, but at very low levels (Law and Reid, 1988). A certain number of molecules of complement compound C3 get hydrolysed to form C3(H20). C3(H20) assumes a conformation that allows the binding of factor B, which, when bound, is cleaved by factor D to Bb. Bb of this complex has enzymatic activity and the ability to convert C3 to C3b which, in turn, can bind more factor B and thus generate more C3-convertase C3bBb. This chain of events, which is a positive feedback mechanism, is kept in balance by control proteins H and I. When C3 is cleaved to C3b, an internal thiolester bond is exposed which has a short-lived ability to react randomly with a hydroxyl group on any foreign or autologous cell. Many invading micro-organisms will not allow the effective binding of control proteins H and I. Thus, the positive feedback will be amplified and lead to deposition of millions of C3b molecules on the microbe within minutes and make nonpathogenic microorganisms prone to either phagocytosis by phagocytic cells, that have receptors for C3b, or to lysis by the terminal complement pathway. The bovine alternative complement pathway discriminates between virulent and nonvirulent microbes (Howard, 1980; Eisenschenk et al., 1995).

Control proteins Some of the control proteins of the bovine complement system, i.e. factor H, factor I, properdin, Cl-inhibitor, C4b-binding protein, membrane cofactor protein and Sprotein, have been characterized to varying degrees. The counterparts of other control proteins of the human complement system, such as decay-accelerating factor, CD59 and homologous restriction factor, have not yet been described.

Cell receptors for cleavage products of complement components The bovine receptors for C3b, iC3b, C3d and C5a have been investigated as indicated in Table XIII.11.1, but the bovine receptors for C3a and C4a have not.

Deficiencies Deficiency of bovine CR3 (iC3b-receptor, Mac-l, CD18/ CDllb) is the only reported deficiency of the bovine

470


Table X111.11.1 Components of the bovine complement cascades Complement components

References

C1, Clq, Cls

Barta (1976), Campbell et al. (1979a,b), Linscott and Triglia (1980), Triglia and Linscott (1980), Yonemasu et al. (1980), Sasaki and Yonemasu (1984), Yonemasu et al. (1980) Linscott and Triglia (1980), Triglia and Linscott (1980) Linscott and Triglia (1980), Triglia and Linscott (1980), Menger and Aston (1985), Mhatre and Aston (1987b), Boulard (1989), Lu et al. (1993), Ogunremi and Tabel (1993a) Booth et aL (1979a,b), Linscott and Triglia (1980), Triglia and Linscott (1980), Smith et aL (1982), Groth et al. (1987), Dodds and Law (1990) Barta (1976), Linscott and Triglia (1980), Gennaro et aL (1986), Aston et al. (1990) Barta (1976), Linscott and Triglia (1980) Barta (1976), Linscott and Triglia (1980) Barta (1976), Linscott and Triglia (1980) Barta (1976), Linscott and Triglia (1980), Eisenschenk et al. (1992) Pang and Aston (1978), Tabel et al. (1984), Sethi and Tabel (1990a,b,c), Ogunremi and Tabel (1993a) Menger and Aston (1984) Mhatre and Aston (1987a), Tabel et aL (1990), Sakakibara et al. (1994), Soames et al. (1996) Barta (1976), Linscott and Triglia (1980), Triglia and Linscott (1980), Menger (1996), Soames et al. (1996) Nielsen et al. (1978) van Nostrand and Cunningham (1987) Hillarp et al. (1994)

C2 C3, C3b, iC3b C4, C4a C5, C5a C6 C7 C8 C9 Factor B Factor D Factor H Factor I (C3b-inactivator) Properdin C1 -inhibitor C4-binding protein Decay-accelerating factor (CD55) Membrane cofactor protein (CD46) CD59 Homologous restriction factor (C8-binding protein) S protein (vitronectin) C3b receptor (CR1; CD35) C3d receptor (CR2; CD21) iC3b-receptor (CR3; CD11 b/18; Mac-l) C3a receptor C4a receptor C5a receptor Conglutinin

m a

Menger (1996) m

Dahlb&ck (1986), Mimuro and Loskutoff (1989), Filippsen et al. (1990), Hillarp et al. (1994) Worku et al. (1995) Naessens et al. (1990), Threadgill et al. (1994) Splitter and Morrison (1991), Gerardi (1996), Rutten et al. (1996)

m

Perret et al. (1992) Lachmann (1967), Davis and Lachmann (1984), Strang et al. (1986), Loveless et al. (1989), Lee et al. (1991), Akiyama et al. (1992), Andersen et al. (1992), Hartshorn et al. (1993), Lim et al. (1993), Lu et al. (1993), Suzuki et al. (1993), Holmskov et al. (1994), Laursen et al. (1994), Reid and Turner (1994), Eda et al. (1996), Epstein et al. (1996) Mannose-binding protein (MBP) Kawasaki et al. (1985), Andersen et al. (1992), Holmskov et al. (1994), Epstein et aL (1996) Pentraxins Akiyama et al. (1992), Anderson et al. (1992), Sarikaputi et al. (1992), Gewurz et al. (1995)

a-Unknown.

complement system to date. This deficiency is associated with the bovine leukocyte adhesion deficiency (BLAD) (Shuster et al., 1992; Gerardi, 1996; Rutten et al., 1996; Cox et al., 1997). BLAD results from a point mutation within the gene encoding bovine CD18 which is one chain of the heterodimeric/32 integrin adhesion molecule (CD18/ CDlla) on bovine leukocytes (Shuster et al., 1992). Since CD18 is also part of the heterodimeric iC3b-receptor, which is present on neutrophils and mononuclear phagocytes, BLAD is associated with impaired microbicidal activities of phagocytes (Nagahata et al., 1994, 1996).

Serum c o m p l e m e n t levels

Hemolytic serum complement levels initiated via the classical or alternative pathway and also C3 levels in calves during their first month of life are about one-third to one-half of the values measured in sera of their dams (Renshaw and Everson, 1979; M~iller et al., 1983). Bactericidal activities in calf sera correlate with complement activity (Barta et al., 1972). Complement activity in bovine colostrum appears to be entirely mediated by the classical pathway (Brock et al., 1975).

References

Differences between bovine complement and the complement system of other mammals All Bovidae differ from other mammalian species in that their serum contains high levels of conglutinin (Lachmann, 1967; Ingrain, 1982). The kinetics of the bovine alternative complement pathway appear to differ from the kinetics of the murine alternative complement pathway (Ogunremi and Tabel, 1993a,b). Conglutinin belongs to the group of proteins called collectins, proteins that share structural features with collagen and functional properties with lectins (Reid and Turner, 1994; Epstein et al., 1996). It binds to terminal Nacetyl glucosamine, mannose and fucose (Loveless et al., 1989). It has the unique property of binding, in a Ca 2§ dependent fashion, to iC3b (Hirani et al., 1985). There is circumstantial evidence that conglutinin may retard the dissociation of Bb from the C3-convertase C3bBb or from this complex after C3b has been degraded to iC3b (Tabel, 1996). Conglutinin that is bound to microorganisms, either directly via microbial carbohydrate or via iC3b, can mediate adherence to phagocytes via the Clq receptor of phagocytes (Reid and Turner, 1994). Conglutinin mediates a complement-dependent enhancement of the respiratory burst of phagocytes stimulated by E. coli (Friis et al., 1991). It contributes to the bactericidal activity of bovine serum (Ingrain, 1982; Friis-Christiansen et al., 1990). Conglutinin is consumed during infections of cattle with Babesia bovis (Goodger et aI., 1981). Serum levels have been observed to be lowest at peaks of infection and to return to normal after infection (Ingram, 1982). The kinetics of the bovine alternative complement pathway appear to proceed more slowly than the kinetics of the murine alternative complement pathway. By incubating zymosan with bovine or murine plasma, it was found that deposition of murine C3b onto zymosan particles peaked at 5 rain (Ogunremi and Tabel, 1993b) whereas deposition of bovine C3b peaked at 20-30rain (Ogunremi and Tabel, 1993a).

12.

References

Aarestrup, F. M., Jensen, N. E., Ostergfird, H. (1995). Analysis of associations between major histocompatibility complex (BoLA) class I haplotypes and subclinical mastitis of dairy cows. J. Dairy Sci. 78, 1684-1692. Ababou, A., Goyeneche, J., Davis, W. C., L6vy, D. (1994). Evidence of the expression of three different BoLA-class II molecules on the bovine BL-3 cell line: determination of a non-DR non-DQ gene product. J. Leukoc. Biol. 56, 182-186. Abraham, J., Mergia, A., Whang, J., Tumolo, A., Friedman, J., Hjerrild, K., Gospodarowicz, D., Fiddes, J. (1986). Nucleotide sequence of a bovine clone encoding the angiogenic protein, basic fibroblast growth factor. Science 233,545-548. Ackermann, M. R., Cheville, N. F., Deyoe, B. L. (1988). Bovine ileal dome lymphoepithelial cells: endocytosis and transport of Brucella abortus strain 19. Vet. Pathol. 25, 28-35.

471

Adams, J., Czuprynski, C. (1995). Ex vivo induction of TNFalpha and IL-6 mRNA in bovine whole blood by Mycobacterium paratuberculosis and mycobacterial cell wall components. Microb. Pathog. 19, 19-29. Adler, H., Frech, B., Thony, M., Pfister, H., Peterhans, E. and Jungi, T. (1995). Inducible nitric oxide synthetase in cattle. Differential cytokine regulation of nitric oxide synthetase in bovine and murine macrophages. J. Immunol. 154, 47104718. Agaba Kasigwa, M. (1996). Development of bovine type I markers and their application to investigating the trypanotolerance trait. Ph.D thesis, Department of Biology and Biochemistry, Brunel University, U.K. Agaba, M., Kemp, S. J., Barendse, W., Teale, A. J. (1996). Polymorphism at the bovine tumor necrosis factor alpha locus and assignment to BTA 23. Mamm. Genome 7, 186-187. Akiyama, K., Sugii, S., Hirota, Y. (1992). Development of enzyme-linked immunosorbent assays for conglutinin, mannose-binding protein and serum amyloid-P component in bovine sera. Am. J. Vet. Res. 53, 2102-2104. Allmann-Iselin, I., Car, B., Zwahlen, R., Mueller-Schupbach, R., Wyder-Walther, M., Steckholzer, U., Walz, A. (1994). Bovine ENA, a new monocyte-macrophage derived cytokine of the interleukin-8 family. Structure, function, and expression in acute pulmonary inflammation. Am. J. Pathol. 145, 13821389. Alterio, J., Halley, C., Brou, C., Soussi, T., Courtois, Y., Laurent, M. (1988). Characterization of a bovine acidic FGF cDNA clone and its expression in brain and retina. FEBS Lett. 242, 41-46. Andersen, O., Friis, P., Holm-Nielsen, E., Vilsgaard, K., Leslie, R. G., Svehag, S. E. (1992). Purification, subunit characterization and ultrastructure of the three soluble bovine lectins: conglutinin, mannose-binding protein and the pentraxin serum amyloid-P-component. Scand. J. Immunol. 36, 131141. Andersson, L., Rask, L. (1988). Characterization of the MHC class II region in cattle. The number of DQ genes varies between haplotypes. Immunogenetics 27, 110-120. Andersson, L., B6hme, J., Peterson, P. A., Rask, L. (1986a). Genomic hybridization of bovine class II major histocompatibility genes: 2. Polymorphism of DR genes and linkage disequilibrium in the DQ-DR region. Anim. Genet. 17, 295304. Andersson, L., B6hme, J., Rask, L., Peterson, P. A. (1986b). Genomic hybridization of bovine class II major histocompatibility genes: 1. Extensive polymorphism of DQ and DQ genes. Anim. Genet. 17, 95-112. Andersson, L., Lund~n, A., Sigurdardottir, S., Davies, C. J., Rask, L. (1988). Linkage relationships in the bovine MHC region. High recombination frequency between class II subregions. Immunogenetics 27, 273-280. Andersson, L., Gustafsson, K., Jonsson, A.-K., Rask, L. (1991). Concerted evolution in a segment of the first domain exon of polymorphic MHC class II loci. Immunogenetics 33, 235242. Adrianarivo, A., Muiya, P., Opollo, M., Logan-Henfry, L. (1995). Trypanosoma congolense: comparative effects of a primary infection on bone marrow progenitor cells from N'Dama and Boran cattle. Exp. Parasitol. 80, 407-418. Anonymous (1982). Proceedings of the Second International

472

Bovine Lymphocyte Antigen (BoLA) Workshop. Anim. Blood Groups Biochem. Genet. 13, 33-53. Armour, K. L., Tempest, P. R., Fawcett, P. H., Fernie, M. L., King, S. I., White, P., Taylor, G., Harris, W. J. (1994). Sequences of heavy and light chain variable regions from four bovine immunoglobulins. Mol. Immunol. 17, 1369-1372. Arriens, M. A., Ruff, G., Sch/illibaum, M., Lazary, S. (1994). Possible association between a serologically detected haplotype of the bovine major histocompatibility complex and subclinical mastitis. J. Anim. Breed. Genet. 111,152-161. Aston, W. P., Mhatre, A., Macrae, J. (1990). Isolation of the fifth component of the bovine complement system. Vet. Immunol. Immunopathol. 24, 301-312. Aviado, D. M., Sadavongvivad, C. (1970a). Pharmacological significance of biogenic amines in the lungs: histamine. Br. J. Pharmacol. 38, 366-373. Aviado, D. M., Sadavongvivad, C. (1970b). Pharmacological significance of biogenic amines in the lungs: noradrenaline and dopamine. Br. J. Pharmacol. 38,374-385. Baker, D. G., Gershwin, L. J. (1992). Seasonal patterns of total and Ostertagia-specific IgE in grazing cattle. Vet. Parasitol. 44, 211-221. Baldwin, C. L., Teale, A. J., Naessens, j. G., Goddeeris, B. M., MacHugh, N. D., Morrison, W. I. (1986). Characterisation of a subset of bovine T lymphocytes that express BoT4 by monoclonal antibodies and function: similarity of lymphocytes defined by human T4 and murine L3T4. J. Immunol. 136, 4385-4391. Barendse, W., Armitage, S. M., Kossarek, L. M., Shalom, A., Kirkpatrick, B. W., Ryan, A. M., Clayton, D., Li, L., Neibergs, H. L., Zhang, N., Grosse, W. M., Weiss, J., Creighton, P., McCarthy, F., Ron, M., Teale, A. J., Fries, R., McGraw, R. A., Moore, S. S., Georges, M., Soller, M., Womack, J. E., Hetzel, D. J. S. (1994). A genetic linkage map of the bovine genome. Nature Genet. 6, 227-235. Barret, K. E., Metcalfe, D. D. (1986). Mast cell heterogeneity. Studies in non-human primates. In Mast Cell Differentiation and Heterogeneity (eds Befus, A. D., Bienenstock, J., Denburg, J. A.), pp. 231-238. Raven Press, New York, USA. Barta, O. (1976). Separation of six bovine complement components and one inactivator. Immunol. Commun. 5, 75-86. Barta, O., Barta, V., Ingrain, D. G. (1972). Postnatal development of bactericidal activity in serum from conventional and colostrum-deprived calves. Am. J. Vet. Res. 33,741-750. Beever, J., Fisher, S., Lewin, H. (1996). Genetic mapping of 12 orthologs from human chromosomes 1 and 4 to bovine chromosomes 3, 6, 16 and 17. Abstract XXVth International Conference on Animal Genetics, July 1996, Tours, p. 92. Belknap, E. B., Baker, J. C., Patterson, J. S., Walker, R. D., Haines, D. M., Clark, E. G. (1991). The role of passive immunity in bovine respiratory syncytial virus-infected calves. J. Infect. Dis. 163,470-476. Bell, K. (1983). The blood groups of domestic mammals. In Red Blood Cells of Domestic Animals (eds Agar, N. S., Board, P. G.), pp. 133-164. Elsevier, Amsterdam, The Netherlands. Bembridge, G. P., MacHugh, N. D., McKeever, D., Awino, E., Sopp, P., Collins, R. A., Gelder, K. I., Howard, C. J. (1995). CD45RO expression on bovine T cells: relation to biological function. Immunology 86, 537-544. Bensaid, A., Young, J. R., Kaushal, A., Teale, A. J. (1991). Pulsed-field gel electrophoresis and its application in the physical analysis of the bovine MHC. In Gene Mapping Techniques and Applications (eds Schook, L. B., Lewin,


H. A., McLaren, D. G.), pp. 127-158. Marcel Dekker, Inc., New York, USA. Bernoco, D., Lewin, H. A., Andersson, L., Arriens, M. A., Byrns, G., Cwik, S., Davies, C. J., Hines, H. C., Leibold, W., Lie, O., Meggiolaro, D., Oliver, R., Ostergkrd, H., Spooner, R. L., Stewart, J. A., Teale, A. J., Templeton, J. W., Zanotti, M. (1991). Joint report of the Fourth International Bovine Lymphocyte Antigen (BoLA) Workshop, East Lansing, Michigan, USA, August 25, 1990. Anirn. Genet. 22, 477-496. Bertler, A., Rosengren, E. (1969). Occurrence and distribution of dopamine in brain and other tissues. Experientia 15, 10-11. Bertler, A., Falck, B., Hillarp, N. A., Rosengren, E., Torp, N. A. (1959). Dopamine and chromaffin cells. Acta Physiol. Scand. 47, 251-258. Bielefeldt Ohmann, H., Babiuk, L. A. (1986). Bovine alveolar macrophages: phenotypic and functional properties of subpopulations obtained by percoll density gradient centrifugation. Eur. J. Biochem. 218, 669-677. Bienhoff, S., Allen, G. (1995). Quantitation of bovine TNF-~ mRNA by reverse transcription and competitive polymerase chain reaction amplification. Vet. Immunol. Immunopathol. 44, 129-140. Bishop, M. D., Kappes, S. M., Keele, J. W., Stone, R. T., Sunden, S. L. F., Hawkins, G. A., Toldo, S. S., Fries, R., Grosz, M. D., Yoo, J., Beattie, C. W. (1994). A genetic linkage map for cattle. Genetics 136, 619-639. Bissumbhar, B., Nilsson, P. R., Hensen, E. J., Davis, W. C., Joosten, I. (1994). Biochemical characterization of bovine MHC DQ allelic variants by one-dimensional isoelectric focusing. Tissue Antigens 44, 100-109. Blecha, F. (1991). Cytokines: applications in domestic food animals. J. Dairy Sci. 74, 328-339. Boosman, R., Niewold, T. A., Mutsaers, C., Gruys, E. (1989). Serum amyloid A concentrations in cows given endotoxin as an acute-phase stimulant. Am. J. Vet. Res. 50, 1690-1694. Booth, N. A., Campbell, R. D., Fothergill, J. E. (1979a). The purification and characterization of bovine C4, the fourth component of complement. Biochem. J. 177, 959-965. Booth, N. A., Campbell, R. D., Smith, M. A., Fothergill, J. E. (1979b). The isolation and characterization of bovine C4a, an activation fragment of the fourth component of complement. Biochem. J. 183,573-578. Boulard, C. (1989). Degradation of bovine C3 by serine proteases from parasites Hypoderma lineatum (Diptera, Oestridae). Vet. Immunol. Immunopathol. 20, 387-398. Brambell, F. W. R. (1958). The passive immunity of the young mammal. Biol. Rev. 33,488. Brandon, M. R., Lascelles, A. K. (1971). Relative efficiency of absorption of IgG1, IgG2, IgA and IgM in the newborn calf. Aust. J. Exp. Biol. Med. Sci. 49, 629-633. Brandtzaeg, P., Fjellanger, I., Gjeruldsen, S. T. (1970). Human secretory immunoglobulins. I. Salivary secretions from individuals with normal or low levels of serum immunoglobulins. Scand. J. Haematol. Suppl. 12, 3-83. Broad, T. E., Burkin, D. J., Cambridge, L. M., Jones, C., Lewis, P. E., Morse, H. G., Geyer, D., Pearce, P. D., Ansari, H. A., Maher, D. W. (1995). Six loci mapped on to human chromosome 2p are assigned to sheep chromosome 3p. Anim. Genet. 26, 85-90. Brock, J. H., Ortega, F., Pinerio, A. (1975). Bactericidal and hemolytic activity of complement in bovine colostrum and serum: effect of proteolytic enzymes and ethylene glycol tetraacetic acid (EFTA). Ann. Immunol. 126C, 439-451.

References

Brown, W., Dziegielewska, K., Foreman, R., Saunders, N. (1990). The nucleotide and deduced amino acid sequences of insulinlike growth factor II cDNAs from adult bovine and fetal sheep liver. Nucl. Acids Res. 18, 4614-4616. Brown, W., Davis, W., Dobbelaere, D., Rice-Ficht, A. (1994a). CD4+-cell clones obtained from cattle chronically infected with Fasciola hepatica and specific for adult worm antigen express both unrestricted and Th2 cytokine profiles. Infect. Immun. 62, 818-827. Brown, W., Woods, V., Chitko-McKown, C., Hash, S., RiceFicht, A. (1994b). Interleukin-10 is expressed by bovine type 1 helper, type 2 helper and unrestricted parasite-specific T-cell clones and inhibits proliferation of all three subsets in an accessory-cell-dependent manner. Infect. Immun. 62, 46974708. Brown, W., Zhao, S., Rice-Ficht, A., Logan, K., Woods, V. (1992). Bovine helper T-cell clones recognize five distinct epitopes on Babesia bovis merozoite antigens. Infect. Immun. 60, 4364-4372. Brown, W., Zhao, S., Woods, V., Tripp, C., Tetzlaff, C., Heussler, V., Dobbelaere, D., Rice-Ficht, A. (1993). Identification of two Thl cell epitopes on the Babesia bovis - encoded 77-kilodalton merozoite protein (Bb-1) by use of truncated recombinant fusion proteins. Infect. Immun. 61,236-244. Bryan, L. A., Griebel, P. J., Haines, D. M., Davis, W. C., Allen, J. R. (1988). Immunocytochemical identification of bovine Langerhans cells by use of a monoclonal antibody directed against class II MHC antigens. J. Histochem. Cytochem. 36, 991-995. Buitkamp, J., Schwaiger, F., Solinas-Toldo, S., Fries, R., Epplen, J. (1995). The bovine interleukin-4 gene: genomic organization, localization, and evolution. Mamm. Genome 6, 350-356. Bull, R. W., Lewin, H. A., Wu, M. C., Peterbaugh, K., Antczak, D., Bernoco, D., Cwik, S., Dam, L., Davies, C., Dawkins, R. L., Dufty, J. H., Gerlach, J., Hines, H. C., Lazary, S., Leibold, W., Leveziel, H., Lie, O., Lindberg, P. G., Meggiolaro, D., Meyer, E., Oliver, R., Ross, M., Simon, M., Spooner, R. L., Stear, M. J., Teale, A. J., Templeton, J. W. (1989). Joint report of the Third International Bovine Lymphocyte Antigen (BoLA) Workshop, Helsinki, Finland, 27 July 1986. Anim. Genet. 20, 109-132. Burka, J., Eyre, P. (1976). Modulation of the release of SRS-A from bovine lung in vitro by several autonomic and autocoid agents. Int. Arch. Allergy Appl. Immunol. 50, 664-673. Burke, M. G., Stone, R. T., Muggli-Cockett, N. E. (1991). Nucleotide sequences and Northern analysis of a bovine major histocompatibility class II DR-like cDNA. Anim. Genet. 22, 343-352. Butler, J. E. (1979). Immunologic aspects of breast feeding, antiinfectious activity of breast milk. Sem. Perinatol. 3, 255270. Butler, J. E. (1983). Bovine immunoglobulins: an augmented review. Vet./mmunol. Immunopathol. 4, 43-152. Butler, J. E. (1986). Biochemistry and biology of ruminant immunoglobulins. Prog. Vet. Microbiol. Immun. 2, 1-53. Butler, J. E., Heyermann, H., Frenyo, L. V., Kieman, J. (1987). The heterogeneity of bovine IgG2. II. The identification of IgG2b. Immunol. Letters 16, 31-46. Butler, J. E., Navarro, P., Heyermann, H. (1994). Heterogeneity of bovine IgG2. VI. Comparative specificity of monoclonal and polyclonal capture antibodies for IgG2a(A1) and IgG2b(A2). Vet. Immunol. Immunopathol. 40, 119-133. Butler, J. E., Sun, J., Navarro, P. (1996). The swine Ig heavy chain

473

locus has a single Jh and no identifiable IgD. Int. Immunol. 8, 1897-1904. Campbell, R. D., Booth, N. A., Fothergill, J. E. (1979a). Purification and characterization of subcomponent Clq of the first component of bovine complement. Biochem. J. 177, 531-540. Campbell, R. D., Booth, N. A., Fothergill, J. E. (1979b). The purification and characterization of subcomponent Cls of the first component of bovine complement. Biochem. J. 183,579588. Capon, D., Shepard, H., Goeddel, D. (1985). Two distinct families of human and bovine interferon-alpha genes are coordinately expressed and encode functional polypeptides. Mol. Cell. Biol. 5,768-779. Cerretti, D., McKereghan, K., Larsen, A., Cantrell, M., Anderson, D., Gillis, S., Cosman, D., Baker, P. (1986a). Cloning, sequence and expression of bovine interleukin 2. Proc. Natl Acad. Sci. USA 83, 3223-3227. Cerretti, D., McKereghan, K., Larsen, A., Cosman, D., Gillis, S., Baker, P. (1986b). Cloning, sequence and expression of bovine interferon-gamma. J. Immunol. 136, 4561-4564. Chaplin, P., Parsons, K., Collins, R. (1996). The cloning of cattle interferon-A subtypes isolated from the gut epithelium of rotavirus-infected calves. Immunogenetics 44, 143-145. Chen, W., Alley, M. R., Manktelow, B. W., Slack, P. (1990). Mast cells in the bovine lower respiratory tract: morphology, density and distribution. Br. Vet. J. 146, 425-436. Chitko-McKown, C., Ruef, B., Rice-Ficht, A., Brown, W. (1995). Interleukin-10 downregulates proliferation and expression of interleukin-2 receptor p55 chain and interferon-gamma, but not interleukin-2 or interleukin-4, by parasite-specific helper T cell clones obtained from cattle chronically infected with Babesia bovis or Fasciola hepatica. J. Interferon Cytokine Res. 15,915-922. Church, M. K. (1988). Mast cell heterogenieity. In Mechanisms of Asthma, Pharmacology, Physiology, and Management (eds Armour, C. L., Black, J. L.), pp. 15-23. Alan R. Liss, Inc., New York, USA. Clevers, H., MacHugh, N. D., Bensaid, A., Dunlap, S., Baldwin, C. L., Kaushal, A., Iams, K., Howard, C. J., Morrison, W. I. (1990). Identification of a bovine surface antigen uniquely expressed on CD4- CD8- T cell receptor gamma/delta + T lymphocytes. Eur. J. Immunol. 20, 809-817. Cludts, I., Droogmans, L., Cleuter, Y., Kettman, R., Burny, A. (1992). Sequence of bovine interleukin 7. DNA Seq. 3, 55-59. Cludts, I., Cleuter, Y., Kettmann, R., Burny, A., Droogmans, L. (1993). Cloning and characterization of the tandemly arranged bovine lymphotoxin and tumour necrosis factoralpha genes. Cytokine 5,336-341. Collins, R., Oldham, G. (1993). Recombinant human interleukin 2 induces proliferation and immunoglobulin secretion by bovine B-cells: tissue differences and preferential enhancement of immunoglobulin A. Vet. Immunol. Immunopathol. 36, 3143. Collins, R., Oldham, G. (1995). Effect of recombinant bovine IL-1 and IL-2 on B-cell proliferation and differentiation. Vet. Immunol. Immunopathol. 44, 141-150. Collins, R., Tayton, H., Gelder, K., Britton, P., Oldham, G. (1994). Cloning and expression of bovine and porcine interleukin-2 in baculovirus and analysis of species cross-reactivity. Vet. Immunol. Immunopathol. 40, 313-324. Collins, R. A., Sopp, R., Gelder, K. I., Morrison, W. I., Howard, C. J. (1996). Bovine )'/3 TCR + T lymphocytes are stimulated

474

to proliferate by autologous Theileria annulata-infected cells in the presence of interleukin-2. Scand. J. Immunol. 44, 444452. Conner, J. G., Eckersall, P. D. (1986). Acute phase response and mastitis in the cow. Res. Vet. Sci. 41,126-128. Conner, J. G., Eckersall, P. D. (1988). Bovine acute phase response following turpentine injection. Res. Vet. Sci. 44, 8288. Conner, J. G., Eckersall, P. D., Wiseman, A., Bain, R. K., Douglas, T. A. (1989). Acute phase response in calves following infection with Pasturella haemolytica, Ostertagia ostertagi and endotoxin administration. Res. Vet. Sci. 47, 203-207. Corley, L. D., Staley, T. E., Bush, L. J., Jones, E. W. (1977). Influence of colostrum on transepithelial movement of Escherichia coli 055. J. Dairy Sci. 60, 1416-1421. Coupland, R. E., Heath, I. D. (1961). Chromaffin cells, mast cells and melanin. II. The chromaffin cells of the liver capsule and gut in ungulates. J. Endocrinol. 22, 71-76. Covert, J., Splitter, G. (1995). Detection of cytokine transcriptional profiles from bovine peripheral blood mononuclear cells and CD4 § lymphocytes by reverse transcriptase polymerase chain reaction. Vet. Immunol. Immunopathol. 49, 3950. Cox, E., Mast, J., MacHugh, N., Swenger, B., Goddeeris, B. M. (1977). Expression of/32 integrins on blood leukocytes of cows with and without bovine leukocyte adhesion deficiency. Vet. Immunol. Immunopathol. 58,249-263. Dahlb~ick, B. (1986). Inhibition of protein Ca cofactor function of human and bovine protein S by C4b-binding protein. J. Biol. Chem. 261, 12022-12027. Daley, M., Williams, T., Coyle, P., Furda, G., Dougherty, R., Hayes, P. (1993). Prevention and treatment of Staphylococcus aureus infections with recombinant cytokines. Cytokine 5, 276-284. Davies, C. J., Joosten, I., Andersson, L., Arriens, M. A., Bernoco, D., Bissumbhar, B., Byrns, G., van Eijk, M. J. T., Kristensen, B., Lewin, H. A., Mikko, S., Morgan, A. L. G., MuggliCockett, N. E., Nilsson, P. R., Oliver, R. A., Park, C. A., van der Poel, J. J., Polli, M., Spooner, R. L., Stewart, J. A. (1994a). Polymorphism of bovine MHC class II genes. Joint report of the Fifth International Bovine Lymphocyte Antigen (BoLA) Workshop, Interlaken, Switzerland, 1 August 1992. Eur. J. Immunogenet. 21,259-289. Davies, C. J., Joosten, I., Bernoco, D., Arriens, M. A., Bester, J., Ceriotti, G., Ellis, S., Hensen, E. J., Hines, H. C., Horin, P., Kristensen, B., Lewin, H. A., Meggiolaro, D., Morgan, A. L. G., Morita, M., Nilsson, P. R., Oliver, R. A., Orlova, A., Ostergfird, H., Park, C. A., Schuberth, H.-J., Simon, M., Spooner, R. L., Stewart, J. A. (1994b). Polymorphism of bovine MHC class I genes. Joint report of the Fifth International Bovine Lymphocyte Antigen (BoLA) Workshop, Interlaken, Switzerland, 1 August 1992. Eur. J. Immunogenet. 21,239-258. Davis, A. E. 3rd, Lachmann, P. J. (1984). Bovine conglutinin is a collagen-like protein. Biochemistry 23, 2139-2144. Davis, W. D., Marusic, S., Lewin, H. A., Splitter, G. A., Perryman, L. E., McGuire, T. C., Gorham, J. R. (1987). The development and analysis of species specific and cross reactive monoclonal antibodies to leukocyte differentiation antigens and antigens of the major histocompatibility complex for use in the study of the immune system in cattle and other species. Vet. Immunol. Immunopathol. 15,337-376. Delbe, J., Vacherot, F., Laaroubi, K., Barritault, D., Courty, J.


(1995). Effect of heparin on bovine epithelial lens cell proliferation induced by heparin affin regulatory peptide. J. Cell Physiol. 164, 47-54. De Martini, J., Baldwin, C. (1991). Effects of gamma interferon, tumor necrosis factor alpha, and interleukin-2 on infection and proliferation of Theileria parva-infected bovine lymphoblasts and production interferon by parasitized cells. Infect. Immun. 59, 4540-4546. Diamond, G., Zasloff, M., Eck, H., Brasseur, M., Maloy, W. L., Bevins, C. L. (1991). Tracheal antimicrobial peptide, a cysteine-rich peptide from mammalian tracheal mucosa: peptide isolation and cloning of a cDNA. Proc. Natl Acad. Sci. USA 88, 3952-3956. Diamond, G., Jones, D. E., Bevins, C. L. (1993). Airway epithelial cells are the site of expression of a mammalian antimicrobial peptide gene. Proc. Natl Acad. Sci. USA 90, 4596-4600. Dodds, A. W., Law, S. K. A. (1990). The complement component of C4 of mammals. Biochem. J. 265,495-502. Droogmans, L., Cludts, I., Cleuter, Y., Kettmann, R., Burny, A. (1992a). Nucleotide sequence of the bovine interleukin-6 gene promoter. DNA Seq. 3, 115-117. Droogmans, L., Cludts, I., Cleuter, Y., Kettmann, R., Burny, A. (1992b). Nucleotide sequence of the bovine interleukin-6 cDNA. DNA Seq. 2, 411-413. Dziegielewska, K. M., Brown, W. M., Gould, C. C., Matthews, N., Sedgwick, J. E. C., Saunders, N. R. (1996). Fetuin: an acute phase protein in cattle. J. Comp. Physiol. B 162, 168171. Easton, A., Gierse, J., Seetharam, R., Klein, B., Kotts, C. (1991). Production of bovine insulin-like growth factor 2 (bIGF-2) in Escherichia coli. Gene 101,291-295. Eda, S., Suzuki, Y., Kase, T., Kawai, T., Ohtani, K., Sakamoto, T., Kurimura, T., Wakamiya, N. (1996). Recombinant bovine conglutinin lacking the N-terminal and collagenous domains, has less conglutination activity but is able to inhibit haemagglutination by influenza A virus. Biochem. J. 316, 43-48. Eddie, D. S., Schulkind, M. L., Robbins, J. B. (1971). The isolation and biologic activities of purified secretory IgA and IgG anti-Salmonella typhimurium 'O' antibodies from rabbit intestinal fluid and colostrum. J. Immunol. 106, 181-190. Eggen, A., Fries, R. (1995). An integrated cytogenetic and meiotic map of the bovine genome. Animal Genetics 26, 215-236. Eisenschenk, F. C., Houle, J. J., Hoffmann, E. M. (1992). Purification of the ninth component of the bovine complement cascade. Am. J. Vet. Res. 53,435-439. Eisenschenk, F. C., Houle, J. J., Hoffmann, E. M. (1995). Serum sensitivity of field isolates and laboratory strains of Brucella abortus. Am. J. Vet. Res. 56, 1592-1598. Ellis, J. A., Baldwin, C. L., MacHugh, N. D., Bensaid, A., Teale, A. J., Goddeeris, B. M., Morrison, W. I. (1986). Characterisation by a monoclonal antibody and functional analysis of a subset of bovine T lymphocytes that express BoT8, a molecule analogous to human CD8. Immunology 58, 351-358. Ellis, J., Godson, D., Campos, M., Sileghem, M., Babiuk, L. (1993). Capture immunoassay for ruminant tumor necrosis factor-a: comparison with bioassay. Vet. Immunol. Immunopathol. 35,289-300. Ennis, P. D., Jackson, A. P., Parham, P. (1988). Molecular cloning of bovine class I MHC cDNA. J. Immunol. 141,642651. Epstein, J., Eichbaum, Q., Sheriff, S., Ezekowitz, R. A. B. (1996). The collectins in innate immunity. Curr. Opin. Immunol. 8, 29-35.

References

Estes, D. M., Templeton, J. W., Hunter, D. M., Adams, L. G. (1990). Production and use of murine monoclonal antibodies reactive with bovine IgM isotype and IgG subisotypes (IgG1, IgG2a and IgG2b) in assessing immunoglobulin levels of serum of cattle. Vet. Immunol. Immunopathol. 25, 61-72. Estes, D., Hirano, A., Heussler, V., Dobbelaere, D. Brown, W. (1995). Expression and biological activities of bovine interleukin 4: effects of recombinant interleukin 4 on T cell proliferation and B cell differentiation and proliferation in vitro. Cell Immunol. 163,268-279. Eyre, P., Deline, T. R. (1971). Release of dopamine from bovine lung by specific antigen and by compound 48/80. Br. J. Pharmacol. 42, 423-427. Falck, B., Nystedt, T., Rosengren, E., Stenflo, J. (1964). Dopamine and mast cells in ruminants. Acta Pharmacol. Toxicol. 21, 51-58. Filippsen, L. F., Valentin-Weigand, P., Blobel, H., Preisner, K. T., Chhatwal, G. S. (1990). Role of complement S protein (vitronectin) in adherence of Streptococcus dysgalactiae to bovine epithelial cells. Am. J. Vet. Res. 51,861-865. Fitzpatrick, J. L., Cripps, P. J., Hill, A. W., Bland, P. W., Stokes, C. R. (1992). MHC class II expression in the bovine mammary gland. Vet. Immunol. Immunopathol. 32, 13-23. Fong, J. S. C., Muschel, L. H., Good, R. A. (1971a). Kinetics of bovine complement. I. Formation of a lytic intermediate. J. Immunol. 107, 28-40. Fong, J. S. C., Muschel, L. H., Good, R. A. (1971b). Kinetics of bovine complement. II. Properties of the lytic intermediate. J. Immunol. 107, 34-40. Fotsis, T., Murphy, C., Gannon, F. (1990). Nucleotide sequence of the bovine insulin-like growth factor 1 (IGF-1) and its IGF1A precursor. Nucl. Acids Res. 18, 676. Fries, R., Eggen, A., Womack, J. E. (1993). The bovine genome map. Mamm. Genome 4, 405-428. Friis, P., Svehag, S. E., Andersen, O., Gahrn-Hansen, B., Leslie, R. G. (1991). Conglutinin exhibits a complement-dependent enhancement of the respiratory burst of phagocytes stimulated by E. coli. Immunology 74, 680-684. Friis-Christiansen, P., Thiel, S., Svehag, S. E., Dessau, R., Svendsen, P., Andersen, O., Laursen, S. B., Jensenius, J. C. (1990). In vivo and in vitro antibacterial activity of conglutinin, a mammalian plasma lectin. Scand. J. Immunol. 31,453461. Garber, T. L., Hughes, A. L., Watkins, D. I., Templeton, J. W. (1994). Evidence for at least three transcribed BoLA class I loci. Immunogenetics 39, 257-265. Gennaro, R., Simonic, T., Negri, A., Mottola, C., Secchi, C., Ronchi, S., Romeo, D. (1986). C5a fragment of bovine complement. Purification, bioassays, amino-acid sequence and other structural studies. Eur. J. Biochem. 155, 77-86. Gennaro, R., Skerlavaj, B., Romeo, D. (1989). Purification, composition, and activity of two bactenecins, antibacterial peptides of bovine neutrophils. Infect. Immun. 57, 3142-3146. Gerardi, A. S. (1996). Bovine leukocyte adhesion deficiency: a brief overview of a modern disease and its implications. Acta Vet. Hungarica 44, 1-8. Gershwin, L. J., Dygert, B. S. (1983). Development of a semiautomated microassay for bovine immunoglobulin E: definition and standardization. Am. J. Vet. Res. 44, 891-895. Gewurz, H., Zhang, X.-H., Lint, T. F. (1995). Structure and function of the pentraxins. Curr. Opin. Immunol. 7, 54-64. Goddeeris, B. M., Morrison, W. I., Teale, A. J. (1986). Generation of bovine cytotoxic cell lines, specific for cells infected

475

with the protozoan parasite Theileria parva and restricted by products of the major histocompatibility complex. Eur. J. Immunol. 16, 1243-1249. Godson, D., Baca-Estrada, M., Hughes, H., Morsy, J., Van Donkersgoed, R., Harland, R., Shuster, D., Daley, M., Babiuk, L. (1995). Regulation of bovine acute phase responses by administration of interleukin-1. Abstract of Fourth International Veterinary Immunology Symposium, July 1995, Davis, p. 156. Godson, D. L., Baca-Estrada, M. E., Van Kessel, A. G., Hughes, H. P. A., Morsy, M. A., Van Donkersgoed, J., Harland, R. J., Shuster, D. E., Daley, M. J., Babiuk, L. A. (1995). Regulation of bovine acute phase responses by recombinant interleukinlfi. Can. J. Vet. Res. 59, 249-255. Goldman, A. S., Garza, C., Nichols, B. L., Goldblum, R. M. (1982). Immunologic factors in human milk during the first year of lactation. J. Pediatr. 100, 563-567. Goldsby, R. A., Srikumaran, S., Arulanandam, B., Hague, B., Ponce de Leon, F. A., Sevoian, M., Guidry, A. J. (1987). The application of hybridoma technology to the study of bovine immunoglobulins. Vet. Immunol. Immunopathol. 17, 25-35. Gomez, E., Corrado, O. J., Davies, R. J. (1987). Histochemical and functional characteristics of the human nasal mast cell. Int. Arch. Allergy Appl. Immunol. 83, 52-56. Goodger, B. V., Wright, I. G., Mahoney, D. F. (1981). Changes in conglutinin, immunoconglutinin, complement C3 and fibronectin concentrations in cattle acutely infected with Babesia bovis. Aust. J. Exp. Biol. Med. Sci. 59, 531-538. Goto, T., Befus, D., Low, R., Bienenstock, J. (1984). Mast cell heterogeneity and hyperplasia in bleomycin-induced pulmonary fibrosis of rats. Am. Rev. Respir. Dis. 130, 797-802. Goureau, O., Faure, V., Courtois, Y. (1995). Fibroblast growth factors decrease inducible nitric oxide synthase mRNA accumulation in bovine retinal pigmented epithelial cells. Eur. J. Biochem. 230, 1046-1052. Groth, D. M., Wetherall, J. D., Umotong, B. A., Sparrow, P., Lee, I. R., Carrick, M. J. (1987). Purification and characterisation of the fourth component of bovine complement. Complement 4, 1-11. Gu, F., Chowdhary, B. P., Andersson, L., Harbitz, I., Gustavsson, I. (1992). Assignment of the bovine immunoglobulin gamma heavy chain (IGHG) gene to chromosome 21q24 by in situ hybridiziation. Hereditas 117, 237-240. Gwakisa, P., Mikko, S., Andersson, L. (1994). Close genetic linkage between DRBP1 and CYP21 in the MHC of cattle. Mamm. Genome 5,731-734. Hagens, G., Galley, Y., Glaser, I., Davis, W. C., Baldwin, C. L., Clevers, H., Dobbelaere, D. A. E. (1996). Cloning, sequencing and expression of the bovine CD3~ and TCR-~ chains, two invariant components of the T-cell receptor complex. Gene 169, 165-171. Hall, J. G., Morris, B. (1965). The origin of cells in the efferent lymph of a single node. J. Exp. Med. 121,901-910. Halley, C., Courtois, Y., Laurent, M. (1988). Nucleotide sequence of a bovine acidic FGF cDNA. Nucl. Acids Res. 16, 10913. Hanby-Flarida, M. D., Trask, O. J., Yang, T. J., Baldwin, C. L. (1996). Modulation of WC1, a lineage-specific cell surface molecule of 7/8 T cells, augments cellular proliferation. Immunology 88, 116-123. Hansen, T., Leaman, D., Cross, J., Mathialagan, N., Bixby, J., Roberts, R. (1991). The genes for the trophoblast interferons

476

and the related interferon-alpha-II possess distinct 5'-promoter and 3'-flanking sequences. J. Biol. Chem. 266, 3060-3067. Hartshorn, K. L., Sastry, K., Brown, K., White, M. R., Okarma, T. B., Lee, Y.-M., Tauber, A. I. (1993). Conglutinin acts as an opsonin for influenza A viruses. J. Immunol. 151, 6265-6273. Hash, S., Brown, W., Rich-Ficht, A. (1994). Characterization of a cDNA encoding bovine interleukin 10: kinetics of expression in bovine lymphocytes. Gene 139, 257-261. Hassfurther, R., Canning, P., Geib, R. (1994). Isolation and characterization of an interleukin-8-1ike peptide in the bovine species. Vet. Immun. Immunopathol. 42, 117-126. Hebb, C., Kasa, P., Mann, S. (1968). The relation between nerve fibres and dopamine cells of the ruminant lung. Histochem. J. 1,166-175. Hein, W. R., Mackay, C. R. (1991). Prominence of 78 T cells in the ruminant immune system. Immunol. Today 12, 30-34. Heussler, V., Eichhorn, M., Dobbelaere, D. (1992). Cloning of a full-length cDNA encoding bovine interleukin 4 by the polymerase chain reaction. Gene 144, 273-278. Heyermann, H., Butler, J. E. (1987). The heterogeneity of bovine IgG2. IV. Structural differences between IgG2a molecules of the A1 and A2 allotypes. Mol. Immunol. 12, 1327-1334. Hillarp, A., Thern, A., Dahlb/ick, B. (1994). Bovine C4b binding protein. Molecular cloning of the 0~- and fl-chains provides structural background for lack of complex formation with protein S. J. Immunol. 154, 4190-4199. Hines, H. C., Ross, M. J. (1987). Serological relationships among antigens of the BoLA and the bovine M blood group systems. Anim. Genet. 18, 361-369. Hirani, S., Lambris, J. D., Mtiller-Eberhard, H. J. (1985). Localization of the conglutinin binding site on the third component of human complement. J. Immunol. 134, 11051109. Hoang-Xuan, M., Charron, D., Zilber, M.-T., Levy, D. (1982). Biochemical characterization of class II bovine major histocompatibility complex antigens using cross-species reactive antibodies. Immunogenetics 15,621-624. Hofner, M. C., Fosbery, M. W., Eckersall, P. D. (1994). Haptoglobin response to cattle infected with foot-and-mouth disease virus. Res. Vet. Sci. 57, 125-128. Holmskov, U., Malhotra, R., Sim, R. B., Jensenius, J. C. (1994). Collectins: collagenous C-type lectins of the innate immune defence system. Immunol. Today 15, 67-74. Holmskov, U. R., Laursen, S. B., Malhorta, R., Wiedemann, H., Timpl, R., Stuart, G. R., Tornoe, I., Madsen, P. S., Reid, K. B. M., Jensenius, J. C. (1995). Comparative study of the structural and functional properties of the bovine plasma C-type lectin, collectin-43 with other collectins. Biochem. J. 305,889896. Hood, L., Gray, W. R., Sanders, G., Dreyer, W. J. (1967). Light chain evolution. Cold Spring Harbor Symp. Quant. Biol. 32, 133-145. Honberg, L. S., Larsen, B. (1992). Bovine monoclonal alloantibodies to blood group antigens prepared by murine • bovine or (murine • bovine) x bovine interspecies fusions. Anim. Genet. 23,497-508. Honberg, L. S., Larsen, B., Koch, C., Ostergfird, H., Skj~dt, K. (1995). Biochemical identification of the bovine blood group M' antigen as a major histocompatibility complex class I-like molecule. Anim. Genet. 26, 307-313. Honkanen-Buzalski, T., Sandholm, M. (1981). Association of bovine secretory immunoglobulins with milk fat globule


membranes. Comp. Immunol. Microbiol. Infect. Dis. 4, 329342. Horadagoda, A., Eckersall, P. D. (1994). Immediate responses in serum TNF0~ and acute phase protein concentrations to infection with Pasteurella haemolytica A1 in calves. Res. Vet. Sci. 57, 129-132. Howard, C. J. (1980). Variation in the susceptibility of bovine mycoplasmas to killing by the alternative complement pathway in bovine serum. Immunology 41,561-568. Howard, C. J., Sopp, P., Parsons, K. R., Finch, J. (1989). In vivo depletion of BoT4 (CD4) and of non-T4/T8 lymphocyte subsets in cattle with monoclonal antibodies. Eur. J. Immunol. 19, 757-764. Howard, C. J., Morrison, W. I., Bensaid, A., Davis, W., Eskra, L., Gerdes, J., Hadam, M., Hurley, D., Leibold, W., Letesson, J. J. et al. (1991). Summary of workshop findings for leukocyte antigens of cattle. Vet. Immunol. Immunopathol. 27, 2127. Howard, C. J., Naessens, J. (1993). Summary of workshop findings for cattle (tables 1 and 2). Vet. Immunol. Immunopathol. 39, 25-47. Howard, C. J., Sopp, P., Brownlie, J., Parsons, K. R., Kwong, L. S., Collins, R. A. (1996). Afferent lymph veiled cells stimulate proliferative responses in allogeneic CD4+ and CD8 + T cells but not y8 TCR + T cells. Immunology 88, 558-564. Hughes, H. P. A., Campos, M., McDougall, L., Beskorwayne, T. K., Potter, A. A., Babiuk, L. A. (1994). Regulation of major histocompatibility complex class II expression by Pasteurella haemolytica leukotoxin. Infect. Immun. 62, 1609-1615. Husband, A. J., Lascelles, A. K. (1975). Antibody responses to neonatal immunisation in calves. Res. Vet. Sci. 18, 201-207. Husband, A. J., Brandon, M. R., Lascelles, A. K. (1972). Absorption and endogenous production of immunoglobulins in calves. Aust. J. Exp. Biol. Med. Sci. 50, 491-498. Ingram, D. G. (1982). Comparative aspects of conglutinin and immunoconglutinins. In Animal Models of Immunological Processes (ed. Hay, J. B.), pp. 221-249. Academic Press, Toronto, Canada. International Society for Animal Blood Group Research (1985). Notice from the standing committee on cattle blood groups and biochemical polymorphisms. Anim. Blood Groups Biochem. Genet. 16, 249-252. Ishiguro, N., Hein, W. R. (1994). The T cell receptor. In Cellmediated Immunity in Ruminants (eds Goddeeris, B. M., Morrison, W. I.), pp. 59-73. CRC Press, Boca Raton, FL, USA. Ishiguro, N., Tanaka, A., Shinagawa, M. (1990). Sequence analysis of bovine T-cell receptor ~ chain. Immunogenetics 31, 57-60. Ishiguro, N., Aida, Y., Shinagawa, T., Shinagawa, M. (1993). Molecular structures of cattle T-cell receptor gamma and delta chains predominantly expressed on peripheral blood lymphocytes. Immunogenetics 38,437-443. Ito, T., Kodama, M. (1996). Demonstration by reverse transcription-polymerase chain reaction of multiple cytokine mRNA expression in bovine alveolar macrophages and peripheral blood mononuclear cells. Res. Vet. Sci. 60, 94-96. Jackson, T., Morris, B. A., Sanders, P. G. (1992). Nucleotide sequences and expression of cDNAs for a bovine anti-testosterone monoclonal IgG1 antibody. Mol. Immunol. 29, 667676. Jian, Z., Yang, Z., Miller, M., Carter, C., Slauson, D., Bochsler,

References

P. (1995). Interleukin-6 secretion by bacterial lipopolysaccharide-stimulated bovine alveolar macrophages in vitro. Vet. Immunol. Immunopathol. 49, 51-60. Johnson, S. E., Barendse, W., Hetzel, D. J. (1993). The gamma fibrinogen gene (FGG) maps to chromosome 17 in both cattle and sheep. Cytogen. Cell Genet. 62, 176-180. Johnston, N. E., Estrella, R. A., Oxender, W. D. (1977). Resistance of neonatal calves given colostrum diet to oral challenge with a septicaemia-producing Escherichia coli. Am. J. Vet. Res. 38, 1323-1326. Joosten, I., Sanders, M. F., van der Poel, A., Williams, J. L., Hepkema, B. G., Hensen, E. J. (1989). Biochemically defined polymorphism of bovine MHC class II antigens. Immunogenetics 29, 213-216. Joosten, I., Oliver, R. A., Spooner, R. L., Williams, J. L., Hepkema, B. G., Sanders, M. F., Hensen, E. J. (1988). Characterization of class I bovine lymphocyte antigens (BoLA) by one-dimensional isoelectrofocusing. Anim. Genet. 19, 103-113. Joosten, I., Sanders, M. F., Hensen, E. J. (1991). Involvement of major histocompatibility complex class I compatibility between dam and calf in the aetiology of bovine retained placenta. Anim. Genet. 22,455-463. Kabbur, M., Jain, N., Farvev, T. (1995). Modulation of phagocytic and oxidative burst activities of bovine neutrophils by human recombinant TNF-~, IL-I~, IFN-7, G-CSF, GM-CSF. Comp. Haematol. Int. 5, 47-55. Kacskovics, I., Butler, J. E. (1996). The heterogeneity of bovine IgG2-VIII. The complete cDNA sequence of bovine IgG2a (A2) and an IgG1. Mol. Immunol. 33,189-195. Kakizaki, Y., Waga, S., Sugimoto, K., Tanaka, H., Nukii, K., Takeya, M., Yoshimura, T., Yokoyama, M. (1995). Production of monocyte chemoattractant protein-1 by bovine glomeruler endothelial cells. Kidney/nt. 48, 1866-1874. Kanse, T., Takahashi, K., Iam, I., Rees, A., Warren, J., Porta, M., Molinatti, P., Ghatei, M., Bloom, S. (1991). Cytokine stimulated endothelin release from endothelial cells. Life Sci. 48, 1379-1384. Kawasaki, N., Kawasaki, T., Yamashina, I. (1985). Mannanbinding protein and conglutinin in bovine serum. J. Biochem. 98, 1309-1320. Kehoe, J. M., Capra, J. D. (1974). Nature and significance of immunoglobulin subclasses. N Y St. J. Med. 74, 489-491. Kehrli, M., Goff, J., Stevens, M., Boone, T. (1991). Effects of granulocyte colony stimulating factor administration to periparturient cows on neutrophils and bacterial shedding. J. Dairy Sci. 74, 2448-2454. Knight, K. L., Suter, M., Becker, R. S. (1988). Genetic engineering of bovine Ig. Construction and characterization of haptenbinding bovine/murine chimeric IgE, IgA, IgG1, IgG2 and IgG3 molecules. J. Immunol. 140, 3654-3659. Koch, A., Harlow, L., Haines, G., Amento, E., Unemori, E., Wong, W., Pope, R., Ferrara, N. (1994). Vascular endothelial growth factor. A cytokine modulating endothelial function in rheumatoid arthritis. J. Immunol. 152, 4149-4156. Kriegelstein, K., Unsicker, K. (1995). Bovine chromaffin cells release a transforming growth factor-beta-like molecule contained within chromaffin granules. J. Neurochem. 65, 14231426. Kulseth, M. A., Toldo, S. S., Fries, R., Womack, J., Lien, S., Rogne, S. (1994). Chromosomal localization and detection of DNA polymorphisms in the bovine polymeric immunoglobulin receptor gene. Anim. Genet. 25,113-117.

477

Lachmann, P. J. (1967). Conglutinin and immunoconglutinins. Adv. Immunol. 6, 479-527. Lalor, P. A., Morrison, W. I., Goddeeris, B. M., Jack, R. M., Black, S. J. (1986). Monoclonal antibodies identify phenotypically and functionally distinct cell types in the bovine lymphoid system. Vet. Immunol. Immunopathol. 13,121-140. Landverk, T. (1987). The follicle-associated epithelium of the ileal Peyer's patch in ruminants is distinguished by its shedding of 50nm particles. Immunol. Cell Biol. 65,251-261. Larsen, B., Jensen, N. E., Madsen, P., Nielsen, S. M., Klastrup, O., Madsen, P. S. (1985). Association of the M blood group system with bovine mastitis. Anim. Blood Groups Biochem. Genet. 16, 165-173. Lascelles, A. K. (1969). Immunoglobulin secretion into ruminant colostrum. In Lactogenesis (eds Reynolds, M., Folley, S. J.), pp. 131-136. University of Pennsylvania Press, Philadelphia, PA, USA. Lascelles, A. K., Lee, C. S. (1978). Lactaction: A Comprehensive Treatise, pp. 115-177. Academic Press, New York, USA. Lascelles, A. K., Beh, K. J., Mukkur, T. K., Watson, D. L. (1986). The mucosal immune system with particular reference to ruminant animals. In The Ruminant Immune System in Health and Disease (ed Morrison, W. I.), pp. 429-457. University Press, Cambridge, UK. Laursen, S. B., Thiel, S., Teisner, B., Holmskov, U., Wang, Y., Sire, R. B., Jensenius, J. C. (1994). Bovine conglutinin binds to an oligosaccharide determinant presented by iC3b, but not by C3, C3b or C3c. Immunology 81,648-654. Law, S. K. A., Reid, K. B. M. (1988). Complement, IRL Press Ltd., Oxford, UK. Lederer, J., Czuprynski, C. (1995). Interleukin-1. In Cytokines in Animal Health and Disease (eds Myers, M., Murtaugh, M.), pp. 59-88. Marcel Dekkers, Inc., New York, USA. Lee, Y.-M., Leiby, K. R., Aller, J., Paris, K., Lerch, B., Okarma, T. B. (1991). Primary structure of bovine conglutinin, a member of the C-type animal lectin family. J. Biol. Chem. 266, 2715-2723. Leong, S., Flaggs, G., Lawman, M., Gray, P. (1988a). The nucleotide sequence for the cDNA of bovine interleukin-1 alpha. Nucl. Acids Res. 16, 9053. Leong, S., Flaggs, G., Lawman, M., Gray, P. (1988b). The nucleotide sequence for the cDNA of bovine interleukin-1 beta. Nucl. Acids Res. 16, 9054. Letesson, J. J., Lostrie-Trussart, N., Depelchin, A. (1985). Production d'anticorps monoclonaux specifiques d'isotypes d'immunoglobulines bovines. Ann. MSd. VSt. 129, 131-137. Leung, D., Capon, D., Goeddel, D. (1984). The structure and bacterial expression of three distinct bovine interferon-beta genes. Biotechnology 2, 458-464. Leung, D., Cachianes, G., Kuang, W., Goeddel, D., Ferrara, N. (1989). Vascular endothelial growth factor is a secreted angiogenic mitogen. Science 246, 1306-1309. Lewin, H. A. (1996). Genetic organization, polymorphism and function of the bovine major histocompatibility complex. In The Major Histocompatibility Complex of Domestic Animal Species (eds Schook, L. B., Lamont, S. J.), pp. 65-98. CRC Press, Inc., Boca Raton, FL, USA. Lewin, H. A., Bernoco, D. (1986). Evidence for BoLA-linked resistance and susceptibility to subclinical progression of bovine leukaemia virus infection. Anim. Genet. 17, 187-207. Lewin, H. A., Calvert, C. C., Bernoco, D. (1985a). Cross reactivity of a monoclonal antibody (H4) with bovine, equine,

478

ovine and porcine peripheral blood B lymphocytes. Am. J. Vet. Res. 46, 785-788. Lewin, H. A., Davis, W. C., Bernoco, D. (1985b). Monoclonal antibodies that distinguish bovine T and B lymphocytes. Vet. Immunol. Immunopathol. 9, 87-102. Lewin, H. A., Wu, M. C., Stewart, J. A., Nolan, T. J. (1988). Association between BoLA and subclinical bovine leukemia virus infection in a herd of Holstein-Friesian cows. Immunogenetics 27, 338-344. Lewin, H. A., Arnet, E. F., Lie, O., Bernoco, D., Davies, C. J., Nilsson, P. R., Ruff, G., Lazary, S. (1991). First international comparison test of serological reagents for typing class II products of the bovine major histocompatibility complex. XXII International Conference on Animal Genetics. Anim. Genet. 22 (Suppl. 1), 46-47. Lewin, H. A., Spevak, E. M., Paige, K. N. (1993). Genetic management of herd health and productivity: molecular strategies. In Proc. North American Public Bison Herds Symposium (ed Walker, R. E.), pp. 38-52. L'Haridon, R. M., Bourget, P., Lefevre, F., La Bonnardiere, C. (1991). Production of a hybridoma library to recombinant porcine alpha I interferon: a very sensitive assay (ISBBA) allows the detection of a large number of clones. Hybridoma 10, 35-47. Li, Q., Congote, L. (1995). Bovine fetal-liver stromal cells support erythroid colony formation: enhancement by insulin-like growth factor II. Exp. Hematol. 23, 66-73. Li, Y., Feng, J., Templeton, J. (1996). Bos taurus interleukin-8 receptor mRNA, complete cds. GenBANK accession U19947, unpublished. Li, Y., Milner, P., Chauhan, A., Watson, M., Hoffman, R., Kodner, C., Milbrandt, J., Deuel, T. (1990). Cloning and expression of a developmentally regulated protein that induces mitogenic and neurite outgrowth activity. J. Sci. 250, 1690-1694. Liebler, E. M., Pohlenz, J. F., Woode, G. N. (1988a). Gutassociated lymphoid tissue in the large intestine of calves. I. Distribution and histology. Vet. Pathol. 25,503-508. Liebler, E. M., Pohlenz, J. F., Cheville, N. F. (1988b). Gutassociated lymphoid tissue in the large intestine of calves. II. Electron microscopy. Vet. Pathol. 25,509-515. Lim, B. L., Lu, J., Reid, K. B. M. (1993). Structural similarity between bovine conglutinin and bovine lung surfactant protein D and demonstration of liver as a site of synthesis of conglutinin. Immunology 78, 159-165. Lindberg, P.-G., Andersson, L. (1988). Close association between DNA polymorphism of bovine major histocompatibility complex class I genes and serological BoLA-A~specificities. Anim. Genet. 19, 245-255. Linscott, W. D., Triglia, R. P. (1980). Methods for assaying nine bovine complement components and C3b-inactivator. Mol. Immunol. 17,729-740. Logan, E. F., Stenhouse, A., Ormrod, D. J., Penhale, W. J. (1974). The role of colostral immunoglobulins in intestinal immunity to enteric colibacillosis in the calf. Res. Vet. Sci. 17, 280-301. Lovejoy, B., Cascio, D., Eisenberg, D. (1993). Crystal structure of canine and bovine granulocyte-colony stimulating factor (GCSF). J. Mol. Biol. 234, 640-653. Loveless, R. W., Feizi, T., Childs, R. A., Mizuichi, T., Stoll, M. S., Oldroyd, R. G., Lachmann, P. J. (1989). Bovine serum conglutinin is a lectin which binds non-reducing terminal Nacetylglucosamine, mannose and fructose residues. Biochem. J. 258, 109-113.


Lu, J., Laursen, S. B., Thiel, S., Jensenius, J. C., Reid, K. B. M. (1993). The cDNA cloning of conglutinin and identification of liver as a primary site of synthesis of conglutinin in members of the Bovidae. Biochem. J. 292, 157-162. Lund~n, A., Sigurdard6ttir, S., Edfors-Lilja, I., Danell, B., Rendel, J., Andersson, L. (1990). The relationship between bovine major histocompatibility complex class II polymorphism and disease studied by use of bull breeding values. Anita. Genet. 21,221-232. Lutje, V., Mertens, B., Boulang~, A., Williams, D., Authi~, (1995). Trypanosoma congolense: proliferative responses and interleukin production in lymph node cells of infected cattle. Expt. Parasitol. 81,154-164. Ma, R. Z., Beever, J. E., Da, Y., Green, C. A., Russ, I., Park, C., Heyen, D. W., Everts, R. E., Overton, K. M., Fisher, S. R., Teale, A. J., Kemp, S. J., Hines, H. C., Gu~rin, G., Lewin, H. A. (1996). A male linkage map of the cattle (Bos taurus) genome. J. Hered. 87, 261-271. Mach, J. P., Pahud, J. J. (1971). Secretory IgA, a major immunoglobulin in most bovine external secretions. J. Immunol. 106, 552-563. Machugh, D. E., Loftus, R. T., Bradley, D. G., Sharp, P. M., Cunningham, P. (1994). Microsatellite DNA variation within and among European cattle breeds. Proc. R. Soc. Lond. B 256, 25-31. Mackay, C. R., Hein, W. R. (1989). A large proportion of bovine T cells express the 78 T cell receptor and show a distinct tissue distribution and surface phenotype. Int. Immunol. 1,540-545. Mackay, C. R., Marston, W. L., Dudler, L. (1990). Naive and memory T cells show distinct pathways of lymphocyte recirculation. J. Exp. Med. 171,801-817. Maier, R., Schmid, P., Cox, D. (1991). Localization of transforming growth factor-beta 1, -beta 2 and -beta 3 gene expression in bovine mammary gland. Mol. Cell Endocrinol. 82, 191198. Malik, N., Haugen, H., Modrell, B., Shoyab, M., Clegg, C. (1995). Developmental abnormalities in mice transgenic for bovine oncostatin M. J. Mol. Cell Biol. 15, 2349-2358. Maliszewski, C., Baker, P., Schoenborn, M., Davis, B., Cosman, D., Gillis, S., Cerretti, D. (1988). Cloning, sequence and expression of bovine interleukin l-alpha and interleukin 1beta complementary DNAs. J. Mol. Immunol. 25,429-437. Maliszewski, C., Schoenborn, M., Cerretti, D., Wignall, J., Picha, K., Cosman, D., Tushinski, R., Gillis, S., Baker, P. (1988). Bovine GM-CSF: molecular cloning and biological activity of the recombinant protein. Mol. Immunol. 25, 843850. Mallard, B. A., Leslie, K. E., Dekkers, J. C. M., Hedge, R., Bauman, M., Stear, M. J. (1995). Differences in bovine lymphocyte antigen associations between immune responsiveness and risk of disease following intramammary infection with Staphylococcus aureus. J. Dairy Sci. 78, 1937-1944. Mandriota, S., Menoud, P., Pepper, M. (1996). Transforming growth factor beta 1 downregulates VEGF-receptor 2/FLK-1 expression in vascular endothelial cells. J. Biol. Chem. 271, 11500-11505. Manning, L. S., Parmely, M. J. (1980). Cellular determinants of mammary cell-mediated immunity in the rat. I. The migration of radioisotopically labelled T lymphocytes. J. Immunol. 125, 2508-2514. Mayans, M. O., Coadwell, W. J., Beale, D., Symons, D. B. A., Perkins, S. (1995). Demonstration by pulsed neutron scattering that the arrangement of the Fab and Fc fragments in the

References

overall structures of bovine IgG1 and IgG2 in solution is similar. Biochem. J. 311,283-291. McCarthy, S., Bicknell, R. (1993). Inhibition of vascular endothelial cell growth by activin-A. J. Biol. Chem. 269, 23066-23071. McGuire, T. C., Crawford, T. B. (1972). Identification and quantitation of equine serum and secretory immunoglobulin A. J. Am. Soc. Microbiol. 6, 610-615. McKeever, D. J. (1994). Induction of T Cell immunity in ruminants. In Cell-mediated Immunity in Ruminants (eds Goddeeris, B. M., Morrison, W. I.), pp. 93-108. CRC Press, Boca Raton, FL, USA. McKeever, D. J., MacHugh, N. D., Goddeeris, B. M., Awino, E., Morrison, W. I. (1991). Bovine afferent lymph veiled cells differ from blood monocytes in phenotype and are superior in accessory function. J. Immunol. 147, 3703-3709. McKeever, D. J., Awino, E., Morrison, W. I. (1992). Afferent lymph veiled cells prime CD4 § T cell responses in vivo. Eur. J. Immunol. 22, 3057-3061. McKeever, D., Nyanjui, J., Ballingall, K. (1997). In vitro infection with Theileria parva is associated with ILl0 expression in all bovine lymphocyte lineages. Parasit. Immunol. 19, 319-324. Meier, R., Becker-Andre, M., Goetz, R., Heumann, R., Shaw, A., Thoenen, H. (1986). Molecular cloning of bovine and chick nerve growth factor (NGF): delineation of conserved and unconserved domains and their relationship to the biological activity and antigenicity of NGF. EMBO J. 5, 1489-1493. Mejdell, C. M., Lie, O., Solbu, H., Arnet, E. F., Spooner, R. L. (1994). Association of major histocompatibility complex antigens (BoLA-A) with AI bull progeny test results for mastitis, ketosis and fertility in Norwegian Cattle. Anim. Genet. 25, 99-104. Menger, M. (1996). Characterization of the bovine alternative complement pathway C3-convertase. PhD thesis, Queen's University, Kingston, Ontario, Canada. Menger, M., Aston, W. P. (1984). Factor D of the alternative pathway of bovine complement: isolation and characterization. Vet. Immunol. Immunopathol. 7, 325-336. Menger, M., Aston, W. P. (1985). Isolation and characterization of the third component of bovine complement. Vet./mmunol. Immunopathol. 10, 317-331. Mertens, B., Muriuki, C., Gaidulis, L. (1995). Cloning of two members of the TNF-superfamily in cattle: CD40 ligand and tumor necrosis factor alpha. Immunogenetics 42, 430-431. Mertens, B., Gorbright, E., Seow, H. (1996). Nucleotide sequence of the bovine interleukin-5 encoding cDNA. Gene 176, 273274. Mertens, B., Muriuki, C., Muiya, P., Andrianarivo, A., Mwangi, S., Logan-Henfrey, L. (1997). Bovine stem cell factor: production of a biologically active protein and mRNA analysis in cattle infected with Trypanosoma congolense. Vet. Immunol. Immunopathol. 59, 65-78. MStSnier, L., Nocart, M., Alaux, M. T. (1991). Mouse monoclonal antibodies to bovine blood groups antigens: additional results. Anim. Genet. 22, 155-163. Mhatre, A., Aston, W. P. (1987a). Isolation of bovine complement factor H. Vet. Immunol. Immunopathol. 14, 357-375. Mhatre, A., Aston, W. P. (1987b). A simple hemolytic assay for bovine complement component C3. Vet. Immunol. Immunopathol. 15,239-251. Mimuro, J., Loskutoff, D. J. (1989). Purification of a protein from bovine plasma that binds to type-1 plasminogen-activator inhibitor and prevents its interaction with extracellular

479

matrix. Evidence that the protein is vitronectin. J. Biol. Chem. 264, 936-939. Modat, G., Dornand, J., Junquero, D., Mary, A., Muller, A., Bonne, C. (1990). LPS-stimulated bovine aortic endothelial cells produce IL-1 and IL-6 like activities. Agents Actions 30, 403-411. Momotani, E., Whipple, D. L., Thiermann, B., Cheville, N. F. (1988). Role of M cells and macrophages in the entrance of Mycobacterium paratuberculosis into domes of ileal Peyer's patches in calves. Vet. Pathol. 25,131-137. Moody, D., Pomp, P., Barendse, W. (1996). Linkage mapping of the bovine insulin-like growth factor-1 receptor gene. Mamm. Genome 7, 168-169. Morrison, W. I., Lalor, P. A., Christensen, A. K., Webster, P. (1986). Cellular constituents and structural organisation of the bovine thymus and lymph node. In The Ruminant Immune System in Health and Disease (ed. Morrison, W. I.), pp. 220-251. Cambridge University Press, Cambridge, UK. Morrison, W. I., Baldwin, C. L., MacHugh, N. D., Teale, A. J., Goddeeris, B. M., Ellis, J. (1988). Phenotypic and functional characterisation of bovine lymphocytes. In Progress in Veterinary Microbiology and Immunology (ed. Padney, R.), pp. 134-164. S. Karger, Basel, Switzerland. Morsey, M., Cox, G., Van Kessel, A., Campos, M., Babiuk, L. (1995). Interleukin-2. In Cytokines in Animal Health and Disease (eds Myers, M., Murtaugh, M.), pp. 89-119. Marcel Dekker, Inc., New York, USA. Muggli-Cockett, N. E., Stone, R. T. (1988). Identification of genetic variation in the bovine major histocompatibility complex DR-like genes using sequenced bovine genomic probes. Anim. Genet. 19, 213-225. M~iller, R., Boothby, J. T., Carroll, E. J., Panico, L. (1983). Changes of complement values in calves during the first month of life. Am. J. Vet. Res. 44, 747-750. Mwangi, S., Logan-Henfrey, L., Mclnnes, C., Mertens, B. (1995). Cloning of the bovine interleukin-3-encoding cDNA. Gene 162, 309-312. Myers, M., Murtaugh, M. (1995). Biology of tumor necrosis factor. In Cytokines in Animal Health and Disease (eds Myers, M., Murtaugh, M.), pp. 121-151. Marcel Dekker, Inc., New York, USA. Naessens, J. (1997). Surface immunoglobulins on B lymphocytes from cattle and sheep. Int. Immunol. 9, 349-354. Naessens, J., Hopkins, J. (1996). Summary of third ruminant leukocyte workshop findings. Vet. Immunol. Immunopathol. 52, 213-235. Naessens, J., Williams, D. J. L. (1992). Characterization and measurement of CD5 + B cells in normal and Trypanosoma congolense-infected cattle. Eur. J. Immunol. 22, 1713-1718. Naessens, J., Newson, J., Williams, D. J. L., Lutje, V. (1988). Identification of isotypes and allotypes of bovine immunoglobulin M with monoclonal antibodies. Immunology 63, 569574. Naessens, J., Newson, J., McHugh, N., Howard, C. J., Parsons, K., Jones, B. (1990). Characterization of a bovine leucocyte differentiation antigen of 145,000 MW restricted to B lymphocytes. Immunology 69, 525-530. Naessens, J., Sileghem, M., MacHugh, N., Park, Y., Davis, W., Toye, P. (1992). Selection of BoCD25 monoclonal antibodies by screening mouse L-cells transfected with bovine p55interleukin-2 (IL-2) receptor gene. Immunology 76, 305-309. Nagahata, H., Nochi, H., Sanada, Y., Tamoto, K., Noda, H., Kociba, G. J. (1994). Analysis of mononuclear cell functions

480

in Holstein cattle with leukocyte adhesion deficiency. Am. J. Vet. Res. 55, 1101-1106. Nagahata, H., Higuchi, H., Noda, H., Tamoto, K., Kuwabara, M. (1996). Adhesiveness for extracellular matrixes and lysosomal enzyme release from normal and beta(2) integrin deficient bovine neutrophils. Microbiol. Immunol. 40, 783786. Nakajima, Y., Momotani, E., Murakami, T., Ishikawa, Y., Morimatsu, M., Saito, M., Suzuki, H., Yasukawa, K. (1993). Induction of acute phase protein by recombinant human interleukin-6 (IL-6) in calves. Vet. Immunol. Immunopathol. 35,385-391. Nielsen, K. H. (1977). Bovine reaginic antibody. Ill. Crossreaction of human IgE and anti-bovine reaginic immunoglobulin antisera with sera from several species of mammals. Can. J. Comp. Med. 41,245-348. Nielsen, K., Sheppard, J., Holmes, W., Tizard, I. (1978). Experimental bovine trypanosomiasis. Changes in serum immunoglobulins, complement and complement components in infected animals. Immunology 35,817-826. Nilsson, P. H., van der Poel, J. J., van bet Klooster, J. W., Davies, C. J., Joosten, I., Williams, J. L., Arriens, M. A. (1991). Comparison of BoLA class II serotyping and 1D-IEF in a Dutch herd of Holstein-Friesians. Anim. Genet. 22, 47-48. Oddgiersson, O., Simpson, S. P., Morgan, A. L. G., Ross, D. S., Spooner, R. L. (1988). Relationship between the bovine major histocompatibility complex (BoLA), erythrocyte markers and susceptibility to mastitis in Icelandic cattle. Anim. Genet. 19, 11-16. Ogunremi, O., Tabel, H. (1993a). A non-hemolytic assay for the activation of the alternative pathway of bovine complement. Vet. Immunol. Immunopathol. 38, 155-167. Ogunremi, O., Tabel, H. (1993b). Differences in the activity of the alternative pathway of complement in BALB/c and C57B1/ 6 mice. Exp. Clin. Immunogenet. 10, 31-37. Ohmann, H. B., Davis, W. C., Babiuk, L. A. (1986). Surface antigen expression by bovine alveolar macrophages: functional correlation and influence of interferons in vivo and in vitro. Immunobiology 171,125-142. Okragly, A. J., Hanby-Flarida, M., Mann, D., Baldwin, C. L. (1996). Bovine 7/8 T-cell proliferation is associated with selfderived molecules constitutively expressed in vivo on mononuclear phagocytes. Immunology 87, 71-79. Oliver, R. A., Brown, P., Spooner, R. L., Joosten, I., Williams, J. L. (1989). The analysis of antigen and DNA polymorphism within the bovine major histocompatibility complex: 1. The class I antigens. Anim. Genet. 20, 31-41. Olsen, S., Stevens, M. (1993). Effect of recombinant human cytokines on mitogen-induced bovine peripheral blood mononuclear cell proliferation. Cytokine 5,498-505. Pahud, J. J., Mach, J. P. (1970). Identification of secretory IgA, free secretory piece and serum IgA in the ovine and caprine species. Immunochemistry 7, 679-686. Palmer, C., Thurmond, M., Picanso, J., Brewer, A. W., Bernoco, D. (1987). Susceptibility of cattle to bovine leukemia virus infection associated with BoLA type. Proc. of 91st Ann. Meeting of U.S. Anim. Health Assoc., pp. 218-228. Pang, A. S. D., Aston, W. P. (1978). The alternative complement pathway in bovine serum: the isolation of a serum protein with factor B activity. Immunochemistry 15,529-534. Park, C. A., Hines, H. C., Monke, D. R., Threlfall, W. T. (1993). Association between the bovine major histocompatibility complex and chronic posterior spinal paresis- a form of


ankylosing spondylitis- in Holstein bulls. Anim. Genet. 24, 53-58. Park, C., Russ, I., Da, Y., Lewin, H. A. (1995). Genetic mapping of F13SA to BTA23 by sperm typing: difference in recombination rate between bulls in the D YA-PRL interval. Genomics 27, 113-118. Parng, C. L., Hansal, S., Goldsby, R. A., Osborne, B. A. (1995). Diversification of bovine 2-light chain genes. Ann. N Y Acad. Sci. 764, 155-157. Parsons, K. R., Howard, C. J., Jones, B. V., Sopp, P. (1989). Investigation of bovine gut associated lymphoid tissue (GALT) using monoclonal antibodies against bovine lymphocytes. Vet. Pathol. 26, 396-408. Parsons, K. R., Bland, A. P., Hall, G. A. (1991). Follicle associated epithelium of the gut associated lymphoid tissue of cattle. Vet. Pathol. 28, 22-29. Pauli, U., Bertoni, G., Duerr, M., Peterhans, E. (1994). A bioassay . for the detection of tumor necrosis factor from eight different species: evaluation of neutralization rates of a monoclonal antibody against human TNF-~. J. Immunol. Methods 171, 263-265. Perret, J. J., Raspe, E., Vassart, G., Parmentier, M. (1992). Cloning and functional expression of the canine anaphylatoxin C5a receptor. Evidence for high interspecies variability. Biochem. J. 288,911-917. Porter, P. (1969). Transfer of immunoglobulins IgG, IgA and IgM to lacteal secretions in the parturient sow and their absorption by the neonatal piglet. Biochim. Biophys. Acta 181,381-392. Randall, L. Wadhwa, M., Thorpe, R., Mire-Sluis, A. (1993). A novel sensitive bioassay for transforming growth factor beta. J. Immunol. Methods 164, 61-67. Reddy, D., Chitko-McKown, C., Reddy, P., Minocha, H., Blecha, F. (1993). Isolation and characterization of monoclohal antibodies to recombinant bovine interleukin-1 beta. Vet. Immunol. Immunopathol. 36, 17-29. Reddy, P., McVey, D., Chengappa, M., Blecha, F., Minocha, H., Baker, P. (1990). Bovine recombinant granulocyte-macrophage colony-stimulating factor enhancement of bovine neutrophil functions in vitro. Am. J. Vet. Res. 51, 1395-1399. Reeves, R., Spies, A., Nissen, M., Buck, C., Weinberg, A., Barr, P., Magnuson, N., Magnuson, J. (1986). Molecular cloning of a functional bovine interleukin 2 cDNA. Proc. Natl Acad. Sci. USA 83, 3228-3232. Reeves, R., Elton, T., Nissen, M., Lehn, D., Johnson, K. (1987). Posttranscriptional gene regulation and specific binding of the non histone protein HMG-1 by the 3' untranslated region of bovine interleukin 2 cDNA. Proc. Natl Acad. Sci. USA 84, 6531-6535. Reid, K. B. M., Turner, M. W. (1994). Mammalian lectins in activation and clearance mechanisms involving the complement system. Springer Semin. Immunopathol. 15,307-325. Rendel, J. (1957). Further studies on some antigenic characters of sheep blood determined by epistatic action of genes. Acta Agric. Scand. 224-259. Renshaw, H. W., Everson, D. O. (1979). Classical and alternate complement pathway activities in paired dairy cow-newborn calf sera. Comp. Immunol. Microbiol. Infect. Dis. 1,259-267. Renshaw, H. W., Eckblad, W. P., Tassinari, P. D., Everson, D. O. (1978). Levels of total haemolytic complement activity in paired cow-newborn calf sera. Immunology 34, 801-805. Reynolds, H. Y., Johnson, J. S. (1970). Quantitation of canine immunoglobulins. J. Immunol. 105,698-703. Reynolds, J. D., Morris, B. D. (1983). The evolution and

References

involution of Peyer's patches in fetal and postnatal sheep. Eur. J. Immunol. 13,627-635. Rice, C. E., Boulanger, P. (1952). The interchangeability of the complement components of different animal species. IV. In the haemolysis of rabbit erythrocytes sensitized with sheep antibody. J. Immunol. 68, 197-205. Rice, C. E., Crowson, C. N. (1950). The interchangeability of the complement components of different animal species. II. In the hemolysis of sheep erythrocytes sensitized with rabbit amboceptor. J. Immunol. 65,201-210. Rice, C. E., Fuhamel, L. (1957). A comparison of the complement, conglutinin, and natural anti-sheep red cell antibody titers of the serum of newborn and older calves. Can. J. Comp. Med. 21,109-116. Riley, J. F., West, G. B. (1953). The presence of histamine in tissue mast cells. J. Physiol. 120, 528-537. Richards, C., Scamurra, R., Murtaugh, M. (1995). Interleukin-6. In Cytokines in Animal Health and Disease (eds Myers, M., Murtaugh, M.), pp. 153-182. Marcel Dekker, Inc., New York, USA. Robey, P., Young, M., Flanders, K., Roche, N., Kondaiah, P., Reddi, A., Termine, J., Sporn, M., Roberts, A. (1987). Osteoblasts synthesize and respond to transforming growth factor-type beta (TGF-beta) in vitro. J. Cell Biol. 105, 457463. Rogivue, C., Car, B., Allmann-Iselin, R., Zwahlen, R., Walz, A. (1995). Bovine melanoma growth stimulatory activity: a new monocyte-macrophage-derived cytokine of the IL-8 family. Partial structure, function and expression in acute pulmonary inflammation. Lab. Invest. 72, 689-695. Romeo, D., Skerlavaj, B., Bolognesi, M., Gennaro, R. (1988). Structure and bactericidal activity of an antbiotic dodecapeptide purified from bovine neutrophils. J. Biol. Chem. 263, 9573-9575. Roth, J. A. (1994). Neutrophils and killer cells. In Cell-mediated Immunity in Ruminants (eds Goddeeris, B. M., Morrison, W. I.), pp. 127-142. CRC Press, Boca Raton, FL, USA. Rouse, B. T., Ingram, D. G. (1970). The total protein and immunoglobulin profile of equine colostrum and milk. Immunology 19, 901-907. Ruitenberg, E. J., Gustowska, L., Elgersma, A., Ruitenberg, H. M. (1982). Effect of fixation on the light microscopical visualization of mast cells in the mucosa and connective tissue of the human duodenum. Int. Arch. Allergy Appl. Immunol. 67, 233-238. Rutten, V. P. M. G., Hoek, A., Muller, K. E. (1996). Identification of monoclonal antibodies with specificity to alpha or beta chains of beta(2) integrins using peripheral blood leucocytes of normal and bovine leucocyte adhesion deficient (BLAD) cattle. Vet. Immunol. Immunopathol. 52, 341-345. Sadavongvivad, C. (1970). Pharmacological significance of biogenic amines in the lungs: 5-hydroxytryptamine. Br. J. Pharmac. 38,353-365. Saif, L. J., Redman, D. R., Smith, K. L., Theil, K. W. (1983). Passive immunity to bovine rotavirus in newborn calves fed colostrum supplement from immunized or non-immunized cows. Infect. Immun. 41, 1118-1131. Saini, S. S., Hein, W. R., Kaushik, A. (1997). A single predominantly expressed polymorphic Vh gene family, related to mammalian group I, class II, is identified in cattle. Mol. Immunol. 34, 641-651. Sakakibara, Y., Suiko, M., Fernando, P. H., Ohashi, T., Liu, M. C. (1994). Identification and characterization of a major

481

bovine serum tyrosine-O-sulfate-binding protein as a complement factor H. Cytotechnology 14, 97-107. Sarikaputi, M., Morimatsu, M., Yamamoto, S., Syuto, B., Saito, M., Naiki, M. (1992). Latex agglutination test: a simple, rapid and practical method of bovine serum CRP determination. Jap. J. Vet. Res. 40, 1-12. Sasaki, T., Yonemasu, K. (1984). Comparative studies on biological activities of subcomponents Clq of the first component of human, bovine, mouse and guinea-pig complement. Biochirn. Biophys. Acta 785, 118-122. Schlossman, S. F., Boumsell, L., Gilks, W. et al. (eds) (1995). Leukocyte Typing V. Oxford University Press, Oxford, UK. Schmidt, A., Eispanier, R., Amselgruber, W., Sinowatz, F., Schams, D. (1994). Expression of insulin-like growth factor 1 (IGF-1) in the bovine oviduct during the oestrous cycle. Exp. Clin. Endrocrinol. 102, 364-369. Schmutz, S., Moker, J., Gallagher, D., Kappes, S., Womack, J. (1996). In situ hybridization mapping of LDHA and IGF2 to cattle chromosome 29. Mamm. Genome 7, 473. Scicchitano, R., Husband, A. J., Cripps, A. W. (1984). Immunoglobulin-containing cells and the origin of immunoglobulins in the respiratory tract of sheep. Immunology 52, 529-537. Scicchitano, R., Sheldrake, R. F., Husband, A. J. (1986). Origin of immunoglobulins in respiratory tract secretion and saliva of sheep. Immunology 58,315-321. Selsted, M. E., Novotny, M. J., Morris, W. L., Tang, Y. Q., Smith, W., Cullor, J. S. (1992). Indolicidin, a novel bactericidal tridecapeptide amide from neutrophils. J. Biol. Chem. 267, 4292-4295. Selsted, M. E., Tang, Y., Morris, W. L., McGuire, P. A., Novotny, M. J., Smith, W., Henschen, A. H., Cullor, J. S. (1993). Purification, primary structures, and antibacterial activities of fi-defensins, a new family of antimicrobial peptides from bovine neutrophils. J. Biol. Chem. 268, 6641-6648. Sethi, M., Tabel, H. (1990a). Activation of bovine monocytes and neutrophils by the Bb fragment of complement factor B: demonstration by the uptake of 3H-deoxyglucose. Can. J. Vet. Res. 54, 106-112. Sethi, M., Tabel, H. (1990b). Fragment Bb of bovine complement factor B: stimulatory effect on the microbicidal activity of bovine monocytes. Can. J. Vet. Res. 54, 405-409. Sethi, M., Tabel, H. (1990c). Bb fragment of bovine complement factor B: stimulation of the oxidative burst in bovine monocytes. Can. J. Vet. Res. 54, 410-414. Shalhevet, D., Da, Y., Beever, J. E., van Eijk, M. J. T., Ma, R., Lewin, H. A., Gaskins, H. R. (1995). Genetic mapping of the LMP2 proteasome subunit gene to the BoLA class lib region. Immunogenetics 41, 44-46. Shanahan, F., Macniven, I., Dyck, N., Denburg, J. A., Bienenstock, J., Befus, A. D. (1987). Human lung mast cells: distribution and abundance of histochemically distinct subpopulations. Int. Arch. Allergy Appl. Immunol. 83,329-331. Shaw, M. K., Tilney, L. G., Musoke, A. J., Teale, A. J. (1995). MHC class I molecules are an essential cell surface component involved in Theileria parva sporozoite binding to bovine lymphocytes. J. Cell Sci. 108, 1587-1596. Sheldrake, R. F., Husband, A. J. (1985). Intestinal uptake of intact maternal lymphocytes by neonatal rats and lambs. Res. Vet. Sci. 39, 10-15. Sheldrake, R. F., Husband, A. J., Watson, D. L., Cripps, A. W. (1984). Selective transport of serum-derived IgA into mucosal secretions. J. Immunol. 132, 363-368. Shuster, D. E., Kehrli, M. E. Jr, Ackerman, M. R., Gilbert, R. O.

482

(1992). Identification and prevalence of a genetic defect that causes leukocyte adhesion deficiency in Holstein cattle. Proc. Natl Acad. Sci. USA 89, 9225-9229. Sigurdard6ttir, S., Borsch, C., Gustafsson, K., Andersson, L. (1991). Cloning and sequence analysis of 14 DRB alleles of the bovine major histocompatibility complex by using the polymerase chain reaction. Anim. Genet. 22, 199-209. Sileghem, M., Saya, R., Ellis, J., Flynn, J., Peel, J., Williams, D. (1992). Detection and neutralization of bovine tumor necrosis factor by a monoclonal antibody. Hybridoma 11,617-627. Simpson-Morgan, M. W., Smeaton, T. C. (1972). The transfer of antibodies by neonates and adults. Adv. Vet. Sci. Comp. Med. 16, 344-386. Sinclair, M. C., Aitken, R. (1995). PCR strategies for isolation of the 5' end of an immunoglobulin-encoding bovine cDNA. Gene 167, 285-289. Sinclair, M. C., Gilchrist, J., Aitken, R. (1995). Molecular characterization of bovine V lambda regions. J. Immunol. 155, 3068-3078. Smith, M. A., Gerrie, L. M., Dunbar, B., Fothergill, J. E. (1982). Primary structure of bovine complement activation fragment C4a, the third anaphylatoxin. Purification and complete amino acid sequence. Biochem. J. 207, 253-260. Soames, C. J., Day, A. J., Sim, R. B. (1996). Predictions from sequence comparisons of residues of factor H in the interaction with complement component C3b. Biochem. J. 315 (Part 2), 523-531. Solbu, H., Lie, O. (1990). Selection for disease resistance in dairy cattle. Proceedings of the Fourth World Congress on Genetics Applied to Livestock Production, 16, 445-448. Solbu, H., Spooner, R. L., Lie, O. (1982). A possible influence of the bovine major histocompatibility complex (BoLA) on mastitis. Proceedings of the Second World Congress on Genetics Applied to Livestock Production, 7, 368-371. Solinas-Toldo, S., Lengauer, C., Fries, R. (1995). Comparative genome map of human and cattle. Genomics 27,489-496. Sopp, P., Howard, C. J. (1997). Cross reactivity of monoclonal antibodies to defined human leukocyte differentiation antigens with bovine cells. Vet. Immunol. Immunopathol. 56, 1125. Splitter, G., Morrison, W. I. (1991). Individual antigens of cattle. Antigens expressed predominantly on monocytes and granulocytes: identification of bovine CD11b and CD11c. Vet. Immunol. Immunopathol. 27, 87-90. Spooner, R. L., Maddy, A. H. (1971). The isolation of ox red cell membrane antigens: antigens associated with sialoprotein. Immunology 21,809-816. Spooner, R. L., Morgan, A. L. G. (1981). Analysis of BoLA w6. Evidence for multiple subgroups. Tissue Antigens 17, 178188. Spooner, R. L., Oliver, R. A., Sales, D. I., McCoubrey, C. M., Millar, P., Morgan, A. G., Amorena, B., Bailey, E., Bernoco, D., Brandon, M., Bull, R. W., Caldwell, J., Cwik, S., van Dam, R. H., Dodd, J., Gahne, B., Grosclaude, F., Hall, J. G., Hines, H., Leveziel, H., Newman, M. J., Stear, M. J., Stone, W. H., Vaiman, M. (1979). Analysis of alloantisera against bovine lymphocytes. Joint report of the 1st International Bovine Lymphocyte Antigen (BoLA) Workshop. Anim. Blood Groups Biochem. Genet. 15, 63-86. Sprague, L. M. (1958). On the recognition and inheritance of the soluble blood group property 'Oc' of cattle. Genetics 43,906912. Spurzem, J. R., Sacco, O., Rossi, G. A., Beckmann, J. D.,


Rennard, S. I. (1992). Regulation of major histocompatibility complex class II gene expression on bovine bronchial epithelial cells. J. Lab. Clin. Med. 120, 94-102. Stear, M. J., Dimmock, C. K., Newman, M. J., Nicholas, F. W. (1988a). BoLA antigens are associated with increased frequency of persistent lymphocytosis in bovine leukaemia virus infected cattle and with increased incidence of antibodies to bovine leukemia virus. Anim. Genet. 19, 151-158. Stear, M. J., Pokorny, T. S., Muggli, N. E., Stone, R. T. (1988b). Breed differences in the distribution of BoLA-A locus antigens in American cattle. Anim. Genet. 19, 171-176. Stear, M. J., Tierney, T. J., Baldock, F. C., Brown, S. C., Nicholas, F. W., Rudder, T. H. (1988c). Class I antigens of the bovine major histocompatibility system are weakly associated with variation in faecal worm egg counts in naturally infected cattle. Anim. Genet. 19, 115-122. Stear, M. J., Nicholas, F. W., Brown, S. C., Holroyd, R. G. (1989). Class I antigens of the bovine major histocompatibility system and resistance to the cattle tick (Boophilus microplus) assessed in three different seasons. Vet. Parasitol. 31,305-315. Stear, M. J., Hetzel, D. J. S., Brown, S. C., Gershwin, L. J., Mackinnon, M. J., Nicholas, F. W. (1990). The relationships among ecto- and endoparasite levels, class I antigens of the bovine major histocompatibility system, immunoglobulin E levels and weight gain. Vet. Parasitol. 34, 303-321. Sterpetti, A., Cucina, A., Morena, A., Di-Donna, S., D'Angelo, L., Cavallarro, A., Stipa, S. (1993). Shear stress increases the release of interleukin-1 and interleukin-6 by aortic endothelial cells. Surgery 114, 911-914. Stevens, M., Olsen, S. (1994). In vitro effects of live and killed Brucella abortus on bovine cytokine and prostaglandin E2 production. Vet. Immunol. Immunopathol. 40, 149-161. Stewart, R., Kashxur, T., Marsden, P. (1996). Vascular endothelial platelet endothelial adhesion molecule-1 (PECAM-1) expression is decreased by TNF-alpha and IFN-gamma. J. Immunol. 156, 1221-1228. Stone, R. T., Muggli-Cockett, N. E. (1993). BoLA-DIB: species distribution, linkage with DOB, and Northern analysis. Anim. Genet. 24, 41-45. Stormont, C. (1978). The early history of cattle blood groups. Immunogenetics 6, 1-15. Strang, C. J., Slayter, H. S., Lachmann, P. J., Davis, A. E. 3rd (1986). Ultrastructure and composition of bovine conglutinin. Biochem. J. 234, 381-389. Suliman, H., Majiwa, P., Feldman, B., Logan-Henfrey, L. (1996). Molecular cloning of a cDNA encoding bovine erythropoietin and analysis of its transcription in selected bovine tissues. Gene 171,275-280. Suzuki, Y., Yin, Y., Makino, M., Kurimura, T., Wakamiya, N. (1993). Cloning and sequencing of a cDNA coding for bovine conglutinin. Biochem. Biophys. Res. Commun. 191,335-342. Symons, D. B. A., Clarkson, C. A., Milstein, C. P., Brown, N. R., Beale, D. (1987). DNA sequence analysis of two bovine immunoglobulin CH gamma pseudogenes. J. Immunogenet. 14, 273-283. Symons, D. B. A., Clarkson, C. A., Beale, D. (1989). Structure of bovine immunoglobulin constant region heavy chain gamma 1 and gamma 2 genes. Mol. Immunol. 26, 841-850. Tabel, H. (1996). Alternative pathway of complement in ruminants: role in infection. Vet. Immunol. Immunopathol. 54, 117-121. Tabel, H., Menger, M., Aston, W. P., Cochran, M. (1984). Alternative pathway of bovine complement: Concentration

References

of factor B, hemolytic activity and heritability. Vet./mmunol. Immunopathol. 5,389-398. Tabel, H., Groat, H. J., Kraay, G. J., Aston, W. P. (1990). Genetic polymorphism of complement factor H in cattle. Anim. Genet. 21,123-128. Takeuchi, N., Ishiguro, N., Shinagawa, M. (1992). Molecular cloning and sequence analysis of bovine T-cell receptor 7 and 3 chain genes. Immunogenetics 35, 89-96. Tanaka, A., Ishiguro, N., Shinagawa, M. (1990). Sequence and diversity of bovine T-cell receptor b-chain genes. Immunogenetics 32, 263-271. Tatcher, E. F., Gerschwin, L. J. (1988). Generation and characterization of murine monoclonal antibodies specific for bovine immunoglobulin E. Vet. Immunol. Immunopathol. 18, 53-66. Taylor, B. C., Choi, K. Y., Scibienski, R. J., Moore, P. F., Stott, J. L. (1993). Differential expression of bovine MHC class II antigens identified by monoclonal antibodies. J. Leukoc. Biol. 53,479-489. Taylor, B. C., Dellinger, J. D., Cullor, J. S., Stott, J. L. (1994). Bovine milk lymphocytes display the phenotype of memory T cells and are predominantly CD8 *. Cell Immunol. 156, 245253. Taylor, G., Thomas, L. H., Wyld, S. G., Furze, J., Sopp, P., Howard, C. J. (1995). Role of lymphocyte subsets in recovery from respiratory syncytial virus infection of calves. J. Virol. 69, 6658-6664. Taylor, K., Lutje, V., Mertens, B. (1996). Nitric oxide synthesis is depressed in Bos indicus cattle infected with Trypanosoma congolense and Trypanosoma vivax and does not mediate Y-cell suppression. Infect. Immun. 64, 4115-4122. Teale, A. J., Kemp, S. J. (1987). A study of BoLA class II antigens with BoT4* T lymphocyte clones. Anim. Genet. 18, 17-28. Teutsch, M. R., Beever, J. E., Stewart, J. A., Schook, L. B., Lewin, H. A. (1989). Linkage of complement factor B gene to the bovine major histocompatibility complex. Anim. Genet. 20, 427. Theile, O. W., Oulevey, J., Hennemuth, K., Koch, J. (1979). Studies on the chemical nature of the lipidic J blood-group substance of cattle. Anim. Blood Groups Biochem. Genet. 10, 1-9. Threadgill, D. S., Threadgill, D. W., Moll, Y. D., Weiss, J. A., Zhang, N., Davey, H. W., Wildeman, A. G., Womack, J. E. (1994). Syntenic assignment of human chromosome 1 homologous loci in the bovine. Genomics 22, 626-630. Tischer, E., Gospodarowicz, D., Mitchell, R., Silva, M., Schilling, J., Lau, K., Crisp, T., Fiddes, J., Abraham, J. (1989). Vascular endothelial growth factor: a new member of the platelet-derived growth factor gene family. Biochem. Biophys. Res. Commun. 165, 1198-1206. Tizard, I. (1995). Interferons. In Cytokines in Animal Health and Disease (eds Myers, M., Murtaugh, M.), pp. 1-57. Marcel Dekker, Inc., New York, USA. Tobin-Janzen, T. C., Womack, J. E. (1992). Comparative mapping of IGI-IG1, IGHM, FES, and FOS in domestic cattle. Immunogenetics 36, 157-165. Tokuyama, Y., Tokuyama, H. (1993). Purification and identification of TGF-beta 2-related growth factor from bovine colostrum. J. Dairy Res. 60, 99-109. Totte, P., De Gree, A., Werenne, J. (1993). Role of interferons in infectious diseases in the bovine species: effect on viruses and rickettsias. Revue Elev. Med. Vet. Pays. Trop. 46, 83-86. Toye, P. G., MacHugh, N. D., Bensaid, A. M., Alberti, S., Teale,

483

A. J., Morrison, W. I. (1990). Transfection into mouse L cells of genes encoding two serologically and functionally distinct bovine class I MHC molecules from a MHC-homozygous animal: evidence for a second class ! locus in cattle. Immunology 70, 20-26. Triglia, R. P., Linscott, W. D. (1980). Titers of nine complement components, conglutinin and C3b-inactivator in adult and fetal bovine sera. Mol. Immunol. 17, 741-748. Tucker, E. M., M&~nier, L., Grosclaude, L., Clarke, S. W., Kilgour, L. (1986). Monoclonal antibodies to bovine blood group antigens. Anim. Genet. 17, 3-13. V~ge, D. I., Lingaas, F., Spooner, R. L., Arnet, E. F., Lie, O. (1992). A study on association between mastitis and serologically defined class I bovine lymphocyte antigens (BoLA-A) in Norwegian cows. Anim. Genet. 23,533-536. van Eijk, M. J. T., Stewart-Haynes, J. A., Beever, J. E., Fernando, R. L., Lewin, H. A. (1992a). Development of persistent lymphocytosis in cattle is closely associated with DRB2. Immunogenetics 37, 64-68. van Eijk, M. J. T., Stewart-Haynes, J. A., Lewin, H. A. (1992b). Extensive polymorphism of the BoLA-DRB3 gene distinguished by PCR-RFLP. Anim. Genet. 23,483-496. van Eijk, M. J. T., Russ, I., Lewin, H. A. (1993). Order of bovine DRB3, DYA, and PRL determined by sperm typing. Mamm. Genome 4, 113-118. van Eijk, M. J. T., Beever, J. E., Da, Y., Stewart, J. A., Nicholaides, G. E., Green, C. A., Lewin, H. A. (1995). Genetic mapping BoLA-A, CYP21, DRB3, D YA and PRL on BTA23. Mamm. Genome 6, 151-152. van Nostrand, W. E., Cunningham, D. D. (1987). Purification of a proteinase inhibitor from bovine serum with Cl-inhibitor activity. Biochim. Biophys. Acta 923,167-175. van Obberghen-Schilling, E., Kondaiah, P., Ludwig, R., Sporn, M., Baker, C. (1987). Complementary deoxyribonucleic acid cloning of bovine transforming growth factor-beta-1. Mol. Endocrinol. 1,693-698. van Voorhis, W. C., Hair, L. S., Steinman, R. M., Kaplan, G. (1982). Human dendritic cells: enrichment and characterisation from peripheral blood. J. Exp. Med. 155, 1172-1187. van Zaane, D., Ijzerman, J. (1984). Monoclonal antibodies against bovine immunoglobulin and their use in isotype specific ELISAs for rotavirus antibody. J. Immunol. Methods 72, 427-441. Velan, B., Cohen, S., Grosfeld, H., Leitner, M., Shafferman, A. (1985). Bovine interferon alpha genes. J. Biol. Chem. 260, 5498-5504. Verbeet, M. P., Vermeer, H., Warmerdam, G. C. M., de Boer, H. A., Lee, S. H. (1995). Cloning and characterization of the bovine polymeric immunoglobulin receptor-encoding cDNA. Gene 164, 329-333. Viuff, B., Osterg~rd, H., Aasted, B., Kristensen, B. (1991). Onedimensional isoelectric focusing and immunoblotting of bovine major histocompatibility complex (BoLA) class I molecules and correlation with class I serology. Anim. Genet. 22, 147-154. Watkins, D. I., Shadduck, J. A., Rudd, C. E., Stone, M. E., Lewin, H. A., Letvin, N. L. (1989a). Isoelectric focusing of bovine major histocompatibility complex class II molecules. Eur. J. Immunol. 19, 567-570. Watkins, D. I., Shadduck, J. A., Stone, M. E., Lewin, H. A., Letvin, N. L. (1989b). Isoelectric focusing of bovine major histocompatibility complex class I molecules. J. Immunogenet. 16, 233-245.

484

Watson, A., Hogan, T., Hahnel, A., Wiemer, K., Schultz, G. (1992). Expression of growth factor ligand and receptor genes in the preimplantation bovine embryo. Mol. Reprod. Dev. 31, 87-95. Watson, D. L., Brandon, M. R., Lascelles, A. K. (1972). Concentrations of immunoglobulins in mammary secretions of ruminants during involution with particular reference to selective transfer of IgG1. Aust. J. Exp. Biol. Med. Sci. 50, 535-539. de Weck, A. L. (1995). What can we learn from the allergic zoo? Int. Arch. Allergy Immunol. 107, 13-18. Weigel, K. A., Freeman, A. E., Kehrli, M. E. Jr, Stear, M. J., Kelley, D. H. (1990). Association of class I bovine lymphocyte antigen complex alleles with health and production traits in dairy cattle. J. Dairy Sci. 72, 2538-2546. Weinberg, A., Shaw, J., Paetkau, V., Bleackley, R., Magnuson, N., Reeves, R., Magnuson, J. (1988). Cloning of cDNA for the bovine IL-2 receptor (bovine Tac antigen). Immunology 63, 603-610. Wempe, F., Henschen, A., Scheit, K. (1991). Gene expression and cDNA cloning identified a major basic protein constituent of bovine seminal plasma as bovine monocyte-chemoattractant protein-1. (MCP-1). DNA Cell Biol. 10, 671-679. Wempe, F., Kuhlmann, J., Scheit, K. (1994a). Characterization of the bovine monocyte chemoattractant protein-1 gene. Biochem. Biophys. Res. Commun. 202, 1272-1279. Wempe, F., Hanes, J., Scheit, K. (1994b). Cloning of the gene for bovine monocyte chemoattractant protein-2. DNA Cell Biol. 13, 1-8. Werling, D., Sileghem, M., Lutz, H., Langhans, W. (1995). Effect of bovine leukemia virus infection on bovine peripheral blood monocyte responsiveness to lipopolysaccharide stimulation in vitro. Vet. Immunol. Immunopathol. 48, 77-88. WHO (1978). Proposed rules for the designation of immunoglobulins of animal origin. WHO Bull. 56, 815-817. Wijngaard, P. L., Metzelaar, M. J., MacHugh, N. D., Morrison, W. I., Clevers, H. C. (1992). Molecular characterization of the WC1 antigen expressed specifically on bovine CD4-CD8gamma delta T lymphocytes. J. Immunol. 149, 3273-3277. Wijngaard, P. L., MacHugh, N. D., Metzelaar, M. J., Romberg, S., Bensaid, A., Pepin, L., Davis, W. C., Clevers, H. C. (1994). Members of the novel WC1 gene family are differentially expressed on subsets of bovine CD4-CD8-gamma delta T lymphocytes. J. Immunol. 152, 3476-3482. Williams, D. J. L., Newson, J., Naessens, J. (1990). Quantitation of bovine immunoglobulin isotypes and allotypes using monoclonal antibodies. Vet. Immunol. Immunopathol. 24, 267-283. Winkler, G. C. (1988). Pulmonary intravascular macrophages in domestic animal species: review of structural and functional properties. Am. J. Anat. 181,217-234. Wood, P., Rothel, J., McWaters, P., Jones, S. (1990). Production and characterization of monoclonal antibodies specific for bovine gamma-interferon. Vet. Immunol. Immunopathol. 25, 37-46. Worku, M., Paape, M. J., Marquadt, W. W. (1994). Modulation of Fc receptors for IgG on bovine polymorphonuclear neutrophils by interferon-), through de novo RNA transcription and protein synthesis. Am. J. Vet. Res. 55,234-238. Worku, M., Paape, M. J., Di Carlo, A., Kehrli, M. E. Jr, Marquardt, W. W. (1995). Complement component C3b and


immunoglobulin Fc receptors on neutrophils from calves with leucocyte adhesion deficiency. Am. J. Vet. Res. 56, 435439. Wyatt, C. R., Madruga, C., Cluff, C., Parish, S., Hamilton, M. J., Goff, W., Davis, W. C. (1994). Differential distribution of gamma delta T-cell receptor lymphocyte subpopulations in blood and spleen of young and adult cattle. Vet. Immunol. Immunopathol. 40, 187-199. Wyatt, C. R., Brackett, E. J., perryman, L. E., Davis, W. C. (1996). Identification of 73 T lymphocyte subsets that populate calf ileal mucosa after birth. Vet. Immunol. Immunopathol. 52, 91-103. Yonemasu, K., Sasaki, T., Shinkai, H. (1980). Purification and characterization of subcomponent Clq of the first component of bovine complement. J. Biochem. 88, 1545-1554. Yoo, J., Stone, R., Kappes, S., Beattie, C. (1994). Linkage analysis of bovine interleukin 1 receptor types I and II (IL-1R I, II). Mature. Genome 5,820-821. Yoo, J., Ponce de Leon, F., Stone, R., Beattie, C. (1995). Cloning and chromosomal assignment of the bovine interleukin-2 receptor alpha (IL-2R alpha) gene. Mature. Genome 6, 751753. Yoo, J., Stone, R., Beattie, C. (1996a). Cloning and characterization of the bovine Fas. DNA Cell Biol. 15,227-234. Yoo, J., Stone, R., Solinas-Toldo, S., Fries, R., Beattie, C. (1996b). Cloning and chromosomal mapping of bovine interleukin-2 receptor gamma gene. DNA Cell Biol. 15,453-459. Xu, A., Clarke, T. J., Teutsch, M. R., Schook, L. B., Lewin, H. A. (1991). Sequencing and genetic analysis of a bovine DQB cDNA clone. Anita. Genet. 22, 381-389. Xu, A., McKenna, K., Lewin, H. A. (1993a). Sequencing and genetic analysis of a bovine DQA cDNA clone. Immunogenetics 37, 231-234. Xu, A., van Eijk, M. J. T., Park, C., Lewin, H. A. (1993b). Polymorphism in BoLA-DRB3 exon 2 correlates with resistance to persistent lymphocytosis caused by bovine leukemia virus. J. Immunol. 151, 6977-6985. Xu, A., Park, C., Lewin, H. A. (1994). Both DQB genes are expressed in BoLA haplotypes carrying a duplicated DQ region. Immunogenetics 39, 316-321. Zanotti, M., Poli, G., Ponti, W., Polli, M., Rocchi, M., Bolzani, E., Longeri, M., Russo, S., Lewin, H. A., van Eijk, M. J. T. (1996). Association of BoLA class II haplotypes with subclinical progression of bovine leukaemia virus infection in Holstein-Friesian cattle. Anita. Genet. 27, 337-341. Zarlenga, D., Canals, A., Aschenbrenner, R., Gasbarre, L. (1995a). Enzymatic amplification and molecular cloning of cDNA encoding the small and large subunit of bovine interleukin 12. Biochim. Biophys. Acta 1270, 215-217. Zarlenga, D., Canals, A., Gasbarre, L. (1995b). Method for constructing internal standards for use in competitive PCR. BioTechniques 19, 324-326. Zhou, J., Hikono, H., Ohtaki, M., Kubota, T., Sakurai, M. (1994). Cloning and characterization of cDNAs encoding two normal isoforms of bovine stem cell factor. Biochim. Biophys. Acta 1223, 148-150. Zurfluh, L., Bolten, S., Byatt, J., McGrath, M., Tou, J., Zupec, M., Krivi, G. (1990). Isolation of genomic sequence encoding a biologically active bovine TGF-alpha protein. Growth Factors 3,257-266.

XIV 1.

SHEEP IMMUNOLOGY AND GOAT PECULIARITIES

Introduction

Small ruminants, which include sheep and goats, are important agricultural species with an estimated global population of 1.7 billion (Morris, 1995). Sheep have often been used as animal models for investigating the physiology of reproduction, endocrinology, cardiovascular function, pulmonary function, and the immune system. An understanding of host functions, relative to disease, and extensive knowledge of the physiology of this small ruminant contributes much to our ability to work effectively with this species for agrarian or scientific purposes. In fact, the sheep model has proven extremely useful for immunological research when addressing questions regarding the physiology of the immune system (reviewed by Hein, 1995). Several sections in the present chapter exemplify the contributions made by the sheep model to the basic concepts of immunology. The sheep model has contributed greatly to our understanding of lymphocyte trafficking and the physiology of cell movement through lymphoid and nonlymphoid tissues (see Section 4). The surgical accessibility of the fetal lamb and its isolation from the maternal environment has offered an excellent opportunity to investigate the development of immunocompetence. This has offered rare insights into the ontogeny of the immune system (Section 10) and into the events that accompany the development of the T-cell receptor (Section 6), the Ig repertoire (Section 7), and self tolerance (Section

18). Investigations of ovine immunology have also provided valuable insights into the evolution of the immune system. Investigations of the 78 T-cell population in sheep have revealed marked structural and functional differences between ruminants and rodents (see Sections 5 and 18). Further investigations of these differences should enhance our understanding of the role that this enigmatic T-cell population plays in the physiology of the immune system and their contribution to host defense mechanisms. The sheep model also has a long history in contributing to our understanding of Peyer's patch structure and function. Investigations of B-cell development in this gut-associated lymphoid tissue have revealed that many mammalian species may utilize strategies for Ig repertoire diversificaHandbook of Vertebrate Immunology

ISBN 0-12-546401-0

tion that are distinctly different from the model based on studies in rodents (reviewed by Griebel and Hein, 1996). In fact, rodents may prove to be the exception rather than the norm when studying mechanisms of mammalian B-cell development. Extensive conservation of the structure and function of the mammalian immune system is also apparent in sheep. This is apparent in the conservation of surface molecules expressed on leukocytes (Section 3), the structure and function of numerous cytokines (Section 5), the organization of the major histocompatibility complex (Section 8), and the complement cascade (Section 14). This conservation of structure and function confirms that sheep provide a valuable model for investigating host responses to a wide variety of pathogens. In fact, as illustrated by studies of Maedi-Visna virus (Section 16) and bovine leukemia virus (Section 17) the sheep offers unique advantages when investigating the interaction between a pathogen and the immune system. There are unique aspects to the development of the ruminant immune system that must be considered when using sheep as an immunological model. The passive transfer of immunity in the neonate (Section 11) has a major impact on the immune competence of the neonate (Section 12). Gut-associated lymphoid tissues also play a critical role in B-cell development (Section 2). Thus, any event that alters ileal Peyer's patch function may alter development of the Ig receptor repertoire. In conclusion, the sheep model provides many unique advantages in the exploration of the immune system. An understanding of immune system structure and function in a variety of species will bring a much broader understanding of the physiological constraints that have influenced the evolution of this complex system.

11


Introduction

A distinction should be made between the organized and diffuse lymphoid tissue, the latter found scattered throughout the loose connective tissues of the body. The Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved

486

SHEEP IMMUNOLOGY AND GOAT PARTICULARITIES

quantitative and functional contribution of the diffuse lymphoid tissue to the immune system tissue is considerable, exemplified by the diffuse lymphoid tissue of the gut, the respiratory tract and the skin. The leukocyte populations found in the epithelia of these organs likewise represent a very significant component. In this section, however, only lymphoid tissues fashioned into organized structures are dealt with. Acquisition of immunological competence involves the ordered emergence of lymphoid organs which in sheep, as in other ruminants, develop in the fetus. The syndesmochorial placentation in sheep provides a protected environment for the fetus, allowing a development of lymphoid tissues in a milieu devoid of external antigens including antibodies from the ewe. The shaping of the early immune system in the sheep is thus determined by factors in the fetus itself. The extent to which the various components of the immune system develop during gestation in sheep presents a telling story about the endogenous potential.

lar association between lymphocytes and epithelial cells is established (Mackay et al., 1986a; Maddox et al., 1987b). A subdivision into cortex and medulla (Mackay et al., 1986a) and primitive Hassal's corpuscles (Maddox et al., 1987a) become apparent at 50 days. The particular association between 78 T cells and Hassal's corpuscles apparent early in ontogeny has been noted (McClure et al., 1989; Hein and Mackay, 1991).

Fetal haemopoiesis The yolk sac, liver, thymus, spleen, bone marrow, lymph nodes and gut-associated lymphoid organs all contribute components to the haemopoietic tissues (Figure XIV.2.1). The primitive haemopoiesis in the yolk sac between 17 and 27 days gestation is essentially an erythropoiesis but may involve cells of the myeloid series. Thus, leukocytes reactive for CD45 can be found (Landsverk et al., 1992) and leukocytic phagocytosis is an early capability. In embryos as young as 24 days gestation there is a population of free-floating macrophage cells which can engulf bacteria and other foreign material (Morris, 1984). Whereas the emergence of truly lymphopoietic tissues with recognizable T and B lineages is a later event (35-40 days gestation), the interim period is dominated by intense haemopoiesis in the liver from about 22 days onwards. The haemopoiesis in the liver of sheep seems to be restricted to erythropoiesis, myelopoiesis and megakaryopoiesis (Miyasaka and Morris, 1988) even in later fetal age, although scattered cells reactive for IgM or CD5 can be found beyond 60 days.

Thymus The thymus of sheep arises mainly from the ventral diverticulum of the paired third and fourth pharyngeal pouch. The endoderm gives rise to the epithelial reticulum that distinguishes the thymus from other lymphoid organs. Sheep retain the cervical part of the thymus in addition to its thoracic portion as the organ develops. The thymus becomes lymphoid about 35 days gestation when cells with the CD45 § and CD5 § phenotype appear and the particu-

Spleen The spleen emerges at about 40 days gestation as a pale organ which is difficult to detect in its position in the dorsal mesentery. It takes 10 days before an increasing erythropoiesis gives the organ its typical dark red colour. The early spleen is remarkably diverse in the way it provides for the various haemopoietic cell lines supporting erythropoiesis, myelopoiesis and lymphopoiesis (A1 Salami, 1995). The first IgM § cells have been reported at 48 days (Press et al., 1993) and the spleen represents the first organ to provide an expansion of the B cell line. There is an early expression of the heavy chain of IgM at the mRNA level (C. M. Press and T. Landsverk, unpublished data) but at the present it is not known whether rearrangement of immunoglobulin genes takes place in the spleen. B-cell expansion is very significant in the early spleen and prior to 77 days of gestation IgM § cells account for over 80% of the emergent while pulp area (Press et al., 1993). The possibility that this early B-cell population might in fact be B-1 cells has attracted interest, however, FACS analysis has indicated just 1-2% CD5 § B cells at 81 days (Press et al., 1993). It is possible that sheep possess predominantly the B-lb (CD5-) phenotype. Doubts exist, however, about the relevance of CD5 as a marker for the B-1 cells in sheep (Griebel and Ferrari, 1995). The role of the spleen in B-cell ontogeny is being addressed. Elimination of B cells by injection of anti-IgM antibody at 63 days results in a persistent deficiency of such cells (Press et al., 1996), although it is uncertain whether the effect is due purely to an effect on the spleen populations. It is possible that the spleen represents a 'dead end' for colonizing cells as in the chicken (Reynaud et al., 1992). It is noteworthy that B-cell expansion at 50-70 days precedes, by a month, the emergence of the ileal Peyer's patch, which contributes the bulk of B cells to the postnatal immune system (reviewed in Section 10). It is of further interest that the B-cell expansion in the early spleen (> 60 days) occurs before the major seeding of lymph nodes and gut with lymphocytes. It is not known whether the migrants to these organs actually originate in the spleen, but the metastatic behaviour of lymphocytes appears to be intrinsic and established early, although lymphocyte recirculation in its proper sense first commences at about 80 days (Pearson et al., 1976).


Yolk sac

487

~ 7777n

Liver Thymus

I I ! i 1 I ! I ! ~ i : : ~.

Spleen

.. ~iii:~iii:::~:::i:~:!:. ~ i~!i!.::i::~i~ ::i.~.::.:..i:;.::!?::::?~:ii:ii ~ , :~: (~i:i.::';::.:":::.i~.: ~::":~":.;:;:~:~::::':::~ ' . : )

:.

: i

Lymph nodes

Jejunum/colon/rectum Ileal Peyer's patch L. . . . . . . . . . . . . .

Bone marrow 0

10

20

30

40

50

60

70

80

90

100

110

120

130

140

150

Days gestatation

Primitive haemopoiesis Erythropoiesis Myelopoiesis Lymphopoicsis

Fig. XIV,2.1

r/////A L,_:~:=.::._~, :: '

'

Haematopoietic tissues in fetal sheep.

Lymph nodes

At such an early stage (50-55 days gestation) no functional lymphatic system exists and the first lymph nodes to appear, the cervical superficial lymph nodes can first be discerned at 55-60 days gestation (Cole and Morris, 1973). The mediastinal lymph nodes are also early and in the next few days nodes such as the portal, subiliaci and jejunal develop (Morris and A1 Salami, 1987). A connection of lymph nodes to peripheral and central lymphatics is established at 65-70 days gestation. This is when a functional blood and lymph network begins to function. The first lymphocytes to appear in lymph nodes are mainly T cells; B cells appear to be somewhat later immigrants, with aggregates of B cells first appearing at about 80 days gestation, just preceded by the subdivision of the lymph node into cortical and medullary areas at 75-80 days (A1 Salami, 1985; A1 Salami et al., 1985). These early B cells associate with specializations of stromal elements in the form of 5'-nucleotidase reactive cells, precursors of follicular dendritic cells (Halleraker et

al., 1994). About 10 days later such follicles appear also in

the spleen. The emergence of primary lymphoid follicles in lymphoid organs such as the lymph nodes and spleen is a particularly noteworthy feature (Halleraker et al., 1994).

Bone m a r r o w

The bone marrow of sheep is involved in lymphopoiesis only to a minor extent. It assumes significance as a haemopoietic organ from about 70 days gestation. During fetal life the bone marrow rarely contains more than 5% cells with an identifiable lymphoid phenotype (Miyasaka and Morris, 1988). The extent of bone marrow erythropoiesis, granulopoiesis and megakaryopoiesis increases throughout fetal life so that from the second half of gestation it is the most important haemopoietic organ. Although lymphocytes and large blast resembling lymphoid precursor cells have been identified in the bone marrow, it is likely that they were migrant cells (A1 Salami, 1985).

488


Gut-associated lymphoid tissue

follicles in the respiratory tract may be questioned, and their emergence following infection by mycoplasma has been reported (Jones et al., 1982).

The origin of the early migrants to the intestines is not known but they constitute both IgM- and CD5-reactive cells. Early seeding appears to be confined to intestinal segments such as sites close to the ileocaecal valve, with populations appearing both proximal and distal to the valve and to the segment in the rectum close to the rectoanal junction (Aleksandersen et al., 1991). Whereas lymphocyte accumulations close to the ileacaecal valve appear around 67 days gestation (M. Aleksandersen and T. Landsverk, unpublished data) collections in the rectum are found at about 70 days (Aleksandersen et al., 1991). Immigration to the jejunum also occurs at about this time (Reynolds and Morris, 1983). Although it appears that these early lymphocyte accumulations contain proliferating cells of both B and T lineages, no stromal specialization has been reported before the emergence of true follicles from about 100 days. The distinction between the lymphoid tissues arising close to the ileo-caecal opening and the ileal Peyer's patch proper is an important one because the former precedes the latter by more than a month. The ontogeny and function of the ileal Peyer's patch is dealt with elsewhere (Immunoglobulins) but its rudiment can be identified at 100 days gestation by histochemical attributes which include carbonic anhydrase activity in the overlying epithelium (Landsverk et al., 1987). This enzyme reactivity marks the commencement of transcytosis and the shedding of 50nm membrane-bound particles to the lymphoid tissues (Landsverk et al., 1990; Nicander et al., 1991). This coincides with the first appearance of clusters of IgM + cells beneath the epithelium (Press et al., 1992). This feature distinguishes the ileal Peyer's patch from the jejunal Peyer's patches (Landsverk, 1987). A full complement of stromal and accessory cells develop in all the intestinal sites (Halleraker et al., 1990; Aleksandersen et al., 1991; Nicander et al., 1991) and the magnitude of the lymphopoiesis, in addition to other features, set the intestinal follicles apart from those of lymph nodes and spleen (Reynolds, 1985). It is thus apparent that the intestinal habitat contains unique components that mature lymphocyte proliferation prior to exposure to the postnatal antigen-rich milieu. The intestinal mucosa is not the only mucosa to be equipped with follicles. The palatine tonsils develop from the second pharyngeal pouch and are significant, although often ignored lymphoid organs that develop in the fetus (T. Landsverk, unpublished data). Characteristic for this organ is a particular lympho-epithelial relationship with similarities to that of M cells (Ol~h et al., 1988). We do not know to what extent there is development of lymphoid follicles in the respiratory tract, the abomasum, the urogenital tract and around the eyes in the fetus, but they are present in the postnatal animal (Nicander et al., 1993). The term mucosa-associated lymphoid tissue (MALT) is therefore appropriate. The constitutive character of the

Hemal nodes and mesenteric 'milk spots'

The enigmatic lymphoid organs in sheep, hemal nodes and mesenteric 'milk spots', also develop in the fetus. The haemal nodes are prevalent in the sublumbar area along the vena cava and abdominal aorta (Salazar, 1984). They develop from lymph node primordia that lose their lymph vessels (Nicander et al., 1993) but contain sinuses filled with red blood cells (Macmillan, 1928). Lymphocyte accumulations may be found in the reticular parenchyma separating the sinuses and follicles may be present (Erencin, 1984). The milk spots emerge at 72 days gestation as small aggregations of cells along omental arteries, accumulating lymphocytes and macrophages as they develop (Shimotsuma et al., 1994). The significance of these organs is unknown.

Stromal cells and accessory cells

In early lymphoid development the apparent lack of specialization in terms of stromal and accessory cells is a noteworthy feature and represents a possible explanation for an inability to mount antibody production against such antigens as Salmonella somatic antigens. It is therefore remarkable that Salmonella flagella antigens and a range of other antigens do result in antibody production upon challenge in utero at 65-80 days (Silverstein et al., 1963; Fahey and Morris, 1978). Nevertheless it appears that the full complement of the immune system's repertoire of responsiveness requires some form of conditioning process which depends on specific structural relationships. Among such decisive components the development of lymphoid follicles may be important. In sheep, the enzyme 5'-nucleotidase represents a marker of follicle stroma cells (Halleraker et al., 1990). The first 5'-nucleotidase reaction appears in the cervical superficial lymph node about 80 days gestation and from 90 days gestation in the spleen. A similar reactivity is associated with the emerging follicles in the intestines. As the follicles in the spleen and lymph node develop, they acquire a full complement of stromal specializations, as well as lymphocyte phenotypes including the occurrence of scattered CD4 cells (Halleraker et al., 1994). Mitoses occur among the lymphocytes and tingible body macrophages can be found. Such follicles are prevalent in late gestation fetuses and no longer correspond to the classical concept of primary follicles as 'rounded aggregations of small lymphocytes and reticular cells' (Nossal et al., 1968) challenging prevailing ideas about the antigen dependency of the various stages through which primary follicles develop into secondary


lymphoid follicles or germinal centres. Admittedly, such primary follicles in late gestation lack the marked zonation typical for germinal centres and the follicular dendritic cells lack the elaborate surface extensions seen in the light zone of germinal centres. All these features develop as the animal is exposed to external antigen after birth, There is extensive development of intestinal lymphoid follicles in utero but the stromal cells of ileal Peyer's patch follicles never attain the elaborate surface extensions characteristic of germinal centre follicular dendritic cells (Nicander et al., 1991). These mesenchyme-derived cells (M~iller-Hermelink et al., 1981) belong to a family of specialized cells that characterize the subdivisions of the follicle as they develop. Starting as primitive cells they develop into reticular fibroblasts in the dome area and the capsule. In the follicle proper, the fibroblasts develop an intimate relationship with lymphocytes which includes typical desmosome-like connections (Nicander et al., 1991). In this respect, the fibroblasts resemble thymic epithelial cells. A further parallel exists between the thymus and the ileal Peyer's patch. There is an apparent endodermal lymphocyte interaction in the ileal Peyer's patch owing to the seeding of 50nm membrane-bound epithelium-derived particles (CAPs) into the follicles and these particles appear to enter the lymphocytes (Landsverk et al., 1990). In the jejunal Peyer's patch such a feature is notably represented by the enfolding of clusters of lymphocytes by the M cells (Landsverk, 1987). The implications of such interrelationships remain to be defined. Lymphoid follicles are designed to provide microenvironments where processes of proliferation, expansion of receptor repertoire by somatic mutation, scrutiny and selection take place. All lymphoid organs, with the possible exception of the thymus, appear to be equipped with structures that ensure a confrontation with both endogenous and exogenous antigens. In fact, the follicleassociated epithelium, although incompletely mapped in sheep, is probably typical of all MALT. The epithelium has a remarkable capacity for uptake of material from the lumen; this is particularly prominent in the ileal Payer's patch (Landsverk, 1988) and may be considered a counterpart to afferent lymphatics of lymph nodes and the blood capillaries supplying the marginal zone of the spleen. These sites are also equipped with dendritic cells thought to play a role in antigen presentation. In Payer's patches of lambs dendritic cells can be identified by their MgATPase reactivity (Halleraker et al., 1990). The descendants of the dendritic cells, the interdigitating cells, constitute an integral population of T-cell areas in both Payer's patches and lymph nodes. Postcapillary venules provide the entry route to these tissues for both circulating lymphocytes and myeloid cells. In sheep, the postcapillary venules are usually lined with a conventional flattened endothelium (Schoefl, 1981), except during ontogeny when a high endothelium may

489

be seen (Morris and A1 Salami, 1987). Exit routes a r e provided by the terminal lymphatics which, both in the GALT and in lymph nodes, are conveniently interposed between the follicles and their adjoining T cell a r e a s (Nicander et al., 1991; Lowden and Heath, 1992). These lymphatics end blindly and contain lymph rich in proteins. Upon activation of lymph nodes such lymphatics tend to be crowded with lymphocytes (Nicander et al., 1991).

Conclusions

The sheep model derives many of its attributes from the extent to which the organs discussed above may be studied as they develop in the fetus, shielded from external influence. The many issues that may be revisited include the pathways of B- and T-cell development, antigen dependent and independent components of lymphoid follicle development, recirculation patterns and forms of lymphocyte-stromal cell interactions. The primary immune responses of a naive immune system may likewise be explored.

3,


Two reviews of sheep leukocyte antigens have been published (Mackay et al., 1987; Mackay, 1988) and, more recently, two International Leukocyte Antigen Workshops, the first in 1991 (Hein et aI., 1991) and the second in 1993 (Hopkins et al., 1993)were conducted to cluster monoclonal antibodies specific for sheep leukocyte antigens. Many of the workshop monoclona] antibodies (mAbs) bound to sheep leukocyte antigens that were identified as homologues of mouse or human leukocyte antigens. However, a few antigens could not be defined and some were unique to sheep. mAbs were clustered on the basis of immunohistochemistry, flow cytometry, and molecular weights for immunoprecipitated proteins. There was limited data on protein sequence, genetic structure, or the function of surface molecules. However, genes for three leukocyte antigens, the T19 molecule (Wijngaard et al., 1992; Walker et al., 1994), MHC class II (see Section 8) and the IL-2R-~ chain (Verhagan et al., 1992), have been cloned. The specificity of mAbs for individual MHC class II proteins (Ballingall et al., 1995) and the IL-2R-~ chain (Verhagaen et al., 1993) have been confirmed through reactivity with proteins expressed in transfected cells. It was also apparent from the International Workshops that many mAbs cross-reacted extensively with leukocyte antigens of sheep, goat and cattle (Howard and Morrison, 1991).

490


Lymphocyte markers

is also expressed on murine pre-B cells (Griebel et al., 1996b). Thus, there may be a unique array of surface molecules that regulate the T cell-independent proliferation and differentiation of B cells in the ileal Peyer's patch (Griebel and Ferrari, 1994).

T lymphocytes Many of the major differentiation antigens defined for human and mouse T cells have been conserved on sheep T cells (Table XIV.3.1). However, there are some striking differences when sheep are compared with other species. First, the CD2 molecule is absent on ovine double-negative thymocytes and 7(5 T cells (Mackay et al., 1988c; Giegerich et aI., 1989). The low level expression of CD2 on ovine T cells may reflect the high level expression of LFA-1, a CD2 ligand, on sheep erythrocytes (Selvaraj et al., 1987). Second, the complex T19 (WC1) molecule is expressed on most 7(5 T cells of ruminants but is absent from mice and humans (Mackay et al., 1986b, 1989; Wijngaard et al., 1992). The CD5 molecule appears to be a pan-T cell antigen in sheep but there are CD5-CD8 + T cell populations in the mammary gland (Lee et al., 1989) and the intestine (Gorrel et al., 1988). As noted in Section 6, 7(5 T cells are very numerous in young lambs. A monoclonal antibody has been raised to the 7(5 T-cell receptor (TCR; Mackay et al., 1989) but no mAbs have been produced for the ~fl TCR. Finally, expression of MHC class I! molecules on T cells is usually restricted to activated T cells but in the blood of older sheep there is a marked increase in the frequency of MHC class II + T cells (Dutia et al., 1993). Resting CD4 + T cells in the blood of sheep are also characterized by the expression of the IL-2R~ chain on approximately 30% of the population (Verhagen et al., 1993). Finally, an activation molecule, not associated with the TCR complex, has been characterized for sheep T cells but the identity of this molecule has not been established (Hein et al., 1988). B lymphocytes A limited number of lineage specific antigens have been identified for sheep B cells (Table XIV.3.1). Monoclonal antibodies have been produced for all the major Ig isotypes: IgM (Beh, 1988), IgA (Beh, 1988), IgG1 (Beh, 1987), IgG2 (Beh, 1987) and IgE (Colditz et al., 1994). Monoclonal antibodies have also been raised to Ig light chain (LC; Beh, 1988). The predominant form of Ig LC in sheep is 2 LC. There is no evidence that IgD is expressed on sheep B cells but it appears that the Ig receptor associated molecule, mb-1 or Ig~, has been conserved (Motyka and Reynolds, 1995). The ileal Peyer's patch is the major site of B-cell production in young lambs. The majority of B cells in lymphoid follicles of the ileal Peyer's patch express surface IgM and are characterized by an absence of differentiation antigens found on B cells in blood and other lymphoid tissues (Hein et al., 1988, 1989a; Griebel et al., 1992). However, a mAb (SIC4.8R) has been produced that identifies a molecular complex unique to B cells present in the Peyer's patch of sheep and a similar molecular complex

Myeloid markers Very few lineage specific surface antigens have been well characterized for sheep myeloid cells. The percentage of cells expressing CD11a, CDllb, and CD11c varies in different populations of granulocytes, monocytes, macrophages and dendritic cells (Gupta et al., 1993). This suggests that heterogeneous populations exist for each cell lineage. A careful examination of Fc receptor expression on afferent lymph dendritic cells confirmed the existence of at least four distinct subpopulations (Harkiss et al., 1991). No lineage-specific mAbs have been identified for mast cells which express CD45 but not the CD44 isoform detected by the 25-32 mAb (Haig et al., 1991).

Endothelial adhesion molecules Monoclonal antibodies have been generated for a variety of endothelial adhesion molecules which may play an important role in the interaction between lymphocytes and endothelial cells. The specificity of these monoclonal antibodies for sheep endothelium was established on the basis of interspecies cross-reactivity of previously characterized mAbs or the molecular weights of immunoprecipitated proteins. These mAbs have been summarized (Mackay et al., 1992a) and include: 218 (IgG2b isotype; ~4), GoH3 (rat IgG; ~6), CLB10Gll (IgG1; ~2), 47 (IgG1; ill), Dul-29 (IgG1; L-selectin), HAE2-1 (IgG1; VCAM1), MECA79 (rat IgG; MECA-79). The role of these molecules in sheep lymphocyte traffic is reviewed in Section 4.

Monoclonal antibody reagents Monoclonal antibodies listed in Table XIV.3.2 are the primary reagent used to define a sheep CD antigen. The International Leukocyte Antigen Workshops have subsequently clustered numerous monoclonal antibodies with similar patterns of reactivity. Many of these mAbs and their laboratory of origin are listed in the Workshop summaries. There are few commercial sources for mAbs specific for sheep leukocyte antigens but many hybridomas and/or mAbs may be obtained from individual laboratories.


TableXlV.3.1

491

Leukocyte markers

CD

Alternative names

Cell~tissue distribution

Protein structure

Genetics

References

CDlb

T6 T6

12 and 48 kDa (reduced and nonreduced) 12 and 46 kDa (reduced and nonreduced)

2-7 genes Homologous to human CD1 b ND

Bujdoso et al. (1989); Ferguson et al. (1994)

CDlc

CD2

E-rosette receptor

51-55 kDa (reduced and nonreduced)

ND

Mackay et al. (1988c); Giegerich et al. (1989)

CD3

TCR complex

Dendritic cells in dermis, afferent lymph, lymph node, spleen, and thymus; cortical thymocytes Dendritic cells in dermis, afferent lymph, lymph node, spleen, and thymus; cortical thymocytes; B cells CD4 and CD8 T cells; 60-70% thymocytes (DP); Dendritic cells and macrophages. Absent on B cells, 75 T cells and DN thymocytes (CD4- CD8-) All ~/fi and 7/5 TCR expressing cells

21 and 23 kDa (reduced)

CD4

ST-4 SBU-T4 ST-1 SBU-T1

Subset of ~//~TCR expressing cells Pan-T cell; Subset of B cells

56 kDa (reduced and nonreduced) 67 kDa (reduced and nonreduced)

7, 5, s, ~ are conserved 7 and 5 linked ND

CD6

T12

CD8

ST-8 SBU-T8 LFA-1 O~L heavy chain associated with ~2 integrin Mac-l; CR3 O~M chain associated with/~2 integrin

Thymocytes and majority of T cells Subset of ~/fi TCR expressing cells Lymphocytes, granulocytes, monocytes, macrophages

100 kDa ND (nonreduced) 33 and 35 kDa ND (reduced) 180 kDa (reduced ND and nonreduced)

Hein et al. (1989b); Hein and Tunnacliffe (1990, 1993) Maddox et al. (1985a); Mackay et aL, (1986b) Mackay et al. (1985); Beya et al. (1986); Griebel and Ferrari, (1995) Hopkins et al. (1993)

CD5

CD11a CD11b

CD11c CD18

p150, 95 C~xchain associated with ~2 integrin Integrin/~2

CD25

IL-2 receptor = chain

CD40 CD44

Pgp-1

CD45

LCA

CD45R

p220

CD58

LFA-3

CD59

Protectin

Expressed on alveolar 170 kDa (reduced macrophages, blood and nonreduced) mononuclear cells, and granulocytes Alveolar macrophages, afferent 150kDa (reduced lymph dendritic cells, and and nonreduced) eosinophils Lymphocytes, granulocytes, 95 kDa (reduced monocytes, macrophages and nonreduced) Activated T cells and 30-40% 47 kDa (reduced) CD4 § T cells in blood

ND

Mackay et al. (1985)

Maddox et al. (1985); Ezaki et al. (1987) Mackay (1990)

ND

Gupta et al. (1993)

ND

Gupta et al. (1993)

ND

Gupta et aL (1993) Verhagenet al. (1992, 1993)

B cells

ND

Chromosome 13q12-15; 71% homology with human ND

Most leukocytes, thymocyte subpopulation, and many other tissues All lymphocytes, macrophages, and granulocytes Primarily B cells and some naive T cells Mature and immature haematopoietic cells. Erythrocytes, vascular endothelium, smooth muscle Expressed on erythrocytes and lymphocytes

94 kDa (reduced)

ND

Griebel and Ferrari (1995) Mackay et al. (1988a)

190,210,225 kDa ND (reduced) 220 kDa (reduced) ND

Mackay et al. (1987)

42 kDa

Ligand for CD2

Hunig et al. (1986)

19 kDa (nonreduced)

Restricts the activity of homologous complement

van den Burg et aL (1993)

Maddox et al. (1985b)

(continued)

492


Table XIV.3.1

(Continued)

CD

Alternative names

Cell~tissue distribution

Protein structure

Genetics

References

WC1

T19

Expression restricted to 75 T cells

220 kDa (nonreduced)

Multigene-family. Homology with SRCR See Section 6

Mackay et aL (1986b); Wijngaard etaL (1992); Walker et al. (1994) Mackay et al. (1989); Hein et al. (1990)

See Section 8

Gogolin-Ewens et aL (1985)

See Section 8

Puri et al. (1987)

ND

Motyka and Reynolds (1995)

WC2 ~,5 Null cell TCR MHC class I

OLAI

MHC class II

OLAII

mb-1

Ig~ protein of IgM receptor

Majority of intraepithelial Tcells 41-44 kDa and in the gut, skin and other 36 kDa (reduced) mucosal surfaces. Majority of T cells in the blood of lambs All somatic cells except 12 and 44 kDa neurones (reduced and nonreduced) Most B cells, monocytes, a-chain: 30macrophages, dendritic cells, 32 kDa; t-chain: thymic epithelial cells, and 24-26 kDa activated T cells B cells 42kDa (reduced)

ND, not demonstrated in sheep; SRCR, scavenger receptor cysteine-rich family.

Table XlM.3.2

Monoclonal antibodies specific for leukocyte molecules Activity

Molecule

Clone(s)

FCM

IHC

Isotype

References

CD1 b CDlc CD2 CD2 CD3 CD4 CD5 CD6 CD8 CD11a CD11b CD11c CD18 CD25 CD44 CD45 CD45R CD58 WC1 WC2 ~6 TCR T-cell activation mb-1 Ig LC IgM IgG1 IgG2 IgA IgE MHC class I MHC class II

VPM5 20.27 36F 135/A Rabbit A/s 17D-13 ST-la BAQ91A E-95 F10-150 CC125 OM1 MF13F5 9-14 25-32 1.11.32 20-96 L180/1 197 86-D

+ + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + + + + NR + + + + + +

IgM IgG1 IgG2a IgG1 IgG1 IgG2a IgG1 IgM IgG1 IgG1 IgG1 IgG1 IgG1 gG1 gG1 gG1 gG1 gG1 gG1

Bujdoso et al. (1989) Mackay et al. (1985) Mackay et al. (1988) Giegerich et al. (1989) Ramos-Vara (1994) Maddox et al. (1985) Beya et al. (1986) Hopkins et al. (1993) Ezaki et al. (1987) Mackay et al. (1989) Dutia et al. (1993) Pepin et al. (1992) Gupta et al. (1993) Verhagen et al. (1993) Mackay et al. (1988) Maddox et al. (1985) Mackay et al. (1987) Hunig et al. (1986) Mackay et al. (1986) Mackay et al. (1989)

B5-5 HM57 McM6 McM9 McM1 McM3 McM10 Y41 41-19 28.1

+ NR + + + + + NR + +

+ NR + + + + + + + +

IgG3 IgG1 IgG3 IgG3 IgG2a IgG3 IgG2a NR IgG1 IgG1

Hein et al. (1988) Motyka and Reynolds (1995) Beh (1988) Beh (1988) Beh (1987) geh (1987) geh (1988) Colditz et al. (1994) Gogolon-Ewens et aL (1985) Puri et al. (1985)

FCM, flow cytometry; IHC, immunohistochemistry; NR, not reported.

Leukocyte Migration

4.

493

Leukocyte Migration

Hay, 1992; Young et al., 1993; Hein, 1995). Examination of the lymph draining normal and inflamed tissues allows analysis of the cellular events occurring within that tissue (Smith et al., 1970c; Chin and Cahill, 1984). As a result, a considerable amount of information has become available regarding the cells trafficking throughout the body, and the mediators involved in these processes. Although the remainder of this section will concentrate on lymphocyte migration, information regarding the migration of other immature and mature leukocytes will also be presented when available.

General considerations The immune system consists of both fixed and migratory cell populations (Gowans, 1959; Reynolds et al., 1982). Migratory cell populations carry out immune surveillance of tissues and disseminate immunological memory (Smith et al., 1970a). Leukocytes gain access to the tissues under normal and pathological conditions by migrating out of the peripheral blood between endothelial cells lining the vasculature (Girard and Springer, 1995). The distribution of leukocytes in blood and lymph is shown in Table XIV.4.1. All leukocytes appear to have the capability to migrate out of the peripheral blood and into the tissues under both normal and pathological conditions. Some of these cells can then be seen in the lymph draining those tissues (Hall and Morris, 1962; Smith et al., 1970c). Sampling this lymph allows analysis of the cell types migrating through tissues. Only in a large animal is it possible to cannulate directly individual lymphatic vessels draining specific tissues; for this reason the sheep has proven to be a valuable model for the study of leukocyte migration (Young et al., 1993; Hein 1995). Although all leukocytes can be found in the prenodal (peripheral) lymph, only lymphocytes are capable of continually recirculating between the blood and the tissues via postnodal (central) lymph (Hall and Morris, 1962; Smith et al., 1970b). Although fewer experiments have been performed to investigate the molecular mechanisms of leukocyte migration in sheep than in rodents and humans, considerably more is known about the physiology of leukocyte migration in the sheep than in any other species (Abernethy and

Leukocyte traffic through unstimulated tissues In mammals, lymphoid tissues constitute about 3% of total body weight (Trepel, 1974). For a 30 kg adult sheep, this would total 1 kg of lymphoid tissue, or about I • 1012 lymphocytes (Chin et al., 1985). Based on a blood volume of 70 ml/kg and a peripheral blood lymphocyte count of 5 • 106/ml, only 1% of all lymphocytes (1 • 101~ are in the peripheral blood at any time (Blunt, 1975). The total recirculating lymphocyte pool is 1-2 x 101] lymphocytes, or 10-20 times the peripheral blood pool (Schnappauf and Schnappauf, 1968). The remaining cells are resident within fixed lymphoid tissue, and do not recirculate in the same manner as those obtained from lymph (Reynolds et al., 1982). Extensive analysis has been made regarding the proportion of lymphocyte subsets in blood, peripheral and central lymph. A summary of this data is presented in Table XIV.4.2. These differences are taken to reflect preferential migration of lymphocyte subsets (Mackay et al., 1988b).

Table XlM.4.1 Leukocyte values in blood and lymph

Lym p hocyt es Neutrophils Eosinophils Basophils Macrophages, monocytes, dendritic cells Cells/ml

Peripheral blood

Peripheral lymph

Central lymph

40-75 % 10-50% 0-15% 0-3% 1-6% 4-12 x 106

70-95 %

95-100 %

0-10%a

< 1%a

5-20% 1-20 x 106

< 1% 3-12 x 107

Data from Blunt (1975); Smith et al. (1970b). apooled values including all granulocytes. Table XlV.4.2

CD4 T cells CD8 T cells y5 T cells a B cells b

Lymphocyte subsets in blood and lymph

Central lymph

Peripheral lymph

Peripheral blood

38.8 14.0 10.0 32.0

38.5 12.8 27.8 7.3

14.3 8.5 11.8 17.5

From Mackay et al. (1988b). SBU-T19-positive cells bSurface Ig-positive cells

a

+ + + +

u

7.7% 1.8% 3.1% 7.0%

+ + + +

3.7% 1.1% 2.2% 0.3%

+ 3.0% + 0.5%

+ 2.1% i

+ 5.3%

494


The typical output of cells in peripheral lymph is about 1 x 106 cells/h (Smith et al., 1970b). This is considerably lower than the output of lymphocytes in the central lymph draining a lymph node (Hall and Morris, 1962). About 3 x 10 7 lymphocytes/h exit per gram of subcutaneous lymph node (Hay and Hobbs, 1977). In contrast to peripheral lymph which can contain all leukocyte subsets, only lymphocytes are found in central lymph (Smith et al., 1970b). Studies of cell proliferation in unstimulated lymph nodes suggested that only about 5-10% of the lymphocytes found in central lymph are derived from cell division within the node (Hall and Morris, 1965). The remainder are derived from direct migration from the blood into the central lymph. Approximately one in every four lymphocytes delivered to the node vasculature exit the blood and passes into the node (Hay and Hobbs, 1977). In the rodent lymph node, the majority of cell traffic occurs between the 'high endothelial cells' (HECs) lining the post-capillary venules. Although sheep do not appear to possess these 'high endothelial venules' (HEVs), lymphocytes traffic through the post capillary venules in lymph nodes at similar high-levels (Harp et al., 1990). Granulocytes are not usually prominent in either peripheral or central lymph, but their numbers may increase significantly after antigen stimulation (Smith et al., 1970b). When recirculating lymphocytes were labeled in vitro, reinjected intravenously, and their behaviour tracked in vivo, it was found that the average lymphocyte recirculates about once per day (Frost et al., 1975; Cahill et al., 1977; Chin and Hay, 1980). The time taken for a lymphocyte to extravasate and enter the lymph was independent of both the tissue examined and the presence of inflammation within the tissue (Cahill et al., 1977; Chin and Hay, 1980).

vessel, and then monitoring the changes in the central lymph (Hall et al., 1967; Smith and Morris, 1970; Smith et al., 1970a). This results in a characteristic change in the traffic of lymphocytes through stimulated lymph nodes (Cahill et al., 1974; Hay et al., 1974). Stage 1 is characterized by a marked decrease in the output of lymphocytes in efferent lymph, and varies in both intensity and duration depending on the antigen used (Cahill et al., 1974). The central lymph draining virally stimulated lymph nodes may become virtually acellular during this stage (Cahill et al., 1976). This period of shutdown is unique to lymph nodes, and does not occur during inflammation in nonlymphoid tissues (Cahill et al., 1976). This decreased cell output is due to arrest of recirculating cells within the node, rather than decreased migration from the blood (Cahill et al., 1976; Hay et al., 1980; Issekutz et al., 1981). Stage 2 is characterized by a period of elevated output of lymphocytes, up to 10 times prestimulation levels. This is due to an increased recruitment of lymphocytes from the blood (Cahill et al., 1974; Hay et al., 1974). Antigenspecific cells functionally disappear from the central lymph during this time interval, and are likely retained within the node. This increased traffic of lymphocytes through stimulated lymph nodes likely maximizes the probability of antigen-specific cells encountering antigen (Cahill et al., 1974). During stage 3, blast cells appear in the draining lymph, concomitant with the appearance of sensitized cells. This stage can last 2-3 days, after which the lymphocyte output returns to prestimulation levels. During a secondary response, the kinetics of this process are much more rapid. The phenotype of lymphocytes migrating out of lymph nodes stimulated with a variety of antigens has been studied, and appears to vary widely depending upon the antigen used (Frost, 1978; Kimpton et al., 1990; McClure et al., 1991; Meeusen et al., 1991; Hare et al., 1995).

Leukocyte traffic through stimulated tissues

Leukocyte traffic increases dramatically during an immune response (Smith et al., 1970). Within lymph nodes, most of the increase can be accounted for by increased blood flow (Hay and Hobbs, 1977; Hay et al., 1980). Mediators that increase blood flow to nonlymphoid tissues do not necessarily cause increased lymphocyte infiltration (A. N. Kalaaji and J. B. Hay, unpublished data). Many changes occurring in tissues during inflammation are mirrored in the composition of the draining lymph. For example, the output of cells in the peripheral lymph draining BCG-induced granulomas and allografted kidneys increases between 10 and 200 times baseline levels, and the cellular makeup is similar to those infiltrating the tissues (Smith et al., 1970c; Pedersen et al., 1975). Depending on the stimulus, the phenotypic makeup of the cells in the draining lymph has been found to vary considerably (Frost, 1978; Kimpton et al., 1990; McClure et al., 1991; Meeusen et al. 1991; Hare et al., 1995). In many cases, antigens have been delivered directly to lymph nodes by infusing them into an afferent lymphatic

Mediators of leukocyte migration

The sheep has proven to be a valuable model for investigating the roles of various mediators in leukocyte migration. Although in vitro models have been useful for screening potential mediators, fewer molecules have been found to be potent in vivo (Mulder and Colditz, 1993). Factors have been identified in the lymph draining antigenstimulated tissues. For example, IL-2 and MIF activities have been identified in the lymph draining inflamed tissue (Hay et al., 1973; Lowe and Lachman, 1974; Bujdoso et al., 1990). In addition, factors effective at increasing the adhesion of lymphocytes to cultured endothelial cells have been identified in the lymph draining PPD-induced delayed type hypersensitivity (DTH) sites (Borron, 1991). An in vivo assay system has been developed in the sheep, which involves quantifying the migration of radiolabeled lymphocytes in response to subcutaneously injected mediators (Borgs and Hay, 1986). The migratory effect of

Leukocyte Migration

495

Table XlV.4.3

Mediators of leukocyte migration in sheep

Mediator

Comments

References

IL-lc~

hulL-1 c~moderately effective at recruiting lymphocytes, causes accumulation of large numbers of neutrophils hulL-2 has no effect on leukocyte migration; IL-2-1ike activity detected in lymph following antigen stimulation of lymph nodes hulL-8 causes slight lymphocyte accumulation, large numbers of neutrophils; ovlL-8 causes intense accumulation of neutrophils, slight accumulation of eosinophils hulFN~ has no effect on the recruitment of leukocytes into skin, but promotes the migration of lymphocytes into but not out of lymph nodes bolFN7 recruits large numbers of lymphocytes, no effect on neutrophils huTNF= recruits large numbers of lymphocytes and neutrophils

Colditz and Watson (1992)

IL-2 IL-8 IFN~

IFN7

TNF~

PAF

Causes slight lymphocyte accumulation, recruits large numbers of neutrophils Appears to be involved in lymph node shutdown during antigen response. No effect on lymphocyte migration when injected subcutaneously No effect on lymphocyte or neutrophil recruitment; recruits eosinophils

Bradykinin LTB4

Increases output of lymphocytes from lymph nodes No effect on leukocyte recruitment

ZAP PGE2=

Colditz and Watson (1992); Bujdoso et al. (1990) Colditz and Watson (1992); Mulder and Colditz (1993); Seow et al. (1994) Kalaaji et al. (1988) Colditz and Watson (1992) Colditz and Watson (1992); Kalaaji et al. (1989) Colditz and Watson (1992); Mulder and Colditz (1993) Hopkins et al. (1981); Kalaaji and Hay, unpublished Colditz and Watson (1992); Mulder and Colditz (1993); Topper et al. (1992) Moore (1984b) Colditz and Watson (1992); Mulder and Colditz (1993)

Abbreviations: all cytokines used are recombinant; hu = human, bo = bovine, ov = ovine.

numerous mediators examined using this method are presented in Table XIV.4.3. Although recombinant human cytokines have been used in most of these studies, a number of sheep cytokines have been cloned in recent years, and are now available for study (Mclnnes, 1993). Neurologic and haemodynamic factors have also been found to play a role in lymphocyte migration through lymph nodes (Quin and Shannon, 1975; Moore, 1984a,b; Moore et al., 1984).

Subset-specific and tissue-specific migration patterns of lymphocytes A large amount of work has focused on linking the expression of specific molecules on the surface of lymphocytes with their in vivo homing patterns. Sheep contain at least three distinct pools of small lymphocytes which recirculate specifically through different tissues (Cahill et al., 1977; Chin and Hay, 1980; Issekutz et al., 1980). Pools of lymphocytes have been identified which recirculate specifically through mesenteric tissues, skin or subcutaneous lymph nodes. This is principally a characteristic of ~fi T cells, whereas 75 T cells migrate randomly (Washington et al., 1994). No such tissue specificity has been demonstrated for B cells. The molecules thought to be involved in regulating this process are discussed in the next section. Lymphocytes have been collected from different sources and labeled in vitro with radioactive or fluorescent c o m -

pounds. These cells were then reinjected into the same animal, and their distributions analyzed. Regardless of the label used, it was found that small lymphocytes labeled in this way reappear at peak concentrations in central lymph approximately 24h following injection (Young et al., 1993). It is interesting to note, however, that labeled cells can be detected in lymph as soon as 2-3h following reinjection (Chin and Hay, 1984; Borgs and Hay, 1986). The differences in transit time likely reflect differences in the route of migration of individual lymphocytes through lymph nodes. There are also subset-specific differences in the migration of lymphocytes. CD4 + and 73 TCR-positive lymphocytes are extracted from the blood by lymph nodes more efficiently than CD8 + T cells, independent of tissuespecific migration patterns (Witherden et al., 1990; Abernethy et al., 1990, 1991). Although lymphoblasts also have tissue-specific homing characteristics, these cells do not recirculate (Hall et al., 1970, 1977). Free-floating cells obtained from lymph appear to be unique in their capacity to migrate preferentially through specific tissues, since cells prepared from lymph nodes migrate randomly in similar assays (Reynolds et al., 1982).

Molecules involved in leukocyte migration In recent years, a model of leukocyte transendothelial migration has been developed, involving the sequential interaction of specific molecules on the surface of leukocytes with the endothelial cells lining blood vessels

496


Table XlV.4.4 Cell surface molecules involved in migration of sheep leukocytes Molecule

Comments

References

L-selectin

Highly expressed on 75 TCR § lymphocytes, 70% of central subcutaneous and intestinal lymph cells express L-selectin. Highest expression on CD4+/CD45RA - T cells in central subcutaneous lymph. Shown to be involved in tethering and rolling on cultured lung endothelial cells Expressed on endothelium of mesenteric lymph nodes, Peyer's patches Correlates with gut-migrating T cells. Highly expressed on CD4+/ CD45R- T cells in central mesenteric lymph, moderate expression in lung central lymph, low expression in subcutaneous peripheral lymph Highly expressed on CD4+/CD45R - T cells in subcutaneous peripheral lymph. Lower expression in mesenteric peripheral lymph Expressed on endothelium in stimulated subcutaneous lymph nodes Expressed on mature lymphocytes, medullary thymocytes and stromal cells, myeloid lineage stem cells. Absent from erythroid lineage stem cells. Expression on lymphocytes increased after mitogen stimulation Expressed on recirculating lymphocytes at high levels, expressed on myeloid stem cells. Absent from erythroid stem cells. Shown to be involved in tethering and rolling on cultured lung endothelial cells

Mackay et aL (1992a); Abitorabi et aL (1996); Li et al. (1996)

MadCAM j~7 Integrin

/~1 Integrin VCAM-1 CD44

CD11a

(Springer, 1994). In other species, in vitro assays have been used to dissect the process of leukocyte migration through endothelium. Although similar studies have not been done widely in the sheep, a number of surface molecules believed to be involved in migration have been found on the surface of sheep leukocytes, and the process of leukocyte emigration is probably similar (Li et al., 1996). The molecules identified on sheep leukocytes and their potential biological significance are summarized in Table XIV.4.4. The sheep model provides the added possibility of linking the expression of these molecules to the in vivo migration characteristics of lymphocytes (Mackay et al., 1992a,b; Abitorabi et al., 1996). For example, it has been proposed that memory T-cells migrate preferentially through nonlymphoid tissues such as skin and gut, whereas naive T cells migrate preferentially through lymph nodes (Mackay et al., 1990). The 1~1 integrin is highly expressed on the surface of memory-phenotype CD4 § T cells in skin lymph, whereas the f17 integrin is highly expressed on the surface of memory-phenotype CD4 § T cells in gut lymph (Mackay et al., 1992a; Abitorabi et al., 1996).

C. Mackay, personal communication Abitorabi et al. (1996)

Mackay et al. (1992a); Abitorabi et al. (1996) Mackay et al. (1992b) Mackay et aL (1988a); Haig et aL (1992) Mackay et aL (1990); Haig et aL (1992); Li et al. (1996)

absence of extrinsic antigen, thereby allowing study of lymphocyte migration in immunologically naive animals (Kimpton et al., 1994). Tissue-specific migration pathways of lymphocytes present in the adult are not identifiable in the sheep fetus (Cahill et al., 1979). When fetal lymphocytes were labeled and injected into mothers, they did not demonstrate tissue-specific recirculation patterns (Kimpton and Cahill, 1985). In the reciprocal experiment, maternal lymphocytes demonstrated tissue-specificity in the fetus. This appears to support the current model of tissue specific migration of memory lymphocytes. However, many newly formed lymphocytes lacking the CD45RA epitope migrate through fetal skin (Witherden et al., 1994; Kimpton et al., 1995). This demonstrates that naive lymphocytes can migrate efficiently through nonlymphoid tissues in vivo, although they may not demonstrate the tissue-specific recirculation patterns evident in adults.

Acknowledgements

The author thanks Wayne Hein and John Hansen for critical reading of the manuscript. Lymphocyte migration/recirculation in the sheep fetus

It is possible to study lymphocyte recirculation in the developing ruminant using techniques similar to those described for the adult. The sheep fetus provides a particularly interesting model because it develops in the

5.

Sheep Cytokines

The characterization of sheep cytokines has progressed rapidly over the last 6-7 years. The impetus for this rapid

Sheep Cytokines

497

progress has been the significance of sheep as a livestock species in many countries and, in addition, the preeminence of sheep as a large animal model for biomedical research. Unlike the cytokines of rodents and humans, molecular characterization of sheep cytokine cDNA has preceded functional characterization or characterization at the protein level. To date, in excess of 18 sheep cytokines have been characterized at the DNA level (Table XIV.5.1). Without exception this molecular characterization has been based on, and was possible as a result of, genetic similarities (primarily nucleotide sequence, but also gene linkage) between the cytokines of sheep and homologous molecules in rodents and humans. These similarities have facilitated the application of relatively

simple cloning strategies such as PCR using primers based on regions of homology between rodent and human cytokine nucleotide sequences or alternatively, the lowstringency screening of sheep cDNA or genomic libraries with homologous human or rodent cDNA probes. A more restricted number of sheep cytokines have been characterized at the protein and/or functional level. For the most part this has involved analysis of the activity of recombinant molecules expressed using either bacterial, yeast or mammalian expression systems (Table XIV.5.2). This characterization has frequently made use of the crossspecies functional activity of many cytokines (Table XIV.5.3) and the availability of simple rodent cell based in vitro bioassays. Thus, it has been possible to assay recom-

Table XlM.5.1 Characteristics of cloned sheep cytokines and cytokine receptors Homologies b Cell source/ Cytokine expression a

IL-I~

B

IL-1/~

B

IL-2

R (T cells)

IL-3

R (T cells)

IL-4

IL-6

R (T cells, mast cells) R (T cells, eosinophils) B

IL-7 IL-8 IL-10

Cloning source

Stimulated macrophages Stimulated macrophages Stimulated T lymphocytes Stimulated lymph node cells Stimulated lymph node cells

Chromosome Polymorphisms/ Accession References DNA Protein location microsatellites number

82% 73%

3p

75% 60%

Yes

X56754

Yes

X56755

Goodall et al. (1990); Johnson et al. (1993) Mclnnes et aL (1994a,b); Hawken et aL (1996a,b) Seow et al. (1993); Engwerde et al. (1996); Hawken et al. (1996a,b) Hawken et al. (1996a,b)

80% 65%

17

58% 36%

5q13-15

Yes

Z18291

78% 57%

5ql 3-15

Yes

M96845

Stimulated Tcells 79% 65%

5q13-15

Yes

4

Yes

B

Stimulated 74% 53% macrophages Lymph node cells 84% 75%

U17052, U 17053 X62501

B .B

Spleen Stimulated macrophages G-CSF B Stimulated macrophages GM-CSF B Stimulated macrophages TNF-= B Stimulated macrophages IFN-~II B Liver IFN-7 R (Tcells, Stimulated lymph macrophages) node cells EPO R (renal and Kidney hepatic cells) TGF-/~I B Spleen

83% 78% 85% 79%

Andrews et al. (1993); Hawken et aL (1996a) OAU10089 Barcham et ai. (1995); Broad et ai. (1995) X7830 Seow et aL (1994a) U11421 Martin et aL (1995)

86% 82%

L07939

O'Brien et al. (1994)

X53561

O'Brien et al. (1991); Hawken et al. (1996b) Nashet aL (1991)

IL-2Rc~

71% 55%

11_-5

R (Tcells)

Stimulated T lymphocytes

86% 85%

X53934

Andrews et al. (1991); Hawken et al. (1996a) Andrews et al. (1991)

9q

5q13-15

Yes

X56756

85% 78% 80% 76%

Yes

82% 90% 96% 13q12-15

X59067/8 Whaley et ai. (1991) X52640 Mclnnes et a/.~(1991); Engwerde et al. (1996) Z24681 Fu et ai. (1993)

Yes

X76916

Yes

Z 11560

aB = broad range of lymphoid and nonlymphoid cell types; R = restricted expression. bHomoIogy to human equivalent, coding region only for DNA.

Robinson et a/.(1994); Woodalt et aL (1994) Verhagen et aL (1992); Mathews et aL (1994); Ansari et aL (1995)

498


Table XlM.5.2 Expression and activity of recombinant sheep cytokines and cytokine receptors Recombinant Cytokine protein expression

Convenient bioassay

IL-1 ~ and IL-1/~

Escherichia coil

NOB-1/CTLL assay Ovine thymocyte costimulation (PHA)

1 x 107 U/mg In vivo adjuvant activity (antibody, DTH) Pyrogenic Cartilage degradation

Escherichia coil

Proliferation of Con A activated IL-2 dependent sheep lymph node cells

1 x 107 U/mg In vivo adjuvant activity Nash et al. (1993); (antibody) Bujdoso et al. (1995) Generation of virus specific cytotoxic T cells

IL-3

Mammalian

Hematopoietic cell differentiation from bone marrow

IL-6

Yeast

Mouse plasmacytoma/ hybridoma proliferation (B9 and 7TD1, etc.)

IL-7

Escherichia coil

Ovine thymocyte costimulation (con A, IL-2, IL-10)

IL-8

Escherichia coil

Chemotaxis of neutrophils

In vivo chemotactic Seow et al. (1994a); Haig activity for neutrophils, et al. (1996) and to a lesser extent eosinophils and some T cells

IL-10

Escherichia coil

Murine thymocyte costimulation (con A, IL-2, IL-7)

Inhibition of Martin et al. (1995, 1996) inflammatory cytokine synthesis (IL-1 and TNF~) by macrophages

IL-2

Yeast Mammalian

Yeast

Mammalian

GM-CSF Escherichia coil Mammalian

Hematopoietic cell differentiation from bone marrow

IFN-c~

Escherichia coil

Cytotoxic activity against actinomycin D-treated WEHI-164 cells Ovine thymocyte costimulation (PHA)

IFN-y

Mammalian

Antiviral activity (MDBK bovine kidney cells and Semliki-Forrest virus)

IL-2Rc~

Mammalian

Binding of 1251-1L-2

Yeast Mammalian

Specific activity

Other biological activities characterized

References

Andrews et aL (1991, 1994); Fiskerstrand et aL (1992); Nash et al. (1993)

Mclnnes et al. (1994a)

1 x 105 U/mg Ig secretion by PMAstimulated PBMC

Ebrahimi et al. (1995)

Barcham et al. (1995); Martin et al. (1996)

Mclnnes et al. (1994a); O'Brien et al. (1995); Haig et al. (1996) 1 x 105 U/mg Cartilage degradation (cytotoxic assays)

Upregulation of MHC II expression on macrophages 9 nm (affinity)

binant sheep IL-1, IL-6, IL-7, IL-10, and TNF-~ biological activity using either mouse cell lines (for example the various plasmacytomas and hybridomas that depend on IL-6 for growth) or dispersed mouse thymocytes in mitogen costimulation assays. In addition to the mouse cell based

Nash et al. (1991, 1993); Green et al. (1993)

Martin et al. (1996)

Verhagen et al. (1992)

bioassays, these particular cytokines can also be assayed using sheep cell based methods including sheep thymocyte costimulation. In contrast, sheep cytokines such as IL-2, IL3, IL-4, IL-8, GM-CSF and IFN7 have a more restricted species specificity and their functional characterization has

Sheep Cytokines Table XlM.5.3

499

Some cross-species reactivities of ovine and human cytokines Cross-species activity a

Human to ovine

Ovine to mouse

Cytokine

In vitro

In vivo

Specific activity

In vitro

In vivo

Specific activity

IL-1 ~ IL-1/~

Yes Yes

Yes

Reduced Reduced

Yes Yes

Yes

Retained

IL-2 IL-6

Yes

Retained

No Yes

IL-7 IL-8 IL-10 GM-CSF M-CSF TNF~

Yes Yes Yes No Yes No

Retained Retained Retained

Yes

Yes

Retained

Yes

Yes

Retained

Yes

Reduced

References

Andrews et al. (1991) Andrews et al. (1991); Seow et al. (1994b) Verhagen et al. (1993) Andrews et al. (1993); Ebrahimi et al. (1995) Barcham et al. (1995) Seow et al. (1994a) Martin et al. (1995, 1996) O'Brien et al. (1991 ) Mclnnes et al. (1994a) Green et al. (1993)

aUnknown if not indicated.

been based on the use of sheep or bovine cell based assays. Sheep IL-2 and IL-4 can be assayed through their ability to support the proliferation of mitogen activated lymph node T cells, while IL-3 and GM-CSF both support the development of differentiated colonies in soft agar assays of sheep bone marrow cells. Sheep IFNy activity is best assayed via its ability to protect a bovine cell line from the cytolytic activity of Semliki-Forest virus. An important point to note is that the species specificity of sheep cytokines is entirely consistent with the species specificity of their rodent and human homologues, although there are clearly some exceptions to this rule (for example, the broad cross-species reactivity of human IL-2 compared with the restricted activity of both sheep and mouse IL-2).

Table XlM.5.4

An important development ensuing from the expression of recombinant sheep cytokines, particularly in large quantities from bacteria and yeast, has been the production of cytokine-specific monoclonal and polyclonal antibodies. These reagents can be used in a variety of immunochemical based assay systems to quantify soluble cytokine levels or demonstrate individual cytokine secreting cells in normal and diseased tissue (Table XIV.5.4). While these immunochemical approaches to cytokine detection offer a number of advantages over bioassay, including both sensitivity and fidelity, there remain a number of limitations. Firstly, the number of sheep cytokines for which they are available is comparatively small, and secondly, their sensitivity, particularly with respect to

Ovine cytokine and cytokine receptor specific monoclonal antibodies

Functional characteristics of ovine cytokine specific monoclonal antibodies a Ovine cytokine

IL-I~ IL-lfl IL-2 TNF-~ IFN-y GM-CSF IL-4 IL-8 IL-10 IL-2R~

Neutralization

In vivo Yes No Yes

In vitro Yes Yes Yes Yes Yes Yes Yes Yes Yes

aUnknown if not indicated.

Western Blot

Immunohistology

FACS

Yes Yes Yes Yes Yes

Yes Yes

Yes Yes

Yes Yes

Yes

Yes Yes

Yes

Yes Yes

Yes

Immunoprecipitation

Immunoassay

Sensitivity (pg/ml)

Yes

Yes Yes Yes Yes Yes Yes

5 5 5000 25O 5 5O

Yes Yes Yes

Yes Yes

5 Yes

9

References

Egan et al. (1994a) Egan et al. (1994a) Martin et al. (1996) Egan et al. (1994b) Rothel et al. (1990) Entrican (1995) Rothel and Seow (1995) Rothel and Seow (1995) Martin et al. (1996) Verhagen et al. (1993); Verhagen et al. (1994)

500


Table XIV.5.50vine cyto,kine and cytokine receptor PCR oligonucleotide sequences Cytokine

IL-I~

Li1fl L-2 L-3 L-4 L-5 L-6 L-7 L-8 L-10 TNF~z

IFN7 GM-CSF G-CSF TGF-fll IL-2R~

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

5'-GCT TCA AGG AGA ATG TGG-3' 5'-GAG AAT CCT CTT CTG ATA C-3' 5',-TAC AGT GAT GAG AAT GAG-3' 5'-TCT CTG TCC TGG AGT l-lG-3' 5'-AAC TCT TGT CTT GCA TTG-3' 5'-GAT GCT I-IG ACA AAA GGT-3' 5'-ATG AGC AGC CTC TCT ATC i-I-G-3' 5'-ATA GTC TCT GCT GCT GCT AAG-3' 5'-GC CAC I-I'C GTC CAT GGA CAC-3' 5'-1-1C CAA GAG GTC TCT CAG CG-3' 5'-A-I-l GAA GAA GTC l-rT CAG GG-3' 5'-ACA CCA AGG AAA ACT TGC AGG TA-3' 5'-GCT TCC AAT CTG GGT TCA-3' 5'-CCA CAA TCA TGG GAG CCG-3' 5'-CCC GCC TCC CGC AGA CCA-3' 5'-TGT GCC CTG TGA AAC TGT-3' 5'-ATG AGT ACA GAA CTT CGA-3' 5'-TCA TGG ATC TTG CI-I CTC-3' 5'-AGC TGT ACC CAC I-I-C CCA-3' 5'-GAA AAC GAT GAC AGC GCC-3' 5'-GGC TCT CCT GTC TCC CGT-3' 5'-G-I-I GGC TAC AAC GTG GGC-3' 5'-ATG GCC AGG GCC CAT I-TT-3' 5'-AFI GAT GGC TI-I- GCG CTG-3' 5'-ATG TGG CTG CAG AAC CTG CTT CTC-3' 5'-CCT CTG GGC TGG TTC CCA GCA GTC-3' 5'-ACC CCC C-I-l- GGC CCT GCC-3' 5'-TCA GGG CTC AGC AAG GTA-3' 5'-ATG CCG CCT TCG GGG C-3' 5'-TCA GCT GCA CI-I GCA GG-3' 5'-ACT AGT CGA CCA ACA AGA GGC TG-3' 5'-CCG CGG ATC CTG AGC TGG GGC TG-3'

the characterization of individual cytokine-secreting cells in tissue or dispersed cell populations, remains questionable. Al:ternative approaches available to researchers are based on detection of cytokine specific mRNA. These approaches include in situ hybridization and Northern blot analysis; however, the most sensitive and widely used technique is PCR analysis. The rapid progress in the molecular characterization of sheep cytokines means that appropriate primer sets are currently available for a wide range of sheep cytokines (Table XIV.5.5).

6.

T-Cell Receptors

T-cell r e c e p t o r g e n e s

All known heterodimers and invariant proteins contributing to the sheep T-cell receptor complex have been cloned and are summarized in Tables XIV.6.1-XIV.6.3.

Fragment size

References

338 bp

Andrews et al. (1991 )

335 bp

Andrews et aL (1991)

436 bp

Seow et al. (1990)

438 bp

Mclnnes et aL (1994a)

302 bp

Seow et al. (1993)

184 bp

Genbank U17052/3

347 bp

Andrews et al. (1993)

347 bp

Barcham et al. (1995)

222 bp

Seow et aL (1994a)

305 bp

Martin et al. (1995)

335 bp

Nash et aL (1991 )

338 bp

Mclnnes et al. (1991)

438 bp


522 bp


1061 bp

Woodall et al. (1994)

661 bp

Verhagen et al. (1992)

S u r f a c e e x p r e s s i o n of C D 3 / T C R proteins

Two CD3 chains of 21 kDa and 23 kDa that are noncovalently associated with the TCR heterodimers have been precipitated from sheep T cells using cross-reactive polyclonal antisera, although the precise identity of the CD3 components was not established (Hein et al., 1989). Sheep CD4 + and CD8 + T cells express a surface TCR0~fl heterodimer which migrates at 85 kDa under nonreducing conditions and resolves into 40 kDa and 50 kDa subunits after reduction (Hein et al., 1989b). The sheep TCR75 heterodimer migrates at 70-75kDa without reduction (Hein et al., 1989b), and, when precipitated by a TCRspecific mAb, resolves into 41-44 kDa and 36 kDa subunits after reduction (Mackay et al., 1989). When anti-CD3 antibodies are used, a presumptive additional TCR7 chain of 55 kDa can also be precipitated (Mackay et al., 1989). The heterogeneous sizes of sheep TCR7 proteins may reflect the diverse primary structure of the constant region genes (see below) or result from differences in posttranslational glycosylation.

T-Cell Receptors TableXlV.6.1

501

Heterodimer constant regions

Locus

Number constant regions

Homology to human/mouse a


References

TCRA TCRB TCRG TCRD

1 2 5 1

62/56 81/78 61/60 68/67

Unknown 4q32-qter Unknown Unknown

Hein etal. (1991) Grossberger et al. (1993); Pearce et al. (1995) Hein et al. (1990); Hein and Dudler (1993a) Hein et al. (1990)

aHomologies are shown as per cent protein identity.

TableXlV.6.2

TableXlV.6.3

Heterodimer variable regions

Locus

D regions

J regions

V regions

References

TCRA TCRB TCRG TCRD

-Several -Several

Multiple Multiple 6 3

multiple multiple .~ 15 ~ 40

Hein et al. (1991) Grossberger et al. (1993) Hein and Dudler (1993a) Hein and Dudler (1993)

Invariant components

Locus

Homology to h uman/mouse a


References

CD3G CD3D CD3E TCRZ

72/65 65/60 54/61 82/72

Unknown Unknown Unknown 1 p 14-p 11

Hein Hein Hein Hein

and and and and

Tunnacliffe Tunnacliffe Tunnacliffe Tunnacliffe

(1990) (1990) (1993) (1993); Ansari et al. (1994)

aHomologies are shown as per cent protein identity.

Table XlV.6.4

Frequency of ~fi and 75 Tcells in different tissues

Tissue

Per cent

Thymus Lymph nodes b Spleen Ileal Peyer's patch c Jejunal Peyer's patch c

96-98 47-58 55-75 80% similarity within and < 70-75% similarity between families (V~ 4/5, 12/13, 20, 21, 23, RF) (reviewed by Kofler et al., 1992).

Table modified from Kofler et aL (1992). aAccording to Strohal et al. (1989) and Kofler and Helmberg (1991). bAccording to Kroemer et al. (1991). c See footnote a, Shefner et al. (1990) and Valiante and Caton (1990). dTwo groups (D'Hoostelaere and Klinman, 1990; Valiante and Caton, 1990) have independently described this family and termed it V,.33 and VK34 respectively. Kofler and Helmberg (1991), have renamed

V~ segment organization. D'Hoostelaere and co-workers (1988) have suggested a V~ gene order based on analyses of known Ig~ recombinant mice and mouse strains with different Ig~ haplotypes (see below and Figure XVI.3.3). Including more recent data (Kofler et al., 1989; D'Hoostelaere and Klinman, 1990; Huppi and D'Hoostelaere, 1991) Kofler et al. propose another map based on the assumption that most V~ gene families reside within individual clusters, since that has been confirmed for the V~21 family (reviewed by Kofler et al., 1992).

J~ and C~ gene segments. The Ig~ complex locus of inbred strains contains only one C~ and five joining gene segments namely JK1 to J~5 (numbering from 5' most J gene segment) located at 3.7 to about 2.5 kb 5' of the C~ region gene (Max et al., 1979; Sakano et al., 1979). J~:3 encodes an amino acid sequence that has never been observed on a ~cchain and it is assumed that JK3 represents a nonfunctional gene segment.

VII

6 5-7

V~33/34. eThis family has also been termed V,-31 by Schlomchik et aL (1990).

al. (1989) using RFLP criteria, the entire V~ germline repertoire would be formed by 160 genes.

Lambda light chain V~. gene germline repertoire. The entire VK repertoire in the germline is not precisely known. According to Kofler et

The low expression of Ig with the 2 isotype in mice has

(a) 3' [Vll-V24-V9-26 I ]Vg"V1 l-V12,13- IV4-V8-V10-V19 l l V28-RN75-6

]-V23-V21-J-C 5'

(b)

3' [V1-V2-V9A-VII-V20-V24/25-V32-VRF ] IV415,V8-V10-V12/13-V22-V19/28 ] IV19/28-V32-V33/34 ]-V23-V21-J-C Figure XMI.3.3 The mouse IgVK locus maps. Two alternative maps are represented according to D'Hoostelaere et al. (1988) (a) and Kofler et al. (1992) (b). The order of V,. families in boxes is unknown.

576

THE MOUSE MODEL

complicated the analysis of 2 chains. Thus, a major part of the knowledge of 2 chains derives from spontaneous myelomas or hybridomas stimulated by antigens known to elicit a 2 response. The 2 gene family found in most laboratory mouse strains is one of the smallest immunoglobulin gene systems (chromosome 16). In contrast to the V~ genes which are represented by several genes, only three V2~functional genes have been found in BALB/c mice (V2ol, V2o2, V~x). Furthermore in contrast to the single mouse C~ gene, four nonallelic mouse C2~genes have been identified, C~1, C22, C2o3 and C~4 respectively. C~1 is the most abundant among 2 L-chains and C23 is the less utilized. The sequence of C2o4 does not contain the termination codons that would necessarily render it nonfunctional (reviewed by Eisen and Reilly, 1985).

V~ gene germline repertoire Each C,~ segment has an associated upstream J,~ segment (about 1.3 kb 5' of the C). The J-C23 and J-C2~1 genes are organized in one cluster about 3 kb apart with the V2~1gene lying about 19kb upstream. A second C2~ cluster lying about 130 kb upstream of the C,~3-1 locus is constituted by J-C,~2 genes and the unexpressed genes J-C~4. This cluster is flanked by two upstream V2o genes, V22 and the rarely used V2x (this last gene presents particular f e a t u r e s - it encodes for a segment that has four additional amino acids in the third hypervariable region). The gene organization explains the common expression of V~2 or V~x with C22 and V21 with C21 or C23 (Figure XVI.3.4) (Storb et al., 1989). The rearrangement of 2 segments takes place within each V~ J2~ C2~ cluster, thereby defining a unit of recombination (Sanchez et al., 1991). These two clusters of J-C genes in mouse appear to arise by duplication of an ancestral v-J-C2x-J-C~y. It should be noted that some wild mice have larger numbers of 2 genes. V~5 gene. A few years ago, a new murine gene, 25, was described (reviewed by Melchers et al., 1993). The 25 gene has extensive homology to mouse 2 genes and it is selectively expressed in pre-B-cell lines (see below). Mice that express low levels of 2 chains. Certain mouse strains, such as SJL, express lower serum levels of 21 chains than those found in most inbred strains like BALB/c or C57BL/6 (reviewed by Selsing and Daitch, 1995). The

[~ 1"

1" ?

)~2(vx) 16% X15%

czl

I

level of 21 molecules is about 50 times lower than the levels observed in BALB/c or C57BL/c. The SJL defect is 21specific since K-Knock-out mice carrying the SJL locus have normal expression at the linked 23 gene. The 21 SJL molecules have a valine at amino acid position 155 instead of a glycine in 21 BALB/c molecules. This substitution results in a KpnI cleavable site in the BALB/c C21 gene which seems to be lost in SJL. Studies on recombinantinbred and random-bred strains have indicated correlation of the C21 KpnI site polymorphism with low 21 serum levels, therefore the Gly-Val polymorphism appears to be directly involved in the low 21 phenotype. The mechanism responsible for the low 21 expression in SJL mice are not completely understood. Because newborn SJL mice have approximately the same number of 21bearing B cells as newborn BALB/c or C57BL/6 mice, the low 21 phenotype at the serum and B-cell levels emerge in the adult SJL mice. The low levels of 21-bearing IgG antibodies in SJL mice are not caused by a defect in the association of SJL 21 chains with H chains since hybridoma 21 chain combines with the 72b heavy chain, suggesting that 21 chains in SJL mice can be associated with H chains other than/~. Models proposed to date are based on an effect of the Gly-Val exchange on the ability of 2 + B cells to be stimulated by antigen binding or on regulation (perhaps by T cells) of 2-producing B cells in SJL and SJL like strains. Some mechanisms unrelated to the Gly-Val exchange may also regulate the low serum levels of 2 chains expressed by some wild mice, since the mice exhibit 21 genes similar to those in BALB/c but do not show the KpnI site polymorphism, suggesting a SJL-like allele. Immunoglobulin gene polymorphisms Although Ig loci have the same set of characteristics among inbred mouse strains, each strain has particular gene segments that encode Ig molecules with specific determinants recognized by specific antisera. These determinants have been termed either allotypes for constant regions or idiotypes roughly correlated with binding specificity. Historically, the study of idiotype expression has revealed the genetic polymorphism of immunoglobulin genes (see for example Tassignon et al., 1993). The entire complex of constant region and variable

F1

3~

c3

r~

c1

1,

1"

)~7% 1"

1"

XI(V2) 15%

1"

Figure XVl.3.4 Organization of the murine 2 locus. Shaded boxes represent pseudogenes. All segments display the same transcriptional orientation. The levels of the most frequent combinations are indicated by lines under the gene segments (modified from Sanchez et aL, 1996).

I m m u nog Io bu li ns

577

Table XVl.3.4 Inbred mouse strains and their Igh-V, Igh-C and IgK haplotypes

9 e for A/J, AL, A/He 9 g for BSVS, SWR, C3H, PL 9 f for CE

Igh-V a Igh-V c Igh-C a IgK b VH1-6-7-5 VH3 VH2 BALB/c SM C58/J DBA/2 DBA/1 Rill PL

a a a c a jo

a b a c g jo

c c d c c a

a a a c a J

a a a c a J

a a a c a J

RF NZB/J AKR CBA/C3H CE BSV9 C57/BL6 SJL A/J A/He AL/N SWR

c d d J f g b b e e g

c n d J f g b b e o p

a b a c 9 c c e c c c

c J J jo f g b b e e g

c J J jo f f b b e e f

c d d jo f g b b e e g

aAccording to Brodeur and

Riblet (1984). b According to Kofler et al. (1989) and D'Hooselaere et al. (1988). CAccording to Riblet et al. (1986) and Kofler et al. (1985).

a for BALB/c, C58/J, Rill, DBA/2, RF, NZB/J, AKR j for CBA/C3H f for CE e for A/J b for C57BL, SJL

The Igh-D locus presents also a polymorphism between mouse strains (Brodeur and Riblet, 1984; Trepicchio and Barrett, 1985): 9 a for BALB/c, Rill, C58/J, NZB/J, AKR 9 c for DBA/2, RF

Table XVI.3.5

Mature B cells remain in a quiescent state until they encounter antigen in an appropriate context. Binding of antigen to Ig molecules on the cell surface of mature B lymphocytes leads to proliferation of clones of antigenspecific lymphocytes and to maturation into effector cells within these clones. It was originally supposed that this phenomenon was mediated only by the binding of antigen to membrane-bound Ig molecules (mIg). A great deal of research has revealed a more complex situation in which B cells can discriminate between simple ligands and those with a more complex nature and in which different surface molecules named co-receptors act negatively or positively on the ongoing B-cell proliferation and differentiation (reviewed by Cambier et al., 1994). BCR structure

region genes is called 'complex locus allele' or 'haplotype'. RFLP and nucleic acid sequence analyses have helped greatly in determining the polymorphism among genes coding for Igs in inbred mouse strains. Table XVI.3.4 illustrates major Igh-V, Igh-C and IgK haplotypes. Solin and Kaartinen (1992) have pointed out the existence of polymorphism at the Igh-J locus also among mice. Briefly, five haplotypes have been described: 9 9 9 9 9

B-cell receptor complex (BCR) structure and co-receptors

Most of mature B cells co-express on their cell surface two Classes of antigen receptors, mlgM and mIgD. During an immune response, class switching occurs and leads to the appearance of memory B-cells that express other classes of mlg (IgG, IgE and IgA). As mentioned above, the small cytoplasmic region of mlg molecules is unable to mediate transducing signals and therefore these mIg molecules constitute only a part of the antigen-receptor complex (BCR). BCRs are noncovalently associated with disulfide-linked Ig~ (CD79a) and Igfi (CD79b) proteins (reviewed by Reth, 1992, 1994; Kim et al., 1993; Pleiman et al., 1994). The symmetry of Ig molecule leads one to assume that each mIg molecule is bound by two Ig0dlg~ heterodimers. These heterodimers are also expressed with Ig-like complex on pre-B cells. The Ig0~-Ig~ proteins are structurally related and are encoded by the Ig superfamily genes mb-1 and B29 respectively. They are glycoproteins containing a single extracellular Ig-like domain, a single transmembrane domain and a cytoplasmic tail. Table XVI.3.5 depicts the

Characteristics of Ig~ and Igfi

Amino acid of Protein

kDa

Amino acids

N-Linked ClIO

Extra cellular part

Transmembrane part

Cytoplasmic part

Isoelectric points

Igc~ (CD79a) Igfi (CD79b)

34 39

220 228

2 3

109 129

22 22

61 48

4.7 3.7

THE MOUSE MODEL

578

major characteristics of murine Ig~-Ig/~. The extracellular domains contain two (Ig~) and three (Ig/3) N-linked glycosylation sites and show all the hallmarks of proteins belonging to the Ig superfamily, such as two conserved cysteine residues forming the intradomain disulfide bond and the conserved tryptophan residue which is important in filling the hydrophobic space inside an Ig domain. The extracellular domains are followed by an extracellular spacer which contains a cysteine residue allowing the disulfide bond between the two proteins. Both transmembrahe parts of Ig~-Ig~ show some similarity to each other (32% identity). The cytoplasmic parts of both proteins are highly conserved between mouse and human proteins (> 90% identity) and contain negatively charged amino acids and are thus acidic proteins. Both cytoplasmic sequences of Ig~ and Ig/3 possess four and two tyrosines respectively. Two tyrosines of Ig~ and both tyrosines of Igfl belong to a conserved motif found in other receptor complex such as TCR and Fc receptors and are named either ITAM (immunoreceptor tyrosine-based activation motif) or YxxL motif. Such motifs link the receptor to protein tyrosine kinases (PTKs) such as Syk and the Scr family members Fyn, Lyn, Blk and Btk. These PTKs act in concert with cytoplasmic and membrane bound phosphatases (reviewed by Goldman and De Franco, 1994; Pleiman et al., 1994; Sefton and Taddie, 1994; Satterthwaite and Witte, 1996). The transmembrane region of mlg molecules contains polar amino acids which play an important role in the binding of Ig~-Ig~ heterodimer (William et al., 1990). The extracellular Ig-domain of Ig~ and Igfl may also play a role in binding the mIgM molecules (reviewed by Reth, 1992). The BCR complex can therefore be compartmentalized into two distinct receptors subunits, the ligand-binding portion which is a tetrameric complex of Ig H chains and L chains and the surface Ig (sIg)-associated proteins which form the transducer unit of the BCR. The mIg-associated proteins may play a role in transporting mlg, since most mlg molecules migrate to the cell surface when they are assembled with the Ig~-Ig/3 heterodimer, although exceptions have been found to mIgD and mIgG (Williams et al., 1993, 1994; Weiser et al., 1994). The Ig~/Ig~ heterodimer also plays an important role in internalization of the BCR and transport to intracellular compartments where antigen processing takes place (Patel and Neuberger, 1993). The Ig~-Ig~ heterodimer is also a critical signal mediator of the pre-B-cell receptor and its expression is required for allelic exclusion and during B-cell development to establish the peripheral pool of mature B-cells (Papavasiliou et al., 1995a,b; Gong and Nussenzweig, 1996; Torres et al., 1996). Although Ig~ and Igfl are clearly the most readily detectable mlg-associated proteins, Cambier and coworkers (1994) identified an Ig7 protein encoded by a second B29 gene. Ig7 protein is identical in structure to Ig~ but has a truncated cytoplasmic tail (by approximately

30 residues) leading to alteration of the ITAM motif (Friedrich et al., 1993). It can be used instead of Igfi in low-density splenic B cells and bone marrow cells (Cambier et al., 1994). Recently, Reth's group described a new family of nonglycosylated proteins associated with murine BCR named BAPs (BCR associated proteins). Two of these proteins (BAP32 and BAP37) are specifically associated with IgM BCR (Terashima et al., 1994), while two others (BAP29 and BAP31) bind preferentially to the IgD BCR (Kim et al., 1994; Adachi et al., 1996). BAP proteins bind specifically to mIg molecules in the transmembrane region which displays differences between mlg molecules. These BAP proteins may contribute to functional differences between IgM and IgD receptors and may represent the missing link between the BCR and the cytoskeleton (Kim and Reth, 1995a,b). Other potential functions of these BAP proteins are discussed by Adachi et al. (1996). Co-receptors As in T cells, the response of B cells to antigen can be modified by co-receptor molecules which can be divided into two subgroups. One includes co-receptors that participate nonspecifically in antigen recognition and act together with the BCR. At least three accessory membrane groups of proteins CD19-CD21-CD81-Leu13 complex, CD22 and FcTRIIb-1 have been described as modulating Bcell activation through mIg molecules (reviewed by Doody et al., 1996). These molecules may recruit crucial signal transduction molecules into receptor complexes that may amplify the magnitude of the signal transduction cascade. They may also improve the overall avidity of antigen-BCR interaction and reduce the threshold of antigen required for signaling, which could be important under circumstances when antigen titers are limiting. The Fc receptors downregulate the proliferation and maturation of B cells. Other subgroup is referred to co-receptors that mediate the interaction between antigen-activated B cell and antigen specific helper T cell (CD40-CD40L, CD80/ CD86-CD28/CTLA-4) (reviewed by Hathcock and Hodes, 1996; Clark et al., 1996). Co-receptors acting, with BCR CD19 is a surface C D 1 9 - C D 2 1 - C D 8 1 - L e u 1 3 complex. glycoprotein of 95kDa which belongs to the Ig superfamily and is expressed from the early stages of B cell development until the plasma cell stage. CD19 extracellular region contains two C2-type Ig-like domains separated by a smaller potentially disulfide-linked domain. CD19 cytoplasmic region has around 240 amino acids. CD21 (CR2, complement receptor 2) is a 145kDa glycoprotein member of the complement receptor family present on the B-cell lineage. CD21 is expressed on mature B cells and is rapidly lost following B-cell activation. CD21 is the B-cell receptor for the iC2b, C3dg and C3d fragments of the third component of complement. The CD21

Im m u nog Iobuli ns

extracellular region is formed by 15 or 16 repeating 60-70 amino acid structural elements named short consensus repeats (SCRs); the cytoplasmic domain has 34 amino acids. CD19 and CD21 are noncovalently associated to form a multimolecular signal transduction complex on the B-cell surface. They are associated with other cell-surface proteins such as CD81 (TAPA-I) and Leu-13. CD81 is a 26 kDa protein expressed by a wide variety of cell types, including different lymphocyte lineages such as natural killer cells, thymocytes, eosinophils and B cells. The CD81 protein has a particular feature in the sense that C- and Nterminal ends are located within the cytoplasm, leading to a major portion of the protein exposed to the extracellular environment. Leu-13 is a 16kDa cell surface protein expressed on leukocyte subsets. Biological functions of this complex have been reviewed by Fearon and Carter (1995), Tedder et al. (1994) and Kehrl et al. (1994). Briefly, antigens with bound C3 fragments strongly enhance B-cell activation, particularly at lower antigen doses by the co-engagement of BCR and the CD19-CD21-CD81-Leu-13 complex (Dempsey et al., 1996). This view is supported by two independent studies of CD19-deficient mice (Engel et al., 1995; Rickert et al., 1995). CD22. CD22 is a 135kDa phosphoglycoprotein belonging to the Ig gene superfamily and expressed on mature IgM § § cells (reviewed by Law et al., 1994). During B-cell activation CD22 surface expression is increased but it is downregulated as B cells differentiate into plasma cells. Crosslinking of BCR induces a rapid phosphorylation of CD22 cytoplasmic tyrosines and thus CD22 can mediate signal transduction in B cells. Various in vitro experiments using antibodies to CD22 suggest two opposite roles of CD22. In some cases, the presence of CD22 increases signals delivered from BCR, in other cases CD22 inhibits these signals. A recent study demonstrates that splenic B cells from mice with a disrupted CD22 gene are hyper-reactive to receptor signaling, which suggests that CD22 is a negative regulator of BCR signaling. CD22 on mature B cells may serve to raise the antigen concentration threshold required for B-cell triggering (O'Keefe et al., 1996). CD22 is also an adhesion molecule through its lectin like-specificity which may restrict B-cell activation in secondary lymphoid organs to T-cell areas which provide necessary signals to B cells (reviewed by Doody et al., 1996). Fc receptors. In contrast to the positive effect on B-cell activation of antigen-bound C3 fragments, antigen bound to antibody induces negative signals to B cells. Antigenantibody complexes can bring together the BCR and the FcTRIIb on B cells. FcyRIIb is a 40 kDa member of the Ig superfamily which is preferentially expressed on B cells. It is compose d of two Ig-like domains, a single transmembrahe region and a cytoplasmic tail (reviewed by Ravetch

579

and Kinet, 1991; Fridman, 1993; Hulett and Hogarth, 1994). The inhibition effect mediated by the Fc receptor is dependent on a intracytoplasmic 13 amino acid motif containing a single tyrosine residue that mediates the negative modulation of mlg signaling by FcTRIIb (Muta et al., 1994). This single tyrosine becomes phosphorylated upon co-crosslinking of mIg and FcTRIIb. This motif is called ITIM (immunoreceptor tyrosine-based inhibitory motif). Recent experiments using mice in which the gene for this Fc receptor has been disrupted suggest a role for FcTRIIB in regulating the serum level of antibody in vivo (Takai et al., 1996). Co-receptors implicated in B - T cell interaction Antibody responses to antigens are heterogeneous with respect to signals required. Some responses are dependent on the presence of mature T helper cells whereas others are not. These distinct requirements depend on the properties of antigen such as physical structure and are referred to as T-dependent or T-independent antigens. Antibody responses to soluble protein antigens require direct contact between antigen-specific B cells and Thelper cells that mediate crucial signals in both partners for the outcome of the response. Additional signals derived from T-helper cytokines are also necessary to achieve Bcell proliferation and differentiation. This phenomenon can be divided in two steps: first, signaling via BCR, and then signaling triggered by MHC plus peptide. Surface BCRs with bound antigen are rapidly internalized and are delivered to processing compartments in which peptides are generated and are bound to MHC class II molecules (reviewed by Lanzavecchia, 1996 and references therein). MHC-bound peptides are expressed on the surface of B cells. Regulatory mechanisms involved in this process are still being investigated (Patel and Neuberger, 1993; Mitchell et al., 1995). The recognition of the peptide bound to MHC by T-cell receptors allows the cognate interaction between T-helper cells and B lymphocytes. CD4 molecules, which can bind to monomorphic parts of MHC, act as coreceptors. This recognition leads to the upregulation of CD40 ligand (gp39) expression on T cells and its sequential interaction with CD40 on B cells. The CD40-CD40L interaction leads to the upregulation of the glycoproteins B7-1 (CD80) and B72 (CD86) on the B cells. T-cell activation is fully achieved by the binding of CD28/CTLA-4 to B7-1/B7-2 on B cells. Lymphokine production and secretion (IL-2, IL-4, IL-5, etc.) are induced in T cells and these lymphokines are bound to lymphokine receptors on B cells. Activated B cells can, therefore, proliferate and differentiate in effector cells such as antibody-producing cells. Generation of memory B-cells requires additional conditions, as reviewed by MacLennan (1994) and Gray et al. (1996). Activation o f B cells with T-independent antigens T-independent antigens are subdivided into two categories based on their ability to elicit an antibody response in mice

THE MOUSE MODEL

580

bearing the xid mutation (X-linked immunodeficiency). Tindependent antigens that do or do not elicit antibody responses in xid mice was referred to as T-independent type I antigens or T-independent type II antigens, respectively (Mosier and Subbarao, 1982). Unresponsiveness of xid mice to T-independent type II antigens is linked to mutations of the BtK tyrosine kinase (Rawlings et al., 1993; Kerner et al., 1995; Khan et al., 1995). Most T-independent type I antigens are components of bacterial cell walls (LPS). They are directly mitogenic for murine B cells, irrespective of antigen specificity and induce polyclonal antibody production. Such antigens have the apparent capacity to replace T-helper cell requirements for B-cell activation. B cells may be activated by the crosslinking of putative LPS receptors (reviewed in Ulevitch and Tobias, 1995). T-independent type II antigens are typically repeating polymers such as polysaccharide antigens (dextran, ficoll, etc.). The extensive surface Ig crosslinking by repetitive determinants of such antigens may trigger signal transduction in B cells (reviewed by Mond et al., 1995). Recent data obtained by Torres et al. (1996) supports this view. Genetically altered mice in which the ITAM motifs in the Ig~ subunit of the BCR were inactivated were unable to respond to a T-independent polysaccharide antigen.

B-cell ontogeny and Ig repertoire expression During the embryonic life, B cells are made in both liver and spleen. Shortly after birth, bone marrow becomes the primary site for de novo production of B cells throughout life. B-lymphocyte development from the earliest progenitors which have all Ig genes in germline configuration to the mature Ig-secreting plasma cells is characterized by various stages. The earliest stages are thought to be either antigen independent or dependent on some unknown self-antigens. The remaining stages in B-cell development (mature resting B cells and memory cells) are antigen sensitive. Antigen-dependent stages coincide with the occurrence of Ig receptors. Establishment of V gene repertoire Progenitor (pro) B cells which, on the basis of surface marker expression, clearly belong to the B lineage must have all Ig genes in germline configuration. Precursor (pre) B cells which have Ig gene loci at various stages of gene rearrangements can be divided into different subsets characterized by the expression of surface markers, intracytoplasmic markers and by growth properties as depicted in Table XVI.3.6. The primary immunoglobulin repertoire results from somatic recombination of gene segments encoding variable region of H and L chains, the pairing of variable region genes and junctional diversity (addition or deletion of nucleotides during recombination process). After immun-

ization, this repertoire is further expanded by somatic mutations taking place inside germinal centers (secondary antibody repertoire). Taking into account all variable gene segments encoding H and L chains, approximately 107 different immunoglobulins can be created. The junctional diversity increases this number to be greater than 109. Immunoglobulin gene rearrangement in B cells is highly regulated since various steps of rearrangement are required to have a functional gene encoding either heavy or light chains. As shown in Table XVI.3.6, the IgH locus rearrange first. H-chain gene assembly begins with the rearrangement of D gene segment to J gene segment (in both alleles), followed by the rearrangement of the V gene segment to the pre-assembled D-J segment (in only one allele). Transcripts issued from the VH promoters that encode the VH, D, JH and CH gene segments are differentially spliced and give rise to both the membrane bound and the secreted form of/l chain. The productive rearrangement of one allele prevents gene recombination on the second allele (allelic exclusion) and induces positive signal to trigger the rearrangement of Ig-L chains. The choice for a/c L-chain or 2 L-chain is discussed below. V(D)J recombination

All functional germline Ig-V region gene segments are flanked by conserved recombination signal sequences (RSS) which consist of a conserved heptamer and an A-T rich nonamer separated by either 12 or 23 bp spacer sequences (Tonegawa, 1983). The V(D)J recombination appears to be initiated by the recognition and the binding of RSSs by the enzymatic recombinase machinery (reviewed by Lewis, 1994). Recombination apparently occurs only between one sequence with a 12bp spacer and another sequence with a 23 bp spacer, a requirement referred to as the 12 + 23 rule. This rule prevents recombinations between two V or two J gene segments. Both strands of the DNA segments are cleaved at the border of the two heptamers. These two are later joined together without modification. The two V gene segment ends that form the coding joints are released together to create hairpin loops. The features of coding joints are complex. A variable number of bases are deleted by an exonuclease activity (to date no specific exonuclease has been definitively identified) from the ends of coding regions (opening of hairpin loops), nongermline nucleotides (N regions) are added in a coding joint by the terminal deoxynucleotide transferase (TdT) and, less frequently, extra bases interpreted as P nucleotides are added. P nucleotides are nucleotides joined to the end of an undeleted coding sequence to form a palindrome (hence P) with that sequence end. The length of P nucleotides is generally around 1 or 2 bp (Lafaille et al., 1989). The resulting ends are ligated together by a DNA polymerase leading to the complete recombination event. TdT catalyzes the addition of nucleotides into the 3' end of DNA strands and, particularly since no template specificity determines the nucleotides added, the enzyme

Table XV1.3.6

Phenotypic changes during B-cell development

Anatomical sites

Bone marrow

Bone marrow periphery

Periphery

Early Pro-B

Intermediate Pro-B

Late Pro-B/ large Pre-B

Small Pre-B

Immature B

Mature B

-

A PrePro B B Pro B C Pro B

C'

D Pre B

Immature B E

Mature B F

Pre-BI

Large Pre-BII

Small Pre-BII

Immature B

Mature B

C

Status of Ig gene rearrangements Heavy chain

germline

DJ

VDJ

VDJ

VDJ

VDJ

Light chain

germline

germline

germline

germline + VJ

VJ

VJ

surrogate H chain/ surrogate L chain (SL)

DJCp protein (RflI)/SL

Surface phenotype lg like complexes:

lntermediate

High

Low

-

High

lntracytoplasmic markers Tdt a RAG1/RAG2 Growth properties on stromal cells and IL-7 in vitro Sites according to: A, Osmond (1986); 6,Hardy eta/. (1991b); C , Melchers etal. (1994) aTerminaldeoxynucleotidyl transferase. b~ccording to Grawunder et a/. (1995).

582

adds dG residues preferentially (Desiderio et al., 1984; Landau et al., 1987; Lieber et al., 1988). Heavy chains frequently contain more N regions than light chains, probably because the activity of TdT decrease as the B cells progress to the H and L chain recombination. The enzymatic recombinase machinery contributes greatly to generate diversity in the CDR3 of immunoglobulins since the CDR3 is generated by the joining of three gene segments (V-(D)-J) (reviewed by van Dyck and Meek 1992). Proteins participating in V(D)J recombination. A few years ago, two genes, RAG1 and R A G 2 (recombinase activating genes), were identified as key genes in the recombination process (Oettinger et al., 1990; Mombaerts et al., 1992; Shinkai et al., 1992). They are not homologous to each other and are conserved in human, mouse and chicken. They are expressed together in pre-B and pre-T cells. Both genes are required for the recombination activity since mouse strains in which RAG genes have been turned off, fail to develop mature B and T cells (reviewed by Spanopoulou, 1996). These data support the view that RAG proteins are critical for V(D)J recombination. Recently, two independent studies have described mechanisms that underlie DNA recognition by the RAG1/RAG-2 proteins at the initial stages of V(D)J recombination (Difilippantonio et al., 1996; Spanopoulou et al., 1996). RAG-1 recognizes the nonamer and this interaction is stabilized by an additional interaction with the heptamer. Binding of RAG-2 is dependent upon the presence of RAG-1 and is more efficient with a 12-bp spacer than with a 23-bp spacer. The interaction between RAG-1 and RAG2 (the nature of this interaction remains unknown) are required to form a cleavage-competent complex. The cleavage reaction depends on the presence of functional heptamer motif. Therefore one site of the RSS (nonamer) functions as high-affinity DNA-binding region that anchors the protein on the DNA, while the other (heptamer) is the site of cleavage. Allelic exclusion and regulation of Ig gene rearrangement. Each B cell expresses only one VH and one V~ region and thus a single antigen-binding site despite the two homologous chromosomal loci for H and L chain genes. This phenomenon is called allelic exclusion (reviewed by Rajwesky, 1996). Two general models have been proposed to explain allelic exclusion. The stochastic model is based on the observation of a high frequency of defective rearranged genes as an indication that functional rearrangements are rare. Consequently, the allelic exclusion would result from the low probability that two rare events take place in the same cell (Coleclough et al., 1981). An alternative to the stochastic model is the 'regulated model' (Alt et al., 1980). A functional rearrangement of one H- or L-chain gene in a B cell would inhibit further Hor L-chain gene rearrangement on the second allele in the

THE MOUSE MODEL

same B cell. In the case of an unproductive rearrangement, no inhibitory effect could prevent B cell from continuing recombination until a productive rearrangement is performed. A large range of distinct experiments supports the regulated model. We will mainly discuss novel investigations based on the introduction of transgenes into the genome of whole mice or mice in which Ig genes have been inactivated by targeted mutation (see also Karasuyama et al., 1996). In transgenic mice carrying a transgenic functionally rearranged/~ gene, the rearrangement of endogenous Ig genes is markedly suppressed (Weaver et al., 1985). Endogenous IgH recombination is abolished with a transgene encoding the membrane form of/~ rather than the secreted form (Nussenzweig et al., 1987; Manz et al., 1988; Picarella et al., 1991). Experiments with mice presenting a disruption of the/~ membrane exon supports the conclusion that a membrane form of /, chain is required to mediate allelic exclusion (Kitamura and Rajewsky, 1992). Interestingly, Iglesias et al. (1987) have shown that a transgene is able to inhibit endogenous V(D)J recombination. Regulation o f Ig gene rearrangements. The rearrangement of the H chain genes appears to be a prerequisite to the activation of the rearrangement of tc genes that occurs before the 2 gene recombination (ordered model) (Reth et al, 1985). ~c-Expressing cells without H chain gene recombination have never been observed. Reth et al (1987) have shown the activation of VK in pre-B cells transfected with a vector expressing C~,. The membrane form of/~ chain is the only effective mediator to activate the ~c rearrangement. According to the regulated model, if the first ~c rearrangement is unproductive, the second allele can proceed to another rearrangement. As soon as a productive ~c chain appears, other K rearrangements are suppressed. Allelic exclusion at the ~c locus level is supported by experiments on transgenic mice carrying a functional rearrangement tc transgene. B cells that express the ~c transgene with an endogenous H chain have their endogenous ~c genes in germline configuration (Ritchie et al., 1984). In the ordered model, the/~ chain expression represents a key point in the development and triggering of rearrangements at IgH locus (allelic exclusion) and the initiation of rearrangements at the L-chain loci. The discovery that B-cell progenitors can express on their membrane a complex formed by a surrogate light chain with a/2 chain (pBCR) has made sense of the ordered model (reviewed by Rajewsky, 1996; see Surrogate Light Chain and pBCR, below). Isotype exclusion. Isotype exclusion phenomenon leads B cells to express only one L-chain allele despite the presence of two alleles at both ~c and 2 loci. Moreover, only one of the three 2 isotypes is mainly expressed in 2producing cells. For most B cells, the choice of L chain expressed is determined during pre-B stage development.

Immunoglobulins

583

Two major contrasting models have been proposed to Fetal/neonatal V gene repertoires versus adult V gene explain how differentiating B cells are committed to repertoire either/c or 2 gene expression. The first is the stochastic model assuming that both/c and 2 genes are activated for Fetal, neonatal and adult bone marrow VH gene reperrecombination concurrently during pre-B-cell develop- toires appear biased towards JH proximal VH gene families ment and that L-chain isotype expression is determined since an over-representation of VH 7183 (VHS) and VH Q52 (VH2) has been shown (Yancopoulos et al., 1984; by the relative frequencies of forming either functional/c genes or 2 genes. The second model is based on an Perlmutter et al., 1985; Jeong and Teale, 1988; Malynn et ordered hierarchy of L-chain gene recombination in al., 1990). The functional significance of nonrandom VH which /c genes are recombined first. In cells that fail to 7183 usage in mouse ontogeny remains enigmatic. Moreproduce a functional /c gene, 2 gene recombinations are over Igs from fetal and newborn mice display very restricted junctional diversity. Some D segments (DFL16.2 activated. The stochastic model is supported by the observed and all DSP2 gene segments) are underexpressed and correlation between the proportions of/c and 2 chains in others are overexpressed (DFL16.1 and DQ52 gene segthe serum and the relative number of V~ and V~ genes ments). The germline-derived D segments are shorter and present in the germline. This correlation appears compat- there is a lack of N regions related to lower TdT activity ible with the idea that the number of B cells committed to (reviewed by Feeney, 1992). either /c or 2 production reflects the relative number of In peripheral B cells, the VH gene families are expressed genes that potentially can be recombined. The stochastic in more stochastic fashion and expressed VH gene pattern model would predict only a single L-chain gene recombi- roughly corresponds to the complexity of VH families nation event either /c or 2 genes. Although mouse K- (Dildrop et al., 1985; Wu and Paige, 1986; Schulze and producing cells frequently exhibit one recombined allele Kelsoe, 1987; Yancopoulos et al., 1988). Some authors and the others in germline configuration, 2-producing have reported differences in VH usage between murine cells often have /c alleles that have recombined. These strains (Jeong et al., 1988; Yancopoulos et al., 1988). Some observations are consistent with the ordered model for L- data suggest that the usage of the VH gene family in the chain gene recombination. Nevertheless, the stochastic adult reflects selection mechanisms (Gu et al., 1991; model can be accepted by assuming that the rate of gene Coutinho et al., 1992; Grandien et al., 1994). The exact recombination differ for the tc and 2 gene families rules of this selection are unknown but a functional BCR is (Ramsdem and Wu, 1991). Studies of A-MulV-trans- required (Torres et al., 1996). These rules could involve formed pre-B cells (Abelson murine leukemia virus) interactions with self-antigen and/or idiotype-antiidiotype support the ordered model because many pre-B-cell lines interactions (reviewed by Urbain et al., 1992; Kearney, recombine ~c genes but not 2 genes (Reth et al., 1985). 1993; Ryelandt et al., 1995). As reviewed by Rajewsky The mechanism of such apparent regulation of the 2 gene (1996) most bone marrow B-cell precursors are destined to rearrangement by the ~c locus is unknown. Recently, data die. Only 3% of immature B-cells generated in the bone obtained from different types of tc Knock-out mice (dele- marrow appear to reach the mature long-lived peripheral tion or disruption of either J~ or C~ or intronic ~c B-cell pool. This observation could explain why the Ig repertoire expressed in the peripheral B cells differs from enhancer region) suggest that even if the recombination of ~c genes is not required to activate the 2 locus, it could that expressed in the pre- and immature B cells in the bone help the recombination of 2 genes (reviewed by Sanchez marrow. Primary and secondary Ig repertoires are also shaped by tolerance phenomenon (reviewed by Klinman, et al., 1996). At this stage in our knowledge, the picture of L-chain 1996a). Ig-transgenic mice have been useful in the identifigene recombination appears to represent a blend of the cation of major parameters of B-cell tolerance induction original stochastic and ordered models. (reviewed by Goodnow, 1995; Carsetti et al., 1995). In bone marrow, B cells expressing autoreactive antibodies are negatively selected. Depending on their affinity for antigen, autoreactive B cells may be rescued in bone Factors participating in the development o f B-cell lineage Factors which contribute throughout B-cell differentiation marrow by further immunoglobulin rearrangement process and signals that trigger genetic rearrangement of V (receptor editing; reviewed by Melchers et aI., 1995; genes are not fully understood. The bone marrow micro- Nemazee, 1993; Radic and Weigert, 1994). In contrast to VH family expression in mouse ontogeny, environment, especially stromal cells, may provide differentiation signals for B cells. Some proliferation factors expression of V,~ families does not reflect positional bias such as IL-7 produced by bone marrow stromal cells, IL-3, for J-proximal families. The relative few studies on V~ c-kit-ligand and flt3-1igand are known to be required for gene usage are somewhat contradictory since one group the proliferation of pro- and pre-B cells in vitro (Billips et report a preferential usage of V~ families located in the al., 1992; Galli et al., 1994; Rosenberg and Kincade, 1994; middle of V~ locus (V~I, V~8 and V~9) without a correlaHirayama et al., 1995; von Freeden-Jeffry et al., 1995; tion with the complexity of the family (Kaushick et al., 1989) and another one observes a bias for V~4/5 and V~10 Winkler et al., 1995).

584

and reduction of V~I in functional early B cells (reviewed by Teale and Medina, 1992). In the adult functional repertoire, some groups report nonstoichiometric V~ family usage (Kaushick et al., 1989; Teale and Morris, 1989), while others fa.vor a more randomized expression pattern (Kalied and Brodeur, 1991). B-ceU repertoire in species Although in all vertebrates the genes encoding antibody variable regions are assembled during B-cell development through a process of site-specific recombination, species have selected different cellular and molecular strategies to create diversity in Ig repertoire. In the chicken, the unique functional Vi and VH are assembled with corresponding joining gene-segments in all B-cell progenitors and thus, all cells initially express the same or similar antibodies. Diversity is generated by a gene conversion process which occurs during intensive proliferation of B cells (reviewed by Reynaud et al., 1994). Rabbits use the same strategy at least for the IgH locus (Knight and Crane, 1994). In the sheep, diverse V and J gene segments (less than in mice) are assembled but these rearrangements are further diversified by hypermutation mechanism without influence of external antigens (Reynaud et al., 1995). In mice and humans, B-cell generation begins in embryonic life in the para-aortic tissues, liver and spleen. After birth, it takes place in the bone marrow, where it continues throughout life. The situation is strikingly different in chicken and sheep. B-cell progenitors which arise early in ontogeny and have already undergone Ig gene rearrangements, colonize particular organs where the generation of diversity takes place. These organs are the bursa of Fabricius in the chicken and the ileal Peyer's patches (IPP) in the sheep. In both species, the building of B-cell repertoire starts during the embryonic development and continues for only a few weeks or months after birth (reviewed by Weill and Reynaud, 1995).

Surrogate light chain and pBCR Gene and protein structure Expression of Ig/i heavy chains on the surface of pre-B cell that do not make light chains has intrigued immunologists. Melchers and colleagues have identified on chromosome 16 a gene that has striking sequence similarity to the J and C regions of the 2 locus (reviewed by Melchers, 1994; Rolink et al., 1996; Karasuyama et al., 1996). Because four murine CA genes were already known, they named it 25. This gene is formed by three exons: the 3' end of exon 1 presents sequence homologies to J~, the intron between exons 2 and 3, exon 3 itself and the 3' untranslated region of the 25 gene show high homology to C2 sequences (Melchers et al., 1993). The use of a probe constructed with flanking regions of

THE MOUSE MODEL

the genomic 25 clone in pre-B cell mRNA has allowed identification of another transcribed segment located about 4.5 Kb 5' of 25. This latter region exhibited similarities to both V~ and V~ and it was consequently named Vpre-B. The mouse genome contains two nearly identical Vpre-B genes named Vpre-BI and Vpre-BII. The nucleotide sequences of Vpre-BIi is 97% identical to Vpre-BI. The Vpre-B genes are pliced in two exons. The first exon and the intron preceding exon 2 show high sequence homologies to V2~ genes. The 5' part of exon 2 shows weak homologies to V~ V~ and VH. The Vpre-B gene encodes a polypeptide (co) of 142 amino acids, including a signal peptide of 19 residues, while the 25 gene codes for a polypeptide (l) of 209 amino acids, including a signal peptide of 30 residues. The two Vpre-B proteins are different in four amino acids. Recently, an additional Vpre-B gene (called Vpre-B3 was isolated from a mouse pre-B cell line. The gene encodes a glycosylated protein of 123 amino acids. Somatic recombination between 25 and Vpre-B genes has not been found in B and pre-B cells, although these genes have no apparent defects that would prevent their expressions as proteins. They have typical consensus splice sites and initiation and termination codons. Therefore, it has been proposed that Vpre-B and 25 proteins could associate with each other to form a light-chain-like structure now termed the surrogate light-chain (SL). Data from Tsubata and Reth (1990) based on gene transfection experiments have shown that surface /IH chains are covalently linked to co protein while 1 protein is noncovalently associated. Each Vpre-B gene can participate to surrogate light chain in pre-B cell lines. Expression of surrogate light chain in B cell development According to Melchers and colleagues the surrogate light chain can be found covalently associated with the gp130/ gp65 of the surrogate H chain complex on pro- and pre-BI cells, the DHJHC,, proteins on pre-BI cells, which have DHJH rearrangements in reading frame II (RflI), and with /IH chains expressed in pre-BII cells. Structure of these preB cells receptors is described by Melchers et al. (1993). Iglike complexes are associated with Ig~ and Igfi. Table XVI.3.6 illustrates the different stages of B-cell development in murine bone marrow. Potential functions of/IH chain-SL complex are well documented although they are still not fully understood (see below). B-cell development in mice carrying a deficient 25 gene Studies of mice in which the 25 gene has been inactivated by targeted mutation (25T) have been of great interest in understanding potential functions of SL chain in B-cell development (Kitamura et al., 1992). The pro/pre-BI compartment has practically normal size in these mice. As in normal mice, this particular population of B cells decreases with age. In vitro these pro/pre-BI cells present

Immunoglobulins the same properties as normal pro/pre-BI cells as reviewed by Rolink et al. (1996). These observations led the authors to propose that the SL was not essential for the formation of a pro/pre-BI compartment. The most striking observation in these 25T mice is the dramatic reduction of the pre-BII cell compartment with productive VHDJH rearrangements (20-fold), suggesting a major role of the SL in the selection and amplification of the pre-BII cells expressing membrane-bound/2H chains. Consequent to this defect, the immature and mature B cell compartments are small in 25T during the first 3 months of life. Later, mature B-cells gradually accumulate in the periphery. Despite such narrow B-cell compartments, 25T mice are able to develop immune responses against Tdependent and T-independent antigens. SL-/~H-chain complexes could signal pre-BII cells to proliferate in order to constitute rapidly the peripheral B-cell compartment. In contrast to normal mice, 25T mice have a high proportion of peripheral B cells that use rfll rearranged D-J alleles. This observation leads the authors to suggest that SL-DHJHC~ protein complexes could induce deletion and/or could prevent the expansion of B cells using rflI rearrangement D-J alleles on pre-B cells.

Functions of/2H chains'SL complex pre-BCR Studies of 25 knock-out mice suggest that the SL plays an important role in B-cell development. Karasuyama et al. (1996) have summarized data which define the possible functional roles ascribed to the SL in B-cell differentiation. We present here the major points:

9 in bone marrow, pre-B cell II that have a productive rearrangement of /2 heavy-chain are selectively expanded by signals delivered through pre-BCR formed by SL-/2H chains and Ig~-Igfi heterodimers; 9 pre-BCR appears to participate in signaling allelic exclusion in the heavy-chain locus; 9 the complex DHJHC~ proteins with the SL appears to block the differentiation of pre-B cells which have rearranged the H-chain gene loci in RflI; 9 The role of pre-BCR in promoting the light-chain gene rearrangement is still controversial since some experiments (Tsubata et al., 1992) conclude to the necessity of a functional pre-BCR to have light-chain gene rearrangements and others (reviewed by Karasuyama et al., 1996) demonstrate that neither/2 heavy-chain nor SL is prerequisite for the rearrangement of light-chain loci. The authors propose that the membrane-bound /2 heavy-chains, possibly in association with SL could only facilitate the rearrangement of light-chain genes; 9 The possible functions of SL complexes with gpl30/ gp65 are still unknown.

585 B-cell subsets (and lineages) and natural antibodies B lymphocytes can now be subdivided into subsets with distinct properties. A subpopulation of B cells which is numerically small in adults bears the pan-T cell glycoprotein Ly-I (CD5). These cells are distinctive from the I g D + + L y l - conventional B cells by surface phenotype (IgM++/IgDl~176 anatomical localization (in spleen of neonates and in the peritoneal cavity in adult), early appearance in ontogeny, secretion of natural antibodies and certain autoreactive antibodies, extensive capacity for self-renewal and increased frequency in autoimmune mouse strains such as NZB and motheaten. These cells have been renamed B1 cells and conventional B cells, B2. Some B cells are similar in many respects to CD5+B cells (phenotype and localization) but lack Ly-1/CD5 marker. They are named sister population or B-lb cells in contrast to B-la cells which express the CD5 surface marker. Many observations support the hypothesis that B1 cells derive from a separate lineage. Fewer B l-a cells are generated from adult bone marrow when compared with early B-cell progenitor sources such as fetal liver, bone marrow from young mice. The fetal omentum is a powerful source of B l-a and B l-b cells (reviewed by Hardy and Hayakawa, 1994; Solvason et al., 1991; Herzenberg et al., 1992; Kantor and Herzenberg, 1993; Marcos et al., 1994). CD5 B cells express an Ig repertoire distinct from that of conventional B cells (Tornberg and Holmberg, 1995) and a highly skewed V-gene repertoire toward the production of antibodies reactive with self antigen such as DNA, bromelian-treated mouse red blood cells (VH11 and VH12 families in context with V~9b and a V~20 gene respectively) (Hardy, 1991). The occurrence of different B-cell subsets is also of importance when considering the function and origin of normal immunoglobulins or natural antibodies (production of antibodies without intentional immunization or exposure to any environmental antigen). It is often assumed that natural antibodies represent the constitutive synthesis or leakage of small amounts of immunoglobulins by all B lymphocytes. This has never been proven but natural antibodies certainly contain IgG immunoglobulins secreted by memory B lymphocytes. Recent data indicate that a significant fraction of normal immunoglobulins (IgM and IgG) is synthesized by CD5 + B lymphocytes. These antibodies were found to be polyreactive and sticky and can act as a first-line defense against bacteria, viruses and parasites. It has also been shown that B1 lymphocytes do not participate in most T-dependent immune response but can be induced by thymus-independent polymers, such as polysaccharides. For the B-2 or conventional B-cell subset, it has not been established whether there is a single lineage giving rise to primary or secondary immune responses or whether there are separate precursors for primary and secondary

THE MOUSE MODEL

586

repertoires already present prior to antigen arrival (reviewed by Klinman, 1996b).

4.

Cellular Immunology

The CD markers Acknowledgements

The Laboratory of Animal Physiology is supported by grants from Belgian State and from Fonds National de la Recherche Scientifique. We are grateful to Dr A. van Acker for the critical reading of the manuscript and to M. Henneghien for invaluable help with computer problems.

Table XVl.4.1 CD CDla CDlb CDlc CD2 CD2R CD3 CD4 CD5 CD6 CD7 CD8 CD9 CD10 CD 11 a CD11 b CD11 c CDW12 CD 13 CD14 CD15 CD16 CDwl 7 CD18 CD19 CD20 CD21 CD22 CD23 CD24 CD25 CD26 CD27 CD28 CD29 CD30 CD31 CDw32

The CD nomenclature is an internationally recognized system for naming the cell surface molecules expressed on lymphocytes which are recognized by monoclonal antibodies; CD refers to 'cluster of differentiation'. Their nomenclature, the cells which express each antigen protein recognize and their function, when known, are listed in Table XVI.4.1.

Nomenclature of CD markers

Function

LFA-3 R TCR sub-unit MHC II R CD72 R

MHCIR

T

B

Thc Thc Thc X XX X S X S S S

S S S

CALLA LFA- 1(c% CR3(c% C R4(~) Amino- peptidase LPS ligand ELAM R FcTR III Ceramide CD11fl

FcsR II

VLA/~ PECAM FcyR II

X S

pre-B pre-B X X X X

X X X mat

XX XX S S X XX

X

Ma

G

PI

Dc

Stc

X X X X X X X X X X X X

X

X

X X X X X X X X X X X

X

CL

CF D

X mat XX X XX X XX X XX X X

Mo

X CL DC

X

Ion channel CR2

IL-2 R

S S

NK

XX

E

XX

X

X X

X

X

X

X

X X

X

X

(continued)

Cellular Immunology

587

Table XVl.4.1

CD CD33 CD34 CD35 CD36 CD37 CD38 CD39 CD40 CD41 CD42a CD42b CD43 CD44 CD45

(Continued)

Function

T

B

NK

Mo

Ma

G

PI

Dc

X CR1 X Thc XX

X X mat prec

S

mat x

Stc X X

X X

X X

X

Fdc Fdc X X X

Sialine Common leukocyte Ag(CLA) CLA isoform CLA isoform CLA isoform MCP

CD45RA CD45RB CD45RO CD46 CD47 CD48 CDw49b VLA~2 CDw49d VLAc~4 CD49f VLA~6 CDw50 CD51 Vitronectin R~ CDw52 CD53 CD54 ICAM -1 CD55 DAF CD56 NCAM CD57 CD58 LFA3 CD59 TAP protectin CDw60 CD61 Vitronectin R/~ CD62 P-selectin CD63 CD64 FcTRI CDw65 CD66 CD67 CD68 CD69 CDw70 CD71 Transferrin R CD72 CD5 R CD73 Ecto-5' nucleotidase CD74 CDw75 c~2,6sialyltransferase CD76 CD77 CD7w78

X X X S X S X X X X X X X X X X X X S X X S

X X

X X

X X X X X X X X

X X X X X X X

X X X X X X

X X X X X X X X X X

S X X

X

XX XX XX

XX XX XX X

X X X

X X

X X X

X X X X X X X X

X X X X X X X

X X X X X X X

X X X X X X

X X X X X X

X X X X X X

X X

X X

X X

X X X

X

X

X X

X X

X X

X X X X X X

X X

X X

X X X X

X X X X X

X XX

X X

XX

X

X

S S S

X mat mat X X

X

T = T lymphocytes; B = B lymphocytes; NK = NK cells; Mo = monocytes; Ma = macrophages; G = granulocytes; PI = platelets; Dc = dendritic cells; Lc = Langerhans cells; Stc = stem cells. X = present; XX = activated cells; S = subpopulation; Thc = thymocyte; mat = mature; Fdc = follicular dendritic cell; E = eosinophil.

588

THE MOUSE MODEL

Cytokines

Cytokines are a group of signalling molecules involved in the communication between cells including those of the immune system. Cytokine-mediated events occur during the initiation and effector stages of immune responses and the development of hematopoietic cells. An important

aspect of cytokine activity is that they frequently work together to produce effects, rendering their activity difficult to describe. In this section, the emphasis is on the nomenclature, cellular source and cellular targets of the best characterized mouse cytokines which have been cloned and which influence cells of the immune systems. These properties are summarized in Table XVI.4.2.

Table XVI.4.2

Nomenclature, source and cellular effects of mouse cytokines

Cytokine

Acronym Alternative title

Cellular source

Cellular target

Interferon-~

IFN-~

Leukocytes

Many cells

Interferon-/~

IFN-fi

Fibroblasts and epithelial cells

Many cells

Interferon-7

IFN-7

T cells, NK cells

Macrophages, Tcells, B cells, NK cells

Interleukin lc~/ IL-I~/ Interleukin 1/~ IL-1/~

Lymphocyte-activating factor (LAF); B-cell activating factor (BAF); mononuclear cell factor (MCF)

Macrophages, endothelial cells, LGL, T and B cells, fibroblasts, epithelial cells, astrocytes, keratinocytes, osteoblasts

Thymocytes, neutrophils, hepatocytes, chondrocytes, muscle cells, endothelial cells, osteocytes, epidermal cells, macrophages, Tcells, B cells, fibroblasts

Interleukin 2

IL-2

T-cell growth factor (TCGF)

T cells

Tcells, B cells, macrophages

Interleukin 3

IL-3

Multi-potential colony stimulating factor (multi-CSF); mast-cell growth factor (MCGF); hematopoietic cell growth factor (HPGF)

Tcells, mast cells

Multipotential stem cells, mast cells

Interleukin 4

IL-4

B-cell stimulating factor (BSF1); T-cell growth factor.II (TCGF-II); B-cell growth factor II (BCGF-II); mast-cell growth factor II (MCGF-II)

Tcells, mast cells, bone marrow stromal cells

T cells, B cells, mast cells, macrophages, hematopoietic progenitors

Interleukin 5

IL-5

T-cell replacing factor (TRF); B- Tcells cell growth factor II (BCGF-II); eosinophil differentiation factor (EDF)

Interleukin 6

IL-6

B-cell stimulation factor 2 (BSF-2); B-cell differentiation factor (BCDF); hepatocyte stimulating factor (HSF)

Interleukin 7

IL-7

Pre-B-cell differentiation factor Thymic stromal cells

Interleukin 8

IL-8

Monocyte-derived neutrophil chemotactic factor (MDNCF); neutrophil activating protein (NAP)

Monocytes, endothelial cells, epithelial cells, fibroblasts, chondrocytes, hepatocytes, keratinocytes, synoviocytes

Neutrophils, Tcells, basophils

Interleukin 9

IL-9

Mast-cell growth factor (MCGF); T-cell growth factor (TGF)

T cells

CD4 § T cells, mast cells

Interleukin 10

IL-10

B-cell derived thymocyte growth factor (B-TCGF); cytokine synthesis inhibiting factor (CSIF)

T cells (-FH2and TH0), macrophages, B cells

Macrophages, mast cells, NK cells

Fibroblasts, macrophages, endothelial cells

Eosinophils, B cells

B cells, T cells, thymocytes, hepatocytes

Pro- and pre-B cells, thymocytes, activated mature T cells

(continued)

Murine Models of Immunodeficiency

Table XVl.4.2

589

(Continued)

Cytokine

Acronym Alternative title

Cellular source

Cellular target

Interleukin 11

IL-11

Stromal cells

Hematopoietic progenitor cells

Interleukin 12

IL-12

Tcells, B lymphoblasts

Tcells, NK cells, LAK cells

Natural killer cell stimulating factor (NKSF); cytotoxic lymphocyte maturation factor (CLMF)

GM-CSF Colony stimulating factor ~, 2 Tcells, endothelial cells, Granulocyte(CSF-~, 2) fibroblasts, macrophages, macrophage colony mast cells stimulating factor

Multipotential stem cells, mature neutrophils and monocytes/macrophages

Macrophage colony M-CSF stimulating factor

Colony stimulating factor 1 (CSF-1)

Fibroblasts, monocytes, endothelial cells

Multipotential stem cells, monocytes/macrophages

Granulocyte colony G-CSF stimulating factor

Colony stimulating factor #

Macrophages, fibroblasts, endothelial cells, mesothelial cells, T cells

Multipotential stem cells, granulocytes

Tumour necrosis factor

TNF

Cachectin, tumour necrosis factor

Macrophages, T cells, Tumour cells, tumour cell thymocytes, B cells, NK cells lines, neutrophils, osteoclasts, fibroblasts, macrophages, adipocytes, eosinophils, endothelial cells, chondrocytes, hepatocytes

Lymphotoxin

LT

Tumour necrosis factor #

Tcells

Tumour cells, tumour cell lines, neutrophiols, osteoclasts

Transforming growth factor #

TGF-#

Platelets, activated macrophages, T cells, hepatocytes, thymocytes

Endothelial cells, Tcells, B cells, keratinocytes, hepatocytes, fibroblasts, hematopoietic cells, osteoblasts

i

(CSF-fi)


This is a brief overview of murine models of immunodeficiency. Such models offer a double interest: first, some are very close or identical to immunodeficiency syndromes affecting humans or other animal species and can therefore be considered as disease models for the development of new treatments (including gene therapy); second, the phenotype of these immunodeficient mice often gives precious insight into more fundamental aspects of the immune system. This review addresses this double perspective. Three types of models are considered here: (1) immunodeficiency caused by spontaneous mutations; (2) immunodeficiency caused by genetic manipulations; (3) acquired immunodeficiency due to nongenetic factors (Table

xvi.5.1) The search for the genes involved in naturally mutant strains such as nude or scid is fundamental because it often reveals unexpected interactions between nonimmune genes and various aspects of the immune responses. For example, the gene responsible for the nude phenotype was

recently identified as a transcription factor controlling proliferation and differentiation of epithelial cells (Brissette et al., 1996). The analysis of genetically engineered animals often derives from a different intellectual process. On a theoretical basis, a candidate gene is proposed and the animal is genetically modified to confirm or refute the hypothesis. Table XVl.5.1

Different types of immunodeficient mice

Spontaneously occurring mutant strains Genetically modified strains 9Knock outs 9Transgenic 9Dominant negative mutations Acquired immunodeficiency 9 Thymectomy 9 Retroviral infection 9Ionizing radiation 9Immunosuppressants 9Alkylating agents 9AIIoimmune stimulation

Table XV1.5.2

Genetic mechanisms involved in immunodeficiency in murine inbred mice

Name, chromosome, transmission

References

Gene involved and mechanism

Phenotype

Nude (nulnu), chromosome 11,AR

Brissette eta/. (1996)

Winged-helix nude gene (whn) transcription factor expressed in hair, skin and thymus, controls balance between proliferation and differentiation.

Hairless, absence of thymus, T-cell lymphopenia, increased activity of NK cells and macrophages

Beige (bglbg), chromosome 13, AR

Burkhardt eta/. (1993), Fukai eta/. (1996), Nagle et a/. (1996)

Mutation specifically affects late endosomes and lysosomes; murine (bg) and human gene (CHS) show homology for yeast vacuolar sorting protein

Abnormal color of fur, impaired natural resistance to viral infections, defect of neutrophils and NK cells, proposed model for human Chediak-Higashi (CH) disease

SClD (scidlscid), chromosome 13, AR

Kirchgessner eta/. (1995), Blunt eta/. (1995), Wiler et a/. (1995)

DNA-dependent kinase (p450), recruits RAG-1, RAG-2, and is involved in V(D)J recombination.

Severe combined immunodeficiency,T-cell and B-cell lymphopenia, hypogammaglobulinemia,proposed model for equine severe combined immunodeficiency

Xid, X chromosome, X-linked

Fukuda eta/. (1996)

Bruton tyrosine kinase (btk) Reduced IP4-binding capacity

Lack of CD5' B cells, impaired immune responses to thymo-independent antigens (pneumococcal polysaccharides),proposed model for human X-linked agammaglobulinemia

Motheaten (melme), chromosome 6, AR

Tsui eta/. (1993), Lorenz et a/. (1996)

Protein tyrosine phosphatase SHTP1. Hyperactivation of src-family tyrosine-kinases

Fatal immunodeficiency, thymic aplasia, autoimmunity (lupus-like syndrome)

Wasted (wsvwst), chromosome 2, AR

Abbot et a/. (1994), Woloschak eta/. (1996)

Gene unknown, increased frequency of apoptosis in thymus and spleen, faulty DNA repair, increased sensibility to ionizing radiation

Tremor, ataxia, thymic and splenic atrophy, death around fourth week of life

Alymphoplasia (alylaly), chromosome 11, AR

Miyawaki eta/. (1994), Koike et a/. (1996)

Unknown

Deficiency in the systemic lymph nodes and Peyer's patches, absence of marginal zone, defective affinity maturation and lg class switching, autoimmune exocrinopathy. Proposed model for Sjogren disease

Generalized lymphoproliferativedisease (gld/gld)

Nagata and Suda (1995)

Fas ligand Impaired apoptosis

Lymphoproliferativedisease, autoimmunity, immunodeficiency

Lymphoproliferation(Iprllpr)

Nagata and Suda (1995)

Fas (CD95) lmpaired apoptosis

Lymphoproliferativedisease, autoimmunity, immunodeficiency


Three different types of genetically modified animals can be distinguished (Table XVI.5.1): (1) transgenic mice with an increased, constitutive expression of a given protein at a chosen site; (2) 'knockout' animals with a targeted disruption of a given gene; (3) animals with 'dominant negative mutations' which express abnormal, inhibitory proteins as transgenes. Mice expressing a transgene coding for a normal murine protein do not usually develop immunodeficiency. In contrast, several autoirnmune or inflammatory phenomena have been described in mice expressing increased amounts of a given cytokine in a target organ. For example, transgenic mice expressing interleukin-4 in the lung develop lymphocytic and eosinophilic inflammation of the trachea and bronchi (Rankin et al., 1996) and mice constitutively expressing interleukin-2 in the Langerhans islets develop autoimmune diabetes (Elliot and Flavell, 1994). The vast majority of genetically induced immunodeficiencies result from the targeted disruption of a gene of which product is involved at various levels of the immune responses. Caution is advised in the analysis of the phenotype of these animals. First, since the knockout is congenital, the development of the immune system is often profoundly modified, therefore it can be difficult to determine whether a given gene product is directly involved in an adult phenotype or if the abnormal adult phenotype is secondary to a more global immaturity of the immune system. Second, compensation mechanisms sometimes attenuate the impact of a given knockout of a phenotype. Although it may have an important role in physiological situations, a given gene may be knocked out without major impact on the immune responses because redundant genes can compensate and maintain an immunocompetent phenotype. Using this principle, mice with dominant negative mutations have been designed (reviewed by Perlmutter and Alberola-Ila, 1996). These mice express transgenes

Table XVI.5.3

591

which encode for abnormal, catalytically inactive proteins which inhibit a given pathway, even in the presence of multiple, redundant signals. Dominant negative mutations of certain genes have illustrated striking immune defects while the corresponding knockouts failed to induce immunodeficiency. For example, mice with a targeted disruption of N-Ras have a grossly normal phenotype while expression of dominant-negative Ras is associated with abnormal T-cell development and function (Swan et al., 1995). Another related concept is the development of mice expressing a viral transgene, with potential immunosuppressive properties. For example, HIV-1 TAT transgenic mice have defective proliferative and cytotoxic response and an increased secretion of interleukin-10 (Garza et al., 1996). Spectacular progress has recently been made in the elucidation of the genetic mechanisms responsible for immunodeficiency in several murine inbred strains (Table XVI.5.2). In a few cases, similar mutations have been demonstrated to be responsible for immunodeficiency syndromes in humans or other animal species. The gene of which mutation is responsible for the beige phenotype is similar to the gene involved in human Chediak-Higashi disease (Nagle et al., 1996). A deficiency of subunit p450 of a DNA-dependent kinase inhibits V(D)J recombination is responsible for a severe combined immunodeficiency in mice and in horses. The mechanism responsible for Xlinked agammaglobulinemia involves Bruton tyrosine kinase in mice as in humans. In both cases, the mutation is associated with a loss of binding capacity for a metabolite of the inositol phosphate pathway (Table XVI.5.2). More than 1000 articles have been published on targeted gene disruption and the potential impact on immune responses. It is therefore impossible to be exhaustive in the description of these knockout mice. Different categories of knockouts are presented together with a few examples inside each category (Tables XVI.5.3 and XVI.5.4). In view of the crucial role played by protein

Examples of knock-out mice with significant impact on immunocompetence

Cytokines Interleukin 2 (IL-2): mild immunodeficiency, inflammatory bowel disease (KQndig et aL, 1993) Interleukin 7 (IL-7): severe lymphopenia (B cells and T cells) (von Freeden-Jeffry et al., 1995) TNF-fi (lymphotoxin): lack of lymph nodes, undifferentiated spleen, hypogammaglobulinaemia, defective Ig switch (De Togni et aL, 1994) IFN-7: increased proliferative responses to lectins or MLC, impaired expression of MHC class II products, reduced NK cell activity, increased secretion of TH2 cytokines, impaired generation of reactive oxygen products, increased susceptibility to infection by intracellular bacteria (i.e. Mycobacterium) (Dalton et aL, 1993) Cytokine receptors Common cytokine (IL-2, -4, -7, -9, -15) receptor 7 chain: severe combined immunodeficiency involving T cells, B cells and NK cells (Cao et aL, 1995; DiSanto et aL, 1995). Murine model for human (Noguchi, 1993) and canine (Henthorn et aL, 1994) X-linked severe combined immunodeficiency Type I (IFN-c~, -fl, -~)interferon receptor: increased susceptibility to viral infection (lymphochoriomeningitis virus, Semliki Forest virus, Theiler's virus) (reviewed in van den Broek, et aL, 1995) Type II (IFN-7) interferon receptor: phenotype grossly similar to IFN-7 - / - mice, increased susceptibility to infection by parasites (i.e. leishmania) and intracellular bacteria (i.e. mycobacterium) (van den Broek et aL, 1995). (continued)

592

Table XVl.5.3

THE MOUSE MODEL

(Continued)

T-cell membrane coreceptors CD4: mild immunodeficiency, normal development of CD8 + T cells and cytotoxic responses, partial inhibition of TH responses (Rahemtulla et aL, 1991) CD8 (c~chain): absence of peripheral CD8+ T cells, inhibition of class I-restricted responses, normal CD4 responses, increased susceptibility to lymphochoriomeningitis virus infection (Fung-Leung et aL, 1991) CD40 ligand: impaired TH-dependent activation of B cells" normal activation of T cells (Oxenius et aL, 1996). Possible model for human X-linked immunodeficiency with IgM CD28: normal thymocyte development, normal number of peripheral T cells, reduced secretion of IL-2, although initial response normal, failure to sustain a proliferation after polyclonal or antigen-specific stimulation (Shahinian et aL, 1993) B-ceil receptor (BCR)

JR (segment of the heavy chain locus): absence of peripheral B cells, absence of slg § B cells in the bone marrow, normal T cells and T-cell responses (Chen et aL, 1993)

B-ceil coreceptors CD40: impaired TH-dependent activation of B cells; normal activation of T cells (Oxenius et aL, 1996) CD43 (leukosialin, sialophorin)" increased proliferative responses, increased homotypic adhesion, reduced viral clearance, possible model for Wiskott-Aldrich disease (Manjunath et aL, 1995) Integrins CD18 (/~ chain of the/~2 integrins LFA-1, Mac-1 and p150, 95): impaired inflammatory responses, allograft rejection, and leukocyte migration (Wilson et aL, 1993). Possible model for human leukocyte adhesion deficiency (LAD) type 1 ICAM-I" phenotype similar to CD18 - / - , in addition decreased contact hypersensitivity, increased resistance to septic shock induced by LPS (Sligh et al., 1993; Xu et aL, 1994) Major histocompatibility products, antigen processing and presentation /~2-Microglobulin: phenotype similar to CD8~ knock-out mice, absence of CTL responses, increased susceptibility to viral infection I-A/~ (MHC class-II): phenotype grossly similar to CD4 - / - mice; some CD4 ~~ T cells in LN; impaired TH responses and decreased levels of IgG1 (Cosgrove, 1991). Possible model for human congenital immunodeficiency caused by defective MHC class II molecules TAP-l" phenotype grossly similar to CD8 - / - mice, impaired expression of class I molecules (van Kaer et aL, 1992) CD3 chains CD3 (r/: normal transition from DN to DP, reduced number of thymocytes, reduced expression of TCR, association of TCR with FceRI 7 chain on IEL TCR chains TCR~: normal expansion of DP cells in thymus, absence of SP thymocytes, absence of ~/~ T cells, normal level of 75 T cells, B cells and NK cells, impaired humoral responses to T cell-dependent antigens, absence of allograft rejection (Mombaerts et al., 1992a) TCR/~: small thymus, defect in the expansion of DP cells, absence of c~/~T cells, normal level of 75 T cells, B cells and NK cells, impaired humoral responses to T ceil-dependent antigens, absence of allograft rejection (Mombaerts et aL, 1992a) TCR&" normal thymocyte development, absence of 76 T cells, normal humoral responses, normal level of ~/~ T cells, B cells and NK cells, normal allograft rejection (Itohara et aL, 1993) Transcription factors IRF-1 (interferon regulatory factor-I): strongly decreased number of peripheral CD8 § T cells, impaired IFN-~ and IFN-/~ secretion after certain stimuli, increased susceptibility to viral infection (Matsuyama et aL, 1993) NF-AT: lymphoproliferative disease, striking impairment of early IL-4 secretion, minor defect in IL-2 secretion (Hodge et aL, 1995). Human immunodeficiency due to mutated NF-AT gene is associated with strongly decreased IL-2 secretion bcl-3 (member of the I• B family): normal development, severe defects in humoral response, susceptibility to infection with Listeria monocytogenes and Streptococcus pneumoniae, absence of germinal centers in the spleen (Schwartz et aL, 1997) CREB: impaired thymocyte activation and IL-3 secretion (Bart.on et aL, 1996) Cytotoxic process Perforin: normal development of the immune system, normal activation of CD8 § T cells" failure to eliminate viral infection (Walsh et aL, 1994) .... Proteins involved in V(D)J recombination RAG-1 and RAG-2: absent B cells and T cells (T-B-); thymocyte maturation arrested at early DN stage (Mombaerts et aL, 1992b; Shinkai et aL, 1992) Ku86: combined immunodeficiency caused by defective V(D)J recombination (Zhu et aL, 1996) Terminal deoxynucleotidyl transferase (TdT): persistence of a fetal antigen receptor repertoire DNA synthesis Adenosine deaminase: total deficiency is lethal, partial deficiency induces lymphopenia and mild immunodeficiency (Blackburn et aL, 1996) (proposed murine model for human ADAdeficiency)

Table XV1.5.4

Genetically modified strains with abnormalities of TCR- and cytokine receptor-associated signaling pathways Ontogeny

T cells

B cells

Early block of thymocyte differentiation arrested transition from DN to DP cells (Molina eta/., 1992)

T-cell lymphopenia, slight inhibition of proliferative responses to TCR crosslinking, impaired cytotoxic activity

Normal responses to T-independent antigens

Grossly normal thymocyte differentiation, reduced proliferation of thymocytes (Appleby etal., 1992; Stein etal., 1992)

Normal proliferative responses


ZAP-70 (proposed model for human immunodeficiency due to ZAP-70 defect; Arpaia etal., 1994)

Major defects in thymocyte differentiation, failure to generate SP CD4' and CD8' thymocytes. Altered negative selection (Chan et a/., 1994)

Refractory to mitogenic stimuli


S Y ~

Normal thymocyte differentiation

Normal proliferative responses

Profound abnormalities of B cell development (block at the pro-B stage) (Cheng et a/., 1995)

Itk (analog of Btk)

Decreased number of SP CD4' thymocytes

Reduced proliferative responses, increased by rlL-2


Small sized thymus but differentiation grossly normal. Increased CD4/CD8 ratio

Tcell lymphopenia, absent IEL and NK cells. lncreased CD4/CD8 ratio in the spleen with anergic CD4 Tcells. Absent lymph nodes increased susceptibility to viral infection, lack of response to IFN-x and IFN-7, normal response to other cytokines (Durbin etal., 1996; Meraz et a/., 1996)

B cell lymphopenia, block at the pro-B stage

Gene involved Antigen receptor signaling Ick

Cytokine receptor signaling JAK3 (proposed model for human autosomal severe combined immunodeficiency) STAT-1


594

kinases in regulating T-cell differentiation and activation processes, Table XVI.5.4 specifically overviews recent findings concerning the phenotype of mice with targeted disruption of protein tyrosine kinase genes. Many of these knockouts are models for human or animal immunodeficiencies. For example, mice with targeted disruption of the gene encoding for the gamma chain of the common cytokine receptor present a severe combined immunodeficiency syndrome similar to human and canine SCID and mice with a knockout of JAK3 gene are similar to the autosomal form of human scid. Interestingly, despite the similarity of the gene involved, the phenotype is sometimes different in the murine model and in human disease. Humans with mutated ZAP-70 kinase present a severe T-cell defect with a lack of mature CD8 § T cells, however CD4 § T cells are present in the peripheral lymphoid, suggesting that another protein tyrosine kinase (i.e. syk) compensates the gene defect (Arpaia et al., 1994). In constrast, mice with a targeted disruption of the ZAP-70 gene develop a defect involving CD8 + and CD4 § T-cells (Chan et al., 1994). Models of murine acquired immunodeficiency have become less relevant since the development of genetically engineered strains. Surgical (neonatal thymectomy), physical (ionizing radiation) or pharmacological suppression of the immune system (alkylating agents, cyclosporinA, corticosteroids) will not be discussed in this chapter. Infection of susceptible strains of mice with the Duplan strain of murine leukemia viruses (MuLV) induces a syndrome, termed murine acquired immune deficiency syndrome (AIDS) (MAIDS) which includes a striking lymphoproliferative disease, T-cell and B-cell immunodeficiency and the late development of B-cell lymphomas (Mistry and Duplan, 1973; Mosier et al., 1985). A defective retrovirus is responsible for the disease and infects mostly B cells and not T cells (Huang et al., 1991). Nevertheless, T cells present striking functional defects such as impaired calcium fluxes in response to mitogens or ionophores (Moutschen et al., 1996) and are strictly required to sustain the lymphoproliferative process. MAIDS is clearly very different from human immunodeficiency virus (HIV) infection and should rather be considered as a model for ubiquitous immune defects as observed in lymphoproliferative or malignant states. SCID mice, grafted with human or feline (Johnson et al., 1995) hematopoietic cells can develop an immune system which can be used as a model for species specific infectious diseases. The efficiency of the grafting process can be increased in SCID-transgenic mice expressing the genes for human cytokines such as interleukin-3 and granulocyte/macrophage-colony stimulating factor (GMCSF) (Bock et al., 1995). Such SCID-HU mice can be infected with the HIV virus (Mosier et al., 1985) and provide useful information about the pathogenesis of HIV infection in a small animal model. Because of the recent identification of HIV coreceptors, a powerful approach could be the development of double transgenic

THE MOUSE M O D E L

mice expressing human CD4 and various chemokine receptors (i.e. CC-CR5). Chronic alloimmune stimulation can also induce an immunodeficiency syndrome which bears some similarity to human AIDS. Allogeneic pregnancies followed by chronic immunization of the offspring with paternal lymphocytes induces lymphoproliferation, CD4 § T cell lymphopenia, Kaposi-like sarcomas and B-cell lymphomas (Tergrigorov et al., 1997).

6.

References

Abott, C., Malas, S., Pilz, A., Pate, L., Ali, R., Peters, J. (1994). Linkage mapping around the ragged (Ra) and wasted (wst) loci on distal mouse chromosome 2. Genomics 20, 94-98. Adachi, T., Schamel, W. W. A., Kim, K. M., Watanabe, T., Becker, B., Nielsen, J., Reth, M. (1996). The specificity of association of the IgD molecule with the accessory proteins BAP31/BAP29 lies in the IgD transmembrane sequence. EMBO J. 15, 1534-1541. Alt, F. W., Anea, V., Bothwell, A. L., Baltimore, D. (1980). Activity of multiple light chain genes in murine myeloma cells producing a single, functional light chain. Cell 21, 1-12. Alt, F. W., Blackwell, T., Yancopoulous, G. (1987). Development of the primary antibody repertoire. Science 238, 1079-1087. Appleby, M. W., Gross, J. A., Cooke, M. P., Levin, S. D., Qian, X., Perlmutter, R. M. (1992). Defective T cell receptor signaling in mice lacking the thymic isoform of p59fyn. Cell 70, 751-763. Arpaia, E., Shahar, M., Dadi, H., Cohen, A., Roifman, C. M. (1994). Defective T cell receptor signaling and CD8 + thymic selection in humans lacking ZAP-70 kinase. Cell 76, 947-958. Barton, K., Muthusamy, N., Chanyangam, M., Fischer, C., Clendenin, C., Leiden, J. M. (1996). Defective thymocyte proliferation and IL-2 production in transgenic mice expressing a dominant-negative form of CREB. Nature 379, 81-85. Billips, L. G., Petitte, D., Dorshkind, K., Narayanan, R., Chia, C.-P., Landreth, K. S. (1992). Differential roles of stromal cells, interleukine-7 and kit-ligand in the regulation of B lymphopoiesis. Blood 79, 1185-1192. Blackburn, M. R., Datta, S. K., Wakamiya, M., Vartabedian, B. S., Kellems, R. E. (1996). Metabolic and immunologic consequences of limited adenosine deaminase expression in mice. J. Biol. Chem. 271, 15203-15210. Blankenstein, T., Bonhomme, E., Krawinkel, U. (1987). Evolution of pseudogenes in the immunoglobulin VH-gene family on the mouse. Immunogenetics 26, 237-248. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A., Jackson, S. P. (1995). Defective DNAdependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine acid mutation. Cell 80, 813-823. Bock, T. A., Orlic, D., Dunbar, C. E., Broxmeyer, H. E., Bodine, D. M. (1995). Improved engraftment of human hematopoietic cells in severe combined immunodeficient (SCID) mice carrying human cytokine transgenes. J. Exp. Med. 182, 2037-2043. Brissette, J. L., Li, J., Kamimura, J., Lee, D., Dotto, G. P. (1996).

References

The product of the mouse nude locus, Whn, regulates the balance between epithelial cell growth and differentiation. Genes Dev. 17, 2212-2221. Brodeur, P. H., Riblet, R. (1984). The immunoglobulin heavy chain variable region (Igh-V) locus in the mouse. I. One hundred Igh-V gene comprise seven families of homologous genes. Eur. J. Immunol. 14, 922-930. Brodeur, P. H., Osman, G. E., Mackle, J. J., Lalor, T. M. (1988). The organization of the mouse Igh-V locus. J. Exp. Med. 168, 2261-2278. Burkhardt, J. K., Wiebel, F. A., Hester, S., Argon, Y. (1993). The giant organelles in beige and Chediak-Higashi fibroblasts are derived from late endosomes and mature lysosomes. J. Exp. Med. 178, 1845-1856. Cambier, J. C., pleiman, C. M., Clark, M. R. (1994). Signal transduction by the B cell antigen receptor and its coreceptors. Annu. Rev. Immunol. 12, 457-486. Cao, X., Shores, E. W., Hu-Li, J., Anver, M. R., Kelsall, B. L., Russel, S. M., Drago, J., Noguchi, M., Grinberg, A., Bloom, E. T. (1995). Defective lymphoid development in mice lacking expression of the common cytokine receptor 7 chain. Immunity 2, 223-228. Carayannopoulos, L., Capra, D. (1993). Immunoglobulins, structure and function. In Fundamental Immunology (ed. Paul, W. E.), pp. 283-314. Raven Press Ltd, New York, USA. Carsetti, R., Kohler, G., Lamers, M. C. (1995). Transitional B cells are the target of negative selection in the B cell compartment. J. Exp. Med. 181, 2129-2140. Chan, A. C., Van Oers, N. S. C., Tran, A., Turka, L., Law, C.-L., Ryan, J. C., Clark, E. A., Weiss, A. (1994). Differential expression of ZAP-70 and Syk protein tyrosine kinases, and the role of this family of protein tyrosine kinases in TCR signaling. J. Immunol. 152, 4758-4766. Chen, J., Trounstine, M., Alt, F. W., Young, F., Kurahara, C., Loring, J. F., Huszar, D. (1993). Immunoglobulin gene rearrangement in B cell deficient mice generated by targeted deletion of the JH locus. Int. Immunol. 5,647-656. Cheng, A. M., Rowley, B., Pao, W., Hayday, A., Bolen, J. B., Pawson, T. (1995). Syk tyrosine kinase required for mouse viability and B-cell development. Nature 378,303-306. Clark, L. B., Foy, T. M., Noelle, R. J. (1996). CD40 and its ligand. Adv. Immunol. 63, 43-78. Coleclough, C., Perry, R. P., Karjalainen, K., Weigert, M. (1981). Aberrant rearrangements contribute significantly to allelic exclusion of immunoglobulin gene expression. Nature 290, 372-378. Colle, J. H., Le Moal, M. A., Truffa-Bachi, P. (1990). Immunological memory. Critical Rev. Immunol. 10, 259-306. Cosgrove, D., Gray, D., Dierich, A., Kaufman, J., LeMeur, M., Benoist, C., Mathis, D. (1991). Mice lacking MHC class II molecules. Cell 66, 1051. Coutinho, A., Freitas, A. A., Holmberg, D., Grandien, A. (1992). Expression and selection of murine antibody repertoires. Int. Rev. Immunol. 8, 173-187. Dalton, D. K., Pitts-Meek, S., Keshav, S., Figari, I. S., Bradley, A., Stewart, T. A. (1993). Multiple defects of immune cell function in mice with disrupted interferon-gamma genes. Science 259, 1739. D'Hoostelaere, L. A., Klinman, D. (1990). Characterization of a new mouse VK group. J. Immunol. 145, 1706. D'Hoostelaere, L. A., Huppi, K., Mock, B., Mallett, C., Potter, M. (1988). The Igk L chain allelic groups among the Igk

595

haplotypes and Igk crossover populations suggest a gene order. J. Immunol. 141,652-661. Dempsey, P. W., Allison, M. E. D., Akkaraju, S., Goodnow, C. C., Fearon, D. T. (1996). C3D of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271,348-350. Desiderio, S. V., Yancopoulos, G. D., Paskind, M., Thomas, E., Boss, M. A., Landau, N., Alt, F. W., Baltimore, D. (1984). Insertion of N-regions into heavy chain genes is correlated with the expression of terminal deoxytransferase in B cells. Nature 311,752-755. De Togni, P., Goellner, J., Ruddle, N. H., Streeter, P. R., Flick, A., Mariathasan, S., Smith, S. C., Carlson, R., Shornick, L. P., Strauss-Schoenberger, J., Russel, L. P., Karr, R., Chaplin, D. D. (1994). Abnormal development of peripheral lymphoid organs in mice deficient in lymphotoxin. Science 264,703-707. Difilippantonio, M. J., McMahan, C. J., Eastman, Q. M., Spanopoulou, E., Schatz, D. G. (1996). RAG1 mediates signal sequence recognition and recruitment of RAG2 in V(D)J recombination. Cell 87, 253-262. Dildrop, R., Krawinkel, U., Winter, E., Rajewsky, K. (1985). VH gene expression in murine lipopolysaccharide blasts distributes over the nine known VH-gene groups and may be random. Eur. J. Immunol. 15, 1154-1156. DiSanto, J. p., Mtiller, W., Guy-Grand, D., Fischer, A., Rajewski, K. (1995). Lymphoid development in mice with a targeted deletion of the interleukin 2 receptor chain. Proc. Natl Acad. Sci. USA 92, 377-381. Doody, G. M., Dempsey, P. W., Fearon, D. T. (1996). Activation of B lymphocytes. Integration signals from CD19, CD22 and FCTRIIbl. Cur. Opin. Immunol. 8,378-382. Durbin, J. E., Hackenmiller, R., Simon, M. C., Levy, D. E. (1996). Targeted disruption of the mouse Stat-1 gene results in compromised innate immunity to viral disease. Cell 84, 443450. Dzierzak, E. A., Janeway, C. A. Jr, Richard, N., Bothwell, A. (1986). Molecular characterization of antibodies bearing Id460. I. The structure of two highly homologous VH genes used to produce idiotype positive immunoglobulins. J. lmmunol. 136, 1864-1870. Eisen, H. N., Reilly, E. B. (1985). Lambda chains and genes in inbred mice. Annu. Rev. Immunol. 3,337-365. Elliot, E. A., Flavell, R. A. (1994). Transgenic mice expressing constitutive levels of IL-2 in islet beta cells develop diabetes. Int. Immunol. 6, 1629-1637. Engel, P., Zhou, L.-J., Ord, D. C., Sato, S., Koller, B., Leder, J. F. (1995). Abnormal B lymphocyte development, activation and differentiation in mice that lack or overexpress the CD19 signal transduction molecule. Immunity 3, 39-50. Esser, C., Radbruck, A. (1990). Immunoglobulin class switching: molecular and cellular analysis. Annu. Rev. Immunol. 8,717735. Fearon, D. T., Carter, R. H. (1995). The CD19/CR2/TAPA-1 complex of B lymphocytes: linking to acquired immunity. Annu. Rev. Immunol. 13, 127-149. Feeney, A. J. (1992). Comparison of junctional diversity in the neonatal and adult immunoglobulin repertoires. Int. Rev. Immunol. 8, 113-122. Feeney, A. J., Riblet, R. (1993). DST4: a new, and probably the last, functional DH gene in BALB/c mouse. Immunogenetics 37, 217-221. Fridman, W. H. (1993). Regulation of B-cell activation and

596

antigen presentation by Fc receptors. Curr. Opin. Immunol. 5, 355-360. Friedrich, J., Campbell, K., Cambier, J. C. (1993). The gamma subunit of the B cell antigen receptor complex is a Cterminally truncated product of the B29 gene. J. Immunol. 150, 2817-2822. Fung-Leung, W. P., Shilham, M. W., Rahemtulla, A., Ktindig, T. M., Vollenweider, M., Potter, J., van Ewijk, W., Mak, T. W. (1991). CD8 is needed for the development of cytotoxic T cells but not helper T cells. Cell 65,443. Fukai, K., Oh, J., Karim, M. A., Moore, K. J., Kandil, H. H.: Ito, H., Burger, J., Spritz, R. A. (1996). Homozygosity mapping of the gene for Chediak-Higashi syndrome to chromosome 1q42-q44 in a segment of conserved synteny that includes the mouse beige locus (bg). Am. J. Hum. Genet. 59, 620-624. Fukuda, M., Kojima, T., Kabayama, H., Mikoshiba, K. (1996). Mutation of the pleckstrin homology domain of Brutons tyrosine kinase in immunodeficiency impaired inositol 1,3,4,5-tetrakisphosphate binding capacity. J. Biol. Chem. 271, 30303-30306. Galli, S. J., Zsebo, K. M., Geissler, E. N. (1994). The kit ligand, stem cell factor. Adv. Immunol. 55, 1-96. Garza, H. H. Jr, Prakash, O., Carr, D. J. (1996). Aberrant regulation of cytokines in HIV-1 TAT72-transgenic mice. J. Immunol. 156, 3631-3637. Goldman, H. R., De Franco, A. L. (1994). Biochemistry of B lymphocyte activation. Adv. Immunol. 55,221-295. Gong, S., Nussenzweig, M. C. (1996). Regulation of an early developmental checkpoint on the B cell pathway by Igfl. Science 272, 411-414. Goodnow, C. C., Cyster, J. G., Hartley, S. B. et al. (1995). Selftolerance checkpoints in B lymphocyte development. Adv. Immunol. 59, 279-368. Grandien, A., Modigliani, Y., Freitas, A. A., Andersson, J., Coutinho, A. (1994). Positive and negative selection of antibody repertoires during B cell differentiation. Immunol. Rev. 137, 53-89. Grawunder, U., Leu, T. M. J., Schatz, D. G., Werner, A., Rolink, A. G., Melchers, F., Winkler, T. H. (1995). Down regulation of RAG1 and RAG2 gene expression in pre-B cells after functional immunoglobulin heavy chain rearrangement. Immunity 3,601-608. Gray, D., Siepmann, K., Van Essen, D. et al. (1996). B-T lymphocyte interactions in the generation and survival of memory cells. Immunol. Rev. 150, 45-61. Greenspan, N. S., Cooper, L. J. N. (1992). Intermolecular cooperativity: active to why mice have IgG3? Immunol. Today 13, 164-168. Gu, H., Tarlinton, D., M/iller, W., Rajeswky, K., F6ster, I. (1991). Most peripheral B cells in mice are ligand selected. J. Exp. Med. 173, 1357-1371. Hardy, C. C. (1991). Variable gene usage, physiology and development of Ly-1 + (CD5) B cells. Curr. Opin. Immunol. 4, 181-185. Hardy, C. C., Carmack, C. E., Shinton, S. A., Kemp, J. D., Hayakawa, K. (1991). Resolution and characterization of proB and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173, 1213-1225. Hardy, R. R., Hayakawa, K. (1994). CD5 B cells, a fetal B cell lineage. Adv. Immunol. 55,297-339. Hathcock, K. S., Hodes, R. J. (1996). Role of CD28-B7 costimu-

THE MOUSE MODEL

latory pathways in T cell-dependent B cell responses. Adv. Immunol. 62, 131-166. Henthorn, P. S., Somberg, R. L., Fimiani, V. M., Puck, J. M., Patterson, D. F., Felsburg, P. J. (1994). IL-2R gamma gene microdeletion demonstrates that canine X-linked severe combined immunodeficiency is a homologue of the human disease. Genomics 23, 62-68. Herzenberg, L. A., Haughton, G., Rajewsky, K., editors (1992). CD5 B cells in development and disease. Ann. N Y Acad. Sci. 651. Hirayama, F., Lyman, S. D., Clark, S. C., Ogawa, M. (1995). The fit3 ligand supports proliferation of lymphohematopoietic progenitors and early B-lymphoid progenitors. Blood 85, 1762-1769. Hodge, M. R., Ranger, A. M., Charles de la Brousse, F., Hoey, T., Grusby, M. J., Glimcher, L. H. (1996). Hyperproliferation and dysregulation of IL-4 secretion in NF-ATP-deficient mice. Immunity 4, 397-405. Honjo, T., Matsuda, F. (1995). Immunoglobulin and heavy chain loci of mouse and human. In Immunoglobulin Genes, 2nd edn (eds Honjo, T., Alt, F. W.), pp. 145-172. Academic Press, London, UK. Huang, M., Simard, C., Jolicoeur, P. (1991). The majority of cells infected with the defective murine AIDS virus belongs to the B-cell lineage. J. Virol. 65, 6562. Hulett, M. D., Hogarth, P. M. (1994). Molecular basis of Fc receptor function. Adv. Immunol. 54, 1-127. Huppi, K., D'Hoostelaere, L. A. (1991). Letter to the editor. J. Immunol. 146, 4053. Huston, J. S., Margolies, M. N., Haber, E. (1996). Antibody binding sites. Adv. Protein Chem. 49, 330-450. Ichihara, Y., Hayashida, H., Miyazawa, S., Kurosawa, Y. (1989). Only DF16.2, DSP2 and DQ52 gene families exist in mouse immunoglobulin heavy chain diversity gene loci, of which DF16.2 and DSP2 originate from the same primordial DH gene. Eur. J. Immunol. 19, 1849-1854. Iglesias, A., Lamers, M., Kohler, G. (1987). Expression of immunoglobulin ~ chain causes allelic exclusion in transgenic mice. Nature 330, 482-484. Itohara, S., Mombaerts, P., Lafaille, J., Iacomini, J., Nelson, A., Clarke, A. R., Hooper, M. L., Farr, A., Tonegawa, S. (1993). T cell delta gene mutant mice: independent generation of alpha beta T cells and programmed rearrangement of gamma delta TCR genes. Cell 72, 337. Jeong, H. D., Teale, J. M. (1988). Comparison of the fetal and adult functional B cell repertoires by analysis of VH gene family expression. J. Exp. Med. 168,589-598. Jeong, H. D., Komisar, J. L., Kraig, E., Teale, J. M. (1988). Strain-dependent expression of VH gene families. J. Immunol. 140, 2436-2441. Kabat, E. A., Wu, T. T., Perry, H., Gottesman, K. S., Foeller, C. (1991). Sequences of Proteins of Immunological Interest. US Department of Health and Human Services, MA, USA. Kalled, S. L., Brodeur, P. H. (1991). Utilization of VK families and VK exons: implications for the available B cell repertoire. J. Immunol. 147, 3194-3200. Kantor, A. B., Herzenberg, L. A. (1993). Origin of murine B cell lineages. Annu. Rev. Immunol. 11,501-538. Karasuyama, H., Rolink, A., Melchers, F. (1996). Surrogate light chain in B cell development. Adv. Immunol. 63, 1-42. Kaushik, A., Shulze, D. H., Bona, C. A., Kelsoe, G. (1989).

References

Murine VK gene expression violates the VH paradigm. J. Exp. Med. 169, 1859-1864. Kearney, J. F. (1993). Idiotypic network. In Fundamental Immunology (ed. Paul, W. E.), pp. 887-902. Raven Press Ltd, New York, USA. Kehrl, J. H., Riva, A., Wilson, G. L., Th~venin, C. (1994). Molecular mechanisms regulating CD19, CD20 and CD22 gene expression. Immunol. Today 15,432-436. Kerner, J. D., Appleby, M. W., Mohr, R. N. et al. (1995). Impaired expansion of mouse B cell progenitors lacking Btk. Immunity 3,301-312. Khan, W. N., Alt, F. W., Gerstein, R. M. et al. (1995). Defective B cell development and function in Btk-deficient mice. Immunity 3,283-299. Kim, K. M., Reth, M. (1995a). Function of B-cell antigen receptor of different classes. Immunol. Lett. 44, 81-85. Kim, K. M., Reth, M. (1995b). The B-cell antigen receptor of class IgD induces a stronger and more prolonged protein tyrosine phosphorylation than of class IgM. J. Exp. Med. 181, 1005-1014. Kim, K. M., Alber, G., Weiser, P., Reth, M. (1993). Signalling function of the B cell antigen receptors. Immunol. Rev. 132, 125-146. Kim, K. M., Adachi, T., Nielsen, P. J., Terashima, M., Lamers, M. C., Kohler, G., Reth, M. (1994). Two new proteins preferentially associated with membrane immunoglobulin D. EMBO J. 13, 3793-3800. Kirchgessner, C. U., Patil, C. K., Evans, J. W., Cuomo, C. A., Fried, L. M., Carter, T., Oettinger, M. A., Brown, J. M. (1995). DNA dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267, 1178-1182. Kitamura, D., Rajewsky, K. (1992). Targeted disruption o f / l chain membrane exon causes loss of heavy-chain allelic exclusion. Nature 356, 154-156. Kitamura, D., Kudo, A., School, S., Muller, W., Melchers, F. (1992). A critical role of 25 protein in B cell development. Cell 69, 823-831. Klinman, N. R. (1996a). The clonal selection hypothesis and current concepts of B cell tolerance. Immunity 5,189-195. Klinman, N. R. (1996b). In vitro analysis of the generation and propagation of memory B cells. Immunol. Rev. 150, 91-111. Knight, K. L., Crane, M. A. (1994). Generating the antibody repertoire in rabbit. Adv. Immun. 56, 179-218. Kofler, R. (1988). A new routine Ig VH gene family. J. Immunol. 140, 4031-4034. Kofler, R., Helmberg, A. (1991). Comment to the article 'A new Igk-V gene family in the mouse'. Immunogenetics 34, 139140. Kofler, R., Perlmutter, R. M., Noonan, D. J., Dixon, F. J., Theofilopoulos, A. N. (1985). Ig heavy chain variable region gene complex of lupus mice exhibits normal restriction fragment length polymorphism. J. Exp. Med. 162, 346-351. Kofler, R., Duchosal, M. A., Dixon, F. J. (1989). Complexity, polymorphism and connectivity of mouse VK gene families. Immunogenetics 29, 65-74. Kofler, R., Geley, S., Kofler, H., Helmberg, A. (1992). Mouse variable-region gene families: complexity, polymorphism and use in non-autoimmune responses. Immunol. Rev. 128, 5-21. Koike, R., Nishimura T., Yasumizu, R., Tanaka, H., Hataba, Y., Hataba, Y., Watanabe, T., Miyawaki, S., Miyasaka, M. (1996). The splenic marginal zone is absent in alymphoplastic aly mutant mice. Eur. J. Immunol. 26, 669-675.

597

Kramer, D. R., Cebra, J. J. (1995). Early appearance of 'natural' mucosal IgA responses and germinal centers in suckling mice developing in the absence of maternal antibodies. J. Immunol. 154, 2051-2062. Kroemer, G., Helmberg, A., Bernot, A., Auffray, C., Kofler, R. (1991). Evolutionary relationship between human and mouse immunoglobulin kappa light chain variable region genes. Immunogenetics 33, 42-49. K/Jndig, T. M., Schorle, H., Bachmann, M., Hengartner, H., Zinkernagel, R. M., Horak, I. (1993). Immune responses in interleukin-2 deficient mice. Science 262, 1059-1061. Kurosawa, Y., Tonegawa, S. (1982). Organization, structure and assembly of immunoglobulin heavy chain diversity DNA segments. J. Exp. Med. 155,201-218. Lafaille, J. J., Decloux, A., Bonneville, M., Takagaki, Y., Tonegawa, S. (1989). Junctional sequences of T-cell receptor 7 delta genes: implications for ~ delta T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59, 859-870. Landau, N. R., Schatz, D. G., Rosa, M., Baltimore, D. (1987). Increased frequency of N-regional insertion in a murine pre-Bcell line infected with a terminal deoxynucleotidyl transferase retroviral expression vector. Mol. Cell. Biol. 7, 3237-3243. Lanzavecchia, A. (1996). Mechanisms of antigen uptake for presentation. Curr. Opin. Immunol. 8,348-354. Law C.-L., Sidorenko, S. P., Clark, E. A. (1994). Regulation of lymphocyte activation by the cell-surface molecule CD22. Immunol. Today 15,442-448. Lewis, S. M. (1994). The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56, 27-150. Lieber, M. R., Hesse, J. E., Mizuuchi, K., Geller, M. (1988). Lymphoid V(D)J recombination: nucleotide insertion at signal joints as well as coding joints. Proc. Natl Acad. Sci. USA 85, 8588-8592. Livant, D., Blatt, C., Hood, L. (1986). One heavy chain variable region gene segment subfamily in the BALB/c mouse contains 500-1000 or more members. Cell 47, 461-470. Lorenz, U., Ravichandran, K. S., Burakoff, S. J., Neel, B. G. (1996). Lack of SHTP1 results in src-family kinase hyperactivation and thymocyte hyperresponsiveness. Proc. Natl Acad. Sci. USA 93, 9324-9629. MacLennan, I. C. M. (1994). Germinal centers. Annu. Rev. Immunol. 12, 117-139. Malynn, B. A., Yancopoulos, G. D., Barth, J. E., Bona, C. A., Alt, F. W. (1990). Biased expression of JH-proximal VH genes occurs in the newly generated repertoire of neonatal and adult mice. J. Exp. Med. 171,843-859. Manjunath, N., Correa, M., Ardman, M., Ardmann, B. (1995). Negative regulation of T-cell adhesion and activation by CD43. Nature 377, 535. Manz, J., Denis, K., Witte, O., Brenster, R., Storb, U. (1988). Feedback inhibition of immunoglobulin gene rearrangement by membrane/2, but not by secreted heavy chains. J. Exp. Med. 168, 1363-1381. Marcos, M. A., Godin, I., Cumano, A. et al. (1994). Developmental events from hemopoietic stem cells to B-cell populations and Ig repertoires. Immunol. Rev. 137, 155-171. Matsuyama, T., Kimura, T., Kitagawa, M., Pfeffer, K., Kawakami, T., Watanabe, N., K~indig, T. M., Amakawa, R., Kishihara, K., Wakeham, A., Potter, J., Furlonger, C. L., Narendran, A., Suzuki, H., Ohashi, P. S., Tanigushi, T., Mak, T. W. (1993). Targeted disruption of IRF-1 or IRF-2 results in

598

abnormal type I IFN gene induction and aberrant lymphocyte development. Cell 75, 83. Max, E. E., Seidman, J. G., Leder, P. (1979). Sequences of five potential recombination sites encoded close to an immunoglobulin K constant region gene. Proc. Natl Acad. Sci. USA 76, 3450-3454. Mazanec, M. B., Nedrud, J. G., Kaetzel, C. S., Lamm, M. E. (1993). A three-tiered view of the role of IgA in mucosal defense. Immunol. Today 14, 430-495. McConnell, H. M., Martinez-Yamout, M. (1996). Insight of antibody combining sites using nuclear magnetic resonance and spin labels haptens. Adv. Protein Chem. 49, 135-149. Meek, K., Rathbun, G., Reiniger, L., Jaton, J. C., Kofler, R., Tucker, P. W., Capra, J. D. (1990). Organization of murine immunoglobulin VH complex: placement of two new VH families (VH10 and VH11) and analysis of VH family clustering and interdigitation. Mol. Immunol. 27, 1073-1081. Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Sakaguchi, N., Jameson, B., Rolink, A. (1993). The surrogate light chain in B-cell development. Immunol. Today 14, 60-68. Melchers, F., Haasner, D., Grawunder, U., Kalberer, C., Karasuyama, H., Winkler, T. H., Rolink, A. (1994). Role of IgH and L chains and surrogate H and L chains in the development of cells of the B lymphocytes lineage. Annu. Rev. Immunol. 12, 209-225. Melchers, F., Robert, A., Grawunder, U., Winkler, T. H., Karasuyama, H., Ghia, P., Andersson, J. (1995). Positively and negatively selecting events during B lymphopoiesis. Curr. Opin. Immunol. 7, 214-227. Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe, A. S., Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., Carver-Moore, K., DuBois, R. N., Clark, R., Aguet, M., Schreiber, R. D. (1996). Targeted disruption of the Stat-1 gene in mice reveals unexpected physiology in the JAK-STAT signaling pathway. Cell 84, 431-432. Mistry, P. B., Duplan, J. F. (1973). Propri~t~s biologiques d'un virus isol~ d'une radioleuc~mie C57BL. I. Premiers passages du virus natif. Bull. Cancer 60, 287. Mitchell, R. N., Barnes, K. A., Grupp, S. A., Sanchez, M., Misulavin, Z., Nussenzweig, M. C., Abbas, A. K. (1995). Intracellular targeting of antigens internalized by membrane immunoglobulin in B lymphocytes. J. Exp. Med. 181, 17051714. Miyawaki, S., Nakamura, Y., Suzuka, H., Koba, M., Yasumizu, R., Ikehara, S., Shibata, Y. (1994). A new mutation, aly, that induces a generalized lack of lymph nodes accompanied by immunodeficiency in mice. Eur. J. Immunol. 24, 429-434. Molina, T. J., Kishihara, K., Siderovski, D. P., Ewik, W., Van Narendran, A., Timms, E., Wakeham, A., Paige, C. J., Hartmann, K.-U. U., Veilette, A. (1992). Profound block in thymocyte development in mice lacking p561ck. Nature 357, 161-164. Mombaerts, P., Clark, A. R., Rudnicki, M. A., Iacomini, J., Itohara, S., Lafaille, J. J., Wang, L., Ichikawa, Y., Jaenisch, R., Hooper, M. L., Tonegawa, S. (1992a). Mutations in the Tcell antigen receptor alpha and beta block thymocyte development at different stages. Nature 360, 225. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., Papaioannou, V. E. (1992b). RAG-1 deficient mice have no mature B and T lymphocytes. Cell 68, 869. Mond, J. J., Lees A., Snapper, C. (1995). T-cell independent antigens Type 2. Annu. Rev. Immunol. 13,655-692.

THE MOUSE MODEL

Mosier, D. E., Subbarao, B. (1982). Thymus-independent antigens: complexity of B lymphocyte activation revealed. Immunol. Today 3,217-222. Mosier, D. E., Yetter, R. A., Morse, H. C. III (1985). Retroviral induction of acute lymphoproliferative disease and profound immunosuppression in adult C57BL/6 mice. J. Exp. Med. 161, 766. Moutschen, M., Trebak, M., Greimers, R., Colombi, S., Boniver, J. (1996). Subset-specific analysis of calcium fluxes in murine AIDS. Int. Immunol. 8, 1715-1727. Muta, T., Kurosaki, T., Misulavin, Z., Sanchez, M., Nussenzweig, M. C., Ravetch, J. V. (1994). A 13-amino-acid motif in the cytoplasmic domain of FCyRIIb modulates B-cell receptor signalling. Nature 368, 70-73. Nagata, S., Suda, T. (1995). Fas and Fas ligand: lpr and gld mutations. Immunol. Today 16, 39-43. Nagle, D. L., Karim, M. A., Woolf, E. A., Holmgren, L., Bork, P., Misumi, D. J., McGrail, S. H., Dussault, B. J. Jr, Perou, C. M., Boissy, R. E., Duyk, G. M., Spritz, R. A., Moore, K. J. (1996). Identification and mutation analysis of the complete gene for Chediak-Higashi syndrome. Nat. Genet. 14, 307311. Nemazee, D. (1993). Promotion and prevention of autoimmunity by B lymphocytes. Curr. Opin. Immunol. 5,866-872. Nisonoff, A., Wissler, F. C., Lipman, L. N. (1960). Properties of the major components of a peptic digest of rabbit antibody. Science 132, 1770-1771. Norvell, A., Monroe, J. G. (1996). Acquisition of surface IgD fails to protect from tolerance-induction: both surface IgM- and surface IgD-mediated signals induce apoptosis of immature murine B lymphocytes. J. Immunol. 156, 1328-1332. Noguchi, M., Yi, H., Rosenblatt, H. M., Filipovich, A. H., Adelstein, S., Modi, W. S., McBride, O. W., Leonard, W. J. (1993). Interleukin-2 receptor 7 chain mutation results in Xlinked severe combined immunodeficiency in humans. Cell 73, 147-157. Novotny, J., Bajorath, J. (1996). Computational biochemistry of antibodies and T-cell receptors. Adv. Protein Chem. 49, 150260. Nussenzweig, M. C., Shaw, A. C., Sinn, E., Danner, D. B., Holmes, K. L., Morse, H., Leder, P. (1987). Allelic exclusion in transgenic mice that express the membrane form of immunoglobulin/l. Science 236, 816-819. O'Keefe, T. L., Williams, G. T., Davies, S. L., Clark, E. A. (1996). Hyperresponsive B cells in CD22-deficient mice. Science 274, 798-801. Oettinger, M. A., Schatz, D. G., Gorka, C., Baltimore, D. (1990). RAG-1 and RAG-2 adjacent genes that synergistically activate V(D)J recombination. Science 248, 1517-1523. Osmond, D. G. (1986). Population dynamics of bone marrow B lymphocytes. Immunol. Rev. 93, 103-124. Oxenius, A., Campbell, K. A., Maliszewski, C. R., Kishimoto, T., Kikutani, H., Hentgarnter, H., Zinkernagel, R. M., Bachmann, M. F. (1996). CD40-CD40 ligand interactions are critical in T-B cooperation but not for other anti-viral CD4 + T cell functions. J. Exp. Med. 3, 2209-2218. Padlan, E. P. (1996). X-ray crystallography of antibodies. Adv. Protein Chem. 49, 57-134. Palmer, J. L., Nisonoff, A. (1964). Dissociation of rabbit 7globulin into half-molecules after reduction of one labile disulfide bond. Biochemistry 3,863-869. Papavasiliou, F., Misulovin, S., Suh, H., Nussenzweig, M. C.

References

(1995a). The role of Igfi in precursor B cell transition and allelic exclusion. Science 268, 408-411. Papavasiliou, F., Misulovin, S., Suh, H., Nussenzweig, M. C. (1995b). The cytoplasmic domains of immunoglobulin Ig0~ and Igfi can independently induce the precursor B cell transition and allelic inclusion. J. Exp. Med. 182, 1389-1394. Patel, K. J., Neuberger, M. S. (1993). Antigen presentation by the B cell antigen receptor is driven by the alpha/beta sheath and occurs independently of its cytoplasmic tyrosines. Cell 74, 934-946. Pennell, C. A., Sheehan, K. M., Brodeur, P. H., Clarke, S. H. (1989). Organization and expression of VH gene families preferentially expressed by Ly-l+ (CD5) B cells. Eur. J. Immunol. 19, 2115-2121. Perlmutter, R. M., Alberola-Ila, J. (1996). The use of dominantnegative mutations to elucidate signal transduction pathways in lymphocytes. Curr. Opin. Immunol. 8,285-290. Perlmutter, R. M., Klotz, J. L., Bond, M. W., Nahm, M., Davie, J. M., Hood, L. (1984). Multiple VH gene segments encode murine antistreptococcal antibodies. J. Exp. Med. 159, 179192. Perlmutter, R. M., Kearney, J. F., Chang, S. P., Hood, L. E. (1985). Developmentally controlled expression of immunoglobulin VH genes. Science 127, 1597-1600. Picarella, D., Serunian, L. A., Rosenberg, N. (1991). Allelic exclusion of membrane but not secreted immunoglobulin in a mature B cell line. Eur. J. Immunol. 21, 55-62. Pleiman, C. M., D'Ambrosio, D., Cambier, J. C. (1994). The Bcell antigen receptor complex: structure and signal transduction. Immunol. Today 15,393-398. Porter, R. R. (1985). Separation and isolation of fractions of rabbit y-globulin containing the antibody and antigenic combining sites. Nature 182, 670-671. Radic, M. Z., Weigert, M. (1994). Genetic and structural evidence for antigen selection of anti-DNA antibodies. Annu. Rev. Immunol. 12, 487-520. Rahemtulla, A., Fung-Leung, W. P., Schilham, M. W., Ktindig, T. M., Sambhara, S. R., Narendran, A., Arabian, A., Wakeham, A., Paige, C. J., Zinkernagel, R. M. (1991). Normal development and function of CD8+ cells but markedly decreased helper cell activity in mice lacking CD4. Nature 353,180-184. Rajewsky, K. (1996). Clonal selection and learning in the antibody system. Nature 381,751-758. Ramsden, D. A., Wu, G. E. (1991). Mouse K light chain recombination signal sequences mediate recombination more frequently than do those of 2 light chain. Proc. Natl Acad. Sci. USA 88, 10721-10725. Rankin, J. A., Picarella, D. E., Geba, G. P., Temann, U. A., Prasad, B., DiCosmo, B., Tarallo, A., Stripp, B., Whitsett, J., Flavell, R. A. (1996). Phenotypic and physiologic characterization of transgenic mice expressing interleukin 4 in the lung: lymphocytic and eosinophilic inflammation without airway hyperreactivity. Proc. Natl Acad. Sci. USA 93, 7821-7825. Ravetch, J. U., Kinet, J.-P. (1991). Fc receptors. Annu. Rev. Immunol. 9, 457-492. Rawlings, D. J., Saffran, D. C., Tsukoda, S. et al. (1993). Mutation of unique region of Bruton's tyrosine kinase in immunodeficient XID mice. Science 261,358-361. Reiniger, L., Kaushik, A., Izui, S., Jaton, J.-C. (1988). A member of the new VH gene family encodes anti-bromelinized mouse

599

red blood cell autoantibodies. Eur. J. Immunol. 18, 15211533. Reth, M. (1992). Antigen receptors on B lymphocytes. Annu. Rev. Immunol. 10, 97-121. Reth, M. (1994). B cell antigen receptors. Curr. Opin. Immunol. 6, 3-8. Reth, M. G., Ammirati, P., Jackson, S., Alt, F. W. (1985). Regulated progression of a cultured pre-B-cell line to the Bcell stage. Nature 317, 353-355. Reth, M., Petrac, E., Wiese, P., Label, L., Alt, F. W. (1987). Activation of VK gene rearrangement in pre-B-cells follows the expression of membrane-bound immunoglobulin heavy chain. EMBO J. 6, 3299-3345. Reynaud, C. A., Bertocci, B., Dahan, A., Weill, J. C. (1994). Formation of chicken B-cell repertoire: ontogenesis, regulation of Ig gene rearrangement and diversification by gene conversion. Adv. Immun. 57, 353-378. Reynaud, C. A., Garcia, C., Hein, W. R., Weill, J. C. (1995). Hypermutation generating the sheep immunoglobulin repertoire is an antigen-independent process. Cell 80, 115-125. Riblet, R., Tutter, A., Brodeur, P. (1986). Polymorphism and evolution of Igh-V gene families. Curr. Top. Microbiol. Immunol. 127, 167-172. Rickert, R. C., Rajewsky, K., Roes, J. (1995). Impairment of Tcell-dependent B-cell responses and B-1 cell development in CD19-deficient-mice. Nature 376, 352-355. Ritchie, K. A., Brinster, R. L., Storb, U. (1984). Allelic exclusion and control of endogenous immunoglobulin gene rearrangement in K transgenic mice. Nature 312, 517-520. Rolink, A., Haasner, D., Melchers, F., Andersson, J. (1996). The surrogate light chain in mouse B-cell development. Intern. Rev. Immunol. 13,341-356. Rosenberg, N., Kincade, P. W. (1994). B-lineage differentiation in normal and transformed cells and the microenvironment that supports it. Curr. Opin. Immunol. 6, 203-211. Ryelandt, M., De Wit, D., Baz, A. et al. (1995). The perinatal presence of antigen (P-azophenylarsonate) or anti-/, antibodies lead to the loss of the recurrent idiotype (CRIA) in A/J mice. Int. Immunol. 7, 645-652. Sakano, H., Htippi, K., Heinrich, G., Tonegawa, S. (1979). Sequences at the somatic recombination sites of immunoglobulin light chain genes. Nature 280, 288-394. Sakano, H., Kurosawa, Y., Weigert, M., Tonegawa, S. (1981). Identification and nucleotide sequence of a diversity DNA segment (D) of immunoglobulin heavy-chain genes. Nature 290, 562-565. Sanchez, P., Nadel, B., Cazenave, P.-A. (1991). VY-J2 rearrangements are restricted within a V-J-C recombination unit in the mouse. Eur. J. Immunol. 21,907-911. Sanchez, P., Rueff-Juy, D., Boudinot, P., Hachemi-Rachedi, S., Cazenave, P.-A. (1996). The 2 B cell repertoire of/c-deficient mice. Intern. Rev. Immunol. 13,357-368. Satterthwaite A., Witte, O. (1996). Genetic analysis of tyrosine kinase function in B cell development. Annu. Rev. Immunol. 14, 131-154. Schlomchik, M., Mascelli, M., Shan, H., Radic, M. Z., Pisetsky, D., Marshak-Rothstein, A., Weigert, M. (1990). Anti-DNA antibodies from autoimmune mice arise by clonal expansion and somatic mutation. J. Exp. Med. 171,265-297. Schulze, D. H., Kelsoe, G. (1987). Genotypic analysis of B cell colonies by in situ hybridization. J. Exp. Med. 166, 163-172. Schwarz, E. M., Krimpenfort, P., Berns, A., Verma, I. M. (1997).

600

Immunological defects in mice with a targeted disruption in Bcl-3. Genes Dev. 11,187-197. Shahinian, A., Pfeffer, K., Lee, K. P., Kfindig, T. M., Kishihara, K., Wakeham, A., Kawai, K., Ohashi, P. S., Thompson, C. B., Mak, T. W. (1993). Differential T cell costimulation requirements in CD28-deficient mice. Science 261,609. Shinkai, Y., Rathburn, G., Lam, K.-P., Oltz, E. M., Steward, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., Stall, A. M., Alt, F. W. (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68,855. Sefton, B. M., Taddie, J. A. (1994). Role of tyrosine kinases in lymphocyte activation. Curr. Opin. Immunol. 6, 372-379. Selsing, E., Daitch, L. E. (1995). Immunoglobulin 2 genes. In Immunoglobulin Genes (eds Honjo, T., Alt, F. W.), pp. 193203. Academic Press, London, UK. Shefner, R., Mayer, R., Kaushik, A., D'Eustachio, P., Bona, C., Diamond, B. (1990). Identification of a new VK gene family that is highly expressed in hybridomas from an autoimmune mouse strain. J. Immunol. 145, 1609-1614. Shimizu, A., Takahashi, N., Yaoita, Y., Honjo, T. (1982). Organization of the constant-region gene family of the mouse immunoglobulin heavy chain. Cell 28,499-506. Shinkai, Y., Rathburn, J., Lam, K. P. et al. (1992). RAG-2 deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68, 855-867. Siu, G., Springer, E. A., Huang, H. V., Hood, L. E., Crews, S. T. (1987). Structure of the T15 VH gene subfamily: identification of immunoglobulin gene promoter homologies. J. Immunol. 138, 4466-4471. Sligh, J. E., Ballantyne, C. M., Rich, S., Hawkins, H. K., Smith, C. W., Bradley, A., Beaudet, A. (1993). Inflammatory and immune responses are impaired in mice deficient in intercellular adhesion molecule 1. Proc. Natl Acad. Sci. USA 90, 8529. Snapper, C. M., Finkelman, F. D. (1993). Immunoglobulin class switching. In Fundamental Immunology (ed. Paul, W. E.), pp. 837-863. Raven Press Ltd, New York, USA. Snider, D. P., Marshall, J. S., Perdue, M. H., Liang, H. (1994). Production of IgE antibody and allergic sensitization of intestinal and peripheral tissues after oral immunization with protein Ag and cholera toxin. J. Immunol. 153, 647657. Solin, M.-L., Kaartinen, M. (1992). Allelic polymorphism of mouse Igh-J locus, which encodes immunoglobulin heavy chain joining (JH) segments. Immunogenetics 36, 306-313. Solvason, N., Lehuen, A., Kearney, J. F. (1991). An embryonic source of lyl but not conventional B cells. Int. Immunol. 3, 543-550. Spanopoulou, E., Zaitseva, F., Wang, F.-H., Santagata, S., Baltimore, D., Panayotou, G. (1996). The homeodomain region of Rag-1 reveals the parallel mechanisms of bacterial and V(D)J recombination. Cell 87, 263-276. Stein, P. L., Lee, H.-M., Rich, S., Soriano, P. (1992). p59fyn mutant mice display differential signaling in thymocytes and peripheral T cells. Cell 70, 741-750. Storb, U., Haasch, D., Arp, B., Sanchez, P., Cazenave, P.-A., Miller, J. (1989). Physical linkage of mouse 2 genes by pulsedfield gel electrophoresis suggests that the rearrangement process favors proximate target sequence. J. Mol. Cell. Biol. 9, 711-718. Strohal, R., Helmberg, A., Keoemer, G., Kofler, R. (1989). Mouse

THE MOUSE MODEL

VK gene classification by nucleic acid sequence similarity. Immunogenetics 30, 475-493. Takai, T., Ono, M., Hikida, M., Ohmori, H., Ravetch, J. V. (1996). Augmented humoral and anaphylactic responses in FCyRII-deficient mice. Nature 379, 346-349. Tassignon, J., Brait, M., Ismaili, J., Urbain, J., Gottlieb, P., Brown, A., Hasemann, C. A., Capra, J. D., Meek, K. (1993). Molecular characterization of monoclonal CRIA-positive anti-arsonate antibodies derived from idiotype-negative mice bearing a light chain polymorphism. Proc. Natt Acad. Sci. USA 90, 9508-9512. Teale, J. M., Morris, E. G. (1989). Comparison of VK gene family expression in adult and fetal B cells. J. Immunol. 143, 2768-2772. Teale, J. M., Medina, C. A. (1992). Comparative expression of adult and fetal V gene repertoire. Intern. Rev. Immunol. 8, 95111. Tedder, T. F., Zhou, L.-J., Engel, P. (1994). The CD19/CD21 signal transduction complex of B lymphocytes. Immunol. Today 15,437-442. Terashima, M., Kim, K. M., Adachi, T., Nielsen, P. J., Reth, M., Kohler, G., Lamers, M. C. (1994). EMBO J. 13, 33782-33792. Tergrigorov, V. S., Krifuks, O., Liubashevsky, E., Nyska, A., Trainin, Z., Toder, V. (1997). A new transmissible AIDS-like disease in mice induced by alloimmune stimuli. Nature Medicine 3, 37-41. Tonegawa, S. (1983). Somatic generation of antibody diversity. Nature 302, 575-581. Tornberg, U. C., Holmberg, D. (1995). Bl-a, Bl-b and B-2 B cells display unique VHDJH repertoires formed at different stages of ontogeny and under different selection pressures. EMBO J. 14, 1680-1689. Torres, R. M., Flaswinkel, H., Reth, M., Rajewsky, K. (1996). Aberrant B cell development and immune response in mice with a compromised BCR complex. Science 272, 1804-1808. Trepicchio W. Jr, Barret, K. J. (1985). The Igh-V locus of MRL mice: restriction fragment length polymorphism in eleven strains of mice as determined with VH and D gene probes. J. Immunol. 134, 2734-2739. Tsubata, T., Reth, M. (1990). The products of pre-B-cell specific (25 and VpreB) and the immunoglobulin /~ chain form a complex that is transported onto the cell. J. Exp. Med. 172, 973-976. Tsubata, T., Tsubata, R., Reth, M. (1992). Crosslinking of the cell surface immunoglobulin chain (/~-surrogate light chains complex) on pre-B-cells induce activation of V gene rearrangements at the immunoglobulin K locus. Int. Immunol. 4, 637-641. Tsui, H. W., Siminovitch, K. A., de Souza, L., Tsui, F. W. (1993). Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat. Gen. 4, 124-129. Tutter, A., Riblet, R. (1988). Selective and neutral evolution in the murine Igh-V locus. Curr. Top. Microbiol. Immunol. 137, 107-115. Tutter, A., Brodeur, P. H., Shlomchik, M., Riblet, R. (1991). Structure, map position and evolution of two newly diverged mouse Ig VH gene families. J. Immunol. 147, 3215-3223. Ulevitch, R. J., Tobias, P. S. (1995). Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13,437-457. Urbain, J., Brait, M., De Wit, D. et al. (1992). B cell subsets,

References

idiotype selection: positive selection for some B lymphocyte? Int. Rev. Immunol. 8,259-267. Valiante, N. M., Caton, A. J. (1990). A new Igk-V gene family in the mouse. Immunogenetics 32, 345-350. van den Broek, M. F., Mtiller, U., Huang, S., Zinkernagel, R. M., Aguet, M. (1995). Immune defence in mice lacking type I and/ or type II interferon receptors. Immunol. Rev. 148, 5-23. van Dyk, L., Meek, K. (1992). Assembly of IgHCDR3: mechanism, regulation and influence on antibody diversity. Int. Rev. Immunol. 8, 123-133. van Kaer, L., Ashton-Rickardt, P. G., Ploegh, H. L., Tonegawa, S. (1992). TAP 1 mutant mice are deficient in antigen presentation, surface class I molecules, and C D 4 - C D 8 + T cells. Cell 71, 1205. Vieira, P., Rajewsky, K. (1988). The half-lives of serum immunoglobulins in adult mice. Eur. J. Immunol. 18,313-316. von Freeden-Jeffry, U., Vieira, P., Lucian, L. A., McNeil, T., Burdach, S. E. G., Murray, R. (1995). Lymphopenia in interleukin (IL)-7 gene-deleted mice identifies IL-7 as a nonredundant cytokine. J. Exp. Med. 181, 1519-1526. Walsh, C. M., Matloubian, M., Liu, C. C., Ueda, R., Kurahara, C. G., Christensen, J. L., Huang, M. T., Young, J. D., Ahmed, R., Clark W. R. (1994). Immune function in mice lacking the perforin gene. Proc. Natl Acad. Sci. USA 91, 10854-10858. Weaver, D., Costantini, F., Imanishi, K. T., Baltimore, D. (1985). A transgenic immunoglobulin/x gene prevents rearrangement of endogenous genes. Cell 42, 117-127. Weill, J. C., Reynaud, C. A. (1995). Generation of diversity by post-rearrangement diversification mechanisms: the chicken and the sheep antibody repertoires. In Immunoglobulin Genes, 2nd edn (eds Honjo, T., Alt, F. W.), pp. 267-288. Academic Press, London, UK. Weiser P., Riesterer, C., Reth, M. (1994). The internalization of the IgG2a antigen receptor does not require the association with Ig-alpha and Ig-beta but the activation of protein kinases does. Eur. J. Immunol. 24, 665-671. Wiler, R., Leber, R., Moore, B. B., van Dyk, L. F., Perryman, L. E., Meek, K. (1995). Equine severe combined immunodeficiency: a defect in V(D)J recombination and DNAdependent protein kinase activity. Proc. Natl Acad. Sci. USA 92, 11485-11489. Williams G. T., Venkitaranan, A. R., Gilmore, D. J., Neuberger, M. S. (1990). The sequence of the/x transmembrane segment determines the tissue specificity of the transport of immunoglobulin M to cell surface. J. Exp. Med. 171,947-952. Williams, G. T., Dariavach, P., Venkitaraman, A. R., Gilmore, D. J., Neuberger, M. S. (1993). Membrane immunoglobulin without sheath or anchor. Mol. Immunol. 30, 1427-1432. Williams G. T., Peaker, C. J., Patel, K. J., Neuberger, M. S. (1994). The alpha/beta sheath and its cytoplasmic tyrosines are required for signaling by the B-cell antigen receptor but not for capping or for serine/threonine-kinase recruitment. Proc. Natl Acad. Sci. USA 91,474-478. Wilson, R. W., Ballantyne, C. M., Smith, C. W., Montgomery, C., Bradley, A., O'Brien, W. E., Beaudet, A. L. (1993). Gene targeting yields a CD18-mutant mouse for study of inflammation. J. Immunol. 151, 1571. Winkler, T. H., Melchers, F., Rolink, A. G. (1995). Interleukine-3 and Interleukine-7 are alternative growth factors for the same B-cell precursors in the mouse. Blood 85, 2045-2051. Winter, E., Radbruch, A., Krawinkel, U. (1985). Members of

601

novel VH gene families are found in VDJ regions of polyclonally activated B-lymphocytes. EMBO J. 4, 2861-2867. Woloschak, G. E., Chang-Liu, C. M., Chung, J., Libertin, C. R. (1996). Expression of enhanced spontaneous and gamma-rayinduced apoptosis by lymphocytes of the wasted mouse./nt. J. Radiat. Biol. 69, 47-55. Wood, C., Tonegawa, S. (1983). Diversity and joining segments of mouse immunoglobulin heavy chain genes are closely linked and in the same orientation: implications for the joining mechanism. Proc. Natl Acad. Sci. USA 80, 3030-3034. Wu, G. E., Paige, C. J. (1986). VH gene family utilization in colonies derived from B and pre-B cells detected by the RNA colony blot assay. EMBO J. 5, 3475-3481. Xu, H., Gonzalo, J. A., St. Pierre, Y., Williams, I. R., Kupper, T. S., Cotran, R. S., Springer, T. A., Guttierrez-Ramos, J.-C. (1994). Leukocytosis and resistance to septic shock in intercellular adhesion molecule 1-deficient mice. J. Exp. Med. 180, 95. Yancopoulos, G. D., Desiderio, D. V., Paskind, M., Kearney, J. F., Baltimore, D., Alt, F. W. (1984). Preferential utilization of the most JH proximal VH gene segments in pre-B cell lines. Nature 311,757-759. Yancopoulos, G. D., Malynn, B. A., Alt, F. W. (1988). Developmentally regulated and strain-specific expression of murine VH gene families. J. Exp. Med. 168,417-435. Zhang, J., Alt, F. W., Honjo, T. (1995). Regulation of class switch recombination of immunoglobulin heavy chain genes. In Immunoglobulin Genes (eds Honjo, T., Alt, F. W.), pp. 235-265. Academic Press, London, UK. Zhu, C., Bogue, M. A., Lim, D. S., Hasty, P., Roth, D. B. (1996). Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86, 379-389.

Further Reading for Section 2 Greene, E. C. (1968). Anatomy of the Rat. Hofner Publish. Comp., New York, USA. GrCmdman, E., Wollmer, E. (1990). Reaction Patterns of the Lymph Node. Springer-Verlag, Berlin, Germany. Heinen, E. (1995). Follicular Dendritic Cells in Normal and Pathological Conditions. Springer, New York, USA. Imai, Y., Matsuda, M., Maeda, K., Yamakaw, M., Dobashi, M., Satoh, H., Terashima, K. (1991). In Dendritic Cells in Lymphoid Tissues (eds Imai, K. et al.), pp. 3-13. Elsevier, Amsterdam, The Netherlands. Komazawa, S., Iki, H., Ohmura, M., Tsutui, S., Fujiwara, K. (1991). Comparative studies on distribution and fine morphology of the intestinal Peyer's patches in mongolian gerbils and mice. J. Vet. Med. Sci. 53,899-904. Kosco-Vilbois, M. H. (1995). An Antigen Depository of the Immune System: Follicular Dendritic Cells. Springer-Verlag, Berlin, Germany. Pastoret, P. P., Govaerts, A., Bazin, H. (1990). Immunologie Animale. MSdecine-Sciences, Flammarion, Paris, France. Sainte-Marie, G., Peng, F. S., B~lisle, C. (1982). Overall architecture and pattern of lymph flow in the rat lymph node. Am. J. Anat. 164, 275-309.

602

Savidge, T. C. (1996). The life and times of an intestinal M cell. Trends Microbiol. 4, 301-306. Szakal, A. K., Kosco-Vilbois, M. H., Tews, J. G. (1989). Annu. Rev. Immunol. 7, 91-109.

THE MOUSE MODEL

Quimby, F. W. (1989). Immunodeficient Rodents. National Academic Press, Washington DC, USA. Tew, J. G., Kosco, M. H., Burtong, F., Szakal, A. K. (1990). Immunol. Rev. 117, 185-211.

XVII

1.

THE S C I D MOUSE MUTANT: DEFINITION AND POTENTIAL USE AS A MODEL FOR IMMUNE DISORDERS

Introduction

Severe combined immunodeficiency (SCID) mice were described in 1983 by Bosma et al. (1983). For many years this model has been used to study V(D)J recombination, which is the only known form of site-specific DNA rearrangement in vertebrates. In 1988, two groups reported that the human immune system could be reconstituted in SCID mice (McCune et al., 1988; Mosier et al., 1988). Prior to this, several attempts were made instead to transfer critical elements of the human hematopoietic system into a mouse (Louwagie and Verwilghen, 1970; Kamelreid and Dick, 1988), although many of these experimental systems showed evidence of human hematopoiesis none presented the conditions necessary for long-term reconstitution with human cells of multiple lineages. SCID mice with a fully functional human immune system would be extremely valuable in biomedical research, and such mouse models became very popular. In recent years, more than 1000 publications have described experiments related to the experimental use of these chimeric animals in studies including human immunodeficiency virus (HIV) infections, vaccine development, drug testing and autoimmune diseases. However, the rush to exploit the model and to publish results obtained from only a few animals have led to an overinterpretation of the relevance of these models. In addition this has detracted from the effort to define the nature of the chimerism and complicated the interpretation of already complex biological interpretations. This review attempts to evaluate the advantages, the difficulties, and the limitations of each SCID model, in the light of our experience over the last five years (Mazingue et al., 1991; Soulez et al., 1991; Palluault et al., 1992; Cesbron et al., 1994; Lemaire et al., 1994; Pestel et al., 1994; Cadore et al., 1995; Grandadam et al., 1995; Tonnel et al., 1995; Autran et al., 1996; LasnSzas et al., 1996; Delhem et al., 1998). The reader is referred to an excellent review of Bosma and Carroll (1991) for comprehensive background information. Handbook of Vertebrate Immunology ISBN 0-12-546401-0

2.

The SCID Mouse

The homozygous mutation of the scid gene which occurred spontaneously in the BALB/c C.B.-17 strain, results in a paucity of functional B and T cells (Bosma et al., 1983). Tissues and cell lines derived from scid mice also exhibit a generalized hypersensitivity to 7 irradiation and a defect in the repair of double-strand DNA breaks (Fulop and Phillips, 1990; Biedermann et al., 1991; Hendrickson et al., 1991). The SCID immune defect results from selective impairment of the joining of coding sequences during V(D)J recombination (Lieber et al., 1988; Malynn et al., 1988; Blackwell et al., 1989). Correspondingly, broken molecules with coding ends are observed to accumulate in the scid mouse thymus (Roth et al., 1992). The mouse scid locus is located on chromosome 16, linked to the 15 and VpreB loci, at 1 cM centromeric from the lgL locus (Bosma et al., 1989; Bosma and Carroll, 1991; Miller et al., 1993). X-ray-hypersensitive Chinese hamster ovary cells carrying mutations in at least three different complementation groups exhibit impaired rearrangement of extrachromosomal V(D)J recombination substrates in cotransfection experiments with recombination-activating (RAG) genes (Pergola et al., 1993; Taccioli et al., 1994). One of these complementation groups, typified by the V3 mutation, is associated with preferential impairment of coding joint formation; this complementation group is represented in the mouse by the scid locus (Taccioli et al., 1994). A second group of complementation which includes the CHO xrs-5 and xrs-6 mutations, encodes a subunit of the Ku antigen, a p86/70 heterodimer that binds DNA ends and associates with the catalytic subunit of a high molecular weight DNA-dependent protein kinase (DNA-PKcs) (Getts and Stamato, 1994; Rathmell and Chu, 1994; Taccioli et al., 1994). In humans, a gene that restores normal radio-resistance, double-strand-break repair and V(D)J recombination to scid cells has been mapped to human chromosome 8qll (Itoh et al., 1993; Kirchgessner et al., 1993; Komatsu et al., 1993; Banga et al., 1994; Kurimasa et al., 1994). No other synteny between mouse chromosome 16 and human chromosome 8 is known. The Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved

SCID MICE

604

gene encoding DNA-PKcs maps to the same interval, and a yeast artificial chromosome clone spanning the DNA-PKcs locus complements the V3 defect in radio-resistance and V(D)J recombination, suggesting that the scid mutation affects expression or activity of DNA-PKcs (Blunt et al., 1995; Kirchgessner et al., 1995; Peterson et al., 1995). No other human DNA repair or immune deficiency diseases that map to this region are known. V(D)J recombination is the major source of B and T cell antigen receptor diversity. Consequently, the scid mutation leads to a failure of functional B and T cells. Natural killer (NK) cell function is unaffected (Dorshkind et al., 1985) and apparently, myeloid cells function normally (Dorshkind et al., 1984; Bancroft et al., 1994). When housed in conventional facilities SCID mice die from opportunistic infections when they are 5-6 months old, whereas in a pathogen-free environment SCID mice survive normally for 1-2 years. However, 10% develop a T-cell lymphoma (Bosma et al., 1983).

11

The SCID Model of Human Immune Responses

The SCID-hu mouse model

Description of the model The SCID-hu mouse is created by surgical implantation of human fetal lymphoid organs into the SCID mouse (McCune et al., 1988). Early constructs of SCID-hu mice were obtained with human fetal thymus harvested during the 18-24 weeks of gestation up to 18 h after interruption of pregnancy, and implanted under the kidney capsule of the mice. Postnatal human thymic tissues can be maintained in the SCID mouse but enlarge to a minimal extent, if at all (Barry et al., 1991). The implanted human thymus quickly becomes vascularized and histological analysis shows that the development of the human tissue in SCID mice is almost indistinguishable from normal human ontogeny (McCune et al., 1988). However, follow-up of the grafts shows a progressive decrease in the relative number of immature thymocytes, and finally a total thymic involution. Reasoning that the duration of T lymphopoiesis might be prolonged if human hematopoietic stem cells were provided to the thymus implant, fragments of fetal liver and thymus were co-implanted contiguous to one another. The liver implant did not persist, engrafted alone, or in the presence of thymus. For 6-11 months post-implantation, the thymus graft exhibited a full range of differentiating thymocytes, and its microanatomical structure was similar to that of a fresh, age-matched thymus (Namikawa et al., 1990). It has been reported that the thymic interlobular septae contained hematopoietic foci, including blast cells, myelomonocytic

elements, megararyocytes, clonogenic myeloerythroid progenitors (Namikawa et al., 1990), or B cells (Vandekerckhove et al., 1993). However, in our work, we have not observed such 'thymic islets' of human hematopoietic differentiation (Autran et al., 1996). Human T cells could be observed in the peripheral circulation for up to 10-12 months in 50% of chimeric animals (Namikawa et al., 1990; Autran et al., 1996). They are CD3 +, ~fi TCR +, with a CD4 + CD8 + ratio of about 2:1. Approximately 75% are CD45RA +, and thus naive T cells, whereas 18% express CD29, a marker of more mature or memory cells. T-lymphocytes from SCID-hu mice appeared functional, as suggested by the expression of the CD69 marker in response to a CD3 Sepharose or PHA stimulation, and by their proliferation after alloantigenic challenge in the presence of recombinant IL-2, or by their cytokine production (Krowka et al., 1991; Vandekerckhove et al., 1994; Vanhecke et al., 1995). The TCR repertoire is polyclonal and very similar to that encountered in healthy humans (Vandekerckhove et al., 1991, 1992a). These studies have also shown the lack of xenoreactive human cells in SCID-hu mice, whereas a graftversus-host reaction (GvH) frequently occurs when adult human peripheral blood leukocytes (PBLs) are injected into SCID mice (see below). These, and additional data, have been reviewed previously in detail (McCune et al., 1991). The SCID-hu model provides a relatively large recipient for the human thymocytes (ranging between 107 and 108 cells. However, human T cells in the peripheral mouse circulation represented rarely more than 5% of the total leukocytes) (Kaneshima et al., 1994; Autran et al., 1996). No other human cell lineages are detectable in the periphery. No primary or secondary immune response is obtained in this model. Therefore, its primary application is in the analysis of human T-lymphoid differentiation, function, and pathology within the context of the organ itself, such as the induction of tolerance in vivo (Vandekerckhove et al., 1992b; Baccala et al., 1993; Kraft et al., 1993). This approach should allow the development of quantitative and qualitative assays to aid the purification of immature human cells (Peault et al., 1991; Baum et al., 1992; Kraft et al., 1993) and will be described in more detail below. The SCID-hu mice model as an in rivo model for the physiopathological analysis of human viral diseases Much of the work on this model has focused on HIV infection (Namikawa et al., 1988). It has been shown that HIV infection is associated with suppression of human thymopoiesis (Aldrovandi et al., 1993; Bonyhadi et al., 1993; Autran et al., 1996), while this is not the case when the human grafts are infected with human cytomegalovirus (Mocarski et al., 1993; Brown et al., 1995). HIV damage to thymic stromal cells might contribute to T-cell depletion and thymic dysfunction (Stanley et al., 1993;

The SCID Model of Human Immune Responses

Autran et al., 1996; Ogura et al., 1996). Varicella zoster virus has also been demonstrated to replicate in T lymphocytes (Moffat et al., 1995). Wild-type measles virus infection of the thymic stroma leads to induction of thymocyte apoptosis and may contribute to long-term alteration of immune responses (Auwaerter et al., 1996). It is generally proposed that the extent of thymic disruption reflects the virulence of the virus studied, and therefore the SCID-hu mouse may serve as a model for the study of viral pathogenesis.

The SCID-hu chimera optimized by co-implanting various fetal human organs The aim of these studies was to add either a microenvironment in which a pluripotent human hematopoietic stem cell could self-renew and differentiate, or a secondary functional compartment through which mature human progeny from the liver/thymus structure could migrate, and differentiate. Kyoizumi et al. (1992) implanted human fetal long bones into the subcutaneous space of the SCID mouse. While active multilineage hematopoiesis could be observed in the bones, no T lymphocytes or small CD19 + and CD33 + cells were found in the periphery (Kyoizumi et al., 1992). More details are available in section 5 (The SCID Model of Normal and Neoplastic Human Hematopoiesis). A methodology for implanting human lymph nodes has been developed. However, these organs disappeared progressively (McCune, 1992). Similarly, the implantation of human fetal lung into SCID mice resulted in the development of normal human alveolar and bronchiolar lung compartments as, indicated by the presence of mucus, cells with moving ciliae in the derived culture, and human macrophages (CD68+) (Cesbron et al., 1994). While this model provided the opportunity to study human viruses with lung tropism and for helping to define gene therapy protocols in human lung cells (Peault et al., 1994), no improvement in the immune response was observed. Similarly, the SCID mouse model has been used to investigate human gastrointestinal ontogenesis. Human fetal gut is able to undergo region-specific morphogenesis and epithelial cytodifferentiation when transplanted subcutaneously into SCID mice (Savidge et al., 1995). However, despite many efforts to develop this model, we were unable to engraft this tissue in a reproducible manner (Figure XVII. 3.1-see colour plate).

Limitations of the SCID-hu model Limitations of this system include a low level of migration of human immune cells through the murine tissues, the absence of an immune response and the dependence on fetal tissues which are not easy to procure (Cadore et al., 1995).

605

The Hu-PBL-SCID

mouse

Description of the model An alternative approach toward introducing human immune cells into SCID mice involves intraperitoneal injection of adult human PBLs (Mosier et al., 1988). During the first 3 weeks after intraperitoneal injection of PBLs, most injected cells can be detected in the peritoneal cavity (Hoffmannfezer et al., 1992), although their number progressively declines. Human cells are not detectable in the mouse organs that could potentially support the T-cell maturation (i.e. the thymus, the liver or the spleen). Injection of either cord blood, splenocytes or human bone marrow does not lead to any long-term engraftment, meaning that mice do not provide the appropriate environment for the establishment of human lymphopoiesis (Tary Lehmann and Saxon, 1992; Alegre et al., 1994; Reinhardt et al., 1994). However, after conditioning of SCID mice by irradiation, the additional injection of human lymphokines yields several human myeloid and lymphoid cell lineages (Lubin et al., 1991; Lapidot et al., 1992b; Chen et al., 1995). This point will be developed in section 5. After 1 month, human T and B leukocyte markers appear in the spleen, the liver, the intestines and the lung of the SCID mice, but not (or very few) in lymph nodes (Saxon et al., 1991; Abedi et al., 1992; Tary Lehmann and Saxon, 1992). Human T cells, which constitute the majority of these cells (>95%), appear in these organs in substantial numbers but are uniformly single-positive and express HLA-DR and CD45R0, which defines them as mature and activated/memory cells (Duchosal et al., 1992b; Tary Lehmann and Saxon, 1992; Hoffmannfezer et al., 1993). No human macrophage or other accessory cells are detectable. B cells are oligoclonal (Saxon et al., 1991) and frequently cannot be detected (Carlsson et al., 1992; Tary Lehmann and Saxon, 1992; Hoffmannfezer et al., 1993). The peripheral distribution of T cells is characteristic of mature activated/memory T cells that have downregulated their lymph node homing receptor; they are anergic and unresponsive to stimulation with anti-CD3 or mitogens (Tary Lehmann and Saxon, 1992). The human T cell repertoire is limited to xenoreactive clones against mouse antigens, which suggests a chronic GvH stimulation (Tary Lehmann et al., 1994, 1995). From these results, Tary Lehmann et al. (1995) have proposed that naive and memory T cells that do not encounter their cognate antigen during the first 2-3 weeks post-engraftment die, while the reactive clones against murine antigens are stimulated and clonally expand, becoming undetectable once more by month 5 post-engraftment. The compartmentalization of human accessory cells and human T cells within the peritoneal cavity appears to be critical: no recolonization could be observed when purified T cells were injected intraperitoneally or when PBLs were injected intravenously (Mosier et al., 1988).

SCID MICE

606

Significant levels of human immunoglobulins can be detected in the serum of the hu-PBL-SCID mice (Mosier et al., 1988; Abedi et al., 1992; Tary Lehmann and Saxon, 1992). During the first 3 weeks antigen-specific immune response can be induced in the chimeras. In agreement with the proposed model of hu-PBL-SCID chimerism (Tary Lehman et al., 1995), an antibody response to recall antigen, against which the donor was sensitized, was often observed (Duchosal et al., 1992a; Neil and Sammons, 1992; Aaberge et al., 1996). Alternatively, the PBLs are challenged in vitro with the antigen before injection. Activated human B cells can subsequently be fused with myeloma cells (Carlsson et al., 1992; Neil and Sammons, 1992). However, a primary immune response has been reported by various groups (Mazingue et al., 1991; Aaberge et al., 1992; Ifverson et al., 1995; Bombil et al., 1996). Hu-PBLs SCID mice as a model for infectious diseases While human engrafted lymphocytes are not functional after 3 weeks post-engraftment, they are still susceptible to lymphotropic viruses such as HIV (Mosier et al., 1991), the Epstein-Barr (EB) virus (Rowe et al., 1991) or prions (Lasm~zas et al., 1996). After the initial report (Mosier et al., 1988) that the hu-PBL-SCID model was associated with a high frequency of outgrowth of B cells transformed with EB virus (Mosier et al., 1992; Riddell and Greenberg, 1995), some reports claimed a strong correlation between EB virus seropositivity of donors and the efficiency of the immune reconstitution (Torbett et al., 1991; Duchosal et al., 1992b), although others did not report such a correlation (Aaberge et al., 1992; Chiang et al., 1995; Steinsvik et al., 1995). Direct microorganism-mediated pathology can be studied in hu-PBLoSCID mice in the absence of pathology mediated by the immune response of the host. Effector functions of human T cells can also be tested in vivo by adoptive transfer into the chimeras (Riddell and Greenberg, 1995). SCID mice grafted with PBLs from gp160vaccinated donors were shown to resist to HIV infection (Mosier et al., 1993a). Adoptive transfer of the Nef-specific human CTL clone into SCID mice also protected them against an HIV challenge (van Kuyk et al., 1994). The ability to use a human-mouse chimeric model to generate CTLs in vivo would represent a further advance toward the establishment of a model for vaccine testing with naive lymphocytes. However, few investigators have succeeded in obtaining human T-cell responses in SCID mice by improving their engraftment. Segall et al. (1966) succeeded in obtaining an anti-Nef CTL response in SCID mice by immunization with a recombinant vaccinia-nef virus, within the first few weeks post-transplant through conditioning of recipient mice with sublethal irradiation and by using a large inoculum of human PBLs (80 x 106 per mouse). However, these authors did not derive a human Tcell line from the hu-PBL-SCID mice, rendering the demonstration of the MHC-restricted and Nef-specific

response incompleted. In addition, the T cell response was only positive within the first weeks after the engraftment, before the antigenic repertoire of the human T cells deviates toward the xenoreactive clones (Tary Lehmann et al., 1994). In another study, Malkowska et al. (1994) showed that V-g9/V-d2 cytotoxic T cells can be generated in vivo by immunization of hu-PBL-SCID mice with irradiated Daudi lymphoma, and that such mice are protected against subsequent IP challenge with the live lymphoma. However, these V-g9/V-d2 cytotoxic T cells are not conventional allogeneic CTLs because they recognize a homologue of the GroEL heat-shock protein family in an MHC-unrestricted manner, reminiscent of a superantigen response (Fisch et al., 1990, 1992). hu-PBLs SCID as a model for immune diseases A detailed general review will not be undertaken, since this topic has been recently reviewed (Elkon et al., 1993; Elkon and Ashany, 1994; Jorgensen et al., 1995; Tonnel et al., 1995). Xenogeneic engraftment of SCID mice is not restricted to human tissues Components of immune system from bovines (Boermans et al., 1992; Balson et al., 1993; Greenwood and Croy, 1993; Greenwood et al., 1996), equines (Balson et al., 1993), and felines (Meers et al., 1993; Johnson et al., 1994, 1995; Linenberger et al., 1995) can be transferred to

these immunodeficient mice. These studies are often performed in the context of infectious diseases such as theileriosis (Fell et al., 1990; Tsuji et al., 1992; Hagiwara et al., 1993a, b, 1995; Nakamura et al., 1995), babesiosis (Tsuji et al., 1995) or the feline AIDS virus (Meers et al., 1993; Johnson et al., 1995; Linenberger et al., 1995). Immune reconstitution with these species is limited by the same parameters that affect the human SCID model. It is also affected by the possible unavailability of recombinant growth factors or species-specific immunological reagents.

The SClD-Skin mouse model

Description of the model Very few non-neoplastic tissues/cells from human adult, other than those from the immunological system, have been successfully engrafted into SCID mice. Levi and Bunge (1994). have analysed the capacity of human Schwann cells to form myelin around regenerating mouse axons. Valentine et al. (1994) showed that the SCID mouse allows the in vivo reconstitution of thyroid follicles from thyroid monolayer cells when transplanted subcutaneously within an extracellular basement membrane matrix. Normal human myoblasts transplanted in the anterior tibias of SCID mice were able to fuse and

The SClD 'Leaky' Phenotype and New Immune-deficient Murine Strain

produce dystrophin in injected muscles of the mice (Huard et al., 1994a, b). The skin model has been more extensively developed because human skin is relatively easily obtained in collaboration with reconstitutive plastic surgeons. The demonstration of skin engraftment onto SCID mice was first described using grafts from recessive dystrophic epidermolysis bullosa patients (Kim et al., 1992). Grafting of normal human skin onto SCID mice was also reported in the study of the regulation of human endothelial cell-leukocyte adhesion molecules (Yan et al., 1993, 1994), the induction of human papillomavirus V-16 DNA replication (Brandsma et al., 1995), or the role of UV light in carcinogenesis (Soballe et al., 1996). Xenografted skin preserves a fully differentiated human epidermis and dermis, up to 12 months post-transplantation, with a success rate of >90% (Figure VXII. 3.2-see colour plate). Kaufmann et al. (1993) have previously reported the presence of human skin immune cells (macrophages, lymphocytes and Langerhans cells) over 12 months of observation. However, in our hands, the Langerhans cells disappeared progressively after the third month postengraftment (Delhem et al., 1998). In an effort to overcome the absence of consistent primary immune responses in the original SCID-hu mouse model, we, and others, have grafted human skin onto the backs of the mice and injected autologous PBLs. Studies of this combined human skin and PBL graft have shown the ability of human T cells to induce first-set rejection of allogeneic human skin (Alegre et al., 1994; Murray et al., 1994), and to induce a delayed-hypersensitivity reaction after intradermic injection of tetanus toxoid (Petzelbauer et al., 1996). In this recent study (Petzelbauer et al., 1996), the adoptive transfer was performed IP with human PBLs from donors immunized with tetanus toxoid. When PBLs from non-tetanus toxoid-vaccinated donors were used, no immune response was observed, indicating the absence of a primary immune response. The obtention of a CTL response in the Hu-PBL-SCID skin model Recently, using this human-mouse chimera, we evaluated the efficacy of raising a primary CTL response in vivo against HIV-LAI env gpl60 protein by immunization with a recombinant vaccinia-Env virus (Delhem et al., 1998). The injection of vCP-LAIgp160 into the skin graft induced a perivascular human CD4+, CD8+, CD3 or CD45 + T cell infiltrate, and an epidermal recruitment of CDla +, CD80+, CD86 + Langerhans cells (LCs). In addition we were able to derive T cell lines from the human immunized engrafted skin, and observe in vitro that they exert an MHC-class II restricted cytolytic activity against target cells displaying the HIV-LAI env protein. The LCs play a pivotal role in the skin immune response (Steinman, 1991; Bos and Kapsenberg, 1993; Schmitt, 1995). The presence of activated LCs (CD86+/CD80 +) may be crucial to the

607

development of a specific T-cell response in the SCID mouse. The main difference between the experiment of Petzelbauer (1996), and ours was the supplementation with recombinant IL-2 (rlL-2). We clearly observed that in the absence of recombinant IL-2 supplementation, the immune response was weak or absent. In the SCID mouse model, an anti-CD3 activation of human PBLs and a subsequent administration of human IL-2 optimized human T-cell engraftment (Murphy et al., 1993) and administration of rlL-2 improved the homing and engraftment of PBLs from rheumatoid arthritis patients (Kaul et al., 1995). The improvement of engraftment by the administration of human interleukins will be further illustrated below. In conclusion, the hu-PBL-SCID-Skin model represents an advance over in vitro and other in vivo SCID models. The ability to induce a CTL response against a viral antigen in naive lymphocytes, might provide a useful preclinical model for vaccine testing. Because many tumors or leukemias can also be transplanted into SCID mice, they could provide a system for generating antitumor T cells and for evaluating the efficiency of antitumor immunizations.

11

The SClD 'Leaky' Phenotype and New Immune-deficient Murine Strain

The 'leaky' phenotype

A few clones of antigen receptor positive B and T lymphocytes do appear in a variable proportion (2-25%) of young adult SCID mice and in virtually all old SCID mice (Bosma et al., 1988; Carroll and Bosma, 1989; Mosier et al., 1993b). Such mice are designated 'leaky' and have been described in detail previously (Bosma and Carroll, 1991). Two explanations have been advanced to account for these observations: either the SCID V(D)J recombinase is altered to permit normal recombination at a low frequency (Hendrickson et al., 1990; Schuler et al., 1990), or it may revert to a wild-type phenotype in some lymphocyte clones under selective pressure (Petrini et al., 1990; Kotloff et al., 1993). However, there is no conclusive evidence for either explanation. For a discussion see Schuler W. (1990), Bosma and Carroll (1991) and WeeiChin and Desiderio (1995). The residual immune system in leaky SCID mice which are capable of responding to mitogens and of producing immunoglobulins and cytokines (Bosma et al., 1988; Carroll and Bosma, 1988; Carroll et al., 1989), may develop reactions to allogeneic tissues/cells and subsequently affect the engrafted immune function. It has been suggested that this immune reaction might be the reason for the considerable variation in the human immune

SCID MICE

608

reconstitution among individual mice (Armstrong et al., 1992; Tary Lehmann and Saxon. 1992; Bazin et al., 1994; Steinsvik et al., 1995). Because of this potential interference with graft acceptance, leaky mice are generally excluded from studies in which the transfer of human immune function is attempted (Torbett et al., 1991). However, the number of leaky SCID mice, and the urgency of work using human tissue from clinical activities, make this precaution difficult in practice.

Other i m m u n e - d e f i c i e n t murine strains In view of the limitations in the use of the SCID mice owing to the leaky phenotype, novel murine strains have been obtained to bypass this problem. The SCID mutation has been introduced into the CH3 strain by intensive backcrossing (Nonoyama et al., 1993). Whereas 79% of 3-month-old SCID mice showed detectable immunoglobulins in the serum, only 15% of CH3-SCID mice have immunoglobulin and only at low levels (Nonoyama et al., 1993). In our hands, however, the results of human immune reconstitution are not significantly affected, and these mice are more aggressive.

RAG knock-out mice Two genes, RAG-1 and RAG-2 have been identified as being necessary for V(D)J recombination (Weei-Chin and Desiderio, 1995). These genes have been characterized and two strains of mice containing homozygous germline disruptions have been generated (Mombaerts et al., 1992; Shinkai et al., 1992). These animals, while fertile and apparently normal in all aspects, completely lack functional B and T cells. No leaky phenotype is observed. These strains are now available, but data supporting the notion that they will make superior recipients for immune system transfer are lacking. In contrast, Steinsvik et al. (1995) have shown that RAG mice support only limited survival of human transplanted PBLs compared to the SCID mice. This suggested, as discussed above, that a certain degree of xenoreactivity as found in SCID mice, improves the survival of human cells.

SCID and NK cell-deficient mice Natural killer cells are present in SCID spleen and thymus (Dorshkind et al., 1985; Garni et al., 1990). NK activity is highly dependent on cytokines, and in particular interferon and IL-2, which are easily stimulated by bacterial or viral infections. Therefore, intercurrent infections of SCID mice lead to an elevation of NK levels and increased resistance to the engraftment of human PBLs (Mosier, 1990). The users of SCID models have to maintain SCID mice in very clean housing conditions. In addition, it has

been suggested that following xenotransplantation, activated SCID NK cells could modulate the GvH reaction and might explain the variation in the efficiency in the immune reconstitution among individual mice (Armstrong et al., 1992; Tary Lehman and Saxon, 1992; Bazin et aI., 1994; Steinsvik et al., 1995). Thus, a few groups have obtained double mutant mice for the SCID mutation and NK cell deficiency (Mosier, 1990; Froidevaux and Loor, 1991; Mosier et al., 1993b). The beige mutation causes a lysosomal storage defect that affects cytotoxic T cells and NK cells. Surprisingly, the introduction of the beige mutation into the SCID strain mutation depresses the leaky phenotype (Mosier et al., 1993b). However, the use of SCID beige mice is not very popular, while nonobese diabetic/SCID (NOD/SCID) mice have become the recipient of choice for the study of human hematopoiesis.

11

SClD Model of Normal and Neoplastic Human Hematopoiesis

The absence of in vivo assays for human hematopoietic cells has been a major limitation in the characterization of the cellular and molecular mechanisms that regulate normal and pathological hematopoiesis, hence the interest in reconstituted SCID mice as a model system.

The S C l D - H u / b o n e model Kyoizumi et al. (1992) implanted human fetal long bones into the subcutaneous space of the SCID-hu mouse. Mice were shown to sustain active human hematopoiesis in vivo for as long as 20 weeks after implantation and this human hematopoiesis was associated with multilineage differentiation in the engrafted bone. Thus, the bone marrow implants provided stem cells as well as the microenvironment requisite for their long-term maintenance and multilineage differentiation. This model was useful to assess the effect of various recombinant human hematopoietic growth factors, administered either alone, or in combination, on human hematopoiesis in vivo (Kyoizumi et al., 1993). Furthermore, this model was applied to a better understanding of the differentiation of hematopoiesis, showing that a simple fractionation based on well-defined CD34 antigen levels could be used to reproducibly isolate cells highly enriched for in vivo long-term repopulating activity and for multipotent progenitors including T- and B-cell precursors (CD34 hi population). Thus, the microenvironment of implanted fetal bone fragments has the ability to induce differentiation as well to maintain fetal and adult CD34 + Lin- selected hematopoietic progenitors (DiGiusto et al., 1994). In addition, donor CD34 + cells can repopulate secondary bone grafts, indicating that the fetal bone microenvironment in the SCID-hu mice is

SCID Model of Normal and Neoplastic Human Hematopoiesis

sufficient for maintenance and proliferation of early progenitors (Chen et al., 1994). Microinjection of enriched human fetal liver and umbilical cord blood hematopoietic stem cell populations in irradiated SCID-hu transplanted with bone, thymus and spleen fragments resulted in donorderived B cells, myeloid cells, immature and mature T cells (Fraser et al., 1995). The classical SCID-hu model is useful in the study of lymphoid reconstitution and differentiation. Peault et al. (1991) showed that low numbers of fetal CD34 § progenitor cells can repopulate the lymphoid compartment in the human thymus. CD34 § transduced with the neoR gene engrafted, reconstituted the lymphoid compartments of the human thymus in SCID-hu, potentially allowing testing of gene therapeutic reagents for both genetic and acquired diseases of the T-lymphoid cell lineage (Akkina et al., 1991).

609

transduced with retroviruses, distinguishing them from most CFCs and LTC-ICs (Larochelle et al., 1996). This observation is consistent with the low level of gene marking seen in human gene therapy trials. The limitations of both models are the low count of human cells harvested in the mouse, and variation in the reproducibility of this in vivo model for hematopoietic stem cell development and differentiation.

SCID mouse models of human hematological diseases

Many human solid tumors can be xenografted into immune deficient nude mice, but leukemias and lymphomas typically grow as an ascites or as localized subcutaneous tumors in these recipients, neither of which is analogous to the human disease.

SCID bone m a r r o w engrafting

Leukemia

In 1988, Kamelreid and Dick described a system closely modeled on conventional bone marrow transplantation assays employing intravenous injection of adult bone marrow into SCID mice conditioned by irradiation. Doses of 400-450 cGy of whole body irradiation are routinely used. Human macrophage progenitors migrate to the murine marrow, increase in number, and are maintained in this environment for several months; however, no mature cells are detected. The adjunction of cell growth factors (stem cell factor and PIXY 321) allowed the detection of immature stem cells, with differentiated human cells of multiple myeloid and lymphoid lineages (Lapidot et al., 1992b). The transplantation of human cord blood cells resulted in high levels of multilineage engraftment, including myeloid and lymphoid lineages and the treatment with cytokines was not required, suggesting that neonatal cells provided their own cytokines in a paracrine fashion (Vormoor et al., 1994b). Human peripheral blood stem cells (PBSCs) injected to SCID mice resulted in prolonged generation of physiological levels of human cytokines including IL-3, IL6 and granulocyte macrophage colony-stimulating factor in the murine blood over a period of at least 4 months (Goan et al., 1995). Similar results were observed in NOD/ SCID with the engraftment of a small number of primitive cells that proliferate and differentiate in the murine microenvironment, producing large numbers of long-term culture-initiating cells (LTC-IC), in vivo colony-forming cells (CFC), immature CD34§ - cells, and also mature myeloid, erythroid and lymphoid cells (Lapidot et al., 1992b; Vormoor et al., 1994a; Torbett et al., 1995). The primitive cells that initiate the graft were operationally defined as SCID-repopulating cells (SRCs) (Vormoor et al., 1995; Dick, 1996); the SRC, exclusively present in the CD4 § CDS- fraction, capable of multilineage repopulation of the bone marrow of NOD/SCID mice, are rarely

The availability of SCID mice has allowed the examination of the in vivo homing, engraftment, and growth patterns of neoplastic human hematopoietic cells (Dick et al., 1992). Primary leukemia cells or leukemia cell lines from patients with acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML), chronic myelocytic leukemia (CML), or chronic lymphocytic leukemia (CLL) have been found to cause overt leukemia in SCID mice, with a pattern reminiscent of human clinical disease (Uckun, 1996). Human ALL cells can cause overt leukemia in SCID mice, and SCID mice may provide an efficient and reproducible model to study the pathogenesis, and for evaluation of therapy (Cesano et al., 1991; Gunther et al., 1993; Uckun et al., 1995b). Furthermore the ability of leukemic cells from newly diagnosed patients to cause leukemia are associated with poor event-free survival in patients from whom the cells were obtained (Cesano et al., 1992; Uckun et al., 1994). Taken together, these studies show that the SCID mouse model may provide important prognostic information for patients with ALL. The information obtained using these models may also be useful for planning the components of intensification and maintenance of therapy. Despite the growth of cytokine-independent AML cell lines in SCID mice, the outcome of initial attempts to grow primary leukemic cells from adult patients with AML has been inconsistent (Cesano et al., 1992; Sawyers et al., 1992; De-Lord et al., 1994). Contrary to the aforementioned studies, Lapidot et al. (1992) and Cesano et al. (1992) reported that primary leukemic cells from some patients with newly diagnosed or relapsed AML are able to cause disseminated leukemia in SCID mice. Lapidot et al. (1994) recently reported that a cytokine-dependent immature cell is responsible for initiating human AML after transplantation and leukemic cell proliferation was seen only with CD34 § CD38- immature leukemic cells. However, some

610

studies have established the sublethally irradiated SCID mouse as an in vivo model system that could replicate human childhood AML without administration of cytokines (Chelstrom et al., 1994). However, cells obtained from patients in blast crisis show an invasive growth pattern, whereas cells from CML patients in the chronic phase show lower engraftment (Sirard et al., 1996). Attempts to establish SCID mouse models of chronic lymphocytic leukemia (CCL) have been largely unsuccessful, with sequestration of leukemic cells in the spleen (Kobayashi et al., 1992). Thus, SCID mice do not provide a suitable microenvironment for the growth of primary human CLL. Epstein-Barr virus lymphomas Burkitt's lymphoma, nasopharyngeal carcinoma and large cell lymphomas are associated with EB virus infection. In vivo studies of EB virus are hampered because the natural host range is restricted to humans. As pointed out in the previous section on hu-PBL-SCID, all mice reconstituted with adult PBL may develop human B cell malignancy, since the majority of adult humans are infected with this herpes virus. The appearance of tumors in hu-PBL-SCID mice depends on the number of PBLs injected and on the serological status of the donors. Typically, the lymphomas arising in SCID mice resemble large cell lymphomas (Okano et al., 1990; Rowe et al., 1990, 1991), and are characteristic of in vitro transformed lymphoblastoid cell lines. They have a diploid karyotype without rearrangement. Burkitt-like tumor-related lymphoma (monoclonal and with genetic alterations) was developed successfully in huPBL-SCID mice infected with EB virus particles (Dosch et al., 1991). Many aspects of EB virus lymphomagenesis, including the role of immune surveillance (Baiocchi et al., 1995; Lacerda, 1996; Sutkowski et al., 1996), might be studied in SCID mice given the remarkable frequency of tumor development in these animals. The SCID mouse model is useful for testing innovative leukemia therapy programs Uckun et al. (1995) have recently compared the antileukemic activity of 15 agents in the SCID mouse model of human ALL, and showed that inhibitors targeted to CD19 receptor associated tyrosine kinases may have therapeutic potential in the treatment of ALL. Cesano et al. (1994) used a SCID mouse model of human AML to determine the effectiveness of a novel adoptive transfer approach with a human killer T-cell clone. The cure of disseminated xenografted human Hodgkin's tumors by bispecific monoclonal antibodies and human cells has been shown in a SCID mouse model (Renner et al., 1996), while Franken et al. (1996) showed that complete macroscopic regression of established B-cell lymphoma in mice was observed after

SCID MICE

the injection of an EBNA2-responsive EB virus promoter driving a suicide gene (Franken et al., 1996). SCID mice support the growth of human tumors of nonhematopoietic origin Several reports suggest that SCID mice are good recipients for studying the growth of human tumor cell lines and primary tumor tissue (Mueller et al., 1991; Nomura et al., 1991; Yano et al., 1996). Most important is the greater degree of metastatic spread observed in SCID mice compared with nude mice (Nomura et al., 1991). More information is available in the review by Williams et al. (1993). In addition, canine (Sugimoto et al., 1994; Anderson et al., 1995) or feline (Maruo et al., 1995; Shtivelman and Namikawa, 1995) tumors can also grow in SCID mice. Conclusions The SCID mouse model is useful in studying human leukemias, evaluating the effects of new drugs and patient prognosis. However, limitations of this model include the fact that the results of leukemia biology in a SCID mouse environment need to be interpreted with caution; the pharmacodynamic studies have to be clarified because therapeutic concentrations may not be achievable without toxicity in patients, and a drug specifically directed against human leukemia cells will not react with mouse tissues, leading to reduced systemic toxicity and greater antileukemic potency.

11

Use of the SCID Model Without Reconstitution

Non reconstituted SCID can be used to establish animal models for infectious diseases

While the SCID mice have been used extensively as xenografts recipients or in selective reconstitution experiments to elucidate the role of immune components in the physiopathology of the infectious diseases, non reconstituted SCID mice have also been used to establish animal models of opportunistic infection and of parasitic diseases such a filarialsis (Nelson et al., 1991) or amebiasis (Cieslak et al., 1992); see Seydel and Stanley (1996) for a review.

The role for the immune system in reproduction remains unclear

SCID mice may be used to study major questions in the field of reproductive immunology. For example, Croy (1993) showed that the transfer of M u s caroli embryos to the uteri of pseudopregnant scid/scid mice disproved the

R

e

f

e

r

e

n

c

hypothesis that antigen-specific immune rejection of fetuses occurred in this model of midgestational pregnancy failure. Xenogeneic engraftment of embryonic and uterine tissues into scid/scid mice is also successful and has the potential for facilitating studies of the fetomaternal interface in domestic animal species, such as cattle and horses (Crepeau and Croy, 1988; Croy, 1993; Ossa et al., 1994).

7.

Acknowledgements

This work was supported by the Agence Nationale de Recherches sur le SIDA. Nadirah Delhem is a granted investigator of the S I D A C T I O N association. We thank Ray Pierce for critical reading of the manuscript.

8.

References

Aaberge, I. S., Miehaelsen, T. E., Rolstad, A. K., Groeng, E. C., Solberg, P., Lovik, M. (1992). SCID-hu mice immunized with a pneumococcal vaccine produce specific human antibodies and show increased resistance to infection. Infect. Immun. 60(10), 4146-4153. Aaberge, I. S., Steinsvik, T. E., Groeng, E. C., Leikvold, R. B., Lovik, M. (1996). Human antibody response to a pneumococcal vaccine in SCID-PBL-hu mice and simultaneously vaccinated human cell donors. Clin. Exp. Immunol. 105(1), 12-17. Abedi, M. R., Christensson, B., Islam, K. B., Hammarstrom, L., Smith, C. I. E. (1992). Immunoglobulin production in severe combined immunodeficient (SCID) mice reconstituted with human peripheral blood mononuclear cells. Eur. J. Immunol.

22(3), 823-828. Akkina, R. K., Rosenblatt, J. D., Campbell, A. G., Chen, I. S., Zack, J. A. (1994). Modeling human lymphoid precursor cell gene therapy in the SCID-hu mouse. Blood 84(5), 1393-1398. Aldrovandi, G. M., Feuer, G., Gao, L. Y., Jamieson, B., Kristeva, M., Chem, I. S. Y., Zack, J. A. (1993). The SCID-hu mouse as a model for HIV-1 infection. Nature 363(6431), 732-736. Alegre, M. L., Peterson, L. J., Jeyarajah, D. R., Weiser, M., Bluestone, J. A., Thistlethwaite, J. R. (1994). Severe combined immunodeficient mice engrafted with human splenocytes have functional human T cells and reject human allografts. J. Immunol. 153(6), 2738-2749. Anderson, P. M., Meyers, D. E., Hasz, D. E., Covalcuic, K., Saltzman, D., Khanna, C., Uckun, F. M. (1995). In vitro and in vivo cytotoxicity of an anti-osteosarcoma immunotoxin containing pokeweed antiviral protein. Cancer Res. 55(6), 1321-1327. Armstrong, N., Cigel, F., Borcherding, W., Hong, R., Malkovska, V. (1992). In vitro preactivated human T cells engraft in SCID mice and migrate to murine lymphoid tissues. Clin. Exp. Immunol. 90(3), 476-482. Autran, B., Guiet, P., Raphael, M., Grandadam, M., Agut, H., Candotti, D., Grenot, P., Puech, F., Debre, P., Cesbron, J. Y. (1996). Thymocyte and thymic microenvironment alterations during a systemic HIV infection in a severe combined immunodeficient mouse model. AIDS 10(7), 717-727. Auwaerter, P. G., Kaneshima, H., McCune, J. M., Wiegand, G., Griffin, D. E. (1996). Measles virus infection of thymic

e

s

6

1

1

epithelium in the SCID-hu mouse leads to thymocyte apoptosis. J. Virol. 70(6), 3734---3740. Baccala, R., Vandekerckhove, B. A. E., Jones, D., Kono, D. H., Roncarolo, M. G., Theofilopoulos, A. N. (1993). Bacterial superantigens mediate T-cell deletions in the mouse severe combined immunodeficiency-human liver/thymus model. J. Exp. Med. 177(5), 1481-1485. Baiocchi, R. A., Ross, M. E., Tan, J. C., Chou, C. C., Sullivan, L., Halder, S., Monne, M., Selden, M. V., Narula, S. K., Sklar, J., Croce, C. M., Caligiuri, M. A. (1995). Lymphomagenesis in the SCID-hu mouse involves abundant production of human interleukin-10. Blood 85(4), 1063-1074. Balson, G. A., Croy, B. A., Ross, T. L., Yager, J. A. (1993). Demonstration of equine immunoglobulin in sera from severe combined immunodeficiency/beige mice inoculated with equine lymphocytes. Vet. Immunol. Immunopathol. 39(4), 315-325. Bancroft, G. J., Kelly, J. P., McDonald, V. (1994). Models of innate immunity and opportunistic infection in the SCID mouse. Res. Immunol. 145(5), 344-347. Banga, S. S., Hall, K. T., Sandhu, A. K., Weaver, D. T., Athwal, R. S. (1994). Complementation of V(D)J recombination defect and X-ray sensitivity of scid mouse cells by human chromosome 8. Mutat. Res.-DNA Repair 315(3), 239-247. Barry, T. S., Jones, D. M., Richter, C. B., Haynes, B. F. (1991). Successful engraftment of human postnatal thymus in severe combined immune deficient (SCID) mice: differential engraftment of thymic components with irradiation versus antiasialo GM-1 immunosuppressive regimens. J. Exp. Med. 173(1), 167-180. Baum, C. M., Weissman, I. L., Tsukamoto, A. S., Buckle,'A. M., Peault, B. (1992). Isolation of a candidate human hematopoietic stem-cell population. Proc. Natl Acad. Sci. USA 89(7), 2804-2808. Bazin, R., Boucher, G., Monier, G., Chevrier, M. C., Verrette, S., Broly, H., Lemieux, R. (1994). Use of hu-IgG-SCID mice to evaluate in vivo stability of human monoclonal IgG antibodies. J. Immunol. Methods 172(2), 209-217. Biedermann, K. A., Sun, J. R., Giaccia, A. J., Tosto, L. M., Brown, J. M. (1991). SCID mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair. Proc. Natl Acad. Sci. USA 88(4), 1394-1397. Blackwell, T. K., Ferrier, P., Malynn, B. A., Pollock, R. R., Covey, L. R., Suh, H. Y., Heinke, L. B., Fulop, G. M., Phillips, R. A., Yancopoulos, G. D., et al. (1989). The effect of the scid mutation on mechanism and control of immunoglobulin heavy and light chain gene rearrangement. Curr. Top. Microbiol. Immunol. 152(85), 85-94. Blunt, T., Finnie, N. J., Taccioli, G. E., Smith, G. C. M., Demengeot, J., Gottlieb, T. M., Mizuta, R., Varghese, A. J., Alt, F. W., Jeggo, P. A., Jackson, S. P. (1995). Defective DNAdependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80(5), 813-823. Boermans, H. J., Percy, D. H., Stirtzinger, T., Croy, B. A. (1992). Engraftment of severe combined immune deficient beige mice with bovine foetal lymphoid tissues. Vet. Immunol. Immunopathol. 34(3-4), 273-289. Bombil, F., Kints, J. P., Scheiff, J. M., Bazin, H., Latinne, D. (1996). A promising model of primary human immunization in human-scid mouse. Immunobiology 195(3), 360-375.

612

Bonyhadi, M. L., Rabin, L., Salimi, S., Brown, D. A., Kosek, J., McCune, J. M., Kaneshima, H. (1993). HIV induces thymus depletion In vivo. Nature 363(6431), 728-732. Bos, J. D., Kapsenberg, M. L. (1993). The skin immune system: progress in cutaneous biology. Immunol. Today 14(2), 75-78. Bosma, M. J., Carroll, A. M. (1991). The SCID mouse mutant: definition, characterization, and potential uses. Annu. Rev. Immunol. 9(323), 323-350. Bosma, G. C., Custer, R. P., Bosma, M. J. (1983). A severe combined immunodeficency mutation in the mouse. Nature 301(5900), 527-530. Bosma, G. C., Fried, M., Custer, R. P., Carroll, A., Gibson, D. M., Bosma, M. J. (1988). Evidence of functional lymphocytes in some (leaky) scid mice. J. Exp. Med. 167(3), 10161033. Bosma, G. C., Davisson, M. T., Reutsch, N. R., Sweet, H. O., Shultz, L. D., Bosma, M. J. (1989). The mouse mutation severe combined immune deficiency (scid) is on chromosome 16 [published erratum appears in Immunogenetics 1989; 29(3), 224]. Immunogenetics 29(1), 54-57. Brandsma, J. L., Brownstein, D. G., Xiao, W., Longley, B. J. (1995). Papilloma formation in human foreskin xenografts after inoculation of human papillomavirus type 16 DNA. J. Virol. 69(4), 2716-2721. Brown, J. M., Kaneshima, H., Mocarski, E. S. (1995). Dramatic interstrain differences in the replication of human cytomegalovirus in SCID-hu mice. J. Inf. Dis. 171(6), 1599-1603. Cadore, B., Puech, F., Cesbron, J. Y. (1995). Ethics and fetal experimental grafts of tissue on scid/scid mice. M. S.-Med. Sci. 11(5), 755-760. Carlsson, R., Martensson, C., Kalliomaki, S., Ohlin, M., Borrebaeck, C. A. K. (1992). Human peripheral blood lymphocytes transplanted into SCID mice constitute an in vivo culture system exhibiting several parameters found in a normal humoral immune response and are a source of immunocytes for the production of human monoclonal antibodies. J. Immunol. 148(4), 1065-1071. Carroll, A. M., Bosma, M. J. (1988). Detection and characterization of functional T cells in mice with severe combined immune deficiency. Eur. J. Immunol. 18(12), 1965-1971. Carroll, A. M., Bosma, M. J. (1989). Rearrangement of T cell receptor delta genes in thymus of scid mice. Curr. Top. Microbiol. Immunol. 152(63), 63-67. Carroll, A. M., Hardy, R. R., Bosma, M. J. (1989). Occurrence of mature B (IgM § B220 § and T (CD3 § lymphocytes in scid mice. J. Immunol. 143(4), 1087-1093. Cesano, A., O'Connor, R., Lange, B., Finan, J., Rovera, G., Santoli, D. (1991). Homing and progression patterns of childhood acute lymphoblastic leukemias in severe combined immunodeficiency mice. Blood 77 (11), 2463-2474. Cesano, A., Hoxie, J. A., Lange, B., Nowell, P. C., Bishop, J., Santoli, D. (1992). The severe combined immunodeficient (SCID) mouse as a model for human myeloid leukemias. Oncogene 7(5), 827-836. Cesano, A., Visonneau, S., Cioe, L., Clark, S. ~ . , Rovera, G., Santoli, D. (1994). Reversal of acute myelogenous leukemia in humanized SCID mice using a novel adoptive transfer approach. J. Clin. Invest. 94(3), 1076-1084. Cesbron, J. Y., Agut, H., Gosselin B., Candotti, D., Raphael, M., Puech, F., Grandadam, M., Debre, P., Capron, A., Autran, B. (1994). SCID-hu mouse as a model for human lung HIV-1 infection. C.R. Acad. Sci. III 317(7), 669-674.

SCID MICE

Chelstrom, L. M., Gunther, R., Simon, J., Raimondi, S. C., Krance, R., Crist, W. M., Uckun, F. M. (1994). Childhood acute myeloid leukemia in mice with severe combined immunodeficiency. Blood 84(1), 20-26. Chen, B. P., Galy, A., Kyoizumi, S., Namikawa, R., Scarborough, J., Webb, S., Ford, B., Cen, D. Z., Chen, S. C. (1994). Engraftment of human hematopoietic precursor cells with secondary transfer potential in SCID-hu mice. Blood 84(8), 2497-2505. Chen, B. P., Fraser, C., Reading, C., Murray, L., Uchida, N., Galy, A., Sasaki, D., Tricot, G., Jagannath, S., Barlogie, B., et al. (1995). Cytokine-mobilized peripheral blood CD34§247 human hematopoietic stem cells as target cells for transplantation-based gene therapy. Leukemia 9(1), $17-25. Chiang, B. L., Chou, C. C., Ding, H. J., Huang, M. S., Chen, J. M., Hsieh, K. H. (1995). Establishment of human IgE system in severe combined immunodeficient mice with peripheral blood mononuclear cells from asthmatic children. J. Allergy Clin. Immunol. 95(1), 69-76. Cieslak, P. R., Virgin, H. T., Stanley, S. J. (1992). A severe combined immunodeficient (SCID) mouse model for infection with Entamoeba histolytica. J. Exp. Med. 176(6), 16051609. Crepeau, M. A., Croy, B. A. (1988). Evidence that specific cellular immunity cannot account for death of Mus caroli embryos transferred to Mus musculus with severe combined immune deficiency diseases. Transplantation 45 (6), 1104-1110. Croy, B. A. (1993). The application of scid mouse technology to questions in reproductive biology. Lab. Anim. Sci. 43(2), 123126. Delhem, N., Hadida, F., Gorochov, G., Carpentier, F., de Cavel, J. P., Andr~ani, J. P., Autran, B., Cesbron, J. Y. (1998). AntiHIVgp 160 cytotoxic T cells lines derived from Hu-PBL SCID coengrafted with human skin after primary immunization using recombinant canary pox. J. Immunol., in press. De-Lord, C., Clutterbuck, R., Powles, R., Morilla, R., Hanby, A., Titley, J., Min, T.~ Millar, J. (1994). Growth of primary human acute lymphoblastic and myeloblastic leukemia in SCID mice. Leuk. Lymphoma 16(1-2), 157-165. Dick, J. E. (1996). Normal and leukemic human stem cells assayed in SCID mice. Semin. Immunol. 8, 197-206. Dick, J. E., Sirard, C., Pflumio, F., Lapidot, T. (1992). Murine models of normal and neoplastic human haematopoiesis. Cancer Surv. 15, 161-181. DiGiusto, D., Chen, S., Combs, J., Webb, S., Namikawa, R., Tsukamoto, A., Chen, B. P., Galy, A. H. (1994). Human fetal bone marrow early progenitors for T, B, and myeloid cells are found exclusively in the population expressing high levels of CD34. Blood 84(2), 421-432. Dorshkind, K., Keller, G. M., Phillips, R. A., Miller, R. G., Bosma, G. C., O'Toole, M., Bosma, M. J. (1984). Functional status of cells from lymphoid and myeloid tissues in mice with severe combined immunodeficiency disease. J. Immunol. 132(4), 1804-1808. Dorshkind, K., Pollack, S. B., Bosma, M. J., Phillips, R. A. (1985). Natural killer (NK) cells are present in mice with severe combined immunodeficiency (scid). J. Immunol. 134(6), 3798-3801. Dosch, H. M., Cochrane, D. M., Cook, V. A., Leeder, J. S., Cheung, R. K. (1991). Exogenous but not endogenous EBV

References

induces lymphomas in beige/nude/xid mice carrying human lymphoid xenografts. Int. Immunol. 3(7), 731-735. Duchosal, M. A.., Eming, S. A., Fischer, P., Leturcq, D., Barbas, C. F., Mcconahey, P. J., Caothien, R. H., Thornton, G. B., Dixon, F. J., Burton, D. R. (1992a). Immunization of Hu-PBLSCID mice and the rescue of human monoclonal Fab fragments through combinatorial libraries. Nature 355(6357), 258-262. Duchosal, M. A., Eming, S. A., Mcconahey, P. J., Dixon, F. J. (1992b). Characterization of hu-PBL-SCID mice with high human immunoglobulin serum levels and graft-versus-host disease. Am. J. Pathol. 141(5), 1097-1113. Elkon, K. B., Ashany, D. (1993). The SCID mouse as a vehicle to study autoimmunity. Br. J. Rheumatol. 32(1), 4-12. Elkon, K. B., Ashany, D. (1994). Autoimmunity versus allo- and xeno-reactivity in SCID mice. Int. Rev. Immunol. 11(4), 283293. Fell, A. H., Preston, P. M., Ansell, J. D. (1990). Establishment of Theileria-infected bovine cell lines in scid mice. Parasite Immunol. 12(3), 335-339. Fisch, P., Malkovsky, M., Kovats, S., Sturm, E., Braakman, E., Klein, B. S., Voss, S. D., Morissey, L. W., DeMars, R., Welch, W. J., Bolhuis, R. L., Sondel, P. M. (1990). Recognition by human V gamma 9/V delta 2 T cells of a GroEL homolog on Daudi Burkitt's lymphoma cells. Science 250, 1269-1273. Fisch, P., Oettel, K., Fudim, N., Surfus, J. E., Malkovsky, M., Sondel, P. M. (1992). MHC-unrestricted cytotoxic and proliferative responses of two distinct human gamma/delta T cell subsets to Daudi cells. J. Immunol. 148(8), 2315-2323. Franken, M., Estabrooks, A., Cavacini, L., Scerbune, B., Wang, F., Scadden, D. (1996). Epstein-Barr virus driven gene therapy for EBV-related lymphomas. Nature Med. 2, 1379-1381. Fraser, C. C., Kaneshima, H., Hansteen, G., Kilpatrick, M., Hoffman, R., Chert, B. P. (1995). Human allogeneic stem cell maintenance and differentiation in a long-term multilineage SCID-hu graft. Blood 86(5), 1680-1693. Froidevaux, S., Loor, F. (1991). A quick procedure for identifying doubly homozygous immunodeficient scid beige mice. J. Immunol. Methods 137(2), 275-279. Fulop, G. M., Phillips, R. A. (1990). The scid mutation in mice causes a general defect in DNA repair. Nature 347(6292), 479482. Garni, W. B., Witte, P. L., Tutt, M. M., Kuziel, W. A., Tucker, P. W., Bennett, M., Kumar, V. (1990). Natural killer cells in the thymus. Studies in mice with severe combined immune deficiency. J. Immunol. 144(3), 796-803. Getts, R. C., Stamato, T. D. (1994). Absence of a Ku-like DNA end binding activity in the xrs double-strand DNA repairdeficient mutant. J. Biol. Chem. 269(23), 15981-15984. Goan, S. R., Fichtner, I., Just, U., Karawajew, L., Schultze, W., Krause, K. P., yon Harsdorf, S., yon Schilling, C., Herrmann, F. (1995). The severe combined immunodeficient-human peripheral blood stem cell (SCID-huPBSC) mouse: a xenotransplant model for huPBSC-initiated hematopoiesis. Blood 86(1), 89-100. Grandadam, M., Cesbron, J. Y., Candotti, D., Vinatier, D., Pauchard, M., Capron, A., Debre, P., Huraux, J. M., Autran, B., Agut, H. (1995). Dose-dependent systemic human immunodeficiency virus infection of SCID-hu mice after intraperitoneal virus injection. Res. Virol. 146(2), 101-112. Greenwood, J. D., Croy, B. A. (1993). A study on the engraftment and trafficking of bovine peripheral blood leukocytes in severe

613

combined immunodeficient mice. Vet. Immunol. Immunopathol. 38(1-2), 21-44.

Greenwood, J. D., Bos, N. A., Croy, B. A. (1996). Offspring of xenogeneically-reconstituted scid scid mice are capable of a primary xenogeneic immune response to DNP-KLH. Vet. Immunol. Immunopathol. 50(1-2), 145-155. Gunther, R., Chelstrom, L. M., Finnegan, D., Tuelahlgren, L., Irvin, J. D., Myers, D. E., Uckun, F. M. (1993). In vivo antileukemic efficacy of anti-CD7-pokeweed antiviral protein immunotoxin against human T-lineage acute lymphoblastic leukemia/lymphoma in mice with severe combined immunodeficiency. Leukemia 7(2), 298-309. Hagiwara, K., Tsuji, M., Ishihara, C., Tajima, M., Kurosawa, T., Iwai, H., Takahashi, K. (1993a). The Bo-RBC-SCID mouse model for evaluating the efficacy of anti-theilerial drugs. Int. J. Parasitol. 23(1), 13-16. Hagiwara, K., Tsuji, M., Ishihara, C., Tajima, M., Kurosawa, T., Iwai, H., Takahashi, K. (1993b). Theileria sergenti infection in the Bo-RBC-SCID mouse model. Parasitol. Res. 79(6), 466-470. Hagiwara, K., Tsuji, M., Ishihara, C., Tajima, M., Kurosawa, T., Takahashi, K. (1995). Serum from Theileria sergentiinfected cattle accelerates the clearance of bovine erythrocytes in SCID mice. Parasitol Res. 81(6), 470-474. Hendrickson, E. A., Qin, X. Q., Bump, E. A., Schatz, D. G., Oettinger, M., Weaver, D. T. (1991). A link between doublestrand break-related repair and V(D)J recombination: the scid mutation. Proc. Natl Acad. Sci. USA 88(10), 4061-4065. Hendrickson, E. A., Schlissel, M. S., Weaver, D. T. (1990). Wildtype V(D)J recombination in scid pre-B cells. Mol. Cell Biol. 10(10), 5397-5407. Hoffmannfezer, G., Kranz, B., Gall, C., Thierfelder, S. (1992). Peritoneal sanctuary for human lymphopoiesis in SCID mice injected with human peripheral blood lymphocytes from Epstein-Barr virus-negative donors. Eur. J. Immunol. 22(12), 3161-3166. Hoffmannfezer, G., Gall, C., Zengerle, U., Kranz, B., Thierfelder, S. (1993). Immunohistology and immunocytology of human T-cell chimerism and graft-versus-host disease in SCID mice. Blood 81(12), 3440-3448. Huard, J., Roy, R., Guerette, B., Verreault, S., Tremblay, G., Tremblay, J. P. (1994a). Human myoblast transplantation in immunodeficient and immunosuppressed mice: evidence of rejection. Muscle Nerve 17(2), 224-234. Huard, J., Verreault, S., Roy, R., Tremblay, M., Tremblay, J. P. (1994b). High efficiency of muscle regeneration after human myoblast clone transplantation in SCID mice. J. Clin. Invest. 93(2), 586-599. Ifversen, P., Martensson, C., Danielsson, L., Ingvar, C., Carlsson, R., Borrebaeck, C. A. (1995). Induction of primary antigenspecific immune responses in SCID-hu-PBL by coupled T-B epitopes. Immunology 84(1), 111-116. Itoh, M., Hamatani, K., Komatsu, K., Araki, R., Takayama, K., Abe, M. (1993). Human chromosome-8 (p12-q22) complements radiosensitivity in the severe combined immune deficiency (SCID) mouse. Radiat. Res. 134(3), 364-368. Johnson, C. M., Selleseth, D. W., Ellis, M. N., Childers, T. A., Tompkins, M. B., Tompkins, W. A. (1994). Feline lymphoid tissues engrafted into scid mice maintain morphologic structure and produce feline immunoglobulin. Lab. Anim. Sci. 44(4), 313-318. Johnson, C. M., Selleseth, D. W., Ellis, M. N., Childers, T. A.,

614

Tompkins, M. B., Tompkins, W. A. (1995). Reduced provirus burden and enhanced humoral immune function in AZTtreated SCID-feline mice inoculated with feline immunodeficiency virus. Vet. Immunol. Immunopathol. 46(1-2), 169-180. Jorgensen, C., Bologna, C., Sany, J. (1995). Autoimmunity. Insights provided by the SCID mouse model. Rev. Rhum. Engl. Ed. 62(7-8), 519-524. Kamelreid, S., Dick, J. E. (1988). Engraftment of immunedeficient mice with human hematopoietic stem cells. Science 242(4886), 1706-1709. Kaneshima, H., Namikawa, R., McCune, J. M. (1994). Human hematolymphoid cells in SCID mice. Curr. Opin. Immunol. 6(2), 327-333. Kaufmann, R., Mielke, V., Reimann, J., Klein, C. E., Sterry, W. (1993). Cellular and molecular composition of human skin in long-term xenografts on SCID mice. Exp. Dermatol 2(5), 209216. Kaul, R., Sharma, A., Lisse, J. R., Christadoss, P. (1995). Human recombinant IL-2 augments immunoglobulin and induces rheumatoid factor production by rheumatoid arthritis lymphocytes engrafted into severe combined immunodeficient mice. Clin. Immunol. Immunopathol. 74(3), 271-282. Kim, Y. H., Woodley, D. T., Wynn, K. C., Giomi, W., Bauer, E. A. (1992). Recessive dystrophic epidermolysis bullosa phenotype is preserved in xenografts using SCID m i c e development of an experimental in vivo model. J. Invest. Dermatol. 98(2), 191-197. Kirchgessner, C. U., Patil, C. K., Evans, J. W., Cuomo, C. A., Fried, L. M., Carter, T., Oettinger, M. A., Brown, J. M. (1995). DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267(5201), 1178-1183. Kirchgessner, C. U., Tosto, L. M., Biedermann, K. A., Kovacs, M., Araujo, D., Stanbridge, E. J., Brown, J. M. (1993). Complementation of the radiosensitive phenotype in severe combined immunodeficient mice by human chromosome-8. Cancer Res. 53(24), 6011-6016. Kobayashi, R., Picchio, G., Kirven, M., Meisenholder, G., Baird, S., Carson, D. A., Mosier, D. E., Kipps, T. J. (1992). Transfer of human chronic lymphocytic leukemia to mice with severe combined immune deficiency. Leuk. Res. 16(10), 1013-1023. Komatsu, K., Ohta, T., Jinno, Y., Niikawa, N., Okumura, Y. (1993). Functional complementation in mouse-human radiation hybrids assigns the putative murine SCID gene to the pericentric region of human chromosome-8. Hum. Mol. Genet. 2(7), 1031-1034. Kotloff, D. B., Bosma, M. J., Ruetsch, N. R. (1993). Scid mouse pre-B cells with intracellular mu-chains- analysis of recombinase activity and IgH gene rearrangements. Int. Immunol. 5(4), 383-391. Kraft, D. L., Weissman, I. L., Waller, E. K. (1993). Differentiation of C D 3 ~ 4 - 8 - human fetal thymocytes in v i v o - characterization of a CD3-4+8 - intermediate. J. Exp. Med. 178(1), 265-277. Krowka, J. F., Sarin, S., Namikawa, R., McCune, J. M., Kaneshima, H. (1991). Human T cells in the SCID-hu mouse are phenotypically normal and functionally competent. J. Immunol. 146(11), 3751-3756. Kurimasa, A., Nagata, Y., Shimizu, M., Emi, M., Nakamura, Y., Oshimura, M. (1994). A human gene that restores the DNArepair defect in SCID mice is located on 8Pll.l-q11.1. Hum. Genet. 93 (1), 21-26.

SCID MICE

Kyoizumi, S., Baum, C. M., Kaneshima, H., McCune, J. M., Yee, E. J., Namikawa, R. (1992). Implantation and maintenance of functional human bone marrow in SCID-hu mice. Blood 79(7), 1704-1711. Kyoizumi, S., Murray, L. J., Namikawa, R. (1993). Preclinical analysis of cytokine therapy in the SCID-hu mouse. Blood 81(6), 1479-1488. Lacerda, J. F. (1996). Human Epstein-Barr virus (EBV)-specific cytotoxic T lymphocytes home preferentially to and induce selective regressions of autologous EBV-induced B cell lymphoproliferations in xenografted CB-17 scid/scid mice. J. Exp. Med. 183(3), 1215-1228. Lapidot, T., Faktorowich, Y., Lubin, I., Reisner, Y. (1992a). Enhancement of T-cell-depleted bone marrow allografts in the absence of graft-versus-host disease is mediated by CD8*CD4- and not by CD8-CD4 + thymocytes. Blood 80(9), 2406-2411. Lapidot, T., Pflumio, F., Doedens, M., Murdoch, B., Williams, D. E., Dick, J. E. (1992b). Cytokine stimulation of multilineage hematopoiesis from immature human cells engrafted in SCID mice. Science 255(5048), 1137-1141. Lapidot, T., Sirard, C., Vormoor, J., Murdoch, B., Hoang, T., Cacerescortes, J., Minden, M., Paterson, B., Caligiuri, M. A., Dick, J. E. (1994). A cell initiating human acute myeloid leukaemia after transplantation into SCID mice. Nature 367(6464), 645-648. Larochelle, A., Vormoor, J., Hanenberg, H., Wang, J. C. Y., Bhatia, M., Lapidot, T., Moritz, T., Murdoch, B., Xiao, X. L., Kato, I., Williams, D. A., Dick, J. E. (1996). Identification of primitive human hematopoietic cells capable of repopulating NOD/SCID mouse bone marrow: implications for gene therapy. Nature Med. 12, 1329-1337. Lasm~zas, C. I., Cesbron, J. Y., Deslys, J. P., Demaimay, R., Adjou, K. T., Rioux, R., Lemaire, C., Locht, C., Dormont, D. (1996). Immune system-dependent and -independent replication of the scrapie agent. J. Virol. 70(2), 1292-1295. Lemaire, R., Flipo, R. M., Monte, D., Dupressoir, T., Duquesnoy, B., Cesbron, J. Y., Janin, A., Capron, A., Lafyatis, R. (1994). Synovial fibroblast-like cell transfection with the SV40 large T antigen induces a transformed phenotype and permits transient tumor formation in immunodeficient mice. J. Rheumatol. 21(8), 1409-1419. Levi, A. D. O., Bunge, R. P. (1994). Studies of myelin formation after transplantation of human Schwann cells into the severe combined immunodeficient mouse. Exp. Neurol. 130(1), 4152. Lieber, M. R., Hesse, J. E., Lewis, S., Bosma, G. C., Rosenberg, N., Mizuuchi, K., Bosma, M. J., Gellert, M. (1988). The defect in murine severe combined immune deficiency: joining of signal sequences but not coding segments in V(D)J recombination. Cell 55(1), 7-16. Linenberger, M. L., Beebe, A. M., Pedersen, N. C., Abkowitz, J. L., Dandekar, S. (1995). Marrow accessory cell infection and alterations in hematopoiesis accompany severe neutropenia during experimental acute infection with feline immunodeficiency virus. Blood 85(4), 941-951. Louwagie, A. C., Verwilghen, R. L. (1970). Growth of haemopoietic spleen colonies after grafting of human bone marrow in mice. Nature 225,383. Lubin, I., Faktorowich, Y., Lapidot, T., Gan, Y., Eshhar, Z., Gazit, E., Levite, M., Reisner, Y. (1991). Engraftment and

References

development of human T and B cells in mice after bone marrow transplantation. Science 252(5004), 427-431. Malkovska, V., Cigel, F., Storer, B. E. (1994). Human T-cells in hu-PBL-SCID mice proliferate in response to Daudi lymphoma and confer anti-tumour immunity. Clin. Exp. Immunol. 96(1), 158-165. Malynn, B. A., Blackwell, T. K., Fulop, G. M., Rathbun, G. A., Furley, A. J., Ferrier, P., Heinke, L. B., Phillips, R. A., Yancopoulos, G. D., Alt, F. W. (1988). The scid defect affects the final step of the immunoglobulin VDJ recombinase mechanism. Cell 54(4), 453-460. Maruo, K., Sugimoto, T., Suzuki, K., Shirota, K., Ejima, H., Nomura, T. (1995). Xenotransplantation of high tumorigenicity of feline tumours in SCID mice. J. Vet. Med. Sci. 57(5), 967-969. Mazingue, C., Cottrez, F., Auriault, C., Cesbron, J. Y., Capron, A. (1991). Obtention of a human primary humoral response against schistosome protective antigens in severe combined immunodeficiency mice after the transfer of human peripheral blood mononuclear cells. Eur. J. Immunol. 21(7), 1763-1766. McCune, J., Kaneshima, H., Krowka, J., Namikawa, R., Outzen, H., Peault, B., Rabin, L., Shih, C. C., Yee, E., Lieberman, M., et al. (1991). The SCID-hu mouse: a small animal model for HIV infection and pathogenesis. Annu. Rev. Immunol. 9(399), 399-429. McCune, J. M. (1992). The SCID-hu m o u s e - a small animal model for the analysis of human hematolymphoid differentiation and function. Bone Marrow Transpl. 9($1), 74-76. McCune, J. M., Namikawa, R., Kaneshima, H., Schultz, L. D., Lieberman, M., Weissman, I. L. (1988). The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science 241(4873), 1632-1639. Meers, J., Delfierro, G. M., Cope, R. B., Park, H. S., Greene, W. K., Robinson, W. F. (1993). Feline immunodeficiency virus infection- plasma, but not peripheral blood mononuclear cell virus titer is influenced by zidovudine and cyclosporine. Arch. Virol. 132(1-2), 67-81. Miller, R. D., Ozaki, J. H., Riblet, R. (1993). The mouse severe combined immune deficiency (scid) mutation is closely linked to the B-cell-specific developmental genes VpreB and lambda5. Genomics 16(3), 740-744. Mocarski, E. S., Bonyhadi, M., Salimi, S., McCune, J. M., Kaneshima, H. (1993). Human cytomegalovirus in a SCIDhu m o u s e - thymic epithelial cells are prominent targets of viral replication. Proc. Natl Acad. Sci. USA 90(1), 104-108. Moffat, J. F., Stein, M. D., Kaneshima, H., Arvin, A. M. (1995). Tropism of varicella-zoster virus for human CD4 + and CD8 + T lymphocytes and epidermal cells in SCID-hu mice. J. Virol. 69(9), 5236-5242. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., Papaioannou, V. E. (1992). RAG-l-deficient mice have no mature lymphocytes-B and lymphocytes-T. Cell 68(5), 869-877. Mosier, D. E. (1990). Immunodeficient mice xenografted with human lymphoid cells: new models for in vivo studies of human immunobiology and infectious diseases. J. Clin. Immunol. 10(4), 185-191. Mosier, D. E., Gulizia, R. J., Baird, S. M., Wilson, D. B. (1988). Transfer of a functional human immune system to mice with severe combined immunodeficiency. Nature 335(6187), 256259. Mosier, D. E., Gulizia, R. J., Baird, S. M., Wilson, D. B., Spector,

615

D. H., Spector, S. A. (1991). Human immunodeficiency virus infection of human-PBL-SCID mice. Science 251(4995), 791794. Mosier, D. E., Picchio, G. R., Kirven, M. B., Garnier, J. L., Torbett, B. E., Baird, S. M., Kobayashi, R., Kipps, T. J. (1992). EBV-induced human B-cell lymphomas in hu-PBLSCID mice. AIDS Res. Hum. Retroviruses 8(5), 735-740. Mosier, D. E., Gulizia, R. J., Macisaac, P. D., Corey, L., Greenberg, P. D. (1993a). Resistance to human immunodeficiency virus-1 infection of SCID mice reconstituted with peripheral blood leukocytes from donors vaccinated with vaccinia gp160 and recombinant gp160. Proc. Natl Acad. Sci. USA 90(6), 2443-2447. Mosier, D. E., Stell, K. L., Gulizia, R. J., Torbett, B. E., Gilmore, G. L. (1993b). Homozygous scid/scid-beige/beige mice have low levels of spontaneous or neonatal T-cell-induced B-cell generation. J. Exp. Med. 177(1), 191-194. Mueller, B. M., Romerdahl, C. A., Trent, J. M., Reisfeld, R. A. (1991). Suppression of spontaneous melanoma metastasis in scid mice with an antibody to the epidermal growth factor receptor. Cancer Res. 51(8), 2193-2198. Murphy, W. J., Conlon, K. C., Sayers, T. J., Wiltrout, R. H., Back, T. C., Ortaldo, J. R., Longo, D. L. (1993). Engraftment and activity of anti-CD3-activated human peripheral blood lymphocytes tranferred into mice with severe combined immune deficiency. J. Immunol. 150(8 Part 1), 3634-3642. Murray, A. G., Petzelbauer, P., Hughes, C. C. W., Costa, J., Askenase, P., Pober, J. S. (1994). Human T-cell-mediated destruction of allogeneic dermal microvessels in a severe combined immunodeficient mouse. Proc. Natl Acad. Sci. USA 91(19), 9146-9150. Nakamura, Y., Tsuji, M., Arai, S., Ishihara, C. (1995). A method for rapid and complete substitution of the circulating erythrocytes in SCID mice with bovine erythrocytes and use of the substituted mice for bovine hemoprotozoa infections. J. Immunol. Methods 188(2), 247-254. Namikawa, R., Kaneshima, H., Lieberman, M., Weissman, I. L., McCune, J. M. (1988). Infection of the SCID-hu mouse by HIV-1. Science 242(4886), 1684-1686. Namikawa, R., Weilbaecher, K. N., Kaneshima, H., Yee, E. J., McCune, J. M. (1990). Long-term human hematopoiesis in the SCID-hu mouse. J. Exp. Med. 172(4), 1055-1063. Neil, G. A., Sammons, D. W. (1992). Immunization of SCID-hu mice and generation of anti-hepatitis B surface antigenspecific hybridomas by electrofusion. Hum. Antibodies Hybridomas 3(4), 201-205. Nelson, F. K., Greiner, D. L., Shultz, L. D., Rajan, T. V. (1991). The immunodeficient scid mouse as a model for human lymphatic filariasis. J. Exp. Med, 173(3), 659-663. Nomura, T., Takahama, Y., Hongyo, T., Takatera, H., Inohara, H., Fukushima, H., Ono, S., Hamaoka, T. (1991). Rapid growth and spontaneous metastasis of human germinal tumors ectopically transplanted into scid (severe combined immunodeficiency) and scid-nudestreaker mice. Jpn. J. Cancer Res. 82(6), 701-709. Nonoyama, S., Smith, F. O., Bernstein, I. D., Ochs, H. D. (1993). Strain-dependent leakiness of mice with severe combined immune deficiency. J. Immunol. 150(9), 3817-3824. Ogura, A., Noguchi, Y., Yamamoto, Y., Shibata, S., Asano, T., Okamoto, Y., Honda, M. (1996). Localization of HIV-1 in human thymic implant in SCID-hu mice after intravenous inoculation. Int. J. Exp. Pathol. 77(5), 201-206.

616

Okano, M., Taguchi, Y., Nakamine, H., Pirruccello, S. J., Davis, J. R., Beisel, K. W., Kleveland, K. L., Sanger, W. G., Fordyce, R. R., Purtilo, D. T. (1990). Characterization of Epstein-Barr virus-induced lymphoproliferation derived from human peripheral blood mononuclear cells transferred to severe combined immunodeficient mice. Am. J. Pathol. 137(3), 517-522. Ossa, J. E., Cadavid, A. P., Maldonado, J. G. (1994). Is the immune system necessary for placental reproduction? A hypothesis of the mechanisms of alloimmunotherapy in recurrent spontaneous abortion. Med. Hypotheses 42(3), 193-197. Palluault, F., Soulez, B., Slomianny, C., Dei, C. E., Cesbron, J. Y., Camus, D. (1992). High osmotic pressure for Pneumocystis carinnii London Resin White embedding enables fine immunocytochemistry studies: I. Golgi complex and cell-wall synthesis. Parasitol. Res. 78(6), 482-488. Peault, B., Weissman, I. L., Baum, C., McCune, J. M., Tsukamoto, A. (1991). Lymphoid reconstitution of the human fetal thymus in SCID mice with CD34+ precursor cells. J. Exp. Med. 174(5), 1283-1286. Peault, B., Tirouvanziam, R., Sombardier, M. N., Chert, S., Perricaudet, M., Gaillard, D. (1994). Gene transfer to human fetal pulmonary tissue developed in immunodeficient SCID mice. Hum. Gene Ther. 5(9), 1131-1137. Pergola, F., Zdzienicka, M. Z., Lieber, M. R. (1993). V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair. Mol. Cell Biol. 113(6), 3464-3471. Pestel, J., Jeannin, P., Delneste, Y., Dessaint, J. P., Cesbron, J. Y., Capron, A., Tsicopoulos, A., Tonnel, A. B. (1994). Human IgE in SCID mice reconstituted with peripheral blood mononuclear cells from Dermatophagoides pteronyssinus-sensitive patients. J. Imminol. 153(8), 3804-3810. Peterson, S. R., Kurimasa, A., Oshimura, M., Dynan, W. S., Bradbury, E. M., Chen, D. J. (1995). Loss of the catalytic subunit of the DNA-dependent protein kinase in DNA double-strand-break-repair mutant mammalian cells. Proc. Natl Acad. Sci. USA 92(8), 3171-3174. Petrini, J. H., Carroll, A. M., Bosma, M. J. (1990). T-cell receptor gene rearrangements in functional T-cell clones from severe combined immune deficient (scid) mice: reversion of the scid phenotype in individual lymphocyte progenitors. Proc. Natl Acad. Sci. USA 87(9)~,3450-3453. Petzelbauer, P., Groger, M., Kunstfeld, R., Petzelbauer, E., Wolff, K. (1996). Human delayed-type hypersensitivity reaction in a SCID mouse engrafted with human T cells and autologous skin. J. Invest. Dermatol. 107(4), 576-581. Rathmell, W. K., Chu, G. (1994). A DNA end-binding factor involved in double-strand break repair and V(D)J recombination. Mol. Cell Biol. 14(7), 4741-4748. Reinhardt, B., Torbett, B. E., Gulizia, R. J., Reinhardt, P. P., Spector, S. A., Mosier, D. E. (1994). Human immunodeficiency virus type 1 infection of neonatal severe combined immunodeficient mice xenografted with human cord blood cells. Aids Res. Hum. Retroviruses 10(2), 131-141. Renner, C., Bauer, S., Sahin, U., Jung, W. Van-Lier, R., Jacobs, G., Helde, G., Pfreundschuh, M. (1996). Cure of disseminated xenografted human Hodgkin's tumors by bi-specific monoclonal antibodies and human T cells: the role of human Tcells subsets in a preclinical model. Blood 87(7), 2930-2937. Riddell, S. R., Greenberg, P. D. (1995). Principles for adoptive T cell therapy of human viral diseases. Annu. Rev. Immunol. 13, 545-586.

SCID MICE

Roth, D. B., Menetski, J. P., Nakajima, P. B., Bosma, M. J., Gellert, M. (1992). V(D)J recombination- broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70(6), 983-991. Rowe, M., Young, L. S., Rickenson, A. B. (1990). Analysis of Epstein-Barr virus gene expression in lymphomas derived from normal human B cells grafted into SCID mice. Curr. Top. Microbiol. Immunol. 166(325), 325-331. Rowe, M., Young, L. S., Crocker, J., Stokes, H., Henderson, S., Rickinson, A. B. (1991). Epstein-Barr virus (EBV)-associated lymphoproliferative disease in the SCID mouse model: implications for the pathogenesis of EBV-positive lymphomas in man. J. Exp. Med. 173(1), 147-158. Savidge, T. C., Morey, A. L., Ferguson, D. L., Fleming, K. A., Shmakov, A. N., Phillips, A. D. (1995). Human intestinal development in a severe-combined immunodeficient xenograft model. Differentiation 58(5), 361-371. Sawyers, C. L., Gishizky, M. L., Quan, S., Golde, D. W., Witte, O. N. (1992). Propagation of human blastic myeloid leukemias in the SCID mouse. Blood 79(8), 20892098. Saxon, A., Macy, E., Denis, K., Tary, L. M., Witte, O., Braun, J. (1991). Limited B cell repertoire in severe combined immunodeficient mice engrafted with peripheral blood mononuclear cells derived from immunodeficient or normal humans. J. Clin. Invest. 87(2), 658-665. Schmitt, D. (1995). Immune response in the skin. Clin. Rev. Allergy Immunol. 13, 177-188. Schuler, W. (1990). The scid mouse mutant: biology and nature of the defect. Cytokines 3,132-153. Schuler, W., Schuler, A., Bosma, M. J. (1990). Defective V-to-J recombination of T cell receptor gamma chain genes in scid mice. Eur. J. Immunol. 20(3), 545-550. Segall, H., Lubin, I., Marcus, H., Canaan, A., Reisner, Y. (1996). Generation of primary antigen-specific human cytotoxic T lymphocytes in human/mouse radiation chimera. Blood 88(2), 721-730. Seydel, K. B., Stanley, S. L. (1996). SCID and the study of parasitic disease. Clin. Microbiol. Rev. 9(2), 126. Shinkai, Y., Rathbun, G., Lam, K. P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., Stall, A M., Alt, F. W. (1992). RAG-2-deficient mice lack mature lymphocytes owing to inability to initiate V(D)J rearrangement. Cell 68(5), 855-867. Shtivelman, E., Namikawa, R. (1995). Species-specific metastasis of human tumor cells in the severe combined immunodeficiency mouse engrafted with human tissue. Proc. Natl Acad. Sci. USA 92(10), 4661-4665. Sirard, C., Lapidot, T., Vormoor, J., Cashman, J. D., Doedens, M., Murdoch, B., Jamal, N., Messner, H., Addey, L., Minden, M., Laraya, P., Keating, A., Eaves, A., Lansdorp, P. M., Eaves, C. J., Dick, J. E. (1996). Normal and leukemic SCIDrepopulating cells (SRC) coexist in the bone marrow and peripheral blood from CML patients in chronic phase, whereas leukemic SRC are detected in blast crisis. Blood 87(4), 1539-1548. Soballe, P. W., Montone, K. T., Satyamoorthy, K., Nesbit, M., Herlyn, M. (1996). Carcinogenesis in human skin grafted to SCID mice. Cancer Res. 56(4), 757-764. Soulez, B., Palluault, F., Cesbron, J. Y., Dei, C. E., Capron, A., Camus, D. (1991). Introduction of Pneumocystis carinii in a colony of SCID mice. J. Protozool. 38(6).

References

Stanley, B. K., McCune, J., Kaneshima, H., Justement, J. S., Sullivan, M., Boone, E., Baseler, M., Adelsberger, J., Bonyhadi, M., Orenstein, J., Fox, C. H., Fauci, A. S. (1993). Human immunodeficiency virus infection of the human thymus and disruption of the thymic microenvironment in the SCID-hu mouse. J. Exp. Med. 178, 1151-1163. Steinman, R. M. (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271-296. Steinsvik, T. E., Gaarder, P. I., Aaberge, I. S., Lovik (1995). Engraftment and humoral immunity in SCID and RAG-2deficient mice transplanted with human peripheral blood lymphocytes. Scand. J. Immuno142(6), 607-616. Sugimoto, T., Maruo, K., Imaeda, Y., Suzuki, K., Shirota, K., Ejima, H., Endo, S., Nomura, T. (1994). Xenotransplantation of canine tumors into severe combined immunodeficient (SCID) mice. J. Vet. Med. Sci. 56(6), 1087-1091. Sutkowski, N., Palkama, T., Ciurli, C., Sekaly, R. P., Thorleylawson, D. A., Huber, B. T. (1996). An Epstein-Barr virusassociated superantigen. J. Exp. Med. 184(3), 971-980. Taccioli, G. E., Gottlieb, T. M., Blunt, T., Priestley, A., Demengeot, J., Mizuta, R., Lehmann, A. R., Alt, F. W., Jackson, S. P., Jeggo, P. A. (1994). Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265 (5177), 1442-1445. Tary Lehmann, M., Saxon, A. (1992). Human mature T cells that are anergic in vivo prevail in SCID mice reconstituted with human peripheral blood. J. Exp. Med. 175(2), 503-516. Tary Lehmann, M., Lehmann, P. V., Schols, D., Roncarolo, M. G., Saxon, A. (1994). Anti-SCID mouse reactivity shapes the human CD4 § T cell repertoire in hu-PBL-SCID chimeras. J. Exp. Med. 180(5), 1817-1827. Tary Lehmann, M., Saxon, A., Lehmann, P. V. (1995). The human immune system in hu-PBL-SCID mice. Immunol. Today 16(11), 529-533. Tonnel, A. B., Pestel, J., Duez, C., Jeannin, P., Cesbron, J. Y., Capron, A. (1995). Human IgE in severe combined immunodeficiency mice reconstituted with peripheral blood mononuclear cells from Dermatophagoides pteronyssinus-sensitive patients. Int. Arch. Allergy Immunol. 107(1-3), 223-225. Torbett, B. E., Picchio, G., Mosier, D. E. (1991). hu-PBL-SCID mice: a model for human immune function, AIDS, and lymphomagenesis. Immunol. Rev. 124(139), 139-164. Torbett, B. E., Conners, K., Shao, L. E., Mosier, D. E., Yu, L. (1995). High level multilineage engraftment of human hematopoietic cells is maintained in NOD/SCID mice. Blood 86, 436:a. Tsuji, M., Hagiwara, K., Takahashi, K., Ishihara, C., Azuma, I., Siddiqui, W. A. (1992). Theileria sergenti proliferates in SCID mice with bovine erythrocyte transfusion. J. Parasitol. 78(4), 750-752. Tsuji, M., Terada, Y., Arai, S., Okada, H., Ishihara, C. (1995). Use of the Bo-RBC-SCID mouse model for isolation of a Babesia parasite from grazing calves in Japan. Exp. Parasitol 81 (4), 512-518.

Uckun, F. M. (1996). Severe combined immunodeficient mouse models of human leukemia. Blood 88(4), 1135-1146. Uckun, F. M., Downing, J. R., Chelstrom, L. M., Gunther, R., Ryan, M., Simon, J., Carroll, A. J., Tuelahlgren, L., Crist, W. M. (1994). Human t(4;11)(q21;q23) acute lymphoblastic leukemia in mice with severe combined immunodeficiency. Blood 84(3), 859-865. Uckun, F. M., Evans, W. E., Forsyth, C. J., Waddick, K. G.,

617

Ahlgren, L. T., Chelstrom, L. M., Burkhardt, A., Bolen, J., Myers, D. E. (1995a). Biotherapy of B-cell precursor leukemia by targeting genistein to CD19-associated tyrosine kinases. Science 267(5199), 886-891. Uckun, F. M., Sather, H., Reaman, G., Shuster, J., Land, V., Trigg, M., Gunther, R., Chelstrom, L., Bleyer, A., Gaynon, P., Crist, W. (1995b). Leukemic cell growth in SCID mice as a predictor of relapse in high-risk B-lineage acute lymphoblastic leukemia. Blood 85(4), 873-878. Valentine, M., Martin, A., Ungar, P., Katz, N., Schultz, L. D., Davies, T. F. (1994). Preservation of functioning human thyroid organoids in the severe combined immunodeficient mouse. 3. Thyrotropin independence of thyroid follicle formation. Endocrinology 134(3), 1225-1230. van Kuyk, R., Torbett, B. E., Gulizia, R. J., Leath, S., Mosier, D. E., Koenig, S. (1994). Cloned human CD8 § cytotoxic T lymphocytes protect human peripheral blood leukocytesevere combined immunodeficient mice from HIV-1 infection by an HLA-unrestricted mechanism. J. Immunol. 153(10), 4826-4833. Vandekerckhove, B. A., Krowka, J. F., McCune, J. M., de Vries, J. E., Spits, H., Roncarolo, M. G. (1991). Clonal analysis of the peripheral T cell compartment of the SCID-hu mouse. J. Immunol. 146(12), 4173-4179. Vandekerckhove, B. A., Baccala, R., Jones, D., Kono, D. H., Theofilopoulos, A. N., Roncarolo, M. G. (1992a). Thymic selection of the human T cell receptor V beta repertoire in SCID-hu mice. J. Exp. Med. 176(6), 1619-1624. Vandekerckhove, B. A., Namikawa, R., Bacchetta, R., Roncarolo, M. G. (1992b). Human hematopoietic cells and thymic epithelial cells induce tolerance via different mechanisms in the SCID-hu mouse thymus. J. Exp. Med. 175(4), 1033-1043. Vandekerckhove, B. A. E., Jones, D., Punnonen, J., Schols, D., Lin, H. C., Duncan, B., Bacchetta, R., Devries, J. E., Roncarolo, M. G. (1993). Human Ig production and isotype switching in severe combined immunodeficient-human mice. J. Immunol. 151(1), 128-137. Vandekerckhove, B. A. E., Barcena, A., Schols, D., Mohanpeterson, S., Spits, H., Roncarolo, M. G. (1994). In vivo cytokine expression in the thymus CD3(high) human thymocytes are activated and already functionally differentiated in helper and cytotoxic cells. J. Immunol. 152(4), 1738-1743. Vanhecke, D., Leclercq, G., Plum, J., Vandekerckhove, B. (1995). Characterization of distinct stages during the differentiation of human CD69 +CD3 § thymocytes and identification of thymic emigrants. J. Immunol. 155(4), 1862-1872. Vormoor, J., Lapidot, T., Larochelle, A., Dick, J. E. (1995). Human hematopoiesis in SCID mice. In Medical Intelligence Unit (eds Roncarolo, M. G., Namikawa, R., Peault, B.), pp. 197-212. R. G. Landes Co., Austin, TX, USA. Vormoor, J., Lapidot, T., Pflumio, F., Risdon, G., Patterson, B., Broxmeyer, H. E., Dick, J. E. (1994a). Immature human cord blood progenitors engraft and proliferate to high levels in severe combined immunodeficient mice. Blood 83(9), 24892497. Vormoor, J., Lapidot, T., Pflumio, F., Risdon, G., Patterson, B., Broxmeyer, H. E., Dick, J. E. (1994b). SCID mice as an in vivo model of human cord blood hematopoiesis. Blood Cells 20(23), 316-322. Weei-Chin, L., Desiderio, S. (1995). V(D)J recombination and the cell cycle. Immunol. Today 6, 279-289. Williams, S. S., Alosco, T. R., Croy, B. A., Bankert, R. B. (1993).

6

1

8

S

C

The study of human neoplastic disease in severe combined immunodeficient mice. Lab. Anim. Sci. 43(2), 139-146. Yan, H. C., Juhasz, I., Pilewski, J., Murphy, G. F., Herlyn, M., Albelda, S. M. (1993). Human/severe combined immunodeficient mouse chimeras. An experimental in vivo model system to study the regulation of human endothelial cell-leukocyte adhesion molecules. J. Clin. Invest. 91(3), 986-996. Yan, H. C., Delisser, H. M., Pilewski, J. M., Barone, K. M., Szklut, P. J., Chang, X. J., Ahern, T. J., Langersafer, P.,

I

D

MICE

Albelda, S. M. (1994). Leukocyte recruitment into human skin transplanted onto severe combined immunodeficient mice induced by TNF-alpha is dependent on E-selectin. J. Immunol. 152(6), 3053-3063. Yano, S., Nishioka, Y., Izumi, K., Tsuruo, T., Tanaka, T., Miyasaka, M., Sone, S. (1996). Novel metastasis model of human lung cancer in SCID mice depleted of NK cells. Int. J. Cancer 67(2), 211-217.

XVIII 1.

X E N O TRAN S P LA N TAT I O N

Introduction

Organ allotransplantation represents an important medical advance of this century. The success of transplantation as the more appropriate treatment for an increasing number of acute and chronic pathologies, however, has engendered a major problem which is organ shortage (Cohen and Wight, 1993, Cooper et al., 1994). In order to overcome the lack of organs, scientists recently reconsidered the possibility of using animals as potential donors for humans (Starzl et al., 1994). Transplantation between species or xenotransplantation is not a new concept- in 1963, Reemtsma and colleagues carried out the first kidney xenotransplantation from chimpanzee to human (Reemtsma et al., 1964) in New York. The kidney recipient lived for 9 months with a normal renal function but eventually died from intercurrent disease while the renal graft was normally functioning. This example certainly encouraged clinicians and scientists to continue to develop research in the xenotransplantation field. The first species to be considered as a potential organ donor for human xenotransplantation is the nonhuman primate such as chimpanzee (Reemtsma et al., 1964) or baboon (Starzl et al., 1993). However, the possibility of virus, especially retrovirus, transmission from these primates to humans and the ethical and financial aspects rapidly negated this option. Most investigators therefore recently proposed swine as an alternative source of organs for clinical transplantation. Unlike nonhuman primates, pigs are easy to breed, have anatomical and physiological characteristics compatible with humans, and are well studied for several pathogens potentially transmissible to humans (Fishman, 1994; Sandrin and McKenzie, 1994). Moreover, genetic engineering is now easily achieved in pigs (Sachs and Bach, 1990). Pigs are phylogenetically distant from humans and the immune reaction across such a barrier is far more severe than with allografts. In fact, while a human allograft is usually rejected within 5-7 days, a primarily vascularized pig xenograft is rejected by primates or humans within minutes or hours owing to hyperacute rejection (HAR) (Perper and Najarian, 1966). The main obstacle to the achievement of discordant swine xenograft is the presence at the surface of the pig endothelium of glycosylated xenoantigens identified as Gal-~(1,3)Gal epitope concomitantly with the presence in the human serum of preformed xenoantibodies (IgM, IgG) which Handbook of Vertebrate Immunology

ISBN 0-12-546401-0

recognize these carbohydrate residues. At unclamping of a vascularized pig organ into human, these natural antibodies would hence immediately recognize and bind the glycosylated determinants thereby activating the complement cascade and producing an HAR which is characterized by a rapid and complete destruction of the xenograft through interstitial hemorrhages, thromboses and infarct. The observation that HAR takes place only when organ xenotransplantation is achieved across widely phylogenetically distant species led to a classification of xenografts into concordant versus discordant, based on the relative phylogenetic distance between the donor and recipient species and the presence or absence of circulating xenoreactive natural antibodies (XNA) in the serum of the recipient (Calne, 1970). As with primarily vascularized discordant xenografts, most of ABO incompatible allografts are hyperacutely rejected by untreated human recipients and the pathogenesis of HAR has been shown to be mainly mediated by recipient circulating natural anti-A or -B isoagglutinins (Hammer et al., 1973; Platt et al., 1990b; Alexandre et al., 1991a,b; Platt and Bach, 1991). In 1982, Alexandre and colleagues, demonstrated in ABO incompatible livingrelated kidney allografts that HAR can be overcome by depletion of recipient circulating natural antibodies (and other circulating proteins) using iterative plasmaphereses prior to transplantation (Alexandre et al., 1991a,b). This was probably the turning point which clearly demonstrated the crucial role of natural antibodies in the pathogenesis of HAR and 'opened the door' to clinical organ allotransplantation across the ABO blood group barrier. Moreover, these pioneering studies suggested that HAR of primarily vascularized discordant xenografts might be achieved whether recipient circulating XNA could be removed (Sachs and Bach, 1990; Bach, 1991b). In the experimental setting, a significant prolongation of the survival time of pig to baboon kidney xenografts for up to 23 days (Alexandre, 1989; Gianello, 1995) was obtained by using a regimen consisting of iterative plasmaphereses prior to transplantation concomitantly to a quadruple drug therapy (antithymocyte globulins, cyclosporin A, azathioprine and prednisone). Although the graft survival was significantly extended, delayed rejection however ensued thereby suggesting the involvement of additional factors beside circulating XNA (Bijsterbosch et al., 1985; Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved

620

XENOTRANSPLANTATION

Plattet al., 1990a; Bach, 1991a,b, 1994a,b; Platt and Bach, 1991a; Bach et al., 1993; Grandien et al., 1993; Platt, 1994; Platt and Holzknecht, 1994).

11

Hyperacute and Delayed Discordant Xenograft Rejection

Minutes or hours after unclamping a primarily vascularized discordant xenograft, HAR occurs and is characterized by a rapid destruction of the organ due to massive interstitial hemorrhages, edema, thromboses and marked endothelial cell (EC) destruction (Bach, 1991a; Platt and Bach, 1991a,b; Alexandre et al., 1989). Although infiltration by neutrophils or macrophages might concomitantly occur, it remains focal and mild. During HAR, marked deposition of IgM and to a lesser extent IgG XNA is detected on the vascular endothelium along with complement C3, C4, C9 deposits (Platt et al., 1990a; Platt, 1991a,b). This binding of circulating IgM XNA to endothelial cells (EC) also provokes an activation of the complement cascade, mainly through the classical pathway. The complement activation leads to EC activation and disruption and to the subsequent generation of intravascular pro-coagulant microenvironment (Bach, 1991a,b, 1994; Platt et al., 1990a, 1991a; Bach et al., 1993, 1994; Platt, 1994; Platt and Holzknecht, 1994). Thus, in presence of xenoreactive natural antibodies (XNA) and complement, the quiescent and anticoagulant vascular endothelium becomes activated and procoagulant initiates the destruction of the endothelial barrier (Bach, 1994). This first phase of events takes minutes or hours and transcription of EC genes or protein synthesis does not occur. If circulating XNA are, however, eliminated and/or the complement pathways inhibited, the survival of discordant xenografts might be significantly prolonged from few minutes or hours to several days or weeks (Alexandre et al., 1989; Fischel et al., 1990; Lesnikoski et al., 1994; Leventhal et al., 1994), but eventually acute rejection still occurs (Bach et al., 1993, 1994). This second phenomenon called delayed xenograft rejection (DXR) includes gene transcription as well as protein synthesis and the pathophysiological basis underlying DXR is thought to be endothelial cell activation. As mentioned above, during DXR, and contrary to hyperacute rejection (HAR), several genes are upregulated and protein synthesized in both EC and recipient circulating leukocytes (Bach et al., 1993, 1994; Bach, 1994). Although the pathogenesis of DXR remains largely unknown, preliminary results demonstrate that during DXR, the xenograft is progressively infiltrated by activated macrophages, neutrophils and monocytes consequently producing a high level of TNF-~, IFN-2 and tissue factor (Lesnikoski et al., 1994). Similar to HAR, there is no clear evidence for T cell activation or infiltration during

DXR (Lesnikoski et al., 1994). At the humoral level, massive EC vascular deposition of mainly IgM or IgG XNA is experienced, provoking processes of antibodydependent cellular cytotoxicity (ADCC) mediated by activated macrophages, neutrophils and NK cells (Vercellotti et al., 1991; Inverardi et al., 1992, 1993; Galili, 1993a; Inverardi and Pardi, 1994; Schaapherder et al., 1994). During both HAR and DXR, complement activation results in the generation of several membrane-bound complement proteolytic molecules, including iC3b, which are thought to contribute to neutrophil activation and EC injury upon the specific binding of neutrophils to iC3bcoated EC through the surface CDllb/CD18 receptor (Vercellotti et al., 1991). Complement activation by XNA is also thought to contribute directly to the activation of EC (Bach et al., 1994b; Platt, 1994a). Finally, xenogeneic T cell activation might also occur later during the process of DXR as suggested by the observation that human T cells can be activated by cultured EC (Rollins, 1994). The implication of unknown factors beyond antibodies and complement is however likely in the pathogenesis of both HAR and DXR (van Noesel et at., 1993), (Figure XVIII.2.1)

11

Human Circulating Xenoreactive Natural Antibodies

The immune system of adult mammals, including humans, is characterized by the presence of peripheral self-reactive mature B cells which, upon activation produce polyreactive and monoreactive circulating natural IgM and IgG antibodies (Alt et aI., 1987; Swain and Reth, 1993). Natural antibodies recognize, in most cases, highly repeated polysaccharide antigens and are generated mainly by B cells from the B-1 lineage, probably in absence of T cell help (Alt et al., 1987; Swain and Reth, 1993). Although natural antibodies represent a significant proportion of the repertoire of circulating antibodies, their role has not been established (Galili et al., 1984, 1987; Kroese et al., 1989; Avrameas, 1991). In humans, antiblood-group (A or B) antibodies and also XNA which are responsible for the hyperacute rejection (HAR) of ABO incompatible allografts and discordant xenografts, respectively, belong to the repertoire of natural antibodies (Galili et al., 1984, 1987; Kroese et al., 1989; Avrameas, 1991). Human natural antibodies directed against A and B tissue antigens recognize the GalNAc-~(1,3)(Fuc)-~(1,2)Gal-fi(1,3)-GlcNAc-R and the Gal-~(1,3)(Fuc)-~(1,2)-Galfl(1,3)-GlcNAc-R oligosaccharide residues, respectively. In addition to these antiblood-group antibodies, humans and old-world primates also have in their serum circulating natural IgM and IgG antibodies which recognize the Gal~(1,3)-Gal-fl(fll,4)-GlcNAc-R oligosaccharide epitope, also termed 0~-galactosyl epitope (Galili et al., 1987).

Human Circulating Xenoreactive Natural Antibodies

621

Classical pathway of complement

--

OClq

Recipient's

blood IgM XNA

Donor's

~

~ee~

XAg

X A~g C E ~ ~~, e

,

IgG2 XNA e~ ~

,

, .....

, ,,~ , "~" ~ " "

Basal layer

I Quiescent EC I Pro-coagulant mechanism8 Secretion of cytokines Upregulation of adhesion molecules

HS

Edema

IPro-coagulant EC I

TM ~o I /PAF\

Loss of vascular integrity Hemorrhage

RBC

r,n ,

x''j

IgG2 XNA -4~

/__\

I

Platelet thrombi

I Type, EC activation I

I. P r.cute rojoctionl

PMN TNF

~

Q

~

,

IL-8

NK cell

,.-,

~

(

~

CD 16

asaia'er

~ ICAM-1

~|TypeII EC activation I I

r j ction I

Figure XVlII.2.1. Model of discordant xenograft rejection: EC, endothelial cell; XNA, natural xenoantibodies; HS, heparan sulfate; TM, thrombomodulin" PAl-l, plasminogen activator inhibitor; PAF, platelet activating factor; Xag, xeno-antigen" MO, monocyte; PMN, polymorphonuclear cells; NK, natural killer cell; TNF, tumor necrosis factor; RBC, red blood cells. (See also Table XVIII.6.1 .)

Recently, anti-~-galactosyl natural antibodies were found to be the main component among the repertoire of antiporcine circulating XNA in humans and Old-world primates (Good et al., 1992; Galili et al., 1993; San&in et al., 1993; Sandrin and McKenzie, 1994). As for the A and B tissue antigens expressed on the surface of human EC, the ~-galactosyl epitope is also present on several glycoproteins and glycolipids found on the surface of EC (Galili, 1988; Oriol, 1993). Upon recognition of these oligosaccharidic epitopes by circulating natural antibodies or xenoreactive natural antibodies (XNA), human or porcine EC is activated and HAR initiated (Cooper et al., 1994; San&in and McKenzie, 1994).

The nature of human IgM and IgG XNA and their respective role in HAR of discordant xenografts remains controversial. Several studies tend to demonstrate that in human and nonhuman primate sera, exclusively polyreactive IgM XNA recognize EC in vitro (Plattet al., 1990c, 1991a,b; Parker et al., 1994) or in vivo (Platt et al., 1991c; Geller et al., 1993), whereas anti-~-galactosyl IgG antibodies are monoreactive (Altet al., 1987; Hamadeh et al., 1992). However, other studies indicate that following ex vivo perfusion of porcine hearts with human blood, both IgM and IgG XNA are deposited on the vascular endothelium (Clark et al., 1992; Tuso et al., 1993) and once XNA are eluted from ex vivo perfused porcine xenografts, both

622

IgM and IgG antibodies are recovered (Ross et al., 1993). As for the IgG anti-~-galactosyl antibodies, most of the XNA of the IgG isotype recovered in these experiments belong to the IgG2 subclass (Kirk et al., 1993; Ross et al., 1993). These data have recently been confirmed by the observation that in up to 100% human sera, circulating XNA which recognize cultured ECs belong mainly to the IgM and IgG2 isotypes (Bijsterbosch and Klaus, 1985; Gold et al., 1990). In humans, up to 1% (50-100/lg/ml) of circulating IgG recognizes the ~-galactosyl epitope and thus potentially recognizes ECs (Galili et al., 1984, 1993), but the binding of such high concentration is not correlated with an intense staining upon immunohistology or ELISA. However, the low level of detection of circulating XNA of the IgG isotype may result from technical problems and in fact, most of the revealing antibodies used in these assays also bear the ~-galactosyl epitope on their molecular structure thereby inducing their recognition by XNA which bind to the same epitope on the surface of EC (Fuller et al., 1987; Thall and Galili, 1990; Borrebaeck et al., 1993; Soares et al., 1994a). While in most mammals, B cells are probably rendered tolerant to the ~-galactosyl 'self-antigen' during the early phase of B-cell development, in humans and anthropoid apes this oligosaccharide epitope is not recognized as part of a 'self-antigen' and mature anti-0~-galactosyl B-cell clones can be generated in the peripheral primary B-cell repertoire (Goodnow, 1992; Galili et al., 1984, 1987). However, in order to produce these anti-~-galactosyl antibodies, peripheral mature B cells must be activated by oligosaccharidic antigens. In humans, the sustained production of anti-~-galactosyl natural antibodies is thought to result from the continuous activation of specific mature peripheral B-cell clones by enteric bacteria presenting in their bacterial wall either the 0~-galactosyl molecule or a cross-reactive antigen (Brown et al., 1993; Cambier et al., 1994). As a result of this robust B-cell stimuJ~tion, up to 1% of circulating mature B cells in humans produce anti-agalactosyl antibodies representing as much as 1% of the circulating IgG (Galili et al., 1984, 1993). Interestingly, these monoreactive anti-0~-galactosyl IgG XNA belong mainly to the IgG2 subclass which suggests their character to be T-independent (Hamadeh et al., 1992; Galili, 1993; Galili et al., 1993). In comparison, as much as 80% of human anti-porcine circulating XNA of the IgM isotype are polyreactive (Parker et al., 1994) and represent only 0.1% of circulating IgM (Turman et al., 1991; Vanhove and Bach, 1993; Parker et al., 1994; Vanhove et al., 1994). Although anti-0~-galactosyl antibodies of the IgM and IgG isotypes represent the majority of the anti-EC XNA repertoire, there is still no correlation between the binding of these anti-~-galactosyl antibodies to EC with the activation of these cells and consequently with the initiation of HAR. Using a porcine kidney cell line (PK15) expressing the 0~-galactosyl epitope, the detection of circulating anti-0~-galactosyl XNA of both IgM and IgG isotypes is correlated with the cytotoxic effect of human and

XENOTRANSPLANTATION

baboon sera (Kujundzic et al., 1994). Conversely, the depletion of the anti-~-galactosyl antibodies inhibits the cytotoxic effect of these sera (Neethling et al., 1994). Similar results have recently been reported using a ~-(1,3)galactosyl transferase transfected COS cell line (Vaughan et al., 1994), but contrary to the PK15 or the transfected COS cell lines, the cytotoxic effect of human serum on cultured ECs is limited. This result indicates that the use of cell lines may not be representative of the type of EC injury caused by circulating XNA. There is no clear evidence that anti-~-galactosyl XNA of the IgG isotype may contribute in vivo to the HAR of pig to primate discordant xenografts. Conversely, circulating XNA of the IgG isotype have recently been suggested to inhibit EC activation in vivo and to protect primarily vascularized porcine xenografts from HAR (Magee et al., 1994). The role of XNA on the pathogenesis of pig to primate discordant primarily vascularized xenografts is actually difficult to assess because many methods used to eliminate circulating XNA in vivo also deplete additional factors which might be involved in HAR (Bach, 1994). The strongest evidence for the involvement of natural antibodies in the pathogenesis of HAR comes perhaps from studies showing that depletion of circulating natural antibodies (and other factors) allows to obtain long term survival of ABO incompatible allografts (Alexandre et al., 1987, 1991a,b). As the oligosaccharidic epitopes expressed on EC and recognized by natural anti-A or-B antibodies are similar to those recognized by XNA, it is possible that circulating XNA may also be involved in the pathogenesis of HAR of pig to primate discordant xenografts. The central role of IgM XNA in the pathogenesis of HAR of discordant xenografts is supported by the following evidence: (1) anti-~-galactosyl XNA are absorbed during the ex vivo perfusion by porcine kidneys (Platt et al., 1990d); (2) depletion of anti-0~ galactosyl circulating XNA is correlated with the prolongation of the survival time of pig to primate discordant xenografts (Platt et al., 1990a,b,c,d); (3) The DXR observed upon depletion of circulating XNA, is correlated with the return of circulating XNA and their binding to 0~-galactosyl residues on EC (Soares, 1994b). Finally, in order to better characterize the genes encoding for IgM natural antibodies in a hamster to rat xenograft model, Wu et al. (1997) examined the genetic structure of immunoglobulin VH genes. Out of 18 individual cDNA libraries, they established that two germline genes encode the VH genes of the preformed rat IgM antibodies. The comparison of the DNA seq~aences of the VH regions revealed a high level of nucleic acids sequence identity (97-100%) between several antibodies, suggesting derivation from common family of germline Vii genes. The preferential use of a closely related group of germline genes is consistent with the hypothesis that the Ig genes encoding the xenoreactive antibodies in this model recognize a relative limited repertoire of target antigen epitopes. In addition the authors suggested that the humoral

Complement Activation

response between concordant or discordant species might use a common group of germline Ig Vn genes, originally selected as part of an innate immune response to infectious agents (Cramer et al., 1996).

4.

The Xenoantigens

On the surface of ECs, the xenoantigens recognized by circulating XNA from human and nonhuman primates are now becoming better understood. Using a sensitive cellular ELISA in which endothelial cells (EC)s are used as targets for human circulating xenoreactive natural antibodies (XNA), it has been demonstrated that IgM XNA and to less extent IgG XNA recognize a triad of glycoproteins that were termed following their molecular masses as gp 115, 125 and 135 (Platt et al., 1990b,c,d). These gp 115/135 xenoantigens are shared by ECs and porcine platelets but not by porcine red blood cells or lymphocytes, which express xenoantigens of different molecular weights. Recently gp115, 125 and 135 xenoantigens have been demonstrated to be the porcine equivalents of human integrin fi3, 0dlb, and 0~2 glycoproteins (Platt and Holzknecht, 1994). Human circulating XNA also recognize on the surface of ECs a large glycoprotein (250 kDa) which is the porcine homolog of the human yon Willebrand Factor (Platt, 1994; Platt and Holzknecht, 1994). The epitope(s) recognized by circulating IgM XNA on the gp 115/135 xenoantigens are located on the N-linked biantennary oligosaccharide structure of these glycoproteins (Platt et al., 1990b; Platt, 1994; Platt and Holzknecht, 1994). The specific elimination of the ~-galactosyl epitope by digestion of the gp115/135 with ~-galactosidase abrogates the binding of both human and baboon IgM XNA to the gp 115/135 xenoantigens thereby suggesting that the ~galactosyl residue is the main molecular epitope recognized on these N-linked-oligosaccharides (Collins et al., 1994). However, the elimination of the ~-galactosyl epitope from the surface of cultured endothelial cells (EC) decreases the binding of circulating XNA by only 70-80%, indicating that 20-30% of circulating XNA in human and Old-world primates recognize porcine xenoantigens other than the ~-galactosyl epitope (Collins et al., 1994). The recognition of other molecular structures by circulating XNA is further suggested by the observation that circulating XNA from New-world primates, which do not have circulating anti-~-galactosyl antibodies, recognize cultured ECs and circulating XNA from human or Old-world primates (Galili et al., 1988; Collins et al., 1994). Lower molecular mass porcine xenoantigens of 62, 48, 42, 36, 34, 28, and 26kDa have also been recently described as xenoantigens recognized by human circulating IgM XNA on the surface of EC (Tuso et al., 1993a,b). Contrary to the gp 115/135kDa xenoantigens, XNA would recognize the protein molecular structure of these lower molecular weight EC xenoantigens (Tuso et al.,

623

1993a,b). The binding of human IgM XNA to the majority of these low molecular weight EC xenoantigens is however not significantly depleted upon ex vivo perfusion of porcine organ or HAR of porcine xenografts, suggesting that these are not the main EC targets recognized in vivo by circulating XNA (Tuso et al., 1993a,b; Platt, 1994; Platt and Holzknecht, 1994). More recently the number of glycoproteins expressing the ~-galactosyl epitope on the surface of EC has been extended to at least 25, including the gp 115/135 (Platt et al., 1990b), the lower molecular weight xenoantigens (Tuso et al., 1993a,b) and several unidentified glycoproteins (Sandrin and McKenzie, 1994). The ~-galactosyl epitope recognized by circulating XNA has a molecular structure similar to the B tissue antigen epitope recognized by natural antibodies on the surface of human ECs. However, the L-fucose saccharide found on the B tissue antigen epitope is not present on the ~galactosyl residue (Galili et al., 1987). In humans, up to 85% of circulating anti-B blood group natural antibodies are in fact XNA directed against the ~-galactosyl epitope and do not recognize the L-fucose saccharide on the B tissue antigen (Galili et al., 1987). The difference between the molecular structures of these two oligosaccharide epitopes results from their formation by two distinct enzymes, namely the 0~-(1,3)-D-galactosyl and ~-(1,3)galactosyl transferases, respectively (Thall and Galili, 1990; Galili et al., 1993). Unlike the ~-(1,3)-D-galactosyl transferase which is present in its active form exclusively in humans and certain nonhuman primates, the ~-(1,3)galactosyl transferase gene is detected in all mammals but has been functionally inactivated in anthropoid apes and humans (Galili and Swanson, 1991; Joziasse, 1992). Inactivation of the ~-(1,3)-galactosyl transferase, by introduction of frameshift mutations generating stop codons in the coding gene, is thought to have occurred late during evolution (25-35 million years ago), as suggested by the observation that New-world primates produce this carbohydrate structure in most of their glycoproteins and glycolipids (Galili, 1991; Sandrin et al., 1993). The selective pressure which may have favored the survival of anthropoid apes in which ~-(1,3)-galactosyl transferase was inactivated is thought to be the presence of the P l a s m o d i u m falciparum parasite responsible for the malaria disease (Ramasamy, 1994).

5.

Complement Activation

Upon binding of IgM xenoreactive natural antibody (XNA) to endothelial cells (ECs), activation of the classical pathway of complement generates several membranelinked complement proteolytic products such as, C5b6 or C5b7, which initiate the morphological retraction of ECs and cause endothelial 'gaps' (Platt, 1994; Saadi et al., 1994). The end-product of complement activation is C9; ECs are then perforated and lose their vascular barrier

624

integrity. Although the classical pathway of complement certainly represents the major way of activation in mammals, the activation of the alternate pathway has also been demonstrated in the guinea pig to rat model. Together with circulating XNA, complement activation is certainly one of the main factors involved in the pathogenesis of both hyperacute rejection (HAR) and delayed xenograft rejection (DXR) of discordant xenografts (Platt et al., 1990a, 1991a,b,c; Platt and Bach, 1991a,b; Deenen and Kroese, 1993; Platt, 1994; Platt and Holzknecht, 1994). Particularly in the porcine to primate xenograft model, activation of recipient complement is believed to act exclusively through the classical pathway, probably upon binding of circulating XNA of the IgM but not the IgG isotype to the gp115/135 kDa xenoantigens (Dalmasso et al., 1992, 1993). The reasons why human complement is not directly activated through the alternative pathway by EC surface membrane, has not been established. After binding of IgM XNA to the gp115/135kDa xenoantigens, the complement is activated through the classical pathway generating iC3b-bound complement fragments which may probably also be found in the form of circulating gpl15/135-bound immune complexes (Collins et al., 1994). Generation of such immune complexes, has been recently shown to induce B-cell antigen processing and subsequent MHC class II restricted antigen presentation to specific T cells, resulting in the specific activation of these B cells and subsequent differentiation into antibody-secreting cells (Thornton et al., 1994). Complement activation is normally regulated by both soluble (C1 inhibitor, factor I, factor H, etc.) and membrane associated complement inhibitors (CD46, CD59 and CD55) which have the crucial role of continuously suppressing complement activation directed against 'self' cellular components in order to avoid a complementmediated autoimmune disease (Mollnes and Lachmann, 1988; Lachmann, 1991). The importance of the complement inhibitors is well illustrated in a series of pathologies resulting from congenital deficiencies in genes encoding these regulatory proteins (Lachmann, 1991; Morgan and Wallport, 1991). Because the vascular endothelium is in constant contact with circulating complement proteins, EC express relatively high levels of surface membraneassociated complement inhibitors, including decay-accelerating factor (DAF, CD55), membrane cofactor protein (MCP, CD46) and membrane inhibitor of reactive lysis (CD59) (Brahim and Osmond, 1970; Gold et al., 1990). However, these complement regulatory proteins are species-specific in order to exclusively allow complement activation against heterologous material such as xenogeneic cells or bacterial germs. While in physiological conditions membrane-bound complement inhibitor protects ECs from autologous complement-mediated injury, upon discordant xenografting these regulatory proteins are probably unable to suppress xenogeneic complement activation. EC activation observed during both HAR and delayed rejection in pig to primate xenografts may there-

XENOTRANSPLANTATION

fore result from the inability of EC membrane-bound regulatory proteins to inhibit the activation of primate complement; this situation would be similar in pig to human (Bach, 1991; Dalmasso et al., 1991). Several studies recently demonstrated the importance of these species-specific complement regulators on the protection of ECs from human complement mediated-injury including EC activation or lysis (Platt et al., 1991a,b,c; Bach et al., 1994; Platt and Holzknecht, 1994). The induction of human DAF (CD55) as well as MCP or CD59 expression on the surface of cultured ECs has been shown to protect these cells from human complementmediated cell lysis (Dalmasso et al., 1991). Similarly, soluble human C1 inhibitor also inhibits human complement-mediated lysis or EC activation (Dalmasso and Platt, 1993) and human sCR1 (soluble complement receptor 1) prolong the survival time of porcine cardiac xenografts perfused ex vivo with human blood (Yeh et al., 1991; Pruitt et al., 1994). These data strongly support the idea that upon discordant xenografting, complement activation, resulting from the inability of EC membrane-associated regulatory proteins to inhibit xenogeneic complement activation, may be one of the central factors involved in the rejection of discordant xenografts.

6.

Endothelial Cell Activation

Normally, endothelial cells (ECs) provide a continuous but semipermeable barrier confining circulating molecules and cells inside the blood vessels, thus allowing the selective transit of some molecules or cells across this endothelial barrier. In order to maintain the vital exchange process between blood and neighboring tissues, the vascular endothelium insures the continuous flow of circulating soluble molecules and cells by generating an appropriate intraluminal anticoagulant microenvironment. At unclamping of discordant primarily vascularized xenografts, the maintenance of this anticoagulant environment is lost. Recent discoveries demonstrate that the vascular endothelium represents an organ in which 'active' cells are able to respond to various stimuli by undergoing specific alterations in their cellular function, metabolism and structure now commonly referred as EC activation (Cotran, 1987). The process of EC activation is not immediate and there is at least two distinct phases that are characterized by the presence or absence of gene transcription and protein synthesis and are termed EC stimulation and EC activation, respectively. These two phases of EC activation have recently been named by Bach and colleagues as type I and type II EC activation (Bach, 1994; Bach et al., 1994) (Table XVIII.6.1). The main feature which characterizes the process of EC activation is the transition from a physiological quiescent and anti-coagulant EC phenotype into an activated and

Endothelial Cell Activation Table XVlII.6.1

625

Endothelial cell (EC) activation EC phenotype

EC stimulation or EC type I activation

No detectable upregulation of gene transcription or protein synthesis. Morphological retraction leading to the formation of vascular 'gaps' probably responsible for edema and interstitial hemorrhage. Release of procoagulant factors such as heparan sulfate, thrombomodulin, PAF, PAl.

Surface expression of adhesion molecules including P-selectin. EC activation or EC type II activation

Detectable up-regulation of gene transcription or protein synthesis. Expression of several surface molecules including: tissue factor, MHC class II, E-selectin, ICAM-1, VCAM-1, P selectin. Generation and release of IL-8, PAl-l, IL-6, PAF, etc. Enhanced adhesion of circulating leukocytes including neutrophils, macrophages and NK cells.

PAF, platelet activating factor; ICAM, intercellular cell adhesion molecule; VCAM, vascular cell adhesion molecule; PAl-l, plasminogen activator inhibitor; IL, interleukin.

highly procoagulant one. Several stimuli including inflammatory cytokines such as IL-1, TNF-~ and IFN-2, and also histamine, thrombin, leukotrienes or bacterial LPS are well known to induce this EC phenotypic change (Nawroth and Stern, 1986; Pober et al., 1986; Bevilacqua et al., 1987; Schleef et al., 1988; Brett et al., 1989; Cavender et al., 1989; Pober and Cotran, 1991). Moreover, the specific interactions between circulating leukocytes and ECs may also induce the expression of proinflammatory cytokines such as IL-1 and TNF-0~ initiating, therefore, activation of EC (Pober and Cotran, 1991; Kishihara et aI., 1993; Inverardi and Pardi, 1994). Leukocyte-mediated EC activation is able to activate circulating neutrophils, NK or T cells through activated ECs, thereby initiating the cellular rejection of primarily vascularized allografts and probably the delayed rejection of primarily vascularized discordant xenografts (Pardi et al., 1987, Colson et al., 1990; Pober and Cotran, 1991; Vercellotti et al., 1991; Inverardi et al., 1992, 1993; Kishihara et al., 1993; Inverardi and Pardi, 1994). As for inflammatory cytokines, human circulating XNA and complement activation have recently been demonstrated to mediate type I and type II activation of EC (Bach et al., 1993; Bach, 1994). In particular, human IgM xenoreactive natural antibodies (XNA) have recently been shown to activate cultured ECs, with or without the participation of complement activation (Bach, 1994; Bach et al., 1994).

The type I activation of cultured EC by human or nonhuman primate sera is characterized by the rapid morphological retraction of EC and formation of 'endothelial holes' (Saadi et al., 1994), the release of heparan sulfate (Platt et al., 1990a,b,c,d, 1991a,b) and platelet-activating factor (PAF), as well as the surface expression of the P-selectin adhesion molecule (Coughlan et al., 1993; Bach, 1994a,b). Type I activation of EC would be sufficient per se to induce the occurrence of edema, interstitial hemorrhage, mild neutrophil adhesion to EC, platelet aggregation and fibrin deposition which are the main pathological features of the HAR of discordant xenografts (Platt et al., 1991a,b,c; Platt and Bach, 1991a,b). As previously mentioned, in absence of circulating IgM XNA and/or in case of suppression of complement activation, hyperactive rejection (HAR) of discordant xenografts may be overcome but DXR still occurs (Bach et al., 1993, 1994). Delayed xenograft rejection (DXR) is thought to be initiated mainly by type II or type I+ II EC activation. Human serum mediates 'in vitro' the upregulation of several EC genes including IL-8 and plasminogen activator inhibitor-1 as well as two new genes (ECI-6 and ECI-7) which are specifically expressed during type II EC activation (de Martin et aI., 1993; Bach, 1994; Bach et al., 1994; Vanhove et al., 1994). Furthermore, type II EC activation has also been demonstrated to occur 'in vivo' during DXR (Lesnikoski et al., 1994). For cultured ECs, in vivo activation of EC involves upregulation of ICAM-1 and VCAM1, tissue factor and IL-8 expression (Lesnikoski et al., 1994). The exact mechanism by which type II EC activation mediates DXR of discordant xenografts has not been demonstrated, but mechanisms occurring through NF-~cB are now proposed (Cooper et al., 1996). Upon recognition of the 0~-galactosyl oligosaccharide residues (and probably other epitopes) on the gp115! 135 kDa xenoantigens (and probably other xenoantigens), circulating XNA may initiate the pathogenesis of HAR by activating the EC lining the endothelium of primarily vascularized porcine xenografts. Furthermore, circulating XNA may either activate EC per se or through the activation of the classical pathway of complement, but these two hypotheses should not be considered as mutually exclusive (Bach, 1993, 1994; Bach et al., 1994). Circulating XNA and particularly those of the IgM isotype and complement pathways contribute to EC activation (Bach et al., 1994; Platt and Holzknecht, 1994). Cultured ECs release heparan sulfate following recognition of surface g p 1 1 5 / 1 3 5 k D a xenoantigens by XNA of the IgM but probably not of the IgG isotype (Platt et al., 1990a,b,c,d,e, 1991a). Heparan sulfate release is dependent on the generation of the C5a complement proteolytic product, thereby suggesting that XNA acts essentially as a 'bridge' to complement activation (Platt, 1991a,c,d; Dalmasso, 1992). Because the initiation of the activation of the complement cascade through the classical pathway by antibodies of the IgG2 isotype is extremely inefficient (Alt

626

XENOTRANSPLANTATION

et al., 1987; Grandien et al., 1993), this may provide an explanation for the inability of XNA of the IgG isotype to activate cultured ECs (Platt et al., 1990a, 1991b). Conversely, circulating IgM XNA have been shown to upregulate per se the expression of several genes involved in EC activation, indicating that even in the absence of complement activation, IgM XNA may initiate pathogenesis of DXR (Vanhove et al., 1994).

11

Tolerance and Endothelial Cell Accommodation

As shown by Alexandre and colleagues, removal of recipient circulating xenoreactive natural antibodies (XNA) and probably other factors- by iterative plasmaphereses is required for the acceptance of human ABO incompatible kidney allografts (Alexandre et al., 1987, 1991a,b). Although anti-ABO natural antibodies regain normal serum levels in the few days following transplantation, hyperacute rejection (HAR) usually does not occur (Alexandre et al., 1987; Latinne et al., 1989). As first hypothesized by Bach (1991a,b), the acceptance of an ABO incompatible allograft could result from modification of endothelial-cell (EC) physiological response characteristics leading to 'accommodation', i.e. allowing the survival of the transplant in presence of high levels of circulating IgM natural antibodies and complement, after a transient period of depletion (Bach, 1991a,b). It is now well established that 'EC accommodation' may be linked to the inability of circulating newly formed antibodies to activate EC, once these EC have been allowed to 'heal-in' over a certain period of time in absence of circulating natural antibodies and complement activation (Bach, 1991a,b, 1993, 1994; Bach et al., 1994). At least three hypotheses may contribute to explain the occurrence of EC accommodation: (1) after a period of depletion, circulating newly formed natural antibodies may have changed their specificity for the EC surface antigens and thus lose their ability to activate EC and initiate HAR; (2) during the period of antibody depletion some EC surface antigens (such as the A or B tissue antigens) may be actively modified and are no longer recognized by newly formed natural antibodies thereby losing their ability to activate EC and initiate HAR; (3) after a period of depletion, newly formed natural antibodies may still recognize the EC antigens which may, however, be expressed on the surface of 'accommodated' EC and thereby be unable to be activated at time of antibody recognition (Platt et al., 1991a,b,c; Platt, 1994; Bach, 1994; Bach et al., 1994). In the pig to primate primarily vascularized discordant xenograft model, xenogeneic EC 'accommodation' appears to be more difficult to achieve compared with the ABO incompatible allograft condition. This is supported by the observation that 'accommodation' of pig to baboon

kidney xenografts is not achieved using protocols similar to those demonstrated to induce the 'accommodation' of ABO incompatible kidney allografts (Alexandre et al., 1987). However, several reports have demonstrated that following a brief period of depletion of circulating XNA, porcine xenografts sometimes survive from some days to several weeks in presence of high levels of circulating newly formed XNA, thus suggesting that xenogeneic EC 'accommodation' may also be possible in case of discordant xenograft (Bach, 1994; Bach et al., 1994; Platt, 1994). Recent reports from Bach and colleagues (1997), demonstrate, however, that in a concordant rodent model (hamster to rat), accommodation may be obtained by a combined treatment including cobra venom factor and cyclosporine A. Tolerant rodents demonstrate several characteristics such as protective gene expression, TH2 cytokines production and a high titer of IgG2c which does not fix the complement. These immune characteristics were, in contrast, absent in control animals, thereby probably explaining the accommodation phenomenon. Such tolerant rats also accepted a second hamster cardiac graft without immunosuppression (Hechenleitner, 1997). EC accommodation has also recently been suggested as an active process involving the specific interaction between EC and serum-derived molecules such as heat-stable 0~globulin which inhibits the upregulation of E-selectin, ICAM-1 and VCAM-1 gene expression upon LPS-driven type II EC activation (Stuhlmeier et al., 1994). However, heat-stable a-globulin does not inhibit the expression of other type II EC genes such as IL-1, IL-8, or PAI-1, suggesting that other molecules may be involved in the induction of EC accommodation (Bach, 1994; Bach et al., 1994; Stuhlmeier et al., 1994). Therefore, the induction of EC accommodation in tolerant ABO incompatible living related kidney allografts may result from the active modification of EC metabolism which renders these cells 'resistant' to activation by natural antibodies or complement. Recently, Bach and colleagues communicated results showing that genes encoding for anti-apoptosis molecules such as A20 or Bcl-2, could be involved in the protection of EC activation. In fact, blocking A20 allows avoidance of EC activation and the mechanisms involved could depend on the inhibition of the phosphorylation of nuclear factors like NF-~cB which cannot get into the nucleus to activate the transcription of several genes involved in EC activation (Cooper et al., 1996).

11

Therapeutic Approaches: Future Trends

A great deal of effort has recently been directed into developing potential therapeutic approaches allowing long-term survival of pig to human discordant xenografts and opening the door to clinical xenografting. It has been postulated that if endothelial cell (EC) activation by

Therapeutic Approaches: Future Trends

human serum is suppressed for a sufficient period of time, the process of EC 'accommodation' would occur and hyperacute rejection (HAR) of porcine to human primarily vascularized xenografts could be avoided (Bach, 1993, 1994; Bach et al., 1994). Given this assumption, three major lines of research are currently being attempted by most investigators in order to control the immunological mechanisms involved in the pathogenesis of HAR and delayed xenograft rejection (DXR) of porcine xenografts: (1) the depletion and the inhibition of production of circulating xenoreactive natural antibodies (XNA) (Alexandre et al., 1989, 1991a,b; Soares et al., 1993; Latinne et al., 1994); (2) the inhibition of complement activation (Cairns et al., 1993; Cooper et al., 1993; Pruitt et al., 1994); and (3) the development of transgenic pigs expressing on the surface of their vascular endothelium, human complement inhibitors such as DAF (CD55), MCP (CD46) or CD59 (Dalmasso et al., 1991; Loveland et al., 1993; Platt and Holzkenecht, 1994), as well as the generation of transgenic pigs lacking the expression of the 0~-galactosyl epitope on the EC vascular surface (Sandrin et al., 1993; San&in and McKenzie, 1994). Finally, it has also been proposed that HAR of porcine to human xenografts potentially may be obviated if EC could be actively rendered 'accommodated' by suppressing the molecular mechanisms leading to the upregulation of certain genes responsible for EC activation while promoting the expression of other genes potentially responsible for EC 'accommodation' (Bach, 1994). Many therapeutic approaches described to date focus on the depletion of recipient circulating IgM XNA. Following the demonstration that successful ABO incompatible kidney allograft could be achieved upon preoperative depletion of circulating natural antibodies (and other factors) by plasma exchange and splenectomy, similar protocols have been used to deplete circulating XNA (and other factors) and prolong xenograft survival time of discordant xenografts. Although splenectomy and plasma exchange have proven to be useful in depleting circulating XNA (80-85% of pretreatment levels) and prolonging the survival of discordant xenografts, HAR or DXR rejection always occurs upon return of circulating XNA. It has been found that following plasma exchanges, circulating XNA are significantly depleted for a short period (1-2 days), which does not allow EC accommodation (van de Stadt et al., 1988; Alexandre et al., 1989; Leventhal et al., 1992; Figueroa et al., 1993; Soares et al., 1993; Latinne et al., 1994). Another approach which has been shown to be successful in achieving profound depletion of circulating IgM XNA in both humans and nonhuman primates consists of the extracorporeal perfusion of recipient blood through one or several porcine vascularized organs prior to transplantation (Fischel et al., 1990; Tuso et al., 1993a; Makowka et al., 1993). In addition, extracorporeal perfusion of recipient serum using immunoabsorbent columns containing the oligosaccharidic epitopes recognized by

627'

circulating XNA (such as the 0~-galactosyl epitope) have also been reported to be useful in depleting these circulating XNA (Cairns et al., 1993). In a pig to primate model, Kozlowski et al. (1997) compared three techniques of natural antibodies elimination: by laparotomy approach, the authors achieved in primates (1) either an ex vivo pig liver perfustion, or (2) a perfusion with a column bearing Gal ~(1,3) Gal residues and (3) by internal jugular access, they tested a perfusion of plasma separated from cellular components by apheresis (CPA) using a similar affinity column. Each perfusion technique reduced the level of circulating natural antibodies by 80-90% and CPA was proposed as the first choice technique because it does not require repeated surgical procedures and appeared to be equally effective (Kozlowski et al., 1997). These ex vivo perfusion techniques, however, have no effect on the level of XNA production and therefore will not avoid the XNA rebound. Continuous infusion of A or B tissue antigens bearing the ~-galactosyl epitope have also been shown to be able to deplete significantly the level of circulating XNA (Cooper et al., 1994). More recently the inhibition of natural IgM and IgG antibodies by using a synthetic octapeptide, Gal pep 1 (DAHWESWL) which mimics the carbohydrate epitope Gal 0~(1,3) has been proposed (Fryer, 1997). However, in order to achieve accommodation, total depletion of circulating XNA for a relatively long period may have to be achieved by removing not only the circulating pool of XNA but probably, more importantly, by inhibiting the production of XNA by B cells. The inhibition of B cells can be obtained by administration of high doses of an anti-/, mAb in adult rats allowing thus the total inhibition of B cell development at an early stage of maturation (Bazim et al., 1978; Soares et al., 1993). Many scientists have concentrated their efforts on manipulating EC genes in order to eliminate the xenoantigen Gal ~(1,3) Gal from the surface of the pig endothelium. Completely blocking the gene from the ~1,3 GT is possible in mice (knock-out) but is currently not feasible in pigs because pig embryonic stem cells are not available. Therefore, San&in et al. (1993) examined the possibility of adding another carbohydrate determinant at the surface of the cell by transfecting the gene of the 0~1,2 fucosyltransferase (0~1,2 FT) which uses the same substrate Nacetyl-galactosamine than ~1,3 GT but leads to the expression at the cell surface of a fucosyl epitope which is the H substance of the human O blood group (McKenzie et al., 1996). This H epitope is not recognized by human preformed antibodies and hyperacute rejection would therefore be avoided. Transgenic mice expressing ~1,2 FT have a 90% reduction in the surface expression of Gal ~(1,3) Gal epitope in all tissues examined and a 90% reduction in the binding of human preformed antibodies. The important reduction of Gal ~(1,3) Gal expression in this case has been called 'transferase dominance', since the ~1,2 FT uses the same substrate N-acetyl-galactosamine than the ~1,3 GT, but the overexpression of the new gene produced a significant derivation to the production of H

628

antigen instead of the Gal ~(1,3) Gal epitope. In order to eliminate completely the expression at the cell surface of the Gal ~(1,3) Gal epitope, the same authors examined the possibility to co-express into COS cells the galactosidase (Galdase) gene; this enzyme cleaves a linked-galactosyl residue to remove Gal 0~(1,3) Gal. The co-transfection into COS cells with ~1,3 GT, ~1,2 FT and Galdase cDNA showed no cell surface expression of Gal ~(1,3) Gal or lysis in a cytotoxicity assay, thereby demonstrating the additive effect in their ability to reduce the expression of the galactosyl determinant. Following the same idea, Koike et al. (1997) microinjected pig embryos with a construct of human ~1,2 FT cDNA and a transgenic pig which carried this human gene was established. Cytotoxicity of several cells derived from this transgenic pig was assessed, and showed a significant resistance to a challenge with human sera (Koike, 1997). Another therapeutic approach is to inhibit the human complement activation by transfecting in pigs, human genes encoding for CD55, CD59 or CD46. In a pig to primate model, extended kidney graft survival from transgenic pigs which expressed the human DAF gene has recently been reported. Using a triple drug therapy including cyclosporin A, cyclophosphamide and methylprednisolone, the authors reported pig kidney graft survival from 6 days up to a maximum of 35 days (median = 13 days). Although these monkeys exhibited transient renal dysfunction during the follow-up, they all recovered normal creatinine levels and four animals were eventually sacrificed because of a very severe anemia. Upon histology, mild interstitial infiltrate and rejection was detected in three out of the four animals, whereas the remaining kidney had no evidence of rejection. These results show that despite the presence of preformed antibodies, the pig transgenic kidneys are able to resist hyperacute rejection, but that the recipient will eventually die from complications resulting from immunosuppression. The morphology of hDAF transgenic pig kidneys was compared with the histology of normal pigs following ex vivo xenoperfusion with human blood: the antibody deposition was similar in each group, whereas deposition of C4 and C9 on the glomerular and vascular endothelium was significantly reduced in transgenic kidneys. However, C4 deposits were similar between both groups. The expression of P selectin and the level of glomerula rupture and hemorrhage were significantly higher in kidneys from normal pigs than in kidneys from transgenic animals (Tolan, 1997). The same team also reported that using similar hDAF transgenic pig donors, they obtained prolonged cardiac graft survival in primates with a median survival of 40 days (range from 6 to 62 days). However, the authors demonstrated in this study that a high dose regimen of cyclophosphamide (CyP) is required in order to prolong the cardiac graft survival: in the first experimental group, the mean CyP daily dose was 21.8 mg/kg and the median graft survival 40 days, whereas in group 2, when the daily dose of CyP was reduced to 12.2 mg/kg, all five animals

XENOTRANSPLANTATION

eventually rejected within a median of only 9 days. Interestingly, rejection of the xenograft was concomitant with a significant antibody rebound. In the first group, six animals out of 10 were sacrificed because of gastrointestinal problems and severe anemia but the cardiac graft was still beating. These important results show that severe immunosuppression significantly prolongs heart graft survival from discordant transgenic pigs expressing hDAF in primates, despite the presence of preformed antibodies. A less toxic anti-B cell agent will, however, be required in order to achieve such xenografts in humans. Finally, Norin et al. (1997) recently reported extended survival of orthotopic lung xenograft from transgenic pigs expressing CD59 (MAC) to baboons. In untreated recipients, a pig lung transplant is hyperacutely rejected within 3 h, whereas this graft survival was extended to 12 h when transgenic pigs expressing CD59 were used as donors. Using an immunosuppressive regimen including xenorgan perfusion to eliminate the preformed antibodies, CyA and total lymphoid irradiation, the authors reported discordant orthotopic lung graft survival up to 17 days (median = 7 days) (Norin et al., 1997). Several authors also recently reported that the coexpression of several genes encoding for inhibiting the expression of the galactosyl epitope or complement inhibitors have additive protective effects. Thus, ~-l,3-galactosyltransferase knock-out mice express very little amount of Gal ~(1,3) Gal residues and therefore are protected against human sera but the co-expression in these mice of the human DAF gene clearly demonstrated that dDAF/Gal Ko mice afforded a marked increase in protection from complement-mediated injury and lysis with human sera compared with cells from control group animals (van Denderen et al., 1997). The same authors co-expressed both C D 5 5 (DAF) and CD59 (MAC) cDNA in mice using the human ICAM-2 promotor to allow increased transgene expression and showed, with an ex vivo Langendorff system, that cotransfected C D 5 5 / C D 5 9 mice had a graft survival significantly longer than 45 min in all the animals tested. Others demonstrated that CD46 (MCP) appears to provide better protection against complement activation than CD59 alone and they showed that transgenic mice expressing either human CD46 or CD59 provide a longer graft survival when perfused with human sera. Finally, they also demonstrated that the co-expression of CD59 in Gal-knockout mice provide an additional protective effect for the activation of the complement cascade by human sera. In order to inhibit the complement cascade, other therapeutic tools have also been investigated and some authors developed complementary binding peptides to inhibit the initial step of complement activation from the classical pathway, the binding of Clq to xenoantibody. Using in vitro porcine endothelial culture, they showed that the lysis by human complement was significantly inhibited by one of the peptides which prevent Clq binding to xenoantibody bound to pig endothelial cells.

References

Others studied the effect of soluble complement receptor 1 (sCR1) in an experimental allograft rejection model and demonstrated that sCR1 is able to inhibit the complement activation and to decrease the B cell response in terms of antibody production, sCR1 is thus capable of blocking the classical complement pathway and a single dose of sCR1 is able to prolong the cardiac graft survival in sensitized rats and in discordant xenograft recipients (Pruitt et al., 1994). Using a combination of CyA, CyP, steroids and sCR1, pig cardiac graft survivals were prolonged in primates up to 32 days. An alternative to transgenic animals for avoiding hyperacute rejection of discordant xenografts, would be the induction of specific and permanent tolerance to xenoantigens. Although such protocols do not yet exist in human allotransplantation, scientists show that this goal appears possible in both concordant and discordant experimental models. Based upon the production of mixed lymphohematopoietic chimerism, Bartholomew et al. (1997) showed that tolerance to renal vascularized xenograft from baboon to cynomolgus primates is feasible. Using a nonlethal total body irradiation (250cGy), a thymic irradiation (700 cGy) and 3 days of ATG prior to transplantation, long-term tolerance to kidney concordant xenografts is obtained for more than 6 months whether CyA (15 rag/ kg.d) is given for 1 month and DSG (6mg/kg) from operative day up to postoperative day 13. Thus, without chronic immunosuppression, a nonmyeloablative preconditioning protocol leads to long-term concordant xenograft survival but genuine tolerance is not induced since rejection of donor skin xenografts also provoked the rejection of the kidney xenograft (Bartholomew, 1997). Across a discordant species barrier, Zhao et al. (1997) demonstrated the possibility to induce specific skin graft tolerance in a pig to mouse model by grafting fetal or neonatal pig thymic tissue to thymectomized, T-cell depleted mice. In addition, they showed that normal maturation patterns are seen for mouse thymocytes developing in pig thymic grafts. Thymectomized pig THYgrafted BI0 mice accepted the fetal pig father's skin for more than 200 days, while rejecting allogenic skin within 13 days. Swine leukocyte antigens histocompatibility system in pigs (SLA) mismatched third party skin grafts were rejected within 40 days. This result is the first demonstration that specific skin graft tolerance can be induced across a discordant species (Zhao, 1997). Studying the hamster to rat model, Bach et al. (1997b) also demonstrated that accommodation of cardiac graft is obtained by using CyA (15 mg/kg.d) and cobra venom factor for 10 days. Dissecting the mechanisms of prolonged graft survival, the authors showed high titers of surface-bound rat IgM, IgG, C3, C6 and minor fibrin depositions. The mononuclear cell infiltration consisted mainly in macrophages, NK cells and activated T cells (CD25 +). The cytokine expression in the tolerated graft clearly was a TH2 cytokine pattern (IL-4, IL-10, IL-13) whereas in rejected grafts, a TH1 cytokine pattern (IL-2,

629

IFN-7) was indicated. In addition to these differences, the authors found a high expression of protective genes in tolerated grafts but no expression of such genes in rejected xenografts. One hypothesis being that TH2 cytokines promote the induction of protective genes expression. Concomitantly to these findings, IgG2c was detected at high titre in tolerant animals whereas the titre was very low in rejecting rats. IgG2c does not fix the complement and thus would be consistent with a tolerant environment. Finally, in rejected xenografts, a high level of atherosclerosis was shown. Second cardiac grafts from hamster were tolerated by long-term tolerant rats of a first hamster graft (Bach et al., 1997b).

9.

Conclusions

Major progress has been made in the last few years in the understanding of the physiopathology of discordant xenografting. At the therapeutic level, more appropriate drugs for maintaining the XNA concentration at a low level and over a long period are required in addition to specific antiB-cell drugs. On the donor side, transgenic pigs which will express human regulators of the complement as well as H antigen instead of the 0~-galactosyl epitope should be available within the next few years allowing combination of these 'universal donors' with an appropriate drug therapy in the recipient. The combination of both should open the door to clinical applications in the near future.

10.

References

Alexandre, G. P. J., Squifflet, J. p., De Bruy+re, M., Latinne, D., Reding, R., Gianello, P., Carlier, M., Pirson, Y. (1987). Present experiences in a series of 26 ABO-incompatible living donor renal allografts. Transplant. Proc. 19, 4538-4542. Alexandre, G. P. J., Gianello, P., Latinne, D., Carlier, M., Dewaele, A., van Obbergh, L., Moriau, M., Marbaix, E., Lambotte, J. L., Lambotte, L., Squifflet, J. p. (1989). Plasmapheresis and splenectomy in experimental renal xenotransplantation. Xenograft 25,259-266. Alexandre, G. P. J., Latinne, D., Carlier, M., Moriau, M., Pirson, Y., Gianello, P., Squifflet, J. P. (1991a). ABO-incompatibility and organ transplantation. Transplant Rev. 5,230-241. Alexandre, G. P. J., Latinne, D., Gianello, P., Squifflet, J. p. (1991b). Preformed cytotoxic antibodies and ABO-incompatible grafts. Clin. Transplantation 5,583-594. Alt, F. W., Baltimore, D. (1982). Joining of immunoglobulin heavy chain gene segments: implications from a chromosome with evidence of three D-JH fusion. Proc. Natl Acad. Sci. USA 79, 4118-4122. Alt, F. W., Blackwell, K., Yancopoulos, G. D. (1987). Development of the primary antibody repertoire. Science 238, 10791087.

630

Avrameas, S. (1991). Natural autoantibodies: from 'horror autotoxicus' to 'gnothi seauton'. Immunol. Today 12, 154-159. Bach, F. H. (1991a). Revisiting a challenge in transplantation: discordant xenografting. Human Immunol. 30, 262-269. Bach, F. H. (1991b). Xenotransplantation: problems for consideration. Clin. Transplantation 5,595-599. Bach. F. H. (1994). Discordant xenografts: problems beyond antibodies and complement. Xeno 2, 57-59. Bach, F. H., Turman, M. A., Vercellotti, G. M., Platt, J. L., Dalmasso, A. P. (1991). Accommodation: a working paradigm for progressing toward clinical discordant xenografting. Transplant. Proc. 23,205-207. Bach, F. H., Blakely, M. L., van der Werf, W., Vanhove, B., Stuhlmeier, K. M., Hancock, W. W., de Martin, R., Winkler, H. (1993). Discordant xenografting: a working model of problems and issues. Xeno 1, 8-16. Bach, F. H., Robson, S. C., Ferran, C., Winkler, H., Millan, M. T., Stuhlmeier, K. M., Vanhove, B., Blakely, M. L., van der Werf, W. J., Hofer, E., de Martin, R., Hancock, W. W. (1994). Endothelial cell activation and thromboregulation during xenograft rejection. Immunol. Rev. 141, 5-30. Bach, F. H., Ferran, C., Caudinas, D., Miyatake, T., Koyamada, N., Mark, W., Hechenleitner, P., Hancock, W. W. (1997a). Accommodation of xenografts: expression of 'protective genes' in endothelial and smooth muscle cells. Transplant Proc. 29, 56-58. Bach, F. H., Ferran, C., Hechlenleitner, P., Marck, W., Kayamada, N., Miyatake, T., Winkler, H., Badrichani, A., Candinas, D., Hancock, W. W. (1997b). Accommodation of vascularized xenografts: expression of 'protective genes' by donor endothelial cells in a host Th2 cytokine environment. Nat. Med. 3, 196-204. Bartholomew, A., Cosimi, A. B., Sachs, D. H., Bailin, M., Boskovic, S., Colvin, R., Hong, H., Johnson, M., Kimikawa, M., Meehan, S., Sablinski, T., Wee, S. L., Powelson, J. (1997). A study of tolerance in a concordant xenograft model. Transplant Proc. 29, 923-924. Bazin, H., Platteau, B., Beckers, A., Pauwels, R. (1978). Differential effect of neonatal injections of anti-/~ or anti-6 antibodies on the synthesis of IgM, IgD, IgE, IgA, IgG1, IgG2a, IgG2b and IgG2c immunoglobulin classes. J. Immunol. 121, 2083-2087. Bazin, H., Gray, D., Platteau, B., MacLennan, I. C. M. (1982). Distinct 6 § and 6 - B lymphocyte lineages in the rat. Ann. N Y Acad. Sci. 399, 157-174. Bevilacqua, M., Pober, J. S., Mendrick, D. L., Cotran, R. S., Gimbrone, M. A. (1987). Identification of an inducible endothelial-leukocyte adhesion molecule. Proc. Natl Acad. Sci. USA 84, 9238-9242. Bevilacqua, M. P., Stengelin, S., Gimbrone, M. A., Seed, J. S. (1989). Endothelial leukocyte adhesion molecule 1: an inducible receptor for neutrophils related to complement regulatory proteins and lectins. Science 243, 1160-1165. Bijsterbosch, M. K., Klaus, G. G. B. (1985). Crosslinking of surface immunoglobulin and Fc receptors on B lymphocytes inhibits stimulation of inositol phospholipid breakdown via the antigen receptors. J. Exp. Med. 162, 1825-1836. Borrebaeck, C. A. K., Malmborg, A. C., Ohlin, M. (1993). Does endogenous glycosylation prevent the use of mouse monoclonal antibodies as cancer therapeutics? Immunol. Today 14, 477-479. Brahim, F., Osmond, D. G. (1970). Migration of bone marrow

XENOTRANSPLANTATION

lymphocytes demonstrated by selective bone marrow labeling with thymidine-H 3. Anat. Rec. 168, 139-160. Brett, J., Gerlach, H., Nawroth, P., Steinberg, S., Godman, G., Stern, D. (1989). Tumor necrosis factor/cachectin increases permeability of endothelial cell monolayers by a mechanism involving regulatory G proteins. J. Exp. Med. 169, 1977-1991. Brown, J. H., Jardetzky, T. S., Gorga, J. C., Stern, L. J., Urban, R. G., Strominger, J. L., Wiley, D. C. (1993). Three-dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 364, 33-39. Cairns, T., Karlsson, E., Holgersson, J., Taube, D., Welsh, K., Samuelsson, G. (1994). Confirmation of a major target epitope of human natural IgG and IgM anti-pig antibodies: terminal galactose alpha-l,3-galactose. Transplant. Proc. 26, 1384. Calne, R. T. (1970). Organ transplantation between widely discordant species. Transplant Proc. 2, 550. Cambier, J. C., Pleiman, C. M., Clark, M. R. (1994). Signal transduction by the B cell antigen receptor and its coreceptors. Annu. Rev. Immunol. 12, 457-486. Cavender, D. E., Edelbaum, D., Ziff, M. (1989). Endothelial cell activation induced by tumor necrosis factor and lymphotoxin. Am. J. Pathol. 134, 551-559. Clark, M. R., Cambell, K. S., Kazlauskas, A., Johnson, S. A., Hertz, M., Potter, T. A., Pleiman, C., Cambier, J. C. (1992). The B cell antigen receptor complex: association of Ig-~ and Ig-fi with distinct cytoplasmic effectors. Science 258, 123-126. Cohen, B., Wight, C. (1993). The shortage of donor organs: the European experience. Xeno 1, 21-22. Collins, B. H., Parker, W., Platt, J. L. (1994). Characterization of porcine endothelial cell determinants recognized by human natural antibodies. Xenotransplantation 1, 36-46. Colson, Y. L., Markus, B. H., Zeevi, A., Duquesnoy, R. J. (1990). Increased lymphocyte adherence to human arterial endothelial cell monolayers in the context of allorecognition. J. Immunol. 144, 2975-2984. Cooper, D. K. C., Ye, Y., Niekrasz, M., Kehoe, M., Martin, M., Neethling, F. A., Kosanke, S., DeBault, L. E., Worsley, G., Zuhdi, N., Oriol, R., Romano, E. (1993). Specific intravenous carbohydrate therapy. Transplantation 56, 769-777. Cooper, D. K. C., Koren, E., Oriol, R. (1994). Oligosaccharides and discordant xenotransplantation. Immunol. Rev. 141, 3158. Cooper, J. T., Stroka, D. M., Brotstjan, C., Palmetshofer, A., Bach, F. H., Ferran, C. (1996). A20 inhibits endothelial cell activation by a mechanism involving NF-/cB. J. Biol. Chem. 271, 18068-18073. Cotran, R. S. (1987). New roles for the endothelium in inflammation and immunity. Am. J. Pathol. 129, 407-413. Coughlan, A. F., Berndt, M. C., Dunlop, L. C., Hancock, W. W. (1993). In vivo studies of P-selectin and platelet-activating factor during endotoxemia, accelerated allograft rejection and discordant xenograft rejection. Transplant Proc. 25, 2930. Cramer, D. V., Wu, G., Borie, D. C., Shirwan, H., Miller, L., Makowka, L. (1996). Germline VH gene usage in xenoreactive monoclonal antibody. Transplant Proc. 28, 541-542. Dalmasso, A. P., Platt, J. L. (1993). Prevention of complementmediated activation of xenogeneic endothelial cells in an in vitro model of xenograft hyperacute rejection by C1 inhibitor. Transplantation 56, 1171-1176. Dalmasso, A. P., Vercellotti, G. M., Platt, J. L., Bach, F. H. (1991). Inhibition of complement-mediated endothelial cell

References

cytotoxicity by decay-accelerating factor. Transplantation 52, 530-533. Dalmasso, A. P., Vercellotti, G. M., Fischel, R. J., Bolman, R. M., Bach, F. H., Platt, J. L. (1992). Mechanism of complement activation in the hyperacute rejection of porcine organs transplanted into primate recipients. Am. J. Pathol. 140, 1157. de Martin, R., Vanhove, B., Cheng, Q., Hofer, E., Csizmadia, V., Winkler, H., Bach, F. H. (1993). Cytokine-inducible expression in endothelial cells of an I kappa B~-like gene is regulated by NF-kappa B. EMBO J. 12, 2773-2779. Deenen, G. J., Kroese, F. G. M. (1993). Kinetics of B cell subpopulations in peripheral lymphoid tissues: evidence for the presence of phenotypically distinct short-lived and longlived B cell subsets. Int. Immunol. 5,735-741. Figueroa, J. Fuad, S. A., Kunjummen, B. D., Platt, J. L., Bach, F. H. (1993). Suppression of synthesis of natural antibodies by mycophenolate mofetil (RS-61443). Its potential use in discordant xenografting. Transplantation 55, 1371. Fischel, R. J., Bolman III, R. M., Platt, J. L., Najarian, J. S., Bach, F. H., Matas, A. J. (1990). Removal of IgM anti-endothelial antibodies results in prolonged cardiac xenograft survival. Transplant. Proc. 22, 1077-1078. Fishman, J. A. (1994). Miniature swine as organ donors for man: strategies for prevention of xenotransplant-associated infections. Xenotransplantation 1, 47-57. Fryer, J. P., Blondin, B., Stadler, C., Ivancic, D., Rattner, U., Kaplan, B., Kaufmann, D., Abecassis, M., Stuart, F., Anderson, B. (1997). Inhibition of porcine endothelial cell lysis by human serum using peptides which inhibit C19 Transplant. Proc. 29, 883. Fuller, L., Carreno, M., Esquenazi, V., Roth, D., Milgrom, M., Miller, J. (1987). Naturally occurring interspecies and intraspecies antiimmunoglobulin antibodies. Transplantation 44, 712-715. Galili, U. (1993). Interaction of the natural anti-Gal antibody with ~-galactosyl epitopes: a major obstacle for xenotransplantation in humans. Immunol. Today 14, 480-482. Galili, U., Swanson, K. (1991). Gene sequences suggest inactivation of 0~-l,3-galactosyl-transferase in catarrhines after the divergence of apes from monkeys. Proc. Natl Acad. Sci. USA 88, 7401. Galili, U., Rachmilewitz, E. A., Peleg, A., Flechner, I. (1984). A unique natural human IgG antibody with anti-~-galactosyl specificity. J. Exp. Med. 160, 1519-1531. Galili, U., Buehler, J., Shohet, S. B., Macher, B. A. (1987). The human natural anti-Gal IgG. III. The subtlety of immune tolerance in man as demonstrated by crossreactivity between natural anti-Gal and anti-B antibodies. J. Exp. Med. 165,693704. Galili, U., Shohet, S. B., Kobrins, E., Stults, C. L. M., Macher, B. A. (1988). Man, apes, and old world monkeys differ from other mammals in the expression of ~-galactosyl epitopes on nucleated cells. J. Biol. Chem. 263, 17755-17762. Galili, U., Anaraki, F., Thall, A., Hill-Black, C., Radic, M. (1993). One percent of human circulating B lymphocytes are capable of producing the natural anti-Gal antibody. Blood 82, 2485-2493. Geller, R. L., Bach, F. H., Turman, M. A., Casali, P., Platt, J. L. (1993). Evidence that polyreactive antibodies are deposited in rejected discordant xenografts. Transplantation 55,168. Gianello, P. G., Latinne, D., Alexandre, G. P. G. (1995). Pig to baboon xenograft. Xeno. 3, 26-30.

631

Gold, M. R., Law, D. A., DeFranco, A. L. (1990).. Stimulation of protein tyrosine phosphorylation by the B-lymphocyte antigen receptor. Nature 345,810-813. Good, A. H., Cooper, D. K. C., Malcolm, A. J., Ippolito, R. M., Koren, E., Neethling, F. A., Ye, Y., Zuhdi, N., Lamontagne, L. R. (1992). Identification of carbohydrate structures that bind human antiporcine antibodies: implications for discordant xenografting humans. Transplant. Proc. 24, 559562. Goodnow, C. C. (1992). Transgenic mice and analysis of B-cell tolerance. Annu. Rev. Immunol. 10, 489-518. Grandien, A., Modigliani, Y., Coutinho, A., Andersson, J. (1993). Suppression of B cell differentiation by ligation of membrane-bound IgM. Eur. J. Immunol. 23, 1561-1565. Hamadeh, R. M., Jarvis, G. A., Galili, U., Mandrell, R. E., Zhou, P., McLeod Griffiss, J. (1992). Human natural anti-Gal IgG regulates alternative complement pathway activation on bacterial surfaces. J. Clin. Invest. 89, 1223-1235. Inverardi, L., Pardi, R. (1994). Early events in cell-mediated recognition of vascularized xenografts: cooperative interactions between selected lymphocyte subsets and natural antibodies. Immunol. Rev. 141, 71-93. Inverardi, L., Samaja, M., Motterlini, R., Mangili, F., Bender, J. R., Parid, R. (1992). Early recognition of a discordant xenogeneic organ by human circulating lymphocytes. J. Immunol. 149, 1416. Inverardi, L., Socci, C., Pardi, R. (1993). Leukocyte adhesion molecules in graft recognition and rejection. Xeno 1, 35. Joziasse, D. H., Sharper, N. L., Kim, D., Van den Eijnden, D. H., Sharper, J. H. (1992). Murine ~l,3-galactosyltransferase a single gene locus specifies four isoforms of the enzyme by alternative splicing. J. Biol. Chem. 267, 5534. Kirk, A. D., Heinle, J. S., Mault, J. R., Sanfilippo, F. (1993). Ex vivo characterization of human anti-porcine hyperacute cardiac rejection. Transplantation 56, 785-793. Kishihara, J. F., Penninger, J., Wallace, V. A., Ktindiz, T. M., Kazuhiro, K., Wekeham, A., Timms, E., Pfeffer, K., Ohashi, P. S., Thomas, M. L., Furlonger, C., Paige, C. J., Mak, T. W. (1993). Normal B lymphocyte development but impaired T cell maturation in CD45-exon6 protein tyrosine phosphatasedeficient mice. Cell 74, 143-156. Koike, C., Kannagi, R., Muramatsu, T., Akutsu, F., Yamakawa, H., Okada, H., Nakashima, I., Yokoyama, I., Tagaki, H. (1997). Introduction of human alpha 1-2 fucosyltransferase and its effect in transgenic pig. Transplant. Proc. 29, 894. Kozlowski, T., Fuchimoto, Y., Monroy, R., Martinez-Ruiz, R., Foley, A., Ritzenthaler, J., Xu, Y., Andrews, D., Awwad, M., Fishman, J., Sablinski, T., Sachs, D. H. (1996). Apheresis and column absorption for specific removal of Gal-alpha (1,3)-Gal natural antibody. Transplant. Proc. 29, 961. Kroese, F. G. M., Butcher, E. C., Stall, A. M., Lalor, P. A., Adams, S. (1989). Many of the IgA producing plasma cells in murine gut are derived from self-replenishing precursors in the peritoneal cavity. Int. Immunol. 1, 75-84. Kujundzic, M., Koren, E., Neethling, F. A., Milotic, F., Koscec, M., Kujundzic, T., Martin, M., Cooper, D. K. C. (1994). Variability of anti-0~Gal antibodies in human serum and their relation to serum cytotoxicity against pig cells. Xenotransplantation 1, 58-65. Lachmann, P. J. (1991). The control of homologous lysis. /mmunol. Today 12, 312-315. Latinne, D., Soares, M., Havaux, X., Cormont, F., Lesnikoski,

632

B., Bach, F. H., Bazin, H. (1994). Depletion of IgM xenoreactive natural antibodies by injection of anti-/l monoclonal antibodies. Immunol. Rev. 141, 94-125. Latinne, D., Squifflet, J. P., De Bruy~re, M., Pirson, Y., Gianello, P., Sokal, G., Alexandre, G. P. J. (1989). Subclasses of ABO isoagglutinins in ABO-incompatible kidney transplantation. Transplant. Proc. 21,641-642. Lesnikoski, B. A., Shaffer, D. A., Van der Werf, W. J., Dalmasso, A. P., Soares, M., Latinne, D., Bazin, H., Hancock, W. W., Bach, F. H. (1995). Endothelial and host mononuclear cell activation and cytokine expression during rejection of pig-tobaboon discordant xenografts. Transplant. Proc. 27, 290-291. Leventhal, J. R., Flores, H. C., Gruber, S. A., Figueroa, J., Platt, J. L., Manivel, J. C., Bach, F. H., Matas, A. J., Bolman III, R. M. (1992). Evidence that 15-deoxyspergualin inhibits natural antibody production but fails to prevent hyperacute rejection in a discordant xenograft model. Transplantation 54, 26-31. Leventhal, J. R., Sakiyalak, P., Witson, J., Simone, P., Matas, A. J., Bolman, R. M., Dalmasso, A. P. (1994). The synergistic effect of combined antibody and complement depletion on discordant cardiac xenograft survival in nonhuman primates. Transplantation 57, 974-978. Loveland, B. E., Johnstone, R. W., Russell, S. M., Thorley, B. R., McKenzie, I. F. C. (1993). Different membrane cofactor protein (CD46) isoforms protect transfected cells against antibody and complement mediated lysis. Transplant. Immunol. 1,101-108. Magee, J. C., Collins, B. H., Harland, R. C., Bollinger, R. R., Frank, M. M., Platt, J. L. (1995). Prevention of hyperacute xenograft rejection by intravenous immunoglobulin. Transplant. Proc. 27, 271. Makowka, L., Cramer, D. V., Hoffman, A., Sher, L., Podesta, L. (1993). Pig liver xenografts as a temporary bridge for human allografting. Xeno 1, 27-29. McKenzie, I. F. C., Osman, N., Cohney, S., Vaughan, H. A., Patton, K., Mouhtouris, E., Atkin, J. D., Elliot, E., Fodor, W. L., Squinto, S. P., Burton, D., Gallop, M. A., Oldenburg, K. R., Sandrin, M. S. (1996). Strategies to overcome the antiGal alpha (1,3) Gal reaction in xenotransplantation. Transplant. Proc. 28,537. Mollnes, T. E., Lachmann, P. J. (1988). Regulation of complement. Scand. J. Immunol. 27, 127-142. Morgan, B. P. (1989). Complement membrane attack on nucleated cells: resistance, recovery and non-lethal effects. Biochem. J. 264, 1-14. Morgan, B. P., Walport, M. J. (1991). Complement deficiency and disease. Immunol. Today 12, 301-306. Nakamura, T., Sekar, M. C., Kubagawa, H., Cooper, M. D. (1993). Signal transduction in human B cells initiated via Igfl ligation. Int. Immunol. 5, 1309-1315. Nawroth, P. P., Stern, D. M. (1996). Modulation of endothelial cell hemostatic properies by tumor necrosis factor. J. Exp. Med. 163,740--745. Neethling, F. A., Koren, E., Ye, Y., Richards, S. V., Kujundzic, M., Oriol, R., Cooper, D. K. C. (1994). Protection of pig kidney (PK15) cells from the cytotoxic effect of anti-pig antibodies by ~-galactosyl oligosaccharides. Transplantation 57, 959-963. Norin, A. J., Brewer, R. J., Lawson, N., Grijalva, G. A., Vaynblat, M., Burack, J. H., Burton, W., Squinto, S. P., Kamholz, S. L., Fodor, W. L. (1997). Human CD59 transgene

XENOTRANSPLANTATION

expression in swine: enhanced survival of orthotopic lung xenografts in baboons. Transplant. Proc. 29, 884. Oriol, R., Ye, Y., Koren, E., Cooper, D. K. C. (1993). Carbohydrate antigens of pig tissues reacting with human natural antibodies as potential targets for hyperacute vascular rejection in pig-to-man organ xenotransplantation. Transplantation 56, 1433-1442. Pardi, R., Bender, J. R., Engleman, E. G. (1987). Lymphocyte subsets differentially induce class II human leukocyte antigens on allogeneic microvascular endothelial cells. J. Immunol. 139, 2585-2592. Parker, W., Bruno, D., Holzknecht, Z. E., Platt, J. L. (1994). Characterization and affinity isolation of xenoreactive human natural antibodies. J. Immunol. 153, 3791-3803. Perper, R. J., Najarian, J. S. (1966). Experimental renal heterotransplantation. I. In widely divergent species. Transplantation 4, 377. Platt, J. L. (1994). A perspective on xenograft rejection and accommodation. Immunol. Rev. 141,127-149. Platt, J. L., Bach, R. H. (1991a). Discordant xenografting: challenges and controversies. Curr. Opin. Immunol. 3, 735739. Platt, J. L., Bach, F. H. (1991b). The barrier to xenotransplantation. Transplantation 52, 937-947. Platt, J. L., Holzknecht, Z. E. (1994). Porcine platelet antigens recognized by human xenoreactive natural antibodies. Transplantation 57, 327-335. Platt, J. L., Dalmasso, A. P., Vercellotti, G. M., Lindman, B. J., Turman, M. A., Bach, F. H. (1990a). Endothelial cell proteoglycans in xenotransplantation. Transplant. Proc. 22, 1066. Platt, J. L., Lindman, B. J., Chen, H., Spitalnik, S. L., Bach, F. H. (1990b). Endothelial cell antigens recognized by xenoreactive human natural antibodies. Transplantation 50, 817. Platt, J. L., Turman, M. A., Noreen, H. J., Fischel, R. J., Bolman III, R. M., Bach, F. H. (1990c). An ELISA assay for xenoreactive natural antibodies. Transplantation 49, 1000-1001. Platt, J. L., Vercellotti, G. M., Dalmasso, A. P., Matas, A. J., Bolman, R. M., Najarian, J. S., Bach, F. H. (1990d). Transplantation of discordant xenografts: a review of progress. Immunol. Today 11,450-457. Platt, J. L., Vercellotti, G. M., Lindman, B. J., Oegema Jr, T. R., Bach, F. H., Dalmasso, A. P (1990e). Release of heparan sulfate from endothelial cells. Implications for pathogenesis of hyperacute rejection. J. Exp. Med. 171, 1363-1368. Platt, J. L., Dalmasso, A. P., Lindman, B. J., Ihrcke, N. A., Bach, F. H. (1991a). The role of C5a and antibody in the release of heparan sulfate from endothelial cells. Eur. J. Immunol. 21, 2887. Platt, J. L., Fishel, R. J., Matas, A. J., Reif, S. A., Bolman, R. M., Bach, F. H. (1991b). Immunopathology of hyperacute xenograft rejection in a swine-to-primate model. Transplantation 52, 214-220. Platt, J. L., Lindman, B. J., Geller, R. L., Noreen, H. J., Swanson, J. L., Dalmasso, A. P., Bach, F. H. (1991c). The role of natural antibodies in the activation of xenogenic endothelial cells. Transplantation 52, 1037-1043. Pober, J. S., Cotran, R. S. (1991). Immunologic interaction of T lymphocytes with vascular endothelium. Adv. Immunol. 50, 261-301. Pober, J. S., Gimbrone, M. A., Lapierre, L. A., Mendrick, D. L., Fiers, W., Rothlein, R., Springer, T. A. (1986). Overlapping patterns of activation of human endothelial cells by interleu-

References

kin 1, tumor necrosis factor, and immune interferon. J. Immunol. 137, 1893-1896. Pruitt, S. K., Kirk, A. D., Bollinger, R. R., Marsh Jr, H. C., Collins, B. H., Levin, J. L., Mault, J. R., Heinle, J. S., Ibrahim, S., Rudolph, A. R., Baldwin III, W. M., Sanfilippo, F. (1994). The effect of soluble complement receptor type 1 on hyperacute rejection of porcine xenografts. Transplantation 57, 363-370. Ramasamy, R. (1994). Is malaria linked to the adherence of ~galactosyl epitopes in Old World primates? ImmunoI. Today 15,140. Reemtsma, K., McCracken, B. H., Schlegel, J. U., Pearl, M. A. (1964). Heterotransplantation of the kidney: two clinical experiences. Science 143,700. Rollin, S. A., Kennedy, S. P., Chodera, A. J., Elliott, E. A., Zavoico, G. B., Marls, L. A. (1994). Evidence that activation of human T cells by porcine endothelium involves direct recognition of porcine SLA and costimulation by porcine ligands for LFA-1 and CD2. Transplantation 57, 1709-1716. Ross, J. R., Kirk, A. D., Ibrahim, S. E., Howell, D. N., Baldwin III, W. M., Sanfilippo, F. P. (1993). Characterization of human anti-porcine 'natural antibodies' recovered from ex vivo perfused hearts- predominance of IgM and IgG2. Transplantation 55, 1144--1150. Saadi, S., Ihrcke, N. S., Platt, J. L. (1994). Endothelial cell shape and hyperacute rejection. Transplant. Proc. 26, 1149. Sachs, D. H., Bach, F. H. (1990). Immunology of xenograft rejection. Human Immunol. 28,245-251. San&in, M. S., McKenzie, I. F. C. (1994). Gal~(1,3)Gal, the major xenoantigen(s) recognized in pigs by human natural antibodies. Immunol. Rev. 141,169-190. Sandrin, M. S., Vaughan, H. A., Dabkowski, P. L., McKenzie, I. F. C. (1993). Anti-pig IgM antibodies in human serum react predominantly with Gal(~l-3)Gal epitopes. Immunology 90, 11391-11395. Schaapherder, A. F. M., Daha, M. R., Te Bulte, M. J. W., van der Woude, F. J., Gooszen, H. G. (1994). Antibody-dependent cell-mediated cytotoxicity against porcine endothelium induced by a majority of human sera. Transplantation 57, 1376-1382. Schleef, R. R., Bevilacqua, M. P., Sawdey, M., Gimbrone, M. A., Loskutoff, D. J. (1988). Cytokine activation of vascular endothelium. Effects on tissue-type plasminogen activator and type 1 plasminogen activator inhibitor. J. Biol. Chem. 263, 5797-5803. Soares, M., Latinne, D., Elsen, M., Figueroa, J., Bach, F. H., Bazin, H. (1993). In vivo depletion of xenoreactive natural antibodies with an anti-/, monoclonal antibody. Transplantation 56, 1427-1433. Soares, M., Latinne, D., Bazin, H. (1994a). Can human anti-pig xenoreactive natural antibodies be detected accurately? Xeno 2, 100-101. Soares, M., Lu, X., Havaux, X., Baranski, A., Reding, R., Latinne, D., Daha, M., Lambotte, L., Bach, F. H., Bazin, H. (1994b). In vivo IgM depletion by anti-/, monoclonal antibody therapy: the role of IgM in hyperacute vascular rejection of discordant xenograft. Transplantation 57, 1003-1009. Starzl, T. E., Fung, J., Tzakis, A., Todo, S., Demetris, A. J., Marino, I. R., Doyle, H., Zeevi, A., Warty, V., Michaels, M., Kusne, S., Rudert, W. A., Trucco, M. (1993). Baboon-tohuman liver transplantation. Lancet 341, 65-71. Starzl, T. E., Valdivia, L. A., Murase, N., Demetris, A. J., Fontes,

633

P., Rao, A. S., Manez, R., Marino, I. R., Todo, S., Thomson, A. W., Fung, J. J. (1994). The biological basis of and strategies for clinical xenotransplantation. Immunol. Rev. 141,212-244. Stuhlmeier, K. M., Csizmadia, V., Cheng, Q., Winkler, H., Bach, F. H. (1994). Selective inhibition of E-selectin, ICAM-1, and VCAM in endothelial cells. Eur. J. Immunol. 24, 2186-2190. Swain, S. L., Reth, M. (1993). Lymphocyte activation and effector functions. Editorial overview. Lymphocytes: the ultimate computers? Curr. Opin. Immunol. 6, 355-358. Thall, A., Galili, U. (1990). Distribution of Gal~l -+ 3Galfil --+ 4GIcNAc residues on secreted mammalian glycoproteins (Thyroglobulin, Fibrinogen, and immunoglobulin G) as measured by a sensitive solid-phase radioimmunoassay. Biochemistry 29, 3959-3965. Thornton, B. P., Vetvicka, V., Ross, G. D. (1994). Natural antibody and complement-mediated antigen processing and presentation by B lymphocytes. J. Immunol. 153, 1728-1737. Tolan, M. J., Friend, P., Lozzi, E., Waterworth, P., Langford, G. A., Dunning, J. (1997). Life-supporting transgenic kidney transplants in a pig to primate model. Transplant. Proc. 29, 899. Turman, M. A., Casali, P., Notkins, A. L., Bach, F. H., Platt, J. L. (1991). Polyreactivity and antigen specificity of human xenoreactive monoclonal and serum natural antibodies. Transplantation 52, 710-717. Tuso, P. J., Cramer, D. V., Yasunaga, C., Cosenza, C. A., Wu, G. D., Makowka, L. (1993a). Removal of natural human xenoantibodies to pig vascular endothelium by perfusion of blood through pig kidneys and livers. Transplantation 55, 1375-1378. Tuso, P. J., Cramer, D. V., Middleton, Y. D., Kearns-Jonker, M., Yasunaga, C., Cosenza, C. A., Davis, W. C., Wu, G. D., Makowka, L. (1993b). Pig aortic endothelial cell antigens recognized by human IgM natural antibodies. Transplantation 56, 651-655. Valdivia, L. A., Fung, J. J., Demetris, A. J., Celli, S., Pan, F., Tsugita, M., Starzl, T. W. (1994). Donor species complement after liver xenotransplantation. Transplantation 57, 918-922. van De Stadt, J., Vendeville, B., Weill, B., Crougneau, S., Michel, A., Filipponi, F., Icard, P., Renoux, M., Louvel, A., Houssin, D. (1988). Discordant heart xenografts in the rat. Transplantation 45, 514---518. van Denderen, B. J., Slavaris, E., Romanella, M., Aminian, A., Katerelos, M., Tange, M., Pearse, M., d'Apice, A. (1997). Combination of decay-accelerating factor expression and alpha-l,3-galactosyltransferase knockout affords added protection from human complement-mediated injury. Transplantation 64, 882-888. van Noesel, C. J. M., Lankester, A. C., van Lier, R. A. W. (1993). Dual antigen recognition by B cells. Immunol. Today 14, 8-11. Vanhove, B., Bach, F. H. (1993). Human xenoreactive natural antibodies. Avidity and targets on porcine endothelial cells. Transplantation 56, 1251-1292. Vanhove, B., de Martin, R., Lipp, J., Bach, F. H. (1994). Human xenoreactive natural antibodies of the IgM isotype activate pig endothelial cells. Xenotransplantation 1, 17-23. Vaughan, H. A., Loveland, B. E., Sandrin, M. S. (1994). GAL~(1,3)GAL is the major xenoepitope expressed on pig endothelial cells recognized by naturally occurring cytotoxic human antibodies. Transplantation 58, 879-882. Vercellotti, G. M., Platt, J. L., Bach, F. H., Dalmasso, A. P.

634

(1991). Neutrophil adhesion to xenogeneic endothelium via iC3b. J. Immunol. 146, 730-734. Wu, G. D., Cramer, D. V., Shirwan, H., Borie, D., Chapman, F. A. (1997). Genetic evidence that the antibody response to xenografts is directed at a restricted number of target antigens. Transplant. Proc. 29, 954. Yeh, C. G., Marsh Jr, H. C., Carson, G. C., Berman, L., Concino, M. F., Scesney, S. M., Kuestner, R. E., Shibber, R., Donahue,

XENOTRANSPLANTATION

K. A., Ip, S. H. (1991). Recombinant soluble human complement receptor type 1 inhibits inflammation in the reversed passive Arthus reaction in rat. J. Immunol. 146, 250-256. Zhao, Y., Khan, A., Sergio, J., Swenson, K., Oliveros, J., Arn, J. S., Barth, R. N., Sachs, D. H., Sykes, M. (1997). Specific tolerance induction across a discordant species barrier by grafting with fetal or neonatal pig thymus. Transplant. Proc. 29, 1228-1229.

XIX

CONCLUSION

As stated in the Introduction, species other than mouse and man have played a crucial role in illuminating our understanding of the structure and function of the immune system. Nevertheless, the mouse remains the primary immunology model owing to an extensive body of knowledge and immunological reagents, genetically defined mouse strains, and numerous disease models. Thus, for many aspects of immunology, the mouse model provides an invaluable research tool. A comparison of the immune systems of different vertebrate species, from poikilothermic fish to homeothermic mammals, facilitates a more comprehensive understanding of how the immune system has evolved and integrated its many functions. With each species, novel responses and/or structures have developed in response to the changing physiology and environment of each animal. However, throughout evolution function has been conserved and the interspecies variation in structure informs us of the complexity, redundancy, and integration of the immune system. Many of the primitive immunological responses first developed in fish or more primitive species have been retained by mammals, with further embellishments in structure or the regulation of function. Thus, any consideration of the vertebrate immune system cannot overlook the diverse collection of species that are fish. With over 20000 members and an evolutionary span of 400-500 million years the immune system of fish provides an insight into the innovation, elaboration, and conservation of structure and function that has occurred in vertebrate immunology. Fish have developed a thymus and spleen, produce conventional immunoglobulin molecules, lymphatics are present, and a distinction can be made between mucosal and systemic immunity. Nevertheless, fish do not possess all features of the present mammalian immune system. They lack bone marrow and organized lymph nodes with germinal centres. However, the similarities between fish and mammals are more striking than the differences. Similarities among vertebrate immune systems are especially evident at the genetic level. This high degree of homology in vertebrate gene organization has facilitated numerous studies of fish T-cell receptor, Ig, and MHC genes. Turning to birds, the immune system conforms to the basic immunological mechanisms described in mammals. Chicken T cells can express either TCR~fi or TCR78 but there is, generally speaking, a higher frequency of TCR78 in birds than in mammals. Chickens produce the major Ig Handbook of Vertebrate Immunology

ISBN 0-12-546401-0

isotypes identified in mammals and there is maternal transfer of immunity through the yolk. However, the mechanism for generating IgV gene diversity is significantly different. In chickens, both the heavy and light chains of Ig have a single functional V and J gene segment. Therefore, Ig diversity is generated not by combinatorial rearrangements but rather through somatic gene conversion which incorporates segments of nonfunctional pseudogenes into the rearranged Ig gene. This process of somatic gene conversion occurs in the lymphoid follicles of the bursa of Fabricius. Thus, in birds a gut-associated lymphoid tissue and not the bone marrow functions as an essential organ for development of the B-cell system. Among mammalian species there are several peculiarities worth noting. The camelid's unique Ig heavy chain structure and the novel antigen-combining site challenges established concepts of Ig structure and function. The fetal development of Peyer's patches in ruminants and numer()us other domestic species also raises questions about the role of gut-associated lymphoid tissue in normal B-cell ontogeny. In a manner that is reminiscent of birds, studies in sheep indicate that for many mammalian species there are alternative mechanisms to combinatorial rearrangement for generating Ig diversity. Furthermore, the high frequency of TCRy8 T cells in ruminants suggest further conservation of immune system structure and function between birds and mammals. Finally, the apparently inverted structure of the pig lymph node and the presence of double-positive (CD4 + CD8 +) T cells in the blood of pigs also challenges dogma regarding the structure and function of the mammalian immune system. This book ends with two chapters on the mouse and one on xenografting. The chapters on mouse immunology acknowledge the significant role that mice continue to play in the development of immune concepts. A chapter on xenografting was considered important because mammalian species, such as the pig, are foreseen as potential graft donors for humans. A variety of forces drive immunology research and xenografting may become a strong motivation for further studies in comparative immunology. The editors of this book also hope that human curiosity continues to extend the pursuit of immunology into species that are of no immediate economic value. Each species is sure to offer fresh insights that challenge the present paradigms of the structure and function of the immune system. The voyage of discovery has just begun for immunologists. Copyright 9 1998AcademicPress Limited All rights of reproduction in any form reserved


GLOSSARY Introduction This glossary is only intended to give definitions of most of the terms necessary for the understanding of this handbook, avoiding technical ones. Many of the definitions are derived from The Dictionary of Immunology, Fourth edition (1995), W. John Herbert, Peter C. Wilkinson and David I. Stott, Academic Press, and we wish to extend our grateful thanks to the authors for permission to reproduce this material. Abbreviations used in the entries: cf. e.g.

esp. i.e. q.v.

compare for example especially that is to say which see (where used indicates important extension to the definition).

A Accessory cell: cell that is essential for initiating T cell dependent immune responses usually by presenting antigen, bound to class II MHC antigen molecules, to CD4 + T lymphocytes. Accessory cells include mainly class II MHC + mononuclear phagocytes, dendritic cells and B lymphocytes. Addressin: term used to refer to the structures on a vascular endothelial cell that are recognized by homing receptors on leucocytes (particularly lymphocytes) thus allowing specific entry of leucocytes into a tissue in, for example, lymphocyte recirculation or inflammation. Adenosine deaminase (ADA) deficiency: an enzyme defect inherited as an autosomal recessive trait. Presents as a form of severe combined immunodeficiency (SCID) in infants with deficiencies of both B lymphocyte precursors and T lymphocyte precursors. Adenosine deaminase is abundant in normal lymphocytes and in the thymus and its lack causes failure of adenosine metabolism and accumulation of toxic metabolites in lymphocyte precursors. Adhesion molecules: extracellular matrix proteins that attract leucocytes from the circulation. For example, T and B lymphocytes possess lymph node homing receptors on their membranes which facilitate their passage through high endothelial venules. Affinity maturation: increase in affinity of antibody occurring during the immune response. This is due to selection of high-affinity B cell clones under conditions of limiting antigen concentration. The high-affinity clones

arise as a result of somatic hypermutation of VH region and V> region genes during proliferation of B cells in germinal centres. Agammaglobulinaemia: absence of immunoglobulin. Agranulocytosis: pathological fall in the level of circulating neutrophil leucocytes resulting from depression of myelopoiesis. Can develop without known cause or following administration of certain cytotoxic drugs and also as an idiosyncratic response to normally harmless doses of various chemicals or drugs. Allelic exclusion: an exception to the rule that both genes (or alleles) are expressed at a particular locus by both of the chromosome pair that bear them. The heavy chain and light chain genes of immunoglobulins are examples of this exception in that only one allele is expressed by them. Thus, in animals heterozygous for immunoglobulin allotypes, individual B lymphocytes express only one of the allotypes, not both. Allergic alveolitis: inflammation of the gas-exchanging part of the lungs consisting of an infiltrate mainly of lymphocytes. Caused by inhaling aerosols of organic particulates of about 1 /~m diameter which are small enough to penetrate and sediment in the terminal airways. The main syndromes include bird fancier's lung (frequently pigeons or budgerigars), and farmer's lung. Allergy: a synonym for hypersensitivity. Allogeneic (allogenic): genetically dissimilar within the same species, usually used with respect to differences in MHC. Allograft: graft exchanged between two genetically dis-

638

similar individuals of the same species, e.g. members of an outbred population, or of two different inbred strains. Allotope (allotypic determinant): the structural region of a protein that distinguishes it from the same protein in another individual of the same species. Allotype: serologically identifiable difference between protein molecules that is inherited as an allele of a single genetic locus. Many allotypes have been correlated with amino acid substitutions in the heavy chains and light chains of immunoglobulins. The epitope formed by these amino acids is known as the allotope. Allotopes can be found in both the constant regions and variable regions of immunoglobulins. Alternative pathway (alternate pathway): a pathway by which complement component C3 is cleaved and C5-C9 formed without a requirement for C1, C2 or C4. Can be activated by bacterial endotoxin, in the absence of specific antibody, and by polysaccharides from various fungal or bacterial sources. Alveolar macrophage: a mononuclear phagocyte found loosely attached to the walls of pulmonary alveoli and derived from circulating monocytes which mature in

situ. Amyloidosis: disease characterized by deposition of insoluble protein fibrils in a variety of tissues, often leading to failure of affected organs. Anaphylatoxins: a group of substances, mediators of inflammation, produced in serum during activation of the complement cascade. Anaphylatoxin activity is located in the low molecular weight fragments C3a and C5a (also C4a) that are formed and released after cleavage of C3, C5 and C4. Anaphylaxis: a severe generalized form of immediate hypersensitivity due to the widespread effects of histamine and other vascular permeability factors. Mechanism identical to that of other type I hypersensitivity reactions, i.e. the result of reaction of antigen with mast cell-bound IgE antibody and subsequent release of vascular permeability factors and inflammatory substances. Symptoms vary in different species. Anergy: failure of lymphocytes that have been primed by an antigen to respond on second contact with the antigen. Occurs in both T lymphocytes and B lymphocytes. Antibody: protein with the molecular properties of an immunoglobulin q.v. and capable of specific combination with antigen. Carries antigen-binding sites that bind non-covalently with the corresponding epitope. Antibodies are produced in the body by the cells of the B lymphocyte series and are secreted by plasma cells in response to stimulation by antigen. Antibody half-life: a measure of the average time of survival of any given antibody molecule after its synthesis. In practice, the time taken for the elimination of 50% of a measured dose of antibody from the body of

GLOSSARY

the animal. The half-life of antibody will vary according to immunoglobulin class and animal species. Antigen-presenting cell: cell that carries antigenic peptides bound to its own major histocompatibility complex (MHC) molecules in such a way that the peptide-MHC complex can be recognized by the T cell receptor (TCR). Antigen processing: the intracellular mechanism by which protein antigens are broken down to form small peptides which, on binding to major histocompatibility complex (MHC) molecules, can be presented to the T cell receptor (TCR). The pathways of antigen processing are different for peptides that bind to class I M H C antigens or to class II MHC antigens. Antiserum: serum from any animal, which contains antibodies against a stated antigen. APC: see antigen-presenting cell. Atopy: a constitutional or hereditary tendency to produce IgE antibody to common inhalant allergens, e.g. house dust mite (Dermatophagoides pteronyssinus) and grass pollen. Autoantibody: antibody capable of specific reaction with an antigen that is a normal constituent of the body of the individual in whom that antibody was formed. Autoantigen (self antigen): an antigen that is a normal constituent of the body and against which an immune response may be mounted by the same individual; this sometimes results in autoimmune disease. Autograft (syngeneic graft): graft originated from, and applied to, the same individual, e.g. skin graft from back used for the repair of a facial burn. Autoimmune disease: clinical disorder resulting from an immune response against autoantigen. Autoimmunity: specific humoral immunity (autoantibodymediated) or cell-mediated immunity to constituents of the body's own tissues (autoantigens). If reactions between autoantibody or T lymphocytes and autoantigen result in tissue damage they may be regarded as hypersensitivity reactions. When such damage is sufficient to cause any clinical abnormality, an autoimmune disease is present. Autologous: derived from self; used in reference to grafts, antigens, etc. Apoptosis: non-necrotic cell death in which cells shrink, show blebbing (zeiosis) with release of cell fragments, rounding-up of cell organelles and nucleus, and condensation of chromatin to give a sharp rim round the periphery of the nucleus. The DNA is cleaved by endonucleases. Apoptotic cells may not show impairment of membrane permeability, and death is not accompanied by release of cell contents as in necrosis. Macrophages are capable of removing large numbers of apoptotic cells without trace and this is probably an important disposal mechanism for senescent neutrophil leucocytes. Important mechanism for selection in maturation of both T cells and B cells. Of wide interest in development, both in immunology and elsewhere.

GLOSSARY

Frequently, but not invariably, the form taken by programmed cell death. Arthus reaction: an inflammatory reaction, characterized by oedema, haemorrhage and necrosis, that follows the administration of antigen to an animal that already possesses precipitating antibody to that antigen. Asthma: a common inflammatory lung disease characterized by general, but reversible, bronchial airway obstruction. Axenic: adjective describing animals reared in isolation from all other organisms. The absence of bacteria and larger organisms is relatively easily achieved; freedom from viruses much more difficult, especially as the latter may be incorporated in the genome. Cf. gnotobiotic, germ free.

B cell: see B lymphocyte; the two names are interchangeable. B lymphocyte (B cell): B lymphocytes are the mediators of humoral immunity and on stimulation by antigen they differentiate into antibody-forming plasma cells and B memory cells. In the case of thymus-dependent antigens this process requires cooperation with T lymphocytes. In birds, B lymphocyte maturation is determined by the bursa of Fabricius. B lymphocyte receptor (B lymphocyte antigen receptor, B cell receptor): synonym for membrane immunoglobulin (mlg), the transmembrane antigen-recognizing unit of the B lymphocyte. B lymphocyte repertoire: the number of different VH region-VL region combinations that the immune system is potentially capable of producing. This is considerably larger than the number of different B lymphocyte receptors present on the B cells of an individual at a given time. BALT: Bronchus-associated lymphoid tissue. Basophil leucocyte: a leucocyte derived from bone marrow and found in small numbers (less than 1%) in blood, which contains round granules of different sizes giving a basophilic reaction with normal stains. The granules contain heparin, also histamine and other vascular permeability factors that may be released at sites of inflammation or in immediate hypersensitivity reactions. Basophil leucocytes possess high affinity Fc receptors of IgE (FceRI). Bence-Jones protein: protein in urine of patients with myelomatosis. Consists of dimerized light chains of myeloma protein. //2 microglobulin: protein (12 kDa) structurally similar to a single immunoglobulin constant region which is found in free form in solution in biological fluids, whose major importance is that it is normally linked non-covalently to the class I MHC molecule and stabilizes that mole-

639

cule in the correct conformation for antigen presentation. Bird fancier's lung: restrictive lung disease (a syndrome of extrinsic allergic alveolitis, q.v.) caused by exposure to dust containing antigens derived from the blood plasma of birds, especially albumin and gammaglobulin. These are present in bird faeces and also in 'bloom' (dust) from the skin and feathers. Cross reactivity between avian species is enough to allow one antigen source, e.g. pigeon serum, to be used in tests for exposure to other birds. Blast cell: a cell usually large (diameter > 8/~m), with illdifferentiated cytoplasm rich in RNA and actively synthesizing DNA. The nuclear patterns of blast cells vary and help to determine morphologically the series to which it belongs, e.g. plasmablast, myeloblast (of myeloid cell series), etc. Blood group: classification of isoantigens on the surfaces of erythrocytes. The most important blood groups in man are those of the ABO and Rhesus blood group systems. Bone marrow: the soft tissue that fills the cavities of bones. Red marrow is actively haemopoietic (i.e. blood forming) and is found in developing bone, ribs, vertebrae and parts of long bones. It contains all the cells and corpuscles (with their precursors) of the circulating blood, and also megakaryocytes, reticulum cells, macrophages and plasma cells. It contains lymphocyte stem cells and is the principal site of formation of B lymphocytes in rodents and humans and pre-T lymphocytes (but not mature T lymphocytes) in the adult. In adult animals much of the red marrow is replaced by fatty tissue and becomes yellow marrow. Bruton-type hypogammaglobulinaemia: see X-linked agamm aglobulinaemia. Buffy coat: the layer of white cells that forms between the red cell layer and the plasma when unclotted blood is centrifuged. Bursa of Fabricius: a sac-like lympho-epithelial structure arising as a dorsal diverticulum from the cloaca of young birds. First described in 1621 by Hieronymus Fabricius, an Italian anatomist, it is composed entirely of plicae containing numerous lymphoid follicles. B cell lymphopoiesis takes place within these and continues until the structure involutes at about the time of sexual maturity. The bursa is associated with humoral immunity. Bursectomized chickens fail to make antibodies to a variety of antigens, and plasma cells and germinal centres are reduced or absent in their lymphoid tissues.

C reactive protein: serum protein of the pentraxin family normally present in serum but increased in concentration in many inflammatory processes. Caecal tonsils: see tonsil.

640

CCP superfamily: complement control protein superfamily. CD antigens: a classification of cell surface proteins as 'clusters of differentiation' antigens based on their reactions with panels of monoclonal antibodies. The CD numbers are assigned to molecules by agreement at international workshops. Cell-mediated immunity (CMI): specific immunity mediated by T lymphocytes which recognize major histocompatibility complex-bound antigens upon contact with the cells bearing them. Cell-mediated immunity deficiency syndromes: syndromes characterized by failure to express reactions of cellmediated immunity. Cellular immunity: (1) term originated by Metchnikoff to refer to an increased ability of phagocytic cells to destroy or to digest parasitic organisms (see phagocytosis), and properly so used. Thus is a synonym for macrophage immunity. (2) Sometimes used to refer to cell-mediated immunity q.v. Chediak-Higashi syndrome: disease of children inherited as autosomal recessive. The children show an increased susceptibility to severe pyogenic infection. There is a defect of granulopoiesis and the neutrophil leucocytes contain abnormally large lysosomal granules or phagolysosomes and are defective in microbicidal and chemotactic function. Similar syndromes are seen in a number of species, e.g. the beige mouse. Chemokines: a family of molecules with cell-specific chemoattractant activity (see chemotaxis) and other activating properties for various cell types within the immune system. Chemotaxis: reaction by which the direction of locomotion and the orientation of cells is determined by chemical substances. The cells become oriented and move towards (positive chemotaxis) or away from (negative chemotaxis) the source of a concentration gradient of the substance. Chimerism: a state in which two or more genetically different propulations of cells coexist in an animal. Class I MHC antigens: histocompatibility antigens composed of two non-covalently associated polypeptides; a type I transmembrane protein of MW 44 kDa heavy chain linked to f12 microglobulin, MW 12 kDa. Class I antigens are expressed on the surface membranes of most nucleated cells, and their function is to present antigenic peptides to class I MHC-restricted T cells. The heavy chain consists of three extracellular domains (~1, 0~2 and ~3) of which the outer two (0~1, 0~2) form an antigen-binding groove. This cleft in the surface of the protein has side walls consisting of ~ helical loops and a platform-like floor composed of fi-pleated sheets. The groove accommodates peptides of 8-10 amino acids in length. Class II MHC antigens: histocompatibility antigens composed of two non-covalently associated Type I transmembrane proteins: ~ chain, MW 32 kDa and/3 chain,

GLOSSARY

MW 28 kDa. Class II MHC antigens are expressed predominantly on dendritic cells, B lymphocytes, macrophages and other accessory cells, but are inducible on other cells including epithelial T cells and vascular endothelium. Their function is to present antigenic peptides to class II MHC-restricted T cells, with the outer ~1 and fll domains forming an antigenbinding groove similar to, but larger than, that in class I MHC molecules. Class switching: see isotype switching. Classical complement pathway: the pathway of complement activation that commences with the binding of Clq to an antibody-antigen complex followed by the activation of C1, C4 and C2. Clonal anergy: see anergy. Clonal deletion: programmed cell death of inappropriately stimulated clones of antigen-reactive lymphocytes. See immunological tolerance, negative selection. Colostrum: the first milk produced by the mother post partum. Viscid and yellow with high protein and high immunoglobulin content. Source of passive maternal immunity in newborn of many species. Combined immunodeficiency: see SCID. Complement: a system of at least 18 serum proteins and a group of membrane proteins which interact in a complex cascade reaction sequence. The components of the system are designated as numbers, e.g. C1, or as names, i.e. factor B. The classical complement pathway is activated primarily by immune complexes formed when antibody combines with antigen. The alternative pathway is activated by bacterial endotoxin, fungal and plant factors. Antigen-specific antibody is not required for initiation of this pathway. Both pathways allow the formation of the membrane attack complex, the insertion of which into cell membranes causes severe perturbation or holes resulting in an inability of the cell to survive. It should be noted that some species, notably pig, horse, dog and mouse, have complements that are not as haemolytically active as guinea pig or human complement. Congenic strain (coisogenic strain): one of a number of separate strains of animals (e.g. mice) all constructed to possess identical genotypes except for a difference at a single gene locus. Although these strains are constructed to be genetically identical outside the single defined locus, the phenomena of mutation and genetic linkage ensure that mice within and between congenic strains will differ randomly at a minority of other loci. Conglutinin: protein of the collectins protein family (q.v.) present in serum of Bovidae which can bind to complement (C3b)-bearing immune complexes in the presence of divalent cations. Not an antibody and not to be confused with immunoconglutinin q.v. Constant region: the C-terminal portion of the heavy chain containing homology regions (immunoglobulin domains) CH1, CH2, CH3, etc., or the C-terminal half

GLOSSARY

of the light chain of an immunoglobulin molecule. Socalled because the amino acid sequence in this region is constant from molecule to molecule except for amino acids at allotype marker sites. Many other members of the Ig superfamily contain domains homologous to the constant regions of immunoglobulin. Costimulatory molecules: cell surface molecules other than the antigen receptor (TCR or membrane immunoglobulin) or its ligand (e.g. the major histocompatibility complex-antigenic peptide complex) that are required for an efficient response of lymphocytes to antigen. Cryoglobulin: globulin, especially IgG or IgM, which precipitates spontaneously when serum is cooled below 37~ and redissolves on warming. Does not occur in normal serum. Cryoglobulinaemia may occur in association with myelomatosis, macroglobulinaemia, lymphoma and systemic lupus erythematosus (SLE). Characterized by peripheral vascular occlusion (Raynaud's phenomenon) and purpura of the extremities. Cytokine receptor superfamily: a family of type I transmembrane proteins, many of which are receptors for cytokines or for haemopoietic growth factors or for hormones. Also known as the haemopoietic growth factor receptor superfamily or the haemopoietin superfamily. Cytokines: generic name for proteins made and secreted by cells, which act as intercellular mediators with effects on growth, differentiation, activation, etc., of the same or other cells. Cytokines are important non-antigen-specific effector molecules in many immune and inflammatory responses. Lymphocytes are an important source of cytokines. It should be noted that cytokines have numerous functions outside the immune system, e.g. in developmental biology. Cytotoxic T lymphocyte (CTL; cytolytic T lymphocyte; Tc; Terx): effector T lymphocyte subset (usually CD8 + class I MHC antigen restricted) which directly lyses target cells. Cytotoxic T lymphocytes kill virus-infected cells provided that the latter carry syngeneic class I MHC antigens (see MHC restriction). Two major mechanisms are used for killing: (a) release of perforins, and (b) cytotoxic T lymphocyte-membrane Fas ligand binds to Fas on target cells thus inducing apoptosis in the latter.

D Delayed-type hypersensitivity (DTH; delayed hypersensitivity type IV): hypersensitivity state mediated by primed T lymphocytes. The lesions, in which lymphocytes and macrophages are usually prominent, do not appear until about 24 hours after challenge of a primed subject with antigen, e.g. by intradermal inoculation. Dendritic cell: the dendritic cells are a system of cells of stellate or dendritic morphology which are constitutively strongly class II MHC antigen positive and are

641

important accessory cells, essential for primary immune responses. Originally derived from bone marrow, they are found throughout the body both in sites of contact with antigen (skin Langerhans cells, dendritic cells in gut, lung, etc.), and in peripheral lymphoid organs. Note that the follicular dendritic cells (q.v.) found in germinal centres are unrelated to the cells described above and are not bone marrow derived. Di George's syndrome: failure of development of the parathyroids and thymus due to intrauterine damage to the third and fourth pharyngeal pouches. There is a defect manifest in infancy of cell-mediated immunity with low levels of circulating T lymphocytes, together with hypocalcaemia and tetany, and congenital heart defects. Domain: sequence of a protein or peptide that forms a discrete structural unit, e.g. the constant regions and variable regions of immunoglobulins. Protein superfamilies comprise groups of proteins all of which contain domains with related tertiary structures, though the primary sequences within these domains may be different. The different superfamilies are defined on the basis of their content of such domains.

Effector cell: a cell that performs defined effector functions in immunity, either directly or as a result of signals from antigen-reactive lymphocytes. Effector lymphocyte: lymphocyte which as a result of antigen-dependent differentiation has a direct functional role in the immune response, e.g. cytotoxic T lymphocyte, helper T lymphocyte, plasma cell. Ellipsoids: fusiform stuctures that surround the capillaries at the termination of the penicillar arterioles of the spleen where these enter the red pulp. They consist of a sheath of high (or cuboidal) endothelial cells. Ellipsoids are prominent in the spleens of birds, pigs, horses and cats, but are difficult to distinguish in man and are absent in rodents. Endoplasmic reticulum: a tubular cytoplasmic structure consisting of paired (parallel) membranes attached to the nuclear membrane. Present in all cells, it is most highly developed in protein-secreting cells where it is called rough-surfaced endoplasmic reticulum (RER) because of the numerous ribosomes attached to it. RER is prominent in protein-secreting cells such as plasma cells which secrete immunoglobulins. Eosinophil leucocyte: a granulocyte found in normal blood (40-440 cells/ram 3 in man, i.e. up to 6% of total white cells), characterized by a bilobed nucleus and large, eosinophilic, cytoplasmic granules rich in cationic proteins. Eosinophilia: increase in numbers of eosinophil leucocytes q.v. especially in blood, above physiological levels.

642

Particularly associated with immediate hypersensitivity reactions and responses to nematode worm infestations. Epitope: the region on an antigen molecule to which antibody or the TCR (T cell receptor) binds specifically. Extrinsic allergic alveolitis (EAA): a restrictive lung disease with constitutional fever and chills (influenza-like symptoms) caused by inhaling organic dusts. The most common syndromes are bird fancier's lung and farmer's lung.

F1 hybrid: heterozygote belonging to the first generation derived from crossing genetically dissimilar parents. Fab fragment: fragment obtained by papain hydrolysis of immunoglobulin molecules. The Fab fragment (MW 45 kDa) consists of one light chain linked to the Nterminal half of the contiguous heavy chain (the Fd fragment). Two Fab fragments are obtained from each four chain molecule. F(ab')2 fragment: fragment obtained by pepsin digestion of immunoglobulin molecules (MW ~ 90 kDa). The F(ab')2 fragment consists of that part of the immunoglobulin molecule which is on the N-terminal side of the site of pepsin digestion and therefore contains both Fab fragments plus the hinge region. Farmer's lung: a syndrome of the extrinsic allergic alveolitis (q.v.) type. It is a disease mainly of farmworkers due in most instances to hypersensitivity to spores of thermophilic bacteria, mainly Faenia rectivergula (Micropolyspora faeni) and Thermoactinomyces vulgaris, organisms which occur in the dust of mouldy hay. Fas (CD95): a type I transmembrane protein of the TNFR superfamily expressed on many cell types, including those of the myeloid cell series and lymphoid cell series. Cross-linking by anti-Fas antibody or by the natural Fas ligand induces apoptosis of the Fas-bearing cell. Fas is the murine equivalent of human Apo-1. Fc fragment: the crystallizable fragment obtained by papain hydrolysis of immunoglobulin molecules. The Fc fragment of human IgG has a molecular weight of 50 kDa and consists of the C-terminal half of the two heavy chains linked by disulphide bonds. It has no antibody activity but contains the sites for complement and Fc receptor binding, placental transmission and the carbohydrate moiety of the molecule. Fc' fragment: a fragment produced in small amounts after papain hydrolysis of an immunoglobulin molecule, in addition to the Fc fragment. It is a non-covalently bonded dimer of the C3 homology region but without the terminal 13 amino acids, i.e. it is composed of the two CH3 domains. The molecular weight of the dimer is 24 kDa (human IgG). Present in normal urine in small quantities. Fc receptor: receptor, found on the plasma membrane of

GLOSSARY

various cells, that binds the Fc fragment of immunoglobulin. A number of these receptors have been characterized. Fce receptor (IgE Fc receptor, FceR): a molecular complex comprising an ~, a fl and two 7 chains. The ~ chain binds to the Fc fragment of IgE with high affinity. Fd fragment: the portion of the heavy chain of an immunoglobulin molecule N-terminal to the site of papain hydrolysis (cf. Fc fragment). It contains the variable region and part of the constant region. Follicle: spherical accumulation of lymphocytes in lymphoid tissues. Follicular dendritic cell (FDC): a cell with extensive dendritic processes found in the B cell areas of lymphoid tissue, i.e. in primary follicles and germinal centres. Follicular dendritic cells are not bone marrow-derived and are unrelated to the dendritic cells (q.v.) found in T cell areas and in other parts of the body (e.g. Langerhans cells, veiled cells, interdigitating cells). Follicular hyperplasia: local or generalized enlargement of lymph nodes with increase in size and number of the follicles which typically contain active germinal centres (q.v.). This is a reactive change in the lymph nodes, usually following infection and is distinguishable from the lymphomas. Forssman antigen: a glycolipid antigen present on tissue cells of many species, e.g. horse, sheep, mouse, dog and cat, but absent in man, rabbit, rat, pig and cow. Freemartin: the female of twin bovine calves where the other twin is male and the two placentae have become fused in utero. Thus, the twins have exchanged cells before immunological maturity and are chimeras that do not reject grafts made from each other. In this situation the female calf is sterile due, amongst other things, to the influence of male hormones and can be recognized by physical examination.

G GALT: see gut associated lymphoid tissue. 7'~ T cells: lineage of T lymphocyte possessing the ),~ form of the T cell receptor (TCR). Appears early in ontogeny, during thymus development, and also accounts for about 5% of mature T lymphocytes in peripheral lymphoid organs. In many species, 78 T cells may be the predominant population of T lymphocyte at epithelial surfaces, such as the skin, intestine and genital tract. Some of these 7~5T cells may be extrathymically derived. 7g T cells never express the ~fi TCR and they constitute a separate lineage of T cells. Gamma (7) globulin: the globulin fraction of serum that on electrophoresis shows the lowest anodic mobility at neutral pH. Contains mainly immunoglobulins. Gene knockout mouse: a mouse in which a selected gene has been replaced by an inactive mutant and which therefore lacks the protein coded for by that gene.

GLOSSARY

Germ free: reared in the complete absence of bacteria and larger organisms. Freedom from all viruses is more difficult to achieve. Cf. gnotobiotic, axenic. Germinal centre: a spherical aggregation of B lymphocytes which develops within the primary follicles of lymphoid tissues in response to stimulation by thymus-dependent antigens. Following antigen recognition in the T cell area, B cells migrate to the primary follicles where they proliferate massively to form a germinal centre, displacing the small recirculating B cells into the mantle zone (follicular mantle). Germinal follicle: synonym for germinal centre. Globulin: any serum protein whose anodic mobility on electrophoresis is less than that of albumin. Includes ~, fi and 7 globulins; the latter fraction includes the immunoglobulins. Also commonly used to define those serum proteins which are precipitated by high concentrations of salts such as ammonium or sodium sulphate. Glomerulonephritis: a term applied, with various qualifying prefixes, to a group of kidney diseases, in which the major lesion is in the glomeruli and is presumed to be immunologically mediated. Gnotobiotic: descriptive of an environment in which all of the living organisms present are known, e.g. both a germ free mouse, and a mouse contaminated with a single known organism, may be described as gnotobiotic. Goodpasture's syndrome: haemoptysis (coughing up blood) associated with proliferative glomerulonephritis. The glomerular basement membrane is thickened and IgG and, to a lesser extent, complement are deposited in a linear fashion along the basement membrane. Graft rejection: destruction of tissue grafted into a genetically dissimilar recipient due to a specific immunological reaction against it by the recipient. Graft-versus-host reaction: reaction of a graft containing immunologically competent T lymphocytes, against the tissues of a genetically non-identical recipient. The recipient must be unable to reject the graft either because of its immaturity (newborn animals, see runt disease), or its genetic constitution, or because it has been subjected to whole body irradiation or immunosuppression. Granulocyte: one of a group of bone marrow-clerived cells found in blood and tissue and characterized by the presence of numerous cytoplasmic granules. Three types of granulocyte can be differentiated by the morphology and staining properties of these granules (which give them their name); thus, neutrophil, eosinophil and basophil granulocytes (see under their synonyms neutrophil leucocyte, eosinophil leucocyte and basophil leucocyte). Granuloma: the term is most frequently used to refer to a localized collection of macrophages and lymphocytes characteristic of chronic inflammatory lesions in which a delayed-type hypersensitivity (DTH) reaction is taking place.

643

Granzyme: granzymes are a family of serine proteases found in the granules of cytolytic lymphocytes (cytotoxic T lymphocytes, NK cells) and which are believed to play a part in lymphocyte-mediated cytotoxicity. Gut-associated lymphoid tissue (GALT): lymphoid tissue closely associated with the gut, e.g. tonsils, Peyer's patches and appendix in man, sacculus rotundus in the rabbit, bursa of Fabricius in the chicken, etc. GVH: see graft-versus-host reaction.

H Haemolytic anaemia: anaemia due to an abnormal increase in the rate of destruction of circulating erythrocytes. Can result from metabolic abnormalities of the erythrocytes, from the development of antibodies to the erythrocytes, or from abnormalities of the mononuclear phagocyte system. Haemolytic disease of the newborn: haemolytic anaemia in the fetus or newborn resulting from an excess of maternal anti-red cell antibody. In man, occurs due to antibody (usually Rhesus antibody) crossing the placenta. In the horse, pig and cattle, it follows the neonatal ingestion of colostrum, as, in these species, antibody does not cross the placenta. Haplotype (haploid genotype): a cluster of genes inherited from one parent which, because of their close linkage on the same chromosome, are normally inherited together. In immunology usually refers to MHC genes. Hassall's corpuscles: keratinized epithelial whorls or islands of cells found in the medulla of the thymus. These may be end-stage thymic epithelial cells and are associated with macrophages and apoptotic (see apoptosis) lymphocytes. Thus the Hassall's corpuscle may be a site of removal of dead cells. Hay fever: acute nasal catarrh and conjunctivitis in atopic subjects caused by the inhalation of antigenic substances such as pollens (allergens q.v.) that are innocuous in normal persons. Due to immediate hypersensitivity (type I hypersensitivity reaction) following the reaction of cell-fixed IgE with the causative allergen. Often seasonal depending on concentration of the relevant antigen in air. Heat shock proteins (HSP): ubiquitous intracellular proteins in all species, whose level increases when the organism is stressed. They were first identified following heat stress. They are involved in repair and re-folding of denatured proteins and they also assist in the folding and assembly of normal proteins, hence classified as 'chaperonins'. In immune cells, they assist in the assembly of immunoglobulin molecules and are believed to play an important role in antigen processing inasmuch as they assist the intracellular assembly of major histocompatibility complex (MHC) molecules. Heavy chain: a polypeptide chain present in all immu-

644

noglobulin molecules. MW ~ 50 kDa in human IgG, 65 kDa in IgM. Each heavy chain is normally linked by disulphide bonds to a light chain and to another identical heavy chain. The heavy chain consists of a variable region (VH) and a constant region composed of three or four domains (CH1--CH4), depending on immunoglobulin class. The amino acid sequence of the heavy chain constant region determines the class and immunoglobulin subclass, and the corresponding heavy chain is called the ~ chain, ~ chain, e chain, 2 chain, or/2 chain. Heavy chain class: the group into which a heavy chain is placed by virtue of features of its primary or antigenic structure, common to all individuals of the same species, which distinguish it from heavy chains of other classes. These structural differences are found in the constant region. The heavy chain classes are ~, a, e, 7 and/~. See also immunoglobulin class and isotype. Helper T lymphocyte (TH lymphocyte, helper cell): a thymus-derived lymphocyte (usually CD4 +, class II MHC antigen-restricted, see MHC restriction) whose presence (help) is required for the production of normal levels of antibody by B lymphocytes and also for the normal development of cell-mediated immunity. Heterospecific (heterologous): derived from or having specificity for a different species. High endothelial venule (HEV): specialized venules found in the thymus-dependent area of the lymph node. Characterized by prominent, cuboidal, high endothelial lining cells. Recirculation of lymphocytes from blood to lymph takes place through the walls of these vessels. High endothelial cells in lymphoid tissue at different sites (lymph nodes, Peyer's patches, etc.) carry specific adhesion molecules (addressins) which are recognized by homing receptors on lymphocytes, thus allowing different populations of lymphocytes to home into specific lymphoid tissues. Hinge region: a flexible proline-rich region of the heavy chain of the immunoglobulin molecule between the Fab fragment and the Fc fragment which acts as a hinge around which the Fab fragments can rotate. The angle between the Fab subunits may vary between 0 ~ and 180 ~ The hinge region is adjacent to the sites of papain and pepsin hydrolysis. Histamine: a vascular permeability factor, vasodilator and smooth muscle constrictor, widely distributed in biological tissues and found in high concentration in mast cells. Histamine and histamine-like substances are released when cell-bound IgE reacts with antigen. They cause the classical vascular lesions (weal and flare response) of immediate hypersensitivity. Anaphylatoxins also mediate release of histamine. Histiocyte: a pathologist's term for a macrophage found within the tissues, in contrast to those found in the blood (monocytes) or serous cavities, etc. Some histiocytes appear to remain at the same site for long periods of time, e.g. those that retain dye particles in the skin

GLOSSARY

after tattooing. They have a strong affinity for silver and other heavy metal stains. Histocompatibility antigen: genetically determined alloantigen carried on the surface of nucleated cells of many tissues. Class I MHC antigens and Class II MHC antigens are of major importance in the recognition of antigens by T cells. C.f. isoantigen. Holoxenic: conventionally reared animals. Cf. axenic,

gnotobiotic, germ free. Homing receptor: the receptor or receptors on leucocytes that specifically recognize addressins, i.e. adhesion molecules on vascular endothelial cells; thus allowing specific entry of a leucocyte into a particular tissue. Term used especially in the context of lymphocyte recirculation. Homograft: an outmoded term for any graft made from one individual to another of the same species. Included allogeneic grafts (allografts), and syngeneic grafts. The latter terms are more informative and used by transplantation immunologists. Humoral immunity: specific immunity mediated by antibodies, and thus ultimately by B lymphocytes. Hypergammaglobulinaemia: raised serum gamma globulin level. Diffuse (i.e. not restricted to a single immunoglobulin class) increase in serum gamma globulin is associated with any condition where continued antigenic stimulation (see antigen) causes production of large amounts of antibody. In paraproteinaemias a sharp, high electrophoretic spike of immunoglobulin, which is monoclonal in origin, is seen. Hypersensitivity: state of the previously immunized body in which tissue damage results from the immunological reaction to a further dose of antigen. Hypervariable region: within the variable region of the heavy chains and light chains of immunoglobulin molecules, residues in certain positions show much higher variability from one molecule to another than do residues at other positions. They are partly, but not wholly, responsible for the specificity of the antigenbinding site and also the idiotypic variations between immunoglobulins secreted by different clones of cells. There are three hypervariable regions within the variable region of both heavy and light chain. Hypocomplementaemia: any condition in which serum complement levels are low. Hypogammaglobulinaemia: lowered serum immunoglobulin (gamma globulin)level.

ICAM-1,-2,-3 (intercellular adhesion molecules): a group of Type I transmembrane proteins within the Ig superfamily, having a variable number of constant region-like domains, and which bind to the f12 (leucocyte) integrins (see integrin superfamily). They are important mediatiors of adhesion of leucocytes to vascular endothelium

GLOSSARY

and to one another, e.g. in clustering of lymphocytes around accessory cells in induction of an immune response. Idiotope (idiotypic determinant): immunoglobulins are immunogenic, just like any other protein molecule, and antibodies can be made against any region of the molecule. An idiotope is an epitope in the variable region of an immunoglobulin that is characteristic of the immunoglobulin molecules produced by a single B cell clone, or a small number of clones. It may be present in the antigen-binding site or outside it. Idiotype: set of one or more idiotopes (q.v.) by which a clone of immunoglobulin-forming cells can be distinguished from other clones. Some, known as individual, or private, idiotypes, appear to be unique to individuals. Others, known as inherited, public, or cross reacting idiotypes, are found in many members of the same animal species and even, in some cases, in more than one species. IFN-~,-fl (alpha-interferon and beta-interferon; type I interferons): two related proteins originally identified as being released by cells in response to viral infection. Their activity is non-specific in its spectrum of antiviral activity in that virtually all viruses are susceptible to their action. IFN-~ was first known as leucocyte interferon since it is made by mononuclear phagocytes. IFN-fi was known as fibroblast interferon. IFN-y (gamma-interferon): a cytokine produced by activated T cells and by NK cells which is a major macrophage activating factor. It enhances expression of class I MHC antigen and class II MHC antigen on many cells, including NK cells and B cells, for both of which it is a differentiation factor. IFN- 7 release is particularly associated with the TH1 cell subset of CD4 + T cells and drives the cell-mediated immune response, but it is also made by CD8 + T cells. IFN-7 has antiviral activity but has little sequence homology with IFN-~ or IFN-fl and these latter are more potent antiviral agents than IFN-7. Ig superfamily (immunoglobulin superfamily): a superfamily of cell membrane proteins which have in common the presence of extracellular domains (see immunoglobulin domain) with an imunoglobulin constant region or variable region-like structure, though most lack the polymorphism characteristic of immunoglobulin. Some proteins carry many such domains, others few. This is by far the largest of the membrane protein superfamilies. The diversity of immunoglobulin-like structures is assumed to result from evolution from a primordial immunoglobulin domain. IgA: the major immunoglobulin of the external secretions (intestinal fluids, saliva, bronchial secretions, etc.) where it is found as a dimer linked to a secretory piece (transport piece) q.v. Also present in serum (concentration 1.5-4.0 mg/ml) as a monomer and in polymeric forms (dimer, trimer, tetramer). Does not cross human placenta. Present in human colostrum and milk, but is not major colostral immunoglobulin of cow or ewe.

645

IgD: immunoglobulin present in low concentrations in serum. Present as membrane immunoglobulin in the surface of B lymphocytes. IgE: the main immunoglobulin associated with immediate hypersensitivity (type I hypersensitivity reaction). Present in serum in very low concentration (20-500 ng/ ml) but elevated in atopic individuals. It shows high affinity for FcgRI on the surface of mast cells. IgG: the major immunoglobulin in the serum of man. Homologous immunoglobulins are found in most species from amphibians upwards, but are not present in fish. There are four subclasses in man, IgG1, IgG2, IgG3 and IgG4, but the number varies in other species. All four subclasses are able to cross the human placenta. IgM: high molecular weight (970 kDa) immunoglobulin. Phylogenetically the most primitive immunoglobulin, present in all vertebrates from lamprey upwards, In mammals it is mainly in the form of a cyclic pentamer of five basic four-chain units of two heavy chains and two light chains linked by disulphide bonds. In other species the predominant form may be a monomer (e.g., dogfish), tetramer (e.g., carp) or hexamer (Xenopus). Heavy (/~) chain is larger than that of other immunoglobulins (MW 70 kDa). High carbohydrate content. Does not cross placenta in man but may in certain other species (e.g., rabbit). Immediate hypersensitivity: IgE antibody-mediated hypersensitivity characterized by lesions resulting from release of histamine and other vasoactive substances (synonym type 1 hypersensitivity reaction). IgE antibody fixes to basophil leucocytes and, especially, to mast cells in the tissues. Immune complex: a macromolecular complex of antigen and antibody molecules bound specifically together. May be present in soluble form especially in antigen excess. Complement components may be bound by immune complexes. Important in pathogenesis of certain hypersensitivity reactions. Immune tolerance: see immunological tolerance. Immunoconglutinin: autoantibody against fixed complement components, especially C3, also C4 (i.e. C3b and C4b). Serum immunoconglutinin levels reflect extent of complement fixation by in vivo immunological reactions and are raised in many bacterial, viral and parasitic infections and autoimmune diseases. Not to be confused with conglutinin q.v. Immunodeficiency: any condition in which a deficiency of humoral immunity or cell-mediated immunity exists. Examples are severe combined immunodeficiency syndrome, cell-mediated immunity deficiency syndromes, X-linked agammaglobulinaemia, antibody deficiency syndrome, inter alia. Immunoglobulin: member of a family of proteins each made up of light chains and heavy chains linked together by disulphide bonds. The members are divided into immunoglobulin classes and immunoglobulin subclasses (q.v.) determined by the amino acid sequence of

646

their heavy chains. Most mammals have five immunoglobulin classes (IgM, IgG, IgA, IgD, IgE), although lower organisms have fewer, e.g. the cartilaginous fishes have only one immunoglobulin closely related to IgM. All antibodies are immunoglobulins; however, it is not certain that all immunoglobulin molecules function as antibodies. Present in serum and other body fluids. On electrophoresis show 7 or fi mobility relative to other serum proteins. Immunoglobulin class (isotype): the group into which an immunoglobulin is placed by virtue of the amino acid sequence of the constant region of its heavy chain which distinguishes it from the other classes; the chains, being named with the Greek letter equivalent for each class. The 7 chain of IgG for instance, differs in the amino acid sequence of its constant region from that of the heavy chains of the other immunoglobulin classes. IgA, IgD, IgE, IgG and IgM are immunoglobulin classes distinguishable respectively by their possession of ~, 8, e, 7 and/z chains. It is the heavy chain constant region that determines the overall structure and properties of the immunoglobulin molecule. Immunoglobulin domain: the three-dimensional structure formed by a single homology region of the heavy chain or light chain of an immunoglobulin, i.e. VL region, CL VH region, CH1--CH4. Each homology region is folded into a similar three-dimensional shape which is believed to be shared by homology regions present in other members of the Ig superfamily. All members of the Ig superfamily are characterized by the presence of domains resembling the variable or constant domains of immunoglobulins. Immunoglobulin subclass: subdivision within each immunoglobulin class, based on structural and antigenic differences in their heavy chains. Thus, human IgG has four subclasses: IgG1, IgG2, IgG3 and IgG4. The 7 chains (21, 22, 73 and 24) of the subclasses show closer sequence homology to each other than to the heavy chains of the other immunoglobulin classes. The subclasses differ structurally from one another, e.g. IgG1 and IgG4 have two inter-heavy chain disulphide bonds in the hinge region, IgG2 has four and IgG3 has 11. They also differ functionally, e.g. IgG1, 2 and 3 activate complement whereas IgG4 does not. Human IgA has two subclasses, IgA1 and IgA2. Immunoglobulins of other species also show subclass differences, e.g. mouse IgG1, IgG2a, IgG2b and IgG3. Immunoglobulin superfamily: see Ig superfamily. Immunological memory: concept formulated to explain the capacity of the immunological system to respond much faster and more powerfully to subsequent exposures to an antigen than it did at the first exposure. Immunological rejection: destruction of foreign cells or tissues inoculated or grafted into a recipient due to a reaction of specific immunity against them. Immunological tolerance: the induction of specific nonreactivity of the lymphoid tissues to an antigen capable

GLOSSARY

in other circumstances of inducing active cell-mediated or humoral immunity. May follow contact with antigen in fetal or early post-natal life or, in adults, after administration of very high or very low doses of certain antigens. Immunological reactions to unrelated antigens are not affected by the induction of tolerance to any given antigen. Tolerance may be due to anergy, clonal deletion or active suppression of antigen-specific clones of T or B lymphocytes. Inbred strain: experimental animals produced by sequential brother-sister matings. In immunology, the term usually refers to animals in the 20th and subsequent generations of such matings. Such animals are so homogeneous at histocompatibility loci that grafts can be freely exchanged between them without provoking graft rejection. Incompatibility: antigenic non-identity between donor and recipient, e.g. in blood transfusion or tissue transplantation, such that harmful reactions may occur when donor material is introduced into the recipient. Examples of such reactions are transfusion reactions and immunological rejection. Inflammatory cell: any cell present in an infl/tmmatory lesion as part of the host response, e.g. neutrophil leucocytes, eosinophil leucocytes, macrophages, etc. Integrin superfamily: a family of heterodimeric Type I transmembrane proteins each of which has an 0~ and fi chain. There are subfamilies determined by the fl chain, thus ill, fi2, etc., each of which may have multiple chains. However, it is also clear that ~ chains can bind to more than one fi chain, so the subfamily structure is not rigid. The fi2 integrins are also known as the leucocyte integrins since they are major mediators of leucocyte binding to vascular endothelium. This takes place in a first stage mediated by selectins (q.v.) which cause leucocytes to roll along the vessel wall, then a second stage in which integrins cause the leucocytes to stop, spread and transmigrate. Some of the fil-integrins (VLA molecules, see CD49) are found on lymphocytes and perform the same function. Various other integrins have specific functions, e.g. 0{4fi 7 is a homing receptor which allows lymphocytes to enter Peyer's patches. The cell surface ICAMs are ligands for integrins in leucocyteendothelial interactions, but integrins also mediate binding of many cell types to extracellular matrix proteins such as fibronectin, laminin, vitronectin, etc. Interdigitating cell: class II MHC antigen + cell of dendritic cell morphology found in the T cell areas of lymph nodes and other lymphoid tissues. Derived from Langerhans cells and other peripherally situated dendritic cells which, on contact with antigen, migrate in the afferent lymphatics to the lymph nodes. Important accessory cells because they present antigen to T cells and provide the first contact site with antigen from recirculating lymphocytes. Interferons: see IFN-oc,-fl; IFN-),. Interleukins (IL) (inter-leucocytes): the name 'interleukin'

GLOSSARY

is given to certain cytokines that act as intercellular signals. There is no logic to the interleukin designation: cytokines such as IFN-7 or TNF-~ could as well be 'interleukins'. Nor is there any logic to the order in which the interleukins are numbered. Intraepithelial lymphocyte: any lymphocyte found within an epithelium particularly the intestinal epithelium. Isoantigen: antigen carried by several individuals belonging to the same group (usually blood groups) and which is often capable of eliciting an immune response in other individuals of the same species but belonging to other groups. Isogeneic (isogenic): possessing absolutely identical genotypes, e.g. animals derived from the same egg, identical twins. Often used as a synonym for syngeneic as a descriptor of inbred strains. However, individuals of the latter are never absolutely identical in the sense implied by the term isogeneic. Isograft: syngeneic grafts. Isotype: classification of a molecule by comparison of its primary or antigenic structure with that of closely related molecules found within all members of the same species. Applied to the immunoglobulins, the isotype describes the immunoglobulin class and immunoglobulin subclass, light chain type and subtype and can also be applied to the variable region groups and subgroups. Isotype switching: a process that occurs during an immune response in which a B cell switches from production of one immunoglobulin class to another class without loss of specificity. Isotypic variation: structural variability of antigens common to all members of the same species, e.g. the antigenic differences which distinguish the immunoglobulin classes and types of immunoglobulin chains.

J chain: polypeptide chain (MW 15 kDa) with a high content of cysteine, found in the polymeric forms of IgA and IgM. Has been shown to link together two of the subunits in these immunoglobulins, thus maintaining the polymeric structure. The J chains from IgA and IgM are identical and only one J chain is present in each molecule.

Kallikreins (kininogenases): enzymes with indirect activity in increasing vascular permeability, vasodilatation and smooth muscle contraction. They are esterases which convert kininogens into pharmacologically active kinins. ~c (kappa) chain: one of the two types of light chain of immunoglobulins, the other being the 2 (lambda) chain.

647

An individual immunoglobulin molecule bears either two 2 chains or two ~c chains, never one of each. About 60% of human IgG molecules are of the ~ctype, 40% of the 2 type, but in the mouse the ratio is 95% to 5%. Kinins: peptides formed by the action of esterases known as kallikreins (kininogenases).

Knockout mouse: see gene knockout mouse. Kupffer cell: a non-motile macrophage derived from blood monocytes and found lining the blood sinuses of the liver. As Kupffer cells are phagocytic and positioned in an area of high blood flow, they are highly active in removing foreign particles from the blood. Kurloff cell: cell found in the peripheral blood, spleen and other organs of pregnant or oestrogen-treated guinea pigs. Contains a large inclusion body composed of mucoprotein and sulphated mucopolysaccharide and has been postulated to be a type of modified lymphocyte of unknown function.

2 (lambda) chain: one of the two types of light chain of immunoglobulins, the other being the ~c (kappa) chain. An individual immunoglobulin molecule bears either two ~c chains or two 2 chains, never one of each. The ratio of ~cto 2 chains varies with species, e.g. about 60% of human IgG molecules are of the ~ctype, 40% of the 2 type, whereas in the mouse the ratio is 95% ~c chains to 5% 2 chains. Lamina propria: layer of connective tissue supporting the epithelium of the digestive tract and with it forming the mucosa. Contains the blood supply, lymphatic drainage and innervation of the mucosa and is the site of accumulation of lymphocytes, plasma cells, mast cells and macrophages in immunological reactions involving the gut. Langerhans cell: an accessory cell of dendritic appearance found in the basal layers of the epidermis, derived from bone marrow and characterized by the presence of tennis racket-shaped cytoplasmic Birbeck granules. Strongly class II MHC antigen positive, weakly positive for Fc~/receptors and C3b receptors. Late phase reaction: reaction which can begin about 5 hours after an immediate hypersensitivity reaction provoked by either skin testing or inhalation challenge by an allergen. The late phase reaction is characterized by inflammation, pruritus and a minimal cellular infiltration; its mechanism is probably due to late effects from the release of cytokines from mast cells or alveolar macrophages. Leader peptide (signal peptide): a sequence of approximately 20, mainly hydrophobic, amino acids found at the N-termini of most nascent secreted proteins, e.g. the light chains and heavy chains of immunoglobulins, but absent from the secreted form. The peptide is rapidly cleaved from the nascent chains once they are released

648

into the cisternal space of the endoplasmic reticulum and is responsible for vectorial release of the polypeptide chains and hence their secretion from the cell. Leucocyte (leukocyte): the white cells of the blood and their precursors (see myeloid cell series and lymphoid cell series). Leucocyte adhesion deficiency (leucocyte adhesion defect; LAD): a serious form of immunodeficiency due to a defect in the/32 integrin (see integrin superfamily) chain (CD18) which results in defective function of leucocyte integrins (CD11/CD18) and failure of leucocytes to adhere to, and transmigrate through, vascular endothelium. The major defect is in neutrophil leucocyte mobilization. Leukotrienes: pharmacologically active substances generated from arachidonic acid by the action of lipoxygenases. Light chain: a polypeptide chain present in most immunoglobulin molecules. MW 22 kDa in man. Immunoglobulins, or their subunits if polymeric, are made up of two identical light chains linked to two heavy chains usually by disulphide bonds. Light chains are of two isotypes,/c and 2 (see/c (kappa) chain and 5[ (lambda) chain) and a single immunoglobulin molecule or subunit always has two/( chains or two 2 chains, never both. Light chain isotype is not related to immunoglobulin class differences. Lupus erythematosus: skin disease with red scaly patches in exposed areas, especially butterfly-shaped area over the nose and cheeks. Not to be confused with systemic lupus erythematosus (SLE, q.v.) of which cutaneous lupus erythematosus is often a sign and to which it is related. Lymph: the fluid that flows from all tissue cells of the body in lymphatic vessels, thus providing a medium for metabolic exchange and removal of waste products. Derived from the blood as an ultrafiltrate through the capillary walls, it returns to the blood stream, after passing through chains of lymph nodes (q.v.), by drainage from the thoracic duct into the vena cava. Lymph node: small bean-shaped organ subdivided into a cortex and medulla and made up largely of lymphocytes and accessory cells, especially dendritic cells (interdigitating cells). The lymph node is a peripheral lymphoid organ and has both a lymphatic supply and a blood supply. The cortex is compartmentalized into T cell and B cell areas. Lymph nodes are distributed throughout the body, frequently in groups which drain lymph from a given area via afferent lymphatic vessels that pass into the node from peripheral tissue. Lymphoblast: a blast cell of the lymphoid cell series with a nuclear pattern characterized by fine chromatin and basophilic nucleoli. Lymphoblasts are formed in vivo and in vitro following antigenic or mitogenic stimulation and divide to form populations of effector lymphocytes. Lymphocyte: the cell type that carries receptors for, and

GLOSSARY

recognizes, antigen and is therefore the mediator cell of specific immunity. There are two major forms of mature lymphocyte: the T lymphocyte, which generates the responses of cell-mediated immunity, and the B lymphocyte, which mediates humoral immunity and is the precursor of antibody-secreting cells. Unstimulated lymphocytes of both types are small cells (5-7 /ira in diameter) with a large round or slightly indented nucleus and a narrow rim of cytoplasm. Lymphocyte activation: the change seen when lymphocytes are cultured in the presence of a mitogen or of an antigen to which they are primed. The cells enter the cell cycle sequence, typically remaining in G1 for about 48 hours before entering the S phase and dividing. They increase in size, the cytoplasm becomes more extensive, and nucleoli are visible in the nucleus, which becomes less densely stained; after about 72 hours these cells resemble lymphoblasts. Activated lymphocytes differentiate into various functional forms, depending on the phenotype of the original cell, e.g. B cells to memory cells or plasma cells, T cells to cytotoxic T lymphocytes, helper T lymphocytes, cytokine-secreting cells, memory cells, etc. Lymphocyte recirculation: the continuous passage of lymphocytes from blood to lymphoid tissues to lymph and thence back to blood. Recirculating cells are small resting cells. Lymphocytosis: rise above normal of the number of lymphocytes, especially in blood. Lymphoid cell series: cell series which includes lymphocytes, their precursors, e.g. thymocytes, and their progeny, e.g. plasma cells. Lymphoid follicle (primary follicle): a tightly packed, spherical aggregation of cells in the cortex of a lymph node, the white pulp of the spleen or in other lymphoid tissues. Consists of a network of follicular dendritic cells, the spaces between which are packed with small recirculating B lymphocytes. Lymphoid follicles characterize the B cell areas of unstimulated lymphoid tissue, but during the secondary immune response to thymus dependent antigens, germinal centre develops within the follicle (secondary follicle). Lymphoid tissues: body tissues in which the predominant cells are lymphocytes. They comprise the lymph, spleen, lymph nodes, thymus, Peyer's patches, pharyngeal tonsils, adenoids, and in birds the caecal tonsils (see tonsils) and bursa of Fabricius. Lymphokine: any cytokine made and secreted by lymphocytes, commonly following antigen stimulation, e.g. IL2, IL-4, etc. Lymphoma: neoplastic disease of lymphoid tissue in which the abnormal cells are chiefly located in solid tissue, rather than found in the blood as in leukaemia, though there is overlap between the two. Lymphoreticular tissue: synonym for lymphoid tissues. Lysosome: a cytoplasmic organelle, limited by a membrane and containing hydrolytic enzymes (acid hydro-

GLOSSARY

lases). Present in many cells throughout the animal kingdom. Lysosomal enzymes are inert until released from the particle. These enzymes play an important part in intracellular digestion and are involved in many types of cell injury. They may also be released from the cell by exocytosis. For role of lysosomes in phagocytosis see phagosome. Lysozyme: enzyme, first described by Fleming in 1922, present in and secreted by neutrophil leucocytes and macrophages and found in tears, nasal secretions, on the skin, and, in lower concentrations, in serum. Lyses certain bacteria, chiefly Gram positive cocci.

M Mab (mAb)" abbreviation for monoclonal antibody. Macroglobulin: any globulin with a molecular weight above about 400 kDa. The best-studied serum macroglobulins are IgM. Macroglobulinaemia" increase in level of macroglobulin in the serum. Usually refers to rise in IgM level. May follow antigenic challenge, e.g. in trypanosomiasis, or be due to paraproteinaemia, either primary, as in Waldenstr6m's macroglobulinaemia, or secondary to diseases such as lymphoma or carcinoma, especially in the alimentary tract. Macrophage: the mature cell of the mononuclear phagocyte system q.v. Macrophages are derived from blood monocytes which migrate into the tissues and differentiate there. They are strongly phagocytic of a wide variety of particulate materials, including microorganisms. They contain lysosomes, and possess microbicidal capacity. They are secretory cells which synthesize and release an enormous number of biologically active substances including cytokines, enzymes, inflammatory mediators, and microbicidal agents. Macrophage activating factor: a generic term for any cytokine that activates macrophages, e.g. IFN-7, TNF~, GM-CSF. Major histocompatibility complex (MHC)" the collection of genes coding for the major histocompatibility antigens, see class I MHC antigens, class II MHC antigens. MALT" mucosa associated lymhoid tissue. Mantle zone (follicular mantle)- a peripheral zone of small B lymphocytes found in a secondary follicle in which a germinal centre has developed. The mantle zone contains the small, recirculating, B cells which originally occupied the primary follicle but which have been pushed out as the germinal centre expands. Marginal zone- a loosely packed area of T lymphocytes, B lymphocytes and macrophages which surrounds both the periarterial lymphatic sheath and the B cell follicles of the mammalian spleen q.v., particularly well-defined in rodents. Mast cell" tissue cell (10-30/,m diameter) bearing highaffinity surface receptors for IgE (FceRI) and strongly

649

basophilic cytoplasmic granules, similar to, but smaller than, those of blood basophil leucocytes. The granules contain histamine, heparin, and tryptase, inter alia. Masugi nephritis: experimental glomerulonephritis produced in one species (e.g. rat) by injection of antibody obtained from a second species (e.g. rabbit) that has been immunized with rat glomerular capillary basement membrane. Maternal immunity (maternally transferred immunity): passive immunity (of humoral immunity type) acquired by the newborn animal from its mother. In man and other primates this is chiefly obtained before birth by the active transport of immunoglobulins across the placenta. The young of ungulates, in whom antibody is not transferred across the placenta, acquire it from the colostrum (q.v.), their intestines being permeable to immunoglobulins for a few days after birth. In mammals, secretory IgA in colostrum provides passive protection for the gut mucosa. The young of birds acquire maternal immunity from antibody in the egg yolk. Medullary cord: area of the medulla of a lymph node close to the efferent lymphatic, composed largely of macrophages and, after antigenic stimulation, containing many plasma cells. Medullary sinus: potential spaces in the medulla of a lymph node into which lymph drains before entering the efferent lymphatic. Membrane attack complex: term used to denote the terminal complement components C5, C6, C7, C8 and C9, which associate to form the terminal attack complex (C5b-9) on activation of either the classical complement pathway or the alternative pathway. C5b-9 contains a hydrophobic region which allows it to insert into lipid bilayers and cause cell lysis. Membrane immunoglobulin (B lymphocyte receptor; mlg; slg): immunoglobulin on B cells in the form of a Type I transmembrane protein, thus synthesized by and acting as the antigen-specific receptor of the B cell. In unprimed cells, membrane immunoglobulin is of the IgM and IgD classes, but isotype switching (class switching) occurs during T cell-dependent immune responses, and these classes are replaced by IgG, IgA or IgE. Memory cells: T lymphocytes or B lymphocytes which mediate immunological memory. MHC: see major histocompatibility complex. MHC restriction: the recognition by T lymphocytes of foreign antigen on the surface of a cell only in association with self-antigens of the major histocompatibility complex. CD8 + T lymphocytes respond to foreign antigen in association with class I MHC antigens, whereas CD4 + T lymphocytes respond to foreign antigen in association with class II antigens. Microfilaments: long, fine strands about 5-8 nm wide composed of helically polymerized actin and found, usually as a network, in the cytoplasm or nucleus of eukaryotic cells, including all immunological cells.

650

Microfilaments are believed to mediate movement of the whole cell and of organelles within it. They form a contractile system which functions by the interaction of actin with actin-binding proteins and myosin. Microglobulin: any globulin or globulin fragment of relatively low molecular weight (40 kDa or below). Has been used in case of low molecular weight proteins such as Bence-Jones protein in urine or similar proteins in serum. See ~2 microglobulin. Microphage: Metchnikoff's term to describe polymorphonuclear leucocytes and other phagocytic cells of the myeloid cell series in contrast to macrophages q.v. Microtubules: long hollow cylindrical structures (tubular in cross section) with an outer diameter of about 20-25 nm, found in the cytoplasm of eukaryotic cells including all cells of the immune system. Composed chiefly of tubulin. Migration inhibition factor: the first immunologically important cytokine to be described was a factor released in delayed-type hypersensitivity reactions that inhibited macrophages from migrating out of capillary tubes. Still not unequivocally defined at the molecular level since several molecules with similar activities have been described. Mixed leucocyte reaction (MLR)" lymphocyte activation seen when mononuclear cells (mixtures of lymphocytes and accessory cells) from two genetically disparate individuals are cultured together in vitro. Due to a cellmediated immune response of the cultured lymphocytes against foreign cell surface antigens. The strength of the reaction is directly related to the degree of incompatibility between the histocompatibility antigens of the two donor~. Monoclonal antibody: antibody produced by a single clone of cells or a clonally derived cell line, and therefore having a unique amino acid sequence. Commonly used to describe the antibody secreted by a hybridoma cell line, although strictly this is only monoclonal if one of the fusion partners is a non-producer. Very widely used as a specific reagent for the identification and study of antigens and particularly useful when the latter have not been purified. Monocyte: a large, motile, amoeboid cell with an indented nucleus, precursor of the macrophage. Found in normal blood (200-800 cells per mm 3 or 2-10% of the total white cell count in humans). Derived from promonocytes in bone marrow and is the blood representative of the mononuclear phagocyte system. Monocytes remain in the blood for a short time (about 24 hours mean halflife) and then migrate into the tissues where they undergo further differentiation to become macrophages. Monokine: generic term for secreted products of mononuclear phagocytes with regulatory effects on their own functions or those of others cells, e.g. IL-I, TNF-~. Mononuclear cell: a vague term often used to refer to cells of the mononuclear, unlobulated phagocyte system or to lymphocytes, or to mixtures of the two, as seen in

GLOSSARY

histological sections or fractionated blood leucocyte samples; in contrast to polymorphonuclear leucocytes. Mononuclear phagocytes (mononuclear phagocyte system): a system of phagocytic cells of which the mature functioning form is the macrophage. The term mononuclear phagocyte system was introduced to replace the term 'reticuloendothelial system' which is now considered inaccurate. All mononuclear phagocytes are considered to share a common origin from the bone marrow promonocytes and to share a common function, i.e. phagocytosis and digestion of particulate material. If class II MHC antigen-positive they also act as accessory cells. Mucosal mast cell: distinct population of mast cells found in mucosal tissues (especially intestine) characterized by production of specific serine protease and dependence on T lymphocyte-derived IL-3 for growth. Myasthenia gravis: autoimmune disease characterized by progressive muscular weakness on exercise caused by faulty neuromuscular transmission. The patients' sera contain antibodies against the acetylcholine receptor on the post-synaptic membrane of the neuromuscular junction. These antibodies are the putative cause of the symptoms and can induce autoimmune myasthenia gravis in experimental animals. Myeloid cell series: a series of bone marrow-derived cell lineages which include, as mature forms, the granular leucocytes (granulocytes) and the mononuclear phagocytes of blood. Myeloma: a tumour of plasma cells, see plasmacytoma,

myelomatosis. Myeloma protein: immunoglobulin that is monoclonal produced by neoplastic plasma cells in myelomatosis in man, mouse and other species. Detected as an electrophoretically homogeneous para-protein. Myelomatosis: disease characterized, in man, by neoplastic proliferation of plasma cells throughout the bone marrow. The neoplastic cells are monoclonal and produce large amounts of structurally identical immunoglobulin (paraprotein), usually of IgG or of IgA class though IgD and IgE have also been reported, forming a sharply localized band on serum electrophoresis and a characteristic monoclonal banding pattern on isoelectric focusing. Bence-Jones protein appears in the urine in a proportion of cases. Myeloperoxidase: peroxidase found in the azurophil granules of the neutrophil leucocyte, which, together with hydrogen peroxidase and halide, forms a bactericidal system. Families with myeloperoxidase deficiency have been reported.

N Naive lymphocyte: a lymphocyte that has not met antigen. An unprimed lymphocyte. Native immunity: non-specific immunity resulting from

GLOSSARY

the genetic constitution of the host, e.g. immunity of man to canine distemper. Natural antibody" antibody present in serum of normal individuals not known to have been immunized against the relevant antigen. Examples in man include the isohaemagglutinins of the ABO blood group system and antibodies to the Forssman antigen. They possibly result from an immune reaction against some closely related antigens of bacteria or food in the intestine of the infant. Negative selection: clonal deletion of antigen-specific, receptor-bearing lymphocytes, resulting in permanent loss of the relevant cells and their progeny. Term usually applied to the deletion of self (autoantigen)-reactive T lymphocytes during development in the thymus, but may also refer to elimination of self-reactive B lymphocytes. Neutrophil leucocyte: cell of myeloid cell series, the most numerous in normal peripheral blood (normal count in human blood 2500-7500 per mm 3 or 40-75% of the total white cell count). A motile, short-lived cell with multilobed nucleus and a cytoplasm filled with azurophil granules q.v. and specific granules q.v. which do not take up acidic or basic dyes strongly (hence name). Actively phagocytic with an efficient microbicidal capacity. Also reacts vigorously to chemotactic stimuli. Name usually abbreviated to neutrophil. Also known as polymorph or polymorphonuclear leucocyte or granulocyte (eosinophil leucocytes and basophil leucocytes also have mutilobed nuclei and cytoplasmic granules). It should be noted that in species other than man, the blood cells acting functionally as neutrophils may have granules whose staining properties are not 'neutrophil'. These are sometimes known as heterophil granulocytes. Nitric oxide (NO)" a highly reactive, colourless and odourless gas. In biological systems it has a half-life between 3 and 15 seconds and is derived from molecular oxygen and the guanidino nitrogen of L-arginine, in a reaction catalysed by NO synthase (NOS). Certain cells, e.g. vascular endothelium, generate NO through a constitutive NOS (cNOS, calcium-dependent). This mediates vascular relaxation. Functions such as neurotransmission and platelet aggregation are mediated through a similar constitutive pathway. Another form of NOS is inducible (iNOS, calcium-independent) by immunological stimuli such as IFN- 7, TNF-~ and lipopolysaccharide to produce large amounts of NO which can be cytotoxic. This is an important microbicidal function of activated macrophages. NK cell (natural killer cell)" cytotoxic lymphocytes which lack the phenotypic markers of both T cells (TCR, CD3) and B cells (membrane immunoglobulin). Normally present as ~ minority population in blood. They contain prominent cytoplasmic granules and are morphologically distinguishable as large granular lymphocytes. Non-specific immunity: mechanisms for the disposal of

651

foreign and potentially harmful macromolecules, microoganisms or metazoa which do not involve the recognition of antigen and the mounting of a specific immune response. Such mechanisms include the action of lysozyme or anti-viral interferons, phagocytosis and chemical and physical barriers to infection. Protective immunity in invertebrates is of the non-specific type. Specific and non-specific immunity are so closely linked in vertebrates that it is often impossible to dissociate their actions. NOS (nitric oxide synthase): see nitric oxide. Nu nu mice: see nude mice. Nude mice: mice with congenital absence of the thymus, and whose blood and thymus-dependent areas of the lymph nodes and spleen are depleted of T lymphocytes. These mice are homozygous for the gene 'nude' abbreviation nu, hence nu nu, and have no hair. Nurse cell: see thymic nurse cell.

O

Opsonin: factor present in plasma and other body fluids which binds to particles, especially cells and microorganisms, and increases their susceptibility to phagocytosis. Oral tolerance: the induction of specific immunological tolerance by oral administration of antigen. This is the usual result of feeding soluble antigens (e.g. food proteins) to a naive animal (non-immune animal). Orthotopic graft: tissue or organ grafted to a site normally occupied by that tissue or organ. Oxidative metabolic burst (respiratory burst): the rapid generation of reactive oxygen intermediates (q.v.) in neutrophil leucocytes and mononuclear phagocytes following phagocytosis and related stimuli (e.g. chemotactic factors).

Paracortex: the thymus-dependent area of a lymph node. Paraprotein: any abnormal protein in serum but usually refers to immunoglobulin derived from an abnormally proliferating clone of neoplastic plasma cells. Paraproreins are normally monoclonal and appear as a sharply localized band on serum electrophoresis. Paraproteinaemia: presence in serum of paraprotein. A diagnostic feature of myelomatosis and Waldenstr6m's macroglobulinaemia. Paratope: antigen-binding site of an antibody or TCR. Passive immunity: immunity due, not to the production of a specific immune response by an individual, but to the presence in his tissues of antibody or primed lymphocytes derived from another immune individual. Examples are the immunity of the neonate against many infectious agents due to placentally or colostrally trans-

652

ferred maternal antibody (see maternal immunity) and the use of antitoxins to give protection against diphtheria or tetanus. In the case where lymphocytes are transferred (adoptive transfer), the term adoptive immunity is often used. Passive transfer: transfer of immunity or hypersensitivity from an immune or primed donor to a previously nonimmune animal by injection either of antibody or primed lymphocytes. Perforin: protein found in granules of cytolytic cells such as cytotoxic T lymphocytes, in which it is formed during immune responses, and in NK cells, in which it is present constitutively. Normally found as a monomer that has no cytolytic activity, but on contact with target cells, the granules fuse with the lymphocyte plasma membrane, the perforins are released and, in the presence of Ca 2+, they form amphipathic ring polymers of 12-18 molecules which resemble the membrane attack complex of complement. These insert into the membrane of the target cell causing lysis of the latter. Periarteriolar lymphatic sheath (PALS): the thymus-dependent area of the white pulp of the spleen q.v. Peyer's patches: lymphoepithelial nodules in the submucosa of the small intestine, more prominent in the ileum (lower part) than in the jejunum. Contain lymphocytes including the precursors of IgA-producing B cells, germinal centres and thymus-dependent areas. These lymphoid tissues are separated from the lumen of the intestine by a single layer of columnar eptihelium (follicle-associated or dome epithelium), containing specialized cells (microfold-M-cells) which take up antigen from the lumen and transport it into the lymphoid areas. Peyer's patches are believed to be the principal site for induction of intestinal immune responses. There is distinct evidence that ileal Peyer's patches in ruminants could be a primary B cell organ. Phagocyte: a cell that is able to ingest, and often to digest, large particles such as effete blood cells, bacteria, protozoa and dead tissue cells. Phagocytosis: 'cell eating'. The ingestion of cells or particles by inclusion in a cytoplasmic phagosome q.v. In mammals, only cells of the mononuclear phagocyte system and neutrophil leucocytes are 'professional' phagocytes, although other cells may, on occasion, show facultative phagocytosis. Phagolysosome: the product of the fusion of lysosomes with a phagosome. Materials included within it may be digested by hydrolysis. Following such digestion the vesicle may continue to function and is sometimes called a 'secondary lysosome'. Phagosome: an intracellular vesicle in a phagocyte q.v. formed by invagination of the cell membrane and containing phagocytosed material. The latter is digested by lysosomal enzymes liberated into the vesicle following fusion of the phagosome with cytoplasmic lysosomes. The structure which results from this fusion is known as a phagolysosome.

GLOSSARY

Pharyngeal tonsil: see tonsil. Pigeon fancier's lung: see bird fancier's lung. Plasma: the fluid phase of blood in which the red and white blood cells are suspended. Plasma cell: cell of B lymphocyte lineage with a major role in antibody synthesis and secretion. The cytoplasm is basophilic, rich in RNA and protein, and packed with rough-surfaced endoplasmic reticulum. The nucleus is often round and eccentrically placed, with clumped chromatin giving a 'clock face' or 'cartwheel' appearance. The plasma cell is the end cell of the B lymphocyte line. It is the major immunoglobulin secreting cell type and therefore the classical cell of humoral immunity. Present in lymphoid tissue and increased in numbers in the draining lymph node and at the site of entry of antigen following antigenic stimulation. Plasmacytoma: a localized tumour of plasma cells in contrast to myelomatosis which is a diffuse plasma cell tumour in bone marrow and elsewhere. Platelet (thrombocyte): a small non-nucleated 'cell' (3/~m diameter) found in mammalian blood, and derived from the megakaryocytes of bone marrow. It is important in blood coagulation as a generator of thromboplastin on contact with foreign surfaces and is essential for haemostasis and thrombosis. PMN: see polymorphonuclear leucocyte. Polymorphonuclear leucocyte: synonym for neutrophil leucocyte which, in its mature form, has a multilobed nucleus though other cell types, e.g. eosinophil leucocytes may also have multilobed nuclei. Positive selection: the process which ensures that mature antigen-reactive T lymphocytes will only recognize foreign antigenic peptide when presented in association with a self major histocompatibility complex (MHC) molecule. This occurs during development in the thymus because T cells expressing T cell receptors (see TCR) capable of interacting with self MHC molecules are rescued from programmed cell death. Positive selection also occurs in germinal centre B cells which recognize their specific antigen in the form of immune complexes on follicular dendritic cells provided that accessory molecules are also present. Highaffinity B cells are thus rescued from programmed cell death. Post-capillary venules: small vessels through which blood flows after leaving the capillaries and before reaching the veins. It is between the endothelial cells of postcapillary venules (rather than capillaries) that most leucocytes migrate into inflammatory sites. The high endothelial venules (q.v.) of lymph nodes are specialized post-capillary venules through which the recirculating pool of lymphocytes pass from blood to lymph. Pre-B lymphocyte (pre-B cell): B cell precursor which has developed from a pro-B lymphocyte, and which has begun to rearrange the heavy chain genes of immunoglobulin and to synthesize/~ chains. Pre-T lymphocyte (pre-T cell): bone marrow-derived pre-

GLOSSARY

cursor of T lymphocyte which has not yet undergone education or development in the thymus. Primary follicle: see lymphoid follicle. Primary immune response: the response of the animal body to an antigen on the first occasion that it encounters it. Primary lymphoid organs: those lymphoid tissues (organs) that are essential to the ontogeny of the immune response, i.e. the thymus and, in birds, the bursa of Fabricius. Primary lysosome: a lysosome prior to fusion with a phagosome. Primary nodule: see lymphoid follicle. Primed: (1) of a whole animal. Exposed to antigen in such a way that the antigen makes contact with the lymphoid tissue so that the appropriate responsive cells are activated. Further contact of a primed host with antigen usually results in a vigorous, rapid, secondary immune response. (2) Of lymphocytes. A primed lymphocyte is one that has been specifically activated in respect of a given antigen and can divide and give rise to effector lymphocytes and memory cells. Primed lymphocyte: lymphocyte, primed (q.v.) specifically to an antigen. Priming: (1) of immune responses. The events that follow initial contact with antigen. (2) Of neutrophil leucocytes. Addition of a stimulus at a dose too low to stimulate an oxidative metabolic burst, but which primes the cell so that on addition of a second stimulus, which may not be identical to the first, a much larger metabolic burst is obtained than in unprimed cells. Privileged sites: sites in the body lacking normal lymphatic drainage and into which antigens, or tissue grafts, can be placed without stimulating an immune response, e.g. the central nervous system, the anterior chamber of the eye, and the cheek-pouch of the hamster. Pro-B lymphocyte: the most immature identifiable precursor of the B lymphocyte.

Processing: see antigen processing. Programmed cell death: death of cells due to activation of a genetic programme that instructs the cell to commit suicide. Requires new gene expression. Frequently takes the form of apoptosis, but the latter does not always involve gene expression by the dying cell. Important generally in developmental biology and, in immunology, in selection of lymphocytes during maturation. Properdin (P; Factor P): protein of the alternative pathway of complement activation. Exists in the circulation as a mixture of polymers (monomer 53 kDa). Binds and stabilizes alternative pathway C3 convertase and C5 convertase preventing their spontaneous dissociation. Prostaglandins: biologically active lipids generated by the action of cyclo-oxygenases on arachidonic acid. There is a large number of prostaglandins, which have a variety of activities as inflammatory mediators. The actions of different prostaglandins may be mutually antagonistic.

653

Proteasome: a proteolytic complex that degrades proteins within the cytosol (that is, the cytoplasm other than organelles and membranes) and nuclear proteins. Implicated in antigen processing for presentation by class I MHC. Purine nucleoside phosphorylase deficiency (PNP deficiency): an autosomal recessive defect due to inheritance of a mutant form of PNP. Toxic metabolites accumulate in T cells and there is primarily a deficiency of cellmediated immunity with normal numbers of B cells, though antibody production may be impaired as a secondary effect.

Receptor: macromolecule, usually a protein, which contains a site capable of selectively combining, with a varying degree of specificity, with complementary molecules known as ligands. Recirculating pool: all the lymphocytes that continuously recirculate between blood and lymph, see lymphocyte

recirculation. Recirculation: see lymphocyte recirculation. Recombinant strains: strains of animals (e.g. mice, sheep) in which the genes in the parental strains have either been reassorted (i.e. recombined) by breeding techniques (to give recombinant inbred strains) or altered by direct DNA manipulation. Recombinant inbred (RI) strains provide large numbers of virtually genetically uniform and homozygous mice in which the effects of reassorting various parental genes (e.g. heavy chain genes) can be studied. Rejection: see immunological rejection. Repertoire: (1) the number of different antibody or TCR (T cell receptor) variable region sequences produced by the immune system of a given species. (2) The number of different epitopes recognized by all the antibodies or T cell receptors produced by the immune system of a species. These two definitions are not synonymous since there is redundancy within the system, i.e. several antibody molecules or T cell receptors with different variable regions are able to recognize the same epitope. The number of different epitope-recognizing receptors on B cells or T cells produced by an individual animal or human at any one time is much less than the number that the immune system is capable of p r o d u c i n g - the ' potential repertoire'. Resident macrophage: macrophage present at a site in the absence of a known eliciting stimulus. Respiratory burst: the increase in anaerobic glycolytic metabolism and oxygen consumption which occurs following activation of phagocytes, e.g. neutrophil leucocytes, by chemotactic factors, phagocytosis, etc., and which is accompanied by enhanced NADPH oxidase activity leading to generation of microbicidal reactive oxygen intermediates.

654

Reticulum cells: cells that, together with reticular fibres, make up the framework or stroma of lymphoid tissues such as the spleen and lymph nodes and of the bone marrow. Reticular dysgenesis: the most complete form of severe combined immunodeficiency syndrome (SCID) in which there is a defect of maturation of all leucocytes, i.e. lymphocytes, granulocytes and monocytes. Runt disease: disease which develops after injection of allogeneic lymhocytes into immunologically immature experimental animals. Characterized by loss of weight, failure to thrive, diarrhoea, splenomegaly and often death. An example of a graft-versus-host reaction.

Scavenger receptor: a type II transmembrane protein (trimeric) found on macrophages. There are two forms of different molecular weights. They bind a number of modified proteins such as acetyl-LDL and maleyl-HSA and may have a general role in scavenging modified proteins. Scavenger receptor superfamily: a number of proteins other than the scavenger receptor have extracellular domains of the scavenger receptor type. They include CD5 and CD6. SCID (severe combined immunodeficiency): a rare immunodeficiency state in infants presenting early with severe infections, diarrhoea and failure to thrive. Both humoral immunity and cell-mediated immunity are defective. There are various forms, e.g. (a) X-linked SCID in which there is a complete absence of T cells and T cell precursors but functional B cells are present; this form may be associated with mutations in the gene for the 7 chain of IL-2R; (b) autosomal recessive forms including adenosine deaminase deficiency; and (c) in some cases, particular chains of the CD3 molecule are absent. The disease can be corrected by bone marrow transplantation, suggesting a stem cell defect (involving T cell precursors prior to migration to the thymus). SCID mouse (severe combined immunodeficiency mouse): a mouse homozygous for a recessive mutation (SCID) on chromosome 16. Such mice have low numbers of both B cells and T cells, lack immunoglobulin in their serum and are deficient in both humoral immunity and cell-mediated immunity. Both T and B lymphocytes have a defective capacity to rearrange the genes coding for antigen receptors. Secondary follicle: lymphoid follicle that contains a germinal centre. More frequently observed in secondary immune response than in primary immune response, hence name. Secondary immune response: response of the immune system to an antigen to which it has already been primed and therefore has memory. There is very rapid production of large amounts of antibody over a few

GLOSSARY

days followed by a slow exponential fall. The response of cell-mediated immunity follows a similar pattern. Secondary lymphoid tissues: those lymphoid organs that are not essential to the ontogeny of the immune response, i.e. spleen, lymph nodes, tonsils, Peyer's patches. Secondary lysosome: see phagolysosome. Secretory IgA: the form of IgA found in external body secretions such as intestinal mucus, colostrum, milk, saliva, sweat and tears; mainly in the form of a dimer with a secretory piece bound to it. Thus distinct from that found in the serum, which has no secretory piece and, in humans, is predominantly monomeric. Secretory piece: polypeptide of molecular weight 60 kDa found attached to dimers of the secretory form of IgA (see secretory IgA). Structurally unrelated to immunoglobulins and synthesized by epithelial cells in the gut, lung, mammary or other secretory tissues, not the plasma cells that synthesize the immunoglobulin. Has strong affinity for mucus thus prolonging retention of IgA on mucous surfaces. May also inhibit the destruction of IgA by enzymes in the digestive tract. Selectins: a family of cell adhesion molecules. Type I transmembrane proteins which mediate the initial adhesion of leucocytes to vascular endothelium by lowaffinity interactions and slow the cells up, causing them to roll along the side of the vessel. The leucocytes then become bound in a second step mediated by integrin superfamily proteins and migrate through the vessel wall. Self tolerance: immunological tolerance to autoantigens. Such tolerance to self antigens accessible to the lymphoid tissues is thought to be acquired normally during fetal life. Sequestered antigen: any antigen or epitope which is hidden from contact with immunologically competent cells and thus cannot stimulate an immune response. Antigens in certain privileged sites may be sequestered from the immune system. Serotonin (5-hydroxytryptamine, 5HT): causes smooth muscle contraction, increased vascular permeability and vasoconstriction of larger vessels. Found in platelets and mast cells. It is also an important neurotransmitter. Serum: fluid expressed from a blood clot as it contracts after coagulation of the blood. The essential difference between plasma and serum is that the latter does not contain fibrinogen. Serum sickness: a hypersensitivity reaction to the injection of foreign antigens in large quantity, especially those contained in antisera used for passive immunization. The symptoms are due to the localization in the tissues of soluble immune complexes formed between antibody produced during the developing immune response and the large quantities of antigen still present (type III hypersensitivity reaction). Severe combined immunodeficiency syndrome: see SCID. Sezary syndrome: a T cell lymphoma with erythroderma

GLOSSARY

and other skin lesions. There are circulating T lymphoma cells with a characteristic irregular nuclear morphology. Associated with mycosis fungoides. slg: surface immunoglobulin. See membrane immunoglobulin. The prefix s is ambiguous and used for 'secretory' and 'soluble', etc., e.g. slgA for secretory IgA found in external body secretions. slgA: see secretory IgA. Signal peptide: see leader peptide. SLE (systemic lupus erythematosus): autoimmune disease of man, characterized by widespread focal degeneration, 'fibrinoid necrosis' of connective tissue and disseminated lesions in many tissues including skin, joints, kidneys, pleura, peripheral vessels, peripheral nervous system, blood, etc. The glomerular lesions are particularly serious and have been shown to result from deposition of immune complexes in the glomerular capillaries. Cf. lupus erythematosus. Small lymphocyte: cell 5-8 ~tm in diameter with a deeply staining nucleus and narrow rim of cytoplasm. The size simply indicates a resting (GO) cell and despite the apparent identity of morphology, small lymphocytes differ in origin and function. See T lymphocyte, B lymphocyte. Somatic hypermutation: mutations that occur rapidly in the V-region (variable region) genes of the light chain and heavy chain during the formation of memory B cells, giving many more V-region sequences than are found in the germline genes from which they originated. Somatic hypermutation takes place in germinal centres. Specific immunity: as a general concept, specific immunity is a non-susceptibility to re-infection by a pathogen, that develops in individuals who survive a first encounter with that same pathogen. Specificity: a term defining selective reactivity between substances, e.g. of an antigen with its corresponding antibody or primed lymphocyte. Spleen: a solid, encapsulated organ, deep red in colour, found in the upper abdomen. It is a peripheral lymphoid organ which has a major arterial supply and acts as a blood filter. The spleen comprises two fundamentally distinct types of tissue, the 'white pulp' (Malpighian body or corpuscle) which is a lymphoid tissue, and the 'red pulp'. (a) The white pulp forms a cuff or sheath of tissue round the arterioles which consists chiefly of lymphocytes together with a smaller number of splenic dendritic cells. The central zone of the white pulp (nearest the arterioles) is a thymus-dependent area and contains T cells. More peripherally are found B cells in spherical lymphoid follicles. Germinal centres (q.v.) develop in these follicles following antigenic stimulation. The arterioles terminate in venules between the white and the red pulp (the marginal zone) and it is from these venules that lymphocytes migrate into and populate the white pulp. The marginal zone itself is rich in B memory cells which are well placed to interact with antigens carried in the blood. (b) The red pulp consists

655

of large numbers of blood-filled sinusoids in which phagocytosis of effete erythrocytes takes place. It also functions as a reserve site for haemopoiesis. It is rich in macrophages, and plasma cells are also found there. Stem cell: the progenitor of all the cells of the immune system. A large cell with a rim of intensely RNA-rich (pyroninophilic) cytoplasm and pyroninophilic nucleoli within a leptochromatic nucleus (i.e. having narrow strands of chromatin) found in bone marrow and other haemopoietic tissues. Stromal cells: see reticulum cells. Subset: term used to classify functionally or structurally different populations of cells within a single cell type. Superantigen: designation of a class of antigen that activates all T cells bearing one or more particular TCR Vfi sequences. Superantigens bind with high affinity to a region of class II MHC molecules that is outside the groove and to a region of the TCR Vfi chain away from the antigen-binding site, forming a direct link between MHC and TCR. Superfamily: a group of proteins which show structural homology and putatively evolved from the same primordial gene. Superoxide anion (02): oxygen molecule that carries an extra unpaired electron, and is therefore a free radical. Generated in neutrophil leucocytes and mononuclear phagocytes by one-electron-step reduction of molecular oxygen. Supressor T lymphocyte: presently ill-defined subpopulation of T lymphocytes which directly suppresses the immune response.

Surface immunoglobulin: see membrane immunoglobulin. Surrogate light chain: a protein found in precursors of B cells (pro-B lymphocytes and pre-B lymphocytes) but not in mature B lymphocytes. Derived from the genes VpreB and ,;[5 which do not undergo translocation (see immunoglobulin gene) but are transcribed separately. The VpreB and 2s polypeptides form light chain-like structures which associate with the/l heavy chain (of IgM) made by B cell precursors before they start to make functional light chains. Syngeneic (syngenic): genetically identical, usually applied to grafts made within an inbred strain. Systemic lupus erythematosus: see SLE.

T-B cell cooperation: a process required for production of normal levels of antibody to thymus-dependent antigens, i.e. most antigens. Requires physical contact of helper T lymphocytes and B lymphocytes with accessory cells. T cell: see T lymphocyte; the two names are interchangeable. T cell-dependent antigen: see thymus-dependent antigen. T cell-dependent area: see thymus-dependent area.

656

T cell-dependent immune response: the immune response of cell-mediated immunity. The latter term was introduced before T cells were discovered and is inexact but universally used. T cell receptor: see TCR. T cell subset: see T lymphocyte subset.

T-dependent antigen: see thymus-dependent antigen. T-dependent area: see thymus-dependent area. T helper cell: see helper T lymphocyte.

Thrombocyte: see platelet. T-independent antigen: see thymus independent antigen. T lymphocyte (also called a T cell; the two names are interchangeable): lymphocyte that is derived from the thymus. Carries an antigen-specific T cell receptor, and is CD3 +. T lymphocytes play a major role (a) as antigen reactive cells and effector cells in cell-mediated immunity; and (b) by cooperating with B lymphocytes in antibody production (humoral immunity) against thymus-dependent antigens. T lymphocyte antigen receptor: see TCR. T lymphocyte-B lymphocyte cooperation: see T-B cell cooperation. T lymphocyte repertoire: the number of different epitopes to which the T lymphocytes of an individual animal are capable of responding. Cf. B lymphocyte repertoire and see repertoire. T lymphocyte subset: group of T lymphocytes which are identified phenotypically by specific cell surface antigens and are characterized by a particular function. T lymphocyte-T lymphocyte cooperation: postulated interaction between different T lymphocyte subsets in activation of cell-mediated immune responses. See also T-B cell cooperation. TAP (transporter associated with antigen processing): proteins derived from MHC gene-associated Tap genes. TAP proteins transport the peptides generated from cytoplasmic cleavage of endogenously synthesized proteins across the membrane into the lumen of the endoplasmic reticulum, where they associate with, and stabilize, class I MHC antigen molecules. TAP proteins are essential for presentation of antigen with class I MHC. TCR (T cell receptor; T lymphocyte receptor TcR): the molecule on the surface membrane of T lymphocytes capable of specifically binding antigen in association with MHC antigens. The molecule belongs to the Ig superfamily and consists of two Type I transmembrane protein disulphide-linked polypeptide chains of molecular weight 40-50 kDa. The majority (_+ 90%) of human T lymphocytes express TCR composed of an 0~fiheterodimer, while the remaining, mutually exclusive, population of T cells expresses a 7~ TCR. Each chain contains a variable (V) and constant (C) region, homologous to those found in immunoglobulin molecule variable regions and constant regions. In addition, the fl and chains contain junctional (J) and diversity (D) regions which are analogous to those in immunoglobulin mole-

GLOSSARY

cules. The ~ and 7 chains also contain junctional regions. The antigen-binding site is formed primarily from the combination of the D and J regions, with a small contribution from the V region, and is responsible for interacting both with foreign peptide and self MHC molecules. The TCR is always non-covalently linked in the T cell membrane to the CD3 molecule, q.v. TD antigen: see thymus-dependent antigen. TDTH lymphocyte: effector T lymphocyte in delayed-type hypersensitivity reaction. Usually CD4 + and putatively may belong to the TH1 subset of CD4 + cells. Function depends on production of cytokines such as IFN-7. TH lymphocyte (helper T lymphocyte): see TH1 cells and TH2 cells. TH1 cells: functional T lymphocyte subset of CD4 + cells, characterized by their production of the cytokines IL-2, IFN-2 and TNF-~,-fi and by failure to produce IL-4, IL5 and IL-10. A polarization of the immune response towards TH1 cell activity can occur in mice (and possibly man) and is associated with cell-mediated immunity in vivo including delayed-type hypersensitivity and T cell proliferation. The selective activation of TH1 cells is favoured by the presence of IFN-2 and IL-12 and is inhibited by IL-4 and IL-10. TH2 cells: functional T lymphocyte subset of CD4 + cells which, in mice (and possibly man) is distinct from the THI subset, q.v. TH2 cells are characterized by the production of IL-4, IL-5 and IL-10 and by the failure to produce IL-2 and IFN-7. TH2 cell activation is associated with helper activity for antibody production (see helper T lymphocyte) and the inhibition of TH1mediated responses. IL-4 is essential for the growth and differentiation of TH2 cells. Thoracic duct: duct that returns lymph to the blood. Thymic cortex: see thymus. Thymic epithelial cells: epithelial cells found in the thymic cortex and medulla (see thymus) and derived from the third branchial pouch. They are believed to control the education of T lymphocyte precursors by presenting self-peptides bound to MHC (major histocompatibility complex) molecules and by secreting cytokines which stimulate lymphocyte growth. Thymic hypoplasia: congenital cell-mediated immunity deficiency syndrome in human infants. Often associated with hypoparathyroidism (see Di George's syndrome). The blood lymphocyte count is low, T lymphocytes being completely absent and the thymus-dependent areas of lymphoid tissues are depleted of lymphocytes. T-dependent B lymphocyte responses are also impaired. Recurrent opportunistic infections of the skin and respiratory tract may be present. Thymic medullary hyperplasia: term used to signify the presence of germinal centres in the medulla of the thymus especially in myasthenia gravis. The term does not imply that thymic weight is increased. Thymic nurse cell: a subset of large thymic epithelial cells with which thymocytes come into close contact.

GLOSSARY

Role in maturation and differentiation of T lymphocytes. Thymocyte: any lymphocyte found within the thymus. Thymus: the organ essential for the development of T lymphocytes. In mammals, it consists of two lobes situated in the anterior part of the thorax, ventral to the trachea and great vessels and is derived from the third and fourth branchial pouches. In birds, it is distributed along the neck as a series of lobes. Histologically, it consists mainly of lymphocytes distributed into distinct cortical and medullary areas on a network of reticular cells (stromal cells). In the cortex, these lymphocytes ('thymocytes') are rapidly dividing progeny of T lymphocyte precursors derived from haemopoietic tissues. During development in the cortex thymocytes are initially C D 4 - C D 8 - , but then become CD4 +CD8 + and eventually develop into either CD4+CD8 - or CD4-CD8 +, at which point they accumulate in the medulla before leaving to populate the peripheral lymphoid organs as mature T cells. C D 4 - C D 8 - thymocytes begin to rearrange T cell receptor (TCR) genes randomly and, depending on the surface receptor expressed, undergo positive selection and negative selection. As a result 95% of the thymocytes produced never leave the thymus and die. In addition to lymphocytes, the thymus contains large numbers of epithelial cells, stromal cells and accessory dendritic cells which play important roles in positive and negative selection, both by presentation of self MHC (major histocompatibility complex) molecules and by production of growth factors for lymphocytes. The thymus functions mainly in the fetal and early neonatal period, and animals thymectomized at birth or congenitally athymic (see nude mice, thymic hypoplasia) have an absence of T lymphocytes. After puberty, the thymus atrophies, but may continue to produce new T lymphocytes and animals thymectomized during adult life gradually become deficient in T cells. Thymus-dependent antigen (T-dependent antigen): an antigen that does not stimulate an antibody response in animals lacking a thymus. Cooperation with helper T lymphocytes is required in order for B lymphocytes to respond to such antigens by maturation into antibodyforming cells. Most proteins and other antigens which present a diversity of epitopes are thymus-dependent. Thymus-dependent area: those areas of the peripheral lymphoid organs that appear selectively depleted of lymphocytes in neonatally thymectomized animals, and in babies and animals with congenital aplasia of the thymus (see thymic hypoplasia and nude mice). Anatomically, these areas are situated in the mid cortex (paracortical area) of lymph nodes, the centre of the Malpighian corpuscle of the spleen and in the internodular zone of Peyer's patches. In normal subjects they are mostly occupied by small lymphocytes of the recirculatory pool (see lymphocyte recirculation) which enter

657

them by crossing high endothelial venules. They also contain various accessory cells including macrophages and dendritic cells (interdigitating cells). Thymus-dependent cells: population of lymphocytes whose normal development depends on the presence of the thymus at birth, i.e. T lymphocytes q.v. Thymus-derived cells: T lymphocytes. Most T lymphocytes, but perhaps not all, must mature in the thymus. Thymus-independent antigen (T-independent antigen): an antigen that is able to stimulate B lymphocytes to produce antibody without the cooperation of T lymphocytes. An antibody response to such antigens can be stimulated in an animal lacking a thymus. T-independent antigens are, frequently, repeating polymers which present an array of identical epitopes to the lymphocyte. Tingible body macrophage: macrophage within a germinal centre that has phagocytosed apoptotic B lymphocytes. The 'tingible bodies' (deeply staining debris) are remnants of ingested cells. TNF (tumour necrosis factor): note that TNF-~ and TNFfi are also frequently called TNF and LT (lymphotoxin) respectively. Thus, in many publications the designation TNF, without a following Greek letter, refers to the cytokine, TNF-~. TNF family: a group of related proteins all of which usually exist as trimers and which bind to members of the TNFR superfamily. The family includes TNF-~ and TNF-fi. TNFR superfamily (tumour necrosis factor receptor superfamily): a family of molecules named the TNFR superfamily by immunologists and the NGFR (nerve growth factor receptor) superfamily by others. It contains TNFR I and II, and NGFR, among others. Tolerance: see immunological tolerance. Tolerogenic: capable of inducing immunological tolerance. Tonsil: accumulations of lymphoid tissue found in invaginations of the mucous membrane in the area between the mouth and the pharynx. Tonsils vary in extent in different species, being extensive in man and the horse and small in cattle. They are not found in mice. In man they form distinct organs. The most prominent of these are the two palatine tonsils; tubal, lingual and a single nasopharyngeal tonsil complete a ring round the area. The tonsil is a peripheral lymphoid organ. It contains a high proportion of B lymphocytes and is almost always rich in germinal centres. In birds, aggregations of lymphoid tissue with germinal centres found in each caecal wall near the point at which the twin caeca enter the junction of the large and small intestines are called 'caecal tonsils'. Transfusion reaction: disease or physiological disturbance following transfusion of blood. Often due to a specific immune reaction of the recipient against antigens on the donor's red blood cells. In man, the most common and severe form of such reactions is due to ABO blood group system (q.v.) incompatibility as the recipient's plasma

658

contains natural antibodies against the ABO antigens not present on his own cells. After repeated transfusions antibodies may be formed against other antigens on donor cells and cause reactions. Transgene: a gene that has been transfected into the germ line to form a transgenic organism, e.g. a transgenic mouse. Transgenic mouse: a mouse that carries a transgene that can be passed on to succeeding generations. The gene (DNA) is microinjected into fertilized eggs which are allowed to develop in u t e r o . If the gene has been introduced into the germ line, the mice, as adults, will pass it on to their offspring. The mice that develop from transfected eggs are screened for the gene and selected mice are bred to achieve stable transmission of the gene. Transplantation antigen: see histocompatibility antigen. Transplantation immunology: the study of the immune response following transplantation of tissue from donor to recipient. Very largely, the study of cell-mediated immunity in this situation. Type I hypersensitivity reaction: term used in Gell and Coombs' classification of hypersensitivity reactions. In the type I reaction, antigen combines with antibody which is fixed passively to the surfaces of cells, usually mast cells, and causes the release of vasoactive substances, thus synonymous with immediate hypersensitivity and anaphylaxis. The cell-bound antibody involved is usually IgE; the antigen is ohen known as an allergen. Typical diseases are hay fever and asthma. Type II hypersensitivity reaction: term used in Gell and Coombs' classification of hypersensitivity reactions. In the type II reaction, antibody reacts either with a cell surface antigen or with an antigen or hapten which has become attached to the cell surface. Typical diseases include Goodpasture's syndrome and transfusion reactions. If the antibody is complement-fixing antibody, cell lysis occurs. Type III hypersensitivity reaction: term used in Gell and Coombs' classification of hypersensitivity reactions. In this reaction the tissue damage is mediated by immune complexes, particularly soluble complexes formed in slight antigen excess. Typical diseases include serum sickness, extrinsic allergic alveolitis and systemic lupus erythematosus (SLE). In such diseases the complexes are deposited in the blood vessel walls and become surrounded by inflammatory cells, especially neutrophil leucocytes in the acute phase. Later, these are replaced by a mononuclear cell infiltrate. Type IV hypersensitivity reaction: term used in Gell and Coombs's classification of hypersensitivity reactions. In the type IV reaction, primed lymphocytes react with antigen at the site of its deposition resulting in the formation of a lymphocyte-macrophage granuloma, e.g. in pulmonary tuberculosis. Circulating antibody is not involved in this reaction. Type I transmembrane protein: a membrane protein in which the N-terminal region is extracellular, there is a

GLOSSARY

single hydrophobic membrane-spanning region, and the C-terminal region is intracytoplasmic. A large majority of membrane-spanning proteins are of this type. Type II transmembrane protein: a membrane protein in which the C-terminal region is extracellular, there is a single hydrophobic membrane-spanning region, and the N-terminal region is intracytoplasmic. Type III transmembrane protein: a membrane protein which is folded so that the molecule crosses the membrane more than once. An important group which does this is the rhodopsin superfamily and the chemokine family. These have seven membrane-spanning domains and their N-terminal regions are outside, and the Cterminal regions inside, the cell. Another group, with four membrane-spanning domains (the TM4 superfamily), has both N- and C-termini within the cytoplasm. The fl chain of the high affinity receptor for IgE (Fc~RI) is of this type.

Unprimed: having never had contact with or responded to a given antigen (of animals, cells, etc.). The terms 'naive' and 'virgin' are also used to describe unprimed lymphocytes.

Variable region (V region): a sequence of approximately 115 amino acids at the N-terminus of the light chain (VL) and the heavy chain (VH) of immunoglobulin molecules and the ~, fl, 7 and 6 chain of the TCR (T cell receptor). The amino acid sequences in these regions are responsible for the great diversity of the antigenbinding site and T cell receptor repertoires, each clone of B cells or T cells producing molecules with different variable regions. Vasoactive amines: substances containing amino groups, such as histamine and serotonin, which cause peripheral vasodilatation and increase the permeability of small vessels. Veiled cell: a cell characterized by large veil-like processes; found in afferent lymph especially after priming with antigen. Veiled cells possess accessory cell function, and represent an intermediate stage between peripheral dendritic cells (e.g. Langerhans cells) and the dendritic cells of lymphoid tissues (e.g. interdigitating cells). VH region: the variable region of the heavy chain of immunoglobulin. V~: the variable region of the tc (kappa) chain of immunoglobulin. VL region: the variable region of the light chain of immunoglobulin. Va: the variable region of the 2 (lambda) chain of immunoglobulin.

GLOSSARY

Virgin lymphocyte: a lymphocyte that has not met antigen. An unprimed lymphocyte.

W Waldenstr6m's macroglobulinaemia: disease occurring mainly in elderly males, characterized by proliferation of cells that make monoclonal IgM paraprotein. Serum IgM levels are high and there is lymph node enlargement, splenomegaly, a haemorrhagic tendency and hyperviscosity of the blood. Bone marrow and lymphoid tissues are infiltrated with pleomorphic lymphocytes and plasma cells. White cells: the nucleated cells of the blood (i.e. granulocytes, lymphocytes and monocytes), so-called because they form a white layer over the erythrocytes when sedimented. White pulp: see spleen.

659

derived antibodies (see maternal immunity) have disappeared from the child's tissues. There are low numbers of circulating B cells and very low levels of all immunoglobulins. Pre-B lymphocytes are present in normal numbers in the bone marrow. Characterized by repeated, severe bacterial infections. There is a single defect in a gene on the X chromosome indentified as btk (Bruton Tyrosine Kinase). This codes for a protein tyrosine kinase presumptively required for B cell maturation beyond the pre-B lymphocyte stage. Xenogeneic (xenogenic; heterogeneic): preferred term for grafted tissue that has been derived from a species different from the recipient. Xenograft (heterograft): preferred term for a graft from a donor of dissimilar species. Xenotype: structural or antigenic difference between molecules, e.g. immunoglobulins, cell membrane antigens, etc., derived from different species.

X X-linked agammaglobulinaemia (Bruton-type hypogammaglobulinaemia): antibody deficiency syndrome in boys which becomes manifest once maternally

Zymosan: cell wall fraction of yeast (Saccharomyces cerevisiae) which activates the alternative pathway to complement activation, and thus binds C3b. Frequently used for study of opsonic phagocytosis.


Index Note: Page references in italics refer to Figures; those in bold refer to Tables Actinobacillus pleuropneumoniae 379 acute-phase proteins (APPs) in the rat 187, 187 sheep 519 acute-phase response (APR) proteins 273,273 Addison's disease in dogs 281 adhesion molecules in the cat 295 in the pig 378,378 in the rabbit 231-2, 231 in the rat 148, 148-9 in sheep 490 adult respiratory distress syndrome (ARDS), pig models for 401 Aeromonas salmonicida 29, 31 African swine fever 401,406 agammaglobulinemia in horses 358 AIDS human 248,289, 290, 353 murine 594 Aleutian disease of mink 338,338, 340 Aleutian disease virus (ADV) 338 allergic asthma in cats 316 allergic breakthrough in humans 316 allergic bronchiolitis in cats 316 allergic colitis, in cats 316 allergic conjunctivitis in cats 316 allergic enteritis, in cats 316 allergic rhinitis 316, 324 alternative complement pathway in chicken (ACP) 100-1 Ambystoma mexicanum 63 Ambystoma tigrinum (tiger salamander) 69 Ambystomatidae family 63 amphibians immunobiology of T and B cells 68-9 lymphocyte antigen-specific receptors 65-7 lymphoid organs and lymphocytes 63-5 B-cell receptors 66-7 in vitro stimulation 65 other sites of lymphocytopoiesis 64 spleen 63-4 surface lymphocyte markers 645 T-cell receptors 65-6 thymus 63 ontogeny of immune response 69-70 tumors of the immune system 70 anaphylactic shock in cats 315 angioneurotic edema in cats 315 anti- (2,4) -dinitrophenol (DNP) antibodies in amphibians 69 Anura 63 appendix, rabbit 226, 227, 228 arthritis adjuvant, in the rat 197

associated with FIV infection in the cat 319 collagen-induced, in the rat 183 see also rheumatoid arthritis asthma, allergic, in cats 316 Aujeszky's disease 401 autoimmune glomerulonephritis in the rat 196, 197 autoimmune hemolytic anemia (AIHA) in cats 317 in dogs 280 autoimmune masticatory myopathy in dogs 281-2 autoimmune skin disease in dogs 280 autoimmune thrombocytopenia (AITP) in cats 317-18 in dogs 280 in pigs 406 avian immunology autoimmunity 111-13,111 cell surface and secreted immunoglobulins in B-cell development 89-92 bursa of Fabricius 89 chicken Ig loci 89, 89 diversification of the primary immune repertoire 90 Ig isotype switching 90 Ig isotypes 91-2, 91, 92 rearrangement of chicken Ig genes 90 complement 99 avian complement components 99-100, 100 complement activation 100-1,102 MHC and ontogeny 101 cytokines 95-9, 96-7 genes 98 methods used to detect 99 receptors characterized 98 effect of viruses on immune functions 113 D N A viruses 114 RNA viruses 115-16 immunocompetence of the embryo and newly hatched chick 104-5 embryo vaccination 105 maternal antibodies 105 nonspecific immune defenses 105 physiology 104 leukocyte markers in the chicken 81-6 lymphoid organs 73-80 of the chicken 74-6 general description 73-6 major histocompatibility complex (MHC) antigens 92-5 genes 92, 93 regulation of immune response 94, 94 species-specific aspects of genetics or protein structure and function 95 tissue distribution, structure and function of proteins and minor antigens 92-4

662

avian immunology continued mucosal gut immunity 105-8 gut-associated immune system 106-8 ontogeny of the immune system 101-4, 102 B-cell development 102-3 early precursors 102 other cell types 103 T-cell development 103 T-cell receptors, chicken 87-9 distribution of 0~fland ~,&TCR populations 88 species-specific aspects of avian T cells 89 function of T-cell subsets 89 TCR genes 89 T-cell receptor repertoire ontogeny 87-8, 87 ontogeny of T-cell subsets 87 ontogeny of TCR gene repertoires 88, 88 tumors of the immune system 108-11,109 effects on immune function 111,111 natural and experimental hosts 109, 109 pathogenesis of Marek's disease 110 pathogenesis of retrovirus-induced tumors 110-11 target cells for transformation by avian retroviruses 110 target cells for transformation by Marek's disease virus 110 avian leukosis virus (ALV) 108 B-cell receptor complex (BCR) structure and receptors, mouse 577-80 B-cell receptors in amphibians 66-7 B cells in amphibians 64, 68-9 in the cat 295 in chicken 90-1,102-3 equine 347 in fish 7-8 rat 168-71 sheep 511-12, 515 B lymphocytes in the cat 313 in the chicken 86 ChB 1 86 ChB3 86 ChB2, ChB4 and ChB5 86 ChB6 86 ChB7, ChB8, ChB9, ChB10 and ChB11 86 ChB 12 86 in fishes 27-9 in pig 394-5 in the rabbit 224 in sheep 490 B lymphoid tumors, rat 177-8 Babesia bovis 471 babesiosis 606 Bacillus cereus 432 bactenecins 399 badger, Eurasian (Meles meles) 337 balance hypothesis Of autoimmunity 196, 197 Bartonella henselae 324 basophils in fishes 9, 31-3 big pad disease in cats 320 BLAD, 470 bone marrow in the cat 290 mouse 564 rat 139-40 sheep 487 Bordetella bronchiseptica 324 bovine leukemia virus (BLV) 485, 530 Brachdanio rerio (zebrafish) 3, 24

INDEX

bronchiolitis, allergic, in cats 316 bronchus-associated lymphoid tissue (BALT) chicken 73, 79, 81 in the pig 403 in the rat 139, 141,187-8, 187 Brucella abortus in the pig 397 in sheep 516 bullous pemphigoid in cats 318 ' in dogs 280 Burkitt's lymphoma 178 bursa of Fabricius, chicken 73, 77-9, 89, 90-1,104, 106 calcivirus in the cat 309 camelpox virus 426-7 camels and llamas blood groups 432 complement system 432 experimental immunizations 428-9 immunodeficiencies 432 immunoglobulins 423-8 experimental immunizations 427-9 heavy chains 426, 428 IgG subclasses 424-5 light chains 425-6 naturally occurring antibodies in infections 427-8 other classes 425 leukocytes and their markers 422-3 lymphoid organs 422 nonspecific immunity 432 ontogeny of immune system 430 passive transfer of immunity 430-2 phylogeny of immune system 429-30 tumors of the immune system 432 CameIus bactrianus (Bactrian camel) 421 Camelus dromedarius (dromedary camel) 421,432 Candida albicans in horses 358 canine distemper virus 279 caprine arthritis encephalitis virus in the goat 502 caprine arthritis encephalomyelitis virus (CAEV) 528,529 carcinoma of the cervix, human 242 Carrassius auratus (goldfish) 24 Castleman's disease 340 cat

complement system 311-12, 312 cytokines 297-301 IFN 300 interleukins 297-300 mast cell growth factor 301 MHC 301-2 nerve growth factor 301 stem cell factor 301 TNF-0~ 300 immunodeficiency diseases 321-5 adaptive immunity 322-3 associated with innate immunity 323-4 cell-mediated immunity 322 deficiencies in adaptive immunity 324-5 humoral immunity 322-3 innate immunity 322 innate versus adaptive immunity 322 maternal immunity 323 immunoglobulins 304-5,306 immunological diseases 315-21 allergic bowel disease 316-17 allergies of the respiratory tract 316 allergies of the skin 315-16

INDEX

alloantibody diseases 317 autoantibody diseases 317-18 caused by cellular immunity 320-1 cell-mediated diseases of unknown etiology 320 chronic plasmacytic/lymphocytic enteritis 320 delayed-type hypersensitivity disease of the skin 320 granulomatous diseases of infectious etiology 320-1 eosinophilic granuloma complex 316 gammopathies (dysproteinemias or paraproteinemias' 321 monoclonal gammopathy 321 polyclonal gammopathy 321 immune complex diseases 318-20 mechanisms of allergy 315 systemic allergies 315 leukocyte differentiation antigens 294-7 adhesion molecules 295 B-cell antigens 295 NK cells 296 nonlineage 295-6 T-cell antigens 294-5 lymphoid organs 289-94 mucosal immunity 313-14 gastrointestinal immune system 313-14 cells of 314 functional studies of gut immune system 314 infection via the intestinal tract 314 secretory immunoglobulins 313-14 neonatal immune response 308-9 nonspecific immunity 309-11 eosinophils 310 globule leukocyte 310 mononuclear phagocytic system 311 natural barriers 309-10 natural killer cells 310-11 neutrophils 310 ontogeny of the immune system 313 B lymphocyte system 313 T lymphocyte system 313 passive transfer of maternal immunity 305-8 failure 308 immunity transferred by colostrum and milk 305-6 transplacental immunity 305 vaccination of kittens 306-7 red blood cell antigens 303-4, 303 tumors of the immune system 325-7, 326 cathelicidins 399 cattle complement system 469-71 cell receptors for cleavage products of complement components 469 cf. complement system of other animals 471 complement components 469 control proteins 469 deficiencies 470 pathways of initiation 469 serum complement levels 470-1 cytokines 444-54, 448-51 immunoglobulins 456-9 Ig gene mapping 459 Ig isotypes and physiochemical properties 456-7 Ig isotypes: functional properties 458 V genes 458-9 leukocytes and their markers 444-7 lymphoid organs 439-44 afferent lymph 442 efferent lymph 442 follicle-associated epithelium (FAE) and membranous cell (M cell) 443-4

66:3

gut-associated lymphoid tissue (GALT) 442-3 lymph and peripheral blood 442 lymph node 440, 441 lymphocyte distribution 443-4 spleen 441-2, 441 thymus 439-40 MHC complex antigens 459-62 class I antigens 459-60 class II antigens 460 disease associations 461,462 genetic organizations 460-2 methods of characterization 459-60 tissue distribution, structure and function of BoLA molecules 462 unique properties 462 nonspecific immunity 466-9 cellular components 467-9 molecular components 466-7 natural killer cells 469 physical and chemical barriers to infection 466 passive transfer of immunity 464-6 red blood cell antigens 462-4 applications and significance of red cell antigen diversity 464 blood group systems 462-3,463 identified by immune antisera 463 natural blood group system 463 structure of 463 T-cell receptor 454-6 distribution of ~fi and 2& TCR populations 456 general features of TCR complexes 454, 454 invariant components 455-6 molecular structure of TCR genes 454-5 ~fi chains 454-5 25 chains 455 Charcot-Marie-Tooth disease 198 Chediak-Higashi syndrome 339-40 chemokines in fishes 11 in the rat 149, 186 chemotactic molecules in the dog 266 chicken infectious anemia virus 104 Chlamydia psittaci 324 cholangiohepatitis in cats 320 chronic obstructive pulmonary disease (COPD) in the horse 352 chronic progressive polyarthritis in the cat 319 classical complement pathway (CCP) in chicken 101 Clostridium perfringens 432 cluster of differentiation (CD) antigens in cattle 444-7, 445-6 in the dog 263-4 equine see CD antigens in the horse in fishes 7 in the mouse 586, 586-7 rat 142, 143-7 CD antigens in the horse 343-7, 344 EqCD2 (EqWC3) 345 EqCD3 345 EqCD4 345 EqCD5 345 EqCD8-9 345-6 EqCDlla/18 346 EqCD 13 346 EqCD44 346 EqMHC I and EqMHC II 346 EqWC1 346 EqWC2 346 EqWC4 (EqCD28) 346-7

664

CD2 in the pig 374-5, 403 in the rat 150 in sheep 490 CD3, pig 375 CD4 in the cat 294 in the dog 264 in the pig 375-6 in the rabbit 226, 226 in the rat 150-1 CD5 in the cat 295 in the pig 376 in the rabbit 226, 228,235 in the rat 142 in sheep and goats 490, 530 CD6, pig 376 CD8 in the cat 294 in the rat 150-1 CD8, pig 376 CD80~ in the dog 264 CD9 in the cat 295 CD28 in the dog 264 CD34 in the dog 264 CD38 in the dog 264 CD44, pig 376-7 CD45 in the pig 377 in the rat 142 CD86, pig 377 Coccidia 324 colony stimulating factors in fishes 13 complement in cattle 469-71 in the chicken 99-102 dog 274-5 equine 355 in fishes 10-11, 31, 36-8 lagomorphs 243,244-5 in mink 339 in the horse 586, 586-7 pig 400-2 rat 190-2 sheep 522-3,523 C1 in the cat 311 in the dog 275 in the rat 191 C2 in the rat 190, 191,192 C3 in the cat 311 in chicken 100 in the dog 275 in fish 38 in the rat 190, 190, 191 C3 deficiency in the dog 277 C4 in chicken 100 in the dog 275 in the rat 191 C5 in the cat 311 C5a in the rat 191 C6 in chicken 100 in the rat 190, 192 C6 deficiency in the pig 405

INDEX

C9 in the rat 191 colitis, allergic, in cats 316 Concanavalin A 8 conglutinin 466-7, 471 conjunctival-associated lymphoid tissue (CALT) in chicken 73, 79, 80 conjunctivitis, allergic, in cats 316 Cooperia curticei 427 Corynebacterium pyogenes in the camel 422 Cryptosporidia 324 cyclic hematopoiesis in the dog 278 Cyphotilapia frontosa 24 Cyprinus carpio (common carp) 24, 30 cytokine-induced neutrophil chemoattractant (CINC) in the rat 149 cytokines in the cat 297-301 in cattle 444-54, 448-51 in chicken 95-9, 96-9, 107, 117 dog 267 equine 350-3 fishes 11-13, 12, 43 in lagomorphs 233 in mink 338-9 mouse 588-9, 588-9 pig 379-83,380 rat 150, 152-9, 186 sheep 496-500, 497 Daudi lymphoma in mice 606 defective leukemia virus (DLV) 108 dermatitis flea allergic, in cats 316 miliary, in cats 315-16 dermatomycosis (ringworm) in cats 324 desmoglein-1 280 desmoplakins 280 diabetes mellitus, insulin dependent (IDDM) in dogs 281 rat as model for 183,195 Dirofilaria immitis 337 discoid lupus erythematosus (DLE) in the cat 3! 8-19 in dogs 280 DNA viruses, chicken 114 dog autoimmunity 278-82 chemotactic molecules 266 complement system 274--5 cytokine receptors 268 cytokines 267 immunodeficiencies 277-8,277, 278 immunoglobulins 268,268 leukocyte traffic and associated molecules 264-7 leukocytes and their antigens 263-4 lymphoid organs 261-3 MHC antigens 268-9 monoclonal antibodies 264, 264. 265-6 mucosal immunity 275-7 antigen transport 275-6 intraepithelial lymphocytes 276 Peyer's patches (Pps) and solitary lymphoid nodules 276-7 secretory immunoglobulins 276 neonatal immune responses 272-3 nonspecific immunity 273-4 ontogeny of the immune system 271 passive transfer of immunity 271-2 red blood cell antigens 270

INDEX

T-cell receptor 268 tumors of the immune system 278,279 Dutonella vivax 432 E-selectin (ELAM- 1) in the dog 264 in the pig 378 in rabbit 232 ecthyma (of) virus in camels 426 eicosanoids fishes 11 Eimeria acervulina 107-8 Eimeria tenella 107, 108 elasmobranchs, major lymphoid tissues 3, 4 endothelial adhesion molecules, sheep 490 enteritis, allergic, in cats 316 Enterococcus faecalis 398 eosinophilic enteritis in cats 317 eosinophils in the cat 310 in fishes 9, 31-3 sheep 525-8 epigonal organ 6 Epstein-Barr virus 606, 610 equine immunoglobulin-secreting heterohybridomas 348 equine infectious anemia virus (EIAV) 347, 353,528 equine influenza virus 353 Erysipelothrix rhusiopathiae 406 erythroblastosis fetalis in pigs 406 Escherichia coli 396, 398,399, 432, 458,465,471 experimental allergic encephalomyelitis (EAE) in rats 186 in sheep and goats 532 experimental allergic thyroiditis in sheep and goats 532 experimental autoimmune encephalomyelitis (EAE) 137, 183, 193, 195, 197 facial-conjunctival edema in cats 315 factor H deficiency in pigs 401,406 feline AIDs 606 feline asthma 316 feline calcivirus infection 321 feline enteric coronavirus (FECV) 324 feline immunodeficiency virus (FIV) 289, 294, 297, 298,299, 300, 306, 310, 311,312, 313,317, 325,327 feline infectious peritonitis (FIP) 297, 310, 312 feline infectious peritonitis virus (FIPV) 321,324 feline leukemia virus (FeLV) 289, 306, 307, 308,310, 312, 317, 324, 325,326 feline oncornavirus 289 feline panleukopenia virus (FPV) 306, 307, 308 feline retrovirus 290 feline rhinotracheitis virus 307 feline urologic syndrome (FUS) 323 ferret, domestic (Mustela putorius) 337 fishes 3-43 acquired immunodeficiencies 40-1 chemicals 40 stress 41 temperature 40 anatomy 3-6 complement system 31, 36-8 agnatha 37 chondrichythes 37 teleosts 37-8 cytokines 11-13, 12 granulopoiesis and granulocytes in 34 immunoglobulins 15-23, 16-19 agnatha 15

665

antibody response 21 biochemical characterization of Ig 20-1 immunoglobulin genes 21-3 regulation of immunoglobulin genes 23 leukocyte traffic 9-11 chemotactic factors: in vitro migration 10-11, 10 stress and pathological conditions affecting 10, 10 within and between organs 9-10 leukocytes 6-9, 41 granulocytes 9 lymphocytes 7-8, 26-7, 27 monocytes/macrophages 8-9 natural cytotoxic cells (NCC) 8 major histocompatibility complex (MHC) antigens 23-5 expression 25 functional studies 23-4 molecular cloning 24-5 polymorphism and genetic organization 25 major lymphoid organs 3-6, 4, 4 mucosal immunity 39-40 mucosal immune responses 39-40 mucosal immune system 39 oral tolerance 40 nonspecific immunity 31-4, 32-3 leukocytes in 35-6 ontogeny of the immune system 26-30 development of T and B lymphocytes 27-9 differentiation of lymphoid organs 26-7 differentiation of phagocytic system 27 ontogeny of B lymphocyte subpopulations 28-9, 28 ontogeny of immune responsiveness 29-30, 30 passive transfer of immunity 30-1 red blood cell antigens 25-6 taxa 3, 19 T-cell receptor 13-15 tumors of the immune system 41, 42 fowl pox 117 furunculosis 31 G-CSF in the pig 383 Gadus morhua (cod) 24 Giardia 324 Ginglymostoma cirratum (nurse shark) 24, 25, 37 glomerulonephritis autoimmune, in the rat 196, 197 in the cat 319-20 membranoproliferative (MPGN) type II in the pig 401,406 GM-CSF in the dog 267 in the pig 383 in sheep 499 gombessa 23 graft-versus-host disease 406 granulocytes in fishes 9, 31-3, 34, 43 in the pig 399-400 in the rat 147, 184 GRO in rabbit 233 gut-associated lymphoid tissue (GALT) m cattle 442-3 m chicken 73, 79, 106, 107-8 m fishes 6 in the rabbit 223,224, 224, 226, 245,246, 247, 250 m the rat 139, 187-8, 187 m sheep 488 Gymnophiona 63 haemobartonellosis 317

666

Haemobartonellosis felis 325 Harderian gland (HG) 79, 80 Hashimoto's thyroiditis (lymphocytic thyroiditis) 111,248, 281 head-associated lymphoid tissue (HALT), chicken 79 Helicobacter mustelae 337

Helicobacter pylori in the cat 313,314 in the ferret 337 hematopoiesis, cyclic, in the dog 278 hemolytic disease of the newborn, rabbit model of 223,250 hemorrhagic enteritis (HE) virus 104, 105 herpes virus in the cat 309, 312, 324 in chicken 117 equine 347, 358 in kittens 323 turkey (HVT) 105 heterophils in fish 31-3 Hippoglossus hipposglossus (halibut), spleen in 6 hives in cats 315 horses and donkeys cytokines 350-3 characterized equine cytokines 350-1 role in equine disease 351 possible models for TH1 and TH2 responses 352-3 septicemia 351-2 development of equine immunity 355-6 immunocompetence in foals 356 ontogeny of equine immune system 355-6 disorders of the immune system 356-9 allogeneic incompatibilities 358-9 failure of passive transfer of immunity 358 primary immunodeficiencies 356-8 secondary immunodeficiencies 358 immunoglobulins 347-9 innate immunity 354-5 complement 355 natural killer and lymphokine activated killer cells 354-5 neutrophil and macrophage function 355 leukocytes and their antigens 343-7, 344 advances in equine immunology dependent on leukocyte markers 347 equine T-cell receptor 347 specific equine leukocyte antigens 344 MHC antigens equine MHC polymorphism 353 genetic, biochemical and functional characteristics 353 non-MHC lymphocyte alloantigens 354 regulation of equine MHC expression 353-4 reproductive immunology 359-61 tumors of the immune system 359 HTLV1, rabbit model for 250 HTV1 in the rabbit 223,250 human immunodeficiency virus (HIV) 289, 290, 294, 312, 321, 594 rabbit model for 223,250 cf with rat immunodeficiency virus 194 hyperthyroidism 317 hypogammaglobulinemia, transient in horses 358 of infancy in the dog 278 ICAM-1 in the dog 264 in the rat 187 ICAM-2 in the dog 264 ichthyophthiriasis 31

INDEX

Ichthyopthiriasis multifillis 31 Ichthyostega 63 Ictalurus punctatus (channel catfish) 24, 30 idiopathic polyarthritis in the cat 319 idiopathic systemic vasculitis in the cat 319 Ig avian 86, 91-2, 91, 92 in camels and llamas 423-8 in the cat 304-5,306 in cattle 456-9 in chicken 89-92 dog 268,268 equine 347-9 in fishes 15-23, 16-19 in lagomorphs 235-8,235 in mink 339, 339 mouse 570-86 pig 384-7 rat 171-3 sheep 503-5 Ig heavy chains in camels and llamas 426, 428 in the cat 304-5 in cattle 459 in fish 21, 22 mouse 572-5 rabbit 236, 237 rat 173-7, 174-6 Ig light chain in camels and llamas 425-6 in the cat 304 equine 349 in fish 22 kappa, mouse 575 lambda, mouse 575-6 rabbit 237-8 rat 177, 178 in sheep 490 IgA in camels and llamas 423,432 in the cat 304, 305,309, 313-14, 322, 323 in cattle 457, 458,464-5,466 in chicken 86, 92, 105, 107 in the dog 272, 276 equine 349 in the mouse 572 in the pig 384, 387, 395-6, 403 rabbit 225,226, 233,247 in sheep 490, 514, 525 in the rat 171,172 IgA deficiency in the dog 277 IgD m camelsand llamas 423 m fish 21 m the mouse 572 m rabbit 235 m the rat 172 m sheep 490 IgE in the cat 305, 322 in cattle 457, 458 equine 349 in the mouse 572 in the rat 172 in sheep 490 IgG in the cat 304, 305,309, 322, 323 in cattle 457, 458,464, 466

INDEX

m chicken 86, 92 m the dog 271-2, 276 m the horse 348-9, 355 m the pig 384--5,387, 395-6, 403 m rabbit 233,247 m the rat 171,172 m sheep 490, 514, 525 IgM m amphibians 68 m camels and llamas 423,425,432 m the cat 304, 305,322, 323 m cattle 456-7, 458,466 m chicken 86, 91-2, 105,107 m the dog 272 m fish 20, 39-40 m the horse 349, 356 m the mouse 572 m the pig 384, 387, 395,403 m rabbit 226, 233,247 m the rat 171,172 m sheep 490, 525 IgM deficiency in horses 357-8 IgNAR in shark 20, 22 IgNARC in shark 20, 22 IgX in the rat 171 IgY in amphibians 68-9, 70 in chicken 86 IL-1 m the cat 297 m the dog 267, 274 m fish 11-12 m the horse 3~0, 351,352 m the pig 379, 403 m rabbit 233 IL-Ifl in fish 11 IL-2 in the cat 297, 314 in the dog 267, 268 fishes 12 in the horse 350, 354 in the pig 383,403 in rabbit 233 in sheep 499 IL-3 in the pig 383 in sheep 499 IL-4 in the cat 297-8,314 equine 350 in the pig 383,403 in sheep 499 IL-5 in the cat 314 IL-6 in the cat 298,314 in the dog 274 in the horse 350-1,352 in the pig 379-82, 383 IL-7 in the dog 267 IL-8 in the dog 267 in the pig 382-3 in rabbit 233 IL-10 in the cat 298-9, 314 in the dog 267, 274 equine 351 in the pig 383

667

IL-11 in the dog 267 in the pig 383 IL-12 in the cat 299, 299 in the pig 383 IL-15 in the pig 383 IL-16 in the cat 299 IL-18 in the cat 300 in the pig 383 ~mmunocytomas, rat 177-8 immunoendocrinopathy syndrome 281 lmmunoglobulins see under Ig lmmunopoiesis 563 infectious bronchitis virus 105 infectious bursal disease virus (IBDV) 104, 105 mterferons 383 equine 351 fishes 13 IFN-~ in the cat 300 IFN-fl in the cat 300 IFN-7 in the cat 300 in the dog 267 in sheep 499 interleukins in fishes 11-12 (see also underIL) juvenile immunodeficiency syndrome in (JLIDS) camels 432 kidney, fishes 5, 26 Kupffer cells in chicken 103 Lactococcus lactis 432 lagomorphs 223-50 allelic exclusion 223 allotype suppression 223 autoimmune diseases 248-50, 250 blood groups 242-3,243 complement 243,244-5 cytokines 233 idiotypes and network interactions in immune regualtion (latent allotypes) 223 immunodeficiencies 248 immunoglobulins 235-8,235 accessory molecule function 235 function 235 Ig gene loci 235 ontogeny of Ig repertoire 236 repertoire generation 236. species specific aspects of Ig structure 236-8 leukocyte markers 226-30,229-30 lymphocyte markers 228-30 specificity of reagents 227-8 leukocyte traffic 230-3 chemotactic molecules and populations recruited 232, 233 evidence for organ-specific leukocyte recruitment 230-1 molecules involved in leukocyte-endothelial interactions 231-2 molecules involved in leukocyte migration 232, 232 species-specific aspects 233 tissue-specific recruitment of leukocyte subpopulations 231 lymphoid organs 223-6 species-specific aspects 226 MHC antigens 238-42 disease association 242 expression and tissue distribution 242 species-specific aspect 242

668

lagomorphs, MHC antigens continued as model for disease-related research 250 mucosal immunity 245-8 antigen transport and function of antigen-presenting cells 245-7 production and transport of mucosal Igs 247 structure/function of mucosal immune system 247-8 nonspecific immunity 243 passive transfer of immunity 243 T-cell receptor (TCR) 233-4 distribution of ~ and 78 TCR populations 234 genes 233-4, 233 species-specific aspects of structure, function or development 234 TCR-associated proteins 234, 234 TCR repertoire ontogeny 234 tumors of the immune system 248,249 VH gene diversification mechanisms 223 Lama glama (domesticated llama) 421 Lama guanicoe (guanaco) 421 Lama pacos (alpaca) 421,430 Lama vicugna (vicufia) 421 Lebistes reticulatus 30 lectin pathway in fish 36 Leishmania braziliensis 108 Leptospira pomona in the skunk 338 leukemia lymphoid in the dog 278 mast cell, in the pig 405,406 myeloid in the dog 278 in the pig 405,406 SCID mice as models for acute lymphoblastic 609 acute myeloblastic 609 chronic lymphocytic 609, 610 chronic myelocytic 609 leukocyte adhesion deficiency in the dog 277 leukocytes in the cat 294-7 in cattle 444-7 in the chicken see leukocytes in the chicken in the dog 263-4 equine 343-7, 344 in fishes 6-9, 31-3, 41, 43 pig 374-7, 403 sheep 489, 491-2, 519 leukocytes in the chicken 82-5 ChL2, ChL3, ChL4, ChL5, ChL7 and ChL10 82 ChL6 82-3 ChL9 83 ChL12 83 ChL13 83 CD45 83-4 CD57 84 HEM CAM 84-5 leukotriene B4 (LTB4) 11 Leydig's organ 6 lipopolysaccharide (LPS) 8 lipoxins 11 Lissamphibia 63 Listeria monocytogenes 522 lymph nodes in camels 422 in the cat 290-4, 291,292, 293,308 in cattle 440, 441 dog 261-3,262, 263 mouse 565-7, 566

INDEX

in the pig 374, 402 rabbit 224-5 rat 138-9, 140-1 sheep 487 lymphadenitis in the camel 422, 423 lymphoblasts in pig 379 lymphocytes in cattle 443-4 in chicken 106-7 in fishes 7-8, 9-10, 26-7, 27 in the rat 142 in sheep 490 lymphoid leukosis (LL) 108 lymphokine activated killer cells, equine 354-5 lymphoma in the dog 278 lymphopoeisis 563 lymphoproliferative disease virus (LPDV) 109 lymphosarcoma in camels and llamas 434 in horses 358,359 M cells in cattle 443-4 in the dog 275-6 in rabbit 245-6 in the rat 188 in sheep and goats 524 macrophage activating factor (MAF) 13 macrophage inflammatory protein-2 (MIP-2) in the rat 149 macrophages in cattle 468 in the dog 274, 274 equine 347, 355 in fish 8-9, 10, 31-3, 43 in the rat 184, 186 Maedi-Visna virus (MVV) 485, 528,529-30 major histocompatibility complex (MHC) antigens in amphibians 67-8 in the cat 301-2 in cattle 459-62 chicken 92-5, 104, 113-17 dog 268-9 equine 353-4 fishes 23-5 in lagomorphs 238-42 in mink 339 pig 387-9 rabbit 226 malignant histiocytosis in the dog 278 mannan-binding lectin (MBL) in fish 36 mannose-binding protein (MBP) in the rat 185 Marek~s disease 108, 109 pathogenesis of 110, 110 Marek's disease virus (MDV) 104, 105, 108,110 marten (Martes martes/foina/americana) 337 mast cells in the cat 301 in cattle 468 sheep 519, 525-8 measles virus 394 melanomacrophages 5, 6, 9, 31 membranoproliferative glomerulonephritis (MPGN) type II in the pig 401,406 Microsporum canis 324 migration inhibition factor (MIF) 11 mink (Mustela vison) 337, 338-40 complement 339 cytokines 338-9

INDEX

immunodeficiency 339-40 immunoglobulins 339,339 leukocytes and their markers 338 MHC antigens 339 nonspecific immunity 339 ontogeny and passive transfer of immunoglobulins 339 mixed lymphoctyte reaction (MLR) 460 in amphibians 65, 69 in fish 23-4 in rabbit 238 monoclonal antibodies (mAbs) in amphibians 64-5 in the cat 296, 296 in cattle 444-7, 447 in the chicken 77, 81-2, 82-5 in the dog 264, 264. 265-6 in fishes 7, 7, 8, 27-8 in the horse 344 rabbit 226, 228 in the rat 190 in sheep 489, 490, 492, 499 monocyte chemoattractant protein-1 (MCP-1) in rabbit 233 in the rat 149 monocytes in the dog 274, 274 in fishes 8-9, 31-3 in the rat 147, 184, 186 mononuclear phagocytes, chicken 86 Morone saxatilis (striped bass) 24 mouse cellular immunology 586-9 CD markers 586, 586-7 cytokines 588-9, 588-9 immunoglobulins 570-86 B-cell receptor complex (BCR) structure and receptors 57780 BCR structure 577-8 co-receptors 578-80 B-cell ontogeny and Ig repertoire expression 580-4 B-cell repertoire in species 584 establishment of V gene repertoire 580-3 fetal/neonatal V gene repertoire vs adult V gene repertoire 583-4 general structure 570-2 biological properties 570-2, 571 physical and chemical aspects 570, 571 genetics 572-7 heavy chains 572-5 CH locus 573 DH and JH gene segments 573 VH gene germline repertoire 573 VH segment organization 573 VH subgroup and family 572 immunoglobulin gene polymorphisms 576-7 kappa light chains 575 lambda light chain 575-6 surface light chain and pBCR 584-5 B-cell development in mice carrying a deficient 25 gene 584-5 B-cell subsets/lineages and natural antibodies 585-6 expression in B-cell development 584 functions of FtH chains-SL complex pre-BCR 585 gene and protein structure 584 lymph organs 563-70 central lymph organs 563-5 peripheral lymph organs 565-70 murine models of immunodeficiency 589-94, 589-93

660

mucosa-associated lymph tissues (MALT) mouse 568-70 in the pig 404 in the rat 139, 141,187 in sheep 488 multicluster type Ig in Chondrichthyes 21 multiple sclerosis 195 mural nodules in the chicken 79 murine AIDS 594 myasthenia gravis in cats 318 in dogs 281 Mycobacterium cheloni 321 Mycobacterium fortuitum 321 Mycobacterium lepraemurium 321 Mycobacterium smegmatis 321

Mycobacterium bovis in badgers 337 in the ferret 337

Mycoplasma arthritidis 198 Mycoplasma hyorhinis 406 mycosis fungoides in the cat 327 myeloid markers, sheep 490 myeloma in the rat 177-8 myeloproliferative disease, equine 359 myxoma virus in the rabbit 223,248,250 nasal-associated lymph tissues (NALT) in the rat 139, 141,187-8, 187 Nanomonas congolense 432 natural antibodies in fishes 21 natural cytotoxic cells (NCC) in fishes 8 natural killer (NK) cells in the cat 296, 310-11 in cattle 469 in chicken 103,105 equine 354--5 neonatal isoerythrolysis in horses 358-9 in kittens 317 nerve growth factor in the cat 301 neutrophils in the cat 310 in cattle 467-8 equine 355 in fishes 9, 31-3 in the rat 184 Newcastle disease virus (NDV) 105 Nocardia opaca 398

Onchorhynchus keta (chum salmon) 30 Onchorhynchus mykiss (rainbow trout) 24, 26, 31 Onchorhynchus nerka (coho salmon) 30 Oreochromis niloticus (tilapia) 24, 30 Ostertagia circumcincta 427 otter, river (Lutra canadensis) 337 otter, sea (Enhydra lutris) 337, 338 panleukopenia virus in the cat 309 papilloma in the rabbit 223,242, 250 paroxysmal nocturnal hemoglobulinuria (PNH) 191 Pasteurella 529 Pasteurella haemolytica 520 Pasteurella multocida 379, 432 pemphigus erythematosus in cats 318 in dogs 280

670

pemphigus foliaceous in cats 318 in dogs 280 pemphigus vegetans in dogs 280 pemphigus vulgaris in cats 318 in dogs 280 Peyer's patches m the cat 291 m chicken 79, 104, 106 m the dog 263,275,276, 276 m the pig 374, 402 m the rabbit 224, 246 In the rat 139, 141,147-8 sheep 525, 527 pig autoimmunity 406 complement system 400-2 animal models of human disease 401-2 complement deficiency states 401 components 400-1,400 infectious disease 401 regulators of complement activation 401 xenotransplantation 402 cytokines and interferons 379-83,380 detection 381 future prospects 383 hematopoietic growth factors 383 immune response cytokines 383 inflammatory 379-83 interferons 383 oligonucleotide primer sequences 382 immunodeficiencies 405,405 leukocyte traffic and associated molecules 377-9 adhesion molecule detection 378 adhesion molecules and experimental models 378 differences in lymphocyte migration 378-9 leukocyte migration 379 lymphoblasts 379 leukocytes 374-7 l~mphoid organs 373-4 development, structure and function 373-4 immunoglobulins 384-7 ontogeny of Ig repertoire 386 species-specific aspects 386-7 MHC antigens 387-9 class I antigens 387 class II antigens 387 class III genes 387 distribution and function 387-9 species-specific aspects 389 mucosal immunity 402-5 functional organization 404-5 mammary glands 404 oropharynx 402 reproductive tract 404 respiratory tract 403 small intestine 402-3 epithelium 403 lamina propria 402-3 mesenteric lymph node 402 Peyer's patch 402 neonatal immune responses 397-8 neonate physiology 397 nonspecific immune defense 397-8 species-specific aspects ~398 specific immune defenses 398

INDEX

nonspecific immunity 398-400 granulocytes 399-400 natural and physical barriers 398-9 soluble antimicrobial factors 399 ontogeny of the immune system 394-5 development of B lymphocytes 394-5 passive transfer of immunity 395-7 closure 396 educational role of mammary secretions 397 functions of mammary gland 395 internal absorption of macromolecules in the neonate 396 origins and composition of colostrum and milk 395-6 placentation 395 role of cells in mammary secretions 396 transition from colostrum to milk 396 red blood cell antigens 389-94 serology 390-2 EAA system 390 EAB, EAD, EAG, EAI and EAO systems 390 EAC, EAJ and EAP systems 391 EAE system 391 EAF system 391 EAH system 391 EAK system 391 EAL system 392 EAM system 392 EAN system 392 historical development 390 reagents 390 serological test 390 significance and application 392-4 heterozygosity and genetic distances 392 mapping of blood group systems 392 parentage testing 392 relationship to production performance and diseases 392-3 species-specific aspects 394 terminology 389-94 xenotransplantation 393-4 T-cell receptor 383-4 tumors of the immune system 405-6 Pipidae 63 plasma cell myeloma in horses 359 plasma cell tumors in the dog 278 plasmacytoma in the cat 327 mouse 178 in the pig 405 in the rat 177-8 Pleurodeles 69

Pleurodeles walt163 Pleuronectes platessa (plaice) 9, 30 Pneumocystis carinii in the ferret 337 in horses 358 pneumonia in cats 323-4 Poecilia formosa 24 polyarteritis nodosa in cats 319 polyarthritis 198 idiopathic, in the cat 319 polychondritis of the ear in cats 320 polymyositis in dogs 281 proximal colonic lymphoid tissue (PCLT) in the rat 139, 141 Pseudomonas aeruginosa 402 pseudorabies in the pig 399, 401 Pteromyzoin marinus (sea lamprey) 31

Rana catesbeiana 63 Rana pipens 63

INDEX

RANTES in the dog 267 rat

autoimmunity 194-8, 194 additional rat models 198 chemically induced 197-8 induced by immune system modulation 196-7 induced BUF rat model of thyroiditis 197 induced models of IDDM 196 syngeneic graft-vs-host (GvH) reactivity 196-7 induced by immunization 197 overview 194-5 spontaneous models 195 BBZ/Wor rat model of obese autoimmune non-insulindependent diabetes 195-6 diabetes-prone bio-breeding (DP-BB) rat 195 female BUF rat model of spontaneous autoimmune thyroiditis 196 transgenic rat models 198 B-cell development 168-71 B- 1 cells 170-2 B-cell generation in adult bone marrow 168-9 B-cell generation in fetal liver 169 in vivo humoral immune response 171 marginal zone B cells 170 peripheral virgin B-cell differentiation 169-70 B lymphoid tumors or immunocytomas 177-8 complement system 190-2 mechanisms of activation 190-1 in the rat 191-2 components of mucosal immune system 187-90 passive immunity 189 production and transport of mucosal Igs 189 structure of the placenta 189-90 transport of antigens 188-9 cytokines and their receptors 150, 152-9 Ig variable region genes 173-7 allotypic markers 173 complexity of the IgVH locus 176-7, 176 development of Ig repertoire 177 generation of Ig diversity 173 Ig heavy-chain variable region sequences 173-6, 174-6 Ig light-chain sequences 177, 178 immunoglobulins 171-3 nomenclature 171-3,171 leukocyte traffic and associated molecules 142-9 species-specific aspects 148-9 lymphoid organs 137-41 morphological and functional aspects 139-41 blood 141,142 central lymphoid organs 139-40 lymph nodes 140-1 mucosa-associated lymphoid tissues 141 peripheral lymphoid organs 140-1 spleen 140 rat lymphoid system 137-9 central part 137 lymphatic system 138,139 mucosa-draining lymph nodes 138-9 organ/tissue-draining lymph nodes 139 peripheral part 138-9 skin-draining lymph nodes 138 major histocompatibility complex (MHC) 179-83 associations of RT1 with disease and/or immunological dysfunction 181-3,183 history 179 rat strains 180-1,180, 181-2 RT1 complex 179-80, 179

671

models of immunodeficiency 192-4, 192 brown Norway (BN) rat 193 DP-BB rat 193 gene-targeted genetic manipulation 194 LEC rat 193 Lewis rat 193-4 nude rats 192-3 SCID rat 194 virus-induced/acquired immunodeficiency in 194 nonspecific immunity 183-7 infiltration of inflammatory cells 186-7 local inflammation 184 macrophages and granulocytes 184 production of inflammatory mediators and cytokines 186 recognition of microorganisms and their components 185-6 skin and mucosa 183-4 systemic effects of inflammation 187 rat cluster of differentiation (CD) antigens 142, 143-7 T-cell development 150--61 intra-thymic 150-1 post-thymic 151-61 T-cell receptor 162-8 distribution and phenotype of 0~/3and 78 populations 168 0~/3T cells 168 78 T cells 168 mAbs to rat TCR 164, 167 ontogeny of the rat TCR repertoire 164-8 T-cell receptor sequences 162-4, 162-4, 165-7 TCR associated proteins and accessory molecules involved in signalling 164, 167 red blood cell antigens in the cat 303-4, 303 in cattle 462-4 in the dog 270 in the pig 389-94 in sheep 509-10 Reiter's disease 319 respiratory burst activity (RBA) in fish 34 reticuloendotheliosis virus (REV) 109 rheumatoid arthritis (RA) in dogs 279, 280 human 198,607, 406 in pigs 406 rat as model for 148, 197 rhinitis, allergic 316, 324 Rhodococcus equi in the horse 355,358 RNA viruses, chicken 115-16 rotavirus in the pig 399 Rous sarcoma virus in chicken 95, 95 sacculus rotundus, rabbit 226, 248 Salmo salar (Atlantic salmon) 24 Salmonella 488,516 Salmonella dysenteriae 432 Salmonella typhimurium 432 Salvelinus leucomaenis 31 sarcoma in chicken 94 Schmidt's syndrome in humans 281 SCID mouse mutant Hu-PBL-SCID mouse 605-6 description 605-6 as model for immune diseases 606 as model for infectious diseases 606 xenogeneic engraftment 606 models of human hematological disease 609-10 Epstein-Barr virus lymphomas 610 growth of human tumors of non-hematopoietic origin 610 leukemia 609-10

672

SCID mouse mutant, models of human hematological disease continued in testing leukemia therapy programs 610 RAG knock-out mice 608 SCI-Skin mouse model 606-7 CTL response 607 description 606-7 SCID and NK cell-deficient mice 608 SCID bone marrow engrafting 609 SCID-Hu/bone model 608-9 SCID-hu mouse model 604-7 chimera optimized by co-implanting various fetal human organs 605 description 604 as in vivo model for physiopathological analysis of human viral diseases 604-5 limitations 605 SCID 'leaky' phenotype and new immune-deficient murine strain 607-8 use without reconstitution 610-11 for immune system in reproduction 610-11 for infectious diseases 610 scleroderma in chicken 112 Semliki-Forest virus in sheep 499 Serpulina hyodysenteriae 379 serum amyloid A (SAA) in the dog 274 severe combined immunodeficiency (SCID) in the horse 354-5,356, 357 in mice 594 see also SCID mouse mutant sheep and goats complement 522-3,523 cytokines 496-500, 497 expression and activity 498 experimental investigation of autoimmunity 531-3 immunodeficiencies 528-30 immunoglobulins 503-5 concentration of Ig in biological fluids 503 expression and function 503 genes 503 Ig repertoire ontogeny 503-5 passive maternal transfer 505 recent reviews 505 repertoire diversification 505 structure of IgG 505 innate immune mechanisms 518,518 acute-phase proteins 519 inducible nitric oxide synthase expression by goat macrophages 521-2 leukocytes and mast cells 519 ovine-specific aspects of structure and function 520-1 reticuloendothelial system and immune defence 518-20 leukocyte migration 493-6 general considerations 493 leukocyte traffic through stimulated tissues 494 leukocyte traffic through unstimulated tissues 493-4 lymphocyte migration/recirculation in the fetus 496 mediators of leukocyte migration 494-5 molecules involved in leukocyte migration 495-6 subset-specific and tissue-specific migration patterns of lymphocytes 495 leukocytes and their markers 489, 491-2 endothelial adhesion molecules 490 lymphocyte markers 490 monoclonal antibody reagents 490, 492 myeloid markers 490 lymphoid organs 485-9 bone marrow 487

INDEX

fetal hemopoiesis 486 gut-associated lymphoid tissue 488 hemal nodes and mesenteric 'milk spots' 488 lymph nodes 487 spleen 486 stromal cells and accessory cells 488-9 thymus 486 mucosal immunity 523-8 antigen transport and function of antigen-presenting cells 524-5 components 523-4, 524 intra-epithelial lymphocytes (Els) 525,526 Peyer's patches 525,527 production and transport of mucosal Ig 525 role of mast cells and eosinophils 525-8 neonatal immune system 515-18 immune system at birth 515 immune system during first month 516-17 precocious development of the fetal immune system 515 B-cell development 515 T-cell development 515 transition to postnatal life 515-16 ontogeny of the immune system 510-13 development of B cells 511-12 development of lymphoid organs 511 development of lymphatic system and lymphocyte recirculation 512 development of other cell lineages 512 development of T cells 511 ontogeny of immune responsiveness 512 recent review 513 ovine major HCA (Ovar) 505-9 genetics 506, 507-8 methods used to characterize MHC antigens 505-6 ovine-specific aspects of MHC genetics or protein structure and function 509 tissue distribution, structure and function of ovine MHC antigens 506-8 red blood cell antigens 509-10 T-cell receptors 500-2 caprine T-cell receptor variable fi chain (TCRVfl) repertoire 502 number and diversity of variable region genes 502 number, diversity and expression of C7 segments 502 prevalence of 0~fland 7& T cells in different tissues 501 prevalence of sheep 7& T cells 502 recent reviews 52 specific features of 0~flTCR 501 specific features of the 7& 502 surface expression of CD3/TCR proteins 500 T-cell receptor genes 500 transmission of passive immunity 513-15 tumors of the immune system 530-1 clinical observations 530 histological, immunological and biochemical studies 530-1 viral expression 531 ex vivo studies 531 in vivo studies 531 Sjorgren's syndrome in dogs 280 skunk, striped (Mephitis mephitis) 337, 338 spleen in amphibians 63-4 in the cat 290-1,308 in cattle 441-2, 441 chicken 79, 80, 104 dog 261 ellipsoids 6 fishes 5-6, 41

INDEX

melanomacrophage centers 6 mouse 567-8 rabbit 224 rat 140 sheep 486 Staphylococcus aureus 432, 458 stem cell factor in the cat 301 Streptococcus canis 324 Strongloides stercoralis in the ferret 337 subacute sclerosing panencephalitis (SSPE) 337 syphilis, rabbit model of 223,250 systemic lupus erythematosus (SLE) in the cat 317, 318 in the dog 278-9, 280 systemic vasculitis, idiopathic, in the cat 319 T cells m amphibians 68-9 m the cat 294-5 in the chicken 103 In fish 8 m the rat 150-61 m sheep 500-2, 511,515 T-cell receptor (TCR) in amphibians 65-6 in cattle 454-6 in the chicken 87-9 in the dog 268 equine 347 in fishes 13-15 in lagomorphs 233-4 pig 383-4 rat 162-8 sheep 500-2 T lymphocytes in the cat 313 in the chicken 85-6 CD3-TCR complex 85 CD4 and CD8 85 CD5 and CDw6 85 CD28 86 ChT1 85 ChT6 86 ChT11 86 in fishes 27-9 in the rabbit 224 sheep 490 Taenia infection 526 teleosts, major lymphoid tissues 3, 4 theileriosis 606 thymoma in the pig 405 thymopoietin 104 thymus in amphibians 63 in the cat 290, 308 in cattle 439-40 in the chicken 73, 76-7, 78, 104 in the dog 261 in fishes 5, 26-7, 27, 41 m the mouse 564-5 in the rat 140 m sheep 486 thyroiditis autoimmune in chickens 111 in the rabbit 248-50 Hashimoto (lymphocytic) in the chicken 111

673

in the dog 287 in the rabbit 248 spontaneous, in the rat 183 tonsils in the cat 291 in the dog 263 toxic epidermal necrolysis (TEN) in cats 319 Toxoplasma gondii 299 transforming growth factor (TGF-fi) in chicken 107, 108 in fish 11, 13 transient hypogammaglobulinemia in horses 358 of infancy in the dog 278 transition type of Ig in Actopterygii 21 transmissible gastroenteritis virus (TGEV) 396, 399 Triakis scyllia 25 Trichinella spiralis 189 Trichostrongylus colubriformis 427 trinitrophenol (TNP) 21 Triturus alpestris 63, 69 Triturus viridescens 63 Trypanosoma brucei 432 Trypanosoma brucei gambiense 432 Trypanosoma brucei rhodesiense 432 Trypanosoma cruzi 108 Trypanosoma evansi 432 trypanosomiasis 426, 432 tuberculosis, rabbit model for 223,250 tumor necrosis factor (TNF-c~) in the cat 300 in fishes 11, 13 in the dog 267, 274 in the horse 351 in the pig 403 tumors of the immune system m the cat 325-7, 326 in the dog 278,279 m fishes 41, 42 m horses 359 m the rabbit 248,249 m sheep 530-1 ulceroproliferative faucitis/periodontis 321 Urodela 63 urticaria in cats 315 VCAM in the rat 187 VCAM-1 in the dog 264 in the pig 378 Venezuelan equine encephalitis virus 356 Vibrio anguillarum vaccine 29, 39 viral plasmacytosis 338,338,340 Visna infections in sheep 532 vitiligo in chicken 111,113 Vogt-Koyanagi-Harada syndrome in dogs 281 weasel (Mustela erminia/frenata/rixosa/sibirica) 337 X-linked severe combined immunodeficiency in the dog 261,277

Xenopus 38 Xenopus laevis 63, 66 M H C in 24

Xenopus ruwenzoriensis 66 Xenopus tropicalis 66 Xiphophorus coychianus (platyfish) 24 Yersinia ruckeri 29

Figure X11.4.3. Stereo view of a space filling representation of the VH,showing the side of the protein that interacts with the VLin a conventional F,. a, The human Pot VHin which the amino acids conserved in human and mouse that are known to be important for the hydrophobic contact with the V~domain,are coloured by atom type; all others are in grey. b, The camel cAb-Lys3 is shown from the same angle as in (a). The amino acids of the CDR3partbetween Cys100e and Trpl03 were removed. c, Same as (b) except that the removed CDR3partis included in black. Reproduced from Desmyter et a/. (1996) with permission.

Figure X11.4.5. Stereo view of a ribbon representation of the X-ray structure of the cAbLys3 in complex with lysozyme. The a-helical domain of lysozyme is shown in blue, and the P-sheet domain in purple. The camel cAb-Lys3 framework P-strands are coloured dark green for the four-stranded 0-sheet and lighter green for the five-standard $-sheet, which makes up the side of the protein that normally interacts with the V~domainin a conventional Fv fragment. The CDRl region is shown in red, the CDRzloop in orange and the CDRBin yellow. The disulphide bond between CDRI and CDR3,and the Glu 35 side-chain of lysozyme, are represented in ball-and-stick for reference. Reproduced from Desmyter eta/. (1996) with permission.

(a)

(b)

Figure Xll, 12,1, (a). Peripheral blood film. Note marked variation in cell size of lymphocytes and lymphoblasts. (Giemsa's stain) (b). Peripheral blood film (Giemsa's stain). Lymphoblasts and atypical lymphocytes showing cytoplasmic blebs (curved arrow upper right), double nucleus (curved arriow left lower) and weak stainability of cytoplasm (short arrow centre). Reproduced from Tageldin et aL (1994).

Figure XVl, 2,3, Partial view of a nu/nu mouse lymph node immunostained with anti-CD3. Primary follicles form the cortex. A few CD3positive cells are scattered through the paracortex and medullary cords. Rare ones are seen in the follicles (Photomicrograph N. Antoine).

Figure XVI, 2,5, Low magnification of a mouse spleen after anti-B-cell (blue) and anti-T-cell (red) immunostaining. T cells occupy the periarteriolar sheath and B cells are gathered in the follicles and marginal zone. In the red pulp scattered B and T cells are found. Dark blue strands are alkaline phosphatase-positive blood vessels (Photograph I. Mancini).

,~

- :~

~.

Figure XVI, 2.6, The white pulp of the mouse spleen revealed by peanut lectin (red) staining of the germinal centers and reticular fibers and by anti-B-cell immunolabelling (blue) of the follicular corona and marginal zones. The latter surround an unstained T-dependent periarteriolar sheath (Photomicrograph I. Mancini).

F

Figure XVI 2.7. Mouse spleen after immunolabeling with anti-N418 antigen. Typical dendritic cells (DC) arte labeled in the periarteriolar sheath, Marginal zone macrophages (M) react intensively. N418-positive cells are rare inside the follicles (F).

Figure XVlI. 3.1. Human fetal gut transplanted subcutaneously into SCID mice.

9 ," "o "~1~ t,.~9

~'~:~-:

Figure XVII. 3.2. A hematoxilin and eosin micrograft of a junctional human (right)/mice (left) showed preservation of human epidermal and dermal structures

Figure XVlI. 3.3. Human CDI+a cells can be observed in human skin engrafted onto Hu-PBI_ SCID mice, 1 week after intradermal immunization.

Handbook of Vertebrate Immunology

Handbook of Human Immunology

Chemical Ecology of Vertebrate

Vertebrate Endocrinology

Handbook of Human Immunology, 2nd ed

Handbook of Human Immunology, Second Edition

Vertebrate Biology

Vertebrate Palaeontology

Biological Control of Vertebrate Pests:

Vertebrate Palaeontology

Vertebrate Palaeontology

Vertebrate Hair Cells (Springer Handbook of Auditory Research)

Immunology

Immunology

Vertebrate Endocrinology, Fourth Edition

Monitoring Vertebrate Populations

Comparative Vertebrate Lateralization

Immunology of Fungal Infections

Atlas of Immunology

Immunology of Behcet's Disease

Immunology of Pregnancy

Color Atlas Of Immunology

A history of immunology

Immunology of Infection

Illustrated dictionary of immunology

Color Atlas of Immunology

Color Atlas Of Immunology

Color Atlas of Immunology

Essentials of Mucosal Immunology

Immunology of Fungal Infections

Color Atlas of Immunology

Handbook of Vertebrate Immunology

Handbook of Human Immunology

Chemical Ecology of Vertebrate

Vertebrate Endocrinology

Handbook of Human Immunology, 2nd ed

Handbook of Human Immunology, Second Edition

Vertebrate Biology

Vertebrate Palaeontology

Biological Control of Vertebrate Pests:

Vertebrate Palaeontology

Vertebrate Palaeontology

Vertebrate Hair Cells (Springer Handbook of Auditory Research)

Immunology

Immunology

Vertebrate Endocrinology, Fourth Edition

Monitoring Vertebrate Populations

Comparative Vertebrate Lateralization

Immunology of Fungal Infections

Atlas of Immunology

Immunology of Behcet's Disease

Immunology of Pregnancy

Color Atlas Of Immunology

A history of immunology

Immunology of Infection

Illustrated dictionary of immunology

Color Atlas of Immunology

Color Atlas Of Immunology

Color Atlas of Immunology

Essentials of Mucosal Immunology

Immunology of Fungal Infections

Color Atlas of Immunology

Recommend Documents