Combinatorial Peptide Library Protocols (Methods in Molecular Biology Vol 87)

Synthesis of a One-Bead One-Compound Combinatorial Peptide Library Kit S. Lam and Michal Lebl 1. Introduction The four ...

Author: Shmuel Cabilly

207 downloads 861 Views 11MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Synthesis of a One-Bead One-Compound Combinatorial Peptide Library Kit S. Lam and Michal Lebl 1. Introduction The four general methods to generate and screen a huge combinatorial peptide library +-lo7 peptides) are: biological libraries such as filamentous phage (I), plasmid (2)) or polysome (3) libraries; the “one-bead one-compound” synthetic combmatonal library method or the “Selectlde process” (4-6); synthetic peptide library methods that require deconvolution, such as an iterative approach (7,8), positional scanning (9); orthogonal partition approach (JO), or recurse deconvolution (II); and synthetic library using affinity column selection method (12,13). There are advantages and disadvantages m each of these methods. In general, the main advantages of the biological library method are that large peptides can be displayed on a filamentous phage library, and that large protein folds can be mcorporated into the library. However, the main disadvantage is that biological libraries, in general, are restricted to all L-amino acids. In contrast, the remaining three methods all use synthetic libraries; therefore, o-amino acids, unnatural ammo acids, nonpeptide components, and small rigid scaffoldings can all be incorporated into these libraries. The “one-bead one-compound” library is based on the concept (4,5) that when a solid-phase split synthesis method (4,8,14) is used, each solid-phase particle (bead) displays only one peptide entity although there are approx 1013 copies of the same peptide in the same bead. The resulting peptide-bead library (e.g., lo7 beads) is then screened in parallel using either “on-bead” binding assays (15) or “solution phase-releasable” assays (16) to identify peptide-beads with the desired biologic, biochemical, chemical, or physical properties. The From

Methods

m Molecular Biology, vol 87 Combmatonal Peptrde Edlted by S CablIly 0 Humana Press Inc , Totowa,

Library NJ

Protocols

Lam and Lebl

2

positive peptide-beads are then physically isolated for microsequencing with an automatic protein sequencer. In this chapter, detailed methods for the synthesis of a random “one-bead one-compound” combinatorial peptide library will be described. Chapters 2 and 10 give examples of two general screening methods for such libraries.

2. Materials 2.1. Chemicals 1. Tenta-Gel Resin S-NH, (90-100 pm) resin may be obtained from Rapp Polymere, Tubmgen, Germany (see Note 1). 2. Fmoc amino acids with standard side chain-protectmg groups, N-hydroxybenzotriazole (HOBt), benzotriazolyl-oxy-trisdimethylammo-phosphonmm hexafluorophosphate (BOP), diisopropylethylamme (DIEA), diisopropylcarbodumide (DIC), piperidme, trifluoroacetic acid (TFA), nmhydrm, may be obtained from many different suppliers, such as Bachem (Torrance, CA), Bioscience (King of Prussia, PA), Advanced ChemTech (Louisville, KY), Novabiochem (San Diego, CA), and Peptides International (Louisville, KY) 3. Technical grade solvents such as dimethylformamide (DMF) or dichloromethane (DCM) may be obtained from many different chemical suppliers HPLC-grade DMF for the coupling may be obtamed from Burdock and Jackson, Muskegon, MI. Ethanol, phenol, p-cresole, thioamsole, ethanedithiol, pyndme, and potassium cyanide may be obtained from many different chemical suppliers. 4 0 1 g/mL Nmhydrm in ethanol 5 4 g/mL Phenol m ethanol. 6 10 mM Potassmm cyanide, stock solution. 7. 50% Piperidme m DMF 8. Reagent K: TFAlp-cresolelwaterlthioamsole/ethanedithiol, 82 5*5:5:5*2.5. (v/v/ v/v/v) 9 10% DIEA m DMF. 10 Dimethylsulfoxide (DMSO)/Amsole/TFA, 10:5:85

2.2. Apparatus 1. Polypropylene vials (5-lo-mL) may be purchased from Baxter Scientific Products, McGaw Park, IL. Polyethylene disposable transfer pipets may be purchased from Elkay Products, Shrewsbury, MA. 2 Motorized rockmg platform. 3 Randomization glass vessel (chromatography column 5-6 x 18 cm) fitted with a medmm glass smtered frit connected to vacuum and nitrogen via a two-way valve from below The three positions of the valve are “off,” “vacuum,” or “nitrogen.” 4 Recnculatmg water aspirator or a solvent-resistant vacuum pump with cold trap 5 Nitrogen tank.

One-Bead One-Compound 3. Methods 3.1. Synthesis

of a Linear Pentapeptide

Library

As indicated

earlier, a solid-phase split synthesis method (4,8,14) is used to generate a random peptide library. The composition and final structure of the peptide library depends on the number of amino acids (one or more) used m each coupling cycle and the number of coupling cycles used. The final peptide library may be linear or cyclic, or have specific secondary structures. For simplicity, the method for the synthesis of a linear pentapeptide library with all 19 eukaryotic amino acids except cysteine is given below: 1. Swell 10 g TentaGel Resin S-NH, beads (- 0 25 mEq/g, see Notes 1 and 2) for at least 2 h m HPLC-grade DMF with gentle shaking in a silicomzed flask. 2 Wash the beads twice with HPLC-grade DMF in the slllcomzed randomlzatlon vessel as follows* add 75 mL DMF from the top, gently bubble nitrogen from below through the smtered glass for 2 min, then remove the DMF by vacuum from below (see Note 3). 3 Transfer all the beads to a slllcomzed flask in HPLC-grade DMF Then dlstrlbute the beads into 19 equal allquots. A disposable polyethylene transfer plpet IS extremely useful m the even distribution of the beads mto each polypropylene vial (see Note 4). 4 Allow the beads to settle and remove most of the DMF above the settled bead surface from each polypropylene reaction vial. 5 Add threefold molar excess of each of the 19 Fmoc-protected ammo acids (see Note 5) and threefold molar excess of HOBt to each reaction vial using a mmlma1 volume of HPLC-grade DMF. 6. Add threefold molar excess each of BOP and DIEA to each reaction vial to ml-

tlate the coupling reaction. 7. Cap the reaction vials tightly and rock them gently for 1 h at room temperature

8. To confirm the completion of couplmg reaction, plpet a minute amount of resin from each reaction vial into small borosilicate form ninhydrm test (17) as follows:

glass tubes (6 x 50-mm) and per-

Wash the minute quantity of resin m the small glass tubes (6 x 50-mm) sequentially with the following solvents* DMF, t-amyl alcohol (2-methylbutan-2-ol), acetic acid, t-amyl alcohol, DMF, and ether Add to each tube one drop of each of the following three reagents,(ninhydrin m ethanol (0.1 g/mL), phenol m ethanol (4 g/mL), and potassium cyanide stock solution diluted 50 times with pyridme. Place the tubes m a heating block at 120°C for 2 min. Observe the color intensity of the beadsunder a microscope.

To ensure complete couplmg, every bead from the minute quantity of sample beadsshould be nmhydrin negative, I e , straw yellow color.

4

Lam and Lebl

9 If the couplmg IS mcomplete (some beads remamed purple or brown with nmhydrm test), remove the supernatant from those reaction vials and add fresh Fmocprotected ammo acids, BOP, DIEA, and HOBt mto the reaction vial for addmonal coupling 10. If the couplmg 1s complete (beads remained straw yellow color with nmhydrm test) discard the supernatants of each reaction vial, and transfer and wash all the beads to the randomtzation vessel with technical grade DMF 11 After all the 19 couplmg reactrons are completed, all the beads are transferred to the randomizatton vessel Wash the beads (8 times, 2 mm each) with technical grade DMF 12 Add 75 mL 50% ptpertdme (m DMF) to the randomtzatton vessel to remove the Fmoc protectmg group After 10 mm, remove the ptpertdme and add 75 mL fresh 50% prpertdme. After another 10 mm, wash the beads 8 times wtth techmcal grade DMF and twtce with HPLC-grade DMF 13 Distribute the beads mto each of the 19 reaction vials and carry out the next couplmg reaction as described above 14. After all the randomtzatton steps are completed, remove the Fmoc protectmg group with prpertdine as described above 15 After thorough washing with technical grade DMF (5X) followed by DCM (3X), add 10 mL of reagent K (18) to the randomrzatron vessel for 3 h at room temperature 16. Wash the deprotected resms thoroughly with DCM (3X), followed by technical grade DMF (5X), then once with 10% DIEA to neutralize the resin 17. After thorough washing with technical grade DMF, store the bead library m HPLC-grade DMF at 4°C. Alternatively, the bead library can be washed thoroughly with water and stored in 0.1 M HCl or 0.1 Mphosphate buffer with 0 05% sodmm azide.

3.2. Synthesis

of a Cyclic Peptide Library

The synthesis of a cyclic peptide library (disulfide bond formation) is essentially the same as that of the linear library except that Fmoc-Cys (Trt) is added at the carboxyl as well as amino terminus of the linear random peptide After deprotectton, add a mixture of DMSO/Anisole/TFA (see Subheading 2.1., item 10) into the resin; incubate overnight at room temperature. After thorough washing, store the library at 4°C as described above. 4. Notes 1 We have tested several commerctally available resins for our library synthesis The two satisfactory resins are TentaGel (polyethylene grafted polystyrene beads) and Pepsyn gel (polydimethylacrylamtde beads) Overall, the TentaGel 1spreferable as it is nonsticky and mechanically more stable However, unlike Pepsyn gel, the level of substrtutron of each TentaGel bead is far from uniform Wtth the advent of combmatorral chemistry, we anticipate newer resins entering the market m the near future

One-Bead One-Compound

5

2. TentaGel already has a long polyethylene linker and we do not routmely add additional linker for our library synthesis In contrast, a linker (preferably a hydrophilic lmker) is necessary for the synthesis of a peptide library with polydimethylacrylamide beads. We have used Fmoc-P-alanme and/or Fmocaminocaprorc acid as linkers in the past. However, aminocaproic acid is rather hydrophobic A polyethyleneglycol-based amino acid (Shearwater, Polymers, Huntsville, AL) is probably preferable. 3 All glass vessels should be sdiconized thoroughly prior to use Besides using nitrogen bubbling through the randomization vessel to mix and wash the beads, we have also prepared libraries in hourglass reaction vessels (Peptides International, Louisville, KY), usmg rocking motion to mix the resins. 4. Each polypropylene reaction vial should be engraved with a letter correspondmg to a specific amino acid to ensure no mix-up during the synthesis 5. We often omit cysteines from the synthesis of linear peptide libraries to avoid the complication of intracham and/or interchain crosslinking

Acknowledgments This work was partially supported by NIH grants CA23074 Kit S. Lam is a scholar of the Leukemia Society of America.

and CA17094.

References 1 Scott, J K. and Smith, G. P. (1990) Searchmg for peptide ligands with an epitope library. Science 249,386-390. 2. Schatz, P. (1993) Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme A 13 residue consensus peptide specifies biotinylation m Escherichia cob Biotechnology 11,1138-l 143. 3. Kawasaki, G. (199 1) Cell-free synthesis and isolation of novel genes and polypeptides. PCT International Patent Application W09 l/05058. 4 Lam, K. S., Salmon, S. E , Hersh, E M., Hruby, V. J , Kazmierski, W. M , and Knapp, R. J. (1991) One-bead, one-peptide: a new type of synthetic peptide library for identifymg bgand-bmdmg activity. Nature 354,82-84 5 Lebl, M., Krchnak, V., Sepetov, N F., Seligmann, B., Strop, P., Felder, S and Lam, K S (1995) One-bead-one structure combmatorial libraries. Bzopolymers 37,177-198. 6 Lam, K S , Lebl, M , and Krchnak, V. (1997) The “one-bead-one-compound” combinatorial library method. Chem. Rev. 97,41 l-448 7 Geysen, H. M , Rodda, S J., and Mason, T J. (1986) A prior-z delmeation of a peptide which mimics a discontmuous antigenic determinant. Mol. Immunol. 23, 709-715. 8. Houghten, R. A , et al. (199 1) Generation and use of synthetic peptide combmatorial libraries for basic research and drug discovery. Nature 354,84-86 9. Dooley, C. T and Houghten, R A (1993) The use of positional scanning synthetic peptide combinatorial libraries for the rapid determination of opioid receptor ligands Life Scl. 56, 1509-1517

6

Lam and Lebl

10. Deprez, B , Willard, X , Bourel, L , Coste, H , Hyafil, F., and Tartar, A (1995) Orthogonal combmatorial chemical libraries J Am. Chem. Sot. 117,5405-5408 11 Erb, E , Janda, K., and Brenner, S. (1994) Recenstve deconvolutton of combmatorial chemtcal ltbraries Proc. Nutl Acad. Scz USA 91, 11,422-l 1,425 12. Zuckermann, R. N , Kerr, J. M , Slam, M A , Banvtlle, S. C., and Santa, D V (1992) Identification of highest-affinity ligands by affinity selection from eqmmolar pepttde mixtures generated by robotic synthesis. Proc Natl. Acad. Scz. USA 89,4505-4509. 13 Songyang, Z., Carraway, K L , Eck, M. J , Harrtson, S C., Feldman, R. A , Mohammadi, M , Schlessmger, J , Hubbard, S. R , Smith, D P , Eng, C., Lorenzo, M. J., Ponder, B. A J , Mayer, B J , and Cantley, L. C (1995) Catalytic spectfrctty of protein-tyrosme kmases 1s crmcal for selecttve stgnallmg Nature 373, 536-539 14. Furka, A., Sebestyen, F., Asgedom, M., and Dtbo, G (1991) General method for rapid synthesis of multicomponent peptide mixtures. Int J Peptzde Protein Res 37,487+93. 15 Lam, K. S and Lebl, M (1994) Selectide technology-bead bmdmg screening Methods f&372-380 16 Lebl, M , Krchnak, V , Salmon, S E., and Lam, K. S (1994) Screenmg of completely random one-bead-one-pepttde libraries for activmes m solution MethodA f&381-387. 17 Kaiser, E., Colescott, R. L , Bossmger, C D., and Cook, P. I. (1970) Color test for detection of free terminal ammo groups m the solid-phase synthesis of pepttdes Anal. Blochem. 34,595-602. 18 King, D. S., Fields, C G , and Fields, G. B. (1990) A cleavage method which mmtmtzes side reactions followmg Fmoc solid phase pepttde synthesis Znt. J. Peptlde Protein Res. 36,255-266.

Enzyme-Linked Calorimetric Screening of a One-Bead One-Compound Combinatorial

Library

Kit S. Lam 1. Introduction In the “one-bead one-compound” combinatorial library method, each bead displays only one chemical compound although there are approx 1013 copies of the same compound in and on the same bead (I-3). With an appropriate detection scheme, compound-beads with specific biological, physical, or chemical properties can be identified, and physically isolated, and then their chemical structure can be determined. In biological systems, one important property that is of interest is the binding property between a ligand and a ligate. The hgate or acceptor molecule could be an enzyme (4-6)) an antibody (1,7,8), a receptor (9,10), a structural protein, or even small molecules (II). Furthermore, the “one-bead one-compound” library method can also be applied to the discovery of ligands that bind to the whole viral particle, bacteria, or mammalian cell by screening for compound-beads that bind to intact cells. When we mix a ligate with an “one-bead one-compound library,” some compound-beads may be coated by the ligate. This interaction can be detected by either a labeled ligate or a labeled secondary probe that recognizes the ligate. Common labels are enzyme, fluorescent probe, color dye, or radionuclide. There are advantages and disadvantages to each of these methods. The choice of detection scheme depends largely on the nature and availability of specific labeled ligates. From our experience, enzyme-linked calorimetric assay is probably the most convenient, economical, and rapid screening method that does not require any elaborate equipment (12). Methods for the preparation of the peptide-bead library are detailed in Chapter 7 of this volume. Details on the enzyme-linked calorimetric screening method will be given in the next sections, From

Methods

m Molecular Bology, Edlted by S CablIly

vol 87 Combmatonal Pep/de 0 Humana Press Inc , Totowa,

7

Library NJ

Protocols

8

Lam

2. Materials All the reagents needed are standard enzyme-linked immunosorbent assay reagents and are readily available from many biochemical and chemical companies. The following buffers are needed for the screening:

(ELISA)

1. PBS-Tween. 8 mM,Na2HP04, 1.5 mMKH2P04, 137mMNaC1,2.7mMKCl,pH 7.2, with 0.1% Tween-20 (v/v) 2 Binding Buffer 16 m&Z Na2HP04, 3 mM KH,PO,, 274 mM NaCl, 5 4 mM KCl, pH 7 2, with 0.1% Tween-20 (v/v) and 0.1% gelatm (w/v). 3 TBS. 2 5 n&Z Trts-HCl, 13 7 mM NaCl, and 0 27 mM KCl, pH 8 0 4. BCIP/Alkalme phosphatase buffer. 1.65 mg 5-Bromo-4-chloro-3-mdolylphosphate (BCIP) m 10 mL of 0 lMTris-HCl, 0 lMNaC1 with 2.34 mMMgCl,, pH 8.5-9 0 5 Gelatin. 0 1% in water 6 6M Guamdme HCl, pH 1 0

3. Methods 3.1. Screening

with an Enzyme-Linked

Ligate

Common enzymes used in ELISA are alkaline phosphatase, horseradish peroxrdase, P-galactosrdase, and glucose oxidase. From our experience the alkaline phosphatase system is more specific and tends to produce the least artifact when we screen a “one-bead one-compound” library. 1 If ligate-alkaline phosphatase complex is not commercially available, one may conmgate the ligate to alkaline phosphatase using bifunctional crosslmkmg reagents Many such reagents are commercially available (e g , Pierce Chemical, Rockford, IL) and standard coupling procedures are supplied by the manufacturers Before screening a library, one has to make sure that the coqugation method does not impair the bmdmg property of the ligate This can usually be accomplished by an ELISA assay using a 96-well plate coated with a known hgand (see

Note 1) 2 Transfer l-10 mL of the bead-library (200,000 to 2 million beads) to a 50lOO-mL polypropylene container Slowly dilute the dimethylformamtde (DMF) by adding an incremental amount of double-distilled water. Wash the beadlibrary thoroughly with double-distilled water m a column (e g., Econo column, Bio-Rad, Hercules, CA) Coat the bead-library with 0 1% gelatin (w/v) m water for at least 1 h. Wash the bead-library with PBS-Tween Transfer the library back into the polypropylene contamer with the bmdmg buffer (see Note 2) Add the ligate-alkaline phosphatase coqugate into the library with gentle mixing for 1 to 24 h at room temperature (see Note 3). 3. Transfer the bead-library to the column and wash the beads thoroughly with PBSTween. Then wash the bead-library one last time with TBS.

Enzyme-Linked

Calorimetric Library Screening

9

Fig. 1. (A) Photomicrograph of a typical enzyme-linked calorimetric bead-library screen; a positive bead is noted in the middle of the micrograph. (B) Single positive beads can easily be retrieved with a handheld micropipet under a dissecting microscope. 4. Transfer and wash the bead-library to lo-20 polystyrene Petri dishes (100 x 20 mm) with the BCIP/alkaline phosphatase buffer (see Notes 4 and 5). More dishes may be needed if the beads are too crowded and there are too many positive beads. Let the enzyme-linked color reaction develop for 30 min to 2 h. Stop the reaction by acidifying the BCIP/alkaline phosphatase buffer with several drops of 1 M HCl. Figure 1A shows the photomicrograph of a typical bead-library screen. 5. With the aid of a light box and a micropipet (e.g., Pipetman PlO, Gilson), transfer the turquoise beads into a small Petri dish. Many colorless beads will also be transferred during this process. 6. Place the small Petri dish of positive beads under a dissecting microscope and pipet individual turquoise beads to a small Petri dish of 6 M guanidine-HCI, pH 1.O (Fig. 1B). At this stage, transfer only the positive beads (see Note 6). After

10

Lam 20-30 mm at room temperature m 6 Mguanidme-HCI, transfer the posmve beads to a dish of double-dtstrlled water. Then prpet each posrttve bead onto a glass filter and msert mto the protein sequencer cartrtdge for mtcrosequencmg (see Notes 7 and 8)

3.2. Screening with an Unlabeled Ligate by Probing with an Enzyme-Linked Secondary Antibody 1 Prepare the library as m Subheading 3.1., item 2. 2 Add the alkaline phosphatase-linked anti-ligate antibody to the bead library and incubate m bmdmg buffer for l-2 h at room temperature 3 Wash the bead-library thoroughly with PBS-Tween and finally once with TBS 4. Add BCIP substrate to the library as described m Subheading 3.1., item 4 5 After 30 mm to 2 h, stop the colortmetrrc reaction by adding several drops of 1 M HCl to each Petri dish. Remove all the color beads from the library over a light box with a mrcropipet These color beads interact with the secondary antibody alone and may be discarded. 6 Recycle the remaining colorless library with the following steps: Incubate the library with 6 M guamdine-HCl, pH 1 .O, 20-30 min, wash 5 times with doubledistilled water, mix the library with DMF for 1 h, wash 5 times wrth double-distilled water, followed by PBS-Tween 7 Add the unlabeled ligate to the bead-library and incubate l-24 h at room temperature 8 Wash the bead-library thoroughly with PBS-Tween 9. Add the alkaline phosphatase-linked antrligate antibody to the bead-library and incubate l-2 h (see Note 3) Then wash the bead-library thoroughly wtth PBSTween and finally once with TBS. 10 Add BCIP substrate to the library as described m Subheading 3.1., item 4. After 30 min to 2 h, stop the colorimetrtc reaction by adding several drops of 1 M HCl to each Petri dish. Since the library has been prescreened with the secondary antibody alone, the posrttve beads Identified at this time should be a result of bmdmg to the ligate and not to the secondary antibody. 11. Isolate those individual posrtive beads for microsequencmg as descrrbed m

Subheading

3.1., items 5,6.

4. Notes 1 For the two-step screening process, instead of using the lrgate/antr-ligate-enzyme system, one may use a biotmylated-ligate/streptavrdm-enzyme system 2. Most of the methods employed m Western blot or ELISA for lowering the background can be applied to the screening of the bead-library We routmely add high salt (2X PBS), 0 1% Tween-20, and 0 1% gelatin to the bmdmg buffer Bovme serum albumin instead of gelatin has also been used successfully. 3 In order to mmimtze the background and false posmves, the concentration of ligate, ligate-enzyme conjugate, or antibody-enzyme conjugate used m the screening should be as dilute as possible Sometrmes lt is advantageous to use a

Enzyme-Linked Colorimetnc Library Screemng

4.

5

6. 7

8

II

small sample of resm (e g., 0.1 mL) to test several levels of reagent concentration before screening a large library It is not uncommon that the concentration of a reagent can be lo-fold more dilute than the optimal concentration recommended for standard ELISA. Although a combmatlon of BCIP and mtroblue tetrazohum (NBT) 1s commonly used m Western blot, we prefer to use BCIP alone. The BCIP/NBT substrate 1s much more sensitive However, NBT can be reduced to formazon and form a dark purple preclpltate on the bead if there IS a trace amount of residual reducmg agent left in the bead-library. Additionally, certain ammo acid sequences such as Asn-Asn-Asn can reduce NBT to formazon m the absence of alkaline phosphatase Furthermore, the formazon deposit on the surface of the bead 1s msoluble in many of the common solvents that we have tested. Therefore, If BCIP/NBT substrates are used, we will not be able to recycle the library for subsequent use or recycle a specific positive bead for confirmatory testmg before sequencing However, under certain circumstances, the tetrazohum salts are useful as a substrate as different tetrazolmm salt generates different colors upon reduction Therefore, a multicolor detection system can be designed for such applxatlons (13) Neither the formazon (when BCIPlNBT are used) nor the indigo (when BCIP alone 1s used) products ~111 affect the microsequencmg results Alkalme phosphatase works best under alkaline condltlons (e g , pH 9 5) However, there 1s a concern about the stability of the llgand-ligate interaction under such condltlon Therefore, depending on the ligate, we routmely adJust the BCIP/ alkahne phosphatase buffer to pH 8.5 to 9.0. In some instances, a dual-color colorlmetrlc detection scheme may be helpful m selectmg the true posltlve beads (13). Since the rate-llmltmg step of the “one-bead one-compound” hbrary method IS the mlcrosequencmg step, one needs to ensure that most of the positive beads submltted to mlcrosequencmg are “true positives.” To further improve the probability of true positlvlty, one may decolorize the posltive beads with DMF and restam the beads m the presence or absence of a competing llgand.

Acknowledgments This work was partially Kit S. Lam is a scholar

supported by NIH grants CA23074

of the Leukemia

Society

and CA17094.

of America

References 1 Lam, K S., Salmon, S. E , Hersh, E M , Hruby, V , Kazmlerskl,

W M , and

Knapp, R. J. (1991) A new type of synthetic peptlde hbrary for ldentlfymg hgandbmdmg actlvlty. Nature 354,82-84 2 Lebl, M , Krchnak, V , Sepetov, N F , Seligmann, B , Strop, P , Felder, S , and Lam, K S (1995) One-bead-one structure combmatorlal libraries Bzopolymen 37,177-198

12

Lam

3 Lam, K S , Lebl, M , and Krchnak, V. (1997) The “One-Bead-One-Compound” combinatorial library method. Chem. Rev 97,41 l-448 4. Wu, .I , Ma, Q N , and Lam, K. S (1994) Identtfymg substrate motifs of protein kinases by a random lrbrary approach Biochemistry 33,14,825-14,833 5. Lam, K. S , Wu, J S , and Lou, Q (1995) Identtfication and characterization of a novel peptide substrate specific for src-family tyrosme kinase Znti. J. Protean Peptlde Res. Q&587-592 6 Lou, Q., Leftwich, M., and Lam, K. S (1996) Identification of GIYWHHY as a novel peptide substrate for human p60c-src protein tyrosme kmase. Bloorg. Med Chem., 4,677-682 7 Lam, K S., Lebl, M., Krchnak, V , Wade, S , Abdul-Lattf, F , Ferguson, R , Cuzzocrea, C , and Wertman, K. (1993) Discovery of D-ammo acid contammg ligands with Selectide Technology Gene 137,13-16 8 Lam, K. S , Lake, D , Salmon, S E , Smtth, J., Chen, M-L., Wade, S., AbdulLatrf, F , Leblova, Z , Ferguson, R. D., Krchnak, V , Sepetov, N. F., and Lebl, M (1996) A one-bead, one-pepttde combmatorial library method for B-cell epitope mapping Methods. A Compamon to Methods m Enzymology 9,482-493 9 Smtth,M H.,Lam,K.S.,Hersh,E M ,andGrtmes,W.(1994)Peptidesequences bmdmg to MHC class I proteins using a synthetic peptide hbrary approach. Mol Immunol 31,1431-1437. 10. Salmon, S E , Lam,K S , Lebl, M , Kandola, A., Khattrt, P , Wade, S., Patek, M , Kocis, P., and Krchnak, V (1993) An orthogonal partial cleavage approach for solution-phase rdenttficatton of biologically active peptides from large chemtcalsynthesized peptide libraries Proc. Nat1 Acad. Scz USA 90, 11,708-l 1,7 12 11. Lam, K. S , Zhao, Z G., Wade, S , Krchnak, V , and Lebl, M (1994) Identtfication of small peptides that interact specifically with a small organic dye Drug Dev. Res 33,157-160 12 Lam, K. S and Lebl, M (1994) Selectide Technology-Bead bmdmg screenmg. Methods 6,372-380. 13 Lam, K. S., Wade, S., Abdul-Latif, F , and Lebl, M. (1995) Application of a dual color detection scheme m the screening of a random combmatorial peptide library J Immunol Methods 180,219-223

3 Synthesis and Screening Combinatorial Libraries

of Positional

Scanning

Colette T. Dooley and Richard A. Houghten 1. Introduction Synthetic combinatorial libraries (SCLs) are collections of very large numbers of synthetic compounds, in which all possible combinations of the burlding blocks used are represented. The development and verification of the utility of combinatorial libraries represent a dramatic advance in the drug discovery process by greatly reducing the time needed to identify new drug leads. Positional scanning (PS) SCLs (Z,2) represent a modified format of the origmal synthetic combmatorial libraries described by this laboratory (3). In contrast to the original libraries, which required several iterative syntheses to identify individual active compounds, this library format provides mformation on the substituent responsible for activity at each varied position withm a structure. Therefore, only a single subsequent synthesis is required. The screening of PS-SCLs, in most instances, permits the identification of the most active substituents at each position of a compound in a single assay.Thus PS-SCLs serve to reduce further the time required to identify new drug leads. PS-SCLs are composed of individual positional SCLs, in which a single position is defined with one substituent while the remaining positions are composed of mixtures of substituents. The defined position is “walked” through the entire sequence of the PS-SCL. Therefore, the number of positional SCLs is equal to the number of residues in each compound of the PS-SCL. It should also be noted that each posrtional SCL, although addressing a single positron of the sequence, represents the same collection of individual compounds For example, a hexapeptide, or a compound with six positions, can be represented as: OIXXXXX, XO,XXXX, XX03XXX, XXO,XX, XXXX05X, or XXXXX06. From

Methods

m Molecular Biology, Edlted by S Cablily

vol 87 Combmatonal Peptrde 0 Humana Press Inc , Totowa,

13

Library NJ

Protocols

14

Dooley and Houghten

Using 20 amino acids (this represents 120 mixtures in total), each peptide mixture contains 3.2 million (205) different sequences, the six positional libraries each contam 64 million hexamers. Peptide PS-SCLs can be prepared with an acetylated N-terminus, as well as with a C-terminal amide or carboxylate. One highly advantageous characterlstlc of the PS-SCLs prepared in this laboratory is that they are free to interact m solution, i.e., they are not bound to any support (beads, glass, phage, and so on), and therefore can be readily screened in any assay system. When used in concert, the data derived from each positional SCL yield Information about the most important substituents for every posltlon. The information IS then used to synthesize individual compounds representing all possible combmations of the most active substituents at each position. This serves to confirm the PS-SCL screening results, as well as to Identify the individual compounds with the highest activities. The preparation of a PS-SCL composed of L-ammo acid hexapeptides is described. This library consists of six separate positional SCLs, each composed of 20 different peptlde mixtures having a single posltlon defined with one of the 20 natural ammo acids (represented as 0)) and the remaining five positions are composed of mixtures of 19 amino acids (represented as X; cysteine is omitted, see Note 1). The six posltlonal SCLs differ only in the location of the defined position A description IS given for the preparation of the library using either Boc or Fmoc chemistries. The choices of procedure depends on the laboratory facilities available, safety, and financial considerations. Methods for screening such a library in a radioreceptor assay are given as an example. Although the methods described here involve the use of peptides, the positlonal scanning concept may be equally applied to a library of any class of compounds m which there are a number of positions that may be systematically altered. PS-SCLs have been prepared composed of decapeptides (4), hexapeptides comprised solely of D-ammo acids (5)) of tetrapeptides comprised of more than 50 L-, D-, and unnatural amino acids (6) and of heterocycles (24). PS-SCLs have been used successfully to identify antigenic determinants recognized by monoclonal antibodies, trypsm inhibitors, opioid receptor llgands, and antlmicroblal compounds. A series of papers on the use of peptlde, peptidomlmetic, polyamme and heterocyclic PS-SCLs in the aforementioned assays have been published by our laboratory (5-15,24). 2. Materials

2.1. Library Synthesis 2.1.1. General Requrements

for Synthesis

1 Resin packets (T-bags) are made with polypropylene Houston TX), using an impulse sealer.

mesh (74 pm, Spectrum,

15

Synthesis and Screenmg 2. T-bags are filled with polystyrene resin, 200 mg, 0.2 mEq. 3. Solvents for all synthetic procedures are dimethylformamide dtchloromethane (DCM) 4 A lyophihzer and somcator are used m the final preparations mixtures.

(DMF)

and/or

of the peptide

2.1.2 t-Boc Synthesis 1. Methylbenzhydrylamine (MBHA) polystyrene resm 2 This synthesis employs N-a-Boc-amino acids with the followmg side champrotecting groups: benzyl is used as the side chain protection for Asp, Glu, Ser, and Thr; 2,4-dmitrophenyl for HIS; Z,chloro-benzyloxycarbonyl (CBZ) for Lys; formyl for Trp, sulfoxide for Met, p-tosyl for Arg; and 2,bromobenzyloxycarbonyl for Tyr 3. DCM and isopropanol (IPA) are used alternatively m wash steps. 4. Trifluoroacettc acid (TFA) is used to remove Boc protecting groups. 5. Dusopropylethylamme (DIEA) is used as a base m neutralization steps 6. Dnsopropylcarbodumide (DIC) and 1-hydroxybenzotnazole (HOBt) are used as coupling reagents 7 Thiophenol, dimethyl sulfide (DMS), ethylenedithiol (EDT), p-cresol, and hydrogen fluoride (HF) gas are used for side cham deprotection, and methanol is used m the wash procedure 8 HF gas and a 24-vessel cleavage apparatus are used for peptide cleavage.

2.1.3. Fmoc Synthesis 1 Polyoxyethylene-grafted polystyrene resin (TentaGel). 2. Fmoc-2,4,dimethoxy-4’(carboxymethyloxy)-benzhydrylam~ne, TFA cleavable linker 3 This synthesis employs Fmoc protected ammo acids with the following side chain protection groups: t-butyl for Ser, Thr, Tyr, Asp, and Glu, trityl for Cys, His, Asn, and Gln, Boc for Lys, and 2,2,5,7,8-pentamethylchroman-6-sulfonyl (Pmc) for Arg. 4. DMF is used in the wash steps 5, Pipendme is used to remove Fmoc protecting groups. 6 DIC and HOBt are used as coupling reagents 7 TFA, trusobutylsilane, water, and “Quick Snap” plastic tubes equipped with a smtered bottom disc (Isolab, Akron, OH) are used for side chain deprotectlon/ cleavage 8 Tert-butylmethylether, hexane and a benchtop centrifuge are required to precipitate and collect peptides

2.2. Screening 2.2.7. Receptor Assay 1 Aqueous buffer, e g ,50 mMTris, 2 Receptor preparation

pH 7 4

76

Dooley and Houghten

3 1-mL Polypropylene tubes wtth caps (Contmental Laboratory Products, San Diego, CA) and 96-well trays (Costar, Pleasanton, CA) 4. Radtoligand. 5. GF/B filtermats, Tomtec harvester, Beta Plate Liquid Scmttllatton Counter, Beta Plate scmtillation fluid (Wallac, Garthersburg, MD).

3. Methods 3.1. Library Synthesis For general procedures on solid phase peptide synthesis, readers are referred to (16) and (17). The peptide mixtures making up the PS-SCLs are synthesized by simultaneous multiple peptide synthesis (SMPS) (18). Mixture posrtions (X) are incorporated by couplmg mixtures of protected ammo acids for pepttdes, or aldehydes, carboxylic acids, and so forth for nonpeptides, using isokmetic coupling of an excess of a predetermined molar ratio, which compensates for the different couplmg rates of the various amino acid derivattves (Table 1). The advantage of using SMPS (also referred to as the T-Bag technology, US. Patent No. 4,63 1,211) is that all wash and deprotection steps may be carried out in a common vessel. For the hexapeptide library, 120 T-bags (resin packets) are made and labeled (see Note 2)

3.1.1. t-Boc Synthesis 1 All bags are washed (approx 4 ml/bag for l-m-square bags) 1X DCM, 2X IPA, 2X DCM This 1s to ensure that the bags do not leak 2 Neutralize bags* 3 x 5% DIEA/DCM, 2 mm; 2X DCM, 2X DMF, 1 mm each 3 Activatton/couplmg (see Subheading 3.1.3. for couplmg procedure and Note 3) 4 Wash bags 1X DMF, 2X DCM 5. Deprotect using a 55% TFA/DCM solution for 30 mm 6 Wash bags 1X DCM, 2X IPA, 2X DCM. 7 Steps 2-6 are repeated for the required number of couplmgs 8 Deprotect the peptide srde chains using (a) DNP removal, 2 5% thtophenol/DMF for 1 h Wash bags 3X DMF, 12X alternating washes of IPA and DCM; and (b) low-HF 60% DMS, 5% EDT, 10% p-cresol, and 25% HF for 2 h at 0” C. Wash bags, 8X alternating washes of IPA and DCM, 4X DMF, 3X DCM, 1X methanol (MeOH). 9 Cleave peptrdes from the resm using 7 5% amsole/HF for 1 h at 0” C 10. Extract pepttdes with water or drlute acetic acid Lyophthze peptide solutions twice and reconstitute in water at lo-20 mg/mL (see Note 4) Mixtures may be stored for prolonged pertods at -20” C (see Note 5).

3.1.2. Fmoc syn thesrs 1 Wash bags. 3X DMF, 3X DCM 2 Couple TFA cleavable lmker to resin (100 mEq), shake overmght

Synthesis and Screenmg Table 1 Molar Ratios

of Amino

17

Acids Used for Coupling

Mixture

Ammo acid Three letter code Ala ASP Glu Phe GUY His Be LYS Leu Met Asn Pro Gln Arg Ser Thr Val Trp T yr

3. 4 5. 6.

7. 8. 9 10. 11

Positions

(X)

Molar ratio

Single letter code A D E F G H I K L M N i R S T V W Y

Boc synthesis 0.55 0 67 0.70 0 49 0 55 0.69 3 34 1 20 0 96 0.44 1.03 0 83 102 1 26 0 54 0 92 2.17 0.73 0.80 18.99

Fmoc synthesis 0.75 1.20 1.oo 0.60 0.70 0.78 2.29 1.oo 0 77 0.71 1.20 0.86 1.oo 1.10 0 72 0.98 1 80 0 70 071 18.87

Wash bags 5X DMF, 1 min Deprotect using 20% prperidme/DMF, 20 mm. Wash bags 5X DMF (1 mm) Acttvatlon/Couplmg (see Subheading 3.1.3. for coupling procedure). Fmocammo acld/DIC/HOBt (5 Eq solution m DMF), 90 mm. Test for coupling completion (see Note 3). Wash bags 5X DMF, 1 mm. Repeat steps 4-7 as necessary Remove resin from bags and place m “Qmck Snap” plastic tubes. Cleave peptides using 1 5 mL of TFA/DCM/H,O/triisobutylsilane 70:20*5.5, for 3 h at room temperature Snap off the tips of the “Quick Snap” tubes and add cleavage solutton to centrtfuge tubes. Precipitate pepttdes with cold (4” C) tert-butylmethylether (30 mL) Centrifuge at 3000g for 10 mm. Dissolve peptides m 15 mL of water, lyophllize pepttde soluttons twice, and reconstitute m water at lo-20 mg/mL (see Note 4). Mtxtures may be stored for prolonged periods at -20” C (see Note 5)

18 Table 2 Coupling

Dooley and Houghten Procedure

for a Hexapeptide

PS-SCL

Couple as O” Coupling Coupling Coupling Coupling Coupling Coupling

step step step step step step

1 2 3 4 5 6

“where 0 = A, or C, or D . bwhere X = A, and D, and E

Bags Bags Bags Bags Bags Bags

101-120 81-100 61-80 41-60 21-40 l-20

Counle as Xb l-100 l-80,101-120 l-60,81-120 l-40,61-120 l-20,41-120 21-120

or Y See Subheading 3.1.3. See Subheading 3.1.3.

3.1.3. Couplmg Procedure 1 The coupling procedure described here is for a hexapeptide PS-SCL. A similar procedure would be used for a library of any peptide length. Bags are labeled 1 to 120, each set of 20 bags represents a particular position m the hexapepttde At each couplmg stage of the synthesis, the bags are separated mto vessels as described m Table 2 2. The 20 bags bemg coupled as 0 (1 of the 20 ammo acids) are separated mto 20 vessels and mdividually coupled to each of the 20 ammo acids (1 = A, 2 = C, 3 = D, and so on) using 0 2 A4 of ammo actd/DCM (6 mL) (with an equimolar concentration of HOBt for asparagine and glutamme), and 0.2 M DIC/DCM (6 mL) for 1 h (6 Eq) 3. Bags being coupled as X are combined m a single vessel and coupled using a mixture of 19 amino acids in ratios described in Table 1 Solutions of ammo acid mixture, DIC, and HOBt (0.5 M, solubihzed m DMF) are mixed to yield a final concentration of 0.167 M 4 The N-terminus of the peptides may be acetylated if desired usmg 0 2 M acetyl tmidazole in DMF (20 Eq).

3.2. Screening and Analysis 3.2.1. Radioreceptor Assay 1. Screening of SCLs requires a high-throughput assay. A 96-well or ELISA format is recommended. Depending on the type of receptor or radiolabel used, adaptmg a known protocol to a 96-well format may require several experiments to optimize assay conditions. It is important to have good separation between total bmdmg and nonspecific bmdmg (ZlOOO cpm) and httle variation between replicates (l-5%). 2. Prepare receptor preparation, a membrane-bound receptor m tissue homogenate is described here as an example Protein content of crude homogenates should be determined using the methods described by Bradford (19) or Lowry (20), as appropriate (see Note 6).

79

Synthesis and Screenmg

Plates 1 and 2

I

1

2

3

4

5

6

7

8

9

10

II

12

2

3

4

5

6

7

8

9

10

11

12

A B C D E F G ~H Plate 3 1 A

B C D E F G H Fig 1. Layout of plates for screening the posttlonal scanning library m a radloreceptor assay. NSB, nonspecific binding, SCI-6, dtluttons of cold hgand for standard curve, TB, total bmdmg Plates 1 and 2 are duplicates. 3 Perform the bmdmg assays m 1-mL polypropylene tubes. A sample plan for this assay IS given m Fig. 1 Usually two replicates are sufftclent for screenmg studies Minimtze ptpetmg by using multichannel pipets or computertzed ptpetmg stations, 4. Determine mterassay and intra-assay variation using standard curves, incubate the radlohgand m the presence of a range of concentrations of an unlabeled hgand (Standard Curve) Reserve one column of each plate for a standard curve (see Fig. 1).

20

Dooley

and Houghten

5. Add peptide mixture (50 pL of 5 mg/mL solution) and the appropriate volumes of buffer, radtohgand, and receptor preparation to each tube. Because of the large size of most assays, it IS recommended that the receptors be added last (see Note 7). 6. Incubate assay tubes until equtlibrmm is reached This is generally longer than the time needed for the unlabeled ligand to reach equillbrmm, and needs to be determmed before the assay (see Note 8) 7 Termmate the reaction by filtration through GF-B filters on a Tomtec Harvester (see Note 9). Wash each sample on the filter with 6 mL of Tris-HCl buffer, at 4” C Count bound radioactivity on a LKB Beta Plate Liqurd Scrntillation Counter, the counts are expressed m counts per mmute (CPM). 8 Process the raw data using spreadsheet software (lotus, Excel, and so forth) Average replicates and express as percent mhtbition* 100 - [(Mean - NSB)/ (TB - NSB) * 1001 Graph data such that there are six graphs (one for each posltton of the hexamer); each graph should contain 20 bars (one for each ammo acid) For certam assays, this data 1s sufficient to identify one, two, or three ammo acids from each of the SIX posittons, which can then be combined to make mdividual peptides (Jee step 9 below). For receptor assays, often too many mixtures are active. Calculate ICsD values (concentration of mixture that mhiblts 50% radioltgand binding) in order to determine the most active mixtures. 9 Perform competitive mhibition assays as above using serial dtlutions of the peptide mixtures. Prepare five threefold dilutions and use the peptide mixture such that six concentrations are tested (e g , 1X mixture, 0.3X mixture, 0.1X mixture, 0 037X mixture, 0.012X mixture, and 0.004X mixture). Calculate IC5a values using the curve-fittmg software, e g , GRAPHPAD (ISI, San Diego, CA) For small combmatorial libraries such as the hexapepttde PS-SCL, IC,, values can easily be determined for all 120 mixtures Rank order the IC,, values for each of the SIX positions, and use these values to choose ammo acids for individual peptides 10 Synthesize all combinations of the most active mixture(s) for each of the six positrons as individual peptides (Table 3) The numbers of individual peptides to be synthesized rises exponentially with the number of amino acids chosen (1 e , one ammo acid from each posmon generates one peptide, two amino acids from each position generates 64 [26] peptides, and three ammo acids for all SIX positions generates 729 [36] peptides) 11 It is important to note that the activity of the individual pepttdes either supports or disproves the connectivity of the most active ammo acid at each position found from the screenmg of the library For example, one of the most active peptide mixtures from the screenmg of a PS-SCL usmg ELISA was AC-XXXPXX-NH,, although none of the resulting individual peptides containing prolme at the fourth position were found to be acttve. However, completron of the iterative process for this pepttde mixture yielded an active indtvtdual pepttde that was completely different from the sequences derived from the PS-SCL (21)


21

Table 3 Example of Individual Sequences Derived from Screening a Hexapeptide Positional Scanning Library Posltlon

oxxxxx xoxxxx xxoxxx xxxoxx xxxxox xxxxxo

Amino acids chosen F AT LV DE W M

Pepttde sequences 1 2 2 2 1 1 8

FALDWM FALEWM FAVDWM FAVEWM FTLDWM FTLEWM FTVDWM FTVEWM

4. Notes 1 Care must be taken when analyzmg data of mixtures containmg cysteme, whtch is mcluded only in the 0 posttton (i.e., CXXXXX, XCXXXX, XXCXXX, XXXCXX, XXXXCX, and XXXXXC) If one of these mixtures IS found to have activity, tt 1s best to iterate (sequentially define the X posmons) or prepare a posittonal scanning hbrary of that mixture 2 The resm swells and shrinks depending on solvent used. Bags should be made large enough to accommodate swelling 3. It 1s important to ensure that all couplmg reactions go to completion. It is htghly recommended that ninhydrm (22) or bromophenol blue (23) monitormg be carrted out on control resins after each coupling. 4 Somcation is used to solubdize mixtures containing hydrophobic amino acids m the defined positions It 1s important to keep the water m the somcator cool, add ice if necessary 5 It 1s recommended that the library be altquoted before storage to avoid freeze and thaw damage. Addmonally, if the library is allquoted mto a 96-well format, the ptpeting required for screening 1s substantially reduced 6 Lowry Method: To 0.1 mL of sample add 0.1 mL of 2N NaOH. Boll at 100” C for 10 min. Cool and add 1 mL of reagant (100 ~012% w/v Na,COa m water, 1 vol 1% w/v CuSo4*5Hz0 m water, and 1 ~012% sodium potassium tartrate m water). Incubate for 10 mm. Add 0.1 mL of Folm reagant, mix, and mcubate for 30 mm Read absorbance at 750 and/or 550 nm. Prepare a standard curve using bovine serum albumin (BSA) and use tt to determine the concentratron of the sample. Bradford Method. Dissolve 100 mg Coomassie Blue G250 in 50 mL of 95% ethanol, mix with 100 mL of 85% phosphoric acid, and make up to 1 L with water. Filter the reagent Ptpet 0 1 mL of sample into test tube, add 5 mL of reagent, and mix Measure absorbance at 595 nm lo-60 min after mtxmg. Prepare a standard curve using BSA and use it to determine the concentration of the sample.

Dooley and Houghten

22

7. Screenmg of this hbrary m an optold radioreceptor assay was optimal at a fmal concentration of 0 4 mg/mL. When screening a new receptor, it is advisable to screen at a high concentration (l-5 mg/mL) and subsequently decrease the concentration if too many mixtures are found to be active 8 The l-mL polypropylene tubes come with plugs m strips of eight We have found that the only way to ensure adequate mtxmg of components 1sto cap all tubes and invert the tray two or three times, tapping both ends to dislodge any solvent from the top or bottom of the tube 9 We have found that soaking filters in polyethylemmme (PEI), as 1s often recommended to reduce nonspecific binding, causes problems when using the filters obtained from Wallac. PEI causes the ink and portions of the filter to stick to the harvester A 5-mg/mL BSA/buffer solution has generally sufficed to muumlze nonspecific bmdmg

Acknowledgments This work

was funded in part by Trega Biosciences,

Pharmaceuticals),

Inc. (formerly

Houghten

San Diego, CA.

References 1 Pnulla, C., Appel, J R , Blanc, P , and Houghten, R A. (1992) Rapid identiftcation of high affmny peptide hgands using positional scanning synthetic peptide combinatorial libraries. BloTeclznzques 13,901-905 2. Dooley, C. T. and Houghten, R. A (1993) The use of postttonal scanning synthetic peptide combmatorial libraries for the rapid determmation of opioid receptor hgands Lzfe Scz 52, 1509-15 17 3 Houghten, R. A., Pnulla, C., Blondelle, S E., Appel, J R., Dooley, C T., and Cuervo, J H. (199 1) Generation and useof synthetic peptide combmatorial libraries for basic researchand drug discovery. Nature 354,84-86 4 Pmllla, C., Appel, J R , and Houghten, R A (1994) Investigation of antigenantibody mteractions using a soluble nonsupport-bound synthetic decapeptide library composedof four trillion sequencesBzochemJ. 301,847-853.

5. Pimlla, C , Appel, J R , Blondelle, S. E., Dooley, C T., Elchler, J , Ostresh, J M., and Houghten, R. A (1994) Versatility of positional scannmgsynthetic combmatorial libraries for the JdentifJcatlon of mdtvidual compounds Drug Dev. Res.33, 133-145 6 Dooley, C T , Bower, A. N , and Houghten, R A (1996) Identification of mu-selective tetrapeptides using a positional scannmgcombmatorial library contaming L-, D- and unnatural ammo acids, m Peptldes Chemutry, Structure and Biology (Proceedmgsof the Fourteenth American PeptzdeSymposium(Kaumaya, P T P and Hodges, R S., eds ), Escom, Leaden,Germany, pp 623,624 7 Pmilla, C , Buencammo, J., Appel, J R., Houghten, R A , Brassard, J A., and Ruggeri, Z M (1995) Two antipeptide monoclonal antibodies that recogmze

adhesive sequences in fibrinogen

Identification

of antlgenlc determinants and


8

9.

10.

11

12.

13

14. 15

16 17. 18

19

20. 21.

23

unrelated sequences using synthetic combmatorial libraries Blamed. Pept. Proterns Nucletc Actds 1, 199-204. Pimlla, C Buencamino, J. Appel, J. R., Hopp, T. P , and Houghten, R A (1995) Mapping the detailed speciftctty of a calcmm-dependent monoclonal antibody through the use of soluble positional scanning combmatonal libraries identification of potent calcium-independent antigens. Mol Diversity 1,21-28. Ostresh, J. M., Husar, G. M., Blondelle, S. E., Dorner, B , Weber, P A., and Houghten, R. A. (1994) “Ltbrartes from libraries”. Chemical transformatton of combmatorial libraries to extend the range and repertoire of chemical diversity. Proc. Nut1 Acad Scl. USA 91,11,138-l 1,142 Perez-Pay&E , Takahashi, E., Mmgarro, I., Houghten, R. A., and Blondelle, S. E. (1996) Use of synthetic combmational libraries to identify pepttde mhtbitors of Ca2’-complexed calmodulm, m Peptides: Chemistry, Structure and Btology (Proceedings of the Fourteenth American Peptzde Symposium) (Kaumaya, P T P and Hodges, R S., eds ), Escom, Leiden, Germany, pp. 303,304 Perez-Pay& E., Houghten, R. A., and Blondelle, S E. (1996) The destgn of selfassemblmg pepttde complexes usmg conformattonally defined ltbrartes, m Techniques tn Protem Chemtstry VII (Marshak, D., ed ), Academic Press, San Diego, CA, pp. 65-7 1. Blondelle, S. E , Houghten, R. A , and Perez-Pay& E (1996). All D-ammo acrd hexapepttde mhlbttors of meltttrn’s cytolyttc activity derived from synthetic combmatonal bbraries J. Mol. Recog. 9, 163-168. Blondelle, S E.,Takahasht, E , Houghten, R. A., and Perez-Pay& E. (1996) Rapid rdentifrcation of compounds having enhanced antimicrobial activity using conformattonally defmed combmatortal ltbrartes. Bzochem. J. 313, 141-147 Dooley , C. T. and Houghten, R A (1995) Identtficatton of mu-selecttve polyamine antagonists from a synthetic combmatorial library, Analgesza, 1,400404 Eichler, J., Lucka, A. W , and Houghten, R A. (1994) Cyclic pepttde template combmatorial libraries Synthesis and identification of chymotrypsin inhibitors, Pept. Res 7,300-307 Steward, J M and Young, J D. (1984) Soled Phase Pepttde Syntheses 2nd ed , U.S.A Pierce Chemtcal Company, Rockford, IL Pennmgton, M. W and Dunn, B. M., eds. (1994) Pepttde Synthesis Protocols Methods in MoEeculur Biology. Humana, Totowa, NJ. Houghten, R A. (1985) General method for the raptd solid-phase synthesis of large numbers of peptides. specificity of antigen-antibody mteraction at the level of mdividual ammo actds Proc. Nat/. Acad. Set. USA, 82,5 13 1-5 135 Bradford, M M. (1976) A rapid and sensitive method for the quantitation of mrcrogram quanttties of protem utibzmg the princtple of protein-dye binding. Anal. Btochem 72,248-254 Lowry, 0. H , Rosebrough, N. J , Farr, A L., and Randall, R J. (195 I) Protein measurement with the Folm phenol reagent J. Btol. Chem. 193,265-275 Pimlla, C , Buencammo, J., Houghten, R A , and Appel, J R (1995) Detailed studies of antibody specificity using synthetic combinatorial libraries, m Vuccznes

Dooley and Houghten

24

1995: Molecular Approaches to the Control of Infectlow Diseases (Brown, F , Chanock, R., Ginsberg, H , and Non-by, E., eds.), Cold Sprmg Harbor Laboratory Press, Cold Spring Harbor, pp 13-17 22 Kaiser, E T., Colescott, R. L., Blossmger, C D , and Cook, P. I. (1970) Color test for detection of free terminal ammo groups m the solid-phase synthesis of peptides. AnaE. Blochem. 34,595-598 23 Krchnak, V , Vagner, J., Safir, P,, and Lebl, M (1988) Nonmvasive contmuous momtormg of solid phase peptide synthesis by acid-base mdtcator. Collect. Czech. Chem Commun. 53,2542-2548. 24 Nefzi, A., Ostresh, J M , Meyer, J -P , and Houghten, R A (1997) Solid phase synthesis of heterocycltc compounds from linear pepttdes. cyclic ureas and thioureas Tetrahedron Lett. 38,93 l-934

4 Synthesis and Screening of Peptide Libraries on Continuous Cellulose Membrane Supports Achim Kramer and Jens Schneider-Mergener 1. Introduction There are different strategies for the construction of soluble and solid phasebound chemrcal peptide libraries. These libraries have been used for the detection of epitopes as well as for the identification of peptides that act as antagonists of medically relevant proteins. We have prepared different types of cellulose-bound peptide libraries by spot synthesis (I), which is a powerful tool for the simultaneous and positronally addressable synthesis of thousands of peptrdes or peptide mixtures bound to continuous cellulose membrane supports. Presently up to 8000 different spots (peptides or peptide mixtures) can be automatically synthesized on a 20 x 30-cm cellulose membrane and screened for ligand binding within l-2 wk. These libraries can be used for the detection of peptides that bind to proteins, metals, and nucleic acids (2). We have mapped several linear and nonlmear antibody epitopes (3-9), and also used this approach for the detection of receptor-ligand interactions For instance, cellulose-bound peptide scanning libraries allowed the detection of the contact sites between tumor necrosis factor-o, and interleukin-6 with its receptors (4,IO). Furthermore, this method proved to be valuable to characterize heat shock protein-peptide mteractlons (II). As another biologically relevant application, these libraries were applied for the study of metal-peptide interactions. For example, we identified technetium-99m binding peptides important for tumor diagnosis (12) and nickelbinding peptides that can be used for the purification of recombinant proteins (3). The synthesis of cellulose-bound peptide libraries is not restricted to L-amino acids. Other building blocks, such as o-amino acids, unnatural ammo acids, and organic compounds, can also be used. Furthermore, the synthesis of From

Methods

m Molecular Bology, Edlted by S CablIly

vol 87 Combmatonal Pepbde 0 Humana Press Inc , Totowa,

25

Library NJ

Protocols

Kramer and Schneider-Mergener

26

Cellulose modification (3.1)

Amino acid coupling (double

couplmg.

15 mm reac(lon

(3.4): bme) \ waslung wrch DMF (3 times, 3 mm)

/ dvng

\ Fmoc deprotecnon Wllb 20 % pqlendme (20 mm)

/ waslung wh methanol (3 mm)

/ waslung wth DMF (5 bmes, 3 mm)

\ stamng wrh BPB waslung wltb methanol (Iwrce, 3 mm)

J

El

Side group cleavage (3.6)

Rg 1. Outhne of the synthesis procedure of cellulose-bound

pepttde libraries

cyclic and branched peptrde libraries can be achieved on cellulose membranes (3,13,14). Described here are protocols for the manual synthesis of a combmatorral peptrde library XXB,B2XX (B = defined position, X = randomized position) (2,15,16), a peptide scanning library, and a mutational analysis of a peptrde eprtope. An outline of the synthesis strategy IS given m Fig. 1. Furthermore, we provide protocols for the screening of these libraries with protein ligands. As an example, we have screened the libraries with the monoclonal antitransforming growth factor-a (TGFa) antibody Tab 2 (Fig. 2). The combina-

Cellulose Membrane Supports A

27

B2 4CDEFGHIKLMNPQRSTVWY A C D E F G H

I

Bli N E I V W Y

Fig. 2. Reaction of the anti-TGFa antibody Tab 2 with different types of peptide libraries. (A) Combinatorial library XXB,B,XX, (B) mutational analysis of the TGFa epitope VVSHFND, (C) TGFa-derived peptide scanning library (7-mers, 6 amino acids overlapping starting with the upper left spot).

torial peptide library XXB ,B,XX allowed the a priori delineation of the TGFa epitope. The peptide scanning library consisting of overlapping peptides spanning the entire TGFa sequence also led to the detection of the epitope. In addition, a mutational analysis substituting each single epitope residue by all 20 gene-encoded amino acids gave interesting insights into the molecular nature of this peptide-antibody recognition. This technique allowed the identification of amino acids that cannot be substituted by other residues and are therefore key residues in antibody binding. A short chapter introduces the Auto-Spot Robot APS 222 (Abimed GmbH, Langenfeld, Germany), which accelerates the spotting steps, thus allowing the semiautomated, parallel synthesis of a high number of peptides. The software for generation of library sequence files, described in this paper, can be purchased from Jerini BioTools GmbH (Berlin, Germany), which also manufactures synthesized libraries.

2. Materials The amino acids (one letter code) are 9-fluorenylmethoxycarbonyl (Fmoc)protected. With the exception of Fmoc-P-alanine-OH (Subheading 2.1.), all amino acids are activated with either pentafluorophenyl (Pfp) or 3-hydroxy2,3-dihydroxy-4-oxobenzotriazolyl (Dhbt). The following side-chain protecting groups are used: trityl for C, H, N, and Q; t-butyl for D, E, S, and T;

28


t-butoxycarbonyl for K and W; and pentamethylchroman sulfonyl for R. All other chemicals should be purchased in their purest quality and used without further purification (see Note 1). All peptide synthesis steps should be carried out in a well-ventilated hood and wtth sufficient protective clothing.

2.1. Modification

of the Cellulose

1 Cellulose paper: Whatman 50 (Whatman, Maidstone, England). 2 Activated p-alamne solution: 0 2 M Fmoc-P-alanme-OH activated with 0 24 A4 DIC (dnsopropylcarbodlimlde) and 0 4 M NM1 (N-methyhmldazole) 3. DMF dlmethylformamlde. 4. Piperidme solution: 20% plperldme m DMF 5 Methanol.

2.2. Definition

of the Spots

1 Fmoc-P-alanme-OPfp solution 0 3MFmoc-P-alanm-OPfp m DMSO (dlmethylsulfoxide). 2 DMF. 3. Plperidine solution 20% plperidine m DMF 4 Methanol. 5. Acetanhydrlde solution A* 2% acetanhydrlde m DMF 6 Acetanhydrlde solution B 2% acetanhydnde, 1% DIPA (dusopropylethylamme) m DMF. 7 BPB-solution A. 0 01% (w/v) bromophenol blue m methanol

2.3. Functionality

Determination

1 BPB-solution B: 0.05% (w/v) bromophenol blue m DMF. 2 Methanol. 3 Plperldine solution. 20% plperldme m DMF.

2.4. Coupling

of the Amino Acids

1 Amino acid solutions* each of the 20 genetlcally encoded ammo acids 1s used as 0 3 A4 solution m NMP (N-methylpyrrolldone) These solutions are stable at -2O’C for several days with the exception of the active ester of argmme, which has to be freshly prepared each working day 2. X-mixture eqmmolar mixture of 17 ammo acids (all 20 genetically encoded ammo acids except cysteme, methlonme, and tryptophane) Use a concentration of 1.5 x (functionality of the spot) per yL. Make use of the result of the calculation of Subheading 3.3. For a functlonahty of 60 nmol per spot, the concentration of the X-mixture has to be 90 mM m NMP MIX the 0 3 M amino acid solutions and dilute with NMP 3. DMF. 4 Piperldine solution* 20% plperldme m DMF 5 BPB-solution A* 0.01% (w/v) bromophenol blue m methanol

29

Cellulose Membrane Supports 2.5. Acetylation

of the N-terminus

1 Acetanhydrlde 2 DMF. 3. Methanol.

2.6. Cleavage

solution B* 2% acetanhydnde,

of the Side-Chain

1% DIPA m DMF

Protecting

Groups

1 Deprotectlon solution: 50% TFA (tnfluoroacetic acid), 3% trusobutylsllane, 2% water, 1% phenol m DCM (dlchloromethane). TFA 1s toxic and very corrosive and should be handled with the greatest caution. Do not mix TFA and DMF waste as it can undergo an exothermlc and explosive reaction Consult your safety officer for approved handling and disposal procedures. 2 DCM. dlchloromethane 3. DMF. 4 Methanol.

2.7. Automated

Spot Synthesis

1. Auto-Spot Robot APS 222 (Ablmed GmbH, Langenfeld, Germany) 2 Software DIGEN (Jerml BloTools GmbH, Berlin, Germany). 3. Peptlde synthesis chemicals of the previous sections.

2.8. Synthesis of a Mutational Peptide synthesis

2.9. Synthesis

of the previous

of a Peptide Scanning

Peptide synthesis

2. IO. Screening

chemicals

Analysis

chemicals

sections.

Library

of the previous

sections.

of the Peptide Libraries

1. Methanol 2 Tns-buffered salme (TBS). 50 mA4 Tns-(hydroxymethyl)-ammomethane, 137mM NaCl, 2 7 mA4 KCl. Adjust the pH to 8 0 with HCl 3 Blocking buffer: dilute blockmg reagent (CRB, NorthwItch, UK) 1*lo m T-TBS and add 10% (w/v) sucrose 4. T-TBS: Tns-buffered salme containmg 0.05% Tween-20, pH 8 0 5 Ligand solution: dilute the protein of interest to a final concentration of 0.1-l pg/mL m blocking buffer (see Note 3).

2.11. Detection

of Ligand Binding

(Alkaline

Phosphatase

Method)

1 T-TBS Tns-buffered salme contammg 0.05% Tween-20, pH 8 0. 2. Blocking buffer. dilute blocking reagent (CRB) 1.10 m T-TBS and add 10% (w/v) sucrose 3. Alkaline phosphatase-labeled antlbody solution. ddute an alkalme phosphataseconjugated antibody, which 1s directed against the primary hgand, 1.lO,OOO m blockmg buffer (see Note 3)

30

Kramer and Schneder-Mergener

4 Nttroblue tetrazolmm (NBT) stock solutton (stable at 4°C for at least 1 yr) dlssolve 0 5 g of NBT m 10 mL of 70% DMF m water 5 Bromochloromdolyl phosphate (BCIP) stock solution (stable at 4°C for at least 1 yr) dissolve 0.5 g of BCIP (dlsodmm salt) m 10 mL of DMF 6 Alkaline phosphatase buffer (stable at 4°C for at least 1 yr). 100 ti NaCl, 5 mM MgCl,, 100 mM Trrs-HCl (pH 9.5). 7 Enzyme substrate solutron add 330 PL of NBT stock solution to 50 mL of alkalme phosphatase buffer Mix well and add 165 uL of BCIP stock solutton. Use wtthm 1 h 8 Stop solution 20 mM EDTA m PBS (phosphate buffered salme).

2.72. Defection

of Ligand Binding (Chemiluminescence

Method)

1 T-TBS Trts-buffered sahne contammg 0.05% Tween-20, pH 8 0 2 Blockmg buffer dilute blockmg buffer stock solutton (CRB, Northwltch, England) 1: 10 m T-TBS and add 10% (w/v) sucrose 3 Peroxtdase-labeled antibody solution dilute a peroxidase-conjugated anttbody, which IS directed agamst the primary ltgand 1 10,000 m blockmg buffer (see Note 3) 4 Detection reagent Just before developmg prepare the detectton reagent (BM Chemtlummescence Western Blottmg Reagents, Boehrmger Mannhelm, Mannhelm, Germany, or ECL Western Blottmg Detection Reagents,Amersham Buchler, Braunschwetg, Germany) according to the given protocols 5 Standard X-ray film and ftlmcassette, developer, water bath, and fixing solution

2.13. Regeneration

of Cellulose-Bound

Pepfide Libraries

1 Water 2 DMF 3 Regeneration buffer A. drssolve urea (480 5 g) and sodturn dodecyl sulfate (10 0 g) m water (800 mL) Make up to 1 L with water, then add 1 mL of 2-mercaptoethanol 4 Regeneration buffer B: mix water (400 mL) with ethanol (500 mL) and add acetic acid (100 mL)

3. Methods In Subheadings 3.1,3.6. we describe the manual synthesis of a combinatorial peptide library of the type XXB,B,XX. Subheading 3.7. contains details about the automated synthesis of peptide libraries using the Spot synthesizer Auto-Spot Robot APS 222 of Abimed GmbH In Subheadings 3.8. and 3.9. the synthesis of a mutational analysis and a peptide scanning library is described. The screening methods of these different peptide libraries are explained in Subheadings 3.10,3.12. Subheading 3.13. describes the regeneration of cellulose-bound peptide libraries.

Cellulose Membrane Supports 3.1. Modification

37

of the Cellulose

1. Mark 400 points as a 20 x 20 matrix on a square piece of cellulose paper (about 20 x 20 cm) usmg a penctl (graphite IS stable against the pepttde synthesis chemrcals) For regular spotting, be sure that the points are visible from the other stde of the paper. 2 Incubate the dry cellulose paper with 12 mL of activated p-alanme solution for 3 h m a sealed metal or glass vessel without shaking. Avoid air bubbles This IS done to mtroduce suitable anchor functions for the subsequent pepttde synthesis The activated p-alanine forms an ester bond with the hydroxyl groups of the cellulose 3. Wash the membrane three times with 50 mL of DMF for about 3 mm each A shaking platform 1s recommended All subsequent DMF washing procedures should be carried out as described here. 4 Cleave the Fmoc protecting groups by treatment of the paper with 50 mL of pipertdine solutton for 20 mm 5 Wash the membrane five times with DMF 6. Wash the membrane twice with 50 mL of methanol for 3 mm All subsequent methanol washing procedures should be carried out as decrtbed here 7. Dry the membrane

3.2. Definition

of the Spots

1 For the second couplmg step, spot 1 uL of Fmoc-P-alanme-OPfp solutron to the predefmed positrons on the cellulose membrane Use the nonmarked stde of the paper Spot at the transparent pencil points A multtstep pipet is recommended. Define an addmonal spot somewhere on the edge of the membrane. This spot will be cut out m order to define the functtonalrty of the spots (see Subheading 3.3.) After 15 mm reaction time repeat the spotting once to assure a complete coupling (15 mm reaction time). 2. Position the membrane carefully face-down m 20 mL of acetanhydrlde solution A. Avoid shaking and an- bubbles. After 2 mm, incubate the membrane face up wrth 50 mL of acetanhydride solution B for 30 mm with shaking. This 1s done to acetylate the amino functtons of the membrane that did not react with the second p-alanme. Thus, defined sites for the following synthesis of the peptlde library can be achieved. 3 Repeat steps 3-6 of Subheading 3.1. 4. Stain the membrane with 50 mL of BPB solution A The BPB solutton should remam yellow and the spots should become blue, owmg to the basic character of the ammo groups of the coupled second p-alanme Treat the membrane untd an equal blue staining of the spots IS reached 5. Wash the membrane wrth methanol for 3 mm 6 Dry the membrane. At this point the synthesis can be interrupted The membrane should be stored u-r a sealed plastic bag at -20°C until the next working day

32


3.3. Functionality

Determination

The randomized positions of a combinatorial peptide hbrary XXB,B,XX are introduced by double coupling an equimolar activated amino acid mixture at 1.5 Eq in proportion to the amino functions (2). This is done to overcome the strong bras of the standard coupling conditions that reflect the different coupling rates of each amino acid. Therefore, the number of free amino functions per spot has to be determined. This does not need to be done for the synthesis of peptide scanning libraries and mutational analyses, since these libraries do not contain randomized positions. I. 2 3. 4 5 6 7.

Cut out the addrtronal spot (see Subheading 3.1., step 1) with a hole puncher. Stam the spot with 1 mL of BPB-solutron B m a 1 5-mL tube untrl saturation Wash three times with about 1 mL of methanol each Dry the spots Destam the spot completely with 1 mL of prperrdme solutron Determine the extinction photometrrcally at a wavelength of 605 nm. Calculate the amount of ammo functrons on the spot using an extmctron coeffrcient of &6a5= 95,000 L mol-’ cm-‘, Presume that each ammo function bmds one bromophenol blue molecule. Usually the membrane carrres about 60 nmol ammo functrons per 0 25 cm’-spot (1 pL creates a soaked area of about 0.25 cm*)

3.4. Coupling

of the Amino Acids

The synthesis of cellulose bound peptides IS done as a cyclic process of double coupling the amino acids, washing with DMF, cleaving the Fmoc protecting groups, washing with DMF and methanol, staining, washing with methanol, and drying. After that, the synthesis of the next position of the peptrdes can be carried out. Work according the synthesis diagram in Fig. 1. Peptides are always synthesized from the C-terminal to the N-terminal position, i.e., for the lrbrary B, +X+X.

XXB,B,XX,

the synthesis

steps are: X + X + Bz +

1. For coupling randomrzed posrtrons X prpet I pL of the X-mixture onto each spot twrce (2 x 15 min reactron time) The couplmg reactron can be followed by a color change from blue to blue-green 2 Repeat steps 3-5 of Subheading 3.2. After that, the membrane IS ready for coupling the next position of the peptrde library (see Note 2) 3 For coupling the B-posrtrons, spot one of the 20 ammo acid solutions twice onto each column (for B2) or each row (for B,) of the 20 x 20 matrrx twice. Use 1 VL per spot (2 x 15 mm reactron time) For a clear bmdmg analysis, an arrangement in alphabetical order IS recommended, 1 e., spot A onto the first column/row and Y onto the 20th column/row Coupling reactions can be followed by color change from blue to blue-green for Pfp esters and yellow for Dhbt esters

Cellulose Membrane Supports 4. After coupling Subheading

3.5. Acetylation 1 2. 3 4.

33

the last position of the peptldes continue with steps 3-5 in

3.1. Do not stam the membrane

of the N-Terminus

Incubate the membrane with 50 mL of acetanhydride B solution for 30 mm Wash the membrane five times with 50 mL of DMF for 3 min Wash the membrane twice with 50 mL of methanol. Dry the membrane.

3.6. Cleavage

of the Side Chain-Protecting

Groups

1 Incubate the membrane with 100 mL of deprotecting solution m a tightly closed box for 2 5 h. After a few seconds the cleaved “tntyl groups” of the cysteme row and column can be observed as yellow spots. After treatment with the deprotection solution the membrane is much less mechamcally stable Therefore, handle the membrane extremely carefully from this point on. 2. Wash 4 times with 50 mL of DCM for 3 mm. 3 Wash three times with 50 mL of DMF for 3 mm. 4 Wash twice with 50 mL of methanol for 3 mm 5. Dry the membrane. 6. Store the membrane at -20°C.

3.7. Automated

Spot Synthesis

The disadvantages of manual synthesis are clear: the high number of synthesis steps are time consuming, the required precision during the pipeting process is not always manually managable. Furthermore the error quote increases with the amount of peptides on the membrane. The laborious pipeting procedure of the peptide library synthesis process led to the development of an automated spot-synthesizer, which allows a maximum amount of precision and reliability for the synthesis. The system Auto-Spot Robot APS 222 was developed by Abimed GmbH especially for the synthesis of peptides on continuous membrane supports and automates the distribution of the amino acid derivatives. The membrane can be divided into several trays and up to 8000 spots can be synthesized simultaneously. This allows the synthesis of a combinatorial peptide library with three defined positions. The system only automates the pipeting procedures, all other steps, such as membrane modification, acetylation, washing, Fmoc-deprotection, and side-chain deprotectlon have to be done manually. The software DIGEN, which can be purchased from Jermi BioTools GmbH, 1s recommended for the generation of sequence files of several types of peptide libraries, such as combinatorial libraries, peptide scanning libraries, mutational analyses of peptides, loop libraries, and so forth. These files can be easily loaded into the Spot-synthesis software of the Auto-Spot Robot APS 222.

34

3.8. Synthesis

Kramer

of a Mutational

and Schneider-Mergener

Analysis

For the manual synthesis of a mutational analysis of a linear peptide use a matrix of 21 x peptide length (Fig. 1). On the first column synthesize the onginal peptide, on the other columns substitute each position of the peptide by all 20 amino acids m alphabetical order. Carry out the peptide synthesis steps as described in the previous sections. Here are some recommendations for the pipeting order. 1 In the first coupling step, ptpet the C-terminal ammo acid of the original peptide onto all rows except the last one 2 Ptpet the same ammo acid onto the first spot of the last column 3 Spot all 20 ammo acids successtvely onto the remaining 20 spots m alphabettcal order 4 Use an analog procedure for the remaining synthesis steps, 1.e , ptpet the subsmutton ammo acids m the second round onto the second row from below, and so on

3.9. Synthesis

of a Pepticfe Scanning

Library

The first step is the derivation of the peptrde sequences from the protein sequence. A peptide length of 12 amino acids and an overlap of 9 amino acids is recommended In Fig. 2 the synthesized peptide sequences derived from the transforming growth factor-a sequence are given. If you choose a higher overlap, the spot number increases, but the information about the minimal hgand binding protein regions is more subtly differentiated. The software DIGEN generates sequence lists of peptide scanning libraries. The manual synthesis of a peptide scanning library requires a much higher degree of concentration than the synthesis of a combmatorial peptide library or a mutational analysis owing to the irregular order of pipeting steps in each synthesis cycle To avoid mistakes, the use of a punch card, which covers the membrane during the pipeting, is recommended. Every hole has to be labeled with the amino acid for the respective spot. This has to be done for each synthesis cycle.

3.70. Screening

of the Peptide Libraries

The screening strategy of the different peptrde libraries depends on various preconditions Is the hgand of interest available m an enzyme-labeled or radioactively labeled form? Is an anti-ligand antibody available in an enzymelabeled or radioactively labeled form? Is the ligand-peptide mteraction expected to have a high or low affinity? In this section, we describe the screening of peptide libraries with a nonlabeled ligand. If you have a labeled ligand available use the Incubating conditions of this section and the developing conditions of one of the next sections depending on your label. If you do not

Cellulose Membrane Supports

35

have a labeled antiligand antibody available, antibody. In this case use the same incubating second and third antibody.

you have to use a third labeled and washing conditions for the

Rinse the membrane with a small volume of methanol for 1 mm This IS done to avoid the precipitation of hydrophobic peptides during the following TBS washing procedure Wash the membrane three times with an appropriate volume of TBS for 10 mm The volume depends on the library and the vessel size The membrane should be sufficiently covered with the solutron.

Block the membrane with the same volume of blocking buffer for about 14 h at room temperature with shaking

Wash the membrane once with the same volume of T-TBS for 10 mm Incubate the membrane with the same volume of hgand solution for 3 h (see Note 3) Wash the membrane three times with the same volume of T-TBS for 10 mm

3.11. Detection

of Ligand Binding

(Alkaline

Phosphatase

Method)

For the detection of high affinity bmdmg peptrdes, such as linear epitopes identified via peptide scanning libraries or mutational analyses of linear antibody epitopes, the alkaline phosphatase method is recommended The BCIP/ NBT substrate generates an intense black-purple precipitate at the site of enzyme binding. The reaction proceeds at a steady state rate, thus allowing control of the development of the reaction. 1. Incubate the membrane with an appropriate volume of alkaline phosphataselabeled antibody solutton for 2 h with gentle agitation The volume depends on the library and the vessel size. The membrane should be suffictently covered with the solution (see Note 3) 2 Wash three times with the same volume of T-TBS for 10 mm each 3 Incubate the membrane with the same volume of enzyme substrate solution Develop the membrane with agitation until the spots are suitably dark (l-30 mm). 4 Stop the reaction by rinsing the membrane with the same volume of stop solution three times for 3 min each. The EDTA in the stop solution chelates the Mg2+ ions, which are essential for alkalme phosphatase activity (see Note 4).

3.12. Detection

of Ligand Binding

(Chemiluminescence

Method)

For the detection of low affinity binding peptides, such as peptide mixtures in a library XXB ,B,XX, the chemiluminescence method is recommended The chemiluminescence method is a highly sensitive detection method, has short exposure times ranging from a few seconds to 1 h, and avoids the use of radioactivity. The lummiscence reaction reaches its maximum after l-2 min and is relatively constant for 20-30 min. After 1 h the signal intensity decreases to about 60-70% of maximum.

36


1, Incubate the membrane with an appropriate volume of peroxldase-labeled antlbody solution for 2 h with agitation. The volume depends on the library and the vessel size. The membrane should be sufflclently covered with the solution (see Note 3) 2 Wash three times with the same vol of T-TBS for 10 mm each. 3. The following steps should be carried out m a dark room* incubate the membrane with 75 pL/cm2 of detection reagent for about 1 min Make sure that each part of the membrane 1scovered with detection solution 4 Insert the membrane protein side up mto a film cassette that 1slined with a plastic film Cover the blot with a transparent plastic film 5. Switch off the light, place a sheet of film onto the membrane, and close the cassette. Expose for 60 s. 6 Immediately replace the exposed film with a new one, reclose the cassette, and develop the exposed film at once. The developing process can be followed by using red safelights. 7 Expose the second film for a suitable time (up to 1 h) estimated from the signal intensity on the first film (see Note 5). 3.13.

Regeneration

of Cellulose-Bound

Pep tide Libraries

After probing, the cellulose peptide libraries can be regenerated using the following procedure. The membrane can then be reprobed with the same or with a different ligand of interest. With care the membrane may be regenerated and reprobed several times. The success of the regeneration should be checked (see Note 6). Do not allow the membrane to dry out before regeneration. 1. Wash the membrane three times with water for 10 mm The volume used for this and the followmg steps should be the same as m Subheading 3.10., step 1 or Subheading 3.11., step 1. 2. Wash the membrane three times with DMF for 10 mm Prolong the DMF washmg time, if the dye cannot be removed during the given time 3. Wash the membrane twice with water for 10 mm. 4. Incubate the membrane with regeneration buffer A for 10 mm Repeat this step twice 5. Incubate the membrane with regeneration buffer B for 10 mm Repeat this step twice 6. Wash the membrane twice with methanol for 10 min 7 If the membrane 1snot immediately reprobed, then dry the membrane and store it at -20°C

4. Notes 1 The purity of DMF and NMP is a critical point m peptide synthesis, for both DMF and NMP can degrade to give free ammes These ammes lead to premature Fmoc-deprotection or decomposltlon of ammo acid active esters. This ~111reduce


2.

3

4.

5

6.

the yield of full length peptide and cause byproduct formation, thus, only DMF and NMP free of amines should be used. To test the purity add 10 ltL of 1% bromophenol blue solution m DMF to 1 mL of NMP or DMF in an 1 S-pL tube and mix thoroughly. Allow to stand for 5 mm and then observe the color. yellow indicates satisfactory to use, yellow/green or green/blue means do not use, purchase a better one. Bromophenol blue staining (Subheading 3.2., step 4). the Intensity of stainmg varies depending on the last spotted ammo acid. Some ammo acids, such as cysteine, aspartrc acid, glutamic actd, and asparagine stain only weakly Alanme, glycine, and prolme stam more strongly than others. These differences may serve as an internal control for correct pipeting. The incubation and washing condittons for the ligand of interest (Subheading 3.10.) and the second antibodies (Subheadings 3.11. and 3.12.) have to be optimized for each system. In general, if you do not get any srgnal or your signals are too weak there are several posstbilities to optimize: a. Increase the ligand and/or antibody concentrations. b Prolong the incubation time with ligand to overnight at 4°C. c. Prolong the mcubation time with secondary antibody to 3 h. d. Shorten the washing times, use washing buffer without Tween-20. e. Shorten the blockmg time to 3 h. If the background IS too high, try the followmg changes: a. Increase the detergent concentration m washing buffer. b Increase the washmg times and/or the washing volumes. Cysteme-containing peptides sometimes cause a signal m the alkaline phosphatase detection system (Subheading 3.11.), which IS not a result of bmdmg to the conjugated antibody, but probably is caused by a catalytic reaction of the thiol group of the cysteme side chain with the bromochloroindolyl phosphate substrate, which forms the product. If you get those spots colored, remember this reaction and synthesize on your next membrane control peptides, m which cysteine is substituted by the physrcochemically related ammo acid serme Another possibility to circumvent this problem is to use the chemiluminecence detection method. In the chemiluminescence detection method (Subheading 3.12.) somettmes clear spots on a black background appear. In this case the ligand and/or secondary antibody concentrations are much too high. On the spots, which carry a high amount of antibody conjugate, all the substrate is used up before the X-ray film can be placed on the membrane, resulting in clear spots Wash extensively with T-TBS and try to redetect, or regenerate the membrane and incubate with lower concentrations of proteins. The success of the regeneration should be checked after each regeneration by incubating with only the secondary antibody and subsequent detection If you have used a directly labeled ligand, repeat the detection procedure after regeneratron. In some cases very strongly bmdmg proteins cannot be removed from the membrane.

38


Acknowledgments This work was supported by the BMBF, DFG, and Fonds der Chemlschen Industrie. We thank Beret Hoffmann and Christlane Landgraf for excellent technical assistance.

References 1 Frank, R (1992) Spot synthesis. an easy technique for the positionally addressable, parallel chemical synthesis on a membrane support Tetrahedron 48, 9217-9232. 2. Kramer, A., Volkmer-Engert, R , Maim, R , Remeke, U , and SchneiderMergener, J (1993) Simultaneous synthesis of peptide libraries on single resin and contmuous membrane supports: identification of protem, metal and DNA bmdmg peptide mixtures. Pept Reh. 6,3 14-3 19. R., Landgraf, 3 Kramer, A , Schuster, A , Remeke, U., Maim, R , Volkmer-Engert, C , and Schnetder-Mergener, J . (1994) Combmatorial cellulose-bound peptide libraries: screening tool for the identification of peptides that bmd hgands with predefmed specificity. Methods f&388-395 4. Remeke, U., Sabat, R , Kramer, A., Stigler, R -D., Seifert, M , Michel, T., Volk, D., and Schneider-Mergener, J (1995) Mapping protem-protein mteractions using hybritope and peptide scanning libraries. Mol. Dzverszty 1,141-148. 5 Schneider-Mergener, J., Kramer, A , and Remeke, U (1996) Peptide libraries bound to contmuous cellulose membranes. tools to study molecular recognition, m Combinatorial Llbrarles, (Cortese, R , ed.), W de Gruyter, Berlin, pp 53-68 6 Kramer, A , Vakalopoulou, E., Schleunmg, W.-D , and Schneider-Mergener, J (1995) A general route to fingerprint analyses of peptide-antibody mteractions using a clustered ammo acids peptide library* comparison with a phage display library. Mol. Immunol. 32,459-465 7 Kramer, A. and Schneider-Mergener, J (1995) Highly complex combmatortal cellulose-bound peptide libraries for the detection of antibody epitopes, m Peptides 1994 (Mala, H L S., ed ), ESCOM, Leiden, pp 475,476 8 Stigler, R., Rdker, F , Katmger, D., Elliot, G., Hohne, W , Henklem, P , Ho, J X , Kramer, A , Nugel, E , Porstmann, T , and Schneider-Mergener, J (1995) Characterization of the Interaction between a Fab fragment against gp4 1 of HIV- 1 and Its peptide epitope using a peptide epitope library and molecular modellmg Protezn Eng. $471479 R., Ehrhard, B , Hohne, W , Kramer, A., Hellwig, J., and 9. Volkmer-Engert, Schneider-Mergener, J (1994) Preparation, analysis and antibody bmdmg studies of simultaneously synthesized soluble and cellulose-bound HIV- 1 p24 peptide epttope libraries Lett. Pept. Sci. 1,243-253. 10 Weiergraber, 0 , Schneider-Mergener, J , Grdtzmger, J , Wollmer. A., Kuster, A., Exner, M., and Hemrich, P C. (1996) Use of immobilized synthetic peptides for the identification of contact sites between human mterleukm-6 and its receptor FEBS Lett 379,122-126


39

11. Riidtger, S , Germeroth, L., Schneider-Mergener, J., and Buckau, B (1997) Substrate spectfrcny of the DnaK chaperone determined by screening cellulose-bound pepttde libraries EMBO J. 16,1501-1507 12. Malm, R , Steinbrecher, A , Semmler, W., Noll, B , Johannsen, B., Frommel, C , Hohne, W., and Schneider-Mergener, J (1995) Identification of technetium-99m binding peptides usmg cellulose-bound combmatortal peptide libraries J Am Chem. Sue. 117,11,821-l 1,822. 13. Wmkler, D., Schuster, A , Hoffmann, B., and Schneider-Mergener, J. (1995) Synthesis of cyclic pepttde libraries bound to contmuous cellulose membrane supports, m Peptzdes 1994 (Mata, H L S., ed ), ESCOM, Letden, pp. 485,486 14 Wmkler, D , Stigler, R , Landgraf, C., Hellwig, J , and Schneider-Mergener, J (1995) Determination of the bmdmg conformations of peptide epttopes usmg cyclic peptide libraries m, Peptzdes 1995 (Kaumaya, P. T P and Hodges, R. S., eds.), ESCOM, Leaden, pp 315,316 15. Geysen, H. M , Rodda, S J , and Mason, T J (1986). A prlorl delmeation of a peptide which mimics a discontmuous anttgemc determinant. Mol. Immunol. 23, 709-715. 16 Houghten, R A , Pmilla, C , Blondelle, S E , Appel, J R , Dooley, C T , and Cuervo, J H. (1991) Generation and use of synthettc peptide combinatorial libraries for baste research and drug discovery. Nature 354,84-86.

5 Peral kylation “Libraries from Libraries”: Chemical Transformation of Synthetic Combinatorial Libraries John M. Ostresh, Barbara Darner, and Richard A. Houghten 1. Introduction 1.1. Soluble Combinatorial Libraries Synthetic combmatorial libraries (SCLs) consisting of millions of compounds are proving to be a powerful source for the identification of novel biologically active compounds (see ref. 1-3). Individual compounds having potent biological activities can now be rapidly identified from pools containing millions of other compounds (4-9). As first presented by this laboratory, nonsupport-bound SCLs have been shown to be usable m virtually any assay system. In an expansion of SCL concepts and diversities, the original peptide SCLs have recently been transformed using a “libraries from libraries” approach (7,10,11a) to yield peptidomimetic and organic libraries having entirely different physical, chemical, and biological properties relative to the peptide SCLs used as starting materials. The screening of a SCL composed of 50 million peptidomimetics (7) has yielded individual active compounds that had no homology to those found in the starting SCLs. We describe here improved methods (10) developed for the transformation of such libraries. Two synthetic approaches are generally used for the incorporation of multiple functionalities at diverse positions within a SCL. The “divide, couple, and recombine” (DCR) synthesis methods (9), also know asthe “split resin” method (12, see also Chapter l), was originally developed for use in the synthesis of peptide SCLs. This synthesis method involves the couplmg of reactants to individual portions of the resin followed by thorough mixing of the resin This From

Methods

m Molecular Edlted

by

B/o/ogy, S CablIly

vol 87 Combmatonel 0 Humana

41

Press

Peptrde

Inc , Totowa,

Llbrery NJ

Protocols

42

0s tresh, D&-net-, and Hough ten

method allows the generation of approximately equrmolar mixtures of compounds since, inherent to the physical process of aliquoting the resin, each resin bead contains only one compound (12). A second synthesis method, termed the “rsokinetic ratio” method, uses a predefmed ratio of incoming reagents at each reaction incorporating a posttion of diversity to accomplish approximately equimolar incorporation of each substituent m each of the mixture positions (13,14, see also Chapter 3). This latter method offers the advantage that a mixture of reagents can be mcorporated readily at any position in a sequence. The determination of chemical ratios, however, requires advance knowledge of the reactron kinetics of the incoming reagents Two approaches employed for the structural deconvolution of active compounds from assay data usmg nonsupport-bound SCLs are illustrated in Fig. 1 (representative data usmg L-amino acids are shown) Both the “iterative” (I) and the “posrtronal scanning” (2) approaches have been used to identify individual active compounds in a wide variety of SCLs and assays.

1.2. Iterative

Deconvolution

Method method (Fig. 1A) is illustrated

The iterative deconvolutron with a tetrapeptide SCL, designated OXXX-NH2 (where 0 represents a defined amino acid at that positron, and X represents a mixture of amino acids at each of the other positions). The SCL is first screened to identify active mixtures. Since for each mrxture within the hbrary the amino acrd in the first position 1s defined, actrve mixtures yield the necessary ammo acid at that position. The remaining three positions are then identified sequentially through an iterative process of synthesis and screening. This process is completed within 6-10 wk, since three separate iterative synthesis steps are required.

1.3. Positional

Scanning

Deconvolution

Method

The positional scanning (PS) approach (Fig. 1B) involves the screening of four separate single-defined position SCLs to individually identify the most effective amino acids at each position of the sequence. A complete tetrapeptide PS-SCL consrsts of four sublibraries (designated OXXX-NH,, XOXX-NH,, XXOX-NH*, and XXXO-NH,), each of which has a single-defined amino acid at one positron and a mixture of ammo acids at each of the other three posrtions. Each sublibrary contains the same peptides, which are pooled so that for each sublibrary the defined amino acid is m a different position. When consrdered in concert, the mformatron from a single screenmg assay is used to rdentrfy individual active sequences. This process of screening, identifying, and synthesizing individual compounds can be completed in 2 wk or less, since only one syntheses step IS required to confirm the activity of individual com-

43

Peralkyla tion Iterative

A AXXX

CXXX

au RXXX

B _ WXXX

YXXX

Positional Scanning AXXX

CXXX

WXXX

YXXX

S&Ctbl

A RAXX

VI,

RCXX

w RLXX

_ RWXX

RYXX

XAXX

XCXX

,, xwxx

.s XLXX

lxyxxl

Selection zzi!t

1, XXAX

RWAX

RWCX

,a RWLX

_ RWWX

Al..

XXLX

8. XXWX

XXYX

XXXW

XXXY

RWYX Sdectlon

J RWCA

:: RWCC

XXXA

m RWCK

I

, RWCW

RCWY

XXXC

PI.. Selection

Selection

Syntheds

RWCK

RWCK

Fig 1 Representative deconvolution of a tetrapeptide combinatorial Iterative approach (B) Positional scanning approach pounds. PS-SCLs above.

are prepared using the chemical

1.4. Peralkylation-Peptidomimetic

Positional

library

(A)

ratio approach described

Scanning

Libraries

The libraries from libraries approach allows the generation of peptidomimetic SCLs through the chemical transformation of existing peptide SCLs. Both iterative and positional scanning SCLs have been used as starting materials for the generation of peptidomimetic SCLs. Peralkylations (using methyl iodide, ethyl iodide, alkyl bromide, benzyl bromide, naphthylmethyl bromide), reductions, and combinations of the two reactions have been carried out (7,lOJl).

The use of a wide variety of chemical transformations permits a range of peptidomimetic libraries to be readily generated, thus greatly expanding the chemical diversity available. The chemical transformation of an existing library to generate a second library from which highly active individual compounds can be identified is illustrated here. This concept, as well as the synthesis methods described (see Chapters 1,3, and 8) and deconvolution methods described here, is easily applied to other reactions. The distinct advantage of the soluble nature of nonsupport-bound SCLs over other methods is that membrane-bound

Ostresh, D&net-, and Houghten

44

and whole cell assays can also be used. Furthermore, based solely on the structural similarities of compounds within each active pool or sublibrary, the deconvolution methods described here allow the chemical structure of peptldlc, peptidomimetic, and orgamc compounds to be determined. The transformation of a PS-SCL made up of 7,3 11,616 tetrapeptides synthesized from 52 amino acid derivatives (17 L-, 15 D-, and 20 “unnatural”) is used here to illustrate the increased diversity obtained using the libraries from libraries concept. The tetrapeptide PS-SCL can be transformed, while still attached to the resin used in its syntheses, into a peralkylated tetrapeptrde PS-SCL (Fig. 2). Thus procedure is described below (10).

2. Materials All reagents are available WI) and used as received.

from Aldrich

Chemical

Company

(Milwaukee,

2. I. Trityla tion 1 5% Dusopropylethylamme m drchloromethane (v/v) 2. Dichloromethane 3. 0.077 M Trlphenylmethyl chloride (trnyl chloride) m 90% dimethylformamlde/ 10% dlchloromethane (v/v) 4. Dusopropylethylamme. 5. Dlmethylformamide

2.2. Bromophenol

Blue Test

1 5% Dusopropylethylamme m dichloromethane (v/v) 2 Dlchloromethane 3 0.62 mM Bromophenol blue m dlchloromethane.

2.3. Peralkyla tion 1 2. 3. 4 5

Anhydrous tetrahydrofuran 0 5 M Lithium t-butoxide m tetrahydrofuran Dlmethylsulfoxlde. 1 5 A4 Alkyl bromide m dimethylsulfoxlde Isopropanol

2.4. Trityl Removal 1. 2 3 4 5

Dlmethylsulfoxide Isopropanol Drchloromethane Methanol 2% Trifluoroacetic

acid in dlchloromethane

(v/v)

45

Peralkyla tion

1) Trltyl chloride 2) LIthum I-butoxlde 3) Ally1 bromide

1) Trlfluoroacetlc acld 2) Hydrogen fluoride

Ftg 2 Reactton scheme for the peralkylatton of one posmonal subhbrary from a tetrapeptlde PS-SCL R, represents the stde chain of a defined amino actd R, represents the side chains of a mixture of ammo acids

3. Methods In the peralkylation method described here, peptide mixture resins (13) have been synthesized in polypropylene mesh packets by the chemical ratio approach on methylbenzhydrylamine polystyrene resin using simultaneous multiple peptide synthesis techniques (15) and BOC chemistry. 3.7. Trifyl Protection 1. Neutrahze the resin packets having free N-terminal ammo groups by washing twice with 5% dnsopropylethylamme m dtchloromethane Enough solvent is used to completely cover the resm packets 2 Wash the resin packets once with dlchloromethane 3 Add 0 077M trityl chloride (5 Eq) m dtmethylformamlde/dtchloromethane (9 1) containmg diisopropylethylamine (29 Eq)

Ostresh, Ddrner, and Houghten

46

4 Shake the resin packets on a reciprocatmg shaker for 3 h 5 Wash the resm packets with dlmethylformamrde 6 Repeat steps 1-5 mm1 the reactton is complete (generally after 3-4 repetmons, see Note l), as determmed by the nondestructive bromophenyl blue test (16)

3.2. Bromophenol

Blue Test

1 Neutraltze the resm packets three ttmes with 5% dtlsopropylethylamme in dlchloromethane 2. Wash the resin packets three trmes wrth dtchloromethane to remove excess base 3 Cut open each resm packet and place a small ahquot of resin (1 mg or less) mto a test tube 4 Reseal the resm packets 5 Add 150 pL dmhloromethane to each resm abquot 6 Add 30 PL of 0 62 mM bromophenol blue m dlchloromethane (0 42 g/L) to each resin aliquot 7 Vortex the resin ahquots briefly 8 Examme the resm beads and solution Blue beads mdmate incomplete couplmg (16) Complete couplmg (~99%) IS mdicated by yellow resm beads (normally with a slight trace of green) and yellow supernatant

3.3. Peralkylation

of Resin-Bound

Peptides

1. Dry the resin packets overmght under htgh vacuum 2 Add 0 5 M ltthmm t-butoxlde (20 Eq per avallable amrde) under anhydrous condmons (see Note 2) 3 Shake for 15 mm at room temperature. 4 Remove the base solution by cannulatlon (or decanted If working m a glove box) 5. Add 1.5 M alkyl bromide (60 Eq per available amide) m DMSO 6 Shake the reaction mixture on a rectprocatmg shaker for 2 h at room temperature 7 Remove the alkylatlon solutron 8 Repeat steps 2-7 two times. 9 Wash the resin packets three times with dtmethylformamlde. 10. Wash the resin packets twice with lsopropanol 11 Wash the resin packets three times with dtchloromethane 12 Wash the resin packets once with methanol 13 Dry the resin packets under hrgh vacuum 14 Check the reactlon completion at this point (Jee Note 3) Repeat steps 2-13 as necessary Normally, the alkylatlon reaction IS complete followmg 4-5 treatments

3.4. Removal

of the Trityl Protecting

Group

1 Wash the resin packets three times with drmethylformamlde 2. Wash the resin packets twice with lsopropanol 3 Wash the resin packets three times with dmhloromethane.

47

Peralkyla t/on

4 Remove the trttyl protecting group by two treatments with 2% trtfluoroacetlc acid in DCM (once for 3 mm, once for 30 mm). 5, Wash the resin packets three times with dlmethylformamlde. 6. Wash the resin packets twtce with tsopropanol. 7 Wash the resin packets twice with dichloromethane 8 Wash the resin packets once with methanol 9. Dry the resin packets overnight under high vacuum The peralkylated pepttdes can then be cleaved from the resm

4. Notes 1 Trttylatton reaction conditions can be altered (i.e , solvent varted, etc ) to promote completion of the reaction. 2 For the peralkylatton reaction, anhydrous conditions must be maintained. Preferably, a glove box IS used 3. It is recommended that control peptide resms having defined sequences that are the same length as the library pepttdes be added to all reactions to serve as analytical controls for the final product. Sufficient resin (100 mg or more) should be used such that multiple ahquots can be cleaved and analyzed as necessary to momtor the completeness of the alkylatton reaction. If alkylatton of the control compounds 1s mcomplete, the peralkylation reaction can be repeated and the reaction time prolonged as necessary. 4 Some side chain modiftcatton is to be expected during the peralkylatton Similar modiftcattons have been described for permethylated hbrartes (7) In our expertence, cysteme, aspartic acid, glutamic acid, and htsttdme derivatives have led to multiple products upon peralkylatlon, and therefore have not been used m most of the peralkylated pepttde ltbrartes we have prepared. 5. The alkylation method 1s easily adapted for use wtth other alkylatmg reagents However, actdolytlc cleavage resultmg m shortened sequences has been seen wtth permethylated pepttdes In addition, peralkylatton wtth bulky alkylating reagents such as benzyl bromide 1s more difficult to drive to completton.

Acknowledgment This work maceuttcals),

was funded by Trega Biosciences, San Diego, CA.

Inc. (formerly

Houghten

Phar-

References 1. Pmilla, C , Appel, J. R., Blondelle, S. E., Dooley, C T , Etchler, J , Ostresh, J. M , and Houghten, R A. (1994) Versatlltty of posttlonal scannmg synthetic combmatorial libraries for the identtftcatton of mdividual compounds Drug Dev Res 33, 133-l 45 2. Pmilla, C , Appel, J , Blondelle, S E., Dooley, C. T , Ddrner, B , Etchler, J , Ostresh, J M , and Houghten, R A (1995) A review of the utthty of pepttde combinatorial libraries Bzopolymers 37,221-240

48

Ostresh, Ddrner, and Houghten

3 Gallop, M. A , Barrett, R W , Dower, W J , Fodor, S. P A , and Gordon, E M. (1994) Appltcattons of combmatortal technologies to drug discovery 1 Background and peptide combinatorial libraries. J. Med. Chem. 37,1233-1251, 4 Blondelle, S. E., Perez-Pay& E , Dooley, C T , Pmilla, C., and Houghten, R A (1995) Chemical combmatortal Itbrartes, pepttdomimettcs and pepttde diversity. Trends Anal. Chem 14,83-92 5. Blondelle, S E , Takahashi, E , Dmh, K. T., and Houghten, R A (1995) The antimicrobtal activity of hexapeptides dertved from synthetic combinatortal libraries J. Appl. Bactertol. 78,39-46 6 Blondelle, S. E., Takahashi, E , Weber, P. A , and Houghten, R A (1994) Identification of antimicrobial peptides using combmatortal ltbraries made up of unnatural ammo acids. Anttmtcrob. Agents Chemother 38,2280-2286. 7 Ostresh, J. M., Husar, G M , Blondelle, S E , Dorner, B , Weber, P A , and Houghten, R. A. (1994) “Ltbrartes from Itbrartes”: chemtcal transformatton of combmatortal libraries to extend the range and repertoire of chemtcal dtverstty Proc. Natl. Acad. Set. USA 91,11,138-l 1,142 8. Houghten, R. A., Appel, J. R., Blondelle, S E , Cuervo, J. H , Dooley, C. T , and Pmilla, C. (1992) The use of synthetic peptide combmatortal ltbraries for the identtficatton of bioactive peptides Btotechniques 13,412-421, 9 Houghten, R. A., Pmilla, C , Blondelle, S E , Appel, J. R , Dooley, C. T , and Cuervo, J H. (199 1) Generation and use of synthetic peptide combmatortal ltbraries for basic research and drug discovery. Nature 354,84-86. 10 Dorner, B , Ostresh, J. M., Husar, G M., and Houghten, R. A. (1995) Extending the range of molecular diversity through amtde alkylation of peptide libraries, m Pepttdes 94: Proceedmgs of the 23rd European Peptide Sympostum (Maia, H. L. S , ed ), Escom, Letden, pp 463,464. 11. Cuervo, J. H., Wettl, F., Ostresh, J. M., Hamashm, V. T., Hannah, A. L., and Houghten, R. A. (1995) Polyalkylamme chemical combmatortal libraries, m Peptides 94: Proceedmgs of the 23rd European Pepttde Sympostum, (Maia H. L. S , ed.), Escom, Leaden, pp 465,466. 1 la.Nefzi, A , Ostresh, J. M., Meyer, J -P , and Houghten, R A. (1997) Solid phase synthesis of heterocycbc compounds from lmear peptides* cyclm ureas and thioureas Tetrahedron Lett. 38,931-934. 12 Lam, K S , Salmon, S. E., Hersh, E M., Hruby, V J , Kazmierskt, W M., and Knapp, R J. (1991) A new type of synthetic peptide library for ldentlfymg ligandbmdmg activity Nature 354,82-84 13 Ostresh, J M , Winkle, J H , Hamashm, V. T , and Houghten, R A (1994) Peptide libraries. determmation of relative reaction rates of protected amino acids m competitive couplmgs Btopolymers 34, 168 l-1 689. 14. Etchler, J and Houghten, R A. (1993) Identificatton of substrate-analog trypsm inhibitors through the screening of synthetic peptide combinatorial libraries Bzochemistry 32,11,035-l 1,041

Peralkyla tion

49

15 Houghten, R. A. (1985) General method for the rapld solld-phase synthesis of large numbers of peptldes speclflclty of antigen-antibody mteractlon at the level of mdwldual ammo acids Proc. Natl. Acad. Set. USA 82,5 131-5 135 16. Krchrkk, V., VBgner, J., Safk, P , and Lebl, M (1988) Nonmvaslve contmuous monitoring of solid-phase peptlde synthesis by acid-base indicator Co11 Czech Chem. Comm. 53,2542-2546

Introduction to Combinatorial Solid-Phase for Enzyme Activity and Inhibition

Assays

Morten Meldal 1. Introduction 1.1. Determining the Specificity of Proteolytic Enzymes Proteolytlc enzymes are often present as major factors m viral, bacterial, and parasitic infections Therefore, an interest in inhibitors of proteolytlc enzymes has been expressed by the pharmaceutical industry, and the mvestment in the development of specific enzyme mhlbltors remains an important challenge. This chapter describes combinatorial approaches to the characterization of enzyme specificity and identification of enzyme inhibitors or lead compounds by direct visual inspection of resin beads containing both a good substrate and a portion mixing llbrari of inhibitors (I). The catalytic site of proteolytic enzymes has traditionally been characterized through the use of small substrates that provide mformatlon about preference for certain amino acids in each subsite covered by the substrate. The enzyme reaction has been followed by determining the formation of cleavage products either by HPLC or by use of chromogenic substrates that change absorbance on cleavage. Alternatively, sensitive internally quenched fluorogenic substrates provided an efficient method for determination of the kinetic parameters (2). The most efficient quenched substrates were of the “long-range resonance energy transfer” type (3). The extent of quenching is dependent on the spectral overlap of the chromophores and only donor/acceptor pairs with complete overlap between emission and absorption are useful for quenching over long distances. In particular, the following pairs have been proven valuable: Abz/Dnp (2-aminobenzoyl/2,4-dimtrophenyl [4]), Edans/ Dabcyl (5(2’-aminoethyl)aminonaphthalene sulfonic acid/4-(4’-dlmethylFrom

Methods

m Molecular Bology, E&ted by S CablIly

vol 87 Combmatonal PeptIde 0 Humana Press Inc , Totowa, 51

Library NJ

Protocols

52

Me/da/

aminobenzeneazo) benzoic acid IS]), and the Abz/Tyr(NO,) (2-aminobenzoyll 3-nitrotyrosine [6]). Usmg substrates with many ammo acids between donor and acceptor it is possible to map all subsites of a protease with a series of single substitution analogs (100-200) to a good reference substrate (6). This approach frequently requires the synthesis of a large variety of different compounds, a laborious process, which in part has been circumvented by using solid-phase multiple synthesis techniques. The kinetic data obtained m this way are informative and provrde an accurate picture of the proteolytic activity with small substrates (7). However, there are two questions that may be raised concerning such results. First, the results will always be biased by the untial selection of the parent substrate and do not address the problem of nonadditrvity between subsrte activities (8). Second, the use of small substrates in pure enzyme-buffer solution may not reflect the sttuatton observed in viva in which tertiary structure, membrane environment, and cofactors may influence the activity and specificity of the enzyme dramatrcally For the complete analysis of proteolytic enzymes it is, therefore, important to investigate the enzymes with a combinatorial display of peptides from which the enzyme may itself select superior substrates Previously, when new enzymes were investigated for their substrate specificity, different proteins were first used as substrates to find possible cleavage sequences (9). Proteins display a small library of possible cleavage sites, and once a cleavage site has been identified by sequence analysis, small analog substrates can be synthesized to study the specificity m detail (7). This method is similar to the application of a large library of substrates from which the enzyme is allowed to select its preferred substrates. However, the resulting picture of the enzyme specificity is much more complete when a large nonbiased hbrary without any particular terttary structure is used. 2. The Use of Combinatorial Peptide to Analyze Enzyme Specificity

Libraries

Combmatorial displays of peptides may be generated as mixtures in solution or as libraries in which the substrates are linked to the solid phase The generation of a multitude of compounds IS most conveniently accomplished by sitedirected or compartmentalized synthesis. The PIN method synthesis on a matrix of polyethylene rods (IO), spot synthesis on paper (Chapter 4, ref. 1 l), and the lithographic light-directed synthesis on sihcon chips (12) are all site-directed synthesis protocols with a predetermined fixed number of compounds, whereas the T-BAG method synthesis on beaded resin compartmentalized in envelopes of polypropylene net (13) and multiple-column peptide synthesis (MCPS [14,15]) are compartmentalized synthesis protocols m which it is posstble to increase the diversity almost infmltely by portion mixing, 1.e , by poolmg, mixing, and redistributing the resin between coupling steps. The results obtained

lntroductlon to Sol/d-Phase Assays

53

with hbrarles from site-directed synthesis are easy to deconvolute from the knowledge of the synthesis protocol for each position, whereas portion mixing libraries have to be analyzed to be deconvoluted. In the case of resin-bound substrates, isolation and sequencing of the 30-50 most reactive substrates yields a statrstrcal drstrlbutron of preferences for particular types of ammo acids m each subsite of the enzyme. Some subsites may be completely specific for one or two, others for a range of hpophilic ammo acids, for example. Some subsites may be found to be essentially unspecific with all amino acids present (Id,1 7)

In contrast to other biomolecules that simply exert their action by binding a partrcular ligand (18), all enzymes are characterized by their conversion of a substrate mto a product and the study of this process requires information about the structure of both the substrate and product. This is true for all classes of enzymes. A proteolytic enzyme may cleave, e.g , an assembly of decapeptldes in solution, at several different posrtrons and it is not easy to align sequence data from such a cleavage mixture in a useful way. The application of a sohdphase assay using the portion mixing libraries, m which each bead contams a unique potential substrate, has allowed the enzyme reaction to be carried out simultaneously with each bead as a separate reactor for the enzyme reaction. The monitoring of an enzyme reaction on different substrates linked to resin beads requires an easy detection method, and one of the most versatile for the detection of proteolytic activity has been the use of substrates contaming a fluorescence donor and an acceptor, which quenches the fluorescence in a distance-dependent manner (3) By use of such quenched substrates, which has the fluorogenic probe attached to the C-terminal of the substrate where it IS covalently linked to the solid support and the quencher attached to the N-terminal end, the beads containing the most active substrates may be identlfied by visual inspection (16,19). The AbzlTyr(N0,) pair IS probably the most efficiently quenched at neutral or slightly basic pH, and this pair was selected for the convenient synthesis of quenched substrate libraries and for visualization in a fluorescence stereomicroscope of active substrates linked to the solid phase. Beads containing active substrates can be collected and analyzed by sequence analysis for their content of both substrate and C-terminal cleavage product. Sequence determination may be achieved by many different methods, ranging from conventional sequencing to various methods of mass spectroscopy to nuclear magnetic resonance (NMR) studies on single beads. Particularly useful are ladder sequencing (20,21) and ladder synthesis (22) in combmation with mass spectrometry. However, m our experience the most reliable method for peptide libraries is still Edman-degradation, which can be combined with determination of molecular mass by MALDI-TOF MS (matrix-assisted laser

54

Meldal

desorptlon lomzatlon time of flight mass spectrometry). Currently, the syntheSIS of protease substrate, inhibitor, and glycopeptide libraries, with capping m each couplmg step and C-terminal methionme for deconvolution and cyanogen bromide release (22), respectively, is under development m our laboratory. Using these methods m combmatlon with MALDI-TOF MS will facilitate the deconvolutlon process tremendously. The use of solid-phase assays, which are often employed for the mvestlgation of llgand-bmdmg proteins, has not previously been found to be useful m the characterlzatlon of enzymatic reaction specificity. This IS mamly because the enzyme performs a transformation of the binding substrate into a product and the study of this process requires the structural investigation of both the substrate and the product. When polystyrene-based resins or ELBA plates are used as the solid support, they are not permeable to the enzymes, and the enzymes have to perform their reaction catalysis on the surface accessible molecules. Only a small fraction of bound substrates (~0 3% on polystyrene-based resins) are exposed for cleavage (23), and the minute amounts of product formed make detection and structural analysis problematic.

3. Polyethylene

Glycol Polyamide

Copolymers

Recently new polyethylene glycol-based polymers with an open structure were introduced for solid-phase reactions with biomolecules (24-26). These polyethylene glycol polyamide (PEGA) copolymers are permeable to the enzymes including glycosyltransferases (27) and proteolytlc enzymes, which can enter into the gel-like polymeric network and perform their catalytic reactions on substrates linked to the solid phase The content of 90% PEG leads to high swelling potentials m most solvents ranging from toluene to water and the swelled resin appears as a firm, tense material (26) The apphcatlon of these new blocompatible polymers m portion mixing library solid-phase enzyme assays IS the basis of this chapter and Chapters 7-9. Enzyme inhibitor assays have traditionally been performed by allowmg putative inhibitors to compete with an enzyme substrate for binding to the active site of the enzyme. The requirement IS that the inhibitor IS not itself a substrate for the enzyme Often the mhlbltors used for inhibition of proteolytlc enzymes are compounds not related to peptldes or peptldes m which a substrate has been converted mto an inhibitor by converting the sclsslle peptlde bond into, e.g , reduced bonds, carbon-carbon bonds, or other modifications, which may even be transitlon-state analogs. The permeable PEGA resins have allowed this type of assay to be confmed to the volume of single beads and have thus opened the possibility of defining inhibitors for serme proteases by combinatorial approaches (I). Particularly useful is a new solid-phase mhlbltor assay m which each bead contains the same substrate and one unique putative inhibitor that

Introduction to Sol/d-Phase Assays

55

may or may not mhlblt the cleavage of the substrate. By this approach beads in which the enzyme remains inactive can be identified and the structure of the contained inhibitor analyzed. Owmg to the very small volume of a single bead the consumption of proteolytic enzyme per compound assayed IS very limited. The method can be used m an iterative process m which more effective inhibitors may be identified in secondary libraries. Once inhibitors are found their inhibitory activity must be confirmed by MCPS and assaying m solution. Libraries for solid-phase assays have been prepared for other types of enzymes such as cruzipain (cysteine protease [17]) and matrix metalloproteinases. References 1 Meldal, M and Svendsen, I. (1995) Direct vlsuahzatlon of enzyme mhlbltors using a portion mixing inhibitor hbrary containing a quenched fluorogemc peptlde substrate 1. Inhibitors for subtlllsm Carlsberg J Chem Sot Perkm Truns 1, 1591-1596. 2. Yaron, A , Carmel, A , and Katchalskl-Katzlr, E (1979) Intramolecularly quenched fluorogemc substrates for hydrolytic enzymes Anal Blochem 95, 228-235 3. Forster, T (1948) Intramolecular energy transfer and fluorescence, Ann Phys. 6, 55-75. 4. Juhano, L , Chagas, J R , Hlrata, I Y , Carmona, E., Sucuplra, M., Ohvelra, E. S , Ollvelra, E. B , and Carmago, A C M (1990) A selective assay for endoohgopeptldase A based on the cleavage of fluorogemc substrate structurally related to enkephalm Blochem. Biophys. Res Commun 173,647-652 5 Wang, G. T. and Krafft, G. A. (1992) Automated synthesis of fluorogemc protease substrates, design of probes for Alzhelmer’s disease-associated proteases Bzoorg Biomed Chem Lett 2,1665-1668. 6. Meldal, M and Breddam, K (1991) Anthramlamlde and mtrotyrosme as a donor acceptor pan m internally quenched fluorescent substrates for endopeptidasesmulticolumn peptlde synthesis of enzyme substrates for subtlhsm Carlsberg and pepsin Anal Blochem 195, 141-147 7 Gr@n, H , Meldal, M., and Breddam, K. (1992) Extensive comparison of substrate preferences of two subtlhsms as determined with peptlde substrates which are based on the principle of intramolecular quenching. Biochemzstry 31,601 l-601 8. 8 Gran, H. and Breddam, K (1992) Interdependency of the binding subsltes m Subtilism. Biochemzstry 31, 8967-897 1 9. Svendsen, I (1976) Chemical modiflcatlons of the subtllisms with special reference to the bmding of large substrates A review Carlsberg Res Commun 41, 237-29 1. 10. Geysen, H. M , Meloen, R. H., and Bartelmg, S J (1984) Use of peptlde synthesis to probe viral antigens for epitopes to a resolution of a single ammo acid Pm. Natl. Acad Scl USA f&3998-4002

56

Meldal

11 Frank, R (1992) Spot-synthesis-an easy technique for the positlonally addressable, parallel chemical synthesis on a membrane support Tetrahedron 48, 9217-9232 12 Fodor, S P A., Read, J L , Plrrung, M C , Stryer, L , Lu, A T , and Solas, D. (1991) Light-directed, spatially addressable parallel chemlcalClsyntheslsSclence 251,767-773 13 Houghten, R A (1985) General method for the rapid solid-phase synthesis of large numbers of peptldes Speclflclty of antigen-antibody mteractlon at the level of mdlvldual ammo acids Proc Nat1 Acad Set USA 82,5 13 1-5 135, 14 Holm, A and Meldal, M. (1989) Multiple column peptlde synthesis, m Pepllcles f988, Proceedings of the 20th European Peptide Symposmm, (Jung, G and Bayer, E eds.), Berlin, Walter de Gruyter, pp. 208-210 15 Meldal, M., Helm, C B , BoJesen, G , Jacobsen, M H , and Helm, A (1993) Multiple column peptlde synthesis, part 2(1,2) Znt. J. Pept. Protezn Res. 41, 250-260 16 Meldal, M , Svendsen, 1 , Breddam, K., and Auzanneau, F I (1994) PortIonmlxmg peptlde hbrarles of quenched fluorogemc substrates for complete subsite mapping of endoprotease speclflclty . Proc Natl. Acad. Scl. USA 91,33 14-33 18 17 Juhano, M A , Nery, E D , Scharfstem, J , Meldal, M , Svendsen, I , Walmsley, A , and Juhano, L (1997) Characterlzatlon of substrate speclficlty of the maJor cysteme protease (cruzlpam) from trypanosoma cruzl .I. Blol Chem., m press 18 Lam, K S , Salmon, S E , Hersh, E. M , Hruby, V J , Kazmlerskl, W M , and Knapp, R J. (199 1) A new type of synthetic peptlde library for identifying hgandbinding activity. Nature 354,82-84 19 Meldal, M. (1994) Multiple column synthesis of quenched solid-phase bound fluorogeruc substrates for characterlzatlon of endoprotease specificity. Method3 6,417-424. 20 Chalt, B. T , Wang, R , Beavls, R. C., and Kent, S B. H (1993) Protein ladder sequencmg. Science 262,89-92 21. Bartlet-Jones, M., Jeffery, W A , Hansen, H F , and Pappin, D. J C (1994) Peptide ladder sequencing by mass spectrometry usmg a novel, volatile degradation reagent Rapid Commun. Mass Spectrom. 8,737-742 22 Youngquut, R S , Fuentes, G R , Lacey, M P., and Keough, T. (1995) Generation and screening of combmatorlal peptlde llbrarles deslgned for rapid sequencmg by mass spectrometry J. Am Chem. Sot 117,3900-3906 23 Vagner, J., Krchnak, V., Sepetov, N F , Strop, P , Lam, K S , Barany, G , and Lebl, M. (1994) Novel methodology for dlfferentlatlon of “surface” and “mterior” areas of polyoxyethylene-polystyrene (POE-PS) supports. appllcatlon to library screening procedures, m Innovatcon and PerspectweJ rn Sol&d Phase Synthesis (Epton, R , ed ), Mayflower Worldwide Llmlted, Kmgswlnford, UK, pp 347-352 24 Meldal, M (1992) PEGA: A flow stable polyethylene glycol dlmethyl acrylamlde copolymer for solid phase synthesis Tetrahedron Lett. 33,3077-3080

Introduction to Solid- Phase Assays

57

25. Meldal, M , Auzanneau, F. I., and Bock, K. (1994) PEGA, Characterization and application of a new type of resm for peptide and glycopeptlde synthesis, m Innovatlon and Perspectives in Solid Phase Synthesis (Epton, R., ed.), Mayflower Worldwide Limited, Kmgswmford, UK, pp 259-266 26 Auzanneau, F I., Meldal, M , and Bock, K (1995) Synthesis, characterization and btocompattbibty of PEGA resms. J Pept. Scz. 1,31-44. 27 Meldal, M , Auzanneau, F.-I , Hmdsgaul, 0 , and Palclc, M M. (1994) A PEGA resin for use m soltd phase chemtcal/enzymatlc synthesis of glycopeptrdes J. Chem Sot. Chem. Common 1849.1850.

Preparation of Biocompatible for Library Syntheses

Resins

Marten Meldal 1. introduction The open structure of the blocompatrble polyethylene glycol polyamide copolymer (PEGA resin) IS presented in Fig. 1, exemplified by the applicatron of the commercrally available bn+2-ammopropyl-PEG,900. With the use of this PEGIgOa, permeability wrth proteins up to 50 kDa has been achreved, as demonstrated by gel permeation chromatography (I). A resin-bound fluoroescencequenched peptrde substrate showed 80% cleavage with subtrhsin Carlsberg (MW 27 kDa) m 1 h and the cleavage went to completion in -2 h. The resin could also be used for glycopeptrde assembly using bovine p-( l-+4)-galactosyl transferase (MW 43/49 kDa) to transfer galactose to the 4-posrtron of GlcNAc (2) In this example, the drffusron and reorientation of the enzyme inside the polymer network was a rate-hmitmg factor for the reactton, which could, however, be brought to completron in 72 h This indicates that the reaction was performed at the practical limit of protein size for preparative enzyme reactions in this resin. PEGA resins perform excellently in solid-phase assays of biomolecular reactions. Furthermore, they are transparent and no light IS absorbed above 250 nm, so they can be used with a variety of different chromophores and fluorescent probes for detection of bromolecular reactions.

2. Materials I

Polymers with longer crosslmkers, PEGdooO,PEGGoooand PEG,,,,, avarlable from Fluka as the underrvatized PEGS, have been prepared for the study of larger proteins in the mass range >-250 kDa (3). The PEGA resins can be prepared by bulk polymerization followed by grmdmg and srevmg of the polymer Into approprrately srzed partrcles or It can be polymerrzed m an inverse suspension polymerFrom

Methods

in Molecular &o/ogy, E&ted by S CablIly

vol 87 Combmatonal Pephde 0 Humana Press Inc , Totowa,

59

Library NJ

Protocols

60

Meldal

D~acryloyl

bts-aminopropyl

PEG

Monoacryloyl

bls ammopropyl

PEG

N-b+. SO4 )z SPAN 20 Heptane cc14 40

JNH, I

m

-90% Free

PEG

amino

group

Nl+

Ftg 1. Preparation of PEGA resin contammg PEG tam by the partial acryloylatton procedure.

lzation under zero gravity (see Note 1) condnions leading to uniformly sized beads (150-250 mm). 2 Various types of PEGA-supports have recently become available from Polymer Laboratories. The suspenston polymerizatton IS carried out m a relatively mexpensive glass reactor composed of a three-necked cylmdrtcal glass reactor with four longitudinal depresstons along the side and a stirrer with two sets of tilted parallel sturer blades as described by Arshady (4) 3 Bts-ammo-PEGS for the preparation of the crosslmker monomer are available m sizes up to MW 2000 (see Note 2), and longer bls-ammo-PEGS are most conveniently prepared by conversion of long-chain PEGS mto the bts-chloride, followed by substitution with potassmm phthaltmlde and treatment with hydrazme hydrate It is also possible to use sodium azrde as a nucleophile, but the subsequent reductton to amme IS more cumbersome and the process 1s not suited for large scale. Several kinds of PEGA polymers have been described (I), and for btochemical assays m water the best 1s a polymer obtained by partial acryloylatton (0 4-O 5 Eq per - NH2) of the brs-ammo-PEG and mixing the monomers with 5-10 weight % acrylamide The synthesis of bls-ammo-PEG IS exemplified with PEG,,,, and polymertzations with PEGA1aaO for library work (1,3)

61

Biocompa tible Resms 3. Methods 3.1. Preparation of Amino Polyethylene Glycols 3.1.1. Preparation of bis-Chloro-Polyethylene Glycol6000

(1)

1. Melt 50 g (8.3 nmol) PEG6aa0 b y heating in an oil bath at 100°C followed by dropwise additron of thronyl chloride (3.65 mL, 50 mmol) within 30 mm 2. Stir the reaction mixture at 100°C overnight, and then cool to room temperature 3 Place the reaction mixture m an ice bath and slowly add 200 mL drethylether with rapid sturmg for 15 min. The product, his-chloro-PEG, precipitates 4 Filter the precipitate, wash rt with ether, and dissolve in 50 mL dichloromethane (DCM). 5. Remove some of the DCM zn V~CUO and repreclpltate the bib-chloro-PEG with ether. 6. Filter the precipitate, wash rt with ether, and dry UI wcuo to give one (46 g 92%). r3C NMR at 75 MHz, (CDCl,): 42 6(Cl-CH,-CH2-), 71 3 (Cl-CHz-CH2-) For PEG&rating material 61 .7(HO-CH2-CHz-), 72 S(HO-CH2-CH2-)

3.1.2. Bis- Ph thal/mido- Polye thylene Glycol6000

(2)

1 Suspend 22g (3.7 mmol) bls-chloro-PEG,,a and 20.5 g (56 7 mmol) potassium phthalimide in 60 mL dry DMF (NWdimethyl formamide). 2 Slowly heat the suspension to 5O”C, add 150 mg tetradecyl trlmethylammomum bromide, and heat the mixture to 110°C m an argon atmosphere for 4 h 3. Filter off the precipitate and slowly add ether to the clear filtrate with sturmg. Then, stir for another 30 min m an ice bath after the preclprtatlon 1s completed. 4. Filter the preciprtate and wash rt with ether. 5 Dissolve the precipitate m 60 mL DCM. 6 Filter off the insoluble impuritres and concentrate the filtrate. 7. Precipitate the resulting Bzs-phthabmzdo-PEG from the DCM solution by addition of ether 8. Filter the Bwphthalimzdo-PEG/ether mixture and wash the precipitate with ether 9. Dry the PEG-phthalrmlde wz vacua to yield two (20 g, 90%) 13C NMR at 75 MHz, (CDC13)* 37.1 (Pht-N-CH,-CH,-), 67.8 (N-CH,-CH,-), 133.8 (Pht), 132.0 (Pht), 123 1 (Pht), 168 1 (C=O)

3.1.3. Bis-Am/no-Polyethylene

Glycoi 6000 (3)

1 Heat under reflux 41 g (6 6 mmol) bls-phthahmldo-PEG and 20.5 mL (414 mmol) hydrazme hydrate (4 14 mmol) in 150 mL absolute alcohol for 12 h. 2. Cool the reaction mixture to room temperature, then filter off the insoluble rmpurules and wash the filter with DCM. 3. Concentrate the filtrate and precipitate the product by addmon of ether in an ice bath 4. Filter the precipitate, redissolve the precipitate in 60 mL DCM, and remove the msoluble lmpurmes by filtration

62

Me/da/

5 Concentate the f&rate and slowly add ether to precipitate the &s-amino-PEG product 6. Filter the product, wash, and dry in vucuo to yteld 36 g of 3 (90%) t3C NMR at 75 MHz, (CDCI,). 41 8 (NH*-CH,-CH2), 73.5 (NH*-CH2-CH2-).

3.2. Monomer

Preparation 3.2.1. Synthesis of Parlrally

and Polymerization Acryloylated

Partially acryloylated PEG IS prepared polymerization apparatus.

(AC&

77 PEG,,,,

to be used directly

in an 850-mL

1 Add dropwrse a solutton of 1.8 mL acryloyl chlortde (0.39 Eq per -NH2 group) m 30 mL DCM to a solutton of 58 g PEG 19oo(29 mmol) m 40 mL DCM whtle starring at 0°C 2 Incubate the reactton mixture for 1 h at 20°C 3 Concentrate the reactton mtxture Concentration of the reactron mixture gives a crude (Acr),, 77-PEG,900 as an opalescent colorless stocky 011 4 Use the same procedure to prepare partially acryloylated polymers of PEG4ac0, PEGGOOO,and PEGSOOO

3 2.2. Polymerization Procedure Using a Suspension Polymerization Apparatus 1 Purge a mixture of N-heptane-carbon tetrachlorrde (6 4, v/v, 470 mL or 138 mL) with argon for 5 mm m the polymertzatton flask (850 mL) 2. Warm up the solutton to 70°C (gee Note 3) and adJUSt the sturmg speedto 1000 rpm (see Note 4). 3 During this period, purge a mixture of the 60-g parttally acryloylated PEG monomet-/95ml water wtth argon. Add 10 g acrylamtde, and after a further 5 mm of purgmg, add to the mtxture of monomers a solutton of sorbttan monolaurate m 2 5 mL DMF and a solution of 750 mg ammonmm persulfate m 2.5 mL water Rapidly pour the mixture mto the polymertzatton flask and leave rt for 2 mm 4 Add 2 mL TEMED (N,N,N’,N’,-tetramethyl ethylene diamme), and a stocky point 1sreached wtthin 30 s 5 After about 5 more mm, resuspendm the reactton mtxture Someof the resm will accumulate at the top of the polymerlzatlon flask durmg the sticky pertod This IS resuspendedby stnrmg at 1500 rpm and then allowing the reaction to proceed under 1000 rpm, stnrmg at 70°C for 3 h 6. Allow the resin to cool. 7 Filter off the resm, washtt twice wrth ethanol, then wtth water, and passtt through a steel mesh(l-mm* holes) (seeNote 5) 8 Transfer the resm back to the filter, wash twice with 2 vol ethanol, and dry successtvely under low vacuum (water pump) and htgh vacuum (lyophtlyzer) for a period of 2 d

Blocompa tible Restns

63

9 Use the same procedure to prepare polymers contammg PEG,,,,, PEG6sa0, and PEGsma (some dtfftculttes might occur when polymers contammg PEG,,,, are prepared)

3.23. Estimation of Polymer Supported Amino Group by the Fmoc Release Method 1. Take 50 mg of dried ammo resin m a plastic syringe and swell rt m DMF 2 Filter off excess DMF Add 10 mg Dhbt-OH (3,4-dlhydro-4-oxoI ,2,3-benzotrtazo-3-yl-OH) and 35 mg Fmoc-Gly-OPfp (fluorene-9-ylmethyloxycarbonyl-Gly-0-pentafluorophenyl) dtssolved m 1 mL DMF. Incubate for 30 mm. 3 Filter the resm and wash 3X wrth 1 mL DMF, twrce wtth 1 mL 5% DIPEA-DMF, 3X with 1 mL DMF, and 3X with 1 mL DCM 4 Dry under vacuum for 6 h. 5 Accurately weigh 5-10 mg dry resin mto a plastic tube, add 6-10 mL 20% prperrdme m DMF, and mrx 6 Measure the OD of the solutton at 290 nm The ammo group capacity can be determmed from a standard curve

4. Notes Zero gravity IS ensured by adjustment of the density of the organic phase by addition of tetrachloromethane tf the aqueous phase 1s smkmg and hexane d tt IS floating The final swellmg of the resm IS dependent on the drstrrbutlon of chain length m the commerctal starting PEG polymer. Broad drstrlbuttons result m less swelling The temperature must be kept close to 70°C m order to avord agglomerates of beads. The size and size drstrrbutron of beads are very dependent on the exact order of events, amounts of reagents, strrrmg, temperature, and geometr;’ of the polymerrzer If small beads are formed they can be removed by srevmg through a 200-mm steel mesh.

References 1 Auzanneau, F I , Meldal, M , and Bock, K (1995) Synthesis, characterlzatton and biocompattbrltty of PEGA resms. J. Pept. Sci. 1,31-44 2 Meldal, M., Auzanneau, F -I , Hmdsgaul, 0 , and Palctc, M M (1994) A PEGA resin for use m solid phase chemlcal/enzymattc synthesis of glycopepttdes J Chem Sot Chem Commun. 1849,185O 3 Renil, M. and Meldal, M (1996) The Influence of PEG-crosslmkers on permeable PEGA-resins for large btomolecules J. Pept Scl., to be submitted 4 Arshady, R (1991) Beaded polymer supports and gels J. Chromatogr 586, 181-197

Intramolecular Fluorescence-Quenched Substrate Libraries Morten Meldal 1. Introduction As described in Chapter 6, the most versatile fluorescence-quenched pan with respect to both ease of synthesis and efficiency of energy transfer IS the Abz/ Tyr(3-NO,) pair (2-ammobenzoyl/3-nitrotyrosme). The synthesis of the surtably protected buildmg blocks that can be used m a flexrble way m multrple-column peptide synthesis (MCPS) mvolves the preparation of Fmoc-Tyr(NOJ-OH (fluorene-9-ylmethyloxycarbonyl-Tyr(NO,)-OH) and Fmoc-Lys(Boc-Abz)OPfp (Fmoc-Lys(tert-butyloxycarbonyl-Abz)-O-pentafluorophenyl ester) as described (m Subheadings 2.2.1,2.2.4.). The Fmoc-Tyr(NOJ-OH can be activated zn sztu since protection of the acidtc phenol IS drffrcult and any acylatron of the nitrotyrosme side-chain during syntheses 1s completely reverted m the subsequent treatment with prperrdme. The MCPS 1s particularly useful for portion mixing since all that IS needed is to add a mixing chamber above the open columns of the synthesizer. A detailed procedure for the synthesis of a fluorescence-quenched substrate library IS described below and demonstrated for the serme protease subtiltsm Carlsberg substrate with the structure H-Y(N02)X’X2PX3X4X5K(Abz)-(PEGA) where X can be any of the 20 naturally encoded ammo acids. Prolme has been inserted to direct the cleavage since prolme IS only accepted m S,; however, rt 1s not a requrrement to dnect the cleavage and subsequent substrate libraries have been randomized m all positions It is important to compare the results obtained by the library assay with those found in solutron assays with soluble substrates. Such results may present minor drfferences m certain subsites as rn the case of P2’ with subtrlism From

Methods

m Molecular B/o/ogy, vol 87 Combmafonal Pepfrde Edlted by S CablIly 0 Humana Press Inc , Totowa,

65

Ljbrary NJ

Profocots

Meldal

66

Carlsberg, where valme gives the fastest reaction in solution whrle glutamic acid IS preferred in the solid-phase assay, although valines were found among the fastest reactions even in the beads. This contradictron indicates that behavior of the enzyme may depend on the mrcroenvironment, e.g., membranes, cofactors, and so forth. The soluble substrates are most conveniently synthestzed by multiple-column peptlde synthesis as described m Subheading 3.4. (I).

2. Materials 2.1. General 1 Mtxmg of resm IS achteved etther by nitrogen bubbling or by mechamcal shakmg 2 A sample manual ltbrary synthesizer has been descrtbed prevtously m detail (2) It IS composed of a cylmdrrcal Teflon reactor wtth 20 columns and a resm-mtxmg chamber above Two washmg heads wrth 20 outlet tubes connected to drspensmg bottles delrver (DMF) and prpertdme, respecttvely, and are mounted on a metal frame A sealed lid IS fitted at the top of the reactor with an 0-rmg when the

hbrary IS turned upside down for resm mixing on a mechanrcal shaker Reagents

3

4.

5. 6.

are removed from the bottom of the reactor by applying a vacuum to the column outlets. A sample and mexpensrve alternatrve IS a series of 20 syrmge synthestzers connected to a vacuum waste flask via manual two-way valves and Teflon tubmg (3), m this case the resin must be mechamcally transferred to a bottle for mixing between couplmg steps The most versatile chemistry for the constructron of libraries IS the use of preformed Fmoc-ammo acid-OPfp ester (4,5) building blocks since these are stable m DMF solutron at -20°C for the period of a complete synthesis, and stock solutions can be made. Furthermore, addition of catalysts, such as Dhbt-OH (3,4dlhydro-4-oxo- 1,2,3-benzotrrazo-3-yl-OH), HOBt (1 -hydroxybenzotrrazol), or HOAt (7-aza-I -hydroxybenzotrrazol) readily converts the Pfp-ester into hrghly reactive intermediates The couplmg of single nonacttvated ammo acid derivatives, such as the FmocTyr(NO,)-OH, IS conveniently performed by the zn sztu procedure using TBTU (0-benzotrrazo-1 -yl-N,N,N’,N’-tetramethyl uromum tetrafluoroborate, [6]) Reagents are purchased from Bachem (Bubendorf, Switzerland), Novabrochem (Bad Soden, Germany), or synthesized as described in Subheadings 2.2.1,2.2.4. Preparatron of btocompattble polyethylene glycol polyamide copolymers (PEGA resin) IS described m Chapter 7

2.2. Preparation

of Fluorogenic

Building

Blocks

2 2.1. Synthesis of 2-tert -9utyloxycarbonylamlno 1, Drssolve the followmg

reagents m 50 mL DMF

Benzoa te

5 1 6 g BoczO (236 mmol), 25 9

g anthranrhc acrd (189 mmol), and 50 mL trrethylamme few minutes gas evolutron IS commenced at 20°C until the gas evolution 1s ceased

(360 mmol). Within a

Leave the mixture for a pertod of 24 h

IM Fluorescence-Quenched

Llbranes

67

2 Verrfy that the reaction 1s completed using thm layer chromatography on srhca gel plates (TLC) by elutron with ethyl acetate (EtOAc). 3 Treat the mrxture wrth charcoal and filter through celrte that has been rinsed wrth DMF. 4. Remove all the DMF WIVQCUOat 30°C. 5. Dtssolve the residue m water and acrdify the solutron to pH 2.0 with crtrrc acid 6 Extract the product with 2X 200 mL drchloromethane. 7. Extract the combined organic phase 3 times with 100 mL water 8. Dry the organic phase wrth filtered sodrum sulfate, filter, concentrate, and drssolve m 100 mL of drethyl ether 9. Add petroleum ether until the product, 2-tert-butyloxycarbonylammo benzoate, IS crystallized and filter off the product. 10 Recrystallize the crude material from 50% aqueous ethanol to give 35 g (8 1%) of pure Boc-anthramlrc acid, mp 149-150°C ‘H-NMR at 500 MHz (CDCI,) ppm (J Hz), Boc, 1 54, H3,8 11 (7.7), H4,7 57 (7.7,7.5); H5,7 04 (7 5,8 4), H6,8 48 (8 4); Boc, 1 55; COOH, 10 02

2.2 2. Synthesis of 3,4-Dihydro-4-oxo-7,2,3-Benzotriazol-3-y/ 2-tert-Butyloxycarbonylamino Benzoate (Boc-Abz-ODhbt) 1 Dissolve 2 37 g 2-tert-butyloxycarbonyl ammobenzorc acrd (10 mmol) m 15 mL of DCM and 5 mL of tetrahydrofurane (THF) 2. Cool the mixture to -5°C and add 2 06 g (10 mmol) DCCI (N,W-dicyclohexyl carbodumtde) 3 After 5 mm add 1.63 g (10 mmol) Dhbt-OH, and star the mrxture at -5°C for 1 h and then at 4°C for 16 h. 4 Alter the reaction mrxture and remove the solvents zn uacuo 5 Crystallize the product by addition of 30 mL drethyl ether. 6. Filtration affords 3 7 g (97%) Boc-Abz-ODhbt, which ISpure according to HPLC. mp 155-156°C ‘H-NMR at 500 MHz (CDCls). ppm (J Hz), H3,8.48 (7 7), H4, 7.72 (7 7,7.4), H5,7 I9 (7.4,7 8); H6,8.61 (7.8); H5’, 8.32 (7 4); H6’, 8 10 (7.4, 7.7, 1.2), H7’, 7 93 (7 7,7 8), H8’, 8.42 (7 8, 1.2), Boc, 1 52, NH, 9.58

2.2.3. Syntheses of N”-(Fluoren-9-yl-Methoxycarbonylj-NE-(2-tertButyloxycarbonylamino Benzoyl) L-lysine Pentafluorophenyl ester (Fmoc-Lys(BocAbz)-OPfp) 1 Dissolve 2.0 g Fmoc-Lys(Boc)-OH (4.27 mmol) m 20 mL TFA (trrfluoro acetic acid), concentrate the solution, and lyophrllze 2. Drssolve the resulting or1 in 10 mL DMF and add to rt a solutron made of 1 63 g Boc-Abz-ODhbt (4 27 mmol) and 5.4 mL NEM (4-ethyl morpholme) (42.7 mmol) m 20 mL DMF. 3 Stir the solutron at room temperature for 1 h, then keep overnight at -20°C 4. Concentrate the solutron and purify the Fmoc-Lys(BocAbz)-OH by VLC (vacuum lrqmd chromatography) using frrst, light petroleum ethyl acetate

68

Meldal

1 1 (500 mL), then hght petroleum ethyl acetate acetic acid 10.10 1 to yield the free acid (2 02 g, 81%). 5. Dissolve 1 28 g of Fmoc-Lys(BocAbz)-OH (2 19 mmol) and 0.40 g Pfp-OH (2 19 mmol) m 5mL THF, cool to 0°C 6 Add 0 45 g (2 19 mmol) DCCI and stir the solution at 0°C for 1 h, then leave at -20°C overnight 7 Filter the reaction mixture, concentrate, and purify by VLC (light petroleum ethyl acetate 4 1) to yield the Fmoc-Lys(BocAbz)-OPfp, ‘H-NMR at 500 MHz (CD(&) 1.51 (9 H, s, Boc), 1 55 (2 H, m, H,), 1 72 (2 H, m, Hd), 1 93 (1 H, m, Hb), 2.08 (1 H, m, Hi,), 3 45 (2 H, m, H,), 4 20 (1 H, t, Fmoc), 4 35-4 47 (2 H, m, Fmoc), 4.73 (1 H, m, H,), 5 49 (I H, d, NH,), 6.41 (1 H, t, NH,), 6 91 (lH, t, Abz), 7 28 (2 H, t, Fmoc), 7 34-7.41 (5 H, m, Abz and Fmoc), 7 56 (2 H, d, Fmoc), 7.75 (2 H, d, Fmoc), 8.32 (lH, d, NH,&

22.4. N”-Fluoren-Bylmethyloxycarbonyl-3-Nitrotyrosine Dissolve 3 39 g H-Tyr(NO,)-OH (15 mmol) m 50 mL water containing 3 98 g sodium carbonate (38 mmol) and 20 mL dioxane. Dissolve 5 20 g of Fmoc-OSu (15 5 mmol) m 20 mL dioxane and add it dropwise at 0°C to the H-Tyr(NO,)-OH solution from step 1 Stir the mixture for I h at O’C and 3 h at 20°C Remove the dioxane zn vacua and dilute the residue to 50 mL with water Extract the byproducts with diethyl ether and acidify the solution with citric acid Collect the precipitate by filtration and dry tt Extract the product with ethyl acetate, filter off msoluble material, and crystallize it by adding -3 vol petroleum ether and coolmg Collection of the crystallme material by filtration and washing with petroleum ether affords 6.09 g of product (91% yield) mp 145-148, ‘H-NMR at 500 MHz (CDCl,) ppm (J Hz), 01-H, 10 52; H2,4 ‘72 (5 0,6 0,7 0 Hz), H3,3 12 (13 5,6 0), H3’, 3 26 (13 5,5 0); H5,7 96, H5’, 7 35 (8.0); H6’, 7.12 (8 0), Fmoc, 4 24 (6 5); 4 45 (6 5, 10.5), 4 54 (6 5,lO 5), 7.37 (7 0), 7 44 (7.5,7 0), 7.54 (7 5,7 5), 7 81 (7 5)

3. Methods

3.7. Library Synthesis 3.1.1.

Preparation

The following

of Substrate procedure

Libraries

demonstrates

H-Y(N02)XLX2PX3X4X5K(Abz)-(PEGA) procedure

can be applied for any proteolytic

by Portron synthesis

Mixing

of the substrate

library

for subtihsin Carlsberg. The same substrate

1 Swell 3 g (0 23 mmol/g) PEGA,sea (see Subheading transfer it to the multiple-column library generator

library. 2.1., step 6) m DMF and


Llbrar\es

69

2. Add to each column 40 mg Fmoc-Lys(BocAbz)-OPfp (0 051 mmol) and 8 mg Dhbt-OH (0.050 mmol) m 700 FL DMF. Leave for 3 h 3 Remove the reagents and wash the resin with 6X 16 mL DMF and then with one ~0120% prperidine in DMF. 4 Treat the resin wrth 20% prpertdme for 20 mm and wash wrth 8X 16 mL DMF 5. Add to each column 3 eq of the 20 Fmoc-ammo acid-OPfp esters and 8 mg DhbtOH in 700 FL DMF, respectively 6 Gently agitate the synthesizer for 3 h. 7 Wash and deprotect the resin as described m steps 3 and 4 8 Wash the resin with 6X I6 mL DMF and add 50 mL DMF to cover the columns as well as one-third of the mrxmg chamber. 9 Frt the closed lid, turn the synthesizer upside down, and agitate tt vrgorously (see

Note 1) 10 Mount the synthesrzer on a mechanical shaker and agitate it for a further 30 mm 11 Turn the synthesizer upright, open it, and empty by suctton. 12 The resin is now evenly dtstributed among the columns Remove the DMF and wash the resm twrce wtth 16 mL DMF 13. Repeat twice the couplmgs of the 20 mdrvidual ammo acids, by repeating the aforementioned process of ammo acid couplmg, deprotectton, and mtxmg 14 Couple the resin m all the columns with 52 mg Fmoc-Pro-OPfp (0 10 mmol) and 16 mg Dhbt-OH (0 10 mmol) 15 Wash, deprotect, and remove the reagents. Then, wash the columns again with 8X 16mLDMF 16 Dissolve 3 eq (0 10 mmol) of the 20 mdtvtdual Fmoc-ammo acid-OPfp (or -0Dhbt m the case of Ser and Thr) esters and 16 mg (0 10 mmol) Dhbt-OH m 700 PL DMF and add tt to the 20 wells of the library synthesizer 17 Gently agitate the synthesizer for a period of 3 h, wash the resm wrth DMF, and deprotect as descrrbed m steps 6 and 7 18 Wash the resin 6X 16 mL DMF, fill the synthesizer with 50 mL of DMF, and close with a hd sealed with an O-ring 19 Turn the synthesizer upside down, vtgorously agitate it for 2 min, and agitate for another 30 mm with a shaker 20 Deprotect the resin as descrtbed above and perform two cycles of coupling with 20 Fmoc-ammo acid-OPfp esters, deprotectron, and mixing 21. Dissolve 1024 mg Fmoc-Tyr(NOJ-OH (2.3 mmol) m 14 mL DMF, add 0.731 mg TBTU (2 3 mmol) and 287 pL NEM (2.3 mmol) (see Note 2) Leave for 10 mm 22 Distribute the mixture equally between the 20 columns of the synthestzer 23 After 2 h remove the reaction mrxture and wash the columns with 8 vol DMF and 8 vol DCM 24 Transfer the resin to a glass vessel and dry rt 25 Deorotect the oeottde hbrarv with 95% TFA for 15 mm.

Melclal 26 Remove the TFA, wash the resm with 95% TFA, and treat it for 2 5 h with 95% TFA 27 Wash the peptlde library successively with 95% acetlc acid, DMF, 5% dllsopropylethylamme (DIPEA) m DMF, DMF, and DCM 28. Dry the resin on a lyophlhzer before commencmg the enzyme assays. 3.2. Enzyme

Assays

The enzyme reaction is carried out in a tube at lo-fold the enzyme concentration required for the solution assays to compensate for general decrease In rate of reaction imposed by the gel matrix. The single beads may be collected and the reaction quenched during the progress of enzyme reaction as they reach an intermediate level of fluorescence. However, it is much preferred to allow the enzyme reaction to progress for an appropriate period of time and then to quench the reaction m the entire library. The degree of conversion in the individual bead is then a semiquantltatlve estimation of the substrate reactivity. The solid-phase substrate library assay is illustrated for subtilisin Carlsberg and a similar study has been performed with the much more specific enzyme cruzlpam isolated from the parasite trypanosoma Cruzi (7). The increased specificity IS clearly reflected in the result of the solid-phase assay. 3.2.1.

Substrate

Library

Assay

1 Treat 300 mg of the swelled PEGA-bead library with the chosen enzyme usmg appropriate enzyme condltlons For example, when subtihsin Carlsberg IS used, 5 x 10m7M of the enzyme is incubated for 45 mm m the presence of 50 mM blcme, 2 mA4 CaCI, at pH 8 5 2 Stop the enzyme reaction (for example, 2% TFA IS used to quench subtlhsm Carlsberg and then the mixture IS neutralized with sodium hydrogen carbonate) 3. Wash the resm with water, pH 8 5. 4. Pick up from the slurry of resin m water 0.75 mL (-70,000) beads and spread them m the center of a glass plate 5 Using fluorescence microscopy (excltatlon 320 nm, emlsslon 420-500 nm), pick up the most fluorescent beads, appearmg with a broad rmg of fluorescence around a darker nucleus, and transfer them to a dry area m the glass periphery 6 Collect the mdlvldual beads with a dry glass rod (see Note 3) and transfer them to a sequencing filter for sequence analysis 7 Sequence analysis yields the complete peptlde sequence as well as the C-terminal part of the cleaved peptide still attached to the resin The C-terminal sequence rndlcates the site of the cleaved bond. 8 The conversIon per minute IS calculated as an approximate rate of hydrolysis for each substrate 9 An example of isolated substrates, indicating a statistical preference dlstrlbutlon between permitted ammo acids for each subslte of the enzyme cavity, 1spresented


Libraries

71

10 1’ 5

0 ACDEFGHIKLMNPQRSTVWY

Fig. 1. The distribution of amino acids in the respective subsites of subtilisin Carlsberg. Particular important subsites are S4 where only lipophilic amino acids are accepted and S 1 where Leu and Phe are preferred. S3 is not selective. S 1’ prefers small polar amino acids, and S2’ prefers a glutamic acid. in Fig. 1. The most active substrates (pH 5.2) and Y(NO,)LGPFNEK(Abz) studies in solution (8).

3.3. Peptide Sequencing on Single Beads

in this case are Y(NO,)FQPLDVK(Abz) (pH 8.5), both in agreement with previous

of Abz/Tyr(3-NO,,)

Substrates

I. Sequence analyses by Edman-degradation is suggested to afford a good signal to noise ratio using large beads (250-400 pm diameter). The beads are directly placed on a sequencing filter and inserted into the amino acid sequencer. Both the nitrotyrosine and the 2-amino benzoic acid are quantitatively released in the first cycle of Edman-degradation and analyzed. When no other amino acid is detected a cysteine is assumed. Repetitive yield of detected amino acids decreases with the cycle number in spite of the fact that the substrates are bound to the solid phase. From the ratio of X1 and X5 in the second cycle it is possible to generate a semiquantitative estimate of the enzymatic conversion obtained for each substrate as a function of the time of reaction. At least 5% of cleavage is required for the determination of the cleavage site (1,2).

3.4. Confirmation of Substrates

of the Results

by Multiple-Column

Synthesis

3.4.1. MCPS of Model Substrates by Substitution of Y(NO,)FQPLDEK(ABz)GD (see Table 1) 1. Pack 30 mg PEGA-resin (0.19 mmohg) already derivatized with hydroxymethyl benzamide and esterified with Fmoc-Asp(tBu) into each column of a 96-column Teflon synthesis block containing PFTE (polyfluorinated polyethylene) filters at the bottom.

Meldal

72 Table 1 Kinetic Data on Cleavage at pH 8.5

of Selected

Substrates

in Solution

kcatKn

Compound 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

Sequence Y(NO,)FQPLDEK(Abz)GD Y (NO,)MQPLDEK(Abz)GD Y(NO,)YQPLDEK(Abz)GD Y(NO,)VQPLDEK(Abz)GD Y(NO,)IQPLDEK(Abz)GD Y(N02)FRPLDEK(Abz)GD Y (NO,)FVPLDEK(Abz)GD Y(NO,)FTPLDEK(Abz)GD Y(NO,)FQALDEK(Abz)GD Y(NO,)FQRLDEK(Abz)GD Y(NO,)FQLLDEK(Abz)GD Y(NO,)FQKLDEK(Abz)GD Y(NO,)FQELDEK(Abz)GD Y(NO,)FQFLDEK(Abz)GD Y(NO,)FQPADEK(Abz)GD Y(NO,)FQPLAEK(Abz)GD Y(NO,)FQPLDVK(Abz)GD Y(NO,)FQPLDDK(Abz)GD Y(N02)IAPLATK(Abz)GD Y(NO,)LQPASEK(Abz)GD

mk-‘mm-’

32,000 11,000 7400 3800 4100 83,000 3 1,000 35,000 290,000 45,000 22,000 130,000 620 930 1300 220,000 200,000 16,000 210,000 8400

2 Synthesize the substrates in 22 of the columns simultaneously with other unrelated synthesis m the residual 74 columns 3 Deprotect the resin m the 96 colums with 40 mL of 20% pipertdme m DMF for 1.5 mm and wash successively with DMF (3X 4.5 mL), Dhbt-OH m DMF (300 mg, in 40 mL), and DMF (3X 45 mL) 4. Dissolve Fmoc-Gly-OPfp (8 mg, 3 Eq/column) and Dhbt-OH (3 mg, 3 Eq/ column) m DMF (300 l.tL/column), then add the mixture to the resm. 5. Leave the reaction for a period of 2 h with agitation, and remove the reagents by suction 6 Deprotect and wash the resin as described m step 3 7 Dissolve Fmoc-Lys(Boc-ABz)-OPfp (13 mg, 3 Eqkolumn) and Dhbt-OH (3 mg, 3 Eq/column) m 300 pL DMF, then add the mixture to the resin 8. Leave the reaction for a period of 18 h with agitation, then remove reagents by suction. 9 Repeat the cycle of washing, deprotectlon, and coupling as described above for Fmoc-Gly-OPfp using the appropriate Fmoc-ammo acid-OPfp esters according to the identified substrate sequences


Libraries

73

10. After the last coupling-deprotectton-washing cycle activate 735 mg (1 64 mmol) Fmoc-Tyr(NOz)-OH for 15 mm at room temperature with TBTU (526 mg, 1 64 mmol) and NEM (205 pL, 1 64 mmol) m 30 mL DMF Then, add the solution to the resm Leave for 24 h 11. Remove the reagents by suction, wash the resin with 6X 45 mL DMF, deprotect with 2X 40 mL 20% ptpertdme in DMF (2 mm and 15 mm), and then successively wash with 6X 45 mL DMF and 5X 45 mL DCM. 12. Dry the resin under high vacuum. 13. Treat the resm with 95% aqueous TFA for 2 h Then remove the TFA by suctton 14. Wash the resin with 6X 45 mL DCM, and then 3X 45 mL DMF, and neutralize with 2X 40 mL 2% ptpertdme in DMF. Fmally, wash the resin with 6X 45 mL DMF and 6X 45 mL DCM 15 Dry the resin zn vacua. 16 Cleave off the peptldes with 0 1M NaOH solutton 350 pL/column for 2 h. 17 Elute the product from the column and neutralize wuh O.lM HCI 18. Dissolve the peptides m a small amount of DMF and purtfy by HPLC

3.5. Enzyme Hydrolysis Use the enzyme and a variety of peptide substrate concentrattons to determine the kinetic profile of hydrolysis of each of the selected substrates (an example IS shown m Table 1). 4.

Notes

1 It is important to ensure extensive mixing between couplmg steps by both mtenstve manual shaking as well as prolonged mechamcal shaking 2. If Boc-Tyr(3-N0.J IS used for the final couplmg the library must be treated with piperidine after the final TFA treatment to revert stde-chain acylatton 3 The beads contam different substrates and are usually not quenched to the same extent It therefore takes practice to dtfferenttate beads that are less well quenched from active beads. The active beads appear wtth an tlluminated rmg-shaped periphery in contrast to less well quenched beads, whtch are uniformly tllummated

References 1 Meldal, M , Svendsen, I , Breddam, K , and Auzanneau, F I (1994) Porttonmixing peptide libraries of quenched fluorogemc substrates for complete subsite mapping of endoprotease specificity. Proc. Natl. Acad. Scz. USA 91,3314-3318 2 Meldal, M (1994) Multtple column synthesis of quenched solid-phase bound fluorogemc substrates for charactertzatton of endoprotease spectfictty Methods 6,417-424. 3 Peters, S , Meldal, M , and Bock, K (1996) Recent development m glycopeptrde synthesis, in Modern Methods in Carbohydrate Syntheses (Khan, S H., O’Netll,

R. A., eds ), Harwood Academic Publishers, Amsterdam, pp. 352-377

Meldal 4 Dryland, A and Sheppard, R C (1988) peptide synthesis Part II. A system for continuous flow sohd phase peptlde synthesis using fluorenylmethoxycarbonylammo acid pentafluorophenyl esters Tetrahedron 44,859-876 5. Klsfaludy , L and Schon, I. (1983) Preparation and applications of pentafluorophenyl esters of 9-fluorenylmethyloxycarbonyl amino acids for peptide synthesis Synthesis 325,326. 6 Knorr, R , Trzeclak, A., Bannwarth, W., and GIllessen, D (1989) New coupling reagents m peptlde synthesis Tetrahedron Lett. 30, 1927-l 930 7. Juhano, M A , Nery, E D , Scharfstem, J , Meldal, M , Svendsen, I., Walmsley, A., and Juhano, L (1996) Characterization of substrate speclficlty of the maJor cysteine protease (cruzlpam) from trypanosoma cruzl .I. Blol. Chem , m press 8 Grpm, H , Meldal, M , and Breddam, K. (1992) Extensive comparison of substrate preferences of two subtdlsms as determined with peptlde substrates which are based on the prmclple of mtramolecular quenching. Bcochemutry 31,601 l-60 18.

9 The Solid-Phase

Enzyme Inhibitor

Library Assay

Morten Meldal 1. Introduction Synthesis of a portion mixing library of putative inhibitors in a resin already containing a good fluorescence-quenched substrate, which may have been defined with substrate libraries as described in Chapter 8, provides a method for direct detection of inhibitory activity (1). Beads containing potential inhibitors remained dark while enzyme cleaved the substrate in beads containmg noninhibitors, resulting m a dramatic increase m fluorescence. The dark beads can be collected and analyzed by sequence analysis. The o-amino acids are usually not accepted in the PI subsite. It is therefore reasoned that incorporation of a single o-ammo acid in the center of an L-amino acid sequence m a portion mixing library would yield a set of compounds that would be likely to show some inhibitory activity. A beaded PEGA-resin is substituted with a mixture of Fmoc-Lys(Boc)-OH (fluorene-9-ylmethyloxycarbonyl-Lys-(tert-butyloxycarbonyl)-OH) and the base labile linker, 4-hydroxymethyl benzoic acid, which acts as a protecting group while assembly of the substrate is performed using Fmoc-amino acid-OPfp (pentafluorophenyl) esters. The side chain of Lys is deprotected and reacted with Boc-Abz-ODhbt (Boc-2-aminobenzoyl3,4-dihydro-4-oxo1,2,3benzotriazo-3-yl-ester). The substrate is assembled with Pfp-esters and N-acetylated using Ac-ODhbt (Acetyl-ODhbt) Two-thirds of the functional groups are reserved for the syntheses of the inhibitor library. The hydroxymethyl benzamide is esterified with Fmoc-Val-OH, and using all encoded Fmoc-amino acid-OPfp esters, a library with the structure X1X2X3x4X5X6 (where X indicates an L-amino acid and x, a o-amino acid) is assembled on the Val after transfer of the resin to the 20-column peptide library generator (2) described m Chapter 8. The completed library is deprotected with From

Methods

m Molecular Edlted

by

Biology, S CablIly

vol 87 Comb/n&or/al 0 Humana

75

Press

Pep/de

Inc , Totowa.

Library NJ

Protocols

76

Me/da/

0.000 0

400

800

1200

1600

Time (Min) Fig. 1. The release of nitrotyrosine using a dilute solution of subtilisin Carlsberg by elution of a column of PEGA resin containing an inhibitor library and a fluorescencequenched substrate.

TFA (trifluoroacetic acid) (see Note 1). Release of peptides from beads with sodium hydroxide and analysis by MALDI-TOF MS (matrix-assisted laser desorption ionization time of flight mass spectrometry) indicated the assembled library to contain pure peptides. The library is packed into a column and treated for 24 h by slow elution with dilute enzyme, e.g., subtilisin Carlsberg solution, and the reaction is monitored as shown in Figs. 1 and 2 (see Notes 2 and 3). After 24 h only very few beads still remain dark and these are collected and sequenced. The elution protocol is performed in order to follow the reaction and to limit peptide transfer reactions (see Note 4). Searching for subtilisin Carlsberg peptide inhibitors we found that inhibitory peptide sequences were surprisingly different in their structure; they could not be aligned and did not have a lot in common with the substrate specificity except for the general lipophilic character. There was a preference for Cys(tBu) (Cys tert-butyl) as the n-amino acid but other o-amino acids were found as well (see Note 5). According to the substrate cleavage the best inhibitor was AMMC(tBu)MIV. Other inhibitor sequences that resulted in less than 50% substrate cleavage were VFNiVWV, IIIC(tBu)NYV, WMVfLHV, PVVnIFV, and PFYiQIV (1). Inhibitors linked to a solid phase present at high pseudo concentration may behave differently when the assay is carried out in solution. Some of the inhibitors identified and some designed peptides were therefore synthesized by MCPS (multiple-column peptide synthesis) and their inhibitory activity studied in solution. They were tested for their inhibitory activity on the

Solid-Phase

Enzyme

Inhibitor

77

Fig. 2. The progress of the enzyme reaction in beads containing a substrate and a library of different putative peptide inhibitors with one o-amino acid. The reaction was monitored through a fluorescence microscope. Beads still dark after 24 h are col-

lected and analyzed. hydrolysis of Abz-FQPLDEY(NO,)D by determination of ICsO at a substrate concentration of 7 yM, and an enzyme concentration of 28 nM. The best inhibitors were those that also were superior in the library assay. Thus the superior inhibitory activity (IC,, = 3.1 yM) was observed with

78 AMMC(tBu)MIV, and 7).

Meldal also found to be most active

m the library

(see Notes

6

2. Materials 1. Syringe synthesizer composed of a 20-mL syringe with a Teflon filter connected to a vacuum waste bottle with Teflon tubing and a two-way Teflon valve u3] and Chapter 8) 2. PEGA resin: for preparation see Chapter 7 3 Reagents preparation and source, see Chapter 8.

3. Methods 3.1. Synthesis of the Inhibitor 3.7. f. Syrtthesrs of the Substrate

Library Contarning Beads

1 Pack I 17 g PEGA,, resm (0 27 mmol) m a syringe synthesizer 2 Swell the resm in DMF (NJ+dlmethyl formamlde). 3 Wash the resin with two vol 20% pipendme/DMF and then with DMF Remove excess solvent 4 Make a solution composed of 6 1 mg hydroxymethyl benzcnc acid (1 5 Eq) and 63 mg Fmoc-Lys(Boc)-OH (0.5 Eq) in 11 mL DMF Activate It for 5 mm with 173 mg (2 Eq) TBTU (0-benzotnazo-I-yl-Nfl,IV’fl’-tetramethyl uromum tetrafluoroborate ) and 68 yL (2 Eq) NEM (4-ethyl morpholine) and add it to the resin. React the mixture for 24 h 5 Wash the resin with DMF and dichloromethane (DCM). 6 Treat the resin for 20 min with 2 vol 50% TFAlDCM. 7. Wash the resm with DCM and DMF 8 Allow the free ammo groups of the lysine side chains to react with Boc-AbzODhbt ( 154 mg , -3 Eq dissolved m DMF) 9 Cleave the Fmoc-group with 20% pipenidme/DMF for 10 mm and wash. 10 Continue with peptide synthesis using Fmoc-ammo acid OPfp esters (3 Eq) with ad&on of a catalytic amount of Dhbt-OH (-5 mg) to generate the substrate peptlde. For example, the substrate peptlde of subtlhsm Carlsberg was synthesized to generate Ac-Y(NO,)FQPLAVK(Abz)-PEGA (I). Acetylation of the peptide IS performed with Ac-ODhbt (I I Eq) 11. Wash the resin with DCM and suck It dry 12 Treat the resin with 0.1 MNaOH m the syrmge 13 Wash the resin with water. 14. Freeze-dry the resin.

3.1.2. Synthesis of Combina tonal Inhibitor Library 1 Dissolve 570 mg Fmoc-Val-OH (4 Eq) m 12 mL DCM Activate with 500 mg (4 Eq) MSNT (l-mesltylenesulfonyl-3-nltro-1,2,4-triazme) and 102 pL N-methyl lmldazole (3 Eq) Then, add the solution to the resin and leave it for 27 h.

Solid- Phase Enzyme lnhibrtor

79

2. Wash the resin with DCM and DMF 3 Cleave the Fmoc-group with 20% pipertdme and wash 4 Use a sample of resin to analyze the ratio between Val and the ammo acids of the substrate 5. Transfer the resin to a 20-column library generator with a mixing chamber above the columns and vacuum and pressure regulation of reagent flow as previously described (2) 6 Synthesize a hexa-peptide library containing u-ammo acids at posmon 4 by standard procedures as descrrbed above usmg Pfp esters (3 Eq), Dhbt-OH catalyst, and 2-6 h coupling times The Fmoc-D-amino acids (3 Eq) are activated with TBTU and NEM for 15 mm prior to addition to the resin 7 In each cycle after the Fmoc cleavage turn the synthesizer upside down and mix the resin by vigorous agitation on a shaking table 8 Wash the resin with DMF and DCM. 9 Treat the resin with three portions of 95% aqueous TFA (10 mm, 10 mm, and 5 h) 10 Wash the resin with DMF, 1 ~0120% plperidme/DMF, DMF, and DCM 1 I Freeze dry the resin. 12. Collect a few beads from a swelled sample, cleave each bead with base, and neutralize the filtrate 13 Analyze the filtrate by MALDI-TOF mass spectrometry. Single peaks should be detected m the mass range 700-l 100.

3.2. Isolation

of Beads

Displaying

Specific

Enzyme

Inhibitors

1 Pack 200 mg library resin into a syringe column 2 Elute the column with the enzyme m the proper buffer condition (I e , elution with subtdism Carlsberg IS done m an enzyme concentration of 5 x 10m8M, m 50 mA4 btcme and 2 mM CaCl* at pH 6 0 for 24 h. 3. Follow the reaction by the UV absorbtion of the effluent at 425 nm (Fig. 1) and by mspectton of resin aliquots under a fluorescence microscope (excitation 320 nm, emtssion 420-500nm) (Fig. 2) 4 Terminate the reaction by filtering and washing with water, 2% aqueous TFA, water, 2% NaHCOs, and water. 5 Freeze dry the resin 6 Make up 25-mg ahquots and plate them as a slurry m water on a small Petri dish for collection of beads under the fluorescence microscope 7. Transport the dark beads to the dry glass m the periphery 8 Collect individual beads with the dry end of a closed capillary, and place them on a filter for sequence analysis 9. Results showing putative resin-bound mhlbttors are exemplified m Table 1

3.3. MCPS

of Putative

Enzyme

Inhibitors

1 Synthesize peptides on 60 mg/column Macrosorb diamine and hydroxymethyl benzorc amide

resm derlvatized with ethylene

Meldal

80 Table 1 Synthetic Inhibitors and Their IC,,-Values with Subtilisin (2.5 x 1 Om8M) and the Substrate ABz-FQPLDEY(N02)D-OH % Substrate Structure

IIIc(tBu)NYVF KMMpISVF KMMpMVVF PVVnIFVF VFNIVWV MMMpMMMF AMMc(tBu)MIVF

cleavage m the library 24% -h -b -0 24% -c 22%

Carlsberg (7 x 1 O-7 ma ICsO-Values from solution assay (cLM> Weak 2000 400 95 91 55 3.1

0 Small letters indicate o-ammo acids 6 Combmatlons of motifs from Identified mhlbltors ‘ Designed soluble mhlbltor A solution of subtlhsm Carlsberg (10m6 M) and the substrate (ABz-FQPLDEY(NO,)D-OH, 7 x lo-” M) were prepared m the enzyme buffer (50 mM blcme and 2 mM CaCl, at pH 6 0) a5 well as 1 mg/mL of the peptlde mhlbltor m DMF Then, 100 mL of the substrate solution and 25 PL of the enzyme solution were added to 825-870 PL of the buffer solution, mixed, and the hydrolysis was followed at 25°C The mltlal fluorescence background of the mixture was recorded and found to be 10% of the fluorescence at complete hydrolysis The Influence of the mhlbltor on the mltlal rate of hydrolysis was determined by addltron of increasing amounts of mhlbltor soluttons (5,20, and 50 pL) and the KS0 was determined A solution of the mhlbltor MMMpMMMF was treated with enzyme (lo-’ A4) and no degradation was observed by HPLC

Attach the first ammoacid by the MSNT procedure(see Subheading 3.1.2., step l), peptide assembly is carried out by MCPS as described m Subheading 3.1.2. A standardFmoc-ammo acid-Pfp ester (3 Eq)/Dhbt-OH protocol with 20% pipendme in DMF for deprotection asdescribedm Subheading 3.1.2., step 6 1sused Couple the o-ammo acidsas the free acids(3 Eq) by zrzsztuactivation with TBTU Cleave the protecting groups off the resin by treatment for 2 h with 95% aqueous TFA Filter the resin, wash it with 95% aqueousTFA, DCM, 20% piperidme, DMF, and DCM Dry the resin and cleave the peptides off the resin m a 2-h reaction with sodium hydroxide (0 1 M) Filter off the releasedpepttdes, wash the resm. The solutions were neutrahzed to pH 7 0 on pH paper with HCl(0 1 M), and the peptides were lyophilized Extract the crude products with DMF and analyze by analytical HPLC (40-mm gradient from 20-100% acetonitrile m 0 1% ag TFA) All the compoundselute as a smgle major peak with the correct mass by ES-MS (electrospray mass spectrometry)

87

Solid-Phase Enzyme lnhibrtor

9 Purify crude products to homogeneity by preparative HPLC and analyze whether the resulting peptlde has the right composltlon according to ammo acid analysis

3.4. Solution Inhibitor Assay 3.4.1. Sol&Ion Assay of the Enzyme lnhrbitors Exemplified for Subtllisin Carlsberg 1. Make up the followmg solutions a. Enzyme buffer solution as above (see Subheading 3.2., step 2), b. Enzyme m its buffer solution, c Fluorescence-quenched pan peptide substrates, and d. The putative peptide mhlbltors

2. Mix the enzyme with the fluorescence-quenched pair substrate. 3 Add increasing amounts of Inhibitor to the enzyme/substrate

solution

4. Determine the ICSO of the reactlon

4. Notes 1 Inspection

under fluorescence

microscope

revealed the beads to be completely

and uniformly dark owing to the quenching by nltrotyrosme. 2 The mtrotyrosine release was very fast in the initial 20 min of the reaction and then the rate decreased. 3 By inspection of the beads after 1 h, it was found that most beads were completely fluorescent, however, a surprlsmgly large number of beads still were quite dark, indicating that the peptldes m those beads competed for binding of the enzyme. 4. Batchwise treatment with the enzyme gave similar results 5. In all beads some cleavage of the substrate was observed, as could be expected with the relatively broad specificity presented by subtlllsms However, the inhibitors had not been cleaved to any measurable degree This result was confirmed in solution where the inhibitors were stable in the presence of high

concentrations of subtihsm Carlsberg for a period of 24 h. 6. It was quite dlfflcult to evaluate some of the inhlbltory compounds in a solution assay owing to then highly hpophihc character leading to essentially insoluble compounds. 7 The result with the more specific enzyme cruzlpam gave 20- to 30-fold higher inhibitory activity for the best inhibitors

5. Concluding

Remarks and Future Perspectives

This and the previous chapters have described a new approach to the characterization of the substrate specificity of proteolytlc enzymes and to a direct definition of enzyme inhibitors employmg the strength of combinatorial chemistry. It was demonstrated that a single D-amino acid can confer complete stab&y against a proteolytlc enzyme. The method 1s general and can be apphed with different proteolytic enzymes Different inhibitory elements like dlpep-

Meldal tide epoxides or ammo phosphonic acids may also be used. It is completely independent of prior knowledge of enzyme specificity or structure of natural inhibitors of the enzyme. Provided suitable visual or other detection methods can be developed the method is even more general and can be used for the detection of substrates and inhibitors for virtually any enzyme that can penetrate into the PEGA polymer network. Other porous supports such as dextrans or supported polyamides may be mvestigated for similar applications. The resulting mhibltors can be used for the preparation of second generation inhibitor libraries with nonencoded amino acids in order to further increase the Inhibitory activity This could be particularly important in the case of proteases like cruzipam from the parasite Trypanosoma cruzz, which showed alignment and sequence homology of the identified inhibitors, allowmg for a more mtellegent design of the mhibttor library. The rate-limitmg step m the generation of mformation about enzymes and their inhibitors by the present method is the peptide sequence analysis The development of more general methods, such as ladder synthesis of the library on a biologically stable and inert spacer combined with MALDI-TOF MS (4), holds a lot of promise for an increase m the efficiency and for the scope of this combinatorial approach even with other classes of resin-bound compound libraries. Another enzyme field that could prosper from a combinatorial solid-phase approach is the investigation of glycosyltransferases. Libraries of glycopeptides or oligosaccharides could be synthesized using combmations of chemical couplmgs and enzymatic reactions with different glycosyl transferases. Libraries of putative glycosyl transferase mhibitors may in a similar manner be synthesized in a PEGA-resin containing a glycosyl acceptor and the inhibitory effect on the transfer of labeled donor-substrates may be investigated

References 1 Meldal,

M and Svendsen, I (1995) Direct visualization

of enzyme inhibitors

using a portion mixing mhrbitor library contammg a quenched fluorogemc peptide substrate. 1 Inhibitors for subttllsm Carlsberg J. Chem Sot., Perkzn Trans 1,1591-1596 2 Meldal, M (1994) Multiple column synthesis of quenched solid-phase bound fluorogeruc substrates for charactertzation of endoprotease spectftctty. Methods 6,417-424. 3. Peters, S., Meldal, M., and Bock, K (1996) Recent development m glycopepttde synthesis, m Modern Methods In Carbohydrate Synthesw (Khan, S H and

O’Neill,

R. A , eds ), Harwood Academic Publishers, Amsterdam, pp. 352-377

4 Youngquist, R S , Fuentes, G R , Lacey, M P., and Keough, T (1995) Generatron and screenmg of combinatorral pepttde libraries designed for rapid sequencmg by mass spectrometry J. Am. Chem Sot 117,3900-3906.

10 Determination of Peptide Substrate Motifs for Protein Kinases Using a “One-Bead One-Compound” Combinatorial Library Approach Kit S. Lam 1. Introduction Protein phosphorylation is one of the more than 100 known posttranslational modifications of proteins (1-4). There are more than 240 protein phosphorylation sites reported (5), and many protein kinases have been cloned and expressed. The sues of phosphorylation are usually serine, threonine, tyrosine, or occastonally histrdine. The two major classes of protein kmases are serme-threonine protein kmase and protein tyrosme kinase. Substrate motifs for several serme-threonine kinases are known (S), and they are often confined to a linear motif. In contrast, little is known about the substrate speclficity of protein tyrosine kinases (PTKs) and peptide substrates based on the autophosphorylatron sue of these enzymes are often very inefficient, with a K, m the high micromolar to millimolar range. It was not until recently when combinatorial peptide library approaches were used that some novel and relatively more efficient peptide substrates for some PTKs were discovered (6-8). Songyang et al. (6) synthesized a biased random peptide library with the following general structure: MXXXXYXXXXAKKK, where X = all 15 ammo acids except Tyr, Trp, Cys, Ser, and Thr. The peptide mtxtures were phosphorylated in vitro with a specific PTK and unlabeled ATP. The phospho-peptldes were then isolated by a ferric chelation column. The eluted peptides were then sequenced concurrently (6; see also Chapter 11). Therefore, the resulting motif 1s a summation of the sequences of all the peptides recovered. We (7,8), on the other hand, used the “one-bead one-compound” library method by incubating a totally random peptide-bead library (e.g , XXXXXXX, where X = all 19 amino acids except Cys) with [T-~~P]ATP and a specific protein kmase. The From

Methods

m Molecular Bology, vol 87 Combmafonal PepMe Edited by S Cabilly 0 Humana Press Inc , Totowa,

83

Ltbraiy

NJ

Profocols

84

Lam

[32P]-labeled peptrde-beads were then localized by autoradrography, isolated, and mrcrosequenced individually. Peptide substrates with multiple motifs can be identified usmg this method. Although we bmlt the followmg discussion on methodologies for determining phosphorylatron motifs, the “one-bead onecompound” library approach, in principle, can also be apphed to the determrnation of substrate motrfs for other post-translational modifications, such as glycosylatlon, ribosylatron, and methylation.

2. Materials 2.1. Chemicals/Buffers 1 MES buffer 30 mI4 2-(N-morpholino) 2 3 4 5

ethanesulfonlc acid, 10 mM MgC12, 0 4

mg/mL bovme serum albumin (BSA), pH 6 8 [Y-~~P]ATP (25 Wmmol) IS available from many sources. Washing buffer. 0 68 M NaCl, 13 mM KCl, 40 mM Na,HPO,, 7 mM KH,PO,, pH 7.0,0.1% Tween-20 (v/v) OlMHCl 1 5% agarose (w/v) m Hz0 Melt the agarose, then keep at 70-75°C

2.2. Reagents,

Supplies,

and Equipment

1 Many protein kmases are commerctally available from many sources 2 Glogos II autoradrogram markers are obtained from Stratagene, La Jolla, CA. 3 Low gellmg temperature Sea Plaque agarose can be obtained from FMC BtoProducts, Rockland, ME 4. X-ray film (e g , Kodak X-OMAT LS) 5 Dissecting mtcroscope

3. Methods 1 Transfer l-5 mL of the bead hbrary (200,000-l,OOO,OOO beads) to a 20-mL polypropylene container Slowly dilute the drmethylformamtde (DMF) by addmg an incremental amount of double-distilled water Wash the bead hbrary thoroughly wtth double-distilled water followed by MES buffer m a dtsposable polypropylene column. 2 Transfer the bead library to a 5-10 mL polypropylene screw-cap veal To 1 mL of settled bead, add 1 mL of 2X MES buffer contammg 0 2 FM [y-s2P]ATP and protein kmase (see Note 1). Cap the reaction vial tightly and put on a rockmg platform for l-5 h at room temperature with gentle rockmg 3. Transfer the [32P]-labeled bead library to a disposable polypropylene column and wash the resins thoroughly with washing buffer, then double-dtstllled water 4 Transfer the bead library to a glass tube wrth 5 mL of 0 1 M HCl and heat to 100°C for 15 mm (see Notes 1 and 2). 5 Wash the acid-treated bead library thoroughly m a disposable column with washmg buffer

Peptide Substrate Motifs

Fig. 1. A typical autoradiogram

85

of a [“*PI-labeled

peptide-bead library.

6. Resuspend each of the 0.5mL bead library in 30 mL of hot 1.5% agarose solution (70-75”C), carefully pour the bead suspension onto a clean glass plate (16 x 18 cm), and air dry overnight at room temperature (see Note 3). Tape the Glogos II autoradiogram markers on each corner of the glass plates. 7. Expose the immobilized bead to X-ray film with an intensifying screen for 20-30 h at room temperature and develop the film. Figure 1 shows the result of a typical autoradiograph. 8. Align the autoradiograph with the Glogos II autoradiograph markers on the glass plate. Excise the area of the dried agar with beads corresponding to the dark spots on the film. 9. Transfer all the excised dried agar with beads to 30 mL of hot 1.5% agarose solution (70-75’C) for 15 min. Replate the beads, expose, and develop the autoradiogram as described above. 10. Under a dissecting microscope, localize an individual bead that is labeled with [32P]. Add a drop of water over the positive bead to swell the agarose. Dislodge the bead with a 27-gage needle and transfer the positive beads to a Petri dish of water (see Note 4). Il. Under a microscope, transfer individual beads onto a glass filter and insert into the protein sequencer cartridge for microsequencing.

4. Notes 1. Although purified protein kinase may not be necessary for the screening, it should be free of other protein kinases, phosphatase, or ATPases. If there are some con-

86

I.

‘.

Lam tammated serme/threonme kmases m the enzyme preparation, one may consider treating the [32P]-labeled bead library with 1 M NaOH at 58°C for 1 h, smce under this condition, all seryl and threonyl phosphate will be hydrolyzed and a considerable portion of tyrosyl phosphate ~111 remam intact Treatment of [32P]-labeled bead library with 0 1 M HCl at 100°C for 15 mm is extremely important to mnnmize background label. Under such conditions, all [Y-~*P] ATP and histidy phosphate, but not tyrosyl, seryl, or threonyl phosphate, ~111be hydrolyzed Avoid loading too many beads (99%, deprotect the resin If uter

DVII

do8 \u

Trx ’

%

cell

pVII1

cell

0

+

pV

assemly

membrane

plll

Inner

inser-

-

-p;,-

membrane

-

RF

ssDNA

Fig. 2. Assembly of the phage virion and its release from E. coli cells.

2. Assembly

of Phage Virion and Its Release from E. co/i Cells

Adsorption of phage particles to E. coli cells occurs through the interaction between the amino terminus domain of pII1 and the bacterium pili. Then after, in an unknown manner that could involve retraction of the pilus, the whole particle transverses the outer cell membrane, strips off its pVII1 over the inner

Structure of Filamen tous Phage

137

membrane, and the ssDNA penetrates into the cytoplasm where it replicates into dsDNA-the phage replicative form (RF). Once the phage coat proteins are produced by E. coli, they move to the bactermm inner cell membrane and associate with it. The circular ssDNA phage particles propagate m the bacterium cytoplasm via a rolling circle mechanism and the particles assume a rodlike structure when bound to dimers of the phage protein pV. A complex of proteins, including the bacterium-encoded thioredoxin (TrxA), the phage p 1, pVII, and pIX, anchor the ssDNA particle to the inner cell membrane and mltiate the assembly of the phage particle and its passage through the inner membrane. In the assembly process, pV is replaced by the major coat proteins (5) and the process terminates with the assembly of pV1 and ~111.The phage crosses the outer membrane through specific gated channels that consist of lo-12 copies of pIV (10) (Fig. 2). There is a requirement for specific fitness between the phage major coat protein and the channel protein pIV (II), thereby, changes made in pVII1 or pIV might interfere with the release of the phage. 3. Display of Peptides on the Phage Coat Proteins Of the five coat proteins, ~111,pV1, and pVII1 have been used for displaying peptides on the phage virion pII1 is the longest coat protein Its sequence consists of 406 amino acids (excluding the leader sequence) hooked to the virion surface through 23 hydrophobic amino acids in its carboxy terminus (12). The protein contains two glycine-rich flexible segments. The first, (GGGSE),GGGT, is located 70 amino acids downstream from the N-terminus, and the second, (GGGS),(GGGSE),(GGGS),GSG, is located 215 amino acids downstream the from N-terminus. The domain between the two glycine-rich segments is required for anchoring the phage to the tip of the bacterium pilus, and the upstream region is required for phage penetration (13,14). Smith was the first to demonstrate that the amino terminus of ~111,which protrudes away from the phage surface, can tolerate insertions of foreign polypeptides (15). His findings and those that followed (16,17) paved the way for the generation of phage display peptide libraries (l&20), for the display of other proteins, such as, various forms of Ab fragments, Ab libraries (21,22), cytokmes (23), receptors (24,25), lectins (26)) protease inhibitors (27,28), DNA-binding proteins (29)) enzymes (30,3I), cDNA expression libraries (32,33), and more. Unlike ~111,pVII1 is a small protein of 50 amino acids. A short segment of five amino acids at its ammo terminus is exposed to the surrounding medium The rest of the molecule has a helical structure with the following three domains: an acidic ampiphatic domain of 14 amino acids; a hydrophobic domain of 20 ammo acids; and a basic ampiphatic domain of ten amino acids. This unique structure enables the deposition of pVII1 molecules, one on top of the other and over the phage DNA m the form of “fish scales” (Fig. 1). An

Cabilly appropriate insertion site for displaymg foreign peptides is at the junction between the first segment of five amino acids and the followmg ampiphatlc domain (34). The length of peptides displayed by pVII1 is limited to 5 to 6 amino acids, unless intact molecules of pVII1 are also present on the surface of the phage vinon (see below). Longer peptides interfere with the phage propagation, probably by affecting the specific interaction between pVII1 and the gated channel or because of unfavorable mteractions with pVI1 or pIX at the mitral stages of assembly (9,35). pII1 can tolerate the insertion of longer peptides, however, displayed peptides may affect the phage assembly or block its adsorption to the E. cull pili (36), and some of the fused peptides decrease the phage propagation rate (see Chapter 16). The number of displayed peptides on the phage virion is m accordance with the number of the fused coat protemsfive on pII1 and about 2800 on pVII1 This multiplicity of peptide display is advantageous for some purposes, but it limits our ability to use the phage for distinguishmg between phage-displaying peptides with different bmdmg affnuties or to select for phage-displaying peptides with improved affinities (20,37). To reduce the number of peptides displayed on each virion, the coat proteins molecules that are fused to the displayed peptides are expressed in the presence of excess copies of intact coat protein. This kmd of double expression has been carried out in two ways. by constructing a phage genome that codes for the two forms of the coat protein; or by a double transfection of E. coli with a phagemid coding for the fused coat protein and with a helper phage that gives rise to the intact coat protein as well as to the rest of the phage proteins (37) Diluting the number of peptides displayed by pVII1 to tens or hundreds of copies enables the construction of phage libraries displaying peptides that are longer than six ammo acids (34) and the display of proteins having a much higher molecular weight (38). Similar dilation of peptides displayed on pII1 enables the production of phage displaymg a single peptide. Truncated forms of pII1 lacking their ammo terminus region, which IS responsible for phage anchoring (to pill) and/or penetration, are properly assembled on the phage virlon Since not all five pII1 are required for phage mfectivity , the truncated form can be used to display foreign peptides while the coexpressed intact pII1 restores the phage infectivity (39-41) Another way to restore the mfectlvity of phage displaying a truncated pII1 is carried out by linking back the missmg part of the pII1 Based on this, Duenas and Borrebaeck (41) developed an approach for the selection of specific phage-displaying peptldes According to then approach, a phagemid expression library of antibodies is constructed by tailoring the genes coding for the

Structure of Fhmenfous

Phage

733

antibody repertoire to the S-end of a truncated pII1 gene Expressing the library in E. colz containing helper phage that does not produce pII1 results m the release of noninfective virions that display the antibody library. When an antigen, coupled to the missmg domam of the truncated ~111, is added to these virions, infectivity is restored only to those displaying the specific antibodies. A similar approach was apphed for cDNA selection (33). pVI is the only coat protein that exposes its carboxy termmal end to the surroundmg medium (8). So far, pVI was used for displaying a cDNA expression library (42)

4. Prospective The enormous length of the filamentous phage affects the bmdmg properties of the displayed peptides and is responsible for its high nonspecific bmding to various matrices. In addition, due to the enormous molecular weight of the phage, the molar concentration of the displayed peptide is too low for the induction of biological activity and detection in most cases. The filamentous phage can be shortened to a particle containmg a DNA of 221 bp coated with 95 copies of pVII1 (mimphage) (10). Though we are mcapable of generating single peptides that are carrying their own coding genes, a construction of miniphage peptide libraries that are selected according to the Duenas and Borrebaeck approach is probably the next step forward

Acknowledgments I would like to thank Judith Heldman for her help m the preparation chapter and to the Rash1 foundation for their financial support

of this

References 1. Day, L. A., Marzec, C J , Relsberg, S. A., and Casadevall, A (1988) DNA packaging in ftlamentous bacteriophages Annu. Rev Brophys. Blophys. Chem. 17,509-539 2 Glucksman, M. J., BhattacharJee, S , and Makowskl, L. (1992) Three-dimentional structure of a clonmg vector, X-ray diffraction studies of filamentous bactertophage Ml3 at 7 8, resolution J. Mol. Blol. 226,455-470 3. Model, P. and Russel, M (1988) The Bacterzophage, vol 2 (Calender, R , ed ), Plenum, New York 4 Lopez, J. and Webster, R. E (1983) Morphogenests of filamentous bacteriophage fl: Onentatton of extruston and production of polyphage Vzrology 127,177-193 5 Russel, M. (1991) Filamentous phage assembly Mol. Mzcrobzol. 5, 1607-1613 6 Slmons, G F M , Veeneman, G H., Konmgs, R N H , Van Boom, J. H , and Schoenmakers, J G. G. (I 98 1) Gene IV, gene VII and gene IX of phage M 13 code for minor capstd proteins of the vu-ton. Proc. Natl. Acad Scz. USA 78, 4194-4198

134

Cablily

7 Makowskr, L ( 1992) Terminating a macromolecular helix, Structural model for the minor proteins of bactertophage Ml 3. J. MoZ Blol. 228,885-898 8 Makowskt, L (1993) Structural constramts on the display of foreign pepttdes on ftlamentous bacteriophage Gene 128,5-l 1 9 Specthrre, L , Bullttt, E , Hormcht, K., Model, P , Russel, M , and Makowskt, L (1992) Constructton of mtcrophage vartant of ftlamentous bacteriophage J Mol. Blol 228,720-124 IO Kazmterczak, B. I , Mtelke, D L , Russel, M , and Model, P. (1994) pIV, a ftlamentous phage protein that medtates phage export across the bacterial cell envelope, forms a multtmer J. Mol. Bzol 238, 187-198 11 Russel, M (1993) Protein-protein mteactions durmg ftlamentous phage assembly J Mol.Biol. 231,689-697 12 Armstrong, J , Perham, R N , and Walker, J E (1981) Domain structure of bacteriophage fd adsorptron protein FEBS Let? 135, 167-172 13 Stengele, I., Bross, P., Graces, X , Gtray, J., and Rasched,I Dtssectton of funtional domains m phage Fd adsorptton protein J. Mol Blol. 212, 143-149 14 Bradbury, A and Cattaneo, A. (1995) The useof phage display m neurobrology Trends Neurosci 18,243-249 15 Smtth, G. P (1985) Ftlamentous fusion phage. novel expression vectors that dtsplayed cloned antigens on the vtrton surface. Sczence228,1315-1317. 16. Parmley, S F and Smith, G P. (1988) Anttbody-selectable ftlamentous fd phage vectors affunty purtftcatton of target genes Gene 73,305-3 18 17 de la Cruz, V.F , Laa, A A , and McCutchan, T F (1988) Immungemctty and epttope mapping foreign sequencesvia a genetically engineered ftlamentous phage J. Blol. Chem. 263,43 18-4322. 18. Scott, J K and Smith, G. P. (1990) Searching for pepttde bgands with an epttope library. Science 249,386-390 19 Devlm, J J , Pangamban,L C , and Devlin, P E (1990) Random peptrde ltbrartes: A source of spectftc protein bmdmg molecules Science 249,404-406 20 Cwtrla, S. E., Peters, E A , Barrett, R W , and Dower, W. J (1990) Pepttdes of phage. A vast library of pepttdes for identifying ltgads Proc. Nat1 Acad Scl. USA 87,6378-6382 2 1 Barbas, III, C. F , Kang, A. S., Lerner, R. A., and Benkovic, S. J (199 1) Assembly of combinatorral antibody ltbrartes on phage surfaces The gene III sue. Proc, Nat1 Acad Sci USA 88,7978-7982 22 Ntsstm, A., Hoogenboom, H R., Tomlmson, I. M., Flynn, G , Mrdgley, C , Lane, D., and Winter, G. (1994) Antibody fragments from a ‘single pot’ phage display library as immunochemical reagents. EMBO J. 13,692-698 23 Gram, H , Strutmatter, U , Lorenz, M , Gluck, D , and Zenke, G. (1993) Phage display asa rapid geneexpressionsystem: productton of btoacttve cytokme-phage and generation of neutraltzmg monoclonal antibodies J Immunol. Methods 161, 169-176

Structure of F//amen tous Phage

135

24. Robertson, M. W. (1993) Phage and Escherzchia ~021 expression of the human htgh affinity immunoglobulm E receptor a-subumt ectodomain 1. BloZ. Chem. 268,12,736-12,743 25, Scarselli, E., Esposito, G., and Trabom. C. (1993) Receptor phage. Display of functional domams of the human high affimty IgE receptor on the M 13 phage surface. FEBS Lett. 329,223-226. 26 Swimmer, C., Lehar, S M , McCafferty, J., Chiswell, D J , Blattler, W A , Guild, B C. (1992) Phage display of ncm B chain and its smgle bmdmg domams system for screening galactose-bindmg mutants Proc. Natl. Acad. Scz. USA 89,3756-3760. 27 Pannekoek, H., van MeiJer, M., Schleef, R R , Loskutoff, D. J , and Barbas, C F III. (1993) Functional display of human plasmmogen-activator inhibitor 1 (PAI1) on phages. novel perspectives for structure-function analysis by error-prone DNA synthesis. Gene 128,135-140. 28 Roberts, B L , Markland, W., Ley, A C., Kent, R. B., White, D. W., Guterman, S. K., and Ladner, R. C (1992) Directed evolution of a protein: selection of potent neutrophil elastase inhibitors displayed on Ml3 fusion phage Proc. Nat1 Acad. Sci USA 89,2429-2433. 29 Rebar, E J and Pabo, C 0 (1994) Zinc finger phage affinity selection of fingers with new DNA-binding specificities Science 263,67 l-673, 30 McCafferty, J , Jackson, R. H., and Chiswell, D J (1991) Phage enzymes: expression and affnuty chromatography of functional alkaline phosphatase on the surface of bacteriophage. Protein Eng. 4,955-961 31 Corey, D. R., Shiau, A. K , Yang, Q., Janowski, B. A., and Craik, C S. (1993) Trypsm display on the surface of bacteriophage Gene 128,129-134 32 Crameri, R. and Suter, M (1993) Display of biologically active proteins on the surface of filamentous phages: a cDNA cloning system for selection of functional gene products linked to the genetic mformation responsible for their production Gene 137,69-75. 33 Gramatikoff, K., Georgiev, 0 , and Schaffner, W. (1994) Direct mteraction rescue, a novel filamentous phage technique to study protein-protein mteractions Nucletc Acids Res 22,5761-5762. 34 Felci, F. (1991) Selection of antibody hgands from a large library oligopeptides expressed on a multivalent exposition vector. J. lMol Bzol. 222,30 l-3 10 35 Greenwood, J , Willis, A E., and Perham, R. N. (1991) Multiple display of foreign peptides on a filamentous bacteriophage J. Mol. Biol. 220,821-827 36. Smith, P G. (1993) Surface display and peptide libraries Gene 128,1,2. 37 Lowman, H. B., Bass, S H., Simpson, N., and Wells, J A. (1991) Selectmg highaffinity binding proteins by monovalent phage display Biochemutry 30, 10,832-10,838. 38 Kang, A S., Barbas, C F , Janda, K D , Benkovic, S J , and Lerner, R A (1991) Linkage of recognmon and replication functions by assembling combmatorial antibody Fab libraries along phage surface. Proc Nat1 Acad. Scl USA 88,4363-4366

136

Cab/l/y

39 Bass, S., Greene, R , and Wells, .I. A (1990) Hormone phage* An enrichment method for variant protems wtth altered bmdmg properties Protems: Struct. Funct. Genet. 8,309-3 14. 40. Lowman, H. B and Wells, J A (1993) Affmlty maturation of human growth hormone by monovalent phage drsplay J. Mol. Bzol 234,564-578 41 Duenas, M. and Borrebaeck, C A. K (1994) Clonal selection and ampltftcatron of phage displayed anttbodtes by lmkmg antigen recognmon and phage repllcatton Biotechnology 12,999-1002 42 Jespers, L S , Messens, J H., De Keyser, A., Eeckhout, D., Van Den Brande, I , Gansemans, Y. G , Lauwereys, M J , Vlasuk, G. P., and Stanssens, P E (1995) Surface expresston and ltgand-based selectton of cDNA fused to filamentous phage gene VI. Biotechnology 13,378-382

16 Construction and Use of a 20-mer Phage Display Epitope Library Baruch Stern and Jonathan

M. Gershoni

1. Introduction Epitope libraries provide an extremely efficient means for epitope mapping and the development of novel diagnostic markers. Filamentous phage fd-tet expression systems have been developed in order to construct such libraries contaming tens to hundreds of mlllions of random peptlde sequences that can be screened for their abihty to bind particular antibodies (I). In essence these phage-expressed peptides mimic the determmants of the antigen that are recognized by the antibodies. The fUSE5 vector derived from phage fd-tet can be propagated m plasmid form in media containmg tetracycline; it does not kill its host nor depend on continual infection for its propagation (2). We have used the method described below to construct several epitope libraries, clonmg a 60-nucleotide-long random sequence (correspondmg to a 20-amino acid random sequence) into the pII1 gene of phage fd-tet, fUSE5 vector. PI11 is a minor coat protein essential for phage infectivity. It is located at the tailing end of the phage and is generally more flexible and exposed than most other regions of the phage. This enables it to not only tolerate epitope insertions but also make the various epitopes accessible for recognition (for a detailed description see ref. 3) The libraries generated in our laboratory have proven to be an excellent source for peptides. Our hbraries, each containing 5 x lo* individual clones, represent only a fraction of the full complexity of 20-mer epitopes (ca. 10z6 combinations). Nonetheless, the total diversity and representation of the shorter peptides (because of the overlapping sequences) 1sincreased many fold. Thus, for example, each 20-mer clone consists of 15 overlappmg 6-mers, 14 overlapFrom

Methods

m Molecular Bfology, vol 87 Combmatonal Peptrde Edlted by S Cablily 0 Humana Press Inc , Totowa,

137

Library NJ

Protocols

138

Stern and Gershoni

pmg 7-mers, 13 overlapping 8-mers, and so forth. Therefore, in a library made up of lo8 clones the entire repertoire of 6- and 7-mer epitopes can be well represented (6 4 x lo7 and 1.3 x lo9 combinations, respectively), and longer peptides are represented also but to ever decreasing degrees In addition, the fact that the shorter sequences are flanked by randomly variant residues is another advantage since this increases the chance of achieving optimal binding conformations. A 20-mer hbrary might also allow presentation of discontinuous secondary and possibly tertiary conformation-dependent eprtopes. Finally, we have found that by using this library and analyzing varieties of phages that bind a specific MAb one can also learn much of the molecular requirements for epitope recognition. 2. Materials In all the procedures listed we recommend using either molecular biology grade or analytical grade reagents and generally all stocks should be kept sterile until use. 2.7. Library

Consfrucfion

1 DNA purification solutions (solutions I and II should be prepared fresh)* a Solution I. 25% (w/v) glucose, 50 mM Trts-HCl, pH 8 0, 10 mM EDTA (ethylenedtammetetraacetic acid), pH 8 0 b. Solution II 0 2 M NaOH, 1% (w/v) SDS. c Solutton III* 60 mL 5 M potassmm acetate, 1 I 5 mL glacial acetic acid, 28 5

mL HZ0 Store at 4°C and use cold. 2 Super broth 32 g Bacto-tryptone, 20 g yeast extract, 5 0 g NaCl Dissolve m 1 L water and adjust to pH 7 5 with NaOH Autoclave 3 Lysozyme (Sigma, St Louts, MO). 4 TE buffer 10 mA4Tris-HCI, pH 8.0, 1 rniW EDTA pH 8.0 5 Isopropanol 6. Cesmm chlortde 7 Ethidmm bromide solution. 10 mg/mL m water 8 Agarose (SeaKem GTG) 9. EDTA stock solution. 0 5 M, pH 8 0 m water, adjusted with NaOH 10 Trts-HCI buffer 1 M, pH 8 0, adjusted with concentrated HCI 11 3 OM Sodium acetate (NaOAc), pH 5 2, adjusted with glacial acetic acid. 12 Tetracychne. 20 mg/mL m water and stertltzed by filtration. 13 PhenoUTE phenol equilibrated with TE buffer, ensure that the pH >7 4 (7) 14 Chloroform/I chIoroform/tsoamylalcohol(24~ 1) 15 Phenol/Chloroform eqmhbrate phenol/TE with an equal volume of chloroform/I. 16 Restrictton enzyme S&I is supplied with 10X restnctton buffer and 100X bovme serum albumin (BSA) (New England Btolabs, Beverly, MA). 17 Synthetic oltgonucleotide 5’-end labeling ktt (#K009) (Fermantas Molecular Biology Instruments, Vtlmus, Lithuania) or alternative

ZO-mer Phage Display Epltope Library

739

18. Olrgonucleotrdes. ON93(5’GAGCCAGTGCATCA(NNK),sTCGCTAACAGG TGGGTCTG3’) ON16(5’ ACCCACCTGTTAGCGA3’) ON17(5’ TGATGCACTGGCTCCGT3’) 19. T4 DNA lrgase (#202S) (New England Brolabs) 20. Glycerol solutron: 10% glycerol (w/v) m water 2 1. HEPES (N-2-hydroxyethylprperazme-IV’-2-ethane sulfomc acrd): 100 mM, pH 7 0 stock solutron 22, LB broth 10 g/L Bacto-tryptone, 5 g/L yeast extract, and 10 g/L NaCl Drssolve in 1 L water and adJust the pH to 7 0 with NaOH Autoclave 23, LA agar plates add 20 g Bacto agar to 1 L of LB broth 24 SOB media* 20 g Bacto-tryptone, 5 g yeast extract, 0 58 g NaCl, 0.19 g KCl. Drssolve m 1 L water, divrde mto lOO-mL portions, and autoclave Add 1 mL of 2M Mg2+ solution (1 M MgCl,, 1 M MgS04, in water, filter sterilized) to each bottle 25. SOC medra. add to each SOB bottle (100 mL), 1 mL of autoclaved 2M glucose (store at room temperature) 26 0.2-cm Electropotatron cuvets. 27 Electroporator. gene pulser (#1652078), pulse controller (# 1652098), capacitance extender (#1652087) (Bio-Rad Laboratories, Hercules, CA) 28. PEG/NaCl* 33% (w/v) polyethelene glycol 8000/3 3M NaCl m water and autoclaved. 29. Tris-buffered salme (TBS): 50 mM Trrs-HCI, pH 7 5, 150 mM NaCl 30. 2X TY medium 16 g/L Bacto-tryptone, 10 g/L yeast extract, and 5 g/L NaCl drssolved m water and autoclaved. 3 1. Kanamycm. 50 mg/mL m water and sterrlrzed by ftltratron. 32 Terrific broth 12 g Bacto-tryptone, 24 g yeast extract, and 4 mL (5.04 g) glycerol are dissolved in 900 mL water and added to 100 mL of separately autoclaved potassium phosphate buffer (0 17 M KH2P04, 0 72 M K2HP04, pH 7.8). 33. TBS/azide* TBS supplemented with 0 02% (w/v) NaN, 34 LA/Kane LA plates supplemented wrth kanamycm (50 pg/mL) 35 LAltet. LA plates supplemented with tetracycline (20 ug/mL) 36 Conical polypropylene 15-mL (120 x 17-mm) screw-cap test tubes (Sarstedt, Numbrecht, Germany), # 62 553 042 PS) 37 14-mL Polypropylene (17 x loo-mm), round-bottom test tubes with cap (Falcon, Becton Dickmson, Lmcoln Park, NJ, #2059). 38. Quick-seal centrifuge tubes* 16 x 76-mm (Beckman Instruments, Palo Alto, CA, #3424 13) 39 50-mL hinge-cap tubes (Kontron, Switzerland, #900370).

2.2. Biopanning 1 AffmiPure rabbit antimouse IgG, Fc fragment-specific antibody (Jackson ImmunoResearch Laboratories, West Grove, PA).

(RbaMIgFc)

140

Stern and Gershoni

2. Elutton buffer 0 1M HCl, pH adJusted to 2 2 with glycme, and 1 mg/mL BSA added The solution is filter sterrlrzed and stored at 4°C 3. Bovme serum albumin (BSA) fraction V* 50 mg/mL is dissolved m TBS and stored at -20°C. 4 Blockmg solution: 0 25% (w/v) gelatm dissolved m TBS 5 Neutralizing solution: 1M Tris-HCl, pH 9 1. 6 LAlKan as described m Subheading 2.1., item 35. 7 6-well cluster plate (Costar, Cambridge, MA, #3506)

2.3. Phage Selection 1 Nitrocellulose membranes. NC 45, cellulose nitrate (E), 0.45 km (Schlercher and Schuell, Dassel, Germany, #40 1- 169) 2 MllhBlot-S system (MilliPore Corporation, Bedford, MA, #MBBDS0480) 3 Evaporated milk: spray-dried skim milk, 1 5% fat (Marvel, Birmingham, England) or alternative. 4 HRP-goat antimouse whole IgG (GtaMIgHRP) (Jackson ImmunoResearch Laboratories) 5 TMB membrane peroxrdase substrate system (Kirkegaard and Perry Laboratories, Gaithersburg, MD) 6. ECL rmmunodetectlon (Amersham International, Buckmghamshire, UK) 7 100 x 16-mm Round-bottom screw-cap tube (Bibby Sterilm, Stone, England, #142AS). 8. U-bottom sterile 96-well plates (Cornmg Glass Works, Corning, NY, # 25850) 9 Flat-bottomed 96-well plates (Corning Glass Works, # 25860).

2.4. Sequencing 1 Ollgonucleotide primer 5’-CCCTCATAGTTAGCGTAACG-3’ for sequencing 2 30% Acrylamlde solution 28 5% (w/v) acrylamide, 1.5% (w/v) NjV’ methylene his-acrylamide. Solution is stored m the dark at 4°C. 3 Sequencmggel 38 x 50 cm apparatus(Blo-Rad Laboratories). 4 X-ray Btomax MR 2 film (Eastman Kodak Company, Rochester, NY) 5 Wizard Ml3 DNA purification system (Promega, Madison, WI) 6. DNA sequencmgkit (#70770), Sequenaseversion 2 0 (United States Biochemical, Cleveland, OH).

2.5. Bacterial Strains and Bacteriophage E. coli K802: E co11MC1061.

F-el4-(mcrA-)

Vectors

galK2 galT22 m&B1 A(lac)6 or LacYI supE44 hsdr2 mcrA, rfbDl mcrB1 hsdR2 (rk - mk+) (5). F araD139 A(ara-leu)7696 AlacX74 galVgalKhsdR2 (rk-mk+) mcrB1 rpsL (Stf) (6).

ZO-mer Phage Display Eprtope Library E. coEi K91Kan:

fUSE5 Vector

141

A h- derivative of K-38; it is Hfr Cavalli and has chromosomal genotype thi. It has the “mini-Kan hopper” element, a kanamycin-resistant transposon without its own transposase gene, inserted in the 1acZ gene (3). A kmd gift from George Smith.

3. Methods 3.1. Constructing the Library Our epitope libraries were constructed m the fUSE5 vector. This is a derivative of the fd-tet phage that contams a frame shift mutation introduced mto the gene III cloning site, resulting in a defective protein and the production of noninfectious particles. Restormg the reading frame is accomplished by clonmg synthetic oligonucleotides of the correct size into gene III (3). Much of the following protocol is based on that developed by George Smith (University of Missouri). We constructed our library using a 93-base oligonucleotide containing a 60-nucleotide degenerate sequence flanked by two nondegenerate sequences. Two additional short oligonucleotide sequences were designed to base pair with the nondegenerate flanking regions and create sticky overhangs complementary to the vector. After the three ohgonucleotides were annealed, they were ligated with fUSE5 and transformed mto an E. coli strain (“fill m” of the gap is not necessary, however, is possible as $2 leaves a 3’ overhang). 3.1.1. fUSE5 Vector Preparation Constructmg epitope libraries requires tens of micrograms of purified fUSE5 vector. Unfortunately, when attempting to prepare fUSE5 using two different commercially available kits for large-scale preparation of plasmid DNA, extremely low yields of vector are obtained with a hrgh degree of chromosomal DNA contamination. We found that our best yields of fUSE5 were obtained by combining a method for the large-scale purification of cosmid DNA (8) with the method for purification of closed circular DNA by equilibrium centrifugation in CsCl-ethidium bromide gradients (4). 1. Inoculate a colony of E. colz KS02 containing the fUSE5 vector m a 2-L flask contammg 500 mL of super broth, supplemented with 20 pg/mL tetracyclme. Grow overnight at 37°C with vrgorous shaking. 2 Pellet the cells at 5,OOOg for 10 min (4°C). Resuspend the pellet in 20 mL of cold solutton I; the pellet can be manually disrupted with a pipet. Makmg sure there are no bacterial aggregates left, add some lysozyme crystals (approx 3-5 mg), mix carefully, and leave for 10 mm at room temperature (see Note 1)

Stern and Gershoni 3. Add 60 mL of solutton II and mix Immediately by swu-lmg (do not shake vlgorously). Chill for 10 min on ice The solution will become VISCOUSand a yellowish aggregate of cellular debris may form 4 Qmckly add 45 mL Ice-cold solutzon III, mix immediately as m step 3, and return the bottle to the me for an additional 30 mm 5 Centrzfuge at 4000g for 15 mm at 4”C, (Sorvall GSA rotor) Carefully decant the clear supernatant through a few layers of gauze mto a clean bottle, avotdmg the transfer of the pellet and debris Recentrifuge the supernatant (15 mm at 4000g at 4°C) and collect the cleared supernatant Measure the volume of the supernatant and add 0 6 vol zsopropanol to zt Invert the bottle several times to mix and mcubate on ice for 30 mm. Centrifuge at 6OOOg for 20 mm at 4°C to pellet the preczprtate, which is heavy and pellets easily Dram the supernatant and resuspend the pellet m TE (see Note 2). 6 When a Beckman 65 rotor 1s used, resuspend each DNA pellet m 4 mL of TE, and pool the DNA m a 50-mL hinge-cap tube. Suppose the volume of DNA solutzon measures y mL Add 0.1~ mL of ethldmm bromide solutzon and 1 ly g of CsCl (the volume will Increase by 25-30%) Mix to dissolve the CsCl, and place tube m the dark for 30 mm, during which a precipitate wzll form. Spm the tube at 6000g for 5 mm at 20-25°C (the debris may either float or sink) Carefully transfer only the clear reddish solutzon mto Quick-seal test tubes In order to completely fill the tubes use a comparable TE + CsCl + ethzdmm bromide solutzon (i.e., without DNA) Seal the tubes, place them m the rotor and centrifuge at 176,OOOg for 48 h at 20°C. 7 At the end of the run remove the tube and illuminate with a long-wavelength UV lamp (~320 nm), two bands should become visible Insert an 18-gage, 1 5-m needle into the upper part of the tube (to let au m) Connect a second 21-gauge, 1.5-m needle to a 1 0- or 3 0-mL syringe (verify that the plunger of each syringe 1s operating smoothly before inserting zt mto the tube) and insert zt slrghtly below the lower band Slowly draw off the lower band, avoiding the upper band. Position the tube above a disposable beaker and disconnect the syringe from the needle. Transfer the DNA mto a comcal 15-mL screw-cap tube. Measure the volume and mark its level on the surface of the test tube. Add 1 5 mL tsopropanol per 1.O mL CsClIDNA solution, vortex at medium speed for 10 s, and allow the phases to separate. Remove the upper, pmk phase Add TE to the mark mdzcatmg the orzgmal volume, and repeat extraction of ethzdmm bromide three addztzonal times until the lower phase becomes colorless, each time adding TE as necessary (see Note 3) Use a plpet to measure the volume and transfer the solution to a 15mL polypropylene, round-bottom tube with a cap Add 2.5 vol fresh TE per mL, mix, and then add 2 vol ethanol (e g , 3 5 mL of DNA solution + 7 0 mL ethanol) Vortex and incubate the tube at -20°C for at least 1 h. Centrifuge at 15,OOOg for 20 mm (Sorvall SS34 rotor), decant all of the ethanol, and resuspend the DNA pellet m 300 pL of TE DNA concentration can be determined by electrophoreszs on an agarose gel and tztratlon of the sample comparmg twofold dzlutzons against a hHzndII1 standard Dispense 270 PL TE containing 30 pg of fUSE5

20-mer Phage D/splay Epltope Library

143

into Eppendorf tubes, add 30 pL NaOAc + 600 pL ethanol, mix, and store at -20°C DNA will remain stable for at least 2 yr 8. Each alquot can be used for the productton of a library For this, pellet the 30 pg of vector, resuspend in water, and proceed to S’I digestion

3.1.2. SfiI Digestion of fUSE5 fUSE5 is a directronal clonrng vector having two 5”zI sites .3’) with different overhanging 3-base 3’ ends (5’ . I . GGCCNNNNNGGCC.. Inserts are spliced into this vector after a 14-bp stuffer 1s removed by @I cleav-

age (3). 1 Reaction mix (total volume 300 p.L)+ 50 pL fUSE 5 (30 pg) 3 0 pL BSA (100X) 30 pL restriction buffer 10X 15 pL S’I (150 U) 202 pL Hz0 (sterihzed by autoclave and filtered) 2. To mix, flick the tube several times, microfuge briefly, and incubate the reaction at 50°C for 2 h (overnight may improve the digestion efficiency) (see Notes 4 and 5). 3. Add to the reaction mix 3 pL of 0 5 M EDTA and 197 /.tL Hz0 Vortex briefly and extract once with phenol/TE and once with chloroform/I 4 Increase the volume of the DNA solution to 8 10 pL with TE. Add 90 nL NaOAc and 540 uL isopropanol, and mix by mvertmg the tube several trmes. Incubate on ice for 20 mm. 5. Microfuge for 20 mm and discard the supernatant, Recentrifuge the pellet for an addrtional minute, and using a drawn Pasteur prpet (or gel-loading tip), carefully remove all remaining traces of isopropanol (see Note 6) 6 Add 1.O mL of cold 70% ethanol and mix by inversion of the tube several times Microfuge for 5 mm and discard the ethanol Microfuge the pellet for an addttional minute, and remove all the remaining traces of ethanol as m step 5 7. Dissolve the pellet m 450 pL TE, add 50 pL of NaOAc and 1.O mL ethanol, mix by inversion, and chill on ice for at least 1 h. 8 Microfuge for 20 mm, wash the pellet (as m steps5 and 6), and dissolve it m 120 pL of TE (see Note 7)

3.1.3. Preparmg Annealed Ohgonucleotides

and Ligation

The use of 3 oligonucleotrdes 1s based on the approach of Cwirla et al (9). The oligonucleotide ON93 (see Subheading 2.1., item 19) used for the construction of the libraries contamed degenerate sequences according to the formula: NNKx20 (N consrstmg of a mixture of eqmmolar amounts of G, A, T, and C, and K of equimolar amounts of G and T). The two additional half-site

Stern and Gershom

144

oligonucleotides were ON 16 and ON 17. Thus, the amino acid sequence corresponding to the conserved regions was: G A S A S (20-a a Insert) S L T G G S A mixture was prepared of the three ollgonucleotides that were annealed, and was ligated with S’I cleaved fUSE5. This resulted in circularized DNA molecules surroundmg a single-stranded gap (correspondmg to a 60-nucleotide-long degenerate sequence). 3 1.3.1

PHOSPHORYLATION

1. The three ohgonucleotlde can be phosphorylated usmg a synthetic oligonucleotlde S-end labeling kit according to the manufacturers instructions (Fermantas Molecular Biology Instruments), carrying out several 50-pmol reactlons slmultaneously for each of the ohgonucleotldes Followmg heat mactivatlon of the enzyme no further steps are taken to purify the ollgonucleotldes and these are subsequently stored at -20°C. 3.1.3.2.

ANNEALING REACTION

1. Reactlon Mix (total volume 25 pL) I 0 pL ON93 (2.5 pmole) 2.5 I.IL ON16 (6 25 pmole) 2.5 FL ON17 (6.25 pmole) 5 .O pL 5X reactlon buffer (from DNA sequencing kit) 14pL Hz0 Anneal by heatmg m a heating-block for 10 mm at 68”C, remove the block from its holder, and let the tubes cool m an ice water bath, begin preparing the llgatlon reaction 3.1 3.3. LIGATION 1 a Reaction mix 12 p.L SfiI digested fUSE5 (3 0 pg) 25 pL total annealed ollgonucleotlde mix 142 yL H20. Heat the tube for 5 mm at 43°C and equilibrate the tube for 1 mm m a 16°C water bath b. Add 20 pL hgatlon buffer 10X 1 0 pL T4 DNA llgase (400 U) Mix gently by flicking the tube several times, mlcrofuge briefly, and incubate the llgatlon reaction at 16°C overnight (see Notes 8 and 9) 2 The next day add 160 PL H20. 40 yL NaOAc

ZO-mer fhage D/splay Epltope Library

3. 4

5. 6

145

800 yL ethanol Mix and Incubate 2 h at -20°C Microfuge 20 min, and remove the ethanol. Add 1.0 mL of cold 70% ethanol, mix by mvertmg the tube several times, and centrifuge for 5 mm. Discard the ethanol, microfuge 1 mm, and using a drawn Pasteur pipet remove all traces of the ethanol Resuspend the pellet m 10 pL of TE. Pool the legations before electroporation.

3.1.4. Preparing Electrocompe ten t Cells This procedure

is as described

m

ref. 7.

Day 1: 1. Dispense 500 mL super broth to each of two 2-L flasks and autoclave Prewarm to 37°C. 2. Inoculate 2.5 mL of LB with a smgle colony of E. colz MC1061 Grow m a 37°C shaker incubator overmght with vigorous aeratton. 3. Prepare, autoclave, and precool m refrigerator: 100 mL glycerol solution 15LoflmMHEPES(pH7.0). 4 Prechill sterilized 50-mL hmge-capcentrifuge tubes and all centrifugation bottles 5 Precool Sorvall SS34 and GS3 rotors (or their equivalents) Day 2: 1. Inoculate each flask containing 500 mL of prewarmed super broth with 1 mL of the overnight culture from d 1. Grow with vigorous aeration to an OD6s0of 0.6-0.7. Chill the flasks for 15 min in a large pan of ice water. From here on, everything is done in the cold. 2 Pour the culture mto precooled GS3 centrifuge bottles, centrifuge at 5000g for 15 mm at 4°C 3 Decant the supernatant, and using a Pasteurptpet remove all traces of the growth medium 4. Add to each bottle 500 mL of me-cold 1 mMHEPES and swirl the bottles untrl the pellet has been resuspended.Collect the cells as m steps 2 and 3. 5 Add to the cells m both bottles a total of 500 mL ice-cold 1 mM HEPES. Swirl the bottles until the pellet has been resuspendedand pool the cells mto a single bottle. Collect the cells as m steps 2 and 3. 6 Add 20 mL of an ice-cold glycerol solution Swirl the bottle until the pellet has been resuspendedand transfer the cells to a prechilled sterile hinge-cap centrtfuge tube. 7 Centrifuge the cells at 5000g for 15 mm at 4°C m a SS34 rotor 8 Repeat step 3

146

Stern and Gershom

9 Add 1.2 mL of ice-cold glycerol solution Swu-I the tube until the pellet has been resuspended Typically the volume will be approx 2 0 mL (if a smaller volume IS obtained add glycerol solution)

3.7.5. Nectroporation

(Day 1).

1. a. Prewarm to 37°C two 2-L flasks each containing 700 mL of LB b Precool on ice. 0 2-cm electroporatlon cuvets, the cuvet holder, and 40 Eppendorf tubes (1 5 mL). Place the chamber on a sheet of plastic m a contamer filled with ice. c Set the electroporator at 2 5 kV, 25 pF, and 400 fi d Set up a rack with 36 15mL tubes, each contammg 2 mL SOC that has been supplemented with 0 2 pg/mL tetracyclme Prewarm to 37°C. Prepare a supply of sterile glass S-inch Pasteur pipets, dropper bulbs, and two plpets suited for 2 5-FL and 50-60-pL volumes (see Note 10) 2 Place 50 pL of electrocompetent cells in an Ice-cold Eppendorf tube Add 2 5 pL of the llgatlon product (typlcally a quarter of the llgatlon), gently flick the tube five times, and return to the ice for 1 mm MeanwhIle remove a cuvet from the ice, put the dropper bulb on one of the Pasteur plpets, open one of the tubes of SOC, put the plpet m, and draw up some of the SOC (leave the cap of the tube face up on the bench) 3 Plpet the DNA/cell mixture directly into the bottom of one of the Ice-cold cuvets Tap the cuvet bottom several times on the bench to brmg the cells to the bottom, put the cuvet m the shde holder, and “zap” with the electroporator. 4 Quickly remove the cuvet from the holder, Immediately adding the prewarmed SOW0 2 pg/mL tet medrum to the cuvet MIX the solution by plpetatlon three times using a Pasteur plpet and transfer the cells to the open test tube. Replace the tube cap and vigorously shake it m a shaker incubator for 1 h at 37°C (phenotypic expression see Note 11) 5. To obtain a 5 x 10s library, the electroporatlon should be repeated 36 times, 1.e , 36 x 50-yL allquots Additionally, we recommend doing a final electroporatlon with 2 5 PL of the self-ligated DNA. 6 Followmg the phenotyplc expression period, remove a mlmmal sample from two or three test tubes to determine the titer of the library Split the 36 electroporatlons mto two groups of 18 test tubes and transfer the content of each group into one of the two 2-L flasks contaimng 700 mL of (prewarmed to 37’C) LB broth that has been supplemented with 20 pg/mL tetracycline Vigorously shake the flasks m a 37°C shaker incubator for 14-16 h 7. Determination of the hbrary titer: prepare four IO-fold dilutions of the minimal samples taken m the previous step into SOC medium. Carefully spot three 3-yL dots of each dilution on LAltet and allow the dots to dry Place the plates m a 37°C mcubator overnight and count the colomes on d 2. Most often there appear S- to lo-fold more colonies of the recombmants m relation to the electroporatlon

20-mer Phage Display Epltope Library

147

of self-ltgated vector. Smgle colomes will be visible on the 10-3-dtlutton spots indicating that there are approx IO* recombmant clones m the library.

3.1.6. Phage Purification (Days 2-4) Day 2: 1 The day after the electroporations, transfer the contents of the flasks to centrifuge bottles (Sorvall GS3 rotor or tts equivalent) and centrifuge at 6000g for 20 mm at 4OC 2. Transfer the supernatant to clean bottles and centrifuge them at 10,OOOg for 20 mm at 4°C in a GS3 rotor 3. Avordmg the small bacterial pellet, pour the cleared supernatant mto a graduated cylinder, note the volume, and transfer mto a 2-L flask that contams a sterile spur bar. Place the flask on a magnettc stirrer. 4. While sttrrmg, add 0.4 vol PEG/NaCl solutton to the phage solutton (1 L phage solution + 400 mL PEG/NaCl), star for 5 mm ((the solution will turn sbghtly turbid) Remove the flask and store at 4°C overnight Day 3: 1 Swirl the contents of the flask several times and divide tt mto several 50-mL hinge-cap tubes. Centrifuge the tubes m a Sorvall SS34 rotor (or its equivalent) at 27,OOOg for 20 mm at 4’C (we recommend using two centrifuges and ftllmg each tube twice wtth the phage + PEG/NaCl solution). Decant the supernatant, carefully avotdmg the phage pellet, and resuspend the pellet m 3 mL of TBS/aztde. For best results resuspend the phage pellets at 4°C for several h or overnight (see

Note 12). 2. Pool the resuspended phages from 8 tubes mto a single tube, centrifuge at 6000g for 5 mm at 4”C, and transfer the cleared supernatant to a clean tube. The tubes may be rinsed with an addtttonal 6 mL TBS/aztde making a total volume of 30 mL Add to that 15 mL PEG/NaCl, mix by inversion several times, and store the tube at 4’C overnight Day 4:

Centrifuge the tubes at 27,000g for 20 mm at 4°C. Discard the supernatant and resuspend the pellet m 2 mL of TBWazide.

3.1.7. Library Ampl/fica t/on Day 1: Prepare: a Two 2-L flasks with 500 mL of prewarmed with 50 pg/mL kanamycin

2X TY medium Supplement each

148

Stern and Gershom b Inoculate 5 mL of LB contammg 100 pg/mL kanamycm to prepare a “starter culture ” Shake overnight at 37°C

with K91Kan cells

Day 2: Here tlmmg 1s of the essence. One must prepare a stock of bacteria to be infected and a second culture of bacterta to be used later for amplification. 1 a. Inoculate

10 mL of prewarmed

terrtftc broth wtth

100 yL of the overnight

“starter culture” (K9 1Kan) and vigorously shake in a shaker incubator at 37°C b. After 60 mm inoculate the two flasks contammg 500 mL prewarmed 2X TY wrth 500 uL of the overnight “starter culture” and grow at 37°C with vigorous shaking 2 When the IO-mL culture gets quite turbid (after approx 2.5 h), start reading the OD,,, of l/10 dtlutton using a spectrophotometer When the OD 600 of a l/l0 dilution reaches 0 2, stop shakmg the flasks and allow the sheared F-pm to regenerate for 15 mm 3 Add the resuspended phages (see Subheading 3.1.6., d 4) to the IO-mL culture, allow 15 mm at room temperature for adsorption, and inoculate each large flask with half the bacterta/phage mixture Grow at 37°C for 6 h with vigorous shaking

(see Note 13) 4 To purify the ampltfted ltbrary repeat phage purtflcatton steps (Subheading 3.1.6.), only resuspend the phage pellet obtamed m the end m 7 mL TBS/aztde

(rather than 2) Transfer the library to a 15-mL screw-cap tube and store at 4’C The titer of the amplified library should be 1013-1014 phages/mL (see Note 14)

3.2. Biopanning Screening the bacteriophage library by the method known as biopanning is the crucial step in locating the epltope of an antibody. A simple and efficient method was devised for screening the vast mrxtures of randomly expressed pepttdes, enabling us to specifically identify binding phages following a single round of affinity purification. We carried out our biopannmg in three steps The first step is adsorption of an antimouse IgG, Fc fragment-specific antibody to a polystyrene well. The second step 1s the addition of the specific MAb to the anti-Fc-coated well, the MAb binding through its Fc fragment and leaving the Fab free to bind bacteriophages. The final step is addmg the library to the immobrlized immunocomplex. When panning we generally use an aliquot of the library contaming approx lOI’ phages. Nonbinding bacteriophages are removed by repeated washes and those phages binding to the MAbs are then eluted and tested. 3 2.1. P/ate Coa tmg Procedure 1 Ptpet 700 PL of TBS contammg 35 1.18of RbaMIgFc onto the bottom of a 35-mm ttssue culture 6-well cluster plate Place the plate m a humidified box at 4°C overnight on a rocker

20-mer Phage Display Epltope Lrbrary 2 The next day discard the excess solutton and immediately add the blockmg solution, completely ftllmg the wells. Incubate the plate for 2 h at room temperature 3 Wash the dish rapidly five times using TBS Fill each well halfway, swirl the liquid m the plate, and pour the contents mto a smk Slap the plate face-down on a clean piece of paper towel to remove residual fluid. Add to each well 700 pL of TBS/O 025% gelatm contammg 10 pg of a specific MAb, and put the plate m a humrdrfted box, rock the plate gently at room temperature for 4 h.

3.2.2. Affinity Selection 1. Wash the coated plates rapidly SIX times with TBS, each time slapping the plate face-down on a clean piece of paper towel Add 700 pL of TBS contammg IO” infectious particles Put the plates m a humidified box and incubate the box at 4°C overnight, shaking gently on a rocker 2 The next day remove the solutton containing the phages using a plpet and wash the plate rapidly 10 times m TBS (as described nbove) To elute the spectfically bound phages, add 400 pL elutton buffer and shake gently on a rocker for 10 mm at room temperature to dtssociate the immunocomplexed MAblphage and/or MAb/antl-Fc fragment annbodies (in either case the phage will retam its mfectivity) (see Note 15) 3. Transfer the solution containing the phages mto an Eppendorf tube contammg 75 pL of neutralizing solutton (see Note 15) 4 To improve the yield of phages, steps 2-3 can be repeated, dtsregard the washing step 5 Pool both phage soluttons

3.2.3. Multiple Rounds of Biopannmg The method that has been described above involves a single step of biopanning. This in many cases will detect numerous phages capable of reacting with a specific antibody wrth various affinities However, to find the phages with the highest affinities, a second and third round of panning are recommended. When carrying out more than a single round of biopanning, one must also be aware that a library can contain phages that for no obvious reason are able to multiply much faster than the rest, thereby enabling them to dominate in a liquid cell culture We were able to overcome this problem in the following manner 1 Amplify the phages after a round of btopanmng by platmg the phages at a density of 2-3 x lo4 on a 90-mm LA plate (tttratton and platmg of phages were done as described m Subheading 3.3.1.) 2 Remove the large plaques with the end of a Pasteur plpet 3 Collect the soft agarose layer by scraping tt off the bottom nutrient layer using a mtcroscope slide Pulvertze the collected agarose by injecting It through an 18-gage, 1.5-m needle connected to a IO-mL syringe directly mto a 50-mL

150

4 5 6

7

8 9.

Stern and Gershom hinge-cap test tube contammg 20 mL TBS Wash the syringe wtth an addmonal 10 mL TBS. Seal the closed tube with a layer of Parafrlm to ensure that tt accidentally does not open, and place rt horizontally on a rocker at 4°C overnight Centrifuge at 6000g for 20 mm at 4°C. Carefully collect the supernatant and prectpttate the phages with 0.4 vol PEG/NaCl solutron Mix well and incubate on ice 4 h . Centrtfuge m a SS34 rotor at 27 ,OOOgfor 20 mm at 4°C Discard the supernatant carefully mamtammg the mtegrtty of the pellet. Resuspend the pellet in 5 mL TBS/azide If several plates are used phages can be pooled at this stage Centrifuge at 5OOOg for 5 mm at 4’C and transfer the cleared supernatant to a clean tube. Add 0 4 vol PEG/NaCl, mix by mvertmg several times, and place at 4°C for 4 h or overmght. Centrtfuge at 27,OOOg for 20 mm at 4°C. Dtscard the supernatant and resuspend the pellet m 1 mL of TBS/aztde For the next round of panning (as described prevtously) use 25% of the phage solutron and store the rest (4’C) for future use

3.3. Phage Selection We generally plate the phages at a maximal density of 400 bacteriophages/ plate and pick 100 or more plaques, which are then propagated individually, purified and concentrated, and transferred to a nitrocellulose membrane. Sub-

sequently, the membrane is probed with the appropriate antibody enabling us to detect phages that bind to the specific antibody being tested. Selecting phages after a single round of panning usually generates a drversity of epitopes that bind the MAb with various affrmties. Through consecuttve rounds of biopanning and amplification, posittve phages can be selected and enriched Carrying out three or more rounds of biopanning will generally select the phages that have the strongest affinity to the antibody. This might be a single phage type or sometimes a few.

3.3.1. P/a ting Bacterrophages 1. Determine the titer of phages from the first round of selectton tn the followmg manner. a. Inoculate 2 5 mL of LB with a single colony of E. co/i K91Kan. Grow m a 37°C shaker incubator and vigorously shake overnight b. Prepare 0.5% agarose dissolved m water (brmg to a boll and cool to 50°C) In a 100 x 16-mm round-bottom screw-cap tube put 200 l.tL of the overnight culture and 3 5 mL of the agarose Roll the test tube brrefly between both hands and qutckly pour its contents onto a prewarmed LAlKan plate Prepare three lo-fold dtluttons of the phages and once the plates have dried spot three 3 l.tL drops of each dtlutton on the plate After the drops dry, incubate the plates at 37°C overnight, by which time tiny turbid plaques will become VIStble. Calculate the ttter of the phages.

20-mer Phage Display Epltope Library

151

2. Prepare an overmght culture as described in step la. Inoculate 10 mL of prewarmed terrific broth in a 125 mL flask with 200 pL of the cells, and vigorously shake at 37°C. When the IO-mL culture becomes quite turbtd (after approx 2.5 h), start reading the ODhOs of l/10 dtlutions. When the OD 600of a l/10 dtlutton reaches 0.2, stop shaking the flask and allow the sheared F-pili to regenerate for 15 mm 3 To plate the phages remove and place the cap of a 100 x 16-mm round-bottom screw-cap tube on the bench facing upward and lean the tube on the cap almost horrzontally Lay 200 pL of the cells 1 cm from the tube openmg and add to the drop of cells a phage solution containing 300-500 phages (about 20-10 pL) Raise the tube to a vertical posmon and the drop will slide to the bottom of the tube. Replace the cap and incubate for 15 mm at room temperature Plate as described above, step lb

3.3.2. Propagating Single Plaques 1. Inoculate 2.5 mL of LB with a single colony of E. coli K91 Kan. Vtgorously shake m a 37°C shaker incubator overnight. 2 The next day fill a U-bottom sterile 96-well plate with 200 pL of terrific broth containing a loo-fold dilution of the E. colz K91Kan overnight culture. Stab single plaques using sterile toothpicks and transfer them to the wells of the plate. Secure the plates m a humidified box and shake overnight gently, to avoid crosscontammatton of wells, 37°C (see Note 16). 3. Centrifuge the plates at 15OOg for 20 mm at room temperature and transfer m a sterile manner (avoiding the bacterial pellet) 125 pL of the supernatant to a flatbottomed 96-well plate already contaming 50 pL of PEG/NaCl solution. Trtturate the solution m the tip several times, mixing well Incubate the plates at 4°C for 2 h and save the angina1 plates containing the bacterial pellet The latter will be used as master plates and should be sealed with parafilm and stored at 4’C. 4 Centrifuge the plates at 15OOg for 20 mm at room temperature. To remove the bulk of the fluid invert the plate mto a biohazard bag, collectmg the waste for disposal. The residual fluid IS removed by slapping the plate gently face-down on several layers of paper towels. Then resuspend the pellet in a total of 100 yL TBS

3.3.3. Probing the Phages 1 Prepare mtrocellulose membrane blots by applying 8OyL aliquots from each well to a MilliBlot-S system usmg a vacuum transfer system. 2. Block membranes m TBS/lO% evaporated milk solutton by rocking them for 1 h at room temperature. 3. After a brief wash m TBS, incubate the membrane in TBS/l% evaporated milk contaimng 1 pg/mL antibody at 4”C, overnight, with gentle rocking. 4 Wash the membrane five times for 5 mm each in TBS Add TBS/ 1% evaporated milk containing GtaMIgHRP (use correct dllutlon according to manufacturers’ recommendation) and incubate it for 1 h at room temperature, with gentle rockmg.

Stern and Gershom 5 Wash the membrane five times for 5 mm each m TBS 6 The positive stgnals can be detected either by the TMB membrane peroxidase substrate system or by ECL tmmunodetection

3.4. DNA Sequencing I 2

3 4

5

Inoculate 2 5 mL of LB supplemented with 50 pg/mL kanamycm with a single colony of E. colz K91 Kan cells, and grow m a 37°C shaker incubator overnight For sequencing 16 phages,maculate 40 mL of terrific broth with 400 pL of the above overnight culture, mix, and dispense2 5-mL ahquots mto sixteen 100 x 16-mm round-bottom screw-cap tubes. Using sterile toothpicks inoculate each tube with the phage that 1sto be sequencedand grow for 6 h m a 37°C shaker incubator For preparation of ssDNA from the phageswe recommendthe Promega Wizard M I3 DNA Purtficatton System To determine the sequenceof the random peptide-encoding segment,the smglestranded phage DNA was sequencedusing a specific antisenseoligonucleotide primer (see Subheading 2.4., item 1). It is also recommendedthat the sequencmg reactions be set up accordmg to the protocol supplied by the Sequenaseversion 2.0 DNA sequencingkit. For clear resolutton of the required sequenceswe recommend a 6% sequencing gel 38 x 50-cm run at 1800 V for approx 2.5-3 0 h The gel IS then dried and exposed to X-ray Btomax MR 2 film for up to 48 h

4. Notes 1 Preparation of fUSE5 vector from frozen bacterial pellets was found to be very mefftctent Thus all plasmid preps were performed on fresh bacteria 2 Yields of fUSE5 plasmid were at times as low as lo-20 pg/500 mL from an overnight culture grown m super broth Therefore, we advise storing the DNA of single large preparations m NaOAc/ethanol at -20°C while several more large preps are produced To obtain clearly vtstble bands m the CsCl gradients, we generally place m each ultracentrtfuge tube the equivalent of two or three large preparations. 3. In the event that the phasesdisappearadd a few gramsof CsCl and mix This ~111 causephasesto separateonce more. 4. At times fUSE5 DNA samplesseemedto undergo degradation rather quickly when kept under standardconditions Therefore along with the S’I digestion we recommend preparing a control of the DNA samplewtthout the enzyme (with all other reagentspresent). 5. After digestion 1scompleted, run the followmg on a 0.8% agarosegel a sample from digested DNA, a sample of undigested DNA, and a marker (we use hHzndII1) 6 The 14-bp stuffer ISremoved by tsopropanolpreclpltation That is why one should take special care to remove all traces of the supernatant and subsequent70% ethanol wash solutton.

ZO-mer Phage Display Epltope Library

153

7. At ttmes the pellet can be difficult to resuspend When this occurs the DNA solution can be warmed to 42°C for 30 mm to help dtssolve the DNA. 8. An ice bucket filled with water precooled to 16°C can be used. The ligation mixes are placed in a Styroform float m the water and the bucket IS placed covered at 4°C overmght 9 To obtain a 5 x lo8 library, nine ltgattons are carried out, while a l/10 reaction IS a self-ltgatron control contammg a mix of fUSE5 vector, ON16, and ON17 10 Emprrically we found that 2.5 pL of the bgatton reactron (0 75 pg covalently close-gapped fUSE5) produce IO7 transformants m the following protocol 11 The low levels of tetracyclme are not enough to affect sensitive cells but are enough to induce expression of the tetracyclme-resistance gene on the fUSE5 vector. Therefore, successfully electroporated cells will be ready to be challenged by a high concentratron of tetracycline following the phenotyptc expressron period 12 We also tried centrrfugmg the phages using either the Sorvall GSA or GS3 rotors at 10,000 and 8OOOg, respectively, for 50 mm However, using both those rotors reduced our yield of phages to 10% of the total phages, while 90% remained m the supernatant 13 We do not amplify the library for longer periods of time, since some ltbrartes contain phages that replicate at extremely fast rates, which enables them to quickly dominate the culture These phages contain inserts of the correct size They were discovered when an aliquot of the library was plated on LA/Kan and a few plaques became visible after 3 h of mcubatron, rncreasmg m stze after an overnight mcubatton The other plaques on the other hand were much smaller and were barely visible even followmg an overmght mcubatton 14 In an effort to test the diversity of our library, mdtvidual clones were prcked at random and sequenced A varrety of sequences were obtamed, almost all contammg a 60-nucleottde-long insert. However, shorter sequences were also found, though to a much lesser degree These sequences exrst because the 93-base-long oligonucleottde contammg the degenerate sequences had not been purified from a gel before clonmg Therefore, smce factors affectmg clonmg depend exclusively on compatible sticky ends and msertton m the correct reading frame, a recombmant mfectrous particle encoding sequences anywhere between 0 and 20 ammo acids could be formed regardless of the length of the degenerate sequence 15 Check the pH of both the elutton buffer (pH 2 2) and the neutraltzmg solutron (pH 9.1) before use The mixture of the two comes out pH 7 O-8 5. One can use pH indicator paper for this test 16 Plaques will be tmy and extremely drfftcult to see When prckmg the isolated plaques we found tt easiest to hold the plate up to the light m order to see them clearly

References I Parmley, S F and Smith, G P (1988) Antibody selectable ftlamentous fd phage vectors affunty purrfrcatron of target genes Gene 73,305-3 18.

154

Stern and Gershonr

2. Scott, J K. and Smith, G P (1990) Searchmg for peptide ligands with an epitope library Science 249,386-390 3 Smith, G. P and Scott, J K (1993) Libraries of pepttdes and proteins displayed on filamentous phage Methods Enzymol. 217,228-257. 4. Sambrook, J , Frttsch, E. F , and Maniatts, T (1989) Molecular Clonmg: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Sprmg Harbor, NY 5 Raleigh, E A and Wilson, G (1986) Escherichuz colz K-12 restricts DNA contaming 5-methylcytosme Proc. Natl. Acad. Scl. USA 83,9070-9074. 6 Huynh, T V., Young, R. A , and Davis, R W (1985) Constructmg and screemng cDNA librartes m agtl0 and hgtll m DNA Clonmg, vol. I (Glover, D M , ed ), IRL Press, Oxford, England, pp 56-110. 7. Smith, G P. (1992) Cloning zn j7JSE Vectors (edition of February 10, 1992), A Laboratory Manual. University of Missouri, Columbia, MO 8 Little, P F. R (1987) Choice and use of cosmid vectors m DNA Clonmg, vol III (Glover, D. M., ed.), IRL, Oxford, pp. 19-42 9 Cwu-la, S E , Peters, E A., Barret, R W , and Dower, W J. (1990) Peptides on phages a vast library of peptides for tdentifymg bgands Proc. Natl. Acad. Scz. USA 87,6378-6382

17 Construction of Disulfide-Constrained Random Peptide Libraries Displayed on Phage Coat Protein VIII Alessandra

Luzzago and Franc0 Felici

1. Introduction Proteins III and VIII of filamentous phage coat (I) have been reported as suitable for the construction of phage-displayed peptide libraries (2-4). Protein VIII (pVII1) is the major coat protein, present m approx 2700 copies per phage particle, and its amino-terminus tolerates insertions of up to six amino acids (5-7). Larger peptide inserts can be displayed only when a two-gene system is used (6,8), thus obtaining hybrid phage particles containing both recombinant and wild-type proteins. The high copy number of recombinant pVII1 molecules per phage particle provides a highly sensitive system, and linear and constrained peptide libraries in pVII1 have been successfully used for the selection of specific hgands for several different monoclonal and polyclonal antibodies (9). Constrained random peptide libraries, in which the number of possible conformations that a linear peptide can assume is limited, could lead to the selection of binders with increased affinity. Using invariant cysteme residues flanking the randomized inserts is a simple way of accomplishing such a constraint. The presence of disulfide bonds in the recombinant proteins can be verified when pVII1 is used as molecular vector, since the wild-type pVII1 sequence does not contain any cysteine residue (JO). The protocol that follows describes the construction of a cystemeconstrained random nonapeptide library in pVII1, using the pC89 phagemid vector (8), which contains gene VIII under the control of the IPTG-inducible LAC promoter. From

Methods

M Molecular Edlted

by

Bo/ogy, S CablIly

vol 87 Combmatord 0 Humana

155

Press

Peptide

Inc , Totowa.

Ltbrary NJ

Protocols

Luzzago

156

and Felice

2. Materials

2.1. Preparation

of Oligonucleotide

Inserts

1 Template ollgonucleotlde 5’ GCTTTTGCTGGATCCCCGCA(N),,GCAGAA TTCACCCTCAGCAG 3’ 2 Pruner ohgonucleotlde. 5’ CTGCTGAGGGTGAATTCTGC 3’ 3 5X SOH buffer. 200 mM Tns-HCI, pH 7.5,50 mM MgCl*, 250 mM NaCl 4. dNTPs (Pharmacla, Uppsala, Sweden) 5 Klenow subunit of DNA polymerase I, 5 U/pL (Boehrmger, Mannhelm, Germany) 6 NuSleve GTG agarose (FMC BloProducts, Rockland, ME). 7 5X TBE buffer: 0 45 M Tns-borate, 0 0 1 M EDTA 8 9 U/pL BumHI (Boehrmger Mannhelm). 9 10 U&L EcoRI (Boehrmger Mannheim). 10 11

12 13

14 15 16 17 18. 19

RestrIction

enzyme

2.2. Preparation I 2 3 4. 5. 6

buffer B (Boehrmger

Mannhelm)

10 mCl/mL [a-32P]-dATP (-3000 Wmmol, Amersham, Little Chalfont, UK) Restriction enzyme buffer M (Boehrmger Mannhelm) 30% Acrylamldeibls-acrylamlde stock mix prepare by dlssolvmg 29 g of acrylamlde (Sigma), I g N,N’-methylene-bls-acrylamlde (Sigma, St Louis, MO) in water, final volume 100 mL 10% Ammomum persulfate (Sigma), prepared m water and stored at 4°C TEMED (Sigma) Gel-loading buffer* 0 25% bromophenol blue (Sigma), 0 25% xylene cyan01 FF (Sigma), 30% glycerol in water TE: 10 mMTns-HCl, pH 7 4, 1 mMEDTA, pH 8.0 Mlllex 0 22-ym filters (Mllllpore, Bedford, MA) Sephadex G50 (Pharmacla)

of Recipient

Vector

10 pg pC89 Vector DNA (8) 9 UlpL BumHI (Boehrmger Mannhelm) 10 U&L EcoRI (Boehringer Mannhetm). Restriction enzyme buffer B (Boehrmger Mannhelm). DNA molecular weight marker III (Boehrmger Mannhelm). Gene Clean II kit (BIO 101, La Jolla, CA)

2.3. Ligation 1 Purified inserts and vector 2. 1 U/pL T4 DNA hgase, with supplied buffer (Boehrmger Mannhelm) 3 Gene Clean II kit (BIO 101)

2.4. Preparation

of Competent

Cells and Electrotransformation

1 Bacterial strain XLl-blue (Stratagene, La Jolla, CA) 2 LB Medium. prepared by dlssolvmg 10 g of Bacto-tryptone, 5 g of Bacto-yeast extract and 10 g of NaCl in water, adjustmg the pH to 7.0 with 5N NaOH and adJustingthe volume to 1 L with water Sterlllze by autoclavmg

Dwlfide-Constrained

Peptide

157

Libraries

3. Amptcillm stock solution* 50 mg/mL m 50% ethanol stored at -20°C 4 Ampicdlm LB agar plates (150 mm) contammg 1% glucose and 50 pg/mL Ampicillm. 5. Tetracyclme, stock solution 20 mg/mL m 50% glycerol stored at -20°C m hghttight containers 6 Tet LB agar plates (90 mm) contammg 20 pg/mL tetracycline. 7 Glycerol (Ultrapure, BRL, Gaithersburg, MD) 8. 0.2-cm Gene pulser cuvets (Bio-Rad, Hercules, CA). 9 Gene pulser apparatus (Bio-Rad) 10 , SOC medium* 2% Bacto-tryptone, 0.5% Bacto-yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl,, 10 mM MgS04, 20 mM glucose 1 I IPTG stock solution 30 mg/mL m water, stored at -20°C 12. X-gal stock solutton. 30 mg/mL m dimethylformamide, stored at -20°C. 13. LB agar plates (90 mm) containing 50 pg/mL Ampiclllm, 40 pg/mL IPTG, and 40 pg/mL X-gal

2.5. Library Amplification

and Titration

1 2 3 4 5 6. 7. 8

LB medium contammg 50 pg/mL Ampicilhn Glycerol (Ultrapure BRL). M 13K07 helper phage (Pharmacia) PEGINaCl: 20% PEG 8000,2 5M NaCl. TBS/NaNs. 50 mMTris-HCl, pH 7 5,150 mM NaCl, 0 02% NaNs Cesmm chloride (Sigma-Aldrich, Steinheim, Germany) Bacterial strain’ XL1 -blue (Stratagene), Terrific broth* 12 g of Bacto-tryptone, 24 g of Bacto-yeast extract, and 4 mL of glycerol m 900 mL of distilled water Autoclave on liquid cycle. Allow to cool to 6O’C and then add 100 mL of a sterile solution of 0 17M KH2P04, 0 72M K2HP0, 9 LB agar plates containing Ampicrllm, IPTG, and X-gal (Subheading 2.4.)

2.6. Identification 1. 2. 3 4 5 6 7. 8

of Disulfide

Bonds in pVll/-Displayed

Peptides

2 x 10” Ampictllm Transducing Units (TU) of Cesmm chloride-purified phage. Myoglobm molecular weight marker (Sigma) Stock acrylamide: 49% acrylamide, 0.5% NAN’-methylene-his-acrylamide. Stock buffer: 3 MTris-HCl, pH 8 3. Glycerol TEMED Ammomum persulfate (25%) Cathode buffer. 17 9 g Tricme (Sigma), 12 1 g Tris base, 1 g SDS, water to a final volume of 1 L. 9 Anode buffer. 0 3 M Tris-HCl, pH 8 3 10 2X Sample buffer. 2 mL 10% SDS, 2 mL 50% glycerol, 170 pL lMTris-HCl, pH 8 0,630 pL H20, 200 yL 2% bromophenol blue.

158

Luzzago and Felice

11 Blotting buffer 14.4 g glycme, 3 g Trts base, 200 mL methanol, water to a final volume of 1 L 12 Immobilon PVDF Transfer Membrane (Mrlhpore) 13 Genie electrophorettc blotter apparatus (IDEA Screntrftc Company, Corvahs, OR) 14 2-Mercaptoethanol 15 50 m&f Potassium-phosphate buffer, pH 8.5. 16. DIG protem detection kit (Boehrmger Mannhelm)

3. Methods 3.1. Preparation

of Oligonucleo

tide inserts

1 Ohgonucleotrde annealing mix 200 pmol of each ohgonucleotlde, primer, and template with 40 pL of SOH buffer and add water to a final volume of 200 pL. Heat at 65°C for 5 mm and then leave 5 mm at room temperature. Perform the annealing, m trtphcate, m Eppendorf tubes 2 Synthesize double-stranded ohgonucleotrdes by adding to each tube 40 pL of dNTPs (2.5 mM concentratton of each deoxynucleotide) and 10 pL of Klenow Incubate for 2 h at 37’C (see Note 1). 3 Run 10 pL of the reaction mixture on a 4% NuSleve agarose gel m 0 5X TBE buffer m parallel with 10 pmol of single-stranded template ohgonucleotide A difference m mtgration between the two samples should be clearly visible 4 Collect together the three samples and make one phenol, one phenol/chloroform, and one chloroform extractlon, followed by three ether extractions (II) Dry the sample in a speed-vacuum apparatus 5 Resuspend the pellet m water, add 50 pL of restrictton enzyme buffer B, 200 U of EcoRI and 200 U of BamHI m a final volume of 500 pL Incubate at 37°C for 7-8 h 6 Make one phenol, one phenol/chloroform, and one chloroform extraction, followed by three ether extractions Dry the sample m speed-vacuum and resuspend the pellet m 100 pL of water. 7 Take 1 pL of the digested mserts and mix with 6 pL of restriction enzyme buffer M, 1 pL of 32P-labeled dATP, 1 pL of 10 mMdGTP, 28 pL of water, and 1 pL of Klenow, and incubate 30 mm at room temperature. 8 Prepare a 0 5-mm thtck, 25-cm long 20% nondenaturmg polyacrylamtde gel m 1X TBE by mixmg 33 3 mL of acrylamide stock, 10 mL of TBE 5X, 6 35 mL of water, 350 pL of 10% ammomum persulfate, and 35 pL of TEMED 9 Load the digestion product, diluted 1 1 with 50% glycerol, m a large central slot, add 8 pL of gel-loading buffer to the radiolabeled Insert, and load mto two slots at both srdes of the central one (1.5 pL each) Run at 150 V at 4°C until the fast blue is close to the end of the gel (it will take more than 12 h) 10 Wrap the gel m Saran Wrap and expose to X-ray film for 1 h wtth an mtenstfymg screen.

Disulf/de-Constrained

Peptide Llbranes

759

11 Using a scalpel, excise the piece of polyacrylamide contammg the doubledigested fragment, which can be identified through the two flankmg radloactlve bands (see Note Z), break mto small pieces, and transfer to a tube 12. Add enough TE to cover the acrylamide fragments and shake it overnight at room temperature 13 Filter through 0 22-pm Mlllex filter and concentrate m speed-vacuum to reach a final volume of 100 PL 14 Plug a plastic 2-mL prpet with a little cotton or glass wool. Fdl the plpet with swollen G50 up to 0.5 cm from the top, avoiding the formation of air bubbles. Wash the column with 5 mL of water 15. Add the sample to the top of the column and let it be absorbed Add 200 pL of water and let it be absorbed. 16 Add water and collect 250~pL ahquots (approx 6 drops). The double-stranded Insert should elute m fractions 3-6 (see Note 3). 17. Collect the fractions, dry m the speed-vacuum, and resuspend m 50 FL of water Run 5 pL on a 4% agarose gel prepared as described m step 3

3.2. Preparation

of Recipient

Vector

1 Mix 10 pg of pC89 vector with 40 U of EcaRI, 40 U of BarnHI, 20 yL of buffer B, and water to a final volume of 200 FL Incubate for 5 h at 37°C (see Note 4) 2 Load 10 pL of the digestion mixture on a 1% agarose gel m parallel with pC89 undigested vector and a DNA molecular weight marker. The digested product should appear as a single band of approx 3500 bp 3 Purify the digested vector with Gene Clean II kit, according to the manufacturer’s instructlons, and resuspend m water m a final volume of 50 pL

3.3. Ligation 1 Set up a pilot experiment by combmmg 100 ng of digested vector and the purlfied fragment at different ratios (for example, try 1X, 2X, 5X molar excess of the insert), m a total volume of 20 FL, containing 2 pL of IOX ligation buffer and I pL of T4 hgase. As a control also make a hgatlon with all the components except the DNA Insert. Incubate overnight at 15°C 2 Run the ligated mixtures on a 1% agarose gel, next to 100 ng of linearized vector (see Note 5) 3, Set up the ligation by scaling up 10 times the chosen condltlon components 4. Desalt and purify the ligation product using Gene Clean II kit, according to the manufacturer’s instructions, and resuspend m water m a final volume of 50 pL

3.4. Preparation

of Competent

Cells and Electroporation

1. Streak XLl-blue bacteria on Tet LB agar plates and grow overmght at 37°C 2 Inoculate a smgle colony m 10 mL of LB contaimng 20 ,ug/mL of tetracycline, and grow overnight at 37°C

160

Luzzago

and Fehci

3. Transfer the overmght culture in 1 L of LB and grow, with vigorous shaking, at 37°C untrl the culture reaches an OD6s0 of 0.5-O 8. Use big flasks (for example, 3-5 L) to allow the culture to aerate. 4. Chdl the flask m Ice for 10 mm and centrifuge m a cold rotor at 4000g for 15 mm All the subsequent steps should be performed keeping the bacterial pellet m me and using me-cold water (see Note 6) 5. Resuspend the pellet m lo-20 mL of water by vigorous pipetmg and then add water to a total volume of 1 L and centrifuge as above 6. Resuspend the pellet as m step 5 and then add water, up to a final volume of 0 5 L Centrifuge as above 7 Resuspend the pellet m 30 mL of 10% me-cold glycerol and centrifuge 8 Resuspend the pellet m 10% glycerol m a fmal volume of 5 mL, freeze m alrquots m lrqmd nitrogen, and store at -80°C (see Note 7). 9 Distribute 1-5 PL ahquots of the ltgatlon product m 20 Eppendorf tubes and keep on me Chill the cuvets m ice 10 Thaw competent cells m ice and distribute 50 yL mto the DNA-contammg Eppendorf tubes 11 Set the Gene Pulser apparatus at 2 5 kV, 25 I.LF and the Pulse Controller Unit at 200 &2 12. Transfer the cells-DNA mixture to an me-cold cuvet, insert m the apparatus, and apply one pulse 13 Add immediately 1 mL of SOC medium mto the cuvet and transfer the cell suspension to a 250-mL flask 14 Repeat the electroporatton for all the remammg samples, collecting them altogether in the flask. Incubate at 37°C with agitation for 1 h 15 Make an appropriate ddutron of the cell suspension (for example, 1.1000) and plate aliquots (10, 30, 100,300 pL) on Amp-Xgal-IPTG plates (see Note 8) 16 Plate the undduted cell suspension m an appropriate number (to obtain 5 x 1055 x lo6 colonies per plate) of Amp LB agar plates (150 mm) and incubate overmght at 37°C

3.5. Library Amplification

and Titration

1. Collect the bacteria by scraping the colonies, add LB containing 50 wg/mL Amp and 10% glycerol (approximately 10 mL for each plate), and pool altogether 2 Dilute an ahquot of cell suspension in 2 L of LB, containmg 50 pg/mL Amp, to reach an ODeoa of 0 05. Incubate at 37°C with vigorous shaking until the OD6ao 1s between 0.2 and 0 3 (approx 2-3 h) Store the remaining cell suspension in ahquots at -80°C (see Note 9) 3 Infect the culture with Ml 3K07 helper phage (multiplicity of mfection=20) and add IPTG (800 PL of the stock solution per L of culture) Grow with vigorous shaking at 37°C for 5 h. 4 Centnfuge the culture m a Sorvall at 8600g for 30 mm and recover the supernatant 5 Add to the supernatant 500 mL of PEG/NaCl, mix, and incubate overnight at 4°C

D/sulfide-Constrained

Peptide L/brat-/es

761

6 Centrtfuge m Sorvall at 4°C (8600g) for 1 h, eliminate the supernatant, and resuspend the phage-contammg pellet m 20 mL of TBS/NaN, Transfer the phage suspension mto a polycarbonate tube. 7 Incubate the phage suspension in a water bath at 70°C for 1 h, cool in ice for 5 mitt, and then centrifuge for 1 h m Sorvall at 17,500g to eliminate cell debris 8 Collect the supernatant mto a new tube, add 5 mL of PEG/NaN,, and Incubate at 4°C for 2 h. 9 Centrifuge m Sorvall for 30 mm at 17,500g to pellet the phage 10. Resuspend the pellet m 20 mL of TBS/NaN, (see Note 10). 1 I. Add 9 g of CsCl to the phage suspension and transfer mto two SW40 polyallomer tubes F111the tubes with lsototuc TBS/CsCl solutton, equilibrate the tubes, and centrifuge at 208,OOOg for 48 h at 19°C Stop without using the brake. 12. Collect the phage band (top band) with a syrmge and transfer to a polycarbonate tube, fill the tube with TBS, and centrifuge at 220,OOOg for 4 h at 4°C m a 70 TI rotor. 13 Discard the supernatant and resuspend the pellet m 1 mL of TBS/NaN,. 14 Inoculate XLl-blue cells m 10 mL of terriftc broth and incubate at 37°C with vigorous agitation until a 1 10 dtlutton of the culture reaches an OD,,, of 0 15 15 Titrate the phage by making appropriate dtluttons of the amphfred hbrary m TBS/ NaN, and mrx 10 yL of each dilution with 200 pL of cells 16. Incubate for 15 mm at 37°C without agitation and 30 mm at 37°C with vigorous shaking 17. Spread on Amp-Xgal-IPTG plates and incubate overnight at 37°C

3.6. Identification

of Disulfide

Bonds in p W-Displayed

Peptides

1 Prepare a 0.5-mm thick, 20-cm long Trtcme gel (see Note 11) with the followmg composmon running gel contammg 4 2 mL glycerol, 3 3 mL H,O, 7 5 mL stock buffer (see Subheading 2.4., item 4), 7 5 mL acrylamlde stock (16 3% final), 200 /.tL ammonmm persulfate (25%), and 20 pL TEMED, stacking gel contammg 1 mL acrylamtde stock, 6 4 mL HzO, 100 pL ammomum persulfate (25%), and 10 pL TEMED 2. Prepare phage samples m duplicate by mtxmg 1 x 10” TU with 10 uL of sample buffer m a final volume of 20 pL Boll samples for 2 mm and load onto the gel. Load 20 pL of molecular weight marker reconstituted as described by the manufacturer Fill the upper chamber with cathode buffer and the lower chamber with anode buffer and run the gel overnight at 130-140 V until the blue 1s at a 3-cm distance from the bottom end of the gel. 3 After electrophoresis, transfer the proteins onto Immobtlon Membrane by using a Genie apparatus, according to the manufacturer’s mstructton (see Note 12) 4 Cut the membrane m two parts and incubate one piece m 2% (v/v) 2-mercaptoethanol in potassium-phosphate buffer. Detect free SH groups on both pieces using the DIG protein-detection kit, according to the manufacturer’s mstructton (see Note 13)

Luzzago and Fehci 4. Notes 1 In our expertence, for this purpose Klenow works more efficiently than polymerase-chain reactron (PCR) and m this way, overampltfrcation of particular classes of ohgonucleotide templates IS mmimized 2 Quite often it is also possible to visualize the digested products by puttmg the gel on a thin-layer chromatography sheet with a fluorescent marker and illummatmg with a UV lamp (300-nm wavelength) The digested products usually run lust above the xylene cyan01 dye 3. It 1s possible to monitor the elutton by exctsmg part of the radioacttve band from the polyacrylamtde gel, and testing the fracttons through measuring 32P content with a beta counter 4 It 1s Important to obtam a complete double-digested vector DNA, m order to avoid recncularization of the plasmid m the hgation step This can be checked by performmg m parallel the EcoRI and BamHI digestions separately, checkmg that they are complete 5 In the control ligation reaction, only unhgated linear vector should be visualized, while m the others a reasonable amount of ctrculartzed DNA should be present 6 The protocol descrtbed 1s essentially that reported by Dower et al (12) It is important to use high-quality water to wash the cells We have also found an increase of the transformation efficiency by using (when possible) new flasks and new centrifuge tubes, which were washed once with distilled water and then sterilized by autoclavmg. 7 The preparation of competent cells with a high efficiency of transformation is extremely important for constructmg a high complexity library. Generally, following the method described here, we have obtained an average efficiency of lo9 transformants/yg of supercoiled pC89 vector DNA, using XLl-blue bacterial strain Competent cells should be tested for thetr efftctency of transformatton using supercoiled pC89 vector DNA at vartous concentrations. A pilot transformation with the ltgatton product IS also necessary to determine how much hgation mixture should be used in each electroporation and the number of electroporation rounds necessary to obtain a high-complextty library. 8. Titration on Amp-Xgal-IPTG plates allows assessment of the total number of recombinant clones and the percentage of blue colonies that contain productive inserts pC89 phagemid vector contains an m-frame fusion of the pVII1 gene to the a-peptide of E colz P-galactosidase, then codmg sequences being separated by an amber stop codon (8) XLl-blue 1s a suppressor strain, thus the expression of pVIII-a-peptide fusion protems results m correspondmg blue colonies on Xgal-IPTG mdtcator plates. After the overnight mcubatton, plates can be left for a few hours at 4”C, to better visuahze the blue color 9 Library amplification can thus be performed again at any time, starting from the frozen cell suspension. 10 Cesmm chloride purifrcatton descrtbed m the subsequent steps IS necessary when a single selected phage has to be assayed for the presence of dlsulftde bonds m the recombmant pVII1 proteins For ltbrary preparation, an alternatrve to cesmm

Dmdfide-Constrained

Peptide Libraries

763

chloride gradient is to repeat steps 7 and 8, finally resuspendmg the phage pellet m 1 mL of TBS/NaN, In both cases the library can be stored at -80°C, m ahquots contammg 7% DMSO 11 Phage electrophoresis through Tricme gel allows separation of recombinant pVII1 protein from wild-type pVII1 The method is a modified version of the original protocol (13)) accordmg to R Perham (personal commumcation), 12. Any other protem-transfer apparatus is also suitable. Note that pVII1 is a small and quite hydrophobic protein and its retention by the membrane can represent a problem We have found that Immobilon has the highest pVIII-binding capabtlity among several different kinds of membranes that we have tested (mtrocellulose, nylon, etc ) Before using Immobilon for protein blot, wet the membrane m methanol for a few seconds, then immerse m water and fmally m blotting buffer: do not allow the membrane to dry until protems have been transferred onto it. 13 It should be possible to visualize m the reduced membrane a band correspondmg to recombinant pVIII, smated at approximately the level of the 6 3 kDa band of the marker. No visible correspondmg band m the nonreduced counterpart will mdicate that the peptide inserts of a specific phage clone are Indeed constrained by disulfide bonds

Acknowledgments We thank Janet Clench for lingulstlc

revlslon of the manuscript.

References 1 Model, P and Russel, M (1988) Filamentous bacteriophage, m The Bacteriophages 2 (Calendar, R , ed.), Plenum Press,New York, pp 375-456 2. Scott, J. K and Smith, G P. (1990) Searching for peptide hgands with an epitope library. Science 249,386-390 3 Winter, J (1994) Bactertophage display Pepttde libraries and drug discovery. Drug Dev Res 33,71-89 4 Fehci, F , Luzzago, A , Monaco, P., Nicosia, A , Sollazzo, M., and Trabom, C. (1995) Peptide and protein display on the surface of filamentous bacteriophage, m Biotechnology Annual Revzew,vol. 1 (El-Gewely, R , ed ), Elsevier Science B V , Amsterdam, pp. 149-183 5 Ilyichev,A. A ,Minenkova,O O.,Tat’kov, S. I ,Karpyshev,N N ,Eroshkm, A M., Petrenko, V A., and Sandachshiev,L S (1989) Production of a viable variant of the Ml3 phage with a foreign peptide inserted mto the basic coat protein Dokl. Acad. Nauk. USSR307,481-483 6 Greenwood, J , Wilhs, A. E , and Perham, R. N. (1991) Multiple dtsplay of foreign peptides on a filamentous bacteriophage peptides from Plasmodlum falclparum cncumsporozoite protein as antigens J Mol Biol. 220,821-827 7 Iannolo, G , Mmenkova, 0 , Petruzzelh, R., and Cesarem,G (1995) Modifying filamentous phage capsid. Limits m the size of the maJor capstd protem J. Mol. Bd. 248,835--844

164

tuzzago

and Felm

8 Fell& F , Castagnoh, L , Musacchlo, A , Jappelh, R , and Cesarem, G (1991) Selection of antlbody llgands from a large hbrary of ohgopeptldes expressed on a multivalent exposltlon vector J Mel Biol. 222,301-310 9 Cortese, R , Fellcl, F , Galfrk, G , Luzzago, A., Monaco, P., and Nlcosla, A. (1994) Epltope dlscovery with peptlde hbraries displayed on phage. Trends Bzotechnol 12,262-267. 10. Luzzago A., Fellcl F , Tramontano A , Pessl A., and Cortese R. (1993) Mlmlckmg of discontinuous epltopes by phage-duplayed peptides, I Epltope mapping of human H ferrltm usmg a phage library of constrained peptldes Gene 128,5 1-57 11 Sambrook, J , Frltsch, E. F , and Mamatls, T. (1989) Molecular Clonzng. A Laboratory Manual, 2nd ed Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 12 Dower, W. J , Miller, J F , and Ragsdale, C. W (1988) High efficiency transformation of E.coll by high voltage electroporatlon. Nucleic Acids Res 16, 6127-6145. 13 Shagger, H and von Jagow, G (1987) Tncme-sodium dodecyl sulfate-polyacrylamlde gel electrophoresls for the separation of proteins m the range from 1 to 100 kDa Anal. Biochem. 166,368-379

Conformational MimicryThrough Random Constraints Plus Affinity Selection Guangming

Zhong

1. Introduction The use of peptides as antagonists to block certam biological reactions or as vaccine components to elicit immune responses reactive with native antigens may be improved if a peptide sequence is imposed with appropriate conformational constramts that allow the peptide to best mimic the structure as it appears m the native protein. However, searching for the appropriate constramts for a given peptide is always a challenge. The conventional approach relies on the biophysical determination of native protein tertiary structures (I), which is not always practical. In this chapter, I describe an alternate strategy called random constraints plus affinity selection (RCAS) to search for the appropriate conformattonal constraints for a given peptide. This strategy takes advantage of the capability of phage display systems to display a large diversity of genetically encoded structures on the phage surface (2,3). Using the phage display system, random conformational constraints can be imposed onto a given peptide even without prior knowledge of the conformational structure of the protein from which the peptrde is derived. The appropriate conformational constraints that allow the peptide to best mimic its native structure are then selected based on the affinity of the constrained peptides to the natural receptors. The RCAS strategy starts with fusing degenerate nucleotide sequences that are coding for random constraints imposed onto a given epitope sequence to a phage coat protein gene to generate a large library of phage clones. Each phage clone in the library displays on the vrrion surface the epitope sequence imposed with a constraint specified by one of the coding sequences in the degenerate mixture. The known epitope sequence 1s thus presented in a diversity of conFrom

Methods

m Molecular Biology, Edlted by S CablIly

vol 87 Combmatorfal Pwpbde 0 Humana Press Inc , Totowa,

165

Lfbrary NJ

Protocols

166

Zhong

figurations. Potential bmding proteins would be native receptors or conformatlonally dependent monoclonal antibodies (MAbs) raised with native an&ens, such as chlamydial orgamsms, which may recognize antigen only in Immunopreclpltatlon assay but not m Western blot assay. These receptors or Abs are used to select out of the library those constrained peptides with the highest bmding affinity. The bmdmg peptides are thus enriched for conformations that mimic the native epltope. Finally the selected phage can be propagated and used directly to block the receptor function or as lmmunogens to assess the immunogemc fitness of the surface-borne peptides. The example I ~111 describe 1s about how to use the RCAS to improve the Immunogenic fitness of a protective epltope, that is, how to enhance the capability to induce antigen reactive antibodles (4,5) One can also use the same approach to improve or alter other blologlcal activities of a given sequence, such as searching for antagonist activity from an agonist sequence. 2. Materials

2.1. Filamen tous Phage Cloning

Vectors

f88-4 1sa pVII1 fusion-based filamentous phage vector that IS available from G. P Smith at the Umverslty of Missouri, Columbia, MO (see Note 1). Although there are many well-estabhshed fllamentous phage vectors available both from other research laboratorles and commercially, I recommend the use of f88-4 because it can display hundreds of copies of foreign peptldes on each virlon, which allows direct evaluation of the dlsplayed peptides (see Note 2)

2.2. Oligonucleotide

Synthesis

The aim is to install a disulfide bridge to bring the known epitope peptide sequence into a loop with random twists. As shown in the middle panel of Fig. 1, one cysteine is placed on each side of the epltope sequence and each cysteme IS surrounded by randomized residues (see Note 3) The N-termmal potential cysteine position has 50% chance to be a serine and 50% a cysteme. Two partially overlapping ohgonucleotldes should be synthesized to include the coding mformatlon for all the above features (Fig. 1, top and middle panels). The forward primer starts with HlndIII restriction site followed by the coding regions for the random constraints and the N-terminal portion of the known epltope sequence, which overlaps with the backward primer. The forward primer sequence is. S-CTA .AGC .TTT GCC .NNK TSC NNK .AGC GAT GTA .GCA .GGC .T TA.CAA.AAC .GAT .-3’. The backward primer should be complementary to the forward primer and starts with PstI site followed by the coding regions for

Conforma tional Mimicry S-CTA. AGC.T’ll.GCC.

167

NNK.TSC. NNK. AGC.GAT.GTA.GCA.GGC.llACAA.AACGAT. ----t CAT.CGT.CCG.AAT.G~.~GG.CTA.GGT.TGT.TGT.NNM,ACA,NNM,GGACGT. Cl-T.5

Regions

for imposing

constraints

AA.CGG.NNM.ASG.NNM.TCG.CTA.CAT.CGT.CCO.A,NNM,G

Signal Peptidase cleavage site

(3

Epitope

Sequence

Region

b

Hvbrid Wild-type

Recombinant

oham

pVlll gene

Wild-type

pVlll gene

Recombinant

pVlll

pVlll

Fig. 1. Construction of a phage display library with random constraints imposed on an epitope sequence. The two oligonucleotide sequences are shown in the top panel. After filling in, the double-strand insert is digested with Hind111 and PstI. The Hind111 and PstI restriction sites of vector f884 are spliced to the degenerate insert digested with the same two enzymes, giving the nucleotide sequence coding for the recombinant pVII1 containing at its N-terminus the known epitope sequence flanked by the two random constraint regions (middle panel). Amino acids are in single letter codes and X stands for any of the 20 amino acids. In the bottom panel, the open circles on the hybrid phage represent wild-type pVII1, and the filled circles represent recombinant pVII1 with a foreign peptide fused at the N-terminus. The genes coding for them are represented by the open and filled boxes, respectively. the random constraints and the C-terminal portion The backward primer sequence is: 5’-TTC.TGC.AGG.MNN.ACA.MNN.TGT.TGT.TGG.ATC.GTT. TTG.TAA. GCC.TGC-3’. N stands for an equimolar otides; K for an equal mixture of G and T; M for an S for an equal mixture of G and C. See Fig. 1 for the tion after the two oligos are filled in.

of the epitope sequence.

mixture of all four nucleequal mixture of A and C; complete coding informa-

168

Zhong

2.3. Bacterial Strains The MC 106 1 strain IS used as the frozen electrocompetent cells for transfection. MC1061 1s F and has genotype araD139 A(araABC-Zeu)7696 AZacI74 gall? galK- hsr- hsm+ m-A thl. The significant markers are hsr- hsd, which means restrictionless but modification-plus; and streptomycin resistance. K-9 1 cells are used to amplify phages. K-91 is a h- derivative of K-38; it is Hfr Cavali and has chromosomal genotype thi

2.4. Biotinylation

of MAbs

The receptors or Abs are labeled with biotm as follow. 20 PL of the purified protein (2 mg/mL) is adjusted to pH 8.0-9.0 in a siliconized 1 S-mL tube by adding 4 4 FL 1 M NaHC03. Sulfosuccnnmidyl-6-(biotmamido) Hexanoate (Pierce, Rockford, IL) is dissolved at 0 5 mg/mL in 2 mM sodium acetate buffer and 20 PL IS immediately added to the antrbody solution. Coupling is allowed to progress 2 h at room temperature and terminated by adding 200 l.rL 1 M ethanolamine (adjusted to pH 9.0 with HCI) and mcubatmg an additional 2 h at room temperature. Carrier protem (20 yL 50 mg/mL dialyzed bovine serum albumin [BSA, cat# A-3912, Sigma, St. Louis, MO]) is added and the reaction mixture is diluted with 1 mL TBS (see Subheading 2.5.) and concentrated and washed 3X with TBS on a 30-kDa centricon (Amicon, Beverly, MA). The concentration of the biotinylated antibody (bio-MAb) is calculated from the final volume (usually 0.1, neutralize with 30 pL 2 M Tris base per mL eluate, and pool samples For pure products of human IgG, the conversion from OD2s0 to IgG concentration in mg/mL is as follows OD,s,/l

43= IgG concentratron m mg/mL

h. Add eluate into dialysis tubing, clamp, and dialyze into l-2 L PBS overnight at 4”C, change to fresh PBS the next day, and dialyze for another day 3. For purification of IgMs a Couplmg of the anti-IgM antibody to the sepharose (see Note 3) 1 The day before couplmg, dialyze the appropriate amount of anti-IgM antibody mto couplmg buffer overnight at 4°C Bring to a concentration of 2 mg/mL. 2. Swell 1 g CNBr-activated Sepharose 4B m 100 mL 1 mMHC1, pH 3.0, m a beaker for 15 mm The gel will swell to a volume of approx 3.5 mL (XY Note 6).

220

Renschler, Dower, and levy 3

Pour gel mto a Buchner funnel with smtered glass filter and wash gel rapidly with 200 mL 1 mMHC1, pH 3 0, then wtth 100 mL coupling buffer to bring pH to 9 0 4 Transfer the gel lmmedtately to a screw-cap plastic tube containing 3.5 mL of the monoclonal anti-IgM antibody at a concentratron of approx 2 mg/mL m couphng buffer. (The ratio of monoclonal anttbody to gel should be 2 0 mg per mL gel, thus for the 3 S-mL gel, approx 3 5 mL (7 0 mg) antibody are needed m the tube before the gel 1s added). 5 Cap the tube tightly and rotate end-over-end for 2 h at room temperature or overnight at 4°C 6. Transfer the gel to a Buchner funnel wtth smtered glass filter Aspirate dry and measure the OD,,, of the aspirate to check the coupling efftctency Compare the OD,,, of the startmg maternal to that of the aspirate More than 90% conjugation should be obtained 7 Incubate the gel m 200 mL 0.2 M glycme pH 8 0 buffer for 2 h to block the excess active groups 8 Transfer the gel to a Buchner funnel wtth smtered glass filter Aspirate dry and expose the gel to 3 cycles of alternatmg 0 1 M sodium acetate buffer with 50 mMTris buffer, pH 8 0, to wash away the unbound protem 9 Wash the gel with 200 mL PBS. 10 Apply the gel to a suitable chromatography column. Clear the column wtth 15 mL elution buffer (0.1 M glycme-HCl, pH 2.4), and wash the column with 100 mL PBS b Purtfrcatron of the human IgM from supernatants usmg this affinity column 1 Run filtered tissue culture supernatant through the antihuman IgMsepharose column In contrast to Protein A purtftcation of IgGs, the pH does not need to be adjusted. The capacity of the column 1s approximately 2-3 mg It is convenient to run 500-1000 mL supernatant over the column, dependent on the IgM concentration of the supernatant. 2 Wash the column with 100-150 mL PBS 3. Save a fraction of the supernatant, the flowthrough, and the wash flowthrough for troubleshootmg 4 Elute the IgM with 15 mL elutton buffer (0 1 M glycme-HCl, pH 2 4) Collect fractions into spectrophotometer cuvets and measure the OD2s0 Save samples with OD2s0 > 0.1, neutralize with 30 uL 2 M Trts base per mL eluate, and pool samples For pure products of human IgM, the conversion from OD,,, to IgM concentration m mg/mL is as follows OD,s,/l 185= IgM concentratton m mg/mL 5. Dialyze antibody into PBS (as m Subheading 3.1.4., step 2h) c. For all purified sIgRs, check the purity by exammmg the proteins on a reducmg and nonreducmg 8% SDS-polyacrylamlde gel, and confirm the protem concentratton obtamed by OD2s,, and by any standard protein assay, such as the BCA assay from Pierce by followmg the manufacturer’s recommendations (see also vol 32 of this series, Chapter 2)

221

Men tifica tion of Peptide Ligands 1. Round

Apply

Phage

Immobilized

slgR

+ Elute

+

Titer A (Output)

4 Amplify

-+

Titer B (Input

2. - 4. Round

Library

next round)

4

YYYYYY I Elute

-w

Titer C

Amplify I

+

Titer E

x2 l l l

Control

slgR

Elute

+

Titer

D

4 Pick Individual Colonies Screen for binding specificity Sequence DNA

Fig. 2. Affinity purification of phage displaying ligand through multiple rounds of panning on immobilized sIgR.

3.2. Panning

with Phage Libraries

(see Note 7)

The methods in this section are adapted from Cwirla (71, Dower (II), and Renschler (9). The strategy for panning with random peptide libraries on bacteriophage is outlined in Fig. 2. The sIgR is immobilized on ELISA plates. The phage library is applied to the coated and blocked ELISA plate. After incubation, the unbound phage are washed off, while the bound phage are eluted with acid. A small aliquot of the eluted phage is titered to determine the amount of phage recovered (Titer A). The phage are amplified by overnight growth in E. coli. Phage are purified from the bacterial culture and are titered to determine their concentration (Titer B). In subsequent rounds, the amplified output from the previous rounds is split, and a fraction is applied to sIgR-coated

222

Renschler, Dower, and Levy

ELISA wells, while another fraction 1s applied to class-matched control sIgRcoated wells. After washing off unbound phage, bound phage are eluted from both the sIgR and the control sIgR. The eluted phage from both are titered (Titers C and D), and enrichment durmg the panning process is expressed as a ratio of the sIgR output titer (Titer C) and the control sIgR output titer (Titer D): enrichment = Titer C/Titer D. Only the phage eluted from the sIgR are amplified, titered (Titer E), and used for the next round. After three to four rounds of panning, individual phage isolates can be amplified from the bacterial plates used to titer the output, and are used m phage ELISAs to determine the binding specificity. Specifically binding isolates are then subjected to DNA sequencing. The DNA sequence of the phage allows one to deduce the amino acid sequence of the peptide displayed Each of the steps is outlined below in detail.

3.2.1. Immobilization of Receptor on P/a tes 1 It is important to achieve the highest density of sIgR on the surface of the ELISA plate This is done by testmg the bmdmg conditions that lead to optimal coating of the microtiter ELISA plates. Coat microtiter plate with 50 uL per well of sIgR at 20,10,5,2 5, and 1 0 ug/mL m PBS and at the same concentrations m carbonate buffer (Subheading 2.1.3., item 5) for 1 h at 37°C Wash plate with PBS, block for 1 hour at 37°C with PBS, 1% BSA, wash, and detect coating by adding 50 pL of a goat antihuman IgG or IgM antibody (dependent on isotype of the patient’s sIgR) coqugated to HRP, diluted 1’1000 to 1 5000 m PBS, 1% BSA. After 1 h, develop with ABTS substrate buffer as described in Subheading 3.1.3., step 8 Use the lowest concentration that gives the maximum signal m the optimal buffer for pannmg with phage or phagemtd libraries. 2 For the actual panning, coat 6 wells in one row of a 96-well ELISA plate for each library and sIgR to be screened with 50 PL sIgR. Leave blank rows m-between wells to be screened with different libraries or coated with different sIgRs to

minimize

contamination.

Incubate for 1 h at 37°C Wash the plate with PBS by

filling the wells to the top with the 12-position microtest manifold hooked up to a self-refillmg syrmge (Subheading 2.2.1., item 6), then flicking out the PBS into the smk If you use the Corning 12-channel ELISA plate washer, the wells can be aspirated dry with the washer. Repeat 8 times. Block the plates by filling the coated wells with PBS, 1% BSA, and mcubatmg them for 1 h at 37°C Repeat the wash with PBS and use them for incubation with the phage library

3.2.2. Screening pill Phage Libraries 1 Preparation Streak E. ~011 K91 fresh K91 bacteria contamination The wtth a single colony

bacteria on an LB-plate. For each round of panning, grow from a single colony picked from the stock plate to avoid day before the screening, 5 mL of LB medium are maculated of K9 1 bacteria from the stock plate, and grown overmght at

Identification of PeptIde L/gancfs

2

3.

4.

5.

223

37°C with shaking On the day of the screen, 20 ml LB medmm are maculated with 1 mL of the overnight culture m a lOO-mL flask and grown to OD6c0 = 0.5 Centrifuge bacterta at 15OOg (2500 rpm) in a desktop centrifuge for 5 mmutes Resuspend in 2 mL LB medium (10X concentrated K91) Incubation with phage library Use plugged aerosol-resistant ptpet tips for all phage work a. Dilute 1000 library equtvalents mto 600 pL PBS/O 1% BSA (If the library has 5 x lo8 independent recombmants, then the total number of phage added m 1000 library equivalents would be 5 x 10” transducing units [ml) BSA is used m all the bmdmg buffers to decrease the recovery of BSA-specific clones that may bmd to the BSA on the ELISA plate b Add 100 pL mto each of the 6 wells coated with sIgR and blocked with PBS/ 1% BSA c. Cover the plate wrth parafrlm and incubate at 4°C for 2 h (see Note 8). Washing. a. In the first round, wash the wells gently by filling with cold PBS and asprratmg approx five times After the first round the washmg can be more vigorous (see Note 9) b In the second round, wash as above, then add cold PBS and incubate at 4°C for 30 mm, then repeat the first washing step In the thud and fourth round, the PBS should no longer be cold, and washing can be even more vigorous. Elution and phage tnermg a. Add 100 ltL glycme-HCl elutron buffer to each well Incubate for 10 mm at room temperature. b. Aspirate elution buffer from each well and pool m a mtcrocentrtfuge tube (total of 600 FL). c Immedtately neutralrze with 35 pL 2 M Trrs base. d Titer the phage eluate to determine the number of phage recovered by preparing lo-fold serial drlutrons of phage m LB medium. Change prpet tips at each dilution step. Add 100 PL diluted phage from 3 drlutions each to 100 ,uL 10X concentrated K91 cells Expect approx lo6 TU after the first round, lo7 TU after the second round, and greater than lo8 TU after the third and fourth round if there is enrichment for phage binding to the sIgR specrftcally. Incubate at 37°C without shaking for 20 mm Plate 100 pL onto IO-cm LB-tetracycline plates. Grow overnight at 37°C The next day, count the colonies Use the plate that has about 100 colonies to determine the titer The total number of phage per mL 1s colony count x dilution factor (e.g., 105) x 20 TU. The factor of 20 1s derived from the amount of phage used to infect K91 cells (l/10 of 1 mL of diluted phage, of which half is plated onto the LB-tetracyclme plates) Amphficatton. a Add 600 pL of the neutralized eluted phage to 600 pL 10X concentrated K91 cells (Subheading 3.2.2., step 1). Incubate at 37°C for 20 mm without shaking.

224


b. Plate 400 yL of the infected K91 cells to each of three 15-cm LB-tet plates c. Incubate overnight at 37°C The next day the plates should be covered with a lawn of small colomes 6 Phage isolatton a Add 10 mL LB media to each of the three 15-cm bacterial plates Incubate for 10 mm at room temperature b Gently scrape the bacteria off the plates using a sterile spreader, aspirate the media with a ptpet, and pool the media from all three plates c. Centrifuge bacterial suspension at 12,000g for 15 mm. The phage will remam m the supernatant d Transfer the cleared supernatant to a clean centrifuge tube and add 0 2 vol 20% PEG/2 5 M NaCl to precipttate the phage Mix well and incubate on ice for 1 h. e Centrrfuge at 12,000g for 15 mm Remove the supernatant, bemg careful to remove as much of the PEG as posstble Resuspend the pellet m 1 mL PBS t Heat the phage suspension for 15 mm m a 70°C water bath to kill the remammg bacteria g Titer the amplified output as m Subheading 3.2.2., step 4d Store the amphfled output at 4°C for up to 24 h, or at -20°C mdefnutely 7 Subsequent rounds of panning Use lOi to 10” TU of the amphfied phage for the next two rounds of panning, following the same procedure as for the first round If there is significant enrichment (phage recovered from sIgR phage recovered from control sIgR > 10) after the third round, a fourth round may be omitted, or may be performed using l/l0 of the number of phage used m the previous round as the Input This helps to reduce the background From the second round on, the titer plates used to determme the number of phage recovered can be saved for later use m the characterization of recovered clones With successive rounds of panning, one should also see mcreasmg recoveries, mdrcatmg that enrichment for certam phage is occurrmg This does not guarantee, however, that enrichment of spectftcally bmdmg phage is occurrmg Specificity is evaluated with the use of phage ELISAs (see Note 10).

3.3. Screening

Phage Isolates for Binding

Specificity

The recovered clones from phage library panning can be characterized m an ELISA, in which the binding of amplified and harvested phage clones to tmmobiltzed sIgR and control sIgRs is detected wtth an antiphage anttbody (14) sIgR and control sIgR are coated onto the surface of plastic microtiter ELISA plates. Unoccupied sites are blocked wtth BSA to avoid the binding of plasticspecific clones The phage are added and allowed to come to an equilibrium with the tmmobilized receptors. The plate IS washed, and bound phage IS detected with HRP-labeled sheep anti-M 13 antibody. ABTS substrate is added to visualtze the bound antibody (see Note 12).

Ident/fication of PeptIde Ligands

225

Using a sterrle toothpick, pick up mdrvidual colonies from the titer plates used to determine the amount of phage recovered in the last round of panning Transfer the colony to 2-3 mL LB-media with tetracyclme (20 mg/L) and grow overmght at 37°C m a shaker Coat microtiter ELISA plates with alternating rows of sIgR and a control sIgR, and block with PBS, 1% BSA (see Subheading 3.2.1., step 1) Take the overmght culture and spin down bacteria m a microcentrifuge for 5 mm at 18,500g (15,000 rpm) Apply 50 pL of this supernatant to each of 4 wells, 2 wells coated with sIgR, 2 wells coated with control sIgR. Thus each clone takes up a square of 4 wells on the ELISA plate. If the signal is too high, dilute the supernatant 1.5 or 1:lO m PBS, 0.1 % BSA. If the signal is too weak, the phage from 1 mL of an overnight culture can be concentrated by precipitation with 0.2 ~0120% PEG, 2 5 M NaCl followed by 30 mm incubation on ice The phage are pelleted by centrifugation m a microcentrifuge at 18,500g (15,000 rpm) for 15 mm. The pellet IS resuspended m 0.5 mL PBS, 0.1% BSA for the ELISA Add 50 pL of concentrated phage to each well m a similar fashion If purified and titered phage stocks are used, add 2-5 x lo9 TU to each well. Incubate for 2 h at 4°C Wash wells with PBS Add 50 pL HRP ConJUgated rabbit anti-Ml3 antibody diluted 1.3000 to each well, and incubate for 1 h at 4°C. Wash wells with PBS and add 100 pL ABTS ELISA substrate solution (see Subheading 2.1.3., item 13). After 30 mm, read the OD405-490wrth a microtiter plate reader Clones that give at least a twofold stronger signal from the sIgR than the control sIgR are subjected to DNA sequencing (see Notes 13 and 14)

3.4. DNA Sequencing

of Phage

The amino acid sequence of the peptrdes displayed by the deduced by DNA sequencing of the gene III, where the library was inserted (see Note 15). Standard single-stranded dideoxy tocols are employed. A variety of commercial DNA isolation to purify single-stranded DNA template for DNA sequencing. the Prep-A-Gene kit to be simple, fast, and reliable.

3.4. I Smgle-Stranded

binding clones is oligonucleotide sequencmg prokits are available We have found

DNA Preparatton

1. Grow pII1 clones as m Subheading 3.3. m a small, 2-5-mL overnight culture 2 Add 1 3 mL of the overnight culture of mdividual clones to a mtcrocentrtfuge tube and centrifuge at 18,500g (15,000 rpm) for 15 mm 3 Add 500 pL Prep-A-Gene bmdmg buffer to new microcentrifuge tubes Transfer 1 .OmL of the supernatants to the tubes filled with binding buffer Invert several times and Incubate at room temperature for 5 mm with intermittent mversion of tubes to lyse the phage particles.


226 4 Add 15 PL of Prep-A-Gene

matrix to each tube. Vortex tubes to resuspend the

matrix and incubate at room temperature for 10 mm with intermittent

mixing

5 Centrifuge the tubes for 30 s m a nncrocentrrfuge at 18,500g (15,000 rpm) to pellet the matrix Aspirate the supernatant. Add 250 ILL 1 M NaC104 (binding buffer diluted 1.6) to each tube and vortex to suspend the pellets. 6. Centrifuge for 30 s to pellet the matrix and aspirate the supernatant Repeat the 1 M NaC104 wash. 7. Resuspendthe pelleted matrix m 250 yL Prep-A-Gene wash buffer by vortexmg. Centrifuge to pellet the matrix, aspirate the supernatant, and repeat this wash two more times. Be careful to remove all the supernatantafter the last wash. 8. Resuspendthe matrix m 40 l.tL Prep-A-Gene elution buffer by vortexmg Incubate for 5 mm at 37°C m a water bath to elute the DNA. Centrifuge for 30 s to pellet the matrtx and carefully remove the single-stranded DNA-contammg supernatantto a clean tube Analyze 5 pL by agarosegel electrophoresis A band should be visible

3.4 2. Smgle-Stranded

DNA Sequencing

1 Sequence the single-stranded template DNA using the dideoxy method and Sequenase2 0 The pII1 sequencingprimer anneals40 basepairs downstream of the 3’ BstXI clonmg site in fAFF1 For detailed mstructronson DNA sequencing, seeChapter 16, Subheading 3.4. (15). 2 Load the sequencing reactions on a 6% polyacrylamtde/7 M urea/TBE gel and run the gel until the bromophenol blue has migrated off the gel Expose X-ray film and read the sequencethe next day

3.5. Evaluation of Binding Pepticle Ligands

Specificity

of Synthetic

From the amino acid sequences of the specifrcally binding clones, a consensus sequence can be identified. If there are poorly conserved residues among the sequences, mutagenesrs libraries can be made to better define the crrtrcal residues (9, see also Note 16). The ammo acid sequence of a phage isolate that is closest to the consensus is then chosen for a synthetic peptide bgand. The binding specificity can be evaluated in an ELISA as well as with flow cytometry.

3.5.1. ELISA 1 The microtiter ELISA plate is coated with 50 pL/well streptavidm or avldm at 10 pg/mL in carbonate buffer (Subheading 2.1.3., item 5) for 2 h at room temperature or overnight at 4°C The plate 1swashed with ELISA wash buffer

(Subheading

2.1.3., item 9)

2 Block the plate with either PBS, 1% BSA, or PBS, 5% nonfat milk for 30 mm at room temperature Wash the plate with ELISA wash buffer

Identification of Peptide Llgands

227

3 Add 50 pL of the synthetic biotmylated peptide m PBS or salme at a concentration of 10 yglmL, and incubate for 30 minutes at room temperature. Wash the plate with PBS 4. Add 50 p,L sIgR at 5 p.g/mL in PBS, 1% BSA. Incubate for 1 h at room temperature. Wash with PBS. 5. Add 50 pL of an HRP-conjugated goat antihuman IgG or IgM antibody and develop ELISA as in Subheading 3.1.3. (see Note 17).

3.5.2. Flow Cytometry 1. Thaw the tumor cells frozen in hqmd nitrogen m smgle cell suspensron (see Note 4), wash them once m RPMI, 5% FCS, resuspend them m 2 mL of the same, and layer them on top of 5 mL Ficoll m a 15mL centrifuge tube 2 Centrifuge at 1OOOg (2000 rpm) for 30 min. The dead cells will mtgrate to the bottom of the tube, while the live lymphocytes will remam at the interface between the ficoll and the RPM1 Aspirate the cells from the interphase with a Pasteur pipet. Wash the cells twice in PBS/BSA/azide. Resuspend the cells in PBS/BSA/azrde and count them 3 Ahquot 1 x lo6 cells mto 5 mL tubes, centrifuge at 500g (1500 rpm) to pellet cells, and pour out supernatant. 4 Add 50 pL biotmylated peptide at 20 pg/mL and incubate for 30 mm on ice 5. Wash cells twice in PBSlBSAlazide 6 Add streptavidm-phycoerythrm, 25 yL per sample, and incubate for 30 mm on ice 7 Wash cells twice m PBS/BSA/azide Resuspendcells m 0 4 mL PBS/BSA/azrde if they will be analyzed within an hour, or m 0 4 mL PBS, 1% paraformaldehyde if they are to be analyzed later 8 Analyze by flow cytometry, gatmg on lymphocytes (seeNote 18)

3.6. Mulfimerlzation of Peptide Ligands We have shown that monomeric synthetic peptide ligands have no effect on B-lymphoma cells (9). Several strategies to generate peptide ligand multimers have been employed, resulting in active peptide dimers or tetramers that crosslink sIgR. The crosslinking triggers a signal transduction cascade that leads to cellular protein tyrosine phosphorylation, extracellular acidification (16), inositol phosphohpid hydrolyses, protem kmase C activation, and ultrmately to programmed cell death or apoptosis. 3.6.1. Strategies to Generate Peptide Mu/timers at the Synthetic Level 1 Synthesis of a tandem repeat peptide, m which the bmdmg motif is contained twice m the peptrde, separatedby 6 glycmes. For example, a hgand for the human lymphoma cell lure SUP-B8 is YSFEDLYRR (9) A tandem repeat peptide we have found to be actrve IS YSFEDLYRRGGGGGGYSFEDLYRR

Renschler, Dower, and Levy 2 Synthesis of a “MAP”

peptide (multiple antigen peptide) tetramer on branching lysines according to the method of Tam (17,18), m which the peptide is extended on both the a- and E-ammo groups of lysmes Because of solubihty concerns, we have only gone to tetrameric structures.

3.6.2. Strategies to Link Monomeric Peptldes Synthesis of a monomer with the carboxytermmal extension GGC, followed by oxidation of the monomeric structures to dimeric structures 2 Synthesis of monomeric peptides with the carboxytermmal extension GGK, with the E-ammo group of lysme biotmylated before synthesis of the peptide This avoids a biotmylation reaction that would biotmylate lysmes m the active portion of the peptide The peptide monomer IS then mixed with streptavidm or avidm at least at a 4 1 molar ratio and rotated for 30 mm at room temperature This results m an active tetrameric structure. The advantage of this approach is that for the price of one synthesis, you obtain a biotmylated monomerrc peptide that can be used to assess bmdmg m an ELISA or by flow cytometry, and a multimeric peptide that can crosslmk sIgR and can be used to assess biological activity.

3.7. Evaluation

of Effects of Peptide Ligands on Tumor Cells

Antiproliferative effects of the peptide hgand multimers can be determmed when lymphoma cell lines are available. However, it is difficult to grow most lymphoma tumors. As an alternative to measurmg antiproliferative effects, early events m the srgnal transduction cascade that follow sIgR crosslmking and that ultrmately lead to apoptosis can be measured in tumor cells. The mduction of cellular protein tyrosine phosphorylation within minutes of sIgR crosslmking correlates with clmical responses seen m patients treated with antridiotypic monoclonal antibodies (19), and can be measured by Western blotting of cell lysates (9,19,2/J). The method will be described m this section. Other early trrggermg events that could be measured include changes in mtracellular calcium and changes m extracellular acidification rates (16). 1 Thaw cells rapidly, resuspend m 12 mL CM (Subheading 2.1.2., item l), and centrifuge for 5 mm at 500g (1500 rpm) Remove supernatant Wash again m 10 mL CM. Resuspend m 10 mL CM 2 Count cells and resuspend at 2 x lo6 cells/ml Ahquot 1 mL per sample mto 1%mL tubes and mcubate at 37°C for 60 mm m a water bath. 3 Activate cells with antibody or peptides at 37”C, using a goat anti-IgM or IgG antibody (dependent on isotype of the tumor) at 10 pg/mL as a positive control, an irrelevant class-matchedantibody at 10 pg/mL asa negative control, and peptide hgand dimers or tetramers as well as scrambled control peptide hgands at 5 @Z concentratton Add the antibodies or peptides to the cells and incubate at 37°C for 30 s, 1, 2, 5, 10, and 15 mm to establish a time course of the cellular tyrosme phosphorylation. One seesvariation in peak protein tyrosine phosphory-

identification of PeptIde Ligands

4

5 6.

7 8. 9 10 11

12.

13

229

latlon from tumor to tumor wlthm that range. Start with the samples that have the longest incubation times first, and incubate the samples with shorter incubation times in the meantime. Stop the reactlon by adding 10 mL cold PBS, 1 mM sodium orthovanadate Na,VO,, a phosphatase inhibitor, and put tubes on ice until the reactions of all samples have been stopped Centrifuge all stimulated cells at 500g (1500 rpm) for 5 mm m a centrifuge cooled to 4°C. Remove supernatants Wash cells with 10 mL cold PBS, 1 mM Na3V0,, and centrifuge at 5OOg (1500 rpm) for 5 mm at 4°C Remove supernatants (wipe out tube carefully to remove all supernatant) and invert tube on a rack to dry out Lyse cells by adding 100 pL per tube of NP-40 lys~sbuffer contammg Na,VO, Incubate 1 h on ice or overnight at 4’C Transfer to mlcrocentrlfuge tubes Centrifuge 10 mm at 18,500g (15,000 rpm) at 4°C Keep supernatants,discard pellets Add 20 pL of the supernatant to 5 pL SDS sample buffer, boll for 5 mm, and apply 20 pL to an 8% SDS PAGE gel Freeze the remainder of the lysate at -80°C Electrotransfer proteins from polyacrylamlde gel to nltrocellulose* Transfer the gel to a glass dish contammg transfer buffer and place the mtrocellulose membrane underneaththe gel, letting It soak Soak SIXsheetsgel-blot paper, place m a semidry gel blotter, place mtrocellulose with gel on top into blotter, cut off unnecessarygel and mtrocellulose with a scalpel or sharprazor blade, and place three soakedgel-blot paper sheetson top of gel Remove air bubbles by rolling a plpet over the blot. Electrotransfer for 2 h according to the manufacturer’s mstructlons (seealso vol 32 of this series,Chapter 24) Remove the mtrocellulose and incubate overnight m PBS, 5% nonfat milk

(Subheading

2.1.3., item 7)

14. Incubate blot with the goat antimouse IgG-blotm antibody diluted 1.5000 m TBST/BSA for 1 h at room temperature. 15. Wash the blot 3X by gently rocking it in 100 mL TBST/BSA for at least 15 mm each wash 16 Incubate blot with streptavldin/HRP diluted 1: 10,000 m TBST/BSA for 30 mm 17. Wash the blot 3X with TBST/BSA for at least 15 min each wash 18. Blot nitrocellulose dry with blottmg paper 19 Add 10 mL ECL reagentsmixed 1: 1 and Incubate for 1 mm 20 Blot dry with blottmg paper, wrap in cellophane, and expose film for approx 1 mm This film will serve asa control to show equal loadmg of all the wells, since the goat antlmouse IgG-blotm antibody crossreacts with a protein of 76 kDa apparent molecular massin all samples. 21 Incubate blot m TBST/BSA overnight on a rocker at room temperature 22 Incubate mtrocellulose blot for 2 h at room temperature with antlphosphotyrosme antibody 4G 10 diluted in TBST/BSA to 0.04 pg/mL

Renschler, Dower, and Levy 23. Wash the blot three times with TBST/BSA for at least 15 mm each wash 24 Incubate blot with the goat antimouse IgG-biotm antibody diluted 1*5000 m TBST/BSA for 1 h at room temperature 25. Wash the blot three times by gently rocking it in 100 mL TBST/BSA for at least 15 mm each wash 26 Incubate blot with streptavidm/HRP diluted 1 10,000 m TBST/BSA for 30 mm 27 Wash the blot three times with TBST/BSA for at least 15 mm each wash 28 Blot mtrocellulose dry with blotting paper 29 Add 10 mL ECL reagents mixed 1.1 and incubate for 1 min. 30 Blot dry with blottmg paper, wrap m cellophane, and expose film for approx 1 mm

The samples treated with a crosslinking antibody or with crosslinking peptide hgand multimers should show a strong induction of tyrosme phosphorylation of many proteins with different molecular masses, whereas the untreated, control antibody or control peptide treated samples should show only few proteins with phosphotyrosines.

4. Notes 4.1. Purification

of Surface lmmunoglobulin

from Tumor Ceils

1 When purifying IgGs, especially if using supernatants from a hybridoma with low human IgG production, it is possible to get significant contamination with bovine IgG from the fetal calf serum that will copurify using protein affinity chromatography In that case, we recommend the usage of low-Ig FCS Because of the added expense, we do not use low-Ig FCS otherwise 2 The supplier of the PEG used m the fusion IS important. We have had good results with the PEG from BDH 3 The ID12 murme monoclonal antihuman IgM antibody that we use for affinity purification of human IgM has been unusually good in binding and m releasmg the human IgM product However, the coupling ratio of antibody to sepharose is critical for good performance. Thus, when purifying IgMs, it may be possible to recover no IgM from the affinity chromatography column even though the hybridoma is producing adequate amounts of IgM In that case it may be helpful to evaluate input and output of the column as well as the flowthrough of the washmg step Using an ELISA, one can see if the protein did not bmd to the column, if it came off during the wash, or if it is still attached to the column. If the protein is not recovered from the column, one could try to make another sepharoseantihuman IgM column using a lower coupling ratio of 1 or 75% of specimens. Repeated attempts at fusing the tumor cells with the heterohybridoma K6H6B5 are recommended should the first attempts fail to yield clones, or to yield producmg clones However, there are some patients whose tumors cannot be fused, even after repeated attempts 6. While column preparation can be scaled up, we do not recommend to use columns with more than 4 mL slurry. Larger columns can make it impossrble to elute the sIgR off the column

4.2. Panning

with Phage Libraries

Avoid contamination problems Use aerosol-resistantpipet tips, work neatly, and clean out pipetors with alcohol periodically Use a fresh batch of bacteria for each round of amplification 8 Incubation of the phage libraries for greater than 2 h at 4°C does not improve recovery of specifically bmdmg clones, but may actually increasethe recovery of nonspecifically binding clones 9 The first round of panning has to be done the most carefully. Phage lost m the first round cannot be recovered Thus the washing conditions in the first round should be the least stringent, using cold PBS, and the least vigorous In subsequent rounds, the vigor of the washing step and the temperatureof the washbuffer can be increasedm a stepwtsefashion. 10 Increasing recoveries of phage from round to round are usually seen, although the increasemay not be specific, 1.e , the recovery from the sIgR is increasing as well as the recovery from the control sIgR However, specifically binding clones may still be found m the panning output. Thus, we go through four rounds of panning if there IS no specific enrichment, and then evaluate the resultant clones for bmdmg specificity with phage ELISAs We screen 24-48 clones If no specifically binding clones are identified, chances are they were not amplified or present m the library and we use another library If only a few specifically bmding clones are identified, larger numbers of clones can be screened with phage lifts, m which bacterial colomes Infected with phageare lifted onto mtrocellulose filters (a,11 seeaZso Chapters 20,21). The mtrocellulose filters are then blocked, and incubated with sIgR. The sIgR bound to the filters is detected with alkaline phosphatase-conjugatedgoat antihuman IgG or IgM antiserum. A double lift allows differential screening using a control sIgR as well as the sIgR of Interest. Only specifically binding clones are then picked from the original bacterial plate, grown, and tested in a phage ELISA. 7

232

Renschler, Dower, and Levy If there is specific enhancement (greater than lo-fold difference m recoveries from the sIgR than the control sIgR), we stop the panning and screen mdividual isolates with a phage ELISA Sometimes a single clone will predommate In that case clones from earlier rounds are screened for their bmdmg specificity and then subjected to DNA sequencmg

4.3. Screening

Phage Isolates

11 An alternative method for the screenmg of a large number of phage isolates are phage lifts, described m detail by W Dower (II) 12 It is not always possible to identify peptide hgands for the sIgR expressed on lymphoma cells with 8-mer and 1Zmer pII1 phage libraries In some cases, we were successful by screening pII1 libraries displaymg cychc peptides. A further option is to screen the receptors with pVII1 phagemid libraries, which are described m Chapters 17,21 In some cases, we had to resort to plasmid libraries m which pepttdes are dtsplayed as C-terminal fusion proteins with LacI to identify peptide hgands (21) Diversity seems to be of major importance. We have had to screen up to 1 8 x IO” independent recombinants to fmd a smgle hgand m some cases. 13 If only nonspecifically bmdmg clones are identified, one can try to pan the library m the presence of excess control protein m solution Other formats n-r which a biotmylated receptor IS free m solution durmg the panning and then captured on streptavidm-coated plates can be tried as well (4,ZO) 14 If the clones identified do not bmd to either sIgR or controls sIgR, overgrowth with wild-type phage or phage without library Inserts may be the problem. The DNA of a few isolates should be sequenced to see if they have inserts.

4.4. DNA Sequencing

of Phage

15 Because a single clone may have outgrown other clones, it IS advisable to first sequence only about 5-10 of the specifically bmdmg clones from a given round If there IS no diversity m the sequences, clones from earlier rounds can be screened. In some cases, we had to go back to the second round of panning to get anythmg but the predominant clone.

4.5. Evaluation of Binding Peptide Ligands

Specificity

of Synthetic

16. Ammo acids that are not very homologous among the hgands identified for a given sIgR can be better defined by screening mutagenesis libraries (9) These hbraries are generated m pII1 phagemrd vectors by base for base mutagenesis of the library ohgonucleotide. For each position in the library oltgonucleotide, the base that encodes the ammo acid of the consensus sequence IS mcorporated 70%, while the remaining 30% are split equally among the three other bases Codons of ammo acids that are not clearly defined are left entirely random, incorporating A, C, G, and T equally at the first two positions of the codon, and G and T equally at the third position This mutagenesis scheme results m a bias towards the con-

ldenfifrcation

of Peptic/e Ligands

233

sensus sequence, yet allows for sufficient varlablhty that poorly defined residues can be better defined. With pII1 phagemid libraries, monovalent display is possible, allowing the selection of higher affinity peptlde lzgands. The resultant libraries are panned as described m this chapter, and speclflcally binding clones are evaluated by phage ELISA or phagemld lifts 17 Some sIgRs from patient tumors will bind to blocked ELISA plates In that case, their bindmg to the lmmoblhzed peptlde cannot be measured m the way outlmed here. Instead, the plate IS coated with the antlbody and blocked. The blotmylated peptlde 1sadded in PBS, 1% BSA, and subsequently visualized with streptavldmHRP diluted 1 1000 m PBS, 1% BSA However, some peptldes are inherently sticky to blocked ELISA plates as well. 18 If blotmylated monomeric peptldes fall to stain tumor cells with the protocol described, tetramers can be preformed with streptavldm-phycoerythrm, and then used to stain tumor cells m one step Stamzng the cells at room temperature or at 37°C may also Improve the stammg

Acknowledgments We thank S. Cwirla for the critical review of this manuscript and B . Taldl for improving the rescue hybridoma protocol. M. Renschler was a Berlex Oncology Foundation Fellow at Stanford University when this work was performed. R. Levy IS an American Cancer Society Clinical Research Professor. This work was In part supported by USPHS grants CA33399, CA34233, and CA66437

References 1. Pennell, C. and Scott, D. ( 1986) Lymphoma models for B cell actlvatlon and tolerance. IV Growth mhlbltlon by anti-Ig of CH31 and CH33 B lymphoma cells Eur J. Immunol. 16,1577-1581. 2 Miller, R A, Maloney, D G., Warnke, R , and Levy, R. (1982) Treatment of B-cell Iymphoma with monoclonal antz-ldlotype antzbody N. Engl. J Med. 306, 517-522 3 Maloney, D G., Levy, R , and Miller, R. A (1992) Monoclonal anti-ldlotype therapy of B cell lymphoma, m Btologzc Therapy of Cancer Updates vol 2, number 6 (De Vita, V T , Hellman, S , and Rosenberg, S A , eds.), Llppmcott, Phlladelphla, PA, pp l-9 4. Scott, J K and Smith, G P (1990) Searchmg for peptlde lzgands with an epztope hbrary Sczence 249,386-390 5 Oldenburg, K R , Loganathan, D , Goldstem, I J , Schultz, P G., and Gallop, M. A. (1992) Peptlde hgands for a sugar-bmdmg protein Isolated from a random peptzde library Proc Nat1 Acad. Scz. USA 89,5393-5397. 6 Devlm, J J., Pangamban, L C., and Devlin, P E (1990) Random peptide Izbrarles: a source of specific protein bmdmg molecules Sczence 249,404-406 7 Cwlrla, S E., Peters, E A., Barrett, R W , and Dower, W J (1990) Peptldes on phage A vast library of peptldes for ldentlfymg hgands Proc Nat1 Acad. Scz. USA 87.623-638.

234


8 Blond,E. S ,Cwlrla, S E , Dower, W J.,Lipshutz,R. J , Sprang, S R , Sambrook, J F , and Gethmg, M J. (1993) Affmity pannmg of a library of peptides displayed on bacteriophages reveals the bmding specificity of BiP Cell. 75,7 17-728. 9 Renschler, M F , Bhatt, R R , Dower, W J., and Levy, R. (1994) Synthetic peptide hgands of the antrgen binding receptor induce programmed cell death m a human B-cell lymphoma. Proc Natl. Acad. Scl. USA 91,3623-3627 10 Scott, J. K., Loganathan, D., Easley, R B , Gong, X , and Goldstein, I. J (1992) A family of concanavahn A-binding pepttdes from a hexapeptide eprtope library Proc Natl. Acad. Scl. USA 89,5398-5402 11 Dower, W J and Cwirla, S. E. (1994) Epitope mapping using libraries of random peptrdes displayed on phage, m Peptlde Antigens (Wisdoms, G. B , ed ), IRL Press at Oxford Umversrty Press, Oxford, UK, pp 219-243. 12 Carroll, W. L., Thtelemans, K , Ddley, J., and Levy, R. (1986) Mouse x human heterohybrtdomas as fusion partners with human B cell tumors J Zrnmunol Methods 89,61-72 13 01, V T and Herzenberg, L A (1980) Immunoglobulm-producing hybrid cell lines, m Selected Methods wz Cellular Immunology (Mishell, B B. and Shngis, S M., eds ), WH Freeman, San Francisco, pp. 368-370 14. Barrett, R W , Cwirla, S E , Ackerman, M S , Olson, A M , Peters, E A , and Dower, W. J. (1992) Selective enrichment and characterization of high affinity ltgands from collections of random peptrdes on ftlamentous phage Anal. Blochem. 204,357-364. 15. Sambrook, J., Fritsch, E F , and Mamatis, T (1989) Molecular Clonzng, A Laboratory Manual, Cold Sprmg Harbor Laboratory, Plamview , NY 16 Renschler, M. F , Wada, H G , Fok, K S., and Levy, R (1995) B-lymphoma cells are activated by peptide hgands of the antigen bmdmg receptor or by anti-idiotypic antibody to induce extracellular acidiftcatton Cancer Research, 55,5642-5647 17. Tam, J P (1988) Synthetic peptide vaccme design Synthesis and properties of a high-density multrple antrgemc peptrde system. Proc. Nat1 Acad. Sci. USA 85, 5409-5413. 18 Tam, J. P and Lu, Y A (1989) Vaccine engineering enhancement of immunogemctty of synthetic peptide vaccmes related to hepatitis m chemically defined models consistmg of T- and B-cell epitopes Proc Nat1 Acad. Sci. USA 86, 9084-9088. 19 Vutst, W. M J., Maloney, D G , and Levy, R. (1994) Lymphoma regression induced by monoclonal anti-idiotypic antibodies correlates with then ability to induce immunoglobulm signal transduction and is not prevented by tumor expression of high levels of BCL-2 protein Blood 83,899-906 20 Schick, M R , Nguyen, V Q , and Levy, S (1993) Anti-TAPAantibodies mduce protein tyrosme phosphorylation that IS prevented by Increasing mtracellular thiol levels J Zmmunol 151, 1918-1925 21 Cull, M G , Miller, J F , and Schatz, P J. (1992) Screening for receptor bgands using large libraries of peptides linked to the C termmus of the lac repressor, Proc Natl. Acad Sci USA 89,1865-1869

23 Major Histocompatibility Complex Allele-Specific Peptide Libraries and Identification of T-Cell Mimotopes Marc A. Gavin and Michael J. Bevan 1. Introduction We descrrbe here a method for generating large libraries of random pepttdes that may be screened for T-cell antigens (1). These libraries make use of the discovery of sequence motifs common to the peptides bound to a particular major hlstocompatibility complex (MHC) molecule (2). The motifs consist of a restricted peptide length and two or three fixed ammo acids required for peptide binding to MHC (anchor motifs) (2-4). Thus the libraries, comprised of a particular motif with the remaining ammo acids randomized, are MHC allele-specific and are useful for T-cells restricted to MHC molecules with known anchor motifs. A degenerate oltgonucleotide encoding the random peptide is cloned mto the prokaryotic expression vector pMAL-c, such that the peptides are expressed as C-terminal fusions to maltose bmdmg protein (MBP) This allows for their purification by amylose column chromatography and factor X, restriction protease cleavage (5). Factor X, cleaves after the tetrameric recognition sequence Ile-Glu-Gly-Arg (IEGR), thus peptides are released without amino-terminal additions. Large preparations of complex pools of peptides may be fractionated by reverse-phase HPLC. By screening the mdividual fractions for T-cell reactivity, the fingerprint of a T-cell receptor’s (TCR) fine specificity can be visualized (I ,6). The peptides can also be detected m factor X,-treated bacterial lysates when the antigen-expressing clone 1srepresented at less than 10m3.Thus, by performing successive rounds of screening, the clone of interest may be isolated and the sequence of the peptide (mtmotope) determined by sequencing its cloned oligonucleotide (I). From

Methods

m Molecular Dology, Edlted by S CablIly

vol 87 Combmatofral Pept!de 0 Humana Press Inc , Totowa,

235

Ljbrary NJ

Protocols

236

Gavin and Bevan

2. Materials 2.1. Preparation

2 2 3. 4 5. 6 7 8 9 10 11 12

13 14. 15

16

and Cloning of Insert DNA

Plasmld vector pMAL-c (New England BroLabs, Beverly, MA) This vector 1s not included m the most recent catalogs, however rt is still avarlable upon request. The current vector, pMAL-c2, cannot be used because rt does not contam a restriction site immediately 5’ of the protease site Endonuclease restrrctron enzymes and buffers (New England BtoLabs) Razor blades, Glass beads for DNA purtfrcatron (such as Qraex, Qragen, Chatsworth, CA) Apparatuses for runnmg agarose and polyacrylamide gel electrophorests Trrs-EDTA (TE) solutron* 10 mM Tris-HCI pH 8.0, 1 m&I ethylenediammetetraacetrc acid (EDTA) Ammomum acetate solutron. 0 5 M ammonmm acetate, 1 mM EDTA 0 45-pm Spin-X filters (Costar, Cambndge, MA) Sodmm acetate: a stock solutron of 3 M, pH 5.2 Magnesium chlorrde 5X Sequenase reactron buffer 200 mA4 Trrs-HCl, pH 7 5, 100 mM MgCl*, 250 mA4 NaCl (United States Brochemtcal, Cleveland, OH) dNTPs: a mixture of dATP, dTTP, dCTP, and dGTP, 25 m&Z each. Drthrothrertol (DTT), 1 A4 stock solution: Dissolve 3 09 g of DTT m 20 mL of 0 .O1 M sodium acetate, pH 5.2 Sterilize by filtration. Dispense mto 1-mL ahquots and store at -20°C. Escherzchza colz DNA polymerase-Klenow fragment (New England BtoLabs). T4 DNA hgase and the enzyme assay buffer (New England BtoLabs) LB agar plates Dissolve m 950 mL of deionized water. 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCl, and 15 g Bacto-agar AdJust the pH to 7.0 with 5 N NaOH (about 0 2 mL), add water up to 1 L, and autoclave for 20 mm Cool to about 5O”C, add the approprrate antrbrotrcs, and pour mto plates LB/amptcillm 50 pg/mL amprcrllm m LB agar.

2.2. E. coli Transformation

and Library Storage

1 E. colt strains (see Subheading 3.2.1.) a TBl JM83 hsdR(rk- mk+) b DHSa (supE44AlacU169 (~80lacZAM15)hsd17recAlendAlgyrA96th~lrelA1) 2 SOC medium Drssolve m 950 mL of deionized water. 20 g Bacto-tryptone, 5 g Bacto-yeast extract, 0.5 g NaCl, and 15 g Bacto-agar. Add 10 mL of a 250 m&f solution of KCl, adJust the pH to 7 0 wrth 5 N NaOH (about 0.2 mL), add water up to 1 L, and autoclave for 20 mm Cool to about 60°C and add 20 mL of a sterile 1 A4 solutron of glucose Just before use add 5 mL of a sterile solutron of 2 M&l,. 3 Glycerol stock solutron at a concentratron of 40% (v/v) 4. -40 primer. supplied wtth Sequenase (United States Brochemtcal)

237

Major His tocompa tlbility Complex 5. LBGA. LB supplemented wrth 2 mg/mL glucose and 50 pg/mL amprcrllm. 6. 48-Well plates

2.3. Preparation

of the HPLC-Fractionated

Library

1 Isopropyl-B-u-throgalactopyranosrde (IPTG) stock solution Prepare a solution of 1 M IPTG m water, stertlrze by filtration, dispense into 1-mL aliquots, and store at -20°C 2 Lysis buffer 20 mM Trts-HCI, pH 8 0,200 mA4 NaCl, 1 mM EDTA 3 50-mL Conical-bottom tissue culture tubes 4 Lysozyme 5. Amylose resin (New England BroLabs) 6. 2.5 x IO-cm columns equrpped with a stopcock 7. Column buffer (CB) 20 mMTrrs-HCl, pH 7 4,200 mM NaCl, 1 mM EDTA 8 Maltose CB elutron solutron. containing 10 mM maltose. 9 3MM Paper. 10 Coomassie stain: 25% methanol (v/v), 8% acetic acid (v/v), 67% dH,O (v/v), and 2 5 mg/mL Coomasste Brilliant Blue R-250. 11 Coomassie destaining solution 25% methanol(v/v), 8% acetic acid (v/v), 67% dH20 (v/v) 12. Bradford reagent or commercially available kits for determining protein concentration 13 Factor X, (New England BtoLabs) 14 C 18 cartridges (Sep-Pak Plus, Mrlhpore, Mtlford, MA) 15. Centrrprep 10 (Amicon, Beverly, MA) 16. Trrfluoroacetrc acid (TFA) . 17 A solutron of 0.1% TFA 18 A solution of 80% acetomtrile, 0 1% TFA 19 A solution of 70% acetomtrile, 0 1% TFA 20. Cl8 column, 300-A pore, 5-urn bead. 21. Fraction collector equipped to hold tubes that can be racked m a 96-well format 22. Individual cluster tubes (Costar, Cambridge, MA). 23. 10 x 75-mm Glass tubes (Baxter, McGaw Park, IL)

2.4. Peptide Storage and Screening 96-Well

U-bottom

2.5. Isolating

with T-Cells

plates,

Clones Expressing

Mimotopes

1 1g-Gage needle 2 A repeat prpetor (Eppendorf Repeater with 0 5-mL Combltlps, Hamburg, Germany) 3. Phosphate-buffered salme (PBS) dissolve m water 8 g NaCl, 0.2 g KCl, 1 15 g Na2HP0,*H20, 0 2 g KH2P04. Adjust the pH to 8.0 and add water to 1 L 4 PBS-EDTA solution PBS supplemented with 1 mM EDTA.

238

Gavm and Bevan

5 Lysosyme solution. A solution of PBS-EDTA lysosyme 6 96-Well flat-bottom plates 7 96Well V-bottom plates

supplemented with 0 5 mg/mL

3. Methods 3.1. Preparation and Cloning of Insert D/VA 3.1 1. Vector Preparation In order to generate a peptide without N-terminal additions, it 1s necessary that tts first ammo acid follow the argmme of the factor X, site (IEGR). The vector pMAL-c contains a StuI restriction site that makes a blunt cut following the arginine codon, however, for higher cloning efficiency, the insert DNA should be ligated to two sites with 4-base overhangs. Thus, for this protocol, the oligonucleotide IS inserted between the BamHI site that precedes the protease sequence and the PstI site. The insert DNA reintroduces the protease sequence (Fig. 1) 1 Digest 3 pg of the plasmid pMAL-c DNA with PstI and BumHI Both enzymes can be included m the same buffer (NEBuffer 3 or BumHI unique buffer, see New England BioLabs catalog) 2 Purify the lmearlzed vector away from the excised DNA by 1% agarose gel electrophoresis Cut out the correct band (-6 1 kb) from the gel with a clean razor blade and purify the DNA by electroelution or glass beads. 3. Bring the final linear DNA preparation to lo-50 ng/pL TE

3.1.2. Ohgonucleotide

Design and Preparation

This protocol is based on that of Hill (7). We recommend that this detailed descriptron of cloning degenerate DNA be consulted should unanticipated problems arise 1 A single degenerate obgonucleotide with an 8-IO-bp palmdromic 3’ end is required The palindrome contains a PstI restriction site, and the S-end contains the BumHI site nested by a few nonpalmdromlc nucleotides Followmg the BumHI sue IS the sequence encoding the factor X, site, the degenerate peptide, and three stop codons Degenerate codons are encoded by NNS rather than NNN for a more even distribution of ammo acids and the exclusion of stop codons (N = G, A, T, C; S = G, C). Thus, for an H-2Db restricted library (Fig. l), the ohgonucleotlde IS as follows S-CGT GGATCC ATC GAG GGT AGG NNS NNS NNS NNS AAC NNS NNS NNS ATS TAA TAA TGA CTGCAG TC-3’ 2 Preparations of large oligonucleotides are often contaminated with shorter fragments, thus, it is necessary to purrfy the DNA by HPLC (offered by many DNA synthesis facllmes) or denaturing polyacrylamide gel electrophoresls (PAGE)

Major Histocompa t/bil/ty Complex factor X

P tac

pMAL-c .a-

239

ma/E

~2-26

-Y

@amHI- IEGR XXXXNXXXd***-

PSI -...a

Fig 1. Schematic representation of the plasmid construct for an H-2Db-restrrcted pepttde library. The translatron of the cloned ohgonucleotrde is shown m capttahzed Italics, where X = a degeneratecodon encoding 20 amino acids and * = a stop codon.

3 4. 5. 6

7

8. 9. 10.

11

For the latter, a 10% gel with 7 Murea is used, andthe excised gel slice is crushed and soaked overmght at 37°C m ammonium acetate solutton Remove the gel fragments with 0.45~pm Spin-X filters, and repeat elutton for a few hours with fresh ammomumacetate solution Combme the eluates and extract wtth phenol/ chloroform followed by an extraction with chloroform alone. Add sodium acetate (pH 5.2) to a final concentratton of 0.3M, and magnesiumchloride to 10 mM, and preclpttate with ethanol. Resuspendat 0.5-l pg/pL m dHzO Bring 2-3 pg oligonucleotide to 10 l.tL dH,O. Incubate at 70°C for 5 mm and add 1.5 FL 5X Sequenasereactton buffer Cool to room temperature and let sit for 60 mm. Add premixed. 64 ~.LLdH,O, 12 l.t.L 5X Sequenasereaction buffer, 2 FL dNTPs (from a mixture of 25 mA4 each), 6.7 pL DTT (0 1 M), and 5 U E coli DNA polymerase-Klenow fragment Incubate 30-60 mm at room temperature Stop by addmg EDTA to a final concentration of 10 mM and sodium acetate to 0 3 M Extract with phenol/ chloroform, precipitate with ethanol, wash with 70% ethanol, and resuspendin 90 FL dHzO Add 10 /.tL 10X restriction endonucleasebuffer (NEBuffer 3 or BarnHI unique buffer). Save 10 yL for PAGE analysis Cut 10 pL wtth PstI, 10 yL with BumHI, and the remamder with both enzymes for 6 h at 37°C Use IO-40 U enzyme per pg DNA. Analyze the uncut and the three cut samplesby 10% PAGE For a nonamer peptide, the uncut sampleshould give a 130-bp fragment, the BumHI digest should give a slightly smaller fragment, the PstI digest shouldbe 65 bp, and the BamHIPstI fragment should be noticeably smaller. If this pattern is not observed it 1s likely that the origmal template oligonucleotide was not pure enough and contamed shorter fragments Gel purify the remaining BarnHI-MI fragment as described for the ortgmal oligonucleotide but wrthout urea

3.7.3. Ligation First the optimum molar ratio of insert to vector DNA then larger scale ligatlons are performed.

is established

and

1 In final volumes of 5 pL 1X hgatton buffer, mix 10 ng lmear vector with 0,O.l) 03,1,33,andlOngmsertDNA

240

Gavin and Bevan

2. Add T4 DNA ligase and Incubate at 16°C overnight 3 Transform competent E. colz as described below and plate ahquots of the transformants on LEVampicrllm plates. The maxrmal hgatron effrcrency is hkely to be observed at a vector insert molar ratio of 1 3 (0 3 ng insert) 4 Set up a larger hgation of the optrmal ratio, such as 500 ng vector with 15 ng Insert in 100 pL hgatron buffer

3.2. E. coli Transformation and Library Storage 3.2 1. Competent E. coil and Transformat/on The TB 1 E. colz strain 1s recommended by New England BtoLabs, and both TBl and DHSa were adequate in our hands For good library representation, high numbers of transformants are required, thus we recommend that great care be taken in preparing competent E. coZi or that competent E. coli are purchased as such. Both electroporatron and heat shock are acceptable methods of transformatron, however, larger numbers of clones are more easrly obtained by electroporation owing to the high density of E. coli and the higher quantities of DNA that can be mcorporated. For electroporatton, tt 1s important that the lrgattons be precipitated with ethanol and resuspended m dH*O. 1 Transform E. co11according to a predetermmed or manufacturer’s protocol 2 Followmg heat shock or electric pulse, add 1 mL SOC medium and incubate at 37”C, 200 rpm agrtatton for 45-60 min. Do not allow the bacteria to recover for more than 1 h because the clones will begin to rephcate.

3 Plate serial dilutions of the culture starting with 50 pL on LB/amp plates. 4 Add an equal volume of sterile glycerol stock to the remaining culture. Snapfreeze wrth an ethanol/dry ice bath and store at -80°C 5 The followmg day, count the colonies and calculate the total number of stored transformants.

6 Repeat hgations and transformatrons untrl adequate numbers of clones are obtained and stored Mrmotopes can easily be detected in severely underrepresented bbrarres (I) However, the degree of peptrde dependency for T-cell actrvatron can vary greatly, as we have recovered one cytotoxrc T-lymphocyte (CTL) clone that did

not respond to any of 1 8 x lo6 peptrdes in a library of lo9 possible sequences (6). The number of clones should be tailored to the number of random posrtions and the precise appllcatron of the library.

3.2.2. Assessmg the QuaMy of the Library 1 Pick several clones from the above plates and prepare the plasmrd DNA by a

mmiprep procedure. 2 Sequence the insert DNA using the -40 pnmer (see Subheading 3.53.) 3 Check to see d there IS one msert per plasmrd and that they are m frame wrth

MBP and the factor X, sate Determine the ratro of productrve clones to total clones

Major Histocompa tlbility Complex 3.2.3. See&g

241

and Expanding Transforman ts

The clones are expanded m sterile 48-well plates m 0.75 mL LBGA per well. The numbers of clones per well should depend on the size and complexity of the library. With a library of seven random positions and two fixed anchor residues, a considerable proportion of the peptides may not bind the specific MHC, allowing for high complexity in these pools. We have not tried pools more complex than 3900 clones/well, in which mlmotopes were easily detected in factor X,-treated bacterial lysates (I) (see Note 4). 1 Work on a clean bench with a Bunsen burner maintaining an air current 2. Thaw the frozen transformants on ice. 3 Dilute all of the bacteria into the total volume LBGA required to fill the 48-well plates at 0 75 mL per well. 4 To confirm the absolute size of the library, plate a predicted 50-100 clones on a few LB/amp plates and count the colonies the following day. 5 Aliquot the clones This IS most accurately done with a 12-channel, 3OO+L pipetor Load the plpetor with 8 tips, skipping every third channel Set to 250 pL, and dispense three allquots per row A 5-mL plpet IS also adequate, if controllmg 0 75-mL volumes is not a dlfflculty 6. When all of the clones are seeded, close the gap between the lid and plate with tape to prevent evaporation Wrap the tape the full circumference of the plate leaving a l-cm gap on one side for aeration. 7 Secure the plates to the table of a shaker/incubator They can be taped to a test tube rack, taped to the table, or taped to each other m a stack and secured into an Erlenmeyer flask holder 8. Culture 12-14 h at 37”C, 200 rpm agitation

3.2.4. Pooling and Storing the Library The library is stored m the 48-well plates for isolating mimotopes, and m more complex pools for larger preparations of HPLC-purified peptides. For this latter application, the highest complexity we have used IS 186,000 clones per 43 HPLC fractions. Because different mlmotopes could be detected in consecutive fractions (6), we recommend either lower complexity or higher HPLC

resolution. 1 The following day remove 250 pL from each well and pool the cultures of a predetermined number of wells, such as all the wells from a single plate Using a 12-channel pipetor loaded with 8 tips, plpet the cultures into a single trough and transfer to a 50-mL tube 2. Add glycerol stock to make a final concentration of 20% (v/v) and mix well 3 Ahquot into 2-mL freezer vials, snap-freeze, and store at -80°C (see Note 1). 4. To the remaining 48-well cultures add 0.5 mL 40% glycerol using the 12-channel pipetor and mix well If two sets of 48-well plates are desired, split the volume of each well between two plates (see Note 1)

242

Gavin and Bevan

5 Tape the lids down and place mdtvtdually at -80°C Once the cultures have frozen, stack the plates, wrap m plastic wrap, and return them to the freezer.

3.3. Preparation

of the HPLC-Fractionated

Library of peptide can be obtained from 1 L of culture. The

One to two milligrams following protocol is for a medium-sized preparation that should last for several T-cell assays. Thts protocol is based on that of Rtggs (5).

3.3.1. From Protein Induction to Factor X, Cleavage 1, Inoculate 250 mL LBGA with two vials of the more complex pools. 2. Culture at 37°C) 250 rpm agitatton, until the OD6, = 0.5. 3. Add IPTG to make a concentratton of 0.3 n-&f m order to induce fusion protein synthesis and contmue mcubation for 3 h 4 Resuspend pelleted bacteria (20 min, 4000g) in 10 mL ice-cold lysis buffer Transfer to a 50-mL conical-bottom tissue culture tube. 5 Add lysozyme to a final concentratton of 0 5 mg/mL, and incubate at 4°C for 30 min 6 Freeze the bacteria, overnight at -20°C is best The column should be run the same day the bacteria are thawed Placing the bacteria at -80°C until frozen is also adequate 7. Prepare the amylose resin columns (2.5 x 10 cm), equtpped with a stopcock At 4”C, ptpet resm (9 mL final bed volume) into the columns and wash with 8 column volumes of CB 8 Thaw the bacteria m cold water and somcate on ice until no longer vtscous The lysozyme-freeze/thaw step will lyse most of the bacterta. Somcatton is to shear the DNA A lower somcator setting is adequate, such as medmm amplitude, 50% pulses for 1-2 mm. To prevent foaming, keep the ttp centered, vertical, and 1 cm from the bottom of the tube 9 Centrifuge the lysate m a swmgmg bucket rotor at 14,OOOg, 30 mm, 4°C (10,000 rpm in a Beckman SW28) 10 Ddute supernatant to 50 mL wtth ice-cold CB. Vacuum filter through a 0.22~ym filter if slightly cloudy 11. At 4”C, pass the lysate through the columns at 1 mL/mm, followed by 8 column volumes of Ice-cold CB. Save the flowthrough It may be difficult to handle many columns at once, divide this task into manageable numbers of columns 12. Elute MBP-peptide fusion protein wtth the maltose CB solutton, collectmg ten 2-mL fractions. 13 Mtx the fractions by mvertmg the tubes, spot 5 ltL each onto 3MM paper, and an dry Stain the paper m a small tray with Coomassie stain for 30 s and destam thoroughly with the Coomasste destaining solution 14 Pool the fractions that contain protem and determine the protein concentration for a few of the pools (Bradford method or commerctally available kits) The fusion protein should elute at 1-3 mg/mL, and 250-mL cultures should yield 20-25 mg fusion protein

Major His tocompa t/bill ty Complex

243

15. Add factor X, at 2.5-5 pg per mg fusion protein. Mix well and incubate at room temperature overnight (see Note 2)

3.3.2. Preparation for HPLC These steps may be performed at room temperature. The peptides are removed from MBP by membrane filtration, and desalted by adherence to Cl 8 cartridges. Prewetting the cartridges with acetonitrrle is important to remove the air and make the Cl8 accessible to peptide binding

2. 3

4

5 6

7 8.

9.

10

Separate the peptides from MBP by lo-kDa membrane filtration. If the Centriprep 10 is used, centrifuge at 3000g m a swinging bucket rotor After all of the solution has been filtered, rmse a few more milliliters of dH20 through the membrane. The Sep-Pak Plus cartridges (step 3 below) may be prepared during the centrifuge spins. Add TFA to the

Combinatorial Peptide Library Protocols (Methods in Molecular Biology Vol 87)

Combinatorial Peptide Library Protocols

Combinatorial Peptide Library Protocols