Helicases: Methods and Protocols (Methods in Molecular Biology, Vol 587)

METHODS IN M O L E C U L A R B I O L O G Y TM Series Editor John M. Walker School of Life Sciences University of Her...

Author: Mohamed M. Abdelhaleem

241 downloads 1747 Views 7MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

METHODS

IN

M O L E C U L A R B I O L O G Y TM

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For other titles published in this series, go to www.springer.com/series/7651

Helicases Methods and Protocols

Edited by

Mohamed M. Abdelhaleem University of Toronto, Toronto, ON, Canada

Editor Mohamed M. Abdelhaleem Hospital for Sick Children Department of Paediatric Laboratory Medicine 555 University Ave. Toronto ON M5G 1X8 Canada [email protected]

ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-60327-354-1 e-ISBN 978-1-60327-355-8 DOI 10.1007/978-1-60327-355-8 Library of Congress Control Number: 2009936373 # Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer ScienceþBusiness Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed on acid-free paper springer.com

Preface The objective of this book is to provide the scientific community with the current methods used to study helicases, the enzymes that utilize the energy derived from nucleoside triphosphate (NTP) hydrolysis to unwind the double-stranded helical structure of nucleic acids. The book starts with an overview chapter that provides a brief introduction of helicases, with few examples of their role in nucleic acid metabolism. This chapter is intended for readers new to the field. The chapters that follow are written by leading international scientists who contributed significantly to our current understanding of helicases. In these chapters, the reader finds methods for the production and purification of helicases from different species as well as detailed studies of helicase activities, including NTP binding and hydrolysis, nucleic acid binding and unwinding, and translocation along nucleic acid substrates. Helicase activities are generally measured by methods that rely on radiometric, enzymatic, and fluorescence-based techniques. As described in Chapter 2, fluorescence probes have high sensitivity and rapid response that permit real time analysis. The ability to use fluorescence probes to investigate helicase activity at the single molecule level has provided significant insights into the mechanism of helicase function. A general guide to such assays is given in Chapter 3. Another advance in helicase studies is the use of pre-steady state kinetic techniques, as described for the translocase activity along single-stranded nucleic acids (Chapter 4) and for the DNA unwinding and polymerization activities of bacteriophage T7 molecule (Chapter 5). In addition to nucleic acid unwinding, helicases are involved in the disruption of protein–nucleic acid interactions. Chapter 6 has four examples of protein displacement by helicases involved in various steps of nucleic acid metabolism. As helicases occur in vivo as part of molecular complexes that include nucleic acid and protein, characterization of their protein and nucleic acid interactions provides insights into their in vivo roles. Chapter 7 describes a protocol to investigate protein–protein interactions in vivo using tandem affinity purification. Chapter 8 describes the use of chromatin immunoprecipitation (ChIP) to determine nucleic acid targets of DNA helicases. The following three chapters describe methods to study DNA helicases involved in replication (Chapter 9), transcription termination (Chapter 10), and recombination (Chapter 11). The RecQ family of DNA helicases is involved in DNA repair and recombination and has been the subject of intense research because of their roles in maintaining genome stability. Three chapters are devoted to the study of RecQ helicases from different species. A protocol for the production and characterization of mutants of the helicase core of human Bloom syndrome gene (BLM) is described in Chapter 12. This protocol can be adapted to study other helicases. Chapter 13 describes the role of Drosophila Blm helicase in double-stranded gap repair. Protocols for the expression and characterization of RecQ helicases from the plant model Arabidopsis thaliana are described in Chapter 14. v

vi

Preface

The following chapters describe methods to study hepatitis C virus (HCV) nonstructural protein 3 (NS3), a potential therapeutic target for the liver disease caused by HCV. Chapter 15 describes a fluorescence-based high-throughput assay to test inhibitors of NS3 helicase activity. In addition to the C-terminal helicase domain, NS3 protein has an N terminal serine protease. A method to simultaneously monitor the helicase and protease activities of HCV NS3 is described in Chapter 16. This method could be used to identify dual NS3 inhibitors. In Chapter 17, computational techniques to study NS3 are described. RNA helicase members of the DExD/H-box family of proteins are involved in all aspects of cellular RNA metabolism. Chapter 18 provides a protocol for the quantitative evaluation of the unwinding activity of the largest family of RNA helicase, the DEAD-box proteins. Examples of the methods used to study the versatile roles played by RNA helicases include the role of Ddx5 in transcription (Chapter 19), the role of DDX3 in HIV infection (Chapter 20), and the activities of DHX9 (RNA helicase A and nuclear DNA helicase II) (Chapter 21) and its drosophila homolog maleless protein (Chapter 22). Chapter 23 describes cloning, expression and activities of the human RNA helicase, Upf1, which is involved in non-sense mediated decay of mRNA. Helicases are involved in regulating the mitochondrial genome. Chapter 24 provides protocols to study the activities of the mitochondrial degradosome, including the activity of its helicase component, Suv3p. Chapter 25 describes the helicase and antitelomere activities of Pif1p, a functionally versatile helicase involved in regulating both the mitochondrial and nuclear genomes. The last two chapters illustrate two applications of helicase research in agriculture and medicine. Chapter 26 describes a method to confer salinity stress tolerance to plants by overexpression of a DNA helicase. Chapter 27 describes the potential targeting of helicases to inhibit the growth of malaria parasites. This book has only been made possible by the contributions from the authors. I would like to thank all of them for their cooperation and timely submissions. I am grateful to the series editor, John Walker, for his helpful comments and editorial expertise. Finally, I would like to acknowledge the support of my family. Mohamed M. Abdelhaleem

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v ix

1.

Helicases: An Overview. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mohamed Abdelhaleem

1

2.

Fluorescent Biosensors to Investigate Helicase Activity . . . . . . . . . . . . . . . . . . . . . Martin R. Webb

13

3.

Single-Molecule FRET Analysis of Helicase Functions . . . . . . . . . . . . . . . . . . . . . . Eli Rothenberg and Taekjip Ha

29

4.

Kinetics of Motor Protein Translocation on Single-Stranded DNA . . . . . . . . . . . . Christopher J. Fischer, Lake Wooten, Eric J. Tomko, and Timothy M. Lohman

45

5.

Experimental and Computational Analysis of DNA Unwinding and Polymerization Kinetics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Manjula Pandey, Mikhail K. Levin, and Smita S. Patel

6.

Protein Displacement by Helicases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Laxmi Yeruva and Kevin D. Raney

7.

In Vivo Investigation of Protein–Protein Interactions for Helicases Using Tandem Affinity Purification. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Matthew Jessulat, Terry Buist, Md Alamgir, Mohsen Hooshyar, Jianhua Xu, Hiroyuki Aoki, M. Clelia Ganoza, Gareth Butland, and Ashkan Golshani

57 85

99

8.

Mapping Genomic Targets of DNA Helicases by Chromatin Immunoprecipitation in Saccharomyces cerevisiae . . . . . . . . . . . . . . . . . . . . . . . . . . 113 Jennifer Cobb and Haico van Attikum

9.

Methods to Study How Replication Fork Helicases Unwind DNA . . . . . . . . . . . . 127 Daniel L. Kaplan and Irina Bruck

10. Simple Enzymatic Assays for the In Vitro Motor Activity of Transcription Termination Factor Rho from Escherichia coli. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Marc Boudvillain, Ce´line Walmacq, Annie Schwartz, and Fre´de´rique Jacquinot 11. Single-Molecule Studies of RecBCD. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 155 Thomas T. Perkins and Hung-Wen Li 12. Mutational Analysis of Bloom Helicase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173 Xu Guang Xi 13. In Vivo Analysis of Drosophila BLM Helicase Function During DNA Double-Strand Gap Repair . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 Mitch McVey 14. Purification and Characterization of RecQ Helicases of Plants . . . . . . . . . . . . . . . . 195 Daniela Kobbe, Manfred Focke, and Holger Puchta

vii

viii

Contents

15. Fluorometric Assay of Hepatitis C Virus NS3 Helicase Activity . . . . . . . . . . . . . . . 211 Mariusz Krawczyk, Anna Stankiewicz-Drogon´, Anne-Lise Haenni, and Anna Boguszewska-Chachulska 16. A Method to Simultaneously Monitor Hepatitis C Virus NS3 Helicase and Protease Activities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 223 David N. Frick, Olya Ginzburg, and Angela M.I. Lam 17. Computer Modeling of Helicases Using Elastic Network Model . . . . . . . . . . . . . . 235 Wenjun Zheng 18. Duplex Unwinding with DEAD-Box Proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245 Eckhard Jankowsky and Andrea Putnam 19. Analysis of the RNA Helicase p68 (Ddx5) as a Transcriptional Regulator . . . . . . . 265 Samantha M. Nicol and Frances V. Fuller-Pace 20. A Method to Study the Role of DDX3 RNA Helicase in HIV-1 . . . . . . . . . . . . . . 281 Chia-Yen Chen, Venkat R.K. Yedavalli, and Kuan-Teh Jeang 21. Molecular Characterization of Nuclear DNA Helicase II (RNA Helicase A) . . . . . 291 Suisheng Zhang and Frank Grosse 22. Regulation of Inter- and Intramolecular Interaction of RNA, DNA, and Proteins by MLE. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 303 Hyangyee Oh, Andrew M. Parrott, Yongkyu Park, and Chee-Gun Lee 23. Biochemical Characterization of Human Upf1 Helicase . . . . . . . . . . . . . . . . . . . . . 327 Zhihong Cheng, Gaku Morisawa, and Haiwei Song 24. Assays of the Helicase, ATPase, and Exoribonuclease Activities of the Yeast Mitochondrial Degradosome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 339 Michal Malecki, Piotr P. Stepien, and Pawel Golik 25. Characterization of the Helicase Activity and Anti-telomerase Properties of Yeast Pif1p In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359 Jean-Baptiste Boule´ and Virginia A. Zakian 26. A Method to Confer Salinity Stress Tolerance to Plants by Helicase Overexpression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 377 Narendra Tuteja 27. A Method to Inhibit the Growth of Plasmodium falciparum by Double-Stranded RNA-Mediated Gene Silencing of Helicases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 389 Renu Tuteja Subject Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 401

Contributors MOHAMED ABDELHALEEM • Department of Paediatric Laboratory Medicine, The Hospital for Sick Children, University of Toronto, Toronto, ON, Canada MD ALAMGIR • Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, ON, Canada HIROYUKI AOKI • Banting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada ANNA BOGUSZEWSKA-CHACHULSKA • Genomed, Warsaw, Poland MARC BOUDVILLAIN • Centre de Biophysique Moleculaire (UPR4301), CNRS, Orleans cedex 2, France JEAN-BAPTISTE BOULE • Department of Molecular Biology, Princeton University, Princeton, NJ, USA IRINA BRUCK • Department of Biological Sciences, Vanderbilt University Nashville, TN, USA TERRY BUIST • Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, ON, Canada GARETH BUTLAND • Life Science Division, Lawrence Berkeley National Laboratory, Berkeley, CA, USA CHIA-YEN CHEN • Molecular Virology Section, Laboratory of Molecular, Microbiology, the NIAID, NIH, Bethesda, MD, USA ZHIHONG CHENG • Cancer and Developmental Cell Biology Division, Institute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Singapore, Singapore JENNIFER COBB • Department of Biochemistry and Molecular Biology, Southern Alberta Cancer Research Institute, University of Calgary, Calgary, AB, Canada CHRISTOPHER J. FISCHER • Department of Physics and Astronomy, University of Kansas, Lawrence, KS, USA MANFRED FOCKE • Botanik II, Universita¨t Karlsruhe (TH), Karlsruhe, Germany FRANCES V. FULLER-PACE • Centre for Oncology & Molecular Medicine, University of Dundee Ninewells Hospital & Medical School, Dundee, UK DAVID N. FRICK • Department of Biochemistry & Molecular Biology New York Medical College Valhalla, NY, USA M. CLELIA GANOZA • Banting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada OLYA GINZBURG • Department of Biochemistry & Molecular Biology, New York Medical College, Valhalla, NY, USA PAWEL GOLIK • Faculty of Biology, Institute of Genetics and Biotechnology, University of Warsaw, Warsaw, Poland ASHKAN GOLSHANI • Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, ON, Canada

ix

x

Contributors

FRANK GROSSE • Leibniz Institute for Age Research, Fritz Lipmann Institute (FLI), Jena, Germany TAEKJIP HA • Department of Physics, Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, IL, USA ANNE-LISE HAENNI • Institut Jacques Monod, Paris, France MOHSEN HOOSHYAR • Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, ON, Canada ECKHARD JANKOWSKY • Department of Biochemistry & Center for RNA Molecular Biology, School of Medicine, Case Western Reserve University, Cleveland, OH, USA FREDERIQUE JACQUINOT • Centre de Biophysique Moleculaire (UPR4301), CNRS, Orleans cedex 2, France KUAN-TEH JEANG • Molecular Virology Section, Laboratory of Molecular, Microbiology, the NIAID, NIH, Bethesda, MD, USA MATTHEW JESSULAT • Department of Biology and Ottawa Institute of Systems Biology, Carleton University, Ottawa, ON, Canada DANIEL L. KAPLAN • Vanderbilt University Department of Biological Sciences Nashville, TN, USA DANIELA KOBBE • Botanik II, Universita¨t Karlsruhe (TH), Karlsruhe, Germany MARIUSZ KRAWCZYK • Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland ANGELA M. I. LAM • Department of Biochemistry & Molecular Biology, New York Medical College, Valhalla, NY, USA CHEE-GUN LEE • UMDNJ-New Jersey Medical School, Department of Biochemistry and Molecular Biology, Newark, NJ, USA HUNG-WEN LI • Department of Chemistry, National Taiwan University, Taipei 10617, Taiwan TIMOTHY M. LOHMAN • Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St. Louis, MO, USA MICHAL MALECKI • Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, Warsaw, Poland MIKHAIL K. LEVIN • Department of Biostatistics & Bioinformatics, Duke University Medical Center, Durham, NC, USA MITCH MCVEY • Department of Biology, Tufts University, Medford, MA GAKU MORISAWA • Cancer and Developmental Cell Biology Division, Institute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Singapore, Singapore SAMANTHA M. NICOL • Centre for Oncology & Molecular Medicine, University of Dundee Ninewells Hospital & Medical School. Dundee, UK HYANGYEE OH • HHMI, Waksman Institute, Rutgers University, Piscataway, NJ, USA MANJULA PANDEY • Department of Biochemistry, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, NJ, USA SMITA S. PATEL • Department of Biochemistry, University of Medicine and Dentistry of New Jersey-Robert Wood Johnson Medical School, Piscataway, NJ, USA YONGKYU PARK • UMDNJ-New Jersey Medical School, Department of Cell Biology and Molecular Medicine, Newark New Jersey, USA

Contributor

xi

ANDREW M. PARROTT • UMDNJ-New Jersey Medical School, Department of Biochemistry and Molecular Biology, Newark, NJ, USA THOMAS T. PERKINS • MCD Biology, JILA, NIST & CU, University of Colorado at Boulder, Boulder, CO, USA HOLGER PUCHTA • Botanik II, Universita¨t Karlsruhe (TH), Karlsruhe, Germany ANDREA PUTNAM • Department of Biochemistry & Center for RNA Molecular Biology, School of Medicine, Case Western Reserve University, Cleveland, OH, USA KEVIN D. RANEY • Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, AR, USA ELI ROTHENBERG • Department of Physics, NSF Center for the Physics of Living Cells, University of Illinois at Urbana–Champaign, Urbana, IL, USA ANNIE SCHWARTZ • Centre de Biophysique Moleculaire (UPR4301), CNRS, Orleans cedex 2, France HAIWEI SONG • Cancer and Developmental Cell Biology Division, Institute of Molecular and Cell Biology, A*STAR (Agency for Science, Technology and Research), Singapore, Singapore ANNA STANKIEWICZ-DROGON´ • Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland PIOTR P. STEPIEN • Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, Warsaw, Poland ERIC J. TOMKO • Department of Biochemistry and Molecular Biophysics, Washington University School of Medicine, St. Louis, MO, USA NARENDRA TUTEJA • Plant Molecular Biology Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India RENU TUTEJA • Malaria Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India HAICO VAN ATTIKUM • Department of Toxicogenetics, Leiden University Medical Center, Leiden, The Netherlands MARTIN R. WEBB • MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London, UK CELINE WALMACQ • National Cancer Institute, NIH, Frederick, MD LAKE WOOTEN • Department of Physics and Astronomy, University of Kansas, Lawrence, KS, USA XU GUANG XI • Institut CURIE Recherche, Orsay, France JIANHUA XU • Banting and Best Department of Medical Research, University of Toronto, Toronto, ON, Canada VENKAT R.K. • YEDAVALLI, Molecular Virology Section, Laboratory of Molecular, Microbiology, the NIAID, NIH, Bethesda, MD, USA LAXMI YERUVA • Department of Biochemistry and Molecular Biology, University of Arkansas for Medical Sciences, Little Rock, AR, USA VIRGINIA A. ZAKIAN • Department of Molecular Biology, Princeton University, Princeton, NJ, USA SUISHENG ZHANG • Department of Biochemistry, National University of Ireland, Galway, Ireland WENJUN ZHENG • Physics Department, University at Buffalo, Buffalo, NY, USA

Chapter 1 Helicases: An Overview Mohamed Abdelhaleem Abstract Helicases are essential enzymes involved in all aspects of nucleic acid metabolism including DNA replication, repair, recombination, transcription, ribosome biogenesis and RNA processing, translation, and decay. They occur in vivo as part of molecular complexes that include the components required for each specific step of nucleic acid metabolism. The role of the helicases is to utilize the energy derived from nucleoside triphosphate hydrolysis to translocate along nucleic acid strands, unwind/separate the helical structure of double-stranded nucleic acid, and, in some cases, disrupt protein–nucleic acid interactions. Because of their essential function, helicases are ubiquitous and evolutionary conserved proteins. This chapter briefly highlights helicase structure and activities and provides examples of the helicases involved in nucleic acid metabolism. Key words: Helicases, DNA replication, DNA repair, DNA recombination, transcription, ribosome biogenesis, RNA splicing, translation, RNA degradation.

1. Helicase Structure and Activities

Helicases are characterized by the presence of conserved motifs in the form of short amino acid sequences. Based on variations of the number of motifs, their amino acid sequence, and spacing, helicases are grouped into superfamilies, including three large (SF1–SF3) and two small (SF4 and SF5) ones (1). SF1 and SF2 have at least seven conserved motifs (I, Ia, II, III, IV, V, and VI) and are monomers, whereas SF3–SF5 members assemble into hexamers (2). The crystal structures of several representative helicases were resolved (3–10) and revealed common features. Monomeric helicases (SF1/SF2) have a core that consists of two domains with a linker region. Hexameric helicases (SF3–SF5) form a core that

M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_1, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

1

2

Abdelhaleem

includes six individual domains arranged in a ring. The domains are termed RecA-like because of the similarity to the ATP-binding core of RecA recombination protein. The conserved helicase motifs include those involved in NTP binding and hydrolysis, which are similar to the Walker A and B boxes of ATPase. The other conserved motifs are involved in coupling of the NTP hydrolytic state to protein conformational changes and in nucleic acid binding (2, 11–13). Helicase core structure allows for cycles of nucleic acid binding and release driven by NTP binding and hydrolysis (11). By utilizing the energy derived from NTP hydrolysis, helicases function as nucleic acid motor or translocases. Models have been proposed to describe helicase coupling of NTP hydrolysis with directional translocation and unwinding (11, 14, 15). Another group of nucleic acid motors include members of the ATPases associated with various cellular activities (AAA+) which have been proposed as SF6 of helicases/translocases (2). These molecules contain the AAA+ fold and include hexameric motor proteins such as mini chromosome maintenance (MCM) protein complexes involved in replication initiation (16). Helicase activities are described in terms of rate, processivity, directionality, and step size. Rate is the number of unwound/ translocated base pairs, or the number of NTP molecules hydrolyzed, per unit time. Processivity is the number of base pairs unwound/translocated before the helicase dissociates from the nucleic acid. Directionality is the bias exhibited by a processive helicase in its movement along nucleic acids, either 30 to 50 or 50 to 30 direction. Finally, step size has been described as either mechanical (the average distance moved) or kinetic (the average number of unwound/translocated) during each catalytic cycle (2, 11, 17, 18). Depending on the type of their nucleic acid targets, helicases are generally classified as DNA or RNA helicases. Some helicases can unwind both targets (19, 20), whereas others preferentially unwind RNA–DNA duplexes (21). DNA helicases are involved in replication, repair and recombination. RNA helicases are involved in all aspects of RNA metabolism. The majority of RNA helicases belongs to DExD/H-box proteins which have the conserved motifs and domain structure of SF2 helicases (13, 22, 23). DExD/H-box proteins derive this name from the single letter code of the four amino acids of motif II (which is equivalent to Walker B motif of ATPases). They are classified into several subgroups including DEAD-box (DDX) and DEAH-box (DHX) families, which are distinguished by consistent sequence differences that extend beyond motif II (23, 24). DEAD-box members constitute the largest subgroup and demonstrate significant functional differences compared to other helicases (13, 23, 25, 26).

Helicases: An Overview

3

Viral DExD/H RNA helicases (e.g., NPH-II) are able to translocate in a directional and processive manner on their targets and function as molecular motors for RNA (27). RNA unwinding is one of several activities that have been demonstrated thus far for DExD/H proteins. Some DExD/H proteins can function as RNPases (enzymes that disrupt protein–RNA interactions) (26, 28), whereas others have RNA annealing activity (29). The RNA unwinding and annealing and RNPase activities are consistent with the role of DExD/H-box proteins as the major players in remodeling of the ribonucleoprotein complexes (13, 23, 30). Structural differences in the amino acid sequences of the conserved motifs and the RecA-like domain as well as differences in the mode of interaction of the helicase core with nucleic acid targets allow a particular helicase to be best suited for the nucleic acid processing step in which it is involved (2, 11–13). However, the unwinding activity of the helicase catalytic core is not sequence specific. Therefore, helicases require mechanisms to recognize, and to be loaded onto, their targets. In addition, their activities are required to be optimally and tightly regulated to prevent potentially deleterious consequences. Moreover, unwinding is only one of multiple steps that take place during nucleic acid processing. Helicase-mediated unwinding is required to be coupled with subsequent steps (31). These various requirements (target recognition and loading, regulation of activities, and coupling of unwinding) are met, at least in part, through the presence of other domains within the helicase itself and/or through protein–protein interactions between helicases and other proteins that assemble in a coordinated manner to form the in vivo molecular complexes involved in nucleic acid processing (11, 18, 31, 32).

2. Examples of Helicases Involved in Nucleic Acid Metabolism 2.1. DNA Replication

The Escherichia coli hexameric helicase DnaB (SF4 member with 50 to 30 directionality) is a component of the replisome, the molecular complex responsible for the duplication of the genetic material (33). Assembly of the replisome is initiated by initiator proteins, which recognize the origin of replication and recruit other replisome components to the DNA in a coordinated manner, including loading of the helicase into the DNA. Replication proceeds with the synthesis of one daughter strand (the leading strand) by DNA polymerase in the same direction as the unwinding of the replication fork (50 to 30 ). Synthesis of the other daughter strand (the lagging strand) occurs in the opposite direction and is initiated by a special RNA polymerase (primase), carried out by DnaG protein.

4

Abdelhaleem

The helicase and primase activities are closely associated and co-regulated (34). The two activities are present within the same molecule in T7 bacteriophage gene product 4 (T7gp4) (35, 36). In archaea and eukaryotes, the minichromosome maintenance (Mcm) protein members of SF6 helicase/translocase with AAA+fold are involved in DNA replication (16, 37, 38). In archaea, a single Mcm protein forms ring-shaped homo-hexamers or doublehexamers. In eukaryotes, six different members (Mcm2–Mcm7) form a heterohexameric complex. The Mcm2–Mcm7 complex is involved both in the initiation and the elongation steps of eukaryotic DNA replication. Before the initiation of replication, other replication factors, including the Cdc45 and GINS complexes, are recruited. During elongation, the Mcm complex, together with Cdc45 and GINS, unwinds double-stranded DNA to produce single-stranded templates for DNA synthesis (39–41). DNA unwinding activity has been characterized for a subcomplex composed of Mcm4, 6, 7 proteins. Recently, the entire Mcm2–Mcm7 complex has been shown to have DNA helicase activity in vitro (42). 2.2. DNA Repair

UvrD is an E. coli hexameric helicase (SF1 member with 30 to 50 directionality) involved in DNA repair. Base–base mismatches can occur as errors of DNA polymerases. The mismatch repair (MMR) process in E. coli involves recognition of the error by a MutS homodimer, which recruits a homodimer of MutL. MutS-MutL activates MutH, which incises the strand. UvrD helicase unwinds the ends of the nicked error-containing strand, followed by its exonuclease-mediated digestion by an exonuclease. The resulting gap is filled by RNA polymerase III followed by sealing the remaining nick by DNA ligase (43, 44). The UvrABC endonuclease (which consists of UvrA, UvrB, and UvrC proteins) is the central enzyme for nucleotide excision repair (NER) process in E. coli (45). UvrB is a SF2 DNA helicase, whereas UvrC is an endonuclease. The main function of UvrA is to deliver UvrB to the damage site. UvrB also assists in the location of DNA damage via a b-hairpin that protrudes from its N-core domain and inserts between the two strands of the DNA duplex. UvrA2B heterotrimer complex recognizes damaged DNA, and a bend is formed in the DNA backbone in an ATP-dependent manner. This is followed by the release of UvrA and formation of a stable UvrB-DNA complex, which is recognized by the endonuclease UvrC which cleaves the damaged strand at two points. UvrD helicase unwinds the damaged fragment followed by exonuclease cleavage (31, 45). XPD (ERCC2) (SF2 member with 50 to 30 directionality) is a component of the transcription factor TFIIH complex and is involved in transcription-coupled NER. Mutations in the human XPD gene result in three different disorders: xeroderma


5

pigmentosum (XP), cockayne syndrome (CS), and trichothiodystrophy (TTD) (46). Recent structural data provided the basis for the different disease phenotypes produced by XPD mutations (47–49) 2.3. DNA Recombination

The E. coli RecBCD complex is involved in several processes including homologous recombination. The N-terminus of RecB and the RecD subunits have the conversed motifs of SF1 helicases. The C-terminus of RecB has the motifs of nucleases. The RecC subunit contains a region implicated in the recognition of Chi (crossover hotspot instigator), an eight base pair cis-acting DNA sequence. In addition to being one of the fastest, the RecBCD complex is unique in that it has two DNA helicases with opposite directionality, which result in a net movement in the same direction because of the anti-parallel nature of the DNA duplex. The two helicases also vary in their speed. The fast RecD helicase (50 to 30 directionality) leads the complex initially. Upon encountering Chi, the slower RecB helicase (30 to 50 directionality) becomes the leading helicase (50–52). RecQ helicases (SF2 members with 30 to 50 directionality) play important roles in maintaining genome stability including regulation of DNA recombination. These helicases participate in several DNA repair pathways through their catalytic activities and interaction with DNA repair proteins (53–55). The RecQ helicase family has been the subject of much interest as mutations in three human members result in cancer predisposition syndromes. Bloom, Werner, and Rothmund-Thomson syndromes result from mutations of the BLM, WRN, and RECQ4 helicases, respectively. BLM plays a key role in regulating homologous recombination. There is an increase in both sister and non-sister chromatid exchange in cells that lack BLM helicase. Werner syndrome is characterized by premature ageing. WRN helicase has both helicase and exonuclease activities and plays an important role in maintaining telomere stability (54, 56).

2.4. Transcription

Rho (SF5 helicase from E. coli) is a hexameric helicase required for transcription termination. Rho binds a specific region in the nascent RNA transcript which is devoid of secondary structures and rich in cytosine residues. Binding activates the RNA-dependent ATPase activity of Rho, which drives the movement of Rho hexamer along the RNA transcript in a 50 to 30 direction (31, 57). In addition to their role in RNA metabolism, some members of the DExD/H-proteins are also implicated in transcription regulation. Examples include RNA helicase A (Dhx9) (58–60) and p68 (Ddx5) (61–63). The role of some of these DExD/ H-proteins is to couple transcription to subsequent steps of RNA processing (61, 64).

6

Abdelhaleem

2.5. Ribosome Biogenesis

The eukaryotic ribosome consists of four ribosomal (r) RNAs and numerous ribosomal proteins. Three (28S, 18S, and 5.8S) rRNAs result from a primary transcript (pre-rRNA) produced by RNA polymerase I in the nucleolus. The fourth (5S rRNA) is transcribed by RNA polymerase III in the nucleoplasm. The pre-rRNA contains three coding regions and spacer fragments, the latter are removed by endo- and exonucleolytic processing reactions. The pre-rRNA is modified by methylation of the 20 -hydroxyl group of specific riboses and conversion of specific uridine residues to pseudouridine. The position of cleavage sites in pre-rRNA and the specific sites of 20 -O-methylation and pseudouridine formation are determined by small nucleolar RNAs (snoRNAs), which hybridize transiently to pre-rRNA molecules (65). Several DExD/H-box proteins are involved in ribosome biogenesis. Their RNA unwinding activity is required for snoRNA/ pre-rRNA dynamic interactions. They are also involved in regulating RNA–protein interactions within the RNP complexes of the ribosomes (23, 66, 67). Mutational analyses suggest that different DExD/H-box proteins have distinct functions in ribosome biogenesis (68, 69).

2.6. RNA Splicing

The spliceosome is a ribonucleoprotein complex that assembles in an ordered manner to catalyze the splicing of intervening introns during the processing of mRNAs from primary RNA transcripts. The well-studied yeast spliceosome contains five small nuclear (sn) RNAs (U1, U2, U4, U5, and U6) that interact with numerous proteins to form small nuclear ribonucleoprotein particles (snRNPs). Catalysis proceeds by two transesterification reactions. Once the exons are ligated, the mature mRNA is released for export and the spliceosome is disassembled and recycled for a new round of activity (70). NTP hydrolysis is not required for the transesterification reactions. Instead, it is has been suggested to drive the extensive spliceosomal conformational changes that take place during splicing. These conformational changes involve dsRNA unwinding and RNA–protein interactions (70). Several DExD/H box proteins are components of the splicesome, each with a role in a specific step during splicing. Prp2 (71) and Prp16 (72) are involved in the first and second catalytic reactions, respectively. Prp22 is involved in mRNA release (73), whereas Prp43 has a role during the release of lariat intron from the spliceosme (74).

2.7. Translation

The DEAD-box protein, eIF4A, is one of the earliest RNA helicases to be structuraly and biochemically characterized. EIF4A is involved in translation initiation as part of the cap-binding complex. The likely role of eIF4A is to unwind RNA secondary structure in the 50 UTR of mRNA to facilitate ribosome binding (75).


7

Two other DEAD-box proteins have been shown to play roles in translation, including the yeast Ded1 (76, 77) and the drosophilia vasa (Ddx4) (78). 2.8. RNA Degradation

In E. coli, the DEAD-box RNA helicase RhlB is a component of the high molecular weight complex degradosome (79). In eukaryotes, the DExH-box protein Mtr4 is required for most of the nuclear activities of the exosome (80). The cytoplasmic RNA helicase, Ski2, is required for the activities of the yeast cytoplasmic exosome (81). Other helicases involved in RNA degradation include RHAU, a DExH-box protein implicated in the turnover of AU rich elements (AREs) (82), and Upf1, a key component of the nonsense-mediated mRNA decay (NMD) machinery, which is responsible for degrading mRNAs that contain premature termination codons (10, 83).

2.9. Mitochondrial Genome

Twinkle is a mitochondrial (mt) DNA helicase with 50 to 30 directionality (84), which was originally identified as the gene mutated in patients with the autosomal dominant disease progressive external ophthalmoplegia (85). The structural similarity of Twinkle to phage T7 gene 4 primase/helicase and other hexameric ring helicases is consistent with its role as the mitochondrial replicative helicase essential for mtDNA maintenance and copy number regulation (86). It has been suggested that Twinkle serves as the primase as well as the helicase for mtDNA replication in most eukaryotes with the exception of Metazoa (87). Pif1p is another mitochondrial DNA helicase with 50 to 30 directionality (SF1 member), which is involved in mtDNA repair and recombination (88–90). A nuclear isoform of Pif1p has several roles in maintaining genome stability including regulation of telomerase activity (91). There are species-dependent variations in the size and organization of the mitochondrial genome that result in differences in RNA processing requirements such as splicing and editing (92). The mammalian mitochondrial genes are arranged in a compact form with no introns, unlike the yeast. Several yeast DEAD-box proteins are involved in splicing mtRNA introns, including Cyt-19 (93), Mss116p (94), and Mrh4 (95). Another DEAD-box protein, mHel61, plays a role in editing mtRNAs in Trypanosoma brucei (96). Suv3p, a DExD/H helicase (Ski2p subfamily), is a component of the mitochondrial degradosome required for mtRNA degradation (97). Suv3p is essential for mammalian development (98) and maintenance of proper function of human mitochondria (99). Other DExH/D-box proteins have been localized to the human mitochondria including DDX28 (100), DHX30 (101), and DHX32 (102). Their exact roles in regulating the mitochondrial genome are yet to be determined.

8

Abdelhaleem

References 1. Gorbalenya A. E. and Koonin E. V. (1993) Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol. 3, 419–429. 2. Singleton M. R., Dillingham M. S., and Wigley D. B. (2007) Structure and mechanism of helicases and nucleic acid translocases. Annu. Rev. Biochem. 76, 23–50. 3. Subramanya H. S., Bird L. E., Brannigan J. A., and Wigley D. B. (1996) Crystal structure of a DExx box DNA helicase. Nature 384, 379–383. 4. Korolev S., Hsieh J., Gauss G. H., Lohman T. M., and Waksman G. (1997) Major domain swiveling revealed by the crystal structures of complexes of E. coli Rep helicase bound to single-stranded DNA and ADP. Cell 90, 635–647. 5. Singleton M. R., Dillingham M. S., Gaudier M., Kowalczykowski S. C., and Wigley D. B. (2004) Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks. Nature 432, 187–193. 6. Kim J. L., Morgenstern K. A., Griffith J. P., Dwyer M. D., Thomson J. A., Murcko M. A., Lin C., and Caron P. R. (1998) Hepatitis C virus NS3 RNA helicase domain with a bound oligonucleotide: the crystal structure provides insights into the mode of unwinding. Structure 6, 89–100. 7. Sengoku T., Nureki O., Nakamura A., Kobayashi S., and Yokoyama S. (2006) Structural basis for RNA unwinding by the DEAD-box protein Drosophila Vasa. Cell 125, 287–300. 8. Skordalakes E. and Berger J. M. (2003) Structure of the Rho transcription terminator: mechanism of mRNA recognition and helicase loading. Cell 114, 135–146. 9. Caruthers J. M., Johnson E. R., and Mckay D. B. (2000) Crystal structure of yeast initiation factor 4A, a DEAD-box RNA helicase. Proc. Natl. Acad. Sci. USA 97, 13080–13085. 10. Cheng Z., Muhlrad D., Lim M. K., Parker R., and Song H. (2007) Structural and functional insights into the human Upf1 helicase core. EMBO J. 26, 253–264. 11. Delagoutte E. and Von Hippel P. H. (2002) Helicase mechanisms and the coupling of helicases within macromolecular machines. Part I: Structures and properties of isolated helicases. Q. Rev. Biophys. 35, 431–478.

12. Caruthers J. M. and Mckay D. B. (2002) Helicase structure and mechanism. Curr. Opin. Struct. Biol. 12, 123–133. 13. Jankowsky E. and Fairman M. E. (2007) RNA helicases – one fold for many functions. Curr. Opin. Struct. Biol. 17, 316–324. 14. Pyle A. M. (2008) Translocation and unwinding mechanisms of RNA and DNA helicases. Annu. Rev. Biophys. 37, 317–336. 15. Levin M. K., Gurjar M., and Patel S. S. (2005) A Brownian motor mechanism of translocation and strand separation by hepatitis C virus helicase. Nat. Struct. Mol. Biol. 12, 429–435. 16. Duderstadt K. E. and Berger J. M. (2008) AAA+ ATPases in the initiation of DNA replication. Crit. Rev. Biochem. Mol. Biol. 43, 163–187. 17. Lohman T. M., Tomko E. J., and Wu C. G. (2008) Non-hexameric DNA helicases and translocases: mechanisms and regulation. Nat. Rev. Mol. Cell Biol. 9, 391–401. 18. Von Hippel P. H. and Delagoutte E. (2003) Macromolecular complexes that unwind nucleic acids. Bioessays 25, 1168–1177. 19. Zhang S. and Grosse F. (1994) Nuclear DNA helicase II unwinds both DNA and RNA. Biochemistry 33, 3906–3912. 20. Pang P. S., Jankowsky E., Planet P. J., and Pyle A. M. (2002) The hepatitis C viral NS3 protein is a processive DNA helicase with cofactor enhanced RNA unwinding. EMBO J. 21, 1168–1176. 21. Boule J. B. and Zakian V. A. (2007) The yeast Pif1p DNA helicase preferentially unwinds RNA DNA substrates. Nucleic Acids Res. 35, 5809–5818. 22. Linder P., Lasko P. F., Ashburner M., Leroy P., Nielsen P. J., Nishi K., Schnier J., and Slonimski P. P. (1989) Birth of the D-E-A-D box. Nature 337, 121–122. 23. Linder P. (2006) Dead-box proteins: a family affair – active and passive players in RNP-remodeling. Nucleic Acids Res. 34, 4168–4180. 24. Abdelhaleem M., Maltais L., and Wain H. (2003) The human DDX and DHX gene families of putative RNA helicases. Genomics 81, 618–622. 25. Yang Q., Del Campo M., Lambowitz A. M., and Jankowsky E. (2007) DEAD-box proteins unwind duplexes by local strand separation. Mol. Cell 28, 253–263.

Helicases: An Overview 26. Yang Q. and Jankowsky E. (2006) The DEAD-box protein Ded1 unwinds RNA duplexes by a mode distinct from translocating helicases. Nat. Struct. Mol. Biol. 13, 981–986. 27. Jankowsky E., Gross C. H., Shuman S., and Pyle A. M. (2000) The DExH protein NPH-II is a processive and directional motor for unwinding RNA. Nature 403, 447–451. 28. Jankowsky E., Gross C. H., Shuman S., and Pyle A. M. (2001) Active disruption of an RNA-protein interaction by a DExH/D RNA helicase. Science 291, 121–125. 29. Yang Q. and Jankowsky E. (2005) ATP- and ADP-dependent modulation of RNA unwinding and strand annealing activities by the DEAD-box protein DED1. Biochemistry 44, 13591–13601. 30. Jankowsky E. and Bowers H. (2006) Remodeling of ribonucleoprotein complexes with DExH/D RNA helicases. Nucleic Acids Res. 34, 4181–4188. 31. Delagoutte E. and Von Hippel P. H. (2003) Helicase mechanisms and the coupling of helicases within macromolecular machines. Part II: Integration of helicases into cellular processes. Q Rev Biophys 36, 1–69. 32. Silverman E., Edwalds-Gilbert G., and Lin R. J. (2003) DExD/H-box proteins and their partners: helping RNA helicases unwind. Gene 312, 1–16. 33. Pomerantz R. T. and O‘donnell M. (2007) Replisome mechanics: insights into a twin DNA polymerase machine. Trends Microbiol. 15, 156–164. 34. Corn J. E. and Berger J. M. (2006) Regulation of bacterial priming and daughter strand synthesis through helicase-primase interactions. Nucleic Acids Res. 34, 4082–4088. 35. Nakai H. and Richardson C. C. (1988) Leading and lagging strand synthesis at the replication fork of bacteriophage T7. Distinct properties of T7 gene 4 protein as a helicase and primase. J. Biol. Chem. 263, 9818–9830. 36. Donmez I. and Patel S. S. (2006) Mechanisms of a ring shaped helicase. Nucleic Acids Res. 34, 4216–4224. 37. Maiorano D., Lutzmann M., and Mechali M. (2006) MCM proteins and DNA replication. Curr. Opin. Cell Biol. 18, 130–136. 38. Labib K., Tercero J. A., and Diffley J. F. (2000) Uninterrupted MCM2-7 function required for DNA replication fork progression. Science 288, 1643–1647.

9

39. Moyer S. E., Lewis P. W., and Botchan M. R. (2006) Isolation of the Cdc45/Mcm2-7/ GINS (CMG) complex, a candidate for the eukaryotic DNA replication fork helicase. Proc. Natl. Acad. Sci. USA 103, 10236–10241. 40. Pacek M., Tutter A. V., Kubota Y., Takisawa H., and Walter J. C. (2006) Localization of MCM2-7, Cdc45, and GINS to the site of DNA unwinding during eukaryotic DNA replication. Mol. Cell 21, 581–587. 41. Gambus A., Jones R. C., Sanchez-Diaz A., Kanemaki M., Van Deursen F., Edmondson R. D., and Labib K. (2006) GINS maintains association of Cdc45 with MCM in replisome progression complexes at eukaryotic DNA replication forks. Nat. Cell Biol. 8, 358–366. 42. Bochman M. L. and Schwacha A. (2008) The Mcm2-7 complex has in vitro helicase activity. Mol. Cell 31, 287–293. 43. Matson S. W. and Robertson A. B. (2006) The UvrD helicase and its modulation by the mismatch repair protein MutL. Nucleic Acids Res. 34, 4089–4097. 44. Jiricny J. (2006) The multifaceted mismatchrepair system. Nat. Rev. Mol. Cell Biol. 7, 335–346. 45. Truglio J. J., Croteau D. L., Van Houten B., and Kisker C. (2006) Prokaryotic nucleotide excision repair: the UvrABC system. Chem. Rev. 106, 233–252. 46. Lehmann A. R. (2001) The xeroderma pigmentosum group D (XPD) gene: one gene, two functions, three diseases. Genes Dev. 15, 15–23. 47. Fan L., Fuss J. O., Cheng Q. J., Arvai A. S., Hammel M., Roberts V. A., Cooper P. K., and Tainer J. A. (2008) XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. Cell 133, 789–800. 48. Liu H., Rudolf J., Johnson K. A., Mcmahon S. A., Oke M., Carter L., Mcrobbie A. M., Brown S. E., Naismith J. H., and White M. F. (2008) Structure of the DNA repair helicase XPD. Cell 133, 801–812. 49. Wolski S. C., Kuper J., Hanzelmann P., Truglio J. J., Croteau D. L., Van Houten B., and Kisker C. (2008) Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD. PLoS Biol. 6, e149. 50. Dillingham M. S. and Kowalczykowski S. C. (2008) RecBCD enzyme and the repair of double-stranded DNA breaks. Microbiol. Mol. Biol. Rev. 72, 642–671, Table of Contents.

10

Abdelhaleem

51. Wigley D. B. (2007) RecBCD: the supercar of DNA repair. Cell 131, 651–653. 52. Spies M., Amitani, I., Baskin R. J., and Kowalczykowski S. C. (2007) RecBCD enzyme switches lead motor subunits in response to chi recognition. Cell 131, 694–705. 53. Cobb J. A. and Bjergbaek L. (2006) RecQ helicases: lessons from model organisms. Nucleic Acids Res. 34, 4106–4114. 54. Hanada K. and Hickson I. D. (2007) Molecular genetics of RecQ helicase disorders. Cell Mol. Life Sci. 64, 2306–2322. 55. Ouyang K. J., Woo L. L., and Ellis N. A. (2008) Homologous recombination and maintenance of genome integrity: cancer and aging through the prism of human RecQ helicases. Mech. Ageing Dev. 129, 425–440. 56. Brosh R. M., Jr. and Bohr V. A. (2007) Human premature aging, DNA repair and RecQ helicases. Nucleic Acids Res. 35, 7527–7544. 57. Ciampi M. S. (2006) Rho-dependent terminators and transcription termination. Microbiology 152, 2515–2528. 58. Nakajima T., Uchida C., Anderson S. F., Lee C. G., Hurwitz J., Parvin J. D., and Montminy M. (1997) RNA helicase A mediates association of CBP with RNA polymerase II. Cell 90, 1107–1112. 59. Myohanen S. and Baylin S. B. (2001) Sequence-specific DNA binding activity of RNA helicase A to the p16INK4a promoter. J. Biol. Chem. 276, 1634–1642. 60. Zhong X. and Safa A. R. (2004) RNA helicase A in the MEF1 transcription factor complex up-regulates the MDR1 gene in multidrug-resistant cancer cells. J. Biol. Chem. 279, 17134–17141. 61. Fuller-Pace F. V. (2006) DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res. 34, 4206–4215. 62. Endoh H., Maruyama K., Masuhiro Y., Kobayashi Y., Goto M., Tai H., Yanagisawa J., Metzger D., Hashimoto S., and Kato S. (1999) Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol. Cell Biol. 19, 5363–5372. 63. Rossow K. L. and Janknecht R. (2003) Synergism between p68 RNA helicase and the transcriptional coactivators CBP and p300. Oncogene 22, 151–156.

64. Clark E. L., Fuller-Pace F. V., Elliott D. J., and Robson C. N. (2008) Coupling transcription to RNA processing via the p68 DEAD box RNA helicase androgen receptor co-activator in prostate cancer. Biochem. Soc. Trans. 36, 546–547. 65. Granneman S. and Baserga S. J. (2004) Ribosome biogenesis: of knobs and RNA processing. Exp. Cell Res. 296, 43–50. 66. Cordin O., Banroques J., Tanner N. K., and Linder P. (2006) The DEAD-box protein family of RNA helicases. Gene 367, 17–37. 67. De La Cruz J., Kressler D., and Linder P. (1999) Unwinding RNA in Saccharomyces cerevisiae: DEAD-box proteins and related families. Trends Biochem. Sci. 24, 192–198. 68. Granneman S., Bernstein K. A., Bleichert F., and Baserga S. J. (2006) Comprehensive mutational analysis of yeast DEXD/H box RNA helicases required for small ribosomal subunit synthesis. Mol. Cell Biol. 26, 1183–1194. 69. Bernstein K. A., Granneman S., Lee A. V., Manickam S., and Baserga S. J. (2006) Comprehensive mutational analysis of yeast DEXD/H box RNA helicases involved in large ribosomal subunit biogenesis. Mol. Cell Biol. 26, 1195–1208. 70. Staley J. P. and Guthrie C. (1998) Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92, 315–326. 71. Kim S. H. and Lin R. J. (1996) Spliceosome activation by PRP2 ATPase prior to the first transesterification reaction of pre-mRNA splicing. Mol. Cell Biol. 16, 6810–6819. 72. Schwer B. and Guthrie C. (1991) PRP16 is an RNA-dependent ATPase that interacts transiently with the spliceosome. Nature 349, 494–499. 73. Schwer B. (2008) A conformational rearrangement in the spliceosome sets the stage for Prp22-dependent mRNA release. Mol. Cell. 30, 743–754. 74. Martin A., Schneider S., and Schwer B. (2002) Prp43 is an essential RNA-dependent ATPase required for release of lariat-intron from the spliceosome. J. Biol. Chem. 277, 17743–17750. 75. Rogers G. W., Jr., Komar A. A., and Merrick W. C. (2002) eIF4A: the godfather of the DEAD box helicases. Prog. Nucleic Acid Res. Mol. Biol. 72, 307–331. 76. Chuang R. Y., Weaver P. L., Liu Z., and Chang T. H. (1997) Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science 275, 1468–1471.

Helicases: An Overview 77. De La Cruz J., Iost I., Kressler D., and Linder P. (1997) The p20 and Ded1 proteins have antagonistic roles in eIF4Edependent translation in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 94, 5201–5206. 78. Carrera P., Johnstone O., Nakamura A., Casanova J., Jackle H., and Lasko P. (2000) VASA mediates translation through interaction with a Drosophila yIF2 homolog. Mol. Cell 5, 181–187. 79. Liou G. G., Chang H. Y., Lin C. S., and Lin-Chao S. (2002) DEAD box RhlB RNA helicase physically associates with exoribonuclease PNPase to degrade double-stranded RNA independent of the degradosomeassembling region of RNase E. J. Biol. Chem. 277, 41157–41162. 80. Lacava J., Houseley J., Saveanu C., Petfalski E., Thompson E., Jacquier A., and Tollervey D. (2005) RNA degradation by the exosome is promoted by a nuclear polyadenylation complex. Cell 121, 713–724. 81. Anderson J. S. and Parker R. P. (1998) The 30 to 50 degradation of yeast mRNAs is a general mechanism for mRNA turnover that requires the SKI2 DEVH box protein and 30 to 50 exonucleases of the exosome complex. EMBO J. 17, 1497–1506. 82. Tran H., Schilling M., Wirbelauer C., Hess D., and Nagamine Y. (2004) Facilitation of mRNA deadenylation and decay by the exosome-bound, DExH protein RHAU. Mol. Cell 13, 101–111. 83. Peltz S. W., Brown A. H., and Jacobson A. (1993) mRNA destabilization triggered by premature translational termination depends on at least three cis-acting sequence elements and one trans-acting factor. Genes Dev. 7, 1737–1754. 84. Korhonen J. A., Gaspari M., and Falkenberg M. (2003) TWINKLE Has 50 ! 30 DNA helicase activity and is specifically stimulated by mitochondrial single-stranded DNAbinding protein. J. Biol. Chem. 278, 48627–48632. 85. Spelbrink J. N., Li F. Y., Tiranti V., Nikali K., Yuan Q. P., Tariq M., Wanrooij S., Garrido N., Comi G., Morandi L., Santoro L., Toscano A., Fabrizi G. M., Somer H., Croxen R., Beeson D., Poulton J., Suomalainen A., Jacobs H. T., Zeviani M., and Larsson C. (2001) Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria. Nat. Genet. 28, 223–231.

11

86. Tyynismaa H., Sembongi H., BokoriBrown M., Granycome C., Ashley N., Poulton J., Jalanko A., Spelbrink J. N., Holt I. J., and Suomalainen A. (2004) Twinkle helicase is essential for mtDNA maintenance and regulates mtDNA copy number. Hum. Mol. Genet. 13, 3219–3227. 87. Shutt T. E. and Gray M. W. (2006) Twinkle, the mitochondrial replicative DNA helicase, is widespread in the eukaryotic radiation and may also be the mitochondrial DNA primase in most eukaryotes. J. Mol. Evol. 62, 588–599. 88. Cheng X., Dunaway S., and Ivessa A. S. (2007) The role of Pif1p, a DNA helicase in Saccharomyces cerevisiae, in maintaining mitochondrial DNA. Mitochondrion 7, 211–222. 89. Pinter S. F., Aubert S. D., and Zakian V. A. (2008) The Schizosaccharomyces pombe Pfh1p DNA helicase is essential for the maintenance of nuclear and mitochondrial DNA. Mol. Cell Biol. 28, 6594–6608. 90. Foury F. and Kolodynski J. (1983) pif mutation blocks recombination between mitochondrial rho+ and rho– genomes having tandemly arrayed repeat units in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 80, 5345–5349. 91. Boule J. B. and Zakian V. A. (2006) Roles of Pif1-like helicases in the maintenance of genomic stability. Nucleic Acids Res. 34, 4147–4153. 92. Gagliardi D., Stepien P. P., Temperley R. J., Lightowlers R. N., and ChrzanowskaLightowlers Z. M. (2004) Messenger RNA stability in mitochondria: different means to an end. Trends Genet. 20, 260–267. 93. Mohr S., Stryker J. M., and Lambowitz A. M. (2002) A DEAD-box protein functions as an ATP-dependent RNA chaperone in group I intron splicing. Cell 109, 769–779. 94. Huang H. R., Rowe C. E., Mohr S., Jiang Y., Lambowitz A. M., and Perlman P. S. (2005) The splicing of yeast mitochondrial group I and group II introns requires a DEAD-box protein with RNA chaperone function. Proc. Natl. Acad. Sci. USA 102, 163–168. 95. Schmidt U., Lehmann K., and Stahl U. (2002) A novel mitochondrial DEAD box protein (Mrh4) required for maintenance of mtDNA in Saccharomyces cerevisiae. FEMS Yeast Res. 2, 267–276. 96. Missel A., Souza A. E., Norskau G., and Goringer H. U. (1997) Disruption of a gene encoding a novel mitochondrial

12

Abdelhaleem

DEAD-box protein in Trypanosoma brucei affects edited mRNAs. Mol. Cell Biol. 17, 4895–4903. 97. Margossian S. P., Li H., Zassenhaus H. P., and Butow R. A. (1996) The DExH box protein Suv3p is a component of a yeast mitochondrial 30 -to-50 exoribonuclease that suppresses group I intron toxicity. Cell 84, 199–209. 98. Pereira M., Mason P., Szczesny R. J., Maddukuri L., Dziwura S., Jedrzejczak R., Paul E., Wojcik A., Dybczynska L., Tudek B., Bartnik E., Klysik J., Bohr V. A., and Stepien P. P. (2007) Interaction of human SUV3 RNA/DNA helicase with BLM helicase; loss of the SUV3 gene results in mouse embryonic lethality. Mech. Ageing Dev. 128, 609–617. 99. Khidr L., Wu G., Davila A., Procaccio V., Wallace D., and Lee W. H. (2008) Role of

SUV3 helicase in maintaining mitochondrial homeostasis in human cells. J. Biol. Chem. 283, 27064–27073. 100. Valgardsdottir R., Brede G., Eide L. G., Frengen E., and Prydz H. (2001) Cloning and characterization of MDDX28, a putative dead-box helicase with mitochondrial and nuclear localization. J. Biol. Chem. 276, 32056–32063. 101. Wang Y. and Bogenhagen D. F. (2006) Human mitochondrial DNA nucleoids are linked to protein folding machinery and metabolic enzymes at the mitochondrial inner membrane. J. Biol. Chem. 281, 25791–25802. 102. Alli Z., Ackerley C., Chen Y., Al-Saud B., and Abdelhaleem M. (2006) Nuclear and mitochondrial localization of the putative RNA helicase DHX32. Exp. Mol. Pathol. 81, 245–248.

Chapter 2 Fluorescent Biosensors to Investigate Helicase Activity Martin R. Webb Abstract ATP-driven translocation of helicases along DNA can be assayed in several ways. Reagentless biosensors, based on fluorophore–protein adducts, provide convenient ways for real-time assays of both the separation of dsDNA and the hydrolysis of ATP. Single-stranded DNA can be assayed using a modified singlestranded DNA-binding protein (SSB), and phosphate production during ATP hydrolysis can be measured by a modified phosphate-binding protein. Advantages and limitations of these approaches are compared with those of other types of measurements. Key words: Helicase, assay, fluorescence, kinetics, ATPase, phosphate.

1. Introduction Different helicases translocate along DNA with a wide range of rates, typically 10–1000 bases per second and may move for short distances of a few bases (low processivity) or up to several thousand bases depending on the kinetics of translocation versus dissociation (1). These kinetics are presumably tuned to the biological role of the helicase. They generally use the energy of ATP hydrolysis to drive this movement and separation of duplex DNA. To study these processes in real time, methods are required that have sufficient sensitivity and time resolution to quantify strand separation and ATP hydrolysis typically on the time scale of milliseconds to seconds. Fluorescence probes often have high sensitivity and rapid response and various types of fluorescence instrumentation are available so that the signals can be measured rapidly and continuously. This chapter describes the use of fluorescent biosensors that have been developed for these types of applications and compares M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_2, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

13

14

Webb

them with other types of measurements that may give similar or complementary information. On the whole, the chapter is limited to bulk measurements in solution and methods that are based on fluorescence. 1.1. Translocation Assays

Potentially standard gel-based assays might be used to measure duplex separation catalyzed by helicases, but with difficulty to get the time resolution required for real-time measurements. In any case, by their discontinuous nature, such measurements are likely to give single time points after the reaction is quenched. Fluorescence probes have proved useful for continuous measurement of the conversion of double-stranded DNA (dsDNA) to singlestranded DNA (ssDNA), although they have the potential for disrupting the natural system being studied. Protein–DNA interactions may be modified by the presence of a dye moiety. Other molecules, added as probes, may bind to the helicase or DNA and so modify the translocation. For translocation along short lengths of DNA, several strategies have been used with fluorescent labels attached to oligonucleotides, to give a signal to monitor translocation with single-base resolution (2–7). If the end of the DNA is labeled, then no signal change is observed until the helicase approaches near to the fluorescent label. The signal change then occurs when the helicase reaches the end label. Even if the fluorescent label interferes with the translocation in some way, the time elapsed before the signal change provides a measure of the time taken to translocate the length of DNA. This is sometimes called an ‘‘all-or-none’’ measurement. Ideally this measurement should be done with different lengths of the DNA track. There should be a linear dependence of the time taken on the length and this allows the translocation speed to be determined. Use of several lengths enables at least partial elimination of end effects in the translocation, such as a lag before movement starts or a fluorescence change due to environmental effects when the helicase complexes are close to the fluorophore. Several laboratories have used fluorescence resonance energy transfer (FRET) (for example, (4)) or a fluorophore– quencher pair, such as Cy3 and Dabcyl groups (for example, (8)). These are at the same end of a length of dsDNA so that they can interact fully and have little or no fluorescence while the duplex is intact. Use of a quencher in the substrate DNA has the advantage of giving a fluorescence increase during the helicase assay, a property that is useful for measuring small extents of reaction and limiting interference by photobleaching. However, these types of approach are limited to < 100 base lengths for bulk measurements: desynchronization of helicases tends to produce smaller signals as the length increases. An advantage is that measurements of short lengths of translocation with end-labeling fluorophores can give single-base resolution in both bulk and

Fluorescent Biosensors to Investigate Helicase Activity

15

single-molecule assays. A precise and powerful analysis for these types of all-or-none assays has been described based on kinetic modeling (9). For translocation over long lengths of DNA (hundreds to thousands of bases), different approaches are required. Strand separation can be measured using probes that discriminate between ssDNA and dsDNA. A number of dyes bind tightly to dsDNA, but weakly, or not at all, to ssDNA and give a fluorescence change, usually an increase, on binding (10, 11). If such an interchelating dye is bound along dsDNA, the helicase will displace the dye molecules as it translocates: in bulk solution assays, there is a continuous, gradual increase in fluorescence that gives a measure of the extent of translocation. However, the presence of the dye may disrupt the helicase action or even, in extreme cases, prevent translocation. In addition, this assay has the disadvantage of producing a decrease in fluorescence, which means that the measurement may be made against a high background and possibly against a simultaneous decrease due to photobleaching. Triplex displacement assays show promise for translocation assays. Here, particular sections of duplex DNA sequence bind a third length of DNA. Helicases can potentially translocate through this triplex section and in doing so release the third DNA molecule. If a fluorescently labeled oligonucleotide is used for this, it can give a change in fluorescence on release, which provides an ‘‘all-or-none’’ measure of translocation time to that point (12, 13). As for end labeling of oligonucleotides, measurements of translocation times for different lengths is advantageous, although, in practice, such end effects are likely to be a much smaller fraction of the total translocation time when long lengths of dsDNA are used. An approach that measures the product ssDNA formation has advantages over ones that measure substrate depletion. Singlestranded DNA-binding protein (SSB) has been used to achieve this, either using the intrinsic tryptophan fluorescence (14) or by use of an extrinsic fluorescence label attached to SSB (15). SSB from Escherichia coli exists as a tetramer and binds a length of up to 70 nucleotides of ssDNA (16, 17). Under some circumstances there may be a different binding mode, whereby approximately half that length binds to the tetramer. This ‘‘35 base’’ binding mode is favored by low ionic strength and high ratio of SSB to DNA. An internal tryptophan has provided a continuous signal for assaying helicase unwinding of duplex DNA. As DNA binds to the SSB, there is a decrease in tryptophan fluorescence. Because of the relatively low-intensity decrease and the potential for other components of the assay solution to interfere with the fluorescence, this assay has relatively low sensitivity. To circumvent some of these problems, a single cysteine mutant of SSB was labeled with a coumarin fluorophore so that it gives a sixfold increase in fluorescence on binding ssDNA (15). The aim was to produce a probe

16

Webb

for helicase assays with high sensitivity and time resolution. Although binding is complex (18) with multiple modes as described above and potentially cooperative effects as multiple SSB tetramers bind along ssDNA, this biosensor gives an approximately linear response to the amount of ssDNA. The fluorescence response is also linear during measurement of dsDNA unwinding by a helicase. Examples of such assays have been published that demonstrate the high sensitivity of the coumarin-labeled SSB (DCC-SSB) (15). This chapter describes the use of this biosensor to measure helicase-driven separation of dsDNA. 1.2. ATPase Activity Assays

There are several different ways to measure the ATPase activity of a helicase, generally by monitoring one of the products, ADP and inorganic phosphate (Pi). Relative advantages of the various assays depend in part on whether a steady-state measurement is required, which is likely to be over a longer time course, or whether ATP hydrolysis is measured in real time to correlate directly with translocation. Use of radiolabeling provides a relatively simple assay, which requires no additional components to be present. However, such measurements are discontinuous and each assay point requires separation of ATP hydrolysis products. There are a number of coupled-enzyme assays that measure product ADP (for example, (19, 20)) or inorganic phosphate, Pi (for example, (21–23)). Some can provide a fluorescence signal or often are based on an absorbance change. The latter sacrifices sensitivity, but has the advantage in that the signal response is linear and readily quantified, based on an extinction coefficient (e.g., of NADH). Fluorescence assays usually have to be calibrated for each different set of conditions. However, coupled-enzyme assays inevitably required addition of multiple components and there needs to be care to ensure that these additions do not affect the assay and that the observed rate is that of the helicase, not of the coupled enzyme. A typical pitfall is to assume that the coupled enzymes are operating at maximal velocity, although pH and buffer conditions are, in practice, producing a suboptimal rate. While these types of assays may be very useful for steady-state measurements, they may not be fast enough for the high activity of helicases during single-turnover measurements with respect to DNA. For the latter, fluorescence-based reagentless biosensors may have advantages, including the need for only one added component (the biosensor molecule). There is, therefore, only one coupled rate that needs to be checked and compared with that of the helicase. There have been several such biosensors described for ADP (for example, (24, 25)) and Pi (for example, (26, 27)), although some are aimed particularly at high-throughput assays and may not have a high rate of response. This chapter describes the use of the biosensors based on the phosphate-binding protein. This type has been widely used in assays of ATPase activity and mechanism of helicase (28) and


17

other motor proteins such as myosins (29) and kinesins (30). The method is particularly suited to stopped-flow measurements, for example, to measure single-turnover kinetics, the details of the ATPase cycle, or the precise relationship between translocation and the number of ATP molecules hydrolyzed. To produce the original phosphate biosensor, a single cysteine mutant of the bacterial phosphate-binding protein was labeled covalently with a single coumarin to give a signal increase (approximately an order of magnitude) on Pi binding. More recently a version of this with two rhodamines was developed with greater sensitivity and photostability (27). The bases for these fluorescence changes, the kinetic mechanism of binding Pi to this protein, have been described (31, 32). The binding is tight (50 nM) so that for most conditions, the biosensor must be in excess over the maximum amount of Pi likely to be encountered in the assay or at least during the time period of the measurement. Because of this and the ubiquity of Pi contamination, it is important to assess and minimize any such contamination. This contamination has been discussed and an enzymic method of reducing it has been described (33, 34). The ‘‘phosphate mop’’ consists of purine nucleoside phosphorylase and 7-methylguanosine, which converts Pi to ribose-1-phosphate and so to a chemical species that is silent with respect to the phosphate biosensor. 1.3. Described Methods

The methods described include examples of applications of these biosensors to measure the enzymic activity of helicases, either in the steady state or as rapid reaction measurements using stoppedflow. Some general points about experimental design are given below. 1.Check the labeled protein. The quality of the fluorescent protein can be simply checked with a titration of the ligand, measuring fluorescence. Examples are given in Section 3. The response should be linear and give fluorescence increases similar to those published. In the case of the Pi sensors, this can also assess the Pi contamination in the preparation and buffers. Addition of Pi mop components rather than Pi will give a small decrease in fluorescence, whose size depends on the degree of contamination. The breakpoint of the titration reflects the concentration of active biosensor. 2.Optical considerations. These are mainly outside the scope of this chapter, but it should be realized that optics plays a large part in determining the quality of the signal obtained. Thus the coumarin-based sensors described here are particularly well suited to excitation via a strong Hg line at 436 nm. There is an Hg line at 546 nm that can be used for rhodamine excitation. Where there is a choice between a xenon lamp and a xenon–mercury lamp, for example, with a stopped-flow instrument, much higher excitation intensity can be obtained with the latter.

18

Webb

The possibility of inner filter effects must also be considered: is the absorbance of the fluorophore significant (say, > 0.1 for the pathlength being used)? Changing the excitation wavelength may be possible. For the coumarin-based sensors the extinction coefficient does not change between apo and bound forms, so to some extent inner filter effects will cause the fluorescence change to decrease, but remain linear. The calibration can be altered accordingly. Note that the rhodamine extinction coefficient does change, so the interpretation may be complex, but in this case, there may be significant scope to change the wavelength. 3.Rate of response. Depending on the type of measurement, the rate of response may also be a significant consideration: this typically depends on the concentration of the binding protein (the biosensor), since the concentration of free ssDNA or Pi is likely to be very low during the assay. The aim is to ligate the product rapidly with the biosensor. The publications describing these sensors have binding measurements for some conditions that are a good guide. Nevertheless significant differences in conditions can lead to large changes in rate constants.

2. Materials 2.1. Assay Components

1. Fluorescent reagents are available as follows: MDCC (N-[2(1-maleimidyl)ethyl]-7-diethylaminocoumarin-3-carboxamide) and IDCC (N-[2-(iodoacetamido)ethyl]-7-diethylaminocoumarin-3-carboxamide) (Invitrogen, USA, or Synchem, Germany); 6-IATR (6-iodoacetamidotetramethylrhodamine) (Chemos, Germany). 2. SSB (G26C): prepared as previously described (15). 3. MDCC-PBP: prepared as previously described (26, 31, 34) (Invitrogen). Rhodamine-PBP was prepared as described and stored as a concentrated solution (1 mM) in small aliquots at –80C (27). 4. Components for the phosphate mop (lyophilized, ‘‘bacterial’’ purine nucleoside phosphorylase and 7-methylguanosine) (Sigma-Aldrich). The additional ‘‘supermop’’ components were glucose-1,6-bisphosphate and manganese chloride (Sigma-Aldrich) and phosphodeoxyribomutase from E. coli, prepared as previously described (33) (see Note 1).

2.2. Other Proteins and Plasmids

1. Wild-type phosphate-binding protein from E. coli was prepared as described (26). This is the phosphate complex. Phosphate was partially removed by treatment with the ‘‘supermop’’ components. A solution (500 ml) in 10 mM PIPES, pH 7.0, of 100 mM protein, 200 mM


19

7-methylguanosine, 0.2 unit ml–1 purine nucleoside phosphorylase, 5 mM MnCl2, 1 mM glucose-1,6-bisphosphate, and 1.5 mg ml–1 phosphodeoxyribomutase was incubated at 20C for 15 min. It was desalted on a PD10 column (GE Heathcare) and pre-equilibrated in the same buffer. This resulted in a solution of 0.5 ml of 80 mM phosphate-binding protein from the peak fraction (see Note 2). 2. RepD from Staphylococcus aureus and PcrA from Bacillus stearothermophilus were prepared as described (35, 36). For steady-state assays, as described, use a fresh 5-nM stock containing 5 mM BSA as carrier. 3. Plasmid pCERoriD, containing the oriD sequence, was prepared as described (37). 2.3. Other Biochemicals

1. 100 mM sodium 2-mercaptoethane-sulfate (MESNA): prepare fresh. 2. 1 M dithiothreitol (DTT). 3. Phosphate (Pi) standard solution (VWR, Aristar, 1000 ppm as ‘‘P,’’ which refers to PO43–). 4. ATP (Sigma) (SigmaUltra grade), which has low Pi contamination (see Note 3). 5. dT20 and dT70 (Eurogentec) and HPLC-purified grade.

2.4. Buffers and Solutions

1. Buffer for DCC-SSB labeling: 20 mM Tris–HCl, pH 7.5, 1.0 mM EDTA, 500 mM NaCl, 20% (v/v) glycerol. 2. Buffer for DCC-SSB purification: 20 mM Tris–HCl, pH 8.3, 1.0 mM EDTA, 500 mM NaCl, 20% (v/v) glycerol. 3. Buffers for testing pH and ionic strength variations in DCCSSB signal: 25 mM Tris–HCl, pH 8.0, or 25 mM PIPES, pH 7.0, each containing 20 or 200 mM NaCl. 4. Buffer for helicase activity assay: 50 mM Tris–HCl, pH 7.5, 200 mM KCl, 10 mM MgCl2, 1 mM EDTA, and 10% ethanediol. 5. Buffer for rhodamine-PBP characterization: 10 mM PIPES, pH 7.0. 6. Buffer for steady-state ATPase assay: 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 3 mM MgCl2.

3. Methods 3.1. Label SSB (G26C) with IDCC

1. Add 5 mmol DTT to 10 mg SSB (530 nmol) and incubate for 20 min at room temperature to ensure all cysteines are fully reduced.

20

Webb

2. Degas the labeling buffer just before use, by bubbling nitrogen through for 5 min. 3. Equilibrate a PD10 column (GE Healthcare) in the degassed buffer: pass 25 ml through. 4. Pass the DTT-treated SSB through the PD10 column, eluting with degassed buffer. Collect 15 0.5 ml fractions and measure their absorbance at 280 nm (dilute a portion 20 and use the buffer as blank). Collect protein fraction(s). 5. In a sealable tube, make the protein 100 mM by diluting, if necessary, with labeling buffer and add 200 mM IDCC. 6. Play nitrogen over the solution just before sealing the tube. 7. Incubate 2 h at 22C with end-over-end stirring, protected from light. 8. Add 1 mM MESNA and leave for 30 min with end-over-end stirring, protected from light, to react with remaining coumarin. 9. Pass the solution through a membrane filter (0.2 mm pores, polyethersulfone from Whatman). 10. Pre-equilibrate a P4 gel filtration column (BioRad; 1 20 cm) in the DCC-SSB purification buffer. 11. Pass the labeled protein through this column, collecting 0.5 ml fractions and pooling the first colored peak. 12. Concentrate the protein to 50–100 mM monomers using a Centricon YM10 membrane concentrator. 13. Measure the absorbance spectrum and calculate the protein concentration at 430 nm, where the extinction coefficient of the coumarin is 44,800 M–1 cm–1. 14. Store the protein at –80C after quick freezing.

3.2. Check the Labeled Protein – Calibration of DCC-SSB

1. This section describes calibrating DCC-SSB at different pH and ionic strength conditions (see Note 4). 2. Place 100 ml of 200 nM DCC-SSB tetramers in the appropriate buffer in a 3 3 mm fluorescence cuvette. 3. Measure fluorescence at 20C in a Cary Eclipse fluorimeter with excitation at 430 nm and emission at 470 nm (see Note 5). 4. Titrate in aliquots of dT70 over the range to 50 nM, as shown in Fig. 2.1. Correct the data for any dilution. 5. Finally, add a twofold molar excess of the oligonucleotide to obtain an end point; in the examples shown, this gives the 100% level for the signal (see Note 6).


21

Fig. 2.1. Calibration of DCC-SSB with DNA at different pH and ionic strength conditions. These data are a single set of measurements. Measurements were done at 25 mM Tris, pH 8.0, 200 mM NaCl (circles); 25 mM Tris–HCl, 20 mM NaCl (diamonds); 25 mM PIPES, pH 7.0, 200 mM NaCl (triangles); 25 mM PIPES, pH 7.0, 20 mM NaCl (squares). All solutions were at 20C and contained 250 nM DCC-SSB (tetramer concentration) and 5 mM BSA as carrier. Fluorimeter settings are as described in the text. One hundred percent fluorescence represents the signal with excess DNA as described in the text.

3.3. Check the Labeled Protein – Titration of Rhodamine-PBP with Phosphate

1. Place a solution (200 ml in 10 mM PIPES, pH 7.0) of 2.5 mM rhodamine-PBP in a 3 3 mm fluorescence cuvette. 2. Measure fluorescence at 20C in a Cary Eclipse fluorimeter with excitation at 555 nm and emission at 578 nm (see Note 5). 3. Add aliquots of Pi standard, suitably diluted, to produce a titration curve as in Fig. 2.2. Correct the data for any dilution (see Note 7). 4. The intercept of the linear fits to the fluorescence rise and to the horizontal portion gives a measure of the active, Pi-free protein.

Fig. 2.2. Titration of rhodamine-PBP with inorganic phosphate. The upper plot (circles) is for rhodamine-PBP alone. The lines are linear fits to the rise and horizontal portions. The lower plot (triangles) is offset by –10% for clarity and is for equimolar mixture of wildtype PBP and rhodamine-PBP. The wild-type protein was treated with phosphate mop as described in the text to remove bound Pi partially. The curvature shows that wild-type protein binds Pi more tightly than the labeled protein. The line is a best fit to a model, in which there is tight binding, as previously described (15): the ratio of dissociation constants is 4 based on this, with the wild type binding Pi tighter.

22

Webb

5. To demonstrate the effect of unlabeled phosphate-binding protein, repeat the titration in the presence of 2.5 mM wildtype protein, after partial removal of bound Pi by treatment with the phosphate ‘‘supermop’’ (see Note 8). 3.4. Real-Time Helicase Activity Assay Using Coumarin-Labeled SSB (DCC-SSB)

1. Prepare 1 ml of a solution in the helicase assay buffer: 2 nM pCERoriD circular plasmid, pre-incubated for 10 min with 4 nM RepD, 400 nM tetramer DCC-SSB, 50 nM PcrA (Note 9). 2. Prepare 1 ml of a 2-mM ATP solution in the helicase assay buffer. 3. After equilibration at 37C, mix these two solutions rapidly, using a stopped-flow apparatus (Hi-Tech, TgK Scientific, UK), equipped with xenon–mercury lamp. Follow the fluorescence with time, exciting at 436 nm and using a 455-nm cut-off filter on the emission. A sample trace is shown in Fig. 2.3 (see Note 10). 4. An identical solution, but in the absence of RepD, can be used as a zero activity control. PcrA has negligible helicase activity under these conditions. This provides a check on the stability of the fluorescent sensor for the experimental (solution and optical) conditions (see Note 11).

Fig. 2.3. Real-time helicase assay using fluorescent SSB. The assay is for unwinding a 3094-bp pCERoriD plasmid by PcrA/RepD at 37C in the presence of DCC-SSB, with details described in the text. The fluorescence of the DCCSSB was followed with time. The lower line is a control in the absence of RepD, for which there should be little or no strand separation.

3.5. Steady-State ATPase Activity Assay Using Rhodamine-PBP

1. Prepare 1 ml of assay solution in the ATPase assay buffer: 0.5 mM dT20, 20 mM ATP, 5 mM rhodamine-PBP (see Note 12). 2. Prepare a 5-nM solution PcrA in ATPase activity buffer, containing 5 mM BSA as carrier. 3. Place 200 ml assay solution in a 3 3 mm fluorescence cuvette and equilibrate to 20C in a fluorimeter (Cary Eclipse – see Note 5).


23

4. Follow fluorescence with time, exciting at 555 nm and measuring emission at 578 nm. 5. When the fluorescence is constant, add PcrA to give a concentration of 50 pM. Following a period (200 s) of constant increase in fluorescence, add a second aliquot of PcrA to give a total of 100 pM to check that the rate doubles. A sample trace is shown in Fig. 2.4. 6. Repeat the fluorescence measurement, but obtain a control in the absence of PcrA (see Note 11). 7. Do linear fits of each section of the time course and the control, to obtain the rate of the reaction at each enzyme concentration. 8. Calibrate the fluorescence signal, using a further 200 ml aliquot of the assay solution, but add 2 0.5 mM aliquots of Pi standard, measuring the fluorescence change on each addition. This should be repeated with a fresh aliquot of assay solution. Average the four fluorescence values to convert the (arbitrary) fluorescence scale to nanomolar phosphate.

Fig. 2.4. Steady-state ATPase assay of PcrA with dT20, measured using the rhodaminePBP phosphate sensor. The incubation solution at 20C contained the following: 450 mM Tris–HCl, pH 7.5, 150 mM NaCl, 3 mM MgCl2, 20 mM ATP, 0.5 mM dT20, and 5 mM rhodamine-PBP. The reaction was initiated at zero time by addition of 50 pM PcrA from a 5-nM stock containing 5 mM BSA as carrier. A similar addition at 260 s illustrates the doubling of rate. A control with no PcrA is shown to check the stability of the fluorescence signal.

4. Notes

1. Store the 7-methylguanosine as a 20 mM solution in water at –20C. Store the phosphorylase as 1000 unit ml–1 in the lyophilized buffer in small aliquots at –80C: repeated freezing and thawing deactivates this enzyme. It is important that the protein solutions are snap frozen. Some other types of this

24

Webb

phosphorylase are available commercially but may not be suitable: either they do not accept 7-methylguanosine as a substrate with high activity or they come with phosphate buffer. 2. Because wild-type phosphate-binding protein binds Pi much tighter than the labeled protein, removal of Pi needs the extra components of glucose-1,6-bisphosphate, MnCl2, and phosphodeoxyribomutase. Normal mopping of protein solutions, if required at all, requires a similar treatment but only with 7-methylguanosine and purine nucleoside phosphorylase. Labeled phosphate-binding protein should have < 10% Pi as prepared. 3. To prevent hydrolysis during storage, keep the solid nucleotide desiccated (over Drierite) in a sealed container at –20C. To avoid condensation, warm to room temperature before opening. Concentrated stock solutions can be stored at –80C with minimal decomposition if the pH is adjusted to 4–7. Avoid many repeats of thawing and freezing. 4. As in almost all cases with fluorescence measurements, the signal must be calibrated at the conditions and concentrations being used. To obtain a relatively linear response, generally for these types of biosensors, there needs to be a compromise with signal sensitivity. Usually the response is closest to linear at low extents of saturation. In the case of SSB, the mode of binding, as discussed above, as well as general factors, such as temperature and ionic strength, affects the fluorescence response. For measuring ssDNA, therefore, we proposed a rule of thumb that the ratio of SSB subunit to nucleotides of ssDNA is 5, based on the maximum ssDNA to be measured (15). This keeps the response fairly linear for a variety of conditions. This method illustrates the variation in fluorescence as pH and ionic strength vary. However, for each condition the response is approximately linear. It is important to test the quality of the labeled protein, using the ‘‘standard’’ buffer, but do a calibration with the conditions that are being used in the helicase assay. 5. The fluorimeter is a standard instrument, equipped with xenon lamp, and any equivalent one would be appropriate. Because any fluorescence intensity can vary with temperature, it is important to have temperature control. In addition, fluorescence measurements may be instrument dependent so that calibrations should be done, if possible, on the same instrument as the actual assay. 6. In the example shown, the 100% signal was, in absolute terms, very similar for the four conditions (within 10%). The main variation is in the starting fluorescence (free DCC-SSB) and whether there is significant ‘‘35-base’’ binding mode at low ionic strength, as described in the text above.


25

7. The rhodamine-PBP has a linear response until almost saturated (7). However, part of the capacity of the PBP may be taken (‘‘used up’’) by contaminating Pi. This must be dealt with in subsequent assays, either by minimizing contamination or by having extra PBP present or by having ‘‘Pi mop’’ present at low enough activity not to affect the measurement. In general, the measurement should be tried first in the absence of mop. Ways of dealing with phosphate contamination have been discussed (34). 8. For each sensor, the labeling does cause a decrease in affinity for the ligand and so at low concentrations of ligand, any unlabeled protein will preferentially bind the ligand. So the fluorescence change is smaller at this stage of the titration. This is illustrated in Fig. 2.2, where a mixture of labeled and unlabeled proteins is used. The same effect will be observed in the titration of labeled protein alone: lack of linearity of the fluorescence rise may reflect incomplete labeling. Mass spectrometry of the protein would act as a check on this. 9. The procedure described for a single turnover of dsDNA strand separation can readily be adapted for other helicases, either using a similar concentration of DNA in terms of bases or by modifying the concentration of DCC-SSB sensor appropriately. The buffer appropriate for the helicase can be used, but with appropriate calibration of the fluorescence signal, as described. Slower helicases or multi-turnover assays can be done in a cuvette using a standard fluorimeter. 10. Several suppliers produce stopped-flow equipment suitable for these types of assay. The technical aspects of stoppedflow fluorimetry have been described in several reviews (for example, (38)), as has the additional information that can be obtained from single-turnover measurements as opposed to steady-state ones (39). 11. The control fluorescence measurements in the absence of enzyme activity are important to test the signal stability under the same experimental conditions and the same timescale as the assay itself. The fluorescence signal may change due to protein stability, solution cloudiness (light scatter), or photobleaching, for example. Note that photobleaching of the Pi-free rhodamine-PBP results in an increase in fluorescence: as one of the stacked (and hence quenched) rhodamine pair photobleaches, the other then exhibits full monomer fluorescence (27). 12. This illustrates a sensitive assay for ATPase activity that can be adapted to other enzymes with appropriate solution and temperature conditions. In any case, it is important to use ATP solutions that are low in phosphate contamination.

26

Webb

Acknowledgments This work was supported by the Medical Research Council, UK. I would like to thank all those who collaborated on developing and implementing these biosensors at NIMR or elsewhere and are coauthors in the referenced papers. References 1. Singleton M.R., Dillingham M.S., and Wigley D.B.(2007) Structure and mechanism of helicases and nucleic acid translocases.Annu. Rev. Biochem. 76, 23–50. 2. Dillingham M. S., Wigley D. B., Webb M. R. (2002) Direct measurement of single stranded DNA translocation by PcrA helicase using the fluorescent base analogue 2aminopurine.Biochemistry 41, 643–651. 3. Ha T., Rasnik I., Cheng W., Babcock H. P., Gauss G. H., Lohman T. M., et al. (2002) Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase.Nature 419, 638–641. 4. Bjornson K. P., Amaratunga M., Moore K. J., Lohman T. M. (1994) Single-turnover kinetics of helicase-catalyzed DNA unwinding monitored continuously by fluorescence energy transfer. Biochemistry 33, 14306–14316. 5. Myong S., Bruno M. M., Pyle A. M.,and Ha T. (2007) Spring-loaded mechanism of DNA unwinding by hepatitis C virus NS3 helicase. Science 31, 7513–516. 6. Martinez-Senac M. M. and Webb M. R. (2005) Mechanism of translocation and kinetics of DNA unwinding by the helicase RecG. Biochemistry 44, 16967–16976. 7. Lucius A. L., Wong C. J., and Lohman T. M. (2004) Fluorescence stopped-flow studies of single turnover kinetics of E. coli RecBCD helicase-catalyzed DNA unwinding.J. Mol. Biol. 339, 731–750. 8. Boguszewska-Chachulska A. M., Krawczyk M., Stankiewicz A., Gozdek A., Haenni A., and Strokovskaya L. (2004) Direct fluorometric measurement of hepatitis C virus helicase activity.FEBS Lett. 56, 7253–258. 9. Lucius A. L., Maluf N. K., Fischer C. J., and Lohman T. M. (2003) General methods for analysis of sequential ‘‘n-step’’ kinetic mechanisms: application to single turnover kinetics of helicase-catalyzed DNA unwinding. Biophys. J. 85, 2224–2239. 10. Eggleston A. K., Rahim N. A., and Kowalczykowski S. C. (1996) A helicase assay based

11.

12.

13.

14.

15.

16.

17.

18.

on the displacement of fluorescent, nucleic acid-binding ligands.Nucleic Acids Res. 24, 1179–1186. Rye H. S., Quesada M. A., Peck K., Mathies R. A., and Giazer A. N. (1991) High-sensitivity two-color detection of double-stranded DNA with a confocal fluorescence gel scanner using ethidium homodimer and thiazole orange. Nucleic Acids Res. 19, 327–333. McClelland S. E., Dryden D. T. F., and Szczelkun M. D. (2005) Continuous assays forDNA translocationusingfluorescenttriplex dissociation: application to Type I restriction endonucleases. J. Mol. Biol. 348, 895–915. Firman K. and Szczelkun M. D. (2000) Measuring motion on DNA by the type I restriction endonuclease EcoR124I using triplex displacement. EMBO J. 19, 2094–2102. Roman L. J. and Kowalczykowski S. C. (1989) Characterization of the helicase activity of the Escherichia coli RecBCD enzyme using a novel helicase assay. Biochemistry 28, 2863–2873. Dillingham M. S., Tibbles K. L., Hunter J. L., Bell J. C., Kowalczykowski S. C., and Webb M. R. (2008) A fluorescent singlestranded DNA binding protein as a probe for sensitive, real time assays of helicase activity. Biophys. J. 95, 3330–3339. Lohman T. M. and Ferrari M. E. (1994) Escherichia Coli single-stranded DNA-binding protein: multiple DNA-binding modes and cooperativities. Annu. Rev. Biochem. 63, 527–570. Raghunathan S., Kozlov A. G., Lohman T. M., and Waksman G. (2000) Structure of the DNA binding domain of E. coli SSB bound to ssDNA.Nat. Struct. Biol. 7, 648–652. Kuznetsov S. V., Kozlov A. G., Lohman T. M., and Ansari A. (2006) Microsecond dynamics of protein-DNA interactions: direct observation of the wrapping/unwrapping kinetics of single-stranded DNA around the E. coli SSB tetramer. J. Mol. Biol. 359, 55–65.

Fluorescent Biosensors to Investigate Helicase Activity 19. Charter N. W., Kauffman L., Singh R., and Eglen R. M. (2006) A generic, homogenous method for measuring kinase and inhibitor activity via adenosine 5’-diphosphate accumulation. J. Biomol. Screen 11, 390–399. 20. Lowry O. H. and Passonneau J. V. (1972) A flexible system of enzymatic analysis. New York Academic Press. 21. Webb M. R. (1992) A continuous spectrophotometric assay for inorganic phosphate and for measuring phosphate release kinetics in biological systems. Proc. Natl. Acad. Sci. USA 89, 4884–4887. 22. Banik U. and Roy S. (1990) A continuous fluorimetric assay for ATPase activity. Biochem. J. 266, 611–614. 23. De Groot H. and Noll T. (1985) Enzymic determination of inorganic phosphates, organic phosphates and phosphate-liberating enzymes by use of nucleoside phosphorylase-xanthine oxidase (dehydrogenase)coupled reactions. Biochem. J. 229, 255–260. 24. Srinivasan J., Cload S. T., Hamaguchi N., Kurz J., Keene S., Kurz M., et al. (2004) ADP-specific sensors enable universal assay of protein kinase activity. Chem. Biol. 11, 499–508. 25. Brune M., Corrie J. E. T., and Webb M. R. (2001) A fluorescent sensor of the phosphorylation state of nucleoside diphosphate kinase and its use to monitor nucleoside diphosphate concentrations in real time. Biochemistry 40, 5087–5094. 26. Brune M., Hunter J. L., Corrie J. E. T., Webb M. R. (1994) Direct, real-time measurement of rapid inorganic phosphate release using a novel fluorescent probe and its application to actomyosin subfragment 1 ATPase. Biochemistry 33, 8262–8271. 27. Okoh M. P., Hunter J. L., Corrie J. E. T., and Webb M. R. (2006) A biosensor for inorganic phosphate using a rhodaminelabeled phosphate binding protein. Biochemistry 45, 14764–14771. 28. Dillingham M. S., Wigley D. B., and Webb M. R. (2000) Demonstration of unidirectional single-stranded DNA translocation by PcrA helicase: measurement of step size and translocation speed. Biochemistry 39, 205–212. 29. White H. D., Belknap B., and Webb M. R. (1997) Kinetics of nucleoside triphosphate cleavage and phosphate release steps by associated rabbit skeletal actomyosin, measured using a novel fluorescent probe for phosphate. Biochemistry 36, 11828–11836.

27

30. Gilbert S. P., Webb M. R., Brune M., and Johnson K. A. (1995) Pathway of processive ATP hydrolysis by kinesin. Nature 373, 671–676. 31. Brune M., Hunter J. L., Howell S. A., Martin S. R., Hazlett T. L., Corrie J. E. T., et al. (1998) Mechanism of inorganic phosphate interaction with phosphate binding protein from Escherichia coli. Biochemistry 37, 10370–10380. 32. Hirshberg M., Henrick K., Haire L. L., Vasisht N., Brune M., Corrie J. E. T., et al. (1998) The crystal structure of phosphate binding protein labeled with a coumarin fluorophore, a probe for inorganic phosphate. Biochemistry 37, 10381–10385. 33. Nixon A. E., Hunter J. L., Bonifacio G., Eccleston J. F., and Webb M. R. (1998) Purine nucleoside phosphorylase: its use in a spectroscopic assay for inorganic phosphate and to remove inorganic phosphate with the aid of phosphodeoxyribomutase. Anal. Biochem. 265, 299–307. 34. Webb M. R. (2003) A fluorescent sensor to assay inorganic phosphate. In: Johnson K.A., ed. Kinetic analysis of macromolecules: a practical approach. Oxford, UK: Oxford University Press, 131–152. 35. Thomas C. D., Balson D. F., and Shaw W. V. (1990) In vitro studies of the initiation of Staphylococcal plasmid replication. Specificity of RepD for its origin (oriD) and characterization of the RepD-ori tyrosyl ester intermediate. J. Biol. Chem. 265, 5519–5530. 36. Bird L. E., Brannigan J. A., Subramanya H. S., and Wigley D. B. (1998) Characterisation of Bacillus stearothermophilus PcrA helicase: evidence against an active rolling mechanism. Nucleic Acids Res. 26, 2686–2693. 37. Soultanas P., Dillingham M. S., Papadopoulos F., Phillips S. E., Thomas C. D., and Wigley D. B. (1999) Plasmid replication initiator protein RepD increases the processivity of PcrA DNA helicase. Nucleic Acids Res. 27, 1421–1428. 38. Eccleston J. F., Hutchinson J. P., and White H. D. (2001) Stopped-flow techniques In: Harding S. E. and Chowdry B.Z., eds.Protein ligand interactions: structure and spectroscopy. A practical approach series. Oxford, UK: Oxford University Press, 201–237. 39. Johnson K. A. (2003) Introduction to kinetic analysis of enzyme systems. In: Johnson K.A., ed. Kinetic analysis of macromolecules: a practical approach. Oxford: Oxford University Press, 1–18.

Chapter 3 Single-Molecule FRET Analysis of Helicase Functions Eli Rothenberg and Taekjip Ha Abstract In recent years, advancements in single-biomolecule probing techniques have provided critical information on and greater insight into the nature of biomolecules. Of significance is the application of single-molecule fluorescence resonance energy transfer (smFRET) to probe isolated events and changes at the nanometer scales. In particular, the study of helicases using smFRET has supplied much information regarding the nature and dynamics of these enzymes and provided a toolbox for further investigations. In this chapter we provide a general guide for the construction and execution of single-molecule FRET assays for the study of helicase properties and functionalities. Key words: Helicase, DNA, single molecule, FRET, binding, translocation, unwinding.

1. Introduction Single-molecule techniques enable us to uncover specific features otherwise masked by the averaging of the ensemble measurements. Of particular advantage is the single-molecule technique based on FRET (1), which utilizes the energy-transfer interaction between a pair of reporter molecules (FRET pair), donor and acceptor, thus allowing us to probe distance changes on a range of a few nanometers. This approach has proven to be extremely beneficial in probing different functional aspects of various helicases (2–6). Our studies of DNA helicases’ functions have revealed many important characteristics, providing a toolbox for assaying such enzymes. Investigating DNA-binding properties of helicases revealed the binding orientation and mechanism of bacterial Rep helicase (3) and archaeal MCM helicase substrate specificity (5). Studies on the translocation kinetics of single M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_3, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

29

30

Rothenberg and Ha

Rep (4), PcrA, and UvrD (Jeehae Park, ‘‘Reeling in DNA One Base at a Time: Repetitive DNA Looping Coupled with PcrA Helicase Translocation,’’ unpublished work) helicases led to the discovery of unique repetitive shuttling behaviors, revealing specific features of these helicases’ translocation mechanisms. Investigations on the unwinding of dsDNA by the bacterial Rep helicase showed unwinding re-initiation (2), while viral NS3 (6) and human Bloom helicases (Jaya and Yodh, ‘‘Single-Molecule Study of Bloom Syndrome Helicase Reveals Repetitive Unwinding via Strand-Switching,’’ unpublished work) revealed a repetitive unwinding behavior that disclosed the unwinding mechanisms of these helicases. Further studies of unwinding dynamics of the T7 phage helicase revealed a cooperative unwinding processivity (Manjula Pandey, ‘‘Kinetic Coupling of DNA Primase-Helicase and DNA Polymerase Coordinates DNA Replication,’’ unpublished work). The general guidelines for approaching and designing such assays are provided herein. The design of a suitable smFRET experiment for helicase functionality depends on a number of factors. Initially, the functional aspects that are intended to be probed in the assay need to be defined. These could be divided into three general categories: 1. Binding of the helicase to the DNA substrate. 2. Translocation of the helicase along ssDNA. 3. Unwinding of dsDNA. The above functionalities are closely intertwined and the outcome of one assay would most likely contribute to the interpretation of another. Section 3 will provide different assays for probing these functionalities. When approaching an assay, one should first classify what type of reaction occurs, and construct the experimental probing scheme accordingly. For instance, monitoring single-turnover short-lived reactions, such as a complete unwinding reaction of dsDNA, would require flow-type experiments. In this type of experiment the initiation and progression of the reaction are continuously monitored. In other cases, if the reaction is longer lived, or cyclic, where re-initiation occurs, then data collection may be carried out at different time intervals following the initiation of the reaction. In this chapter we will provide general protocols for assaying the functions of helicases using smFRET. First the materials and general instrumentation used will be described. We note that a comprehensive guide for the construction of a home-built smFRET setup is not provided here and to the inquisitive reader we recommend Ref. (7) for an excellent tutorial on the topic.

Single-Molecule FRET Analysis

31

2. Materials 2.1. Reagents

We list the commonly required materials for these experiments. Other necessary reagents that are not listed here are of life sciences grade and may be obtained commercially. 1. Aminopropylsilane (United Chemical Technologies) (store at –20C). 2. Glucose oxidase (Sigma). 3. Catalase (Roche). 4. Oligonucleotides (IDT technology). 5. Coverslips: VWR 240 40 mm, CAT. No. 48393 230 (vwr.com). 6. Standard 300 100 1 mm microscope slides (Fisher). 7. mPEG-SC: MW 5000, 1 g, lot#101-68 (Laysan Bio Incorporated). 8. Biotin-PEG-SC: MW 5000 (Laysan Bio Incorporated). 9. Neutravidin: 31000, 10 mg (http://www.piercenet.com). Prepare a concentration of 5 g/mL in T50 buffer. Store in 4C. 10. T50 Buffer: 10 mM Tris, pH 8, 50 mM NaCl. 11. Drill bits: Kingsley North Inc.: 1-0500-100 (www. kingsleynorth.com). 12. Permanent double-sided tape (Scotch/3 M). 13. Epoxy, 5-min (http://www.devcon.com/). 14. Tubing for flow experiments. ETT-28 (http://www. weicowire.com/).

2.2. Preparation of Gloxy

1. Put 100 mL of T50 buffer in a 250-mL tube. Add 20 mL of catalase. 2. Add 10 mg of glucose oxidase. Centrifuge at 10,000 rpm for 1 min. 3. Recover the yellow supernatant. Store in 4C; it is good for 3 weeks.

2.3. Instrumentation

As mentioned above, for a thorough guide on the assembly of homebuilt TIRF-FRET microscope please review Ref. (7).

2.4. Software and Analysis

When analyzing smFRET data, it is best to begin by looking at representative smFRET histograms. These histograms are constructed by averaging the initial 8–10 data points from many smFRET trajectories in the smFRET histograms. For substrates having a well-defined donor–acceptor distance, a second peak will appear corresponding to that distance, as shown in Fig. 3.1 for a DNA substrate having a separation of seven nucleotides between the donor and acceptor. The donor-only peak serves as the zero FRET mark of the histogram.

32

Rothenberg and Ha

Fig. 3.1. smFRET histogram for the substrates imaged in Fig. 3.5b. Two picks are shown in the histogram. The donor-only peak appears at approximately zero FRET efficiency corresponding to substrates having no emitting acceptor, while the highly excited acceptor peak appears at FRET efficiency of about 0.85.

For more in-depth analysis the specific features of single donor/acceptor trajectories should be monitored closely. For instance, Fig. 3.2 shows two trajectories exhibiting changes: one

Fig. 3.2. Simulated single-molecule trajectories. a,–b. Trajectory of donor (grey) and acceptor (black) and their corresponding FRET efficiency trajectory, showing several well-defined and long-lived FRET values. c. Rapidly and periodically changing FRET efficiency similar to observed repetitive translocation and unwinding.


33

showing discrete changes with substantial dwell times, while the other showing rapid periodical changes. Analysis of these types of trajectories can provide useful measurements such as dwell times, frequency and magnitude of FRET changes, and intensity of donor and acceptor.

3. Methods 3.1. Coverslips and Slides Preparations and Assembly 3.1.1. Cleaning

Here we provide a basic glass cleaning protocol, though several protocols may be suitable for single-molecule experiments. 1. Rinse and fill the glass container with MilliQ-H2O. Fill with acetone. Sonicate for 15 min. 2. Fill with 1 M KOH. Sonicate for 20 min. Rinse slides thoroughly with MilliQ-H2O. 3. Burn the slides with propane torch on each side for 30 s. Burn the coverslips for 1 s on one side. Place back in the container (see Note 1).

3.1.2. Aminosilanization and PEGylation

1. Pour 150 mL of MeOH into the flask. Add 7.5 mL of acetic acid (glacial) with a glass pipette. Add 1.5 mL of aminopropylsilane by a glass pipette into the flask and mix well. 2. Pour the mixture quickly into both slide and coverslip containers. Incubate for 10 min on bench, sonicate for 1 min, and then incubate on bench for an additional 10 min. After completion of aminosilanization, rinse coverslips and slides with MeOH and water and dry them with N2(g). Place the coverslips inside tip boxes. Place slides inside tip boxes (see Note 2). 3. Measure 1–2 of biotin-PEG (for five slides) and place inside a 1.5 mL tube. 4. Measure 40 mg of mPEG and put it in the same tube. 5. Add 320 mL of the PEGylation buffer (10 mL MilliQ-H2O + 84 mg sodium bicarbonate) and mix gently with pipette. Centrifuge for 1 min at 10,000 rpm. 6. Drop 70 mL of it on each slide. Gently place a coverslip on the top of each slide (be careful not to create bubbles). Place boxes in a dark, well-leveled location. Incubate for 2–3h. 7. After the incubation period, disassemble the slides, rinse them thoroughly with MilliQ-H2O, and dry completely with N2(g). Store and assemble the slides according to your application. Always store them in the dark (see Note 3).

34

Rothenberg and Ha

3.1.3. Assembly of Slides and Coverslips into Flow Chambers

The number of channels in the flow chamber depends on the desired experiments and applications. The holes should be drilled in the glass prior to cleaning, using a Dremel and diamond-coated drill bits. For a single experiment or flow experiments, a single diagonal channel would suffice, as shown in Fig. 3.3, while for running several experiments sequentially or simultaneously several channels may be used (Fig. 3.4). 1. Place the slide on a stable surface with the PEG-coated surface facing up. 2. Place two strips of double-sided tape on the slide bordering a single diagonal channel between the drilled flow holes (see Fig. 3.3 and Note 5). 3. For assembly of multiple channels, place parallel strips of double-sided tape as spacers between channels (refer to Fig. 3.4). 4. Gently place the coverslip on top of the slide. Cut doublesided tape around the coverslip and carefully peel off the unsandwiched portions. 5. Reinforce double-sided adhesion by carefully pressing tape regions through the coverslip (using a pipette tip). Seal open regions of the channels with 5-min epoxy (see Note 4).

Fig. 3.3. Assembly of single-channel diagonal flow chamber (see text for protocol). a. After drilling the holes and cleaning, the double-sided tape and coverslip is placed. b. The channel is filled with buffer and sealed with epoxy. c. The flow apparatus is assembled and the chamber is placed on the microscope.


35

Fig. 3.4. Assembly of multichannel flow chamber (see text for protocol). a. After drilling the holes and cleaning, small strips of double-sided tape are placed as spacers and the coverslip is placed on top. b. The channel is filled with buffer and (c) sealed with epoxy. d. Buffer is added with a pipette directly to the channel and imaged with the microscope.

6. For flow channel assembly, cut two pieces of tubing, approximately 20–30 each. Carefully insert a syringe needle into the end of one of the tubes. 7. Insert the two tubes directly into the drilled holes in the glass. 8. Verify flow through the channel. Insert the loose end of one tube into a tube containing buffer. Pull buffer through the channel using the syringe. Seal the tubing-holes connections using 5-min epoxy (refer to Fig. 3.3). 3.2. Sample Preparation 3.2.1. Nonspecific Binding

Checking for surface integrity and nonspecific binding is a prerequisite for the reliability of surface-tethered experiments. Please refer to Fig. 3.5 for an example of nonspecific labeled protein binding and specific binding of DNA substrates. 1. Image surface. 2. Add 1 nM of Cy3-labeled DNA and image the surface. If image does not contain fluorescent spots resulting from nonspecifically bound DNA, use T50 buffer to wash off channels with 8 channel volumes (see Note 6). 3. To determine the level of nonspecific binding by protein, add protein labeled with Cy3 or Cy5 at similar concentrations as intended to be used in the experiments (at least 1 nM) and

36

Rothenberg and Ha

Fig. 3.5. Nonspecific and specific binding in TIRF-FRET imaging. a. Nonspecific binding of Cy3 (donor) labeled protein. The left-donor channel is saturated. b. Specific binding with optimal coverage of a DNA substrate exhibiting high FRET. The right-acceptor channel shows a number of spots corresponding to the fluorescence of Cy5 molecules.

image the surface. Figure 3.5a shows an example of high levels of nonspecifically bound Cy3-labeled protein. If no fluorescent spots resulting from nonspecific binding are observed, use at least 8 channel volumes of T50 buffer to wash off each channel. 3.2.2. Surface Tethering of DNA Constructs

1. In a 1.5 mL tube, add 960 mL of T50 buffer and 40 mL of Neutravidin stock, giving a final concentration of 0.2 mg/ mL. Add 100 mL of Neutravidin solution to each channel. Incubate for 1 min. 2. Wash off Neutravidin with 400 mL T50 buffer (4–6 channel volumes). 3. Add 100 mL of 30 pM biotinylated DNA (see Note 7). Wait for 5 min and wash off with 400 mL T50 buffer.


37

4. Image surface and obtain the density of fluorescent spots. If the number of spots is sufficient, the channel is now ready for the experiments. Refer to Fig. 3.1 for an example of desired density of spots for a high FRET substrate (see Note 8). 3.2.3. Helicase Activity Assays

As discussed earlier, the three main activity assays would be helicase–DNA binding, ssDNA translocation, and dsDNA unwinding. The experimental components for which concentrations should be optimized for kinetic analysis include helicase, hydrolyzable nucleotides and analogues, and salt (see Note 9). The various helicase functionality assays differ mainly in the choice of FRET pair and substrates that will be used, which consequently will define the measured functionality. Besides the various substrates and FRET pairs, the manner by which the experiments are executed is similar. Hence, we will provide some choices for substrates to be used in each type of assay, followed by a general assay that can be used to probe each of the pairs/substrates. The total volume of the imaging/reaction buffer to be added to the channel is typically 100 mL (see Note 10). In a flow-type experiment, data recording is started several seconds prior to the flow of imaging/reaction buffer. For recording data, initially take three long (1000 frames each) consecutive movies followed by ten short movies (30–50 frames each). The longer movies will provide information on single-molecule dynamics over time while the shorter movies will provide data on multiple molecules, which can be used to construct statistically significant fluorescence intensity and FRET histograms.

3.2.4. Imaging Buffer

All single-molecule reactions will be carried out in imaging buffer with an oxygen scavenger system (gloxy/catalase) to reduce the photobleaching rate and BME for reduced blinking. Buffer is made immediately before addition to the channel. 1. In a 250 mL tube prepare 98 mL of reaction buffer already containing the desired reactants (helicase, ATP, etc.) and 0.4% beta-D-glucose. Add 1 mL of Gloxy. Add 1 mL of BME (see Note 11). Mix by pipetting up and down several times (being careful to avoid forming bubbles) and add to the channel. 2. Capture data.

3.3. Binding Assay with Labeled DNA and Protein 3.3.1. Binding Assays

To verify binding and gain structural and organizational information on DNA-bound helicase, the FRET between a labeled helicase and the DNA substrate is monitored. The choice of which will serve as donor and which as acceptor would depend on the binding stoichiometry and labeling efficiency of the helicase. Figure 3.6 shows typical substrates for binding assays. The fork substrate in Fig. 3.6a may be used to monitor the distance

38

Rothenberg and Ha

between the tails, which may be drawn together or restricted due to binding of a helicase (Fig. 3.6a (ii)). In the substrate shown in Fig. 3.6b, the distance between the end and the junction is monitored and may display a change upon binding. An example of such a change is shown in Fig. 3.6b (iii), where binding of ssoMCM helicase to such a substrate with a tail of 40 nt shows a shift in the peak in the smFRET histograms. Figure 3.6c shows a scheme for binding assays that involves measuring FRET between the labeled DNA and the labeled helicase. In this assay no FRET will be detected unless the helicase binds the DNA substrate. By using various DNA substrates or a helicase labeled in different locations, the resultant smFRET histograms may provide domain orientation and structural information, as illustrated in Fig. 3.6c (i)–(iii).

Fig. 3.6. DNA substrates for binding assays. a. (i ),(ii ) End-labeled fork substrate for monitoring the change between the single-stranded ends. b. (i ),(ii ) End- and junctionlabeled substrate for monitoring distance change between junction and tail, and helicase loading on the tail. (iii) FRET change induced by loading of helicase on a substrate as shown on the left, having a tail of 40 nt. Blue histogram represents substrate when no protein is present. Red histogram shows a distinct shift to lower FRET in the histogram after helicase was added, representing helicase-induced stretching of the DNA. c. Substrate for probing binding of labeled helicase.

Single-Molecule FRET Analysis 3.3.2. Translocation Assays

39

Translocation can be monitored in three principal assays, illustrated in Fig. 3.7. First, the distortion of the ssDNA track resulting from the translocation can be probed. This is accomplished by monitoring the FRET change along the track itself using a FRET pair on ends of the track, as illustrated in Fig. 3.7a. Since translocation involves a relative motion of the helicase to the DNA substrate, measuring the FRET change between the moving helicase and a fixed point on the DNA track may provide information on translocation speed and step size. Figure 3.7b shows the scheme for such assays. In this assay, no FRET will be observed prior to binding of the helicase. Finally, probing helicase’s conformational changes associated with translocation and hydrolysis can be done by using a helicase labeled with both donor and acceptor and an unlabeled DNA (see Notes 7 and 8), as illustrated in Fig. 3.7c.

Fig. 3.7. DNA substrates for translocation assays. a. (i )–(iii ) End- and junction-labeled substrate to monitor track distortion and end recapture. b. (i )–(iii ) End-labeled substrate to probe translocation of labeled helicase along the track. c. (i )–(iii ) Unlabeled substrates to probe conformational changes of helicase labeled with donor and acceptor.

40

Rothenberg and Ha

Lastly, an additional assay that we wish to include in conjunction with the binding assays is a helicase binding-stability/dissociation assay (Section 3.3.5). This assay is complementary to the binding assays (Sections 3.3.1 and 3.3.4) and may be done in the same flow chamber immediately following binding experiments. Here, after binding is verified, the channel is washed with buffer to remove excess helicase in solution and then the changes in FRET associated with dissociation are monitored. 3.3.3. Unwinding Assays

The principal role of helicase is the unwinding of dsDNA by harvesting energy from nucleotide hydrolysis, resulting in separation of dsDNA into two strands of ssDNA. Generally, unwinding is best approached by monitoring FRET changes on dually labeled DNA in the vicinity of the duplex region of the DNA substrate, and unlabeled helicase, as illustrated in Fig. 3.8. The substrates for unwinding may be partial duplexes, having a free tail for the loading of the helicase (Fig. 3.8a (iii),(iv)), or forked having both tails (Fig. 3.8a (i),(ii)). The substrate may be orientated relative to the surface through tethering, either via the blunt end of the duplex (Fig. 3.8a (i)–(iii)) or in reverse orientation via the ssDNA tail such that the duplex is away from the surface (Fig. 3.8a (ii)–(iv)). The

Fig. 3.8. DNA substrates for unwinding assays. a. (i )–(iv ) Partial duplex substrates for unwinding, with either single tails (iii ),(iv ) or forked (i ),(ii ) structures with the substrate being either directly tethered to the surface through its duplex blunt end or tethered via a ssDNA tail, away from the surface (i.e., reverse orientation). b. (i )–(iii ) Scheme for unwinding where donor strand disengages from substrate after unwinding.


41

biotin surface-tethered strand should be labeled with Cy5 such that if full unwinding occurs, as illustrated in Fig. 3.8b (i)–(iii), the Cy3 donor-labeled strand would be released from the substrate and the fluorescence signal will diminish. 3.3.4. Helicase General Activity Assay

This assay is to be customized according to the desired functionality and probing scheme, as specified in Sections 3.3.1, 3.3.2, and 3.3.3 (also see Note 12). 1. Check nonspecific binding properties of the surface (Section 3.2.1) – if a labeled protein is to be used, measure nonspecific binding of labeled protein. 2. Attach substrate of interest (depending on desired activity, see Sections 3.3.1, 3.3.2, and 3.3.3). 3. Place all reagents (helicase, ATP, gloxy, etc.) in a covered ice bucket. 4. Measure FRET of substrate alone as a control – add imaging buffer and take ten short movies (20–40 frames) and three long ones (1000 frames). 5. Prepare reaction buffer (see Note 12), add and take ten short movies (20–40 frames) and three long ones (1000 frames). 6. If the studied reaction can be re-initiated, change the concentration of one of the reaction variables and repeat step 5.

3.3.5. Helicase Dissociation Assay

1. For binding assays, following each of the above additions, wash channel using 400 mL T50 buffer. Add imaging buffer and image. Take two long and ten short movies. 2. Repeat, after each concentration, addition in the above assays. Further suggestion regarding assays and analysis are provided in Notes 13 and 14.

4. Notes 1. Heated coverslips tend to bend; therefore, pass the coverslips quickly through the flame. 2. The layer of PEG solution in between the glass tends to dry; incubate in vapor-saturated environment (empty pipette tip box with a flooded floor). 3. Can be stored in –20C for extended periods. Prior to assembly, let it thaw and reach room temperature. 4. Prior to sealing sides with epoxy, carefully add 100 mL of T50 to the channels. This is done so epoxy will not fill the channel. Apply epoxy to the sides using a pipette tip and let it dry.

42

Rothenberg and Ha

5. Wash with two additions of 200 mL for 50 mL channel volume. When adding solution to a channel, pipette carefully so no bubbles are formed; place a folded Kimwipe on the exit hole to absorb flow-through. 6. For some substrates adjusting the buffer pH to the range of 8–8.5 may lower nonspecific binding, particularly for ssDNA. 7. The concentration of substrate to be added varies and would depend on labeling efficiency of the substrates and the actual amount of biotin and Neutravidin on the PEG surface; typically the concentration range of 30–200 pM yields a sufficient number of surface-bound fluorescence spots. 8. If the initial number of spots is low (due to reasons given in Note 7), gradually increase the concentration of substrate until the desired number of fluorescent spots is reached. 9. T50 buffer with 10 mM of added Mg is typically required for helicase–DNA binding (magnesium acetate or MgCl2). Alternatively enzymatic activity buffer, such as NEBuffer 4 (New England Biolabs), may be used. 10. In the case of narrow channels or if protein is scarce, smaller quantities can be used as long as the concentration of reactants remains the same. 11. BME does not provide a good blinking suppressor in the case of a FRET pair along rigid dsDNA regions. One can use buffer containing TROLOX for blinking suppression (8). 12. For each of the functionalities that are being probed, there exist matrixes of variable quantities. For binding assays, salt and helicase concentration should be titrated. For translocation and unwinding assay, salt, helicase, and hydrolyzable nucleotide concentration should be titrated. Accordingly, for each of these variables a separate control is required. For instance, in translocation and unwinding assays, prior to adding the helicase to the reaction buffer, a control containing imaging buffer plus hydrolyzable nucleotides should be performed in order to ensure that the substrate FRET is not affected. 13. Careful and methodological data analysis is the principal part in quantifying and interpreting the resulting smFRET data. For specific IDL and Matlab code requests, the readers are encouraged to contact the authors for their availability. 14. We note that the assays provided here must be optimized depending on the helicases that are being investigated. Optimizing the assays and constructing appropriate DNA substrates should depend on general helicase characteristics such as dissociation constants and effective concentration, helicase oligomeric forms, DNA footprint, directionality,


43

and processivity. We recommend that prior to expediting smFRET experiments, one should perform fluorimeter activity assays in the bulk, with the same (or similar) DNA constructs as are intended for the smFRET measurements.

Acknowledgments The authors would like to thank Jaya Yodh for carefully reading this chapter and providing helpful comments. The authors thank Jaya Yodh, Salman Sayed, Jeehae Park, and Hamza Balci for providing data, comments, and manuscripts in preparation. E.R. is a fellow of the NSF Center for the Physics of Live Cells at the University of Illinois, and he acknowledges its support. References 1. Ha T., Enderle T., Ogletree D. F., Chemla D. S., Selvin P. R., and Weiss S. (1996) Probing the interaction between two single molecules: Fluorescence resonance energy transfer between a single donor and a single acceptor. Proc. Natl. Acad. Sci. USA 93, 6264–6268. 2. Ha T., Rasnik I., Cheng W., Babcock H. P., Gauss G. H., Lohman T. M., and Chu S. (2002) Initiation and re-initiation of DNA unwinding by the Escherichia coli Rep helicase. Nature 419, 638–641. 3. Rasnik I., Myong S., Cheng W., Lohman T. M., and Ha T. (2004) DNA-binding orientation and domain conformation of the E-coli Rep helicase monomer bound to a partial duplex junction: Single-molecule studies of fluorescently labeled enzymes. J. Mol. Biol. 336, 395–408. 4. Myong S., Rasnik I., Joo C., Lohman T. M., and Ha T. (2005) Repetitive shuttling of a

5.

6.

7.

8.

motor protein on DNA. Nature 437, 1321–1325. Rothenberg E., Trakselis M. A., Bell S. D., and Ha T. (2007) MCM fork substrate specificity involves dynamic interaction with the 50 tail. J. Biol. Chem. 282, 34229–34234. Myong S., Bruno M. M., Pyle A. M., and Ha T. (2007) Spring-loaded mechanism of DNA unwinding by hepatitis C virus NS3 helicase. Science 317, 513–516. C. Joo and T. Ha (2008) Ch 2. ‘‘SingleMolecule FRET with Total Internal Reflection Microscopy’’ In, ‘‘Single Molecule Techniques: A Laboratory Manual’’, Eds. Pauls R. Selvin and Taekjip Ha. Cold Spring Harbor Laboratory Press, New York, ISBN 978-087969775-4, pp. 507. Rasnik I., McKinney S. A., and Ha T. (2006) Nonblinking and longlasting singlemolecule fluorescence imaging. Nat. Methods 3, 891–893.

Chapter 4 Kinetics of Motor Protein Translocation on Single-Stranded DNA Christopher J. Fischer, Lake Wooten, Eric J. Tomko, and Timothy M. Lohman Abstract The translocation of nucleic acid motor proteins along DNA or RNA can be studied in ensemble experiments by monitoring either the kinetics of the arrival of the protein at a specific site on the nucleic acid filament (generally one end of the filament) or the kinetics of ATP hydrolysis by the motor protein during translocation. The pre-steady state kinetic data collected in ensemble experiments can be analyzed by simultaneous global non-linear least squares (NLLS) analysis using a simple sequential ‘‘n-step’’ mechanism to obtain estimates of the rate-limiting step(s) in the translocation cycle, the average ‘‘kinetic step-size,’’ and the efficiency of coupling ATP binding and hydrolysis to translocation. Key words: Translocase, kinetics, ATPase, helicase, motor protein.

1. Introduction The ability to translocate processively and with biased directionality along a nucleic acid filament is central to the biological function of several enzymes including polymerases (1), helicases (2–4), chromatin remodelers (5, 6), some nucleases (7, 8), and some restriction enzymes (9–11). These ‘‘molecular motors’’ all use the chemical potential energy obtained through the binding and hydrolysis of nucleoside triphosphates (NTP or dNTP) to perform the mechanical work of directional translocation along the filament. An understanding of the translocation mechanisms of these motor proteins requires quantitative kinetic information to obtain the rate constants, processivities, kinetic step-sizes, and ATP coupling stoichiometries associated with translocation. M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_4, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

45

46

Fischer et al.

Here, we describe the use and analysis of pre-steady state ensemble kinetic approaches (3, 6, 10–17) to probe the translocation mechanisms of processive translocases along nucleic acids using a simple sequential ‘‘n-step’’ kinetic model. The application of this methodology provides an accurate determination of macroscopic kinetic parameters such as the rate of net forward motion of the translocase along the nucleic acid and the net efficiency at which the hydrolysis of ATP is coupled to this net forward motion. However, the estimates of microscopic kinetic parameters, such as the kinetic step-size of translocation, can be inflated under some circumstances if non-uniform motion occurs during translocation.

2. Materials 2.1. Matching Experimental Conditions to Model Assumptions

The kinetic model and associated equations used here assume that no more than one translocase is bound to each nucleic acid. Thus, the application of these equations to the analysis of kinetic data requires that the experiments are performed under conditions that favor this binding distribution; this is generally achieved by performing the experiments under conditions where the concentration of the nucleic acid is in excess of the concentration of the translocase. This model also assumes that any translocase that is initially free in solution at the start of the reaction or that dissociates from the nucleic acid during translocation is prevented from rebinding to the nucleic acid. This is accomplished experimentally by including a protein trap. When selecting such a trap it is best to use one that does not stimulate the ATPase activity of the translocase (18). This will allow for more straightforward and simple analysis of the ATPase activity of the translocase that is associated with translocation.

3. Methods 3.1. Mathematical Model for Translocation

The sequential ‘‘n-step’’ kinetic mechanism shown in Scheme 4.1 has been used to model helicase translocation and its coupling to ATP hydrolysis (13, 18). In this mechanism (13), depicted in Fig. 4.1, a translocase with an occluded site size of b nucleotides and a contact size of d nucleotides binds with polarity to a nucleic acid filament, L nucleotides long. The contact size, d, represents the number of consecutive nucleotides required to satisfy all contacts with the translocase and is thus less than or equal to the

Kinetics of Motor Protein Translocation

47

Scheme 4.1

occluded site size. In this discussion we will assume that translocation along the nucleic acid is directionally biased from 30 to 50 , but the results are equally applicable to a translocase that exhibits the opposite directional bias.

Fig. 4.1. Kinetic model for ATP-dependent protein translocation along a nucleic acid filament. Panel A: A cartoon depicting the binding of a translocase with a contact size d and occluded site size b to a nucleic acid filament of length L. As shown in this cartoon, the contact size, d, is always less than or equal to the occluded site size, b. Panel B: Cartoon showing the model used to describe enzyme translocation along a nucleic acid filament. The line segments represent the nucleic acid and the triangles represent the translocase. The translocase binds randomly, but with polarity, to the nucleic acid and upon binding and hydrolysis of ATP proceeds to translocate toward the 50 end of the filament in discrete steps with rate constant kt. The rate constant of dissociation during translocation is kd. Upon reaching the 50 end of the filament, the translocase dissociates with a rate constant kend. Dissociated translocases bind to a protein trap, T, and are thereby prevented from rebinding the nucleic acid.

48

Fischer et al.

The translocase is initially bound i translocation steps away from the 50 end, with concentration Ii. The number of translocation steps, i, is constrained (1 8000 g as instructed (in successive aliquots of up to 700 ml if the volume exceeds this). Retain 300 l of the flow-through for protein extraction and discard the remainder of the flow-through. 3. Wash the RNeasy1 Mini column serially according to the manufacturer’s instructions (see Note 4). After the washes elute the RNA in the RNase-free water provided in the kit. Following the final elution measure the RNA concentration at 260/280 nm using a spectrophotometer and store at –80C.

3.2.2. Protein Extraction

1. To the 300 ml flow-through from step 2, above, add 1200 ml of acetone and mix gently. Do not vortex (see Note 5). 2. Centrifuge at 14,000 g for 10 min at room temperature. 3. Aspirate off the acetone and add 100 ml of ice-cold ethanol. Mix gently, do not vortex.

Analysis of the RNA Helicase p68 (Ddx5)

273

4. Centrifuge at 14,000 g for 10 min at room temperature. 5. Aspirate off the ethanol and air-dry the pellet for 10 min. 6. Add 150 ml of standard SDS sample buffer and boil for 10 min, vortexing occasionally. This protein can then be used for analysis by standard SDS-PAGE and Western blotting (see Fig. 19.1b). 3.3. Reverse Transcription/cDNA Synthesis

This is a two-step protocol involving DNA digestion followed by reverse transcription. This procedure can be carried out either using water baths at 37, 65 and 70C, or using a PCR machine programme for the required incubations. 1. For each reaction, place 1 mg of RNA in a microfuge tube and add 2 ml of 5 first strand buffer and 1 ml of RQ1 DNase. Make up the final volume to 10 ml with RNase-free water. Incubate at 37C for 30 min. 2. Following this incubation add 1 ml of RQ1 DNase stop solution and incubate the sample at 65C for 10 min and then chill on ice. 3. Add 2 ml of RNase-free water and 1 ml of random hexamer (300 ng/ml), incubate at 70C for 10 min followed by a brief chill on ice. Finally, add 6 ml of RT-mix (containing 2 ml of 5 first strand buffer, 2 ml of 10 mM dNTPs, 1 ml of 100 mM DTT and 1 ml M-MLV reverse transcriptase 200 U/ml) and incubate for 10 min at 25C followed by 1 h at 37C and, subsequently, 15 min at 70C. Store the resulting cDNA at –20C.

3.4. qRT-PCR (TaqMan)

For the analysis of mRNA levels in the untransfected/siRNAtransfected and/or untreated/treated samples, we perform quantitative real-time PCR using the Stratagene Mx3005PTM TaqMan PCR machine with MxPro300 software and cDNA (prepared as described in Section 3.3) as follows. 1. Set up qPCR reactions in 96-well plates (Applied Biosystems). All reactions include Universal PCR Master Mix, primer sets (including forward, reverse and probe) and the appropriate cDNA template. For every primer set a non-template control (NTC) is included to monitor possible primer contamination. (a). For ABI primers each reaction requires 6 ml of 2 Universal PCR Master Mix (Applied Biosystems), 0.6 ml of the appropriate ABI primer mix (including the forward and reverse primers and the probe) and 3.4 ml RNase-free water. (b). For MWG-primers each reaction requires 6 ml of 2 Universal PCR Master Mix, 1.2 ml of a primer mix (20 ml stock prepared using 17.5 ml of RNase-free water, 1 ml of forward and 1 ml of reverse primer and 0.5 ml of probe) and 2.8 ml of RNase-free water.

274

Nicol and Fuller-Pace

However, to ensure consistency across all wells, prepare a stock master/primer mix for the required number of reactions, including NTC reactions, and dispense in 10-ml aliquots per well. 2. To each well add 10 ml of the master/primer mix (as above) and 2 ml of the appropriate cDNA, diluted 1 in 36 in RNase-free water. Seal the plates with Optical Caps (Applied Biosystems) and centrifuge briefly at 1000 g prior to loading into the TaqMan PCR machine. For our experiments the samples are amplified on the following Fast 2 Step PCR programme. (However, this might need to be adjusted for different primers/mRNAs.) 1 cycle at 95C for 10 min 40 cycles at 95C for 15 s 60C for 1 min Analyse TaqMan results by the Ct method in Microsoft Excel with an appropriate control sample as a reference sample and in all cases RNA levels are calculated relative to a ‘housekeeping’ mRNA, e.g. actin. For our studies on the effect of p68 siRNA knockdown on the induction of expression of p53 responsive genes after treatment with etoposide, we use untransfected cells, which have not been treated with etoposide, as the reference sample with a value of 1 relative to actin (see Fig. 19.1a and Note 6). 3.5. Chromatin Immunoprecipitation (ChIP)

The protocol below, adapted from previously described protocols (5, 6), gives the amounts used per 10 cm plate. We usually prepare six plates in each case and pool the harvested cells (step 2). For a standard ChIP, 2 106 cells are seeded in each plate 16–24 h prior to cross-linking with formaldehyde. When required, etoposide is added at 100 mM for 2 h prior to cross-linking. 1. To cross-link remove medium from cells, wash twice in warm 1 PBS and add 10 ml of 1.5% formaldehyde. Leave at 37C for 10 min. 2. Wash cells twice with ice-cold 1 PBS. To harvest cells add 2 ml of ice-cold collection buffer, leave for 2–3 min and then scrape off into a 15-ml falcon tube. 3. Pellet cells by centrifugation at 110 g for 10 min at 4C. 4. Remove supernatant and lyse pellet in 900–1000 ml of lysis buffer per 6 plates (depending on pellet size), transfer to a 1.5-ml centrifuge tube and leave suspension on ice for 10 min. 5. Sonicate (at a setting of 10 m) while keeping the tube on ice, seven times for 20 s, with 1 min between each sonication, to prevent overheating and DNA denaturation. This should give DNA fragments ranging from 200 to 1000 bp (see Note 7). Centrifuge at 10,000 g for 10 min at 4C to remove debris.


275

6. Remove the supernatant (chromatin), measure the volume and place into a clean 15-ml falcon tube. At this stage take a 10-ml aliquot and check sonication efficiency by electrophoresis through a 1% agarose gel, ethidium bromide staining and visualisation using a UV trans-illuminator. 7. Dilute the chromatin fivefold in dilution buffer. At this stage the chromatin lysate can be aliquoted into 500- to 600-ml aliquots in microfuge tubes, snap frozen on dry ice and stored at –80C. 8. To set up the chromatin immunoprecipitation, pre-clear a 500- to 600-ml aliquot of the chromatin lysate with 30 ml of protein A 50% slurry with salmon sperm DNA (2 mg), on a rotating wheel at 4C for 2 h. This step removes any proteins binding non-specifically to the protein A. 9. Following pre-clearing, centrifuge the lysate at 400 g for 3 min at 4C. Place supernatant into fresh microfuge tube, removing 100 ml for use as an input control sample. Add an appropriate volume of the required antibody (to give 3 mg of antibody) and place on rotating wheel at 4C for overnight incubation. 10. The next day add 50 ml of protein A 50% slurry with salmon sperm DNA (2 mg) and place back on rotating wheel at 4C for 2 h. 11. Centrifuge at 400 g for 3 min at 4C. 12. Serially wash beads in 500 ml of low salt wash, high salt wash (see Note 8), LiCl wash and then twice in 1 TE buffer, on the rotating wheel at 4C for 5 min in each case centrifuging 400 g for 3 min at 4C between washes. 13. Finally centrifuge at 400 g for 3 min at 4C. 14. Elute complexes from the beads, by placing on rotating wheel at room temperature for 15 min with 50 ml of elution buffer. 15. Centrifuge at 1500 g for 3 min and repeat elution step (step 14). Combine the eluates from the two elution steps, i.e. final volume 100 ml. 16. Reverse cross-linking of the immunoprecipitated and the input samples by adding 4 ml of 5 M NaCl and 1 ml of RNAse A and placing in 65C water bath overnight. 17. Recover DNA by adding 4 ml of 1 M Tris, pH 6.5, 2 ml of 0.5 M EDTA, pH8.0, and 2 ml of 10 mg/ml proteinase K. Place in a 45C water bath for 1 h. 18. Purify DNA using QIAquick1 Gel Extraction Kit according to manufacturer’s instructions. 19. Store samples at –20C. These can now be used for qPCR or semi-quantitative PCR with appropriate primers.

276


1. qPCR from ChIP DNA is performed largely as that for cDNA described in Section 3.4, with the appropriate primers and PCR programmes as indicated in that section. However, when setting up the plate add only 9.5 ml of the stock master/primer mix (instead of 10 ml) with 2.5 ml of the appropriate non-diluted ChIP DNA sample.

3.6. qPCR from ChIP

2. Analyse TaqMan results by the Ct method in Microsoft Excel with the relative input sample as the reference sample. The fold change from the input can be converted into percentage of input by multiplying fold change by 100. GAPDH and ‘no antibody’ controls are used to rule out non-specific immunoprecipitation (see Fig. 19.2a). A: q-PCR

B: semi-quantitative PCR

120

100 input

% Input

80

M

–

+

p53 IP (DO-1) –

+

p68 IP (PAb204) –

+

No antibody –

+

Etoposide

500

60

250

p21 promoter PCR product Primer dimers

40

20

Etoposide ChIP

0

–

+

p53 (DO-1)

–

+

p68 (PAb204)

Fig. 19.2. Chromatin immunoprecipitation showing recruitment of p53 and p68 to the p21 promoter in response to etoposide treatment (100 mM for 2 h). (a) qPCR providing a quantitative measure of recruitment as a percentage of input. (b) Semi-quantitative measurement of the recruitment of p53 and p68; this also shows an increase in response to etoposide treatment, although precise comparison is, of course, not possible. In both (a) and (b), no PCR products were obtained in the ‘no antibody’ control (data not shown for (a) but values were below detection). The antibodies used for the IP are indicated.

3.7. Semi-quantitative PCR from ChIP

1. Dilute primers to a final concentration of 5 pmol/ml. Set up a 50-ml reaction with GoTaq1 Flexi DNA Polymerase (Promega) as follows: 10 ml of 5 buffer, 3 ml of 25 mM MgCl2, 0.4 ml of 25 mM dNTPs (GE Healthcare) 8 ml of the ChIP DNA sample, 5 ml of forward and reverse primers, 18.4 ml of RNase-free H2O and 0.2 ml of Taq. Note: for input samples use only 2.5 ml of input DNA. 2. Amplify the DNA using the following PCR programme: 1 cycle at 95C for 4 min 35 cycles at 95C for 30 s


277

60C for 1 min 72C for 45 s 1 cycle at 72C for 5 min 3. Analyse PCR products by electrophoresis through a 15% Tris–glycine polyacrylamide gel as for standard sodium dodecylsulphate (SDS) polyacrylamide gel electrophoresis (PAGE) but omitting the SDS. 4. After electrophoresis, stain DNA by ethidium bromide (as for standard agarose gels) and visualise using a UV trans-illuminator (see Fig. 19.2b).

4. Notes 1. siRNA oligonucleotides are provided by Dharmacon/ Thermo Scientific as lyophilised samples. These should be made up in 1 siRNA buffer (prepared using the 5 siRNA buffer and RNase-free water, both purchased from Dharmacon/Thermo Scientific) as a 200 mM stock, aliquoted out in 100 ml amounts and stored at –80C. Prior to use, 20 mM working solutions are prepared from these stocks and aliquoted out in appropriate amounts, ranging from 20 to 50 ml depending on the scale of experiments performed, and again stored at –80C. This procedure avoids repeated freeze/thawing. 2. Maintain U2OS and MCF-7 cells in Dulbecco’s Modified Eagle’s Medium (D-MEM) supplemented with 10% foetal bovine serum, 2 mM L-glutamine, 50 units/ml penicillin and 50 mg/ml streptomycin (all from Invitrogen) and grow at 37C and 5% CO2. Omit the antibiotics for siRNA transfections. Detach for passaging cells by rinsing in phosphate buffered saline (PBS-see below) and trypsinise using trypsinEDTA (Invitrogen). Determine cell count by counting using a haemocytometer. Cells should be passaged every 2–3 days with a 1:3 dilution for MCF-7 and 1:5 dilution for U2OS. Do not allow cells to become too confluent and when passaging do not seed cells too sparsely. This is particularly important for MCF-7 cells. Discard cells after 15 passages for MCF-7 and 20 passages for U2OS. Early passage stocks are stored in liquid nitrogen and can be used for experiments 2– 3 passages after recovery from liquid nitrogen. 3. For siRNA knockdown the medium does not need to be changed if the cells are to be harvested 48 h after transfection. However, if a longer period is required to achieve

278


sufficient knockdown the medium should be changed 24 h after transfection. It is useful to check whether changing the medium affects knockdown/recovery of cells depending on cell type and the target that is being knocked down by siRNA. 4. For the first wash (RW1 in the Qiagen RNeasy1 kit) we find that better/cleaner yields are obtained if the RW1 buffer is left on the column for 5 min prior to centrifugation. At the elution stage the RNase-free water is left for 1 min on the column prior to centrifugation. 5. Once acetone has been added to the 300-ml flow-through from the RNeasy1 Mini column the sample can be stored at –20C prior to continuing the protein extraction protocol. This can prove useful if several samples are being processed at the same time for RNA/protein extraction. 6. All values for mRNA levels are calculated relative to a ‘housekeeping’ mRNA, e.g. actin, GAPDH or TBP, with an appropriate reference, or control, sample taken as having a relative value of 1. For example, in our studies, untransfected cells (with normal levels of p68), which had not been treated with etoposide, were given a value of 1 relative to the actin mRNA level in that sample (see Fig. 19.1). 7. The sonication is one of the most important steps in this protocol. It is critical that the DNA fragment size obtained by sonication is reproducible (at 200–1000 bp) to avoid false-positive or negative results. It is best to sonicate a volume of between 600 and 800 ml and care must be taken to avoid over-sonication since this will result in denaturing the proteins. It is also important to keep the sample cold and to wait 1 min between the 20 s sonication bursts. It is also advisable to check sonication efficiency by electrophoresis of a sample. Once the procedure has been standardised for a particular system it is best to use the same sonication equipment as different sonicators can give very different results. 8. Normally the high salt wash after immunoprecipitation contains 0.1% SDS. However, for some antibodies (e.g. PAb204 for p68), this should be omitted (5, 6). Conditions should be optimised for different antibodies. 9. PBS can be prepared as a batch and stored at room temperature; LiCl wash buffer also can be prepared as a batch but aliquoted and stored at –20C. All other buffers must be prepared fresh just prior to use.


279

Acknowledgements This work is supported by the Association for International Cancer Research (06-613). References 1. Fuller-Pace F. V. (2006) DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res. 34, 4206–4215. 2. Endoh H., Maruyama K., Masuhiro Y., Kobayashi Y., Goto M., Tai H., Yanagisawa J., Metzger D., Hashimoto S. and Kato S. (1999) Purification and identification of p68 RNA helicase acting as a transcriptional coactivator specific for the activation function 1 of human estrogen receptor alpha. Mol. Cell Biol. 19, 5363–5372. 3. Clark E. L., Coulson A., Dalgliesh C., Rajan P., Nicol S. M, Fleming S., Heer R., Gaughan L., Leung H. Y., Elliott D. J. et al. (2008) The RNA helicase p68 is a novel androgen receptor coactivator involved in splicing and is overexpressed in prostate cancer. Cancer Res. 68, 7938–7946. 4. Caretti G., Schiltz R. L., Dilworth F. J., Di Padova M., Zhao P., Ogryzko V., FullerPace F. V., Hoffman E. P., Tapscott S. J. and Sartorelli V. (2006) The RNA helicases p68/p72 and the noncoding RNA SRA are coregulators of MyoD and skeletal muscle differentiation. Dev. Cell 11, 547–560. 5. Bates G. J., Nicol S. M, Wilson B. J., Jacobs A. M., Bourdon J. C., Wardrop J., Gregory D. J., Lane D. P, Perkins N. D and Fuller-Pace F. V. (2005) The DEAD box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. EMBO J. 24, 543–553.

6. Metivier R., Penot G., Hubner M. R., Reid G., Brand H., Kos M. and Gannon F. (2003) Estrogen receptor-alpha directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter. Cell 115, 751–763. 7. Wilson B. J., Bates G. J., Nicol S. M., Gregory D. J., Perkins N. D. and Fuller-Pace F. V. (2004) The p68 and p72 DEAD box RNA helicases interact with HDAC1 and repress transcription in a promoter-specific manner. BMC Mol. Biol. 5, 11. 8. Rossow K. L. and Janknecht R. (2003) Synergism between p68 RNA helicase and the transcriptional coactivators CBP and p300. Oncogene 22, 151–156. 9. Espinosa J. M., Verdun R. E. and Emerson B. M. (2003) p53 functions through stress- and promoter-specific recruitment of transcription initiation components before and after DNA damage. Mol. Cell 12, 1015–1027. 10. Kaeser M. D. and Iggo R. D. (2002) Chromatin immunoprecipitation analysis fails to support the latency model for regulation of p53 DNA binding activity in vivo. Proc. Natl. Acad. Sci. U.S.A. 99, 95–100. 11. Donner A. J., Szostek S., Hoover J. M. and Espinosa J. M. (2007) CDK8 is a stimulusspecific positive coregulator of p53 target genes. Mol. Cell 27, 121–133.

Chapter 20 A Method to Study the Role of DDX3 RNA Helicase in HIV-1 Chia-Yen Chen, Venkat R.K. Yedavalli, and Kuan-Teh Jeang Abstract Viral replication requires the use of host cell proteins and enzymes. Many viruses utilize viral helicases at various stages of their life cycle; these viruses have evolved to encode directly helicase or helicase-like proteins. In contrast, the genomes of retroviruses are devoid of viral helicases. Human immunodeficiency virus (HIV-1) has adopted the ability to use one or more cellular RNA helicases for its replicative life cycle. In this chapter, we briefly summarize the approach for assaying the RNA unwinding activity of RNA helicases measuring the effect of helicase inhibitors on HIV-1 replication. Key words: RNA helicases, human immunodeficiency virus type 1 (HIV-1), DEAD-Box domain, DDX3.

1. Introduction Helicases, including DNA and RNA helicases, are enzymes that separate stretches of duplexed DNA and/or RNA into singlestranded components in an energy-dependent manner. Based on motifs and sequences, RNA helicases are grouped into three superfamilies (SF1–SF3) and two smaller families (F4 and F5) (1). Most of the RNA helicases are in the SF2 superfamily and are conserved among different species. They can be found in organisms ranging from bacteria to humans to viruses. Viral replication requires the use of host cell proteins and enzymes. Many viruses utilize viral helicases at various stages of their life cycle; these viruses have evolved to directly encode helicase or helicase-like proteins. However, viruses that synthesize their genome within the cell nucleus tend to exploit cellular


281

282

Chen, Yedavalli, and Jeang

helicases and thus do not encode for any RNA helicases. Human immunodeficiency virus type 1 (HIV-1) is one example of this latter class of viruses. HIV-1 is a human retrovirus that packages two copies of positive strand full-length viral RNA per virion. HIV-1 infects human cells using a major receptor (CD4) with one of several co-receptors (CCR5, CXCR4, DC-SIGN), and it infects mostly T-helper (TH) cells, macrophages, and some microglial and dendritic cells (2). The viral genome is > 9 kilobases and encodes nine proteins. HIV-1 structural proteins include Gag (group-specific antigen), Pol (polymerase), and Env (envelope). In addition, HIV1 encodes two regulatory proteins, the transcriptional transactivator (Tat) and the regulator of post-transcriptional gene expression (Rev). The virus also has four genes that encode accessory proteins: Nef, Vif, Vpr, and Vpu. Replication of HIV-1 RNA starts inside an infected cell with the reverse transcription of its RNA into a cDNA form followed by its integration into the host chromosomal DNA to form a provirus. HIV-1 RNA is then transcribed from the proviral DNA by the cellular RNA polymerase II, processed like cellular mRNAs including 5’- and 3’-end modifications as well as splicing, and is then exported into the cytoplasm for translation. There are three processes pertaining to HIV-1 RNA that do not normally occur for cellular RNAs: nuclear export of introncontaining HIV-1 RNAs, packaging of viral RNAs into the spacelimited interior of virions, and completion of the reverse transcription of HIV-1 genomic RNA in the cytoplasm. In these regards, it is important to appreciate that HIV-1 encodes the nucleocapsid (NC) protein which bears RNA chaperone activity and has been shown to regulate HIV-1 RNA packaging and viral reverse transcription (3). A single HIV-1 transcript in its unspliced and spliced forms directs the synthesis of all viral proteins. Although export of intron-containing cellular transcripts from the nucleus into the cytoplasm is restricted in mammalian cells, HIV-1 must use unspliced RNA for the packaging of its genome into new virions and for the translation of Gag protein. Similarly, HIV-1 has to use a partially spliced transcript for translation of its Env protein. Thus, the virus must overcome the cell’s normal constraints of retaining unspliced/partially spliced RNAs in the nucleus preventing the nuclear-cytoplasmic export of such entities. To overcome these constraints, HIV-1 has evolved the Rev protein. Rev utilizes CRM1 as a cellular cofactor for Rev-dependent export of unspliced and partially spliced HIV-1 RNA. There is evidence that for export of HIV-1 RNAs, Rev/CRM1 activity also needs an ATP-dependent co-factor, RNA helicase DDX3 (4). DDX3 is a nucleocytoplasmic shuttling protein that binds CRM1 and localizes to nuclear membrane pores. Experimentally, abolition of the cell’s DDX3 activity suppressed Rev-RRE (Rev-responsive element)

Role of DDX3 RNA Helicase in HIV-1

283

function for unspliced and partially spliced HIV-1 RNAs (4), supporting that DDX3 is a human RNA helicase that functions in the CRM1 RNA export pathway.

2. Materials 2.1. Purification of DDX3 Protein

1. LB broth. 2. Chitin beads (New England Biolabs (NEB)). 3. Column buffer: 20 mM Tris–HCI, 1000 mM NaCI, 0.5% Triton X-100, 0.1 mM EDTA, and 20 mM PMSF. 4. Cleavage buffer: 20 mM Tris–HCl (pH 7.5), 500 mM NaCl, 1 mM EDTA, and 50 mM DTT.

2.2. RNA Unwinding Assay

1. ATPase/helicase buffer: 20 mM Tris–HCl, pH 8.0, 70 mM KCl, 2 mM MgCl2, 2 mM dithiothreitol, 15 units of ATPase/ helicase buffer. 2. Maxiscript T7 in vitro transcription kit (Ambion). 3. MaxiScript T3 in vitro transcription kit (Ambion). 4. Sample loading buffer: 10 mM EDTA, 40% glycerol, bromphenol blue, xylene cyanol. 5. EasyTides uridine 50 -triphosphate,[a-32P] (Perkin Elmer). 6. 5 RNA annealing Buffer: 30 mM HEPES (pH 7.4), 100 mM potassium acetate, 2 mM magnesium acetate. 7. 10 Tris boric acid EDTA (TBE) buffer. 8. Accugel 29:1 (National Diagnostics), TEMED, 10% ammonium persulfate.

2.3. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

1. Separating buffer (4): 1.5 M Tris–HCl, pH 8.7, 0.4% SDS (Protogel Resolving Buffer, National Diagnostics). Store at room temperature. 2. Stacking buffer (4): 0.5 M Tris–HCl, pH 6.8, 0.4% SDS (Protogel Resolving Buffer, National Diagnostics). Store at room temperature. 3. 30% acrylamide/bis solution (37.5:1 w/v) (ProtoGel (30%), National Diagnostics). 4. N,N,N,N’-tetramethyl-ethylenediamine (TEMED, Bio-Rad, Hercules, CA). 5. 10% Ammonium persulfate: prepare 10% solution in water. 6. Running buffer (10): 125 mM Tris, 960 mM glycine, 0.5% (w/v) SDS (Tris–glycine–SDS PAGE buffer (10), National Diagnostics). Store at room temperature.

284


7. Prestained protein marker, broad range (7–175 kDa) (NEB). 8. Hoeffer S600 electrophoresis unit (GE Biosciences). 9. Sample buffer (SDS reducing buffer) (store at room temperature). a. Deionized water 3.8 ml, 0.5 M Tris–HCl, pH 6.8, 1.0 ml, glycerol 0.8 ml. b. 10% (w/v) SDS 1.6 ml, 2-mercaptoethanol 0.4 ml, 1% (w/v) bromophenol blue. c. 0.4 ml, add water to 8.0 ml. 2.4. Western Blotting

1. Tris–glycine transfer buffer: 25 mM Tris (do not adjust pH), 190 mM glycine, 20% (v/v) methanol. 2. Casein hydrolysate (USB). 3. CSPD (Applied Biosystems). 4. Nitro-Block (Applied Biosystems). 5. PVDF membrane (Millipore). 6. Semi-dry blotting apparatus. 7. 10 assay buffer: 200 mM Tris–HCl (pH 9.8), 10 mM MgCl2. 8. Blocking buffer: 1X PBS containing 0.2% casein hydrolysate, 0.1% Tween 20 detergent.

2.5. HIV-1 RT Assay

1. RT assay buffer: 60 mM Tris–HCl, pH 7.8, 75 mM KCl, 5 mM MgCl2, 0.1% Nonidet-P40, 1.04 mM EDTA, 5 mg/ ml poly rA, 0.16 mg/ml Oligi dT(18), 4 mM DTT. 2. Alpha 32P dTTP (Perkin Elmer). 3. DE81 paper (Whatman). 4. Phosphorimaging plate/Phosphorimager (Fuji Medical, FLA7000). 5. 20 SSC buffer (Invitrogen). 6. Plasmid pNL4-3 (proviral HIV-1 molecular clone).

3. Methods 3.1. Purification of DDX3 Protein

1. DDX3 cloned into pTYB11 vector, fused at its N-terminus with chitin binding domain was used to transform Escherichia coli BL21-DE3 cells. Cells were grown at 25C overnight.


285

2. A single colony was selected and grown at 25C in LB medium containing 100 mg/ml ampicillin.When the OD 600 of the culture reaches 0.8, protein expression was induced at 15C with IPTG at a final concentration of 0.5 mM. 3. Cell extracts were prepared by lysing the cells by sonication in column buffer. Extracts were clarified by centrifugation and supernatant was used for protein purification. 4. Chitin column (20 ml for 1 culture) was equilibrated with 10 volumes of column buffer and slowly loaded with the clarified lysate. 5. The columns were then washed with at least 20 bed volumes of column buffer to thoroughly remove the unbound proteins. 6. The column were then washed two times with 3 bed volumes of cleavage buffer [20 mM HEPES or Tris–HCl (pH 7.5), 500 mM NaCl, 1 mM EDTA] and then once with cleavage buffer containing 50 mM DTT. The column flow was stopped without draining the cleavage buffer completely. The columns were then left at 8C for one day to allow for cleavage. 7. Cleaved protein was eluted by adding 0.5 bed volumes of cleavage buffer and continuing the column flow with cleavage buffer. 8. The eluted protein was dialyzed and concentrated before use. Purification was confirmed by SDS-PAGE electrophoresis and coomassie blue staining of gel. 3.2. RNA Unwinding Assay

1. The pBluescript plasmid was used to generate partially doublestranded RNA for the RNA unwinding assay (Fig. 20.1). The pBluescript vector was digested to completion with Kpn I and transcribed with T3 polymerase to generate a 120-base long transcript. The vector was also digested with EcoRI and transcribed with T7 polymerase in the presence of (32p) UTP. 2. The two complementary transcripts were purified and suspended in 1 annealing buffer. Samples were heated for 1 min to 95C and gently cooled to RT in the heating block. 3. The double-stranded RNA was then incubated with purified DDX3 in ATPase/helicase buffer. 4. After incubation for 30 min at 37C, the reactions were stopped by the addition of a solution containing 10 mM EDTA, 40% glycerol, bromphenol blue, and xylene cyanol. 5. The reaction was resolved in a 10% polyacrylamide gel (30 ml of Accugel 29:1, 10 ml 10 TBE, and 60 ml of H2O, 1 for 2 h). The gel was dried and exposed to a phosphorimaging plate.

286


Fig. 20.1. A schematic illustration of a helicase assay. (a) Preparation of partial RNA duplex for RNA unwinding assay. (b) RNA unwinding assay.

3.3. SDS-PAGE Electrophoresis

1. Prepare a 0.75-mm-thick, 10% gel by mixing 3.75 ml of 4 separating buffer with 5.0 ml acrylamide/bis solution, 6.25 ml water, 150 mL ammonium persulfate solution, and 10 mL TEMED (Fig. 20.2). Pour the gel, leaving space of 3–4 cm for a stacking gel, and overlay with water. Wait until the gel polymerizes (approx 20 min). 2. Pour off water and prepare the stacking gel by mixing 0.65 ml of 30% acrylamide/0.8% bisacrylamide, 1.25 ml of 40 Tris-Cl/ SDS, pH 6.8, and 3.05 ml H2O. Add 100 ml of 10% ammonium persulfate and 5 ml TEMED. Swirl gently to mix. Insert the comb and pour the stacking gel avoiding air bubbles. Once the stacking gel polymerizes remove the comb gently and rinse the well with deionized water. 3. Prepare the running buffer by diluting 100 ml of the 10 Tris–glycine SDS running buffer with 900 ml of deionized water. 4. Add diluted Tris–glycine SDS running buffer to the upper and lower chambers of the gel unit and load the 25 mL of each sample in a well. Include one well for prestained protein molecular weight markers.


287

Fig. 20.2. An illustration of an approach for assaying the effect of Helicase inhibitors on HIV-1 replication.

5. Complete the assembly of the gel unit and connect to a power supply. The gel can be run overnight at 45 V. 3.4. Western Blotting

1. The samples that have been separated by SDS-PAGE are transferred to PVDF membrane electrophoretically (Fig. 20.2). The gel unit is disconnected from the power supply and disassembled. The stacking gel is removed and discarded. 2. Five 3 M sheets wetted with transfer buffer are laid over the electrode (anode). The PVDF membrane is activated in methanol and after rinsing in transfer buffer laid on top of the 3 M paper. The separating gel is then laid on top of the PVDF membrane. Five more sheets of 3MM paper are wetted in the transfer buffer and carefully laid on top of the gel, ensuring that no bubbles are trapped in the resulting sandwich. The lid (electrode/cathode) is put on the gel sandwhich and the transfer is performed at a constant current of 250 mA for 2 h. 3. Following transfer, incubate the blot in blocking buffer (at least 30 ml) for 60–120 min. 4. Dilute primary antibody in blocking buffer (30 ml). Incubate with blot for 30–60 min. 5. Wash the membrane at least twice for 5 min in blocking buffer. Use at least 30 ml for all washes.

288


6. Dilute secondary antibody-AP (alkaline phosphatase) conjugate 1:5000 in blocking buffer (30 ml). Incubate with blot for 30–60 min. 7. Wash three times for 5 min each as in step 5, then rinse two times for 2 min with 1 assay buffer. 8. Drain blots by touching a corner on a paper towel, then place on plastic wrap on a flat surface (do not let blots dry). 9. Pipette a thin layer of CSPD solution containing 5% NitroBlock onto the blot and incubate for 5 min. 10. Drain excess substrate solution and wrap the blot in plastic sheets. Smooth out bubbles or wrinkles. 11. Blots may be imaged by placing them in contact with standard X-ray film. 3.5. Reverse Transcriptase Assay (RT Assay) to Measure Inhibition of HIV

Reverse transcriptase assays provide an inexpensive approach to quantify the amount of virus present in the sample (Fig. 20.2). RT assay is an indirect measure of virus particles present in sample; it measures the amount of viral protein reverse transcriptase, which is incorporated into the virions (5). 1. Culture supernatants from pNL4-3 transfected HeLa cells or PBMC infected with HIV-1 were used in the assay. In case of HIV-1-infected peripheral blood mononuclear cells, PBMC, cell culture supernatants were collected every third day. HeLa cells were transfected with 2 mg of pNL4-3 (HIV-1 molecular clone) using Lipofectamine—Lipofectamine plus reagent. Forty-eight hours post-transfection, the culture supernatant was collected and assayed for RT activity. 2. 10 ml of culture supernatant was mixed with 50 ml of RT assay buffer containing 32P dTTP (2 ml/ml of RT assay buffer). 3. The reaction mix was incubated for 2 h at 37C. Subsequently 10 ml of the reaction mix was spotted on DE81 paper and allowed to dry. 4. The paper was washed three times with 2 SSC buffer, dried, and used to expose a phosphorimaging plate. 5. The RT activity was quantified by phosphorimager FLA-7000 (Fuji Medical) and also using scintillation counter (Beckman).

4. Notes In order to use radioactive isotopes in RNA unwinding assay and RT assays, users should follow their institutional guidelines for safe use of radioactive compounds in research. The users must be certified and properly trained in the use of radioactivity.


289

Acknowledgments Research in KTJ’s laboratory is supported by intramural funds from NIAID, NIH, USA, and by the IATAP program from the office of the Director, NIH. References 1. Gorbalenya A. E. and Koonin E. V. (1989) Viral proteins containing the purine NTPbinding sequence pattern. Nucleic Acids Res. 17, 8413–8440. 2. Peterlin B. M. and Trono D. (2003) Hide, shield and strike back: how HIV-infected cells avoid immune eradication. Nat. Rev. Immunol. 3, 97–107. 3. Levin J. G., Guo J., Rouzina I., and MusierForsyth K. (2005) Nucleic acid chaperone activity of HIV-1 nucleocapsid protein: critical role in reverse transcription and

molecular mechanism. Prog. Nucleic Acid Res. Mol. Biol. 80, 217–286. 4. Yedavalli V. S., Neuveut C., Chi Y. H., Kleiman L., and Jeang K. T. (2004) Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function. Cell 119, 381–392. 5. Willey R. L., Smith D. H., Lasky L. A. et al. (1988). In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. J. Virol. 62,139–147.

Chapter 21 Molecular Characterization of Nuclear DNA Helicase II (RNA Helicase A) Suisheng Zhang and Frank Grosse Abstract Nuclear DNA helicase II (NDH II) was first isolated from calf thymus using a DNA-unwinding assay. Subsequently it has been shown to be a homologue of human RNA helicase A (RHA) and the maleless protein (MLE) from Drosophila. Accordingly, the protein possesses both DNA and RNA unwinding activities. Also, it can use all four NTPs or dNTPs to fuel the reaction. At its N-terminus it possesses two double-strand RNA binding domains (dsRBD I and II), while the C-terminus comprises an imperfect glycine (G)- and arginine (R)-rich repeat, a so-called RGG-box that preferably binds to ssDNA or ssRNA. Many proteins interact with NDH II both at its N- and C-terminus and thereby mediate transcriptional regulation, RNA processing, and transport, the DNA damage response and genome surveillance. The latter includes the histone variant g-H2AX and the Werner syndrome helicase (WRN). Here we describe experimental approaches to obtain mechanistic information about this important nuclear helicase. Key words: DDX9, MLE, NDH II, RHA, unwindase, helicase assays, helicase function, domain mapping, DNA helicase, RNA helicase, DEXH box, maleless (MLE), double-stranded RNA binding domain (dsRBD), RGG-box.

1. Introduction Nuclear DNA helicase II (NDH II), also known as RNA helicase A, DDX9, and MLE protein, belongs to the superfamily II of DEXH box helicases (1). In addition to the seven canonical helicase motifs (Ia, Ib to VI) of this family NDH II further contains three nucleic acid binding motifs, i.e., two N-terminal doublestrand RNA binding domains (dsRBDs) and a C-terminal RGGbox (2). While a contribution of these additional nucleic acid binding sites to the unwinding activity of NDH II remains unclear, there is some evidence for their involvement in targeting specific M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_21, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

291

292

Zhang and Grosse

nucleic acid structures and mediating protein–protein contacts (1, 3). Increasing evidence is emerging for clinical importance of this helicase, for example, in autoimmune diseases (4), in tumorigenesis (5), and in checkpoint control processes (6). NDH II seems also to be involved in the DNA damage response as suggested by its physical and functional interaction with the histone variant gH2AX (7) and the Werner syndrome helicase (8). WRN helicase is deficient in patients displaying a human progeria that leads to premature ageing and a predisposition to tumorigenesis (9). Despite the fact that NDH II was initially identified as a DNA helicase, some workers had difficulties in measuring its DNA but interestingly not its RNA unwinding activity. Although it is quite clear now that NDH II and its homologues can unwind both nucleic acid substrates equally well (10, 11), the obvious technical problems in studying DNA-unwinding induced us to provide detailed experimental protocols for a successful examination of the enzymatic properties of this essential enzyme. The procedures presented here can be adapted to RNA unwinding studies as well. In this case, however, further precautions, such as treating buffers with diethylpyrocarbonate and/or using RNase inhibitors such as RNasin, should be considered. Hopefully the detailed protocols given here will help to rapidly expand our knowledge on human NDH II and its orthologues from other higher eukaryotes such as worms, plants, and insects.

2. Materials 2.1. Chemicals and Solutions 2.2. Native and Recombinant Proteins

All chemicals were of at least analytical grade, the water was bidistilled, and all aqueous solutions were sterilized adequately before use. 1. Native NDH II can be purified from calf thymus by conventional chromatography (12). The final purification step may either be performed with ATP-agarose (12) or preferably with poly(rI)(rC)-agarose (11), the latter of which is currently not commercially available. A useful procedure for the preparation of poly(rI)(rC)-agarose is given by (13). Bovine NDH II obtained from conventional column purification consisted of two polypeptides of 130 and 100 kDa, representing degradation products with losses of the N- and C-terminal nucleic acid binding domains. Despite this, both degraded forms were active in nucleic acid unwinding and nucleic acid-stimulated ATP hydrolysis (12). Human NDH II can be easily expressed in insect cells as an N-terminal (His)6-tagged recombinant protein using the Bacmid technology (Life

Nuclear DNA Helicase II (RNA Helicase A)

293

Technologies) (2). Recombinant NDH II was purified by Ni2+-NTA-agarose and then by poly(rI)(rC)-agarose. These two steps are sufficient to yield more than 90% homogenous enzyme free of nucleases, which inevitably affect the helicase assay. To avoid nuclease contaminations, NDH II should be collected from the final elution step in individual fractions and those showing the highest purity (with regard to nuclease contaminations) should be used. Protein concentration was determined by densitometry after SDS-PAGE, using bovine serum albumin as a standard. The protein remains active for more than one year when stored at –20C in the presence of 50% glycerol. 2. The nucleic acid binding of domains of NDH II have been mapped by Northwestern blotting. To achieve this goal, fragments of NDH II were expressed as GST-fusion proteins as described before (2, 8). Alanine substitutions of phenylalanine 211 (F211A) or lysines 235 and 236 (K235A, K236A) of dsRBD II were introduced by PCR-based site-directed mutagenesis (14). The GST-fusion proteins were expressed in Escherichia coli followed by suspension of the bacteria from 2 ml culture medium in 500 ml of SDS-PAGE loading buffer (15), a brief sonication and heating at 95C for 5 min. The recombinant proteins can be stored at –20C for more than 1 year. 2.3. Oligonucleotides, Bacteriophage M13 Single-Stranded DNA (ssDNA) and Synthetic Homopolymeric Nucleic Acids

1. An oligodeoxyribonucleotide (50 -ACTCTAGAGGATC CCCGGGTACGTTATTGCATGAAAGCCCGGCTG,45mer) with 22 nucleotides complementary to M13mp 18’s position 6243–6264, and a non-complementary tail of 23 nucleotides at its 30 end was designed. The oligonucleotides should be of high quality and purified by electrophoresis, such as those from Purimex (Grebenstein, Germany). Small aliquots were stored at a concentration of 20 mg/ml in order to avoid repeated freeze and thaw cycles (see Note 1). 2. M13mp18 ssDNA was prepared as described (16), but can be also obtained commercially (GE-Healthcare). The DNA was dissolved in TE buffer (10 mM Tris–HCl, pH 8.0, and 1 mM EDTA) and its concentration was measured by optical absorbance at 260 nm where 1 optical density per cm (1 OD) equals 40 mg/ml M13-DNA. To avoid multiple freeze and thaw cycles, the DNA was divided into small aliquots at about 3 mg/ml (1 pmol/ml) for storage at –20C. 3. Poly(rI) or poly(rI)(rC) (GE-Healthcare).

2.4. Radioactive Labeling of the Nuclei Acids

1. 50 -end labeling of oligo- and polynucleotides was achieved by T4 polynucleotide kinase (New England BioLabs). 2. g-32P-ATP (5000 Ci/mmol) (GE-Healthcare).

294

Zhang and Grosse

3. 50 -end labeling buffer: 80 mM Tris–HCl, pH 7.4, 10 mM MgCl2, and 5 mM DTT. 4. To separate the free nucleotide from the labeled nucleic acid the spun column method employing Sephadex G-50 was used (14). Autoclaved and silanized glass wool was used as plug for 1-ml tuberculin syringes filled with column material. Alternatively, commercially available spun columns can be used (GE-Healthcare). 2.5. Preparation of the Helicase Substrate

1. DNA annealing buffer (2 ): 12 mM Tris–HCl, pH 7.5, 14 mM MgCl2, 100 mM NaCl, and 2 mM DTT. 2. Bio-gel A-5 M (Bio-Rad). 3. Bio-gel A-5 M chromatography buffer: 10 mM Tris–HCl, pH 7.5, 100 mM NaCl, and 0.5 mM EDTA.

2.6. Helicase Assays

1. 40% polyacrylamide gel solution with a ratio of 39–1 (acrylamide to bisacrylamide) prepared in water and stored at 4C. 2. 5 TBE buffer: 25 mM Tris–borate, pH 8.3, 2.5 mM EDTA. 3. Native polyacrylamide gels (15%) were prepared by mixing 3.75 ml of the 40% gel stock solution, 2 ml of 5 TBE, and water to a volume of 10 ml. 60 ml of 10% ammonium peroxidisulfate (APDS) and 5.5 ml N,N,N’,N’-tetramethylethylene diamine (TEMED) and 8 10 cm gels with a thickness of 1 mm were cast. Polymerization was allowed to complete at room temperature overnight, or, if necessary, at 37C for at least 4 h. 4. 5 helicase reaction buffer: 100 mM Tris–HCl, pH 7.5, 50% glycerol, 17.5 mM MgCl2, 500 mg/ml BSA, and 25 mM DTT; store at –20C. 5. A 100 mM ATP solution was prepared and neutralized using 1 M Tris–base and pH indicator sticks; store at –20C. 6. Helicase reaction stop buffer: 1% SDS, 200 mM EDTA, 50% glycerol, 0.1% bromophenol blue, and 0.1% xylene cyanole FF; store at –20C.

2.7. Filter Binding Assay

1. 96-well vacuum blotter (Millipore, Dassel, Germany) 2. Nitrocellulose membrane (Protran B85, 0.45 mm) with the size of the 96-well vacuum blotter (Millipore). 3. Filter binding buffer: 20 mM HEPES, pH 8.0, 50 mM NaCl, 1 mM DTT, and 1 mM EDTA. 4. The nitrocellulose membrane was pre-treated by incubation with 0.3 N NaOH for 10 min, washed two times for 5 min each with water, and then equilibrated with the above binding buffer for at least 16 h (see Note 2).


295

5. Whatman 3MM paper was cut out to yield the same size as the nitrocellulose membrane. The 3MM paper was equilibrated with binding buffer just before use. 2.8. Agarose Gel Shift Assay

1. Agarose (Life Technologies, GIBCO). 2. 1.5% agarose gel in 1 TBE buffer: 5 mM Tris–borate, pH 8.3, 0.5 mM EDTA. 3. Agarose gel shift loading buffer: 0.25% bromophenol blue, 0.25% xylene cyanol FF, and 30% glycerol in water (14).

2.9. Northwestern Blot

1. 10% SDS polyacrylamide gel (15). 2. Hybond-C nitrocellulose membrane (GE-Healthcare). 3. Proteins were electro-transferred from the SDS polyacrylamide gel to the nitrocellulose membrane using a semi-dry blot apparatus (e.g., from Sigma). 4. Transfer buffer: 25 mM Tris, 190 mM glycine, 0.1% SDS, and 20% methanol. 5. Hybond-C nitrocellulose membrane, cut to a similar size of the gel, was wetted with water, and then equilibrated with transfer buffer for 15 min before use. 6. Six sheets of Whatman 3MM paper, cut to the same size as the gel and equilibrated with transfer buffer. 7. Ponceau solution: 0.1% (w/v) Ponceau S in 10% (w/v) acetic acid. 8. TBS buffer: 25 mM Tris–HCl, pH 7.8, 140 mM NaCl, and 3 mM KCl. 9. 8 M urea in TBS solution. 10. Binding buffer: 10 mM HEPES, pH 8.0, 25 mM NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM DTT. 11. Blocking buffer: dissolve 5% (w/v) milk powder in binding buffer (see Note 6).

3. Methods 3.1. Preparation of DNA Helicase Substrate

1. The 45-mer deoxyoligonucleotide was 50 -labeled by T4 polynucleotide kinase in a 20-ml reaction mixture containing 20 pmol oligonucleotide, 60 mCi g-32P-ATP (18 pmol), and 20 units of T4 polynucleotide kinase in 50 -labeling buffer for 30 min at 37C. 2. At the end of the labeling reaction, the polynucleotide kinase was inactivated by heating at 65C for 15 min.

296

Zhang and Grosse

3. Free g-32P-ATP was removed from the labeled oligonucleotide by the spun column method (14). 4. The labeled oligonucleotide in the eluant of the spun column (100 ml) was mixed with 20 pmol M13mp18 ssDNA in 20 ml. 5. 120 ml 2 annealing buffer was mixed with the nucleic acids and water to a final volume of 240 ml. 6. Annealing proceeded by heating to 95C for 10 min, followed by incubation at 60C for 30 min, at 37C for 30 min, and finally at room temperature for 30 min. 7. The annealing mixture was loaded onto a Bio-gel A-5 M column (1 ml bed volume, Bio-Rad) pre-equilibrated with Bio-gel A-5 buffer and then eluted with the same buffer. 8. Fractions of 100 ml were collected. Elutions of the annealed DNA and the unannealed oligonucleotide were monitored by liquid scintillation counting. These measurements can be done with closed 0.25 ml eppendorf tubes placed into the scintillation bottles. 9. The eluted radioactive fractions in the void volume (the first peak) contained annealed DNA for the helicase assay. These fractions were not pooled in order to select the substrate with the highest specific radioactivity. 3.2. Helicase Assay

1. A 15% native polyacrylamide gel was prepared. 2. A 10-ml helicase reaction mixture was prepared to contain 20 mM Tris–HCl, pH 7.5, 10% glycerol, 3.5 mM MgCl2, 100 mg/ml BSA, 5 mM DTT, 6 mM (nucleotides) helicase substrate, 3 mM ATP, and up to 280 nM NDH II (see Note 4). 3. The reaction mixture was incubated at 37C for 30 min. 4. The reaction was terminated by adding 3 ml stop solution to the reaction mixture, and immediate chilling on ice. 5. The reaction mixture was loaded to the native polyacrylamide gel. 6. Electrophoresis was performed at 1 mA/cm constant current for about 45 min until the bromophenol blue marker reached the bottom of the gel. 7. The gel on one glass plate was wrapped into Saran wrap and then exposed at –80C to X-ray film or PhosphoImager screen. 8. Unwinding of dsDNA was determined according to the separation of the released oligonucleotide that migrated considerably faster than the annealed dsDNA, which remained at the upper position of the gel. The position of the free oligonucleotide can be referred to as a ‘‘heat control’’ obtained by


a)

297

b)

Fig. 21.1. Measurement of the DNA-unwinding activity of NDH II. (a) NDH II unwinds dsDNA in the presence of any one of the four common rNTPs or dNTPs. This is in contrast to the NDH II-copurifying helicase NDH I that prefers ATP or dATP. (b) Time-dependent unwinding activity of NDH II. Unwinding can be quantified as time- or enzyme concentrationdependent percentage of displaced oligonucleotide from the dsDNA substrate. The displacement can be determined by scintillation counting of the excised radioactive bands or by evaluation of the PhosphoImager signal (12).

denaturing the substrate at 95C for 5 min and subsequent chilling on ice with 3 ml stop solution. This releases the labeled oligonucleotide quantitatively from the ssDNA template. On the other hand, a control without addition of any protein provided the marker for the annealed substrate (Fig. 21.1). 3.3. Filter Binding Assay

1. Synthetic homopolymeric nucleic acids such as poly(rI) or poly(rI)(rC) were 50 -labeled by T4 polynucleotide kinase and g-32P-ATP following a similar molar ratio of nucleic acid to g-32P-ATP as described above for preparing the helicase substrate. A labeled M13 ssDNA was obtained by hybridization with a 50 -labeled oligonucleotide as described above for the helicase substrate. 2. 2 mM (nucleotides) of the nucleic acid probes were incubated with increasing amounts of NDH II (from 0 to 280 nM) in 10 ml binding buffer containing 20 mM HEPES, pH 8.0, 50 mM NaCl, 1 mM DTT, and 1 mM EDTA for 20 min at room temperature. 3. Meanwhile the 96-well vacuum blotter was mounted by placing the pre-treated nitrocellulose membrane over Whatman 3MM paper that was pre-equilibrated with binding buffer. A pre-filtration of the binding buffer through the membrane was examined to ensure that there was no blockage or leakage between the nitrocellulose membrane and the blotter.

298

Zhang and Grosse

4. The samples at the end of incubation were loaded to the slots of the blotter and then sucked through the nitrocellulose membrane using a vacuum pump. 5. The nitrocellulose membrane was washed under vacuum for three times each with 500 ml of binding buffer. 6. The vacuum blotter was dismantled and the nitrocellulose membrane was carefully removed to avoid any breakage or contamination. 7. The nitrocellulose membrane was dried and slots cut out according to the loading positions. 8. Nucleic acids retained on the membrane were measured by scintillation counting. 9. Nucleic acid binding was quantified according to nucleic acid retention as a function of the addition of NDH II. This provided an estimate of the nucleic acid binding constant as well as the binding length of NDH II (Fig. 21.2). a)

b)

Fig. 21.2. Nitrocellulose binding assay of NDH II. (a) Binding of NDH II to poly(rI)(rC). (b) Determination of the association constant of NDH II according to the binding data (11).

3.4. Gel Shift by Agarose Gel Electrophoresis

1. 1.5% agarose in TBE was melted in a microwave oven and cooled down to about 60C (a hot but hand endurable temperature). The agarose was poured into a 2-mm-thick space between two glass plates (20 20 cm), which can be slightly opened to facilitate filling. The comb was inserted at the top of the gel to a depth just enough for holding the sample volume (see Note 3). 2. A labeled M13 ssDNA probe as applied for the filter binding assay was used for the agarose gel shift assay.


299

3. 6 mM (nucleotides) M13 ssDNA were incubated for 20 min at room temperature with increasing amount (0–280 nM) of NDH II in 10 ml binding buffer as used for the filter binding assay. To measure the binding specificity, increasing amounts of nucleic acid competitors (1.5–15 mM nucleotides) were added. 4. At the end of incubation time samples were mixed with 3 ml of loading buffer and loaded to the agarose gel prepared in 1 TBE buffer. 5. Electrophoresis was performed in 1 TBE buffer at a low and constant voltage (10–30 V) for a period of 16–18 h (see Note 5). 6. Electrophoresis was stopped when the bromophenol blue dye reached the bottom of the agarose gel. 7. One glass plate was carefully removed to avoid damage of the agarose, which together with the other glass plate was packed into Saran wrap and then exposed to an X-ray film overnight at –80C (Fig. 21.3).

Fig. 21.3. Determination of single strand nucleic acids binding of NDH II by agarose gel electrophoresis. Binding of NDH II to ssDNA was competed by ssRNA but not by dsRNA (17).

3.5. Northwestern Blotting

1. 5–10 ml of bacterial lysates containing GST-fusion proteins were separated through a 10% SDS polyacrylamide gel. 2. After electrophoresis the proteins were transferred to a HybondC nitrocellulose membrane using a semi-dry blotter, which was assembled by placing in an order from the cathode (–) to the anode (+) three sheets of Whatman 3MM paper, the protein gel, the Hybond-C nitrocellulose membrane, and three sheets of Whatman 3MM paper. 3. Electrotransfer proceeded for 1 h at a current of 0.8 mA per cm2. 4. After electrotransfer, the nitrocellulose membrane was removed from the semi-dry blotter and stained with Ponceau S solution in a culture dish for a few minutes. The stained protein on the membrane was photographed.

300

Zhang and Grosse

5. The nitrocellulose membrane was washed with a few changes of TBS to remove the dye. 6. The membrane was placed into 8 M urea in TBS for 10 min, followed by ten steps of dilutions with TBS, i.e., by replacing after every 10 min one-third of the volume of the previous urea-containing TBS with TBS buffer without urea. During this procedure the protein undergoes partial renaturation. 7. After urea removal the membrane was blocked with 5% milk powder in binding buffer for 1 h at room temperature to saturate unspecific binding sites. 8. The membrane was incubated for at least 30 min with binding buffer in a minimum volume (10 ml) containing a nucleic acid probe, e.g., 50 -labeled poly(rI) or poly(rI)(rC). 9. After binding, the radioactive solution was removed and the membrane was washed three times for about 5 min each with binding buffer (see Note 7). 10. After washing the membrane was packed into Saran wrap and exposed to X-ray film for visualizing the nucleic acid binding signals (Fig. 21.4).

Fig. 21.4. Characterization of the nucleic acid binding domains of NDH II by Northwestern blots. (a) dsRNA binding of the N-terminal dsRBD I (aa 1–130), dsRBD II (aa 131–318) and dsRBD I+II (aa 1–318) of NDH II. Apparently, dsRBD II displayed a higher affinity to dsRNA than dsRBD I while dsRBD I + II bound co-operatively, i.e., binding to dsRBD I + II was stronger than that of either of the individual domain (2). (b) dsRNA binding of the three dsRBD II mutants F211A, K235A, and K236A (unpublished data). The K235A mutant completely abolished dsRNA binding. Note that the band at 66 kDa represents unspecific binding.


301

4. Notes 1. Repeated freezing and thawing cycles of the oligonucleotide may lead to a serious decrease in the efficiency of 50 -labeling and thus the sensitivity of the assay. Once this occurs, the oligonucleotide should be discarded and replaced by a new batch. 2. The described processing of the nitrocellulose membrane is necessary for an improvement of its flow rate. Without this pre-treatment a high background level and/or a variation of the retained nucleic acid can arise that might give wrong positive results. 3. A too cold agarose solution would be difficult to cast between the glass plates for vertical electrophoresis. Moreover, the well depth should be carefully controlled because the gel may be disrupted when a too deeply inserted comb is removed. 4. The storage buffer of NDH II contains 50% glycerol. Glycerol may inhibit the helicase activity when exceeding 10% in the assay mixture. 5. No attempt should be made to accelerate the speed of the gel shift by increasing the voltage for electrophoresis because an increased electric field might disrupt the protein–nucleic acid complex by denaturing the protein at temperatures above 37C. 6. Blocking buffer should always be prepared immediately before use because prolonged storage of this solution might lead to bacterial growth and, as a result contamination with bacterial nucleases that destroy the nucleic acid probe. 7. Too extensive washing may lead to a complete elimination of the radioactive signal whereas insufficient washing causes a higher background. This problem may be avoided by closely monitoring the radioactivity during the washing procedure using a Geiger counter so that the time to stop washing, usually judged by experience, can be adjusted.

Acknowledgments The work was supported by Deutsche Forschungsgemeinschaft Grant Gr 895/5-2. We are indebted to H. Pospiech for his critical comments.

302

Zhang and Grosse

References 1. Fuller-Pace F. V. (2006) DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res. 34, 4206–4215. 2. Zhang S. and Grosse F. (1997) Domain structure of human nuclear DNA helicase II (RNA helicase A). J. Biol. Chem. 272, 11487–11494. 3. Zhang S. and Grosse F. (2004) Multiple functions of nuclear DNA helicase II (RNA helicase A) in nucleic acid metabolism (review). Acta Biochim. Biophys. Sin. (Shanghai) 36, 177–183. 4. Takeda Y., Caudell P., Grady G., Wang G., Suwa A., Sharp G. C., Dynan W. S., and Hardin J. A. (1999) Human RNA helicase A is a lupus autoantigen that is cleaved during apoptosis. J. Immunol. 163, 6269–6274. 5. Toretsky J. A., Erkizan V., Levenson A., Abaan O. D., Parvin J. D., Cripe T. P., Rice A. M., Lee S. B., and Uren A. (2006) Oncoprotein EWS-FLI1 activity is enhanced by RNA helicase A. Cancer Res. 66, 5574–5581. 6. Schlegel B. P., Starita L. M., and Parvin J. D. (2003) Overexpression of a protein fragment of RNA helicase A causes inhibition of endogenous BRCA1 function and defects in ploidy and cytokinesis in mammary epithelial cells. Oncogene 22, 983–991. 7. Mischo H. E., Hemmerich P., Grosse F., and Zhang S. (2005) Actinomycin D induces histone gH2AX foci and complex formation of gH2AX with Ku70 and nuclear DNA helicase II. J. Biol. Chem. 280, 9586–9594. 8. Friedemann J., Grosse F., and Zhang S. (2005) Nuclear DNA helicase II (RNA helicase A) interacts and stimulates the

9.

10.

11.

12.

13.

14.

15.

16.

17.

exonuclease of Werner syndrome helicase (WRN). J. Biol. Chem. 280, 31303–31313. Hanada K. and Hickson I. D. (2007) Molecular genetics of RecQ helicase disorders. Cell Mol. Life Sci. 64, 2306–2322. Lee C.-G., Chang K. A, Kuroda M. I., and Hurwitz J. (1997) The NTPase/helicase activities of Drosophila maleless, an essential factor in dosage compensation. EMBO J. 16, 2671–2681. Zhang S. and Grosse F. (1994) Nuclear DNA helicase II unwinds both DNA and RNA. Biochemistry 33, 3906–3912. ZhangS.andGrosseF.(1991)Purificationand characterization of two DNA helicases from calfthymus.J.Biol.Chem.266,20483–20490. Fenner B. J., Goh W., and Kwang J. (2006) Sequestration and protection of doublestranded RNA by the betanodavirus b2 protein. J. Virol. 80, 6822–6833. Sambrook J., Fritsch E. F., and Maniatis T. (1989), in Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY. Harlow E., and Lane D. (1999), in Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY. Reckmann B., Grosse F., and Krauss G. (1983) The elongation of mismatched primers by DNA polymerase from calf thymus. Nucleic Acids Res. 11, 7251–7260. Zhang S., Herrmann C. and Grosse F. (1999) Pre-mRNA and mRNA binding of human nuclear DNA helicase II (RNA helicase A). J. Cell Sci. 112, 1055–1064.

Chapter 22 Regulation of Inter- and Intramolecular Interaction of RNA, DNA, and Proteins by MLE Hyangyee Oh, Andrew M. Parrott, Yongkyu Park, and Chee-Gun Lee Abstract Drosophila maleless (MLE) is a member of helicase superfamily 2 and functions as a dosage compensation factor essential for the development of male flies. This function provides a good opportunity to investigate diverse biochemical activities associated with MLE in the context of a defined in vivo pathway, i.e., the transcriptional activation of X-linked genes. We have shown for the first time that MLE catalyzes the unwinding of both DNA and RNA and that MLE helicase activity is essential for its in vivo function. Also, we have provided evidence that MLE stimulates the transcriptional activity of roX2 on the X chromosome. We have also found that MLE interacts with dsDNA, topoisomerase II, and nucleosome. This observation supports a current model of dosage compensation: transcriptional activation of X-linked genes is causally associated with conformational change in the male X chromosome, subsequent to the targeted association of the dosage compensation complex (DCC). Key words: Maleless (MLE), roX2, dosage compensation, topoisomerase II.

1. Introduction In Drosophila, dosage compensation is achieved by transcriptional activation of X-linked genes (1). To date, genetic analysis has identified eight transacting factors that are necessary for the onset or maintenance of dosage compensation. Based on observations that loss of their functional allele leads to a male-specific lethal phenotype, these factors are named the MSL (male-specific lethal) proteins. They include six protein factors such as MSL1 (2), MSL2 (3, 4), MSL3 (5), MLE (maleless) (6), MOF (male-absent on the first) (7), and JIL-1 (8) and two non-coding RNAs, roX1 and roX2 (RNA on X) (9, 10). M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_22, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

303

304

Oh et al.

It is generally believed that dosage compensation occurs in several discernible steps, starting with the targeted association of roX RNAs and MSL complex with the X chromosome. Upon the expression of MSL2 protein, MSL proteins assemble a complex on approximately 35 sites of the X chromosome, called ‘‘chromatin entry sites’’ (11–14). Once the chromatin entry sites are fully occupied with the MSL complex in the presence of MLE, the flanking chromatin region becomes competent in binding the MSL complex (15, 16). This ‘‘spreading’’ or ‘‘nucleation’’ process appears to require the histone acetyltransferase (HAT) activity of MOF (17). We have shown that mleGET, a mutant MLE defective in ATPase activity, leads to a poor association of the MSL complex with the male X chromosome and lethality in male embryos (18). In addition, MLE is also involved in the transcriptional activation of roX2 and its subsequent association with MSL complexes (17, 19). Detailed mechanistic understanding of dosage compensation has greatly advanced due to the employment of diverse biochemical assays. For example, dsRNA/dsDNA unwinding assays, ATPase, nucleotide UV-crosslinking, immunoprecipitation coupled with RT-PCR, and multiplex PCR and reporter gene assays have yielded important clues to the molecular basis of how ATP-dependent and ATP-independent activities of MLE contribute to dosage compensation.

2. Materials 2.1. Expression and Purification of Recombinant MLE

1. Sf9 cells (Invitrogen). 2. Grace’s Medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Sigma), 1% Pluronic F-68 solution (Sigma-Aldrich), and 1% penicillin-streptomycin (SigmaAldrich). 3. Chromatography resins: Pro-Bond1 (Invitrogen) and hydroxyapatite (Bio-Rad). 4. Hypotonic buffer: 50 mM Tris–HCl, pH 8.0, 10 mM KCl, 1.5 mM MgCl2, 20 mM Na2HPO4, pH 7.4, and 0.5 mM PMSF (phenyl methylsulfonate fluoride, Sigma-Aldrich). 5. Nuclei re-suspending (NS) buffer: 50 mM Tris–HCl, pH 8.0, 1.5 mM MgCl2, 20 mM Na2HPO4, pH 7.4, and 0.5 mM PMSF. 6. Column wash (CW) buffer: 20 mM sodium phosphate, pH 6.0, 0.5 M NaCl, and 0.5 mM PMSF. 7. Buffer P20: 20 mM sodium phosphate, pH 7.4, 0.5 mM PMSF, 0.05% Nonidet P-40 (Bufferad), and 10% glycerol.

Regulation of Inter- and Intramolecular Interaction

305

8. Buffer P250: 0.25 M sodium phosphate, pH 7.4, 0.5 mM PMSF, 0.05% Nonidet P-40, and 10% glycerol. 9. Buffer A250: 20 mM HEPES–NaOH, pH 7.4, 0.1 mM EDTA, 0.5 mM PMSF, 2 mM dithiothreitol (DTT), 0.25 M NaCl, and 12.5% glycerol. 10. Protease inhibitors: All reagents are from Sigma-Aldrich. (a) 0.5 M EGTA (1,000 ); store at room temperature. (b) A mixture of leupeptin (10 mg/ml) and aprotinin (10 mg/ml) in de-ionized H2O (500 ); store at –20C. (c) Pepstatin (1 mg/ml) in ethanol (100 ); store at –20C. 11. Dialysis tubing: Spectrapor1 membrane (Spectrum) (MWCO 6-8000). (a) Membranes are cut into pieces (15 cm) and autoclave in a beaker (2 l) containing 2% sodium bicarbonate and 1 mM EDTA for 10 min at 10 lb/in2. (b) Wash extensively with de-ionized H2O and repeat the autoclave. (c) After cooling, store the tubing at 4C. 12. Acrylamide:bis (30:1) stock solution: dissolve 30 g acrylamide (Invitrogen) and 1 g bis-N,N’-methylene-bis-acrylamide (Bio-Rad) in 100 ml of de-ionized H2O. Filter the solution through a 0.45-mm filter (Nalgene) and store it at 4C. 13. SDS-polyacrylamide gel: gels (7–12.5%) are prepared using a 30% acrylamide:bis (30:1) stock solution and 4 separation buffer (0.5 M Tris–HCl, pH 8.8, 0.4% SDS), whereas a stacking gel (4% acrylamide) is prepared using 4 stacking buffer (0.5 M Tris–HCl, pH 6.8, 0.4% SDS). 14. SDS sample buffer (5 ): 0.1 M Tris–HCl (pH 6.8), 0.5% SDS, 0.05% bromophenol blue (BPB), and 50% glycerol. 15. SDS-PAGE running buffer (10 ): dissolve 30.2 g Tris base, 144 g glycine, and 10 g SDS per liter. (It is not necessary to adjust the pH of the stock solution.) 2.2. Preparation of ssRNA and dsRNA

1. Plasmid DNAs: pSP65 (Promega), pGEM1 (Promega), pGEM3 (Promega), and pGEM3CS– (20). 2. Enzymes: SP6 RNA polymerase (Promega), T7 RNA polymerase (Promega), RNasin (Promega), RNase P1 (Boehringer Mannheim), U2AF (21), topoisomerase II (22) (Vaxron), and restriction endonucleases (New England BioLabs, NEB) such as PvuII, HaeII, RsaI, XbaI, and AccI. 3. Light box, permanent marker, and disposable micropestles (Eppendorf). 4. Circular glass fiber filter paper (25 mm diameter): GF/C (Enzo).

306

Oh et al.

5. Trichloroacetic acid (Fisher): prepare 10 and 1% solutions (w/v) in de-ionized H2O and store at 4C. 6. Carrier DNA solution: dissolve 25 mg salmon sperm DNA (Sigma-Aldrich) in 50 ml of 5 mM sodium pyrophosphate (pH 7.0), sonicate 6–8 times for 15 s using a microtip probe on ice until it gets pipettable, and then store at 4C. 7. Formamide dye mix (2 ): to 10 ml formamide, dissolve 10 mg xylene cyanol FF (XC) and 10 mg BPB. 8. Native dye mix (5 ): 0.1 M Tris–HCl (pH 7.4), 0.05% XC, 0.05% BPB, 0.1% Nonidet P-40, and 50% glycerol. 9. Denaturing polyacrylamide gel (about 18 20 cm): using 30% acrylamide:bis stock solution and 5 TBE, prepare a 10% denaturing gel containing 50% urea and 0.5 TBE. 10. Native polyacrylamide gel (about 18 20 cm): using 30% acrylamide:bis stock solution and 5 TBE, prepare an 8% native gel containing 0.5 TBE. 11. Electrophoresis mobility shift assay (EMSA): (a) Prepare 5–10% acrylamide/5% glycerol composite gel about 1.5 h before use, using a 30% acrylamide stock solution (see Section 2.1, step 12), 50% glycerol (v/v), and 5 TBE buffer. (b) Pre-run the gel for at least 30 min at constant 20 mA. 12. Load the reaction mixture, continue the electrophoresis until BPB migrates about two-thirds of the gel. 13. DNA/RNA hybridization buffer: 50 mM Tris–HCl (pH 8.0), 0.5 M NaCl, 0.1 mM EDTA, and 0.5% SDS. 14. Extraction buffer (2 ): 1 M ammonium acetate, 10 mM EDTA, and 0.2% SDS. 15. RNA/DNA dilution buffer: 20 mM HEPES–NaOH (pH 7.4), 50 mM KCl, 0.5 mM EDTA, 0.01% Nonidet P-40, and RNasin (Promega) (250 units/ml). 16. TBE (5 ): per liter, add 54 g Tris base, 27.5 g boric acid, and 20 ml 0.5 M EDTA (pH 8.0). 17. Reaction termination buffer (5 ): 0.1 M Tris–HCl (pH 7.4), 50 mM EDTA, 0.1% BPB, 0.1% XC, and 0.1% NP-40, 0.5% SDS, and 50% glycerol. 2.3. Preparation of dsDNA

1. Plasmid DNA: pBluescriptIIKS– (Stratagene). 2. Enzymes: T4 polynucleotide kinase and Klenow fragment (NEB); Taq DNA polymerase (NEB). 3. -32P-dCTP and g-32P-ATP: Specific radioactivity, 3,000 Ci/ mmol.


307

4. 1 TBS: 50 mM Tris-–HCl, pH 8.0, 150 mM NaCl, and 0.1 mM EDTA. 5. Sephadex G-50 (Amersham Biosciences) in 1 TBS. 6. Duplex DNAs for the helicase assay are prepared using the following synthetic DNAs dissolved in de-ionized H2O at 100 nM: (a) 98-mer; 50 -GAATA CAAGC TTGGG CTGCA GGTCG ACTCT AGAGG ATCCC CGGGC GAGCT CGAAT TCGGG TCTCC CTATA GTGAG TCGTA TTAAT TTCGA TAAGC CAG-30 (b) 38-mer; 50 -GAATA CACGG AATTC GAGCT CGCCC GGGGA TCCTC TAG-30 (c) 5/30-mer; 50 -AGAGT CGACC TGCAG CCCAA GCTTG TATTC-30 (d) 5COM/30-mer; 50 -GAATA CAAGC TTGGG CTGCA GGTCG ACTCT-30 (e) 3/30-mer; 50 -CTGGC CGACT CATCA-30

TTATC

GAAAT

TAATA

7. For the preparation of dsDNA substrate for EMSA, prepare the following DNA primers: (a) T3 and T7 primers (Stratagene). (b) ProxA; 50 -TTGGA ATCCC GCTAT TTTCG GATTC ATGCA GTTCC CATTA TATTT TATTC GGTA-30 . (c) ProxB; 50 -TACCG AATAA AATAT AATGG GAACT GCATG AATCC GAAAA TAGCG GGA-30 . 2.4. ATPase Assay

1. g-32P-ATP (MP 3,000 Ci/mmol.

Biochemicals):

specific

radioactivity,

2. RNAs: Yeast tRNA (Roche) and RNA homopolymers such as poly(A), poly(U), poly(G), and poly(C) (GE Healthcare) are dissolved in DEPC-treated H2O at 10 mg/ml and stored in aliquots at –20C. 3. DNA homopolymers: Poly(dA), poly(dT), poly(dC), and poly(dG) (GE Healthcare) are dissolved in de-ionized H2O (10 mg/ml) and stored in aliquots at –20C. 4. Thin layer chromatography (TLC) plate: cellulose PEI-F plate (J.T. Baker). 5. TLC buffer: 1 M formic acid and 0.5 M LiCl. 6. TLC developing tank with lid (27 7 25 cm) (Kontes). 2.5. Nucleotide UVCrosslinking and Western Blotting

1. -32P-GTP (MP 3,000 Ci/mmol.

Biochemicals):

specific

radioactivity,

308

Oh et al.

2. 96-well plate (round bottom): Flexible and untreated PVC (Costar). 3. Western transfer buffer (1 ): per liter, dissolve 5.8 g Tris base, 29 g glycine, 1 g SDS, and 200 ml methanol. 4. PVDF filter: Immobilon-P (Millipore). Cut the filter into appropriate sizes and submerge it in methanol for 10 min followed by Western transfer buffer for additional 10 min. 5. Blocking solution: 5% non-fat dry milk (Carnation) in 1 PBST. 6. Secondary antibody: anti-mouse and anti-rabbit IgGs conjugated with horseradish peroxidase (Amersham Biosciences). 7. Enhanced chemiluminescent (ECL) reagents (Amersham Biosciences) and Bio-Max ML film (Kodak). 8. DE-81 and Whatman-3 M paper (Whatman). 2.6. Immunoprecipitation and RT-PCR Analysis

1. 1 Extraction buffer: prepare a fresh buffer consisting of 20 mM HEPES–NaOH (pH 7.6), 70 mM KCl, 2 mM DTT, 0.1% NP-40, 1 mM PMSF, and 1 unit/ml RNasin (Promega), and protease inhibitor (1 ) (see Section 2.1, step 10). 2. Polyclonal antibodies: rabbit pre-immune sera and polyclonal antibodies specific for MLE or MSL1 (13). 3. Protein A-Sepharose (50% slurry) (Sigma-Aldrich). 4. Lysis buffer for total RNA isolation: Ultraspec reagent (Biotecx). 5. RNase-free DNase RQI (1 unit/ml) and 10 DNase I buffer (Promega). 6. SuperScript II RT and 10 Advantage II PCR buffer (Clontech). 7. Taq DNA polymerase (NEB). 8. 100 mM dNTP set (Amersham Biosciences). 9. PCR primers roX2-5/rox2-3; 50 -TTGGC ATTTT GCTCT TGTTT TTCTC-30 /50 -CGTTA CTCTT GCTTC ATTTT GCTTC G-30 .

2.7. Multiplex PCR and Reporter Gene Assays

1. Expression vectors: pMT/V5-b-galactosidase (Invitrogen), pMT-MLE (19), and pMT-MSL1 (19). 2. A reporter construct: Prox2-luciferase (19). 3. S2 cells (Invitrogen): cells are grown in Drosophila-SFM (Invitrogen).


309

4. Transfection reagents: Prepare 2 M CaCl2 and 2 HBS (50 mM HEPES–NaOH, pH 7.05, 1.5 mM Na2HPO4.2H2O, 280 mM NaCl, 10 mM KCl, and 12 mM dextrose) (adjust pH with 1 N HCl or 1 N NaOH if necessary) and store them in aliquots at –20C. 5. Copper sulfate solution (100 ): Prepare 100 mM solution and store it at room temperature. 6. 1 luciferase lysis buffer: 50 mM potassium phosphate, pH 7.4, 0.2% Triton X-100, 2 mM DTT, and 5 mM b-glycerophosphate. 7. Spin column (Qiagen). 8. PCR primer sets: Prepare the following primer sets (100 mM) in TE buffer: (a) MSL1-5/MSL1-3; 50 -GAAGA TCTAT GAGCG CCA30 /50 -CTGCT TTAAT TCCTC ATTCT GCG-30 . (b) DSRPK1-3/dSRPK11-5; 50 -GATGA ATGCA ACGTC CACGT AAAG-30 /50 -CATCC TTTTG CGACC ACTCG TAC-30 . (c) MLE-5/MLE-3; 50 -CAAAA CCTCG GTGAA TTGCA GCAA-30 /50 -CTGAT CCTCT ATTGC TTTCA-30 . (d) RoX2-5/rox2-3 (see Section 2.6, step 9).

3. Methods Diverse in vivo and in vitro assays make possible investigations into the biochemical basis by which MLE brings about a twofold increase in the transcription activity of numerous genes on the male X chromosome. For example, by employing recombinant MLE, it can be determined whether the in vivo interaction between MLE and roX2 RNA is dependent on the ATPase or helicase activity of MLE, and whether the conformation of bound roX2 RNA is subject to MLE helicase activity. Conversely, how the association of roX2 influences the ATPase and helicase activities of MLE or its interaction with specific DNA (19) or with non-specific DNA (23) can be explored. Once the minimal roX2 RNA binding region is identified, in vivo reporter gene assays will enable us to address the above issues from the aspect of transcription regulation of X-linked genes, an in vivo context that mimicks dosage compensation.

310

Oh et al.

3.1. Expression and Purification of Recombinant MLE Using Baculoviruses

1. Sf9 cells, in exponential growth phase, are centrifuged at 800 g for 15 min and are re-suspended in fresh Grace’s medium to a density of 2 106 cells/ml. About 1 109 Sf9 cells in 0.5-l medium are needed for a reproducible and reliable yield of recombinant MLE. 2. Infect Sf9 cells with baculoviruses at 5.0 MOI (multiplicity of infection) in a 2-l culture flask, and incubate them in a refrigerated incubator at 27C, while stirring at 100 rpm. 3. Two days later, cells are centrifuged at 800 g for 15 min and washed once with ice-cold 1 PBS containing 1 protease inhibitors. After centrifugation, decant the supernatant and measure the packed cell volume (PCV), which is typically approximately 5–6 ml. All subsequent purification steps should be processed at 4C. 4. Re-suspend Sf9 cells in 2.5 PCV of ice-cold hypotonic buffer supplemented with 1 protease inhibitors. 5. After incubation for 15 min on ice, cells are disrupted by homogenization: 10 strokes using a type B pestle. 6. Homogenate is cleared by centrifugation at 2,000 g for 10 min. Pellet, containing nuclei, is re-suspended in 1.5 PCV of NS buffer with 1 protease inhibitors. 7. Quickly add 1/10 volume of 5 M NaCl to nuclear and cytoplasmic fractions, and incubate them on a nutator for 20 min. 8. Clear the mixtures by centrifugation at 15,000 g for 30 min. 9. Pool the clear supernatants in a tube containing Pro-Bond1 resin (4 ml) pre-equilibrated with NS buffer containing 0.5 M NaCl. 10. After overnight incubation on a nutator, pack the resin into a column, and wash the column resin with 60 ml of CW buffer. 11. Bound proteins, including MLE, are eluted with a linear gradient (50 ml) of 0–0.5 M imidazole in CW buffer in a total of 40 fractions (1.2 ml/fraction). 12. Aliquots (5 ml) of fractions are subject to a 7.5% SDS-PAGE (Fig. 22.1), and fractions enriched in MLE are pooled and dialyzed overnight against 2 l of buffer P20 containing 20% glycerol and 1 mM DTT. 13. The following day, pooled fractions are loaded onto a hydroxyapatite column (3 ml) equilibrated with buffer P20 containing 0.2 M NaCl. 14. Bound proteins are eluted with a linear gradient (60 ml) of 20–250 mM Na phosphate, pH 7.4, using buffer P20 and P250 containing 0.25 M NaCl, in a total of 60 fractions.


311

Fig. 22.1. Purification of hexahistidine-tagged MLE using a Ni+-conjugated Pro-Bond column. Clear cell lyate, prepared from Sf9 cells infected with baculoviruses, was loaded onto the column, and bound proteins were eluted with a linear gradient of imidazole (0–0.5 M) as described in Section 3.1, step 11. Aliquots (5 ml) of the following fractions were resolved on a 7.5% SDS-PAGE, and proteins were visualized by Coomassie blue staining. Hexahistidine-tagged MLE (145 kDa) is indicated by arrowhead. L, clear cell lysate; FT, flow-through fraction; W1, supernatant fraction obtained from the first batchwise wash; W2, supernatant fraction obtained from the second batch-wise wash; 3–33, fractions eluted with the indicated imidazole gradient.

15. Aliquots (10 ml) of fractions are resolved on a 7.5% SDSPAGE, and fractions enriched in MLE are pooled, dialyzed against 2 l of buffer A250, and stored in aliquots at –70C. 3.2. Preparation of ssRNA and dsRNA

1. A standard helicase substrate, a partial dsRNA, is prepared using two in vitro transcription reactions. The first reaction (100 ml), which is for 32P-labeled 38-mer RNA, is set up with 10 ml of 10 reaction buffer (provided by Manufacturer), 5 mM DTT, 20 units RNasin, 2.5 mg pSP65 cut with XbaI, 0.5 mM ATP, 0.5 mM CTP, 0.5 mM UTP, 50 mM GTP, and 40.7 ml -32P-GTP. The second reaction, for a longer 98-mer RNA, is assembled essentially the same way except it is provided with 2.5 mg pGEM1 cut with PvuII, 0.5 mM GTP, and 0.5 ml -32P-GTP (see Fig. 22.2 and Note 1). 2. After incubation for 100 min at 37C, reactions are terminated by the addition of 100 ml of 1 RNA/DNA extraction buffer, which is followed by conventional phenol/chloroform and chloroform extraction. 3. To the aqueous phase recovered in step 2, add glycogen (20 mg) and 2.5 volume of ice-cold ethanol, mix well, and place in powdered dry-ice. 4. After 5 min incubation (see Note 2), centrifuge the mixture at 12,000 g for 15 min at 4C and discard the supernatant using a pipette.

312

Oh et al.

Fig. 22.2. Preparation of dsRNA and dsDNA substrates. (A) DNA templates and RNA polymerases necessary for the preparation of dsRNA substrates are summarized relative to upper or lower RNA strand constituting each dsRNA. For example, 52-nt long upper strand of 50 -tailed dsRNA is synthesized in a transcription reaction provided with pGEM3SacI and SP6 RNA polymerase, whereas a 46-nt long lower strand is prepared using pGEM3-AccI and T7 RNA polymerase. RNA polymerases used are indicated in parenthesis. (B) An autoradiogram shows the position of indicated dsRNA and dsDNA substrate relative to xylene cyanol (XC) and bromophenol blue (BPB) on an 8% native polyacrylamide gel (30:1). In lanes 1–2, the sequence and structure of dsRNA and dsDNA are same as RNA-a in Fig. 22.2A. Flushed-ended dsRNA (29 bp) (lane 3) and dsDNA (30 bp) (lane 4) are described in Sections 3.2 and 3.3, respectively.

5. Wash the pellet with ice-cold 70% ethanol and repeat the centrifugation. 6. Air-dry the pellet, and dissolve it in 10 ml of formamide dye mix by incubating for at least 15 min at 37C. 7. After heating 5 min at 95C, resolve RNA on a 10% denaturing polyacrylamide gel.


313

8. When BPB migrates about two-thirds of the gel, remove the top glass plate and cover the gel with plastic wrap on top of the bottom glass plate. 9. Inside a darkroom, overlay the covered gel on an X-ray film. 10. After 1–2 min exposure, develop X-ray film. 11. Place the developed X-ray film on a light box, overlay the gel with the glass plate facing the X-ray film, and mark the gel area containing RNA. 12. Cut out the marked gel area and transfer it to a microcentrifuge tube containing 0.4 ml of 1 RNA/DNA extraction buffer. 13. Thoroughly grind the gel piece using a micropestle, and incubate it on a nutator for 2 h at room temperature. 14. Centrifuge at 12,000 g for 5 min, and transfer the supernatant into a new tube. 15. Isolate 32P-labeled RNA following the procedures described in steps 2–5. 16. Dissolve the RNA pellets as follows. (a) To prepare ssRNA, dissolve the 38-mer RNA in 100 ml DNA/RNA dilution buffer, and go to step 17. (b) To prepare dsRNA, dissolve 38-mer and 98-mer RNAs in 50 ml DNA/RNA hybridization buffer and go to step 18. 17. Measure the radioactivity with 1 ml aliquot using the liquid scintillation counter. By adding extra volume of DNA/RNA dilution buffer, adjust the specific radioactivity of ssRNA solution to be either 50,000 cpm/ml (equivalent to 25 fmol ssRNA/ml) or 100,000 cpm/ml, and store 38-mer RNA in aliquots at –20C. 18. Combine 38-mer RNA with 98-mer RNA, and using a PCR instrument, incubate the mixture as follows: 95C for 5 min, 75C for 1 h, 68C for 3 h, 55C for 0.5 h, 45C for 0.5 h, 37C for 0.5 h, and 25C for 10 min. 19. Add equal volume of 2 DNA/RNA extraction buffer, adjust the final volume of the sample to 400 ml with 1 DNA/RNA extraction buffer, and isolate RNAs following the procedures described in steps 3–5. (a) To prepare a partial dsRNA (Fig. 22.2A), dissolve the RNA pellet in 10 ml of 1 Native dye mix and go to step 20. (b) To prepare flush-ended dsRNA, re-suspend the RNA pellet in 100 ml of DNA/RNA dilution buffer and go to step 22. 20. After pre-running an 8% native polyacrylamide gel for 30 min at 20 mA, load the RNA sample, and then follow the procedures described in steps 8–15 (Fig. 22.2B).

314

Oh et al.

21. The dsRNA is re-dissolved in 100 ml DNA/RNA dilution buffer and store them after adjusting the specific radioactivity to be either 50,000 or 100,000 cpm/ml as described in step 17. 22. Add 5 mg of RNase P (1 mg/ml), incubate at 37C for 90 min, and re-isolate the flush-ended dsRNA following the procedure described in step 19 (Fig. 22.2B). 23. Re-dissolve the flush-ended dsRNA as described in step 17. 3.3. Preparation of dsDNA Substrates for the Helicase Assay

1. Set up end-labeling reaction (25 ml) as follows: 2.5 ml 10 polynucleotide T4 Kinase buffer (provided by NEB), 0.5 ml (10 units) T4 polynucleotide kinase, 1 ml 0.1 M DTT, and 25 pmol of a synthetic DNA oligomer (38-mer, 5/30-mer, or 3/30-mer described in Section 2.3, step 6). 2. After 30 min incubation at 37C, continue the incubation for an additional 30 min at 65C and subsequently transfer the reaction mixture on ice. 3. Determine the labeling efficiency as follows: (a) Take 0.5 ml aliquot of each reaction and mix it with 100 ml carrier DNA solution in a new tube on ice. (b) Fill-up the tube with 10% TCA, and incubate it on ice for 20 min, during which, GF/C filter is thoroughly hydrated with de-ionized H2O. (c) Place the GF/C filter on meshed filtration funnel. (d) While applying a mild vacuum, collect the DNA precipitate by filtering the mixture through GF/C filter. (e) Wash the filter with 10 ml 1% TCA and 10 ml 95% ethanol. (f) Dry the filter and measure the radioactivity. (g) Calculate the specific radioactivity of DNA using the following formula: Specific radioactivity per 50 fmol of labeled DNA = Observed cpm 0.1. (h) By adding unlabeled DNA, adjust the specific radioactivity to be either 50,000 or 100,000 cpm per 50 fmol of ssDNA. 4. To the above reaction mixture, add 5 ml 1 M Tris–HCl, pH 8.0, 10 ml 5 M NaCl, 1 ml 10% SDS, 0.2 ml 0.5 M EDTA, and unlabeled complementary DNA as follows: (a) To prepare a partial dsDNA, 30 -tailed or 50 -tailed dsDNA (Fig. 22.3), add 200 pmol 98-mer ssDNA to the reaction mixture containing 32P-labeled 38-mer, 3/30-mer, or 5/ 30-mer DNA, respectively. (b) To prepare a flushed-ended dsDNA, add 200 pmol 5COM/30-mer to the reaction mixture containing 32 P-labeled 5/30-mer.


315

Fig. 22.3. dsDNA substrates used for the determination of the directionality of helicasecatalyzed unwinding reaction. Helicase reactions were carried out with four different DNA substrates (A–D), as described in Section 3.8. Lane 1, DNA substrate alone; lane 2, boiled substrate; lane 3, 10 ng MLE without ATP; lanes 4–6, 2.5, 5, and 10 ng MLE with ATP, respectively.

5. After adjusting the final volume to 200 ml, the mixture is subject to hybridization reaction as described in step 18 of Section 3.2, and dsDNA formed is isolated following the procedures described in steps 19–21 of Section 3.2 (Figs. 22.2b and 22.3). 3.4. Preparation of Non-specific dsDNA Probes for EMSA

1. Six to ten standard PCR reactions (50 ml each), containing 1 ng pBS, 50 pmol T3 primer, and 50 pmol T7 primer, are incubated at 95C for 3 min, followed by 35 cycles of (95C for 30 s, 55C for 1 min, and 72C for 2 min). 2. Combine all reactions in one microcentrifuge tube and isolate PCR product by conventional phenol/chloform and chloroform extraction followed by ethanol precipitation. 3. Dissolve the DNA pellet in 50 ml TE buffer, re-purify the DNA using a spin column (Qiagen), and determine the DNA concentration using a UV spectrometer (1.0 OD260 equals 50 mg/ml). 4. Treat 1.1 mg (10 pmol) DNA with ClaI, (EcoRI + NotI) or (EcoRI + XbaI) to prepare a mixture of dsDNAs of varying length such as (65 þ 104 bp), (41 þ 50 þ 84 bp), or (34 þ 57 þ 84 bp) DNAs, respectively (Fig. 22.4A). Subsequently, re-purify the mixture of DNA fragments following the procedure described in steps 19 and 20 of Section 3.2, and re-suspend in 10 ml TE buffer.

316

Oh et al.

Fig. 22.4. Coupling of PCR with end-filling reaction to prepare dsDNA substrates. (A) A 167-bp long dsDNA was prepared by PCR using pBluescriptIIKS– and T3/T7 primers. Subsequent to digestion with the indicated restriction enzymes, end-filling reactions, provided with Klenow fragment and deoxynucleotides, yield radiolabeled dsDNAs, shown as filled-bars. (B) Two major 32P-labeled DNAs of predicted length, obtained from each end-filling reaction, were detected by autoradiography subsequent to electrophoresis on an 8% native polyacrylamide gel (30:1).

5. End-label the mixture of DNA fragments (10 pmol) in a fill-in reaction (50 ml), containing 5 ml 10 reaction buffer (provided by manufacturer), 2 ml 2 mM dATP/dCTP/dGTP, 15 ml (50 pmol) -32P-dCTP, 10 units Klenow enzyme, and 10 pmol DNA. After 30 min incubation at room temperature, add 2 ml 0.5 M EDTA and transfer on ice. 6. Determine the specific radioactivity of end-labeled DNA by TCA precipitation following the procedure described in Section 3.3, step 3. 7. Gel-purify the labeled DNAs as described in steps 19–21 of Section 3.2 (Fig. 22.4B). 3.5. Preparation of Specific dsDNA Probes for EMSA

1. ProxA (20 pmol) (1 ml) and ProxB (25 pmol) (1 ml) (see Section 2.3, step 7) are added to a mixture (34 ml) containing 5 ml 10 NEB buffer I (0.1 M Bis Tris propane-HCl, pH 7.0, 0.1 M MgCl2, and 10 mM DTT). 2. Incubate the above mixture at 94C for 5 min, 63C for 8 h, and then slowly cool down to room temperature.


317

3. Supplement the mixture with 1 ml 0.1 M DTT, 2 ml 2 mM dATP/dGTP/dTTP, 1 ml 0.1 mM dCTP, 10 ml -32PdCTP, and 10 units of Klenow enzyme. 4. After 30 min incubation at room temperature, add 2 ml 0.5 M EDTA and transfer on ice. 5. Determine the specific radioactivity of end-labeled Prox DNA by TCA precipitation following the procedure described in Section 3.3, step 3. 6. The reaction mixture is loaded onto a G-50 column (5 ml) equilibrated with 1 TBS. 7. Elute the sample, collecting 200 ml fractions in microcentrifuge tubes. 8. Determine the distribution of 32P-labeled Prox DNA by determining the radioactivity of all fractions through Cerenkov counting (i.e., measurement of the radioactivity without using counting cocktail). It should be noted that Prox is reproducibly recovered in fractions 9–11. 9. Pool the peak fractions, and store in aliquots (50 ml) at –20C. 3.6. ATPase Assay

1. Prepare a master reaction mixture for ‘‘N’’ number of reactions as follows: (a) Mix ‘‘N+2’’ volumes of the following reagents: 0.3 ml 1 M HEPES–NaOH (20 mM)*, pH 7.4, 0.3 ml 0.1 M DTT (2 mM), 0.9 ml 50 mM MgCl2 (3 mM), 0.75 ml 1 mM ATP (50 mM), 0.3 ml (3 mCi) g-32P-ATP, 0.2 ml 1 mg/ml homopolymer RNA or DNA**, 0.15 ml 10 mg/ml bovine serum albumin (BSA) (0.1 mg/ml), and 7.1 ml de-ionized H2O. The final volume of the master mix should be (N+2) 10 ml. *; The final concentration of each component in the reaction mix (15 ml) is given in parentheses. **; If necessary, RNA or DNA homopolymer can be omitted in the master mix. (b) Dispense 10 ml aliquots into ‘‘N’’ number of microcentrifuge tubes. Add recombinant MLE (5–40 ng) and if needed, additional protein factors and RNA/DNA cofactors, and adjust the final reaction volume to 15 ml by adding de-ionized H2O. 2. After 0–60 min incubation at 37C, transfer the reaction mixture on ice, and aliquots (0.5 or 1 ml) of each reaction are spotted onto a PEI-F plate (about 15–18 samples per plate at about 2.5 cm from the bottom). 3. ATP and Pi are separated by chromatography for about 45 min in a TLC developing tank containing 75–100 ml TLC buffer (the buffer level should be kept lower than the line of spotted samples).

318

Oh et al.

4. Dry the TLC plate, and locate and quantify Pi and ATP using a Phosphorimager. Note that the specific radioactivity of ATP is 8,800 cpm/pmol. 3.7. Nucleotide UV-Crosslinking Assay

1. Prepare a master reaction mixture for ‘‘N’’ number of reactions as follows: (a) Mix ‘‘N+2’’ volumes of the following reagents: 0.4 ml 1 M HEPES–NaOH (20 mM)*, pH 7.4, 0.4 ml 0.1 M DTT (2 mM), 1.2 ml 50 mM MgCl2 (3 mM), 0.2 ml 1 mM GTP (10 mM), 0.2 ml (2 mCi) -32P-GTP, 0.2 ml 10 mg/ml bovine serum albumin (BSA) (0.1 mg/ml), and 7.4 ml de-ionized H2O. *; The final concentration of each component in the reaction mix (20 ml) is given in parentheses. (b) Dispense 10 ml aliquots into a 96-well assay plate. Add recombinant MLE (5–40 ng) and if needed, additional protein factors and RNA/DNA cofactors, and adjust the final reaction volume to 20 ml by adding de-ionized H2O. 2. After 10 min incubation on ice, irradiate for 10 min on ice with a UV-light source (254 nm) from 10 cm above the open plate. 3. Add 5 ml SDS sample buffer to each well, incubate for 5 min at 95C, and aliquots (10 ml) of each reaction are resolved by a 10% SDS-PAGE at 25 mA for 2.5 h. 4. After overnight fixation in a mixture of methanol and acetic acid (each 10%), the gel is dried on DE-81 paper under vacuum, and the GTP-MLE complex is visualized by autoradiography and quantified using a Phosphorimager.

3.8. Helicase Assay

1. Prepare a master reaction mixture for ‘‘N’’ number of reactions as follows: (a) Mix ‘‘N+2’’ volumes of the following reagents: 0.4 ml 1 M HEPES–NaOH (20 mM)*, pH 7.4, 0.4 ml 0.1 M DTT (2 mM), 1.2 ml 50 mM MgCl2 (3 mM), 2 ml 10 mM ATP (1 mM), 0.2 ml 10 mg/ml BSA (0.1 mg/ml), 1 ml 32Plabeled dsRNA or dsDNA substrate (50 fmol/reaction), 0.05 ml 40 U/ml RNasin (2 U/reaction), and 4.75 ml deionized H2O. The final volume of the master mix should be (N+2) 10 ml. *; The final concentration of each component in the reaction mix (20 ml) is given in parentheses. (b) Dispense 10 ml aliquots into ‘‘N’’ number of microcentrifuge tubes. Add recombinant MLE (5–40 ng) and if needed, additional protein factors such as topoisomerase II and RNA/DNA cofactors (Fig. 22.5), and adjust the final reaction volume to 20 ml by adding de-ionized H2O.


319

Fig. 22.5. Influence of homopolymer RNA and topoisomerase II on MLE. (A) Helicase reaction was performed with a partial dsRNA substrate (25 fmol) (see Fig. 22.2B, lane 1), 10 ng MLE in the absence (lane 2) or presence of 60 fmol (lanes 3 and 5) or 300 fmol (lanes 4 and 6) homopolymer RNA. (B) Helicase reaction was provided with the indicated RNA homopolymer (300 fmol), 10 ng MLE, and increasing amounts (12.5 and 25 ng) of topoisomerase II. In (A) and (B), lane 1 shows the control helicase reaction containing dsRNA substrate alone.

2. After 30 min incubation at 37C, transfer the reaction mixture on ice, mix it with 5 ml of reaction termination buffer (see Note 3), and warm it to room temperature. 3. Aliquots (10 ml) of each reaction are loaded onto a 10% native polyacrylamide (30:1) gel and electrophoresed in 0.5 TBE at 19 mA until BPB migrates about two third of the gel (it usually takes 1.5–2 h). 4. The gel is then completely dried on top of DE-81 paper under vacuum at 80C. 5. Unwound ssRNA or ssDNA is visualized by autoradiography (Fig. 22.5). In addition, locate and quantify duplex substrates and unwound product using a Phosphorimager. 3.9. RNA/DNA EMSA

1. Prepare the master reaction mix containing ssRNA, dsRNA, non-specific dsDNA, or specific dsDNA (i.e., 54 bp Prox) following the procedure described in Section 3.8, step 1, in the presence or absence of ATP. For reactions containing Prox, 0.25 mg 1 Kb DNA ladder (Invitrogen) per reaction should be included in the master reaction mix. 2. After 30 min incubation at 37C, transfer the reaction mixture on ice, and mix it with 5 ml of native dye mix (see Note 3). 3. Aliquots (10 ml) of each reaction are loaded onto a 5 or 10% polyacrylamide (30:1)/5% glycerol composite gel and electrophoresed in 0.5 TBE at 19 mA until BPB migrates about two-thirds of the gel (it usually takes 2–3 h).

320

Oh et al.

4. The gel is dried on top of DE-81 paper under vacuum at 80C. 5. Visualize RNA- or DNA-MLE complexes by autoradiography and quantify them using a Phosphorimager (18, 19). 3.10. Immunoprecipitation (IP) and RT-PCR

1. Prepare two groups (1 and 2) of exponentially growing S2 cells on 150 mm culture plates at 80% confluency. 2. Carefully remove and discard culture medium from each well of the culture plate, and then collect and transfer the cells into two separate 50 ml conical tube on ice. 3. Centrifuge the tubes at 1,500 g for 5 min and wash the pellet once with ice-cold 1 PBS, and then carefully transfer the cell suspension to microcentrifuge tubes. 4. Two groups of cells are processed as follows. (a) For group 1, cells are quickly re-suspended in 1 ml Ultrapec reagent by pipetting, and total RNA is isolated following the procedure recommended by the manufacturer (see Note 4). Subsequently, proceed to step 20. (b) For group 2, cells are re-suspended in 1 extraction buffer, and proceed to step 5. 5. Homogenize the cell suspension using a micropestle and sonicate it three times, each 10 s with 1 min intervals on ice. 6. Remove the insoluble debris by centrifugation at 12,000 g for 5 min and transfer the clear total cell extract (TCE) into a new tube. 7. If necessary, repeat the centrifugation to clarify the TCE and determine the protein concentration using Bradford reagent (see Note 5). 8. Dilute aliquots (100 mg) of TCE to a final volume of 1 ml with 1 extraction buffer. 9. Add polyclonal antibodies (3 ml) specific for MLE, MSL1, or pre-immune sera (control), and the mixture is incubated on a nutator for 1 h at 4C. 10. While performing step 9, prepare protein A-sepharose as follows. (a) Take aliquots (100 ml) of protein A–sepharose suspension to microcentrifuge tubes* and mix them with 500 ml 1 extraction buffer. *Tube number should equal that of antibodies used. (b) Centrifuge the mixture at 3,000 rpm for 20 s. (c) Decant the supernatant and repeat the wash three times using 1 extraction buffer. (d) After the final wash, decant the supernatant and keep the protein A-sepharose on ice.


321

11. Transfer the TCE/antibody mixtures to tubes containing protein A-sepharose, and incubate the mixture on a nutator for 30 min at 4C. 12. Centrifuge the mixture at 3,000 rpm for 20 s and remove the supernatant. 13. Wash the pellet with 1 ml 1 extraction buffer five times. 14. After the final wash, carefully remove the supernatant by pipetting. 15. The pellet is mixed with 40 ml 10 DNase I buffer and the final volume should be adjusted to 400 ml using DEPCtreated H2O. 16. Add 1 ml RNase-free DNase I, and the mixture is incubated for 20 min at 37C. 17. Isolate RNA by conventional phenol/chloroform and chloroform extraction method. 18. After ethanol precipitation, wash the RNA pellet with ice-cold 70% ethanol. 19. RNA is re-dissolved in DEPC-treated H2O to a final volume of 10 ml. 20. Prepare primary cDNA with an aliquot (5 mg) of total S2 cell RNA (Section 3.10, step 4(a)) or RNA obtained from the IP pellet (Section 3.10, step 19) using SuperScript II RT. 21. Constitute PCR reaction mixture (50 ml) using aliquots (2 ml) of cDNA, 1 PCR buffer, 0.25 mM dNTP mixture, 0.5 ml Taq DNA polymerase, roX2-5 primer (10 pmol), and roX2-3 primer (10 pmol). 22. PCR reaction is carried out as follows: 4 min at 94C, 20 or 30 cycles of (1 min at 94C, 1 min at 60C, 1 min at 72C), and 10 min at 72C. 23. PCR products are resolved on a 1.5% agarose gel. 24. After confirming their presence by ethidium bromide staining, the PCR products are subject to Southern blot analysis using a probe specific for roX2 (Fig. 22.6) (13, 24). 3.11. Reporter Gene Assay

1. S2 cells are grown in 6-well culture plate at 20% confluency. 2. Prepare a CaPO4-DNA mixture (100 ml/well) as follows: (a) To each microcentrifuge tube, add 1 mg Prox-luciferase reporter construct, 50 ng pMT/V5-b-galactosidase construct (an internal control vector), and varying amounts (0.4–1.2 mg) of either pMT-MLE or pMT-MSL1. (b) Adjust the total amount of DNA to 3 mg using pBS and the final volume to 40 ml using sterilized and de-ionized H2O.

322

Oh et al.

Fig. 22.6. In vivo association of MSL complex with roX2 RNA. Immunoprecipitation (IP) was performed using S2 cell lysate and the indicated antibodies. Subsequently, RT-PCR was performed with total RNA isolated from S2 cells or RNA obtained from the IP pellet. Lane 1, the unspliced product from the roX2 78.13 cDNA (10); lane 2, male larval total RNA (5 mg); lane 3, S2 cell total RNA (5 mg); lane 4, S2 cell lysate (100 mg); lane 5, MSL1 IP pellet; lane 6, IP pellet obtained with MSL1 pre-immune serum; lane 7, MLE IP pellet; lane 8, IP pellet obtained with MLE pre-immune serum; lane 9, pellet obtained with protein A-Sepharose alone without any antibody. Samples in lanes 1–4 were generated with 30 cycles of PCR and subsequently diluted 100- to 1,000-fold. Samples in lanes 5–9 were generated with 20 cycles of PCR. All samples were run on the same 1.5% agarose gel and Southern blotted. Two RT-PCR products for roX2 represent unspliced (roX2-1, 503 bp) and spliced form (roX2-2, 233 bp) of mRNA. Lanes 1–4 were exposed for 2 h and lanes 5–9 for 11 h.

(c) Add 50 ml 2 HBS and mix well by pipetting. (d) Add 6 ml 2 M CaCl2, mix by pipetting, and incubate for 30 min at room temperature. 3. Gently pipette the CaPO4-DNA precipitates up and down 3–4 times, and transfer them into the culture medium. 4. Rock the culture plate gently and incubate the transfected cells for 24 h. 5. Replenish with culture medium containing 0.5 mM CuSO4, and continue the incubation for an additional 24 h. 6. Carefully remove and discard 0.5 ml culture medium from each well of the culture plate, then collect and transfer the cells into microcentrifuge tubes on ice (see Note 6). 7. Centrifuge the tubes at 1,500 g for 5 min and wash the pellet once with ice-cold 1 PBS. 8. Quickly resuspend the pellet in 200 ml 1 luciferase lysis buffer by pipetting. 9. After 30 min incubation on ice, clear the lysate by centrifugation at 12,000 g for 15 min. 10. Transfer the clear lysate to fresh tubes and measure the b-galactosidase activity, a control to normalize the transfection efficiency, and the luciferase activity as reported previously (25) (see Fig. 22.7A).


323

Fig. 22.7. Influence of MLE, MSL1, and MSL2 on the transcription activity of Prox2. (A) S2 cells, seeded in 6 well plate, were transfected with Prox2-luciferase (1 mg, lane 1) and increasing amounts (0.4–1.2 mg) of pMT/V5 vector expressing MLE (lanes 2 and 3), MSL1 (lanes 4 and 5), or MSL2 (lanes 6 and 7). On the following day, cells were treated with copper sulfate (0.5 mM), and 24 h later, total cell lysate was prepared and used to measure both luciferase and b-galactosidase activities, as described previously (19). Luciferase activities in lanes 1–7 were normalized to b-galactosidase and presented as RLU (relative luciferase unit) in comparison with that of control in lane 1. (B) RT-PCR was performed in a mixture (50 ml) provided with the indicated primers, as described previously (19). Following either 25 or 30 cycles of reaction, aliquots (5 ml) of PCR products were resolved on a 2% agarose gel and visualized by ethidium staining. Predicted size of RT-PCR product is 737 bp for MLE mRNA, 408 bp for dSRPK1 mRNA, and 322 bp for MSL1 mRNA. Two PCR products for roX2 RNA are described in Fig. 22.6. (C and D) RT-PCR was performed in the standard reaction mixture containing -32P-dCTP (30 mCi) and cDNA (1 ml) prepared from S2 cells expressing the indicated protein. RT-PCR products were isolated by spin column, and aliquots (10%) were resolved on a 2% agarose gel, followed by autoradiography (C). All RT-PCR products were quantified by Instant b-Imager, normalized to that of Drosophila SRPK1 (dSRPK1) and presented as relative RNA abundance in comparison with cognate RT-PCR product of control cells (D). Statistical analysis was performed using two-tailed Student’s t-test, comparing control and test samples. *p < 0.05.

324

Oh et al.

3.12. Multiplex PCR Assay

1. Transfect S2 cells following the procedures described in steps 1–4 of Section 3.11. 2. Replace the culture medium with media containing 0.5 mM CuSO4, and continue the incubation for an additional 48 h. 3. Carefully remove and discard 0.5 ml culture medium from each well of the culture plate, and then collect and transfer the cells into microcentrifuge tubes on ice. 4. Centrifuge the tubes at 1,500 g for 5 min and wash the pellet once with ice-cold 1 PBS. 5. Quickly resuspend the pellet in 1 ml Ultraspec reagent by pipetting. 6. Total RNA is isolated following the procedure recommended by the manufacturer (Biotecx Laboratories), and is dissolved in 85 ml DEPC-treated H2O and mixed with 10 DNase I buffer and 5 ml RNase-free DNase RQI. 7. After 30 min incubation at 37C, re-isolate RNA by phenol/ chloroform extraction and ethanol precipitation (see Note 4). 8. Prepare primary cDNA with an aliquot (1 mg) of total RNA using SuperScript II RT following the procedure recommended by the manufacturer. 9. Add an aliquot (1 ml) in a mixture (50 ml) containing 1 Advantage II PCR buffer, 0.25 mM dNTP mixture, 3 ml -32P-dCTP, 1 ml Advantage II polymerase, and a mixture of four PCR primer sets (10 pmol/primer) described in Section 2.7, step 8. 10. Perform PCR as follows: 1 min at 95C, 25 cycles of (95C for 15 s, 55C for 30 s, 68C for 1.5 min), and 7 min at 68C. 11. Purify PCR products using a spin column, and resolve aliquots (2.5–10 ml) on a 2% agarose gel in 0.5 TBE (Fig. 22.7B). 12. Visualize PCR products by ethidium bromide staining and autoradiography, and quantify them using a Phosphorimager (Fig. 22.7B–D).

4. Notes 1. This amount of -32P-GTP helps detect a longer ssRNA on a denaturing acrylamide but its contribution to the specific radioactivity of dsRNA formed is negligible. 2. If all the content is frozen due to prolonged incubation, thaw it by rubbing the tube a few seconds until it becomes a jelly.


325

3. At this step, the reaction mixture can be stored at –70C for future analysis. 4. About 85–100 mg of total RNA is obtained from 1 107 S2 cells. 5. Protein concentration is usually 10–20 mg/ml. 6. S2 cells are easily detached from the culture plate, especially following the DNA transfection. Therefore, S2 cells can be efficiently recovered by pipetting. References 1. Park Y. and Kuroda M. I. (2001) Epigenetic aspects of X-chromosome dosage compensation. Science 293, 1083–1085. 2. Palmer M. J., Mergner V. A., Richman R., Manning J. E., Kuroda M. I., and Lucchesi J. C. (1993) The male-specific lethal-one (msl-1) gene of Drosophila melanogaster encodes a novel protein that associates with the X chromosome in males. Genetics 134, 545–557. 3. Bashaw G. J. and Baker B. S. (1995) The msl-2 dosage compensation gene of Drosophila encodes a putative DNA-binding protein whose expression is sex specifically regulated by sex-lethal. Development 121, 3245–3258. 4. Kelley R. L., Solovyeva I., Lyman L. M., Richman R., Solovyev V., and Kuroda M. I. (1995) Expression of msl-2 causes assembly of dosage compensation regulators on the X chromosomes and female lethality in Drosophila. Cell 81, 867–877. 5. Gorman M., Franke A., and Baker B. S. (1995) Molecular characterization of the male-specific lethal-3 gene and investigations of the regulation of dosage compensation in Drosophila. Development 121, 463–475. 6. Kuroda M. I., Kernan M. J., Kreber R., Ganetzky B., and Baker B. S. (1991) The maleless protein associates with the X chromosome to regulate dosage compensation in Drosophila. Cell 66, 935–947. 7. Hilfiker A., Hilfiker-Kleiner D., Pannuti A., and Lucchesi J. C. (1997) mof, a putative acetyl transferase gene related to the Tip60 and MOZ human genes and to the SAS genes of yeast, is required for dosage compensation in Drosophila. EMBO J. 16, 2054–2060. 8. Jin Y., Wang Y., Johansen J., and Johansen K. M. (2000) JIL-1, a chromosomal kinase implicated in regulation of chromatin

9.

10.

11.

12.

13.

14.

15.

16.

structure, associates with the male specific lethal (MSL) dosage compensation complex. J. Cell Biol. 149, 1005–1010. Meller V. H., Wu K. H., Roman G., Kuroda M. I., and Davis R. L. (1997) roX1 RNA paints the X chromosome of male Drosophila and is regulated by the dosage compensation system. Cell 88, 445–457. Amrein H. and Axel R. (1997) Genes expressed in neurons of adult male Drosophila. Cell 88, 459–469. Kageyama Y., Mengus G., Gilfillan G., Kennedy H. G., Stuckenholz C., Kelley R. L., Becker P. B., and Kuroda M. I. (2001) Association and spreading of the Drosophila dosage compensation complex from a discrete roX1 chromatin entry site. EMBO J. 20, 2236–2245. Kelley R. L., Meller V. H., Gordadze P. R., Roman G., Davis R. L., and Kuroda M. I. (1999) Epigenetic spreading of the Drosophila dosage compensation complex from roX RNA genes into flanking chromatin. Cell 98, 513–522. Meller V. H., Gordadze P. R., Park Y., Chu X., Stuckenholz C., Kelley R. L., and Kuroda M. I. (2000) Ordered assembly of roX RNAs into MSL complexes on the dosage-compensated X chromosome in Drosophila. Curr. Biol. 10, 136–143. Park Y., Mengus G., Bai X., Kageyama Y., Meller V. H., Becker P. B., and Kuroda M. I. (2003) Sequence-specific targeting of Drosophila roX genes by the MSL dosage compensation complex. Mol. Cell 11, 977–986. Oh H., Park Y., and Kuroda M. I. (2003) Local spreading of MSL complexes from roX genes on the Drosophila X chromosome. Genes Dev. 17, 1334–1339. Park Y., Kelley R. L., Oh H., Kuroda M. I., and Meller V. H. (2002) Extent of chromatin spreading determined by roX RNA

326

17.

18.

19.

20.

21.

Oh et al. recruitment of MSL proteins. Science 298, 1620–1623. Gu W., Wei X., Pannuti A., and Lucchesi J. C. (2000) Targeting the chromatinremodeling MSL complex of Drosophila to its sites of action on the X chromosome requires both acetyl transferase and ATPase activities. EMBO J. 19, 5202–5211. Lee C. G., Chang K. A., Kuroda M. I., and Hurwitz J. (1997) The NTPase/helicase activities of Drosophila maleless, an essential factor in dosage compensation. EMBO J. 16, 2671–2681. Lee C.-G., Reichman T. W., Baik T., and Mathews M. B. (2004) MLE functions as a transcriptional regulator of the roX2 gene. J. Biol. Chem. 279, 47740–47745. Scheffner M., Knippers R., and Stahl H. (1989) RNA unwinding activity of SV40 large T antigen. Cell 57, 955–963. Lee C. G., Zamore P. D., Green M. R., and Hurwitz J. (1993) RNA annealing activity is

22.

23.

24.

25.

intrinsically associated with U2AF. J. Biol. Chem. 268, 13472–13478. Lee C. G., Hague L. K., Li H., and Donnelly R. (2004) Identification of toposome, a novel multisubunit complex containing topoisomerase IIalpha. Cell Cycle 3, 638–647. Zhou K., Choe K. T., Zaidi Z., Wang Q., Mathews M. B., and Lee C. G. (2003) RNA helicase A interacts with dsDNA and topoisomerase IIalpha. Nucleic Acids Res. 31, 2253–2260. Park Y., Oh H., Meller V. H., and Kuroda M. I. (2005) Variable splicing of noncoding roX2 RNAs influences targeting of MSL dosage compensation complexes in Drosophila. RNA Biol. 2, 157–164. Nakajima T., Uchida C., Anderson S. F., Lee C. G., Hurwitz J., Parvin J. D., and Montminy M. (1997) RNA helicase A mediates association of CBP with RNA polymerase II. Cell 90, 1107–1112.

Chapter 23 Biochemical Characterization of Human Upf1 Helicase Zhihong Cheng, Gaku Morisawa, and Haiwei Song Abstract We present here the biochemical characterization of human Upf1 helicase core (hUpf1c). hUpf1c is overexpressed as a GST fusion protein in Escherichia coli and purified using chromatographic methods. In vitro ATP binding and single-stranded RNA (ssRNA) binding activities are measured using dot-blot technique. Measurement of RNA-dependent ATPase activity is performed by thin layer chromatography (TLC). The ATP-modulated ssRNA binding activity is examined by surface plasma resonance (SPR). The binding of double-stranded DNA (dsDNA) to hUpf1c is checked by electrophoretic mobility shift assay (EMSA, gel shift assay). Key words: Upf1, helicase, ATPase, RNA binding, nonsense-mediated mRNA decay, superfamily 1, NMD.

1. Introduction Nonsense-mediated mRNA decay is an evolutionally conserved mRNA quality-control mechanism that selectively degrades aberrant mRNAs containing premature termination codons in order to prevent the accumulation of truncated proteins, which are often non-functional or potentially deleterious in the cells (1–3). Three conserved proteins Upf1, Upf2, and Upf3 constitute the core NMD machinery (4–9) with Upf1 as the key member in this protein set. Upf1 acts in concert with the peptide release factors eRF1/eRF3 to recognize aberrant translation termination events and, together with Upf2 and Upf3, triggers degradation of mRNA in a subsequent step (10–12). In addition to its role in NMD, Upf1 also regulates mRNAs in a NMD-independent manner. For example, Upf1 is recruited by the RNA-binding protein Staufen to the downstream of a stop M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_23, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

327

328

Cheng, Morisawa, and Song

cordon to degrade some mRNAs in a Staufen-mediated decay (13). Human Upf1 (hUpf1) has been shown to regulate the degradation of histone mRNAs in mammalian cells (14). Moreover, hUpf1 is involved in nonsense-mediated altered splicing (15). Upf1 contains two conserved functional regions, an N-terminal Cys-rich domain and a C-terminal helicase domain, which belong to superfamily 1 (SF1) of DNA/RNA helicases (16, 17). It has been shown that Upf1 exhibits RNA binding, RNA-dependent ATP hydrolysis, and 50 to 30 ATP-dependent RNA helicase activities, which are critical for its role in NMD (18–20). The crystal structure of the human helicase core has been determined (21). Structural data combined with mutational analysis reveals a mechanism by which ATP binding modulates the RNA binding to Upf1 (21). In this chapter, biochemical characterization of human Upf1 helicase core domain (hUpf1c) is described. The cDNA encoding hUpf1c is cloned into the pGEX-6P-1 vector and expressed as a GST-fusion protein in E. coli. GST affinity, ion exchange, and size exclusion chromatography are used to purify hUpf1c. ATP and single-stranded RNA (ssRNA) binding assays are carried out based on the unique property of PVDF membrane on protein-specific absorption. Effects of nucleotides on ssRNA binding to hUpf1c are measured by Surface Plasma Resonance (SPR), which is the label-free study of interactions between biomolecules (22). The sensorgram of SPR reflects the mass change in real time near the sensor chip surface, on which one molecule is immobilized; the other exists in the nearby micro fluid (23). Thin layer chromatography has the capability of differentiating small molecules like ATP, ADP, and phosphate, enabling researchers to measure ATPase activity (http://inst.sfcc.edu/chemscape/catofp/chromato/tlc/tlc.htm). Finally, double-stranded DNA (dsDNA) binding to hUpf1c is examined by electrophoretic mobility shift assay (EMSA), which is based on the observation that protein:DNA complexes migrate more slowly than free DNA molecules when subjected to non-denaturing polyacrylamide or agarose gel electrophoresis. Because the rate of DNA migration is shifted or retarded upon protein binding, the assay is also referred to as a gel shift or gel retardation assay.

2. Materials 2.1. Cloning and Overexpression

1. Human cDNA library (ATCC). 2. PCR primers (Sigma, Proligo).

Human Upf1

329

3. pGEX-6p-1 vector (Amersham). 4. Turbo Pfu DNA polymerase (Stratagene). 5. Restriction enzyme and ligase (New England Biolabs). 6. TAE buffer (1X): 40 mM Tris, 1.14% acetic acid, 1 mM EDTA. 7. 1.5% agarose gel in 1X TAE buffer. 8. QIAquick PCR purification kit, Gel Extraction kit and QIAprep Spin Miniprep kit (QIAGEN). 9. DH-5a competent cell (Invitrogen), BL-21 DE3 expression strain (Novagen). 10. 80% Glycerol autoclaved. 11. LB medium: 10 mg/ml tryptone, 5 mg/ml yeast extract, 10 mg/ml NaCl, 100 mg/ml ampicillin, pH 7. 12. Isopropyl-b-D-thiogalactopyranosid (IPTG), 1 M in stock. 13. Sample loading buffer (3X): 200 mM Tris-Cl, pH 6.8, 6.5% (w/v) SDS, 0.16% (v/v) b-mercaptoethanol, 0.6 mg/ml bromophenol blue. 14. Running buffer (1X): 3.03 mg/ml Tris base, 14.4 mg/ml glycine, 1 mg/ml SDS. 15. Gel staining buffer: 45% methanol, 10% acetic acid, 0.25% Coomassie Brilliant Blue R-250. 16. De-staining buffer: 5% methanol and 7.5% acetic acid. 2.2. Purification

1. Hen egg lysozyme (Sigma). 2. LB medium: 10 mg/ml tryptone, 5 mg/ml yeast extract, 10 mg/ml NaCl, 100 mg/ml ampicillin, pH 7. 3. PBS buffer: 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4 in 1 l, pH 7.4. 4. Lysis buffer: 20 mM Tris, 500 mM NaCl, 2 mM DTT, 2 mM benzamidine, 0.1 mM PMSF, pH 6.0, 1 mg/ml lysozyme. 5. Elution buffer: 20 mM L-glutathione reduced (GSH) in lysis buffer. 6. Coomassie Protein Assay kit (Pierce). 7. PreScission protease (Amersham). 8. Desalting buffer: 20 mM HEPES, 100 mM NaCl, 2 mM DTT, pH 7.0. 9. Ion-exchange buffer A: 20 mM HEPES, 100 mM NaCl, 2 mM DTT, pH 7.0. 10. Ion-exchange buffer B: 20 mM HEPES, 1000 mM NaCl, 2 mM DTT, pH 7.0.

330


11. Gel filtration buffer: 20 mM HEPES, 200 mM NaCl, 2 mM DTT, pH 7.0. 2.3. In Vitro ATP Binding

1. PVDF membrane for protein blotting (Bio-rad). 2. 5000 Ci/mmol [g-32P] ATP (Amersham). 3. Blocking buffer: 20 mM HEPES, 50 mM KAc, 2.5 mM Mg(Ac)2, 2 mM DTT, 3% BSA, pH 7.0. 4. Binding buffer: 20 mM HEPES, 50 mM KAc, 2.5 mM Mg(Ac)2, 2 mM DTT, 1.5% BSA, pH 7.0. 5. Cling wrap. 6. Autoradiography film cassette and Hyperfilm (Amersham).

2.4. In Vitro ssRNA Binding

1. PVDF membrane for protein blotting (Bio-rad). 2. 2 mg/ml BSA protein. 3. 5000 Ci/mmol [g-32P] ATP (Amersham). 4. Single-stranded RNA 50 CGCCCGAGGCTGTGCCGT30 (Dharmacon). 5. T4 kinase kit (Invitrogen). 6. G-25 Spin column (Amersham). 7. Blocking buffer: 20 mM HEPES, 50 mM KAc, 2.5 mM Mg(Ac)2, 2 mM DTT, 3% BSA, pH 7.0. 8. Binding buffer: 20 mM HEPES, 50 mM KAc, 2.5 mM Mg(Ac)2, 2 mM DTT, 1.5% BSA, pH 7.0. 9. Cling wrap. 10. Autoradiography film cassette and Hyperfilm (Amersham).

2.5. In Vitro ATP Hydrolysis

1. 500 nM 15-mer poly (C) purchased from Dharmacon. 2. 5000 Ci/mmol [g-32P] ATP (Amersham). 3. 500 mM EDTA. 4. Reaction buffer: 50 mM MES, pH 6.0, 50 mM KAc, 2.5 mM Mg(Ac)2, 1 mM DTT, 0.1 mg/ml BSA. 5. Nucleotide ATP (Sigma) dissolved in distilled water. 6. PEI-cellulose plate (Sigma). 7. Development buffer: 0.3 M K2HPO4, pH 7.6. 8. Glass development tank (Sigma). 9. Cling wrap. 10. Autoradiography film cassette and Hyperfilm (Amersham).

2.6. Effects of Nucleotides on ssRNA Binding to hUpf1c

1. BIAcore 2000 instrument (BIAcore). 2. 50 Biotin-labeled ssRNA TGTCATTCGAGTACAGTCTGT TCAGCTAGTCTCC (CureVac).

Human Upf1

331

3. Steptavidin-coated Sensor Chip SA (BIAcore). 4. Coupling buffer: 10 mM HEPES, pH 7.0, 150 mM NaCl, 0.005% (v/v) Tween-20. 5. 0.3 M NaCl and 2.5 M NaCl. 6. 1 mg/ml biotin dissolved in 0.3 M NaCl (Sigma). 7. Binding buffer: 20 mM HEPES, pH 7.0, 100 mM NaCl, 2 mM MgCl2, 2 mM DTT, 0.002% (v/v) Tween-20. 8. Nucleotide ATP (Sigma) dissolved in distilled water. 2.7. Gel Shift Assay of dsDNA Binding to hUpf1c

1. T4 Polynucleotide Kinase (New England Biolabs). 2. 3000 Ci/mmol [g-32P] ATP (Amersham). 3. 500 mM EDTA. 4. G-25 Spin column (Amersham). 5. Single-stranded 28 nt DNA 50 AAACAAAA CTAGCACCGT AAAGCAAGCT30 and 18 nt DNA 50 AGCTTGCTTTAC GGTGCT30 (Sigma). 6. Binding buffer: 20 mM Tris, pH 8.0, 50 mM KCl, 3 mM MgCl2, 1 mM DTT. 7. TBE buffer (5X): 30.28 g Tris base, 1.86 g EDTA, and 13.25 g boric acid dissolved in 1 l water. 8. Vertical electrophoresis apparatus (Bio-rad). 9. Gel dryer (Bio-rad). 10. Autoradiography film cassette and Hyperfilm (Amersham).

3. Methods 3.1. Cloning and Overexpression

1. Gene fragment encoding hUpf1c (residues 295–914) is amplified by PCR using human cDNA library as the template. General PCR parameters are used (see Note 1). 2. 5 ml of the PCR product is run on a 1.5% agarose gel with 1X TAE buffer as running buffer. The PCR product is purified using a QIAquick PCR purification kit (QIAGEN). 3. Restriction enzyme digestions of plasmid pGEX-6p-1 and PCR product are performed at 37C for 3–5 h. The digested DNA fragments were excised from the gel and purified using a QIAquick Gel Extraction kit (QIAGEN). 4. Ligation is performed at 15C overnight. Five microliters of the ligation product is then transformed into 100 ml of DH5a competent cells. Positive clones are screened by colony PCR or double digestion. The sequences of positive clones are

332


confirmed by DNA sequencing. The recombinant plasmid is transformed into BL-21 star (DE3) expression strains for overexpression of hUpf1c. 5. The resulting expression strain is inoculated into 2 ml of LB medium supplemented with 100 mg/ml ampicillin and incubated overnight at 37C. Five hundred microliters of cells mixed with 80% glycerol were stored at –80C. For trial expression, 100 ml of cells is transferred into 10 ml of fresh LB medium and cultured at 37C. When the optical density at 600 nm (OD600) reaches to about 0.5–0.6, 0.5 mM of isopropyl-ß-D-thiogalactopyranosid (IPTG) is added to the cell culture. Further 2 h incubation at 37C is required to get sufficient amount of overexpressed hUpf1c. Two hundred microliters of non-induced cells and 100 ml of induced cells are pelleted and boiled in the SDS-PAGE loading buffer. The samples are separated by SDS-PAGE using a 12% polyacrylamide gel to check the protein expression level (see Note 2). 3.2. Purification

1. The strain overexpressing hUpf1c is inoculated into 150 ml of LB medium supplemented with 100 mg/ml ampicillin and grown at 37C overnight. One hundred and twenty milliliters of the overnight culture is added into 4 l of LB medium and incubated in shaker (220 rpm) at 37C. When OD600 reaches to 0.5–0.6, 0.1 mM IPTG is added into the cell culture and further cell growth is performed overnight at 18C. The cells are harvested by centrifugation (4000 rpm), and washed by the PBS buffer. The resulting cell pellets are stored at –80C for subsequent protein purification (see Note 3). 2. All steps of protein purification must be performed at 4C. The frozen cell pellets are thawed at room temperature and re-suspended in the lysis buffer containing 1 mg/ml Hen egg lysozyme for at lease 30 min. The lysozyme-treated cells are subjected to sonication with eight bursts of 15 s using a Soniprep 150 (SANYO). At least 90 s incubation on ice is required after each sonication burst to cool down the temperature of the cells. Cell debris is removed by centrifugation for 1 h using J6-HC centrifuge (Beckman Coulter) at 18,000 rpm. The supernatant is filtered (0.45 mm) and mixed with 2 ml of glutathione sepharose 4B (Amersham) for 30 min at 4C. 3. The resulting GST beads are centrifuged at 780 g for 10 min and washed with 50 ml of the lysis buffer. At least three cycles of centrifugation/washing are required to remove the non-specific bound proteins to the GST beads. During the centrifugation, elution buffer is prepared by adding 20 mM GSH into the lysis buffer (see Note 4).

Human Upf1

333

4. GST-hUpf1c is eluted with 15 ml of the elution buffer. Protein concentration is determined by the Bradford method using the Coomassie Protein Assay kit (Pierce) with BSA as the standard. PreScission protease (Amersham) is added to the eluted fraction at a ratio of 50:1 (w/w) between target protein and protease. The reaction mixture is incubated at 4C overnight to cleave off the GST tag. 5. The protease-treated protein sample is loaded onto a HiPrep desalting column (Amersham) equilibrated with the desalting buffer. The desalted protein sample is then reloaded onto a regenerated glutathione sepharose 4B column to remove the cleaved GST tag and non-cleaved GST-hUpf1c. 6. The flow-through from the second glutathione sepharose 4B column is loaded onto a MonoS HR 10/10 column (Amersham) pre-equilibrated with ion exchange buffer B and subsequently buffer A. The hUpf1c is eluted with a 100 ml linear gradient of NaCl (0.1–1.0 M) using the same buffers (A and B). The fractions containing hUpf1c are verified by SDS-PAGE and pooled for further purification. 7. The pooled fractions from MonoS column are loaded onto a Superdex-200 column (Amersham) pre-equilibrated with the gel filtration buffer. The fractions containing pure hUpf1c are verified by SDS-PAGE (Fig. 23.1a) and concentrated to 10 mg/ml using vivaspin 20 concentrators (30,000 MWCO, Vivascience). The concentrated hUpf1c is aliquoted and stored at –80C. 3.3. In Vitro ATP Binding

1. Cut a proper size of PVDF membrane; slowly lower the membrane into 100% methanol and shake briefly for 10 s. After the membrane become translucent, rinse the membrane with deionized water and equilibrated in a binding buffer for at least 10 min. Keep the membrane fully wet all the time. If the membrane becomes partially dry, allow it to dry completely and repeat step 1. Do not touch membrane directly by hands; use forceps instead. 2. Soak two thick tissue papers into water and place them on a sheet of cling wrap. Slowly place the PVDF membrane onto the tissue paper and remove the air bubbles between them (see Note 5). Keep the tissue papers wet by adding water. Dotblot equal amounts (15 mg) of BSA and hUpf1c onto the membrane. After protein samples are absorbed into membrane, transfer the membrane into the blocking buffer and incubate for 1 h at room temperature. 3. Transfer the membrane into a binding buffer and add 50 mCi of 5000 Ci/mmol [g-32P] ATP (Amersham) for incubation at low rotation speed for 30 min.

334


Fig. 23.1. Purification and biochemical characterization of hUpf1c. a. Ten percent SDS-PAGE of the fractions (F4–F10) from Superdex-200 column. Ten microliters of protein samples in each fraction are loaded for SDS-PAGE. b. ATP binding activity of hUpf1c (15 mg). c. RNA-dependent ATPase activity of hUpf1c: 200 nM protein in the presence of 500 nM 15-mer poly(C). d. Surface plasma resonance analysis of ssRNA binding to 100 nM hUpf1c in the absence or presence of 2 mM ATP. e. dsDNA binding activity to hUpf1c. Except for the control sample (lane 1), 1 pmol (lane 2) or 5 pmol (lanes 3–7) of purified hUpf1c are used for binding assay. At a high salt concentration, 50 mM (lane 4), 100 mM (lane 5), and 200 mM (lane 6), sodium chloride appears to inhibit Upf1-DNA complex formation. Non-labeled double-stranded DNA (15 pmol) is also included as a competitor in the reaction (lane 7).

4. After incubation, the membrane was washed twice with 10 ml of the binding buffer each time. The signal was measured by exposing the membrane to Hyperfilm and quantified using a Phosphoroimager (Molecular Dynamics). An example of the ATP binding is shown in Fig. 23.1b. 3.4. ATP Hydrolysis

1. In vitro ATPase assay is performed in 20 ml of reaction mixture. The mixture contains reaction buffer, 200 nM hUpf1c, 500 nM 15-mer poly(C), 10 mM cold ATP, and 1 mCi of 5000 Ci/mmol [g-32P] ATP (Amersham). The reaction condition should be optimized through several trial experiments (see Note 6).

Human Upf1

335

2. The reaction mixture is incubated for 1 h at 37C. During the incubation, prepare a proper size of PEI-cellulose plate and the development buffer. Make the glass tank ready for development. 3. After incubation, add 1 ml of 500 mM EDTA into the mixture to terminate the reaction and spot 1 ml of reaction mixture on the PEI-cellulose plate. The plate is placed vertically in the glass tank with the spots of samples 1 cm above the development buffer. 4. After the edge of development buffer reaching to the top of plate, take the plate out and cover the plate by a plastic wrap. The plate is exposed to Hyperfilm and quantified using a Phosphoroimager. An example result is shown in Fig. 23.1c. 3.5. In Vitro ssRNA Binding Assay

1. PVDF membrane is prepared as described in step 1 of in vitro ATP binding assay. 2. Label ssRNA with [g-32P] ATP. The labeling reaction mixture of 25 ml contains 1X reaction buffer and 10 units of T4 kinase (Invitrogen), 5 pmol ssRNA, and 50 mCi of 5000 Ci/ mmol [g-32P] ATP (Amersham), and is incubated at 37C for 10 min. 3. The reaction mixture is then passed through G-25 spin column (Amersham) to remove unused [g-32P] ATP. 4. As in step 2 of in vitro ATP binding assay, dot-blot equal amounts (15 mg) of BSA and hUpf1c onto the membrane, transfer the membrane into the blocking buffer and incubate it for 1 h at room temperature. 5. Transfer the membrane into the binding buffer, add in 1 pmol of 32P-labeled RNA substrate, and incubate for additional 1 h with low speed shaking. 6. After incubation, the membrane is washed with 20 ml of the binding buffer three times and then measured in the same manner as in step 4 of ATP binding assay.

3.6. Effects of Nucleotides on the ssRNA Binding to hUpf1c

1. Undock the maintenance chip or the previously used sensor chip and remove it from the instrument. Insert and dock the new Sensor chip SA, set up the instrument buffer tubing into the coupling buffer (see Note 7). Perform the prime to exchange all of the solutions in the system with the coupling buffer. 2. The coupling buffer is flowed across the sensor chip SA until the trace leveled off. During the equilibration, prepare 100 nM of biotin-labeled RNA.

336


3. Inject 20 ml of 100 nM biotin-labeled RNA in 0.3 M NaCl at the flow rate of 5 ml/min. 4. After immobilization, 100 ml of 1 mg/ml biotin is flowed across the flow cell 2 and reference flow cell 1 at the flow rate of 5 ml/min to block the unbinding site of the sensor chip. 5. Set up the instrument buffer tubing into the binding buffer and perform the prime to exchange all of the solutions in the system with the binding buffer. Keep the instrument in standby mode when not in use. 6. Inject 150 ml of 100 nM wild-type protein in the absence of ATP into the binding buffer across the sensor chip at the flow rate of 50 ml/min, followed by the dissociation time of 180 s. 7. The bound protein sample is removed by injecting 50 ml of regeneration buffer 2.5 M NaCl to regenerate the sensor chip for next cycle of binding assay (see Note 8). 8. Repeat steps 6 and 7 by injecting protein sample in the presence of 2 mM ATP. 9. The data curves were analyzed using the BIAevaluation software. An example result is shown in Fig. 23.1d. 3.7. Gel Shift Assay of dsDNA Binding to hUpf1c

1. DNA duplex is prepared by annealing 18- and 28-nt singlestrand oligodeoxyribonucleotide. 2. Double-stranded DNA (3 pmol) is labeled at the 50 end with 10 mCi [g-32P] ATP (3000 Ci/mmol) and 10 units of T4 polynucleotide kinase for 30 min at 37C. Stop the reaction by adding 1 ml of 0.5 M EDTA and reaction mixture is passed through G-25 spin column to remove unincorporated [g-32P] ATP. 3. Binding reaction is performed in 10 ml volume of the binding buffer (20 mM Tris, pH 8.0, 3 mM MgCl2, 1 mM DTT, 50 mM KCl). 4. Purified hUpf1c and 50 fmol of labeled double-stranded DNA was added to the binding buffer and incubated for 15 min at room temperature. Different concentrations of hUpf1c, sodium chloride, and nucleic acid are used for comparative study. 5. Fill an electrophoresis apparatus with 0.5X TBE and preelectrophorese the 4.5% non-denaturing gel (contains 0.5 TBE and 5% glycerol) for 30 min at 100 V and samples are resolved in a gel for 1 h. 6. Gel is dried and exposed to Hyperfilm. An example result is shown in Fig. 23.1e.

Human Upf1

337

4. Notes 1. Turbo Pfu DNA polymerase should be used to avoid random mutations. In some cases, optimizing the concentration of Mg2+ may improve the quality of PCR product. 2. High concentration of IPTG is used in trial expression to shorten the time for induction. 3. In case of proteins’ poor solubility, low temperature (such as at 18C) induction is preferred to improve protein solubility and yield. 4. It is essential to adjust the pH back to its original value after adding GSH to the elution buffer as GSH will decrease the elution buffer’s pH to around 3. 5. It is critical to remove air bubbles between the PVDF membrane and tissue papers. 6. The concentration of each reactant or substrate should be optimized by a couple of trial assays by varying the concentrations of proteins, cold ATP, RNA, as well as incubation time and temperature. 7. Operate the instrument following the manual provided by the manufacturer. All buffers used in this assay should be filtered using a 0.22-mm filter and degassed prior to use. 8. Optimize the regeneration buffer by injecting different concentrations of NaCl into the sensor chip and select the lowest concentration of NaCl that can remove the bound protein completely.

Acknowledgments This work is financially supported by the Biomedical Research Council of A*STAR (Agency for Science, Technology and Research). References 1. Baker K. E. and Parker R. (2004) Nonsensemediated mRNA decay: terminating erroneous gene expression. Curr. Opin. Cell Biol. 16, 293–299. 2. Conti E. and Izaurralde E. (2005) Nonsense-mediated mRNA decay: molecular insights and mechanistic variations across

species. Curr. Opin. Cell Biol. 17, 316–325. 3. Lejeune F. and Maquat L. E. (2005) Mechanistic links between nonsense- mediated mRNA decay and pre-mRNA splicing in mammalian cells. Curr. Opin. Cell Biol. 17, 309–315.

338


4. Cui Y., Hagan K. W., Zhang S., and Peltz S. W. (1995) Identification and characterization of genes that are required for the accelerated degradation of mRNAs containing a premature translational termination cordon. Genes Dev. 9, 423–436. 5. He F., Brown A. H., and Jacobson A. (1997) Upf1p, Nmd2p, and Upf3p are interacting components of the yeast nonsense-mediated mRNA decay pathway. Mol. Cell Biol. 17, 1580–1594. 6. Hodgkin J., Papp A., Pulak R., Ambros V., and Anderson P. (1989) A new kind of informational suppression in the nematode Caenorhabditis elegans. Genetics 123, 301–313. 7. Gatfield D., Unterholzner L., Ciccarelli F. D., Bork P., and Izaurralde E. (2003) Nonsense-mediated mRNA decay in Drosophila: at the intersection of the yeast and mammalian pathways. EMBO J. 22, 3960–3970. 8. Lykke-Andersen J., Shu M. D., and Steitz J. A. (2000) Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 103, 1121–1131. 9. Serin G., Gersappe A., Black J. D., Aronoff R., and Maquat L. E. (2001) Identification and characterization of human orthologues to Saccharomyces cerevisiae Upf2 protein and Upf3 protein (Caenorhabditis elegans SMG-4). Mol. Cell Biol. 21, 209–223. 10. Amrani N., Ganesan R., Kervestin S., Mangus D. A., Ghosh S., and Jacobson A. (2004) A faux 30 -UTR promotes aberrant termination and triggers nonsensemediated mRNA decay. Nature 432, 112–118. 11. Kashima I., Yamashita A., Izumi N., Kataoka N., Morishita R., Hoshino S., Ohno M., Dreyfuss G., and Ohno S. (2006) Binding of a novel SMG-1-Upf1-eRF1-eRF3 complex (SURF) to the exon junction complex triggers Upf1 phosphorylation and nonsense-mediated mRNA decay. Genes Dev. 20, 355–367. 12. Sheth U. and Parker R. (2006) Targeting of aberrant mRNAs to cytoplasmic processing bodies. Cell 125, 1095–1109. 13. Kim Y. K., Furic L., Desgroseillers L., and Maquat L. E. (2005) Mammalian staufen1

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

recruits Upf1 to specific mRNA 30 UTRs so as to elicit mRNA decay. Cell 120, 195–208. Kaygun H. and Marzluff W. F. (2005) Regulated degradation of replica- tondependent histone mRNAs requires both ATR and Upf1. Nat. Struct. Mol. Biol. 12, 794–800. Mendell J. T., ap Rhys C. M., and Dietz H. C. (2002) Separable roles for rent1/ hUpf1 in altered splicing and decay of nonsense transcripts. Science 298, 419–422. Applequist S. E., Selg M., Raman C., and Jack H. M. (1997) Cloning and characterization of HUPF1, a human homolog of the Saccharomyces cerevisiae nonsense mRNAreducing UPF1 protein. Nucleic Acids Res. 25, 814–821. Culbertson M. R. and Leeds P. F. (2003) Looking at mRNA decay pathways through the window of molecular evolution. Curr. Opin. Genet. Dev. 13, 207–214. Czaplinski K., Weng Y., Hagan K. W., and Peltz S. W. (1995) Purification and characterization of the Upf1 protein: a factor involved in translation and mRNA degradation. RNA 1, 610–623. Weng Y., Czaplinski K., and Peltz S. W. (1996) Genetic and biochemical characterization of mutations in the ATPase and helicase regions of the Upf1 protein. Mol Cell Biol. 16, 5477–5490. Bhattacharya A., Czaplinski K., Trifillis P., He F., Jacobson A., and Peltz S. W. (2000) Characterization of the biochemical properties of the human Upf1 gene product that is involved in nonsensemediated mRNA decay. RNA 6, 1226–1235. Cheng Z., Muhlrad D., Lim M., Parker R., and Song H. (2007) Structural and functional insights into the human Upf1 helicase core. EMBO J. 26, 253–264. Lieberg B., Cylinder C., and Lundstrom I. (1983) How surface plasmon resonance for gas detection and biosensing. Sens. Actuators 4, 299–304. Jason-Moller L., Murphy M., and JoAnne Bruno J. (2006) Overview of biscoe systems and their applications. Curr. Protoc. Protein Sci. 19.13.1–19.13.14.

Chapter 24 Assays of the Helicase, ATPase, and Exoribonuclease Activities of the Yeast Mitochondrial Degradosome Michal Malecki, Piotr P. Stepien, and Pawel Golik Abstract The mitochondrial degradosome (mtEXO) is the main enzymatic complex in RNA degradation, processing, and surveillance in Saccharomyces cerevisiae mitochondria. It consists of two nuclear-encoded subunits: the ATP-dependent RNA helicase Suv3p and the 30 to 50 exoribonuclease Dss1p. The two subunits depend on each other for their activity; the complex can therefore be considered as a model system for the cooperation of RNA helicases and exoribonucleases in RNA degradation. All the three activities of the complex (helicase, ATPase, and exoribonuclease) can be studied in vitro using recombinant proteins and protocols presented in this chapter. Key words: RNA helicase, RNA degradation, degradosome, mtEXO, mitochondria, yeast.

1. Introduction RNA turnover is one of the key processes in the regulation of gene expression and plays an important role in removing aberrant forms of RNA resulting from defective synthesis or maturation of RNA molecules (RNA surveillance) (1–5). In most physiological conditions, the level of each RNA species is the result of a balance between transcription and degradation. We recently demonstrated the critical importance of maintaining this balance in the yeast mitochondrial system (6). Mechanisms of RNA degradation in different genetic systems are very divergent and involve several classes of ribonucleases (both 30 to 50 and 50 to 30 exoribonucleases as well as endoribonucleases) and various other activities (1, 2, 5, 7–11). In general, cooperation of ribonucleases and RNA helicases appears to be a common theme in prokaryotic (7), eukaryotic (10, 11), and organellar (1) systems. M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_24, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

339

340

Malecki, Stepien, and Golik

RNA turnover in yeast mitochondria is carried out by a relatively simple enzymatic complex called the mitochondrial degradosome or mtEXO, consisting of only two subunits: a 30 to 50 exoribonuclease encoded by the nuclear gene DSS1 (YMR287C) belonging to the RNR (RNase II-like) family and an NTP-dependent RNA helicase related to the DExH/D (Ski2p) superfamily encoded by the nuclear gene SUV3 (YPL029W) (12–14). The activity of this complex is critical for the functioning of the mitochondrial genetic system—inactivating either of the two genes results in respiratory incompetence and a loss of mitochondrial genome stability, with a plethora of phenotypes indicating severe perturbations in all RNA-related processes (6, 12, 15–18). The yeast mitochondrial degradosome displays a remarkably tight functional interdependence of the two subunits (13). The activity of the Dss1p exoribonuclease alone is barely detectable, but is greatly enhanced and becomes entirely ATP-dependent in the presence of Suv3p, making the mtEXO complex an ATPdependent exoribonuclease, which is unique for this group of enzymes. This is evident even with short single-stranded oligoribonucleotide substrates devoid of any secondary structure, suggesting that the role of Suv3 RNA helicase is not restricted to the unwinding of the secondary-structure elements in the substrate that could impede the enzyme’s progress. We, therefore, proposed a model in which the Suv3p helicase acts as a molecular motor feeding the substrate to the catalytic center of the Dss1p ribonuclease (13). The Suv3 protein alone does not display any detectable RNA helicase activity and becomes a 30 to 50 directional helicase requiring a free 30 single-stranded substrate only when Suv3p is in complex with Dss1p. The ATP-dependent RNA-duplex unwinding activity of the Suv3p helicase can therefore only be studied within the whole mtEXO complex. Such interdependence may be a key to explain the frequent failure of demonstrating the helicase activities of DExH/DEAD-box proteins in vitro. It appears that the activity of Suv3p depends on the presence of Dss1p, but not on its activity, as RNA/DNA and even DNA/DNA duplexes are also unwound, even though the DNA strands are not degraded by Dss1p (13). In contrast to the helicase activity, the ATPase activity of Suv3p does not depend on the presence of Dss1p; its background activity in the absence of RNA is, however, greatly reduced when the protein is in the complex (13). It is therefore clear that in order to study the activities of the Suv3p helicase in vitro it is necessary to analyze the entire mtEXO complex, not the isolated protein alone. In this chapter, we describe the methods used in the study of the ATPase, helicase, and exoribonuclease activities of the mitochondrial degradosome complex.

Helicase, ATPase, and Exoribonuclease Activities

341

2. Materials 2.1. Recombinant Proteins and Materials Common to All Protocols

1. All the assays are carried out with the reconstituted recombinant mtEXO complex or the Suv3 and/or Dss1 proteins. The methods for obtaining the recombinant proteins and reconstituting the complex are beyond the scope of this chapter and have been published elsewhere (13, 19). The recombinant proteins are stored at –80C in 10% glycerol, 0.5 M NaCl, 20 mM Tris–HCl (pH 8.0) in small aliquots. Bovine Serum Albumin (BSA) can be used as a negative control. 2. Mid-size vertical SDS-PAGE gel apparatus (10 10 cm glass plates with 0.7 mm spacers) with a suitable power supply. 3. 6 loading dye: 10 mM Tris–HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol, 60 mM EDTA. 4. 10 TBE buffer: 0.9 M Tris–HCl (pH 8.0), 0.9 M borate, 20 mM EDTA. 5. 10 reaction buffer (RB): 100 mM Tris–HCl (pH 8.0), 250 mM KCl, 100 mM MgCl2. 6. 0.1 M dithiotreitol in water (DTT, store at –20C in small aliquots). 7. General-use autoradiography equipment (we use a digital PhosphorImager).

2.2. Substrate Preparation and Helicase Activity Assays

1. Synthetic dephosphorylated oligoribonucleotides: D – 50 CAAACUCUCUCUCUCUCAAC 30 5 W – 50 AGAGAGAGAGGUUGAGAGAGAGAGAGUUUG 30 3 W – 50 GUUGAGAGAGAGAGAGUUUGAGAGAGAGAG 30 B – 50 GUUGAGAGAGAGAGAGUUUG 30 Deoxyribonucleotide equivalents of the above oligos can also be used in helicase activity assays, as RNA/DNA and DNA/DNA hybrids are also unwound by the yeast mitochondrial degradosome (13). 2. T4 Polynucleotide Kinase (PNK) (New England Biolabs, Ipswich, MA) with the supplied reaction buffer. 3. Radiolabeled g-P32ATP (3000–5000 Ci/mmol). 4. 1:1 acid phenol:chlorophorm mixture. 5. For RNA precipitation: glycogen (MBI Fermentas, Vilnius, Lithuania), 96% ethanol, 3 M Na-acetate (pH 5.2). 6. RNase-free water obtained by DEPC treatment or purchased.

342


7. 4 annealing buffer: 80 mM Tris–HCl (pH 8.0), 2 M NaCl, 4 mM EDTA. 8. 30% 19:1 acrylamide/bisacrylamide solution in water; N,N,N’,N’-tetramethyl-ethylenediamine (TEMED); 10% ammonium persulfate solution in water (APS) prepared immediately before use. 9. Autoradiography X-ray film, exposure cassette, developing machine with appropriate chemicals (Agfa). 10. Plastic wrap (Saran), aluminum foil, sharp blades, handheld Geiger counter. 11. Gel extraction buffer: 0.2 M Tris–HCl (pH 7.5), 0.3 M NaCl, 25 mM EDTA, 2% SDS. 12. E. coli tRNA. 13. Proteinase K. 14. 20 mM ATP solution. 2.3. ATPase Activity Assays

1. Plastic-backed PEI-cellulose F TLC plates (Merck). 2. Radiolabeled -P32ATP or g-P32ATP (3000–5000 Ci/ mmol). 3. 1:1 mixture of 0.5 M formic acid and 2 M LiCl. 4. ATP, ADP and AMP solutions (100 mM). 5. 0.5 M EDTA.

2.4. Exoribonuclease Activity Assays

1. Synthetic oligoribonucleotide (5 W) (see Section 2.2, step 1) and materials for T4 PNK labeling with g-P32ATP as described in Section 2.2 2. Denaturing gel stock solutions: 20% 19:1 acrylamide/bisacrylamide solution in 8 M urea and 1 TBE; 8 M urea in 1 TBE. 3. N,N,N’,N’-tetramethyl-ethylenediamine (TEMED); 10% ammonium persulfate solution in water (APS) prepared immediately before use. 4. 20 mM ATP. 5. 2 denaturing loading buffer: 95% formamide, 0.025% SDS, 0.025% bromophenol blue, 0.025% xylene cyanol FF, 0.025% ethidium bromide, 0.5 mM EDTA. 6. (Optional): T7 Transcription Kit (MBI Fermentas, Vilnius, Lithuania), radiolabeled -P32 UTP.

2.5. RNA–Protein Binding Filter Assays

1. Synthetic oligoribonucleotide (5 W) (see Section 2.2, step 1) and materials for T4 PNK labeling with g-P32ATP as described in Section 2.2


343

2. Nylon and nitrocellulose membranes (Whatman Nytran N and Protran, respectively, Sigma-Aldrich, St Louis, MO). 3. 0.1 M EDTA. 4. 0.5 M KOH. 5. 1 M KCl. 6. pH indicator strips. 7. 5 binding buffer: 50% glycerol, 25 mM EDTA, 125 mM KCl, 50 mM Tris–HCl (pH 8.0). 8. Dot-blotter (Bio-Dot1SF Microfiltration Apparatus, BioRad, Hercules, CA) with a suitable vacuum source.

3. Methods All experiments involving RNA were carried out in siliconized tubes (Sigma, St Louis, MO) to avoid sticking of nucleic acids to the walls. Most of the protocols involve working with significant amounts of radioactivity, use proper safety equipment, wear protective clothing, and monitor the work area and equipment. Consult with your lab’s radiation safety officer before attempting these procedures for the first time. 3.1. Helicase Activity Assays

In standard helicase assays we use three types of double-stranded RNA substrates. Each of them has a 20 nt double-stranded core structure, optionally with 10 nt single- stranded overhangs on the 50 or the 30 end (Fig. 24.1). The ‘‘bottom’’ strand (D) in all of the substrates was the same, and usually this oligonucleotide was radiolabeled during substrate preparation.Each ofthe top strand oligonucleotides 5 W, 3W, or B, is then annealed to the radiolabeled D oligonucleotide in order to produce the 50 overhang (S5), 30 overhang (S3), or blunt-ended (SB) substrates, respectively (Fig. 24.1a). Reaction products and substrates during preparation are separated on native polyacrylamide gels. As the wild-type mtEXO complex is an active exoribonuclease, time-course assay is required to visualize the strand separation before RNA degradation, as the helicase reaction products are rapidly degraded. Alternatively, a DNA oligonucleotide can be used as the labeled strand, with only minor decrease in the helicase activity (13). Only the double-stranded substrate with the 30 overhang (S3), produced by annealing oligonucleotides D and 3 W is unwound by the helicase activity of the mtEXO complex; the remaining two duplexes are not good substrates and should only be used as negative controls (13) (see also Fig. 24.1c). The Suv3p protein alone does not display detectable duplex-unwinding activity; the presence of the Dss1p ribonuclease subunit is required (13).

344


A

B

S5

5W 5’ AGAGAGAGAGGUUGAGAGAGAGAGAGUUUG 3’ D 5’ CAACUCUCUCUCUCUCAAAC 3’

S3

3W 5' GUUGAGAGAGAGAGAGUUUGAGAGAGAGAG 3' D 5’ CAACUCUCUCUCUCUCAAAC 3’

SB

S5

S3

SB

B 5' GUUGAGAGAGAGAGAGUUUG 3' D 5’ CAACUCUCUCUCUCUCAAAC 3’

C S5 t(min.)

0

0.5

SB 5

10

0

0.5

5

S3 10

0

0.5

5

10

+

Fig. 24.1. Preparation of substrates and time-course assay of the yeast mitochondrial degradosome helicase activity. (a) Structures of different duplex substrates used in the assay. Oligoribonucleotide D was labeled at the 50 end using T4 PNK. (b) Preparative electrophoresis of substrates after annealing. Note different migration of substrates S5 and S3 in comparison to substrate SB suggesting that the observed bands are indeed doublestranded molecules (see Note 12). (c) A typical time-course assay for the helicase activity of the mtEXO complex using 0.1 mg of recombinant proteins. Reaction products were analyzed on a 15% native polyacrylamide gel. Substrates S5 and SB are not unwound (and only partially degraded), while substrate S3 is unwound after 30 s, and subsequently rapidly degraded. 3.1.1. Substrate Preparation

1. The first step is to obtain the radioactively labeled substrate oligonucleotide (D) (see Note 1). This is achieved by the 50 labeling protocol using the T4 PNK enzyme (New England Biolabs, Ipswich, MA) according to the manufacturer’s instructions. Prepare a 20 mL reaction with 2 mL of 10 PNK buffer (NEB), 1 mL of T4 PNK, 2 pmole of the RNA oligonucleotide, and 2 mL (20 mCi) of radiolabeled gP32ATP. The reaction is carried out at 37C for 45 min. 2. After reaction, remove proteins by phenol:chlorophorm extraction: add equal volume of acidic phenol:chlorophorm solution (see Note 2), vortex vigorously for about 1 min and spin down at maximum speed in a tabletop centrifuge for 5 min. Carefully collect the upper phase (see Note 3). 3. Transfer the water phase to a new eppendorf tube and precipitate RNA with ethanol (see Note 4). To precipitate RNA, add 1/10 of sample volume of 3 M Na-acetate (pH 5.2), 5 mg of glycogen, and two volumes of ice-cold 96% ethanol (see Note 5); incubate for at least 1 h at –20C. 4. After incubation, spin down at maximum speed for 10 min; the pellet is usually hardly visible. Remove ethanol and wash the pellet with 70% ice-cold ethanol (100–200 mL), centrifuge for 1 min at maximum speed, carefully remove ethanol, and air-dry the pellet for 1–2 min (see Note 6).


345

5. Dissolve the pellet in 33 mL of RNase-free water and divide the solution into three tubes (11 mL each). 6. Add 4 mL of 4 annealing buffer to each tube and add a proper amount of each unlabeled second-strand oligonucleotide (3 W, 5 W, or B) to obtain a ratio of 1:3 or higher (see Note 7). The final volume should be 16 mL. 7. Heat the samples at 80C for 10 min and then let them cool down slowly to room temperature. You can use a heat block set to 80C, switch it off after 10 min, and wait until the temperature goes down to about 25C (see Note 8). 8. In the meantime prepare a 15% native polyacrylamide gel. To prepare the gel, mix equal volumes of the 30% 19:1 acrylamide/bisacrylamide solution in water and 2 TBE. Add proper amounts of 10% APS (100 mL per 10 mL of gel) and TEMED (8 mL per 10 mL of gel) immediately before pouring. The glass plates should be carefully washed and rinsed with RNase-free water before use. With the 10 10 cm plates and 0.7 mm spacers that we routinely use, about 10 mL of acrylamide solution is sufficient for one gel. Use a comb that will allow at least 20 mL of well volume. 9. Prepare the running buffer (1 TBE). 10. Add the 6 loading dye (see Note 9) to the samples cooled to room temperature and load on the gel. Leave empty wells between each sample—this will make the subsequent steps of band excision easier. Run the gel at 200 V for 1 h (this is for 10 cm gels; adjust to match your equipment). 11. Autoradiography on film (not digital) is necessary for detection at this stage. After electrophoresis, disassemble the apparatus trying to keep the gel intact on one of the glass plates. Prepare the autoradiography cassette by lining it with a piece of aluminum foil. Cover the gel on top of a glass plate with plastic wrap (‘‘Saran’’), and place on the aluminum foil in the exposure cassette (see Note 10). Attach corners of the glass plate to the silver foil with sticky tape to immobilize the gel in the cassette. Subsequent steps will be carried out in the darkroom. 12. Working under the safety light (adapted to your film), cut a sheet of film approximately the size of the gel, and put it on the top of the gel. Mark the film on the edges with a waterproof marker so that you leave markings both on the film and on the aluminum foil (see Note 11). This is done so that you can reposition the developed film on the gel exactly as it was positioned during exposition. Carefully close the cassette and expose for about two minutes. Develop the film.

346


13. Using markings on the film and the aluminum foil place the developed film again on the gel, locate the bands corresponding to the labeled product, and cut the corresponding area of the gel with a clean sharp blade, and place in eppendorf tubes (see Note 12 and Fig. 24.1b). 14. Freeze the tubes with cut sections in liquid nitrogen, then grind them carefully with a sterile pipette tip (see Note 13). 15. Add 800 mL of gel extraction buffer to the crumbled gel and rotate overnight at 4C. 16. Spin the samples for 5 min at 4C at maximum speed, collect supernatant as carefully as possible; centrifugation at 4C will also remove some of the SDS from the sample. Try to avoid aspirating any solid pieces; if this happens, repeat the centrifugation step. Check the supernatant and the remaining gel with a Geiger counter to estimate the elution efficiency. 17. Precipitate the RNA by adding glycogen and 2 volumes of icecold 96% ethanol (see Note 14). Incubate the sample at – 20C for an hour, then spin down, and wash the pellet with 70% ethanol as in point 4. Check the pellet radioactivity with a Geiger counter. 18. Calculate the amount of water or 10 mM Tris–HCl (pH 7.5) required to resuspend the samples. You should aim to obtain enough radioactivity per mL to ensure efficient detection of reaction products with your equipment. We usually use substrates at about 50–100 cps/mL (see Note 15). 3.1.2. Time-Course Assay for the Helicase Activity

1. Prepare a 15% native polyacrylamide gel (see Section 3.1.1, step 8) and the running buffer (1 TBE). 2. Prepare the loading dye by supplementing it with carrier tRNA (see Note 16) and proteinase K (1 mg of tRNA and 10 mg of proteinase K per reaction), then aliquot in siliconized eppendorf tubes, one tube for each time point of each assay. As in this assay proteins are in large excess over the RNA substrate, adding unlabeled carrier RNA and proteinase K is necessary to avoid the formation of large protein-substrate complexes that will not migrate into the gel. 3. Prepare the reaction mix for each reaction consisting of 2 mL of 10 reaction buffer (RB), 0.2 mL of 0.1 M DTT, and 1 mL of radiolabeled substrate (50–100 cps, see Section 3.1.1, step 18) in a total volume of 19 mL. Supplement each reaction with 1 mL of 20 mM ATP or water (see Note 17). Reactions without ATP serve as negative controls. Add 0.1 mg of recombinant mtEXO complex; as a negative control, use samples without any proteins or with 0.1 mg BSA. Start timing the reactions. Reactions are carried out at 30C (see Note 18).


347

4. At each time point, take out 4 mL of each reaction and immediately add to the tube containing the loading dye with carrier RNA and proteinase K. 5. After the time-course is completed, let the last sample stand in RT for 10 min; then load the samples on the gel. As a positive control to visualize the products of strand separation, prepare one reaction without the proteins and denature by heating to 80C for 5 min and then rapidly cooling on ice for 5 min. Run the gel at 200 V (for a 10 cm gel) for 1 h. 6. Perform the autoradiographic detection procedure appropriate for your equipment. We recommend using a digital phosphor imager system, but photographic film can also be used. We recommend drying the gel before detection (see Note 19). Typical results are presented in Fig. 24.1c. 3.2. ATPase Activity Assays

In the mtEXO protein complex the Suv3p subunit has an ATP hydrolysis activity, hydrolyzing ATP to ADP. This activity is induced by RNA and short single-stranded DNA; the presence of Dss1p subunit does not increase the maximum ATPase activity, it does, however, decrease the basal activity in the absence of the inducing nucleic acid (13). The ATP hydrolysis reaction is monitored using thin layer chromatography on PEI-cellulose. In the conditions used in this assay, ATP remains at the starting point of the chromatography plate while ADP, AMP, and Pi products migrate in the abovementioned order. Radiolabeled -P32ATP or g-P32ATP can both be used as substrates. When -P32ATP is used, radioactive ADP is detected as the reaction product; if the substrate is g-P32ATP, radioactive inorganic phosphate is detected. The substrates are commercially available radiolabeled nucleotides diluted to obtain radioactivity optimal for subsequent detection (300–500 cps/mL). As the resulting ATP concentration is very low, unlabeled ATP can be added to a desired concentration in, for example, enzyme kinetics studies. As the ATPase activity is induced by RNA, unlabeled RNA can be added to the assay as described in the protocol. 1. Prepare substrates for the reaction: dilute commercially available radiolabeled -P32ATP (g-P32ATP can be used as well, see discussion above) to obtain radioactivity in the 300–500 cps/ mL range (about 500 depending on the initial activity and age of the preparation). This usually results in a final concentration of ATP in the reaction in the range of 200 pM. We usually supplement the reactions with unlabeled ATP to the final concentration of 1 mM. Obviously, other final ATP concentrations can be used, for example, in kinetics measurements. 2. Prepare the chromatography standards. Use commercially available unlabeled ATP, ADP, and AMP at a concentration of 100 mM (see Note 20). Verify that at the chosen amount

348


the standards are visible on chromatography plates in the UV light before starting the experiment; increase the amount if necessary. 3. Prepare plates for chromatography. We use plastic-backed PEICellulose F from Merck. Cut out a piece about 6–7 cm high and 9 cm wide—this will give sufficient space for about seven samples, if more are desired the plate should be made proportionally wider. The samples are deposited about 1.5 cm from the bottom edge (see Note 21), leave about 1 cm space between each sample. It is convenient to mark the spots for sample loading on the reverse (plastic) side of the plate with a waterproof marker (the markings will be visible on the other side through the plate). 4. Prepare the reaction mix. For one reaction (total volume of 20 mL) add 2 mL of 10 reaction buffer (RB), 0.2 mL of 0.1 M DTT, and 1 mL of diluted radiolabeled substrate (300– 500 cps). These ingredients can be premixed for convenience. Supplement each reaction with 1 mg of inducing RNA (tRNA, total RNA or oligoribonucleotides can be used) or water. Add 0.1 mg of the recombinant mtEXO complex or the Suv3 protein; use samples without proteins or with BSA as negative controls. Incubate the reaction at 30C for 30 min. The reactions can also be run in a time-course format (e.g., in kinetics studies), in such case remove an aliquot at each time point and stop the reaction by adding EDTA to 25 mM. 5. Prepare the chromatography solvents: a 1:1 mixture of 2 M formic acid and 0.5 M LiCl. Dedicated chromatography chambers are not necessary; if they are not available any vessel of a suitable size can be used, for example, a plastic culture dish. Prepare enough solvent for the vessel used. 6. Pre-run the plate with water. Fill the vessel with water (ddH2O) just to cover the bottom (water and solvent levels must be below the spots where the samples will be deposited). Put your plate with the bottom edge in the water and support it so that it remains nearly vertical. Water will move up the plate by capillary action, when it gets close to the upper edge of the plate (this should take about 5 min) you can begin to prepare the samples (see Note 22). 7. Stop the reactions by adding EDTA to 25 mM and placing the samples on ice. 8. Remove the pre-run plate from the vessel and put it on the bench with the silica side up. Load 1 mL of each sample on the places marked with spots; try not to touch the silica layer with the tip during loading (see Note 23). Then load the unlabeled ATP, ADP, and AMP standards (1 mL each). Remove water from the vessel and add the solvent mixture. Place the plate back in the vessel.


349

9. Chromatography takes 10–20 min and can be monitored under the UV light by the migration of the markers. After the separation is complete, the plate should be dried—we use a 50C oven for 10 min. 10. Wrap the plate with transparent plastic foil (Saran) and visualize by autoradiography on film or on a phosphor imager screen. Typical results are shown in Fig. 24.2a.

A

B mtEXO

-

RNA DNA

BSA

-

RNA

t(min.)

0

2

5

8

ADP S (30 nt)

P (4 nt) ATP

C

mtEXO

BSA

Nitrocellulose (bound) Nylon (free)

Fig. 24.2. Assays for the ATPase, exoribonuclease and RNA-binding activities of the yeast mitochondrial degradosome. (a) Chromatographic assay of the ATPase activity of the mtEXO complex. -P32ATP was used as substrate with 0.1 mg of recombinant proteins in the presence of RNA, DNA, or no nucleic acid (–). BSA was used as a negative control. Direction of chromatography is marked by an arrow. (b) Time-course assay of the exoribouclease activity using 50 labeled 30 nt oligoribonucleotide 5 W as substrate (S, 2 mM) with 0.1 mg of recombinant proteins. The reactions were separated on a 15% denaturing polyacrylamide gel. The product (P) is a short residual 4 nt fragment that is left after mtEXO digestion of the substrate. (c) Double filter assay of the RNA-binding capability of the mtEXO complex. The 5 W RNA oligonucleotide labeled on the 50 end was used at the concentration of 87.5 pM (1.75 fmol per 20 mL reaction) with a series of twofold dilutions of the mtEXO complex. Results for increasing protein concentration from 9.45 to 605 nM, along with the negative control (BSA) are shown.

3.3. Exoribonuclease Activity Assays

The Dss1 protein is the exoribonuclease of the mtEXO complex. Its activity is greatly enhanced by the helicase activity provided by the Suv3p subunit—the activity of Dss1p alone is barely detectable (13). It digests RNA in the 30 to 50 direction, producing nucleoside monophosphates. There are many possible assays that can be performed to analyze various aspects of the exoribonuclease activity of mtEXO; most of them are, however, beyond the scope of this volume. In this protocol, we will only introduce a method to perform a time-course assay of the mtEXO exoribonuclease

350


reaction using a short oligonucleotide substrate (30 nt in this example), labeled at the 50 end, and separation of the products on a denaturing polyacrylamide gel. Like other enzymes in the RNB family, mtEXO leaves a short residual undigested core of four nucleotides (13), which is easily detected using the described protocol. Longer substrates can be obtained by in vitro transcription of appropriate DNA constructs using -P32UTP labeling with subsequent detection of degradation by-products and released UMP. In such cases, PEI-cellulose thin layer chromatography can also be used to monitor the reaction in conditions described in protocol 3.2 (undigested RNA will remain at the bottom of the chromatogram, while the released UMP will migrate upwards). Different formats of the exoribonuclease assay have been described in our previous papers (13, 19). 1. Label the substrate. Use an oligoribonucleotide substrate like oligo 5 W used in previous assays. Label the oligo at the 50 end with T4 PNK and g-P32ATP exactly like it is described in Section 3.1.1, step 1. After the completion of the reaction, add 2X loading dye for denaturing gels, heat to 65C for 10 min, and immediately put on ice for 5 min. Denaturation should be performed just prior to electrophoresis; the labeled undenatured substrate can be stored at –20C for a few days. 2. Prepare a 15% denaturing polyacrylamide gel by mixing two volumes of 20% 19:1 acrylamide/bisacrylamide solution in 8 M urea and 1 TBE with one volume of 8 M urea in 1 TBE. Add proper amounts of 10% APS (100 mL per 10 mL of gel) and TEMED (8 mL per 10 mL of gel) immediately before pouring. With the 10 10 cm plates and 0.7 mm spacers that we routinely use, about 10 mL of acrylamide solution is sufficient for one gel. Run the gel for 1 h at 200 V (for 10 cm gels). 3. Locate and purify the radioactively labeled oligonucleotide exactly as described in Section 3.1.1, steps 11–18. 4. Prepare another 15% denaturing polyacrylamide gel as described in point 2 above and pre-run it. 5. Prepare the 2 loading dye for denaturing gels supplemented with 1 mg of carrier RNA (tRNA or total yeast RNA) per reaction and aliquot it into siliconized eppendorf tubes (4 mL for each tube). Carrier RNA is added to avoid the formation of protein-substrate complexes that will remain in the wells (this can be a problem even with denaturing gels) and to prevent further hydrolysis of the substrate (which should be negligible due to the presence of EDTA in the loading buffer). 6. Prepare the reaction mix. For one reaction (total volume of 20 mL) add 2 mL of 10 reaction buffer (RB), 0.2 mL of 0.1 M DTT, 1 mL of 20 mM ATP, and 1 mL of radiolabeled substrate


351

(50–100 cps). Add 0.1 mg of recombinant mtEXO complex; as a negative control, use samples without any proteins or with 0.1 mg BSA. Start timing the reactions. Reactions are carried out at 30C. 7. At each time point, take out 4 mL of each reaction and immediately add to the tube containing the loading dye with carrier RNA and place on ice. 8. After the time-course is completed, denature the samples by heating to 65C for 10 min and immediately transfer to ice and incubate for further 5 min. Load the samples on the prepared and pre-run 15% denaturing polyacrylamide gel and electrophorese for about 1 h at 200 V (for a 10 cm gel). 9. After electrophoresis dry the gel, wrap with transparent plastic foil (Saran), and visualize by autoradiography on film or on a phosphor imager screen. Typical results are shown in Fig. 24.2b. Decreasing amounts of substrate and the production of the 4 nt residual core left after exoribonucleolytic digestion should be readily detectable. 3.4. RNA–Protein Binding Filter Assays

For investigating the ability of the mtEXO complex to bind various RNA molecules, we use a variant of the double filter assay developed by Wong and Lohman (20) and adapted by Tanaka and Schwer (21). In our experiments we generally follow the protocol described by Vincent and Deutsher (22). The method, in general, is based on the separation of free RNA molecules from RNA bound to proteins. Radiolabeled RNA is incubated with the proteins and subsequently passed through a nitrocellulose filter and then through a nylon filter. Proteins with bound RNA should be retained on the first (nitrocellulose) filter, while the free unbound RNA should be retained on the second (nylon) filter. Quantitative autoradiography of both filters allows the estimation of the amount of bound vs. unbound RNA, and the calculation of the bound fraction. Varying the amount of protein (conveniently by a series of twofold dilutions) and plotting the bound fraction against the protein concentration makes estimation of the binding constant (Kd) possible. In this protocol, we provide the method using a short oligoribonucleotide substrate (5 W) labeled on the 50 end; longer polynucleotide substrates obtained by in vitro transcription of appropriate DNA constructs using -P32UTP labeling can also be used with this method (13). 1. Label the oligoribonucleotide substrate (5 W) and purify it as described in Section 3.3, steps 1–3. 2. Prepare the solutions for filter presoaking: 0.1 M EDTA; 1 M KCl; 0.5 M KOH.

352


3. Prepare the 1 binding buffer (BB) using the 5 stock, add DTT to 1 mM (see Note 24). 4. Cut both filter membranes to a proper size determined by the dot-blotting equipment used (we use the Bio-Dot1SF Microfiltration Apparatus, Bio-Rad, Hercules, CA; but any similar device should work). 5. Presoak the membranes (see Note 25) as follows. For the nylon membrane: 10 min in 0.1 M EDTA, followed by three times in 1 M KCl for 10 min each, then 1 min in 0.5 M KOH and finally rinse several times with H2O until the pH returns to neutral (see Note 26). For the nitrocellulose membrane: 10 min in 0.5 M KOH and then rinse several times with H2O until the pH returns to neutral. After presoaking incubate both filters in the binding buffer at 4C for at least one hour before proceeding with the experiment. 6. Prepare the reaction mixtures. For one reaction (total volume of 20 mL) add 4 mL of 5 binding buffer, 0.2 mL 0.1 M DTT, and a proper amount of protein (generally from about 5 nM to about 1200 nM, 200–600 nM should give strong binding to oligoribonucleotide substrates). Add the radioactive substrate (we use 1.75 fmol per 20 mL reaction, which gives 87.5 pM final RNA concentration). 7. Incubate the reactions for about 10 min at 30C. Exact timing is not very important as the sample-loading step usually takes much longer when many samples are processed in parallel. 8. Assemble the dot blotter equipment, from the bottom: sealing gasket, two (or more depending on the equipment) sheets of Whatman 3 MM paper soaked in the binding buffer, the nylon membrane, then the nitrocellulose membrane, and finally the sample loading template. Secure with screws according to the manufacturer’s instructions. Attach the vacuum pump and verify if the apparatus is properly assembled and sealed by loading one well with buffer and checking if it is quickly passed through the membranes. 9. Load the samples one at a time. Immediately before loading each sample, wash the well with 100 mL of binding buffer, and as soon as the wash passes through the membranes, load the entire 20-mL sample of the binding reaction (see Note 27). Repeat the washing step with another 100 mL of binding buffer. Proceed to the next sample. With many samples the whole procedure will take considerable amounts of time, but it is critical that the initial wash, loading of the sample, and the final wash are done quickly in succession. Delays at this stage can contribute to a high nonspecific background.


353

10. After loading the samples, wait until all the buffer has passed through the membranes, disassemble the dot-blotter, and airdry the membranes. Wrap the dried membranes with transparent plastic foil (Saran) and visualize by autoradiography on film or on a phosphor imager screen (see Note 28). Typical results are shown in Fig. 24.2c. 11. Bound RNA fraction is estimated as the product of the signal on the nitrocellulose filter and the total signal on both filters. Kd can be estimated by a nonlinear regression fit of the data to the formula B = [P]/(Kd + [P]), where B is the bound RNA fraction and [P] is the protein concentration (see Note 29).

4. Notes 1. We recommend ordering synthetic dephosphorylated oligonucleotides, otherwise a dephosphorylation step is needed prior to 50 end labeling 2. As the volume of the sample is small (20 mL); if you decide to perform phenol:chlorophorm extraction, you can dilute the sample with water to a convenient volume (generally few hundred mL)—it will make the procedure much easier and minimize the loss of material. 3. If the labeled ATP is marked with a color dye, it can make this step easier as the dye will partition in the organic phase (not all dyes used by different suppliers will necessarily exhibit this behavior). 4. As the buffer used in the next step (RNA annealing) has a very high salt concentration, the precipitation step at point 3 can be skipped and the annealing reaction can be performed directly with the oligonucleotide obtained after phenol:chlorophorm extraction. 5. In each RNA precipitation step we use glycogen and siliconized tubes to avoid sticking of nucleic acids to tube walls, but even then it remains a problem which causes significant loses of material—after precipitation, up to 50% of total radioactivity can remain on the tube walls after dissolving the pellet. 6. The pellet formed during precipitation of radiolabeled RNA oligonucleotides is usually hardly visible, but its presence can be verified using a Geiger counter. Do not discard the supernatants from the precipitation steps immediately; when monitoring the pellet and supernatants with a Geiger counter, you can notice when the pellet becomes accidentally unstuck and is removed with the supernatant. Recover it by reprecipitation.

354


7. Estimating the amount of labeled oligonucleotide is difficult (it depends on the labeling and purification yield); we usually use 2 pmole of each unlabeled second-strand oligonucleotide for annealing reaction. It is not critical, as the subsequent gel purification will get rid of any not-annealed strands. 8. If the design of the heating block allows it, you can remove the block from the heater and place it on the bench to accelerate the cooling. 9. The 6 loading buffer can be prepared using the formula given in Section 2 but we used commercial DNA loading buffer supplied by MBI Fermentas, Vilnius, Lithuania. For the RNA work, choose a fresh unopened tube of the buffer and store it at –20C. 10. At this point you should use a Geiger counter to check the efficiency of your preparation; electrophoresis removes the unincorporated nucleotides, so the signal from the gel should correspond to the amount of labeled oligonucleotide. It should be strong enough to exceed the scale of most handheld Geiger counters, if the signal is weak there is no point in continuing the procedure and the labeling and annealing steps should be repeated. 11. Before this step, you should check if the ink of your waterproof marker survives the film development—mark a spare piece of film, run it through the developer, and see if the markings are still visible. 12. Using different second-strand unlabeled oligonucleotides of various lengths (like our oligonucleotides B and 5 W or 3 W) in the same experiment provides an additional control of the annealing reaction. The resulting double-stranded products will migrate differently on the gel (Fig. 24.1b), depending on the size of the second strand; if annealing fails, the labeled oligonucleotide will always migrate at the same level. In our experience the annealing step is very reliable and further controls are not necessary. 13. Before grinding the frozen gel slice wait until it is slightly thawed; a hard frozen piece of polyacrylamide can jump uncontrollably in the test tube when you attempt to grind it. 14. As the elution buffer contains 0.3 M NaCl, no further addition of salt is required for precipitation. SDS should not precipitate under these conditions. 15. When estimating the amount of water needed for resuspension of the pellet, start with half the intended volume and check the radioactivity of 1 mL of the solution using a Geiger counter. A significant portion of radioactivity can remain in insoluble form. (see also Note 5).


355

16. You can use different carrier RNAs for this purpose; we used commercial E. coli tRNA or total yeast RNA preparations with success. Without the carrier RNA, the majority of reaction products remain in the wells associated with proteins and do not migrate into the gel. The same suggestion also applies to denaturing polyacrylamide gels used in exoribonuclease assays. 17. For performing multiple assays in parallel, the most convenient way is to prepare a master premix (without ATP, RNA substrate, and proteins) for all the samples. ATP or water (control) can be placed in the reaction tubes (1 mL of 20 mM ATP/water each). Then add an appropriate amount of the radioactive RNA substrate to the master premix and aliquot to each of the reaction tubes (18 mL each). Finally add 1 mL of the recombinant enzyme, vortex, and start the incubation at 30C. 18. You can use ‘‘trap’’ RNA (0.5 pmole of unlabeled oligoribonucleotide D) in each reaction to avoid strand reannealing. It is not required when working with the wild-type mtEXO complex, as the exoribouclease activity will quickly degrade the released strands anyway. It can be useful when working with mutants deficient in the exoribonuclease activity or with substrates that do not undergo degradation by mtEXO (like DNA molecules). 19. Drying high-percentage polyacrylamide gels can sometimes be problematic (gel crumbling) depending on the equipment available. If this happens you can try to make exposure with wet gels using X-ray film (using wet gels in phosphor imager cassettes is not recommended). This will work if the signal is strong enough to allow detection with short exposure time (not more than a few hours), otherwise the bands will become blurred due to diffusion. 20. If ADP and AMP solutions are not available, the standards can be prepared by leaving an aliquot of the ATP solution at room temperature overnight. Spontaneous hydrolysis should produce enough ADP and AMP to serve as chromatography standards (verify by chromatography and UV light detection before the actual experiment). 21. The exact distance from the edge is not critical, it is important to make sure the samples are deposited above the level of the solvents in the vessel. 22. The important part is to make sure that the chromatographic plate does not become dry during the experiment. After the pre-run, it is therefore critical to load the samples quickly and replace the plate in the vessel with the proper solvent mixture before it dries out. This is why it is convenient to get the samples ready for loading during the pre-run.

356


23. The silica on the plate is very fragile when wet and touching it with a tip can result in scratches that will disrupt the proper development of the chromatogram. 24. The main difference between the binding and reaction buffers is the lack of magnesium and presence of EDTA in the former. The reason is to avoid degradation of the RNA substrate by the exoribonuclease activity of mtEXO. In the absence of divalent cations, the exoribonuclease should not be active. 25. Presoaking the membranes is a critical step in this protocol and its omission will lead to a very high nonspecific background, particularly on the nitrocellulose filter which without presoaking will bind free RNA not bound to proteins. 26. We use pH indicator strips to check the neutrality; touch the strip to the filter in the area where no samples will be loaded. 27. When loading the sample try to place it at the bottom of the well without touching the membrane. Try to avoid air bubbles and sticking of the sample to the walls of the well. If this happens, touch the sample with the tip and bring it to the bottom of the well. It is important that the sample is passed through the membranes quickly and in its entirety. 28. Mark the membranes (e.g., by making notches) to avoid mixing them during the experiment and analysis. 29. If the experiment is performed with Kd estimation in mind, it is important to ensure that both ends of the binding curve are included in the range of concentrations used: the bound RNA fraction for the highest protein concentrations should approach 95–100% and should not increase with further protein concentration increase. On the other end, the bound RNA fraction for the lowest protein concentrations should approach that of a negative control (e.g., BSA). When the experiment is performed properly, this should not exceed 1%.

Acknowledgments This work was supported by the Ministry of Science and Higher Education of Poland through The Faculty of Biology, Warsaw University Intramural Grants BW#1720/46 and BW#1680/40, the CoE BioExploratorium project: WKP_1/1.4.3/1/2004/ 44/44/115/2005, and by grants 2P04A 002 29 and N N301 2386 33 from the Ministry of Science and Higher Education of Poland.


357

References 1. Gagliardi D., Stepien P. P., Temperley R. J., Lightowlers R. N., and ChrzanowskaLightowlers Z. M. (2004) Messenger RNA stability in mitochondria: different means to an end. Trends Genet. 20, 260–267. 2. Meyer S., Temme C., and Wahle E. (2004) Messenger RNA turnover in eukaryotes: pathways and enzymes. Crit. Rev. Biochem. Mol. Biol. 39, 197–216. 3. Mitchell P. and Tollervey D. (2000) mRNA stability in eukaryotes. Curr. Opin. Genet. Dev. 10, 193–198. 4. Mitchell P. and Tollervey D. (2001) mRNA turnover. Curr. Opin. Cell Biol. 13, 320–325. 5. Newbury S. F. (2006) Control of mRNA stability in eukaryotes. Biochem. Soc. Trans. 34, 30–34. 6. Rogowska A. T., Puchta O., Czarnecka A. M., Kaniak A., Stepien P. P., and Golik P. (2006) Balance between transcription and RNA degradation is vital for Saccharomyces cerevisiae mitochondria: reduced transcription rescues the phenotype of deficient RNA degradation. Mol. Biol. Cell 17, 1184–1193. 7. Carpousis A. J. (2002) The Escherichia coli RNA degradosome: structure, function and relationship in other ribonucleolytic multienzyme complexes. Biochem. Soc. Trans. 30, 150–155. 8. Mitchell P., Petfalski E., Shevchenko A., Mann M., and Tollervey D. (1997) The exosome: a conserved eukaryotic RNA processing complex containing multiple 30 !50 exoribonucleases. Cell 91, 457–466. 9. Zuo Y. and Deutscher M. P. (2001) Exoribonuclease superfamilies: structural analysis and phylogenetic distribution. Nucleic Acids Res. 29, 1017–1026. 10. Cordin O., Banroques J., Tanner N. K., and Linder P. (2006) The DEAD-box protein family of RNA helicases. Gene 367, 17–37. 11. Rocak S. and Linder P. (2004) DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232–241. 12. Dziembowski A., Piwowarski J., Hoser R., Minczuk M., Dmochowska A., Siep M., van der Spek H., Grivell L., and Stepien P. P. (2003) The yeast mitochondrial degradosome. Its composition,

13.

14.

15.

16.

17.

18.

19.

20.

interplay between RNA helicase and RNase activities and the role in mitochondrial RNA metabolism. J. Biol. Chem. 278, 1603–1611. Malecki M., Jedrzejczak R., Stepien P. P., and Golik P. (2007) In vitro reconstitution and characterization of the yeast mitochondrial degradosome complex unravels tight functional interdependence. J. Mol. Biol. 372, 23–36. Margossian S. P., Li H., Zassenhaus H. P., and Butow R. A. (1996) The DExH box protein Suv3p is a component of a yeast mitochondrial 30 -to-50 exoribonuclease that suppresses group I intron toxicity. Cell 84, 199–209. Dmochowska A., Golik P., and Stepien P. P. (1995) The novel nuclear gene DSS-1 of Saccharomyces cerevisiae is necessary for mitochondrial biogenesis. Curr. Genet. 28, 108–112. Dziembowski A., Malewicz M., Minczuk M., Golik P., Dmochowska A., and Stepien P. P. (1998) The yeast nuclear gene DSS1, which codes for a putative RNase II, is necessary for the function of the mitochondrial degradosome in processing and turnover of RNA. Mol. Gen. Genet. 260, 108–114. Golik P., Szczepanek T., Bartnik E., Stepien P. P., and Lazowska J. (1995) The S. cerevisiae nuclear gene SUV3 encoding a putative RNA helicase is necessary for the stability of mitochondrial transcripts containing multiple introns. Curr. Genet. 28, 217–224. Stepien P. P., Margossian S. P., Landsman D., and Butow R. A. (1992) The yeast nuclear gene suv3 affecting mitochondrial post-transcriptional processes encodes a putative ATP-dependent RNA helicase. Proc. Natl. Acad. Sci. U.S.A. 89, 6813–6817. Malecki M., Jedrzejczak R., Puchta O., Stepien P. P., and Golik P. (2008) In vivo and in vitro approaches for studying the yeast mitochondrial RNA degradosome complex. Methods Enzymol. 447, 463–488. Wong I. and Lohman T. M. (1993) A double-filter method for nitrocellulose-filter binding: application to protein-nucleic acid interactions. Proc. Natl. Acad. Sci. U.S.A. 90, 5428–5432.

358


21. Tanaka N. and Schwer B. (2005) Characterization of the NTPase, RNA-binding, and RNA helicase activities of the DEAH-box splicing factor Prp22. Biochemistry 44, 9795–9803.

22. Vincent H. A. and Deutscher M. P. (2006) Substrate recognition and catalysis by the exoribonuclease RNase R. J. Biol. Chem. 281, 29769–29775.

Chapter 25 Characterization of the Helicase Activity and Anti-telomerase Properties of Yeast Pif1p In Vitro Jean-Baptiste Boule´ and Virginia A. Zakian Abstract Pif1p is the prototype member of a family of helicases that is highly conserved from yeast to humans. In yeast, Pif1p is involved in many aspects of the preservation of genome stability. In particular, Pif1p is involved in the maintenance of mitochondrial DNA and in the direct inhibition of telomerase at telomeres and double-stranded breaks. Here we describe methods to purify Pif1p and study in vitro its enzymatic properties and functional interaction with telomerase. Key words: Yeast, Pif1p, helicase, telomerase, oligonucleotide substrate-based radiometric assays.

1. Introduction This chapter focuses on the characterization of the Saccharomyces cerevisiae Pif1p helicase. Pif1p is the prototype member of the PIF1 family of helicases, which is conserved from yeast to human (1, 2). Two isoforms of the enzyme are expressed in yeast, owing to alternative usage of two start codons from the same mRNA. Translation from the first start codon leads to the synthesis of a mitochondria-directed isoform, while translation from the second AUG codon leads to the synthesis of the nuclear isoform (3). Genetic studies have shown that the nuclear form of Pif1p plays an important role in counteracting the activity of telomerase, the specialized reverse transcriptase that elongates the end of eukaryotic chromosomes. Through this activity, Pif1p prevents gross chromosomal rearrangements that are due to the addition of telomerase-mediated de novo telomere addition at double strand breaks (4). In vivo and in vitro data suggest that this action is M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_25, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

359

360

Boule´ and Zakian

achieved through a direct interaction between Pif1p and telomerase (5, 6). Using oligonucleotide-based radiometric assays, Pif1p has been shown to unwind preferentially RNA–DNA hybrids over DNA substrates (7). This preference suggests that Pif1p inhibits telomerase by unwinding the RNA–DNA substrate formed by the telomerase RNA, TLC1, and the telomeric DNA end. Importantly, the interaction between Pif1p and telomerase is conserved in evolution, since Pif1p has been shown to interact with mouse and human telomerase (8–10). This chapter focuses on in vitro methods to purify recombinant yeast Pif1p and to characterize its activity by classical oligonucletide substrate-based radiometric assays. We also describe methods to study in vitro its functional interaction with yeast telomerase.

2. Materials 2.1. Overexpression of Recombinant His-Tagged Pif1p in Bacteria

1. Luria Bertani (LB) (per liter): 10 g Bacto-tryptone, 5 g yeast extract, 10 g NaCl. Adjust pH to 7.5 with 1 N NaOH. Autoclave. 2. Isopropyl-b-thiogalactoside (IPTG): 1 M solution in ddH2O. Filter-sterilize and store at –20C in 1 mL aliquots. 3. Kanamycin sulfate stock solution: make stock at 50 mg/mL in ddH2O. Filter sterilize. Store at 4C. 4. Chloramphenicol stock solution: make stock at 50 mg/mL in 100% ethanol. Store at –20C.

2.2. Purification of Recombinant His-Tagged Pif1p 2.2.1. Affinity Chromatogaphy

1. Buffer A: 30.5 mM Na2HPO4, 19.5 mM NaH2PO4, 300 mM NaCl, pH 7.0. Filter sterilize. 2. 1 M imidazole: pH 7.0. Adjust pH with 1 N NaOH and filter sterilize. 3. Protease inhibitor cocktail tablets, EDTA free (Roche Applied Science). 4. 45 mM sterile syringe filter; 10 mL sterile plastic syringe. 5. Sonicator and thin probe. 6. Talon polyhistidine-Tag purification resin (Clontech) (see Note 1). 7. Low pressure chromatography column (5 mL capacity or above, e.g., Millipore Vantage-L chromatography column or equivalent). 8. Peristaltic pump (Gilson Minipuls, or equivalent) and silicone tubing.

Helicase Activity and Anti-telomerase Properties

361

9. Low protein binding tubes (e.g., Nunc MiniSorp). 10. Dialysis tubing (e.g., Pierce Snakeskin, 10 kD cut off) and clips (Pierce). 11. Anti-His-Tag monoclonal antibody (Novagen). 2.2.2. Cation Exchange Chromatography

1. Buffer A2: 45.5 mM Na-acetate, 4.5 mM acetic acid, 50 mM (NH4)2SO4, 50 mM Mg-acetate, 200 mM NaCl, 5% glycerol, pH 5.6. Filter sterilize. 2. Buffer B2: Same composition as buffer A2 but containing NaCl 1 M, pH 5.6. Filter sterilize. 3. Buffer C: HEPES 50 mM pH 7.8, (NH4)2SO4 50 mM, Mgacetate 50 mM, 200 mM NaCl, DTT 1 mM, glycerol 5%. Filter sterilize. 4. Pif1p storage buffer: 0.5 buffer C containing 50% glycerol. 5. FPLC system (GE healthcare Akta system or equivalent). 6. Centrifugal filter concentrator, 10 kD cut off (Millipore Centricon YM-10 or equivalent).

2.3. Preparation of Telomerase Activity from Yeast Protein Extracts 2.3.1. Overexpression of Telomerase Core Subunits

1. Complete SCGLA medium (per liter): 6.7 g of yeast nitrogen base without amino acids, 1 g glucose, 30 g glycerol, 20 g lactic acid, 20 mg of each adenine, uracil, histidine, tryptophan, proline, arginine, and methionine; 30 mg of each leucine, isoleucine, tyrosine, and lysine. Adjust pH to 5–6 with NaOH 10 N and autoclave. 2. YPGLA medium (per liter): 10 g yeast extract, 20 g peptone, 2 g glucose, 30 g glycerol, 20 g lactic acid, 20 mg adenine. Adjust to pH 5–6 and autoclave. 3. D(þ)-galactose (Sigma). 4. Diethylpyrocarbonate (DEPC)-treated ddH2O. Add 0.5 mL DEPC to 500 mL ddH2O. Mix well. Incubate at 37C overnight. Sterilize by autoclaving. 5. Buffer L: 40 mM Tris–HCl, pH 8.0, 500 mM sodiumacetate, 2.2 mM MgCl2, 0.2 mM EDTA, 0.2% Triton X-100, 0.4% Igepal CA-630, 20% glycerol. Prepare using RNase-free reagents and glassware (see Note 2).

2.3.2. Telomerase Activity Fractionation and Storage

As telomerase activity is RNase-sensitive, all reagents, solutions, and equipment must be handled in an RNase-free environment (see Note 2). 1. Automated mortar and Pestle (e.g., Retsch RM100). 2. RNaseZAP solution (Ambion). 3. 50 mL sterile conical polypropylene tubes. 4. Sterile single-usage plastic pipettes.

362

Boule´ and Zakian

5. RNase inhibitor (e.g., Promega RNAsin). 6. DEAE sepharose fast flow (GE healthcare). 7. TMG-500 buffer: 10 mM Tris–HCl, pH 8.0, 1.1 mM MgCl2, 500 mM Na-Acetate, 0.1 mM EDTA, 0.1% Triton X-100, 0.2% Igepal CA-630, 10% glycerol, 0.1 mM phenylmethanesulphonylfluoride (PMSF). 8. TMG-900 buffer: same as above, but containing 900 mM Na-Acetate. 9. TMG-30 buffer: same as above, but containing 30 mM Na-Acetate. 10. PD-10 desalting column (GE healthcare). 11. Centrifugal filter concentrator (e.g., 5 mL centricon YM-30, Millipore). 12. Glycerol (Sigma). 2.4. Characterization of Pif1p Activity Using Radiolabeled Oligonucleotide Substrates 2.4.1. Preparation of Oligonucleotide Substrates

1. T4 polynucleotide kinase (New England Biolabs). 2. [g-32P]-ATP (> 5000 Ci/mmol). 3. Annealing buffer (5 ): 10 mM Tris–HCl, pH 7.5, 10 mM MgCl2. 4. Ficoll loading buffer (6 ): 17% Ficoll, 0.05% bromophenol blue, 0.05% xylene cyanol. 5. Polyacrylamide gel oligonucleotides.

electrophoresis

(PAGE)-purified

6. Microspin G-25 columns (GE healthcare). 7. 12% polyacrylamide gel (20:1 acrylamide:bis-acrylamide ratio): To prepare 100 mL of gel, mix 28.5 mL 19:1 acrylamide:bis-acrylamide 40% solution (Bio-Rad), 1.45 mL acrylamide 40% solution (Bio-Rad), 10 mL TBE 10 , 60 mL ddH2O. Filter and degas. Per mini-gel, mix 10 mL of gel mix with 100 mL of APS 10% and 10 mL of N,N,N 0 ,N 0 tetramethylethylenediamine (TEMED). Poor the solution to make a 1.5-mm thick 10 8 cm mini-gel. 8. Microcon Ultrafree-MC centrifugal filters (0.22 mm, Millipore). 9. D-Tube midi Dialyzer tubes (Novagen). 10. Microcon YM-10 centrifugal filter unit (Millipore). 11. Horizontal agarose gel slab unit and power supply. 12. Sterile razor blades. 13. Kodak autoradiography film and cassette. 14. Scintillation cocktail and 20 mL scintillation vials. 2.4.2. Pif1p Activity Assay

1. Helicase reaction buffer (5 ): 100 mM Tris, pH 7.5, 200 mM NaCl, 500 mg/mL BSA, 10 mM dithiotreitol (DTT).


363

2. Helicase stop/load buffer: Ficoll loading buffer (see Section 2.4.1) supplemented with 50 mM EDTA and 1 mM single stranded DNA oligonucleotide (see Note 3). 3. 12% polyacrylamide gel (20:1 acrylamide:bis-acrylamide ratio): Per gel, mix 40 mL of gel mix with 0.2 mL of APS 10% and 40 mL of TEMED. Poor the solution to make a 1.5-mm thick 18 16 cm gel. 4. Vertical slab gel electrophoresis unit and power supply. 5. Kodak autoradiography film (BioMax MR) and film cassette. 6. Radiolabeled oligonucleotide helicase substrate (see Section 2.4.1). 7. 3 MM and DE81 chromatography papers (Whatman). 2.5. Functional Interaction Assay Between Pif1p and Yeast Telomerase 2.5.1. Telomerase Assay

1. Telomerase Reaction (TR) buffer (10 ): 200 mM Tris, pH 8.0, 200 mM NaCl, 10 mM DTT, 10 mM spermidine. 2. 50 mM MgCl2. 3. dNTP mix: 0.5 mM of each dATP, dGTP, and dCTP, 50 mM dTTP, 40 mM ATP. 4. [a-32P]-TTP (>5000 Ci/mmol). 5. TR stop buffer: 20 mM Tris, pH 8.0, 1 mM EDTA, 0.5% SDS, 250 mg/mL PCR-grade proteinase K, 50 pM [g-32P]labeled control oligonucleotide (see Note 4). 6. Glycogen. 7. (NH4)-Acetate 4 M. Filter sterilize. 8. Formamide loading buffer: 10 mM NaOH, 95% formamide, 0.05% bromphenol blue, 0.05% xylene cyanole.

2.5.2. Electrophoresis and Detection of Reaction Products

1. 16% urea-polyacrylamide sequencing gel. To prepare 1 L of gel mix, add successively in a beaker 100 mL TBE 10 , 400 mL 19:1 acrylamide:bis-acrylamide 40% solution (BioRad) and 420 g urea. Mix by stirring on medium heat until urea is dissolved. Let cool to room temperature, poor into a 1 L graduated cylinder, and complete to 1 L with ddH2O. Mix, filter through a paper filter and degas. To prepare one gel, mix 100 mL of 16% gel mix, 0.5 mL APS 10%, and 100 mL TEMED. 2. Nucleic acid sequencing unit (Sigma IBI model STS-45 is recommended) and power supply.

2.5.3. Telomerase Displacement Assay

All buffers and material should be RNase-free (see Note 2). 1. Dynabeads M-280 streptavidin magnetic beads (Invitrogen). 2. PAGE-purified biotinylated telomeric oligonucleotide.

364

Boule´ and Zakian

3. Magnet. 4. Buffer S1: 0.1 M NaOH, 0.05 M NaCl. 5. 0.1 M NaCl. 6. Buffer B/W: 10 mM Tris–HCl (pH 7.5), 1 mM EDTA, 2 M NaCl. 7. TR buffer: see Section 2.5.1.

3. Methods 3.1. Overexpression of Recombinant Pif1p in Bacteria

3.2. Purification of Recombinant Pif1p 3.2.1. Affinity Chromatography

1. These instructions assume the use of a bacterial strain expressing the Pif1p nuclear isoform (amino acids 40–859) fused to a 6-histidine tag. As an example, we use the BL21(DE3) derivative strain Rosetta (Novagen) expressing the PIF1 ORF (minus the first 117 base pairs) cloned into the pET28(b) vector (Novagen), in order to express, upon IPTG induction, Pif1p fused at its N-terminus to a 6-histidine tag (see Note 5). Fresh colonies are grown overnight on a LB plate containing 30 mg/mL kanamycin and 34 mg/mL chloramphenicol. Inoculate a colony in 50 mL LB supplemented with kanamycin and chloramphenicol and grow at 37C overnight with agitation (150 rpm). Inoculate 5 mL of the overnight culture in 1 L of LB and grow cells at 37C with agitation until OD600 reaches 0.6–0.8 (see Note 6). Cool the bacterial culture for 30 min by placing it in an ice bucket. After the culture has cooled down, add IPTG at 1 mM final concentration and incubate the culture at 18–23C with agitation for another 15 h (see Note 7). Pellet the bacteria by centrifugation at 4000 g and freeze the pellet at –80C, or keep on ice and proceed to purification (see Section 3.2). All steps should be performed at 4C. 1. Resuspend cell pellet in 1/20th culture volume of cold buffer A containing protease inhibitors (one Complete EDTA-free protease inhibitor tablet per 30 mL buffer A). Cells are broken by a single passage in a French press at 10,000 PSI. The lysate is subsequently cleared by centrifugation for 30 min at 16,000 g at 4C. At this stage, the supernatant is still viscous due to presence of bacterial nucleic acids. The supernatant is transferred to a beaker and sonicated on ice using a thin probe at the following settings: 40% amplitude, pulse 40% (see Note 8). Continue until the lysate is no longer viscous. Filter the supernatant through a 45-mM syringe filter to remove remaining aggregates.


365

2. Load the supernatant on a column containing 5 mL packed Talon resin equilibrated in buffer A using a peristaltic pump (see Note 9). Load at a constant flow rate of about 3 mL/min or slower. Faster flow rates tend to decrease binding of recombinant Pif1p to the resin. After loading the supernatant, wash the column successively with 3 volumes of buffer A supplemented with 30 mM imidazole and 3 volumes of buffer A. Recombinant Pif1p is eluted from the Talon column with 3 column volumes buffer A supplemented with 200 mM imidazole (see Note 10). Collect fractions from flow through, washes and elution steps in low protein-binding tubes (e.g., MiniSorp tubes) for analysis. Most of recombinant Pif1 should elute between one and two column volumes. 3. The elution profile of Pif1p should be monitored by analyzing aliquots of the colleted fractions by SDS-polyacrylamide gel electrophoresis followed by Western blotting using an anti His-tag antibody and/or Coomassie staining (An example is shown in Fig. 25.1).

Fig. 25.1. Pif1p purification. Coomassie staining of an 8% SDS-PAGE gel showing the supernatant after IPTG induction (SN), the protein pool after elution from the Talon resin (His), or the protein pool after cation exchange (CE) chromatography.

4. Pool fractions containing Pif1p and proceed to cation exchange chromatography. 3.2.2. Cation Exchange Chromatography

1. The pooled fractions from the affinity purification are poured into dialysis tubing (10 kD cut off) and dialyzed against 1 L buffer A2 at 4C overnight. Provide gentle agitation using a stirring bar. 2. Remove sample from dialysis tubing. The sample usually contains some precipitate. Pellet precipitate briefly at 4C at 10,000 g and filter the supernatant through a 0.2-mm filter fitted on a 10-mL syringe. The volume of the sample can be reduced if desired using centrifugal concentrators.

366

Boule´ and Zakian

3. The following steps assume the use of a FPLC system with gradient elution capabilities, to which is connected a 2-mL cation exchange column. The column is first rinsed with water and then equilibrated in buffer A2 until the OD280 and the conductivity signals are stable. The sample injection loop should also be rinsed with buffer A2 during this step. Load the sample on the column at a rate of 1–1.5 mL/min and then wash the column with 5 volumes of buffer A2. Start collecting 2-mL fractions and elute proteins from the column with a 0–100% gradient in buffer B2 (the gradient should be 10 column volumes in length). Using these conditions, Pif1p will elute around 300 mM NaCl. Check elution fractions by analyzing 20-mL aliquots by SDS-PAGE followed by Coomassie staining. Pool fractions containing pure Pif1p based on visual estimation of the stained gel. 4. Concentrate pooled fractions using a centrifugal concentrator with a cut of 10 kD to a volume of around 500 mL. Add 4 mL of cold buffer C and concentrate the sample again. Repeat this step three times and concentrate the sample to less than 500 mL. Transfer the concentrated protein to a clean eppendorf tube and place on ice. Add 0.8 volume of glycerol, mix well, and distribute in aliquots of 10–50 mL (or desired volume). The aliquots are then flash frozen in liquid N2 and stored at –80C (see Note 11). 3.3. Preparation of Telomerase Activity from Yeast Protein Extracts 3.3.1. Overexpression of Telomerase Core Subunits

This protocol assumes the use of a yeast strain containing a 2-mm plasmid allowing the expression of EST2 and TLC1 ORFs under the control of GAL promoters. For example, we use a pESC plasmid (stratagene) containing the EST2 and TLC1 genes placed under the control of he GAL1 and GAL10 promoters, respectively. The yeast strain used for expression was the protease deficient strain BCY123 est1 type II survivor strain (described in (5)). 1. Starting from a fresh colony on plate, grow a 50-mL culture in SCGL media lacking appropriate amino acids to saturation. Use this culture to inoculate 1 L of SCGL media (minus appropriate amino-acids) and grow at 30C with agitation to an OD600 of 1. Add 1 L of YPGLA media and incubate at 30C with agitation for another 3 h. Add 20 g galactose (2% final concentration) to induce expression of EST2 and TLC1 and incubate for another 16 h at 30C. 2. Pellet cells by centrifugation at 3000 g. Resuspend the pellet in 1 volume L buffer and pour slowly in liquid N2. Keep frozen noodles at –80C or proceed directly to telomerase fractionation.

Helicase Activity and Anti-telomerase Properties 3.3.2. Telomerase Activity Fractionation and Storage

367

Since telomerase is a ribonucleoprotein, all steps of the purification should be performed at 4C and in an RNase-free environment (see Note 2). With these considerations in mind, telomerase activity can be fractionated from yeast cells using the following method, adapted from (8). 1. This protocol assumes the use of a RM100 automated mortar and pestle. Breakage of the cells is performed while cells are still frozen with liquid N2 (see Note 12). Pre-cool the mortar and pestle with liquid N2. To avoid hazardous splashes, pour only little amount of liquid N2 at a time. The mortar should be cold during the entire procedure. Add the frozen noodles obtained as described in Section 3.3 to the mortar and grind them at the finest setting of the RM100 for approximately 15 min. The cell lysate will appear as a fine white powder. Add a small amount of liquid N2 every 2–3 min to ensure that the cells stay frozen. After 15 min, check a small amount of the frozen powder under a microscope to estimate roughly lysis efficiency. Most of the cells should appear as dark debris (a lysis efficiency of about 70% or above can be easily achieved using this technique). Continue grinding if necessary. 2. Add the frozen powder to a clean 50 mL polypropylene tube and add 120 units RNase inhibitor (e.g., RNAsin, Promega) and one protease inhibitor tablet. Thaw the lysate at 4C (see Note 13). Pour the lysate in DEPC-treated corex tubes and centrifuge at 4C at 10,000 g for 30 min. Transfer supernatant in a fresh tube and place on ice. 3. Incubate the supernatant with DEAE sepharose preequilibrated in TMG-500 buffer at 4C for 30 min on a rotating wheel. Use 1 mL bed volume for 10 mL supernatant. 4. Pellet resin by centrifugation at 800 g for 1 min. Discard supernatant and replace with the same volume of TMG-500 buffer. Resuspend by gentle pipetting and gently rotate 10 min at 4C. Repeat three times. 5. Telomerase is eluted by incubation with the high salt TMG900 buffer. After the last wash, add 1 mL TMG-900 per mL of resin and incubate 15 min on the rotating wheel at 4C. Pellet resin by centrifugation at 3000 g for 10 min and save the supernatant containing telomerase at 4C. 6. The elution fraction is then desalted by passage through a PD-10 column equilibrated in TMG-30 buffer according to the manufacturer’s instructions. Concentrate the eluate using a centrifugal concentrator (10 kD cut off) to a volume of approximately 100 mL or less. Add an equal volume of glycerol. Mix well by pipetting, distribute in aliquots of 10 mL RNase-free microfuge tubes and freeze in liquid N2. Store at –80C.

368

Boule´ and Zakian

3.4. Characterization of Pif1p Activity Using Radiolabeled Oligonucleotide Substrates

3.4.1. Preparation of Oligonucleotide Substrates

Detailed methodological reviews describing radiometric assays and their application to helicase mechanistic studies exist (9–11). A favorite general reference that details synthesis of radiolabeled nucleic acids substrates and gel-based analysis of reaction products can be found in this book series (11). However, since optimal assay conditions vary among different helicases, we will briefly describe the assay system that we developed to analyze Pif1p helicase enzymatic properties using radiometric assays (5, 7). 1. Radiolabel the top (helicase-displaced)-strand oligonucleotide by adding the following to a microfuge tube: 1 mL 10 T4 polynucleotide kinase buffer, 10 pmol of oligonucleotide (5 mL, 2 mM), 3 mL [g-32P]-ATP, 1 mL T4 polynucleotide kinase. Incubate the mixture for 1 h at 37C. Inactivate the kinase by heating 5 min at 95C. Place on ice for 5 min and spin down briefly. 2. For the annealing reaction, add directly to the previous reaction: 5 mL of complementary oligonucleotide (loading strand), 2 mL 10 annealing buffer, 3 mL ddH2O. Place on a 95C heating block for 5 min, then remove the block from the thermostat and allow cooling to room temperature over a period of 2–3 h. 3. To remove unincorporated [g-32P]-ATP, load the 20 mL reaction on a prespun MicroSpin G-25 column. Centrifuge at 735 g for 1 min and collect the eluate. 4. Measure carefully the volume of the eluate and calculate the specific activity assuming 95% recovery. Add 6 Ficoll loading buffer to a final 1 concentration and load substrate on a 12% non denaturing mini-gel set up at 4C. Electrophorese at 5 V/cm until the bromophenol blue dye reaches two-thirds of the gel (or appropriate time). Disassemble and wrap gel in saran wrap. Expose briefly to an autoradiography film, develop, and cut out the gel area containing the substrate with a sterile razor blade. 5. To electroelute the substrate, place the gel piece in a dialysis midi D-Tube, fill with 1 TBE, close the tube, and place it in an electrophoresis tank containing cold 1 TBE (most horizontal agarose gel slabs will be convenient for this). Electroelute the substrate for 1 h at 80 V at 4C. 6. Invert current for 40 s, remove power supply, and disassemble. Filter the content of the dialysis tube through an Ultrafree-MC centrifugal filter and concentrate the eluate to approximately 30 mL. Measure the activity of the sample, and calculate the concentration of the radiolabeled substrate according to the previously determined specific activity. Prepare a dilution of the substrate at 10 fmol/mL and store at –20C behind a shield until use.

Helicase Activity and Anti-telomerase Properties 3.4.2. Pif1p Activity Assay

369

1. Reaction mixtures are set up in 10 mL aliquots. Place a microfuge tube on ice and add in the following order: 2 mL of 5 helicase reaction buffer, 1 mL 50 mM Mg2+, 10 fmol radiolabeled DNA substrate (1 mL, 10 fmol/mL), 4 mL H2O, and 1 mL of Pif1p dilution in Pif1p storage buffer (see Note 14). Place the tube at 35C (or desired temperature). Start the reaction by adding 1 mL of 40 mM ATP and incubate for 15 min (or desired time) (see Note 15). 2. Stop the reaction by adding 2 mL of helicase stop buffer. 3. Load the reaction products on a 13 18 cm non-denaturing 12% polyacrylamide gel (20:1 acrylamide:bis-acrylamide ratio). Run the gel by electrophoresis at 150 V for 2 h or appropriate time at 4C (see Note 16). 4. Disassemble the gel tray and recover the gel on DEAE paper (see Note 17). It is convenient to double the DEAE paper with a piece of 3 MM paper in order to ease handling the gel. Cover with plastic wrap and expose against an autoradiography film at –80C. 5. Detection and quantification are best carried out on a dried gel using phosphorimaging systems, such as the Molecular Dynamics Storm device, and the Image quant software (GE healthcare).

3.5. Functional Interaction Assay Between Pif1p and Yeast Telomerase 3.5.1. Telomerase Assay

Yeast telomerase activity can be monitored with an oligonucleotide extension assay, using an oligonucleotide whose sequence mimicks the end of a yeast telomere. Similarly to results from other labs, we find that telomerase extends efficiently short oligonucleotides (around 15 nucleotides in size) but displays poor polymerization efficiency on longer oligonucleotides (above 30 nucleotides). It is also advantageous that the 30 end of the telomeric primer has with a unique sequence complementary to TLC1 RNA. We had the best success with the following sequence: TEL15: 50 -TGTGGTGTGTGTGGG-30 , which anneals on TLC1 at the template position 475C (8). 1. Enzymes and solutions should be kept cold during the assembly of the reaction. 2. Prepare a dilution of Pif1p in Pif1p storage buffer such that 1 mL will contain the desired amount of enzyme. 3. Assemble the telomerase reaction by adding to a microfuge tube, in the following order: 1 mL 10 TR buffer, 1 mL Telomeric primer at 1 mM, 1 mL dNTP mix, 1 mL 40 mM ATP, 2 mL [a-32P]-dTTP, and 0.3 mL RNAsin. Place the tube in a water bath at 30C for 2 min to equilibrate the reaction in temperature, and then add 1 mL Pif1p dilution and 3 mL telomerase extract. Incubate the tube for 45 min or desired time.

370

Boule´ and Zakian

4. Stop the reaction by adding 200 mL TR stop buffer containing the radiolabeled control oligonucleotide that will serve as a quantitative loading control. Prepare enough TR stop buffer containing the loading control to distribute to all samples from the same stock. Incubate for another 45 min at 30C. 5. Extract the reaction twice with phenol/chloroform. 6. Precipitate the reaction products by adding 1 volume of 4 M (NH4)2-Acetate, 30 mg glycogen, and 2.5 volumes of cold 100% Ethanol. Place the tubes at –80C for 30 min. Centrifuge at 20,000 g for 30 min at 4C. 7. Due to the presence of glycogen, a clear white pellet should be visible at the bottom of the tube after centrifugation. Remove supernatant carefully and add 300 mL of 70% ethanol. Centrifuge again, and air-dry the pellet. Add 5 mL of formamide loading buffer and heat denature the samples at 96C for 5 min. Telomerase reaction products are now ready to be separated on a sequencing gel. 3.5.2. Electrophoresis and Detection of Reaction Products

The telomerase reaction products are best resolved on a polyacrylamide-urea sequencing gel. We had the best results with 16% polyacryamide gels run on a STS45 IBI sequencing gel unit, but the method can be adapted for other equipment. 1. Before pouring the gel, plates need to be cleaned with a water soluble detergent and rinsed extensively with distilled water. Plates are then rinsed briefly with ethanol 95% and air-dried. Avoid touching the surface of the plates with hands after cleaning. Plates should then be coated with a glass plate coating solution (e.g., gel slick solution, FMC bioproducts) to facilitate removing of the gel. Distribute the coating solution evenly using a paper towel on both plates, air dry and assemble the gel unit. Prepare the 100 mL of sequencing-gel mix and pour promptly into the plates. Insert the comb (see Note 18) and let the gel polymerize for an hour. Assemble the gel unit, and pre-run the gel in 1 TBE for 1 h at 75 W constant power setting (around 1600 V on the STS45 unit). 2. Disconnect the power supply and load the samples, leaving the wells on the side of the gel empty if possible. Reconnect the power supply and run the gel until the bromophenol blue dye has reached four-fifths of the gel. 3. Disassemble the gel unit and delicately remove one plate, leaving the gel stuck to the bottom plate. Apply two sheets of 3 MM paper to the gel and carefully remove the gel from the glass plate by having it stick to the paper, starting from a corner. Cover with plastic wrap and expose at –80C against an autoradiography film. A 24-h exposure is usually sufficient. An example of the signal observed is shown in Fig. 25.2.


371

Fig. 25.2. Effects of Pif1p on telomerase activity in vitro. Autoradiograph of a sequencing gel showing telomerase extension products of a TEL15 oligonucleotide in the presence of telomerase alone (lane 1), in presence of RNase A (lane 2), or two concentrations of Pif1p (lane 3, 1 mM Pif1p; lane 4, 0.2 mM Pif1p). LC: loading control.

4. If quantitation is desired, the gel can be exposed against a phosphor screen to be scanned on a phosphorImager. Sixteen percent urea-gel cannot be dried before exposure. Therefore, to expose the gel against a phosphor screen, thaw the gel at room temperature for 10 min and place it in a phosphorImager cassette. Cover with a clean plastic wrap (to prevent the phosphor screen from contact with the wet gel) and expose for 4–5 h. Longer exposure is not recommended, as the gel likely will start deteriorating. 5. Given the unique alignment between TLC1 and the TEL15 oligonucleotide, the sequence of the extension products is predicted to be 50 -TGTGGTG (8). Using the ImageQuant software, measure the intensity of each addition product as well as the intensity of the loading control. If several lanes are to be compared, the intensity of the signal given by the loading control with serve as a reference for normalization of the signal observed in each lane.

372

Boule´ and Zakian

6. Calculate the percentage of each addition product synthesized during the reaction according to the following rule, which takes into account the number of radiolabeled nucleotide for each product size: The total amount of products being synthetized (in arbitrary units) is given by the following formula: T=I1þI2þI3/ 2þI4/2þI5/2þI6/3þI7/3 where In is the quantification of band at position +n. Therefore, the percentage of product synthesized of a specific size (+n) is given by the ratio In/T, divided by the number of radiolabeled nucleotide in the product of this size (e.g., %(þ5) = I+5/T/2) (see Notes 19 and 20). 3.5.3. Telomerase Displacement Assay

1. Prepare 100 mL (or the desired volume) of M-280 Streptavidin beads by washing them successively in 5 volumes buffer S1, 5 volumes 0.1 M NaCl, and 5 volumes buffer W/B. Resuspend the beads in one volume buffer W/B. To remove buffer between each step, place tube on magnet for 1–2 min to separate beads from buffer and remove buffer by gentle pipetting. 2. Using a 100 mM stock of 50 -biotinylated TEL15 telomeric oligonucleotide (or the desired oligonucleotide), add the amount of oligonucleotide to the equilibrated beads to give a final oligonucleotide concentration of 1 mM. incubate at room temperature for 15 min with occasional mixing by gently taping the tube. Remove buffer and wash the beads 2–3 times with 1 buffer W/B and resuspend beads in 1 volume 1 TR buffer. 3. Assemble on ice the following reaction in a microfuge tube: 3 mL of beads (coated with the telomeric oligonucleotide), 4 mL of 1 TR buffer, and 3 mL of telomerase extract. Incubate at room temperature for 10 min. In the meantime, assemble in a separate tube on ice the following helicase mix: 1 mL 10 TR buffer, 1 mL ATP (40 mM stock), 1 mL Pif1p (at a concentration of 10 mM if possible), 1 mL non-biotinylated TEL15 oligonucleotide (10 mM stock), and 6 mL H2O. Separate beads from reaction mix containing unbound telomerase using a magnet and replace with the Helicase mix. Incubate the reaction at 30C for 10 min (or desired time). 4. Again, separate beads from supernatant and carefully remove supernatant by pipetting. Wash beads by gentle pipetting with 100 mL 1 TR buffer and resuspend beads in 10 mL 1 TR buffer. Add to both tubes (beads and reaction supernatant) 4 mL of 3 Laemmli buffer and boil for 5 min. Centrifuge briefly and load on an 8% SDS-PAGE protein gel.


373

5. Following electrophoresis, reveal bound fraction (bead fraction) and unbound fraction (supernatant) by Western blotting using an anti-Est2p antibody (or other appropriate antibody if using, for example, a tagged version of Est2p) (see Note 21).

4. Notes 1. Other type of IMAC resins can be adapted to fit this protocol, although binding, wash, and elution buffer components (pH, salt, and imidazole concentration) should be optimized for the specific resin. 2. To prevent RNase contamination, wear latex gloves at all times and change them regularly. All glassware should be DEPC-treated. Work surfaces should be cleaned with an RNase inhibitor solution, e.g., RNaseZAP (Ambion). All buffers should be DEPC-treated and autoclaved prior to use. Tris-containing buffers can not be DEPC-treated as DEPC will react with primary amines. Therefore, RNasefree Tris and DEPC-treated stock solutions should be used to make these buffers. 3. The presence of excess unlabeled oligonucleotide prevents reannealing of the unwound strand to its complementary strand. 4. To prevent confusion between the loading control and the addition products, we use a 60-mer single-stranded oligonucleotide of random sequence as a loading control. 5. Although the pET system is convenient and has become a widely used standard, other inducible systems for heterologous expression in bacteria can be used. 6. Given the low level of Pif1p overexpression, we usually induce large volumes (5–10 L). The volume of LB in each flask should be no more than a third of the flask volume. For example, use a 6 L flask for a 2 L culture. 7. Induction at lower temperatures greatly increases Pif1p solubility. The optimal induction temperature and time will depend on the expression system and should be determined experimentally. 8. To prevent heating of the supernatant, sonication should be paused every minute for 30 s to cool the probe. One round of 100 pulses is usually enough to sonicate 100 mL of supernatant.

374

Boule´ and Zakian

9. Optimal column volume will depend on the culture volume and on the level of Pif1p expression in the system used. We find that 5-mL columns give reproducible yields and quality in Pif1p purified from 10-L cultures. 10. As a rule of thumb, 5 column volumes of washing buffer should be enough to remove proteins interacting nonspecifically with the Talon resin. If another resin is used for affinity chromatography, optimal volumes for washing the column before elution should be determined experimentally. 11. We find that the enzyme is stable at –80C for a year. It is not recommended to freeze/thaw the enzyme as it makes the helicase activity decrease rapidly. If an aliquot is thawed, it can be kept at –20C for 2–3 months without a significant drop in activity. However, we have observed precipitation at –20C. Therefore, aliquots kept at –20C should be checked for precipitation and protein concentration should be recalculated before each use. 12. Since liquid N2 can cause serious burns, safety glasses and protective gloves should be worn at all times during this procedure. 13. Frozen lysates can take a long time to thaw (> 30 min for a 20-mL lysate). Thawing can be initiated by warming the lysate between the hands and then on a rotating wheel at 4C until thawing is complete. 14. Similarly to what has been reported for other helicases, we find that the Pif1p concentration necessary to observed efficient unwinding exceeds several fold the concentration of the substrate. We routinely perform Pif1p helicase assays using 100 nM enzyme and 1 nM substrate. 15. For a control reaction, set up a reaction using Pif1p storage buffer instead of the helicase. This is the ‘‘no enzyme’’ control. Another control is the heat denatured substrate, which is achieved by heating the reaction mix containing the labeled substrate and no enzyme at 95C for 2 min. 16. The final polyacrylamide percentage of the gel and the optimal electrophoresis time depends on the sizes of the intact nucleic acids substrate and the unwound radiolabeled product. These conditions should be optimized depending on the size of the substrate used. 17. Use of DEAE paper is recommended when the gel is going to be dried before quantification, since, unlike 3 MM paper, it will bind and retain small nucleic acids. 18. Use a 5-mm well-dented comb, not a sequencing shark-tooth comb.


375

19. To visualize the displacement of telomerase, a variation of this protocol can be performed. During the course of the reaction, an excess of a ‘‘chasing’’ telomeric oligonucleotide of different size is incorporated in the reaction. For example, we use a 30-mer oligonucleotide containing the TEL15 sequence extended by 15 random nucleotides from its 50 end. This oligonucleotide is utilized more efficiently than a 30-mer oligonucleotide containing only telomeric sequence, as discussed in Section 3.5.1. The reaction is started as described, but a 10-fold excess chasing oligonucleotide is added after 15 min into the reaction. Since yeast telomerase stays associated with its product (12), telomerase will only elongate the chasing oligonucleotide if telomerase is released from its elongation product. 20. The effect of Pif1p on telomerase activity can be calculated in term of telomerase nucleotide processivity, defined as the probability P with which telomerase adds more than one nucleotide without dissociating from its product. Telomerase nucleotide processivity is then defined for each product of size þn by P+n ¼ ((x > n) Ix)/T. This calculation assumes that in the presence of Pif1p, an already elongated product is not re-elongated by secondary association with telomerase, provided that TEL15 primer is present in large excess compared to telomerase. 21. Alternatively, quantification of telomerase core enzyme in each fraction can be achieved by detection of the TLC1 RNA, either by qRT-PCR or Northern blotting.

Acknowledgments This work was supported by grants from the National Insitutes of Health to VAZ.

References 1. Bessler J. B., Torres J. Z., and Zakian V. A. (2001) The Pif1p subfamily of helicases: region specific DNA helicases. Trends Cell Biol. 11, 60–65. 2. Boule´ J.-B. and Zakian V. A. (2006) Roles of Pif1-like helicases in the maintenance of genomic stability. Nucleic Acids Res. 34, 4147–4153. 3. Schulz V. P. and Zakian V. A. (1994) The Saccharomyces PIF1 DNA helicase inhibits

telomere elongation and de novo telomere formation. Cell 76, 145–155. 4. Myung K., Chen C., and Kolodner R. D. (2001) Multiple pathways cooperate in the suppression of genome instability in Saccharomyces cerevisiae. Nature 411, 1073–1076. 5. Boule´ J.-B., Vega L. R., and Zakian V. A. (2005) The yeast Pif1p helicase removes telomerase from telomeric DNA. Nature 438, 57–61.

376

Boule´ and Zakian

6. Zhou J. Q., Monson E. M., Teng S. C., Schulz V. P., and Zakian V. A. (2000) The Pif1p helicase, a catalytic inhibitor of telomerase lengthening of yeast telomeres. Science 289, 771–774. 7. Boule´ J.-B. and Zakian V. A. (2007) The yeast Pif1p DNA helicase preferentially unwinds RNA DNA substrates. Nucleic Acids Res. 35, 5809–5818. 8. Forstemann K. and Lingner J. (2001) Molecular basis for telomere repeat divergence in budding yeast. Mol. Cell Biol. 21, 7277–7286. 9. Bachrati C. Z. and Hickson I. D. (2006) Analysis of the DNA unwinding activity of

RecQ family helicases. Methods Enzymol. 409, 86–100. 10. Brosh R. M., Jr., Opresko P. L., and Bohr V. A. (2006) Enzymatic mechanism of the WRN helicase/nuclease. Methods Enzymol. 409, 52–85. 11. Brosh R. M., Jr. and Sharma S. (2006) Biochemical assays for the characterization of DNA helicases. Methods Mol. Biol. 314, 397–415. 12. Prescott J. and Blackburn E. H. (1997) Functionally interacting telomerase RNAs in the yeast telomerase complex. Genes Dev. 11, 2790–2800.

Chapter 26 A Method to Confer Salinity Stress Tolerance to Plants by Helicase Overexpression Narendra Tuteja Abstract High salinity stress adversely affects plant growth and limits agricultural production worldwide. To minimize these losses it is essential to develop stress-tolerant plants. Several genes, including the genes encoding for helicases, are induced in response to salinity stress. Helicases are ubiquitous motor enzymes that catalyze the unwinding of energetically stable duplex DNA (DNA helicases) or duplex RNA secondary structures (RNA helicases) in an ATP-dependent manner. Helicase members of DEAD-box protein family play essential roles in cellular processes that regulate plant growth and development. Overexpression of one helicase in plant by using Agrobacterium tumefaciens-mediated transformation system confers salinity stress tolerance. To develop the salinity stress tolerant transgenic plants several sequential steps are required including cloning the helicase gene into plant transformation vector, transformation of the gene into Agrobacterium followed by Agrobacterium-mediated transformation of the gene into plant, selection and regeneration of the transgenic plants, confirmation of transgenic plants by PCR or GUS assay, and finally analysis of transgenic plants (T0 and T1 generations) for salinity stress tolerance. Key words: Agrobacterium, DEAD-box protein, DNA and RNA helicases, leaf disk assay, plant transformation, salinity stress tolerance, transgenic plant.

1. Introduction Among abiotic stress, the high salinity stress is the major cause for reducing the crop yield (1). High salinity exerts its negative impact mainly by disrupting the ionic and osmotic equilibrium of the cell (1, 2). Various genes are upregulated in response to high salinity stress signal. The products of these genes are involved, either directly or indirectly, in plant protection. Some of the genes encoding osmolytes, ion channels, receptors, components of calcium-signaling, M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8_26, ª Humana Press, a part of Springer ScienceþBusiness Media, LLC 2010

377

378

Tuteja

some other regulatory signaling factors, or enzymes are able to confer salinity-tolerant phenotypes when transferred to sensitive plants (2). Since abiotic stress affects the cellular gene expression machinery, it is possible that molecules involved in nucleic acid metabolism including helicases are likely to be affected (3). Helicases are motor proteins that catalyze the unwinding of duplex nucleic acids in an ATP-dependent manner and thereby play important role in most of the basic genetic processes including replication, repair, recombination, transcription, and translation (4). Most helicases share a core region (200–700 amino acids) of highly conserved nine sequence motifs (designated Q, I, Ia, Ib, II, III, IV, V, and VI). The rapidly growing DEAD-box protein family of helicases is conserved from bacteria to humans (5, 6). In the plant genome several helicase genes are present but only a few have been biochemically characterized (3, 4). Some recent reports indicate a role of helicases in salinity stress-regulated processes (7–9). To develop the salinity-tolerant plants, we have delivered PDH45 gene (pea DNA helicase 45) into the tobacco plants by using Agrobacterium tumefaciens-mediated transformation system (7, 10). Agrobacterium tumefaciens is a phytopathogenic bacterium (gram-negative) and has been widely used for plant transformation (11). The resulting transgenic plants grow normally in the presence of salt without yield loss (7).

2. Materials 2.1. Cloning the PDH45 Gene into Plant Transformation Vector

1. PDH45 cDNA: The PDH45 cDNA was cloned by pea cDNA library screening with degenerate oligodeoxynucleotide corresponding to DEAD-box motif of the helicase as described (10) (see Note 1). 2. PGMT-T Easy vector (Promega Life Science). 3. pBluescript (SK+) vector (Stratagene). 4. pBI-121 (Plant transformation vector) (Clontech, Palo Alto, CA, USA). 5. Primers to amplify ORF of PDH45 gene: Forward primer, PDH45-F1 [50 -ATGGCGACAACTTCTGTGG-30 ] starting from the translation initiation site ATG. Reverse primer, PDH45-R1 [50 -GAGCTCGAGTTATATAAGATCACCAATATTC-30 ], designed to create an XbaI site at the 30 end (italicized above) next to the translation termination codon (underlined). 6. Tobacco seeds/plants: Nicotiana tabacum cv. Xanthi (see Note 2). 7. Agrobacterium tumefaciens: Bacterial strain LBA4404.

A Method to Confer Salinity Stress Tolerance to Plants

379

8. Escherichia coli (DH5): (Invitrogen life technologies) (see Note 3). 2.2. Transformation of Agrobacterium

1. YEM medium: 0.04% yeast extract, 1% mannitol, 0.01% NaCl, 0.02% MgSO4.7H2O, and 0.05% K2HPO4, pH 7.0.

2.3. AgrobacteriumMediated Plant Transformation

1. Seed surface sterilization solution: 1% bleach plus 0.1% Tween-20.

2.4. AgrobacteriumMediated Transformation

1. Benzyl amino purine (BAP).

2. MS-Basal media: 3.44 gm MS-salt (Sigma), 3% sucrose, and 1X Gamborg’s B5-vitamins (Sigma, USA), pH 5.8, and 0.6% agar.

2. Naphthan acetic acid (NAA). 3. Carbenicillin. 4. Thiamine.

2.5. Confirmation of Transgenic Plants by PCR or GUS Assay

1. CTAB extraction buffer: 2% CTAB, 1.4 M NaCl, 20 mM EDTA, pH 8.0, 100 mM Tris–HCl, pH 8.0, 100 mM bME (see Note 4) 2. Phenol mixture: phenol:chloroform:isoamyl alcohol (25:24:1). 3. Chloroform mixture: chloroform:isoamyl alcohol (24:1). 4. TE buffer: 10 mM Tris–HCl, pH 8.0, and 1 mM EDTA. 5. GUS-R1 primer: 50 -TCATTGTTTGCCTCCCTGCTGC-30 , as the reverse primer. 6. X-Gluc solution: 2 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc, Biosynth. Inc.) in 50 mM of Na-phosphate buffer, pH 7.0.

3. Methods 3.1. Cloning the PDH45 Gene into Plant Transformation Vector (pBI-121)

The strategy of cloning the PDH45 gene into pBI-121 vector is described as a flow diagram in Fig. 26.1, and the detailed method is described below. 1. The complete ORF of PDH45 cDNA (1.2 kb) was PCR amplified using the gene specific forward and reverse primers. 2. The amplified fragment (1.2 kb) was purified and cloned into pGEMTeasy vector to create a pGEMT-PDH45[ORF] construct. 3. The EcoRI fragment from pGEMT-PDH45[ORF] was isolated and ligated into EcoRI site of vector pBluescript (SK+) to create a pBluescript-PDH45[ORF] construct. 4. The XbaI fragment from pBluescript-PDH45[ORF] was isolated and ligated into XbaI site of vector pBI-121 to create a pBI-121-PDH45[ORF] sense construct. This vector contains PDH45 and GUS (uidA) under a single CaMV-35S promoter;

380

Tuteja

however, a stop codon has been inserted in between the PDH45 gene and the reporter gene to avoid translational fusions. It also carries the NPTII (Kanamycin) gene as a selectable marker. The pBI-121-PDH45[ORF] construct contains two HindIII sites, one internal in the PDH45 gene and one in the backbone of the vector just at the beginning of CaMV-35S promoter region, which will help in checking the orientation (sense or antisense) of the gene (Fig. 26.1).

Fig. 26.1. Diagramatic representation of the flow chart of generation of pBI-121-PDH45 sense construct for Agrobacteriummediated transformation of PDH45 gene into tobacco plant.


381

5. The above ligated product (pBI-121-PDH45[ORF]) was transformed into Escherichia coli (DH5) competent cells and spread on LB plates containing 50 mg/ml kanamycin. Plasmid DNA was prepared from few transformed colonies and subjected to HindIII digestion followed by agarose (1%) gel electrophoresis. The product sizes of 13 kb (vector backbone) and 1.2 kb (CaMV-35S promoter + 50 end portion of PDH45 gene) fragments should give a PDH45 construct in sense orientation. 3.2. Transformation of the PDH45 Gene into Agrobacterium

1. A single colony of Agrobacterium tumefaciens was inoculated in YEM medium and kept at 28C with vigorous shaking for 2 days. 2. Competent cells of Agrobacterium were prepared by inoculating 1 ml of a full-grown culture into fresh 50 ml YEM medium and further grown at 28C till OD600 of 0.5–0.6 was reached. 3. The culture was chilled on ice and cells were harvested by centrifugation at 3,000 g for 10 min at 4C. 4. The pellet was resuspended in 2 ml of 20 mM CaCl2 (chilled) and 0.1 ml aliquots were dispensed in pre-chilled eppendorf tubes, frozen in liquid nitrogen, and stored at –80C. 5. Transformation of Agrobacterium with recombinant pBI121-PDH45[ORF] plasmid constructs in sense orientation was done by adding 0.5–1 mg of the recombinant plasmid to 0.1 ml of Agrobacterium competent cells, mixed gently, and immediately frozen in liquid nitrogen for 2 min. 6. Subsequently, cells were thawed by incubating the eppendorf tube at 37C for 5 min. 7. Thereafter, 1 ml of YEM was added to the eppendorf tube and the tube was kept for incubation at 28C for 6 h with slow shaking. 8. The revived cells were plated on YEM-agar plate containing 50 mg/ml of kanamycin and 50 mg/ml of streptomycin and incubated at 28C. 9. Transformed colonies appeared after 2–3 days and were analyzed either by PCR or by colony hybridization. 10. Agrobacterium tumefaciens carrying the recombinant pBI121 sense clones were grown in YEM containing 50 mg kanamycin and used for Agrobacterium-mediated plant transformation.

3.3. AgrobacteriumMediated Transformation of PDH45 Gene into Plant

1. Tobacco seeds were first washed with the seed surface sterilization solution for 15–20 min and then washed with 70% ethanol for 1 min followed by washing with sterile water (at least ten times).

382

Tuteja

2. Sterilized seeds were plated on MS-Basal media and allowed to grow under moderate light, temperature, and humidity conditions till plants with healthy leaves were produced (see Note 4). 3. Wild-type tobacco plants were maintained in jam bottles by taking the stems and cutting them at the internode regions such that a single node remains intact. 4. An oblique cut was given to the internode below the node and a horizontal cut was given to the internode above the node. 5. The stem was then placed, oblique side facing downwards on approximately 50 ml MS-Basal media. 6. Healthy, unblemished leaves from young plants were harvested for preparing leaf samples. 7. Leaf discs of uniform size were made by cutting leaves into small circle or square (1 cm2)and placed them in preculture medium (MS + BAP + NAA) for 1–2 days under photo period of 16/8 h (16 h day light and 8 h dark). 8. The explants (above leaf discs) were then immersed in a 1:10 diluted grown recombinant Agrobacterium culture at OD600 = 0.5 in YEM medium (see Note 5). 9. Incubation was carried out for 5–10 min and then the incubated leaf discs were blot dried and placed on the same medium (MS + BAP + NAA) minus antibiotics with abaxial side facing upwards. 10. These explants were allowed to grow (co-cultivate) with Agrobacterium for 3–4 days. 3.4. Selection, Regeneration, and Growth of Transgenic Plants Overexpressing PDH45

1. After co-cultivation steps, the explants were briefly rinsed in MS-Basal solution containing 500 mg/ml carbenicillin, blot dried and plated onto MS-Basal-agar plates containing 300 mg/ml kanamycin, 500 mg/ml carbenicillin, 1.0 mg/ml BAP, 0.10 mg/ml NAA, and 1.0 mg/ml thiamine. 2. After 3–4 weeks, the shoots developed and defined stems were visible. They were cleanly cut from the explant and callus and placed upright on rooting medium (MS-basalagar medium containing 500 mg/ml carbenicillin and 100 mg/ml kanamycin) for root formation. Only one shoot was taken from each explant to ensure that no siblings are propagated. 3. When the roots emerged, the plants were taken out, rinsed with sterile water to remove any piece of agar, and transferred to sterile vermiculite containing pots for hardening. To provide high humidity the pots were covered with plastic bags and grown in tissue culture room (see Note 6).


383

4. After 7–10 days the plastic bags were opened slowly in order to reduce the humidity gradually until the plants were acclimatized to the ambient humidity. Once the plants hardened, they were transferred to potted soil and then to glasshouse for further growth. 3.5. Confirmation of Transgenic Plants by PCR or GUS Assay

The integration of the trans-gene into the transgenic plants can be confirmed by PCR, GUS assay, Northern blot, Southern blot, or by Western blot analysis. Here only PCR and GUS assay are described.

3.5.1. PCR

PCR is one of the first approaches to confirm the integration of the PDH45 gene into the transgenic plants. For this we need gene specific primers, GUS-specific primer and the genomic DNAs from all the putative transgenic lines. Genomic DNA was isolated by grinding leaf tissue followed by extraction using the CTAB (N-acetyl-N,N,N-trimethylammonium bromide) method of Murray and Thompson (12) with minor modifications as described below. 1. Small pieces of leaf tissue (1 1 cm) were frozen in liquid nitrogen in Eppendorf tubes and homogenized in (500 ml) CTAB extraction buffer. 2. The extract was incubated at 60C for 20 min. 3. To this 500 ml of phenol mixture was added and mixed by vortexing for 30 s followed by centrifugation at 10,000 g for 5 min at room temperature. 4. The aqueous phase (top phase) was transferred to another tube, and extracted once with 500 ml of chloroform mixture in Eppendorf tube. 5. 0.6 volume of isopropanol was added to the final aqueous phase that precipitated the genomic DNA that was spooled out. 6. Genomic DNA was then washed thrice with 70% ethanol, dried in vacuum, dissolved in TE buffer containing 10 mg/ml RNase A and incubated at 37C for 1 h. 7. This was followed by extraction again with phenol mixture and aqueous phase was transferred to a fresh tube (genomic DNA). 8. Thereafter, the genomic DNA was precipitated by adding 0.3 M sodium acetate (final concentration), pH 5.2, and 2.5 volumes of ethanol. The tube was kept at –20C freezer for 1–2 h. 9. The pellet was collected by centrifugation at 10,000 g for 20 min at 4C and washed with 70% ethanol, vacuum dried and dissolved in TE. The DNA is ready for PCR as a template.

384

Tuteja

10. PCR was performed using the PDH45-F1 and PDH45-R1 primers. The PCR was also performed using PDH45-F1 primer as the forward primer and GUS-R1, 50 TCATTGTTTGCCTCCCTGCTGC-30 , as the reverse primer. The pBI-PDH45 was used as a positive control template. 3.5.2. Histochemical GUS Assay

This method was used for screening the putative transgenic plants for the expression of b-glucuronidase (GUS). 1. Small pieces (2–3 cm) of leaf tissues from wild-type and transgenic plants were collected and rinsed in 50 mM Na-phosphate buffer, pH 7.0. 2. Then the tissue was stained with X-Gluc solution, followed by brief vacuum infiltration. 3. The stained tissues were placed at 37C overnight in dark. 4. After staining, tissues were rinsed extensively in 70% ethanol to remove chlorophyll before examination. 5. If the GUS gene is expressing then the tissues will be blue or blue-green in color, which confirmed that the tans-gene has been integrated in to the transgenic plants. 6. After visualization of the blue color in the leaf tissues, the GUS activity can also be measured fluorimetrically using 1 mM MUG as substrate as described by Jefferson (13).

3.6. Analysis of T0-Transgenic Plants to High Salinity Stress Tolerance by Leaf Disk Assay

In general, the morphological and growth characteristics of T0 generation transgenic tobacco plants were similar to the untransformed plants (wild type). The helicase overexpressing transgenic plants (T0 generation) were first checked by leaf disk assay for salinity stress tolerance as described below and the results are shown in Fig. 26.2a. 1. Healthy and fully expanded leaves (of similar age) from wild types (WT) and transgenic plants (around 60 days old) were briefly washed in deionized water (see Note 4). 2. Leaf disks of about 1 cm diameter were punched out and floated in 6 ml solution of NaCl (200 mM) or sterile distilled water (control) in petri dishes (see Note 5). 3. The petri dishes were kept at room temperature for 72 h (14). 4. After 72 h the leaf disks were visually examined for bleaching of the green color of the leaf (Fig. 26.2a) (see Note 7). 5. Please note that the WT leaf will not tolerate the salt therefore these will bleach faster and will give yellow color to the leaf disk as compared to green color (nonbleach) of the WT leaf disk floating on the water. On the other hand if the transgenic plants are salt tolerant then


385

Fig. 26.2. (a) Leaf disk assay of PDH45 sense (overexpressing) transgenic lines and wildtype plant under 300 mM salt (NaCl) concentration. Relative bleaching of leaf disks from PDH45 sense and wild type are shown. (b) Growth of WT and transgenic plants in soil pot supplied with 200 mM NaCl solution. Note that WT plant could not sustain growth under salinity stress while transgenic plants grew normally up to maturity without yield loss.

the leaf disks of these plants will not bleach (remain green in color) or will bleach less (green-yellow color) as compared to the WT. 6. The chlorophyll a and b content was then measured spectrophotometrically after extraction with 80% acetone (15). 7. Overall, the results clearly showed that PDH45 overexpressing lines can tolerate the salinity stress. 3.7. Analysis of T1-Transgenic Plants Germination and Growth Under Salinity Stress 3.7.1. Analysis of T1-Transgenic Progeny

When the seeds from the T0 sense plants of PDH45 were plated onto kanamycin-containing medium, the segregation ratio was found to be in agreement with the Mendelian ratio, i.e., 3:1 (Kanr/Kans). The T1 seedlings from each line were further confirmed for the presence of the transgene by PCR and the GUS assay (as described in Sections 3.5.1 and 3.5.2). Leaf disk senescence assay for salinity stress tolerance from T1-transgenic plants and WT tobacco were also performed as described above (see Section 3.6). Overall the results were similar to the T0-transgenic plants, which clearly show that overexpressing PDH45 resulted in tolerance salinity stress. Morphologically there was not much difference in T1 generation of PDH45 tobacco transgenics and wildtype plants in terms of height, chlorophyll content, flowering and seed weight per pod.

386

Tuteja

3.7.2. Germination of T1-Seeds and Growth of the Plants Under Salinity

The T1-transgenic lines of G and Gb and WT tobacco seeds germinated and grew normally in water. To assess the effect of high salt on seeds germination/growth of overexpressing PDH45 plants (T1) and the kanamycin-positive T1 seedlings were characterized. In the presence of salinity (100 and 200 mM NaCl) the seeds of WT plants showed no germination (or only very slow germination), while seeds of PDH45 overexpressing plants showed normal germination and the plants did not develop any sign of stress. Statistically similar results were obtained for the seven transgenic lines. Finally the transgenic plants were transferred to the pots, which continued to grow till maturity directly in the presence of salt and the plants showed normal growth under salinity stress (Fig. 26.2b).

4. Notes 1. The sequence of the degenerate oligonucleotide primer used for pea cDNA library screening is as follows: 50 -ACTAGT(A/ G/C/T)CT(AGCT)GA(T/C)GA(G/A)GC(A/G/C/ T)GA-30 . Please note that this oloigonucleotide has to be first purified electrophoretically before use as a probe. 2. The tobacco seeds first need to be surface sterilized before use (see Section 3.3). 3. The E. coli strain DH5 is the most common strain used for transformations in research laboratories. Its full genotype is as follows: F-endA1 glnV44 thi-1 relA1 gyrA96 deoR nupG lacZdeltaM15 hsdR17. This bacterial strain is resistance to nalidixic acid, therefore, E. coli strain DH5 should first be grown in LB agar plates containing 10 mg/ml nalidixic acid before use. 4. Unless stated otherwise, all solutions should be prepared in deionized water that has a resistivity of 18.2 M -cm and total organic content of less than five parts per billion. This standard is referred to as ‘‘water’’ in this text. 5. The explants should be handled very carefully using blunt ended forceps. 6. After 5–6 days few pin size holes can be made on the plastic bags. 7. The treatment was carried out in continuous white light at 25–2C.The experiment was repeated minimum three times with different transgenic lines.


387

Acknowledgments Work on plant stress tolerance in NT’s laboratory is partially supported by Department of Science and Technology, Government of India, and Department of Biotechnology, Government of India. I am thankful to Dr. Renu Tuteja, Mr. Hung Quang Dung, and Dr. Hoi Xuan Pham for their help in the preparation of the article. References 1. Tuteja N. (2007) Mechanisms of high salinity tolerance in plants. Methods Enzymol. 428, 419–438. 2. Mahajan S. and Tuteja N. (2005) Cold, salinity and drought stresses: an overview. Arch. Biochem. Biophys. 444, 139–158. 3. Vashisht A. A. and Tuteja N. (2006) Stress responsive DEAD-box helicases: a new pathway to engineer plant stress tolerance. J. Photochem. Photobiol.: Biology. 84, 150–160. 4. Tuteja N. and Tuteja R. (2004) Prokaryotic and eukaryotic DNA helicases: essential molecular motor proteins for cellular machinery. Eur. J. Biochem. 271, 1835–1848. 5. Rocak S. and Linder P. (2004) DEAD-box proteins: the driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 5, 232–241. 6. Tuteja N. and Tuteja R. (2004) Unraveling DNA helicases: motif, structure, mechanism and function. Eur. J. Biochem. 271, 1849–1863. 7. Sanan-Mishra N., Pham X. H., Sopory S. K., and Tuteja N. (2005) Pea DNA helicase 45 overexpression in tobacco confers high salinity tolerance without affecting yield. Proc. Natl. Acad. Sci. U.S.A. 102, 509–514. 8. Vashisht A., Pradhan A., Tuteja R., and Tuteja N. (2005) Cold and salinity stressinduced pea bipolar pea DNA helicase 47 is involved in protein synthesis and stimulated by phosphorylation with protein kinase C. Plant J. 44, 76–87.

9. Liu H. H., Liu L., Fan S. L., Song M. Z., Han X. L., Liu F., and Shen F. F. (2008) Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J. Exp. Bot. doi:10.1093/jxb/erm355 10. Pham X. H., Reddy M. K., Ehtesham N. Z., Matta B., and Tuteja N. (2000) A DNA helicase from Pisum sativum is homologous to translation initiation factor and stimulates topoisomerase I activity. Plant J. 24, 219–229. 11. Horsch R. B., Fry J. E., Hoffman N. L., Eichholtz D., Rogers S. G., and Fraley R. T. (1985) A simple and general method for transferring gene into plants. Science 227, 1229–1231. 12. Murray M. G. and Thompson W. F. (1980) Rapid isolation of high molecular-weight plant DNA. Nucleic Acid Res. 8, 4321–4325. 13. Jefferson R. A., Kavanagh T. A., and Bavan M. W. (1987) GUS fusions: betaglucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901–3907. 14. Fan L., Zheng S., and Wang X. (1997) Antisense suppression of phospholipase D alpha retards abscisic acid—and ethylene— promoted senescence of postharvest Arabidopsis leaves. Plant Cell 9, 2183–2196. 15. Lichtenthaler H. K. (1987) Methods Enzymol. 148, 350–366.

Chapter 27 A Method to Inhibit the Growth of Plasmodium falciparum by Double-Stranded RNA-Mediated Gene Silencing of Helicases Renu Tuteja Abstract Malaria in human is caused by four Plasmodium species, with Plasmodium falciparum responsible for the most severe form of the disease. Global resistance to multiple antimalarial drugs is becoming a major challenge in worldwide efforts to control malaria. It is essential to identify new targets. One possible target is helicases, which are important ubiquitous unwinding enzymes required for nucleic acid metabolism and the maintenance of genomic stability. Helicases are motor proteins that use the energy derived from their intrinsic nucleic acid-dependent NTPase activity to unwind the duplex nucleic acid substrate. In this chapter, we study the functional role of helicases in malaria parasite by using specific dsRNA against PfH45, one of the parasite helicases. We describe the methods for Plasmodium falciparum culture, the amplification of specific helicase gene, the construction of specific dsRNA, and the analysis of the effect of dsRNA on parasite growth. Using this approach, we show that helicases are indispensable enzymes, which are required for growth and most probably survival of the malaria parasite Key words: dsRNA, DNA-dependent NTPase, helicase, malaria parasite, molecular motor, nucleic acid unwinding, Plasmodium falciparum.

1. Introduction Unwinding of double-stranded DNA into single-stranded intermediates required for various fundamental life processes is catalyzed by helicases, a family of mono-, di-, or hexameric motor proteins fueled by nucleoside triphosphate hydrolysis (1, 2). These enzymes use the free energies of binding and hydrolysis of ATP to drive the unwinding of double-stranded nucleic acids, and their function is usually ‘‘coupled’’ to the macromolecular


389

390

Tuteja

machines of gene expression. These enzymes are believed to transduce free energy available from NTPase activity to unwind the duplex and translocate along the nucleic acid lattice. Helicases play essential roles in many important biological processes such as DNA replication, repair, recombination, transcription, splicing, and translation. RNA helicases of the DEAD-box and related DExD/H proteins form a very large superfamily of proteins conserved from bacteria and viruses to humans and play a central role in the control of RNA metabolism (1, 2). They have seven to eight conserved motifs, the characteristics of which are used to subgroup members into individual families (3, 4). They are associated with all processes involving RNA molecules, including transcription, editing, splicing, ribosome biogenesis, RNA export, translation, RNA turnover, and organelle gene expression. Analysis of the three-dimensional structures obtained through the crystallization of viral and cellular RNA helicases reveals a strong structural homology to DNA helicases (3, 4). Malaria is one of the important and most widespread parasitic diseases caused by protozoa of the genus Plasmodium. Each year approximately 300–500 million people become infected with malaria and 2–3 million people die as a result (5). A full set of helicases was identified in the original genome sequence of Plasmodium falciparum during annotation (http://www.plasmodb.org) (6), but detailed analysis using a bioinformatics approach revealed that the genome contains at least 22 full-length putative DEAD-box helicases, as well as a few other putative helicases (7, 8). Recently it has also been reported that helicases are feasible novel drug targets for malaria (9). We have cloned and characterized important helicases from Plasmodium falciparum such as PfDH60 and PfH45 (10, 11). PfH45 contains all the conserved domains of the DEAD-box family and is homologous to eukaryotic translation-initiation factor 4A (eIF4A). It has a role in translation and it is expressed in all the intraerythrocytic developmental stages of the parasite (11). The parasite culture treated with dsRNA against PfH45 exhibited 60% growth inhibition and this inhibitory effect was due to interference with expression of the cognate messenger and downregulation of synthesis of PfH45 protein in the parasite culture (11). Our previous studies have shown that PfH45 is a multifunctional protein; therefore, inhibition of its synthesis leads to downregulation of all its associated activities, which most likely results in parasite growth inhibition. These results also suggest that PfH45 is essential for the growth and survival of the parasite (11). Few other helicases have also been characterized from Plasmodium falciparum (8, 12). The method for studying the role of helicases in parasite growth and survival using the dsRNA approach is presented in the following sections.

Inhibit the Growth of Plasmodium falciparum

391

2. Materials 2.1. Parasite Culture

1. Roswell Park Memorial Institute (RPMI) 1640 medium (Gibco/BRL, Bethesda, MD) supplemented with 10% human serum. 2. Human serum (type O+ve /AB+ve) is obtained by collecting fresh human blood without an anticoagulant from different (at least three) donors. The blood is stored overnight at 4C and then centrifuged at 2000 rpm for 10 min at 4C. The serum obtained is pooled and heat inactivated at 56C for 30 min in a circulating water bath. The serum is filter sterilized through a 0.45-mm filter and stored in single use aliquots at –20C. 3. Gentamycin sulfate (Sigma) is dissolved in tissue-culture water at 1 mg/ml concentration, stored in aliquots at –80C, and then added to tissue-culture dishes as required. 4. Albumax I (GIBCO): dissolve 5% (w/v) in 0.05% hypoxanthine in RPMI 1640 medium by gentle stirring for 1–2 h and filter sterilized through a 0.22-mm filter and stored in single use aliquots at –20C. 5. 5% solution of sorbitol: dissolve 5 g sorbitol (Sigma) powder in 100 ml tissue-culture water, filter sterilized through a 0.22mm filter and stored in single use aliquots at 4C. 6. 0.15% solution of saponin: dissolve 150 mg saponin (Sigma) powder in 100 ml tissue-culture water, filter sterilized through a 0.22-mm filter and stored in single use aliquots at 4C. 7. Complete medium using serum: add 5.8 ml of 3.6% sodium carbonate solution, 100 ml of gentamycin sulfate solution and 10 ml of Type O+ve /AB+ve human serum per 100 ml of RPMI 1640 solution. 8. Complete medium using Albumax is prepared by adding 5.8 ml of 3.6% sodium carbonate solution, 100 ml of Gentamycin sulfate solution and 10 ml of 5% (w/v) Albumax solution per 100 ml of RPMI 1640 solution.

2.2. Staining of Parasite Smears

1. Glass slides.

2.3. Genomic DNA Isolation

1. Phosphate buffered saline (PBS. 10X): 1.37 M NaCl, 27 mM KCl, 100 mM Na2HPO4, 18 mM KH2PO4 (adjust to pH 7.4 with HCl if necessary) and autoclave before storage at room temperature. Prepare working solution by dilution of one part with nine parts water.

2. Methanol and Giemsa stain (Sigma).

2. Lysis buffer: 50 mM Tris–HCl, pH 8.0, 5 mM EDTA, 100 mM NaCl.

392

Tuteja

3. 10% SDS. 4. Proteinase K (20 mg/ml). 5. Phenol equilibrated with 0.1 M Tris–HCl, pH 7.0. 6. Chloroform saturated with isoamyl alcohol 24:1 ratio. 7. RNase (10 mg/ml) (New England Biolabs). 8. 3 M sodium acetate, pH 5.2. 9. Absolute and 70% alcohol. 10. TE buffer: 10 mM Tris–HCl, pH 8.0, 1 mM EDTA, pH 8.0. 2.4. RNA Isolation

1. Trizol reagent (Invitrogen). 2. PBS. 3. Isopropanol. 4. 75% ethanol. 5. RNase free water. 6. RNA isolation kit (Qiagen).

2.5. Reverse Transcription and Polymerase Chain Reaction (PCR)

1. Superscript II reverse transcriptase (Invitrogen) and reaction buffer. 2. dNTP mix (Pharmacia). 3. Oligo dT (Invitrogen), Random hexamers (Invitrogen) or gene-specific primer. 4. RNase H (New England Biolabs, Ipswich, MA, USA). 5. Taq polymerase (New England Biolabs) and Taq buffer. 6. Gene-specific sense and antisense primers. 7. Thermocycler.

2.6. Cloning of PCR Product and Preparation of dsRNA

1. pGEMT easy vector (Promega, Madison, WI, USA). 2. Competent E. coli cells. 3. In vitro transcription kit (RiboMAX express system, Promega).

3. Methods 3.1. Parasite Culture

1. Thaw the cryopreserved parasite culture (Plasmodium falciparum) at 37C in a circulating water bath by gently swirling and immediately transfer contents to a sterile 15-ml tube (13). 2. Intermittently add, drop by drop, equal volume of thawing solution (3.5% NaCl) along the sidewall of the tube and mix gently. 3. Centrifuge at 1600 rpm at room temperature for 5 min.


393

4. Discard the supernatant and repeat the wash with the thawing solution until a clear supernatant is obtained. 5. Discard the supernatant and wash the packed cells once with incomplete medium. 6. Resuspend the packed cells in 5 ml of complete medium and place the plate in a gas chamber, outgas it, and incubate at 37C. 7. Replace the culture medium daily by transferring the culture plates to a sterile hood and aspirating off the medium through a sterile pipette. 8. Make smears to determine the parasitemia. Add fresh complete medium (prewarmed to 37C in a water bath) using a pipette. 9. Resuspend the settled cells in the fresh medium by gentle mixing and return the plates to gas chamber, outgas, and continue incubation at 37C. 10. At high parasitemia (5%), the parasite is subcultured. The culture is harvested by centrifuging at 1600 rpm for 5 min at room temperature. A 50% cell suspension of packed cells is made and the medium is added to obtain the desired dilution. The culture is maintained as described above. 3.2. Staining of Blood Smears

1. Parasite cultures are monitored by preparing the smears from the culture and staining them with modified Giemsa stain. The stain is diluted with water and used for staining. 2. Make the smears from the culture by spreading the concentrated cells on the glass slide. 3. Air-dry the smears and fix the cells by dipping in absolute methanol for 20 s. 4. Dilute the Giemsa stain 1:20 with de-ionized water and stain the smears by dipping in the diluted stain for 15–30 min. 5. After 30 min, remove the slides and gently wash with water. Dry the stained slides completely and view under microscope using 100 oil immersion lens. 6. Count about 1000 infected as well as total erythrocytes separately per field. Repeat the counting at least twice for a total examination of three different parts of the slide. Single or more than one parasite in an erythrocyte is counted as single infection. Calculate the percent parasitemia as number of infected erythrocytes out of 100 erythrocytes.

3.3. Synchronization of Parasite Culture by Sorbitol Treatment

1. Harvest the culture at about 10% parasitemia with majority at ring stages by centrifuging at 1500 rpm for 5 min at room temperature. 2. Add 5 volumes of 5% sorbitol solution to the cell pellet; mix gently and incubate this mixture for 5 min at 37C.

394

Tuteja

3. Centrifuge the mixture at 1600 rpm for 5 min at room temperature and wash the cell pellet twice with complete medium. 4. Make the smear and determine the percent parasitemia by staining. Dilute the culture appropriately and continue the culture in complete medium at 37C. 5. Repeat the sorbitol treatment once again after one cycle of growth (approximately 48 h). 3.4. Isolation of Genomic DNA From the Parasite

1. For the best yield of genomic DNA, a culture with 5–10% parasitemia is used. The volume of each reagent refers to a starting culture of 10 ml. Centrifuge the culture at 1500 rpm for 5 min. Resuspend the cells in 1.5 volume of 1.5% saponin and incubate on ice for 5 min. 2. Centrifuge the suspension at 5000 rpm for 5 min at room temperature and add 9 volumes (450 ml) of the lysis buffer to the pellet. Add 10 ml of 10 mg/ml RNase stock solution and 50 ml of 10% SDS. 3. Mix well and incubate at 37C for 15 min. Add 10 ml of 20 mg/ml proteinase K solution and incubate at 37C for 60–90 min. 4. Extract with equal volume of saturated phenol and centrifuge at 13,000 rpm for 10 min. Extract the supernatant once again with phenol, followed by chloroform. 5. Precipitate the genomic DNA by adding 1/10th volume of sodium acetate and 2.5 volumes of absolute ethanol to the supernatant. Leave the mixture at –20C overnight. 6. Pellet the DNA by centrifugation at 13,000 rpm for 30 min at 4C. Wash the pellet once with 70% ethanol and air-dry. Resuspend the pellet in 25–100 ml of TE. 7. Determine the DNA concentration by measuring optical density at 260 nm and check the quality of DNA by agarose gel electrophoresis (14).

3.5. Isolation of Total RNA from the Parasite and cDNA Synthesis

1. Centrifuge the culture at 1500 rpm for 5 min and wash the cells once with PBS (see Note 1). 2. Add 1 ml of trizol reagent to the pellet and lyse the cells by passing several times through a pipette (see Note 2). Incubate the homogenized sample for 5 min at 15–30C. 3. Add 0.2 ml of chloroform per ml of trizol reagent. Mix by shaking the tube vigorously for 15 s and incubate this mixture at room temperature for 2–3 min. 4. Centrifuge at 12,000 rpm for 15 min at 2–8C. RNA remains in the upper colorless layer.


395

5. Transfer the upper layer to a fresh tube and precipitate RNA by adding 0.5 ml of isopropanol per ml of trizol reagent. Incubate the samples at 15–30C for 20 min and pellet the RNA by centrifugation at 12,000 rpm for 20 min at 2–8C. 6. Remove the supernatant and wash the pellet with 75% ethanol. Recover the pellet by centrifuging at 12,000 rpm for 5 min. Briefly dry the pellet and dissolve the RNA in 100 ml of RNase free water (14). 7. For cDNA synthesis, use up to 5 mg of total RNA, 1 ml of dNTP mix, 2 ml of 10X buffer, 1 ml appropriate primer, 4 ml of 25 mM MgCl2, 2 ml of 100 mM DTT, 1 ml of RNase inhibitor and 1 ml of superscript II reverse transcriptase enzyme and make up the volume to 20 ml (see Note 3). Incubate this reaction mix at 42C for 1 h for the cDNA synthesis. 8. Terminate the reaction by incubating at 70C for 15 min and then chill on ice. 9. Centrifuge briefly and add 1 ml of RNase H to the tube and incubate at 37C before proceeding for amplification. 3.6. Amplification of the Target DNA by PCR

1. The helicase gene is amplified using Plasmodium falciparum cDNA as template and oligonucleotide primers PfHF-50 GGGATCCATGAGTACTAAAGAAGA-30 and PfHR-50 CCTCGAGTTATAAATAGTCAGCAA-30 . For the amplification of intronless genes, the Plasmodium falciparum genomic DNA can be used as template. 2. The primers PfHF and PfHR contain BamHI and XhoI sites for cloning. 3. The PCR conditions used for primer pair PfHF and PfHR are 95C for 1 min, 54C for 1 min, and 72C for 2 min. This was repeated for a total of 35 cycles and at the end one elongation was done at 72C for 10 min. 4. The PCR products are analyzed by agarose gel electrophoresis. A single band of 1.2 kb is obtained. 5. The PCR product of 1.2 kb was gel purified and cloned into pGEM-T vector (Promega) to generate PfH45 clones. The DNA was prepared and the clones were checked by using the specific restriction enzymes BamHI and XhoI. The positive clones were further confirmed by sequencing using the dideoxy sequencing reactions.

3.7. DsRNA Preparation of the Amplified Helicase Gene

1. PfH45 cloned in pGEMT easy vector is used as a template to amplify the gene using T7 and SP6 primers (see Note 4). 2. The purified template was used for in vitro transcription to generate sense RNA (sRNA) and antisense RNA(asRNA) using the T7 and SP6 RiboMAX express large-scale RNA production system from Promega.

396

Tuteja

3. The reaction components for SP6 or T7 RNA polymerase were added in a 1.5-ml tube as follows: 5X SP6 or T7 transcription buffer, 20 ml; rNTP mix, 20 ml; DNA template 10 mg; SP6 or T7 enzyme mix 10 ml and nuclease free water to make up the volume to 100 ml. After addition of all the components, the contents are mixed gently. The mixture is incubated at 37C for 4 h. 4. The dsRNA is prepared by annealing the sRNA and asRNA as described (11). For the production of dsRNA equal amounts of sRNA and asRNA were mixed and incubated, first at 65C for 30 min and then the incubation was continued at room temperature overnight (see Note 5). The mixture was treated with DNase and precipitated after phenol–chloroform extraction. 5. The pellet of dsRNA was dissolved in diethyl pyrocarbonate (DEPC) water and treated with RNase T1. These samples were checked on 1% (w / v) native agarose gel. 6. This dsRNA was quantitated and used for the following experiments. 7. dsRNA of green fluorescent protein (GFP) used for the control experiment was also synthesized using the same procedure. The dsRNA corresponding to PfH45 and GFP are shown in Fig. 27.1 .

Fig. 27.1 dsRNA of PfH45 (lane 1) and GFP (lane 2). Lane M is the molecular weight marker. The size of the marker is written in kb on the left side.


3.8. DsRNA Inhibition Assay

397

1. For analyzing the effect of dsRNA, the parasite culture is adjusted to 4% hematocrit with 1% infected red blood cells (RBCs) (see Note 6). 2. 200 ml of this mixture is centrifuged and the pellet is resuspended in 50 ml of incomplete media and 20 mg per ml of dsRNA. 3. This mixture is incubated at 37C with intermittent mixing to avoid settling of RBCs. 4. After this incubation, serum is added to a final concentration of 20% and the mixture is dispensed in 96-well plate and incubated at 37C for specific times. 5. The smears are made at specific time points (0, 12, 24 and 48 h) and the effect is determined by microscopic examination of parasitemia. 6. The morphology of the cultures is determined by examination of RBCs under oil immersion for the presence of intraerythrocytic Plasmodium falciparum and expressed as percentage parasitemia. An example of the parasite treated with the control GFP dsRNA and the specific dsRNA corresponding to PfH45 is shown in Fig. 27.2. It is clear that all the intraerythrocytic developmental stages are visible in the cultures treated with control GFP dsRNA (Fig. 27.2(a–c)) but the parasite morphology and growth is affected in cultures treated with PfH45-specific dsRNA (Fig. 27.2 (d)).

Fig. 27.2. The parasite morphology in untreated (a–c) or treated (d) parasite cultures. The cytologic examination of blood smears prepared from cultures revealed that the parasite morphology was distorted after treatment with PfH45-specific dsRNA, as evidenced by the presence of abnormal forms of parasites (d) as compared to the parasites prepared from cultures treated with control (GFP) dsRNA (a–c). It is clear that in cultures treated with control (GFP) dsRNA, the parasite undergoes its normal course of intraerythrocytic development and all the developmental stages, i.e., ring, trophozoite, and schizont stages are detectable (a–c). But in cultures treated with PfH45-specific dsRNA, the parasite growth is inhibited and the various developmental stages are not detected (d).

398

Tuteja

7. The growth in cultures treated with GFP is considered as 100% and the growth in culture treated with specific dsRNA relative to the control is also determined. The inhibition rate is determined using these two values (11).

4. Notes

1. For RNA extraction, wear gloves for every step and use RNase-free plasticware. 2. Trizol seems to work better if it is prewarmed to 37C. 3. It is better to heat the RNA sample at 65C for 5 min before adding the reagents for cDNA synthesis. 4. For preparation and assay of dsRNA, RNase-free conditions and autoclaved tubes treated with DEPC should be used. 5. It is also advised to check the quality and quantity of the sRNA and asRNA before mixing for the preparation of dsRNA. 6. It is advised to set the experiment with parasite culture in triplicate to obtain statistically significant results.

Acknowledgements The author thanks Arun Pradhan for help in the preparation of figures. The work on helicases in R.T.’s laboratory is partially supported by Department of Science and Technology grant. Infrastructural support from the Department of Biotechnology, Government of India is gratefully acknowledged. References 1. Tuteja, N. and Tuteja, R. (2004) Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery. Eur. J. Biochem. 271, 1835–1848. 2. Tuteja N. and Tuteja R. (2006) Helicases as molecular motors: an insight. Physica A 372, 70–83. 3. Tanner N. K. and Linder P. (2001) DExD/ H box RNA helicases: from generic motors

to specific dissociation functions. Mol. Cell. 8, 251–262. 4. Linder P. (2006) DEAD-box proteins: a family affair—active and passive players in RNP-remodeling. Nucleic Acids Res. 34, 4168–4180. 5. Tuteja R. (2007) Malaria-An overview. FEBS J., 274, 4670–4679. 6. Gardner M. J., Hall N., Fung, E., White O., Berriman M., Hyman R. W., Carlton J. M.,


7.

8.

9.

10.

Pain A., Nelson K. E., Bowman S. et al. (2002) Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419, 498–511. Tuteja R. and Pradhan A. (2006) Unraveling the ’DEAD-box’ helicases of Plasmodium falciparum. Gene 376, 1–12. Suntornthiticharoen P., Petmitr S., and Chavalitshewinkoon-Petmitr P. (2006) Purification and characterization of a novel 30 –50 DNA helicase from Plasmodium falciparum and its sensitivity to anthracycline antibiotics. Parasitology 133, 389–398. Tuteja R. (2007) Helicases: feasible antimalarial drug target for Plasmodium falciparum FEBS J. 274, 4699–4704. Pradhan A. and Tuteja R. (2006) Plasmodium falciparum DNA helicase 60: dsRNAand antibody-mediated inhibition of the malaria parasite growth and down regulation of its enzyme activities by DNA-

11.

12.

13.

14.

399

interacting compounds. FEBS J. 273, 3545–3556. Pradhan A. and Tuteja R. (2007) Bipolar, dual Plasmodium falciparum helicase 45 expressed during intraerythrocytic developmental cycle is required for parasite growth. J. Mol. Biol. 373, 268–281. Seow F., Sato S., Janssen C. S., Riehle M. O., Mukhopadhyay A., Phillips R. S., Wilson R. J., and Barrett M. P. (2005) The plastidic DNA replication enzyme complex of Plasmodium falciparum. Mol. Biochem. Parasitol. 141, 145–153. Trager W. and Jensen J. B. (1976) Human malaria parasite in continuous culture. Science 193, 673–675. Sambrook J., Fritsch E. F., and Maniatis T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

SUBJECT INDEX A AAA+ family ........................................................2, 4, 113, 114 fold ............................................................................ 2, 4 Affinity purification ......... 99–110, 198–199, 201–203, 213, 214–215, 365 Agrobacterium .................................. 378, 379, 380, 381–382 Antiviral agents............................................................... 224 Arabidopsis thaliana ......................................................... 195 Archae ........................................................... 4, 29, 127, 128 Assay agarose gel shift................................................. 295, 298 ATPase activity.................16–17, 22–23, 342, 347–349 binding ...37–41, 42, 169, 294–295, 297–298, 299, 328, 334, 335, 336 continuous stopped-flow fluorescence........................ 60 discontinuous gel-based radiometric .......................... 60 DNA strand annealing ..................................... 181–182 DNA unwinding...................................71, 72–74, 175, 177–179, 304 DNA unwinding and protein displacement ............... 88 dsRNA inhibition ............................................. 397–398 electrophoretic mobility shift (EMSA) ........... 306, 307, 315–316, 319–320, 328 exoribonuclease activity............................. 342, 349–351 filter binding ..................................... 294–295, 297–298 fluorescence anisotropy based DNA unwinding ...... 175 fluorometric....................................................... 211–220 helicase dissociation assay ........................................... 41 highresolution assay .................................................. 155 histochemical GUS assay.......................................... 384 leaf disk assay .................................................... 384–385 motility assay for molecular motors.......................... 160 oligonucleotide substrate-based radiometric ............ 360 optical-trapping ........................ 156, 159, 164–167, 170 RNA–protein binding filter.............. 342–343, 351–353 simultaneous helicase/protease ......................... 228, 230 strand displacement ........................ 197, 199–200, 203, 204–206 streptavidin displacement ..............87–88, 90, 138, 139, 142–143, 145–150 telomerase ................................................. 363, 369–370 translocation.............................................. 14–16, 39–40

unwinding assays........40–41, 42, 60, 62, 70, 71, 72–76, 128, 131, 133–134, 175, 177–179, 247, 283, 285–286, 288, 304 video-based tethered particle ............ 159–160, 167–168

B Bacteriophage T7.............................................................. 58 Biosensors ................................................................... 13–25 Branch migration .................................................... 128–130

C Calmodulin affinity chromatography............ 197, 198–199, 202–203 binding peptide ................................................. 197, 200 Cation exchange chromatography .......... 143, 361, 365–366 Chromatin immunoprecipitation (ChIP)...... 113–125, 266, 267, 268, 269, 274–275, 276–277 Computational model for polymerization....................................................... 68 for unwinding ............................................................. 68 Conformational change ............2, 6, 39, 58, 236, 237, 239, 240, 242 Conserved motif ................................................. 1, 2, 3, 390

D Daughter strand .................................................................. 3 Degradosome ...................................................... 7, 339–356 D-loops ........................................................... 185, 187, 197 DNA annealing...................................130–132, 176, 181, 294 binding .........15, 29, 37, 42, 86, 91, 169, 175, 178, 179, 227, 328, 331, 334, 336 polymerase......................3, 4, 30, 57, 58, 60, 61, 62, 64, 71, 76, 80, 114, 121, 269, 276, 306, 308, 321, 329, 337 replication .........................................3–4, 7, 30, 58, 390 secondary structures .................................................. 211 synthesis .....4, 61–63, 64, 71, 72, 76–77, 192, 268, 273, 394–395, 398 DNA-dependent NTPase .............................................. 390 Domain mapping............................................................ 293 Dosage compensation ..................................... 303, 304, 309 Double affinity purification .................... 198–199, 201–203

M.M. Abdelhaleem (ed.), Helicases, Methods in Molecular Biology 587, DOI 10.1007/978-1-60327-355-8, ª Humana Press, a part of Springer Science+Business Media, LLC 2010

401

HELICASES

402 Subject Index Double stranded break repair ............................................................... 113 DNA .........................4, 14, 74, 179, 328, 334, 336, 389 RNA.......................................................... 285, 289–398 RNA binding domain (dsRBD) ............................... 300 Drosophila................................128, 185–194, 303, 308, 323 BLM helicase.................................................... 185–194 Dual NS3 helicase/protease inhibitors ........................... 224 Duplex unwinding ............................ 87, 245–262, 340, 343

E Elastic network model ............................................ 235–243 Elementary rate constants....................................... 257, 258 Exonuclease..................................................... 4, 5, 121, 187

F Flow cell assembly........................................... 159, 164–165 Flow chambers ...................................... 34–35, 40, 167, 170 Fluorescence resonance energy transfer (FRET)............. 14, 29–43, 93, 94, 181, 182, 212 Fluorescent biosensors ................................................ 13–25 Fluorescent dyes.................................................. 50, 60, 212

G Global regression analysis................................................. 69

H Helicase Cyt-19....................................................................... 261 Dda ............................................................................. 86 DDX3 ............................................................... 281–288 Ddx4 ............................................................................. 7 Ddx5 ................................................................. 265–278 DDX9 ....................................................................... 291 DDX28 ......................................................................... 7 DEAD-box...................2, 6, 7, 245–262, 340, 378, 390 DEAH-box................................................................... 2 Ded1p ....................................................................... 254 DExD/H-box ............................................................... 2 DHX30 ......................................................................... 7 DHX32 ......................................................................... 7 DnaB...............................3, 60, 127, 128, 129, 132, 133 eIF4A ............................................................................ 6 helicase-catalyzed reaction.......................................... 58 helicase core ......................2, 3, 176, 227, 245, 246, 328 helicase motif ........2, 196, 197, 200, 203, 226, 245, 291 hepatitis C virus (HCV) non structural protein 3 (NS3) ...................86, 211–220, 223–232, 236 hexameric helicase.....................1, 3, 4, 5, 58, 60, 72–76 mHel61 ......................................................................... 7 mitochondrial................................................ 7, 339–356 monomeric ............................................................ 1, 236 Mrh4 ............................................................................. 7

Mss116p........................................................ 7, 250, 254 Mtr4.............................................................................. 7 NDH II............................................................. 291–301 NPH-II.......................................................3, 86, 95, 96 NS3 ......30, 86, 211–220, 223–232, 236, 239, 240, 241, 242, 243 p68 ................................................................ 5, 265–278 PcrA ..................................22, 30, 86, 88–89, 93, 94–97 PfDH60 .................................................................... 390 PfH45 ....................................................... 390, 395–396 Pif1p.............................................................. 7, 359–375 plant helicase............................. 196, 197–198, 200–201 RecBCD ................................................................... 168 RECQ4......................................................................... 5 RecQ helicases in Drosophila ............................ 185–194 RecQ helicases in plant..................................... 195–208 replication fork helicases................................... 127–134 RHAU .......................................................................... 7 RhlB.............................................................................. 7 Rho................................................5, 139, 142, 148, 150 ring-shaped helicase........................................ 58, 59, 60 RNA helicase .......2, 3, 5, 6, 7, 86, 87, 94–97, 246, 247, 249, 258, 259, 261, 265–278, 281–288, 291–301, 328, 339, 340, 390 RNA helicase A .................................................... 5, 291 Ski2 ....................................................................... 7, 340 Ski2p ..................................................................... 7, 340 Suv3p ............................................7, 340, 343, 347, 349 T7gp4............................................................................ 4 Twinkle ......................................................................... 7 Upf1 .............................................................. 7, 327–337 UvrABC........................................................................ 4 UvrD ................................................................. 4, 30, 85 viral helicase .............................................................. 281 WRN .................................................................... 5, 292 XPD (ERCC2)......................................................... 4, 5 High throughput screening .................................... 212, 230 Holliday junctions........................................... 174, 185, 197 Homologous recombination ........5, 86, 174, 186, 187, 188, 190, 193 Human immunodeficiency virus type 1 (HIV-1)... 281–288

I Inhibitor screening.................................................. 212, 230

K Kinetic model........................................................ 15, 46, 47 Kinetic step-size........................................45, 46, 48, 49, 62

L Ligase ................................................4, 89, 94, 95, 229, 329

HELICASES Subject Index 403 M Malaria parasite............................................................... 390 Maleless (MLE) ............................................. 291, 303–325 Mass spectrometry ............................25, 100, 101, 109, 143 Mathematical model for translocation ....................... 46–51 Mini chromosome maintenance (MCM)....... 2, 29, 38, 114 Mismatch repair (MMR) ................................................... 4 Mitochondrial degradosome complex............................................... 340 DNA repair and recombination ................................... 7 helicase .......................................................... 7, 339–356 RNA editing ................................................................. 7 Model-based methods .......................................... 63, 65, 66 Molecular motor ...................................3, 45, 156, 160, 340 Mutational analysis ......................................... 173–184, 328

Pre-steady state ensemble kinetic approaches....................................... 46 single-turnover measurements .............................. 16, 25 unwinding reactions.................................. 253–258, 259 Primase......................................................3, 4, 7, 30, 58, 80 Primer extension ......................................................... 62, 63 Processivity................2, 13, 30, 43, 48, 57, 59, 81, 258, 375 Progressive external ophthalmoplegia ................................ 7 Protein conformational change................................... 2, 237 Protein displacement by helicases............................... 85–97 Protein–protein interaction ............................ 3, 85, 99–110 PTC premature termination codon............................ 7, 327

Q Quantitative kinetic information.............................. 45, 256 Quantitative PCR, RT-PCR ......................................... 266

N Nonsense-mediated mRNA decay (NMD) ....... 7, 327, 328 Normal mode analysis............................................. 236–237 Northwestern blotting .................................... 293, 299–300 n-step .............................................................. 46, 53, 54, 59 NTP binding....................................................................... 2 NTP hydrolysis ................................................... 2, 6, 57, 85 Nucleic acid binding domain......................................... 291, 292, 300 motor..................................................................... 2, 137 substrates................................... 140–142, 145–150, 292 unwinding ................................................... 57, 105, 292 Nucleotide excision repair (NER) ...................................... 4

O Optical trap ..........................................156, 159, 160, 164–167, 168, 170 tweezers..................................................................... 165 Overexpression.............................................. 101, 143, 157, 160–162, 328–332, 360, 361, 364, 366, 373, 377–386

P PAGE-based duplex unwinding .................................... 247 P element ................................................................ 186, 188 Plant transformation............................................... 378–381 Plasmodium falciparum ............................................ 389–398 Polymerase ....................................................3, 4, 6, 30, 45, 53, 57, 58, 60, 61, 62, 64, 68, 71, 76, 77, 79, 80, 86, 94, 109, 114, 121, 139, 140, 146, 187, 192, 196, 200, 212, 229, 266, 269, 276, 282, 285, 305, 306, 308, 312, 321, 324, 329, 337, 392, 396 Polymerization kinetics............................................... 57–81 Pre-mRNA ..................................................................... 247 Pre-rRNA ........................................................................... 6

R Real-time measurement.............................................. 14, 16 RecA-like domain............................................... 3, 227, 245 Recombination.......2, 5, 7, 85, 86, 100, 101, 104, 106, 113, 114, 117, 174, 186, 187, 188, 190 Repair.........2, 4–5, 7, 85, 86, 113, 117, 155, 174, 185–194, 196, 235, 378, 390 Replication fork............3, 62, 64, 114, 118, 121, 122, 127–134, 197 initiation........................................................................ 2 Replisome.......................................................... 3, 64, 71, 76 RGG-box........................................................................ 291 Ribonucleoprotein complex .................................... 3, 6, 246 Ribosome biogenesis........................................... 6, 247, 390 RNA binding .......94, 143, 236, 238, 241, 242, 243, 246, 291, 300, 309, 327, 328, 330–331, 334, 335–336, 349 degradation ........................................... 7, 151, 339, 343 ribosomal....................................................... 6, 265, 390 secondary structure ...................................5, 6, 211, 246 SnoRNA ....................................................................... 6 SnRNA ......................................................................... 6 splicing .......................................................................... 6 RNPase ............................................................................... 3

S Saccharomyces cerevisiae.................... 100, 113–125, 128, 359 Salinity stress tolerance........................................... 377–386 Single molecule FRET.................................................................... 29–43 studies ............................................................... 155–171 Single-stranded DNA binding protein (SSB)..... 15, 16, 18, 19–21, 22, 24, 25, 62, 69, 74, 75, 91, 157, 159, 160, 162, 168 Software for model-based analysis.............................. 65–66 Spliceosome ........................................................................ 6

HELICASES

404 Subject Index Steady state reactions.............................. 254, 258, 259–261 Step size ....2, 39, 45, 46, 48, 49, 51, 53, 60, 62, 65, 68, 258 Strand annealing reactions...................... 254, 255–256, 257 Strand displacement...............62, 64, 71, 76, 197, 199–200, 203, 204–206 Streptavidin displacement and DNA unwinding by Dda ........................................................... 90–92 Superfamily .........................1, 245, 281, 291, 328, 340, 390 Syndrome Bloom syndrome................................................. 30, 185 Cockayne syndrome...................................................... 5 Rothmund-Thomson syndrome................................... 5 Werner syndrome ................................................. 5, 292

T T7 bacteriophage .......................................................... 4, 58 Tandem affinity purification (TAP)......................... 99–110 Telomere ............................................................. 5, 359, 369 telomerase activity...............7, 361–362, 366–367, 369, 371, 375 Termination ....................5, 7, 137–152, 306, 319, 327, 378 Tethered particle motion ................................................ 167 Thin layer chromatography ............151, 307, 328, 347, 350 Topoisomerase II ............................................ 305, 318, 319 Transcription coactivator ................................................................. 266 regulation .............................................. 5, 113, 265, 309 Transesterification .............................................................. 6 Transgenic plant ..................................... 378, 379, 382–386

Transient pre-steady state kinetic experiments ................ 51 Translation.....6–7, 104, 165, 207, 235, 237, 238, 247, 265, 282, 327, 359, 378, 380, 390 Translocase................2, 4, 46, 47, 48, 49, 50, 51–52, 53, 54 Translocation ...2, 13, 14–16, 17, 29, 30, 32, 37, 39–40, 42, 45–55, 58, 65, 86, 167, 247, 248, 258 directional ............................................................... 2, 45 Transposon.............................................................. 186, 188 Trichothiodystrophy (TTD) .............................................. 5

U Unwinding activity......3, 4, 6, 57, 70, 128, 129, 167, 174, 247, 250, 261, 262, 291, 292, 297, 340, 343 kinetics ............................................................ 59–60, 81

W Walker A motif........................................................... 2, 200 Walker B motif ................................................................... 2

X Xeroderma pigmentosum (XP) ...................................... 4, 5 X-linked dosage compensation............................... 303, 309

Y Yeast.........................6, 7, 86, 100, 102, 109, 114, 115–116, 117–119, 123, 128, 187, 197, 307, 329, 339–356, 359–375, 379

Helicases: Methods and Protocols (Methods in Molecular Biology, Vol 587)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Metabolomics: Methods and Protocols (Methods in Molecular Biology Vol 358)

Metagenomics: Methods and Protocols - Methods in Molecular Biology Vol 668

Immunotoxin Methods and Protocols (Methods in Molecular Biology Vol 166)

Liposome Methods and Protocols (Methods in Molecular Biology Vol 199)

Peptidomics: Methods and Protocols (Methods in Molecular Biology Vol 615)

Nuclease Methods and Protocols (Methods in Molecular Biology Vol 160)

Neuroproteomics: Methods and Protocols (Methods in Molecular Biology, Vol 566)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Immunotoxin Methods and Protocols (Methods in Molecular Biology Vol 166)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Bioremediation: Methods and Protocols (Methods in Molecular Biology Vol 599)

Claudins: Methods and Protocols (Methods in Molecular Biology Vol 762)

Complement Methods and Protocols (Methods in Molecular Biology Vol 150)

Chemotaxis: Methods and Protocols (Methods in Molecular Biology Vol 571)

Yeast Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Molecular Imaging: Methods and Protocols (Methods in Molecular Biology)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology, v787)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology 787)

Molecular Profiling: Methods and Protocols (Methods in Molecular Biology, 823)

Molecular Toxicology Protocols (Methods in Molecular Biology)

Bioinformatics. Methods and Protocols in Molecular Biology

Microchip Capillary Electrophoresis: Methods And Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Epidermal Cells: Methods and Protocols (Methods in Molecular Biology) (Methods in Molecular Biology Series)

Systems Biology in Drug Discovery and Development: Methods and Protocols (Methods in Molecular Biology, Vol. 662)

Human Embryogenesis: Methods and Protocols (Methods in Molecular Biology)

Immunological Tolerance: Methods and Protocols (Methods in Molecular Biology)

Clostridium difficile: Methods and Protocols (Methods in Molecular Biology, 646)

Hepatocytes: Methods and Protocols (Methods in Molecular Biology 640)

Biofuels: Methods and Protocols (Methods in Molecular Biology 581)

Helicases: Methods and Protocols (Methods in Molecular Biology, Vol 587)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Metabolomics: Methods and Protocols (Methods in Molecular Biology Vol 358)

Metagenomics: Methods and Protocols - Methods in Molecular Biology Vol 668

Immunotoxin Methods and Protocols (Methods in Molecular Biology Vol 166)

Liposome Methods and Protocols (Methods in Molecular Biology Vol 199)

Peptidomics: Methods and Protocols (Methods in Molecular Biology Vol 615)

Nuclease Methods and Protocols (Methods in Molecular Biology Vol 160)

Neuroproteomics: Methods and Protocols (Methods in Molecular Biology, Vol 566)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Immunotoxin Methods and Protocols (Methods in Molecular Biology Vol 166)

Cytoskeleton Methods and Protocols (Methods in Molecular Biology Vol 161)

Bioremediation: Methods and Protocols (Methods in Molecular Biology Vol 599)

Claudins: Methods and Protocols (Methods in Molecular Biology Vol 762)

Complement Methods and Protocols (Methods in Molecular Biology Vol 150)

Chemotaxis: Methods and Protocols (Methods in Molecular Biology Vol 571)

Yeast Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Molecular Imaging: Methods and Protocols (Methods in Molecular Biology)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology, v787)

Molecular Chaperones: Methods and Protocols (Methods in Molecular Biology 787)

Molecular Profiling: Methods and Protocols (Methods in Molecular Biology, 823)

Molecular Toxicology Protocols (Methods in Molecular Biology)

Bioinformatics. Methods and Protocols in Molecular Biology

Microchip Capillary Electrophoresis: Methods And Protocols (Methods in Molecular Biology) (Methods in Molecular Biology)

Epidermal Cells: Methods and Protocols (Methods in Molecular Biology) (Methods in Molecular Biology Series)

Systems Biology in Drug Discovery and Development: Methods and Protocols (Methods in Molecular Biology, Vol. 662)

Human Embryogenesis: Methods and Protocols (Methods in Molecular Biology)

Immunological Tolerance: Methods and Protocols (Methods in Molecular Biology)

Clostridium difficile: Methods and Protocols (Methods in Molecular Biology, 646)

Hepatocytes: Methods and Protocols (Methods in Molecular Biology 640)

Biofuels: Methods and Protocols (Methods in Molecular Biology 581)

Recommend Documents