Antisense Drug Technology: Principles, Strategies, and Applications, Second Edition

CRC_8796_FM.qxd 6/22/2007 11:27 Page i Second Edition Antisense Drug Technology Principles, Strategies, and Appli...

Author: Stanley T. Crooke

197 downloads 1671 Views 7MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

CRC_8796_FM.qxd

6/22/2007

11:27

Page i

Second Edition

Antisense Drug Technology

Principles, Strategies, and Applications

CRC_8796_FM.qxd

6/22/2007

11:27

Page ii

CRC_8796_FM.qxd

6/22/2007

11:27

Page iii

Second Edition

Antisense Drug Technology

Principles, Strategies, and Applications

Edited by

Stanley T. Crooke

Boca Raton London New York

CRC Press is an imprint of the Taylor & Francis Group, an informa business

CRC_8796_FM.qxd

6/22/2007

11:27

Page iv

CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2008 by Taylor & Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business No claim to original U.S. Government works Printed in the United States of America on acid-free paper 10 9 8 7 6 5 4 3 2 1 International Standard Book Number-10: 0-8493-8796-5 (Hardcover) International Standard Book Number-13: 978-0-8493-8796-8 (Hardcover) This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. No part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, please access www.copyright.com (http:// www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC) 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Library of Congress Cataloging-in-Publication Data Antisense drug technology : principles, strategies, and applications / editor Stanley T. Crooke. -- 2nd ed. p. ; cm. Includes bibliographical references and index. ISBN-13: 978-0-8493-8796-8 (alk. paper) ISBN-10: 0-8493-8796-5 (alk. paper) 1. Antisense nucleic acids--Therapeutic use. I. Crooke, Stanley T. [DNLM: 1. Oligonucleotides, Antisense--therapeutic use. QU 57 A6324 2006] I. Title. RM666.A564A567 2006 615’.31--dc22 Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com

2006101712

CRC_8796_FM.qxd

6/22/2007

11:27

Page v

Contents Preface ..............................................................................................................................................ix Acknowledgments............................................................................................................................xi The Editor......................................................................................................................................xiii Contributors....................................................................................................................................xv Part I Introduction ........................................................................................................................................1 Chapter 1 Mechanisms of Antisense Drug Action, an Introduction...................................................................3 Stanley T. Crooke, Timothy Vickers, Walt Lima, and Hongjiang Wu Chapter 2 The RNase H Mechanism ................................................................................................................47 Walt Lima, Hongjiang Wu, and Stanley T. Crooke Chapter 3 Small RNA Silencing Pathways.......................................................................................................75 Alla Sigova and Phillip D. Zamore Chapter 4 Splice Switching Oligonucleotides as Potential Therapeutics.........................................................89 Peter Sazani, Maria A. Graziewicz, and Ryszard Kole Part II The Basics of Oligonucleotide-Based Therapeutics ......................................................................115 Chapter 5 Basic Principles of Antisense Drug Discovery ..............................................................................117 Susan M. Freier and Andrew T. Watt Chapter 6 The Medicinal Chemistry of Oligonucleotides..............................................................................143 Eric E. Swayze and Balkrishen Bhat Chapter 7 Basic Principles of the Pharmacokinetics of Antisense Oligonucleotide Drugs ...........................183 Arthur A. Levin, Rosie Z. Yu, and Richard S. Geary Chapter 8 Routes and Formulations for Delivery of Antisense Oligonucleotides .........................................217 Gregory E. Hardee, Lloyd G. Tillman, and Richard S. Geary Chapter 9 Liposomal Formulations for Nucleic Acid Delivery......................................................................237 Ian MacLachlan v

CRC_8796_FM.qxd

vi

6/22/2007

11:27

Page vi

CONTENTS

Part III A Hybridization-Based Drugs: Basic Properties 2⬘-O-Methoxyethyl Oligonucleotides ..................271 Chapter 10 Pharmacological Properties of 2⬘-O-Methoxyethyl-Modified Oligonucleotides ..........................273 C. Frank Bennett Chapter 11 Pharmacokinetic/Pharmacodynamic Properties of Phosphorothioate 2⬘-O-(2-Methoxyethyl)Modified Antisense Oligonucleotides in Animals and Man .........................................................305 Richard S. Geary, Rosie Z. Yu, Andrew Siwkowski, and Arthur A. Levin Chapter 12 Toxicologic Properties of 2⬘-O-Methoxyethyl Chimeric Antisense Inhibitors in Animals and Man .......................................................................................................................327 Scott P. Henry, Tae-Won Kim, Kimberly Kramer-Stickland, Thomas A. Zanardi, Robert A. Fey, and Arthur A. Levin Chapter 13 An Overview of the Clinical Safety Experience of First- and Second-Generation Antisense Oligonucleotides............................................................................................................365 T. Jesse Kwoh Chapter 14 Manufacturing and Analytical Processes for 2⬘-O-(2-Methoxyethyl)-Modified Oligonucleotides.............................................................................................................................401 Daniel C. Capaldi and Anthony N. Scozzari Part III B Hybridization-Based Drugs: Basic Properties Duplex RNA Drugs ..............................................435 Chapter 15 Utilizing Chemistry to Harness RNA Interference Pathways for Therapeutics: Chemically Modified siRNAs and Antagomirs .............................................................................437 Muthiah Manoharan and Kallanthottathil G. Rajeev Chapter 16 Discovery and Development of RNAi Therapeutics......................................................................465 Antonin R. de Fougerolles and John M. Maraganore Part IV Other Chemical Classes of Drugs ..................................................................................................485 Chapter 17 Optimization of Second-Generation Antisense Drugs: Going Beyond Generation 2.0 ................487 Brett P. Monia, Rosie Z. Yu, Walt Lima, and Andrew Siwkowski Chapter 18 Modulating Gene Function with Peptide Nucleic Acids (PNA)....................................................507 Peter E. Nielsen

CRC_8796_FM.qxd

6/22/2007

CONTENTS

11:27

Page vii

vii

Chapter 19 Locked Nucleic Acid......................................................................................................................519 Troels Koch and Henrik Ørum Chapter 20 Morpholinos ...................................................................................................................................565 Patrick L. Iversen Part V Therapeutic Applications ...............................................................................................................583 Chapter 21 Potential Therapeutic Applications of Antisense Oligonucleotides in Ophthalmology ................585 Lisa R. Grillone and Scott P. Henry Chapter 22 Cardiovascular Therapeutic Applications ......................................................................................601 Rosanne Crooke, Brenda Baker, and Mark Wedel Chapter 23 Developing Antisense Drugs for Metabolic Diseases: A Novel Therapeutic Approach ...............641 Sanjay Bhanot Chapter 24 Inflammatory Diseases...................................................................................................................665 Susan A. Gregory and James G. Karras Chapter 25 Antisense Oligonucleotides for the Treatment of Cancer..............................................................699 Boris A. Hadaschik and Martin E. Gleave Chapter 26 Targeting Neurological Disorders with Antisense Oligonucleotides.............................................721 Richard A. Smith and Timothy M. Miller Chapter 27 Mechanisms and Therapeutic Applications of Immune Modulatory Oligodeoxynucleotide and Oligoribonucleotide Ligands for Toll-Like Receptors ............................................................747 Jörg Vollmer and Arthur M. Krieg Chapter 28 Aptamer Opportunities and Challenges .........................................................................................773 Charles Wilson Index...............................................................................................................................................801

CRC_8796_FM.qxd

6/22/2007

11:27

Page viii

CRC_8796_FM.qxd

6/22/2007

11:27

Page ix

Preface At the conclusion of the preface for the first edition of this publication, I wrote: The chapters in this volume, recent publications, and recent symposia, such as the meeting sponsored by Nature Biotechnology, provide compelling answers to the questions about the technology. In the aggregate, the data provide ample justification for cautious optimism. It is clearly a remarkably valuable tool to dissect pharmacological processes and confirm the roles of various genes. Perhaps more importantly, even the first-generation compounds— the phosphorothioates—may have sufficient properties to be of use as drugs for selected indications, and new generations of antisense drugs may broaden the therapeutic utility of drugs based on antisense technology. Nevertheless, it is important to remember that we are less than a decade into the aggressive creation and evaluation of antisense technology. And we are attempting to create an entirely new branch of pharmacology: new chemical class, oligonucleotides; a new receptor, RNA; a new drug–receptor binding motif, hybridization; and new postreceptor binding mechanisms. Thus there are still many more questions than answers. Arguably, then, we are at the end of the beginning of this technology. There is a great deal more to do before we understand the true value and limits of antisense, but we are buoyed by the progress to date and look forward to the challenges ahead.

So where do we stand today? This volume speaks to logarithmic progress in oligonucleotide-based therapeutics and, in particular, antisense therapeutics. Advances in every area from medicinal chemistry to clinical evaluations are remarkable, especially when one considers the modest investment that has been made relative to the investments in other new platform opportunities such as monoclorial antibodies or gene therapy. Nevertheless, despite logarithmic progress in advancing and understanding the technology, the process of converting the technology to therapeutically important, commercially successful, and systemically administered new medicines has encountered several substantial disappointments. Although macugen, an aptamer, was approved for the local treatment of age-related macular edema (see Chapter 22), two first-generation antisense drugs administered systemically failed to achieve positive phase 3 studies. The new drug application (NDA) for a third drug, Genasense, was rejected by the Food and Drug Administration (FDA) and a new NDA for use of the drug in chronic lymphocytic leukemia was also rejected. How should we interpret these disappointments with regard to the value of the technology as a whole and in the context of the extraordinary progress that has been reported? This volume provides detailed answers to that enormously complex question. Affinitak, a first-generation antisense inhibitor of protein kinase C (PkC) was added to either carboplatinum and taxol or gemcitibine and cisplatinum and its effects on survival in patients with stage III/IV nonsqamous cell carcinoma of the lung (NSCCL) were evaluated. It resulted in no statistically significant survival benefit. Although we were unable to measure drug levels in tumors in the phase 3 studies, based on our experience with other first- and second-generation antisense drugs, we believe it is likely that there was sufficient drug in the tumors to produce a pharmalogic effect. So perhaps, PkC is not a significant contributor to the maintenance of the malignant phenotype in these patients. Perhaps we underdosed; we certainly didn’t achieve a maximal tolerated dose. Perhaps the disease was so advanced that patients could not benefit. That a new drug added to a two-drug regimen for NSCCL failed to bring benefit is not too surprising as most drugs have failed in this setting. Nevertheless, Affinitak failed and it was a setback for acceptance of the technology. The failure of Affinitak is discussed in some detail in Chapter 26. Because initial phase 2 results obtained in randomized double-blind placebo-controlled clinical trials were quite positive, the failure of Alicaforsen in the treatment of patients with Crohn’s disease is perhaps more disappointing and puzzling. It was also surprising because after a dose of 2 mg/kg three times weekly for one month in a phase 2 trial, we reported reductions of ICAM-1, the Alicaforsen target, in the bowels of patients with Crohn’s disease. In fact, in two phase 3 studies we used doses substantially greater than 2 mg/kg, so it is likely that the drug was dosed adequately. Our ix

CRC_8796_FM.qxd

x

6/22/2007

11:27

Page x

PREFACE

best guess is that ICAM-1 is not critical in maintenance of Crohn’s disease in the patients we studied. Interestingly, as discussed in Chapter 25, the enema formulation of the drugs has demonstrated good efficacy in patients with ulcerative colitis. However, it is gratifying that in studies on Affinitak and Alicaforsen and now many other firstgeneration antisense drugs, we did not encounter severe dose-limiting toxicities. Even in the presence of very toxic chemotherapeutic regimes, in very sick patients, Affinitak’s contribution to toxicity was modest (see Chapters 14 and 26 for review). The third first-generation antisense drug to undergo phase 3 evaluations, an NDA, Genasense, was submitted for approval by the FDA for the treatment of malignant melanoma and was rejected. More recently, an NDA for the treatment of chronic lymphocytic leukemia was submitted. Despite the fact that the trial met its primary endpoint, the oncology advisory panel recommended the NDA be denied. Are there general lessons about antisense technology to be derived from these disappointments? Yes. First and most important, the experiences with these drugs and the many other first-generation antisense drugs demonstrate that even first-generation antisense drugs are reasonably well tolerated. Even Genasense, the most immunotoxic of the first-generation antisense drugs, was adequately tolerated when administered at relatively high doses in the presence of very cytotoxic chemotherapeutic regimens. Second, it is clear that antisense drugs with improved potency, better pharmacokinetic properties, and improved therapeutic index are needed. Of course, that was obvious in 1989 when we began the work on the technology, the evaluation of first-generation drugs, and the creation of second-generation drugs. Importantly, as Part 3 of the volume demonstrates, 2⬘ methoxyethyl chimeras represent a dramatic advance and are performing well. Other new chemistries and mechanisms of action offer the promise of even greater advances (Part 4 of this volume). Third, obviously drugs fail and often we really do not understand why. After more than 100 years of experience with small molecule drug discovery, 9 out of the 10 small molecules that begin development fail. So, it should not be surprising that representatives of a new class of drugs also fail. After all, they are subject to the same challenges and issues that all drugs face in phase 3 trials and in the regulatory process. What is important is amply demonstrated by this volume. Our understanding of the technology has advanced at a remarkable pace. New mechanisms and new opportunities for antisense drugs and other oligonucleotide-based drugs are being identified at an exciting pace. Second-generation antisense drugs are dramatically better, work in vitro, in vivo, and in clinical trials. And the technology is poised to continue logarithmic growth. Therefore, the tasks that remain are to finish the first leg of the journey. Developing a new platform for drug development is much more than a marathon. We must continue to aggressively, but prudently pursue the great opportunity that is presented by the technology and which is now firmly in our grasp. Stanley T. Crooke Isis Pharmaceuticals, Inc.

CRC_8796_FM.qxd

6/22/2007

11:27

Page xi

Acknowledgments Editing a multiauthor volume is a bit like managing the United Nations. The editor has no authority and must depend on the goodwill and commitment of the authors of the chapters and his ability to twist the occasional arm. In the preparation of this volume, I was fortunate to have outstanding authors who met their commitments. I want to thank all the authors for their scholarly contributions and their commitment to meet the deadlines I imposed. I hope the reader will agree that all the chapters offer excellent value and are more than simply reviews. Rather, individually and in the aggregate, I believe that they constitute a compilation of the information available about this complex topic today and are integrated in a fashion that supports the development of a perspective on the future and an informed agenda with which to continue to advance the science. I want to thank Donna Parrett, who not only was responsible for preparing the two chapters in which I was involved, but was also coordinating the assembly of the book while completing all her other responsibilities. Thanks, Donna. I also want to thank those who will read the book. I appreciate your interest and look forward to the many contributions to the field that will be supported by the knowledge summarized in this volume.

xi

CRC_8796_FM.qxd

6/22/2007

11:27

Page xii

CRC_8796_FM.qxd

6/22/2007

11:27

Page xiii

The Editor Stanley T. Crooke is founder, chairman, and chief executive officer of Isis Pharmaceuticals. Isis is a development-stage biopharmaceutical company that is focused on a new paradigm in drug discovery, antisense oligonucleotides. Since Dr. Crooke and his colleagues founded Isis in 1989, the company has grown rapidly, completing its initial public offering in May 1991, and has reported broad progress in antisense technology and its rapid conversion to therapeutic product opportunities. Isis was the first company to commercialize an antisense drug and has achieved a number of important corporate collaborative relationships. In 2006, Dr. Crooke was named in Nature Biotechnology as one of biotech’s influential individuals. Dr. Crooke is currently a member Northern Arizona University Arts and Sciences Advisory Council, Flagstaff, Arizona and San Diego State University BioScience Center Scientific Advisory Board. He is a member of the Current Drugs Advisory Board; the Editorial Advisory Board of Journal of Drug Targeting and Antisense Research and Development; and the Editorial Board of Gene Therapy and Molecular Biology. He is also editor-in-chief of Current Opinion in Anticancer Drugs and section editor for Biologicals and Immunologicals for Expert Opinion on Investigational Drugs. Prior to founding Isis, Dr. Crooke was president of Research and Development for SmithKline Beckman Corporation (SKB). He also coordinated the research and development activities of SKB including its instruments, diagnostics, animal health, and clinical laboratory businesses. Before joining SKB, Dr. Crooke helped establish the anticancer drug discovery and development program at Bristol Myers, which succeeded in bringing to market a significant number of drugs. During his career, Dr. Crooke has supervised the development of 19 drugs currently on the market and others in development. In addition to his involvement in the pharmaceutical industry, Dr. Crooke also maintains active academic positions. He is an adjunct professor at San Diego State University, and has won a number of teaching awards. He has authored over 440 publications and has edited 20 books. Dr. Crooke is active in molecular and cellular biology and pharmacology of antisense oligonucleotides. Dr. Crooke received his BS in Pharmacy from Butler University, Indianapolis, Indiana, and his MD and PhD from Baylor College of Medicine, Houston, Texas.

xiii

CRC_8796_FM.qxd

6/22/2007

11:27

Page xiv

CRC_8796_FM.qxd

6/22/2007

11:27

Page xv

Contributors Brenda Baker Isis Pharmaceuticals, Inc. Carlsbad, California

Maria A. Graziewicz Ercole Biotech Inc. Chapel Hill, North Carolina

C. Frank Bennett Isis Pharmaceuticals, Inc. Carlsbad, California

Susan A. Gregory Isis Pharmaceuticals, Inc. Carlsbad, California

Sanjay Bhanot Isis Pharmaceuticals, Inc. Carlsbad, California

Lisa R. Grillone Aerie Pharmaceuticals, Inc. Research Triangle Park, North Carolina

Balkrishen Bhat Isis Pharmaceuticals, Inc. Carlsbad, California

Boris A. Hadaschik The Prostate Centre Vancouver General Hospital Vancouver, British Columbia, Canada

Daniel C. Capaldi Isis Pharmaceuticals, Inc. Carlsbad, California Rosanne Crooke Isis Pharmaceuticals, Inc. Carlsbad, California Stanley T. Crooke Isis Pharmaceuticals, Inc. Carlsbad, California Antonin R. de Fougerolles Alnylam Pharmaceuticals Cambridge, Massachusetts Robert A. Fey Isis Pharmaceuticals, Inc. Carlsbad, California Susan M. Freier Isis Pharmaceuticals, Inc. Carlsbad, California Richard S. Geary Isis Pharmaceuticals, Inc. Carlsbad, California Martin E. Gleave Department of Urologic Sciences Vancouver General Hospital Vancouver, British Columbia, Canada

Gregory E. Hardee Isis Pharmaceuticals, Inc. Carlsbad, California Scott P. Henry Isis Pharmaceuticals, Inc. Carlsbad, California Patrick L. Iversen AVI BioPharma, Inc. Corvallis, Oregon James G. Karras Isis Pharmaceuticals, Inc. Carlsbad, California Tae-Won Kim Isis Pharmaceuticals, Inc. Carlsbad, California Troels Koch Santaris Pharma Hørsholm, Denmark Ryszard Kole University of North Carolina Lineberger Comprehensive Cancer Center Chapel Hill, North Carolina Kimberly Kramer-Stickland Biogen IDEC San Diego, California xv

CRC_8796_FM.qxd

6/22/2007

11:27

Page xvi

xvi

CONTRIBUTORS

Arthur M. Krieg Coley Pharmaceutical Group, Inc. Wellesley, Massachusetts

Peter Sazani Ercole Biotech Inc. Chapel Hill, North Carolina

T. Jesse Kwoh Isis Pharmaceuticals, Inc. Carlsbad, California

Anthony N. Scozzari Isis Pharmaceuticals, Inc. Carlsbad, California

Arthur A. Levin Isis Pharmaceuticals, Inc. Carlsbad, California

Alla Sigova Department of Biochemistry and Molecular Pharmacology University of Massachusetts Medical School Worcester, Massachusetts

Walt Lima Isis Pharmaceuticals, Inc. Carlsbad, California Ian MacLachlan Protiva Biotherapeutics Inc. Burnaby, British Columbia, Canada Muthiah Manoharan Alnylam Pharmaceuticals Cambridge, Massachusetts John M. Maraganore Alnylam Pharmaceuticals Cambridge, Massachusetts Timothy M. Miller Department of Neurosciences University of California San Diego, California Brett P. Monia Isis Pharmaceuticals, Inc. Carlsbad, California

Andrew Siwkowski Isis Pharmaceuticals, Inc. Carlsbad, California Richard A. Smith Center for Neurologic Study La Jolla, California Eric E. Swayze Isis Pharmaceuticals, Inc. Carlsbad, California Lloyd G. Tillman Isis Pharmaceuticals, Inc. Carlsbad, California Timothy Vickers Isis Pharmaceuticals, Inc. Carlsbad, California Jörg Vollmer Coley Pharmaceutical, GmbH Langenfeld, Germany

Peter E. Nielsen The Panum Institute University of Copenhagen Copenhagen, Denmark

Andrew T. Watt Isis Pharmaceuticals, Inc. Carlsbad, California

Henrik Ørum Santaris Pharma Hørsholm, Denmark

Mark Wedel Isis Pharmaceuticals, Inc. Carlsbad, California

Kallanthottathil G. Rajeev Alnylam Pharmaceuticals, Inc. Cambridge, Massachusetts

Charles Wilson Archemix Corp Cambridge, Massachusetts

CRC_8796_FM.qxd

6/22/2007

11:27

Page xvii

CONTRIBUTORS

Hongjiang Wu Isis Pharmaceuticals, Inc. Carlsbad, California Rosie Z. Yu Isis Pharmaceuticals, Inc. Carlsbad, California

xvii

Phillip D. Zamore Department of Biochemistry and Molecular Pharmacology University of Massachusetts Medical School Worcester, Massachusetts Thomas A. Zanardi Isis Pharmaceuticals, Inc. Carlsbad, California

CRC_8796_FM.qxd

6/22/2007

11:27

Page xviii

CRC_8796_S001.qxd

4/23/2007

09:24 AM

Page 1

PART

I

Introduction

CRC_8796_S001.qxd

4/23/2007

09:24 AM

Page 2

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 3

CHAPTER

1

Mechanisms of Antisense Drug Action, an Introduction Stanley T. Crooke, Timothy Vickers, Walt Lima, and Hongjiang Wu

CONTENTS 1.1

1.2

1.3

1.4

Introduction...............................................................................................................................5 1.1.1 The Opportunity ...........................................................................................................5 1.1.2 The Challenge...............................................................................................................5 1.1.3 Phases of Antisense Drug Action .................................................................................7 RNA Intermediary Metabolism ................................................................................................7 1.2.1 Coding RNAs................................................................................................................7 1.2.2 Noncoding RNAs..........................................................................................................9 1.2.2.1 Antisense Transcripts ....................................................................................9 1.2.2.2 Small Noncoding RNAs..............................................................................10 1.2.2.3 Other Noncoding RNAs ..............................................................................12 Factors that Influence the Selectivity of Antisense Drugs .....................................................12 1.3.1 Affinity........................................................................................................................12 1.3.2 Specificity for Nucleic Acid Sequences .....................................................................13 1.3.3 Protein Binding to Target RNA ..................................................................................14 1.3.4 Facilitated Hybridization ............................................................................................14 1.3.5 Levels of Target RNA.................................................................................................15 1.3.6 Terminating Mechanism .............................................................................................15 1.3.7 Posttranscriptional Modifications of RNA .................................................................15 1.3.8 Screening Processes Used to Identify Antisense Inhibitors .......................................16 1.3.9 Therapeutic Specificity (Therapeutic Index)..............................................................19 Occupancy-Only-Mediated Mechanisms ...............................................................................19 1.4.1 Modulation of Splicing...............................................................................................19 1.4.1.1 Can Antisense Drugs Be Used to Alter Splicing in Vitro and in Vivo? ....................................................................................20 1.4.1.2 How Is the Activity of Antisense Drugs Affected by the Strength of the Splicing Signal? .................................................................21 1.4.1.3 Does the Position of the Antisense Drug at a Splice Site Affect the Activity of the Antisense Drug?..........................................24 1.4.1.4 Do the Characteristics of Introns or Exons Affect the Activities of Antisense Agents? .................................................24 3

CRC_8796_ch001.qxd

5/24/2007

4

21:54

Page 4

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION

1.4.1.5

Can Antisense Agents Designed to Bind Exonic Enhancer or Silencer Sequences Affect Splicing? ......................................25 1.4.1.6 Does Chemical Class Influence Activity?...................................................25 1.4.2 Translation Arrest .......................................................................................................25 1.4.2.1 Is It Feasible to Arrest Translation with Antisense Drugs? ........................25 1.4.2.2 What Are the Optimal Sites in Target RNAs to Induce Translation Arrest? ..........................................................................25 1.4.2.3 What Is the Influence of Chemical Class on Activity?...............................26 1.4.2.4 How Robust Is Translation Arrest? .............................................................26 1.4.3 Disruption of Necessary RNA Structure ....................................................................26 1.5 Occupancy-Activated Destabilization ....................................................................................26 1.5.1 5 Capping ..................................................................................................................27 1.5.2 Inhibition of 3-Polyadenylation ................................................................................27 1.5.3 Other Mechanisms......................................................................................................27 1.5.4 RNase H......................................................................................................................27 1.5.4.1 Do Antisense Drugs That Use the RNase H Mechanism Work?...................................................................................28 1.5.4.2 What Sites in Target RNAs Are Accessible to RNase H–Based Antisense Drugs? .........................................................................28 1.5.4.3 Can Information about the Enzymology of RNase H1 Be Used to Improve the Performance of RNase H–Based Drugs?..............................................................................30 1.5.4.4 How Robust a Mechanism Is RNase H?.....................................................30 1.5.5 Double-Strand RNase (siRNA) ..................................................................................31 1.5.5.1 siRNA and RNase H Mechanisms Are Similar ..........................................32 1.5.5.2 RISC-Mediated Pathways ...........................................................................33 1.5.5.3 RISC-Mediated Pathways Are Promiscuous with Regard to Hybridization-Based Off-Target Effects.....................................34 1.5.5.4 siRNAs May Induce Transcriptional Repression........................................35 1.5.5.5 siRNAs Have Displayed Activities in Vivo That Are Similar to Those Displayed by RNase H Antisense Drugs—But There Are Also Substantial Differences................................................................................36 1.5.5.6 Structural Features and Medicinal Chemistry of siRNAs ..................................................................................36 1.5.5.7 Unique Challenges of Duplex RNA Drugs.................................................37 1.5.6 Covalent Modifications of Target Nucleic Acids .......................................................38 1.5.7 Oligonucleotide-Induced Cleavage of Target RNA....................................................38 1.5.8 RNase L–Mediated Cleavage .....................................................................................38 1.6 Micro-RNAs ...........................................................................................................................39 1.7 Conclusions and Future Perspectives .....................................................................................39 Acknowledgments ............................................................................................................................40 References ........................................................................................................................................40

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 5

MECHANISMS OF ANTISENSE DRUG ACTION, AN INTRODUCTION

5

1.1 INTRODUCTION 1.1.1

The Opportunity

The antisense concept derives from an understanding of nucleic acid structure and function and depends on Watson–Crick hybridization [1]. Thus, arguably, the demonstration that nucleic acid hybridization is feasible [2] and the advances in situ hybridization and diagnostic probe technology [3] lay the most basic elements of the foundation supporting the antisense concept. The first clear enunciation of the concept of antisense oligonucleotides as therapeutic agents was in the work of Zamecnik and Stephenson [4] in 1978. In this publication, these authors reported the synthesis of a 13 nucleotide long oligodeoxyribonucleotide, which was complementary to a sequence in the respiratory syncytial virus genome. They suggested that this oligonucleotide could be stabilized by 3- and 5-terminal modifications and showed evidence of antiviral activity. More important, they discussed possible sites for binding in ribonucleic acid (RNA) and potential mechanisms of action of oligonucleotides. The opportunity suggested by the antisense concept was seductive for a number of reasons. First, it suggested that it might be possible to create gene-selective reagents and drugs. The perceived value of such selectivity has increased as the molecular biology of the cell has become better understood and it has become apparent that most genes are arrayed within multigene families. The concept also suggested the possibility of the rational design of reagents and drugs based on well-understood principles: Watson–Crick hybridization rules. Again, the perceived value of such an approach has increased since the ability to dissect molecular biological processes at ever greater detail has evolved and the productivity of drug discovery exercises using traditional approaches has declined. The demonstration of broad distribution to multiple organs, multiple routes of administration, and excellent therapeutic index of second-generation antisense drugs as well as their potential applicability to a very broad array of diseases have further enhanced the perceived value of the technology. Finally, advances in understanding noncoding RNAs, RNA structure, function, and metabolism have broadened the potential targets and pathways to be exploited, adding further to the perceived value of the platform. In short, the more that has been understood about the RNA world and the performance of the hybridization-based drugs, the broader and more exciting the overall opportunity seems. 1.1.2

The Challenge

The development of antisense technology is, in effect, the creation of a new pharmacology. The receptor for antisense drugs is a specific sequence of nucleotides in a target RNA. Thus, a key step in the development of the platform was the understanding of the structure, functions, and intermediary metabolism of RNA from a pharmacological perspective. Advances in understanding all these aspects of RNA and advances in identifying novel RNA species have contributed to the evolution of antisense technology. Prior to the late 1980s and early 1990s, essentially no medicinal chemistry had been performed on oligonucleotides. In fact, the phosphorothioate modification, which has proven to be a versatile and useful backbone modification, was first synthesized to stabilize polyribonucleotides used to induce interferon [5] and the methylphosphonates were discovered as a part of an effort to evaluate the effects of chemical modifications on hybridization [6]. However, since the early 1990s, extraordinary progress in creating and evaluating modifications of oligonucleotides has been reported (for review, see [7,8]). The pharmacophore, a dinucleotide, and a few of the many hundreds of modifications made and tested are all shown in Figure 1.1. In our laboratories at Isis, we have had the opportunity to evaluate and compare hundreds of modified oligonucleotides in various animal models. Thus, there is today a substantial chemical toolbox and an extraordinarily rich database that extends from synthesis to hybridization and nuclease stability to all the characteristics of interest with regard to drug properties for these modifications.

Figure 1.1

N

O

O N

O

R

N

N

O

H

O

R

R O O PS O O Base

O

O

O Base

R

N

O

H

H

LNA

O O

O Base

R

O

O Base

OCH3

O

ENA

O

Base

O R Phosphodiester

O

O Base

O

O

O

NH

N

NH

N

O

O

PNA

O

Base

Base

OCH3

OCH3 O O O PS O O Base

O

2′-OMOE

O R O PO O O Base

O

O

The pharmacophore and representative oligonucleotide modifications.

G-Clamp

O

O O PS O

O N

O

O Base

OCH3

O Base

O O PS O

O

2′-OMe O Base

2′-F

O

O

N

O

O

O P

F

H2 C

O

N

O

R

O Base

R

Morpholino

Base

R

O Base

O

Methylenemethylimino

Phophoramidate O Base

R

O Base

O PO O

HN

O

O

O Base

Phosphorothioate

O Base

O O PS O

O

H3 C N O

F O O PS O O Base

O

6

Phenoxazine

O

H

R

O

O R O PS O O Base

O N

N

NH 2

21:54

N

O

O

O Base

R

O N

O O PS O

O

N

OH (NH 2 )

O

H3 C

5/24/2007

O

5-Propynyl-

H3 C

5-Methyl-C

CRC_8796_ch001.qxd Page 6


CRC_8796_ch001.qxd

5/24/2007

21:54

Page 7


7

As progress in creating the chemical toolbox was effected, these chemicals were used to induce drug effects expected to begin with binding to the target RNA. Once an antisense drug binds to its target sequence, it may induce a variety of events that lead to destruction or inactivation of the RNA. We have referred to these as terminating mechanisms. Again, the progress in understanding terminating mechanisms has been gratifying and will be the subject of this chapter. Of course, contemporaneously, the properties of various types of antisense drugs had to be defined. These properties include ease of synthesis, analytical characteristics, stability, pharmacokinetics, toxicological properties, formulations, and routes of delivery. Remarkable progress has been achieved for many different types of oligonucleotide analogs providing the basis for rational selection of oligonucleotides, formulations, doses, schedules, and the design of preclinical and clinical trials (for review, see [9] and this volume). 1.1.3

Phases of Antisense Drug Action

At the most conceptual level, the effects of hybridization-based drugs can be divided into three phases: pre- or nonhybridization, hybridization, and posthybridization. Because the typical cellular level of target m-RNAs is less than 100 copies per cell, the interaction with target RNA results in de minimis reduction of the total antisense drug concentration. Consequentially, nonhybridization interactions, principally with cellular and extracellular proteins, account for the pharmacokinetics and non-pharmacologically-based toxicological properties of antisense drugs. As our understanding has become more sophisticated, ever larger numbers of subtle variations in these properties due to variations in sequence have been identified. Nevertheless, most pharmacokinetic and toxicologic observations are qualitatively and quantitatively consistent across all members of a chemical class, i.e., class-generic behaviors are observed. Thanks to the extraordinary advances reported, we now understand these properties in detail for several classes of antisense drugs and are beginning to dissect them down to the level of specific interactions between oligonucleotides and proteins that result in specific properties (for review, see [10–14] and this volume). Equally impressive progress has been reported with regard to understanding the posthybridization or terminating mechanisms. In fact, today, for some mechanisms we have sufficient understanding to use the mechanistic information to design improved antisense drugs. The progress in understanding the mechanisms of action of antisense drugs has previously been reviewed [15] and is the subject of this chapter. Rather remarkably, however, very little progress has been reported in understanding how hybridization to a specific target RNA occurs in cells. Although the evidence that antisense agents can specifically hybridize to many specific RNA species and cause reduction of the target RNA is overwhelming in cells and animals, little is understood either about the process by which hybridization takes place or the kinetics of intracellular hybridization in cells. Conceptually, it would seem challenging for antisense drugs to identify and bind to the few copies of their cognate sequences in the midst of substantially greater concentrations of potentially competitive nucleic acid sequences in the cells. This remains an area in which there are inadequate explanations for the observed phenomena and where future research should focus.

1.2 RNA INTERMEDIARY METABOLISM 1.2.1

Coding RNAs

Most oligonucleotides are designed to modulate the information transfer from the gene to protein—in essence, to alter the intermediary metabolism of RNA. Figure 1.2 summarizes these processes. RNA intermediary metabolism is initiated with transcription. The transcription initiation complex contains proteins that recognize specific deoxyribonucleic acid (DNA) sequences and

CRC_8796_ch001.qxd

5/24/2007

21:54

8

Page 8

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Transcriptional arrest

Transcription

CAP Capping/ polyadenylation

AAAA

CAP

Splicing

AAAA Nucleus

CAP

AAAA

Transport CAP

Effects on catabolism of RNA

CAP AAAA

Degradation CAP Translation

Effects on anabolism of mRNA

AAAA

Translational arrest

Protein

Figure 1.2

RNA intermediary metabolism. Steps in the transcription and processing for a pre-mRNA are shown. The thick lines represent exons. The thin lines represent noncoding regions including the 5 and 3 UTRs and introns. Potential sites for intervention are defined by arrows.

locally denature double-stranded DNA, thus allowing a member of the RNA polymerase family to transcribe one strand of the DNA (the antisense strand) into a sense pre-messenger RNA (pre-mRNA) molecule. Usually during transcription, the 5 end of the pre-mRNA is capped by adding a methyl-guanosine, and most often by methylation of one or two adjacent sugar residues. This enhances the stability of the pre-mRNA and may play a role in a number of key RNA processing events [16]. Between the 5 cap and the site at which translation is initiated is usually a stretch of nucleotides referred to as the 5 untranslated region (5-UTR). This area may play a key role in regulating messenger RNA (mRNA) half-life and transitional efficiency [17]. Similarly, the 3 end of the pre-mRNA usually has a stretch of several hundred nucleotides beyond the translation termination signal. This area often plays an important role in determining mRNA half-life. Moreover, posttranscriptionally, most pre-mRNA species are polyadenylated. Polyadenylation stabilizes the RNA, is important in transport of mature mRNA out of the nucleus, and may play important roles in the cytoplasm as well [18,19]. Because eukaryotic genes usually contain intervening sequences (introns), most pre-mRNA species must have these sequences excised and the mature RNA spliced together. Splicing reactions are complex, highly regulated, and involve specific sequences, small-molecular-weight RNA species, and numerous proteins. Alternative splicing processes are often used to produce different mature mRNAs and, thus, different proteins. Even though introns have been considered waste, important sequences are conserved, and intronic sequences can play important roles including coding for proteins, antisense transcripts, and noncoding RNAs [20]. Mature mRNA is exported to the cytoplasm and engages in translation. mRNA half-lives vary from a few minutes to many hours, and appear to be highly regulated. Each step shown in the pathway is a composite of numerous steps and is theoretically amenable to intervention with oligonucleotides. The pathway is fully defined for virtually no mRNA, and available information is insufficient to determine the rate-limiting steps in the intermediary metabolism of any mRNA species. Alternative splicing is an important biological process, has been implicated in a large number of diseases and has been the subject of intervention with antisense drugs. In a typical multiexon

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 9


9

RNA, the splicing pattern may be altered in many ways. Although the splicing of most exons is constitutive, the splicing of some exons is inducible and is highly cell- and tissue-context-dependent (for review, see [16]). Although a key determinant of the rate and extent of splicing is the strength of the splicing site consensus sequences, intronic, and exonic sequences that may enhance or inhibit splicing of a particular exon play important roles. As will be discussed, interventions with antisense drugs designed to encourage a particular splicing pattern have been successful. Sites at which success has been observed include splice sites and exonic sequences. 1.2.2

Noncoding RNAs

In the past few years, the prevalence and importance of noncoding RNAs have become much more apparent. Although there are numerous types of noncoding RNAs, two classes, antisense transcripts and micro-RNAs, may be particularly important with regard to antisense therapeutics.

1.2.2.1 Antisense Transcripts Antisense transcripts were identified in eukaryotic cells some time ago, but the extent of antisense transcripts and the breadth of roles they may play have been appreciated only recently (for review, see [21]). Antisense transcripts may code for a variety of proteins or may be noncoding [22]. Noncoding antisense transcripts appear to regulate gene expression at a variety of points in the information transfer process from transcription to translation [21,22]. Of equal importance, however, is the actual production of double-stranded RNA (dsRNA) through binding of an antisense transcript to its sense transcript. Eukaryotic cells contain a variety of enzymatic pathways to process dsRNAs [23,24] and they can induce a number of important processes including posttranscriptional gene silencing [25]. Antisense transcripts can arise from transcription of both strands of a gene. Alternatively in many cases, transcription of two closely positioned genes coding for different proteins and reading in the opposite orientation can lead to an “antisense” transcript for the genes [26]. Importantly, recent studies suggest that 5–10% of the human genome may have antisense transcripts [27,28]. Thus, antisense transcripts may be the result of at least two processes and play important roles in regulating gene function and phenotype via a variety of mechanisms [29]. Given the prevalence and roles of natural antisense manuscripts, it seems likely that they have an effect on the activities of antisense drugs. Clearly, if an antisense transcript were to hybridize to a portion of a target RNA, that portion would be less accessible to an antisense drug, irrespective of chemistry or mechanism of action. Also, any influence of an antisense transcript on the regulation of intermediary metabolism of a targeted RNA could influence the effects induced by an antisense drug designed to bind to that RNA. To date, there has been no report of studies designed to directly assess the effect of antisense transcripts on the activities of antisense drugs. However, at Isis we have created antisense drugs to more than 4000 genes and have never failed to find active drugs to any RNA target based on screening processes that evaluate the effects of scores of antisense drugs designed to bind to multiple sites within the RNA. Nor has it proven unusually difficult to identify antisense drugs designed to bind to the 3 untranslated region (3-UTR) of targeted RNAs, a site to which many antisense transcripts bind (for review, see [9,30]). As most antisense transcripts are reported to be poly A minus and localized to the nucleus, it may be that some of the potential effects of antisense transcripts on antisense drug activity are avoided when antisense drugs are designed to target mature RNAs and can work in both the nucleus and cytosol. However, many antisense drugs are designed to bind to sites that are excised before the RNA exits the nucleus and have been shown to be active; so drug effects in the cytoplasm cannot fully explain the failure to identify RNA sequences that may be inaccessible because of binding to antisense RNA. Clearly, much more work needs to be done in this area with focused experiments that can directly address the impacts of antisense transcripts on the activities of antisense drugs.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 10

10


1.2.2.2 Small Noncoding RNAs The recent discovery of small noncoding RNAs has stimulated one of the most exciting new areas of research in cell biology. Small noncoding RNAs are RNA species that do not code for proteins, but are involved in a host of vital cellular processes. These tiny RNAs add a new layer of regulation of gene function, are involved in processing multiple classes of RNA, respond to viral infections, represent novel RNA targets for antisense drugs, present novel cellular pathways to exploit as new mechanisms for antisense drugs, and in due course may be found to be accountable for some of the limitations and off-target effects of antisense drugs. This group of RNAs is comprised of C or D box containing small RNAs (C/D RNAs), micro-RNAs and small interfering RNA (siRNAs) (for review, see [31]). C/D RNAs are metabolically stable 60–300 nucleotide RNAs that reside in the nucleus and localize to the nucleolus or Cajal bodies and are involved in site-specific methylation of RNAs. They are crucial to processing of preribosomal RNAs as well as pre-mRNAs. Most are transcribed from introns of genes and are processed from the host-gene intron. They contain specific C-box or D-box sequences located near their 5 or 3 termini, respectively. Micro-RNAs are 19–23 nucleotide RNA species. It is estimated that as many as 3% of genes in the mammalian genome have complementary micro-RNAs. Micro-RNAs may form perfect duplexes with their targets, in which case they lead to cleavage in the center of the duplex; or imperfect duplexes, in which case they may lead to translation arrest or cleavage of the targeted RNA. Although micro-RNAs and siRNAs were originally thought to be quite different and result in different cellular responses, in fact the characteristics and behaviors of these RNAs appear to be very similar. Figure 1.3 summarizes the characteristics of the small noncoding RNAs discovered to date.

5′ D/D′

3′

3′

5′

CH3

5 bp Small nucleolar RNAs (snoRNAs)

18S, 5.8S, 28S rRNAs

3′

5′

U6

Other RNAs ? (mRNA ?)

3′ 5′ Perfect DNA duplex

RNA degradation (RNA interference) Figure 1.3

Small Cajal-body-specific RNAs (scaRNAs)

U1, U2, U4, U5

5′

3′ 5′

3′ Irregular RNA duplex

Chromatin modifications

Nonproductive translation

C/D RNA modifications guide and miRNAs. Sequences complementary to the cognate RNA target are depicted in thick lines. (Top) For C/D RNAs, the nucleotide triggered for 2-O-methylation is denoted by a box. It is always paired to the fifth nucleotide upstream from the D (or D) box. The different RNA targets of C/D snoRNAs and scaRNAs are shown. (Bottom) For miRNAs, depending on the degree of complementary with their target, they can trigger RNA cleavage in the middle of the duplex (RNA interference) or nonproductive translation of the target mRNA by an unknown mechanism. miRNA can also promote RNA-directed DNA methylation.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 11


11

Micro-RNAs can be transcribed from the sense or antisense strands of DNA. They can be located in introns, exons, or intragenic regions. Thus, they may use the transcriptional machinery of annotated genes or they may derive from independent transcriptional units (for review, see [32]). Irrespective of gene location or orientation, the initial transcript, the pre-mir, is typically kilobases long and is processed in the nucleus to a pre-mir, an approximately 70-nucleotide species by an RNase III called drosha. The pre-mir is exported to the cytoplasm and cleaved to the approximately 20-nucleotide mir by another RNase III dicer (for review, see [33]). The mir can then be loaded into the RNA-induced silencing complex (RISC) complex in which it may hybridize perfectly or imperfectly with target RNAs. Perfect hybridization leads to degradation by the RISC complex. Imperfect hybridization may lead to translation arrest or degradation of the RNA after localization in processing bodies [34]. Each of these steps is significantly more complex than described and a more detailed description is beyond the scope of this review, but the pathways are shown in simplified form in Figure 1.4. In addition to these complex pathways, it is now apparent that microRNAs or RASi RNAs may, if their sequences are complementary to repetitive DNA sequences, activate the RNA-induced transcriptional silencing (RITS) complex and lead to gene inactivation and heterochromatin formation (for reviews, see [35–37]). Furthermore, these processes can lead to

miRNA - siRNA Biogenesis dsRNA Cell membrane

RLC TRBP

Dicer

siRNA Ago2

RLC

Exportin 5

TRBP

Dicer

Pre-mir Drosha

mRNA

Mature mir RISC

Ago 1/2/3/4

DGCR8

?

Ago

Dcp

P body

40s 60s

Pre-mir DNA Nucleus

mRNA

Cytoplasm

Figure 1.4 The micro-RNA and siRNA pathways. Large precursor RNAs (pre-mirs) are transcribed. They are processed by human RNase III (Drosha) in the nucleus to pre-mirs. Pre-mirs are exported from the nucleus by exporten. In the cytoplasm pre-mi processing bodies are processed by a complex, the RISC loading complex (RLC), of proteins including the RNase III, dicer, and thyroid hormone receptor-binding protein (TRBP). Mature mirs load RISC and eIF2c2 cleaves the target RNA. This may enter processing bodies (p-bodies). Alternatively, the RISC complex can arrest translation. Exogenous RNAs may also enter the pathways.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 12

12


“spreading” and the silencing of additional genes located near the repetitive DNA. Finally, it has been shown that RNA sufficient to induce gene silencing can be processed in the nucleus by transcription of inverted DNA repeats or by cleavage of longer RNA precursors. The potential impacts of small RNAs on antisense therapeutics are manifold and several will be discussed in more detail in later sections of this review and in subsequent chapters. Most directly and obviously micro- and siRNAs reinforce the opportunity suggested in 1998 that RNA-like antisense drugs that activate double-strand RNases could be therapeutically valuable [38]. The direct application of duplex oligoribonuleotides to exploit the RNA interference (RNAi) pathway has been the subject of a great deal of work and is but one means of exploiting double-strand RNases [39]. Perhaps even more important is the identification of multiple new pathways by which regulatory RNAs are produced and used. Each arm of each of these pathways presents unique opportunities and risks. Each protein and each RNA involved presents a potential site for the interaction of antisense drugs that could lead to off-target effects. Micro-RNAs are themselves attractive targets for antisense drugs as demonstrated by several recent publications (for review, see [40]). Again, this area is one that deserves a great deal of attention. It is gratifying to see substantial progress already.

1.2.2.3 Other Noncoding RNAs There are, of course, many other noncoding RNAs, including ribosomal RNA, small-molecular weight nuclear, nuclear, and nucleolar RNAs (for review, see [41]) and RASi RNAs [37]. Although a review of these RNA species is beyond the scope of this chapter, each class of RNA could influence the effects of antisense drug if they were to bind to partially complementary sequences accrued and may represent interesting target opportunities as well.

1.3 FACTORS THAT INFLUENCE THE SELECTIVITY OF ANTISENSE DRUGS 1.3.1

Affinity

The affinity of oligonucleotides for their receptor sequences results from hybridization interactions. The two major contributors to the free energy of binding are hydrogen bonding (usually Watson–Crick base pairing) and base stacking in the double helix that is formed. Affinity is affected by ionic strength, where in general the higher the ionic strength, the higher the affinity of charged oligonucleotides for polynucleotides. As affinity results from hydrogen bond formation between bases and stacking occurs between coplanar bases, affinity increases as the length of the oligonucleotide receptor complex increases. Thus, the affinity per nucleotide unit and the number of hybridizing nucleotide pairs are crucial determinants of overall affinity. Affinity also varies as a function of the sequence in the duplex. Nearest-neighbor rules support the prediction of the free energy of binding for DNA–DNA and RNA–RNA hybrids with relatively high precision [42,43]. A common misconception is that DNA–RNA duplexes are more stable than DNA–DNA duplexes. In fact, the relative stability of these duplexes varies as a function of the sequence. RNA–RNA duplexes are typically the most stable [9]. As with other drug–receptor interactions, activity requires a minimum level of affinity. For many targets and types of oligonucleotides, the minimum length of an oligonucleotide may be 12–14 nucleotides. Although theoretical affinities for oligonucleotide single-strand nucleic acid interactions are very large, in practice, affinity constants are substantially lower. Several factors contribute to the differences between theoretical and realized affinities. Undoubtedly, the most important factor is that RNA can adopt a variety of secondary structures (for review, see [44]). In addition to secondary structure, RNA can adopt tertiary structures. Tertiary structures result from the interactions of secondary structures in an RNA molecule with other secondary structural elements or single-stranded regions [45].

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 13


13

A third factor that can potentially reduce the affinity of an oligonucleotide for its RNA receptor is that oligonucleotides can form secondary and tertiary structures themselves. To avoid duplex formation, oligonucleotides that contain self-complementary regions are usually not employed. However, other structures that were not well understood or expected have been described. Tetrameric complexes formed by oligonucleotides with multiple guanosines [46–49] and other base sequences [50] can be highly stable, clearly would prevent an antisense interaction, and have a number of biological effects that have confounded interpretation of experiments. Since RNA and oligonucleotide structures are affected by ionic milieu and nonproductive interactions with proteins and polycations, the in vivo situation is, of course, considerably more complicated. Relatively little is understood about the interplay among all these factors and their effects on the true affinities of oligonucleotides for potential RNA targets. Advances in the medicinal chemistry of antisense drugs have resulted in numerous classes of these agents that display substantially enhanced affinity (for review, see [51]). Conceptually, increased affinity should result in increased potency. Indeed, this has been observed in both in vitro and in vivo test systems (e.g., see [52]). However, in our experience, the increase in potency has typically not been as substantial as predicted based on affinity considerations. This has prompted us to begin to search for potential cellular factors that may influence hybridization. A second potential effect of increasing affinity should be that greater numbers of sites within an RNA molecule might be accessible to antisense drugs. Indeed, that has been our experience. For example, we have compared the activities of lower- and higher-affinity antisense drugs that work via an RNase H (RNase H enzymes are double-strand RNA-binding proteins that cleave RNA in an RNA–DNA duplex) mechanism against a number of cellular targets. In addition to the expected increase in potency, many more sites within the RNA were accessible to the higher-affinity class of antisense drugs for all the transcripts studied. 1.3.2

Specificity for Nucleic Acid Sequences

Specificity derives from the selectivity of Watson–Crick or other types of base pairing. The decrease in affinity associated with a mismatched base pair varies as a function of the specific mismatch, the position of the mismatch in a region of complementarity, and the sequence surrounding the mismatch. In a typical interaction between complementary 18-mers, the G37 or change in the Gibbs free energy of binding induced by a single mismatch varies from 0.2 to 4.0 kcal/ mol/modification at 100 mM NaCl. Thus, a single base mismatch could result in a change in affinity of approximately 500-fold [53]. Modifications of oligonucleotides may alter specificity. At the genomic level, any sequence of 17 residues is expected to occur only once [54]. Assuming a random distribution of sequences in RNA, any sequence of 13 residues is expected to occur once in the cellular RNA population and, if the nonrandom nature of mammalian RNA sequence is taken into account, an 11-mer or perhaps smaller oligonucleotide could identify and bind to a unique sequence [55]. To exploit fully the theoretical potential for specificity of an oligonucleotide in a therapeutic context, it is necessary to manipulate the length of the oligonucleotide and its concentration at target. The results of such an exercise have been reported [56]. In this study, phosphorothioate oligodeoxynucleotides were designed to target the normal or codon 12-point mutation of Ha-ras mRNA. Predictions from hybridization experiments suggested that approximately a fivefold specificity for mutant compared to normal Ha-ras RNA was possible. By optimizing oligonucleotide length and the extracellular concentration of the oligonucleotide, nearly theoretical specificity was achieved in cells in tissue culture. Other factors can also be used to enhance specificity. RNA secondary and tertiary structure assures that not all sequences are equally accessible. Design of oligonucleotides to interact with sequences involved in the maintenance of RNA structure can theoretically enhance specificity and, if the structure is essential to the stability or function of the RNA, potency. Furthermore, many RNA

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 14

14


and DNA sequences interact with proteins, again assuring far more diversity in response to an oligonucleotide and, therefore, greater specificity than might be predicted solely on the basis of differences in nucleic acid sequence. 1.3.3

Protein Binding to Target RNA

Although understanding RNA structure provides crucial information that enhances the identification of optimal binding sites for antisense drugs, it is not sufficient for a number of reasons, including the fact that RNAs bind multiple proteins at multiple sites (for review, see [57]). Obviously, any protein interaction with a target RNA may adversely affect the ability of the antisense drug to interact with the desired sites in the RNA. Despite the progress in understanding factors that influence antisense drug activity, virtually nothing is known about the competition between antisense drugs and proteins that bind to RNA. This is undoubtedly one of the reasons that algorithms designed to select optimal binding sites in RNA based on predicting internal RNA structures have failed to provide significant benefit, as discussed in a later section. 1.3.4

Facilitated Hybridization

Precisely how an antisense drug binds to its cognate site in a target RNA in cells is unknown. However, given the enormous excess of partially complementary sites relative the very few copies of individual mRNAs with the fully complementary binding site, it seems unlikely that the process is as simple as hybridization reactions in which appropriate concentrations of two reactants are mixed in a test tube. This has prompted us to consider the possibility that intracellular hybridization to cognate sites is somehow facilitated. Several proteins have been shown to promote RNA annealing or hybridization [57]. A protein found in messenger ribonucleoprotein particles (mRNP), a member of the Y-box family of proteins P50 (YB-1), has been reported to be involved in a number of DNA repair and replication processes and to promote hybridization of RNA (and DNA) [58]. This protein was reported to enhance RNA hybridization by up to a thousandfold. Its activity was dependent on the ratio of protein to RNA, the length of the RNA, and ionic strength. It did not require adenosine triphosophate (ATP) hydrolysis. It also enhanced hybridization of DNA. The promiscuity of this protein suggests that it can participate in facilitating the hybridization of antisense drugs of various chemistries to target RNAs. Its localization to the polysomes, m-RNPs, and in the nucleus makes it an excellent candidate to facilitate the hybridization of antisense drugs in all cellular compartments. Although the detailed mechanism is not yet understood, it has been proposed that YB-1 works stoichiometrically by melting interfering structures and increasing the local effective concentrations of the two hybridizing strands. As all the proteins in this family have clusters of positively charged amino acids, it is thought that they may serve to neutralize the charge–charge repulsion of the two nucleic acids strands as well. Other proteins display similar properties. For example, the major proteins of the heterogeneous nuclear ribonucleoprotein complexes (hnRNP A1, C1, and U) exhibit annealing activities [59]. More recently, the RISC has been shown to facilitate hybridization of RNA strands in the RISC complex by as much as 400 fold [60]. Thus, there is ample and growing evidence that facilitated hybridization occurs in cells. How might facilitated hybridization affect the activity of antisense drugs? First, it may be the case that the facilitation of hybridization by RISC is simply the first demonstration of the phenomenon and that all interactions of antisense drugs with their cognate sequences are facilitated. It is possible that the substantial differences in potency of antisense drugs designed to bind to different sites in target RNAs could be a function of RNA structure, proteins that are bound, and the ability of the site to participate in facilitated hybridization. Finally, as chemistries diverge substantially from natural nucleic acid structures, e.g., peptide nucleic acids, they may be less able to participate in facilitated hybridization and this might explain the limited activities displayed by some chemical

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 15


15

classes. It may also impose true structural limitations on the divergence from natural nucleic acid structures that can be tolerated in antisense drugs. At present, the proposition that facilitated hybridization is important in determining the effectiveness of antisense drugs is largely conjectural. However, this area has benefited from virtually no research and now that the tools are available, progress in this important area should be forthcoming. 1.3.5

Levels of Target RNA

Although it is theoretically possible that the concentration, transcriptional rate, or stability of a target RNA may influence the effectiveness of antisense drugs, at least for antisense drugs that work via the RNase H mechanism, it has been experimentally determined that RNA concentration and transcription rate do not affect their performance [61]. In this study the level of RNA transcribed from either an exogenous or induced endogenous gene was varied from 1 to 400 copies per cell and shown to have no effect on the potency or efficacy of antisense drugs transfected into either A549 or HeLa cells. Nor did transcription rate have any effect. Less direct evidence also derives from our broad experience in screening for antisense drug activity. As a general rule, within a specific chemical and mechanistic class of antisense drugs, the maximum potency and efficacy achieved against each RNA target is roughly comparable. Inasmuch as we have identified antisense drugs to approximately 4000 genes, if RNA concentration, transcriptional rate, or RNA stability significantly influenced antisense drug performance it seems likely that greater variability in these parameters would have been observed (for review, see Chapter 5 in this volume). Why do these factors not affect the activities of antisense drugs? Consider the basic equation that defines drug action: D F & DR → Effect where D is the drug concentration, R the receptor concentration, and DR the drug–receptor complex. Given the low concentrations of pre- and m-RNAs in cells and the high intracellular concentrations of antisense drugs achieved, the receptor concentration can be eliminated and drug effect should be dependant only on drug concentration. Transcriptional rate should have no effect because receptor concentrations are irrelevant. Similarly, m-RNA decay rate should have no effect. 1.3.6

Terminating Mechanism

The first step in the induction of pharmacodymic effects by an antisense drug is hybridization to its cognate sequence or receptor. What happens after binding is also of great importance. Terminating mechanisms can be divided into occupancy only and occupancy-induced degradation classes. Inhibiting RNA function by occupying selected sites in the target RNA has been demonstrated and includes processes such as translation arrest and inhibition of splicing or induction of alternative splicing. Occupancy-induced destabilization of RNA involves the recruitment of nucleases that degrade the target RNA and can include RNases H and double-strand RNases such as those involved in siRNA activities. The “robustness” of the terminating mechanism can be qualitatively characterized using several parameters. These include the ease of identification of active antisense drugs, the ratio of active to inactive sites in target RNAs, and the potency and efficacy of drugs that use the mechanism both in vitro and in vivo. We now have enough experience to compare the robustness of various mechanisms in vitro. For comparisons of robustness in vivo, we have less data, but some trends are emerging. These topics will be considered in some detail in later sections of this review. 1.3.7

Posttranscriptional Modifications of RNA

Although RNAs are subject to far fewer postsynthesis modifications than proteins, posttranscriptional modifications that could influence the activities of antisense drugs do occur.

CRC_8796_ch001.qxd

16

5/24/2007

21:54

Page 16


Posttranscriptional modifications of RNA include 2-0 methyl modifications of the ribose, conversion of uridine to pseudouridine and RNA editing (for review, see [62–64]). However, only RNA editing has been shown to modify the sequences of pre- and mature m-RNAs. RNA editing is effected by the deamination of either adenosine to inosine or cytosine to uridine. In both cases, the sequence of the RNA is modified from that originally transcribed from the gene. RNA editing has been shown to play significant roles by introducing new codons that may initiate translation, prematurely stop translation, alter splicing, or influence other steps in the metabolism and utilization of RNAs (for review, see [64,65]). Given how frequently RNA editing occurs and its substantial importance to normal and pathophysiological process, it seems likely that the processes should influence the activities of antisense drugs. Clearly, the introduction of a mismatch in the center of a 2 gap in a second-generation antisense drug should dramatically reduce activity that would be dependant on RNase H1. It is also possible that editing of siRNA duplexes by adenosine deaminase and editing of single-strand oligoribonucleotides by cytosine deaminase could take place even though they would not be ideal substrates for the enzymes. If that were to happen, of course, off-target effects could ensue. To date, however, no systematic studies of the potential impacts of RNA editing on the activities of antisense drugs have been reported. Although it is unlikely that RNA editing could profoundly influence the activities of many antisense drugs, it is possible that a thorough evaluation of this possibility could help explain some anomalous behaviors observed occasionally with specific antisense drugs. 1.3.8

Screening Processes Used to Identify Antisense Inhibitors

In drug discovery, it is axiomatic that the more thorough the search to identify an optimal drug, the better the drug. Antisense drug discovery technology provides additional incentives for thorough screening. First, the design, synthesis, and testing of potential antisense inhibitors is straightforward, rapid, and automatable. Second, a wide array of potential chemical modifications is now available. Third, substantial experience with multiple terminating mechanisms can inform screening processes. Fourth, because all the drugs from a particular chemical class behave similarly, there is great value in databases that can be created from information about the performance of hundreds to thousands of representatives of each chemical class. Fifth, it is now apparent that it is possible to identify problematic sequence motifs such as immunostimulatory consensus sequences, and thus avoid them. At Isis, the screening process begins with the sequence of the target RNA. That sequence is input and algorithms design antisense inhibitors to 40–80 different sites within the RNA excluding known problematic motifs and sequences that may lead to internal structures in the antisense agents. These are then screened at active concentrations in cells. Multiple active antisense inhibitors are then studied in detailed dose–response curves in vitro. For targets of substantial interest, at this stage we often screen antisense inhibitors to as many as several hundred additional sites. Then typically, 5–6 potential antisense drugs are taken into rodents. In fact, we typically evaluate several antisense inhibitors in monkeys (Figure 1.5). Thus, compared to earlier times, the antisense drugs designed today at Isis begin better because of the medicinal chemistry and basic research done earlier and the number of problematic motifs excluded. The final selection of the lead drug for detailed study then benefits from the number of potential drugs evaluated in vitro and in vivo providing better data-driven choices. As can be observed in Figure 1.6, just screening multiple sites in each target RNA greatly enhances the likelihood of enhanced performance by antisense drugs. Consider, for example, the likelihood of success with antisense oligonucleotide 1 (ASO1) or ASO2 compared to some of the less active antisense inhibitors. Moreover, as this screen was performed with higher-affinity more potent second-generation antisense drugs, the ratio of sensitive versus insensitive sites is very high and much higher than observed with most other chemistries or mechanisms of action. Furthermore, each RNA is different. Thus, in our experience algorithms designed [66,67] to identify optimal sites in target RNAs have simply not performed adequately to reduce the need for detailed in vitro screening (see Chapter 5 for more detailed discussion).

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 17


17

150

FAK mRNA (relative units)

125

100

75

50

25

0

Figure 1.5

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Oligonucleotide

Routine screening process to identify optimal antisense drugs (2006). The sequence of the target RNA is used to identify potential antisense inhibitors. On the basis of earlier research, many potentially problematic sequences are excluded. The process is enhanced by evaluating multiple candidates in several species. Avoid mouse immunostimulatory motifs

Avoid mouse toxic motifs Oligo design

Avoid human immunostimulatory motifs

Avoid C strings

Avoid toxicity Mouse lean screens/ pharmacology screens

Avoid proinflammatory activity Avoid toxicity

Monkey screens (human candidate) Avoid kidney toxicity

Figure 1.6

Avoid proinflammatory activity

Results of an initial screen of 2-MOE chimeric antisense inhibitors designed to inhibit superoxide dismutase 1. Each inhibitor was transfected into A549 cells at 100 nM and the effects on SOD1 RNA levels evaluated 24 h after treatment of the cells.

Do these generalizations apply to drugs other than 2 methoxy-ethyl (2-MOE) chimeras that work via an RNase H mechanism? Yes. For example, consider Figure 1.7, which compares the activities of phosphorothioate oligodeoxynucleotides and 2-MOE chimeras. Or consider the experience gained comparing siRNAs to second-generation antisense inhibitors. The activities of siRNAs are influenced

Figure 1.7

5′-UTR 3300 nt

ASO 1

3′-UTR

Intron Targeting ASOs

Comparison of antisense inhibition of p125 FAK by first- and second-generation antisense drugs. A549 cells were treated with 400 nM of each of the antisense drugs. Twenty-four hours after transfection, the level of p125 FAK messenger RNA was assessed by real-time polymerase chain reaction (RT-PCR). The black bars represent the level of p125 FAK RNA with 20 mer phosphorothioate oligonucleotides. The grey bars represent the levels of p125 FAK RNA in cells treated with a 20 mer 2-MOE chimeric second-generation antisense drugs. Both classes of drugs activate human RNase H1.

0

20

40

ASO 2

Negative control oligos

18

60

Untreated control

21:54

80

100

120

140

5/24/2007

% Control expression



CRC_8796_ch001.qxd

5/24/2007

21:54

Page 19


19

by target structure just as RNase H–based antisense drugs [68]. In fact a thorough and direct comparison of the performance of second-generation antisense inhibitors to siRNA showed very comparable ratios of sensitive to insensitive sites and considerable overlap in active sites [69]. Single-strand antisense RNAs behave similarly as well [70]. For less robust mechanisms such as translation arrest or inhibition of splicing, the need to identify an optimal inhibitor is even greater. 1.3.9

Therapeutic Specificity (Therapeutic Index)

Clearly, in a therapeutic context, the ability of an oligonucleotide to bind selectively to specific sequences in nucleic acid targets is an important factor in determining its therapeutic index. However, oligonucleotide analogs can interact with other cellular components, and these interactions can have significant effects on the therapeutic index of oligonucleotides. The factors that determine the significance of nonnucleic interactions of oligonucleotides on the therapeutic index include the affinities for nonnucleic acid sites versus nucleic acids, the numbers of different nonnucleic acid binding sites, the concentrations of each of the binding sites, the biological importance of various binding sites, and kinetic factors. These are, of course, conceptually equivalent to the factors that affect the therapeutic index of drugs of all classes, but very little is understood about these potential interactions [71–73]. Chemical classes of oligonucleotides differ in their tendency to interact with various nonnucleic acid targets. For example, phosphorothioates tend to bind to a wide range of proteins with relatively low affinity [15]. Nevertheless, detailed in vitro and in vivo toxicological studies have shown that these interactions probably reduce the therapeutic index of phosphorothioates less than perhaps was expected [7,72]. We believe that this is because the phosphorothioates bind with very low affinity to a large number of proteins and their potential toxic effects are consequently “buffered.” As previously discussed, improvements in the performance of antisense drugs effected by advances in chemistry, design, mechanisms of action, and screening processes have all been shown to profoundly influence the therapeutic specificity of antisense drugs. 1.4 OCCUPANCY-ONLY-MEDIATED MECHANISMS Classic competitive antagonists are thought to alter biological processes because they bind to receptors, preventing natural agonists from binding and inducing normal biological processes. Binding of oligonucleotides to specific sequences may inhibit the interaction of the RNA with proteins, other nucleic acids, or other factors required for essential steps in the intermediary metabolism of the RNA or its utilization by the cell. 1.4.1

Modulation of Splicing

A key step in the intermediary metabolism of most mRNA molecules is the excision of introns. These “splicing” reactions are sequence-specific and require the concerted action of spliceosomes. Consequently, oligonucleotides that bind to sequences required for splicing may prevent binding of necessary factors or physically prevent the required cleavage reactions. This then would result in inhibition of the production of the mature mRNA. In the past several years, substantial progress has been reported in the discovery of antisense drugs that inhibit splicing and result in alternative splicing. Not surprisingly, the first compelling demonstration that antisense drugs could affect splicing was the restoration of correct splicing in thalesemic pre-mRNA in a cell-free system [74]. Since that observation, a variety of chemically modified antisense drugs have been shown to alter splicing in vitro and in vivo. Obviously, to induce alternative splicing, antisense drugs that do not induce degradation of the target RNA must be used, so fully modified 2-methoxy, 2-MOE, peptide nucleic acid (PNA), morpholino, and fully modified locked nucleic acid (LNA) analogs have been studied (for review, see [75]).

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 20

20


Although the inhibition of splicing is interesting, alternative splicing is perhaps more exciting because in this setting it is possible to use an antisense drug to induce the production of an alternative protein; in effect to produce “agonist-like” activities. Both the inhibition of splicing and the induction of alternative splicing have been reported for a number of genes in vitro and a few in vivo (for review, see Chapter 4 in this volume). However, alteration of splicing has proven to be very difficult for many genes and no obvious explanation for difference in susceptibility has emerged. Because the use of antisense drugs to alter splicing is reviewed in detail in a subsequent chapter, in this chapter I will address a number of questions concerning the mechanism: 1. Can antisense drugs be used to alter splicing in vitro and in vivo? 2. How is the activity of antisense drugs affected by the a. Strength of splicing signal b. Splicing element to which the drugs binds c. Position of the drug vis-à-vis the splicing element d. Characteristics of the intron or exon e. Presence of exonic enhancers or silencers f. Chemical class or the antisense drug 3. Is it possible to design antisense drugs that affect exonic enhancer or silencer function? 4. Is efficacy influenced by cell or tissue context? 5. How robust a mechanism is alteration of splicing?

1.4.1.1 Can Antisense Drugs Be Used to Alter Splicing in Vitro and in Vivo? Today, there is no question that appropriately designed antisense drugs can alter splicing. The evidence for this is, of course, broader and more compelling in vitro, but there are now also multiple well-documented examples of antisense drugs altering splicing in vivo.

Alteration of Dystrophin Splicing One of the better-characterized examples of alteration in splicing induced by antisense drugs is the exon skipping induced in dystrophin RNA. Dystrophin is an essential protein for the normal function of skeletal and cardiac muscle. The gene for dystrophin is subject to mutations that result in early termination of the protein or frame shift mutations that can result in a dysfunctional protein. When shortened dystrophin is produced, the protein is partially effective and milder muscular dystrophy is observed. As the pre-mRNA for dystrophin has a large number of introns, the goal has been to induce exon skipping, thereby avoiding the frame shift mutations that result in a shortened form of the protein. A number of laboratories have reported that 2 methoxy and morpholino oligomers induced altered splicing in vitro and in vivo [76–80]. Indeed, in dystrophic mice, induction of alternative splicing with a morpholino antisense drug resulted in improved muscle performance.

B-Cell Lymphoma/Leukemia Cell x (Bc1-x) The Bc1-x gene can result in the production of either a long or short form of the protein and this is effected by use of an alternative splice site. Bc1-x long inhibits apoptosis while Bc1-x short induces apoptosis. 2-MOE antisense agents were shown to induce the production of Bc1-x short in malignant cells and this resulted in apoptosis [81,82].

Alteration of Splicing in -Globin RNA The Kole Laboratory has developed a transgenic mouse that expresses green fluorescent protein and has a -globin intron with an aberrant splice site. When the aberrant splice is blocked, normal splicing ensues and green fluorescent protein is produced and easily detectable in mouse tissues.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 21


21

These investigators used this model to demonstrate that 2-MOE and 4-Lysine PNA antisense agents could potently induce alternative splicing of the transgene while morpholinos were less potent [83].

MyD88 MyD88 is an adapter protein through which proinflammatory cytokines signal. In a very thorough study, the authors demonstrated that 2-MOE antisense agents could alter splicing of MyD88 in vitro and in several tissues in vivo [84]. This was associated with reduced interleukin 1 beta (IL-1) signaling in vitro and in vivo.

1.4.1.2 How Is the Activity of Antisense Drugs Affected by the Strength of the Splicing Signal? Both 5 and 3 splicing signals are degenerate in mammalian cells and numerous factors influence the relative efficiency of splicing of different introns. Some of these factors include the strength of the 5 and 3 splice sites, the characteristics of the polypyrimidine tract, the size of the intron, the guanosine cytosine (GC) content of the intron, the presence of exonic enhancers and silencers, and the affinity of the two exonic sequences adjacent to the intron for each other (for review see [85]). To some extent, it may be simpler to define the strength of the 5 splice site than other sites. Based only on the sequence of the 5 splice sites itself, 5 splice sites have been divided into strong, intermediate, and weak. The strength of the splice site correlated with the complementarity to the terminus of uridine-rich RNA 1a (U1a RNA) [86]. Only for the weak 5 splice sites did factors other than the sequence of the splice site play a role. In contrast, the efficiency of 3 splice sites appears to be related to the strength of the splice signal, the GC content of the intron, the position and strength of the polypyrimidine tract, and the presence of exonic regulatory elements. Even considering all these factors, the correlations with predicted rates of splicing are only modest [87]. Thus, it is clear that attempting to evaluate the effects of the efficiency of a particular splicing event on the activity of antisense drugs is likely to be challenging. Indeed, that has proven to be the case. To begin to address the effects of splice-site strength on the activities of antisense inhibitors, some years ago we [88] constructed a luciferase receptor gene with -globin or adenovirus introns. Mutating the weaker splice signals in the -globin construct progressively toward the stronger adenovirus signals progressively increased the extent of splicing. Inhibition of splicing was greater when the weaker splice sites were targeted. On the basis of these studies, we suggested that introns with weaker splicing signals might be more sensitive to antisense inhibition. In a thorough examination of multiple introns in dystrophin pre-mRNA, the effects of one hundred and fourteen (114) 2 methoxy antisense inhibitors designed to bind to different sites and induce skipping of many different exons were evaluated [76]. Although there was substantial variability in the ease with which different splicing of events were inhibited, very little correlation between the strength of splice sites and activity was observed. Antisense agents designed to bind to 3 splice sites and branch points were reported to be ineffective. A detailed analysis of antisense agents designed to cause skipping of exon 23 in the dystrophin pre-mRNA also showed that the 5 splice site, but not the 3 splice, was sensitive to the effects of these agents [77]. In contrast, in other pre-mRNA targets, antisense agents designed to bind to either 5 or 3 splice sites were effective [83,84]. On the basis of all the results available then, it appears that alteration in splicing can be achieved by binding to either 5 or 3 splice sites, but there is great variability in the results. In fact, in unpublished studies focused on eIF-4E and survivin, in which we have thoroughly evaluated 5 and 3 splice sites, again, activities were observed at both splice sites. Figure 1.8 exemplifies our experience. In this study, 20-nucleotide full 2-MOE antisense agents were designed to bind to various regions of the 5 and 3 splice junctions in various pre-mRNA, cells were treated, and the induction of splice-variant RNA species evaluated. For MCL-1, inhibitors of both the 5 and 3 splice sites were effective, with the 5 splice site being slightly more susceptible. In contrast, for

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 22

22

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Acceptor

Donor

Intron

Exon

0

Intron

0

5′ Splice site ASOs


utc

MCL-1

mMyd88

hMyd88

ERalpha exon4

IL4

Syk

Figure 1.8

Effect of 2 MOE ASOs on RNA splicing. A schematic representation of targeting strategy. A series of 5 ASOs were designed to the acceptor or donor site of the exon targeted for skipping. Number indicates ASO start site relative to the intro/exon junction. All ASOs are 20 nucleotides in length and have 2 MOE ASOs targeted to exon splice sites at a single concentration of 200 nM for 4 h using Lipofectin Reagent. ASO was removed and fresh media added to cells. Following overnight incubation, cells were harvested and total RNA purified using RNeasy mini columns (Qiagen). Standard RT-PCR analysis of mRNA was preformed using PCR primers complementary to exonic sequence bracketing the targeted exon. Of total RNA, 5 g were reverse-transcribed in the presence of oligo(dT) using SuperScript II reverse transcriptase according to the manufacturer’s protocol (Invitrogen Life technologies). Following a 1-h incubation at 42°C, the cDNA was diluted by the addition of 80 l of water. Three microliters of the diluted cDNA were combined with 15 l of HotStarTaq mix (Qiagen) and 2.5 l each of 10 uM forward and reverse PCR primer in a final volume of 30 l. The PCR was cycled 30 s at 94°C, 30 s at 72°C, and 2 min at 60°C with 35 repetitions. Products were visualized by electrophoresis on 2% agarose gels stained with ethidium bromide.

splicing in mouse and human, MyD88, only the 3 splice site was susceptible. For the other targets, both 5 and 3splice sites were sensitive with slight differences in sensitivity between the two sites. So both the 5 and 3 splice sites are amenable to the effects of antisense drugs. Is there then a pattern of sensitivity with regard to the strength of the splicing signal? If there is, it is certainly neither obvious nor universal. One of the problems, of course, is deciding how strong a splice signal is. Using the classification of 5 splice sites proposed by Roca et al. [86], no pattern in responsiveness as a function of splice signal is evident in published data, nor in unpublished information at

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 23


23

Isis involving many targets. Although it is even more difficult to assign a “strength” value for 3 splice sites, certainly no pattern emerges [89]. What about more complex approaches to assignment of “strength” to splice sites? A good example derives from studies on estrogen receptor (ER). ER has 8 exons. Skipping of each of the exons has been observed naturally, as has skipping of several exons simultaneously [90]. Because all the splice sites are relatively homologous to consensus sites, a statistical evaluation of sequences 60 nucleotides upstream and downstream of the splice sites was used to assess relative “strength.” Relative strengths of splice signals were then compared to the frequency with which an intron was skipped naturally. Although the correlation was very limited, the study suggested that something abut the intron–exon junctions around exon 4 encouraged more alternative splicing. We evaluated the ability to alter splicing of three introns in ER (Figure 1.9). In this experiment, we evaluated five 2-MOE inhibitors positioned around the 5 and 3 splice sites of these exons. Figure 1.9 shows that for the frequently alternatively spliced exon 4 that had an intermediate “strength” of splice signal, potent inhibitors were found. In contrast, exon 7 is also frequently alternatively spliced as is shown in Figure 1.9, but no inhibitors were found.

Acceptor

(a)

Donor

Intron

Intron

Exon

0

0


(b) utc

3′ Splice site ASOs 0

0

ER-alpha exon7

ER-alpha exon5

ER-alpha exon4

Figure 1.9

Effects of 2 MOE ASOs on estrogen receptor alpha RNA splicing. (a) Schematic representation of targeting strategy. A series of 5 ASOs was targeted to the acceptor or donor site of the exon targeted for skipping. Numbering indicates ASO start site relative to the intron/exon junction. All ASOs are 20 nucleotides in length and have 2 MOE sugar modifications with phosphorothioate linkages at all positions. (b) MCF-7 cells were treated with 2 MOE ASOs targeted to exon splice sites at a single concentration of 200 nM for 4 h using Lipofectin Reagent. ASO was removed and fresh media added to cells. Following overnight incubation, cells were harvested and total RNA purified; then standard RT-PCR analysis of mRNA was preformed using PCR primers complementary to exonic sequence bracketing the targeted exon as detailed above.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 24

24


Exon 5 is also frequently alternatively spliced, has a high “strength score” and no inhibitors were identified. On the basis of all the data, we can therefore conclude the following: ●

● ●

The ability to alter splicing of different introns by antisense drugs is variable and no obvious rules have emerged. Both 5 and 3 splice sites are amenable to effects of antisense drugs. There is no correlation between strength of splice sites or propensity to undergo alternative splicing, and the effectiveness of antisense modulation of splicing is apparent.

1.4.1.3 Does the Position of the Antisense Drug at a Splice Site Affect the Activity of the Antisense Drug? The answer to this question is unequivocally yes. This conclusion is supported by an evaluation of published data and exemplified by the data shown in Figure 1.8. Although effectiveness appears to vary as a function of the position of the 20-nucleotide antisense agents vis-à-vis the splice junctions for all targets, the only generalization supported by the observations is that agents that bind to or are adjacent to the junction and extend some distance into the intron or exon tend to be more effective than those that do not include the splice junction.

1.4.1.4 Do the Characteristics of Introns or Exons Affect the Activities of Antisense Agents? Given the wide variation in responsiveness of introns to alteration of splicing by antisense drugs and the lack of obvious explanations for this provided by in the characteristics of the splice site, it is obvious that other intronic or exonic characteristics must contribute [89,90]. However, no generalizations are feasible based on available data. For example, we evaluated the three ER exons shown in Table 1.1 for the presence of several putative exonic splicing enhancers (ESEs). At the 5 and 3 ends of the exons to which the splice antisense agents would have bound, all three exons were endowed with a number of putative ESEs, yet there was no obvious difference that could explain the ease of induction of skipping of exon 4 versus the other exons. Of course, it may be that the putative ESEs are, in fact, not functional or that antisense binding to the SF2 ESE is somehow unique. Nevertheless, based on evidence available today, the identification of ESEs within the binding site of antisense agents designed to bind to splice junctions results in no obvious guidance with regard to the design of the drugs.

Table 1.1

Predicted Exonic Enhancer Sequences in Estrogen Receptor 5 ESE sites

3 ESE sites

Target

SF2/ASF Thr 1.956

SC35 Thr 2.383

SRp40 Thr 2.67

SRp55 Thr 2.676

SF2/ASF Thr 1.956

SC35 Thr 2.383

SRp40 Thr 2.67

SRp55 Thr 2.676

ER-alpha E4 ER-alpha E5 ER-alpha E7 mMyD88 hMyD88 Syk MCL-1 IL-4

3.233 N N 2.786 2.786 4.018 N 2.922

2.893 N 3.321 3.867 3.299 3.850 N N

3.009 2.995 N N 3.830 2.863 2.762 N

Na 3.405 N 2.858 3.366 N 3.831 N

2.506 N 4.065 3.122 4.115 3.407 N 3.411

N 3.721 2.476 3.186 3.186 4.956 2.572 2.711

3.455 N 3.526 3.176 3.280 3.585 N 2.692

N N 4.087 N N 2.908 N 3.831

Note: ESEfinder was used to locate putative exonic splicing enhancers within or overlapping the first or last 20 bases of each exon. Scores are given for ESEs with values above the threshold for each sequence element. The thresholds are values above which a score for a given sequence is considered to be significant (high-score motif). Where more than one ESE was found for given sequence element, only the highest score has been given. a ESE absent [89].

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 25


25

1.4.1.5 Can Antisense Agents Designed to Bind Exonic Enhancer or Silencer Sequences Affect Splicing? The answer to the question is yes. Perhaps the most thorough study reported to date examined the effects of a number of 2-MOE antisense agents that targeted exonic regulatory sequences in the pre-mRNA of the spinal motor neuron 2 (SMN2) gene [91]. Several agents were shown to either induce or inhibit exon inclusion.

1.4.1.6 Does Chemical Class Influence Activity? Both in vitro and in vivo, the answer to this question is yes. Analyses of in vitro data are more robust both because there are more data and because differences in pharmacokinetic and toxicologic properties are less likely to influence the results. Activities have been observed for fully modified 2 methoxy, 2-MOEs, 4-Lysine and 8-Lysine PNAs, and morpholinos. As a general rule, in vitro potencies correlated with relative affinities for RNA: PNA2-MOEmorpholinos2 methoxy [76–84]. Only modest experience has been reported in vivo. Nevertheless, 2 methoxy, 2-MOEs, morpholinos, and Lysine PNAs have been shown to be active [76–84]. Direct comparisons have again suggested that affinity for target RNA is the critical determinant although differences in pharmacokinetics complicate the analyses. 1.4.2

Translation Arrest

Translation arrest is defined as the inhibition of translation secondary to binding (and not inducing cleavage) of an antisense drug to a target RNA in a fashion that inhibits the translation of the message into protein. Because polysomes are capable of “melting” structures in RNA, inhibitors of translation have typically interacted with the 5-UTR, or the translation initiation codon, or an internal ribosome entry (IRE) sequence (for review, see [7,15]). However, antisense inhibitors designed to bind to sites in coding sequences have also been shown to be active. Here again, meaningful progress has been reported and significant questions remain to be answered.

1.4.2.1 Is It Feasible to Arrest Translation with Antisense Drugs? Yes. Translation arrest can be induced by a variety of chemical classes of antisense drugs in vitro and in vivo. Well-documented examples include inhibition of intercellular adhesion molecule 1 (ICAM-1) [92], Hepatitis C virus (HCV) [93–95], and c-Myc [96]. In vivo activities have been reported for targets such as HCV and c-Myc [94–96]. Morpholino antisense drugs designed to inhibit translation have also been studied in the clinic and these results are reviewed in Chapter 20.

1.4.2.2 What Are the Optimal Sites in Target RNAs to Induce Translation Arrest? The 5-UTRs of m-RNAs vary in length from a few nucleotides to hundreds, beginning with a 5 cap [92]. Many m-RNAs also contain internal IREs, thus multiple potential sites outside the coding region may be affected. Several studies have attempted to identify optimal sites in target RNAs for translation arrest. For example, in a study on Hepatitis C viral core protein production in hepatocytes, a 2-MOE antisense agent designed to the translation initiation codon did not inhibit protein production while another antisense drug designed to bind to a loop in the 5-UTR was effective [97]. In a more detailed study, multiple 2 methoxy antisense agents were designed to bind a variety of sites in the 5-UTR and the coding region of the core protein. The effects were evaluated in a cell free protein synthesis assay and in hepatocytes [93]. Binding to several sites in the UTR, the translation initiation codon and in the open reading frame resulted in inhibition of core protein synthesis, but the most effective inhibitors were all located near the translation initiation site. In fact, effectiveness declined dramatically as the binding sites were shifted a few nucleotides into the coding sequence from the translation initiation codon.

CRC_8796_ch001.qxd

26

5/24/2007

21:54

Page 26


In contrast, for mammalian m-RNAs, most studies have suggested that binding in the 5-UTR tends to be more effective. For example, the inhibition of the translation of ICAM-1 was effected by binding antisense agents to the 5 cap [91]. In this interesting study, the level of ICAM-1 RNA actually increased in the cytoplasm and was associated with subpolysome functions rather than polysomes, suggesting that entry into the polysome cycle was inhibited by binding the antisense drug to the 5 cap. Also of interest was the observation that binding to the area of the m-RNA adjacent to the cap had no effect on the splicing of the first intron.

1.4.2.3 What Is the Influence of Chemical Class on Activity? Very little work has been reported with regard to this question, but two studies [92,93,98] have evaluated the effects of various fully 2-modified oligonucleotides. Although the correlation is not perfect, if the results from studies with the relatively unstable 2 fluoro (2 F) analog are excluded, there is a trend toward increasing potency with increasing affinity for target RNA.

1.4.2.4 How Robust Is Translation Arrest? Given the amount of work reported on translation arrest, a definitive conclusion about the robustness of the mechanism versus cleavage-moving mechanisms is not possible. However, it is clear that significantly less sequence space is available to antisense agents designed to inhibit translation splicing and the ratio of actives to inactives is lower than for cleavage-based mechanisms. However, in the one study that directly compared translation arrest to RNase H–based target RNA cleavage, potencies were roughly equivalent in vitro [92]. 1.4.3

Disruption of Necessary RNA Structure

RNA adopts a variety of three-dimensional structures induced by intramolecular hybridization, the most common of which is the stem loop. These structures play crucial roles in a variety of functions. They are used to provide additional stability for RNA and as recognition motifs for a number of proteins, nucleic acids, and ribonucleoproteins that participate in the intermediary metabolism and activities of RNA species. Thus, given the potential general utility of the mechanism, it is surprising that occupancy-based disruption of RNA structure has not been more extensively exploited. As an example, we designed a series of oligonucleotides that bind to the important stem-loop present in all RNA species in human immunodeficiency virus (HIV), the transactivating region (TAR) element. We synthesized a number of oligonucleotides designed to disrupt TAR, and showed that several indeed did bind to TAR, disrupt the structure, and inhibit TAR-mediated production of a reporter gene [99,100]. Furthermore, general rules useful in disrupting stem-loop structures were developed [101]. Although designed to induce relatively nonspecific cytotoxic effects, two other examples are noteworthy. Oligonucleotides designed to bind to a 17-nucleotide loop in Xenopus 28 S RNA required for ribosome stability and protein synthesis inhibited protein synthesis when injected into Xenopus oocytes [102]. Similarly, oligonucleotides designed to bind to highly conserved sequences in 5.8 S RNA inhibited protein synthesis in rabbit reticulocyte and wheat germ systems [103].

1.5 OCCUPANCY-ACTIVATED DESTABILIZATION RNA molecules regulate their own metabolism. A number of structural features of RNA are known to influence stability, various processing events, subcellular distribution, and transport. It is likely that as RNA intermediary metabolism is better understood, many other regulatory features and mechanisms will be identified.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 27


1.5.1

27

5 Capping

A key early step in RNA processing is 5 capping (Figure 1.2). This stabilizes pre-mRNA and is important for the stability of mature mRNA. It also is important in binding to the nuclear matrix and transport of mRNA out of the nucleus. Since the structure of the cap is unique and understood, it presents an interesting target. Several oligonucleotides that bind near the cap site have been shown to be active, presumably by inhibiting the binding of proteins required to cap the RNA. For example, the synthesis of Simian virus 40 (SV40) T-antigen was reported to be most sensitive to an oligonucleotide linked to poly-L-lysine that targeted the 5-cap site of RNA [102,104]. However, again, in no published study has this putative mechanism been rigorously demonstrated. In fact, in no published study have the oligonucleotides been shown to bind to the sequences for which they were designed. In studies in our laboratory, we have designed oligonucleotides to bind to 5 cap structures and identified reagents to cleave the unique 5 cap structure [105]. These studies demonstrated that 5-cap-targeted oligonucleotides were capable of inhibiting the binding of the translation initiation factor eIF-4. 1.5.2

Inhibition of 3-Polyadenylation

In the 3-UTR of pre-mRNA molecules, there are sequences that result in the posttranscriptional addition of long (hundreds of nucleotides) tracts of polyadenylate. Polyadenylation stabilizes mRNA and may play other roles in the intermediary metabolism of RNA species. Theoretically, interactions in the 3-terminal region of pre-mRNA could inhibit polyadenylation and destabilize the RNA species. Although there are a number of oligonucleotides that interact in the 3-UTR and display antisense activities [106], to date, only one study has reported evidence for alterations in polyadenylation. In this study [106], fully modified 2-MOE antisense regents caused polyadenylation to be redirected, increasing RNA stability and enhanced protein synthesis. This study certainly merits attention and follow up because the mechanism offers the potential to create antisense agents that selectively increase expression of a protein. 1.5.3

Other Mechanisms

In addition to 5 capping and 3 adenylation, there are clearly other sequences in the 5- and 3-UTRs of mRNA that affect the stability, localization, and translatability of the molecules. Again, there are a number of antisense drugs that may work by interfering with these processes, but no studies that confirm these possibilities have been reported. 1.5.4

RNase H

Without question, the RNase H mechanism has proven to be the most robust mechanism identified and characterized to date. The experience with first- and second-generation RNase H–based antisense drugs in vitro and in vivo exceeds by many fold the total experience with drugs of all other mechanisms. Several thousand humans have been treated with first- and second-generation RNase H–based antisense drugs. Again, this experience dwarfs the combined experience with antisense drugs designed to work through other mechanisms (for review, see 9; Chapters 2, 3, and 4; and Part 4 of this volume), and this mechanism is reviewed in considerable detail in Chapter 2 of this volume. In this chapter, I will address a number of questions about the RNase H mechanism and consider future experiments. The RNases H cleave RNA only in RNA–DNA duplexes. In human cells, two RNases H have been identified, cloned, and expressed (for review, see [107,108] and Chapter 2 in this volume). We have characterized the enzymological properties of human RNase H1 and to a lesser extent those of human RNase H2 (for review see chapter 2 of this volume). We have demonstrated that the antisense effects

CRC_8796_ch001.qxd

28

5/24/2007

21:54

Page 28


of DNA-like antisense drugs in cells and animals are due strictly to the activities of RNase H1, even though RNase H2 is substantially more abundant. We have demonstrated that RNase H2 is not involved in the effects of DNA-like antisense drugs because it is inaccessible to the oligonucleotide RNA duplexes formed, probably because it is bound to chromatin (Chapter 2, this volume and [107–109]).

1.5.4.1 Do Antisense Drugs That Use the RNase H Mechanism Work? Yes. In vitro, in vivo, and in humans RNase H–based antisense drugs have produced impressive pharmacological effects in a wide range of cells and tissues when given by a wide range of routes of administration (for review, see [9] and this volume). In fact, in studies in our laboratories on more than 4000 genes, we have never failed to identify multiple potent and selective RNase H–based actives for any target.

1.5.4.2 What Sites in Target RNAs Are Accessible to RNase H–Based Antisense Drugs? Figure 1.7 shows results form an in vitro screen for RNase H–based active sites. Obviously, sites throughout the pre-mRNA are accessible to RNase H1–based antisense drugs. Despite the vast experience in designing and testing RNase H–based antisense drugs, no rules or guides have emerged that enable selection of optimal sites in target RNAs to which to bind to. Thus, we continue to screen against a large number of sites throughout the target RNA as shown in Figure 1.7. That no rules for site selection have emerged despite the enormous experience confirms that the interaction of oligonucleotides with target RNA and the recruitment and activation of RNase H1 are complex processes governed by many factors that are inadequately understood. The demonstration that sites in pre-mRNA and mature mRNA appear to be equally amenable to the effects of RNase H–based antisense drugs is consistent with the observations that human RNase H1 is present in the nucleus, cytosol, and mitochondria (for review, see [15,108,109] and Chapters 2 and 10 in this volume). As we have demonstrated that recruitment of RNase H1 to the antisense drug–RNA duplex is limiting [109], it is likely that in addition to the access of the antisense drug to a site in a target RNA, the access and relative activity of human RNase H1 at the site of drug binding to the duplex is critical. Human RNase H1 consists of an RNA-binding domain, a spacer region, and a catalytic domain (Figure 1.10) (for review, see [110,111] and Chapter 2 in this volume). Two Lysines and a tryptophan in the RNA-binding domain position the enzyme at the first DNA/RNA nucleotide and the catalytic domain cleaves approximately one helical turn from the binding site. The enzyme displays little sequence preference, but within a particular site the enzyme displays preferred cleavage sites. Thus, for any site to be affected by human RNase H1, a binding site and a site with appropriate characteristics to support cleavage must be separated by one helical turn from the RNA binding site. Therefore, a number of sites that might be accessible to antisense drugs might not be optimal sites for RNase H1 resulting in variations in potency. The use of second-generation antisense drugs exaggerates the potential effects of site selection as shown in Figure 1.11. Consequently, the substantial variations in potency from site to site are easily explained. Until much more is known about the influence of sequence on protein binding and subtle changes in RNA structure, it is very unlikely that more sophisticated rules for site selection will be developed, i.e., screening to identify optimal sites will remain essential. Perhaps a more interesting question is why so many sites are amenable to RNase H1–mediated cleavage. The answer to this question awaits much more research. We know that RNase H1 is active as a monomer in contrast to RNase H2, which is only active in a complex of several proteins. We also know that RNase H1 is present in multiprotein complexes, but do not know the identity of any of the RNase H1–associated proteins. Perhaps the associated proteins facilitate access and the induction of the appropriate RNA conformation to support activity.

3

4

5

Nucleus

RNase H

DNA

Nucleus

RNase III

mRNA

Helicase

RISC

3

4

Antisense strand

5

Cytoplasm

Figure 1.10 Schematic showing a simplified view of RNase H and siRNA mechanisms. The left panel shows a single-stranded DNA-like antisense oligonucleotide entering a cell, interacting with its target RNA in the cytoplasm or nucleus of a cell, and then recruiting RNase H1. The right panel shows an siRNA duplex entering a cell, the duplex entering the siRNA pathway, the sense strand being removed, and the RISC complex cleaving the target RNA.

DNA

mRNA

2

2

1

21:54

RNase H

1

Cell membrane

Sense strand

siRNA antisense mechanism

5/24/2007

Cytoplasm

Cell membrane

Antisense strand

RNase H antisense mechanism


MECHANISMS OF ANTISENSE DRUG ACTION, AN INTRODUCTION 29

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 30

30


RNA-BD

Cat

5′ 3′

mRNA ASO

Figure 1.11 Schematic of potential interactions of human RNase H1 with a 2-MOE- chimeric antisense drug mRNA duplex. Because RNase H1 is unable to cleave RNA opposed to a 2-MOE modified nucleotide and because subtle conformational changes due to sequence differences result in preferred cleavage sites, the extent of cleavage can vary substantially from site to site in a target RNA.

1.5.4.3 Can Information about the Enzymology of RNase H1 Be Used to Improve the Performance of RNase H–Based Drugs? Yes. This topic is dealt with in considerably more detail in Chapter 2 of this volume. Suffice it to say, we have shown that by extending the RNase H gap and introducing modifications at the junctions of the MOE wings and the gap, we can improve potency [110,112]. For example, we have shown that a gap-widened version of a 2-MOE chimeric antisense inhibitor of phosphatase and tensin homolog deleted on chromosome ten (PTEN) was significantly more potent in reducing liver PTEN RNA than the parent second-generation antisense drug when administered to mice [111]. Although the extent to which the potency may be increased varies, several of these “generation 2.2” analogs are progressing toward clinical trials.

1.5.4.4 How Robust a Mechanism Is RNase H? The RNase H mechanism is remarkably robust. At Isis alone, RNase H–based inhibitors to as many as 4000 genes have been identified. With second-generation antisense inhibitors, the active to inactive ratio in vitro is typically 1 or greater. Thorough studies comparing second-generation RNase H–based inhibitors to siRNA in vitro have demonstrated that the two approaches result in approximately the same hit rates and similar potencies at most sites [69]. However, for scientists without ready access to 2-MOE chimeric antisense agents, siRNA is probably a more efficient and easier-to-use approach for in vitro gene functionalization (e.g., see [113]). The fact that there is considerable overlap in active sites in target RNAs for 2-MOE second-generation antisense inhibitors and siRNA (Figure 1.12) suggests that access to human RNase H1 and to the RISC complex in the cytoplasm to target RNAs must be similar. More important, there is substantial experience with RNase H–based first- and second-generation antisense drugs in animals and in man. Second-generation 2-MOE antisense inhibitors have proven to be potent and versatile gene-selective inhibitors in vivo. As their pharmacokinetic and toxicological properties are well defined, the design of appropriate controls and interpretation of the results of in vivo experiments are relatively straightforward (for review, see [10–12,114] and Part 3 of this volume). Moreover, they can be administered by multiple routes [115]. Finally, they display important activities in clinical trials (for review, see Part 3 of this volume). Another important consideration with regard to the “robustness” of an antisense mechanism is how well in vitro results obtained with agents that work via the mechanism in question correlate with in vivo observations. We have had the opportunity to address this question in a number of ways and in several species, but the most complete data set compares the potencies of RNase H–based antisense drugs in reducing target RNAs in vitro to their potencies with regard to reducing target RNA levels in the liver of mice treated systemically with the drugs. One interesting means to evaluate this is to systematically adjust the potency of antisense drugs either by introducing mismatches or by introducing chemical modifications, then comparing the rank order potency in vitro versus in vivo. For example, the potency of first-generation RNase H–based

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 31


RNA-BD Cat 5′ 3′

31

mRNA ASO

Fast

or

I

RNA-BD Cat

5′ MOE 3′

II 5′ MOE 3′

mRNA MOE

ASO

Fast

RNA-BD Cat

mRNA MOE

Slow

ASO

Figure 1.12 Schematic showing the RNA binding, spacer, and catalytic domains of human RNase H1 and their interactions with an mRNA antisense drug duplex.

inhibitors to c-Raf kinase was varied by introducing mismatches; then the rank order potency in vitro was compared to that observed for reducing c-Raf kinase in RNA levels in mouse livers. There was a one-to-one correlation [116]. These observations have been repeated many times with other targets and other sets of antisense agents. Further, we compared the activities of 129 RNase H–based antisense drugs targeted to 63 different genes in vitro to their relative potencies in reducing the same target RNA in mouse livers after systemic administration. The correlation was highly statistically significant ( p 0.001). Thus, the RNase H mechanism has proven to be extraordinarily robust in vitro and in vivo, and as growing data suggest, in the clinic. In fact, the robustness of the mechanism is even more remarkable on reflection. We know that only RNase H1 is involved in this mechanism. We have shown that although it is expressed ubiquitously, the concentration of RNase H1 in cells is very low [117]. Moreover, phosphorothioate antisense drugs are highly effective competitive antagonists to human RNase H1 [118]. Despite this, for many targets, RNase H–based antisense drugs can reduce the levels of target RNAs by as much as 90%. Why is not the top part of the dose–response curve lost if phosphorothioate-modified oligonucleotides are such effective inhibitors of human RNase H1? We do not know, but we hypothesize that human RNase H1 is located in a multiprotein complex. Perhaps it is protected from inhibition until it binds to a duplex substrate. We also surmise that for most target RNAs, turnover of the enzyme is not terribly important because of the limited number of copies of most RNAs in cells. These questions should be the focus of future research in addition to continuing to use the understanding about human RNase H to guide the development of antisense drugs that form RNA antisense duplexes that are more attractive substrates for human RNase H1. 1.5.5

Double-Strand RNase (siRNA)

In 1998, using stabilized single-strand and duplex oligoribonucleotides, we reported that dsRNases in cells and tissues could degrade RNA–RNA-like duplexes [38]. We also showed that nuclear and cytoplasmic homogenates could degrade RNA–RNA-like duplexes and partially purified the enzyme involved. Subsequently, such activities in mammalian cells were shown to be mediated, at least in part, by the siRNA pathway [70]. The identification of the siRNA pathway in mammalian cells has led to the emergence of the use of siRNAs for gene functionalization, target validation, and therapeutic purposes, and to the elaboration of exciting new areas of cell biology. Chapters 3, 15, and 16 of this volume provide detailed reviews of the

CRC_8796_ch001.qxd

32

5/24/2007

21:54

Page 32


pathways and progress in the development of siRNA therapeutics. In this chapter, our goals are to the following: Mechanistically compare and contrast the siRNA mechanism to the RNase H–based mechanism. Consider some of the unique opportunities and challenges presented by the siRNA pathway with regard to the therapeutic potential of siRNAs. Consider some of the challenges of using duplex RNAs as therapeutics and potential solutions to these issues.

● ●

●

1.5.5.1 siRNA and RNase H Mechanisms Are Similar The goal of both RNase H–based and siRNA antisense inhibitors is to bind to target RNAs via Watson and Crick hybridization and recruit a cellular nuclease that will degrade the targeted RNA (Figure 1.13). Antisense drugs designed to work via the RNase H mechanism are single-stranded and must have a DNA-like portion that serves as the antisense strand of the duplex that becomes a substrate for RNase H1. As RNase H1 is present in both the nucleus and cytosol, it is possible for these antisense agents to work in both cellular compartments and on sites in the RNA that are excised in the nucleus or are present in the mature m-RNA. siRNA activities are typically effected with duplex RNAs. The simplest way to think of the sense strand is that it meets the basic definition of a drug delivery device: it is used to enhance the stability of the drug, the antisense strand, and the delivery of the antisense strand to the site of

120

90

60

30

0

19 57 197 314 421 494 671 757 817 891 952 1106 1169 1262 1342 1418 1504 1541 1694 1792 1855 2020 2098 2180 2268 2347 2403 2523 2598 2703 2765 2806 2844 2950 3037 3088

Relative mRNA expression (qRT/PCR)

150

Target site start position Figure 1.13 Phosphatase and tensin homolog deleted on chromosome ten (PTEN) oligonucleotide screen. A series of 36 chimeric RNase H–dependent oligonucleotides and a series of corresponding siRNA duplexes were administered to T24 cells in the presence of Lipofectin Reagent. Sixteen hours later, total RNA was harvested and PTEN mRNA levels assessed by qRT/PCR as detailed in Materials and Methods. Results are the percent PTEN mRNA relative to untreated control. Solid bars: chimeric RNase H–dependent oligonucleotides; striped bars: siRNAs.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 33


33

action, RISC. Unfortunately, it is not yet an optimal drug delivery device because it is not pharmacologically inert and is metabolized to potentially pharmacologically active metabolites. Once the sense strand is removed, the antisense strand is used by the RISC complex to degrade the target RNA. It has been suggested that RISC is localized in the cytoplasm, so siRNA drugs are assumed to work in the cytoplasm. Thus, in both cases, hybridization-based drugs are designed to exploit normal cellular processes to effect cleavage of target RNA. Thanks to the extraordinary progress in understanding the RISC mediated pathways, we know more about the cellular functions and pathways with which siRNAs may interact than RNase H–based antisense drugs, but obviously RNase H has cellular functions and participates in pathways including those involved in de novo and repair DNA synthesis and probably others (for review, see Chapter 2). Similarities between RNase H–based and RISC-based mechanisms extend beyond both simply being RNA cleavage mechanisms. As was discussed previously, both require access to RNA and display similar patterns of sites of activities in target RNAs [119–121]. Both are influenced similarly by RNA structure [119–121]. The variations between the potencies for the most sensitive versus least sensitive sites in RNA are roughly comparable [119]. In fact, eIF2c2, the RISC effector, is an RNase H–type enzyme and generates cleavage products with 5 phosphates and 3 hydroxyls [122,123]. Both mechanisms are quite robust in vitro despite the fact that human RNase H1 and eIF2c2 are present in low amounts in cells. Finally, oligonucleotides that employ both mechanisms can be chemically modified with similar modifications, albeit at different positions and with somewhat different results (for review, see [124–129] and Chapter 15 of this volume). There are also important differences between the RNase H and RISC-based mechanisms.

1.5.5.2 RISC-Mediated Pathways One of the most important differences between the RNase H–based mechanism and the RISCbased mechanism is that pathways can be induced by activation of RISC or other pathways that may be induced by double-strand RNA molecules are remarkably more diverse that those associated with RNase H. In fact, the siRNA-associated pathways are extraordinarily complex and our understanding of the pathways evolves almost monthly as new data are reported. These pathways will be reviewed in much more detail in Chapter 3 and other chapters of this volume. The purpose of this discussion is to highlight therapeutic issues and opportunities related to the diverse siRNA pathways and the pleitropic effects that they may mediate. In contrast to RNase H, RISC-mediated pathways are designed to differentially respond to siRNAs that are fully or partially complementary to target RNA and to induce different outcomes (Figure 1.14). Fully complementary siRNAs are thought to induce an initial cleavage by eIF2c2, then subsequent degradation of the target RNA in cytoplasmic bodies. Partially complementary siRNAs may induce target RNA degradation or translation arrest. Thus, cellular responses to siRNAs are much more promiscuous with regard to hybridization and more versatile than those to RNase H–based antisense drugs, offering interesting opportunities and substantial challenges. From a gene functionalization perspective, the potential to affect multiple RNA targets is highly problematic, but the potential to affect the level of synthesis of unintended proteins is even more problematic because of analytical limitations in measuring proteins. From a therapeutic perspective, the potential to induce multiple hybridization-based effects through at least two different mechanisms is a cause of substantial concern and will require very careful experimentation and controls to (1) define the mechanism by which pharmacological effects are induced and (2) ensure the safety of each siRNA drug candidate. Moreover, since such effects may be very species-specific (if not cell- and tissue-context dependent), they influence considerations about the design of preclinical toxicological evaluation.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 34

34


Programmed RISC

Programmed GW182 RISC

Full complement

eIF2C2

eIF2C2

5′

mRNA

guide

Partial complement

or

? Programmed RISC

Programmed RISC eIF2C1 eIF2C3

Programmed RISC

GW182

eIF2C1/2/3/4 eIF2C2

eIF2C4

Guide or

Guide

Guide or

5′ ?

Arrest

Degrade

Programmed RISC

Programmed RISC

eIF2C1/2/3/4

eIF2C1/2/3/4

Programmed GW182 RISC

GW182

Dcp1

eIF2C2

5′ Exosome

5′

5'

Dcp2

Deaden.

Helicase ?

XRN1

Ski2 / 3 / 8

Ribosome Cytoplasmic bodies Figure 1.14 RISC Pathway Programmed RISC contains guide (antisense) strand bound to the slicer enzyme eIF2c2. Guide strand exhibiting full complementarity (siRNA) or partial complementarity (miRNA) hybridize to target mRNA and the glycine/tryptophan-rich GW182 RNA-binding protein localizes programmed RISC to cytoplasmic bodies [168]. eIF2c2 of programmed RISC containing siRNA guide strand cleaves target mRNA. eIF2c2 nicked mRNA is further degraded by the 5 → 3 exonuclease XRN1 and 3 → 5 exonuclease of the exosome in cytoplasmic bodies [169]. Exosome cofactors SKI2, 3, and 8 of yeast have also been shown to be important for the degradation of the nicked mRNA [169]. Target mRNA bound to programmed RISC containing miRNA guide strand is degraded in the cytoplasmic bodies by deadenolases and the decapping enzymes DCP1 and 2 [170,171]. Alternatively, target mRNA bound to programmed RISC containing miRNA guide strand promotes ribosomal drop-off, resulting in translational arrest [172].

1.5.5.3 RISC-Mediated Pathways Are Promiscuous with Regard to Hybridization-Based Off-Target Effects Although effects on target RNAs that have sequences that are partially complementary to the desired target are observed on occasion with RNase H–based antisense drugs, this has proven to be a very modest issue. In fact, the dominant cause of off-target effects of RNase H–based antisense drugs is interactions with proteins. In contrast, siRNA-mediated systems have evolved to be promiscuous at the level of RNA sequence. This is a unique and potentially very difficult problem with which to contend. In fact, as suggested by Figure 1.14, the RISC complex tolerates a large number of mismatches outside the seed region and still results in translation arrest and/or target RNA cleavage. This is dramatically different from RNase H, which may tolerate a mismatch or two at the 5 or 3 termini, but is intolerant of mismatches of any sort in the cleavage area (for review, see Chapter 2 in this volume). Nevertheless, specific effects for many siRNAs have been reported; there are probably qualitycontrol processes that limit the number of off-target effects. But there are now several reports that

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 35


35

demonstrate that hybridization-based off-target effects are common with siRNAs. Two papers published by the same group [130,131] exemplify the challenges related to the promiscuity of siRNAs and the problems of developing an exciting new scientific idea. Despite the common wisdom that all pharmacological agents result in unintended effects and scores of publications dealing with offtarget effects of other hybridization-based drugs, this group initially drew the following conclusion: “These results indicate that siRNA is a highly specific tool for targeted gene knockdown, establishing siRNA mediated gene silencing as a reliable approach to large scale gene functionalization and target validation” [130,131]. One year later, using similar methods but more thorough investigations, the same authors reported very substantial off-target effects that occurred at concentrations near those at which the target RNA was reduced [132]. Such hybridization-based off-target effects have also been reported by other laboratories [133–135]. In one study, RNAs with 3-UTR sequences complementary to the seven-nucleotide seed region of the antisense strand of siRNA (a large number) were affected [133,135]. This problem is exacerbated by the potential for true nonspecific effects that may not be related to promiscuous hybridization but rather other mechanisms such as induction of interferon [134]. Furthermore, a screen of randomly selected siRNAs showed that a number of siRNAs could result in reduced viability of HeLa cells transfected with 10 nM of the siRNAs. The toxicity appeared to correlate with the presence of a four-base-pair motif [136]. The mechanisms that might underlie the cellular toxicity were not identified. That the problems of specificity associated with promiscuous hybridization may not be insurmountable is suggested by one publication in which modifications at position 2 of a siRNA reduced off-target effects [137]. It is also important to remember that the sense strand is capable of hybridization-based effects as well as the antisense strand. Contending with the potential of promiscuous hybridizationbased effects of two stabilized strands will be particularly challenging. However, as siRNAs are modified to enhance nuclease stability and in vivo pharmacokinetics, those modifications are likely to increase protein binding, exacerbating the non-hybridization-based off-target effects. In short, a great deal of very careful pharmacological work is required to minimize these problems. Specifically, we must develop appropriate chemistries and designs to reduce the promiscuity of hybridization-based effects while minimizing non-hybridization-based effects. We must be able to measure both strands in vivo and create sense strands that are relatively rapidly degraded so as to avoid the potential pharmacological effect of the sense strand. Alternatively, the use of stabilized single-strand antisense oligonucleotides may be of value here.

1.5.5.4 siRNAs May Induce Transcriptional Repression siRNAs can induce heterochromatin and gene silencing, i.e., a heritable repression of gene transcription, in all species including humans (for review, see [35,138]). siRNAs may be generated in the nucleus by the action of the RNA-dependent RNA polymerase on single-stranded RNA or by transcription of inverted DNA repeats [35]. These siRNAs can interact with the RITS complex. Activation of RITS can directly methylate DNA or induce methylation of histones, which can methylate DNA [138]. This then leads to the formation of heterochromatin, silencing of the targeted gene, and in some cases spreading of silencing to contiguous genes [139–144]. Exogenous siRNAs complementary to promoter regions of both an integrated reporter gene and an endogenous gene in human cells have also been reported to be capable of transcriptional gene silencing [144]. The transcriptional silencing activity required transport of the siRNA to the nucleus, suggesting that it interacts with the RITS complex in the nucleus. However, RISC and siRNA have now been reported to be present in the nucleus [145], so the effects might have been mediated via nuclear loading RISC and transfer to RITS. What are the implications of transcriptional gene silencing, heterochromatin formation, and spreading for the therapeutic uses of siRNAs and RISC activation? Although it is theoretically possible to avoid promoter sequences, it is also possible that the RITS complex is imprecise in its

CRC_8796_ch001.qxd

36

5/24/2007

21:54

Page 36


interactions with nucleic acid sequences. If RITS were to be activated by therapeutic siRNAs, in theory alteration in the genome could result. If the RITS complex displays limited promoter sequence fidelity or if spreading occurs, substantial, entirely unexpected genomic effects could ensue. Thus, until more is understood it seems sensible to attempt to avoid activation of the RITS pathway if possible.

1.5.5.5 siRNAs Have Displayed Activities in Vivo That Are Similar to Those Displayed by RNase H Antisense Drugs—But There Are Also Substantial Differences Gratifying progress has been reported in demonstrating that siRNAs can be active in vivo. However, much remains to be learned before it is clear that siRNAs have properties that will support systemic applications for therapeutic purposes. Unmodified siRNAs designed to reduce TNF superfamily 6 (FAS) message and protein levels were administered to mice via hydrodynamic vein injections. Doses of 2–2.3 mg/kg were administered at 0 h, 8 h, and 24 h; then liver effects were evaluated. Fas RNA and protein were reduced for multiple days after the injections and the mice were protected from ligand-induced hepatitis [146]. These remarkable results may be partially explained by the hydrodynamic injection method. However, it has clearly been shown that unmodified siRNAs are rapidly cleared from blood via glomular filtration and are relatively rapidly degraded in plasma and tissues [147]. Thus, the effects and their prolonged duration are difficult to reconcile with the known pharmacokinetic properties of these chemicals, unless once RISC is loaded, the complex is stable and provides effects for prolonged periods of time. This same group also reported that siRNA bound to a fusion protein that included the fab fragment of an HIV-1 envelope antibody could accumulate in B16 melanoma tumors and reduce tumor growth [148]. Other groups have reported reduction of target RNAs in the livers of mice after delivering unmodified and modified siRNA in liposomes and in the livers of monkeys [149,150]. While these are encouraging results, substantial experience with liposome-formulated oligonucleotides has demonstrated significant limitations including the need to give the drugs by intravenous infusion and significant toxicities. A more important and relevant study was conducted in mice treated with siRNA containing 2 methoxy and partial phosphorothioate modifications and 3 sense conjugated cholesterol. This siRNA was targeted to apoB100 and produced significant reductions in apoB100 and reductions in cholesterol [151]. This work is important because it demonstrates that a chemically modified siRNA duplex can be delivered systemically without liposome formulation and produce effects. However, we have shown multiple times that cholesterol-conjugated oligonucleotides are highly hepatotoxic [152,153]. In conclusion, there is ample evidence of progress toward being able to use siRNAs systemically for therapeutic purposes. However, a great deal of work needs to be accomplished before such approaches can be considered ready for clinical development, in contrast to second-generation RNase H–based antisense drugs.

1.5.5.6 Structural Features and Medicinal Chemistry of siRNAs That it is possible to exploit the RISC pathway using agents that differ substantially from the 21-base-pair duplexes originally shown to be active [154] is now clear. One of our principal areas of focus is to develop stable single-strand RNA-like antisense drugs that can exploit both RISC and non-RISC mechanisms. Our demonstration in 1998 that single-strand stabilized RNA-like antisense agents were active in cells [38] and the demonstration that single-strand antisense RNA activates RISC [70,155,156] are quite exciting. In our laboratories, we have confirmed that chemically modified single-strand antisense oligoribonuleotides can reduce target RNAs and, at least in part, their effects are mediated by the RISC pathway (Balkrishen Bhat unpublished results). These results are perhaps more remarkable than might appear at first blush since we know that even extensively modified single-strand antisense oligoribonuleotides are still relatively unstable. Thus, as more is

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 37


37

learned about the medicinal chemistry of single-strand oligoribonuleotides, significant improvements in potency should be achievable. This could be quite important if some of the potential limitations of duplex RNA drugs about which we are concerned prove to be difficult to overcome. It is also possible to vary the length and structures of siRNA duplexes and influence the activities of siRNAs. In addition to variations in the ends (blunt versus overhangs), other factors such as GC content, bias toward low internal stability at the 3 terminus of the sense strand, and lack of inverted repeats increase siRNA activities in vitro [157]. siRNAs that were 25–31 nucleotides long and were substrates for dicer-mediated cleavage were also found to be more potent than 21 mers [158]. Additionally, substantial progress in defining potential chemical modifications that might be useful and identifying sites in siRNAs that can be modified without dramatic loss of activity have been reported [124–129,151]. Thus, it seems feasible to introduce a variety of modifications that may improve the drug properties of both single-strand antisense oligoribonuleotides and siRNA. The structure–activity relationships are being worked out for both classes of molecules and they appear to be different. More work is required to identify the modifications and positions to be modified that provide the best properties for systemic applications for therapeutic purposes for both classes of molecules.

1.5.5.7 Unique Challenges of Duplex RNA Drugs In the discovery and development of new drugs, many factors must be considered in addition to the observations of desired pharmacological effects at achievable doses. siRNA duplexes pose drug development challenges that are unique and different from those encountered with single-strand oligonucleotides.

Physical Chemical Properties siRNA duplexes are substantially different from single-strand oligonucleotides. Obviously, they are at least twice the molecular weight of single-strand antisense drugs. This is nontrivial since single-strand antisense drugs have molecular weights of 6000–7000 Daltons, the increase to perhaps greater than 14,000 Daltons should dramatically affect pharmacokinetic and toxicologic properties. It would also substantially increase the cost of manufacturing such drugs. Perhaps more important is the change in the interactions with water. Single-strand oligonucleotides are amphipathic, with the phosphates being very water-soluble and the bases hydrophobic. In a duplex, the phosphate backbones are presented to water and water is somewhat excluded from the more hydrophobic internal portion of the duplex. All these changes mean that extrapolation from the behavior of single-strand oligonucleotides to the behavior of duplexes is not possible.

Manufacturing Large-scale manufacturing of single-strand antisense drugs is well in hand and the advances made over the past 15 years can be employed in the manufacture of the sense and antisense strands of the duplex. The challenge will be to hybridize on large scale and to prove that there is no residual single-strand contamination.

The Sense Strand The sense strand is a drug delivery device. However, it is pharmacologically active. It may bind to unintended transcripts. It may be an immunostimulant. It may bind to a variety of proteins. As the sense strand is modified to enhance the pharmacokinetic properties of the duplex, these properties will likely become more prominent. Certainly, assays will need to be developed to follow the fate of the sense strand and to evaluate the potential effects of this pharmacologically and metabolically active drug delivery device.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 38

38


Immune Stimulation Oligonucleotides are immunostimulatory. The immunostimulatory properties of oligonucleotides are affected by dose length, sequence, chemical modifications, internal structure, and other factors (for review, see [9] and Chapters 1, 3, 13, and 27 of this volume). For single-strand antisense drugs, it is now possible to reduce the potential for immunostimulation. It is also possible to optimize to enhance immunostimulatory (see Chapter 27 of this volume). As a general rule, any propensity toward internal structure enhances the immunostimulatory potential of oligonucleotides. Thus, conceptually, duplex RNA might be expected to be at least as immunostimulatory and perhaps much more immunostimulatory than single-strand oligonucleotides once they are sufficiently stable and distribute to a variety of organs. In fact, siRNAs have been shown to be immunostimulatory. They have been shown to induce interferon in mammalian cells [159]. Unmodified siRNAs 23 nucleotide and longer induced interferon, up-regulated the dsRNA receptor and toll-like receptor 2 in a celltype-specific mamer [157]. In addition, dsRNAs may induce innate immunity [87]. Finally, both single strands when liberated from the duplex have the potential to be immunostimulants. Does the potential to induce a wide variety of immunological responses secondary to duplex properties and motifs, single-strand properties and motifs, and a variety of mechanisms pose an insurmountable problem? Probably not. However, it requires careful attention and lessons learned from studies on single-strand antisense drugs should be considered carefully. For example, ensuring that pharmacological observations are truly the result of siRNAs effects on the target RNA and not confounded by immunological effects is crucial and has been the subject of an enormous effort with regard to RNase H antisense-based drugs. For single-strand antisense drugs, we know that the rodent is particularly sensitive to these effects. We know that there are problematic sequence motifs that are species-specific. We know that chemical modifications can alter immunological properties of these drugs. We know that liposome encapsulation may worsen these effects (for review, see [7]). These lessons should be considered as pharmacological effects are reported and decisions to develop siRNA drugs are made. 1.5.6

Covalent Modifications of Target Nucleic Acids

One area of research that was a significant focus for a number of years was the synthesis of oligonucleotides conjugated to alkylating moleties species designed to alkylate the target RNA and result in disablement and degradation, or either of these. Despite all the early excitement and work, this approach has to a large extent been abandoned. This is primarily because there was no evidence that such approaches resulted in drugs as effective as those that were RNase H–based and because of concerns about toxicity (for review, see [15]). 1.5.7

Oligonucleotide-Induced Cleavage of Target RNA

Another approach that has been the subject of very substantial investment was the creation of either oligonucleotides that were conjugated to RNA cleavage reagents or synthetic ribozymes. Although work continues in these areas (for review, see [15]), little progress has been reported in recent years. It now appears that it is pharmacologically more attractive and feasible to create antisense drugs that recruit either RNase H1 or dsRNases such as the RISC complex than to create oligonucleotides that can effect RNA cleavage themselves. 1.5.8

RNase L–Mediated Cleavage

RNase L or 2-5 adenylate–dependent nuclease is an enzyme that cleaves RNA that contains at least a trimer of 2-5 linked adenylic acid at the 5 terminus of a target RNA (for review, see [160]). The enzyme is ubiquitous but exists in inactive form until activated by interferon. The enzyme has multiple anykrin motifs that suppress the activity of the enzyme until 2-5 is bound [124,161]. Failure in the regulation of RNase L or truncation of the enzyme is associated with disease. It is

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 39


39

therefore quite important to consider RNase L as a potential confounding mechanism for any dsRNA that could activate the interferon pathway. It is also a potential mechanism that could be exploited to induce antisense effects [160]. The challenge to exploitng RNase L as a mechanism has been the synthesis of stable oligonucleotide analogs that contain a 2-5 moiety. To some extent, this has been accomplished. One set of modifications included full 2 methoxy modifications of the oligonucleotide coupled to 5 and 3 phosphorothioate modifications and a 5 thiophosphate [162]. This molecule displayed improved activity against respiratory syncytial virus infection in monkeys after intranasal administration. Other modifications have also been reported. In short, the 2-5 adenyllic RNase or RNase L mechanism remains a potentially attractive mechanism. Very little work on this mechanism has been reported and it probably deserves more substantial efforts in the future. 1.6 MICRO-RNAs As previously discussed, micro-RNAs represent a new level of transcriptional and translational control and a very exciting area of research (for review, see [163]). They also present interesting targets for antisense-based therapeutics. Fully modified 2 methoxy antisense drugs designed to bind to several micro-RNAs were administered to mice and shown to produce substantial changes in m-RNA levels in a large number of RNA species [164]. Mir-122 inhibition with 2-MOE-based antisense drugs substantially reduced serum cholesterol, hepatic fatty acid oxidation, and hepatic synthesis of cholesterol [164,165] demonstrating that alteration of mir function could result in potentially interesting therapeutic effects. More recently, an initial structure activity relationship (SAR) study identified potential approaches to enhance the activities of antisense agents that target mirs [166]. The opportunity to target mirs with antisense drugs opens a number of exciting avenues because the mirs are thought to be involved in relatively large-scale phenotypic shifts including differentiation and dedifferentiation phenomena. Given the number of potential roles of these RNAs in normal and pathophysiologic processes and the relative ease with which they can be targeted with antisense drugs, the therapeutic potential seems quite high. However, careful selection of diseases to be targeted and exploration of the effects on phenotype will be essential given the breadth of potential effects. Furthermore, as components of the micro-RNA pathway are important to the maintenance of a normal phenotype, effects on micro-RNA pathways by single-strand antisense agents or siRNAs could have toxicities. In fact, overexpression of siRNAs has been shown to be toxic to animals possibly secondary to effects on exportin [167]. Therefore, this is an exciting new opportunity that requires prudent but aggressive research. 1.7 CONCLUSIONS AND FUTURE PERSPECTIVES In the 5 years since the publication of the first volume of this series, remarkable progress has been reported. RNase H–based antisense drugs have progressed across a broad front and the information gained about the mechanism is being used to improve their performance. New opportunities such as the use of dsRNases including siRNA and micro-RNAs have emerged and been the subjects of exciting progress. Perhaps equally important, concepts such as transcriptional control though triplex formation, and ribozymes have been thoroughly evaluated and demonstrated to offer too little value using current approaches to warrant further investment. Several areas deserve continued aggressive research. We need to continue to evaluate secondgeneration RNase H–based antisense drugs in the clinic and in animals to better define their strengths and limitations, particularly with regard to chronic administration. We need to continue to use the information on the RNase H mechanism to improve the performance of RNase H–based drugs and determine if generation 2.2 antisense drugs do indeed do perform better than second-generation drugs in the clinic.

CRC_8796_ch001.qxd

40

5/24/2007

21:54

Page 40


We must continue to invest in understanding the RISC mediated pathways and determine which limbs of the pathway we can safely exploit. We must then create agents that can be specific enough to activate the desired limbs of the RISC pathways only. We must determine if surmounting the challenges posed by duplex RNA drugs is feasible and evaluate the potential of single-strand RNA-based drugs. Splicing is now an even more interesting process to alter as we know it is feasible and have the tools to exploit if. However, we must develop a better understanding of splicing processes so that we can improve the robustness of the mechanism. RNase L represents a mechanism that deserves more investment. At present, it is difficult to know if it offers any advantage over other cleavage mechanisms. We should generate the data to support an informed decision about the value of this mechanism. Finally, micro-RNAs represent an exciting opportunity, but the roles of micro-RNAs, the pathways involved, and risks associated with large phenotypic shifts should be adequately understood before proceeding with the development of anti-mer therapeutics. ACKNOWLEDGMENTS We thank Dr. Frank Bennett, Dr. David Ecker, and Dr. Brenda Baker for critical review and helpful comments; as also Tracy Reigle for preparing the figures and Donna Parrett for excellent typographical assistance. REFERENCES 1. Watson, J., Molecular structure of nucleic acids: a structure for deoxyribose nucleic acid. Nature, 1953. 171: 737–738. 2. Gillespie, D. and S. Spiegelman, A quantitative assay for DNA-RNA hybrids with DNA immobilized on a membrane. J. Mol. Biol., 1965. 12(3): 829–842. 3. Thompson, J.D. and D. Gillespie, Current concepts in quantitative molecular hybridization. Clin. Biochem., 1990. 23(4): 261–266. 4. Zamecnik, P.C. and M.L. Stephenson, Inhibition of Rous sarcoma virus replication and cell transformation by a specific oligodeoxynucleotide. Proceedings of the National Academy of Science USA, 1978. 75(1): 280–284. 5. De Clercq, E., F. Eckstein, and T.C. Merigan, Interferon induction increased through chemical modification of synthetic polyribonucleotide. Science, 1969. 165: 1137–1140. 6. Barrett, J.C., P.S. Miller, and P.O. Ts’o, Inhibitory effect of complex formation with oligodeoxyribonucleotide ethyl phosphotriesters on transfer ribonucleic acid aminoacylation. Biochemistry, 1974. 13(24): 4897–4906. 7. Crooke, S.T., Basic Principles of antisense technologies, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 1–28. 8. Cook, P.D., Medicinal chemistry of antisense oligonucleotides, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 29–56. 9. Crooke, S.T., ed., Antisense Drug Technology: Basic Principles, Strategies, and Applications, 2001, Marcel Dekker, Inc.: New York. 10. Geary, R.S. et al., Pharmacokinetic properties in animals, in Antisense Drug Technology: Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 119–154. 11. Crooke, R.M. and M.J. Graham, Suborgan pharmacokinetics, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 155–182. 12. Yu, R.Z. et al., Pharmacokinetic properties in humans, in Antisense Drug Technology: Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 183–200. 13. Levin, A.A. et al., Toxicity of antisense oligonucleotides, in Antisense Drug Technology: Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 201–267.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 41


41

14. Dorr, F.A., J.G. Glover, and T.J. Kwoh, Clinical safety of phosphorothioate oligodeoxynucleotides, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 269–290. 15. Crooke, S.T., Molecular mechanisms of action of antisense drugs. Biochem. Biophys. Acta, 1999. 1489(1): 31–44. 16. Mizumoto, K. and Y. Kaziro, Messenger RNA capping enzymes from eukaryotic cells. Prog. Nucleic Acid Res. Mol. Biol., 1987. 34: 1–28. 17. Ross, J., Messenger RNA turnover in eukaryotic cells. Mol. Biol. Med., 1988. 5(1): 1–14. 18. Friedman, D.I., M.J. Imperiale, and S.L. Adhya, RNA 3 end formation in the control of gene expression. Annu. Rev. Genet., 1987. 21: 453–88. 19. Manley, J.L., Polyadenylation of mRNA precursors. Biochem. Biophys. Acta, 1988. 950: 1–12. 20. Black, D., Mechanisms of alternative pre-messenger RNA splicing. Annu. Rev. Biochem., 2003. 72: 291–336. 21. Kumar, M. and G.G. Carmichael, Antisense RNA: function and fate of duplex RNA in cells of higher eukaryotes. Microbiol. Mol. Biol. Rev., 1998. 62(4): 1415–1434. 22. Vanhee-Brossollet, C. and C. Vaquero, Do natural antisense transcripts make sense in eukaryotes? Gene, 1998. 211(1): 1–9. 23. Zamore, P.D., Ancient pathways programmed by small RNAs. Science, 2002. 296: 1265–1269. 24. Bass, B.L., RNA editing and hypermutation by adenosine deamination. Trends Biochem. Sci., 1997. 22(5): 157–162. 25. Zamore, P.D. et al., RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell, 2000. 101: 25–33. 26. Dahary, D., O. Elroy-Stein, and R. Sorek, Naturally occurring antisense: transcriptional leakage or real overlap? Genome Res., 2005. 15(3): 364–368. 27. Yelin, R., Widespread occurence of antisense transcription in the human genome. Nat. Biotechnol., 2003. 21: 379–386. 28. Kiyosawa, H. et al., Antisense transcripts with FANTOM2 clone set and their implications for gene regulation. Genome Res., 2003. 13(6B): 1324–1334. 29. Kiyosawa, H. et al., Disclosing hidden transcripts: mouse natural sense-antisense transcripts tend to be poly(A) negative and nuclear localized. Genome Res., 2005. 15(4): 463–474. 30. Freier, S.M., Methods of selecting sites in RNA for antisense targeting, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 107–118. 31. Royo, H. et al., Small non-coding RNAs and genomic imprinting. Cytogenet. Genome Res., 2006. 113(1–4): 99–108. 32. Sevignani, C. et al., Mammalian microRNAs: a small world for fine-tuning gene expression. Mamm. Genome, 2006. 17(3): 189–202. 33. Pillai, R.S., MicroRNA function: multiple mechanisms for a tiny RNA? RNA, 2005. 11(12): 1753–1761. 34. Brengues, M., D. Teixeira, and R. Parker, Movement of eukaryotic mRNAs between polysomes and cytoplasmic processing bodies. Science, 2005. 310(5747): 486–489. 35. Matzke, M. and J. Birchler, RNAi mediated pathways in the nucleus. Nat. Rev., 2005. RNA Collection: 7–18. 36. Buhler, M., A. Verdel, and D. Moazed, Tethering RITS to a nascent transcript initiates RNAi- and heterochromatin-dependent gene silencing. Cell, 2006. 125(5): 873–886. 37. Vagin, V.V. et al., A distinct small RNA pathway silences selfish genetic elements in the germline. Science, 2006. 313(5785): 320–324. 38. Wu, H. et al., Identification and partial purification of human double strand RNase activity: a novel terminating mechanism for oligoribonucleotide antisense drugs. J. Biol. Chem., 1998. 273(5): 2532–2542. 39. Dykxhoorn, D.M., C.D. Novina, and P. Sharp, Killing the messenger: short RNAs that silence gene expression. Nat. Rev. Mol. Cell Biol., 2003. 4: 457–467. 40. Weiler, J., J. Hunziker, and J. Hall, Anti-miRNA oligonucleotides (AMOs): ammunition to target miRNAs implicated in human disease? Gene Ther., 2005. 13: 496–502. 41. R.F. Gesteland and J.F. Atkins, eds., RNA World, 1993, Cold Spring Harbor Laboratory Press: Plainview. 42. Breslauer, K.J. et al., Predicting DNA duplex stability from the base sequence. Proceedings of the National Academy of Science USA, 1986. 83(11): 3746–3750.

CRC_8796_ch001.qxd

42

5/24/2007

21:54

Page 42

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION 43. Freier, S.M. et al., Improved free-energy parameters for predictions of RNA duplex stability. Proceedings of the National Academy of Science USA, 1986. 83(24): 9373–9377. 44. Chastain, M. and I. Tinoco, RNA structure as related to antisense drugs, in Antisense Reseach and Applications, 1993, CRC Press: Boca Raton, FL, p. 55. 45. Ecker, D., Strategies for invasion of RNA secondary structure, in Antisense Research Applications, S. T. Crooke and B. Lebleu, eds., 1993, CRC Press: Boca Raton, FL. pp. 378–400. 46. Tuerk, C. and L. Gold, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 1990. 249(4968): 505–510. 47. Wyatt, J.R., Combinatorially selected guanosine-quartet structure is a potent inhibitor of human immunodeficiency virus envlope-mediated cell fusion. Proceedings of the National Academy of Science USA, 1994. 91(4): 1356–1360. 48. Wang, K.Y. et al., A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA. Biochemistry, 1993. 32(8): 1899–1904. 49. Leroy, J.L. et al., Acid multimers of oligodeoxycytidine strands: stoichiometry, base-pair characterization, and proton exchange properties. Biochemistry, 1993. 32(23): 6019–6031. 50. Gehring, K., J.L. Leroy, and M. Gueron, A tetrameric DNA structure with protonated cytosine.cytosine base pairs. Nature, 1993. 363(6429): 561–565. 51. Crooke, S.T., Antisense Research and Applications, S.T. Crooke and B. Lebleu, eds., 1993, CRC Press: Boca Raton, FL. 52. Bennett, C.F. and T.P. Condon, Use of antisense oligonucleotides to modify inflammatory processes, in Antisense Research and Application, A Handbook of Experimental Pharmacology, S.T. Crooke, ed., 1998, Springer-Verlag: New York, pp. 371–393. 53. Freier S.M., W. Lima, Y.S. Sanghvi, T. Vickers, M. Zounes, P.D. Cook, and D.J. Ecker, Thermodynamics of antisense oligonucleotide hybridization, in GeneRegulation: Biology of Antisense RNA and DNA, R.P. Erickson, and J. G. Izant, eds., 1992, Raven Press: New York, pp. 95–107. 54. Thein, S.L. and R.B. Wallace, The use of synthetic oligonucleotides as specific hybridization probes in the diagnosis of genetic disorders, in Human Genetic Diseases: A Practical Approach, K.E. Davies, ed. 1986, IRL Press: Oxford, pp. 33–50. 55. Helene, C., Control of gene expression by triple-helix-forming oligonucleotides: the antigene strategy, in Antisense Research and Applications, S.T. Crooke and B. Lebleu, eds., 1993, CRC Press: Boca Raton, FL, pp. 375–385. 56. Monia, B.P. et al., Selective inhibition of mutant Ha-ras mRNA expression by antisense oligonucleotides. J. Biol. Chem., 1992. 267(28): 19,954–19,962. 57. Saunders, L.R. and G.N. Barber, The dsRNA binding protein family: critical roles, diverse cellular functions. Faseb J., 2003. 17(9): 961–983. 58. Skabkin, M.A. et al., The major messenger ribonucleoprotein particle protein p50 (YB-1) promotes nucleic acid strand annealing. J. Biol. Chem., 2001. 276(48): 44,841–44,847. 59. Pontius, B.W. and P. Berg, Rapid assembly and disassembly of complementary DNA strands through an equilibrium intermediate state mediated by A1 hnRNP protein. J. Biol. Chem., 1992. 267(20): 13,815–13,818. 60. Wunsche, W. and G. Sczakiel, The activity of siRNA in mammalian cells is related to the kinetics of siRNA-target recognition in vitro: mechanistic implications. J. Mol. Biol., 2005. 345(2): 203–209. 61. Miraglia, L. et al., Variations in mRNA content have no effect on the potency of antisense oligonucleotides. Antisense Nucleic Acid Drug Dev., 2000. 10(6): 453–461. 62. Samuel, C.E., RNA editing minireview series. J. Biol. Chem., 2003. 278(3): 1389–1390. 63. Maas, S., A. Rich, and K. Nishikura, A-to-I RNA editing: recent news and residual mysteries. J. Biol. Chem., 2003. 278(3): 1391–1394. 64. Blanc, V. and N.O. Davidson, C-to-U RNA editing: mechanisms leading to genetic diversity. J. Biol. Chem., 2003. 278(3): 1395–1398. 65. Smith, H.C., J.M. Gott, and M.R. Hanson, A guide to RNA editing. RNA, 1997. 3(10): 1105–1123. 66. Giddings, M.C. et al., Artificial neural network prediction of antisense oligodeoxynucleotide activity. Nucleic Acids Res., 2002. 30(19): 4295–4304. 67. Chalk, A.M. and E.L. Sonnhammer, Computational antisense oligo prediction with a neural network model. Bioinformatics, 2002. 18(12): 1567–1575.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 43


43

68. Far, R.K. et al., Technical improvements in the computational target search for antisense oligonucleotides. Oligonucleotides, 2005. 15(3): 223–233. 69. Vickers, T.A. et al., Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents. A comparative analysis. J. Biol. Chem., 2003. 278(9): 7108–7118. 70. Holen, T. et al., Similar behaviour of single-strand and double-strand siRNAs suggests they act through a common RNAi pathway. Nucleic Acids Res., 2003. 31(9): 2401–2407. 71. Crooke, R.M., In vitro toxicology and pharmacokinetics of antisense oligonucleotides. Anti-Cancer Drug Design, 1991. 6: 609–646. 72. Crooke, S.T., Oligonucleotide therapeutics, in Burger’s Medicinal Chemistry and Drug Discovery, Vol. 1, M.E. Wolff, ed., 1995, Wiley: New York, 863–900. 73. Crooke, S.T., Progress in antisense therapeutics. Hematol. Pathol., 1995. 9(2): 59–72. 74. Dominski, Z. and R. Kole, Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proceedings of the National Academy of Science USA, 1993. 90(18): 8673–8677. 75. Sazani, P. and R. Kole, Therapeutic potential of antisense oligonucleotides as modulators of alternative splicing. J. Clin. Invest., 2003. 112(4): 481–486. 76. Aartsma-Rus, A. et al., Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of SR protein binding sites. Oligonucleotides, 2005. 15(4): 284–97. 77. Mann, C.J. et al., Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene. Med., 2002. 4(6): 644–654. 78. Alter, J. et al., Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat. Med., 2006. 12(2): 175–177. 79. Gebski, B.L. et al., Morpholino antisense oligonucleotide induced dystrophin exon 23 skipping in mdx mouse muscle. Hum. Mol. Genet., 2003. 12(15): 1801–1811. 80. Williams, J.H. et al., Induction of dystrophin expression by exon skipping in mdx mice following intramuscular injection of antisense oligonucleotides complexed with PEG-PEI copolymers. Mol. Ther., 2006. 14(1): 88–96. 81. Taylor, J.K. et al., Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat. Biotechnol., 1999. 17(11): 1097–1100. 82. Mercatante, D.R., J.L. Mohler, and R. Kole, Cellular response to an antisense-mediated shift of Bcl-x pre-mRNA splicing and antineoplastic agents. J. Biol. Chem., 2002. 277(51): 49,374–49,382. 83. Sazani, P. et al., Systemically delivered antisense oligomers upregulate gene expression in mouse tissues. Nat. Biotechnol., 2002. 20(12): 1228–1233. 84. Vickers, T.A. et al., Modification of MyD88 mRNA splicing and inhibition of IL-1beta signaling in cell culture and in mice with a 2-O-methoxyethyl-modified oligonucleotide. J. Immunol., 2006. 176(6): 3652–3661. 85. Garcia-Blanco, M.A., A.P. Baraniak, and E.L. Lasda, Alternative splicing in disease and therapy. Nat. Biotechnol., 2004. 22(5): 535–546. 86. Roca, X., R. Sachidanandam, and A.R. Krainer, Determinants of the inherent strength of human 5 splice sites. RNA, 2005. 11(5): 683–698. 87. Wang, L. et al., Noncoding RNA danger motifs bridge innate and adaptive immunity and are potent adjuvants for vaccination. J. Clin. Invest., 2002. 110(8): 1175–1184. 88. Hodges, D. and S.T. Crooke, Inhibition of splicing of wild-type and mutated luciferase-adenovirus pre-mRNAs by antisense oligonucleotides. Mol. Pharmacol., 1995. 48(5): 905–918. 89. Cartegni, L. et al., ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res., 2003. 31(13): 3568–3571. 90. Ferro, P. et al., Alternative splicing of the human estrogen receptor alpha primary transcript: mechanisms of exon skipping. Int. J. Mol. Med., 2003. 12(3): 355–363. 91. Hua, Y. et al., Enhancement of alternative exon 7 inclusion in SMN2 by antisense 2MOE oligonucleotides targeting the exon. PLoS Bio., 2007. 5(4): 73. 92. Baker, B.F. et al., 2-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells. J. Biol. Chem., 1997. 272(18): 11,994–12,000.

CRC_8796_ch001.qxd

44

5/24/2007

21:54

Page 44


93. Alt, M. et al., Comparative inhibitory potential of differently modified antisense oligodeoxynucleotides on hepatitis C virus translation. Eur. J. Clin. Invest., 1999. 29(10): 868–876. 94. Brown-Driver, V. et al., Inhibition of translation of hepatitis C virus RNA by 2-modified antisense oligonucleotides. Antisense Nucleic Acid Drug Dev., 1999. 9(2): 145–154. 95. Azad, R.F. et al., Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediate-early region. Antimicrob. Agents Chemother., 1993. 37(9): 1945–1954. 96. Arora, V. et al., c-Myc antisense limits rat liver regeneration and indicates role for c-Myc in regulating cytochrome P-450 3A activity. J. Pharmacol. Exp. Ther., 2000. 292(3): 921–928. 97. Zhang, H. et al., Antisense oligonucleotide inhibition of hepatitis C virus (HCV) gene expression in livers of mice infected with an HCV-vaccinia virus recombinant. Antimicrob. Agents Chemother., 1999. 43(2): 347–353. 98. Hanecak, R. et al., Antisense oligonucleotide inhibition of hepatitis C virus gene expression in transformed hepatocytes. J. Virol., 1996. 70(8): 5203–5212. 99. Brown, E.A., et al., Secondary structure of the 5 nontranslated regions of hepatitis C virus and pestivirus genomic RNAs. Nucleic Acids Res., 1992. 20: 5041–5045. 100. Vickers, T. et al., Inhibition of HIV-LTR gene expression by oligonucleotides targeted to the TAR element. Nucleic Acids Res., 1991. 19(12): 3359–3368. 101. Ecker, D.J. et al., Pseudo-half-knot formation with RNA. Science, 1992. 257(5072): 958–961. 102. Saxena, S.K. and E.J. Ackerman, Microinjected oligonucleotides complementary to the alpha-sarcin loop of 28 S RNA abolish protein synthesis in Xenopus oocytes. J. Biol. Chem., 1990. 265(6): 3263–3269. 103. Walker, K., S.A. Elela, and R.N. Nazar, Inhibition of protein synthesis by anti-5.8 S rRNA oligodeoxyribonucleotides. J. Biol. Chem., 1990. 265(5): 2428–2430. 104. Westermann, P., B. Gross, and G. Hoinkis, Inhibition of expression of SV40 virus large T-antigen by antisense oligodeoxyribonucleotides. Biomed. Biochim. Acta., 1989. 48(1): 85–93. 105. Baker, B.F., L. Miraglia, and C.H. Hagedorn, Modulation of eukaryotic initiation factor-4E binding to 5-capped oligoribonucleotides by modified anti-sense oligonucleotides. J. Biol. Chem., 1992. 267(16): 11,495–11,499. 106. Vickers, T.A. et al., Fully modified 2-MOE oligonucleotides redirect polyadenylation. Nucleic Acids Res., 2001. 29: 1293–1299. 107. Crooke, S.T., Antisense strategies. Curr. Mol. Med., 2004. 4: 465–487. 108. Lima, W.F., H. Wu, and S.T. Crooke, Human RNases H, in Methods in Enzymology, A.W. Nicholson, ed., 2001, Academic Press: San Diego, pp. 430–440. 109. Wu, H. et al., Determination of the role of the human RNase H1 in the pharmacology of DNA-like antisense drugs. J. Biol. Chem., 2004. 279(17): 17,181–17,189. 110. Lima, W.F. et al., Human RNAse H1 discriminates between subtle variations in the structure of the heteroduplex substrate. Mol. Pharmacol. (in press). 111. Lima, W.F. et al., The postional influence of the helical geometry of the heteroduplex substrate on human RNase H1 catalysis. Mol. Pharmacol. (in press). 112. Wu, H., W.F. Lima, and S.T. Crooke, Investigating the structure of human RNase H1 by site-directed mutagenesis. J. Biol. Chem., 2001. 276(26): 23,547–23,553. 113. Grunweller, A. et al., Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2-O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Res., 2003. 31(12): 3185–3193. 114. Dean, N.M. et al., Pharmacology of 2-O-(2-methoxy)ethyl modified antisense oligonucleotides, in Antisense Drug Technology: Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker Inc.: New York, pp. 319–338. 115. Hardee, G.E., S.P. Weinbach, and L.G. Tilman, New routes and novel formulations for delivery of antisense oligonucleotides, in Antisense Drug Technology: Basic Principles, Strategies, and Applications, S.T. Crooke, ed., 2001, Marcel Dekker, Inc.: New York, pp. 795–832. 116. Monia, B.P. and N.M. Dean, Pharmacological activity of antisense oligonucleotides in animal models of disease, in Antisense Research and Application, S.T. Crooke, ed., 1998, Springer-Verlag: Berlin Heidelberg, pp. 427–443. 117. Wu, H., W.F. Lima, and S.T. Crooke, Molecular cloning and expression of cDNA for human RNase H. Antisense Nucleic Acid Drug Dev., 1998. 8(1): 53–61.

CRC_8796_ch001.qxd

5/24/2007

21:54

Page 45


45

118. Wu, H., W.F. Lima, and S.T. Crooke, Properties of cloned and expressed human RNase H1. J. Biol. Chem., 1999. 274(40): 28,270–28,278. 119. Siwkowski, A.M. et al., Effects of altering antisense oligonucleotide composition on distribution, metabolism, RNase H activity, and potency in mice. In preparation. 120. Overhoff, M. et al., Local RNA target structure influences siRNA efficacy: a systematic global analysis. J. Mol. Biol., 2005. 348(4): 871–881. 121. Kretschmer-Kazemi Far, R. and G. Sczakiel, The activity of siRNA in mammalian cells is related to structural target accessibility: a comparison with antisense oligonucleotides. Nucleic Acids Res., 2003. 31(15): 4417–4424. 122. Liu, J. et al., Argonaute2 is the catalytic engine of mammalian RNAi. Science, 2004. 305(5689): 1437–1441. 123. Haley, B. and P.D. Zamore, Kinetic analysis of the RNAi enzyme complex. Nat. Struct. Mol. Biol., 2004. 11(7): 599–606. 124. Hall, A.H. et al., RNA interference using boranophosphate siRNAs: structure-activity relationships. Nucleic Acids Res., 2004. 32(20): 5991–6000. 125. Prakash, T.P. et al., RNA interference by 2,5-linked nucleic acid duplexes in mammalian cells. Bioorg. Med. Chem. Lett., 2006. 16(12): 3238–3240. 126. Kraynack, B.A. and B.F. Baker, Small interfering RNAs containing full 2-O-methylribonucleotidemodified sense strands display Argonaute2/eIF2C2-dependent activity. RNA, 2006. 12(1): 163–176. 127. Dande, P. et al., Improving RNA interference in mammalian cells by 4-thio-modified small interfering RNA (siRNA): effect on siRNA activity and nuclease stability when used in combination with 2-O-alkyl modifications. J. Med. Chem., 2006. 49(5): 1624–1634. 128. Prakash, T.P. et al., Positional effect of chemical modifications on short interference RNA activity in mammalian cells. J. Med. Chem., 2005. 48(13): 4247–4253. 129. Chiu, Y.L. and T.M. Rana, siRNA function in RNAi: a chemical modification analysis. RNA, 2003. 9(9): 1034–1048. 130. Semizarov, D. et al., Specificity of short interfering RNA determined through gene expression signatures. Proceedings of the National Academy of Science USA, 2003. 100(11): 6347–6352. 131. Semizarov, D., P. Kroeger, and S. Fesik, siRNA-mediated gene silencing: a global genome view. Nucleic Acids Res., 2004. 32(13): 3836–3845. 132. Lin, X. et al., siRNA-mediated off-target gene silencing triggered by a 7 nt complementation. Nucleic Acids Res., 2005. 33(14): 4527–4535. 133. Birmingham, A. et al., 3 UTR seed matches, but not overall identity, are associated with RNAi offtargets. Nat. Meth., 2006. 3(3): 199–204. 134. Jackson, A.L. et al., Expression profiling reveals off-target gene regulation by RNAi. Nat. Biotechnol., 2003. 21(6): 635–637. 135. Scacheri, P.C. et al., Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proceedings of the National Academy of Science USA, 2004. 101(7): 1892–1897. 136. Fedorov, Y. et al., Off-target effects by siRNA can induce toxic phenotype. RNA, 2006. 12: 1–9. 137. Jackson, A.L. et al., Position-specific chemical modification of siRNAs reduces “off-target” transcript silencing. RNA, 2006. 12: 1197–1205. 138. Lippman, Z. and R. Martienssen, The role of RNA interference in heterochromatic silencing. Nature, 2004. 431(7006): 364–370. 139. Noma, K. et al., RITS acts in cis to promote RNA interference-mediated transcriptional and post-transcriptional silencing. Nat. Genet., 2004. 36(11): 1174–1180. 140. Cam, H.P. et al., Comprehensive analysis of heterochromatin- and RNAi-mediated epigenetic control of the fission yeast genome. Nat. Genet., 2005. 37(8): 809–819. 141. Schramke, V. et al., RNA-interference-directed chromatin modification coupled to RNA polymerase II transcription. Nature., 2005. 435(7046): 1275–1279. 142. Sugiyama, T. et al., RNA-dependent RNA polymerase is an essential component of a self-enforcing loop coupling heterochromatin assembly to siRNA production. Proceedings of the National Academy of Science USA, 2005. 102(1): 152–157. 143. Volpe, T.A. et al., Regulation of heterochromatic silencing and histone H3 lysine-9 methylation by RNAi. Science, 2002. 297(5588): 1833–1837.

CRC_8796_ch001.qxd

46

5/24/2007

21:54

Page 46


144. Morris, K.V. et al., Small interfering RNA-induced transcriptional gene silencing in human cells. Science, 2004. 305(5688): 1289–1292. 145. Robb, G.B. et al., Specific and potent RNAi in the nucleus of human cells. Nat. Struct. Mol. Biol., 2005. 12(2): 1–4. 146. Song, E. et al., RNA interference targeting Fas protects mice from fulminant hepatitis. Nat. Med., 2003. 347–351. 147. Allerson, C.R., N. Sioufi, R. Jarres, T.P. Prakash, N. Naik, A. Berdeja, L. Wanders, R. Griffey, E.E. Swayze, and B. Bhat, Fully 2-modified oligonucleotide duplexes with improved in vitro potency and stability compared to unmodified small interfering RNA. J. Med. Chem., 2005 (in press). 148. Song, E. et al., Antibody mediated in vivo delivery of small interf RNAs via cell-surface receptors. Nat. Biotechnol., 2005. 23(6): 709–717. 149. Morrissey, D.V. et al., Potent and persistent in vivo anti-HBV activity of chemically modified siRNAs. Nat. Biotechnol., 2005. 23(8): 1002–1007. 150. Zimmermann, T.S. et al., RNAi-mediated gene silencing in non-human primates. Nature, 2006. 441(7089): 111–114. 151. Soutschek, J. et al., Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature, 2004. 432(7014): 173–178. 152. Crooke, S.T. et al., Pharmacokinetic properties of several novel oligonucleotide analogs in mice. J. Pharmacol. Exp. Ther., 1996. 277(2): 923–937. 153. Henry, S.P. et al., Toxicological properties of several novel oligonucleotide analogs in mice. AntiCancer Drug Des., 1997. 12(1): 1–14. 154. Elbashir, S.M. et al., Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 2001. 411: 494–498. 155. Martinez, J. et al., Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell, 2002. 110: 563–574. 156. Xu, Y. et al., Functional comparison of single- and double-stranded siRNAs in mammaliam cells. Biochem. Biophys. Res. Comm., 2004. 316: 680–687. 157. Reynolds, A. et al., Rational siRNA design for RNA interference. Nat. Biotechnol., 2004. 22(3): 326–30. 158. Kim, D.-H. et al., Synthetic dsRNA Dicer substrates enhance RNAi potency and efficacy. Nat. Biotechnol., 2005. 23(2): 222–226. 159. Bridge, A.J. et al., Induction of an interferon response by RNAi vectors in mammalian cells. Nat. Genet., 2003. 34(3): 263–264. 160. Torrence, P.F. et al., Develpoment of 2,5 oligonucleotides as potential therapeutic agents. Curr. Med. Chem., 1994. 1: 176–191. 161. Nakanishi, M. et al., Functional characterization of 2,5-linked oligoadenylate binding determinant of human RNase L. J. Biol. Chem., 2005. 280(50): 41,694–41,699. 162. Leaman, D.W. et al., Targeted therapy of respiratory synctial virus in African green monkeys by intranasally administered 2-5A antisense. Virology, 2002. 292: 70–77. 163. Kim, V.N. and J.W. Nam, Genomics of microRNA. Trends Genet., 2006. 22(3): p. 165–73. 164. Krutzfeldt, J. et al., Silencing of microRNAs in vivo with ‘antagomirs.’ Nature, 2005. 438(7068): 685–689. 165. Esau, C. et al., miR-122 regulation of lipid metabolism revealed by in vivo antisense targeting. Cell Metab., 2006. 3(2): p. 87–98. 166. Davis, S. et al., Improved targeting of miRNA with antisense oligonucleotides. Nucleic Acids Res., 2006. 34(8): 2294–2304. 167. Grimm, D. et al., Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature, 2006. 441(7092): 537–541. 168. Jakymiw, A. et al., Disruption of GW bodies impairs mammalian RNA interference. Nat. Cell Biol., 2005. 12: 1267–1274. 169. Orban, T.I. and E. Izaurralde, Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA, 2005. 11(4): 459–469. 170. Liu, J. et al., MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat. Cell Biol., 2005. 7(7): 719–723. 171. Wu, L., J. Fan, and J. Belasco, MicroRNAs direct rapid deadenylation of mRNA. Proceedings of the National Academy of Science USA, 2006. 11: 4034–4039. 172. Petersen, C. et al., Short RNAs repress translation after initiation in mammalian cells. Mol. Cell., 2006. 4: 533–542.

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 47

CHAPTER

2

The RNase H Mechanism Walt Lima, Hongjiang Wu, and Stanley T. Crooke

CONTENTS 2.1

Introduction.............................................................................................................................47 2.1.1 ASO Terminating Mechanisms ..................................................................................47 2.1.2 RNase H Enzymes......................................................................................................48 2.1.3 Human RNases H .......................................................................................................48 2.2 Human RNase H1...................................................................................................................49 2.2.1 Biochemical Properties...............................................................................................49 2.2.2 Structure and Enzymology .........................................................................................49 2.2.2.1 RNA-Binding Domain ................................................................................50 2.2.2.2 Catalytic Domain.........................................................................................52 2.2.3 Biological Roles .........................................................................................................55 2.2.4 Genomics and Regulation...........................................................................................56 2.3 Human RNase H2...................................................................................................................56 2.3.1 Structure and Enzymology .........................................................................................56 2.3.2 Biological Roles .........................................................................................................61 2.3.3 Genomics and Regulation...........................................................................................63 2.4 The Roles of the Human RNases H in the Effects of DNA-Like ASOs................................63 2.5 The Effects of Chimeric ASOs on Human RNase H1 Activity .............................................65 2.6 Implications for Antisense Therapeutics ................................................................................70 References ........................................................................................................................................71

2.1 INTRODUCTION 2.1.1

ASO Terminating Mechanisms

Antisense oligonucleotides (ASOs) are designed to modulate the information transfer from gene to protein—in essence to alter mRNA intermediary metabolism. mRNA intermediary metabolism is extremely complex beginning with transcription and concluding with degradation usually after translation. Each step is complex and in dynamic equilibrium with competing pathways. Although great progress has been made in understanding these processes, much remains unknown, and we

47

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

48

Page 48


have only begun to understand the potential impacts of ASOs on these processes and the factors that influence the outcomes. Once ASOs bind to a target RNA, they may induce pharmacological effects by one of two mechanisms: occupancy or occupancy-mediated destabilization [1–3]. Occupancy only mediated mechanisms include alteration of splicing, inhibiting of translation, and the disruption of required RNA structure and miRNA-induced gene silencing. Occupancy-mediated destabilization includes degradation of the target RNA by single- and double-stranded RNases. RNases H are enzymes that cleave the target RNA when bound in a DNA–RNA duplex. In addition, there are double-strand RNases that recognize RNA–RNA duplexes and cleave the target RNA. For example, the RISC endonuclease Argonaute2 combined with the antisense strand of siRNA, cleaves target mRNA at the sequence complementary to the siRNA [4,5]. This enzyme may also be involved in the activity of single-strand RNA-like ASOs. Thanks to the substantial progress reported in understanding the human RNases H, their roles in the effects of DNA-like ASOs, and the factors that influence the activities of DNA-like ASOs; today, we have the intellectual framework for the design of optimized RNase H-active ASOs. In this report, we shall review the progress in this area and discuss the implications of the observations on the design of more potent ASO therapeutics. 2.1.2

RNase H Enzymes

The RNases H hydrolyze RNA in RNA–DNA hybrids [6]. RNase H belongs to a nucleotidyl transferase super family, which includes transposase, retroviral integrase, Holliday junction resolvase, and the RISC nuclease Argonaute2. Proteins with RNase H activity have been isolated from numerous organisms ranging from viruses to mammalian cells and tissues [7–12]. Although RNase H isotypes vary substantially in molecular weight and associated functions, the nuclease properties of the enzymes are similar. All RNase H enzymes, for example, function as endonucleases exhibiting limited sequence specificity, require divalent cations (e.g., Mn2⫹ and Mg2⫹), and generate products with 5⬘-phosphate and 5⬘-hydroxyl termini [8]. In prokaryotes, three classes of RNase H enzymes, RNase H1, H2, and H3, have been identified. RNase H2 and H3 share significant sequence homology, whereas RNase H3 and RNase H1 share similar divalent cation preference and cleavage properties. Of the three classes, RNase H2 appears to be the most ubiquitous [13]. To date no organism has been shown to express active forms of all three classes of RNase H. The best characterized of the prokaryotic enzymes is Escherichia coli RNase H1 [14–18]. This enzyme is believed to be involved in DNA replication [19]. The key amino acids involved in metal binding, substrate binding, and catalysis have been identified and are highly conserved in the RNase H1 family [14,20–22]. Furthermore, the enzyme–substrate interaction has been determined based on the X-ray cocrystal structure for Bacillus halodurans RNase H1 and the heteroduplex substrate [23]. RNase H has also been shown to be involved in viral replication. RNase H domains have been identified in viral reverse transcriptases, and these typically share homology with E. coli RNase H1 [20]. The RNase H portion of the enzyme has been shown to cleave the viral RNA strand producing RNA primers for second-strand DNA synthesis, thereby converting the viral RNA into double-strand DNA [24]. Two classes of RNase H enzymes have been identified in mammalian cells [7,9–12]. They were reported to differ with respect to cofactor requirements and activity. For example, RNase H type 1 has been shown to be activated by both Mg2⫹ and Mn2⫹, and was active in the presence of sulfhydryl reagents, whereas RNase H type 2 was shown to be activated by only Mg2⫹ and inhibited by Mg2⫹ and sulfhydryl reagents [12]. 2.1.3

Human RNases H

Both human RNase H genes have been cloned and expressed [21–22,25]. RNase H1 is a 286 amino acid (aa) protein with a calculated mass of 32 kDa [22]. The enzyme is encoded by a single

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 49

THE RNase H MECHANISM

49

gene that is at least 10 kb in length and is expressed ubiquitously in human cells and tissues. The amino acid sequence of human RNase H1 displays strong homology with RNase H1 from yeast, chicken, E.coli, and mouse [22]. The human RNase H2 enzyme is a 299 aa protein with a calculated mass of 33.4 kDa and has also been shown to be ubiquitously expressed in human cells and tissues ([25]; H. Wu, unpublished data). Human RNase H2 shares strong amino acid sequence homology with RNase H2 from Caenorhabditis elegans, yeast, and E. coli [25].

2.2 HUMAN RNase H1 2.2.1

Biochemical Properties

Human RNase H1 has been cloned, expressed, and purified to electrophoretic homogeneity. The enzyme is active as a single polypeptide and retains activity after it is denatured and refolded [22,26]. The activity of RNase H1 is Mg2⫹-dependent and inhibited by Mn2⫹. Human RNase H1 was also inhibited by increasing ionic strength with optimal activity for both KCl and NaCl observed at 10–20 mM [22,26]. The enzyme exhibited a bell-shaped response to divalent cations and pH, with the optimum conditions for catalysis observed to be 1 mM Mg2⫹ and pH 7–8 [22,26]. The protein was shown to be reversibly denatured under the influence of temperature and destabilizing agents such as urea. Renaturation of human RNase H1 was observed to be highly cooperative and did not require divalent cations. Furthermore, RNase H1 displayed no tendency to form intermolecular disulfides or to form homomultimers. Human RNase H1 was shown to bind selectively to “A-form” duplexes with 10–20-fold greater affinity than that observed for E. coli RNase H1 [22,26]. Finally, human RNase H1 displays a strong positional preference for cleavage, that is, the enzyme cleaves between 8 and 12 nucleotides from the 5⬘-RNA–3⬘-DNA terminus of the duplex [26]. One biochemical property that has been used to classify RNase H enzymes is the sensitivity to sulfhydryl alkylating reagents such as N-ethylmaleimide (NEM) [12,14,22,27]. In general, RNase H1 enzymes are inhibited by NEM and both the E.coli and human enzymes share this property. In the case of E. coli RNase H1, NEM alkylation of C13 and C133 was responsible for the observed loss in enzymatic activity [14]. Alkylation of the cysteines was predicted to sterically interfere with substrate binding, as the E.coli enzyme was shown to be active under both reduced and oxidized conditions and the cysteine residues were not required for endonuclease activity [14]. A similar NEM alkylation pattern was observed for human RNase H1 with alkylation of the conserved C148 (C13 in the E. coli enzyme) resulting in the observed loss in activity (Figure 2.1) [28]. In addition, NEM alkylation of human RNase H1 had no effect on the binding affinity of the enzyme for the substrate. Given that C148 is positioned close to the catalytic site of the enzyme and the phosphate backbone of the substrate, NEM alkylation likely interferes with proper positioning of the enzyme on the substrate. Human RNase H1 is active only under reduced conditions [28]. Site-directed mutagenesis of human RNase H1 indicated that the conserved C148 and adjacent C147 residues were responsible for the observed redox-dependent activity of the enzyme (Figure 2.1) [28]. Tryptic digestion of the enzyme and analysis of the fragments by HPLC-ESI-FITCR mass spectrometry revealed a unique disulfide bond between the vicinal C147 and C148 residues under oxidized conditions [28]. Oxidation of the enzyme had no effect on the binding affinity of the enzyme for the substrate suggesting that the oxidized enzyme exhibited a conformation that could no longer catalyze the hydrolysis of the RNA. 2.2.2

Structure and Enzymology

The structure of human RNase H1 consists of three domains: a 73-aa region homologous with the RNA-binding domain (RNA-BD) of yeast RNase H1 at the amino-terminus of the protein, the conserved catalytic domain at the carboxy-terminus of the protein, and a 62-aa spacer region that

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 50

50

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION E186 W43 K59-K60

RNA-binding

1

Figure 2.1

C18

C46

D145

Spacer

73

K226-K227 K236 D210 K231

Catalytic

135 C147-C148 C191

286

Schematic showing the structure of human RNase H1. Enzyme consists of three domains. The 73-aa RNA-BD at the amino-terminus of the protein contains the tryptophan and lysine residues involved substrate binding at, respectively, positions 43, 59, and 60 as well as two cysteines at positions 18 and 46. The 62-aa spacer region is positioned between the RNA-BD and the catalytic domain. The 151-aa catalytic domain at the carboxy-terminus of the enzyme contains the glutamic and aspartic acid residues of the catalytic triad at positions 145, 186, and 210; the basic substrate-binding residues at positions 226, 227, 231, and 236; and the cysteines of the redox switch at positions 147 and 148.

separates the RNA-BD from the catalytic domain (Figure 2.1) [29–31]. The roles of each of the regions and a number of the specific amino acids were determined by site-directed mutagenesis of both the enzyme and substrate [26,29,32–35]. Although the specific role of the spacer region remains unclear, this region was shown to be required for the activity [29,36].

2.2.2.1 RNA-Binding Domain The RNA-BD of human RNase H1 is conserved in other eukaryotic RNases H1 [22,31]. The nuclear magnetic resonance (NMR) structure of the RNA-BD of Saccharomyces cerevisiae RNase H1 consists of a three-stranded antiparallel -sheet sandwiched between two -helices and shares strong structural similarities with the N-terminal domain of the ribosomal RNA-binding protein L9 [31,37]. Two highly conserved lysine residues are located within the third -strand. In addition, a highly conserved tryptophan at position 22 was shown to project outwards. A solvent exposed aromatic amino acid at this position was also observed in the L9 protein and has been shown to be important for binding to 23S ribosomal RNA [37]. In a 46 aa peptide corresponding to the RNA-BD of S. cerevisiae RNase H1, the conserved lysine residues have been shown to be important for binding to the heteroduplex substrate [30]. Site-directed mutagenesis of human RNase H1 showed that the conserved lysine residues at positions 59 and 60 were involved in binding to the heteroduplex substrate (Figure 2.1) [36]. Alanine substitution of the Lys59 (K59A) and Lys60 (K60A) resulted in a twofold reduction in the binding affinity for the substrate compared with the wild-type enzyme. Alanine substitution of the conserved tryptophan residue (W43A), in contrast, had no effect on the binding affinity for the substrate but exhibited a significantly lower Km and kcat values compared with the wild-type enzyme (Table 2.1) [36]. The lower Km and kcat values for the mutant enzyme are indicative of nonproductive binding interactions between the enzyme and the substrate suggesting that the tryptophan is important for properly positioning the enzyme on the heteroduplex for catalysis. Importantly, human RNase H1 has been shown to exhibit a strong positional preference for cleavage cleaving the heteroduplex substrate 7–12 nucleotides from the 3⬘-DNA/5⬘-RNA terminus (Figure 2.2) [26]. Under single turnover conditions, the positional preference for cleavage was more pronounced suggesting that given a single interaction between human RNase H1 and the heteroduplex, the majority of the RNase H1 proteins bound to the heteroduplex in such a manner so as to cleave the substrate 7–10 nucleotides from the 5⬘-RNA [36]. Mutants in which W43 and K59–K60 of the RNA-BD were substituted with alanine, showed a loss of the positional preference for cleavage (Figure 2.2) [36]. Together these data suggest that the W43, K59, and K60

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 51


51

Table 2.1 Initial Cleavage Rates for Wild-Type and Mutant Human RNase H1 Proteins Human Enzyme RNase RNase RNase RNase

H1 H1[K59,60A] H1[W43A] H1[W43/K59.60A]

kcat (min⫺1)

Km (nM) 601 1264 129 1084

⫾ ⫾ ⫾ ⫾

42 88 4 96

1.46 1.00 0.04 1.19

⫾ ⫾ ⫾ ⫾

0.05 0.08 0.001 0.11

kcat/Km (M⫺1/min) (2.4 ⫾ 0.04) (7.9 ⫾ 0.6) (3.0 ⫾ 0.2) (8.8 ⫾ 0.1)

⫻ ⫻ ⫻ ⫻

6

10 105 105 105

Kd (nM) 665 1121 412 1556

⫾ ⫾ ⫾ ⫾

13 136 67 119

Note: The kcat, Km, and Kd values were determined as previously described [36]. The kcat, Km, and Kd values are an average of n ⱖ 2 slopes of Lineweaver–Burk and/or Augustisson analysis with estimated errors of CV ⬍ 10%. (A)

r(GGGCGCCGUCGGUGUGG) d(CCCGCGGCAGCCACACC) (B)

r(GGGCGCCGUCGGUGUGG) d(CCCGCGGCAGCCACACC) Figure 2.2

Comparison of cleavage patterns for human and E. coli RNases H1. Digestion of the heteroduplex was performed as previously described [29]. The RNA sequence (5⬘ → 3⬘) is shown above the DNA sequence. The arrows indicate the sites of enzymatic digestion, and the size of the arrows reflects the relative cleavage intensities. (A) Cleavage pattern for human RNase H1. (B) Cleavage pattern for E. coli RNase.

residues constitute an extended nucleic-binding surface for the RNA-BD of the human RNase H1 with the lysine residues forming electrostatic interactions with the phosphate backbone and the solvent-exposed tryptophan forming either stacking interactions or hydrogen bonds with the heterocycle bases of the substrates [36]. In addition, these data suggest that the interaction between the RNA-BD and the substrate takes place at the 3⬘-DNA/5⬘-RNA pole of the heteroduplex (Figure 2.3). Structure–activity relationships at the 3⬘-DNA/5⬘-RNA terminus of the heteroduplex substrate have also been performed. These studies include modifications at the 3⬘, 2⬘, and heterocycle base of the terminal 3⬘-nucleotide in the DNA strand as well as modifications at the 5⬘ and 2⬘ of the terminal 5⬘-nucleotide in the RNA strand [36]. Heteroduplex substrates containing a 3⬘-phosphate at the 3⬘-terminus of the DNA strand or 5⬘-phosphate at the 5⬘-terminus of the RNA strand had no effect on either the cleavage pattern or rate of cleavage compared with the substrate containing hydroxyl groups at the 3⬘-DNA/5⬘-RNA terminus [36]. In contrast, a single ribonucleotide or 2⬘-methoxyethyl (MOE) substitution at the 3⬘-terminus of the DNA strand, with or without a 3⬘-phosphate, resulted in the ablation of the 5⬘-most cleavage site (Figure 2.3). A similar ablation of the 5⬘-most cleavage site was observed for a heteroduplex substrate in which a mismatched base pair was positioned at the 3⬘-DNA/5⬘-RNA terminus [36]. Similarly, heteroduplex substrates in which the DNA strand was successively truncated at the 3⬘-terminus resulted in a concomitant ablation of the 5⬘-most cleavage with a constant 7 base pair separation between the 3⬘-terminus of the DNA and 5⬘-most cleavage site [36]. Conversely, no shift in the cleavage pattern was observed for heteroduplex substrates in which the DNA strand was successively truncated at the 5⬘-terminus. The structure–activity relationships for the 3⬘-DNA/5⬘-RNA terminus of the heteroduplex are consistent with the site-directed mutagenesis of the RNA-BD in which stable base pairing at the 3⬘-DNA/5⬘-RNA terminus would be important for intercalation of the

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 52

52

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION (A)

Spacer RNABD

Cat

5′ 3′

7 base pairs

(B)

Spacer RNABD

Cat

5′ 3′

7 base pairs Figure 2.3

Schematic illustrating the relationship between the position of the RNA-binding domain and the catalytic domain of human RNase H1 on the heteroduplex substrate. (A) Each observed cleavage site on the RNA is coupled to a specific binding interaction between the RNA-binding domain and the 3⬘-DNA/5⬘-RNA pole of the heteroduplex substrate. The distance between the heteroduplex/RNAbinding domain interaction and the catalytic site is ⬃7 base pairs. (B) Crossed-out box represents either an RNA/RNA, 2⬘-MOE/RNA or mismatched base pair at the 3⬘-DNA/5⬘-RNA terminus of the heteroduplex. The alteration in helical geometry or steric interference by the 2⬘-substitutents disrupts the binding interaction between the RNA-binding domain and the heteroduplex resulting in the observed ablation of catalytic activity at the 5⬘-most cleavage site on the RNA.

W43 residue, and the interstrand phosphate distance across the minor groove within this region would be critical for the interaction with K59 and K60 [36]. Taken together these data suggest that the RNA-BD of human RNase H1 binds to the first stable 3⬘-DNA/5⬘-RNA base pair in the heteroduplex substrate and positions the catalytic domain approximately one helical turn 5⬘ on the RNA (Figure 2.3).

2.2.2.2 Catalytic Domain The catalytic domain of human RNase H1 is highly conserved relative to other RNase H1 proteins [15–17,29,38]. The glutamic acid and two aspartic acid residues of the catalytic site, as well as the histidine and aspartic acid residues of the proposed second divalent cation-binding site of the E. coli enzyme are conserved in human RNase H1 (Figure 2.1) [15–17,38]. In addition, the lysine residues within the highly basic -helical substrate-binding region of E. coli RNase H1 are also conserved in the human enzyme (Figure 2.1). The substitution of the conserved catalytic amino acids Asp-145, Glu-186, and Asp-210 of human RNase H1 with respectively, Asn, Gln, and Asn resulted in the complete ablation of the catalytic activity [29]. Furthermore, the ablation of cleavage activity observed for the catalytic site mutations did not appear to be due to a loss in the binding affinity for the heteroduplex substrate, as these substitutions had no effect on the binding affinity of the mutant proteins for the heteroduplex substrate. Alanine substitution of as few as two lysine residues in the basic substrate-binding region of the catalytic domain (e.g., lysines at positions 226, 227, 231, and 236)

CRC_8796_ch002.qxd

6/20/2007

9:30 PM


Page 53

53

ablated the activity of human RNase H1 [29]. Again, the basic substrate-binding mutants exhibited binding affinities for the substrate comparable to the wild-type enzyme, suggesting that other regions of the human enzyme may be contributing to the overall binding interaction and that the lysine residues may play a more critical role in properly positioning the enzyme on the substrate for cleavage. In fact, the binding affinity for the deletion mutant of human RNase H1 in which the RNA-BD was deleted was fivefold lower compared with the wild-type enzyme [29]. In addition, the catalytic rate for the mutant enzyme without the RNA-BD was twofold faster than the kcat observed for the wild-type enzyme [29]. The deletion mutant demonstrates that the RNA-binding domain increases the affinity for substrate and reduces catalytic efficiency. Structure–activity relationships at the catalytic site of the heteroduplex substrate have also been determined [35]. In this study, modified nucleotides were introduced into the oligodeoxyribonucleotides at the human RNase H1-preferred cleavage sites on the heteroduplex. The modifications consisted of nucleotides exhibiting RNA-like northern, DNA-like southern, and eastern-biased sugars with and without 2⬘-substitutents. In addition, varying degrees of conformational flexibility were introduced into the heteroduplex substrate by incorporating base modifications which -stack with adjacent nucleotides but do not form hydrogen bonds, abasic deoxynucleotides, internucleotide hydrocarbon linkers ranging from three to five residues, and ganciclovir substitution of the deoxyribose. Heteroduplexes containing modifications exhibiting strong northern (e.g., 2⬘-fluorothymidine and 2-thiouridine) or southern (e.g., 2⬘-methylthiothymidine) conformational biases with and without bulky 2⬘-subtituents showed significantly slower site-specific cleavage rates for the ribonucleotide opposing the modification as well as the adjacent ribonucleotides. The nucleotide modifications predicted to mimic the sugar pucker of the deoxyribonucleotide of an RNA/DNA heteroduplex (e.g., heteroduplexes containing the 2⬘-ara-fluoropyrimidines and pseudouridine modifications) exhibited cleavage rates comparable to the rates observed for the unmodified substrate [35]. The 2⬘-ara-fluoro modification has been shown by NMR to form the eastern O4⬘-endo sugar conformation similar to DNA when hybridized to RNA [39]. In addition, the size and position of the 2⬘-ara-substituent, that is, the fluorine is directed upward and away from the minor groove, is predicted not to sterically interfere with the enzyme. These modified heteroduplexes, which suggest variations in minor groove width as a function of sugar conformation, appear to obviate the proper positioning of the enzyme on the heteroduplex substrate. Modifications imparting the greatest degree of conformational flexibility were the poorest substrates, resulting in dramatically slower cleavage rates for the ribonucleotide opposing the modification and the surrounding ribonucleotides. Specifically, heteroduplex substrates containing highly flexible hydrocarbon linkers were among the poorest substrates for RNase H1 activity [35]. The site-specific rates for the ribonucleotide opposing the hydrocarbon linkers as well as the surrounding 3⬘- and 5⬘-ribonucleotides were either significantly reduced or ablated resulting in initial cleavage rates (V0), approximately twofold slower than the unmodified substrate. Heteroduplex substrates containing ganciclovir-, abasic-, and tetrahydrofuran-modified deoxyribonucleotides were also poor substrates for human RNase H1, although the site-specific cleavage rates for these heteroduplexes were slightly faster than the rates observed for the heteroduplexes containing the hydrocarbon linkers [35]. In contrast, the base modifications that -stack with adjacent nucleotides, but do not form hydrogen bonds with the bases of the RNA strand (e.g., 2-fluoro-6-methylbenzoimidazole, 4-methylbenzoimidazole, and 2,4-difluorotoluyl deoxyribonucleotides), better supported human RNase H1 activity. Comparable initial cleavage rates and site-specific cleavage rates were observed for these heteroduplexes compared with the unmodified substrate [35]. Although conformational flexibility of the deoxyribose was preferred, flexibility in the phosphate backbone of the DNA strand inhibited human RNase H1 activity. These data suggest that proper positioning of the phosphate groups

CRC_8796_ch002.qxd

6/20/2007

54

9:30 PM

Page 54


of the deoxyribonucleotide, presumably for electrostatic contact with the enzyme, is essential for human RNase H1 catalysis. The cleavage rates observed for the -stacking deoxyribonucleotides suggest that stable base stacking independent of hydrogen bond formation between the bases at the catalytic site appeared to offer sufficient rigidity to the phosphate backbone. Taken together these data suggest that sugar conformation, minor groove width, and the relative positions of the intra- and internucleotide phosphates are critical determinants in the selective recognition of the heteroduplex substrate by human RNase H1. In addition, the structure–activity relationships at the catalytic site of the heteroduplex substrate suggest that the preferred properties for the modified oligodeoxyribonucleotide include (1) a conformationally flexible sugar producing an O4⬘-endo pucker when hybridized to RNA; (2) no sterically bulky 2⬘-substituents; and (3) a conformationally rigid phosphate backbone. Clearly, the 2⬘-ara-fluoro-, pseudouridine-, and -stacking-modified deoxyribonucleotides exhibit many of these qualities. The recent X-ray crystal structure of RNase H from B. halodurans bound to the RNA/DNA heteroduplex substrate offers further insights into the observed effects of modified nucleotides on human RNase H1 catalysis [23]. Specifically, the catalytic domain of the enzyme was shown to interact with both the RNA and DNA strands of the heteroduplex substrate including the phosphates of the RNA strand on either sides of the scissile phosphate; the three 2⬘-hydroxyls upstream; and three 2⬘-hydroxyls downstream of the scissile phosphate; the heterocycle bases of both strands upstream of the scissile phosphate; and the DNA backbone upstream of the cleavage site via a phosphate-binding pocket (Figure 2.4). In all, the binding interactions between the enzyme and substrate comprise six base pairs of the heteroduplex substrate. The catalytic domain of human RNase H1 shares strong sequence homology with the catalytic domain of the B. halodurans RNase H, suggesting that human RNase H1 likely interacts in a similar manner with the heteroduplex substrate. Considering the scope of the interactions, modified nucleotides within the DNA strand of the heteroduplex can affect catalysis in a number of different ways. For example, the modified nucleotides could have a direct effect on catalysis if the modifications were positioned at sites on the substrate that interact directly with the enzyme (e.g., modified internucleotide linkages positioned at the phosphate-binding pocket of the enzyme) (Figure 2.4). In addition, modified nucleotides that influence the local substrate structure would have a local effect on catalysis when positioned adjacent to the nucleotides that directly interact with the enzyme (e.g., hydrophobic base modifications) (Figure 2.4). Finally, modified nucleotides that exert a long-range influence on substrate structure would exhibit a distributive or transmission effect on catalysis (e.g., northern- or southern-biased 2⬘-modifications positioned outside the footprint of the enzyme) (Figure 2.4).

3′

5′

5′

3′ PO-binding pocket Figure 2.4

Model for the interaction of RNase H1 with the heteroduplex substrate. The putative enzyme/nucleotide interactions for cleavage at ribonucleotide 7. The arrow indicates the position of the scissile phosphate. Heteroduplex is shown with the RNA strand (upper) oriented from 5⬘ to 3⬘ and the ASO (lower) from 3⬘ to 5⬘. The dark gray and light gray structures indicate the interactions between the enzyme and, respectively, the sugars of the nucleotides and heterocycle bases. The black filled circles represent the enzyme/phosphate interactions.

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 55


2.2.3

55

Biological Roles

Human RNase H1 is ubiquitously expressed in the cell, residing in both the nucleus and cytoplasm [40]. Important insights into the biological roles of mammalian RNase H1 have recently been provided by an RNase H1 knockout mouse [41]. The knockout was embryonically lethal and failed to produce mitochondrial DNA resulting in defective mitochondria and massive apoptosis. Both the mouse and human enzyme have a putative mitochondrial localization signal (MLS). Thus, the authors concluded that the enzyme is likely involved in Okazaki fragment processing in the mitochondria. The biochemical and enzymological data are consistent with the proposed biological role of the enzyme. The enzyme is believed to participate in the generation and/or removal of RNA primers during lagging strand DNA synthesis. These RNA primers form chimeric structures consisting of a 7–14 ribonucleotide region at the 5⬘-terminus and contiguous stretches of DNA extending in the 3⬘-direction (Figure 2.5) [42]. On the basis of the positional preference for cleavage exhibited by human RNase H1, cleavage of the chimeric structure would occur at or near the RNA–DNA junction, effectively removing the RNA primer (Figure 2.5). Alternatively, human RNase H1 cleavage of the RNA/DNA heteroduplex formed during DNA replication would produce the observed 7–14 ribonucleotide primers for lagging strand DNA synthesis. The human RNase H1 activity observed for Okazaki-like substrates was consistent with the proposed biological role for the enzyme [43]. The Okazaki-like substrates consisted of an oligodeoxyribonucleotide annealed to a complementary RNA/DNA chimeric oligonucleotide containing 10 and 15 ribonucleotides at the 5⬘-pole and, respectively, 10 and 5 contiguous deoxyribonucleotides extending 3⬘. The Okazaki-like substrates ablated the 3⬘-most cleavage sites and exhibited enhanced cleavage rates for the remaining cleavage sites. In other words, the successive ablation of the 3⬘-most cleavage sites produced new preferred cleavage sites [43]. Furthermore, given that the short RNA primers are interspersed within long stretches of dsDNA, the model for the interaction between the enzyme and the heteroduplex substrate correlates well with biological role for the enzyme. First, the strong positional preference for cleavage is consistent with the length of the RNA primers. Second, human RNase H1 binds the RNA/DNA heteroduplex ⬃50-fold tighter than dsDNA suggesting that the enzyme would not be trapped in nonproductive interactions within the large field of dsDNA [26]. Third, the limited sequence discrimination exhibited by the enzyme would be beneficial given that the RNA primers comprise mixed sequences. Finally, given that high concentrations of proteins and their cofactors such as manganese superoxide dismutase (SOD2) are required to regulate the highly oxidative environment of the mitochondria, human RNase H1 may have evolved a sensitivity to manganese as well as a redox switch to regulate the activity of the enzyme within this environment.

RNA primer

Lagging strand

5′ Okazaki fragment

RNA primer 5′

Okazaki fragment

Okazaki fragment

Leading DNA strand Figure 2.5

Schematic illustrating the position of human RNase H1 cleavage during lagging strand DNA synthesis. Upper and lower lines represent, respectively, the lagging and leading DNA strands. Lagging strand contains the 7–12 nucleotide RNA primers interdispersed between 200 and 300 nucleotide long Okazaki fragments. Arrows indicate the predicted human RNase H1 cleavage sites based on the positional preference for cleavage exhibited by the enzyme, that is, 7–12 nucleotides from the 5⬘-terminus of the RNA. Human RNase H1 cleavage is predicted to occur at or near the junction between the RNA primer and the Okazaki fragment.

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 56

56

2.2.4


Genomics and Regulation

Human RNase H1 is encoded by a single gene on chromosome 2p25 [22]. The gene spans 13 kb and contains seven introns with the shortest being 333 base pairs and the longest being 4480 base pairs. There are also multiple pseudogenes in chromosomes 1 and 17. Although expressed at low levels, the enzyme is broadly expressed in cells and tissues [22]. In all cells and tissues, we observed a 1.2 kb band that corresponds to the mature message and a 5 kb band that may be an alternatively or incompletely processed message or a transcript from one of the pseudogenes. The promoter region has numerous potential regulatory elements, but to date, we have seen no evidence of transcriptional regulation of the gene (Wu, unpublished data). Obviously, much more work is required before firm conclusions can be drawn about transcriptional regulation or alternative pre-mRNA processing.

2.3 HUMAN RNase H2 Although human RNase H2 has been cloned and expressed by a number of laboratories [25], much less is known about the properties of this enzyme. This is due primarily to the fact that human RNase H2 is inactive as a monomer. Human RNase H2 is also inactive in the gel renaturation assay so there is no assay with which to study the enzyme in situ. Consistent with these observations, recombinant RNase H2 from yeast was also shown to be inactive as a single polypeptide [44]. In fact, affinity purification identified two yeast proteins Ydr279p and Ylr54p associated with RNase H2, which restored RNase H2 activity in a reconstitution assay [44]. 2.3.1

Structure and Enzymology

Human RNase H2 is a 33 Kd protein that is homologous to E. coli RNase H2 (23% amino acid identity). On the basis of the crystal structure and mutational analyses of archaeal RNase H2, human RNase H2 has highly conserved RNA binding and catalytic domains [45,46]. Of the type 2 enzymes, prokaryote RNases HII are the best characterized. The three-dimensional structure has been determined and the key catalytic amino acids identified [47]. Although type 1 and 2 enzymes exhibit very low-sequence homology, the tertiary structures of these enzymes are similar [45]. In fact, the catalytic- and substrate-binding amino acids of type 1 and 2 enzymes are conserved [47]. The prokaryote type 1 and 2 enzymes were also shown to generate similar patterns based on short heteroduplexes [48]. Finally, prokaryotic RNases HI and HII were shown to differ with respect to cofactor requirements. Specifically, RNase H1 can be activated with both Mg2⫹ and Mn2⫹, whereas RNase H2 is active only in the presence of Mn2⫹ [48]. Given that cloned, expressed, and purified human RNase H2 is inactive in the gel renaturation or solution-based assays, we have developed an assay that, for the first time, supports preliminary characterization of the enzymology of human RNase H2 (Wu, unpublished data). To achieve this, we reasoned that the enzyme may require one or more protein cofactors for activity or that refolding of the enzyme could be ineffective. Thus, we prepared highly purified polyclonal antibodies to both human RNase H1 and RNase H2 and used them to immunoprecipitate both native enzymes in protein complexes from cells. We immunoprecipitated the overexpressed cloned enzymes and analyzed the activity of both the native and overexpressed proteins either by the trichloroacetic acid (TCA) precipitation or gel electrophoresis assays. For the overexpression of human RNase H2, a strain of adenovirus containing the full-length H2 cDNA insert was developed (Figure 2.6A). Figure 2.6B shows the Western blot for overexpressed human RNase H2 in Hela and A549 cells. Furthermore, the virally encoded human RNase H2 protein comigrated with the RNase H2 protein from uninfected cells confirming that the overexpressed protein was full length (data not shown). Peak expressions were observed 36–48 h after

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 57


57

(A)

Full-length human RNase H2 cDNA Met1

Inserted cDNAs

FL_H2

Met27

FL_H1

MLS Full-length human RNase H1 cDNA Met27

NT 26 animo acid minus H1 cDNA

Virus shuttle vector: pACCMVpLpA(-)LoxP-ssp

Adv arm  CMV promoter − MCS  Adv arm (B) Size standard

Native Hela lysate

H2 virus infection

A549 cells Time (h)

0

12

24

36

Hela cells 48

0

12

24

48

Size standard 50 kDa

50 kDa RNase H2

36 kDa

36 kDa 30 kDa

30 kDa H2 Ab immobilized on Agarose Gel

Figure 2.6

36

Western blot with anti-RNase H2 Ab

Development of adenoviruses overexpressing human RNases H. (A) Human RNase H constructs in adenovirus shuttle vectors. Full-length (FL) and N-terminal 26 amino acid (putative mitochondria localization signal, MLS) minus RNase H1, and full-length RNase H2 cDNAs were amplified by PCR and cloned into EcoRI and XhoI sites in the multiple cloning site (MCS) downstream from the CMV promoter in the adenovirus shuttle vector, pACCCMVpLpA(-)Loxp-ssp (core facility of University of Michigan). (B) Western blot analysis of protein lysates from Hela or A549 cells infected with fulllength H2 virus (200 pfu/cell). The cells were harvested at different time points (0, 12, 24, 36, and 48 h) after virus infection. The protein concentrations of the cell lysates were measured. The lysates were subjected to 4–20% gradient SDS-PAGE (20 g/lane) and Western blot analysis with antiRNase H2 antibody (right panel). Immunoprecipitation was performed using uninfected Hela cell lysate with purified H2 Ab which was covalently immobilized to agorose beads. The eluted samples were subjected to western blot analysis with the H2 Ab (left panel).

infection. Human RNase H2 was also overexpressed in T24, MCF7, and HepG2 cells (data not shown). The overexpression of human RNase H1 was performed as previously reported [1]. Because RNase H1 contains a 26 aa putative MLS at the N-terminus of the protein, the 26-aa deletion mutant adenovirus was also developed to evaluate the role of this signal peptide in the subcellular localization of RNase H1. To compliment the overexpression experiments, potent selective DNA-like ASOs and small interference RNAs (siRNA) were identified to reduce cellular RNase H2 [49,50]. A screen of ASOs targeting the mRNA of human RNase H2 revealed ISIS 194186, which was located at nucleotides 1008 to 989 in the 3⬘ UTR of the RNA (accession number AY 363912) as the most potent ASO (Table 2.2). The most potent siRNA for RNase H2 was si-21956 and located at nucleotides 667–686 in the coding region. Both the ASOs and siRNAs targeting human RNase H2 mRNA reduced RNase H2 mRNA and protein levels in a dose-dependent manner and the effects were specific to RNase H2 (Figure 2.7). The duration of effect was greater than 48 h (data not shown). The two RNase H enzymes display different cleavage patterns in the substrate (Figure 2.8). Human RNase H1 preferentially cleaves the heteroduplex 6–7 nucleotides from the 5⬘-RNA/3⬘-DNA terminus of the duplex while RNase H2 preferentially cleaves 11–12 bases from this terminus. Further, the cleavage pattern observed for immunoprecipitated human RNase H1 was identical to that observed with cloned and purified RNase H1 [40]. In fact, there was excellent correlation between the human RNase H1 activities observed for the recombinant protein, the gel renaturation assay, and the immunoprecipitation (IP) assay. Specifically, RNase H1 immunoprecipitated from human cells exhibited similar cleavage site specificity and basic properties such as sensitivity to divalent cations as those observed for both the recombinant protein and gel renaturation

CRC_8796_ch002.qxd

6/20/2007

9:30 PM

Page 58

58

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Table 2.2 ASOs and siRNAs against Human RNase H2 ISIS # 21955 21956 21957 21958 21959 21960 21961 21962 194186

Antisense oligonucleotides O

O B

O O P O -S O

2′-MOE O O

B DNA

O P O -S O

Si21955 si21956 si21957 si21958 si21959 si21960 si21961 si21962

Small interference RNA (siRNA)

Sequences

% Inhibition

CAGTTTCTCCACGAATTGCC TTTTGTCTTGGGATCATTGG AGCTGAACCGGACAAACTGG CCTCTTTCTCCAGGATGGTC ACTCCAGGCCGCGTTCCAGG CCTACGTGTGGTTCTCCTTA GCACACTCCCACCTTGCTTC CAAAAGGAAGTAGCTGGACC CCTACGTGTGGTTCTCCTTA

33.3 63.1 68.1 38.0 81.2 91.7 6.1 36.0

GGCAAUUCGUGGAGAAACUGC CCAAUGAUCCCAAGACAAAAG CCAGUUUGUCCGGUUCAGCUG GACCAUCCUGGAGAAAGAGGC CCUGGAACGCGGCCUGGAGUC UAAGGAGAACCACACGUAGGG GAAGCAAGGUGGGAGUGUGCU GGUCCAGCUACUUCCUUUUGG

19.2 87.6 42.4 45.8 53.8 9.9 15.2 0

Note: Bold text in the ASO sequences represent 2⬘-MOE nucleotides and plain text represent deoxynucleotides. All ASOs contained phosphorothioate linkages throughout the molecules. To the left of the table is the structure of 2⬘-MOE and 2⬘-deoxynucleotides with a phosphorothioate linkage between them. % inhibition: reduction of RNase H2 mRNA level in A549 with ASO (200 nM) or siRNA (100 nM) treatment for 24 h compared to control oligonucleotide or siRNA treatment, detected by Northern blot with 32Plabeled RNase H2 cDNA probe. ISIS194186 shares the same sequence as ISIS21960 (the most potent ASO for RNase H2 in the study), but with only five (instead of six) 2⬘-MOE nucleotides in both wings of the oligonucleotide. For siRNAs, all nucleotides are ribonucleotides and the internucleotide linkages are phosphates. Only the sense strands are shown.

Hela cells

(A) Treatment

Control

Concentration (nM)

0 120 10

ASO194186 25

60 120

Hela cells

A549 cells Control

ASO194186

0 120 10 25

60 120

Control

si21956

0 120 10 25

60 120

A549 cells Control 0

si21956

120 10 25 60 120

RNase H2 (1.4 kb) G3PDH

(B) RNase H2 (~37 kDa) 100% ------------------- 200

1-10-1 Gapmer TAGCCACCAACT

13.58

Antisense suppression of SGLT2 mRNA levels in mouse kidney by a “5-10-5” or a “1-10-1” MOE gapmer phosphorothioate. (A) Mice were treated (i.p.) with increasing molar doses of “5-10-5” or “1-10-1” MOE gapmer twice per week over a 3-week period and SGLT2 mRNA levels were determined by RT-PCR as described [20]. Doses administered for the “5-10-5” MOE gapmer were 0.875, 1.75, 3.5, and 7.0 mol/kg and for the “1-10-1” MOE gapmer were 0.035, 0.175, 0.875, and 1.75 mol/kg. (B) EC50 values were calculated following determination of MOE gapmers levels in kidney (g MOE gapmer/g kidney tissue) as described [31].

(Figure 17.10). Although ED50 and EC50 values could not be determined for the “5-10-5” MOE gapmer group, improved potency for the “1-10-1” gapmer could be approximated to be on the order of 100–200-fold. Analysis of oligonucleotide levels in kidney indicated that similar levels of the “1-10-1” and the “5-10-5” MOE gapmer were present in the kidney at the termination of the study (data not shown), supporting the conclusion that the increase in potency observed for the shorter MOE gapmer was due primarily to an increase in RNase H activity. Similar potency has been observed on both RNase H activity and on SGLT2 mRNA suppression using other 12-base MOE gapmers targeted to SGLT2, indicating that these findings have some general applicability to other antisense sequences. These results suggest that the tremendous loss in predicted binding affinity that occurs as a result of shortening a high-affinity “5-10-5” MOE gapmer to a lower affinity “1-10-1” MOE gapmer can be overcome by improving other aspects of antisense action, such as the ability to more efficiently support RNase H activity.

17.5 FUTURE DIRECTIONS As described above, advancements made in the understanding of RNase H enzymology has resulted in improved potency for existing “second-generation” antisense drugs in animals. The magnitude of the increase in potency observed is wide ranging, depending on oligonucleotide sequence, deoxy gap length, and overall oligonucleotide length. Thus, rather simple alterations in chimeric oligonucleotide structure has resulted in the creation of “Generation 2.2” antisense oligonucelotides; drugs that are similar in design and chemistry as Generation 2.0 drugs, but differ slightly in their design to improve RNase H activity and potency. However, many unanswered

CRC_8796_ch017.qxd

504

5/25/2007

9:04 AM

Page 504


questions still exist that need to be addressed. For example, why does the optimization of some second-generation 2⬘ MOE gapmers result in increased RNase H activity but not increased potency? What will the tolerabilility profile be for Generation 2.2 oligonucleotides relative to Generation 2.0 in the clinic? Afterall, Generation 2.2 oligonucleotides are more “first-generation-like” in their chemical composition and we know that second-generation antisense drugs exhibit an improved tolerability profile relative to first-generation drugs. Third, how do we further achieve improvements in RNase H activity and potency for second-generation antisense drugs? In this regard, it is quite likely that further improvements in antisense potency for 2⬘-modified chimeric oligonucleotides based on further improvements in RNase H activity will require a better understanding of how oligonucleotide modifications, particularly in the wings of the chimeric molecule, influence RNase H activity. With this understanding, modifications and oligonucleotide designs can be utilized to increase RNase H activity while providing additional benefits to oligonucleotide drugs, such as affinity, stability, and tolerability. For example, it has been shown that the nature and position of the 2⬘ modification contained in the wings of a gapmer can have a transmissional influence on the RNase H-sensitive deoxy gap, thereby altering preferred cleavage sites for RNase H, and modulating RNase H efficiency overall [10,17,29]. Thus, insertion of preferred modified nucleotides into appropriate positions within a gapmer may modulate the transmission of the duplex geometry in a manner that increases RNase H activity beyond that observed for Generation 2.2, resulting in further increases in antisense potency. Antisense oligonucleotides that are based on Generation 2.2 design and chemistry that are further optimized for RNase H activity by incorporating subtle changes in chemistry to influence duplex geometry in a beneficial manner are referred to as “Generation 2.5.” 17.6 CONCLUSIONS Second-generation antisense drugs that act through an RNase H-dependent mechanism of action have been developed that demonstrate a number of advantages over first-generation phosphorothioate oligodeoxynucleotides, including better potency, stability, and tolerability. These drugs are designed as chimeric oligonucleotides in which a portion of the molecule contains chemical modifications that provide increased binding affinity and stability, but do not support RNase H activity, is combined with another portion of the molecule that serves to support the RNase H mechanism of action. At the time these oligonucleotides were developed, the key parameters that required optimization to maximize RNase H efficiency were unknown. Thus, although second-generation antisense drugs displayed improved potency over first-generation drugs, further improvements in potency were expected based on advancements in our understanding of RNase H enzymology. Indeed, these predictions have been born out. The development and systematic implementation of assays to quantitatively measure the influence of oligonucleotide chemistry and design on RNase H activity and antisense activity has resulted in further improvements in antisense potency. These increases in potency are expected to have significant implications on the profile of antisense drugs in humans. Most importantly, the need for lower doses in the clinic should translate to an improved therapeutic index, lower cost of goods, and increase the commercial potential for oral routes of administration. Finally, new progress being made in the understanding of oligonucleotide substrate preferences for RNase H enzymes are expected which may result in further advancements in the pharmacology of antisense drugs. ACKNOWLEDGMENTS The authors thank Pamela Black and Tracy Reigle for their administrative assistance and graphical support. The authors also thank Sanjay Bhanot, Rosanne Crooke, and Richard Geary for contributions of unpublished data and to John Matson and Ed Wancewicz for excellent technical assistance.

CRC_8796_ch017.qxd

5/25/2007

9:04 AM

Page 505

OPTIMIZATION OF SECOND-GENERATION ANTISENSE DRUGS

505

REFERENCES 1. B. F. Baker, S. S. Lot, T. P. Condon, S. Cheng-Flournoy, E. A. Lesnik, H. M. Sasmor and C. F. Bennett; 2⬘-O-(2-Methoxy)ethyl-modified anti-intercellular adhesion molecule 1 (ICAM-1) oligonucleotides selectively increase the ICAM-1 mRNA level and inhibit formation of the ICAM-1 translation initiation complex in human umbilical vein endothelial cells; J Biol Chem; 272; 11994–2000; 1997. 2. Z. Dominski and R. Kole; Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides; Proc Natl Acad Sci USA; 90; 8673–8677; 1993. 3. J. G. Karras, R. A. McKay, T. Lu, N. M. Dean and B. P. Monia; Antisense inhibition of membrane-bound human interleukin-5 receptor-alpha chain does not affect soluble receptor expression and induces apoptosis in TF-1 cells; Antisense Nucl Acid Drug Dev; 10; 347–357; 2000. 4. G. Meister and T. Tuschl; Mechanisms of gene silencing by double-stranded RNA; Nature; 431; 343–349; 2004. 5. H. Wu, W. F. Lima and S. T. Crooke; Properties of cloned and expressed human RNase H1; J Biol Chem; 274; 28270–28278; 1999. 6. B. F. Baker, L. Miraglia and C. H. Hagedorn; Modulation of eucaryotic initiation factor-4E binding to 5⬘-capped oligoribonucleotides by modified anti-sense oligonucleotides; J Biol Chem; 267; 11495–11499; 1992. 7. J. K. Taylor, Q. Q. Zhang, J. R. Wyatt and N. M. Dean; Induction of endogenous Bcl-xS through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides; Nat Biotechnol; 17; 1097–10100; 1999. 8. J. Roberts, E. Palma, P. Sazani, H. Orum, M. Cho and R. Kole; Efficient and persistent splice switching by systemically delivered LNA oligonucleotides in mice; Mol Ther; 14; 471–475; 2006. 9. T. A. Vickers, H. Zhang, M. J. Graham, K. M. Lemonidis, C. Zhao and N. M. Dean; Modification of MyD88 mRNA splicing and inhibition of IL-1beta signaling in cell culture and in mice with a 2⬘-O-methoxyethyl-modified oligonucleotide; J Immunol; 176; 3652–3661; 2006. 10. W. F. Lima, H. Wu and S. T. Crooke; Human RNases H; Methods Enzymol; 341; 430–440; 2001. 11. B. P. Monia, E. A. Lesnik, C. Gonzalez, W. F. Lima, D. McGee, C. J. Guinosso, A. M. Kawasaki, P. D. Cook and S. M. Freier; Evaluation of 2⬘-modified oligonucleotides containing 2⬘-deoxy gaps as antisense inhibitors of gene expression; J Biol Chem; 268; 14514–14522; 1993. 12. C. F. Bennett; General pharmacology of phosphorothioate oligodeoxynucleotides; In Antisense Drug Technology: Principles, Strategies, and Applications; S. T. Crooke; ed. Marcel Dekker, Inc.; New York; 2001; pp. 291–318. 13. K. H. Altman, N. M. Dean, D. Fabbro, S. Freier, T. Geiger, R. Haner, D. Husken, P. Marting, B. P. Monia, M. Muller, F. Natt, P. Nicklin, J. Phillips, U. Pieles, H. Sasmor and H. E. Moser; Second generation of antisense oligonucleotides: from nuclease resistance to biological efficacy in animals; Chimia; 50; 168–176; 1996. 14. B. P. Monia, J. F. Johnston, H. Sasmor and L. L. Cummins; Nuclease resistance and antisense activity of modified oligonucleotides targeted to Ha-ras; J Biol Chem; 271; 14533–14540; 1996. 15. N. M. Dean, M. Butler, B. P. Monia and M. Manoharan; Pharmacology of 2⬘-O-(2⬘-Methoxyethoxy) Ethyl Modified Antisense Oligonucleotides; Antisense Drug Technology: Principles, Strategies and Applications; S. T. Crooke; Marcel Dekker, Inc.; New York; 2001; pp. 319–338. 16. W. F. Lima, J. G. Nichols, H. Wu, T. P. Prakash, M. T. Migawa, T. K. Wyrzykiewicz, B. Bhat and S. T. Crooke; Structural requirements at the catalytic site of the heteroduplex substrate for human RNase H1 catalysis; J Biol Chem; 279; 36317–36326; 2004. 17. W. F. Lima, J. B. Rose, J. G. Nichols, H. Wu, M. T. Migawa, T. K. Wyrzykiewicz, G. Vasquez, E. E. Swayze and S. T. Crooke; The positional influence of the helical geometry of the heteroduplex substrate on human RNase H1 catalysis; Mol. Pharmacol; 71; 73–82; 2007. 18. H. Wu, W. F. Lima and S. T. Crooke; Molecular cloning and expression of cDNA for human RNase H; Antisense Nucl Acid Drug Dev; 8; 53–61; 1998. 19. H. Wu, W. F. Lima, H. Zhang, A. Fan, H. Sun and S. T. Crooke; Determination of the role of the human RNase H1 in the pharmacology of DNA-like antisense drugs; J Biol Chem; 279; 17181–17189; 2004. 20. M. Butler, R. A. McKay, I. J. Popoff, W. A. Gaarde, D. Witchell, S. F. Murray, N. M. Dean, S. Bhanot and B. P. Monia; Specific inhibition of PTEN expression reverses hyperglycemia in diabetic mice; Diabetes; 51; 1028–1034; 2002.

CRC_8796_ch017.qxd

506

5/25/2007

9:04 AM

Page 506


21. R. S. Geary, T. A. Watanabe, L. Truong, S. Freier, E. A. Lesnik, N. B. Sioufi, H. Sasmor, M. Manoharan and A. A. Levin; Pharmacokinetic properties of 2⬘-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats; J Pharmacol Exp Ther; 296; 890–897; 2001. 22. A. M. Siwkowski, L. A. Madge, S. Koo, E. L. McMillan, B. P. Monia, J. S. Pober and B. F. Baker; Effects of antisense oligonucleotide-mediated depletion of tumor necrosis factor (TNF) receptor 1-associated death domain protein on TNF-induced gene expression; Mol Pharmacol; 66; 572–579; 2004. 23. M. Elchebly, P. Payette, E. Michaliszyn, W. Cromlish, S. Collins, A. L. Loy, D. Normandin, A. Cheng, J. Himms-Hagen, C. C. Chan, C. Ramachandran, M. J. Gresser, M. L. Tremblay and B. P. Kennedy; Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene; Science; 283; 1544–1548; 1999. 24. C. M. Rondinone, J. M. Trevillyan, J. Clampit, R. J. Gum, C. Berg, P. Kroeger, L. Frost, B. A. Zinker, R. Reilly, R. Ulrich, M. Butler, B. P. Monia, M. R. Jirousek and J. F. Waring; Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis; Diabetes; 51; 2405–2411; 2002. 25. B. A. Zinker, C. M. Rondinone, J. M. Trevillyan, R. J. Gum, J. E. Clampit, J. F. Waring, N. Xie, D. Wilcox, P. Jacobson, L. Frost, P. E. Kroeger, R. M. Reilly, S. Koterski, T. J. Opgenorth, R. G. Ulrich, S. Crosby, M. Butler, S. F. Murray, R. A. McKay, S. Bhanot, B. P. Monia and M. R. Jirousek; PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice; Proc Natl Acad Sci USA; 99; 11357–11362; 2002. 26. L. L. Kjems, S. Bhanot, J. D. Bradley, B. P. Monia, J. Kwoh and M. Wedel; Increased insulin sensitivity in humans by protein tyrosin IB (PTP1B) inhibition—evaluation of ISIS 113715, and antisense inhibition of PTP-1B; Diabetes; 54; A530; 2004. 27. S. Bhanot, L. M. Watts, K. W. Sloop, J. X. C. Cao, A. D. Showalter, M. D. Michael and B. P. Monia; Reduction of hepatic glucagon receptor expression with an optimized antisense oligonucleotide increased active GLP-1 levels in cynomolgus monkeys without pancreatic alpha cell expansion; Diabetes; 55; A326; 2006. 28. T. W. Kim, H. S. Rose, K. Kramer-Strickland, M. J. Graham, K. Subramaniam, R. M. Crooke, P. B. Lappin, G. S. Elliot, A. A. Levin and S. P. Henry; ISIS 326358 an antisense oligonucleotide targeted to ApoB reduces plasma LDL-C in a monkey model of hyperlipidemia; The Toxicologist; 90; 63; 2006. 29. W. F. Lima, J. B. Rose, J. G. Nichols, H. Wu, M. T. Migawa, T. K. Wyrzykiewicz, A. M. Siwkowski and S. T. Crooke; Human RNase H1 discriminates between subtle variations in the structure of the heteroduplex substrate; Mol. Pharmacol; 71; 83–91; 2007. 30. E. M. Wright; Renal Na(+)-glucose cotransporters; Am J Physiol Renal Physiol; 280; F10–F18; 2001. 31. S. T. Crooke, M. J. Graham, J. E. Zuckerman, D. Brooks, B. S. Conklin, L. L. Cummins, M. J. Greig, C. J. Guinosso, D. Kornbrust, M. Manoharan, H. M. Sasmor, T. Schleich, K. L. Tivel and R. H. Griffey; Pharmacokinetic properties of several novel oligonucleotide analogs in mice; J Pharmacol Exp Ther; 277; 923–937; 1996.

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 507

CHAPTER

18

Modulating Gene Function with Peptide Nucleic Acids (PNA) Peter E. Nielsen

CONTENTS 18.1 Introduction .........................................................................................................................507 18.2 PNA Chemistry ...................................................................................................................508 18.3 mRNA Targeting .................................................................................................................508 18.4 dsDNA (gene) Targeting .....................................................................................................510 18.5 Anti-Infective Agents ..........................................................................................................512 18.6 Cellular Delivery.................................................................................................................513 18.7 In Vivo Bioavailability of PNA ...........................................................................................514 18.8 Prospects .............................................................................................................................515 References ......................................................................................................................................515 18.1 INTRODUCTION Peptide nucleic acid (PNA) is a pseudo peptide DNA mimic based on an aminoethyl glycine backbone (Figure 18.1). It was introduced 15 years ago [1] and is in contrast to almost all other DNA analogs and mimics uncharged and achiral. Furthermore, PNA oligomers are synthesized via peptide-like solid-phase chemistry rather than DNA-like chemistry. In fact, PNA synthesis is fully and directly compatible with Boc- and Fmoc-based peptide synthesis. Obviously, PNA oligomers are not substrates for nucleases, but due to the nonnatural character of the amide (“peptide”) bond connecting individual PNA units, PNA oligomers are not susceptible to hydrolysis by peptidase or proteases either, and exhibit exquisite stability in serum and cell extracts as well as in vivo. These properties combined with excellent sequence-specific and high-affinity recognition of single-stranded RNA (and DNA) gave very high initial expectations for PNA in an antisense drug discovery context. The finding that homopyrimidine PNA oligomers form exceedingly stable triplex invasion complexes with sequence-complementary targets in duplex DNA further emphasized the gene targeting potential of PNA. Numerous in vitro and cell culture studies have demonstrated that PNA oligomers are indeed very potent modulators of gene expression ranging from gene silencing at the mRNA (antisense) or the dsDNA (antigene) level, and redirection of mRNA splicing to gene activation through transcription bubble mimicking. However, these studies have also revealed that for both cell culture 507

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 508

508

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION B B B

O -

O O

O

(5')

O O

P O O

O DNA

(N terminal)

O

B O

O

O N

O

P O O

B

B

NH

-

N

NH

NH O

O

N

NH O

PNA Figure 18.1 Chemical structures of PNA compared to DNA (B signifies a nucleobase).

studies and, in particular, for in vivo application, the major challenge to be met is effective cell delivery and sufficient in vivo bioavailability of PNA oligomers (for recent reviews, see [2–5]).

18.2 PNA CHEMISTRY The original aeg (aminoethyl glycine) PNA with the carbonyl methylene (“acetyl”) linker to the nucleobase was based on molecular model building keeping intrabackbone distances as close as possible to that of DNA. Subsequently, numerous derivatives and modifications of the aegPNA structure have been made and it is quite clear that keeping these distances is critical for strong RNA/DNA hybridization. Furthermore, the restricted flexibility imposed by the (two) planar amide groups also appears very important for high-affinity binding [6]. Thus, of the noncyclic derivatives, the original aegPNA still appears to be the most promising candidate for gene targeting. Nonetheless, a variety of cyclic PNA analogs have shown promise as a means of increasing PNA-RNA (and/or DNA) duplex stability [7], but their synthesis is less straightforward than that for aegPNA monomers, and through the ring systems chirality is also introduced. Furthermore, duplex stabilization appears, at least for some of the derivatives, to be more sequence context–dependent than for aegPNA, although for virtually all derivatives too limited data are yet available for drawing more general conclusions in this respect. A large variety of PNA monomers with functionalized backbone have also been developed most commonly by substituting the -position of the glycine moiety (Figure 18.1) (e.g., [8]), but derivatives having substituents in the ethyl part have also been described [9]. Such derivatives may turn out to be of significant interest for modulating (improving) the bioavailability and pharmacokinetics of PNA oligomers (vide infra, Section 18.7). Finally, a number of nonnatural nucleobases have been exploited in the PNA context for specific purposes, mostly in connection with targeting of duplex DNA (vide infra, Section 18.4).

18.3 mRNA TARGETING It is well established and not surprising that PNA-RNA duplexes are not substrates for RNaseH. Thus, the antisense activity of PNA oligomers must rely on other mechanisms, such as

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 509

MODULATING GENE FUNCTION WITH PEPTIDE NUCLEIC ACIDS (PNA)

509

direct interference with translation initiation or elongation. Cell-free in vitro translation studies have demonstrated that PNAs targeted to or upstream from the translation initiation site effectively inhibit translation, whereas this is not the case if the PNA is target to sequences within the coding region (unless homopurine regions are targeted with homopyrimidine PNA, or even better, bisPNAs, which form exceedingly stable PNA2-DNA triplexes). Accordingly, in one study the most effective antisense PNA identified by gene walk in a cell culture experiment targets the 5⬘-UTR [10]. Nonetheless, several other less systematic studies have identified active antisense PNAs targeting the coding region [11–13]. The mechanism(s) of action for these PNAs has not been determined, but could involve translation elongation arrest in particularly sensitive regions, changes in RNA secondary structure affecting mRNA translation, stability, or trafficking. Thus, more systematic and mechanistic studies on the effects of mRNA targeting by PNA would be highly desirable. Recently, it was discovered that targeting of RNaseH “negative” oligonucleotides to intron–exon junctions of pre-mRNA can effectively inhibit or redirect mRNA splicing. Likewise, several studies have demonstrated that PNAs effectively can interfere with splicing [14–16]). Blocking of an intron–exon junction may have two fundamentally different outcomes (Figure 18.2). Simply the splicing out of the intron may be inhibited, and a dysfunctional mRNA still containing the intro results and, consequently, synthesis of the protein coded for by the mRNA is disrupted. However, a more biologically interesting consequence arises if the spliceosome utilizes a downstream splice site instead of the one blocked by the PNA as this will result in an mRNA with one (or more) exon(s) missing, thereby producing an alternatively spliced mRNA. The technology may also be exploited for drug discovery of splicing correcting drugs for diseases caused by genes containing aberrant splice sites [15]. Alternative splicing is widely utilized by nature to create multiple products from the same mRNA and antisense agents may thus rationally be used to control this process. Indeed, this principle was recently exploited to convert the apoptosis inhibiting bcl-xL protein isoform into the pro-apoptotic bcl-xS isoform as a means for discovering new anticancer antisense agents [17]. Analogously, it can be envisaged that novel proteins not used by nature may be induced by exon-skipping of functional domains, e.g., active sites, ligand binding sites, membrane spanning domains, etc.

PNA

Intron skipping or

Exon skipping Figure 18.2 Effect of PNA targeting of a pre-mRNA intron–exon splice junction. Thick “lines” signify exons while thin lines signify introns.

CRC_8796_ch018.qxd

5/2/2007

510

4:56 PM

Page 510


Finally, PNAs targeting the RNA of telomerase have been evaluated in in vitro cell culture studies as potential anticancer agents (e.g., [18,19]), but although very potent inhibitors of telomerase activity have been identified it is still too early to judge the merits of this approach, not least to the uncertainties concerning telomerase as a validated anticancer target.

18.4 dsDNA (GENE) TARGETING It is well established that targeting of double-stranded DNA with PNA in vitro using purified DNA can result in a variety of complexes (Figure 18.3) dependent on target (and PNA) sequence, PNA modification, and experimental conditions. For homopurine targets, and corresponding homopyrimidine PNA oligomers, triplex structures are formed. Initially, traditional external triplexes with the PNA bound by Hoogsteen base-pairing in the major groove take place, and, subsequently, at a much slower rate, a triplex invasion complex having an internal PNA2DNA triplex and an extruded DNA strand is formed (P-loop) [20] (Figure 18.4). Furthermore, the invasion process is dramatically accelerated under conditions that favor opening (denaturation) of the DNA double helix (such as negative supercoiling or active transcription) and severely deaccelerated under conditions that stabilize the double helix, such as elevated ionic strength or the presence of di- or multivalent cations (Mg2⫹, spermidine, etc.). Indeed, triplex invasion binding of simple homopyrimidine PNA oligomers to relaxed duplex DNA hardly takes place under physiologically similar conditions (140 mM K⫹/Na⫹, 2 mM Mg2⫹). Thus, the ratio of external triplex versus triplex invasion products varies dramatically depending on the conditions [21]. However, relative enhancement of invasion can be accomplished by using PNA-intercalator (acridine) conjugates [22], especially in combination with bisPNA clamps, which furthermore allows use of the pseudoisocytosine nucleobase instead of cytosine in the Hoogsteen bound PNA strand, thereby obtaining PNAs that bind strongly to the target independent of pH [23]. Mixed purine/pyrimidine sequence PNAs do not form PNA2DNA triplexes and bind very weakly, if at all, to targets in relaxed double-stranded DNA [24], but binding has been demonstrated to negatively supercoiled targets using PNAs conjugated to cationic peptides [25]. Mixed purine/pyrimidine sequences in duplex DNA can, however, be targeted using pairs of pseudocomplementary PNAs (Figure 18.5). In these PNAs, adenines are replaced with diaminopurines (DAP) and thymines are replaced with thiouracil (Us) [26], resulting in a pair of sequence-complementary PNAs, which bind weakly to each other due to steric clash in the DAP-Us base pair, but which still binds effectively to complementary DNA and therefore can form double duplex invasion complexes with targets in duplex DNA.

Triplex

Triplex invasion Duplex invasion Double duplex invasion

Tail clamp

Figure 18.3 Five different types of PNA-dsDNA complexes. DNA is schematically drawn as a ladder, and the PNA oligomers are in bold.

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 511


511

CH3

DNA Hoogsteen

CH3

O

N N

Watson-Crick

H

H

N

H

O

O

N

N

H

N

T

N

N

N

H

O

DNA loop

ΨiC + N

N

N

N

Hoogsteen

N

H

N N

N N

O

C+

PNA

H

H H

O

N

N

N

O

H

N

N

H

H

N

T

H

H

N

A

PNA

H

N

O

H

O

C N

N

N

H

H

N

G

O

C N

H

H

Watson−Crick

G

Figure 18.4 Triplex invasion by homopyrimidine PNA oligomers. One PNA strand binds via Watson–Crick basepairing (preferably in the antiparallel orientation), while the other binds via Hoogsteen base-pairing (preferably in the parallel orientation). It is usually advantageous to connect the two PNA strands covalently via a flexible linker into a bis-PNA, and to substitute all cytosines in the Hoogsteen strand with pseudoisocytosines (iC), which do not require low pH for protonation at N3.

CH3 O

O H

N

H

H H

N

O

H

N

N

Thymine N

N H

N

N

N

N

N

N

N

H N S Thiouracil

N H

N

H

H

Diaminopurine

Diaminopurine

CH3 O

O H

N

H

N N

H

H N

N Adenine

N

N O

H

N

H H

N

N

S

Thymine N

N

N

Thiouracil N

H

Adenine

Figure 18.5 Double duplex invasion of pseudocomplementary PNAs. To obtain efficient binding, the target (and thus the PNAs) should contain at least 50% AT, and in the PNA oligomers all adenines and thymines are substituted with 2,6-diaminopurine or 2-thiouracil, respectively. Pairing between these base analogs is very unstable due to steric hindrance. Therefore, the two sequence-complementary PNAs will not be able to bind to each other, but they bind to their complementary DNA sequences very well.

In vitro transcription studies using phage- or prokaryotic RNA polymerases or cell extracts have shown that PNA triplex invasion complexes—in particular, when positioned on the template DNA strand—are able to arrest elongating RNA polymerases [27,28]. Very recently, it was demonstrated that the RNA polII open complex can be blocked by PNA binding to the DNA loop [29], in full analogy to previous reports using Escherichia coli RNA polymerase and oligonucleotides [30,31].

CRC_8796_ch018.qxd

512

5/2/2007

4:56 PM

Page 512


Most interestingly, it was discovered that PNA triplex invasion complexes recruit RNA polymerase for transcription initiation, thereby functioning as an artificial promoter with the PNA as a “transcription factor” [32]. A subsequent study has indicated that such a specific gene-activating effect of PNA can also occur in cells [33], but unfortunately these results haven not been followed up further. The very specific sequence-targeting of triplex-forming (bis)PNAs (and pseudocomplementary PNAs) has been exploited to introduce covalent modification of the target by photocrosslinking or base alkylation using PNA-psoralen [34] or PNA-nitrogen mustard conjugates [35,36]. In view of the recent success in achieving effective cellular gene repair via double-strand-break-provoked homologous recombination using a genetically delivered endonuclease [37], such PNA conjugates could be interesting agents in targeted gene repair studies and drug discovery, as the repair of DNA interstrand crosslinks involves double-strand breaks, which could facilitate sequence-targeted homologous recombination. Unfortunately, no in vivo or even cell culture studies have yet been published in which a biological effect on repair, replication, or transcription has been directly correlated with genomic PNA binding. Therefore, although several reports have implicated or been interpreted in terms of an antigene mechanism, validated studies demonstrating in vivo antigene effects of PNA are still lacking (see also Section 18.7). A series of in vitro cell culture studies have implicated mixed purine/pyrimidine sequence PNA oligomers conjugated to a nuclear localization (NLS) peptide as effective antigene agents, in particular for targeting myc genes [38–41]. This is highly surprising in view of the fact that such PNAs do not efficiently bind duplex DNA targets in vitro; also NLS in comparative studies is an extremely poor cellular delivery peptide (at least in HeLa cells) [42]. Unfortunately, the studies do not directly address the mechanism(s) of the observed effects of the PNAs on mRNA and protein levels, and show no evidence of DNA binding of the PNA in the cells. It is thus premature to conclude that these PNAs elicit bona fide antigene activity.

18.5 ANTI-INFECTIVE AGENTS Infectious agents such as bacteria and viruses have genomes that are dramatically different from the human genome and these pathogens are therefore obvious targets for gene therapeutic drugs. Not surprisingly, several studies have addressed the potential of PNA in this respect. Almost 10 years ago, it was demonstrated that PNA oligomers targeting the -sarcin loop of bacterial ribosomes were able to inhibit the growth of E. coli [43], and a subsequent study identified a delivery peptide, (KFF)3K, which when conjugated to PNA significantly increased the potency of the PNA [44]. In this study, it was also demonstrated that antisense PNAs targeting the essential acpP gene are bacteriocidal and thus have the potential of being developed into novel antibiotics. Indeed, a recent study has supported these hopes by demonstrating the antibacterial effects of this PNA in a peritonitis mouse infection model [45]. Unfortunately, toxicity studies in dogs have shown that the (KFF)3K peptide induces a severe histamine release and this peptide therefore appears unsuited for further drug development [46]. However, it should be possible to discover other (peptide) carriers that effectively deliver PNA to bacterial cells without causing histamine release as has been accomplished in the field of antibacterial peptides [47], and thereby allow discovery of novel antibacterial PNAs for clinical development. It is encouraging that PNA antisense targeting in bacteria seems a very robust phenomenon [48–50] that is not restricted to E. coli, but has for instance also been demonstrated in Staphylococcus aureus [51]. Interestingly, other unicellular organisms such as amoeba are also susceptible to PNA antisense techniques [52,53]. A number of studies have successfully addressed the discovery of anti-HIV PNAs [54–60]. Reverse transcriptase is extremely sensitive to PNA interference by targeting the template RNA, and by using PNA oligomers conjugated to cell delivery peptides (e.g., transportan), antiviral

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 513


513

effects of such PNAs have been demonstrated in cell culture at low micromolar concentrations of the PNA-peptide conjugates [58–60]. In vitro data likewise have been reported to support the fact that PNAs against Hepatitis (HBV and HCV) may eventually be developed [61,62].

18.6 CELLULAR DELIVERY It is generally accepted that PNA oligomers, due to their size and hydrophilic nature, are taken up extremely poorly by both pro- and eukaryotic cells. Consequently, a variety of PNA derivatives and delivery methods that enhance the cellular bioavailability of PNA have been developed. These methods include cationic liposome-assisted delivery of PNA oligomers hybridized to an oligonucleotide carrier [63], or of PNAs conjugated to lipophilic ligands, such as fatty acids [64] or (hetero)polyaromatic ligands [65]. Although these methods are adequate for most studies in cell culture, they cannot be directly transferred to in vivo applications, primarily due to toxicity and instability of simple cationic liposomes. Thus, methods based on PNA derivatives that are taken up by cells unaided would be highly advantageous. A variety of such derivatives has been described and almost all rely on conjugation to cationic cell-penetrating peptides (CPPs). The first CPPs were derived from protein domains known to facilitate cellular uptake, such as part of the homeo domain from the antennapedia transcription factor in Drosophila (penetratin) and the Tat-peptide from HIV. These peptides are cationic with a high arginine content and were originally reported to facilitate cellular entry by passive transport over the lipid bilayer membrane [66]. However, supported by more recent studies [67–69], there is now a general consensus that the major route of cellular entry for these and analogous cationic peptides, such as simple oligo arginines and also transportan involves an endosomal pathway, perhaps predominantly macropinocytosis [70]. Therefore, a major challenge is the induction of endosomal escape (at least for such conjugates) rather than achieving cellular uptake per se. A variety of endosome disruptive agents have recently been discovered and their effect on peptide-mediated PNA antisense activity in cells in culture has been studied. The general conclusion from these studies is that all agents (chloroquine [69,71], photochemical internalization (PCI) [72,73], and calcium ions [71]) enhance the potency of all cationic peptides. This effect can be as large as two orders of magnitude as seen for the Tat peptide but differs significantly between the different peptides [71], thereby strongly suggesting that despite an overall similar endosomal uptake mechanism, some peptides may to some extent be taken up by alternative pathways and more or less efficiently escape the endosomal compartment by themselves. Determination of the structure–activity relations for these differences should allow the design of more effective delivery agents. Two studies have attempted to more systematically deduce such structure-activity relations for antisense enhancement of PNA-peptide conjugates for simple cationic [74] as well as amphiphilic peptides [75], but clear-cut conclusions are difficult to draw from these data at this stage except that the presence of multiple lysines or aginines is required. Indeed, other studies have identified hepta- or octaarginines as optimal in this respect [67,72]. However, it is important to note that most cationic peptides exhibit significant general cytotoxicity due to their membrane active/disruptive properties, and that a fine balance between delivery activity and toxicity usually exists [67,72]. A couple of comparative studies of the most common delivery peptides (including Tat, penetratin, transprotan, NLS, and oligoarginines) have been performed exploiting PNA-peptides conjugates in a very sensitive and easily quantifiable HeLa cell luciferase splicing correction assay. The overall conclusion from these studies identifies transportan as the most effective delivery agent followed by oligoarginines [67,72,76,77]. However, the studies also indicate that seemingly very small changes in the peptide (such as changing the C-terminal of transportan from an amide to a free carboxylic acid) can profoundly affect the activity [67]. Furthermore, it appears advantageous to connect the PNA to peptide via a biologically cleavable linker, such as a disulfide or an ester [67]. A variety of other ligands, such as triphenylphosphonium [78] and terpyridyl [79] have been reported to facilitate PNA cellular delivery, but these have not yet been comparatively validated.

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 514

514

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION B O NH

B O

O N

O N

NH

B O NH

O N

NH HN

NH2

Figure 18.6 Structure of PNA containing single arginine derived backbone unit (B signifies a nucleobase).

Also, direct modification of the PNA structure in terms of backbone substituents [8] have yielded compounds with enhanced uptake properties. In particular, exploiting backbones based on lysine [8,64] or arginine (Figure 18.6) [8,80] instead of glycine are of interest as are glycosylated PNAs [81], although there is no evidence that such internal modification is advantageous compared to analogous end-conjugation. Finally, it is important to mention that endosmal uptake and subsequent escape is exploited by Nature as the route of cellular entry for many viruses. Specially evolved proteins are responsible for the endosomal escape process, although the detailed mechanism is still poorly understood. Clearly, low-molecular-weight ligands or small peptides that could mimic the delivery mechanism of these larger (20–40 amino acid) viral peptides (70) would be of major interest for drug discovery of PNA gene-targeting drugs.

18.7 IN VIVO BIOAVAILABILITY OF PNA Although a number of in vivo experiments have been conducted with unmodified PNA oligomers [82–84]), these are poorly validated and all available pharmacokinetic data agree that the bioavailability of unmodified aegPNA in vivo is extremely limited because the PNA is very quickly (t½⬍30 min) excreted through the kidneys [81,85,86]. This conclusion is also supported by the most convincing in vivo study published so far [87]. In this study, a transgenic green fluorescent protein (GFP) mouse in which GFP can be activated by antisense splice correction was used, and the antisense effect of PNA, MOE, and morpholino oligomers were compared and scored as GFP level (fluorescence) as well as mRNA correction (RT-PCR) in several tissues. The results very clearly showed that while no effect could be detected with an unmodified PNA, the same PNA conjugated to four lysines showed significant (comparable to that of the corresponding MOE and morpholino oligomers) antisense effect in liver, muscle, and heart, thereby indicating that simple peptide conjugation can positively affect the in vivo bioavailability of PNA. Accordingly, significantly improved pharmacokinetic behavior of a PNA-(KFF)3K conjugate as compared to an unmodified PNA was found [85]. In a more comprehensive study, a series of cationic peptides have been tested, again identifying several that enhance PNA bioavailability upon conjugation [73]. Using a different approach, the bioavailability in particular organs has been dramatically improved by specifically targeting the PNA to receptors present on the cells of the organ. Specifically, it has been shown that GalNac (N-acetylgalactosamin)-modified PNA up-concentrate very efficiently in the liver [81] due to the presence of asialoglycoprotein receptors, although it is not clear how much of the PNA is actually available for gene targeting inside the hepatocytes or the kupffer cells of the liver. Most likely, in this case most of the PNA will be trapped in endosomes due to the receptor-mediated uptake.

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 515


515

The experience with the in vivo behavior of PNA oligomers and,in particular, concerning the effects of chemical modification and conjugation is still very limited, but it is fair to conclude that the results so far are encouraging in terms of the very significant effects seen in bioavailability (both pharmacokinetics and tissue distribution) upon chemical modification or conjugation of the PNA. This behavior reflects the fact that aegPNA oligomers are biologically speaking “neutral” molecules whose physicochemical properties can be easily and dramatically changed without severely affecting their affinity toward their nucleic acid cellular target.

18.8 PROSPECTS Clearly, PNA oligomers can modulate cellular gene expression at many levels and via a multitude of mechanisms, and therefore provide a broad opportunity for novel drug discovery. In particular, splice modulation and interference with gene function at the DNA level may open exiting new possibilities such as altering gene function by inducing alternative protein isoforms and targeted sequence-specific somatic gene repair. However, it is also painstakingly clear that the major hurdle to overcome for these opportunities to become reality is in vivo delivery and bioavailability of the PNA oligomers. Whether this challenge will be met by using chemical modification, ligand conjugation, formulation, or some new technology remains to be seen, but if effectively solved a new era in drugs discovery could be dawning.

REFERENCES 1. Nielsen PE, Egholm M, Berg RH, and Buchardt O: Sequence-selective recognition of DNA by strand displacement with a thymine-substituted polyamide. Science, 254: 1497; 1991. 2. Marin VL, Roy S, and Armitage BA: Recent advances in the development of peptide nucleic acid as a gene-targeted drug. Expert Opinion on Biological Therapy, 4: 337; 2004. 3. Geller BL: Antibacterial antisense. Current Opinion in Molecular Therapeutics, 7: 109; 2005. 4. Kaihatsu K, Janowski BA, and Corey DR: Recognition of chromosomal DNA by PNAs. Chemistry and Biology, 11: 749; 2004. 5. Lundin KE, Good L, Stromberg R et al.: Biological activity and biotechnological aspects of peptide nucleic acid. Advances in Genetics, 56: 1; 2006. 6. Nielsen PE: Peptide nucleic acid. A molecule with two identities. Accounts of Chemical Research, 32: 624; 1999. 7. Kumar VA and Ganesh KN: Conformationally constrained PNA analogues: structural evolution toward DNA/RNA binding selectivity. Accounts of Chemical Research, 38: 404; 2005. 8. Püschl A, Sforza S, Haaima G et al.: Peptide nucleic acids (PNAs) with a functional backbone. Tetrahedron Letters, 39: 4707; 1998. 9. Kosynkina L, Wang W, and Liang TC: A convenient synthesis of chiral peptide nucleic acid (PNA) monomers. Tetrahedron Lett, 35: 5173; 1994. 10. Doyle DF, Braasch DA, Simmons CG et al.: Inhibition of gene expression inside cells by peptide nucleic acids: effect of mRNA target sequence, mismatched bases, and PNA length. Biochemistry, 40: 53; 2001. 11. Liu Y, Braasch DA, Nulf CJ et al.: Efficient and isoform-selective inhibition of cellular gene expression by peptide nucleic acids. Biochemistry, 43: 1921; 2004. 12. Shiraishi T and Nielsen PE: Down-regulation of MDM2 and activation of p53 in human cancer cells by antisense 9-aminoacridine-PNA (peptide nucleic acid) conjugates. Nucleic Acids Research, 32: 4893; 2004. 13. Kilk K, Elmquist A, Saar K, et al.: Targeting of antisense PNA oligomers to human galanin receptor type 1 mRNA. Neuropeptides, 38: 316; 2004. 14. Sazani P, Kang SH, Maier MA, et al.: Nuclear antisense effects of neutral, anionic and cationic oligonucleotide analogs. Nucleic Acids Research, 29: 3965; 2001.

CRC_8796_ch018.qxd

516

5/2/2007

4:56 PM

Page 516


15. Cartegni L and Krainer AR: Correction of disease-associated exon skipping by synthetic exon-specific activators. Nature Structural Biology, 10: 120; 2003. 16. Siwkowski AM, Malik L, Esau CC, et al.: Identification and functional validation of PNAs that inhibit murine CD40 expression by redirection of splicing. Nucleic Acids Research, 32: 2695; 2004. 17. Wilusz JE, Devanney SC, and Caputi M: Chimeric peptide nucleic acid compounds modulate splicing of the bcl-x gene in vitro and in vivo. Nucleic Acids Research, 33: 6547; 2005. 18. Herbert BS, Pitts AE, Baker SI et al.: Inhibition of human telomerase in immortal human cells leads to progressive telomere shortening and cell death. Proceedings of the National Academy of Science USA, 96: 14,276; 1999. 19. Folini M, Berg K, Millo E et al.: Photochemical internalization of a peptide nucleic acid targeting the catalytic subunit of human telomerase. Cancer Research, 63: 3490; 2003. 20. Nielsen PE, Egholm M, and Buchardt O: Evidence for (PNA)2/DNA triplex structure upon binding of PNA to dsDNA by strand displacement. Journal of Molecular Recognition, 7: 165; 1994. 21. Bentin T, Hansen GI, and Nielsen PE: Structural diversity of target specific homopyrimidine peptide nucleic acid-dsDNA complexes. Nucleic Acids Research, 34: 5790; 2006. 22. Bentin T and Nielsen PE: Superior duplex DNA strand invasion by acridine conjugated peptide nucleic acids. Journal of the American Chemical Society, 125: 6378; 2003. 23. Egholm M, Christensen L, Dueholm KL et al.: Efficient pH-independent sequence-specific DNA binding by pseudoisocytosine-containing bis-PNA. Nucleic Acids Research, 23: 217; 1995. 24. Nielsen PE and Christensen L: Strand displacement binding of a duplex-forming homopurine PNA to a homopyrimidine duplex DNA target. Journal of the American Chemical Society, 118: 2287; 1996. 25. Zhang X, Ishihara T, and Corey DR: Strand invasion by mixed base PNAs and a PNA-peptide chimera. Nucleic Acids Research, 28: 3332; 2000. 26. Lohse J, Dahl O, and Nielsen PE: Double duplex invasion by peptide nucleic acid: a general principle for sequence-specific targeting of double-stranded DNA. Proceedings of the National Academy of Science USA, 96: 11,804; 1999. 27. Peffer NJ, Hanvey JC, Bisi JE et al.: Strand-invasion of duplex DNA by peptide nucleic acid oligomers. Proceedings of the National Academy of Science USA, 90: 10,648; 1993. 28. Nielsen PE, Egholm M, and Buchardt O: Sequence-specific transcription arrest by peptide nucleic acid bound to the DNA template strand. Gene, 149: 139; 1994. 29. Janowski BA, Kaihatsu K, Huffman KE et al.: Inhibiting transcription of chromosomal DNA with antigene peptide nucleic acids. Nature Chemical Biology, 1: 210; 2005. 30. Hwang JT, Baltasar FE, Cole DL et al.: Transcription inhibition using modified pentanucleotides. Bioorganic and Medicinal Chemistry, 11: 2321; 2003. 31. Milne L, Xu Y, Perrin DM, and Sigman DS: An approach to gene-specific transcription inhibition using oligonucleotides complementary to the template strand of the open complex. Proceedings of the National Academy of Science USA, 97: 3136; 2000. 32. Møllegaard NE, Buchardt O, Egholm M, and Nielsen PE: Peptide nucleic acid-DNA strand displacement loops as artificial transcription promoters. Proceedings of the National Academy of Science USA, 91: 3892; 1994. 33. Wang G, Xu X, Pace B, Dean DA et al.: Peptide nucleic acid (PNA) binding-mediated induction of human -globin gene expression. Nucleic Acids Research, 27: 2806; 1999. 34. Kim KH, Nielsen PE, and Glazer PM: Site-specific gene modification by PNAs conjugated to psoralen. Biochemistry, 45: 314; 2006. 35. Zhilina ZV, Ziemba AJ, Nielsen PE, and Ebbinghaus SW: PNA-nitrogen mustard conjugates are effective suppressors of HER-2/neu and biological tools for recognition of PNA/DNA Interactions. Bioconjugate Chemistry, 17: 214; 2006. 36. Ziemba AJ, Zhilina ZV, Krotova-Khan Y et al.: Targeting and regulation of the HER-2/neu oncogene promoter with bis-peptide nucleic acids. Oligonucleotides, 15: 36; 2005. 37. Urnov FD, Miller JC, Lee YL et al. Highly efficient endogenous human gene correction using designed zinc-finger nucleases. Nature, 435: 646; 2005. 38. Cutrona G, Carpaneto EM, Ulivi M et al.: Effects in live cells of a c-myc anti-gene PNA linked to a nuclear localization signal. Nature Biotechnology, 18: 300; 2000. 39. Pession A, Tonelli R, Fronza R et al.: Targeted inhibition of NMYC by peptide nucleic acid in N-myc amplified human neuroblastoma cells: cell-cycle inhibition with induction of neuronal cell differentiation and apoptosis. International Journal of Oncology, 24: 265; 2004.

CRC_8796_ch018.qxd

5/2/2007

4:56 PM

Page 517


517

40. Cogoi S, Codognotto A, Rapozzi V et al.: Transcription inhibition of oncogenic KRAS by a mutationselective peptide nucleic acid conjugated to the PKKKRKV nuclear localization signal peptide. Biochemistry, 44: 10,510; 2005. 41. Tonelli R, Purgato S, Camerin C et al.: Anti-gene peptide nucleic acid specifically inhibits MYCN expression in human neuroblastoma cells leading to cell growth inhibition and apoptosis. Molecular Cancer Therapy, 4: 779; 2005. 42. Bendifallah N, Rasmussen FW, Zachar V et al.: Evaluation of cell-penetrating peptides (CPPs) as vehicles for intracellular delivery of Antisense peptide nucleic acid (PNA). Bioconjugate Chemistry, 17: 750; 2006. 43. Good L and Nielsen PE: Inhibition of translation and bacterial growth by peptide nucleic acid targeted to ribosomal RNA. Proceedings of the National Academy of Science USA, 95: 2073; 1998. 44. Good L, Awasthi SK, Dryselius R et al.: Bactericidal antisense effects of peptide-PNA conjugates. Nature Biotechnology, 19: 360; 2001. 45. Tan XX, Actor JK, and Chen Y: Peptide nucleic acid antisense oligomer as a therapeutic strategy against bacterial infection: proof of principle using mouse intraperitoneal infection. Antimicrobial Agents and Chemotherapy, 49: 3203; 2005. 46. Frandsen N, Kjærulf S, Nielsen PE et al. (in preparation). 47. Jenssen H, Hamill P, and Hancock RE. Peptide antimicrobial agents. Clinical Microbiology Reviews, 19: 491; 2006. 48. Dryselius R, Aswasti SK, Rajarao GK et al.: The translation start codon region is sensitive to antisense PNA inhibition in Escherichia coli. Oligonucleotides, 13: 427; 2003. 49. Kulyte A, Dryselius R, Karlsson J and Good L: Gene selective suppression of nonsense termination using antisense agents. Biochimica et Biophysica Acta, 1730: 165; 2005. 50. Dryselius R, Nekhotiaeva N, and Good L: Antimicrobial synergy between mRNA- and protein-level inhibitors. Journal of Antimicrobial Chemotherapy, 56: 97; 2005. 51. Nekhotiaeva N, Awasthi SK, Nielsen PE, and Good L: Inhibition of Staphylococcus aureus gene expression and growth using antisense peptide nucleic acids. Molecular Therapy, 10: 652; 2004. 52. Stock RP, Olvera A, Sánchez R et al.: Inhibition of gene expression in Entamoeba histolytica with antisense peptide nucleic acid oligomers. Nature Biotechnology, 19: 231; 2001. 53. Sánchez R, Saralegui A, Olivos-Garcia A et al.: Entamoeba histolytica: intracellular distribution of the sec61alpha subunit of the secretory pathway and down-regulation by antisense peptide nucleic acids. Experimental Parasitology, 109: 241; 2005. 54. Koppelhus U, Zachar V, Nielsen PE et al.: Efficient in vitro inhibition of HIV-1 gag reverse transcription by peptide nucleic acid (PNA) at minimal ratios of PNA/RNA. Nucleic Acids Research, 25: 2167; 1997. 55. Kaushik N, Basu A, and Pandey VN: Inhibition of HIV-1 replication by anti-trans-activation responsive polyamide nucleotide analog. Antiviral Research, 56: 13; 2002. 56. Riguet E, Tripathi S, Chaubey B et al.: A peptide nucleic acid-neamine conjugate that targets and cleaves HIV-1 TAR RNA inhibits viral replication. Journal of Medicinal Chemistry, 47: 4806; 2004. 57. Chaubey B, Tripathi S, Ganguly S et al.: A PNA-transportan conjugate targeted to the TAR region of the HIV-1 genome exhibits both antiviral and virucidal properties. Virology, 331: 418; 2005. 58. Pesce CD, Bolacchi F, Bongiovanni B et al.: Anti-gene peptide nucleic acid targeted to proviral HIV-1 DNA inhibits in vitro HIV-1 replication. Antiviral Research, 66: 13; 2005. 59. Tripathi S, Chaubey B, Ganguly S et al.: Anti-HIV-1 activity of anti-TAR polyamide nucleic acid conjugated with various membrane transducing peptides. Nucleic Acids Research, 33: 4345; 2005. 60. Turner JJ, Ivanova GD, Verbeure B et al.: Cell-penetrating peptide conjugates of peptide nucleic acids (PNA) as inhibitors of HIV-1 Tat-dependent trans-activation in cells. Nucleic Acids Research, 33: 6837; 2005. 61. Nulf CJ and Corey D: Intracellular inhibition of hepatitis C virus (HCV) internal ribosomal entry site (IRES)-dependent translation by peptide nucleic acids (PNAs) and locked nucleic acids (LNAs). Nucleic Acids Research, 32: 3792; 2004. 62. Robaczewska M, Narayan R, Seigneres B et al.: Sequence-specific inhibition of duck hepatitis B virus reverse transcription by peptide nucleic acids (PNA). Journal of Hepatology , 42: 180; 2005. 63. Hamilton SE, Simmons CG, Kathiriya IS, and Corey DR: Cellular delivery of peptide nucleic acids and inhibition of human telomerase. Chemistry & Biology, 6: 343; 1999. 64. Ljungstrøm T, Knudsen H and Nielsen PE: Cellular Uptake of adamantyl conjugated peptide nucleic acids. Bioconjugate Chemistry, 10: 965; 1999.

CRC_8796_ch018.qxd

518

5/2/2007

4:56 PM

Page 518


65. Shiraishi T, Nadia Bendifallah N, and Nielsen PE: Cellular delivery of polyheteroaromate-peptide nucleic acid (PNA) conjugates mediated by cationic lipids. Bioconjugate Chemistry, 17: 189; 2006. 66. Fotin-Mleczek M, Fischer R, and Brock R: Endocytosis and cationic cell-penetrating peptides—a merger of concepts and methods. Current Pharmaceutical Design, 11: 3613; 2005. 67. Koppelhus U, Awasthi SK, Zachar V et al.: Cell-dependent differential cellular uptake of PNA, peptides, and PNA-peptide conjugates. Antisense and Nucleic Acid Drug Development, 12: 51; 2002. 68. Richard JP, Melikov K, Vives E et al. Cell-penetrating peptides. A reevaluation of the mechanism of cellular uptake. Journal of Biological Chemistry, 278: 585; 2003. 69. Abes S, Williams D, Prevot P et al.: Endosome trapping limits the efficiency of splicing correction by PNA-oligolysine conjugates. Journal of Controlled Release, 110: 595; 2006. 70. Wadia JS, Stan RV, and Dowdy SF: Transducible TAT-HA fusogenic peptide enhances escape of TAT-fusion proteins after lipid raft macropinocytosis. Nature Medicine, 10: 310; 2004. 71. Shiraishi T, Pankratova S, and Nielsen PE: Calcium ions effectively enhance the effect of antisense peptide nucleic acids conjugated to cationic tat and oligoarginine peptides. Chemistry & Biology, 12: 923; 2005. 72. Shiraishi T and Nielsen PE: Photochemically enhanced cellular delivery of cell penetrating peptidePNA conjugates. FEBS Letters, 580: 1451; 2006. 73. Bøe S, Hovig E: Photochemically induced gene silencing using PNA-peptide conjugates. Oligonucleotides, 16: 145; 2006. 74. Albertshofer K, Siwkowski AM, Wancewicz EV et al.: Structure-activity relationship study on a simple cationic peptide motif for cellular delivery of antisense peptide nucleic acid. Journal of Medicinal Chemistry, 48: 6741; 2005. 75. Maier MA, Esau CC, Siwkowski AM et al.: Evaluation of basic amphipathic peptides for cellular delivery of antisense peptide nucleic acids. Journal of Medicinal Chemistry, 49: 2534; 2006. 76. Nelson MH, Stein DA, Kroeker AD et al.: Arginine-rich peptide conjugation to morpholino oligomers: effects on antisense activity and specificity. Bioconjugate Chemistry, 16: 959; 2005. 77. El-Andaloussi S, Johansson H, Lundberg P and Langel Ü: Induction of splice correction by cellpenetrating peptide nucleic acids. The Journal of Gene Medicine, 2006 (in press). 78. Filipovska A, Eccles MR, Smith RAJ, and Murphy MP: Delivery of antisense peptide nucleic acids (PNAs) to the cytosol by disulphide conjugation to a lipophilic cation. FEBS Letters, 556: 180; 2004. 79. Füssl A, Schleifenbaum A, Göritz M et al.: Cellular uptake of PNA-terpyridine conjugates and its enhancement by Zn2⫹ ions. Journal of the American Chemical Society, 128: 5986; 2006. 80. Dragulescu-Andrasi A, Zhou P, He G, and Ly DH: Cell-permeable GPNA with appropriate backbone stereochemistry and spacing binds sequence-specifically to RNA. Chemical Communications, 244; 2005. 81. Hamzavi R, Dolle F, Tavitian B et al.: Modulation of the pharmacokinetic properties of PNA: Preparation of galactosyl, mannosyl, fucosyl, N-acetylgalactosaminyl, and N-acetylglucosaminyl derivatives of aminoethylglycine peptide nucleic acid monomers and their incorporation into PNA oligomers. Bioconjugate Chemistry, 14: 941; 2003. 82. McMahon BM, Stewart JA, Jackson J et al.: Intraperitoneal injection of antisense peptide nucleic acids targeted to the mu receptor decreases response to morphine and receptor protein levels in rat brain. Brain Research, 904: 345; 2001. 83. McMahon BM, Stewart JA, Bitner MD et al.: Peptide nucleic acids specifically cause antigene effects in vivo by systemic injection. Life Sciences, 71: 325; 2002. 84. Boules M, Williams K, Gollatz E et al.: Down-regulation of amyloid precursor protein by peptide nucleic acid in vivo. Journal of Molecular Neuroscience, 24: 123; 2004. 85. Kristensen E: In vitro and in vivo studies on pharmacokinetics and metabolism of PNA constructs in rodents. In Peptide Nucleic Acids: Methods and Protocols, PE Nielsen ed. Copenhagen: Humana Press (Totowa, NJ, United States); 2002, pp. 259–269. 86. McMahon BM, Mays D, Lipsky J et al.: Pharmacokinetics and tissue distribution of a peptide nucleic acid after intravenous administration. Antisense and Nucleic Acid Drug Development, 12: 65; 2002. 87. Sazani P, Gemignani F, Kang S-H et al.: Systemically delivered antisense oligomers upregulate gene expression in mouse tissues. Nature Biotechnology, 20: 1228; 2002.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 519

CHAPTER

19

Locked Nucleic Acid Troels Koch and Henrik Ørum

CONTENTS 19.1 19.2

Introduction .......................................................................................................................520 Chemistry of LNA and LNA Analogs...............................................................................521 19.2.1 Synthesis of LNA Amidites...............................................................................522 19.2.2 Key Reactions during the Synthesis of Amino- and Thio-LNA Amidites........524 19.2.3 Key Reactions during the Synthesis of LNA-Diastereoisomer Amidites .........526 19.2.4 Base Modifications of LNA ..............................................................................528 19.3 LNA Synthesis...................................................................................................................528 19.4 Structure of LNA and -L-LNA ........................................................................................530 19.4.1 LNA Hybrid Structure.......................................................................................530 19.4.2 -L-LNA Hybrid Structure ................................................................................531 19.5 Biophysical Properties of LNA and LNA Analogs...........................................................532 19.5.1 Thermal Denaturation of LNA Heteroduplexes................................................532 19.5.2 Thermal Denaturation of LNA Analog Heteroduplexes: Thio- and Amino-LNA.......................................................................................................533 19.5.3 Thermal Denaturation of LNA Diastereoisomer Heteroduplexes.....................534 19.5.4 Thermal Denaturation of LNA Containing Base Modifications.......................535 19.5.5 Thermodynamic Considerations........................................................................536 19.5.6 Hybridization Kinetics ......................................................................................536 19.5.7 Thermal Denaturation of LNA Triplexes ..........................................................537 19.6 Biochemical Properties of LNA and LNA Analogs..........................................................537 19.6.1 General Designs ................................................................................................537 19.6.2 Nuclease Resistance ..........................................................................................537 19.6.3 RNase H Recruitment of LNA and LNA Analogs............................................539 19.7 Inhibition of Coding RNA in Vitro ...................................................................................540 19.8 Inhibition of Micro-RNA in Vitro .....................................................................................544 19.9 Pharmacological Activity in Experimental Animals .........................................................546 19.9.1 Brief Summary ..................................................................................................547 19.10 Pharmacokinetics...............................................................................................................548 19.10.1 Plasma Pharmacokinetics ..................................................................................548 19.10.2 Biodistribution and Tissue Half-Life.................................................................548

519

CRC_8796_ch019.qxd

5/25/2007

520

22:16

Page 520


19.10.3 19.10.4

Uptake into Cells ...............................................................................................551 Excretion............................................................................................................552 19.10.4.1 Brief Summary................................................................................552 19.11 Toxicology .........................................................................................................................553 19.11.1 Acute Toxicities.................................................................................................553 19.11.2 Subacute Toxicities............................................................................................554 19.11.2.1 Brief Summary................................................................................556 19.12 LNA Drugs in Development .............................................................................................557 19.13 Conclusions and Future Directions ...................................................................................557 Acknowledgments ..........................................................................................................................558 References ......................................................................................................................................558

19.1 INTRODUCTION The concept of using single-stranded oligonucleotides to therapeutically inactivate RNA (antisense therapy) is enjoying a major renaissance. In part, interest is being driven by the prospect of effectively treating many diseases where the causative proteins have proven difficult or impossible to target by conventional drug approaches. Even greater impetus, however, comes from the explosive growth of information about the human genome and the genetic and molecular basis of disease, which has dramatically expanded the number of potential RNA targets for drug action over the past few years. In addition, enthusiasm is enhanced by the realization that antisense therapy may be the only realistic approach to target noncoding, regulatory RNAs, such as miRNAs, whose role in disease is being increasingly recognized. These regulatory microRNAs exert their function through Watson–Crick pairing to their target messenger RNAs providing strong evidence that effective antisense mechanisms are a natural biological feature of normal cell physiology. Our understanding of the technical, biological, and clinical issues that face antisense therapy has advanced significantly in recent years. Today it is clear that many clinical failures reported for the first-generation antisense drugs made from DNA phosphorothioates can be attributed to shortcomings in their physico-chemical properties. Notably, phosphorothioates exhibit modest metabolic stability and very low affinity for their target mRNA thus necessitating the use of rather large molecules and high doses to achieve adequate binding affinity and pharmacological activity in animals. To aggravate matters, large phosphorothioates are poorly taken up by cells and display size-proportional binding to several plasma proteins, causing potentially serious acute toxicities in animals that limit their therapeutic window. This admittedly simplified description of the clinical challenges that have faced phosphorothioates nevertheless suggests that novel chemistries with improved affinity and metabolic stability are key to the development of antisense oligonucleotides (AONs) with satisfactory clinical performance. Locked nucleic acid (LNA*) is a novel RNA analog characterized by high metabolic stability and truly unprecedented binding affinity to its complementary RNA and DNA sequence. In this chapter we review how these properties have led to the development of shorter-than-usual oligonucleotides that exhibit dramatically improved pharmacological activity and safety compared to oligonucleotides based on other chemistries. The chapter starts with an overview of the chemistry and physical and biochemical properties of LNA oligonucleotides. This is followed by a detailed description of the performance of LNA oligonucleotides against different classes of RNA targets (pre-mRNA, mRNA, and microRNAs), in vitro and in experimental animals. We also describe the pharmacokinetics of LNA oligonucleotides and their toxicity in rodents and monkeys and provide an outline of candidate *

Terminology: (1) LNA is defined as an oligonucleotide comprising one or more 2⬘-O,4⬘-C-methylene--d-ribofuranosyl nucleotide building blocks (⫽ LNA monomeric unit). (2) LNA-analog is defined as an oligonucleotide comprising one or more chemically modified LNA monomeric unit.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 521

LOCKED NUCLEIC ACID

521

LNA drugs in development. The most advanced of these, SPC2996, directed against the Bcl-2 mRNA, is currently undergoing an international phase IⲐII multicenter trial for the treatment of chronic lymphocytic leukemia (CLL). We end the chapter with a short summation and some thoughts on the future of LNA oligonucleotide-based therapy.

19.2 CHEMISTRY OF LNA AND LNA ANALOGS The name LNA was coined in 1997 by the Wengel group at the University of Copenhagen, and it was introduced in the first publication where the 2⬘-O,4⬘-C-methylene--D-ribofuranosyl nucleotide building block was incorporated into oligonucleotides [1] (Figure 19.1B). The term was selected to signal the structural fact that the bicyclic structure of LNA locks the conformational flexibility of the ribose ring. The design rationale for making the 2⬘-O,4⬘-C-oxymethylene link was to make a high-affinity RNA analog by preorganising—locking—the furanose in a North-type conformation. From a thermodynamic point of view the benefit was intended to be twofold: (1) to reduce the inherent entropy loss during nucleic acid hybridization, and (2) preorganizing the molecule in a high-affinity conformation. LNA showed unprecedented high-affinity binding to nucleic acids [1], but the full thermodynamic explanation for this is significantly more complex than initially anticipated (vide infra). Independently of this work the Imanishi group at the University of Osaka [53] published the synthesis of the 2⬘-O,4⬘-C-methylene--D-ribofuranosyl nucleoside a few months earlier. Obika et al. [2] coined later the name bridged nucleic acid (BNA) for the 2⬘-O,4⬘-C-methylene bicyclic structure that 2 years earlier had been named LNA. The term LNA has been accepted worldwide and is also used across a range of commercial aspects. It is the most frequently used term to cover oligonucleotides comprising one or more 2⬘-O,4⬘-C-methylene--D-ribofuranosyl nucleotides. Despite massive efforts the search for new DNA and RNA analogs with improved therapeutic properties has largely been unsuccessful. In this light the invention of LNA becomes even more remarkable since it was immediately realized by the Wengel group that the bicyclic structure of the LNA-monomer serve as a general template for the development of additional analogs of LNA with further therapeutically useful properties (vide infra). Prominent examples of such LNA-analogs are amino-Ⲑthio- and -L-LNA where the 2⬘-, 4⬘-bicyclic structure also is composed of five-membered rings (Figure 19.1B). The first LNA-analogs were reported in 1998 by Singh et al. [3–5]. Since then a variety of other chemically derivatized structures of LNA have been prepared which, for the purpose of this review,

(A)

B

O O

O

O O

P

O

−

LNA

(B)

O

B

O

O O

O

Amino-LNA

O O

S

B

O O

O

NH

P

O

B O

O

P

O P O

O

B

O

O

P

Thio-LNA

-L-ribo-LNA

Figure 19.1 Molecular structure of (A) LNA and (B) selected LNA analogs.

-D-xylo-LNA

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 522

522


will be divided into the following three main categories: (1) amino- and thio-modifications of LNA; (2) diastereoisomers of LNA; and (3) base modifications, which covers LNA having other bases than A, MeC, G, and T. More recently, additional 2⬘-, 4⬘-bicyclic analogs composed of six-membered rings have been synthesized by the Imanishi group. Prominent representatives of this class are 2⬘-,4⬘-BNANC and 2⬘-,4⬘-BNACOC (BNA-NC, BNA-COC) [6,7]. When these conformationally restricted molecules are included in oligonucleotides they show RNA selective binding, have good nuclease resistance and the 2⬘-,4⬘-BNANC thymidine residue increases the Tm against RNA with 5–6°C per modification. These new analogs confirm the high affinity generality of the bicyclic space offered by LNA. Since this review covers only 2⬘-, 4⬘-bicyclic structures composed of five-membered rings, further information of these interesting structures can be appreciated from the literature [6,7]. In the subsequent sections of this chapter the synthesis of LNA-amidites will be described in detail. This is by far the most well-described and optimized synthesis sequence, and it has been performed in multikilogram scales (vide infra). Today, LNA-amidites are commodities and widely used for both academic and commercial purposes. The syntheses of the LNA-analog amidites will also be dealt with but from a more general perspective, where the focus will be on key intermediatesⲐ reactions during the synthesis and on specific synthesis improvements.

19.2.1 Synthesis of LNA Amidites Two different strategies have been used for the LNA amidite synthesis. The Wengel group introduced a convergent strategy using protected glucose as the starting material (Figure 19.2A) [1,8,9]. This strategy employs a common sugar coupling intermediate to which the nucleobases are coupled via a classical Vorbrüggen reaction (Figure 19.2B) [10,11]. The second strategy was introduced by the Imanishi group and here the corresponding RNA nucleosides are used as starting materials [12,53]. Both of these strategies have different pros and cons, but in this review we will focus on the convergent synthesis route that over the past 5 years have proven to be very effective during scale-up and has provided remarkable yields and qualities of the LNA amidites. The starting material is the commercially available 1,2:5,6-di-O-isopropylidene--D-glucofuranose (Figure 19.2A, 1). By electrophilic-assisted dimethyl sulfoxide (DMSO) oxidation of the 3⬘-OH and subsequent stereoselective reduction by sodium borohydride, 1,2:5,6-di-O-isopropylidene-D-allofuranose (2) is formed [13]. Protection of 3⬘-OH is done by alkylation with benzylbromide and the 5,6-isopropylidene group is selectively removed in diluted acetic acid. Oxidative cleavage of the diol with periodate followed by aldol condensation and Cannissaro reaction yields the 4⬘-C-hydroxymethyl furanose (Figure 19.2A, 3). Formation of the bicyclic structure is based on selective reactions of the two alcohols (5⬘-OH and 4⬘-hydroxymethyl). Originally this was done by “selective” 5-O-benzylation followed by tosylation of the 4-C-hydroxymethyl group [1,8,9,14]. However, it turned out that the selectivity was rather poor and the low yield of this crucial step reduced the overall yield of all four monomers significantly. Koshkin et al. [15] reported in 2001 a marked improvement of the synthesis strategy. Instead of using the “selective” benzylation, the alcohol groups in 3 were permesylated (bismesylate, Figure 19.2A, 4). The 5-O-methanesulfonyl group serves as a suitable protecting group of the 5⬘-OH, and the 4-C-methanesulfonoxy-methyl group serves as a suitable activation group for nucleophilic substitution by the 2⬘-OH that is liberated by saponification after the coupling [15–17]. Prior to the coupling and ring closure the diacetylated furanose (Figure 19.2A, 5) is made in situ and the anomeric mixture of 5 is used as a common glycosyl donor for the protected or nonprotected nucleobases. Since all four LNA amidite syntheses follow the same principal reactions only the LNA-T amidite reactions will be described here in detail. The interested reader may consult excellent publications and reviews for further details [8,14,15,18], but a few synthetic highlights and important improvements of these reactions will be touched upon here.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 523

LOCKED NUCLEIC ACID

523

O

(A)

O

O OH O

O O O

O

3, NaIO4 HO 4, H2CO, NaOH

O

OH

2, NaBH4

Glucofuranose (1) 1, NaH, BnBr 2, 80% AcOH HO

O

1, DMSO-P2O5

Allofuranose (2) MsO

MsCl, Py

O O

MsO

OBn O

(3)

O O OBn O

Bismesylate (4)

MsO

O

MsO

OAc

OBn OAc

Coupling intermediate (5)

(B)

DMTO

5 steps

i Pr2N

MsO

O O P O(C H )-CN 2 4

NH

NH O

CBz

O

O

MsO

Me

O

N

O

5 steps

HO

OBn OAc

N

O HO

DMTO

O 2 steps

O (6)

i Pr2N

BzHN

O

T


N N MsO MsO

O

OAc

OBn OAc

MsO MsO

N

O

N

DMTO 7 steps

OBn OAc i Pr2N

ABz O O O P O(C H )-CN 2 4

Cl N N MsO MsO

O

N

OBn OAc

N

NH2

DMTO

6 steps

i Pr2N

O

GDMF


Figure 19.2 Key steps and intermediates in the (A) convergent part of the LNA amidite synthesis and (B) divergent part of the LNA amidite synthesis.

Reaction of 5 (Figure 19.2A) with silylated thymine under classical Vorbrüggen conditions [10,11] provides the glycosylation reaction stereo selectively and the beta-configured nucleoside is obtained in high yield. Liberation of the 2⬘-OH by saponification mediates fast intramolecular 2⬘-C, 4⬘-C-oxymethylene cyclization. The 5-O-methanesulfonyl group is removed in a two-step manner by first substitution with benzoate and second saponification of the benzoate. Catalytic hydrogenation

CRC_8796_ch019.qxd

524

5/25/2007

22:16

Page 524


of the 3⬘-O-benzyl group affords the LNA-T nucleoside (Figure 19.2B, 6, the “T-Diol”). This latestage intermediate is then 5⬘-OH DMT protected and 3⬘-OH phosphitylated to provide the LNA-T amidite. It is noteworthy that all LNA-DMT-protected nucleosides are phosphitylated according to the same general procedure in which bis-amidite (2-cyanoethyl-N,N,N⬘,N⬘-tetraisopropylphosphorodiamidite) and 0.7 equivalent 4,5-dicyanoimidazole (DCI) is used. This improved procedure produces the amidites in yields higher than 90% after column purification [19]. The LNA-T nucleoside (Figure 19.2B, 6) serves as the starting material for the synthesis of the LNA-MeC nucleoside via the classical reaction of thymine with 1,2,4-triazole and POCl3 to afford methyl-cytosine [15,20]. It is well known that glycosylations performed under Vorbrüggen conditions with protected purines provide both the N-7 and the N-9 isomers, where the N-9 is the wanted isomer [10,11]. The N-9 isomer is the thermodynamically favored product and will gradually be formed at elevated temperature. In the case of protected adenine the N-9 isomer is formed at elevated temperature in high yield, whereas protected guanine (i-Bu) always provide the N-7 isomer in ca. 15% yield [15]. A marked improvement of the LNA guanine synthesis was reported in 2004 by Rosenbohm et al. [21]. Here the guanine nucleoside was obtained regioselectively by coupling with the guanine synthon: 2-amino-6-chloro-purine. The 6-oxo-group of guanine is formed in a subsequent step where the 6-chloro atom is substituted with 3-hydroxy-acrylonitrile that via elimination forms the 6-oxo group. Besides providing the N-9 isomer in high yield, the 6-chloro position of the 2-amino-6-chloro-purine base can be substituted by other nucleophiles to provide a range of naturalⲐunnatural bases like di-amino-purines [16,21]. The overall yields of the LNA amidite syntheses were initially very low. The yields of the LNApurine syntheses were 1–5% and the yields for the LNA-pyrimidine syntheses were 5–10%. Thanks to a further medicinal chemistry effort over the past 6 years the yields are now in range of 25–40%. This is a significant achievement since the total number of synthetic steps of the four amidites is 34, and the total synthetic steps for the individual monomers are ranging from 14 to 17. This work has mainly been done at Exiqon AⲐS, Proligo GmbhⲐInc, Cureon AⲐS, and Santaris Pharma AⲐS, where many talented chemists have made their contributions to making LNA amidites cost-efficient drivers for the commercialization of LNA. Today, LNA amidites are produced in multikilogram scale, and the early intermediates, allofuranose and bis-mesylate are manufactured in scales ranging from 100 to 250 kg. The significant optimization of the entire synthesis sequence combined with the economy of scale has reduced the costs of LNA amidites to a very competitive level. For manufactures larger than 100 kg scale the average cost per step is now around $1, and with the knowledge available today of the LNA amidite synthesis we can predict that this level will be reached for the entire amidite synthesis. 19.2.2 Key Reactions during the Synthesis of Amino- and Thio-LNA Amidites The first LNA-analog to be synthesized was amino-LNA [3,4]. The amino group of the nucleoside was introduced via a double nucleophilic substitution reaction on a di-O-tosylated nucleoside (Figure 19.3, 1) at 130°C in benzylamine to provide the configuration of amino-LNA monomer (Figure 19.3, 3) via a postulated 2,2⬘-anhydro nucleoside (Figure 19.3, 2) intermediate. The benzyl groups were removed by transfer hydrogenation and the resulting fully deprotected amino-LNAnucleoside could selectively be protected on the amine with trifluoroacetyl followed by the standard DMT and phosphitylation reactions. Rosenbohm et al. [22,23] published later an improved synthesis of the amino-LNA nucleoside. This synthesis strategy is convergent to a late stage with the LNA amidite synthesis and can, therefore, benefit from the bulk manufactures of the LNA amidites. After the coupling with thymine the 2⬘-OH is liberated under mild conditions to avoid cyclization. The 2,2⬘-anhydro nucleoside (Figure 19.4, 2) is formed and subsequently hydrolyzed and triflated. The 2,2⬘-anhydro nucleoside is a key intermediate for both strategies that therefore are restricted to syntheses of pyrimidine amino-LNA nucleosides. However, the purines can be made by a transnucleosidation reaction that recently has been published. According to this approach the triflate (Figure 19.4, 3) is reacted with azide by which the configuration at C2⬘ is inverted. The amine is obtained by reduction of the azide and it is subsequently protected with trifluoroacetic anhydride. This compound serves as

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 525

LOCKED NUCLEIC ACID

525

O NH BnO

O

O

O

N

NH

N

O

BnNH

TsO

TsO

OBn OTs

N O O

BnO

1

BnNH

OBn

BnO

O

O

NBn

BnO

2

N

3

Figure 19.3 Key steps and intermediates in the amino-LNA amidite synthesis.

O

O NH

MsO MsO

O

N

OBn OAc

O

O

N

1, NH3 in MeOH 2, MsCl, Py; 3, DBU

N O O

MsO MsO

OBn

NH 1, H2SO4 (dil.)

N O R

MsO

2, Tf2O, DMAP, Py MsO

O

OBn R = OTf

1

2

3

Figure 19.4 Key steps and intermediates of the improved synthesis of the amino-LNA amidite.

a common intermediate for the transnucleosidation reaction with 2-amino-6-chloropurine and N6-benzoyladenine providing the corresponding purines in 57 and 58% yield, respectively [24]. The trivalent nature of the amino group in amino-LNA offers conjugation opportunities [4,25]. In contrast to a traditional 5⬘-/3⬘-OH end conjugation, ligand linking via an internal position offers new perspectives and the effect of the conjugate can be multiplied as the nucleosides are incorporated into the oligonucleotide [26]. Also, it can be anticipated that the conjugate will exhibit different properties since the location internally, as compared to terminally, of an oligonucleotideⲐhybrid duplex will be different. Sorensen et al. [25] attached a series of ligands to amino-LNA. N-benzoyl and N-aminoethyl showed in particular good hybridization properties, but even a large group as pyrene linked via a methyl group provided good hybridization to complementary DNAⲐRNA. The excited complex of two pyrenes is known to give rise to a strong excimer band at 430–530 nm. This was used to demonstrate interstrand “communication” in duplexes comprising amino-LNA-nucleosides on opposing strands [27,28]. The hybridization can be followed by spectroscopy, since the pyrene groups are structuredⲐstacked during duplex formation. An analogous excimer effect of pyrenes on opposing strands is seen when pyrene is linked to amino--L-LNA [29]. Synthesis of the thio-LNA nucleoside posed a new synthetic challenge (Figure 19.1B) [3,30]. The synthetic strategy for the formation of the bicyclic structures of LNA and LNA analog nucleosides is based on the reductive removal of the 3⬘-O-Bn-protection group after cyclization, but when sulfur is present catalytic reductions are not possible. The original synthesis used bis-protection of the 5⬘- and 3⬘-alcohols with TIPS to avoid the problem, but the overall yield was rather low [3]. Pedersen and Koch [31] reported an improved procedure for the synthesis of the thio-LNA-T and Me C nucleoside. The synthesis was convergent with the improved amino-LNA procedure (vide supra) and uses the same late stage 2,2⬘-anhydro nucleoside intermediate (Figure 19.4, 2). The key step in the synthesis is the removal of the 3⬘-O-Bn protection group without formation of the 4⬘-C,3⬘-O oxetane. The rigid structure of the 2,2⬘-anhydro nucleoside intermediate prevents that and the protection group on the 3⬘-OH can be exchanged with benzoyl that after cyclization with Na2S can be removed by hydrolysis (Figure 19.5). As for the amino-LNA nucleoside synthesis only the pyrimidine nucleosides can be made by this procedure.

CRC_8796_ch019.qxd

5/25/2007

22:16

526

Page 526

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION O

O

MsO MsO

N

N

N O O

N O O

OBn

1

1, Pd/C, H2 2, BzCl, Py

MsO MsO

OBz

O NH 1, H2SO4 (dil.) 2, Tf2O,DMAP 3, Na2S, DMF

MsO

O

S

BzO

2

N

O

3

Figure 19.5 Key steps and intermediates of the improved synthesis of the thio-LNA amidite.

19.2.3 Key Reactions during the Synthesis of LNA-Diastereoisomer Amidites Rajwanshi et al. [32–34] reported in 1999 the synthesis and basic properties of thymine xylo-LNA (Figure 19.1B). The xylo-LNA nucleoside is made from 4-C-hydroxymethyl--Lthreo-pentofuranose (Figure 19.6A, 1). Benzoylation of 4-C-hydroxymethyl--L-threo-pentofuranose and subsequent removal of the isopropylidene protection group afforded the xylo-coupling sugar 2 (Figure 19.6A) that is coupled to thymine under Vorbrüggen conditions (Figure 19.6A, 3). The 4⬘-C-hydroxymethyl group is—in a moderate yield—tosylated but cyclization can only proceed if the 5⬘-OH was DMT protected [32]. Reductive debenzylation removes also the DMT protecting group providing the fully deprotected xylo-LNA-T nucleoside. DMT protection and phosphitylation is performed according to the traditional procedures [32]. Xylo-LNA can only give rise to increased Tm when fully modified (3–4°C per modification). Therefore, it does not have the important property of cooperative binding as LNA and -L-LNA (vide infra) [33–35]. Håkansson et al. [36] has reported several syntheses of thymine -L-LNA amidites. The most attractive procedure converts the intermediate 3 derived for the xylo-LNA nucleoside synthesis (Figure 19.6A, 3) into the corresponding trimesylate (Figure 19.6B, 1). Treatment of the trimesylate with aqueous base affords the -L-LNA bicyclic structure and hydrolyzes the 5⬘-O-Ms. Reverting the configuration at C2⬘ is proposed to proceed via the 2,2⬘-anhydro nucleoside intermediate. The 3⬘-O-Bn group is removed by catalytic hydrogenation and the 5⬘-OH is Dmt protected according to the traditional procedures to provide 4 (Figure 19.6B). The MeC -L-LNA nucleoside is prepared from the thymine nucleoside according to the same procedures as described for LNA (vide supra). The synthesis of adenine -L-LNA was reported in 2001 [37]. The synthesis of the diastereoisomer -L-xylo is performed to a procedure closely resembling the one described here for -L-LNA. The details can be appreciated from Håkansson et al. [36]. Recently, a new chemical modification has been synthesized where the oxygen of the 2⬘-O, 4⬘-C-methylene biradical of the -L-LNA nucleoside is replaced with nitrogen, amino--L-LNA [38]. In the preferred synthesis route the amino functionality is introduced—as in the improved synthesis of the amino-LNA nucleoside [22] via the azide (Figure 19.6C, 3). Surprisingly, both anomers of the triflated nucleoside underwent smoothly nucleophilic substitution with azide to provide 3 (Figure 19.6C) in high yields. Compound 3 was acetolyzed (Figure 19.6C) and the coupling of thymine provided the Ⲑ-anomer mixture in 80% yield. Subsequent reduction of the azide under Staudinger conditions [22] provided a separable mixture of the nucleosides. The final phosphoramidite was obtained over 15 steps in an overall yield of 4% (Figure 19.6C, 1). When this molecule was incorpotated into oligonucleotides a significant increase in Tm against RNA was observed (vide infra). Amino--L-LNA is very interesting since it combines the structure and configuration of -L-LNA with the changed functionalities that the trivalent amine offers. The -configured isomer of LNA—-D-LNA or just -LNA—has also been synthesized [39,40]. In contrast to the -isomer incorporation of -LNA monomeric units leads to significant

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 527

LOCKED NUCLEIC ACID

527

(A) HO

OBn O O

HO

BzO

1, BzCl, Py

OBn O

2, 80%, AcOH BzO

O

OAc OAc

1

2 O

O NH

1, BSA, thymine, TMS-Tf HO 2, NaOMe, MeOH

OBn O

HO

N

NH

O

1, TsCl, Py

OH O

HO

2, DmtCl, Py 3,H2, Pd/C

OH

N

O

O

4

3

(B) O

O

NH

NH HO

OBn O

HO

O

N

MsCl, Py

OBn O

MsO MsO

OH

N

O

OMs

1

2 O

O NH

N OBn O O

NaOH

NH

O

HO

N OH O O

1, H2, Pd/C 2, DmtCl, Py

O

DmtO

3

4

(C) HO

OBn O

1, MsCl, Py O

HO

O

OBn O

2, HCl (2.5%) MsO MeOH

1

OMe OH

2

1, Tf2O, Py MsO 2, NaN3

MsO

MsO

1, H2SO4 MsO OBn N3 O OMe 2, T, BSA, MsO MSOTf

3

OBn N3 O N

O NH

O

4

Figure 19.6 Key steps and intermediates of the (A) xylo-LNA amidite synthesis, (B) -L-LNA amidite synthesis, and (C) amino -L-LNA amidite synthesis.

decreased affinities in most oligonucleotide designs against both DNA and RNA [41,42]. But fully modified -LNA oligonucleotides display significantly increased affinities towards RNA when hybridized in the parallel orientation [42,43]. However, -LNA has not been used in antisense technology.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 528

528


19.2.4 Base Modifications of LNA In the improved synthesis procedure of the LNA-G amidite, 2-amino-6-chloropurine is used as guanine synthon (Figure 19.2B). Rosenbohm et al. [21] used this synthon to prepare diaminopurine nucleosides by treating the protected LNA-2-amino-6-chloropurine nucleoside with saturated ammonia. This procedure is convergent with the LNA-G synthesis and affords the final diaminopurine phosphoramidite in (42%) yield counted from the cyclized 5⬘-O-MsⲐ3⬘-O-Bn-protected 2-amino-6-chloro derivative [21]. The 6-chloro atom can be removed reductively by treatment with ammonium formiate and 20% Pd(OH)2ⲐC affording 2-amino purine LNA nucleoside [16]. In the synthesis of the hypoxanthine LNA nucleoside the coupling affords a ratio of N-9ⲐN-7 isomers of 4:1. The isomers are separable chromatographically at high pH [16]. A variety of LNA C-nucleosides have been synthesized. Among these are Pyrene, phenyl, pyrrole, imidazole, and pyridine just to mention a few. The interested reader can consult the literature for further syntheses information of these modifications [44–51].

19.3 LNA SYNTHESIS Synthesis of LNA oligonucleotides follows the well-known solid-phase principles of the phosphoramidite approach [69,70], and it has been performed on most commercial available automated synthesizers [71]. LNA-amidites [19] have a close structural resemblance to DNAamidites and use standard DNA protecting groups: DMT for the 5⬘-OH, Bz for adenine and 5methylcytosine, and DMF or i-Bu for guanine. In the early publications no particular emphasis was made on LNA synthesis, except the need for prolonged coupling times, and average cycle yields of ⬎98% were reported [1,55,60]. However, it was soon realized that modifications of the standard DNA protocols were needed for robust LNA synthesis. As mentioned, it was early observed that the LNA-amidite coupling kinetics were slower when compared to DNA-amidites, and that the standard activator, tetrazole, did not provide satisfactory coupling yields. In contemporary optimized protocols, tetrazole is replaced with 4,5-dicyanoimidazole (DCI), which is used in molar excess to the amidites (1.2–2 times). For small-scale syntheses (1–15 mol) a molar excess of the amidites of four to eight times is used. The recommended coupling time depends on the scale but ranges from 6 to 15 min [72]. In DNA synthesis the phosphite is flush oxidized with aqueous iodine. The reaction time is only ca. 15 s and very high yields are obtained (⬎99%). For LNA syntheses flush oxidation is not adequate and the oxidation time has to be prolonged to 1–2 min [73,74]. When LNA-phosphorothioates (PS) are made the classical oxidation reagent—Beaucage reagent—can be used, but more powerful reagents such as dimethylthioramdisulfideⲐxanthanhydrideⲐphenylacetyldisulfide (PADS)Ⲑ3-ethoxy1,2,4-dithiazoline-5-one(EDITH)Ⲑ1,2,4-dithiazoline-3,5-dione(DtsNH) are recommended. As with iodine oxidation, prolonged oxidation is used during thiolation (2–3 min) [74]. It is clear from the LNA synthesis optimizations, not surprisingly, that locking the conformation by introducing the additional ring in LNA changes the chemical properties of the 3⬘-OHⲐ phosphoramiditeⲐ phosphite. However, by using these minor changes to standard DNA synthesis protocols, LNA synthesis with phosphordiester or phosphorothioate internucleoside linkages can be performed in yields comparable to the corresponding DNA syntheses [73,74]. All subsequent manipulations, work-up, and characterization of LNA, follow the identical procedures developed for DNA synthesis [74]. Synthesis of LNA analogs follows essentially the same protocol as for LNA. For amino- and thio-LNA synthesis coupling times of 12 min are employed but otherwise standard DNA cycles are used [4,30]. For -L-LNA and xylo-LNA synthesis slightly shorter coupling times are used (10 min) and the amidites are activated with either tetrazole or pyridinium hydrochloride [33,75]. Stereo-controlled synthesis of LNA with PS internucleoside linkages has been reported using the exact analogous procedure reported for deoxyoligonucleotides [76]. The stereo selectivity for

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 529

LOCKED NUCLEIC ACID

529

making an LNA T-MeC dimer was over 96% and the absolute configuration of the isomers—SpⲐRp—is assigned. The Sp dimer is resistant against snake venom diesterase digestion for more that 24 h. Besides phosphordiester and PS internucleoside linkages, methylphosphonate, N5⬘- phosphoramidate and N3⬘-phosphoramidate linkages have been reported for LNA (Figure 19.7) [77–79]. The methylphosphonate internucleoside linkage is easily introduced via the corresponding monomeric methylphosphonamidite (Figure 19.7, 1) that is used directly under standard oligosynthesis conditions [77]. The coupling time is increased to 15 min and the reported coupling yield is 83%. LNA with 3⬘-methylphosphonate internucleoside linkages have decreased affinities compared to LNA diesters. N5⬘- phosphoramidate linkages can also be introduced directly during oligosynthesis via the 5⬘-Mmt-NH-protected LNA phosphoramidite (Figure 19.7, 2). The coupling yield for this LNAanalog is reported to be 94% [79]. The affinity increase per modification is 2–5°C against respective DNA and RNA. LNA comprising N3⬘-phosphoramidate is more complicated to prepare. The N3⬘-phosphoramidate is introduced via a dimer composed of 5⬘-ODMT-LNA-T-N3⬘→ P5⬘-DNA-T3⬘-phosphoramidite (Figure 19.7, 3) [78]. LNA phosphoramidate hybrid duplexes have almost the same thermal stability as LNA diesters with affinity increases per modification of 4–11°C against respective DNA and RNA. LNA without phosphate in the internucleoside linkage has also been prepared by Lauritsen and Wengel [80]. The native diester is here substituted with an amide linkage C3⬘-O-CH2-CH2NH-C(⫽O)-C4⬘ (∗). Four dimers comprising this internucleoside linkage is reported: 5⬘-ODMT-dT∗ L L L dT-3⬘-phosphoramidite (A), 5⬘-ODMT-T — ∗dT-3⬘-phosphoramidite (B), 5⬘-ODMT-T — ∗T — -3⬘L phosphoramidite (C), and 5⬘-ODMT-dT∗ T — -3⬘-phosphoramidite (D). Since the dimers are 5⬘-ODMTⲐ3⬘-phosphoramidite protected they can be directly incorporated into oligonucleotides. The coupling times are increased compared to LNA cycles from 10 to 20 min. Oligonucleotides comprising these dimers have significantly decreased hybrid stabilities, but a Tm increase of 2–9°C per modification is observed for (D) against respective DNA and RNA. This can be explained by the fact that the 5⬘-dT can accommodate by its more flexible and dynamic nature of the long amide L linkage, and that the 3⬘-T — can tune the conformation of the downstream dT towards higher Tm [80]. Oligonucleotides with phosphoramidate and amide internucleoside linkages have an interesting perspective in antisense since the nuclease resistance is much increased compared to oligonucleotides comprising native diesters and PS [78,79]. LNA synthesis has over the past years been scaled up from milligram to hundreds of gram scales. LNA synthesis is very “portable” and the improvements obtained in small scale are directly transferable to large scales. Today, LNA oligonucleotides are routinely made in scales of hundreds of grams in yields comparable to DNAⲐPS. O NH DmtO

O

O NH

DmtO

N

O O

(i-Pr)2N

1

P

O

NH MMTrHN

O CH3

O O

(i-Pr)2N

N

P

2

O

N

O

MeO P O O

OCH2CH2CN

O NH

O O

O

N

O

N

O

O (i-Pr)2N

P

OCH2CH2CN

3

Figure 19.7 Chemical structures of the amidites used to make methylphosphonate (1), N5⬘- phosphoramidate (2), and N3⬘-phosphoramidate (3) linkages.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 530

530


19.4 STRUCTURE OF LNA AND -L-LNA Natural dsDNA exists at physiological pH as a B-form helix, whereas dsRNA exists as an A-form helix. This morphological difference is originated in the difference in the preferred sugar conformations of the deoxyriboses and the riboses. The furanose ring of deoxyribose exists at room temperature in an equilibrium between C2⬘-endo (S-type) and C3⬘-endo (N-type) conformation with an energy barrier of only ⬃2 kcalⲐmol (Figure 19.8) [52]. The C2⬘-endo (S-type) conformation gives rise to the B-form helix, whereas the C3⬘-endo (N-type) conformation gives rise to the A-form helix. For deoxyribose the S-type conformation is slightly lowered in energy (⬃0.6 kcalⲐmol) compared to the N-type and explains why DNA is found in the S-type conformation. For ribose the preference is for the N-type and thus, RNA adopts the A-form helix associated with higher hybridization stability. The structure of LNA and -L-LNA has been comprehensively studied by NMR and x-ray analyses, and it is evident that LNA and -L-LNA adopt right-handed helixes and hybridize according to the antiparallel Watson–Crick base-pairing pattern. The LNA–nucleoside has a fixed C3⬘-endo sugar pucker (N-type, 3E) [53–55], a sugar pucker—formalistically—also assigned for the -L-LNA nucleoside, since the nucleoside is L-ribo configurated. The -L-LNA nucleoside is often referred to as having a C2⬘-endo and thus “S-type” when compared with D-ribo-configured sugars (e.g., LNA nucleosides). 19.4.1 LNA Hybrid Structure A number of NMR, CD, and x-ray studies have been conducted to study the structure of LNA:RNA hybrids [54–59]. The glycosidic angle of the included LNA–nucleosides is in the anti range and upon inclusion of an increasing number of LNA–nucleosides the overall duplex geometry is progressively altered towards A-type. When only three LNA–nucleotides are included in a 9-mer oligonucleotide the hybrid adopts an almost canonical A-type duplex geometry. This correlates with the observed helical thermostability per LNA–nucleoside that reaches a maximum with ⬍50% LNA nucleotides [1,14,54,60]. This feature of “structural saturation” can be explained from the conformational changes of the deoxynucleotides by the flanking LNA–nucleotides. In unmodified deoxyoligonucleotides the preferred conformation is S-type, corresponding to a low-percentage N-type (Table 19.1, column “DNA”). When one LNA–nucleoside is included the percentage N-type of the 5⬘-adjacent and in particular in the 3⬘-adjacent deoxynucleotide is significantly increased (Table 19.1, column “LNA1”). This is further demonstrated when three LNA–nucleosides are included (Table 19.1, column “LNA3”). This phenomenom of “structural saturation” is a very interesting basic property of LNA since only a few inclusions are able to induce a conformational change of the entire oligonucleotide towards a high-affinity structure. Or in other words, the high-affinity conformation of a single LNA inclusion is amplified by its induction of a conformational change of juxtaposed DNA nucleotides. The consequence of “structural saturation” is that a few LNA inclusions give rise to a higher affinity increase per residue than many inclusions. This property of LNA is, in contrast, to

O

B O

B

O O O

O

C2′-endo (S-type) Figure 19.8 Furanose conformations.

C3′-endo (N-type)

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 531

LOCKED NUCLEIC ACID

531

Table 19.1 Sugar Puckers of the Deoxyriboses in Oligonucleotides Containing LNA and -L-LNA Nucleosides Hybridized to Complementary RNA and Expressed as % of N -type Sugar Conformation

C1 X G3 A4 X A6 X G8 C9

DNA

LNA1

LNA3

-L-LNA3

64 16 23 38 31 27 20 15 36

56 12 20 ⬃50a na ⬎90 21 17 27

47 na ⬎90 ⬎90 na ⬎90 na ⬎90 70

25 na 37 24 na 30 na 46 43

Note: The first column represents the generic oligonucleotide: 5⬘-CXGAXAXGC-3⬘, where X represents (X ⫽ dT, TL, or LTL). Thus, the four oligonucleotides are DNA, d(CTGATATGC); LNA1, d(CTGATLATGC); LNA3, d(CTL GATL ATL GC); -L-LNA, d(CLTL GAL TL A L T L GC). na, no analysis of locked structures. a Estimated value.

many classical 2⬘ modifications (2⬘-O-Me and 2⬘-MOE) that show the exact opposite trend where the largest effect per residue is reached when the strand is fully modified [61]. The LNA–nucleotides fit perfectly to the A-type duplex structure with the 2⬘-O, 4⬘-C methylene bridge positioned at the brim of the minor groove of the duplex and with the backbone torsion angles as the standard A-type genus [54]. The complementary RNA strands seems unperturbed by the opposite LNA strand [54–59]. It has recently been demonstrated that the high-frequency dynamics of a nucleic acid duplex is significantly damped by inclusion of LNA on one strand [62]. Thus, the locked structure of the LNA–nucleoside translates into more rigid and less dynamic helixes. When LNA oligonucleotides are hybridized to DNA a general transition toward an A-type helix is seen [56,58,63,64]. With up to three modifications in a nonamer conformational changes are only seen in the LNA strand and the complementary DNA strand retains its native B-type geometry. For fully modified LNA the complementary DNA strand begins to alter its geometry. Thus, the sugars are changed from S-type conformation to an equilibrium of NⲐS-type. For both LNA:RNA and DNA hybrids increased stacking of the nucleobases are observed. 19.4.2 -L-LNA Hybrid Structure The structure of -L-LNA:RNA hybrids have been studied by NMR and MD [65–68]. As for LNA–nucleosides the glycosidic angle of -L-LNA nucleosides is in the anti range with the 2⬘-O,4⬘C methylene bridge positioned at the brim of the major groove. Since the -L-LNA nucleoside is an unnatural stereochemistry it is basically futile to label it as N- or S-type, but the fact is that when the -L-LNA nucleoside is incorporated into deoxyoligonucleotides it acts as a B-type mimic [66], and in contrast to LNA–nucleotides -L-LNA-nucleotides do not induce any significant conformational change of neighboring deoxynucleotides (Table 19.1, column “-L-LNA”). Owing to these structural facts the overall structural features of -L-LNA:RNA duplexes are the same as for the DNA:RNA. However, -L-LNA nucleosides alter the sugar–phosphate backbone slightly, so the phosphate groups are rotated into the minor groove compared to the unmodified hybrid. When -L-LNA is hybridized to DNA the duplex features all the characteristics for B-type duplexes. For both -L-LNA:RNA and DNA hybrids increased stacking of the nucleobases is observed. Both LNA and -L-LNA nucleosides fit perfectly within the Watson–Crick framework. This explains why these modifications can be mixed with nucleic acid nucleosides and analogs thereof and act cooperatively. Interestingly, when LNA and -L-LNA nucleosides are aligned in space the

CRC_8796_ch019.qxd

5/25/2007

22:16

532

Page 532


three key atoms N-1, O-3⬘, and O-5⬘ overlay [34]. These key positions are of course fully correlated with the Watson–Crick framework and it also explains why LNA and -L-LNA-nucleosides can be mixed in the same oligonucleotide and act cooperatively (vide infra) representing respectively an A-type mimic and a B-type mimic. 19.5 BIOPHYSICAL PROPERTIES OF LNA AND LNA ANALOGS 19.5.1 Thermal Denaturation of LNA Heteroduplexes The most intriguing property of the LNA–nucleotide is that it fits so perfectly within the Watson–Crick framework. LNA–nucleotides can be incorporated in any combination with DNAⲐRNA nucleotides, and with any analog hereof that also fits within the Watson–Crick framework. LNA oligonucleotides obey the WⲐC-hydrogen bonding rules and form right-handed helices (vide supra). The hybrid stability is determined by classical thermal denaturation (Tm), and since almost all hybrid duplexes show regular cooperative sigmoid melting curves the Tm is conveniently determined by the first derivative of the Tm curves. The extraordinary high affinity of LNA was the immediate property described for LNA [1]. Since then this property has been confirmed in numerous papers [1,5,9,14,55,81]. When LNA monomers are included in either DNA or RNA each residue adds to the affinity in an additive manner (Table 19.2). When a few LNA residues are included a Tm increase of 6–7°C per modification is observed (Table 19.2, entry 2, 5, and 6). When LNA residues are included in PSs the affinity increase per modification is even larger (⬇10°C against RNA; Table 19.2, entry 4–5, and 8–9). For fully modified LNA oligonucleotides the increase per modification is reduced to 4–5°C (Table 19.2, entry 7). This is a general pattern for LNA: the affinity increase per LNA-monomer is larger the fewer incorporated (Table 19.2, entry 1–7) [81]. The reason for this is “structural saturation” of LNA (vide supra). LNA residues are therefore, the most efficient way of affinity gain, and a single modification in an oligonucleotide may be enough to provide enabling properties of the oligonucleotide [82]. When six nucleotides (nts) of 2⬘-O-Me RNA are included in a DNA oligonucleotide the Tm decreases against the DNA complement and increases only 1°C per modification against the RNA complement (Table 19.2, entry 4, 10–11). When the oligonucleotide becomes fully 2⬘-O-Me Table 19.2 Hybridization Studies with 14-ⲐⲐ 9-mer LNA against Complementary DNA and RNA Entry

Sequence

DNA Compound Tm (oC)

RNA Complement Tm (oC)

1: Reference DNA 5⬘-dT14-3⬘ 2: LNA Ⲑ DNA chimera 3: LNA Ⲑ DNA chimera 4: Reference DNA 5: LNA Ⲑ DNA chimera 6: LNA Ⲑ RNA chimera 7: Fully modified LNA 8: Fully PS 9: PS-LNA Ⲑ -DNA chimera 10: 2⬘-O-Me-RNA 11: 2⬘-O-Me-RNA/DNA chimera 12: LNA Ⲑ 2⬘-O-Me-RNA chimera

5⬘-dT14 5⬘-d(T)3(TLT)4T3 5⬘-(TL)13T 5⬘-d(GTGATATGC) 5⬘-d(GTLGATLATLGC) 5⬘-r(GTLGATLATLGC) 5⬘-(GLTLGLALTLALTLGL MeCL) 5⬘-d(GSTSGSASTSASTSGSC) 5⬘-d(GSTLSGSASTLSASTLSGSC) 5⬘-(GTGATATGC) 5⬘-(GTGATATGC) 5⬘-(GTLGATLATLGC)

35 47 ⬎90 28 44 55 64 21 41 33 22 53

32 53 88 28 50 63 74 17 47 49 34 64

Note: A ⫽ nucleotide monomer with an adenin-9-yl base, C ⫽ nucleotide monomer with a cytosin-1-yl base, G ⫽ nucleotide monomer with a guanin-9-yl base, T ⫽ nucleotide monomer with a thymin-1-yl base. MeC ⫽ nucleotide monomer with a 5-methylcytosin-1-yl base. Oligo-2⬘-deoxyribonucleotide sequences are depicted as d(sequence), oligoribonucleotide sequences as r(sequence), and 2⬘-O-Me-oligoribonucleotide residues are underlined. LNA monomers are shown in boldface with superscript “L”. PS designates phosphorthioates and subscript “S” denotes a phosphorothioate linkage.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 533

533

RNA-modified the Tm increases ca. 0.5 and 2.2°C against DNA and RNA, respectively. Despite the fact that LNA inclusions always give rise to increases, also against DNA, the 2⬘-O-Me RNA hybridization pattern is the exact opposite of LNA: the Tm increase per modification increases as the number of 2⬘-O-Me RNA residues increases [81,83]. The same pattern has previously been reported for 2⬘-O-MOE [83]. When three LNA residues are included in the oligonucleotide together with six 2⬘-O-Me RNA residues a dramatic increase in the Tm of the RNA duplex from 34 to 64°C is observed (Table 19.2, entry 12). In other words LNA residues restore entirely the affinity lowering the effect by spiking 2⬘-O-Me RNA residues into oligonucleotides. Kierzek et al. [84] studied in detail the influence of LNA in 2⬘-O-Me RNA. Except for a few isolated cases (2 out of 34) the additive increase in Tm when LNA residues substituted 2⬘-O-Me RNA residues was confirmed. The increase in Tm in 2⬘-O-Me RNA (7-mers) ranged from 2.1 to 10.3°C per LNA modification against RNA. The highest increase was seen for internal inclusions and the lowest increase was seen for 3⬘ inclusions. A Tm prediction algorithm was proposed to approximate the stabilities of 2⬘-O-Me RNA/LNA hybrid duplexes. Recently, LNA has also been included in 2⬘-O-MOE RNA [85]. The affinity of 2⬘-O-MOE oligonucleotides is also increased when MOE is substituted with LNA. A chimeric LNAⲐ2⬘-O-MOE oligonucleotide is reported to have the highest Tm of all the tested oligonucleotides. The oligonucleotides were tested in a microRNA inhibition assay and high activity was related to high affinity. Thus, the chimeric LNA/2⬘-O-MOE oligonucleotides was more potent than the 2⬘-O-MOE or 2⬘-O-Me “alone” oligonucleotides. Since 2⬘-O-MOE and 2⬘-O-Me are very similar in their hybridization properties it is reasonable to assume that LNA can cooperate with 2⬘-O-MOE with the same basic principles so carefully studied for 2⬘-O-Me. Despite LNA hybridize with high affinity to its nucleic acid target the binding is highly specific in terms of Watson–Crick (W–C) base pairing. Mismatch studies have shown that a Tm of ⫺21°C for T/C mismatches and Tm of ⫺14°C is found for a TⲐG mismatch [14]. Sequence dependencies are expected and have been reported [82], but the base-pairing specificity of LNA is in general at least as high as that of DNA. The high affinity and sequence specificity of LNA has been used across the entire field of nucleic acid technologies to improve oligonucleotide properties: For allele-specific primers [86], for specific detection of microRNAs [87–89], for genotyping SNPs in apolipoprotein E [90] and for specific detection of the Factor V Leiden [91]. The conclusion is that LNA exerts its affinity increase additively in a very cooperative manner. LNA can be mixed in any way with nucleic acid residues and analogs hereof. LNA inclusions via their high affinity are able to restore the negative affinity effects of PS and certain combinations of nucleic acids and analogs (e.g., 2⬘-O-Me RNA). In classical antisense designs, large blocks of 2⬘ modifications are needed to provide better affinities, but with LNA only a few nucleotides will suffice. 19.5.2 Thermal Denaturation of LNA Analog Heteroduplexes: Thio- and Amino-LNA The Tm values of both the thio- and amino-LNA analog closely resemble the values of LNA itself (Table 19.3, entry 2–3) [30]. This is particularly surprising in the case of amino-LNA where the amino functionality introduces a positive charge at physiological pH (Table 19.3, entry 2, 4–5) [4]. However, the affinity increase of amino-LNA is not as high as for LNA and thio-LNA due to the positive charge [5]. The influence of the charge is illustrated by an increase of Tm when amino-LNA is N-benzoylated (which removes the positive charge) (Table 19.3, entry 6) and a decrease of Tm when amino-LNA is N-benzylated (Table 19.3, entry 7) [25,28]. A fully modified N-benzoylated(Bz)amino-LNA T9 has an impressive Tm of 73°C against RNA. Molecular dynamics simulation shows that the benzoyl groups are located at the brim of the minor groove and they occupy about half of the space of the groove. They do not stack but are likely to exclude water of the groove during hybridization and to interact via van der Waals interactions with the sugars. Increased thermal denaturations temperatures are also observed for amino-LNA containing bulky groups as pyrene (Table 19.3, entry 9) [27]. When pyrene is linked via a rigid amide to amino-LNA only a few derivatized

CRC_8796_ch019.qxd

5/25/2007

22:16

534

Page 534


Table 19.3 Hybridization Studies with 9-mer Amino- and Thio-LNAs toward Complementary DNA and RNA Entry 1: Reference DNA 2: LNA Ⲑ DNA chimera 3: Thio-LNA Ⲑ DNA chimera 4: Amino-LNA Ⲑ DNA chimera 5: Methylamino-LNA/DNA chimera 6: N-Bz-amino-LNA/DNA chimera 7: N-Bn-amino-LNA/DNA chimera 8: N-Bz-amino-LNA/DNA chimera 9: N-Py-amino-LNA/DNA chimera

Sequence 5⬘-d(GTGATATGC) 5⬘-d(GTLGATLATLGC) 5⬘-d(GULSGAULSAULSGC) 5⬘-d(GTLNHGATLNHATLNHGC) 5⬘-d(GTLNRGATLNRATLNRGC) 5⬘-d(GTLNBzGATLNBzATLNBzGC) 5⬘-d(GTLNBnGATLNBnATLNBnGC) 5⬘-(TLNBz)9-T 5⬘-d(GTGATLNPyATLNPyGC)

DNA Target Tm (oC) 28 44 42 39 39 47 37 75 38a

RNA Target Tm (oC) 28 50 52 47 49 56 50 73 41

Note: LNA monomers are shown in boldface with superscript “L.” A ⫽ nucleotide monomer with an adenin-9-yl base, C ⫽ nucleotide monomer with a cytosin-1-yl base, G ⫽ nucleotide monomer with a guanin-9-yl base, U ⫽ nucleotide monomer with a uracil-1-yl base, T ⫽ nucleotide monomer with a thymin-1-yl base. Oligo2⬘-deoxyribonucleotide are called d(sequence). Superscript “LS” a thio-LNA monomer, superscript “LNH” an amino-LNA monomer, superscript “LNR” a methylamino-LNA monomer, superscript “LNBz” a benzoylamino-LNA monomer, superscript “LNBn” a benzylamino-LNA monomer, and superscript “LNPy” a pyreneamino-LNA monomer. a Tm of 33°C was reported by Hrdlicka et al. [29].

amino-LNAs are allowed, whereas the more flexible N-methyl linkage provide increase in Tm for even fully modified N-Py-amino-LNA nonamers [25]. When the bulky N,N-bis(2-pyridylmethyl)--alanylgroup is linked to amino-LNA the Tm is increased up to 12°C in a mixed sequenced nonamer. The Tm increase was dependent on sequence and on the concentrations of divalent cations [26]. From the data described in this section it can be concluded that the 2⬘-X-CH2-4⬘ bicyclic structure in the -D configuration is a general high-affinity locked structure that allows the presence of other heteroatoms than oxygen. The trivalent nature of the amino functionality of amino-LNA can serve as a conjugation junction for functionalities otherwise not included by LNA. Therefore, aminoLNA can be used to link high-affinity hybridization with a variety of biological ligands with the potential for novel therapeutic functionalities. 19.5.3 Thermal Denaturation of LNA Diastereoisomer Heteroduplexes Alpha-L-LNA is by far the most studied diastereoisomer of LNA, and since it is the analog of most interest for antisense therapeutics it will be the focus of this section [33–35,75,81,92,93]. Alpha-L-LNA monomers can be included in complex-designed oligonucleotide chimerae. Alpha-L-LNA monomers act cooperatively with the non-LNA residues, and the affinity increase is mediated in an additive way (Table 19.4). However, the affinity increase per modification of -L-LNA is not as high as it is for LNA (Table 19.4, entry 9–10), and -L-LNA shows affinity preference for RNA (Table 19.4, entry 2–3, 6, 9–10) [75]. RNA “selection” is also seen when -L-LNA residues are incorporated in 2⬘-O-Me containing oligonucleotides (Table 19.2, entry 12, and Table 19.4, entry 7). The fact that -L-LNA does not have the same “spiking” power as LNA can be explained by the observation that it does not steer the conformation of nearby DNA-residues to the high affinity N-conformation (vide supra). This is in line with the observation that fully modified hetero duplexes of -L-LNA and LNA—where conformational steering has no relevance—have almost the same Tm (Table 19.4, entry 11–12). LNA and -L-LNA can also be mixed and act cooperatively in the same oligonucleotide to give rise to an increase per modification of 4–5°C (Table 19.4, entry 4). The reason for this is likely to be the canonical position in space of the 5⬘-OH, 3⬘-OH groups on the furanose and the N1 of nucleobases (vide supra). The sequence-dependent specificity of -L-LNA hybridization is good and comparable to that of DNA and LNA [34,75]. For 11-mer -L-LNA oligonucleotides a thermal denaturation difference

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 535

LOCKED NUCLEIC ACID

535

Table 19.4 Hybridization Studies with 9-mer, 10-mer, and 11-mer LNA, and -L-LNA toward Complementary DNA and RNA Targets Entry

Sequence

DNA Target Tm (oC)

RNA Target Tm (oC)

1: Reference DNA 2: LNA 3: -L-LNA 4: -L-LNA Ⲑ LNA chimera 5: Reference DNA 6: -L-LNA Ⲑ DNA chimera 7: -L-LNA Ⲑ 2⬘-OMe-RNA chimera 8: Reference DNA 9: LNA/DNA chimera 10: -L-LNA Ⲑ DNA chimera 11: Fully modified LNA 12: Fully modified -L-LNA

5⬘-d(T)14 5⬘-d(TL)9T 5⬘-d(LTL)9T 5⬘-d(T)3(TL)4(LTL)4(T)5 5⬘-d(GTGATATGC) 5⬘-d(GLTL GA LTL A LTL GC) 5⬘-(G LTL GA LTL A LTL GC) 5⬘-d(CACACTCAATA)-3⬘ 5⬘-d(CAL CAL CTL CALATLA)-3⬘ 5⬘-d(CLALCLALCLTLCLALALTLA)-3⬘ 5⬘-(MeCAMeCAMeCTMeCAATA)L-3⬘ 5⬘-L(MeCAMeCAMeCTMeCAATA)L-3⬘

32 80 63 64 28 37 38 36 54 39 69 65

28 71 66 63 28 45 52 30 63 49 77 75

Note:

A ⫽ nucleotide monomer with an adenin-9-yl base, C ⫽ nucleotide monomer with a cytosin-1-yl base, G ⫽ nucleotide monomer with a guanin-9-yl base, T ⫽ nucleotide monomer with a thymin-1-yl base. Me C ⫽ nucleotide monomer with a 5-methylcytosin-1-yl base. Oligo-2⬘-deoxyribonucleotide sequences are depicted as d(sequence), oligoribonucleotide sequences as r(sequence), and 2⬘-O-Me-oligoribonucleotide residues are underlined. LNA monomers are shown in boldface with superscript “L.” Superscript “L” indicates -L-LNA residue.

between the fully matched and the single base pair mismatch was in the range of 6–29°C against DNA. The corresponding Tm against RNA was in the range of 17–25°C [75]. An interesting diastereoisomeric variant is 2⬘-amino--L-LNA [38]. This molecule can be regarded as a chemical “combination” of amino-LNA and -L-LNA. A robust Tm increase is seen for 2⬘-amino--L-LNA against RNA (Tm per modification: 2.0–4.5°C). Against DNA the Tm is also increased (Tm per modification: 0.5–2.5°C), except for one sequence where a small decrease is found (Tm per modification: ⫺0.5) [38]. Interestingly, when 2⬘-amino--L-LNA is conjugated with pyrene a dramatic increased in Tm is seen against DNA (7–15°C per modification), whereas the Tm increase against RNA is more moderate [94]. In this molecule the pyrene points out into the major groove (in contrast to the amino-LNA congener) and the high affinity against DNA is likely due to intercalation which is also supported by the observed reduced mismatch discrimination and the spectroscopic redshift during hybridization. The conclusion is that the 2⬘-X-CH2-4⬘ bicyclic structure fits within Watson–Crick framework no matter whether it points into the major groove (-L-LNA) or the minor groove (LNA). The generality is nicely confirmed by 2⬘-amino--L-LNA that due to its structure is a vehicle for positioning ligands into the major groove [38]. 19.5.4 Thermal Denaturation of LNA Containing Base Modifications Replacement of adenine with diaminopurine in LNA gives rise to an affinity increase. Rosenbohm et al. [21] reported an increase of 2 and 4.5°C per modification against DNA and RNA, respectively, and Koshkin [16] reported an even higher increase against DNA (6.2°C per modification). In both publications a larger discriminative power of single base-pair mismatches is reported. LNA containing inosine shows—as expected—selective binding to cytosine, but at the same time comparable high binding to the other three nucleobases. In contrast, 2-aminopurine LNA showed selective DNA-thymidine binding, and the Tm is reduced by 7, 15, and 17°C against DNAcytosine, -adenosine, and -guanosine, respectively. A variety of LNA and -L-LNA aryl C-nucleosides have been made [44,45,48,95]. The general pattern is that LNA-aryl nucleosides have significant reduced affinities, however LNA-pyrenyl could be included in oligonucleotides if it was surrounded by regular LNA residues to compensate for the reduced affinity.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 536

536


19.5.5 Thermodynamic Considerations One of the design rationales behind locking the conformations of the furanose in LNA was to make hybridization entropy less unfavorable [1,9], and early reports on LNA:RNA hybridization supported this hypothesis [55,63]. However, it was also reported that for fully modified LNA oligonucleotides hybridized to DNA the formation was strongly enthalpy favored [60]. This observation is in line with the marked increased stacking observed by NMR (vide supra) [56]. Christensen et al. [96] reported also that increased affinity as a function of LNA-residue addition was driven—during LNA:DNA hybridizations—by a more favorable enthalpy contribution, although a minor more favorable entropy component also contributed to a larger negative G. Kvaerno et al. [97,98] demonstrated the importance of the enthalpic factor by including one abasic LNA residue in a duplex that resulted in a dramatic decrease in the Tm. A very comprehensive analysis of LNA:DNA hybridizations was undertaken by McTigue et al. [82]. They concluded that LNA pyrimidines contribute more to the stability than the purines, especially AL, and that the contributions are sequence-dependent. They observed enthalpy–entropy compensations across the entire data set and reported that both entropy (preorganization) and enthalpy (stacking) are contributing, but not both for a given sequence. A detailed study was also undertaken by Kaur et al. [99] and they confirmed the higher contribution of LNA pyrimidines to the affinity of LNA:DNA duplexes and that the thermodynamic parameters are sequence-dependent. They found for most sequences that hybridization was driven by enthalpy, but in a few cases driven by entropy. They reported higher counterion uptake of LNA duplexes but lower uptake of water. These are characteristic parameters during A-form helix formation and thus, in accordance with the structural observations of LNA. The full picture of hybridization thermodynamics is not yet clear. Thermodynamically, hybridization is very complex with contribution of many components: stacking, rotational freedom of nucleotidesⲐoligonucleotides, structure of helices, counterion releaseⲐbinding, water releaseⲐbinding, H bonding, etc. With H and S being a part of each of these components an unequivocal assignment of H and S is very complex. However, the bottom line is that the individual importance of H and S during LNA hybridization is sequence-, context-, and target-dependent, but—very importantly—always with a negative G. 19.5.6 Hybridization Kinetics It is generally believed that duplex formation of oligonucleotides is a process involving two main events, initial formation of a nucleation complex followed by annealing of the duplex where IC is the nucleation complex and D the duplex: k1 k2   → IC ←    → D DNA(A) ⫹ LNA(B) ←   k k ⫺1

⫺2

The temperature-dependent overall dissociation constant, KD is given by K D ⫽ ( k⫺ 1 ⫻ k⫺2 ) Ⲑ ( k1 ⫻ k2 ) ⫽ [DNA ⫺ A eq ][LNA ⫺ Beq ]Ⲑ[D] The hybridization kinetics of LNA 9-mer oligonucleotides containing one to three LNA-T residues have been reported [96]. The observed on-rates are high and found to be in the order of 2 ⫻ 107 MⲐs. The overall KD values are calculated from the Tm curves at various temperatures and decreased from 20 to 0.3 nM as one to three LNA residues were included. It is demonstrated that the on-rates were similar for DNA–DNA and DNA–LNA hybridization. Therefore, the very different KD values between DNA and LNA reflect a marked difference of the off-rate. By taking the fast on-rates into account it is estimated that the hybridization is nearly diffusion controlled, meaning that every correct base-to-base encounter leads to hybridization. Thus, the rate-determining step is the association reaction followed by fast annealing of the duplex.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 537

LOCKED NUCLEIC ACID

537

Hybridization kinetics is also reported for a 12-mer 2⬘-O-MeⲐLNA mixmer. The rate constants are determined by a PAGE mobility shift assay using TAR 39 RNA as target [100]. On- and offrates rates of respectively 2 ⫻106 MⲐs and 2 ⫻10⫺3/ are observed. Compared to isosequential PNA, the 12-mer 2⬘-O-MeⲐLNA mixmer and the fully modified 2⬘-O-Me 12-mer oligonucleotide have five times faster on-rates. 19.5.7 Thermal Denaturation of LNA Triplexes LNA and -L-LNA oligonucleotides hybridize also in the classical triplex binding motif, but triplex binding is outside the scope of this review. However, a few comments are appropriate. LNA and -L-LNA triplexes exhibit significant increased thermal stabilities (up to 5°C per modification) compared to the DNA congeners, with the design provison that fully modified locked oligonucleotides are not allowed. Triplex formation is possible even at neutral pH [2,50,101–107]. The improved triplex binding of LNA is obtained by decreasing the dissociation rate constant and is associated with an entropic gain [105,108]. The biological relevance has been illustrated by the inhibition of NF-B binding to its target sequence at 1 M (pH ⫽ 7) [101]. The interested reader can consult an excellent review by S. Obika [109].

19.6 BIOCHEMICAL PROPERTIES OF LNA AND LNA ANALOGS 19.6.1 General Designs LNA and most LNA-analogs can be mixed in any combination with nucleic acids and analogs hereof (vide supra). Depending on the intended application of LNA, or for that matter that of other oligonucleotide analogs, the design may be divided into five categories: mixmer, gapmer, headmer, tailmer and fully modified (Figure 19.9, 1–5). In the mixmer the LNA residues are dispersed along the sequence of the oligonucleotide (1), while in the gapmer two continuous LNA segments in the flanks are separated by a central nucleic acid segment (2). In the headmer a continuous LNA segment is positioned in the 5⬘ end followed by a continuous nucleic acid segment (3), and vice versa for the tailmer (4). Finally, a fully modified LNA oligonucleotide is self-explanatory (5). The length of the various segments will vary and the specific design is dependent on the intended use and how important affinity, nuclease resistance, and RNase HⲐRISC recruitment are for the proposed application. 19.6.2 Nuclease Resistance The incorporation of LNA nucleosides into ODNs increases their stability against nucleases. The degradation rate is very dependent on the number of LNA residues, their position, and incorporation of other stabilizing entities (e.g., PS internucleoside linkages). When one LNA-T residue 1.

5′

3′

2.

5′

3′

3.

5′

3′

4.

5′

3′

5.

5′

3′

Figure 19.9 General designs of LNA antisense oligonucleotides.

LNA/LNA analogs DNA/PS or analogs

CRC_8796_ch019.qxd

538

5/25/2007

22:16

Page 538


is included in either the ultimate or penultimate 3⬘ position no significant increase in the stability is obtained against the 3⬘ exonuclease snake venom phosphordiesterase (SVPD) [92,110–112]. When 2 LNA-T modifications were positioned in either the ultimate or penultimate 3⬘ positions the oligonucleotide is almost as stable as the fully modified analog that is virtually resistant to SVPD degradation [1,92,110,111]. Interestingly, when one -L-LNA-T residue is positioned at the penultimate 3⬘ position the oligonucleotide becomes much more stable and ca. 40% full-length product remains after 2 h incubation where the LNA congener is entirely digested after 1 h [92]. The fact that -L-LNA contributes more to the stability than LNA can be explained by its nonnatural configuration (vide supra). However, 11-mer LNA and -L-LNA, mixmers, modified identically with five modifications are both essentially resistant to SVPD digestion [75]. The same resistance is seen for 20-mer LNA mixmer and gapmer designs containing 8–11 residues [113]. Introducing artificial internucleoside linkages can significantly increase the nuclease stability. For instance, one methylphosphonate internucleoside linkage (vide supra) in the 3⬘ position to a single LNA-T residue blocks entirely the 3⬘-exonucleolytic activity of SVPD [77]. 3⬘-Exo-nucleases have very different nuclease activities, and SVPD is one of the most aggressive. To understand the subtle positional differences less aggressive exo-nucleases have to be employed. Di Giusto et al. [114] compared the degradation rate of LNA oligonucleotides singly modified in either the ultimate or the penultimate 3⬘ position against five different exo-nucleases. It turned out that a single LNA modification in the penultimate position is almost as stable as the double modified against all five tested exo-nucleases, whereas the single modification in the ultimate position was labile to all enzymes. This positional effect is likely to be due to the structural change of the ultimate phosphordiester bond by the penultimate LNA substitution (vide supra). However, the main conclusion is that a single modification is most stable in the penultimate position, and that at least two LNA modifications is the lower limit for global 3⬘-exo-nuclease protection. The gapmer design is an effective way to secure exo-nucleolytic protection, but the central DNA segment is sensitive to endo-nucleolytic activity. A fully modified LNA is essentially resistant to S1-endonuclease degradation [92], but if the central DNA segment becomes longer than four nucleotides cleavage starts to occur, and the cleavage rate increases as the DNA segment increases. However, the protection of the LNA flanks is still significant even for a 4LNA-7DNA-5LNA diester gapmer since the cleavage rate is slower for this molecule compared to the isosequential PS [92]. The degradation pattern of 18-mer LNA phosphordiester gapmers has also been studied in human serum [115]. The nuclease stability is closely related to the length of the LNA segments. Substituting just one LNA in either end increases the half-life from 1.5—for the DNA oligonucleotide—to 4 h. Increasing the LNA segment from 1 to 4 at either end increases the half-life from 4 to 15 h. The stability of the LNA containing three or four modifications at either end is also better than the corresponding 2⬘-O-Me congener gapmer and the PS with respective half-lifes of 12 and 10 h. The nuclease stability of LNA 15-mers has also been studied in human serum [111]. The half-life of a 15-mer LNA (mixmer w. 9 LNA residues) is ⬃10 times greater in blood serum compared to the isosequential PS, whereas the isosequential LNA gapmer (4LNA-6DNA-5LNA) has decreased stability compared to the PS. This is explained by more endo-nucleolytic digestion of the central DNA segment in the gapmer compared to the PS [111]. This observation is in contrast to the findings of Frieden et al. [92] (vide supra), but since the sequences are very different in the two studies, the discrepancy could be explained by sequence dependent endo-nucleolytic activity. Since the central DNA segment is degraded—albeit rather slowly—it has to be further protected. One way to do this is to use the above-mentioned methylphosphonate internucleoside linkage, but a more obvious choice is to use PS internucleoside linkages. The PS linkage is easy to introduce under LNA synthesis and it serves as substrate for RNase H (vide infra). We have examined a series of gapmers fully PS modified in human and in rat plasma and observed no sign of endo-nucleolytic activity. The gap size ranged from 9 to 11 PS linkages and is entirely protected over 24 h. Some of the tested gapmers had a single 3⬘-DNA residue in the ultimate position. Despite the fact that immediately to the 5⬘ side of the DNA residue is a PS LNA segment of 2–3 residues some

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 539

LOCKED NUCLEIC ACID

539

cleavage is still observed. However, this lability is base dependent where DNA A is most labile (25% is cleaved over 24 h) and DNA C is entirely stable under the same conditions. LNA inclusions can also effectively stabilize double-stranded DNA. Including just one LNA residue in the ends of both strands of a 30-mer DNA duplex (four LNA in total) increases the half-life of the duplex significantly [116]. After 3 h incubation with DNase 1 65% of the LNA modified duplex remains, whereas the unmodified DNA duplex is completely degraded. Including more LNA residues increase the half-life further. RNA oligonucleotides are even more susceptible to nuclease degradation than DNA oligonucleotides, and with the advent of siRNA as a potent antisense technology, stabilization of RNA has gained great importance. LNA is also here an obvious choice, since it is a structural RNA mimic and it brings two kinds of stabilizing parameters: nuclease stability and an increase in siRNA duplex lifetime, via affinity. The latter is important since duplex siRNA is very stable to nuclease activity in cells and in serum [117]. Inclusion of LNA residues in a siRNA duplex increased the Tm 3–4°C per modification, whereas no increase is seen for either 2⬘-F or 2⬘-O-Me inclusions. Inclusion of LNA in the overhangs + one LNA residue in the 5⬘-sense strand increased the half-life of the siRNA from seconds to 24 h [118]. When further six LNA residues are included in the sense strand the half-life was not reached during the time span of the experiment. The conclusion is that LNA and LNA analogs effectively stabilize oligonucleotides against nucleases. The inclusion of just a few LNA modifications in the ends in combination with PS internucleoside linkages provides essential nuclease resistance. 19.6.3 RNase H Recruitment of LNA and LNA Analogs RNase H belongs to a class of ubiquitous enzymes that cleave the RNA strand in RNA:DNA duplexes. It is a well-established fact in antisense that oligonucleotides that recruit RNase H are among, if not, the most potent to inhibit the activity of mRNA. Since a RNA:DNA duplex recruits RNase H and since LNA resembles an RNA structure, LNA:RNA will not recruit RNase H. Therefore, to be effective in degrading RNA, LNA has to be designed with segments of DNA as in gapmers, headmer or tailmers. In the first antisense report with LNA activation of RNase H with 15-mers, designed as a gapmer (4LNA-6DNA-5LNA) or as a mixmer with 9 LNA modifications, were examined. The RNA target was a 24-mer corresponding to the targeted portion of the rat delta opioid receptor (DOR) [111]. Surprisingly, both the gapmer and the mixmer were able to cleave the RNA target sequence. In a comprehensive study using LNA 18-mers the cleavage pattern by RNase H was studied in detail [115]. The target RNA was the full-length transcript of the vanilloid receptor subtype I (VRI) cDNA (2614 nt). With mixmers containing 5 or 6 LNA residues scattered along the 18-mer sequence no activity was seen. However, for one sequence with a gap of 8 DNA residues, ca. 90% of the RNA was cleaved (same as for the DNA control). The isosequential PS recruits RNase H less efficiently. When the DNA segment in LNA-DNA-LNA gapmers is increased from 4 to 8 residues, RNA cleavage initiates at 6 DNAs and is maximal at 8 DNAs. For isosequential gapmers containing 2⬘-O-Me modifications only a stretch of 6 DNA residues is necessary to elicit RNase H cleavage. This difference between LNA and 2⬘-O-Me is likely to be the “structural saturation” of LNA meaning that the DNA residues proximate to LNA attain a higher degree of N-conformation (vide supra). Cleavage of the RNA by the LNA gapmer is very specific and occurs for these 18-mers on the complementary RNA strand at the position opposing DNA nucleosides 8 and 9 (from 5⬘ end). Kinetically, the LNA gapmer is the fastest to cleave RNA followed by the isosequential 2⬘-O-Me. All the DNA and the PS are the slowest [115]. The optimal gapsize has also been studied in a Firefly luciferase inhibition assay. The cell line HeLa X1Ⲑ5 was used and it was stably transfected with a Tet-Off luciferase system [92]. The LNA gapmers were 16-mers with a central PS segment. For the three different target sequences examined, the trend was the same, a gapsize ranging from 7 to 10 DNA nucleotides being the most potent. Interestingly, this study reveals the subtle relationship between affinity and gapsize. For the

CRC_8796_ch019.qxd

540

5/25/2007

22:16

Page 540


low-affinity 16-mers with Tms from 42 to 52°C against DNA, an increased gapsize results in reduced activity, whereas for the high-affinity 16-mers of the same general design and with Tms of 61–72°C, increased gap size up to 10 PS leads to increased activity. Further increased activity is seen if also the LNA segments are phosphorothiolated—a modification that does not lead to an affinity decrease for LNA (vide supra). The very high affinity of LNA provides the unique opportunity to combine size reduction with high potency, and this is shown in the study. A 14-mer LNA gapmer (3LNA-8DNA3LNA) fully thiolated with a Tm of 57°C, against DNA, shows an impressive IC50 value ⬍2 nM [92]. Head and tail designs have also been examined but the activity is significantly lower than for the gapmers. Finally, the mechanistic relation to RNase H activity of the gapmers is justified, since all active oligonucleotides in the antisense assay also are active in an isolated Escherichia coli RNase H assay. In contrast to LNA -L-LNA does attain a B-like structure when hybridized to nucleic acids. As a structural DNA mimic -L-LNA displays different RNase H recruiting properties of that LNA [65]. Fully modified and mixmers of -L-LNA do recruit E.coli RNase H whereas the isosequential LNA under the same conditions shows no signs of RNase H activity [75]. However, the cleavage rate for -L-LNA was much slower than for the control DNA. In the luciferase assay mentioned above, isosequential LNA and -L-LNA gapmers have roughly the same potency. However, if a single -L-LNA nucleotide is included in the gap the activity is maintained, whereas the activity ceases for the same sequence if a single LNA nucleotide is included [92]. Recruitment of RNase H has been compared between isosequential gapmers of the 3LNA9DNA-3LNA-1DNA design comprised of LNA, -L-LNA, amino-LNA and thio-LNA modifications (internal communication). Gapmers containing LNA, thio-LNA and -L-LNA modifications turned out to be the most active in recruiting both E.coli and human RNase H. Compared to isosequential DNA, all four locked oligonucleotides were more potent with relative RNA cleavages ranging from 42 to 80% compared to 15% for DNA. This section underlines the fact that the most potent design for RNase H recruitment by LNA, amino-LNA, thio-LNA and -L-LNA is the gapmer design. The optimal gapsize in E. Coli assays is ⬎7 DNA nts and slightly longer, ⬎8–9 DNA nts, in antisense assays using human RNase H [92,119,115]. This is related to the longer DNAⲐPS substrate size required for human RNase H. The optimal design is also related to the affinity of the nativeⲐunmodified DNA oligonucleotide sequence. If it is a low-affinity sequence (⬍40°CⲐ16-mer) the LNA load must be relatively high (6–8 nt). If it is a high-affinity sequence the LNA load can be reduced to 4–6 nts. This section also illustrates the importance of the high affinity of LNA. High affinity offers the opportunity to design short (14–16 mers) highly potent antisense agents, and furthermore, in contrast to other chemistries where PS modifications lead to lower affinity, LNA can be phosphorothiolated without affinity loss. Thus, LNA can be used in combination with PS, to take the advantages and the properties that PS offers, into one short AON without potency compromises (vide infra).

19.7 INHIBITION OF CODING RNA IN VITRO Antisense mechanisms are divided in two main categories: (1) Steric block of the nucleic target by the AON; and (2) inhibition of gene expression through mRNA destruction [120]. The steric block mechanism includes prevention of ribosome binding by blocking the 5⬘-UTR, acting as a “road” block during translation by binding to the message, or by redirection of splicing by blocking splice sites to alter the production of splice variants. When AON’s are acting according to these mechanisms the RNA remains intact. The other main category requires enzyme recruitment by the AON either by RISC-mediated RNAi or by RNase H to mediate cleavage of the mRNA. The antisense properties of LNA—and LNA analogs—flow directly from the basic properties of the molecules. When these are considered (high affinity for RNA, nuclease resistance, and high rates of RNase H recruitment for LNA for selected designs) one would expect high potency to be

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 541

541

the outcome (vide infra). Since LNA is a relative recent AON technology an important part of the scientific studies to date has been to compare its antisense properties with more traditional antisense chemistries. In particular, it is of great interest to verify whether the high affinity of LNA is a differentiating factor that may enable the fulfillment of the large expectations of antisense technology in human clinical therapies. The majority of antisense experiments made with LNA have mechanistically been focused on mRNA inhibition by RNase H recruitment [92,93,111,113,119,121–127] (Table 19.5). The general picture in all these publications is that LNA AONs are potent, and actually more potent than the competing chemistries. Values of IC50s for mRNA inhibition are frequently obtained in the subⲐlow nano molar range (Table 19.5). However, the reason for the rather high IC50 for Bcl-xL targeting shown in Table 19.5 is that the oligonucleotide is designed to target both Bcl-2 and Bcl-xL meaning that the sequence has three mismatches to Bcl-xL [126]. When compared to the isosequential MOE (IC50 ⫽ 253 nM) LNA is more potent, and the authors explain this by the higher affinity of LNA. The potency of the different LNA designs is also related to the target site. When the target site is the 5⬘-UTR the most potent mixmer—designed for steric block in the 5⬘-UTR region—inhibited luciferase activity with 76% at 25 nM, almost as potently as the most potent gapmer that inhibited 82% [121]. When LNA gap- and mixmers are compared for mRNA inhibition in the translation start site the gapmer is found to be slightly more potent [92,121,125]. However, when the target site is in the coding region the gapmer is superior [121] The explanation for this observation is that a high-affinity LNA mixmer can prevent ribosome binding to the mRNA and thereby stop translation, but once the ribosome is bound and initiates translation, the mRNA has to be cleaved to stop its action. Jepsen et al. [119] confirmed this relation between the target site of gapⲐmixmer and potency, in a study on the Estrogen receptor . For isosequential gapⲐtailⲐheadmers the headmer was almost inactive, the tailmer was more active reducing the expression to 40% of the control level, whereas the gapmer was the most potent and reduced the expression to 10%. However, such a clear potency differentiation between headⲐtailmers was not established in a HIV replication assay where the potency was found to be sequence dependent on the individual AONs [127]. The most potent 18-mer, targeted at the dimerization initiation site was of a headmer like design, and the HIV-1 replication was reported to be inhibited by 64% compared to untreated Jurkat-Tat cells (AON concentration ⫽ 160 nM). LNA has also been used for mRNA inhibition according to non-RNase H mechanisms. LNA mixmers can inhibit telomerase binding to telomeres effectively, and mixmers as short as eight nucleotides inhibit binding with an IC50 value of 25 nM [128]. Compared to PNA, the LNA mixmers are 200-fold more potent [128]. The most potent were 13-mers with IC50 values ranging from 1 to 10 nM. It was concluded that the high potency was directly related to the high affinity of LNA [128]. Another non-RNase H mechanism is the steric block of TAR-tat binding that inhibits HIV transcription and translation [100,129,130]. Arzumanov et al. [131] showed that the cooperative binding of LNA and 2⬘-O-Me in mixmer designs can be used to make highly potent AONs of only 12 nucleotides. A steric block approach was also used for intracellular inhibition of the hepatitis C virus (HCV) internal ribosomal entry site. An LNA mixmer composed of 8 LNA and 9 DNA—with the highest Tm (92ºC) of all the tested LNAs—was found to be the most potent. The estimated IC50 value is 50 nM. A logical application of the steric block approach is to use LNA mixmers to redirect splicing [132]. Fully modified LNA 14-mers induce potent splice skipping of exon 46 in myotubes. In patient samples with Duchenne muscular dystrophy, 85% splice skipping has been observed, whereas a 20-mer 2⬘-O-Me AON shows only 20%. A 22-mer morpholino showed only 6% and a 14-mer PNA showed no skipping at all [132]. Owing to the fact that the LNA was fully modified the Tm was calculated to be ⬎100ºC and the inhibition was associated with some non-specific target binding.

Steric block of telomerase activity

LNA-2⬘-O -RNA mixmers (12-mer)

LNA mixmersⲐfully modified (13- or 8-mers) LNA-DNA gapⲐmixmer (13- and 15-mers) LNA/thio-LNAⲐα-LLNA mixmers with 2⬘-O -Me (8Ⲑ9/10/12/ 16-mers) LNA-PS gapmers (16 & 18-mers) LNAⲐα-L-LNA gap/ mixmers w. DNA/PS (12Ⲑ14/16-mers) LNA-DNA Gap/tail/ headⲐmix-mer (9 and 18-mers)

HIV dimerization initiation site (DIS)

Luciferase

PKC-α

HIV-1 transactivator element (TAR)

Luciferase

RNase H cleavage of target HIV RNA and inhibition of HIV genome dimerization

RNase H cleavage of mRNA RNase H cleavage of mRNA

Steric block & mRNA cleavage by RNase H activation Steric block of TAR-Tat binding

Steric block of TAR-Tat binding

LNA-DNA gapmer (20-mer) LNA-2⬘-O -RNA mixmers (12-mer)

ICAM-1

In vitro HIV genome dimerization, RNase H assay and cell culture (PEI transfection)

Up to ⬃60% inhibition of HIV dimerization and replication

⬍2 nM

Inhibition of HIV genome dimerization, RNase H activation and inhibition of HIV replication

Inhibition of mRNA and protein expression Inhibition of luciferase expression

⬃5 nM

A549 cellular assay (lipofectamine) HeLa cellular assay (lipofectamine)

Inhibition of luciferase expression 120 nM (16-mer mix-mer LNA)

HeLa cellular assay (effectin 12)

Inhibition of luciferase activity

Inhibition of telomerase activity

Inhibition of luciferase expression

Inhibition of spinal antinociceptive response to deltorphin II Inhibition of protein expression Inhibition of full-length transcription

Biological/Functional Effect of LNA

N/A

1–10 nM

N/A

20 nM (estimated) 70–150 nM

Reduction in DOR densities by 35–50%

Potency (IC50)

CV-1 cellular assay (lipofectamine)

HeLa cellular transcription assay (effectin 12) DU145E cellular assay (lipofectamine)

HUVEC cellular assay (lipofectamine) In vitro transcription assay

Injection in rat brain (in vivo)

Model (transfection)

Comparisons

Mismatch

N/A

PS

N/A

PS

PNA/PS

2⬘-O-Me

DNA/PS PNA/2⬘-O-Me/ propynyl cytocine

DNA

[127]

[92]

[123]

[130]

[121]

[128]

[129]

[113] [100]

[111]

Reference

542

HIV-1 transactivator element (TAR) HIV-1 transactivator element (TAR) Telomerase

RNase H cleavage of mRNA RNase H cleavage of mRNA Steric block of TAR-Tat binding

LNA-DNA Gap/ mix-mer (15-mer)

Mechanism

Delta opioid receptor(DOR)

LNA Design

22:16

Target

5/25/2007

Table 19.5 Inhibition of Coding RNA by LNA in vitro



Survivin

RNase H cleavage of mRNA and steric block RNase H cleavage of mRNA

RNase H cleavage of mRNA

LNA/thio-LNA/ amino-LNA, -LLNA gapmers with PS (16-mers) LNA-DNA gap/ mix-mers (22-/18mers, respectively) LNA gapmers with DNA or PS (20-mers) Xenopus laevis embryos (microinjection)

Chicken pinealocytes (lipofectamine)

15PC3 cellular assay (lipofectamine)

Cos-7 cellular assay (lipofectamine)

Human myoblasts/ myotube cultures (PEI tranfection)

MDA-MB-231/H125 cellular assay (lipofectamine)

CV-1 cellular assay (lipofectamine)

MCF-7 cellular assay (lipofectamine)

N/A

N/A

LNA,thio/amino-LNA ⫽ 2 nM -L-LNA ⫽ 0.4 nM

0.4 nM

N/A

100 nM (Bcl-xL) 65 nM (Bcl-2)

50 nM

Inhibition of cBmal & cAanat mRNA & melatonin secretion Inhibition of mRNA

Inhibition of mRNA

Inhibition of mRNA/ protein expression, proapoptotic phenotypes, caspase-3 activity, and chemo-sensitized Exon skipping, restoring dystrophin synthesis in DMD patient myotube cultures Inhibition of mRNA and protein expression

Inhibition of luciferase activity

Inhibition of mRNA and protein expression

[125]

[124]

2⬘-O-Me/PS phosphoramidate

[93]

N/A

N/A

[122]

[132]

2⬘-O -Me, PNA, morpholinos

siRNA/PS/ 2⬘-O -Me

[126]

[131]

[119]

2⬘-MOE

PNA

PS

22:16

cBmal and cAanat


LNA-DNA gapmers (18-mers)

VR1 (Vanilliod rec. Subtype 1) H-Ras

Exon 46 skipping— restoration of DMD reading frame

Disrupt RNA secondary structure and protein binding RNase H cleavage of mRNA


Fully modified 14-mers

LNA-DNA gapmer (20-mer)

LNA-DNAⲐPS gap/ mix/headⲐtail-mers & fully modified (15-mers) LNA-DNA mixmers (17-mers)

5/25/2007

DMD (Duchenne muscular dystrophy)

HCV internal Ribosomal entry site (IRES) Bcl-2 & Bcl-xL

Estrogen receptor & p21


LOCKED NUCLEIC ACID 543

CRC_8796_ch019.qxd

544

5/25/2007

22:16

Page 544


The high affinity of LNA makes it possible to design shorter AONs with retained high potency, but it also means that the “hit rate” of LNA AONs designed to complement different sequences along the mRNA are higher compared to traditional antisense chemistries [122]. This means that the lead identification process in drug discovery becomes faster and that fewer LNA AONs are needed for an adequate gene walk. In a lead selection process involving H-Ras, Thioredoxin and Survivin, we prepared respectively a total of 14, 10, and 14 LNA gapmers [133]. The AONs were of the 4LNA-8PS-4LNA design and fully phosphorothiolated. The AONs were screened at 25 NM in 15PC3 cells and 4 LNAs from each group reduced the expression of the respective targets ⱖ80%. Using this limit as definition for the hit rate, 35% of all LNA AON’s were potent against H-Ras and Survivin, and 40% were potent against thioredoxin. When these candidates were subjected to dose response screening, leads with IC50 values in the range of 0.5–2 nM were identified. The high hit rate is a direct evidence for the broad accessibility of LNA, or in other words, nucleic acid target sites that are not accessible to traditional antisense chemistries are to a large extent accessible with LNA. LNA-analog gapmers containing amino-thio and -L-LNA have been shown to inhibit H-Ras expression [93]. In a study with isosequential gapmers the design used was 3LNA-9PS-3LNA-1PS, where the LNA analog part was composed of either amino-thio or -L-LNA. The LNA-analog AONs all had similar Tms ranging from 67 to 71°C. The amino- and thio-LNA had almost the same IC50 value of 2 nM as the LNA congener. Interestingly, the -L-LNA gapmer was the most potent with an IC50 value of 0.4 nM. Owing to the “DNA”-like structure of -L-LNA (vide supra) the normal optimal gapsize of 8–9 DNAⲐPS for LNA can be reduced to 7 and still be very potent, IC50 ⬍2 nM [92]. The potency was maintained even if one -L-LNA residue was placed in the center of the 7 DNA/ PS gap. The functional readouts of the LNA antisense studies described above are listed in Table 19.5. It is reported in almost all cases that the functional effects are concentration dependent related to the RNA inhibition. In this context one example is worthwhile emphasizing. In the study of Simões-Wüst et al. [126], downregulation of Bcl-xLⲐBcl-2 proteins results in strong proapoptotic phenotypes of both MDA-MB-231-, and H125 cells. The cell death is correlated with caspase-3 activation and cleavage of its substrate ICAD (caspase-activated DNase). Interestingly, the treated cells also showed marked increases in chemosensitization. The strongest reduction of cell viability was seen in treated MDA-MB231 cells in combination with paclitaxel, and in treated H125 cells, the strongest effect was seen in combination with cisplatin and gemcitabine [126]. These data underline the strong potential for LNA Bcl-LxⲐBcl-2 inhibitors as antisense therapeutics either alone, or augmented, in combination with classical chemotherapy. This section confirms the broad potential of LNA in antisense. A common conclusion from all of the studies presented here is that the high potency of LNA is directly related to its high binding affinity. The high affinity offers the opportunity to reduce the size of AONs and to retain the potency. Size reduction also has many advantages for AONs: Better cellular uptake, better target specificity, more cost effective to produce, and reduced toxicity [111,128,132,133]. The most potent design of LNAⲐLNA-analogs is the gapmer design, and using that design in vitro the potency of short single stranded LNA AONs is comparable to that of siRNA [122].

19.8 INHIBITION OF MICRO-RNA IN VITRO Micro-RNAs (miRNAs) are a family of short noncoding regulatory RNA molecules expressed in a variety of different cell types. The miRNA pathway serves as an important posttranscriptional regulation mechanism and the potential of miRNAs in pathologically significant pathways is increasingly appreciated [134]. Similar to classical AON extensively developed for the inhibition for coding RNA, synthetic oligonucleotides are the only rational approach for specific inhibition of the individual miRNAs, and they have therefore, the potential to progress into an important new class of drugs.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 545

545

Mechanistically the inhibition of microRNA activity is based on the specific hybridization between the microRNA and the synthetic oligonucleotide. A stable and high-affinity binding of the synthetic oligonucleotide to the microRNA will outcompete the binding to the mRNA. Such “sequestering” of the microRNA will inhibit its silencing effect. LNA oligonucleotides directed against microRNAs are named LNA-antimiRs. Naguibneva et al. [135] reported that effective sequestering of miR-125 (at 50 nM) could be obtained by 22-mer LNA-antimiRs of either the gapmer or the mixmer design. Remarkably, the duration of action of these was very long. After 4 days the target miR-125b was undetectable and even at day 10, after several cell divisions, expression of miR-125b was still effectively inhibited. Although sequestering of miR-125 was reported to be the likely mechanism of both designs, it was also possible that the microRNA inhibition was effectuated by an RNase H mechanism. The biological function of miR-181 in muscle differentiation and regeneration has also been studied with LNA-antimiRs. MiR-181 was effectively and specifically sequestered by LNAantimiR mixmers, and in C2C12 myoblast the differentiation was dramatically affected, both by myotube formation and expression of MHC [136]. It was furthermore shown that sequestering of miR-181 was related to an increased expression of Hox-A11 protein indicating that Hox-A11 is the target gene for miR-181. Inhibition of the well-characterizsed interaction between the Drosophila melanogaster bantam miR and its target hid gene was effectuated potently with mixmer LNA-antimiRs [137]. This was demonstrated in a model system where a luciferase reporter plasmid containing the Drosophila hid 3⬘-UTR (hid-pGL3⫹) was cotransfected into HEK293 cells with bantam miR. A bantam miR concentration of 30 nM reduced the luciferase expression to ca. 60%. The expression was restored when 30 nM LNA-antimiR was cotransfected, and the expression of the hid protein was increased to 177% in cell lines expressing both hid and bantam when only 10 nM LNA-antimiR was used. Lecellier et al. [138] used LNA-antimiRs to inhibit the human miR-32 that was shown to effectively limit primate foamy virus type 1 (PFV-1) replication. To address the antiviral effect of miR-32 they designed LNA-antimiRs against mir-32, and when the LNA-antimiR was cotransfected with PFV-1 in HeLa- and in BHK-21 cells the translation prevention by mir-32 disappeared specifically. At LNA concentrations of 10 nM the antiviral effect of mir-32 disappeared leading to accumulation of PFV-1. Davis et al. [85] compared a series of known antisense chemistries for their relative potencies as micro-RNA inhibitors. They tested 2⬘-O-Me, 2⬘-O-MOE, 2⬘-F, and 2⬘-O-MOEⲐLNA nucleotides in combination with DNA and PS nucleotides in a series of designs. The anti-miR oligonucleotides were tested in a lucifirase assay in a construct with the full 22 base-pair sequence complementary to the mature miR-21 inserted into the 3⬘-UTR of pGL3-control in HeLA cells. In general, the gapmers were not particularly active, and targeting the pri-miRNA with siRNA did not lead to microRNA inhibition. The most active anti-miR oligonucleotides were the once with the highest affinity, 2⬘-F and 2⬘-O-MOEⲐLNA, of the mixmer design, and the authors concluded that affinity is the single most important parameter for anti-miR activity. The advantage of the high affinity offered by LNA is nicely illustrated by Kloosterman and coworkers [88]. They showed that the size of anti-miR oligonucleotides could be reduced with out compromising the sensitivity and specificity. LNA oligonucleotides used to detect mir-124a and mir-206 in zebrafish embryos were equally effective in sizes ranging from 22 to 16 nucleotides [88]. These data suggest that the optimal size for LNA-antimiRs is likely to be of the same short size as for LNA AONs (vide supra). The data in this section confirm that LNA is a high potency micro-RNA inhibitor. The fact that the mixmer design generally appears to be the most active is even more suited for LNA compared to other chemistries, due to the “structural saturation” by LNA (vide supra). It is clear in the studies presented here that LNA also as a microRNA inhibitor offers the possibility to make “shorter than usual” anti-miRs with high potency. Thus, LNA is a very promising candidate for microRNA inhibition.

CRC_8796_ch019.qxd

546

5/25/2007

22:16

Page 546


19.9 PHARMACOLOGICAL ACTIVITY IN EXPERIMENTAL ANIMALS As described in the previous sections, incorporation of LNA nucleotides into ODNs leads to a substantial enhancement in affinity that increases with LNA nucleotide load and is independent of ODN design, for example, gapmers or mixmers. This freedom of design has enabled the development of LNA-ODNs with the ability to effectively and specifically target both coding and noncoding RNAs in vivo utilizing different mode-of-actions, such as target destruction, steric block to translation, inactivation by sequestration and interference with splicing. The first evidence of in vivo activity of LNA-ODNs was provided in 2000 by Wahlestedt et al. [111], who used 15-mer LNApo ODNs to knock down the -opioid receptor potently and sequence specifically in the brain of living rats, thus altering their response to pain in the presence of an opiate. Both gap- and mix-mer designs were highly effective and much more so than their unmodified versions. Fluiter et al. [140] demonstrated allele-specific knockdown of xenografted tumors in mice using 16-mer LNAPO ODNs directed against two different alleles of the large subunit of RNA polymerase II, POLR2A. The LNA-ODNs were all fully modified and therefore unable to direct RNaseH mediated target cleavage, suggesting that the observed activity was caused by a steric block to translation. This latter mode-of-action is generally considered inferior to an RNaseH mode-of-action. Nevertheless, the LNA-ODNs were five times more potent that the corresponding RNaseH recruiting PS-ODNs, giving clear inhibition of tumor growth when administered at 1 mgⲐkgⲐday by subcutaneously implanted osmotic minipumps. Potent suppression of tumor growth in xenografted mice at 1 mgⲐkgⲐday was also observed with 16-mer LNAPS gap-mers directed against H-Ras mRNA [93]. Both LNA-ODNs and -L-LNA-ODNs, were evaluated in this study and shown to be effective and specific. Recently, Roberts et al. [146] used a transgenic mouse, carrying the splice defective EGFP-654 gene, to evaluate the ability of a 16-mer LNAPS ODN to alter mRNA splicing. To achieve such splice modulation, the ODN must be RNaseH inactive and hence the authors used an LNA-ODN comprising alternating LNA and DNA nucleotides. The authors found the LNA-ODN to be uniquely potent in correcting aberrant EGFP mRNA splicing with activity in the liver at doses as low as 0.75 mgⲐkg administered intraperitoneally once daily for 4 days. At 25 mgⲐkg there was major splice switching activity in the liver, colon and small intestine and minor activity in the kidney, lung, and spleen, all of which are organs in which LNA-ODNs accumulate. In liver, colon and intestine the LNA-ODN was about 17-fold more potent than a corresponding, but somewhat larger, fully modified 18-mer PS-ODN comprised entirely of 2⬘-OMe nucleotides. Furthermore, the duration-of-action of the 2⬘-OMe PS-ODN (after a single intraperitoneal injection of 25 mg/kg) was significantly shorter than that of the LNA-ODN, with no activity being detected in the liver at day 15 compared to 50% activity with the LNA-ODN at day 22. Remarkably, administration of a single dose of 50 mg/kg of the LNA-ODN to mice by oral gavage produced activity in the small intestine, colon and liver that was clearly above background. Notably, whereas liver showed the most activity after intraperitoneal administration, small intestine showed the most activity after oral administration. The above reports of in vivo activity of LNA-ODNs are consistent with our own observations that 16-mer LNAPS-ODNs, termed RNA Antagonists, are able to downregulate mRNA targets effectively in mice and monkeys. Dosing by intraperitoneal injection daily for 14 days of SPC2968, an RNA Antagonist of Hif-1 (vide infra), resulted in potent and dose-dependent downregulation of its mRNA target in the liver and kidney of wild-type mice [133]. Of the two tissues examined, the activity was most pronounced in the liver, where a 50% reduction in Hif-1 mRNA levels was achieved by a daily dose of 3.6 mgⲐkg. Consistent with the role of Hif-1 as a transcription factor, treatment with SPC2968 also caused a substantial reduction in the mRNA from the Hif-1-regulated gene, VEGF. In a similar manner, intravenous administration of SPC3197, an RNA Antagonist of ApoB-100, potently and dose dependently reduced ApoB-100 mRNA in both the liver and jejunum of normal mice with 50% target reduction observed at ⬃5 mg/kg [147]. Paralleling the reduction in ApoB-100

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 547

547

120

Normalize Bcl-2 protein values in % of saline

Normalize Bcl-2 mRNA values in % of saline

LOCKED NUCLEIC ACID

100 80 60 40 20 0

120 100 80 60 40 20 0

3 mg/kg

6 mg/kg

SPC2996

3 mg/kg

6 mg/kg

G3139

Saline

3 mg/kg SPC2996

3 mg/kg G3139

Figure 19.10 Steady-state levels of Bcl-2 mRNA (normalized to -actin mRNA) and Bcl-2 protein (normalized to tubulin) in the liver of monkeys after every second day intravenous bolus injection of 3 or 6 mg/kg of SPC2996 (hatch bars) or G3139 (Oblimersen sodium) (black bars) for 2 weeks.

mRNA, circulating levels of cholesterol were reduced by ⬃50% at 5 mgⲐkg and ⬃75% at 25 mg/kg. The study comonitored the performance of a corresponding siRNA (conjugated to cholesterol and containing 2⬘-OMe and PS modifications) that had previously been demonstrated to downregulate ApoB-100 in normal mice after systemic administration [148]. At the 50 mgⲐkg dose the modified siRNA showed no significant activity in the liver and only modest activity in the jejunum. Also, no effects were observed on plasma levels of cholesterol. SPC2996, an RNA Antagonist of Bcl-2, has been evaluated for pharmacological activity in Cynolomolgus monkeys using doses (3 and 6 mgⲐkg), an administration route (intravenously), and a schedule (every second day for two weeks) that are clinically relevant. As shown in Figure 19.10, substantial and dose-dependent reduction in both Bcl-2 mRNA and protein was observed in the liver when compared to the saline control (obtained from an earlier monkey study with SPC2996). In contrast, little to no effect on either Bcl-2 mRNA or protein, and no indication of dose-response, was observed in animals treated with the somewhat larger 18-mer PS-ODN, G3139 (Oblimersen sodium)—a Bcl-2 inhibitor that has been tested in several clinical trials. Recent years have witnessed the discovery of a novel class of small, noncoding, regulatory RNAs, termed micro RNA, that are increasingly attracting interest as pharmaceutical intervention points for the treatment of a diversity of human diseases. ODNs are uniquely suited to therapeutically target these miRNAs exploiting a simple sequestration mode-of-action. Ideally, the ODN should be short to reduce unwanted toxicities, yet have very high affinity to cause tight and durable binding to the miRNA suggesting that LNA-ODNs would be well suited for the task. Consistent with this notion, intraperitoneal injection for three days of a 16-mer LNAPS ODN against miR-122a (comprising alternating LNA and DNA nucleotides) potently inhibited the target in mice liver with an IC50 around 4–5 mgⲐkg [149]. The inhibition was dose-dependent, sequencespecific and at the 25 mgⲐkg dose, more than 50% inhibition was evident one week after dosing. Consistent with its role in cholesterol metabolism, inhibition of miR-122a translated into a significant reduction in plasma cholesterol that was reduced by more than 40% one week after dosing. 19.9.1 Brief Summary As expected from their behavior in cell cultures, LNA-ODNs are specific and potent inhibitors of their cognate RNA targets in vivo at very low doses. To date, pharmacological activity has been demonstrated in many different tissues (liver, kidney, colon, jejunum, small intestine, lung, spleen, and brain), and species (mice, rats, and monkeys) using a variety of administration routes (subcutaneous infusion, intravenous injection, intraperitoneal injection and direct injections into brain). Using different designs of LNA-ODNs it has been possible to target effectively both mRNAs and noncoding miRNAs, causing either a reduction in protein synthesis, a shift in the splicing pattern or inactivation by physical sequestration.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 548

548


19.10 PHARMACOKINETICS 19.10.1

Plasma Pharmacokinetics

Detailed plasma pharmacokinetic studies have been completed for two development candidates: SPC2996, a 16-mer LNAPS gapmer directed against the Bcl-2 mRNA and SPC2968, a 16-mer LNAPS gapmer directed against the Hif-1 mRNA. After intravenous bolus administration to rodents and monkeys, plasma concentrations of SPC2996 (Figure 19.11) as well as SPC2968 decreased in a biphasic manner with an initial rapid distribution phase during which the LNA-ODN deposits in tissues (vide infra) followed by a slower elimination phase. For both ODNs, the maximum mean plasma concentration (Cmax) was observed at the first sampling time point postdose, as would be expected following intravenous dosing. The calculated, theoretical plasma concentration at time zero (C0) increased linearly with dose in both mice, rats and monkeys, and in monkeys (where both oligos were tested) peak plasma concentrations of the ODNs were quite similar at similar doses. There was no statistically significant evidence of any sex-related differences in any of the species examined. Table 19.6 shows the C0 values for SPC2996 in rats and monkeys. The extent of systemic exposure (characterized by the area under the mean plasma concentration curve up to 24 h, AUC24) increased with increasing dose in all species. Increases, however, were greater than the proportionate dose increment for both SPC2996 (Figure 19.12) and SPC2968, indicating the existence of one or more saturable elements to distribution. In the SPC2996 study, where doses of up to 60 mgⲐkg were given every second day for 2 weeks, the AUC24 values at day 14 showed evidence of accumulation. By contrast, no accumulation was observed in the SPC2968 study that used lower doses (up to 40 mgⲐkg) and intensity (twice weekly for 4 weeks) 19.10.2

Biodistribution and Tissue Half-Life

Whole body biodistribution, tissue accumulation and subsequent clearance have been studied with several LNA-ODNs, using different dosing schedules, routes of administration and types of LNA

Mean plasma concentrations (µg/ml)

Rat

Monkey

1000

1000

100

100

10

10

1

1 0

200

400

600

Time after dosing (min)

0

500

1000

1500

2000

Time after dosing (min)

Figure 19.11 Plasma clearance of SPC2996 in rats and monkey after intravenous bolus injection of 60 mg/kg. Table 19.6 The Calculated, Theoretical Plasma Concentration at Time Zero Values (C 0) in Rats and Monkeys after Intravenous Bolus Injection of SPC2996 at 6, 20 or 60 mg/kg. g/mL) C0 ( LAN Oligo

Species

SPC2996

Monkey Monkey Rat Rat

Sex Male Female Male Female

6 mg/kg

20 mg/kg

60 mg/kg

131⫾12 138⫾6 104 73.8

388⫾19 431⫾36 271 152

1120⫾96 1350⫾70 1050 929

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 549

LOCKED NUCLEIC ACID

549 Monkey

AUC24(µg h/ml)

Rat 800 700 600 500 400 300 200 100 0

2000 1500 1000 500 0 6

20 Dose (mg/kg)

60

6

20 Dose (mg/kg)

60

Figure 19.12 Systemic exposure (AUC24) to SP2996, after intravenous bolus injection of 6, 20 and 60 mg/kg to rats and monkey on day 1 and after repeated dosing (every second day for 13 days). Hatched bars indicate the expected AUC24 assuming dose linearity. Black bars show the actual measurement after the first dose and white bars show the actual measurements after repeated dosing. 1.2 1.0 0.8 0.6 0.4 0.2

Brown fat

Myocardium

Skeletal muscle

Thymus

Lung

Pancreas

Adrenal gland

Lymph node

Pituitary gland

Salivary gland

Spleen

Ovary

Thyroid gland

Bone marrow

Liver

Gastric mucosa

Skin

Uvea (eye)

Uterus

Kidney

0.0

Figure 19.13 Biodistribution of titriated SPC 2996 (white bars) and SPC 2968 (black bars) 4 h after intravenous bolus injection of 60 mg Ⲑ kg to mice. Data normalized to kidney.

monomers. Bolus injection of 50 mgⲐkg of tritium-labeled SPC2968 or SPC2996 in mice resulted in rapid distribution to tissues that tracked ODN clearance from plasma, which was completed within 2–4 h. Except for the brain, spinal cord, bone, testis, and lens both ODNs reached all tissues examined and with quite similar distribution profiles (Figure 19.13). Tissue half-lives were estimated on the basis of disappearance of label over 18 days and were found to be remarkably similar (⬃200 h) for the two ODNs across tissues. This is a much longer tissue half-life than those reported for PS-ODNs [139] and consistent with the much improved metabolic stability of LNA-ODNs. Distribution profiles quite similar to that shown in Figure 19.13 were also reported after intraveneous bolus administration to mice of tritium-labeled 16-mer LNAPO or LNAPS ODNs directed against either the POLR2A or H-Ras gene [93,140]. Moreover, the distribution profile was similar whether the H-Ras LNA-ODN was administered as intravenous bolus or by subcutaneous continuous infusion over 14 days (K. Fluiter, personal communication), suggesting that distribution is independent of the route of systemic administration. The H-Ras study also evaluated the distribution of several LNA analogs, for example, thio-LNA, amino-LNA and -L-LNA. After subcutaneous continuous dosing of 5 mgⲐkgⲐday for 2 days several significant differences were observed in the distribution profiles of the three analogs. The amino-LNA differed the most with substantially more label accumulating in the heart, skeletal muscles, bones, and liver than observed with either of the other chemistries [93].

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 550

550


These data show that LNA analogs can be used to influence pharmacokinetics-a potentially useful feature when designing drug candidates against different diseases. Tissue accumulation as a function of dose and schedule has been studied in both mice and monkeys using an HPLC method that enables detection of LNA-ODNs (full-length and n-1 oligonucleotides) with a lower limit of detection of ⬃5 gⲐg of tissue. In mice, intraperitoneal administration of 2, 10 or 50 mgⲐkg on day 0, 3,7,10, and 13 resulted in dose-linear accumulation in liver and kidney with no signs of having reached steady state (Figure 19.14). Different dosing schedules (0.7, 3.6 or 18 mgⲐkg daily for two weeks) that delivered the same total dose resulted in similar final tissue concentrations suggesting that total dose rather than schedule is the major determinant of tissue accumulation. In monkeys, intravenous dosing of 6 to 60 mg/kg of the development candidate SPC3042 (a 16-mer LNAPS gap-mer directed against survivin) twice weekly for 4 weeks also resulted in dose-linear tissue accumulation and a distribution similar to that observed in mice (Figure 19.15). Dose-linear accumulation in liver and kidney was also observed upon repeated intravenous dosing of 6–60 mg/kg of SPC2996 (every second day for 2 weeks) and 6– 40 mgⲐkg of SPC2968 (twice weekly for 4 weeks).

180 160

SPC2968 µg/g tissue

140 120 100 80 60 40 20 0 0.7

3.6

18

mg/kg daily for 14 days

2.0

10

50

mg/kg on days 0,3,7,10, and 13

Figure 19.14 Accumulation of SPC 2968 (intraperitoneal injection) in the liver of mice as a function of dose and dosing schedule. 1800 1600

SPC3042 µg/g tissue

1400 1200 1000 800 600 400 200 0 Kidney

Liver

Bone Pancreas marrow

Colon

Figure 19.15 Accumulation of SPC 3042 in five different tissues in monkeys following intravenous bolus injection of 60 mg/kg.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 551

551

The half-lives of LNA-ODNs in monkey livers have been estimated from measurements of ODN present at the end of the treatment phase and after a further recovery period. Assuming monoexponential decay the following half-lives in liver were calculated on the basis of the means of data from six (treatment group) and four animals (recovery group), SPC3042: 19.5 days, SPC2996: 22.6 days, and SPC2968: 29.3 days. Given the quite large standard deviations on the measurements, we infer that half-lives of LNA-ODNs in monkey liver are quite similar and remarkably long (at least several weeks) providing the possibility that pharmacologically active concentrations of LNA-ODNs in humans may be maintained with infrequent and therefore convenient dosing schedules. 19.10.3

Uptake into Cells

Once distributed to tissues, short LNA-ODNs appear to be internalized into the constituent cells in a pharmacologically active form, as evidenced by many examples of potent pharmacological activity in vivo (vide supra). By and large, there seems to be good correlation between pharmacology and pharmacokinetics, that is, good activity is normally observed in highly accumulating tissues. The notable exception identified so far is kidney where pharmacological activity in whole organ homogenates has consistently been much smaller than expected from bulk accumulation data alone. This apparent discrepancy was partly explained by fluorescence microscopy examination of mouse kidney sections after systemic administration of fluorescently labeled LNA-ODNs showing label to be predominantly confined to the kidney cortex with particularly strong staining in the epithelium of the proximal and, to a lesser extend, distal tubules (suggesting that uptake into kidney tissue is primarily through re-absorption into proximal tubule epithelial cells from glomerular filtrate in the lumen of the tubule rather than directly from the blood stream). Uptake into mice hematopoietic cells in vivo has been studied by Flow-Activated Cell Sorting (FACS) analysis, using lineage-specific antibodies and a fluorescently labeled version of SPC2968. After intraveneous bolus injection of either FITC-SPC2968 or FITC alone (control), the ODN was found to be associated with all cell types in the bone marrow, spleen, and circulation (Figure 19.16). The amount of SPC2968 associated with different cell types, however, differed significantly and the ranking between cell types was different in the different compartments analyzed. These differences strongly suggest that SPC2968 was not merely adhering to the surface of the cells but was in fact internalized. Moreover, the data indicate that the ability to internalize LNA-ODNs varies between different cell types and depends on the context in which cells encounter the ODN. As shown in Figure 19.16, SPC2968 was also associated with multipotent stem cells in the bone marrow as defined by the CD34, Lin-stain. That these cells were in fact progenitor cells was subsequently confirmed by their ability to form colonies when plated in soft agar. This finding is crucial to the use of LNA-ODNs in the treatment of leukemia, where the defect is often in the stem cell compartment. More recently, uptake and cytoplasmic compartmentalization of LNA-ODNs has been demonstrated in primary CLL cells in culture, highlighting their applicability to target hematopoietic malignancies (R. Van Oers, personal communication). Uptake of short LNA-ODNs into cultured cells without the use of transfection reagents or carrier molecules has also been reported. Incubation of ACSH cells (⬃106 per well) with 5 nM of a 99mTc labeled 15-mer LNA-ODN against Ri mRNA led to a continuous accumulation with time that at 24 h corresponded to ⬃5 ⫻ 104 molecules per cell [141]. The ODN was not simply adhering to the cell surface as indicated by the finding that accumulation of the antisense LNA-ODN significantly exceeded that of sense LNA-ODN at all timepoints from 1 h and forward, ending at a fivefold higher concentration at 24 h (i.e., the antisense ODN is assumed to be retained in the cell by binding to its target mRNA whereas the sense ODN, which does not have a target in the cell, is not). Fractionation of the cells showed that the antisense LNA-ODN was significantly present in both the nuclear, cytoplasmic, and membrane fractions lending further support to the conclusion that the ODN was taken up by the cells.

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 552

552


Median fluorescent intensity (MFI)

(A)

60 50 40 30 20 10 0 CD4

Granulocyte Macrophage

B cells

CD34-Lin/

Dendritic

(B)

50


Cell lineages

40 30 20 10 0

CD4

CD8


B cells

Cell lineages

(C)

70


60 50 40 30 20 10 0

CD4

CD8


B cells

Cell lineages

Figure 19.16 Median fluorescent intensity of hematopoitic cell lineages 24 h after intravenous bolus injection of fluorescently labeled SPC 2968s into mice. (A) Bone marrow. (B) Circulation. (C) Spleen. Grey bars indicate the MFI signal obtained with the FITC alone (control) and black bars indicate the MFI signal obtained with FITC labeled SPC 2968.

19.10.4

Excretion

Radioactivity has been detected in the urine and bile of all mice treated with both radiolabeled LNAPS or LNAPO 16-mer gapmers [140] indicated that both are routes of elimination. At pharmacologically active doses plasma clearance of LNAPS ODNs is predominantly by tissue distribution with very little being filtrated by the kidney and even less excreted via the bile [140]. When SPC2968 or SPC2996 were administered intravenously at very high doses (50 mgⲐkg), however, renal excretion was markedly increased suggesting that ODN concentrations had exceeded the capacity of plasma binding that would otherwise prevent renal filtration.

19.10.4.1

Brief Summary

The aggregate data suggest that the pharmacokinetics of short LNAPS ODNs are sequence independent but can be influenced by the choice of LNA chemistry. Cmax increases linearly with dose in

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 553

LOCKED NUCLEIC ACID

553

the concentration range examined (6–60 mgⲐkg) and is observed at the first sampling time point. Plasma clearance is rapid, shows saturation kinetics at very high doses and is largely driven by broad distribution to tissues. With the constraint of limited data, tissue accumulation appears to depend more on total dose than dosing schedule and to be rather independent of the route of systemic administration (continuous subcutaneously, intraperitoneally or intraveneously). Once in the tissues, LNA-ODNs have very long half-lives which in monkeys are measured in several weeks. This is consistent with the good metabolic stability of LNAPS ODNs and suggests that activity in humans may be achieved with relatively infrequent and therefore patient convenient dosing schedules.

19.11 TOXICOLOGY 19.11.1

Acute Toxicities

Acute toxicities of clinically sized phosphorothioates (typically 20-mers) have been characterized in detail in monkeys [142], thus providing a suitable background against which LNA-ODNs can be benchmarked. The principal acute toxicities of PS-ODNs are class related and attributable to complement activation and inhibition of clotting function both of which have been of significant concern in the clinical development of PS-ODN drugs. Complement activation by phosphorothioates consistently occurs at plasma threshold levels of 40–50 gⲐmL in monkeys and manifests as pronounced increases in complement split products such as Bb (which may increase 100-fold above baseline), transient fluctuations in circulating neutrophils and hemodynamic changes. Occasionally, complement activation has resulted in cardiovascular collapse and an anaphylactic-like response, which in some animals have been lethal. The causal mechanism is well understood and involves binding of the PS-ODNs to complement factor H that acts as a break on the constitutively active alternative cascade of complement [142]. Decreasing the size of the ODN has been shown to reduce factor H binding [143,144] suggesting that the 16-mer LNA-ODN development candidates would have a much reduced propensity to activate complement than their larger sized PS-ODN cousins. Consistent with this, intravenous bolus injections of up to 60 mgⲐkg of SPC2996 in primates (C0 values of ⬃1200 gⲐmL; Table 19.6) in the context of formal GLP toxicity studies, did not produce any of the overt signs of acute toxicity reported to accompany PS-ODN induced complement activation. In fact, the dose escalation study preceding the main study reached doses of 300 mgⲐkg (administered as 5 min bolus injection) before encountering signs of reaction to the treatment and then only following the third dose. At the biochemical level, no increase in Bb split products was observed following intravenous bolus injections of SPC3042 until the 15 mgⲐkg dose was reached (expected C0 values ⬃300 g/mL) at which the level of Bb split products was approximately twice that of background. Only at the 60 mg/kg dose (expected C0 values ⬃1200 gⲐmL) did plasma levels of Bb split products clearly increase, approximately five- to sevenfold (Figure 19.17), although this is still far lower than the levels observed with clinical PS-ODNs at much lower doses [142]. Elevated Bb split products in the 60 mg/kg dose group was not associated with any clinical signs or changes in hematological or hemodynamic parameters. In all animals, the increased concentrations of Bb split products were transient in nature, peaking 30 min after dosing and reverting to normal values when measured 24 h after dosing. Also, responses were approximately similar whether measured after the first dose or after twice weekly dosing for 4 weeks. Increases in Bb split product were also observed with SPC2968. At the 40 mg/kg dose the level was about twice that observed at the 60 mgⲐkg dose of SPC3042, indicating some variation between oligonucleotides and complement activation could not be ruled out as a contributing factor to the poor clinical condition of one animal that necessitated sacrifice on day 29 of the 4-week study. Inhibition of clotting function is the other major acute toxicity of PS-ODNs, which manifests as a prolongation of activated partial thromboplastin time (APTT) and prothrombin time (PT), the magnitudes of which have been reported to be linearly proportional to ODN concentrations in

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 554

554


Bb-fragment (µg/mL)

12 10 8 6 4 2

First dose

24 h

4h

30 min

Predose

24 h

4h

30 min.

Predose

0

Eighth dose

Figure 19.17 Increase in Bb complement split product in monkeys following the first and eighth dose of 60 mg Ⲑkg of SPC 3042 (intravenous bolus injection). Solid circles designate female monkeys and solid squares designate males.

plasma. APTT is significantly more affected than PT and typically doubles in monkeys when plasma concentrations of PS-ODNs reach 150 gⲐmL. Like complement activation, prolongation of bleeding is caused by drug binding to plasma proteins that in the case of APTT have been identified as activated Factor Xa [142]. Prolongation of APTT has been shown to be directly proportional to the length of the phosphorothioate [142], suggesting that the LNA-ODN development candidates would also have a much reduced ability to provoke this acute toxicity. Indeed, dosing of 15 mgⲐkg of SPC3042 had no effect on either APTT or PT at plasma concentrations (expected C0 ⬃300 gⲐmL) that far exceed that at which PS-ODNs will cause a doubling. In fact, a doubling of APTT was only observed at the highest doses tested with SPC3042 (60 mgⲐkg) and SPC2968 (40 mgⲐkg) and even at these doses PT was only marginally affected. Figure 19.18 shows the results for SPC3042. In all cases, APTT and PT values returned to baseline at 24 h postdosing with the LNA-ODN and in only one high dose group animal in the SPC3042 study (sacrificed on the basis of poor clinical condition at day 22 of the 4-week study) were prolongations in APTT associated with pathological bleeding in internal organs. 19.11.2

Subacute Toxicities

Several investigators have reported that LNA-ODNs are well tolerated in rodents at pharmacologically active doses. In a study with 15-mer LNAPO ODNs against the -opioid receptor, no detectable histological toxicity or changes in core body temperature were noted after direct injection of the ODN into the striatum of rat brains [111]. In contrast, the isosequential PS-ODNs caused fever and severe necrosis along the trajectory of the injection site. Continuous subcutaneous administration of up to 5 mgⲐkg for 14 days of various 16-mer LNAPO ODNs against the POL2R mRNA did not result in any histological changes in the liver or kidney of mice [140]. Also, the mixed mononuclear infiltrate in liver that is characteristically found when PS-ODNs are used was absent (vide infra). Minor increases in ALAT and ASAT levels were noted but only at the highest dose, which were well above the therapeutically active dose. Likewise, neither ASAT, ALAT or alkaline phosphatase levels were increased significantly when mice were dosed with pharmacologically active doses of either a 16-mer LNAPS ODN or the isosequential -L-LNA-ODN against H-Ras [93]. Also, there was no abnormal fluctuation in body temperature during the study. Immune stimulation is a particularly well–studied toxicity of PS-ODNs, which manifests as splenomegaly, lymphoid hyperplasia, hypergammaglobulinemia and infiltration of mixed mononuclear cells in a variety of tisues such as liver, kidney, heart, lung, thymus, pancreas and

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 555

LOCKED NUCLEIC ACID

555

(A) 90 Seconds to thrombus formation

80 70 60 50 40 30 20 Predose

30 min

24 h

Predose

First dose

Seconds to thrombus formation

(B)

30 min

24 h

Eighth dose

14 13 12 11 10 9

Predose

30 min

24 h

First dose

Predose

30 min

24 h

Eighth dose

Figure 19.18 Increase in (A) APTT and (B) PT values after the first and eighth dose of 60 mg/kg of SPC 3042 (intravenous bolus injection). Solid circles designate female monkeys and solid squares designate males.

salivary glands [142]. Stimulation is particularly pronounced with PS-ODNs carrying CpG motifs, but all PS-ODNs, independent of sequence, exhibit some degree of immune stimulation (which is most prominent in rodents). In 2004, Vollmer et al. [145] reported that LNA nucleotides could be used to substantially decrease the immune stimulatory effect of otherwise highly efficient PS-ODNs (scored as cytokine release from human PMBC cells). Increasing the number of LNA nucleotides at the 5⬘ and 3⬘ ends of the highly immunostimulatory PS-ODN, G3139 (Oblimersen sodium), led to progressive loss of IL-10 secretion that dropped to background levels when the ODN contained 4 LNA nucleotides at each end. Likewise, substitution by LNA nucleotides of both the DNA-C and G in the CpG motif of another strongly immunostimulatory PS-ODN led to massive decreases in IL-6, IL-10 and IFN- production. A substantial reduction in immune stimulation was also observed with single LNA nucleotide substitutions (LNA-C substitutions being more effective than LNA-G). The subacute toxicity of the development candidates SPC2996, SPC2968, and SPC3042 has been investigated in rodents andⲐor nonhuman primates. The first candidate SPC2996 was dosed intravenously to Cynomolgus monkeys every second day for 14 days at dose levels 6, 20, and 60 mg/kg. Recovery after 14 days was evaluated in the 60 mgⲐkg group. Based on experience from the first subacute study with SPC2996 the next two candidates, SPC3042 and SPC2968, were dosed intravenously to Cynomolgus monkeys twice weekly for 4 weeks, with recovery being evaluated after 4 weeks at high- and medium-dose level. The dose levels for SPC3042 were 6, 15, and 60 mgⲐkg, and SPC2968 was dosed at 6, 10, and 40 mgⲐkg.

CRC_8796_ch019.qxd

5/25/2007

22:16

556

Page 556


Slight degenerativeⲐhypertrophic changes in the liver associated with slight increases in liver weight and liver enzymes (ASTⲐALT) were seen in the medium- and high-dose groups treated with SPC2996 and SPC3042. No liver toxicity was recorded after 4 weeks treatment with SPC2968 (in a preceding MTD study with SPC2968 the monkeys showed slight liver toxicity at 80 mgⲐkg). Slight renal toxicity associated with increased organ weight was recorded in high-dose groups of all three candidates and in the medium groups of SPC2996 and SPC2968. The local response to treatment was identical for the three candidates, slightly increased compared to identical treatment with vehicle but much reduced to that reported for PS-ODNs [142]. Findings at the injections sites were characterized as hemorrhage, inflammatory, and degenerative changes. Sporadic, treatment related, mononuclear infiltration was recorded in spleen, lymph nodes, lung, salivary glands, liver or gall bladder after treatment with SPC2996. Owing to the short recovery period in the SPC2996 study (14 days), full recovery was not obtained, in contrast to the SPC3042 and SPC2968 studies where full recovery of toxicity effect was recorded after 4 weeks. The subacute toxicity of SPC2996 was also estimated in rats in a 14-day intravenous study at 6, 20, and 60 mgⲐkg with 14 days recovery evaluated at high-dose level. Slight dose related liver toxicity, including single cell degeneration, inflammation, and mitotic increase, increased organ weight and slightly increased liver enzymes were recorded at 20 and 60 mgⲐkg. Slight dose-related renal toxicity, including cellular degeneration and inflammation associated with macroscopic changes, increased organ weight and slightly increased urine volumes, were recorded at 20 and 60 mgⲐkg. Inflammatory cell infiltration was recorded in lung and liver and increased cellularity in spleen and lymph nodes associated with increased white blood cell counts were recorded in rats at 20 and 60 mgⲐkg. The local response to treatment was slightly increased compared to identical treatment with vehicle. Owing to the short recovery period in the SPC2996 study in rats full recovery of the treatment-related effects was not obtained. At 6 mgⲐkg, no toxicity or pathological changes were observed. The subacute toxicity of SPC2968 was investigated in mice in a 4-week intravenous study at 2, 8, and 40 mgⲐkg with 4 weeks recovery evaluated at all treatment levels. Slight liver toxicity including cell hypertrophy, degeneration, inflammation, and necrosis associated with macroscopic changes, increased organ weight and slightly increased liver enzymes were recorded at the top dose of 40 mgⲐkg. At 8 mgⲐkg the toxicity was minimal, recorded in only a few animals, and not associated with increases in liver enzymes. Increased extramedullary hematopoiesis andⲐor increased cellularity was recorded in the spleen of mice treated at the 40 mgⲐkg dose. The local reaction to treatment was slightly increased compared to identical treatment with vehicle. Apart from slight inflammatory infiltrate in the livers of mice treated at 40 mgⲐkg, full recovery after treatment was recorded. The immune stimulating effect of the three LNA candidates was minimal in monkeys. The increased immune stimulating effect observed following the treatment with SPC2996 compared to the other two candidates was most likely related to the higher doseⲐmore frequent treatment schedule. In the subacute rat study with SPC2996 evidence of slight immune stimulation was recorded in several organs compared to the mouse study with SPC2968 where the inflammatory infiltrates were restricted to the liver. The difference was most likely related to dose level. In all cases, the immune stimulating effects seen in rodents treated with any of the LNA-ODN development candidates were substantially less than the reported immunostimulatory effects of PS-ODNs.

19.11.2.1

Brief Summary

The available data clearly show that 16-mer LNAPS ODNs have very little—if any ability to activate complement and inhibit clotting at clinically relevant doses. This means that the margin of safety for these molecules is much greater than that of other PS-based ODNs in the antisense field. The available evidence further suggests that the toxicity of LNAPS ODNs observed in rodent and nonhuman primates is a class effect that is independent of sequence and fully reversible upon cessation of treatment. Importantly, the subacute toxicities observed at high doses of the LNAPS ODNs have all been previously described for PS-ODNs and are thought to be due to the

CRC_8796_ch019.qxd

5/25/2007

22:16

Page 557

LOCKED NUCLEIC ACID

557

phosphorothioate backbone suggesting that the addition of LNA monomers to oligonucleotides does not add new class-toxicities.

19.12 LNA DRUGS IN DEVELOPMENT In 2005, the first LNAPS ODN, SPC2996 entered into a phase IⲐII study in patients with CLL. SPC2996 is a potent and selective inhibitor of the Bcl-2 gene that encodes a key sensor protein, which protects cells against apoptosis. The Bcl-2 protein is overexpressed in many cancers, including CLL, and high expression has been firmly correlated with low response rates and resistance to chemotherapy, faster time to relapse and shorter survival times [150]. SPC2996 has the potential to become a broad acting anticancer drug, working through sensitization of cancer cells to naturally produced, or clinically induced, apoptotic instructions. The human phase IⲐII clinical trial is an open label, international multicenter, dose-escalation study being conducted by Santaris Pharma at 13 sites in four countries (Denmark, UK, US, and France). In total, the study will enroll 42 patients. The primary endpoints are to define the maximum tolerated dose, identify clinical side effects, and to investigate changes in Bcl-2 expression during and following treatment. Secondary endpoints include the study of overall tumor response, changes to CLL cell numbers in peripheral blood and time to progression. SPC2996 is given as a 2-h intravenous infusion, three times a week for 2 weeks. Two other LNAPS ODNs, SPC2968 and SPC3042, have completed preclinical toxicology and are ready for clinical trials in patients with cancers. SPC2968 is a potent and selective inhibitor of Hif-1 that encodes the oxygen sensitive -subunit of the HIF-1 transcription factor. Under low oxygen tension HIF-1 transcriptionally activates more than 60 genes that facilitate cell survival under anaerobic conditions, upregulate neovascularization, increase the oxygen transporting capacity of the blood, facilitate cell proliferation, and enhance the ability of cells to transgress tissue boundaries and metastazise [151]. High levels of Hif-1 are common in human tumors and have in many cases been reported to correlate with increased tumor vascularization, aggressive behavior and overall poor clinical outcome [152]. SPC2968 is being codeveloped by Santaris Pharma and Enzon Pharmaceuticals and has the potential to become an innovative new anticancer drug working by interference with several metabolic pathways important for the malignant phenotype. SPC3042 is a potent and selective inhibitor of survivin that plays a vital regulatory role in apoptosis by inhibiting activation of lethal caspases [153]. In addition, survivin plays a pivotal role in normal mitotic progression and cell division. Survivin is expressed in many cancers, but almost absent in normal, adult, differentiated tissues. Clinically, survivin expression is generally associated with poor prognosis, resistance to therapy and increased risk of relapse [153]. SPC3042 is also the subject of a codevelopment agreement between Santaris Pharma and Enzon Pharmaceuticals and is expected to enter clinical studies in 2007.

19.13 CONCLUSIONS AND FUTURE DIRECTIONS So far, efforts to develop LNA-ODNs into therapeutics have focused on fully phosphorothiolated 16-mers. As reviewed in this chapter such short, single-stranded, LNA-ODNs, which we term RNA Antagonists, combine unprecedented potency in vitro and in vivo with improved safety profiles compared to longer PS-ODNs comprising other chemistries. As we further explore the potential of the LNA chemistry, it is conceivable that the size and PS load of these molecules can be further reduced without compromising potency and specificity, and that such shorter molecules will offer additional advances in regard to for instance cellular uptake and reduced toxicity. We are also just at the beginning of understanding how the different LNA analogs can be used to alter biodistribution

CRC_8796_ch019.qxd

558

5/25/2007

22:16

Page 558


andⲐor improve uptake, thereby broadening the applicability of the LNA drug platform to human diseases. In conclusion, the advent of LNA has underpinned the importance of affinity and metabolic stability in the development of effective single-stranded oligonucleotide drugs. Over the next few years, LNA-ODNs of a variety of designs will enter and complete human clinical trials, in a number of different disease settings. The data from these trials will be pivotal in confirming whether short LNA-ODNs (RNA Antagonists) represent a successful new class of drugs or only a step along the way to effective RNA targeting therapeutics. ACKNOWLEDGMENTS We are grateful to Keith McCullagh for his valuable suggestions and comments during the review process of the manuscript. Part of the work described in this chapter has been performed by our colleagues at Santaris Pharma and have yet to be published. We thank them for their contributions and assistance all of which are greatly appreciated. In particular, we would like to recognize the contributions of Lisa Eriksen, Vibeke Aarup, Phil Kearney, Christoph Rosenbohm and Sakari Kauppinen. REFERENCES 1. Singh, S.K., Nielsen, P., Koshkin, A. et al., LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition, Chem. Commun., 455, 1998. 2. Obika, S., Hari, Y., Sugimoto, T. et al., Triplex-forming enhancement with high sequence selectivity by single 2⬘-O,4⬘-C-methylene bridged nucleic acid (2⬘,4⬘-BNA) modification, Tetrahedron Lett., 41, 8923, 2000. 3. Singh, S.K., Kumar, R., and Wengel, J., Synthesis of novel bicyclo [2.2.1] ribonucleosides: 2⬘-amino-and 2⬘-thio-LNA monomeric nucleosides, J. Org. Chem., 63, 6078, 1998. 4. Singh, S.K., Kumar, R., and Wengel, J., Synthesis of 2⬘-amino-LNA: a novel conformationally restricted high-affinity oligonucleotide analogue with a handle, J. Org. Chem., 63, 10035, 1998. 5. Wengel, J., Koshkin, A., Singh, S.K. et al., LNA (Locked Nucleic Acid), Nucleosides Nucleotides Nucl. Acids, 18, 1365, 1999. 6. Rahman, S.M.A., Seli, S., Utsiki, K. et al., Synthesis and properties of 2⬘,4⬘-BNANC, a second generation BNA, Nucl. Acids Symp. Series, 49, 5, 2005. 7. Hari, Y., Osaki, T., Eguchi, K. et al., Synthesis and properties of oligonucleotiodes containing novel 2⬘,4⬘-BNA analogues (2⬘,4⬘-BNACOC), Nucl. Acids Res. Suppl., 2, 147, 2002. 8. Koshkin, A., Rajwanshi, V.K., and Wengel, J., Novel convenient syntheses of LNA [2.2.1] bicyclo nucleosides, Tetrahedron Lett., 39, 4381, 1998. 9. Singh, S.K. and Wengel, J., Universality of LNA-mediated high-affinity nucleic acid recognition, Chem. Commun., 1247, 1998. 10. Vorbrüggen, H. and Höfle, G., On the mechanism of nucleoside synthesis, Chem. Ber., 114, 1256, 1981. 11. Vorbrüggen, H. and Bennua, B., A new simplified nucleoside synthesis, Chem. Ber., 114, 1279, 1981. 12. Takashi, I. and Satoshi, O., Synthesis and properties of novel conformationally restrained nucleoside analogues, J. Synth. Org. Chem., Jpn., 57, 969, 1999. 13. Christensen, S.M., Hansen, H.F., and Koch, T., Molar-scale synthesis of 1,2:5, 6-Di-0-isopropylidenealpha-D-allofuranose: DMSO oxidation of 1,2:5,6-Di-O-isopropylidene-alpha-D-glucofuranose and subsequent sodium borohydride reduction, Organic Proc. Res. Dev., 8, 777, 2004. 14. Koshkin, A., Singh, S.K., Nielsen, P. et al., LNA (Locked Nucleic Acids): synthesis of the adenine, cytosine, guanine, 5-methylcytosine, thymine and uracil bicyclonucleoside monomers, oligomerisation, and unprecedented nucleic acid recognition, Tetrahedron Lett., 54, 3607, 1998. 15. Koshkin, A.A., Fensholdt, J., Pfundheller, H.M. et al., A simplified and efficient route to 2⬘-O, 4⬘-Cmethylene-linked bicyclic ribonucleosides (locked nucleic acid), J. Org. Chem., 66, 8504, 2001.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 559

559

16. Koshkin, A.A., Syntheses and base-pairing properties of locked nucleic acid nucleotides containing hypoxanthine, 2,6-diaminopurine, and 2-aminopurine nucleobases, J. Org. Chem., 69, 3711, 2004. 17. Gaubert, G. and Wengel, J., Synthesis of a base-protected alpha-L-LNA guanine nucleoside, Nucleosides Nucleotides Nucl. Acids, 22, 1155, 2003. 18. Wengel, J., Synthesis of 3⬘-C-and 4⬘-C-branched oligodeoxynucleotides and the development of locked nucleic acid (LNA), Acc. Chem. Res., 32, 301, 1999. 19. Pedersen, D.S., Rosenbohm, C., and Koch, T., Preparation of LNA phosphoramidites, Synthesis, 802, 2002. 20. Lin, T.S., Mancini, W.R., and Gao, Y.S., Synthesis and biological activity of various 3⬘-azido analogs of 5-substituted pyrimidine deoxyribonucleotides, J. Med. Chem., 26, 1691, 1983. 21. Rosenbohm, C., Pedersen, D.S., Frieden, M. et al., LNA guanine and 2,6-diaminopurine. Synthesis, characterization and hybridization properties of LNA 2,6 diaminopurine containing oligonucleotides, Biorg. Med. Chem., 12, 2385, 2004. 22. Rosenbohm, C., Christensen, S., Sorensen, M.D. et al., Synthesis of 2⬘-amino-LNA: a new strategy, Org. Biomol. Chem., 1, 655, 2003. 23. Christensen, S.M., Rosenbohm, C., Sorensen, M. et al., Improved synthesis of 2⬘-amino-LNA, Nucleosides Nucleotides Nucl. Acids, 22, 1131, 2003. 24. Ravn, J., Rosenbohm, C., Christensen, S.M. et al., Synthesis of 2⬘-amino-LNA purine nucleosides, Nucleosides Nucleotides Nucl. Acids, 25, 843, 2006. 25. Sorensen, M.D., Petersen, M., and Wengel, J., Functionalized LNA (locked nucleic acid): high-affinity hybridization of oligonucleotides containing N-acylated and N-alkylated 2⬘-amino-LNA monomers, Chem. Commun. (Camb.), 2130, 2003. 26. Babu, B.R., Hrdlicka, P.J., McKenzie, C.J. et al., Optimized DNA targeting using N,N-bis(2-pyridylmethyl)--alanyl 2⬘-amino-LNA 1, Chem. Commun. (Camb.), 1705, 2005. 27. Hrdlicka, P.J., Babu, B.R., Sorensen, M.D. et al., Interstrand communication between 2⬘-N-(pyren-1-yl) methyl-2⬘-amino-LNA monomers in nucleic acid duplexes: directional control and signalling of full complementarity, Chem. Commun. (Camb.), 1478, 2004. 28. Hralicka, P.A., Babu, B.R., Sørensen, M.D. et al., Multilabeled pyrene-functionalized 2⬘-amino-LNA probes for nucleic acid detection in homogenous flourescence assay, J. Am. Chem. Soc., 127, 13293, 2005. 29. Hrdlicka, P.J., Kumar, T.S., and Wengel, J., Targeting of mixed sequence double-stranded DNA using pyrene-functionalized 2⬘-amino-alpha-L-LNA, Chem. Commun. (Camb.), 4279, 2005. 30. Kumar, R., Singh, S.K., Koshkin, A.A. et al., The first analogues of LNA (locked nucleic acids): phosphorothioate-LNA and 2⬘-thio-LNA, Bioorg. Med. Chem. Lett., 8, 2219, 1998. 31. Pedersen, D.S. and Koch, T., Analogues of LNA (locked nucleic acid): synthesis of the 2⬘-thio-LNA ribothymidine and 5-methylcytidine phosphoramidites, Synthesis, 4, 578, 2004. 32. Rajwanshi, V.K., Kumar, R., Kofod-Hansen, M. et al., Synthesis and restricted furanose conformations of three novel bicyclic thymine nucleosides: a xylo-LNA nucleoside, a 3⬘-0,5⬘-C-methylene-linked nucleoside, and a 2⬘-0,5⬘-C-methylene-linked nucleoside, J. Chem. Soc., Perkin Trans. 1, 1407, 1999. 33. Rajwanshi, V.K., Haakansson, A.E., Dahl, B.M. et al., LNA stereoisomers: xylo-LNA (-D-xylo configures locked nucleic acid) and -L-LNA (-L-ribo configures locked nucleic acid), Chem. Commun., 1395, 1999. 34. Rajwanshi, V.K., Håkansson, A.E.S.M.D., Pitsch, S. et al., The eight stereoisomers of LNA (locked nucleic acid): a remarkable family of strong RNA binding molecules, Angew. Chem. Int. Ed., 39, 1656, 2000. 35. Rajwanshi, V.K., Haakansson, A.E., Kumar, R. et al., High-affinity nucleic acid recognition using “LNA” (locked nucleic acid, beta-D-ribo configures LNA), “xylo-LNA” (beta-D-xylo configures LNA) or “alfa-L-LNA” (alfa-L-ribo configured LNA), Chem. Commun., 2073, 1999. 36. Håkansson, A.E., Koshkin, A.A., Sørensen, M.D. et al., Convenient syntheses of 7-hydroxy-1(hydroxymethyl)-3-(thymin-1-yl)-2,5-dioxabicyclo[2.2.1]heptanes: -L-ribo- and -L-xylo configured LNA nucleosides, J. Org. Chem., 65, 5161, 2000. 37. Hakansson, A.E. and Wengel, J., The adenine derivative of alpha-L-LNA (alpha-L-ribo configured locked nucleic acid): synthesis and high-affinity hybridization toward DNA, RNA, LNA and alphaL-LNA complementary sequences, Bioorg. Med. Chem. Lett., 11, 935, 2001. 38. Kumar, T.S., Madsen, A.S., Wengel, J. et al., Synthesis and hybridization studies of 2⬘-amino--L-LNA and tetracyclic “Locked LNA”, J. Org. Chem., 71, 4188, 2006.

CRC_8796_ch019.qxd

560

5/25/2007

22:16

Page 560


39. Nielsen, P. and Wengel, J., A new synthetic approach towards alfa and beta-LNA (locked nucleic acids), Nucleosides Nucleotides Nucl. Acids, 18, 701, 1999. 40. Christensen, N.K., Dalskov, J.K., and Nielsen, P., Synthesis and evaluation of alpha-LNA, Nucleosides Nucleotides Nucl. Acids, 20, 825, 2001. 41. Christensen, N.K., Dahl, B.M., and Nielsen, P., Incorporation of alfa- and beta-LNA (locked nucleic acid) monomers in oligodeoxynucleotides with polarity reversals, Bioorg. Med. Chem. Lett., 11, 1765, 2001. 42. Nielsen, P. and Dalskov, J.K., Alpha-LNA, locked nucleic acid with alpha-D-configuration, Chem. Commun., 1179, 2000. 43. Christensen, N.K., Petersen, M., Vester, B. et al., Alpha-LNA (alpha-D-configured locked nucleic acid), Nucleosides Nucleotides Nucl. Acids, 22, 1143, 2003. 44. Babu, B.R. and Wengel, J., Universal hybridization using LNA (locked nucleic acid) containing a novel pyrene LNA nucleotide monomer, Chem. Commun., 2114, 2001. 45. Raunak, R.B.B., Sorensen, M.D. et al., Oligodeoxynucleotides containing alpha-L-ribo configured LNA-type C-aryl nucleotides, Org. Biomol. Chem., 2, 80, 2004. 46. Hari, Y., Obika, S., and Sasaki M., Effective synthesis of C-nucleosides with 2⬘-4⬘-BNA modification, Tetrahedron, 58, 3051, 2002. 47. Babu, B.R. and Wengel, J., Aryl-beta-C-LNA monomers as universal hybridization probes, Nucleosides Nucleotides Nucl. Acids, 22, 1317, 2003. 48. Babu, B.R., Prasad, A.K., Trikha, S. et al., Conformationally locked aryl C-nucleosides: synthesis of phosphoramidite monomers and incorporation into single-stranded DNA and LNA (locked nucleic acid), J. Chem. Soc. Perkin Trans. 1, 2509, 2002. 49. Obika, S., Hari, Y., Morio, K.-I. et al., Synthesis of conformationally locked C-nucleosides having a 2,5-dioxabicyclo (2.2.1) heptane ring system, Tetrahedron Lett., 41, 215, 2000. 50. Hari, Y., Obika, S., Inohara, H. et al., Synthesis and triplex-forming ability of 2⬘,4⬘-BNAs bearing imidazoles as a nucleobase 1, Chem. Pharm. Bull (Tokyo), 53, 843, 2005. 51. Koshkin, A., Conformationally restricted triplex-forming oligonucleotides (TFOs). Binding properties of alpha-L-LNA and introduction of the N7-glycosylated LNA-guanosine, 5962, 2006. 52. Brameld, K.A. and Goddard, W.A., Ab Initio quantum mechanical study of the structures and energies for the pseudorotation of 5⬘-dehydroxy analogues of 2⬘-deoxyribose and ribose sugars, J. Am. Chem. Soc., 121, 985, 1999. 53. Obika, S., Nanbu, D., Hari, Y. et al., Synthesis of 2⬘-0,4⬘-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C3-endo sugar puckering, Tetrahedron Lett., 38, 8735, 1997. 54. Egli, M., Minasov, G., Teplova, M. et al., X-ray crystal structure of a locked nucleic acid (LNA) duplex composed of a palindromic 10-mer DNA strand containing one LNA thymine monomer, Chem. Commun., 651, 2001. 55. Obika, S., Nanbu, D., Hari, Y. et al., Stability and structural features of the deplexes containing nucleoside analogues with a fixed N-type conformation, 2⬘-O,4⬘-C-methyleneribonucleosides, Tetrahedron Lett., 39, 5401, 1998. 56. Nielsen, K.E., Singh, S.K., Wengel, J. et al., Solution structure of an LNA hybridized to DNA: NMR study of the d(CT(L)GCT(L)T(L)CT(L)GC):d(GCAGAAGCAG) duplex containing four locked nucleotides, Bioconjug. Chem., 11, 228, 2000. 57. Nielsen, K.E., Rasmussen, J., Kumar, R. et al., NMR studies of fully modified locked nucleic acid (LNA) hybrids: solution structure of an LNA:RNA hybrid and characterization of an LNA:DNA hybrid, Bioconjug. Chem., 15, 449, 2004. 58. Petersen, M., Nielsen, C.B., Nielsen, K.E. et al., The conformations of locked nucleic acids (LNA), J. Mol. Recognit., 13, 44, 2000. 59. Petersen, M., Bondensgaard, K., Wengel, J. et al., Locked nucleic acid (LNA) recognition of RNA: NMR solution structures of LNA:RNA hybrids, J. Am. Chem. Soc., 124, 5974, 2002. 60. Koshkin, A., Nielsen, P., Meldgaard, M. et al., LNA (locked nucleic acid): an RNA mimic forming exceedingly stable LNA: LNA duplexes, J. Am. Chem. Soc., 120, 13252, 1998. 61. Martin, P., Ein neuer Zugang zu 2⬘-O-Alkylribonucleosiden und Eigenschaften deren Oligonucleotiden, Helv. Chim. Acta, 78, 486, 1995. 62. Nielsen, K.E., The structure of a mixed LNA Ⲑ DNA:RNA duplex is driven by conformational coupling between LNA and deoxyribose residues as determined from (13)C relaxation measurements, J. Am. Chem. Soc., 127, 15273, 2005.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 561

561

63. Jensen, G.A., Singh, S.K., Kumar, R. et al., A comparison of the solution structures of an LNA:DNA duplex and the unmodified DNA:DNA duplex, J. Chem. Soc., Perkin Trans. 2, 1224, 2001. 64. Nielsen, C.B., Singh, S.K., Wengel, J. et al., The solution structure of a locked nucleic acid (LNA) hybridized to DNA, J. Biomol. Struct. Dyn., 17, 175, 1999. 65. Nielsen, J.T., Stein, P.C., and Petersen, M., NMR structure of an alpha-L-LNA:RNA hybrid: structural implications for RNase H recognition, Nucl. Acids Res., 31, 5858, 2003. 66. Nielsen, K.M.E., Petersen, M., Håkansson, A.E. et al., Alpha-LNA (alpha-L-ribo configures locked nucleic acid) recognition of DNA: an NMR spectroscopic study, Chem. Eur. J., 8, 3001, 2002. 67. Petersen, M., Hakansson, A.E., Wengel, J. et al., Alpha-L-LNA (alpha-L-ribo configured locked nucleic acid) recognition of RNA. A study by NMR spectroscopy and molecular dynamics simulations, J. Am. Chem. Soc., 123, 7431, 2001 68. Petersen, M., Nielsen, J.T., Bondensgaard, K. et al., Structural characterization of LNA and alpha-LLNA hybridized to RNA, Nucleosides Nucleotides Nucl. Acids, 22, 1691, 2003. 69. Beaueage, S.L. and Iver, R.P., Advances in the synthesis of oligonucleotides by the phosphoramidite approach, Tetrahedron Lett., 48, 2223, 2001. 70. Beaucage, S.L., Bergstrom, D.E., Glick, D.G., and Jones, R.A., Current Protocols in Nucleic Acid Chemistry, John Wiley, New York, 2004, Chaps. 1–4. 71. Brown, T. and Brown, D.J.S., Modern machine-aided methods of oligodeoxiribonucleotide synthesis; ligonucleotides and analogues a practical approach, Eckstein, F., Ed., Oxford University Press, 1991, Chap. 1. 72. Hansen, H.F., Olsen, O., and Koch, T., New standards in LNA synthesis, Nucleosides Nucleotides Nucl. Acids, 22, 1273, 2003. 73. Wengel, J., Petersen, M., Frieden, M. et al., Chemistry of locked nucleic acids (LNA): design, synthesis, and bio-physical properties, Lett. in Peptide Sci., 10, 237, 2003. 74. Pfundheller, H.M., Lomholdt, C., Johansen, A. et al., LNA synthesis; Methods in Molecular Biology; Herdewijn, Ed., Humana Press, New York, 2005, Chap. 8. 75. Soerensen, M.D., Kvaerno, L., Bryld, T. et al., Alpha-L-ribo-configures locked nucleic acid (alpha-LLNA): synthesis and properties., J. Am. Chem. Soc., 124, 2164, 2002. 76. Karwowski, B., Okruszek, A., Wengel, J. et al., Stereocontrolled synthesis of LNA dinucleoside phosphorothioate by the oxathiaphospholane approach, Bioorg. Med. Chem. Lett., 11, 1001, 2001. 77. Lauritsen, A., Dahl, B.M., Dahl, O. et al., Methylphosphonate LNA: a locked nucleic acid with a methylphosphonate linkage, Bioorg. Med. Chem. Lett., 13, 253, 2003. 78. Obika, S., Onoda, M., Morita, K. et al., 3⬘-Amino-2⬘,4⬘-BNA: novel bridged nucleic acids having an N3⬘-P5⬘ phosphoramidate linkage, Chem. Commun. (Camb.), 19, 1992, 2001. 79. Obika, S., Nakagawa, O., Hiroto, A. et al., Synthesis and properties of a novel bridged nucleic acid with a P3⬘ → N5⬘ phosphoramidate linkage, 5⬘-amino-2⬘,4⬘-BNA, Chem. Commun. (Camb.), 17, 2202, 2003. 80. Lauritsen, A. and Wengel, J., Oligodeoxynucleotides containing amide-linked LNA-type dinucleotides: synthesis and high-affinity nucleic acid hybridization, Chem. Commun., 5, 530, 2002. 81. Wengel, J., Petersen, M., Nielsen, K.E. et al., LNA (locked nucleic acid) and the diastereoisomeric alpha-L-LNA: conformational tuning and high-affinity recognition of DNA/RNA targets, Nucleosides Nucleotides Nucl. Acids, 20, 389, 2001. 82. McTigue, P.M., Peterson, R.J., and Kahn, J.D., Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation, Biochemistry, 43, 5388, 2004. 83. Martin, P., Ein neuer Zugang zu 2⬘-O-Alkylribonucleosiden und Eigenchaften deren Oligonucleotide, Helv. Chim, Acta, 78, 486, 1995. 84. Kierzek, E., The influence of locked nucleic acid residues on the thermodynamic properties of 2⬘-Omethyl RNAⲐRNA heteroduplexes, Nucl. Acids Res., 33(16), 5082, 2005. 85. Davis, S., Lollo, B., Freier, S. et al., Improved targeting of miRNA with antisense oligonucleotides, Nucl. Acids Res., 34, 2294, 2006. 86. Latorra, D., Campbell, K., Wolter, A. et al., Enhanced allele-specific PCR discrimination in SNP genotyping using 3⬘ locked nucleic acid (LNA) primers, Hum. Mutat., 22, 79, 2003. 87. Valoczi, A., Hornyik, C., Varga, N. et al., Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes 1, Nucl. Acids Res., 32, e175, 2004. 88. Kloosterman, W.P., Wienholds, E., de Bruijn, E. et al., In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes, Nat. Methods, 3, 27, 2006.

CRC_8796_ch019.qxd

562

5/25/2007

22:16

Page 562


89. Oerum, U.A., Kauppinen, S., and Lund, A.H., LNA-modified oligonucleotides mediate specific inhibition of microRNA function, Gene, 372, 137, 2006. 90. Jacobsen, N., Bentzen, J., Meldgaard, M. et al., LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E, Nucl. Acids Res., 30, e100, 2002. 91. Oerum, H., Jacobsen, M.H., Koch, T. et al., Detection of the factor V Leiden mutation by direct allelespecific hybridization of PCR amplicons to photo-immobilized locked nucleic acids., Clin. Chem., 45, 1898, 1999. 92. Frieden, M., Christensen, S.M., Mikkelsen, N.D. et al., Expanding the design horizon of antisense oligonucleotides with alpha-L-LNA, Nucl. Acids Res., 31, 6365, 2003. 93. Fluiter, K., Frieden, M., Vreijling, J. et al., On the in vitro and in vivo properties of four locked nucleic acid nucleotides incorporated into an anti-H-ras antisense oligonucleotide, Chembiochem, 6, 1, 2005. 94. Hrdlicka, P.J., Targeting of mixed sequence double-stranded DNA using pyrene-functionalized 2⬘-amino-alpha-L-LNA, 2005. 95. Babu, B.R., Novel nucleic acid architectures involving locked nucleic acied (LNA) and pyrene residues: Results from an Indo-Danish collaboration, Pure Appl. Chem., 77(1), 319, 2005. 96. Christensen, U., Jacobsen, N., Rajwanshi, V.K. et al., Stopped-flow kinetics of locked nucleic acid (LNA)-oligonucleotide duplex formation: studies of LNA-DNA and DNA–DNA interactions, Biochem. J., 354, 481, 2001. 97. Kvaerno, L. and Wengel, J., Investigation of restricted backbone conformations as an explanation for the exceptional thermal stabilities of duplexes involving LNA (locked nucleic acid): ⫹ synthesis and evaluation of abasic LNA, Chem. Commun., 657, 1999 98. Kvaerno, L., Kumar, R., Dahl, B.M. et al., Synthesis of abasic locked nucleic acid and two seco-LNA derivatives and evaluation of their hybridization properties compared with their more flexible DNA counterparts, J. Org. Chem., 65, 5167, 2000. 99. Kaur, H., Arora, A., Wengel, J. et al., Thermodynamic, counterion, and hydration effects for the incorporation of locked nucleic acid nucleotides into DNA duplexes, Biochemistry, 45, 7347, 2006. 100. Arzumanov, A., Walsh, A.P., Liu, X. et al., Oligonucleotide analogue interference with the HIV-1 Tat protein-TAR RNA interaction, Nucleosides Nucleotides Nucl. Acids, 20, 471, 2001 101. Obika, S., Uneda, T., Sugimoto, T. et al., 2⬘-O,4⬘-C-Methylene bridged nucleic acid (2⬘,4⬘-BNA): synthesis and triplex-forming properties, Bioorg. Med. Chem., 9, 1001, 2001. 102. Sun, B.W., Babu, B.R., Sorensen, M.D. et al., Sequence and pH effects of LNA-containing triple helix-forming oligonucleotides: physical chemistry, biochemistry, and modeling studies, Biochemistry, 43, 4160, 2004. 103. Torigoe, H., Hari, Y., Obika, S. et al., Triplex formation involving 2⬘-O,4⬘-C-methylene bridged nucleic acid (2⬘,4⬘-BNA) with 2-pyridone base analogue: efficient and selective recognition of C:G interruption, Nucleosides Nucleotides Nucl. Acids, 22, 1097, 2003. 104. Obika, S., Hari, Y., Sekiguchi, M. et al., A 2⬘,4⬘-bridged nucleic acid containing 2-pyridone as a nucleobase: efficient recognition of a C-G interruption by triplex formation with a pyrimidine motif, Angew. Chem. Int., 40, 2079, 2001. 105. Brunet, E., Corgnali, M., Perrouault, L. et al., Intercalator conjugates of pyrimidine locked nucleic acid-modified triplex-forming oligonucleotides: improving DNA binding properties and reaching cellular activities 2, Nucl. Acids Res., 33, 4223, 2005. 106. Sorensen, J.J., Nielsen, J.T., and Petersen, M., Solution structure of a dsDNA:LNA triplex 1, Nucl. Acids Res., 32, 6078, 2004. 107. Kumar, N., Triplex formation with alpha-L-LNA (alpha-L-ribo-configured locked nucleic acid), J. Am. Chem. Soc., 128, 14, 2006. 108. Brunet, E., Alberti, P., Perrouault, L. et al., Exploring cellular activity of locked nucleic acid-modified triplex-forming oligonucleotides and defining its molecular basis 2, J. Biol. Chem., 280, 20076, 2005. 109. Obika, S., Development of bridged nucleic acid analogues for antigene technology 2, Chem. Pharm. Bull. (Tokyo), 52, 1399, 2004. 110. Frieden, M., Hansen, H.F., and Koch, T., Nuclease stability of LNA oligonucleotides and LNA-DNA chimeras, Nucleosides Nucleotides Nucl. Acids, 22, 1041, 2003. 111. Wahlestedt, C., Salmi, P., Good, L. et al., Potent and nontoxic antisense oligonucleotides containing locked nucleic acids, Proc. Natl. Acad. Sci. USA, 97, 5633, 2000. 112. Morita K., Hasegawa, C., Kaneko, M. et al., 2⬘-0,4⬘-C-Ethylene-bridged nucleic acids (ENA): highly nuclease-resistant and thermodynamically stable oligonucleotides, Bioorg. Med. Chem. Lett., 12, 73, 2001.

CRC_8796_ch019.qxd

5/25/2007

22:16

LOCKED NUCLEIC ACID

Page 563

563

113. Obika, S., Hemamayi, R., Masuda, T. et al., Inhibition of ICAM-I gene expression b antisense 2⬘,4⬘-BNA oligonucleotides, Nucl. Acids Res., 1(1), 145, 2001. 114. Di Giusto, D. and King G.C., Strong positional preference in the interaction of LNA oligonucleotides with DNA polymerase and proofreading exonuclease activities: implications for genotyping assays, Nucl. Acid Res., 32, e32, 2004. 115. Kurreck, J., Wyszko, E., Gillen, C. et al., Design of antisense oligonucleotides stabilized by locked nucleic acids, Nucl. Acids Res., 30, 1911, 2002. 116. Crinelli, R., Bianchi, M., Gentilini, L. et al., Design and characterization of decoy oligonucleotides containing locked nucleic acids, Nucl. Acids Res., 30(11), 2435, 2002. 117. Braasch, D.A., Jensen, S., Liu, Y. et al., RNA interference in mammalian cells by chemically-modified RNA, Biochemistry, 42, 7967, 2003. 118. Elmen, J., Thonberg, H., Ljungberg, K. et al., Locked nucleic acid (LNA) mediated improvements in siRNA stability and functionality 1, Nucl. Acids Res., 33, 439, 2005. 119. Jepsen, J.S., Pfundheller, H.M., and Lykkesfeldt, A.E., Downregulation of p21(WAF1/CIP1) and estrogen receptor alpha in MCF-7 cells by antisense oligonucleotides containing locked nucleic acid (LNA), Oligonucleotides, 14, 147, 2004. 120. Braasch, D.A. and Corey, D.R., Novel antisense and peptide nucleic acid strategies for controlling gene expression, Biochemistry, 41, 4503, 2002. 121. Braasch, D.A., Liu, Y., and Corey, D.R., Antisense inhibition of gene expression in cells by oligonucleotides incorporating locked nucleic acids: effect of mRNA target sequence and chimera design, Nucl. Acids Res., 30, 5160, 2002. 122. Grunweller, A., Wyszko, E., Bieber, B. et al., Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2⬘-O-methyl RNA, phosphorothioates and small interfering RNA, Nucl. Acids Res., 31, 3185, 2003. 123. Hansen, J.B., Westergaard, M., Thrue, C.A. et al., Antisense knockdown of PKC-alpha using LNA-oligos, Nucleosides Nucleotides Nucl. Acids, 22, 1607, 2003. 124. Lennox, K.A., Sabel, J.L., Johnson, M.J. et al., Characterization of modified antisense oligonucleotides in Xenopus laevis embryos, Oligonucleotides, 16, 26, 2006. 125. Rekasi, Z., Horvath, R.A., Klausz, B. et al., Suppression of serotonin N-acetyltransferase transcription and melatonin secretion from chicken pinealocytes transfected with Bmal1 antisense oligonucleotides containing locked nucleic acid in superfusion system, Mol. Cell Endocrinol., 249, 84, 2006. 126. Simoes-Wust, A.P., Hopkins-Donaldson, S., Sigrist, B. et al., A functionally improved locked nucleic acid antisense oligonucleotide inhibits Bcl-2 and Bcl-xL expression and facilitates tumor cell apoptosis 1, Oligonucleotides, 14, 199, 2004. 127. Elmen, J., Zhang, H.Y., Zuber, B. et al., Locked nucleic acid containing antisense oligonucleotides enhance inhibition of HIV-1 genome dimerization and inhibit virus replication, FEBS Lett., 578, 285, 2004. 128. Elayadi, A.N., Braasch, D.A., and Corey, D.R., Implications of high-affinity hybridization by locked nucleic acid oligomers for inhibition of human telomerase, Biochemistry, 41, 9973, 2002. 129. Arzumanov, A., Walsh, A.P., Rajwanshi, V.K. et al., Inhibition of HIV-1 Tat-dependent trans activation by steric block chimeric 2⬘-O-methylⲐLNA oligoribonucleotides, Biochemistry, 40, 14645, 2001. 130. Arzumanov, A., Stetsenko, D.A., Malakhov, A.D. et al., A structure activity study of the inhibition of HIV-1 Tat-dependent trans-activation by mixmer 2⬘-O-methyl oligoribonucleotides containing locked nucleic acid (LNA), a-L-LNA, or 2⬘-thio-LNA residues, Oligonucleotides, 13, 435, 2003. 131. Nulf, C.J. and Corey, D., Intracellular inhibition of hepatitis C virus (HCV) internal ribosomal entry site (IRES)-dependent translation by peptide nucleic acids (PNAs) and locked nucleic acids (LNAs) 1, Nucl. Acids Res., 32, 3792, 2004. 132. Aartsma-Rus, A., Kaman, W.E., Bremmer-Bout, M. et al., Comparative analysis of antisense oligonucleotide analogs for targeted DMD exon 46 skipping in muscle cells, Gene Ther., 11, 1391–1398, 2004. 133. Oerum, H., RNA antagonists—a new class of antisense drugs, IEEE Engineering in Medicine and Biology magazine, 24, 81, 2005. 134. Weiler, J., Hunziker, J., and Hall, J., Anti-miRNA oligonucleotides (AMOs): ammunition to target miRNAs implicated in human disease? Gene Ther., 13, 496, 2006. 135. Naguibneva, I., Ameyar-Zazoua, M., Nonne, N. et al., An LNA-based loss-of-function assay for micro-RNAs, Biomed. Pharmacother., 9, 633, 2006.

CRC_8796_ch019.qxd

564

5/25/2007

22:16

Page 564


136. Naguibneva, I., Ameyar-Zazoua, M., Polesskaya, A. et al., The microRNA miR-181 targets the homeobox protein Hox-A11 during mammalian myoblast differentiation, Nat. Cell Biol., 8, 278, 2006. 137. Orom, U.A., Kauppinen, S., and Lund, A.H., LNA-modified oligonucleotides mediate specific inhibition of microRNA function, Gene, 372, 137, 2006. 138. Lecellier, C.H., Dunoyer, P., Arar, K. et al., A cellular microRNA mediates antiviral defense in human cells, Science, 308, 557, 2005. 139. Geary, R.S., Yu, R.Z., Leeds, J.M. et al., Pharmacokinetic properties in animals; in Antisense Drug Technology, Crooke, S.T. Ed., Marcel Dekker, New York, p. 119; 2001. 140. Fluiter, K., Ten Asbroek, A.L., De Wissel, M.B. et al., In vivo tumor growth inhibition and biodistribution studies of locked nucleic acid (LNA) antisense oligonucleotides, Nucl. Acids Res., 31, 953, 2003. 141. Zhang, H.Y., He, J., Liu, G. et al., Initial observations of 99m Tc labelled locked nucleic acids for antisense targeting, Nucl. Med. Commun., 25(11), 1113, 2004. 142. Levin, A.A., Henry, S.P., Monteith, D. et al., Toxicity of antisense oligonucleotides, in Antisense Drug Technology, Crooke, S.T., ed., Marcel Dekker, New York, 201, 2001. 143. Iversen, P.L., Cornish K.G., Iversen, L.J. et al., Bolus intravenous injection of phosphorothioate oligonucleotides causes hypotension by acting as alpha1-adrenergic receptor antagonists, Toxicol. Appl. Pharmacol., 160, 289, 1999. 144. Geary, R.S., Watanabe, T.A., Truong, L. et al., Pharmacokinetic properties of 2⬘-O-(2-methoxyethyl) modified oligonucleotides in rats, J. Pharmacol. Exp. Ther., 296, 890, 2001. 145. Vollmer, J., Jepsen, J.S., Uhlmann, E. et al., Modulation of CpG oligodeoxynucleotide-mediated immune stimulation by locked nucleic acid (LNA) 9, Oligonucleotides, 14, 23, 2004. 146. Roberts, J., Palma, E., Sazani, P. et al., Efficient and persistent splice switching by systemically delivered LNA oligonucleotides in mice, Mol. Ther., 14(4), 471, 2006. 147. Frieden, M. and Oerum, H., The application of locked nucleic acid in the treatment of cancer, Drugs, 9(10), 706, 2006. 148. Soutschek, A., Aakinc, A., and Bramlage, K.C.R., Therapeutic silincing of an endogenous gene by systemic administration of modified siRNA, Nature, 432, 173, 2004. 149. Kauppinen, S., Elmen, J., and Kearney, P., Novel antisense drugs for micro-RNA therapeutics, Eur. Pharm. Rev., 4, 20, 2006. 150. Shangary, S. and Johnson, D.E., Recent advances in the development of anticancer agents targeting cell death inhibitors in the Bcl-2 family, Leukemia, 17, 1470, 2003. 151. Lee, J.-W., Bae, S.-H.J.J.-W., Kim, S.-H. et al., Hypoxia-inducible factor (HIF-1)alpha: its protein stability and biological function, Exp. Mol. Med., 36, 1, 2004. 152. Höpfl, G., Ogunshola, O., and Gassmann, M., HIF’a and tumors—causes and consequences, Am. J. Regul. Intgr. Comp. Physiol., 286, R608, 2004. 153. O’Driscoll, L., Lineham, R., and Clynes, M., Survivin: role in normal cells and in pathological conditions, Curr. Cancer Drug Targets, 3, 131, 2003.

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 565

CHAPTER

20

Morpholinos Patrick L. Iversen

CONTENTS 20.1 20.2 20.3 20.4

Introduction .........................................................................................................................565 Safety Profile.......................................................................................................................567 Pharmacokinetic Profile ......................................................................................................569 Antiviral ..............................................................................................................................570 20.4.1 Exploration............................................................................................................570 20.4.2 Rapid Response to Emerging Infectious Disease .................................................571 20.4.3 Clinical Trials........................................................................................................571 20.5 Antibacterial........................................................................................................................572 20.6 Cardiovascular.....................................................................................................................572 20.7 Cancer .................................................................................................................................574 20.8 Metabolic Redirection.........................................................................................................575 20.9 Altered RNA Splicing for Duchenne Muscular Dystrophy (DMD)...................................576 20.10 Formulations .......................................................................................................................577 20.11 Summary .............................................................................................................................577 Acknowledgments ..........................................................................................................................577 References ......................................................................................................................................578

20.1 INTRODUCTION The phosphorodiamindate morpholino oligomers (PMO) are comprised of (dimethylamino) phosphinylideneoxy–linked morpholino backbone moieties (Figure 20.1). These morpholino moieties contain a heterocyclic base recognition moiety of DNA (A,C,G,T) attached to a substituted morpholine ring system. When linked to each other via the (dimethylamino) phosphinylideneoxy function, the functional group formed by the intersubunit linkage is commonly referred to as a phosphorodiamidate. Some improved profiles of PMOs include: (1) PMOs mechanism of action does not utilize oligomer as a cofactor for enzymatic cleavage of RNA [1,2]; (2) PMOs do not form G-quartet structures capable of off-target gene regulation [3,4]; (3) PMOs do not interact with traditional drugs such as acetaminophen (Tylenol) [5]; (4) PMOs do not cause severe and occasionally lethal hypotension in primates following bolus intravenous injections [6,7]; (5) PMOs do not chelate

565

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 566

566


5′ O

O

HO

O

O N

N NMe2 P O

O

Base1-21

O

N

21

Me2N

P

O O

Base22

O

3′

N H

NH2 N

N

A= N

N

N

C= N

O

NH2

N

NH

G= O

O Me

NH

T= N

N

NH2

N

O

Position is stereochemically homogeneous, with same configuration as D-ribose. Position is not stereochemically homogeneous. Figure 20.1 Chemical structure of phosphorodiamidate morpholino oligomers.

metal ions including zinc, which may interfere with apoptotic mechanisms [8]; (6) PMOs do not alter blood coagulation times [9–12]; and (7) PMOs do not bind to cellular and extracellular proteins [13–15]. A critical advantageous character is that PMO oligomers are highly resistant to degradation [16]. PMOs have been evaluated in animal models and many publications have already documented PMO efficacy for a number of diseases. They include c-myc PMO (AVI-4126) to ameliorate murine infantile polycystic kidney disease [17], CYP3A2 PMO (AVI-4457) to modulate cytochrome P-450 activity in the rat [18], and AVI-4126 to prevent myointimal hyperplasia in a rabbit balloon injury model [19], and in pig model [20]. Further, we have observed efficacy in animal models following a variety of routes of administration including intravenous administration in a prostate model [21], topical application for cytochrome P450 3A2 rat model [22], inhalation for inhibition of TNF [23], and oral application for inhibiting cytochrome P450 3A2 in rats [24].

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 567

MORPHOLINOS

567

20.2 SAFETY PROFILE In brief, there have been no observed clinical, laboratory, or histological abnormalities or toxicity in mice, rats, and nonhuman primates that have received sufficient PMO to cause a desired biological effect and at doses that are assumed to exceed 5–10 times the desired effect (Table 20.1). Toxicology studies have involved up to 150 mg/kg single intravenous doses and 28 daily doses of 140 mg/kg administered subcutaneously. The observation that has established the no effect level has been the appearance of basophilic granules within the cytoplasm of renal tubular epithelial cells, lymph node macrophages, and hepatic Kupfer cells, which was dose-dependent and reversible after discontinuation of administration. PMOs are devoid of teratogenic potential in the zebrafish embryogenesis model. Exposure of zebrafish embryos at early blastula stage to increasing concentrations of AVI-4126 did not cause any developmental abnormality. Long-term survivability of antisense-treated embryos was also not affected [25]. Further, the study was validated when zebrafish embryos were incubated with the PMO targeted to ntl gene, a distinct phenotype similar to ntl null mutation was observed in 3 of 100 embryos [25]. The direct injection of embryos with PMOs is very popular among investigators in the zebrafish developmental biology community. A review of 203 peer-reviewed publications revealed that the teratogenesis rate is 0.3% for PMO. This represents over 500 different PMO sequences in over 47,000 embryos [26]. Finally, no mutational events were observed in the battery of mutagenicity studies that have been conducted for three different PMOs to satisfy FDA preclinical recommendations. Four PMO compounds have been employed in 15 clinical trials, inclusive of Phase 1 and Phase 2 studies (see Table 20.2). A total of approximately 350 individuals have received the PMOs by oral, subcutaneous, or intravenous administration. There have been no observed serious drug-related adverse events. In addition, there is no evidence of any adverse clinically significant trends among Table 20.1 Toxicology and Safety Pharmacology GLP Studies with PMOs Target AVI-4126 c-myc

AVI-4020 WNV

AVI-4065 HCV

a b

Type

Species

N

Dose mg/kg

Route

Frequency

Study

NHP

Cyno

4 Tx 2 cont

Rat

S-D

20/dose 80 total 6/dose 30 total

0, 0.3, 3.0, 30 5, 15, 50, 100, 150

IV

Daily ⫻ 14

Tox

IV

Single

Tox

6/dose 12 total 6/dose 24 total

0, 15

IP

Daily ⫻ 28

Tox

0, 1.5, 7.5, 30

IV

Q 12H ⫻ 15

Tox

0, 4, 12, 40

SCb

Single

Safety

Single 4-way crossover ⫹ 5-day recovery Daily ⫻ 28 ⫹ 14-day recovery Daily ⫻ 28 ⫹ 14-day recovery

Safety

Rat

S-D

NHP

Cyno

Rat

S-D

0, 10

IVa

Single

Tox

Safe, well tolerated Safe, well tolerated Safe, well tolerated

6/dose 24 total 8/dose 32 total 6/dose 24 total

0, 4, 12, 40

SC

0, 4, 12, 40

SC

NHP

Cyno

Rat

S-D

12/group 72 total

0, 14, 70,140

SC

NHP

Cyno

6/group 4/group recovery 32 total

0, 4, 12, 40

SC

Intravenous. Subcutaneous.

Conclusions

Safety

Safe, well tolerated Safe, well tolerated NOAEL ⫽ 40 mg/kg NOAEL ⫽ 40 mg/kg NOAEL ⫽ 40 mg/kg

Tox

NOAEL ⫽ 70 mg/kg

Tox

NOAEL ⫽ 40 mg/kg

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 568

568


Table 20.2 Survey of PMO Clinical Studies and Safety Total Related Drug

Study Description

AVI-4126 Safety and PK of a single, IV dose of AVI-4126 in healthy adults Safety and PK of oral AVI-4126 administration in healthy adults Safety and PK of single, IV dose of AVI-4126 in patients with polycystic kidney disease (PKD) Exploratory safety and PK of single, IV dose of AVI-4126 in patients with breast and prostate cancer Intramural delivery of AVI-4126 to the coronary artery Safety and efficacy of RESTEN-MP™ to prevent restenosis Safety and efficacy of RESTEN-MP™ to prevent restenosis AVI-4020

1-, 3-, 10-, 30-, 90-mg single oral dose

29 healthy adults

10-, 30-, 90-mg single IV injection

17 adult PKD patients

90-mg single IV injection

2 adult cancer patients

0, 3, 10 mg via intramural injection via the Infiltrator® catheter during angiography 8 mg RESTEN-MP (AVI-4126 ⫹PESDA) via IV injection at time of stent placement 16 mg RESTEN-MP via IV injection at time of stent placement and 24 hours thereafter

46 adult patients (30-AVI-4126; 16 placebo)

Compassionate use of AVI-4020 in patient with sever neuroinvasive disease

30 mg every 12 h for 5 days via IV injection

Safety study of AVI-4065 in healthy adults Exploratory study of AVI-4065 in patients with active HCV infection. Patients refractory to INF and ribavarin and treatment naïve patients

a

30 healthy adults

15 mg every 12 h for 5 days via IV injection

Safety, PK/PD and efficacy of AVI-4557 (based on impact on midazolam metabolism) Safety, PK/PD and efficacy of AVI-4557 (based on impact on midazolam metabolism) Safety, PD/PK and efficacy of AVI-4557 administered orally (based on impact on midazolam metabolism)

Ongoing study.

Subjects

1-, 3-, 10-, 30-, and 90-mg single IV injection

AVI-4020 for West Nile virus neuroinvasive disease

AVI-4557 Safety, PK/PD of AVI-4557; impact on buspirone metabolism (CYP3A4)

AVI-4065

Dosage, Route, etc.

AE

SAE

17

0

6

0

2

0

0

0

0

0

0

0

0a

0a

21

0

0

0

6

0

2

0

3

0

2

0

0

0

10 adult patients

50 patients a

10 patients (9 active; 1 placebo) 1 patient

Single dose of 10, 30, or 90 mg AVI-4557 via SC or IV routes 10 mg oral buspirone 5 daily IV doses of 90 mg 10 mg oral midazolam

96 healthy adults

Single 300-mg IV dose 10 mg oral midazolam

8 healthy adults (6 AVI-4557; 2 placebo)

Day 3 or days 3 and 7: 300 mg AVI-4557 ⫹ deoxycholate in Enterion™ capsule 10 mg midazolam on days 1, 4, and 6 or days 1 and 8

16 healthy adults (2 cohorts; 6 AVI-4557, 2 placebo)

8 healthy adults (6 AVI-4557; 2 placebo)

14 daily SC dose escalation 30 healthy (50, 100, 300 mg); single volunteers dose level for HCV patients 100 mg every 12 h for 12 patients 14 days via SC injections

0a

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 569

MORPHOLINOS

569

these treated volunteers. Furthermore, there is early evidence of efficacy, which is statistically significant at p ⱕ 0.05 that AVI-4126 prevents restenosis of coronary artery stents and P4503A4 PMO modulates drug metabolism that is linked to the corresponding cytochrome system.

20.3 PHARMACOKINETIC PROFILE The lack of iterated charge appears to eliminate non-targeted binding to cellular components other than RNA. PMO–protein binding studies to date indicate affinities of greater than 1 mM (unpublished data). Thus, protein binding would not occur at concentrations utilized in experimental protocols in cell culture or in in vivo efficacy studies. The limited protein binding and weak interactions with cell membranes imply that PMO available for hybridization with RNA will be minimally competed for by nonspecific binding. This difference represents the basis for speculation that the sequence-dependent pharmacokinetics for PMOs is unique relative to the iterated ionic oligomers chemistries [27]. Current studies tend to indicate that in vitro potency determined by the rabbit reticulocyte in vitro translation methods accurately predicts required concentrations for in vivo efficacy (Figure 20.2) and the pharmacokinetic behavior observed in animal models accurately predicts human pharmacokinetic behavior. A database of pharmacokinetic parameters from over 50 different PMOs that have been evaluated in the rat has been compiled. PMOs administered by an extravascular route (intraperitoneal and subcutaneous) are rapidly absorbed into circulation with an absorption half-life between 0.7 and 1 h and time to maximal plasma concentration between 0.5 and 2 h. The distribution is variable with plasma clearance range between 1 and 33 mL/min and the volume of distribution between 0.4 and 56 L/kg. Distribution appears to vary with the sequence composition and existing disease state. The kidney and liver are the primary sites of PMO accumulation and brain; muscle and T-lymphocytes represent the tissues of poorest accumulation. No degradative metabolism has ever been observed and hence no metabolites have ever been recovered. The plasma elimination half-life varies from 1.8 to 15 h but this appears to be an underestimate of the tissue residence time, which tends to range from 7 to 14 days in kidney and liver. Finally, the primary route of excretion is renal with between 15% and 30% of the administered dose in the urine in the first day postadministration. Renal excretion increases with dose. Fecal elimination is less than 2% of an administered dose. Mass balance studies have been conducted with recovery of over 95% of administered dose entirely as unchanged PMO.

Tissue concentration (nM)

600 500

Androgen receptor

400

AVI-4472

300 AVI-4065 200 100 AVI-4126

αV

0 0

100

200

300

400

500

600

700

RRL EC50 (nM) Figure 20.2 In vitro potency predicts in vivo potency. PMO inhibition in rabbit reticulocyte lysate in vitro translation accurately predicts potency in vivo. The potency (EC50) for five different PMOs targeting V integrin, c-myc (AVI-4126), Cyp3A2 (AVI-4472), HCV (AVI-4065), and the Androgen receptor was determined from in vitro translation indicated on the abscissa, and target tissue concentrations from effective in vivo studies are indicated on the ordinate. The correlation coefficient for in vitro potency versus in vivo efficacy was significant (r ⫽ 0.95) and the slope of the line is significantly different from zero (p ⫽ 0.0078).

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

570

Page 570


20.4 ANTIVIRAL 20.4.1 Exploration The impetus for AVI BioPharma to seek antiviral exploration is based on our extensive opus of empiric studies that have demonstrated the plausibility that PMOs have a broad application and role in the prevention or treatment of microbial pathogens that are life-threatening or disabling biowarfare pathogens or emerging infectious diseases that would adversely affect general public health, inclusive of NIAID category A, B, and C priority pathogens. We have successfully employed PMOs to inhibit a number of viral infections including replicon and plasmid constructs, infections in cell culture, and infections in animal models (Table 20.2). These studies have been conducted independently by nationally or internationally recognized investigators. The exploration of antisense antiviral PMO agents has now led to successful targeting strategies for all seven viral families with single-stranded positive sense RNA genomes that infect humans (Table 20.3). The positive-sense genome represents the simplest targeting strategy and successful genome targets have included inhibition of viral protein translation, interference with viral replication, and disruption of double-stranded RNA structures including IRES structures. The project has led to

Table 20.3 Antiviral Studies Exploration Viral Family, Virus

Activity

Reference

⫹) Strand Viruses Single-Stranded RNA (⫹ Astroviridae Human Astrovirus Caliciviridae Vesivirus Flaviviridae West Nile virus Dengue Arteriviridae EAV PRRSV Coronaviridae MHV SARS Picornaviridae CVB3 Togaviridae Alphavirus-VEE

Efficacy in cell culture

Manuscript in prep.

In vivo efficacy Efficacy in cell culture

[28] [29] [30] [31]

Efficacy in cell culture [32] [33] Efficacy in cell culture [34] [35] Efficacy in cell culture

Manuscript submitted


Manuscript in prep.

⫺) Strand Viruses Single-Stranded RNA (⫺ Arenaviridae Junin Bunyaviridae Rift Valley fever Filoviridae Ebola Zaire Paramyxoviridae measles Rhabdoviridae IHNV Orthomyxoviridae Influenza A


Manuscript in prep.

Efficacy in cell culture In vivo efficacy: mouse, guinea pig and nonhuman primate

Manuscript in prep.


Manuscript in prep.


[38]

In vivo efficacy

[39]

[36] [37]

DNA Viral Genomes Herpesviridae HHV8


[40]

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 571

MORPHOLINOS

571

successful inhibition of all six families of single-stranded negative sense RNA genome viruses that infect humans (Table 20.3). The strategies for targeting the negative sense RNA genome viruses have been significantly more complex and less common to all members of the group. The single-stranded viral RNA genome represents an exceptionally mutation-prone system and these viruses are described as a quasispecies due to genome instability. This presents a challenge to a nucleic acid–based therapy but those genome regions of high conservation appear to represent sites of critical function. Viral resistance to the antisense inhibitor through target site mutation was observed but the resultant mutant virus exhibited attenuated viral products in the case of SARS [35], West Nile virus (WNV), and foot and mouth disease virus (data not published). 20.4.2 Rapid Response to Emerging Infectious Disease The PMO technology offers a unique advantage to rapidly respond to one or many identified biowarfare threats. It is clear that PMO technology can readily be applied to emerging infectious disease or newly created bioterrorism threats. For example, an outbreak of WNV infection in Humbolt penguins initiated our WNV program. The therapeutic PMO was designed within two hours of our decision to treat the penguins. The PMOs were synthesized, purified, evaluated for quality, and shipped to the Milwaukee County Zoo within six days. This enabled the zoo to afford significant survival benefit to PMO-treated penguins within 8 days of being notified of this problem. This successful experience led to the treatment of WNV infections in humans with this prototype PMO. An accelerated WNV program was initiated and completed within 6 months to enter Phase 1 testing with a c-GMP WNV PMO among clinically suspected cases of WNV in Colorado. Similarly, the PMO for treating SARS was designed within days of public availability of viral genome sequence. Finally, an emergency response to make Ebola PMOs under an emergency IND was coordinated among AVI, USAMRIID, and FDA because of an accidental Ebola infection at USAMRIID. Within 5 days of the accidental injection exposure, a cocktail of two clinical-grade Ebola PMOs was delivered from AVI facilities in Oregon to USAMRIID in Maryland. Furthermore, due to the inherent safety and tolerability of PMOs, it should be possible to sponsor a program to produce treatment or prevention formulations against a variety of microbes within individual vials. 20.4.3 Clinical Trials Two clinical trials have been initiated for PMO treatment of viral infection. Both involve singlestranded positive-sense RNA genome viruses, WNV, and Hepatitis C virus (HCV). First, AVI-4020 was investigated in WNV patients with neuroinvasive disease. The primary endpoint of the study was safety and due to small numbers of patients, no significant efficacy data have been accumulated. However, headache and rash subsided in most patients. Motion was restored in at least two patients with paralysis at time of entry and rapid, greater than 1 log reduction in white blood cell counts in cerebrospinal fluid was observed within 3 days of initiating treatment. A critical limitation in this study was the difficulty in IRB approval in centers with active WNV infection. Little progress in this trial has been made in the past 2 years due to less active infection, as the spread of WNV came to the west coast of the United States. One explanation has been the effective mosquito abatement programs in western states. A clinical trial with AVI-4065 to treat HCV began late in 2005. The initial trials involved healthy volunteers administered AVI-4065 subcutaneously daily with doses of 50, 100, and 300 mg per day for 14 consecutive days. There were no serious adverse events (Table 20.2), the pharmacokinetic data indicate mean residence time of 7–10 days, renal excretion of unchanged AVI-4065 and the drug was well tolerated. Once these studies were completed, a cohort of active HCV-infected patients was treated with 100 mg administered subcutaneously twice a day for 14 consecutive days. Preliminary observations from AVI-4065 were presented at the 2006 International Congress for Antiviral Research in Puerto Rico. A total of nine patients with chronic active HCV hepatitis had

CRC_8796_ch020.qxd

572

5/25/2007

1:22 PM

Page 572


received between 4 and 14 days of AVI-4065 at 100 mg twice a day by a subcutaneous route. Among these subjects, there were no clinically significant findings based on physical examinations and conventional laboratory tests (hematology, serum chemistry, coagulation, and urinalysis) to indicate any safety concerns. It should be noted that for all laboratory tests, there were no clinically significant differences between baseline and subsequent days after treatment, up to 28 days for a subset of patients. Furthermore, there have been no drug-related adverse events or serious adverse events, inclusive of site-injection reactions. Among a subset of these patients, five subjects who received at least 14 days of treatment have been monitored to assess preliminary efficacy of AVI-4065. This has been evaluated by comparing the plasma HCV-RNA levels as determined by a branched DNA PCR-based assay on aliquots taken at baseline and sequentially after treatment. Preliminary evaluation suggests AVI-4065 subcutaneous administration at 100 mg twice a day did not lead to a robust reduction of plasma HCV-RNA levels by 14 days of treatment in chronic active HCV hepatitis patients.

20.5 ANTIBACTERIAL In addition to PMO approaches to viral infections, studies have also been initiated to investigate preventing pathology following exposure to various toxins and bacterial pathogens [41]. PMOs have already been made and demonstrated to reduce viable bacterial pathogens in a mouse model by ⬃2 logs within 2 h of administration of a PMO dose. We have recently determined the feasibility of using PMOs to block antibiotic resistance mechanisms. AVI has plans to prevent or treat a number of bacterial diseases and toxin-mediated disease. PMOs with lengths of 9–12 were observed to be effective in inhibiting bacterial gene expression [42]. Longer PMOs will inhibit prokaryotic gene expression in in vitro translation systems but are less effective in intact bacteria, most likely due to penetration of the bacterial cell wall. The short 9–12-mer PMOs are not effective inhibitors of eukaryotic translation either in vitro or in vivo. This factor may add significantly to the potential therapeutic margin of safety of PMO antibiotics. An 11-mer PMO targeting the acyl carrier protein (AcpP) in Escherichia coli was effective in reducing infection in a mouse peritonitis model [43]. The E. coli with a leaky cell wall were more effectively inhibited than strains with intact cell wall, indicating transport across the cell wall as a critical barrier to potential clinical use. A peptide-conjugated PMO was employed to overcome the slow transport across the bacterial cell wall. The peptide conjugates were substantially more potent inhibitors of bacterial gene expression [44]. Multiple gram negative bacteria have now been evaluated successfully. These peptide conjugates represent a feasible approach of development of a PMO antibiotic for antibiotic resistant gram negative bacteria.

20.6 CARDIOVASCULAR Medical therapy of coronary artery disease (CAD) has changed considerably in recent years. It is characterized by expanding use of PCI and continued conversion to minimally invasive percutaneous transluminal coronary angioplasty (PTCA) and stent therapy despite significant advances in pharmacological treatment and implementation of novel surgical techniques in the treatment of CAD [45]. Introduction of stents showed a significant decrease in vessel remodeling and elastic recoil at the site of intervention and clearly demonstrated the superiority of stent implantation over PTCA alone with respect to restenosis in de novo coronary lesions. Extensive use of coronary stents to prevent restenosis has produced a new disease, in-stent restenosis. Unfortunately, this complication continues to be difficult to prevent; regardless of the treatment strategy, the rate of in-stent restenosis (20–60% after bare metal stent implantation) is still unacceptably high, depending on vessel and

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 573

MORPHOLINOS

573

patient bias [46–48,50]. This is particularly true in patients with diabetes and in some lesion sublets, such as bifurcated lesions, long diffuse lesions, and small vessels [50]. However, it was also evident that neointimal proliferation is not affected by the stenting technique [49]. Thus, despite significant advances in the treatment of cardiovascular disease, intimal hyperplasia remains the most common cause of early failure after revascularization. In addition to mechanical procedures, current treatment strategy on intimal hyperplasia includes two main approaches: (i) inhibiting vascular smooth muscle cell (VSMC) proliferation and growth, and stimulating the pathways that lead to VSMC apoptosis, as well as (ii) promoting re-endothelialization and augmenting endothelial functions. New trends toward stent-based drug delivery explored the potential of antiproliferative drugs in treatment and prevention of the intimal hyperplasia. Several completed studies on Sirolimus and Paclitaxel eluting stents showed great capacity of this approach in the prevention and treatment of in-stent restenosis. However, recent advances in vascular gene transfer have shown potential new treatment modalities for cardiovascular disease, particularly in the treatment of vascular restenosis. AVI-4126 is a PMO antisense to c-myc developed to prevent intimal VSMC hyperplasia while sparing endothelial cell function. Initial studies involved New Zealand white, atherosclerotic rabbits maintained on a diet of 0.25% cholesterol. A weeping balloon, transport catheter, delivered approximately 500 g of AVI-4126 into the endoluminal site of PTCA in the internal iliac artery of the rabbit. Table 20.4 shows the 60-day follow-up with significant prevention in late loss of lumen diameter and reduced intimal thickening [51]. A 6-month follow-up of these rabbits confirmed the long-lasting influence of the 30-s delivery of AVI-4126 by significant reduction in intimal thickening [52]. These observations in the rabbit model did not utilize the coronary artery, so subsequent studies investigated the pig restenosis model and coronary artery evaluation. An Infiltrator catheter delivered 1–10 g of AVI-4126 into the PTCA site of pig coronary vessels. Western blot analysis demonstrated a dose-dependent reduction in MYC expression [53]. Further, 28-day follow-up studies showed a significant reduction in the intimal area of the pig coronaries (Table 20.4). The emergence of stent coating technologies led to the examination of this alternative method of AVI-4126 delivery to the PTCA site. A commercially available phosphorylcholine-coated stent (BiodivYsio; Biocompatibles, Surrey, UK) designed to trap drug molecules in the phospholipid layer was utilized to delivery AVI-4126 into pig coronary arteries [54]. These studies show significant protection of lumen diameter and reduction in intimal area (Table 20.4). The polymers from many coated stents appear to obligate long-term use of anticoagulants. Further, the delivery of drug is limited to the site where stents are placed, limiting use to focal lesions and failure due to the systemic nature of acute coronary syndrome. This led to the development of a microbubble delivery system for AVI-4126. The microbubbles are composed of perfluorobutane, which promotes cell penetration of AVI-4126. This noninvasive method of drug delivery

Table 20.4 Summary of in Vivo Restenosis Efficacy Studies with AVI-4126 Intima (mm2)

Late Loss (mm) Study Transport catheter in rabbit iliac Transport catheter in rabbit iliac (6 months) Infiltrator catheter in pig coronary PC-coated stent in pig coronary IV microbubble in pig coronary

Control

AVI-4126

p-value

Control

AVI-4126

p-value Reference

1.8 ⫾ 0.3

0.9 ⫾ 0.2

0.001

1.67 ⫾ 0.44

0.82 ⫾ 0.32

0.002

[51]

–

–

–

1.43 ⫾ 0.25

0.65 ⫾ 0.26

⬍0.05

[52]

–

–

–

3.88 ⫾ 1.04

1.95 ⫾ 0.91

⬍0.001

[53]

1.14 ⫾ 0.16

0.40 ⫾ 0.53

0.04

3.9 ⫾ 0.8

2.3 ⫾ 0.7

0.0077

[54]

–

–

–

3.6 ⫾ 1.4

2.6 ⫾ 1.4

⬍0.05

[55]

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

574

Page 574


relies on the microbubble retention at sites of vascuolar endothelial dysfunction. Thus, AVI-4126 is delivered on a film at the surface of perfluorobutane gas microbubbles. The microbubble delivery strategy has proven successful in the pig PTCA model [55]. A significant reduction in intimal area was observed in pig coronaries (Table 20.4). The studies have utilized three different delivery technologies each with significant efficacy in the pig coronary model. Phase I studies with AVI-4126 involved simple intravenous and oral routes of administration of 1–90 mg as a single bolus in healthy volunteers. This collection of robust observations and excellent safety profile has led to a phase II study, AVAIL, in which patients with de novo lesions or in stent restenosis were treated with AVI-4126 delivered with Infiltrator catheter [56]. The AVAIL trial was a prospective, evaluator-blinded, randomized study including clinical follow-up at 30 days and 6 months after intervention and 6-month angiographic and IVUS follow-up. Primary endpoints included major adverse cardiac events (MACE), TVR, angiographic restenosis, and IVUS at 6 months. Forty six patients with either de novo lesions or restenosis were randomized into three groups: low dose (3 mg, 15 patients); high dose (10 mg, 15 patients); and control (16 patients). Baseline angiographic characteristics did not differ between the groups (reference vessel diameter: 2.5–4 mm, lesion length ⬍16mm). No MACE was recorded in any group, either in the hospital or within 30 days of treatment. At 6 months, three patients (33.3%) from the control group (n ⫽ 9) and six (46.1%) from the low-dose group (n ⫽ 13) required TVR. In contrast, in the high-dose group (n ⫽ 14) only one patient (7.1%) needed TVR. Angiographic follow-up demonstrated significant reduction in late loss ( p⫽0.025). Binary restenosis was 33.3% in the control group, 33.3% in the low-dose group, and 0.0% in the high-dose group. These preliminary findings from the small cohort of patients require confirmation in a larger trial utilizing more sophisticated drug eluting technologies.

20.7 CANCER Cancer therapy remains an area of unmet medical need. The development of anticancer agents is enticing due to the likelihood of low risk and great potential benefit. However, development is difficult due to lengthy and costly clinical trials in patients with advanced disease. An antisense therapeutic agent should have outstanding antitumor properties to move from preclinical evaluation into clinical development. The PMO AVI-4126 was found to have poor to moderate activity in a lung tumor model but was very good when used in combination with cisplatin [57]. The c-myc target appeared to be significantly more active than both RAD 51 and p21 in the Lewis lung tumor model (Table 20.5). AVI-4126 was found to be more active in a prostate tumor model [58], which provided the rationale Table 20.5 Summary of PMO Antisense Anticancer Efficacy Studies mRNA Target

Tumor Type

Model

Observation

c-myc

Lung

LLC1 Lewis lung syngeneic tumor in C57BL/6 mice

o MYC protein (Western blot) o tumor growth in

c-myc

Prostate

o tumor volume

hCG

Prostate

MMP-9

Prostate

SNAIL

Colorectal

PC-3 xenograft in nu/nu mouse DU145 xenograft in nu/nu mouse DU145 xenografts in athymic male mouse MIN mouse model

XIAP

Prostate

DU145 cell culture

Androgen Rec

Prostate

LAPC-4 xenograft in nu/nu mouse

combo w/ cisplatin Combo of hCG ⫹ c-myc show antitumor synergy m Tumor growth

o SNAIL protein, m E-cadherin exp. o tumor number and incidence o XIAP Expression, o cell viability o hAR protein, o PSA expression

Reference

[57] [58] [59] [60] [61] [62] [63]

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 575

MORPHOLINOS

575

for pilot clinical studies. Combination of AVI-4126 with another PMO was investigated [59]. Antitumor synergy was observed when both AVI-4126 and a PMO targeting human chorionic gonadotropin were administered together (Table 20.5). A combination therapy approach to antisense for cancer chemotherapy is feasible given the outstanding safety data for PMOs in tumor models. Multiple targets have been evaluated to investigate antitumor strategies. An antisense PMO targeting MMP-9 was shown to inhibit protein expression, reduce tumor cell invasion and increase tumor cell apoptosis [60]. However, tumor mass in a xenograft model failed to demonstrate meaningful reduction in tumor mass. A transcriptional repressor, SNAIL, was targeted in the MIN mouse model and a significant antitumor effect was observed [61]. These data are particularly meaningful given the spontaneous tumor model and the intact immune system of the mouse. An anti-apoptitic gene, XIAP, was targeted in prostate cancer cells (Table 20.5) with antisense-linked reduction in protein correlating with reduced cell viability [62]. While encouraging, these observations were not considered sufficiently robust for further development. Finally, targeting the androgen receptor (AR) in prostate cancer cells has generated significant observations [63]. A LAPC-4 xenograft mouse model showed decreased AR protein expression as well as signal transduction, leading to diminished PSA expression. This may represent a feasible anticancer strategy as the patient population of hormone refractory tumor with low PSA would be well suited to the treatment strategy, but this would be a lengthy clinical trial. A pilot clinical trial to evaluate tumor accumulation of AVI-4126 established the feasibility of using PMO in human cancer trials [64]. These studies investigated a single 90-mg intravenous dose of AVI-4126 in patients with breast and prostate cancer. The AVI-4126 was administered one day prior to surgical removal of tumors. The excised tumor was evaluated for AVI-4126 concentrations, which were between 50 and 100 nM, near the 110 nM EC50 for AVI-4126. 20.8 METABOLIC REDIRECTION The cytochrome P450 (CYP) enzymes are heme-containing proteins involved in oxidative metabolism of thousands of compounds. Twelve CYP families have been identified in human beings, with the CYP3A4 being involved in the biotransformation of a majority of all drugs. The most abundant CYP in the human liver is the CYP3A family with specific content of 96 ⫾ 51 nmol/mg microsomal protein, which represents 40% of the total liver CYP content. CYP3A4 is expressed at significant levels extrahepatically with extensive activity in the gastrointestinal tract. This is a significant factor contributing to the poor oral bioavailability of many drugs [65]. The CYP enzymes display relatively low substrate specificity such that two or more individual enzymes often catalyze a given biotransformation reaction. Further, a given cell may express more than one CYP enzyme. Finally, the human CYP3A5 and CYP3A7 enzymes are known, but CYP3A5 is expressed in the liver of 10–30% of individuals and CYP3A7 is expressed in the endometrium and placenta but is not observed in the liver after birth. The CYP3A family metabolizes a number of clinically important drugs such as midazolam, nifedipine, erythromycin, tamoxefin, cyclosporine, phenytoin, digoxin, and 17 -ethylestradiol. Enormous interindividual variation in enzyme content and activity has been reported in the liver, 10- to 20-fold, and intestines, 10- to 49-fold. These differences are responsible for variations in efficacy and disposition of a variety of drugs. The potential to inhibit CYP3A expression is expected to result in a more narrow range of metabolic capacity for individuals. Midazolam metabolism is considered a specific in vivo pharmacological marker of CYP3A enzymatic activity. Early antisense studies with phosphorothioate oligodeoxynucleotides (PSO) demonstrated that a dose of 5 mg/kg administered once a day for 2 days will increase midazolaminduced sleep time in rats from 22 ⫾ 0.4 min to 35 ⫾ 1.5 min (Figure 20.3). This was accompanied by a reduction in CYP3A protein in the liver measured by western blot and reduction in erythromycin demethylase activity in the liver from 124 ⫾ 13 mol formaldehyde/mg microsomal

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 576

576

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION PSO EC50 = 4.2 mg/kg PMO EC50 =1.6 mg/kg

Percent inhibition

75

50

25

0 -0.50

-0.25

0.00

0.25

0.50

0.75

Dose (mg/kg)

Dose (mg/kg)

Route

Substrate

Percent Inhibition

Reference

5.0 2.5 2.5 2.0 1.5

IP IP IP PO TD

Midazolam Paclitaxel Tamoxefin Erythromycin 7-BC

29 62 59 69 51

[66] [67] [68] [69] [70]

Figure 20.3 In vivo inhibition of rat CYP3A2. Inhibition of cytochrome P450 3A2 in a rat model. The compounds were administered by several routes of administration: IP is intraperitoneal; PO, oral; and TD, transdermal. Different substrates were evaluated as endpoints, 7-BC is 7-benzyloxy-4-(trifluoromethyl)coumarin. PSO indicates a phosphorothioate oligodeoxynucleotide; PMO indicates a phosphorodiamidate morpholino oligomer.

protein/min to 64 ⫾ 8, a reduction of 52% [66]. The potency (EC50) of the uniform phosphorothioate olidodeoxynucleotide was 4.6 mg/kg as shown in Figure 20.3. The PMO chemistry represents a significant difference in mechanism of action and molecular properties from these earlier efforts with the PSO chemistry. A PMO, AVI-4472, targeting the rat CYP3A2 enzyme was effective in inhibiting the metabolism of paclitaxel with a single intravenous dose of 2.5 mg/kg resulting in extended half-life, 12 ⫾ 1 min in control versus 32 ⫾ 2 min in the AVI-4472-treated group (Figure 20.2). Significant changes were also observed in reduced plasma clearance, 8 ⫾ 2 versus 2 ⫾ 0 mL/min, and enhanced plasma AUC, 266 ⫾ 48 versus 900 ⫾ 36 g min/mL [67]. More recently, a dose of 2.5 mg/kg/day of AVI-4472 administered intraperitoneally for 8 days was employed to inhibit the rat CYP3A2 and reduce tamoxefin-related DNA adducts from 5.06 to 2.08 TAM-DNA adducts per 108 nucleotides [68]. AVI-4472 was also found to be effective after transdermal delivery with 0.3 mg (1.5 mg/kg) AVI-4472 applied topically to a 2-cm2 area of skin [69]. AVI-4472 was also effective following oral administration of 2.0 mg/kg to rats [70]. These observations were compiled in a single dose-response curve shown in Figure 20.2 and indicate the EC50 for the PMO is 1.6 mg/kg. The human ortholgous PMO, AVI-4557, targets CYP3A4 and confirmed activity in primary human hepatocytes from 11 donors and in Caco-2 cells stably transfected with CYP3A4 cDNA [71].

20.9 ALTERED RNA SPLICING FOR DUCHENNE MUSCULAR DYSTROPHY (DMD) Duchenne and Becker muscular dystrophies are allelic disorders arising from mutations in the dystrophin gene. Disease-causing mutations in the dystrophin gene can be eliminated by removal of exons bearing non-sense mutations or exons that flank frame-shifting deletions to produce an in-frame

CRC_8796_ch020.qxd

5/25/2007

1:22 PM

Page 577

MORPHOLINOS

577

transcript [72]. Reverse transcriptase polymerase chain reaction (RT-PCR), analysis of transcripts from RNA prepared from mdx mouse tibialis anterior muscle after a single injection of 5 g of 2⬘-Omethylphosphorothioate, PMO, and peptide nucleic acid oligomers showed effective skipping of exon 21 in only the PMO treatment group [73]. Studies have been extended with PMO to restore dystrophin expression in the golden retriever muscular dystrophy (GRMD) animal model [74] and normal and DMD human tissue [75]. Recently, PMO-induced skipping of multiple exons was accomplished in the mdx mouse [76]. Maximal in vivo efficacy is observed following 2–10 g dose injected directly into the muscle 4 weeks postinjection and robust exon-skipped dystrophin expression was observed 8 weeks postinjection. These observations indicate that PMO-induced exon skipping is effective in multiple species and that prolonged dystrophin expression can be accomplished. Plans are currently in progress to initiate human clinical trials. 20.10 FORMULATIONS Enhanced potency can be achieved through the creation of a PMO covalently conjugated to arginine-rich peptides at the 5⬘ end, which was determined in an in vitro translation assay [77]. This is likely to be due to ionic interactions between the net positive charge of arginine and the net negative charge in the target complementary RNA. This has been verified through the use of ornithine and lysine peptide conjugates. The addition of a few positive charges also influences the interactions between the PMO and cells by enhanced adsorption to the cell surface. The enhanced adsorption leads to greater cellular internalization of the PMO [78,79]. Recently, we have determined that these conjugated PMOs are different with respect to tissue distribution, more toxic than unmodified PMOs, and have altered pharmacokinetic parameters including enhanced secretion in the renal tubule. Hence, the benefit of added potency and potential for improved delivery to tissue must be balanced with the potential for toxicity. 20.11 SUMMARY The PMO chemistry is an outstanding platform for the development of gene-specific therapeutics. The mechanism of action allows a small and focused search for active agents. The stability, lack of net charge, and resistance to metabolic degradation simplify the process of drug development. A growing database of safety data indicates that the PMO can be used in settings where risk must be minimal. The observations reported here indicate that PMOs are effective in a variety of animal models and humans. They can be administered via most routes of administration with favorable pharmacokinetic properties. The antiviral uses have exploited virtually all single-strand RNA viral families capable of producing pathology. The antiviral capabilities continue to unfold as activity against DNA viral genomes has been reported. The PMOs represent a potential new class of antibiotic compound with outstanding safety characteristics and excellent in vivo efficacy. Studies in areas of cardiovascular, cancer, metabolism, and neuromuscular diseases confirm the broad utility of the PMO antisense platform. ACKNOWLEDGMENTS I would like to thank a large number of collaborators including P-Y Shi, Sina Bavari, Kelly Warfield, Ben Neuman, Mike Buchmeier, Richard Kinney, Eva Harris, Eric Snijder, E van den Born, Yanjin Zhang, David Matson, Al Smith, Jonzhu Chen, Elke Muhlberger, Nick Kipshidze, Marty Leon, Jeff Moses, Tom Porter, Vic Arora, Hemant Roy, Rhonda Brand, and Gayathri Devi. I would also like to thank Dave Stein, Hong Moulton, Bruce Geller, Luke Tilley, Janet Christensen, Peter O’Hanley, and Dwight Weller for their contributions to this chapter. Finally, I would like to express thanks to Stan Crooke for the careful review of this chapter.

CRC_8796_ch020.qxd

578

5/25/2007

1:22 PM

Page 578


REFERENCES 1. Giles RV, Spiller DG, and Tidd DM (1993) Chimeric oligodeoxynucleotide analogues: Enhanced cell uptake of structures which direct RNase H with high specificity. Anti-Cancer Drug Des. 8: 3–51. 2. Stein D, Foster E, Huang SB, Weller D, and Summerton J (1997) A specificity comparison of four antisense types: morpholino, 2⬘-O-methyl RNA, DNA, and phosphorothioate DNA. Antisense Nucleic Acid Drug Dev. 7: 151–157. 3. Burgess TL, Fisher EF, Ross SL, Bready JV, Qian YX, Bayewitch LA, Cohen AM, Herrera CJ, Kramer TB, Lott FD, Martin FH, Pierce GF, Simoner L, and Farrell CL (1993) The antiproliferative activity of c-myb and c-myc antisense oligonucleotides is smooth muscle cells iscaused by a nonantisense mechanism. Proc. Natl. Acad. Sci. USA 92: 4051– 4055. 4. Hudziak RM, Summerton J, Weller, DD, and Iversen PL (2000) Antiproliferative effects of steric blocking phosphorodiamidate morpholino antisense agents directed against c-myc. Antisense Nucleic Acid Drug Dev. 10: 163–176. 5. Copple BL, Gmeiner WM, and Iversen PL (1995) Reaction between metabolically activated acetaminophen and phosphorothioate oligonucleotides. Toxicol. Appl. Pharmacol. 133: 53–63. 6. Cornish KG, Iversen PL, Smith LJ, Arneson MA, and Bayever E (1993) Cardiovascular effects of a phosphorothioate oligonucleotide with sequence antisense to p53 in the conscious rhesus monkey. Pharmacol. Commun. 3: 239–247. 7. Iversen PL, Cornish KG, Iversen LJ, Mata JE, and Bylund DB (1999) Bolus intravenous injection of phosphorothioate oligonucleotides causes severe hypotension by acting as ␣1-adrenergic receptor antagonists. Toxicol. Appl. Pharmacol. 160: 289–296. 8. Mata JE, Bishop MR, Tarantolo SR, Angle CR, Swanson SA, and Iversen PL (1999) Evidence of enhanced iron excretion during systemic phosphorothioate oligodeoxynucleotide treatment. J. Toxicol. Clin. Toxicol. 38(4): 383–387. 9. Farman CA and Kornbrust DJ (2003) Oligodeoxynucleotide studies in primates: antisense and immune stimulatory indications. Toxicol. Pathol. (Jan–Feb) 31(suppl.): 119–122. 10. Webb MS, Tortora N, Cremese M, Kozlowska H, Blaquiere M, Devine DV, and Kornbrust DJ (2001) Toxicity and toxicokinetics of a phosphorothioate oligonucleotide against the c-myc oncogene in cynomolgus monkeys. Antisense Nucleic Acid Drug Dev. (Jun) 11(3): 155–163. 11. Levin AA (1999) A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim. Biophys. Acta 1489(1): 69–84. 12. Henry SP, Novotny W, Leeds J, Auletta C, and Kornbrust DJ (1997) Inhibition of coagulation by a phosphorothioate oligonucleotide. Antisense Nucleic Acid Drug Dev. (Oct) 7(5): 503–510. 13. Stein CA and Cheng YC (1993) Antisene oligonucleotides as therapeutic agents – Is the bullet really magical? Science 261: 1004–1012. 14. Stein CA (1995) Does antisense exist? Nat. Med. 1: 1119–1121. 15. Shoeman RL, Hartig SB, Huang Y, Grub S, and Traub P (1997) Fluorescence microscopic comparison of the binding of phosphodiester and phosphorothioate (antisense) oligodeoxyribonucleotides to subcellular structures, including intermediate filaments, the endoplasmic reticulum, and the nuclear interior. Antisense Nucleic Acid Drug Dev. 7: 291–298. 16. Hudziak RM, Barofsky E, Barofsky DF, Weller DL, Huang SB, and Weller DD (1996) Resistance of Morpholino phosphorodiamidate oligomers to enzymatic degradation. Antisense Nucleic Acids Drug Dev. 6: 267–272. 17. Ricker JL, Mata JE, Iversen PL, and Gattone VH (2002) c-myc Antisense oligonucleotide treatment ameliorates murine infantile polycystic kidney disease. Kidney Int. 61: S125–S131. 18. Arora V, Knapp DC, Smith BL, Statdfield ML, Stein DA, Reddy MT, Weller DD, and Iversen PL (2000) c-Myc antisense limits rat liver regeneration and indicates role for c-myc in regulating cytochrome P-450 3A activity. J. Pharmacol. Exp. Ther. 292: 921–928. 19. Kipshidze N, Keane E, Stein D, Chawla P, Skrinska V, Shankar LR, Khanna A, Komorowski R, Haudenschild C, Iversen P, Leon M, Keelan MH, and Moses J (2001) Local delivery of c-myc neutrally charged antisense oligonucleotides with transport catheter inhibits myointimal hyperplasia and positively affects vascular remodeling in the rabbit balloon injury model. Catheterization Cardiovasc. Interventions 54: 247–256.

CRC_8796_ch020.qxd

5/25/2007

MORPHOLINOS

1:22 PM

Page 579

579

20. Kipshidze NN, Kim H-S, Iversen PL, Yazdi HA, Bhargava B, Mehran R, Haundenschild C, Dangas G, Stone GW, Roubin GS, Leon MB, and Moses JW (2002) Intramural delivery of advanced antisense oligonucleotides with infiltrator cathetor inhibits c-myc expression and intimal hyperplasia in the porcine. J. Am. Coll. Cardiol. 39(10): 1686–1691. 21. London CA, Sekhon HS, Arora V, Stein DA, Iversen PL, and Devi GR (2003) A novel antisense inhibitor of MMP-9 attenuates angiogenesis, human prostate cancer cell cinvasion and tumorigenicity. Cancer Gene Ther. 10: 823–832. 22. Arora V, Hannah TL, Iversen PL, and Brand RM (2002) Transdermal use of phosphorodiamidate morpholino oligomer AVI-4472 inhibits cytochrome P450 3A2 activity in male rats. Pharmaceut. Res. 19(10): 1465–1470. 23. Qin G, Taylor M, Ning YY, Iversen P, and Kobzik L (2000) In vivo evaluation of a morpholino antisense oligomer directed against TNF. Antisense Nucleic Acid Drug Dev. 10: 11–16. 24. Arora V, Knapp DC, Reddy MT, Weller DD, and Iversen PL (2002) Phosphorodiamidate morpholino oligomers demonstrate antisense activity in rat liver following oral administration. J. Pharm. Sci. 91(4): 1009–1018. 25. Ghosh C, Reddy M, and Iversen PL (2003) Analysis of antisense phosphorodiamidate morphino oligomer teratogenicity in the zebrafish embryogenesis model. Anal. Pharmacol. 1(3): 80–89. 26. Iversen PL and Newbury S (2005) Manipulation of zebrafish embryogenesis by phosphorodiamidate morpholino oligomers indicates minimal non-specific teratogenesis. Curr. Opin. Mol. Ther. 7(2): 104–108. 27. Arora V, Devi GR, and Iversen PL (2004) Neutrally charged phosphorodiamidate morpholino oligomers: uptake, efficacy and pharmacokinetics. Curr. Pharm. Biotech. 5(5): 431–439. 28. Stein D, Skilling D, Iversen PL, and Smith AO (2001) Inhibition of Vesivirus infections in mammalian tissue culture with antisense morpholino oligomers. Antisense Nucleic Acid Drug Dev. 11: 317–325. 29. Deas TS, Binduga-Gajewska I, Tilgner M, Ren P, Stein DA, Moulton HM, Iversen PL, Kauffman EB, Kramer LD, and Shi P-Y (2005) Inhibition of Flavivirus infections by antisense oligomers specifically suppressing viral translation and RNA replication. J. Virol. 79(8): 4599–4609. 30. Kinney RM, Huang CY-H, Rose BC, Kroeker AD, Dreher TW, Iversen PL, and Stein DA (2005) Inhibition of dengue virus serotypes 1 to 4 in cell culture with morpholino oligomers. J. Virol. 79(8): 5116–5128. 31. Holden KL, Stein DA, Pierson TC, Ahmed AA, Clyde K, Iversen PL, and Harris E (2005) Inhibition of dengue virus translation and RNA synthesis by a morpholino oligomer targeted to the terminal 3⬘ stem-loop structure. Virology 344: 439–452. 32. van den Born E, Stein DA, Iversen PL, and Snijder EJ (2005) Antiviral activity of morpholino oligomers designed to block various aspects of Equine arteritis virus amplification in cell culture. J. Gen. Virol. 86(11): 3081–3090. 33. Zhang YJ, Stein DA, Fan SM, Wang KY, Kroeker AD, Meng XJ, Iversen PL, and Matson DO (2006) Suppression of porcine reproductive and respiratory syndrome virus replication by morpholino antisense oligomers. Vet. Microbiol. (in press). 34. Neuman BW, Stein DA, Kroeker AD, Paulino AD, Moulton HM, Iversen PL, and Buchmeier MJ (2004) Antisense morpholino oligomers directed against the 5⬘-end of the genome inhibit coronavirus proliferation and growth. J. Virol. 78(11): 5891–5899. 35. Neuman BW, Stein DA, Kroeker AD, Churchill MJ, Kim AM, Dawson P, Moulton HM, Bestwick RK, Iversen PL, and Buchmeier MJ (2005) Inhibition, escape and attenuation of SARS coronavirus treated with antisense morpholino oligomers. J. Virol. 79: 9665–9676. 36. Warfield KL, Swenson DL, Olinger GG, Nichols DK, Pratt WD, Blouch R, Stein DA, Aman MJ, Iversen PL, and Bavari S (2006) Gene-specific countermeasures against Ebola virus based on antisense phosphorodiamidate morpholino oligomers. PLoS Pathogens 2(1): 1–9. 37. Enterlein S, Warfield KL, Swenson DL, Stein DA, Smith JL, Gamble CS, Kroeker AD, Iversen PL, Bavari S, and Muhlberger K (2006) VP35 knockdown inhibits Ebola virus amplification and protects against lethal infection in mice. Antimicrob. Agents Chemother. 50(3): 984–993. 38. Alonso M, Stein DA, Thomann E, Moulton H, Leong J-AC, Iversen P, and Mourich D (2005) Inhibition of infectious hematopoietic necrosis virus in cell cultures with peptide-conjugated morpholino oligomers J. Fish Disease 28: 399–410.

CRC_8796_ch020.qxd

580

5/25/2007

1:22 PM

Page 580


39. Ge Q, Kroeker AD, Bestwick RK, Iversen PL, Chen J, and Stein D (2006) Inhibition of influenza A virus in Vero cell culture with morpholino oligomers. J. Virol. (in press). 40. Zhang YJ, Wang KY, Stein DA, Patel D, Watkins R, Moulton HM, Iversen PL, and Matson DO (2006) Inhibition of replication and transcription activator and latency-associated nuclear antigen of Kaposi’s sarcoma-associated herpesvirus by morpholino oligomers. Antivir. Res. 73: 12–23. 41. Geller BL, Deere JD, Stein DA, Kroeker AD, Moulton HM, and Iversen PL (2003) Inhibition of gene expression in Escherichia coli by antisense phosphorodiamidate morpholino oligomers. Antimicrob. Agents Chemother. 47: 3233–3239. 42. Deere J, Iversen P, and Geller BL (2005) Antisense phosphorodiamidate morpholino oligomer length and target position effects on gene-specific inhibition in Escherichia coli. Antimicrob. Agents Chemother. 49: 249–255. 43. Geller BL, Deere J, Tilley L, and Iversen PL (2005) Antisense phosphorodiamidate morpholino oligomer inhibits viability of Escherichia coli in pure culture and in mouse peritonitis. J. Antimicrob. Chemother. 10: 1093. 44. Tilley LD, Hine OS, Kellogg JA, Hassinger JN, Weller DD, Iversen PL, and Geller BL (2006) Genespecific effects of antisense phosphorodiamidate morpholino oligomer-peptide conjugates on Escherichia coli and Salmonella enterica Serovar Typhimurium in pure culture and in tissue culture. Antimicrob. Agents Chemother. 50(8): 2789–2796. 45. Simonsen M (2003) Changing role for cardiac surgery as use of stents continues growth. Cardiovasc. Device Update 9: 1–7. 46. Topol EJ and Serruys PW (1998) Frontiers in interventional cardiology. Circulation 98: 1802–1820. 47. Serruys PW, Foley DP, Suttorp M-J, Rensing BJ, Suryapranta H, Materne P, van den Bos A, Benit E, Anzuini A, Rutsch W, Legrand V, Dawkins K, Cobaugh M, Bressers M, Backx B, Wijns W, and Colombo A (2002) A randomized comparison of the value of additional stenting after optimal balloon angioplasty for long coronary lesions. J. Am. Coll. Cardiol. 39: 393–399. 48. van den Brand M, Rensing J, Morel MM, Foley DP, de Valk V, Breeman A, Suryapranata H, Haalebos MM, Wijns W, Wellens F, Balcon R, Magee P, Rigeiro E, Buffolo E, Unger F, and Serruys PW (2002) The effect of completeness of revascularization on event-free survival at one year in the ARTS trial. J. Am. Coll. Cardiol. 39: 559–564. 49. Nakatani M, Takeyama Y, Shibata M, Yorozuya M, Suzuki M, Koba S, and Katagirl T (2003) Mechanisms of restenosis after coronary intervention. Difference between plain old balloon angioplasty and stenting. Cardiovasc. Pathol. 12: 40–48. 50. Goldberg SL, Loussararian A, De Gregorio J, Di Mario C, Albierro R, Colombo A (2001) Predictors of diffuse and aggressive intrastent restenosis. J. Am. Coll. Cardiol. 37: 1019–1025 51. Kipshidze N, Keane E, Stein D, Chawla P, Skrinska V, Shankar LR, Khanna A, Komorowski R, Haudenschild C, Iversen P, Leon M, Keelan MH, and Moses J (2001) Local delivery of c-myc neutrally charged antisense oligonucleotides with transport catheter inhibits myointimal hyperplasia and positively affects vascular remodeling in the rabbit balloon injury model. Catheter. Cardiovasc. Interventions 54: 247–256. 52. Kipshidze N, Iversen P, Keane E, Stein D, Chawla P, Skrinska V, Shankar LR, Mehran R, Chekanov V, Dangas G, Komorowski R, Haudenschild C, Khanna A, Leon M, Keelan MH, and Moses J (2002) Complete vascular healing and sustained suppression of neointimal thickening after local delivery of advanced c-myc antisense at six months follow-up in a rabbit balloon injury model. Cardiovasc. Radiation Med. 3: 26–30. 53. Kipshidze NN, Kim H-S, Iversen PL, Yazdi HA, Bhargava B, Mehran R, Haundenschild C, Dangas G, Stone GW, Roubin GS, Leon MB, and Moses JW (2002) Intramural delivery of advanced antisense oligonucleotides with infiltrator cathetor inhibits c-myc expression and intimal hyperplasia in the porcine. J. Am. Coll. Cardiol. 39(10): 1686–1691. 54. Kipshidze NN, Iversen PL, Kim H-S, Yazdi HA, Dangas G, Seaborn R, New G, Tio FB, Waxman R, Mehran R, Tsapenko M, Stone GW, Roubin GS, Iyer S, Leon MB, and Moses JW (2004) Advanced c-myc antisense (AVI-4126)-eluting phosphrylcholine-coated stent implantation is associated with complete vascular healing and reduced neointimal formation in the porcine coronary restenosis model. Catheter. Cardiovasc. Interventions 61: 518–527. 55. Porter TR, Xie F, Knapp D, Iversen P, Markey LA, Tsutsui JM, Maiti S, Lof J, Radio SJ, and Kipshidze N (2006) Targeted vascular delivery of antisense molecules using intravenous microbubbles. Cardiovasc. Revasc. Med. 7(1): 25–33.

CRC_8796_ch020.qxd

5/25/2007

MORPHOLINOS

1:22 PM

Page 581

581

56. Kipshidze NN, Tsapenko M, Iversen P, and Burger D (2005) Antisense therapy for restenosis following percutaneous coronary intervention. Expert Opin. Biol. Ther. 5(1): 79–89. 57. Knapp DC, Mata JE, Reddy MT, Devi GR, and Iversen PL (2003) Resistance to chemotherapeutic drugs overcome by c-Myc inhibition in Lewis lung carcinoma model. Anti-cancer Drugs 14(1): 39–47. 58. Iversen PL, Arora V, Acker AJ, Mason DH, and Devi, GR (2003) Efficacy of antisense morpholino oligomer targeted to c-myc in prostate cancer xenograft model and a phase I safety study in humans. Clin. Cancer Res. 9: 1–10. 59. Devi GR, Oldencamp JR, London CA, and Iversen PL (2002) Inhibition of human chorionic gonadotropin ␤-subunit modulates the mitogenic effect of c-myc in human prostate cancer cells. The Prostate 53(3): 200–210. 60. London CA, Sekhon HS, Arora V, Stein DA, Iversen PL, and Devi GR (2003) A novel antisense inhibitor of MMP-9 attenuates angiogenesis, human prostate cancer cell cinvasion and tumorigenicity. Cancer Gene Ther. 10: 823–832. 61. Roy HK, Iversen PL, Hart J, Liu Y, Koetsier JL, Kim Y, Kunte DP, Madugula M, Backman V, and Wali RK (2004) Down-regulation of SNAIL suppresses MIN mouse tumorigenesis: modulation of apoptosis, proliferation and fractal dimension. Mol. Cancer Ther. 3(9): 1159–1165. 62. Amantana A, London CA, Iversen PL, and Devi GR (2004) X-linked inhibitor of apoptosis protein inhibition induces apoptosis and enhances chemotherapy sensitivity in human prostate cancer cells. Mol. Cancer Ther. 3(6): 699–707. 63. Ko YJ, Devi GR, London CA, Kayas A, Iversen PL, Bubley GJ, and Balk, SP (2004) Antisense mediated androgen receptor downregulation in prostate cancer xenografts J. Urol. 172: 1140–1144. 64. Devi GR, Beer TM, Corless CL, Arora V, Weller DL, and Iversen PL (2005) In vivo bioavailability and pharmacokinetics of a c-MYC antisense phosphorodiamidate morpholino oligomer, AVI-4126, in solid tumors. Clin. Cancer Res. 11(10): 3930–3938. 65. Arora V and Iversen PL (2001) Redirection of drug metabolism using antisense technology. Curr. Opin. Mol. Therap. 3(3): 249–257. 66. Desjardins JP and Iversen PL (1995) Inhibition of the rat cytochrome P450 3A2 by an antisense phosphorothioate oligodeoxynucleotide in vivo. J. Pharm. Exp. Ther. 275(3): 1608–1613. 67. Arora V (2003) Antisense strategies for redirection of drug metabolism using paclitaxel as a model. In Methods in Molecular Medicine, Vol. 106: Antisense Therapeutics, Second Edn., I. Phillips, ed., Humana Press Inc., Totowa, NJ. 68. Mahadevan B, Arora V, Schild LJ, Keshava C, Cate M, Iversen PL, Poirier M, Weston A, Pereira C, and Baird WM (2005) Reduction in tamoxifen-induced CYP3A2 expression and DNA adducts using antisense technology. Mol. Carcinogenesis, Dec 3. 69. Arora V, Hannah TL, Iversen PL, and Brand RM (2002) Transdermal use of phosphorodiamidate morpholino oligomer AVI-4472 inhibits cytochrome P450 3A2 activity in male rats. Pharmaceut. Res. 19(10): 1465–1470. 70. Arora V, Knapp DC, Reddy MT, Weller DD, and Iversen PL (2002) Phosphorodiamidate morpholino oligomers demonstrate antisense activity in rat liver following oral administration. J. Pharm. Sci. 91(4): 1009–1018. 71. Arora V, Cate M, Ghosh C, and Iversen PL (2002) Phosphorodiamidate morpholino oligomers inhibit expression of human cytochrome P450 3A4 and alter selected drug metabolism. Drug Metabol. Dispos. 30(7): 1–6. 72. Wilton SD, Lloyd F, Carville K, Fletcher S, Honeyman K, Agrawal S, and Kole R (1999) Specific removal of the nonsense mutation from the mdx dystrophin mRNA using antisense oligonucleotides. Neuromuscular Disord. 9: 330–338. 73. Fletcher S, Honeyman K, Fall AM, Harding PL, Johnsen RD, and Wilton SD (2006) Dystrophin expression in the mdx mouse after localized and systemic administration of a morpholino antisense oligonucleotide. J Gene Med. 8: 207–216. 74. McClorey G, Moulton HM, Iversen PL, Fletcher S, and Wilton SD (2006) Antisense oligonucleotideinduced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. (Epub ahead of print). 75. McClorey G, Fall AM, Moulton HM, Iversen PL, Rasko JE, Ryan M, Fletcher S, and Wilton SD (2006) Induced dystrophin exon skipping in human muscle explants. Neuromuscular Disord. 16: 1–8. 76. Fall AM, Johnsen R, Honeyman K, Iversen P, Fletcher S, and Wilton SD (2006) Induction of revertant fibers in the mdx mouse using antisense oligonucleotides. Genetic Vaccines Ther. 4: 3–15.

CRC_8796_ch020.qxd

582

5/25/2007

1:22 PM

Page 582


77. Nelson MH, Stein DA, Kroeker AD, Hatlevig SA, Iversen PL, and Moulton HM (2005) Arginine-rich peptide conjugation of morpholino oligomers: effects on antisense activity and specificity. Bioconjugate Chem. 16: 959–966. 78. Moulton, HM, Hase HC, Smith KH, and Iversen PL (2003) HIV Tat peptide enhances cellular delivery of antisense morpholino oligomers. Antisense Nucleic Acid Drug Dev. 13: 32–37. 79. Moulton HM, Nelson MH, Hatlevig SA, Reddy MT, and Iversen PL (2004) Cellular uptake of antisense morpholino oligomers conjugated to arginine-rich peptides. BioConjugate Chem. 15(2): 290–299.

CRC_8796_S005.qxd

4/23/2007

09:31 AM

Page 583

PART

V

Therapeutic Applications

CRC_8796_S005.qxd

4/23/2007

09:31 AM

Page 584

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 585

CHAPTER

21

Potential Therapeutic Applications of Antisense Oligonucleotides in Ophthalmology Lisa R. Grillone and Scott P. Henry

CONTENTS 21.1 Background ..........................................................................................................................585 21.1.1 Classes of Therapeutic Oligonucleotides ...............................................................586 21.1.2 Pharmacokinetics ...................................................................................................587 21.1.3 Tolerability .............................................................................................................588 21.1.4 Pharmacodynamics ................................................................................................589 21.2 Ocular Therapeutic Areas .....................................................................................................591 21.2.1 Antivirals ...............................................................................................................591 21.2.2 Angiogenesis (Neovascular Age-Related Macular Degeneration and Diabetic Retinopathy) .....................................................................................592 21.2.3 Intraocular Inflammation .......................................................................................593 21.2.4 Glaucoma ...............................................................................................................594 21.3 Drug Delivery Options ........................................................................................................595 21.3.1 Formulations (Liposomes, Nanosized Particles) ...................................................595 21.4 Conclusions...........................................................................................................................595 References .....................................................................................................................................596

21.1 BACKGROUND In the past several decades tremendous strides have been made toward understanding the molecular basis of various ocular diseases. Modern day ocular pharmacology provides the basis for utilization of rational drug design targeted toward molecular mechanisms in a plethora of ocular conditions with the ultimate goal of developing effective therapeutics [1]. The application of antisense oligonucleotide (ASO) therapeutics for the treatment of ocular diseases and conditions has tremendous opportunity to add treatment option in ophthalmology. This class of pharmacologic agent has several advantages that exemplify rational drug design principles. There is the potential to target a vast array of genes that specifically inhibit cellular processes. The use of ASOs to treat ocular diseases is limited only by our knowledge of the underlying molecular pharmacology. With advancements in the understanding of the molecular basis for ocular diseases, spawned by new

585

CRC_8796_ch021.qxd

586

5/25/2007

11:28 AM

Page 586


animal and cell-culture models that mimic specific diseases, oligonucleotide therapeutics are well positioned to take advantage of new opportunities in ophthalmology and to address unmet needs. Initial reviews of the state of phosphorothioate oligodeoxynucleotides (PS ODNs), ASOs as ocular therapeutics noted the opportunity for treatments of serious and sight-threatening diseases such as diabetic retinopathy, macular degeneration, glaucoma, uveitis, and retinitis pigmentosa [2,3]. Since that time, research in oligonucleotide therapeutics has expanded and now includes small interfering RNA (siRNA) inhibitors and oligonucleotide aptamers (Chapter 1). The culmination of the last 10 years of research in this area has resulted in the approval of two therapeutic agents for the treatment of ocular conditions, an antisense oligonucleotide and an aptamer [4–6]. The opportunity for the development of ASOs in the treatment of ocular conditions is fortified by the current interest in ophthalmology to treat many “back of the eye” conditions previously untreatable with any therapeutic agent. Although ocular conditions are frequently manifestations of systemic diseases and, as such, may best be treated with systemic administration of therapeutic agents, there are advantages to local administration directly to the eye with a specific tissue as the target (e.g., by intravitreous administration). Nevertheless, there remain hurdles to the use of ASOs to treat ocular diseases. This review will summarize the state of the art in the use of oligonucleotides in ophthalmology, the pharmacokinetics, local tolerability, and will summarize the various classes of oligonucleotide agents along with the fundamental properties that make them good drug candidates. Lastly, a look to the future and the opportunities for targeting a variety of ocular diseases will be presented. 21.1.1 Classes of Therapeutic Oligonucleotides Oligonucleotide therapeutic agents fall into two broad categories. The first includes oligonucleotides that work through an antisense mechanism to inhibit the expression of a specific protein. The inhibition of the production of a targeted protein involved in a disease process results from the hybridization of an oligonucleotide to a single-stranded mRNA molecule and activation of enzyme systems that subsequently degrade the mRNA, inhibit the translation process, or modulate RNA processing [7–10]. The single-stranded ASOs utilize the RNase H enzyme mechanism and are further divided into categories based on chemical modification as described below. To date this first broad category is represented by fomivirsen sodium (Vitravene, Isis Pharmaceuticals, Inc.) approved in the United States and Europe for the treatment of cytomegalovirus (CMV) retinitis in patients with AIDS [4,11–13]. The development of the first antisense oligonucleotide to be approved is covered in more detail in the section of this chapter on antivirals. Also included in this category of antisense oligonucleotides are siRNA inhibitors that function through the RISC-complex mechanism [5]. The second broad category is a class referred to as oligonucleotide aptamers which function through the selection of an oligonucleotide that will interact with a specific soluble protein or cell-surface receptor rather than through hybridization with mRNA. In this case the interaction between aptamer and target is dependent on the conformational structure of the oligonucleotide [14]. The only approved drug in this category is pegaptanib (Macugen, Pfizer, Inc.), a pharmacologic agent for the treatment of neovascular age-related macular degeneration (AMD) [15–17]. Pegaptanib is a 28-base ribonucleic acid aptamer covalently bound to polyethylene glycol, that blocks the activity of the vascular endothelial growth factor (VEGF), specifically VEGF165 [6]. The approval of pegaptanib, ⬃6 years after the approval of fomivirsen, supports the use of oligonucleotides in the treatment of retinal conditions through an intravitreous route of administration. While there are other aptamers with the potential for use as ocular therapeutics, there are not many examples in this category in the published literature. Therefore, this review will focus on the application of antisense inhibitors. The bulk of the experience with antisense inhibitors has been single-stranded agents, specifically PS ODN (Table 21.1). Fomivirsen sodium approved for the treatment of CMV retinitis is representative of this class of compound. Since the time of the approval of fomivirsen, additional

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 587

POTENTIAL THERAPEUTIC APPLICATIONS OF ANTISENSE OLIGONUCLEOTIDES

587

Table 21.1 Structure of Typical PS ODN and 2⬘⬘-MOE ASO Compound

Molecular Target

ISIS 2922 (Fomivirsen) ISIS 13312

Human CMV Human CMV

Sequence (5⬘⬘→ 3⬘⬘) GsCsGsTsTsTsGsCsTsCsTsTsCsTsTsCsTsTsGsCsG GsC*sGsTsTsTsGsC*sTsC*sTsTsC*sTsTsC*sTsTsGsC*sG

Notes: The inhibitors of human CMV (Fomivirsen and ISIS 13312) are presented as examples of the class. C, deoxynucleotide; C*, 5 methyl cytosine; T, 2⬘-methoxyethyl; s, phosphorothioate linkage.

chemical modifications to PS ODN have greatly improved their potency, pharmacokinetic properties, and tolerability profile (Chapter 1). Modified oligonucleotides of this type contain phosphorothioate linkages, but also contain alkoxy substituents on the 2⬘-position of ribose. The most common substituents are either methoxyethoxy (i.e., 2⬘-MOE ASO), and are typically placed on several terminal residues on the 3⬘ and 5⬘ ends of the oligonucleotide, leaving the center residues as deoxyribose sugars (Table 21.1). The modified oligonucleotides that have progressed the most toward therapeutic application are the 2⬘-MOE ASO. Incorporation of the 2⬘-MOE modifications resulted in an increased hybridization affinity and a concomitant increase in potency [18]. In addition, the 2⬘-MOE substituents provide another improvement to these molecules, that is, increased resistance of phosphorothioate linkages to nuclease cleavage [19]. Since the primary route of clearance for PS ODN is exonuclease-mediated degradation, these modifications effectively extend the residence time of oligonucleotides in tissue as described below. The chemical modifications that result in increased residence time in tissue are significant in that there is a clinical benefit to less frequent treatment administration. The final change imparted by the 2⬘-MOE substituents, in combination with 5-methyl cytosine substitution, is to improve the tolerability profile by decreasing the proinflammatory effects, resulting in less toxicity. The consequence of these changes is demonstrated in the ocular pharmacokinetic and tolerability properties discussed below. The siRNA molecules used to date are primarily the typical double-stranded DNA inhibitors that are not stabilized by phosphorothioate linkages or are partially stabilized with the mixture of phosphorothioate and 2⬘-alkoxy modifications, such as 2⬘-methoxy. The successful in vivo application of these inhibitors has been limited to date, because of issues with metabolic stability and cell uptake. Most in vivo applications have used some sort of formulation to protect and facilitate cellular uptake [20]. However, the activity of these siRNA inhibitors in vitro is impressive and local application to the eye in sufficient amounts to produce pharmacological effects appear possible. Further, advances in medicinal chemistry will likely enable this very important class of antisense inhibitor to become viable therapeutic agents. Additional research into oligonucleotide modification that replace the carbohydrate backbone all together using peptide nucleic acid or morpholino chemistry are also being performed, but will not be reviewed herein [21,22]. 21.1.2 Pharmacokinetics While the ability of ASO or siRNA to inhibit the specific target and affect a disease process is important, it is equally important, especially for platform technologies such as antisense inhibitors, that the compounds have favorable pharmacokinetic and tolerability profiles to be effective therapeutic agents. Delivery of the oligonucleotides to the necessary site of action must also be considered, both with respect to tissue and cell type. The majority of the ocular experience with these compounds has targeted treatment of the posterior ocular segment using intravitreous administration. However, by varying the method of application or route of administration of oligonucleotides to the eye, it is possible to target other ocular tissues and regions. Thus, one must characterize the distribution and pharmacokinetic properties with a specific focus on the unique aspects of each application. For the antisense mechanism to work, the oligonucleotide must be taken up into cells that express the target mRNA and protein [23]. Documentation of tissue distribution and cellular uptake are readily addressed for PS ODN and 2⬘-MOE ASO using available analytical techniques [24,25].

CRC_8796_ch021.qxd

5/25/2007

588

11:28 AM

Page 588


This is more difficult, but no less important, for siRNA inhibitors because of their lower degree of stability. For PS ODN and 2⬘-MOE ASO, the mechanism of cellular uptake is not well defined, but internalization of oligonucleotides does occur [26–28]. Studies in rabbits, monkeys, and pigs have shown that intravitreous injection of both PS ODN and 2⬘-MOE ASO have very favorable distribution and clearance patterns for treating ocular disease [29–32]. The kinetics of fomivirsen in rabbits, monkeys, and humans was characterized by slow clearance from vitreous and distribution to retina [29,30,33]. The pharmacokinetic properties of 2⬘-MOE ASO have been shown to be very similar to PS ODN [34]. In the eye specifically, immunohistochemical staining of retina following a single intravitreous administration of PS ODN and 2⬘-MOE ASO revealed extensive and similar distribution to most ocular tissues in proximity to the vitreous [31]. Cell types in the eye that contained 2⬘-MOE ASO following intravitreous injection included outer plexiform layer, outer limiting membrane, inner plexiform layer, ganglion cells, ciliary body, iris, retinal-pigmented epithelium, and optic nerve. Similar results are reported for fluorescent-labeled oligonucleotides [35]. This distribution profile potentially supports treatment of many types of posterior segment ocular diseases, including ocular infection, inflammation, neovascular disease, or other metabolic and functional abnormalities. Once in retinal cells, PS ODN or 2⬘-MOE ASO are cleared slowly relative to clearance from vitreous. The half-life of PS ODN in monkey retina is ⬃3–7 days [30]. This slow clearance was the basis of the once monthly dose regimen approved for the use of fomivirsen in the treatment of CMV retinitis. By comparison, the clearance of 2⬘-MOE-modified oligonucleotides is much slower than for phosphorothioate oligodeoxynucleotides. The half-life for ISIS 13312 (a 2⬘-MOE-modified oligonucleotide with the same sequence as fomivirsen, Table 21.1) in monkey retina was on the order of 2 months compared to 3–7 days [31]. This resulted in significant accumulation in retina with once-monthly dosing, and retinal concentrations that were considerably higher than those achieved with PS ODN. The slower clearance from retina of the 2⬘-MOE ASO may be exploited to extend the dose frequency to once every 3–6 months. The durability of effect in the retina still needs to be investigated for 2⬘-MOE ASO, but a close pharmacodynamic correlation between activity and oligonucleotide concentration in tissue has been established for systemic target organs [36,37]. Infrequent intravitreal administration would allow for the consideration of treatment of chronic ocular diseases. The ocular pharmacokinetics for siRNA are not as well characterized to date. The half-life appears to be far shorter than for 2⬘-MOE ASO because the siRNA molecules are not stabilized against nuclease degradation to the same degree. However, while the residence time in cells will be shorter, an impressively long duration of action has been reported for siRNA in cells [38]. Exactly how this will translate into duration of action in the clinical setting is not known but will be revealed overtime in nonclinical and clinical studies. The pharmacokinetic considerations for oligonucleotide aptamers, such as Macugen, are quite different from antisense inhibitors. Most notable is that the aptamer oligonucleotides do not need to enter the cells, and instead interact outside of the cells, binding to receptors or soluble factors such as cytokines, or growth factors. Obviously the vitreal kinetics are more important for the ocular therapeutic application of aptamers. In the case of Macugen the dose interval is once every 6 weeks, which likely reflects the clearance rate from vitreous. 21.1.3 Tolerability In addition to optimizing the ocular kinetics for therapy, the tolerability of agents administered directly into the eye is very important. The experience gained thus far from the approval of Vitravene (fomivirsen) and Macugen (pegaptanib) and the effect of pegaptanib on macular edema and retinal neovascularization in patients with diabetes clearly demonstrates that oligonucleotide therapy administered by intravitreous injection can be well tolerated [4,6,11–13,15,39,40]. With the

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 589


589

publication of specific guidelines for the delivery of drugs via intravitreous injection to reduce risks [41] and with the approval of the third therapeutic agent, Lucentis (ranibizumab), administered via this route [42], there is sufficient evidence that this is a reasonable route for administration of ocular therapeutics. Modifications made to 2⬘-MOE ASO have also improved the tolerability of oligonucleotides in animals relative to PS ODN (for review, see Chapter 12). The primary source of ocular toxicity for PS ODN is a proinflammatory reaction [31,43]. Ocular inflammation is particularly evident in rabbits, and best characterized by infiltrating cells in the vitreous and the anterior chamber. This proinflammatory reaction to PS ODN is an effect common to most oligonucleotides in this class, and is also observed with systemic administration in mice, rats, and rabbits [44]. Although proinflammatory effects are not an antisense effect of the oligonucleotide, specific sequence motifs that contain cytosine–guanosine dinucleotide motifs (CpG) contribute to the inflammatory response [45]. There is a difference in species sensitivity to this reaction, which is greatest in rodents and seen to a lesser degree in primates. While some proinflammatory effect was seen in clinical studies of fomivirsen, the effect was relatively mild, transient, and well managed by the use of topical corticosteroids [4,12,13]. The compound selection and chemical modifications made to 2⬘-MOE ASO have greatly reduced the proinflammatory activity of these so-called second-generation oligonucleotides. Avoiding the CpG dinucleotide motifs and incorporation of the 2⬘-MOE modifications have combined to reduce the interaction with the primary receptor on monocytes and dendritic cells responsible for triggering the proinflammatory effects. Substitution of cytosine with 5-methyl cytosine residues also reduces the proinflammatory effects of oligonucleotides [46]. These modifications appear to combine to decrease the potency of immune stimulation relative to PS ODN [43,47]. These modifications result in an improved ocular tolerability profile for 2⬘-MOE ASO, despite the higher retinal concentrations. The primary evidence of increased ocular tolerability of 2⬘-MOE ASO has been the observation of little or no ocular inflammation in rabbit following intravitreal injection. The primary effect in the eye associated with repeated intravitreous injections of 2⬘-MOE ASO appears to be the development of faint lens opacities at high doses or with frequent administration. These occur at the posterior surface of the lens in a dose- and time-dependent fashion consistent with accumulation of the oligonucleotide. The histologic appearance of the opacities on the lens surface supports the hypothesis that these are related to oligonucleotide accumulation. This effect has only been observed at high doses when the oligonucleotide is administered on a monthly dose regimen, far more frequent than would be anticipated in the clinic based on pharmacokinetic properties, and therefore accumulation is occurring. Lens opacities were avoided by using lower doses or less frequent administration in pharmacology and toxicology studies. Thus, 2⬘-MOE ASO appear to have favorable ocular safety and pharmacokinetic profiles for the treatment of a number of ocular diseases. There appears to be no information in the published literature on the ocular tolerability of siRNA inhibitors, however, Phase 1 and 2 clinical studies were recently completed for the two compounds currently in development. There have been no reports of issues with ocular irritation or functional abnormalities. It is expected that siRNA would be well tolerated in the eye since there is little opportunity for accumulation and the oligonucleotide will be readily cleared. However, siRNA compounds have been associated with proinflammatory effects, much like PS ODN and 2⬘-MOE ASO [48]. As a result, one must be vigilant to the possibility of proinflammatory effects, and each sequence will need to be thoroughly characterized. 21.1.4 Pharmacodynamics To efficiently utilize a platform technology for either mechanistic or therapeutic purposes, it is important to understand the dose, pharmacokinetic, and activity correlations. By and large, the tissue distribution and kinetic behavior of ASO have proved to be independent of sequence. If these

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 590

590


properties are well understood for the desired application, then this knowledge can be used to greatly improve the efficiency of properly designed experiments. For PS ODN and 2⬘-MOE ASO it is relatively straightforward to measure concentrations of oligonucleotide in dissected tissues. There are also approaches that can be used to reveal what cell types take up the oligonucleotide. The characterization of cellular uptake and elimination half-lives following intravitreous injection of both PS ODN and 2⬘-MOE ASO was presented above. For pharmacologic application, the subsequent characterization of a dose and tissue concentration that will produce efficacy is important. These pharmacodynamic relationships have been defined in liver for several specific targets following systemic administration. While there is obviously some variability, the general pharmacodynamic relationships are reasonably consistent even with respect to the relationship between tissue clearance and the durability of activity. This is important with a compound that has a long half-life in tissue. In cases where oligonucleotide concentration in liver has been correlated with target mRNA levels, the rate of clearance is very close to the reversibility of pharmacologic effect. In the eye, these types of relationships can also be studied. Preliminary characterization of a 2⬘-MOE ASO inhibitor of ERK-6 in mice suggests that there is a correlation between exposure and effect that was time- and dose-dependent (Figure 21.1).

ERK6 mRNA in retina PBS 140

ERK6

ERK6 mRNA (% PBS treatment)

120 100 80 60 40 20 0

0.3

1

3

10

ASO (µg)

Oligonucleotide concentration in retina

Concentration (µg/g)

100 80 60 40 20 0 10

1

3

0.3

ASO (µg) Figure 21.1 Dose-dependent reduction of ERK-6 mRNA is correlated with increase in retina oligonucleotide concentration.

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 591


591

21.2 OCULAR THERAPEUTIC AREAS 21.2.1 Antivirals The local application of ASO inhibitors for the treatment of viral infections in the eye has proved beneficial. The eye and surrounding structures are potential targets for viruses, either by direct infection at the cellular level or by ocular manifestations of systemic diseases as in the case of CMV retinitis. Because viruses must depend on the machinery of the host cell for replication they are virtually the ideal targets for the development of ASO therapeutic agents, particularly in the eye. Virally encoded proteins make excellent targets for ASOs and have been considered as viable potential targets in the development of ASOs as antiviral therapeutic agents in general [49]. Importantly, viral diseases of the posterior and anterior segments of the eye remain prevalent, often sight threatening, and in need of new treatments. The number of antiviral agents available to treat ocular infections is somewhat limited and even for those agents in use, the development of resistance remains a challenge. As an example, the prevalence of and growth in the number of patients with the acquired immune deficiency syndrome (AIDS) in the late 1980s and 1990s leads to the increasing prevalence of opportunistic infections, such as, CMV retinitis. The development of ASOs to target specific viral proteins provides several advantages over traditional antiviral drugs. First, unlike traditional drugs that bind not only to the targeted protein but also to other proteins, ASOs are highly selective and specific [50]. Thus, selection of a unique target in combination with a unique mechanism of action is likely to result in a therapeutic agent with significantly less likelihood of inducing resistance. The development of fomivirsen exemplifies the therapeutic utility of an ASO and demonstrates that an ASO can be delivered directly into the eye with a good benefit to risk profile even in the face of repeated intravitreous injections over the course of several months to years [12,13]. Fomivirsen is a first-generation ASO, a PS ODN that is specific for the immediate early region 2 (IE2) of the human CMV virus [51]. The reduction of the expression of the immediate early viral proteins by fomivirsen demonstrates a mechanism of action consistent with the antisense theory and mechanism of action. The targeted region is unique to CMV and selective inhibition of the IE proteins results in a highly effective antiviral agent. A second-generation ASO with the identical sequence as fomivirsen, ISIS 13312, is a 2⬘-MOE ASO that has been shown to have antiviral activity comparable to fomivirsen in fibroblasts and retinal pigment epithelial cells [31,52]. Both fomivirsen and ISIS 13312 demonstrated comparable and consistent antiviral activity with the IC50 between 0.1 and 1.0 M. The advantage derived from the 2⬘-MOE-modified ASO ISIS 13312 was evident following single and multiple intravitreous injections in rabbit and monkey eyes. The modification, as described earlier in this chapter, resulted in a longer residence time and better local ocular tolerability. While a Phase 2a clinical study to investigate the efficacy of ISIS 13312 was initiated, the program was discontinued following a significant decrease in the number of patients with CMV retinitis as a result of the introduction of the “triple cocktail” antiretroviral drugs [53]. Other viruses that manifest as an ocular condition in the anterior segment include herpes simplex (HSV), Varicella–Zoster (VZV), Epstein–Barr (EBV) and adenovirus. Among these, HSV-1 is commonly associated with ocular infections and is the leading cause of corneal blindness. Targeting HSV-1 is yet another opportunity for ASOs as therapeutic agents that has not been fully developed for ophthalmology. There are a variety of sites on the HSV-1 genome that are likely to play a critical role in viral replication including IE and early genes. As well there are a variety of ASO chemical modifications that have been designed to specifically inhibit a variety of targets and which have resulted in varying degrees of success discussed earlier in this chapter. All of the published information to date is based on in vitro cell assays and animal studies with no application to date in clinical studies. Nevertheless, the data strongly suggest that there is an opportunity to target both single and multiple genes, in some instances with synergistic effects.

CRC_8796_ch021.qxd

592

5/25/2007

11:28 AM

Page 592


ASOs modified as methylphosphonates designed to target the splice junction and splice donor site of the HSV-1 IE-pre-mRNA 4 and 5 and to the translation initiation site of IE4 mRNA [54–57] used in cell assays as well as in a mouse ear and footpad model of HSV infection [56]. The antiviral effect when ASO-methylphosphonates are targeted to multiple sites (e.g., IE1 and IE4) has been studied in cell-culture assays and the findings suggest that there is the potential for synergistic antiviral activity [58]. Other ASO modifications designed to target specific regions of the HSV-1 gene have been evaluated, including a second-generation 2⬘-O-methylribonucleoside containing alternating methylphosphate/phosphodiester linkages. The in vitro activity in rabbit corneal epithelial cells and keratocytes infected with HSV-1 has been investigated with just such a modified ASO [59]. This second-generation ASO has a chimeric backbone with alternating methylphosphate/phosphodiester linkages and is targeted to a splice junction region of the HSV IE68 and IE12 gene. The results suggest potent antiviral activity in vitro in a dose-dependent manner that was sequence-specific. Thus, careful selection of both sequence-specific target, perhaps even including multiple targets, and the appropriate modification that may reduce cytotoxicity and enhance cellular uptake combine to play a significant role in the control of antiviral replication and open the way as a novel approach to treating viral infections in the eye. 21.2.2 Angiogenesis (Neovascular Age-Related Macular Degeneration and Diabetic Retinopathy) A good deal of the research into molecular mechanisms of ocular disease is focused on ocular neovascularization since diabetic retinopathy (retinal neovascularization) and neovascular AMD (choroidal neovascularization) are among the most prevalent causes of blindness [60]. Although all neovascular diseases are complex processes, involving multiple growth factors, proliferation of vascular endothelium, and differentiation, much of the attention of ocular disease is focused on the role of VEGF in this process [61,62]. It has been shown that VEGF expression is increased in ocular angiogenesis [62,63], and inhibition of VEGF signaling using a soluble oligonucleotide aptamer (e.g., Macugen) or a monoclonal antibody fragment (Lucentis) have recently been approved for treatment of neovascular AMD [6,15,17,64]. This recent experience both demonstrated the utility and tolerability of oligonucleotide-based therapeutics in the eye, and also confirmed the acceptability of intravitreous injection as a viable route of administration for chronic ocular disease. Inhibition of VEGF or VEGF-receptor expression have been targeted using antisense therapy as well, among other potential targets in the angiogenesis cascade. Based on the pharmacokinetic properties described above, they have the opportunity to be administered less frequently than current therapies. This durability of activity for PS ODN inhibitors targeting VEGF (i.e., more than 2 months) has been demonstrated in rat models of choroidal neovascularization when administered with a dendrimer formulation [65,66]. While single-stranded antisense inhibitors of VEGF expression have been reported, the most progress in the last few years has been with siRNA inhibitors [67]. Of the two siRNA compounds currently in development one is targeted to the VEGF receptor while the other is targeted to VEGF expression itself [68,69]. The siRNA targeting VEGF-R1 clearly demonstrated inhibition of target mRNA by 50% that corresponded with a 50% decrease in neovascular area in a mouse model of laser-induced CNV [68]. This work also demonstrated the presence of inhibitor in the retina for 5 days. The Phase 1 clinical trial for the VEGF-R1 siRNA (Sirna-027; Sirna Therapeutics, Inc.) was initiated in November 2004. Subjects were treated with a single intravitreous injection at doses between 100 and 1600 g with safety evaluations up to 15 months. Phase 1 trial has also been conducted for the siRNA targeting VEGF (Cand5; Acuity Pharmaceuticals, Inc.). In this trial, Cand5 was administered to 15 subjects as an intravitreous injection with doses ranging from 100 to 3,000 g per eye. Tolerability was good in Phase 1 studies, and repeat-dose-randomized, masked, controlled Phase 2 studies are being conducted for both these siRNA inhibitors (from presentation by P. Kaiser, Retinal Physician 2006 Symposium, Bahamas).

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 593


593

In addition to diabetic retinopathy and neovascular AMD, these VEGF inhibitors may also be studied for other types of ocular angiogenesis. For example, a PS ODN targeted against VEGF has shown efficacy in a monkey model of iris neovascularization, and both PS ODN and siRNA have shown efficacy in rodent models of corneal neovascularization [68,70]. Another approach to inhibiting VEGF action using ASO is to inhibit a downstream component of the signaling cascade. As it turns out, both bFGF and VEGF signal through the MAP kinase cascade, which includes raf kinase [71,72]. Raf kinase activation following VEGF stimulation was confirmed in human endothelial cells [73]. More recently it has been reported that other factors such as erythropoietin [74] and hepatocyte growth factor [75] may play a major role in the etiology of diabetic macular edema and diabetic retinopathy. Thus, affecting a downstream target such as C-raf kinase may be a more effective strategy in that targeting multiple growth factors (much like a combination drug in one product approach) rather than targeting the individual growth factors themselves. A 2⬘-MOE antisense inhibitor of C-raf kinase has been investigated in a pig model of venous-occlusion retinal neovascularization and shown to decrease retinal neovascularization with good tolerability [32]. This compound is expected to enter Phase 1 clinical trials in 2007 (iCo-007; iCo Therapeutics, Inc.), initially targeting diffuse diabetic macular edema. Other ASO targeting MAP kinase pathways (e.g., B-raf kinase and FAK) have also shown promising activity in a rabbit model of angiogenesis initiated by VEGF [76]. Inhibiting a common component of the signaling cascade for both bFGF and VEGF in this manner has proved effective for small molecule inhibitors as well, and may increase the likelihood of antiangiogenic activity by eliminating the possible signaling through redundant pathways [77,78]. 21.2.3 Intraocular Inflammation Inflammation of the uveal tract (iris, ciliary body, and choroid) is termed uveitis and is a potentially blinding condition that may result from trauma or injury to the eye, invasive infectious agents (e.g., viral infection) or autoimmune reactivity and can affect the anterior chamber and/or vitreous cavity. Although several animal models exist and have been key in our understanding of uveitis there have been relatively few instances where the effects of ASO have been evaluated in these models. Still the opportunity for ASO therapy is significant given the number of antiinflammatory strategies that have been studied (see Chapter 24). For example, within the eye the expression of intracellular adhesion molecules (e.g., ICAM-1, ICAM-2), P-selectin, vascular adhesion molecule (VCAM-1) and the subsequent induction of cytokines play a critical role in the ocular immune response [79,80]. Blocking the expression or function of these adhesion molecules with either local or systemic administration could interfere with the inflammatory process. HSV infection was discussed above in the context of ocular antiviral targets; however, another aspect of viral infections of the eye is the resultant devastating ocular inflammation. A discussion of the inflammatory component of HSV infection includes the diagnoses of blepharitis, scleritis, keratitis, and anterior uveitis to name a few. The cytokines that play a role in the inflammatory response to viral infection include IL-2 and tumor necrosis factor (TNF)-. Topical application of a specific ASO targeted at TNF- mRNA may provide an advantageous local treatment for corneal inflammation in this scenario. Demonstration of the effectiveness of an anti-TNF- ASO in the downregulation of this proinflammatory cytokine in cell culture and an infected mouse corneal model supports the potential of ASO as antiinflammatory agents. Not only were these authors able to demonstrate significant decrease in the secretion of TNF- from the cells in culture and mouse cornea, but this may be the first evidence that administration of an ASO via a subepithelial injection to the cornea is a safe method which also allows for multiple injections [81]. Others have evaluated the potential of ASO to downregulate NOSII in a rat model of endotoxininduced uveitis [82]. To enhance intraocular delivery to the appropriate target cell type these investigators used iontophoresis. In this model significant levels of ASO were observed in the iris and ciliary body within 1 h after delivery of the ASO via iontophoresis and with time, levels in the retina and

CRC_8796_ch021.qxd

5/25/2007

594

11:28 AM

Page 594


choroid were also observed. NOSII mRNA levels were decreased in iris and ciliary body compared with saline control and control oligonucleotides, and there was a concomitant decrease in nitrate production that was sequence-specific [82]. Thus, ASO treatment was associated with antiinflammatory effect in rats, but whether this method of delivery is viable in the clinic remains to be seen. The opportunity for treatment of ocular inflammation has had only limited investigation. It would seem that ocular manifestations of infection and immune-mediated inflammation are in need of intense study with ASO therapeutics targeted to any number of proteins. 21.2.4 Glaucoma Glaucoma is another leading cause of blindness, but very little work with antisense inhibitors has been focused on this particular ocular condition [2]. Glaucoma is a complex pathology with several different approaches to treatment that may be amenable to antisense therapy. The greatest areas of need in the management of glaucoma are treatments that limit the damage to the neurosensory retina caused by elevated pressure that ultimately leads to blindness, [83] an approach called neuroprotective therapy. Nueroprotection in the management of glaucoma is a complex multifactorial process making investigative studies difficult. To date the only clinical studies in this area are the memantine trials that are nearing completion [83,84]. One proposed mechanism of blindness is retinal ganglion cell death caused by chronic increased ocular pressure. Regulating expression of genes in retinal ganglion cells are thus of interest, and there are reports of in vitro and in vivo uptake and activity of antisense inhibitors (both single strand ASO and siRNA) in this cell type. Although not specific to the treatment of glaucoma, the examples of antisense activity in vitro in retinal ganglion cells include the demonstration of uptake and decreased expression of targets such as optinuerin and OPA1 in RCG-5 cells treated with siRNA inhibitors [85,86]. The ability to deliver PS ODN by intravitreous injection to retinal ganglion cells in vivo, and affect target mRNA level and ocular processes has also been demonstrated in rabbit targeting kinesin and in rats targeting kynurenine aminotransferase II [87–89]. These data demonstrate the opportunity to affect retinal ganglion cell physiology with ASO inhibitors. With advances in the understanding into the mechanism of apoptosis, ASO may be used to inhibit cell death. For example, intravitreous injection of a PS ODN ASO inhibitor of bax, a pro-apoptotic protein, did reduce ganglion cell death in a rodent model of neurodegeneration [90]. The control of ocular pressure using ASO is another potential approach to treat glaucoma. The opportunity exists because of the uptake of oligonucleotide in ciliary epithelium and trabecular meshwork cells. The issue with IOP control is whether there is the medical need for additional therapies given the efficacy of topically applied medicines. Nonetheless, recently investigators have provided preliminary reports of successful use of siRNA inhibitors to regulate ocular pressure by targeting either - or -adrenoreceptors, or carbonic anhydrase [91,92]. ASO inhibitors might also prove useful as an adjuvant to glaucoma filtration surgery. One of the methods of glaucoma therapy is to provide a shunt that drains the anterior chamber, and thus, controls ocular pressure. The primary limitation of this surgery is scarring and fibrous buildup in subconjunctival and tenon membranes that blocks aqueous flow and leads to failure of the shunt. Scar formation in the eye is thought to be mediated in large part by TGF-, and a monoclonal antibody inhibitor of TGF-2 has been shown to inhibit proliferation and migration of fibroblasts [93]. Experiments using an ASO inhibitor of TGF-1 and 2 in a mouse model of glaucoma surgery demonstrated a significant reduction in the conjunctival scar formation and increased survival of filtration bleb compared to a control oligonucleotide [94]. In this model, the ASO was injected subconjunctivally directly into the filtration bleb, and oligonucleotide uptake into fibroblasts, epithelial cell, and macrophages was confirmed by immunohistochemical staining. These results were confirmed along with improvement in efficacy and duration of activity when anti-TGF-2 PS ODNs were formulated with polyethylenamine [95]. In this case the PS ODN alone was effective, but the formulated material appeared to be taken up in target cell types to a greater degree. The opportunity

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 595


595

to replace the use of mitomycin C in this surgical procedure is significant, and is an interesting application of antisense inhibitors in that it uses a method of administration that is less invasive even than intravitreous injection and illustrates the opportunity for topical application for anterior ocular indications.

21.3 DRUG DELIVERY OPTIONS Antisense inhibitors and other oligonucleotide therapeutics are showing promise in the treatment of ocular diseases and conditions, but in order for them to reach their full potential and optimal safety profile, alternatives to intravitreous injections must be developed, particularly for those agents expected to treat chronic conditions that affect the retina. Preliminary work has been done with nonintravitreal routes of administration, which indicate that periorbital administration can achieve the necessary retinal concentrations for inhibition of target gene expression. The sclera is a relatively porous structure composed primarily of collagen and glycosaminoglycans, and is largely acellular [96]. Thus, transscleral delivery of drugs is a viable alternative to intravitreal injection [97]. In fact, transscleral absorption of macromolecules such as a 70-kDa dextran and a monoclonal antibody for ICAM-1 has been demonstrated using subconjunctival injection or infusion [98,99]. The permeability of sclera to ASO has been studied using iontophoresis as a way to direct the charged molecules across various ocular barriers. Iontophoresis has been shown to facilitate penetration into all layers of the cornea, and into both epithelial and endothelial cells [100]. Iontophoresis of PS ODN targeted against NOSII was also used to penetrate the corneoscleral barrier to effectively reduce expression and inflammation in endotoxin-induced uveitis model [82]. Development of a convenient and reliable nonintravitreal route of administration would greatly increase the therapeutic utility of ASO and appears possible. 21.3.1 Formulations (Liposomes, Nanosized Particles) The need for formulations in the application of oligonucleotides will depend on the type of inhibitor and the nature of the application. Certainly less frequent administration to the eye is preferable regardless of whether the route is intravitreous injection or subtenon injection. Still for some oligonucleotide therapeutics, such as 2⬘-MOE ASO where the site of action of the drug is in cells and the half-life in tissues is on the order of 2 months, sustained release formulations may not be necessary for the therapeutic application. In other contexts such as siRNA that are rapidly degraded or oligonucleotide aptamers that operate outside the cells, a formulation approach might be beneficial. There are a number of formulation strategies that have been used in ocular administration of ASO in the eye, including dendrimers, PLGA microspheres, liposomes, and polyethylenimine [66,95,101–103]. In most cases, the ASO studied were PS ODN and formulations enhanced the retinal absorption of ASO. In the case of a VEGF ASO formulated with dendrimer, the duration of action was reported to be greater than 2 months in a rat model of choroidal neovascularization [65]. These investigators also report good ocular tolerability in all cases. Still, it has already been demonstrated that formulations of oligonucleotide therapeutics are not necessarily needed [4,15]. However, in applications where it provides some advantage to the controlled delivery, these technologies appear to be compatible with ocular pharmacology.

21.4 CONCLUSIONS Much progress has been made in the last few years in the application of oligonucleotide therapeutics to the eye. This approach to treating ocular disease is attractive in that the local delivery of oligonucleotides results in distribution to numerous ocular cell types. The tolerability of these

CRC_8796_ch021.qxd

596

5/25/2007

11:28 AM

Page 596


molecules is good, and the opportunity for long residence time, and thus infrequent administration, affords the desirable properties for treating ocular disease. With continued success of the VEGF siRNA development programs, it is expected that application of antisense inhibitors will expand in scope over the next few years.

REFERENCES 1. Williams, P. B., Crouch, E. R., Jr., Sheppard, J. D., Jr., Lattanzio, F. A., Jr., Parker, T. A., and Mitrev, P. V., The birth of ocular pharmacology in the 20th century, J. Clin. Pharmcol. 40 (9), 990, 2000. 2. Henry, S. P. and Danis, R. P., Potential therapeutic application of antisense oligonucleotides in the treatment of ocular diseases, Expert Opin. Pharmacother. 2 (2), 277, 2001. 3. Henry, S. P., Marcusson, E. G., Vincent, T. M., and Dean, N. M., Setting sights on the treatment of ocular angiogenesis using antisense oligonucleotides, Trends Pharmacol. Sci. 25 (10), 523, 2004. 4. Perry, C. M. and Barman Balfour, J. A., Fomivirsen, Drugs 57 (3), 375, 1999. 5. Chiu, Y.-L., Dinesh, C. U., Chu, C.-Y., Ali, A., Brown, K. M., Cao, H., and Rana, T. M., Dissecting RNA-interference pathway with small molecules, Chem. Biol. 12 (6), 643, 2005. 6. Gragoudas, E. S., Adamis, A. P., Cunningham, E. T., Jr., Feinsod, M., and Guyer, D. R., Pegaptanib for neovascular age-related macular degeneration, N. Engl. J. Med. 351 (27), 2805, 2004. 7. Bennett, C. F., Butler, M., Cook, P. D., Geary, R. S., Levin, A. A., Mehta, R., Teng, C.-L., Deshmukh, H., Tillman, L., and Hardee, G., Antisense oligonucleotide-based therapeutics, in Gene Therapy, Templeton, N. S. and Lasic, D. D. Marcel Dekker, Inc., New York, 2000, p. 305. 8. Crooke, S. T., Molecular mechanisms of action of antisense drugs, Biochem. Biophys. Acta 1489 (1), 31, 1999. 9. Agrawal, S. and Kandimalla, E. R., Antisense therapeutics: Is it as simple as complementary base recognition, Mol. Med. Today 6 (2), 72, 2000. 10. Crooke, S. T., Basic principles of antisense therapeutics, in Antisense Research and Applications, 1st ed., Crooke, S. T., ed., Springer, Berlin, 1998, p. 1. 11. Crooke, S. T., Treatment of retinitis induced by cytomegalovirus using intravitreal formivirsen (ISIS 2922), in Clinical Trials of Genetic Therapy with Antisense DNA and DNA Vectors, Wickstrom, E., ed., Marcel Dekker, New York, 1998, p. 353. 12. The Vitravene Study Group, Safety of intravitreous fomivirsen for treatment of cytomegalovirus retinitis in patients with AIDS, Am. J. Ophthal. 133 (4), 484, 2002. 13. The Vitravene Study Group, Randomized dose-comparison studies of intravitreous fomivirsen for treatment of cytomegalovirus retinitis that has reactivated or is persistently active despite other therapies in patients with AIDS, Am. J. Ophthal. 133 (4), 475, 2002. 14. Stull, R. A. and Szoka, F. C. J., Antigene, ribozyme and aptamer nucleic acid drugs: Progress and prospects, Pharm. Res. 12 (4), 465, 1995. 15. Tobin, K. A., Macugen treatment for wet age-related macular degeneration, Insight 31 (1), 11, 2006. 16. Zhou, B. and Wang, B., Pegaptanib for the treatment of age-related macular degeneration, Exp. Eye. Res. 83 (3), 615, 2006. 17. Ng, E. W., Shima, D. T., Calias, P., Cunningham, E. T., Jr., Guyer, D. R., and Adamis, A. P., Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease, Nat. Rev. Drug Discov. 5 (2), 123, 2006. 18. Dean, N. M., Madeline, B., Monia, B. P., and Muthiah, M., Pharmacology of 2⬘-o-(2-methoxy)ethyl modified antisense oligonucleotides, in Antisense Drug Technology: Principles, Strategies, and Applications, Crooke, S. T., ed., Marcel Dekker, New York, 2001, p. 319. 19. Geary, R. S., Mathison, B., Ushiro-Watanabe, T., Savides, M. C., Henry, S. P., and Levin, A. A., Second generation antisense oligonucleotide pharmacokinetics and mass balance following intravenous administration in rats, in Society of Toxicology, Oxford University Press, San Francisco, CA, 2001, p. 343. 20. De Fougerolles, A., Manoharan, M., Meyers, R., and Vornlocher, H.-P., RNA interference in vivo: toward synthetic small inhibitory RNA-based therapeutics, Methods Enzymol. 392, 278, 2005. 21. Nielsen, P. E., Peptide nucleic acids (PNA): potential antiviral agents, Int. Antiviral News 1 (3), 37, 1993.

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 597


597

22. Summerton, J., Morpholino antisense oligomers: the case for an RNase H-independent structural type, Biochim. Biophys. Acta 1489, 141, 1999. 23. Crooke, S. T., Antisense technology, Curr. Opin. Biotechnol. 2, 282, 1991. 24. Geary, R. S., Matson, J., and Levin, A. A., A nonradioisotope biomedical assay for intact oligonucleotide and its chain-shortened metabolites used for determination of exposure and elimination half-life of antisense drugs in tissue, Anal. Biochem. 274 (2), 241, 1999. 25. Yu, R. Z., Geary, R. S., and Levin, A. A., Application of novel quantitative bioanalytical methods for pharmacokinetic and pharmacokinetic/pharmacodynamic assesments of antisense oligonucleoutides, Curr. Opin. Drug Discov. Dev. 7 (2), 195, 2004. 26. Graham, M. J., Crooke, S. T., Monteith, D. K., Cooper, S. R., Lemonidis, K. M., Stecker, K. K., Martin, M. J., and Crooke, R. M., In vivo distribution and metabolism of a phosphorothioate oligonucleotide within rat liver after intravenous administration, J. Pharmacol. Exp. Ther. 286 (1), 447, 1998. 27. Butler, M., Stecker, K., and Bennett, C. F., Histological localization of phosphorothioate oligodeoxynucleotides in normal rodent tissue, Nucleosides Nucleotides 16 (7–9), 1761, 1997. 28. Butler, M., Stecker, K., and Bennett, C. F., Cellular distribution of phosphorothioate oligodeoxynucleotides in normal rodent tissues, Lab. Invest. 77 (4), 379, 1997. 29. Leeds, J. M., Henry, S. P., Truong, L., Zutsi, A., Levin, A. A., and Kornbrust, D. J., Pharmacokinetics of a potential human cytomegalovirus therapeutic, a phosphorothioate oligonucleotide, after intravitreal injections in the rabbit, Drug Metab. Dispos. 25 (8), 921, 1997. 30. Leeds, J. M., Henry, S. P., Bistner, S., Scherrill, S., Williams, K., and Levin, A. A., Pharmacokinetics of an antisense oligonucleotide injected intravitreally in monkeys, Drug Metab. Dispos. 26 (7), 670, 1998. 31. Henry, S. P., Miner, R. C., Drew, W. L., Fitchett, J., York-Defalco, C., Rapp, L. M., and Levin, A. A., Antiviral Activity and Ocular Kinetics of Antisense Oligonucleotides Designed to Inhibit CMV Replication, Invest. Ophthalmol. Vis. Sci. 42 (11), 2646, 2001. 32. Danis, R. P., Criswell, M. H., Orge, F., Wancewicz, E., Stecker, K., Henry, S. P., and Monia, B. P., Intravitreous anti-raf-1 kinase antisense oligonucleotide as an angioinhibitory agent in porcine preretinal neovascularization, Curr. Eye Res. 26 (1), 45, 2003. 33. Grillone, L. R., The development of antisense oligonucleotides as antivirals, in Antisense Drug Technology, Crooke, S. T., ed., Marcel Dekker, New York, 2001, p. 725. 34. Geary, R. S., Yu, R. Z., Watanabe, T., Henry, S. P., Hardee, G. E., Chappell, A., Matson, J., Sasmor, H., Cummins, L., and Levin, A. A., Pharmacokinetics of a tumor necrosis factor-alpha phosphorothioate 2⬘-O-(2-methoxyethyl) modified antisense oligonucleotide: comparison across species, Drug Metab. Dispos. 31 (11), 1419, 2003. 35. Rakoczy, P. E., Lai, M. C., Watson, M., Seydel, U., and Constable, I., Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect, Antisense Nucleic Acid Drug Dev. 6 (3), 207, 1996. 36. Yu, R. Z., Geary, R. S., Butler, M., Booten, S., McKay, R., Bhanot, S., Monia, B., and Levin, A. A., Pharmacodynamics of a 2⬘-MOE Modified Antisense Oligonucleotide Targeting to PTEN mRNA in Diabetic Mouse and Rat Model, in Annul Meeting of American Association of Pharmaceutical Scientists, Toronto, Canada, 2002. 37. Yu, R. Z., Zhang, H., Geary, R. S., Graham, M., Masarjian, L., Lemonidis, K., Crooke, R., Dean, N. M., and Levin, A. A., Pharmacokinetics and pharmacodynamics of an antisense phosphorothioate oligonucleotide targeting Fas mRNA in mice, J. Pharmacol. Exp. Ther. 296 (2), 388, 2001. 38. Xie, F. Y., Woodle, M. C., and Lu, P. Y., Harnessing in vivo siRNA delivery for drug discovery and therapeutic development, Drug Discov Today 11 (1–2), 67, 2006. 39. Cunningham, E. T., Jr., Adamis, A. P., Altaweel, M., Aiello, L. P., Bressler, N. M., D’Amico, D. J., Goldbaum, M., Guyer, D. R., Katz, B., Patel, M., and Schwartz, S. D., A phase II randomized doublemasked trial of pegaptanib, an anti-vascular endothelial growth factor aptamer, for diabetic macular edema, Ophthalmology 112 (10), 1747, 2005. 40. Adamis, A. P., Altaweel, M., Bressler, N. M., Cunningham, E. T., Jr., Davis, M. D., Goldbaum, M., Gonzales, C., Guyer, D. R., Barrett, K., and Patel, M., Changes in retinal neovascularization after pegaptanib (Macugen) therapy in diabetic individuals, Ophthalmology 113 (1), 23, 2006. 41. Aiello, L. P., Brucker, A. J., Chang, S., Cunningham, E. T., Jr., D’Amico, D. J., Flynn, H. W., Jr., Grillone, L. R., Hutcherson, S., Liebmann, J. M., O’Brien, T. P., Scott, I. U., Spaide, R. F., Ta, C., and Trese, M. T., Evolving guidelines for intravitreous injections, Retina 24 (5 Suppl), S3, 2004.

CRC_8796_ch021.qxd

598

5/25/2007

11:28 AM

Page 598


42. Bylsma, G., Guymer, R., Qureshi, S., Gin, T., Allen, P., Madhok, P., McCombe, M., and Harper, A., Intravitreous injections, Clin. Exp. Ophthalmol. 34 (4), 388, 2006. 43. Henry, S. P., Stecker, K., Brooks, D., Monteith, D., Conklin, B., and Bennett, C. F., Chemically modified oligonucleotides exhibit decreased immune stimulation in mice, J. Pharmacol. Exp. Ther. 292 (2), 468, 2000. 44. Levin, A. A., Henry, S. P., Monteith, D., and Templin, M., Toxicity of Antisense Oligonucleotides, in Antisense Drug Technology, Crooke, S. T., ed., Marcel Dekker, New York, 2001, p. 201. 45. Krieg, A. M., Yi, A.-K., Matson, S., Waldschmidt, T. J., Bishop, G. A., Teasdale, R., Koretzky, G. A., and Klinman, D. M., CpG motifs in bacterial DNA trigger direct B-cell activation, Nature 374, 546, 1995. 46. Krieg, A. M., Matson, S., and Fisher, E., Oligonucleotide modifications determine the magnitude of B-cell stimulation by CpG motifs, Antisense Nucl. Acid Drug Dev. 6, 133, 1996. 47. Zhao, Q., Temsamani, J., Iadarola, P. L., Jiang, Z., and Agrawal, S., Effect of different chemically modified oligodeoxynucleotides on immune stimulation, Biochem. Pharmacol. 51 (2), 173, 1996. 48. Kariko, K., Bhuyan, P., Capodici, J., and Weissman, D., Small interfering RNAs mediate sequenceindependent gene suppression and induce immune activation by signaling through toll-like receptor 3, J. Immunol. 172 (11), 6545, 2004. 49. Van Aerschot, A., Oligonucleotides as antivirals: Dream or realistic perspective?, Antiviral Res. 71 (2–3), 307, 2006. 50. Mirabelli, C. K. and Crooke, S. T., Antisense oligonucleotides in the context of modern molecular drug discovery and development, in Antisense Research and Applications, Crooke, S. T. and Lebleu, B., eds., CRC Press, Inc., Boca Raton, FL, 1993, p. 7. 51. Azad, R. F., Driver, V. B., Tanaka, K., Crooke, R. M., and Graham, M., Antiviral activity of a phosphorothioate oligonucleotide complementary to RNA of the human cytomegalovirus major immediateearly region, Antimicrob. Agents Chemother. 37 (9), 1945, 1993. 52. Detrick, B., Nagineni, C. N., Grillone, L. R., Anderson, K. P., Henry, S. P., and Hooks, J. J., Inhibition of human cytomegalovirus replication in a human retinal epithelial cell model by antisense oligonucleotides, Invest. Ophthalmol. Vis. Sci. 42 (1), 163, 2001. 53. Goldberg, D. E., Smithen, L. M., Angelilli, A., and Freeman, W. R., HIV-associated retinopathy in the HAART era, Retina 25 (5), 633, 2005. 54. Smith, C. C., Aurelian, L., Reddy, M. P., Miller, P. S., and Ts’o, P. O., Antiviral effect of an oligo(nucleoside methylphosphonate) complementary to the splice junction of herpes simplex virus type 1 immediate early pre-mRNAs 4 and 5, Proc. Natl. Acad. Sci. USA 83 (9), 2787, 1986. 55. Feng, C. P., Kulka, M., Smith, C., and Aurelian, L., Herpes simplex virus-mediated activation of human immunodeficiency virus is inhibited by oligonucleoside methylphosphonates that target immediateearly mRNAs 1 and 3, Antisense Nucl. Acid Drug Dev. 6 (1), 25, 1996. 56. Kulka, M., Smith, C. C., Aurelian, L., Fishelevich, R., Meade, K., Miller, P., and Ts’o, P. O. P., Site specificity of the inhibitory effects of oligo(nucleoside methylphosphonate)s complementary to the acceptor splice junction of herpes simplex virus type 1 immediate early mRNA, Proc. Natl. Acad. Sci. USA 86, 6868, 1989. 57. Kean, J. M., Kipp, S. A., Miller, P. S., Kulka, M., and Aurelian, L., Inhibition of herpes simplex virus replication by antisense oligo-2⬘-O-methylribonucleoside methylphosphonates, Biochemistry 34 (45), 14617, 1995. 58. Kulka, M., Smith, C. C., Levis, J., Fishelevich, R., Hunter, J. C., Cushman, C. D., Miller, P. S., Ts’o, P. O., and Aurelian, L., Synergistic antiviral activities of oligonucleoside methylphosphonates complementary to herpes simplex virus type 1 immediate-early mRNAs 4, 5, and 1, Antimicrob. Agents Chemother. 38 (4), 675, 1994. 59. Adler, R. A., Li, Q., Miller, P. S., and O’Brien, T. P., Antiviral efficacy of therapeutic oligonucleotide in corneal epithelial cells and keratocytes in vitro, Invest. Ophthalmol. Vis. Sci., 2000, p. S58. 60. Miller, J. W., Vascular endothelial growth factor and ocular neovascularization, Am. J. Pathol. 151 (1), 13, 1997. 61. Aiello, L. P., Vascular endothelial growth factor and the eye: biochemical mechanisms of action and implications for novel therapies, Ophthalmic Res. 29, 354, 1997. 62. Miller, J. W., Adamis, A. P., Shima, D. T., D’Amore, P. A., Moulton, R. S., O’Reilly, M. S., Folkman, J., Dvorak, H. F., Brown, L. F., Berse, B., Yeo, T.-K., and Yeo, K.-T., Vascular endothelial growth factor/vascular permeability factor is temporally and spatially correlated with ocular angiogenesis in a primate model, Am. J. Pathol. 145 (3), 574, 1994.

CRC_8796_ch021.qxd

5/25/2007

11:28 AM

Page 599


599

63. D’Amore, P., Mechanisms of retinal and choroidal neovascularization, Invest. Ophthalmol. Vis. Sci. 35 (12), 3974, 1994. 64. Rosenfeld, P. J., Rich, R. M., and Lalwani, G. A., Ranibizumab: Phase III Clinical Trial Results, Ophthalmol. Clin. North Am. 19 (3), 361, 2006. 65. Marano, R. J., Toth, I., Wimmer, N., Brankov, M., and Rakoczy, P. E., Dendrimer delivery of an anti-VEGF oligonucleotide into the eye: a long-term study into inhibition of laser-induced CNV, distribution, uptake and toxicity, Gene Ther. 12 (21), 1544, 2005. 66. Marano, R. J., Wimmer, N., Kearns, P. S., Thomas, B. G., Toth, I., Brankov, M., and Rakoczy, P. E., Inhibition of in vitro VEGF expression and choroidal neovascularization by synthetic dendrimer peptide mediated delivery of a sense oligonucleotide, Exp. Eye Res. 79 (4), 525, 2004. 67. Michels, S., Schmidt-Erfurth, U., and Rosenfeld, P. J., Promising new treatments for neovascular age-related macular degeneration, Expert Opin. Invest. Drugs 15 (7), 779, 2006. 68. Shen, J., Samul, R., Silva, R. L., Akiyama, H., Liu, H., Saishin, Y., Hackett, S. F., Zinnen, S., Kossen, K., Fosnaugh, K., Vargeese, C., Gomez, A., Bouhana, K., Aitchison, R., Pavco, P., and Campochiaro, P. A., Suppression of ocular neovascularization with siRNA targeting VEGF receptor 1, Gene Ther. 13 (3), 225, 2006. 69. Reich, S., Fosnot, J., Kuroki, A., Tang, W., Yang, X., Maguire, A., Bennett, J., and Tolentino, M., Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model, Mol. Vision 9, 210, 2003. 70. Bhisitkul, R. B., Robinson, G. S., Moulton, R. S., Claffey, K. P., Gragoudas, E. S., and Miller, J. W., An antisense oligodeoxynucleotide against vascular endothelial growth factor in a nonhuman primate model of iris neovascularization, Arch. Ophthalmol. 123 (2), 214, 2005. 71. Leng, J., Klemke, R. L., Reddy, A. C., and Cheresh, D. A., Potentiation of cell migration by adhesiondependent cooperative signals from the GTPase Rac and Raf kinase, J. Biol. Chem. 274 (53), 37855, 1999. 72. Cheresh, D. A., Death to a blood vessel, death to a tumor, Nat. Med. 4 (4), 395, 1998. 73. Hood, J. and Granger, H. J., Protein kinase G mediates vascular endothelial growth factor-induced raf-1 activation and proliferation in human endothelial cells, J. Biol. Chem. 273 (36), 23504, 1998. 74. Watanabe, D., Suzuma, K., Matsui, S., Kurimoto, M., Kiryu, J., Kita, M., Suzuma, I., Ohashi, H., Ojima, T., Murakami, T., Kobayashi, T., Masuda, S., Nagao, M., Yoshimura, N., and Takagi, H., Erythropoietin as a retinal angiogenic factor in proliferative diabetic retinopathy, N. Engl. J. Med. 353 (8), 782, 2005. 75. Clermont, A. C., Cahill, M., Salti, H., Rook, S. L., Rask-Madsen, C., Goddard, L., Wong, J. S., Bursell, D., Bursell, S. E., and Aiello, L. P., Hepatocyte growth factor induces retinal vascular permeability via MAP-kinase and PI-3 kinase without altering retinal hemodynamics, Invest. Ophthalmol. Vis. Sci. 47 (6), 2701, 2006. 76. Wong, C., Dean, N., Sioulis, C., Kuppermann, B., Chuck, G., McDonnell, P. J., Ho, M., Cohen, D., Papaioannu, T., and Grundfest, W. W., Anti-sense oligonucleotides block angiogenesis in newly developed model of retinal neovascularitzation presenting with hemorrhage and subsequent fibrovascular membrane formation, Invest. Ophthalmol. Vis. Sci., 2000, p. S641. 77. Seo, M. S., Kwak, N., Ozaki, H., Yamada, H., Okamoto, N., Yamada, E., Fabbro, D., Hofmann, F., Wood, J. M., and Campochiaro, P. A., Dramatic inhibition of retinal and choroidal neovascularization by oral administration of a kinase inhibitor, Am. J. Pathol. 154 (6), 1743, 1999. 78. Danis, R. P., Bingaman, D. P., Jirousek, M., and Yang, Y., Inhibition of intraocular neovascularization caused by retinal ischemia in pigs by PKCbeta inhibition with LY333531, Invest. Ophthalmol. Vis. Sci. 39 (1), 171, 1998. 79. Tsujikawa, A., Ogura, Y., Hiroshiba, N., Miyamoto, K., Kiryu, J., Tojo, S. J., Miyasaka, M., and Honda, T., Retinal ischemia-reperfusion injury attenuated by blocking of adhesion molecules of vascular endothelium, Invest. Ophthalmol. Vis. Sci. 40 (6), 1183, 1999. 80. Suzuma, K., Mandai, M., Kogishi, J.-i., Tojo, S. J., Honda, Y., and Yoshimura, N., Role of P-selectin in endotoxin-induces uveitis, Invest. Ophthalmol. Vis. Sci. 38 (8), 1610, 1997. 81. Wasmuth, S., Bauer, D., Yang, Y., Steuhl, K. P., and Heiligenhaus, A., Topical treatment with antisense oligonucleotides targeting tumor necrosis factor-alpha in herpetic stromal keratitis, Invest. Ophthalmol. Vis. Sci. 44 (12), 5228, 2003. 82. Voigt, M., de Kozak, Y., Halhal, M., Courtois, Y., and Behar-Cohen, F., Down-regulation of NOSII gene expression by iontophoresis of anti-sense oligonucleotide in endotoxin-induced uveitis, Biochem. Biophys. Res. Commun. 295 (2), 336, 2002.

CRC_8796_ch021.qxd

600

5/25/2007

11:28 AM

Page 600


83. Weinreb, R. N., Clinical trials of neuroprotective agents in glaucoma, Retina 25 (8 Suppl), S78, 2005. 84. Levin, L. A., Neuroprotection and regeneration in glaucoma, Ophthalmol. Clin. North Am. 18 (4), 585, 2005. 85. Davies, V. J. and Boulton, M., Expression profile of rat primary retinal ganglion cells and retinal cell lines, RGC-5 and R28 and mitochondrial morphological changes following OPA1 knockdown mediated siRNA, in ARVO, Florida, 2006. 86. Duong, M. and Ball, A. K., siRNA-mediated knowckdown of optineurin in Rgc-5 cells, in ARVO, Florida, 2006. 87. Amaratunga, A. P., Kosik, K. S., Rittenhouse, P. A., Leeman, S. E., and Fine, R. E., Antisense inhibition of protein synthesis and function—Rabbit retinal protein, in Antisense Therapeutics, Agrawal, S., ed., Humana Press, Inc., Tatowa, NJ, 1996, p. 109. 88. Amaratunga, A., Morin, P. J., Kosik, K. S., and Fine, R. E., Inhibition of kinesin synthesis and rapid anterograde axonal transport in vivo by an antisense oligonucleotide, J. Biol. Chem. 268 (23), 17427, 1993. 89. Thaler, S., Rejdak, R., Dietrich, K., Ladewig, T., Okuno, E., Kocki, T., Turski, W. A., Junemann, A., Zrenner, E., and Schuettauf, F., A selective method for transfection of retinal ganglion cells by retrograde transfer of antisense oligonucleotides against kynurenine aminotransferase II, Mol. Vision 12, 100, 2006. 90. Isenmann, S., Engel, S., Gillardon, F., and Bahr, M., Bax antisense oligonucleotides reduce axotomy-induced retinal ganglion cell death in vivo by reduction of Bax protein expression, Cell Death Differ. 6 (7), 673, 1999. 91. Pintor, J. J., Mediero, A., Jimenez, A., Sesto, A., Gonzalez de Buitrago, G., and Peral, A., SiRNA in the treatment of ocular hypertension targeting alpha and beta adrenoceptors, Invest. Ophthalmol. Vis. Sci. 47 (5), 403, 2006. 92. Jimenez, A., Sesto, A., Pintor, J., Mediero, A., Peral, A., and Gonzalez de Buitrago, G., RNAi: a new strategy for treating ocular hypertension silencing carbonic anhydrases, Invest. Ophthalmol. Vis. Sci. 47 (5), 405, 2006. 93. Corderio, M., Gay, J., and Khaw, P., A new glaucoma anti-scarring agent, Invest. Ophthalmol. Vis. Sci. 40, 2225, 1999. 94. Cordeiro, M. F., Mead, A., Ali, R. R., Alexander, R. A., Murray, S., Chen, C., York-Defalco, C., Dean, N. M., Schultz, G. S., and Khaw, P. T., Novel antisense oligonucleotides targeting TGF-beta inhibit in vivo scarring and improve surgical outcome, Gene Ther. 10 (1), 59, 2003. 95. Gomes dos Santos, A. L., Bochot, A., Doyle, A., Tsapis, N., Siepmann, J., Siepmann, F., Schmaler, J., Besnard, M., Behar-Cohen, F., and Fattal, E., Sustained release of nanosized complexes of polyethylenimine and anti-TGF-beta 2 oligonucleotide improves the outcome of glaucoma surgery, J. Controlled Rel. 112 (3), 369, 2006. 96. Ahmed, I., Gokhale, R. D., Shah, M. V., and Patton, T. F., Physicochemical determinants of drug diffusion across the conjunctiva, sclera, and cornea, J. Pharm. Sci. 76 (8), 583, 1987. 97. Ambati, J. and Adamis, A. P., Transscleral drug delivery to the retina and choroid, Prog. Retin. Eye Res. 21 (2), 145, 2002. 98. Kim, T. W., Lindsey, J. D., Aihara, M., Anthony, T. L., and Weinreb, R. N., Intraocular distribution of 70-kDa dextran after subconjunctival injection in mice, Invest. Ophthalmol. Vis. Sci. 43 (6), 1809, 2002. 99. Ambati, J., Gragoudas, E. S., Miller, J. W., You, T. T., Miyamoto, K., Delori, F. C., and Adamis, A. P., Transscleral delivery of bioactive protein to the choroid and retina, Invest. Ophthalmol. Vis. Sci. 41 (5), 1186, 2000. 100. Berdugo, M., Valamanesh, F., Andrieu, C., Klein, C., Benezra, D., Courtois, Y., and Behar-Cohen, F., Delivery of antisense oligonucleotide to the cornea by iontophoresis, Antisense Nucl. Acid Drug Dev. 13 (2), 107, 2003. 101. Roy, S., Zhang, K., Roth, T., Vinogradov, S., Kao, R. S., and Kabanov, A., Reduction of fibronectin expression by intravitreal administration of antisense oligonucleotides, Nat. Biotechnol. 17, 476, 1999. 102. Bourges, J. L., Gautier, S. E., Delie, F., Bejjani, R. A., Jeanny, J. C., Gurny, R., BenEzra, D., and Behar-Cohen, F. F., Ocular drug delivery targeting the retina and retinal pigment epithelium using polylactide nanoparticles, Invest. Ophthalmol. Vis. Sci. 44 (8), 3562, 2003. 103. Bochot, A., Fattal, E., Boutet, V., Deverre, J. R., Jeanny, J. C., Chacun, H., and Couvreur, P., Intravitreal delivery of oligonucleotides by sterically stabilized liposomes, Invest. Ophthalmol. Vis. Sci. 43 (1), 253, 2002.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 601

CHAPTER

22

Cardiovascular Therapeutic Applications Rosanne Crooke, Brenda Baker, and Mark Wedel

CONTENTS 22.1 Introduction .........................................................................................................................601 22.1.1 Background............................................................................................................601 22.1.2 Current Treatment Paradigm..................................................................................602 22.1.3 The Unmet Medical Need .....................................................................................602 22.1.4 Antisense Oligonucleotides as Novel Cardiovascular Therapeutics .....................603 22.2 Application of Antisense Compounds to Cardiovascular Disease......................................605 22.2.1 Liver Targets Involved in Dyslipidemias...............................................................605 22.2.1.1 Inhibition of Cholesteryl Ester Transfer Protein to Increase Low HDL-C Levels................................................................605 22.2.1.2 Inhibition of Lp(a) ................................................................................605 22.2.1.3 Inhibition of Apolipoprotein C-III........................................................606 22.2.1.4 Inhibition of Acyl-Coenzyme A: Cholesterol Acyltransferase 2..........608 22.2.1.5 Antisense Inhibition of ApoB-100........................................................611 22.2.2 Antisense Inhibition of CRP, a Nonlipid Hepatic Target Involved in CHD..........626 22.2.3 Antisense Inhibitors for the Treatment of Hypertension.......................................628 22.2.4 Antisense Inhibitors Affecting Restenosis.............................................................628 22.3 Summary and Future Perspectives ......................................................................................629 Acknowledgments ..........................................................................................................................630 References ......................................................................................................................................630

22.1 INTRODUCTION 22.1.1 Background Coronary heart disease (CHD), despite tremendous medical and technological advances and clearer insights into the pathogenesis of atherosclerosis, has been the leading cause of death in the United States for over a century [1–4]. Complications from atherosclerotic heart disease are the most common causes of morbidity and mortality in industrialized nations. In fact, the World Health Organization and others project that CHD will become the primary cause of death worldwide by the

601

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 602

602


year 2020 [5,6]. Several factors have been identified that increase the probability that an individual might develop atherosclerosis [1,7,8]. The major independent risk factors include elevated total and low-density lipoprotein cholesterol (LDL-C) levels, low serum high-density cholesterol (HDL-C) levels, cigarette smoking, hypertension, diabetes mellitus, insulin resistance, and advancing age. Other factors include obesity, physical inactivity, family history of premature cardiovascular disease, ethnicity, elevated serum triglyceride, homocysteine, and lipoprotein(a) [Lp(a)] levels, and the presence of prothrombotic factors such as fibrinogen and inflammatory markers such as C-reactive protein (CRP). These categories can be further subdivided into those that can be modified through various interventions (alterations in lifestyle and diet, or pharmacological agents) and those that cannot. Unmodifiable factors include advancing age, gender, ethnicity, and genetic predisposition. Of those factors that can be modulated, the abnormalities associated with lipid metabolism have been the most extensively studied and therefore, the best understood. 22.1.2 Current Treatment Paradigm Experimental and epidemiological studies have strongly implicated elevated cholesterol and LDL-C in the development of atherosclerosis [9–11]. Several large interventional clinical studies have clearly demonstrated that lowering LDL-C levels reduced not only the incidence of CHD, but also the associated morbidity and mortality of the disease [12–14]. Due to the strong correlation between elevated LDL-C plasma levels, the atherogenic process, and the log-linear relationship that exists between LDL-C and cardiovascular event rates [15,16], its reduction has been the principal goal for CHD treatment and prevention. The lipid management guidelines have been established since 1988 by the National Cholesterol Education Program (NCEP) Adult Treatment Panel (ATP) [10]. The most recent recommendations suggest that patients at greatest risk should aggressively reduce LDL-C below 70 mgⲐdL. This value was chosen as a result of an increasing number of studies in the past several years demonstrating that lower levels are highly beneficial. For example, a metaanalysis of 14 outcome trials suggested that an approximate 2 mg/dL reduction in LDL-C would produce a 1% reduction in CHD rate per year [17]. More compelling data from the REVERSAL and ASTEROID trials revealed that the greatest reduction in LDL-C levels resulted in significant regression in atherosclerotic plaque burden [18,19]. While exercise and sensible dietary changes may lower LDL-C and triglyceride levels, many patients require further therapeutic interventions. The five classes of approved antihyperlipidemic therapeutic agents are the fibrates, niacin, bile acid sequestrants, cholesterol absorption inhibitors, and competitive inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase), or the statins [7,11,20]. The choice of therapy is individualized to meet the needs of patients; however, the most widely prescribed and efficacious therapeutic LDL-C lowering agents are the statins. Administration of these drugs has been shown to reduce mortality rates in patients with existing CHD, prevent the onset of a first coronary event, reduce the risk of progressive atherosclerotic disease and, as described above, cause regression of atheromatous plaque volume [19,21–23]. Other lipid or lipoprotein risk factors may also be altered by some of the agents listed above. For example, fibrates can reduce high serum triglyceride levels, but in some refractory patients, a combination of fibrates, statins, and niacin are required to avoid pancreatitis [8,9,24]. Niacin, or nicotinic acid is currently the most effective agent to raise HDL-C levels [25,26]. High Lp(a) levels may also be modestly reduced by niacin as well [7,27]. However, dermatological, gastrointestinal, and hepatic side effects have limited its use [7,28]. 22.1.3 The Unmet Medical Need Even with the availability of statins and the second tier agents, several studies have shown that the attainment of the ATP-III recommended LDL-C goal is low and cardiovascular mortality

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 603

CARDIOVASCULAR THERAPEUTIC APPLICATIONS

603

rates are still high, especially in patients with CHD with multiple risk factors [29–32]. A number of potential factors can contribute to the failure to reach target LDL-C levels and include patient noncompliance (not taking prescribed medications/expense of therapies), inadequate treatment by physicians (e.g., inappropriate choice of drugs, use of ineffective dose of drugs, and unwillingness to escalate appropriately), and ineffectiveness or intolerance to single/combination therapies [29,33]. There are also data suggesting that maximal doses of statins, either alone or in combination with other agents, are ineffective in some high-risk patients [34]. Additionally, when combination interventions are employed, many of the drugs are metabolized by common enzymatic machinery, and thus possess significant potential for untoward drug-drug interactions [7,33]. Increasingly stringent LDL-C goals, coupled with the inadequacy of existing drugs and a clearer understanding of the molecular basis of various types of dyslipidemias and cardiovascular disease in general, underscore the need for novel therapeutics that can be safely administered either alone or in combination with statins and other existing agents. One class of novel cardiovascular drugs showing great promise, both preclinically and in humans, exploits antisense technology. 22.1.4 Antisense Oligonucleotides as Novel Cardiovascular Therapeutics The tremendous advances in antisense technology over the past 17 years have facilitated the development of novel therapeutics that target many of the risk factors that predispose individuals to cardiovascular disease. Many aberrantly expressed genes contributing to various dyslipidemic states, or thought to be involved in the pathogenesis of atherosclerosis can be rapidly validated both in vitro and in vivo with exquisite specificity and isoform selectivity. Theoretically, any region within an mRNA sequence can be targeted and full-length gene sequences are not necessary to obtain effective antisense inhibitors. The opportunity, therefore, exists to selectively inhibit classically undruggable targets, such as lipid phosphatases, transcription factors, and macromolecules with no intrinsic enzymatic activity such as transport, structural proteins, and lipoproteins. Another advantage of this technology is the predictable chemical class-related toxicological properties of the drugs. As others will describe in this book (Chapters 12 and 13), [35], first- and second-generation antisense oligonucleotides (ASOs) have attractive safety profiles, both preclinically and in man. Key safety issues have been identified, and tremendous progress has been made toward understanding potential adverse events. It is also known that these agents are cleared from tissue via slow endonucleolytic degradation and not through interaction with the CYP3A4 and CYP3A5 isoforms of the cytochrome P450 system [36], the common pathway for the metabolism of statins and a multitude of other agents [37]. Antisense compounds can, therefore, be used safely in combination with known cardiovascular therapeutics with different mechanisms of action. The pharmacokinetic properties and tissue distribution of ASOs have also been extensively characterized in preclinical models and humans (Chapter 11) [38–41]. The second-generation 2⬘-O-(2-methoxy)ethyl (2⬘MOE)–modified gapmer analogs, which represent the most advanced antisense therapeutics in the clinic, are localized in tissues such as kidney, liver, adipose tissue, spleen, and lymph nodes after parenteral administration. More recent data suggest that antisense oligonucleotides also distribute to macrophages and endothelial cells within atheromas (Figure 22.1) [42]. Vascular endothelial cells provide substances that help regulate vascular tone, coagulation, thrombosis, and inflammation and their dysfunction is thought to be integral to the development and progression of atherosclerosis [43–46]. Accumulation of LDL-C within monocytes/macrophages, and its subsequent oxidation results in the formation of foam cells and the release of various cytokines and chemokines that are critical to the initiation and propagation of the inflammatory process within the plaque.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 604

604

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION H&E

ASO

Lumen Muscle

Foamy macrophages in aortic plaque

Trichrome staining

Macrophages

Figure 22.1 (See color insert following page 270.) Localization of a representative 20-mer phosphorothioate within an atherosclerotic lesion of a Watanabe Heritable Hyperlipidemic rabbit. Animals were administered 25 mg/kg ASO twice weekly for 3 weeks. Top left panel: H&E staining of the aortic plaque indicating the presence of foamy macrophages in the lesion. Bottom left panel: Masson’s Trichrome staining of the lesion to highlight excess collagen deposition. Top right panel: Localization of the ASO using immunostaining. Bottom right panel: Localization of macrophages using a monoclonal mouse anti-macrophage antibody (RAM 11).

The highest concentrations of second-generation antisense drugs are found in kidney and liver [39–41,47–49], organs whose interactions and dysregulation contribute to various aspects of cardiovascular disease. The kidney plays an important role in maintaining blood pressure levels and is also the site of action of many of the marketed antihypertensive agents [50]. The liver, most importantly, regulates several key metabolic pathways that directly influence the development of CHD [3,51]. It is the major site of cholesterol and fatty acid/triglyceride synthesis in mammals and is also responsible for the production and degradation of all atherogenic apolipoprotein B-100 containing lipoproteins such as very low-density lipoprotein cholesterol (VLDL-C), LDL-C, and Lp(a). Because of its vital role in cholesterol and lipid homeostasis and since most of the lipid-lowering drugs ultimately target hepatic lipid metabolism (statins, fibrates, bile acid resins), perhaps as Davis and Hui suggested [3], atherosclerosis may, indeed, be a liver disease of the heart. In this chapter, we will summarize preclinical data and, where possible, the clinical activity of ASOs directed against several risk factors that contribute to CHD. The majority of the ASOs to be discussed represent the most advanced, second-generation 2⬘MOE chemistries and have been designed to inhibit the production of novel proteins produced in the liver that contribute to various dyslipidemic states (elevated serum LDL-C, Lp(a) and triglycerides and low levels of HDL-C). A nonlipid-related hepatic target, CRP, which is thought to contribute to the initiation and progression of the atherosclerotic plaque, will also be described. Finally, the last two sections will discuss experiments using first- and second-generation antisense inhibitors that affect hypertension and the development of restenosis.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 605


605

22.2 APPLICATION OF ANTISENSE COMPOUNDS TO CARDIOVASCULAR DISEASE 22.2.1 Liver Targets Involved in Dyslipidemias

22.2.1.1 Inhibition of Cholesteryl Ester Transfer Protein to Increase Low HDL-C Levels As described in the introduction, low HDL-C levels are now recognized as a risk factor for the development of CHD. The metabolism of HDL-C is a complex process and involves the interplay of a number of lipoproteins, receptors, and enzymes that regulate its synthesis, intravascular remodeling, and catabolism [25,26,52]. More importantly, HDL’s atheroprotective mechanisms are not completely understood, but may include reverse cholesterol transport, whereby excess cholesterol is removed from plaque sites and other tissues for redistribution to liver, and various antioxidant and anti-inflammatory effects. Cholesteryl ester transfer protein (CETP) is the enzyme that facilitates the transfer of cholesteryl esters from HDL-C to apolipoprotein B (apoB) containing lipoproteins [25,52–54]. Some humans who are deficient in CETP have increased HDL-C levels and decreased LDL-C levels. Additionally, CETP deficiency has been associated with decreased coronary artery disease and predisposition to ischemic heart disease [55–57]. Sugano used a rabbit-specific first-generation phosphodiester antisense inhibitor to CETP to determine the importance of that enzyme in determining serum HDL-C levels and its role in the development of atherosclerosis in cholesterol-fed Japanese white rabbits [58,59]. Since the liver is the principal site of CETP synthesis, the authors believed that reduction of CETP in that organ could favorably alter the HDL/LDL ratio and reduce the risk of atherosclerosis. The first-generation phosphodiester CETP antisense inhibitor used in their studies was complexed to asialoglycoprotein-poly(L-lysine) to enhance the uptake of the drug in liver and protect the oligonucleotide from degradation by nucleases [60]. Rabbits were systemically administered 30 g/kg oligonucleotide complex twice weekly for 8 weeks. At that time, reductions in CETP liver mRNA, plasma CETP, and total cholesterol, principally VLDL and LDL-C, were observed in the antisense but not saline or oligonucleotide control rabbits. Surprisingly, HDL-C levels were not significantly affected. Nonetheless, the aortic cholesterol contents and total atherosclerotic lesion surface area were significantly lower in treated animals. These data suggest that reduction of liver CETP may be beneficial for reducing plasma LDL-C, possibly by enhancing the catabolism of LDL-C through up-regulation of LDL receptors and decreasing the transfer of cholesteryl esters from HDL-C to atherogenic apoB-containing lipoproteins. While the plaque data are encouraging, no further information regarding the use of firstgeneration antisense compounds has been published, possibly due to potential issues related to using nuclease-labile, phosphodiester oligonucleotides and long-term toxicities related to the poly(L-lysine) moiety on the carrier protein [60]. Nonetheless, given the positive clinical data using small-molecule inhibitors of CETP [55–57,61], second-generation antisense inhibitors have been generated and are being tested in vivo in our laboratories [62].

22.2.1.2 Inhibition of Lp(a) Lp(a) is a heterogeneous family of lipoprotein particles synthesized exclusively in the liver of humans, Old World nonhuman primates, and the European hedgehog that was discovered in 1963 by Kare Berg [28,63,64]. It is a complex molecule that consists of a single copy of apoB-100 linked by a disulfide bond to a single copy of a glycoprotein, apolipoprotein (a) or apo(a), at the C-terminal regions of both molecules [28,64]. The human apo(a) gene is thought to have evolved from the plasminogen gene on chromosome 6q27. Lp(a), similar to plasminogen, has coding

CRC_8796_ch022.qxd

606

6/20/2007

10:11 PM

Page 606


sequences for loop structures, or modules, called kringles (multiple K4 and one KV domains) that contain 80–85 amino acids each. The size of the apo(a) gene varies from 300–800 kDa and these differences arise principally from variable copies of K4. Generally, there is an inverse relation between apo(a) size and Lp(a) levels, with smaller apo(a) sizes resulting in higher plasma Lp(a) levels. In recent years, elevated Lp(a) levels (⬎30 mg/dL) have become recognized as an independent risk factor for the development of CHD, cerebrovascular, and peripheral vascular disease [28,65–67]. The exact mechanisms by which this molecule contributes to the pathogenesis of atherosclerosis are unknown. However, Lp(a) has pleotropic effects that include inhibiting the conversion of plasminogen to plasmin, attenuation of fibrinolysis and promotion of the prothrombotic state, enhancing proliferation and migration of smooth muscle cells and up-regulation of cell adhesion molecules [28,64]. More recently, it has been suggested that Lp(a) might act as a preferential acceptor of proinflammatory oxidized phospholipids and it is the modified molecule that is taken up into vessel walls, ultimately contributing to foam cell formation within the plaque [67–71]. Apo(a) has also been localized in atherosclerotic plaques using immunohistochemistry [72] and found to be deposited in vein grafts following coronary artery bypass [73]. As mentioned above, with the exception of niacin, conventional therapeutic options for lowering elevated Lp(a) levels are limited. In some cases, LDL-apheresis has even been used to lower significantly elevated LDL and Lp(a) levels in patients with familial hypercholesterolemia [74]. Our laboratory has taken two approaches in an attempt to modulate Lp(a)—first, by using second-generation antisense drugs that target hepatic apo(a) and second, by inhibiting apoB-100. The latter approach will be discussed later in this chapter (Section 22.1.5, High Fat–Fed Monkey Studies). The principal challenge to the design of apo(a) antisense oligonucleotides has been the close homology of the apo(a) gene to plasminogen. Nonetheless, we have successfully identified an exon 2–specific human apo(a) ASO that does not affect plasminogen expression in vitro or in vivo. As shown in Figure 22.2a, this inhibitor selectively inhibits human apo(a), not plasminogen, mRNA expression in a dose-responsive fashion in primary human hepatocytes. Pharmacological evaluation of potential inhibitors to Lp(a) is also problematic because only humans and Old World monkeys express the apo(a) gene. However, our collaborators and we validated the activity of the human antisense inhibitor in transgenic mice expressing human apo(a) [75]. The hLPA-YAC transgenic mice used in this study had previously been shown to develop significant atherosclerosis on a normal chow diet [76]. Mice were administered 50 mg/kg/week via intraperitoneal (i.p.) injection of ISIS 144367 and a control ASO. After completion of the experiment, liver apo(a) mRNA and plasma apo(a) protein levels were determined by quantitative RT-PCR and ELISA, respectively. After 4 weeks of treatment with the antisense inhibitor, apo(a) mRNA expression levels were reduced by 85% (Figure 22.2b) and serum apo(a) by 70% compared to the saline control animals (Figure 22.2c). As expected, the control ASO had no effect on any measured parameter. Administration of the apo(a) ASO also had no effect on triglyceride, LDL-C, HDL-C, and total cholesterol levels. Plasma from mice was used to assess potential toxic effects of the drugs. Alanine transaminase (ALT), aspartate transaminase (AST), and blood urea nitrogen (BUN) levels were unchanged. Interestingly, the hepatosteatosis that is characteristic of this model was ameliorated as judged from Oil Red O staining of liver sections. The mechanisms for this effect are not known. These preliminary data suggest that specific inhibition of apo(a) with antisense technology could be a useful strategy for the treatment of high Lp(a) levels in man. Several studies are planned in transgenic mice to address the pharmacological effects of this compound on the development of atherosclerosis and to help dissect the role of Lp(a) and its relationship to oxidized phospholipids [77].

22.2.1.3 Inhibition of Apolipoprotein C-III Apolipoprotein C-III (apoC-III) is another hepatically derived lipoprotein that is thought to contribute to the development of elevated triglyceride levels, or hypertriglyceridemia (HTG).

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 607


Apo(a) mRNA (% untreated control)

(a)

120

12kB PPset

607

7kB PPset

100

80

60

40

20

0

300 nM 200 nM 100 nM 50 nM

25 nM

ISIS 144367

Apo(a) mRNA expression

(b)

Plasminogen

10 nM 300 nM

UTC

ISIS141923

2.5 2 1.5 1 0.5 0 Saline

(c)

ISIS 144367

ISIS 299705

ISIS 144367

ISIS 299705

1000

Apo(a) (mg/dL)

800 600 400 200 0 Saline

Figure 22.2 Second-generation ASOs targeting apo(a) inhibit apo(a) expression in vitro and in vivo. (a) Dosedependent reduction of apo(a) mRNA in human primary hepatocytes. The apo(a) ASO has no effect on plasminogen mRNA levels. (b) Reduction in hepatic human apo(a) expression in transgenic mice after 4 weeks of treatment with ISIS 144367, the human apo(a) inhibitor, or control ASO, ISIS 299705 (50 mg/kg/week). Each bar represents the mean and SEM of six replicate animals. After qRT-PCR using two human apo(a) primer probe sets positioned either on the 5⬘ or 3⬘ region of apo(a), the samples were normalized using mouse-specific G3PDH. (c) Reduction in apo(a) serum protein secretion from transgenic mouse liver after 4 weeks of treatment as described above. Each bar represents the mean and SEM of six replicate animals. Serum apo(a) levels were determined using a human apo(a) elisa assay.

CRC_8796_ch022.qxd

608

6/20/2007

10:11 PM

Page 608


HTG, with or without concomitantly low levels of HDL-C, is now recognized as contributing to the risk of CHD [21,78,79]. Statins lower serum triglyceride levels in some dyslipidemic patients, but the fibrates are still the preferred therapeutic modality for the treatment of HTG [7,80–83]. Recent data suggest that these agents increase lipolysis and clearance of triglycerides through a reduction of hepatic apoC-III gene expression mediated by peroxisome proliferator–activated receptor ␣ [7,80–83]. ApoC-III associates with triglyceride-rich lipoproteins (VLDL and remnants) and is thought to inhibit the clearance of these particles by noncompetitively inhibiting lipoprotein lipase, an enzyme localized in the capillary endothelium [84]. The importance of apoC-III in triglyceride homeostasis has been demonstrated in vivo using genetically engineered mice. For example, transgenic mice overexpressing apoC-III have high levels of serum triglycerides as a result of their inability to catabolize triglyceride-rich lipoproteins [81,82,85]. Conversely, apoCIII-deficient mice rapidly clear VLDL [86]. More importantly, humans with HTG have increased levels of apoC-III and, in contrast, those with genetic deficiencies of that lipoprotein have low levels of VLDL enriched with TG, and rapidly convert VLDL to LDL-C [85,87]. There is also an association between increased apoC-III levels and susceptibility to type I diabetes in mice and humans [88–90]. In an insulin-dependent murine model of diabetes, mice have elevated glucose, triglyceride, and hepatic apoC-III mRNA. Administration of insulin resulted in a dosedependent down-regulation of apoC-III transcriptional activity [91], and in more recent studies, Altomonte [92] demonstrated that forkhead box O1, a nuclear transcription factor, mediated insulin’s effects on apoC-III. Takahashi [93] also suggested that apoC-III deficiency in streptozotocininduced diabetic mice prevented the development of hypertriglyceridemia. These data and clinical studies implicating total apoC-III and apoB-associated apoC-III levels as increased risks for CHD [94,95] suggest that apoC-III would be an ideal liver-derived target for antisense inhibition. Evaluation of several second-generation mouse and rat-specific apoC-III ASOs suggest that direct inhibition of that target has the predicted beneficial effect of lowering serum triglyceride levels in rodents [96,97]. As demonstrated in Figure 22.3, administration of two murine apoC-III ASOs for 6 weeks (50 mg/kg/week, i.p.) decreased hepatic apoC-III mRNA levels by 60–80% (Figure 22.3a), with concomitant reductions in serum triglyceride levels (40–60%; Figure 22.3b). Interestingly, both ASOs appeared to reduce hepatic steatosis in these C57BL/6 mice fed a high-fat Western diet, as determined by Oil Red O staining and quantitation of liver triglyceride levels (Figures 22.3c and 22.3d). More detailed studies in rat HTG models with rat-specific ASOs demonstrated similar pharmacological effects [96]. For example, administration of apoC-III compounds to Zucker fa/fa and fructose-fed Sprague-Dawley rats resulted in dose- and time-dependent reductions of apoC-III mRNA and serum triglycerides. Liver and serum apoC-III proteins and circulating free fatty acids were commensurately reduced. ASO treatment did not produce hepatotoxicity in mice or rats, as defined by increases in serum transaminases or alter any other metabolic parameter.

22.2.1.4 Inhibition of Acyl-Coenzyme A: Cholesterol Acyltransferase 2 Acyl-coenzyme A: cholesterol acyltransferase (ACAT) is an integral endoplasmic reticulum protein that plays a major role in lipoprotein particle secretion, dietary fat absorption, and intracellular cholesterol homeostasis [98–100]. Six years after the cloning of the ACAT gene in 1993 [101], two isoforms of the enzyme, ACAT1 and ACAT2, with different tissue localizations and functions, were identified [100,102–105]. ACAT1 is found in at least one cell type within most tissues of the body, with the highest levels in mice observed in macrophages and foam cells within atherosclerotic lesions, adrenal glands, and the dermis. ACAT2 is localized primarily in hepatocytes and the apical region of enterocytes. Data derived from experiments in ACAT-deficient mice helped define the potential roles of the isoforms in CHD and suggested that selective inhibition of ACAT2, not ACAT1, would be therapeutically beneficial. For example, mice lacking ACAT1 accumulated toxic levels of unesterified cholesterol in dermis and brain [106,107] and developed severe atherosclerotic lesions as a result

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 609

CARDIOVASCULAR THERAPEUTIC APPLICATIONS (b)

(a)

160 Serum triglycerides (mg/dL)

120 ApoC-III mRNA (% saline control)

609

100 80 60 40 20

140 120 100 80 60 40 20 0

0 Saline Treated

Saline

ISIS 167878 ISIS 167880 50 mg/kg/week 50 mg/kg/week Treatment

(c)

ISIS 167878 50 mg/kg/week Treatment

ISIS 167880 50 mg/kg/week

(d)

Saline

167878

Liver triglycerides (mg/g)

300 250 200 150 100 50 0 167880

Saline



Figure 22.3 (See color insert following page 270.) Pharmacological effect of two ASOs targeting murine apoC-III in high fat–fed C57BL/6 mice. In this representative experiment, mice were administered 50 mg/kg/week ISIS 167878 and ISIS 167880 for 6 weeks. (a) Reduction in hepatic apoC-III mRNA analyzed by qRT-PCR. Data are expressed as the mean percentage of mRNA levels in saline treated animals. (b) Reduction in serum triglyceride levels of treated animals. (c) ApoC-III ASOs reduced hepatic steatosis as assessed by Oil Red O staining of livers. (d) Quantitation of liver triglyceride levels.

of cholesterol-induced macrophage cell apoptosis [108,109]. In contrast, a deficiency in ACAT2 appeared to be beneficial, as mice lacking that isoform were protected against diet-induced hypercholesterolemia and gallstone formation [110–113]. Most importantly, mice lacking ACAT2 bred onto an apolipoprotein E–deficient (Apoe) or LDL receptor–deficient (Ldlr) background, lacked cholesterol esters in apoB-containing lipoproteins, and were protected against the development of atherosclerosis. Over the past 30 years, the pharmaceutical industry has been keenly interested in inhibiting ACAT as a way of modulating elevated lipids and preventing the development of atherosclerosis. However, this drug discovery path was initiated well before the identification of the two forms of the enzyme [114,115]. While a multitude of nonselective ACAT inhibitors of varying chemical classes (fatty acid amides, urea-derived compounds, natural products) showed promising results in vitro and in vivo in multiple models of atherosclerosis, recent clinical trial failures of two ACAT inhibitors, Avisimibe [116,117] and Pactimibe [118] have engendered skepticism as to the feasibility of this therapeutic approach to atherosclerotic heart disease. Clearly, inhibition of ACAT by antisense drugs offers a distinct advantage over the current nonselective agents as the ACAT2 isoform can be specifically targeted. Additionally, based on the well-defined pharmacokinetic properties of ASOs, liverlocalized ACAT2 can be preferentially modulated without altering its activity in the enterocytes or the availability/activity of ACAT1 in other tissues, e.g., brain, macrophages, and adrenals.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 610

610


Activity (nmol/mg/min)

Protein (AU X 1000)

mRNA (A2/gapdh)

Second-generation antisense inhibitors targeting ACAT2 and a control ASO were administered 50 mg/kg/week, i.p. to apoB-100-only Ldlr–deficient mice for 16 weeks to determine the effects of liver-specific inhibition on the development of hypercholesterolemia and atherosclerosis [119]. The ASOs selectively reduced hepatic, not intestinal, ACAT2 mRNA (80%), protein, and ACAT2 enzymatic activity. As predicted from pharmacokinetic studies, intestinal cholesterol absorption was unaffected. ACAT1 mRNA was not altered in liver or in other tissues. Hepatic cholesteryl ester (CE) was reduced, and plasma CE content was shifted to a predominantly polyunsaturated form. Plasma lipid concentrations of treated mice were similar to those found in ACAT2-deficient mice. LDL-C size was altered by ASO treatment and most likely reflected the loss of ACAT2-derived CE in the core of the LDL particle. These cumulative lipid changes resulted in a reduction in the severity of atherosclerosis in mice, as quantified by aortic CE concentration, with the most potent ASO reducing CE content by 67%. While the effect on plaque progression was not as pronounced as that observed in ACAT2-deficient mice, it was more than sufficient to suggest that pharmacological modulation of hepatic ACAT2 was atheroprotective in this model. While these studies provide convincing evidence that selective inhibition of ACAT2 reduced lipids and limited the development of atherosclerosis, additional studies in nonhuman primates are in progress to determine if these results can be reproduced in a species whose lipid and lipoprotein metabolism more closely resembles that of humans. Initial data derived from a pilot study in cynomolgus monkeys administered a monkey-specific ACAT2 ASO (30 mg/kg/week for 8 weeks) corroborate the murine results described above [120]. For example, as seen in Figure 22.4, inhibition of the monkey ACAT2 ASO significantly reduced hepatic ACAT2 mRNA (⬎70%), protein and enzymatic activity. Lipid parameters were affected as well, with 30% and 40% reductions, respectively, in total and LDL-C. As observed in mice, the CE content of the LDL-C particle decreased by approximately 50%. While preliminary, these results are encouraging and suggest that antisense inhibition of ACAT2 may be useful as an antiatherogenic therapeutic in humans.

100 80 60 40 20 0 40 35 30 25 20 15 10 5 0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0

ACAT2 mRNA Baseline 8 weeks

ACAT2 protein

ACAT2 activity

Control

ACAT2 ASO

Figure 22.4 An ACAT2 ASO specifically reduces ACAT2 mRNA, protein, and ACAT2 enzymatic activity in cynomolgus monkeys compared to baseline values. Animals, on a high-cholesterol, saturated-fat diet, were administered 30 mg/kg/week ASO for 8 weeks.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 611


611

22.2.1.5 Antisense Inhibition of ApoB-100 The most advanced cardiovascular antisense therapeutic agent, ISIS 301012, a second-generation 2⬘MOE gapmer targeted to human apoB-100, entered clinical trials in December 2003 [121,122]. The following sections will, first, describe the rationale for the selection of this target; second, review data from extensive preclinical pharmacological and toxicological studies using speciesspecific apoB-100 ASOs; and third, provide efficacy and safety data from phase 1 and 2 clinical trials.

Rationale for Inhibition of ApoB-100 The atherogenic apoB-containing lipoproteins play essential roles in the secretion and transport of dietary and endogenously produced lipids and the transport and uptake of several classes of lipoproteins [123–126]. The human apoB gene codes for two related proteins, apoB-100 and apoB-48. ApoB-100 is the principal apolipoprotein of VLDL, intermediate density lipoprotein (IDL), and LDL-C, and, as described in Section 22.2.1.2, is a key component of Lp(a), an independent risk factor for CHD. It is primarily synthesized in the liver and serves as the ligand for the removal of LDL-C by the LDL receptor and is required for the assembly and secretion of VLDL from the liver. By comparison, apoB-48, which corresponds to the N-terminal 48% of apoB-100, is the integral structural component for chylomicrons, which play a key role in dietary fat absorption. It is encoded by the same mRNA as apoB-100, but is edited by the multicomponent enzyme complex, apobec-1, in the human small intestine [123,124,126–129]. In contrast to man, mice edit apoB-100 to apoB-48 in liver as well as small intestine. The production of apoB-100-containing particles in the liver is a complex, highly regulated, and well delineated process that requires the coordinated addition of triglycerides, cholesteryl esters, free cholesterol, and the apolipoprotein itself, facilitated by the rough endoplasmic reticulum localized protein, microsomal triglyceride transfer protein (MTP) [126,127,130–133]. The expression of apoB mRNA is constant but secretion of the protein is controlled at the posttranscriptional level and varies as a function of the rate lipogenesis [124,134–136]. ApoB-100 is considered to be an atypical secretory protein in that its translocation across the endoplasmic reticulum is inefficient. This results in an increased susceptibility to ubiquitin-dependent proteasomal degradation within the hepatocyte under certain physiological conditions, i.e., the lack of MTP or the core lipids themselves [135,137]. Conversely, when lipid is in excess, the liver responds by rapidly incorporating lipids onto apoB-100, resulting in increased VLDL secretion [138,139] and, ultimately, higher levels of circulating atherogenic apoB-100-containing particles [125,126,128]. ApoB-100 has been shown to play a critical role in cholesterol homeostasis and its overproduction has been associated with various diseases. Elevated apoB and LDL-C levels are observed in several inherited diseases and correlate with premature atherosclerosis [140]. These include familial hypercholesterolemia (FH), familial defective apoB, and familial combined hypercholesterolemia. The latter is the most common of the inherited lipid disorders, affecting 1–2% of the general population [141–145] and results from the hepatic overproduction of VLDL. It is believed to be responsible for 10–20% of premature CHD [144,145]. Abnormalities in apoB-100 metabolism that increase the risk of CHD are also observed in diabetes mellitus and obesity [139,146,147]. In addition to the clear relationship of apoB-100 to LDL-C and cholesterol homeostasis, there are emerging data suggesting that apoB-100 itself is atherogenic through its ability to bind at specific sites to the proteoglycan matrix components of the vascular subendothelium [126]. Eight proteoglycan/apoB-100 binding sites have been identified to date. Interestingly, transgenic mice expressing proteoglycan binding–deficient human LDL-C exhibited far less atherosclerosis than those with the wild-type LDL-C. Conversely, reduction of apoB in vivo has been shown to be beneficial. For example, heterozygous apoB-deficient mice, whose cholesterol and apoB levels are reduced, are protected from diet-induced

CRC_8796_ch022.qxd

612

6/20/2007

10:11 PM

Page 612


hypercholesterolemia [148,149]. Similarly, the benefits of indirectly reducing apoB levels in vivo have been suggested by using chemical inhibitors of MTP [150–152], MTP knockout mice [153], and with Reversa mice whose hypercholesterolemia can be reversed by transient induction of an Mx-I-Cre transgene [151]. Enhancement of hepatic apoB editing by providing apobec-1 to transgenic mice and rabbits reduced plasma apoB-100 [151,154] but resulted in hepatocellular dysplasia and carcinoma, which was thought to be the result of a nonspecific, aberrant editing of unrelated mRNAs involved in cell growth and regulation [155]. More recent data, however, suggest that all members of the apobec gene family might have DNA mutator activity [123]. The most relevant data suggesting that inhibition of human apoB-100 would have beneficial therapeutic effects come from studies in humans with familial hypobetalipoproteinemia, or FHBL [140,156–158]. The majority of individuals with FHBL are clinically asymptomatic and usually detected through routine cholesterol screening programs. These patients are hypolipidemic, with plasma concentrations of apoB and LDL-C typically 25–50% of that observed in normocholesterolemic individuals. In some subjects, triglyceride levels are also significantly reduced [140,156–159]. More importantly, some of these individuals have a low incidence of CHD [156,160,161] and in a recent study, have been shown to have a decreased level of arterial wall stiffness in the presence of nonlipid risk factors, suggesting that low levels of apoB-100 afford some form of cardiovascular protection [159]. Although the genetic defect in many FHBL subjects is not known, three genetic subclasses of this disease have been characterized [140,157–159]. The best-characterized defect in this autosomal dominant condition is linked to chromosome 2, and results in the inability to translate the full-length apoB-100 protein. ApoB/LDL-C levels are ⬍30% compared to age- and gender-matched controls. To date, 45 truncated apoB proteins, ranging in size from apoB-2 to apoB-89 have been identified, with metabolic consequences ranging from reduced VLDL apoB pool size and production rates, to enhanced clearance. Although the subjects with identified truncation mutations are usually clinically asymptomatic, one commonly identified consequence of impairing hepatic VLDL/triglyceride export is a mild hepatosteatosis with concomitant three- to five-fold increases in transaminases. The long-term consequences of these transaminase elevations have not been established [140,157–159]. The second subtype of FHBL has been linked to a susceptibility locus on chromosome 3p21. The genes involved at this locus have not been identified. Subjects with this defect have apoB/LDL-C levels that are approximately 50% of normal controls, are clinically asymptomatic, and have similar metabolic consequences to those with truncation mutations. Interestingly, hepatic steatosis is absent. A third FHBL group that is not linked to chromosome 2 or 3p21, but with similar characteristics to the 3p21 locus, has also been identified. Once again, these subjects lack hepatic steatosis [140,157,158].

In vivo Pharmacology of Species-Specific ApoB Antisense Inhibitors Inhibition of apoB expression by 2⬘MOE ASOs has been shown to significantly reduce hepatic mRNA and protein, serum apoB-100, LDL-C, and total cholesterol in a dose-, drug concentration–, and time-dependent fashion in several species, including mouse, hamster, rabbit, and monkey (Table 22.1). The most extensive studies have been performed in mouse and monkey and key results of these experiments will be described below. Additionally, data from a hamster-specific-apoB ASO and statin combination study will be discussed.

Murine Pharmacology The pharmacology of an optimized murine-specific apoB antisense inhibitor, ISIS 147764, was studied in various models of hyperlipidemia including C57BL/6 mice fed a high-fat diet (diet-induced obesity model), Apoe-deficient mice, and Ldlr-deficient mice. Other studies were performed in C57BL/6 mice on a normal chow diet. In each case, reductions in apoB, LDL-C, and total cholesterol were observed. A majority of these experiments was performed using the high

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 613


613

Table 22.1 Evaluation of ApoB-100 Antisense Oligonucleotides in Various Animal Models Model Lean C57/BL/6 mouse High fat–fed C57/BL/6 mouse Apoe-deficient mouse Ldlr-deficient mouse High fat/chol–fed ob/ob mouse hApoB trangenic mouse Lean New Zealand white rabbit Lean hamster High fat–fed monkey

Liver ApoB mRNA (% Reduction)

LDL-Cholesterol (% Reduction)

Total Cholesterol (% Reduction)

73 87 75 74 57 75 70 80 50

64 88 40 62 52 58 67 66 71

43 55 25 40 43 30 44 52 46

fat–fed model because these mice had significantly elevated LDL-C and total cholesterol levels compared to normal chow–fed littermates [121]. Significant reductions in apoB mRNA levels in liver and serum apoB-100 levels (⬎80%) were observed as a function of dose and time in mice administered the ASO via i.p. injection. None of the multiple control ASOs—including an antisense inhibitor of MTP, scrambled and mismatch compounds—nor atorvastatin, affected apoB mRNA levels. ISIS 147764 did not alter mRNA expression of nontargeted genes, including ACAT, MTP, and HMG-CoA reductase, indicating that inhibition of apoB gene expression was both target- and sequence-dependent. Consistent with those findings, total cholesterol and LDL-C decreased by 25–55% and 40–88%, respectively. Serum triglycerides were also reduced by approximately 25%. The absolute particle numbers of all apoBcontaining lipoproteins, as assessed by NMR, were significantly suppressed as well. However, chylomicrons were unchanged. Loss of apoB mRNA and protein occurred as early as 48 h after dosing and reached maximal reductions 4–6 weeks after treatment was initiated. The lipid-lowering effects of the drug were prolonged (50% reduction 6 weeks after cessation of dosing) and correlated closely with the parent drug elimination half-life of 21 days. These results were also consistent with the extended half-life of 2⬘MOE ASOs in the liver (Chapter 11) [39,41]. Administration of drug in high fat–fed mice for as long as 5 months was not associated with any adverse effects. Levels of ALT and AST, and other metabolic parameters (glucose, ketones, and liver and spleen weights) in apoB-100 ASO–treated mice were similar to those observed in saline and ASO control animals, regardless of the model being evaluated. A key finding was that the murine apoB-100 drug did not produce hepatic or intestinal steatosis. Dietary fat absorption was not altered principally because apoB-100 ASO treatment did not affect intestinal apoB-48 protein or chylomicron formation. Histological evaluation of the small intestine from multiple experiments has demonstrated that there were no differences between saline- and apoB-treated mice.

High Fat–Fed Monkey Studies A primate study was also performed using a monkey-specific apoB ASO, ISIS 326358, to demonstrate that an antisense inhibitor targeting apoB could effectively reduce total-C and LDL-C in high fat–fed cynomolgus monkeys [162]. ISIS 326358 was administered subcutaneously to cynomolgus monkeys (5, 10, or 33 mg/kg/week) for 5 weeks. Treatment with the apoB ASO produced dose- and time-dependent decreases in hepatic apoB mRNA and serum apoB-100 protein (苲50%). Statistically significant ( p ⬍ 0.01) reductions in total cholesterol (up to 50%) and LDL-C (苲70%) were observed as well. In addition to apoB reductions, treatment with the monkey-specific ASO also reduced serum Lp(a) levels by 35%. This finding may have been anticipated because of the nature of the Lp(a) particle described in Section 22.2.1.2. Interestingly, ASO treatment also reduced apo(a) mRNA by 77% through an as yet undefined mechanism. The reduction apoB mRNA and subsequent reduction in serum lipids did not produce hepatotoxicity, as assessed by serum transaminases, nor produce hepatic or intestinal steatosis.

CRC_8796_ch022.qxd

614

6/20/2007

10:11 PM

Page 614


ApoB ASO Treatment Does Not Produce Hepatic Steatosis in Mouse or Monkey A potential toxicity that could result from a reduction in apoB expression might be an accumulation of fat or triglycerides in the liver. Suppression of formation of hepatic apoB-100 protein, could, in theory, reduce the export of triglyceride rich-VLDL, resulting in hepatosteatosis. This phenomenon has been observed in some FHBL patients (described in Section 22.2.1.5, Rationale for Inhibition of ApoB-100), in mice with known truncation mutations of apoB-100 [159,163,164], and after administration of small-molecule inhibitors of MTP [165]. However, as mentioned above, no hepatic steatosis has been observed following apoB antisense–mediated suppression of apoB/LDL-C in either normal or hyperlipidemic mice or monkeys. Key experimental data will be described below. A study was performed in high fat–fed mice over a 20-week treatment period to determine if reductions of apoB mRNA and protein after weekly administration of 50 mg/kg ISIS 147764 would result in accumulation of triglycerides in liver. During this 20-week period, apoB mRNA, total-C, and LDL-C were reduced significantly to 70–85%, 50–70%, and 50–80% of control values, respectively. These effects on apoB-100 expression, total-C, and LDL-C were sustained over the duration of treatment. No adverse effects were observed after this prolonged treatment of mice with ISIS 147764. When liver triglyceride levels were measured, there appeared to be a slight, though not statistically significant, increase in hepatic triglyceride levels after 6 weeks of treatment with ISIS 147764. However, by 12 and 20 weeks, liver triglycerides were significantly lower (⬎60%; p ⬍ 0.01) than those observed in saline control animals. These reduced levels of hepatic triglycerides were also confirmed in Oil Red O–stained livers of ISIS 147764–treated mice. A number of experiments performed using transcriptional profiling (microarray analysis) of liver mRNA derived from apoB-100 ASO–treated mice, as a function of both time and dose, provided possible insight into the absence of hepatic steatosis associated with inhibition of apoB-100 expression. These analyses suggested that a number of key genes involved in cholesterol and fatty acid biosynthesis, as well as transport, were down-regulated as a result of the reduction in apoB. These effects were specific to apoB-100 reduction and were not observed with control ASOs or atorvastatin in high fat–fed mice. Examples of the affected genes include fatty acid synthase (FASN), stearoyl CoA desaturase (SCD), hepatic lipase (LIPC), fatty acid binding protein 2 (FABP-2), and the transcriptional activator sterol responsive element binding protein-1 (SREBP-1). Concomitant with these effects on SREBP-1, fatty acid synthase protein levels were reduced as early as 1 week after ASO administration. Fatty acid synthase is the ratelimiting enzyme responsible for the biosynthesis of saturated long-chain fatty acids. This down-regulation of the fatty acid synthetic pathway is consistent with metabolic adaptations previously described with a targeted apoB-38.9 mutation [163,164]. Up-regulation of AMP-activated protein kinase-␣ (AMPK-␣), a vital sensor of cellular energy levels that affects multiple catabolic and anabolic metabolic pathways, was also observed and is thought to be a key mechanism for promoting fatty acid oxidation [51,166]. AMPK-␣ mRNA levels were doubled after 6 weeks of treatment with the apoB ASO. Consistent with these alterations in lipogenesis/energy balance, while apoB ASO–treated mice do gain weight, they appear to be protected over time from the incremental increases in body mass typically seen in high fat–fed control mice. The resolution of hepatic steatosis via up-regulation of AMPK-␣ observed with ISIS 147764 is consistent with metabolic effects, including stabilization of weight gain without fat malabsorption, observed in ob/ob mice treated with metformin, a drug used for the treatment of Type 2 diabetes [167,168]. Inhibitors of MTP in vivo generally cause significant hepatic and intestinal steatosis, elevations in liver and intestinal triglycerides, inhibition of dietary fat absorption, and elevations in transaminases [165]. Treatment of high fat–fed mice with small-molecule and antisense inhibitors to MTP caused similar effects [169], i.e., increases in transminases and significant hepatic steatosis (Figure 22.5). Secondary transcriptional effects differed as well. For example, AMPK-␣ is not activated after MTP ASO treatment, nor is FABP2 mRNA reduced. These data suggest that pharmacological inhibition

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 615


Saline

SMI

615

ISIS 147764

ISIS 158661

ISIS 144477

Figure 22.5 (See color insert following page 270.) Microsomal triglyceride transfer protein (MTP) inhibitors exacerbate hepatic steatosis in high fat–fed C57BL/6 mice. In this representative experiment, mice were administered 50 mg/kg/week ASOs for 6 weeks and 1 mg/kg daily of a small-molecule MTP inhibitor. Oil Red O–stained liver sections of high fat–fed C67BL/6 mice administered either saline (top left panel), ISIS 147764, the apoB inhibitor (top right panel), small-molecule MTP inhibitor (bottom left panel), ISIS 158661 and ISIS 144477, antisense inhibitors to MTP (bottom middle and right panel, respectively).

of apoB-100 with antisense therapeutics is clearly different from that of MTP using small-molecule or antisense inhibitors and that at least one factor in the toxicities of MTP inhibitors may be the failure to induce secondary liver-protective effects on the transcription of AMPK-␣ and SREBP-1 regulated genes. As described, antisense inhibition of apoB in normal and high fat–fed monkeys is not associated with hepatic steatosis. To further assess the mechanism of this effect, a subset of lipogenic genes that were altered after apoB treatment in mice were examined using monkey hepatic mRNA isolates. A similar expression pattern was observed in monkey, in that the transcription of a number of genes was reduced as a result of apoB-100 suppression, e.g., FASN, FABP2, LIPC, and SCD-1. The key finding is that apoB inhibition appears to result in reduced transcription of SREBP-1 in both species and this, in turn, reduces lipid and fatty acid synthesis. The fact that this relationship is present in rodent and monkey suggests that these compensatory mechanisms are highly conserved and likely to be operant in man. In summary, the data derived from mouse and monkey models of hyperlipidemia using speciesspecific analogs indicate that steatosis is not associated with antisense inhibition of apoB and reduction in total cholesterol and LDL-C. The apparent absence of hepatic and intestinal steatosis may be attributed to several factors. First, while humans and mice with truncation mutations of apoB have deficient export of triglycerides from the liver, antisense inhibition of apoB does not completely abolish apoB-100 protein production; therefore, the export of triglyceride-rich VLDL into the plasma still occurs, although at a diminished rate. Nor does antisense inhibition of apoB produce protein truncation mutations—full-length apoB-100 is still present, albeit at lower levels.

CRC_8796_ch022.qxd

616

6/20/2007

10:11 PM

Page 616


Those characteristics, combined with the down-regulation of a significant number of lipogenic genes and the induction of fatty acid oxidation, appears to ameliorate any potential steatotic progression coincident with apoB suppression.

Hamster Combination Studies In the clinic, it is very likely that the human apoB antisense inhibitor will be co-administered with statins. Because both drugs lower LDL-C by distinctly different mechanisms, it might be predicted that their effects would be additive. To address this question, combination studies were performed in hamsters, a species whose lipoprotein metabolism more closely resembles that of humans [170]. In chow-fed hamsters, administration of simvastatin (10 mg/kg/day) alone reduced total cholesterol (5%) and LDL-C (16%) levels. Administration of the hamster-specific apoB-100 ASO alone for 6 weeks (50 mg/kg/week) reduced apoB-100 hepatic mRNA (Figure 22.6a) and serum protein expression by 70% and reduced serum total cholesterol (27%) and LDL-C (18%) levels, with no overt hepatotoxicity, as defined by increases in serum transaminases. A significant additive reduction in plasma LDL-C was observed in animals treated with an apoB-100 inhibitor (50 mgⲐkgⲐweek) in combination with simvastatin (10 mgⲐkgⲐday). When co-administered for 6 weeks, a 33% reduction in plasma LDL-C levels was observed when compared to saline-treated animals (from 50.8 mg/dL to 33.6 mg/dL, p ⬍ 0.01; Figure 22.6b). These data suggest that combining an apoB-100 antisense inhibitor with statins could produce additive cholesterol-lowering effects in man. ISIS 301012—The Human Antisense Inhibitor to ApoB ISIS 301012 is a second-generation antisense inhibitor that is complementary to a sequence (3249-3269 bp) within the coding region of human apoB mRNA. It is a 20-mer phosphorothioate oligonucleotide comprised of five 2⬘MOE-modified ribonucleosides at the 3⬘ and 5⬘ ends with ten 2⬘-deoxy nucleosides in between. The sequence of ISIS 301012 is 5⬘GCCTCAGTCTGCTTCGCACC-3⬘, where the underlined bases are 2⬘MOE-modified ribonucleosides and all cytosines are methylated at the C5 position.

Preclinical Evaluation The in vitro pharmacological activity of ISIS 301012 was characterized in human cell lines (HepG2, Hep3B) and in human and cynomolgus monkey primary hepatocytes. In these experiments, ISIS 301012 selectively reduced apoB mRNA, protein, and secreted protein in a concentrationand time-dependent manner, with the IC50 for mRNA reduction in primary hepatocytes ⬍10 nM. The effects of ISIS 301012 were shown to be highly sequence-specific. When a series of mismatches were introduced into the ISIS 301012 sequence and tested in HepG2 cells, a single mismatch abolished pharmacological activity. The in vivo activity of ISIS 301012 was also assessed in human apoB–expressing transgenic mice. In multiple experiments, the human apoB inhibitor specifically reduced human, not murine, apoB mRNA, hepatic and serum apoB-100 by more than 80%. Additionally, administration of ISIS 301012 to apoB transgenic/Ldlr–deficient mice significantly reduced aortic sinus plaque volume in animals with advanced atherosclerotic lesions (Figure 22.7) [171]. The potential adverse effects of treatment with ISIS 301012 have been assessed in a number of experiments. Genetic toxicity studies (in vitro bacterial cell and mouse lymphoma gene mutation) and human ether-a-go-go related gene assays have been performed, and results were all negative. Pharmacology studies to assess safety were conducted in accordance with ICH Guidelines and cardiovascular, CNS, renal, and pulmonary systems were unaffected. Fertility and reproductive toxicity studies in mice (Segment I/II) and rabbits (Segment II) were also conducted and no effects on fertility and fetal development were observed. To support clinical trials of longer duration, chronic toxicity studies are currently in progress in mice (6 months) and monkeys (1 year). To date, the toxicity of ISIS 301012 has been evaluated after

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 617


617

(a) 120

ApoB mRNA (% saline control)

100

80

60

40

141923 50 mg/kg/week



349811 12.5 mg/kg/week

Simvastatin 10 mg/kg/day


Saline


0

349811 12.5 mg/kg/week

20

Simvastatin (10 mg/kg/day)

(b) 75

33% 16%

50


Saline

349811 50 mg/kg/week + Simvastatin 10 mg/kg/day

0

Simvastatin 10 mg/kg

25


LDL-C (mg/dL)

20%

Figure 22.6 Administration of an apoB ASO in combination with simvastatin, an HMGCoA reductase inhibitor, lowers hepatic apoB and results in additive reductions in LDL-C in chow-fed Golden Syrian hamsters. Hamsters received ISIS 349811, the apoB ASO, and ISIS 141923, a control ASO, at the indicated doses for 6 weeks, and orally administered simvastatin (10 mg/kg/day). (a) Total mRNA was prepared from liver and apoB mRNA expression analyzed by qRT-PCR. Data are expressed as the mean percentage of mRNA levels in saline-treated hamsters. (b) Additive effects of combination therapy on LDL-C levels.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

618

Page 618


P 0.6 0.5

P P Saline

0.4 0.3 0.2



Volume mm3

Normal intima

Saline

0


*

0.1

*P = 0.033 (one-tailed t test) Figure 22.7 (See color insert following page 270.) ISIS 301012, the human apoB antisense inhibitor, reduces aortic sinus plaque volume in human apoB transgenic/Ldlr–deficient mice. Transgenic mice were administered 20 or 50 mg/kg/week ASO for 14 weeks. Top left panel: Aortic sinus region of saline treated mice. P indicates the plaque that is characterized by neointimal hyperplasia, macrophage foam cells, intracellular lipid, and fibrous caps. Lower left panel: Aortic sinus region of ISIS 301012–treated animals indicating the decrease in plaque volume. Right panel: Quantitative imaging analysis of total plaque volume within the aortic sinus. Administration of ISIS 301012 reduced total aortic sinus plaque volume in a dose-dependent fashion, with the highest dose group reducing plaque by approximately 60%.

4 and 13 weeks of treatment in mice (3.5–88 mg/kg/week) and monkeys (3.5–33 mg/kg/week). A dose-dependent exposure in plasma and tissues was observed with both ISIS 301012 and its metabolites in each of these studies. Repeated administration up to 88 mg/kg/week in mice and 33 mg/kg/week in monkeys produced no treatment-related signs of clinical toxicity, mortality, body weight change, change in food consumption, ophthalmic abnormalities, or changes in renal and cardiovascular function. Mild to moderate dose-related signs of toxicities were observed and can be attributed to the generic chemical class-specific effects of second-generation ASOs rather than specific pharmacological inhibition of apoB expression. These effects included acute and transient changes in hemostasis (primarily in monkeys), or more sustained alterations in tissue morphology (hyperplasia in liver Kupffer cells, kidney tubule epithelial vacuolation). In mice, some of the changes in tissue morphology were associated with modest alterations of hematological and serum chemistry parameters. These effects were generally observed at the high doses levels, correlated with high concentrations of ISIS 301012 in plasma and tissues, and were reversible following discontinuation of treatment. Although the tissue distribution and plasma pharmacokinetic parameters were similar between mice and monkeys, the toxicity profiles were distinct and reflect the sensitivity of mice to the immunostimulatory effects of the drugs [38,172]. Oral tolerability and intestinal absorption of ISIS 301012 with a penetration enhancer (sodium caprate, C10) have also been characterized in mice and dogs after 4 and 13 weeks of treatment. ISIS 301012 in an oral formulation with C10 was well tolerated at doses up to 2100 mg/kg/week in mice and 700 mg/kg/week in dogs. There was no histologic evidence of intestinal toxicity with oral administration of up to 2100 mg/kg/week and 700 mg/kg/week ISIS 301012 with C10 in mice and dogs, respectively.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 619


619

Clinical Trials ISIS 301012 has been extensively studied in the clinic, both in healthy volunteers and in hypercholesterolemic subjects. To date, it has been evaluated for safety, tolerability, and pharmacokinetics in four phase 1 clinical trials, both as monotherapy and in combination with other lipid-lowering agents. The first-in-man study of ISIS 301012 demonstrated significant statin-like reductions in serum apoB, LDL-C, and non-HDL cholesterol. Those results have now been confirmed in two additional phase 1 studies, providing compelling evidence for its efficacy as a lipid-lowering agent in healthy volunteers. In addition to suppression of all atherogenic lipoprotein levels, clinically significant reductions in serum triglycerides were observed. These data are consistent with the pharmacodynamic/pharmacokinetic effects observed in preclinical experiments in multiple species. Data from the completed phase 1 clinical trials are summarized below, along with a brief summary of initial results from the initial phase 2 dose escalation study in hypercholesterolemic subjects failing to reach lipid target levels with diet and exercise alone. Safety and Efficacy of ISIS 301012 in Humans First-in-Human Clinical Trial (ISIS 301012-CS1) The first-in-man clinical trial was conducted as a double-blind, randomized, placebo-controlled, dose-escalation study in 36 healthy volunteers [122]. Eighteen men and 18 women ranging from 30 to 64 years of age were enrolled. Mean fasting total cholesterol and LDL-C levels were 219 (⫾27) mg/dL and 128 (⫾22) mg/dL, respectively. ISIS 301012 was administered at doses of 50, 100, 200, or 400 mg. Following an initial single dose for safety evaluation, subjects entered a multiple dosing regimen comprised of three intravenous (i.v.) loading doses in the initial week (designed to achieve approximately 65% hepatic tissue steady state) followed by once-weekly subcutaneous (s.c.) dosing for three weeks at the same assigned dose. A statistically significant, dose-dependent and prolonged reduction of apoB and LDL-C was observed in subjects administered ISIS 301012 (Figure 22.8). Mean percent reduction in serum apoB and LDL-C levels ranged from 14% to 50% and 4% to 44% relative to baseline shortly after the end of the treatment period (Table 22.2). Significant reductions in apoB and LDL-C were observed in the 200-mg group by day 15 of the multiple dose regimen and levels of these atherogenic lipoproteins remained below baseline ( p ⬍ 0.05) up to 3 months after the last dose. This extended pharmacology was the result of a dose-dependent terminal elimination half-life of 23 days in the 50-mg group and 31 days in the 200-mg group. The prolonged duration of the effect of ISIS 301012 is consistent with (1) preclinical data with species-specific apoB ASOs and (2) the general pharmacokinetic behavior of second-generation antisense inhibitors (Chapter 11). Dose-dependent reductions were also observed in total cholesterol and triglycerides, with maximum reductions of 39% and 43% in the highest dose group of 400 mg (Table 22.2). No statistically significant changes were observed in HDL-C. NMR analysis of lipoprotein particle subclass levels demonstrated preferential reduction of small dense LDL particles. A maximum of 63% and 88% reduction in small LDL particle number was observed in the higher dose groups of 200 mg (Figure 22.9) and 400 mg (data not shown), respectively. The safety profile of ISIS 301012 in this study was satisfactory as no drug-related serious adverse events were reported. Injection-site reactions were the most common adverse event, occurring in 72% of all treated subjects. These responses typically consisted of mild, painless erythema, with spontaneous resolution over a median period of 5 days. Mild elevations in serum ALT levels, with an incidence less than or equal to currently marketed statins [173], were also observed during the course of study. These elevations were asymptomatic and never accompanied by abnormalities in liver function. This seminal phase 1 study with ISIS 301012 provides the first demonstration of potent apoB and LDL-C lowering by an antisense mechanism in humans. The outcome from this study also provided precedent for an investigation of the safety and pharmacokinetics of ISIS 301012 in combination treatment with existing oral hypolipidemic agents as well as the first phase 2 monotherapy study in subjects failing to meet target cholesterol levels with diet and exercise alone.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 620

620


(a)

(b) Placebo

50 mg

100 mg

200 mg

Placebo

400 mg

LDL-C mean % change

ApoB mean % change

−10 −20 −30 −40

200 mg

400 mg

−10 −20 −30 −40 −50

−50

−60 0

10

20

30

40

50

60

70

80

90

0

10

20

30

Days

40

50

60

70

80

90

Days

(c)

(d) 10

Placebo

50 mg

100 mg

200 mg

0 −10 −20

*

−30 −40

†

−50 −60

400 mg

LDL-C mean % change ±SEM

ApoB mean % change ± SEM

100 mg

0

0

−60

50 mg

10

10

0

Placebo

50 mg

100 mg

200 mg

400 mg

−10 −20 −30 −40

†

−50

Figure 22.8 Dose-dependent effect of ISIS 301012 on (a) apoB and (b) LDL C levels, presented as mean percent change from baseline. The multiple dosing period was from day 0 to day 22. Baseline is defined by measure prior to initial treatment of each subject. Significant reductions in (c) ApoB and (d) LDL-C were observed in the 200-mg group in the posttreatment period (day 39). Data presented as percent change from baseline, bars represent mean ⫾ standard error. P values determined from the Wilcoxon Rank-Sum test, where “*” indicates ⱕ0.05 and “†,” ⱕ0.01.

Table 22.2 ApoB and Lipids Levels in Humans after Administration of ISIS 301012 (ISIS 301012-CS1) Characteristic ApoB

LDL-C

HDL-C

Cholesterol

Triglyceride

Mean ⫾ SD Median IQR Mean ⫾ SD Median IQR Mean ⫾ SD Median IQR Mean ⫾ SD Median IQR Mean ⫾ SD Median IQR

Placebo (7)

50 mg (8)

100 mg (8)

2.3 ⫾ 20.9 ⫺13.5 ⫾ 9.0 ⫺22.2 ⫾ 15.0* 4.4 ⫺15.9 ⫺19.2 ⫺20.4 to 12.2 ⫺19.0 to ⫺ 7.6 ⫺23.2 to ⫺12.7 ⫺0.8 ⫾ 13.0 ⫺3.7 ⫾ 15.8 ⫺18.6 ⫾ 13.5 –2.6 ⫺7.8 –17.8 ⫺8.6 to 12.6 ⫺13.5 to 2.1 ⫺31.1 to ⫺7.1 7.4 ⫾ 19.7 5.8 ⫾ 9.5 1.2 ⫾ 13.2 ⫺1.6 6.1 ⫺0.8 ⫺3.6 to 29.2 1.6 to 12.4 ⫺8.3 to 12.2 7.2 ⫾ 9.6 ⫺1.2 ⫾ 8.7 ⫺12.4 ⫾ 8.2† 8.5 ⫺0.1 ⫺12.9 ⫺2.9 to 14.9 ⫺10.0 to 6.9 ⫺18.5 to –5.2 12.0 ⫾ 43.1 23.4 ⫾ 34.5 9.9 ⫾ 44.1 ⫺3.3 15.6 3.7 ⫺17.1 to 39.2 ⫺1.7 to 40.2 ⫺12.7 to 17.5

200 mg (8) ⫺38.5 ⫾ 18.0† ⫺36.6 ⫺57.2 to ⫺21.3 ⫺35.2 ⫾ 19.3† ⫺35.2 ⫺47.1 to ⫺21.6 0.9 ⫾ 9.5 0.6 ⫺4.9 to 4.5 ⫺26.8 ⫾ 13.9‡ ⫺28.0 –35.7 to ⫺12.9 ⫺15.1 ⫾ 23.1 ⫺19.9 ⫺30.0 to ⫺3.2

400 mg (2) ⫺49.5 ⫺49.5 ⫺57.9 to ⫺41.1 ⫺44.2 ⫺44.2 ⫺51.2 to ⫺37.1 5.2 5.2 ⫺0.4 to 10.8 ⫺38.6 ⫺38.6 ⫺46.5 to ⫺30.7 ⫺42.8 ⫺42.8 ⫺51.7 to ⫺34.0

Note : IQR stands for interquartile range and SD, standard deviation. Percent change relative to baseline 2 weeks after cessation of the treatment period (day 39). P values were determined by the Wilcoxon Rank-Sum Test. ∗ ⱕ0.05. † ⱕ0.01. ‡ ⱕ0.001.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 621


Total

(a)

Large

621

Small

1600

Mean particle conc. (nM)

1400 1200 1000 800 600 400 200 0 0

8

15

22

25

39

55

69

83

Day (b)

Day 55 (200 mg)

LDL (nmol/L)

% change (baseline)

Total

684 ± 87

− 51 ± 7‡

Large

385 ± 41

− 27 ± 6*

Small

289 ± 82

− 63 ±11†

Figure 22.9 Preferential and prolonged reduction of small LDL-C after administration of ISIS 301012 in the 200-mg dose group. (a) Mean LDL particle subclass levels from day 0 to day 83. (b) Maximum mean percent change from baseline in small LDL particle levels was observed on day 55. P values were determined by the Wilcoxon Rank-Sum test, where “*” indicates ⱕ0.05; “†,” ⱕ0.01; and “‡,” ⱕ0.001.

Confirmation of Safety and Efficacy (ISIS 301012-CS101) In a second phase 1 study designed to evaluate oral dosage forms of ISIS 301012 (Chapter 8), six subjects were administered an equivalent 350 mg/week of ISIS 301012 by i.v. infusion over a 6-week treatment period. Three men and 3 women ranging from 21 to 55 years of age, with a mean fasting total cholesterol level of 228 (⫾ 50) mg/dL and LDL-C level of 160 (⫾ 38) mg/dL were randomized into this cohort. This “positive control” group (the cohort receiving the parenteral equivalent of 350 mg/week) achieved a median reduction in apoB and LDL-C of 60% and 54%, relative to baseline (Figure 22.10). Serum triglycerides were also significantly reduced by 46% ( p ⫽ 0.005) in this cohort. The long duration of effect was similar to that observed in the initial phase 1 study (Figure 22.8). Two subjects experienced minor elevations in liver transaminases that might be related to study drug, however, this relationship is unclear. No other unexpected toxicities or safety issues were reported. Combination Treatment with Other Lipid-Lowering Agents (ISIS 301012-CS2) Statins and ezetimibe are two of the most commonly prescribed cholesterol-lowering agents today. Statins act by inhibiting HMG CoA reductase in the liver and subsequently increasing hepatic LDL receptor expression, while ezetimibe inhibits absorption of dietary cholesterol from the small intestine. A phase 1 study was performed to determine the safety and pharmacokinetics of ISIS 301012 as an add-on therapy to each of these two cholesterol-lowering agents and to specifically provide evidence for the lack of a drug-drug interaction with the antisense inhibitor to apoB. This study specifically evaluated the pharmacokinetics of combinations of simvastatin/ISIS 301012 and ezetimibe/ISIS 301012 and was designed as a one-sequence crossover of the oral hypolipidemic agent, initially administered alone, and subsequently, in combination with 200 mg of ISIS 301012. The dose regimen for ISIS 301012 was designed to achieve near steady-state tissue accumulation by the end of dosing, equivalent to once-weekly dosing of 200 mg. Twenty healthy male volunteers ranging in age from18 to 64 years and with a mean fasting total cholesterol level of 183 (⫾ 40) mg/dL and LDL-C level of 129 (⫾ 37) mg/dL were enrolled in this

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 622

622

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION (a)

Placebo

350 mg/week

10

ApoB mean % change

0 −10 −20 −30 −40 −50 −60 −70 0

10

20

30

40

50

60

70

80

90

100 110 120

130

100 110 120

130

100 110 120

130

Days

(b)

Placebo

350 mg/week

20 10

LDL-C mean % change

0 −10 −20 −30 −40 −50 −60 −70 0

10

20

30

40

50

60

70

80

90

Days

(c)

Placebo

350 mg/week

20

Triglyceride mean % change

10 0 −10 −20 −30 −40 −50 −60

0

10

20

30

40

50

60

70

80

90

Days

Figure 22.10 Confirmation of ISIS 301012 efficacy after administration of 350 mg/week to subjects in a second phase I study (ISIS 301012-CS101). Mean percent change from baseline in (a) apoB, (b) LDL-C, and (c) triglycerides. Treatment period was for 6 weeks starting on day 0. Placebo is pooled data from two cohorts receiving oral dosage forms without drug (n ⫽ 12). Data are presented as percent change from baseline, where bars represent mean ⫹ standard error.

open-label study. Subjects received either a single oral dose of 40 mg of simvastatin (n ⫽ 10) or 10 mg of ezetimibe (n ⫽ 10) on day 1. Following clearance of the initial dosed drug, subjects received four i.v. infusions of 200 mg of ISIS 301012 over an 8-day period. The combination agents were then administered again with the last dose of ISIS 301012. The pharmacokinetics of ISIS 301012 was not significantly affected by concomitant administration of either simvastatin or ezetimibe. Consistent with the well-established fact that antisense compounds are not metabolized via the cytochrome P450 system, plasma concentration curves and plasma half-lives of simvastatin and ezetimibe were also unaffected when administered in combination with ISIS 301012. A moderate lowering in the Cmax of simvastatin and free ezetimibe was

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 623


623

observed upon co-administration with ISIS 301012. These values, however, were consistent with those reported in the literature for each agent alone. The safety profile of ISIS 301012 in combination with each of these drugs was satisfactory. No abnormal laboratory parameters, including elevations in transaminases, were present in this study and no serious adverse events were reported.

Treatment of Hypercholesterolemia (ISIS 301012-CS3; NCT00216463) Following demonstration of substantial apoB and LDL-C lowering in healthy volunteers, a phase 2 clinical study was designed to examine dose and dose frequency of ISIS 301012 as a single agent in hypercholesterolemic subjects unable to reach target cholesterol levels by lifestyle changes alone. Treatment duration was extended to 13 weeks. Pharmacological outcomes from the first three dose cohorts are summarized below. Twenty-five men and 5 women, 28 to 64 years of age, were enrolled in this placebo-controlled, double-blind study. Fasting baseline total cholesterol ranged from 195 to 340 mg/dL, with a mean of 251 (⫾ 36) mg/dL, while baseline LDL-C levels ranged from 127 to 266 mg/dL, with a mean of 168 (⫾ 32) mg/dL. Subjects were randomly assigned to receive one of three ISIS 301012 dose regimens or placebo (4:1 ratio of active:placebo) for 3 months. Study drug was administered by s.c. injection at a dose of 200 mg twice weekly for two weeks followed by 100 (50 mg/week group) or 200 mg (100 mg/week group) every other week for 11 weeks, or 200 mg once per week for 13 weeks (200 mg/week group) without an initial loading dose. Weekly dosing with 200 mg ISIS 301012 for 13 weeks resulted in a 42% reduction in LDL-C from baseline ( p ⬍ 0.001 to placebo) two weeks after treatment, with concomitant reductions in apoB (47%, p ⬍ 0.001) and non-HDL cholesterol (44%, p ⬍ 0.001—data not shown). Significant reductions in triglycerides and VLDL were also observed with median reductions of 46% ( p ⫽ 0.04) and 54% ( p ⫽ 0.02), respectively. ApoB and LDL-C levels were reduced by 22–23% and 12–22%, respectively, in the 50- and 100-mg/week dose groups. No significant changes in HDL-C levels were observed. As monotherapy, ISIS 301012 has now demonstrated significant lowering of apoB, LDL-C, VLDL, total cholesterol, and triglycerides in healthy volunteers and subjects who are unable to control elevated cholesterol by diet and exercise alone. Treatment has been well tolerated in all dosing cohorts. Tolerability and Safety Profile Subcutaneous Injections Local injection-site reactions (ISRs) are the most common adverse event observed in subjects after s.c. administration of ISIS 301012 (Table 22.3). These reactions are a common side effect in humans of subcutaneous administration of both first- and second-generation ASOs (Chapter 13), as well as other pharmacologic agents [174]. ISRs, which appear to be dosedependent, are most accurately characterized as painless local erythema that subsides spontaneously. Two approaches have been evaluated to mitigate the incidence and severity of skin reactions in an open-label, observer-blind, dose-escalation phase 1 study (ISIS 301012-CS301). The first was the co-administration of ISIS 301012 with local corticosteroid. The second approach was to divide a single dose into multiple simultaneous, smaller, s.c. injections. Local skin responses were assessed clinically and by microscopic analysis of skin biopsies. In cohorts that evaluated the effects of concomitantly administered corticosteroids, the overall incidence of erythema was 42% (21 of 50 subjects) at the ISIS 301012–alone injection site, and 36% (18 of 50 subjects) at the steroid co-administered site. A notable reduction in the duration of erythema was observed in subjects who received a 200-mg dose of ISIS 301012 admixed with 1 mg dexamethasone sodium phosphate (n ⫽ 10), where a median duration of 2 days was observed compared to 4 days at the ISIS 301012–alone injection site. Usage of multiple injection sites for a single dose had no clinically relevant effect on the incidence or duration of erythema. Histologically, ISRs were characterized by prominent macrophage and neutrophil infiltration, whereas negative clinical findings were associated with minimal infiltration. The onset of microscopic changes was generally seen at 24–48 h postinjection. No significant microscopic findings were

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 624

624

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Table 22.3 Adverse Events Reported in ⱖ5.0% of ISIS 301012–Treated Subjects in ISIS 301012-CS1, CS2, CS3, CS101 (Positive Control Cohort), and CS301 ISIS 301012 (N ⫽ 139) Adverse Event

n

Erythema Swelling Bruising Induration Inflammation Hemorrhage

76 46 30 23 21 8

Headache Fatigue Discomfort Pyrexia

33 17 12 9

Placebo (N ⫽ 13) %

n

%

Injection Site Reactions* 67 41 27 20 19 7.1

0 0 0 0 0 0

0 0 0 0 0 0

24 12 8.6 6.5

7 1 0 0

54 7.7 0 0

8.6

1

7.7

7.2 5.8

1 1

7.7 7.7

5.0

1

7.7

General

Infection Nasopharyngitis

12 Gastrointestinal

Nausea Constipation

10 8

Elevated ALT

7

Liver Function

* Percent of subjects are based on a total of 113 subjects who received ISIS 301012 subcutaneously. No ISRs were reported for subjects who were administered ISIS 301012 by intravenous infusion only (CS2, CS101).

observed in biopsies from the steroid co-administered site at these time points. The degree of histologic change within the biopsy sites correlated directly with the amount of stainable (and measured) drug present. Methods to determine whether more rapid systemic absorption may mitigate this histology are currently under investigation.

Other Adverse Events Asymptomatic, transient, and, in most cases, mild elevations in hepatic transaminases (⬍3 X upper limit of normal) have also been observed in ISIS 301012–treated subjects. In each incidence, transaminase levels returned to normal without the need for additional interventions. No associated abnormalities in bilirubin or evidence for liver dysfunction have been observed. Two reports of hepatic steatosis in subjects with elevated ALTs have been received, but in each instance the relationship to study drug is uncertain. No clinically relevant changes in renal function, as determined by urinalysis, glomerular filtration rate or serum creatinine, have been observed. Additionally, in contrast to MTP inhibitors [165], there has been no evidence of steatorrhea in any ISIS 301012 study to date, nor of changes in serum vitamin A levels that would indicate an adverse affect on fat-soluble vitamin absorption. Hybridization-independent toxicities such as aPTT prolongation have occurred within the expected ranges, been rapidly reversible, and have not been clinically significant. No other clinically significant adverse events have been observed and no treatment-related serious adverse events (SAEs) have been reported to date. Combination Treatment Combination dosing of ISIS 301012 with simvastatin or ezetimibe yielded no adverse events in healthy volunteers. This result sets the stage for further evaluation of ISIS 301012 in patients on stable doses of these widely prescribed lipid-lowering agents. These studies are currently in progress.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 625


625

Table 22.4 Efficacy of ISIS 301012 after 3 Months of Dosing at 200 mg/Week in Comparison to Efficacy of Statins after Intensive Treatment for 4 (Rosuvastatin) and 18 Months (Atorvastatin) Intervention

Antisense ApoB

Rosuvastatin

Atorvastatin

Clinical Trial Dose Treatment Period

ISIS 301012-CS33 200 mg/Week 3 Months

ASTEROID1 40 mg/Day 24 Months

REVERSAL2 80 mg/Day 24 Months

125 69 ⫺47

128 75 ⫺42

152 92 ⫺39

171 96 ⫺42

130 61 ⫺53

150 79 ⫺46

ApoB Baseline Endpoint % Change LDL-C Baseline Endpoint % Change

Note : Mean baseline and endpoint values are in mg/dL. 1 Nissen, S.E. et al., JAMA, 295, 1556–1565, 2006. 2 Nissen, S.E. et al., JAMA, 291, 1071–1080, 2004. 3 Percent change from baseline is presented as the median value.

Efficacy Profile Antisense inhibition of apoB in humans results in statin-like reductions in apoB, LDL-C (Table 22.4), and all atherogenic lipoproteins and lipids, including triglycerides. The favorable impact on LDL-C subclass distribution is encouraging. Significant changes in HDL-C have not yet been observed in these studies with small numbers of subjects [175]. The relatively long, dose-dependent tissue half-life of ISIS 301012 yields persistent and prolonged reductions in atherogenic lipoproteins. This attribute can be expected to eventually facilitate less frequent dosing, perhaps monthly or even quarterly drug administration. Ongoing and Future Studies With positive outcomes in the initial clinical trials, phase 2 studies are now in progress to (1) assess pharmacology when administered in combination with statin therapy, (2) evaluate safety and pharmacology of higher doses, (3) define dosing intervals, (4) investigate safety and pharmacology in subjects with familial hypercholesterolemia (FH), and (5) determine if pharmacological reduction in apoB results in hepatic steatosis (as assessed by serial liver triglyceride content) in subjects after administration of ISIS 301012. Inhibition of ApoB Using siRNA in Preclinical Animal Models Inhibition of apoB expression was also observed in mice after short-term treatment with a cholesterol-conjugated apoB siRNA [176]. In these studies, intravenous administration of the conjugate to C57BL/6 and human apoB transgenic mice delivered drug into several organs, including liver, intestine, heart, kidney, lung, and adipose tissue. ApoB mRNA was reduced by 苲70% in the jejunum and 50% in liver. Serum apoB-100 protein, total cholesterol, LDL-C, and chylomicron levels were also reduced (68%, 37%, 40%, and 50%, respectively). Unconjugated apoB siRNAs were not taken up into cells and were, therefore, pharmacologically inactive. The authors did not show pharmacological effects and stability of the drug in long-term studies in the chow-fed, transgenic or, importantly, hyperlipidemic mice. The potential toxicities of this compound and the cholesterol adduct alone, including elevations in transaminases and effects on lipid accumulation in liver and intestine, were not addressed. This is particularly important given that our laboratories have demonstrated that cholesterol-conjugated oligonucleotides are hepatotoxic [177]. Finally, given the significant reductions in chylomicrons observed after drug treatment, dietary fat and fat-soluble vitamin malabsorption could be a serious side effect of the cholesterol-conjugated apoB siRNA in vivo. An apoB specific-siRNA that was encapsulated in a liposomal preparation (stable nucleic acid lipid particles-SNALP) also inhibited apoB mRNA and protein and lowered total and LDL-C in

CRC_8796_ch022.qxd

626

6/20/2007

10:11 PM

Page 626


monkeys after single i.v. injections of 1 or 2.5 mg/kg of the formulated drug [178]. Two days after administration of the compounds, liver apoB mRNA was reduced from 68% to 90% (1 and 1.5 mg/kg doses, respectively) and correlated with tissue levels of the drug. The reduction in apoB message was prolonged, as 2 monkeys, 11 days after receiving the higher dose of drug, still had an approximate 91% reduction of apoB message. There was no effect of the siRNA-SNALP on apoB mRNA levels in the jejunum, in contrast to the effects of the cholesterol-siRNA conjugate described. Maximal reductions of LDL-C and total cholesterol were 82% and 62%, respectively in the highest dose group. Tolerability of the SNALP-siRNA was evaluated using various parameters and while there was no evidence of complement activation, delayed coagulation, or the induction of proinflammatory cytokines, there was, however, a significant and prolonged increase in transaminase levels that peaked 48 h after injection of the highest dose. Both AST and ALT levels were approximately 25 times greater than predose values at this time. The transaminitis appeared to resolve modestly over time. For example, at days 6 and 11, ALT levels day values were still 12 and 3 times greater, respectively, than those observed before administration of the drug. The long-term effects of SNALP-apoB siRNA were not addressed in lean or hyperlipidemic monkeys and, most importantly, the authors did not determine what factor or factors (e.g., liposomes) were responsible for the transaminitis. As others have mentioned in this volume (Chapters 1 and 3), while siRNA is a great target validation tool in vitro, many hurdles, including delivery, safety (off-target effects, toxicities of delivery vehicles), and development issues, remain before siRNA therapeutics can be used for the chronic treatment of a variety of diseases. 22.2.2 Antisense Inhibition of CRP, a Nonlipid Hepatic Target Involved in CHD CRP, the prototypic positive acute phase protein, is produced primarily by the liver as part of the body’s homeostatic mechanism to restrict injury and promote repair after an acute inflammatory stimulus [179–183]. Elevated levels of CRP are often observed in a variety of medical conditions including metabolic syndrome, various inflammatory diseases and malignancies, diabetes mellitus, and end-stage renal disease. However, in recent years, the relationship of CRP to the inflammatory aspects of atherosclerosis has been an area of intense interest [184–186]. On the basis of multiple prospective epidemiological studies, CRP has become recognized as an independent marker and powerful predictor for future risks of myocardial infarction (MI), stroke, and deaths from CHD in individuals apparently free of known cardiovascular disease [181,185,187]. The precise function of CRP in CHD is extremely controversial and many in the scientific community believe that it is solely a biomarker, and not a participant in the pathogenesis of atherosclerosis [188,189]. Nonetheless, there is increasing evidence in vitro that CRP promotes vascular damage, increases thrombosis, and inhibits fibrinolysis within plaques. In vivo studies have demonstrated that CRP can activate complement [190], was detected in early atherosclerotic lesions [191], and was colocalized with activated complement components and enzymatically degraded LDL in human atherectomy lesions [192,193]. Even more compelling data suggestive of CRP’s role as a mediator of atherothrombotic events emerged from a study by Bisoendial [194] where administration of recombinant human CRP to human volunteers was shown to induce endothelial cell activation, activate the coagulation cascade, and elicit an acute systemic inflammatory response. What is needed to address (1) the epiphenomenon versus causal role of CRP in the pathogenesis of atherosclerosis and (2) whether reduction of that acute phase reactant results in a meaningful decrease in adverse clinical outcomes in CHD is a pharmacological inhibitor of CRP. To date, the only small-molecule inhibitor of CRP is 1,6-bis(phosphocholine)-hexane, which binds circulating CRP [195]. Preliminary data suggested that daily, intravenous infusion of this compound was cardioprotective in rats. However, a more stable and direct inhibitor of human CRP would be more useful to delineate the role of that acute phase reactant in CHD. Several monkey/human cross-reactive antisense inhibitors targeting hepatic CRP have been characterized and tested in vitro and in vivo in our laboratories [196]. The potency for reduction of CRP mRNA and protein was confirmed in both monkey and human primary hepatocytes

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 627


627

(IC50 ranged from 5 to 25 nM). Two sequences were compared in a dose escalation study where animals were administered these second-generation 2⬘MOE compounds, using either the 5-10-5 or 3-14-3 configuration, in four dosing cycles over an 8-week period and then challenged with IL-6. Several of the compounds were pharmacologically active as defined by their ability to reduce IL-6-induced hepatic CRP mRNA (60–85%) and serum CRP (30–66%) levels. Standard toxicological endpoints, including clinical signs, serum chemistry, hematology, and body weights, were evaluated as well. Our data suggest that the antisense pharmacological reduction of CRP was safe. All four ASOs produced a similar spectrum of changes, although subtle differences in tissue distribution and concentration were observed in the kidney with the 3-14-3 gap-widened compounds. Several human/monkey CRP inhibitors were also evaluated in mice expressing the human CRP transgene [197–199]. Human CRP has been shown to accelerate the rate of thrombotic occlusion after vascular injury and potentially contribute to the progression of atherosclerosis in apolipoprotein E–deficient mice in one laboratory [200]. In a preliminary experiment from our laboratories, serum CRP was reduced (75–99%) in transgenic mice after 2 weeks of treatment with 50 mg/kg/week CRP ASOs. In another study, 2-week systemic administration of a human CRP antisense inhibitor (50 mg/kg/week) significantly reduced serum CRP levels (⬎90%; Figure 22.11a) and improved time to thrombotic occlusion in animals after photochemical injury (Figure 22.11b). More extensive (a) 6

CRP (mg/L)

4

2

0 Baseline

Pre-injury

Post-injury

(b)

Occlusion time (min)

160

120

80

40

0 WT

ASO-tg

CRPtg

Figure 22.11 Effect of a human CRP ASO in CRP transgenic mice administered drug (50 mg/kg/week) for 2 weeks. (a) Reduction in serum CRP levels pre- and post-photochemical vascular injury. (b) CRP ASO treatment improves time to occlusion after vascular injury.

CRC_8796_ch022.qxd

628

6/20/2007

10:11 PM

Page 628


studies are in progress to determine the therapeutic effectiveness of these inhibitors in models of carotid artery ligation (transgenic mouse and normal rat) [201]. 22.2.3 Antisense Inhibitors for the Treatment of Hypertension Hypertension has been established as a causal, independent risk factor for the development of CHD and the benefits of antihypertensive therapy have been demonstrated in several large, interventional clinical trials [50,201–203]. The factors that contribute to the normal and hypertensive states are complex and multifactorial. Essential hypertension, or systemic arterial hypertension, occurs in 90% of patients with elevated blood pressure, while the remaining 10% of patients develop hypertension that is secondary to renal disease [203]. Even with an extensive antihypertensive therapeutic armamentarium (diuretics, Ca2+ channel blockers, vasodilators, sympatholytic drugs, angiotensin-converting enzyme inhibitors, and angiotensin II- receptor antagonists), only 30% of hypertensive patients can adequately control their blood pressure. In fact, the incidence of hypertension has increased over the past decade [201–204]. The renin-angiotensin system (RAS) is vital to the regulation of arterial blood pressure and components of the system are localized in the CNS, kidney, pituitary, adrenal glands, liver, heart, lung, fat, and the vasculature [205,206]. Key mediators of the RAS include angiotensin I and II, (Ang I and II), angiotensin II type 1 and type 2 receptors (AT1R, AT2R), angiotensinogen (AGT), angiotensin-converting enzyme (ACE), and renin. Data from human genetic studies and a variety of rodent transgenic and knockout models suggest that dysregulation of this complex pathway contributes to the hypertensive state [203,206,207]. First-generation (phosphodiester and phosphorothioate) ASOs designed to inhibit components of RAS have been tested in rodent models [203,206,208,209], including the spontaneously hypertensive rat (SHR), a model of essential hypertension [210], the two kidney one clip surgical [211], and the cold-induced hypertension model [212]. AT1R, AGT, and renin ASOs administered by intracerebroventricular (i.c.v) injection into the 3 models described above resulted in transient 16–45% reductions in blood pressure [203,206]. In some experiments, in addition to reduction in blood pressure, drinking responses to renin and isoproteronol were attenuated. The extent and duration of the effects varied (2 to more than 5 days) as a function of the model and the chemical modification of the drug. Systemic administration of those ASOs has also been reported to modestly reduce elevated blood pressure (20–30%) [206]. More recently, viral vectors have been used to deliver these first-generation RAS ASOs in the brain and systemically [203,206,208], with several groups demonstrating long-lasting antihypertensive effects in normo- and hypertensive animal with no evidence of toxicities. An enormous amount of work must be completed before RAS or other antihypertensive-specific ASOs can approach the clinic. For example, while reductions in hypertension were observed after ASO treatment, the effects were modest and not superior to those observed with existing antihypertensive therapeutics. Additionally, the routes of administration of these ASOs for this indication are inconvenient (i.c.v) and have the potential to produce serious toxicities (viral vectors) [206,213,214]. The use of the retroviral vectors for delivery of ASOs is also not necessary given that first and, most importantly, second-generation compounds have been shown to be widely distributed and pharmacologically active in vivo after multiple routes of administration. Nevertheless, these proof-of-principle studies suggest that antisense inhibitors may be a useful therapeutic approach for the treatment of another unmet cardiovascular medical need. 22.2.4 Antisense Inhibitors Affecting Restenosis Percutaneous coronary intervention (PCI) is the primary revascularization procedure for the treatment of coronary artery disease. Drug eluting stents coated with sirolimus or paclitaxel have proven to limit the incidence of in-stent restenosis by local delivery of these antiproliferative

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 629


629

agents to the site of angioplasty [215,216]. Consistent with this approach, ASOs targeted to a variety of regulatory and signaling molecules involved in excessive vascular smooth muscle proliferation have also been investigated for prevention of neointimal hyperplasia [217–224]. Some of the targets that have been investigated both in vitro and in vivo include cyclin-dependent kinase 2 (cdk2), cell division cycle 2 kinase (cdc2), cyclin B1, proliferating cell nuclear antigen (PCNA), NF-B, platelet-derived growth factor (PDGF), c-raf, basic fibroblast growth factor (bFGF), c-myb, and c-myc. Antisense inhibitors for c-myc, a proto-oncogene that regulates the growth of vascular cells within atherosclerotic lesions, have been evaluated in the clinic for their ability to prevent PCIinduced intima cell proliferation. Two types of antisense chemistries have been evaluated—a firstgeneration phosphorothioate ASO [225] and a neutral (dimethylamino) phosphinylideneoxy-linked morpholino ASO (Chapter 20) [218,226]—both based on the sequence complementary to the translation initiation region of the c-myc transcript. In the ITALICS trial, a 15-mer phosphorothioate ASO was evaluated for its ability to inhibit restenosis in patients who received a coronary stent implant [225]. A single dose of 10 mg of ASO was delivered locally by catheter to 85 patients immediately after stent placement. The primary end point was percent in-stent volume obstruction as measured by intravascular ultrasound (IVUS) 6 months following catheterization. Unfortunately, the investigators were unable to distinguish differences between the in-stent volume in placebo and antisense-treated patients. Additionally, there were no significant differences in secondary angiographic parameters or in the clinical event rate between treatment groups at the 6-month follow-up visit. Lack of efficacy was attributed to insufficient absorption and uptake of oligonucleotide by the intima tissue, and, possibly, insufficient local drug retention time using the catheter-based delivery system. The c-myc ASO, AVI-4126, or Resten-NG, used in the AVAIL trial had been previously reported to inhibit c-myc mRNA expression and reduce neo-intimal formation after endoluminal delivery in treated vessels in rabbit and pig models of restenosis (Chapter 20) [225,226]. The investigators concluded that high-dose Resten-NG, 6 months after local delivery (10 mg) via infiltrator catheter during PCI to a small cohort of patients (n ⫽ 12), safely reduced neointimal formation. A larger phase 3 trial has been initiated to confirm and extend these results and to show superiority over existing drug-eluting stents. To date, no further data have been reported.

22.3 SUMMARY AND FUTURE PERSPECTIVES Cardiovascular disease is currently the leading cause of morbidity and mortality in the United States and all industrialized nations, with total healthcare costs approaching hundreds of billions of dollars. While multiple risk factors have been identified that predispose individuals to this disease, it has become fairly clear that there is a direct and causal relationship between elevated LDL-C and CHD. Despite the availability of existing therapies, only a small fraction of high-risk patients achieve their LDL-C goals. The recent revision of the NCEP guidelines recommending even lower LDL-C levels, coupled with the growing recognition of the involvement of other lipid (Lp(a), triglycerides, HDL-C) and nonlipid factors (CRP) in cardiovascular disease, suggests the need for novel and more effective pharmacological agents to be used as monotherapy or in combination with existing drugs. The (1) specificity of antisense technology, (2) optimal distribution within liver, kidney, and atherosclerotic plaques, (3) ability to inhibit unique targets involved in dylipidemias and cardiovascular disease, and (4) their lack of interaction with the cytochrome P450 system suggest that antisense drugs represent a valuable, novel therapeutic modality. Efficacy and safety data derived from extensive preclinical and clinical studies, especially with the newer generation 2⬘MOE drugs, suggest that these compounds have great potential to fulfill the unmet medical needs in cardiovascular medicine.

CRC_8796_ch022.qxd

630

6/20/2007

10:11 PM

Page 630


The antisense agents described in this chapter, many representing previously unapproachable targets, have shown impressive effects in vivo, and may, with more extensive evaluation, prove efficacious in the clinic. The collective data provide an excellent demonstration of the strengths of the technology platform and, importantly, help delineate the role of various unique genetic factors contributing to dyslipidemias and the pathogenesis of atherosclerotic heart disease. ISIS 301012, the second-generation 2⬘MOE drug to human apoB-100, is the most advanced of the antisense inhibitors for the treatment of cardiovascular disease. It is an exemplar antisense drug and highlights the efficiencies of the technology. ApoB-100 has been therapeutically unapproachable by small-molecule inhibitors or antibodies but has proven to be an excellent candidate for antisense inhibition. On the basis of data from extensive preclinical studies, our hypothesis that suppressing apoB mRNA in the liver would ultimately result in concomitant reductions in total cholesterol and LDL-C was proven correct. Consistent with the preclinical data, ISIS 301012 has shown impressive efficacy in four phase 1 studies and one phase 2 trial, with statistically significant and prolonged statin-like reductions in serum apoB, LDL-C, and non-HDL cholesterol. Serum triglycerides were reduced as well, a predicted consequence of reducing the export of triglyceriderich VLDL from the liver. While the efficacy and safety data are encouraging, ISIS 301012 is still early in development. The studies to date have been small in size and limited in duration and are probably not sufficient to demonstrate all possible side effects. Areas of continued research for ISIS 301012 (and the other compounds described above) include evaluating toxicities that are (1) specific to inhibition of the target, (2) that might arise when ISIS 301012 is given in combination with existing antihyperlipidemic agents, and (3) after chronic administration. Assuming the safety and efficacy profile continues to be positive, we believe this drug will not only be an important addition to the cardiovascular therapeutic armamentarium but also a significant proof of principle for the antisense platform.

ACKNOWLEDGMENTS The authors would like to thank Tracy Reigle for her expertise in graphics, Donna Parrett for her help in finalizing the manuscript, and Kristina Lemonidis, Mark Graham, and Kannan Subramaniam for their keen laboratory skills and review of the chapter.

REFERENCES 1. Lloyd-Jones, D.M. et al. Prediction of lifetime risk for cardiovascular disease by risk factor burden at 50 years of age, Circulation, 113, 791, 2006. 2. Epstein, J.A., Rader, D.J., and Parmacek, M.S. Perspective: cardiovascular disease in the postgenomic era—Lessons learned and challenges ahead, Endocrinology, 143, 2045, 2002. 3. Davis, R.A. and Hui, T.Y. 2000 George Lyman Duff memorial lecture. Atherosclerosis is a liver disease of the heart, Arterioscler. Thromb. Vasc. Biol., 21, 887, 2001. 4. Nabel, E.G., Cardiovascular disease, N. Engl. J. Med., 349, 60, 2003. 5. World Health Organization Website. World Health Organization cardiovascular disease (CVD): prevention and control fact sheet 2003. http://www.who.int/dietphysicalactivity/publications/facts/ cvd/en 6. Murray, C.J.L., and Lopez, A.D. Alternative projections of mortality and disability by cause 1990–2020: Global burden of disease study, Lancet, 349, 1498, 1997. 7. Mahley, R.W. and Bersot, T.P. Drug therapy for hypercholesterolemia and dyslipidemia, in Goodman and Gilman’s The Pharmacological Basis of Therapeutics, Brunton L.L., ed., McGraw-Hill, New York, 2006, chap. 35. 8. Grundy, S.M. et al. Assessment of cardiovascular risk by use of multiple risk factor assessment equations. A statement for Healthcare professional from the American Heart Association and the American College of Cardiology, J. Am. Coll. Cardiol., 34, 1348, 1999.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 631


631

9. Executive summary of the Third Report of the National Cholesterol Education Program (NCEP) Expert panel on detection, evaluation and treatment of high blood cholesterol in adults (Adult Treatment Panel III). Expert panel on detection, evaluation, and treatment of high blood cholesterol in adults, JAMA, 285, 2486, 2001. 10. Grundy, S.M. et al. Implications of recent clinical trials for the National Cholesterol Education Program Adult Treatment Panel III Guidelines, Circulation, 110, 227, 2004. 11. Knopp, R.H. Drug treatment of lipid disorders, N. Engl. J. Med., 341, 498, 1999. 12. Lipid Study Group: Prevention of cardiovascular events and death with pravastatin in patients with coronary heart disease and a broad range of initial cholesterol levels, N. Engl. J. Med., 339, 1339, 1998. 13. Downs, G.R., Clearfield, M., and Weiss, S. Primary prevention of acute coronary events with lovastatin in men and women with average cholesterol levels: results of the AFCAPS/TEXCAPS (Air Forces/Texas Coronary Atherosclerosis Prevention Study), JAMA, 279, 1615, 1998. 14. Heart Protection Study Collaborative Group: MRC/BHF heart protection study of cholesterol lowering with simvastatin in 20,536 high risk individuals: a randomized placebo controlled trial, Lancet, 360, 7, 2002. 15. Hulthe, J. and Faberberg, B. Circulating oxidized LDL is associated with subclinical atherosclerosis development and inflammatory cytokines (AIR study), Arterioscler. Thromb. Vasc. Biol. 22, 1162, 2002. 16. Skalen, K. et al. Subdendothelial retention of atherogenic lipoproteins in early atherosclerosis, Nature, 417, 750, 2002. 17. Cholesterol Treatment Trialists (CTT) Collaborators, Efficacy and safety of cholesterol-lowering treatment: prospective meta-analysis of data from 90,056 participants in 14 randomised trials of statins, Lancet, 366, 1267, 2005. 18. Nissen, S.E. et al. Effect of intensive compared with moderate lipid-lowering therapy on progression of coronary atherosclerosis. A randomized controlled trial, JAMA, 291, 1071, 2004. 19. Nissen, S.E., et al. Effect of very high-intensity statin therapy on regression of coronary atherosclerosis. The ASTEROID trial, JAMA, 295, 1556, 2006. 20. Gotto, A.M. Management of dyslipidemia, Am. J. Med., 112, 102, 2002. 21. Abookire, S. A. et al. Use and monitoring of statin lipid-lowering drugs compared with guidelines, Arch. Int. Med., 161, 53, 2001. 22. Ahmed, S.M., Clasen, M.E., and Donnelly, J.E. Management of dyslipidemia in adults, Am. Fam. Physician, 57, 2192, 1998. 23. Bocan, T.M. Pleiotropic effects of HMG-CoA reductase inhibitors, Curr. Opin. Invest. Drugs, 2, 21, 2002. 24. Grundy, S.M. et al. Diagnosis and management of the metabolic syndrome. An American Heart Association/National Heart, Lung, and Blood Institute Scientific Statement, Circulation, 112, 2735, 2005. 25. Lewis, G.F. and Rader, D.J. New insights into the regulation of HDL metabolism and reverse cholesterol transport, Circ. Res., 96, 1221, 2005. 26. Nicholls, S.J. and Nissen, S.E. Strategies to promote HDL-C: an emerging therapeutic target, Eur. Heart. J., 26, 853, 2005. 27. Carlson, L.A., Hamsten, A., and Asplund, A. Pronounced lowering of serum lipoprotein Lp(a) in hyperlipidemic subjects treated with nicotinic acid, J. Intern. Med., 226, 271, 1989. 28. Utermann, G. Lipoprotein(a), in The Metabolic & Molecular Bases of Inherited Disease, Scriver, C.R., Beaudet, A.L., Sly, W.S., and Valle, D., eds., McGraw-Hill, New York, 2001, chap. 116. 29. Pearson, T.A. et al. The Lipid Treatment Assessment Project (L-TAP). A multicenter survey to evaluate the percentages of dyslipidemic patients receiving lipid-lowering therapy and achieving lowdensity lipoprotein cholesterol goals, Arch. Inter. Med., 160, 459, 2000. 30. Jacobsen, T.A. et al. Impact of evidence-based “clinical judgement” on the number of American adults requiring lipid-lowering therapy based on updated NHANES III Data, Arch. Inter. Med., 160, 1361, 2000. 31. Sloan, K.L. et al. Frequency of serum low-density lipoprotein cholesterol measurement and frequency of results ⱕ100 mg/dl among patients who had coronary events (Northwest VA Network Study), Am. J. Cardiol., 88, 1143, 2001. 32. Sueta, C.A. et al. Undertreatment of hyperlipidemia in patients with coronary artery disease and heart failure, J. Cardiac Failure, 9, 36, 2003. 33. Stein, E. et al. Achieving lipoprotein goals in patients at high risk with severe hypercholesterolemia: efficacy and safety of Ezetimibe co-administered with atorvastatin, Am. Heart J., 148, 447, 2004.

CRC_8796_ch022.qxd

632

6/20/2007

10:11 PM

Page 632


34. Bruckert, E. et al. Mild to moderate muscular symptoms with high-dosage statin therapy in hyperlipidemic patients-the PRIMO study, Cardiovasc. Drugs Ther., 19, 403, 2005. 35. Levin, A.A. et al., Toxicity of antisense oligonucleotides, in Antisense Drug Technology. Principles, Strategies, and Applications, Crooke, S.T., ed., Marcel Dekker, Inc., New York, 2001, chap. 9. 36. Pacheo, G. et al. Characterization of nonspecific effects of phosphorothioate antisense oligodeoxynucleotides on cytochrome P450 3A2 and cytochrome P450 2CII in male Sprague-Dawley rats, Toxicologist, 66, 22, 2002. 37. Gonzalez, F.J. and Tukey, R.H. Drug metabolism, in Goodman and Gilman’s The Pharmacological Basis of Therapeutics, Brunton L.L., ed., McGraw-Hill, New York, 2006, chap 3. 38. Henry, S.P. et al. Drug properties of second generation antisense oligonucleotides: how do they measure up to their predecessors? Curr. Opin. Invest. Drugs, 2, 1444, 2001. 39. Geary, R.S. et al. Pharmacokinetic properties of 2⬘-O-(2-methoxyethyl)-modified oligonucleotides in rat, J. Pharmacol. Exp. Ther., 296, 890, 2001. 40. Geary, R.S. et al. Pharmacokinetic properties in animals, in Antisense Drug Technology. Principles, Strategies, and Applications, Crooke, S.T., ed., Marcel Dekker, Inc., New York, 2001, chap. 6. 41. Yu, R. et al. Tissue disposition of 2⬘-O-(2-methoxy)ethyl modified antisense oligonucleotides in monkeys, J. Pharm. Sci., 93, 48, 2004. 42. Crooke, R.M., unpublished data, 2006. 43. Faxon, D.P. et al. Atherosclerotic vascular disease conference. Writing group III: pathophysiology, Circulation, 109, 2617, 2004. 44. Libby, P. and Theroux, P. Pathophysiology of coronary artery disease, Circulation, 111, 3481, 2005. 45. Deguchi, J.O. et al. Inflammation in atherosclerosis: visualizing matrix metalloproteinase action in macrophages in vivo, Circulation, 114, 55, 2006. 46. Tardif, J.C. et al. Vascular markers and surrogates in cardiovascular disease, Circulation, 113, 2936, 2006. 47. Graham, M.J. et al. In vivo distribution and metabolism of a phosphorothioate oligonucleotide within rat liver after intravenous administration, J. Pharmacol. Exp. Ther., 286, 447, 1998. 48. Graham, M.J. et al. Hepatic distribution of a phosphorothioate oligodeoxynucleotide within rodents following intravenous administration, Biochem. Pharmcol., 62, 297, 2001. 49. Zhang, H.J. et al. Reduction of liver Fas expression by an antisense oligonucleotide protects mice from fulminant hepatitis, Nat. Biotech., 18, 862, 2000. 50. Hoffman, B.B. Therapy of hypertension, in Goodman and Gilman’s The Pharmacological Basis of Therapeutics, Brunton L.L., ed., McGraw-Hill, New York, 2006, chap. 32. 51. Browning, J.D. and Horton, J.D. Molecular mediators of hepatic steatosis and liver injury, J. Clin. Invest., 114, 147, 2004. 52. Linsel-Nitschke, P. and Tall, A.R. HDL as a target in the treatment of atherosclerotic cardiovascular disease, Nat. Rev. Drug Discov., 4, 193, 2005. 53. Tall, A.R. Plasma cholesteryl ester transfer protein, J. Lipid. Res., 34, 1255, 1993. 54. Doggrell, S.A. Inhibitors of cholesteryl ester transfer protein-a new approach to coronary artery disease, Expert Opin. Investig. Drugs, 15, 99, 2006. 55. Bruce, C., Sharpe, D.S., and Tall, A.R. Relationship of HDL and coronary heart disease to a common amino acid polymorphism in the cholesteryl ester transfer protein in men with and without hypertriglyderidemia, J. Lipid. Res., 39, 1071, 1998. 56. Clark, R.W. et al. Raising high-density lipoprotein in humans through inhibition of cholesteryl ester transfer protein: an initial multidose study of torcetrapib, Arterioscler. Thromb. Vasc. Biol., 24, 490, 2004. 57. Clark, R.W. Raising high-density lipoprotein with cholesteryl ester transfer protein inhibitors, Curr. Opin. Pharmacol., 6, 162, 2006. 58. Sugano, M. and Makino, N. Changes in plasma lipoprotein cholesterol levels by antisense oligodeoxynucleotides against cholesteryl ester transfer protein in cholesterol-fed rabbits, J. Biol. Chem., 271, 19,080, 1996. 59. Sugano, M. et al. Effect of antisense oligonucleotides against cholesteryl ester transfer protein on the development of atherosclerosis in cholesterol-fed rabbits, J. Biol. Chem., 2731, 5033, 1998. 60. Chiou, H.C. et al. Enchanced resistance to nuclease degradation of nucleic acids complexed to asialoglycoprotein-polylysine carriers, Nucl. Acids Res., 22, 5439, 1994. 61. Anke, H.E.M. et al. Cholesteryl ester transfer protein (CETP) inhibition beyond raising high-density lipoprotein cholesterol levels. Pathways by which modulation of CETP activity may alter atherogenesis, Arterioscler. Thromb. Vasc. Biol., 25, 2020, 2005.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 633


633

62. Crooke, R.M., personal communication, 2006. 63. Berg, K. A new serum type system in man-the Lp system, Acta Path. Microbiol. Scand., 59, 369, 1963. 64. Berglund, L. and Ramakrishnan, R. Lipoprotein(a). An elusive cardiovascular risk factor, Arterioscler. Thromb. Vasc. Biol., 24, 2219, 2004. 65. Berg, K. et al. Lp(a) lipoprotein level predicts survival and major coronary events in the Scandinavian Simvastatin Survival Study, Clin. Genet., 52, 254, 1997. 66. Candido, A.P. et al. Lipoprotein(a) as a risk factor associated with ischemic heart disease: Ouro Preto Study, Atherosclerosis, in press, 2006. 67. Schreiner, P.J. et al. Lipoprotein(a) as a risk factor for preclinical atherosclerosis, Arterioscler. Thromb., 13, 826, 1993. 68. Edelstein, C. et al. Lysine-phosphatidylcholine adducts in kringle V impart unique immunological and potential pro-inflammatory properties to human apolipoprotein(a), J. Biol. Chem., 278, 52,841, 2003. 69. Silaste, M.I. et al. Changes in dietary fat alter plasma levels of oxidized low-density lipoprotein and lipoprotein(a), Arterioscler. Thromb. Vasc. Biol., 24, 498, 2004. 70. Tsimikas, S. et al. Temporal increases in plasma markers of oxidized low-density lipoprotein strongly reflect the presence of acute coronary syndromes, J. Am. Coll. Cardiol., 41, 360, 2003. 71. Schneider, M. et al. High-level lipoprotein(a) expression in transgenic mice: evidence for oxidized phospholipids in lipoprotein(a) but not in low density lipoproteins, J. Lipid. Res., 46, 769, 2005. 72. Rath, M. et al. Detection and quantification of lipoprotein(a) in the arterial wall of 107 coronary bypass patients, Arteriosclerosis, 9, 579, 1989. 73. Cushing, G.L. et al. Quantitation and localization of apolipoproteins (a) and B in coronary artery bypass vein grafts resected at reoperation, Arteriosclerosis, 9, 593, 1989. 74. Schenck, I. et al. Reduction of Lp(a) by different methods of plasma exchange, Klin. Wochenschr., 66, 1197, 1988. 75. Eliassen, K. et al. Significant reduction of lipoprotein(a) level in LPA-transgenic mice after treatment with an antisense inhibitor of the LPA gene, Atherosclerosis, in press, 2006. 76. Berg, K. et al. Spontaneous atherosclerosis in the proximal aorta of LPA transgenic mice on a normal diet, Atherosclerosis, 163, 99, 2002. 77. Crooke, R.M., personal communication, 2006. 78. Asia Pacific Cohort Studies Collaboration, Serum triglycerides as a risk factor for cardiovascular disease in the Asia-Pacific Region, Circulation, 110, 2678, 2004. 79. Tanne, D. et al. Blood lipids and first-ever ischemic stroke/transient ischemic attack in the Benzfibrate infarction prevention (BIP) registry. High triglycerides constitute an independent risk factor, Circulation, 104, 2892, 2001. 80. Schoonjans, K., Staels, B., and Auwerx, J. Role of the peroxisome proliferators-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression, Circulation, 37, 907, 1996. 81. Haubenwallner, S. et al. Hypolipidemic activity of select fibrates correlates to changes in hepatic apolipoprotein C-III expression: a potential physiologic basis for their mode of action, J. Lipid. Res., 36, 2451,1995. 82. Staels, B. et al. Mechanism of action of fibrates on lipid and lipoprotein metabolism, Circulation, 98, 2088,1998. 83. Minnich, A. et al. A potent PPAR␣ agonist stimulates mitochondrial fatty acid beta-oxidation in liver and skeletal muscle, Am. J. Physiol. Endocrinol. Metab., 280, E270, 2001. 84. Goldberg, I.J. Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and atherogenesis, J. Lipid. Res., 37, 693, 1996. 85. Dallinga-Thie, G. et al. Atorvastatin decreases apolipoprotein C-III in apolipoprotein B-containing lipoproteins and HDL in Type 2 diabetes, Diabetes Care, 27, 1358, 2004. 86. Maeda, N. et al. Targeted disruption of the apolipoprotein C-III genes in mice results in hypotriglyceridemia and protection from postprandial hypertriglyceridemia, J. Biol. Chem., 269, 23,610, 1994. 87. Ginsberg, H.N. et al. Apolipoprotein B metabolism in subjects with a deficiency of apolipoprotein CIII and A1. Evidence that apolipoprotein CIII inhibits the catabolism of triglyceride-rich lipoprotein lipase in vivo, J. Clin. Invest., 78, 1287, 1986. 88. Hokanson, J.E. et al. Susceptibility to type 1 diabetes is associated with apoCIII gene haplotypes, Diabetes, 55, 834, 2006.

CRC_8796_ch022.qxd

634

6/20/2007

10:11 PM

Page 634


89. Florez, H. et al. Increased apolipoprotein C-III levels associated with insulin resistance contribute to dyslipidemia in normoglycemic and diabetic subjects from a triethnic population, Atherosclerosis, 188, 143, 2006. 90. Juntti-Berggren, L. et al. Apolipoprotein CIII promotes Ca2⫹-dependent beta cell death in type I diabetes, Proc. Natl. Acad. Sci. USA, 101, 19,909, 2004. 91. Chen, M. et al. Transcriptional regulation of the apoC-III gene by insulin in diabetic mice: correlation with changes in plasma triglyceride levels, J. Lipid. Res., 35, 1918, 1994. 92. Altomonte, J. et al. Foxo1 mediates insulin action on apoC-III and triglyceride metabolism, J. Clin. Invest., 114, 493, 2004. 93. Takahashi, T. et al. Apolipoprotein C-III deficiency prevents the development of hypertriglyceridemia in streptozotocin-induced diabetic mice, Metabolism, 52, 2354, 2003. 94. Gervaise, N. et al. Triglycerides, apoC3 and LpB: C3 and cardiovascular risk in type II diabetes, Diabetologia, 43, 703, 2000. 95. Tiret, I. et al. Postprandial response to a fat tolerance test in young adults with a paternal history of premature coronary artery disease; the EARS II study, Eur. J. Clin. Invest., 30, 578, 2000. 96. Subramaniam, A. et al. ApoC-III antisense oligonucleotides reduce liver mRNA and serum triglyceride levels in hypertriglyceridemic rats, Diabetes, 54, suppl.1, A233, 2005. 97. Lemonidis, K.M., unpublished data, 2006. 98. Rudel, L.L., Lee, R.G., and Parini, P. ACAT2 is a target for treatment of coronary heart disease associated with hypercholesterolemia, Arterioscler. Thromb. Vasc. Biol., 25, 1112, 2005. 99. Joyce, C. et al. Acyl-coenzyme A: cholesterol acyltransferase 2, Curr. Opin. Lipidol., 10, 89, 1999. 100. Parini, P. et al. ACAT2 is localized to hepatocytes and is the major cholesterol-esterifying enzyme in human liver, Circulation, 110, 2017, 2004. 101. Chang, T.Y., Chang, C.C.Y., and Cheng, D. Acyl-coenzyme A: cholesterol acyl-transferase, Annu. Rev. Biochem., 66, 613, 1997. 102. Oelkers, P. et al. Characterization of two human genes encoding acyl coenzyme A: cholesterol acyltransferase-related enzymes, J. Biol. Chem., 273, 26,275, 1998. 103. Lee, R.G. et al. Differential expression of ACAT1 and ACAT2 among cells within the liver, intestine, kidney, and adrenal of nonhuman primate, J. Lipid. Res., 41, 1991, 2000. 104. Rudel, L.L., Lee, R.G., and Cockman, T.L. Acyl-coenzyme A: cholesterol acyltransferase type 1 and 2: structure and function in atherosclerosis, Curr. Opin. Lipidol.,12, 121, 2001. 105. Matsuo, M. et al. Effect of FR145237, a novel ACAT inhibitor, on atherogenesis in cholesterol-fed and WHHL rabbits. Evidence for a direct effect on the arterial wall. Biochem. Biophys. Acta., 1259, 254, 1995. 106. Accad, Â. et al. Massive xanthomatosis and altered composition of atherosclerotic lesions in hyperlipidemic mice lacking acyl CoA: cholesterol acyltransferase 1, J. Clin. Invest., 105, 711, 2000. 107. Yagyu, H. et al. Absence of ACAT1 attenuates atherosclerosis but causes dry eye and cutaneous xanthomatosis in mice with congenital hyperlipidemia, J. Biol. Chem., 275, 21,324, 2000. 108. Fazio, S. et al. Increased atherosclerosis in LDL receptor-null mice lacking ACAT1 in macrophages, J. Clin. Invest.,107, 163, 2001. 109. Warner, G.J. et al. Cell toxicity induced by inhibition of acyl coenzymeA: cholesterol acyltransferase and accumulation of unesterified cholesterol, J. Biol. Chem., 270, 5772, 1995. 110. Lee, R.G., et al. Plasma cholesteryl esters provided by lecithin:cholesterol acyltranferase and acyl-coenzyme A: cholesterol acyltransferase 2 have opposite atherosclerotic potential, Circ. Res., 95, 998, 2004. 111. Repa, J.J. et al. ACAT2 deficiency limits cholesterol absorption in cholesterol-fed mice: Impact on hepatic cholesterol homeostasis, Hepatology, 40, 1088, 2004. 112. Buhman, K.K. et al. Resistance to diet-induced hypercholesterolemia and gallstone formation in ACAT2-deficient mice, Nat. Med., 6, 1341, 2000. 113. Willner, E.L. et al. Deficiency of acyl CoA: cholesterol acyltransferase 2 prevents atherosclerosis in apolipoprotein E-deficient mice. Proc. Natl. Acad. Sci. USA, 100, 1262, 2003. 114. Farese, R.V. The nine lives of ACAT inhibitors. Arterioscler. Thromb. Vasc. Biol., 26,1684, 2006. 115. Sliskovic, D.R., Picard, J.A., and Krause, B.R. ACAT inhibitors: the search for a novel and effective treatment of hypercholesterolemia and atherosclerosis, Prog. Med. Chem., 39, 121, 2002. 116. Raal, F.J. et al. Avasimibe, and ACAT inhibitor, enhances the lipid lowering effect of atorvastatin in subjects with homozygous familial hypercholesterolemia, Atherosclerosis, 171, 273, 2003.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 635


635

117. Tardif, J.-C. et al. Effects of the acyl coenzymeA: Cholesterol acyltransferase inhibitor Avasimibe on human atherosclerotic lesions, Circulation, 110, 3372, 2004. 118. Nissen, S.E. et al. Effect of ACAT inhibition on the progression of coronary atherosclerosis, N. Engl. J. Med., 354, 1253, 2006. 119. Bell, T.A. et al. Liver-specific inhibition of acyl-coenzyme A: Cholesterol acyltransferase 2 with antisense oligonucleotides limits atherosclerosis development in apolipoprotein B100-only low-density lipoprotein receptor-/- mice, Arterioscler. Thromb. Vasc. Biol., 26,1814, 2006. 120. Crooke, R.M. and Rudel, L.L., personal communication, 2006. 121. Crooke, R.M. et al. An apolipoprotein B antisense oligonucleotide lowers LDL cholesterol in hyperlipidemic mice without causing hepatic steatosis, J. Lipid Res., 46, 872, 2005. 122. Kastelein, J.J.P. et al. Potent reduction of apolipoprotein B and LDL cholesterol by short term administration of an antisense inhibitor of apolipoprotein B, Circulation, 114, 1729, 2006. 123. Greeve, J. Inhibition of the synthesis of apolipoproteinB-containing lipoproteins, HEP, 170, 483, 2005. 124. Davidson N.O. and Shelness G.S. Apolipoprotein B: mRNA editing, lipoprotein assembly, and presecretory degradation, Annu. Rev. Nutr., 20,169, 2000. 125. Marsh, J.B. et al. Apolipoprotein B metabolism in humans: studies with stable isotope-labeled amino acid precursors, Atherosclerosis, 162, 227, 2002. 126. Olofsson, S.-O. and Boren, J. Apolipoprotein B: a clinically important apolipoprotein which assembles atherogenic lipoproteins and promotes the development of atherosclerosis, J. Int. Med., 258, 395, 2005. 127. Oloffson, S.-V., Stillemark-Billton, P., and Asp, L. Intracellular assembly of VLDL. Two major steps in separate cell compartments, Trends Cardiovasc. Med., 10, 338, 2001. 128. Das, H.K., Leff, T., and Breslow, J.L., Cell type-specific expression of the human apoB gene is controlled by two cis-acting regulatory regions. J. Biol. Chem., 263, 11,452, 1998. 129. Anant, S. et al. Novel role for RNA-binding protein CUGBP2 in mammalian RNA editing, J. Biol. Chem., 276, 47,338, 2001. 130. Shoulder, C.C. and Shelness, G.S. Current biology of MTP; implications for selective inhibition, Curr. Topics Med. Chem., 5, 283, 2005. 131. Pease, R.J. and Leiper, J.M. Regulation of hepatic apolipoprotein-B-containing lipoprotein secretion, Curr. Opin. Lipidol., 7, 132, 1996. 132. Liang, J.-S. and Ginsberg, H. Microsomal triglyceride transfer protein binding and lipid transfer activities are independent of each other, but both are required for secretion of apolipoprotein B lipoproteins from liver cells, J. Biol. Chem., 276, 28,606, 2001. 133. Shelness, G.S. and Sellers, J. A. Very-low-density lipoprotein assembly and secretion, Curr. Opin. Lipidol., 12, 151, 2001. 134. Wang, S.-L. et al. Coordinate regulation of lipogenesis; the assembly and secretion of apolipoprotein B-containing lipoproteins by sterol response element binding protein 1, J. Biol. Chem., 272, 19,351, 1997. 135. Liang, J.-S. et al. Translocation efficiency, susceptibility to proteasomal degradation and lipid responsiveness of apolipoprotein B are determined by the presence of B sheet domains, J. Biol. Chem., 273, 35,216, 1998. 136. Kang, S. and Davis, R.A. Cholesterol and hepatic lipoprotein assembly and secretion, Biochem. Biophys. Acta, 1529, 223, 2000. 137. Fisher, E.A. et al. The triple threat to nascent apolipoprotein B. Evidence for multiple, distinct degradative pathways, J. Biol. Chem., 276, 27,855, 2001. 138. Ginsberg, H. Insulin resistance and cardiovascular disease, J. Clin. Invest.,106, 453, 2000. 139. Chan, D.C. et al. Apolipoprotein B kinetics in visceral obesity; associations with plasma apolipoprotein C-III concentration, Metabolism, 51, 1041, 2002. 140. Kane, J.P. and Havel, R.J. Disorders of the biogenesis and secretion of lipoproteins containing the B apolipoproteins, in The Metabolic and Molecular Bases of Inherited Disease, Scriver, C.R. et al., eds., McGraw-Hill, New York, 2001, chap. 115. 141. Boren, J. et al. Identification of the low density lipoprotein receptor-binding site in apolipoprotein B100 and the modulation of its binding activity by the carboxyl terminus in familial defective apoB, J. Clin. Invest., 101, 1084, 1998. 142. Tybjaerg-Hansen, A. et al. Association of the mutations in the apolipoprotein B gene with hypercholesterolemia and the risk of ischemic heart disease, N. Engl. J. Med., 338, 1577, 1998.

CRC_8796_ch022.qxd

636

6/20/2007

10:11 PM

Page 636


143. Gaffney, D. et al. Comparison of apolipoprotein B metabolism in familial defective apolipoprotein B and heterogeneous familial hypercholesterolemia, Atherosclerosis, 162, 33, 2002. 144. Greevenbroek, M.M.J., Vermeulen, V.M.M.-J, and deBruin, T.W.A. Familial combined hyperlipidemia plasma stimulates protein secretion by HepG2 cells: identification of fibronectin in the differential secretion proteome, J. Lipid Res., 43, 1846, 2002. 145. Veerkamp, M.J. et al. Diagnosis of familial combined hyperlipidemia based on lipid phenotypes expression in 32 families. Results of a 5 year follow-up study, Arterioscler. Thromb. Vasc. Biol., 22, 274, 2002. 146. Grundy, S.M. Hypertriglyderidemia, atherogenic dyslipidemia, and the metabolic syndrome, Am. J. Cardiol., 81, 18B, 1998. 147. Chan, D.C. et al. Regulatory effects of HMGCoA reductase inhibitot and fish oils on apolipoprotein B kinetics in insulin-resistant obese male subjects with dyslipidemia, Diabetes, 51, 2377, 2002. 148. Farese, R.V. et al. Knockout of the mouse apolipoprotein B gene results in embryonic lethality in homozygotes and protection against diet-induced hypercholesterolemia in heterozygotes, Proc. Natl. Acad. Sci. USA, 92, 1774, 1995. 149. Srivastava, R.A. et al. Regulation of the apolipoprotein B in heterozygous hypobetalipoproteinemic knock-out mice expressing truncated apoB, B81. Low production and enhanced clearance of apoB cause low levels of apoB, Mol. Cell Biochem., 202, 37, 1999. 150. Liao, W., Young, S.G., and David, R. Blocking microsomal triglyceride transfer protein interferes with apolipoprotein B secretion without causing retention or stress in the endoplasmic reticulum, J. Lipid Res., 44, 978, 2003. 151. Lieu, H.D. et al. Eliminating atherogenesis in mice by switching off hepatic lipoprotein secretion, Circulation, 107, 1315, 2003. 152. Magnin, D.R. et al. Microsomal triglyceride transfer protein inhibitors: discovery and synthesis of alkyl phosphonates as potent MTP inhibitors and cholesterol lowering agents, Bioorg. Med. Chem. Lett., 13, 1337, 2003. 153. Leung, G.K. et al. A deficiency of microsomal triglyceride transfer protein reduced apolipoprotein B secretion, J. Biol. Chem., 275, 7515, 2000. 154. Yang, Y., Ballatori, N., and Smith, N.C. Apolipoprotein B mRNA editing and the reduction in synthesis and secretion of the atherogenic risk factor, apolipoprotein B100 can be effectively targeted through TAT-mediated protein transduction, Mol. Pharm., 61, 269, 2002. 155. Yamanaka, S. et al. Apolipoprotein B mRNA-editing protein induces hepatocellular carcinoma and dysplasia in transgenic animals, Proc. Natl. Acad. Sci., 92, 8483, 1995. 156. Linton, M.F., Farese, R.V., and Young S.G. Familial hypobetalipoproteinemia, J. Lipid Res., 34, 521, 1993. 157. Schonfeld, G., Lin, X., and Yue, P. Familial hypobetalipoproteinemia: genetics and metabolism, Cell Mol. Life Sci., 62, 1372, 2005. 158. Yue, P. et al. Absence of fatty liver in familial hypobetalipoproteinemia linked to Chromosome 3p21, Metabolism, 54, 682, 2005. 159. Sankatsing, R.R. et al. Hepatic and cardiovascular consequences of familial hypobetalipoproteinemia, Arterioscler. Thromb. Vasc. Biol. 25, 1979, 2005. 160. Tarugi, P. et al. Phenotypic expression of familial hypobetalipoproteinemia in three kindreds with mutations of the apolipoprotein B gene, J. Lipid Res., 42, 1552, 2001. 161. Neuman, R.J. et al. Replication of linkage of familial hypobetalipoproteinemia to Chromose 3p in six kindreds, J. Lipid Res., 43, 407, 2002. 162. Kim, T.W. et al. ISIS 326358, an antisense oligonucleotide targeted to apoB reduced plasma LDL-C in a monkey model of hyperlipidemia, Toxicologist, 90, 63, 2006. 163. Lin, X. et al. Hepatic fatty acid synthesis is suppressed in mice with fatty livers due to targeted apolipoprotein B38.9 mutation, Arterioscler. Thromb. Vasc. Bio., 22, 476, 2002. 164. Chen, Z. et al. Hepatic secretion of apoB-100 is impaired in hypobetalipoproteinemic mice with an apoB38.9-specifying allele, J. Lipid Res., 45, 155, 2004. 165. Chandler, C.E. et al. CP-356086: an MTP inhibitor that lowers plasma cholesterol and triglycerides in experimental animals and in humans, J. Lipid Res., 44, 1887, 2003. 166. Hardie, D.G. Minireview: The AMP-activated protein kinase cascade; the key sensor of cellular energy status, Endocrinology, 144, 5179, 2003. 167. Lin, H.Z. et al. Metformin reverses fatty liver disease in obese, leptin-deficient mice, Nat. Med., 6, 998, 2000.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 637


637

168. Zhou, G. et al. AMP-activated protein kinase in mechanism of metformin action, J. Clin. Invest., 108, 1167, 2001. 169. Lemonidis, et al. Pharmacological profiling of apolipoprotein B-100 and microsomal triglyceride transfer protein antisense inhibitors in hyperlipidemic mice, in 7th Annual Conference on Arteriosclerosis, Thrombosis and Vascular Biology, Denver, April 27–29, 2006, P45. 170. Subramaniam, A., unpublished data, 2006. 171. Crooke, R.M., A human apolipoprotein B antisense inhibitor reduces aortic sinus plaque volume in LDL receptor-deficient apolipoprotein B-100 transgenic mice, in 7th Annual Conference on Arteriosclerosis, Thrombosis and Vascular Biology, Denver, April 27–29, 2006, session A4. 172. Krieg, A.M. Immune stimulation by oligonucleotides, in Antisense Drug Technology. Principles, Strategies, and Applications, Crooke, S.T., ed., Marcel Dekker, Inc., New York, 2001, chap. 17. 173. Nawrocki, J.W. et al. Reduction of LDL cholesterol by 25% to 60% in patients with primary hypercholesterolemia by atorvastatin, a new HMG-CoA reductase inhibitor, Arterioscler. Thromb. Vasc. Biol., 15,678, 1995. 174. Gottlieb, A.B. et al. Etanercept monotherapy in patients with psoriasis: a summary of safety based on an integrated multistudy database, J. Am. Acad. Dermatol., 54 (3 Suppl.2), S92, 2006. 175. Wedel, M., unpublished data, 2006. 176. Soutschek, J. et al. Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs, Nature, 432, 172, 2004. 177. Henry, S.P. et al. Toxicological properties of several oligonucleotide analogs in mice, Anti-Cancer Drug Design, 12, 1, 1997. 178. Zimmerman, T.S. et al. RNAi-mediated gene silencing in non-human primates, Nature, 441, 111, 2006. 179. Yeh, E.T.H. and Willerson, J.T. Coming of age of C-reactive protein, Circulation, 107, 370, 2003. 180. Yeh, E.T.H. A new perspective on the biology of C-reactive protein, Circ. Res., 97, 609, 2005. 181. Verma, S., Szmitko, P.E., and Ridker, P.M. C-reactive protein comes of age, Nature Clinical Practice, 2, 29, 2005. 182. Agrawal, A., Kilpatrick, J.M., and Volanakis, J.E. Structure and Function of human C-reactive protein, in Acute phase proteins, Molecular biology, biochemistry, and clinical applications, Mackiewicz, A., Kushner, I., and Baumann, eds. CRC press, 1993, Boca Raton, Fl, chap. 4. 183. Ablij, H.C. and Meinders, A.E. C-reactive protein; history and revival, Europ. J. Int. Med., 13, 412, 2002. 184. Kushner, I., Rzewnicki, D., and Samols, D. What does minor elevation of C-reactive protein signify? Am. J. Med., 119, 166.e17, 2006. 185. Ridker, P.M. and Rifai, N. C-reactive protein in the primary prevention of myocardial infarction and stroke, in C-reactive Protein and Cardiovascular Disease, Ridker, P.M. and Rifai, N., eds., MediEdition, 2006, chap. 1. 186. Jialal, I., Devaraj, S., and Venugopal, S.K. C-reactive protein: risk marker or mediator in atherothrombosis? Hypertension, 44, 6, 2004. 187. Lagrand, W.K. et al. C-reactive protein as a cardiovascular risk factor. More than an epiphenomenon? Circulation, 100, 96, 1999. 188. Scirica, B.M. and Morrow, D.A. Is C-reactive protein an innocent bystander or proatherogenic culprit? The verdict is still out, Circulation, 113, 2128, 2006. 189. Verma, S., Devaraj, S., and Jialal, I. C-Reactive protein promotes atherothrombosis, Circulation, 113, 2135, 2006. 190. Wolbink, G.J. et al. CRP-mediated activation of complement in vivo. Assessment by measuring circulating complement-C-reactive protein complexes, J. Immunol., 157, 473, 1996. 191. Torzewski, J. et al. C-reactive protein frequently colocalizes with the terminal complement complex in the intima of early atherosclerotic lesions of human coronary arteries, Arterioscler. Thromb. Vasc. Biol., 18, 1386, 1998. 192. Shang-Rong, J. et al. Effect of modified C-reactive protein on complement activation. A possible complement regulatory role of modified or monomeric C-reactive protein in atherosclerotic lesions, Arterioscler. Thromb. Vasc. Biol., 26, 935, 2006. 193. Yasojima, K. et al. Generation of C-reactive protein and complement components in atherosclerotic plaques, Am. J. Pathol., 158, 1039, 2001. 194. Bisoedial, R.J. et al. Activation of inflammation and coagulation after infusion of C-reactive protein in humans, Circ. Res., 96, 714, 2005.

CRC_8796_ch022.qxd

638

6/20/2007

10:11 PM

Page 638


195. Pepys, M.B. et al. Targeting C-reactive protein for the treatment of cardiovascular disease, Nature, 440, 1217, 2006. 196. Crooke, R.M., Development of a human C-reactive protein antisense inhibitor, in Cytokines and Inflammation, GTCBios’s Fourth Annual Conference, San Diego, January 30–31, 2006. 197. Szalai, A.J. and McCrory, M.A. Varied functions of C-reactive protein: lesions learned from transgenic mice, Immunol. Res., 26, 279, 2002. 198. Danenberg, H.D. et al. Increased thrombosis after arterial injury in human C-reactive protein-transgenic mice, Circulation, 108, 512, 2003. 199. Wang, D. et al. Estrogen treatment abrogates neointima formation in human C-reactive protein transgenic mice, Arterioscler. Thromb. Vasc. Biol., 25, 2094, 2005. 200. Paul, A. et al. C-reactive protein accelerates the progression of atherosclerosis in apolipoprotein E-deficient mice, Circulation, 109, 647, 2004. 201. Crooke, R.M., and Szalai, A., personal communication, 2006. 202. Hunt, S.C. and Hopkins, P.N., Hypertension genetics and mechanisms, in Atherothrombosis and Coronary Artery Disease, Fuster, V., Topol, E.J., and Nabel, E.G., eds., Lippincott, Williams and Wilkins, Philadelphia, 2005, chap. 13. 203. Frohlich, E.D., Clinical classifications of hypertensive disease, in Atherothrombosis and Coronary Artery Disease, Fuster, V., Topol, E.J., and Nabel, E.G., eds., Lippincott, Williams and Wilkins, Philadelphia, 2005, chap. 15. 204. Raizada, M.K. and Sarkissian, S.D. Potential of gene therapy strategy for the treatment of hypertension, Hypertension, 47, 6, 2006. 205. Jackson, E.K., Renin and angiotensin, in Goodman and Gilman’s The Pharmacological Basis of Therapeutics, Brunton, L.L., ed., McGraw-Hill, New York, 2006, chap. 30. 206. Phillips, M.I., and Kimura, B., Gene therapy for hypertension. Antisense inhibition of the reninangiotensin system, in Methods in Molecular Medicine, vol. 108: Hypertension: Methods and Protocols, Fennell, J.P. and Bake, A.H., eds., Humana Press, Inc., Totowa, N.J., 2005, 363. 207. Yoneda, M. et al. Differential effects of angiotensin II type-I receptor antisense oligonucleotides on renal function in spontaneously hypertensive rats, Hypertension, 46, 58, 2005. 208. Pachori, A.S. et al. The future of hypertension therapy: Sense, antisense, or nonsense? Hypertension, 37 (part 2), 357, 2001. 209. Tomita, N. and Morishita, R. Antisense oligonucleotides as a powerful molecular strategy for gene therapy in cardiovascular disease, Curr. Pharmaceut. Des., 10, 797, 2004. 210. Phillips. M.I. and Kimura, B.C. Brain angiotensin in the developing spontaneously hypertensive rat, J. Hypertension, 6, 607, 1088. 211. Kagiyama, S. et al. Antisense inhibition of brain renin-angiotensin system decreased blood pressure in chronic 2-kidney, 1 clip hypertensive rats, Hypertension, 37, 371, 2001. 212. Peng, J.-F. et al. Reduction of cold-induced hypertension by antisense oligodeoxynucleotides to angiotensinogen mRNA and AT1-receptor mRNA in brain and blood, Hypertension, 31, 1317, 1998. 213. Sinnayah, P. et al. Selective gene transfer to key cardiovascular regions of the brain: Comparison of two viral vector systems, Hypertension, 39 (part 2), 603, 2002. 214. Gardon, M.L. et al. The potential use of gene therapy in the control of hypertension, Drugs Today, 35, 92,225, 1999. 215. Serruys, P.W., Kutryk, M.J., and Ong, A.T. Coronary-artery stents. N. Engl. J.Med., 354, 483, 2006. 216. Costa, M.A. and Simon, D.I. Molecular basis of restenosis and drug-eluting stents. Circulation, 111, 2257, 2005. 217. Monia, B.P. and Dean, N.M. Pharmacological activity of antisense oligonucleotides in animal models of disease, in Antisense Research and Application, Crooke, S.T., ed., Springer-Verlag, Berlin, 1998, chap. 14. 218. Kipshidze, N. et al. Antisense therapy for restenosis following percutaneous coronary intervention, Expert. Opin. Biol. Ther., 5, 79, 2005. 219. Abe, J. et al. Suppression of neointimal smooth muscle cell accumulation in vivo by antisense cdc2 and cdk2 oligonucleotides in rat carotid artery, Biochem. Biophys. Res. Comm., 198, 16, 1994. 220. Simons, M. et al. Antisense c-myb oligonucleotides inhibit intimal arterial smooth muscle cell accumulation in vivo, Nature, 359, 67, 1992. 221. Burgess, T.L. et al. The antiproliferative activity of c-myb and c-myc antisense oligonucleotides in smooth muscle cells is caused by a nonantisense mechanism, Proc. Natl., Acad., Sci., 92, 4051, 1995.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 639


639

222. Morishita, R. et al. Single intraluminal delivery of antisense cdc2 kinase and proliferating-cell nuclear antigen oligonucleotides results in chronic inhibition of neointimal hyperplasia, Proc. Natl., Acad., Sci., 90, 8474, 1993. 223. Cohen-Sacks, H. et al. Novel PDGFBR antisense encapsulated in polymeric nanospheres for the treatment of restenosis, Gene Therapy, 9, 1607, 2002. 224. Kipshidze, N. et al. Complete vascular healing and sustained suppression of neointimal thickening after local delivery of advance c-myc antisense at six months follow-up in a rabbit balloon injury model, Cardiovasc. Radiat. Med., 3, 26, 2002. 225. Kutryk, M.J. et al. Local intracoronary administration of antisense oligonucleotide against c-myc for the prevention of in-stent restenosis: results of the randomized investigation by the Thoraxcenter of antisense DNA using local delivery and IVUS after coronary stenting (ITALICS) trial, J. Am. Coll. Cardiol., 39, 281, 2002. 226. Iversen, P.L. et al. Local application of antisense for prevention of restenosis, Methods Mol. Med., 106, 37, 2005.

CRC_8796_ch022.qxd

6/20/2007

10:11 PM

Page 640

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 641

CHAPTER

23

Developing Antisense Drugs for Metabolic Diseases: A Novel Therapeutic Approach Sanjay Bhanot

CONTENTS 23.1 23.2 23.3

Introduction .........................................................................................................................642 Rationale .............................................................................................................................642 Antisense Drug Discovery ..................................................................................................642 23.3.1 Drug Discovery for Type 2 Diabetes ....................................................................644 23.3.1.1 Antisense Targeting of Protein Phosphatases ......................................644 23.3.1.2 Targeting Transcription Factors with Antisense Drugs........................647 23.3.1.3 Antisense Strategies to Inhibit Hepatic Glucose Output .....................648 23.3.1.4 Exploiting Tissue Selectivity and Pharmacokinetic Properties of Antisense Drugs ...................................................................................649 23.3.1.5 Targeting the Kidney Using Novel Antisense Chemistries .................651 23.3.2 Antisense Drug Discovery for Obesity.................................................................652 23.3.2.1 Antiobesity Effects of ISIS 113715, a PTP-1B Antisense Inhibitor ...652 23.3.2.2 Antisensing Additional Peripheral Targets for Obesity .......................654 23.3.3 Discovery of Antisense Drugs for Nonalcoholic Steatohepatitis .........................655 23.3.3.1 Acyl-CoA : Diacylglycerol Acyltransferase 2 (DGAT2).....................655 23.3.3.2 Antisense Reduction of Stearoyl-CoA Desaturase Expression ...........656 23.3.3.3 Antisense Reduction of Acetyl-CoA Carboxylases 1 and 2 Expression ............................................................................................656 23.4 Antisense Drug Development .............................................................................................656 23.4.1 Phase 1/2 Clinical Program Overview..................................................................657 23.4.1.1 Clinical Safety Summary .....................................................................657 23.4.1.2 ISIS 113715 Clinical Pharmacokinetics ..............................................657 23.4.1.3 ISIS 113715 Clinical Pharmacology....................................................658 23.5 Conclusion ..........................................................................................................................659 Acknowledgments ..........................................................................................................................659 References ......................................................................................................................................659

641

CRC_8796_ch023.qxd

642

5/7/2007

10:17 AM

Page 642


23.1 INTRODUCTION The incidence of several metabolic disorders such as type 2 diabetes, obesity, and fatty liver disease has increased to epidemic proportions in the past decade, primarily due to indulgence in a diet rich in fats, coupled with a sedentary lifestyle [1]. While significant progress has been made in understanding the mechanisms underlying the pathophysiology of these disorders, the development of novel therapeutics for these diseases has been a slow and arduous process. Two key factors that have hampered the development of traditional small molecule approaches are lack of target specificity and limited versatility. In contrast, antisense technology represents an innovative approach for the discovery and development of target-specific inhibitors against a wide variety of targets, many of which are undrugable with traditional approaches [2]. The use of advanced and proprietary chemistries has generated antisense drugs that are not only highly selective, but that also have a high therapeutic index [2]. Furthermore, since the pharmacokinetics and tissue distribution are largely similar and predictable between different antisense sequences with the same chemistry backbone, it has facilitated rapid evaluation of hundreds of gene targets in animal models, thereby generating a very efficient in vivo drug-discovery process. In addition, direct comparison of the pharmacology of different targets in vivo has paved the way for selection of the best preclinical targets for clinical development. The antisense drugs that have been the most extensively studied in vivo are 20-base chimeric oligonucleotides, where the first five bases and last five bases have a 2⬘-O-(2-methoxy)-ethyl (2⬘-MOE) modification [3]. This chimeric strategy enhances the binding affinity of the ASOs to complimentary sequences and their resistance to the action of nucleases, thereby increasing the potency and half-life of these compounds. The term “antisense drugs” in this chapter refers to this advanced MOE gapmer chemistry, unless specifically stated otherwise.

23.2 RATIONALE The rationale for evaluating the therapeutic potential of antisense drugs for metabolic disorders stems from observations that these drugs distribute very well to liver and adipose tissue [4], two tissues that play a key role in the pathology of type 2 diabetes, obesity, and fatty liver disease. Furthermore, since these drugs display long tissue half-lives, it allows infrequent subcutaneous administration (once a week or less frequent), which confers important advantages in terms of patient compliance and cost-competitiveness for chronic therapy [4,5]. These drugs also have the potential for oral delivery, which could make them very attractive for the treatment of metabolic disorders. Importantly, growing clinical experience after systemic administration of these compounds indicates that these drugs demonstrate a favorable safety and tolerability profile [5], which is essential for treating chronic diseases such as type 2 diabetes and obesity.

23.3 ANTISENSE DRUG DISCOVERY Over the past 4 years, antisense inhibitors against ⬎125 cellular targets have been evaluated in a variety of animal models of diabetes and obesity (Figure 23.1). More than 65 gene targets have been invalidated and ⬎15 targets have demonstrated robust pharmacology. Antisense drugs against several of these targets are currently under development. The most advanced compound, ISIS 113715, is an antisense inhibitor of the molecular target protein tyrosine phosphatase 1B (PTP-1B) and is currently under evaluation in Phase 2 trials for type 2 diabetes [6–8]. Since antisense inhibitors cause profound and specific target reduction in adipose tissue, peripheral targeting of antisense compounds to treat obesity is also being explored. In addition,

Miscellaneous [27] Miscellaneous [28] Miscellaneous [29] Miscellaneous [30] Transcription factor [6] Transcription factor [7] Miscellaneous [22] Miscellaneous [23] Miscellaneous [24] Kinase [20] Phosphatase [18] Kinase [18] Kinase [19] Miscellaneous [25] Miscellaneous [26] Phosphatase [14] Miscellaneous [11] Miscellaneous [12] Receptor [4] Transcription factor [3] Miscellaneous [13] Transcription factor [4] Miscellaneous [14] Kinase [12] Enzyme [6] Kinase [13] Miscellaneous [8] Phosphatase [6] Phosphatase [7] Kinase [3] Kinase [4] Phosphatase [4] Phosphatase [5] Enzyme [3] Enzyme[4] Phosphatase [6] Phosphatase [7] Miscellaneous [4] PTFN Enzyme Enzyme [2] Kinase Receptor

5/7/2007

10:17 AM

Figure 23.1 Schematic depicting the in vivo antisense drug discovery paradigm. Potent and selective antisense inhibitors were identified in vitro and subsequently evaluated in tier 1 and tier 2 in vivo pharmacology screens in ob/ob and db/db diabetic mice, respectively. Targets that were evaluated included phosphatases, kinases, transcription factors, adaptor proteins, and metabolic enzymes (⬎125 targets have been evaluated to date). Targets that were validated in mouse screens (depicted in gray) were then evaluated for second species efficacy in Zucker Diabetic Fatty rats by employing specific antisense inhibitors against the specific rat gene/s. Similarly, targets with robust pharmacology in rats were subsequently tested in monkeys. Antisense drugs against three of these targets (PTP-1B, glucagon receptor and glucocorticoid receptor) are currently being pursued for clinical development.

Human

Primate

Second species rat

Tier 2 (db / db)

Tier 1 (ob /ob)

Leads identified

Glucagon receptor PTP-1B Glucocorticoid receptor

Transcription factor [2] Kinase [2] Miscellaneous Phosphatase [2] Miscellaneous [5] Miscellaneous [6] Kinase [5] Kinase [6] Phosphatase [8] Miscellaneous [7] Enzyme [5] Miscellaneous [2] Transcription factor [2] Ligand Receptor [3] Phosphatase [10] Phosphatase [11] Phosphatase [12] Ligand [2] Miscellaneous [9] Kinase [7] Kinase [8] Kinase [9] Ligand [3] Miscellaneous [10] Kinase [10] Kinase [11] Phosphatase [13] Phosphatase [15] Phosphatase [16] Miscellaneous [15] Miscellaneous [16] Kinase [14] Kinase [15] Phosphatase [17] Transcription factor [5] Miscellaneous [17] Kinase [16] Kinase [17] Miscellaneous [18] Miscellaneous [19] Miscellaneous [20] Miscellaneous [21]

DEVELOPING ANTISENSE DRUGS FOR METABOLIC DISEASES CRC_8796_ch023.qxd

643

Page 643

CRC_8796_ch023.qxd

644

5/7/2007

10:17 AM

Page 644


antisense compounds that improve hepatic steatosis in preclinical models have been discovered [9]. The improvement in hepatic steatosis is marked, rapid and is accompanied by improved liver function. These drugs are being evaluated for the treatment of fatty liver disorders including nonalcoholic steatohepatitis (NASH), a disease that affects up to 2–3% of the adult population and for which no effective drug therapies are available today [10]. In the following sections, an attempt has been made to summarize some of the key observations from this extensive drug-discovery effort. Since a discussion of data with antisense drugs against individual targets is beyond the scope of this chapter, findings are summarized in the context of specific pathways or target classes, with key examples from each class highlighted to reflect the scope and nature of the findings. 23.3.1 Drug Discovery for Type 2 Diabetes Diabetes mellitus is an endocrine disorder in which the body’s ability to regulate blood sugar is impaired, resulting in high blood sugar levels. The incidence of diabetes has increased by ⬎250% in the past decade and is predicted to rise to epidemic proportions, with the global figure of diabetic patients reaching 300 million by 2025 (World Health Organization). Type 2 diabetes, which represents ⬃90% of the diabetic population, is characterized by relative insulin deficiency coupled with the inability of the body to respond to circulating insulin levels (also known as insulin resistance). The inability of the body to respond to circulating insulin levels is a consequence of abnormal regulation of intracellular signaling mechanisms. Intracellular protein phosphatases function as key negative regulators of insulin signaling and several phosphatases, including PTEN (Phosphate and Tensin Homolog on Chromosome Ten), SHIP2 (SH2-domain containing inositol 5-phosphatase 2) and PTP-1B have been shown to regulate insulin action by dephosphorylating key intracellular enzymes involved in insulin signal transduction [11–13]. Inhibition of these phosphatases would be expected to result in enhanced insulin action, resulting in an improvement in insulin sensitivity. However, protein phosphatases are difficult targets to approach with small molecules due to the lack of target specificity of such approaches and therefore, elucidation of the pharmacological roles of these enzymes has been challenging.

23.3.1.1 Antisense Targeting of Protein Phosphatases By using potent and specific antisense inhibitors, we have explored the roles of ⬎25 phosphatases in animal models of diabesity (Figure 23.2). In studies conducted several years ago, we demonstrated that antisense reduction of PTEN, a lipid phosphatase, normalized blood glucose concentration, attenuated hyperinsulinemia and improved insulin sensitivity in diabetic rodents [11]. These findings have since been confirmed and extended by several investigators by using a variety of different approaches [14,15]. Another phosphatase that has been investigated extensively using an antisense approach is PTP-1B [6–8]. Interest in PTP-1B as a potential therapeutic target for type 2 diabetes and obesity was sparked by the observation that targeted disruption of the PTP-1B gene in mice resulted in improved insulin sensitivity and resistance to diet-induced obesity [16,17]. These findings, coupled with observations that the expression of PTP-1B was increased in rodent models of type 2 diabetes and obesity [18], raised the possibility that inhibition of PTP-1B could be an attractive approach for treating these metabolic disorders. Developing small molecule PTP-1B inhibitors has been challenging and many pharmaceutical companies have unsuccessfully pursued this target for almost a decade. While all reported small molecule agents against PTP-1B require improved pharmacokinetic properties, the overriding concern is selectivity for the target [19]. Adequate selectivity with a small molecule inhibitor may not be achievable due to active site homology among closely related phosphatases.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 645

DEVELOPING ANTISENSE DRUGS FOR METABOLIC DISEASES

645

Isis phosphatase program Relative liver expression

Phosphatase class

Common name

Class name

Receptor-type

P TP 1B

P TP N1

tyrosine phosphatases

TCP TP

P TP N2

++

ME G2

P TP N9

+++

S HP 2

P TP N11

++

PEST

P TP N12

+++

+++

P TP 36

P TP N14

+

B DP

P TP N18

+

P TP RL10

P TP N21

+++

Nonreceptor-type

LA R

P TP RF

++


P TP del ta

P TP RD

+++

P TP s i gma

P TP RS

++

P TP l amda

P TP RU

+

P TP k appa

P TP RK

+++

P TP beta

P TP RB

++

DE P 1

P TP RJ

+++

P TP al pha

P TP RA

+++

P TP S L

P TP RR

+

IA 2

P TP RN

+++

Dual specificity

MK P 1

DUS P 1

+++

Tyrosine phosphatases

MK P 3

DUS P 6

++

PKP4

DUS P 9

+

Other classes of

P TE N

P TE N


LMW-PTPase

LMW-PTPase

PTP-4A2

+++ +++ +++

Figure 23.2 List of protein tyrosine phosphatases that have been evaluated in animal models using antisense drugs. The expression of each of these phosphatases relative to the expression of protein tyrosine phosphatase-1B (PTP-1B) in the liver of diabetic rodents is also shown. PTP-1B is depicted as ⫹⫹⫹ (highly expressed). Five phosphatases with novel roles in glucose and lipid metabolism were discovered and are presently under evaluation in late-stage pharmacology studies.

ISIS 113715: A PTP-1B Antisense Inhibitor ISIS 113715 is an antisense inhibitor of PTP-1B that reduces PTP-1B expression in a highly target-specific manner without affecting the expression of other phosphatases including T-cell phosphatase, a phosphatase that has ⬃80% homology with PTP-1B in the catalytic domain [8]. The binding site of ISIS 113715 is conserved across all species studied to date including rodents, dog, monkey, and man. Multiple studies in our laboratory have demonstrated remarkably consistent, specific, and significant reduction of PTP-1B mRNA and protein levels in liver and adipose tissue after ISIS 113715 treatment [6–8]. In diabetic rodents, ISIS 113715 treatment normalized blood glucose levels without producing hypoglycemia or body weight gain [8]. ISIS 113715 treatment in diabetic mice was accompanied by enhanced insulin receptor activity as well as enhanced postreceptor signaling through key signaling intermediates, including insulin receptor substrates 1 and 2, phosphatidylinositol 3-kinase and Akt [8]. These findings mirrored those observed in PTP-1B null mice and provided further validation for PTP-1B as an attractive therapeutic target for type 2 diabetes. The effects of ISIS 113715 were also evaluated in obese, insulin-resistant, hyperinsulinemic monkeys [20]. ISIS 113715 improved insulin sensitivity and attenuated hyperinsulinemia in glucose intolerant, obese monkeys without causing hypoglycemia (Figure 23.3A and Figure 23.3B). The effects in obese monkeys were accompanied by an increase in plasma adiponectin levels

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 646

646

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Plasma insulin 80 70 60 50 40 30 20 10 0

(C)

100 80 60 40 20 Baseline

200

Week 2

0

Week 4

Plasma triglycerides

(D)

Baseline

Week 4

Plasma adiponectin 300 250

% baseline

150

mg/dL

Fasted plasma glucose

(B)

mg/dL

(µU/mL)

(A)

100 50

200 150 100 50

0

0 Baseline

Week 4

Baseline

Week 4

Figure 23.3 Effects of ISIS 113715 in obese, insulin-resistant, hyperinsulinemic Rhesus monkeys. Following the baseline data collection, animals (n ⫽ 5) received ISIS 113715 subcutaneously at a dose of 20 mg/kg on three alternate days during the first week and once each week as a subcutaneous injection for the next three weeks. 16-h-fasted plasma samples were collected 48 h after dosing and were assayed for insulin (A), glucose (B), triglycerides (C), and adiponectin (D). Data are expressed as means ⫾SEM. *p ⬍ 0.05 versus baseline, paired t-test.

(Figure 23.3D), which, in turn, can lead to secondary improvements in peripheral insulin sensitivity. In addition, a reduction in circulating triglycerides (Figure 23.3C) as well as a 20% reduction in serum ApoB100, LDL, and total cholesterol levels was observed, which is consistent with recent reports demonstrating indirect regulation of ApoB100 degradation and assembly by PTP-1B [21]. Hypoglycemia was not observed even in 16-h-fasted animals at doses that were ⬎10 times the anticipated efficacious dose in humans. These results were the first demonstration of positive pharmacology of any PTP-1B inhibitor in a nonrodent species and further supported the clinical development of ISIS 113715. Collectively, the preclinical data obtained indicate that ISIS 113715 may offer a substantial improvement over currently available diabetes drugs. ISIS 113715 may control blood glucose without the risk of hypoglycemia and weight gain and may promote weight loss, a significant benefit in this patient population. In addition, ISIS 113715 has been shown to be additive to most currently available therapies, without increasing any of the adverse effects associated with those drugs [22].

Discovery of Additional Phosphatases as Novel Antidiabetic Targets In addition to PTP-1B, several additional phosphatases that play novel roles in insulin signaling have been identified. One such phosphatase is low-molecular-weight phosphatase (LMW-PTP), also known as acid phosphatase locus 1 [23]. Although discovered more than a decade ago, no data were available describing its role in glucose metabolism. Antisense reduction of this phosphatase resulted in improved hepatic insulin signaling in diabetic animals [24]. In contrast to other phosphatases such as PTP-1B, PTEN and SHIP2, enhanced insulin signal transduction was also observed in adipose tissue after LMW-PTP antisense treatment, suggesting a distinct and broader role in regulation of metabolic pathways [24]. Treatment with LMW-PTP antisense inhibitors normalized hyperglycemia, improved insulin sensitivity and glucose tolerance and decreased hepatic steatosis in diabetic mice.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 647


647

Another phosphatase that appears to play an important role in glucose and lipid metabolism is protein tyrosine phosphatase R alpha (PTPR). Antisense reduction of hepatic PTPR mRNA expression in diabetic mice resulted in decreased plasma glucose and triglyceride levels [25]. In addition, antisense treatment decreased hepatic triglyceride levels and improved hepatic function, as assessed by a reduction in plasma ALT and AST levels. Thus, several phosphatases with novel roles in the regulation of glucose and lipid metabolism have been identified, some of which are under further evaluation as insulin sensitizers for type 2 diabetes. Future discovery efforts will be aimed at exploring the specific mechanism of action of these phosphatases, exploring intracellular cross talk between them as well as exploring the pharmacological effects of the combined reduction of these phosphatases in diabetic and obese animals.

23.3.1.2 Targeting Transcription Factors with Antisense Drugs Antisense inhibitors against ⬎12 transcription factors have been studied in preclinical models. Several transcription factors appear to play broad and critical roles in the regulation of glucose and lipid metabolism. These include eukaryotic initiation factor binding protein 2 (eIF4E-BP2) and forkhead transcription factor (FKHR). eIF4E-BP2 belongs to a family of three inhibitors (eIF4E-BP1, 2, 3) that inhibit the 5⬘ cap-dependent translation initiation by sequestering eIF4E from the eIF4F complex [26]. eIF4E-BP1 gene knockout mice show decreased body weight and adiposity, and increased metabolic rate [26]. However, no data are available for the other two eIF4E-BP gene knockouts. We recently reported that treatment of mice fed a high-fat diet with an eIF4E-BP2 antisense drug caused reduction of eIF4E-BP2 gene expression by 84% in fat and 74% in liver, which was accompanied by decreased body fat percentage content and liver triglyceridecontent [27]. Treatment also lowered plasma glucose and insulin levels and improved glucose tolerance. Western blot analysis revealed that treatment with the eIF4E-BP2 antisense drug increased phosphorylation levels of Akt (Ser 473) but not insulin receptor beta subunit (Tyr1163/1164) or IRS-1 in both liver and fat in response to an insulin challenge, indicating a postreceptor mechanism of action. Importantly, treatment did not affect the protein levels of several proteins involved in mitogenesis, including eIF4E, eIF4E-BP1, ERK1/2, p70s6k or GSK3b. Thus, eIF4E-BP2 appears to play a very specific role in regulating metabolic pathways. Robust data were also reported with the winged helix transcription factor FKHR [28]. It has been demonstrated that FKHR regulates the transcription of key gluconeogenic enzymes and can thereby modulate hepatic gluconeogenesis [28]. We recently demonstrated that in high-fat diet fed mice, FKHR antisense therapy lowered the rate of hepatic glucose production, hepatic triglyceride and diacylglycerol content, and caused a significant improvement in hepatic insulin sensitivity [29]. Similarly, reduction of hepatic FKHR expression by ⬎50% caused significant attenuation of hyperglycemia in diabetic mice [30]. Reduction of FKHR expression in adipose tissue resulted in improved insulin action, which was reflected as an increase in glucose uptake and an improved suppression of lipolysis. The net result was improved glucose clearance after an intraperitoneal glucose load and increased whole body glucose disposal in response to insulin. Thus, hepatic and adipose reduction of FKHR expression caused an improvement in both hepatic and peripheral insulin action, indicating that inhibition of FKHR with antisense drugs may provide a useful intervention point in the treatment of type 2 diabetes. While transcription factors regulate a multitude of transcriptional events inside cells, what was surprising was that pharmacological reduction of most of these targets in the liver by ⬎75% did not result in either overt toxicity or abnormalities in hepatic function (unpublished data). This suggests that evolution has created a lot of redundancy in these pathways and that alternate mechanisms exist that can potentially compensate for the selective reduction of these regulatory switches in a very specific manner. Thus, selective reduction of these targets can provide exciting opportunities for clinical development with antisense compounds, since most of these targets are not approachable with small molecules.

CRC_8796_ch023.qxd

648

5/7/2007

10:17 AM

Page 648


23.3.1.3 Antisense Strategies to Inhibit Hepatic Glucose Output The inability to suppress excessive hepatic glucose production is a key defect in type 2 diabetes and inhibition of hepatic glucose output has been pursued widely as a therapeutic strategy. Excessive hepatic glucose output is believed to occur due to excessive glycogenolysis as well as increased gluconeogenesis. Attempts have been made to inhibit both these pathways with traditional approaches with limited success [31]. Since liver is one of the key tissues of pharmacological action of antisense drugs, the contribution of these pathways towards diabetic hyperglycemia was evaluated in considerable detail. This was achieved by inhibiting rate-limiting enzymes in these pathways with specific ASOs and observing the resultant effects on plasma glucose levels. Since PEPCK is believed to be the rate-limiting enzyme in gluconeogenesis, it was one of the first targets that was evaluated. Surprisingly, it was found that even a 90% reduction in hepatic PEPCK mRNA expression in several diabetic animal models failed to have any effect on fed or 16-h-fasted glucose levels [32]. These data have been confirmed by using liver-specific PEPCK knockout approaches and have challenged the contribution of hepatic PEPCK toward the fasting hyperglycemia observed in type 2 diabetes [33]. Equally surprising was the observation that hepatic reduction of the enzyme fructose 1, 6 bisphosphatase (FBP-1) by ⬎95% did not reduce fasting blood glucose levels in diabetic animals [34]. Although not a rate-limiting enzyme, near complete reduction of the enzyme would be expected to have an impact on gluconeogenesis, since several gluconeogenic substrates (e.g., fructose and glycerol) have to be processed by FBP-1 to complete subsequent steps in the gluconeogenic cycle. These antisense observations were in contrast to those reported with small molecules [35] as well as findings in humans with the FBP-1 null mutation [36]. Further evaluation revealed that although hepatic FBP-1 activity was almost completely inhibited after antisense treatment, only ⬃50% reduction of FBP-1 activity was achieved in the kidney. Since the kidney also contributes to gluconeogenesis, the antisense data point to a very important contribution of extrahepatic gluconeogenesis toward maintaining circulating glucose levels. Thus, liver-specific pharmacological antagonism of FBP-1 may not yield the postulated therapeutic benefit for ameliorating hyperglycemia in type 2 diabetes. Using a similar approach, the contribution of the glycogenolysis pathway toward hyperglycemia was examined by inhibiting glycogen phosphorylase, the rate-limiting enzyme in that pathway. Antisense reduction of hepatic glycogen phosphorylase levels by ⬎75% resulted in very modest reductions in plasma glucose levels that were accompanied by increased glycogen accumulation in the liver [37]. Although extrapolation of animal data to humans needs to be made with caution, these data suggest that therapeutic approaches being pursued with small molecule glycogen phosphorylase inhibitors [38] may not yield the desired efficacy in patients with type 2 diabetes. In contrast to data obtained after reduction of hepatic PEPCK and FBP-1 expression, attenuation of hepatic glucose-6-phosphatase (G6P) expression resulted in significant glucose lowering effects in the same animal models [39]. (G6P) is a multicomponent enzyme that catalyzes the final step of both the gluconeogenesis and glycogenolysis pathways by hydrolyzing glucose-6-phosphate to D-glucose, which is then released into the plasma. G6P is comprised of a transport protein T1, which permits the entry of glucose-6-phosphate into the endoplasmic reticulum, a catalytic subunit that cleaves the glucose-6-phosphate, transporters T2 and T3 that transport the hydrolysis products to the cytosol, and a stabilizing protein. While studies using small molecule inhibitors targeting the G6PT1 protein have provided some validation for pursuing G6P as a treatment for type 2 diabetes [31], these approaches have been fraught with significant side effects such as increased hepatic and renal glycogen accumulation, hypoglycemia and increased plasma lactate levels. In contrast, partial and tissue selective reduction of hepatic G6PT1 mRNA expression (by ⬃85%) with antisense drugs significantly reduced plasma glucose levels in the fed and fasted states [39] without causing hypoglycemia, kidney enlargement, neutropenia, hyperlipidemia or increased hepatic glycogen content.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 649


649

Several factors likely underlie these fascinating findings. First, in contrast to patients and rodents with global G6PT1 deficiency, G6P transport activity in the liver was not completely abolished by G6PT1 antisense therapy (⬃20–30% G6P hydrolysis activity was still present after antisense treatment). Similarly, when ⬃20% hepatic G6Pase activity was restored in G6P knockout animals by G6P gene-bearing adenovirus treatment, most of the side effects associated with global gene knockdown were abolished [40], supporting the notion that 20–30% residual activity of this enzyme may be sufficient to mitigate these adverse effects. Second, reduction of G6PT1 activity resulted in a compensatory increase in hepatic G6P catalytic subunit expression, which preserved some residual capacity of the liver to breakdown glucose despite G6PT1 reduction. Third, since G6PT1 ASOs lowered G6PT1 mRNA levels by only 45% in the kidney, there was likely enough residual activity to allow for glycogen mobilization, thereby avoiding renal glycogen accumulation. Finally, G6PT1 mRNA levels in the small intestine, another extra-hepatic source of gluconeogenesis were unchanged, which likely also helped avoid hypoglycemia in the treated animals. In summary, antisense drugs have provided novel insights into the contribution of hepatic gluconeogenic and glycogenolytic pathways toward increased hepatic glucose production in type 2 diabetes. Surprising data have been obtained that challenge the role of key hepatic gluconeogenic enzymes such as PEPCK towards fasting hyperglycemia in diabetic animals. Finally, this drug discovery effort has provided a new basis to reconsider pursuing strategies to specifically target the hepatic G6P enzyme for type 2 diabetes.

23.3.1.4 Exploiting Tissue Selectivity and Pharmacokinetic Properties of Antisense Drugs The preferential distribution of antisense drugs to tissues such as liver and adipose tissue after systemic administration, coupled with poor distribution to other tissues such as the central nervous system (CNS), has opened up unique therapeutic opportunities for the treatment of metabolic diseases [4]. One such strategy that has been investigated in considerable detail is to explore tissue selective reduction of the glucocorticoid (GC) receptor, as discussed below.

Antisense Reduction of Hepatic and Adipose Tissue Glucocorticoid Receptor Expression Excessive GC action is known to cause a wide spectrum of clinical features such as obesity, insulin resistance, and glucose intolerance [41]. GCs bind to an intracellular GC receptor, which then translocates into the nucleus and binds to GC response elements, resulting in the transcriptional activation of gluconeogenic enzymes and a consequent increase in hepatic glucose output. Furthermore, GCs stimulate lipogenesis and increase secretion of triglycerides from the liver as well as regulate cholesterol biosynthesis by elevating HMG-CoA reductase expression levels [42]. In adipose tissue, GCs promote differentiation of adipocytes from preadipocytes and increase triglyceride storage. Although systemic GC inhibition has been shown to improve hyperglycemia in rodents and man, it leads to adrenal insufficiency and stimulation of the hypothalamic-pituitary-adrenal (HPA) axis. Recent data suggest that increased GC action within liver and white fat (WAT) tissues may cause tissue-specific amplification of GC effects such as increased adipocyte differentiation, increased lipogenesis, and increased gluconeogenesis, without any change in circulating GC levels [43]. Thus, tissue-specific reduction of GC action could be an attractive therapeutic strategy for type 2 diabetes. In fact, GC receptor (GCCR) antagonists have been shown to reduce hyperglycemia in rodent models of diabetes. Despite this positive effect, these agents also caused unfavorable extrahepatic effects, including activation of the HPA axis [44]. Antagonism of tissue-specific GC action was attempted by reducing GCCR expression with antisense drugs. In several mouse and rat models of diabetes, treatment with a GCCR antisense inhibitor caused ⬎60% reduction in GCCR expression in liver and adipose tissue, which led to

CRC_8796_ch023.qxd

650

5/7/2007

10:17 AM

Page 650


significant attenuation of hyperglycemia and hyperlipidemia [43]. Decreased hepatic steatosis and improved hepatic function was also observed. In addition, reduction of GCCR expression in adipose tissue caused a reduction in adipose mass in obese mice. As expected, the antisense inhibitors did not cause any reduction of GCCR expression in the pituitary and adrenal glands [43]. Circulating levels of corticosterone and adrenocorticotropic hormone (ACTH) remained unchanged, indicating that the HPA axis was not stimulated. Furthermore, when animals treated with the GCCR antisense inhibitor were challenged with dexamethasone, a complete reduction of dexamethasone-induced increase in hepatic gluconeogenesis was observed, without any change in dexamethasone-induced lymphopenia (a marker for systemic effects of dexamethasone). Another target in this pathway that has generated intense pharmaceutical interest in the past couple of years is the enzyme 11-beta hydroxysteroid dehydrogenase 1 (HSD-1). This enzyme catalyzes the conversion of inactive cortisol (or corticosterone in rodents) into its active form. Therefore, inhibition of this enzyme is being pursued as a treatment for type 2 diabetes [31]. Reduction of HSD1 in liver and adipose tissue (⬎80%) with antisense drugs revealed only modest effects on plasma glucose levels as compared to those seen with a GCCR antisense inhibitor, indicating the latter to be a better therapeutic target for pharmacological intervention [45]. Thus, tissue-selective reduction of GCCR expression with antisense drugs presents another unique therapeutic strategy and this approach is being actively pursued for clinical development.

Antisense Reduction of Hepatic and Adipose Tissue Glucagon Receptor Expression While most treatments for type 2 diabetes are focused on increasing insulin secretion or improving insulin sensitivity, it is in fact the disruption of the normal glucagon-insulin ratio that causes diabetes [46]. Not only are basal glucagon levels elevated in type 2 diabetes, but its suppression after meal ingestion is also impaired [47,48]. Glucagon receptor null mice show slightly reduced plasma glucose and insulin levels and improved glucose tolerance [49]. Therefore, it is not surprising that pharmacological antagonism of glucagon action has been investigated as a therapeutic approach for type 2 diabetes. To that aim, peptide antagonists as well as monoclonal antibodies against glucagon receptor have been shown to attenuate hyperglycemia in animal models [50,51]. Development of small molecules against the glucagon receptor has been slow due to issues with pharmacokinetics, selectivity, cross-species differences and lack of sustained effects after noncompetitive blockade [52]. Only a single Phase 1 study has been published that describes the acute effects of a glucagon receptor inhibitor in normal subjects [53]. In a series of studies, we demonstrated that antisense drugs caused a marked reduction of hepatic glucagon receptor expression (⬎75%), which was accompanied by normalization of blood glucose levels in multiple animal models of diabetes [54]. In addition to hepatic effects, glucagon receptor antisense therapy increased the levels of active glucagon-like peptide-1 (GLP-1), an incretin that is also known to improve pancreatic beta cell function [54]. In agreement with observations made in glucagon receptor deficient mice, reduced hepatic glucagon receptor expression with antisense drugs caused pancreatic alpha cell hyperplasia and hyperglucagonemia [54]. However, when the effects of a glucagon receptor antisense inhibitor were evaluated in monkeys, about a sixfold increase in the levels of GLP-1 were observed (Figure 23.4) without any evidence of alpha cell expansion or hyperplasia [55]. GLP-1 levels achieved by antisense treatment were similar to or exceeded those shown to be efficacious in humans by exogenous dosing [56]. In addition, it has been demonstrated that the alpha-cell produced active GLP-1 may have local effects within islets [57], suggesting that high levels of circulating GLP-1 may not be required to achieve efficacy and could ameliorate dose-related side effects associated with exogenous GLP-1 administration. These data in nonhuman primates support earlier observations indicating that differences exist across species in the physiological mechanisms by which islets respond to increases in hormone demand. For example, alpha-cells

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 651

DEVELOPING ANTISENSE DRUGS FOR METABOLIC DISEASES (B) 50 45 40 35 30 25 20 15 10 5 0

2000 Baseline Week 5 Week 10

Glucagon (pg/mL)

Active GLP-1 (pM)

(A)

651

1600

Baseline Week 5 Week 10

1200 800 400 0

Saline

GCGR ASO

Saline

(C)

GCGR ASO

GCGR mRNA

GCGR / 18S

100 75 50 25 0 Saline

GCGR ASO

Figure 23.4 Glucagon receptor antisense drug increased plasma-active GLP-1 levels in Cynomolgus monkeys. Following the baseline data collection, animals (n ⫽ 4) received the glucagon receptor antisense drug (ASO) at a dose of 10 mg/kg twice a week subcutaneously for 10 weeks. Plasma samples were collected 48 h after dosing and were assayed for active GLP-1 (A) and glucagon levels (B). (C) Liver tissue from the animals was homogenized and glucagon receptor mRNA expression analyzed by RT-PCR as previously described [37]. Data are expressed as means ⫾SEM. *p ⬍ 0.05 versus saline, ANOVA.

within rodent islets predominantly proliferate to meet the animal’s insulin need, while in humans, neogenesis (and not proliferation) occurs to satisfy an increasing demand [58]. Thus, it is expected that efficacy in humans will be achieved at doses that do not result in alpha-cell expansion. If successful, the development of antisense drugs against the glucagon receptor will likely provide significant glucose control in diabetic patients due to a dual mode of action (antagonism of hepatic glucagon action, combined with an increase in active GLP-1 levels).

23.3.1.5 Targeting the Kidney Using Novel Antisense Chemistries Since antisense drugs distribute very well to the kidney, pharmacological reduction of targets in this organ was attempted as a therapeutic approach for type 2 diabetes. An interesting target in the kidney that is involved in the reabsorption of glucose is the sodium glucose transporter 2 (SGLT2) [59]. SGLT2 is a low-affinity, high-capacity sodium-dependent glucose transporter whose function is to transport glucose into cells against its concentration gradient via a secondary active transport system. SGLT2 is the major reabsorptive mechanism for D-glucose in the kidney proximal convoluted tubule [59]. Inhibition of this target would be expected to decrease renal glucose reabsorption, resulting in increased glycosuria and a consequent attenuation of hyperglycemia. Using a modified version of the second-generation antisense chemistry termed mixed-backbone (MBB) chemistry, we specifically inhibited SGLT2 expression in the kidney and evaluated the resultant effects on plasma glucose levels in diabetic mice. MBB chemistry enhanced the distribution of antisense drugs to the kidney and increased potency by ⬃30-fold as compared to the standard phosphorothioate antisense compounds [60]. Treatment of diabetic mice for 4 weeks at doses as low as 1–2 mgⲐkgⲐweek with an optimized MBB antisense drug resulted in ⬃80% reduction of kidney

CRC_8796_ch023.qxd

652

5/7/2007

10:17 AM

Page 652


SGLT2 mRNA expression and a marked decrease in plasma glucose levels [60]. Furthermore, the MBB antisense did not affect the expression of SGLT1 and GLUT-2, two other glucose transporters that are coexpressed within the early proximal convoluted tubule. No hepatotoxicity or nephrotoxicity was observed based on blood chemistry, organ/body weight ratio or histology. These results suggest that antisense chemistries optimized to target the kidney may provide a novel therapeutic approach to treat diabetes as well as other renal disorders. As is evident from the preceding sections, using the antisense approach for diabetes drug discovery has led to rapid evaluation of a multitude of exciting drug targets with robust pharmacology in preclinical models. Furthermore, the specificity and versatility of this approach has allowed identification of targets that are difficult to drug with traditional approaches, including novel phosphatases and transcription factors. 23.3.2 Antisense Drug Discovery for Obesity Obesity is a major cause of morbidity and mortality in the Western hemisphere, and is a disease that afflicts one-third of all adults and one in five children [61]. Although there has been an explosion in the prevalence of this disease, current treatment strategies are very limited [61]. While most of the research effort has focused on exploring the orexigenic and anorexigenic pathways in the CNS, recent research has demonstrated that the adipose tissue is a very dynamic endocrine organ and that inhibiting specific targets in that tissue can lead to decreased body weight gain and increased metabolic rate in animals, thus opening a new peripheral approach for the treatment of obesity [61]. Since antisense inhibitors cause profound and specific target reduction in adipose tissue, we have recently started exploring the potential to treat obesity with antisense compounds. Such a drug would be complementary to CNS-based therapeutics and would provide substantial benefit in treating a disease that has reached enormous proportions [61]. One of the best examples validating the antisense approach comes from ISIS 113715, the PTP-1B antisense inhibitor, the glucose lowering effects of which have been described previously in this document.

23.3.2.1 Antiobesity Effects of ISIS 113715, a PTP-1B Antisense Inhibitor PTP-1B knockout mouse studies demonstrated that, in addition to improved insulin sensitivity, the animals were also resistant to weight gain when fed a high-fat diet [16]. Subsequent studies revealed that the lean phenotype in PTP-1B deficient mice was accompanied by an increase in metabolic rate and energy expenditure [17]. PTP-1B-deficient mice demonstrate leptin hypersensitivity, have an exaggerated response to leptin-mediated weight loss and suppression of feeding, and display enhanced leptin-induced hypothalamic STAT3 tyrosyl phosphorylation [17]. To investigate the role of pharmacological reduction of PTP-1B, the antiobesity effects of ISIS 113715 were explored in several preclinical models of obesity. In diabetic and obese leptin deficient obⲐob mice, ISIS 113715 treatment resulted in a decrease in fat pad weight, which was accompanied by a 10–15% reduction in body weight after 6 weeks of treatment [7]. Microarray studies revealed that ISIS 113715 caused a decrease in adipose tissue triglyceride levels and affected several key lipogenic genes including sterol regulatory element-binding protein, fatty acid synthase as well as genes involved in adipogenesis such as lipoprotein lipase and PPAR-gamma [7]. These data suggested a role of PTP-1B in adipocyte hypertrophy and energy storage. When ISIS 113715 was administered to mice fed a high-fat diet, significantly reduced weight gain was observed (Figure 23.5A). At the end of 6 weeks, ISIS 113715-treated mice had gained 45% less body weight versus saline or control antisense oligonucleotide-treated mice and had a similar reduction in epididymal fat pad weights. The decrease in body weight gain was accompanied by an increase in metabolic rate, as indicated by an increase in oxygen consumption without any change in the respiratory quotient

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 653


653

(A) Saline

Weight gain (g)

10 9 8

ISIS 113715 Control ASO

7 6 5 4 3

Normal chow

2 1 0 0

2

RER

(B)

4 Time (weeks)

(C)

Light Saline ISIS 113715

Metabolic rate

3.8 3.6

8

Saline ISIS 113715

Respiratory quotient

0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 Dark

VO2 (mL /g/h)

6

3.4 3.2 3 2.8 2.6 2.4 Dark

Figure 23.5

Light

ISIS 113715 increased metabolic rate and reduced body-weight gain in mice fed a high-fat diet. Four-week-old male C57BL/6J mice were placed on a high-fat diet for 4 weeks and then treated with either saline, control ASO or ISIS 113715 at a dose of 50 mg/kg once a week i.p. for 6 weeks (n ⫽ 7/group). ISIS 113715 reduced body weight gain (A) and caused an increase in metabolic rate, as reflected in increased oxygen consumption (C) without any change in the respiratory quotient (B).

(Figure 23.5B). In these studies, PTP-1B protein expression was reduced by ⬃50% in the liver and adipose tissues. ISIS 113715 treatment also decreased subcutaneous and abdominal adipose tissue mass in prediabetic, obese, faⲐfa Zucker rats [7]. These effects were observed after only 4 weeks of treatment and were not accompanied by any change in food intake. ISIS 113715 administration to obese monkeys for only 4 weeks caused a fourfold increase in plasma adiponectin levels, a cytokine that has been shown to increase fat oxidation. If the preclinical data gets translated to human diabetic patients in the ongoing clinical studies with this drug, it will make this compound very attractive for the treatment of type 2 diabetes, since ⬎60% of diabetic patients are also obese.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 654

654


23.3.2.2 Antisensing Additional Peripheral Targets for Obesity Several additional targets have demonstrated attractive antiobesity effects in rodent models, one of which is described below to further demonstrate the utility of the antisense approach for this indication. Recent data suggest that c-Jun N-terminal kinases (JNKs) may act as a key mediator between obesity and insulin resistance. There are three JNKs (JNK1, 2, and 3) present in mammals each encoded by a distinct gene [62]. In contrast to JNK2 knockout mice, JNK1 null mice demonstrate lower body weight gain and improved insulin sensitivity when fed a high-fat diet as compared to the wild-type controls [62]. To investigate the role of peripheral JNK1 reduction in metabolism, we employed antisense drugs to reduce its expression in liver and fat in a genetic model of obesity. Treatment of obese, diabetic mice with a JNK1 antisense inhibitor for 6 weeks reduced JNK1 mRNA by ⬎80% in both liver and WAT and by 78% in brown fat (BAT), but did not change JNK2 mRNA levels in any of these tissues (Figure 23.6A). Treatment with JNK1 ASO did not change food intake but decreased BW gain, epididymal fat pad weight and whole body fat content (unpublished data), and increased metabolic rate (Figure 23.6B). Furthermore, treatment markedly lowered both fed and fasting plasma glucose and insulin levels, improved glucose and insulin tolerance and improved liver steatosis (decreased triglyceride content by ⬎40%). This positive phenotype was accompanied by increased mRNA levels of adrenoceptor 3 and UCP1 mRNA in BAT, and increased mRNA levels of both UCP2 and PPAR in liver. These data indicate that specific reduction of JNK1 expression results in increased fuel combustion and that robust antiobesity effects can be achieved by targeting peripheral tissues

(A)

Saline

JNK2 mRNA (%)

JNK1 gene expression

120

JNK1 mRNA (%)

Control ASO

100 80 60 40

** ##

** ##

** ##

20 0 liver

WAT

JNK1 ASO

JNK2 gene expression

140 120 100 80 60 40 20 0 liver

BAT

(B)

Saline

Control ASO

WAT

BAT

JNK1 ASO

VO2 * ,#

VO2 (mL/g/h)

2.2

** ##

2.0 1.8 1.6 1.4 1.2 1.0 Dark

Light

Figure 23.6 JNK1 antisense drug reduced JNK1 expression and increased metabolic rate in ob/ob mice. Male, 5-week-old ob/ob mice (n ⫽ 6/group) were treated with a JNK1 antisense oligonucleotide (ASO) or control ASO at a dose of 25 mg/kg BW twice a week (subcutaneously, dissolved in saline) or with saline for 6 weeks. JNK1 ASO caused significant reductions in JNK1 mRNA expression in liver, white and brown adipose tissue (A) but did not alter JNK2 mRNA expression. JNK1 ASO also caused an increase in metabolic rate, as reflected by increased oxygen consumption (B). *p ⬍ 0.05 versus saline, **p ⬍ 0.05 versus saline, #p ⬍ 0.001 versus control ASO, ##p ⬍ 0.001 versus control ASO, ANOVA.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 655


655

such as liver and fat. Several additional targets are currently under evaluation, most of which are undrugable with small molecules. 23.3.3 Discovery of Antisense Drugs for Nonalcoholic Steatohepatitis Nonalcoholic fatty liver disease now afflicts a significant percentage of people in the Western world, with an estimated prevalence of ⬎14% in the entire population [63]. It is caused by an excess buildup of triglycerides in liver and is often associated with obesity. NASH is a form of nonalcoholic fatty liver disease that presents itself as significant steatohepatitis that cannot be ascribed to the use of alcohol, drugs or any other single identifiable cause [64]. It is a form of metabolic liver disease in which hepatic steatosis is complicated by chronic inflammatory changes that result in steatohepatitis and progressive fibrosis with subsequent progression to cirrhosis, end-stage liver disease, and even hepatocellular carcinoma. The prevalence of NASH has also increased considerably due to an increase in the incidence of obesity and insulin resistance in recent years [64]. The incidence is believed to range from 2 to 3% in normal subjects to ⬃20% in subjects who are obese or have type 2 diabetes. Although equivocal, the pathogenesis of NASH is believed to involve an initial metabolic disturbance that results in steatosis, followed by a second insult resulting in oxidative stress, lipid peroxidation, and a resultant steatohepatitis [64]. The role of inflammatory mediators and other environmental mechanisms in the pathogenesis of NASH is poorly understood. Current management strategies include preventive measures such as lifestyle changes, diet and exercise as well as the treatment of concomitant disorders such as hyperlipidemia and diabetes. There are no therapies that have shown to be successful in treating NASH, although limited studies have shown minimal benefit with antioxidants and thiazolidinediones [65,66]. However, treatment with thiazolidinediones also resulted in weight gain, which is highly undesirable in this population. Thus, there is an immense need for developing drugs that would reduce the steatosis and consequently prevent the fibrosis observed in NASH. The antisense drug discovery effort involved evaluation of ⬎15 targets in intermediary lipid metabolism, with the goal of directly comparing the effects of these targets on hepatic steatosis in rodent models. Antisense drugs against several targets caused marked improvements in hepatic steatosis that were also accompanied by beneficial effects on serum lipids, some of which are discussed below.

23.3.3.1 Acyl-CoA : Diacylglycerol Acyltransferase 2 (DGAT2) Acyl coenzyme A:diacylglycerol acyltransferase (DGAT), is an enzyme that catalyzes the last step in mammalian triglyceride synthesis via the covalent binding of the acyl moiety with diacylglycerol [67]. Two DGATs (DGAT1 and DGAT2), which are encoded for by two different gene families, have been identified [67,68]. While DGAT1 gene knockout mice were found to be resistant to high-fat diet-induced obesity due to an increased metabolic rate, DGAT2 null mice were lipopenic and died soon after birth due to profound reductions in substrates for energy metabolism and impaired skin permeability [69]. Therefore, the consequences of pharmacological reduction of DGAT2 expression in adult tissues remained undetermined. In a series of studies, we explored the effects of specific antisense reduction of each of these isoforms on hepatic steatosis. While reduction of DGAT1 expression by ⬎80% in the liver did not result in a significant change in hepatic steatosis, a similar reduction of DGAT2 expression caused profound improvements in hepatic steatosis in obese rodent models of diabetes that also display marked hepatic steatosis [9]. There was a decrease in hepatic lipid export and an attenuation of circulating triglyceride and cholesterol levels. Reduction of hepatic DGAT2 expression also initiated a

CRC_8796_ch023.qxd

656

5/7/2007

10:17 AM

Page 656


secondary inhibitory feedback loop that inhibited key enzymes involved in lipogenesis, including acetyl CoA carboxylase 1 and 2, stearoyl CoA desaturase, and fatty acid synthase. This decrease in lipogenesis, coupled with an increase in fatty acid oxidation, resulted in clearing of hepatic fat and a paradoxical decrease in hepatic diacylglycerol levels. In contrast to findings reported in the DGAT2-deficient mice, no changes in hepatic energy substrates or any abnormalities in skin microstructure were observed [9]. These findings were further extended by evaluating the effects of a DGAT2 antisense inhibitor in rats fed a high-fat diet. In agreement with data obtained in murine models, DGAT2 antisense treatment caused a decrease in hepatic steatosis, which was accompanied by a marked improvement in hepatic and peripheral insulin sensitivity [70].

23.3.3.2 Antisense Reduction of Stearoyl-CoA Desaturase Expression Stearoyl-CoA desaturase (SCD) is a key enzyme involved in the synthesis of monounsaturated from saturated fatty acids. Mice with a targeted disruption of SCD1 gene are lean and display increased insulin sensitivity [71]. Treatment of obese, diabetic mice with an optimized SCD1 antisense inhibitor (in rodents, this isoform constitutes ⬎99% expression of total SCD activity in the liver) caused an improvement in hepatic steatosis [72]. In rats fed a high-fat diet, antisense reduction of hepatic SCD1 expression caused a significant increase in insulin sensitivity and a reduction in hepatic glucose production. The effects obtained after antisense reduction of SCD1 were less robust than those seen after DGAT2 antisense treatment.

23.3.3.3 Antisense Reduction of Acetyl-CoA Carboxylases 1 and 2 Expression Acetyl-CoA carboxylases (ACCs) catalyze the synthesis of malonyl-CoA, which is both an intermediate in fatty acid synthesis and an allosteric inhibitor of carnitine palmitoyl transferase 1, a key enzyme involved in fatty acid oxidation [73,74]. Of the 2 ACC isoforms, ACC1 is highly expressed in liver and fat whereas ACC2 is largely expressed in heart and skeletal muscle [73]. While it has been suggested that cytosolic ACC1 regulates malonyl-CoA synthesis for incorporation into fatty acids and that ACC2 regulates mitochondrial fatty acid oxidation [75], this postulation has not been directly evaluated. We evaluated the role of individual ACC isoforms by reducing their expression in the liver with antisense inhibitors. While reduction of ACC1 caused a slight decrease in hepatic steatosis, ACC2 reduction did not have any meaningful effect on hepatic lipids [76]. Interestingly, reduction of both ACC1 and ACC2 together caused marked reductions in hepatic malonyl-CoA levels, hepatic lipids, and improved hepatic insulin sensitivity, indicating that combined reduction of the ACC isoforms may be a novel approach for the treatment of disorders such as NASH and the metabolic syndrome. Thus, antisense inhibitors against several lipid targets have demonstrated robust effects on hepatic steatosis that are also accompanied by significant improvements in circulating lipids and hepatic insulin sensitivity. Of all the targets studied to date, antisense reduction of hepatic DGAT2 expression has demonstrated the most profound effects on these parameters. This is not unexpected, since reduction of DGAT2 expression caused secondary inhibition of several other enzymes, including ⬎80% reduction of SCD1, ACC1, and ACC2 [9]. Therefore, the net effect of DGAT2 inhibition exceeds the effect of reducing any single enzyme in the intermediary lipid metabolism pathway, making DGAT2 a promising therapeutic target for NASH and metabolic syndrome.

23.4 ANTISENSE DRUG DEVELOPMENT Several antisense drugs, including those against the glucagon receptor and GC receptor, are expected to enter Phase 1 clinical trials within the next 18–24 months. The most advanced

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 657


657

drug, ISIS 113715, is under evaluation in Phase 2 trials and will be discussed in the following section. 23.4.1 Phase 1/2 Clinical Program Overview ISIS 113715 is being developed as combination therapy in patients who do not achieve adequate glycemic control (HbA1c ⬍7%, ADA criteria) despite maximal effective or maximal tolerated therapy with oral antidiabetic agents such as sulfonylureas, metformin, and thiazolidinediones. In addition, since ISIS 113715 is an insulin sensitizer, it is also being developed as combination therapy in patients inadequately controlled on insulin. To date, ISIS 113715 has been evaluated in normal subjects at doses ranging from 0.5–7.5 mgⲐkg for short durations (7–10 days). ISIS 113715 has also been examined in type 2 diabetic subjects as a single agent at doses of 100, 200, 400, and 600 mgⲐweek for 6 weeks and at a dose of 200 mgⲐweek for 12 weeks. While the ISIS 113715 single-agent study in type 2 diabetic patients was designed primarily to assess the safety, tolerability, and pharmacokinetics of the drug (to support the intended combination studies), encouraging pharmacology was observed in that short-term trial. Key findings obtained in the clinical program are summarized below.

23.4.1.1 Clinical Safety Summary ISIS 113715 has been administered to 169 subjects, 89 healthy volunteers, and 80 patients with type 2 diabetes. Treatment with ISIS 113715, at the doses and regimens examined, did not cause any clinically remarkable changes in markers of glomerular or renal function, nor did it cause any changes in estimated glomerular filtration rates. There were no cases of renal deterioration, renal insufficiency or renal failure in any trial. In addition, no clinically significant changes in hepatic function, no weight gain and no clinically remarkable changes in other laboratory parameters (hematology, coagulation, and complement split product) were observed. Importantly, ISIS 113715 did not induce hypoglycemia when administered as a single agent either in normal or diabetic subjects. There were no drug-related serious adverse events in any clinical trial. Asymptomatic, transient prolongation of aPTT during intravenous infusion of phosphorothioate oligonucleotides has been described previously and was observed in preclinical studies with ISIS 113715. In agreement with these findings, intravenous infusion of the drug caused mild, transient, dose-related prolongations of aPTT (⬃37 and 66% increases for the 400 and 600 mg doses, respectively). These prolongations reversed within minutes after the end of infusion and were not associated with any clinically significant manifestations. Since the intravenous route is not the intended route of administration of the drug upon approval and is primarily used to explore pharmacokinetics in early trials, the aPTT changes become a nonissue for late-stage development of the compound. It is also worth noting that nonclinical and clinical experience indicate that ISIS 113715 treatment, at the doses selected for clinical evaluation, is not expected to have CNS, cardiovascular system, bone marrow, skeletal muscle, gastrointestinal, respiratory, immunologic (i.e., antibody formation) or genotoxic effects.

23.4.1.2 ISIS 113715 Clinical Pharmacokinetics Dose-dependent pharmacokinetics were observed in Phase I studies in healthy volunteers. Subcutaneous administration resulted in complete absorption of ISIS 113715 from the injection site and resulted in similar tissue distribution and elimination as that produced after intravenous infusion. No pharmacokinetic interactions were seen following coadministration of ISIS 113715 with glipizide, rosiglitazone or metformin in healthy volunteers [77].

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

658

Page 658


Plasma pharmacokinetics of ISIS 113715 following single- and multiple-dose administration in normal volunteers and diabetics were remarkably similar. Terminal elimination half-life for ISIS 113715 is preliminarily estimated to be 16 days in type 2 diabetic patients (following treatment at 400 mgⲐweek). Once weekly maintenance dosing did not result in substantial additional accumulation beyond the first week for up to 12 weeks of dosing. In addition, pharmacokinetics were not altered after repeated dose administration up to 12 weeks in type 2 diabetic subjects.

23.4.1.3 ISIS 113715 Clinical Pharmacology Studies in Normal Subjects The pharmacology of ISIS 113715 was examined after administration of the drug at doses of 5.0 and 7.5 mgⲐkg, each administered three times over a course of 1 week [78]. As expected in nondiabetic subjects, there were no changes in glucose excursion during the intravenous glucose tolerance tests (AUC % change from baseline: 5.9, 0.3, 1.3% in the placebo, 5.0 mgⲐkg, and 7.5 mgⲐkg groups, respectively). Pharmacology with ISIS 113715 was reflected as reductions in insulin AUC of 27 and 32% relative to baseline in the 5.0 and 7.5 mgⲐkg cohorts, respectively, a finding not seen in the placebo-treated subjects. A glucose tolerance test in normal volunteers is a particularly rigorous test, since the subjects already have normal insulin sensitivity. Further improvements in insulin sensitivity result in reduced insulin secretion by the pancreas, since the treated subjects require less insulin to maintain normal glucose utilization. This, in turn, is reflected as a reduction in postprandial insulin levels after a glucose challenge, as was seen after just 1 week of ISIS 113715 treatment. The data obtained with ISIS 113715 are consistent with results of preclinical studies in normal and prediabetic animals [8].

Studies in Treatment Naïve Diabetic Subjects The longest duration of ISIS 113715 treatment in type 2 diabetic patients has been 12 weeks at a dose of 200 mgⲐweek (n ⫽ 30). The subjects were newly diagnosed, treatment naive, and had moderate diabetes, as reflected in the average baseline HbA1c of ⬃8.0% and fasting plasma glucose levels of ⬃160 mgⲐdL. Each subject received three doses of ISIS 113715 or placebo during the first week, followed by weekly doses for the remaining treatment weeks. After 3 months of treatment, subjects treated with 200 mgⲐweek ISIS 113715 demonstrated significant improvement in several measurements of glucose homeostasis as compared to the placebo group. Specifically, reductions were seen in both plasma fasted (⬃20 mgⲐdL) and postprandial (⬃30 mgⲐdL) glucose levels [79]. In addition, by the end of treatment, patients treated with ISIS 113715 achieved significant reductions in total and LDL cholesterol levels (⬃35 and ⬃20 mgⲐdL, respectively) as compared to the placebo group. Body weight decreased (⬃2 kg) in both placebo and 113715-treated groups, reflecting compliance to diet and exercise in this drug-naive population. Dietary compliance also resulted in an average decrease in plasma glucose levels of ⬃15 mgⲐdL during the 3-week baseline period in both the placebo- and ISIS 113715-treated groups. As expected, this reduction in plasma glucose levels during the baseline period contributed towards the observed reduction in HbA1c at the end of the subsequent 12-week treatment period, resulting in a significant placebo effect of 0.7% on HbA1c. ISIS 113715 treatment caused a reduction of 1.1% versus baseline, indicating a placebo-subtracted reduction of 0.4%. Importantly, while HbA1c reductions in the placebo group reached a plateau at 9 weeks, those in the ISIS 113715-treated group continued to decline at the end of treatment. Thus, whereas the primary goal of this small, short-term study was to evaluate safety of the drug in a “pure” type 2 diabetes population, encouraging pharmacology was observed in several measures of glucose and lipid control. Evaluation of ISIS 113715 as combination therapy with oral antidiabetic agents is in progress to assess its therapeutic potential for type 2 diabetes.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 659


659

These clinical findings provide the first demonstration of pharmacology in type 2 diabetic patients with any specific PTP-1B inhibitor and validate PTP-1B as a therapeutic target for type 2 diabetes. The data suggest that ISIS 113715 may offer a substantial improvement over currently available diabetes drugs. ISIS 113715 could control blood glucose without the risk of hypoglycemia and weight gain. In addition, ISIS 113715 could also be useful for the treatment of dyslipidemia that is often observed in diabetic patients. 23.5 CONCLUSION As is evident from the preceding sections, the extensive in vivo drug-discovery effort conducted in recent years has identified multiple, exciting targets for the treatment of metabolic disorders. Reduction of these targets with antisense drugs has produced pharmacological effects that not only provide the desired glucose control, but also encompass reductions in hyperlipidemia and body weight gain, thereby offering a multipronged approach for the treatment of diabetic patients. Furthermore, several drug-development opportunities have been identified that have unique antisense advantages, making them very compelling therapeutic strategies. During the next few years, multiple antisense drugs are poised to enter the clinic. These drugs display unique therapeutic profiles that are unmatched by existing therapies. While long-term efficacy and safety of antisense drugs needs to be carefully evaluated in the coming years, the data obtained to date suggest that these drugs may add a new dimension to our therapeutic arsenal for metabolic diseases such as type 2 diabetes and NASH. ACKNOWLEDGMENTS The author thanks Pamela Black, Tracy Reigle, and Susan F. Murray for assistance in preparation of this chapter. The author is also indebted to Drs. Brett P. Monia, Frank Bennett, Mark Wedel, and Stan Crooke for their guidance and support and to members of the Metabolic Research & Development teams at Isis for their contribution to the unpublished data discussed in this chapter. REFERENCES 1. B. B. Kahn and L. Rossetti; Type 2 diabetes—who is conducting the orchestra?; Nat Genet; 20; 223–225; 1998. 2. S. T. Crooke; Basic principles of antisense technology; Antisense Drug Technology: Principles, Strategies, and Applications; S. T. Crooke, ed.; Marcel Dekker, Inc., New York, USA; 2001. 3. S. T. Crooke; Progress in antisense technology; Annu Rev Med; 55; 61–95; 2004. 4. R. S. Geary, R. Z. Yu and A. A. Levin; Pharmacokinetics of phosphorothioate antisense oligodeoxynucleotides; Curr Opin Invest Drugs; 2; 562–573; 2001. 5. S. T. Crooke; Antisense strategies; Curr Mol Med; 4; 465–487; 2004. 6. R. J. Gum, L. L. Gaede, S. L. Koterski, M. Heindel, J. E. Clampit, B. A. Zinker, J. M. Trevillyan, R. G. Ulrich, M. R. Jirousek and C. M. Rondinone; Reduction of protein tyrosine phosphatase 1B increases insulin-dependent signaling in obⲐob mice; Diabetes; 52; 21–28; 2003. 7. C. M. Rondinone, J. M. Trevillyan, J. Clampit, R. J. Gum, C. Berg, P. Kroeger, L. Frost, B. A. Zinker, R. Reilly, R. Ulrich, M. Butler, B. P. Monia, M. R. Jirousek and J. F. Waring; Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis; Diabetes; 51; 2405–2411; 2002. 8. B. A. Zinker, C. M. Rondinone, J. M. Trevillyan, R. J. Gum, J. E. Clampit, J. F. Waring, N. Xie, D. Wilcox, P. Jacobson, L. Frost, P. E. Kroeger, R. M. Reilly, S. Koterski, T. J. Opgenorth, R. G. Ulrich, S. Crosby, M. Butler, S. F. Murray, R. A. McKay, S. Bhanot, B. P. Monia and M. R. Jirousek; PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice; Proc Natl Acad Sci USA; 99; 11357–11362; 2002.

CRC_8796_ch023.qxd

660

5/7/2007

10:17 AM

Page 660


9. X. X. Yu, S. F. Murray, S. K. Pandey, S. L. Booten, D. Bao, X. Z. Song, S. Kelly, S. Chen, R. McKay, B. P. Monia and S. Bhanot; Antisense oligonucleotide reduction of DGAT2 expression improves hepatic steatosis and hyperlipidemia in obese mice; Hepatology; 42; 362–371; 2005. 10. A. J. McCullough; Pathophysiology of nonalcoholic steatohepatitis; J Clin Gastroenterol; 40; S17–S29; 2006. 11. M. Butler, R. A. McKay, I. J. Popoff, W. A. Gaarde, D. Witchell, S. F. Murray, N. M. Dean, S. Bhanot and B. P. Monia; Specific inhibition of PTEN expression reverses hyperglycemia in diabetic mice; Diabetes; 51; 1028–10234; 2002. 12. K. Fukui, T. Wada, S. Kagawa, K. Nagira, M. Ikubo, H. Ishihara, M. Kobayashi and T. Sasaoka; Impact of the liver-specific expression of SHIP2 (SH2-containing inositol 5⬘-phosphatase 2) on insulin signaling and glucose metabolism in mice; Diabetes; 54; 1958–1967; 2005. 13. K. A. Kenner, E. Anyanwu, J. M. Olefsky and J. Kusari; Protein-tyrosine phosphatase 1B is a negative regulator of insulin- and insulin-like growth factor-I-stimulated signaling; J Biol Chem; 271; 19810–19816; 1996. 14. C. Kurlawalla-Martinez, B. Stiles, Y. Wang, S. U. Devaskar, B. B. Kahn and H. Wu; Insulin hypersensitivity and resistance to streptozotocin-induced diabetes in mice lacking PTEN in adipose tissue; Mol Cell Biol; 25; 2498–2510; 2005. 15. B. Stiles, Y. Wang, A. Stahl, S. Bassilian, W. P. Lee, Y. J. Kim, R. Sherwin, S. Devaskar, R. Lesche, M. A. Magnuson and H. Wu; Liver-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity; Proc Natl Acad Sci USA; 101; 2082–2087; 2004. 16. M. Elchebly, P. Payette, E. Michaliszyn, W. Cromlish, S. Collins, A. L. Loy, D. Normandin, A. Cheng, J. Himms-Hagen, C. C. Chan, C. Ramachandran, M. J. Gresser, M. L. Tremblay and B. P. Kennedy; Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene; Science; 283; 1544–1548; 1999. 17. L. D. Klaman, O. Boss, O. D. Peroni, J. K. Kim, J. L. Martino, J. M. Zabolotny, N. Moghal, M. Lubkin, Y. B. Kim, A. H. Sharpe, A. Stricker-Krongrad, G. I. Shulman, B. G. Neel and B. B. Kahn; Increased energy expenditure, decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice; Mol Cell Biol; 20; 5479–5489; 2000. 18. S. Shimizu, S. Ugi, H. Maegawa, K. Egawa, Y. Nishio, T. Yoshizaki, K. Shi, Y. Nagai, K. Morino, K. Nemoto, T. Nakamura, M. Bryer-Ash and A. Kashiwagi; Protein-tyrosine phosphatase 1B as new activator for hepatic lipogenesis via sterol regulatory element-binding protein-1 gene expression; J Biol Chem; 278; 43095–43101; 2003. 19. G. Liu; Protein tyrosine phosphatase 1B inhibition: opportunities and challenges; Curr Med Chem; 10; 1407–1421; 2003. 20. S. Bhanot, K. Stanhope, P. Havel, L. Watts, R. McKay, A. Levin and B. Monia; A novel PTP-1B antisense inhibitor (ISIS 113715) improves insulin sensitivity in obese hyperinsulinemic rhesus monkeys; Diabetes; 52 (Suppl. 1); A111; 2003. 21. W. Qiu, R. K. Avramoglu, N. Dube, T. M. Chong, M. Naples, C. Au, K. G. Sidiropoulos, G. F. Lewis, J. S. Cohn, M. L. Tremblay and K. Adeli; Hepatic PTP-1B expression regulates the assembly and secretion of apolipoprotein B-containing lipoproteins: evidence from protein tyrosine phosphatase-1B overexpression, knockout, and RNAi studies; Diabetes; 53; 3057–3066; 2004. 22. S. F. Murray, S. L. Booten, E. N. Finger, R. A. McKay, B. P. Monia and S. Bhanot; Additive glucose lowering effects of a novel PTP-1B antisense oligonucleotide (ISIS 113715) with Rosiglitazone and Metformin in ZDF rats; Diabetes; 54 (Suppl. 1); A373; 2005. 23. G. Ramponi and M. Stefani; Structural, catalytic, and functional properties of low M(r), phosphotyrosine protein phosphatases. Evidence of a long evolutionary history; Int J Biochem Cell Biol; 29; 279–292; 1997. 24. S. K. Pandey, M. D. Michael, K. W. Sloop, L. M. Watts, A. R. Rivard, T. A. Leedom, P. Manchem, S. Petok, R. A. McKay, B. P. Monia and S. Bhanot; in vivo inhibition of low molecular weight protein tyrosine phosphatase (LMW-PTP) with an antisense oligonucleotide improves hyperglycemia and insulin sensitivity in diabetic mice; Diabetes; 54 (Suppl. 1); A22; 89-OR; 2005. 25. W. A. Gaarde, S. F. Murray, S. Booten, B. P. Monia, K. W. Sloop, M. D. Michael, C. Su and S. Bhanot; Reduction of hepatic protein tyrosine phosphatase, receptor, type A (PTPR-alpha) expression using an antisense oligonucleotide improves hyperglycemia, steatosis and plasma triglycerides in diabetic mice; Diabetes; 55 (Suppl. 1); A439; 2006.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 661


661

26. K. Tsukiyama-Kohara, F. Poulin, M. Kohara, C. T. DeMaria, A. Cheng, Z. Wu, A. C. Gingras, A. Katsume, M. Elchebly, B. M. Spiegelman, M. E. Harper, M. L. Tremblay and N. Sonenberg; Adipose tissue reduction in mice lacking the translational inhibitor 4E-BP1; Nat Med; 7; 1128–1132; 2001. 27. X. X. Yu, S. L. Booten, S. K. Pandey, B. P. Monia and S. Bhanot; Antisense reduction of eukaryotic initiation factor 4E-binding protein 2 expression improves adiposity and insulin sensitivity in diet-induced obese mice; Keystone Symposia—Diabetes Mellitus and the Control of Cellular Energy; 183; 2006. 28. A. Barthel, D. Schmoll, K. D. Kruger, G. Bahrenberg, R. Walther, R. A. Roth and H. G. Joost; Differential regulation of endogenous glucose-6-phosphatase and phosphoenolpyruvate carboxykinase gene expression by the forkhead transcription factor FKHR in H4IIE-hepatoma cells; Biochem Biophys Res Commun; 285; 897–902; 2001. 29. V. T. Samuel, C. S. Choi, T. G. Phillips, A. J. Romanelli, J. G. Geisler, S. Bhanot, R. McKay, B. Monia, J. R. Shutter, R. A. Lindberg, G. I. Shulman and M. M. Veniant; Targeting foxo1 in mice using antisense oligonucleotide improves hepatic and peripheral insulin action; Diabetes; 55; 2042–2050; 2006. 30. J. G. Geisler, S. Bhanot, R. A. McKay, J. R. Shutter, B. P. Monia, R. A. Lindberg and M. M. Veniant; Effect of Foxo1 antisense oligonucleotide (ASO) therapy in mice; Keystone Symposia–Diabetes Mellitus: Molecular Signaling, Genes and Therapeutics; 224; 2004. 31. J. T. Link; Pharmacological regulation of hepatic glucose production; Curr Opin Invest Drugs; 4; 421–429; 2003. 32. S. Bhanot, S. F. Murray, S. L. Booten, R. A. McKay, S. J. Jacobs, M. D. Michael, A. Nestorowicz, K. W. Sloop and B. P. Monia; Inhibition of hepatic PEPCK (cytosolic) mRNA expression with an antisense oligonucleotide does not attenuate hyperglycemia in diabetic ob/ob and db/db mice; Diabetes; 53 (Suppl. 2); A574; 2004. 33. P. She, S. C. Burgess, M. Shiota, P. Flakoll, E. P. Donahue, C. R. Malloy, A. D. Sherry and M. A. Magnuson; Mechanisms by which liver-specific PEPCK knockout mice preserve euglycemia during starvation; Diabetes; 52; 1649–1654; 2003. 34. J. G. Geisler, M. Veniant-Ellison, S. Bhanot, B. Monia, R. Lindberg, R. McKay and J. Shutter; 98% reduction in liver FBP1 is insufficient to lower fasting blood glucose levels in mice; Diabetes; 54 (Suppl. 1); A373; 2005. 35. M. D. Erion, P. D. van Poelje, Q. Dang, S. R. Kasibhatla, S. C. Potter, M. R. Reddy, K. R. Reddy, T. Jiang and W. N. Lipscomb; MB06322 (CS-917): A potent and selective inhibitor of fructose 1,6-bisphosphatase for controlling gluconeogenesis in type 2 diabetes; Proc Natl Acad Sci USA; 102; 7970–7975; 2005. 36. B. Herzog, U. Wendel, A. A. Morris and K. Eschrich; Novel mutations in patients with fructose-1,6bisphosphatase deficiency; J Inherit Metab Dis; 22; 132–138; 1999. 37. M. Butler, R. Valley, L. M. Watts, S. F. Murray, S. L. Booten, B. P. Monia, M. D. Michael, K. W. Sloop, S. I. Taylor and S. Bhanot; Inhibition of liver glycogen phosphorylase expression using an antisense oligonucleotide lowers blood glucose levels in diabetic mice; Diabetes; 51 (Suppl. 2); A43; 2002. 38. J. L. Treadway, P. Mendys and D. J. Hoover; Glycogen phosphorylase inhibitors for treatment of type 2 diabetes mellitus; Expert Opin Investig Drugs; 10; 439–454; 2001. 39. S. F. Murray, S. L. Booten, E. N. Finger, R. A. McKay, B. P. Monia, A. M. Siesky, J. X. Cao, A. Nestorowicz, S. J. Jacobs, M. D. Michael, K. W. Sloop and S. Bhanot; Antisense inhibition of glucose-6 phosphatase (G6Pase) transport protein T1 expression lowers plasma glucose in diabetic mice; Diabetes; 53 (Suppl. 2); A70; 2004. 40. J. Y. Chou, A. Zingone and C. J. Pan; Adenovirus-mediated gene therapy in a mouse model of glycogen storage disease type 1a; Eur J Pediatr; 161 Suppl 1; S56–S61; 2002. 41. R. C. Andrews and B. R. Walker; Glucocorticoids and insulin resistance: old hormones, new targets; Clin Sci (Lond); 96; 513–523; 1999. 42. R. C. Lin and P. J. Snodgrass; Effect of dexamethasone on 3-hydroxy-3-methylglutaryl-coenzyme A reductase activity and cholesterol synthesis in rat liver; Biochim Biophys Acta; 713; 240–250; 1982. 43. L. M. Watts, V. P. Manchem, T. A. Leedom, A. L. Rivard, R. A. McKay, D. Bao, T. Neroladakis, B. P. Monia, D. M. Bodenmiller, J. X. Cao, H. Y. Zhang, A. L. Cox, S. J. Jacobs, M. D. Michael, K. W. Sloop and S. Bhanot; Reduction of hepatic and adipose tissue glucocorticoid receptor expression with antisense oligonucleotides improves hyperglycemia and hyperlipidemia in diabetic rodents without causing systemic glucocorticoid antagonism; Diabetes; 54; 1846–1853; 2005.

CRC_8796_ch023.qxd

662

5/7/2007

10:17 AM

Page 662


44. J. E. Friedman, Y. Sun, T. Ishizuka, C. J. Farrell, S. E. McCormack, L. M. Herron, P. Hakimi, P. Lechner and J. S. Yun; Phosphoenolpyruvate carboxykinase (GTP) gene transcription and hyperglycemia are regulated by glucocorticoids in genetically obese db/db transgenic mice; J Biol Chem; 272; 31475–31481; 1997. 45. S. F. Murray, S. Booten, R. A. McKay, M. Butler, B. P. Monia and S. Bhanot; Liver and fat specific reduction of 11-beta-hydroxysteroid dehydrogenase type 1 expression does not cause significant glucose or lipid lowering effects in db/db mice; Keystone Symposia–Diabetes Mellitus and the Control of Cellular Energy; 74; 2006. 46. R. H. Unger; Letter: Glucagon in pathogenesis of diabetes; Lancet; 1; 1036–1042; 1975. 47. G. M. Reaven, Y. D. Chen, A. Golay, A. L. Swislocki and J. B. Jaspan; Documentation of hyperglucagonemia throughout the day in nonobese and obese patients with noninsulin-dependent diabetes mellitus; J Clin Endocrinol Metab; 64; 106–110; 1987. 48. P. Shah, A. Vella, A. Basu, R. Basu, W. F. Schwenk and R. A. Rizza; Lack of suppression of glucagon contributes to postprandial hyperglycemia in subjects with type 2 diabetes mellitus; J Clin Endocrinol Metab; 85; 4053–4059; 2000. 49. J. C. Parker, K. M. Andrews, M. R. Allen, J. L. Stock and J. D. McNeish; Glycemic control in mice with targeted disruption of the glucagon receptor gene; Biochem Biophys Res Commun; 290; 839–843; 2002. 50. C. L. Brand, B. Hansen, S. Groneman, M. Boysen and J. J. Holst; Sub-chronic glucagon neutralisation improves diabetes in ob/ob mice [abstract]; Diabetes; 49; A81; 2000. 51. C. L. Brand, B. Rolin, P. N. Jorgensen, I. Svendsen, J. S. Kristensen and J. J. Holst; Immunoneutralization of endogenous glucagon with monoclonal glucagon antibody normalizes hyperglycaemia in moderately streptozotocin-diabetic rats; Diabetologia; 37; 985–993; 1994. 52. J. G. McCormack, N. Westergaard, M. Kristiansen, C. L. Brand and J. Lau; Pharmacological approaches to inhibit endogenous glucose production as a means of anti-diabetic therapy; Curr Pharm Dev; 7; 1451–1474; 2001. 53. K. F. Petersen and J. T. Sullivan; Effects of a novel glucagon receptor antagonist (Bay 27-9955) on glucagon-stimulated glucose production in humans; Diabetologia; 44; 2018–2024; 2001. 54. K. W. Sloop, J. X. Cao, A. M. Siesky, H. Y. Zhang, D. M. Bodenmiller, A. L. Cox, S. J. Jacobs, J. S. Moyers, R. A. Owens, A. D. Showalter, M. B. Brenner, A. Raap, J. Gromada, B. R. Berridge, D. K. Monteith, N. Porksen, R. A. McKay, B. P. Monia, S. Bhanot, L. M. Watts and M. D. Michael; Hepatic and glucagon-like peptide-1-mediated reversal of diabetes by glucagon receptor antisense oligonucleotide inhibitors; J Clin Invest; 113; 1571–1581; 2004. 55. S. Bhanot, L. M. Watts, K. W. Sloop, J. X. Cao, A. D. Showalter, M. D. Michael and B. P. Monia; Reduction of hepatic glucagon receptor expression with an optimized antisense oligonucleotide increased active GLP-1 levels in cynomolgus monkeys without pancreatic alpha cell expansion or hyperplasia.; Diabetes; 55 (Suppl. 1); A326; 2006. 56. R. Ritzel, M. Schulte, N. Porksen, M. S. Nauck, J. J. Holst, C. Juhl, W. Marz, O. Schmitz, W. H. Schmiegel and M. A. Nauck; Glucagon-like peptide 1 increases secretory burst mass of pulsatile insulin secretion in patients with type 2 diabetes and impaired glucose tolerance; Diabetes; 50; 776–784; 2001. 57. K. Cejvan, D. H. Coy and S. Efendic; Intra-islet somatostatin regulates glucagon release via type 2 somatostatin receptors in rats; Diabetes; 52; 1176–1181; 2003. 58. A. E. Butler, J. Janson, S. Bonner-Weir, R. Ritzel, R. A. Rizza and P. C. Butler; Beta-cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes; Diabetes; 52; 102–110; 2003. 59. Y. Kanai, W. S. Lee, G. You, D. Brown and M. A. Hediger; The human kidney low affinity Na⫹/glucose cotransporter SGLT2. Delineation of the major renal reabsorptive mechanism for D-glucose; J Clin Invest; 93; 397–404; 1994. 60. L. M. Watts, T. A. Leedom, E. V. Wancewicz, A. M. Siwkowski, S. Bhanot and B. P. Monia; Reduction of sodium dependent glucose transporter SGLT2 expression with an antisense oligonucleotide (ASO) optimized to target the kidney results in significant glucose lowering effects in diabetic mice; Diabetes; 54 (Suppl. 1); A386; 2005. 61. D. M. Schnee, K. Zaiken and W. W. McCloskey; An update on the pharmacological treatment of obesity; Curr Med Res Opin; 22; 1463–1474; 2006. 62. J. Hirosumi, G. Tuncman, L. Chang, C. Z. Gorgun, K. T. Uysal, K. Maeda, M. Karin and G. S. Hotamisligil; A central role for JNK in obesity and insulin resistance; Nature; 420; 333–336; 2002.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 663


663

63. J. D. Browning and J. D. Horton; Molecular mediators of hepatic steatosis and liver injury; J Clin Invest; 114; 147–152; 2004. 64. G. Marchesini, E. Bugianesi, G. Forlani, F. Cerrelli, M. Lenzi, R. Manini, S. Natale, E. Vanni, N. Villanova, N. Melchionda and M. Rizzetto; Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome; Hepatology; 37; 917–923; 2003. 65. S. H. Caldwell, E. E. Hespenheide, J. A. Redick, J. C. Iezzoni, E. H. Battle and B. L. Sheppard; A pilot study of a thiazolidinedione, troglitazone, in nonalcoholic steatohepatitis; Am J Gastroenterol; 96; 519–525; 2001. 66. T. Hasegawa, M. Yoneda, K. Nakamura, I. Makino and A. Terano; Plasma transforming growth factor-beta1 level and efficacy of alpha-tocopherol in patients with non-alcoholic steatohepatitis: a pilot study; Aliment Pharmacol Ther; 15; 1667–1672; 2001. 67. S. Cases, S. J. Smith, Y. W. Zheng, H. M. Myers, S. R. Lear, E. Sande, S. Novak, C. Collins, C. B. Welch, A. J. Lusis, S. K. Erickson and R. V. Farese, Jr.; Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key enzyme in triacylglycerol synthesis; Proc Natl Acad Sci USA; 95; 13018–13023; 1998. 68. S. Cases, S. J. Stone, P. Zhou, E. Yen, B. Tow, K. D. Lardizabal, T. Voelker and R. V. Farese, Jr.; Cloning of DGAT2, a second mammalian diacylglycerol acyltransferase, and related family members; J Biol Chem; 276; 38870–38876; 2001. 69. S. J. Stone, H. M. Myers, S. M. Watkins, B. E. Brown, K. R. Feingold, P. M. Elias and R. V. Farese, Jr.; Lipopenia and skin barrier abnormalities in DGAT2-deficient mice; J Biol Chem; 279; 11767–11776; 2004. 70. A. R. Kulkarni, C. S. Choi, D. Savage, K. Morino, V. T. Samuel, S. Kim, A. Wang, J. G. Geisler, S. Bhanot, B. Monia, X. X. Yu, S. Neschen, A. J. Romanelli, G. Cline and G. I. Shulman; Suppression of DGAT2 expression by antisense oligonucleotide improves hepatic steatosis and prevents fat induced insulin resistance in vivo; Diabetes; 54 (Suppl. 1) Late Breaking; 17; 2005. 71. J. M. Ntambi, M. Miyazaki, J. P. Stoehr, H. Lan, C. M. Kendziorski, B. S. Yandell, Y. Song, P. Cohen, J. M. Friedman and A. D. Attie; Loss of stearoyl-CoA desaturase-1 function protects mice against adiposity; Proc Natl Acad Sci USA; 99; 11482–11486; 2002. 72. G. Jiang, Z. Li, F. Liu, K. Ellsworth, Q. Dallas-Yang, M. Wu, J. Ronan, C. Esau, C. Murphy, D. Szalkowski, R. Bergeron, T. Doebber and B. B. Zhang; Prevention of obesity in mice by antisense oligonucleotide inhibitors of stearoyl-CoA desaturase-1; J Clin Invest; 115; 1030–1038; 2005. 73. M. R. Munday; Regulation of mammalian acetyl-CoA carboxylase; Biochem Soc Trans; 30; 1059–1064; 2002. 74. D. Zhang, Z. X. Liu, A. Wang, D. Savage, J. Dong, V. Samuel, B. Monia, S. Bhanot, J. Geisler and G. I. Shulman; Reversal of high-fat diet induced liver insulin resistance in rats treated with stearoyl-CoA desaturase 1 anti-sense oligonucleotide; Diabetes; 54 (Suppl. 1); A360; 2005. 75. L. Abu-Elheiga, M. M. Matzuk, K. A. Abo-Hashema and S. J. Wakil; Continuous fatty acid oxidation and reduced fat storage in mice lacking acetyl-CoA carboxylase 2; Science; 291; 2613–2616; 2001. 76. D. B. Savage, C. S. Choi, V. T. Samuel, Z. X. Liu, D. Zhang, A. Wang, X. M. Zhang, G. W. Cline, X. X. Yu, J. G. Geisler, S. Bhanot, B. P. Monia and G. I. Shulman; Reversal of diet-induced hepatic steatosis and hepatic insulin resistance following suppression of both ACC1 and ACC2 with antisense oligonucleotides; Keystone Symposia—Diabetes Mellitus and the Control of Cellular Energy Metabolism; 74; 2006. 77. R. S. Geary, J. D. Bradley, T. Watanabe, Y. Kwon, M. Wedel, J. J. van Lier and A. A. VanVliet; Lack of pharmacokinetic interaction for ISIS 113715, a 2⬘-o-methoxyethyl modified antisense oligonucleotide targeting protein tyrosine phosphatase 1B messenger RNA, with oral antidiabetic compounds metformin, glipizide or rosiglitazone; Clin Pharmacokinet; 45; 789–801; 2006. 78. G. Liu; Technology evaluation: ISIS-113715, Isis; Curr Opin Mol Ther; 6; 331–336; 2004. 79. Isis Pharmaceuticals; Isis Pharmaceuticals reports positive phase 2 data: ISIS 113715 Improves glucose control in patients with type 2 diabetes; Press Release; June 13, 2006.

CRC_8796_ch023.qxd

5/7/2007

10:17 AM

Page 664

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 665

CHAPTER

24

Inflammatory Diseases Susan A. Gregory and James G. Karras

CONTENTS 24.1

24.2

24.3

24.4

24.5

24.6

24.7

Introduction .........................................................................................................................666 24.1.1 The Inflammatory Disease Process.......................................................................666 24.1.2 Advantages and Challenges in Antisense Therapy Development.........................666 Inflammatory Bowel Disease (IBD) ...................................................................................667 24.2.1 Pathology and Current Therapy of Inflammatory Bowel Disease........................667 24.2.2 Clinical Evaluation of Intercellular Adhesion Molecule (ICAM)-1 Antisense (Alicaforsen) in Crohn’s Disease..........................................................................667 24.2.3 Clinical Evaluation of Alicaforsen in Ulcerative Colitis ......................................668 24.2.4 Preclinical Application of Antisense in Models of Inflammatory Bowel Disease................................................................................671 Rheumatoid Arthritis...........................................................................................................672 24.3.1 Pathology and Current Therapy of Rheumatoid Arthritis.....................................672 24.3.2 Clinical Evaluation of ICAM-1 and TNF- Antisense in Rheumatoid Arthritis.........................................................................................672 24.3.3 Preclinical Applications of Antisense in Models of RA.......................................674 Multiple Sclerosis (MS)......................................................................................................675 24.4.1 Disease Pathology and Current Therapy of Multiple Sclerosis............................675 24.4.2 Clinical Evaluation of Very Late Activation Antigen (VLA)-4 Antisense in Multiple Sclerosis .................................................................................................675 24.4.3 Preclinical Application of Antisense in Models of Multiple Sclerosis.................676 Asthma ................................................................................................................................678 24.5.1 Disease Pathology and Current Therapy of Asthma.............................................678 24.5.2 Clinical Evaluation of Antisense Oligonucleotides in Asthma.............................678 24.5.3 Preclinical Application of Antisense in Models of Asthma..................................679 Additional Preclinical in Vivo Pharmacology in Models of Inflammation ........................682 24.6.1 Immunomodulation and Transplantation ..............................................................682 24.6.2 Hyperalgesia..........................................................................................................684 Cellular and Molecular Pharmacology ...............................................................................685 24.7.1 Cell Proliferation, Maturation, and Survival.........................................................685 24.7.2 Cell Activation ......................................................................................................686 24.7.3 Cell Migration and Adhesion................................................................................686 665

CRC_8796_ch024.qxd

666

6/20/2007

10:30 PM

Page 666


24.7.4 Gene Expression and Receptor Signaling.............................................................686 24.7.5 Mediator Release...................................................................................................687 24.7.6 Immunomodulation and Immune Surveillance.....................................................688 24.8 Future Directions ................................................................................................................689 References ......................................................................................................................................690 24.1 INTRODUCTION 24.1.1 The Inflammatory Disease Process Inflammation is normally a localized, protective host response to trauma or infectious agents. Acute inflammation confines the area of injury, destroys or dilutes the injurious agent, and contributes to the restoration of tissue integrity [1]. Chronic inflammation, resulting from repeated exposure, persistent injury, or a failure to appropriately terminate the immune or inflammatory response, may lead to organ injury and morbidity. Current therapeutic strategies aim to suppress or redirect aberrant cellular responses to environmental and infectious stimuli. 24.1.2 Advantages and Challenges in Antisense Therapy Development Antisense provides a novel pharmacological approach to the modification of the inflammatory response. Advantages of antisense strategies include the ability to achieve hybridization-based target specificity and the ability to reduce expression of a target protein in the nuclear, cytoplasmic, or membrane compartment(s) of cells. This combination of properties distinguishes antisense oligonucleotides (ASOs) from small-molecule and protein-based technologies. In addition, the pharmacokinetic properties of first- and second-generation phosphorothioate oligodeoxyribonucleotides (PS-ODNs) are compatible with more convenient, once daily, or less frequent administration of antisense therapeutics in patients. Polygenetic inflammatory diseases pose formidable challenges for antisense drug development, however, including dose, dose interval, and delivery optimization. The involvement of aberrant local and systemic host responses is apparent in syndromes such as Crohn’s disease, asthma, and rheumatoid arthritis (RA). There is experimental evidence for heterogeneity in cell responsiveness to ASOs [2], which may reflect differences in oligonucleotide uptake efficiency or intracellular distribution. The evaluation of antisense therapeutics in inflammatory diseases can also be complicated by off-target proinflammatory effects of oligonucleotides. Both first- and second-generation PS-ODNs are capable of activating complement and eliciting release of cytokines and chemokines [3]. Cells of the innate immune system may recognize internalized oligonucleotides via Toll-like receptor (TLR) 9 [4]. The existence of non-TLR-based mechanisms for recognition of single- and doublestranded DNA have also been documented in human neutrophils and may also be involved in the acute inflammatory response to specific sequence motifs [5]. Second-generation, 2-O-methoxyethyl (2-MOE)-modified PS-ODNs have demonstrated increased pharmacological potency relative to first-generation antisense inhibitors [6]. Consequently, fewer proinflammatory effects of 2-MOE PS-ODNs are observed at clinically relevant doses [7]. Several lines of evidence can be pursued to distinguish antisense effects of ODNs from off-target effects in vivo, including demonstrations of target mRNA or protein reduction concomitant with pharmacology and activity of multiple ASOs directed to nonoverlapping target mRNA hybridization sites. Mismatched oligonucleotides can also be evaluated in preclinical studies to explore chemical-class-related effects of ODNs. Collectively, these analyses can provide insight into the mechanism(s) underlying oligonucleotide drug activity. While significant challenges lie ahead for clinical development of antisense therapies for inflammatory diseases, important achievements have recently been made. The clinical development status of antisense therapies and the molecules that are likely to advance into the clinic for treatment of inflammatory diseases are the focus of this review.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 667

INFLAMMATORY DISEASES

667

24.2 INFLAMMATORY BOWEL DISEASE (IBD) 24.2.1 Pathology and Current Therapy of Inflammatory Bowel Disease Ulcerative colitis (UC) and Crohn’s disease (CD) are polygenetic, chronic inflammatory disorders of the gastrointestinal tract of unknown etiologies. Inflammation in UC is usually limited to the large bowel wall while CD involves transmural inflammation that may occur anywhere in the alimentary canal. UC appears to be driven by the local production of interleukin (IL) 13 [8]. In contrast, T helper (Th) 1 cytokines are characteristically produced in CD, and IL 12 and IL 23 have been implicated in polarization of the Th cell response [9]. Constitutional abnormalities in innate immunity have also been described in CD patients [10,11], and these disturbances may predispose CD patients to accumulation of intestinal contents, leading to breach of the bowel wall mucosal barrier and chronic inflammation. Therapy for IBD has traditionally relied upon 5-aminosalicylic acid compounds and corticosteroids [12,13]. Corticosteroids are effective for induction and maintenance of remission, but toxicities and dependency can complicate treatment. Azathioprine, methotrexate, and cyclosporin have limited use in patients with refractory disease because of the potential for toxicities and infections. The IgG1 antitumor necrosis factor (TNF)- monoclonal antibodies (mAb) infliximab (Remicade®; Centocor, Malvern, PA) [14] and adalimumab (D2E7, Humira®; Abbott Laboratories, Abbott Park, IL) [15] have also demonstrated efficacy for induction of CD remission. In contrast, the soluble TNF receptor fusion protein etanercept (Enbrel®, Amgen, Thousand Oaks, CA and Wyeth, Madison, NJ) [16] and the IgG4 mAb certolizumab pegol (CDP)571 (Humicade®, UCB, Brussels, Belgium,) [17] failed to demonstrate a therapeutic benefit in CD patients. These differences may be explained by the abilities of infliximab [18] and adalimumab [19] to bind cell-bound and soluble TNF- and induce apoptosis of lamina propria T lymphocytes (LPLs). 24.2.2 Clinical Evaluation of Intercellular Adhesion Molecule (ICAM)-1 Antisense (Alicaforsen) in Crohn’s Disease The first antisense strategy evaluated in CD patients aimed to block T-cell and neutrophil migration and activation by reducing the expression of ICAM-1 (CD54). ICAM-1 mRNA is highly expressed in tissues from patients with active CD or UC [20], and ICAM-1 antisense has been shown to reduce disease severity, neutrophil infiltrates, and epithelial damage in a mouse model of experimental colitis [21]. Alicaforsen (ISIS 2302, Isis Pharmaceuticals, Carlsbad, CA) is a first-generation oligonucleotide inhibitor of ICAM-1 expression that has demonstrated a satisfactory safety profile and trends suggesting effects on mucosal ICAM-1 expression, endoscopic measures of disease severity, and quality of life in subjects with active CD [22,23]. While alicaforsen failed to achieve the primary endpoint of clinical remission at week 12 when administered at doses of 0.5 to 2 mg/kg/d intravenously 3 times per week for 4 weeks, post hoc population pharmacokinetic analysis indicated that patients with the highest drug exposure had consistent improvements in median Crohn’s disease activity index (CDAI) and quality of life scores. Fixed doses of 300 mg and 350 mg were selected for further evaluation based on a pharmacokinetic/pharmacodynamic model developed from phase 2 results [24]. The 300-mg dose was well tolerated and carried forward into phase 3 development. The clinical efficacy of 300 mg of alicaforsen (3 times per week, intravenous [i.v.], for 4 weeks) was evaluated in two identical phase 3 trials in subjects with active, steroid-dependent CD [25]. While alicaforsen was well tolerated in these studies, no significant difference in clinical remission at week 12 was demonstrated for the alicaforsen and placebo treatments. Several factors may have contributed to the clinical failure of alicaforsen in CD. While ICAM-1 may be overexpressed and play an active role in cell recruitment and activation in mucosal tissues, other integrins are also overexpressed in IBD tissues [26] and vascular addressins such as the integrins have been shown to facilitate lymphocyte homing to mucosal tissues [27]. Consistent and

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 668

668


adequate reduction of ICAM-1 protein expression may have been achieved in only a portion of targeted cells at the alicaforsen doses and regimen tested, resulting in incomplete suppression of the inflammatory response in affected tissues. Finally, the inflammatory status of the subject population may have influenced the clinical response to alicaforsen. No significant differences in baseline subject characteristics, including previous treatment history, current mean steroid dose, and serum levels of C-reactive protein (CRP), were noted between alicaforsen- and placebotreated subjects. A post-hoc analysis of the phase 3 results suggested, however, that the likelihood of achieving a clinical response increased with higher alicaforsen exposure in subjects who had elevated CRP [25]. The presence or absence of elevated levels of CRP in serum has predicted the clinical outcomes of other agents including TNF- inhibitors [17,28–30] and the integrin antagonist natalizumab (formerly Antegren, Tysabri®, Biogen Idec, Cambridge, MA and Elan Corporation, Dublin, Ireland) [31]. Whether CRP elevation defines a subset of Crohn’s patients is not known, but these results suggest that customized therapies may be required to manage systemic and local manifestation of Crohn’s disease. 24.2.3 Clinical Evaluation of Alicaforsen in Ulcerative Colitis ICAM-1 interacts with leukocyte function antigen (LFA)-1 (L2) and integrin CD11b/CD18 (Mac-1,M2) on neutrophils [32] and eosinophils [33] to facilitate granulocyte adhesion and migration into colonic mucosa in response to inflammatory stimuli. The safety, tolerability, and efficacy of alicaforsen enema (6–240 mg administered once daily for 28 days) were demonstrated in patients with mild to moderate, descending UC [34]. A dose-related improvement in the mean absolute DAI was apparent in alicaforsen-treated patients at the end of the treatment period (day 29) and also at the 3- and 6-month assessment time points as shown in Figure 24.1. Statistically significant differences in DAI improvement between the 2- and 4-mg/mL alicaforsen groups and the placebo group were observed up to 3 months postinitiation of treatment. Improvement in disease severity relative to baseline measures was also significantly increased in the 2- and 4-mg/mL alicaforsen enema dose groups as shown in Figure 24.2. Complete normalization of endoscopy at 3 months was noted in 9 of 16 patients receiving 2 mg/mL or 4 mg/mL alicaforsen enema compared to 0 of 8 placebo-treated patients.

12

10

Baseline Month 1 Month 3 Month 6

Mean DAI

8

6

0.377 p = 0.568

0.744 0.125 p = 0.034

4 0.107

2 n= n= n= 8 7 3 3 8 8 5 4 8 8 3 3

n= 8 8 7 7

n= 8 8 8 8

2 mg/mL

4 mg/mL

0 Placebo Figure 24.1

0.1 mg/mL

0.5 mg/mL

Mean absolute value for disease activity index (DAI) for each alicaforsen enema dose group is shown at each time point and compared with placebo. P values are for change from baseline versus placebo. (From van Deventer, S.J., et al., Gut 53, 1646, 2004. With permission.)

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 669


Mean DAI (% change from baseline)

140

669

Month 1 Month 3 Month 6

120

0.021 p = 0.004

0.016

100

0.414

0.628

80 p = 0.201

60 40 20 n= 8 5 4

n= 7 3 3

n= 8 3 3

n= 8 7 7

n= 8 8 8

Placebo

0.1 mg/mL

0.5 mg/mL

2 mg/mL

4 mg/mL

0

Mean percent change in DAI score from baseline for each alicaforsen enema dose group was compared with placebo at each time point. P values versus placebo. (From van Deventer, S.J., et al., Gut 53, 1646, 2004. With permission.)

Mean % change in DAI (± S.E.M)

Figure 24.2

Figure 24.3

4.0 g Mesalamine

120 mg Alicaforsen

240 mg Alicaforsen

0 −20 −40 −60 0

3

6

9

12

15 18 Week

21

24

27

30

33

Mean percent change in DAI score from baseline for each alicaforsen enema dose group was compared with placebo at each time point. (From Miner, P.B., Wedel, M.K. Xia, S., and Baker, B.F., Aliment. Pharmacol. Ther. 23, 1403, 2006. With permission.)

Alicaforsen was well tolerated, and no significant safety effects were reported. In a separate study, alicaforsen enema (240 mg nightly for 6 weeks) demonstrated improvement in DAI scores and clinical remissions in subjects with active UC. This course of exposure resulted in minimal ( 0.6%) systemic drug exposure [35]. These results suggested that alicaforsen acts locally to reduce colonic mucosal inflammation in UC patients. The effects of alicaforsen enema were compared with standard of care mesalazine enema in subjects with mild to moderate active left-sided UC [36]. Subjects received a nightly enema of 120 mg ISIS 2302, 240 mg ISIS 2302, or 4 g mesalazine for 6 weeks and were then followed for 6 months. As shown in Figure 24.3, DAI relative to baseline decreased over time in subjects in all treatment arms. Clinical improvement was reached by a similar proportion of subjects in each cohort by the end of treatment. By week 18 a higher percentage of subjects in the 120 and 240 mg alicaforsen cohorts (33% and 42%, respectively) met the target improvement criteria (a three point reduction in DAI from baseline). DAI at week 6 relative to baseline, the primary endpoint, was

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 670

670


% Clinical remission

(a) 20

4.0 g Mesalamine 120 mg Alicaforsen 240 mg Alicaforsen

10

0 0

5

10

15

20

25

30 Week

35

40

(b)

50

55

60

4.0 g Mesalamine 120 mg Alicaforsen 240 mg Alicaforsen

30 % Clinical remission

45

20

10

0 0

5

10

15

20

25

30 Week

35

40

45

50

55

60

Figure 24.4 Rate of clinical remission. (a) Percentage remission over time, where remission is defined as disease activity index (DAI): 2, stool frequency: 1, rectal bleeding: 0, endoscopy: 0, and Physicians’ Assessment of Disease (PAD): 1. (b) Percentage remission over time, where remission is defined as an endoscopic score of 0 (normal or inactive disease). (From Miner, P.B., et al., Aliment. Pharmacol. Ther. 23, 1403, 2006. With permission.)

Proportion in remission

4.0 g Mesalamine

120 mg Alicaforsen

240 mg Alicaforsen

1.00 0.75 0.50 0.25 0.00 0

50

100

150 200 Time to relapse (days)

250

300

350

Figure 24.5 Kaplan-Meier curve estimates of the probability of relapse through week 54. Relapse is defined as an endoscopic score 1. Subjects in remission at week 6 had a Mayo Score of 0 (4 g mesalazine [n 9], 120 mg alicaforsen [n 11], and 240 mg alicaforsen [n 10]). (From Miner, P.B., et al., Aliment. Pharmacol. Ther. 23, 1403, 2006. With permission.)

similar in all treatment groups. Dose-dependent effects of alicaforsen on clinical remission and mucosal healing were also demonstrated as shown in Figures 24.4a and 24.4b, respectively. The long-term outcome of treatment, as determined by a Kaplan-Meier analysis of the rate of clinical relapse, is shown in Figure 24.5. The response to alicaforsen enema was 2–3 times more durable than the response to mesalazine enema based on endoscopic appearance over time. This study suggested that local ICAM-1 reduction leads to modification of the inflammatory disease process in affected colonic mucosal tissue. Durable responses to alicaforsen were also demonstrated in

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 671


671

Table 24.1 Summary of Decreases in Pouchitis Disease Activity Index (PDAI) and Subscores at Weeks 3 and 6 for 12 Patients Treated with Alicaforsen Baseline PDAI Endoscopy subscore Clinical symptom subscore Histology

11.42 1.62 5.25 0.97 3.75 1.06 2.42 0.51

a

Week 3

Week 6

N/A 3.08 1.88 b 2.33 1.07 b N/A

6.83 2.17 b 2.58 1.68 b 2.25 1.36 b 2.00 0.00

Data are presented as the mean standard deviation. Statistically significant decreases compared to baseline at P 0.05. Source: Miner, P. et al., Aliment. Pharmacol. Ther. 19, 281, 2004. With permission. a b

subjects with an acute exacerbation of mild to moderate left-sided UC [37]. Collectively, these studies demonstrate the safety and durable effects of topical alicaforsen on UC symptoms and endoscopic appearance of the bowel. Alicaforsen enema has also shown promising results in a related syndrome, pouchitis. Following small bowel resection in refractory UC patients, anal anastomosis is performed along with construction of an ileal pouch. The incidence of pouchitis in these patients is as high as 50% several years after surgery. Alicaforsen enema demonstrated significant clinical benefit in patients with pouchitis in a 6-week, open-label trial [38]. Daily treatment with 240 mg alicaforsen enema improved the pouchitis disease activity index (PDAI) at 6 weeks after treatment initiation as shown in Table 24.1. Significant decreases in endoscopy and clinical symptom subscores were noted after 3 weeks of alicaforsen treatment. Alicaforsen, therefore, appears to provide clinical benefit in UC and pouchitis when administered as a topical therapy. 24.2.4 Preclinical Application of Antisense in Models of Inflammatory Bowel Disease Numerous recent studies have documented the efficacy of systemically or locally administered ASOs in rodent models of IBD and gastric inflammation. Antisense strategies aimed at inhibiting cellular activation [39–42], leukocyte recruitment [43–46], and apoptosis [47] have all demonstrated protective effects in these models. Of particular note, systemic administration of TNF- antisense was shown to improve disease activity scores in both dextran sodium sulfate (DSS)induced and IL-10-deficient mouse colitis models [40]. These results support the clinical success of TNF--directed protein biological therapies in IBD. Systemic or local administration of a firstgeneration ICAM-1 ASO significantly reduced colonic mucosal wall thickness and inflammation, as well as the percentage of colon weight per final body weight in the human leukocyte antigen (HLA)-B27/2 microglobulin transgenic rat IBD model [44]. These effects coincided with inhibition of ICAM-1 protein expression in colonic tissue and in peripheral blood lymphocytes and with reduction of TNF- immunostaining in the colon. Finally, the efficacy of antisense directed at the p65 subunit of nuclear factor (NF)-B has been demonstrated in mouse DSS colitis following a single intrarectal dose of ASO [39] and in a chronic model of trinitrobenzene sulfonic acid (TNBS)-induced colitis [48] using PS antisense inhibitors. A prevalent complication of abdominal surgery is the development of postoperative ileus, a generalized hypomotility of the gastrointestinal tract that is self-limiting but is responsible for increased morbidity and prolonged hospitalization. Recently, it became clear that manipulation of the intestine results in an influx of inflammatory cells, an occurrence thought to play a key role in the disruption of gastrointestinal tract motility. In an experimental model of postoperative ileus, subcutaneous administration of an ICAM-1 ASO improved gastric emptying, reduced manipulation-induced inflammation, and reduced ICAM-1 protein expression [49]. ICAM-1 appears to be an important mediator of inflammation in a model of postoperative ileus, and parenteral administration of ICAM-1 antisense may offer a potential prophylactic treatment for this condition.

CRC_8796_ch024.qxd

672

6/20/2007

10:30 PM

Page 672


24.3 RHEUMATOID ARTHRITIS 24.3.1 Pathology and Current Therapy of Rheumatoid Arthritis RA is a chronic inflammatory polyarthritis affecting approximately 1% of adults worldwide. The disorder is characterized by inflammatory synovitis with pain, swelling, and stiffness, and progressive bone erosion that leads to significant disability and poor quality of life. A minority of patients have systemic features of the disease including rheumatoid nodules and lung disease. The etiology of RA is unknown, but experimental evidence suggests that both innate and acquired immune responses are involved in disease initiation [50]. Cytokines produced by macrophages and fibroblasts dominate in affected synovial tissues, and the cytokine profile within the macrophage and fibroblast reflects a hierarchy, with IL-1 and TNF- assuming particular importance [51]. The TNF- inhibitors infliximab, etanercept, and adalimumab have been approved for treatment of RA based on their ability to induce disease remissions. TNF- inhibition also improves clinical and laboratory measures, reduces erosive damage, and decreases disability in patients with RA [52]. Serious side effects, including increased risk for serious infection and malignancies, have been documented for these drugs in clinical trials [53] and in clinical practice [54]. Disease-modifying antiinflammatory drugs (DMARD), including leflunomide and methotrexate, have also been documented to increase the risk for infection [55]. Therapies that safely and effectively modify disease progression alone or in combination with other DMARD are still needed for the management of RA. Antisense in Rheumatoid Arthritis 24.3.2 Clinical Evaluation of ICAM-1 and TNF- Therapeutic strategies aimed at suppressing lymphocyte activation and trafficking through joint tissues have recently been evaluated in clinical trials. ICAM-1 protein expression is elevated in the rheumatoid nodules and synovium of RA patients [56]. High concentrations of soluble ICAM-1 have been reported in serum and synovial fluid from patients with active juvenile idiopathic polyarthritis, and correlations between ICAM-1 levels and joint counts suggested a synovial origin for the adhesion molecule [57]. The safety of alicaforsen, the first-generation ICAM-1 antisense inhibitor, was evaluated in a 6-month, placebo-controlled study in patients with active RA [58]. Alicaforsen (0.5–2 mg/kg, administered i.v. 13 times over a 4-week period) was well tolerated but failed to demonstrate clinical efficacy based on the day 26 Paulus index. T- and B-cell immunophenotyping, recall antigen skin testing, and serum immunoglobulin levels revealed no significant immunosuppressive effects of alicaforsen. The lack of pharmacological activity may have been related to poor drug exposure, as plasma areas under the curve were lower than those associated with efficacy in a subsequent study of subjects with Crohn’s disease. A murine mAb directed against human ICAM-1 showed initial efficacy for clinical improvement of early or indolent RA [59,60], but repeated treatment with this mAb produced diminished clinical efficacy that may have been related to the development of antibodies to the murine protein [61]. These clinical results are inadequate to draw formal conclusions regarding the efficacy of ICAM-1 antisense or antibody inhibitors in patients with RA. Antisense inhibition of TNF- expression has also been evaluated as a therapeutic approach for RA. ISIS 104838 is a second-generation PS-ODN that has demonstrated the ability to markedly and specifically reduce the levels of TNF- mRNA and secreted TNF- protein in activated human keratinocytes and monocytes [62]. The safety and pharmacokinetics of ISIS 104838 were demonstrated in healthy subjects in two phase 1 studies [62]. Multiple i.v. infusions of ISIS 104838 (0.1–6 mg/kg on days 1, 8, 10, and 12) and s.c. injections of ISIS 104838 (0.1–6 mg/kg on days 1, 3, and 5) were well tolerated, with transient and reversible partial prothrombin time prolongation observed at higher dose levels. Skin injection sites showed some mild tenderness, erythema, or induration that resolved by 4 days postdosing. Infused ISIS 104838 produced a significant, dose-related reduction in the level of TNF- protein produced ex vivo by stimulated peripheral

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 673


673

blood mononuclear cells compared to levels produced at baseline with no effect on IL-1 protein production. Dose-dependent plasma pharmacokinetics and synovium distribution of ISIS 104838 (100 or 300 mg for 6 doses over 22 days) were demonstrated in subjects with active RA, and high synovial drug concentrations were achieved using either i.v. or s.c. dosing over a 1-month period [63]. ISIS 104838 was well tolerated in this study with generally mild s.c. injection-site reactions and transient prolongation of partial prothrombin times at higher dose levels. Synovial biopsies of knee or wrist at the end of the treatment showed a 50% decrease in TNF- mRNA in three of five patients treated with 300 mg ISIS 104838, whereas no biopsies from placebo subjects showed a 50% reduction. The safety and clinical efficacy of ISIS 104838 were further evaluated in a placebo controlled phase 2 study in TNF inhibitor–naïve subjects with active RA [64]. Subjects received at least eight subcutaneous injections of ISIS 104838 (200 mg every other week, 200 mg every week, or 400 mg every week) or placebo (every week) over a 40-day period. ISIS 104838 was well tolerated in this study, with reversible reduction in circulating platelet counts observed by the end of treatment but no adverse clinical sequelae associated with reduced platelet counts. These results are consistent with reversible platelet reductions observed in monkeys treated with ISIS 104838 [65]. Mild injection-site reactions and mild diarrhea were noted in the 400-mg dose cohort, and no serious adverse events were considered by the investigator to be potentially related to study drug. Response to ISIS 104838 was measured at the end of the 3-month treatment period as the percentage of subjects who achieved a 20% decrease in disease activity as defined by the American College of Rheumatology (ACR20). A trend toward improvement in the ACR20 compared with placebo was observed at each of the highest two ISIS 104838 dose levels as shown in Table 24.2. The ACR20 for the 200-mg biweekly cohort (18.6%) was not significantly different from the placebo group (22.5%). ACR20 results for the 200- and 400-mg weekly dose groups at day 85 were similar (41.2 % and 40.5%, respectively). When the 200- and 400-mg weekly dose groups were combined, a significant difference in ACR20 was observed compared with the placebo-treated group (p 0.05 using the chi-square test), and 50% of the responders in the top two dose groups (combined) maintained their response at day 169. A trend toward improvement over baseline in the number of swollen and tender joints was observed in subjects treated with 400 mg/week ISIS 104838 as shown in Table 24.3. These effects were evident up to 2 months after the end of treatment. Response rates and improvements in primary and secondary endpoint measures increased with drug dose as well as drug exposure based on the plasma drug concentration AUC. These results demonstrated durable clinical activity of ISIS 104838 as a single agent in patients with RA and an exposure-response relationship. No significant difference in the ACR50 rate at day 85 was observed, however, for ISIS 104838 at any dose compared to placebo as shown in Table 24.2. While ISIS 104838 was well tolerated and pharmacologically active in RA patients, the clinical response rates (ACR 20 and ACR 50) were lower than the response rates Table 24.2 ACR 20 and ACR 50 Response Rates at the End of the 3-Month ISIS 104838 Treatment Period

a

ACR 20% at 3 Months: Evaluable a Population (%; n 157)

ACR 50% at 3 Months: Evaluable a Population (%; n 157)

22.5 18.6

7.5 4.7

Placebo ISIS 1048383 200 mg every other week 200 mg every week

40.0 (P 0.09)

5

400 mg every week

41.2 (P 0.08)

11.8

ISIS 1048383 200 and 400 mg combined

40.5b (P 0.05)

N/A

Evaluable indicates all patients who received a minimum of 8 injections over 40 days, without relevant protocol deviations. b Statistically significant increase in response rate compared to placebo.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

674

Page 674


Table 24.3 ISIS 1048383 Phase 2 Secondary Endpoint Results at Week 12 Dose

Placebo

200 mg Every Other Week

200 mg Every Week

400 mg Every Week

Count Decrease % Change

Week 12 Swollen Joint Count Decrease, % Change 4.6 3.1 4.8 18.5 0.3 8

3.9 22

Count Decrease % Change

Week 12 Tender Joint Count Decrease, % Change 5.4 3.3 6.1 0.2 14 22

13.5 33

reported for etanercept [66] or adalimumab [67] after 3 months of treatment. These results may be attributed to differences in the systemic or synovial distribution of the drugs. Pharmacodynamic analyses suggested that TNF- protein expression was only partially reduced under the treatment conditions evaluated in the ISIS 104838 trials. Incomplete reduction of TNF- expression in some tissues or cell populations may have allowed systemic or synovial inflammatory responses to persist during treatment. It is also possible that etanercept and adalimumab have additional pharmacological activities in vivo that are not achieved using an antisense approach to inhibition of cellular responses to TNF in RA. The inferior clinical efficacy of ISIS 104838 suggests that second-generation PS-ODNs lack the biopharmaceutical profile required for effective parenteral treatment of active RA. Progress toward achievement of oral bioavailability for second-generation oligonucleotides has been made using formulations of ISIS 104838 that include the permeation enhancer, sodium caprate, in an enteric-coated solid dosage form. The tolerability and relative plasma bioavailability of single and multiple doses of each of seven tablet formulations of ISIS 104838 were evaluated in healthy subjects [68]. Each of the administered formulations was well tolerated. The average plasma bioavailability was 1.4% relative to i.v. administration with similar tissue distribution profiles. Mean systemic tissue bioavailability ranged from 2% to 4.3%, relative to i.v. tissues, and was dependent on tissue type, with highest drug concentrations observed in kidney followed by liver, lymph nodes, and spleen. These results demonstrate that comparable tissue concentrations of a second-generation oligonucleotide can be achieved using oral or i.v. administration. Oral formulations could provide greater flexibility in oligonucleotide administration, e.g., dose and dose interval, and facilitate the customization of combination antisense inhibitor therapies for the treatment of chronic diseases. 24.3.3 Preclinical Applications of Antisense in Models of RA In rats with arthritis induced by injection of Mycobacterium butyricum, daily intraperitoneal administration of an 18-mer first-generation phosphorothioate cyclooxygenase (COX)-2 ASO (⬃25–30 mg/kg) in a prophylactic treatment regimen reduced synovial tissue COX-2 but not COX-1 mRNA expression and protein immunostaining, hind paw swelling, synovial hyperplasia, mononuclear cell infiltration, and joint destruction [69]. Neither sense nor scrambled-sequence control oligonucleotides demonstrated these effects. The COX-2 ASO failed to demonstrate efficacy when administered to mice with established arthritis, however. The differences in efficacy may be related to unique patterns of oligonucleotide distribution in normal and inflamed tissues or the expression of COX-2 in additional cell populations in synovial tissue with established inflammation. Canonical rodent cytosine-guanosine-dinucleotide (CpG) motifs (Purine-Purine-CpG-Pyrimidine-Pyrimidine) were present in antisense, sense, and scrambled control oligonucleotides, indicating that the investigators controlled for the possible non-hybridization-based effects of this motif in the ASO. Deng et al. utilized intraarticular administration of PS-ODNs targeted to the p65 subunit of the NF-B transcription factor in mice with bacterial CpG deoxyribonucleic acid (DNA)-induced arthritis [70]. p65 ASO treatment reduced the incidence of joint inflammation by 50%, suggesting that local administration of ASO may effectively block the activation of macrophages in the joint or

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 675


675

inhibit TNF--mediated signaling in other synovial inflammatory cells in a p65 NF-B-dependent manner.

24.4 MULTIPLE SCLEROSIS (MS) 24.4.1 Disease Pathology and Current Therapy of Multiple Sclerosis MS is a polygenic disorder of unknown etiology characterized by perivascular T-cell infiltration and disseminated demyelinating white matter disease of the central nervous system (CNS) that usually affects young adults. Considerable debate exists within the clinical community regarding an autoimmune pathogenesis in MS [71]. Recent histopathology studies suggest that there may be considerable heterogeneity in the pathogenesis of MS as evidenced by the identification of four distinct subtypes of MS, all characterized by perivascular and parenchymal T-cell and macrophage inflammation [72]. While no infectious process has been linked to MS, the involvement of viral infection has been suggested by the ability of a variety of viruses to produce acute and chronic demyelinating conditions in experimental animals [73]. The unresolved inflammatory response in MS contributes to neuronal damage and the formation of plaques or lesions that interfere with axon function, resulting in neurocognitive or neuromuscular impairment. Four clinical subtypes of MS have been described based on the clinical course of the disease, with the majority of patients developing a relapsing-remitting lifelong course that is rarely fatal and a minority developing progressive disability from the onset with or without superimposed relapses (so-called primary progressive multiple sclerosis), with reduced life expectancy [74]. The -interferon (IFN-) preparations Avonex® (Biogen Idec), Rebif ® (Merck KGaA, Darmstadt, Germany and Pfizer, New York, NY) and Betaferon/Betaseron® (Chiron, Emeryville, CA and Berlex Laboratories, Montville, NJ) and the immunomodulatory glatiramer acetate Copaxone® (Teva Neuroscience, Petach Tikva, Israel and Aventis Pharmaceuticals, Strasbourg, France) have been approved for the long-term treatment of relapsing-remitting MS. Each of these drugs is generally well tolerated with reported adverse effects including flu-like symptoms and injection-site reactions [75]. These therapies produce moderate effects on disease relapse rate, disease severity, and progression of disability in MS patients [76]. Immunomodulators such as cyclosporin, methotrexate, and azathioprine provide some therapeutic benefit in progressive MS, but the frequent occurrence of adverse reactions to treatment, especially nephrotoxicity, together with the small magnitude of the potential benefit, makes the risk/benefit of this therapeutic approach unacceptable. The immunosuppressant mitoxantron (Ralenova®, Wyeth, Madison, NJ) was recently approved by the European Agency for the Evaluation of Medicinal Products (EMEA) as a second-line therapy for patients with secondary-progressive and progressive-relapsing MS who have failed to respond to immunomodulatory agents [77]. 24.4.2 Clinical Evaluation of Very Late Activation Antigen (VLA)-4 Antisense in Multiple Sclerosis Antagonism of T-cell trafficking has been investigated as a therapeutic approach to MS using antibody and antisense technologies. Clinical evidence of the central role of VLA-4 (41-integrin) in lymphocyte transmigration into the CNS has recently been confirmed based on the efficacy of the humanized mAb to 4 integrin, natalizumab (Antegren, Tysabri, Elan Pharmaceuticals and Biogen/Idec) in patients with relapsing MS. Long-term administration of natalizumab provided significant benefits in clinical trials, including a marked reduction in the risk of new lesions and a significant reduction in the risk of exacerbations within 2 months of the initiation of therapy [78]. In early 2005, Biogen Idec and Elan Corporation voluntarily suspended marketing of Tysabri in the United States based on two reported cases of progressive multifocal leukoencephalopathy (PML) [79,80],

CRC_8796_ch024.qxd

676

6/20/2007

10:30 PM

Page 676


a rare and frequently fatal, demyelinating disease of the CNS, in patients who received Tysabri. In June 2006, after an extensive safety review, the FDA approved the reintroduction of Tysabri for the treatment of relapsing forms of MS. Prophylactic and therapeutic treatment with s.c. injections of a second-generation ASO directed to the mouse VLA-4 4 integrin molecule was demonstrated to reduce the incidence and severity of paralytic symptoms in the experimental autoimmune encephalomyelitis (EAE) model of MS in mice [81]. The effect on key disease severity indicators appeared comparable to results reported for a mouse VLA-4 antibody [82] and mouse interferon [83] in similar mouse models of MS. These results suggested that antisense targeting of VLA-4 would be an effective therapeutic approach in MS. A second-generation antisense inhibitor of VLA-4 (ATL1102, Antisense Therapeutics Limited or ATL, Melbourne, Australia) is currently being investigated as a subcutaneous therapy for relapsing-remitting MS. The pharmacokinetics and safety of ATL1102 was investigated in a doubleblind, placebo-controlled study in healthy subjects [84]. Both i.v. and s.c. formulations of ATL1102 were well tolerated. The most frequently reported side effects included mild flu-like symptoms and occasional injection-site reactions, which were generally mild but increased in incidence and severity with escalating dose levels, particularly at 12 and 18 mg/kg/week. A dose of 6 mg/kg/week of ATL1102 appeared well-tolerated and was selected for further clinical evaluation. A phase 2a clinical trial designed to obtain preliminary evidence of the drug’s effectiveness using magnetic resonance imaging (MRI) indices was initiated in December 2004. Although no safety problems had been reported, ATL voluntarily halted its trial in March 2005 in light of safety issues associated with the drug, Tysabri. In August 2005, an independent, international medical advisory board, convened by ATL, unanimously recommended that the company continue the development of ATL1102 in MS, and that the phase 2a trial be restarted with the addition of certain safety parameters to address the potential safety issues reported in the Tysabri trials. The ongoing study is a randomized, double-blinded, placebo-controlled trial in 80 patients with relapsing-remitting MS. Patients receive ATL1102 (200 mg administered twice weekly, s.c., for 8 weeks) or placebo [85]. MRI will be conducted at monthly intervals over the 8-week dosing period and at monthly intervals during the 8-week period following completion of dosing. 24.4.3 Preclinical Application of Antisense in Models of Multiple Sclerosis A series of recent reports indicate that systemic administration of ASO may show promise for treatment of MS. All these studies were conducted in EAE rodent models and aimed to inhibit specific mechanisms of immune cell activation. The p75 low-affinity neurotrophin receptor (p75NTR) is associated with the pathology of MS, CNS inflammation mediated by immune cells, oligodendrocyte demyelination, and death [86]. Intraperitoneal injection of phosphorothioate p75NTR ASO daily for 18 days following immunization of SJL/J (H-2s) mice (with myelin proteolipid protein peptide 139–151) significantly reduced the mean maximal disease score, disease incidence, CNS inflammation, and demyelination, and produced a 30% decrease in p75NTR expression at the blood-brain barrier as determined by immunohistochemistry, compared to control animals injected with PBS or non-sense oligonucleotide [87]. p75NTR expression in neural cells was not different between the three treatment groups. p75NTR protein has been demonstrated on the surface of perivascular macrophages, endothelial cells, and infiltrating monocytes [88,89] and EAE was exacerbated rather than improved in p75NTR-deficient mice [90]. These observations suggest that the role of p75NTR in EAE models may depend on the cell population in which it is expressed, and may mediate a proinflammatory response in immune cells. The role of the Th1 cell transcription factor T-bet was evaluated in a mouse model of EAE by i.v. injection of a T-bet phosphorothioate ASO at the time of immunization [91]. A single injection of T-bet ASO (50 g; ⬃2 mg/kg) prevented the onset of actively induced disease, suppressed disease score in a dose-related manner for up to 45 days and reduced T-bet protein in splenocytes at day 13 by 60%, compared to animals that received non-sense control oligonucleotide injection.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 677


677

In this study, both the T-bet antisense and non-sense oligonucleotides contained noncanonical CpG motifs. Injection of T-bet small interfering ribonucleic acid (siRNA) produced similar effects in this model and both T-bet ASO and siRNA inhibited IFN- production in splenocytes and lymph node cells. An 4 integrin ASO approach demonstrated efficacy in mouse EAE using either a prophylactic or therapeutic dosing regimen [81]. In this study, a second-generation 2-MOE ASO (1 mg/kg) was administered s.c. each day starting either one day before EAE induction or when more than 50% of the mice in the vehicle group exhibited Grade 1 or higher EAE and continued for 15 days. Significant effects on disease severity and relapse rate were observed, coupled with a reduction in immunohistochemical staining for VLA-4 cells, CD4 T cells, and BM8 macrophages in spinal cord sections as shown in Figure 24.6, suggesting that 4 down-regulation inhibits trafficking of immune cells into the CNS during EAE. It has been shown that cholinergic stimulation can mediate suppression of proinflammatory cytokine production in a mouse model of lethal endotoxemia [92]. Nizri and colleagues targeted acetylcholinesterase (AChE) mRNA in mice induced to develop EAE with a 20-mer ASO containing three 2-O-methyl modifications on the 3 end. Daily treatment with 0.1 mg/kg administered by intraperitoneal injection starting at the day of induction of disease produced a reduction in AChE activity in serum and suppressed disease severity by 90% [93]. Leukocyte infiltration in the CNS was Saline

VLA-4 ASO

(a)

(b)

(c)

(d)

(e)

(f)

VLA4+ cells

CD4+ T cells

BM8+ Mφs

Figure 24.6 (See color insert following page 270.) VLA-4, T cell, and macrophage immunostaining on spinal cords from EAE mice. Saline-treated mice (a, c, e) had a Grade 2 paralysis but were symptom free while receiving treatment with a VLA-4 antisense inhibitor (b, d, f). Antibodies were used to detect VLA-4 (a, b), CD4 T cells (c, d), or BM8 macrophages (e, f). Magnification: 250X. (From Myers, K.J. et al., J. Neuroimmunol., 160, 12, 2005. With permission.)

CRC_8796_ch024.qxd

678

6/20/2007

10:30 PM

Page 678


reduced in AChE ASO–treated animals, although this study did not compare the ASO results to those of a control oligonucleotide sequence.

24.5 ASTHMA 24.5.1 Disease Pathology and Current Therapy of Asthma Asthma is a polygenetic syndrome characterized by symptoms of wheeze, dyspnoea, and cough. Objective evidence of variable airflow obstruction provides confirmation of the clinical diagnosis. In developed countries the prevalence of asthma has steadily increased over the past 30 years and is strongly but not exclusively linked to allergic sensitization to environmental antigens [94]. Interactions between environmental and genetic factors likely influence disease progression and severity as well as individual risk for development of asthma [95]. Linkage analyses have also identified polymorphic variation in treatment response [96]. Despite the marked heterogeneity in asthma phenotype that has been documented in clinical practice [97], extensive experimental and clinical evidence indicates that persistent asthma is an inflammatory disorder of the airways involving resident pulmonary and inflammatory cells as well as recruited lymphocytes, mast cells, and granulocytes. Chronic inflammation in susceptible individuals causes recurrent episodes of symptoms, variable airflow obstruction, and increased airway hyperresponsiveness (AHR) to a variety of stimuli [98]. In severe disease, the pathology may include airway remodeling and irreversible airflow obstruction. The inflammatory processes in asthma and animal models of airway inflammation are associated with Th 2 cells and cytokines, especially IL-4, IL-5, and IL-13 [99–101]. Other inflammatory mediators, including leukotrienes, prostaglandins, and platelet-aggregating factors, are also produced in response to inhaled antigens and are capable of inducing bronchospasm, mucus overproduction, and cell recruitment to the lung. Leukotriene modifiers and receptor antagonists have been shown to provide clinical benefit to patients with persistent asthma [102–104]. The goals of asthma management currently emphasize environmental control measures and treatment to prevent chronic persistent symptoms and preserve lung function [105]. Corticosteroids are the most effective treatment available for atopic diseases, and inhaled corticosteroids (ICSs) are the firstline treatment for chronic asthma in patients of all ages and severity of disease [106]. These drugs inhibit transcription factors such as activator protein-1 (AP-1), NF-B, and nuclear factor of activated T cells (NF-AT), and thereby suppress the expression of multiple inflammatory genes, including cytokines, enzymes, adhesion molecules, and inflammatory mediator receptors [107,108]. While ICSs have a proven track record of safety and efficacy for symptom control, these drugs do not cure asthma and do not adequately control symptoms in all individuals. Step-up controller therapies include higher dose ICS, long-acting 2-agonists (LABA), leukotriene receptor antagonists, theophylline, cromolyn, and oral costicosteroids. Unmet medical needs in asthma include medications that can modify the progression of asthma, especially in children, or provide more complete and consistent asthma control in combination with low doses of ICS. Novel corticosteroids with very limited systemic exposure and therapies that offer more convenient dosing schedules are also being evaluated in clinical studies. 24.5.2 Clinical Evaluation of Antisense Oligonucleotides in Asthma Respiratory diseases, including asthma, are well suited for inhaled therapies, and present an attractive opportunity for topical antisense strategies. Phosphorothioate oligonucleotides distribute broadly in the lungs of mice [109,110] and rabbits [110] with very limited systemic exposure. Similar results have been observed for second-generation oligonucleotides in mice and monkeys [111]. Pulmonary concentrations of oligonucleotides orders of magnitude higher than the concentrations required for pharmacological activity are readily achieved and well tolerated in mice using aerosolization and nose-only inhalation [112]. These findings suggest that inhaled antisense

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 679


679

inhibitors could provide a novel therapeutic approach for control of symptoms and disease modification in patients with asthma. EpiGenesis Pharmaceuticals (Cranbury, NJ) was the first to demonstrate clinical efficacy of an aerosolized ASO. EPI-2010, a first-generation ASO targeting the adenosine A1 receptor mRNA, was well tolerated in normal subjects and patients with mild asthma. A single inhaled dose of EPI-2010 (50 mcg/kg) produced a significant decrease in the requirement for a rescue bronchodilator concomitant with reduction in asthma symptom scores in patients with mild asthma [113]. However, EPI-2010 failed to demonstrate efficacy in patients with moderate asthma that was not well controlled by ICS [114], and development of this compound was discontinued. Topigen Pharmaceuticals (Montreal, Quebec, Canada) recently demonstrated the safety, tolerability, and pharmacological activity of TPI-ASM8, a first-in-class antisense drug that combines two oligonucleotides into a single inhaled product, in patients with mild allergic asthma. TPI-ASM8 is a combination of two ASOs targeting the cysteine-cysteine chemokine receptor (CCR)-3 and the common chain of the IL-3, IL-5, and granulocyte and macrophage colony stimulating factor (GM-CSF) receptors [115]. CCR-3 is an important receptor involved in the differentiation, adhesion, and chemotaxis of eosinophils, mast cells, and macrophages [116], while IL-3, IL-5, and GM-CSF are involved in the survival and activation of eosinophils, mast cells, and macrophages [117]. Preliminary data from a phase 2 study in patients with mild asthma was recently reported showing substantially reduced sputum eosinophil cell number, suppressed target gene expression, and significant physiological effects (on the early and late phase response) in these patients following three daily doses of TPI-ASM8 prior to allergen challenge [118]. The compound combines a phosphorothioate backbone with 2, 6-diaminopurine modifications of adenosines. A second-generation oligonucleotide, ISIS 369645, has advanced into clinical development. ISIS 369645 is a 5-10-5 2-MOE gapmer oligonucleotide that reduces expression of IL-4 receptor- (IL-4R) mRNA and protein in human cells [119]. IL-4R is shared by the IL-4 and IL-13 receptors, and its presence is required for cellular responses to both cytokines [120]. Inhaled antisense inhibition of this receptor has been shown to reduce antigen-induced airway eosinophilia and neutrophilia, mucus production, and AHR to methacholine in mice concomitant with reduction of IL-4R protein on pulmonary antigen presenting cells and epithelial cells [121]. The mouse IL-4R ASO was effective when administered to mice with established asthma and also demonstrated additive effects with inhaled budesonide on airway inflammation and AHR in mice [122]. ISIS 369645 is currently being evaluated in preclinical toxicology studies and is expected to enter phase 1 studies in 2007. 24.5.3 Preclinical Application of Antisense in Models of Asthma In recent years, substantial evidence has been generated supporting the use of ASO for allergic diseases, in particular, by topical delivery to the respiratory tract to treat disorders such as asthma and allergic rhinitis [114,123]. The sufficiency of local targeting of a gene product(s) in the pulmonary environment, in the absence of systemic suppression, remains to be demonstrated in asthma patients, but preclinical models have provided encouraging results to date. Both firstand second-generation ASO administration, either by systemic or local routes, have produced anti-inflammatory effects in rodent asthma models with concomitant pharmacodynamic activity in relevant immune cells, suggesting that current chemical designs appear to be satisfactory for clinical development as aerosolized medications. Systemic antisense administration may be required for targets with significant biological roles outside of the pulmonary tissue, such as the role of the IL-5R in eosinophil maturation and emigration from the bone marrow. Lach-Trifilieff and colleagues administered a 2-MOE-modified second-generation IL-5R ASO by i.v. injection to mice and observed suppression of bone-marrow and blood eosinophilia following treatment with recombinant murine IL-5. IL-5R ASO treatment also inhibited blood and tissue eosinophilia in a ragweed-induced allergic peritonitis model [124].

CRC_8796_ch024.qxd

680

6/20/2007

10:30 PM

Page 680


Other investigators evaluated the effects of pretreatment of mice with i.v. administration of a first-generation phosphorothioate ASO targeting the p65 subunit of NF-B in the ovalbumin (OVA) sensitization and challenge model of asthma [125]. Two successive days of treatment with the p65 ASO immediately before OVA challenge significantly reduced lung and airway inflammation, AHR, bronchoaveolar lavage (BAL) Th2 cytokine levels, and antigen-specific IgE and IgG in serum. Parameters of target-dependent toxicity that might be expected with systemic exposure to an NF-B pathway inhibitor were not reported in the study. The broad utility of locally delivered ASO for treatment of allergic respiratory disease is supported by the effective targeting of an array of diverse molecular targets expressed by a variety of different cell types. Intranasal administration of phosphorothioate ASOs targeting stem cell factor (SCF), the c-kit ligand [126] or the Th2 cell transcription factor GATA-3 [127] in mice reduced pulmonary inflammation in both studies following OVA sensitization and challenge. In the GATA-3 ASO experiments, the investigators also monitored AHR and showed significant ASO-mediated suppression following cholinergic stimulation. The treatment effects of the ASOs were correlated with inhibition of protein expression in lung interstitial cells (SCF and GATA-3) and epithelium (SCF). In other supporting studies, rats were treated with a first-generation PS-ODN designed to suppress the expression of the common chain of the IL-3, IL-5, and GM-CSF receptors by intratracheal administration prior to OVA challenge [128]. Levels of chain mRNA levels in lung were found to be reduced by 60% compared to mismatch control oligonucleotide treatment, and chain immunostaining was also decreased in the subepithelial regions of the lung. One dose (⬃1 mg/kg, intratracheal) administered before allergen challenge inhibited airway and lung antigen-induced eosinophilia as well as leukotriene D4–induced AHR. Further, similar anti-inflammatory effects were observed in OVA sensitized and challenged rats treated with an aerosolized stem loop structure Syk ASO consisting of 60 nucleotides formulated in liposomes [129,130]. Excellent potency of inhaled first- and second-generation ASO has been demonstrated in animal models of asthma [131,132]. Reduction of allergen-induced phenotypes in OVA sensitized and challenged mice were observed at lung concentrations of a 2-MOE p38 mitogen–activated protein kinase (MAPK) ASO from ⬃10 to 300 ng/g of lung tissue (⬃3–300 g/kg estimated inhaled dose; EID) [132]. The specificity of the p38 ASO used in this study for the isoform and not the other p38 family members was demonstrated in vitro and in vivo as shown in Figure 24.7 [133], suggesting that an inhaled ASO strategy can selectively inhibit expression of individual molecular targets despite a high degree of protein similarity. An inhaled 2-MOE IL-4R ASO produced a dose-dependent reduction in the percentage of BAL eosinophils in OVA challenged mice, with activity observed at 10 ng ASO/g lung tissue [111,121,134]. Flow cytometric analyses of lung cells following inhaled ASO treatment showed reduced cell-surface IL-4R expression in dendritic cells and the mixed alveolar macrophage and eosinophil population (Figure 24.8) compared to vehicle-treated, challenged mice [122]. Since asthma is a chronic disease with ongoing pulmonary inflammation, novel therapies must effectively suppress existing disease or prevent episodic exacerbations. Previous studies have indicated mixed results for Th2 pathway inhibitors in chronic mouse asthma models, with activity demonstrated following intraperitoneal injection of an IL-13 antibody [135] and only modest effect of an intranasally administered IL-4 mutein that blocks IL-4 and IL-13 bioactivity [136]. More recently, therapeutic efficacy in a chronic mouse asthma model was demonstrated following once-weekly inhalation of a 2-MOE IL-4R ASO. IL-4R ASO treatment reduced the percentage of eosinophils and neutrophils in the airways, suppressed perturbation of the animals’ breathing pattern (measured as enhanced pause or Penh) in response to methacholine, and decreased mucus production and lung inflammation. Systemic treatment with dexamethasone had similar effects but did not reduce the percentage of airway neutrophils (Figure 24.9) [122]. Inhaled IL-4R antisense demonstrated significant effects on Penh and airway neutrophilia at an estimated delivered dose of

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 681

INFLAMMATORY DISEASES (a)

681

140

p38α

p38β

250

120 200

100

150

80 60

100 50

20 p38α ASO

160

140

140

120

120

100

100

80

80

60

60

40

40

20

20 No oligo

p38α ASO

0 µM

0.3 µM

3.0 µM

0.1 µM

1.0 µM

10 µM

p38γ

No oligo

p38β

p38α 140

140

120

120

60 40 20 50

25

10

50

25

10

Saline

0

Control oligo

mg/kg oligo

100 80 60 40 20 0

p38β Antisense treatment

50

80

25

100

p38α Antisense treatment

Control oligo

p38α ASO

20 µM

p38β mRNA (% Saline)

p38α mRNA (% Saline)

(b)

0

Control oligo

Control oligo

p38α ASO

180

p38δ

160

0

No oligo

10

180

0

Control oligo

50

No oligo

25

0

Saline 10

% Mock transfected cells (mRNA)

40

mg/kg oligo

Control oligo

Figure 24.7 Isoform specificity of p38 ASO in cells and in liver tissue. (a) THP-1 cells were electroporated with p38 ASO at the concentrations shown. Cellular mRNA was extracted 24 h later and analyzed for p38 isoform expression by quantitative RT-PCR. Data are normalized to cells that were electroporated in the absence of p38 ASO. (b) Subcutaneous administration of p38 ASO decreased the level of p38 mRNA in livers of Balb-c mice but had no effect on p38 mRNA expression. The mismatched (MM) control oligonucleotide had no effect on either p38 or p38 mRNA expression. (From Karras, J. et al., Strategic Research Institute’s Protein Phosphorylation Drug Discovery World Summit, La Jolla, March 1, 2005. With permission.)

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 682

682


CD11b+GR-1lo

250 200

Mean fluorescence intensity

150 100 50 0 400

MHC-II+CD11C+

300 200 100 0

NA

Veh

10

100

500

10

100

500

Control oligo IL 4R α ASO Oligonucleotide concentration (mcg/kg) Figure 24.8 Reduction of cell-surface IL-4R protein on pulmonary antigen presenting cells from allergic mice following inhalation of IL-4R ASO. OVA-sensitized and challenged mice were rested for 1 month before treatment with aerosolized oligonucleotides and subsequent rechallenge with nebulized OVA. Lungs were harvested 6 h following the second nebulized OVA rechallenge on day 67 from mice treated with IL-4R ASO or its seven-base mismatched (MM) control oligonucleotide (10, 100 and 500 g/kg administered on days 59, 61, 61, 66, and 68). Lung cells were recovered after collagenase treatment of the tissue and analyzed by multiparametric flow cytometry. IL-4R protein expression was measured on a mixed population of eosinophils and macrophages (CD11b-positive, GR-1 negative or low; upper panel) and CD11c-positive and MHC class II-positive dendritic cells (lower panel). Data are expressed as (a) the group mean percentage of cells from vehicle-treated, rechallenged mice or (b) the group mean fluorescence intensity (MFI) standard error of the mean (SE), n 4 per group. “ ∗ ” indicates p 0.05 using Student’s T-test. NA, naïve; MM, mismatched base control oligonucleotide; VH, saline vehicle. (From Karras, J. et al., Am. J. Respir. Cell Mol. Biol.; published ahead of print on September 21, 2006 as doi:10.1165/rcmb.2005-0456OC. With permission.)

5 g/kg (the lowest dose evaluated) in this model. In separate studies, an inhaled 2-MOE TNF- ASO administered in this model reduced subsequent allergen-induced eosinophil and neutrophil recruitment, mucus production, and Penh [137]. Interestingly, the inhaled TNF- ASO inhibitor did not show pronounced activity in an acute OVA challenge model when administered in a prophylactic regimen. The ability of an inhaled antisense inhibitor to reduce pulmonary inflammation and AHR in chronically challenged mice with established pulmonary inflammation suggests that topical ASO intervention may have clinical utility in chronic asthma.

24.6 ADDITIONAL PRECLINICAL IN VIVO PHARMACOLOGY IN MODELS OF INFLAMMATION 24.6.1 Immunomodulation and Transplantation The activity of systemically administered ICAM-1 PS-ODN and 2-MOE ASOs in animal models of organ transplantation has previously been reviewed [138]. In addition to preservation of heart and

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 683


683

(a) 7

NA

6

Veh Veh + Dex

Penh

5 4

IL 4Rα ASO 5 mcg/kg

3 2

IL 4Rα ASO 500 mcg/kg

1 0 0

20

40 60 80 Methacholine (mg/mL)

100

120

Percent BAL neutrophils (day 62)

(b) 100 90 80 70 60 50 40 30 20 10 0

Percent BAL eosinophils (day 76)

(c) 100 90 80 70 60 50 40 30 20 10 0 5

500

Veh

Veh + Dex Oligonucleotide dose (mcg/kg)

NA

IL 4Rα ASO

Figure 24.9 Suppression of lung inflammation by inhaled IL-4R ASO using a therapeutic treatment regimen in chronically OVA-challenged mice. (a) Methacholine-induced Penh dose-response curves from Balb/c mice exposed to inhaled IL 4R ASO (5 and 500 g/kg administered once weekly) following the development of established lung inflammation. Additional groups of mice were exposed to nebulized saline or injected with dexamethasone (2.5 mg/kg i.p. on days 47, 62, 73–75). Responses of naïve mice (open triangles), saline vehicle–treated mice (circles), vehicle- plus dexamethasonetreated mice (filled triangles), IL 4R ASO (5 g/kg)–treated mice (open squares), and IL 4R ASO (500 g/kg)–treated mice (filled squares) are shown. (b) Airway cells were recovered by bronchoalveolar lavage and analyzed by multiparametric flow cytometry on day 62 for neutrophils, (c) or immediately following measurement of AHR on Day 76 for eosinophils. Data are presented as group means SE, n 10 per group for Penh and n 7 per group for cell differentials. “∗ ” indicates p 0.05; Student’s T-test. (From Karras, J. et al., Am. J. Respir. Cell Mol. Biol.; published ahead of print on September 21, 2006 as doi:10.1165/rcmb.2005-0456OC. With permission.)

renal allografts, and reduced severity of ischemia-reperfusion injury shown earlier, recent work has demonstrated that systemic administration of ICAM-1 ASO improves pancreatic islet cell allograft survival and function in mice [139]. Cyclosporin-induced nephrotoxicity, particularly the chronic form of the disorder, can cause decreased kidney function and structural changes including tubulointerstitial fibrosis, tubular atrophy, and glomerulosclerosis. The combination of perfusion of the allograft and systemic administration (10 mg/kg per day, i.v., for 14 days) of the host rat with 2-MOE ICAM-1 ASO

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

684

Page 684


was found to completely alleviate Cyclosporin-induced nephrotoxicity, whereas perfusion alone produced a partial protective effect [140]. In this study, renal allograft rejection was significantly delayed by oral administration of ICAM-1 2-MOE ASO, although 50–100 mg/kg doses were required due to an estimated 10–15% bioavailability. Several other studies have demonstrated delayed allograft rejection following PS-ODN perfusion of the graft tissue before transplant, identifying early growth response (Egr)-1, IL-15, and TNF- as additional targets of interest in lung, islet, and liver transplantation models, respectively [141–143]. Together, this work supports continued investigation of improved ASO therapies in organ transplantation. Human acute allogeneic graft rejection responses have been recently modeled in severe combined immune deficiency (SCID)/beige mice engrafted with human skin and reconstituted with allogeneic peripheral blood mononuclear cells (PBMC). Intradermal injection of human IL-11 delayed the CD3 T cell–mediated destruction of the graft microvessels and up-regulated survivin gene expression in graft endothelial cells and keratinocytes in a manner consistent with its protective effect [144]. Topical application of survivin 2-MOE ASO formulated in cream to healed engrafted skin (100 L of a 5% w/v cream 3 times daily from days 5–10 following PBMC inoculation) suppressed both IL-11-mediated survivin expression and protection of microvessel integrity. A role for endocrine hormones, particularly estrogens, in the increased incidence of autoimmune disease in females has long been postulated, although the activities of estrogens in immunity are not well characterized. The immunomodulatory hormone, gonadotropin-releasing hormone (GnRH), is increased by estrogens and pituitary cells from females are more responsive to GnRH than those from males. GnRH has been shown to be immunostimulatory, to exacerbate systemic lupus erythematous (SLE) in female but not male mice, and to signal through the stimulatory G-proteins Gq and G11 (together termed GQ/11) [145–147]. In ovariectomized female (NZB NZW) F1 hybrid mice, a model of SLE, subcutaneous injection of GQ/11 PS-ASO (0.5 mg/kg 3 times weekly) significantly reduced serum anti-DNA antibody levels, and proteinuria compared to treatment with missense control oligonucleotide [147]. These effects were not evident until 20–25 weeks of treatment. At 1 year of treatment, mesangial hypercellularity, sclerosis, and capillary wall thickening were decreased in ASO-treated animals, and GQ/11 mRNA levels were shown to be decreased in splenic mononuclear cells. The PS-ODN used in this study contained a noncanonical CpG motif and although in vitro IL-6 production by splenocytes was not increased compared to control oligonucleotide not containing a CpG motif, in vivo cytokine measurements were not reported. This study suggests that GnRH may promote autoimmunity by modulating immunocyte responsiveness and that the endocrineimmune axis may be a target for ASO intervention in vivo. 24.6.2 Hyperalgesia Chronic neuropathic pain is a significant clinical problem. There is growing evidence that inflammation contributes to hypersensitivity to subsequent afferent stimuli following tissue injury, termed hyperalgesia. A number of targets associated with inflammation have been implicated in sensitizing peripheral nociceptors to produce a decrease in pain threshold [148]. Inflammatory mediators, such as prostaglandin E2 (PGE2) and carrageenan, cause hyperalgesia in animal models. Therefore, anti-inflammatory strategies that can be safely practiced in the CNS may be of future therapeutic value. In rat models of hyperalgesia, signaling molecules classically associated with inflammation, such as NF-B and p38, have been recently implicated. Intrathecal administration of NF-B p65 subunit PS-ODN suppressed p65 protein expression in spinal cord and significantly attenuated chronic constriction injury-induced pain sensation and thermal hyperalgesia [149]. In rats administered p38 2-MOE ASO by intrathecal injection, both nocifensive flinching evoked by intraplantar injection of formalin and hyperalgesia produced by intrathecal injection of substance P were prevented [150]. Phosphorylation of p38 in the immediate spinal cord tissue surrounding the ASO injection site was reduced and p38 ASO had no effect on nociception or hyperalgesia.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 685


685

Other studies have shown that TNF- can activate the protein kinase C (PKC)-dependent development of a chronic hyperalgesia susceptible state [151,152]. The intrathecal administration of tumor necrosis factor receptor type-1 or PKC ASOs prevented hyperalgesic priming of sensory neurons and PKC ASO treatment was found to terminate a fully developed state of priming. Inflammatory hyperalgesia induced by PGE2, epinephrine, forskolin, and MAPK or PKC agonists all were found to depend on the function of integrins [153]. Intrathecal administration of integrin subunit ASOs differentially blocked hyperalgesia induced through the PKA and PKC pathways, or by PGE2 or epinephrine, indicating that integrin subunits regulate extracellular matrix-induced signaling in neurons by uniquely integrating second messenger systems. In the case of PGE2, integrity of lipid rafts was essential to maintain a state of hyperalgesia, as detergent treatment of membrane fractions antagonized hyperalgesic signaling induced by PGE2. Since changes in extracellular matrix occur at sites of inflammation, it is likely that inflammatory processes mediate hyperalgesia by activating neuronal second messenger pathways through engagement of specific sets of integrins.

24.7 CELLULAR AND MOLECULAR PHARMACOLOGY 24.7.1 Cell Proliferation, Maturation, and Survival The contribution of resident synovial cells and joint-infiltrating leukocytes to the pathophysiology of RA has been actively investigated in recent years [154]. There is considerable evidence that immune and inflammatory mechanisms drive the abnormal formation of the pannus, an outgrowth of synovial fibroblast-like tissue observed in affected joints, resulting in reduction of the synovial space and damage to the surrounding articular tissue. The use of modern genetic manipulations, including the use of ASO, has helped to more clearly define key cell types, gene products, and signaling pathways intimately involved in joint inflammation. In addition to inducing the production of inflammatory chemokines, TNF- promotes the abnormal proliferation of RA synoviocytes and enhances their survival. Nakazawa et al. have studied the Notch family proteins in RA synoviocytes, due to the association of these factors with cell fate and proliferative capacity [155]. Notch-1 was found to be present in the nucleus of RA patient synoviocyte samples, whereas it was largely restricted to the cytoplasm in normal and osteoarthritis synoviocytes, suggesting disease-specific activation of the pathway. Nuclear Notch-1 was characterized as Notch-1 intracellular domain and was inducible by TNF- treatment. Notch-1 ASO treatment reduced the basal and TNF--induced proliferation of RA synoviocytes, identifying the Notch signaling pathway in altered proliferation of RA synoviocytes. The protective role of TNF- in RA synoviocytes was demonstrated to be dependent upon FLICE inhibitory protein (FLIP), as TNF- up-regulated FLIP expression in RA fibroblast-like synoviocytes and FLIP ASO treatment sensitized these cells to Fas-mediated apoptosis [156]. Since Fas ligand is present in RA synovium, these data suggest that TNF--induced protection of RA synoviocytes from normal homeostatic mechanisms of apoptosis is mediated through up-regulation of FLIP. FLIP is overexpressed in inflamed colonic lesions of Crohn’s disease [157] and appears to play a role in protection of LPL from Fas-mediated apoptosis in CD [158]. Fas ligand (FasL) -induced apoptosis was lower in CD3 LPL from patients with CD than in CD3 LPL from UC patients or normal subjects, although normal expression of Fas and FasL were found in CD LPL and mucosal cells, respectively. Enhanced FLIP expression was observed in CD LPL compared to UC or normal LPL, with the FLIP S isoform that contains two death effector domains but no caspase-binding domain highly up-regulated following anti-CD3 cross-linking. A FLIP PS-ODN that inhibited both FLIP isoforms restored susceptibility of CD LPL to Fas-induced apoptosis, suggesting that chronic inflammatory conditions present in CD promote overexpression of FLIP, resulting in resistance of LPL to normal mechanisms of programmed cell death.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

686

Page 686


24.7.2 Cell Activation T lymphocytes and monocyte/macrophages have been implicated in the pathogenesis of fibrotic diseases [159,160]. Consistent with this notion, immunosuppressive drugs such as cyclosporin and FK506 have demonstrated clinical efficacy in some systemic sclerosis (SSc) or scleroderma patients [161]. Several studies have evaluated expression of inflammatory cell activation markers in either immune cells or tissue fibroblasts using ASO, resulting in a proposed causal role for interaction of hematopoietic cells or their products and fibroblasts in at least the early stages of fibrotic disease. The chemokine (C-C motif) ligand 2 (CCL2, monocyte chemoattractant protein 1, MCP-1) interaction with CCR2 has been implicated in the fibrogenesis process via paracrine and autocrine regulation of myofibroblast differentiation. Increased CCR2 expression has been demonstrated on myofibroblasts, lymphocytes, macrophages, and endothelial cells from SSc patients [162]. Treatment of CD14 human peripheral blood macrophages with CCL2 enhanced expression of transforming growth factor (TGF)-1 and a pro-1 chain of type 1 collagen (COL1A1) [163] while amplifying macrophage CCL2/CCR2 expression. CCL2 down-regulation with phosphorothioate ASO in these macrophages reduced autocrine stimulation of CCL2/CCR2 expression [160]. Fibroblasts from SSc patients with a profibrotic phenotype (elevated -smooth muscle actin and connective tissue growth factor expression) but not control fibroblasts were CCR2 . It has been shown that cultured SSc fibroblasts continue to produce excessive amounts of extracellular matrix proteins [163], suggesting that once these cells have been appropriately activated, a constitutive autoregulatory activation pathway becomes engaged. SSc fibroblasts express elevated levels of TGF-R and the v3 integrin, recently demonstrated to promote activation of the latent form of TGF-1 [164]. Treatment of normal fibroblasts overexpressing v3 or SSc fibroblasts with TGF-1 ASO blocked 2 (I) collagen gene expression [165], suggesting that an autocrine TGF- loop exists in SSc fibroblasts that may result from increased endogenous expression of genes that mediate extracellular TGF- protein processing from the latent to the active form. 24.7.3 Cell Migration and Adhesion Expression of chemoattractant molecules by RA synovial tissue recruits mononuclear cells to the joints where they release TNF-, IL-1, and IL-12, among other factors involved in inflammation. Ruth et al. utilized a human RA synovial tissue SCID mouse chimera to study the key signals required for homing of mononuclear cells to the RA synovium [166]. In these studies, a synovial biopsy from an RA patient was coimplanted with human cartilage just under the renal capsule in SCID mice and peripheral blood leukocytes from RA subjects were used to reconstitute the animal’s immune system. Recruitment of human mononuclear cells to the synovial tissue was induced by intragraft injection of human CXC chemokine ligand (CXCL)16 or TNF-. Ex vivo transfection of mononuclear cells with extracellular signal-related kinase (ERK)1/2 ASO before reconstitution of the mice resulted in a 50% decrease in recruitment of mononuclear cells to the engrafted RA synovial tissue. This study suggests that the MAPK pathway regulates chemoattraction of human inflammatory leukocytes to RA synovial tissue. 24.7.4 Gene Expression and Receptor Signaling NF-B signaling has been implicated in cytokine-induced synovial fibroblast adhesion molecule and chemokine production. IL-18, a proinflammatory cytokine found in synovial fluid from RA patients, activates NF-B in human RA synovial fibroblasts and up-regulates the secretion of CXCL8 (IL-8), CXCL1 (growth-regulated oncogene, gro-alpha), and CXCL5 (epithelial-neutrophil activating protein, ENA-78) [167]. Pretreatment of RA synovial fibroblasts with p65 subunit of NF-B phosphorothioate ASO produced a 44% reduction in CXCL8 secretion, compared to control sense oligonucleotide [168]. In a separate study, ASO inhibition of IL-1 receptor associated

CRC_8796_ch024.qxd

6/20/2007

10:30 PM


Page 687

687

kinase (IRAK)-1 also blocked IL-18-induced NF-B expression [169]. IL-18 also induces adhesion of leukocytes to synovial tissue fibroblasts via activation of ERK1/2 and Akt-1 through Srcdependent pathways that result in increased synovial fibroblast vascular cell adhesion molecule (VCAM)-1 expression. These results suggest that IL-18 utilizes IRAK-1- and Src-dependent signaling pathways to induce chemokine and VCAM-1 expression in RA synovial fibroblasts, resulting in the promotion of interactions between bone marrow–derived leukocytes and synovial fibroblasts resident in the joint that contribute to RA pathology. Identification of the effector molecules mediating islet cell apoptosis in type 1 diabetes mellitus has lagged behind delineation of the immune cell types involved. Clearly, perforin contributes to CD8 cell-mediated islet cell death but the roles for other implicated factors such as Fas, TNF-, IL-1, and nitric oxide are less clear. The combination of TNF- and IFN- treatment was shown to synergistically produce caspase-dependent apoptosis in insulinoma cells and primary islet cells [169]. Interferon regulatory factor (IRF)-1, a key regulator of IFN- signaling, was found to mediate the cytotoxic effects of the cytokine combination, as IRF-1 ASO treatment abolished TNF- plus IFN- induced apoptosis of insulinoma cells. These data implicate the IFN- signaling pathway as a major contributor to the development of autoimmune diabetes by acting in concert with TNF- in a final effector pathway of islet cell death. TNF- plays a central role in the pathogenesis of UC. In normal human intestinal lamina propria mononuclear cells (LPMC), treatment with the immunosuppressive factor TGF-1 markedly suppresses TNF--induced activation of NF-B through TGF- receptor (TGF-R) -mediated phosphorylation of Smad2 and Smad3 and their subsequent association with Smad4 to form a transcriptionally active complex [170]. However, in LPMC from patients with IBD, TGF-1 treatment failed to suppress NF-B activation following TNF- stimulation, suggesting that a defect in the TGF-1 signaling pathway may be in part responsible for sustained NF-B activation observed in these cells. Further investigation demonstrated that the antagonistic Smad7 TGF- signaling pathway family member, known to interfere with phosphorylation of Smad2/ Smad3 by preventing its association with TGF-1 R, was overexpressed in LPMC from IBD patients. Inhibition of Smad7 with a targeted ASO restored the inhibitory effect of TGF-1 treatment on TNF--induced NF-B activation in IBD LPMC, demonstrating that Smad7 overexpression during gut inflammation results in unchecked activation of NF-B and identifying Smad7 as a potential therapeutic target in IBD. 24.7.5 Mediator Release Th2 cytokines are believed to mediate allergic inflammation in asthma and allergic rhinitis. Although an inhaled soluble IL-4 receptor protein inhibitor and IL-5 monoclonal antibody therapeutic strategies have failed in clinical trials, a locally delivered oligonucleotide Th2 inhibitor has not yet been evaluated in man and may have different pharmaceutical properties/activities. IL-4 antisense decreased the levels of IL-4 mRNA and IL-4 protein in nasal biopsy tissues from patients with seasonal ragweed allergic rhinitis following coincubation of the tissue with ragweed antigen ex vivo [171]. IL-4 ASO treatment also suppressed ragweed-induced germline (immunoglobulin E, IgE) and eotaxin-1 transcription, downstream IL-4-regulated genes. The epithelial side was largely unstained, indicating that diffusion of oligonucleotides is limited through the tissue, most likely due to their protein-binding characteristics. Effects of the Th2 cytokine IL-13 on pulmonary airway smooth muscle cells (ASMC) appear to promote AHR. The signaling pathway utilized by IL-13 to induce the production of eotaxin-1 in ASMC was shown to require the transcription factor signal transducer and activator of transcription 6 (STAT6), as transfection of ASMC with STAT6 PS-ODN reduced IL-13- or IL-4-induced eotaxin-1 release by 81% and 75%, respectively [172]. STAT6-mediated regulation of eotaxin-1 production was specific for Th2 cytokines, as IL-1-induced eotaxin-1 secretion was not affected by STAT6 ASO treatment.

CRC_8796_ch024.qxd

688

6/20/2007

10:30 PM

Page 688


Mast cells are believed to play a central role in the pathology of asthma, by triggering the early phase response to allergen exposure following allergen-mediated cross-linking of their high-affinity IgE receptors, resulting in release of proinflammatory mediators and in inducing the onset of the late-phase reaction characterized by pulmonary infiltration of eosinophils. A recent report has shown that an IgE-independent mechanism of human mast cell activation occurs in vitro when lung or cord blood mast cells are incubated with eosinophil major basic protein (MBP) in the presence of human lung fibroblasts [173]. Coculture of cord blood mast cells with 3T3 fibroblasts produced more histamine and PGD2 upon stimulation with MBP than mast cells maintained without contact with fibroblasts. A 2-O-methyl modified SCF ASO preincubated with the fibroblasts reduced MBP-mediated histamine release from cord blood mast cells by 83% and completely blocked the production of PGD2. Coincubation of mast cells with MBP and soluble SCF did not increase their histamine and PGD2 production, indicating that the membrane-bound form of SCF was required for optimal mast cell activation. These results point to an IgE-independent mast cell activation pathway in the lung interstitium that may promote prolonged lung inflammation following allergen exposure. 24.7.6 Immunomodulation and Immune Surveillance Excessive interferon- (IFN-) production is linked to the pathology of MS. Both IL-12 and IL-23 are primarily dendritic cell (DC) products known to induce IFN- expression in vitro. DC from MS patients secrete increased levels of IL-23 and EAE cannot manifest in mice lacking IL-23 [174], suggesting that IL-23 may play a critical role in MS. Mature monocyte-derived human DC transfected with morpholino ASO targeting IL-23 produced decreased amounts of TNF- and increased levels of IL-10 [175], a known product of regulatory T cells. In addition, IL-23 ASO–treated DC displayed impaired antigen presentation activity to autologous T cells, indicating that IL-23 promotes Th1-biased autoimmunity and DC maturation. In a model of type 1 diabetes mellitus, transfer of pancreatic islet DC from nonobese diabetic (NOD) mice into prediabetic NOD mice conferred protection from induction of diabetes, presumably due to acquisition of islet antigens by the DC that allowed them to promulgate regulatory immune cells [176]. In a similar approach with potential therapeutic implications, bone marrow–derived DC were transfected ex vivo with CD40, CD80, and CD86 ASOs before injection into prediabetic NOD mice or cotransfer with splenic T cells into NOD-SCID recipients [177]. In mice receiving ASOtreated DC, the onset and incidence of diabetes were reduced, with 25% of the mice remaining disease-free up to 45 weeks following a single injection of ASO-treated DC. These animals were able to mount a normal immune response to alloantigen, indicating that they were not generally immunosuppressed. Furthermore, splenocytes from mice receiving ASO-treated DC had a higher frequency of CD4 CD25 regulatory T cells (Treg) than control animals, suggesting that phenotypically immunosuppressive DC may promote the appearance of regulatory T cells and offer a method for protecting remaining pancreatic islet cells in type 1 diabetes from immune-mediated cell death. Interactions between immune and nonhematopoietic cells are critical for the preservation of normal tissue homeostasis. In the gastrointestinal tract, mechanisms of tolerance must be in place to prevent the inappropriate activation of mucosal T cells by the frequent presence of bacterial and dietary antigens. Intestinal fibroblasts have been shown to act as regulators of mucosal immunity, although the mechanisms by which they control lymphocyte-dependent responsiveness have not been defined. Ina and colleagues have recently demonstrated that mucosal human T-cell viability after exposure to growth factor withdrawal was maintained by IL-10 derived from human intestinal fibroblasts (HIF) [178]. Antisense inhibition of fibroblast IL-10 blocked the antiapoptotic activity of conditioned medium from cultured HIF. These results suggest that survival of regulatory or memory T cells in the gastrointestinal tract requires fibroblast IL-10 production and may provide a potential mechanistic explanation for the basis of IBD in IL-10-deficient mice.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 689


689

Recent studies have indicated that oncogenic signaling molecules can aid tumor immune evasion by production of immunosuppressive factors and inhibition of DC maturation [179,180]. A common pathway through which tumor-mediated immunosuppression occurs involves activation of signal transducer and activator of transcription STAT3. STAT3 is commonly activated in tumors and promotes expression of immunosuppressive factors such as vascular endothelial cell growth factor (VEGF) and IL-10 [181]. Genetic deletion [182,183] and antisense [181] strategies have shown that STAT3 suppression blocked tumor cell production of immunosuppressive factors and up-regulated tumor cell apoptotic cascades. Reduction of STAT3 expression also had multiple positive effects on host antitumor immunity. These data suggest that tumors evade immune surveillance by active mechanisms and that ASOs may have therapeutic activity in oncological applications by either direct tumor cell targeting or inducing antitumor immune responses in host hematopoietic cells. Control of Treg production and function is of great current interest as a therapeutic approach to chronic disease modification. There is evidence suggesting that mammalian T cell–mediated immunity depends on both innate immune signals and the antigen receptor–costimulatory molecule pathway of acquired immunity. The TLR4/MD2/CD14 receptor complex that mediates recognition of bacterial lipopolysaccharide (LPS) and is negatively regulated by RP105-MD1 represents one example of an innate immune system signaling element linked to the generation of Treg in mice [184]. Reduction of MD1 expression in splenic mouse DCs following in vivo treatment with PS-ASOs resulted in suppression of LPS-stimulated CTL induction in mixed lymphocyte cultures. Administration of MD1 ASO to mice also reduced allogeneic graft rejection responses in vivo (with or without LPS cotreatment). Higher numbers of CD4 CD25 and Foxp3 Treg cells were recovered from MD1 KO mice or mice treated with MD1 PS-ODNs used for allogeneic graft rejection experiments, suggesting that MD1 antagonizes a high level of TLR4 signaling required to generate Treg cells and that inhibition of MD1 expression may therefore be a useful approach for transplantation and autoimmunity.

24.8 FUTURE DIRECTIONS Understanding how distinct genes influence the immune and inflammatory processes that contribute to the initiation and progression of chronic diseases is at an early stage. The application of antisense technologies in basic and applied research continues to provide novel insights into the complex network of molecular structures, interactions, and processes that support physiological function and health as well as those involved in disease pathogenesis. Significant progress in the development and clinical assessment of putative antisense therapies has been recently made. Firstand second-generation ASOs have demonstrated limited utility for safely and effectively targeting sites of inflammation located outside the liver and kidney using parenteral or oral administration. Topical administration strategies including enema and aerosol formulations have produced promising early clinical results in UC, pouchitis, and asthma. Current chemistries offer the promise of once-daily or less frequent topical administration of antisense therapies with acceptable safety profiles to support chronic treatment, but substantial safety and efficacy hurdles remain for these compounds. Technical hurdles, including oligonucleotide delivery to the skin, CNS, and musculoskeletal tissues must be overcome before antisense is likely to become a mainstay technology for treatment of chronic inflammatory diseases in these tissues. Current first- and second-generation ASOs have demonstrated consistent and reproducible activities in vivo in antigen-presenting cells, including dendritic cells, macrophages, eosinophils, and certain epithelial and endothelial cell populations, and in parenchymal cells of the liver, kidney, lung, and brain. Target down-regulation and pharmacological activity in relatively resistant cell populations such as lymphocytes, fibroblasts, and smooth muscle cells may require additional formulation development to facilitate ASO targeting and uptake.

CRC_8796_ch024.qxd

690

6/20/2007

10:30 PM

Page 690


Finally, improvements in the oral bioavailability of antisense therapies would be a welcome and significant breakthrough. ISIS 104838 was demonstrated to be orally bioavailable in humans after administration of solid dose forms. The estimated tissue bioavailability was approximately 15%. Optimized formulations would be expected to provide equivalent results for all second-generation 2-methoxyethyl antisense drugs, and this work is currently underway.

REFERENCES 1. Shanahan, F., Crohn’s disease, Lancet, 359, 62, 2002. 2. Pirollo, K.F. et al., Antisense therapeutics: from theory to practice, Pharmacol. Therap., 99, 55, 2003. 3. Henry, S.P. et al., Drug properties of second-generation antisense oliognucleotides: how do they measure up to their predecessors? Curr. Opin. Investig. Drugs, 2, 1444, 2001. 4. Akira, S. and Hemmi, H., Recognition of pathogen-associated molecular patterns by TLR family, Immunology, 85, 85, 2003. 5. Senn, J.J. et al., Non-CpG-containing antisense 2-methoxyethyl oligonucleotides activate a proinflammatory response independent of Toll-like receptor 9 or myeloid differentiation factor 88, J. Pharmacol. Exp. Ther., 14, 972, 2005. 6. Monia, B.P. et al., Evaluation of 2-modified oligonucleotides containing 2-deoxy gaps as antisense inhibitors of gene expression, J. Biol. Chem., 268, 14,514, 1993. 7. Henry, S. et al., Chemically modified oligonucleotides exhibit decreased immune stimulation in mice, J. Pharmacol. Exp. Ther., 292, 468, 2000. 8. Heller, F. et al., Interleukin-13 is the key effector Th2 cytokine in ulcerative colitis that affects epithelial tight junctions, apoptosis and cell restitution, Gastroenterology, 129, 550, 2005. 9. Kakazu, T. et al., Type 1 T-helper cell predominance in granulomas of Crohn’s disease, Am. J. Gastroenterol., 94, 2149, 1999. 10. Cobrin, G.M. and Abreu, M.T., Defects in mucosal immunity leading to Crohn’s disease, Immunol. Rev., 206, 277, 2005. 11. Marks, D.J.B. et al., Defective acute inflammation in Crohn’s disease: a clinical investigation, Lancet, 367, 668, 2006. 12. Korzenik, J.R. and Podolsky, D.K., Evolving knowledge and therapy of inflammatory bowel disease, Nat. Rev. Drug Disc., 5, 197, 2006. 13. Hanauer, S.B., Inflammatory bowel disease, Drug Ther., 334, 841, 1996. 14. Targan, S.R. et al., A short-term study of chimeric monoclonal antibody cA2 to tumor necrosis factor alpha for Crohn’s disease, N. Engl. J. Med., 337, 1029, 1997. 15. Hanauer, S.B. et al., Human anti-tumor necrosis factor monoclonal antibody (adalimumab) in Crohn’s disease: the CLASSIC-I Trial, Gastroenterology, 130, 323, 2006. 16. Sandborn, W.J. et al., Etanercept for active Crohn’s disease: a randomized, double-blind, placebocontrolled trial, Gastroenterology, 121, 1088, 2001. 17. Sandborn, W.J. et al., CDP571, a humanised monoclonal antibody to tumour necrosis factor alpha, for moderate to severe Crohn’s disease: a randomised, double-blind, placebo-controlled trial, Gut, 53, 1485, 2004. 18. van den Brande, J.M.H. et al., Infliximab but not etanercept induces apoptosis in lamina propria T-lymphocytes from patients with Crohn’s disease, Gastroenterology, 124, 1774, 2003. 19. Vigna-Perez, M. et al., Immune effects of therapy with adalimumab in patients with rheumatoid arthritis, Clin. Exp. Immunol., 141, 372, 2005. 20. Nakamura, S. et al., In situ expression of the cell adhesion molecules in inflammatory bowel disease. Evidence of immunologic activation of vascular endothelial cells, Lab Invest., 69, 77, 1993. 21. Bennett, C.F. et al., An ICAM-1 antisense oligonucleotide prevents and reverses dextran sulfate sodium-induced colitis in mice, J. Pharmacol. Exp. Ther., 280, 988, 1997. 22. Yacyshyn, B.R. et al., A placebo-controlled trial of ICAM-1 antisense oligonucleotide in the treatment of Crohn’s disease, Gastroenterology, 114, 1133, 1998. 23. Yacyshyn, B.R. et al., Double blind, placebo controlled trial of the remission inducing and steroid sparing properties of an ICAM-1 antisense oligodeoxynucleotides, alicaforsen (ISIS 2302), in active steroid dependent Crohn’s disease, Gut, 51, 30, 2002.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM


Page 691

691

24. Yu, R.Z. et al., Prediction of clinical responses in a simulated Phase 3 trial of Crohn’s patients administered the antisense phosphorothioate oligonucleotide ISIS 2302: comparison of proposed dosing regimens, Antisense Nucleic Acid Drug Dev., 13, 57, 2003. 25. Yacyshyn, B.R. et al., Randomized, double-masked, placebo-controlled studies of alicaforsen, an antisense inhibitor of ICAM-1, for the treatment of subjects with active Crohn’s disease, Clin. Gastroenterol. Hepatol., 2006 (in press). 26. Nakamura, S. et al., In vitro expression of the cell adhesion molecules in inflammatory bowel disease. Evidence of immunologic activation of vascular endothelial cells, Lab Invest., 69, 77, 1993. 27. Hamann, A. et al., Role of alpha 4-integrins in lymphocyte homing to mucosal tissues in vivo, J. Immunol., 152, 3282, 1994. 28. Schreiber, S. et al., A randomized, placebo-controlled trial of certolizumab pegol (CDP870) for treatment of Crohn’s disease, Gastroenterology, 129, 807, 2005. 29. Vermeier, L.E. et al., A positive response to infliximab in Crohn’s disease: association with a higher systemic inflammation before treatment but not with -308 TNF gene polymorphism, Scand. J. Gastroenterol., 37, 818, 2002. 30. Sandborn, W.J. et al., Certolizumab pegol administered subcutaneously is effective and well tolerated in patients with active Crohn’s disease: results from a 26-week, placebo controlled Phase III study (PRECISE1), Gastroenterology (Suppl), A745, 2006. 31. Rutgeerts, P. et al., Subanalysis from a phase 3 study on the evaluation of natalizumab in active Crohn’s disease, Gut 52 (Suppl), A239, 2003. 32. Butcher, E.C., Leukocyte-endothelial cell recognition: Three (or more) steps to specificity and diversity, Cell, 67, 1033, 1991. 33. Forbes, E. et al., ICAM-1-dependent pathways regulate colonic eosinophilic inflammation, J. Leukocyte Biol., 80, 1, 2006. 34. van Deventer, S.J., Tami, J.A., and Wedel, M.K., A randomized, controlled, double blind, escalating dose study of alicaforsen enema in active ulcerative colitis, Gut, 53, 1646, 2004. 35. Miner, P.B. et al., Bioavailability and therapeutic activity of alicaforsen (ISIS 2302) administered as a rectal retention enema to subjects with active ulcerative colitis, Aliment. Pharmacol. Ther., 23, 1427, 2006. 36. Miner, P.B. et al., Safety and efficacy of two dose formulations of alicaforsen enema compared with mesalazine enema for treatment of mild to moderate left-sided ulcerative colitis: a randomized, doubleblind, active-controlled trial, Aliment. Pharmacol. Ther., 23, 1403, 2006. 37. van Deventer, S.J.H. et al., A Phase II dose ranging, double blind, placebo-controlled study of alicaforsen enema in subjects with acute exacerbation of mild to moderate left-sided ulcerative colitis, Aliment. Pharmacol. Ther., 23, 1415, 2006. 38. Miner, P. et al., An enema formulation of alicaforsen, an antisense inhibitor of intercellular adhesion molecule-1, in the treatment of chronic, unremitting pouchitis, Aliment. Pharmacol. Ther., 19, 281, 2004. 39. Spiik, A.K. et al., Abrogated lymphocyte infiltration and lowered CD14 in dextran sulfate induced colitis in mice treated with p65 antisense oligonucleotides, Int. J. Colorectal Dis., 17, 223, 2002. 40. Myers, K.J. et al., Antisense oligonucleotide blockade of tumor necrosis factor-alpha in two murine models of colitis. JPET, 304, 411, 2003. 41. Gao, D. et al., CD40 antisense oligonucleotide inhibition of trinitrobenzene sulphonic acid induced rat colitis. Gut, 54, 70, 2005. 42. Kim, S.G. et al., Inhibition of proinflammatory cytokine expression by NF-kappaB (p65) antisense oligonucleotide in Helicobacter pylori-infected mice. Helicobacter, 10, 559, 2005. 43. Rijcken, E. et al., ICAM-1 and VCAM-1 antisense oligonucleotides attenuate in vivo leucocyte adherence and inflammation in rat inflammatory bowel disease. Gut, 51, 529, 2002. 44. Bowen-Yacyshyn, M.B. et al., Amelioration of chronic and spontaneous intestinal inflammation with an antisense oligonucleotide (ISIS 9125) to intracellular adhesion molecule-1 in the HLA-B27/beta2 microglobulin transgenic rat model, J. Pharmacol. Exp. Ther., 302, 908, 2002. 45. Kwon, J.H. et al., Topical antisense oligonucleotide therapy against LIX, an enterocyte-expressed CXC chemokine, reduces murine colitis, Am. J. Physiol. Gastrointest. Liver Physiol., 289, G1075, 2005. 46. Goto, A. et al., Antisense therapy of MAdCAM-1 for trinitrobenzenesulfonic acid-induced murine colitis, Inflamm. Bowel Dis., 12, 758, 2006.

CRC_8796_ch024.qxd

692

6/20/2007

10:30 PM

Page 692


47. Popoff, I. et al., Antisense oligonucleotides to poly (ADP-ribose) polymerase-2 ameliorate colitis in interleukin-10-deficient mice, J. Pharmacol. Exp. Ther., 303, 1145, 2002. 48. Lawrance, I.C. et al., A murine model of chronic inflammation-induced intestinal fibrosis downregulated by antisense NF-kappa B, Gastroenterology, 125, 1750, 2003. 49. The, F.O. et al., The ICAM-1 antisense oligonucleotide ISIS 3082 prevents the development of postoperative ileus in mice, Br. J. Pharmacol., 146, 252, 2005. 50. Falgarone, G., Jaen, O., and Boissier, M.C., Role for innate immunity in rheumatoid arthritis, Joint Bone Spine, 72, 17, 2005. 51. Zwerina, J. et al., Pathogenesis of rheumatoid arthritis: targeting cytokines, Ann. N. Y. Acad. Sci., 1051, 716, 2005. 52. Scott, D.L. and Kingley, G.H., Tumor necrosis factor inhibitors for rheumatoid arthritis, N. Engl. J. Med., 355, 704, 2006. 53. Bongartz, T. et al., Anti-TNF antibody therapy in rheumatoid arthritis and the risk of serious infections and malignancies, JAMA, 295, 2275, 2006. 54. Salliot, C. et al., Infections during tumour necrosis factor-alpha blocker therapy for rheumatic diseases in daily practice: a systemic retrospective study of 709 patients, Rheumatology, 46, 327, 2007. 55. Cannon, G.W. et al., Adverse events with disease modifying antirheumatic drugs (DMARD): a cohort study of leflunomide compared with other DMARD, J. Rheumatol., 31, 1906, 2004. 56. Elewaut, D. et al., A comparative phenotypical analysis of rheumatoid nodules and rheumatoid synovium with special reference to adhesion molecules and activation markers, Ann. Rheum. Dis., 57, 480, 1998. 57. Dolezalova, P. et al., Soluble adhesion molecules ICAM-1 and E-selection in juvenile arthritis: clinical and laboratory correlations, Clin. Exp. Rheumatol., 20, 249, 2002. 58. Maksymowych, W.P. et al., A randomized, placebo controlled trial of an antisense oligodeoxynucleotide to intercellular adhesion molecule-1 in the treatment of severe rheumatoid arthritis, J. Rheumatol., 29, 447, 2002. 59. Kavanaugh, A.F. et al., Treatment of refractory rheumatoid arthritis with a monoclonal antibody to intercellular adhesion molecule 1, Arthritis Rheum., 37, 992, 1994. 60. Kavanaugh, A.F. et al., A phase I/II open label study of the safety and efficacy of an anti-ICAM-1 (intercellular adhesion molecule-1; CD54) monoclonal antibody in early rheumatoid arthritis, J. Rheum., 23, 1338, 1996. 61. Kavanaugh, A.F. et al., Repeat treatment of rheumatoid arthritis patients with a murine anti-intercellular adhesion molecule 1 monoclonal antibody, Arthritis Rheum., 40, 849, 1997. 62. Sewell, K.L. et al., Phase I trial of ISIS 104838, a 2-methoxyethyl modified antisense oligonucleotide targeting Tumor Necrosis Factor-, J. Pharmacol. Exp. Ther., 303, 1334, 2002. 63. Geary, R.G., unpublished data, 2002. 64. Tami, J., unpublished data, 2003. 65. Henry, S. unpublished data, 2001. 66. van der Heijde, D. et al., Comparison of etanercept and methotrexate, alone and combined, in the treatment of rheumatoid arthritis: two-year clinical and radiographic results from the TEMPO study, a double-blind, randomized trial, Arthritis Rheum., 54, 1063, 2006. 67. van de Putte L.B., et al., Efficacy and safety of the fully human anti-tumour necrosis factor alpha monoclonal antibody adalimumab (D2E7) in DMARD refractory patients with rheumatoid arthritis: a 12 week, phase II study, Ann. Rheum. Dis., 62, 1168, 2003. 68. Raoof, A.A. et al., Oral bioavailability and multiple dose tolerability of an antisense oligonucleotide tablet formulated with sodium caprate, J. Pharm. Sci., 93, 1431, 2004. 69. Yamada, R., et al., Selective inhibition of cyclooxygenase-2 with antisense oligodeoxynucleotide restricts induction of rat adjuvant-induced arthritis, Biochem. Biophys. Res. Commun., 269, 415, 2000. 70. Deng, G.M., et al., The major role of macrophages and their product tumor necrosis factor alpha in the induction of arthritis triggered by bacterial DNA containing CpG motifs. Arthritis Rheu., 43, 2283, 2000. 71. Martino, G. et al., Inflammation in multiple sclerosis: the good, the bad and the complex, Lancet Neurol., 1, 499, 2002. 72. Lucchinetti, C. et al., Heterogeneity of multiple sclerosis lesions: implications for the pathogenesis of demyelination, Ann. Neurol., 47, 707, 2002. 73. Johnson, R.T., The virology of demyelinating diseases, Ann. Neurol., 36, S54, 1994.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM


Page 693

693

74. Lublin, F.D. and Reingold, S.C., Defining the clinical course of multiple sclerosis: results of an international survey, Neurology, 46, 907, 1966. 75. Galetta, S.L. and Markowitz, C., US FDA-approved disease-modifying treatments for multiple sclerosis: review of adverse effect profiles, CNS Drugs, 19, 239, 2005. 76. Khan, O.A. et al., A prospective, open-label treatment trial to compare the effect of IFN beta-1a (Avonex), IFNbeta-1b (Betaseron), and glatiramer acetate (Copaxone) on the relapse rate in relapsingremitting multiple sclerosis, Eur. J. Neurol., 8, 141, 2001. 77. Le Page, E. and Edan, G., Disease modifying therapy drugs approved in multiple sclerosis, Rev. Prat., 56, 1336, 2006. 78. Miller, D.H. et al., A controlled trial of natalizumab for relapsing multiple sclerosis, N. Engl. J. Med., 348, 15, 2003. 79. Langer-Gould, A. et al., Progressive multifocal leukoencephalopathy in a patient treated with natalizumab, N. Engl. J. Med., 353, 375, 2005. 80. Kleinschmidt-DeMasters, B.K. and Tyler, K.L., Progressive multifocal leukoencephalopathy complicating treatment with natalizumab and interferon beta-1a for multiple sclerosis, N. Engl. J. Med., 353, 369, 2005. 81. Myers, K.J. et al., Antisense oligonucleotide blockade of alpha 4 integrin prevents and reverses clinical symptoms in murine experimental autoimmune encephalomyelitis, J. Neuroimmunol., 160, 12, 2005. 82. Baron, J.L. et al., Surface expression of alpha 4 integrin by CD4 T cells is required for their entry into brain parenchyma, J. Exp. Med., 177, 57, 1993. 83. Yu, M. et al., Interferon-beta inhibits progression of relapsing-remitting experimental autoimmune encephalomyelitis, J. Neuroimmunol., 64, 91, 1996. 84. Press release, Antisense Therapeutics, Limited, June 8, 2004, PRNewswire (http://www.prnewswire.com/ cgi-bin/stories.pl?ACCT=109&STORY/06-08-2004/0002189126 & EDATE=. 85. Wraight, C., personal communication, 2006. 86. Dowling, P. et al., Up-regulated p75NTR neurotrophin receptor on glial cells in MS plaques, Neurology, 53, 1676, 1999. 87. Soilu-Hanninen, M. et al., Treatment of experimental autoimmune encephalomyelitis with antisense oligonucleotides against the low affinity neurotrophin receptor, J. Neurosci. Res., 59, 712, 2000. 88. Nataf, S. et al., Low affinity NGF receptor expression in the central nervous system during experimental allergic encephalomyelitis, J. Neurosci. Res., 52, 83, 1998. 89. Flugel, A et al., Anti-inflammatory activity of nerve growth factor in experimental autoimmune encephalomyelitis: inhibition of monocyte transendothelial migration, Eur. J. Immunol., 31, 11, 2001. 90. Copray, S. et al., Deficient p75 low-affinity neurotrophin receptor expression exacerbates experimental allergic encephalomyelitis in C57/BL6 mice, J. Neuroimmunol., 148, 41, 2004. 91. Lovett-Racke, A.E. et al., Silencing T-bet defines a critical role in the differentiation of autoreactive T lymphocytes, Immunity, 21, 719, 2004. 92. Borovikova, L.V. et al, Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin, Nature, 405, 458, 2000. 93. Nizri, E. et al., Anti-inflammatory properties of cholinergic up-regulation: A new role for acetylcholinesterase inhibitors, Neuropharmacology, 50, 540, 2006. 94. Tattersfield, A.E. et al., Asthma, Lancet, 360, 1313, 2002. 95. Malerba, G. and Pignatti, P., A review of asthma genetics: gene expression studies and recent candidates, J. Appl. Genet., 46, 93, 2005. 96. Fenech, A. and Hall, I.P., Pharmacogenetics of asthma, Br. J. Clin. Pharm., 53, 3, 2002. 97. Wardlaw, A.J. et al., New insights into the relationship between airway inflammation and asthma, Clin. Sci., 103, 201, 2002. 98. Lemanske, R.F. and Busse, W.W., Asthma. J. Allergy Clin. Immunol., 111, S502, 2003. 99. James, D.G. and Kay, A.B., Are you TH-1 or TH-2? Clin. Exp. Allergy, 25, 389, 1995. 100. Ricci, M. et al., The importance of TH2-like cells in the pathogenesis of airway allergic inflammation, Clin. Exp. Allergy, 23, 360, 1993. 101. Colavita, A.M., Reinach, A.J., and Peters, S.P., Contributing factors to the pathobiology of asthma. The Th1/Th2 paradigm, Clin. Chest Med., 21, 263, 2000. 102. O’Byrne, P.M., Israel, E., and Drazen, J.M., Antileukotrienes in the treatment of asthma, Ann. Intern. Med., 127, 472, 1997.

CRC_8796_ch024.qxd

694

6/20/2007

10:30 PM

Page 694


103. Drazen, J.M., Israel, E., and O’Byrne, P.M., Treatment of asthma with drugs modifying the leukotriene pathway, N. Engl. J. Med., 340, 197, 1999. 104. Laviolette, M. et al., Montelukast added to inhaled beclomethasone in treatment of asthma: Montelukast/Beclomethasone Additivity Group, Am. J. Respir. Crit. Care Med., 160, 1862, 1999. 105. National Asthma Education and prevention Program. Quick reference NAEPP expert panel report guidelines for the diagnosis and management of asthma – update on special topics. 2002. NIH publication no. 02-5075. http://www.nhlbi.nih.gov/guidelines/asthma/execsumm.pdf. 106. Barnes, P.J., Pedersen, S. and Busse, W.W., Efficacy and safety of inhaled corticosteroids: an update, Am. J. Respir. Crit. Care Med., 157, S1, 1998. 107. Barnes, P.J., Anti-inflammatory actions of glucocorticoids: molecular mechanisms, Clin. Sci., 94, 557, 1998. 108. Barnes, P.J., Therapeutic strategies for allergic diseases, Nature, 402, B31, 1999. 109. Templin, M.V. et al., Pharmacokinetic and toxicity profile of a phosphorothioate oligonucleotide following inhalation delivery to lung in mice, Antisense Nucleic Acid Drug Dev., 10, 359, 2000. 110. Ali, S. et al., Absorption, distribution, metabolism, and excretion of a respirable antisense oligonucleotide (RASON) for asthma, Am. J. Respir. Crit. Care Med., 163, 989, 2001. 111. Karras, J., Geary, R., and Gregory, S., Inhaled antisense oligonucleotide therapies: Inspiration and progress, Drug Disc. Today: Ther. Strat., 3, 335, 2006. 112. Karras, J. et al., Anti-inflammatory activity of inhaled Interleukin-4 receptor- antisense oligonucleotide in mice, Am. J. Respir. Cell Mol. Biol., 36, 276, 2007. 113. Ball, H.A. et al., Clinical potential of respirable antisense oligonucleotides (RASONs) in asthma, Am. J. Pharmacogenomics, 3, 97, 2003. 114. Ball, H.A. et al., Sense and antisense: therapeutic potential of oligonucleotides and interference RNA in asthma and allergic disorders, Clin. Rev. Allergy Immunol., 27, 207, 2004. 115. Renzi, P., personal communication, 2006. 116. Elsner, J., Escher, S.E., and Forssmann, U., Chemokine receptor antagonists: a novel therapeutic approach in allergic diseases, Allergy, 59, 1243, 2004. 117. Metcalf, D. et al., Control of granulocytes and macrophages: molecular, cellular, and clinical aspects. Science, 254, 529, 1991. 118. Renzi, P., personal communication, 2006. 119. Gaarde, W., unpublished data, 2005. 120. Nelms, K. et al., The IL-4 receptor: Signaling mechanisms and biologic functions. Annu. Rev. Immunol., 17, 701, 1999. 121. Crosby, J.R. et al., Inhalation of an interleukin-4 receptor antisense oligonucleotide suppresses allergeninduced pulmonary inflammation and targeted protein expression in mice, Annual Meeting of the American Thoracic Society, San Diego, May 21, 2006. 122. Karras, J.G. et al., Combination studies of inhaled corticosteroid and interleukin-4 receptor- antisense oligonucleotide in mouse models of asthma/rhinitis, Strategic Research Institute’s Tenth International Inflammation and Immune Diseases Drug Discovery and Development Summit, New Brunswick, March 21, 2006. 123. Popescu, F-D., Antisense- and RNA interference-based therapeutic strategies in allergy, J. Cell. Mol. Med., 9, 840, 2005. 124. Lach-Trifilieff, E. et al., In vitro and in vivo inhibition of interleukin (IL)-5-mediated eosinopoiesis by murine IL-5R antisense oligonucleotide, Am. J. Respir. Cell Mol. Biol., 24, 116, 2001. 125. Choi, I.W., Kim, D.K., Ko, H.M., and Lee, H.K., Administration of antisense phosphorothioate oligonucleotide to the p65 subunit of NF-kappaB inhibits established asthmatic reaction in mice, Int. Immunopharmacol., 4, 1817, 2004. 126. Finotto, S. et al., Local administration of antisense phosphorothioate oligonucleotides to the c-kit ligand, stem cell factor, suppresses airway inflammation and IL-4 production in a murine model of asthma, J. Allergy Clin. Immunol., 107, 279, 2001. 127. Finotto, S. et al., Treatment of allergic airway inflammation and hyperresponsiveness by antisenseinduced local blockade of GATA-3 expression, J. Exp. Med., 193, 1247, 2001. 128. Allakhverdi Z. et al., Inhibition of antigen-induced eosinophilia and airway hyperresponsiveness by antisense oligonucleotides directed against the common chain of IL-3, IL-5, GM-CSF receptors in a rat model of allergic asthma, Am. J. Respir. Crit. Care Med., 165, 1015, 2002.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM


Page 695

695

129. Stenton, G.R. et al., Aerosolized Syk antisense suppresses Syk expression, mediator release from macrophages, and pulmonary inflammation, J. Immunol., 164, 3790, 2000. 130. Stenton, G.R. et al., Inhibition of allergic inflammation in the airways using aerosolized antisense to Syk kinase, J. Immunol., 169, 1028, 2002. 131. Nyce, J.W. and Metzger, W.J., DNA antisense therapy for asthma in an animal model, Nature, 385, 721, 1997. 132. Duan, W. et al., Inhaled p38 mitogen-activated protein kinase antisense oligonucleotide attenuates asthma in mice, Am. J. Respir. Crit. Care Med., 171, 571, 2005. 133. Karras, J.G. et al., Anti-inflammatory activity of inhaled p38-MAPK antisense in mouse models of asthma, Strategic Research Institute’s Protein Phosphorylation Drug Discovery World Summit, La Jolla, March 1, 2005. 134. Guha, M. et al., An aerosolized IL-4R antisense oligonucleotide (ASO) reduces target gene expression on epithelial and inflammatory cells and suppresses the pulmonary response to allergen in mice, Strategic Research Institute’s Ninth International Inflammation and Immune Diseases Drug Discovery and Development Summit, Philadelphia, March 15, 2005. 135. Kumar, R.K. et al., Effects of anticytokine therapy in a mouse model of chronic asthma, Am. J. Respir. Crit. Care Med., 170, 1043, 2004. 136. Hahn, C. et al., Inhibition of the IL-4/IL-13 receptor system prevents allergic sensitization without affecting established allergy in a mouse model for allergic asthma, J. Allergy Clin. Immunol., 111, 1361, 2003. 137. Crosby, J.R. et al., Inhaled TNF antisense oligonucleotide inhibits lung inflammation and airway hyper-responsiveness in a mouse model of chronic asthma, American Thoracic Society Annual Meeting, San Diego, May 25, 2005. 138. Stepkowski, S.M., Development of antisense oligodeoxynucleotides for transplantation, Curr. Opin. Mol. Ther., 2, 304, 2000. 139. Katz, S.M. et al., ICAM-1 antisense oligodeoxynucleotide improves islet allograft survival and function, Cell Transplant, 9, 817, 2000. 140. Chen, W. et al., Methoxyethyl-modified Intercellular Adhesion Molecule-1 antisense phosphorothioate oligonucleotides inhibit allograft rejection, ischemic-reperfusion injury, and Cyclosporine-induced nephrotoxicity, Transplantation, 79, 401, 2005. 141. Okada, M. et al., Extinguishing Egr-1-dependent inflammatory and thrombotic cascades after lung transplantation, FASEB J., 15, 2757, 2001. 142. Lewis, E.C. et al. Involvement of graft-derived interleukin-15 islet allograft rejection in mice, Cytokine, 34, 106, 2006. 143. Yoshizumi, T. et al., Tumor necrosis factor- antisense transfer remarkably improves hepatic graft viability, Liver Int., 26, 451, 2006. 144. Kirkiles-Smith, N.C. et al., IL-11 protects human microvascular endothelium from alloinjury in vivo by induction of survivin expression, J. Immunol., 172, 1391, 2004. 145. Emanuele, N.V. et al., Rat spleen lymphocytes contain an immunoreactive and bioactive luteinizing hormone-releasing hormone, Endocrinology, 126, 2482, 1990. 146. Jacobson, J.D. et al., Gender-specific exacerbation of murine lupus by gonadotropin-releasing hormone: potential role of Gq/11, Endocrinology, 140, 3429, 1999. 147. Ansari, M.A. et al., Administration of antisense oligonucleotides to GQ/11 reduces the severity of murine lupus, Biochemie, 85, 627, 2003. 148. Reichling, D.B. and Levine, J.D., Peripheral mechanisms of inflammatory pain. In Textbook of Pain, R. Melzack, ed. Edinburgh: Churchill Livingstone, 1999, pp. 59–84. 149. Sun, T. et al., Alleviation of neuropathic pain by intrathecal injection of antisense oligonucleotides to p65 subunit of NF-{kappa}B, Br. J. Anaesth., 97, 553, 2006. 150. Svensson, C.I. et al., Spinal p38 isoform mediates tissue injury-induced hyperalgesia and spinal sensitization, J. Neurochem., 92, 1508, 2005. 151. Parada, C.A. et al., Transient attenuation of protein kinase C can terminate a chronic hyperalgesic state in the rat, Neuroscience, 120, 219, 2003. 152. Parada, C.A. et al., Tumor necrosis factor receptor type-1 in sensory neurons contributes to induction of chronic enhancement of inflammatory hyperalgesia in rat, Eur. J. Neurosci., 17, 1847, 2003. 153. Dina, O.A. et al., Primary afferent second messenger cascades interact with specific integrin subunits in producing inflammatory hyperalgesia, Pain, 115, 191, 2005.

CRC_8796_ch024.qxd

696

6/20/2007

10:30 PM

Page 696


154. Pap, T. et al., Role of synovial fibroblasts in the pathogenesis of rheumatoid arthritis, Arthritis Res., 2, 361, 2000. 155. Nakazawa et al., Role of Notch-1 intracellular domain in activation of rheumatoid synoviocytes, Arthritis Rheum., 44, 1545, 2001. 156. Palao et al., Down-regulation of FLIP sensitizes rheumatoid synovial fibroblasts to Fas-mediated apoptosis, Arthritis Rheum., 50, 2803, 2004. 157. Hagiwara K, et al., Identification of genes upregulated in the inflamed colonic lesions of Crohn’s disease, Biochem. Biophys. Res. Commun., 283, 130, 2001. 158. Monteleone, I. et al., A functional role of FLIP in conferring resistance of Crohn’s disease lamina propria lymphocytes to FAS-mediated apoptosis. Gastroenterology, 130, 389, 2006. 159. Roumm, A.D. et al., Lymphocytes in the skin of a patient with progressive systemic sclerosis, Arthritis Rheum., 27, 645, 1984. 160. Sakai, N. et al., MCP-1/CCR2-dependent loop for fibrogenesis in human peripheral CD14-positive monocytes, J. Leukocyte Biol., 79, 555, 2006. 161. Morton, S.J. and Powell, R.J., Cyclosporin and tacrolimus: their use in a routine clinical setting for scleroderma, Rheumatology, 39, 865, 2000. 162. Carulli, M.T. et al., Chemokine receptor CCR2 expression by systemic sclerosis fibroblasts: evidence for autocrine regulation of myofibroblast differentiation, Arthritis Rheum., 52, 3772, 2005. 163. LeRoy, E.C., Increased collagen synthesis by scledroderma skin fibroblasts in vitro: a possible defect in the regulation or activation of the scleroderma fibroblast, J. Clin. Invest., 54, 880, 1974. 164. Asano, Y. et al., Increased expression of integrin v3 contributes to the establishment of autocrine TGF- signaling in scleroderma fibroblasts, J. Immunol., 175, 7708, 2005. 165. Ihn, H. et al., Blockade of endogenous transforming growth factor signaling prevents up-regulated collagen synthesis in scleroderma fibroblasts, Arthritis Rheum., 44, 474, 2001. 166. Ruth, J.H. et al., CXCL16-mediated cell recruitment to rheumatoid arthritis synovial tissue and murine lymph nodes is dependent upon the MAPK pathway, Arthritis Rheum., 54, 765, 2006. 167. Morel, J.C. et al., Interleukin-18 induces rheumatoid arthritis synovial fibroblast CXC chemokine production through NFB activation, Lab Invest., 81, 1371, 2001. 168. Morel, J.C. et al., Signal transduction pathways involved in rheumatoid arthritis synovial fibroblast interleukin-18-induced vascular cell adhesion molecule-1 expression, J. Biol. Chem., 277, 34679, 2002. 169. Suk, K. et al., IFN-/TNF- synergism as the final effector in autoimmune diabetes: A key role for STAT1/IFN regulatory factor-1 pathway in pancreatic cell death, J. Immunol., 166, 4481, 2001. 170. Monteleone, G. et al., A failure of transforming growth factor-1 negative regulation maintains sustained NF-B activation in gut inflammation, J. Biol. Chem., 279, 3925, 2004. 171. Fiset, P. et al., Modulation of allergic response in nasal mucosa by antisense oligodeoxynucleotides for IL-4, J. Allergy Clin. Immunol., 111, 580, 2003. 172. Peng Q. et al., Signaling pathways regulating interleukin-13-stimulated chemokine release from airway smooth muscle, Am. J. Respir. Crit. Care Med., 169, 596, 2003. 173. Piliponsky, A.M. et al., Non-IgE-dependent activation of human lung- and cord blood-derived mast cells is induced by eosinophil major basic protein and modulated by the membrane form of stem cell factor, Blood, 101, 1898, 2003. 174. Cua, D.J. et al., Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain, Nature, 421, 744, 2003. 175. Vaknin-Dembinsky, A. et al., IL-23 is increased in dendritic cells in multiple sclerosis and downregulation of IL-23 by antisense oligos increases dendritic cell IL-10 production, J. Immunol., 176, 7768, 2006. 176. Clare-Salzler, M.J. et al., Prevention of diabetes in nonobese diabetic mice by dendritic cell transfer, J. Clin. Invest., 90, 741, 1992. 177. Machen J, et al., Antisense oligonucleotides down-regulating costimulation confer diabetes-preventive properties to nonobese diabetic mouse dendritic cells, J. Immunol. 173, 4331, 2004. 178. Ina, K. et al., Intestinal fibroblast-derived IL-10 increases survival of mucosal T cells by inhibiting growth factor deprivation- and Fas-mediated apoptosis, J. Immunol., 175, 2000, 2005. 179. Ratta, M. et al., Dendritic cells are functionally defective in multiple myeloma: the role of interleukin-6, Blood, 100, 230, 2002.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM


Page 697

697

180. Melani, C. et al., Myeloid cell expansion elicited by the progression of spontaneous mammary carcinomas in c-erbB-2 transgenic BALB/c mice suppresses immune reactivity, Blood, 102, 2138, 2003. 181. Wang, T. et al., Regulation of the innate and adaptive immune response by Stat-3 signaling in tumor cells, Nat. Med., 10, 48, 2004. 182. Kortylewski, M. et al., Inhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity, Nat. Med., 11, 1314, 2005. 183. Niu, G. et al., Over expression of a dominant-negative signal transducer and activator of transcription 3 variant in tumor cells leads to production of soluble factors that induce apoptosis and cell cycle arrest, Cancer Res., 61, 3276, 2001. 184. Gorczynski, R.M. et al., MD1 expression regulates development of regulatory T cells, J. Immunol., 177, 1078, 2006.

CRC_8796_ch024.qxd

6/20/2007

10:30 PM

Page 698

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 699

CHAPTER

25

Antisense Oligonucleotides for the Treatment of Cancer Boris A. Hadaschik and Martin E. Gleave

CONTENTS 25.1 Introduction .........................................................................................................................699 25.2 Antisense Targets in Cancer ................................................................................................700 25.2.1 BCL2 and BCL-xL................................................................................................701 25.2.2 Survivin and XIAP ................................................................................................704 25.2.3 Protein Kinase C- and RAF1 ..............................................................................705 25.2.4 Clusterin ................................................................................................................706 25.2.5 HSP27....................................................................................................................708 25.2.6 STAT3....................................................................................................................709 25.2.7 Insulin Growth Factor Binding Proteins ...............................................................710 25.2.8 Ribonucleotide Reductase .....................................................................................710 25.2.9 Other Promising ASO ...........................................................................................711 25.3 Summary .............................................................................................................................711 References ......................................................................................................................................712 25.1 INTRODUCTION The development of therapeutic resistance is the underlying basis for most cancer deaths and therefore of great interest in medical research. Despite the introduction of a number of new agents, cure for advanced tumors remains infrequent and a distant goal. For example, prostate cancer is the most common cancer and the third most common cause of cancer related mortality in men in the United States [1]. While early detection has increased with the advent of serum prostate-specific antigen (PSA) testing, the disease is often advanced when patients present with symptoms. For those with metastatic disease, androgen withdrawal is the most effective form of systemic therapy. Unfortunately, caused by clonal selection and adaptive responses androgen-independent progression is inevitable and death occurs within a few years in the majority of cases [2]. Historically, chemotherapy was thought to have minimal clinical efficacy. However, more recently for docetaxelbased chemotherapy a 20% prolongation in survival was demonstrated [3,4]. These improvements are significant but modest, since median survival for patients with hormone-refractory prostate cancer (HRPC) is still only 18 months. 699

CRC_8796_ch025.qxd

700

6/20/2007

10:39 PM

Page 700


Therapeutic resistance results from multiple, stepwise changes in DNA structure and gene expression—a Darwinian interplay of genetic and epigenetic factors, arising in part from selective pressures of treatment. This highly dynamic process cannot be attributed to singular genetic events, involving instead cumulative changes in gene expression that facilitate escape from normal regulatory control of cell growth and survival. In prostate cancer, for instance, changes in the hormonal environment precipitate a cascade of events in gene expression and signaling networks that provide a selective survival and growth advantage for subpopulations of tumor cells, thereby accelerating androgen-independent progression and rendering cells more resistant to chemotherapy. New therapeutic strategies designed to inhibit the emergence of this phenotype must be developed. Over the last years and fueled from the development of high-throughput genomic, transcriptomic, and proteomic technologies, increased understanding of the molecular basis for cancer progression and therapeutic resistance has identified many gene targets that regulate apoptosis, proliferation, and cell signaling. Since many of these gene products are not easily amenable to agents like small molecules or antibodies, antisense inhibition is an attractive concept. Antisense oligonucleotides (ASOs) offer a tool for the selective silencing of their targets at the gene expression level. Like antibody-based therapeutics, which evolved to become a clinically useful therapeutic class through years of optimization, ASOs are evolving through chemical modifications to prolong in vivo half-life, improve tissue distribution, increase potency and reduce off-target toxicity. ASOs promise good specificity for malignant cells and favorable side-effect profiles due to well-defined modes of action. Indeed, recent clinical trials confirm the ability of this class of drugs to significantly suppress target gene expression in cancer tissues. In this chapter, the current status and future directions of several antisense drugs that have potential clinical use in cancer are reviewed. The chemistry and clinical safety profiles are described elsewhere in this volume. Owing to the rapid progress of the antisense field it is beyond the scope of this review to cover all targets in development. Since the power of siRNA for systemic in vivo applications remains to be determined, we will focus on ASO anticancer drugs. Particular emphasis will be placed on interpreting the recent phase III trial failures of several ASO compounds, and on highlighting advances that promise to overcome the hurdles that confront nucleotide-based therapeutics on their way to become successful treatment options in oncology.

25.2 ANTISENSE TARGETS IN CANCER Advances in tumor biology have identified many attractive molecular targets for new drug discovery. The most promising candidates for antisense therapy are those targets that become upregulated during and are causally related to cancer progression and therapeutic resistance, and not otherwise amendable to inhibition with antibodies or small molecules. Moreover, the target should be selectively overexpressed in tumor cells to minimize side effects as tumor-selective uptake of ASOs cannot be ensured by standard protocols. Although potential gene target libraries developed by microarray technology are valuable, this information must be balanced by the inherent limitations of microarray analyses. These include the inability to examine translational and posttranslational regulatory mechanisms that impact the activity of various cellular proteins. In our laboratory, one method of identifying potential therapeutic targets for prostate cancer starts with use of comparative hybridization of high-density cDNA arrays to rapidly and efficiently characterize changes in gene expression after androgen withdrawal in xenograft models that mimic the human condition of castration-induced regression followed by androgen-independent progression. Computer-assisted subtractive analyses of arrays highlight increases or decreases in gene expression at various time points during progression. Northern or Western analysis is then used to confirm the array data which can be verified in human tissue microarrays of untreated and posthormone therapy-treated cancers. Figure 25.1 shows some targets validated by this strategy.

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 701

ANTISENSE OLIGONUCLEOTIDES FOR THE TREATMENT OF CANCER Androgen-dependent growth

Androgen-independent growth

Regression Hormone withdrawal

701

Progression

Clonal selection + adaptive responses ++ PSA ++ AR - BCL2 - Clusterin - IGFBP-5 - YB1 ++ Survivin - HSP27

- PSA - AR ++ BCL2 +++ Clusterin ++++ IGFBP-5 + YB1 - Survivin + HSP27

++ PSA ++ AR ++ BCL2 +++ Clusterin ++ IGFBP-5 ++ YB1 ++ Survivin +++ HSP27

Figure 25.1 Changes in gene expression of prostate cancer after castration-induced regression and during androgen-independent progression.

ASOs have been reported to specifically silence the expression of many different genes and delay tumor progression in various preclinical and some clinical models. ASO drugs that target the apoptotic rheostat, interfere with signaling pathways involved in cell proliferation and growth, or target the tumor’s microvasculature, are particularly promising not only as single agents, but in combination with conventional anticancer treatments. A survey of a number of ASO drugs in clinical development is given in Table 25.1 and several compounds are highlighted below. 25.2.1 BCL2 and BCL-xL Apoptotic pathways, which are well modulated and strictly controlled in nonmalignant cells, are frequently disrupted in tumor cells. This dysregulation of apoptosis is mainly affected by members of two families of antiapoptotic factors: the BCL2 family and the inhibitors of apoptosis (IAP) gene family. The BCL2 gene (B-cell leukemia-lymphoma gene 2) is the prototype of a class of oncogenes that contribute to neoplastic progression by enhancing cell survival through inhibition of apoptosis. Initially identified in follicular lymphoma due to the characteristic t14;18 translocation, BCL2 is a mitochondrial membrane protein that functions to stabilize the mitochondrial membrane, thereby inhibiting the release of cytochrome c and subsequent activation of the apoptotic cascade [5,6]. BCL2 heterodimerizes with BAX and other proapoptotic regulators and the selective and competitive dimerization between pairs of these antagonists and agonists determines how a cell responds to an apoptotic signal. Several lines of evidence have implicated overexpression of BCL2 with treatment resistance [7–10], highlighting BCL2 as an attractive target to improve the efficacy of conventional treatment by enhancing chemotherapy-induced apoptosis. Several BCL2 ASOs have been reported good hormone or chemosensitization activity in many preclinical models [11–15]. G3139, also referred to as oblimersen sodium or Genasense (Genta Inc.), is a first-generation 18-mer phosphorothioate ASO complimentary to the first six codons of the initiating sequence of the human BCL2 mRNA. G3139 moved into clinical trials based on promising activity in preclinical models of many cancers [12,13]. In 1997, the first clinical study evaluating G3139 enrolled 21 patients with non-Hodgkin’s lymphoma (NHL) and treated them with subcutaneous infusion of G3139 as a single agent [16]. Local inflammation at the infusion site was the most common side effect observed, while the maximum-tolerated dose was determined to be 147.2 mg/m2/d and

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 702

702


Table 25.1 Anticancer Oligonucleotides in Late-Stage Pre-Clinical or Clinical Development Company/ Investigator

Phase of Development

Target

Compound

BCL2

G3139 (Oblimersen, Genasense)

Genta

II–III

Melanoma, AML, CLL, MM, NHL, HRPC, NSCLC, SCLC

Tumor Type

PKC

ISIS 3521 (Affinitak, Aprinocarsen)

Lilly/Isis

II–III

NSCLC, colon, ovarian, NHL, prostate

CLU

OGX-011

OncoGeneX

II

HRPC, breast, NSCLC

RAF1

ISIS 5132

Isis

II

NSCLC, colon, prostate

HRAS

ISIS 2503

Isis

II

NSCLC, breast, pancreas

DNA Methyltransferase

MG98

MethylGene

II

Metastatic renal cancer, head, and neck cancer

Protein kinase A

GEM231

Hybridon/Idera

II

SCLC, colon, pancreas, prostate

RNR (R1 and R2 component) TGF2

GTI-2501, GTI-2040 AP12009

Lorus

I–II

Antisense Pharma

I–II

HRPC, renal cell, breast Glioma, pancreas, melanoma-

Survivin

LY2181308/ISIS 23722

Lilly/Isis

I

cMYB

LR3001

Genta

I

CML

XIAP

AEG35156/GEM 640

Aegera

I

Solid tumors

HSP27

OGX-427

OncoGeneX

I

HRPC

eIF4E

LY2275796

Lilly/Isis

Preclinical-I

Xenografts (broad)

STAT3

ISIS 345794

Isis

Preclinical

Xenografts (broad), MM

MDM2

GEM240

Hybridon/Idera

Preclinical

Xenografts (broad)

IGFBP-2 + IGFBP-5

OGX-225

OncoGeneX

Preclinical

HRPC, breast, glioma

MCL1

ISIS 20408

Isis

Preclinical

Xenografts (broad)

Solid tumors

dose-limiting toxicity was thrombocytopenia. One complete response and two minor responses were observed, but only half of the evaluable patients had measurable decreases in BCL2 protein levels following treatment with G3139 and there was no apparent relationship to the dose [17]. Subsequent clinical trials of G3139 employed continuous intravenous (i.v.) infusions necessitated by the short tissue half-life of first-generation phosphorothioate ASOs, most often in combination with another cytotoxic agent. In a phase I/II trial in patients with advanced melanoma, continuous i.v. infusion of G3139 in combination with full-dose dacarbazine (DTIC) reduced BCL2 protein levels in serial melanoma biopsies, and this pharmacodynamic activity was associated with significant clinical responses [18]. Transient thrombocytopenia at 12 mg/kg/d was dose limiting in patients who also received full-dose DTIC treatment. An international, phase III, randomized trial was recently completed in patients with advanced melanoma using a 5-day pretreatment regimen of 7 mg/kg/d G3139 administered by continuous i.v. infusion followed by DTIC at 1000 mg/m2 [19,20]. Analysis on an intent-to-treat (ITT) basis after a minimum follow-up of 24 months reported a median survival of 9 months in patients treated with G3139 plus dacarbazine, compared with 7.8 months for dacarbazine alone (n ⫽ 771, p ⫽ 0.077). The addition of G3139 to dacarbazine significantly improved median progression-free survival (2.6 versus 1.6 months, p ⬍ 0.001) and

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 703

ANTISENSE OLIGONUCLEOTIDES FOR THE TREATMENT OF CANCER

703

overall response rates (13.5 versus 7.5%, p ⫽ 0.007). However, this drug failed to obtain FDA approval because overall survival of the ITT population was not significantly prolonged, and the increased time to progression was not deemed clinically significant. Results of a phase III trial of G3139 in combination with fludarabine and cyclophosphamide (Flu/Cy) in patients with advanced chronic lymphocytic leukemia (CLL) were presented in 2004 [21]. In this trial, 120 patients were randomized to receive Flu/Cy with or without G3139 at 3 mg/kg/d continuous i.v. infusion (day 1-7). This dose of G3139, which is significantly lower than doses used in other trials in solid tumors with lower tumor burden, based on phase I/II studies in CLL patients that showed dose-limiting development of a cytokine release syndrome and modest single-agent activity [22,23]. Patients in the phase III trial had failed prior therapy and the primary endpoint of this study was complete response plus nodular partial response. Nineteen patients (16%) treated with G3139 plus Flu/Cy achieved the primary endpoint, compared with eight patients (7%) treated with Flu/Cy alone ( p ⫽ 0.039). However, the overall response rate was similar between the treatment groups when partial responders were included. G3139 was generally well tolerated, with specific adverse events associated with G3139 treatment being nausea, fever, fatigue, and back pain. According to the manufacturer, the FDA will review G3139 as treatment for CLL by the end of October 2006 (www.genta.com). At time of submission of this chapter however, the Oncologic Drugs Advisory Committee voted not to recommend approval of Genasense. The results of a phase III trial of G3139 in combination with high-dose dexamethasone in patients with refractory multiple myeloma (MM) has also been disclosed [24]. In this trial, 224 patients were randomized to receive standard therapy using high-dose dexamethasone with or without 7 mg/kg/d G3139. The primary objective of the study was to evaluate whether addition of G3139 would significantly increase the time to progression, with monitoring of secondary endpoints that included objective response and overall clinical benefit. Prior to entering the study, patients in both groups had received extensive treatment with corticosteroids. No clinical benefit was observed in this trial for patients receiving G3139 plus dexamethasone versus dexamethasone alone. The median time to progression was similar for both treatments and no difference was observed in response rates or toxicity between the groups. Several trials in hormone refractory prostate cancer demonstrated that standard doses of docetaxel or mitoxantrone could be delivered with G3139 without apparent increased toxicity [25,26]. A lately reported phase II trial in men with metastatic hormone refractory prostate cancer combined G3139 (7 mg/kg/d for 7 days) with docetaxel (75 mg/m2 on day 6), repeated every 21 days until progression or toxicity. Partial responses were noted in 4 of 12 patients with measurable disease and a ⬎50% reduction in PSA was measured in 15 of 27 patients [26]. On the basis of this phase II data, a randomized phase III trial was scheduled, but with the negative results from trials in melanoma and myeloma, and the subsequent breakup of the Aventis/Genta partnership, this trial has been put on hold. Issues persist about the regimen of G3139, and whether treatment at the doses and schedules tested is enough to suppress target gene expression sufficiently. Moreover, Anderson et al. [27] demonstrated recently using microarray studies that the mechanism by which G3139 produces cytostatic effects might not only be related to BCL2. While both the first-generation ASO and BCL2 targeting siRNA strongly downregulated BCL2 expression in vitro, the effects of these two classes of molecules on cell proliferation and apoptosis were distinct, suggesting that the mechanism of action of G3139 was not exclusively the result of its target-specific action on BCL2. Application of their approach that combines ASO and siRNA with gene expression profiling may be used to assess validity of new drug candidates in the future. BCL-xL is another antiapoptotic BCL2 family member. In tumors where BCL2 and BCL-xL are coexpressed, it is difficult to predict which of the two proteins is more critical for survival and some tumor cells have been reported to switch expression from BCL2 to BCL-xL [28,29]. ASOs against BCL-xL have been reported to induce apoptosis in various tumor cells and sensitize tumor cells to chemotherapy [30–35]. While BCL-xL ASO marginally enhanced chemosensitivity and

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

704

Page 704


delayed androgen-independent progression of prostate cancer xenografts, combined BCL-xL plus BCL2 ASOs acted synergistically to improve efficacy of chemotherapy beyond that of either agent alone [36]. Simultaneous downregulation of both BCL2 and BCL-xL protein expression by a single bispecific ASO has been accomplished by taking advantage of the similarity of specific regions of BCL2 and BCL-xL mRNA. This bispecific second-generation 2⬘-O-methoxyethyl (2⬘-MOE) modified ASO with complete sequence identity to BCL2 and three mismatches to BCL-xL inhibits expression of both BCL2 and BCL-xL in tumor cells and is a potent inducer of apoptosis in several tumor cell types [37–39]. Future development plans for this particular ASO are yet unknown, but the reported findings illustrate that combination regimen that inhibit two or more specific gene targets can produce additive effects. Recently, small molecule inhibitors against antiapoptotic BCL2 family members have been developed [40] and several are in early phase clinical trials. This further raises the possibility of strategies, in which a small molecule inhibitor is combined with antisense gene suppression of BCL2 family members. 25.2.2 Survivin and XIAP The inhibitors of apoptosis (IAP) gene family encodes proteins that protect cells from undergoing apoptosis through, at least in part, inhibition of caspases which are key effector proteins of apoptotic cell death [41–44]. In addition, IAPs have roles in seemingly caspase-unrelated functions including cell division and signaling [45–47]. IAPs have been found to be expressed in multiple malignancies including human prostate cancer [48] and limited expression in normal tissues. Second-generation ASOs have been designed against two IAP family members: Survivin (LY2181308/ISIS 23722, Eli Lilly and Co. in collaboration with Isis Pharmaceuticals) and X-linked IAP (AEG35156/GEM640, Aegera Therapeutics Inc.). Survivin plays an important role in both cell growth and apoptosis inhibition [49,50]. Survivin is highly expressed in a wide variety of human cancer types, including lung, colon, pancreas, prostate, breast, and gastric tumors [49,51]. However, Survivin is generally not expressed in differentiated normal tissue, with expression limited to a few cell types including angiogenic endothelium, thymus, testis, activated T cells and intestinal epithelium crypts. Survivin levels correlate with lower apoptotic index in tumor cells and poor prognosis in cancer patients [52,53], and gene expression studies have indicated that Survivin is one of the top genes uniformly expressed in cancer cells but not in normal tissues [54]. Furthermore, overexpression of Survivin in tumor cells inhibits chemotherapy-induced, BAX-induced, and FAS-induced apoptosis, and expression of dominant negative mutants of Survivin induces apoptosis in many tumor cell lines [55,56]. Taken together, these observations make Survivin an obvious target for novel cancer therapy. LY2181308/ISIS 23722 is a second-generation 2⬘-MOE ASO that potently and specifically downregulates Survivin expression in a broad range of human cancer cells including lung, colon, pancreas, breast, and prostate [57,58]. Survivin inhibition in tumor cells by LY2181308 results in caspase-3-dependent apoptosis, cell cycle arrest in the G2/M phase, and in sensitization of tumor cells to chemotherapy-induced apoptosis [57–60]. Moreover, LY2181308 has been reported to produce potent antitumor activity against a broad range of tumor types in human tumor xenograft models (www.isispharm.com). Anticancer activity displayed by LY2181308 in these models is sequence-specific and associated with reduced Survivin levels. On the basis of these preclinical results, LY2181308 has been selected for clinical development and phase I studies have been initiated against a broad range of human cancers. The X-linked mammalian inhibitor of apoptosis protein (XIAP) was the first IAP identified and has been shown to bind several partners. By inhibiting caspase-3, -7 and -9 activity, XIAP suppresses apoptosis triggered by multiple stimuli: intrinsic—mitochondrial-mediated—as well as extrinsic—death receptor-mediated. Overexpression of XIAP reduces apoptosis arising from chemotherapy, radiation, and growth factor deprivation [43,46,61]. XIAP antisense knockdown in

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 705


705

cancer cells under stress and primed for apoptosis (e.g., when challenged by chemotherapeutic agents), enhances proapoptotic signals and tips the apoptotic rheostat towards death. XIAP is highly expressed in acute myeloid leukemia (AML), glioblastoma, prostate, pancreatic, gastric, and colorectal tumors [47]. In AML, this overexpression has been associated with poor clinical outcome. AEG35156/GEM640 (Aegera Therapeutics Inc.) is a 19-mer ASO targeted to human XIAP mRNA that incorporates 2⬘-O-methyl chemistry with a phosphorothioate backbone. In vitro and in vivo preclinical proof-of-concept studies have demonstrated that inhibition of XIAP protein expression by AEG35156/GEM640 enhances the antitumor activity of chemotherapy in several xenograft models [62,63]. A phase I dose-escalation tolerability study of AEG35156 as a single agent is currently underway in the United Kingdom as a 7-day continuous i.v. infusion in patients with advanced tumors and phase I trials evaluating shorter infusion schedules in combination with docetaxel or reinduction chemotherapy for AML are also recruiting patients. In addition to standard safety and efficacy endpoints, these trials will also measure pharmacodynamic endpoints [64]. and RAF1 25.2.3 Protein Kinase C- ISIS 3521 and ISIS 5132 (Isis Pharmaceuticals) are first-generation phosphorothioate ASOs directed against the mRNA of Protein kinase C- [PKC] and RAF1, respectively. Protein kinase C (PKC) belongs to a class of serine threonine kinases that adjust numerous intracellular responses arising from G-protein-coupled receptors, receptors with tyrosine kinase activity and nonreceptor tyrosine kinases [65]. Increased PKC expression has been implicated in both oncogenesis and tumor progression [66,67]. PKC inhibitors affect growth and survival of tumors, promote apoptosis, and sensitize tumor cells to chemotherapeutic agents [68,69]. ISIS 3521 (also referred to as LY900003 or Affinitak or Aprinocarsen) potently inhibits PKC expression in a wide range of human tumor types in an isoform-specific manner [70,71]. Systemic administration of ISIS 3521 to nude mice bearing subcutaneously implanted human tumors suppresses PKC levels in tumor tissue and inhibits tumor growth of numerous human tumor cell lines, including glioblastoma, breast, pancreatic and lung carcinoma [72–74]. On the basis of the biological evidence implicating PKCs in human tumorigenesis, and the preclinical activity of ISIS 3521 clinical trials were initiated for the treatment of cancer. In phase I single-agent studies of ISIS 3521 [75,76], responses were noted in two patients with low-grade non-NHL and three patients with ovarian cancer. Dose-limiting toxicities were thrombocytopenia and fatigue at a dose of 3.0 mg/kg/d, and the recommended phase II dose was 2 mg/kg/d via continuous i.v. infusion. Toxicity at this dose appeared mild, with one of six patients developing grade 3 thrombocytopenia. A similar phase I clinical study using ISIS 5132, a first-generation ASO targeted to the MAP kinase signaling pathway protein RAF1 [77], escalated doses up to 5 mg/kg/d without reaching a maximum tolerated dose [78]. The difference in apparent tolerability of ISIS 3521 and ISIS 5132 is not clear, and may not even be real, since it may reflect nondrug related adverse events, or differences in patient population. Nevertheless, based in part on these observations and on preclinical models demonstrating activity at equivalent dosing, the phase II dose for ISIS 3521 as well as ISIS 5132 was set to 2 mg/kg/d. Both agents were compared in a National Cancer Institute of Canada randomized phase II trial in patients with hormone-refractory prostate cancer [79]. Scheduling for both ASOs was 2 mg/kg/d for 21 days by continuous infusion followed by a 7-day rest period. Overall, treatment was well tolerated, with fatigue and mild thrombocytopenia as the main treatment-related adverse events. However, although some patients had stable disease, no biochemical or objective responses were observed. A following phase I/II combination trial tested ISIS 3521 at 2 mg/kg/d by continuous infusion on days 0–14 with cisplatin at 80 mg/m2 (day 1) and gemcitabine at 1000 mg/m2 (day 1 and 8) [80] in 55 chemotherapy-naïve patients with advanced nonsmall cell lung cancer (NSCLC). Sixteen of 48 evaluable patients had a response (1 complete response and 15 partial responses). The median survival time for the entire group of 55 patients was 8.9 months and 10.5 months for the 45 patients receiving ⱖ 2 full cycles

CRC_8796_ch025.qxd

6/20/2007

706

10:39 PM

Page 706


of treatment. Toxicity was moderate but included thrombocytopenia, neutropenia, anemia, fatigue, dehydration, sepsis, and neutropenic fever. On the basis of this phase II data and another combination study by Yuen et al. [81] with carboplatin and paclitaxel that had a reported 42% response, two large randomized phase III trials were conducted as first line treatment in patients with NSCLC. The first enrolled 600 patients using ISIS 3521 in combination with carboplatin and paclitaxel in patients with Stage IV NSCLC, and the results were disappointing [82]. No difference was observed in time to progression or overall survival between groups. There were, however, indications of antitumor activity, as patients who completed the prescribed course of therapy (6 cycles) receiving ISIS 3521 had a median survival of 17.4 months compared to 14.3 months in patients who did not ( p ⫽ 0.048). Negative results were also obtained in the other phase III NSCLC trial testing ISIS 3521 in combination with gemcitabine and cisplatin. Therapy was fairly well tolerated, but median survival was 10 months in both groups [83]. Several factors may have accounted for the lack of clinical efficacy for ISIS 3521. First, because measuring target levels in tumors is difficult in this patient population, patients were not screened and it is unknown whether the target was actually expressed in the majority of patients. Therefore the target itself may not have been relevant in the studied cohort. Moreover, recent preclinical data suggests that in NSCLC other PKC isoforms than PKC may be a driving force for cancer cell survival [84]. Secondly, inhibition of PKC may not produce a large enough effect on tumor growth and only result in a cytostatic effect, which the study design would not detect. Third, inhibiting a single molecular target may be insufficient to exert a clinically detectable effect beyond what can be achieved with combination chemotherapy alone. Finally, since target knockdown was not assessed, the dose of ASO used may not have been the optimal biological dose and hence not potent enough to inhibit PKC expression sufficiently. Longer-lived second-generation chemistry or higher doses may have been required to produce anticancer activity and efficacy. 25.2.4 Clusterin The Clusterin gene encodes a cytoprotective chaperone protein also known as testosteronerepressed prostate message-2, apolipoprotein J, or sulphated glycoprotein-2. It is a secretory heterodimeric disulphide-linked glycoprotein that is expressed in virtually all tissues, and found in all human fluids at relatively high concentrations [85–87]. Clusterin (CLU) was first described for its ability to cause clustering of a variety of cell types. Since then it has been revealed to be involved in a variety of physiological processes relevant for carcinogenesis including apoptotic cell death, cell cycle regulation, DNA repair, cell adhesion, tissue remodeling, lipid transportation, membrane recycling, as well as immune system and complement regulation. Because CLU binds to numerous biological ligands, and is regulated by heat shock transcription factor 1, an emerging view suggests that Clusterin functions similarly to the small heat shock proteins and stabilizes conformations of proteins at times of cellular stress [88]. Indeed, CLU is substantially more potent than other heat shock proteins at inhibiting stress-induced protein precipitation [89]. Significant differences exist, however, in amino acid sequence, which suggests that Clusterin is a unique protein without any closely related family members yet identified. Increased CLU mRNA and protein levels have been consistently detected in various tissues undergoing stress, including heart, brain, liver, kidney, breast, and retinal tissues [90]. Several observations have indicated an association of CLU expression with contradictory functions, either cell survival, tumor progression, treatment resistance or apoptosis [85,91–95]. These opposing functions are likely attributed to two functionally divergent CLU protein isoforms, a secreted glycosylated form (sCLU), and a nonglycosylated nuclear form (nCLU). sCLU is a highly conserved 80 kDa heterodimer comprised of 40 and 60 kDa subunits derived from the first AUG codon of the full-length Clusterin mRNA, while the other isoform starts from the second AUG codon and therefore omits the endoplasmic reticulum-targeting signal. nCLU is a 55-kDa protein, which translocates from the cytoplasm to the nucleus following several cytotoxic stimuli. It has been suggested that tumor cell survival is connected with overexpression of the

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 707


707

prosurvival form (sCLU) and loss of the proapoptotic form (nCLU) [86,90]. Clusterin upregulation has been reported in many varied human malignancies including lymphoma [96], prostate [97], breast [98], bladder [99], kidney [100], and colon cancers [86]. Overexpression of sCLU protects cells from a variety of agents that otherwise induce apoptosis. For example, Clusterin levels increase dramatically in response to castration-induced apoptosis in rat prostate epithelial cells [101], androgen-dependent mouse Shionogi tumors [95,102], and human prostate cancer xenografts [103]. In patients, Clusterin levels are low in hormone-naïve tissue, but increase significantly within weeks after neoadjuvant hormone therapy [104]. CLU has also been shown to suppress apoptotic cell death from cytotoxic chemotherapy [105,106], radiation [93,107], and oxidative stress [92]. Consequently, CLU gene silencing is an attractive anticancer therapeutic. OGX-011 (OncoGeneX Technologies Inc.) is a second-generation ASO complementary to the translation-initiation site of human Clusterin mRNA. OGX-011 incorporates a phosphorothioate backbone with 2⬘-MOE modifications to the four bases on either end of the 21-mer molecule [108]. Such gapmer modifications maintain the improved tissue pharmacokinetic profile of the secondgeneration chemistry but preserve the high affinity for target mRNA and the recruitment of RNase H necessary for activity. In primates, tissue half-life of OGX-011 was in the order of 7 days, and intermittent schedules of OGX-011 were therapeutically equivalent to continuous dosing of unmodified phosphorothioate CLU ASO. Therefore, more relaxed dosing schedules are possible while maintaining biologic efficacy of target inhibition. In prostate cancer models, OGX-011 improved the efficiency of androgen withdrawal, chemotherapy, and radiation by silencing of Clusterin and enhancing the apoptotic response [93,95,106]. Additional preclinical activity was reported in lung [109], renal cell [110], urothelial [111], osteosarcoma [85], and breast [112] cancers. In a phase I clinical trial, OGX-011 was recently reported to potently suppress CLU expression in prostate cancer tissues in combination with androgen deprivation therapy [113]. This trial had a unique design in that patients with localized prostate cancer were administered OGX-011 prior to radical prostatectomy, allowing for dose-dependent correlations between Clusterin expression and tissue concentrations. Surrogate tissues for markers of biological effect (CLU expression in peripheral blood mononuclear cells and serum CLU) were also assessed and could be associated with those effects found in target tissue. Thus, the presurgery study design allowed for the determination of an optimal biologically effective dose and tissue drug levels in addition to the usual parameters of toxicity. Patients having localized prostate cancer with high-risk features and candidates for prostatectomy were enrolled to this dose-escalation trial. OGX-011 was given by i.v. infusion over 2 h at a starting dose of 40 mg on days 1, 3, 5, 8, 15, 22, and 29. Androgen deprivation therapy was started on day 1 and prostatectomy was performed on days 30–36. Twenty-five patients were enrolled to six cohorts with doses of OGX-011 up to 640 mg delivered. Toxicity was mild or moderate only and adverse events included fevers, rigors, fatigue, and transient liver function elevations. Plasma pharmacokinetic analysis showed linear increases in OGX-011 with a half-life of 2 h and mean peak concentrations of 80 µM at 640 mg dose. More importantly, prostate tissue concentrations of OGX-011 increased with dose, and tissue concentrations associated with preclinical effect could be achieved and observed even 7 days after dosing. Dose-dependent decreases in prostate cancer cell CLU expression were also observed. At 640 mg dosing, CLU mRNA levels were decreased by ⬃92% compared with lower dose levels and historical controls as assessed by a quantitative RT-PCR assay of microdissected cancer cells. By immunohistochemistry, mean percentage of cancer cells staining negative for CLU at 640 mg dosing was 54% compared with 2–15% for lower dose levels and historical controls. As shown in Figure 25.2, Clusterin levels were also suppressed significantly in regional lymph tissues. This phase I trial demonstrated that OGX-011 is well tolerated and potently inhibits Clusterin expression in prostate cancers. The phase II dose for OGX-011 is now set to 640 mg based on pharmacokinetic and pharmacodynamic parameters. This is significantly higher than doses selected for G3139 and the Isis compounds reviewed above, especially when tissue exposure is considered given the prolonged tissue half-life of OGX-011, highlighting a potential explanation for the lack of demonstrated efficacy with the first-generation ASO agents. Two other phase I trials combined increasing

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

708

Page 708


(a)

(b)

(c)

Figure 25.2 (See color insert following page 270.) Immunostaining of OGX-011 drug distribution (a) and Clusterin expression (b, c) in human lymph tissue. (a) An antibody raised against the 2⬘-MOE backbone of OGX-011 enabled the immunohistochemical staining (brown) of resected human lymph tissue to verify that the drug had reached its target. (b, c) Clusterin protein expression (brown) in lymph node samples. Figure 25.2b shows an untreated control specimen while Figure 25.2c demonstrates downregulation of Clusterin in lymph tissue from a trial subject treated with OGX-011 at 640 mg dosing.

doses of OGX-011 with docetaxel in patients with metastatic breast, nonsmall cell lung, and hormone-refractory prostate cancers and with cisplatin and gemcitabine in patients with advanced NSCLC. Both confirmed the phase II dose for OGX-011 of 640 mg also in combination regimen [114,115]. Four phase II trials of OGX-011 in combination with chemotherapy are now underway in patients with prostate, breast, and lung cancers. 25.2.5 HSP27 Heat shock proteins (HSPs) were first discovered in 1962 as a set of highly conserved proteins that were induced by hyperthermia [116] and other kinds of cellular insults such as oxidative stress, activation of the FAS death receptor, and cytotoxic drugs that were subsequently reported [117–119]. They are ubiquitous proteins and have been characterized as cytoprotective molecular chaperones. The typical function of a chaperone is to assist proteins to attain their functional conformation, to mediate interaction with other proteins, and to prevent nonfunctional side reactions such as precipitation of misfolded proteins [120–122]. Mammalian HSPs have been classified into groups according to their electrophoretic characteristics. The four principal HSP families are HSP90, HSP70, HSP60, and the small HSPs including HSP27. High-molecular-weight HSPs are ATP-dependent chaperones while small HSPs act ATP independently. HSPs are important for signaling and protein traffic even in the absence of stress and regulated by specific heat shock transcription factors [123].

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 709


709

However, the need of HSPs increases markedly after environmental assaults as a defense mechanism to allow cells to survive otherwise lethal conditions. HSPs have attracted attention as new targets for cancer therapy, especially since the discovery and characterization of geldanamycin as an inhibitor of HSP90 [124] and the targeting of the Clusterin gene as discussed above, whose product has small heat shock protein-like function. High levels of HSP27 are commonly detected in many cancers including prostate [125–128], breast [129,130], ovarian [131,132], glial [133], and gastric tumors [134]. HSPs have been associated with multidrug resistance and are functionally linked to increased tumorigenicity in breast [135,136] and colon cancers [137]. Recent evidence reveals that HSP27 provides cytoprotection to cells via many complex cell survival pathways, including interference with caspase activation, modulation of oxidative stress and stabilization of the cytoskeleton [138–144]. HSP27 appears to be crucial in maintaining the balance between cell death and cell survival. Accordingly, overexpression of HSP27 contributes to disequilibrium in this balance that leads to suppression of apoptosis and resistance to treatment. Consequently, HSP27 is an important therapeutic target. To specifically silence HSP27 gene expression the use of ASO and siRNA against the human translation-initiation site is a rational approach. Rocchi et al. [145,146] showed recently using prostate cancer cell lines, that HSP27 ASOs potently reduced HSP27 levels and significantly decreased cell growth in vitro. Pretreatment of PC-3 cells with HSP27 ASO enhanced apoptosis via caspase-3 activation, supporting recent data showing that HSP27 functions as a negative regulator of cytochrome c-dependent activation of procaspase-3. Concannon et al. [140] also reported that HSP27 inhibits caspase activation by sequestering both procaspase-3 and cytochrome c. Consistent with these in vitro data, systemic administration of HSP27 ASO monotherapy suppressed PC-3 tumor growth in vivo and considerably enhanced paclitaxel efficacy. Similarly, HSP27 overexpression was reported to confer resistance to doxorubicin in breast cancer cells [147]. Overexpression of HSP27 in human prostate LNCaP cells caused these normally androgen-dependent cells to become androgen-independent and more resistant to cytotoxic chemotherapy [146]. These findings suggest that increased levels of HSP27 after androgen withdrawal provide a cytoprotective role during development of androgen independence and that ASO-induced silencing can enhance apoptosis and delay tumor progression. A second-generation MOE gapmer ASO targeting HSP27 (OGX-427, OncoGeneX Technologies Inc.) is planned to enter phase I/II clinical trials in solid cancers and multiple myeloma in 2007. 25.2.6 STAT3 The signal transducer and activator of transcription (STAT) factors function as downstream effectors of many cytokine and growth factor receptors. Upon specific receptor stimulation and dimerization, activation of the Janus tyrosine kinases or SRC family members results in the phosphorylation and activation of STAT family members [148]. Once activated, STATs dimerize and translocate to the nucleus where they bind to specific DNA regulatory elements. A critical role for STAT3 in malignant transformation was first proposed in studies demonstrating constitutive activation of STAT3 in oncogene-transformed cells [149]. Since then, an abundance of studies have presented strong evidence that persistent STAT3 signaling activity participates in malignant transformation. This consequently leads to increased expression of genes associated with proliferation, cell survival and angiogenesis [150–152], and inhibition of inflammatory signals, thereby facilitating evasion of the immune system by tumor cells [153]. On the basis of this evidence, as well as the difficulties associated with discovering small molecule inhibitors against transcription factors, antisense strategies are underway to target STAT3 as a novel approach to treat human cancers. Screening of second-generation 2⬘-MOE ASOs against human STAT3 identified a highly potent and selective ASO that inhibits STAT3 expression in vitro and in vivo (ISIS 345794, Isis Pharmaceuticals). Reduced STAT3 level promote tumor cell death and increase sensitivity to chemotherapeutic agents in a variety of tumor types in vitro and human xenograft models in vivo,

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 710

710


including multiple myeloma, melanoma, lymphoma, and prostate cancer [154,155]. ISIS 345794 has now been selected for clinical development and initiation of phase I studies is expected in the near future for the treatment of multiple myeloma, lymphoma, and other forms of cancer. 25.2.7 Insulin Growth Factor Binding Proteins Among the more promising ASO agents for prostate cancer in preclinical development are those that target the insulin-like growth factor binding proteins (IGFBPs). Insulin-like growth factor 1 (IGF1) plays an important role in the pathophysiology of prostatic disease and its activity is regulated by various factors in the microenvironment, including the IGFBPs [156,157]. In different physiological contexts, IGFBPs can either increase or decrease IGF1 signaling. After castration, the expression levels of certain IGFBPs change rapidly in the rat ventral prostate [158] and Shionogi tumors [159]. Differences in the expression of various IGFBPs in benign and malignant prostatic epithelial cells have been reported, with increases in IGFBP-2 and IGFBP-5, and decreases in IGFBP-3 in malignant versus benign cells [160]. After castration, higher levels of IGFBP-5 have been shown to be an adaptive cell survival response that helps potentiate the antiapoptotic and mitogenic effects of IGF1, thereby accelerating androgen-independent progression [161,162]. Furthermore, IGFBP-5 is present in high concentrations in bone, the most frequent site of metastases from prostate cancer. Systemic administration of IGFBP-5 ASO in mice bearing Shionogi tumors after castration attenuated castration-induced increases in IGFBP-5 and significantly delayed time to progression. IGFBP-2 expression also increases in human prostate tumors after castration and during androgen-independent progression and like IGFBP-5, appears to accelerate time to progression by enhancing IGF1 responsiveness [163]. IGFBP-2 levels have been shown to be increased in hormone-refractory clinical tumors [125] and forced overexpression of IGFBP-2 in LNCaP tumors produced an androgen-independent phenotype with a growth advantage compared to parental cells only in the absence of androgens. Moreover, IGFBP-2 ASOs decreased IGFBP-2 levels and reduced LNCaP cell growth rates in vitro and in vivo. Increased IGFBP-5 and IGFBP-2 levels after androgen ablation therefore represent adaptive mechanisms to potentiate IGF1-mediated survival and mitogenesis. The use of ASOs to target IGFBP-modulation of IGF1 signaling is undergoing further study, and a bispecific ASO that can simultaneously suppress both IGFBP-2 and IGFBP-5 is under development for clinical applications (OGX-225, OncoGeneX Technologies Inc.). 25.2.8 Ribonucleotide Reductase Ribonucleotide reductase (RNR) is an important enzyme for cell division and tumor growth that is required for the reductive conversion of ribonucleotides into deoxyribonucleotides, which is a crucial step in the synthesis and repair of DNA [164,165]. Mammalian RNR has a dimeric structure composed of two dissimilar subunits, R1 and R2, encoded on different chromosomes and each inactive on its own [166]. Both subunits consist of a nucleotide binding site (M1) and a metal binding site (M2). M1-affecting RNR inhibitors are nucleoside analogs, for example, gemcitabine. M2 contains nonheme iron and a tyrosine-free radical, which are required for the enzymatic reduction of ribonucleotides. Inhibitors of M2 act by destroying the free radical. Hydroxyurea is a clinically approved RNR inhibitor acting at the iron/free radical site, but the inhibition is reversible due to the ease in regenerating the tyrosine-free radical by mammalian cells [167]. The R1 subunit protein levels are constant during cell cycle, however, the expression of the R2 subunit increases in late G1/early S phase of the cell cycle when DNA replication occurs. The R2 subunit was also shown to be overexpressed in tumor tissues and appears to influence transformation and malignant potential of some oncogenes [165]. GTI-2501 and GTI-2040 (Lorus Therapeutics Inc.) are first-generation phosphorothioate antisense molecules that target and inhibit expression of the R1 and R2 subunit of RNR, respectively [168]. A phase I trial of GTI-2040 has been reported, and dose-limiting toxicity of hepatic enzyme elevation

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 711


711

was observed [169]. The recommended phase II dose was determined to be 185 mg/m2/d given as a 21-day continuous i.v. infusion. Phase I trials of GTI-2501 and GTI-2040 in combination with docetaxel have been completed and phase II trials of these combination regimens are underway in patients with chemotherapy-naïve HRPC. The phase II trial of GTI-2040 and docetaxel has been reported in abstract form by Sridhar et al. [170] in 2006, with 9 patients out of 22 being described as having a PSA response. GTI-2040 is also currently in a phase II clinical trial for patients with advanced or metastatic renal cell carcinoma. The study investigates the effectiveness of the combined use of GTI-2040 and capecitabine, an oral chemotherapeutic cancer treatment. Data presented from the ongoing clinical study reported that more than 50 percent of patients showed disease stabilization (www.lorusthera.com). Recently, a RT-PCR method to quantify ribonucleotide reductase M2 mRNA in tumor samples and peripheral white blood cells (WBC) from breast cancer patients treated with GTI-2040 in another phase II trial was described [171]. By providing quantitative measurement of changes in target gene expression, this method offers an opportunity to determine correlation between target response and clinical response. 25.2.9 Other Promising ASO There have been many recently published in vitro studies applying ASO technology to various targets. One of those targets, MCL1, is a member of the BCL2 protein family, and is strongly associated with suppression of tumor apoptosis and promotion of malignancy [172,173]. MCL1 is overexpressed in many human tumor specimens, and confers resistance to chemotherapy-induced apoptosis [174–176]. A second-generation 2⬘-MOE ASO (ISIS 20408) that potently inhibits MCL1 expression in a variety of human tumor cell types has been identified [177–182]. Treatment of tumor cells in vitro promotes apoptosis and sensitizes tumor cells to chemotherapy-induced apoptosis, while in vivo administration delays growth of a variety of human xenograft models. Preclinical evaluation of ISIS 20408 continues with the goal of initiating clinical trials in the near future. Members of the protooncogenic RAS family are G-proteins involved in receptor signaling pathways controlling cell growth and division. Point mutations can convert RAS proteins into constitutively activated oncogenes mediating unrestricted cell proliferation and transformation [183]. Activated HRAS is supposed to contribute to therapeutic resistance against chemotherapy and radiation [184,185]. ISIS 2503 is a first-generation ASO that binds to the translation-initiation region of the human mRNA for HRAS and has shown promising results in a couple of single agent or combination phase I/II trials [186–188]. Additional genes currently validated as targets for antisense therapy include the p53 regulator MDM2 (GEM240, Idera Pharmaceuticals Inc., formerly Hybridon Inc.) [189–191], DNA methyltransferase (MG98, MethylGene Inc.) [192,193], Protein kinase A (GEM231) [194,195], TGF2 (AP12009, Antisense-Pharma) [196], eIF4E (LY2275796, www.isispharm.com) [197], BCR-ABL [198]. HSP70 [199], cMYB [200,201], hTERT [202], VEGF [203,204], and Lipoxygenase [205].

25.3 SUMMARY Antisense inhibition of relevant genes involved in cancer progression remains an area of hope for therapeutic development. ASO technology has quickly moved from preclinical models to testing in the clinic. Challenges remain to optimize tissue exposure, cellular uptake and demonstration of mechanism and antitumor activity in the clinic. The lack of success in the recent randomized phase III trials in lung cancer, CLL, myeloma, and melanoma has dampened enthusiasm for ASO therapeutics. However, next generation ASO chemistry, such as second-generation MOE gapmers, holds significant potential advantages for patient friendly dosing and routes of administration, enhanced activity and improved toxicity profile. Similar to the difficulties in developing any of the targeted therapies, there are several issues that need to be addressed in the early phase clinical trials

CRC_8796_ch025.qxd

712

6/20/2007

10:39 PM

Page 712


of antisense therapeutics, and the failure of the first-generation ASOs in randomized trials only emphasizes this more. These issues include determination of biologically effective dose, ensuring the target is relevant in the patient population being studied, study designs that can detect meaningful cytostatic activity if appropriate, and rational use of combination strategies with study designs that will yield unambiguous endpoints. Addressing these issues early on will allow optimal use of these agents clinically and best ensure success in upcoming phase III trials. The clinical experience to date should still be considered part of the beginning of the era of antisense treatment for cancer.

REFERENCES 1. Jemal, A. et al., Cancer statistics, CA Cancer J Clin, 56, 106–130, 2006. 2. Oh, W.K., Kantoff, P.W., Management of hormone refractory prostate cancer: Current standards and future prospects, J Urol, 160, 1220–1229, 1998. 3. Tannock, I.F. et al., Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer, N Engl J Med, 351, 1502–1512, 2004. 4. Petrylak, D.P. et al., Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer, N Engl J Med, 351, 1513–1520, 2004. 5. Tsujimoto, Y., Croce, C.M., Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma, Proc Natl Acad Sci U S A, 83, 5214–5218, 1986. 6. Reed, J.C., bcl-2 and the regulation of programmed cell death, J Cell Biol, 124, 1–6, 1994. 7. Miyashita, T., Reed, J.C., bcl-2 oncoprotein blocks chemotherapy-induced apoptosis in a human leukemia cell line, Blood, 81, 151–157, 1993. 8. McDonnell, T.J. et al., Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer, Cancer Res, 52, 6940–6944, 1992. 9. Kyprianou, N. et al., bcl-2 over-expression delays radiation-induced apoptosis without affecting the clonogenic survival of human prostate cancer cells, Int J Cancer, 70, 341–348, 1997. 10. Raffo, A.J. et al., Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo, Cancer Res, 55, 4438–4445, 1995. 11. Miyake, H. et al., Antisense bcl-2 oligodeoxynucleotides inhibit progression to androgen-independence after castration in the Shionogi tumor model, Cancer Res, 59, 4030–4034, 1999. 12. Gleave, M. et al., Progression to androgen independence is delayed by adjuvant treatment with antisense Bcl-2 oligodeoxynucleotides after castration in the LNCaP prostate tumor model, Clin Cancer Res, 5, 2891–2898, 1999. 13. Jansen, B. et al., bcl-2 antisense therapy chemosensitizes human melanoma in SCID mice, Nat Med, 4, 232–234, 1998. 14. Schaaf, A. et al., Cytotoxicity of cisplatin in bladder cancer is significantly enhanced by application of bcl-2 antisense oligonucleotides, Urol Oncol, 22, 188–192, 2004. 15. Wacheck, V. et al., bcl-2 antisense oligonucleotides chemosensitize human gastric cancer in a SCID mouse xenotransplantation model, J Mol Med, 79, 587–593, 2001. 16. Webb, A. et al., bcl-2 antisense therapy in patients with non-Hodgkin lymphoma, Lancet, 349, 1137–1141, 1997. 17. Waters, J.S. et al., Phase I clinical and pharmacokinetic study of bcl-2 antisense oligonucleotide therapy in patients with non-Hodgkin’s lymphoma, J Clin Oncol, 18, 1812–1823, 2000. 18. Jansen, B. et al., Chemosensitisation of malignant melanoma by BCL2 antisense therapy, Lancet, 356, 1728–1733, 2000. 19. Millward, M.J. et al., Randomized multinational phase 3 trial of dacarbazine (DTIC) with or without Bcl-2 antisense (oblimersen sodium) in patients (pts) with advanced malignant melanoma (MM): Analysis of long-term survival, J Clin Oncol (Meeting Abstracts), 22, 7505, 2004. 20. Bedikian, A.Y. et al., Bcl-2 antisense (oblimersen sodium) plus dacarbazine in patients with advanced melanoma: The oblimersen melanoma study group, J Clin Oncol, 24, 4738–4745, 2006. 21. Rai, K.R. et al., Phase 3 randomized trial of fludarabine/cyclophosphamide chemotherapy with or without oblimersen sodium (bcl-2 antisense; genasense; G3139) for patients with relapsed or refractory chronic lymphocytic leukemia (CLL), ASH Annual Meeting Abstracts, 104, 338, 2004.

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 713


713

22. O’Brien, S.M. et al., Phase I to II multicenter Study of oblimersen sodium, a Bcl-2 antisense oligonucleotide, in patients with advanced chronic lymphocytic leukemia, J Clin Oncol, 23, 7697–7702, 2005. 23. Chanan-Khan, A.A. et al., A pilot study of genasense(R) (oblimersen sodium, Bcl-2 antisense oligonucleotide), fludarabine and rituximab in previously treated and untreated subjects with chronic lymphocytic leukemia, ASH Annual Meeting Abstracts, 104, 4827, 2004. 24. Chanan-Khan, A.A. et al., Randomized multicenter phase 3 trial of high-dose dexamethasone (dex) with or without oblimersen sodium (G3139; Bcl-2 antisense; genasense) for patients with advanced multiple myeloma (MM), ASH Annual Meeting Abstracts, 104, 1477, 2004. 25. Tolcher, A.W. et al., A phase I pharmacokinetic and biological correlative study of oblimersen sodium (genasense, g3139), an antisense oligonucleotide to the bcl-2 mRNA, and of docetaxel in patients with hormone-refractory prostate cancer, Clin Cancer Res, 10, 5048–5057, 2004. 26. Tolcher, A.W. et al., A phase II, pharmacokinetic, and biological correlative study of oblimersen sodium and docetaxel in patients with hormone-refractory prostate cancer, Clin Cancer Res, 11, 3854–3861, 2005. 27. Anderson, E.M. et al., Gene profiling study of G3139- and Bcl-2-targeting siRNAs identifies a unique G3139 molecular signature, Cancer Gene Ther, 13, 406–414, 2006. 28. Han, Z. et al., Isolation and characterization of an apoptosis-resistant variant of human leukemia HL-60 cells that has switched expression from Bcl-2 to Bcl-xL, Cancer Res, 56, 1621–1628, 1996. 29. Arriola, E.L. et al., Bcl-2 overexpression results in reciprocal downregulation of Bcl-X(L) and sensitizes human testicular germ cell tumours to chemotherapy-induced apoptosis, Oncogene, 18, 1457–1464, 1999. 30. Leech, S.H. et al., Induction of apoptosis in lung-cancer cells following bcl-xL anti-sense treatment, Int J Cancer, 86, 570–576, 2000. 31. Simoes-Wust, A.P. et al., Bcl-xl antisense treatment induces apoptosis in breast carcinoma cells, Int J Cancer, 87, 582–590, 2000. 32. Lebedeva, I. et al., Bcl-xL in prostate cancer cells: Effects of overexpression and down-regulation on chemosensitivity, Cancer Res, 60, 6052–6060, 2000. 33. Lebedeva, I. et al., Chemosensitization of bladder carcinoma cells by bcl-xL antisense oligonucleotides, J Urol, 166, 461–469, 2001. 34. Heere-Ress, E. et al., Bcl-X(L) is a chemoresistance factor in human melanoma cells that can be inhibited by antisense therapy, Int J Cancer, 99, 29–34, 2002. 35. Wacheck, V. et al., Bcl-x(L) antisense oligonucleotides radiosensitise colon cancer cells, Br J Cancer, 89, 1352–1357, 2003. 36. Miyake, H. et al., Inhibition of progression to androgen-independence by combined adjuvant treatment with antisense BCL-XL and antisense Bcl-2 oligonucleotides plus taxol after castration in the Shionogi tumor model, Int J Cancer, 86, 855–862, 2000. 37. Gautschi, O. et al., Activity of a novel bcl-2/bcl-xL-bispecific antisense oligonucleotide against tumors of diverse histologic origins, J Natl Cancer Inst, 93, 463–471, 2001. 38. Yamanaka, K. et al., Induction of apoptosis and enhancement of chemosensitivity in human prostate cancer LNCaP cells using bispecific antisense oligonucleotide targeting Bcl-2 and Bcl-xL genes, BJU Int, 97, 1300–1308, 2006. 39. Yamanaka, K. et al., A novel antisense oligonucleotide inhibiting several antiapoptotic Bcl-2 family members induces apoptosis and enhances chemosensitivity in androgen-independent human prostate cancer PC3 cells, Mol Cancer Ther, 4, 1689–1698, 2005. 40. Oltersdorf, T. et al., An inhibitor of Bcl-2 family proteins induces regression of solid tumours, Nature, 435, 677–681, 2005. 41. Deveraux, Q.L. et al., IAPs block apoptotic events induced by caspase-8 and cytochrome c by direct inhibition of distinct caspases, Embo J, 17, 2215–2223, 1998. 42. Roy, N. et al., The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases, Embo J, 16, 6914–6925, 1997. 43. Deveraux, Q.L. et al., X-linked IAP is a direct inhibitor of cell-death proteases, Nature, 388, 300–304, 1997. 44. Tamm, I. et al., IAP-family protein survivin inhibits caspase activity and apoptosis induced by Fas (CD95), Bax, caspases, and anticancer drugs, Cancer Res, 58, 5315–5320, 1998. 45. Levkau, B. et al., xIAP induces cell-cycle arrest and activates nuclear factor-kappaB: New survival pathways disabled by caspase-mediated cleavage during apoptosis of human endothelial cells, Circ Res, 88, 282–290, 2001.

CRC_8796_ch025.qxd

714

6/20/2007

10:39 PM

Page 714


46. Silke, J. et al., The anti-apoptotic activity of XIAP is retained upon mutation of both the caspase 3- and caspase 9-interacting sites, J Cell Biol, 157, 115–124, 2002. 47. Salvesen, G.S., Duckett, C.S., IAP proteins: Blocking the road to death’s door, Nat Rev Mol Cell Biol, 3, 401–410, 2002. 48. Krajewska, M. et al., Elevated expression of inhibitor of apoptosis proteins in prostate cancer, Clin Cancer Res, 9, 4914–4925, 2003. 49. Ambrosini, G. et al., A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma, Nat Med, 3, 917–921, 1997. 50. Li, F. et al., Control of apoptosis and mitotic spindle checkpoint by survivin, Nature, 396, 580–584, 1998. 51. Lu, C.D. et al., Expression of a novel antiapoptosis gene, survivin, correlated with tumor cell apoptosis and p53 accumulation in gastric carcinomas, Cancer Res, 58, 1808–1812, 1998. 52. Kamihira, S. et al., Aberrant expression of caspase cascade regulatory genes in adult T-cell leukaemia: Survivin is an important determinant for prognosis, Br J Haematol, 114, 63–69, 2001. 53. Meng, H. et al., Prognostic significance and different properties of survivin splicing variants in gastric cancer, Cancer Lett, 216, 147–155, 2004. 54. Lal, A. et al., A public database for gene expression in human cancers, Cancer Res, 59, 5403–5407, 1999. 55. Altieri, D.C., Survivin, versatile modulation of cell division and apoptosis in cancer, Oncogene, 22, 8581–8589, 2003. 56. Zaffaroni, N. et al., Survivin as a target for new anticancer interventions, J Cell Mol Med, 9, 360–372, 2005. 57. Li, F. et al., Pleiotropic cell-division defects and apoptosis induced by interference with survivin function, Nat Cell Biol, 1, 461–466, 1999. 58. Chen, J. et al., Down-regulation of survivin by antisense oligonucleotides increases apoptosis, inhibits cytokinesis and anchorage-independent growth, Neoplasia, 2, 235–241, 2000. 59. Ansell, S.M. et al., Inhibition of survivin expression suppresses the growth of aggressive nonHodgkin’s lymphoma, Leukemia, 18, 616–623, 2004. 60. Carter, B.Z. et al., Targeting Survivin expression induces cell proliferation defect and subsequent cell death involving mitochondrial pathway in myeloid leukemic cells, Cell Cycle, 2, 488–493, 2003. 61. Schimmer, A.D. et al., Targeting XIAP for the treatment of malignancy, Cell Death Differ, 13, 179–188, 2006. 62. Hu, Y. et al., Antisense oligonucleotides targeting XIAP induce apoptosis and enhance chemotherapeutic activity against human lung cancer cells in vitro and in vivo, Clin Cancer Res, 9, 2826–2836, 2003. 63. Sasaki, H. et al., Down-regulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells, Cancer Res, 60, 5659–5666, 2000. 64. Cummings, J. et al., Validation of pharmacodynamic assays to evaluate the clinical efficacy of an antisense compound (AEG 35156) targeted to the X-linked inhibitor of apoptosis protein XIAP, Br J Cancer, 92, 532–538, 2005. 65. Newton, A.C., Regulation of protein kinase C, Curr Opin Cell Biol, 9, 161–167, 1997. 66. Liu, B. et al., 12(S)-HETE enhancement of prostate tumor cell invasion: Selective role of PKC alpha, J Natl Cancer Inst, 86, 1145–1151, 1994. 67. Ways, D.K. et al., MCF-7 breast cancer cells transfected with protein kinase C-alpha exhibit altered expression of other protein kinase C isoforms and display a more aggressive neoplastic phenotype, J Clin Invest, 95, 1906–1915, 1995. 68. Isonishi, S. et al., Depletion of protein kinase C (PKC) by 12-O-tetradecanoylphorbol-13-acetate (TPA) enhances platinum drug sensitivity in human ovarian carcinoma cells, Br J Cancer, 82, 34–38, 2000. 69. Swannie, H.C., Kaye, S.B., Protein kinase C inhibitors, Curr Oncol Rep, 4, 37–46, 2002. 70. Shen, L. et al., Induction of p53-dependent, insulin-like growth factor-binding protein-3-mediated apoptosis in glioblastoma multiforme cells by a protein kinase C-alpha antisense oligonucleotide, Mol Pharmacol, 55, 396–402, 1999. 71. Dean, N.M. et al., Inhibition of protein kinase C-alpha expression in human A549 cells by antisense oligonucleotides inhibits induction of intercellular adhesion molecule 1 (ICAM-1) mRNA by phorbol esters, J Biol Chem, 269, 16416–16424, 1994. 72. Wang, X.Y. et al., Antisense inhibition of protein kinase C-alpha reverses the transformed phenotype in human lung carcinoma cells, Exp Cell Res, 250, 253–263, 1999.

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 715


715

73. Yazaki, T. et al., Treatment of glioblastoma U-87 by systemic administration of an antisense protein kinase C-alpha phosphorothioate oligodeoxynucleotide, Mol Pharmacol, 50, 236–242, 1996. 74. Geiger, T. et al., Antitumor activity of a PKC-alpha antisense oligonucleotide in combination with standard chemotherapeutic agents against various human tumors transplanted into nude mice, Anticancer Drug Des, 13, 35–45, 1998. 75. Nemunaitis, J. et al., Phase I evaluation of ISIS 3521, an antisense oligodeoxynucleotide to protein kinase C-alpha, in patients with advanced cancer, J Clin Oncol, 17, 3586–3595, 1999. 76. Yuen, A.R. et al., Phase I study of an antisense oligonucleotide to protein kinase C-alpha (ISIS 3521/CGP 64128A) in patients with cancer, Clin Cancer Res, 5, 3357–3363, 1999. 77. Monia, B.P. et al., Antitumor activity of a phosphorothioate antisense oligodeoxynucleotide targeted against C-raf kinase, Nat Med, 2, 668–675, 1996. 78. Cunningham, C.C. et al., A phase I trial of c-Raf kinase antisense oligonucleotide ISIS 5132 administered as a continuous intravenous infusion in patients with advanced cancer, Clin Cancer Res, 6, 1626–1631, 2000. 79. Tolcher, A.W. et al., A randomized phase II and pharmacokinetic study of the antisense oligonucleotides ISIS 3521 and ISIS 5132 in patients with hormone-refractory prostate cancer, Clin Cancer Res, 8, 2530–2535, 2002. 80. Villalona-Calero, M.A. et al., A phase I/II study of LY900003, an antisense inhibitor of protein kinase C-alpha, in combination with cisplatin and gemcitabine in patients with advanced non-small cell lung cancer, Clin Cancer Res, 10, 6086–6093, 2004. 81. Yuen, A. et al., Phase I/II Trial of ISIS 3521, an antisense inhibitor of PKC-alpha, with carboplatin and paclitaxel in non-small cell lung cancer, Proc Am Soc Clin Oncol, 20, Abstract 1234, 2001. 82. Lynch, T.J. et al., Randomized phase III trial of chemotherapy and antisense oligonucleotide LY900003 (ISIS 3521) in patients with advanced NSCLC: Initial report, Proc Am Soc Clin Oncol, 22, Abstract 2504, 2003. 83. Paz-Ares, L. et al., Phase III study of gemcitabine and cisplatin with or without aprinocarsen, a protein kinase C-alpha antisense oligonucleotide, in patients with advanced-stage non-small-cell lung cancer, J Clin Oncol, 24, 1428–1434, 2006. 84. Clark, A.S. et al., Altered protein kinase C (PKC) isoforms in non-small cell lung cancer cells: PKCdelta promotes cellular survival and chemotherapeutic resistance, Cancer Res, 63, 780–786, 2003. 85. Trougakos, I.P. et al., Silencing expression of the clusterin/apolipoprotein j gene in human cancer cells using small interfering RNA induces spontaneous apoptosis, reduced growth ability, and cell sensitization to genotoxic and oxidative stress, Cancer Res, 64, 1834–1842, 2004. 86. Pucci, S. et al., Modulation of different clusterin isoforms in human colon tumorigenesis, Oncogene, 23, 2298–2304, 2004. 87. Wilson, M.R., Easterbrook-Smith, S.B., Clusterin is a secreted mammalian chaperone, Trends Biochem Sci, 25, 95–98, 2000. 88. Michel, D. et al., Stress-induced transcription of the clusterin/apoJ gene, Biochem J, 328 (Pt 1), 45–50, 1997. 89. Humphreys, D.T. et al., Clusterin has chaperone-like activity similar to that of small heat shock proteins, J Biol Chem, 274, 6875–6881, 1999. 90. Shannan, B. et al., Challenge and promise: Roles for clusterin in pathogenesis, progression and therapy of cancer, Cell Death Differ, 13, 12–19, 2006. 91. Leskov, K.S. et al., Synthesis and functional analyses of nuclear clusterin, a cell death protein, J Biol Chem, 278, 11590–11600, 2003. 92. Miyake, H. et al., Protection of androgen-dependent human prostate cancer cells from oxidative stressinduced DNA damage by overexpression of clusterin and its modulation by androgen, Prostate, 61, 318–323, 2004. 93. Zellweger, T. et al., Enhanced radiation sensitivity in prostate cancer by inhibition of the cell survival protein clusterin, Clin Cancer Res, 8, 3276–3284, 2002. 94. Bettuzzi, S. et al., Clusterin (SGP-2) transient overexpression decreases proliferation rate of SV40immortalized human prostate epithelial cells by slowing down cell cycle progression, Oncogene, 21, 4328–4334, 2002. 95. Miyake, H. et al., Testosterone-repressed prostate message-2 is an antiapoptotic gene involved in progression to androgen independence in prostate cancer, Cancer Res, 60, 170–176, 2000.

CRC_8796_ch025.qxd

716

6/20/2007

10:39 PM

Page 716


96. Wellmann, A. et al., Detection of differentially expressed genes in lymphomas using cDNA arrays: Identification of clusterin as a new diagnostic marker for anaplastic large-cell lymphomas, Blood, 96, 398–404, 2000. 97. Steinberg, J. et al., Intracellular levels of SGP-2 (clusterin) correlate with tumor grade in prostate cancer, Clin Cancer Res, 3, 1707–1711, 1997. 98. Redondo, M. et al., Overexpression of clusterin in human breast carcinoma, Am J Pathol, 157, 393–399, 2000. 99. Miyake, H. et al., Overexpression of clusterin in transitional cell carcinoma of the bladder is related to disease progression and recurrence, Urology, 59, 150–154, 2002. 100. Parczyk, K. et al., Gp80 (clusterin; TRPM-2) mRNA level is enhanced in human renal clear cell carcinomas, J Cancer Res Clin Oncol, 120, 186–188, 1994. 101. Montpetit, M.L. et al., Androgen-repressed messages in the rat ventral prostate, Prostate, 8, 25–36, 1986. 102. Bruchovsky, N. et al., Effects of androgen withdrawal on the stem cell composition of the Shionogi carcinoma, Cancer Res, 50, 2275–2282, 1990. 103. Kyprianou, N. et al., Programmed cell death during regression of PC-82 human prostate cancer following androgen ablation, Cancer Res, 50, 3748–3753, 1990. 104. July, L.V. et al., Clusterin expression is significantly enhanced in prostate cancer cells following androgen withdrawal therapy, Prostate, 50, 179–188, 2002. 105. Miyake, H. et al., Acquisition of chemoresistant phenotype by overexpression of the antiapoptotic gene testosterone-repressed prostate message-2 in prostate cancer xenograft models, Cancer Res, 60, 2547–2554, 2000. 106. Miyake, H. et al., Antisense TRPM-2 oligodeoxynucleotides chemosensitize human androgenindependent PC-3 prostate cancer cells both in vitro and in vivo, Clin Cancer Res, 6, 1655–1663, 2000. 107. Zellweger, T. et al., Overexpression of the cytoprotective protein clusterin decreases radiosensitivity in the human LNCaP prostate tumour model, BJU Int, 92, 463–469, 2003. 108. Zellweger, T. et al., Antitumor activity of antisense clusterin oligonucleotides is improved in vitro and in vivo by incorporation of 2⬘-O-(2-methoxy)ethyl chemistry, J Pharmacol Exp Ther, 298, 934–940, 2001. 109. July, L.V. et al., Nucleotide-based therapies targeting clusterin chemosensitize human lung adenocarcinoma cells both in vitro and in vivo, Mol Cancer Ther, 3, 223–232, 2004. 110. Zellweger, T. et al., Chemosensitization of human renal cell cancer using antisense oligonucleotides targeting the antiapoptotic gene clusterin, Neoplasia, 3, 360–367, 2001. 111. Miyake, H. et al., Synergistic chemsensitization and inhibition of tumor growth and metastasis by the antisense oligodeoxynucleotide targeting clusterin gene in a human bladder cancer model, Clin Cancer Res, 7, 4245–4252, 2001. 112. Biroccio, A. et al., Antisense clusterin oligodeoxynucleotides increase the response of HER-2 gene amplified breast cancer cells to Trastuzumab, J Cell Physiol, 204, 463–469, 2005. 113. Chi, K.N. et al., A phase I pharmacokinetic and pharmacodynamic study of OGX–011, a 2’-methoxyethyl antisense oligonucleotide to clusterin, in patients with localized prostate cancer, J Natl Cancer Inst, 97, 1287–1296, 2005. 114. Laskin, J.J. et al., Phase I study of OGX-011, a second generation antisense oligonucleotide (ASO) to clusterin, combined with cisplatin and gemcitabine as first-line treatment for patients with stage IIB/IV non-small cell lung cancer (NSCLC), J Clin Oncol (Meeting Abstracts), 24, 17078, 2006. 115. Chi, K.N. et al., A phase I study of a second generation antisense oligonucleotide to clusterin (OGX-011) in combination with docetaxel: NCIC CTG IND.154, J Clin Oncol (Meeting Abstracts), 23, 3085, 2005. 116. Ritossa, F., Discovery of the heat shock response, Cell Stress Chaperones, 1, 97–98, 1996. 117. Concannon, C.G. et al., On the role of Hsp27 in regulating apoptosis, Apoptosis, 8, 61–70, 2003. 118. Garrido, C. et al., HSP27 and HSP70: Potentially oncogenic apoptosis inhibitors, Cell Cycle, 2, 579–584, 2003. 119. Ciocca, D.R. et al., Biological and clinical implications of heat shock protein 27,000 (Hsp27): A review, J Natl Cancer Inst, 85, 1558–1570, 1993. 120. Ellis, R.J., van der Vies, S.M., Molecular chaperones, Annu Rev Biochem, 60, 321–347, 1991. 121. Lindquist, S., Craig, E.A., The heat-shock proteins, Annu Rev Genet, 22, 631–677, 1988. 122. Georgopoulos, C., Welch, W.J., Role of the major heat shock proteins as molecular chaperones, Annu Rev Cell Biol, 9, 601–634, 1993.

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 717


717

123. Morimoto, R.I. et al., The heat-shock response: Regulation and function of heat-shock proteins and molecular chaperones, Essays Biochem, 32, 17–29, 1997. 124. Isaacs, J.S. et al., Heat shock protein 90 as a molecular target for cancer therapeutics, Cancer Cell, 3, 213–217, 2003. 125. Bubendorf, L. et al., Hormone therapy failure in human prostate cancer: Analysis by complementary DNA and tissue microarrays, J Natl Cancer Inst, 91, 1758–1764, 1999. 126. Cornford, P.A. et al., Heat shock protein expression independently predicts clinical outcome in prostate cancer, Cancer Res, 60, 7099–7105, 2000. 127. Bostwick, D.G., Immunohistochemical changes in prostate cancer after androgen deprivation therapy, Mol Urol, 4, 101–106;discussion 107, 2000. 128. Hoang, A.T. et al., A novel association between the human heat shock transcription factor 1 (HSF1) and prostate adenocarcinoma, Am J Pathol, 156, 857–864, 2000. 129. Conroy, S.E., Latchman, D.S., Do heat shock proteins have a role in breast cancer? Br J Cancer, 74, 717–721, 1996. 130. O’Neill, P.A. et al., Increased risk of malignant progression in benign proliferating breast lesions defined by expression of heat shock protein 27, Br J Cancer, 90, 182–188, 2004. 131. Arts, H.J. et al., Heat-shock-protein-27 (hsp27) expression in ovarian carcinoma: Relation in response to chemotherapy and prognosis, Int J Cancer, 84, 234–238, 1999. 132. Langdon, S.P. et al., Expression of the heat shock protein HSP27 in human ovarian cancer, Clin Cancer Res, 1, 1603–1609, 1995. 133. Zhang, R. et al., Identification of differentially expressed proteins in human glioblastoma cell lines and tumors, Glia, 42, 194–208, 2003. 134. Kapranos, N. et al., Expression of the 27-kDa heat shock protein (HSP27) in gastric carcinomas and adjacent normal, metaplastic, and dysplastic gastric mucosa, and its prognostic significance, J Cancer Res Clin Oncol, 128, 426–432, 2002. 135. Oesterreich, S. et al., The small heat shock protein hsp27 is correlated with growth and drug resistance in human breast cancer cell lines, Cancer Res, 53, 4443–4448, 1993. 136. Vargas-Roig, L.M. et al., Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy, Int J Cancer, 79, 468–475, 1998. 137. Bruey, J.M. et al., Differential regulation of HSP27 oligomerization in tumor cells grown in vitro and in vivo, Oncogene, 19, 4855–4863, 2000. 138. Garrido, C. et al., HSP27 inhibits cytochrome c-dependent activation of procaspase-9, Faseb J, 13, 2061–2070, 1999. 139. Samali, A. et al., Hsp27 protects mitochondria of thermotolerant cells against apoptotic stimuli, Cell Stress Chaperones, 6, 49–58, 2001. 140. Concannon, C.G. et al., Hsp27 inhibits cytochrome c-mediated caspase activation by sequestering both pro-caspase-3 and cytochrome c, Gene Expr, 9, 195–201, 2001. 141. Lavoie, J.N. et al., Modulation of actin microfilament dynamics and fluid phase pinocytosis by phosphorylation of heat shock protein 27, J Biol Chem, 268, 24210–24214, 1993. 142. Huot, J. et al., Characterization of 45-kDa/54-kDa HSP27 kinase, a stress-sensitive kinase which may activate the phosphorylation-dependent protective function of mammalian 27-kDa heat-shock protein HSP27, Eur J Biochem, 227, 416–427, 1995. 143. Mehlen, P. et al., Constitutive expression of human hsp27, Drosophila hsp27, or human alpha B-crystallin confers resistance to TNF- and oxidative stress-induced cytotoxicity in stably transfected murine L929 fibroblasts, J Immunol, 154, 363–374, 1995. 144. Paul, C. et al., Hsp27 as a negative regulator of cytochrome C release, Mol Cell Biol, 22, 816–834, 2002. 145. Rocchi, P. et al., Heat shock protein 27 increases after androgen ablation and plays a cytoprotective role in hormone-refractory prostate cancer, Cancer Res, 64, 6595–6602, 2004. 146. Rocchi, P. et al., Increased Hsp27 after androgen ablation facilitates androgen-independent progression in prostate cancer via signal transducers and activators of transcription 3-mediated suppression of apoptosis, Cancer Res, 65, 11083–11093, 2005. 147. Hansen, R.K. et al., Hsp27 overexpression inhibits doxorubicin-induced apoptosis in human breast cancer cells, Breast Cancer Res Treat, 56, 187–196, 1999. 148. Darnell, J.E., Jr. et al., Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins, Science, 264, 1415–1421, 1994.

CRC_8796_ch025.qxd

718

6/20/2007

10:39 PM

Page 718


149. Yu, C.L. et al., Enhanced DNA-binding activity of a Stat3-related protein in cells transformed by the Src oncoprotein, Science, 269, 81–83, 1995. 150. Yu, H., Jove, R., The STATs of cancer—New molecular targets come of age, Nat Rev Cancer, 4, 97–105, 2004. 151. Buettner, R. et al., Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention, Clin Cancer Res, 8, 945–954, 2002. 152. Mora, L.B. et al., Constitutive activation of Stat3 in human prostate tumors and cell lines: Direct inhibition of Stat3 signaling induces apoptosis of prostate cancer cells, Cancer Res, 62, 6659–6666, 2002. 153. Cheng, F. et al., A critical role for Stat3 signaling in immune tolerance, Immunity, 19, 425–436, 2003. 154. Epling-Burnette, P.K. et al., Inhibition of STAT3 signaling leads to apoptosis of leukemic large granular lymphocytes and decreased Mcl-1 expression, J Clin Invest, 107, 351–362, 2001. 155. Turkson, J., Jove, R., STAT proteins: Novel molecular targets for cancer drug discovery, Oncogene, 19, 6613–6626, 2000. 156. Jones, J.I., Clemmons, D.R., Insulin-like growth factors and their binding proteins: Biological actions, Endocr Rev, 16, 3–34, 1995. 157. Pollak, M.N. et al., Insulin-like growth factors and neoplasia, Nat Rev Cancer, 4, 505–518, 2004. 158. Nickerson, T. et al., Castration-induced apoptosis in the rat ventral prostate is associated with increased expression of genes encoding insulin-like growth factor binding proteins 2,3,4 and 5, Endocrinology, 139, 807–810, 1998. 159. Nickerson, T. et al., Castration-induced apoptosis of androgen-dependent shionogi carcinoma is associated with increased expression of genes encoding insulin-like growth factor-binding proteins, Cancer Res, 59, 3392–3395, 1999. 160. Figueroa, J.A. et al., Differential expression of insulin-like growth factor binding proteins in high versus low Gleason score prostate cancer, J Urol, 159, 1379–1383, 1998. 161. Miyake, H. et al., Overexpression of insulin-like growth factor binding protein-5 helps accelerate progression to androgen-independence in the human prostate LNCaP tumor model through activation of phosphatidylinositol 3⬘-kinase pathway, Endocrinology, 141, 2257–2265, 2000. 162. Miyake, H. et al., Castration-induced up-regulation of insulin-like growth factor binding protein-5 potentiates insulin-like growth factor-I activity and accelerates progression to androgen independence in prostate cancer models, Cancer Res, 60, 3058–3064, 2000. 163. Kiyama, S. et al., Castration-induced increases in insulin-like growth factor-binding protein 2 promotes proliferation of androgen-independent human prostate LNCaP tumors, Cancer Res, 63, 3575–3584, 2003. 164. Elford, H.L. et al., Ribonucleotide reductase and cell proliferation. I. Variations of ribonucleotide reductase activity with tumor growth rate in a series of rat hepatomas, J Biol Chem, 245, 5228–5233, 1970. 165. Fan, H. et al., The mammalian ribonucleotide reductase R2 component cooperates with a variety of oncogenes in mechanisms of cellular transformation, Cancer Res, 58, 1650–1653, 1998. 166. Bjorklund, S. et al., S-phase-specific expression of mammalian ribonucleotide reductase R1 and R2 subunit mRNAs, Biochemistry, 29, 5452–5458, 1990. 167. Wright, J.A. et al., Regulation and drug resistance mechanisms of mammalian ribonucleotide reductase, and the significance to DNA synthesis, Biochem Cell Biol, 68, 1364–1371, 1990. 168. Lee, Y. et al., GTI-2040, an antisense agent targeting the small subunit component (R2) of human ribonucleotide reductase, shows potent antitumor activity against a variety of tumors, Cancer Res, 63, 2802–2811, 2003. 169. Desai, A.A. et al., A phase I study of antisense oligonucleotide GTI-2040 given by continuous intravenous infusion in patients with advanced solid tumors, Ann Oncol, 16, 958–965, 2005. 170. Sridhar, S.S. et al., A phase II study of the antisense oligonucleotide GTI-2040 plus docetaxel and prednisone as first line treatment in hormone refractory prostate cancer (HRPC), J Clin Oncol (Meeting Abstracts), 24, 13015, 2006. 171. Juhasz, A. et al., Analysis of ribonucleotide reductase M2 mRNA levels in patient samples after GTI2040 antisense drug treatment, Oncol Rep, 15, 1299–1304, 2006. 172. Kozopas, K.M. et al., MCL1, a gene expressed in programmed myeloid cell differentiation, has sequence similarity to BCL2, Proc Natl Acad Sci U S A, 90, 3516–3520, 1993. 173. Bae, J. et al., Mcl-1S, a splicing variant of the antiapoptotic Bcl-2 family member Mcl-1, encodes a proapoptotic protein possessing only the BH3-domain, J Biol Chem, M909826199, 2000.

CRC_8796_ch025.qxd

6/20/2007

10:39 PM

Page 719


719

174. Zhou, P. et al., Mcl-1, a Bcl-2 family member, delays the death of hematopoietic cells under a variety of apoptosis-inducing conditions, Blood, 89, 630–643, 1997. 175. Miyamoto, Y. et al., Immunohistochemical analysis of Bcl-2, Bax, Bcl-X, and Mcl-1 expression in pancreatic cancers, Oncology, 56, 73–82, 1999. 176. Chung, T.K. et al., Expression of apoptotic regulators and their significance in cervical cancer, Cancer Lett, 180, 63–68, 2002. 177. Derenne, S. et al., Antisense strategy shows that Mcl-1 rather than Bcl-2 or Bcl-x(L) is an essential survival protein of human myeloma cells, Blood, 100, 194–199, 2002. 178. Thallinger, C. et al., Mcl-1 antisense therapy chemosensitizes human melanoma in a SCID mouse xenotransplantation model, J Invest Dermatol, 120, 1081–1086, 2003. 179. Aichberger, K.J. et al., Identification of mcl-1 as a BCR/ABL-dependent target in chronic myeloid leukemia (CML): Evidence for cooperative antileukemic effects of imatinib and mcl-1 antisense oligonucleotides, Blood, 105, 3303–3311, 2005. 180. Skvara, H. et al., Mcl-1 blocks radiation-induced apoptosis and inhibits clonogenic cell death, Anticancer Res, 25, 2697–2703, 2005. 181. Sieghart, W. et al., Mcl-1 overexpression in hepatocellular carcinoma: A potential target for antisense therapy, J Hepatol, 44, 151–157, 2006. 182. Wacheck, V. et al., Mcl-1 is a relevant molecular target for antisense oligonucleotide strategies in gastric cancer cells, Cancer Biol Ther, 5, 2006. 183. Adjei, A.A., Blocking oncogenic Ras signaling for cancer therapy, J Natl Cancer Inst, 93, 1062–1074, 2001. 184. Kim, I.A. et al., The influence of Ras pathway signaling on tumor radiosensitivity, Cancer Metastasis Rev, 23, 227–236, 2004. 185. Li, C. et al., H-Ras oncogene counteracts the growth-inhibitory effect of genistein in T24 bladder carcinoma cells, Br J Cancer, 92, 80–88, 2005. 186. Cunningham, C.C. et al., A phase I trial of H-ras antisense oligonucleotide ISIS 2503 administered as a continuous intravenous infusion in patients with advanced carcinoma, Cancer, 92, 1265–1271, 2001. 187. Adjei, A.A. et al., A phase I trial of ISIS 2503, an antisense inhibitor of H-ras, in combination with gemcitabine in patients with advanced cancer, Clin Cancer Res, 9, 115–123, 2003. 188. Alberts, S.R. et al., Gemcitabine and ISIS-2503 for patients with locally advanced or metastatic pancreatic adenocarcinoma: A North Central Cancer Treatment Group phase II trial, J Clin Oncol, 22, 4944–4950, 2004. 189. Sigalas, I. et al., Alternatively spliced mdm2 transcripts with loss of p53 binding domain sequences: Transforming ability and frequent detection in human cancer, Nat Med, 2, 912–917, 1996. 190. Wang, H. et al., Experimental therapy of human prostate cancer by inhibiting MDM2 expression with novel mixed-backbone antisense oligonucleotides: In vitro and in vivo activities and mechanisms, Prostate, 54, 194–205, 2003. 191. Zhang, Z. et al., Antisense therapy targeting MDM2 oncogene in prostate cancer: Effects on proliferation, apoptosis, multiple gene expression, and chemotherapy, Proc Natl Acad Sci U S A, 100, 11636–11641, 2003. 192. Davis, A.J. et al., Phase I and pharmacologic study of the human DNA methyltransferase antisense oligodeoxynucleotide MG98 given as a 21-day continuous infusion every 4 weeks, Invest New Drugs, 21, 85–97, 2003. 193. Winquist, E. et al., Phase II trial of DNA methyltransferase 1 inhibition with the antisense oligonucleotide MG98 in patients with metastatic renal carcinoma: A National Cancer Institute of Canada Clinical Trials Group investigational new drug study, Invest New Drugs, 24, 159–167, 2006. 194. Chen, H.X. et al., A safety and pharmacokinetic study of a mixed-backbone oligonucleotide (GEM231) targeting the type I protein kinase A by two-hour infusions in patients with refractory solid tumors, Clin Cancer Res, 6, 1259–1266, 2000. 195. Goel, S. et al., A phase I safety and dose escalation trial of docetaxel combined with GEM231, a second generation antisense oligonucleotide targeting protein kinase A R1alpha in patients with advanced solid cancers, Invest New Drugs, 24, 125–134, 2006. 196. Schlingensiepen, K.H. et al., Targeted tumor therapy with the TGF-beta2 antisense compound AP 12009, Cytokine Growth Factor Rev, 17, 129–139, 2006.

CRC_8796_ch025.qxd

720

6/20/2007

10:39 PM

Page 720


197. De Benedetti, A., Graff, J.R., eIF-4E expression and its role in malignancies and metastases, Oncogene, 23, 3189–3199, 2004. 198. Rapozzi, V. et al., Antisense locked nucleic acids efficiently suppress BCR/ABL and induce cell growth decline and apoptosis in leukemic cells, Mol Cancer Ther, 5, 1683–1692, 2006. 199. Nylandsted, J. et al., Selective depletion of heat shock protein 70 (Hsp70) activates a tumor-specific death program that is independent of caspases and bypasses Bcl-2, Proc Natl Acad Sci U S A, 97, 7871–7876, 2000. 200. Ratajczak, M.Z. et al., Acute- and chronic-phase chronic myelogenous leukemia colony-forming units are highly sensitive to the growth inhibitory effects of c-myb antisense oligodeoxynucleotides, Blood, 79, 1956–1961, 1992. 201. Luger, S.M. et al., Oligodeoxynucleotide-mediated inhibition of c-myb gene expression in autografted bone marrow: A pilot study, Blood, 99, 1150–1158, 2002. 202. Kraemer, K. et al., Chemosensitization of bladder cancer cell lines by human telomerase reverse transcriptase antisense treatment, J Urol, 172, 2023–2028, 2004. 203. Forster, Y. et al., Antisense-mediated VEGF suppression in bladder and breast cancer cells, Cancer Lett, 212, 95–103, 2004. 204. Krause, S. et al., Vascular endothelial growth factor antisense pretreatment of bladder cancer cells significantly enhances the cytotoxicity of mitomycin C, gemcitabine and Cisplatin, J Urol, 174, 328–331, 2005. 205. Ikemoto, S. et al., Antitumor effects of lipoxygenase inhibitors on murine bladder cancer cell line (MBT-2), Anticancer Res, 24, 733–736, 2004.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 721

CHAPTER

26

Targeting Neurological Disorders with Antisense Oligonucleotides Richard A. Smith and Timothy M. Miller

CONTENTS 26.1 26.2 26.3

Introduction ......................................................................................................................721 Distribution ......................................................................................................................723 Nucleic Acid-Based, Nonantisense Gene Silencing ........................................................726 26.3.1 DNAzymes and Ribozymes ..............................................................................726 26.3.2 RNAi ..................................................................................................................727 26.4 Safety and Toxicity ..........................................................................................................728 26.5 Amyotrophic Lateral Sclerosis ........................................................................................730 26.6 Huntington’s Disease .......................................................................................................734 26.7 Pain ..................................................................................................................................735 26.8 Glioblastoma ....................................................................................................................735 26.9 Prion Disorders ................................................................................................................736 26.10 Dementias ........................................................................................................................737 26.11 Neuropathy ......................................................................................................................738 26.12 Spinal Muscular Atrophy .................................................................................................739 26.13 Muscular Dystrophy ........................................................................................................739 26.14 Conclusions ......................................................................................................................740 References .....................................................................................................................................740

26.1 INTRODUCTION Neurological disorders represent a major health burden that is increasing in magnitude in parallel with the demographic shift in the age of the population of advanced societies. In the United States alone it is estimated that 3.5 million people are afflicted with Alzheimer’s disease, which typically runs its fatal course over 3–5 years [1]. While advances in medicine have been one of the defining achievements of modern times it is fair to say that these have had little impact on the fortunes of persons afflicted with Alzheimer’s disease, multiple system atrophy, frontotemporal dementia, and the like. Modest success has been achieved with symptomatic treatment; the best example being the treatment of Parkinson’s disease with L-dopa and dopamine agonists.

721

CRC_8796_ch026.qxd

722

6/20/2007

10:48 PM

Page 722


The ability to regulate gene expression in the nervous system has broad scientific and clinical implications. From the basic science perspective turning a gene off offers the promise of understanding complicated systems, particularly when the effects of multiple receptor subtypes cannot be distinguished due to the lack of ligands with the required specificity. In this regard, antisense oligonucleotides (ASOs) have been used successfully to target a variety of receptors (e.g., dopamine) and neuropeptides in the central nervous system (CNS) such as corticotrophinreleasing factor and cholecystokinin [2–6]. And, of course, the medical uses for such a technology would be immediately applicable to diseases whose pathogenesis involves the undesirable activation of a receptor or the accumulation of a toxic protein. A number of strategies have been devised to regulate gene expression, albeit it recently has become evident that nature has long developed the means to accomplish such a feat and, in fact, does so throughout the plant and animal world. It is all but certain that more such processes remain to be discovered and that human inventiveness will result in others. Considering the variety of neurological disorders and their complexity it may seem naïve to suggest that a particular treatment strategy could be applicable to diseases ranging from prion disease to amyotrophic lateral sclerosis. But for obvious reasons the use of a technology as adaptable as antisense therapy offers unlimited therapeutic utility in instances for which an appropriate target has been identified. In the case of neurodegenerative disease, one overarching principle may underlie these conditions, namely, that collectively they are examples of proteinopathies that result from aging, genetic, or environmental causes that lead to the misfolding of proteins [7]. Accordingly, the development of appropriate antisense therapeutics would seem to be a reasoned means of treating conditions for which there is currently no meaningful treatment. The evidence that perturbation of proteins is a leading cause of neurodegeneration comes primarily from the discovery that genetic disorders such as Huntington’s disease, familial amyotrophic lateral sclerosis, and Parkinson’s disease are linked to mutations of proteins [7]. In the instance of Huntington’s disease, which is a dominantly inherited disorder leading to cognitive decline and severe choreaform movements, it has been discovered that the mutant gene is expanded due to polyglutamine repeats. The size of the repeat varies. Individuals with larger repeats experience earlier onset of their disease, which typically commences in the 40s, but the size of the repeat does not affect survival [8]. Huntington’s is just one of several examples of such a mutation. In contrast to mutations involving large segments of a gene, single-nucleotide mutations have also been etiologically linked to brain disorders including familial amyotrophic lateral sclerosis and familial Alzheimer’s disease. In spite of knowing the exact cause of Huntington’s and other genetic disorders the mechanism(s) by which a specific mutation leads to nerve cell degeneration remains mostly conjectural. Much of what has been learned has been extrapolated from the study of animal models. This has the effect of increasing the opportunity to select appropriate treatment targets. The discovery in 1993 that a proportion of ALS is caused by mutation in the ubiquitously expressed enzyme superoxide dismutase 1 (SOD1) represents one such example [9]. Experiments in mice and rats have demonstrated that a number of human mutants cause motor neuron death in rodents. While the basis for their toxic property(ies) remains unknown it is evident from rodent models that the timing of disease onset is specified by the level of expression of the mutant protein [10]. Transgenic mice that express higher levels of mutant protein have earlier onset; lines that express lower levels have later onset or do not develop disease at all [11] and animals that spontaneously lose copy number enjoy increased survival [12]. From this it is reasonable to assume, whether toxicity is achieved within motor neurons or transferred indirectly from mutant expression in astrocytes or microglia; toxicity should be ameliorated if mutant SOD1 expression is reduced. On this basis one can predict that a treatment strategy that targets SOD in the instance of familial amyotrophic lateral sclerosis (FALS) could be successful. By analogy, targeting amyloid and tau in the instance of Alzheimer’s disease might similarly be of clinical use.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 723

TARGETING NEUROLOGICAL DISORDERS WITH ANTISENSE OLIGONUCLEOTIDES

723

While wild-type SOD1 and other proteins implicated in neurodegenerative disease are biologically important it is likely that a modest reduction of these will be well tolerated. For example, even though SOD1 provides protection from oxidative damage, especially during recovery from ischemia, mice with only 50% of the normal amount of enzyme do not generate any reported phenotype [13]. Even complete loss of SOD1 does not produce disease or compromise life span in mice [14]. In the instance of disease caused by SOD1 mutation the evidence leads to the conclusion that toxicity will be alleviated, possibly eliminated, by as little as 50% reduction in mutant SOD1 expression. In contrast, simultaneous reduction in wild-type SOD1 would be predicted to have little consequence and might be of benefit.

26.2 DISTRIBUTION One of the limiting factors in the use of ASOs for the treatment of brain disorders is the obligation to introduce them directly into the CNS compartment or modify them in an effort to circumvent the blood–brain barrier (BBB). As a general rule, molecules of the size of ASOs would not be expected to breach the BBB and this has been demonstrated repeatedly [15]. Following systemic administration by intraperitoneal injection, ASOs are taken up by numerous organs including the liver and kidneys but the amount detected in brain, muscle, and nerve is negligible and insufficient to the task of modifying the production of a mutant protein (Figure 26.1). On this background Banks et al. [16] report that a phosphorothioate-modified ASO directed against amyloid precursor protein (APP) crosses the BBB following intravenous administration to SANP8 mice, a strain that carries a natural mutation affecting APP. Steady-state tissue levels were reached within 30–60 min. The spleen had the highest level and the brain the least. Brain and cerebrospinal fluid (CSF) levels were in equilibrium. Since uptake could be saturated by coadministration of unlabeled oligo the evidence was interpreted to favor active transport into the CNS, which the authors suggest might be coupled to a protein transporter. Comparing tissue concentrations achieved with intravenous and intraventricular (ICV) administration, a 100-fold difference in favor of ICV delivery was found. Extrapolating this result to the treatment of humans would, by our calculations, require the systemic administration of ASOs that vastly exceed tolerated doses. A seemingly ideal solution to the problem of delivering an antisense therapeutic to the nervous system is the use of peptide nucleic acids (AS-PNAs). The purported advantages of these DNA analogs include their resistance to nucleases and proteases, and their high affinity for nucleic acids. In contrast to phosphorothioate ASOs (P⫽S ASOs), AS-PNA molecules more readily penetrate the BBB and can be detected in both the brain and CSF after systemic administration [17]. As opposed to conventional antisense therpeutics, AS-PNAs do not appear to act via an RNAase H mechanism since mRNA levels remain normal in spite of a reduction in protein synthesis. This has suggested that the mechanism of action involves a translation block, a potentially advantageous property in the instance of a CNS therapeutic since neurons, nondividing cells, have less RNAase H levels than their counterparts [15]. In a study designed to test the therapeutic effect of downregulating a neurotrophin in an ALS animal model, peritoneal administration of an AS-PNA targeting p75ntr was shown to delay disease onset and increase survival [18]. Further, this result was accompanied by reduction in spinal cord levels of p75ntr and diminished caspase activation, which is under p75npr regulation. It has been suggested that conjugation of AS-PNAs to biotin or another carrier might further facilitate delivery of these molecules to the CNS. But thus far no commercial sponsor has chosen to develop this class of therapeutics. Further, it has been assumed that by transiently interrupting the BBB with administration of a highly osmotic agent it might be possible to circumvent the BBB but such treatment would, in most therapeutic instances, require repeated administration, be impractical, and likely to be dangerous. Some investigators have employed positive pressure infusion to facilitate delivery of ASOs to the CNS, an idea promulgated by the notion that ASOs do not permeate the nervous system after

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 724

724

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION Rat lumbar ventral horn

(A) Oligonucleotide (µM)

Rat

(C)

(E)

9 6 3

(B)

Lumbar cord

Thoracic cord

Cerivical cord

Left cortex

Brain stem

Right cortex

0

Rhesus monkey

Isis13920treated

50 µm

Oligo-treated secondary antibody only

Salinetreated

Rhesus monkey ventral horn (F)

Anti-oligo astrocyte

Anti-GFAP astrocyte

(G)

Oligo-treated

Oligonucleotide (µM)

(D)

12

12 9 6 50 µm

50 µm

3

Lumbar cord

Thoracic cord

Cerivical cord

Brain stem

Left cortex

Right cortex

(I)

Saline-treated

(H)

0

50 µm

50 µm

Rhesus monkey brain (J) Hippocampus Pyramidal neuron

(K)

Substantia nigra Dendritic neuron

(I)

Pons

(M)

Cerebellum

Pontine nucleus Granular neuron

Dentate granular neuron

60 µm

50 µm

50 µm

Purkinje cell

50 µm

Figure 26.1 (See color insert following page 270.) Distribution of antisense oligonucleotides after infusion into the right lateral ventricle in rat and Rhesus monkey. (A, B) Antisense oligonucleotides were continuously infused at 100 g/day (A) or 1 mg/day (B) for two weeks via infusion pump into the right lateral ventricle of (A) normal rats or (B) Rhesus monkey. Tissues were collected and extracts of them analyzed for oligonucleotide content by capillary gel electrophoresis. Mean values ± standard deviations are shown (A) n ⫽ 6; (B) n ⫽ 2. (C–G) A 24-mer modified oligonucleotide Isis13920 was infused for 2 weeks into the right lateral ventricle at 100 g/day in (C–E) rats or 1 mg/day in (F–M) Rhesus monkey. After perfusion, distribution of the oligonucleotide was determined by immunohistochemistry using a monoclonal antibody that recognizes the oligonucleotide (C–E, F, H) or astrocytes (GFAP; G, I). No oligonucleotide staining was seen in animals (D, H) infused with saline only or (E) an oligonucleotide infused animal but using secondary antibody only. Bar, 50 m. (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

intrathecal or intraventricular administration [19]. A variant of this technique has been utilized as a means of enhancing the treatment of malignant brain tumors [20]. As a result of limitations to the delivery of ASOs, direct administration to the nervous system appears to offer promise although this route of administration has not yet been widely adopted for

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 725


725

clinical use. In contrast to blood, spinal fluid exhibits minimal nuclease activity [21]. But this has little practical importance since brain nucleases rapidly degrade unmodified ASOs, primarily due to the activity of exonucleases acting at the 3⬘ end of the molecule. This problem has, more or less, been obviated by the use of phosphorothioate-modified oligonucleotides. In a seminal study designed to evaluate the clearance and disposition oligonucleotides, Whitesell et al. [21] administered labeled 15-mer oligonucleotides intraventricularly in adult rats. Since bolus infusions were thought to be unreliable, the clearance of an ASO and inulin were determined after continuous CSF infusion for 1 week. CSF samples were removed serially from the cisterna magma. At steady-state clearance t½ was determined to be 17.2 ⫾ 4.7 min for the ASO and 23 ⫾ 7.5 min for inulin. Because steady-state levels of ASO were comparable to inulin the authors concluded that tissue uptake was minimal although this conclusion is seemingly undercut by their microscopic observations. Using double staining, prominent uptake was noted in the soma of many cells, especially those of presumed glial origin as judged by florescent microscopy. Using in situ hybridization, Yaida and Nowak [22] compared the distribution of phospodiester and phosphorothioate ASOs after intraventricular and intraparenchymal injection. The distribution of phosphodiester ASOs was limited in both circumstances. Predominately, periventricular staining was seen following ICV administration, whereas phosphorothioate ASOs were detected in the ipsilateral striatum and hippocampus. The extent of brain penetration did not increase with repeated injections leading to the conclusion that ASOs were being rapidly cleared from the spinal fluid as a result of bulk flow and that drug delivery to the brain via this route depends strongly on proximity to the ventricular space. This, along with similar reports cast doubt on the general utility of antisense as a viable therapy in the instance of brain disorders such as Alzheimer’s disease, which are associated with widespread pathology [23]. More recent evidence challenges these assumptions. Chauhan studied the tissue distribution of a florescein-labeled 2⬘ methoxyethyl ASO (MOE ASO) directed against the secretase cleavage site of APP. This was injected intraventricularly into mice as a bolus and animals were sacrificed at four time points. In the first 15 min, intense staining was noted within the ependymal lining and adjacent tissue. Subsequently, staining spread. By 3 h there was overall diffusion and at 8 h postinjection, clearance was complete. Both neuronal and nonneuronal stainings were noted. Nuclear and cytoplasmic uptake was observed in some neurons, in others only perikaryl localization was observed. While experiments demonstrating widespread uptake of ASOs in the brain following ICV administration are relevant to the treatment of Alzheimer’s disease and the like, they do not shed light on the treatment of diseases such as ALS that predominately affect the lower brain and spinal cord. Further, the question arises as to whether the results seen in rodents can be extrapolated to primates whose nervous systems are exponentially larger. With this in mind the authors have studied the distribution of ASOs within the entire CNS following ICV administration of 5-10-5 MOE gapmers in both rats and subhuman primates [24]. These modified oligonucleotides retain RNAase activity and are characterized by long half-lives due to their stability [25]. Using an antibody that recognizes motifs in a tracking oligo robust uptake was demonstrated in motor neurons in the lumbar spinal cord in both species after continuous ICV infusion of oligonucleotides for 1 month (Figure 26.1). Additionally, uptake was seen in the striatum, thalamus, cerebellum, and pons following chronic ICV administration. Using capillary gel electrophoresis capable of measuring as little as 0.35 g/g of tissue, it was further demonstrated that tissue concentrations in all brain and spinal cord tissues could be sustained over long intervals and that they were of sufficient concentration to be biologically active (Figure 26.1). A parallel study was conducted in subhuman primates using the intrathecal (IT) route of administration. While the expected findings were noted: greater spinal cord ASO levels after IT administration and greater hemispheric concentrations after ICV delivery, the finding that substantial levels of ASO could be detected within the brain after IT administration was unexpected (Figure 26.2). Since spinal fluid is produced within the choroid plexus and flows out of the ventricles, ultimately ending up in the subarachnoid space surrounding the hemispheres where it is readsorbed,

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 726

726

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION 30 Intraventricular

Oligonucletide (mM)

25

Intrathecal 20 15 10 5

Cerebellum

Pons

Hippocampus

Right cortex

Left frontal

Lumbar

Thoracic

Cervical

Kidney

Liver

0

Figure 26.2 Comparison of antisense oligonucleotide concentrations in Rhesus monkey with intraventricular or intrathecal infusion. Two Rhesus monkeys in each group were infused with antisense oligonucleotide (Isis13920) for 14 days at 1 mg/day. Animals were sacrificed and oligonucleotide concentrations were measured by capillary gel electrophoresis.

one would not have anticipated that a molecule introduced in the lumbar space would enjoy widespread access to deep brain structures, such as the striatum. If this is the case in humans, IT delivery would obviously be the preferred route of administration in most clinical circumstances since this would obviate the need to place an intraventricular catheter with its small but attendant risks. 26.3 NUCLEIC ACID-BASED, NONANTISENSE GENE SILENCING As might be expected, a number of competing strategies to the use of ASOs have emerged, several of which are nucleic acid based. Thus far, none of the demonstrated strategies have advanced, beyond proof of principle, to a clinical application. It is too early to know which of these approaches will be the most adaptable to clinical use. A number of factors will determine this, including stability, ease of manufacture, and tolerability. And a key determinant will be the ability to moderate the dose, including the ability to terminate treatment. 26.3.1 DNAzymes and Ribozymes Nucleic acids were long considered to be passive molecules whose function was restricted to the passage of information embodied in the genetic code. More recently, nucleic acids have been shown to have catalytic properties. Naturally occurring ribozymes have been demonstrated to inactivate viral and messenger RNA and DNAs with similar properties have been synthesized. The 10–23 deoxyribozyme is a catalytic DNA species discovered by Gerald Joyce at Scripps Research Institute using directed evolution [26]. It has two user-friendly features: sequence specificity and catalytic efficiency. The 10–23 DNA consists of a catalytic core of 15 nucleotides with side arms. The substrate requirements are also simple. The target RNA must be amenable to Watson–Crick pairing, must contain a purine–pyrimidine junction, and the target purine must be unpaired. Further design features include an analysis of the binding characteristics of the side arms. If they bind too tightly, turnover is hindered, lowering the catalytic efficiency. Finally, the secondary structure is analyzed. A molecule that folds upon itself is unlikely to work.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 727


727

Fraction SOD1 mRNA cleaved

1 0.8 0.6

E438 DNA enzyme E439 DNA enzyme

0.4 0.2 0 0

5

15 30 Time (min)

1

2

Figure 26.3 DNA enzyme cleaves SOD mRNA. Radioactive SOD mRNA transcribed from a plasmid using a T3 promoter was incubated on separate occasions with DNAzymes at a 1:10 dilution (2.5 nM SOD mRNA and 25 nM DNAzyme). Samples taken at intervals from 1 to 30 min were quenched and loaded onto a 5% acrylamide gel and the amount of mRNA cleavage was quantitated by measuring the intensity of the resulting bands using densitometry.

In collaboration with Dr. Joyce we have synthesized 10–23 DNAzymes that cleave SOD mRNA with the intent of developing a therapeutic that might have application to the treatment of familial ALS. Putative cleavage sites were selected based on screening a panel of antisense oligos, reasoning that a site accessible to an antisense molecule should be accessible to a 10–23 DNA. To test this in vitro, a plasmid containing full-length SOD was linearized with BAM I and transcribed using T3 polymerase in the presence of the 10–23 DNA and a control. Cleavage was demonstrated by gel electrophoresis (Figure 26.3). Subsequently, two candidate DNAzymes were injected intraventricularly into rats for 1 month using an Alzet pump connected to an indwelling cannula. Animals were then sacrificed and SOD protein was quantified using Western blots. No effect on protein was apparent, but given the small number of DNAzyme tested this is not a surprising result. In the instance of identifying an antisense therapeutic it is often necessary to screen 100 oligonucleotides to find one that works in the brain as well as it does in vitro. 26.3.2 RNAi The discovery, first in plants and then in animals, that small RNAs are involved in gene regulation and can silence viral gene products has vitalized interest in gene therapy [27]. In the initial processing steps, specialized nucleases, RNAase 111-like enzymes that are part of the Dicer complex, cleave double-stranded stretches of RNA that have been exported to the cytoplasm [28]. Subsequently, the double-stranded (ds) RNAs are modified in the RISC complex, which brings together the target mRNA, an RNAase H-like nuclease (recently identified as an Argonaute protein) and the 22 nucleotide ds RNA processed by the Dicer complex. In this configuration either the ds RNA or a single derivative antisense strand of RNA act as a guide for the nuclease that cleaves the target mRNA in a sequence-specific fashion or sets in motion a process leading to a translation block. This latter event could result from a steric effect or through the recruitment of proteins that bind to the target mRNA, interfering with its translation [29]. RNA interfering (RNAi) molecules synthesized in vitro require modification to maintain their stability and enhance their resistance to degradation, both serious issues in a clinical settting [30]. Overcoming these limitations, Thakker and his colleagues [31] were able to achieve approximately 50% knockdown of a target mRNA following instillation of stabilized RNAi molecules into the lateral ventricle, although distribution within the CNS was limited [31].

CRC_8796_ch026.qxd

728

6/20/2007

10:48 PM

Page 728


As an alternative, a gene therapy approach employing a viral vector allows for the continuous production of RNAi molecules. Such viral vectors can be injected directly into the CNS or injected into muscle, provided the viral coat proteins mediate synaptic uptake and subsequent retrograde delivery to nuclei of motor or sensory neurons. Using these techniques, an effect on disease in an animal model has been demonstrated for spinal cerebellar ataxia type 1 targeting ataxin [32], Huntington’s disease targeting huntingtin [33], ALS targeting SOD1 [34–36], and Alzheimer’s disease targeting BACE1 [37]. A potential concern of RNAi-based therapy is that the level of gene silencing from the current generation of viruses cannot be regulated. Further, there is the possibility of saturating the endogenous capacity for processing small RNAs, resulting in fatal dysregulation of endogenous genes [38].

26.4 SAFETY AND TOXICITY Phosphorothioate-modified antisense molecules (PS⫽ASOs) have been in development for a number of years but the use of 2⬘ MOE gapmers dates to the late 1990s. These compounds have been administered to hundreds of patients, primarily cancer patients via systemic administration. In general, treatment is well tolerated but with prolonged treatment constitutional effects including malaise, fever, anorexia, etc. have been observed. When side effects occur they have been attributed to the chemistry of the molecule rather than to sequence-specific effects of the drug. Only recently has an antisense therapeutic been administered directly to the brain of a patient. Details surrounding this treatment trial have not been published but it has been reported that patients with malignant glioma do tolerate intraparenchymal injection of an antisense molecule that targets TGF- [6]. With systemic administration drug is concentrated preferentially in the liver and kidneys. Both these organs show minor histological evidence of injury and in clinical studies mild elevations of liver enzymes are seen. Surprisingly, our own studies demonstrate considerable uptake of oligos in both these organs after intraventricular administration (Figure 26.4C). Enlargement of the spleen is also observed. Effects on coagulation are the most common side effects observed thus far in clinical trials. This is manifested by prolongation of the partial thromboplastin time. The effect is dose and schedule dependent and has resolved within hours of the cessation of therapy. Mild activation of complement has been observed in both preclinical and clinical studies at a threshold concentration of approximately 50 g/mL. To prevent cardiovascular collapse, administration is designed to avoid these peak concentrations. Prolonged administration of P⫽S ASOs has been associated with thrombocytopenia in approximately one-third of treated patients. This has generally not required dose adjustment and in some cases platelet counts have been noted to increase with continued treatment. The basis for this appears to be different among species. In mice, thrombocytopenia has been thought to be due to sequestration of platelets in enlarged organs, such as the spleen. Phosphorothioate oligodeoxynucleotides (PS ODNs) are well recognized to activate cells of the immune system predominantly through interaction with Toll-like receptor 9 (TLR-9), although there are TLR-9-independent pathways as well [39]. Rodents are known to be much more sensitive to the immune stimulatory effects of PS ODNs than primates, including humans. Although sequences with appropriate CpG motifs are very potent activators of immune cells, many sequences are capable of activating TLR9 receptors at higher concentrations. In 1998, Peng Ho and his colleagues [15] synthesized a number of oligonucleotide analogs to identify chemistries that maximized potency and minimized the occurrence of side effects that were associated with first-generation phosphorothioatemodified oligonucleotides. These most notably have been associated with febrile responses and weight loss after intraventricular administration [40]. In a trade-off between potency and side effects a chimeric oligonucleotide that replaced the central phoshodiester linkages with phosphorothioate

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 729


729

(A) 140 scrambled

Rat SOD1 mRNA (% untreated control)

SOD 120

100 Untreated control 80

60

SODr146192 SODr/h146144

40 SODr/h146145 20

0 5′-UTR

3′-UTR

Intron-targeting ASOs

650 nt SODr/h146192 SODscrambled

SODr/h146144 r/h146145 SOD

(B)

(C) 140 Rat SOD1 mRNA (% untreated control)

Rat SOD1 mRNA (% untreated control)

100 75 50 25

Liver

100 80 60 40 20 0

0 3

10

30

100

Oligonucleotide concentration (nM)

e

lin

Sa

5

14

r/h

e

n ali

S

S

OD

14

r/h

OD

S

4 61

D

1

S

46

D

SO

45

61

14

r/h

d ble

92

61

r14

S

OD

ram

sc

D

SO

d ble

92

r1

OD

44

61

14

r/h

SO 4

4 61

(D)

Brain

Kidney

120

m ra

sc

OD

S

SOD1 α-Tubulin

Figure 26.4 Identifying antisense oligonucleotides that reduce rat SOD1 in vitro and in vivo. (A) Seventy-eight 24-mer-modified oligonucleotides complementary to rat SOD1 mRNA were synthesized and then transfected (at 150 nM) into primary rat A10 cells, RNA prepared 24 h posttransfection and SOD1 mRNA levels were measured by quantitative RT-PCR. Mean values⫾standard deviations are shown (n ⫽ 4). Oligonucleotides are displayed relative to their positions on the 462 nucleotide SOD1 coding sequence. (B) Oligonucleotides identified by the in vitro screen in (A) were evaluated in a similar transfection paradigm again using rat A10 cells and transfection of increasing concentrations of oligonucleotide to produce a dose response curve. (C) Oligonucleotides SODr/h146144, SODr/h146145, SODr146192, and SODscrambled (a control oligo) were injected (with 37.5 mg/kg) three times per week intraperitoneally into adult rats for 3 weeks after which time mRNA levels were measured in the liver, kidney, and brain. Mean values ± standard deviations are shown (n ⫽ 6). (D) SOD1 protein levels in liver extracts from animals treated with oligonucleotides SODr/h146144, SODr/h146145, SODr146192, and SODscrambled were measured by immunoblotting with an antibody to SOD1. Bottom: Immunoblot for tubulin to verify protein loading. (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

ones proved to be the best choice. An iteration of this molecule (2⬘ MOE phosphorothioate oligonucleotide) is now in clinical development for the treatment of FALS although more effort might be profitably expended to identify oligonucleotides that are tailored for use in the CNS [25]. To our knowledge formal toxicology studies have not been undertaken in the instance of intraventricular or intrathecal administration of these molecules. Following intraventricular administration of 2⬘ MOE

CRC_8796_ch026.qxd

730

6/20/2007

10:48 PM

Page 730


gapmers targeting SOD we noted inconsistent inflammatory changes at the site of administration or in a subependymal distribution. These were usually manifested as macrophage infiltration. In separate experiments, at high doses (300–400 g/day), we noted hind limb paralysis in some animals suggesting that oligos were pooling in the lumbar space with the result that nerve roots, the spinal cord, or possibly its coverings are adversely affected. Studies that do not optimize the oligonucleotide for the target may be at risk for increasing the incidence of adverse events. Numerous studies have demonstrated marked differences in the effectiveness of oligonucleotides designed to bind to different regions of the mRNA. Thus, studies requiring use of high doses of nonoptimized oligonucleotides may have pushed the therapeutic index. In this regard second-generation 2⬘-O-methoxyethyl-modified oligonucleotides have significantly greater affinity for RNA than PS ODNs. This translates to a 10- to 15-fold increase in potency and these molecules exhibit a longer duration of action in tissues due to increased metabolic stability. They also have decreased propensity for immune stimulation in rodents, primates, and man compared to PS ODNs. Thus, 25- to 50-fold lesser drug is needed to produce the same effect. Over 500 subjects have been exposed to these second-generation oligonucleotides.

26.5 AMYOTROPHIC LATERAL SCLEROSIS The majority (⬎ 90%) of cases of amyotrophic lateral sclerosis (ALS) are sporadic. Typically, ALS causes progressive severe weakness resulting in loss of use of the limbs, inability to swallow or speak, and ultimately death from respiratory failure 3–5 years after the onset of the disease. There are approximately 9000 new cases of ALS every year in the United States. There are no treatments that substantially slow the disease. The best therapy, Rilutek, is only marginally effective [41]. While the cause(s) of sporadic ALS is/are currently unknown a general understanding of the events leading to neurodegeneration has evolved [10]. Attractive targets for slowing disease progression in sporadic ALS have arisen from recognition that an intraneuronal cell death pathway represents the final step in the demise of motor neurons in both inherited and sporadic ALS. One such potential target is Bax, a member of the BCL-2 family of proteins that triggers cell death, including cell death in neurons [42]. Accordingly, targeting Bax with an ASO is an example of a speculative target for treating a fatal disorder whose cause(s) remain unknown. Less speculative are targets known to cause FALS. Approximately 20% of FALS cases are due to a mutation of the superoxide dismutase gene. Over a hundred such mutations have been described, but in the United States half of these cases are the so-called A4V variant [10]. This is the most virulent mutation and survival after disease onset is 1 year or less in almost all instances. While the number of A4V patients in the United States is small, probably 150 or so at any one time, the development of a treatment for this group of ALS patients would be a medical milestone since the only effective therapy for any form of ALS is palliative. Along with the gravity of the disease, there are other reasons to believe that A4V patients are an ideal population to test a novel therapy. First, ALS patients, inspite of the seriousness of their underlying disease, are otherwise in good health. As a group, patients are usually in middle life. Their vital organs are not involved in the disease process and they generally retain their cognitive abilities. Accordingly, patients are able to provide informed consent and they are hearty enough to withstand whatever medical challenges they might encounter as part of the treatment regimen. With the initial goal of treating familial ALS due to mutation in the SOD1 gene, ASOs that target rat SOD1 were selected from a panel of 80 ASOs (Figure 26.4) and lead oligos were screened further for ability to decrease endogenous SOD1 in the liver. After 1 month of intraventricular administration of lead rat oligos, SOD1 mRNA and protein were decreased by about 50% (Figure 26.5).

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 731

TARGETING NEUROLOGICAL DISORDERS WITH ANTISENSE OLIGONUCLEOTIDES 28 day infusion

(A) Rat SOD1 mRNA (% saline control)

120 100

(B)

SODscrambled SODr146192

80 60 40 20 Rat SOD1 0

Right frontal cortex

Brain Cervical Thoracic Lumbar stem cord cord cord

α-Tubulin ed

bl

D

SO

(D)

100

100

60 40 20

80 60 40 20

0

(E)

Right frontal/ temporal cortex

80 60 40 20

0 Right Cervical Lumbar frontal cord cord cortex

Figure 26.5

SO

mRNA (% saline control)

120

80

r1

D


120 Rat SOD1 protein (% saline control)

α−Tubulin protein (% saline control)


92

1

46

m ra

sc

(C)

731

0 Right Cervical Lumbar frontal cord cord cortex

in1 -3β K GS

nil

Pr

e es

Antisense oligonucleotides reduce rat SOD1 in vivo. (A–D) An antisense SOD1 SODr146192, or a SODscrambled oligonucleotide was infused for 28 days into the right lateral ventricle of normal rats at 100 g/day. (A) Endogenous SOD1 mRNA levels from brain and spinal cord regions were measured by quantitative real time PCR. Mean values ⫾ standard deviations are shown (n ⫽ 6). (B) SOD1 and -tubulin protein levels analyzed by immunoblotting following infusion. Top panel: Coomassie stained gel demonstrates equal loading. (C, D) Protein levels for tubulin and SOD1 quantified for right cortex, cervical cord, and lumbar cord after infusion as in (B). Mean values ⫾ standard deviations are shown (n ⫽ 6). (E) Antisense oligonucleotides against presenilin1 or GSK3 were infused for 2 weeks into the right lateral ventricle of nontransgenic mice and mRNA levels were measured by quantitative RT-PCR in the right frontal temporal cortex (n ⫽ 6). (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

Subsequently, a lead oligo, Isis oligo 333611, effective against human SOD1 was identified. This oligo has been shown to downregulate both the expression of SOD1 mRNA and protein throughout the brain and spinal cord of transgenic animals carrying the mutant human gene (Figure 26.6).

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 732

732


(B)

Liver

120 Human SOD1G93A RAT SOD1

ine

11

36

1

l

Sa

92

46

33

r1

r/h

D

SO

OD

S

Human SOD1G93A mRNA (% saline control)

(A)

SODscrambled SODr/h333611

100 80 60 40 20 0 Brain stem

(C)

Cervical Thoracic Lumbar cord cord cord

(D) SOD1G93A rat cervical cord

Cervical cord

α-Tubulin ne

li Sa

1

r/h

D SO

61

3 33

120 Human SOD1G93A protein (% saline control)

Human SOD1G93A RAT SOD1

100 80 60 40 20 0 SOD1G93A α-Tubulin

Figure 26.6 Antisense oligonucleotides complementary to human SOD1 mRNA decrease SOD1 protein levels in SOD1G93A rat liver and spinal cord. (A) An oligonucleotide active against human SOD1 mRNA as well as a rat mRNA specific oligonucleotide (SODr146192) was injected intraperitoneally three times per week (37.5 mg/kg at a concentration of 3 M) into adult rats expressing a low copy number human SOD1G93A transgene (line L26L). After 3 weeks, liver extracts were prepared and analyzed by (A) immunoblotting using an antibody that recognizes rat and human SOD1 with equal affinity. (B–D) Antisense oligonucleotides complementary to human SOD1 mRNA were infused into the right lateral ventricle of 65-day-old SOD1G93A rats at 100 g/day for 28 days. (B) RNA was prepared from tissue extracts and SOD1 RNA levels were measured by real-time PCR. (C–D) Protein levels for SOD1 and -tubulin were analyzed in parallel extracts (C) by immunoblotting with an antibody recognizing human and rat SOD1 with equal affinity and quantified (D) for cervical cord. * indicates p ⬍ 0.05 for students t-test compared with SODscrambled. Mean values ⫾ standard deviations are shown (SOD1scrambled, n ⫽ 4; SODr/h333611, n ⫽ 8). (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

Finally, treatment of these animals with Isis oligo 3336111, delivered intraventricularly using an Alzet pump, resulted in slowed disease progression after onset and prolonged survival of affected animals in comparison to animals treated with saline or a scrambled ASO (Figure 26.7). As a further test, fibroblasts were cultured from a patient meeting clinical criteria for ALS and carrying an SOD1A4V mutation (Figure 26.8). Fibroblasts were treated with 300 nM of Isis oligo 333611 for 72 h and then analyzed for SOD1 mRNA levels. As demonstrated, treatment with oligo 333611 and another SOD acting oligo had a marked effect in vitro.

0

0.2

0.4

0.6

0.8

1

80

Saline SODr/h333611

90 100 110 120 130 140 Age (d)

Onset

(B)

0

0.2

0.4

0.6

0.8

1

80 90 100 110 120 130 140 Age (d)

Early disease

(C)

0

0.2

0.4

0.6

0.8

1

80

90 100 110 120 130 140 Age (d)

Survival

10:48 PM

Figure 26.7 Infusion of oliogonucleotides complementary to human SOD1 mRNA extends survival in SOD1G93A rats. (A–C) Antisense oligonucleotides complementary to human SOD1 mRNA were infused into the right lateral ventricle of 65-day-old SOD1G93A rats at 100 g/day for 28 days (A) Disease onset defined as the peak animal weight and (B) early disease defined as the point where the animals had lost 10% of their peak weight, and (C) survival defined as the inability of the animal to right itself after 30 s after being placed on its side. Saline infused, n ⫽ 11; SODr/h333611, n ⫽ 12. (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

Cumulative onset

(A) Cumulative onset

6/20/2007

Cumulative survival


TARGETING NEUROLOGICAL DISORDERS WITH ANTISENSE OLIGONUCLEOTIDES 733

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 734

734

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION SOD1A4V fibroblasts SOD1 mRNA (% control)

120 100 80 60 40 20 0

d

1

te

c sfe

61

n

33

tra

Un

3 r/h

D

SO

Figure 26.8 Antisense oligonucleotides decrease SOD1A4V in fibroblasts from an ALS patient. Fibroblasts from a patient meeting clinical criteria for ALS and heterozygous for the SOD1A4V mutation were transfected with 300 nM of an oligonucleotide complementary to wild-type and mutant human SOD1 mRNA. Extracts were prepared after 48 h and analyzed (n ⫽ 4) by quantitative RT-PCR for SOD1 mRNA levels. (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

On the basis on these data, formal toxicity studies with Isis333611 are underway and a clinical trial for familial SOD1 ALS has been planned. 26.6 HUNTINGTON’s DISEASE Huntington’s disease is a progressive inherited disorder characterized by disabling, uncontrollable movements, a change in personality, and a loss of cognitive abilities [43]. With progression, patient’s speech and swallowing are affected, contributing further to eventual incapacitation and death. The disease affects approximately 15,000 patients in the United States. All instances of Huntington’s disease are caused by a dominant mutation in the huntingtin gene. Disease typically begins between the ages of 35 and 40 and is fatal within 15 years. There are no therapies that slow disease onset or progression. Each disease-causing mutation results in the expansion of the huntingtin protein as a result of the incorporation of an excess stretch of polyglutamine repeats [44]. There is an inverse relation between the size of the expansion and the onset of the disease, with longer expansions resulting in early onset. But the size of the expansion does not influence the severity of the disease. Expression of mutant huntingtin in mice causes dysfunction of the nervous system [45]. Decreasing mutant huntingtin in adult mice not only slows the progressive deterioration of the nervous system, but, in fact, reverses some of the symptoms. Thus, it is very likely that decreasing huntingtin in humans would provide a therapeutic benefit, even in adult patients. ASOs that decrease huntingtin protein when infused into a normal mouse have already been identified, as have ASOs targeting the human protein. Although complete deletion of huntingtin, using genetic strategies, is incompatible with normal development of the mouse; this is not anticipated to represent a significant impediment to the use of ASOs to lower mutant Huntington synthesis for the following reasons: a. ASOs typically reduce protein by 50% rather than completely and the degree of target knockdown can be regulated by the amount of ASO delivered. b. Initial experiments with ASOs to decrease endogenous mouse huntingtin protein by 50% have not resulted in any untoward side effects.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 735


735

26.7 PAIN Intractable pain represents a major health burden that has multiple causations. Common causes related to the nervous system include peripheral neuropathy, post herpetic neuralgia, thalamic syndrome, multiple sclerosis, and the like. The magnitude of the problem is illustrated by diabetic neuropathy that affects approximately 350,000 patients in the United States [46]. A large percentage of these patients experience pain at some point in their disease. Neuropathic pain, usually results from both peripheral and central mechanisms [47]. In the periphery it is thought that spontaneous discharges of nociceptive fibers result from dysregulation of sodium channels [48]. Clinically, sodium channel antagonists, such as carbamazipine, have long been used to treat neuropathic pain [49]. Central sensitization may involve a cascade of events, starting with repetitive firing of C fibers that ultimately leads to activation of protein kinase C and phosphorylation of NMDA receptors decorating neurons in the dorsal horn [50]. This results in increased central sensitization that may be further enhanced by the release of ATP, which facilitates glutamate release by activating purine receptors (P2X) in sensory afferents in the dorsal horn. This, along with phosphorylation of the NMDA receptor cumulatively leads to increased calcium influx. Similar, perhaps identical events, are associated with the development of tolerance, which is a major obstacle to the continued use of opioids such as morphine. On this basis Hua et al. [51] targeted spinal cord PKC using intrathecal delivery of an ASO in a rat model of opioid tolerance. After treatment for 5 days, using a 2⬘ MOE PKC ASO, spinal cord PKC protein was diminished approximately 50% and treatment prevented the development of tolerance resulting from chronic administration of morphine. Employing an injury model of pain, Honore et al. demonstrated a reduction in mechanical allodynia in rats treated intrathecally for 7 days with an ASO that targeted the expression of P2X receptors in the spinal cord. In this model the L5-6 nerve roots are traumatized, leading to an exaggerated response to touch that is manifest 1 week postoperatively [52].

26.8 GLIOBLASTOMA Glioblastoma is the most common form of primary brain tumor with glioblastoma multiforme being the most common and malignant of the glial tumors. Few patients diagnosed with glioblastoma multiforme survive longer than 1 year from the time of diagnosis [53]. Over the past 20 years, survival has not improved, thus, current therapies are inadequate. Recent scientific studies have provided valuable insights into the genetic and biological changes that occur in glioblastoma. These studies have identified several potential molecular targets for therapeutic intervention. Unfortunately, other than epidermal growth factor, most targets are not amenable to traditional drug discovery programs. In that ASOs are capable of inhibiting virtually any RNA in the cell, antisensebased therapeutics may be ideally suited for treatment of this disease. Some investigators have placed emphasis on local, direct administration into CNS tissue, presuming that systemic side effects can be avoided. The rationale for local therapy, in our opinion, is problematic since the combination of surgery and radiotherapy are effective in reducing tumor burden and it is the local spread of tumor that ultimately is fatal. Based on current evidence it is presumed that intraventricular administration of an ASO that prevented local, initially microscopic spread of malignant cells, could curtail the inexorable progression of tumor. A number of glioma targets have been studied with the intent of demonstrating their therapeutic relevance. Typically, these have been assessed in vitro in a glioblastoma cell line which has been evaluated either by transfecting cells with vectors that code for an antisense cDNA or by directly treating cells with antisense molecules. Extending this strategy to animal models it is possible to determine the effect of similar therapeutic manipulations following subcutaneous or intracranial injection of treated and control cell lines into nude mice. For example, ASOs that downregulate the

CRC_8796_ch026.qxd

736

6/20/2007

10:48 PM

Page 736


expression of several growth factors, such as insulin-like growth factor (IGF-I) have moderated tumor growth in vivo [54]. Dysregulation of the epidermal growth factor receptor (EGFR) is noted in about half of the gliomas studied [55]. The receptor is a member of a family of transmembrane glycoproteins that may be overexpressed in some tumors. This has the effect of stimulating tumor growth and invasiveness. Further, the EGFR may be mutated in some tumors leading to a truncated extracellular domain, again enhancing tumorigenicity. Considering its pivotal role in the biology of gliomas, the EGFR receptor has been thought to be a suitable treatment target. Several small molecules and monoclonal antibodies have been developed with the idea of inhibiting phosphorylation of the receptor and the resulting cascade of cellular effects implicated in the malignant process. Several of these therapies are being tested in clinical trials. Relevant to the use of an antisense therapeutic, an RNAi-based therapy targeting the EGFR achieved a marked extension of survival in a murine model of brain tumor [56]. A marked reduction in mortality was observed in mice bearing an experimental glioma following daily intraperitoneal administration of aprinocarsen, an oligo that inhibits PKC. Based on these results a clinical trial was conducted to test the efficacy of the drug in patients with recurrent high-grade astrocytoma [57]. Patients received a continuous intravenous infusion for 21 days (2 mg per kg/day) in repeated cycles. While the treatment was well tolerated, no beneficial effect was seen and, in fact, there was a suggestion that treatment may have accelerated tumor progression, and possibly disrupted the BBB. A phase I/II trial with an antisense molecule directed against TGF-2 has been undertaken in patients with high-grade glioma [20]. Malignancies, including glioma, are known to overexpress TGF-, which may facilitate tumor progression as a result of its effect on metastasis, cell proliferation, and angiogenesis. The drug was administered directly into the tumor and adjacent brain by high-flow micro perfusion. The results have not been published but preclinical studies involving rabbits and subhuman primates have been reported. In normal rabbits, continuous intraparenchymal infusion of AP 12009 at a rate of 1 L/h was tolerated for 7 days without ill effects. On postmortem examination, both leptomeningeal and parenchymal inflammations were noted microscopically. Both lymphocytes and macrophages were observed and phagocytosed material, presumably oligonucleotides, were seen in the latter. In spite of these findings the investigators were reassured about the safety of their method since there were no macroscopically visible changes, concluding that there are no reservations against the local administration of AP120019 in patients with malignant glioma.

26.9 PRION DISORDERS Prion diseases, once thought to be a biological and medical curiosity, have become a serious health concern based on the occurrence of variant Creutzfeldt Jakob disease (CJD) in Britain and elsewhere that has been linked to the consumption of tainted meat and meat products. Further is the concern that the disease may be transmissible via the medical use of blood products [58]. CJD has long been known to be capable of transmission through the transplantation of corneal tissue from affected donors, inadequate sterilization of surgical instruments, etc. Affected persons suffer from an inexorable neurological disorder characterized by mental deterioration, and characteristic encephalographic and pathological (spongiform degeneration) findings. Death ensues rapidly, usually within 1 year. Following infection, as currently understood, a protease resistant form of prion protein (PrPres) recruits the normal cellular protein (PrPsens); the result being that normal protein is converted into the protease-resistant form [59]. Evidence suggests that several sugar polymers can interfere with this process, presumably by binding to PrPsens and thereby interfering with the conversion to PrPres. Reasoning that the efficacy of polyanionic glycans is related to their sulfate moieties, Kocisko et al. synthesized a random assortment of phosphorothioate oligonucleotides and found that they similarly exhibited activity against scrapie. The

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 737


737

optimum length of the oligomers was found to be 20–40-mer and there was no obvious sequence requirement [60]. Although untested it is assumed that targeting the expression of PrPsens protein would itself be therapeutic since this would reduce the amount of native protein that could be recruited to the disease process. This result is inferred from the fact that knockout animals lacking PrPsen are resistant to experimental infection [61]. Accordingly, several potent PrPsens oligos have been synthesized and are scheduled to be tested for efficacy in a transgenic mouse overexpressing PrPres. These will be administered intraventricularly, initially before experimental inoculation with scrapie and subsequently after inoculation so as to determine whether treatment confers prophylactic protection in the first instance and confers a treatment effect in the second instance. Should this be the case, further studies will be warranted to determine whether the benefit is due to a singular effect, for example, lowering of PrPsens or a combination of effects, including interference due to binding of the oligo to PrPsens. However, this strategy may need revision if a human homologue for Doppel, a second murine prion-like protein is found to be etiologically linked to human prion disease [62,63].

26.10 DEMENTIAS In a clinical context, the term dementia has descriptive value, connoting a general deterioration of mental processes including impairment of memory and reason but the term lacks specificity unless elaborated upon. It would be fair to say that much of the progress made in the nineteenth and twentieth centuries toward understanding the causes of dementia were made through clinical and pathological description. While the classic findings in Alzheimer’s disease of senile plaques and neurofibrillary tangles have been recognized for over 100 years, the molecular makeup of these and other changes in the brain (Lewy bodies) have only recently been characterized. With this advance it has been possible to further refine the classification of the dementias. On this basis, for example, frontotemporal dementia is considered a tauopathy whereas Lewy body dementia is considered a synucleinopathy [64]. The recognition that amyloid plaques are composed of A peptides and that the longest of these are the most likely to aggregate and accumulate in the extracellular space led to the formulation of the amyloid hypothesis [65]. Support for this has come from the finding that mutations in APP, or the enzymes that process APP, are responsible for familial variants of Alzheimer’s disease. Patients with Down’s syndrome who carry an extra copy of the APP gene may develop Alzheimer’s disease at an early age. However, the amyloid hypothesis, as originally conceived, has undergone revision since the presence of neurofibrillary tangles correlates better with the clinical and pathological features of Alzheimer’s disease than the presence of amyloid plaques [66] and amyloid plaques may be seen in nondemented individuals. In its current incarnation the amyloid hypothesis places more emphasis on the toxicity of soluble forms of A, which accumulate early, and maximally, prior to the appearance of clinical features of the disease. By as yet unknown means a cascade of events subsequently ensues with the result that there is inexorable loss of neurons, and synaptic loss accompanied by gliosis and the formation of neurofibrillary tangles, which are characterized by the presence of hyperphosphorylated tau [65]. On this continuum, patients exhibit memory loss, disorientation, and ultimately enfeeblement until they die, usually within 3–6 years from onset. The mainstay of dementia treatment has been the use of drugs that inhibit acetylcholinesterase based on the findings that cholinergic neurons in the basal forebrain are preferentially affected in Alzheimer’s disease [67]. This therapeutic approach, pioneered by William Summers in 1986, has shown modest symptomatic benefit in numerous treatment trials [68,69]. Both cognitive and behavioral performances are ameliorated with treatment and this is associated with lessening of caretaker burden and a delay in nursing home placement.

CRC_8796_ch026.qxd

738

6/20/2007

10:48 PM

Page 738


Interestingly, a subset of cholinergic neurons appears to preferentially accumulate A 42, leading ultimately to the formation of dense-core amyloid plaques that are most likely due to cell lysis. This may account for the selective vulnerability of cholinergic neurons observed in Alzheimer brains [70]. On this basis it has been suggested that a drug that targeted the 7nAChR might diminish the tendency of cholinergic neurons to take up A42 [70]. With the goal of reducing A, research has focused on identifying drugs that inhibit or secretase [71]. Several inhibitors that reduce spinal fluid and brain levels of A have been reported but enthusiasm for this has been diminished by the realization that a number of substrates, including Notch, are processed by secretase. Unfortunately, efforts to develop a secretase inhibitor have not been productive, in part because of the difficulty in designing a drug that distinguishes between BACE 1 and other aspartyl proteases and BACE may also process multiple substrates [72]. Also, an immunologic therapy to promote clearance of A 42, remarkably effective in animal studies, was accompanied by the unacceptable occurrence of encephalomyelitis in a small percentage of patients [73]. Potential dementia disease targets that could be amenable to treatment with ASOs or similar strategies are not abundantly expressed in the brain compared to superoxide dismutase. These include APP (0.05% [74]), presenilin 1 (0.0003% [75]), tau (0.01-0.1% [76]), and alpha-synuclein (0.5% [77]), all of which have been implicated in the pathogenesis of one or more of the dementias. Such a treatment strategy is especially appealing for targets that are nonessential genes whose absence does not compromise life span in mice, including APP [78], the BACE protease whose action is required to generate the A peptide in Alzheimer’s disease [79] and tau [80]. In mice, in whom a tau transgene was under control of a doxycycline promoter, improvement in memory was demonstrated when the transgene was suppressed and neuronal numbers and brain weights were similarly increased compared to untreated animals. But interestingly, there was no effect on neurofibrillary tangles [81]. We have identified ASOs that direct degradation of mRNAs encoding target proteins involved in Alzheimer’s disease, including presenilin 1, part of the -secretase complex that processes APP to produce the A peptide [75], and GSK3, a kinase thought to be responsible for the aberrant phosphorylation of tau in intraneuronal tangles [82,83]. Oligonucleotides effective in targeting presenilin 1 or GSK3 mRNAs were identified by screening a series of oligonucleotides in cell culture for inhibition of their respective targets. Intraventricular administration of the most effective of these for 14 days into normal mice substantially reduced the corresponding mRNAs in regions primarily affected in Alzheimer’s disease, including the frontal and temporal cortices (Figure 26.5E).

26.11 NEUROPATHY Neuropathies represent a vast and varied group of disorders ranging from hereditable ones such as Charcot Marie Tooth disease and familial amyloidosis to metabolic ones including diabetic peripheral neuropathy. In the instance of familial amyloidosis, more than 85 mutations of the transthyretin (TTR) gene have been identified. The most prevalent mutation, Val30Met, is found in approximately 5% of the Portuguese population. The familial disease has protean manifestations leading to cardiomyopathy, nephropathy, and neuropathy. Because most of the serum transthyretin produced is of hepatic origin, liver transplantation has been a mainstay of therapy. But disease progression, while slowed, has continued, most likely due to the deposition of wildtype TTR. On this basis an antisense treatment strategy offers the likelihood of being less invasive and more efficacious, in part because systemically administered ASOs are avidly taken up by the liver where they are biologically active. Using transgenic mice containing the entire TTR ILe84Ser coding region and the upstream human promoter, Benson et al. [84] demonstrated a marked reduction in serum TTR over a 6-week course of treatment. Following treatment twice a week with

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 739


739

subcutaneous injections serum TTR levels dropped over 70% with the most effective ASO. This was dose dependent: each mg increase in dose was associated with a 1–2% reduction in the serum level. Unfortunately, this animal model fails to replicate the human disorder in that characteristic amyloid deposits are not seen despite the fact that serum levels of TTR are double the normal human serum concentration. But considering the results in the animal model and the apparent safety of the therapy one would anticipate that an antisense therapeutic targeting TTR offers the most immediate and promising strategy for treating familial amyloidosis.

26.12 SPINAL MUSCULAR ATROPHY Spinal muscular atrophy (SMA) is the leading hereditable cause of infant mortality, with an incidence of 1 in 10,000 births. In the most severe of the three forms, motor milestones are never reached and children usually die within the first year of life. Type 111 SMA patients are able to walk and may enjoy a normal life span. The gene coding for the motor neuron survival gene (SMN) is located on chromosome 5 and consists of an inverted repeat with a telomeric (SMN1) and a centromeric (SMN2) copy [85]. While both genes code for the identical product, mutations of the SMN1 gene alone lead to SMA. But the severity of phenotype is moderated by the character of the SMN2 transcript, which is subject to differential RNA splicing, leading in most cases to an isoform lacking exon 7. Unfortunately, this isoform cannot adequately compensate for a mutation of the SMN1 gene. The recognition that a single nucleotide substitution accounts for the splicing event that excludes exon 7 has led to the realization that SMA might be favorably treated by a therapeutic strategy that targets the splicing machinery that edits SMN2 expression. Ultimately the editing process is determined by the interplay between the splicing machinery and exonic splicing enhancers (ESEs). In an effort to bias splicing in favor of the inclusion of exon 7, several strategies employing oligonucleotides have been demonstrated in vitro. The most promising of these have incorporated a noncomplementary tail that contains sequences that have the effect of mimicking the function of ESEs [86]. The body of these 2⬘-O-methylphosphorothioate oligos is complementary to the 5⬘ end of SMN exon 7 and the tail component contains GGA repeats. These sequences are known to exhibit enhancer effects, most likely by the recruitment of splicing proteins such as SF2/ASF that are known to bind ESEs.

26.13 MUSCULAR DYSTROPHY Muscular dystrophy, a childhood muscular disorder resulting from mutations of the dystrophin gene, affects 1 in 3500 males [87]. In its severest form muscle weakness and wasting become apparent in infancy, usually about 3 years of age, and by adolescence, affected individuals develop contractures and become wheelchair bound. As the disease progresses inexorably, respiratory and cardiac functions are compromised, leading to death. Mutations of the dystrophin gene in these cases results in the production of a biologically defective protein as a result of nonsense or frameshift mutations [88]. A variant of the disease, the Becker variant, is associated with a milder phenotype because the gene product, while truncated, is still biologically active. Even in its severest form it is apparent that splice variants occur spontaneously in scattered muscle fibers [89]. This is demonstrated in muscle biopsies from affected patients in which rare fibers containing dystrophin can be visualized by histochemistry. In short, nature has provided therapeutic guidance, leading to the notion that a treatment that could bias splicing might have the effect of moderating the severity of the disease process. Considering the size and complexity of the dystrophin gene—greater than 2.3 million base pairs—a conventional gene therapy approach appears to be a daunting challenge. But fortuitously,

CRC_8796_ch026.qxd

740

6/20/2007

10:48 PM

Page 740


the majority of the mutations in the dystrophin gene occur in the rod domain, which itself is not critical to the function of the protein. Exploiting this a number of researchers have demonstrated that ASOs that lead to exon skipping can enhance synthesis of a functional, albeit truncated dystrophin transcript following direct injection into the muscle of mdx mice, a murine animal model of muscular dystrophy, or following systemic delivery [89,90]. Thus far the effect within muscles and between muscles is variable and the heart has been refractory to treatment, a serious limitation to a promising therapy. Preliminary results in humans confirm the findings in animals, namely, that dystrophin can be upregulated in the muscle of an affected patient but formal clinical trials have not been undertaken [91].

26.14 CONCLUSIONS There is an obvious need for therapies that offer the opportunity to selectively target the expression of any protein in the nervous system. This is particularly compelling since it has become increasingly apparent that a large number of neurodegenerative disorders can be considered proteinopathies. It is paradoxical that we know the exact cause of many of these diseases, most notably those that are caused by mutation but thus far we do not know the cellular basis for any of these conditions. In this context, a therapeutic strategy based on the use of ASOs makes sense because there is good reason to believe that reducing the amount of an offending protein should be of therapeutic benefit. While this treatment strategy has been considered for sometime it has long been believed that it was difficult to target the CNS, first, because the BBB excludes molecules the size of oligonucleotides and second because a number of investigators have reported that oligonucleotides were not well distributed throughout the nervous system after direct instillation into the neural parenchyma or to the spinal fluid bathing the brain. Whatever the basis for these conclusions there is overwhelming evidence that second- and thirdgeneration ASOs readily penetrate the brain substance after intrathecal and intraventricular administrations. What remains to be demonstrated is that such therapies are safe. Such studies are currently being undertaken but irrespective of the outcome it is likely that the ideal chemistry for a molecule intended for neurological use has yet to be identified, most certainly because emphasis has been placed on the development of a universal therapeutic. As the field matures one might speculate that some chemistries might be better suited to one application than another and it will become clear which of the many strategies available to regulate genes will be most suited for clinical use.

REFERENCES 1. Wolfson, C., Wolfson, D. B., Asgharian, M., M’Lan, C. E., Ostbye, T., Rockwood, K., and Hogan, D. B. (2001). A reevaluation of the duration of survival after the onset of dementia. N Engl J Med 344, 1111–1116. 2. Zhou, L. W., Zhang, S. P., Qin, Z. H., and Weiss, B. (1994). In vivo administration of an oligodeoxynucleotide antisense to the D2 dopamine receptor messenger RNA inhibits D2 dopamine receptor-mediated behavior and the expression of D2 dopamine receptors in mouse striatum. J Pharmacol Exp Ther 268, 1015–1023. 3. Oguro, K., Oguro, N., Kojima, T., Grooms, S. Y., Calderone, A., Zheng, X., Bennett, M. V., and Zukin, R. S. (1999). Knockdown of AMPA receptor GluR2 expression causes delayed neurodegeneration and increases damage by sublethal ischemia in hippocampal CA1 and CA3 neurons. J Neurosci 19, 9218–9227. 4. Wahlestedt, C., Pich, E. M., Koob, G. F., Yee, F., and Heilig, M. (1993). Modulation of anxiety and neuropeptide Y-Y1 receptors by antisense oligodeoxynucleotides. Science 259, 528–531.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 741


741

5. Heinrichs, S. C., Lapsansky, J., Lovenberg, T. W., De Souza, E. B., and Chalmers, D. T. (1997). Corticotropin-releasing factor CRF1, but not CRF2, receptors mediate anxiogenic-like behavior. Regul Pept 71, 15–21. 6. Cohen, H., Kaplan, Z., and Kotler, M. (1998). Inhibition of anxiety in rats by antisense to cholecystokinin precursor protein. Biol Psychiatry 44, 915–917. 7. Taylor, J. P., Hardy, J., and Fischbeck, K. H. (2002). Toxic proteins in neurodegenerative disease. Science 296, 1991–1995. 8. Di Prospero, N. A., and Fischbeck, K. H. (2005). Therapeutics development for triplet repeat expansion diseases. Nat Rev Genet 6, 756–765. 9. Rosen, D. R., Sapp, P., O’Regan, J., McKenna-Yasek, D., Schlumpf, K. S., Haines, J. L., Gusella, J. F., Horvitz, H. R., and Brown, R. H., Jr. (1994). Genetic linkage analysis of familial amyotrophic lateral sclerosis using human chromosome 21 microsatellite DNA markers. Am J Med Genet 51, 61–69. 10. Bruijn, L. I., Miller, T. M., and Cleveland, D. W. (2004). Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu Rev Neurosci 27, 723–749. 11. Wong, P. C., and Borchelt, D. R. (1995). Motor neuron disease caused by mutations in superoxide dismutase. Curr Opin Neurol 8, 294–301. 12. Alexander, G. M., Erwin, K. L., Byers, N., Deitch, J. S., Augelli, B. J., Blankenhorn, E. P., and Heiman-Patterson, T. D. (2004). Effect of transgene copy number on survival in the G93A SOD1 transgenic mouse model of ALS. Brain Res Mol Brain Res 130, 7–15. 13. Reaume, A. G., Elliott, J. L., Hoffman, E. K., Kowall, N. W., Ferrante, R. J., Siwek, D. F., Wilcox, H. M., Flood, D. G., Beal, M. F., Brown, R. H., Jr. et al. (1996). Motor neurons in Cu/Zn superoxide dismutase-deficient mice develop normally but exhibit enhanced cell death after axonal injury. Nat Genet 13, 43– 47. 14. Shefner, J. M., Reaume, A. G., Flood, D. G., Scott, R. W., Kowall, N. W., Ferrante, R. J., Siwek, D. F., Upton-Rice, M., and Brown, R. H., Jr. (1999). Mice lacking cytosolic copper/zinc superoxide dismutase display a distinctive motor axonopathy. Neurology 53, 1239–1246. 15. Peng Ho, S., Livanov, V., Zhang, W., Li, J., and Lesher, T. (1998). Modification of phosphorothioate oligonucleotides yields potent analogs with minimal toxicity for antisense experiments in the CNS. Brain Res Mol Brain Res 62, 1–11. 16. Banks, W. A., Farr, S. A., Butt, W., Kumar, V. B., Franko, M. W., and Morley, J. E. (2001). Delivery across the blood-brain barrier of antisense directed against amyloid beta: reversal of learning and memory deficits in mice overexpressing amyloid precursor protein. J Pharmacol Exp Ther 297, 1113–1121. 17. McMahon, B. M., Mays, D., Lipsky, J., Stewart, J. A., Fauq, A., and Richelson, E. (2002). Pharmacokinetics and tissue distribution of a peptide nucleic acid after intravenous administration. Antisense Nucleic Acid Drug Dev 12, 65–70. 18. Turner, B. J., Cheah, I. K., Macfarlane, K. J., Lopes, E. C., Petratos, S., Langford, S. J., and Cheema, S. S. (2003). Antisense peptide nucleic acid-mediated knockdown of the p75 neurotrophin receptor delays motor neuron disease in mutant SOD1 transgenic mice. J Neurochem 87, 752–763. 19. Broaddus, W. C., Prabhu, S. S., Wu-Pong, S., Gillies, G. T., and Fillmore, H. (2000). Strategies for the design and delivery of antisense oligonucleotides in central nervous system. Methods Enzymol 314, 121–135. 20. Schlingensiepen, R., Goldbrunner, M., Szyrach, M. N., Stauder, G., Jachimczak, P., Bogdahn, U., Schulmeyer, F., Hau, P., and Schlingensiepen, K. H. (2005). Intracerebral and intrathecal infusion of the TGF-beta2-specific antisense phosphorothioate oligonucleotide AP 12009 in rabbits and primates: Toxicology and Safety. Oligonucleotides 15, 94–104. 21. Whitesell, L., Geselowitz, D., Chavany, C., Fahmy, B., Walbridge, S., Alger, J. R., and Neckers, L. M. (1993). Stability, clearance, and disposition of intraventricularly administered oligodeoxynucleotides: implications for therapeutic application within the central nervous system. Proc Natl Acad Sci USA 90, 4665–4669. 22. Yaida, Y., and Nowak, T. S., Jr. (1995). Distribution of phosphodiester and phosphorothioate oligonucleotides in rat brain after intraventricular and intrahippocampal administration determined by in situ hybridization. Regul Pept 59, 193–199. 23. Yee, F., Ericson, H., Reis, D. J., and Wahlestedt, C. (1994). Cellular uptake of intracerebroventricularly administered biotin- or digoxigenin-labeled antisense oligodeoxynucleotides in the rat. Cell Mol Neurobiol 14, 475– 486.

CRC_8796_ch026.qxd

742

6/20/2007

10:48 PM

Page 742


24. Smith, R. A., Miller, T. M., Yamanaka, K., Monia, B. P., Condon, T. P., Hung, G., Lobsiger, C. S., Ward, C. M., McAlonis-Downes, M., Wei, H. et al. (2006). Antisense oligonucleotide therapy for neurodegenerative disease. J Clin Invest 116, 2290–2296. 25. Monia, B. P., Lesnik, E. A., Gonzalez, C., Lima, W. F., McGee, D., Guinosso, C. J., Kawasaki, A. M., Cook, P. D., and Freier, S. M. (1993). Evaluation of 2⬘-modified oligonucleotides containing 2⬘-deoxy gaps as antisense inhibitors of gene expression. J Biol Chem 268, 14514–14522. 26. Santoro, S. W., and Joyce, G. F. (1997). A general purpose RNA-cleaving DNA enzyme. Proc Natl Acad Sci USA 94, 4262–4266. 27. Sharp, P. A., and Zamore, P. D. (2000). Molecular biology. RNA interference. Science 287, 2431–2433. 28. Zamore, P. D., and Haley, B. (2005). Ribo-gnome: the big world of small RNAs. Science 309, 1519–1524. 29. Nelson, P., Kiriakidou, M., Sharma, A., Maniataki, E., and Mourelatos, Z. (2003). The microRNA world: small is mighty. Trends Biochem Sci 28, 534–540. 30. Dorn, G., Abdel’Al, S., Natt, F. J., Weiler, J., Hall, J., Meigel, I., Mosbacher, J., and Wishart, W. (2001). Specific inhibition of the rat ligand-gated ion channel P2X3 function via methoxyethoxy-modified phosphorothioated antisense oligonucleotides. Antisense Nucleic Acid Drug Dev 11, 165–174. 31. Thakker, D. R., Natt, F., Husken, D., Maier, R., Muller, M., van der Putten, H., Hoyer, D., and Cryan, J. F. (2004). Neurochemical and behavioral consequences of widespread gene knockdown in the adult mouse brain by using nonviral RNA interference. Proc Natl Acad Sci USA 101, 17270–17275. 32. Xia, H., Mao, Q., Eliason, S. L., Harper, S. Q., Martins, I. H., Orr, H. T., Paulson, H. L., Yang, L., Kotin, R. M., and Davidson, B. L. (2004). RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia. Nat Med 10, 816–820. 33. Harper, S. Q., Staber, P. D., He, X., Eliason, S. L., Martins, I. H., Mao, Q., Yang, L., Kotin, R. M., Paulson, H. L., and Davidson, B. L. (2005). RNA interference improves motor and neuropathological abnormalities in a Huntington’s disease mouse model. Proc Natl Acad Sci USA 102, 5820–5825. 34. Miller, T. M., Kaspar, B. K., Kops, G. J., Yamanaka, K., Christian, L. J., Gage, F. H., and Cleveland, D. W. (2005). Virus-delivered small RNA silencing sustains strength in amyotrophic lateral sclerosis. Ann Neurol 57, 773–776. 35. Ralph, G. S., Radcliffe, P. A., Day, D. M., Carthy, J. M., Leroux, M. A., Lee, D. C., Wong, L. F., Bilsland, L. G., Greensmith, L., Kingsman, S. M. et al. (2005). Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat Med 11, 429–433. 36. Raoul, C., Abbas-Terki, T., Bensadoun, J. C., Guillot, S., Haase, G., Szulc, J., Henderson, C. E., and Aebischer, P. (2005). Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11, 423–428. 37. Singer, O., Marr, R. A., Rockenstein, E., Crews, L., Coufal, N. G., Gage, F. H., Verma, I. M., and Masliah, E. (2005). Targeting BACE1 with siRNAs ameliorates Alzheimer disease neuropathology in a transgenic model. Nat Neurosci 8, 1343–1349. 38. Grimm, D., Streetz, K. L., Jopling, C. L., Storm, T. A., Pandey, K., Davis, C. R., Marion, P., Salazar, F., and Kay, M. A. (2006). Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature 441, 537–541. 39. Senn, J. J., Burel, S., and Henry, S. P. (2005). Non-CpG-containing antisense 2⬘-methoxyethyl oligonucleotides activate a proinflammatory response independent of Toll-like receptor 9 or myeloid differentiation factor 88. J Pharmacol Exp Ther 314, 972–979. 40. Schobitz, B., Pezeshki, G., Probst, J. C., Reul, J. M., Skutella, T., Stohr, T., Holsboer, F., and Spanagel, R. (1997). Centrally administered oligodeoxynucleotides in rats: occurrence of non-specific effects. Eur J Pharmacol 331, 97–107. 41. Smith, R. A. (2000). Effects of the early diagnosis of amyotrophic lateral sclerosis on the patient: disadvantages. Amyotroph Lateral Scler Other Motor Neuron Disord Suppl 1, S75–S77. 42. Hetz, C., Bernasconi, P., Fisher, J., Lee, A. H., Bassik, M. C., Antonsson, B., Brandt, G. S., Iwakoshi, N. N., Schinzel, A., Glimcher, L. H., and Korsmeyer, S. J. (2006). Proapoptotic BAX and BAK modulate the unfolded protein response by a direct interaction with IRE1alpha. Science 312, 572–576. 43. Everett, C. M., and Wood, N. W. (2004). Trinucleotide repeats and neurodegenerative disease. Brain 127, 2385–2405. 44. Bates, G. (2003). Huntingtin aggregation and toxicity in Huntington’s disease. Lancet 361, 1642–1644. 45. Glabe, C. G., and Kayed, R. (2006). Common structure and toxic function of amyloid oligomers implies a common mechanism of pathogenesis. Neurology 66, S74–S78.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 743


743

46. Bansal, V., Kalita, J., and Misra, U. K. (2006). Diabetic neuropathy. Postgrad Med J 82, 95–100. 47. Baron, R. (2000). Peripheral neuropathic pain: from mechanisms to symptoms. Clin J Pain 16, S12–S20. 48. Zimmermann, M. (2001). Pathobiology of neuropathic pain. Eur J Pharmacol 429, 23–37. 49. Jensen, T. S., Gottrup, H., Sindrup, S. H., and Bach, F. W. (2001). The clinical picture of neuropathic pain. Eur J Pharmacol 429, 1–11. 50. Brenner, G. J., Ji, R. R., Shaffer, S., and Woolf, C. J. (2004). Peripheral noxious stimulation induces phosphorylation of the NMDA receptor NR1 subunit at the PKC-dependent site, serine-896, in spinal cord dorsal horn neurons. Eur J Neurosci 20, 375–384. 51. Hua, X. Y., Moore, A., Malkmus, S., Murray, S. F., Dean, N., Yaksh, T. L., and Butler, M. (2002). Inhibition of spinal protein kinase Calpha expression by an antisense oligonucleotide attenuates morphine infusion-induced tolerance. Neuroscience 113, 99–107. 52. Honore, P., Kage, K., Mikusa, J., Watt, A. T., Johnston, J. F., Wyatt, J. R., Faltynek, C. R., Jarvis, M. F., and Lynch, K. (2002). Analgesic profile of intrathecal P2X(3) antisense oligonucleotide treatment in chronic inflammatory and neuropathic pain states in rats. Pain 99, 11–19. 53. Maher, E. A., Furnari, F. B., Bachoo, R. M., Rowitch, D. H., Louis, D. N., Cavenee, W. K., and DePinho, R. A. (2001). Malignant glioma: genetics and biology of a grave matter. Genes Dev 15, 1311–1333. 54. Pulkkanen, K. J., and Yla-Herttuala, S. (2005). Gene therapy for malignant glioma: current clinical status. Mol Ther 12, 585–598. 55. Halatsch, M. E., Schmidt, U., Behnke-Mursch, J., Unterberg, A., and Wirtz, C. R. (2006). Epidermal growth factor receptor inhibition for the treatment of glioblastoma multiforme and other malignant brain tumours. Cancer Treat Rev 32, 74–89. 56. Zhang, Y., Zhang, Y. F., Bryant, J., Charles, A., Boado, R. J., and Pardridge, W. M. (2004). Intravenous RNA interference gene therapy targeting the human epidermal growth factor receptor prolongs survival in intracranial brain cancer. Clin Cancer Res 10, 3667–3677. 57. Grossman, S. A., Alavi, J. B., Supko, J. G., Carson, K. A., Priet, R., Dorr, F. A., Grundy, J. S., and Holmlund, J. T. (2005). Efficacy and toxicity of the antisense oligonucleotide aprinocarsen directed against protein kinase C-alpha delivered as a 21-day continuous intravenous infusion in patients with recurrent high-grade astrocytomas. Neuro-oncol 7, 32–40. 58. Trifilo, M. J., Yajima, T., Gu, Y., Dalton, N., Peterson, K. L., Race, R. E., Meade-White, K., Portis, J. L., Masliah, E., Knowlton, K. U. et al. (2006). Prion-induced amyloid heart disease with high blood infectivity in transgenic mice. Science 313, 94–97. 59. Ma, J., Wollmann, R., and Lindquist, S. (2002). Neurotoxicity and neurodegeneration when PrP accumulates in the cytosol. Science 298, 1781–1785. 60. Kocisko, D. A., Vaillant, A., Lee, K. S., Arnold, K. M., Bertholet, N., Race, R. E., Olsen, E. A., Juteau, J. M., and Caughey, B. (2006). Potent antiscrapie activities of degenerate phosphorothioate oligonucleotides. Antimicrob Agents Chemother 50, 1034–1044. 61. Bueler, H., Aguzzi, A., Sailer, A., Greiner, R. A., Autenried, P., Aguet, M., and Weissmann, C. (1993). Mice devoid of PrP are resistant to scrapie. Cell 73, 1339–1347. 62. Moore, R. C., Lee, I. Y., Silverman, G. L., Harrison, P. M., Strome, R., Heinrich, C., Karunaratne, A., Pasternak, S. H., Chishti, M. A., Liang, Y. et al. (1999). Ataxia in prion protein (PrP)-deficient mice is associated with upregulation of the novel PrP-like protein doppel. J Mol Biol 292, 797–817. 63. Weissmann, C., and Aguzzi, A. (1999). Perspectives: neurobiology. PrP’s double causes trouble. Science 286, 914–915. 64. Galpern, W. R., and Lang, A. E. (2006). Interface between tauopathies and synucleinopathies: a tale of two proteins. Ann Neurol 59, 449–458. 65. Ingelsson, M., Fukumoto, H., Newell, K. L., Growdon, J. H., Hedley-Whyte, E. T., Frosch, M. P., Albert, M. S., Hyman, B. T., and Irizarry, M. C. (2004). Early Abeta accumulation and progressive synaptic loss, gliosis, and tangle formation in AD brain. Neurology 62, 925–931. 66. Giannakopoulos, P., Herrmann, F. R., Bussiere, T., Bouras, C., Kovari, E., Perl, D. P., Morrison, J. H., Gold, G., and Hof, P. R. (2003). Tangle and neuron numbers, but not amyloid load, predict cognitive status in Alzheimer’s disease. Neurology 60, 1495–1500. 67. Lleo, A., Greenberg, S. M., and Growdon, J. H. (2006). Current pharmacotherapy for Alzheimer’s disease. Annu Rev Med 57, 513–533.

CRC_8796_ch026.qxd

744

6/20/2007

10:48 PM

Page 744


68. Summers, W. K., Majovski, L. V., Marsh, G. M., Tachiki, K., and Kling, A. (1986). Oral tetrahydroaminoacridine in long-term treatment of senile dementia, Alzheimer type. N Engl J Med 315, 1241–1245. 69. Winblad, B., Engedal, K., Soininen, H., Verhey, F., Waldemar, G., Wimo, A., Wetterholm, A. L., Zhang, R., Haglund, A., and Subbiah, P. (2001). A 1-year, randomized, placebo-controlled study of donepezil in patients with mild to moderate AD. Neurology 57, 489–495. 70. D’Andrea, M. R., and Nagele, R. G. (2006). Targeting the alpha 7 nicotinic acetylcholine receptor to reduce amyloid accumulation in Alzheimer’s disease pyramidal neurons. Curr Pharm Des 12, 677–684. 71. Tomita, T., and Iwatsubo, T. (2006). Gamma-secretase as a therapeutic target for treatment of Alzheimer’s disease. Curr Pharm Des 12, 661–670. 72. Nawrot, B. (2004). Targeting BACE with small inhibitory nucleic acids – a future for Alzheimer’s disease therapy? Acta Biochim Pol 51, 431–444. 73. Broytman, O., and Malter, J. S. (2004). Anti-Abeta: The good, the bad, and the unforeseen. J Neurosci Res 75, 301–306. 74. Price, D. L., and Sisodia, S. S. (1998). Mutant genes in familial Alzheimer’s disease and transgenic models. Annu Rev Neurosci 21, 479–505. 75. Thinakaran, G., Borchelt, D. R., Lee, M. K., Slunt, H. H., Spitzer, L., Kim, G., Ratovitsky, T., Davenport, F., Nordstedt, C., Seeger, M. et al. (1996). Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo. Neuron 17, 181–190. 76. Cleveland, D. W., Hwo, S. Y., and Kirschner, M. W. (1977). Purification of tau, a microtubule-associated protein that induces assembly of microtubules from purified tubulin. J Mol Biol 116, 207–225. 77. Iwai, A., Masliah, E., Yoshimoto, M., Ge, N., Flanagan, L., de Silva, H. A., Kittel, A., and Saitoh, T. (1995). The precursor protein of non-A beta component of Alzheimer’s disease amyloid is a presynaptic protein of the central nervous system. Neuron 14, 467–475. 78. Zheng, H., Jiang, M., Trumbauer, M. E., Sirinathsinghji, D. J., Hopkins, R., Smith, D. W., Heavens, R. P., Dawson, G. R., Boyce, S., Conner, M. W. et al. (1995). Beta-amyloid precursor protein-deficient mice show reactive gliosis and decreased locomotor activity. Cell 81, 525–531. 79. Cai, H., Wang, Y., McCarthy, D., Wen, H., Borchelt, D. R., Price, D. L., and Wong, P. C. (2001). BACE1 is the major beta-secretase for generation of Abeta peptides by neurons. Nat Neurosci 4, 233–234. 80. Harada, A., Oguchi, K., Okabe, S., Kuno, J., Terada, S., Ohshima, T., Sato-Yoshitake, R., Takei, Y., Noda, T., and Hirokawa, N. (1994). Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature 369, 488–491. 81. Santacruz, K., Lewis, J., Spires, T., Paulson, J., Kotilinek, L., Ingelsson, M., Guimaraes, A., DeTure, M., Ramsden, M., McGowan, E. et al. (2005). Tau suppression in a neurodegenerative mouse model improves memory function. Science 309, 476–481. 82. Lucas, J. J., Hernandez, F., Gomez-Ramos, P., Moran, M. A., Hen, R., and Avila, J. (2001). Decreased nuclear beta-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3beta conditional transgenic mice. EMBO J 20, 27–39. 83. Phiel, C. J., Wilson, C. A., Lee, V. M., and Klein, P. S. (2003). GSK-3alpha regulates production of Alzheimer’s disease amyloid-beta peptides. Nature 423, 435–439. 84. Benson, M. D., Kluve-Beckerman, B., Zeldenrust, S. R., Siesky, A. M., Bodenmiller, D. M., Showalter, A. D., and Sloop, K. W. (2006). Targeted suppression of an amyloidogenic transthyretin with antisense oligonucleotides. Muscle Nerve 33, 609–618. 85. Lim, S. R., and Hertel, K. J. (2001). Modulation of survival motor neuron pre-mRNA splicing by inhibition of alternative 3⬘ splice site pairing. J Biol Chem 276, 45476–45483. 86. Skordis, L. A., Dunckley, M. G., Yue, B., Eperon, I. C., and Muntoni, F. (2003). Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci USA 100, 4114–4119. 87. Lu, Q. L., Rabinowitz, A., Chen, Y. C., Yokota, T., Yin, H., Alter, J., Jadoon, A., Bou-Gharios, G., and Partridge, T. (2005). Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 102, 198–203. 88. Aartsma-Rus, A., Kaman, W. E., Weij, R., den Dunnen, J. T., van Ommen, G. J., and van Deutekom, J. C. (2006). Exploring the frontiers of therapeutic exon skipping for duchenne muscular dystrophy by double targeting within one or multiple exons. Mol Ther 14, 401–407.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 745


745

89. Lu, Q. L., Morris, G. E., Wilton, S. D., Ly, T., Artem’yeva, O. V., Strong, P., and Partridge, T. A. (2000). Massive idiosyncratic exon skipping corrects the nonsense mutation in dystrophic mouse muscle and produces functional revertant fibers by clonal expansion. J Cell Biol 148, 985–996. 90. Alter, J., Lou, F., Rabinowitz, A., Yin, H., Rosenfeld, J., Wilton, S. D., Partridge, T. A., and Lu, Q. L. (2006). Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 12, 175–177. 91. Takeshima, Y., Yagi, M., Wada, H., Ishibashi, K., Nishiyama, A., Kakumoto, M., Sakaeda, T., Saura, R., Okumura, K., and Matsuo, M. (2006). Intravenous infusion of an antisense oligonucleotide results in exon skipping in muscle dystrophin mRNA of Duchenne muscular dystrophy. Pediatr Res 59, 690–694.

CRC_8796_ch026.qxd

6/20/2007

10:48 PM

Page 746

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 747

CHAPTER

27

Mechanisms and Therapeutic Applications of Immune Modulatory Oligodeoxynucleotide and Oligoribonucleotide Ligands for Toll-Like Receptors Jörg Vollmer and Arthur M. Krieg

CONTENTS 27.1 27.2 27.3 27.4 27.5

Introduction .........................................................................................................................747 History of Immune Activation by Synthetic ODN and Identification of the CpG Motif ..748 MOA of CpG ODN and Role of TLR9 ..............................................................................748 Classes of Immune Modulatory ODN and Their Immune Stimulatory Effects.................751 Structure–Activity Relationship of CpG ODN...................................................................753 27.5.1 Characteristics of the CpG B-Class ......................................................................753 27.5.2 Characteristics of the CpG A-Class ......................................................................754 27.5.3 Characteristics of the CpG C-Class ......................................................................754 27.5.4 ODN Lacking CpG Motifs and Their TLR-Dependent Effects ...........................754 27.5.5 Characteristics of the S-Class ...............................................................................755 27.6 Therapeutic Applications of CpG ODN .............................................................................755 27.6.1 Infectious Disease Monotherapy...........................................................................755 27.6.2 Infectious Disease Vaccines ..................................................................................757 27.6.3 Cancer ...................................................................................................................758 27.6.4 Asthma/Allergy .....................................................................................................759 27.6.5 Autoimmunity .......................................................................................................759 27.6.6 Safety of CpG ODN..............................................................................................759 27.7 Identification and Immune Stimulatory Effects of Oligoribonucleotide Ligands for TLR7 and TLR8 ............................................................................................................760 27.8 Conclusion ..........................................................................................................................762 References ......................................................................................................................................762

27.1 INTRODUCTION Most of the therapeutic applications for synthetic oligodeoxynucleotides (ODN) and oligoribonucleotides (ORN) relate to the role of DNA as the genetic blueprint, and to mechanisms of manipulating gene expression based on Watson–Crick base pairing to endogenous nucleic acids. 747

CRC_8796_ch027.qxd

748

5/5/2007

03:46 PM

Page 748


However, in recent years it has become clear that the immune system has evolved defense mechanisms against infections that are based on the detection of infecting viral/bacterial nucleic acids. In some cases, synthetic ODN and ORN can trigger these defenses. Although this is generally considered to be an unwanted toxicity when the goal is developing a drug based on antisense or siRNA mechanisms, immune stimulatory ODN have recently proven to be promising drug candidates in their own right, and are currently in phase III human trials for several indications, while immune stimulatory ORN are at a much earlier stage of clinical development. The purpose of this chapter is to review this field of therapeutic immune activation by ODN and ORN.

27.2 HISTORY OF IMMUNE ACTIVATION BY SYNTHETIC ODN AND IDENTIFICATION OF THE CpG MOTIF Early during the development of antisense ODN, reports began to emerge on the appearance of strong and unexpected immune stimulatory effects of certain phosphorothioate (PS) ODN that had been designed to be antisense, and also for some control ODN [1–4]. At first, the immune stimulation seemed to be rather unpredictable, and there was no apparent common sequence motif to unify these different observations. While pursuing our own antisense studies, we (AMK) became intrigued by these immune stimulatory effects, and performed a series of experiments to define their structure–activity relationship. Eventually, we discovered that the immune stimulation in each case resulted from the presence of a CpG dinucleotide, in the presence of certain flanking bases on the 5⬘ and 3⬘ sides, which have become known as “CpG motifs” ([5] reviewed in [6]). For example, if a CpG is preceded by a C and followed by a G, the immune stimulation is generally reduced, compared to other CpG motifs. As will be described in greater detail below, the most important base positions for determining the immune stimulatory effect of a CpG dinucleotide are the two bases on its 5⬘ and 3⬘ sides, which comprise the CpG motif. While the CpG motif explained the previously observed immune stimulatory effects of antisense ODN, it raised a new question of whether these effects served any physiological purpose, and if so, what? It is now accepted that immune recognition of CpG motifs allows the immune system to distinguish self DNA from invading viral or bacterial DNAs, which differ markedly from vertebrate DNA in their CpG content and methylation [7]. Bacterial and many viral DNAs generally contain the expected frequency of about one CpG dinucleotide per 16 bases, but CpG dinucleotides are markedly suppressed in vertebrate genomes to about 1/4 of the expected frequency if base utilization was random. Furthermore, the bases flanking CpGs in vertebrate genomes are not random: the most common base preceding a CpG is a C and the most common base following a CpG is a G [8]. As noted, these types of CpG motifs have reduced immune stimulation, so their predominance in our genomes may contribute to the usual lack of immune activation from self DNA. In addition, CpG dinucleotides are not methylated in viral or bacterial DNAs, but in vertebrate genomes, the C of the CpG is usually methylated at the 5 position [7]. The functional effect of DNA methylation is clear—CpG ODN in which the C is replaced with a 5-methyl C have greatly decreased immune stimulatory effects, especially if the ODN backbone is phosphodiester (PO) [5,38]. In the case of ODN with PS backbones the reduction tends to be less complete. Thus, immune recognition of unmethylated CpG motifs functions as a defense mechanism for the detection of invading viruses and bacteria.

27.3 MOA OF CpG ODN AND ROLE OF TLR9 The most important single advance in understanding the mechanism of action of the CpG motif was probably the identification of its receptor, Toll-like receptor 9 (TLR9) [9]. Including TLR9, 10 human TLRs have been identified to date, and function as one family of what have been termed

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 749

APPLICATIONS OF IMMUNE MODULATORY ODN AND ORN LIGANDS

749

“pattern recognition receptors” (PRRs) (reviewed in [10]). PRRs have a general ability to detect certain molecular structures that are conserved in certain pathogens, but are not present or are not accessible to the appropriate PRRs in self tissues. Besides the CpG motif as a ligand for TLR9, examples of such TLR ligands include certain lipopeptides (detected by TLR2), double-stranded RNA (TLR3), endotoxins (TLR4), and flagellin (TLR5). The immune system appears to use the presence of any of these molecular structures as a danger signal that indicates the presence of one general type of infection and activates appropriate defense pathways. Vertebrates have two complementary immune systems, the innate and the adaptive. The primary function of the innate immune system is to detect infection and to initiate an appropriate response. TLRs are thought to play a very important role in this earliest phase of the immune response. The innate immune activation results in the induction of appropriate parts of the adaptive immune system, which is a highly sophisticated and far more specific set of defenses including most notably B and T cells, that specifically target the invader, and provide a memory response to prevent a repeat of the infection. The appropriate immune defense pathways differ for different types of pathogens. At the risk of oversimplifying, if a pathogen replicates extracellularly, then the correct type of immune response to contain the infection is a Th2-like response, which is characterized by the predominant production of cytokines such as IL-4 and IL-5, and by production of antipathogen antibodies. Conversely, if a pathogen replicates intracellularly, the innate immune system should induce a Th1-like immune response, which is characterized by the predominant production of interferons (IFNs) and IL-12, and by cellular responses such as natural killer cells (NK) and cytolytic T cells, to kill infected cells. The family of TLRs is thought to play an important role in the detection and initial classification of infectious agents by detecting these PRRs. The classification of the pathogens as intracellular or extracellular may be assisted by the fact that the innate immune system has compartmentalized TLR expression: TLR2, 4, 5, and 6 are expressed on the cell surface of certain immune cells, where they detect components of extracellular pathogens, while TLR3, 7, 8, and 9 are expressed within the endosomal compartments of some immune cells, where they appear to be looking inward to detect nucleic acid components of intracellular pathogens [11]. The endosomal localization of TLR9 allows efficient detection of invading viral nucleic acids, while preventing accidental stimulation by CpG motifs within self DNA [12]. TLR9 is absolutely required for all known CpG-specific responses to synthetic PS ODN [9,13,14]. Although beyond the scope of this review, it should be noted that one or more TLR9-independent cytosolic pathways of DNA detection has recently been demonstrated, but this pathway appears to be specific for PO DNA, and requires that the DNA is transfected into the cells, and so may not be relevant to investigations using modified ODN [15–18]. TLR9-independent pathways have also been reported for PO DNA vaccines, though they are not yet characterized [19–21]. High concentrations of non-CpG PS ODN also have certain immune stimulatory effects, but these are almost completely TLR9-dependent, and are qualitatively different from the immune effects of a CpG ODN [14]. Each of the TLRs has a unique pattern of cellular expression, which likely enables the immune system to tailor its responses against different pathogen classes [10]. Among resting human immune cells, TLR9 is expressed primarily or exclusively in B cells and in plasmacytoid dendritic cells (pDC), which produce most of the type I IFN that is made in response to viral infection [22] (reviewed in [10]). Some studies have also reported functional TLR9 expression in activated but not in resting human neutrophils [23], monocytes and monocyte-derived cells [24,25], activated CD4 T cells [26], pulmonary epithelial cells [27,28], and intestinal epithelium [29,30]. In some studies, natural killer cells (NK) cells have been reported to express TLR9 and respond directly to CpG ODN [31–33], but in other studies this has not been observed, or they showed no direct response to CpG ODN [34–39]. However, the culture conditions used may not recreate the in vivo setting, in many cases the TLR9 expression was assessed using antibodies of uncertain specificity, and the functional significance of this TLR9 expression has not always been rigorously established. In some cases, the purity of the cells used may have been insufficient to completely exclude effects due to

CRC_8796_ch027.qxd

750

5/5/2007

03:46 PM

Page 750


contaminating pDC, which are activated even at concentrations of less than 0.1%. For example, we and others [40,41] have found that CpG-induced activation of human monocytes was indirect and dependent on the presence of contaminating pDC and IFN-. Eosinophils, neutrophils (polymorphonuclear leukocytes [PMN]), and basophils were reported to express TLR9 mRNA, but CpG ODNs in contrast to other TLR ligands such as lipopolysaccharide (LPS) did not induce direct immune modulatory effects in isolated human eosinophils or basophils [42]. To date, the only human cell types that universally and constitutively have been found to express TLR9 and respond to ODN stimulation in a CpG-specific manner are B cells and pDC. The tissue distribution of TLR expression in normal human tissues has been examined using PCR by the codiscoverers of TLR7, 8, and 9. Studies by these and other investigators have concluded that human hTLR9 mRNA has a more limited tissue expression profile than any of the other TLRs: “In contrast to all the other hTLRs, the hTLR9 is preferentially expressed in immune-cell-rich tissue including spleen, lymph node, bone marrow, and peripheral blood leukocytes” [43]. Generally, similar findings have been reported by the other groups that have performed quantitative PCR tissue distribution analyses of the hTLRs, with agreement that TLR9 mRNA is absent or only weakly detectable in adrenal gland, CNS, heart, kidney, liver, lung, pancreas, placenta, prostate, salivary gland, small intestine, spinal cord, testis, thyroid gland, trachea, and uterus [43–47]. Unfortunately, the cellular patterns of TLR expression vary between different species, so the results of TLR stimulation in one species may not be predictive of what will occur in another. For example, mice differ from primates in that they express TLR9 not only in pDC and B cells, but also in monocytes and myeloid DC (reviewed in [10]). This makes it difficult at best to use observations with CpG ODN in murine studies to predict accurately the effects of TLR9 activation in humans. In contrast to hTLR9, hTLR7 and hTLR8 appear to have a broader cell-type-specific expression. TLR7 RNA expression seems to be strongest in human pDC and B cells [48,49], and at least low hTLR7 RNA expression was reported in, for example, monocytes, monocyte-derived DC, mDC, and macrophages [47,48,50–54], although other reports showed lack of TLR7 expression from all or some of these cell types [41,55]. In contrast to hTLR7, hTLR8 RNA was readily observed in monocyte-derived DC, mDC, macrophages, Langerhans cells, or regulatory T cells [48,49,52,54–56], and was maximal in CD14+ mononuclear cells [47,48,57], but could not be detected in pDC and B cells [41,48,49,58]. Therefore, hTLR7 and hTLR9 colocalize in pDC and B cells, whereas hTLR8 and hTLR7 seem to be expressed in myeloid cells. Both receptors appear not be expressed in other cell types such as human NK cells and T cells, although some conflicting reports describe their RNA expression or lack of expression in these cell types [32,37,48,59]. Nevertheless, owing to the lack of appropriate antibodies it is difficult to judge functional TLR7/8 protein expression in the tested cells. In addition to the reported unfunctionality of murine mTLR8 [60], mTLR7 appears to be expressed in a wide variety of cells including murine pDC, CD8⫺ DC, B cells, regulatory T cells and macrophages [61–63]. TLR7 expression was also observed in CD8⫹ DC or T cells, although these cells did not respond to TLR7 activation [61,62,64]. In both rodents and humans, administration of a CpG ODN activates pDC to secrete IFN-, promoting Th1 adaptive immune responses [65]. TLR9-stimulated B cells and pDC show increased expression of costimulatory molecules, resistance to apoptosis, upregulation of the chemokine receptor CCR7, and secretion of Th1-promoting chemokines and cytokines such as MIP-1, IP-10, and other IFN-inducible genes [6]. These effects drive the migration and clustering of pDC in the T cell regions of lymph nodes and other lymphoid tissues. Coactivation of naïve, germinal center, or memory B cells through the B cell antigen receptor and TLR9 can be strong enough to drive their differentiation into antibody-secreting plasma cells [66]. In the case of memory B cells, which have been stimulated previously, activation through TLR9 alone is sufficient to drive differentiation to plasma cells [58,67]. We are unaware of any other single B cell mitogen that is as strong as an optimal B-Class CpG ODN, which has provided applications for CpG in promoting the production of antigen-specific human antibodies. The efficiency of hybridoma generation from purified primary

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 751


751

human memory B cells is improved from 1–2% without a CpG ODN to 30–100% with the addition of PF-3512676 (formerly known as CPG 7909 or ODN 2006) [68]. CpG-induced plasma cell differentiation does not require T cell help, but its efficiency is enhanced further by interactions with pDC and by B cell receptor (BCR) crosslinking [69]. The net effect of TLR9 activation is to induce Th1-biased cellular and humoral effector functions of innate and adaptive immunity. Since we now know that TLR9 is an intracellular protein, it is not surprising that immune cell stimulation by CpG ODN requires internalization [5]. ODN internalization occurs spontaneously in culture without the need for uptake enhancers or transfection, is temperature- and energy-dependent, and appears to be relatively sequence-independent. Recent studies have shown that transfection of CpG ODN into cells can dramatically enhance certain of their immune stimulatory effects, especially the induction of IFN- secretion [70]. The mechanism for this effect is not yet clear. Once internalized, CpG motifs appear to induce the relocalization of TLR9 from the endoplasmic reticulum into the endosomal vesicle containing the ODN, leading to the direct binding and recognition of the CpG by TLR9, possibly in a pH-dependent fashion [71,72]. The earliest described step in the CpG-induced signal transduction pathways is the generation of reactive oxygen species, which can be detected within a few minutes [73,74]. These steps lead to the rapid recruitment and activation of the adaptor molecules MyD88, IL-1 receptor-associated kinase (IRAK)-1, IRF-7, and TNF- receptor activated factor 6 (TRAF6) [72,75–79]. This results in the rapid activation of several mitogen-activated protein kinases (MAPKs) including extracellular receptor kinase (ERK), p38, and Jun N-terminal kinase as well as the IB complex, which pathways converge on the nucleus to alter gene transcription [80–86]. All of these steps can be blocked by inhibitors of endosomal acidification/maturation [73,75,87,88], the mechanism of which are incompletely understood, or by inhibitors of phosphatidylinositol 3 kinase (PI3-kinase), which appears to have a role in the ODN internalization [89]. To date, there has been a paucity of studies examining these questions for TLR7/8, and it is unclear whether the signaling pathways triggered by TLR7 and TLR8 differ in any significant way from those induced by TLR9.

27.4 CLASSES OF IMMUNE MODULATORY ODN AND THEIR IMMUNE STIMULATORY EFFECTS Three different major immune stimulatory classes of CpG ODN were identified that induce diverse immune modulatory profiles: the A-, B- and C-Classes. The earliest identified CpG ODN class, the B-Class, are linear molecules that strongly activate B cells, stimulate the release of Th1like cytokines and chemokines including moderate levels of IFN- and upregulate costimulatory and MHC molecules on the cell surface of professional antigen presenting cell (APC) [5,90]. In contrast, another class of CpG ODN, the A-Class, forms higher ordered structures that appear to be responsible for the induction of high IFN- production from pDC [91,92]. Nevertheless, A-Class ODN are surprisingly weak in mediating TLR9-dependent NFB signaling or other TLR9-dependent effects such as pDC maturation and B cell stimulation [91,93]. The third class of CpG ODN, the C-Class, combines the characteristics of the A- and B-Classes and stimulates strong IFN- production and B cell stimulation [93,94]. The composition of linear CpG motifs (as in B-Class ODN) with sequences forming secondary and tertiary structures (as in A-Class ODN) in the C-Class CpG ODN seems to be critical for the combined activities [93]. CpG A-Class ODN are retained for longer periods in endosomes together with the MyD88-IRF-7 complex [70], and the A- and C-Classes localize to different endolysosomal compartments than the B-Class CpG ODN [90,95]. The formation of secondary and tertiary structures appears to control compartmental retention and intracellular distribution, and results in the triggering of IRF-7-mediated intracellular signaling pathways from early endosomes by the A- and C-Classes leading to their strong IFN- induction. Human TLR9 triggering induces particularly the release of antiviral and antitumoral Th1 and Th1-like cytokines and chemokines. All type I IFN subtypes, as well as the type I IFN proteins

CRC_8796_ch027.qxd

752

5/5/2007

03:46 PM

Page 752


IFN- and IFN- are produced upon CpG stimulation [91,96,97]. In addition, the recently described type III IFNs, IL-28A/B and IL-29, that exhibit IFN-like antiviral activity, induce typical IFN-inducible genes and share homology with IFN-, are stimulated by all three classes of CpG ODN, although to different degrees as observed for type I and II IFNs [97]. A- and C-Class ODN induce highest upregulation of IL-28, IL-29, and IFN- mRNA, as well as strongest production of type I IFNs [91,93,94,98], whereas the B-Class induces moderate amounts of these IFNs. In contrast to type I and III IFNs, the production of IFN- from human immune cells is weaker, and most probably results from an indirect activation of the IFN- producers NK, NKT and T cells [36,37,99–103]. Additional cytokines exhibiting antiviral and antitumor effects induced by CpGdependent TLR9 stimulation include IL-18 and TNF-related apoptosis-inducing ligand (TRAIL). TRAIL enables monocytes to kill tumor cells and IL-18 augments the cytolytic activity of NK cells [104–106]. In contrast, IL-12 production from human immune cells appears to be weaker compared to murine cells, but nevertheless contributes along with IFN- and TNF- to the CpG-mediated cytolytic activities of human NK cells [33,36,92]. CpG stimulation also results in the secretion of IFN-inducible proteins, including OAS, Mx1, MCP-1, or IP-10 [40,98,107]. Although the A- and C-Classes produce highest IFN- levels, and IP-10 production strongly depends on IFN-mediated monocyte activation, B-Class ODN stimulate levels of IP-10 secretion that are higher than expected from their modest IFN- induction [108]. This appears to be due to direct stimulation of IP-10 production in TLR9-expressing B cells and pDC, that is synergistically enhanced by IFN- [40,108]. In contrast to the Th1 and Th1-like cytokines, CpG ODN induce relatively few proinflammatory cytokines such as TNF- from human immune cells, only consistent IL-6 production from B cells that is lower than LPS-mediated IL-6 is observed upon in vitro CpG stimulation [93,109,110]. When administered to normal humans by subcutaneous injection B-Class CpG ODN induced an increase in serum levels of IFN- as well as of multiple IFN-inducible genes, whereas serum IL-6 and IL-12p40 were still lower in magnitude compared to increases usually observed in mice upon CpG injection. No statistically significant change for other cytokines such as TNF- was observed, despite the previously reported strong induction of serum TNF- and IL-6 in various rodent studies [6,111,112]. The immune effects reported in humans appear to correlate with the observed in vitro effects, and suggest that the cytokine-mediated toxicities observed in rodents are unlikely to occur in humans, presumably due to the species- and cell-specific differences in TLR9 expression. CpG stimulation also induces the production of negative regulators of the CpG response dependent on the ODN class [113]. For example, IL-10 is secreted by murine macrophages and murine and human B cells upon CpG B- and C-Class stimulation [93,114]. The CpG-induced IL-10 negatively affects pDC IFN- secretion perhaps functioning to limit an otherwise potentially dangerous IFN-mediated immune response [115–117]. Besides the CpG-dependent stimulation of cytokines and chemokines, CpG ODN also induce an enhanced expression of activation markers, cytokine and chemokine receptors, costimulatory and MHC molecules on several immune cell types including antigen-presenting cells that are important for triggering adaptive immune responses. Such molecules include the early activation marker CD69 on NK, NKT, and T cells, the costimulatory molecules CD80 and CD86 (B7-1 and B7-2) on B cells, monocytes, mDC or pDC that provide an important costimulatory signal to T cells, MHC I and II molecules on DC, monocytes or B cells leading to enhanced antigen-presentation and antigen-specific T cell responses [32,93,98,99,103,109,118,119]. In contrast to the CpG A-, B-, and C-Classes that efficiently trigger diverse TLR9-mediated stimulatory effects, inhibitory ODN sequences were identified that block TLR9-dependent activation. The mode of action of these suppressive ODN (S-Class) is incompletely understood, but appears not to be due to competition for uptake of immune stimulatory DNA [120–122]. S-Class ODN may directly interfere with binding of the CpG ligand to TLR9 and can contain defined sequence motifs selectively acting not only on TLR9 but also on TLR7 and TLR8 [98,123,124]. The identification of ODN selectively suppressing TLR activation results in a tool to specifically inhibit, modulate, or tailor TLR-mediated immune responses. S-Class ODN not only block

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 753


753

pathogen DNA- or RNA-mediated stimulation, but also suppress immune stimulatory effects mediated by self DNA and RNA [123–127]. This is especially of interest as TLR signaling appears to be involved in autoimmunity. In autoimmune responses to DNA-containing chromatin–IgG or RNA-containing snRNP–IgG complexes TLR9 or TLR7 act in concert with Ig receptor engagement to promote autoreactive B cell or pDC activation that can be blocked by S-Class ODN [123,126,127]. Moreover, S-Class ODN were demonstrated in vivo to be effective as a treatment for rheumatoid arthritis or lupus in animal models [128,129]. These data link TLR activation to disease development, and, therefore, S-Class ODN may represent promising candidates for suppressing or limiting inflammatory responses in therapeutic indications such as systemic lupus erythematosus (SLE), where TLRs may drive inappropriate and pathogenic immune responses to self nucleic acids and their associated proteins.

27.5 STRUCTURE–ACTIVITY RELATIONSHIP OF CpG ODN 27.5.1 Characteristics of the CpG B-Class The activity of CpG ODN is determined by their sequence composition including the CpG motif(s), the number of these motifs, their spacing, position, and the surrounding bases, as well as the ODN length and the secondary and tertiary structure. B-Class CpG ODN are linear molecules containing 6mer CpG motifs with 5⬘-GTCGTT-3⬘ representing the human CpG motif, and 5⬘-GACGTT-3⬘ the murine CpG motif, reflecting the species-specific differences in CpG recognition [5,80,90,110]. The most potent B-Class ODN for activating human immune cells usually have two or three CpG motifs preceded by a 5⬘-TC and are between 20 and 26 nucleotides in length [6,14,110,130]. A 5⬘-TCG induces strongest immune effects, and the more 3⬘ the first CpG dinucleotide is positioned, the less stimulatory the B-Class ODN is: ideally the first CpG should be within two or three bases of the 5⬘ end that is critical for immune stimulation [110,130,131]. The CpG motifs are preferably spaced with at least two intervening Ts, and the overall T content of an ODN has a strong positive impact on immune modulation [14,110,132,133]. Chemical modifications positively or negatively affect the activity of B-Class CpG ODN. A PS backbone modification stabilizes CpG ODN against nuclease degradation and enhances their B cell stimulatory activity by about 10- to 100-fold compared to PO ODN [134], although this may be associated with some relative decrease in induction of IFN- secretion. In principle, the most stimulatory CpG sequence in a PO backbone is also most stimulatory with a PS backbone [121]. [Rp] diastereoisomer PS CpG ODN even evoke higher cell activation than the corresponding [Sp] ODN, suggesting that the P-chirality impacts the CpG-mediated activity [135,136]. In addition to backbone modifications, nucleobase modifications of the CpG dinucleotide(s) strongly affect the outcome of the TLR9dependent response [137–139]. Most cytosine modifications in CpG dinucleotides do cause a strong decrease to loss of immune stimulatory effects. It appears as if both the primary exocyclic amino group as well as the spatial requirements at C5 of cytosine are very important for the immune modulatory effects stimulated by CpG ODN via TLR9. In contrast, TLR9 appears to be more forgiving to modifications at the guanosine position. The recognition of the guanine base in the CpG motif appears to be primarily determined by the N7 and exocyclic O6 functions, meaning that guanine is recognized from the Hoogsteen base pairing site by TLR9. In addition, receptor recognition of CpG ODN appears to require a DNA-like rather than a RNA-type sugar conformation at the CpG motif: 2⬘ modifications or locked nucleic acids (LNA) at the CpG dinucleotides reduce or eliminate the immune stimulatory effects of CpG ODN [139–142]. Nevertheless, certain 2⬘ substitutions at positions distal from the CpG motif increase or decrease the immune modulatory response, although depending on the position, the kind, and number of modifications [143,144]. In addition to the species-specific differences observed for TLR9 CpG motif recognition, additional data generated by comparing human and mouse TLR9 signaling stimulated by ODN with chemical

CRC_8796_ch027.qxd

754

5/5/2007

03:46 PM

Page 754


modifications at the CpG indicate that the spatial requirements at the mouse receptor differ substantially from those of the human receptor [138]. Some CpG modifications that were reported not to alter immune effects observed in murine in vitro and in vivo models appeared to affect signaling induced via human TLR9. Therefore, the use of mouse models for ranking CpG ODN for human use appears to be of limited value. 27.5.2 Characteristics of the CpG A-Class In contrast to B-Class ODN, A-Class ODN form higher ordered structures and contain PS linked G runs at the 5⬘ and 3⬘ ends surrounding a PO palindromic CpG sequence [90–92]. These G residues and the palindromic core sequence are responsible for the formation of intermolecular G tetrads and highmolecular-weight aggregates. Preventing the formation of higher ordered structures by introducing 7-deaza-guanosine nucleotides or destroying the palindrome prevents IFN- production indicating that the G tetrads and the palindrome both are essential for the A-Class activity [91,145]. A-Class CpG ODN with palindromic 5⬘-purine-purine-C-G-purine-pyrimidine-C-G-pyrimidine-pyrimidine-3⬘ or 5⬘-purine-pyrimidine-C-G-purine-pyrimidine-3⬘ sequences are remarkably strong inducers of type I IFN secretion from human pDCs [91,145]. As observed for the B-Class, the immune modulatory effects of A-Class ODNs are influenced by their sequence, length, and chemical modifications. Nucleobase modification of the guanosine is relatively well tolerated, but cytosine modifications usually result in a strong decrease and loss of type I IFN induction [91,146]. In contrast to the B-Class, the A-Class strongly depends on the presence of a chimeric PO/PS backbone. Complete PS A-Class ODN in principle lack the capability to induce strong IFN- production from pDCs [91,92]. 27.5.3 Characteristics of the CpG C-Class C-Class CpG ODN combine the A- and B-Class characteristics and stimulate strong B cell and pDC type I IFN responses [93,94]. Similar to the B-Class, typical C-Class ODN preferably contain a linear stimulatory hexameric CpG motif 5⬘-GTCGTT-3⬘ positioned near the 5⬘ end, preferably adjacent to a 5⬘-TC and linked by a T spacer to a GC-rich palindromic sequence [93,98]. A wide range of modifications that maintain the GC-rich palindrome are well tolerated, but full immune activity requires physical linkage between the palindrome and the 5⬘ stimulatory sequence. The palindromic sequence similar to the A-Class appears to be involved in the formation of higher ordered structures that affect stability, uptake characteristics, and intracellular localization [147]. Indeed, C-Class ODN were demonstrated to be taken up in early as well as late endosomes, whereas B-Class ODN mainly reside in the late, and A-Class ODN in the early endosomes, suggesting that different signaling pathways are stimulated from these compartments leading to the differential CpG class effects [95]. The stimulatory capacities of C-Class CpG ODN are dependent on the length and the base content and are influenced by chemical modifications. C-Class ODN similar to the B-Class require unmodified 5⬘ CpG dinucleotides, modifications such as 5-methylation of the cytosine result in a strong reduction of the immune modulatory activity [93,94,98]. In addition, the C-Class requires a DNA-type sugar conformation for the CpG dinucleotides in the 5⬘ stimulatory sequence. In contrast, 2⬘ modifications in the 3⬘ palindromic sequence are allowed and do not strongly affect immune stimulatory activity [98]. 27.5.4 ODN Lacking CpG Motifs and Their TLR-Dependent Effects CpG-mediated B cell stimulation appears to be accomplished not only by CpG ODN but even appears to be achieved by PS thymidine-rich non-CpG ODN, although such ODN fail to induce detectable type I IFN production in pDC, despite promoting pDC maturation, as assessed by expression of costimulatory markers [14,132,133]. Thymidine-containing non-CpG ODN, and even more

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 755


755

so non-CpG ODN containing a 5⬘-TC motif stimulate TLR9-dependent effects, although with lower efficiency compared to unmodified CpG ODN [14,148]. They not only lack stimulation of Th1 and Th1-like cytokines and chemokines, but induce Th2-biased responses in vivo [14,149]. In addition, Th2-dominated effects are predominantly observed upon mucosal ODN application, and appears to be associated with the PS backbone, but is shifted to Th1 by CpG motifs [149]. Therefore, it appears as if TLR9 can mediate either Th1- or Th2-dominated responses with varying efficacy depending on whether it is stimulated by CpG or non-CpG ODN, and the route of administration. An additional important factor determining the activity of non-CpG ODN appears to be the intracellular localization and the amount of ODN delivered to the endosomal compartments. Enforced uptake by using a cationic lipid results in a several fold higher accumulation of ODN in LAMP-1-positive late endosomes [15], the same intracellular vesicles found to be the primary site of CpG A-Class localization [95]. Localization to LAMP-1-positive endosomes appears to be a prerequisite for IFN- induction, and by introducing high amounts of TLR9 ligands with low affinity, e.g., certain non-CpG ODN, a threshold ligand concentration in late endosomes may be reached that allows for some degree of IFN- induction even by non-CpG ODN. 27.5.5 Characteristics of the S-Class Certain sequences in PS ODN efficiently block TLR9-dependent effects. Inhibitory sequences in S-Class ODN do not contain classical CpG motifs, but sometimes differ only slightly from stimulatory motifs (e.g., 5⬘-GCGGG-3⬘ instead of 5⬘-GCGTT-3⬘) [120,121,150]. The identified murine suppressive motif is 5⬘-CCNnotCnotCNNGGGN-3⬘, where N is any base, and 5⬘-NCCNGGGN-3⬘ represents the human suppressive motif [98,120], and the activity of S-Class ODN depends on the presence of the consecutive 3⬘ Gs [98,121,124,151]. In addition, PS S-Class ODN exist that specifically interfere with the activation of either one of TLRs 7,8,9. PS ODN inhibiting TLR8-mediated signaling by the synthetic TLR7/8 ligand R-848 require a TLR8 suppressive motif comprising a 3⬘ GT dinucleotide [98], and ODN with a TLR7 suppressive 5⬘ GC motif inhibit R-848 mediated and TLR7-dependent IFN- production [124], although the PS backbone itself appears to interfere with TLR7-mediated immune modulation [98,138]. In summary, fine-tuning of the immune modulatory profiles of A-, B-, C-, or S-Class ODN is possible by introducing appropriate modifications including sequence mutations, alteration of the number and position of CpG motifs, chemical modifications inside and outside the CpG dinucleotides, or introduction of secondary and tertiary structures, allowing targeted generation of ODN for different therapeutic indications such as cancer, infectious disease, allergy, and autoimmune disease.

27.6 THERAPEUTIC APPLICATIONS OF CpG ODN 27.6.1 Infectious Disease Monotherapy Since the biologic function of TLR9 appears to be to stimulate protective immunity in response to infection by intracellular pathogens, we and others [152–157] have hypothesized that prophylactic or therapeutic treatment with a CpG ODN would protect against an intracellular infectious challenge and eliminate a chronic infection. Indeed, studies in mice have demonstrated that the innate immune defenses activated by B-Class CpG ODN (almost no studies have been reported with A- or C-Class) given by injection, inhalation, or even by oral administration can protect against a wide range of viral, bacterial, and even some parasitic pathogens, including lethal challenge with Category A agents or surrogates such as B. anthracis, vaccinia virus, F. tularensis, and Ebola, as well as more common pathogens such as L. monocytogenes, M. tuberculosis and influenza virus [152–169]. The mechanisms of protection have only been partially investigated. Protection in an L. monocytogenes model has been linked to CpG-activated DC, which protects

CRC_8796_ch027.qxd

756

5/5/2007

03:46 PM

Page 756


naïve mice upon adoptive transfer [170–172]. Additional cell types may also be able to provide some protection, since naïve mice that received CpG-pretreated spleen cells depleted of CD11c+ DC still had a partial survival benefit. In a herpes simplex virus challenge model mice depleted of pDC no longer were protected by CpG pretreatment and IFN- was also needed, since mice genetically deficient in the type I IFNR were no longer fully protected [173]. However, in a L. monocytogenes challenge model type I IFN were not required for CpG-induced protection, even though the protection was abolished when pDC were depleted [174]. In this and many other animal models IFN- was found to be critically required for the CpG-induced protection. Postexposure therapy with TLR9 activation is generally ineffective against rapidly progressive acute infectious agents. However, there may be a role for TLR9 activation in the therapy of chronic viral infections, since HBV transgenic mice treated with a CpG ODN showed a significant decrease in viral expression [175]. As hepatocytes normally do not express TLR9, the antiviral effect in this model is presumably indirect. HBV expression was not suppressed in mice genetically deficient in the type I IFN receptor, suggesting that the antiviral effect of CpG therapy in this model results from the CpG-induced IFN- secretion, presumably by pDC. Hepatitis C virus is an important human pathogen that chronically infects approximately 170 million people worldwide. Infection can lead to liver cirrhosis and death, and is currently the major cause of liver failure requiring transplantation in North America. Fewer than half of North American patients respond to the current standard of care treatment for HCV, which consists of 48 weeks of a combination therapy with IFN- and ribavirin. In up to 20% of acutely infected HCV patients, the immune system is able to clear the infection without specific therapy. This spontaneous viral clearance is associated with early and strong innate immune activation leading to the development of a strong and diverse adaptive immune response with anti-HCV Th1 and CD8 cytolytic T cells [176]. Since TLR9 activation can drive a similar pattern of innate and adaptive immune responses to that seen in the spontaneous resolvers, we investigated whether a C-Class CpG ODN, CPG 10101, may have activity against HCV. In a 4 week phase Ib blinded randomized controlled trial involving 60 HCV-infected subjects, monotherapy with once or twice weekly subcutaneous injection of CPG 10101 caused a dose-dependent decrease in blood viral RNA levels [177]. At the highest dose level of 0.75 mg/kg weekly, there was up to a 1.6 mean log reduction in viral RNA, which was associated with biomarkers for TLR9 activation, including NK cell activation and serum IFN- and IFN-inducible chemokines. Treatment was generally well tolerated, with the most common side effects being mild to moderate flu-like symptoms and injection site reactions, and the maximal tolerated dose was not reached. This trial showed encouraging anti-HCV activity for CpG 10101 as a monotherapy. Based on in vitro studies showing that exogenous IFN- primes human PBMC for stronger responses to CpG [178] and other studies suggesting synergy between TLR9 activation and ribavirin, we decided to perform a clinical trial using the CPG 10101 in a combination regimen, together with the conventional, partially effective therapy of pegylated IFN and ribavirin. The randomized phase Ib clinical study enrolled 74 evaluable genotype 1 patients chronically infected with Hepatitis C virus. All subjects had previously received at least 24 weeks of treatment with the standard of care (pegylated IFN and ribavirin), and achieved viral negativity, but had subsequently relapsed within 6 months of treatment. Patients in the study were randomly assigned to one of five groups, receiving 12 weekly doses of: CPG 10101 alone, CPG 10101 in combination with pegylated IFN, CPG 10101 with ribavirin, CPG 10101 with pegylated IFN and ribavirin, or pegylated IFN and ribavirin. CPG 10101 was administered by subcutaneous injection at a dose of 0.2 mg/kg once weekly. Patients who achieved a greater than 2 log (⬎99%) reduction in HCV RNA were eligible to continue on therapy for a total of 48 weeks and be followed for an additional 24 weeks to monitor for sustained virological responses. At 12 weeks, 50% (7 of 14) of treatment-refractory patients in the CPG 10101–pegylated IFN–ribavirin arm of the study achieved HCV RNA of undetectable levels, or viral negativity, versus only 2 of 13 of those patients who received pegylated IFN and ribavirin alone ( p ⫽ 0.050). The triplet combination of CPG 10101 with pegylated IFN and ribavirin resulted in a 3.3 mean log reduction in HCV RNA levels, versus a 2.3 mean log reduction

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 757


757

( p ⬍ 0.050) among patients receiving the control combination. The CPG 10101 combinations were generally well tolerated. Adverse events were similar to pegylated IFN and ribavirin treatment and were predominantly mild to moderate in intensity and consisted of flu-like symptoms, headache, and injection site reactions. CPG 10101 recently received fast track status from the FDA for the therapy of these treatment refractory patients, and is currently being evaluated in a phase II trial. 27.6.2 Infectious Disease Vaccines CpG ODN have become well established as a gold standard vaccine adjuvant, capable of inducing powerful antigen-specific antibody and Th1 cellular immune responses in many vertebrate species, including humans. The range of vaccines in which this has been demonstrated include peptide or protein antigens, live or killed viruses, dendritic cell vaccines, autologous cellular vaccines, and polysaccharide conjugates. The strong vaccine adjuvant activity of CpG ODN probably results from the following factors: (i) synergy between TLR9 and BCR preferentially stimulates antigen-specific B cells [5]; (ii) inhibition of B cell apoptosis [179]; (iii) enhanced IgG class switch DNA recombination [180–182]; and (iv) DC maturation and differentiation, resulting in enhanced activation of Th1 cells and strong CTL generation, even in the absence of CD4 T cell help [183,184]. CpG ODN show even greater adjuvant activity when formulated or coadministered with other adjuvants or in formulations such as microparticles, nanoparticles, lipid emulsions, or similar formulations [185]. In humans, CpG ODN have been used as adjuvants for hepatitis B vaccination either in combination with alum [186] or alone [187]. In a randomized, double-blind controlled phase I/II dose escalation study, healthy individuals received three intramuscular (IM) injections (using the FDA-approved vaccination regimen of 0, 4, and 24 weeks) of an alum-absorbed HBV vaccine either in saline or mixed with a B-Class ODN, CPG 7909, at doses of 0.125, 0.5, or 1.0 mg [186]. HBsAg-specific antibody responses (anti-HBs) appeared earlier and had higher titers at all time points from 2 weeks after the initial prime up to 48 weeks in CPG 7909 recipients compared to those individuals who received vaccine alone. Moreover, most of the subjects who received CPG 7909 as adjuvant developed protective levels of anti-HBs IgG within just 2 weeks of the priming vaccine dose, compared to none of the subjects receiving the commercial vaccine alone [186]. The addition of the CpG ODN also improved the quality of the antigen-specific antibody response, with an increased proportion of high-avidity antibodies [188]. The ability of CPG 7909 to accelerate seroconversion has also been demonstrated when used as an adjuvant to the approved anthrax vaccine in a randomized controlled trial in healthy volunteers. Control subjects reached their peak titer of toxin-neutralizing antibody at day 46, but this titer was achieved in the subjects receiving CPG 7909 already at day 22, more than 3 weeks earlier [189]. More rapid seroconversion to the anthrax toxin could be of great importance in the setting of a bioterror attack. Furthermore, the addition of CPG 7909 induced a statistically significant 8.8-fold increase in the peak titer of toxin-neutralizing antibody, and increased the proportion of subjects who achieved a strong IgG response to the anthraxprotective antigen from 61 to 100% [189]. These results indicate great potential for TLR9 agonists as vaccine adjuvants. Certain populations are hypo-responsive to vaccination, especially immune-suppressed individuals such as those infected with HIV. A randomized double-blind controlled trial in HIV-infected humans who previously had failed to respond to Engerix-B® alone demonstrated that addition of CPG 7909 to the vaccine significantly enhanced both the mean titers of anti-HBs and the antigenspecific T cell proliferative response [190]. The proportion of HIV patients who had seroprotective levels at 12 months following vaccination was increased from 63% in the controls to 100% in the group receiving CPG 7909 [190]. One of the limitations in vaccine development is the cost of antigen production, especially for vaccines such as the flu vaccine that have to be produced in large quantity in a short time frame. The use of a CpG ODN as vaccine adjuvant in mice enables the antigen doses to be reduced by approximately two orders of magnitude, with comparable antibody responses to the full-dose vaccine without CpG [191]. In a phase Ib randomized, double-blind

CRC_8796_ch027.qxd

5/5/2007

758

03:46 PM

Page 758


controlled clinical trial, subjects vaccinated with a one-tenth dose of a commercial trivalent killed split influenza vaccine (Fluarix®) had reduced levels of antigen-specific IFN- secretion from restimulated PBMC compared to those measured in PBMC from subjects vaccinated with the full-dose vaccine alone [192]. However, the coadministration of CPG 7909 with the one-tenth dose of Fluarix restored the antigen-specific IFN- secretion to the level seen with full-dose vaccine [192]. This suggests that addition of a CpG ODN to a flu vaccine could enable the effective use of the vaccine with lower antigen doses. 27.6.3 Cancer When used as a monotherapy, CpG ODN have antitumor activity in many mouse models (reviewed in [193]). In relatively small tumors, CpG monotherapy can be sufficient to induce a T cell-mediated rejection of established tumors, but to induce rejection of larger tumors the CpG ODN often needs to be combined with other effective antitumor strategies, such as monoclonal Ab, radiation therapy, surgery, and chemotherapy. Monotherapy with the human-optimized CpG ODN PF-3512676 (formerly known as CPG 7909) has induced objective tumor regressions in patients with advanced renal cell carcinoma, melanoma, cutaneous T cell lymphoma, and late regressions in non-Hodgkin’s lymphoma. PF-3512676 and a different B-Class ODN have been shown to induce a Th1-like cytokine response in lymphoma patients treated with the CpG ODN alone or in combination with an antitumor antibody [112,194]. For improving the response rates to TLR9 activation therapy we have been investigating various combination therapy approaches that may show synergy. Surprisingly, chemotherapy combinations with CpG ODN have shown substantial survival improvements in mouse tumor models using chemotherapy regimens ranging from the topoisomerase I inhibitor, topotecan, to the alkylating agent cyclophosphamide and the antimetabolite 5-fluorouracil [195–197]. These combination approaches appear to promote the development of an antitumor T cell response capable of controlling the tumor and improving survival. Therefore, we investigated the effect of adding the PF-3512676 to standard taxane/platinum chemotherapy for first-line treatment of stage IIIb/IV nonsmall cell lung cancer in a phase II randomized controlled human clinical trial. 112 chemotherapy-naïve patients were randomized to receive four to six 3-week cycles of standard chemotherapy alone or in combination with 0.2 mg/kg subcutaneous PF-3512676 on weeks 2 and 3 of each cycle. The primary end point for the trial, response rate (by response evaluation criteria in solid tumors [RECIST], intention-to-treat), was significantly improved ( p ⬍ 0.05) from 19% in the patients randomized to standard chemotherapy to 37% in the patients who also received PF-3512676 [198]. The secondary end point of this trial, survival, shows a trend to improvement from a median survival of 6.8 months in the chemotherapy arm, versus 12.3 months in the combination arm and an improvement in the 1 year survival from 33 to 50% [198]. As in the other clinical trials with TLR9 agonists, the most common side effects were mild to moderate injection site reactions and transient flu-like symptoms. Grade 3 or 4 neutropenia was more common in the combination arm, and is thought to reflect neutrophil redistribution, but febrile neutropenia and grade 3/4 infections were actually slightly less common in the combination arm than in the chemotherapy alone arm. Thrombocytopenia, a PS-backbone effect that has occurred in many trials of antisense ODN, was seen more commonly in the combination arm, but there was no apparent increase in bleeding events. Based on these encouraging results, two phase III human clinical trials of this regimen were initiated by Pfizer in late 2005. CpG ODN have also found application as adjuvant to human cancer vaccines. In a small phase I tumor vaccine trial using a 1 mg dose of CPG 7909 as adjuvant to recombinant MAGE-3 tumor antigen for triweekly vaccination in six patients with metastatic melanoma, there were two stable disease and two partial responses beginning after 7–10 vaccinations, and lasting at least 1 year by RECIST [199]. In eight melanoma patients CPG 7909 at a dose of 0.5 mg stimulated strong and rapid CD8 T cell responses to a Melan-A tumor peptide antigen when used with Montanide as a

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 759


759

cancer vaccine adjuvant [200]. GlaxoSmithKline is currently performing several human clinical trials using CPG 7909 as one component in a breast cancer vaccine (phase II) and a prostate cancer vaccine (phase I). 27.6.4 Asthma/Allergy Allergic diseases such as asthma result from an inappropriate Th2 immune response against harmless environmental antigens. Because the Th1 type of immune response triggered through TLR9 tends to oppose Th2 immunity, there has been much interest in exploring the application of CpG ODN for allergy/asthma immunotherapy. The Th1-biased immune effect of CpG ODN have dramatically improved the efficacy of allergy vaccines in mouse models, even in mice with established allergic disease [201,202]. A conjugate of a CpG ODN to a portion of the ragweed allergen has been evaluated in human clinical trials as an allergy vaccine, with encouraging evidence for a selective and specific redirection of the allergic Th2 response toward a nonallergic and noninflammatory Th1 response, and showing significant clinical benefit with reduced allergic symptoms [203,204]. Mouse and primate models also support the development of CpG ODN as a monotherapy for allergic diseases. This may seem counterintuitive, since these diseases are inflammatory, and TLR9 activation can induce powerful inflammatory effects. However, there are many types of inflammatory responses, and the Th1 type of inflammation that is induced through TLR9 antagonizes the Th2 type of inflammation that prevails in the allergic subject. In addition, TLR9 activation triggers counterregulatory pathways that feedback to reduce local and systemic inflammation, through mechanisms such as the systemic expression of IL-10 or TGF-, and pulmonary expression of indoleamine (2,3)-dioxygenase IDO [205,206]. Inhaled CpG ODN monotherapy given repeatedly can prevent or treat allergic airway responses not only in mouse models [207] but also in primates [208]. One CpG ODN given by inhalation to allergic subjects induced a Th1 immune activation pattern in the airways, but without any obvious clinical benefit, suggesting a need for further optimization of the ODN design (the ODN was not optimized for activating human TLR9), or dose and schedule [209]. The approach of a CpG ODN as monotherapy for asthma/allergy is undergoing further clinical development by sanofi-aventis. 27.6.5 Autoimmunity Recent studies have implicated inappropriate activation of TLR9 by endogenous DNA and DNA–protein complexes in the generation of autoimmune anti-DNA antibodies, and in the pathogenesis of systemic lupus erythematosus and rheumatoid arthritis [126,210–213]. More recently, we and other groups [123,124,127,214] have reported similar findings for TLR7/8: certain endogenous RNAs and RNA protein complexes can stimulate TLR7/8, leading to the development of autoimmune responses against RNA containing self antigens. The results of these studies offer a new direction in targeting TLR7/8/9; they suggest that TLR7/8/9 antagonists may be useful in the treatment of these autoimmune diseases, by blocking this inappropriate activation of B cells and pDC. Indeed, in mouse models, suppressive ODN (S-Class) designed to block TLR9 have shown substantial benefit in preventing or reversing both systemic lupus erythematosus and rheumatoid arthritis [124,128,129]. 27.6.6 Safety of CpG ODN Even if they do not contain a CpG motif, all PS ODN can have a variety of sequenceindependent backbone-related effects that have been characterized in detailed studies of antisense ODN [215–217]. These effects are most prominent in rodents, which show on chronic dosing of ODN dose-dependent mononuclear cell infiltration in the organs of ODN deposition [215,218], and largely depend on TLR9 [108,215]. Such changes have not been described in monkeys or humans.

CRC_8796_ch027.qxd

760

5/5/2007

03:46 PM

Page 760


Presumably these species-specific findings are a consequence of the cellular pattern of TLR9 expression, which determines the cytokines that will be produced in response to administration of a CpG ODN, and thus the safety profile of the drug. Since TLR9 is expressed in a broader range of immune cells in rodents compared to primates, the rodent tends to overpredict toxicities that will occur in primates. For example, rodents respond to CpG ODN administration with high serum concentrations of proinflammatory cytokines such as TNF-, which can result in a lethal cytokine storm [219] but in humans and primates there is no change in serum TNF- following CpG injection, which is generally well tolerated [111]. In terms of mechanism of action-related effects, CpG ODN treatment clearly can exacerbate autoimmunity in mouse models of lupus [220], multiple sclerosis [221], colitis [222], and arthritis [223]. However, CpG ODN protect against autoimmunity and inflammatory diseases in other murine experimental systems, through mechanisms ranging from induction of IFN- secretion to expression of IDO [206,224–226]. The safety profile of several TLR9 agonists in man has been observed in the clinical trials described above over a more than 1000-fold dose range from 0.0025 to 0.81 mg/kg. A maximal tolerated dose in humans has not been reported to date. The primary adverse events are dosedependent local injection reactions (e.g., erythema, pain, swelling, induration, pruritus, or warmth at the site of injection) or systemic flu-like reactions (e.g., headache, rigors, myalgia, pyrexia, nausea, and vomiting), and are consistent with the known TLR9 agonist mechanism of action. Depending on the dose, systemic symptoms typically appear within 12–24 hours of dosing and persist for 1–2 days. At the low doses used in vaccine trials there appears to be a slight increase in the frequency of injection site reactions, which are generally mild, above the frequency observed with the vaccine alone. So far there are no subjects who have been reported to develop an autoimmune disease following CpG therapy, but the duration of therapy has usually been less than 6 months; only a few patients have received chronic therapy with CpG ODN for longer than 3 years. Definite conclusions on the safety of chronic TLR9 activation with CpG ODN await the completion of clinical trials involving larger numbers of patients followed for longer periods of time.

27.7 IDENTIFICATION AND IMMUNE STIMULATORY EFFECTS OF OLIGORIBONUCLEOTIDE LIGANDS FOR TLR7 AND TLR8 Vertebrate TLRs are currently assigned to six major TLR subfamilies that are dominated by their evolutionary pressure to maintain the recognition of a specific class of pathogen-expressed molecules [227]. Examples are the TLR family recognizing pathogen-specific lipopeptides consisting of TLR1, TLR6, and TLR10, the family sensing double-stranded RNA currently encompassing TLR3, and the family responding to stimulation with single-stranded pathogen DNA and RNA with TLR7, TLR8, and TLR9 [227,228]. The members of the TLR9 family share high sequence homologies, sense pathogen-derived nucleic acids that are generated during intracellular infections and virus replication, and trigger signaling cascades involving similar signal transduction molecules dependent on MyD88. In contrast to TLR9 that recognizes bacterial and viral single-stranded DNA, the single-stranded genomes of RNA viruses such as influenza, vesicular stomatitis virus, Sendai virus, and HIV trigger endosomal recognition and production of type I IFN dependent on TLR7 [229–232]. The first ligands identified to induce TLR7-dependent immune modulatory effects included synthetic antiviral guanosine derivatives, as well as imidazoquinolines that stimulate TLR7- and TLR8-dependent signaling [60,233–235]. Although TLR7 is activated selectively by the guanosine analogue loxoribine, and the imidazoquinoline derivative Resiquimod (R-848) activates both TLR7 and TLR8, the combination of loxoribine or R-848 with a thymidine-rich PS ODN completely abolished TLR7-dependent signaling, but redirected activity to TLR8-mediated effects [138]. The unexpected effect of combining a single-stranded DNA with a TLR7 ligand to induce TLR8

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 761


761

signaling reveals a plasticity in the ligand specificities of TLR7 and TLR8, probably explained by the homologies between the TLR9 family members, and suggests a sequence-selective interaction between these receptors and synthetic PS ODN. The identification of nucleic acid-like structures such as loxoribine triggered the search for natural ligands of TLR7 and resulted in the observation that only the mixture of the unmodified RNA nucleosides uridine and guanosine resulted in the stimulation of human peripheral blood cells [236]. Furthermore, the immune modulatory effects of single-stranded viral RNA was mimicked by synthetic ORN containing uracil and guanosine demonstrating that single-stranded RNA motifs rich in these nucleotides function as physiological pathogen-derived ligands for TLR7 and TLR8 [231,236]. Nevertheless, TLR7 reportedly is also stimulated by small interfering RNAs lacking high GU content besides the reported GU-containing siRNAs [57,237], suggesting that other RNA sequences are also capable of triggering immune stimulation via this receptor [57,238,239]. A prerequisite for the potent ORN-mediated TLR7/8 activation appears to be its formulation with cationic lipids [231,236,239] that may be explained by the need for their protection from rapid degradation by RNAses [240] and the requirement for their delivery into intracellular compartments due to the endosomal localization of their receptors [239,241,242]. Similar to CpG-mediated immune responses chemical modifications in the GU-rich sequences can result in an abrogation of TLR7/8-dependent signaling. For example, replacement of the 2⬘-hydroxyl positions with 2⬘-O-methyl or incorporation of modified nucleotides such as 5-methylcytidine or pseudouridine inhibits the immune effects observed with unmodified ORNs [57,243]. Most host-derived single-stranded RNA molecules contain a high frequency of such modified nucleotides, and it is tempting to speculate that specific posttranscriptional modifications of host-derived RNA interferes with TLR-mediated effects and acts as a potential mechanism to prevent immune stimulation by self RNA. Another interesting aspect of TLR7/8-dependent recognition is the reported species-specific differences. Mice deficient in TLR7 fail to respond to ORN or imidazoquinoline stimulation, although genetic complementation of nonresponder cells with either human TLR7 or TLR8 restores responsiveness to imidazoquinolines [60,233]. Therefore, murine TLR8 appears to be defective in recognizing nucleic acid-like structures, may be incapable of triggering intracellular signaling, or possibly senses a different yet unidentified physiological ligand. Stimulation with single-stranded ORN results similar to small molecule synthetic TLR7/8 ligands in the production of Th1, Th1-like, and proinflammatory cytokines including IFN- from pDCs, TNF- and IL-12p70 from monocytes and mDCs, as well as IL-12p40, IL-6, and IFN- [57,123,231,235,236,244–248]. The induction of early innate immune effects including the production of cytokines such as IL-12 or type I IFNs is essential for the stimulation of adaptive immune responses by TLRs. In addition, adaptive immunity depends on the expression of costimulatory molecules by professional APCs. Single-stranded ORN stimulate enhanced expression of such molecules on murine and human APC, mediate the expression of the early-activation marker CD69 on T cells, NK cells, or NKT cells, and enhance the proliferation of alloreactive T cells [236,238,244,245]. These hallmarks of adjuvant effects suggest that ORN can facilitate and enhance the priming of antigen-specific adaptive immune responses. Indeed, injection of lipidencapsulated ORN in mice results in the production of Th1 and proinflammatory cytokines, and addition of antigens such as Ova or Hepatitis B antigens induces enhanced levels of antigen-specific antibodies, as well as increased numbers of antigen-specific IFN- producing T cells and stronger antigen-specific CTL responses compared to mice immunized with lipid-encapsulated antigen alone [244,247,249,250]. In contrast to single-stranded RNA, double-stranded RNA is normally absent in mammalian cells and only occurs as a replication intermediate of RNA viruses in cells [251]. In vitro-generated viral double-stranded RNA appears not to be recognized by TLR7 [252], but TLR3 is activated by extracellular double-stranded RNA after entering the endosomal pathway [253]. Nevertheless, DCs that lack TLR3 are still stimulated to secrete type I IFN after intracellular delivery of doublestranded RNA, and the cytoplasmic helicase domain of the helicase protein retinoic acid-induced

CRC_8796_ch027.qxd

762

5/5/2007

03:46 PM

Page 762


gene 1 (RIG-1) was demonstrated to be the mediator of the antiviral immune responses [252,254]. In addition, the double-stranded RNA-activated protein kinase (PKR) was identified to induce inflammatory signals upon binding double-stranded RNA and, therefore, represents together with the cytoplasmic melanoma differentiation-associated gene 5 (Mda5) another candidate sensing pathogen double-stranded RNA [255–257]. TLRs, RIG-1, Mda5, and PKR sense different pathogen RNAs in a cell-type and compartment-specific manner and, therefore, contribute each to the innate and adaptive antiviral responses that are triggered upon virus infection.

27.8 CONCLUSION Synthetic ODN ligands for TLR9, and more recently, ORN ligands for TLR7 and TLR8, contain immune stimulatory sequence motifs that can mimic molecules of infectious agents and activate therapeutic immune responses. The specificity of these immune responses can be directed against cancer, infectious diseases, or can redirect allergic immune responses, resulting in a more normal immune balance. In one class of therapeutic application low doses of CpG ODN have been used as vaccine adjuvants, in which case the specificity of the immune response is determined by the vaccine antigen. In a second type of clinical application, higher doses of CpG ODN, alone or preferably in combinations with other nonspecific therapeutic agents, such as chemotherapy, can induce therapeutic antigen-specific immune responses. The encouraging clinical results in human phase I and phase II trials and the relative lack of serious toxicities observed to date demonstrate the potential of this class of innate immune activators for improving human and animal health.

REFERENCES 1. Tanaka, T, Chu, CC, and Paul, WE; An antisense oligonucleotide complementary to a sequence in Ig 2b increases 2b germline transcripts, stimulates B cell DNA synthesis, and inhibits immunoglobulin secretion; J. Exp. Med.; 175; 597; 1992. 2. Branda, RF, Moore, AL, Mathews, L et al.; Immune stimulation by an antisense oligomer complementary to the rev gene of HIV-1; Biochem. Pharmacol.; 45; 2037; 1993. 3. Pisetsky, DS and Reich, CF; Stimulation of murine lymphocyte proliferation by a phosphorothioate oligonucleotide with antisense activity for herpes simplex virus; Life Sciences; 54; 101; 1993. 4. McIntyre, KW, Lombard-Gillooly, K, Perez, JR et al.; A sense phosphorothioate oligonucleotide directed to the initiation codon of transcription factor NF- B p65 causes sequence-specific immune stimulation; Antisense Res. Dev.; 3; 309; 1993. 5. Krieg, AM, Yi, AK, Matson, S et al.; CpG motifs in bacterial DNA trigger direct B-cell activation; Nature; 374; 546; 1995. 6. Krieg, AM; CpG motifs in bacterial DNA and their immune effects; Annu. Rev. Immunol.; 20; 709; 2002. 7. Bird, AP; CpG islands as gene markers in the vertebrate nucleus; Trends Genet.; 3; 342; 1987. 8. Han, J, Zhu, Z, Hsu, C et al.; Selection of antisense oligonucleotides on the basis of genomic frequency of the target sequence; Antisense Res. Dev.; 4; 53; 1994. 9. Hemmi, H, Takeuchi, O, Kawai, T et al.; A Toll-like receptor recognizes bacterial DNA. [In Process Citation]; Nature; 408; 740; 2000. 10. Iwasaki, A and Medzhitov, R; Toll-like receptor control of the adaptive immune responses; Nat. Immunol.; 5; 987; 2004. 11. Pulendran, B; Variegation of the immune response with dendritic cells and pathogen recognition receptors; J. Immunol.; 174; 2457; 2005. 12. Barton, GM, Kagan, JC, and Medzhitov, R; Intracellular localization of Toll-like receptor 9 prevents recognition of self DNA but facilitates access to viral DNA; Nat. Immunol.; 7; 49; 2006. 13. Hemmi, H, Kaisho, T, Takeda, K et al.; The roles of Toll-like receptor 9, MyD88, and DNA-dependent protein kinase catalytic subunit in the effects of two distinct CpG DNAs on dendritic cell subsets; J. Immunol.; 170; 3059; 2003.

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 763


763

14. Vollmer, J, Weeratna, RD, Jurk, M et al.; Oligodeoxynucleotides lacking CpG dinucleotides mediate Toll-like receptor 9 dependent T helper type 2 biased immune stimulation; Immunology; 113; 212; 2004. 15. Yasuda, K, Yu, P, Kirschning, CJ et al.; Endosomal translocation of vertebrate DNA activates dendritic cells via TLR9-dependent and -independent pathways; J. Immunol.; 174; 6129; 2005. 16. Ishii, KJ, Coban, C, Kato, H et al.; A Toll-like receptor-independent antiviral response induced by double-stranded B-form DNA; Nat. Immunol.; 7; 40; 2006. 17. Okabe, Y, Kawane, K, Akira, S et al.; Toll-like receptor-independent gene induction program activated by mammalian DNA escaped from apoptotic DNA degradation; J. Exp. Med.; 202; 1333; 2005. 18. Stetson, DB and Medzhitov, R; Recognition of cytosolic DNA activates an IRF3-dependent innate immune response; Immunity; 24; 93; 2006. 19. Spies, B, Hochrein, H, Vabulas, M et al.; Vaccination with plasmid DNA activates dendritic cells via Toll-like receptor 9 (TLR9) but functions in TLR9-deficient mice; J. Immunol.; 171; 5908; 2003. 20. Babiuk, S, Mookherjee, N, Pontarollo, R et al.; TLR9⫺/⫺ and TLR9⫹/⫹ mice display similar immune responses to a DNA vaccine; Immunology; 113; 114; 2004. 21. Tudor, D, Dubuquoy, C, Gaboriau, V et al.; TLR9 pathway is involved in adjuvant effects of plasmid DNA-based vaccines; Vaccine; 23; 1258; 2005. 22. Liu, YJ; IPC: professional type 1 interferon-producing cells and plasmacytoid dendritic cell precursors; Annu. Rev. Immunol.; 23; 275; 2005. 23. Hayashi, F, Means, TK, and Luster, AD; Toll-like receptors stimulate human neutrophil function; Blood; 102; 2660; 2003. 24. Saikh, KU, Kissner, TL, Sultana, A et al.; Human monocytes infected with Yersinia pestis express cell surface TLR9 and differentiate into dendritic cells; J. Immunol.; 173; 7426; 2004. 25. Siren, J, Pirhonen, J, Julkunen, I et al.; IFN-alpha regulates TLR-dependent gene expression of IFN-alpha, IFN-beta, IL-28, and IL-29; J. Immunol.; 174; 1932; 2005. 26. Gelman, AE, Zhang, J, Choi, Y et al.; Toll-like receptor ligands directly promote activated CD4⫹ T cell survival; J. Immunol.; 172; 6065; 2004. 27. Li, J, Ma, Z, Tang, ZL et al.; CpG DNA-mediated immune response in pulmonary endothelial cells; Am. J. Physiol. Lung Cell Mol. Physiol.; 287; L552; 2004. 28. Platz, J, Beisswenger, C, Dalpke, A et al.; Microbial DNA induces a host defense reaction of human respiratory epithelial cells; J. Immunol.; 173; 1219; 2004. 29. Pedersen, G, Andresen, L, Matthiessen, MW et al.; Expression of Toll-like receptor 9 and response to bacterial CpG oligodeoxynucleotides in human intestinal epithelium; Clin. Exp. Immunol.; 141; 298; 2005. 30. Rachmilewitz, D, Karmeli, F, Shteingart, S et al.; Immunostimulatory oligonucleotides inhibit colonic proinflammatory cytokine production in ulcerative colitis; Inflamm. Bowel. Dis.; 12; 339; 2006. 31. Roda, JM, Parihar, R, and Carson, WE, III; CpG-containing oligodeoxynucleotides act through TLR9 to enhance the NK cell cytokine response to antibody-coated tumor cells; J. Immunol.; 175; 1619; 2005. 32. Sivori, S, Falco, M, Della, CM et al.; CpG and double-stranded RNA trigger human NK cells by Tolllike receptors: induction of cytokine release and cytotoxicity against tumors and dendritic cells; Proc. Natl. Acad. Sci U.S.A.; 101; 10116; 2004. 33. Sivori, S, Carlomagno, S, Moretta, L et al.; Comparison of different CpG oligodeoxynucleotide classes for their capability to stimulate human NK cells; Eur. J. Immunol.; 2006. 34. Suzuki, Y, Wakita, D, Chamoto, K et al.; Liposome-encapsulated CpG oligodeoxynucleotides as a potent adjuvant for inducing type 1 innate immunity; Cancer Res.; 64; 8754; 2004. 35. Romagnani, C, Della, CM, Kohler, S et al.; Activation of human NK cells by plasmacytoid dendritic cells and its modulation by CD4⫹ T helper cells and CD4⫹ CD25hi T regulatory cells; Eur. J. Immunol.; 35; 2452; 2005. 36. Marshall, JD, Heeke, DS, Abbate, C et al.; Induction of interferon-gamma from natural killer cells by immunostimulatory CpG DNA is mediated through plasmacytoid-dendritic-cell-produced interferonalpha and tumour necrosis factor-alpha; Immunology; 117; 38; 2006. 37. Gorski, KS, Waller, EL, Bjornton-Severson, J et al.; Distinct indirect pathways govern human NK-cell activation by TLR-7 and TLR-8 agonists; Int. Immunol.; 18; 1115; 2006. 38. Gerosa, F, Gobbi, A, Zorzi, P et al.; The reciprocal interaction of NK cells with plasmacytoid or myeloid dendritic cells profoundly affects innate resistance functions; J. Immunol.; 174; 727; 2005. 39. Hanabuchi, S, Watanabe, N, Wang, YH et al.; Human plasmacytoid predendritic cells activate NK cells through glucocorticoid-induced tumor necrosis factor receptor-ligand (GITRL); Blood; 107; 3617; 2006.

CRC_8796_ch027.qxd

764

5/5/2007

03:46 PM

Page 764


40. Blackwell, SE and Krieg, AM; CpG-A-induced monocyte IFN-gamma-inducible protein-10 production is regulated by plasmacytoid dendritic cell-derived IFN-alpha; J. Immunol.; 170; 4061; 2003. 41. Jarrossay, D, Napolitani, G, Colonna, M et al.; Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells; Eur. J. Immunol.; 31; 3388; 2001. 42. Komiya, A, Nagase, H, Okugawa, S et al.; Expression and function of toll-like receptors in human basophils; Int. Arch. Allergy Immunol.; 140 Suppl 1; 23; 2006. 43. Chuang, TH and Ulevitch, RJ; Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9 [In Process Citation]; Eur. Cytokine Netw.; 11; 372; 2000. 44. Du, X, Poltorak, A, Wei, Y et al.; Three novel mammalian toll-like receptors: gene structure, expression, and evolution [In Process Citation]; Eur. Cytokine Netw.; 11; 362; 2000. 45. Bsibsi, M, Ravid, R, Gveric, D et al.; Broad expression of Toll-like receptors in the human central nervous system; J. Neuropathol. Exp. Neurol.; 61; 1013; 2002. 46. Nishimura, M and Naito, S; Tissue-specific mRNA expression profiles of human Toll-like receptors and related genes; Biol. Pharm. Bull.; 28; 886; 2005. 47. Zarember, KA and Godowski, PJ; Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines; J. Immunol.; 168; 554; 2002. 48. Hornung, V, Rothenfusser, S, Britsch, S et al.; Quantitative expression of toll-like receptor 1-10 mRNA in cellular subsets of human peripheral blood mononuclear cells and sensitivity to CpG oligodeoxynucleotides; J. Immunol.; 168; 4531; 2002. 49. Bekeredjian-Ding, IB, Wagner, M, Hornung, V et al.; Plasmacytoid dendritic cells control TLR7 sensitivity of naive B cells via type I IFN; J. Immunol.; 174; 4043; 2005. 50. Krug, A, Towarowski, A, Britsch, S et al.; Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12; Eur. J. Immunol.; 31; 3026; 2001. 51. Ito, T, Amakawa, R, Kaisho, T et al.; Interferon-alpha and interleukin-12 are induced differentially by Toll- like receptor 7 ligands in human blood dendritic cell subsets; J. Exp. Med.; 195; 1507; 2002. 52. Renn, CN, Sanchez, DJ, Ochoa, MT et al.; TLR activation of Langerhans cell-like dendritic cells triggers an antiviral immune response; J. Immunol.; 177; 298; 2006. 53. Osterlund, P, Veckman, V, Siren, J et al.; Gene expression and antiviral activity of alpha/beta interferons and interleukin-29 in virus-infected human myeloid dendritic cells; J. Virol.; 79; 9608; 2005. 54. Miettinen, M, Sareneva, T, Julkunen, I et al.; IFNs activate toll-like receptor gene expression in viral infections; Genes Immun.; 2; 349; 2001. 55. Kokkinopoulos, I, Jordan, WJ, and Ritter, MA; Toll-like receptor mRNA expression patterns in human dendritic cells and monocytes; Mol. Immunol.; 42; 957; 2005. 56. Peng, G, Guo, Z, Kiniwa, Y et al.; Toll-like receptor 8-mediated reversal of CD4⫹ regulatory T cell function; Science; 309; 1380; 2005. 57. Sioud, M; Single-stranded small interfering RNA are more immunostimulatory than their doublestranded counterparts: a central role for 2⬘-hydroxyl uridines in immune responses; Eur. J. Immunol.; 36; 1222; 2006. 58. Bernasconi, NL, Onai, N, and Lanzavecchia, A; A role for Toll-like receptors in acquired immunity: up-regulation of TLR9 by BCR triggering in naive B cells and constitutive expression in memory B cells; Blood; 101; 4500; 2003. 59. Caron, G, Duluc, D, Fremaux, I et al.; Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R-848 up-regulate proliferation and IFN-gamma production by memory CD4⫹ T cells; J. Immunol.; 175; 1551; 2005. 60. Jurk, M, Heil, F, Vollmer, J et al.; Human TLR7 or TLR8 independently confer responsiveness to the antiviral compound R-848; Nat. Immunol.; 3; 499; 2002. 61. Edwards, AD, Diebold, SS, Slack, EM et al.; Toll-like receptor expression in murine DC subsets: lack of TLR7 expression by CD8 alpha⫹ DC correlates with unresponsiveness to imidazoquinolines; Eur. J. Immunol.; 33; 827; 2003. 62. Applequist, SE, Wallin, RP, and Ljunggren, HG; Variable expression of Toll-like receptor in murine innate and adaptive immune cell lines; Int. Immunol.; 14; 1065; 2002. 63. Renshaw, M, Rockwell, J, Engleman, C et al.; Cutting edge: impaired Toll-like receptor expression and function in aging; J. Immunol.; 169; 4697; 2002.

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 765


765

64. Cottalorda, A, Verschelde, C, Marcais, A et al.; TLR2 engagement on CD8 T cells lowers the thresholdfor optimal antigen-induced T cell activation; Eur. J. Immunol.; 36; 1684; 2006. 65. Asselin-Paturel, C, Brizard, G, Chemin, K et al.; Type I interferon dependence of plasmacytoid dendritic cell activation and migration; J. Exp. Med.; 201; 1157; 2005. 66. Jung, J, Yi, AK, Zhang, X et al.; Distinct response of human B cell subpopulations in recognition of an innate immune signal, CpG DNA; J. Immunol.; 169; 2368; 2002. 67. Bernasconi, NL, Traggiai, E, and Lanzavecchia, A; Maintenance of serological memory by polyclonal activation of human memory B cells; Science; 298; 2199; 2002. 68. Traggiai, E, Becker, S, Subbarao, K et al.; An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus; Nat. Med.; 10; 871; 2004. 69. Poeck, H, Wagner, M, Battiany, J et al.; Plasmacytoid dendritic cells, antigen and CpG-C license human B cells for plasma cell differentiation and immunoglobulin production in the absence of T cell help; Blood; 103; 3058; 2004. 70. Honda, K, Ohba, Y, Yanai, H et al.; Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction; Nature; 434; 1035; 2005. 71. Latz, E, Schoenemeyer, A, Visintin, A et al.; TLR9 signals after translocating from the ER to CpG DNA in the lysosome; Nat. Immunol.; 5; 190; 2004. 72. Rutz, M, Metzger, J, Gellert, T et al.; Toll-like receptor 9 binds single-stranded CpG-DNA in a sequence- and pH-dependent manner; Eur. J. Immunol.; 34; 2541; 2004. 73. Yi, AK, Tuetken, R, Redford, T et al.; CpG motifs in bacterial DNA activate leukocytes through the pH-dependent generation of reactive oxygen species; J. Immunol.; 160; 4755; 1998. 74. Kirsch, JD, Yi, AK, Spitz, DR et al.; Accumulation of glutathione disulfide mediates NF-kappaB activation during immune stimulation with CpG DNA; Antisense Nucleic Acid Drug Dev.; 12; 327; 2002. 75. Ahmad-Nejad, P, Hacker, H, Rutz, M et al.; Bacterial CpG-DNA and lipopolysaccharides activate Toll-like receptors at distinct cellular compartments; Eur. J. Immunol.; 32; 1958; 2002. 76. Hacker, H, Vabulas, RM, Takeuchi, O et al.; Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 88 and tumor necrosis factor receptor-associated factor (TRAF)6; J. Exp. Med.; 192; 595; 2000. 77. Schnare, M, Holtdagger, AC, Takeda, K et al.; Recognition of CpG DNA is mediated by signaling pathways dependent on the adaptor protein MyD88; Curr. Biol.; 10; 1139; 2000. 78. Muzio, M, Ni, J, Feng, P et al.; IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling; Science; 278; 1612; 1997. 79. Muzio, M, Natoli, G, Saccani, S et al.; The human toll signaling pathway: divergence of nuclear factor kappaB and JNK/SAPK activation upstream of tumor necrosis factor receptor-associated factor 6 (TRAF6); J. Exp. Med.; 187; 2097; 1998. 80. Hartmann, G and Krieg, AM; Mechanism and function of a newly identified CpG DNA motif in human primary B cells; J. Immunol.; 164; 944; 2000. 81. Yi, AK and Krieg, AM; Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA; J. Immunol.; 161; 4493; 1998. 82. Takeshita, F and Klinman, DM; CpG ODN-mediated regulation of IL-12 p40 transcription; Eur. J. Immunol.; 30; 1967; 2000. 83. Tsujimura, H, Tamura, T, Kong, HJ et al.; Toll-like receptor 9 signaling activates NF-kappaB through IFN regulatory factor-8/IFN consensus sequence binding protein in dendritic cells; J. Immunol.; 172; 6820; 2004. 84. Choudhury, BK, Wild, JS, Alam, R et al.; In vivo role of p38 mitogen-activated protein kinase in mediating the anti-inflammatory effects of CpG oligodeoxynucleotide in murine asthma; J. Immunol.; 169; 5955; 2002. 85. Yi, AK, Yoon, JG, and Krieg, AM; Convergence of CpG DNA- and BCR-mediated signals at the c-Jun N- terminal kinase and NF-kappaB activation pathways: regulation by mitogen-activated protein kinases; Int. Immunol.; 15; 577; 2003. 86. Yi, AK, Yoon, JG, Yeo, SJ et al.; Role of mitogen-activated protein kinases in CpG DNA-mediated IL-10 and IL-12 production: central role of extracellular signal-regulated kinase in the negative feedback loop of the CpG DNA-mediated Th1 response; J. Immunol.; 168; 4711; 2002. 87. Hacker, H, Mischak, H, Miethke, T et al.; CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation; EMBO J.; 17; 6230; 1998.

CRC_8796_ch027.qxd

766

5/5/2007

03:46 PM

Page 766


88. Manzel, L, Strekowski, L, Ismail, FM et al.; Antagonism of immunostimulatory CpG-oligodeoxynucleotides by 4-aminoquinolines and other weak bases: mechanistic studies; J. Pharmacol. Exp. Ther.; 291; 1337; 1999. 89. Ishii, KJ, Takeshita, F, Gursel, I et al.; Potential role of phosphatidylinositol 3 kinase, rather than DNA-dependent protein kinase, in CpG DNA-induced immune activation; J. Exp. Med.; 196; 269; 2002. 90. Gursel, M, Verthelyi, D, Gursel, I et al.; Differential and competitive activation of human immune cells by distinct classes of CpG oligodeoxynucleotide; J. Leukoc. Biol.; 71; 813; 2002. 91. Krug, A, Rothenfusser, S, Hornung, V et al.; Identification of CpG oligonucleotide sequences with high induction of IFN-alpha/beta in plasmacytoid dendritic cells; Eur. J. Immunol.; 31; 2154; 2001. 92. Ballas, ZK, Rasmussen, WL, and Krieg, AM; Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA; J. Immunol.; 157; 1840; 1996. 93. Vollmer, J, Weeratna, R, Payette, P et al.; Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities; Eur. J. Immunol.; 34; 251; 2004. 94. Hartmann, G, Battiany, J, Poeck, H et al.; Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-alpha induction in plasmacytoid dendritic cells; Eur. J. Immunol.; 33; 1633; 2003. 95. Guiducci, C, Ott, G, Chan, JH et al.; Properties regulating the nature of the plasmacytoid dendritic cell response to Toll-like receptor 9 activation; J. Exp. Med.; 203; 1999; 2006. 96. Coccia, EM, Severa, M, Giacomini, E et al.; Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells; Eur. J. Immunol.; 34; 796; 2004. 97. Jurk, M, Schulte, B, Kritzler, A et al.; Oligonucleotide-induced production of new antiviral cytokines IL-28 and IL-29 by human immune cells is CpG-dependent; Gordon Research Conference Immunochemistry & Immunobiology; 2005. 98. Jurk, M, Schulte, B, Kritzler, A et al.; C-Class CpG ODN: sequence requirements and characterization of immunostimulatory activities on mRNA level; Immunobiology; 209; 141; 2004. 99. Kranzer, K, Bauer, M, Lipford, GB et al.; CpG-oligodeoxynucleotides enhance T-cell receptor-triggered interferon- production and up-regulation of CD69 via induction of antigen- presenting cell-derived interferon type I and interleukin-12; Immunology; 99; 170; 2000. 100. Marschner, A, Rothenfusser, S, Hornung, V et al.; CpG ODN enhance antigen-specific NKT cell activation via plasmacytoid dendritic cells; Eur. J. Immunol.; 35; 2347; 2005. 101. Rothenfusser, S, Hornung, V, Ayyoub, M et al.; CpG-A and CpG-B oligonucleotides differentially enhance human peptide-specific primary and memory CD8⫹ T-cell responses in vitro; Blood; 103; 2162; 2004. 102. Rothenfusser, S, Hornung, V, Krug, A et al.; Distinct CpG oligonucleotide sequences activate human gamma delta T cells via interferon-alpha/-beta; Eur. J. Immunol.; 31; 3525; 2001. 103. Montoya, CJ, Jie, HB, Al Harthi, L et al.; Activation of plasmacytoid dendritic cells with TLR9 agonists initiates invariant NKT cell-mediated cross-talk with myeloid dendritic cells; J. Immunol.; 177; 1028; 2006. 104. Kemp, TJ, Elzey, BD, and Griffith, TS; Plasmacytoid dendritic cell-derived IFN-alpha induces TNF-related apoptosis-inducing ligand/apo-2L-mediated antitumor activity by human monocytes following CpG oligodeoxynucleotide stimulation; J. Immunol.; 171; 212; 2003. 105. Matikainen, S, Paananen, A, Miettinen, M et al.; IFN-alpha and IL-18 synergistically enhance IFN-gamma production in human NK cells: differential regulation of Stat4 activation and IFN-gamma gene expression by IFN-alpha and IL-12; Eur. J. Immunol.; 31; 2236; 2001. 106. Micallef, MJ, Yoshida, K, Kawai, S et al.; In vivo antitumor effects of murine interferon-gamma-inducing factor/interleukin-18 in mice bearing syngeneic Meth A sarcoma malignant ascites; Cancer Immunol. Immunother.; 43; 361; 1997. 107. Kato, A, Homma, T, Batchelor, J et al.; Interferon-alpha/beta receptor-mediated selective induction of a gene cluster by CpG oligodeoxynucleotide 2006; BMC. Immunol.; 4; 8; 2003. 108. Vollmer, J, Jurk, M, Samulowitz, U et al.; CpG oligodeoxynucleotides stimulate IFN-gammainducible protein-10 production in human B cells; J. Endotoxin. Res.; 10; 431; 2004. 109. Hartmann, G and Krieg, AM; CpG DNA and LPS induce distinct patterns of activation in human monocytes; Gene Ther.; 6; 893; 1999.

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 767


767

110. Hartmann, G, Weeratna, RD, Ballas, ZK et al.; Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo; J. Immunol.; 164; 1617; 2000. 111. Krieg, AM, Efler, SM, Wittpoth, M et al.; Induction of systemic TH1-like innate immunity in normal volunteers following subcutaneous but not intravenous administration of CPG 7909, a synthetic B-class CpG oligodeoxynucleotide TLR9 agonist; J. Immunother.; 27; 460; 2004. 112. Friedberg, JW, Kim, H, McCauley, M et al.; Combination immunotherapy with a CpG oligonucleotide (1018 ISS) and rituximab in patients with non-Hodgkin lymphoma: increased interferon-alpha/betainducible gene expression, without significant toxicity; Blood; 105; 489; 2005. 113. Vollmer, J; TLR9 in health and disease; Int. Rev. Immunol.; 25; 155; 2006. 114. Redford, TW, Yi, AK, Ward, CT et al.; Cyclosporin A enhances IL-12 production by CpG motifs in bacterial DNA and synthetic oligodeoxynucleotides; J. Immunol.; 161; 3930; 1998. 115. Duramad, O, Fearon, KL, Chan, JH et al.; IL-10 regulates plasmacytoid dendritic cell response to CpG-containing immunostimulatory sequences; Blood; 102; 4487; 2003. 116. Gary-Gouy, H, Lebon, P, and Dalloul, AH; Type I interferon production by plasmacytoid dendritic cells and monocytes is triggered by viruses, but the level of production is controlled by distinct cytokines; J. Interferon Cytokine Res.; 22; 653; 2002. 117. Vicari, AP, Chiodoni, C, Vaure, C et al.; Reversal of tumor-induced dendritic cell paralysis by CpG immunostimulatory oligonucleotide and anti-interleukin 10 receptor antibody; J. Exp. Med.; 196; 541; 2002. 118. Lee, KW, Lee, Y, Kim, DS et al.; Direct role of NF-kappaB activation in Toll-like receptor-triggered HLA-DRA expression; Eur. J. Immunol.; 36; 1254; 2006. 119. Hartmann, G, Weiner, GJ, and Krieg, AM; CpG DNA: a potent signal for growth, activation, and maturation of human dendritic cells; Proc. Natl. Acad. Sci. U.S.A.; 96; 9305; 1999. 120. Ashman, RF, Goeken, JA, Drahos, J et al.; Sequence requirements for oligodeoxyribonucleotide inhibitory activity; Int. Immunol.; 17; 411; 2005. 121. Stunz, LL, Lenert, P, Peckham, D et al.; Inhibitory oligonucleotides specifically block effects of stimulatory CpG oligonucleotides in B cells; Eur. J. Immunol.; 32; 1212; 2002. 122. Lenert, P, Stunz, LL, Yi, AK et al.; CpG stimulation of primary mouse B cells is blocked by inhibitory oligodeoxyribonucleotides at a site proximal to NF-kB activation; Antisense Nucleic Acid Drug Dev.; 11; 247; 2001. 123. Vollmer, J, Tluk, S, Schmitz, C et al.; Immune stimulation mediated by autoantigen binding sites within small nuclear RNAs involves Toll-like receptors 7 and 8; J. Exp. Med.; 202; 1575; 2005. 124. Barrat, FJ, Meeker, T, Gregorio, J et al.; Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus; J. Exp. Med.; 202; 1131; 2005. 125. Marshak-Rothstein, A, Busconi, L, Lau, CM et al.; Comparison of CpG s-ODNs, chromatin immune complexes, and dsDNA fragment immune complexes in the TLR9-dependent activation of rheumatoid factor B cells; J. Endotoxin. Res.; 10; 247; 2004. 126. Leadbetter, EA, Rifkin, IR, Hohlbaum, AM et al.; Chromatin-IgG complexes activate B cells by dual engagement of IgM and Toll-like receptors; Nature; 416; 603; 2002. 127. Lau, CM, Broughton, C, Tabor, AS et al.; RNA-associated autoantigens activate B cells by combined B cell antigen receptor/Toll-like receptor 7 engagement; J. Exp. Med.; 202; 1171; 2005. 128. Dong, L, Ito, S, Ishii, KJ et al.; Suppressive oligodeoxynucleotides delay the onset of glomerulonephritis and prolong survival in lupus-prone NZB ⫻ NZW mice; Arthritis Rheum.; 52; 651; 2005. 129. Dong, L, Ito, S, Ishii, KJ et al.; Suppressive oligonucleotides protect against collagen-induced arthritis in mice; Arthritis Rheum.; 50; 1686; 2004. 130. Vollmer, J; CpG motifs to modulate innate and adaptive immune responses; Int. Rev. Immunol.; 25; 125; 2006. 131. Yu, D, Zhao, Q, Kandimalla, ER et al.; Accessible 5⬘-end of CpG-containing phosphorothioate oligodeoxynucleotides is essential for immunostimulatory activity; Bioorg. Med. Chem. Lett.; 10; 2585; 2000. 132. Vollmer, J, Janosch, A, Laucht, M et al.; Highly immunostimulatory CpG-free oligodeoxynucleotides for activation of human leukocytes; Antisense Nucleic Acid Drug Dev.; 12; 165; 2002. 133. Liang, H, Nishioka, Y, Reich, CF et al.; Activation of human B cells by phosphorothioate oligodeoxynucleotides; J. Clin. Invest.; 98; 1119; 1996.

CRC_8796_ch027.qxd

768

5/5/2007

03:46 PM

Page 768


134. Sester, DP, Naik, S, Beasley, SJ et al.; Phosphorothioate backbone modification modulates macrophage activation by CpG DNA; J. Immunol.; 165; 4165; 2000. 135. Krieg, AM, Guga, P, and Stec, W; P-chirality-dependent immune activation by phosphorothioate CpG oligodeoxynucleotides; Oligonucleotides; 13; 491; 2003. 136. Yu, D, Kandimalla, ER, Roskey, A et al.; Stereo-enriched phosphorothioate oligodeoxynucleotides: synthesis, biophysical and biological properties [In Process Citation]; Bioorg. Med. Chem.; 8; 275; 2000. 137. Agrawal, S and Kandimalla, ER; Medicinal chemistry and therapeutic potential of CpG DNA; Trends Mol. Med.; 8; 114; 2002. 138. Jurk, M, Kritzler, A, Debelak, H et al.; Structure-activity relationship studies on the immune stimulatory effects of base-modified CpG Toll-like receptor 9 agonists; ChemMedChem.; 1; 1007; 2006. 139. Uhlmann, E and Vollmer, J; Recent advances in the development of immunostimulatory oligonucleotides; Curr. Opin. Drug Discov. Devel.; 6; 204; 2003. 140. Zhao, Q, Temsamani, J, Iadarola, PL et al.; Effect of different chemically modified oligodeoxynucleotides on immune stimulation; Biochem. Pharmacol.; 51; 173; 1996. 141. Vollmer, J, Jepsen, JS, Uhlmann, E et al.; Modulation of CpG oligodeoxynucleotide-mediated immune stimulation by locked nucleic acid (LNA); Oligonucleotides; 14; 23; 2004. 142. Henry, S, Stecker, K, Brooks, D et al.; Chemically modified oligonucleotides exhibit decreased immune stimulation in mice; J. Pharmacol. Exp. Ther.; 292; 468; 2000. 143. Zhao, Q, Yu, D, and Agrawal, S; Immunostimulatory activity of CpG containing phosphorothioate oligodeoxynucleotide is modulated by modification of a single deoxynucleoside; Bioorg. Med. Chem. Lett.; 10; 1051; 2000. 144. Zhao, Q, Yu, D, and Agrawal, S; Site of chemical modifications in CpG containing phosphorothioate oligodeoxynucleotide modulates its immunostimulatory activity; Bioorg. Med. Chem. Lett.; 9; 3453; 1999. 145. Verthelyi, D, Ishii, KJ, Gursel, M et al.; Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs; J. Immunol.; 166; 2372; 2001. 146. Vollmer, J, Weeratna, RD, Jurk, M et al.; Impact of modifications of heterocyclic bases in CpG dinucleotides on their immune-modulatory activity; J. Leukoc. Biol.; 76; 585; 2004. 147. Marshall, JD, Fearon, K, Abbate, C et al.; Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions; J. Leukoc. Biol.; 73; 781; 2003. 148. Yasuda, K, Rutz, M, Schlatter, B et al.; CpG motif-independent activation of TLR9 upon endosomal translocation of “natural” phosphodiester DNA; Eur. J. Immunol.; 36; 431; 2006. 149. McCluskie, MJ and Davis, HL; Oral, intrarectal and intranasal immunizations using CpG and nonCpG oligodeoxynucleotides as adjuvants [In Process Citation]; Vaccine; 19; 413; 2001. 150. Ho, PP, Fontoura, P, Ruiz, PJ et al.; An immunomodulatory GpG oligonucleotide for the treatment of autoimmunity via the innate and adaptive immune systems; J. Immunol.; 171; 4920; 2003. 151. Gursel, I, Gursel, M, Yamada, H et al.; Repetitive elements in mammalian telomeres suppress bacterial DNA-induced immune activation; J. Immunol.; 171; 1393; 2003. 152. Elkins, KL, Rhinehart-Jones, TR, Stibitz, S et al.; Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria; J. Immunol.; 162; 2291; 1999. 153. Gramzinski, RA, Doolan, DL, Sedegah, M et al.; Interleukin-12- and interferon-dependent protection against malaria conferred by CpG oligodeoxynucleotide in mice; Infect. Immun.; 69; 1643; 2001. 154. Zimmermann, S, Egeter, O, Hausmann, S et al.; CpG oligodeoxynucleotides trigger protective and curative Th1 responses in lethal murine leishmaniasis; J. Immunol.; 160; 3627; 1998. 155. Krieg, AM, Love-Homan, L, Yi, AK et al.; CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge; J. Immunol.; 161; 2428; 1998. 156. Klinman, DM, Conover, J, and Coban, C; Repeated administration of synthetic oligodeoxynucleotides expressing CpG motifs provides long-term protection against bacterial infection; Infect. Immun.; 67; 5658; 1999. 157. Klinman, DM, Verthelyi, D, Takeshita, F et al.; Immune recognition of foreign DNA: a cure for bioterrorism?; Immunity; 11; 123; 1999. 158. Rees, DG, Gates, AJ, Green, M et al.; CpG-DNA protects against a lethal orthopoxvirus infection in a murine model; Antiviral Res.; 65; 87; 2005.

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 769


769

159. Deng, JC, Moore, TA, Newstead, MW et al.; CpG oligodeoxynucleotides stimulate protective innate immunity against pulmonary Klebsiella infection; J. Immunol.; 173; 5148; 2004. 160. Ray, NB and Krieg, AM; Oral pretreatment of mice with CpG DNA reduces susceptibility to oral or intraperitoneal challenge with virulent Listeria monocytogenes; Infect. Immun.; 71; 4398; 2003. 161. Klinman, DM; Immunotherapeutic uses of CpG oligodeoxynucleotides; Nat. Rev. Immunol.; 4; 249; 2004. 162. Weighardt, H, Feterowski, C, Veit, M et al.; Increased resistance against acute polymicrobial sepsis in mice challenged with immunostimulatory CpG oligodeoxynucleotides is related to an enhanced innate effector cell response [In Process Citation]; J. Immunol.; 165; 4537; 2000. 163. Pyles, RB, Higgins, D, Chalk, C et al.; Use of immunostimulatory sequence-containing oligonucleotides as topical therapy for genital herpes simplex virus type 2 infection; J. Virol.; 76; 11387; 2002. 164. Ashkar, AA, Bauer, S, Mitchell, WJ et al.; Local delivery of CpG oligodeoxynucleotides induces rapid changes in the genital mucosa and inhibits replication, but not entry, of herpes simplex virus type 2; J. Virol.; 77; 8948; 2003. 165. Walker, PS, Scharton-Kersten, T, Krieg, AM et al.; Immunostimulatory oligodeoxynucleotides promote protective immunity and provide systemic therapy for leishmaniasis via IL-12- and IFN--dependent mechanisms; Proc. Natl. Acad. Sci. U.S.A.; 96; 6970; 1999. 166. Cho, JY, Miller, M, Baek, KJ et al.; Immunostimulatory DNA sequences inhibit respiratory syncytial viral load, airway inflammation, and mucus secretion; J. Allergy Clin. Immunol.; 108; 697; 2001. 167. Juffermans, NP, Leemans, JC, Florquin, S et al.; CpG oligodeoxynucleotides enhance host defense during murine tuberculosis; Infect. Immun.; 70; 147; 2002. 168. Olbrich, AR, Schimmer, S, Heeg, K et al.; Effective postexposure treatment of retrovirus-induced disease with immunostimulatory DNA containing CpG motifs; J. Virol.; 76; 11397; 2002. 169. Freidag, BL, Melton, GB, Collins, F et al.; CpG oligodeoxynucleotides and interleukin-12 improve the efficacy of Mycobacterium bovis BCG vaccination in mice challenged with M. tuberculosis; Infect. Immun.; 68; 2948; 2000. 170. Ramirez-Pineda, JR, Frohlich, A, Berberich, C et al.; Dendritic cells (DC) activated by CpG DNA ex vivo are potent inducers of host resistance to an intracellular pathogen that is independent of IL-12 derived from the immunizing DC; J. Immunol.; 172; 6281; 2004. 171. Ishii, KJ, Ito, S, Tamura, T et al.; CpG-activated Thy1.2⫹ dendritic cells protect against lethal Listeria monocytogenes infection; Eur. J. Immunol.; 35; 2397; 2005. 172. Lugo-Villarino, G, Ito, S, Klinman, DM et al.; The adjuvant activity of CpG DNA requires T-bet expression in dendritic cells; Proc. Natl. Acad. Sci. U.S.A.; 102; 13248; 2005. 173. Shen, H and Iwasaki, A; A crucial role for plasmacytoid dendritic cells in antiviral protection by CpG ODN-based vaginal microbicide; J. Clin. Invest.; 116; 2237; 2006. 174. Kuwajima, S, Sato, T, Ishida, K et al.; Interleukin 15-dependent crosstalk between conventional and plasmacytoid dendritic cells is essential for CpG-induced immune activation; Nat. Immunol.; 7; 740; 2006. 175. Isogawa, M, Robek, MD, Furuichi, Y et al.; Toll-like receptor signaling inhibits hepatitis B virus replication in vivo; J. Virol.; 79; 7269; 2005. 176. Rehermann, B and Nascimbeni, M; Immunology of hepatitis B virus and hepatitis C virus infection; Nat. Rev. Immunol.; 5; 215; 2005. 177. McHutchison, JG, Bacon, BR, Gordon, SC et al.; Relationships of HCV RNA responses to CPG 10101, a TLR9 agonist: pharmacodynamics & patient characteristics; AASLD; 2005. 178. Vallin, H, Perers, A, Alm, GV et al.; Anti-double-stranded DNA antibodies and immunostimulatory plasmid DNA in combination mimic the endogenous IFN- inducer in systemic lupus erythematosus; J. Immunol.; 163; 6306; 1999. 179. Yi, AK, Chang, M, Peckham, DW et al.; CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry [published erratum appears in J. Immunol. 1999 Jul 15; 163(2): 1093]; J. Immunol.; 160; 5898; 1998. 180. Davis, HL, Weeratna, R, Waldschmidt, TJ et al.; CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen [published erratum appears in J. Immunol. 1999 Mar 1; 162(5): 3103]; J. Immunol.; 160; 870; 1998. 181. Liu, N, Ohnishi, N, Ni, L et al.; CpG directly induces T-bet expression and inhibits IgG1 and IgE switching in B cells; Nat. Immunol.; 4; 687; 2003.

CRC_8796_ch027.qxd

770

5/5/2007

03:46 PM

Page 770


182. He, B, Qiao, X, and Cerutti, A; CpG DNA induces IgG class switch DNA recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10; J. Immunol.; 173; 4479; 2004. 183. Lipford, GB, Sparwasser, T, Zimmermann, S et al.; CpG-DNA-mediated transient lymphadenopathy is associated with a state of Th1 predisposition to antigen-driven responses; J. Immunol.; 165; 1228; 2000. 184. Sparwasser, T, Vabulas, RM, Villmow, B et al.; Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent cytotoxic T cell responses to soluble proteins; Eur. J. Immunol.; 30; 3591; 2000. 185. Krieg, AM and Davis, HL; Enhancing vaccines with immune stimulatory CpG DNA; Curr. Opin. Mol. Ther.; 3; 15; 2001. 186. Cooper, CL, Davis, H, Morris, ML et al.; CpG 7909, an immunostimulatory TLR9 agonist oligodeoxynucleotide, as adjuvant to Engerix-B HBV vaccine in healthy adults: a double-blind phase I/II study; J. Clin. Immunol.; 24; 693; 2004. 187. Halperin, SA, Van Nest, G, Smith, B et al.; A phase I study of the safety and immunogenicity of recombinant hepatitis B surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide adjuvant; Vaccine; 21; 2461; 2003. 188. Siegrist, CA, Pihlgren, M, Tougne, C et al.; Co-administration of CpG oligonucleotides enhances the late affinity maturation process of human anti-hepatitis B vaccine response; Vaccine; 23; 615; 2004. 189. Rynkiewicz, D, Rathkopf, M, Ransom, J et al.; Marked Enhancement of Antibody Response to Anthrax Vaccine Adsorbed with CPG 7909 in Healthy Volunteers; ICAAC; 2005. 190. Cooper, CL, Davis, HL, Angel, JB et al.; CPG 7909 adjuvant improves hepatitis B virus vaccine seroprotection in antiretroviral-treated HIV-infected adults; AIDS; 19; 1473; 2005. 191. Weeratna, R, Comanita, L, and Davis, HL; CPG ODN allows lower dose of antigen against hepatitis B surface antigen in BALB/c mice; Immunol. Cell Biol.; 81; 59; 2003. 192. Cooper, CL, Davis, H, Morris, ML et al.; Safety and immunogenicity of CpG 7909 injection as an adjuvant to Fluarix Influenza vaccine; Vaccine; 22; 3136; 2004. 193. Krieg, AM; Antitumor applications of stimulating Toll-like receptor 9 with CpG oligodeoxynucleotides; Curr. Oncol. Rep.; 6; 88; 2004. 194. Link, B, Ballas, Z, Weisdorf, D et al.; Oligodeoxynucleotide CPG 7909 delivered as intravenous infusion demonstrates immunologic modulation in patients with previously treated non-Hodgkin’s lymphoma; J. Immunother.; 2006. 195. Weigel, BJ, Rodeberg, DA, Krieg, AM et al.; CpG oligodeoxynucleotides potentiate the antitumor effects of chemotherapy or tumor resection in an orthotopic murine model of rhabdomyosarcoma; Clin. Cancer Res.; 9; 3105; 2003. 196. Balsari, A, Tortoreto, M, Besusso, D et al.; Combination of a CpG-oligodeoxynucleotide and a topoisomerase I inhibitor in the therapy of human tumour xenografts; Eur. J. Cancer; 40; 1275; 2004. 197. Wang, XS, Sheng, Z, Ruan, YB et al.; CpG oligodeoxynucleotides inhibit tumor growth and reverse the immunosuppression caused by the therapy with 5-fluorouracil in murine hepatoma; World J. Gastroenterol.; 11; 1220; 2005. 198. Manegold, C, Leichman, G, Gravenor, D et al.; Addition of PF-3512676 (CpG 7909) to a taxane/ platinum regimen for first-line treatment of unresectable non-small cell lung cancer (NSCLC) improves objective response – Phase II clinical trial; Eur. J. Cancer; 3; 326; 2005. 199. van Ojik, H, Kruit, W, Portielje, J et al.; Phase I/II study with CpG 7909 as adjuvant to vaccination with MAGA-3 protein in patients with MAGE-3 positive tumors; Ann. Oncol.; 13; 157; 2002. 200. Speiser, DE, Lienard, D, Rufer, N et al.; Rapid and strong human CD8(⫹) T cell responses to vaccination with peptide, IFA, and CpG oligodeoxynucleotide 7909; J. Clin. Invest.; 115; 739; 2005. 201. Kline, JN, Waldschmidt, TJ, Businga, TR et al.; Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma; J. Immunol.; 160; 2555; 1998. 202. Jain, VV, Kitagaki, K, Businga, T et al.; CpG-oligodeoxynucleotides inhibit airway remodeling in a murine model of chronic asthma; J. Allergy Clin. Immunol.; 110; 867; 2002. 203. Creticos, PS, Eiden, JJ, and et al.; Immunotherapy with immunostimulatory oligonucleotides linked to purified ragweed Amb a 1 allergen: effects on antibody production, nasal allergen provocation, and ragweed seasonal rhinitis; J. Allergy Clin. Immunol.; 109; 742; 2002. 204. Simons, FE, Shikishima, Y, Van Nest, G et al.; Selective immune redirection in humans with ragweed allergy by injecting Amb a 1 linked to immunostimulatory DNA; J. Allergy Clin. Immunol.; 113; 1144; 2004.

CRC_8796_ch027.qxd

5/5/2007

03:46 PM

Page 771


771

205. Racila, DM and Kline, JN; Perspectives in asthma: molecular use of microbial products in asthma prevention and treatment; J. Allergy Clin. Immunol.; 116; 1202; 2005. 206. Hayashi, T, Beck, L, Rossetto, C et al.; Inhibition of experimental asthma by indoleamine 2,3-dioxygenase; J. Clin. Invest.; 114; 270; 2004. 207. Jain, VV, Businga, TR, Kitagaki, K et al.; Mucosal immunotherapy with CpG oligodeoxynucleotides reverses a murine model of chronic asthma induced by repeated antigen exposure; Am. J. Physiol. Lung Cell Mol. Physiol.; 285; L1137; 2003. 208. Fanucchi, MV, Schelegle, ES, Baker, GL et al.; Immunostimulatory oligonucleotides attenuate airways remodelling in allergic monkeys; Am. J. Respir. Crit. Care Med.; 170; 1153; 2004. 209. Gauvreau, GM, Hessel, EM, Boulet, LP et al.; Immunostimulatory sequences regulate interferoninducible genes but not allergic airway responses; Am. J. Respir. Crit. Care Med.; 2006. 210. Viglianti, GA, Lau, CM, Hanley, TM et al.; Activation of autoreactive B cells by CpG dsDNA; Immunity; 19; 837; 2003. 211. Boule, MW, Broughton, C, Mackay, F et al.; Toll-like receptor 9-dependent and -independent dendritic cell activation by chromatin-immunoglobulin G complexes; J. Exp. Med.; 199; 1631; 2004. 212. Christensen, SR, Kashgarian, M, Alexopoulou, L et al.; Toll-like receptor 9 controls anti-DNA autoantibody production in murine lupus; J. Exp. Med.; 202; 321; 2005. 213. Means, TK, Latz, E, Hayashi, F et al.; Human lupus autoantibody-DNA complexes activate DCs through cooperation of CD32 and TLR9; J. Clin. Invest.; 115; 407; 2005. 214. Lovgren, T, Eloranta, ML, Kastner, B et al.; Induction of interferon-alpha by immune complexes or liposomes containing systemic lupus erythematosus autoantigen- and Sjogren’s syndrome autoantigen-associated RNA; Arthritis Rheum.; 54; 1917; 2006. 215. Levin, AA, Henry, S, Monteith, D, and Templin, MV; Toxicity of antisense oligonucleotides; in Antisense Drug Technology; Crooke, ST, Ed., Marcel Dekker, New York; 201; 2001. 216. Levin, AA; A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides; Biochim. Biophys. Acta; 1489; 69; 1999. 217. Monteith, DK and Levin, AA; Synthetic oligonucleotides: the development of antisense therapeutics; Toxicol. Pathol.; 27; 8; 1999. 218. Henry, SP, Taylor, J, Midgley, L et al.; Evaluation of the toxicity of ISIS 2302, a phosphorothioate oligonucleotide, in a 4-week study in CD-1 mice; Antisense Nucleic Acid Drug Dev.; 7; 473; 1997. 219. Sparwasser, T, Miethke, T, Lipford, G et al.; Bacterial DNA causes septic shock [letter]; Nature; 386; 336; 1997. 220. Hasegawa, K and Hayashi, T; Synthetic CpG oligodeoxynucleotides accelerate the development of lupus nephritis during preactive phase in NZB ⫻ NZWF1 mice; Lupus; 12; 838; 2003. 221. Ichikawa, HT, Williams, LP, and Segal, BM; Activation of APCs through CD40 or Toll-like receptor 9 overcomes tolerance and precipitates autoimmune disease; J. Immunol.; 169; 2781; 2002. 222. Obermeier, F, Dunger, N, Deml, L et al.; CpG motifs of bacterial DNA exacerbate colitis of dextran sulfate sodium-treated mice; Eur. J. Immunol.; 32; 2084; 2002. 223. Ronaghy, A, Prakken, BJ, Takabayashi, K et al.; Immunostimulatory DNA sequences influence the course of adjuvant arthritis; J. Immunol.; 168; 51; 2002. 224. Boccaccio, GL, Mor, F, and Steinman, L; Non-coding plasmid DNA induces IFN- in vivo and suppresses autoimmune encephalomyelitis; Int. Immunol.; 11; 289; 1999. 225. Quintana, FJ, Rotem, A, Carmi, P et al.; Vaccination with empty plasmid DNA or CpG oligonucleotide inhibits diabetes in nonobese diabetic mice: modulation of spontaneous 60-kDa heat shock protein autoimmunity; J. Immunol.; 165; 6148; 2000. 226. Katakura, K, Lee, J, Rachmilewitz, D et al.; Toll-like receptor 9-induced type I IFN protects mice from experimental colitis; J. Clin. Invest.; 115; 695; 2005. 227. Roach, JC, Glusman, G, Rowen, L et al.; The evolution of vertebrate Toll-like receptors; Proc. Natl. Acad. Sci. U.S.A.; 102; 9577; 2005. 228. Wagner, H; The immunobiology of the TLR9 subfamily; Trends Immunol.; 25; 381; 2004. 229. Lund, JM, Alexopoulou, L, Sato, A et al.; Recognition of single-stranded RNA viruses by Toll-like receptor 7; Proc. Natl. Acad. Sci. U.S.A.; 101; 5598; 2004. 230. Beignon, AS, McKenna, K, Skoberne, M et al.; Endocytosis of HIV-1 activates plasmacytoid dendritic cells via Toll-like receptor-viral RNA interactions; J. Clin. Invest.; 2005. 231. Diebold, SS, Kaisho, T, Hemmi, H et al.; Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA; Science; 303; 1529; 2004.

CRC_8796_ch027.qxd

772

5/5/2007

03:46 PM

Page 772


232. Melchjorsen, J, Jensen, SB, Malmgaard, L et al.; Activation of innate defense against a paramyxovirus is mediated by RIG-I and TLR7 and TLR8 in a cell-type-specific manner; J. Virol.; 79; 12944; 2005. 233. Hemmi, H, Kaisho, T, Takeuchi, O et al.; Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway; Nat. Immunol.; 3; 196; 2002. 234. Heil, F, Ahmad-Nejad, P, Hemmi, H et al.; The Toll-like receptor 7 (TLR7)-specific stimulus loxoribine uncovers a strong relationship within the TLR7, 8 and 9 subfamily; Eur. J. Immunol.; 33; 2987; 2003. 235. Gibson, SJ, Lindh, JM, Riter, TR et al.; Plasmacytoid dendritic cells produce cytokines and mature in response to the TLR7 agonists, imiquimod and resiquimod; Cell Immunol.; 218; 74; 2002. 236. Heil, F, Hemmi, H, Hochrein, H et al.; Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8; Science; 303; 1526; 2004. 237. Judge, AD, Sood, V, Shaw, JR et al.; Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA; Nat. Biotechnol.; 23; 457; 2005. 238. Hornung, V, Guenthner-Biller, M, Bourquin, C et al.; Sequence-specific potent induction of IFN-alpha by short interfering RNA in plasmacytoid dendritic cells through TLR7; Nat. Med.; 11; 263; 2005. 239. Sioud, M; Induction of inflammatory cytokines and interferon responses by double-stranded and single-stranded siRNAs is sequence-dependent and requires endosomal localization; J. Mol. Biol.; 348; 1079; 2005. 240. Probst, J, Brechtel, S, Scheel, B et al.; Characterization of the ribonuclease activity on the skin surface; Genet. Vaccines. Ther.; 4; 4; 2006. 241. Nishiya, T and DeFranco, AL; Ligand-regulated chimeric receptor approach reveals distinctive subcellular localization and signaling properties of the Toll-like receptors; J. Biol. Chem.; 279; 19008; 2004. 242. Nishiya, T, Kajita, E, Miwa, S et al.; TLR3 and TLR7 are targeted to the same intracellular compartments by distinct regulatory elements; J. Biol. Chem.; 2005. 243. Kariko, K, Buckstein, M, Ni, H et al.; Suppression of RNA recognition by Toll-like receptors: the impact of nucleoside modification and the evolutionary origin of RNA; Immunity; 23; 165; 2005. 244. Scheel, B, Braedel, S, Probst, J et al.; Immunostimulating capacities of stabilized RNA molecules; Eur. J. Immunol.; 34; 537; 2004. 245. Forsbach, A, Montino, C, Muller, C et al.; Identification of ssRNA sequences that stimulate innate immunity through TLRs; Clin. Immunol.; Supplement 1, 2005; 2005. 246. Gorden, KB, Gorski, KS, Gibson, SJ et al.; Synthetic TLR agonists reveal functional differences between human TLR7 and TLR8; J. Immunol.; 174; 1259; 2005. 247. Nemorin, JG, Lampron, C, McCluskie, M et al.; Adjuvant activity of ssRNA in Hepatitis B vaccine; First Meeting of the Oligonucleotide Therapeutics Society 2005; 2005. 248. Bekeredjian-Ding, I, Roth, SI, Gilles, S et al.; T cell-independent, TLR-induced IL-12p70 production in primary human monocytes; J. Immunol.; 176; 7438; 2006. 249. Riedl, P, Stober, D, Oehninger, C et al.; Priming Th1 immunity to viral core particles is facilitated by trace amounts of RNA bound to its arginine-rich domain; J. Immunol.; 168; 4951; 2002. 250. Westwood, A, Elvin, SJ, Healey, GD et al.; Immunological responses after immunisation of mice with microparticles containing antigen and single stranded RNA (polyuridylic acid); Vaccine; 24; 1736; 2006. 251. Jacobs, BL and Langland, JO; When two strands are better than one: the mediators and modulators of the cellular responses to double-stranded RNA; Virology; 219; 339; 1996. 252. Loseke, S, Grage-Griebenow, E, Heine, H et al.; In vitro-generated viral double-stranded RNA in contrast to polyinosinic:polycytidylic acid induces interferon-alpha in human plasmacytoid dendritic cells; Scand. J. Immunol.; 63; 264; 2006. 253. Alexopoulou, L, Holt, AC, Medzhitov, R et al.; Recognition of double-stranded RNA and activation of NF-kappaB by Toll-like receptor 3; Nature; 413; 732; 2001. 254. Yoneyama, M, Kikuchi, M, Natsukawa, T et al.; The RNA helicase RIG-I has an essential function in double-stranded RNA-induced innate antiviral responses; Nat. Immunol.; 5; 730; 2004. 255. Yoneyama, M, Kikuchi, M, Matsumoto, K et al.; Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity; J. Immunol.; 175; 2851; 2005. 256. Meylan, E, Curran, J, Hofmann, K et al.; Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus; Nature; 437; 1167; 2005. 257. Balachandran, S, Roberts, PC, Brown, LE et al.; Essential role for the dsRNA-dependent protein kinase PKR in innate immunity to viral infection; Immunity; 13; 129; 2000.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 773

CHAPTER

28

Aptamer Opportunities and Challenges Charles Wilson

CONTENTS 28.1 28.2 28.3

Introduction ........................................................................................................................773 The History of Aptamers and SELEX ...............................................................................774 Applying SELEX to Generate Therapeutic Aptamers .......................................................776 28.3.1 Pool Design ..........................................................................................................776 28.3.2 Pool Composition ................................................................................................776 28.3.3 Positive and Negative Selection Pressures ...........................................................778 28.4 Post-SELEX Optimization .................................................................................................779 28.4.1 Minimization ........................................................................................................780 28.4.2 Affinity Optimization ...........................................................................................780 28.4.3 Nuclease Resistance .............................................................................................781 28.4.4 PEGylation ...........................................................................................................783 28.5 Binding and Functional Properties of Aptamers ...............................................................784 28.6 In Vivo Properties ...............................................................................................................786 28.7 Representative Therapeutic Aptamers ...............................................................................788 28.7.1 Macugen (Pegaptanib) .........................................................................................788 28.7.2 AS1411 ................................................................................................................790 28.7.3 ARC183 ...............................................................................................................791 28.7.4 REG1 ....................................................................................................................792 28.7.5 Preclinical Programs ............................................................................................793 28.8 Conclusions ........................................................................................................................794 28.8.1 Strengths and Opportunities .................................................................................794 28.8.2 Weaknesses and Challenges .................................................................................795 References .....................................................................................................................................795

28.1 INTRODUCTION Aptamers can be considered as the oligonucleotide analogs of antibodies, functioning to bind specific molecular targets with high affinity and high specificity. Since the invention of the SELEX process used to generate aptamers over 15 years ago, significant advances have been made in both our understanding of how aptamers fold and function and in our ability to generate aptamers with 773

CRC_8796_ch028.qxd

774

5/7/2007

05:15 PM

Page 774


properties suitable for practical therapeutic applications. As with the development of monoclonal antibody therapeutics, a number of challenges have been addressed in the move from the lab into the clinic, including dramatic improvements in the pharmacokinetic properties of aptamers, the ability to cost-effectively synthesize large quantities of clinical-grade aptamers, and the ability to tune the specificity and affinity of aptamers for appropriate therapeutic targets. This chapter reviews the process by which these molecules are discovered and summarizes the properties of those that have been developed for therapeutic applications. A handful of example therapeutic programs are described, focusing in particular upon Macugen (pegaptanib), the first aptamer to be approved and marketed for therapeutic use. Remaining challenges in broadening the scope of aptamer therapeutic applications are presented, together with initial efforts at addressing the limitations of the current generation of molecules.

28.2 THE HISTORY OF APTAMERS AND SELEX In contrast to most other therapeutic modalities considered in this compendium, aptamers function by directly interacting with their targets at the protein level rather than at the gene or transcript level. Thus, whereas simple Watson-Crick base pairing defines the basic structural rules that govern the design of antisense and siRNA molecules, it is the ability of aptamers to fold into unpredictable, noncanonical structures that enables them to function. That it is, in fact, possible to create specific binding molecules solely from nucleotide building blocks was not at all obvious when the first aptamers targeting proteins and small molecules were discovered and reported in 1990 [1]. Prior to that time, characterization of a handful of biological RNAs (perhaps the transfer RNAs and the autocatalytic ribozymes serving as the best examples) had shown that certain nucleic acids could adopt discrete three-dimensional conformations to directly confer molecular recognition of proteins and small molecules—aminoacyl synthetases by the tRNAs, nucleotide cofactors by the self-splicing introns. The extent to which such properties could be generalized to other targets was considered limited. It was assumed, for example, that tRNA synthetases had evolved to specifically complement the tRNAs (rather than vice versa) and that recognition of nucleotides by ribozymes such as the group I intron was probably a highly specialized form of base pairing. Early work by Larry Gold on the mechanisms of translational regulation in bacterial and bacteriophage mRNAs provided some key insights that suggested to him that opportunities for structured nucleic acids to recognize protein targets could be larger than generally appreciated [2]. These observations led directly to the first systematic evolution of ligands by exponential enrichment (SELEX) experiment, carried out in his lab by Craig Tuerk and aimed at generating RNA molecules that could recognize bacteriophage T4 DNA polymerase (Figure 28.1) [1]. In this experiment, the translational operator sequence of the polymerase transcript (previously shown to interact with the polymerase itself [3]) was randomized at all eight positions within a loop domain. To facilitate downstream steps in the experiment, the operator sequence was flanked with constant sequences that could serve as binding sites for RT-PCR primers and which would enable individual molecules to be efficiently amplified. The corresponding library of 48 molecules was prepared by transcription with T7 RNA polymerase and purified. The pool was combined with the protein target (T4 DNA polymerase) and captured on a nitrocellulose filter to separate functional (protein-binding) from nonfunctional sequences. The isolated sequences were reverse transcribed, PCR-amplified, and then retranscribed with T7 RNA polymerase to yield an enriched pool of molecules with improved binding activity. This process of selection for binding followed by enzymatic amplification lies at the heart of the SELEX process and survives in every subsequent variant that has been developed in the past 15 years. In this first example, four cycles of selection and amplification yielded an enriched pool with binding activity comparable to the naturally occurring operator sequence. Once the desired level of functional activity had been reached and could not be improved with further

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 775

APTAMER OPPORTUNITIES AND CHALLENGES

775

Template construction (a)

1 5′ 3′

T7 PRO

3′

3

2

5′

nnnnnnnn

3′

4

Ligation

5′ 5

Ligation

In vitro transcription (b)

n n n n n n n n

(c)

Variable sequence

gp43 3′ 5′ gp43 recognition sequence

5′

3′ primer annealing site Selection by gp43 3′ 5′

RT 5

(d) cDNA synthesis of selected RNAs eluted from filters

(e) Second strand synthesis and PCR

T7 PRO 5′ DNA Pol 5′

1

DNA Pol

DNA Pol

5

5′ 3′ 5′

(f) In vitro transcription to begin the next round of SELEX

Figure 28.1 SELEX process. The original scheme for performing SELEX to isolate aptamers as described by Tuerk and Gold (reproduced from [1]).

selection, individual molecules in the pool were cloned and sequenced. Intriguingly, of the approximately 65,000 possible sequences in the starting library, only two—the natural sequence and a four-nucleotide variant—appear in the enriched library. This result is striking as it speaks both to the complexity of molecular recognition by nucleic acids (functional sequences do not occur frequently) and to the power of the SELEX method (despite their rarity, functional sequences can be rapidly isolated). The results of the first SELEX experiment clearly do not speak to the generality of the aptamer phenomenon (i.e., the extent to which aptamers might exist for any arbitrary target). The initial SELEX target was, after all, a protein known to bind nucleic acids and at least one functional aptamer (the natural operator sequence) was known to exist within the starting library. Despite these limitations, Tuerk and Gold immediately grasped the significance of their results and in the first publication of the SELEX method went on to propose several significant variant methods by which aptamers can be identified and the range of targets to which aptamers might be generated. They predict, for example, that small molecules (including transition-state analogs) immobilized

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

776

Page 776


on solid supports could be used as substrates for carrying out SELEX (and that aptamers isolated against such molecules might include catalysts). These predictions were borne out by later publications from the Szostak [4] and Schultz [5] labs showing that small-molecule aptamers did exist and that aptamers targeting transition-state analogs could have catalytic activity. Ellington and Szostak coined the term “aptamer” (obtained from the Latin aptus, “to fit”) and the term is now generally used to encompass nonnatural nucleic acids that bind to molecular targets through means other than Watson-Crick base pairing [2]. As described in the following sections, work by many other academic and industrial groups has gone on to demonstrate the extent to which the SELEX method can be broadly applied to generate aptamers against a wide range of targets, including proteins with no intrinsic nucleic acid–binding propensity [6,7].

28.3 APPLYING SELEX TO GENERATE THERAPEUTIC APTAMERS While the basic SELEX method developed by Tuerk and Gold and described above remains at the core of the process for generating aptamers, it is worth highlighting important refinements that have been developed over the past 15 years that are particularly important in generating these molecules for therapeutic applications. 28.3.1 Pool Design The first SELEX library consisted of RNA molecules with eight random positions [1]. The complexity of this library is low and, in the general case, insufficient to yield aptamers against an arbitrary target. Today’s libraries are typically designed with 30–40 random positions (e.g., [8]). A library prepared at the micromole scale using standard solid-phase methods generally contains approximately 1014–1015 different molecules and correspondingly spans the space of all 28-mers (i.e., an arbitrary 28-mer sequence will on average appear once within the pool). While the first SELEX experiment was carried out using a pool designed to fold as a stem-loop, most current SELEX experiments do not have defined secondary structures built into the library design. Instead, they rely upon fortuitous base pairing within the random region of the library or between the random region and either of the flanking constant regions to drive aptamer folding [9]. 28.3.2 Pool Composition The first SELEX experiments in both the Gold and Szostak labs were performed using pools of RNA molecules. While RNA clearly has the ability to fold into well-defined tertiary structures, RNA as a composition presents a number of challenges for therapeutic use. RNA is marginally stable in vivo as endonucleases and exonucleases act rapidly to cleave both single-stranded and duplex regions. Additionally, the monomers used to chemically synthesize RNA are expensive in comparison to other compositions such as DNA and the efficiency of monomer couplings (as defined by the number of equivalents required to drive coupling and the overall yield) is relatively low. It is difficult to identify workup conditions following solid-phase synthesis that fully deprotect the molecule while avoiding the introduction of other lesions. Together, these properties make RNA aptamers difficult and expensive to prepare and short-lived in the body. Alternative compositions with improved properties—cheaper, more efficient synthesis, and longer in vivo half-life—are universally sought for today’s therapeutic applications. Shortly after the first RNA SELEX experiments (and indeed envisioned in the initial Tuerk and Gold paper [1]), SELEX was carried out using DNA pools [10]. As described in the following sections, the ability to perform SELEX with a variety of other pool compositions has now been demonstrated and these compositions form the basis for most therapeutic aptamer SELEX experiments performed today.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 777


777

Serum nucleases responsible for turnover of RNAs are largely directed toward pyrimidine nucleotides and, as such, modifications to cytosine and uridine have the most beneficial effects on serum stability. Replacement of the ribopyrimidine 2⬘-hydroxyl group with 2⬘-amino, 2⬘-fluoro, or 2⬘-O-methyl substituents yields modified transcripts with significantly improved serum stability. In principle, these modifications can be introduced pre-SELEX, into the initial pools that are subjected to repeated cycles of selection and amplification. To be used in this manner, the polymerases responsible for transcribing the pool or for reverse-transcribing the selected molecules must accommodate the modified nucleotide as either a substrate or template. Before some of the earliest SELEX experiments directed at therapeutic protein targets, it was shown that T7 RNA polymerase could efficiently generate transcripts when the ribonucleotides CTP and UTP were substituted with the corresponding 2⬘-amino variants [11]. Pools of mixed composition—2⬘-ribopurines, 2⬘-aminopyrimidines—could readily yield specific aptamers to a variety of tested targets [12,13]. Whereas natural RNA aptamers exhibit a very short serum half-life (estimated at 10 s), 2⬘-aminopyrimidine-containing transcripts have a serum half-life of 170 h. Despite these properties, the 2⬘-amino modification has several shortcomings and the modification is not widely used in current SELEX approaches. While 2⬘-amino substitution increases nuclease stability, it decreases base pairing thermodynamic stability, potentially limiting the affinity of resulting aptamers [14]. Furthermore, difficulties with synthesis, deprotection, and subsequent preparation of site-specific conjugates using standard nucleophile-targeted strategies (e.g., PEGylation with NHS-activated esters) disfavor the use of 2⬘-amino-modified nucleotides [15]. As a successor to 2⬘-amino modifications, libraries containing 2⬘-fluoro modifications at uridine and cytosine have been prepared and subjected to SELEX to successfully yield functional aptamers against a number of targets. Transcripts containing 2⬘-fluoropyrimidines are somewhat less nuclease resistant than the 2⬘-amino variants (t½ ⬃ 90 h) but are still dramatically improved relative to RNA. Wild-type T7 RNA polymerase will catalyze the synthesis of 2⬘-ribopurine, 2⬘-fluoropyrimidine transcripts but the efficiency is low compared to native RNA transcription. Yields, however, are significantly improved by using the Y639F active site mutant discovered by Sousa and coworkers [16]. In contrast to the 2⬘-amino modification, introduction of the 2⬘-fluoro modification increases relative base-pair stability [17] and, in at least three head-to-head comparisons, aptamers generated using 2⬘-fluoro nucleotides show better affinity than 2⬘-amino aptamers generated to the same target [15,18,19]. Transcription of 2⬘-ribopurine, 2⬘-fluoropyrimidine pools has yielded some of the best characterized aptamers, including pegaptanib, the only aptamer currently approved and marketed as a therapeutic. Despite its many favorable properties, the 2⬘-fluoro modification has its own set of issues. 2⬘-fluoropyrimidine phosphoramidites are expensive in comparison to more commonly used chemistries and commercial supplies are limited. Deprotection of mixed ribo/fluoro oligonucleotides presents its own set of issues that seems to vary from one sequence to another. While there is no evidence for specific toxicities associated with 2⬘-fluoropyrimidines, in vitro biochemical studies have shown that these nucleotides can be used as substrates by mitochondrial DNA polymerases [20] and that, indeed, animals dosed with high concentrations incorporate these fluoropyrimidines into mitochondrial DNA [21]. The 2⬘-O-methyl modification combines many of the favorable properties of the 2⬘-fluoro modification (nuclease resistance, thermodynamic stability) without the apparent liabilities (high cost, complicated deprotection, potential for incorporation into cellular DNA). A key limitation preventing widespread use of 2⬘-O-methyl nucleotides in SELEX has been the inability to generate 2⬘-O-methyl-containing transcripts. Recent work from several groups has addressed this limitation and ultimately yielded the first 2⬘-O-methyl-containing aptamers where such modifications have been introduced pre- rather than post-SELEX. In one approach, Chelliserrykattil and Ellington reported the application of an activity-based protein selection for T7 RNA polymerase mutants with the ability to generate transcripts using 2⬘-O-methyl-containing NTPs as substrates [22]. Through this means, they successfully identify variant polymerases that accept 2⬘-OMe A, C, and U (but not G).

CRC_8796_ch028.qxd

778

5/7/2007

05:15 PM

Page 778


In principle, such mutants could be used to generate largely 2⬘-O-methylated aptamers by transcription. Burmeister et al. have achieved this end result using a fundamentally different approach [8]. Relying initially upon the well-characterized Y639F and Y639F/H784A T7 RNAP mutants [16,23], transcription conditions were exhaustively screened to identify combinations that allowed all four 2⬘-O-methyl nucleotides to be simultaneously incorporated into optimized pool sequences. Using these modified conditions, it became possible to generate full-length 2⬘-O-methyl pool transcripts and to turn repeated rounds of SELEX. Using otherwise conventional SELEX methods, Burmeister et al. succeeded in isolating a fully 2⬘-O-methyl aptamer to vascular endothelial growth factor (VEGF) that compares favorably with Macugen in several respects (e.g., ease of synthesis, serum stability, in vivo stability). While much work has focused on enabling SELEX with pools bearing different 2⬘ modifications, it is worth noting in passing that a wider set of modifications spanning other sites within the backbone or nucleobases has been conceived and reduced to practice in the context of SELEX. Phosphorothioate modifications can be readily introduced via polymerization using -thio-NTPs as substrates. King et al. have used this approach to generate aptamers targeting NF-B [24] while Tam et al. have generated phosphorothioate-containing aptamers to CD28 [25]. Modifications to the nucleobases, most commonly at the 5 position of pyrimidines, are often tolerated by the polymerases used for SELEX and raise the possibility of introducing entirely new functional groups with altered recognition properties into aptamers. One of the earliest examples of such a modification was the replacement of thymidine by 5-(1-pentynyl)-2⬘-deoxyuridine in a DNA library, which was subsequently used to isolate thrombin aptamers [26]. More recently, several groups have shown that amino acid-like functional groups can be synthetically appended in the same way and that these modified nucleotides can be incorporated by T7 RNA polymerase or KOD DNA polymerase to yield pools suitable for SELEX [27,28]. 28.3.3 Positive and Negative Selection Pressures The SELEX process depicted in Figure 28.1 shows a single selective pressure for function: positive selection for binding to the target of interest. In virtually all SELEX experiments performed today, negative selection is also used as a means for preventing the enrichment of nonspecific binding molecules. In the general case, the pool is initially contacted with the partitioning matrix (e.g., the nitrocellulose filter) and nonspecific matrix-binding molecules are discarded. To optimize aptamer specificity for therapeutic applications, cross-binding to undesired targets can be minimized by also including such targets in the negative selection step. An interesting example of the utility of negative selection is afforded by the related heterodimeric cytokines IL-23 and IL-12. Both molecules play important roles in the activation of T cells with IL-12 exerting its effects preferentially upon naïve TH0 cells and IL-23 acting upon memory TH1 cells [29]. The cytokines share a common p40 subunit and most monoclonal antibodies reported to date bind this shared subunit and knockout the activities of both cytokines. On the basis of both theoretical understandings of the roles of the cytokines and on knockout experiments in animal models for disease, there are good reasons to believe that specifically targeting IL-23 is likely to have beneficial effects in a range of autoimmune indications (e.g., multiple sclerosis, rheumatoid arthritis, psoriasis, and Crohn⬘s disease) while targeting IL-12 may increase the risk for infection through general immunosuppression [30]. To isolate aptamers with specificity favoring IL-23 over IL-12, SELEX was carried out using IL-12 in the negative selection step and IL-23 in the positive selection step [31]. The resulting molecules exhibit greater than 100-fold discrimination in binding. Whereas the aptamers fully inhibit IL-23-triggered release of interferon- at nanomolar concentrations, IL-12 release cannot be fully blocked at any concentration. There are some situations in which cross-specificity to multiple targets may be desirable, and in these instances successive positive selection steps can be used (either with or without an intervening amplification step) to favor the isolation of aptamers with broadened specificity. For example, it can

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 779


779

be useful to generate aptamers that recognize both the human and rodent forms of a target protein such that the molecule that will be developed as a human-specific therapeutic can also be tested in preclinical disease models to demonstrate efficacy and to assess potential toxicities. Aptamers with such properties can in principle be generated by performing rounds of SELEX with the human form of the target and interspersing or following with rounds of SELEX against the rodent form. This concept has been successfully applied to generate aptamers that recognize a VEGF receptor from human (KDR) and mouse (flk-1) [32]. Five rounds of SELEX were initially performed using a soluble form of the human protein. A pool of protein-binding aptamers was identified but it failed to show significant cross-binding to the soluble mouse protein. Using the human-specific round 5 pool as a starting point, five additional rounds of SELEX were subsequently performed using the mouse protein as a target. The pool resulting from a total of 10 rounds of selection shows good cross-reactivity, hitting both human and mouse soluble receptors with comparable affinities. It is worth noting that this strategy presents some risks in the general case. If the two positive selection targets are not closely related, it is likely that the best binding molecules to either target will be lost through the combined selection process. In the worst case, SELEX will fail outright and no target-specific aptamers to either protein will be enriched.

28.4 POST-SELEX OPTIMIZATION Molecules isolated by the SELEX process typically exhibit good affinity and specificity for the targets against which they have been selected to bind. They suffer, nonetheless, from several shortcomings that may significantly limit their potential as therapeutics. Functional activity: Unless specifically designed otherwise, SELEX isolates aptamers simply on the basis of their ability to bind to a target of interest. High-affinity binding does not necessarily correlate with functional activity to the extent that aptamers may localize to nonneutralizing epitopes on their targets. As with other strategies based on enrichment for binding (e.g., antibodies, phage display peptides), aptamer clones must be screened in biochemical and cellular assays to identify those that not only bind a target but which modulate an interaction between the target and its downstream effectors to alter its biological function (e.g., block receptor-ligand binding, prevent enzyme-substrate turnover). Synthesis length: The initial aptamer sequences isolated by SELEX are typically 70–80 nucleotides long. This constraint is imposed by the initial pool design since they must generally include a 30–40 nucleotide long random region and ⬃20 nucleotide long constant sequences at both 5⬘ and 3⬘ ends. While it may be possible to chemically synthesize such full-length molecules using current solid-phase synthesis methods, the cost for synthesis is very high and yields are low, making commercialization of such molecules difficult or impossible. In general, aptamer sequences must be truncated and minimized to enable efficient large-scale synthesis. Affinity: While varying significantly from target to target, aptamers initially isolated from random pools often exhibit KDs in the 1–10 nanomolar range. Depending upon other factors (e.g., target concentration, the affinity of the target for downstream effectors, etc.), affinities in this range may or may not be sufficient for therapeutic applications. Metabolic stability: Serum nucleases have a profound impact on the metabolic stability of aptamers. Depending upon the initial pool composition used to perform the SELEX experiment, resulting molecules may show sensitivity to serum nucleases that is incompatible with the desired therapeutic application. While there are some exceptions, it is often desirable to increase the nuclease resistance of the initial aptamer clones to extend their in vivo half-life. Renal filtration/biodistribution: While aptamers are large molecules from a synthetic perspective, they are small compared to most proteins and, unless appropriately modified, are subject to rapid elimination from the body via renal filtration. In those indications where long duration of action is a desired attribute, blocking renal filtration is essential.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

780

Page 780


Minimization

3′-cap

Optimization

PEGylation

Figure 28.2 Stepwise process for optimizing aptamers for therapeutic applications. Aptamer clones obtained by SELEX are (a) initially minimized to remove excess nucleotides not required for function, (b) capped to prevent 3⬘→ 5⬘ exonuclease degradation (typically using an inverted nucleotide to create a 3⬘-3⬘ linkage), (c) optimized by replacement of starting nucleotides (open circles) with base and backbone modifications (shaded and filled circles) to improve endonuclease resistance and target affinity, and (d) PEGylated to prevent rapid renal filtration.

Despite the limitations listed above, there are relatively straightforward means to address each through post-SELEX optimization (Figure 28.2). The following sections outline the available strategies, supported by specific examples. 28.4.1 Minimization While aptamer sequences isolated from random sequence pools are relatively long, it is almost invariably possible to remove a significant fraction (typically half to two-thirds) of the total oligonucleotide without compromising and in some cases improving binding activity. Most high-affinity aptamers generated against protein targets can be shortened to approximately 25–35 nucleotides although there are occasional examples of significantly smaller (e.g., ARC183, a 15-nucleotide aptamer targeting thrombin [10]) and larger aptamers [33]. It is generally not the case that only the random region within the starting library contains the functional aptamer core. Often, a portion of the constant sequence will base-pair with a complementary region within the random sequence to define the secondary structure required for folding and function. There are many ways in which the minimal core within an aptamer sequence may be defined. In the optimal case, visual inspection of independent clone sequences may reveal a conserved sequence or structural motif present in each (e.g., [34]). Constructs corresponding to the conserved motif can be chemically synthesized and tested for binding to confirm the prediction. Algorithms for predicting RNA secondary structure (e.g., MFOLD [35]) may assist this process. Alternatively, biochemical experiments or brute-force, systematic synthesis of truncations and internal deletions can be used to map the binding domain directly [36]. 28.4.2 Affinity Optimization A combination of both sequence and chemical modifications can be used to improve aptamer affinities for their targets, often converting low nanomolar binders into low- to mid-picomolar binders. One approach to optimization parallels the biological affinity maturation process of antibodies [37,38]. In a typical experiment, a parent aptamer sequence to be optimized is used to direct synthesis of a degenerate library of molecules with the parent sequence nucleotide dominating at each position but with each of the non-wild-type possibilities doped into the pool at low frequency (typically 5–10%). Most molecules in this library incorporate mutations by chance that prevent proper functioning of the aptamer and thus the starting pool typically exhibits minimal binding activity. By subjecting the pool

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 781

APTAMER OPPORTUNITIES AND CHALLENGES (a)

(b)

KD= 3 nM Figure 28.3

781

KD= 35 pM

KD= 2 nM

KD= 20 pM

Examples of aptamer optimization. Aptamers directed toward therapeutic targets with applications in inflammation (a) and oncology (b) were optimized through an iterative process of testing individual backbone modifications (2⬘-deoxy → 2⬘-OMe, 2⬘-OMe → 2⬘-deoxy, phosphodiester → phosphorothioate) and base modifications (guanosine → inosine) to identify those that could improve aptamer affinity and nuclease stability. Beneficial modifications were combined to yield the composite molecules shown. In the first example, modifications at roughly half the nucleotides in the aptamer yield approximately 100-fold improvement in affinity. In the second example, a single modification accomplishes comparable effects. Open circles: 2⬘-deoxy nucleotides; closed circles: 2⬘-OMe nucleotides; and shaded circles: phosphorothioate, inosine, and 3⬘-idT nucleotides.

to a few cycles of SELEX, reselecting for the ability to bind to the target, functional activity may be rapidly recovered. By progressively increasing selective pressure (e.g., using lower concentrations of target or increasing the concentration of nonspecific competitors during the partitioning step), it is possible to drive enrichment of those sequence variants with the strongest affinity. Sequencing individual clones within the reselected library typically reveals a handful of preferred sequence changes that can often be combined in composite variants to yield the highest-affinity sequences. Through this process, five- to tenfold improvements in KD are often observed. An alternative means for improving affinity involves the introduction of site-specific chemical modifications that cannot be accessed through simple changes in nucleotide sequence. 2⬘ modifications (e.g., 2⬘-deoxy → 2⬘-O-methyl, 2⬘-hydroxy → 2⬘-O-methyl), phosphate modifications (e.g., phosphodiester → phosphorothioate), and nucleobase modifications (e.g., uridine → thymidine, guanosine → inosine) have all been shown to have beneficial effects on aptamer affinity when introduced in the appropriate context [15,39]. Some of these modifications likely function by improving the folding of the aptamer, favoring either a more rigid structure or preventing its misfolding into inactive conformations. Other modifications likely function to optimize the overall steric fit between the aptamer and the target or introduce additional stabilizing pairwise interactions to drive binding. Sites where modifications are beneficial (or even tolerated) cannot generally be predicted, even when the secondary structure of the aptamer is clearly defined. As such, a typical optimization approach involves systematically synthesizing and testing a series of single-site variants in which a given type of substitution is individually introduced at each successive position within an aptamer. The effect of substitutions is assessed by comparing the variant target-binding affinity to the parental affinity—all modifications that individually improve target binding may be simultaneously combined to create a single composite molecule. Effects are quite often additive with multiple incremental improvements in binding combining to yield substantial net gains in affinity [39]. In the course of a typical optimization process, approximately 100 different variants may be tested and affinity improved by 100- to 1000-fold (Figure 28.3). 28.4.3 Nuclease Resistance Depending upon the composition of the starting SELEX pool and the desired therapeutic application, it may be necessary to engineer increased nuclease resistance into an aptamer to ultimately achieve a desired in vivo half-life. Both exonucleases and endonucleases play a role in defining the rate and pathway by which aptamers are degraded in serum. As described in the following sections, several different types of modifications can be introduced to limit the activity of these enzymes.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 782

782


3⬘→ 5⬘-directed exonucleases are responsible for the much of the cleavage of unstabilized nucleic acids [40]. Nucleotide or nonnucleotide caps attached to the 3⬘ end of an aptamer can effectively block such exonucleases, making endonucleolytic cleavage the preferred pathway for degradation. For historical reasons, the inverted deoxythymidine (idT) cap has been used in many therapeutic aptamers although other approaches (e.g., PEGylation, biotinylation) appear to be equally effective. By simply conjugating a deoxythymidine nucleotide via a 3⬘-3⬘ linkage to an otherwise unstabilized DNA aptamer, serum half-life is increased from minutes to approximately 1 h [41]. 5⬘→ 3⬘-directed exonucleases play a less prominent role in defining the stability of aptamers but can similarly be blocked using nonnucleotide caps. The most commonly used cap with therapeutic aptamers has been an alkylamine, typically introduced in the last step in solid-phase synthesis to create a reactive nucleophile for subsequent conjugation reactions. Even without subsequent conjugation, the alkylamine itself is sufficient to stabilize aptamers to subsequent exonuclease-mediated degradation. Di Giusto and King recently described a novel strategy for blocking exonucleases by circularizing aptamers via intra- or intermolecular ligation [42]. Joining the ends of the aptamer eliminates the termini altogether and thus obviates the requirement for stabilizing cap structures. The aptamer constructs they generate are remarkably stable, exhibiting serum half-lives exceeding 10 h. Modifications to the aptamer backbone can hinder both rate-limiting cleavages at internal sites by endonucleases and processive degradation by exonucleases. As noted previously, the replacement of the 2⬘-hydroxyl of ribopyrimidines with 2⬘-fluoro, 2⬘-amino, or 2⬘-O-methyl modifications can dramatically improve the serum stability of aptamers. While 2⬘ substitutions to pyrimidines have the predominant effect on stability, 2⬘ modifications to purines further extend aptamer half-lives (Figure 28.4). In contrast to cap modifications, which are invariably well tolerated, 2⬘-modifications introduced post-SELEX must be evaluated for their effect on aptamer activity since they have the potential to interfere with either folding or target binding [15].

Aptamer (ng/mL)

10000.0

1000.0

MNA mRfY

100.0 rRfY

10.0

0

1000

r/mRfY

2000 3000 Time (min)

4000

Figure 28.4 Effects of 2⬘-modifications on aptamer in vivo stability. A series of related aptamers were prepared in which a common base sequence was synthesized with a variety of different backbone substitutions including 2⬘-ribopurine, 2⬘-fluoropyrimidine (rRfY), partial replacement of some 2⬘-ribopurines with 2⬘-OMe nucleotides (r/mR,fY), replacement of all 2⬘-ribopurines with 2⬘-OMe nucleotides (mRfY), and fully 2⬘-OMe substitution (MNA). The oligonucleotides were conjugated with a 40 kDA PEG and administered to Sprague-Dawley rats as a 1 mg/kg bolus intravenous injection. Pharmacokinetic profiles were determined by measuring aptamer in serum at the indicated times following injection.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 783


783

28.4.4 PEGylation With appropriate modifications to control nuclease-mediated degradation, elimination via renal filtration becomes the major limitation to aptamer half-life. A typical minimized and stabilized aptamer has a molecular weight of 5–15 kDa, well below the effective cut-off size of the glomerular filter responsible for sieving macromolecules in the bloodstream (which generally excludes species greater than 30–50 kDa). As such, even highly nuclease-resistant aptamers exhibit relatively short functional half-lives (i.e., less than 10 min) unless additional modifications are introduced to increase their apparent size. Among the different strategies that have been explored, conjugation with high-molecular-weight poly(ethylene glycols) (PEGs) has had the most practical success. Alternative methods yielding some reduction in renal clearance have included conjugation to carrier proteins (e.g., streptavidin via biotinylated aptamer [43]) and association with liposomes through conjugation with lipid tags [44]. A handful of additional small molecules (including Tat, Ant, or poly-arginine peptides and cholesterol derivatives) have been linked to aptamers with the objective of modifying aptamer clearance and biodistribution [45]. For the most part, however, the pharmacokinetic properties of these conjugates remain largely unchanged relative to the unmodified aptamers. PEGylation is a widely used method for controlling the pharmacokinetic properties of therapeutics [46]. PEGs used for this purpose can range in size from 5 kDa up to 60 kDa. PEGs are linear molecules, generally synthesized by the catalytic polymerization of ethylene oxide. One end of the PEG polymer is usually derivatized with a cross-linking group to facilitate subsequent conjugation to a therapeutic. The preparation of high-molecular-weight molecules suitable for incorporation into therapeutics (i.e., consistent batch-to-batch mean molecular weight, low polydispersity, and high conjugation efficiency) is technically challenging. To facilitate preparation of larger PEGs (e.g., 40 kDa and 60 kDa), two or more shorter PEGs may be covalently joined to yield branched polymers. Depending upon the chemistry of the PEG activating group and the therapeutic to be conjugated, one or more PEGs may be linked to a single molecule. Very often, PEG is provided as an activated ester (e.g., N-hydroxy-succinimide) to react with available primary amines on the target (e.g., the multiple lysine side chains of a protein therapeutic) to form stable amide linkages. The basic chemical structure of aptamers (including the standard modifications previously described) generally excludes reactive nucleophiles. As such, the sites of PEG conjugation can be well defined by introducing reactive groups at specified sites into the aptamer during synthesis. Most often, a 5⬘-alkylamine phosphoramidite modifier is provided as the last solid-phase coupling and a single PEG subsequently conjugated in a solution reaction to the 5⬘ end of the aptamer. Recent work by Kurz and colleagues has relied upon both 5⬘- and 3⬘-amine modifications to aptamers to prepare diPEGylated conjugates [47]. While synthesis of these molecules imposes some additional challenges relative to monoderivatized conjugates, it avoids the requirement to use costly branched PEGs to generate molecules with the highest PEG-loading/largest apparent size. In contrast to the general case with PEGylation of biologics, PEGylation of aptamers generally does not alter their functional activity although effects must be experimentally evaluated on a case-by-case basis. This observation can be directly tied to the site-specific manner in which PEGs are attached at the termini of the molecule, typically well removed from the structural core responsible for target binding. If, in contrast, reactive amines are introduced via nucleobase modifications into the functional core of an aptamer and subsequently PEGylated, loss of functional activity is frequently observed. As shown in Figure 28.5, modification with PEGs of progressively increasing molecular weight yields aptamer conjugates with progressively longer half-lives. This simple relationship can be exploited to engineer an aptamer with a prespecified duration of action to optimize its use for a particular therapeutic indication.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 784

784

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION 10,000 40 kDa PEG

Aptamer (nM)

1,000 20 kDa PEG 100

no PEG

10

1 0

5

10

15

20

25

Time (h) Figure 28.5

Effects of PEGylation on aptamer in vivo half-life. Pharmacokinetic profiles of a 39-nucleotide dRmY composition aptamer bearing stabilizing 2⬘-OMe chemical substitutions and either no PEG, a 20-kDa linear PEG, or a 40-kDa branched PEG following intravenous administration of a 10-mg/kg bolus to CD-1 mice (n = 3 per time point).

28.5 BINDING AND FUNCTIONAL PROPERTIES OF APTAMERS Aptamers have been reported targeting over 100 different proteins [6,7]. Examining the range of targets that have yielded high-affinity binders suggests that aptamers as a class are capable of recognizing a very broad range of protein types. Successful SELEX targets include intracellular and extracellular proteins, soluble and membrane-associated proteins, and acidic and basic proteins. With respect to the biological function of targets, aptamers have been successfully generated against cytokines, hormones, growth factors, cell signaling receptors, coagulation and complement factors, enzymes, immunoglobulins, structural proteins, intracellular signaling molecules, splicing factors, transcription factors, translation factors, and toxins. There are no systematic differences in the properties of aptamers across the different functional classes that would suggest any particular protein family is particular well or poorly suited for generating high-affinity binders (Figure 28.6). Along these lines, it is interesting also to note that while some proteins clearly exhibit nonspecific low-affinity nucleic acid binding, such binding is not a pre-requisite for the generation of highaffinity aptamers—subnanomolar binders have been generated to targets that show no detectable binding to the naïve libraries used to perform SELEX. Similar to antibodies, aptamers are generally highly specific for the targets against which they have been elicited. In general, they do not cross-react to orthologs within a protein family unless a high level of sequence homology exists between the targets (⬎70%). As a specific example [48], aptamers generated to reverse transcriptase from HIV-1 bind with a KD in the low picomolar range. The reverse transcriptase of HIV-2 is recognized by the same aptamer with ⬎3000-fold weaker affinity. Along the same lines, an aptamer elicited to basic fibroblast growth factor (bFGF) binds its target with 350 pM affinity [49]. As shown in Table 28.1, other proteins within the FGF protein family are recognized with approximately 1000- to 10,000-fold weaker affinity. Finally, aptamers generated to L-selectin bind its target with 8000- to 15,000-fold and 200- and 500-fold specificity versus P-selectin and E-selectin, respectively [50]. In each of these cases, no active measures (e.g., negative selection) were taken to ensure lack of cross-reactivity. Conceptually, nonspecific protein binding could have a number of effects on the in vivo properties of aptamers. Binding to serum proteins might reduce the fraction of aptamer available to interact with a specific target and limit aptamer potency (presuming serum protein binding competes for specific binding). At the same time, association with serum proteins might help

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 785


785

(a) 45 Other (toxin, structural protein, etc.)

40

Transcription/splicing/translation factor

# Targets

35

Intracellular signal transduction

30

Immunoglobulin

25

Enzyme

20

Cytokine; chemokine; hormone; growth factor

15

Coagulation/complement

10

Cell surface receptor; adhesion molecule; viral coat protein

5 0

10

Affinity (nM)

00

0

00 10

10

10

1

1 0.

00 1 0. 01

0.

0

0

(b) 40 Pool Hit Truncated Minimized Stabilized Optimized

35 # Targets

30 25 20 15 10 5 00 00 0 10

0 10

10

10

1

1 0.

00 1 0. 01

0.

0

0

Affinity (nM) Figure 28.6 Reported affinities for aptamers. Aptamers reported in publications and patents were tabulated with respect to (a) target protein class, and (b) stage of aptamer development. Overall, most reported aptamers have affinities in the 1–10 nM range. Aptamer affinities are relatively uniform across protein classes with no particularly favored or disfavored target types. Aptamer affinities uniformly improve following the development process outlined in Figure 28.2, which pool affinities at the low end of the spectrum and aptamers having undergone medicinal chemistry optimization showing the best affinities.

Table 28.1 Example of Aptamer Specificity: Basic Fibroblast Growth Factor (bFGF) Protein BFGF (FGF-2) Denatured FGF-1 FGF-4 FGF-5 FGF-6 FGF-7 VEGF PDGF AB AT III Thrombin

KdbFGF/Kdprotein 1.0 0.0008 0.0003 0.0006 0.041 0.0005 0.0007 0.0008 0.002 0.000008 0.00003

Note: An aptamer specifically selected for binding to bFGF was assessed for binding to related protein targets. Results are expressed as the ratio between the KD for bFGF (350 pM) and that for the nonspecific target.

CRC_8796_ch028.qxd

786

5/7/2007

05:15 PM

Page 786


drive distribution of aptamers out of the bloodstream into tissues and also limit clearance by renal filtration. Certain chemical modifications to oligonucleotides, most notably phosphorothioates, are known to confer both serum protein binding and the predicted pharmacokinetic effects [51]. With a handful of exceptions, aptamers lack the extensive phosphorothioate modifications routinely used for antisense therapeutics, and the rapid renal clearance of (unPEGylated) aptamers suggests minimal influence by serum protein binding. The vast majority of therapeutic aptamers that have been generated are designed to function as antagonists by competitively blocking protein-protein interactions between an aptamer target and a biological effector of the target. In general, aptamers generated to proteins that exist as single folded domains (e.g., cytokines) have a high likelihood of functioning as antagonists with a potency directly related to the balance between aptamer-target affinity and target-effector affinity. Aptamers generated against multidomain protein targets (e.g., cell-surface receptors) may or may not function as antagonists, depending largely upon where they bind relative to the biological effector. Using appropriate experimental strategies, e.g., SELEX against a defined ligand binding domain rather than the complete protein, it is possible to direct the binding specificity of resulting aptamers in ways that maximize the likelihood of obtaining functional inhibitors. A handful of potential therapeutic applications have been described in which an aptamer functions as a targeting vehicle for delivery of an active agent. One of the best developed examples of this strategy is provided by aptamers selected to bind PSMA, a cell-surface protein preferentially expressed on the surface of prostate tumour cells. Aptamers generated to PSMA bind with affinities in the range of 1–10 nM and specifically label PSMA(⫹) LNCaP cells [33]. Aptamers conjugated to the protein toxin gelonin [52] or to cytotoxin-loaded nanoparticles [53] have demonstrated efficient in vitro killing of PSMA-expressing cells and improved efficacy in mouse xenograft models [54].

28.6 IN VIVO PROPERTIES The preceding sections have highlighted the range of chemical modifications that can be introduced into an aptamer in the course of optimization. Through the judicious choice of backbone modifications and conjugation chemistries, it is possible to generate aptamers with widely divergent pharmacokinetic properties (Figure 28.7). As such, the in vivo properties of an aptamer can be tailored to optimize its utility for a particular indication. As an example at one end of the spectrum, ARC183 is a thrombin-specific aptamer developed for use as an anticoagulant in CABG and PCI surgeries where rapid pharmacological off-set is highly desired (discussed in more detail in Section 28.7.3). Because this molecule lacks backbone modifications that would prevent nuclease attack and PEGylation that would limit renal filtration, it exhibits a very short in vivo half-life, making it possible to predictably and rapidly dial in an appropriate level of anticoagulant activity by simply adjusting the rate at which drug is infused. At the other extreme, pegaptanib (marketed as Macugen) is an anti-VEGF aptamer developed for the treatment of age-related macular degeneration (AMD). Because administration of the drug requires direct injection into the eye, very long half-life is desired to enable as infrequent dosing as possible. As discussed in Section 28.7.1, pegaptanib incorporates extensive backbone modifications (introduced both pre- and post-SELEX) to block nucleases and conjugation to a high-molecular-weight branched PEG to slow absorption from the eye into the systemic circulation (the rate-limiting step in the disposition of the aptamer [55]). Intravitreally administered pegaptanib exhibits an average apparent half-life of 10 days [56], sufficient to enable dosing in patients once every 6 weeks (to be contrasted with dosing once every 4 weeks for Lucentis, the anti-VEGF antibody fragment). With these and other examples spanning a range of aptamer compositions, it is possible to draw some general conclusions regarding the ADME properties of aptamers. With appropriate stabilizing

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 787


787

modifications using the range of previously discussed chemistries, serum nuclease-mediated metabolism is not a limitation for many therapeutic applications. The terminal half-life of a typical stabilized and PEGylated aptamer following intravenous bolus administration ranges from 3 to 22 h in rodents and 30–60 h in primates [57]. The observed volume of distribution (Vss) is typically two- to fivefold larger than the plasma volume (⬃40 mL/kg) in rodents and primates with 40-kDa PEG conjugates falling at the low end of the range and unconjugated and 20-kDa PEG conjugates reaching the upper end. PEGylated aptamers composed fully by 2⬘-O-methyl modified nucleotides (enabled via recent modifications to the SELEX process) exhibit the longest in vivo half-lives studied to date [8]. Figure 28.7 shows the profile of a fully 2⬘-O-Me aptamer administered to CD-1 mice at 10 mg/kg. Aptamer concentrations in these plasma samples were assessed by fluorescence using the intercalating dye Oligreen™ (Molecular Probes, Eugene, OR) by comparison with standard curves. The aptamer shows monophasic pharmacokinetics with an elimination half-life of 22 h and a volume of distribution of 87 mL/kg. The ability to penetrate and persist in target tissues is a requisite property for therapeutics targeting factors that are expressed or exert their function in tissue. Aptamer tissue distribution has been studied as a function of composition using tritium exchange as means for labeling aptamer and with either traditional tissue oxidation followed by liquid scintillation counting (LSC) [45] or quantitative whole-body autoradiography (QWBA) [58] to quantify aptamer levels. Using these methods, both PEGylated and unPEGylated aptamers are shown to access all tissues with the exception of the central nervous system and the testis (similar low penetration across the blood-brain barrier has been previously observed for antisense oligonucleotides). There are, however, significant differences across tissue types with the proportions influenced by composition and PEGylation. For all compositions examined, the highest concentrations of radioactivity are observed in the kidney and bladder, consistent with urinary elimination as a primary route of clearance. An unPEGylated, fully 2⬘-O-Me aptamer is more rapidly cleared from the circulation than other compositions and appears to be eliminated through the kidney without metabolism. PEGylation

(a) 1000

(b) primate rodent

100

anti-C5 (rat)

10

pegaptanib(rat) anti-PDGF (mouse)

1

Aptamer in plasma (nM)

fully 2′-OMe (mouse) pegaptanib(primate)

Half-life (h)

100000

anti-C5 (cyno)

10000 1000 100 10 1 0

20

40

60

80

100

120

Time (h) 0.1

ARC183

0.01 DNa

DNA/RNA/OMe

PEG-OMe

Composition

Figure 28.7 Tailored pharmacokinetics. (a) The range of aptamer half-lives accessible via backbone modifications and PEGylation. (b) Pharmacokinetic profile of a 23-nucleotide-long fully 2⬘-OMe aptamer following intravenous administration of a 10-mg/kg bolus to female CD-1 mice (n = 3 per time point).

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 788

788


significantly increases the total level of radioactivity in well-perfused organs and tissues, including liver, lungs, spleen, bone marrow, and myocardium. The ability of aptamers to penetrate into inflamed tissue has been directly studied using the carrageenan mouse paw model [58]. Boomer et al. treated animals initially with direct carrageenan injection into the right hind paw, followed 10 min later with injection of tritiated aptamer. After 3 h, animals were sacrificed and analyzed by QWBA. Inflamed tissues contained significantly more aptamer than normal tissue, suggesting that inflammation increases permeability to aptamer uptake. While all aptamers could be detected at significant concentrations in the inflamed paw tissue, a PEG-conjugated aptamer accumulated to higher levels than did unconjugated aptamers. This observation parallels those that have been made regarding the distribution of PEGylated biologics into tumors where a phenomenon of enhanced permeability and retention (EPR) similarly leads to elevated drug levels [59]. It has been postulated that the leaky vasculature of tumors (and inflamed tissue) facilitates influx into tissue but that PEGylation slows efflux via the lymphatics responsible for draining the tissue. Traditional “cut and burn” and QWBA studies described above suffer two key limitations. First, while they inform on the quantity of drug-derived material in tissues, it is impossible to discriminate between parent drug and metabolites. It remains possible that tissue-associated radioactive label reflects the distribution of metabolites as much as it does active aptamer. Second, they do not inform on the subcellular distribution of aptamer and thus the actual availability of aptamer for binding to its target. Microautoradiography has been used to examine the localization of labeled aptamer (and metabolites) in extracted tissue sections and it is clear that some fraction of labeled material resides within cells, most notably the sinusoidal lining cells in the liver and the proximal and distal tubular cells in the kidney [58]. At the same time, it is clear from in vivo pharmacology studies using aptamers directed against tissue-based targets (e.g., PDGF-BB, complement C5, IL-23) that they are able to penetrate into the extravascular space with sufficient efficiency to achieve efficacy. Future studies will be required to characterize the proportion of intra- and extracellular aptamer in tissues and understand the effects of composition (oligonucleotide and PEG) on the relative balance.

28.7 REPRESENTATIVE THERAPEUTIC APTAMERS Aptamers directed against specific protein targets have progressed by varying degrees toward development and approval as therapeutics. The following sections highlight those for which significant public data are available. 28.7.1 Macugen (Pegaptanib) Macugen, an anti-VEGF165 aptamer co-developed by OSI Eyetech and Pfizer, is approved and marketed for the treatment of AMD. As the first aptamer to run the full course from discovery to clinical development to regulatory approval, it provides a comprehensive example of some of the principles outlined previously in the chapter. Work initially pioneered by the laboratory of Judah Folkman helped establish the role of VEGF as a central regulator of angiogenesis. By the mid-1990s, the role of angiogenesis in pathology was strongly indicated by preclinical studies in both oncology (where inhibitors of VEGF signaling were shown to limit tumor growth [60]) and conditions of ocular neovascularization (diabetic retinopathy [61], retinopathy of prematurity [62], and macular degeneration [63]). With this impetus, Gold, Janjic, and coworkers at NeXstar began efforts to generate therapeutic aptamers that could bind and block VEGF. Following initial efforts with suboptimal aptamer compositions [12,64], Ruckman et al. succeeded in generating high-affinity VEGF aptamers using conventional SELEX partitioning from a starting library of 2⬘-fluoropyrimidine, 2⬘-ribopurine oligonucleotides [15].

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 789


789

A large number of independent clone sequences were initially identified but many could be assigned to one of three dominant sequence families on the basis of a conserved sequence motif in each. Representatives from each of the major sequence families were minimized using a combination of biochemical fragmentation experiments and synthetic truncations, yielding aptamers ranging from 23 to 29 nucleotides long for the three different families. The tolerance of each 2⬘-ribopurine to substitution by 2⬘-OMe was biochemically mapped in an effort to remove potential sites of nuclease attack. For each of the three different minimized aptamers, a handful of sites were identified where a significant loss of affinity accompanied introduction of the 2⬘-OMe group. Simultaneously introducing 2⬘-OMe modifications at all sites that were well tolerated yielded stabilized variants with affinities for VEGF ranging from 40 to 130 pM. All three molecules were shown to block binding of VEGF to its receptors, Flt-1 and KDR, in in vitro assays with potencies correlated to their intrinsic ligand affinity. The optimized leads were evaluated in an in vivo test known as the Miles assay to identify a single candidate for further development. In this experiment, VEGF is injected into the dermis to induce changes in cutaneous vascular permeability, causing intravenously administered Evans blue dye to escape out of the blood and color surrounding tissue. Despite the relatively similar in vitro properties of the three aptamers, only one, t44-OMe, showed significant in vivo activity. Following capping of the 3⬘ end with an inverted deoxythymidine to block exonuclease activity and modification with a branched 40-kDa PEG, treatment with this aptamer (known subsequently as NX1838, EYE001, Macugen, or pegaptanib) was able to almost completely prevent dye leakage into the VEGF injection site, suggesting complete blockade of VEGF function [65]. In a second in vivo model, polymer pellets containing VEGF were implanted in the corneal stroma of rats to induce the growth of blood vessels into the normally avascular cornea [65]. Pegaptanib-treated animals showed up to 65% reduction in angiogenic index (a quantitative scoring of blood vessel density and length) relative to controls. Additional animal studies included a retinopathy of prematurity (ROP) model in which 7-day old mice were exposed to hyperoxic conditions for an extended period to induce the growth of blood vessels through the limiting membrane of the retina into the vitreous [65]. Histological scoring showed that pegaptanib treatment caused an 80% reduction in retinal neovascularization. While not directly relevant to ophthalmic applications, pegaptanib was also tested in the A673 rhabdomyosarcoma xenograft model [65]. Aptamer-treated animals showed tumor growth inhibition of ⬃70–75% relative to vehicle-treated animals, results comparable to those achieved with Avastin (bevacizumab), an anti-VEGF monoclonal antibody [60]. The pharmacokinetic properties of pegaptanib have been explored following intravenous or intravitreal administration [66,67]. When provided as an intravenous bolus injection of 1 mg/kg to cynomolgus macaques, pegaptanib exhibits a half-life of approximately 9.3 h. Its intravitreal half-life, defined by the rate of absorption, is roughly tenfold higher than the systemic half-life (94 h in monkeys and 83 h in rabbits). Intravitreal bioavailability varies slightly across species but is uniformly high (70–100%). Limited pharmacokinetic data on pegaptanib exist in humans. Following intravitreal administration at 10 times the recommended dose, pegaptanib reaches maximal plasma concentrations after 1–4 days and displays a terminal half-life of 10 days [56]. In its initial phase I clinical trial, 0.25–3.0 mg pegaptanib was administered by intravitreal injection to patients diagnosed with exudative AMD (wet AMD) [65]. Dose-limiting toxicity was not achieved. 80% of patients receiving the aptamer had improved or stabilized vision after 3 months and 27% had a ⱖ 3 line improvement on the Early Treatment for Diabetic Retinopathy Study Chart (ETDRS). With repeat dosing in a phase II study, 88 % of AMD patients demonstrated stabilized or improved vision after 3 months and 25% of eyes showed ⱖ 3 line improvement in the ETDRS [68]. Two identically designed multicenter phase III clinical trials including a total of 1186 patients were used to generate the data that supported regulatory approval for pegaptanib use in AMD [69]. Patients were randomized to receive 0, 0.3, or 3.0 mg pegaptanib every 6 weeks over a course of 54 weeks. All patients receiving pegaptanib had significantly less disease progression than untreated patients; 70% of patients receiving the approved dose of pegaptanib (0.3 mg) were

CRC_8796_ch028.qxd

5/7/2007

790

05:15 PM

Page 790


classified as responders (losing less than 15 letters of visual acuity after 54 weeks) as compared to 55% of patients receiving sham injections ( p ⬍ 0.001). Focusing upon those patients with the best response during the treatment period, 6% of aptamer-treated patients showed a ⱖ 3 ETDRS line improvement compared with only 2% of the control group. Conversely, a significantly ( p ⬍ 0.001) smaller proportion of aptamer-treated patients experienced severe vision loss than did patients receiving the sham injection (10% versus 22%). Pegaptanib was generally well tolerated and most adverse ocular events were mild, transient, and unrelated to the drug. With safety and efficacy established for AMD through the clinical trial experience described above, pegaptanib was approved by the FDA in December 2004 for marketing in the United States under the trade name Macugen. By 2006, approval from regulatory agencies had been granted allowing its use in Canada and Europe as well. Potential applications in the treatment of diabetic macular edema (DME) and retinal vein occlusion (RVO) are currently being explored through ongoing clinical trials [70]. 28.7.2 AS1411 AS1411 is an aptamer currently being developed by Antisoma (UK) as a potential cancer treatment. The G-rich aptamer (also known as GRO29A and AGRO100) was discovered fortuitously as a designed control molecule through in vitro experiments exploring the cytostatic activity of oligonucleotides against a number of different tumor cell lines [71]. Subsequent characterization established that the oligonucleotide associated as a dimer, stabilized by the formation of intermolecular stacked G-quartets [72]. The folded dimer was shown to bind nucleolin, a large, highly expressed protein that has been implicated in a number of cellular functions that include ribosome biogenesis. While normally found in the nucleolus (hence its name), a proportion of the expressed protein is localized to the plasma membrane in transformed cells. This extracellular localization may explain both the ability of the aptamer to be efficiently taken up into cells and the observation that activity is limited to transformed and not normal cells. Recent data suggest that the aptamer additionally has the capacity to interact with NF-B essential modulator (NEMO), a regulatory subunit of the inhibitor of B kinase (IKK) complex, and that this additional activity may partially account for the aptamer’s biological activity [73]. The IKK complex is normally responsible for the phosphorylation of IB and ultimately drives the transcriptional activation activity of NF-B. Treatment of transformed cells with AS1411 was shown to inhibit IKK activity and reduce IB phosphorylation observed following induction with TNF-. As expected from these results, AS1411 was shown to block both induced and constitutive NFB activity in human cancer cell lines derived from a variety of tumor types (including cervical, prostate, breast, and lung). The initial in vitro studies used to identify AS1411 have been followed by a number of in vivo xenograft studies. In a pancreatic cancer model, a combination of AS1411 with gemcitabine was shown to be significantly more effective in slowing tumor growth than gemcitabine alone [74]. AS1411 accumulates rapidly in lung cancer xenografts, reaching levels at least 9 times those seen in any normal tissue after 1 h. An initial phase I trial with AS1411 was carried out to define potential limiting toxicities, to explore the pharmacokinetic properties in humans, and, by exploring responses wide range of cancer types, to identify target indications for further development [75]. Patients with documented progressive metastatic disease, who had failed multiple previous therapies, received aptamer administered as a continuous intravenous infusion over 96 h at 1 mg/kg/day. A follow-up treatment at 10 mg/kg/day over 7 days was provided if no toxicity had been observed following the initial treatment. A total of 17 patients received 22 cycles of AS1411 treatment. The aptamer appears to be well tolerated as no drug-related toxicities were observed in any patients. Detailed pharmacokinetic data have not been reported from the trial but aptamer was detected in the serum throughout the infusion period and serum levels correlated with the administered dose. Two months after treatment, eight patients (50%) showed stable disease. Disease remained stable in these patients for 2–9 months

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 791


791

before progression. At the time the trial results were initially presented, one patient was maintaining a nearly complete response more than 6 months after treatment. On the basis of the profile of responses in the initial trial, a second phase I trial was designed targeting patients with advanced renal cell carcinoma (RCC) or non-small cell lung cancer (NSCLC) [76]. The aptamer was delivered as a single continuous 7-day intravenous infusion with an optional second treatment cycle. At the time interim trial results were presented (June 2006), no serious adverse events had been observed. Doses of 22 mg/kg/day yielded peak plasma levels of 1.5 M, a concentration shown to be effective at killing cancer cells in in vitro studies. One of five RCC patients receiving AS1411 therapy maintained a near-complete response 18 months after treatment. Among the four other patients, three had stable disease while a fourth had progressed. Among three NSCLC patients receiving therapy, one had stable disease and two had progressed. As the first aptamer tested for the treatment of cancer in humans, AS1411 continues to show promising results. 28.7.3 ARC183 Originally discovered by Bock and colleagues at Gilead in the early 1990s [10], ARC183 (previously known as GS522) is an extensively characterized direct thrombin inhibitor that has been explored as a potential short-acting anticoagulant for use in cardiac surgeries (e.g., coronary artery bypass graft [CABG] procedures). Heparin, the current standard of care in this setting, has a number of practical advantages including a long history of physician experience with the drug, low cost, straightforward monitoring, and the ability to reverse activity with protamine. Despite these advantages, heparin has a number of widely recognized limitations. The long half-life of heparin necessitates its reversal with an antidote and, while protamine is effective in most patients in this capacity, it can trigger adverse immune reactions and its short half-life (⬃5 min) may result in postoperative unopposed (rebound) heparin effects [77]. Repeated exposure to heparin can result in the generation of antibodies directed against complexes of heparin with Platelet Factor 4 and these antibodies can induce thrombocytopenia upon subsequent heparin treatment [78]. Current estimates suggest that up to 5% of patients receiving heparin treatment will experience heparin-induced thrombocytopenia (HIT), a condition characterized by thromboembolic events in 30–50 % of patients and mortality in 10–20%. The inability of heparin to inhibit clot-bound thrombin and its tendency to induce platelet aggregation and dysfunction represent further limitations that may impact heparin’s effectiveness and which have driven the development of alternative therapies [79,80]. ARC183 is a 15-nucleotide-long all-DNA aptamer composed entirely of guanosine and thymidine residues. Structural studies indicate that the aptamer adopts a stable chair-like structure [81] in which guanosines self-associate to form two stacked tiers of G-quartets. Two dithymidine loops at the bottom of the chair structure appear to be critical for the high-affinity interaction with thrombin, directing binding to exosite I on the surface of the coagulation cascade protease. The measured affinity of the aptamer for thrombin is dependent upon both environmental conditions and assay method. KDs ranging from 1.4 nM to 100 nM have been reported [82,83]. Affinity for prothrombin is approximately an order of magnitude weaker than that for thrombin. Binding to other serum proteins or proteolytic enzymes is essentially undetectable [10]. In vitro studies using whole human blood show that ARC183 is an effective anticoagulant, inhibiting both thrombin-catalyzed generation of fibrin from fibrinogen and thrombin-induced platelet aggregation [10]. In contrast to heparin, ARC183 is effective at inhibiting clot-bound thrombin, potentially limiting the propagation of venous thrombi or rethrombosis. In vivo studies have explored the anticoagulant properties of ARC183 using dog and monkey models of cardiopulmonary bypass [84,85]. Because it lacks stabilizing backbone modifications to limit nuclease attack and PEGylation to limit renal filtration, ARC183 exhibits a very short in vivo half-life (⬃2 min). Upon infusion into cynomolgus monkeys, anticoagulation (measured as prothrombin times or ACTs) is rapidly induced and plateaus at a constant level within 10 min of beginning the treatment. Because the aptamer is rapidly cleared, drug levels sustained in the blood

CRC_8796_ch028.qxd

5/7/2007

792

05:15 PM

Page 792


are directly proportional to the infusion rate and the anticoagulation level can be rapidly adjusted by increasing or decreasing the infusion rate. Ten minutes after stopping the infusion, measures of coagulation status return to normal, coincident with clearance of the aptamer from the blood. The aptamer has been tested in a series of phase I clinical trials in normal human volunteers and patients with coronary artery disease. Results from these experiments show that infusion of ARC183 results in a rapid onset of anticoagulation and that stable, dose-related anticoagulation can be maintained with continuous infusion. Rapid reversal and return to normal hemostasis was observed after drug infusion stopped. While the pharmacokinetic profile observed in humans was well predicted by the preclinical studies, the limited potency of the aptamer meant that the amount of drug needed to achieve the desired anticoagulation required for CABG surgery resulted in a suboptimal dosing profile. Efforts correspondingly have now focused on a second-generation aptamer, designated NU172 (ARC2172), which possesses a pharmacokinetic profile similar to that for ARC183 but with significantly higher potency as an anticoagulant. 28.7.4 REG1 REG1 is an anti-Factor IXa aptamer that is currently being explored in phase I studies for development as an anticoagulant for use in coronary procedures, driven by many of the same factors that motivated the development of ARC183 (Section 28.7.3). A unique feature of REG1 is its codevelopment with a targeted antidote that is designed to rapidly reverse its pharmacological activity. Coagulation Factor IXa (FIXa) is a component of the intrinsic tenase complex responsible for generating Factor Xa, the enzyme that converts prothrombin to thrombin. Inihibitors of Factor IXa can have potent anticoagulant effects and may offer advantages with respect to bleeding complications relative to alternative anticoagulant targets [86]. Aptamers to Factor IXa were initially isolated using standard SELEX methods from a pool of 2⬘-fluoropyrimidine, 2⬘-ribopurine oligonucleotides [34]. All aptamer sequences that bound to the target contained a conserved structural motif consisting of a hairpin containing a common asymmetric bulge. A truncated version of one of the aptamers, designated 9.3t, bound Factor IXa with 580 pM affinity and suppressed Factor X activation in vitro. As expected, the aptamer had significant activity as an anticoagulant when measured using assays that measure the intrinsic pathway (e.g., activated partial thromboplastin time (aPTT)) but minimal effects in assays based on extrinsic pathway activity (e.g., prothrombin time [PT]). REG1 appears to be a modified version of the 9.3t aptamer incorporating additional stabilizing backbone modifications and a high-molecular-weight PEG [87]. As discussed for ARC183, the ability to rapidly control and reverse anticoagulant activity is essential for safe therapeutic use. In contrast to ARC183, which achieves rapid reversibility as a result of its short in vivo half-life, REG1 has an intrinsically long half-life. Reversal of anticoagulant effects has been achieved in this case using a complementary antidote oligonucleotide that, via base-pairing to the active aptamer, is able to block proper aptamer folding and thus interfere with its interaction with the target [34]. Initial in vitro studies have been recently extended with testing of an anti-Factor IXa aptamer in a porcine model of cardiopulmonary bypass (CPB) [88]. In these experiments, aptamer was initially administered as a bolus injection to achieve a relatively constant level of anticoagulation that persisted throughout 60 min of the CPB procedure. At the end of the procedure, a specific complementary antidote oligonucleotide was administered by bolus injection and it affected an immediate return to normal coagulation status. In these experiments, the aptamer/antidote achieved a pharmacokinetic profile very similiar to that observed with heparin/protamine (i.e., rapid onset, constant activity throughout the procedure, followed by rapid offset). In addition, a number of ancillary observations point toward potential competitive advantages for the aptamer relative to heparin. For example, inflammatory responses triggered by thrombin generation (including IL-1 and IL-6 release) may contribute to the morbidity and mortality observed in patients undergoing open-heart procedures. By blocking the generation

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 793


793

of thrombin upstream in the coagulation cascade rather than inhibiting thrombin itself, the aptamer has the potential to minimize these effects. In the porcine CPB model, heparin/protamine-treated animals showed 15 times higher levels of IL-1 and 2 times higher levels of IL-6 than aptamer/ antidote-treated animals. Protamine treatment itself has a number of potentially adverse effects in addition to its reversal of heparin, including increases in pulmonary artery pressue, decreases in systolic and diastolic blood pressure, impairment of myocardial oxygen consumption, and decreased cardiac output. To define whether aptamer/antidote treatment would be expected to have the same effects (and correspondingly adverse patient outcomes), cardiac physiology was assessed by measuring mean arterial pressure (MAP) during and after the CPB procedure. While aptamer- and heparin-treated animals showed no significant differences during CPB, significant differences were observed postreversal. Protamine caused a consistent and dramatic drop in MAP in heparin-treated animals in the period up to 30 min following administration. The antidote oligonucleotide in contrast had inconsistent and comparatively minor effects on MAP. To date, data on Factor IXa aptamers and the potential to reverse their activity with complementary oligonucleotides appear very encouraging. REG1 is currently undergoing testing in normal human volunteers in a phase I trial and results will be presented before the end of 2006. It remains to be seen what other types of aptamer therapeutic applications might similarly benefit from rapid reversal using an antidote approach. 28.7.5 Preclinical Programs Aptamers targeting a number of additional targets have been isolated, optimized for in vivo use, and tested in animal disease models for efficacy. Many of these are currently being assessed in IND-enabling studies with expections to enter formal clinical development in the near future. The following represents a partial listing. ●

●

ARC1779 is a PEGylated, stabilized aptamer targeting the A1 domain of von Willebrand Factor (vWF). It inhibits arterial thrombus formation by blocking platelet recruitment to collagen exposed at sites of vascular injury. In primate electrical injury studies, the aptamer has provided antiplatelet activity comparable to that of the most potent available therapies (e.g., GPIIb/IIIa inhibitors) and thus may be useful as a treatment for acute coronary syndromes (ACS), percutaneous coronary intervention (PCI), and possibly thrombotic thrombocytopenic purpura (TTP). The limited role of vWF in thrombus formation under conditions of low shear flow is expected to translate into reduced bleeding risk and thus a wider therapeutic index. The half-life of the aptamer has been optimized to allow for relatively rapid pharmacological off-set, thereby enabling its use in patients who may need to undergo subsequent surgical intervention. Clinical testing of ARC1779 is expected to start in early 2007. Anti-PDGF-B aptamers have been tested in a variety of animal models where the effects of PDGF-B in driving proliferation, differentiation, and migration of mesenchymal cells have been shown to play a role in pathology. In a model for restenosis, aptamer-treated animals exhibited significantly reduced intimal hyperplasia in response to balloon injury relative to vehicle-treated animals [89]. In a rat model of mesangioproliferative glomerulonephritis, aptamer treatment significantly reduced the number of glomerular mitoses [90]. With treatment limited to 4 days following disease induction, long-term benefit in kidney function (including reduced proteinuria, tubulointerstitial damage, and renal extracellular matrix accumulation) extended for 100 days. Anti-PDGF aptamers have shown benefit in tumor models [91,92] where they reduce interstitial fluid pressure (IFP) presumably through effects on both proliferation of fibroblasts within the tumour stroma and on recruitment of pericytes to endothelial cells in the neovasculature. Aptamer-induced reduction in IFP allows higher levels of cytotoxics to penetrate into the tumor and thus correspondingly potentiates cytotoxic effects in reducing tumor growth. The angiogenic effects of anti-PDGF agents in combination with anti-VEGF agents have been explored in the context of ocular models for neovascularization [93]. It is in this context that E10030, an anti-PDGF aptamer under development by OSI Eyetech, is likely to enter clinical testing in the near future.

CRC_8796_ch028.qxd

794

5/7/2007

05:15 PM

Page 794

ANTISENSE DRUG TECHNOLOGY, SECOND EDITION ●

ARC1905 is a PEGylated, stabilized aptamer targeting complement factor C5 that effectively inhibits activation of the downstream proinflammatory complement cascade (including generation of C5a and the membrane attack complex). Complement activation has been implicated in a number of acute and chronic conditions. Some of the strongest clinical data suggesting a role for complement inhibitors come from pexelizumab, an anti-C5 antibody fragment that has been clinically tested for use in CABG surgeries [94]. Along similar lines, the aptamer has been tested in the isolated perfused mouse heart model. In this setting, ARC1905 was shown to block complement activation occurring both in the bloodstream and within cardiac tissue to indefinitely preserve heart function.

28.8 CONCLUSIONS The preceding sections have provided a sense of how aptamers are developed for specific molecular targets and tailored for in vivo use as therapeutic agents. The approval of Macugen (pegaptanib) as a therapy for AMD validates the aptamer approach and provides a measure of both the opportunities and the challenges associated with aptamer development. In conclusion, I briefly review the general features currently defining aptamers as a therapeutic platform. 28.8.1 Strengths and Opportunities ●

●

●

●

●

●

●

Rapid discovery: Using standard SELEX methods, aptamers can be rapidly discovered and optimized once a particular molecular target has been specified. Arguably, the discovery timelines from target to IND are faster for aptamers than they are for both small molecules (which are typically slowed by the challenges of lead optimization) and antibodies (which are slowed by the requirement to optimize GMP manufacture). The ability to rapidly generate new aptamers makes it possible to integrate results from clinical trials with other compounds to generate second-generation therapeutics with optimal properties. Target specificity: Similar to antibodies, aptamers isolated via the SELEX process demonstrate high specificity for their targets. This specificity minimizes the potential for off-target toxicities and should ultimately translate into large therapeutic indices. (It is worth noting that this specificity comes with potential costs. Aptamers may not cross react with unidentified isoforms that may be important for efficacy or with orthologs from other species that could facilitate preclinical testing). Stability: Modern aptamer compositions are typically resistant to degradation under a relatively wide range of environmental conditions (e.g., extremes of pH or temperature). In contrast to the monoclonal antibodies that they functionally resemble, aptamers can be readily denatured and will spontaneously refold into their active conformation. This combination of properties renders them appropriate for settings that cannot be readily developed with biologics (e.g., field use in the absence of a refrigeration chain, formulation with novel controlled-release technologies that involve denaturing solvents, etc.). Blocking protein-protein interactions: Aptamers, similar to antibodies, can robustly prevent interactions between ligand-receptor and substrate-enzyme pairs, interactions that often have proven refractory to inhibition using small-molecule approaches. Tailored pharmacokinetics: The range of backbone modification and conjugation chemistries allows aptamer half-life and biodistribution to be predictably adjusted over a very wide range— enabling extremely rapid off-set for acute indications and relatively infrequent dosing for chronic indications. Lack of immunogenicity: Similar to other nucleic acid–based modalities and in contrast to proteinbased biologics, aptamers have minimal propensity to elicit an antibody response. The standard chemistries used by aptamers (including 2⬘-OMe backbone modifications and PEGylation) have also been shown to prevent Toll-like receptor–mediated immunostimulatory responses that may be undesirable for many therapeutic applications. Manufacturing: The basic process of milligram-scale aptamer synthesis that is used during discovery and optimization can be used to readily scale up to gram and kilogram scale for clinical and commercial

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 795


795

manufacture. Both the relative investment required to build aptamer GMP manufacturing capacity and the timeframe for aptamer GMP process development provide advantages over competing monoclonal antibodies.

28.8.2 Weaknesses and Challenges ●

●

●

●

●

●

●

ADMET unknowns: Our current understanding of aptamers as therapeutics is limited by the body of data defining their in vivo properties. Recent studies have continued to suggest that aptamer disposition can be understood in terms that generalize to the entire class but exceptions remain likely. The fate of aptamers and aptamer metabolites in tissues remains broadly undefined. Half-life limits: Using current compositions, the longest-lived aptamers appear to have systemic half-lives approaching 1 week in primates. In contrast, half-lives of 3 weeks and longer have been demonstrated for monoclonal antibodies in humans. Unless more stable compositions or new controlled-release technologies are developed, aptamers may not be able to achieve the multiweekly dosing intervals that contribute to competitive advantage in the monoclonal antibody space. Parenteral administration: While the feasibility of delivery via nonparenteral routes (e.g., inhalation, topical, oral, enema) has been explored for other types of oligonucleotides, no such studies have been described for aptamers. For applications where small-molecule drugs make oral delivery a possibility, aptamers may not be competitive if parenteral administration is the only delivery option. Cost of goods: Aptamers are complicated molecules to manufacture and, despite continued progress in cost-effective manufacture, are unlikely to be routinely competitive with traditional small-molecule drug manufacture. Requirements for tertiary structure: In contrast to small-molecule and antisense therapeutics, aptamers require a specific three-dimensional folded structure to function. This need imparts unique requirements for analytical and bioanalytical characterization. Effector functions: Aptamers are pure binding molecules, selected solely for the ability to bind to a therapeutic target with high affinity and specificity. In contrast to antibodies, aptamers do not intrinsically allow for target-directed immune effector functions such as complement-dependent cytotoxicity (CDC) or antibody-dependent cellular cytotoxicity (ADCC). For some specific applications (e.g., certain oncology targets), these effector functions may be important contributors to efficacy and their absence with aptamers represents a limitation. Intracellular targets: Aptamers can be readily generated to intracellular targets and can, if transcribed intracellularly via transfected expression vectors, block intracellular targets. No studies to date, however, have shown that an exogenously provided aptamer can functionally block an intracellular target.

In conclusion, aptamers as a therapeutic platform offer a number of advantages that complement existing small-molecule and biologic approaches to drug discovery. Continued efforts to better understand the properties of aptamers and to refine the technology through changes in chemical composition will broaden the opportunities for aptamers as a class of therapeutics.

REFERENCES 1. Tuerk, C. and Gold, L, Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase, Science, 249, 505, 1990. 2. Tuerk, C. et al., CUUCGG hairpins: extraordinarily stable RNA secondary structures associated with various biochemical processes, PNAS, 85, 1364, 1988. 3. Andrake, M. et al., DNA polymerase of bacteriophage T4 is an autogenous translational repressor, PNAS, 85, 7942, 1988. 4. Ellington, A.D. and Szostak, J.W., In vitro selection of RNA molecules that bind specific ligands, Nature, 346, 818, 1990.

CRC_8796_ch028.qxd

796

5/7/2007

05:15 PM

Page 796


5. Prudent, J.R., Uno, T., and Schultz, P.G., Expanding the scope of RNA catalysis, Science, 264, 1924, 1994. 6. Nimjee, S.M., Rusconi, C.P., and Sullenger, B.A., Aptamers to proteins, in The Aptamer Handbook, Klussmann, S. ed., Wiley-VCH, Weinheim, 2006, chap. 6. 7. Cload, S.T. et al., Properties of therapeutic aptamers, in The Aptamer Handbook, Klussmann, S. ed., Wiley-VCH, Weinheim, 2006, chap. 17. 8. Burmeister, P.E. et al., Direct in vitro selection of a 2⬘-O-methyl aptamer to VEGF, Chem. Biol., 12, 25, 2005. 9. Legiewicz, M. et al., Size, constant sequences, and optimal selection, RNA, 11, 1701, 2005. 10. Bock, L.C. et al., Selection of single-stranded DNA molecules that bind and inhibit human thrombin, Nature, 355, 564, 1992. 11. Aurup, H., Williams, D.M., and Eckstein, F., 2⬘-Fluoro- and 2⬘-amino-2⬘-deoxynucleoside 5⬘-triphosphates as substrates for T7 RNA polymerase, Biochemistry, 31, 9636, 1992. 12. Green, L.S. et al., Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor, Chem. Biol., 2, 683, 1995. 13. Jellinek, D. et al., Potent 2⬘-amino-2⬘-deoxypyrimidine RNA inhibitors of basic fibroblast growth factor, Biochemistry, 34, 11,363, 1995. 14. Aurup, H. et al., Oligonucleotide duplexes containing 2⬘-amino-2⬘-deoxycytidines: thermal stability and chemical reactivity, Nucleic Acids Res., 22, 20, 1994. 15. Ruckman, J., et al., 2⬘-Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165): inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain, J. Biol. Chem., 273, 20,556, 1998. 16. Padilla, R. and Sousa, R., Efficient synthesis of nucleic acids heavily modified with non-canonical ribose 2⬘-groups using a mutant T7 RNA polymerase (RNAP). Nucleic Acids Res., 27, 1561, 1999. 17. Sabahi, A. et al., Hybridization of 2⬘-ribose modified mixed-sequence oligonucleotides: thermodynamic and kinetic studies, Nucleic Acids Res., 29, 2163, 2001. 18. Pagratis, N.C. et al., Potent 2⬘-amino-, and 2⬘-fluoro-2⬘-deoxyribonucleotide RNA inhibitors of keratinocyte growth factor. Nat. Biotechnol., 15, 68, 1997. 19. Kubik, M.F. et al., Isolation and characterization of 2⬘-fluoro-, 2⬘-amino-, and 2⬘-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding, J. Immunol., 159, 259, 1997. 20. Richardson, F.C. et al., Polymerization of 2⬘-fluoro- and 2⬘-O-methyl-dNTPs by human DNA polymerase alpha, polymerase gamma, and primase, Biochem Pharmacol., 59, 1045, 2000. 21. Richardson, F.C. et al., Quantification of 2⬘-fluoro-2⬘-deoxyuridine and 2⬘-fluoro-2⬘-deoxycytidine in DNA and RNA isolated from rats and woodchucks using LC/MS/MS, Chem. Res. Toxicol., 15, 922, 2002. 22. Chelliserrykattil, J. and Ellington, A.D., Evolution of a T7 RNA polymerase variant that transcribes 2⬘-O-methyl RNA, Nat. Biotechnol., 22, 1155, 2004. 23. Padilla, R. and Sousa, R., A Y639F/H784A T7 RNA polymerase double mutant displays superior properties for synthesizing RNAs with non-canonical NTPs, Nucleic Acids Res., 30, e138, 2002. 24. King, D.J. et al., Combinatorial selection and binding of phosphorothioate aptamers targeting human NF-kappa B RelA(p65) and p50, Biochemistry, 41, 9696, 2002. 25. Tam, R.C. et al., Increased potency of an aptameric G-rich oligonucleotide is associated with novel functional properties of phosphorothioate linkages, Antisense Nucleic Acid Drug Dev., 9, 289, 1999. 26. Latham, J.A., Johnson, R., and Toole, J.J., The application of a modified nucleotide in aptamer selection: novel thrombin aptamers containing 5-(1-pentynyl)-2⬘-deoxyuridine, Nucleic Acids Res., 22, 2817, 1994. 27. Vaught, J.D., Dewey, T., and Eaton, B.E., T7 RNA polymerase transcription with 5-position modified UTP derivatives, J. Am. Chem. Soc., 126, 11,231, 2004. 28. Kuwahara, M. et al., Direct PCR amplification of various modified DNAs having amino acids: convenient preparation of DNA libraries with high-potential activities for in vitro selection, Bioorg. Med. Chem., 14, 2518, 2006. 29. Kreymborg, K., Bohlmann, U., and Becher, B., IL-23: changing the verdict on IL-12 function in inflammation and autoimmunity, Expert Opin. Ther. Targets, 9, 1123, 2005. 30. Bowman, E.P., Chackerian, A.A., and Cua, D.J., Rationale and safety of anti-interleukin-23 and antiinterleukin-17A therapy, Curr. Opin. Infect. Dis., 19, 245, 2006. 31. Pendergrast, P.S., Aptamers that discriminate between IL-23 and IL-12 are specific inhibitors of IL-23 activity in vitro, presented at 4th Conference on Cytokines and Inflammation, La Jolla, CA, January 31, 2006.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 797


797

32. Janjic, N. and Gold, L., High affinity vascular endothelial growth factor (VEGF) receptor nucleic acid ligands and inhibitors, US Patent 6,762,290, 2004. 33. Lupold, S.E. et al., Identification and characterization of nuclease-stabilized RNA molecules that bind human prostate cancer cells via the prostate-specific membrane antigen, Cancer Res., 62, 4029, 2002. 34. Rusconi, C.P. et al., RNA aptamers as reversible antagonists of coagulation factor IXa, Nature, 419, 90, 2002. 35. Mathews, D.H. et al., Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure, J. Mol. Biol., 288, 911, 1999. 36. Wilson, C., Nix, J., and Szostak, J., Functional requirements for specific ligand recognition by a biotin-binding RNA pseudoknot, Biochemistry, 37, 14,410, 1998. 37. Knight, R. and Yarus, M., Analyzing partially randomized nucleic acid pools: straight dope on doping, Nucleic Acids Res., 31, e30, 2003. 38. Biesecker, G. et al., Derivation of RNA aptamer inhibitors of human complement C5, Immunopharmacology, 42, 219, 1999. 39. Keefe, T., personal communication, 2005. 40 Gamper, H.B. et al., Facile preparation of nuclease resistant 3⬘ modified oligodeoxynucleotides, Nucleic Acids Res., 21, 145, 1993. 41. Floege, J. et al., Novel approach to specific growth factor inhibition in vivo: antagonism of platelet-derived growth factor in glomerulonephritis by aptamers, Am. J. Pathol., 154, 169, 1999. 42. Di Giusto, D.A. and King, G.C., Construction, stability, and activity of multivalent circular anticoagulant aptamers, J. Biol. Chem., 279, 46,483, 2004. 43. Dougan, H. et al., Extending the lifetime of anticoagulant oligodeoxynucleotide aptamers in blood, Nucl. Med. Biol., 27, 289, 2000. 44. Willis, M.C. et al., Liposome-anchored vascular endothelial growth factor aptamers, Bioconjug. Chem., 9, 573, 1998. 45. Healy, J.M. et al., Pharmacokinetics and biodistribution of novel aptamer compositions, Pharm. Res., 21, 2234, 2004. 46. Caliceti, P. and Veronese, F.M., Pharmacokinetic and biodistribution properties of poly(ethylene glycol)-protein conjugates, Adv. Drug Deliv. Rev., 55, 1261, 2003. 47. Kurz, M., Aptamer therapeutics: recent developemnts, presentation at EuroTIDES 2004, Brussels, Belgium, Nov. 16, 2004. 48. Kensch, O. et al., HIV-1 reverse transcriptase-pseudoknot RNA aptamer interaction has a binding affinity in the low picomolar range coupled with high specificity, J. Biol. Chem., 275, 18,271, 2000. 49. Jellinek, D. et al., Potent 2⬘-amino-2⬘-deoxypyrimidine RNA inhibitors of basic fibroblast growth factor, Biochemistry, 34, 11,363, 1995. 50. O’Connell, D. et al., Calcium-dependent oligonucleotide antagonists specific for L-selectin, Proc. Natl. Acad. Sci. USA, 93, 5883, 1996. 51. Watanabe, T.A., Geary, R.S., and Levin, A.A., Plasma protein binding of an antisense oligonucleotide targeting human ICAM-1 (ISIS 2302), Oligonucleotides. 16, 169, 2006. 52. Chu, T.C. et al., Aptamer:toxin conjugates that specifically target prostate tumor cells. Cancer Res., 66, 5989, 2006. 53. Farokhzad, O.C. et al., Nanoparticle-aptamer bioconjugates: a new approach for targeting prostate cancer cells, Cancer Res., 64, 7668, 2004. 54. Farokhzad, O.C. et al., Targeted nanoparticle-aptamer bioconjugates for cancer chemotherapy in vivo, Proc. Natl. Acad. Sci. USA, 103, 6315, 2006. 55. Drolet, D.W. et al., Pharmacokinetics and safety of an anti-vascular endothelial growth factor aptamer (NX1838) following injection into the vitreous humor of rhesus monkeys, Pharm Res., 17, 1503, 2000. 56. Capone, A., for the Macugen AMD Study Group. Safety and pharmacokinetcs of intravitreous pegaptanib sodium (Macugen) in patients with exudative age-related macular degeneration (AMD), abstract presented at The 28th Annual Macula Society Meeting, Key Biscayne, FL, Feb 23-26, 2005. 57. McCauley, T., personal communication, 2006. 58. Boomer, R.M. et al., Conjugation to polyethylene glycol polymer promotes aptamer biodistribution to healthy and inflamed tissues, Oligonucleotides, 15, 183, 2005. 59. Fang, J., Sawa, T., and Maeda, H., Factors and mechanism of “EPR” effect and the enhanced antitumor effects of macromolecular drugs including SMANCS, Adv. Exp. Med. Biol., 519, 29, 2003.

CRC_8796_ch028.qxd

798

5/7/2007

05:15 PM

Page 798


60. Kim, K.J. et al., Inhibition of vascular endothelial growth factor–induced angiogenesis suppresses tumour growth in vivo, Nature, 362, 841, 1993. 61. Adamis, A.P. et al., Increased vascular endothelial growth factor levels in the vitreous of eyes with proliferative diabetic retinopathy, Am. J. Ophthalmol., 118, 445, 1994. 62. Pierce, E.A., et al., Vascular endothelial growth factor/vascular permeability factor expression in a mouse model of retinal neovascularization, Proc. Natl. Acad. Sci. USA, 92, 905, 1995. 63. Kvanta, A. et al., Subfoveal fibrovascular membranes in age-related macular degeneration express vascular endothelial growth factor, Invst. Ophthalmol. Visual Sci., 37, 1929, 1996. 64. Jellinek, D. et al., Inhibition of receptor binding by high-affinity RNA ligands to vascular endothelial growth factor, Biochemistry, 33, 10450, 1994. 65. Eyetech Study Group, Preclinical and phase 1A clinical evaluation of an anti-VEGF pegylated aptamer (EYE001) for the treatment of exudative age-related macular degeneration, Retina, 22, 143, 2002. 66. Tucker, C.E. et al., Detection and plasma pharmacokinetics of an anti-vascular endothelial growth factor oligonucleotide-aptamer (NX1838) in rhesus monkeys, J. Chromatogr. B Biomed. Sci. Appl., 732, 203, 1999. 67. Drolet, D.W. et al., Pharmacokinetics and safety of an anti-vascular endothelial growth factor aptamer (NX1838) following injection into the vitreous humor of rhesus monkeys, Pharm. Res., 17, 1503, 2000. 68. Eyetech Study Group, Anti-vascular endothelial growth factor therapy for sub-foveal choroidal neovascularization secondary to age-related macular degeneration: phase II study results, Ophthalmology, 110, 979, 2003. 69. Gragoudas, E.S. et al., VEGF inhibition study in ocular neovascularization clinical trial group. Pegaptanib for neovascular age-related macular degeneration, N. Engl. J. Med., 351, 2805, 2004. 70. Cunningham, E.T. Jr. et al., A phase II randomized double-masked trial of pegaptanib, an anti-vascular endothelial growth factor aptamer, for diabetic macular edema, Ophthalmology, 112, 1747, 2005. 71. Bates, P.J. et al., Antiproliferative activity of G-rich oligonucleotides correlates with protein binding, J. Biol. Chem., 274, 26,369, 1999. 72. Dapic, V. et al., Biophysical and biological properties of quadruplex oligodeoxyribonucleotides, Nucleic Acids Res., 31, 2097, 2003. 73. Girvan, A.C. et al., AGRO100 inhibits activation of nuclear factor-kappaB (NF-kappaB) by forming a complex with NF-kappaB essential modulator (NEMO) and nucleolin, Mol. Cancer Ther., 5, 1790, 2006. 74. Kelland, L., AS1411 (AGRO100): a G-rich oligonucleotide based aptamer targeting cell surface nucleolin on tumours, presentation at IBC TIDES Conference, Boston, MA, USA, May 4, 2005. 75. Laber, D.A. et al., A phase I study of AGRO100 in advanced cancer, Journal of Clinical Oncology, 2004 ASCO Annual Meeting Proceedings (Post-Meeting Edition), 22, 3112, 2004. 76. Laber, D.A. et al., Extended phase I study of AS1411 in renal and non-small cell lung cancers, Journal of Clinical Oncology, 2006 ASCO Annual Meeting Proceedings (Post-Meeting Edition), 24, 13098, 2006. 77. Butterworth, J. et al., Rapid disappearance of protamine in adults undergoing cardiac operation with cardiopulmonary bypass, Ann. Thorac. Surg., 74, 1589, 2002. 78. Warkentin, T.E., Heparin-induced thrombocytopenia: diagnosis and management, Circulation, 110, e454, 2004. 79. Adler, B.K., Unfractionated heparin and other antithrombin mediated anticoagulants, Clin. Lab. Sci., 17, 113, 2004. 80. Warkentin, T.E. and Greinacher, A., Heparin-induced thrombocytopenia and cardiac surgery, Ann. Thorac. Surg., 76, 2121, 2003. 81. Wang, K.Y. et al., A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA, Biochemistry, 32, 1899, 1993. 82. Tsiang M. et al., Selection of a suppressor mutation that restores affinity of an oligonucleotide inhibitor for thrombin using in vitro genetics, J. Biol. Chem., 270, 19,370, 1995. 83. Diener, J., personal communication, 2004. 84. Griffin, L.C. et al., In vivo anticoagulant properties of a novel nucleotide-based thrombin inhibitor and demonstration of regional anticoagulation in extracorporeal circuits, Blood, 81, 3271, 1993. 85. DeAnda, A. Jr. et al., Pilot study of the efficacy of a thrombin inhibitor for use during cardiopulmonary bypass, Ann. Thorac. Surg., 58, 344, 1994.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 799


799

86. Feuerstein, G.Z. et al., An inhibitory anti-factor IX antibody effectively reduces thrombus formation in a rat model of venous thrombosis, Thromb. Haemost. 82, 1443, 1999. 87. Rusconi, C., Modulators of coagulation factors, US Patent Application 20060040881, 2006. 88. Nimjee, S.M. et al., A novel antidote-controlled anticoagulant reduces thrombin generation and inflammation and improves cardiac function in cardiopulmonary bypass surgery, Mol Ther., 14, 408, 2006. 89. Leppanen, O. et al., Intimal hyperplasia recurs after removal of PDGF-AB and -BB inhibition in the rat carotid artery injury model, Arterioscler. Thromb. Vasc. Biol., 20, E89, 2000. 90. Ostendorf, T. et al., Specific antagonism of PDGF prevents renal scarring in experimental glomerulonephritis, J. Am. Soc. Nephrol., 12, 909, 2001. 91. Pietras, K. et al., Inhibition of platelet-derived growth factor receptors reduces interstitial hypertension and increases transcapillary transport in tumors, Cancer Res., 61, 2929, 2001. 92. Pietras, K. et al, Inhibition of PDGF receptor signaling in tumor stroma enhances antitumor effect of chemotherapy, Cancer Res., 62, 5476, 2002. 93. Jo, N. et al., Inhibition of platelet-derived growth factor B signaling enhances the efficacy of anti-vascular endothelial growth factor therapy in multiple models of ocular neovascularization, Am. J. Pathol., 168, 2036, 2006. 94. Mahaffey, K.W. et al., Effect of pexelizumab, an anti-C5 complement antibody, as adjunctive therapy to fibrinolysis in acute myocardial infarction: the COMPlement inhibition in myocardial infarction treated with thromboLYtics (COMPLY) trial, Circulation, 108, 1176, 2003.

CRC_8796_ch028.qxd

5/7/2007

05:15 PM

Page 800

CRC_8796_index.qxd

5/31/2007

15:44

Page 801

Index A acetylcholinesterase (AChE) antisense therapies, 737–738 multiple sclerosis therapy, 677–678 splice switching oligonucleotide targeting, 99–100 acetyl-coA carboxylases (ACCs), nonalcoholic steatohepatitis, antisense reduction, 656 activated partial thromboplastin time (APTT) ISIS 113715 compound, clinical safety profiles, 657 locked nucleic acid, 553–554 systemic ASO therapy, clinical safety experiments, 374–375 toxicology of ASOs and, 337–339 activator solution reagents, 2⬘-methoxyethyl (MOE)modified oligonucleotide manufacture, 409 active targeting mechanisms, liposomal drug delivery systems, nucleic acids, 242 activity assays, antisense oligonucleotide design, 119–123 primary assays, 128–134 acyl-coenzyme A: cholesterol acyltransferases (ACATs), dyslipidemias, ASO liver-targeted inhibition, 608–610 acyl-coenzyme A: diacylglycerol acyltransferase 2 (DGAT2), nonalcoholic steatohepatitis, antisense therapy, 655–656 adenosine 1 receptor delivery system, toxicologic effects of ASOs, 334 adipose tissue 2⬘-methoxyethyl oligonucleotide pharmacology in, 287 type 2 diabetes, 648-651 AEG35156/GEM640 antisense, mechanisms, 705 aerosol delivery systems, toxicologic effects of ASOs, 333–334 affinity mechanisms antisense drugs, 12–13 aptamer optimization, 780–781 oligonucleotide medicinal chemistry, 145–146 age-related macular degeneration, antisense oligonucleotide therapies, 592–593 alicaforsen profiles clinical safety experiments, 378–385 Crohn’s disease therapy, 667–668 ulcerative colitis, 668–669 allergies, CpG oligodeoxynucleotide therapy, 759 allogeneic graft rejection, inflammatory disease therapy, 684 α-L-locked nucleic acid modification oligonucleotide medicinal chemistry, 160 RNase H recruitment, 540 alternative splicing current technologies and applications, 90 global strategies, 102–103 hybridization strategies, 100–101 levels and ratios in, 92–93

mechanisms of, 20–25 modification as therapeutic tool, 98–99 RNA intermediary metabolism, 8–9 small interfering RNA, 103 small molecules, 103–104 small nuclear RNA, 102–103 trans-splicing mechanisms, 101–102 Alzheimer’s disease, splice switching oligonucleotide targeting, 96 amides, furanose nonphosphate backbones, oligonucleotide medicinal chemistry, 151–152 amidites, locked nucleic acid synthesis, 522–524, 528–529 amino- and thio-LNA amidites, 524–525 base modifications, 528 diastereoisomer amidites, 526–527 amino-LNA amidites heteroduplex thermal denaturation, 533–534 RNase H recruitment, 540 synthesis, 524–526 AMP-activated protein kinase-α, ApoB-100 inhibition therapies, 614–616 amyloid precursor protein (APP), dementia antisense therapies, 737–738 amyotrophic lateral sclerosis, antisense oligonucleotide therapy, 730–734 analytical testing, 2⬘-methoxyethyl (MOE)-modified oligonucleotides, 419–430 drug substance intermediates, 421–422 identity testing, 422 impurity tests and assay, 422–430 reagents and solvents, 421 starting materials, 419–421 angiogenesis, ophthalmology therapy and, 592–593 animal studies ApoB-100 inhibition therapies hamster combination studies, 616 monkey studies, 613–616 murine pharmacology, 612–616 siRNA inhibition, 625–626 species-specific in vivo pharmacology, 612–613 clinical safety experiments with gen-1/gen-2 ASOs and, kidney effects, 386–389 dyslipidemias, ASO liver-targeted therapies, 605-607 locked nucleic acid pharmacology, 546–547 morpholinos basic properties, 565–566 RNA splicing alteration, 577 neurological disorders, 722–723 pharmacokinetics/pharmacodynamics of ASOs, 308–316 second-generation antisense oligonucleotide optimization, gap size effects, 492–500 toxicological effects of ASOs in kidney, 343–345

801

CRC_8796_index.qxd

5/31/2007

15:44

Page 802

802 animal studies (contd.) proinflammatory effects, 348–351 species specificity, 350–351, 356–357 anion exchange (AX) HPLC, 2⬘-methoxyethyl (MOE)modified oligonucleotide manufacture, purification process, 415–416 antagomirs, micro-RNA silencing pathways, 456–458 antibacterial agents morpholinos, 572 peptide nucleic acids, 512–513 antibodies, RNA interference drug development, 478 anti-PDGF-B aptamer, 793 antisense oligonucleotides (ASOs). See also specific ASOs, e.g. morpholinos; specific compounds, e.g. phosphorothioate oligonucleotides (PS-ODNs) antisense therapeutics and, 70–71 cancer therapy, 699–701, 711–712 cardiovascular therapy, 602–630 chimeric ASOs, human RNase H1 and, 65–70 clinical trials future research issues, 394–395 kidney effects, 386–389 liver effects, 391–392 local adminstration protocols, 371, 393–394 proinflammatory effects, 377–386 selectivity and reduction research overview, 365–367 subject characteristics and disease conditions, 367–369 systemic administration trials aPTT prolongation, 374–375 complement activation, 375–377 duration of treatment, 370–371 results, 371–392 schedules and dosages, 369–370 thrombocytopenia, 389–391 cross-species, 124–127 current technologies and applications, 90 delivery routes and formulations, 217–218, 233–234 design principles, 118–128 DNA-like structure, human RNases H and, 63–65 drug action human RNases and, 70–71 occupancy-activated destabilization, 26–39 occupancy-only mechanisms, 19–26 phases of, 7 selectivity mechanisms, 12–19 exclusion criteria for, 123 follow-up assays, 134–135 human RNase H2 biochemistry, 57–61 inflammatory disease, 666 local administration, 221–225 multiple mechanisms, 277–279 neurological disorders, 721–741 ophthalmology therapies, 585–596 oral and gastrointestinal delivery, 227–233 pharmacokinetics, 184–211 polymorphism sequence variants, 123 primary screening assays, 128–134 propyne modifications, 165

INDEX research background, 118 screening and identification, 16–19 systemic administration, 218–221 targeted oligonucleotide silencers of splicing (TOSS), 101 terminating mechanisms, 47–48 in vitro vs. in vivo activity, 135–138 antisense theory pharmacology, 5–7 second-generation antisense oligonucleotide optimization, 487–488 antiviral therapies morpholinos, 570–572 ophthalmology therapies, 591–592 ApoB-100 antisense compound, 316–320 dyslipidemias, ASO liver-targeted therapies, 611–626 apolipoprotein C-III, dyslipidemias, ASO liver-targeted inhibition, 606–608 apoptotic pathways, antisense oligonucleotide development, cancer therapy, 701–704 aprinocarsen, glioblastoma antisense therapy, 736 aptamer structures ARC183, 791–792 AS1411, 790–791 binding and functional properties, 784–786 development of, 773–774 future research issues and applications, 794–795 history of, 774–776 macugen (pegaptanib), 788–790 2⬘-methoxyethyl (MOE)-modified oligonucleotides, manufacturing and analysis of, 402–403 oligonucleotide medicinal chemistry, 171 ophthalmology therapies, 586–587 optimization strategies, 779–784 affinity optimization, 780–781 minimization technology, 780 nuclease resistance, 781–782 PEGylation, 783–784 preclinical programs for, 793–794 REG1, 792–793 representative structures, 788–792 RNA interference drug development, 475 therapeutic applications, 776–779 thrombin-binding aptamers, toxicological effects, 339 toxicologic effects, 328–331 in vivo properties, 786–788 ARC183 aptamer, 791–792 ARC1779 aptamer, 793 ARC1905 aptamer, 794 Argonaute proteins, RNAi enzymes basic properties, 80–81 pathways, 439 AS1441 aptamer, 790–791 asthma antisense oligonucleotide therapy, 678–682 CpG oligodeoxynucleotide therapy, 759 pathology and current therapy, 678 “asymmetry rule,” short interfering RNA specificity, 445–446 ATL1102, multiple sclerosis therapy, 676 autoimmune disease, CpG oligodeoxynucleotide therapy, 759

CRC_8796_index.qxd

5/31/2007

15:44

Page 803

INDEX

803

average mass spectrum measurements, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 426–430 AVI-4020, antiviral therapy, clinical trials, 571–572 AVI-4065, antiviral therapies, clinical trials, 571–572 AVI-4126 animal studies, 566–567 cancer therapy, 574–575 cardiovascular therapy, 573–574 restenosis inhibition, 629 AVI-4457, animal studies, 566–567

B BACE protease, dementia antisense therapies, 738 backbone modifications antisense oligonucleotides gastrointestinal drug delivery systems, 225–233 system administration systems, 218–219 oligonucleotide medicinal chemistry, 148–154 furanose-nonphosphate backbones, 151–153 furanose-phosphate backbones, 148–151 sugar and backbone replacements, 153–154 peptide nucleic acid, 508 short interfering RNAs, 440 base modifications locked nucleic acids chemistry, 528 thermal denaturation, 535 short interfering RNAs, 442–443 basic fibroblast growth factor (bFGF), aptamer development, 784–786 basophilic granules, toxicological effects of ASOs in kidney and, 341–345 Bax gene family, amyotrophic lateral sclerosis antisense therapy, 730–734 BCL2 (B-cell leukemia-lymphoma gene 2) gene antisense oligonucleotide development, cancer therapy, 701–704 2⬘-methoxyethyl oligonucleotide pharmacology, in liver, 285–286 bcl-x gene, splice switching oligonucleotide targeting, 98 BCL-xL gene, cancer therapy, 703–704 Bc1-x gene, splicing alteration, 20 Becker muscular dystrophy (BMD), splice switching oligonucleotide targeting, 95 β-globin gene, splice switching oligonucleotide targeting of, 94 β-globin RNA, splicing modulation, 20–21 bicyclic sugars locked nucleic acid, 522 oligonucleotide medicinal chemistry, 158–161 bioavailability parameters antisense oligonucleotides gastrointestinal drug delivery systems, 228–231 subcutaneous injections, 220–221 liposomal nucleic acid delivery formulations, 254–256 locked nucleic acid, 548–551 peptide nucleic acids, 514–515

Bligh-Dyer monophase, reverse-phase evaporation nucleic acid encapsulation, 248–249 blood-brain barrier (BBB), antisense oligonucleotide delivery, 221 neurological disorders, 723–726 pharmacokinetics and metabolism, 307 blood-urea-nitrogen (BUN) levels, clinical safety experiments with gen-1/gen-2 ASOs and, kidney effects, 387–389 blunt-ended perfect duplex design, short interfering RNAs (siRNAs), 443–445 bone tissue, 2⬘-methoxyethyl oligonucleotide pharmacology in, 287–288 boranophosphate backbone, oligonucleotide medicinal chemistry, 149 brain-targeted drug delivery antisense oligonucleotide delivery, 221 pharmacokinetics and metabolism, 307 toxicology of ASOs and, 334

C C5 alkyl/halogen substitution, pyrimidine 5⬘-position modifications, oligonucleotide medicinal chemistry, 163–164 cancer therapy antisense oligonucleotides, 699–712 clinical safety experiments with gen-1/gen-2 ASOs, 367–369, 378–381 CpG oligodeoxynucleotides, 758–759 immunomodulation and immune surveillance, 688–689 morpholino compounds, 574–575 synthetic short interfering RNA, systemic drug administration, 450–453 5⬘ capping mechanism, occupancy-activated destabilization, 27 capping reagents, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 409–410 cardiovascular disease antisense oligonucleotide therapies advantages of, 603–604 C-reactive protein inhibition, 626–628 current treatment paradigm, 602 dyslipidemias, liver targets in, 605–626 evolution of, 601–602 future research and applications, 629–630 hypertension inhibitors, 628 restenosis affects, 628–629 unmet therapeutic needs and, 602–603 morpholino therapies, 572–574 catalytic domain, human RNase H1, 52–54 cationic lipids, liposomal drug delivery systems, nucleic acids, 239–240 cationic 2⬘-O-alkyl modifications, oligonucleotide medicinal chemistry, 157 CD40 cell membrane protein, splice switching oligonucleotide targeting, 99 C/D RNAs, intermediary metabolism, 10–12

CRC_8796_index.qxd

5/31/2007

15:44

Page 804

804 cell activation, inflammatory disease antisense therapy, 686 cell-free assays, antisense oligonucleotide design, activity correlation with, 122 cell migration and adhesion, inflammatory disease antisense therapy, 686 cell proliferation, maturation, and survival, inflammatory disease antisense therapy, 685 cellular delivery systems, peptide nucleic acids, 513–514 cell uptake locked nucleic acid, 551–552 ophthalmology therapies, 587 central nervous system administration neurological diseases, ASO distribution, 723–726 RNA interference drug development, “naked” siRNA, 472–474 toxicologic effects of ASOs, 333–334 chemical modifications antisense drug activity and, 25 small interfering RNAs, 439–443 translation arrest and, 26 chemical penetration enhancers, topical drug delivery systems, 222–223 chemokine release asthma therapy, 679 inflammatory disease antisense therapy, cell activation, 686 toll-like receptors, immunomodulation and immune stimulation effects, 751–753 toxicological properties of chimeric antisense oligonucleotides, proinflammatory effects, 348–351 chimeric antisense oligonucleotides human RNase H1 and, 65–71 metabolic diseases drug discovery schematic, 642–644 evaluation rationale for, 642 evolution of, 642 future research issues, 659 nonalcoholic steatohepatitis, 655–656 obesity drug discovery, 652–655 phase 1/2 clinical program overview, 657–659 type 2 diabetes, 644–652 hepatic glucose output inhibition, 648–649 kidney targeting, 651–652 protein phosphatase targeting, 644–647 tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647 second-generation antisense oligonucleotide optimization, gapmer structures, 490 toxicologic properties chronic administration, 351 clotting inhibition, 338–339 complement activation, 339–340 genetic effects, 353–354 hematopoietic effects, 345 kidney effects, 340–345 liver effects, 345–346 mechanisms and clinical correlates, 336–337 oral administration, 334–336

INDEX phosphorothioate comparisons, 328–329 plasma protein binding effects, 337–340 proinflammatory effects, 346–351 reproductive toxicology, 352–353 safety assessment strategies, 330–331 safety pharmacology, 354–356 sequence motifs, 329–330 single-strand ASO, siRNA, and aptamers, 328 species-specific effects, 356–357 systemic vs. local administration, 333–334 target organ accumulation and effect, 340–346 toxicokinetics, 332–333 chitosan nanoparticles, RNA interference drug development, 477–478 cholesterol conjugates cardiovascular therapies, 601–602 ISIS 301012 (ApoB-100), 316–320 oligonucleotide medicinal chemistry, 167–168 RNA interference drug development, 474–475 synthetic short interfering RNA, systemic drug administration, 449–451 cholesteryl esters, dyslipidemias, ASO liver-targeted therapies, acyl-coenzyme A;cholesterol acyltransferases (ACAT) inhibition, 608–610 cholesteryl ester transfer protein (CETP), dyslipidemias, ASO liver-targeted therapies, 605 chromatin, human RNase H2 biochemistry, 62–63 chronic administration systems, toxicological effects of ASOs, 351 c-Jun N-terminal kinases, obesity therapy, antisense targeting, 654–655 class-related toxicologic properties antisense oligonucleotides, 336–338 safety assessment strategies for, 331 cleavage mechanisms chimeric antisense oligonucleotides, human RNase H1 and, 69–70 human RNase H1 catalytic domain, 52–54 wild-type and mutant proteins, 50–52 human RNases and, DNA-like antisense oligonucleotides, 63–65 locked nucleic acid synthesis, amidites, 522–524 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 406–407 clinical trials antisense oligonucleotides (ASOs) future research issues, 394–395 kidney effects, 386–389 liver effects, 391–392 local adminstration protocols, 371, 393–394 metabolic diseases, 657–659 proinflammatory effects, 377–386 selectivity and reduction research overview, 365–367 subject characteristics and disease conditions, 367–369 systemic administration trials aPTT prolongation, 374–375 complement activation, 375–377 duration of treatment, 370–371 results, 371–392

CRC_8796_index.qxd

5/31/2007

15:44

Page 805

INDEX schedules and dosages, 369–370 thrombocytopenia, 389–391 aptamer therapeutic agents, pegaptanib, 789–790 ARC183 aptamer, 791–792 AS1441 aptamer, 790–791 asthma therapy, 678–679 cancer therapy, G3139 antisense, 702–704 cardiovascular therapy current treatment paradigm, 602 ISIS 301012 ApoB inhibitor, 619–626 inflammatory bowel disease therapy, alicaforsen therapy, 667–671 locked nucleic acids, 557–558 morpholinos, 567–572 REG1 aptamer, 792–793 RNA interference drug development, 478–480 clotting time inhibition locked nucleic acid, 553–554 toxicology of ASOs and, 338 clusterin antisense compound cancer therapy, 706–708 clinical safety experiments, two-hour infusion profile, 378–381 pharmacokinetics and pharmacodynamics, 321–322 c-myc proto-oncogene, antisense inhibitors of, 629 coated cationic liposomes (CCL), reverse-phase evaporation nucleic acid encapsulation, 248–249 complement activation systemic ASO therapy, clinical safety experiments, 375–377 toxicology of ASOs and, 339–340 complementary DNAs (cDNAs) antisense oligonucleotide design, 119 locked nucleic acid hybridization, 531–532 complexation techniques, synthetic short interfering RNA, systemic drug administration, 451–453 conjugation strategies morpholinos, antibacterial agents, 572 oligonucleotide medicinal chemistry, 167–168 RNA interference drug development, 474–475 synthetic short interfering RNA, systemic drug administration, 449–451 controlled pore glass (CPG) supports, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 410–411 coronary heart disease. See cardiovascular disease corticosteroids asthma therapy, 678 inflammatory bowel disease therapy, 667 cost-competitive manufacturing, oligonucleotide medicinal chemistry, 147 covalent modification, target nucleic acids, covalent modifications, 38 CpG oligodeoxynucleotides (ODNs) A-class structure-activity relationships, 754 antisense oligonucleotide toxicology, 329–330 B-class structure-activity relationships, 753–754 C-class structure-activity relationships, 754 immune activation, 748 immunomodulation and immune stimulation effects, 751–753

805 rheumatoid arthritis antisense therapy, 674–675 structure-activity relationships, 753–755 therapeutic applications, 755–760 TLR9 and mechanism of action, 748–749 toxicological properties of chimeric antisense oligonucleotides, proinflammatory effects, 347–351 C-reactive protein, antisense oligonucleotide targeting of, 626–628 Creutzfeldt Jakob disease, antisense therapies, 736–737 Crohn’s disease clinical safety experiments with gen-1/gen-2 ASOs, 367–369 complement activation, 376–377 duration studies, 367–370 hypersensitivity reactions, 385–386 subcutaneous injection responses, 383–385 two-hour infusion profile, 378–381 FLICE inhibitory protein expression, 685 intercellular adhesion molecule (ICAM)-1, 667–668 intracellular adhesion molecule, 667–668 pathology and current therapy, 667 cross reactor identification antisense oligonucleotide design, 119 2⬘-methoxyethyl oligonucleotide pharmacology, in vitro conditions, 280–282 cross-species antisense oligonucleotide design, 124–127 2-cyanoethoxymethyl (CEM), short interfering RNA chemical synthesis, 447–448 (2-ctabietgtk)-N 3-thymine (CNET) residue, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, deprotection process, 415 cyclohexenyl HNA analogs (CeNA), oligonucleotide medicinal chemistry, 163 CYP3A family, morpholino redirection of, 575–576 cystic fibrosis transmembrane conductance regulator (CFTCR), splice switching oligonucleotide targeting, 95–96 cytochrome P450 enzymes, morpholino redirection of, 575–576 cytokines asthma antisense therapy and, 678–682 clinical safety experiments with ASOs, intravenous infusion profiles, 381–383 CpG dinucleotide motifs, toll-like receptors and mechanism of action, 749–751 CpG oligodeoxynucleotide therapy, asthma/allergy, 759 inflammatory disease antisense therapy, 686–687 intraocular inflammation, ophthalmology therapy, 593–594 liposomal nucleic acid delivery encapsulation, immune stimulation, 258–259 SELEX process and, 778–779 toll-like receptors, immunomodulation and immune stimulation effects, 751–753 toxicological properties of chimeric antisense oligonucleotides, proinflammatory effects, 348–351 cytoplasmic vacuolation, toxicological effects of ASOs in kidney and, 341–345

CRC_8796_index.qxd

5/31/2007

15:44

Page 806

806

INDEX

cytosine analogs, oligonucleotide medicinal chemistry, 165–166

D dacarbazine (DTIC), cancer therapy, antisense G3139 combined with, 702–704 deazapurines, oligonucleotide medicinal chemistry, 167 dementia disorders antisense oligonucleotide therapy, 737–738 splice switching oligonucleotide targeting, 96 deposition mechanisms, pulmonary drug delivery systems, antisense oligonucleotides, 223–225 deprotection, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 415 detritylation reagent, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 408–409 drug intermediate analysis, 422 solid-phase synthesis, 417–418 diabetes therapy antisense oligonucleotides, ophthalmology therapies, 592–593 immunomodulation and immune surveillance, 688–689 second-generation antisense oligonucleotide optimization, gap size effects, rodent studies, 497–500 type 2 diabetes, drug discovery, 644–652 diaminopurine modification, oligonucleotide medicinal chemistry, 166 diastereoisomer LNA amidites heteroduplex thermal denaturation, 534–535 LNA synthesis, 526–527 2⬘-O-[2-[N,N-(dimethyl)aminoethoxyl]ethyl] (DMAEOE), oligonucleotide medicinal chemistry, 157 2⬘-O-2,4-dinitrophenyl substitution, oligonucleotide medicinal chemistry, 157 distribution kinetics, antisense oligonucleotides, pharmacokinetics, animal studies, 311–312 DNA-like antisense oligonucleotides (ASOs), human RNases and, 63–65 DNA synthesis, human RNase H1, 55 DNAzymes, neurological disorders, nonantisense gene silencing, 726–727 dosage studies, antisense oligonucleotides, clinical safety experiments, 369–370 “double overhang” design, short interfering RNAs (siRNAs), 443–445 double-stranded DNA (dsDNA) locked nucleic acid structure, 530–532 peptide nucleic acid targeting, 510–512 double-stranded RNAs (ds-RNAs) antisense transcripts, 9 oligoribonucleotide ligand identification, 760–762 RNAi pathways, 438–439 small interfering RNA silencing, 76–77 double-stranded RNase immune stimulation, 38 manufacturing, 37

occupancy-activated destabilization, 31–38 physical chemical properties, 37 sense strand device, 37 structural features and medicinal chemistry, 36–37 Down’s syndrome, splice switching oligonucleotide targeting, 96 Drosha enzyme, micro-RNA biogenesis, 11–12, 78–79 Drosophila, RISC assembly in, 81–82 drug delivery systems antisense oligonucleotides future research issues, 233–234 local administration, 221–225 oral and gastrointestinal delivery, 225–233 research background, 217–218 systemic administration, 218–221 2⬘-methoxyethyl oligonucleotide pharmacology, in vitro conditions, 279–282 morpholino compounds, cardiovascular therapies, 574 neurological disorders, 723–726 nucleic acids, liposomal delivery formulations active targeting strategies, 242 analytical methods, 251–254 encapsulation, 253–254 particle size measurement, 251–253 zeta potential, 253 basic properties, 237–239 cationic lipids, 239–240 efficacy evaluation, 261–262 encapsulation technologies, 242–251 analytical methods, 253–254 ethanol-destabilized liposomes, 247–249 ethanol drop (SALP) method, 247 passive encapsulation, 243–246 reverse-phase evaporation, 249–250 spontaneous vesicle formation by ethanol dilution method, 250–252 immune stimulation, 258–259 immunogenicity, 259–261 intracellular delivery, helper lipids and, 240 liposome constituents, 239–242 pharmacology, 254–262 polyethylene glycol lipids, 241–242 systemic administration, 254–256 toxicity issues, 256–258 ophthalmology therapies, 588–589, 595 RNA interference delivery systems, 471–478 drug discovery and development, metabolic diseases drug discovery schematic, 642–644 evaluation rationale for, 642 evolution of, 642 future research issues, 659 nonalcoholic steatohepatitis, 655–656 obesity drug discovery, 652–655 phase 1/2 clinical program overview, 657–659 type 2 diabetes, 644–652 hepatic glucose output inhibition, 648–649 kidney targeting, 651–652 protein phosphatase targeting, 644–647 tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647

CRC_8796_index.qxd

5/31/2007

15:44

Page 807

INDEX

807

drug intermediates, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 421–422 Duchenne muscular dystrophy (DMD) morpholino-base RNA splicing alteration in, 576–577 splice switching oligonucleotide targeting, 95 duration of action ISIS 301012 (ApoB-100), 317 phosphorothioate oligonucleotides, pharmacokinetics, animal studies, 312–314 dyslipidemias, antisense oligonucleotide therapies, liver targets for, 605–626 acyl-coenzyme A; cholesterol acyltransferase 2 inhibition, 608–610 ApoB-100 inhibition, 611–626 apolipoprotein C-III inhibition, 606–608 cholesterylester transfer protein inhibition, 605 Lp(a) inhibition, 605–606 dystrophin gene morpholino-base RNA splicing alteration in, 576–577 muscular dystrophy antisense therapies and, 739–740 splice switching oligonucleotide targeting, 95, 103 splicing alteration in, 20

E efficacy analysis cardiovascular therapy, ISIS 301012 ApoB inhibitor, 619–626 liposomal nucleic drug delivery systems, 260–262 encapsulation technologies, liposomal delivery formulations nucleic acids, 242–251 ethanol-destabilized liposomes, 247–248 ethanol drop (SALP) method, 247 passive encapsulation, 243–246 reverse-phase evaporation, 248–249 spontaneous vesicle formation by ethanol dilution method, 250–252 pharmacology analysis, 253–254 enema formulations, clinical safety experiments with ASOs, 394 enhanced green fluorescence protein (EGFP), splice switching oligonucleotide assay, 104–105 enzymology. See also specific human RNases antisense oligonucleotides, gastrointestinal drug delivery systems, 225–233 RNase H mechanism, 30 EPI-2010, asthma therapy, 679 epidermal growth factor receptor (EGFR), glioblastoma antisense therapy, 736 ethanol-destabilized liposomes, nucleic acid encapsulation, 247–248 ethanol drop (SALP) method, nucleic acid encapsulation, liposomal drug delivery systems, 247 eukaryotic initiation factor binding protein 2 (eIF4E-BP2), type 2 diabetes, antisense targeting of, 647 exaggerated pharmacology strategy, toxicology of ASOs, 330–331 excretion mechanisms, locked nucleic acid, 552–553

exon characteristics, antisense drug activity and, 24 exonic splicing enhancers (ESEs) antisense drug activity and, 24–25 pre-mRNA splicing, 90–92 spinal muscular atrophy antisense therapy, 739 exonic splicing silencers (ESSs) antisense drug activity and, 25 pre-mRNA splicing, 91–92 exon-specific splicing enhancement by small chimeric effectors (ESSENCE) technique, RNA splicing hybridization, 100–101 experimental autoimmune encephalomyelitis, multiple sclerosis therapy, 676–677 exploration studies, morpholinos, antiviral therapies, 570–572

F facilitated hybridization, RNA targeting, 14–15 Factor IXa, REG1 aptamer inhibition, 792–793 FALS mutation, amyotrophic lateral sclerosis antisense therapy, 730–734 familial amyloidosis, antisense therapies, 738–739 familial hypobetalipoproteinemia (FHBL), ApoB-100 inhibition therapies, 612 Fas genes antisense oligonucleotides, pharmacokinetics, animal studies, 314 2⬘-methoxyethyl oligonucleotide pharmacology, in liver, 285–286 fatty acid conjugates, oligonucleotide medicinal chemistry, 168 five-membered ring structures, oligonucleotide medicinal chemistry, sugar analogs, 162 FLICE inhibitory protein (FLIP) Crohn’s disease, 685 rheumatoid arthritis antisense therapy, cell proliferation, maturation, and survival, 685 flow-through supports, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 410–411 2⬘-deoxy-2⬘-fluoro-D-arabinonucleic (FANA), oligonucleotide medicinal chemistry, 156 2⬘-fluoro modifications, oligonucleotide medicinal chemistry, 154–155 folate hydrolase (FOLH1) gene, splice switching oligonucleotide targeting, 98 Fomivirsen ocular delivery system, 221–222 ophthalmology therapy, 586–587 antiviral compounds, 590–592 tolerability parameters, 588–589 forkhead transcription factor (FKHR), type 2 diabetes, antisense targeting of, 647 formacetal backbone, oligonucleotide medicinal chemistry, 152–153 free energy binding, antisense oligonucleotide design and, 120–122 freeze-drying, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 419

CRC_8796_index.qxd

5/31/2007

15:44

Page 808

808

INDEX

fructose 1,6 bisphosphatase (FBP-1), type 2 diabetes, antisense inhibition, 648–649 furanose nonphosphate backbones locked nucleic acid structure, 530–532 oligonucleotide medicinal chemistry, 151–153, 158 furanose phosphate backbones, oligonucleotide medicinal chemistry, 148–151, 158 fusogenic liposomes, intracellular delivery systems, 240

G G3139 antisense compound, cancer therapy, 701–704 gapmer ASO structures cardiovascular therapies, 603–604 gastrointestinal drug delivery systems, 229–231 medicinal chemistry design strategies, 169–170 methylene(methylimino) backbone, 152 metabolic diseases drug discovery schematic, 642–644 evaluation rationale for, 642 evolution of, 642 future research issues, 659 nonalcoholic steatohepatitis, 655–656 obesity drug discovery, 652–655 peripheral targets for, 654–655 PTP-1B antisense inhibitor, 652–653 phase 1/2 clinical program overview, 657–659 type 2 diabetes, 644–652 hepatic glucose output inhibition, 648–649 kidney targeting, 651–652 protein phosphatase targeting, 644–647 tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647 2⬘-methoxyethyl (MOE)-modified oligonucleotides administration systems, 289–290 first-generation PS-ODN comparisons, 275–277 manufacturing and analysis of, 402–403 oncology models, 289–290 in vitro conditions, 279–282 in vivo conditions, 282–290, 284 liver, 285–286 lymphoid tissue and inflammatory cells, 288–289 second-generation antisense oligonucleotide optimization, 488–490 oligonucleotide length, 501–503 “1-10-1” gapmer structures gap size effects, animal studies, 498–501 second-generation antisense oligonucleotide optimization, oligonucleotide length, 502–504 “5-10-5” gapmer structures gap size effects, animal studies, 598–501 second-generation antisense oligonucleotide optimization, oligonucleotide length, 502–504 gap size, second-generation antisense oligonucleotide optimization, 490–501 limitations of, 500–501 monkey studies, 500

RNase H1, 490–492 rodent studies, 492–500 gastrointestinal delivery systems, antisense oligonucleotides local GI uptake, 231–233 permeability, 227–228 presystemic metabolism, 225–226 systemic bioavailability, 228–231 G-clamp substitution, oligonucleotide medicinal chemistry, 166 gene expression antisense oligonucleotides cancer therapy, 700–701 design-activity correlation, 119–120 inflammatory disease antisense therapy, 686–687 peptide nucleic acid modulation anti-infective agents, 512–514 basic properties, 507–508 chemistry, 508 dsDNA targeting, 510–512 future applications, 515 mRNA targeting, 508–510 in vivo bioavailability, 514–515 splice switching oligonucleotide restoration of, 94–98 toxicologic effects of ASOs and, 353–354 gene regulation human RNase H1, 55 human RNase H2, 63 gene sequence alignment, antisense oligonucleotide design, 118–119, 123 gene target inhibition, antisense oligonucleotides, pharmacokinetics, animal studies, 308–311 genomics human RNase H2, 63 human RNase H1 and, 55 GE OligoProcess synthesizer, 2⬘-methoxyethyl (MOE)modified oligonucleotide manufacture, 411–412 glaucoma management, oligonucleotide ophthalmology therapy, 594–595 glioblastoma, antisense oligonucleotide therapy, 735–736 global splicing strategies, therapeutic targeting, 103–104 glucocorticoids, type 2 diabetes, antisense reduction of, 649–650 glucose-6-phosphatase (G6P), type 2 diabetes, antisense inhibition, 648–649 golden retriever muscular dystrophy (GRMD) animal model, morpholino-base RNA splicing alteration in, 577 G-quartets, antisense oligonucleotide toxicology, 329–330 green fluorescent protein (GFP), small interfering RNA silencing, 76–77 GSK3β kinase, dementia antisense therapies, 738 guanine analogs, oligonucleotide medicinal chemistry, 167

H half-life concentrations, locked nucleic acid, 548–551 heat shock proteins, cancer therapy, 708–709 helper lipids, liposomal drug delivery systems, 240

CRC_8796_index.qxd

5/31/2007

15:44

Page 809

INDEX

809

hematopoiesis, toxicological properties of ASOs and, 346 hepatic steatosis ApoB-100 inhibition therapies, animal studies, 614–616 nonalcoholic, antisense drug discovery, 655–656 hepatic tissue, type 2 diabetes, 648–651 hepatitis C virus (HCV), morpholino antiviral therapy, clinical trials, 571–572 hepatotoxicity, clinical safety experiments with gen-1/ gen-2 ASOs and, 391–392 heterocyclic modifications, oligonucleotides, 163–167 heteroduplex locked nucleic acid, thermal denaturation, 532–535 heteroduplex substrates, human RNase H1, catalytic domain, 53–54 heterogeneous nuclear ribonucleoprotein complexes (hnRNP), facilitated hybridization, 14–15 hexitol-derived nucleic acids (HNA), oligonucleotide medicinal chemistry, 163 high-density lipoprotein cholesterols, dyslipidemias, ASO liver-targeted therapies, cholesteryl ester transfer protein inhibition of, 605 Hoogsteen base-pairing, peptide nucleic acids, 510–512 human immunodeficiency virus patients, clinical safety experiments with gen-1/gen-2 ASOs, 367–369 human tumor xenografts, antisense oligonucleotides, pharmacokinetics, animal studies, 310–311 Huntington’s disease, antisense oligonucleotide therapy, 734 Hutchinson-Gilford progeria syndrome, splice switching oligonucleotide targeting, 97 hybridization antisense drug action, 7 activity correlation with secondary structure, 120–122 facilitated hybridization, RNA targeting, 14–15 locked nucleic acids, 530–532, 536–537 occupancy-activated destabilization, off-target effects, 34–35 hydroxyproline backbone, oligonucleotide medicinal chemistry, 153 hyperalgesia, inflammatory disease therapy, 684–685 hypercholesterolemia, ISIS 301012 ApoB inhibitor, 623–626 hypersensitivity reactions, clinical safety experiments with gen-1/gen-2 ASOs, 385–386 hypertension, antisense oligonucleotide inhibitors, 628

I identity testing, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 422 IL-1 receptor associated kinase (IRAK)-1, inflammatory disease antisense therapy, 686–687 immune response, short interfering RNA reduction of, 446–447 immune stimulation liposomal nucleic acid delivery systems, 258–259 oligodeoxynucleotides, 751–753 oligoribonucleotide ligand identification, 760–762

toxicological properties of chimeric antisense oligonucleotides, proinflammatory effects, 347–351 immune surveillance, inflammatory disease antisense therapy, 688–689 immunofluorescence staining, human RNase H2 biochemistry, 61–63 immunogenicity, liposomal nucleic acid drug delivery systems, 259–260 immunomodulation inflammatory disease antisense therapy, 682–683 cellular and molecular pharmacology, 688–689 oligodeoxynucleotides, 751–753 immunoprecipitation assay, human RNase H2 biochemistry, 57–61 impurity tests and assays, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 422–430 indole compounds, global splicing strategies, 104 infectious disease CpG oligodeoxynucleotides, 755–758 morpholino rapid response, 571–572 peptide nucleic acid anti-infective agents, 512–513 inflammatory bowel disease (IBD) antisense therapies, preclinical applications, 671 intracellular adhesion molecule antisense therapy, 667–668 pathology and current therapy, 667 inflammatory disease antisense therapy development, 666 (See also specific diseases) cellular and molecular pharmacology, 684–689 defined, 666 future research issues, 689–690 intraocular inflammation, ophthalmology therapy, 593–594 2⬘-methoxyethyl oligonucleotide pharmacology in, 288–289 preclinical in vivo pharmacology models, 681–685 inhibitors of apoptosis (IAP) gene, cancer therapy BCL2/BCL-xL development, 701–704 survivin and XIAP development, 704–705 in situ hybridization, neurological diseases, ASO distribution, 725–726 insulin growth factor binding proteins (IGFBPs) cancer therapy, 710 glioblastoma antisense therapy, 736 intercellular adhesion molecule (ICAM)-1 antisense Crohn’s disease therapy, 667–668 immunomodulation and transplantation, 682–683 preclinical applications, 671 rheumatoid arthritis therapy, 672–674 interferons CpG dinucleotide motifs, toll-like receptors and mechanism of action, 749–751 immunomodulation and immune stimulation effects, 751–753 infectious disease monotherapies, 755–757 liposomal nucleic acid delivery encapsulation, immune stimulation, 258–259 multiple sclerosis therapy, 675 interleukins, asthma antisense therapy and, 680–682

CRC_8796_index.qxd

5/31/2007

15:44

Page 810

810 internal ribosome entry (IRE), translation arrest and, 25–26 intracellular delivery systems, liposomal drug delivery, helper lipids, 240 intraocular inflammation, ophthalmology therapy, 593–594 intratracheal administration, pulmonary drug delivery systems, 225 intravenous infusion antisense oligonucleotide delivery, 219 clinical safety experiments complement activation, 375–377 constitutional symptoms, 377–383 continuous infusion (14- and 21-day), 381 dosage and scheduling studies, 369–370 twenty-four-hour infusions, 381 two-hour infusions, 378–381 toxicologic effects of ASOs, 334 intravitreal injection, antisense oligonucleotide delivery, 221–222 clinical safety experiments, 372, 393–394 intron characteristics, antisense drug activity and, 24 intronic splicing enhancers (ISEs), pre-mRNA splicing, 91–92 intronic splicing silencers (ISSs), pre-mRNA splicing, 91–92 in vitro characterization antisense oligonucleotide screening, 131–132 follow-up assays, 134–138 chemical class effects on, 25 ISIS 301012 ApoB inhibitor, 616–618 locked nucleic acids, 540–545 2⬘-methoxyethyl oligonucleotide pharmacology, 279–282 micro-RNA pathways, 456 peptide nucleic acids, 514–515 RISC assembly, 81–82 RNA interference drug development, 466–470 splicing mechanisms in, 20–21 toxicologic effects of ASOs, hERG assay, 354–356 in vivo characterization antisense oligonucleotide screening, follow-up assays, 135–138 ApoB-100 inhibition therapies, species-specific pharmacology, 612–613 aptamer structures, 786–788 chemical class effects on, 25 coronary stent restenosis insufficiency, morpholinos and, 573–574 inflammatory disease antisense therapy, 682–685 locked nucleic acid pharmacology, animal studies, 546–547 2⬘-methoxyethyl (MOE)-modified oligonucleotide pharmacology, 282–290 adipose tissue, 287 bone tissue, 287–288 gapmer administration, 289–290 kidney, 286–287 liver, 285–286 lymphoid tissues and inflammatory cells, 288–289 oncology models, 289 RNA interference delivery systems, 471–478

INDEX antibodies, 478 conjugated compounds, 474–475 liposomes and lipoplexes, 475–477 naked siRNA, 471–474 peptides and polymers, 477–478 splice switching oligonucleotide targeting, β-thalassemia, 94 splicing mechanisms in, 20–21 ion chromatography, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 424–430 iontophoresis, antisense oligonucleotide delivery, 222 IP-HPLC-ES-MS chromatography, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 429–430 IP-HPLC-UV chromatography, 2⬘-methoxyethyl (MOE)modified oligonucleotide analysis, 424–430 ISIS 3521, cancer therapy, 705–706 ISIS 5132, cancer therapy, 705–706 ISIS 36945, asthma therapy, 679 ISIS 301012 cardiovascular therapies ApoB-100 inhibition, 611–626 combined lipid-lowering agent regimens, 621–626 hypercholesterolemia treatment, 623–626 duration of action, 317 onset of action, 316–317 plasma trough concentration-effect determination, 317–318 subchronic dosing, 318–320 toxicology of, 335 ISIS 13312 antiviral, ophthalmology therapy, 591–592 ISIS 104838 compound pharmacokinetics and pharmacodynamics, 321 rheumatoid arthritis therapy, 672–674 ISIS 113715 compound clinical trials, 657–659 metabolic disease and, drug discovery protocol, 642–644 obesity effects of, 652–653 pharmacokinetics, 657–658 pharmacology, 658–659 second-generation antisense oligonucleotide optimization, gap size effects, rodent studies, 497–500 type 2 diabetes, 645–646 ISIS 333611 compound, amyotrophic lateral sclerosis antisense therapy, 731–734

K (KFF)3K peptide, anti-infective agents, 512–513 kidney cardiovascular ASO therapies and, 604 clinical safety experiments with gen-1/gen-2 ASOs and, 386–389 2⬘-methoxyethyl oligonucleotide pharmacology in, 286–287 toxicological effects of ASOs in, 340–345 type 2 diabetes, antisense therapeutic targeting of, 651–652

CRC_8796_index.qxd

5/31/2007

15:44

Page 811

INDEX

811

kinetic RT-PCR assay, antisense oligonucleotide design, 129–130 Kupffer cell hypertrophy, toxicological effects of ASOs and, 345–346

L lamin A protein, splice switching oligonucleotide targeting, 96–97 large unilamellar vesicles (LUVs), liposomal drug delivery systems nucleic acids, 238–239 passive nucleic acid encapsulation, 244–246 Lewy body dementia, antisense therapies, 737–738 LIC-101 complex, synthetic short interfering RNA, systemic drug administration, 452–453 linker materials 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 406–407 peptide nucleic acid, 508 “Lipinski Rules,” small molecule pharmaceuticals, 437–438 lipophilic conjugates, oligonucleotide medicinal chemistry, 167–168 lipophilic 2⬘-O-alkyl modifications, oligonucleotide medicinal chemistry, 156–157 lipoplex systems nucleic acid drug delivery, encapsulation technologies, 242–251 RNA interference drug development, 475–477 liposomal delivery formulations nucleic acids active targeting strategies, 242 analytical methods, 251–254 basic properties, 237–239 cationic lipids, 239–240 efficacy evaluation, 261–262 encapsulation technologies, 242–251 analytical methods, 253–254 ethanol-destabilized liposomes, 247–248 ethanol drop (SALP) method, 247 passive encapsulation, 243–246 reverse-phase evaporation, 248–249 spontaneous vesicle formation by ethanol dilution method, 249–251 immune stimulation, 258–259 immunogenicity, 259–261 intracellular delivery, helper lipids and, 240 liposome constituents, 239–242 pharmacology, 254–262 polyethylene glycol lipids, 241–242 systemic administration, 254–256 toxicity issues, 256–258 ophthalmology therapies, 595 RNA interference drug development, 475–477 liver, drug targeting of. See also hepatic tissue cardiovascular ASO therapies, 604 ApoB-100 inhibition therapies, hepatic steatosis effects, 614–616 ISIS 301012 ApoB inhibitor, 624–626

clinical safety experiments with gen-1/gen-2 ASOs and, 391–393 dyslipidemias, antisense oligonucleotide therapies, 605–626 acyl-coenzyme A;cholesterol acyltransferase 2 inhibition, 608–610 ApoB-100 inhibition, 611–626 apolipoprotein C-III inhibition, 606–608 cholesterylester transfer protein inhibition, 605 Lp(a) inhibition, 605–606 2⬘-methoxyethyl oligonucleotide pharmacology, 285–286 nonalcoholic steatohepatitis, 655–656 toxicological effects of ASOs and, 345–346 type 2 diabetes, 648–651 local administration systems antisense oligonucleotides, 221–225 pharmacokinetics, animal studies, 310 clinical safety experiments with gen-1/gen-2 ASOs, 372, 393–394 gastrointestinal uptake mechanisms, 231–233 toxicologic effects of ASOs, 333–334 locked nucleic acid (LNA) biochemical properties, 537–540 biophysical properties, 532–537 chemistry, 521–528 chimeric antisense oligonucleotides, human RNase H1 and, 69–70 drug development, 557 evolution of, 520–521 future research issues, 557–558 liposomal drug delivery systems, immune stimulation, 258–259 oligonucleotide medicinal chemistry, 158–159 pharmacokinetics, 548–553 pharmacology, animal studies, 546–547 structure, 530–532 synthesis, 528–529 toxicology, 553–557 in vitro inhibition, 540–544 Loquacious (Loqs) protein, micro-RNA biogenesis, 79 low-density lipoprotein cholesterol (LDL-C) antisense oligonucleotide therapies, 601–602 current therapeutic limitations, 602–603 ISIS 301012 (ApoB-100), 316–320 oligonucleotide medicinal chemistry, 167–168 RNA interference drug development, 474–475 synthetic short interfering RNA, systemic drug administration, 449–451 Lp(a) lipoprotein particles, dyslipidemias, ASO liver-targeted therapies, 605–607 LY2181308/ISIS 23722, cancer therapy, 704–705 lymphoid tissue, 2⬘-methoxyethyl oligonucleotide pharmacology in, 288–289, 288(c)

M Macugen aptamer therapeutic agents, 788–790 in vivo characterization, 786–788

CRC_8796_index.qxd

5/31/2007

15:44

Page 812

812 magnesium ions, human RNase H1 biochemistry, 49 manganese human RNase H1 biochemistry, 49 human RNase H2 biochemistry, 56–61 manufacturing process, 2⬘-methoxyethyl (MOE)-modified oligonucleotides, 403–419 deprotection, 415 detritylation, 417–418 freeze-drying, 419 future issues in, 430 oligonucleotide synthesis, 413–415 precipitation, 418 purification, 415–416 reagents, 408–410 solid-phase synthesis, purification, and isolation, 413–419 solid support, 410–411 solution preparation, 413 starting materials, 404–408 synthesizers, 411–413 yield and purity, 419 MAP kinase cascade, ophthalmology therapy, angiogenesis mechanisms, 593 mass spectrometry, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 424–430 mast cells, asthma antisense therapy, 687–688 matrix metalloproteinases, morpholino-targeted cancer therapy, 574–575 MCL1 molecular target, antisense cancer therapy, 711 mediator release mechanisms, inflammatory disease antisense therapy, 687–688 messenger ribonucleoprotein particles (mRNP), facilitated hybridization, 14–15 messenger RNA (mRNA) locked nucleic acid inhibition, 540–544 2⬘-methoxyethyl oligonucleotides, multiple antisense mechanisms, 278–279 ophthalmology therapies angiogenesis mechanisms, 592–593 pharmacodynamics, 589–590 peptide nucleic acid targeting, 508–510 phosphorothioate oligonucleotides, pharmacokinetics, 308 animal studies, 309–316 short RNA-directed destabilization and translational repression, 82–83 short RNA silencing pathways, 458–459 toxicology of ASOs, off-target antisense effects, 331 metabolic diseases, antisense oligonucleotide drug development drug discovery schematic, 642–644 evaluation rationale for, 642 evolution of, 642 future research issues, 659 nonalcoholic steatohepatitis, 655–656 obesity drug discovery, 652–655 phase 1/2 clinical program overview, 657–659 type 2 diabetes, 644–652 hepatic glucose output inhibition, 648–649 kidney targeting, 651–652 protein phosphatase targeting, 644–647

INDEX tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647 metabolism antisense oligonucleotide toxicology, 330 gastrointestinal drug delivery systems, 225–226 morpholino redirection of, 575–576 2⬘-methoxyethyl (MOE)-modified oligonucleotides analytical testing, 419–430 drug substance intermediates, 421–422 identity testing, 422 impurity tests and assay, 422–430 reagents and solvents, 421 starting materials, 419–421 aptamer development, SELEX process, 776–778 asthma therapy, 679–682 cancer therapy, 704–705 STAT3, 709–710 cardiovascular therapies ApoB-100 inhibition therapies, species-specific pharmacology, 612–613 current protocols, 603–604 ISIS 301012 human ApoB inhibitotr, 616 cardiovascular therapies and, 603–604 chimeric antisense oligonucleotides human RNase H1 and, 65–70 toxicologic properties chronic administration, 351 clotting inhibition, 338–339 complement activation, 339–340 genetic effects, 353–354 hematopoietic effects, 345 kidney effects, 340–345 liver effects, 345–346 mechanisms and clinical correlates, 336–337 oral administration, 334–336 phosphorothioate comparisons, 328–329 plasma protein binding effects, 337–340 proinflammatory effects, 346–351 reproductive toxicology, 352–353 safety assessment strategies, 330–331 safety pharmacology, 354–356 sequence motifs, 329–330 single-strand ASO, siRNA, and aptamers, 328 species-specific effects, 356–357 systemic vs. local administration, 333–334 target organ accumulation and effect, 340–346 toxicokinetics, 332–333 clinical safety experiments future research issues, 394–395 kidney effects, 386–389 liver effects, 391–392 local adminstration protocols, 371, 393–394 proinflammatory effects, 377–386 hypersensitivity reactions, 385–386 infusion-associated symptoms, 377–383 subcutaneous injection site responses, 383–385 selectivity and reduction research overview, 365–367 subject characteristics and disease conditions, 367–369

CRC_8796_index.qxd

5/31/2007

15:44

Page 813

INDEX systemic administration trials aPTT prolongation, 374–375 complement activation, 375–377 duration of treatment, 370–371 results, 371–392 schedules and dosages, 369–370 thrombocytopenia, 389–391 drug delivery systems gastrointestinal systems, 225–233 systemic administration systems, 218–219 evolution of, 402–403 human RNase H1, 51–52 inflammatory disease therapy, 666 hyperalgesia, 684–685 immunomodulation and transplantation, 682–683 manufacturing process, 403–419 deprotection, 415 detritylation, 417–418 freeze-drying, 419 future issues in, 430 oligonucleotide synthesis, 413–415 precipitation, 418 purification, 415–416 reagents, 408–410 solid-phase synthesis, purification, and isolation, 413–419 solid support, 410–411 solution preparation, 413 starting materials, 404–408 synthesizers, 411–413 yield and purity, 419 medicinal chemistry cationic 2⬘-O-alkyl modifications, 157 lipophilic 2⬘-O-alkyl modifications, 156–157 methylene(methylimino) backbone, 152 optimization strategies, 170–171 propyne modifications, 165 sugar modification, 156 metabolic diseases drug discovery schematic, 642–644 evaluation rationale for, 642 evolution of, 642 future research issues, 659 nonalcoholic steatohepatitis, 655–656 obesity drug discovery, 652–655 phase 1/2 clinical program overview, 657–659 type 2 diabetes, 644–652 hepatic glucose output inhibition, 648–649 kidney targeting, 651–652 protein phosphatase targeting, 644–647 tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647 metabolism, 307 neurological disorders antisense pain therapy, 735 delivery and distribution, 725–726 ophthalmology therapy, 586–587 antiviral compounds, 591–592 formulations, 595 pharmacodynamics, 589–590

813 pharmacokinetics, 587–588 tolerability parameters, 589 pharmacokinetic/pharmacodynamic properties animal studies, 308–316 duration of action, 312–314 multiple-dose regimens, 314 onset of action, 311–312 plasma-tissue linkage, accumulation and clearance, 314–316 target tissues, 308–311 basic principles, 307–308 in humans, 316–321 ISI 104838, tumor necrosis factor-a, 321 ISIS 301012, ApoB-100 compound, 316–320 OGX-011, clusterin antisense, 321–322 pharmacological properties evolution and development, 273–275 future research issues, 291–292 human pharmacology, 290–291 multiple antisense mechanisms, 277–279 phosphorothioate oligonucleotide comparisons, 276–277 structural properties, 275–276 in vitro properties, 279–282 in vivo concentrations, 282–290 adipose tissue, 287 bone tissue, 287–288 gapmer administration, 289–290 kidney, 286–287 liver, 285–286 lymphoid tissues and inflammatory cells, 288–289 oncology models, 289 pulmonary drug delivery systems, 223–225 second-generation antisense oligonucleotide optimization gapmer structures, 489–490 gap size effects, animal studies, 492–500 oligonucleotide length, 501–503 splice switching oligonucleotide assay, 104–105 5-methyl cytosine (5-MeC), antisense oligonucleotide toxicology, 329–330 3⬘-methylene phosphonate, oligonucleotide medicinal chemistry, 150 methylene(methylimino) (MMI) backbone, oligonucleotide medicinal chemistry, 152 2⬘-O- methyl and methoxyethyl modifications, oligonucleotide medicinal chemistry, 156 methyl phosphates, discovery of, 5–7 methylphosphonate, oligonucleotide medicinal chemistry, 151 micro-RNAs (miRNAs) antagomir silencing, 453–458 antisense therapeutics and, 10–12 locked nucleic acid inhibition, 544–545 mechanisms of, 39 2⬘-methoxyethyl oligonucleotides, multiple antisense mechanisms, 279 mRNA destabilization and translation repression and, 82–83 oligonucleotide medicinal chemistry, optimization strategies, 169–171

CRC_8796_index.qxd

5/31/2007

15:44

Page 814

814 micro-RNAs (contd.) pathways for, 453–456 precursor biogenesis, 78–79 precursor maturation process, 79 silencing pathways, 77–79 microsomal triglyceride transfer protein (MTP), cardiovascular therapies ApoB-100 inhibition, 611 hepatic steatosis and, 614–616 midazolam metabolism, morpholino redirection of, 575–576 Millipore 8800 synthesizer, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 411–412 minimization algorithms, aptamer optimization, 780 mitochondrial localization signal (MLS), human RNase H1 and, 55 modification sites, oligonucleotide medicinal chemistry, 147 molecular mechanisms inflammatory disease antisense therapy, 685–689 locked nucleic acid, 521–522 RNA interference, 438–439 monkey studies, ApoB-100 inhibition therapies, 613–616 morpholinos alterned RNA splicing, Duchenne muscular dystrophy, 576–577 antibacterial applications, 572 antiviral applications, 570–572 basic properties, 565–566 cancer applications, 574–575 cardiovascular applications, 572–574 formulations, 577 future research issues, 577 metabolic redirection, 575–576 pharmacokinetic profile, 569 phosphorodiaminidate backbone, oligonucleotide medicinal chemistry, 153 safety profile, 567–569 mucosal delivery systems, RNA interference drug development, 476–477 multilamellar vesicles (MLVs), liposomal drug delivery systems nucleic acid delivery, 238–239 passive nucleic acid encapsulation, 243–246 multiple-dose regimens, antisense oligonucleotides, pharmacokinetics, animal studies, 314 multiple sclerosis (MS) pathology and current therapy, 675 preclinical models of antisense therapy, 676–678 very late activation antigen (VLA)-4 antisense therapy, 674–676 murine pharmacology studies, ApoB-100 inhibition therapies, 612–616 muscular dystrophies antisense oligonucleotide therapy, 739–740 splice switching oligonucleotide targeting, 95 MyD88 protein splice switching oligonucleotide targeting, 99 splicing modulation, 21

INDEX

N nanosized materials, ophthalmology therapies, 595 natural ligands, RNA interference drug development, 475 nebulization formulas pulmonary drug delivery systems, antisense oligonucleotides, 223–225 toxicologic effects of ASOs, 333–334 N-ethylmaleimide (NEM), human RNase H1 biochemistry, 49 neurological disorders. See also specific diseases antisense oligonucleotide therapies current therapies, 721–723 distribution barriers, 723–726 future research issues, 740–741 safety and toxicity, 728–730 mechanisms of, 722–724 nucleic acid-based, nonantisense gene silencing, 726–728 neuropathies, antisense oligonucleotide therapy, 738–739 NF-ΚB signaling, inflammatory disease antisense therapy, 686–687 NittoPhase supports, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 411 nonalcoholic steatohepatitis, antisense drug discovery, 655–656 non-antisense activities, antisense oligonucleotide design and, 123 noncoding RNAs, intermediary metabolism, 9–12 nontarget genes, antisense oligonucleotide design and reduction of, 123 nonviral targeting strategies, synthetic short interfering RNA, 453 Northern blot assays, antisense oligonucleotide design, 130–131 nose-only administration, pulmonary drug delivery systems, 225 nuclear localization peptides, peptide nucleic acid conjugation, 512 nuclease resistance aptamer optimization, 781–782 locked nucleic acids, 537–539 nucleic acids covalent modifications, occupancy-activated destabilization, 38 liposomal delivery formulations active targeting strategies, 242 analytical methods, 251–254 basic properties, 237–239 cationic lipids, 239–240 efficacy evaluation, 261–262 encapsulation technologies, 242–251 analytical methods, 253–254 ethanol-destabilized liposomes, 247–248 ethanol drop (SALP) method, 247 passive encapsulation, 243–246 reverse-phase evaporation, 248–249 spontaneous vesicle formation by ethanol dilution method, 249–251 immune stimulation, 258–259 immunogenecity, 259–261

CRC_8796_index.qxd

5/31/2007

15:44

Page 815

INDEX

815

intracellular delivery, helper lipids and, 240 liposome constituents, 239–242 pharmacology, 254–262 polyethylene glycol lipids, 241–242 systemic administration, 254–256 toxicity issues, 256–258 nonantisense gene silencing, neurological disorders, 726–728 sequences, specificity mechanisms, 13–14 nucleoside-loaded solid support, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 406–407 nucleoside phosphoramidites and precursors, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 404–405 impurities in, 405–406 number-surface mean diameter, particle size measurement, liposomal delivery systems, 251–253

O obesity, antisense drug discovery, 652–655 oblimersen clinical safety experiments, subcutaneous injection, 383–385 G3139 antisense compound, cancer therapy, 701–704 occupancy-activated destabilization, antisense drug action, 26–39 5⬘ capping, 27 double-strand RNase (siRNA), 31–38 oligonucleotide-induced RNA cleavage, 38 3⬘-polyadenylation inhibition, 27 RNase H mechanism, 27–31 RNase L-mediated cleavage, 38–39 target nucleic acids, covalent modifications, 38 “occupancy-mediated antisense interference,” secondgeneration antisense oligonucleotide optimization, 487–488 occupancy-only mechanisms antisense drugs, 19–26 oligonucleotide medicinal chemistry, design strategies, 170–171 ocular albinism type 1 gene, splice switching oligonucleotide targeting, 97–98 ocular drug delivery. See also ophthalmology therapies antisense oligonucleotides, 221–222 clinical safety experiments with ASOs, 372, 393–394 RNA interference drug development clinical trials, 478–479 “naked” siRNA, 471–472 toxicologic effects of ASOs, 333–334 ocular pressure, ASO compounds for, 594–595 off-target silencing RNA interference drug development, specificity criteria, 468 short interfering RNA specificity, 445–446 toxicology of ASOs, 331

OGX-011 compound cancer therapy, 707–708 clinical safety experiments, two-hour infusion profile, 378–381 pharmacokinetics and pharmacodynamics, 321–322 Okazaki fragments, human RNase H1 and, 55 oligodeoxynucleotides (ODNs) CpG structure-activity relationships, 753–755 CpG therapeutic applications, 755–760 asthma/allergy, 759 cancer therapies, 758–759 infectious disease monotherapy, 755–757 infectious disease vaccines, 757–758 safety profiles, 759–760 future research issues, 762 immune activation, 748–751 immune modulatory classifications, 751–753 S-class characteristics, 755 oligonucleotides affinity mechanisms, 12–13 antisense, terminating mechanisms, 47–48 antisense theory and, 5 backbone modifications, 148–154 basic properties, 145–147 conjugates, 167–168 heterocyclic modifications, 163–167 length parameters, second-generation antisense oligonucleotide optimization, 501–502 medicinal chemistry, 5–7, 144 affinity limitations, 145–146 cost-competitive manufacture, 147 drug optimization, 169–171 aptamer designs, 171 gapmer designs, 169 occupancy only designs, 170–171 siRNA designs, 170 future research and applications, 171–172 pharmacokinetics, 144–146 receptor specificity, 146 stability limitations, 144 therapeutic index criteria, 147 modification sites, 147 specificity, 13–14 sugar modifications, 154–163 bicyclic sugars, 158–161 furanose substitution positions, 158 ribofuranose sugar, 161–163 2⬘-modifications, 154–157 target RNA cleavage, 38 therapeutic specificity (therapeutic index), 19 oligoplex systems, nucleic acid drug delivery, encapsulation technologies, 242–251 oligoribonucleotide (ORN) ligands future research issues, 762 immune stimulatory effects, TLR7 and TLR8, 760–761 oncology models, 2⬘-methoxyethyl oligonucleotide pharmacology, 289–290

CRC_8796_index.qxd

5/31/2007

15:44

Page 816

816

INDEX

onset of action mechanisms antisense oligonucleotide pharmacokinetics, animal studies, 311–312 ISIS 301012 (ApoB-100), 316–317 ophthalmology therapies, antisense oligonucleotides angiogenesis, 592–593 antiviral therapies, 591–592 classification, 586–587 drug delivery options, 595 formulations, 595 future research and applications, 595–596 glaucoma, 594–595 intraocular inflammation, 593–594 pharmacodynamics, 589–590 pharmacokinetics, 587–588 research background, 585–586 tolerability, 588–589 optimal RNA target sites, translation arrest and, 25–26 optimization strategies aptamer development, 779–784 locked nucleic acid synthesis, 528–529 oligonucleotide medicinal chemistry, 169–171 second-generation antisense oligonucleotides basic principles, 487–488 future research issues, 503–504 gapmer designs, 488–490 gap size limitations of, 500–501 monkey studies, 500 RNase H1, 490–492 rodent studies, 492–500 oligonucleotide length, 501–503 oral delivery systems antisense oligonucleotides local GI uptake, 231–233 permeability, 227–228 presystemic metabolism, 225–226 systemic bioavailability, 228–231 toxicology of ASOs and, 334–336 organ accumulation effects second-generation antisense oligonucleotide optimization, gap size effects, rodent studies, 494–500 toxicology of ASOs and, 340–346 osmotic nephrosis, toxicological effects of ASOs in kidney and, 342–345 overexpression mechanisms, human RNase H2 biochemistry, 56–61 OX26 monoclonal antibody, brain drug delivery system, 221

P packed-bed supports, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 410–411 pain management antisense oligonucleotide therapy, 735 inflammatory disease therapy, 684–685 par-1 locus, RNA silencing studies, 76

particle size measurement, liposomal delivery systems, nucleic acid analysis, 251–253 Pasha enzyme, micro-RNA biogenesis, 11–12, 78–79 passive nucleic acid encapsulation, liposomal drug delivery systems, 243–246 pathogen-associated molecular pattern (PAMP) receptors, toxicological properties of chimeric antisense oligonucleotides, proinflammatory effects, 347–351 “pattern recognition receptors” (PRRs), CpG dinucleotide motifs, toll-like receptors and mechanism of action, 749–751 PAZ domain, Argonaute protein structure, 80–81 pegaptanib aptamer therapeutic agents, 788–790 ophthalmology therapy, 586–587 tolerability parameters, 588–589 in vivo characterization, 786–788 PEGylation technology, aptamer optimization, 783–784 in vivo characterization, 786–788 PEPCK enzyme, type 2 diabetes, antisense inhibition, 648–649 peptide nucleic acid (PNA) anti-infective agents, 512–513 cellular delivery, 513–514 basic properties, 507–508 chemistry, 508 dsDNA targeting, 510–512 future applications, 515 mRNA targeting, 508–510 neurological diseases, ASO distribution, 723–726 oligonucleotide medicinal chemistry, backbone substitution, 154 topical drug delivery systems, 222–223 in vivo bioavailability, 514–515 peptide structures, RNA interference drug development, 477–478 percutaneous coronary intervention (PCI), restenosis, antisense inhibitors of, 628–629 percutaneous transluminal coronary angioplasty (PTCA), morpholino therapies, 572–574 peripheral blood mononuclear cells (PBMCs) immune response, short interfering RNA reduction of, 446–447 inflammatory disease therapy, immunomodulation and transplantation, 684 permeability, gastrointestinal drug delivery systems, 227–228 permeation enhancers gastrointestinal drug delivery systems, 227–231 topical drug delivery systems, 222–223 pharmacodynamics antisense oligonucleotides animal studies, 308–316 duration of action, 312–314 multiple-dose regimens, 314 onset of action, 311–312 plasma-tissue linkage, accumulation and clearance, 314–316 target tissues, 308–311 in humans, 316–321

CRC_8796_index.qxd

5/31/2007

15:44

Page 817

INDEX ISI 104838, tumor necrosis factor-a, 321 ISIS 301012, ApoB-100 compound, 316–320 OGX-011, clusterin antisense, 321–322 ophthalmology therapies, 589–590 pharmacokinetics antisense oligonucleotides absorption, 191–192 animal studies, 308–316 distribution, 192–198 excretion, 202–206 metabolism, 198–202, 307 methoxyethyl modifications, 188–190 ophthalmology therapies, 587–588 phosphorothioate backbone, 185–188 research background, 184 treatment regimen applications, 206–211 type 2 diabetes therapy, 649–651 gastrointestinal drug delivery systems, 228–231 ISIS 113715 compound, 657–658 liposomal nucleic acid delivery formulations, 254–256 locked nucleic acid biodistribution and tissue half-life, 548–551 cell uptake, 551–552 excretion, 552–553 plasma, 548 morpholinos, 569 oligonucleotide medicinal chemistry, 144–146 toxicology of ASOs and, 332–333 pharmacology inflammatory disease antisense therapy, 682–689 liposomal delivery formulations, nucleic acids, 254–262 locked nucleic acids, animal studies, 546–547 oligonucleotide medicinal chemistry, 146 pulmonary drug delivery systems, 224–225 toxicology of ASOs exaggerated pharmacology strategy for, 330–331 safety pharmacology, 354–356 pharmacophore, development of, 5–7 phenoxazine modification, oligonucleotide medicinal chemistry, 165–166 phenylacetyl disulfide (PADS) reagent, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 420–421 manufacturing, 407–408 pH levels, liposomal drug delivery systems, nucleic acids, 239–240 phosphatases, type 2 diabetes, novel antidiabetic target therapies, 646–647 phosphodiester oligonucleotides dyslipidemias, ASO liver-targeted therapies, cholesteryl ester transfer protein ihibition of, 605 local administration, in brain, 221 phosphonoacetate, oligonucleotide medicinal chemistry, 150 phosphonoformate, oligonucleotide medicinal chemistry, 150 phosphoramidate backbone, oligonucleotide medicinal chemistry, 150

817 phosphoramidites locked nucleic acid synthesis, 528–529 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 419–420 short interfering RNA chemical synthesis, 446–448 phosphorodiaminidate-linked morpholino oligomers (PMOs) alterned RNA splicing, Duchenne muscular dystrophy, 576–577 antibacterial applications, 572 antiviral applications, 570–572 basic properties, 565–566 cancer applications, 574–575 cardiovascular applications, 572–574 formulations, 577 future research issues, 577 metabolic redirection, 575–576 pharmacokinetic profile, 569 safety profile, 567–569 phosphorodithioate backbone, oligonucleotide medicinal chemistry, 149 phosphorothioate cyclooxygenase, rheumatoid arthritis antisense therapy, 674–675 phosphorothioate oligodeoxynucleotides (PS-ODNs). See also oligodeoxynucleotides (ODNs) asthma therapy, 679–682 cancer therapy, 701–704 cardiovascular therapies, 603–604 chemical structure, 306–307 chimeric antisense oligonucleotides, human RNase H1 and, 65–70 clinical safety experiments, antisense oligonucleotides (ASOs) future research issues, 394–395 kidney effects, 386–389 liver effects, 391–392 local adminstration protocols, 371, 393–394 proinflammatory effects, 377–386 hypersensitivity reactions, 385–386 infusion-associated symptoms, 377–383 subcutaneous injection site responses, 383–385 selectivity and reduction research overview, 365–367 subject characteristics and disease conditions, 367–369 systemic administration trials aPTT prolongation, 374–375 complement activation, 375–377 duration of treatment, 370–371 results, 371–392 schedules and dosages, 369–370 thrombocytopenia, 389–391 gastrointestinal drug delivery systems, 228–231 impurity tests and assays, 423–430 inflammatory disease therapy, 666 hyperalgesia, 684–685 local administration, in brain, 221 locked nucleic acids, 537–539 medicinal chemistry, 5–7 modification, 148–149

CRC_8796_index.qxd

5/31/2007

15:44

Page 818

818 phosphorothioate oligodeoxynucleotides (contd.) metabolism, 307 ophthalmology therapies, 589–595 pharmacokinetic/pharmacodynamic properties animal studies, 308–316 in humans, 316–321 physical and chemical properties, system administration systems, 218–219 pulmonary drug delivery systems, 223–225 restenosis inhibition, 629 rheumatoid arthritis antisense therapy, 674–675 toxicologic effects class-related toxicologic properties, 336–338 2-O-methoxyethyl chimeric ASO vs., 328–329 organ accumulations, 340–346 proinflammatory effects, 347–351 reproductive systems, 352–353 safety pharmacology, 354–356 toxicokinetic properties, 332–333 toxicology of ASOs and, oral administration of, 334–336 Pick’s disease, splice switching oligonucleotide targeting, 96 PIWI domain Argonaute protein structure, 80–81 RNAi pathways, 439 plasma binding proteins, toxicology of ASOs, acute and transient changes, 337–340 plasma disposition, antisense oligonucleotides, pharmacokinetics, animal studies, 314–316 plasma pharmacokinetics, locked nucleic acid, 548 plasma trough concentration-effect determination, ISIS 301012 (ApoB-100), 317–318 platelet function clinical safety experiments with gen-1/gen-2 ASOs and, 389–391 toxicological properties of ASOs and, 346 p75 low-affinity neurotrophin receptor multiple sclerosis antisense therapy, 676–677 neurological diseases, ASO distribution, 723–726 PNA oligomers, 99, 104–105 polyadenylation regions, splice switching oligonucleotide targeting, 100 3⬘-Polyadenylation inhibition, occupancy-activated destabilization, 27 polyethylene glycol (PEG) lipids aptamer optimization, 783–784 liposomal drug delivery systems immunogenicity, 259–260 nucleic acids, 241–242 polyethyleneimine (PEI) formations RNA interference drug development, 477–478 synthetic short interfering RNA, systemic drug administration, 451–453 polymer systems, RNA interference drug development, 477–478 polymorphism, antisense oligonucleotide design, gene sequence variants, 123 posthybridization, antisense drug action, 7 posttranscriptional gene silencing (PTGS), small interfering RNAs, 76–77 posttranscriptional modification, RNA, 15–16

INDEX potency studies morpholinos, 569 formulation and enhancement technologies, 577 RNA interference drug development, 467–468 second-generation antisense oligonucleotide optimization, 500–501 pouchitis disease activity index (PDAI), alicaforsen therapy, 670–671 P50 protein, facilitated hybridization, 14–15 precipitation, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 418 preclinical applications aptamer therapeutics, 793–794 asthma antisense therapy, 679–682 inflammatory bowel disease antisense therapy, 671 inflammatory disease antisense therapy, in vivo characterization, 682–685 multiple sclerosis antisense therapy, 676–677 rheumatoid arthritis antisense therapy, 674–675 pre-mir transcript, micro-RNA biogenesis, 11–12 pre-mRNA RNA intermediary metabolism, 7–12 splicing mechanisms, 90–92 pre-/non-hybridization, antisense drug action, 7 presenilin 1 complex, dementia antisense therapies, 738 presystemic metabolism, gastrointestinal drug delivery systems, 225–226 primary cell assays, antisense oligonucleotide design, 131 primary miRNA (pri-miRNA), biogenesis, 78–79 prion diseases antisense oligonucleotide therapy, 736–737 splice switching oligonucleotide targeting, 96 progressive supranuclear palsy (PSP), splice switching oligonucleotide targeting, 96 proinflammatory effects clinical safety experiments with gen-1/gen-2 ASOs, 377–386 hypersensitivity reactions, 385–386 infusion-associated symptoms, 377–383 subcutaneous injection site responses, 383–385 ophthalmology therapy, tolerability parameters, 589 toxicological properties, chimeric antisense oligonucleotides, 346–351 propyne modifications, oligonucleotide medicinal chemistry, 164–165 prostaglandins compounds, inflammatory disease therapy, hyperalgesia, 684–685 prostate-specific membrane antigen (PSMA) splice switching oligonucleotide targeting, 98 synthetic short interfering RNA, systemic drug administration, 450–451 protamine-antibody fusion protein, synthetic short interfering RNA, systemic drug administration, 452–453 protein binding, 14–15 protein kinase C-α antisense cancer therapy, 705–706 pain therapy, 735 protein kinase R (PKR) activating protein (PACT), micro-RNA biogenesis, 79

CRC_8796_index.qxd

5/31/2007

15:44

Page 819

INDEX

819

protein phosphatases, type 2 diabetes, 644–647 protein tyrosine phosphatase 1B (PTP-1B) metabolic disease, drug discovery protocol, 642–644 obesity, ISIS 113715 compound effects, 652–653 type 2 diabetes, 644–647 prothrombin time (PT) systemic ASO therapy, clinical safety experiments, 374–375 toxicology of ASOs and, 338–339 proximal tubule morphology, toxicological effects of ASOs in, 341–345 PrPres protein, prion disease antisense therapy, 736–737 PSMA protetin, aptamer binding, 786 PTEN cell lines antisense oligonucleotides pharmacokinetics, animal studies, 309–311 screening, 131–134 oligonucleotide medicinal chemistry peptide nucleic acid backbone substitution, 154 propyne modifications, 165 second-generation antisense oligonucleotide optimization, gap size effects, rodent studies, 492–500 type 2 diabetes, 644 antisense targeting of, 644–647 PTM RNA, trans-splicing mechanisms, 102 pulmonary drug delivery systems antisense oligonucleotides, 223–225 RNA interference drug development clinical trials, 480 “naked” siRNA, 472–474 toxicologic effects of ASOs, 333–334 purification, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 415–416 yield and, 419 purine modifications antisense pain therapy, 735 locked nucleic acid synthesis, amidites, 524 oligonucleotide medicinal chemistry, 166–167 peptide nucleic acids, 510–512 pyrimidine modifications locked nucleic acid synthesis, amidites, 524 oligonucleotide medicinal chemistry, 163–166 peptide nucleic acids, 510–512

Q quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), antisense oligonucleotide design, 130–131 quantitative whole-body autoradiography (QWBA), aptamer in vivo characterization, 787–788 “quelling” silencing phenomenon, small RNA systems, 75–76

R RAF1 antisense, cancer therapy, 705–706 ranibizumab, ophthalmology therapy, tolerability parameters, 589

RANK protein expression, 2⬘-methoxyethyl oligonucleotide pharmacology, bone tissue, 286–287 RAS ongene family, antisense cancer therapy, 711 reagents, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 421 manufacturing, 407–410 receptor signaling, inflammatory disease antisense therapy, 686–687 REG1 aptamer, 792–793 relative standard deviation (RSD), 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, 429–430 renal function clinical safety experiments with gen-1/gen-2 ASOs and, 386–389 toxicological effects of ASOs in kidney and, 341–345 renin-angiotensin system (RAS), antisense inhibitors and, 628 reproductive systems, toxicological effects of ASOs on, 352–353 respiratory syncytial virus (RSV), RNA interference drug development, clinical trials, 480 restenosis antisense inhibitors of, 628–629 morpholinos and, 573–575 retention enema formula, antisense oligonucleotide delivery and, 232–233 reverse-phase evaporation, nucleic acid encapsulation, liposomal delivery formulations, 248–249 reverse-phase HPLC, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, purification process, 416–417 reverse transcriptase polymerase chain reaction (RT-PCR) primers, antisense oligonucleotide design, 119 kinetic RT-PCR, 129–130 rheumatoid arthritis antisense therapies cell migration and adhesion, 686 cell proliferation, maturation, and survival, 685 clinical evaluation, 672–674 gene expression and receptor signaling, 686–687 preclinical applications, 674–675 pathology and current therapy, 672 Ribofuranose sugars, oligonucleotide medicinal chemistry, 161–163 ribonuclease protection assays, antisense oligonucleotide design, 130–131 ribonucleic acid (RNA) antisense drugs, 12–13 antisense theory and, 5 chemical synthesis, 446–448 intermediary metabolism, 7–12 locked nucleic acid inhibition, 540–544 posttranscriptional modifications, 15–16 structural disruption, 26 targeting of, 14–15 ribonucleotide reductase (RNR), cancer therapy, 710–711

CRC_8796_index.qxd

5/31/2007

15:44

Page 820

820 ribozymes, neurological disorders, nonantisense gene silencing, 726–727 ring structures, oligonucleotide medicinal chemistry, 162–163 RNA-binding domain (RNA-BD), human RNase H1 structure and enzymology, 49–52 RNA-induced silencing complex (RISC). See also Silencing pathways assembly mechanisms, 81–82 facilitated hybridization, 14–15 2⬘-methoxyethyl oligonucleotides, multiple antisense mechanisms, 278–279 micro-RNA biogenesis, 11–12 occupancy-activated destabilization, 33–35 ophthalmology therapies, 586–587 RNAi enzymes and, 79–80 RNA interference drug development, potency criteria, 467–468 RNAi pathways, 438–439 small interfering RNA strand selection, 77 RNA-induced transcriptional silencing (RITS), micro-RNA biogenesis, 11–12 RNA interference (RNAi) chemical modifications, 439–443 clinical trials, 478–480 discovery and development evolution of, 465–466 in vitro selection of lead candidates, 466–470 duplex oligoribonucleotides, 12 future research and applications, 480–481 liposomal drug delivery systems, immune stimulation, 258–259 2⬘-methoxyethyl oligonucleotides, multiple antisense mechanisms, 278–279 molecular mechanism, 438–439 neurological disorders, nonantisense gene silencing, 727–728 oligonucleotide medicinal chemistry, 156 therapeutic applications, 437–438 immune response reduction, 446 in vivo delivery systems, 471–478 antibodies, 478 conjugated compounds, 474–475 liposomes and lipoplexes, 475–477 naked siRNA, 471–474 peptides and polymers, 477–478 RNA primers, human RNase H1 and, 55 RNase H enzymes antisense therapeutics and, 70–71, 586–587 characeristics, 48 human RNase H1 biochemical properties, 49 biological roles, 55 catalytic domain, 52–54 chimeric antisense oligonucleotide activity, 65–70 genomics and regulation, 56 RNA-binding domain, 50–52 second-generation antisense oligonucleotide optimization, gap size effects, 490–492 structure and enzymology, 49–54

INDEX human RNase H2 biological roles, 61–63 genomics and regulation, 63 structure and enzymology, 56–61 human RNases H, 48–49 DNA-like antisense oligonucleotides, 63–65 locked nucleic acid recruitment, 539–540 2⬘-methoxyethyl oligonucleotides first-generation pharmacological comparisons, 273–277 multiple antisense mechanisms, 277–279 occupancy-activated destabilization, 27–31 double-stranded RNase vs., 32–33, 36 enzymology of, 30 robustness of, 30–31 target site accessibility, 28–29 oligonucleotide medicinal chemistry, 146 furanose substitution positions, 158 peptide nucleic acid, mRNA targeting, 509–510 phosphorothioate oligonucleotides, pharmacokinetics, 308 second-generation antisense oligonucleotide optimization, 488 future research issues, 503–504 gapmer structures, 488–490 oligonucleotide length, 501–503 RNase III enzymes, second-generation antisense oligonucleotide optimization, 488 RNase L cleavage mechanism, occupancy-activated destabilization, 38–39 RNA splicing, morpholino alteration of, 576–577 robustness RNase H mechanism, 30–31 translation arrest, 26 RP-HPLC UV chromatography, 2⬘-methoxyethyl (MOE)-modified oligonucleotide analysis, phosphoramidites, 419–420

S safety profiles antisense oligonucleotides metabolic diseases, 657–658 neurological diseases, 728–730 cardiovascular therapy, ISIS 301012 ApoB inhibitor, 619–626 clinical safety experiments future research issues, 394–395 kidney effects, 386–389 liver effects, 391–392 local adminstration protocols, 371 results, 393–394 proinflammatory effects, 377–386 hypersensitivity reactions, 385–386 infusion-associated symptoms, 377–383 subcutaneous injection site responses, 383–385

CRC_8796_index.qxd

5/31/2007

15:44

Page 821

INDEX selectivity and reduction research overview, 365–367 subject characteristics and disease conditions, 367–369 systemic administration trials aPTT prolongation, 374–375 complement activation, 375–377 duration of treatment, 370–371 results, 371–392 schedules and dosages, 369–370 thrombocytopenia, 389–391 CpG oligodeoxynucleotides, 759–760 morpholinos, 567–569 toxicology of ASOs, 330–331 pharmacological aspects, 354–356 SARS virus, morpholino rapid response to, 571 S-class oligodeoxynucleotides (ODNs), 755 screening processes antisense inhibitor identification, 16–19 antisense oligonucleotides (ASOs), primary assays, 128–134 activity assay, 128–134 kinetic RT-PCR, 129–130 positive and negative controls, 134 “selective” benzylation, locked nucleic acid synthesis, amidites, 522–524 selectivity mechanisms, antisense drugs, 12–19 affinity, 12–13 facilitated hybridization, 14–15 inhibitor screening and identification, 16–19 nucleic acid sequence specificity, 13–14 posttranscriptional RNA modifications, 15–16 protein binding and RNA targeting, 14 target RNA levels, 15 terminating mechanism, 15 therapeutic specificity (index), 19 type 2 diabetes, 649–651 SELEX process aptamer development binding and functional properties, 784–786 historical background, 774–776 optimization strategies, 779–784 therapeutic applications, 776–779 in vivo characterization, 786–788 pool composition, 776–778 pool design criteria, 776 positive and negative selection pressures, 778–779 sequence motifs antisense oligonucleotide toxicology, 329–330 morpholinos, 569 toxicological effects of ASOs, proinflammatory mechanisms, 349–351 sequence-specific hybridization-independent effects, toxicology of ASOs and, 331 serum creatinine levels, clinical safety experiments with gen-1/gen-2 ASOs and, kidney effects, 386–389 serum transaminases, clinical safety experiments with gen-1/gen-2 ASOs, liver function and, 391–392

821 SH2-domain containing inositol 5-phosphatase 2 (SHIP2), type 2 diabetes, 644 signaling cascade inflammatory disease antisense therapy, 686–687 ophthalmology therapy, angiogenesis mechanisms, 593 signal tranducer and activator of transcription (STAT3) cancer therapy, 709–710 immunomodulation and immune surveillance, 689 silencing pathways argonaute protein structure, 80–81 micro-RNAs, 77–79, 453–457 RISC system, 79–82 RNAi enzyme complex, 79–81 small interfering RNAs, 76–77 small molecule systems mRNA destabilization and translational repression, 82–83 overview, 75–76 “single overhang” design, short interfering RNAs (siRNAs), 443–445 single-strand antisense oligonucleotides ophthalmology therapies, 586–587 toxicologic effects, 328 single-strand RNA, oligoribonucleotide ligand identification, 760–762 site accessibility, RNase H mechanism and, 28–29 six-membered ring structures, oligonucleotide medicinal chemistry, 162–163 skin barriers, topical delivery systems, 222–223 small interfering RNAs (siRNAs) antisense therapeutics and, 10–12 ApoB-100 inhibition therapies, animal studies, 625–626 argonaute protein structure, 80–81 backbone modifications, 440 base modifications, 442–443 cancer therapy, HSP27 gene silencing, 709 chemical synthesis, 446–448 design, 443–445 enzyme complex, 79–81 global splicing strategies, 103 human RNase H2 biochemistry, 57–61 immune response reduction, 446 liposomal drug delivery systems efficacy analysis, 260–262 immune stimulation, 258–259 nucleic acids, 238–239 pharmacokinetics and biodistribution, 254–256 2⬘-methoxyethyl oligonucleotides, multiple antisense mechanisms, 278–279 neurological disorders, nonantisense gene silencing, 727–728 oligonucleotide medicinal chemistry cholesterol conjugates, 168 design strategies, 170 2⬘-fluoro modifications, 156 2⬘-O- methyl and methoxyethyl modifications, 156 ophthalmology therapies angiogenesis mechanisms, 592–593 classification, 587

CRC_8796_index.qxd

5/31/2007

15:44

Page 822

822 small interfering RNAs (contd.) pharmacokinetics, 587–588 research background, 586 tolerability parameters, 589 RISC system, 79–80 RNA interference drug development antibodies, 478 clinical trials, 478–480 conjugation strategies, 474–475 liposomes and lipoplexes, 475–477 “naked” siRNA, 471–474 peptides and polymers, 477–478 potency criteria, 467–468 specificity criteria, 468 stability properties, 468–469 therapeutic applications, 468–470 RNAi pathways, 439 sliencing pathways, 76–77 specificity improvements, 445–446 RNA interference drug development, 468 sugar modifications, 440–442 systemic delivery complexation techniques, 451–453 conjugation techniques, 448–451 toxicologic effects, 328 small molecules. See also short interfering RNAs (siRNAs) global splicing strategies, 103–104 “Lipinski Rules” for, 437–438 RNA interference drug development, 475 small noncoding RNAs, intermediary metabolism, 10–12 small nuclear ribonucleoproteins (snRNPs), pre-mRNA splicing and, 90–92 small nuclear RNAs (snRNAs) hybridization of splicing with, 102–103 pre-mRNA splicing and, 90–92 small RNA systems, silencing pathways, overview, 75–76 SMN gene, spinal muscular atrophy antisense therapy, 739 SNAIL transcription repressor, morpholino-targeted cancer therapy, 575 sodium glucose transport protein 2 (SGLT2) second-generation antisense oligonucleotide optimization, 502–504 type 2 diabetes, antisense therapeutic targeting of, 651–652 solid-phase synthesis, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 413–419 deprotection, 415 detritylation, 417–418 freeze-drying, 419 precipitation, 418 purification, 415–417 solution preparation, 413–415 yield and purity, 419 solid support materials, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 410–411 solution preparation, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, solid-phase synthesis, 413–415 sparged reactor vessels, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 410–411

INDEX species sensitivity ApoB-100 inhibition therapies, 612–613 toxicological effects of ASOs, 350–351, 356–357 specificity aptamer development, 784–786 nucleic acid sequences, 13–14 oligonucleotide medicinal chemistry, 146 impurity tests and assays, 424–430 RNA interference drug development, 468 short interfering RNAs, improvements in, 445–446 therapeutic specificity (therapeutic index), 19 spinal muscular atrophy (SMA) antisense oligonucleotide therapy, 739 splice switching oligonucleotide targeting, 97 spliceosome, structure and function, 90–92 splice switching oligonucleotides (SSOs) basic properties, 93–94 defective gene function restoration, 94–98 natural alternative splicing modification, 98–100 therapeutic targets, 94–100 acetylcholinesterase, 99–100 bcl-x gene, 98 β-globin, 94 CD40 cell membrane protein, 99 cystic fibrosis transmembrane conductance regulator, 95–96 dystrophin, 95 lamin A protein, 96–97 MyD88 protein, 99 ocular albinism type 1 gene, 97–98 polyadenylation regions, 100 prostate-specific membrane antigen, 98 survival motor neurons, 97 tau protein, 96 Wilms’ tumor suppressor (WT1) gene, 99 splicing mechanisms. See also alternative splicing global strategies, 103–104 hybridization strategies, 100–103 modulation of, 19–25 antisense drug position, 24 B-cell lymphoma/leukemia cell x (Bc1-x), 20 β-globin RNA splicing, 20–21 chemical class influences, 25 dystrophin splicing alteration, 20 exonic enhancer/silencer binding, 25 intron/exon characteristics, 24 MyD88 protein, 21 signal strength, 21–24 pre-mRNA, 90–92 RNA intermediary metabolism, 8–12 splice-site position, 24 splice-site strength, 21–24 splice switching oligonucleotides assay, 104–105 basic properties, 93–94 defective gene function restoration, 94–98 natural alternative splicing modification, 98–100 spontaneous vesicle formation by ethanol dilution (SNALP), nucleic acid encapsulation, 249–251

CRC_8796_index.qxd

5/31/2007

15:44

Page 823

INDEX SRB-1 gene expression, 2⬘-methoxyethyl oligonucleotide pharmacology, liver concentrations, 285–286 stability properties locked nucleic acids, 539 oligonucleotide medicinal chemistry, 144 RNA interference drug development, 468–469 stabilized antisense-lipid particles (SALPs), ethanol drop nucleic acid encapsulation, liposomal drug delivery systems, 247 stabilized plasmid lipid particles (SPLPs), liposomal nucleic drug delivery systems immunogenicity, 259–260 spontaneous vesicle formation by ethanol dilution, 249–251 stable nucleic acid lipid particle (SNALP) ApoB-100 inhibition therapies, combined regimen, animal studies, 625–626 liposomal nucleic acid delivery encapsulation efficacy analysis, 260–262 pharmacokinetics and biodistribution, 254–256 toxicity measurement, 256–258 liposomal nucleic delivery encapsulation, spontaneous vesicle formation by ethanol dilution, 249–251 RNA interference drug development, liposomes and lipoplexes, 475–477 synthetic short interfering RNA, systemic drug administration, 451–453 statin therapies, cardiovascular disease, antisense oligonucleotides combined with current treatment paradigm, 602 hamster combination studies, 616 ISIS 301012 combined regimen, 621–626 limitations of, 602–603 stearoyl-CoA desaturase (SCD), nonalcoholic steatohepatitis, antisense reduction, 656 stent devices, morpholino therapies and, 572–574 streptavidin, brain drug delivery system, 221 “structural saturation,” locked nucleic acid structure, 530–532 structure-activity relationships (SARs) CpG-oligodeoxynucleotides, 753–755 human RNase H1, 51–54 oligonucleotide medicinal chemistry, 146 subcellular localization, human RNase H2 biochemistry, 61–63 subchronic dosing regimen, ISIS 301012 (ApoB-100), 318–320 subcutaneous injection antisense oligonucleotide drugs, 219–220 clinical safety experiments aPTT prolongation, 374–375 ASO responses, 383–385 dosage and scheduling studies, 369–370 local administration results, 372, 393–394 ISIS 301012 ApoB inhibitor, 623–626 toxicologic effects of ASOs, 334

823 sugar modifications locked nucleic acid structure, 530–532 oligonucleotide medicinal chemistry, 154–163 backbone replacements, 152–154 bicyclic sugars, 158–161 furanose substitution positions, 158 ribofuranose sugar, 161–163 2⬘-modifications, 154–157 second-generation antisense oligonucleotide optimization, gapmer structures, 489–490 short interfering RNAs, 440–442 sulfur transfer reagent, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 407–408 superoxide dismutase 1 (SOD1) amyotrophic lateral sclerosis antisense therapy, 730–734 neurological disorders, 722–723 survival motor neurons, splice switching oligonucleotide targeting, 97 survivin antisense, cancer therapy, 704–705 synthesizers locked nucleic acid synthesis, 528–529 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 411–413 synthons, locked nucleic acid synthesis, base modifications, 528 systemic drug administration antisense oligonucleotides clinical safety experiments aPTT prolongation, 374–375 complement activation, 375–377 dosage studies, 369–370 duration of treatment, 370–371 results, 371–392 intravenous infusion, 219 pharmacokinetics, animal studies, 308–309 physical and chemical properties, 218–219 subcutaneous injection, 219–221 liposomal nucleic acid delivery formulations, pharmacokinetics and biodistribution, 254–256 synthetic short interfering RNA, 448–453 complexation techniques, 451–453 conjugation techniques, 448–451 toxicologic effects of ASOs, 333–334

T targeted oligonucleotide silencers of splicing (TOSS), RNA splicing hybridization, 101 target sites accessibility in RNAs, RNase H mechanism and, 28–29 antisense oligonucleotide design and selection, 119–123 antisense oligonucleotides, pharmacokinetics, animal studies, 308–311 toxicology of ASOs and, 340–346

CRC_8796_index.qxd

5/31/2007

15:44

Page 824

824 tau protein-related diseases, splice switching oligonucleotide targeting, 96 TBDMS chemistry, short interfering RNA chemical synthesis, 446–448 T-bet transcription factor, multiple sclerosis antisense therapy, 676–677 temperature effects, oligonucleotide concentrations, subcutaneous injections and, 219–220 terminal plasma concentrations, antisense oligonucleotides, pharmacokinetics, animal studies, 315–316 terminating mechanism in antisense drugs, 15 antisense oligonucleotides, 47–48 tetrabutylammonium fluoride (TBAF), short interfering RNA chemical synthesis, 447–448 β-thalassemia, splice switching oligonucleotide targeting of, 94 small nuclear RNA hybridization, 103 therapeutic index, oligonucleotide medicinal chemistry, 147 therapeutic specificity (therapeutic index), antisense drugs, 19 thermal denaturation, locked nucleic acid, 532–537 thermodynamics, locked nucleic acids, 536 thiazole modification, oligonucleotide medicinal chemistry, 165 thioformacetal, oligonucleotide medicinal chemistry, 152–153 thio-LNA amidites heteroduplex thermal denaturation, 533–534 RNase H recruitment, 540 synthesis, 524–526 thiophosphonoacetate, oligonucleotide medicinal chemistry, 150 thiophosphoroamidates, oligonucleotide medicinal chemistry, 150 4⬘-thioribose, oligonucleotide medicinal chemistry, 161–162 threofuranosyl-(3→2⬘)-linked nucleic acid analog (TNA), oligonucleotide medicinal chemistry, 163 thrombin-binding aptamers, toxicological effects, 339 thrombocytopenia, clinical safety experiments with gen-1/gen-2 ASOs and, 389–391 tissue concentrations antisense oligonucleotides, pharmacokinetics accumulation and clearance, 314–316 animal studies, 308–311 gastrointestinal drug delivery systems and, 231–233 locked nucleic acid, 548–551 TNF receptor-associated adaptor protein (TRADD), second-generation antisense oligonucleotide optimization, gap size effects, rodent studies, 495–500 tolerability parameters ISIS 301012 ApoB inhibitor, 623–626 ophthalmology therapies, 588–589 toll-like receptors (TLRs) autoimmune disease therapy, 759 cancer therapies, 758–759

INDEX CpG dinucleotide motifs, TLR9 and mechanism of action, 748–751 immunomodulation and immune stimulation effects, 751–753 infectious disease monotherapies, 755–757 inflammatory disease therapy, 666 oligodeoxynucleotides with CpG, 754–755 oligoribonucleotide ligand identification and immune stimulation, 760–762 RNA interference drug development, specificity improvements, 468 safety profiles, 759–760 toxicological effects of ASOs, proinflammatory mechanisms, 349–350 topical delivery systems antisense oligonucleotides, 222–223 pharmacokinetics, animal studies, 310 clinical safety experiments, 372, 394 toxicity effects cardiovascular ASO therapies, ISIS 301012 ApoB inhibitor, 617–618 chimeric antisense oligonucleotides chronic administration, 351 clotting inhibition, 338–339 complement activation, 339–340 genetic effects, 353–354 hematopoietic effects, 345 kidney effects, 340–345 liver effects, 345–346 mechanisms and clinical correlates, 336–337 oral administration, 334–336 phosphorothioate comparisons, 328–329 plasma protein binding effects, 337–340 proinflammatory effects, 346–351 reproductive toxicology, 352–353 safety assessment strategies, 330–331 safety pharmacology, 354–356 sequence motifs, 329–330 single-strand ASO, siRNA, and aptamers, 328 species-specific effects, 356–357 systemic vs. local administration, 333–334 target organ accumulation and effect, 340–346 toxicokinetics, 332–333 liposomal nucleic acid delivery encapsulation, 256–258 locked nucleic acid, 553–557 2⬘-methoxyethyl oligonucleotide pharmacology, in vitro conditions, 280–282 morpholinos, safety profiles, 567–569 neurological disease antisense therapies, 728–730 TPI-ASM8, asthma therapy, 679 transactivating region (TAR) element, RNA disruption, 26 transactivating reseponse (tar) RNA-binding protein (TRBP), micro-RNA biogenesis, 79 transcription factors antisense oligonucleotides, 9 asthma pathology and, 678 multiple sclerosis antisense therapy, 676–677 occupancy-activated destabilization, siRNA repression, 35–36 peptide nucleic acids, 512

CRC_8796_index.qxd

5/31/2007

15:44

Page 825

INDEX

825

RNA intermediary metabolism, 7–12 type 2 diabetes, antisense targeting of, 647 transfected cell lines, antisense oligonucleotide screening, 131 transforming growth factor, ophthalmology therapies and, 594–595 transforming growth factor-β, glioblastoma antisense therapy, 736 translational repression occupancy-only antisense drug mechanisms, 25–26 small RNA-directed mechanisms in mRNA, 82–83 transplantation, inflammatory disease antisense threapy, 682–683 trans-splicing mechanisms, technology for, 101–102 transthyretin (TTR) gene, neuropathies, 738–739 Treg production and function, inflammatory disease antisense therapy, 689 tricyclic cytosine analogs, oligonucleotide medicinal chemistry, 165–166 triplex structures, locked nucleic acids, thermal denaturation, 537 tumor necrosis factor-α inflammatory bowel disease antisense therapy, 671 pharmacokinetics and pharmacodynamics, 321 rheumatoid arthritis therapy, 672–674 cell proliferation, maturation, and survival, 685 RNA interference drug development, 477 ulcerative colitis therapy, 687 tumor necrosis factor receptor family, 2⬘-methoxyethyl oligonucleotide pharmacology in, bone tissue, 287–288 2⬘-sugar modifications, oligonucleotide medicinal chemistry, 154–157 type 2 diabetes, drug discovery for, 644–652 hepatic glucose output inhibition, 648–649 ISIS 113715 compound, 658–659 kidney targeting, 651–652 protein phosphatase targeting, 644–647 tissue selectivity and pharmacokinetic properties, 649–651 transcription factor targeting, 647

U ulcerative colitis, 667–671 Unylinker molecule, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 406–407 uptake mechanisms locked nucleic acid, 551–552 ophthalmology therapies, 587 pulmonary drug delivery systems, 223–225

V vaccines, CpG oligodeoxynucleotides, 757–758 vascular endothelial growth factor (VEGF) aptamer therapeutic agents, pegaptanib, 788–790 ophthalmology therapy angiogenesis and, 592–593 pegaptanib, 586–587 RNA interference drug development clinical trials, 480 “naked” siRNA, 471–472 SELEX process and, 777–779 toxicologic effects, reproductive systems, 352–353 vascular smooth muscle cell (VSMC) inhibition, morpholino therapies and, 573–574 very late activation antigen (VLA)-4 antisense, multiple sclerosis therapy, 675–676 viral miRNAs, antagomir silencing, 457–458 viral suppression, miRNA silencing, 458 viscosity, oligonucleotide concentrations, subcutaneous injections and, 219–220

W Watson-Crick base-pairing antisense oligonucleotide pharmacokinetics, 306–307 antisense theory and, 5 locked nucleic acid heteroduplexes, 532–534 oligonucleotide medicinal chemistry, 145 peptide nucleic acids, 510–512 West Nile virus (WNV), morpholino rapid response to, 571 Wilms’ tumor suppressor (WT1) gene, splice switching oligonucleotide targeting, 99

X X-linked mammalian inhibitor of apoptosis protein (XIAP), cancer therapy mechanisms, 704–705 morpholino-targeted drug development, 575

Y yield statistics, 2⬘-methoxyethyl (MOE)-modified oligonucleotide manufacture, 419

Z zeta potential, liposomal drug delivery systems, nucleic acids, 253

CRC_8796_index.qxd

5/31/2007

15:44

Page 826

CRC_8796_colpla.qxd

5/25/2007

12:31 PM

(A)

Page 1

(B) NR IgG

Anti-H1 Ab

(C) Anti-H1 Ab

Infected with virus

us vir 1 H1 rol Size _H 6(−) ont L standard C 2 F

50 kDa

Uninfected Hela cell

Anti-H2 Ab


Anti-H1 Ab

FL_H1 virus infected Hela cell

RNase H1

36 kDa

infected Hela cell

30 kDa

Mitotracker red Purified H1 Ab


26(−)H1 virus infected Hela cell

Anti-H2 Ab

Anti-H1 Ab



Figure 2.10



Anti-H1 Ab mitotracker red merge



Immunofluoresence staining of human RNases H with purified anti-H1 or H2 antibody. Normal rabbit IgG (NR IgG) was used as control. (A) Human RNase H1 and H2 immunostaining of normal (uninfected) or virus infected Hela cells. (B) RNase H1 staining of Hela cells infected with H1 virus and costaining with mitochondrial-specific stain. (C) Expression of human full length (FL) and N-terminal 26 amino acid (⫺26) minus RNase H1 in Hela cells. Hela cells were infected with FL or ⫺26 minus RNase H1 virus or control virus (LoxP) for 24 h. The cell lysates were prepared and subjected to immunoprecipitation with RNase H1 Ab. The immunoprecipitated samples were then used to the Western blot with same H1 Ab.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 2

Liver

Kidney

Adipose

Bone

Spleen

Human tumor xenograft

Figure 10.4 Immunolocalization of 2⬘-MOE gapmer in different mouse tissues following systemic treatment. Mice were dosed with ISIS 13920, a 2⬘-MOE gapmer recognized by the 2E1 monoclonal antibody. Tissues were collected and stained with the 2E1 antibody for presence of oligonucleotide as described by Butler et al. [133]. Antibody bound to the oligonucleotide appears as the brown stain in the histological sections. The blue stained structures are the result of staining with hematoxylin, used as a counterstain. G—glomerulus, PT—proximal tubules, O—osteoclast, E—endosteum, T— tumor xenograft, S—stromal cells.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 3

Granular cells Purkinje cell

Motor neuron Molecular layer

Lumbar cord, ICV

Cerebellum, IT

R/C

Lung, inhalation

IN

Eye, intravitreal

Figure 10.5 Immunolocalization of 2⬘-MOE gapmer in different tissues following local administration. Animals were dosed with the 2⬘-MOE gapmer ISIS 13920 and oligonucleotide localized using immunocytochemistry as previously described [133]. Lumbar cord, ICV: 13920 was infused into the lateral ventricle for 14 days and ISIS 13920 localized (brown stain) in the lumbar cord. Cerebellum, IT: Rhesus monkeys were infused with ISIS 13920 into the intrathecal space for 14 days and ISIS 13920 localized in the cerebellum. Lung, inhalation: Mice were treated with ISIS 13920 by aerosol administration and localization of ISIS 13920 determined in lung tissue. Eye, intravitreal: ISIS 13920 was injected intravitreally into a mouse eye and localized in different cell population by immunohistochemical staining (brown stain). R/C—cell bodies of the rods and cones in the retina, IN—inner nuclear layer of the retina.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 4

Figure 10.6 Immunolocalization of 2⬘-MOE gapmer in normal and inflamed tissue. Inflammation was induced in mouse ears by either treating topically with DNFB [200] or in intestinal tissue by treating with dextran sulfate [163]. Once the inflammation was established, mice were treated with ISIS 13920 and tissue collected approximately 24 h after dosing. The 2⬘-MOE gapmer was localized in normal and inflamed tissue by staining with 2E1 antibody [133]. Tissues were counterstained with hematoxylin (blue stain). Brown staining represents localization of ISIS 13920.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 5

(a)

(c)

2

1.5

1

75% MM inhibition p = 0.001 vsMM

* Scheffer’s post hoc analysis

49% inhibition vs MM p = 0.18MM

Neovascularization (mm2)

2.5

Irrelevant siRNA

0.5

0 No Inj

PBS

siMM 60 µg

siVEGF 3 µg

siVEGF Pegaptanib VEGF Rc Ig 60 µg 16 µg 1 µg

(d)

(b) 100

Normal vascular area (%)

90 80 70 60

ALN-VEG01

50 40 30 20 10 0 No Inj

Figure 16.4

BS

siMM 60 µg

siVEGF 3 µg

siVEGF Pegaptanib VEGF Rc Ig 60 µg 16 µg 1 µg

ALN-VEG01 specifically inhibits retinal neovascularization in a rat oxygen-induced retinopathy model. Newborn rats were exposed to alternating high oxygen concentrations from days 0–14 as outlined previously [101]. On day 14, therapeutic agents were given once intravitreally (5 l volume) at the amounts indicated and rats placed in room air for the following 6 days (days 14–20). On day 20, rats were sacrificed and flat mount retinal preparations stained with ADPase was used to quantitate (a) pathologic neovascularization and (b) normal vascular development; representative ADPase flat mount preparations are shown following administration of (c) irrelevant control siRNA or (d) ALN-VEG01. Experimental groups: no injection (No Inj), saline (PBS), highand low-dose ALN-VEG01 siRNA (siVEGF), high-dose ALN-VEG01 mismatch siRNA (siMM), clinical-grade VEGF aptamer (Pegaptanib), and research-grade VEGF receptor immunoglobulin fusion protein from R&D Systems (VEGF Rc Ig). All groups were scored blinded; N ⫽ 10 per group. Neovascularization data are expressed as mean neovascular area (mm2) ⫾ SE (A) and normal retinal vasculature data are expressed as percentage vascular area (⫾ SE). Scheffe’s post-hoc analysis was employed to identify significant differences in both neovascular area and normal vascular area. One of three representative experiments.

(a)

5/25/2007

12:32 PM

Light field

Page 6

900

Dark field

Concentration (µg / gram tissue)

CRC_8796_colpla.qxd

Retina

RPE Choroid/ Sclera

800 700

Equivalent to 45,000 nM in vitro IC50: < 1 nM

600 500 400 300 200 100 0

Vitreous fluid Retina Ocular compartment

2 days post Intravitreal Injection Magnification 400x

(b)

0.5 h

Unmodified siRNA

6h

24 h

72 h

168 h

10000 Unmodified siRNA Chemically modified siRNA

modified siRNA

1000 100 10

IC50for VEGF silencing

1 0.5 0.1 0.5 h

3 days

7 days

Vitreous fluid

0.5 h

3 days

7 days

Choroid/sclera

Figure 16.5 Beneficial effect of nuclease stabilization on intact ocular drug levels and anatomical distribution of siRNA following intravitreal injection. A 7-day rabbit study was performed to determine the pharmacokinetics of a chemically modified siRNA (P ⫽ S) and its unmodified counterpart. (a) Rapid uptake and distribution of siRNA within ocular tissues. 33P-radiolabeled unmodified and modified compounds (0.4 mg) were injected intravitreally and ocular tissues analyzed after 0.5, 6, 24, 72, and 168 h. Counts per minute (CPM) were measured for different eye compartments (aqueous humor, vitreous, retina, iris, sclera/choroid). Negligible counts were detected in aqueous humor and iris. Analysis of total CPM in retina for the modified siRNA is shown; unmodified siRNA exhibited a similar profile. Concentration of siRNA/gram of tissue was calculated based on CPM assuming 100% intact duplex. Microautoradiography (as visualized under light and dark field microscopy) shows distribution of radiolabeled modified siRNA throughout retina and sclera two days following intravitreal injection. Radiolabel is detected as dark spots under light field and bright spots under dark field. (b) In vivo benefit of exonuclease protection. Ocular tissues (vitreous and choroid/sclera) were subjected to polyacrylamide gel electrophoresis and percentage of intact 33P-labeled duplex was determined by autoradioluminogram. Exonuclease protection results in greater stability within the vitreous and ocular tissue than the same duplex in its unmodified form. Estimated ocular levels of intact nucleases protected siRNA (based on CPM ⫻ % intact duplex) are approximately 50-fold above the in vitro IC50 7 days after a single intravitreal injection.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

H&E

Page 7

ASO

Lumen Muscle

Foamy macrophages in aortic plaque

Trichrome staining

Macrophages

Figure 22.1 Localization of a representative 20-mer phosphorothioate within an atherosclerotic lesion of a Watanabe Heritable Hyperlipidemic rabbit. Animals were administered 25 mg/kg ASO twice weekly for 3 weeks. Top left panel: H&E staining of the aortic plaque indicating the presence of foamy macrophages in the lesion. Bottom left panel: Masson’s Trichrome staining of the lesion to highlight excess collagen deposition. Top right panel: Localization of the ASO using immunostaining. Bottom right panel: Localization of macrophages using a monoclonal mouse anti-macrophage antibody (RAM 11).

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 8

(b)

(a)

160 140

100

Serum triglycerides (mg/dL)

ApoC-III mRNA (% saline control)

120

80 60 40 20

120 100 80 60 40 20 0

0 Saline Treated

Saline

ISIS 167878 ISIS 167880 50 mg/kg/week 50 mg/kg/week Treatment

(c)



(d)

Saline

167878

Liver triglycerides (mg/g)

300 250 200 150 100 50 0 167880

Saline



Figure 22.3 Pharmacological effect of two ASOs targeting murine apoC-III in high fat–fed C57BL/6 mice. In this representative experiment, mice were administered 50 mg/kg/week ISIS 167878 and ISIS 167880 for 6 weeks. (a) Reduction in hepatic apoC-III mRNA analyzed by qRT-PCR. Data are expressed as the mean percentage of mRNA levels in saline treated animals. (b) Reduction in serum triglyceride levels of treated animals. (c) ApoC-III ASOs reduced hepatic steatosis as assessed by Oil Red O staining of livers. (d) Quantitation of liver triglyceride levels.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 9

Saline

SMI

ISIS 147764

ISIS 158661

ISIS 144477

Figure 22.5 Microsomal triglyceride transfer protein (MTP) inhibitors exacerbate hepatic steatosis in high fat–fed C57BL/6 mice. In this representative experiment, mice were administered 50 mg/kg/week ASOs for 6 weeks and 1 mg/kg daily of a small-molecule MTP inhibitor. Oil Red O–stained liver sections of high fat–fed C67BL/6 mice administered either saline (top left panel), ISIS 147764, the apoB inhibitor (top right panel), small-molecule MTP inhibitor (bottom left panel), ISIS 158661 and ISIS 144477, antisense inhibitors to MTP (bottom middle and right panel, respectively).

P 0.6 0.5

P P Saline

0.4 0.3 0.2



Volume mm3

Normal intima

Saline

0


*

0.1

*P = 0.033 (one-tailed t test) Figure 22.7 ISIS 301012, the human apoB antisense inhibitor, reduces aortic sinus plaque volume in human apoB transgenic/Ldlr–deficient mice. Transgenic mice were administered 20 or 50 mg/kg/week ASO for 14 weeks. Top left panel: Aortic sinus region of saline treated mice. P indicates the plaque that is characterized by neointimal hyperplasia, macrophage foam cells, intracellular lipid, and fibrous caps. Lower left panel: Aortic sinus region of ISIS 301012–treated animals indicating the decrease in plaque volume. Right panel: Quantitative imaging analysis of total plaque volume within the aortic sinus. Administration of ISIS 301012 reduced total aortic sinus plaque volume in a dose-dependent fashion, with the highest dose group reducing plaque by approximately 60%.

CRC_8796_colpla.qxd

5/25/2007

12:32 PM

Page 10

Saline

VLA-4 ASO

(a)

(b)

(c)

(d)

(e)

(f)

VLA4+ cells

CD4+ T cells

BM8+ Mφs

Figure 24.6 VLA-4, T cell, and macrophage immunostaining on spinal cords from EAE mice. Saline-treated mice (a, c, e) had a Grade 2 paralysis but were symptom free while receiving treatment with a VLA4 antisense inhibitor (b, d, f). Antibodies were used to detect VLA-4 (a, b), CD4⫹ T cells (c, d), or BM8⫹ macrophages (e, f). Magnification: 250X. (From Myers, K.J. et al., J. Neuroimmunol., 160, 12, 2005. With permission.)

CRC_8796_colpla.qxd

5/25/2007

12:33 PM

(a)

Page 11

(b)

(c)

Figure 25.2 Immunostaining of OGX-011 drug distribution (a) and Clusterin expression (b, c) in human lymph tissue. (a) An antibody raised against the 2⬘-MOE backbone of OGX-011 enabled the immunohistochemical staining (brown) of resected human lymph tissue to verify that the drug had reached its target. (b, c) Clusterin protein expression (brown) in lymph node samples. Figure 25.2(b) shows an untreated control specimen while Figure 25.2(c) demonstrates downregulation of Clusterin in lymph tissue from a trial subject treated with OGX-011 at 640 mg dosing.

CRC_8796_colpla.qxd

5/25/2007

12:33 PM

Page 12

Rat lumbar ventral horn

(A) Oligonucleotide (µM)

Rat

(C)

(E)

9 6 3

(B)

Lumbar cord

Thoracic cord

Cerivical cord

Left cortex

Brain stem

Right cortex

0

Rhesus monkey

Isis13920treated

50 µm

Oligo treated secondary antibody only

Salinetreated

Rhesus monkey ventral horn (F)

Anti-oligo astrocyte

Anti-GFAP astrocyte

(G)

Oligo-treated

Oligonucleotide (µM)

(D)

12

12 9 6 50 µm

50 µm

3

Lumbar cord

Thoracic cord

Cerivical cord

Brain stem

Left cortex

Right cortex

(I)

Saline-treated

(H)

0

50 µm

50 µm

Rhesus monkey brain (J) Hippocampus Pyramidal neuron

(K)

Substantia nigra Dendritic neuron

(I)

Pons

(M)

Cerebellum

Pontine nucleus Granular neuron

Dentate granular neuron

60 µm

50 µm

50 µm

Purkinje cell

50 µm

Figure 26.1 Distribution of antisense oligonucleotides after infusion into the right lateral ventricle in rat and Rhesus monkey. (A, B) Antisense oligonucleotides were continuously infused at 100 g/day (A) or 1 mg/day (B) for 2 weeks via infusion pump into the right lateral ventricle of (A) normal rats or (B) Rhesus monkey. Tissues were collected and extracts of them analyzed for oligonucleotide content by capillary gel electrophoresis. Mean values ± standard deviations are shown (A) n ⫽ 6; (B) n ⫽ 2. (C–G) A 24-mer-modified oligonucleotide Isis13920 was infused for two weeks into the right lateral ventricle at 100 g/day in (C–E) rats or 1 mg/day in (F–M) Rhesus monkey. After perfusion, distribution of the oligonucleotide was determined by immunohistochemistry using a monoclonal antibody that recognizes the oligonucleotide (C–E, F, H) or astrocytes (GFAP; G, I). No oligonucleotide staining was seen in animals (D, H) infused with saline only or (E) an oligonucleotide infused animal but using secondary antibody only. Bar, 50 nm. (Copyright 2006 by American Society for Clinical Investigation. Reproduced with permission of American Society for Clinical Investigation in the format Textbook via Copyright Clearance Center.)

Antisense Drug Technology: Principles, Strategies, and Applications, Second Edition

Antisense Drug Technology: Principles, Strategies and Applications

Antisense Drug Technology: Principles, Strategies, and Applications

Coated Textiles: Principles and Applications - Principles and Applications, Second Edition

Drug Delivery: Principles and Applications

Ecological Economics, Second Edition: Principles and Applications

Biomechanics: Principles and Applications, Second Edition

Satellite technology: principles and applications

Basic Principles of Membrane Technology, Second Edition

Satellite Technology: Principles and Applications

Ophthalmologic Drug Guide, Second Edition

Laser Technology, Second Edition

Technology Guide: Principles, Applications, Trends

Drug Safety Evaluation Second Edition

Drug Abuse Handbook, Second Edition

Membrane Separations Technology: Principles and Applications

Biopharmaceutical Drug Design and Development Second Edition

Principles and Modern Applications of Mass Transfer Operations, Second Edition

Radio Frequency Transistors, Second Edition: Principles and Practical Applications

Computational Fluid Dynamics: Principles and Applications, Second Edition:

Drug Discovery Strategies and Methods

DRUG DISCOVERY STRATEGIES AND METHODS

Principles of Turbomachinery - Second Edition

Teaching by Principles, Second Edition

Principles of Neuropsychology , Second Edition

Principles of Hydrogeology, Second Edition

Electrical principles - second edition (1958)

Principles of Turbomachinery - Second Edition

Security Analysis: Principles and Technique, Second Edition

Technology of Breadmaking Second Edition

Carotid Endarterectomy: Principles and Technique, Second Edition

Antisense Drug Technology: Principles, Strategies, and Applications, Second Edition