Sika Deer: Biology and Management of Native and Introduced Populations

Sika Deer

Dale R. McCullough • Seiki Takatsuki Koichi Kaji Editors

Sika Deer Biology and Management of Native and Introduced Populations

Editors Dale R. McCullough Professor Emeritus Department of Environmental Science, Policy, and Management and Museum of Vertebrate Zoology University of California, Berkeley California 94720-3114 USA

Koichi Kaji Department of Ecoregion Science Laboratory of Wildlife Conservation Tokyo University of Agriculture and Technology 3-5-8 Saiwaicho Fuchu, Tokyo 183-8509 Japan

Seiki Takatsuki Laboratory of Wildlife Ecology and Conservation Azabu University 1-17-71 Fuchinobe Sagamihara, Kanagawa 229-8501 Japan

Front cover: Top: Male sika deer and (bottom) a group of grazing sika deer. Photos by D. R. McCullough. Back cover: Top left: A male during the rut. Top right: A female grooming her fawn in late winter. Bottom: A female and her fawn in early summer. Photos by S. Takatsuki. All photographs are from Kinkazan Island, northern Japan.

ISBN: 978-4-431-09428-9 Springer Tokyo Berlin Heidelberg New York e-ISBN: 978-4-431-09429-6 DOI: 10.1007/978-4-431-09429-6 Library of Congress Control Number: 2008934594 © Springer 2009 Printed in Japan This work is subject to copyright. All rights are reserved, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in other ways, and storage in data banks. The use of registered names, trademarks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. Printed on acid-free paper Springer is a part of Springer Science+Business Media springer.com

Preface

This book reviews in detail the sika deer of eastern Asia to bring together under one cover a compilation of the growing literature on this fascinating animal of such great ecological and economic importance. The sika deer is important not only in its native range of east Asia, but also in the many parts of the world where it has been introduced, and become a naturalized member of the fauna, for better or worse. The literature on sika deer is widely scattered and in many different languages, including Japanese, Russian, Chinese, and Vietnamese. This literature is difficult for most readers to access and, for practical purposes, the information does not exist, despite the fact that some of the best research on deer in the world is now being done by Japanese scientists and scattered researchers in other parts of the sika deer’s Asiatic range are accumulating information on local populations. Consequently, sika deer remain rather poorly known, even among experienced deer biologists, despite their importance in the affairs of humans in many countries and cultures and this growing knowledge. Our purpose in producing this book is to compile and integrate the immense amount of knowledge of sika deer in one source. It is directed primarily towards biologists, conservationists, and hunters. However, most interested lay readers may profitably gain from a reading. Although the subject matter is science, the presentation is made at a level that any reasonably well-read person can access the essential information. This book emphasizes sika deer as a wild species and/or conservation issue, and lesser attention has been given to the sika as a domestic species despite large numbers being raised in captivity in many countries. It is organized into six parts. Part I introduces the basic biology of the species, its origins and evolution, genetic structure, physiology, nutrition, and reproduction. The next three parts discuss food and habitat relations (Part II), behavior, migration, and breeding systems (Part III), and population dynamics and management (Part IV). Most work on sika deer has been done in Japan, and it is appropriate that this area predominates in the coverage—a simple numerical decision. Part V covers sika deer in the remainder of their native range on the Asian continent in China, North Korea, Vietnam, and Far East Russia, and on the island of Taiwan. The last part (Part VI) covers the many introduced and naturalized populations of sika deer around the world. v

vi

Preface

In seeking authors for the various chapters we have attempted to gather together the most recognized experts on each topic. We have asked independent workers to collaborate in new ways to optimize the expertise and coverage to achieve an integration of all that is known about the sika deer in one book. The organization of the book by biology and distribution themes inevitably results in some overlap of subject matter between parts. For example, the topic of reproduction reoccurs in nearly every part of the book. This should remind us that placing subjects into categories violates the reality that sika deer are whole entities, with completely integrated physical and biological systems connected with real climates, topography, vegetation, competitors, and predators. So, in many ways this book reads more like a symposium volume than an easy overview of the species. To assist the reader through the material we have begun each chapter with an abstract, a brief synopsis to help put the chapter in perspective. At the same time we have tried to take advantage of the multiple overlapping studies to use a comparative approach to advantage. For example, there are many studies now available of sika deer populations on islands or isolated populations in various parts of the range, and we have included many of these to extract the lessons to be learned from comparative work. We have erred on the side of completeness, so that this will be the reference work that serves to give thorough insight into the species, rather than a summary work predigested for the casual reader. Nonetheless, the more general reader can pick and choose to achieve the latter goal. We ask the reader’s indulgence and trust by the end of the book the desired integration, still retaining important nuance, will have been achieved. Dale R. McCullough

Acknowledgements

I, along with my co-editors, Seiki Takatsuki and Koichi Kaji, wish to thank the following people for their indispensable contributions to the completion of the book. First, we thank all of the authors for their giving of their expertise and time to write chapters and appreciate their patience with the process of give and take in shaping the needs of each chapter to the larger goal of an integrated whole. My long-time administrative assistant, Margaret Jaeger, who has suffered through a number of previous book efforts with me, was once again her stalwart self, clarifying meaning, checking details, catching errors, keeping track of things, and generally supporting the effort. Without her assistance and guidance this project could not have been completed. Thanks once again, Margaret, for a job well done. Mayuko Tanigawa helped with early coordination between Japanese authors and we three editors and Margaret. Karen Klitz, illustrator for the Museum of Vertebrate Zoology at Berkeley, checked the illustrations and made changes when necessary for legibility and style. She also drew some new map figures to complete the work. Aiko Hiraguchi, Executive Editor for Life Sciences of Springer Japan was most helpful in bringing the book to publication. Her patience, understanding, and continued support of the project were much appreciated. I thank my co-editors, Seiki Takatsuki and Koichi Kaji, for their indispensable assistance in identifying appropriate Japanese authors, organizing book planning meetings, encouraging authors to write, and helping me negotiate the cultural gaps in ways of doing things between cultures. Their dedication and expertise, and long experience with research on sika deer, were critical to the conception and production of this book. For reading and commenting on all or parts the draft book manuscript we thank George Bubenik, Paul Krausman, and John Kie. We are indebted for financial support. The A. Starker Leopold Endowed Chair at the University of California, Berkeley, of which Dale R. McCullough was the chair-holder, was the main support for preparation of the book. We also thank the Ninth International Mammal Congress planning committee for making additional funds available to help complete the book. To all of the above we give our heartfelt appreciation and we hope that the outcome justifies their contributions. vii

Contents

1

Introduction .............................................................................................. Dale R. McCullough

1

Part I Basic Biology 2

Fossil Record of Sika Deer in Japan ...................................................... Yoshinari Kawamura

3

Two Genetically Distinct Lineages of the Japanese Sika Deer Based on Mitochondrial Control Regions ............................................. Junco Nagata

27

Evolutionary Significance of Admixture and Fragmentation of Sika Deer Populations in Japan ......................................................... Hidetoshi B. Tamate

43

Nutritional Physiology of Wild and Domesticated Japanese Sika Deer .................................................................................. Takayoshi Masuko and Kousaku Souma

61

4

5

6

Endocrinology of Sika Deer .................................................................... Kiyoshi Yamauchi and Yukiko Matsuura

7

Reproduction of Female Sika Deer in Japan, with Special Reference to Kinkazan Island, Northern Japan................................... Nobumasa Ohnishi, Masato Minami, Rie Nishiya, Kotoyo Yamada, Hiroyuki Nishizuka, Hiroshi Higuchi, Azusa Nara, Masatsugu Suzuki, and Seiki Takatsuki

11

83

101

ix

x

Contents

Part II Food and Habitat Relations 8 Food Habits of Sika Deer on Kinkazan Island, Northern Japan with Reference to Local Variations, Size Effects, and Comparison with the Main Island ................................................ Seiki Takatsuki and U. K. G. K. Padmalal

113

9 Plants and Plant Communities on Kinkazan Island, Northern Japan, in Relation to Sika Deer Herbivory ........................ Seiki Takatsuki and Takehiko Y. Ito

125

10 Productivity and Foraging Efficiency of the Short-Grass (Zoysia japonica) Community for Sika Deer ....................................... Takehiko Y. Ito, Mariko Shimoda, and Seiki Takatsuki

145

11 Home Range, Habitat Selection, and Food Habits of the Sika Deer Using the Short-Grass Community on Kinkazan Island, Northern Japan ...................................................................................... Takehiko Y. Ito and Seiki Takatsuki 12 Shift to Litterfall as Year-Round Forage for Sika Deer after a Population Crash ................................................................................ Masami Miyaki and Koichi Kaji 13

The Dynamics of Forest Stands Affected by Sika Deer on Nakanoshima Island—Change of Size Structure Similar to the Thinning Effect............................................................................ Masami Miyaki and Koichi Kaji

159

171

181

14 Biology of Sika Deer in Hyogo: Characteristics of Reproduction, Food Habits, Growth, and Condition ......................... Mayumi Yokoyama

193

15 Bark-Stripping Preference of Sika Deer and Its Seasonality on Mt. Ohdaigahara, Central Japan .............................. Masaki Ando and Ei’ichi Shibata

207

16 North-South Variations in Sika Deer Ecology as a Forest-Dwelling Cervid ................................................................. Seiki Takatsuki

217

17 Geographical Variations in Food Habits of Sika Deer: The Northern Grazer vs. the Southern Browser ................................ Seiki Takatsuki

231

Contents

xi

18 What Is “Natural” Vegetation? A Reconsideration of Herbivory by Wild Ungulates .......................................................... Seiki Takatsuki

239

Part III Behavior: Migration and Breeding Systems 19 Seasonal Migration of Sika Deer on Hokkaido Island, Japan .......... Hiromasa Igota, Mayumi Sakuragi, and Hiroyuki Uno

251

20 Migratory and Sedentary Behavior Patterns of Sika Deer in Honshu and Kyushu, Japan ............................................................ Tsuneaki Yabe and Seiki Takatsuki

273

21 Variation in Mating Behavior of Sika Deer: Mating Behavior of Sika Deer on Nozaki Island .............................................................. Akira Endo

285

22 Reproductive Ecology of Sika Deer on Kinkazan Island, Northern Japan: Reproductive Success of Males and Multi-Mating of Females ............................................................... Masato Minami, Nobumasa Ohnishi, Ayumi Okada, and Seiki Takatsuki

297

23 Life-Time Reproductive Success of Female Sika Deer on Kinkazan Island, Northern Japan .................................................. Masato Minami, Nobumasa Ohnishi, Naoko Higuchi, Ayumi Okada, and Seiki Takatsuki 24

Reproduction of Female Sika Deer in Western Japan ....................... Toru Koizumi, Shin-ichiro Hamasaki, Mayumi Kishimoto, Mayumi Yokoyama, Masato Kobayashi, and Aiko Yasutake

319

327

Color Plates Part IV

Population Dynamics and Management

25 Sika Deer in Nara Park: Unique Human-Wildlife Relations ............ Harumi Torii and Shirow Tatsuzawa 26 A 20-Year History of Sika Deer Management in the Mt. Goyo Area, Northern Honshu............................................. Seiki Takatsuki

347

365

xii

Contents

27 Survival Patterns of Male and Female Sika Deer on Kinkazan Island, Northern Japan .................................................. Masato Minami, Nobumasa Ohnishi, and Seiki Takatsuki

375

28 Sika Deer in an Evergreen Broad-Leaved Forest Zone on the Boso Peninsula, Japan ............................................................... Masahiko Asada and Keiji Ochiai

385

29 Sika Deer Population Irruptions and Their Management on Hokkaido Island, Japan ................................................................... Hiroyuki Uno, Koichi Kaji, and Katsumi Tamada

405

30 Irruptive Behavior of Sika Deer ........................................................... Koichi Kaji, Hiroshi Takahashi, Hideaki Okada, Masao Kohira, and Masami Yamanaka

421

31 The Management of Sika Deer Populations in Hyogo Prefecture, Japan ................................................................... Hiroshi Sakata, Shin-ichiro Hamasaki, and Hiromune Mitsuhashi

437

32 Management Strategy of Sika Deer Based on Sensitivity Analysis ........................................................................... Shingo Miura and Kunihiko Tokida

453

Part V

Sika in Mainland Asia and Taiwan

33 Sika Deer in Russia ................................................................................ Vladimir V. Aramilev 34 Sika Deer Distribution Changes at the Northern Extent of Their Range in the Sikhote-Alin Mountains of the Russian Far East ................................................................................................... Inna V. Voloshina and Alexander I. Myslenkov

475

501

35 Sika Deer in Mainland China ............................................................... Dale R. McCullough, Zhi-Gang Jiang, and Chun-Wang Li

521

36 Sika Deer in Korea and Vietnam ......................................................... Dale R. McCullough

541

37 Sika Deer in Taiwan............................................................................... Dale R. McCullough

549

38

The Present Status of the Re-introduced Sika Deer in Kenting National Park, Southern Taiwan ....................................... Kurtis Jai-Chyi Pei

561

Contents

xiii

Part VI Introduced Sika Deer 39 Sika Deer in Continental Europe ......................................................... Luděk Bartoš

573

40 Sika Deer in the British Isles ................................................................ Graeme M. Swanson and Rory Putman

595

41 Free–Ranging and Confined Sika Deer in North America: Current Status, Biology, and Management ......................................... George A. Feldhamer and Stephen Demarais

615

42 The Sika in New Zealand ...................................................................... D. Bruce Banwell

643

Index ...............................................................................................................

657

Contributors

Ando, Masaki Research Associate, Department of Ecology and Environmental Science, Faculty of Applied Biological Science, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan Aramilev, Vladimir V. Scientist, Laboratory of Nature Resources Use, Pacific Institute of Geography, Far-Eastern Branch, Russian Academy of Science, Radio Street 7, 690041 Vladivostok, Russia Asada, Masahiko Senior researcher, Natural History Museum and Institute, 955-2 Aoba-cho, Chuo-ku, Chiba 260-8682, Japan Banwell, D. Bruce Author about deer in New Zealand, Na Fiadh, 39 Lane Street, Allenton, Ashburton, Canterbury 7700, New Zealand Bartoš, Luděk Professor of Ethology, Department of Ethology, Institute of Animal Science, Přátelství 815, Praha Uhříněves, Czech Republic Demarais, Stephen Professor of Wildlife Management, Department of Wildlife and Fisheries, Mississippi State University, Mississippi State, Mississippi 39762, USA Endo, Akira Researcher, Department of Applied Biological Sciences, Faculty of Agriculture, Saga University, 1 Hongo, Saga 840-8502, Japan Feldhamer, George A. Professor of Zoology, and Director of the Environmental Studies Program, Department of Zoology MC 6501, Southern Illinois University, Carbondale, Illinois 62901, USA Hamasaki, Shin-ichiro Chief of Kansai Branch, Wildlife Management Office, 4-10-6 Fujiwaradaiminamimachi, Kita-ku, Kobe 651-1303, Japan xv

xvi

Contributors

Higuchi, Hiroshi Kinkazan Deer Research Group, c/o Picchio Wildlife Community Institute, 1549-3-1 Oiwake, Karuizawa, Nagano 389-0115, Japan Higuchi, Naoko Graduate Student, Laboratory of Functional Animal Ecology, Department of Biology and Geosciences, Graduate School of Science, Osaka City University, 3-3-138 Sugimoto, Sumiyoshi-ku, Osaka 558-8585, Japan Igota, Hiromasa Assistant Professor, Department of Biosphere and Environmental Sciences, Faculty of Environmental Systems, Rakuno Gakuen University, 582 Bunkyodai-midorimachi, Ebetsu, Hokkaido 069-8501, Japan Ito, Takehiko Y. Assistant Professor, Arid Land Research Center, Tottori University, 1390 Hamasaka, Tottori 680-0001, Japan Jiang, Zhi-Gang Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, China Kaji, Koichi Professor, Department of Ecoregion Science, Laboratory of Wildlife Conservation, Tokyo University of Agriculture and Technology, 3-5-8 Saiwaicho, Fuchu, Tokyo 183-8509, Japan Kawamura, Yoshinari Professor of Paleontology and Stratigraphy, Department of Earth Sciences, Aichi University of Education, Kariya, Aichi 448-8542, Japan Kishimoto, Mayumi Researcher of Kansai Branch, Wildlife Management Office, 4-10-6 Fujiwaradaiminamimachi, Kita-ku, Kobe 651-1303, Japan Kobayashi, Masato Student at Laboratory of Forest Ecology, Faculty of Agriculture, Kyoto University, Kitashirakawaoiwake-cho, Sakyo-ku, Kyoto 606-8502, Japan Kohira, Masao Head of Conservation and Management Section and Senior Researcher, Shiretoko Nature Foundation, 531 Iwaobetsu, Shari-chou, Hokkaido 099-4356, Japan Koizumi, Toru Director of Department of Wildlife Biology, Department of Wildlife Biology, Forest and Forest Products Research Institute, 1 Matsunosato, Tsukuba, Ibaraki 305-8687, Japan

Contributors

xvii

Li, Chun-Wang Associate Professor, Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China Masuko, Takayoshi Professor, Faculty of Bioindustry, Tokyo University of Agriculture, Abashiri, Hokkaido 099-2493, Japan Matsuura, Yukiko Field Science Center for Northern Biosphere, Hokkaido University, Kita 9, Nishi 9, Kita-ku, Sapporo, Hokkaido 060-0809, Japan McCullough, Dale R. Professor Emeritus, Department of Environmental Science, Policy, and Management, and Museum of Vertebrate Zoology, University of California, Berkeley, California 94720-3114, USA Minami, Masato Director, Wildlife Community Institute, 1549-3-1 Oiwake, Karuizawa, Nagano 389-0115, Japan Mitsuhashi, Hiromune Assistant Professor, Institute of Natural and Environmental Sciences, University of Hyogo, 6 Yayoigaoka, Sanda, Hyogo 669-1546, Japan Miura, Shingo Professor, School of Human Sciences, Waseda University, 2-579 Migashima, Tokorozawa, Saitama 359-1192, Japan Miyaki, Masami Director of Conservation Department, Hokkaido Institute of Environmental Sciences, Kita 19, Nishi 12, Kita-ku, Sapporo, Hokkaido 060-0819, Japan Myslenkov, Alexander I. Department of Science, Lazovsky State Nature Reserve, Centralnaya, 56, Lazo, Primorsky Krai 692980, Russia Nagata, Junco Forestry and Forest Products Research Institute, Tsukuba, Ibaraki 305-8687, Japan Nara, Azusa Kinkazan Deer Research Group, Wildlife Community Institute, 1549-3-1 Oiwake, Karuizawa, Nagano 389-0111, Japan Nishiya, Rie Wild Bird Observation Center of Mt. Zao, 162-1 Uenohara, Zao-machi, Miyagi 989-0800, Japan

xviii

Contributors

Nishizuka, Hiroyuki Kinkazan Deer Research Group, Wildlife Community Institute, 1549-3-1 Oiwake, Karuizawa, Nagano 389-0111, Japan Ochiai, Keiji Senior researcher, Natural History Museum and Institute, Chiba, 955-2 Aoba-cho, Chuo-ku, Chiba 260-8682, Japan Ohnishi, Nobumasa Senior Researcher, Eco-planning Research Co. Ltd., 2-28-5 Sakaemachi, Higashimurayama, Tokyo 189-0013, Japan Okada, Ayumi Lecturer, Department of Environmental Bioscience, School of Veterinary Medicine, Kitasato University, 23-35-1 Higashi, Towada, Aomori 034-8628, Japan Okada, Hideaki Deputy Director and Senior Researcher, Shiretoko Nature Foundation, 531 Iwaobetsu, Shari-chou, Hokkaido 099-4356, Japan Padmalal, U.K.G.K. Head, Post Graduate Studies, Environmental Sciences Open University of Sri Lanka, Nawala, Negegoda, Sri Lanka Pei, Kurtis Jai-Chyi Professor of Wildlife Ecology and Management, Institute of Wildlife Conservation, National Pingtung University of Science and Technology, Neipu, Pingtung 91201, Taiwan Putman, Rory Professor of Behavioural and Environmental Biology (Emeritus at the Manchester Metropolitan University), Keil House, Ardgour, by Fort William, Inverness-shire PH33 7AH, Scotland Sakata, Hiroshi Associate Professor, Institute of Natural and Environmental Sciences, University of Hyogo, 940 Sawano, Aogaki, Tanba, Hyogo 669-3842, Japan Sakuragi, Mayumi Laboratory of Boreal Forest Conservation, Field Science Center for Northern Biosphere, Hokkaido University, Kita 9, Nishi 9, Kita-ku, Sapporo, Hokkaido 060-8589, Japan Shimoda, Mariko Graduate School of Agriculture and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan Shibata, Ei’ichi Professor of Forestry, Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa-ku, Nagoya 464-8601, Japan

Contributors

xix

Souma, Kousaku Assistant Professor, Faculty of Bioindustry, Tokyo University of Agriculture, Abashiri, Hokkaido 099-2493, Japan Suzuki, Masatsugu Professor, Laboratory of Zoo and Wildlife Medicine, Faculty of Applied Biological Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan Swanson, Graeme Christ’s College, Rolleston Avenue, Christchurch, New Zealand Tamada, Katsumi Researcher, Nature Conservation Department, Hokkaido Institute of Environmental Sciences, Kita 19, Nishi 12, Kita-ku, Sapporo, Hokkaido 060-0819, Japan Tamate, Hidetoshi B. Department of Biology, Faculty of Science, Yamagata University, 1-4-12 Kojirakawa, Yamagata 990-8560, Japan Takahashi, Hiroshi Kansai Research Center, Forestry and Forest Products Research Institute, Fushimi-ku, Kyoto 612-0855, Japan Takatsuki, Seiki Professor, Laboratory of Wildlife Ecology and Conservation, Azabu University, 1-17-71 Fuchinobe, Sagamihara, Kanagawa 229-8501, Japan Tatsuzawa, Shirow Assistant Professor, Research Group of Regional Sciences, Graduate School of Letters, Hokkaido University, Kita 10, Nishi 7, Kita-ku, Sapporo, Hokkaido 060-0810, Japan Tokida, Kunihiko Senior Scientist, Japan Wildlife Research Center, 3-10-10 Sitaya, Taitou-ku, Tokyo 110-8676, Japan Torii, Harumi Associate Professor, Education Center for Natural Environment, Nara University of Education, Takabatake, Nara 630-8528, Japan Uno, Hiroyuki Nature Conservation Department, Hokkaido Institute of Environmental Sciences, Kita 19, Nishi 12, Kita-ku, Sapporo, Hokkaido 060-0819, Japan Voloshina, Inna V. Department of Science, Lazovsky State Nature Reserve, Centralnaya, 56 Lazo, Primorsky Krai 692980, Russia

xx

Contributors

Yabe, Tsuneaki Kyushu Research Center, Forestry and Forest Products Research Institute, 4-11-16 Kurokami, Kumamoto 860-0862, Japan Yamada, Kotoyo Kinkazan Deer Research Group, c/o Picchio Wildlife Research Center Co. Ltd. 2148 Nagakura, Karuizawa, Nagano 389-0111, Japan Yamanaka, Masami Director and Chief Researcher, Shiretoko Nature Foundation, 531 Iwaobetsu, Shari-chou, Hokkaido 099-4356, Japan Yamauchi, Kiyoshi Technical Researcher, Natural Environment Laboratory, Department of Earth Science, Research Institute for Environmental Science and Public Health of Iwate Prefecture (I-RIEP), 1-36-1 Iiokashinden, Morioka, Iwate 020-0852, Japan Yasutake, Aiko Researcher of Kansai Branch, Wildlife Management Office, 4-10-6 Fujiwaradaiminamimachi, Kita-ku, Kobe 651-1303, Japan Yokoyama, Mayumi Institute of Natural and Environmental Sciences, Wildlife Management Research Center, University of Hyogo, 940 Sawano, Aogaki, Tanba, Hyogo 669-3842, Japan

Chapter 1

Introduction Dale R. McCullough

Abstract The sika deer (Cervus nippon) is an important member of the native fauna in eastern Asia, and it has been widely introduced into many other parts of the world. It has an interesting paleogeographic history, having reached the Japanese Islands and Taiwan during low sea level periods. It has a long history of close association with humans, both positive and negative, given that its preferred habitat is also prime agricultural and developmental land for humans. In this respect, sika deer are similar to secondary-successional deer species in North America and Europe. However, sika deer have the ability to cause damage to crops and forests, as well as to their own habitats, that far exceed those of comparable deer in other parts of the world. In different parts of their range sika deer are over-abundant, or extinct in the wild. They are commonly raised in captivity for their antlers. Consequently, they present an unusually wide array of evolutionary, ecological, and management issues. We begin with the question, what is the sika deer? Peruse any book of Japanese or Chinese art, and within a few pages you will encounter a landscape painting with a graceful spotted deer surveying its world from beneath the pendant leaves of a luxurious tree. This deer, the sika, is an icon of nature in the far eastern rim of the Asian continent—from Vietnam in the south, through China and Korea to Russia in the north, and on the continental islands of Taiwan and the Japanese Archipelago— where it holds almost a religious status. Indeed, it is the sacred deer of Japan where it occupies the sanctuary grounds surrounding many Shinto shrines and temples. An ancient legend says that a god rode into Nara Temple near Kyoto (probably the most famous temple in Japan, which has numerous sika deer yet today) on the back of a sika deer. The English-speaking world knows this beautiful deer as the “sika deer.” “Sika” is the Japanese word for deer (although pronounced “she-ka”), so this linguistic hybrid results in a redundant deer-deer. Nevertheless, “sika deer” is so ingrained in the western literature that it is rather pointless to urge adoption of the simpler, and more correct, “sika.” The deer’s more evocative and descriptive Chinese name, my hwa lu, means “white-flower deer.” This name refers to the white spots arrayed over the body that are particularly apparent in the summer coat.

D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_1, © Springer 2009

1

2

D. R. McCullough

The elegant pattern of white spots against a rusty red background—which seems to be the work of an artist—evolved as concealment in forests where the white spots mimic the splotches of light on the forest floor produced by sunlight filtered through the canopy leaves of a broad-leaved forest. It can be surprisingly cryptic in this environment despite being so vivid in open land habitats. This pattern of light is characteristic of deciduous broad-leaved forests. Although the sika deer occupies some coniferous forests, particularly at the higher elevations and northern edges of its distribution, this animal is essential a denizen of the broad-leaved forest regions of southeastern Asia. This spotted pattern is found in young fawns of many members of the deer family in which the vulnerable newly born avoid detection by predators by lying quietly concealed in the vegetation of the forest floor. In the wintertime, when the leaves of broad-leaved trees are cast, the patterning of light in the forest is less spotty and, predictably, the spots of the sika deer in winter coat are either lost (in the north where conifers or deciduous broad-leaved trees predominate), or become diffuse (in the south where semitropical broad-leaved trees do not cast their leaves in autumn). The retention of juvenile spots by adults in the sika deer contributes to the esthetics of the species—a correlate of the Bambi syndrome. Also important is the slender body form and graceful movements, again adaptations to traversing a forested environment with many tree trunks, woody shrubs, downed logs, and other obstructions of a natural forest. While the sika deer is a beautiful, and seemingly fragile, part of a munificent and peaceful nature, when saturated by male hormones during the fall rut the males are transformed into super-aggressive fighting machines, literally slavering from the mouth. The male deer of all species undergo these changes during rut, but none to the extreme that the sika deer does. Most people think of the sika deer as a deep forest animal, and it is true that this deer is dependent on forests for escape cover. Still, this is a misrepresentation of the preferred habitat of sika. An equally important need is areas where the mature forest has been disturbed. Sika deer are an “edge” species that meets life requirements from different kinds or stages of habitat. Although sika deer are dependent on forest cover to evade enemies, and sometimes climatic extremes, they are equally dependent on disturbed areas where, because sunlight reaches the ground level and plant competition is reduced, the nutritional quality of the forage is appreciably higher. Like with the white-tailed deer (Odocoileus virginianus) in North America, the roe deer in Europe (Capreolus capreolus) and Asia (C. pygargus), some of the muntjacs (Muntiacus), and a few other deer species, the sika deer thrives in forests with a mix of different habitats—either separate vegetation types or different stages of succession within a vegetation type. Their evolutionary history was shaped through opportunities presented by the mosaic in the forest created by natural disasters—fires, wind storms, floods, etc.—which were the original source of forest disturbance and renewal. In such landscape mosaics the sika deer can shift about to satisfy different requirements for survival. Edge species of deer, in response to natural predators, often spend the daylight hours secreted in the forests, and venture out at night to feed in the disturbed areas where during daylight they would be exposed to detection.

1

Introduction

3

Since the ascendance of modern humans with their activities of burning, cultivating, and forest cutting, human impacts have supplemented, if not largely supplanted, the natural processes of disturbance. Humans, too, have benefited from the mosaic of vegetation across the landscape that furnish their separate requirements for food, fuel, and shelter. It is neither accidental, nor surprising, that deer preferring disturbed environments with lots of edges between different kinds of vegetation capitalized on the alterations of humans and became closely associated with them. For the deer, the disturbed areas, particularly enhanced by the presence of human-grown crops, proved highly attractive feeding areas yielding superior nutrition. Sika deer and humans have lived in close proximity in Asia for much longer than edge-occupying deer in other parts of the world. Throughout their range in Asia sika deer and humans have had almost identical habitat preferences, and the best habitats for sika are the best environments for agricultural development. Indeed, agricultural development has come at the expense of, or benefit to sika deer, depending upon the technology of humans to exploit or control the deer. It is notable that in Japan, the wolf (Canis lupus) was considered a sacred animal for most of its history because it protected the crop fields of early humans from the ravages of sika deer (Knight 2003; Walker 2005). Only later—when humans invented firearms and gained the ability to directly control sika deer, rabies was accidentally introduced to Japan (with consequent rabid-wolf attacks on people), and wolves attacked the stock of the fledgling livestock industry—that wolves went from being sacred animals to being big, bad wolves. Thus, for the last century, sika deer and humans have been on a collision course, and this nexus of human civilization and sika deer population density persists because of their need for the same environments, often for the same reasons. Usually it has worked to the detriment of sika deer, and they have been severely reduced or driven to extinction in the wild over much of the non-Russian part of the mainland distribution, and in Taiwan. But even where extirpation has occurred, the tie of sika deer to humans continues; they are commonly raised in captivity, in China for several thousand years, to supply the demand for “panty” (velvet antler) for the Asian medicine market. Perhaps this long history of cohabitation at least partially accounts for the sika deer’s extraordinary capacity to negatively impact its own habitats. Most edge-species of deer show tendencies towards boom-bust population trajectories—depending on the amount and frequency of forest disturbance—with consequent time lags between numbers and food resources (“irruptive” population behavior; see review of McCullough (1997) ). At highs in these population fluctuations it is common that excessive consumption by deer has unsustainable impacts on the vegetation. No other deer, however, can match the sika in its ability to strip the vegetation bare and expose soils to massive erosion—thereby creating a wasteland. Many other species suppress young woody plants (and, consequently, subsequent forest tree composition), and a few strip bark from small, fast-growing trees such as aspen. Only sika deer peel the bark off large, fully mature forest trees, sometimes killing by girdling trees with a diameter of over a meter in size. Many deer follow the sound of

4

D. R. McCullough

chainsaws in winter to feed on the twigs and small stems of felled trees. Only the voracious sika deer peels the bark off of the trunks as well. Most such foods are considered starvation rations, and they are eaten only in the winter when alternative foods are absent. But once again, sika deer stretch the envelope. They sometimes strip bark off of the trunks of mature trees in the summertime when alternative foods of greatest quality are most available. Why? From this feeding behavior and consequent destructive capacity it is apparent that sika deer were “managing” forests long before human beings arrived upon the scene. When mature forests dominated the landscape, and naturally disturbed areas were small patches in the forest matrix, sika deer probably were at low numbers and influenced forest vegetation mainly by delaying the succession of openings through their feeding effects on the vegetation. The earlier “balance-of-nature” views of ecology proposed that predators regulated sika deer and other herbivores within rather narrow limits and maintained balances between plants, herbivores, and carnivores. Such simplistic explanations for nature have been largely dispelled by research experience with ecosystem processes, which are not nearly so neat and precise. Natural systems are much messier, replete with time lags, and don’t conform much to balance-of-nature paradigms. Indeed, the very idea of such a precise balance and order in nature is more a belief of a quasi-religious nature. Even the proposition that such a balance is apparent over only larger landscape scales and time scales is being dispelled by a rapidly growing knowledge of paleobiology—the study of deep time horizons. Such studies are overwhelmingly showing that the only constant in nature is change. Such neat balances between ecosystem components and integrity of natural communities are products of our limited lifetimes, which allow our imaginations to impose on nature an orderliness by how we perceive it, think about it, map it, and catalog it. Although we probably underestimate the degree and kind of disturbance that went on in natural forests, there is no doubt that in the modern world humans have altered forests over a shorter time and to a greater extent than is typical in the paleobiology record. No longer is the “undisturbed” (mature forest) forest the matrix and the disturbed areas the isolated patches; now, the mature forest occurs only as isolated patches in the matrix of disturbed area. In other words, the matrix and patches have been transposed (McCullough 1996). Having been selected strongly for exploiting naturally disturbed patches in mature vegetation, there was little counterselection on sika deer for not overdoing it when humans altered landscapes on a massive scale. Rather than being distributed in relatively rare patches, ideal sika deer habitat is the matrix, and the large sika populations favored (where they are not overexploited by hunting) are probably having effects on the remaining mature forest patches of a magnitude that was rare in the pre-civilization human world. Over most of human history local tribes influenced the abundance of deer by hunting. These hunters were severely limited in their effect on deer populations by their stone-age technology. For the humans in such early landscapes, losing some crops to deer could be balanced by hunting and eating the deer. The cost-benefit ratios on both sides were favorable so long as a reasonable balance—a sort of sharing of the joy and pain—was struck. When things got out of whack—too little or too

1

Introduction

5

much hunting success—either deer or humans suffered disproportionately; but there were consequences for both. Only with the development of modern technology—guns, traps, etc.—has it become routinely possible for humans to overexploit sika deer populations, and in some areas (Vietnam, Taiwan) drive them to extinction in the wild, despite the abundance of ideal habitat created by human disturbances. Just as vegetation mosaics are important to sika deer on a fine spatial and time scale, they also have been important on a broad spatial and time scale. Geographically sika deer inhabit the eastern fringes of the Asian continent, and their evolution has been greatly influenced by geological and climatic processes. On a north-south axis, sika deer occupy a band of land on the eastern edge of the Asian continent. They are found mainly on low-elevation plains and surrounding hills and lower reaches of mountains. Their habitats vary from the tropical and semitropical jungles of Vietnam to broad-leaved deciduous forests of Far East Russia and northern Japan. Climates vary from tropical in the south to cold and snowy winters in the north. Their greatest extension westward to the inland of the continent occurred in China in the Sichuan Basin, which although at much higher elevation, has habitat characteristics similar to more coastal areas. Recent studies of sika deer mitochrondrial DNA (Goodman et al. 2001) show that the species is split broadly into a northern and a southern type, and these differences have an evolutionary and genetic basis. In the south they are relatively small in body size and have more similar summer and winter coats. They are nonmigratory, non-winter adapted, and feed predominantly on evergreen broad-leaved plants (Takatsuki 1991). In the northern parts of their range, conversely, climate, especially snow depth, sets the limit to their northern distribution. They have large body sizes, and the summer and winter coats are substantially different. They use mountainous areas, migrate from low-elevation winter areas to high-elevation summer areas, and are adapted to winter conditions. In winter they feed mainly on grasses (Takatsuki 1991). During the Pleistocene repeated climatic fluctuations shifted the latitudinal distribution northwards and southwards, accordion-like, as cold climates pushed southward and then retreated northward. On an east-west axis sea level changes associated with climate fluctuations similarly shifted the distributional range of sika deer and fractionated the populations. At low sea level periods—when water was stored in large polar ice masses—the sika range extended eastward on the exposed ocean floor to the edge of the continental shelf, beyond which the earth fell off precipitously to great ocean depths. The current islands of Taiwan and the Japanese Archipelago are mountain ranges uplifted by subduction of the Pacific and Philippine plates under the Asian plate. They protruded out of the vast plain marking the eastern edge of the continental shelf. When the glaciers melted and released the stored water, rising sea levels isolated these mountains as islands, and sika deer were trapped. There were two such land bridge periods during the major evolutionary history of the sika deer, one about 150,000 years ago, and a second at the end of the Pleistocene about 12,000 years ago (Cook et al. 1999). Given that fossils of sika deer are known from the islands

6

D. R. McCullough

that trace to the earlier event, the sika deer range was very substantially larger during land bridge periods. Virtually all of the current lands beneath the East China Sea and the Japanese Sea were sika deer habitat at the time. Isolation of populations on islands was a major factor in the evolution of the species as the distributional range morphed north-south and east-west under the force of climate change. These forces that shaped the sika deer over paleontological times raise the question of how we should classify the modern survivors for taxonomic purposes. Although sika deer hybridize with red deer and wapiti (Cervus elaphus), which are their closest relatives, most taxonomists accept that sika constitute a valid species. The more pertinent question is how the species should be divided into subspecies, and on this topic there is, and almost certainly will continue to be, ongoing debate. This is inevitable given that subspecific designations are arbitrary, just as a cake can be cut into many small or fewer large pieces, depending on one’s feeling about appropriate serving sizes. “Lumpers” and “splitters” can debate forever. In this book we treat the problem from the view of evidence—the fossil record, geologic and climate events, genetic structuring, biological variation across the range, etc.— and leave the question of the how best to subdivide for classification to other works. As a practical matter, we use commonly accepted subspecies names for different parts of the range, but our emphasis is on the variation in sika deer by geographic area, climate, habitat selection, and other factors that formed the animal as we see it today. Superimposed on this complex of north-south and east-west gyrations of the sika deer range due to climate and topography is the recent advent of modern, technological human societies. Alteration of habitats and creation of new artificial habitats attractive to sika deer have changed the environmental background to a degree not seen before in history. Given the long association of humans and sika deer these changes, inevitably, have had a major impact on the sika populations—both good and bad. Thus, conservation intersects with ecology and evolution. In the southern end of the range the surviving populations are managed as threatened and endangered. Some populations have gone to extinction in the wild. On Taiwan, free-roaming populations have been reestablished by release of captive animals to the wild. In Vietnam no sika occur in the wild anymore, although they are commonly held in captivity and, hopefully, when the economic conditions allow, wild populations can be reestablished. In China, a once extensive range of the sika deer extended eastward to the Sichuan Basin. Now sika have been heavily exploited, and their range has contracted to a few isolated pockets where their future continues to waver under human pressure. In Primorsky Krai in extreme southeastern Russia sika deer still occur in substantial numbers while on many Japanese islands they are extremely overabundant. Raising crops or regenerating forests is impossible without fencing to exclude the deer. Deer-car collisions there are an increasingly serious hazard on the roadways. Sika deer are invading Japanese cities just as white-tailed deer did several decades earlier in the eastern United States, and black-tailed deer (O. hemionus columbianus) have in recent decades along the Pacific Coast. Management to control overpopulations is a key issue in Japan. As in other parts of the world the large carnivores that

1

Introduction

7

originally served to partially control deer numbers were extirpated (wolves) or reduced (brown and Asiatic black bears). Hunting is widely practiced, but as a sika deer control measure it is made difficult by a small and declining hunter population (due to age; there is almost no recruitment of young hunters). Hunters in other parts of the world, where annual bag limits are typical one deer, are amazed to hear that hunters in some areas of southern Japan can legally kill 180 sika deer per year. High annual bag limits are the rule across the country. Still, due to a lack of hunters, paid cullers have been necessary to achieve the desired control in a number of areas. So, is easy to be fooled by the sika deer’s appearance, delicate build, and liquid dark eyes. Indeed, the sika deer is a study in contradictions, both beauty and beast. Whether sika deer are a blessing or a curse is entirely dependent on the situation. Sika deer are seen as a positive and esthetic element when they are on the fringes of the human enterprise, whereas in high numbers they can destroy the livelihoods of the people. No other deer species reaches the extremes shown by the sika deer. That is part of what makes the sika deer such a fascinating animal. This great intertwining of climate, geology, people, and sika deer created a plethora of experiments over time and space driven by natural and cultural forces. These, in turn, present biologists with an array of research opportunities to study processes that have led to the modern distribution and status of the sika deer. Many researchers have been attracted to the natural experiments and the management problems. Research on the sika deer has burgeoned in recent years, and students of deer biology in other parts of the world are not aware of much of this work, which rivals in quality the best being done anywhere. Knowledge about sika deer has now reached a critical mass and justifies this book. It is a propitious time to bring the results scattered about in journal articles, governmental reports, and researchers’ experiences together and integrated in one source.

Literature Cited Cook, C. E., Y. Wang, and G. Sensabaugh. 1999. A mitochondrial control region and cytochrome b phylogeny of sika deer (Cervus nippon) and report of tandem repeats in the control region. Molecular Phylogenetics and Evolution 12:47–56. Goodman, S. J., H. B. Tamate, R. Wilson, J. Nagata, S. Tatsuzawa, G. M. Swanson, J. M. Pemberton, and D. R. McCullough. 2001. Bottlenecks, drift and differentiation: The population structure and demographic history of sika deer (Cervus nippon) in the Japanese archipelago. Molecular Ecology 10:1357–1370. Knight, J. 2003. Waiting for wolves in Japan: An anthropological study of people-wildlife relations. Oxford University Press, Oxford, United Kingdom. McCullough, D. R. 1996. Metapopulations and wildlife conservation. Island Press, Covelo, California, USA. McCullough, D. R. 1997. Irruptive behavior in ungulates. Pages 69–98 in W. J. McShea, H. B. Underwood, and J. H. Rappole, editors, The science of overabundance: Deer ecology and population management. Smithsonian Institution Press, Washington, DC, USA and London, United Kingdom. Takatsuki, S. 1991. Food habits of sika deer in Japan with reference to dwarf bamboo in Northern Japan. Pages 200–204 in N. Maruyama, editor, Wildlife conservation: Present trends and

8

D. R. McCullough

perspectives for the 21st century. Proceedings of the International Symposium on Wildlife Conservation in Tsukuba and Yokohama, Japan, August 21–25, 1990. Japan Wildlife Research Center, Tokyo, Japan. Walker, B. 2005. The lost wolves of Japan. University of Washington Press, Seattle, Washington, USA.

Chapter 2

Fossil Record of Sika Deer in Japan Yoshinari Kawamura

Abstract Diagnoses for antlers of The sika deer is now presented to distinguish it from other medium-sized deer species based on observation of numerous fossil and living deer antlers from Japan and the adjacent Asian continent as well as examination of published data on the antlers. Well-dated records of fossil antlers from 16 localities were selected from numerous fossil records hitherto known in Japan as reliable occurrences of C. nippon. All the selected localities were situated in the Honshu-Shikoku-Kyushu complex constituting the main part of Japan. Morphological discussions and chronological comments are briefly given for the fossil antlers from these localities. A revision was also made to records of fossil antlers of the medium-sized deer from the adjacent continent which are probably conspecific to C. nippon. The records of C. nippon from the 16 localities are arranged in a chronological framework, which includes climatic records during the Quaternary, to reconstruct the history of C. nippon. C. nippon is inferred to have migrated from China into Honshu-Shikoku-Kyushu through the short-lived land bridge formed in and around the present-day Korea Strait at MIS 12 (about 0.43 Ma) and then to have inhabited Honshu-Shikoku-Kyushu for a long time in association with Cervus kazusensis, a survivor of the medium-sized deer from the Early Pleistocene fauna. After the extinction of C. kazusensis at the terminal stage of the Late Pleistocene, C. nippon became the only medium-sized deer species in Honshu-Shikoku-Kyushu and has survived until the present day.

Introduction The sika deer (Cervus nippon) is now distributed over all the main islands of Japan. From a viewpoint of mammalian biogeography, however, the main islands can be divided into two parts, Hokkaido and the Honshu-Shikoku-Kyushu complex (Fig. 2.1). The present-day fauna of Hokkaido is similar to that of the adjacent continent, while that of Honshu-Shikoku-Kyushu shows higher endemism. Such faunal differences can be explained in relation to the depths of the straits in and around the main islands. The straits between Hokkaido and Sakhalin and the adjaD. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_2, © Springer 2009

11

12

Y. Kawamura

Fig. 2.1 Location map of the fossil localities discussed here. The numbers of the localities correspond to those in Fig. 2.3.

cent continent are much shallower than the Tsugaru Strait between Hokkaido and Honshu-Shikoku-Kyushu (depth about 130 m). The Korea Strait between Tsushima Island and the Korean Peninsula rivals the Tsugaru Strait in depth and is considered to be the biogeographic boundary between Honshu-Shikoku-Kyushu and the adjacent Asian continent. During the Quaternary, the global climatic oscillation linked to the glacial cycles caused severe sea level changes. The straits sometimes dried up to form land bridges which enabled the immigration of nonflying land mammals from the continent. The sika deer must have immigrated from the continent in some stage of the Quaternary and then spread all over the main islands. Fossils of the sika deer provide direct evidence to clarify its Quaternary history in Japan. Numerous deer fossils have been recorded from the Quaternary of Japan by paleontological studies for more than 100 years. They are easily grouped into fossils of small-, medium-, and large-sized deer, which are exemplified by Hydropotes (water deer), Cervus, and Alces (moose), respectively. Fossils of the medium-sized deer are much more abundant than those of the others. In paleontological studies, especially on the medium-sized deer, antlers have been generally considered as the

2

Fossil Record of Sika Deer in Japan

13

most important fossil records, because they are frequently found in fossil state and are more useful for specific distinction than teeth and bones. But the antlers show a wide range of intraspecific variation, which has often led to over-splitting taxonomy of fossil antlers by previous paleontologists. Thus, reliable taxonomy requires consideration of the variation in fossil antlers. Accurate chronological data for each fossil antler is also required to place it in a historical framework. In this chapter, I provide reliable diagnoses which distinguish antlers of the sika deer from those of other medium-sized deer species. Using the diagnoses and considering the state of preservation, I selected the records of the well-dated antlers assignable to the sika deer from the numerous fossil records in Japan. On the basis of the selected records, I reconstruct the Quaternary history of the sika deer in Japan.

Taxonomy I have examined numerous published data on fossil and living materials of the medium-size deer from Japan and the adjacent continent. I have also observed a great many antler specimens of living and fossil deer stored in many museums, institutes, and universities in Japan and China, as well as those kept as private collections, in order to comprehend intraspecific variation and interspecific difference in deer antlers. My studies have revealed that the Quaternary medium-sized deer fossils from Japan with sufficient morphological and chronological data can be classified into five species, Cervus nippon, C. kazusensis (including C. praenipponicus as a synonym), C. kyushuensis, Axis japonicus, and Elaphurus bifurcatus (including E. shikamai as a synonym) by the following characters of their antlers: 1. 2. 3. 4. 5. 6. 7.

Number of points. Height of the first forking (h in Fig. 2.2). Angle between the brow tine and beam (a in Fig. 2.2). Direction of the brow tine. Brow tine branchless or bifurcated. Curvature of the beam between the first and second forkings. Direction of the second tine.

C. nippon is distinguishable from the other species by the following diagnoses: (1) the antler usually has four points; (2) the first forking is low; (3) the angle between the brow tine and beam is moderate or obtuse; (4) the brow tine extends anterodorsally; (5) the brow tine is branchless; (6) the beam between the first and second forkings curves gently and is not lyre-shaped; and (7) the second tine extends anterodorsally or dorsally. In fossil antlers, the state of preservation strongly affects the taxonomic allocation of each specimen. Complete antlers, although few in fossil state, can be allocated convincingly, while the allocation of antlers in poor preservation is less reliable. Thus it is necessary to categorize the state of preservation to evaluate the reliability of each allocation. Six categories are devised here to express the state of

14

Y. Kawamura

Fig. 2.2 Schematic sketches of antlers of Cervus nippon showing the terminology and categories of preservation (A1–C). Black: preserved part, a: angle between the brow tine and beam, h: height of the first forking.

preservation for antlers of C. nippon (Fig. 2.2). The shaft and burr are, of course, preserved in all the categories. A 1: A2: A3: B1: B2: C:

Complete or almost complete in preservation. All the forkings are preserved. The brow and second tines are also preserved, but the beam above the third forking or the third tine may be damaged. All the forkings are preserved. The brow tine, beam above the third forking, and third tine are damaged. All the forkings are preserved. The brow, second, and third tines as well as the beam above the third forking are damaged. The first and second forkings are preserved, while the third forking is lost. The brow tine is also preserved. The second tine may be damaged. The first and second forkings are preserved, while the third forking is lost. The brow tine is damaged. The second tine may be damaged. The first forking and brow tine are preserved, while the second and third forkings are lost. The beam between the first and second forkings is almost preserved.

Among the antler characters given above (1)–(7), five or more are observable in fossil antlers belonging to these categories (Table 2.1), which were adopted for the present study. However, antlers in poorer preservation than those of category C were omitted. Consequently, antlers from 16 localities with reliable chronological data were selected for the subsequent discussion on the fossil records of C. nippon (Fig. 2.1). All of them were located in Honshu-Shikoku-Kyushu, as were the other four medium-sized deer species recognized herein. Evaluation based on fossil record is, therefore, not possible in Hokkaido. In the following discussion the morphological

2

Fossil Record of Sika Deer in Japan

15

Table 2.1 Relationship between the state of preservation and observable characters in the fossil antlers: + observable or inferable in most specimens, ±inferable in part of specimens, − not observable. State of preservation Character 1 2 3 4 5 6 7

A1

A2

A3

B1

B2

C

+ + + + + + +

± + + + − + +

± + + + − + +

− + + + + + +

− + + + − + +

− + + + + + −

characters of fossil antlers from the 16 localities are considered from a taxonomic point of view and chronological comments are given for the antlers.

Fossil Record in Japan Middle Pleistocene Record Fossil antlers reliably assigned to C. nippon were recorded from only two Middle Pleistocene localities: Yoshinoda, Sodegaura, Chiba Prefecture, and Sahama, Hamamatsu, Shizuoka Prefecture (Fig. 2.1). These can be regarded as the earliest record of C. nippon so far known in Honshu-Shikoku-Kyushu (Fig. 2.3). A left antler from Yoshinoda was described as C. (Sika) nippon by Takakuwa (2006). Judging from his description and figure (his fig. 2), it is referred to A1 in preservation and shows characters (1), (2), and (4)–(7), well coincident with the above-mentioned diagnoses of C. nippon. As regards character (3), the angle is relatively acute in the specimen, but antlers with similar angles are sometimes found in living populations of C. nippon (for example, plates 3 and 4 of Ohtaishi 1976). Thus its original allocation is reliable. This antler occurred from the Kiyokawa Formation in the Shimosa Group. This group is one of the stratotypes of the Middle and Upper Pleistocene in Japan and is accurately correlated with the oxygen isotope fluctuation curve and marine isotope stages (MIS). The horizon yielding the antler is positioned in MIS 7.2–7.4, and dated to about 0.22 Ma (Okazaki et al. 2006). A right antler from Sahama was described and figured by Takahashi et al. (2003), who allocated it to C. nippon. The description and figure (their fig. 4 of plate 1) show its preservation as B2, and all the preserved characters (2)–(4), (6),

16

Y. Kawamura

Fig. 2.3 Chronological distribution of Cervus nippon in Honshu-Shikoku-Kyushu. The dots with numbers on its range bar indicate the fossil localities shown in Fig. 2.1. That of another mediumsized deer species, C. kazusensis, is also shown. The climatic background based on the oxygen isotope fluctuation curve by Shackleton (1995) is shown on the left side. The first appearance of the key proboscidean species (Palaeoloxodon naumanni) in Honshu-Shikoku-Kyushu is indicative of a land bridge, through which land mammals immigrated to Japan from the continent. (The chronological range of the proboscidean species is cited from Yoshikawa et al. 2007.)

and (7) accord with the diagnoses of C. nippon, which justifies its original allocation. This antler was recovered from the Sahama Mud Bed in the Hamamatsu Formation. The formation is reliably correlated with the well-dated standard sequences including the Shimosa Group by using marker tephras intercalated, and the bed is allocated to MIS 7 (Sugiyama 1991).

Late Pleistocene Record Fossil antlers reliably assigned to C. nippon occurred from only three Late Pleistocene localities: Nishikigaoka, Shimoda, Aomori Prefecture, the Hanaizumi site, Hanaizumi, Iwate Prefecture, and the Tategahana site, Shinano, Nagano Prefecture (Fig. 2.1). A fragmented skull with a left and right antler from Nishikigaoka was described by Takakuwa (2004) with five figures of the antlers (his figs. 1–5). He referred it to C. (Sika) nippon. On the basis of his description and figures, the left antler is better preserved and belongs to A1. This antler therefore preserves all the characters (1)– (7), which agree with the diagnoses of C. nippon. This indicates that its original

2

Fossil Record of Sika Deer in Japan

17

allocation is undoubted. The skull was found in marine terrace deposits, which were assigned to MIS 5 (Kuwabara 2004; Takakuwa 2004). A small right antler from the Hanaizumi site was studied by Matsumoto et al. (1959), who identified it as “C. (Sika) natsumei.” Judging from their description and figures (their fig. 3, and fig. 1 of plate 32), this antler probably belongs to a young individual and is referable to B1 in preservation. The preserved characters (2)–(7) coincide with the diagnoses of C. nippon, and thus the antler is reliably assigned to C. nippon. “C. natsumei” proposed by Matsumoto (1938) is considered to be synonymous with C. nippon, but the taxonomic problems with “C. natsumei” will be discussed in a separate paper. The sediments yielding the antler are dated between 16 and 28 ka by the radiocarbon method (Kanto Loam Research Group and Shinshu Loam Research Group 1962; Hanaizumi Site Excavation Research Group 1993). A left antler from the Tategahana site was referred to “Cervus sp. cf. nippon” by Nojiriko Excavation Research Group (1975). According to their description and figure (fig. 11-8), the antler belongs to C in preservation, and shows the characters (2)–(6) coincident with the diagnoses of C. nippon. It is therefore referable to C. nippon. The sediments yielding the antler are determined as T1–T3 units of the Tategahana Sand Member in the Nojiri-ko Formation. These units range from 41 to 43 ka in radiocarbon age (Geology Research Group for Nojiri-ko Excavation 2004).

Holocene Record Fossil antlers of Holocene age are more numerous than those of Middle and Late Pleistocene ages and were obtained from archaeological sites which were accurately dated mainly by the archaeological method using pottery. The eleven sites listed in Table 2.2 yield antlers which show the characters coincident with the diagnoses of C. nippon (at least five characters among the seven, see Table 2.1), and thus they are reliably assigned to C. nippon. In these sites, however, antlers suitable for specific determination are few (mostly one or two). The only exception is the case of the Torihama shell mound site, which yields many well-preserved antlers figured by Torihama Shell Mound Research Group (1983, 1985, 1987a,b) and Shigehara et al. (1991). The antlers figured show a wide range of morphological variation, but their allocation to C. nippon is undoubted, because similar variation is observable in living populations of C. nippon.

Fossil Record in the Adjacent Continent In northern China, well-preserved and abundant fossils of the medium-sized deer have been obtained from cave sediments of many localities at Zhoukoudian (= Choukoutien), a famous place for paleoanthropology and paleontology in Beijing.

Kainohana shell mound site, Matsudo, Chiba Pref. Mawaki site, Noto, Ishikawa Pref. Aoshima shell mound site, Minamikata, Miyagi Pref.

7

9

8

6

Sanya shell mound site, Sodegaura, Chiba Pref. Morinomiya site, Higashi-ku, Osaka

Onji site, Higashi-osaka, Osaka Pref. Kamei site, Hirano-ku, Osaka, and Yao, Osaka Pref. Shirahama shell mound site, Fukue (Goto-shi), Nagasaki Pref. Gionbara shell mound site, Ichihara, Chiba Pref.

5

4

3

2

1

Locality

ca. 2 ka

ca. 2–3 ka

ca. 2.5–4 ka Archaeological dating using pottery

Japanese sika deer Deer

Japanese sika deer Cervus nippon nippon Japanese sika deer

A1 B1, B2 A3 A1, B1

Cervus nippon nippon Cervus (Sika) nippon matsumotoi

B1, B2 A1

Cervus nippon nippon

B2

B2

ca. 2.5– Archaeological dating using 6.5 ka pottery ca. 3–6.5 ka Archaeological dating using pottery

ca. 2.5–5 ka Archaeological dating using pottery, and radiocarbon

ca. 2.5–4 ka Archaeological dating using pottery ca. 2–5 ka Archaeological dating using pottery, and radiocarbon

Archaeological dating using pottery

Archaeological dating using pottery, and radiocarbon Archaeological dating using pottery

ca. 2 ka

Cervus nippon

B2

Dating method

Metric age

State of Original preservation identification

Miyazaki and Hiraguchi (1986) Matsumoto (1930); Kato and Goto (1975)

Taruno and Ishii (1978); Matsuo (1978) Yawata (1973)

Uriudo Site Research Group (1980) Osaka Cultural Property Center (1984) Fukue Municipal Board of Education (1980) Cultural Property Center of Ichihara City (1999) Kaneko et al. (1973)

Literature

Latest to Early Jomon in age Late to Early Jomon in age

Latest to Late Jomon in age Yayoi and Latest to Middle Jomon in age Latest to Middle Jomon in age

Early Yayoi and Latest Jomon in age Latest to Late Jomon in age

Yayoi in age

Yayoi in age

Remarks

Table 2.2 Well-dated localities of Holocene age yielding antlers assignable to Cervus nippon with confidence. The numbers of the localities correspond to those in Figs. 2.1 and 2.3.

Torihama shell mound site, Mikata (Wakasa-cho), Fukui Pref.

Awazu shell midden site, Otsu, Shiga Pref.

10

11

B1, B2 Cervus nippon

A1, A2, A3, Cervus nippon B1, B2, C

ca. 4–10 ka

Archaeological dating using pottery

ca. 5–6.5 ka Archaeological dating using pottery

Torihama Shell Mound Early Jomon Research Group in age (1983, 1985, 1987a, b); Shigehara et al. (1991) Shiga Prefectural Middle to Earliest Board of Education Jomon in age and Shiga Institute for Cultural Heritage Protection (1984, 1997)

20

Y. Kawamura

The fossils of the genus Cervus from the Middle Pleistocene sediments of Locality 1 were assigned to “Pseudaxis grayi” (= Cervus grayi) by Zdansky (1928) and Young (1932). “P. grayi” was also reported from the early Middle Pleistocene sediments of Locality 13 (Teilhard de Chardin and Pei 1941). On the basis of the descriptions and figures in these papers, the antlers of “P. grayi” are large and have broad angles between the brow tine and beam, but they are not basically different from those of C. nippon. “P. grayi” is, therefore, considered to be a synonym of C. nippon. Further discussion on the systematic position of “P. grayi” will be given in a separate paper. Additionally Pei (1936) described an antler from the late Middle Pleistocene sediments of Locality 3 and referred it to “Pseudaxis hortulorum.” This antler shows the characters coincident with the diagnoses of C. nippon. A skull with both antlers was recovered from the Late Pleistocene sediments of Guxiangtun (= Ku-hsiang-tung), Harbin, Heilongjiang Province and was described as the type specimen of a new species named “C. harbinensis” (Tokunaga and Naora 1939). The morphological characters of the antlers described well agree with the diagnoses of C. nippon. Thus “C. harbinensis” is synonymous with C. nippon, but the problems of “C. harbinensis” will be discussed in a separate paper. The Holocene archaeological site of Anyang, Henan Province yielded several antlers of “P. hortulorum,” which were described by Teilhard de Chardin and Young (1936). Their description and figures indicate that the antlers bear the diagnoses of C. nippon, and are assignable to this species. In conclusion, the above-mentioned fossil records indicate that C. nippon has continuously inhabited northern China from the early Middle Pleistocene to Holocene.

Immigration The reliable fossil records of C. nippon from Honshu-Shikoku-Kyushu are arranged chronologically in Fig. 2.3. They indicate that C. nippon ranges from the late Middle Pleistocene (0.22 Ma) to the present day. Taking the above-mentioned chronological distribution in northern China into account, C. nippon probably immigrated from China prior to 0.22 Ma. In Honshu-Shikoku-Kyushu, proboscidean (elephant-related) fossils are successively found in the Quaternary sequences, and the chronological range of each proboscidean species is determined accurately in the sequences. Kawamura (1998) considered that the first appearance of each species indicated its immigration from China through a land bridge. This idea was improved by the more precise range of each species and correlation with the oxygen isotope fluctuation curve (Konishi and Yoshikawa 1999; Kawamura and Taruno 2000; Yoshikawa et al. 2007). The curve linked to global climatic changes has a decisive meaning when we consider the extreme sea-level drops which formed land bridges across the present-day Tsugaru and Korea Straits (Fig. 2.1). The last proboscidean species in Honshu-ShikokuKyushu (Palaeoloxodon naumanni) ranges from about 0.38 to about 0.02 Ma (Fig. 2.3).

2

Fossil Record of Sika Deer in Japan

21

This species is inferred to have immigrated at MIS12, because it is a very cold stage just prior to 0.38 Ma. As regards C. nippon, three cold stages (MIS 8, 10, and 12) are recognized prior to 0.22 Ma. Among them, MIS 12 is most probable as the time of its immigration, because MIS 12 is the coldest and P. naumanni is inferred to have immigrated as mentioned above. At MIS 12, C. nippon possibly immigrated from northern China through the exposed area in and around the present-day Korea Strait in association with P. naumanni. As pointed out by Kawamura (2007), this land bridge is considered to have been short-lived, because the fluctuation curve shows a very sharp peak at MIS 12, as other cold stages. C. nippon may have expanded its distribution into Hokkaido through the Tsugaru Strait when it dried up at MIS 12. There is no clear evidence indicative of mammalian immigration or land bridge formation after MIS 12, excepting the ice bridge formation across the Tsugaru Strait at MIS 2 (Fig. 2.3). The ice bridge was inferred by Kawamura (1985, 1989, 1994), through which a few elements of the mammoth fauna complex of the continent invaded Honshu-Shikoku-Kyushu from Hokkaido. At MIS 2, C. nippon may have interchanged between Honshu-Shikoku-Kyushu and Hokkaido through this ice bridge, but it is unlikely that the continental population of this species immigrated to Honshu-Shikoku-Kyushu through Sakhalin and Hokkaido which were undoubtedly connected by land with the adjacent continent. The reason is that on the continent, the Ussuri region is the northernmost distribution of C. nippon at the present day which is in a very warm stage (MIS 1); the northern limit is inferred to have shifted southward to northern China at MIS 2 and, thus, C. nippon was probably absent from the continent adjacent to Sakhalin at MIS 2.

Changes in the Medium-Sized Deer Fauna Besides Cervus nippon, four medium-sized deer species are recognized here in welldated fossil records of Quaternary age from Honshu-Shikoku-Kyushu, as mentioned before. Among the four, C. kyushuensis, Axis japonicus, and Elaphurus bifurcatus are restricted in their occurrences to the Early Pleistocene. The remaining species, C. kazusensis, has a long chronological range from the Early Pleistocene to the terminal stage of the Late Pleistocene (Fig. 2.3). In spite of the over-lumping taxonomy by Nakaya (1993), C. kazusensis is distinguishable from C. nippon by antler morphology; namely characters (1), (2), and (7) differ between them. In C. kazusensis, the antler has three points, the first forking is high, and the second tine extends posterodorsally and medially. The differences are sufficiently specific. The fossil records suggest that C. kazusensis was a survivor of the more diversified medium-sized deer fauna of the Early Pleistocene and lived alone in HonshuShikoku-Kyushu during the early part of the Middle Pleistocene. After the immigration of C. nippon at MIS 12, C. kazusensis coexisted with C. nippon for a long time, possibly more than 400,000 years. They seem to have been distributed

22

Y. Kawamura

allopatrically (separately) in Honshu-Shikoku-Kyushu, because the two species have never been found together in well-dated sediments in a single locality. In Honshu-Shikoku-Kyushu, several mammalian species including C. kazusensis and Palaeoloxodon naumanni became extinct at the terminal stage of the Late Pleistocene, between 20 and 10 ka (Kawamura 1991, 1994; Fig. 2.3). This extinction event decreased the species diversity of the mammalian fauna and made the medium-sized deer fauna again monospecific, the survivor being C. nippon. This species was well established in the Holocene mammalian fauna of HonshuShikoku-Kyushu and has survived to the present despite increasing hunting pressure by prehistoric and historic people. Acknowledgements This chapter has been written to publish a part of my research on Quaternary deer fossils from Japan and adjacent countries. I wish to express my gratitude to Prof. T. Ozawa (Cyber University), Mr. H. Taruno (Osaka Museum of Natural History), Prof. S. Matsu’ura (Ochanomizu University), Prof. T. Inada (Okayama University), Prof. H. Yamazaki (Tokyo Metropolitan University) for their helpful discussion and encouragement and affording facilities for my observation of specimens or literature collection. I am also indebted to Mr. Y. Abe (Taga Town Museum), Dr. Y. Kondo (Nojiri-ko Museum), Mr. Y. Matsuhashi (Aichi University of Education), Mr. Y. Takakuwa (Gunma Museum of Natural History), and Mr. I. Risho for providing useful information or helpful assistance. Thanks are due to Prof. C. Z. Jin, Dr. Y. Q. Zhang, and Dr. W. Dong (Institute of Vertebrate Paleontology and Paleoanthropology, Chinese Academy of Sciences), and Prof. Z. J. Feng, Mr. Y. G. Xu, and Ms. L. H. Sun (Institute of Zoology, Chinese Academy of Sciences) for giving me convenience to access specimens from China and to obtain useful information concerned. I also acknowledge Dr. D. R. McCullough and Ms. M. Jaeger for critical reading of my manuscript to improve English expression and to adjust it to the purpose of this book; and Prof. S. Takatsuki (Azabu University) for giving me the opportunity to publish it in this book. This study was financially supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (project nos. 13854001 and 14390027).

Literature Cited Cultural Property Center of Ichihara City, editor. 1999. Gionbara shell mound. Ichihara Municipal Board of Education, Chiba Prefecture, Japan. (In Japanese.) Fukue Municipal Board of Education, editor. 1980. Shirahama shell mound. Fukue Municipal Board of Education, Nagasaki Prefecture, Japan. (In Japanese.) Geology Research Group for Nojiri-ko Excavation. 2004. Geology of the excavation site at Lake Nojiri and its surrounding areas, northern part of Nagano Prefecture − On the redefinition of the Nojiri-ko Formation. Bulletin of the Nojiri-ko Museum 12:1–13. (In Japanese with English abstract.) Hanaizumi Site Excavation Research Group. 1993. The Hanaizumi site. Board of Education of Hanaizumi-cho, Iwate Prefecture, Japan. (In Japanese.) Kaneko, H., M. Koyanagi, and Y. Ushizawa. 1973. Vertebrate remains from the Sanya shell mound at Iitomi. Pages 221–229, plates 85–90 in Sanya shell mound, Sodegaura-cho. Tokyo Electric Power Company, Tokyo and Urban Development Public Corporation of Chiba Prefecture, Chiba, Japan. (In Japanese.) Kanto Loam Research Group and Shinshu Loam Research Group. 1962. On the geological age and sedimentary environment of the Hanaizumi Bed. Earth Science (Chikyu Kagaku) 62:1–10; 63:10–18. (In Japanese with English abstract.)

2

Fossil Record of Sika Deer in Japan

23

Kato, T., and K. Goto. 1975. Report on the excavations of the Aoshima shell mound, Minamikatamachi, Tome-gun. Pages 3–145 in Report on the excavations of the Aoshima shell mound, Minamikata-machi, Tome-gun, Miyagi Prefecture: Research on an inland freshwater shell mound. Minamikata-machi, Miyagi Prefecture, Japan. (In Japanese.) Kawamura, Y. 1985. Succession of the mammalian fauna in Japan since the Last Glacial Period. The Earth Monthly 7:349–353. (In Japanese.) Kawamura, Y. 1989. Quaternary rodent faunas in the Japanese Islands (Part 2). The Memoirs of the Faculty of Science, Kyoto University, Series of Geology and Mineralogy 54:1–235. Kawamura, Y. 1991. Quaternary mammalian faunas in the Japanese Islands. The Quaternary Research (Daiyonki-Kenkyu) 30:213–220. Kawamura, Y. 1994. Late Pleistocene to Holocene mammalian faunal succession in the Japanese Islands, with comments on the Late Quaternary extinctions. ArchaeoZoologia 6:7–22. Kawamura, Y. 1998. Immigration of mammals into the Japanese Islands during the Quaternary. The Quaternary Research (Daiyonki-Kenkyu) 37:251–257. (In Japanese with English abstract.) Kawamura, Y. 2007. Recent progress in paleontological studies on the Quaternary mammals of Japan. Honyurui Kagaku (Mammalian Science) 47:107–114. (In Japanese.) Kawamura, Y., and H. Taruno. 2000. Immigration of mammals into Japan during the Quaternary, with comments on land or ice bridge formation enabled human immigration. Acta Anthropologica Sinica, supplement to volume 19:264–269. Konishi, S., and S. Yoshikawa. 1999. Immigration times of the two proboscidean species, Stegodon orientalis and Palaeoloxodon naumanni, into the Japanese Islands and the formation of land bridge. Earth Science (Chikyu Kagaku) 53:125–134. (In Japanese with English abstract.) Kuwabara, T. 2004. Relative sea-level changes and marine-terrace deposits in Kamikita Plain, northern end of Honshu, Japan. The Journal of the Geological Society of Japan 110:93–102. (In Japanese with English abstract.) Matsumoto, H. 1930. Report of the mammalian remains obtained from the sites at Aoshima and Hibiku, Province of Rikuzen. The Science Reports of the Tohoku Imperial University, Second Series (Geology) 13:59–93, plates 30–38. Matsumoto, H. 1938. On some fossil antlers of deers [sic] from the Basal Calabrian at Nagahama, Minato Town, Province of Kazusa, Japan. The Zoological Magazine (Dobutsugaku Zasshi) 50:111–115. (In Japanese with English résumé.) Matsumoto, H., H. Mori, K. Marui, and H. Ozaki. 1959. On the discovery of the Upper Pliocene fossiliferous and culture-bearing bed at Kanamori, Hanaizumi Town, Province of Rikuchu. Bulletin of the National Science Museum, Tokyo 4:287–324, plates 25–48. Matsuo, N. 1978. Conclusion. Pages 171–177 in The Morinomiya site: Report on the third and fourth excavations. Naniwanomiya-ato-kenshokai, Osaka, Japan. (In Japanese.) Miyazaki, N., and T. Hiraguchi. 1986. Animal remains. Pages 346–400 in The Mawaki site in Noto-cho, Ishikawa Prefecture. Board of Education of Noto-cho and Mawaki Site Excavation Research Group, Ishikawa Prefecture, Japan. (In Japanese.) Nakaya, H. 1993. Evolution of Quaternary middle-sized Cervus in Japan and China. Pages 106– 114 in N. Ohtaishi, and H. I. Sheng, editors. Deer of China: Biology and management. Elsevier Science, Amsterdam, The Netherlands. Nojiriko Excavation Research Group. 1975. The Lake Nojiri excavation 1962–1973. Kyoritsu Shuppan Company, Ltd, Tokyo, Japan. (In Japanese with English résumé.) Ohtaishi, N. 1976. Developmental variation of the antlers on Japanese deer at Nara Park (Preliminary). Pages 107–128 in Annual report of Nara Deer Research Association for the fiscal year 1976. Kasugakenshokai, Nara, Japan. (In Japanese with English summary.) Okazaki, H., H. Nakazato, and H. Ikeda. 2006. The flood deposit of the Middle Pleistocene Kiyokawa Formation, Shimosa Group, eastern Japan. The Quaternary Research (DaiyonkiKenkyu) 45:157–167. (In Japanese with English abstract.) Osaka Cultural Property Center. 1984. The Kamei site II. Osaka Cultural Property Center, Osaka, Japan. (In Japanese.) Pei, W. C. 1936. On the mammalian remains from Locality 3 at Choukoutien. Palaeontologia Sinica, Series C 7 (fasc. 5):1–121.

24

Y. Kawamura

Shackleton, N. J. 1995. New data on the evolution of Pliocene climatic variability. Pages 242–248 in E. S. Vrba, G. H. Denton, T. C. Partridge, and L. H. Burckle, editors. Paleoclimate and evolution, with emphasis on human origins. Yale University Press, New Haven, Connecticut, USA. Shiga Prefectural Board of Education and Shiga Institute for Cultural Heritage Protection, editors. 1984. Awazu shell midden: A lake bottom site. Shiga Prefectural Board of Education and Shiga Institute for Cultural Heritage Protection, Otsu, Japan. (In Japanese.) Shiga Prefectural Board of Education and Shiga Institute for Cultural Heritage Protection, editors. 1997. Awazu no.3 shell midden. Shiga Prefectural Board of Education and Shiga Institute for Cultural Heritage Protection, Otsu, Japan. (In Japanese with English summary.) Shigehara, N., H. Hongo, and K. Amitani. 1991. Mammal remains from the 1985 excavation of the Torihama shell mound. Bulletin of the National Museum of Japanese History 29:329–342, plates 1–15. (In Japanese with English abstract.) Sugiyama, Y. 1991. The Middle Pleistocene deposits in the Atsumi Peninsula and along the east coast of Lake Hamana, Tokai district – sedimentary cycles formed by the glacio-eustatic sea-level change and their correlations to the contemporaneous deposits in the Kanto and Kinki districts–. Bulletin of the Geological Survey of Japan 42:75–109. (In Japanese with English abstract.) Takahashi, K., H. Matsuoka, H. Taru, K. Yasui, and Y. Hasegawa. 2003. Vertebrate fossils from the excavation site of the Naumann’s elephant at Sahama. Shizuoka Chigaku 87:15–21. (In Japanese.) Takakuwa, Y. 2004. Sika deer fossils from the Middle Pleistocene of Nishikigaoka, Shimoda, Kamikita-gun, Aomori Prefecture. Report on sika deer fossils from Nishikigaoka, Shimodacho. Board of Education of Shimoda-cho, Aomori Prefecture, Japan. (In Japanese.) Takakuwa, Y. 2006. Cervid fossils from the Kiyokawa Formation of Shimosa Group, Sodegaura, Chiba Prefecture, Japan. The Quaternary Research (Daiyonki-Kenkyu) 45:197–206. (In Japanese with English abstract.) Taruno, H., and M. Ishii. 1978. Animal remains from the Morinomiya site (the third excavation). Pages 160–165 in The Morinomiya site: Report on the third and fourth excavations. Naniwanomiya-ato-kenshokai, Osaka, Japan. (In Japanese.) Teilhard de Chardin, P., and C. C. Young. 1936. On the mammalian remains from the archaeological site of Anyang. Palaeontologia Sinica, Series C 12 (fasc. 1):1–79. Teilhard de Chardin, P., and W. C. Pei. 1941. The fossil mammals from Locality 13 of Choukoutien. Palaeontologia Sinica, New Series C 11:1–119. Tokunaga, S., and N. Naora. 1939. Fossil remains excavated at Ku-hsiang-tung near Harbin, Manchoukuo. Pages 1–229, plates 1–22 in Report of the first scientific expedition to Manchoukuo, Section 2, Part 4. Office of the Scientific Expedition to Manchoukuo, Tokyo, Japan. (In Japanese with English résumé.) Torihama Shell Mound Research Group, editor. 1983. Torihama shell mound: Outline of the excavations and results of the researches in the fiscal years 1981–1982. Fukui Prefectural Board of Education and Wakasa Museum of History and Folklore, Fukui Prefecture, Japan. (In Japanese.) Torihama Shell Mound Research Group, editor. 1985. Torihama shell mound: Outline of the excavations and results of the researches in the fiscal year 1984. Fukui Prefectural Board of Education and Wakasa Museum of History and Folklore, Fukui Prefecture, Japan. (In Japanese.) Torihama Shell Mound Research Group, editor. 1987a. Torihama shell mound: Researches of the fiscal years 1980–1985. Fukui Prefectural Board of Education and Wakasa Museum of History and Folklore, Fukui Prefecture, Japan. (In Japanese.) Torihama Shell Mound Research Group, editor. 1987b. Torihama shell mound: Outline of the excavations and results of the researches in the fiscal year 1985. Fukui Prefectural Board of Education and Wakasa Museum of History and Folklore, Fukui Prefecture, Japan. (In Japanese.) Uriudo Site Research Group, editor. 1980. The Onji site. Uriudo Site Research Group, Higashiosaka, Osaka Prefecture, Japan. (In Japanese.)

2

Fossil Record of Sika Deer in Japan

25

Yawata, I., editor. 1973. The shell mounds of Kainohana. Board of Education of Matsudo City, Chiba Prefecture, Japan. (In Japanese with English summary.) Yoshikawa, S., Y. Kawamura, and H. Taruno. 2007. Land bridge formation and proboscidean immigration into the Japanese Islands during the Quaternary. Journal of Geosciences, Osaka City University 50:1–6. Young, C. C. 1932. On the Artiodactyla from the Sinanthropus site at Chouk’outien. Palaeontologia Sinica, Series C 8 (fasc. 2):1–159. Zdansky, O. 1928. Die Säugetiere der Quartärfauna von Chou-K’ou-Tien. Palaeontologia Sinica, Series C 5 (fasc. 4):1–146, plates 1–16.

Chapter 3

Two Genetically Distinct Lineages of the Japanese Sika Deer Based on Mitochondrial Control Regions Junco Nagata

Abstract To investigate genetic diversity among populations of sika deer, Cervus nippon, in Japan, nucleotide sequences (705–824 bases) of the mitochondrial control regions were determined in 61 animals from localities in the Japanese islands and 13 animals from three localities in China. A phylogenetic tree constructed by the sequences indicated that the Japanese sika deer are separated into two distinct lineages: the Northern Japan group (Hokkaido Island and most of the Honshu mainland) and the Southern Japan group (a part of the southern Honshu mainland, Kyushu Island and small islands around Kyushu Island). All sika deer examined in this study shared four to seven units of repetitive sequences (37–40 bases each) within the control region sequences. The number of tandem repeats was different between the two lineages. Six or seven repeats occurred in the northern group, while four or five repeats occurred in the southern group. Based on these control region data, separation of the two lineages was estimated to have occurred approximately 0.35 million years before present. The divergence of the two groups coincides with the last glacial period during the Pleistocene and suggests that there were at least two invasions from the continent to Japan possibly through the land bridges of the Korean Strait.

Introduction The sika deer has been classified as a member of the family Cervidae in the order Artiodactyla (Corbet and Hill 1991). Sika deer occupy most of the islands of the Japanese Archipelago, from Hokkaido in the north to islands off the coast of Okinawa in the south. The sika deer on the Japanese islands are divided into six subspecies (Ohtaishi 1986), and this classification is widely accepted at present: Cervus nippon yesoensis (Hokkaido Island population), C. n. centralis (Honshu mainland and Tsushima Island populations), C. n. nippon (Kyushu Island, Shikoku Island, and Goto Islands populations), C. n. mageshimae (Mageshima Island and Tanegashima Island populations),

D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_3, © Springer 2009

27

28

J. Nagata

C. n. yakushimae (Yakushima Island and Kuchinoerabu Island populations), and C. n. keramae (Ryukyu Islands population). However, there have been some questions on taxonomy of the Tsushima population (Imaizumi 1970; Corbet 1978; Matsumoto et al. 1984; Endo 1996). The sika deer in Japan show a striking variation in body weight from the northern to southern islands: the largest is C. n. yesoensis, while the smallest is C. n. yakushimae with a weight less than half of the former. It is unusual for mammals to show as great a difference as Japanese sika deer show. Morphological variation within Japanese sika is almost equivalent to that seen among individual species of other mammals. Despite remarkable differences in body size and morphology, taxonomy of sika deer subspecies has been controversial. Thus, sika deer in Japan provide an excellent opportunity to study relationships between biogeographic and genetic characters. Several previous studies have reported that there are two mitochondrial (mt) lineages of sika deer in Japan: the Northern Japan group and the Southern Japan group (Nagata et al. 1995; Tamate and Tsuchiya 1995; Tamate et al. 1998; Cook et al. 1999; Nagata et al. 1999). These molecular data did not reflect the previous morphological classification of sika deer subspecies. Fossil records indicated that the sika deer could have colonized the Japanese islands in the Mid- to Late Pleistocene (Kawamura 1982; Kawamura et al. 1989; Kawamura 1991, Kawamura chapter 2). The general opinion is that the animals could have migrated to the islands through land bridges that were repeatedly formed between Japan and the Asian continent. In the Late Pleistocene, as the Japanese islands were isolated by surrounding straits, deer populations became confined to each island. Such isolation would have initiated subspeciation. However, where the Japanese sika deer originally came from and their path of migration and speciation are still unclear. As techniques for genetics improve, theoretical concepts have been confirmed, and it is clear that information from DNA sequences is very useful to understand phylogenetic relationships among animals. Phylogenetic analyses have been used in many fields in biology because convergence is easier to control for in DNA studies than in morphological studies. Genetic analysis of mtDNA sequences have been recently applied in wildlife studies to provide reliable information on the relationships among closely related species and among populations, because of more rapid evolution of mtDNA, maternal inheritance, and nonrecombination (Brown et al. 1979, 1982). In particular, the control region sequence is most variable in mtDNA and its substitution rate is estimated to be five times as much as that of the rest of the sequences in mtDNA (Aquadro and Greenburg 1983). For this reason, my colleagues and I have been studying genetic diversity of sika deer. It is becoming clear that the Japanese sika deer has a dynamic history that can not be inferred from its distribution pattern or variation of morphological characters. In the present study, we determined nucleotide sequences of the mtDNA control region and present genetic characteristics of the Japanese sika deer. Then, we discuss genetic relationships among Japanese sika deer populations to understand their history and evolution.

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

29

Materials and Methods Animal Collection and DNA Extraction A total of 74 sika deer specimens (blood, muscle, or liver tissues) were collected from three Chinese subspecies (n = 13) and all Japanese subspecies (n = 61) of sika deer (Table 3.1, Fig. 3.1). Nucleotide sequences from 31 of the 74 animals have already been reported by Nagata et al. (1999), and the remaining animals (43 samples) were newly analyzed in this study. From the whole blood or other tissues, total DNA was extracted using QIAamp minikits (QIAGEN), following the manufacture’s instructions. Extract without any tissue was used as a negative control in the subsequent polymerase chain reaction (PCR) amplification.

PCR Product-Direct Sequencing of the Control Region To amplify and sequence the control regions of the sika deer, 17 primers were used (Table 3.2, Fig. 3.2). The primer pair of L15926/H597 was used for PCR amplification. In the case that PCR failed with L15926/H597, other pairs L15926/ HD6 and LD3/H597 were used. In order to amplify the control region a PCR reagent kit (TaKaRa) was used according to the manufacturer’s instructions. One microliter of the DNA extract was subjected to PCR amplification in a reaction mixture of 50 µl including 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, each dNTP at 0.2 mM, 1.25 U of Taq DNA polymerase, and each primer at 0.5 µM. The step program for PCR amplification was as follows: 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. The cycle was repeated 30–40 times followed by a reaction completion at 72 °C for 10 min. Sequences were obtained with ABI Dye Terminator Kit (Applied Biosystems) and an ABI 310 automatic sequencer. Cycle sequencing reactions were performed according to the instructions provided by the manufacturer. All PCR primers (except L15926) were used for the direct sequencing.

Sequence Analysis Sequence analysis was performed using a computer software GENETYX-MAC Ver.8.5 (SOFTWARE DEVELOPMENT CO., Tokyo, Japan). Phylogenetic trees were constructed using the neighbor-joining (NJ) method (Saitou and Nei 1987) in the computer software Clustal X 1.81 (Thompson et al. 1997). Numbers of nucleotide substitutions per site were estimated for multiple substitutions using the Kimura’s two-parameter method (Kimura 1980). The 31 sequences from Nagata et al. (1999) were included in

30

J. Nagata

Table 3.1 Taxonomy and haplotypes of sika deer (Cervus nippon) (74 individuals) analyzed in this study. No. in Subspeciesa Fig. 3.1 JAPAN C. n. yesoensis 1 2 C. n. centralis 3 4 5

Haplotypes (N/N of tandem repeats)

Groups b

Shari, Hokkaido 2 Utanobori, Hokkaido 4

Hka (2/7) Hkb (4/7)

N N

Mt. Goyo, Iwate, Honshu Chiba, Honshu

2

Gyo1 (2/6)

N

13

N

2

Kmo1 (1/7)/Kmo2 (3/7)/Ama1 (9/6) Kna1 (1/7)/Kna2 (1/7)

N

1 2

Tga1 (1 /7) Wda1 (1/6)/Wda2 (1/6)

N N

3 6

Yma1 (3/4) Tma1 (6/4)

S S

Gto1 (3/4) Gto1 (1/4) Mya1 (1/5)/Mya2 (1/5)/Mya3 (2/5) Kgo1 (4/4)

S S S

Localities

N examined

8 9

Kanayama,Gifu, Honshu Taga, Shiga, Honshu Wadayama, Hyogo, Honshu Yamaguchi, Honshu Tsuhima Island

10 11 12

Goto Islands Nagasaki, Kyushu Miyazaki, Kyushu

3 1 4

13 C. n. yakushimae 14

Kagoshima, Kyushu

4

Yakushima Island

7

15 C. n. mageshimae 16 C. n. keramae 17

Kuchinoerabu Island

6 7

C. n. nippon

CHINA C. n. hortulorum 18 C. n. sichuanicus 19 C. n. kopchi 20 a

S

3

Yku1 (1/4)/Yku2 (1/4)/ Yku3 (2/4)/Yku4 (2/4)/Yku5 (1/4) Kti1 (3/4)

S

S

Tanegashima Island

3

Tng1 (3/4)

S

Kerama Island

1

Kra1 (1/5)

S

Jilin Province

7

CNCI3 (7/4)

C

Sichuan Province

4

CNCI1 (4/4)

C

Anhui Province

2

CNCI2 (1/4)/CNCI4 (1/4)

C

Ohtaishi (1986) and Ohtaishi and Gao (1990). N, S, or C represent Northern Japan group, Southern Japan group, or Chinese group, respectively (see Figs. 3.2 and 3.3).

b

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

31

Fig. 3.1 Sampling locations of the sika deer, Cervus nippon. Numbers correspond to those in Table 3.1.

Table 3.2 Primers for PCR and sequencing. Name

Sequences (5′–3′)

L strand LD15926 CTAATACACCAGTCTTGTAAACC CervL1 CAACCTTCAAGGAAGAAGCCAT LD5 AAGCCATAGCCCCACTATCAA LD15 TATATGCCCCATGCTTATAAGC CervL3 ACCATGCCGCGTGAAACCAG LD3 CTCTTCTCGCTCCGGGCCCATGAA CervL4 GACTAATGACTAATCAGCCCAT LD7 ACTCAGCAATGGCCGTCTGAGG LD9 ATCATCATTTTTAACACACTTT H strand HD10 TAGGACATAAATGTAAATTGGGTG HD2 CCTGAAAAAAGAACCAGATG HD14 TGGGGATGCTCAAGATGCAG HD8 TTGACTTAATGCGCTATGTA HD6 GTCCTGTGACCATTGACTGC H597 AGGCATTTTCAGTGCCTTGCTTTG CervH1 CAAACCTATGTGTTTATGGAGT CervH3 CCCGGAGCGAGAAGAGGGAT *Note: Primers with asterisks were created for this study.

Length

Reference and DNA data base accession No.

23 22 21 22 20 24 22 22 22

Nagata et al. 1998 AB295410 Nagata et al. 1998 Nabata et al. 2004 AB295414 Unpublished AB295416 * *

24 20 20 20 20 24 22 20

Nabata et al. 2004 Nagata et al. 1998 * Nagata et al. 1998 Nagata et al. 1998 Nagata et al. 1998 AB295418 AB295415

32

J. Nagata Primers for L strand Tandem repeat CervL1

LD15

L 15926 LD5

Thr

tRNA

LD9

CervL3 CervL5 LD3

LD7

1 2345 67

tRNAPro

HD10

tRNA

HD8

HD2

CervH3

HD6 HD14

Phe

CervH1 H597

Primers for H strand

Fig. 3.2 Schematic diagram of the mitochondrial DNA control region (shaded boxes) of the sika deer. Numbers 1 through 7 indicate tandemly repeated units. Bars show the rough positions of primers used for amplification and/or sequencing.

the analysis. The sequence obtained from one red deer, Cervus elaphus xanthopygus, (AF296817) was used as an outgroup to set a root for the phylogenetic tree. Gap sites and tandem repeated regions were deleted for sequence analysis. The bootstrap analysis (Felsenstein 1985) consisted of 1,000 replications for the NJ tree. We defined three sika deer lineages in the NJ tree; the Northern Japan, the Southern Japan, and China. Nucleotide diversity, π (Nei 1987) and percentage differences were calculated for the three lineages. As an approach to investigate the relationships among the three lineages, genetic distances were calculated using AMOVA (Excoffier et al. 1992). In this analysis, the pairwise sequence differences among the haplotypes were used as a measure of molecular divergence. Significance of the F st value was determined by performing randomization tests using 1,000 replications (Excoffier et al. 1992).

Results MtDNA control regions of the 74 sika deer individuals from 17 localities of Japan and three localities in China (Table 3.1, Fig. 3.1) were successfully PCR-amplified with primers L15926/H597, L15926/HD6, and LD3/H597. Using PCR productdirect sequencing with 16 primers (Fig. 3.2, Table 3.2 except L15926), nucleotide sequences from all sika deer samples were determined. Sequence analysis of control region was operated based on the shortest sequence Yku2. The length of the compared region varied from 705 bases to 824 bases due to insertion or deletion and varied unit number of tandem repeats (see below). We found 30 haplotypes in control region sequences (Table 3.1). Gap sites and the repeated domain in sequence alignment were deleted and then 577 bases were used for further

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

33

pairwise comparisons. As a result, Mya1 and Yku1 were identical with Mya2, Yku2 and Yku4 respectively, because the nucleotide differences between them were within their repeated domains. The nucleotide sequences reported in this paper will appear in the DDBJ/EMBL/ GenBank nucleotide sequence databases with the accession numbers AB378335– AB378377.

Molecular Phylogeny of Sika Deer Control Region The control region phylogenetic tree of the 30 haplotypes was reconstructed by the neighbor-joining method (Fig. 3.3). The phylogenetic tree showed that the Japanese sika deer are separated into two lineages: the Northern Japan group and the Southern Japan group (Fig. 3.3, Table 3.1) with high bootstrap values (958 and 891 on Fig. 3.3). Haplotypes in the Northern Japan group were seen in Hokkaido Island and most of the Honshu mainland, while haplotypes of the Southern Japan group were located in Yamaguchi in the southern most Honshu mainland, Kyushu Island, and islands around Kyushu Island (Fig. 3.4).

Genetic Divergence and Relationships among Sika Deer Groups The number of haplotypes seen in the Northern Japan group, the Southern Japan group, and the China group were 11, 15, and 4, respectively (Table 3.3). Among the Northern Japan group, nucleotide diversity, π, was 10.10 ± 0.92, while it was 13.38 ± 0.44 for the Southern Japan group and 13.26 ± 1.53 for the China group (Table 3.3). We performed the AMOVA analysis to assess genetic differentiation among these lineages. The AMOVA analysis partitioned 33% of the total variation among three groups and 67% of the total within groups. The Fst value for three groups was 0.66 (p < 0.001 in the randomization test).

Tandem Repeats in the Sika Deer Control Region All sika deer examined in this study possessed arrays consisting of repeat units of 37–40 bases, each of which included several substitutions with the other units (see Nagata et al. 1999). The composition of the repeat unit types was different among groups due to substitutions (data not shown). As shown in Table 3.1 and Fig. 3.4, specimens from the Northern Japan group (Hokkaido and the Honshu islands, except Yamaguchi) contained six or seven units, while animals from the Southern Japan group (Yamaguchi, Kyushu, and southern islands) shared four or five units. Specially, five units were only seen in Miyazaki and Kerama Island. All animals from China possessed four units.

34

J. Nagata Hkb

998

Hka

337

Ama1 401

Kmo2

921 885

Kmo1

660 Wda1 Wda2 657 Tga1

672 958

Gyo1

Northern Japan

0.005

Kna2 698

Kna1

683

Yma1

556

753

Tma1 Kra1

419

Kgo1

891

582

Tng1 730

Yku5 Yku4

865 853

Southern Japan

504 Mya1 948 Mya2 786 Mya3 313 Gto1

759 Yku2 736 Yku1 Yku3

501

Ktil

China

CNCI3 CNCI4 CNCI2

914 927

CNCI1 Cervus elaphus xanthopygus

Fig. 3.3 NJ tree based on nucleotide sequences (577 bases) of the mitochondrial control regions in sika deer. Numbers near internal branches indicate the support values from 1,000 bootstrap replicates.

Discussion Classification and Phylogeny of the Japanese Sika Deer Many questions about the evolution of the Japanese sika deer are still open. One interesting question is the taxonomic position of the Tsushima population and the Hokkaido population. In traditional taxonomy of sika deer subspecies, the population on the Honshu mainland and that on the Tsushima Island were both classified as Cervus nippon centralis, and that on the Hokkaido Island was considered as C. n. yesoensis (Ohtaishi 1986). This classification has been widely accepted so far.

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

35

Fig. 3.4 Distribution of control region haplotypes. Numbers indicate number of repeat units.

Table 3.3 Number of haplotypes and nucleotide diversity (π) of nucleotide sequences of the mitochondrial control region in three sika deer lineages, Northern Japan, Southern Japan, and China. Nucleotide diversity No. of individuals No. of haplotypes (π × 1,000) Northern Japan Southern Japan China

26 35 13

11 15 4

10.10 ± 0.92 13.38 ± 0.44 13.26 ± 1.53

However, Imaizumi (1970) classified the Tsushima deer as a distinct species C. pulchellus based on peculiar characters such as strikingly narrow constriction of the jugal bone, deep emargination of the anterior border of the nasal bones, and a longer first segment of the antler, and he considered it a primitive and relic sika deer, compared with other Japanese sika deer populations. In addition, he classified the Hokkaido population in the species of the Asian continent C. hortulorum (Imaizumi 1970). The phylogenetic tree of control region sequences (Fig. 3.3) indicated two genetically distinct groups of sika deer (the Northern and Southern Japan groups) showing high bootstrap values. In the Northern Japan group, Hokkaido C. n. yesoensis and Honshu C. n. centralis (except for individuals from Yamaguchi and Tsushima)

36

J. Nagata

were very closely related to each other, and no obvious genetical distance was found between these subspecies. In this study we also analyzed Asian continental subspecies including C. n. hortulorum (Table 3.1). All individuals from C. n. hortulorum shared the same haplotype CNCI4. Our NJ tree (Fig. 3.3) obviously showed that CNCI4 did not have a close relationship with sika deer on Hokkaido Island, which implies that they are relatively closer to the Southern Japan group than to the Northern Japan group. Intrasubspecific differences between Honshu centralis of the northern group and Yamaguchi centralis or Tsushima centralis were much greater than intersubspecific differences between centralis and yesoensis of the northern group. The Southern Japan group including Yamaguchi and Tsushima centralis was clustered with a relatively high bootstrap value (753) (Fig. 3.3). These results are in agreement with data of mitochondrial cytochrome b sequences (Tamate et al. 1998). Additionally although the Shikoku population has been classified as C. n. nippon (Ohtaishi 1986), recently Yamada et al. (2006) found the two Japanese groups co-existing on the island. Thus, the relationships among these subspecies do not reflect the taxonomy previously reported (Imaizumi 1970; Corbet 1978; Matsumoto et al. 1984; Ohtaishi 1986). Tandemly repeated sequences including 37–40 bp were detected in the sika deer control region (Fig. 3.2). Between the Northern group and the Southern group in Japan, there were large differences in the unit number and the constitution of the first to third units. Moreover, the number of repeat units is specific to each population except for a population in Chiba (Table 3.1). Such a replication slippage could have occurred after isolation of populations on the Japanese islands, and the repeat patterns could have been fixed into each population probably due to genetic drift and/or inbreeding. The tandem repeat domains, therefore, are not concordant with the morphological taxonomy. However, it can be a handy genetic marker for identifying the northern lineage from the southern lineage.

Evolution and History of the Japanese Sika Deer From paleontological evidence, the American bison, Bison bison, was estimated to have diverged from the cow approximately one million years (Myr) before present. Based on the divergence time and the control region data (375 bases) reported by Loftus et al. (1994), the substitution rate in the cow control region was estimated to be 10.6%/Myr. In the sika deer control region sequences, percentage difference of the Northern group/Southern group, China/Northern group, and China/Southern group were 3.7%, 3.2%, and 2.9%, respectively. Considering the above substitution rate and the sequence differences obtained in the present study, the two lineages of Japanese sika deer were estimated to have diverged approximately 0.35 Myr before present. Percentage differences between the Northern group and the Southern group showed similar magnitude to that between the Northern group and the Chinese sika deer as well as that between the Southern group and Chinese sika. The large genetic divergence between the Northern group and the Southern group indicates

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

37

that segregation of mtDNA could have occurred prior to their colonization to Japan in the glacial period during the middle Pleistocene. The divergence time 0.35 Myr for the two groups of Japanese sika deer estimated in this chapter is not in discordance with Kawamura’s conclusion on the first sika deer colonization of Japan (0.4 Myr before present, Kawamura chapter 2). Kawamura (chapter 2) concluded that the most possible sika deer colonization route from the continent to Japan could be through the southern route via land bridges of the Korean Strait but could not be through the northern route via Sakhalin and Hokkaido Islands. As mentioned above, the haplotypes of Hokkaido Island, Hka and Hkb, are most genetically diverged from the haplotype CNCI4 which was detected among C. n. hortulorum, the northern most subspecies in China (Fig. 3.3). Thus, the genetic data also indicated that the northern route was considered to be unlikely. Although paleontological data do not show multiple sika deer colonization to Japan (see Kawamura’s chapter), the current peculiar distribution of the two mitochondrial lineage groups (see Fig. 3.4) implies that colonization from the continent to Japan could have occurred at least twice; one could have brought the ancestors of the Northern group, the other could have brought the ancestors of the Southern group. A probable scenario is that the first colonization brought ancestors of the Northern group (about 0.4 Myr). Judging from habitat preferences of extant Japanese sika deer, their ancestors may have established a population in temperate areas after the first colonization, then expanded northwards to suitable habitats during warmer stages. The first colonized group must have extended up to Sahama in Shizuoka Prefecture on the Honshu mainland at the very least (see Fig. 2.3 of Kawamura’s chapter and Takahashi et al. 2003). The second colonization brought ancestors of the Southern group and led secondly to contact between the two lineages in the Japanese archipelago, then may have pushed northwards the first colonized group, the Northern Japan group. Although there is no information on land bridges, according to Fig. 2.3 in Kawamura’s chapter, it is most likely that the second colonization occurred in MIS 6, about 0.15 Myr, which was one of the remarkably cold stages in the middle Pleistocene. A relatively smaller genetic distance between the Southern Japan group and the China group than one between the Northern Japan group and the China group (Table 3.3) would support that the southern group colonized the Japanese archipelago later than the northern group.

Biogeographic Boundaries, Genetic Boundary, and Biological Characteristics In Japan, biogeographic boundaries often lie between islands. Blakiston’s line, which lies in the Tsugaru Strait between Hokkaido Island and the Honshu mainland (Fig. 3.4), is one clear boundary for distribution of some mammals. For example the Asiatic black bear (Ursus thibetanus), Japanese squirrel (Sciurus lis), serow (Capricornus hircus), and Japanese macaque (Macaca fuscata) all occur on the southern side of Blakiston’s line. The Watase line, which lies in the Tokara Strait

38

J. Nagata

between Yakushima Island and Amami Ohshima Island (Fig. 3.4), forms a boundary between neotropical fauna/flora derived from the late Tertiary and the fauna/ flora originating in the Pleistocene. The deer on Kerama Island (no. 17 in Fig. 3.1) had been introduced from Kyushu (Okinawa Prefecture 1996). Our results are consistent with the Watase line. Part of our results suggests that biogeographic boundary (or zone of overlap) of sika deer lineages is not in agreement with Blakiston’s line. The demarcation occurs much further south, near the south end of the Honshu mainland. Kawamoto (2002) and Kawamoto et al. (2007) reported two mitochondrial lineages, the Eastern Japan lineage (corresponding to our Northern Japan) and the Western Japan lineage (corresponding to our Southern Japan), in Macaca fuscata. Interestingly, this species also has a genetic boundary which nearly coincides with the range of the two major groups of Japanese sika deer They estimated that the Western lineage is older than the Eastern lineage, which is consistent with the two major types of fauna/flora in Japan (Kondo 1982; Kamei et al. 1987; Kawamura et al. 1989). Recently, Hosoi et al. (2005) and Yamada et al. (2006) conducted further study on geographic boundaries between the two groups and found they co-exist in Hiroshima and Shimane prefectures, western parts of the Honshu mainland, and Shikoku Island. Interestingly, there are no boundaries between the two groups, and zones of overlap exist in the western Honshu mainland and Shikoku Island. Although the Hokkaido population (C. n. yesoensis) is morphologically close to the northernmost Chinese population (C. n. hortulorum) and was classified into a single species C. horturolum in the past (Imaizumi 1970), the Hokkaido haplotypes were not genetically closely related to CNCI4 which C. n. hortulorum possessed but were closely related to most of the Honshu haplotypes (Fig. 3.3). Kawamura (chapter 2) reported that the colonization into Hokkaido Island may have occurred from the Honshu mainland through land or ice bridge connections between the Honshu mainland and Hokkaido Island in remarkably cold stages of the late Middle and Late Pleistocene, or by human introduction during the early Holocene. The close genetic distance between the Hokkaido population and the Honshu population in this study supports rather recent colonization from the Honshu mainland to Hokkaido Island. Are there any biological differences in the two lineages of Japanese sika deer? We know the feeding style may differ between the two lineages. Takatsuki (1991) reported the percentage of graminoids in the sika deer diet drastically changes from north to south. The northern sika deer diet is mostly graminoids, while southern sika eat broad-leaved plants. In other words, the northern sika is predominately a grazer, and the southern sika is a browser. Significantly, this diet shift zone is concordant with the genetic boundary. There are some other biological differences between the two lineages. For example, in the northern lineage populations in Hokkaido, Iwate, Tochigi, and Kanagawa, sika deer migrate seasonally between their winter and summer habitats (Miura 1974; Maruyama 1981; Ito and Takatsuki 1987; Uno and Kaji 2000). However, Takatsuki (2000) and Igota et al. (2004) revealed that seasonal migratory animals and residents are mixed in Iwate and Hokkaido. On the other hand, southern lineage

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

39

populations, such as Kyushu, do not show seasonal migration (Endo and Doi 1996; Yabe et al. 2001). In other words, the populations of the northern lineage are more adapted to cold regions with strong seasonality. How did the northern lineage in Japan differentiate to the southern lineage type? Studies on floral changes in Japan based on fossil pollen (Tsukada 1984) revealed that boreal conifer forests covered broad areas of the Japanese Archipelago from the southern Hokkaido Island to the western Honshu mainland and, in fact, reflected the cold climate during the last glacial period (25,000–15,000 years ago). When the second sika colonization happened from the continent to Japan (about 0.15 Myr ago) ancestors of the Southern group would have pushed ancestors of the Northern group northwards. This may have allowed the Northern group to adapt to the following cold climate during the last glacial period resulting in it being phenotypically more like northern sika on the continent. This study demonstrates that genetic distances of mtDNA sequences can be used to estimate genetic diversity in Japanese sika deer populations and to reconstruct evolutionary relationships between the populations. These results could provide a reliable insight for reconsidering subspecies taxonomy, biogeographic boundaries, and history of the sika deer. However, it is still unclear how mtDNA genetic difference affects the biological differences between north and south. To understand the evolution history of sika deer, we need to study relationships between those biological differences and genetic difference using other appropriate genes.

Literature Cited Aquadro, C. F., and B. D. Greenberg. 1983. Human mitochondrial DNA variation and evolution: Analysis of nucleotide sequences from seven individuals. Genetics 103:287–312. Brown, W. M., M. George, Jr., and A. C. Wilson. 1979. Rapid evolution of animal mitochondrial DNA. Proceedings of the National Academy of Sciences USA 76:1967–1971. Brown, W. M., E. M. Prager, A. Wang, and A. C. Wilson. 1982. Mitochondrial sequences of primates: Tempo and mode of evolution. Journal of Molecular Evolution 18:225–239. Cook, C. E., Y. Wang, and G. Sensabaugh. 1999. A mitochondrial control region and cytochrome b phylogeny of sika deer (Cervus nippon) and report of tandem repeats in the control region. Molecular Phylogenetics and Evolution 12:47–56. Corbet, G. B. 1978. The mammals of the Palaearctic Region: A taxonomic view. British Museum, London, United Kingdom. Corbet, G. B., and J. E. Hill. 1991. A world list of mammalian species. Oxford University Press, Oxford, United Kingdom. Endo, A., and T. Doi. 1996. Home range of female sika deer Cervus nippon on Nozaki Island, the Goto Archipelago, Japan. Mammal Study 21:27–35. Endo, H. 1996. Scientific and Japanese names of Artiodactyls of Japan. Honyurui Kagaku (Mammalian Science) 35:203–209. (In Japanese with English abstract.) Excoffier, L., P. E. Smouse, and J. M. Quattro.1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 131:479–491. Felsenstein, J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 39:783–791.

40

J. Nagata

Hosoi, E., M. Yamada, H. Tado, and S. Ozawa. 2005. Geographic boundaries of the two distinct lineages of the sika deer, Cervus nippon, in Japan. The 9th international Mammalogical Congress, July-August, 2005, Sapporo, Hokkaido, Japan. Igota, H., M. Sakuragi, H. Uno, K. Kaji, M. Kaneko, R. Akamatsu, and K. Maekawa. 2004. Seasonal migration patterns of female sika deer in eastern Hokkaido, Japan. Ecological Research 19:169–178. Imaizumi, Y. 1970. Description of a new species of Cervus from the Tsushima Island, Japan, with a revision of the subgenus sika based on clinal analysis. Bulletin of the National Science Museum, Tokyo 13:185–196. Ito, T., and S. Takatsuki. 1987. Distribution and migration pattern of sika deer in Mt. Goyo. The Bulletin of Yamagata University 11:411–430. Kamei, S., Z. Kawamura, and H. Taruno. 1987. Mammals. Pages 86–89 in The Quantity Society of Japan, editor, Illustrated map of the quantity in Japan. Tokyo University Press, Tokyo, Japan. (In Japanese.) Kawamoto, Y. 2002. Population genetics on establishment of a species of Macaca fuscata. Asian Paleoprimatology 2:55–73. Kawamoto, Y., T. Shotake, K. Nozawa, S. Kawamoto, K. Tomari, S. Kawai, K. Shirai, Y. Morimitsu, N. Takagi, H. Akaza, H. Fujii, K. Hagihara, K. Aizawa, S. Akachi, T. Oi, and S. Hayashi. 2007. Postglacial population expansion of Japanese macaques (Macaca fuscata) inferred from mitochondrial DNA phylogeography. Primates 48:27–40. Kawamura, Y. 1982. Biogeographical aspects of the Quaternary mammals of Japan. Honyurui Kagaku (Mammalian Science) 43–44:99–130. (In Japanese.) Kawamura, Y. 1991. Quaternary mammalian faunas in the Japanese islands. Quaternary Research 30:213–220. Kawamura, Y., T. Kamei, and H. Taruno. 1989. Middle and Late Pleistocene mammalian faunas in Japan. Quaternary Research 28:317–326. (In Japanese with English abstract.) Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111–120. Kondo, N. 1982. Mammal fauna of Japan, with special reference to the ecological property of species, paleo-environment and the Tsugaru Strait. Honyurui Kagaku (Mammalian Science) 43–44:131–144. (In Japanese.) Loftus, R. T., D. E. MacHugh, D. G. Bradley, P. M. Sharp, and P. Cunningham. 1994. Evidence for two independent domestications of cattle. Proceedings of the National Academy of Sciences USA 91:2757–2761. Maruyama, N. 1981. A study about seasonal migration and gathering of sika deer, Cervus nippon TEMMINCK. Report of the Department of Agriculture, Tokyo University of Agriculture and Technology 23:85. (In Japanese with English summary.) Matsumoto, M., H. Nishinakagawa, and J. Otsuka. 1984. Morphometrical study on the skull of Cervus pulchellus, Cervus nippon mageshimae and Cervus nippon yakushimae. Journal of the Mammalogical Society of Japan 10:41–53. (In Japanese with English abstract.) Miura, S. 1974. Seasonal changes of sika deer habitats in Hinoebora, Tanzawa, Japan. Honyu Dobutugaku Zassi 6:51–66 (In Japanese). Nabata, D., R. Masuda, O. Takahashi, and J. Nagata. 2004. Bottleneck effects on the sika deer Cervus nippon population in Hokkaido, revealed by ancient DNA analysis. Zoological Science 21:473–481. Nagata, J., R. Masuda, and M. C. Yoshida. 1995. Nucleotide sequences of the cytochrome b and 12S rRNA genes in the Japanese sika deer Cervus nippon. Journal of the Mammalogical Society of Japan 20:1–8. Nagata, J., R. Masuda, K. Kaji, M. Kaneko, and M. C. Yoshida. 1998. Genetic variation and population structure of Japanese sika deer (Cervus nippon) in Hokkaido Island, based on mitochondrial D-loop sequences. Molecular Ecology 7:871–877. Nagata, J., R. Masuda, H. B. Tamate, S. Hamasaki, K. Ochiai, M. Asada, S. Tatsuzawa, K. Suda, H. Tado, and M. C. Yoshida. 1999. Two genetically distinct lineages of the sika deer, Cervus nippon,

3

Two Genetically Distinct Lineages of the Japanese Sika Deer

41

in Japanese islands: Comparison of mitochondrial D-loop region sequences. Molecular Phylogenetics and Evolution 13:511–519. Nei, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York, New York, USA. Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation on sika deer. Honyurui Kagaku (Mammalian Science) 53:13–17. (In Japanese.) Ohtaishi, N., and Y. T. Gao. 1990. A review of the distribution of all species of deer (Tragulidae, Moschidae and Cervidae) in China. Mammal Review 20:125–144. Okinawa Prefecture. 1996. A report of conservation and management of sika deer in Kerama Island. Board of Education, Okinawa Prefecture, Okinawa, Japan. (In Japanese.) Saitou, N., and M. Nei. 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406–425. Takahashi, K., H. Matsuoka, H. Taru, K. Yasui, and Y. Hasegawa. 2003. Vertebrate fossils from the excavation site of the Naumann’s elephant (Palaeoloxodon naumanni) at Sahama. Shizuoka Chigaku 87:15–21. (In Japanese.) Takatsuki, S. 1991. Feeding ecology of ungulates with reference to cervids. Pages 119–144 in Asahi M. and Kawamichi K., editors, Modern Mammalogy. Asakura Publishing, Tokyo, Japan. (In Japanese.) Takatsuki, S. 2000 Seasonal elevational movements of sika deer on Mt. Goyo, northern Japan. Mammal Study 25:107–114. Tamate, H. B., and T. Tsuchiya. 1995. Mitochondrial DNA polymorphism in subspecies of the Japanese sika deer, Cervus nippon. Journal of Heredity 86:211–215. Tamate, H. B., S. Tatsuzawa, K. Suda, M. Izawa, T. Doi, K. Sunagawa, F. Miyahira, and H.Tado. 1998. Mitochondrial DNA variations in local populations of the Japanese sika deer, Cervus nippon. Journal of Mammalogy 78:1396–1403. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX windows interface: Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24:4876–4882. Tsukada, M. 1984. A vegetation map in the Japanese archipelago approximately 20,000 years B. P. Japanese Journal of Ecology 34:203–208. (In Japanese with English abstract.) Uno, H., and K. Kaji. 2000. Seasonal movements of female sika deer in eastern Hokkaido, Japan. Mammal Study 25:49–57. Yabe, T., T. Koizumi, A. Endo, S. Seki, and Y. Miura. 2001. Home range of sika deer in the central mountains in Kyushu. Kyushu Journal of Forest Research 54:131–132. (In Japanese.) Yamada, M., E. Hosoi, H. B. Tamate, J. Nagata, S. Tatsuzawa, H. Tado, and S. Ozawa. 2006. Distribution of two distinct lineages of sika deer (Cervus nippon) on Shikoku Island revealed by mitochondrial DNA analysis. Mammal Study 31:23–28.

Chapter 4

Evolutionary Significance of Admixture and Fragmentation of Sika Deer Populations in Japan Hidetoshi B. Tamate

Abstract The sika deer is genetically very close to the red deer (Cervus elaphus): nucleotide divergences between the two species are less than 1% in most of the protein-coding sequences. Genetic markers that were developed for red deer and other cervine, ovine, and bovine species are readily applicable to genetic analyses of sika deer. By using such DNA markers, I and my colleagues studied the level of genetic diversity of local populations, past demographic changes of populations, and spatial structures of populations. A phylogenetic tree constructed from microsatellite allele frequencies separates “northern” and “southern” groups in different clusters, showing a similar split pattern between the two lineages as observed in the mtDNA-based phylogenetic tree. However, the level of differentiation between the northern and southern mtDNA groups is lower than that among the populations in Honshu, which suggest that the genetic difference between the two groups has been reduced by the admixture. The genetic differentiation among populations was caused by a loss of genetic variation during past fragmentation of populations and not by the accumulation of novel mutations in each population. Two cases of the fragmentation of sika deer populations at a local scale, which were revealed by DNA analyses, are described in this chapter. Population genetic studies thus provide empirical data for monitoring and predicting long-term changes in demography and population structure of sika deer.

Introduction Recent molecular phylogenetic studies have shown that the Japanese sika deer is genetically subdivided into two major mitochondrial DNA (mtDNA) lineages, the northern and southern haplotype groups, and that a split between the two had occurred in the mid-Pleistocene (Nagata et al. 1999; Nagata chapter 3). Despite the deep divergence time, sympatric distribution of the two groups has been observed in eastern Shikoku Island (Yamada et al. 2006), suggesting secondary contact between genetically differentiated populations in the Japanese Archipelago. Such encounters between populations often lead to the formation of a new population by a genetic D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_4, © Springer 2009

43

44

H. B. Tamate

process known as “admixture” if they are not separated reproductively. Admixture sometimes causes the genetic traits of the resultant population to change because more advantageous alleles are likely to be selected during a merger of populations. Since there is no geographical boundary between the two groups of sika deer on Honshu Island, it is likely that admixture caused the genetic variations that might have been selected independently in each lineage to intermingle, and hence it caused the morphological and physiological differences—if they exist—between the northern and southern deer to diminish. As the admixture proceeds, it will reinforce the adaptability of deer in the merged population in accordance with their new environment. Genetic studies of the population structure, therefore, are important to help elucidate the nature and evolutionary significance of the sika deer in different environments in Japan, from subtropical to cold-temperate zones. In this chapter, I will first summarize our current knowledge of the basic genetics of the Japanese sika deer. I then refer to the population history of the sika deer and discuss how local populations have been established in the Japanese Archipelago. Finally, I will return to an old question—the taxonomy and species concept of the sika deer—to which recent genetic studies have provided some clues.

Basic Genetic Characteristics of the Sika Deer Genes To date, about seven hundred nucleotide sequences of the sika deer have been deposited in DNA databases such as GenBank, EMBL Nucleotide Sequence Database (EMBL) and DNA Databank of Japan (DDBJ). Those sequences consist of nuclear DNA, mitochondrial DNA, and complementary DNA (Table 4.1). Homology analysis of the deposited nucleotide sequences has shown that the sika deer is genetically very close to the red deer/wapiti (Cervus elaphus) (wapiti are the somewhat different lineage of Cervus elaphus distributed in East Asia and North America); nucleotide divergences between the sika and red deer are less than 1% in most of the protein-coding sequences (Table 4.2). Our recent study also demonstrated that sequences at the second exon of the major histocompatibility complex (MHC) DRB locus in the sika deer are not separated phylogenetically from those of the red deer (Fig. 4.1), suggesting that some genetic variations are shared by the two species. Therefore, genetic markers that are developed for the red deer are readily applicable to studies of sika deer. Also, bovine and ovine microsatellites are often utilized in genetic analyses of the sika deer as well as other deer species because they are conserved well among Artiodactyla (Slate et al. 1998). A large number of such genetic markers can be found in the linkage map of the red deer (Slate et al. 2002). Those markers allowed us to study the level of genetic diversity of a single population (Tamate et al. 1998),

4

Evolutionary Significance of Admixture and Fragmentation

45

Table 4.1 Number of nucleotide sequences deposited in GenBank in June, 2006. Category Sika deer Red deer Mitochondrial DNA Protein coding rRNA or tRNA coding D-loop Nuclear DNA Protein coding without MHC MHC Microsatellite and/or non-coding cDNA and EST Patented sequencea Total a Features are not described in detail.

148 43 12 93 378 25 330 23 23 0 549

162 51 17 94 220 62 97 61 72 6 460

Fig. 4.1 Neighbor-joining tree based on MHC-DRB sequences (210 bps) among sika deer (CeniDRB) and red deer (CeelDRB). Branching patterns are shown if the bootstrap value at a node is more than 50%. Branch lengths do not reflect genetic distances. Red deer sequences (CeelDRB.13, 21, 26, 37, 46, and CeelDRQ.03 which was used as an outgroup) were retrieved from Genbank. Sika deer sequences (CeniDRB.clone 1, 2, 3, 5, and 9) were determined in the present study.

past demographic changes of populations (Goodman et al. 2001), pedigree structure (Okada and Tamate 2000), rate of gene flow among populations (Goodman 1999), and genetic relatedness between individuals (Okada et al. 2005). Moreover they provide empirical data to help determine management units (Yuasa et al. 2007). These topics of study will be discussed later in this chapter.

46

H. B. Tamate

Despite the increasing number of DNA and protein sequence data in the database, genes that determine the distinctness of the deer are yet to be identified. Morphological characteristics of the sika deer such as body size, the shape of the antlers, and pelage pattern are supposed to be under the control of a group of genes known as the quantitative trait loci (QTL). To date, a large panel of microsatellite markers has been used to map the QTL in the red deer, and this map has begun to show the chromosomal regions that are responsible for various quantitative traits (Slate et al. 2002). It is expected that in future research the genes responsible for the morphological and physiological characteristics of the sika deer will be identified by means of a genome-wide analysis of the red deer and related species.

Chromosomes An odd number of chromosomes in a diploid organism is often a consequence of the hybridization between closely related species that differ in chromosome number. Such a phenomenon has been shown to occur in the Japanese sika deer. The number of chromosomes in the Japanese sika deer varies from 65 to 68 (Ohmura et al. 1983). The mode of the chromosome number in northern sika deer, C. n. yesoensis from Hokkaido, is 68 with a pair of metacentric chromosomes (Ohmura et al. 1983; Yokohama et al. 1994), which is supposed to be the basic chromosome number in Cervidae (Slate et al. 2002). In contrast, C. n. nippon from the Chugoku region, a representative of the southern sika deer, possesses 66 chromosomes including two pairs of metacentric chromosomes (Ohmura et al. 1983), implying that a metacentric fusion of chromosomes took place during the differentiation of the southern sika deer. Because an odd number of chromosomes, 67, was found among deer in Honshu and Hokkaido, Ohmura et al. (1982) suggested that a past hybridization had

Table 4.2 Number of nucleotide substitutions between the sika and red deer in protein-coding genes. Number of Maximum number nucleotides of substitution Protein-coding genes compared (bps) sites (bps) Reference Amelogenin Y Growth hormone precursor Kappa-casein precursor Prion protein

101 273 371 706

0 1 2 3

Sex determining factor (SRY)

166

1

Yamauchi et al. (2000) Chikuni et al. (1994) Cronin et al. (1996) Jeong et al. (accession number DQ234266) Takahashi et al. (1998)

4

Evolutionary Significance of Admixture and Fragmentation

47

occurred between two different karyotype groups of the Japanese sika deer. He then hypothesized that the Japanese sika deer have evolved from those deer that migrated from the south at one period and from the north at another period. After 16 years, his hypothesis gained further support from molecular studies (Tamate et al. 1998; Nagata et al. 1999). Chromosomes are still important markers in the study of the evolution of the sika deer because they are used to detect genome-wide changes such as recombination and translocation, which cannot be easily analyzed by mtDNA and microsatellite markers.

Population History of the Japanese Sika Deer Revealed by Genetic Studies Admixture in the Past MtDNA-based phylogeography of the sika deer indicated clearly that the two genetically differentiated populations—the northern and southern haplotype groups—came in contact with each other on the Japanese Archipelago. The question then arises as to what extent the two populations have been mixed after their encounter. Recently, Hosoi and his colleagues conducted fine-scale analysis of the mtDNA phylogeography over the contact zone of the two haplotype groups in eastern Shikoku and found that southern and northern haplotypes are distributed in a mosaic-like pattern within a hundred-kilometer range (Yamada et al. 2006, 2007). Considering that the rate of nuclear gene flow is generally higher than the rate of MtDNA introgression in animals with female-biased philopatry, it is reasonable to assume that genetic admixture beyond the contact zone is in progress. If the admixture proceeds, genetic differences between the northern and southern groups will be reduced unless disruptive selection, in which individuals with extreme phenotypes have a higher fitness than those with mean values, takes place (Page and Holmes 1998). To determine the level of genetic differentiation among the Japanese sika deer on a regional scale, I and my colleagues conducted population-genetic analyses of samples collected from three main regions, namely, Hokkaido, Honshu, and Kyushu (Fig. 4.2), by using nine microsatellite loci (Goodman et al. 2001). In contrast to mtDNA markers that represent matrilineal lineage only, microsatellite markers on autosomal chromosomes correspond to gene flow mediated by both sexes and are therefore suitable for studying population history under an assumption of the neutral model of molecular evolution. The neutral model is based on a theory that the most of genetic variations within a species are selected by chance (Page and Holmes 1998), which gives a theoretical framework for population-genetic analyses. The microsatellite data demonstrated that some alleles are found exclusively in the southern mtDNA haplotype group; allele 169 at the BMC4107 locus and allele 123 at the OARfcb193 locus, for instance, are only observed among populations from southern Honshu and Kyushu. A phylogenetic tree constructed from microsatellite allele frequencies separates “northern” and “southern” groups in different

48

H. B. Tamate

Fig. 4.2 Distribution of sika deer populations discussed in the present study. Dark-shaded areas show current distribution of sika deer in Japan except the Ryukyu Islands. Localities are indicated by numbers: (1) NW Hokkaido, (2) Akan, (3) Daisetsu, (4) Hidaka, (5) Iwate, (6) Kinkazan Island, (7) Shizuoka, (8) Nara, (9) Shoudoshima Island, (10) Hyogo, (11) Shimane, (12) Yamaguchi, (13) Tsushima Island, (14) Nagasaki, (15) Miyazaki, (16) Tanegashima Island, and (17) Yakushima Island. Populations that belong to the northern and southern mtDNA lineages are indicated by open circles and closed circles, respectively.

clusters, showing a similar split pattern between the two lineages as observed in the mtDNA-based phylogenetic tree (Fig. 4.3). Genetic analysis of population differentiation revealed, however, that the level of differentiation between the northern and southern groups is lower than that among the populations within the region of Honshu (Table 4.3). Genetic differentiation among groups of populations was quantified by calculating θ and ρ, estimators of population differentiation based on Fst (Weir and Cockerham 1984) and Rst (Slatkin 1995), respectively. There is a weak but significant correlation between geographical distance and the magnitude of genetic differentiation (Goodman et al. 2001). This represents a pattern of “isolation by distance” which suggests gene flow over whole populations. We concluded, therefore, that the genetic difference between the northern and southern mtDNA groups in the nuclear genome has been reduced by the admixture, even though the groups are subdivided phylogenetically.

4

Evolutionary Significance of Admixture and Fragmentation

49

Fig. 4.3 Phylogenetic tree based on Cavalli-Sforza Edwards distance calculated from microsatellite data. Populations of sika deer in Scotland (Fife and Peebles) and in England (Dorset) and a population of red deer in Scotland (Argyll) are included in the analysis. Branch lengths reflect genetic distance according to scale, and numbers at nodes show bootstrap values over 50% (from Goodman et al. 2001).

Bottlenecking in the Past According to our microsatellite data, two measures of genetic diversity of a population, average expected heterozygosity and allelic richness (average number of alleles per locus), ranged from 0.10 to 0.65, and from 1.5 to 5.1, respectively,

50

H. B. Tamate

Table 4.3 Population differentiation among sika deer in hierarchical groupings (from Goodman et al. 2001). Populations θ ρ All 0.429 0.577 (0.565–0.613) Japan only 0.415 0.483 (0.475–0.519) Hokkaido-North Honshu-South 0.343 0.323 (0.295–0.375) Honshu-Tsushima-Kyushu-Kyushu Islands Hokkaido-Honshu-Kyushu 0.219 0.245 (0.229–0.275) Northern mtDNA haplotypes-Southern 0.166 0.190 (0.161–0.229) mtDNA haplotypes 0.035 (0.018–0.131)** Hokkaido (Akan-Daisetsu-Hidaka-NW Hokkaido) 0.009* Honshu (Iwate-Kinkazan-Hyogo-Shimane0.296 0.321 (0.304–0.370) Yamaguchi-Tsushima) Kyushu (Nagasaki-Miyazaki0.552 0.543 (0.514–0.605) Tanegashima-Yakushima) UK introduced sika 0.471 0.447 (0.412–0.583) Values in parentheses for ρ are 95% confidence intervals. *P = 0.200, **P = 0.24, all other comparisons P < 0.001, permutation test.

among populations (Fig. 4.4). The genetic diversity is mainly determined by the balance between genetic drift and gene flow. Genetic diversity declines rapidly due to the effect of genetic drift if a population has a small effective population size (Ne) or has experienced a sudden decrease in the size of a population, often called “bottlenecking,” in the past. Gene flow among populations, on the other hand, counteracts the genetic drift and decelerates the reduction of the diversity. Regression analysis showed that the diversity measure positively correlates with the habitat fragment size (Goodman et al. 2001), indicating that current population size is a major factor that determines the level of genetic diversity. There are, however, some cases in which current population size and diversity do not match. Hokkaido populations have a remarkably low level of diversity even though they occupy the largest habitat area among the populations in Japan (Goodman et al. 2001). This can be explained as a consequence of bottlenecking that occurred in the past. Molecular phylogeographic studies revealed that the current Hokkaido populations have recovered from three remnant populations that survived severe bottlenecking in the last century (Nagata et al. 1998, 2004). The microsatellite analysis provides another piece of evidence for the recent bottlenecking in Hokkaido and presents empirical data showing that genetic diversity does not keep up with rapid growth of populations over 100 or so years. In contrast to the Hokkaido populations, the genetic diversity is unexpectedly high in a small population on Kinkazan Island (for a description of the island see Takatsuki and Padmalal chapter 8). The census population size (Nc) of deer on this island, which has been recorded since the 1970s, never exceeded about 550 individuals. An estimate of the effective population size (Ne), on the other hand, has been calculated to be 220 based on the proportion of reproductive individuals (Tamate et al. 2000), and 256 based on the allele frequency data (Goodman et al. 2001). It is expected theoretically that the genetic diversity declines rapidly with such a small

4

Evolutionary Significance of Admixture and Fragmentation

51

Fig. 4.4 Genetic diversity and habitat sizes of sika deer populations in Honshu and Kyushu. Genetic diversities were measured as heterozygosity and an average number of alleles per locus (Allelic Richness). Habitat sizes are shown in square kilometers. Numbers in open circles correspond to sampled populations as shown in Fig. 4.2.

population size. Therefore, it remains an unsolved question why the Kinkazan population retains a relatively high level of diversity despite its small population size. The highest genetic diversity is observed in the Nara population (for a description of this population see Torii and Tatsuzawa chapter 25). Historically, this population has been protected for religious reasons since the Middle Ages, which leads to an assumption that the population has been free from bottlenecking caused by overexploitation. By using microsatellite markers, we carried out two different tests, M ratio (Garza and Williamson 2001) and heterozygosity excess test (Cornuet and Luikart 1996), to determine whether the Nara population has experienced bottlenecking in the past. The results showed no sign of bottlenecking. It is likely, therefore, that the Nara population is most likely to represent the genetic variability of the ancestral populations of sika deer on the Honshu mainland. Goodman et al. (2001) carried out further microsatellite analysis using a coalescent-based genetic approach to test whether the observed diversity data are best explained by either of two alternative demographic hypotheses, “gene flow and drift” or “drift only” models. The result suggested that populations in Kyushu have been under “drift and gene flow” equilibrium—a balanced condition in which genetic variations will be lost due to genetic drift but will be supplemented by gene flow from other populations. It is therefore likely that the sika deer in Kyushu consist

52

H. B. Tamate

of a metapopulation: a group of partially isolated populations among which exchange of individuals is quite infrequent. The population history that led to such a metapopulation was described for tule elk, and the effect of demographic changes on retention of genetic diversity was discussed in McCullough et al. (1996). In contrast, the genetic differences among the Honshu populations are explained by the “drift-only” model, which implies that the populations have been isolated from each other. It is concluded, therefore, that genetic differentiation among current Japanese populations on a regional scale was facilitated not by a long-term evolutionary process but by a short-term stochastic change in the allelic frequency of individual populations.

Fragmentation at Present To evaluate the impact of habitat fragmentation over populations within a region, Yuasa et al. (2007) conducted local-scale genetic analysis of the population structure of the sika deer in southern Kanto, central Japan. The distribution of the deer in this region is discontinuous due to the development of large urban areas and road networks. Genetic diversity indices have suggested that seven local populations in southern Kanto probably experienced population bottlenecking in the recent past. Nested clade analysis of the mtDNA control region variations among local populations indicated restricted gene flow within the region. The sika deer in the southern Kanto region, therefore, are fragmented not only geographically, but genetically into several local populations. These populations are likely to function as a metapopulation, as suggested by the genetic and ecological studies (Yuasa et al. 2007). Another case of fragmented populations was observed on Shoudoshima Island. The population on this island is subdivided into two subpopulations (the northern Shoudo and southern Santo peninsula populations) only about a 10 km distance from each other, separated by a residential area. Microsatellite analysis demonstrated that the two local populations are genetically differentiated (Fig. 4.5). An assignment test indicated that none of the individuals were likely to immigrate between the two populations (data not shown). These results showed clearly that population fragmentation within a small area can be caused by human activities, even for highly mobile animals like the sika deer. In summary, population-genetic studies revealed significant genetic differentiation among populations of the Japanese sika deer. Such genetic differentiation, however, is mainly caused by a loss of genetic variation during population fragmentation, and not by the accumulation of novel mutations in each population. It can be said, therefore, that populations of the Japanese sika constitute a single evolutionary significant unit so far as neutral loci are concerned. Nevertheless, it remains unknown whether the Japanese sika deer populations differ locally in genetic variations that correspond to their adaptability to different habitats.

4

Evolutionary Significance of Admixture and Fragmentation

53

Fig. 4.5 Phylogenetic tree showing genetic relationships among individuals sampled from Shoudoshima population. The tree was constructed by the neighbor-joining method based on Cavalli-Sforza Edwards distance calculated from microsatellite data. Deer in northern Shoudo population (open circles) and southern Santo peninsula population (closed circles) are clustered into separate clades according to the localities except for one individual on the Santo peninsula.

Taxonomy and Species Concept of the Sika Deer Reexamined by Recent Genetic Studies Taxonomy The sika deer was first described as the species “Cervus nippon” by Temminck in 1838, who examined a specimen that was collected in Kyushu. In the classification system in use at the time, the definition of a species was based solely on the morphological species concept; if a group of animals has remarkable morphological characteristics that can be easily distinguished from other groups, it should be classified as a separate taxon. To the eyes of researchers who came from Europe in the nineteenth century, the sika deer was no doubt a distinct species because of its unique pelage pattern, antler shape, and small body size. Even at that time, however, a question was posed regarding the taxonomic status of the sika deer in Hokkaido. Blakiston (1883), a British zoologist who studied mammalian fauna in Japan, wrote that the deer in Hokkaido and those on the mainland were identical. He also noted, however, that Reverend Père Heude, who had examined a head of deer from

54

H. B. Tamate

Hokkaido, informed him that the specimen was rather like C. manchuricus minor or an unknown species. Some taxonomist later classified the sika deer in Hokkaido and northern China as a separate taxon, C. horturolum (Imaizumi 1970). Another debate over the taxonomy of the sika deer has continued since Imaizumi (1970) classified the sika deer from the Tsushima Islands into a separate species, C. pulchellus. He proposed this novel taxon because several measures of the cranial morphology of the deer did not fit into the “cline” of the morphological variations among C. nippon and C. hortulorum. Matsumoto et al. (1984), however, later pointed out that the morphological differences between the deer from the Tsushima Islands and C. nippon are not readily distinguishable. Even morphological variations among local races of sika deer are evident (Kuroda and Okada 1950), a range of morphological variations that do not overlap with those of the red deer/wapiti (Cervus elaphus), a closely related species that is sympatric with sika deer in northeastern China and Far East Russia (see Aramilev chapter 33). For this reason, it is widely accepted at present that in morphology-based taxonomy the sika deer is a single species, and all local races of the sika deer are classified into subspecies according to their natural distribution (Ohtaishi and Gao 1990). Recent molecular phylogenetic studies have provided further support for the classification; both the deer in Hokkaido (C. horturolum sensu Imaizumi) and the deer in the Tsuhima Islands (C. pulchellus sensu Imaizumi 1970) remain within a clade of C. nippon in molecular phylogenetic trees. It has also been shown that nucleotide sequence divergence between C. pulchellus sensu Imaizumi 1970 and C. nippon stays within the level observed within a species (Kuwayama and Ozawa 2000; Li et al. 2003). It has been concluded, therefore, that C. nippon Temminck 1883 is the only valid taxon for the Japanese sika deer at the species level. At the subspecies level, as discussed in a earlier chapter (Nagata chapter 3), molecular studies have demonstrated that the morphology-based taxonomy does not reflect the phylogeny. For example, three subspecies, C. n. keramae, C. n. nippon and C. n. yakushimae, are indistinguishable in the mtDNA cytochrome-b lineage, as they share a common haplotype (Fig. 4.6). The subspecies of the sika deer do not necessarily correspond to evolutionarily significant units within the species; allopatry is the only reliable criterion for defining the subspecies of the sika deer.

Species Concept Revisited Since the 1980s, biochemical and genetic studies have explored “species differences” within the genus Cervus. Based on the biochemical analysis of serum proteins, Harrington (1985) suggested that the sika deer is serologically similar to Asian wapiti and suggested that the sika deer is a very close relative of the red deer. His idea was later confirmed by DNA-based studies (Kuwayama and Ozawa 2000; Pitra et al. 2004). A close relationship between the two species has also been demonstrated by geneticists who studied hybridization between the sika deer and red deer where sika have been introduced in Europe, which in both captive and natural populations often

4

Evolutionary Significance of Admixture and Fragmentation

55

Fig. 4.6 Parsimonious cladogram based on mtDNA cytochrome-b gene sequences (429 bps) among subspecies in Honshu and Kyushu. Large circles indicate the observed haplotypes and small closed circles indicate hypothetical haplotypes inferred from parsimonious analysis. A common haplotype among three subspecies, C. n. keramae, C. n. nippon, and C. n. yakushimae, is shown by a larger circle in the center.

leave fertile offspring (Lowe and Gardiner 1975; Abernethy 1994; Goodman et al. 1999; Swanson and Putman chapter 40). The lack of reproductive isolation was also reported among species of Cervinae, such as in hybrids between red and Père David’s deer (Tate et al. 1997) and between sika and axis deer (Asher et al. 1999). Therefore, sika deer do not match up simply with the criteria of the biological species concept in which “species” is defined as a reproductively isolated group. Although the sika deer and other species are not genetically differentiated enough to establish reproductive isolation, they are separated clearly in molecular phylogeny except for MHC genes. All phylogenetic trees constructed from mtDNA data agree that the sika deer and wapiti form a monophyletic group to which European red deer, i.e., C. elaphus sensu stricto, become a sister group (Polziehn and Strobek 1998; Cook et al. 1999; Kuwayama and Ozawa 2000; Li et al. 2003; Pitra et al. 2004). Fossil records indicate that both C. nippon and C. elaphus appeared in China in the late Pleistocene (Dong 1993), while European red deer first appeared in the middle Pleistocene (Lister 1984). Among the molecular studies, however, the estimated divergence time for the sika + wapiti/European red deer split varies from the late Pliocene to the Pleistocene among the studies (Table 4.4). It is likely that in some molecular studies the rate of nucleotide substitution was underestimated because calibration points were taken at a deep divergence time. Alternatively, the longer estimated time for the split among the species can be explained if the split in the mtDNA lineage occurred much earlier than the onset of morphological differentiation among the species. Within the sika-wapiti lineage, all races of the sika deer constitute a monophyletic group in both the mitochondrial cytochrome-b gene (Cook et al. 1999) and the control region sequences. The divergence time between the sika and wapiti is as deep as those observed between species of Cervidae (Li et al. 2003; Pitra et al. 2004; Gilbert et al. 2006), providing further support for classifying the sika deer and wapiti into separate species.

56

H. B. Tamate

Table 4.4 Estimated divergence time between the sika and related species and among the major clades of the sika deer. Calibration points Estimated rate Estimated time for the molecular of nucleotide Split Literature Gene of the split clock substitution Wapiti/Red Polziehn and Strobek (1998) Mahmut et al. (2002)

D-loop

Pleistocene Red/fallow split (0.5–0.6 Mya) 1.6 Mya

D-loop

Late Pleistocene (0.3–0.4 Ma)

Kuwayama and cytchrome b Pleistocene Ozawa (2000) (0.8 Ma) Li et al. (2003) cytchrome b Middle Pliocene (3.9 Mya)a Pitra et al. (2004) cytchrome b Middle Plioceneb

Sika/Wapiti Kuwayama and cytchrome b Pleistocene Ozawa (2000) (0.57 Ma) Li et al. (2003) cytchrome b Late Pliocene (2.77 Ma)b Pitra et al. (2004) cytchrome b Late Pliocenea

Nd

Red/fallow split 1.6 Ma Muntianinae/ Cervinae split 7.0 Ma Muntianinae/ Cervinae split 7.0 Ma, The oldest known New World Odocoileinae 5.0 Ma Red/fallow split 1.6 Ma Muntianinae/ Cervinae split 7.0 Ma Muntianinae/ Cervinae split 7.0 Ma, The oldest known New World Odocoileinae 5.0 Ma

Based on human D-loop data (Stoneking et al. 1992) Based on human D-loop data (Stoneking et al. 1992) 0.035 substitutions/ site/Mya 0.016 substitutions/ site/Mya 0.0257 substitutions/ site/Mya

0.035 substitutions/ site/Mya 0.016 substitutions/ site/Mya 0.0257 substitutions/ site/Mya

Northern/Southern Sika Nagata et al. D-loop (1999)

Late Pleistocene (0.3 Ma)

Northern/southern, Based on bovine northern/China, D-loop data southern/China (Loftus et al. were 3.7, 3.2 1994) and 2.9%.

Among Chinese Sika Wu et al. (2004) D-loop

Not determined

Cluster I and II 2.9%

a

Recalculated from data in Table 4.2 from Li et al. (2002). Described in Fig. 4.3 from Pitra et al. (2004).

b

Based on bovine D-loop data (Loftus et al. 1994)

4

Evolutionary Significance of Admixture and Fragmentation

57

Conclusion Genetic studies have unveiled the unique evolutionary history of the sika deer: speciation, admixture, and fragmentation. Ancestors of the Japanese sika deer split into at least two lineages as vicariants in the Asian mainland. They would have taken a different course of adaptation, but they met again in the Japanese Archipelago. Since then admixture has been reducing the genetic differences between the two lineages, the northern and southern deer. Before completing panmixia, however, the admixing process was interrupted by population fragmentation, possibly caused by anthropologic activities, which resulted in a loss of the genetic diversity of the sika deer. Nevertheless, a relatively large number of genetic variations remain in some populations that have not suffered from extensive overexploitation in the past. The genetic study by Yuasa et al. (2007) suggested that fragmented populations of the sika deer are likely to form a metapopulation. One of the important issues to be studied in future genetic research is the stability of local populations under the scheme of a metapopulation; strong hunting pressure due to culling conducted by local governments may alter the dispersal pattern of deer herds and, hence, modify the pattern of gene flow among subpopulations. Further genetic research on the Japanese sika deer will provide information not only about the past of the species— the phylogeny and phylogeography—but also about the status of populations in the present and future. Population-genetic analyses will provide empirical data that will be useful for monitoring and predicting long-term changes in demography and population structure.

Literature Cited Abernethy, K. 1994. The establishment of a hybrid zone between red and sika deer (genus Cervus). Molecular Ecology 3:551–562. Asher, G. W., D. S. Gallagher, M. L. Tate, and C. Tedford. 1999. Hybridization between sika deer (Cervus nippon) and axis deer (Axis axis). Journal of Heredity 90:236–240. Blakiston, T. W. 1883. Zoological indications of ancient connection of the Japan islands with the continent. Transactions of the Asiatic Society of Japan 11:126–140. Chikuni, K., T. Tabata, M. Monma, and M. Saito. 1994. Direct sequencing of the promoter region of growth hormone gene from Artiodactyla. Journal of Animal Science and Technology 65:120–124. Cook, C. E., Y. Wang, and G. Sensabaugh. 1999. A mitochondrial control region and cytochrome b phylogeny of sika deer (Cervus nippon) and report of tandem repeats in the control region. Molecular Phylogenetics and Evolution 12:47–56. Cornuet, J.-M., and G. Luikart. 1996. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144:2001–2014. Cronin, M. A., R. Stuart, B. J. Pierson, and J. C. Patton. 1996. K-casein gene phylogeny of higher ruminants (Pecora, Artiodactyla). Molecular Phylogenetics and Evolution 6:295–311. Dong, W. 1993. A morphological analysis of cheek teeth of Eurasian Pliocene cervids. Pages 65–72 in N. Ohtaishi, and H. L. Sheng, editors, Deer of China. Elsevier Science, Amsterdam, the Netherlands. Garza, J. C., and E. G. Williamson. 2001. Detection of reduction in population size using data from microsatellite loci. Molecular Ecology 10:305–318.

58

H. B. Tamate

Gilbert, C., A. Ropiquet, and A. Hassanin. 2006. Mitochondrial and nuclear phylogenies of Cervidae (Mammalia, Ruminantia): Systematics, morphology, and biogeography. Molecular Phylogenetics and Evolution 40: 101–117. Goodman, S. J., N. H. Barton, G. Swanson, K. Abernethy, and J. M. Pemberton. 1999. Introgression through rare hybridization: A genetic study of a hybrid zone between red and sika deer (genus Cervus) in Argyll, Scotland. Genetics 152:355–371. Goodman, S. J, H. B. Tamate, R. Wilson, J. Nagata, S. Tatsuzawa, G. M. Swanson, J. M. Pemberton, and D. R. McCullough. 2001. Bottlenecks, drift and differentiation: The population structure and demographic history of sika deer (Cervus nippon) in the Japanese archipelago. Molecular Ecology 10:1357–1370. Harrington, R. 1985. Evolution and distribution of the Cervidae. Pages 3–11 in P. F. Fennessy and K. R. Drew, editors, Biology of deer reproduction. Bulletin 22 of the Royal Society of New Zealand, Wellington, New Zealand. Imaizumi, Y. 1970. Description of a new species of Cervus from the Tsushima Island, Japan, with a revision of the subgenus Sika based on clinal analysis. Bulletin of the Natural Science Museum, Tokyo 13:185–194. Kuroda, N., and Y. Okada. 1950. On two new races of Cervus nippon from the southern islands of Kyushu, Japan. Annotationes Zoologicae Japonenses 24:59–64. Kuwayama, R., and T. Ozawa. 2000. Phylogenetic relationships among European red deer, wapiti, and sika deer inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 15:115–123. Li, M., H. B. Tamate, F. W. Wei, X. Wang, R. Masuda, H. L. Sheng, and N. Ohtaishi. 2003. Phylogenetic relationships among deer in China derived from mitochondrial DNA cytochrome b sequences. Acta Theriologica 48:207–219. Lister, A. M. 1984. Evolutionary and ecological origins of British deer. Proceedings of the Royal Society of Edinburgh 82b:205–229. Loftus, R. T., D. E. MacHugh, D. G. Bradley, P. M. Sharp, and P. Cunningham. 1994. Evidence for two independent domestications of cattle. Proceedings of the National Academy of Sciences of the United States of America 91:2757–2761. Lowe, V. P. W., and A. S. Gardiner. 1975. Hybridization between red deer (Cervus elaphus) and sika deer (Cervus nippon) with particular reference to stocks in N. W. England. Journal of Zoology 177:553–566. Mahmut, H., R. Masuda, M. Onuma, M. Takahashi. J. Nagata, M. Suzuki, and N. Ohtaishi. 2002. Molecular phylogeography of the red deer (Cervus elaphus) populations in Xinjiang of China: Comparison with other Asian, European, and North American populations. Zoological Science 19:485–495. Matsumoto, M., H. Nishinakagawa, and J. Otsuka. 1984. Morphometrical study on the skull of Cervus pulchellus, Cervus nippon mageshimae and Cervus nippon yakushimae. Journal of the Mammalogy Society of Japan 10:41–53. McCullough, D. R., J. K. Fischer, and J. D. Ballou. 1996. From bottleneck to metapopulation: Recovery of the tule elk in California. Pages 375–403 in D. R. McCullough, editor, Metapopulations and Wildlife Conservation. Island Press, Washington, DC, USA. Nabata, D., R. Masuda, O. Takahashi, and J. Nagata. 2004. Bottleneck effects on the sika deer Cervus nippon population in Hokkaido, revealed by ancient DNA analysis. Zoological Science 21:473–481. Nagata, J., R. Masuda, K. Kaji, M. Kaneko, and M. C. Yoshida. 1998. Genetic variation and population structure of the Japanese sika deer (Cervus nippon) in Hokkaido Island, based on mitochondrial D-loop sequences. Molecular Ecology 7:871–877. Nagata, J., R. Masuda, H. B. Tamate, S. Hamasaki, K. Ochiai, M. Asada, S. Tatsuzawa, K. Suda, H. Tado, and Y. C. Yoshida. 1999. Two genetically distinct lineages of the sika deer, Cervus nippon, in Japanese islands: Comparison of mitochondrial D-loop region sequences. Molecular Phylogenetics and Evolution 13:511–519. Ohmura, Y., Y. Fukumoto, and K. Ohtaki. 1983. Chromosome polymorphism in Japanese sika, Cervus (Sika) nippon. Japan Journal of Veterinary Science 45:23–30. Ohtaishi, N., and Y. Gao. 1990. A review of the distribution of all species of deer (Tragulidae, Moschidae and Cervidae) in China. Mammalian Review 20:125–144.

4

Evolutionary Significance of Admixture and Fragmentation

59

Okada, A., and H. B. Tamate. 2000. Pedigree analysis of the sika deer (Cervus nippon) using microsatellite markers. Zoological Science 17:335–340. Okada, A., H. B. Tamate, M. Minami, N. Ohnishi, and S. Takatsuki. 2005. Use of microsatellite markers to assess the spatial genetic structure of a population of sika deer Cervus nippon on Kinkazan Island, Japan. Acta Theriologica 50:227–240. Page, R. D. M., and E. C. Holmes. 1998. Molecular evolution: A phylogenetic approach. Blackwell Science, Oxford, United Kingdom. Pitra, C., J. Fickel, E. Meijaard, and P. C. Groves. 2004. Evolution and phylogeny of old world deer. Molecular Phylogenetics and Evolution 33:880–895. Polziehn, R. O., and C. Strobeck. 1998. Phylogeny of wapiti, red deer, sika deer, and other North American cervids as determined from mitochondrial DNA. Molecular Phylogenetics and Evolution 10:249–258. Slate, J., C. W. Coltman, S. J. Goodman, I. MacLean, J. M. Pemberton, and J. L. Williams. 1998. Bovine microsatellite loci are highly conserved in red deer (Cervus elaphus), sika deer (Cervus nippon) and Soay sheep (Ovis aries). Animal Genetics 29:307–15. Slate, J., T. C. Van Stijin, R. M. Anderson, K. M. McEwan, N. J. Maqbool, H. C. Mathias, M. J. Bixley, D. R. Stevens, A. J. Molenaar, J. E. Beever, S. M. Galloway, and M. L. Tate. 2002. A deer (subfamily Cervinae) genetic linkage map and the evolution of ruminant genomes. Genetics 160:1587–1597. Slatkin, M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139:457–462. Stoneking, M., S. T. Sherry, A. J. Redd, and L. Vigilant. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philosophical Transactions of the Royal Society B 337:34–37. Takahashi, M., R. Masuda, H. Uno, M. Yokoyama, M. Suzuki, M. C. Yoshida, and N. Ohtaishi. 1998. Sexing carcass remains of the sika deer (Cervus nippon) using PCR amplification of the Sry gene. Journal of Veterinary Medical Science 60:713–716. Tamate, H. B., S. Tatsuzawa, T. Suda, M. Izawa, T. Doi, K. Sunagawa, F. Miyahira, and H. Tado. 1998. Mitochondrial DNA variations in local populations of the Japanese sika deer, Cervus nippon. Journal of Mammalogy 79:1396–1403. Tamate, H. B., A. Okada, M. Minami, N. Ohnishi, H. Higuchi, and S. Takatsuki. 2000. Genetic variations revealed by microsatellite markers in a small population of the sika deer (Cervus nippon) on Kinkazan Island, northern Japan. Zoological Science 17:47–53. Tate, M. L., G. J. Goosen, H. Patene, A. J. Pearse, K. M. McEwan, and P. F. Fennessy. 1997. Genetic analysis of Pere-David x red deer interspecies hybrids. Journal of Heredity 88:361–365. Weir, B. S., and C. C. Cockerham. 1984. Estimating F-statistics for the Analysis of population structure. Evolution 38:1358–1370. Wu, H., Q. H. Wan, and S. G. Fang. 2004. Two genetically distinct units of the Chinese sika deer (Cervus nippon): Analyses of mitochondrial DNA variation. Biological Conservation 119:183–190. Yamada, M., E. Hosoi, H. B. Tamate, J. Nagata, S. Tatsuzawa, H. Tado, and S. Ozawa. 2006. Distribution of two distinct lineages of sika deer (Cervus nippon) on Shikoku Island revealed by mitochondrial DNA analysis. Mammal Study 31:23–28. Yamada, M., E. Hosoi, J. Nagata, H. B. Tamate and H. Tado. 2007. Phylogenetic relationship of the southern Japan lineages of the sika deer (Cervus nippon) in Shikoku and Kyushu islands, Japan. Mammal Study 32:121–127. Yamauchi, K., S. Mamasaki, K. Miyazaki, T. Kukusui, Y. Takeuchi, and Y. Mori. 2000. Sex determination based on fecal DNA analysis of the amelogenin gene in sika deer. Journal of Veterinary Medical Science 62:669–671. Yokohama, M., Y. Hoshi, H. Nishi, H. Sumiyoshi, and Y. Ishijima. 1994. Karyotype analysis of the Yeso sika (Cervus nippon yesoensis) and its related species. Journal of Agricultural Science 39:170–176. Yuasa, T., J. Nagata, S. Hamasaki, H. Tsuruga, and K. Furubayashi. 2007. The impact of habitat fragmentation on genetic structure of the Japanese sika deer (Cervus nippon) in southern Kantoh, revealed by mitochondrial D-loop sequences. Ecological Research 22:97–106.

Chapter 5

Nutritional Physiology of Wild and Domesticated Japanese Sika Deer Takayoshi Masuko and Kousaku Souma

Abstract The nutritional physiology of Yeso sika deer (Cervus nippon yesoensis, Hokkaido Island) and Honshu sika deer (C. n. centralis, Honshu Island) is reviewed and compared to results from domestic ruminants. Wild sika deer grazed on various types of plants, and the fiber content in these plants was low. The tastes of Yeso sika deer for existing feeds for ruminant livestock resembled those of sheep. Though the digestibility of these feeds in Yeso sika deer was slightly lower than that in sheep, the nutritive values of digestible crude protein (DCP) and total digestible nutrients (TDN) were similar between the two species, suggesting that feed for sheep can be utilized. Therefore, in small-scale farming of Yeso sika deer, the feeding amount in feeding planning can be determined using the feeding standards for sheep. However, when concentrates are fed, correction of TDN is necessary. In large-scale native pasturage, the nutritional intake in summer is adequate because Yeso sika deer graze on various types of wild plants or herbage. In early winter, they mainly graze on sasa (Sasa senanensis), and supplementary food may be necessary to supply TDN. Thus, since Yeso sika deer graze on many types of wild plants, existing feeds for ruminant livestock can be used. In addition, plant biomasses except concentrates that do not cause competition with existing livestock may be effectively utilized in Yeso sika deer, suggesting their importance as animal resources. Many problems must be evaluated before the deer farming industry can grow. In addition to administrative support, research results that enhance deer farming technology must be accumulated as quickly as possible. On the basis of the above research results on the nutritional physiology of Japanese sika deer, analysis of factors that affect fattening and meat quality of deer is necessary.

Introduction Deer farming for antler velvet or venison of sika deer (Cervus nippon), red deer (Cervus elaphus), rusa deer (Cervus timorensis), sambar (Cervus unicolor), and fallow deer (Dama dama) occurs in Oceania, Europe, and Asia (Drew et al. 1989; Fennessy and Taylor 1989; Fletcher 1989). At present, the number of farmed D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_5, © Springer 2009

61

62

T. Masuko, K. Souma

sika deer is the highest in China, and that of red deer is the highest in New Zealand. In Japan, about three tons of velvet is annually imported from China and Taiwan and about 300 tons of venison from New Zealand (Yokohama et al. 1991). With such a background, deer farming has attracted attention in Japan where six subspecies of wild sika deer occur and deer farming was initiated in the mid-1980s. Since capture of wild deer is legally restricted, sika deer that have been maintained in zoos and parks in Japan, those imported from China and Taiwan, and red deer are farmed at present. The number of domesticated deer has increased gradually since 1990, and 4,600 deer were being raised at 144 farms in Japan in 1998. However, deer farming became stagnant thereafter, and the number of domesticated deer has not increased. Many fundamental problems have been suggested as causes, including lack of deer farming skills, inadequate slaughterhouse facilities, and poor development of the distribution system for venison, and more scientific and administrative support has been demanded. Approaches from nutritional physiology, management, and breeding science are needed to establish effective deer farming technology. However, the history of studies on nutritional physiology of sika deer in Japan is short (Miyazaki et al. 1984), and data that can be used as reference are scarce. In other countries, there have been studies on digestion and seasonal changes in feed intake in red deer and fallow deer under farming conditions (Henke et al. 1988; Ramanzin et al. 1997). In New Zealand, an advanced deer farming country, Barry and colleagues (Barry and Wilson 1990; Barry et al. 1991) have been leading research; they recently evaluated the association between feed intake and the endocrine system and reported results of studies on feed intake control, for instance, for prevention of a decrease in feed intake in winter. Recently, data concerning the nutritional physiology of Yeso (Hokkaido Island) sika deer (C. n. yesoensis) and Honshu sika deer (C. n. centralis) have been collected by the Masuko Group of the Faculty of Bioindustry, Tokyo University of Agriculture, and the Ikeda Group of Miyagi Agricultural College, respectively. In this chapter, the nutritional physiology of Japanese sika deer is discussed on the basis of these data.

Nutritional Composition of Plants Grazed on by Wild Japanese Sika Deer Yeso Sika Deer Souma et al. (1996) collected 13 types of herbaceous plants and 17 types of twigs, bark, endodermis, and fallen leaves of arboraceous plants that are frequently grazed on by wild Yeso sika deer and analyzed their compositions for proximate analysis (Horowitz 1980) (Table 5.1). When the component contents of herbaceous plants were compared with those of the heading stages of orchardgrass (Dactylis glomerata)

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

63

Table 5.1 Chemical composition of herbaceous plants and arboraceous plants. Moisture (% FMd) Herbaceous plants Aralia cordata 90.9 Aster glehni 80.4 Polygonatum odo- 84.3 ratum var. maximowiczii Lilium cordatumu 88.3 var. glehnii Heracleum 89.4 lanatum Trillium 86.0 kamtschaticum Patasites 91.2 japonicus var. giganteus Filipendula 76.3 kamtschatica Impatiens 90.7 noli-tangere Picris hieracioides 78.9 var. glabrescens 91.1 Anemonne flaccida Trifolium pratence 76.8 66.8 Sasa senanensis Arboraceous plants 43.8 Ulmus davisiana var. japonica 37.2 Alnus hirsula 30.7 Acer mono Betula platyphylla 29.7 var. japonica 39.6 Ulmus laciniata Fraxinus mandshu- 40.1 rica var. japonica 60.0 Taxus cuspidate 25.8 Tilia japonica 85.9 Euonymus sieboldianus 67.9 Aralia elata a EE: Ether extract b NFE: Nitrogen-free extract c NDF: Neutral detergent fiber d FM: Fresh matter e DM: Dry matter

Crude protein (% DMe)

EEa (% DM)

NFEb (% DM)

NDFc (% DM)

Gross energy (Mcal/ DMkg)

26.4 15.3 22.2

4.7 5.7 5.8

41.3 45.5 41.1

39.2 48.7 30.3

– 4.6 4.7

9.4

2.9

67.3

55.1

4.3

24.0

4.3

44.1

37.6

4.5

16.7

4.3

52.2

29.7

4.6

19.7

3.4

43.2

34.1

4.1

12.5

1.8

55.2

68.8

4.3

17.2

3.9

44.3

57.9

4.3

10.2

7.2

44.2

51.7

4.6

21.7

4.9

41.9

–

–

17.7 13.9

2.2 2.5

55.2 34.3

41.7 65.4

4.6 4.2

6.6

2.6

46.0

67.1

4.4

7.1 6.7 3.5

9.8 2.7 10.2

50.7 38.5 40.5

58.1 71.8 72.2

5.2 4.9 5.7

7.2 4.1

2.4 2.9

38.4 44.7

63.9 69.1

4.4 4.6

6.6 4.3 14.9

3.0 5.1 18.4

52.9 50.8 34.8

53.6 67.9 32.3

4.7 4.7 5.0

5.1

2.4

56.7

48.7

4.6

64

T. Masuko, K. Souma

and timothy (Phleum pratense), general grass types for dairy cows, (Secretariat of Agriculture, Forestry, and Fisheries Research Council, Ministry of Agriculture, Forestry, and Fisheries 1995), the nitrogen-free extract (NFE) content was similar, but the crude protein content in the herbaceous plants was higher, being only slightly lower than that in alfalfa hay. Comparison of component contents among the twigs, bark, and withered leaves showed a higher crude protein content in the twigs and withered leaves than in the bark but a higher crude fat content in the bark and withered leaves than in the twigs. On the other hand, when the component contents in the twigs, bark, and withered leaves were compared with those in orchardgrass and timothy, the acid detergent fiber (ADF) and neutral detergent fiber (NDF) contents in the twigs and bark were higher than those in these grasses, corresponding to the values in the blooming stage of each grass. The crude protein content in the withered leaves was lower than that in the grasses. In grazing tests, most wild plants were grazed on. However, when tested by feeding 67 types of herbaceous and arboraceous plants, some plants were not grazed on, and the grazing degree of some differed among individual deer (Souma et al. 1996). Among plants in which grazing marks by wild Yeso sika deer had been confirmed, plants such as Anemone flaccida (windflower) and Lilium glehni (Liliaceae) were not grazed. Why anemones were not selected may be that while young sprouts and young leaves are palatable (Takatsuki 1992), other parts contain a weakly toxic alkaloid substance (Hashimoto 1986; Nakai 1988). For Lilium glehni, the reason may be that parts other than the floral axis generally selected by wild Yeso sika deer were fed in the test. These results suggest that caution should used when plants containing toxic substances occur in pasturage using natural geographical features, but wild plants growing in deer farm pastures can be utilized. Masuko et al. (2001) collected twigs, bark, and withered leaves of 36 woody plants and measured chemical composition and in vitro dry matter digestibility (IVMD). The crude protein content and IVMD of withered leaves were higher than those of twigs and bark. In withered leaves, the crude protein content of Alnus hirsute (Manchurian alder) was highest (15.7% on a dry matter basis), and IVMD of Ulmus laciniata (Manchurian elm) was highest (69.4%). The crude fiber, ADF, and NDF contents of twigs and bark were higher than those of withered leaves. The fibrous contents of twigs and bark differed greatly among species of woody plants. The crude fiber, ADF, and NDF contents of Acer mono (painted maple) and Betula platyphylla var. japonica (Japanese white birch) were higher than those of other species. Concerning the composition of dwarf bamboo, Sasa senanensis, the contents of dry matter, crude fat, and crude ash increased while the contents of fiber components such as crude fiber, ADF, NDF, and hemicellulose decreased from leaf-bud formation to withering, but changes from October to June next year were slight (Souma et al. 1999) (Table 5.2). In general, the composition of grass fed to ruminant livestock varies markedly according to the growth stage (Morimoto 1989). In orchardgrass and timothy, the contents of dry matter, crude fat, crude fibers, ADF, and NDF increase with the growth period, but the content of the crude ash is nearly constant (Secretariat of Agriculture, Forestry, and Fisheries Research Council, Ministry of Agriculture, Forestry, and Fisheries 1995). When composition changes

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

65

Table 5.2 Changes in the chemical composition of Sasa senanensis with growth stage.

Date of collection

Dry matter (%FMd)

14 June 1995 25.7 5 August 1995 37.0 26 September 1995 47.5 27 October 1995 51.6 3 November 1995 47.1 31 December 1995 43.6 3 April 1996 49.3 16 May 1996 41.3 20 June 1996 48.0 14 July 1996 50.9 12 August 1996 51.6 14 September 1996 54.2 15 October 1996 61.7 a EE: Ether extract b NFE: Nitrogen-free extract c NDF: Neutral detergent fiber d FM: Fresh matter e DM: Dry matter

Crude protein (%DMe)

EEa (%DM)

NFEb (%DM)

NDFc (%DM)

Crude ash (%DM)

24.1 14.5 16.2 15.2 14.5 12.6 13.9 15.8 14.7 13.3 11.3 11.6 11.1

2.0 2.4 3.0 3.8 3.5 2.0 2.5 3.4 3.9 4.0 4.2 4.0 5.2

35.7 42.5 39.1 40.3 41.2 44.3 42.5 40.0 38.9 37.9 39.3 38.0 37.8

71.5 77.6 74.1 69.5 68.5 64.6 65.2 66.4 64.2 61.4 60.7 58.7 60.5

8.0 8.2 11.9 12.1 12.8 14.4 14.5 13.9 16.3 18.4 19.7 20.9 21.6

with growth are compared between Sasa senanensis and grass, the patterns of changes in the contents of crude fibers, ADF, and NDF differed, showing reverse changes (Souma et al. 1999). The slight composition changes from October to June next year may be due to inhibition of growth metabolism caused by low ground temperature and occasional snow cover that occurs during this period. In vitro dry matter digestibility decreased with the growth stage and changed only slightly from October to the following June, showing a pattern similar to that of composition changes (Souma et al. 1999) (Table 5.3). In general, digestibility also decreases with growth in grass, mainly due to an increase in the lignin content (Nakamura 1977; Morimoto 1989). Lignin is only slightly digestible, and an increase in lignin reduces degradation by enzymes, resulting in a decrease in digestibility. However, in Sasa senanensis, the contents of fiber components decreased with the growth stage, and it is unlikely that an increased lignin content reduced in vitro dry matter digestibility. Concerning the components of Sasa senanensis other than fiber, the crude ash content markedly increased while the organic matter content decreased with the growth stage (Table 5.2). This may have reduced in vitro dry matter digestibility. From autumn to spring, the composition and dry matter digestibility of Sasa senanensis are relatively stable. The dry matter intake during this period is also high (Masuko et al. 1999a, b). This suggests that a certain nutrient intake from Sasa senanensis is possible in Yeso sika deer.

66

T. Masuko, K. Souma Table 5.3 Changes in in vitro dry matter digestibility of Sasa senanensis leaves with growth stage. In vitro dry matter Date of collection digestibility (%) 14 June 1995 5 August 1995 26 September 1995 27 October 1995 3 November 1995 31 December 1995 3 April 1996 16 May 1996 20 June 1996 14 July 1996 12 August 1996 14 September 1996 15 October 1996

72.2 61.1 54.2 57.4 58.2 59.9 58.1 59.8 58.5 55.0 53.9 55.2 55.9

Honshu Sika Deer Ikeda et al. (1999) studied seasonal changes in the contents of crude protein and crude fiber in the leaves and edible parts of branches and stalks of 18 plant species (six deciduous trees, three deciduous shrubs, three evergreens, two forbs, and four grasses) for suitability of feeding by Honshu sika deer and serow (Capricornis crispis) in the Sendai area, which lies in the temperate/snow forest climate zone. The crude protein content in the leaves of growing deciduous trees varies widely among species and ranged from about 16% in Morus australis (Korean mulberry) to 10% in Clethra barvinervis (pepperbush). Among deciduous shrubs, it was high at about 17% in Lespedeza bicolor (bush clover) and about 10% in Viburnum dilatatum (linden arrowwood); it decreased to about 10% immediately before shedding of leaves in October to November and further to about 5% after shedding of leaves. In the leaves of evergreens, the crude protein content ranged from about 13% in Neolitsea sericea (Lauraceae) to about 9% in Pinus densiflora (Japanese red pine), but seasonal changes in each species were small. It remained high at about 15% throughout the year in Sasaella ramosa (a groundcover bamboo) and Sasa nipponica (a dwarf bamboo). In Zoysia japonica (lawn grass) and Miscanthus sinensis (silver grass), it was about 12% in summer but decreased to about 8% in autumn and thereafter. Seasonal changes in the crude protein content were smaller in the branches and stalks than in the leaves. In the growing period, the crude protein content of the leaves was 10% or higher in most plants and reached 15% or higher in some plants. In consideration of these nutritional contents and the abundant vegetation, the feeding environment of deer can be considered rich in the growing period of plants, but the crude protein content in the leaves of most plants decreased to about 5% in winter. Bamboo grass maintained a high crude protein content and was abundant throughout the year, so it is

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

67

an excellent feed for deer. Although Zoysia japonica is highly productive during summer, its value as a feed for deer during winter is small because of its limited actual bulk. Miscanthus sinensis has a large actual bulk, but it has a low nutritional value, because the crude protein content in its leaves decreased to about 3% in winter. The branches and withered leaves of woody plants retained a protein content of about 5%, and their supply was large even in winter if they were not buried under snow. The crude fiber content was high at 25–35% in leaves of Acuba japonica (Japanese laurel), Pinus densiflora, Quercus serrata (sawthorn oak), Morus australis, Viburnum dilatatum, Rubus palmatus var. coptophyllus (Rosaceae), and grasses. It was even higher in the branches and stalks, being 35% or higher in many species. As a feeding environment for Honshu sika deer and serow, the area of the Tohoku District along the Pacific coast seems to be adequate during summer but to be markedly deteriorated during winter.

The Fluid and Solid Contents of the Rumen of Sika Deer Composition of the Fluid and Solid Contents of the Rumen of Wild Yeso Sika Deer The fluid content of the rumen of wild Yeso sika deer (collected as harmful animals in Abashiri City by the Abashiri branch of the Hokkaido Government) showed a pH of 5.54, total volatile fatty acid (VFA) concentration of 22.7 mmol/dl, ammonia concentration of 48.6 mg/dl, acetic acid molar ratio of 48.2%, propionic acid molar ratio of 35.4%, and protozoa count of 8.9 × 105/ml (Table 5.4). The total VFA concentration, ammonia concentration, and the propionic acid molar ratio in Yeso sika deer were higher than those in cattle and sheep, but the pH and acetic acid molar ratio were lower. The number of protozoa in Yeso sika deer was similar to that in sheep and goats.

Table 5.4 Composition of the fluid rumen contents of wild Yeso sika deera (mean ± standard error, N = 11). pH 5.45 ± 0.06 Ammonia-N (mg/dl)b 48.6 ± 6.6 VFA (mmol)c 22.7 ± 2.4 Acetic acid (molar ratio %) 48.2 ± 1.1 Propionic acid (molar ratio %) 35.4 ± 1.0 Butyric acid (molar ratio %) 12.3 ± 0.4 Protozoa count (´105/ml) 8.9 ± 2.2 a Wild Yeso sika deer collected as harmful animals b N: Nitrogen c VFA: Volatile fatty acid

68

T. Masuko, K. Souma

Seasonal differences were observed in the rumen contents. Arboreal plants such as Sasa senanensis leaves, twigs, and bark were found in addition to herbaceous plants in spring, but mainly herbaceous plants were found in summer. In autumn and winter, root vegetables, nuts, and leaves (including dry leaves) of Sasa senanensis and other species were observed. These contents were similar to those of wild Yeso sika deer captured for scientific purposes at Ashiyoro-cho and Onbetsu-cho in Hokkaido (Hokkaido Institute of Environmental Sciences 1995). These findings suggested that Yeso sika deer graze on a wide variety of foods and like to graze on field crops and fallen leaves. The fermentation pattern of these rumen contents was similar to that observed in cattle or sheep grazing on plants with a low content of structural carbohydrates (cellulose, hemicellulose, and lignin) and a high protein content (Masuko et al. 1992). Rumen samples were also collected from 36 deer killed in non-agricultural areas for 11 months from March through the following January to study the rumen contents of wild Yeso sika deer. Major components of the contents were bamboo grasses in March, grasses in April through June, leguminous plants in July and August, and grasses and bamboo grasses in October and thereafter. The pH of fluid content of the rumen was highest at 7.34 in March, decreased to 5.40 in May, and increased gradually to 6.53 in January. The ammonia concentration was lowest at 10.4 mg/dl in March, reached a peak at 69.6 mg/dl in May, remained above 20.9 mg/dl until October, and decreased further in and after November (Fig. 5.1). The major minerals sodium (Na), phosphorus (P), potassium (K), and calcium (Ca) and the trace elements iron (Fe), copper (Cu), and zinc (Zn) were analyzed in the fluid and solid contents of the rumen. Only the mineral concentrations in the solid contents are discussed here. The Ca and P contents showed large peaks between June and October and were low in the months before and after this period (Fig. 5.2). Seasonal changes in the Na and K contents were small. The Fe content showed a large peak between March and October, and the Cu and Zn contents were low throughout the year (Fig. 5.3). In domesticated deer, mineral requirements can be provided by feeding, but wild sika deer must consume minerals selectively in the diet. The sources of minerals

Fig. 5.1 The ammonia concentration of the fluid contents of the rumen of wild Yeso sika deer.

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

69

Trace minerals (ppm DM)

Fig. 5.2 The major minerals contents of the solid contents of the rumen of wild Yeso sika deer.

1400 1200

Fe

1000 Cu

800

Zn

600 400 200 0 3

4

5

6

7

8

10

11

12

1

Months of year Fig. 5.3 The trace mineral contents of the solid contents of the rumen of wild Yeso sika deer.

could not be determined in this study, but the seasonal changes observed in the mineral concentrations suggest a relationship of the mineral intake with the route of migration of wild sika deer. Studies of this relationship are needed for the future. The dry matter ratio in the contents of the rumen-abomasum was much higher than that reported in sheep (Tsuda 1990), suggesting a high concentration of gastric contents in Yeso sika deer (Masuko et al. 1996). The ratio of the total content weight (fresh matter weight) in the rumen and reticulum to body weight was 6.1% (Table 5.5). This ratio has been reported to be 4.1% in roe deer, 9.0% in red deer, and 4.3% in fallow deer (Nagy and Regelin 1975). The ratio of the rumen content

70

T. Masuko, K. Souma

Table 5.5 Ratio of the total content weight (mean ± standard error; N = 9) in the rumen, reticulum, omasum, and abomasum.

Rumen Reticulum Omasum Abomasum a b

Fresh matter weight (g)

Dry matter weight (g)

FMWa/body weight (g/kg)

DMWb/body weight (g/kg)

4,598.6 ± 678.0 190.0 ± 42.3 49.2 ± 15.3 152.9 ± 20.4

743.9 ± 102.3 29.1 ± 6.8 8.9 ± 3.0 23.0 ± 3.4

58.44 ± 5.35 2.38 ± 0.42 0.70 ± 0.20 2.03 ± 0.29

9.48 ± 0.88 0.36 ± 0.06 0.12 ± 0.04 0.30 ± 0.04

FMW: Fresh matter weight DMW: Dry matter weight

weight (dry matter weight) to body weight was nearly 1.0% (Masuko et al. 1996). Considering that the daily feed intake per body weight was 2.3–2.8% in Japanese sika deer allowed free access to alfalfa pellets and beet pulp (Tsuda et al. 1987), this ratio (1.0%) corresponded to 50% of the daily dry matter intake, suggesting adequate feed intake in wild Yeso sika deer.

Composition of the Fluid Contents of the Rumen of Domesticated Honshu Sika Deer The results of analysis of the fluid contents from the rumen of deer obtained after feeding by inserting a rumen fistula have been reported (Ikeda et al. 1992). Their feed consisted of raw grass, alfalfa hay cubes, compound feed for dairy cows, hay, grass silage, and apple lees. In the fluid content of the rumen, the pH was 5.7 to 7.6, ammonia concentration was 3.1–8.2 mg/dl, and protozoa count was 5.0 × 104/ml to 2.5 × 105/ml. These values were similar to the above-described values in cattle and sheep but differed from those in Yeso sika deer reported by Masuko et al. (1992). Fermentation in the rumen widely varies according to the characteristics of consumed feed components (McCullough 1979). Therefore, this inconsistency between the two studies may be associated with differences in the rumen fluid between Yeso sika deer fed prepared feeds and wild Yeso sika deer that selectively grazed on feeds suiting their preferences.

Digestive Ability of Sika Deer Preference for Feeds Yeso sika deer. Souma et al. (1995) evaluated the preferences of Yeso sika deer for hay and silage, as generally fed to livestock, and Sasa senanensis, which is heavily grazed by wild Yeso sika deer throughout the year. Yeso sika deer favored roll baled grass hay and corn silage according to preparation types (Fig. 5.4), and alfalfa

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

71

100% Sasa senanensis 80% Corn Silage 60% High-moisture grass silage 40% Roll baled grass silage 20% Roll baled grass hay 0% Sheep

Deer

Fig. 5.4 The ratio of each preparation type in total dry matter intake. 100% Alfalfa

80%

Perennial ryegrass 60% Orchardgrass 40%

20% 0% Sheep

Deer

Fig. 5.5 The ratio of each legume/grass type in total dry matter intake.

(Medicago sativa L.) and perennial ryegrass (Lolium perenne L.) according to legume/ grass types (Fig. 5.5). High-moisture grass silage was least favored. Another study on the preferences for grasses in sheep showed a preference of perennial ryegrass to orchardgrass (Sawada 1994). These types of roughage are fed to dairy cattle but considered to be also suited for domesticated Yeso sika deer. Sasa senanensis, together with Sasa kurilensis and Sasa nipponica, are widely distributed in Hokkaido (Toyooka et al. 1983) and are preferred by Yeso sika deer, suggesting their usefulness as food resources. When sasa is used as feed, autumn and winter are appropriate seasons. However, when the leaves of Sasa nipponica are grazed on in pasturage in summer, its subsequent reproduction is known to decrease (Okubo et al. 1990). Where sika graze on Sasa senanensis, deer numbers should be maintained low enough to not reduce its reproduction.

72

T. Masuko, K. Souma

Comparison between Yeso sika deer and sheep in terms of feed intake showed similar preferences (Figs. 5.4 and 5.5); feed types mainly grazed by Yeso sika deer were also frequently grazed by sheep. Honshu sika deer. Ikeda et al. (1991) studied preferences of farmed Honshu sika deer for basic foods commonly given them. The animals began eating concentrated feed, wheat bran, and apple lees immediately when they were offered, indicating high preference for them. The preference for raw grass, hay, and corn silage was also good, although hard parts of stalks were left uneaten. Rice straw and grape leaves were least preferred.

Feed Intake Yeso sika deer. In general, feed intake differs among the seasons in deer (Barry et al. 1991; Ikeda et al. 1991; Odajima et al. 1993; Aagnes et al. 1996). In Yeso sika deer, seasonal changes were also observed in hay intake (Souma et al. 1998) (Table 5.6). The feed intake of hay reached a peak in summer, decreased in autumn, was lowest in winter, and recovered in spring. The feed intake relative to body weight was 3.01% per day, and its ratio to metabolic body size was 82.2 g/kgW0.75/day in summer but dropped to 1.60% and 43.9 g/kgW0.75/day in winter. Changes in feed intake were not associated with age or sex. The average body weight of deer was heaviest at 62.6 kg in autumn and was 57.4 kg in winter, 58.4 kg in spring, and 58.1 kg in summer. In Yeso sika deer, the intake of Sasa senanensis differed among autumn, winter, and spring (Masuko et al. 1999a, b) (Table 5.7). The dry matter intake of Sasa Table 5.6 Seasonal changes in the mean hay intake of domesticated Yeso sika deer (N = 5). Intake (g/day) Intake (% of BW/day)e Intake (g/kgW0.75/day)f

Spring

Summer

Autumn

Winter

SEMa

1370.4b, c 2.35b, c 64.8b, c

1705.4b 3.01b 82.2b

1172.4c, d 1.88c, d 52.7c, d

908.0d 1.60d 43.9d

91.0 0.16 4.2

a

SEM: Standard error of the means Means within the same row with different superscripts differ: P < 0.05 e BW: Body weight f W0.75: Metabolic body size b, c, d

Table 5.7 Seasonal changes in the dry matter intake of Sasa senanensis in domesticated Yeso sika deer (N = 4). Autumn Mean ± SE Spring Mean ± SE Difference Intake (DMg/day)a Intake (% of BW/day)b Intake (DMg/kgW0.75/day)c a DM: Dry matter b BW: Body weight c W0.75: Metabolic body size

956.8 ± 146.5 1.66 ± 0.16 45.7 ± 5.0

1,008.5 ± 109.5 1.95 ± 0.18 52.3 ± 4.8

NS P < 0.01 P < 0.01

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

73

senanensis per day was the highest in winter, followed in order by autumn and spring. The dry matter intake per body weight was the highest in autumn, followed in order by winter and spring. This change in the order of autumn and spring is because dry matter intake was most markedly decreased in winter, but body weight was decreased in winter compared with autumn. The dry matter intake of Sasa senanensis per body weight in spring was lower, but that in autumn and winter was slightly higher than the dry matter intake of hay per body weight in each season. These results suggest that the dry matter intake of Sasa senanensis in Yeso sika deer is similar to or higher than that of hay, and Sasa senanensis is an important feed resource for nutrient intake in winter. These seasonal changes in feed intake may be partly due to seasonal differences in the types of plants that can be grazed by wild sika deer. Deer such as red deer are known to show seasonal differences in behavior. In autumn, during their reproduction season, male deer show active reproductive behavior such as defense of harems, and the resulting marked decrease in the grazing time reduces feed intake. In female deer, grazing is interrupted by male deer that form harems and guard females, which also reduces the grazing time compared with the other seasons (Souma et al. 1994). In ruminants, changes in feed intake are considered to be affected by temperature and other aspects of the physical environment (Okamoto 1970; Mimura and Morita 1990). In particular, feed intake is associated with atmospheric temperature. Since body temperature is adjusted according to environmental temperature, energy consumption increases in the cold. However, in deer such as Yeso sika deer, feed intake was the lowest in winter, suggesting the importance of factors other than atmospheric temperature. Concerning such factors, Barry et al. (1991) suggested an association between feed intake and hormones. Melatonin secreted from the pineal body is known as a hormone associated with seasonality (Tomioka 1996). The major roles of melatonin are inhibition of gonad activity, development of biological rhythms, and adjustment of the circadian rhythm. The secretion of melatonin is markedly affected by light/dark cycles, i.e., day length (Ishida 1995; Tomioka 1996). In an experiment with red deer, feed intake increased in summer and decreased in winter, showing a pronounced seasonal cycle. Melatonin administration depressed feed intake in late spring and summer and increased feed intake in autumn and winter, relative to control deer, and appeared to move the cycles by approximately six months (Françoise-Domingue et al. 1992). Administration of melatonin was reported to decrease feed intake (Barry et al. 1991). Thus, Yeso sika deer show seasonality in feed intake even when fed adequate rations under farming conditions, and such seasonal changes appear to be associated with the endocrine system. Since feed intake and body weight of Yeso sika deer decrease in winter, the feeding method and fattening period in each season should be evaluated, and inadequate nutritional intake associated with decreased feed intake from autumn to spring should be avoided in farming of Yeso sika deer. Honshu sika deer. When Honshu sika deer were continuously fed on alfalfa hay cubes, the feed intake showed annual changes associated with seasons (Ikeda 2000). It increased suddenly in the mating season in males although they were not

74

T. Masuko, K. Souma

kept with females. The feed intake of deer was 2.5–3.5% of the body weight during the high-feeding period between March and September, but 1.2–3.1% during the low-feeding period between October and February. The annual mean of the feed intake of red deer was reported to be 3.0 kg/day, or 2.4% of the body weight (125 kg). The annual feed intake of wapiti was reported to be 1–3% of the body weight. The feed intake of red deer and wapiti converted to the ratio relative to the metabolic body size was 30–40 g/day and 35–85 g/day respectively (Takatsuki 1994). The feed intake of Honshu sika deer was 60–90 g/day in females and 38–100 g/day in males, showing a considerable variation (Ikeda 2000). On comparison among seasons, the body weight was largest in autumn, decreased toward winter, and increased from spring to summer. In domesticated Honshu sika deer fed continuously, seasonal changes were observed in the quantity of back fat deposit. The back fat thickness was 1.31, 0.91, 0.90, and 0.81 cm in autumn (November), winter (February), spring (May), and summer (August), respectively (Ikeda 2000). The quantity of back fat deposit tended to increase in autumn and decrease in winter although its seasonal differences were not significant.

Digestibility and Nutritive Value of Feeds Masuko et al. (1997) evaluated the digestibility and nutritive value of hay, silage, and hay cubes for Yeso sika deer. In sika deer fed roll baled grass hay, roll baled grass silage, and alfalfa hay cubes corresponding to 1.8–2.2% of body weight, the digestion rates of crude fibers and hemicellulose were slightly lower than those in sheep, but the digestion rates of the other components were similar. However, since the findings on the digestion rate of ADF differ from those on NDF, further detailed studies on the digestibility of fiber components are necessary. The contents of digestible crude protein (DCP), total digestible nutrients (TDN), and digestible energy (DE) in the three feed types were similar between Yeso sika deer and sheep. Therefore, the nutritive values in grasses fed to sheep are available for Yeso sika deer. Some Yeso sika deer with a particularly high urine volume showed a high urinary nitrogen excretion and a high nitrogen accumulation amount and rate compared with sheep. However, in other Yeso sika deer, the nitrogen accumulation amount and rate were similar to those in sheep (Masuko et al. 1997). Yeso sika deer fed a mixture of hay and wheat bran or soybean meal showed higher digestion rates of all components than did sheep (Masuko et al. 1998). Also, when a single grass type is fed alone, the digestion rates of fiber components are lower in Yeso sika deer than in sheep. However, when hay mixed with wheat bran with lower fiber content or soybean meal with a higher crude protein content is fed, the total fiber digestion rate is higher in Yeso sika deer than in sheep. This suggests high digestibility of a grass-concentrate mixture in Yeso sika deer. This tendency was more marked using soybean meal than using wheat bran, indicating that the combination with a feed with high protein content markedly improves the digestibility of fiber components as reported by McCullough (1979).

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

75

After feeding hay or silage alone, the DCP, TDN, and DE contents were similar between Yeso sika deer and sheep (Masuko et al. 1997). After feeding of a mixture of each type of grass and wheat bran or soybean meal, the DCP content was similar between Yeso sika deer and sheep, but the TDN and DE contents were higher in deer. This tendency was marked using the combination with soybean meal; the TDN content differed by 10.1% and the DE content by 1.06 Mcal/kg (Table 5.8). The fecal nitrogen excretion in Yeso sika deer was similar to or slightly lower than that in sheep while the urinary nitrogen excretion in Yeso sika deer was higher than that in sheep. Therefore, both the nitrogen accumulation amount and rate in Yeso sika deer were high. The urine volume in Yeso sika deer was about 1.6 to 2.2 times that in sheep. However, due to the low nitrogen concentration in urine, the urinary nitrogen excretion in Yeso sika deer was lower than that in sheep (Table 5.9). This may cause a high nitrogen accumulation in Yeso sika deer. Detailed analysis of urinary nitrogen is necessary to evaluate differences between Yeso sika deer and sheep. The digestion rates of the dry matter, organic matter, and energy of Sasa senanensis were low (44.5–48.6%) (Table 5.10). These values were similar to those of roll baled grass silage consisting mainly of second cut orchardgrass (36.6–43.7%) among feed types used in previous digestion tests (Masuko et al. 1997). The digestion rates of crude fibers, ADF, NDF, and hemicellulose after feeding roll baled grass silage were 37.1–51.6%, which were similar to those of Sasa senanensis

Table 5.8 Digestibility and nutrient content of a mixture of hay and concentrate fed to sheep (N = 4) and Yeso sika deer (N = 4). (Significant difference between deer and sheep in each treatment: * P < 0.05 and ** P < 0.01.) Hay + wheat bran Digestibility (%) Dry matter Crude protein NFEb NDFc Energy Nutrient content DCPd (%DMe) TDNf (%DM) DEg (Mcal/kgDM) a

Deer

SEMa

Sheep

Deer

SEMa

56.3 58.0 61.6 52.9 56.5

63.9 60.1 66.3 61.5 62.1

4.3 3.9 3.8 4.8 4.2

56.5 70.1 54.9 55.4 55.3

68.3** 74.7** 67.5** 67.5** 66.4**

2.9 1.2 2.9 3.1 3.0

7.4 57.9 2.96

7.5 63.1 3.22

0.5 3.9 0.38

14.8 55.5 2.37

15.0 65.6** 3.43*

0.3 10.4 0.32

SEM: Standard error of the mean NFE: Nitrogen-free extract c NDF: Neutral detergent fiber d DCP: Digestible crude protein e DM: Dry matter f TDN: Total digestible nutrients g DE: Digestible energy b

Hay + soybean meal

Sheep

76

T. Masuko, K. Souma Table 5.9 Nitrogen balance in sheep (N = 4) and Yeso sika (N = 4) deer fed a mixture of hay and concentrate. Hay + wheat bran Intake of Nb (g/kgW0.75/day)c Fecal N (g/kgW0.75/day) Urinary N (g/kgW0.75/day) Retained N (g/kgW0.75/day)

Hay + soybean meal

Sheep

Deer

SEMa

Sheep

Deer

SEMa

1.03 0.44 0.47 0.13

1.07 0.43 0.43 0.21

0.03 0.05 0.02 0.04

1.57 0.47 0.80 0.30

1.74 0.44 0.75 0.55**

0.06 0.02 0.03 0.07

a

SEM: Standard error of the means N: Nitrogen c W0.75: Metabolic body size ** P < 0.01 b

Table 5.10 Digestibility and nutrient content of Sasa senanensis fed to Yeso sika deer (N = 3). Mean SEMa Digestibility (%) Dry matter 44.5 Crude protein 74.5 NFEb 42.2 NDFc 45.9 Energy 48.4 Nutrient content 12.7 DCPd (%DMe) TDNf (%DM) 44.7 DEg (Mcal/kgDM) 2.21 a SEM: Standard error of the means b NFE: Nitrogen-free extract c NDF: Neutral detergent fiber d DCP: Digestible crude protein e DM: Dry matter f TDN: Total digestible nutrients g DE: Digestible energy

1.6 0.7 0.6 0.5 0.4 0.1 0.4 0.02

(43.7–47.5%). However, the digestion rate of crude protein in Sasa senanensis (74.5%) was much higher than that in roll baled grass silage (53.5–55.2%) (Masuko et al. 1999a). Masuko et al. (1998) reported a high digestion rate of crude protein (74.7%) after feeding of a hay-soybean meal mixture. The digestion rate of crude protein in Sasa senanensis was similar to this value. Similar findings were also reported in experiments in which sika deer were fed Sasa palmata (broadleaf bamboo) (Matoba et al. 1987). The DCP content in dry matter was markedly high (12.7%). This value was only slightly lower than that after feeding of a hay-soybean meal mixture, suggesting a high nutritive value of Sasa senanensis in terms of protein. However, the TDN content in dry matter was low (44.7%) since the digestion rate of each component other than protein was low (Table 5.10), and was only slightly higher than the TDN content in roll baled grass silage.

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

77

Table 5.11 Nitrogen balance in Yeso sika deer fed Sasa senanensis (N = 3). Mean SEMa Intake of Nb (g/kgW0.75/day)c Fecal N (g/kgW0.75/day) Urinary N (g/kgW0.75/day) Retained N (g/kgW0.75/day) a SEM: Standard error of the means b N: Nitrogen c W0.75: Metabolic body size

1.20 0.31 0.81 0.08

0.08 0.01 0.09 0.05

Concerning nitrogen balance, the fecal nitrogen excretion was low, but the nitrogen accumulation amount and rate were high because of a high urinary nitrogen excretion (Masuko et al. 1999a) (Table 5.11).

Body Weights of Sika Deer Uchida et al. (2001) measured body weights of artificially-reared Honshu sika deer, including 10 males and 11 females from birth until 24 to 36 months of age. The monthly changes in body weights from birth until 36 months of age are shown in Fig. 5.6, and the least square means of body weights at birth and at 4, 6, 12, 24 and 36 months of age are shown in Table 5.12. The actual body weights at birth were 4.3 ± 0.8 kg and 4.3 ± 0.6 kg for females and males, respectively. In the first three months, the increase in body weight of males and females was almost the same. However, the rate of increase in body weights of males became greater than that of females after four months of age; the actual body weights for females and males were 28.3 ± 3.4 kg and 31.1 ± 4.0 kg at six months of age, 39.9 ± 4.7 kg and 47.1 ± 6.8 kg at 12 months of age, 53.9 ± 7.0 kg and 66.4 ± 8.3 kg at 24 months of age, and 61.6 ± 8.8 kg and 83.4 ± 12.8 kg at 36 months, respectively. These differences in rates of body weight increase became greater with advancing of age. The rate of increase in body weights of females, but not males, became asymptotic after 30 months of age. The body weights of both sexes recorded in this study were greater than those of artificially reared sika deer reported by Yamane et al. (1997), which were measured in early winter at one and three years of age. Body weights of both males and females tended to stop increasing or to decrease during the breeding season, and this tendency was more pronounced in males. The sika deer were born from June to September and their first breeding season appeared from November of the following year to late February two years later. These correspond to 17 to 20 months and 29 to 32 months of age, respectively (Fig. 5.6). A reduction in feed intake and a 20% reduction in body weights of wild male sika deer in the breeding season was reported by Shiraishi et al. (1996) who found that the body weights of wild male sika deer increased and decreased repeatedly from September to June of the following year. In contrast, the body weights of wild female

78

T. Masuko, K. Souma 90

Male

Body weight (kg)

80

Female

70 60 50 40 30 20 10 0

1

4

7

10

13

16

19

22

25

28

31

34

37

Month of age Fig. 5.6 Changes in body weight means of male and female sika deer.

Table 5.12 Comparison of body weight (least square mean in kg ± SE) by sex and family (classified according to paternal and maternal pedigrees) in Honshu sika deer. Age in months Sex Female Male Family 1 2 3 4

Birth

4

6

12

24

36

4.2 ± 0.22 4.3 ± 0.26

24.2 ± 0.84a 27.2 ± 0.95c

28.6 ± 0.88a 32.5 ± 0.95c

39.5 ± 1.33b 47.4 ± 1.58d

54.0 ± 2.45b 59.7 ± 3.58a 67.1 ± 2.69d 87.1 ± 6.86c

3.9 ± 0.36 4.5 ± 0.27 4.2 ± 0.36 4.6 ± 0.37

22.9 ± 1.36a,b 23.7 ± 0.97a,b 29.2 ± 1.36d 26.9 ± 1.40a,d

28.4 ± 1.43a 27.7 ± 0.96b 32.4 ± 1.43d 33.6 ± 1.47c,d

36.9 ± 2.52a,b 42.2 ± 1.45a 45.3 ± 2.16c 49.5 ± 2.22c,d

57.7 ± 4.00 59.0 ± 2.66 63.2 ± 4.00 62.6 ± 4.08

68.1 ± 5.69 69.5 ± 7.92 73.3 ± 5.69 82.8 ± 6.90

a,c

Least square means in the same column with different superscript letters differ significantly (P < 0.05) b,d Least square means in the same column with different superscript letters differ significantly (P < 0.01)

sika deer did not change or in some cases actually increased slightly during the winter period from December to March of the following year.

Discussion The digestive tract of ruminants can be classified according to morphological characteristics into the grass-eater type showing high fiber digestibility, concentrateselector type showing low fiber digestibility, and the intermediate type. Sika deer

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

79

are classified as the intermediate type/concentrate-selector type while sheep are classified as the grass-eater type (Hofmann 1988). Deer are distributed in forests and grasslands and have feeding habits intermediate between the forest type (leafeaters) and grassland type (grass-eaters), and most closely resemble the feeding habits in goats among domestic ruminants such as cattle, sheep, and goats (Takatsuki 1992). Terada et al. (1987) observed differences in the digestibility of the fiber fraction of feed between sheep and goats, suggesting that this is due to differences in the activity of rumen microorganisms and the digestive tract feed passage rate. Odajima et al. (1991) and Katoh et al. (1991) compared the digestive tract feed passage rate between Honshu sika deer and sheep and observed a significantly higher rate in deer, suggesting that this is a cause of the low digestibility. After feeding a hay-concentrate mixture, the presence of the concentrate may have affected rumen microorganisms, improving the digestibility of all fiber components. With an increase in digestibility, the TDN and DE contents also improved. Japan has had only a short history of research on nutritional physiology of domesticated Japanese sika deer, and this field needs further development. Both research objectives and clear industrial needs must be present for sika deer to become an attractive subject for many researchers. How the deer farming industry will develop is unclear; nevertheless, certain preparations will be necessary for success. Since the nutritive values of DCP and TDN in Yeso sika deer were similar to those in sheep, feed menus for sheep can be utilized (Masuko et al. 2000). Therefore, in small-scale deer farming, the feeding amount can be determined using feeding standards for sheep. In large-scale farming, sika deer grazed on various types of plants or herbage. Thus, from spring to autumn when wild plants can be used, adequate nutritional intake may be achieved. However, in early winter, use of mainly Sasa senanensis is considered. When only Sasa senanensis is fed, TDN intake may be inadequate, and supplementary feed may be necessary. Sika deer graze on various types of plants. Therefore, sika deer may be able to effectively utilize plant biomass resources in addition to existing feeds for ruminant livestock (Secretariat of Agriculture, Forestry, and Fisheries Research Council, Ministry of Agriculture, Forestry, and Fisheries 1991). Many problems must be evaluated before the deer farming industry can grow in Japan. In addition to administrative support, research results that enhance deer farming technology must be accumulated as quickly as possible. On the basis of the above research results on the nutritional physiology of Japanese sika deer, analysis of factors that affect fattening and meat quality of deer is necessary.

Literature Cited Aagnes, T. H., A. S. Blix, and S. D. Mathiesen. 1996. Food intake, digestibility and rumen fermentation in reindeer fed baled timothy silage in summer and winter. Journal of Agricultural Science 127:517–523. Barry, T. N., and P. R. Wilson. 1990. Development and present status of deer farming industry in New Zealand – International Deer Symposium Report (II). Animal Husbandry 44:1015–1021.

80

T. Masuko, K. Souma

Barry, T. N., J. M. Suttie, J. A. Milne, and R. N. B. Kay. 1991. Control of food intake in domesticated deer. Pages 385–401 in T. Tsuda, Y. Sasaki, and R. Kawashima, editors, Physiological aspects of digestion and metabolism in ruminants. Academic Press, Inc., San Diego, California, USA. Drew, K. R., Q. Bai and E. V. Fadeev. 1989. Deer farming in Asia. Pages 309–345 in R. J. Hudson, K. R. Drew, and L. M. Baskin, editors, Wildlife production systems: Economic utilization of wild ungulates. Cambridge University Press, Cambridge, United Kingdom. Fennessy, P. F., and P. G. Taylor. 1989. Deer farming in Oceania. Pages 309–345 in R. J. Hudson, K. R. Drew, and L. M. Baskin, editors, Wildlife production systems: Economic utilization of wild ungulates. Cambridge University Press, Cambridge, United Kingdom. Fletcher, T. J. 1989. Deer farming in Europe. Pages 309–345 in R. J. Hudson, K. R. Drew, and L. M. Baskin, editors, Wildlife production systems. Economic utilization of wild ungulates. Cambridge University Press, Cambridge, United Kingdom. Françoise-Domingue, B. M., P. R. Wilson, D. W. Dellow, and T. N. Barry. 1992. Effect of subcutaneous melatonin implants during long daylength on voluntary feed intake, rumen capacity and heart rate of red deer (Cervus elaphus) fed on a forage diet. British Journal of Nutrition 68:77–88. Hashimoto, I. 1986. Illustrated book of delicious wild plants 2. Seibundo Shinkosha, Tokyo, Japan. (In Japanese.) Henke, S. E., S. Demarais, and J. A. Pfister. 1988. Digestive capacity and diet of white-tailed deer and exotic ruminants. Journal of Wildlife Management 52:595–598. Hofmann, R. R. 1988. Aspects of digestive physiology in ruminants. Comstock Publishing Associates, Ithaca, New York, USA. Hokkaido Institute of Environmental Science. 1995. Report of survey of inhabitant status of brown bears and Yeso sika deer (I). (In Japanese.) Horowitz, W., editor. 1980. Official methods of analysis of the Association of Official Analytical Chemists, 13th edition. AOAC, Washington, DC, USA. Ikeda, S. 2000. Studies on the seasonal productivity of Japanese sika deer. Bulletin of the Miyagi Agricultural College 10:3–12. (In Japanese.) Ikeda, S., and S. Takatsuki. 1999. Seasonal changes in nutritive compositions of the major food plants of sika deer (Cervus nippon) and Japanese serow (Capricornis crispus)—a case study of the Sendai area. Tohoku Journal of Animal Science and Technology 49:1–8. (In Japanese.) Ikeda, S., T. Takeda, M. Ishida, and T. Saito. 1991. Feeding and digestion tendencies of sika deer (Cervus nippon). Report of Miyagi Agricultural College 38:27–36. (In Japanese.) Ikeda, S., T. Sugata, T. Takeda, M. Ishida, and T. Saito. 1992. Properties of rumen contents of sika deer (Cervus nippon) fed on various feeds. Report of Miyagi Agricultural College 40:51–58. (In Japanese.) Ishida, N. 1995. What is the biological clock? Kogyo Gijutsu 36:52–57. (In Japanese.) Katoh, K., Y. Kajita, M. Odashima, M. Ohta, and Y. Sasaki. 1991. Passage and digestibility of lucern (Medicago sativa) hay in Japanese sika deer (Cervus nippon) and sheep under restricted feeding. British Journal of Nutrition 66:399–405. Masuko, T., Y. Kameyama, M. Yokohama, and Y. Ishijima. 1992. Characteristics of rumen contents in Yeso sika deer (Cervus nippon yesoensis). Journal of Agricultural Science, Tokyo Nogyo Daigaku 37:162–165. (In Japanese.) Masuko, T., K. Souma, and Y. Ishijima. 1996. The amount of rumen contents in wild Yeso sika deer (Cervus nippon yesoensis). Grassland Science 42:176–177. (In Japanese.) Masuko, T., K. Souma, H. Kumagai, K. Takasaki, Y. Kameyama, and Y. Ishijima. 1997. Digestibility and nitrogen balance in Yeso sika deer (Cervus nippon yesoensis) fed round baled hay, alfalfa hay cube and round baled silage. Grassland Science 43:32–36. (In Japanese.) Masuko, T., K. Souma, M. Fujii, K. Takasaki, and Y. Ishijima. 1998. Digestibility and nitrogen balance in Yeso sika deer (Cervus nippon yesoensis) fed mixtures of hay and wheat bran or soybean meal. Hokkaido Animal Science and Agriculture Society 40:22–26. (In Japanese.) Masuko, T., K. Souma, K. Miyairi, T. Komatsu, and Y. Ishijima. 1999a. Intake, digestibility and nitrogen balance of sasa (Sasa senanensis) in Yeso sika deer (Cervus nippon yesoensis). Hokkaido Animal Science and Agriculture Society 41:72–75. (In Japanese.)

5 Nutritional Physiology of Wild and Domesticated Japanese Sika Deer

81

Masuko, T., and K. Souma. 1999b. Studies of nutrition in Yeso deer feeding. Hokkaido Animal Science and Agriculture Society 41:1–9. (In Japanese.) Masuko, T., T. Taji, K. Nakamura, M. Sekikawa, and S. Masaoka. 2000. Deer products utilization handbook. Zennipon Youroku Kyoukai, Tokyo, Japan. (In Japanese.) Masuko, T., K. Souma, R. Kitahara, N. Sawada, K. Miyairi, and Y. Ishijima. 2001. Chemical composition and in vitro dry matter digestibility of woody plants eaten by Yeso sika deer (Cervus nippon yesoensis) during from winter to spring season. Hokkaido Animal Science and Agriculture Society 43:41–47. (In Japanese.) Matoba, K., T. Nakamura, S. Sato, T. Watanabe, M. Odajima, K. Usa, and H. Tamate. 1987. Feed utilization in sika deer. Kawatabi Farm Report 3:158–159. (In Japanese.) McCullough, Y. 1979. Carbohydrate and urea influences on in vitro deer forage digestibility. Journal of Wildlife Management 43:650–656. Mimura, K., and T. Morita. 1990. Kachiku Kanrigaku, 6th edition. Yokendo Limited, Tokyo, Japan. (In Japanese.) Miyazaki, A., S. Kasagi, and T. Mizuno. 1984. Digestibility of Zoysia-type grass by Japanese deer. Japanese Journal of Zootechnical Science 55:661–669. Morimoto, H. 1989. Revised nutrition, 17th edition. Yokendo Limited, Tokyo, Japan. (In Japanese.) Nagy, J. G., and W. L. Regelin. 1975. Comparison of digestive organ size of three deer species. Journal of Wildlife Management 39:621–624. Nakai, S. 1988. Methods of identifying 100 familiar poisonous herbs. Kinensha, Tokyo, Japan. (In Japanese.) Nakamura, R. 1977. New feed study, Volume 1. General remarks. Chikusan Shuppansha, Tokyo, Japan. (In Japanese.) Odajima, M., Y. Kajita, K. T. Nam, S. R. Lee, H. Senge, K. Katoh, Y. Shoji, M. Ohta, and Y. Sasaki. 1991. Seasonal changes in food passage and digestibility in Japanese sika deer (Cervus nippon) and sheep under restricted feeding condition. Animal Science Technology (Japan) 62:308–313. (In Japanese.) Odajima, M., K. Nakajima, Y. Ohtomo, S. Oda, Y. Shoji, K. Katoh, M. Ohta, and Y. Sasaki. 1993. Year-long changes in food intake and body weight in group-fed Japanese sika deer (Cervus nippon). Animal Science Technology (Japan) 64:421–423. (In Japanese.) Okubo, T., H. Hirota, Y. Takasaki, A. Ueno, S. Saiga, K. Ataku, H. Kobayashi, T. Shimada, M. Kikuchi, and I. Nakanishi. 1990. Grassland Study 24:28–32. (In Japanese.) Okamoto, S. 1970. Environment and physiology of livestock and poultry. Yokendo Limited, Tokyo, Japan. (In Japanese.) Ramanzin, M., L. Bailoni, and S. Schiavon. 1997. Effect of forage to concentrate ratio on comparative digestion in sheep, goats and fallow deer. Animal Science 64:163–170. Sawada, Y. 1994. Study on improvement and utilization of pasture, and on evaluation of grazing characteristics of temperate grasses. Grassland Science 28:1–5. (In Japanese.) Secretariat of Agriculture, Forestry, and Fisheries Research Council, Ministry of Agriculture, Forestry, and Fisheries. 1991. Biomass change plan—utilization of rich biological resources. Korin, Tokyo, Japan. (In Japanese.) Secretariat of Agriculture, Forestry, and Fisheries Research Council, Ministry of Agriculture, Forestry, and Fisheries. 1995. Japan standard feed components table (1995). Central Association of Livestock Industry, Tokyo, Japan. (In Japanese.) Shiraishi, T., Y. Nagaguchi, S. Hayama, N. Tokita, K. Furubayashi, and M. Yamane. 1996. Seasonal changes of body weight and food intake in captive sika deer (Cervus nippon). Japanese Journal of Zoo and Wildlife Medicine 1:119–124. (In Japanese.) Souma, K., T. Masuko, and Y. Ishijima. 1994. General behavior of the sika deer (Cervus nippon) under housing. Hokkaido Animal Science and Agriculture Society 36:57–62. (In Japanese.) Souma, K., Y. Honda, T. Masuko, and Y. Ishijima. 1995. The palatability of hay, silage, and sasa (Sasa senanensis) on the Yeso sika deer (Cervus nippon yesoensis). Hokkaido Animal Science and Agriculture Society 37:28–34. (In Japanese.)

82

T. Masuko, K. Souma

Souma, K., T. Masuko, R. Kitahara, and Y. Ishijima. 1996. Intake of wild herbaceous and arborous plant in the Yeso sika deer (Cervus nippon yesoensis) and its chemical composition. Hokkaido Animal Science and Agriculture Society 38:98–104. (In Japanese.) Souma, K., T. Masuko, Y. Kobayashi, and Y. Ishijima. 1998. Seasonal alteration of hay intake in the Yeso sika deer (Cervus nippon yesoensis). Hokkaido Animal Science and Agriculture Society 40:27–30. (In Japanese.) Souma, K., T. Masuko, K. Miyairi, R. Kitahara, T. Komatsu, and Y. Ishijima. 1999. Changes in chemical composition and in vitro dry matter digestibility of sasa (Sasa senanensis) on different growth stages. Hokkaido Animal Science and Agriculture Society 41:76–79. (In Japanese.) Takatsuki, S. 1986. Analysis of gastric contents of dead deer in mass deaths in Nikko in 1984. Hakkenpo, Tochigi Prefecture 4:15–22. (In Japanese.) Takatsuki, S. 1992. Deer in the north—ecology of deer, sasa, and snow. Dobutsusha, Tokyo, Japan. (In Japanese.) Takatsuki, S. 1994. Report on the investigation of deer in Mt. Goyo (1992–1993). Pages 45–59. Nature Conservation Division, Environmental Health Department, Iwate Prefecture, Japan. (In Japanese.) Terada, F., R. Tano, K. Iwasaki, and T. Haryu. 1987. Comparison of nutritive values among cattle, sheep and goats fed the same diets. Japanese Journal of Zootechnical Science 58:131–137. (In Japanese.) Tomioka, K. 1996. Creatures that know time. Shokabo, Tokyo, Japan. (In Japanese.) Toyooka, K., A. Sato, and M. Ishizuka. 1983. Distribution map of the sasa group in Hokkaido: Explanatory note. Hokkaido Branch Forest Products Research Institute, Hokkaido, Japan. (In Japanese.) Tsuda, T., I. Ito, T. Hoshino, S. Nishiguchi, Y. Sasaki, and M. Ohta. 1987. Physiological ecological study of productivity of sika deer. Report of a grant-supported study of meat. Itoh Science Foundation, Tokyo 5:147–153. (In Japanese.) Tsuda, T. 1990. Livestock physiology, 9th edition. Yokendo Limited, Tokyo, Japan. (In Japanese.) Uchida, H., S. Ikeda, M. Ishida, T. Inoue, and T. Takeda. 2001. Growth characteristics of artificially reared sika deer (Cervus nippon). Animal Science Journal 72:461–466. Yamane, M., S. Hayama, T. Shiraishi, I. Yoshimura, and K. Frubayashi. 1997. Body weight changes of sika deer (Cervus nippon) under different nutritional conditions—comparison between free-ranging deer and captive deer from Tanzawa mountains. Japanese Journal of Zoo and Wildlife Medicine 2:59–66. (In Japanese.) Yokohama, M., Y. Kameyama, T. Masuko, T. Komatsu, R. Hashizume and Y. Ishijima. 1991. An investigation on the merits of the animal resouces of the Yeso sika deer (Cervus nippon yesoensis). Journal of Agricultural Science, Tokyo Nogyo Daigaku 35:185–191. (In Japanese.)

Chapter 6

Endocrinology of Sika Deer Kiyoshi Yamauchi and Yukiko Matsuura

Abstract There have been few studies of endocrinology of sika deer in Japan, although several studies have been conducted on reproductive physiology. In recent years, we have obtained basic information on sika deer endocrinology by applying fecal steroid analysis as a noninvasive method. In this chapter we explore hormonal changes during the estrous cycle and pregnancy in female sika deer and in addition consider what is known about “silent” ovulation. For male sika deer, we provide the annual testosterone pattern and relate it to aggressive behavior.

Introduction It is an indisputable fact that reproductive organs and mechanism are regulated by the endocrine system in which hormones play a key role. The reproductive physiology of mammals is controlled by the hypothalamo-hypophysial-gonadal axis. The secretion of the gonadotropic hormones (LH and FSH) from the anterior pituitary is controlled by gonadotropin releasing hormone (GnRH) produced in the hypothalamus. Gonadotropins stimulate reproductive organs to secrete steroid hormones, which in turn regulate reproductive physiology such as development and maintenance of sex characteristics, estrus, ovulation, and gestation. By monitoring the hormonal changes, we can determine the length of the estrous cycle and the gestation period. Additionally, steroids released from the gonads not only regulate the function of reproductive organs but also effect secondary sex characteristics, such as antlers, pelage, and behavior. Much research has been conducted into the relationship between testosterone and dominance hierarchy or reproductive success of several species, as it was suggested that testosterone has a direct inductive effect on aggressive and sexual behavior. It is of interest to understand the function of testosterone and its relation to deer behavior. This chapter will review primarily the basic information of endocrinology in sika deer and compare it to other Cervidae, as well as provide new findings based on fecal steroid analysis.

D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_6, © Springer 2009

83

84

K.Yamauchi, Y. Matsuura

Fecal Steroid Analysis Several studies have been conducted on the reproductive physiology of sika deer. Most of the subjects used in anatomical and morphological analyses were individuals shot for population control programs, killed in a traffic accident, or hunted for sport (Yamauchi et al. 1982, 1983, 1984; Koizumi 1991; Suzuki et al. 1992a, b, 1996, 2001b; Suzuki and Ohtaishi 1993; Kameyama et al. 2000;Yokoyama et al. 2000a, b, 2001a, b). Compared to ecological information for this species, however, very little is known about the endocrine system. Measurements of hormone levels in the blood have been the most popular technique for the estimation of reproductive status. In intractable species such as Cervidae, however, blood sampling is extremely troublesome because it requires capture, immobilization, and/or restraint. Further, the chemical immobilizations and restraint associated with blood sampling are known to affect the hormone levels in blood (Wesson et al. 1979; Seal and Bush 1982) and thus could compromise the reliability of the endocrine information. The possibility of accidental death by immobilization and restraint also has been reported (Kaji et al. 1991; Suzuki et al. 2001a). Since the 1980s, fecal steroid hormone measurement has been used in several captive and wild species to monitor their reproductive profiles noninvasively (Bamberg et al. 1991; Lasley and Kirkpatrick 1991; Wasser et al. 1991, 1994; Kirkpatrick et al. 1992, 1993; Monfort et al. 1993; Hirata and Mori 1995; Schwartz et al. 1995). As this method allows sampling without disturbing the focal animals, detailed behavioral observations have been applied to several species. In sika deer, this method for fecal progesterone and testosterone analyses were developed and confirmed that fecal concentrations of gonadal steroid show parallel changes to those in plasma. Moreover cyclical fluctuations during the estrous cycle and a pregnancy-related increase in fecal progesterone in the doe, as well as an annual fecal testosterone profiles in the buck, were revealed (Yamauchi et al. 1999, 1997).

Seasonal Breeding Since growth of vegetation, especially grass, fluctuates with seasonal variation, the breeding of carnivores and herbivores is limited according to the seasonal change. In most of these animals the period of parturition corresponds to spring, when ambient temperature rises and food resources increase, so that newborn offspring will grow and prosper. Animals have mechanisms to detect the change of day length, and melatonin plays an important role in relation to photoperiodic modification. Briefly, the information on the change of day length is mediated by the pineal gland through the secretion of melatonin which reaches peak levels during the night (Bubenik and Smith 1987). When melatonin reaches the medial basal hypothalamus (MBH) directly or indirectly, the hypothalamic GnRH pulse generator activity is controlled and, consequently, the pattern of gonadotropin secretion is modified (Mori 1992).

6

Endocrinology of Sika Deer

85

No information is yet available regarding melatonin in sika deer. In some other cervids, functional mechanisms of melatonin for antler cycle or reproductive development have been elucidated by administration, implants, and intake of melatonin (Bubenik 1983; Adam and Atkinson 1984; Whitsett et al. 1984; Webster and Barrell 1985; Adam et al. 1986, 1989; Asher et al. 1987, 1988; Loudon and Curlewis 1988; Webster et al. 1991). From these results it was concluded that the effect of reduced photoperiod is mediated by melatonin. Melatonin influences the seasonal secretory pattern of prolactin which then regulates secretion of pituitary gonadotropins (Bubenik et al. 1985; Bubenik 1990). The same mechanism probably exists in sika deer. In many countries farming deer for the production of venison and/or antler velvet these studies have been conducted, as seasonal breeding could be manipulated by melatonin. Very few sika deer are farmed in Japan, and thus little is understood about melatonin in sika deer. Deer living in temperate latitudes are seasonal breeders (Barrell et al. 1985; Kelly et al. 1985; Lincoln 1985, 1992; Loudon and Brinklow 1992). Sika deer are short-day seasonal breeders as well as other cervid species, and the breeding season begins in early autumn (Miura 1983, 1984a, b). It is expected that luteinizing hormone (LH) or follicle-stimulating hormone (FSH) concentrations increase during the breeding season via secretion of melatonin. Yamaji et al. (1994) observed gonadotropic cells in the pituitary by immunohistochemical methods in wild sika deer (C. n. yesoensis) which were collected from Hokkaido in August (the last month of the nonbreeding season) and October (the peak of rutting season). They found that LH and FSH cells showed seasonal changes; the immunostaining reactivity of LH and FSH cells in October was more intense than that in August in both sexes, and these cells were abundant even in August. These results indicated that gonadotropic hormones in sika deer are activated before breeding season as with other deer species. The seasonal changes of gonadotropic hormones were investigated in roe deer (Schams et al. 1980), white-tailed deer (Mirarchi et al. 1978; Plotka et al. 1980) and red deer (Lincoln 1985), showing that gonadotropic hormones are increasing several months before peak levels of testosterone are achieved and began to decline already some time before the rutting season. C. n. yesoensis also showed a similar tendency in LH and testosterone patterns (Kameyama et al. 2002). Determination of seasonal breeding of deer species not only assists in fundamental research on evolution or environmental adaptation, but could be also utilized in industries for the production of venison and antler velvet.

Female Sika Deer Estrous Cycle Like most cervid species, the sika deer is polyestrous (Sadleir 1987). There are a variety of lengths of estrous cycle in deer species. Though the length of estrous cycle in sika deer had been estimated to be around 20 days based on only behavioral

86

K.Yamauchi, Y. Matsuura

observation, the result of detailed research had not been reported. Monitoring of estrous cycle based on hormonal profiles is difficult to apply in sika deer, because repeated blood sampling is needed. To cope with this difficulty, a noninvasive method for monitoring the reproductive function has been developed by using fecal steroid analysis (Yamauchi et al. 1997; Matsuura et al. 2004a). Additionally, detailed behavior observation was also conducted and its results were compared with hormonal changes. Figure 6.1 Shows the pattern of cyclic fluctuation of two nonpregnant female deer (C. n. centralis) during the breeding season. All estrous behaviors were observed at the time when fecal progesterone concentrations were low. Consequently, the date of the nadirs of progesterone concentration is considered the follicular phase. The mean length of estrous cycle estimated based on the fecal progesterone concentrations (days between the nadirs) and that based on the estrous behavior (days between the first sign of estrus) are shown in Table 6.1. The ranges as well as the mean lengths based on the two parameters coincided well, and the estrous cycle was

80 #1 60

Fecal Progesterone (ng/g)

40

20

0 #2 40

30

20

10

Oct

Nov

Dec

Jan

Fig. 6.1 Changes of fecal progesterone concentration in two female sika deer (C. n. centralis) during the breeding season. In this study, fecal samples were collected every day or every other day during the period between September 1994 and February 1995 to monitor estrous cyclicity at the zoo in Urawa city (35°51′N, 139°39′E), Saitama Prefecture, Japan. Behavioral observations were conducted on the same day as fecal sampling. Behavioral changes including an active approach to the male deer, frequent urination, vaginal discharge, and mating were regarded as a sign of estrus. Arrows indicate the day of behavioral estrus (from Yamauchi et al. 1997).

6

Endocrinology of Sika Deer

87

Table 6.1 Comparison of estrous cycle lengths estimated from fecal progesterone profile and those from behavior changes in two female sika deer (from Yamauchi et al. 1997). Hind Based on Mean ± SEM (n) Range (days) #1 #2

Fecal Progesterone Estrous Behavior Fecal Progesterone Estrous Behavior

13.0 ± 0.9 (6) 12.8 ± 0.7 (10) 12.5 ± 0.3 (6) 12.4 ± 0.4 (9)

10–17 10–16 10–14 10–14

shown to be around 12 to 13 days. The pattern of gradual increase followed by an abrupt decrease was similar to fecal progesterone profiles reported in other ruminant species and cervid species (Hirata and Mori 1995; Schwartz et al. 1995). The cycle length was considerably shorter compared to the goat and cow (21 days), ewe (16 days), and deer species such as moose (24–25 days) (Schwartz and Hundertmark 1993), fallow deer (22 days) (Asher 1985), red deer (18–21 days) (Guiness et al. 1971; Adam et al. 1985; Kelly et al. 1985), white-tailed deer (25–30 days) (Plotka et al. 1977a), caribou (24 days) (Bergerud 1975), and Père David’s deer (19 days) (Curlewis et al. 1988). Duration of estrous cycle in Formosan sika deer (Cervus nippon taiouanus), which belong to Cervus nippon, was investigated during breeding season based on the cyclic basal serum progesterone levels and the observations of the cyclic signs of swollen and moistened external genitalia. Mean duration of estrous cycle was estimated to be 19.3 ± 1.8 days with a range of 17–21 days (Liu et al. 2002). This result was also longer than sika deer (C. n. centralis).

“Silent” Ovulation The length of ovarian cycle in C. n. yesoensis has been examined based on fecal progesterone measurement and behavioral observation of copulation and estrous symptoms such as frequent urination, tail lifting, and changes in external genitalia including color, swelling, and vaginal discharge (Matsuura et al. 2004a). From this study, it was revealed that the days between ovulations, which occurred from the first ovulation to the ovulation accompanied by the first copulation, was 9.8 ± 4.6 days, ranging from five to 24 days (Fig. 6.2), and that ovulation without estrus/ copulation occurred early in the breeding season in most cases. This “silent” ovulation usually has a shorter and more irregular luteal phase than normal estrus (Asher 1985; Curlewis et al. 1988); e.g., 6–12 days in red deer (Asher et al. 2000), within 11 days in elk (Cook et al. 2001), 2–5 days in Eld’s deer (Monfort et al. 1990), and 8–9 days in black-tailed deer (Thomas and Cowan 1975). A detailed study of dairy cows revealed that the average interval between the first (silent) and second ovulation was 12.7 ± 1.7 days, ranging from 6–32 days, and it was shorter than normal intervals. The length obtained in C. n. yesoensis is similar to those lengths and interpreted as the interval indicating luteal phase during “silent” ovulation in sika deer. “Silent” ovulation occurred before the first behavioral estrus, and the increasing length also occurred as the season progressed in red deer (Asher 1985). Since most females in C. n. yesoensis conceived in the early stage of the breeding season

88

K.Yamauchi, Y. Matsuura

Fig. 6.2 Ovulation patterns revealed by fecal progesterone profiles, estrous symptoms, and dates of copulation in 12 female sika deer (C. n. yesoensis). Fecal samples were collected daily, every other day, or every third day from October 3 to December 30, 2000 at a deer farm in Hokkaido (143°27′E, 42°56′N), Japan. Behavioral observations were made during the daytime, and estrous symptoms, copulation and parturition dates were recorded. In this study, behavioral changes of frequent urination and tail lifting and changes in external genitalia including color, swelling, and vaginal discharge were defined as estrous symptoms. Open circles indicate the dates of nadirs of progesterone concentration (ovulation) without any estrous symptoms or copulation, double circles indicate the dates of nadirs with estrous symptoms, and closed circles indicate the dates of nadirs with copulation. Arrowheads indicate the dates of copulation. The last copulation (conception) dates varied by up to 22 days, ranging from October 26 to November 16 (the time interval indicated by the line at the bottom marked by an*), except for female no. 5 (from Matsuura et al. 2004a).

(Matsuura et al. 2004a), it was suggested that the interval between ovulations (9.8 ± 4.6 days) was shorter than mean estrous length (12–13 days) estimated by Yamauchi et al. (1997) in C. n. centralis. Concerning the length of estrous cycle in sika deer, we need to elucidate accurate length and the estrous length in other subspecies by using a vasectomized male and monitoring the receptivity of females, although many animals are required for such research.

6

Endocrinology of Sika Deer

89

Progesterone Profile in Pregnant Sika Deer Figure 6.3 shows changes of fecal progesterone concentrations in pregnant and nonpregnant sika deer (C. n. centralis). Fecal progesterone concentrations of nonpregnant deer were maintained at low levels throughout a year, while that of the pregnant deer increased immediately after mating. There was a conspicuous difference in progesterone profiles between pregnant and nonpregnant deer. Annual profiles of serum progesterone were investigated in red deer (Kelly et al. 1982) and white-tailed deer (Plotka et al. 1977b). Their progesterone concentrations showed basal levels during nonbreeding season, increased rapidly after mating, and then were sustained at the high level. Several days before parturition, there was a marked decrease in progesterone levels. A similar pattern of fecal progestagen was also reported in moose (Schwartz et al. 1995), in which fecal progestagen rapidly increased following conception and maintained high levels after eight weeks of gestation when fecal progestagen levels exceeded peak luteal phase concentration. Annual changes of fecal progesterone concentrations were measured in C. n. yesoensis by K. Jinma et al. in the Laboratory of Theriogenology at Hokkaido University (personal communication 1995); fecal progesterone profiles in pregnant deer were similar to those in pregnant moose (Schwartz et al. 1995).

Fig. 6.3 Changes of fecal progesterone concentrations in three female sika deer (C. n. centralis) (modified from Yamauchi et al. 1997).

90

K.Yamauchi, Y. Matsuura

Regarding the gestation period in sika deer, estimated results based only on behavioral observation have been described in a few papers in Japan (230–236 days (Iimura 1980)), (228 days (Miura 1984b)). To clarify exact gestation period further, conception dates were decided by hormonal profiles and behavioral observation (Matsuura et al. 2004a). Gestation period in 11 Hokkaido sika deer females whose conception were known by hormonal profiles was 224.5 ± 3.7 days, ranging from 216–228 days. The gestation period of sika deer is similar to that of the moose, 216–240 days (Schwartz and Hundertmark 1993) and the caribou, 208–240 days (Leader-Williams 1988), but slightly longer than that of the white-tailed deer, 196– 213 days (Verme 1969) and slightly shorter than that of the red deer, 240–252 days (Haigh 2001). Although gestation period was not related to the fawn’s sex or the female’s age, young females and those in poor condition appear to have a higher probability of prolonged gestation periods following a severe winter (Matsuura et al. 2004b). As to gestation period in sika deer, further research is needed to determine the length in other subspecies, because their body size is influenced by geographical and ecological factors (Ohtaishi 1986).

The Timing of Conception in Sika Deer The timing of conception in C. n. yesoensis was estimated to occur over about 100 days from fetal analysis of culled deer (Suzuki et al. 1996). In Hyogo prefecture, the duration of the calving period was estimated 83 days (Koizumi 1991). The study of captive sika deer showed that lactating or young females were more likely to conceive later than other females (Matsuura et al. 2004b). The timing of breeding is important for reproductive success in wild animals, because the parturition period influences fawn or infant mortality (Clutton-Brock et al. 1982) and subsequent fertility rates (Clutton-Brock et al. 1983). In general, high ranking male deer have more opportunities for copulation than low ranking male deer. In red deer, rut of dominant stags precedes that of bachelor or younger groups (Lincoln and Guiness 1973). Consequently, it was thought that time differences of rut in male deer caused the 100-day variation of conception dates. Fecal testosterone concentrations were measured from captive male sika deer (C. n. nippon) of various body and antler size. From this result, the peak of testosterone levels occurred around the same time among all deer (K. Yamauchi et al. unpublished data, 2001), regardless of dominance hierarchy position or extreme difference in body and antler size. In other deer species it has been reported that late conception is due to a failure to conceive at first estrus (Bergerud 1975; Guiness et al. 1978) or a delay in the onset of ovulation (Cook et al. 2001). In C. n. yesoensis, delay in the onset of ovulation is not likely the factor affecting the delayed conception (Matsuura et al. 2004a). Some females had repeated “silent” ovulation early in the breeding season creating a three- to four-cycle variation in the timing of conception. Furthermore, a few females conceived very late in the breeding season probably due to uterine disease or the failure

6

Endocrinology of Sika Deer

91

to maintain the pregnancy. Therefore, it appears that the variation of conception dates is in most cases caused by the female.

Male Sika Deer Annual Testosterone Rhythm Concerning the endocrinology of males in deer species, there have been many detailed studies of antler development, mostly investigating the role of testosterone (Bubenik 1990; Mourik and Stelmasiak 1990). Plasma testosterone concentrations were measured in wild sika deer (C. n. yesoensis) and peak testosterone levels were detected in late October and early November (Suzuki et al. 1992a). In another study, blood sampling at monthly intervals was carried out on captive sika deer (C. n. yesoensis), and testosterone concentrations peaked in September and October (Kameyama et al. 2000). Moreover, the annual testosterone profile has been measured by fecal analysis (Yamauchi et al. 1997). There was a clear annual change of fecal testosterone concentration; it reached the peak in late September and then decreased rapidly by November, around the estimated time for the breeding season. This relatively low concentration was maintained during the nonbreeding season (Fig. 6.4). In other cervid species, annual testosterone concentrations in serum/ plasma have been examined in white-tailed deer (McMillin et al. 1974; Mirarchi et al. 1978), wapiti (Haigh et al. 1984), roe deer (Schams and Barth 1982; Sempere and Lacroix 1982), fallow deer (Asher et al. 1989), and red deer (Barrell et al. 1985; Lincoln 1985; Bubenik 1990). Those testosterone concentrations attained a peak in the early stage of the breeding season and began to decline during the rut. Seasonal changes of reproductive organs such as testis or seminiferous tubules were examined in C. n. yesoensis (Suzuki et al. 1992a). In this study, spermatogenic activity reached its height in late October and had already begun to decline in late December, and spermatogenesis had stopped by February. However as a very few spermatozoa were observed in February, it seemed that fertility might be maintained in this season. Similar results were found in white-tailed deer (McMillin et al. 1974) and wapiti (Haigh et al. 1984), in which the increase in testosterone correlated with increasing testicular size or scrotal circumference. Yamauchi et al. (1997) found that reproductive behavior was maintained until February when testosterone levels were low (Fig. 6.4). This indicates that reproductive behavior coincides well with annual testicular activities just described above. From these results, it was suggested that temporary secretion of testosterone might be responsible for triggering the aggressive or sexual behaviors in the male deer. However, it appears more likely that a secretion of a large quantity of testosterone may be important for the initiation of the reproductive activities rather than for the maintenance of it, since fecal testosterone rapidly decreased in early breeding season.

92

K.Yamauchi, Y. Matsuura

Antler Cycle Annual testosterone rhythms in sika deer have relevance to annual antler cycles. As shown in Fig. 6.4, antler casting was observed in April when fecal testosterone reached the lowest level and velvet shedding occurred in late August when fecal testosterone began to increase. Similar results were shown in other cervid species (McMillin et al. 1974; Schams and Barth 1982; Barrell et al. 1985; Lincoln 1985; Bubenik and Bubenik 1987; Bubenik 1990; Mourik and Stelmasiak 1990). In general, antler cycles, namely calcification, cleaning, casting, and regeneration, are regulated by the changes in testosterone. In other cervid species, it is also shown that prolactin or insulin-like growth factor 1 (IGF-1), which is under photoperiodic changes, are implicated in antler growth (Mirarchi et al. 1978; Barrell et al. 1985; Lincoln 1985; Bubenik 1990; Mourik and Stelmasiak 1990; Suttie and Fennessy 1992; Li et al. 1999, 2003).

Testosterone and Behavior in Sika Deer Wild male sika deer begin to show aggressive behavior in early autumn to obtain as many females as possible in their territories. Testosterone secreted from testes has been considered to play an essential role in this aggressive behavior (Lincoln et al. 1970; Hart 1974). By experimental manipulation such as castration or implantation with testosterone, a close relationship between androgen levels and social dominance has been reported in ungulates and primates (Bouissou 1983). Similarly, dominant males tend to have higher testosterone levels in red deer (Lincoln et al. 1972).

Antler Casting

Fecal Testosterone (ng / g)

Antler 2500

Antler Regrowth

Velvet

Velvet Shedding

2000 1500 Antler Casting

1000

Velvet Shedding

500 0 9

10

11

12

1

2

3

4

5

6

7

8

(Month)

Fig. 6.4 Annual pattern of fecal testosterone concentration in a male sika deer (C. n. centralis). The shaded area represent the breeding season during which the female deer showed regular estrous cyclicity (redrawn from Yamauchi et al. 1999).

6

Endocrinology of Sika Deer

93

It is known that deer antlers are visual signals of male rank (Bubenik 1990). For example, changing social rank alters antler growth in fallow deer (Bartos and Losos 1987). In sika deer (C. n. centralis), large antlers were related to dominance (Miura 1984a). To elucidate the relation between dominance, antler characteristics, and testosterone levels, C. G. Silva et al. used the fecal testosterone analysis method in wild male sika deer (C. n. centralis) (unpublished data 2001). They determined social rank among the males by observation and measured antler length or weight and fecal testosterone levels at the same time in summer and in autumn. Consequently, it was shown that social rank was influenced by antler characteristics rather than fecal testosterone levels. Further research was conducted to clarify the relationship between fecal testosterone concentration and aggressive behaviors in sika deer. K. Yamauchi et al. collected feces weekly from captive male sika deer (C. n. nippon) which have various body and antler size throughout the year and observed aggressive behaviors among them (unpublished data 2001). From this result, the peak of testosterone levels occurred around the same time in all deer. Although there was not a significant difference in fecal testosterone concentrations between adult male and young male deer during rutting season from September to November, aggressive behaviors were extremely different. Taken together, it appears that, although testosterone induces aggressive or sexual behavior, it does not always coincide with social hierarchy. Moreover, K. Yamauchi et al. have found that fecal testosterone concentrations of adult male deer were significantly higher than those of young male deer in the period from December to March of the following year when normal rut terminated. However, there was a lot of aggressive behavior between them, and young male deer were attacked frequently compared with adult male deer. That is, adult male deer kept their behavioral advantage by their bigger body and antler size, so that testosterone was also kept at high levels. It was suggested that testosterone secretion in young male deer was suppressed because they suffered many attacks. For example, when two male macaques fight, the testosterone levels of the winning male elevate above those of the defeated male (Bernstein et al. 1974). In humans, rise or fall in testosterone levels among players or fans was affected by the winning or losing of sporting events (Booth et al. 1989; Bernhardt et al. 1998). The fluctuation of testosterone levels with physical and psychological effects, as mentioned above, was discussed in a recent report. Testosterone levels in all male sika deer indicate a clear annual rhythm in the long term according to short-day seasonal breeding; however, in the short term, they would vary with the status of population or habitat and result in various subsequent behaviors.

Subject of Future Investigation Japan is a long landmass from south to north, and its climate ranges dramatically. There is a geographical variation among subspecies in aspects such as body size, antler shape, social structure, and eating habits (Miura 1986; Ohtaishi 1986; Takatsuki 1992). Currently, six species of sika deer in Japan exist (Ohtaishi 1986).

94

K.Yamauchi, Y. Matsuura

Although only a few studies have been reported on endocrine information in sika deer, we are gradually clarifying them by means of fecal steroid analysis without disturbing the focused animals. Because marked variations in morphology and ecology are shown, we need to investigate the estrous cycle or gestation period in detail. Furthermore, as reproductive behavior could vary, hormonal secretion is also likely to differ accordingly group by group, as mentioned above in Testosterone and Behavior in Sika Deer. Recently, cortisol levels have been measured as a useful index of stress. By noninvasive methods such as fecal or urinary analysis, the estimation of habitat and the relation to social dominance (Creel et al. 1996; Robbins and Czekala 1997; Bartos et al. 1998; Dehnhard et al. 2001; Huber et al. 2003) were investigated. By applying the fecal steroid method to a population of sika deer, we look forward to contributing to a wide range of management or biological studies in the future.

Literature Cited Adam, C. L., and T. Atkinson. 1984. Effect of feeding melatonin to red deer (Cervus elaphus) on the onset of the breeding season. Journal of Reproduction and Fertility 72:463–466. Adam, C. L., C. E. Moir, and T. Atkinson. 1985. Plasma concentration of progesterone in female red deer (Cervus elaphus) during the breeding season, pregnancy and anoestrus. Journal of Reproduction and Fertility 74:631–636. Adam, C. L., C. E. Moir, and T. Atkinson. 1986. Induction of early breeding in red deer (Cervus elaphus) by melatonin. Journal of Reproduction and Fertility 76:569–573. Adam, C. L., C. E. Moir, and P. Schiach. 1989. Melatonin can induce year-round ovarian cyclicity in red deer (Cervus elaphus). Journal of Reproduction and Fertility 87:401–408. Asher, G. W. 1985. Oestrous cycle and breeding season of farmed fallow deer, Dama dama. Journal of Reproduction and Fertility 75:521–529. Asher, G. W., A. M. Day, and G. K. Barrell. 1987. Annual cycle of liveweight and reproductive changes of farmed male fallow deer (Dama dama) and the effect of daily oral administration of melatonin in summer on the attainment of seasonal fertility. Journal of Reproduction and Fertility 79:353–362. Asher, G. W., G. K. Barrell, J. L. Adam, and L. D. Staples. 1988. Effects of subcutaneous melatonin implants on reproductive seasonality of farmed fallow deer (Dama dama). Journal of Reproduction and Fertility 84:679–691. Asher, G. W., A. J. Peterson, and J. J. Bass. 1989. Seasonal pattern of LH and testosterone secretion in adult male fallow deer, Dama dama. Journal of Reproduction and Fertility 85:657–665. Asher, G. W., K. T. O’Neill, I. C. Scott, B. G. Mockett, and M. W. Fisher. 2000. Genetic influences on reproduction of female red deer (Cervus elaphus) (1) seasonal luteal cyclicity. Animal Reproduction Science 59:43–59. Bamberg, E., E. Mostle, M. Patzl, and G. J. King. 1991. Pregnancy diagnosis by enzyme immunoassay of estrogen in feces from nondomestic species. Journal of Zoo and Wildlife Medicine 22:73–77. Barrell. G. K., P. D. Muir., and A. R. Sykes. 1985. Seasonal profiles of plasma testosterone, prolactin, and growth hormone in red deer stags. Pages 185–190 in P. F. Fennessy and K. R. Drew, editors, Biology of deer production. Royal Society of New Zealand Bulletin 22. Wellington, New Zealand. Bartos, L., and S. Losos. 1987. Response of antler growth to changing rank of fallow deer buck during the velvet period. Canadian Journal of Zoology 75:1934–1939.

6

Endocrinology of Sika Deer

95

Bartos, L., E. Reyes, D. Schams, G. Bubenik, and A. Lobos. 1998. Rank dependent seasonal levels of IGF-1, cortisol and reproductive hormones in male pudu (Pudu puda). Comparative Biochemistry and Physiology, Part a 120:373–378. Bergerud, A. T. 1975. The reproductive season of Newfoundland caribou. Canadian Journal of Zoology 53:1213–1221. Bernhardt, P. C., J. M. Dabbs, Jr., J. A. Fielden, and C. D. Lutter. 1998. Testosterone changes during vicarious experiences of winning and losing among fans at sporting events. Physiology and Behavior 65:59–62. Bernstein, I. S., R. M. Rose, and T. P. Gordon. 1974. Behavioral and environmental events influencing primate testosterone levels. Journal of Human Evolution 3:517–525. Booth, A., G. Shelley, A. Mazur, G. Tharp, and R. Kittok. 1989. Testosterone, and winning and losing in human competition. Hormones and Behavior 23:556–571. Bouissou, M. F. 1983. Androgens, aggressive behaviour and social relationships in higher mammals. Hormone Research 18:43–61. Bubenik, A. B., And S. P. Smith. 1987. Circadian and circannual rhythm of melatonin in plasma of male white-tailed deer and the effect of oral administration of melatonin. Journal of Experimental Zoology 241:81–89. Bubenik, G. A. 1983. Shift of seasonal cycle in white-tailed deer by oral administration of melatonin. Journal of Experimental Zoology 225:155–156. Bubenik, G. A. 1990. Neuroendocrine regulation of the antler cycle. Pages 265–297 in G. A. Bubenik and A. B. Bubenik, editors, Horns, pronghorns, and antlers. Springer, New York, USA. Bubenik, G. A., And A. B. Bubenik. 1987. Recent advances in studies of antler development and neuroendocrine regulation of the antler cycle. Pages 99–109 in C. M. Wemmer, editor, Biology and management of the Cervidae. Smithsonian Institution Press, Washington, DC, USA. Bubenik, G. A., D. Schams, and J. F. Leatherland. 1985. Seasonal rhythm of prolactin and its role in the antler cycle of white-tailed deer. Pages 257–262 in P. F. Fennessy and K. R. Drew, editors, Biology of deer production. Royal Society of New Zealand Bulletin 22. Wellington, New Zealand. Clutton-Brock, T. H., F. E. Guiness, and S. D. Albon. 1982. Red deer: The behavior and biology of two species. University of Chicago Press, Chicago, Illinois, USA. Clutton-Brock, T. H., F. E. Guiness, and S. D. Albon. 1983. The costs of reproduction to red deer hinds. Journal of Animal Ecology 52:367–383. Cook, R. C., D. L. Murray, J. G. Cook, P. Zager, and S. L. Montfort. 2001. Nutritional influences on breeding dynamics in elk. Canadian Journal of Zoology 79:845–853. Creel, S., N. M. Creel, and S. L. Montfort. 1996. Social stress and dominance. Nature 379:212. Curlewis, J. D., A. S. Loudon, and A. P. Coleman. 1988. Oestrous cycles and the breeding season of the Père David’s deer hind (Elaphurus davidianus). Journal of Reproduction and Fertility 82:119–126. Dehnhard, M., M. Clauss, M. Lechner-Doll, H. H. Meyer, and R. Palme. 2001. Noninvasive monitoring of adrenocortical activity in roe deer (Capreolus capreolus) by measurement of fecal cortisol metabolites. General and Comparative Endocrinology 123:111–120. Guiness, F. E., G. A. Lincoln, and R. V. Short. 1971. The reproductive cycle of the female red deer, Cervus elaphus L. Journal of Reproduction and Fertility 27:427–428. Guiness, F. E., S. D. Albon, and T. H. Clutton-Brock. 1978. Calving times of red deer (Cervus elaphus) on Rhum. Journal of Zoology, London 185:104–114. Haigh, J. C. 2001. The gestation length of wapiti (Cervus elaphus) revisited. Animal Reproduction Science 665:89–93. Haigh, J. C., W. F. Cates, G. J. Glover, and N. C. Rawlings. 1984. Relationships between seasonal changes in serum testosterone concentrations, scrotal circumference and sperm morphology of male wapiti (Cervus elaphus). Journal of Reproduction and Fertility 70:413–418. Hart, B. L. 1974. Gonadal androgen and sociosexual behavior of male mammals: a comparative analysis. Psychological Bulletin 81:383–400. Hirata, S., and Y. Mori. 1995. Monitoring reproductive status by fecal progesterone analysis in ruminants. Journal of Veterinary Medical Science 57:845–850.

96

K.Yamauchi, Y. Matsuura

Huber, S., R. Palme, and W. Arnold. 2003. Effects of season, sex, and sample collection on concentrations of fecal cortisol metabolites in red deer (Cervus elaphus). General and Comparative Endocrinology 130:48–54. Iimura, T. 1980. An ecological study on the Japanese deer, Cervus nippon centralis, in the Tanazawa Mountains from the view point of forest protection. Dainipponsanrinkai, Tokyo, Japan. Kaji, K., T. Koizumi, N. Ohtaishi, T. Tsubota, and M. Suzuki. 1991. Evaluation of mass capture methods for sika deer. Honyurui Kagaku (Mammalian Science) 30:183–190. Kameyama, Y., R. Takahashi, M. Ito, R. Maru, and Y. Ishijima. 2000. Seasonal changes of testis volume, scrotal circumference and serum testosterone concentrations in male sika deer (Cervus nippon). Animal Science 71:137–142. Kameyama, Y., A. Miyamoto, S. Kobayashi, T. Kuwayama, and Y. Ishijima. 2002. Annual changes in serum LH and testosterone concentrations in male sika deer (Cervus nippon). Journal of Reproduction and Development 48:613–617. Kelly, R. W., K. P. McNatty, G. H. Moore, D. Ross, and M. Gibb. 1982. Plasma concentrations of LH, prolactin, oestradiol and progesterone in female red deer (Cervus elaphus) during pregnancy. Journal of Reproduction and Fertility 64:475–483. Kelly, R. W., K. P. McNatty, and G. H. Moore. 1985. Hormonal changes about oestrus in female red deer. Pages 181–184 in P. F. Fennessy and K. R. Drew, editors, Biology of deer production. Royal Society of New Zealand Bulletin 22, Wellington, New Zealand. Kirkpatrick, J. F., K. Bancroft, and V. Kincy. 1992. Pregnancy and ovulation detection in bison (Bison bison) assessed by means of urinary and fecal steroids. Journal of Wildlife Diseases 28:590–597. Kirkpatrick, J. F., D. F. Gudermuth, R. L. Flagan, J. C. McCarthy, and B. L. Lasley. 1993. Remote monitoring of ovulation and pregnancy of Yellowstone bison. Journal of Wildlife Management 57:407–412. Koizumi, T. 1991. Reproductive characteristics of female sika deer, Cervus nippon, in Hyogo Prefecture, Japan. Pages 561–563 in F. Spitz, G. Janeau, G. Gonzalez, and S. Aulagnier, editors, Ongules/Ungulates, 1991, Societé Française pour l’Étude et la Protection des Mammiferes, Institute de Recherche sur les Grands Mammiferes, Paris and Toulouse, France. Lasley, B. L., and J. F. Kirkpatrick. 1991. Monitoring ovarian function in captive and free-ranging wildlife by means of urinary and fecal steroids. Journal of Zoo and Wildlife Medicine 22:23–31. Leader-Williams, N. 1988. Reindeer on South Georgia. Cambridge University Press, Cambridge, United Kingdom. Li, C., R. P. Littlejohn, and J. M. Suttie. 1999. Effects of insulin-like growth factor 1 and testosterone on the proliferation of antlerogenic cells in vitro. Journal of Experimental Zoology 284:82–90. Li, C., R. P. Littlejohn, I. D. Corson, and J. M. Suttie. 2003. Effects of testosterone on pedicle formation and its transformation to antler in castrated male, freemartin and normal female red deer (Cervus elaphus). General and Comparative Endocrinology 131:21–31. Lincoln, G. A. 1985. Seasonal breeding in deer. Pages 165–179 in P. F. Fennessy and K. R. Drew, editors, Biology of deer production. Royal Society of New Zealand Bulletin 22, Wellington, New Zealand. Lincoln, G. A. 1992. Biology of seasonal breeding in deer. Pages 565–574 in R. D. Brown, editor, The biology of deer. Springer, New York, USA. Lincoln, G. A., and F. E. Guiness. 1973. The sexual significance of the rut in red deer. Journal of Reproduction and Fertility, Supplement 19:475–489. Lincoln, G. A., R. W. Youngson, and R. V. Short. 1970. The social and sexual behaviour of the red deer stag. Journal of Reproduction and Fertility, Supplement 11:71–103. Lincoln, G. A., F. E. Guiness, and R. V. Short. 1972. The way in which testosterone controls the social and sexual behavior of the red deer stag (Cervus elaphus). Hormones and Behavior 3:375–396. Liu, B.T., S. P. Cheng, M. C. Huang, and J. Y. L. Yu. 2002. Serum progesterone changes in luteal cyclicity and duration of estrous cycle in Formosan sika deer (Cervus nippon taiouanus) hinds. Zoological Science 19:1033–1037.

6

Endocrinology of Sika Deer

97

Loudon, A. S., and J. D. Curlewis. 1988. Cycles of antler and testicular growth in an aseasonal tropical deer (Axis axis). Journal of Reproduction and Fertility 83:729–738. Loudon, A. S., and B. R. Brinklow. 1992. Reproduction in deer: Adaptations for life in seasonal environments. Pages 261–278 in R.D. Brown, editor, The biology of deer. Springer, New York, New York, USA. Matsuura, Y., Y. Sasamoto, K. Sato, Y. Takahashi, M. Suzuki, and N. Ohtaishi. 2004a. Monitoring ovarian function and conception by fecal progesterone analysis in sika deer. Ecological Research 19:397–404. Matsuura, Y., K. Sato, M. Suzuki, and N. Ohtaishi. 2004b. The effects of age, body weight and reproductive status on conception dates and gestation periods in captive sika deer. Mammal Study 29:15–20. McMillin, J. M., U. S. Seal, K. D. Keenlyne, A. W. Erickson, and J. E. Jones. 1974. Annual testosterone rhythm in the adult white-tailed deer (Odocoileus virginianus borealis). Endocrinology 94:1034–1040. Mirarchi, R. E., B. E. Howland, P. F. Scanlon, R. L. Kirkpatrick, and L. M. Sanford. 1978. Seasonal variation in plasma LH, FSH, prolactin, and testosterone concentration in adult male white-tailed deer. Canadian Journal of Zoology 56:121–127. Miura, S. 1983. Grouping behavior of male sika deer in Nara Park, Japan. Honyurui Kagaku (Mammalian Science) 9:279–284. Miura, S. 1984a. Social behavior and territoriality in male sika deer (Cervus nippon Temminck 1838) during the rut. Zeitschrift für Tierpsychologie 64:33–73. Miura, S. 1984b. Annual cycles of coat changes, antler regrowth, and reproductive behavior of sika deer in Nara Park, Japan. Journal of the Mammalogical Society of Japan 10:1–7. Miura, S. 1986. A note on the evolution and social system in Cervidae. Honyurui Kagaku (Mammalian Science) 53:19–24. Monfort, S. L., C. Wemmer, T. H. Kepler, M. Bush, J. L. Brown, and D. E. Wildt. 1990. Monitoring ovarian function and pregnancy in Eld’s deer (Cervus eldi thamin) by evaluating urinary steroid metabolite excretion. Journal of Reproduction and Fertility 88:271–281. Monfort, S. L., C. C. Schwartz, and S. K. Wasser. 1993. Monitoring reproduction in captive moose using urinary and fecal steroid metabolites. Journal of Wildlife Management 57:400–407. Mori, Y. 1992. Central integration of photoperiodicity for gonadotropin release in ruminants. Pages 93–118 in A. Yokoyama, editor, Brain control of the reproductive system. Japan Scientific Societies Press, Tokyo, Japan. Mourik, S., and T. Stelmasiak. 1990. Endocrine mechanisms and antler cycles in rusa deer, Cervus (Rusa) timorensis. Pages 416–425 in G. A. Bubenik and A. B. Bubenik, editors, Horns, pronghorns, and antlers. Springer, New York, New York, USA. Ohtaishi, N. 1986. Preliminary memorandum of classification, distribution and geographic variation on sika deer. Honyurui Kagaku (Mammalian Science) 53:13–17. Plotka, E. D., U. S. Seal, G. C. Schmoller, P. D. Karns, and K. D. Keenlyne. 1977a. Reproductive steroids in the white-tailed deer (Odocoileus virginianus borealis). I. Seasonal changes in the female. Biology and Reproduction 16:340–343. Plotka, E. D., U. S. Seal, L. J. Verme, and J. J. Ozoga. 1977b. Reproductive steroids in the white tailed deer (Odocoileus virginianus borealis). II. Progesterone and estrogen levels in peripheral plasma during pregnancy. Biology and Reproduction 17:78–83. Plotka, E. D., U. S. Seal, L. J. Verme, and J. J. Ozoga. 1980. Reproductive steroids in deer. III. Luteinizing hormone, estradiol and progesterone around estrus. Biology and Reproduction 22:576–581. Robbins, M. M., and N. M. Czekala. 1997. A preliminary investigation of urinary testosterone and cortisol levels in wild male mountain gorillas. American Journal of Primatology. 43:51–64. Sadleir, R. M. F. S. 1987. Reproduction of female cervids. Pages 123–144 in C. M. Wemmer, editor, Biology and management of the Cervidae. Smithsonian Institution Press, Washington, DC, USA. Schams, D., and D. Barth. 1982. Annual profiles of reproductive hormones in peripheral plasma of the male roe deer (Capreolus capreolus). Journal of Reproduction and Fertility 66:463–468. Schams, D., D. Barth, and H. Karg. 1980. LH, FSH and progesterone concentrations in peripheral plasma of the female roe deer (Capreolus capreolus) during the rutting season. Journal of Reproduction and Fertility 60:109–114.

98

K.Yamauchi, Y. Matsuura

Schwartz, C. C., and K. J. Hundertmark. 1993. Reproductive characteristics of Alaskan moose. Journal of Wildlife Management 57:454–468. Schwartz, C. C., S. L. Monfort, P. H. Dennis, and K. J. Hundertmark. 1995. Fecal progestagen concentration as an indicator of the estrous cycle and pregnancy in moose. Journal of Wildlife Management 59:580–583. Seal, U. S., and M. Bush. 1982. Capture and chemical immunobilization of cervids. Pages 480– 497 in C. M. Wemmer, editor, Biology and management of the Cervidae. Smithsonian institution Press, Washington, DC, USA. Sempéré, A. J., and A. Lacroix. 1982. Temporal and seasonal relationship between LH, testosterone and antlers in fawn and adult male roe deer (Capreolus capreolus): A longitudinal study from birth to four years of age. Acta Endocrinology 99:295–301. Suttie, J. M., and P. F. Fennessy. 1992. Recent advances in the physiological control of velvet antler growth. Pages 471–486 in R. D. Brown, editor, The biology of deer. Springer, New York, New York, USA. Suzuki, M., and N. Ohtaishi. 1993. Reproduction of female sika deer (Cervus nippon yesoensis Heude, 1884) in Ashoro District, Hokkaido. Journal of Veterinary Medical Science 55:833–836. Suzuki, M., K. Kaji, and H. Nigi. 1992a. Annual changes of testis size, seminiferous tubules and plasma testosterone concentration of wild sika deer (Cervus nippon yesoensis Heude, 1884) in Hokkaido. Journal of Veterinary Medical Science 54:551–556. Suzuki, M., T. Koizumi, and M. Kobayashi. 1992b. Reproductive characteristics and occurrence of accessory corpora lutea in sika deer Cervus nippon centralis in Hyogo Prefecture, Japan. Journal of the Mammalogical Society of Japan 17:11–18. Suzuki, M., K. Kaji, M. Yamanaka, and N. Ohtaishi. 1996. Gestational age determination, variation of conception date, and external fetal development of sika deer (Cervus nippon yesoensis Heude, 1884) in eastern Hokkaido. Journal of Veterinary Medical Science 58:505–509. Suzuki, M., Y. Nakamura, M. Onuma, J. Tanaka, H. Takahashi, K. Kaji, and N. Ohtaishi. 2001a. Acid-base status and blood gas arterial values in free-ranging sika deer hinds immobilized with medetomidine and ketamine. Journal of Wildlife Diseases 37:366–369. Suzuki, M., M. Onuma, M. Yokoyama, K. Kaji, M. Yamanaka, and N. Ohtaishi. 2001b. Body size, sexual dimorphism, and seasonal mass fluctuations in a larger sika deer subspecies, the Hokkaido sika deer (Cervus nippon yesoensis Heude, 1884). Canadian Journal of Zoology 79:154–159. Takatsuki, S. 1992. Sika deer living in the north. Dobutsusya Publishing, Tokyo, Japan. (In Japanese.) Thomas, D. C., and I. McT. Cowan. 1975. The pattern of reproduction in female Columbian black-tailed deer, Odocoileus hemionus columbianus. Journal of Reproduction and Fertility 44:261–272. Verme, L. J. 1969. Reproductive patterns of white-tailed deer related to nutritional plane. Journal of Wildlife Management 33:881–887. Wasser, S. K., S. L. Monfort, and D. E. Wildt. 1991. Rapid extraction of fecal steroids for measuring reproductive cyclicity and early pregnancy in free-ranging yellow baboons (Papio cynocephalus cynocephalus). Journal of Reproduction and Fertility 92:415–423. Wasser, S. K., S. L. Monfort, J. Southers, and D. E. Wildt. 1994. Excretion rates and metabolites of oestradiol and progesterone in baboon (Papio cynocephalus cynocephalus) faeces. Journal of Reproduction and Fertility 101:213–220. Webster, J. R., and G. K. Barrell. 1985. Advancement of reproductive activity, seasonal reduction in prolactin secretion and seasonal pelage changes in pubertal red deer hinds (Cervus elaphus) subjected to artificially shortened daily photoperiod or daily melatonin treatments. Journal of Reproduction and Fertility 73:255–260. Webster, J. R., J. M. Suttie, and I. D. Corson. 1991. Effects of melatonin implants on reproductive seasonality of male red deer (Cervus elaphus). Journal of Reproduction and Fertility 92:1–11. Wesson, J. A., 3rd, P. F. Scanlon, R. L. Kirkpatrick, H. S. Mosby, and R. L. Butcher. 1979. Influence of chemical immobilization and physical restraint on steroid hormone levels in blood of white-tailed deer. Canadian Journal of Zoology 57:768–776.

6

Endocrinology of Sika Deer

99

Whitsett, J. M., H. Underwood, and J. Cherry. 1984. Influence of melatonin on pubertal development in male deer mice (Peromyscus maniculatus). Journal of Reproduction and Fertility 72:287–293. Yamaji, A., Y. Kiso, M. Suzuki, M. Yokoyama, and F. Sasaki. 1994. Seasonal changes in the gonadotropic cells in the pituitary of wild sika deer (Cervus nippon yesoensis). Journal of Reproduction and Development 40:159–165. Yamauchi, K., T. Murai, H. Tanaka, T. Yamamoto, and Y. Nishitani. 1982. Study on male reproductive organs in Japanese deer, Cervus nippon (Nara Park) - postnatal development and seasonal changes of testis and epididymis. Japanese Journal of Animal Reproduction 28:81–90. Yamauchi, K., Y. Ukai, M. Yaguchi, and Y. Nishitani. 1983. Study on male accessory sex glands in Japanese deer, Cervus nippon (Nara Park), particularly on the seasonal changes. Japanese Journal of Animal Reproduction 29:32–40. Yamauchi, K., T. Murai, and Y. Nishitani. 1984. Studies on the ovary of the Japanese deer, Cervus nippon in the Nara Park - postnatal development and seasonal changes. Japanese Journal of Animal Reproduction 30:162–173. Yamauchi, K., S. Hamasaki, Y. Takeuchi, and Y. Mori. 1997. Assessment of reproductive status of sika deer by fecal steroid analysis. Journal of Reproduction and Development 43:221–226. Yamauchi, K., S. Hamasaki, Y. Takeuchi, and Y. Mori. 1999. Application of enzyme immunoassay to fecal steroid analysis in sika deer (Cervus nippon). Journal of Reproduction and Development 45:429–434. Yokoyama, M., K. Kaji, and M. Suzuki. 2000a. Food habits of sika deer and nutritional value of sika deer diets in eastern Hokkaido, Japan. Ecological Research 15:345–355. Yokoyama, M., H. Uno, M. Suzuki, K. Kaji, and N. Ohtaishi. 2000b. Indices for nutritional condition and thresholds for winter survival in sika deer in Hokkaido, Japan. Japanese Journal of Veterinary Research 48:119–127. Yokoyama, M. M. Onuma, M. Suzuki, and K. Kaji. 2001a. Seasonal fluctuations of body condition in northern sika deer on Hokkaido Island, Japan. Acta Theriologica 46:419–428. Yokoyama, S., I. Maeji, T. Ueda, M. Ando, and E. Shibata. 2001b. Impact of bark stripping by sika deer, Cervus nippon, on subalpine coniferous forests in central Japan. Forest Ecology and Management 140:93–99.

Chapter 7

Reproduction of Female Sika Deer in Japan, with Special Reference to Kinkazan Island, Northern Japan Nobumasa Ohnishi, Masato Minami, Rie Nishiya, Kotoyo Yamada, Hiroyuki Nishizuka, Hiroshi Higuchi, Azusa Nara, Masatsugu Suzuki, and Seiki Takatsuki Abstract Reproduction of female sika deer (Cervus nippon) is explored in detail for a population on Kinkazan Island in northern Japan and compared to the variation in timing and value of reproductive parameters across the Japanese Archipelago. Age at sexual maturity usually occurs at yearling age, but some females, particularly in high nutritional environments, breed in their first year. Timing of the breeding season varies from north to south depending on the climate and vegetation, in relation to the most favorable season for giving birth. Late conceptions are commonplace, some due to young females maturing later in the season, and others due to older females failing to conceive in first estrous periods. Estrous cycles are variable, ranging from five to 25 days, with 15 days being most common. Usually a single calf is born after a 231-day gestation period, but twins occur, especially in nutritious environments. The sex ratio of offspring is balanced. Gestation period varies little across Japan despite northern animals being substantially larger than southern ones. The results for Japanese sika are discussed in relation to sika deer in other areas of the native and introduced range.

Introduction Until the 1980s, studies about the reproductive biology of female sika deer had been conducted on only some limited wild or captive populations (Chapman and Horwood 1968; Chapman 1974; Miura 1978, 1980; Feldhamer 1980; Iimura 1980; Yamauchi et al. 1982; Yamauchi et al. 1983). Therefore, descriptions of sika deer were often lacking in previous reviews of cervid reproduction such as Sadleir (1987) and Loudon and Brinklow (1992). Large-scale research of sika deer reproduction in Japan started in the late 1980s. Now a considerable amount of basic data has accumulated, and it is possible to evaluate variation in reproductive parameters that are influenced by geological, meteorological, and vegetational variables among local populations. Simultaneously, detailed studies of reproduction in particular populations of sika deer were conducted. Kinkazan Island is one area where reproduction of the D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_7, © Springer 2009

101

102

N. Ohnishi et al.

population has been followed in detail over a number of years. The focus of this chapter, therefore, is to report the results of reproduction in the Kinkazan population and to relate these findings to variation in reproductive parameters across the Japanese Archipelago. All the deer at the Kinkazan study area were identified by individual natural characteristics and artificial marks such as hair staining and cuts on the ears. We weighed the deer by live-capturing them in mid-March from 1990 to 2002. Deer were captured by inducing them to enter a paddock by offering food and then confining them there. They were driven by people and tangled in a net. Each deer was immobilized by fastening its legs with rubber rope and placed on a flat electronic balance to measure body weight to the nearest 0.5 kg. Estrous periods were determined by observing female copulatory behavior. Rutting behavior, particularly copulation, was observed during daytime from September to November, though we did not observe at night. Some of the females copulated twice or more (Minami et al. chapter 22), and such copulations were also recorded. Data on copulations taken from 1993 to 2002 were used in this analysis. Parturition was observed from May to July, and some additional observation was made thereafter. Since we observed most copulations, we carefully observed the behavior of particular females prior to parturition dates. Females leave their home ranges immediately before parturition and go into forests or shrub lands. We carefully tracked them from a distance so as to not disturb them and confirmed the parturition dates. Dates of parturition taken from 1994 to 2002 were determined (N = 133). To calculate the length of the gestation period, we used the data where both the copulation and parturition were observed between the period of 1993–2002 (N = 82).

Age at Sexual Maturity First ovulation and/or pregnancy of wild sika deer in the Japanese Islands usually occurs during the breeding season at yearling age. That this is typical is confirmed in many populations in Japan such as Hokkaido (Suzuki and Ohtaishi 1993), Iwate Prefecture (Yamauchi and Matsuura chapter 6), Chiba Prefecture (Asada and Ochiai chapter 28), Hyogo Prefecture (Suzuki et al. 1992), and Kumamoto Prefecture (Koizumi et al. chapter 24). Pregnancy rate of this age is as high as that of older age classes in some populations. However, age at first reproduction, while typically at the yearling age, does vary due to environmental quality and population density. For example, fawns may become pregnant in low density populations (Chapman and Horwood 1968; Swanson and Putman chapter 40); however, it is not known if such pregnancies produce surviving offspring or not. There may be failure during gestation, or fawn mortality at or shortly after birth. However, if fawn pregnancy in sika deer is similar to that in white-tailed deer (Odocoileus virginianus), their ecological equivalent in North America, then the results of McCullough (1979) at the George Reserve in Michigan, that conception rate of fawns was

7

Reproduction of Female Sika Deer in Japan

103

matched virtually one-to-one by recruited young in the fall, may apply to sika deer as well. Apparently fawn females reach sexual maturity only under environmental conditions in which the mother is nutritionally capable of successfully rearing the offspring. Similarly, age at first reproduction can be set back to ages older than yearling in high density populations. For example, on Nakanoshima Island of Lake Toya on Hokkaido, age of first pregnancy is later due to their high density and poor nutritional condition (Kaji et al. chapter 30). Females did not give birth until two years of age on Kinkazan Island. Only 1.3% of three-year-old females gave birth, but birth rates increased at four years old and older (see Minami et al. chapter 23).

Timing and Length of Breeding Period The breeding season of free-ranging sika deer has been determined by direct observation (Nara Park) or calculating back gestational age from the date killed (studies in Hokkaido, Chiba Prefecture, Hyogo Prefecture, and Kumamoto Prefecture) assuming a 231-day gestation period as found in captive sika deer females (Hama 1990; Ikeda 1998). According to these studies, the seasonal spread in breeding is from September to January in Japan (Table 7.1). Breeding in northeastern populations tends to take place later than in southwestern populations (Fig. 7.1), probably due to phenological differences in the vegetation and climate (see Yabe and Takatsuki chapter 20 for maps of vegetation and snow depth). These study areas cover approximately 14 degrees of latitude. Large variations in conception date are found within populations (Table 7.1). However, results from Kinkazan Island to be presented below show that most of the breeding occurs in a cluster approximating a normal distribution over about a one month period, with a smaller skew of later breeding dates, including occasional isolated cases much later. Late conception tends to occur in young females (Suzuki et al. 1996). Difference in average or median date of conception between yearlings and females aged greater than two years is significant in Hokkaido (Suzuki et al. 1996), Hyogo (Koizumi 1992) and Kumamoto Prefecture (Koizumi et al. chapter 24). Besides later maturation of young females, failure to conceive followed by repeated estrous cycles results in some mature females breeding later. Yamauchi et al. (1999) Table 7.1 Timing and length of the breeding season for various sika deer populations in Japan, arranged in geographic order from northeast to southwest. Mean date Prefecture of conception Range Days Reference Hokkaido Chiba

29 Oct 23–24 Sep

7 Oct–17 Jan 8 Sep–11 Dec

78 94

Hyogo Kumamoto

29 Sep 1 Oct

9 Sep–23 Jan 12 Sep–22 Dec

136 83

Suzuki et al. 1996 Asada and Ochiai 1996 Koizumi 1992 Koizumi chapter 24

104

N. Ohnishi et al.

Fig. 7.1 Map of Japan showing the location of prefectures mentioned in the text and the location of Kinkazan Island.

reported that the cycle was 12–13 days according to progesterone concentration. Ikeda (1998), on the other hand, reported that it was 20.6 days (range: 18–22 days). Both of these studies were done on female deer in captivity and may be influenced by artificial factors. However, in the wild, since most of the females conceive during the first estrus, the second or later estruses are less frequently observed. Details of estrous cycle and reproductive endocrinology are described in Yamauchi and Matsuura chapter 6. Observed copulations by females in the Kinkazan Island study area are shown in Fig. 7.2. As noted earlier, the distribution of copulations over time approximated a normal distribution over the month of October. We observed 222 copulations through the study period. Copulations were first observed in early October, peaked in mid-October (mean ± SD = October 22 ± 10.4 days), and continued until late November. The pattern was not symmetric but long-tailed to the latter half (Fig. 7.2). Second and later copulations were distributed from mid-October until late November. As many as 85.0% of the copulations were successful in achieving

7

Reproduction of Female Sika Deer in Japan

105

20 15 10 5 0 1

6

11 16 21 October

26

31

5

10 15 November

20

25

30

Fig. 7.2 Percentage frequency of copulations by date of “single-estrus” i.e., pregnancy was achieved (black bar) and “multi-estrus” females (gray bar) of sika deer on Kinkazan Island.

pregnancy during the first estrus, and these females (“single-estrus females,” hereafter) did not come into heat again. The rest of the females (“multi-estrus females,” hereafter) showed a second (10.2%), third (3.9%), or fourth estrus (0.8%). Multiestrus females did not show a clear peak of copulation date; some females became estrus as soon as five days after the first copulation, but approximately 15-day intervals were most common. A few females showed as long as 25-day intervals between estrous cycles. Although the mean body weights of successful females (37.0 kg, N = 99) and multi-estrus females (37.1 kg, N = 15) were not significantly different (t-test, p > 0.97), the successful females were significantly younger (7.3 years old, N = 135) than the multi-estrus females (9.2 years old, N = 23, t-test, p = 0.008). Success of pregnancy of the successful females was 85.0% (87/108), which was significantly higher than that of the multi-estrus females (68.5%, 9/19, χ2 test, p = 0.0081).

Pregnancy Rates Pregnancy rate of adult sika deer (two years and older) in rich nutritional condition is generally higher than 80%. This is reported in Hokkaido, Iwate Prefecture, Chiba Prefecture, Hyogo Prefecture, etc. This high pregnancy rate is maintained even in yearlings and populations that show a reduction of body size due to higher population density. However, the pregnancy rate declines in populations that are at severe high density and/or poor nutritional condition such as Nakanoshima Island, Lake Toya (Kaji et al. chapter 30). In Chiba Prefecture, depression of pregnancy rates appear in the areas that exceed 15 individuals/km2. Takatsuki (1992) suggested that there is a decline of sexual activities in aged females (>12 years old, see Minami et al. chapter 23 for Kinkazan females).

106

N. Ohnishi et al.

Sika deer typically have a single offspring per pregnancy (Sadleir 1987). However, twinning does occur in sika deer, and in Japan, has been observed in Hokkaido and Iwate Prefecture. Suzuki (personal communication) found only two cases of twins over 15 years of research in Hokkaido. In Iwate Prefecture, Takatsuki (1998) reported the twinning rate was only 0.29%. Similarly, twins have been reported occasionally in wild sika deer introduced to areas outside of Japan (Feldhamer and Marcus 1994). So twinning in wild sika deer is relatively rare. On the other hand, in a captive (penned) population in China, the rate was reported to attain 10.4% (Sheng 1992). This may be due to long-term selective breeding to improve the deer farm stock. The sex ratio of newborn fawns was reported to be 1:1 in Hokkaido (Suzuki 1993) and Hyogo Prefecture (Koizumi 1992) and 1.08M:0.92F on Kinkazan Island. In white-tailed deer, females in populations under highly nutritious conditions have a disproportionate number of female offspring (Verme 1965; McCullough 1979), whereas in red deer (Cervus elaphus), in the British Isles, the fetal sex ratio (% of males) rises in populations showing high reproductive performance (Clutton-Brock and Albon 1989). However, comparable deviations from unity of the sex ratio of fetus in sika deer, so far, have not been confirmed in sika deer in the Japanese islands.

Parturition Date The calving season, of course, is affected by variation in the timing of the breeding season; in the Japanese Archipelago it is mainly from April to June. Previous reports indicate calving outside of the regular season occurred until September in Hokkaido (Suzuki et al. 1996), and November in Nara Park (Miura 1980). Observed parturitions on Kinkazan Island began in mid-May, peaked in early June (mean ± SD = June 4 ± 9.2 days), and declined to a low level by early July. This distribution again was nearly normal, but with a skew due to a few later dates, including some exceptional parturitions as late as 2 August (Fig. 7.3). The 2 August parturition would suggest a copulation date by this female in mid-December, which was not observed. This result shows how the length of the breeding seasons, as for example shown in Table 7.1, can be easily over- or underestimated by observing or missing a few copulations at scattered outlier dates.

Gestation Period Whereas several studies cited above determined the length of the gestation period in sika deer in captivity, accurate determination of gestation periods of wild female sika deer had not been determined before our study of the wild sika deer population living on Kinkazan Island. Based on our observations on known females on

7

Reproduction of Female Sika Deer in Japan

107

Fig. 7.3 Percentage frequency of parturition by date of sika deer females on Kinkazan Island.

Kinkazan Island observed to both copulate and give birth, the mean gestation period was 231.6 ± 4.5 days (N = 82). This closely approximates the estimates of 231 days reported for captive sika deer populations in Japan.

Neonatal Weights Just as adult weights of sika deer are greater in the north than the south, weights of neonatal calves vary among local populations. It is estimated at about 6 kg in Hokkaido in the north (Suzuki et al. 1996), and under 4 kg in Hyogo and Kumamoto Prefecture in the south (Koizumi et al. chapter 24). The mean of actual measurements from a Hokkaido captive population was 5.6 kg in males and 4.5 kg in females (Matsuura et al. 2004). For the wild population on Kinkazan Island the weights were 3.38 kg in males and 3.07 in females. The relatively low neonatal weights is related to comparable lower adult weights in this population due to high density.

Discussion The breeding season on Kinkazan Island occurs when it becomes cool in late September and frost begins in October. Plants begin withering in early October, and almost all plants wither in November. Sika deer deposit fat in summer, and the fat deposit of males peaks in September while the peak of females is delayed to November (Takatsuki unpublished data). From these results, it is likely that the rut occurs immediately after the peak of fat deposit of male sika deer. Parturition,

108

N. Ohnishi et al.

in turn, occurred mainly from late May through the first half of June. Plants begin to grow in mid-April on Kinkazan Island. During the parturition period, their leaves are succulent and fresh. This is the best season in terms of nutrition for the sika deer, particularly for offspring and lactating mothers. Thus, both the rut and parturition periods seem to synchronize with plant phenology affecting the nutritional conditions for sika deer. These results explain why the phenology of reproduction varies across Japan. In the north, the breeding season is set back so that parturition coincides with the later spring green-up, and consequent nutritious forage for raising the young. Parturition is concentrated in the north while the peak is less sharp in the south, though intensive studies are limited in the latter. Our results on the gestation period of sika deer were similar to those reported by Hama (1990) for captive animals. However, the Japan results differed from other areas of the sika deer range. The gestation periods of sika deer in Russia and China were longer: 242 and 237.2 days, respectively (Geist 1998), both of which were recorded for captive populations. The female weights for these deer were as much as 71–73 kg while ours were about 40 kg. In general, gestation period is related to body size, and it is likely that since the sika deer on Kinkazan Island are smaller than other populations (partly because of poor food conditions), the gestation period is shortened. In spite of great variations in the weights of mothers and newborn fawns of cervid species, the gestation periods do not differ greatly. For example, it is 250 days for wapiti (Cervus elaphus canadensis) in which mother’s body weight is as heavy as 254 kg and fawn’s weight is 14.8 kg (Geist 1998). Similarly, it is 234 days for red deer (Cervus elaphus) whose mother and fawn body weights are 84 and 7.9 kg, respectively. Interestingly, the data for fallow deer (Dama dama) are very close to ours: gestation period is 230 days and mother and fawn weights are 39 and 4.2 kg, respectively. These comparisons suggest that for the temperate cervids, it is more advantageous to rut immediately after the peak of fat deposition and give birth in the fresh green season, and therefore the gestation periods are less variable. Since late May and early June is the best season of food quality and abundance, parturition is concentrated in this period regardless of mothers’ body weight. If the gestation period is relative to body weight of mother deer, sika deer females “elongate” the duration depending on the plant phenology. The estrous cycle of sika deer females on Kinkazan Island was about 15 days, though the majority (85%) of females became estrous only once. The cycle of captive females was 12–13 days (Yamauchi et al. 1999) or 21 days (Ikeda 1998). Although we do not know the reason for this difference, it is noteworthy that the captive females were kept apart from males (Ikeda 1998). For comparison, it is known that the estrous cycle of red deer is 18–22 days (Morrison 1960a, b; Lincoln et al. 1970; Guiness et al. 1971) and that of wapiti is 21 days (Morrison 1960a). According to body size, a 21-day cycle seems to be too long for sika deer females. The multi-estrus females in our study were older and may have some limitations in their reproductive physiology. The distribution of estrous cycles was not concentrated at any particular length, but was spread from five days to 25 days without any clear peak. Thus, we should be cautious about comparing captive females with

7

Reproduction of Female Sika Deer in Japan

109

artificially controlled reproduction with wild females whose estrous cycles have been determined only from multi-estrus females. Late conception of multi-estrus females automatically results in late parturition, which would shorten the growth of offspring before winter. The growth rate of early-born fawns of Hokkaido sika deer was the same as that of late-born ones, and consequently the mean body weight of the former before winter was greater than that of the latter (Takatsuki and Matsuura 2000). It is likely that mortality would be higher in the late-born fawns. More study is needed on reproduction to answer these questions. For example, are multi-estrus females particular individuals or do many females become multiestrus with age? And, does the behavior of rutting males or their hierarchical position influence females to be single- or multi-estrus?

Literature Cited Asada, M., and K. Ochiai. 1996. Conception dates of sika deer on the Boso Peninsula, central Japan. Mammal Study 21:153–159. Chapman, D. I. 1974. Reproductive physiology in relation to deer management. Mammal Review 4:61–74. Chapman, D. I., and M. T. Horwood. 1968. Pregnancy in sika deer calf, Cervus nippon. Journal of Zoology, London 155:227–228. Clutton-Brock, T., and S. D. Albon. 1989. Red deer in the Highlands. BSP Professional Books, Oxford, United Kingdom. Feldhamer, G. A. 1980. Cervus nippon. Mammalian Species 128:1–7. Feldhamer, G. A., and M. A. Marcus. 1994. Reproductive performance of female sika deer in Maryland. Journal of Wildlife Management 58:670–673. Geist, V. 1998. Deer of the world: Their evolution, behavior, and ecology. Stackpole Books, Mechanicsburg, Pennsylvania, USA. Guiness, F. E., G. A. Lincoln, and R. V. Short. 1971. The reproductive cycle of the female red deer, Cervus elaphus L. Journal of Reproduction and Fertility 27:427–438. Hama, N. 1990. Judgment of pregnancy by supersonic waves, fetal growth, and measurements of blood progesterone for Hokkaido sika deer. Thesis for Veterinary School, Hokkaido University, Japan. (In Japanese.) Ikeda, S. 1998. Management of reproduction. Pages 16–21 in Guidebook for sika deer farming. Ministry of Agriculture, Forestry, and Fishery, Japan, and the Tohoku Branch of Ministry of Agriculture, Forestry, and Fishery. (In Japanese.) Iimura, T. 1980. An ecological study on the Japanese deer, Cervus nippon centralis, in the Tanzawa Mountains from the view point of forest protection. Dainippon-Sanrinkai, Tokyo, Japan. (In Japanese with English summary.) Koizumi, T. 1992. Reproductive characteristics of female sika deer, Cervus nippon, in Hyogo Prefecture, Japan. Ongules/Ungulates 91: 561–563. Lincoln, G. A., R. W. Youngson, and R. V. Short. 1970. The social and sexual behaviour of the red deer stag. Journal of Reproduction and Fertility Supplement 11:71–103. Loudon, A. S. I., and B. R. Brinklow. 1992. Reproduction in deer: Adaptations for life in seasonal environments. Pages 261–278 in R. D. Brown, editor, Biology of deer. Springer, New York, USA. Matsuura, Y., K. Sato, M. Suzuki, and N. Ohtaishi. 2004. The effects of age, body weight, and reproductive status on conception dates and gestation periods in captive sika deer. Mammal Study 29:15–20.

110

N. Ohnishi et al.

McCullough, D. R. 1979. The George Reserve deer herd: Population ecology of a K-selected species. University of Michigan Press, Ann Arbor, Michigan, USA. Miura, S. 1978. A study of sika deer in Nara Park. I. Rutting period. Pages 2–13 in Kasuga Kensho Kai, editor, Annual report of Nara Deer Research Association. Nara, Japan. (In Japanese.) Miura, S. 1980. Annual cycles of sika deer with special reference to birth season. Pages 87–94 in Kasuga Kensho Kai, editor, Annual report of Nara Deer Research Association. Nara, Japan. (In Japanese.) Morrison, J. A. 1960a. Characteristics of estrus in captive elk. Behaviour 16:84–92. Morrison, J. A. 1960b. Ovarian characteristics in elk of known breeding history. Journal of Wildlife Management 24:297–307. Sadleir, R. M. F. S. 1987. Reproduction in female cervids. Pages 123–144 in C. M. Wemmer, editor, Biology and management of the Cervidae. Smithsonian Institution Press, Washington DC, USA. Sheng, H-L. 1992. Sika deer. Pages 202–212 in H-L. Shen, editor, The deer in China. East China Normal University Press, Shanghai, China. (In Chinese with English summary.) Suzuki, M., and N. Ohtaishi. 1993. Reproduction of female sika deer (Cervus nippon yesoensis Heude, 1884) in Ashoro District, Hokkaido. Journal of Veterinary Medical Science 55:833–836. Suzuki, M., T. Koizumi, and M. Kobayashi. 1992. Reproductive characteristics and occurrence of accessory corpora lutea in sika deer Cervus nippon centralis in Hyogo Prefecture, Japan. Journal of the Mammalogical Society of Japan 17:11–18. Suzuki, M., K. Kaji, M. Yamanaka, and N. Ohtaishi. 1996. Gestational age determination, variation of conception date, and external fetal development of sika deer (Cervus nippon yesoensis Heude, 1884) in eastern Hokkaido. Journal of Veterinary Medical Science 58:505–509. Takatsuki, S. 1992. A sika deer herd living in the north. Dobutsu-sha, Tokyo, Japan. (In Japanese.) Takatsuki, S. 1998. The twinning rate of sika deer, Cervus nippon, on Mt. Goyo, northern Japan. Mammal Study 23:103–107. Takatsuki, S., and Y. Matsuura. 2000. Higher mortality of smaller sika deer fawns. Ecological Research 15:237–240. Verme, L. J. 1965. Reproduction studies on penned white-tailed deer. Journal of Wildlife Management 29:74–79. Yamauchi, S., S. Miura, H. Tanaka, T. Yamamoto, and Y. Nishitani. 1982. Study on male reproductive organs in Japanese deer, Cervus nippon (Nara Park): Postnatal development and seasonal changes of testis and epididymis. Japanese Journal of Animal Reproduction 28:81–88. (In Japanese with English summary.) Yamauchi, S., Y. Ukai, M. Yaguchi, and Y. Nishitani. 1983. Study on male accessory sex glands in Japanese deer, (Nara Park), particularly on the seasonal changes. Japanese Journal of Animal Reproduction 29:32–38. (In Japanese with English summary.) Yamauchi, K., S. Hamasaki, Y. Takeuchi, and Y. Mori. 1999. Application of enzyme immunoassay to fecal steroid analysis in sika deer (Cervus nippon). Journal of Reproduction and Development 45:429–434.

Chapter 8

Food Habits of Sika Deer on Kinkazan Island, Northern Japan with Reference to Local Variations, Size Effects, and Comparison with the Main Island Seiki Takatsuki and U. K. G. K. Padmalal

Abstract Food habits of sika deer (Cervus nippon) on Kinkazan Island were studied to show (1) whether local variations exist on this small island (9.6 km2); (2) which kinds of plants are the staple foods for the deer living in the plant communities heavily affected by deer gazing; and (3) whether dietary differences exist or not among males, females, and fawns. Plant availability on Kinkazan Island was characterized by higher frequency of forbs and lower frequency of browse and graminoids than other areas on the adjacent mainland. Local variations in foods were great, but graminoids such as Zoysia japonica, Miscanthus sinensis, and/or Pleioblastus chino were consistently the staple foods. Forbs included many unpalatable plants and did not contribute greatly to the deer diets. Males tended to feed on lower quality foods, while fawns fed on nutritious foods. Food differences among the deer sex and age classes were greatest in spring and autumn, while they were smaller in summer and winter.

Introduction The distribution of sika deer in northern Honshu, the main island of Japan, is mainly limited by winter snow and hunting pressure, particularly on the Japan Sea side. On the Pacific side of northern Honshu, the main island, although a major population exists at Mt. Goyo and the surrounding area, deer distribution occurs in isolated patches; this differs from southern Japan where deer distribution is more continuous. Kinkazan Island, a small island (960 ha) on the Pacific side of northern Honshu (Fig. 26.1 in Takatsuki chapter 26), is an exception, for it is inhabited by many sika deer. The island is regarded as a sanctuary, and wildlife has been conserved. Hunting is prohibited and because no large predator lives there, the deer population is close to the carrying capacity. This has led to prevention of forest regeneration (Takatsuki and Gorai 1994; Takatsuki and Hirabuki 1998), dominance of unpalatable and grazing-tolerant plants (Yoshii and Yoshioka 1949), and mass-mortality of deer (Takatsuki et al. 1994). Also, the forests of Kinkazan Island lack shrub layers and have more gaps than comparable areas on the mainland so that open patches are more available. This affords a high diversity in physiognomy on this island, and the deer can utilize these diversified habitats. D. R. McCullough et al. (eds.), Sika Deer: Biology and Management of Native and Introduced Populations, DOI: 10.1007/978-4-431-09429-6_8, © Springer 2009

113

114

S. Takatsuki, U. K. G. K. Padmalal

It is expected, therefore, that deer behavior and plant responses are reflected in various aspects of the life history of the sika deer. Food habits, explored in this chapter, are a cogent example. We were interested to know what kinds of plants the deer living in this distinctive vegetation characterized by unpalatable plants and grazing-tolerant plants chose as foods. Since the high density of deer limits food, the deer must eat poorer quality foods, particularly in winter, which determines the maximum number of deer that can overwinter. In summer, by contrast, foods are superabundant. Such clear seasonal differences in food supply should be also reflected in their food habits. Also of interest is how food habits relate to the body size of the deer. It is generally accepted that the larger ungulates tend to feed on less nutritious foods because they can survive on lower quality foods which are more abundant, while smaller ungulates tend to feed on more nutritious foods because they require high quality foods which are often less abundant. This is often referred to as the Jarman-Bell principle (Bell 1970; Jarman 1974). It is instructive to know how different sized deer feed under a condition where food quality is poor and seasonal changes in food supply are marked. This chapter describes the food habits of sika deer on Kinkazan Island, focusing on local variations on this small island and comparisons among different sized deer classes based on the former studies by Takatsuki (1980) and Padmalal and Takatsuki (1994).

Methods Plants appearing in 1 m × 1 m quadrats in six sites representing habitats of sika deer on Kinkazan Island were recorded (Fig. 8.1). The feeding effects and plant species lists are described in detail by Takatsuki (1980). In this chapter we summarize those records to compare the feeding of different food plant types: graminoids, forbs, ferns, lianas, shrubs, and trees. The six sites sampled were as follows: Site 1 was chosen in the shrine park in the northwestern part of the island, where the Zoysia japonica (Japanese lawngrass) community develops in open lands and the Poa annua (annual bluegrass) community develops under cherry trees. A very high density of deer live here. Site 2 was selected in a small patch of the Zoysia community among the Pleioblastus chino (dwarf bamboo) community on a flat located north of the shrine. Site 3 was selected in the above Pleioblastus community. Miscanthus sinensis (Japanese silver grass), a tall species, is also abundant here, and shrubs like Viburnum dilatatum (linden arrowwood) and Berberis thunbergii (Japanese barberry) occur. Site 4 was at a higher elevation than Site 3. This site is composed of various plant communities including the forest patches dominated by Carpinus tschonoskii (Yeddo hornbeam), Abies firma (Japanese fir), and Zelkova serrata (gray-bark elm), the Miscanthus community, the Senecio cannabifolius (Aleutian ragwort) community, and the Hypolepis punctata (bramble fern) community.

8

Food Habits of Sika Deer on Kinkazan Island, Northern Japan

115

Fig. 8.1 Map of Kinkazan Island showing the locations of sampling sites for fecal pellets. Contour lines show 100 m intervals.

Site 5 was selected in the Miscanthus community on the peninsula at the northern end of the island. Viburnum shrubs are abundant. Site 6 was selected in the Fagus crenata (Japanese beech) forest. The undergrowth is sparse and only short grasses and forbs grow there, though some unpalatable shrubs of Leucothoe grayana (fetterbush, Ericaceae) and Zanthoxylum piperitum (Japanese pepper tree) grow in clumps. Quantitative evaluation of food habits was done using the point frame method of examining fecal pellets (Stewart 1967). To show local variations of food habits, fecal pellets were collected at the six sites on the island (Fig. 8.1). For sampling, 20 pellets were collected from 20 different fecal piles in August, October, and December, 1976 and in April, 1977. Only fresh pellets were collected. Plants were identified by epidermal features of the plant fragments and placed into six categories: (1) Miscanthus sinensis, (2) Zoysia japonica, (3) Pleioblastus chino, (4) other graminoids, (5) “others” including forbs, browse, and ferns, and (6) unidentified materials. Fields of each microscopic slide were viewed at 200× or 600× magnification. Crossing points (1 mm aperture) on slides covered by plant fragments were scored for each food category and a total of 500 identifications was made for each sample. Percentage frequency of feeding (Fi) was determined as: Fi = fi /Ni where fi = the number of quadrats including the species i eaten by deer, and Ni = the total number of quadrats including the species i.

116

S. Takatsuki, U. K. G. K. Padmalal

In order to compare the food habits of different size classes of sika deer, we designated Site 7 in the western part of the island where a place (0.2 ha) composed of patches of the Zoysia japonica community, forb communities, and deciduous broadleaf forests was available (Fig. 8.1). We adopted the same method as above. Fecal pellets (four pellets each from six to eight fecal piles) were collected in October, 1990 and February, April, and July, 1991. They were treated similarly for determination of plant categories, but in this analysis about half of the samples were used to determine the nitrogen concentrations as an indicator of food quality by the micro-Kjeldahl method.

Results Plants Eaten by Sika Deer Table 8.1 summarizes the results of occurrence of plants (indicating their availability) and their consumption by sika deer. Among the 44 plots, a total of 158 plant species was recorded. Forbs were most abundant, with 674 occurrences (60.9%). These were followed by graminoids (295 occurrences, 26.6%) and browse (126 occurrences, 11.4%). Only four ferns appeared and none were eaten by sika deer. Feeding on graminoids was most frequent (84.7%) and least frequent on forbs (16.8%) except ferns whose sample size was very small.

Food Composition Seasonal changes in food composition determined by fecal analysis are shown in Fig. 8.2. At the shrine park (Site 1), Zoysia japonica was dominant in the feces, making up more than half of the diet in summer and fall. However, it significantly

Table 8.1 Frequencies of feeding (F) of five plant categories. Comparable results from Mt. Goyo are also shown. (From Takatsuki 1996). Kinkazan Island

Graminoid Forb Fern Browse Total

Mt. Goyo

Frequency of occurrence

Frequency of feeding

F(f/N)

Frequency of occurrence

Frequency of feeding

F(f/N)

N

(%)

f

(%)

N

(%)

f

(%)

295 674 12 126 1107

26.6 60.9 1.1 11.4 100

250 113 0 61 424

84.7 16.8 0.0 48.4 38.3

436 224 26 350 1,036

42.1 21.6 2.5 33.8 100

260 12 2 58 332

59.6 5.4 7.7 16.6 32.0

8

Food Habits of Sika Deer on Kinkazan Island, Northern Japan

117

Fig. 8.2 Seasonal changes in the botanical compositions of sika deer feces from six sites on Kinkazan Island. Miscanthus: Miscanthus sinensis, Zoysia: Zoysia japonica, Pleioblastus: Pleioblastus chino. Site numbers correspond to those of Fig. 8.1.

decreased in winter and spring diets, constituting only 10.2% and 25.6%, respectively. Pleioblastus chino appeared consistently although the proportion was small. At the grassland on a flat in the western part (Sites 2 and 3), fecal compositions were similar each other. Zoysia japonica made up 20–30% of the fecal composition in summer and fall but decreased in winter to only 1.2%. Pleioblastus chino formed 20–40% of the diet except in spring when it decreased to 13.2% and 8.4% at Sites 2 and 3, respectively. Pleioblastus chino was constantly grazed in winter and made up 30% of fecal composition. At the deciduous forest in the western part of the island (Site 4), Pleioblastus chino formed 17.4% of fecal composition in spring. In summer, Miscanthus sinensis occupied 13.1%, followed by Zoysia japonica (11.3%) and Pleioblastus chino (9.9%). In fall, Zoysia japonica occupied 15.4%, followed by P. chino (12.3%) and Miscanthus sinensis (8.8%). In winter, Pleioblastus chino increased again to reach a level comparable to that of spring (13.2%), while Zoysia japonica decreased markedly (2.5%). Seasonal changes in the fecal composition were less marked here than other sites. At the grassland in the northern peninsula (Site 5), Miscanthus sinensis was the most important forage in summer and fall. Total amount of graminoids contributed to 70–90%, although identification was difficult because many plant fragments recovered in the feces were sheaths and culms. In the Fagus forest (Site 6), Miscanthus sinensis accounted for 18.7% of the diet in summer and maintained around 10% in fall and even in winter (7.8%). This site differed from others in that “others” and “unidentified” materials occupied considerably large portions of the fecal composition. These categories included browse, forbs, and ferns, but most of the fragments were unidentifiable. It is probable that at least in winter a considerable part of the diet would be bark and twigs, most of which are not identifiable by epidermal features.

118

S. Takatsuki, U. K. G. K. Padmalal

Comparison Among Size Classes of Deer Botanical composition of the feces at Site 7, where feces were sampled to size-class differences on nitrogen content, were similar to those of the shrine park (Site 1) in that Zoysia japonica occupied large portions of the diet particularly in summer and fall, though Pleioblastus chino did not appear at Site 7, although it was present at Site 1. There were apparent differences in botanical compositions among the deer classes (Fig. 8.3). The proportion of graminoids was greatest in males and least in fawns (ANOVA, p < 0.05) except in winter (p > 0.05). Culms and sheaths constituted much of the diet in fall and winter, and these non-leaf parts were found more often in the larger deer classes. Contrary to graminoids, leaves of dicotyledonous plants showed a reversed pattern: their proportions were greater in smaller deer classes (p < 0.05). The exception was between fawns and females in fall when no difference was found (p > 0.05). The “others” category did not show any consistent tendency among the deer classes. They were greater in larger deer in spring and winter while they were smaller in spring and fall. Marked differences were found in seeds in fall when smaller deer consumed more seeds. Similarity indices (Whittaker 1952) between the diets of the deer of different classes indicated that the dietary overlaps were greater in summer and winter and less in spring and fall (Table 8.2). The indices also showed that the dietary overlaps were highest between females and fawns, and lowest between males and fawns (Table 8.2). Nitrogen concentrations of the feces were low in spring, increased in summer and fall, and decreased in winter (Fig. 8.4). They were consistently highest in fawns and lowest in males in every season (Fig. 8.4).

Comparison of Kinkazan Island with Mt. Goyo On Kinkazan Island, from the 158 plant species, forbs composed 60.9% of the plants in quadrats in the sika deer habitats (Table 8.1). However, the frequency of

Fig. 8.3 Seasonal changes in the botanical compositions of diets of male, female, and fawn sika deer at Site 7.

8

Food Habits of Sika Deer on Kinkazan Island, Northern Japan

119

Table 8.2 Percent similarities (Whittaker 1952) of dietary compositions between different classes of sika deer in different seasons. Deer class Spring Summer Fall Winter Males and females Females and fawns Males and fawns

83.6 89 72.7

90.3 96.4 83.7

80.9 82.8 69.5

85.7 90.4 77.2

Fig. 8.4 Seasonal changes in nitrogen concentrations in fecal pellets of male, female, and fawn sika deer at Site 7.

feeding on forbs was only 16.8% (Table 8.1). As a result, the feeding frequency for all the plants was 38.3%. By comparison 88 plant species appeared in the study plots at Mt. Goyo where the sika deer density was low. Among the 1,036 occurrences of plants in these plots, 332 cases contained eaten plants. Although this total frequency of feeding (32.0%) was significantly smaller than that of Kinkazan Island (38.3%) (χ2 value = 352.1, p < 0.0001, df = 1), the difference was small. This is unexpected because the deer density is much higher on Kinkazan Island (50 deer/km2) than at Mt. Goyo (80 cm) (Fig. 9.5). A remarkable difference was the scarcity of young trees smaller than 10 cm DBH. We counted some young Fagus trees at four different sites: two were outside a deer-proof fence, another two were inside the fence. One plot outside the fence was located in the unpalatable Leucothoe grayana mat in the understory of the Fagus forest (Fig. 9.3) and another was not in a Leucothoe mat. Very few young trees grew outside of a Leucothoe mat, where most regeneration occurred (Fig. 9.6). Inside the fence, we took sampling plots both beneath and away from the Fagus crenata canopy. There were more young trees under the canopy. Although fewer individuals occurred where there

Fig. 9.3 View of the Fagus crenata forest on Kinkazan Island. Note the poor subtree and shrub layers, and the development of a Leucothoe grayana “mat” in the understory.

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

131

Fig. 9.4 A clump of Sasamorpha borealis surviving in a crack of a rock in the forest where it is protected from sika deer browsing.

Fig. 9.5 Frequency distributions of DBH (diameter at breast height) of composite trees in the Fagus forest on Kinkazan and other two control forests (Mt. Moriyoshi and Kayano Flat) on the main island (from Nakashizuka and Numata 1982a, b).

was no canopy, some of these were very large (Fig. 9.6). The height distributions were different within and outside the Leucothoe mat. All the young trees outside were shorter than 40 cm, the canopy height of the Leucothoe grayana mat, while some

132

S. Takatsuki, T. Y. Ito

Fig. 9.6 Frequency distributions of DBH of young Fagus trees in different habitats. (A) outside the Leucothoe grayana mat outside a deer-proof fence, (B) within the Leucothoe mat outside the fence, (C) under the Fagus canopy inside the fence, (D) not under the Fagus canopy inside the fence. DBH classes are –5 = 0–5 mm, –10 = 6–10 mm, etc.

grew taller than 40 cm within the Leucothoe mat (Fig. 9.7). These data demonstrate that Fagus does produce seeds but that seedlings and saplings are eaten by deer. To follow seedling survival, we traced the survival of Fagus seedlings both inside and outside a fence from 1994 to 1996. The autumn of 1993 was a masting year for Fagus crenata. In May, 1994, we labeled the seedlings in 56 1 m × 1 m quadrat inside and 60 quadrats outside the fence. The initial densities were 2.1 and 1.6/m2, respectively. Figure 9.8 shows the survival curves of the Fagus seedlings. Decrease was more rapid outside; they had decreased by more than half as early as September, 1994, and to 11% by October, 1995. In contrast, the decrease was more

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

133

Fig. 9.7 Height distributions of Fagus trees outside of (left) and within (right) the Leucothoe grayana mat in the Fagus crenata forest on Kinkazan Island.

Fig. 9.8 Survival curves of young Fagus trees inside and outside a deer-proof fence in the Fagus crenata forest on Kinkazan Island.

134

S. Takatsuki, T. Y. Ito

gradual inside the fence, and seedlings had only decreased to 60% by October 1995. In 1996, no seedling survived outside while 42% of the seedlings survived inside. These results indicate that the deer feeding reduced the seedlings and eliminated them within three years. We also examined the Abies firma forests on Kinkazan Island and on the opposite Oshika Peninsula (Fig. 9.1; Takatsuki and Hirabuki 1998). Among the three plots on Kinkazan Island, two plots were composed of very large Abies trees and smaller deciduous broad-leaved trees while one plot (Kinkazan 1) was composed of comparatively smaller Abies trees with many other coniferous trees (mainly Torreya nucifera (Japanese nutmeg-yew) ) (Fig. 9.9). The undergrowth of the Abies forest on Kinkazan Island is quite sparse (Fig. 9.10). In contrast, there were various types of the Abies forests on Oshika Peninsula. Oshika plot 1 was composed of numerous small Abies trees with similar sized broad-leaved trees, Oshika plots 2 and 3 were composed of fewer small Abies trees with many broad-leaved trees, and Oshika plot 4 was composed of larger Abies trees. Despite this variation, young Abies trees were more abundant on Oshika Peninsula than on Kinkazan Island, and the undergrowth was densely covered by lianas, shrubs, forbs, and ferns. Thus, the Abies forest on Kinkazan Island has been strongly affected by deer browsing, and forest regeneration has been prevented.

Grassland Communities The forest on Kinkazan Island contains gaps formed by wind-thrown old trees (Fig. 9.11). Gaps often are enlarged by blowdown of an adjacent tree exposed to winds which formerly were blocked by the continuous forest canopy. Consequently, small gaps often are enlarged. When the diameter of a gap exceeds about 30 m, light conditions on the ground are improved, and Miscanthus sinensis, a tall grass, invades these larger gaps (Fig. 9.12). M. sinensis is not always a good forage because the leaf has sharp prickles containing silica at the leaf edge. However, due to its nontoxicity and abundance, the deer are attracted by the Miscanthus community and the density on this community is as high as 200 deer/km2 (Takatsuki 1983). They subsist on it to the extent it is available in the habitat (Takatsuki 1980). The leaves of Miscanthus sinensis are often clipped by the deer in spring when young succulent leaves develop. With removal, new leaves often regrow beside the clipped leaves. Because of repeated grazing, the Miscanthus community on Kinkazan Island is shorter than is usual for Miscanthus communities. The vertical structures of the Miscanthus community on Kinkazan Island and on Oshika Peninsula clearly demonstrate how heavily the former is grazed (Fig. 9.13). Heavy grazing also resulted in size reduction of Miscanthus leaves. We compared the width of Miscanthus leaves of Kinkazan Island with those at Kawatabi Farm of Tohoku University in northern Miyagi Prefecture (Fig. 9.1). The former was significantly narrower (mean = 32.8 mm) than the latter (mean = 56.3 mm, t-test, DF = 38, t = −7.564, p < 0.001). When grazed M. sinensis on Kinkazan Island is protected

9

Plants and Plant Communities on Kinkazan Island, Northern Japan 100

100

Kinkazan 2

Kinkazan 1 50

50

0

0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150-

0

0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150-

100

Abies firma Other conifers Broad-leaved trees

Kinkazan 3

Density (number / ha)

135

50

0 0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150722 289 389

556 300

300 250

Oshika 1

250

200

200

150

150

100

100

50

50

0

Oshika 2

0 0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150-

0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150411 300 250

300

Oshika 3

250

200

200

150

150

100

100

50

50

Oshika 4

0

0 0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150-

0- 10- 20- 30- 40- 50- 60- 70- 80- 90- 100-110-120-130-140-150-

Fig. 9.9 Frequency distributions of DBH (diameter at breast height) of composite trees in the Abies firma forest on Kinkazan (1–3) and on the Oshika Peninsula (1–4, Takatsuki and Hirabuki 1998). Note that scales of the density (Y axis) are different between Kinkazan Island and Oshika Peninsula.

by a fence, it recovers the leaf width within two years after protection. In 1995, we measured the widths of Miscanthus leaves inside and outside a fence that was established in 1993. The mean width inside was 49.3 mm which was significantly wider than that of outside (mean = 32.3 mm, t-test, DF = 38, t = −5.000, p < 0.001). Due to tolerance to grazing, the Miscanthus community is maintained at many places on Kinkazan Island. The community is often accompanied by the shrubs Viburnum dilatatum (linden) and Berberis thunbergii, graminoids like Brachypodium sylvaticum, Agrostis clavata, Festuca rubra, and Carex humilis var. nana, and forbs like Potentilla freyniana (cinquefoil), Viola grypoceras (violet), and Hydrocotyle ramiflora (Apiaceae). Table 9.1 shows the species composition of an area at the northern end of the island dominated by Miscanthus sinensis, but where Cirsium

136

S. Takatsuki, T. Y. Ito

Fig. 9.10 Inside view of the Abies firma forest on Kinkazan Island.

Fig. 9.11 Fallen trees of Fagus crenata in the Fagus forest on Kinkazan Island.

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

137

Fig. 9.12 Large forest gap invaded by Miscanthus sinensis, a tall grass (gap formation is accelerated by wind throw in a domino effect).

Fig. 9.13 Component structures of the Miscanthus sinensis community on Oshika Peninsula and on Kinkazan Island.

amplexifolium var. muraii, an unpalatable forb, grew abundantly. Coverage and height of the composite species were measured within 10 1 m × 1 m plots. As many as 31 forbs species were found, but in small amounts; 14 graminoids appeared and were more abundant. Browse species were less dominant and most of these were shrubs (Takatsuki 1980).

138

S. Takatsuki, T. Y. Ito

Table 9.1 Dominance of composite species in the Miscanthus sinensis community in a western part of Kinkazan Island. Figures are Summed Dominance Ratio (SDR) (Numata and Yoda 1957). Growth forms are: b = browse, bl = woody liana, bu = woody unpalatable, fe = fern, fo = forb, fol = herbaceous liana, fou = unpalatable forb, g = graminoid (modified from Takatsuki 1980). Species Growth form Plot 2 Miscanthus sinensis Cirsium amplexifolium var. muraii Carex lanceolata Pleioblastus chino Brachypodium sylvaticum Stephanandra incisa Lonicera gracilipes Zanthoxylum piperitum Caryopteris divaricata Rubus microphyllus Viburnum dilatatum Potentilla freyniana Bromus pauciflorus Agrostis clavata Pennisetum alopecuroides Calamagrostis arundinacea Paederia scandens var. mairei Agrimonia pilosa Smilax china Oxalis corniculata Clinopodium chinense var. parviflorum Zelkova serrata Clinopodium micranthum Clematis apiifolia Galium trachyspermum Viola grypoceras Ixeris dentata Clinopodium gracile var. multicaule Trisetum bifidum Lysimachia japonica Lespedeza pilosa Perilla frutescens var. citriodora Carpinus tschonoskii Zoysia japonica Festuca rubra var. rubra Rhododendron juponicum Chamaele decumbens Geranium tripartitum Phryma leptostachya var. asiatica Desmodium oxyphyllum Hydrocotyle ramiflora Lycopus maackianus Plectranthus inflexus Paspalum thunbergii

G Fo G G G B B Bu Fo Bu B Fo G G G G Fo Fo Bu Fo Fo B Fo Bl Fo Fo Fo Fo G Fo Fo Fo B G G Bu Fo Fo Fou Fo Fo Fo Fo G

100 62.8 29.6 29.2 29.1 28.0 23.1 18.7 18.4 17.1 16.5 15.6 15.1 15.0 14.6 14.2 9.9 9.6 8.1 7.8 7.0 6.6 6.5 5.5 5.3 5.1 4.8 4.5 4.2 4.1 4.0 3.8 3.5 3.5 3.2 2.9 2.8 2.5 2.5 2.2 2.2 2.2 2.2 2.0 (continued)

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

Table 9.1 (continued) Species Moehringia lateriflora Polygala japonica Hypericum erectum Oplismenus undulatifolius Galium paradoxum Lapsana humilis Cerastium holosteoides var. hallaisanense Luzula capitata Geranium thunbergii Leibnitzia anandria Ajuga decumbens

Growth form Fo Fo Fo G Fo Fo Fo G Fo Fo Fo

139

Plot 2 1.6 1.6 1.6 1.6 1.4 1.4 1.2 1.0 0.8 0.8 0.6

Fig. 9.14 View of an openland in the western part of Kinkazan Island where a Miscanthus sinensis community in 1983 (left) was replaced by the Zoysia japonica community by 1999 (right) due to heavy grazing by sika deer. Berberis thunbergii (shrubs) and Cirsium amplexifolium var. muraii survived.

At a higher deer density, Miscanthus sinensis cannot survive and is replaced by Zoysia japonica, a lawn grass. This short grass is quite productive under good light conditions (Kira 1952; Inoue and Sasaki 1958; Ito et al. chapter 10). That is, heavy grazing removes other taller plants and facilitates the growth and development of Zoysia japonica. In the 1970s, Zoysia japonica contributed to the deer diets as an important forage in habitats where it was available (Takatsuki 1980). During the last two decades, the Zoysia community has enlarged its distribution on Kinkazan Island (Fig. 9.14). Accordingly, the contribution of Z. japonica to the deer diet increased in the 1990s as the Zoysia community developed (Ito et al. chapter 10). Zoysia japonica seems to be a preferred forage for the deer. For example, the bite rate of sika deer is much higher on the Zoysia community than in other plant communities (Ito et al. chapter 10). Seed dispersal by sika deer also enhances the development of the Zoysia community (Takatsuki 1999). Z. japonica produces abundant large seeds at the top of short peduncles, most of which are eaten by the deer. A feeding experiment showed that the survival rate of the seeds passing through the digestive tract of sika deer was about 40%, and the germination of the

140

S. Takatsuki, T. Y. Ito

recovered seeds was higher than that of intact seeds (Imaei 1992). This seems to be a good example of the “foliage is a fruit” theory of Janzen (1984). He proposed that foliage is ecologically a fruit in that the plants afford foliage as bait foods to herbivores and consequently utilize animals as seed dispersal agents, as berrybearing trees do with birds. The Zoysia community and the Miscanthus community are interchangeable depending on grazing intensity of the deer. When a Zoysia community is protected by a fence, it is replaced by Miscanthus within several years. Table 9.2 shows the species compositions of the communities inside (Miscanthus community) and outside (Zoysia community) five years after establishment of a fence. It is noticeable that biomass increased sixfold inside the fence. Zoysia japonica was the superdominant species (93.1% of the total biomass) outside, whereas inside Miscanthus sinensis accounted for 67.1% and some other important plants such as Stephanandra incisa (Rosaecea) and Pleioblastus chino (a bamboo) also grew inside the fence. Growth form composition was also different; only two woody plants and no lianas grew outside whereas five woody plants and four lianas grew inside. A view of the fence 10 years after establishment is shown in Fig. 9.15. Thus for the Zoysia community, grazing of sika deer functions to (1) remove other competitive taller plants and (2) disperse seeds away from mother plants. It is

Table 9.2 Dry weight of each species inside and outside a deerproof fence five years after establishment on Kinkazan Island. Outside Inside Zoysia japonica Carex breviculmis Brachypodium sylvaticum Paspalum thumbergii Viola obtusa Liriope minor Agrostis clavata var. nukabo Haloragis micrantha Luzula capitata Festuca rubra Botrychium ternatum Polygala japonica Lespedeza juncea var. subsessilis Gnaphalium japonicum Lysimachia japonica Ixeris dentata Hydrocotyle ramiflora Plantago asiatica Viburnum dilatatum Galium pogonanthum Oxalis corniculata Miscanthus sinensis

Dry weight (g/m2)

(%)

144.6 ± 53.0 2.2 ± 1.7 1.5 ± 1.2 0.8 ± 1.5 0.7 ± 1.3 0.8 ± 0.2 0.8 ± 0.3 0.4 ± 0.8 0.5 ± 0.4 0.3 ± 0.2 0.2 ± 0.2 0.2 ± 0.2 0.1 ± 0.2 0.1 ± 0.1 0.1 ± 0.1 0.0 ± 0.1 0.0 ± 0.1 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0

93.1 1.8 1.2 0.8 0.6 0.6 0.5 0.4 0.4 0.2 0.1 0.1 0.1 0.1 0.0 0.0 0.0 0.0 0.0 0.0 0.0

Dry weight (g/m2)

(%)

0.8 ± 1.5 0.6 ± 0.8 0.8 ± 1.3 9.1 ± 9.7

0.1 0.1 0.1 0.9

0.0 ± 0.0 0.7 ± 0.8

0.0 0.1

0.0 ± 0.1

0.0

0.0 ± 0.0

0.0

41.7 ± 83.4 0.1 ± 0.2 0.1 ± 0.2 609.7 ± 204.3

3.6 0.0 0.0 67.1 (continued)

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

141

Table 9.2 (continued) Outside Dry weight (g/m2) Stephanandra incisa 106.2 ± 117.9 Pleioblastus chino Smilax china Carex lanceolata Calamagrostis epigeios Zanthoxylum piperitum Cirsium amplexifolium var. muraii Rubus microphyllus Akebia quinata Lespedeza pilosa Dioscorea tokoro Potentilla freyniana Phryma letostachya var. asiatica Scilla scilloides Moehringia lateriflora Geranium nepalens ssp. thunbergii Chamaele decumbens Muhlenbergia longiatolon Abies firma Total 153.2

Inside (%)

Dry weight (g/m2)

(%)

11.2

100

53.5 ± 43.1 42.6 ± 85.3 21.7 ± 7.7 11.6 ± 18.0 6.0 ± 11.9 5.4 ± 7.0 2.1 ± 2.7 1.8 ± 2.4 1.4 ± 1.2 1.1 ± 2.3 0.8 ± 0.6 0.5 ± 1.1 0.5 ± 0.3 0.4 ± 0.5 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ±0.0 920.5

6.2 4.1 2.6 1.1 1.2 0.5 0.2 0.3 0.1 0.2 0.1 0.1 0.1 0.0 0.0 0.0 0.0 0.0 100

Fig. 9.15 A fence established in the Zoysia japonica community on Kinkazan Island. This photo was taken in June, 2002, 12 years after establishment.

142

S. Takatsuki, T. Y. Ito

also plausible that Zoysia is fertilized by sika defecation, which may enhance establishment of new plants. Overall, despite the “rich green” appearance of Kinkazan Island, the plants are not always good forage for the deer. Many common palatable plants have been replaced by unpalatable plants. Forest regeneration is prevented because seedlings and saplings are fed on by the deer. Only old, big canopy trees remain but they are lost as they become decadent and fall down. This results in gap formation, and small openings are enlarged as further trees, exposed to wind, fall in turn. At an early phase of gap formation, shrubs and tall grasses grow, but subsequently they are replaced by the Zoysia community because the deer concentrate in these openings and the balance of the former plant groups cannot tolerate deer feeding effects and they decrease. Acknowledgements This series of studies were done with the following personnel: T. Gorai (Tohoku University), Dr. Y. Hirabuki (Miyagi Educational University), F. Shibata (Tohoku University), I. Imaei (Tohoku University), A. Kimura, M. Kikuchi, T. Miura, and H. Kawakatsu (Macky School). All photos were taken by S. Takatsuki.

Literature Cited Anderson, R. C., and A. J. Katz. 1993. Recovery of browse-selective tree species following release from white-tailed deer (Odocoileus virginianus Zimmerman) browsing pressure. Biological Conservation 63: 203–208. Asahi, M., S. Azuma, T. Ito, M. Kawai, and K. Hayashi. 1967. A faunal survey on large mammals in Kinkazan Island, Miyagi Prefecture - sika deer. Annual Report of International Biological Program, Japan Branch-CTS for 1966: 189–196. Boerner, R. E., and J. A. Brinkman. 1996. Ten years of tree seedling establishment and mortality in an Ohio deciduous forest complex. Bulletin of the Torrey Botanical Club 123:309–317. deCalesta, D. S. 1997. Deer and ecosystem management. Pages 267–279 in W. J. McShea, H. B. Underwood, and J. H. Rappole, editors, The science of overabundance: Deer ecology and population management. Smithsonian Institution Press, Washington, DC, USA. Healy, W. M. 1997. Influence of deer on the structure and composition of oak forests in Central Massachusetts. Pages 249–266 in W. J. McShea, H. B. Underwood, and J. H. Rappole, editors, The science of overabundance: Deer ecology and population management. Smithsonian Institution Press, Washington, DC, USA. Imaei, H. 1992. Seed ecology of the Zoysia japonica community on Kinkazan Island. Graduate thesis, Department of Biology, Faculty of Science, Tohoku University, Sendai, Japan. (In Japanese.) Inoue, T., and T. Sasaki. 1958. The effects of shading on sod. Report of Tohoku Agricultural Institute 14:92–103. Janzen, D. H. 1984. Dispersal of small seeds by big herbivores: Foliage is the fruit. American Naturalist 123:338–353. Kira, T. 1952. So called “overgrazed pastures” in ecological context. Bulletin of the Society of Plant Ecology 1:209–213. McNaughton, S. J. 1983. Compensatory plant growth as a response to herbivory. Oikos 40:329–336. McNaughton, S. J. 1984. Grazing lawns: animals in herds, plant form, and coevolution. American Naturalist 124:863–886. Miller, S. G., S. P. Bratton, and J. Hadidian. 1992. Impacts of white-tailed deer on endangered and threatened vascular plants. Natural Areas Journal 12:67–74.

9

Plants and Plant Communities on Kinkazan Island, Northern Japan

143

Nakashizuka, T., and M. Numata. 1982a. Regeneration process of climax beech forests, I. Structure of a beech forest with the undergrowth of Sasa. Japanese Journal of Ecology 32:57–67. Nakashizuka, T., and M. Numata. 1982b. Regeneration process of climax beech forests, II. Structure of a climax beech forest under the influence of grazing. Japanese Journal of Ecology 32:473–482. Numata, M., and K. Yoda. 1957. The community structure and succession of artificial grassland, I. Journal of Japanese Society of Grassland Science 3:4–11. Takatsuki, S. 1980. Food habits of sika deer on Kinkazan Island. Science Reports Tohoku University, Series IV (Biology) 38:7–31. Takatsuki, S., 1983. Habitat selection by sika deer on Kinkazan Island. Journal of the Mammalogical Society of Japan 9:183–191. Takatsuki, S. 1999. The Zoysia japonica community maintained by sika deer. Pages 65–85 in K. Ueda, editor, Processes of mutualism, 2. Seed dispersal. Tsukiji Publishing Company, Tokyo, Japan. Takatsuki S., and T. Gorai. 1994. Effects of sika deer on the regeneration of a Fagus crenata forest on Kinkazan Island, northern Japan. Ecological Research 9:115–120. Takatsuki, S., and Y. Hirabuki. 1998. Effects of sika deer browsing on the structure and regeneration of the Abies firma forest on Kinkazan Island, northern Japan. Journal of Sustainable Forestry 6:203–221. Takatsuki, S., and T. Ito. 1999. Population dynamics of sika deer on Kinkazan Island. Pages 85–97 in Miyagi Prefecture, editor, Conservation of Kinkazan Island. Sendai, Japan. (In Japanese.) Takatsuki, S., K. Suzuki, and I. Suzuki. 1994. A mass-mortality of sika deer on Kinkazan Island, northern Japan. Ecological Research 9:215–223. Whitney, G. G. 1984. Fifty years of change in the arboreal vegetation of Heart’s Content, an oldgrowth hemlock-white pine-northern hardwood stand. Ecology 65:403–408. Yoshii, Y., and K. Yoshioka. 1949. The vegetation of Kinkazan Island. Ecological Review (Sendai). 12: 84–105. (In Japanese.) Yoshioka, K., and T. Kashimura. 1959. Plant communities induced by deer grazing and browsing. Science Reports of the Faculty of Arts and Sciences, Fukushima University 8:9–14.

Chapter 10

Productivity and Foraging Efficiency of the Short-Grass (Zoysia japonica) Community for Sika Deer Takehiko Y. Ito, Mariko Shimoda, and Seiki Takatsuki

Abstract A sika deer population at an extremely high density (814 deer/km2) on Kinkazan Island in northeastern Japan heavily used a lawn grass, Zoysia japonica, community. Field experiments and behavior observations were done to determine the reason for this high use. The productivity of the Zoysia community was as high as 370 g/m2/year. The biomass concentration (150–180 g/cm3 below 5 cm) and the bite rate (about 50 times/min) were higher on the Zoysia community than those in the adjacent forest understory. These characteristics of the Zoysia community seem to attract the sika deer. The potential deer density supported was estimated as 1,840–2,875 deer/km2 during the growing period. This was twice the achieved deer density.

Introduction Because of its warm and humid climate, the vegetation of Japan is dominated by forests, and grassland communities appear only under disturbances such as mowing or grazing (Numata 1973). On small islands, for example, where the density of sika deer (Cervus nippon Temminck) sometimes reaches as high as 30–130 deer/km2 (e.g., Nakanoshima Island, Takahashi 1998; Nozaki Island, Doi and Endo 1995), small grassland communities appear (e.g., Takatsuki 1977, 1980), although sika deer usually live in forests at a low density ( Sk based on availability, grazing tolerance, and nutritional value. The values (scores in parentheses) were none (0), Sk(1), Sk + Ss (2), Sb or Sn + Sb or Ss + Sb (3), Ss (4), Ss + Sn (5), and Sn (6). Coniferous cover ratio (%) was determined by calculating the proportion of 30-m grids of coniferous forest or mixed forests in a COA grid (Environment Agency of Japan 1997). Site fidelities to the seasonal home ranges were assessed by whether individual deer summer or winter home ranges overlapped or not in successive years, and by calculating the distances between individual COAs in successive years for summer and winter.

Migration Information We collected 7,765 location points between April 1997 and May 2002 (Igota et al. 2004). Monitored duration for each individual averaged 714 ± 67 (SE) days (range = 20–1,877). Ten (18%) of 57 radio-collared deer were upward migrants (UM) that had summer home ranges lower than or at similar elevation as their winter home ranges, 29 (51%) were downward migrants (DM) that had the summer home ranges higher than their winter home ranges, and 12 (21%) were nonmigrants (NM) that had overlapping seasonal home ranges (Table 19.1). The remaining 6 deer (11%) indicated migratory behaviors but died or were missed due to radio-collar troubles before their summer home ranges were determined. Upward migrants and DMs migrated from winter home ranges to summer home ranges between March and April, and migrated from summer home ranges to winter

Upward migrants Downward migrants Non-migrants Unknownb

Migration direction East 9, West 1 North 25, East 4 – –

Mean ± SE 58.7 ± 8.9 27.0 ± 2.3 – –

Range 18.4–101.7 7.2–53.4 – –

125 ± 25 (9) 123 ± 29 (19) 66 ± 4 (11) –

Mean ± SE (n) 26–264 19–602 48–94 –

Range

Summer home range size (ha)a

74 ± 19 (9) 107 ± 17 (14) 197 ± 36 (7) –

Mean ± SE (n)

b

9–163 27–230 69–353 –

Range

Winter home range size (ha)a

Seasonal home range sizes were calculated when deer were located more than 30 times in a season. They showed migratory behavior but were missed due to radiocollar failures or died before their summer ranges were reached.

a

N

10 29 12 6

Migratory type

Migration distance (km)

Table 19.1 Migration patterns of upward migrant, downward migrant, and nonmigrant sika deer in eastern Hokkaido, Japan (Igota et al. 2004).

19 Seasonal Migration of Sika Deer on Hokkaido Island, Japan 257

258

H. Igota et al.

0

20

40

60

80

100 km

Elevation (m) 0 – 100 100 – 200 200 – 300 300 – 400 400 – 500 500 – 600 600 – 700 700 – 800 800 – 900 900 – 1000 1000 – 1100 1100 – 1200 1200
0.05), they were pooled for each season. Thirty-two (97%) of 33 deer had overlapping summer home ranges in successive years. Seventeen (71%) of 24 deer had overlapping winter home ranges in successive years. The proportions of individuals with overlapping or nonoverlapping seasonal home ranges differed between summer and winter (p = 0.005; Fig. 19.5). As the distance between individual COAs in successive years did not differ among three migratory types in summer or winter (p > 0.05), they were pooled for each season. The distance between individual COAs in two successive years in summer (mean ± SE = 814 ± 626 m, n = 58) were significantly shorter than in winter (mean ± SE = 2,340 ± 768 m, n = 42; p = 0.008; Fig. 19.6). The winter home range characteristics and migration distances

19 Seasonal Migration of Sika Deer on Hokkaido Island, Japan

259

Fig. 19.5 The proportion of individuals with overlapping seasonal home ranges in successive years for sika deer in eastern Hokkaido, Japan, 1997–2001. As the proportion of individuals with overlapping and nonoverlapping seasonal home ranges did not differ among the three migration types in summer or winter, the bars were pooled for each season (Igota et al. 2004).

Fig. 19.6 The distance between individual geographic centers of activity (COAs) in two successive years in summer and winter. The bars indicate SE. As the distance between individual COAs in successive years did not differ among three migration types in summer or winter, they were pooled for each season (Igota et al. 2004).

of the individuals with nonoverlapping winter ranges (n = 7) did not vary among years (p > 0.05). The summer home ranges of UMs were at significantly lower elevations than their winter home ranges, whereas DMs had the summer home ranges at significantly higher elevations than their winter home ranges (Table 19.2). The summer and winter home ranges of NMs did not vary in elevations (Table 19.2). The elevations in summer home range differed among three migratory types (p < 0.0001), whereas the elevations of winter home range were similar among three migratory types (p = 0.17). The snow depths in the summer home ranges of UMs were significantly higher than in their winter home ranges (Table 19.2). Although only one UM migrated to a winter home range with deeper snow than its summer home range, the difference was only 1 cm. The snow depths in the summer home ranges of DMs were significantly higher than in their winter home ranges (Table 19.2). No DM migrated to a winter home range with deeper snow than its summer home range. There was no significant difference in snow depth between the seasonal home ranges of NMs (Table 19.2). The snow depths in summer home range differed among three migratory types (p < 0.0001), and those of DMs were significantly higher than of NMs or UMs (p < 0.0167). The snow depths in winter home range were similar among three migratory types (p = 0.58). According to the weather data of Japan Meteorological Agency, the snow depths during November and May in Naka-Shibetsu in the eastern part of the study area (see Fig. 19.2 for locations) were higher than those

260

H. Igota et al.

Table 19.2 Comparison of the characteristics (mean ± SE) of the seasonal home ranges of upward migrants (UM, n = 10), downward migrants (DM, n = 29), and nonmigrants (NM, n = 12) for sika deer in eastern Hokkaido, Japan (Igota et al. 2004). Summer

Wilcoxon’s signed-ranks test

Winter

Characteristics

Typea

Mean

SE

Mean

SE

Z

P

Elevation (m)

UM DM NM UM DM NM UM

137 489 242 67 93 55 3.2

26 26 6 4 3 1 0.9

250 262 241 53 53 55 6.0

11 7 5 2 1 1 0.0

−2.65 −4.70 −0.37 −2.71 −4.70 −0.58 −2.27

0.008