Ribozyme Protocols

1 Ribozymes An Introduction Helen A. James and Philip C. Turner 1. Introduction One of the more important new insights i...

Author: Philip C. Turner

16 downloads 655 Views 29MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

1 Ribozymes An Introduction Helen A. James and Philip C. Turner 1. Introduction One of the more important new insights in the field of molecular biology in the past 15 years was the discovery that RNA molecules, once thought to be primarily passive carriers of genetic information, can carry out some functions previously ascribed to proteins. Some RNAs are capable of acting as enzymes even in the complete absence of proteins. The reactions observed include cleavmg themselves or other RNA molecules, ligation, and trans-splicing. Other new biochemical activities are being developed using in vitro selection protocols. The rapid identificatton of features that allow these catalytic RNA molecules, or ribozymes, to carry out their specific reactions has led to the realization that ribozymes can easily be manipulated to act on novel substrates. These custom-designed RNAs have great potential as therapeutic agents and are becommg a powerful tool for molecular biologrsts. This book is a fairly comprehensive collection of contributions aimed at giving practical advice to anyone wanting to design and use ribozymes. It covers the selection of target sites (Chapters 2-6), the synthesis and production of ribozymes in vitro and in viva (Chapters 7-20), reaction parameters, kinetics, product detection, and optimization (Chapters 21-36), methods for analyzing ribozyme structure (Chapters 37-41), and delivery methods and some examples of current applications (Chapters 42-49). This chapter provides a brief introduction to ribozymes, which we hope will be useful to those wishing to use the various protocols in subsequent chapters. From

Methods m Molecular Edlted by P C Turner

Biology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

2

James and Turner

1.1. RNA Cata/ysis A rtbozyme is an RNA molecule that can break and/or form covalent bonds (I). It greatly accelerates the rate of the reaction, and shows extraordinary specificity with respect to the substrates it acts on and the products it produces. RNA catalysis has been demonstrated in members of the group I and II introns, the genomes of viroids, virusoids, and satellite RNAs of a number of vu-uses, and m the prokaryotic pre-tRNA processing machinery. In several other cellular processes involving ribonucleoproteins (RNPs), it has been proposed that an RNA component may be acting as a ribozyme, e.g., rRNA in translation, U6 snRNA in the spliceosome, snoRNAs in rRNA processing, and guide RNAs in RNA editing. 1.2. Self-Cleaving RNAs One category of intramolecular RNA catalysis is that which produces 2’,3’-cyclic phosphate and 5’-OH termim on the reaction products. A number of small plant pathogenic RNAs (viroids, satellite RNAs, and virusoids), a transcript from a Neurospora mitochondrial DNA plasmid, and the animal virus hepatms delta virus (HDV) undergo a self-cleavage reaction in vitro m the absence of protein. The reactions require neutral pH and Mg2’ (2,3). In the case of the pathogenic RNAs, it is thought that the self-cleavage reaction IS an integral part of their in viva rolling circle mechanism of replicatton (4). These self-cleaving RNAs can be subdivided mto groups depending on the sequence and secondary structure formed about the cleavage site. 7.2.1, Hammerhead Ribozymes This group of RNAs share a two-dimensional structural motif known as the “hammerhead” which has been shown to be sufficient to direct site-specific cleavage (although the three-dtmenstonal structure recently elucidated 1.51suggests that the ribozyme should be renamed “wishbone”). The hammerhead structure consists of three base-paired stems (helices I, II, and III), which flank the susceptible phosphodtester bond, and two single-stranded regions, which are highly conserved m sequence (3,6). Extensive mutagenesis has revealed the important nucleotides and functional groups for efficient catalysis. The hammerhead cleavage domain has been split mto two (6) or three (7) independent RNAs, and trans-cleavage has been demonstrated in vitro. Haseloff and Gerlach (8) proposed a model (see Fig. 1) whereby the hammerhead domam 1sseparated such that the substrate RNA contains just the cleavage site, and the ribozyme contains the other conserved nucleotides of the catalytic core. Mutagenesis has revealed that the target site can be any NUH sequence where H = A, C, or U (IUB system) and N is any nucleotide (8,9). However, identifying a suitable target site 1ssubject to a number of other variables, none

3

Introduction to Ribozymes

Substrate

5’

I&.)1.7 + I, ,2 NNNNNNNNNU8-NNNNNNNNNN3’ 11111111 I I I I I I I NNNNNN,$& JjgNNNNNN 3’ 1424 csu ,,A “c, 12G A As X-G,: !’ UT Ribozyme

I

5’

g-E G-C A

G GU

Fig. 1. The hammerhead ribozyme. Shaded sequences are conserved, and the arrow indicates the bond cleaved. Numbering is that of Hertel et al. (36).

of which can be easily overcome (see Chapters 2-6). The sequence of the arms of the rtbozyme aligns the catalytic core to the target site via complementary base pairing. Analysis has also allowed determination of the mimmum core sequence required for catalytic activity. This has resulted m the “mmrzyme” of McCall et al. (ZO) described in Chapter 17. Haseloff and Gerlach’s model has allowed the design of specrtic endoribonucleases. They tested this by designing three ribozymes against the mRNA for chloramphemcol acetyl transferase (CAT), all of which cleaved in vitro. This work encouraged others to design trans-acting rrbozymes. The ability to cleave the RNA and thereby inhibit the expression of a specific gene selec-

tively has two main applications: as a tool for molecular biology (in vitro manipulation

of RNAs)

and the inactivation

of gene transcripts

in VIVO, as

antiviral agents, for example. The use of ribozymes for both applications has become possible with the development of chemical synthesis of RNA, with or without modtfied nucleosides and links (see Chapters 7 and 8) and the identification of suitable expression vectors (see Chapter 42).

1.2.2. Hairpin Ribozyme A second small catalytic domain is the “hairpin” structure (see Fig. 1 m Chapters 18 and 19), which has four helical domains and five loops (I I, 12). Two helices of the hanpin domain form between the substrate and rtbozyme, and this allows the design and specificrty of binding for trans-acting hairpin

4

James and Turner

ribozymes. The hairpin ribozyme has a more complicated substrate requirement than the hammerhead ribozyme, but despite this, any RNA of interest is expected to have numerous potential target sites. The design and uses of hairpin ribozymes are discussed further m Chapters 18, 19,23, 37, and 48. 1.2.3. Hepatitis Delta Virus HDV genomic and antigenomic RNAs contam a self-cleavage site hypothesized to function during rolling circle replication (13). Like the plant pathogens, the sites m HDV are postulated to have a related secondary structure, three models of which have been proposed: cloverleaf (13); pseudoknot (14), and axehead (15), none of which is similar to the catalytic domains previously described Like the other ribozyme motifs, the HDV ribozymes require a divalent cation (131, and cleavage results m products with 2’,3’-cychc phosphate and S-OH termim (IS). Investigations of truns-cleavage with the HDV ribozyme are not so advanced, and consequently, the use of the HDV ribozyme m trans is not covered in this book, although it has been used in czsin Chapter 38. 7.2.4. Neurospora Mitochondrial

VS RNA

The Neurosporu mitochondrial VS RNA, a single-stranded circular RNA of 88 1nt, sharessome features of the self-catalytic RNAs of HDV, group I mtrons, and some plant vu-al satellite RNAs (16). Although VS RNA can be drawn to have a secondary structure like group I mtrons, it is missmg essential basepairing regions, the cleavage site is m a different position, and the termini produced are 2’,3’-cyclic phosphate and 5’-OH. Like hammerhead ribozymes, VS RNA requires divalent cations for cleavage in vitro. The catalytic core of Neurosporu VS RNA has been shown to consist of 154 nt (17). 1.3. Self-Splicing RNAs A second group of catalytic RNAs are those that produce S-phosphate and 3’-OH termini on the reaction products. 1.3.7. Group I In trons Group I intron self-splicing (in vitro) in the absence of protein was first observed for the intervening sequence (IVS, intron) of the nuclear 26s rRNA gene in Tetrahymena thermophila (1). Splicing proceeds by two consecutive trans-esterification reactions (18). The reaction (see Fig. 2A) is initiated by a nucleophilic attack by the 3’-hydroxyl of a guanosme (or a phosphorylated derivative: GMP, GDP, or GTP) at the phosphodiester bond between the 5’-exon and the intron (5’-splice site). The new 3’-hydroxyl group of the 5’-exon then initiates a second nucleophilic attack,

5

introduction to Ribozymes

A

5’ exon

G

CUpA

PU-

3’exon

1c GOH 1

1

Intermediate -CuO

H

GpU -

__)

UGpA / U O---MA

-C

H

Ligated exons

ucgu

+ GpA- WUpA 4 HOG

-

CpA+

Intron Lariat intron

UGDA ‘1 UOH

1

circnlar intron

Fig. 2. Self-splicing of group I and group II introns. (A) Group I introns: splicing of the Tetrahymena pre-rRNA IVS and cyclization of the excised IVS. (B) Group II introns with the formation of a lariat.

this time on the phosphodiester bond between the 3’-exon and the intron (the 3’-splice site). This results in ligation of the exons and excision of the intron. Self-splicing is, by definition, an intramolecular event, and the intron is therefore not acting as a true enzyme. However, the catalytic activity found

6

James and Turner

within the conserved core can be dissociated mto dtstmct active enzyme and substrate molecules. Shortened verstons of the Tetrahymena IVS (L- 19 IVS and L-2 1 &a1 IVS) have been shown to be true enzymes m vitro, for example, as a restriction endoribonuclease (19) and as a template-dependent polymerase (20). Despite all the evidence for self-spltcing m vitro, it is clear that splicing m vivo requires protein factors. Even the Tetrahymena IVS, which at low levels of Mg2+ splices efficiently m vitro, is splicing at a rate of about 50-fold less than the level estimated for splicing in vivo (1). 1.3.2. Group II lntrons It has also been demonstrated that some members of the group II introns can self-splice m vitro. The urnmolecular reaction was shown to be Mg2+-dependent, require spermidine, have a temperature optimum of 45OC,have a requirement for ribonucleotides or monovalent cations as cofactors, and have a pH optimum of between 6.5 and 8.5 (ZZ). Group II mtrons splice by way of two successive phosphate transfer reactions (see Fig. 2B). In the first step, the 2’-OH group of an intramolecular branchpoint adenosine attacks the phosphodiester bond at the 5’-splice site (creating a 2’,5’ bond), producing the free 5’-exon and a sphcmg intermediate, the mtron-3’-exon. The second step involves cleavage at the 3’-splice site by the 3’-OH of the 5’-exon. Simultaneously, the exons are ligated and the intron lariat, with a 2’,5’-phosphodiester bond, is released. The ability of the group II introns to bmd the 5’-exon spectfically has been exploited to encourage the IVS to catalyze reactions on exogenous substrates. Investigations have now shown, as well as a reversal of splicing (22), a group II intron can ligate ssDNA to RNA, and another cleave an ssDNA substrate, 1.4. Ribonuclease P Ribonuclease P (RNase P) is the ubiquitous endoribonuclease that processesthe 5’-end of precursor tRNA molecules (23). It cleaves specific bonds to produce 5’-phosphate and 3’-OH termini, and in vitro requires adtvalent metal ton. RNase P consistsof a protein moiety and an RNA moiety. It was dtscovered that, at least m bacteria, tt is the RNA moiety that is the catalyst (24) and, as such, ts the only rtbozyme that is a true enzyme:it catalyzesan intermolecular reaction, 1sunaltered by the event, follows Michaelis-Menten kinetics, and is stable.Several studieshave now shown that RNase P can be tricked into cleaving any desired substrate (25), and Chapter 20 details the design and preparatton of RNase P ribozymes. 1.5. Ribozyme Delivery Whatever type of ribozyme is chosen, it must be introduced mto its target cell. Two general mechanismsexist for introducing catalytic RNA molecules into cells:


7

(1) exogenousdelivery of the preformed ribozyme (seeChapters44 and 46) and (2) endogenousexpressionfrom a transcriptional umt (seeChapters42-45,47, and 48). Preformed ribozymes can be delivered mto cells using hposomes (26), electroporation, or microinlection. Efforts have been made to overcome the lack of stability of introduced RNAs by using modified nucleottdes, 2’-fluoroand 2’-ammo- (271, or 2’-Gallyl- and 2’-O-methyl- (28), mixed DNA/RNA molecules (29), or by the addition of termmal sequences (such as the bacteriophage T7 transcriptional terminator) at the 3’-end of the RNA to protect against cellular nucleases (30). Endogenous expression has been achieved by inserting ribozyme sequences into the untranslated regions of genes transcribed by RNA polymerase II (pol II), which have strong promoters, such as the SV40 early promoter (32), the actin gene (32), or a retrovrral long terminal repeat (LTR) (33). Ribozymes have also been inserted into the anticodon loop of tRNA (transcribed by RNA polymerase III) and shown to be functional in Xenopus oocytes (34) or in plant cells (35). References 1. Kruger, K , Grabowskl, P. J., Zaug, A J., Sands, J , Gottschlmg, D E , and Cech, T. R. (1982) Self-splicmg RNA. autoexctsion and autocyclization of the rtbosoma1 RNA intervening sequence of Tetrahymena. Cell 31, 147-157. 2 Hutchins, C J , RathJen, P. D., Forster, A. C., and Symons, R. H. (1986) Selfcleavage of plus and minus RNA transcripts of avocado sunblotch vtroid Nuclezc Acids Res. 14,3627-3640. 3. Forster, A C and Symons, R. H. (1987) Self-cleavage of plus and minus RNAs of a virusotd and a structural model for the active sites. Cell 49,2 1 l-220. 4. Branch, A. D. and Robertson, H D. (1984) A replication cycle for vnolds and other small mfectrous RNA’s Science 223,450-455 5. Pley, H. W., Flaherty, K. M., and Mckay, D. B. (1994) Three dimensional structure of a hammerhead rtbozyme. Nature 372,68-74. 6. Uhlenbeck, 0 C. (1987) A small catalytic oligoribonucleotide. Nature 328,59&600 7 Kotzumt, M , Iwat, S , and Ohtsuka, E (1988) Cleavage of specific sites of RNA by designed ribozymes. FEBS Lett 239,285-288. 8 Haseloff, J. and Gerlach, W. L. (1988) Sample RNA enzymes with new and hrghly specific endoribonuclease activities Nature 334,585-59 1 9. Perrtman, R., Deices, A., and Gerlach, W. L. (1992) Extended target-site spectficity for a hammerhead ribozyme. Gene 113, 157-l 63. 10 McCall, M J , Hendry, P , and Jennings, P A. (1992) Minimal sequence requirements for ribozyme activtty Proc Nat1 Acad Scl USA 89, 5710-57 14 11 Hampel, A. and Tritz, R. (1989) RNA catalytic properttes of the minimum (-) sTRSV sequence. Bzochemzstvy 28,4929-4933 12 Berzal-Herranz, A., Joseph, S , Chowrira, B. M., Butcher, S. E., and Burke, J. M (1993) Essential nucleotide sequences and secondary structure elements of the hairpin ribozyme EMBO J 12,2567-2574

8

James and Turner

13 Wu, H.-N., Lin, Y.-J., Lin, F.-P., Makino, S., Chang, M.-F., and Lai, M. M. C. (1989) Human hepatitis 6 vu-us RNA subfragments contain an autocleavage activity. Proc. Nat1 Acad Scz USA 86, 183 1-1835 14. Perrotta, A. T. and Been, M D. (1990) The self-cleavmg domain from the genomic RNA of hepatitis delta virus: sequence requirements and the effects of denaturant. Nucleic Acids Res 18,6821-6827. 15. Branch, A. D. and Robertson, H. D (1991) Efficient trans cleavage and a common structural motif for the rtbozymes of the human hepatitis 6 agent. Proc Natl Acad. Sci USA 88, 10,163-10,167. 16. Saville, B. J and Collins, R. A (1990) A site-specific self-cleavage reaction performed by a novel RNA in Neurospora mltochondria. Cell 61,685-696. 17. Guo, H. C. T., Abreu, D. M. D., Tilher, E. R. M , Savllle, B J., Olive, J E., and Collms, R A. (1993) Nucleotide sequence requirements for self-cleavage of Neurospora VS RNA. J Mol Bzol 232,35 1-361. 18. Zaug, A. J , Grabowski, P. J and Cech, T R. (1983) Autocatalytic cychzation of an excised intervening sequence RNA IS a cleavage-ligation reaction. Nature 301, 578-583. 19. Zaug, A. J., Been, M. D., and Cech, T. R. (1986) The Tetrahymena ribozyme acts hke an RNA restriction endonuclease. Nature 324,429-433 20. Kay, P. S. and Inoue, T. (1987) Catalysis of splicing-related reactions between dmucleotides by a ribozyme. Nature 327,343-346 21. Peebles, C. L., Perlman, P. S., Mecklenburg, K L , Petrillo, M L , Tabor, J H , Jarrell, K A , and Cheng, H -L (1986) A self-splicing RNA excises an mtron lariat. Cell 44,2 13-223. 22. Augustin, S., Muller, M W., and Schweyen, R. J (1990) Reverse self-spllcmg of group II mtron RNAs in vztro. Nature 343,383-386. 23. Darr, S. C., Brown, J. W., and Pace, N. R (1992) The varieties of ribonuclease P. TIBS 17,178-182. 24. Guerrier-Takada, C , Gardiner, K., Marsh, T., Pace, N., and Altman, S. (1983) The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. CelZ 35,849857 25. Forster, A. C. and Altman, S. (1990) External gutde sequences for an RNA enzyme. Science 249,783-786. 26. Sulhvan, S A (1993) Liposome-mediated uptake of ribozymes. Methods A Companzon to Methods zn Enzymol 5,61-66 27 Pieken, W A., Olsen, D. B., Benseler, F., Aurup, H., and Eckstem, F. (199 1) Kinetic characterization of ribonuclease-resistant 2’-modified hammerhead ribozymes Sczence 253,3 14-3 17 28 Paolella, G., Sproat, B. S., and Lamond, A. I. (1992) Nuclease resistant ribozymes with high catalytic activity. EMBO J 11, 19 13-l 9 19. 29. Snyder, D. S., Wu, Y., Wang, J. L., Rossi, J. J., Swlderski, P , Kaplan, B. E., and Forman, S. J. (1993) Ribozyme-mediated inhibition of bcr-abl gene expression m a Philadelphia chromosome-positive cell line. Blood 82,600-605 30. Sioud, M., Natvig, J. B., and Forre, 0. (1992) Preformed ribozyme destroys tumour necrosis factor mRNA in human cells. J MoZ Bzol 223,83 l-835


9

31 Cameron, F. H. and Jennings, P. A. (1989) Specific gene suppression by engineered ribozymes in monkey cells. Proc. Natl. Acad. Sci. USA 86,9139-9143. 32. Sarver, N., Cantm, E. M , Chang, P S , Zaia, J. A , Ladne, P. A , Stephens, D. A , and Rossi, J. J. (1990) Ribozymes as potential anti-HIV-l therapeutic agents. Science 247,1222-1225.

33. Kolzumi, M., Kamlya, H., and Ohtsuka, E. (1992) Rlbozymes designed to inhibit transformation of NIH3T3 cells by the activated c-Ha-ras gene. Gene 117, 179-184. 34. Cotten, M. and Bimstiel, M. L. (1989) Ribozyme mediated destruction of RNA zn vzvo. EMBO J 8,3861-3866.

35. Perrlman, R., Bruenmg, G. B., Dennis, E. S., and Peacock, W. J. (1995) Efficient ribozyme delivery to plant cells. Proc Nat1 Acad. Sci USA 92, 6175-6179 36 Hertel, K. J , Pardl, A , Uhlenbeck, 0. C , Koizumi, M , Ohtsuka, E., Uesugl, S., Cedergren, R., Eckstein, F., Gerlach, W. L., Hodgson, R., and Symons, R. H. (1992) Numbering system for the hammerhead. Nuclezc Acids Res. 20,3252.

2 Computer-Aided Calculation of the Local Folding Potential of Target RNA and Its Use for Ribozyme Design Georg Sczakiel and Martin Tabler 1. Introduction Ribozymes first bmd their target via complementary sequences like a conventional antisense strand and, subsequently, catalyze the hydrolyses of the cleavable motif. In the case of hammerhead ribozymes, this is a specific base triplet. Even though it has been described that there are 12 conceivable motifs recognized by hammerhead ribozymes that are cleaved with different efficiencies (1,2), a typical long-chain target RNA provides a large number of potential cleavage sites. Given this flexibility, one important step in ribozyme design is the selection of an appropriate cleavable motif within the target For ribozyme-mediated mhibition in living cells, the contribution of antisense effects and catalytic effects to the overall extent of inhibition remains unresolved, and may well be dependent on the specific constructs and biologtcal systems. However, it is reasonable to assume that the first step, the binding of the ribozyme with its target, is crucial. Therefore, the local target sequence against which a ribozyme is directed does not only have to contain a cleavable triplet, but should also be accessible for the rtbozyme. To monitor the local accessibility of a given RNA sequence, one can perform experimental analyses, such as nuclease mapping (see Chapter 5), chemical probing, or kinetic selection for effective annealing (3) (see Chapter 30). On the other hand, theoretical analyses and the use of computer algorithms can be performed with less expense, although at reduced reliability. Different assumptions have been made, and various attempts have been reported to understand the different effectiveness of related, but not identical antisense From

Methods Edlted by

m Molecular P C Turner

Brology, Humana

Vol 74 Rfbozyme Protocols Press Inc , Totowa, NJ

12

Sczakiel and Tabler

inhibitors and to increase the probability of selecting effective local target sequences by using computer programs (4,5) (see Chapter 3). Such programs are aimed at increasing the probabihty of applying antisense and ribozyme inhibitors more successfully than on a purely statistic basis. The algorithm described m the followmg can be used to calculate the extent of local folding of a given target sequence (see Note 1). For a certain stretch of bases (window), the program calculates the most stable structure, and plots the correspondmg value for the lowest possible free energy (AG) against the target sequence position. Subsequently, the window is shifted for the step width along the target sequence,and the next AG value is calculated thereby, scanning along the sequence to be analyzed. Local maxima correspond to relatively unstable local sequence stretches and indicate potential target regions for complementary RNA. The cleavable motif for hammerhead ribozymes should be chosen such that its antisense sequencesthat form helix I or helix III (see Note 2) are directed against a target region with a low folding potential. 2. Materials

2.1. Programs The program that calculates the local folding potential for a given nucleottde sequence is termed “foldsplit.” It is based on the GCG package (6) and is available as part of the Heidelberg Unix Sequence Analysis Resources (HUSAR) (7). On request, tt can be made available for external users of HUSAR as well as for those who hold a license for GCG programs (see Note 3).

2.2. Definitions Within the Program “Foldsplit” The principle of the “foldsplit” program is schematically depicted in Fig. 1. To run the program, one first defines two variable parameters, the step width and the window size. The window defines the length of the sequence stretch for which the structure with the lowest possible free energy (AG) 1scalculated (see Note 4). Note that it is the AG value that is used and not the particular structure. The distance along which this window is shd before the next AG value is calculated is defined by the step width (see Note 5). In the case of a step width that is smaller than the window, the given sequence is scanned by overlappmg windows. The folding potential for a given sequence is represented by the plot of the AG values vs the sequence position (Fig. 2). 3. Methods

3.7. Setting up and Running “Foldsplit” To run the program “foldsplit,” one first defines the wmdow and the step width. Usually the calculation of a set of window sizesis recommend, e.g., 50, 100,200, and 300 nt (see Note 6). The step width depends on the capacity of

Local Foldmg Potential of Target RNA

13

5’

step (

Fig. 1. Definition of the step width (here 2 nt) and the wmdow size (here 10 nt) for a gtven sequence. The AG values are calculated for sequences contained within a sequence stretch that is defined by the begmnmg (usually the first position of the sequence) and the step width (location), aswell as by the window size (length) For example, the AG value AG(3) corresponds to a sequence startmg at position +3 and ending at positron + 12 (10 nt in length).

AG (kcal/mole)

A’ 1

B’

length (nt) Fig. 2. Plot of the folding potential of the genomic RNA strand of the human immunodeficiency vnus type 1 (HIV-l) at a step width of 1 nt and a window size of 250 nt. A’ and B’ indicate local maxima of the folding potential. A and B indicate two minima of the folding potential that comcide with functional RNA structures, the TAR element (A) and the RRE element (B) of HIV- 1. the computer system. In principle,

the optimal parameter is 1 nt, but even plots of the folding potential that had been calculated with a step width of 10 nt unequivocally showed the existing peaks (5).

Sczakiel and Tabler 3.2. Interpretation of the Folding Potential It is important to remember that the folding potential represents the lowest possible free energy according to a given structure prediction algorithm. Assuming that the prediction algorithm is correct, one can conclude that the true values for AG are equal to or greater than the calculated ones.This has two imphcations. A local mimmum (see A and B in Fig. 2) Indicates that the sequence starting at this position and extending with the chosen window size has the potential to form a relatively stable structure. This does not necessarily mean that the corresponding low-energy structure is indeed formed m vitro or in VIVO.However, a more complex computer study that included a similar program to that used here was able to identify the functional RRE element of HIV- 1 (7), mdicating that the potential to form stable RNA structurescan have biological relevance Note that RNA domains that contam extensive palmdromes, long inverted repeats, or other extensively folded sequenceswith biological functions can also be identified by calculating the folding potential at a certam window size. Conversely, local maxima indicate sequence stretches that cannot form stable structures (see A’ and B’ m Fig. 2). Considermg that the existmg structures can even be of higher energy, but not of lower energy, such local sequences could represent suitable targets for complementary nucletc acids, such as chemically synthesized antisense oligonucleotides, endogenously expressed antisense RNA, and ribozymes. If one makes use of “foldspllt” to select target sequences for anttsense nucleic acids and ribozymes, it is recommended to calculate the folding potential for both strands. Local maxima occurring at complementary sequence positions of both strands indicate potentially effective targets as well as the corresponding complementary sequence (see Note 7) In prmciple, one should select the window size such that it corresponds to the length of the antisense sequence that is planned to be delivered. However, one should consider that local maxima of the folding potential can be broad and indicate the accessibility over a wide sequence stretch of the target strand. Further, the location of local maxima is not dependent on the chosen window size. Thus, there is no absolute requirement to fit exactly the size of the wmdow and the size of the ribozyme or antisense construct that one plans to use m btologtcal experiments. 4. Notes 1. The calculationof the localfolding potentialseemsto beparticularlysuitablefor longchainRNA, including long-chainhammerheadnbozymesthatarealsotermed“catalytic antisenseRNA.” CatalyticantisenseRNA is describedin detailin Chapter14 2 For long-chain hammerheadnbozymes,only one antisensearm (helix III-forming) IS sufficient for function provided that at leastthe inner three basepairs can

Local Folding Potential of Target RNA

3.

4.

5

6.

7.

15

be formed in the second one (helix I) The resultmg asymmetric hammerhead ribozymes (8) are described m detail m Chapter 16 External users of HUSAR as well as those who wish to obtain accessto HUSAR and “foldspht” should contact the following E-mail address: [email protected] and ask for the service “GENIUSnet.” Those who wish to receive “foldspht” on request, need to own a license agreement for the GCG package. In prmciple, any program that calculates secondary or even partial tertiary RNA structure can be used to define the lowest possible AG value for a sequence stretch with a given length at a given sequence position. Ideally, the step width is 1 nt, which, however, costs the maximal computing time In the case of large window sizes, e.g., >lOO nt, it 1s not necessary to perform the algorithm for every sequence position rn order to draw a sigmficant plot, since the differences m AG values of neighboring and overlappmg windows are usually not as dramatic For almost all sequences for which the folding potential has been calculated so far, the locations of local minima and maxima were not dependent on the selected window size Surprtsmgly, the folding potentials for two complementary strands often correspond to each other, i.e., local maxima and local minima occur at complementary sequence positions of both strands.

References 1. Shimayama, T., Nishrkawa, S., and Taira, K. (1995) Generality of the NUX rule* kinetic analyses of the results of systematic mutations m the trmucleottde at the cleavage site of hammerhead ribozymes. Biochemistry 34,3649-3654 2. Zoumadakis, M. and Tabler, M (1995) Comparative analysis of cleavage rates after systematic permutation of the NUX$ consensus target motif for hammerhead ribozymes. Nucleic Aczds Res 23, 1192-l 196 3 Rittner, K , Burmester, C , and Sczakiel, G. (1993) In vztro selection of fast-hybridizing and effective antisense RNAs directed against the human unmunodeficiency vuus type 1 Nuclezc Aczds Res 21, 1381-1387. 4 Rhodes A. and James W J (1990) Inhibition of human mmmnodeficiency virus replication by endogenously synthesized antisense RNA. J Gen Vzrol 71, 1965-1974. 5 Sczakrel, G., Homann, M , and Rrttner, K. (1993) Computer-aided search for effective antisense RNA target sequences of the human immunodeficiency virus type 1 An&sense Res Dev 3,45-52. 6. Devereux, J , Haeberh, P , and Smithies, 0. (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Aczds Res 12,387-395 7 Senger, M , Glatting, K -H , Ritter, 0 , and Suhai, S. (1995) X-HUSAR, an X-based graphical interface for the analysis of genomic sequences. Comput Programs Blamed. 46, 13 1-141 8. Tabler, M., Homann, M , Tzortzakai, S , and Sczakiel, G (1994) A three-nucleotide helix Its sufficient for full acttvtty of a hammerhead rtbozyme. advantages of an asymmetric design Nuclerc Acids Res 22, 3958-3965.

3 Computational Approaches to the Identification of Ribozyme Target Sites William James and Elizabeth Cowe 1. Introduction Artificial antisense RNAs and recombinant, trans-acting ribozymes have been developed whose abihty to inhibtt gene expresston varies from negligible to profound. Although we are only beginning to understand the underlying reasons for this extreme variation, we can identify a number of variables that might well be significant in the process, and some of these can be modeled computationally. It must be emphasized, however, that only well-designed and systematic experimentation will prove whether one or the other of these variables is of key significance in living cells. In order for an endogenously expressed antisense RNA or a trans-acting ribozyme to exert its inhibitory effect, we envisage the following stages m the process and propose factors that will influence their outcome. 1.1. Encounter

That is, the probabihty that each molecule of target mRNA will encounter the potentially mhibitory RNA before it becomestranslated into protein. This will be determined by a large number of factors,of which the following arethe most obvious: 1. Global abundance of the complementary RNA relative to the target mRNA This, m turn, might be affected by a. Positron effect: The chromosomal locus from which the two genes are being expressed b. Promoter/enhancer strength. c. Relative stability of the RNAs. 2 Colocalizatron of the mteractmg RNAs To take an extreme example, rrbosomal RNAs follow very constramed paths from the site of their transcription to the site of nbosome assembly. Consequently, the volume of nucleoplasm m which they might From

Methods m Molecular Edited by P C Turner

B/ology, Vol 74 R/bo.zyme Protocols Humana Press Inc , Totowa, NJ

17

James and Cowe

18

be available for pamng with artificial complementary RNAs is very small. It is becoming tncreasnrgly clear that transcripts of all types are, to a lesser or greater extent, confined to small subregions of the nucleus, either by virtue of the locus from which they are transcribed or addressing signals within the RNA (I-3). One may therefore have very abundant complementary RNAs that never encounter their target 3. Dwell time/mtcrocolhstons: The nbozyme-mediated cleavage reaction can only occur after the nbozyme and the substrate encounter each other m solution. The portions of the two complementary RNAs that first come into contact are unlikely themselves to be complementary. However, the so-called “encounter complex” that is formed between both strands 1s believed to allow short-distance dtssociatton, reorientatton, and reassociation, processes that are sometimes summarized by the term “microcolhsion ” Consequently, the longer the life-time of the encounter complex, the greater the chance that the complementary portions of both strands may colhde and initiate the formation of the nbozyme/substrate complex It is possible that RNA-binding proteins m the cell that are normally used to facilitate snRNAhnRNA interactions during splicing may also facilitate the microcollisions that enable the complementary nucleotides to encounter each other

1.2. Nucleation

and Propagation

of the Hybrid

1. Nucleation involves the interaction between two short complementary RNA stretches that results in a low-binding-strength hybridization complex For this to occur, the two stretches of RNA must be available for mtermolecular pamng, and so must not be engaged m intramolecular pamng or mteractrons with other molecules (such as proteins), the binding strength of which is greater than that of intermolecular reaction 2. Propagation involves the extension of the mtermolecular hybnd 5’ and 3’ of its nucleation site The extent to which propagation is required for mhibition is determmed by the relative posmon of the nucleation site and the site for cleavage (m the case of nbozymes), or by the size of duplex requtred for the host cell machinery to &grade the RNA before dissociation (in the case of antisense RNA). Propagation may be slowed or even halted by regions of highly stable secondary structure.

1.3. Cleavage,

Degradation,

and Recycling

1 Cleavage, in the case of truns-acting ribozymes, happens very rapidly after the complementary regions flanking the catalytic motif hybridize to their target Thereafter, the target RNA appears to be rapidly degraded by host cell enzymes 2. Degradation, m the case of antisense RNAs, appears to be a less efficient process and depends on substantial duplexes between the target and mhtbitor 3 Recycling of trans-acting ribozyme to allow it to cleave further molecules of target RNA, occurs in cell-free systems when flanking complementary regions (helices I and III) are very short. It is far from clear that this occurs inside cells, since there is no general correlation between k,,, and potency. It is also possible that the locations of encounter, nucleation, and cleavage are successive compartments of the nucleus, and so released ribozyme may no longer be in a position to encounter further molecules of target.

/dent/f/cat/on of Ribozyme Target Sites

19

From the above discussion, it should be apparent that the identity of the potency-determining step should determine the approach one would take to enhance potency. For example, there would be little point m optimtzing m vitro determined k,,, if the rate-limiting step in the cell were nucleation, It is therefore of value to attempt to identify the factors that may influence each step in the process, and to devise experimental or computattonal methods that analyze them. There are a number of reasons for believing that the nucleation and propagation stages are of key importance, and that they may be significantly affected by the structural properties of the interactmg RNAs. For example, in many cases of prokaryotic antisense regulation, it is clear that small, complementary loops are required to form “kissing complexes” during the nucleation event. Moreover, an inverse correlation between the degree of secondary structure of the complementary RNAs and the potency of inhibition of gene expression has been noted in eukaryotic systems (4,5). For more detailed treatment of these concepts, the reader 1sreferred elsewhere (6-10). It is very nearly nnpossibleto desrgnaribozyme, or an RNA complementaryto an mRNA, that will have the desired structurewhen embeddedin a long transcript, so tt is more practtcable to attempt to identify regions of the target RNA that might have the structural properties that favor mtermolecular hybridization. A method 1spresentedbelow for the identification of such sites.As with the method of Sczakieland Tabler (see Chapter 2), it startsfrom the premise that the probabtlity of successful intermolecular hybridization is adversely affected by high levels of mtramolecular basepaning. It attemptsto simplify and enrich the interpretation of secondarystructure predictions by the use of methodsto summarizethe thermodynamic parameters. 2. Materials 1 The sequenceof the target RNA m PIR format. 2 A computer that has a FORTRAN compiler. We use a DEC VAX rumung VMS, but the RiboSite code usesstandard syntax and can be compiled with any standard compiler. 3. A copy of the MFOLD program (see Note 1) by Zuker (II), or any other secondary structure program that can produce output files (.CT and REG) m an identical format (see Note 2) MFOLD can be obtained by FTP from snark.wustl.edu/pub. It 1s possible to run MFOLD remotely by pointing an mternet browser, such as Mosaic, at: http://ibc.wustl.edu/-zuker. 4. The source code for the RiboSite program. This can be obtained by E-mail request to Ribosite@molbiol ox ac uk 5. Data presentation software, such as Sigmaplot, Excel, or CricketGraph.

3. Method 3.7. Overview The method attempts to do three things. First, since there 1sa very large number of possible alternative structures for any long RNA molecule (22), tt summa-

James and Cowe

20

/---zzr/

RlboSub

1.((: “save”

file

G&r--1

/ cc;nuatto;”

/Yiiq

N-best best 10% 1000 tracebacks 1, window size

17

piy7 \

I 4 read in CT, REG and sequence files

asslgnatlon

of nucleotides

nt parsmg weighted

u

RiboSlte 4 to hellces

i

of helix delta Gs

(5) window size (1) #of 1st base (ribosite.out) output filename

i

mean of dGs over all structures duplex potentral

sum dp over user-defined wlndow wmdow duplex potent/a/ determme stacking energy of Intermolecular hybrids of user-defined length wmdow hybrrdrzatron potent/a/ calculate

(mn hp)/(mn

dp)+ratro

potent/a/ I

I

Fig. 1.

A flow diagram of the RiboSub commandfile and the RiboSite procedures

rizes the information contained m as many of the suboptimal structures the user choosesto consider, using an averaging method that takes into account the overall AG of each alternative structure. Second, it determines the free energy required to melt a given region of the “average” RNA structure mto its unwound form, over a user-defined window of conttguous nucleottdes (duplex potential, d.p.).

ldentificabon of Ribozyme Target Sites Table 1 A Sample

21

Run of RiboSiteO

Local> RiboSite Name of sequence file m PIR format ? myseq.pir Name of MFOLD region (KEG) tile ? myseq.reg Name of MFOLD connect (CT) file ? myseq.ct Window size for averagmg (* 5 *) ? 5 Number of first base m sequence (* 1 *) ? 1 Name for output file ( * RlboSlte.Out * )? myseq.rzt aPrompts from the program are shown m courter roman and user Inputs are m courier bold

Third, It evaluates whether a perfectly matched complementary sequence on a second RNA molecule has a higher binding energy to the target RNA (hybridizatron potential, h.p.) than the energy required to melt the probable mtermolecular base pairing. Finally, It identifies all the potential hammerhead cleavage sites m the molecule and lists them with their score, as determmed above

3.2. Operation The relationships between the RiboSub command file and the RiboSlte procedures are presented as a flow diagram in Fig. 1 (opposite). The precise operations to be carried out are as follows: 1 Submit your sequence to the MFOLD program, definmg the region over which you want to Identify rlbozyme sites (see Note 3), the number of alternatlve structures you want to evaluate (default = lOOO), and the centile of near-optimal structures mto which they must fall (default = 10%). 2 Run the RlboSite program (see Table l), speclfymg the name of the sequence file (e.g , myseq.PIR) and the output files from MFOLD (e.g , myseq.CT and myseq REG) (see Note 4). 3. Type in the window size over which you wish to evaluate the data (i.e., the length of the subfragments whose interaction you want to model) The default 1s5 4. Type m the number of the first base (m case the folded sequence does not start at the beginning of the target RNA). 5. Type m a filename for the output (e.g., myseq.Rzt).

3.3. output The output (see Table 2) 1s in the form of a fixed-width table that can be incorporated into most spreadsheets, graphmg, or presentation packages (see Note 5). The output file consists of the followmg columns. 1 The nucleotlde number (hlstoncal number: user-defined) 2 The nucleotlde base code.

Table 2 Sample Output

8

File from RiboSite

0.000

n

0.000

0 000

0.000

0 000

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

G A A C A C A G A C A A G G A T G T A T G T G T

-0 13 -0.55 a.6 -0.61 -0.61 -0 63 -0 63 -0 58 Al 11 4 14 -0 13 a.08 -0.37 a.42 -0 42 -0 45 4 48 446 -0.05 -0.11 4 11 -0 89 -0.89 a.9

0 0 -2.49 -2 99 -3.07 -3.06 -2 56 -2 09 -1 59 -1 04 4 83 -1 13 -1.42 -1.73 -2 13 -2 22 -1 85 -1 54 -12 -1.61 -2.03 -2 89 -3 66 4.45

-2.3 -0.9 -2 1 -1.8 -2 1 -1.8 -1 7 -2.3 -2.1 -1.8 -0.9 -1.7 -2 9 -2.3 a.9 -1.8 -2.1 -1.1 -09 -1.8 -2.1 -1.8 -2 1 -1 8

0 0 -5.8 -5.3 -6.1 43 -66 4.3 -5.4 -5.4 -6 -6.2 -5.3 -62 -66 -4.8 -3.4 -4.3 -4.6 43 -5 3 42 -7.3 -8.1

0.000

0 000

0.000

0 000

0.000

0.000

2.3293 1 7726 1 987 2 0588 2 5781 3 0144 3 3962 5 1923 7 2289 5.4867 3.7324 3.5838 3 0986 2 1622 1 8378 2 7922 3 8333 2.6708 2 6108 2 1453 1 9945 1 8202

-

-

-

-

-

-

-

-

-

-

-

3.8333 -

-

25 26 27 28 29 30 31 32 33 34 35

G G G T T C A G C A G

a.88 XI.89 -0.89 a.89 -0 02 -0.01 -0.02 a.03 -0.02 a.02 4.88

4.45 4 45 -3.57 -2.7 -1.82 -0.96 -0.1 -0 1 -0.98 -1 85 -2.7 1

-2.9 -2 9 -2.1 -0 9 -2 3 -1 8 -1 7 -3 4 -1 8 -1 7 -3 4

-84 -7 2 -7 7 A.6 -5.4 47 -7.6 -7 46 -9 8 -9 3

1 8876 1.618 2 1569 2.4444 2 967 6.9792 76 70 8 7755 5.2973 3 4317

-

-

-

-

2.967 -

-

6.9792 -

24

James and Cowe 8 0 GUC o 0 GUA

1000 100

4

V

GUU

v

cut

i-Juuc

10 2

A

B

0

/ I’

-

-cl

-.

.

400

- emplncally determined hybndlzatlon predlcled rabo hybndlzabon

potenbal

600

Nucleotlde number

10 too rabo hybrldtzabon potenbal

tendency

1000

c’

Fig. 2. (A) A plot of hybndtzation rano potential for the rat OX40 mRNA sequence, together with the positions of hammerhead target triplets (B) A plot of hybridization ratto potential over a subregron of the rat OX40 mRNA (upper panel) and the hybndtzatton tendency of the same region empirically determmed using a solid-phase ohgonucleotide array method. (C) A frequency dtstnbution of hybndization ratto potential n-rrat OX40 mRNA 3 4 5 6. 7 8. 9 10 11. 12.

The nucleottde duplex potenttal. The window-summed duplex potential The hybrtdrzation potenttal. The window-summed hybrtdtzatton potential. The ratto of hybrrdtzatton:duplex potentrals The value of column 7 tf the sequence is GUC (null otherwrse). Ditto for GUA Ditto for GUU. Ditto for CUC Ditto for UUC

The first line consistsof pad charactersthat define the data type and sizefor each column, facilitating import into programs, such as Mtcrosoft Excel or Sigmaplot. In the sample output graph, shown rn Fig. 2, the hybrrdization.duplex ratio potential is plotted on a logarithmic scale against the sequence nucleotide number. The great majority of the sequence has a ratio hybridization potential oscillatmg between 2 and 4 (median value = 2.98), but occasional small patches

identification of Ribozyme Target Sites

25

reach 100-1000 (see Fig. 2C). When the predicted structures are inspected, these correspond to loops, stabthzed by highly conserved hehces. It should be noted that many of the loops that are predicted tn the minimal energy structure are not present m a large proportion of alternative structures, and these do not appear as peaks on the plot. The position and ratio potential of all potential hammerhead ribozyme sites are marked. The ideal ribozyme may not be one whose target is in the middle of a narrow peak, but one m which a peak corresponds to one of Its flanking arms, allowing efficient intermolecular hybridization. In Frg. 2B, a small portron of the plot from Fig. 2A is displayed above an experimentally derived estimate of the availability of the same sequence (within a full-length transcript) to hybridize to a set of solid-phase, overlapping 15mer DNA oligodeoxynucleotides (data courtesy of Ed Southern, Kalim Mir, and Aymen Al-Shamkhani, Biochemtstry Department, University of Oxford, OX1 3QU, UK). It is apparent that the large peak of predicted high hybridization potential is comcrdent with the region of strong hybridization to DNA oligos, indicating that the method successfully predicts the presence of major sites of strong hybrtdization. It should be noted, however, that the prediction does not take into account the enthalpic barriers to interstrand annealing, nor does it use the recently determined thermodynamic parameters for RNA/DNA duplex formation appropriate to the empirical method (13,14). 4. Notes 1. The MFOLD program of Zuker (Zl) can be obtained by FTP from snark.wustl.

edulpub. Zuker’s WWW site IS at http://ibc.wustl.edu/-zukerlcgi-bin/indexcgi, from which it is possibleto run MFOLD interactrvely 2. Programsbasedon the earlier FOLD program that do not give suboptimal alternative secondary structures are not suitable for this procedure 3. The “save” run of MFOLD consumes a large amount of cpu time and system resources for long molecules. On the VAX, an effective limit is 1200 nt, although on machines such as the Convex, tt has proven possible to fold molecules of more than 9000 nt. However, you should liaise closely with your systems manager before runnmg these programs for the first time, and you should expect to be told the programs will run m batch mode, perhaps overnight 4. We have produced a VMS DCL command file (RiboSub) that will automattcally run MFOLD and RrboStte, and this 1s available for interested users 5 It is helpful to import the output file into a spreadsheet program, such as Excel, or a spectahzed scientific graphics program, such as Stgmaplot

References 1 Carter, K C , Bowman, D., Carrmgton, W., Fogarty, K , McNeil, J A., Fay, F. S , and Lawrence, J B (1993) A three-dimensional view of precursor messenger RNA metabolism wtthm the mammahan nucleus. Sczence 259, 1330-1335

26

James and Cowe

2. Izaurralde, E and MattaJ, I. W (1995) RNA export Cell 81, 153-159 3. St-Johnston, D (1995) The intracellular localization of messenger RNAs. Cell 81, 161-170 4. Rhodes, A. and James, W. (1990). Inhibition of HIV rephcation m cell culture by endogenously synthesized antisense RNA. J Gen Vu-01 71, 1965-l 974 5 Sczakiel, G , Homann, M , and Rittner, K. (1993). Computer-aided search for effective antisense RNA target sequences of HIV- 1. Antrsense Res Dev 3,45-52 6 Sczakiel, G and Goody, R S. (1994) Catalytic antisense RNA. antisense prmciple or ribozyme action? Bzol Chem Hoppe-Seyler 375, 745-746. 7 Nordstrom, K and Wagner, E G. H. (1994) Kmetic aspects of control of plasmid replication by antrsense RNA. TIBS 19,294-300. 8. Wagner, E. G. H. and Simons, R W. (1994). Antisense control m bacteria, phage and plasmids. Ann Rev Mcroblol. 48,713-742 9 James, W. and Al-Shamkham, A (1995) RNA enzymes as tools for gene ablation Curr. Opinion Blotechnol

6,44-49.

10 Nellen, W. and Lichtenstem, C. P. (1993) What makes an mRNA anti-sense-itwe? TIBS l&419-423

11 Zuker, M. (1989) Computer prediction of RNA structure Methods Enzymol 180, 262-288

12. Zuker, M. (1989) On finding all suboptimal foldings of an RNA molecule

Scr-

ence 244,48-52

13. Freier, S. M , Kterzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H , Neilson, T , and Turner, D. H. (1986) Improved free-energy parameters for predictions of RNA duplex stability Proc Nat1 Acad Sci. USA 83,9373-9377. 14 Sugimoto, N , Nakano, S., Katoh, M , Matsumura, A., Nakamuta, H , Ohmichi, T , Yoneyama, M., and Sasaki, M (1995) Thermodynamic parameters to predict stability of RNA/DNA hybrid duplexes. Bzochemistry 34, 11,21 l-l 1,216

Computer Analysis of the Conservation and Uniqueness of Ribotyme-Targeted HIV Sequences Mary Beth DeYoung and Arnold Hampel 1. Introduction Ribozymes are currently being developed as therapeutic agents agamst AIDS (2,2). Successful cleavage of the mRNAs produced by HIV or the HIV genome itself could produce improvement by stgmficantly reducing the patients’ viral burden. However, choosmg the appropriate target sites in HIV RNA 1scomplicated by its high mutability It is estimated that nme sequence errors occur with each reverse transcription of the genome (3). Since ribozyme action is highly sequence-dependent, the virus may thus escaperibozyme cleavage with time. However, some mutations will inactivate critical viral functions and cannot be propagated m the host. The goal of ribozyme design is to locate and target the sequences m HIV RNA whose importance results in conservation m a majority of patients. An additional concern is that these highly conserved HIV sequences may not be virus-specific. If an important functional motif is also present rn normal human mRNA, it too might be cleaved by the HIV therapeutic ribozyme, possibly resulting in harmful side effects. For these reasons, a procedure has been developed for searching the available sequence databases to determine (1) an approximate percentage of conservation among HIV strains for a potential ribozyme target site and (2) which known human mRNAs have a similar sequence. The search process can be performed relatively easily using any computer system with accessto the Internet. The key to the sequence analysis strategy to be described is Genbank, the database provided by the National Center for Biotechnology Information (NCBI), which is part of the National Library of Medicine (NLM), under the From

Methods

In MOi8CUkU

Edited by P C Turner

Btology,

Humana

27

Vol

74

R/bo.?yme

Press Inc , Totowa,

Protocols

NJ

28

DeYoung and Hampel

auspices of the National Institutes of Health (NIH). The NIH has been orgamzmg Genbank since 1982, and it is currently a collection of over 3 18,000,OOO nucleotides from 425,000 sequences, which is updated on a daily basis. Sequences are exchanged with the library of the European Biomformatics Institute (EMBL) and the DNA Data Bank of Japan (DDBJ) to give the most up-to-date and comprehensive sequence collection possible. Furthermore, the NCBI provides software known as Basic Local Alignment Search Tool (BLAST), whtch raptdly and thoroughly compares query sequences to each sequence m the database, and collects a list of identical or highly homologous sequences as output (4). No additional software needs to be developed by the researcher for this purpose. BLAST can be accessedvia an E-mail message, through the World Wide Web or with the experimental “BLAST client,” which directly contacts the NCBI network server through the Internet. The BLAST system was originally designed, and is most frequently used, to find similarities between newly discovered protem or DNA sequences and sequences of known function. Default parameters have been established for BLAST based on an “average” query. First, it is assumed that 100 descriptions will be sufficient to summarize the similar sequences found in the database, and that no more than 50 high-scoring or highly similar sequences will be found. However, when searching for highly conserved HIV sequences, more than 100 identical sequences can eastly be retrteved, all of whtch are not reported unless the default parameters are changed. Additionally, the default statistical significance threshold for reporting matches is set at 10, assuming that 10 matches are expected to occur merely by chance. Since it is desired that the search for randomly similar sequence m normal human mRNA produce as many matches as possible, this value is increased to retrieve more dissimilar sequences.Finally, to locate extensive areas of similarity with an average gene, the BLAST sequence initially selects sequences with 12 matched residues m a row, and then extends the search on either side. For a ribozyme target that may be only 15 or 16 bases long, the requirement for 12 identical bases m a row causes many sequences with a single mismatch m the center to be missed. Thus, the number of matched residues required for a “hit,” also known as the wordlength, must be adjusted. When the changes in the program specifications have been made, a query sequence is sent, the received output is read, and the number of mismatched HIV sequences and similar, but non-HIV human sequencesare tabulated. The ease with which this procedure can be performed depends in part on the computer system and user support available to the searcher. Several alternative means for establishing the proper computer connections will be discussed. Once commumcation channels are established, the search process is rapid, reproducible, and invaluable in choosmg the least-variable, most virus-specific targets for a therapeutic ribozyme against HIV.

Ribozyme-Targeted HIV Sequences

29

2. Materials 1 A computer with access to the Internet 2. An E-mail address 3 Sufficient memory to install an Internet information browser or Navigator (approx 1 5-3.0 MB) and to receive output files from the BLAST server (about 100 kB each, although the stze 1ssearch-dependent). 4 A text-management program such as Microsoft Word. 5 A mouse. 6 A computer printer.

3. Method 1 The starting point of the procedure depends on the available computer system. An Internet Navigator, such as Netscape or Mosaic, must be installed and available. Information on Netscape can be obtained by E-mall at [email protected] or by calling 415-528-2555 in the US. Mosaic is available through the National Center for Supercomputing Apphcattons at the University of Illinois at UrbanaChampaign 2 With access to the world-wide-web via the Navigator, up-to-date mformation on the BLAST system, Genbank, and the AIDS database can be obtained This is important, because the databases and programs are contmually being updated (see Note 1). The addresses at the time of writing are given below a. NCBI home page http://www.ncbi.nlm.nih.gov b. BLAST notebook Home Page with the BLAST theory and algorithm, bibhography, manual, program hst, database descriptions, frequently asked questtons, bug list, BLAST search form, BLAST network server information, and so forth. http://www.nlm.nih.gov/Recipon/index.html c National Online Information Services at the NLM Information for estabhshmg a connection to the AIDS data base http:Nwww.nlm.nih.gov/top~leveI.dir/nlm_online~info.html After opening a Navigator program (see Note 2), an address is typed mto a space labeled “location,” and the connection is made by the program. Once at a location, a mouse is used to “point and click” on underlined phrases that make subsequent connecttons to locations of interest automattcally 3. The first information to obtain m a search for conserved HIV sequences is a copy of the AIDS database This collection of HIV sequences from throughout the world is mcorporated into Genbank, but can also be obtained on its own. Although many researchers may be comfortable accessing it online, we prefer to have a printout that can be marked with comments Application materials can be obtained over the net at the online information service address given above or by calling the MEDLARS service desk at l-800-638-8480. Questions can be sent by E-mail to [email protected]. The database can be viewed online, downloaded, obtained on a disk, or received as a printout The prmtout 1scurrently more than 4 in thick, printed on both sides

30

DeYoung and Hampel

4. A useful section of the AIDS database for quickly findmg regions of conserved sequence is Part I Alignments This chapter collects full-length HIV sequences and aligns them for direct comparison Partial sequences are omitted for the sake of clarity. When a given HIV sequence matches the consensus sequence for that region, a dash is used m place of a letter. When a different base 1sfound, the letter of the replacing nucleotide 1s recorded as shown below Consensus sequence Type B TGCCCGTCTGTTGTGT ----_---_------_ HIVlSG3X _-___-__-_-A- _ _ HIVlE6LTR _ _ -A---------HIVlE5LTR _-___-______HIV4BlLTR -AThus, the pages can be scanned for areas with a high proportron of dashes instead of letters The “dashed” areas can then be assessed for possible ribozyme targets. Targeting rules for the hanpm rrbozyme are given elsewhere in this volume (see Chapters 18 and 19) When a conserved candidate target is found by thus superficial process, the sequence IS further analyzed with a BLAST search to find the relative proportions of variants. 5 A BLAST search can be completed by several methods that do not all allow mampulatlon of the program parameters (see Note 3) The changes we make in the program are to the “expect” value, which sets the statrstrcal srgmticance threshold for reporting matches; “descrrptions,” which establishes how many matches are reported; and “alrgnments,” which establishes the number of high-scoring pairs reported. In an E-mail message addressed to [email protected] the followmg format is used. PROGRAM blastn DATALIB nr EXPECT 1000 DESCRIPTIONS 500 ALIGNMENTS 500 BEGIN >S’LTR HIV sequence TGCCCGTCTGTTGTGT The program “blastn” 1s selected because rt compares two nucleic acid sequences (n), not protein sequences The data library chosen 1s“nonredundant,” which is a complete collection of the updated Genbank and EMBL data banks, with overlapping (redundant) sequences deleted. 1000 1s the highest EXPECT value allowed, which gives the lowest stringency. 500 DESCRIPTIONS and ALIGNMENTS should be sufficient for a complete output, although they may be set to higher values if the program reports that additional matches were omitted We use T in place of U in the sequences submitted, More information on the BLAST system can be obtained by sending the message “help” to the same E-marl address. A form that provides the same information to the BLAST server is available at http://www.ncbi.nlm.nih.gov/Recipon/bs-seq.html. The desired program 1s

Rhozyme- Targeted HIV Sequences

31

chosen from a list of choices by chckmg on it with a mouse. Similarly, the data library, and the number of descriptions and alignments are chosen. Only the sequence needs to be typed in. For both the E-mail and form submission, output is received by E-mail (see Note 4) 6 Although the search method above will give an approximation of the degree of conservatron for a given sequence, the hmitation with either E-mail or the BLAST form is that the wordlength searched, set at 12, cannot be modified Thus, the previous searches will report only sequences in which 12 residues in a row match the submitted sequence. To modify the wordlength, the search must be completed through the BLAST client (see Note 5) This program allows more flexrbilny in adjusting BLAST parameters, since it contacts the BLAST server directly. At the time ofwrttmg, mformation on downloadmg the BLAST client is available at the BLAST Notebook Home Page under the heading “BLAST Network Services ” This is an experimental system with Client interfaces available for UNIX platforms, Macintosh with MacTCP, DEC VMS and MS-DOS, but not MS-Windows. The program can be obtained by tile transfer protocol (FTP) from the mtemet address given in Section 3 , step 2b, by highlighting the word FTP on the page and clicking on it with the mouse However, the software will not work until the copy is registered with NCBI The registration form requires contact information for a computer system administrator at your mstitution, description of the intended use of the system, the approximate number of users, the expected average number of sequences per week, and the numerical Internet address for the computer or computer subnet accessing the system (i.e., 130 14.25) The E-mail address for questions is [email protected]~h.gov. Once the BLAST client is Installed and opened, a short form appears onscreen The sequence is typed first m the indicated area (capital letters, standard nucleotide abbreviations), the nonredundant nucleotide database is chosen from a list of 24 possible databases, the “display alignments” option is chosen, and a “0” is typed after “limit output to,” indicating no restrictions Then “Other parameters” is followed by a space The program parameters described m the BLAST manual (available at the home page) are entered in this area. Previously, the parameters have been referred to as “expect,” “descriptions, ” “alignments,” and “wordlength.” In the BLAST program itself, “expect” is E, “descriptions” is V, “ahgnments” is B, and “wordlength” is W. Thus, a horizontal list 1s typed to change the parameters as follows: E = 1000, V = 500, B = 500, W = 4. This list of commands alters the expect, description, and alignment commands as before. It also changes the wordlength to 4, so that 4 matched nucleotrdes m a row will generate a “hit ” The “blastofp command IS then chcked on, and an output file appears m a matter of minutes, whereas E-mail and form submissions can take several hours depending on the mquny volume being handled (see Note 6). 7 The size of the output file often means that it IS easier to review the results after prmting them out. To do this, we usually open the file m Mrcrosoft Word with text formattmg. On a Macmtosh system, this is accomplished by dragging the recetved file with a mouse over the icon for Microsoft Word We then reformat

32

DeYoung and Hampel

the file to a 10 point nonproportronally spaced font, specify 1 m margins, and print it on a laser printer. 8. The prmted copy may begin with a histogram showing the number of Database Sequences that satisfy various E parameter values. This 1s followed by a list of the sequences found, beginning with the database m which they were found (gb = genbank, emb = EMBL, dbJ = the data bank of Japan), the accession number the sequence 1sfiled under (t e , M64586), and a more specific name (HIVN7201) as shown below. The high score given drmmrshes as more mismatches occur Sequences high-scoring

producing segment

emblA24330/A24330 gblM64586(HIVN7201 gblM64582

HIVA19

gblM64581

HIVA21

gblS69617

S69617

gblM64578

HIVN60

gblM64579

HIVN63

gbjL28853

HIVlB5LTR

gblT23947lT23947 gblH162221H16222 gblH03906lH03906 db] ID28215lRICC1018A gblLO5545lRATPMCA2A2

pairsSK31 probe Human immunodeficiency virus type 1 . . . Human immunodefrciency virus type 1 . . . Human xtununodeficiency virus type 1 . . gag ILTR, patient Mal, provirus) [hu.. Human immunodeficiency virus type 1 . . . Human immunodeflciency virus type 1 . . . Human immunodeficiency virus type 1 . . . seq2099 Homo sapiens cDNA clone HB3M , y128flO.sl Homo sapiens cDNA clone l... yl39e09.rl Homo sapiens cDNA clone 1. . Rice cDNA, partial sequence (C1018-l... Rat plasma membrane calcium ATPase i. .

Sum high score

Probability P(N)

11 80

0.9999 1.000000

N 1 1

80

1.000000

1

80

1.000000

1

80

1.000000

1

80

1.000000

1

75

1.000000

1

75

1.000000

66

1.000000

1

66

1.000000

1

66

1.000000

1

66

1.000000

1

66

1.000000

1

The printout continues with a detailed list of sequence alignments of whrch two are given below. No vertical bar 1sseen between the two sequences when a mrsmatch 1spresent. >gblS69617)S69617 gag {LTR, patient Mal, provirus} [human immunodeficiency virus type 1 HIV-l, South India isolate, Genomic, 156 ntl. Length = 156

Ribozyme- Targeted HIV Sequences Plus Strand HSPs: Score = 80 (22.1 bits), Expect = 40., Identities = 16/16 (lOO%), Positives (100%) , Strand = Plus ! Plus Query: 1 TGCCCGTCTGTTGTGT 16

33 P = 1.0 = 16/16

IIIIIIIIIIIIIIII 45 TGCCCGTCTGTTGTGT 60 Sbjct: >gblL28841)HIVlBlLTR Human immunodeficiency virus type 1 (clone lB-1) long terminal repeat (LTR). Length = 657 Plus Strand HSPs: Score = 71 (19.6 bits), Expect = 2.9e+02, P = 1.0 Identities = 15/16 (93%), Positives = 15/16 (93%), Strand = Plus / Plus Query: 1 TGCCCGTCTGTTGTGT 16

IIIIIII

IIIIIIII

Sbjct: 435 TGCCCGTTTGTTGTGT 450 Alignments with the negative strands of DNA may also be retrieved These will not match a messenger RNA sequence and can be disregarded 9 Our method of tabulating the HIV sequences is straightforward We count the total number of HIV sequences obtained (see Note 7) and, of those sequences, how many are identical to the query sequence. (Identrcal sequences)/(total HIV sequences) x 100 = % conservation Mismatches are also categorized as those likely to be cleaved, and those that are not. Pernnssible mutations m hairpin ribozyme substrates are described elsewhere (see Chapter 19) (.5,6) The ideal for a ribozyme target would be >90% cleavable, although this is difficult to achieve. 10. The number of similar human non-HIV sequences are also tabulated In some cases, several alternative substrates may be found. For example: POL 3493 Query sequence AGTTTGTCAATACCCCTC gblL Human retinoblastoma susceptibility gene exons l-27 AGTTTGTCAATACCC*** embJX75208)HSPKTR H Sapiens HEK2 mRNA for protein tyrosine kinase receptor AGATTGTCAATACCC*** gb(M63397lHUM3BHSD03 Human 3-beta-hydroxysteroid dehydrogenase/delta-5-4 isomerase gene, exon 3 and complete coding sequence A&TTTGTCAATACCCTT* emb)X51755(HSIGLAMB Human lamda-immunoglobulin constant region complex (germlime) *GTTTGTCQATQCCCTC

34

De Young and Hampel

Of the above group, the human retmoblastoma sequence 1s most likely to be cleaved efficiently. The observed similarities with functionally important human genes may have no consequences For example, the stmilar area may be in a nontranscrtbed regton of a gene. If it IS transcrtbed, that section of mRNA may be structurally maccessible to rtbozyme bmdmg or be covered with protein The ratto of HIV mRNA to the mRNA of the human gene may be so high that httle spurious cleavage will occur. However, this informatton 1s useful in desrgnmg control experiments exammmg the specifictty of rtbozyme cleavage m human cells Homologous sequences are more hkely to be promtscuously cleaved than random cellular mRNA controls 11 More mformatton on the human sequences reported to have sequence simtlarmes can be obtained using the accesston number associated with the sequence on the prmtout If the “Entrez” database connection (also available as a network resource through the BLAST home page) is available, simply entering the accession number will retrieve a tile with all of the sequence mformatton available, the names of the researchers who submttted It, and any associated publication reference Alternattvely, the “retneve” server can be utilized to obtain the same mformatton via E-mail The mail IS addressed to retieve@ncbi nlm.nih.gov. An example of a message is DATALIB genbank BEGIN Ml5782 More mformation on the “retrteve” system can be obtained by writing to the above address wtth the message “help ” 12. The BLAST search process is repeated with as many potenttal HIV target sequences as necessary to obtam the least-vartable, most virus-specific sequences possible for ribozyme targeting (see Note 8).

4. Notes 1. The BLAST system and databases are continually evolvmg A year ago, the AIDS database was avatlable through Los Alamos National Laboratory, and the BLAST client had not been implemented The BLAST administrators mdtcate that the present form of the BLAST client is likely to change, and current programs will be inactivated. For this reason, multiple means of making contact with the system are given m this chapter, since not all routes may be active m the future If dtfticulties are encountered with the addresses given, a Search Engine, such as “Infoseek” or “Webcrawler,” can be used through your Navigation Program Entry of the keyword BLAST, NIH, NLM, or NCBI should lead you to any new destmattons. 2. The BLAST forms and BLAST client are available from sources other than those given m the text. The most complete hsting of alternate BLAST sources is the Homology Search Home Page on DNA Information and Stock Center (DISC) Seven other search sttes are listed there at this time The location IS http:// www.dna.affrc.go.jp/htdocs/homology/homo~ogy.html.

Ribozyme-Targeted

3.

4.

5

6

7.

8.

HIV Sequences

35

The BLAST chent is also available by FTP from colsa.unh.edu The contact person given for mformatton is William A. Gilbert at the University of New Hampshire at Durham, NH. HIS E-mail address is Will.Gilbert@unh edu. If a BLAST form other than the one specified here is used, the default parameters should be checked to be sure that the number of alignments and descriptions IS either suffictent or can be adjusted as necessary. Some forms are unsuitable for the method described here. A problem with retrieving BLAST output via E-mail can be the size of the message Some mailers will not accept files of more than 1000 lines Adding the command SPLIT to the E-marl message example given before BEGIN instructs the BLAST server to split the output mto messages of 1000 lines each. If another message length is desired, the number of lmes can be put after the SPLIT command, as in “SPLIT 500” to receive 500 lines per file. If the BLAST client is discontinued or unavailable, the 12 base wordlength settmg of the E-mail and BLAST form methods can be partially compensated for. Sequences longer than the intended target size, with a mmlmum length of 24 nucleotides, should be entered Adding 12 bases to each end further increases the hkehhood of finding rmsmatches toward the center of a sequence (which are most likely to be missed because of the reqmrement for 12 bases in a row) The disadvantage of this approach is that the output needs to be heavily edited, since semiIarnies in the “filler” regions are not of Interest. FASTA is another program suitable for homology searches (7). FASTA has the advantage that it uses a wordlength or “ktup” of l-6 for a “hit ” However, available support systems for FASTA are less elaborate than for BLAST (see the DISC location m Note 2), and do not report a sufficient number of descriptions at this time The BLAST search for conserved HIV sequences described here has the weakness that only highly similar sequences are retrieved. If, for some reason, two highly disparate HIV sequence populatrons exist, only one will be detected For example, there is a unique HIV variant found m Cameroon, known as Type 0 (8) with sequences that are rarely similar enough to the query sequence to be mcluded in the BLAST output. However, these sequences are listed in the Alignment section of the AIDS data base described m Section 3., step 4 and can be added to the total number of HIV sequences. A second BLAST search on the variant sequence may be indicated A clue that the search sequence is not dominant m the population IS retrieval of a small number of sequences (lO,OOOg m a microfuge for 10-30 mm Remove the supematant carefnlly with a drawn-out Pasteur pipet being careful not to disturb the DNA pellet. 9 Wash the pellet with ice-cold 70% ethanol (500 pL) by gently mvertmg the tube several times 10 Centrifuge for 5 mm, remove the supematant carefully so as not to disturb the DNA pellet, and dry the pellet under vacuum. 11 Redissolve the pellet in RNase-free water or TE to a concentration of 0 5 pg/&

3.2. In Vitro Transcription

of Target Gene

1 Commercially available kits are available for the m vitro transcription of RNA. We have found that the MEGAscnpt kit from Ambion gives a very good yield of complete transcripts The manufacturer supplies the appropriate enzyme (SP6, T7, or T3 RNA polymerase), buffers, and nucleotides Along with the nucleotides supplied with the kit, add 2 pL of a suspension of guanosine hydrate ( 17 mg/mL)/ 20 uL reaction volume, and reduce the amount of GTP by 20% (6) Add linearized DNA (2 u.L, 0.5 pglpL)(see Note 6), and mix well by ptpetmg the reaction mixture up and down several times After adding the RNA polymerase, incubate at 37°C for l-3 h. If a commercial kit is not used, the transcription can be conducted as follows (cfchapter 10). In an autoclaved microfuge tube, add lmearized DNA (2 pL, 0 5 pg/pL) (see Note 6), 1OX transcription buffer (2 p.L) for the RNA polymerase (T7, T3, or SP6, often supplied with the enzyme), RNase-free water (4 4 CCL),ATP, CTP, UTP (7.5 mM, 2 pL each), and GTP (7 5 mM, 1.6 pL), guanosme hydrate (2 p.L), RNasin (1 pL), and RNA polymerase (1 pL) Mix components well, and incubate for 60 min at 37°C. 2 Add RNase-free DNase I (1 pL), and incubate for 15 mm at 37’C. 3 Extract twtce with phenol.chloroform:isoamyl alcohol (40 l.tL), saving the aqueous layer (top) containing the DNA 4. Purify RNA from nucleostdes and nucleotides on a G-50 Sephadex spin column (available commercially from several manufacturers) according to the manufacturer’s instructions. 5. Determine the concentration of the RNA by UV absorbance at 260 nm using an approximate extinction coefficient of (10,000 x n) M-‘/cm where n = number of bases. For example, a 1000 base transcript would have an approximate extmction coefficient of (10,000 x 1000 bases) 1M-‘/cm/base = 1 x 107M’lcm. 6 Ahquot the RNA (5 pL) mto autoclaved microfuge tubes, and store at -80°C until needed.

3.3. End-Labeling

of RNA with [y-3*P]A TP

1. Remove an ahquot of RNA (5 pL) from the -80°C freezer, add 10X T4 kmase buffer (2 pL, often supplied with the enzyme), [Y-~~P]ATP (5 pL), RNasin (1 @,), RNase-free water (11.5 ltL), and T4 PNK (2 5 pL), and incubate for 1 h at 37°C. 2. Purify the RNA from radioactive nucleotide on a G-50 Sephadex spm column as above. Store at -80°C until needed (see Note 7).

41

Accessible Sites for Ribozymes 3.4. Cleavage

of RNA with RNase H and a Random Oligodeoxynucleotide

Library

1 The end-labeled RNA (5 pL) was added to 10X RNase H buffer (1 pL) and RNase-free water (3 pL) to bring the volume to 9 & 2 Heat a randomized library of oligodeoxynucleotides for 1 mm at 95°C add ohgodeoxynucleotide (1 l.rL) to the RNA, and incubate for 90 mm at 37°C (see Note 8). Add RNase H (1 pL), and incubate for 10 mm at 37°C (see Notes 4 and 8) Quench the reaction with formamtde gel loading buffer (10 pL), and place on dry ice (see Note 9) Heat-denature the quenched cleavage reactions at 9S’C for 2 5 min, and quench on ice Load aliquots of quenched cleavage reactions (5 pL) and 32P-labeled DNA or RNA mol wt markers into indtvidual lanes of a 5% denaturing polyacrylamide gel prerun to 50-55°C Run the phenol red dye to the bottom (l-l .5 h) at 50-90 W (constant power). Remove the top plate and spacers, and remove the gel from the bottom plate with a piece of Whatman (Clifton, NJ) 3MM filter paper. Place this gel up onto a second piece of filter paper, cover the gel with plastic wrap, and dry on a vacuum gel dryer at 80°C for 60 mm. Expose the dried gel in the dark to Kodak (Rochester, NY) X-OMAT film for l-24 h as needed to discern cleavage products. Develop according to film supplier’s directions 10 Compare the bands resulting from RNase H cleavage with the mol-wt markers to estimate sites of RNA cleavage (see Note 10).

3.5. RNase H Cleavage of RNA with Specific Oligodeoxynucleotides 1 In a micromge tube, add end-labeled RNA prepared as above (1 pL), RNase-free water (6 uL), 10X RNase H buffer (1 l.rL), and antisense ohgodeoxynucleotide (1 pL, l-10 clM> targeted to an appropriate hammerhead ribozyme site (see Note 11) determined by the random ohgonucleotide method above. Incubate at 37’C for 15 mm 2. Add RNase H (1 pL), and incubate for 10 mm at 37°C. 3. Quench with formamide dye loading buffer (10 pL), and place the tube on dry ice. Analyze by gel electrophoresis and autoradiography as described above

3.6. Cleavage

of RNA by Hammerhead

Ribozymes

1 In a microfuge tube, add end-labeled RNA prepared as above (1 pL), Tris buffer (1 a), MgCl, (1 &), RNase-free water (6 @I,), and hammerhead ribozyme (4,5) (see Note 11) (1 pL), and incubate for l-60 min at 37°C. 2 Quench the reaction with formamide dye loading buffer (10 @), and place on dry ice 3. Analyze the products by gel electrophorests and autoradiography as described above.

42

Frank and Goodchild

4. Notes 1 When working with RNA, extreme care should be taken to avoid contammatmg reagents, glassware, or plasticware with ribonucleases Use gloves at all times, and change them regularly. It is highly recommended that all plastic tubes and tips, glass pipets, and bottles be autoclaved before use and reserved for RNA reagents. In addition, water used to prepare soluttons should be treated with DEPC (1 mL/L water) overnight at 37°C with sttrrmg to ehmmate any rtbonuclease activity. DEPC-treated water should then be autoclaved. Use gloves at all times when working with DEPC, smce it IS a suspected carcinogen. 2. Ohgodeoxynucleotides can be ordered from several commercial vendors or can be prepared by automated synthesis. Random ohgodeoxynucleottdes can be prepared using a mixture of equal amounts of deoxynucleoside phosphoramtdites and a solid support prepared from a mtxture of the four deoxynucleonde-derived controlled-pore glass supports and proceeding as mstructed by the manufacturers. 3. Addttton of NaCl to the buffer has little effect on RNase H results and is generally omitted. After about 6 mo of repeated use of the 10X RNase H buffer, the cleavage activity of ohgonucleotides decreases, probably because of oxidation of DTT. Preparation of fresh buffer is recommended every 6 mo. 4. All the commercially available RNase H preparations tested contam some nonspecific endoribonuclease activity that 1sIndependent of ohgonucleotide bindmg This activity is mostly unaffected by addmon of RNasin, but can be lessened somewhat by addition of more RNA In addition, we have found that high concentrations of phosphorothioate oligonucleotides (> 10 clM> inhibit the activtty of RNase H 5 Long RNA transcripts are susceptible to magnesium- dependent cleavage on long incubation with high concentrattons of MgCl, For incubations longer than 1 h, the concentration of magnesium chloride should not exceed 10 mM. 6. 3’-Overhanging ends have been shown to initiate transcription at the wrong end of the linearized plasmid. If the restriction endonuclease cleavage provides a 3’-overhang and there IS no altemattve site, the 3’-end can be made blunt using the 3’ + 5’ exonuclease activity of the Klenow fragment of DNA polymerase Set up the transcrtption reaction minus nucleotides and polymerase Add Klenow fragment (5 U/ug DNA), and incubate for 15 mm at 2S’C Add nucleotides and RNA polymerase, and proceed as directed. 7. Use the labeled RNA as soon as possible to mmimize damage to the transcrtpt from the radioactive decay. If it cannot be used the same day as labeling, storage overnight at -20 or -80°C is acceptable. 8. Run controls with RNase H, but no ohgonucleottde and with oltgonucleottde, but no RNase H to monitor background cleavage by contammatmg ribonucleases m the enzyme and oligonucleotide preparations. 9. For large transcripts greater than about 1500 bases, protein left m the reaction alters the migration of the bands at the top of the gel only. If this is a problem, reactions should be arrested by extraction wtth phenol chlorofotmtsoamyl alcohol (20 pL), the RNA is then precipitated with 0 1 vol of 3 M sodium acetate and

Accessible Sites for Ribozyrnes

43

3 vol of absolute ethanol. Isolate the RNA by centrifugatton, dry the pellet under vacuum, and dissolve the protein-free RNA in RNase-free water (10 pL) and formamide loading buffer (10 pL) Heat at 95°C for 3 mm and load onto the gel. 10. Graphing the migration of the bands vs the log (DNA size m bases) of the corresponding markers grves a strarght line The use of DNA standards permits RNA cleavage sites to be located to within a few bases 11. Sequences containmg the NUX motif are considered to be the most susceptible to hammerhead rtbozyme cleavage Ohgodeoxynucleotides of 12-20 bases are useful for analyzmg the accessibility of these sites.

References Tmoco, I , Jr., Davis, P. W , Hardin, C. C., Puglisi, J. D., Walker, G. T , and Wyatt, J. (1987) RNA Structure from A to Z. Cold Sprzng Harbor Symp. Quant. Bzol LII, 135-146. Wyatt, J. R , Puglisi, J D , and Tmoco, I , Jr (1989) RNA foldmg* pseudoknots, loops and bulges. BzoEssuys 11, 100-106. Zarrmkar, P P. and Williamson, J. R. (1994) Kinetic mtermediates m RNA folding. Science 265,9 18-924 Shimiyama, T , Nishikara, S , and Taira, K. (1995) Generality of the NUX rule: kinetic analysts of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes Biochemistry 34,3649-3654 Zoumadakis, M. and Tabler, M. (I 995) Comparative analysis of cleavage rates after systematic permutation of the NUX consensus target motif for hammerhead ribozymes Nucleic Acid Res 2.3, 1192-I 196 Harper, J. W and Logsdon, N. J (199 1) Refolded HIV- 1 tat protein protects both bulge and loop nucleotides m TAR RNA from ribonucleolytic cleavage Biochemwry 30,8060-8066.

Selection of Efficient Ribozyme Cleavage Sites in Target RNAs Andre Lieber, Mikkel Rohde, and Michael Strauss 1. Introduction The identification of cleavage sites for nbozymes within a particular target RNA exclusively on the basis of sequence mformatlon often leads to dlsappointing failures. Even prediction of secondary structures of the target RNA by computer modeling with a more or less exact predlctlon of smgle-stranded or loop regions does not guarantee successful cleavage of the target RNA by a synthetic or an expressed rlbozyme (I). Expensive screening tests with large numbers of individual ribozymes are the result. As an alternatlve to this tnaland-error approach, we have recently developed a novel strategy for identlfication of cleavage sites (2). The strategy 1sbased on the existence of a library of ribozyme genes cloned mto a suitable expression vector. A pool of synthetic ollgonucleotldes coding for a hammerhead rlbozyme flanked by target-binding arms of random sequences was placed in the loop portion of a unique stem-loop structure that was cloned mto a vector as part of the adenoviral vaRNA1 gene (Fig. 1). The construct allows for expression from both T7 RNA polymerase and RNA polymerase III promoters. The library consists of 5 x IO9 individual ribozyme genes. This library 1stranscribed m vitro, and the rlbozyme transcripts are incubated with total RNA from cells that contain the target transcript of interest. After cleavage in vitro, 3’-terminal fragments are purified via ohgo-dT, reverse-transcribed, and cloned. The actual cleavage sites can be identified by sequencing of the ends of fragments. Using primers specific for the flanks of the cleavage site, the respective rlbozymes can be reamphfied from the library, recloned into the expression vector, and tested for tinction in vivo The strategy is outlined in Fig. 2 and described in the following. From


Bfology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

45

Lieber, Rohde, and Strauss

46 hammerhead

ribozyme

sequence

Fig. 1. Schematic map of the expression unit m the ribozyme vector pGvaL (lower part) and insert of the synthetrc rrbozyme sequences (upper part) The library constructed as described (2) has 15 and 13 random nucleotides on the 5’- and 3’-ends of the rtbozyme sequence, respectively

lribozyme

library

1. ribozyme

tn vitro

DNA 1

of Interest

cells

RNA preparation

transcrlptton

cellular

RNA

RNA

I 2.

In wtro

cleavage

l< cellular

RNA ohgo-dT reverse tailing, cloning,

3.

fragments purlflcation, transcriptton, PCR amplification, sequencing.

1 cDNA clones, sequence of cleavage primers PCR, clontng

l--L

site(s)

for cleavage

site,

1

[ selected

ribozyme

gene

(

Fig. 2. Flowchart of the methods involved in tdenttfication of cleavage sites m target RNAs and in isolatron of a parttcular ribozyme from a library of rtbozyme genes.

Selection of Ribozyme Cleavage Sites 2. Materials 2.1. Transcription

of Ribozymes

47

from a Library

1. Ribozyme library DNA (can be obtained from the authors). 2. TKB buffer: 20 mA4 Trts-HCL, pH 7.9, 10 mA4 MgCl*, 0.2 mM EDTA, 10 mM 2-mercaptoethanol, 0.1 MKCl, 20% glycerol, 0.5 mMphenylmethylsulfony1 fluoride. 3. 10 mM Drthiothrertol (DTT). 4 RNasm (Boehrmger Mannheim, Mannhelm, Germany) 5. T7-RNA polymerase (New England Biolabs, SchwalbacWTadnus, Germany). 6. NTP stock solution: 10 mM of each of ATP, GTP, CTP, UTP. 7. a[32P]-CTP (see Note 1) 8 DNase I (Boehringer Mannheim). 9. Phenol/chloroform (1.1). 10. Ethanol. Il. Agarose gel

2.2. Cleavage

of Target RNA by Ribozymes

1 500 mA4 Tns-HCl, pH 7.5 2 100mMDTT 3 100 mMMgC12. 4. RNasin

5. Stop solution: 95% formamtde, 20 mM EDTA, 0.05% bromphenol blue, 0.05% xylene cyanol. 6. 10X TBE: 108 g Tris base, 55 g boric actd, 9 3 g Na2EDTA m 1 L (pH should be 8.3, add extra solid boric acid to adjust). 7 Sequencmg gels. 6% polyacrylamide, 8 Murea, 1X TBE buffer and/or NuSieve agarose gels.

2.3. Identification of Cleavage Sites by Cloning of Cleavage Products 1. 2. 3. 4 5. 6. 7. 8. 9. 10 11. 12. 13.

Oligo-dT cellulose (PolyATract, Promega, Heidelberg, Germany). Ohgo dT primer: 0.5 mg/mL solution of oligo dT,*-is in sterile water NMWL spin filter units, 30,000 NMWL (Millipore, Eschborn, Germany) Superscript II reverse transcriptase (Life Technologies, Eggenstein, Germany). 5X Reverse transcription buffer 250 mA4 Tris-HCl, pH 8 3, 375 mM KCl, 15 mM MgC12. Gene Clean (Bio 101, LaJolla, CA). Terminal deoxynucleottdyl transferase (Life Technologies). 5X Tathng buffer: 500 mMpotassmm cacodylate, pH 7.2, 10 mMCoC12, 1 mMDTT. Cis-ohgonucleottde primer. Gene-specific PCR primer. Taq polymerase (Perkin Elmer, Langen, Germany) 10X PCR buffer: 100 nut4 Tris-HCl, pH 7 9, 500 mA4 KCl, 20% DMSO, 1% Trrton X- 100. DNA sequencing kit.

48 2.4. Isolation

Lieber, Rohde, and Strauss of Ribozyme Genes from a Library

1. Tuq polymerase (Perkin Elmer). 2 10X PCR buffer as m Section 2.3. 3 Two gene-specific primers for the sequence flankmg the cleavage site.

3. Methods 3.1. Transcription of Ribozymes from a Library For this protocol, you need plasmid DNA from a ribozyme library like the one we have generated (2). The vector pGvaL, which was especially designed for generation of this library, contains the adenoviral vaRNA gene and an additional synthetic sequence forming a stable stem-loop region with the adjacent upstream region of the vaRNA1 (see Note 2). The ribozyme sequences were cloned via their XhoI and NszI sites between the S&I and PstI sites within the loop-forming region (Fig. 1). Since the sequences of the two oltgonucleotides used for generation of the library in ref (2) contain

two errors, the correct sequences are gtven here: Oltgonucleotide S’CCGCTCGAG(N)&TGATGAGTCCGTGAGGACGAAA3’;

III*

oltgonucle-

otide IV: 5’TGCATGCAT(N)i3NoTTTCGTCCTCACGGACTCATCAG3’. The two ohgos were annealed, filled in, and cleaved with XhoI and NsiI before cloning into pGvaL. Large-scale plasmid preparations are available, generated from a total of 5 x IO9 bacterial colomes (see Note 3). 1 Mix 2 pL (2 erg) of Hind III-digested ribozyme hbrary plasmid DNA with 12 5 uL TKB, add 10 U of RNasm, 2.5 pL of 5 mMNTP stock solution, 2.5 pL 10 mM DTT, 100 U T7-RNA polymerase, and water to a total volume of 25 u.E, and incubate at 37°C for 60 mm (see Note 1). 2. Add 23 U of DNase I, and incubate for 10 min at room temperature 3 Add an equal volume of phenol/chloroform (l.l), mix, and take the aqueous phase, repeat the extraction, and add 2 5 vol of ethanol for precipitation 4 Resuspend RNA m 10 pL of water, and run an ahquot on an agarose gel to estrmate the amount of RNA About 5-10 pg RNA are normally synthestzed m a 25-pL reaction volume.

3.2. Cleavage

of Target RNA by Ribozymes

1 Mix 1 clg of purified total RNA from cells of mterest with 10 pg of library RNA from the above transcription reaction, and add 1 & of 0.5 MTris-HCl buffer, pH 7.5, and 1 pL of 100 mM DTT to give a total volume of 8 pL. 2. Carry out heat denaturation of RNA by heating to 95°C for 90 s, and quickly cool on ice 3. Add 1 u.E of 100 mM MgCl, and 1 p+Lof RNasm, and mcubate reaction for 1 h at 37°C. 4 For analyttcal purposes, run a sample on a sequencmg gel. For quality control m preparation for the method m Section 3 3 , run a sample on a NuSieve agarose gel

Selection of Ribozyme Cleavage Sites 3.3. Identification

49

of Cleavage Sites by Cloning of Cleavage Products

1. Purify RNA cleavage products by binding to oligo-dT cellulose according to the mstructtons of the supplier. 2 Anneal approx 0 2 pg of purified RNA wtth 2 5 pA4 oligo-dT primer m 10 & water for 10 min at 70°C 3 Remove unbound primer by centrtfirgation through a 30,000 NMWL filter unit 4 To 16 pL of template, add 3 pL of 10 mM dNTP stock solutton, 6 pL of 5X reverse transcription buffer, 3 & of 100 mM DTT, 1 pL of RNasm, 1 pL (200 U) of superscript II reverse transcrtptase, and water to a total volume of 30 l.tL, and incubate at 37°C for 1 h 5. Purify cDNA&NA hybrids by bmdmg to Gene Clean, and elute with 30 uL of water. 6 Boll the hybrids for 2 mm, and cool on ice. 7 Add 5 pL of dGTP (2 n&Q, 10 pL of 5X tailmg buffer, 20 U of terminal deoxynucleottdyl transferase, and water to 50 $ and incubate at 37°C for 15 mm 8. Take 2 5 pL of tatlmg reactton, and add 2 pL of dNTP (10 mA4), 1 5 mA4 MgCl,, 10 pL 1OX PCR buffer, 2.5 U of Taq polymerase, 15 @f C ,,-primer, and water to a total volume of 100 pL (see Note 4). 9 Run seven cycles of one-directtonal PCR with 30 s at 95’C, 30 s at 42°C and 90 s at 72°C 10 Add 25 pM of a gene-specific downstream primer, and carry out 40 cycles of PCR with 60 s at 94°C and 90 s at 72°C The annealing temperature depends on the primer sequence 11 Reduce the volume by drying, run reaction products on a gel, and cut out the most prominent band(s) correspondmg to the preferred cleavage products 12. Perform cloning of fragments into a suitable vector according to standard procedures, and carry out sequence analysis followmg the instructtons of the manufacturer

3.4. Isolation

of Ribozyme Genes from a Library

There are several options to continue from this stage in order to obtain a rrbozyme specific for the preferred cleavage site. We prefer the method of amplification of the rtbozyme from the library and reclonmg over clone selectron by hybridization (see Note 5). 1. Mix 50 ng ofplasmids from the nbozyme library with 20 pA4of each of the upstream and downstream primers that are specific for the sequences around the cleavage site of the sequenced fragment and add 2.5 U of Taq polymerase, 10X PCR buffer containing 1 5 mMMgC12, and water to give 100 pL total reaction volume 2. Run PCR for 40 cycles (45 s at 95°C 45 s at 52°C 45 s at 72°C) 3. Purify the reaction product by spin filtration using NMWL filter units, digest with desired restrtctton endonuclease, and perform clonmg mto a suitable expression vector, preferably pGvaL (see Note 6).

4. Notes 1. If desired, one can trace-label the transcripts using a[32P]-CTP The lowest specific activity supplied (400 Ci/mmol) is sufficient, and only 1 $ need be added to the reaction In Sectlon 3.1 , step 1 (see Chapter 10)

Lieber, Rohde, and Strauss

50

2. The vector pGvaL allows for expression from both the T7 promoter and the

3.

4.

5

6

vaRNA-associated pol III promoter. Whereas the first is preferentially used for m vitro transcription, the latter seems to be very efficient m vtvo. Alternattvely, the T7 promoter could also be used m vivo if a nuclear T7-polymerase encoding gene IS cotransfected (2) The results obtained with ribozymes directed against different target sequences (2 and our unpublished data) suggest that the size of the library could be reduced by shortening the length of the random sequences m both arms of the hammerhead to seven or eight nucleotrdes, which would still provide sufficient specificity and stability, and would even allow for more efficient cleavage owing to a higher turnover rate. The most critical step m the procedure of cleavage-sue determmation IS the amplification of specific cDNA fragments. We found tt useful to run one-directional PCR from the G-tad first m order to obtain sufficient template for genespecific amplification. The concentration of the gene-spectfic primer should be fairly high (15-25 pM), but needs to be optimrzed for any given target sequence Alternative ways to obtain spectfic ribozymes would be either selection of clones from the library by filter hybridization or generation of synthetic ribozymes based on the sequence mformatton The latter can be cloned mto a vector like pGvaL (2) Ribozymes selected by the procedure described above are highly efficient m mactivatmg the function of the target RNA, and as little as an excess of 2- to lofold over the target RNA can be sufficient to abolish the function of a particular gene completely, as demonstrated for overexpressed human growth hormone m stably transformed clones (2).

References 1 Bertrand, E L., Pictet, R., and Grange, T (1994) Can hammerhead ribozymes be efficient tools to inactivate gene function? Nucleic Acids Res 22, 293-300 2 Lreber, A. and Strauss, M. (1995) Selection of efficient cleavage sites in target RNAs by using a ribozyme expression library. A401 Cell Biol. 15, 540-55 1

Chemical Synthesis, Analysis, and Purification of Ribozymes Ravi Vinayak 1. Introduction The chemrcal synthesis of RNA, like DNA, IS carried out in the 3’ to 5’ du-ectron to take advantage of the high chemical reactivity of the S-hydroxyl group. Solid-phase chemistry currently provides the most effective means for the scale-up of RNA synthesis. The biologtcal activity of chemrcally synthesized RNA (I--3), equivalent to that of RNA derived by transcription methods (4-6), IS contingent on efficient synthesis and purtfication protocols. Chemical synthesis also allows for site-specrfic modtfications, such as deoxynucleotrdes, phosphorothtoates and modified nucleottdes (7-11). A number of improvements have been reported recently that have stgmficantly improved the chemical synthesisand purification of RNA and rtbozymes (I 2-14). Synthesis of RNA up to 200~pm01scale has been reported, which can provide quantities sufficient for therapeutic and structural applications (14). An optimized set of protocols are presented here that assure high-quality synthetic RNA. We also provide reliable HPLC techniques for the analysis and purrficatton of these molecules. 2. Materials

2.1. Equipment 1. Automated DNA/RNA synthesizer (e g., ABI Model 392 or 394, Applied Blosystems, Foster City, CA). 2. HPLC system (e g , series 200LC pump, Perkm-Elmer, Norwalk, CT)

2.2. RNA Phosphoramidites

and Supports

1 2’-O-t-butyldnnethylsllyl-S-O-DMT-flbonucleoside phosphoramldltes (A, G, C, U) 2 Nucleoslde-functlonallzed CPG or polystyrene supports (A, G, C, U). From

Methods tn Molecular Edlted by P C Turner

Biology, Vol 74 Fhbozyme Protocols Humana Press Inc , Totowa, NJ

51

Vmayak

52

Both of these are available from a number of commercial sources (e g., Applied Blosystems, Glen Research [Sterling, VA], Perseptive Biosystems [Frammgham, MA], and so on). 2.3. Ancillary Reagents 1. Tetrazole/acetonltrrle 2 3. 4. 5

Acetic anhydride/lutidine/tetrahydrafuran 1-Methyl-lmidazole/THF. Trlchloroacetlc acuI/dichloromethane Iodme/water/pyridine/THF.

(THF)

6 HPLC-grade acetonrtrrle. 7 Anhydrous acetomtrrle (for dissolution of phosphoramldites) 8. Ethylthio-tetrazole.

All the above are available from Applied Brosystems. 2.4. Postsynthesis 1 2 3 4 5 6 7 8 9

Reagents

Tetrabutylammomum fluoride (TBAF) (Aldrich [Milwaukee, WI] P/N 21,6 14-3) Trrethylamme trrhydrofluoride (Et,N[HF],) (Aldrich P/N 34,464-8) G-25 Sephadex (Aldrich P/N 27,109-8). Dimethylformamlde (DMF). 1-Butanol (Aldrich P/N 27,067-9) 1-Propanol (Aldrich P/N 29328-8). Sodmm acetate. Lithmm perchlorate Concentrated ammomum hydroxide (30%) (Aldrich P/N 38,053-9)

2.5. HPLC Reagents 1 Reverse-phase cartridge: 220 x 4 6 mm (Aquapore RP-300, C-8; Applied Biosystems P/N 07 1 l-0059) 2 2 M Trrethyl ammonmm acetate, Applied Brosystems P/N 4006 13 3 Acetonitrtle 4. Anion-exchange cartridge: Nucleopac PA- 100 anion-exchange column (Dlonex Corporation, Sunnyvale, CA, P/N 043010) 250 x 4 mm (analytical); 250 x 9 mm (semipreparative). 5. Solvent A. 20 mA4 LiC104 + 20 mM NaOAc m H20.CH3CN (9.1) (pH 6 5 with dilute AcOH) 6 Solvent B* 600 mA4LiC104 + 20 mMNaOAc m H20.CH3CN (9.1) (pH 6.5 with dilute AcOH)

3. Methods 3.1. Oligoribonucleotide Synthesis Ribozymes can be synthesized on a 1 pm01 scale column (trityl-off) using the 1 pm01 RNA cycle (15) (see Note 1). RNA phosphoramtdttes are diluted

Synthesis, Analysis, and Purification

53

with dry acetomtrile to a concentration of 0.1 M. These phosphoramidlte solutions should be used within 3 d of dilution (see Note 2) 3.7.7. Synthesis of Chimeric and Phosphorothioate Oligoribonucleotides If the RNA phosphoramldites are attached at bottle positions l-4, and DNA phosphoramldltes (Applied Blosystems) at bottle positions 5-8 (on an ABI model 392/4 with 8 bottle positions), mixed DNA/RNA ohgonucleotldes may be synthesized (25). 2’-O-alkyl RNA/RNA oligonucleotides can also be synthesized slmllarly by attaching the RNA phosphoramidites to bottle positions 14 and 2’-0alkyl RNA phosphoramidltes (Glen Research) to bottle positions 5-8. Phosphorothioate oligoribonucleotides can be synthesized by replacing the oxidizing reagent (iodine/water/pyridine) with the sulfurizing reagent tetraethylthluramdisulfide/acetonitrile (TETD) (Applied Biosystems) (16). 3.2. Cleavage, Deprotection, and Desalting (Postsynthesis) To cleave the oligorlbonucleotlde from the support and to deprotect the baseprotecting groups, a 3:l mixture of 30% aqueous ammomum hydroxide and ethanol is employed. The cleavage can be performed either on or off the mstrument. Protocols for the 2’-hydroxyl deprotection with either TBAF or Et,N(HF), and subsequent desalting then follow. 3.2.1. Cleavage on the Synthesizer 1. Use the End RNA procedure, which is mcluded m the permanently encoded cycle files on the instrument (392/4). 2. On completion of the end procedure, remove and cap the collection vial, and then heat for 4 h at 55T for complete removal of the base-protectmg groups (see Note 3).

3.2.2. Cleavage off the Synthesizer This may be implemented through the double-syringe method (Z 7). 1. After completion of the synthesis, dry the synthesis column with a flush of argon. 2 Load a fresh syringe (with luer tip) with a 2 mL solution of 3:l concentrated ammoma:ethanol. 3. Mount another empty syringe, with plunger fully inserted, mto one end of the synthesis column Mount the ammoma:ethanol-loaded syringe into the other end of the column. 4. Holding a syringe m each hand, gently pass the reagent through the column to the

empty syringe, and return severaltimes. 5 Let stand for 2-3 h at ambient temperature.

54

Vinayak

6 Withdraw the ammonia:ethanol solution mto one syringe, and inject the solution into a screw-cap vial 7. Heat at 5S’C for 4 h for complete removal of the base-protecting groups.

3.2.3. 2’- Hydroxyl Deprotection (Desiiylation) with TBAF 1 Measure the OD of the crude oligorlbonucleotlde (see Note 4) 2. Dry the ammoma:ethanol solution contammg the crude ohgorlbonucleotlde (trltyl off) after heating it for 4-5 h at 55°C (see Note 5). 3 Add a 1 Msolution of TBAF in THF. Use 15 pL/optlcal dens@ unit (ODU) (40 ccg) of the crude ohgorlbonucleotlde (see Note 6) 4. Vortex thoroughly, and stir the solution with a magnetic stir bar at amblent temperature for 2430 h. 5. Quench the reaction with an equal volume of sterile deionized water

3.2.4. Desalting with G-25 Sephadex@ (Size-Exclusion Chromatography) When Using TBAF Desalting procedures remove morgamc salts, traces of organic compounds, low-mol-wt impurities, and short failure sequences. 1. Concentratethe quenchedsolution(Sectton3.2.3,step5) to approximatelyone-half its original volume usmg a vacuum centrifuge (see Note 7). 2 Swell the G-25 Sephadex in sterile deionized water for 4-5 h. Load a Blo-Rad Econo-column (0 7 x 20 cm, Blo-Rad P/N 737-72 1) with this slurry A maximum of 100 ODU of crude RNA can be loaded on this column. 3 Allow the slurry to flow through the column until the Sephadex has settled (up to 16cm). 4. Carefully load the RNA sample in a mmimum amount of sterile deionized water, After the sample has descended to the Sephadex@ level, carefully add additional deionized water to the top of the column (about 10 mL) Collect 1 mL fractions in sterile tubes once the sample has been loaded 5. Collect 10 x 1 mL fractions. The RNA product elutes m tubes 2-5. 6 Assay each fraction on a UV spectrometer at 260 nm to determine which tubes contam the RNA ohgonucleotlde 7 Pool the fractions containing RNA, and evaporate to dryness 8. Dissolve the dried RNA m water. It 1snow ready for analysis

3.2.5. Desilylation with Et,N(HF), at Ambient Temperatures (see Note 8) 1 Add a neat solution of Et3N(HF)3 (10 pL/ODU) to the crude ohgoribonucleotlde (see Note 9) obtained from step 2 of Section 3 2 3 2 Vortex thoroughly and stir the solution with a magnetic stir bar at ambient temperature for 24-30 h. 3 Quench the reaction with sterile deionized water (2 pL/ODU).

Synthesis, Analysis, and Purification

55

3.2.6. Desilylation with Et,N(HF), at Elevated Temperatures 1 Add 9 pL/ODU of Et,N(HF), followed by 3 pL/ODU of DMF to the crude RNA obtamed from step 2 of Section 3 2 5 2. Vortex thoroughly, and heat to 55°C for 1 h (see Note 10) 3 Cool the solution and quench the reaction with sterile deionized water (2 &/ODU)

3.2.7. Desalting and Precipitation When Using Et3N(HF)3 1 To the solution obtained from step 3 of Section 3 2 5 and of 3 2.6., add I-butanol (100 pL/ODU), mix, and chill the solution at -20°C or lower for about 45 mm (or m dry ice/ acetone for 20 min) 2 Centrifuge the tube at >3OOOg for 5 min, and decant the butanol to collect the precipitated RNA (see Note 11). 3. Dtssolve the precipitated RNA in water. It 1snow ready for analysis.

3.3. Analysis and Purification The fully desalted and deprotected ohgortbonucleotide (tntyl-off) analyzed and purified HPLC (IS).

either by reverse phase HPLC

can be

or by anion-exchange

3.3.1. RP-HPLC Cartridge: Gradient

220 x 4 6 mm (RI’-300, C-8) Time. mm 0 24 34 Mobile phase. 0.1 M trtethylammomum acetate (TEAA) acetonitrile Flow rate. 1.O mL/mm RP-HPLC

purification

1s generally

limited

% Acetomtrile 0 20 40

to ollgorlbonucleottdes

>20

bases, provided they give sharp peaks and good resolution. This cartridge is suitable for analysis of about 0.3-1.0 ODU of crude oligonucleotide. It may also be used for purifications up to 15 ODU, with some loss of resolution. A larger column (250 x 7 mm, Applied Biosystems P/N 0712-0034) gives better separation with greater loading. Retention times for trityl-off oligoribonucleotides are sequence- and lengthdependent. Generally, ohgonucieotides between 10 and 20 nucleotides elute between 15 and 25 min. Ribozymes with 30 or more bases, or those that form stable secondary structures, may give broad peaks by RP-HPLC analysis, because the mobile phase (TEAAlwaterlacetonitrile) is not denaturing. Anionexchange HPLC may be the preferred method for analysis and purification for such oltgorlbonucleotldes.

Vinayak

56 3.3.2. An/on-Exchange

HPLC

Cartridge, Gradtent.

Nucleopac PA- 100 anion-exchange column Ttme. mm %B 0 0 30 50 Mobile phase. Solvent A: 20 mkf L&10, f 20 mMNaOAc in H20: CHsCN (9 1) Solvent B: 600 mM LiClO, + 20 rr& NaOAc m H20* CHsCN (9.1) (see Note 11) Flow rate* 1 0 mL/mm Temperature* 50-70°C The analytical cartridge is suitable for loading about 5 ODU of crude oligonbonucleotide. The semipreparatlve column may also be used for purtficatron of up to 50 ODU, with some loss of resolutron. An even larger column 1s available for purrfying up to 200 ODU of the ollgoribonucleotide. Oligoribonucleotrdes that form stable secondary structures or hairpins will deviate from their size-dependent elutlon pattern and may elute as broad peaks (see Note 13). Oltgoribonucleotldes purified by anion-exchange HPLC must subsequently be desalted by either size-exclusion chromatography (Section 3.2.4 ) or by precipitation of RNA by the addition of propanol as follows. 1 Collect the product peak in a sterile tube (when using anion-exchange HPLC gradient) 2 Add 3-4 vol of I-propanol Mix thoroughly, and keep the tube at -20°C for 4-6 h 3 Centrifuge at >5OOOg for approximately 10 mm. 4 Decant the propanol, wash the pellet with 1-propanol, and dry 5. Minute amounts of salts remammg may be further desalted by size-excluston chromatography as described m Section 3.2 4 (see Note 14)

4. Notes 1. For nbozymes longer than 40 bases, the tradmonal activator tetrazole should be replaced with a 0.75 A4 solutron of 5-ethylthro-lH-tetrazole m acetomtrrle as an activator This activator provides a higher couplmg efficiency (12) 2. Exposing the reagents or soluttons to moisture will result m degradation of the phosphoramldites, significantly affecting synthesis performance In addition, care must be exercised at every step to ensure good quahty of the final product. It 1s essential to use fresh reagents, anhydrous acetonitrile, gloves, and sterile, RNasefree materials for high-quality synthettc RNA. 3. This process also removes the 2-cyanoethyl (phosphate protecting) group For rlbozymes longer than 40 bases, a 5-6 h deprotection time is required The concentration of ammonia 1scritical. Use fresh, concentrated ammonium hydroxide that has been opened less than 1 mo. Use of anhydrous ammonia m ethanol for

Synthesis, Analysis, and Punficatlon

4

5

10

11. 12.

13 14

57

base deprotectlon is reported. However, the volatile nature of this reagent precludes its use on an automated instrument (28) The expected yield of a 20-mer after cleavage from the support is 80-100 ODU (1 ODU 1s that amount of material that gives an absorbance of 1 0 when dlssolved m 1 mL of water m a cuvet with a path length of 1 0 cm at 260 nm). The 2’-O-silyl ohgoribonucleotides thus obtained are relatively stable compounds They are resistant to ribonucleases and may be stored for extended times as a dry pellet or m cold, aqueous, neutral solutions, preferably sterile deionized water. Use a fresh solution of TBAF ~6 mo old, preferably stored under argon at room temperature (I 9). Degradation of the oligoribonucleotides can occur if the solution IS concentrated to more than one-half. Desllylatlon with this reagent can be effected either at room temperature or at 55°C Effective use of this reagent 1sboth length- and sequence-dependent In addition, care must be taken during workup owing to limited solubility of the products (20) and during desllylatlon of chlmerlc DNA-RNA ohgonucleotldes The acidic nature of this reagent may cause some depurination of deoxyadenosme residues. Heating for more than 1 h causes degradation and loss of yield (21). This method 1s applicable to ohgorlbonucleotides in general, with the exception of certain homopolymers (e.g , poly A and poly C) or long stretches of homopolymers m a heterogenous sequence. Attempts to precipitate RNA with 1-butanol from a TBAF solution have not been successful. Since the gradient system employs LlC104 m the mobile phases, the RNA obtained 1sm hthium salt form. For some experiments, the hthmm salt form of RNA may not be preferred, and postpurification cation exchange will be necessary A column oven (e g , Hitachi CTO-6A) may be necessary to analyze and purify rlbozymes that deviate from the size-dependent predictable pattern. Purified RNA can be stored as a dry pellet or m an aqueous solution, e.g , sterile water, at -20°C or lower up to 2 mo.

References 1 Gait, M. J , Pritchard, C., and Slim, G (1991) Oligonbonucleotlde synthesis, m Ollgonucleotldes and Analogues, A Practxal Approach (Eckstem, F , ed.), IRL, Oxford, pp. 25-48. 2. Damha, M. J. and Ogllvle, K. K. (1993) Ohgonbonucleotlde synthesis, in Methods m Molecular Biology, vol. 20, Protocols for Ollgonucleotldes and Analogs (Agrawal, S., ed.), Humana Press, Totowa, NJ, pp. 81-114. 3 Vinayak, R (1995) Ohgoribonucleotldes: Theory and synthesis, in Molecular Bzology* Current Innovatzons and Future Trends, part 1, (Griffin, A M. and Griffin, H G , eds ), Horizon Scientific, Wymondham, UK, pp. 107-126. 4. Milligan, J. F , Groebe, D R , Wltherell, G W , and Uhlenbeck, 0. C (1987) Oligoribonucleotlde synthesis usmg T7 RNA polymerase and synthetic DNA templates Nucleic Acids Res. 15, 8783-8798

58

Vinayak

5 Wyatt, J R., Chastam, M , and Pughsi, J. D. (1991) Synthesis and purification of large amounts of RNA oligonucleottdes. BzoTechnzques 11,7&I-769 6. Beckett, D. and Uhlenbeck, 0. C (1984) Enzymatic synthesis of oligoribonucleotides, m Oligonucleotide Syntheszs,A Practzcal Approach (Gait, M. J , ed.), IRL, Oxford, pp. 185-197 7 Heidenreich, O., Pieken, W., and Eckstem, F. (1993) Chemically modified RNA approaches and applications. FASEB J 7,90-96 8. Goodchild, J (1992) Enhancement of ribozyme catalytic activity by a contiguous oltgodeoxynucleotide (facilitator) and by 2’-0-methylation. Nucleic Aczds Res 20,4607-46 12 9. Sproat, B. S. (1993) Synthesis of 2’-0-Alkylohgoribonucleotides, m Methods zn Molecular Bzology, vol. 20, Protocols for Olzgonucleotzdes and Analogs (Agrawal, S., ed.), Humana Press, Totowa, NJ, pp 115-141 10. Chownra, B. M. and Burke, J. M (1992) Extensive phosphorothioate substttution ytelds highly active nuclease-resistant hairpin nbozymes. Nuclezc Acids Res. 20,2835-2840 11. Grasby, J A , Mersmann, K., Smgh, M., and Gait, M. J (1995) Purme functional groups m essential residues of the hairpin nbozyme required for catalytic cleavage of RNA. Bzochemzstzy 34,4068-4076 12. Sproat, B., Colonna, F , Mullah, B., Tsou, D., Andrus, A , Hampel, A , and Vmayak, R. (1995) An efficient method for the analysis and purification of ohgoribonucleotides. Nucleoszdes & Nucleotzdes 14,255-273. 13 Wmcott, F., DiRenzo, A., Shaffer, C., Tracz, D , Grtmm, S., Workman, C , Sweedler, D , Gonzalez, C , Scarmge, S., and Usman, N (1995) Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nuclezc Aczds Res. 23,2677-2684. 14 Tsou, D., Hampel, A., Andrus, A , and Vmayak, R (1995) Large scale synthesis of ohgoribonucleotides on HLP support. Nucleoszdes & Nucleotzdes 14, 148 1-1492 15 Applied Biosystems User Bulletm (1995) RNA Synthesis: Improved 1 pm01 RNA synthesis, analysis and purification, vol. 91 16. Vu, H and Hwchbem, B. (1991) Internucleottde phosphite sulfurizatton with tetraethylthiuram disulfide. Phosphorothioate oligonucleotide synthesis via phosphoramidtte chemistry. Tetrahedron Lett 32,3005-3008 17 Applied Biosystems Model 3921394 User’s Manual, Appendix VI 18 Scarmge, S. A., Francklyn, C., and Usman, N. (1990) Chemical synthesis of biologically active ohgoribonucleotides using P-cyanoethyl protected ribonucleoside phosphoramidites. Nuclezc Aczds Res. 18, 5433-544 1. 19. Hogrefe, R. I., McCaffrey, A. P., Borozdma, L. U , McCampbell, E. S., and Vaghefi, M M. (1993) Effect of excess water on the desilylation of ohgoribonucleottdes using tetrabutylammonmm fluoride Nuclezc AczdsRes. 21,4739-4741 20. Murray, J. B., Collier, A. K., and Arnold, J. R. P. (1994) A general purification procedure for chemically synthesized oligonbonucleotides. Anal. Bzochem. 218, 177-184 2 1. Vinayak, R , Andrus, A., and Hampel, A. (1995) Rapid desilylation of oligoribonucleotides at elevated temperatures. Cleavage activity m ribozyme-substrate assays. Bzomedzcal Peptzdes, Protezns and Nuclezc Aczds 1,227-230.

A Practical Method for the Production of RNA and Ribozymes Francine E. Wincott and Nassim Usman 1. Introduction As a result of both the therapeutrc (I) and structural (2) Interest in RNA, there has been an increased demand for larger amounts of oligoribonucleotides. Although great progress has been made in improving the methods for DNA synthesis, such that productron of large amounts has become commonplace, simrlar quantities of RNA are still difficult to obtam. RNA and DNA are generally synthesized and purrfied using the same methodologies. However, the one feature that embodies the difference between the two types of nucleic acrds, the 2’-hydroxyl moiety found m RNA, renders oligoribonucleotrde synthesisand purification more challenging. The typical protecting group used, t-butyldrmethylsrlyl, IS quite bulky and therefore hinders coupling. Additionally, an extra deprotection step, traditronally utilizing tetrabutyl ammomum fluoride (TBAF), is required to remove this group Finally, smce existing RNA synthesisprotocols did not allow for the production of larger (>0.5 mg) amounts, accompanymg purificatron techniques have not been developed. We have found that some rmprovements can be made during the synthesis of oligoribonucleotrdes (3), particularly with regard to RNA phosphoramidite coupling times. However, the biggest impact is achieved with improved deprotection protocols. New reagents for deprotection of both the exocychc amine and 2’-0-TBDMS hydroxyl-protecting groups can increase both the yield and recovery of the synthetic RNA. 7.1. Synthesis As m DNA synthesis, tetrazole is the activator of choice for RNA synthesis (4,5). A 0.5 A4 solution of tetrazole reacts with the RNA phosphoramrdite, and From

Methods m Molecu/ar Edlted by P C Turner

Biology, Vol 74 Rbozyme Protocols Humana Press Inc , Totowa, NJ

59

60

Wincott and Usman

the resulting activated speciesthen couples with the polymer-bound 5’-hydroxyl group for 10 mm (5). Although many attempts have been made to optimize this process by varying concentration or coupling times, improvements were not observed. However, with the advent of substttuted tetrazoles (6,7), enhancement of the couphng step could be effected. In particular, 5-ethylthto- lH-tetrazole (S-ethyl tetrazole) has been found to be a more effective activator owing to its higher solubihty properties and greater acidity (7). This reagent can be used at half the concentration (0.25 vs 0.5 M> of tetrazole and with half the coupling time, wtth no resultmg detrimental effect on full-length product yield (3). 7.2. Base Deprofecfion Judtclous choice of protecting groups on the exocyclic amines of the bases is critical to a successful synthesis. They must be stable to the synthetic cycle and, concurrently, readily cleaved at the end of the synthesis. We and others (8-11), have found that the phenoxyacetyl-type protecting groups on guanosine and adenosine and acetyl-protecting groups on cytidine meet these requirements. Typically, these acyl groups require incubation in 3:l NH,OH:EtOH for 4 h at 65°C to achieve complete removal. This is a marked reduction from the standard protecting groups, benzoyl for adenosme, isobutyryl or benzoyl for cytidme, and isobutyryl for guanosme, which using the same reagent require an mcubation time of 16-20 h at 65°C to effect complete removal. We have developed conditions that further accelerate the deprotection of oligoribonucleotides (3). A 1: 1 mixture of NH40H and methylamme (AMA) was reported to deprotect oligodeoxyribonucleotides fully at 65°C m 10 mm, if acetyl is used as the protecting group for cytidine. We have found that methylamme alone can be used to realize full base deprotection of oligoribonucleotides under the same conditions. Neither premature removal of the silyl-protecting groups, a concern when NH,OH:EtOH (3: 1) is utilized for base deprotection, nor base modification (12) is observed with AMA mcubation. 7.3.2’-O-My/ Deprofecfion Removal of the 2’-O-alkylsilyl-protecting group has traditionally been a “necessary evil.” Although the standard reagent, 1.OMTBAF, works quite well, it is a time-consuming process, requiring 8-24 h (4,5). Additionally, salts that must be removed prior to purtfication are produced. Alternative reagents have been explored. Neat triethylamine trihydrofluoride (TEA, 3HF) has been used to desilylate oligoribonucleotides (8,23) with limited success. We found that an anhydrous reagent of TEA, 3HF in N-methyl-pyrrohdinone (NMP) wrth TEA at 65°C for 0.5-l .5 h gives equivalent or better results than TBAF (3). In addition, the resulting oligomer can be isolated by anion exchange desalting or by direct precipitation from the deprotection mixture using 3 A4

61

Production of RNA and Ribozymes mAU , 50 -

Areas

40 -

1: 690.147 2:664.666 3:214.943

% 43.66 42.26 13.67

30 -

20 10 -

0

1 0

5

10

15

20

min

Fig. 1. Chromatogramof crude nbozyme 1, analyzedon a Hewlett Packard 1090 HPLC with a DronexNucleoPac@PA- 100column at 50°C using NaClO, buffers Area 2 representsthe full-length 37-mer Rz 1= ucu ccaucu GAu Gag geegaaagg ccG aaA auc ecu T Lower case= 2’-O-Me, T = 3’-3’ thymidine. sodium acetate (NaOAc) and butanol (see Section 3.3.). More recently, there have been reports of the utihty of a similar reagent where NMP IS replaced with dtmethylformamide (DMF) (14). 1.4. Analysis

Anion-exchange HPLC is the best method for accurately assessing the percentage of full-length oligomer present m a fully deprotected, crude sample. In conjunction with spectrophotometric quantitation, an accurate measurement of the amount of product can be calculated. We have found that a Dionex NucleoPac@PA-l 00 column, 4 x 250 mm, at 5O”C, used with NaC104 buffers, gives optimal resolution (3). Figure 1 shows a typical chromatogram of a 2.5~umol scale synthesis of a 37-mer, ribozyme 1, synthesized and deprotected according to the methods described herein. Spectrophotometric analysis indicated a crude yield of 422 AU. Integration by area provides a value of 42% (177 AU) for the full-length product. 1.5. Purification Prior to analysts of the oltgomer, the crude RNA is typically isolated by precipitation or anion-exchange cartridge desalting. Once the amount of full-

62

Wincott and Usman

length product has been determined, the material must be purified. Reversedphase chromatography, a useful method for the purification of short ollgomers (cl 0 bases) (15-I 7), 1s not viable for longer oligonucleotldes. Amon exchange chromatography has also been reported for the purification of shorter ohgomers (18,19) or as a preliminary purification step (20). We have found that a single anion-exchange purification of long (>30-mer), tntyl-off ohgonbonucleotldes provides material m good yield of high purity (3).

1.6. Summary The methods presented in this chapter provide an efficient protocol for the production of routine scale ohgorlbonucleotldes. Both synthesis and deprotectlon times have been reduced through the development of better reagents. These Improvements appreciably reduce the time requn-ed for the production of long ohgoribonucleotldes. Finally, the use of anion-exchange chromatography has refined the analysts and purlficatlon processes. Both the yield and quality of the final product have been enhanced by the mcorporation of these protocols

2. Materials The procedures described below were developed for the ABI 394 DNA/RNA synthesizer, although they can be modified to utilize any standard synthesizer.

2.1. Synthesis Reagents and Materials 1 Empty OPC columns for 2 5-pm01 scale syntheses (ABI [Foster City, CA]) 2. Ammomethyl polystyrene (ABI or Pharmacla [Milwaukee, WI) derlvltized using standard methods (21). 3 RNA phosphoramldites 5’-0-DMT-N6-(phenoxyacetyl)-2’-O-TBDMS-adenosme-3’-O-(P-cyanoethyl-N,N-dnsopropylamino) phosphoramldlte, Y-O-DMT~-(lsopropylphenoxyacetyl)-2’-O-TBDMS-guanos~ne-3’-O-(P-cyanoethyl-N,Ndnsopropyl-ammo) phosphoramldlte, S-0-DMT-N“-(acetyl)-2’-0-TBDMS-cytldine-3’-0-(P-cyanoethyl-N,N-dusopropylammo) phosphoramldite, 5’-O-DMT-2’0-TBDMS-undine-3’-0-(P-cyanoethyl-N, N-dlisopropylamino) phosphoramldlte (Pharmacla) See Fig 2 4 2’-O-methyl phosphoramidltes 5’-0-DMT-i@(t-butyl or phenoxyacetyl)-2’-Omethyl-adenosine-3’-O-(~-cyanoethyl-N,N-di~sopropylam~no) phosphoramidlte, 5’-0-DMT-fl-(t-butyl or isopropylphenoxyacetyl)-2’-O-methyl-guanoslne-3’-0(P-cyanoethyl-N,N-dilsopropylammo) phosphoramldite, 5’-O-DMT-N4-(acetyl)2’-O-methyl-cyt~d~ne-3’-O-(~-cyanoethyl-N,N-dnsopropylam~no) phosphorarmdlte, 5’-O-DMT-2’-O-methyl-ur~dine-3’-O-(~-cyanoethyl-N,N-dnsopropylam~no) phosphoramldite, (PerSeptlve Blosearch [Framingham, MA] or Pharmacla) See Fig. 2. 5. All phosphoramtdites are diluted on the synthesizer, usmg automated protocols (see Note 1) 6 Ancillary reagents: 2% TCA in methylene chloride (ABI), 16% N-methyl lmldazole m tetrahydrafuran (THF) (ABI); 10% acetic anhydnde, 10% 2,6-lutldme m THF

63

Production of RNA and Rlbozymes

DMTO

DMTO

y

OR

y

lPr2N / pyocE

OR

IPr2N / p‘OCE

Cytidine

Adenosine R = TBDMS, R, = H R = Me, RI = H or t-butyl

R = TBDMS R=Me

DMTO

DMTO

0

OR

?

OR

IPr2N ‘p‘OCE

Uridine

Guanosine R = TBDMS. RI = Isopropyl R = Me, RI = rsopropyl or t-butyl

R = TBDMS R=Me

Fig. 2. RNA and 2’-O-Me phosphoramidites

(ABI); 16 9 mM I,, 49 nnV pyridme, 9% water in THF (Perseptive); B & J Synthesis Grade acetonitrrle, s-ethyl tetrazole solution (0 25 M in acetonitrtle) was made up from the solid obtained from American International Chemical, Inc , Natwk, MA

2.2. Base Deprotection 1. 40% Methylamme 2. Mill1 Q water 3 EtOH/MeCN/H,O.

in water (Aldrich [Milwaukee, WI]). 3/1/l (v/v/v)

2.3. PI-O-Silyl Deprotection 1. Anhydrous TEA/HF* prepare this solution just prior to use by combining 1.5 mL N-methylpyrrohdmone, 750 pL TEA, and 1.0 mL TEA, 3HF, in this order (all reagents purchased from Aldrich). 2. Qiagen (Chatsworth, CA) desalt: Qragen column, 50 mM TEAB, 2 M TEAB. 3. Prectpttatton from destlylation. 3 M NaOAc, 1-butanol, 70% EtOH.

Wincott and Usman

64 Table 1 2.5 pmol Synthesis

Cycle

Reagent Phosphoramidites S-Ethyl tetrazole Acetic anhydride N-Methyl imidazole TCA Iodme Acetonitrile

Equtvalents

Amount

Wait time

6.5 23 8 100 186 83 2 80 NA

163 /AL 238 pL 233 /AL 233 /.IL 1.73 mL 118mL 667mL

512 5 mm 512.5 mm 5s 5s 21 s 45 s NA

2.4. Analysis 1. Analytical anion-exchange HPLC analysts. Hewlett Packard 1090 HPLC 2. Dionex (Sunnyvale, CA) NucleoPac PA-100 column, 4 x 250 mm, at 50°C Flow rate: 1.5 mL/mm 3 Buffer A* 20 mMNaC104. 4 Buffer B: 300 nn14NaC104 (Fluka [Ronkonkoma, NY]). 5 The gradient should be* Time, min

%B

0.00 5.00 20.00 21 00 23 00 24.00

0.0 38.0 73.0 100.0 1000 0.0

2.5. Purification 1. 2 3. 4. 5. 6

Milli Q water Pharmacia Mono Q@16/l 0 mm or Dtonex NucleoPac PA- 100 22 x 250 mm column Buffer A 10 mA4 NaCIO,. Buffer B. 300 mMNaC104 SepPak cartridge (C,,) (Milhpore, Bedford, MA) CHsCN. CH3CN/MeOH/H20. l/l/l (v/v/v) usmg Mill1 Q water

3. Methods 3.1. Synthesis of RNA and Ribozymes 1 Carry out small-scale syntheses on a 394 (ABI) synthesizer usmg a modified 2.5 pm01 scale protocol with a 5 min couplmg step for 2’-0-TBDMS-protected nucleottdes and 2.5 mm couplmg step for 2’-0-methylated nucleotides (see Note 2). Table 1 outlines the amounts, and the contact times, of the reagents used m

Production of RNA and Ribozymes

65

the syntheses cycle to allow the cycle to be adapted to other instruments A 6 5-fold excess (163 pL of 0.1 M = 16.3 pool) of phosphoramrdrte and a 24-fold excess of S-ethyl tetrazole (238 pL of 0 25 M = 59 5 pool) relative to polymerbound 5’-hydroxyl were used m each coupling cycle. Average couplmg yields on the 394, determmed by colorrmetric quantrtation of the trrtyl fractions, were 97 5-99%. 2 When the ollgonucleotrde 1s synthesized and automatrcally detritylated, remove the column and dry rt with a stream of argon gas

3.2. RNA and Ribozyme Deprotecfion of Exocyclic Amino-Protecfing Groups Using Methylamine 1 Transfer the dried support from the synthesis column to a 4 mL glass screwtop vral (Wheaton). 2. Add 1 mL of methylamme, screw cap on tightly and place m a heat block at 65’C for 10 mm (see Note 3) 3 Remove the vial from the heating block, place m another block at room temperature and put m a -20°C freezer until cooled 4 Decant the solutron mto a 15 mL centrifuge tube. Add 1 mL of EtOH/MeCN/H,O 3/1/l, vortex well, and allow the support to settle Decant, wash, and add to deprotectron solution 5. Repeat the washing two more times 6 Dry the combined supernatants m a Speed-Vat

3.3. RNA and Ribozyme Deprotection of P’-O-Silyl Groups Using Anhydrous

TEA/HF

1. Resuspend the base deprotected oligorrbonucleotrde in 250 & of anhydrous TEA, 3HF/NMP solutron, m a 15 mL centrtfuge tube (see Note 4) 2 Place the tube m a heatmg block at 65°C for 1 5 h 3. After heating, either precipitate drrectly from the desilylation reaction (steps 4-6 below) or quench with 9 mL of 50 mM TEAB prtor to amon exchange desalting (steps 7 and 8 below and see Note 5) 4 For preciprtation, add 25 & of 3 MNaOAc, followed by 1 mL of n-butanol to the destlylatton reactron. 5 Cool the mtxture to -70°C for 1 h, and then centrifuge at 4”C, 10,OOOgfor 30 mm. 6 Decant the supernatant, wash the pellet with 70% EtOH, and then dry it. 7. For amon-exchange desalting of the deprotected ohgomer, load the quenched reaction m TEAB onto a Qragen 500@’ anion-exchange cartridge that had been prewashed with 10 mL of 50 mM TEAB 8 Wash the loaded cartridge with 10 mL of 50 mMTEAB , and elute the RNA with 10 mL of 2 M TEAB Then dry to a white powder (5) in a vacuum centrifuge.

3.4. RNA and Ribozyme Analysis and Purification 1 Dissolve the crude material m 5 mL of RNase-freewater. 2. Inlect the sample onto either.

Wincott and Usman

66

3.

4. 5. 6 7.

a. Pharmacta Mono Q 16110 mm; or b. Dtonex NucleoPac PA- 100 22 x 250 mm column wtth 100% buffer A (10 mA4 NaCIO,). Elute the RNA using a gradient from. a 180-210 mM NaClO, at a rate of 8 mL/min for a Pharmacta Mono Q amonexchange column. b 100-l 50 mA4NaC10, at a rate of 15 mL/mm for a Dionex NucleoPac amonexchange column Analyze fractions by HPLC, and pool those containing full length product (280% by peak area) for desaltmg. Apply the pooled fractions to a C,, SepPak cartridge that had been prewashed successively with CH,CN (10 mL), CH.$N/MeOH/H,O:l/l/l (10 mL), and RNase-free H,O (20 mL). Following sample apphcatton, wash the cartridge with RNase free H,O (10 mL) to remove the salt. Elute the product from the column wtth CHsCN/MeOH/H,O.l/l/l (10 mL) and dry.

4. Notes 1. Critical to the successful production of RNA is the use ofproper handling techniques. No adventitious water must be allowed to come m contact with the oligomer durmg synthesis Therefore, all reagents and bottles must be kept dry and under argon. 2 In Table 1, watt time does not include contact ttme during delivery. Where two couplmg times are indicated, the first refers to RNA couplmg and the second to 2’-O-methyl couplmg. 3 During base deprotection, the cap on the Wheaton vial must be tightly sealed to avoid loss of contents. 4 When preparing the TEA, 3HF/NMP destlylatton solution, the components must be combined in the order specified. In addition, if the reagent IS not used nnmedtately after preparation, store tt m a warm (5565°C) heating block, capped The reagent will form an intractable gel if allowed to stand at room temperature. 5 Once the ohgomer 1sfully deprotected, special precautions must be taken to avoid degradation by nucleases. Gloves should be worn at all times and Mtlli Q water should be used.

References 1. Cech, T. (1992) Rrbozyme engineering Curr Opwon Struct Blol 2, 605-609. 2. Usman, N. and Cedergren, R. J. (1992) Explottmg the chemical synthesis of RNA Trends Blochem SCI 17,334-339

3. Wincott, F., DiRenzo, A , Shaffer, C., Grimm, S , Tracz, D., Workman, C , Sweedler, D., Gonzalez, C., Scarmge, S., and Usman, N (1995) Synthesis, deprotectton, analysis and purtficatron of RNA and ribozymes. Nucleic Acids Res 23,2677-2684. 4. Usman, N., Ogilvie, K. K., Jtang, M -Y , and Cedergren, R J. (1987) Automated

chemical synthesis of long oligoribonucleotides

using 2’-O-silyl-rtbonucleoside-

Production of RNA and Rbozymes

5

6.

7.

8.

9.

10.

11

12 13

14

15.

16

17.

67

3’-O-phosphoramrdites on a controlled-pore glass support: synthesis of a 43-nucleonde sequence srmrlar to the 3’-half molecule of an Escherichla toll formylmethtonine tRNA J. Am Chem Sot 109,7845-7854. Scaringe, S A , Francklyn, C , and Usman, N. (1990) Chemical synthesis of btologrcally actrve ohgorrbonucleottdes using j3-cyanoethyl protected rrbonucleosrde phosphoramrdites Nuclezc Acids Res 18, 5433-534 1. Andrus, A., Beaucage, S., Ohms, J , and Wert, K. (1986) A servesof 5’-substttuted tetrazoles for phosphoramrdrte activation during oligonucleotrde synthesis American Chemical Society Meeting, New York, April 1986, Organic Divisron, Abstract 333. Sproat, B , Colonna, F , Mullah, B , TSOU, D., Andrus, A., Hampel, A , and Vmayak, R (1995) An efficient method for the rsolatron and purification of ohgorrbonucleotrdes. Nucleoszdes & Nucleoades l&255-273 Gasparutto, D , Livache, T , Bazin, H., Duplaa, A.-M., Guy, A., Khorlm, A , Molko, D., Roget, A , and Teoule, R. (1992) Chemical synthesis of a biologtcally actrve natural tRNA with its minor bases Nuclezc Aczds Res. 20, 5 159-5 166. Wu, T., Ogtlvie, K. K , and Pon, R. T. (1988) N-Phenoxyacetylated guanosme and adenosme phosphoramidrtes in the solid phase syntheses of olrgoribonucleotides. synthesis of a ribozyme sequence Tetrahedron Lett 34,4249-4252. Chatx, C., Duplaa, A. M., Molko, D., and Teoule, R. (1989) Solid phase synthesis of the 5’-half of the mrttator t-RNA from B sub&s. Nuclezc Acids Res. 17, 7381-7393. Smha, N. D , Davis, P , Usman, N., Perez, J., Hodge, R., Kremsky, J., and Casale, R. (1993) Labtle exocychc amme protection of nucleosrdes in DNA, RNA and oligonucleotide analog synthesis facilitating N-deacylatron, mmimrzmg depurination and chain degradation. Bzochzmze 75, 13-23. Reddy, M. P , Hanna, N. B., and Farooqur, F (1994) Fast cleavage and deprotection of oligonucleotrdes Tetrahedron Lett 55,43 1143 14. Westman, E and Stromberg, R (1994) Removal of t-butyldrmethylsrlyl protection m RNA synthesis Trrethylamine trihydrofluorrde (TEA, 3HF) 1sa more reliable alternative to tetrabutylammonium fluoride (TBAF) Nuclezc Aczds Res 22, 2430-243 1 Vinayak, R , Andrus, A , and Hampel, A. (1995) Rapid desrlylatton of ohgoribonucleotrdes at elevated temperatures: cleavage activtty in ribozyme-substrate assays. Blomedxal Peptides, Proteins and Nucleic Acids 1,227-230 Odat, 0 , Hiroaki, H., Sakata, T , Tanaka, T., and Uesugr, S (1990) The role of a conserved guanosme residue m the hammerhead-type RNA enzyme FEBS Lett 267, 150-152. Korzumr, M and Ohtsuka, E (1991) Effects of phosphorothioate and 2-amino groups m hammerhead rrbozymes on cleavage rates and Mg2+ binding. Biochemzstry 30,5145-5150. Usman, N., Egli, M , and Rich, A (1992) Large scale chemtcal syntheses, purtfication and crystallization of RNA-DNA chimeras. Nuclezc Acids Res 20, 6695-6699

68

Wincott

and Usman

18. Slim, G. and Gait, M. J. (1991) Configurationally defined phosphorothioate-containmg oligortbonucleotides m the study of the mechamsm of cleavage of hammerhead ribozymes Nuclezc Aczds Res 19, 1183-l 188 19. Hall, K. B. and McLaughlin, L. W (1992) Properties of pseudouridme Nl ammo protons located m the major groove of an A-form RNA duplex Nuclezc Aads Res 20, 1883-1889. 20. Fu, D.-J and McLaughlm, L W (1992) Importance of specttk adenosme N7mtrogens for efficient cleavage by a hammerhead ribozyme A model for magnesium bmdmg Blochemzstry 31, 10,941-10,949. 2 1, Pon, R T., Usman, N , and Ogtlvie, K K. (1988) Derwmzation of controlled pore glass beads for sohd phase ohgonucleotide synthesis BzoTechnzques 6,768-775

Preparation of Templates for Production of Ribozymes and Substrates Rajesh K. Gaur and Guido Krupp 1. Introduction Transcrrptron by DNA dependentbacteriophage RNA polymeraseshas become a very powerful technique m molecular biology. Smgle-stranded RNAs generated by m vttro transcriptton can be used as substratesin a variety of experiments ranging from sphcmg and translation to structural studies.This chapter describesmethods for the preparation of templates suitable for in vitro transcriptton. The methods described m the followmg protocols are based primarily on the use of bacteriophage T7 RNA polymerase as the transcribing enzyme (I). For other phage polymerases, their cognate promoter sequence must be used, and optimal results may require minor changes in the transcription conditions. Three different template types can be used for in vitro transcription: plasmtds, polymerase chain reaction (PCR) products, and synthetic DNA templates. Each template has distinct advantages, depending on the investigator’s requirements. Long RNAs can be prepared as “run-off’ transcripts from linearized plasmtds. PCR-generated DNA templates provide a fast approach with certain hmitattons (see Section 3.2.). Synthetic DNA templates can provide a convenient alternative to the more costly and cumbersome chemical synthesis of short RNAs. As described here and in Chapters 10 and 12, in vitro transcription can provide the flexibility needed to produce a variety of RNAs, including znsitu 5’-terminal or internal labeled RNAs and transcripts with defined 5’-terminal sequences.Partial and quantitatively controlled modified transcripts can also be produced. 2. Materials Multicopy plasmid vector, restrrctron enzymes, T4 DNA ligase, competent E’scherichia co& cells (JM 109), IPTG, X-Gal, RNasm, T7 RNA polymerase, From

Methods Edited

by


Ecology, Vcl 74 Rbozyme Humana

69

Press

Inc , Totowa,

Pfotocc/s NJ

70

Gaur and Krupp

dithiothreitol (DTT), and RNase-free RQl DNase were obtained from Promega (Madison, WI); calf intestinal alkaline phosphatase, 10X dephosphorylation buffer, and Tuq DNA polymerase were obtained from Boehringer (Mannheim, Germany); NTPs, dNTPs, and NP-40 were procured from Pharmacia Biotech (Uppsala, Sweden), and Sigma (St. LOUIS,MO), respectively. The alkaline lysis method (2,.3)or any commercially available kit can be used for plasmid isolation. For electroporation, we prefer the BRL (Gaithersburg, MD) cell-porator. PCR amplifications require a DNA Thermal Cycler (e.g., Perkm Elmer, Norwalk, CT). Ohgonucleotides can be obtained from commercial sources or synthesized m-house if a DNA synthesizer is available (e.g., Applied Biosystem’s model ABI 39 1, Foster City, CA) 1 RNA elution buffer 0 5 MTris-HCl, pH 7 0, 0 1% (w/v) SDS, 0 1 mMEDTA, 1 mMMgC12. 2 10X Transcriptton buffer: 400 mM Tris-HCl, pH 8 0, 200 mA4 MgCl,, 20 mM

spermidine. 3 10X PCRamphfication buffer: 500 mMKCI, 100 mMTrrs-HCl, pH 8.3,15 mMMgClz 4 5X Ligation buffer: 100 mM Trts-HCl, pH 7.4, 25 r&4 MgCl,, 5 mM DTT, 2 5 mM ATP, 250 ug/mL BSA 5. TE 10 mM Tris-HCI, pH 8 0, 1 mM EDTA 6. DEPC-treated water (see Note 1) 7 Restriction enzyme buffers (see Note 2) 8. IOX Dephosphorylation buffer: 500 mA4Tris-HCl, pH 8 5, 1 mA4EDTA. 9. Phenol/CHCls* phenol:CHCI,:isoamyl alcohol in the ratio 50 49.1 with 0.1% 8-hydroxyquinoline 10 CHC13/isoamyl alcohol. CHCls*isoamyl alcohol in the ratio of 24 1 11. Polyacrylamide gel loading buffer 8 Murea, 0.03% tracking dyes (bromophenol blue and xylene cyanol). 12. Luna-Bertani (LB) medium. 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 5 g NaCl in 1 L water, adjusted to pH 7.5 with NaOH, and autoclaved

3. Methods 3.7. Preparation of Plasmid DNA Template Single-stranded RNAs encoded by virtually any cloned DNA molecule under the control of a T7 or SP6 promoter can be obtained by m vitro transcription (4,5). The DNA sequenceof interest is cloned downstream of the T7 or SP6 promoter into the multiple clonmg site of a multicopy plasmid (Fig. I), and the recombinant plasmid is linearized with a suitable restrtction enzyme to allow “run-off’ transcription. Restriction enzymes that generate blunt or S-overhangs should be selected for lmeartzing plasmtd DNA, since endonucleasesthat generate 3’-protrudmg ends (for example KpnI or &I) may result in the addition of extraneous sequences (6). We recommend

phenol/chloroform

extraction followed by ethanol

precipitation of the restricted DNA template prior to the transcription reaction.

71

Templates for Ribozymes and Substrates

Lmearm enzyme

wth restnctlon T?

SP6 I

,

I

Fig. I. Structure of pRG recombmant plasmtd for m vttro transcriptton reacttons. The gene of interest 1s cloned mto the multiple cloning site of the vector. Arrows indicate the dtrectton and start points of T7 and SP6 RNA polymerase-dependent transcription The j3-lactamase gene, which confers ampicillin resistance, is denoted as Amp’ The multiple cloning site within the LacZ gene allows blue/white screening for recombmants. The linearized DNA thus serves as a template for runoff transcription by either T7 or SP6 RNA polymerases

RNA transcripts from cloned DNA templates will generally include several 5’- and 3’-nucleotrdes from the multiple clonmg site of the vector. It is posstble, however, to obtain RNA transcripts with correct 5’- and/or 3’-ends by placing the sequence of interest in the plasmid in such a way that transcription begins within the desired region (7).

3.1.7. Cloning of DNA for In Vitro Transcription Digest the DNA fragment and the tion enzymes to generate compatible for recombinants, the DNA insert and different restriction enzymes to allow

plasmid vector with appropriate restricends for cloning. To simplify screening vector should each be digested with two directional clonmg.

1. Set up restnctton digests in mlcrotirge tubes in a total volume of 50 pL. by adding. 10.0 pL (5-10 pg) Plasmtd vector or DNA fragment 2.5 $ (10 U/pL) Restrictton enzyme 1OX Restriction enzyme buffer 5.0 pL Water (to 50 pL) 325 pL 2 Incubate the reaction mixture for l-2 h at the temperature appropriate for the restriction enzyme

Gaur and Krupp

72

3 For the lmeanzed vector only, to prevent self-ligation, add the following components directly to the above reaction mixture: 1OX Dephosphorylatlon buffer 10 ClL 1 U/l 00 pmol for S-protruding ends Alkaline phosphatase and 1 U/2 pmol for recessed ends 100 pL Water to final volume 4 Incubate for 60 mm at 37’C, followed by 30 mm at 55°C 5. Terminate the reactlon with 4 pL of 250 mM EDTA. 6 Extract the reaction mixture with 1 vol of phenol/chloroform. 7 Mlcrofuge the reaction for 2 mm to separate the phases and transfer the top layer to a new tube 8. Extract once with chloroform/lsoamyl alcohol (24-l) 9. Precipitate by adding 2 5 vol of 100% ethanol. 10 Collect the DNA by centrifugation at >lO,OOOg for 10 mm, wash the pellet with 70% ethanol, dry, and dissolve in TE at about 50-100 ng/pL.

3.1.2. Ligation of Plasmid Vector and DNA We recommend 1:2 and 1:5 molar ratio of vector to insert and a control without insert for the ligation reaction. 1 Set up the followmg 10 pL reactlon: 1 p.L (50-100 ng) Linearized vector DNA insert 2N5X Ligation buffer 2cLL Water 4& T4 DNA ligase (1 U/c(.L) 1 pL 2. Incubate for 5 h at 16°C 3. Add 1 & ofE colz tRNA (100 ng/pL), 2.5 pL of 2 MNaCI, 36.5 pL of water, and 150 pL of ethanol. 4 Mix and Incubate for 15 mm at -70°C 5 Collect the DNA pellet by centnfugatlon at >lO,OOOg for 10 mm, and wash the pellet with 70% ethanol 6. Dissolve the dried DNA pellet m 5 pL of water

3.7.3. Transformation

and Plasmid Isolation

Many protocols are available for bacterial transformation (8,9). We use the electroporatlon technique developed by Dower et al. (IO), since it gives higher transformation efficiency than the method employing calcium chloride-treated cells (II). Electroporation should be done as follows. 1 Thaw 25 pL of competent cells (JM 109 strain, Promega, Madison, WI). 2 Add 1 pL of the ligation reaction (Section 3 1.2 ), and subject the mixture to electroporation according to the instructions provided by the manufacturer (BRL, Galthersburg, MD)


73

3 Mix the cells with 1 mL of LB m a sterile tube 4. Incubate at 37°C for 30 mm 5 Plate 50-100 pL of the cells on an LB plate contammg 50 pg/mL amplclllm, 0.5 mM IPTG, and 40 pg/mL X-Gal Incubate at 37°C for 12-16 h 6 Select the recombinant colonies that are white. 7. Grow a single colony in 1 5 mL of LB medium containing 50 pg/mL ampicillin. 8. Isolate the plasmid DNA using an alkaline lysls method (2,3) Usually, 10-12 pg of DNA can be obtamed startmg with 1.5 mL of culture (see Note 3) 9 Verify the presence of the desired insert by restriction digestion of the plasmld followed by analysis of the reaction products by agarose gel electrophoresls

3.1.4. Linearization of Plasmid DNA 1 Digest 10-20 pg of the recombinant plasmid with the appropriate restriction enzyme that cleaves at the 3’ end of the desired sequence (see Notes 4 and 5) 2 Extract the reactlon mixture twice with 1 vol ofphenol/chloroform and once with chloroform/isoamyl alcohol. 3 Add 0.1 vol of 3 M sodium acetate (pH 5 2) and 2 5 vol of cold ethanol. 4. Chill for 5 mm on dry ice, and then mlcrofuge for 10 mm at 4°C. 5 Wash the pellet with 70% ethanol, dry, and dissolve the dried pellet m TE to a final concentration of 1-2 pg/*.

3.2. PCR for Custom Made DNA Template PCR has become a powerful tool for producmg template DNA suitable for m vitro transcription (12-14). PCR-based template preparation obviates the requirement of lengthy clonmg steps and allows the mtroductton of mutations technique

using altered PCR primers. The most important advantage of this 1s that RNA transcripts with defined ends can be obtained from

virtually any part of a specific gene. Moreover, by selecting the proper PCR primers, restriction sites for clonmg can be created m the DNA template (see Note 6). The strategy for constructmg a DNA template usmg PCR is shown m Fig. 2. The 5’-upstream forward primer (see Note 7) consists of T7 RNA polymerase promoter sequence followed by 15-20 nucleotides of the sequence from the desired region. By mtroducmg changes m the nucleotide sequence (no changes should be made m the promoter region) of the forward primer, it IS possible to generate specific mutations at the 5’-end of the template. The reverse primer consists of about 20 nucleotides and can be used to create mutations at the 3’-end of the template. Owing to the absenceofproofreadmg activity, Taq DNA polymerase can introduce mutations during the PCR amplificatron. Thus, for very long RNAs where base substitution cannot be tolerated, DNA polymerase with a lower mutation frequency, such as Pfu (Stratagene, La Jolla, CA), may be employed (15).

Gaur and Krupp

74

Target S----3’-----

DNA

AATACACGGAnrrCG---------TTATGTGCCTTAAGC ----------

3’

3’ -

AAAGGTCACCCCTAGG-----3 Tl-fCCAGTGGGGATCC -----5 TTTCCAGTGGGGATCC5’

I

PCR amphflcation buffer, dNfPs and Taq polymense

5’ TAATACGACTCACTATAG AATACACGGAAl-KG 3’AlTATGCTGAGTGATATCTTATGTGCCTTAAGC

- -- - - - - -- ----------

AAAGGTCACCCCTAGG lTKCAGTGGGGATCC5

3’

PCR template

Fig. 2. Construction of PCR-synthesized DNA template. The DNA sequence to be transcribed IS contained m a circular plasmid. Two synthetic oligonucleotide primers (forward and reverse) are designed such that each contains 15-20 nucleotides of template sequence. The forward pnmer contains a bacteriophage T7 RNA polymerase promoter sequence (bold letters), and the reverse primer represents the antisense strand of the template. In the first cycle, the bacteriophage T7 promoter sequence will not anneal to the template After 25-30 cycles, the target DNA is amplified as a linear DNA with a T7 promoter upstream of the sequence of interest

3.2. I. Protocol for PCR Amplification 1 For a 100~pL PCR reaction, rmx the followmg components in the order given below 1OX PCR buffer 10 FLL Forward primer 10 pL (100 pmol) Reverse primer 10 i.tL (100 pmol) 1OX dNTPs (2 rnM each) 10 dWater 57 GIL 1% NP-40 loa DNA template 1.0 pL (IO-20 ng1l.L) 1.0 pL (5 II/&) Tag polymerase 2. To prevent evaporation, put a layer of mineral oil (SO-100 pL) on top of the reaction mixture 3 The reaction should be cycled as follows: 25 cycles consisting of 94°C for 1 mm (denaturmg step), annealing temperature depending on the template and primer length (see Note 8), followed by 72’C for 1 mm (the extension step optimum for template of 1 kb). 4. Carefully remove the mineral oil and extract the reaction mixture twice with phenol/chloroform, once with chloroform, and followed by ethanol precipitatton

75

Templates for Ribozymes and Substrates Top rtrsnd containing pmmoter region -17 5’ TAATACGACTC*cr*T~~

Bottom strand and template

3’

containing sequence

promoter

3’AiTATGCTGAGTGATAkCGTACAGTAGCCG (I) 65’C (II) Cool

for 3 mm/denaturatlon at room temperature/

-17 TAATACGACTCACTAd 3’AllATGCTGAGTGATATCCCGTACAGTAGCCG

5’

step annealing

step

5

Incubate at 37’C wth transcnptlon buffer, NTPs and T7 RNA poiymerase 5’

pppGGGCAUGUCAUCGGC

3’

RNA

Fig. 3. A synthetic DNA template The T7 promoter and template sequence are shown +1 mdrcates the transcription mrtiatlon site. Only the promoter regton need be double-stranded

5 Collect DNA by centrtfugatton at 4°C 6 Dry and dissolve the DNA pellet m 10-20 pL of TE buffer (to avoid denaturanon, do not dissolve m water)

We recommend a trial transcription to check the quality of the PCR-amplrtied DNA template. If the expected product does not appear as a major band, it may be necessary to purify the template DNA by nondenaturmg polyacrylamrde or agarose gel electrophoresrs. 3.3. Synthetic DNA Oligos as Templates A very useful method for making small RNAs of defined length and sequence was developed by Mrlhgan et al. (26,I7) usmg synthetic DNA templates and T7 RNA polymerase (Fig 3). Here the template DNA consists of two synthetrc oligos base paired only m the promoter region (-17 to +l). Thrs method offers a number of advantages: 1 The trme- and labor-consuming steps of clonmg are not required 2. The unwanted S- and 3’-sequences from the vector DNAs of the cloned template are ehminated 3 Unltke plasmtd DNA templates, the nucleotide cornpositron of the 5’ and 3’end of the RNA can be specifically chosen. 4 Synthesis of both strands of the template DNA 1s not necessary, since only the promoter region (-17 to -1) of the template must be double-stranded.

76

Gaur and Krupp

Thus, the noncodmg universal top strand, being identical for each template, can be synthesized on a large scale. 3.4. Selection of DNA Template for Transcription Since a full description of the standard protocol for transcription, RNA isolation, and purification is given in Chapter 10 (Section 3.1.), we complete this chapter with a discussion of the effect of template type on the yield and efficiency of transcription. In our experience, the efficiency and overall yield of transcripts from plasmid DNA templates are better than that from PCR-amplified or synthetic DNA templates. Furthermore, double-stranded DNA templates (plasmids or PCR products) usually give higher yields than the synthetic DNA templates containing only a short 18-bp double-stranded region. Similar observations have been made by others, using T7 or SP6transcrtption system(18,19 and see Note 9). Since the molar massof a PCR or synthetic DNA template is much less than a plasmid template, a lesser mass of these templates should m theory be sufficient to obtain yields similar to plasmid templates. However, we have observed that a significantly larger amount of short templates is required to obtain best results. For example, m a 50-pL transcription, contammg a 150-200 nucleotide-long template, 5-10 pmol of template are required for optimum yield. In our experience, the yield of the transcription varies for different templates. We recommend a trial transcription to optimize the conditions for a particular template type. For transcripts produced from synthetic or PCR templates, we recommend that the transcription be followed by a DNase treatment step prior to purlfication of the RNA from a polyacrylamide denaturing gel (see Note 10). The first six 5’-terminal nucleotides of the template play a crucial role in determmmg the overall yield and efficiency of the transcription (26,17). Thus, the first encoded nucleotide in any RNA transcript should be a guanosine. However, a number of moditicattons can be introduced mto the 5’ half of the RNA transcript using initiator ohgos m the transcrtption reaction (20-23). For a detailed study based on the use of initiator oligos in transcription reactions,see Pitulle et al. (24). 4. Notes 1. Treat deionizedwater with 0 1%dlethyl pyrocarbonatefor 12-14 h at 37°C followed by autoclavmg for 30 mm. 2. Virtually all companiesprovide individual buffers or buffer setsfor then enzymes as 10X stocksolutions. 3. In general, most small-scale mmiprep plasmid isolation protocols include an RNaseA treatmentstepto digestbacterial RNA. Before using the plasmid DNA template for transcription, we strongly recommend protemase K treatment (5-100 &mL, at 37°C for 1 h) followed by phenol/chloroform extraction.


77

4 Complete digestion of plasmld DNA with restriction enzyme is very Important Trace amounts of supercoiled plasmld DNA will allow production of long transcripts, thus reducing the yield of the desired RNA. 5. Protruding 3’-terrmm generated by certain restrictlon enzymes can be converted to blunt ends by the Klenow fragment of E colz DNA polymerase I (25). 6 PCR-amplified DNA can be cloned directly (26) mto commercially avallable cloning vectors, such as pNoTA/T7 (5 prime + 3 prime, Boulder, CO). 7 Incomplete deprotectlon of oligonucleotldes used as PCR primers or for preparing synthetic DNA template can result in abortive products 8. As a rough estimation, the annealing temperature is calculated based on total number of pyrimidine and purme bases m a primer. A temperature of 2 and 4°C IS assigned to each pyrimidme and purme nucleotlde, respectively, and the values summed. For example, if a 20-mer primer contains an equal number of purmes and pyrimidmes, then the annealing temperature should be kept between 55 and 60°C. 9 It is possible to obtain fully double-stranded DNA templates from synthetic templates usmg a DNA polymerase (Klenow, T4 or Taq) to extend the shorter, annealed ohgonucleotide 10. When using PCR or synthetic DNA template, a DNase treatment step should be Included after the transcription, since the size of the transcript is only 17 nucleotldes shorter than the template.

Acknowledgments We are thankful to L W. McLaughlm for comments, and Nyaya Kelkar and Scott Walker for crltical reading of the manuscript. References 1 Chamberlin, M. and Ryan, T (1982) Bacteriophage DNA-dependent RNA polymerases, in The Enzymes, vol 15 (Bayer, P. D. ed.), Academic, New York, pp. 87-108. 2. Bnnboim, H. C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening plasmid DNA. Nucleic Aczds Res. 7, 15 13-1523. 3. Ish-Horowitz, D. and Burke, J F (1981) Rapid and efficient cosmid cloning. Nucleic Acids Res. 9,2989-2998 4. McAllister, W. T. and Morris, C. (198 1) Utilization of bacteriophage T7 late promoters m recombinant plasmlds during mfectlon J. Mol. Biol 153, 527-544 5 Melton, D. A., Krieg, P. A., Rebagliati, M. R., Maniatis, T., Zmn, K., and Green, M. R. (1984) Efficient in vztro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. NuclelcAclds Res 12,7035-7056 6. Schenborn, E. T. and Mierendorf, R C. (1985) A novel transcription property of SP6 and T7 RNA polymerases: dependence on template structure. Nuclezc Acids Res. 13,6223-6236. 7. Sampson, J. R. and Uhlenbeck, 0. C. (1988) Biochemical and physlcal characterizatron of an unmodified yeastphenylalanme transfer RNA transcribed zn vzzro Proc Nat1 Acad Scr USA 85, 1033-1037.

Gaur and Krupp

78

8. Alexander, D. C. (1987) An efficient vector-primer cDNA cloning system. Methods Enzymol

154,4 l-64.

9. Sambrook, J , Fritsch, E. F , and Mamatis, T (1989) Molecular Clonzng--A Laboratory Manual Cold Sprmg Harbor Laboratory Press, Cold Spring Harbor, NY 10 Dower, W J , Miller, J F., and Ragsdale, C. W. (1988) High efficiency transfonnanon of E. coli by high voltage electroporation Nuclezc Acids Res 16,6 127-6 145 11 Mandel, M and Higa, A. (1970) Calcmm-dependent bacteriophage DNA mfectton. J Mol Blol. 53, 159-162 12. Mullis, K B. and Faloona, F. (1987) Specific synthesis of DNA zn vttro via a polymerase-catalyzed chain reaction. Methods Enzymol 155,335-350 13 Stoflet, E S , Koeberl, D D., Sarkar, G., and Sommer, S S (1988) Genomic amplificatron with transcript sequencing Sczence 239,49 l-494. 14. Krupp, G., Kahle, D., Vogt, T., and Char, S. (1991) Sequence changes m both flanking sequences of a pre-tRNA influence the cleavage specificity of RNase P J Mol Blol. 217,637-648.

15. Lundberg, K. S , Shoemaker, D. D , Adams, M W. W , Short, J M , Sorge, J A , and Mathur, E J (1991) High-fidelity amphfication using a thermostable DNA polymerase isolated from Pyrococcus furzosus. Gene 108, 16. 16 Mulligan, J. F., Groebe, D R , Witherell, G W , and Uhlenbeck, 0. C (1987) Ohgoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nuclerc Aczds Res. 15,8783-8798 17. Mulligan, J. F and Uhlenbeck, 0 C (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol 180,5 l-62 18. Frugier, M., Florentz, C., Hossemi, M., Lehn, J -M , and Giege, R. (1994) Synthetic polyammes stimulate m vitro transcription by T7 RNA polymerase Nuclezc Acids Res. 22,2784-2790.

19 Stump, W. T. and Hall, K. B. (1993) SP6 RNA polymerase efficiently synthesize RNA from short double-stranded DNA templates. Nucbc AczdsRes.21,5480-5484 20 Harris, M E. and Pace, N. R. (1995) Identification of phosphates involved m catalysis by the ribozyme RNase P RNA. RNA 1,210-218. 2 1 Gaur, R K. and Krupp, G. (1993) Modification interference approach to detect nbose moieties rmportant for the optimal activity of a nbozyme Nuchc AczdsRes.21,2 l-26 22. Gaur, R. K. and Krupp, G. (1993) Enzymatic RNA synthesis with deoxynucleoside-5’-0-(l-throtriphosphates). FEBS Lett. 315, 56-60. 23. Conrad, F , Hanne, A., Gaur, R. K., and Krupp, G (1995) Enzymatic synthesis of 2’-modified nucleic acids: identification of important phosphate and ribose moieties in RNase P substrate Nuclerc Aczds Res. 23, 1845-l 853 24 Pitulle, C , Kleineidam, R G., Sproat, B , and Krupp, G (1992) Initiator ohgonucleotides for the combination of chemical and enzymatic RNA synthesis.Gene112,101-105 25 Telford, J L., Kressmann, A., Koski, R. A., Grosschedl, R , Muller, F., Clarkson, S. G., and Birnstiel, M L. (1979) Delimitation of a promoter for RNA polymerase III by means of a functional test Proc Nat1 Acad Scr USA 76,2590-2594 26 Holton, T A. and Graham, M. W (1991) A simple and efficient method for direct clomng of PCR products using ddT-tailed vectors Nucleic Acids Res. 19, 1156

Enzymatic Synthesis and Characterization of Unmodified Ribozymes and Substrates Guido Krupp 1. Introduction This chapter provides the basic procedures for RNA handling, transcription reactions, and transcript punfkation (1,2). For further analysis, the RNAs can be end-labeled. Simple procedures generate a sequence ladder to confirm colineartty of template and transcript (3,4). This is not a “mere luxury,” since examples with significant template slippage have been reported (5). If a small labeled cleavage product 1s produced, also the exact cleavage sites can be determined (6).

2. Materials 2.1. RNA Synthesis and Purification

of Transcripts

1. Template DNA (see Chapter 9) 2 NTP solutions: convenient ready-made 100 mM soluttons are available (Amersham, Pharmacta, and so forth). 3 100 mM Drthrothreitol (DTT) Prepare with sterile water; do not autoclave; store frozen 4. 10X Transcriptton buffer 400 mJ4 Trts-HCl, pH 8 0, 200 mA4 MgCl,, 20 mM spermrdine 5. Optional: RNase inhibitor, RNasm from human placenta (Boehrmger, Promega, and so forth). RNasm can be useful as a safeguard against RNase contammatton, but careful preparation of soluttons avoids the necessity. 6 50% (w/v) Polyethylene glycol (PEG) (M, 6000). Can be autoclaved; store at 4OC 7 0 1% Trrton X-100. Prepare with sterile water, and store at 4°C 8 [cx-~~P]-NTP. convenient, dye-stained, stabilized solutions are available that can be stored at 4°C (Amersham, NEN-DuPont, Hartmann-Analytic, and so forth). Note: High specific actrvtty [~c-~~P]-NTP is not essential, since an activity of 50 Cr/mmol or greater is sufficient (see Note 1). From


Biology, Vol 74 Rbozyme Protocols Humana Press Inc , Totowa, NJ

79

80 9 T7 RNA polymerase or other phage RNA polymerases (AGS, Boehringer, NE-Btolabs, Pharmacta, and so forth). 10 4 M Ammonium acetate, 20 mM EDTA. Adjust to pH 7 0 and autoclave 11 Ice-cold ethanol (stored at -20°C for rapid coohng) 12 Polyacrylamide gel loading solution: 8 A4 urea, 0 03% tracking dyes (xylene cyanol/bromophenol blue). Prepare with stertle water, and store frozen Small working aliquots can be stored at room temperature 13 Permanent markers for autoradiography. fix tmy pieces of phosphorescent tape (local hardware store) on transparent Scotch tape, and enclose between two layers of Scotch tape. Alternative: use tmy pieces of filter paper, soaked with 14Cmk (mix a radtoactive sample with ink). About 50 pCt/pL are suitable for short exposure times (2-60 min), and 1 pCi/pL for longer exposures 14 Polyacrylamide gel elution buffer O.SMTris-HCl, 0 1 mMEDTA, 1 mMMgCl,, adJust to pH 7 0, autoclave, and then add 0.1% SDS. 15. 3 A4 Sodium acetate, pH 5 0 (autoclave). 16. Optional (see Note 2): high-efficiency transcriptton kit, like AmpliScrtbe (Epicentre), RiboMAX (Promega), and so on 17 Sterile water: dtethylpyrocarbonate (DEPC)-treated water (see Note 3)

2. I. 1. Special Transcription Protocols for Subsequent [5’-32P]-Labeling or for 5’-Modified RNAs (Section 3.1.3.) 1. 2 3 4.

Guanosme, nucleoside (Sigma, Dmucleotide ApG, unmodified Cap analogs m7G(5’)ppp(5’)G Longer, modified, btotmylated, have to be custom-synthesized

2.2. End-Labeling

Boehrmger, and so forth). (Sigma, USB) (Pharmacta) or fluorescent-labeled nutiator oligonucleotides or made m-house (7)

of RNA

1 5 pg/pL Glycogen, molecular-btology-grade 2 4 M Ammonium acetate, pH 7.0 3 Ice-cold ethanol.

(Boehrmger)

2.2.1. 5’-Labeling Additional

matertals

for 5’-labeling:

1. 1 M Trts-HCl, pH 8.0 2 0 2 A4 MgCl,, 32 mM spernudme. 3 [Y-~~P]-ATP with h’ig h specific activity, at least 3000 Ct/mmol (Amersham, ICN, NEN-DuPont, Hartmann-Analytic, and so forth). 4. T4 polynucleotide kinase (PNK) (NE-Btolabs, Boehnnger, Pharmacta, and so forth)

2.2.2. 3’-Labeling with T4 RNA Ligase 1. Deiomzed dimethylsulfoxide (DMSO): In a microfuge tube, mtx about 1 mL of DMSO with about 100 pL of mixed-bed ton-exchange resin, like Amberlite MB-l (Serva) or AG 501-X8 (D) (Bto-Rad). Store wtth the resm at room temperature

Unmodified Ribozymes and Substrates

81

2 Denaturatlon mix: 20 pL,of deiomzedDMSO, 10 pL of 60 mM HEPES-KOH,

pH 8.3 3 RNA ligation buffer 120 mA4HEPES-KOH, pH 8 3,25% delomzed DMSO, 10 & DTT, 30 mMMgCl,, 30 pg/mL RNase-free BSA or autoclaved gelatine. 4 150 @4ATP 5. [5’-32P]-pCp with high specific activity, at least 3000 Wmmol (Amersham, ICN, NEN-DuPont, Hartmann-Analytic, and so forth) 6 T4 RNA ligase (NE-Blolabs, and so forth)

2.2.3. 3’4abeling

with Yeast PO/Y(A) Polymerase (PAP)

I 5X PAP reaction buffer 100 WTns-HCI, pH 7.0,250 mMIW3.5 mMMnCl*, 1 WEDTA, 0 5 mg/mL RNase-free BSA (or autoclaved gelatme), 50% glycerol. 2. “Cordycepm-5’-triphosphate,” [a-32P]-3’-dATP at 5000 Wmmol (NEN-DuPont). 3 Yeast PAP (Amersham, USB).

2.3. Generation and Analysis of Sequence Ladders 1. Carrier RNA, e.g., tRNA from yeast(Boehringer). 2. Tl buffer. 8 A4 urea, 1 mM Na,EDTA, 20 mM sodium citrate, pH 3 5, 0 03% tracking dyes (store frozen). 3 RNase Tl (Boehrmger, Pharmacla, and so forth) 4 Alkali mix. 20 pL. of 9 Murea, 7 5 mL of 200 miVNaOH, 1 5 pL of water and 1 pL of 1% tracking dyes

3. Methods For synthesizmg and handling of RNAs, all equipment items (like plpet tips, microfuge tubes, glassware) and, where appropriate, solutions should be autoclaved. Plasticware can subsequently be dried m an oven (at SO’C). For glassware, baking at 120°C can replace autoclaving. For solutions that cannot be autoclaved (nucleoslde tnphosphates, DTT, spermidme, and so on), the solids are weighed out in sterile containers and dissolved in sterile water or buffer and/or filter-stenlized. Teflon-coated magnetic stir bars can be decontaminated by soaking overnight in a solution of about 20% (w/v) KOH m 50% ethanol and rinsing with sterile water. Glass plates for polyacrylamlde gels can be cleaned with ethanol, but no further precautions are required to remove nucleases. 3.1. Synthesis and Purification of Transcripts The same protocols can be used for the three different template types (plasmlds, double-stranded PCR products, partially double-stranded ollgonucleotldes) described in Chapter 9. It is only important to control the molar amounts. For example, 1 pmol corresponds to 2 B of a 3000 bp transcription plasmid, or to 40 ng of a 60 bp oligonucleotide template.

82

KruPP

For the synthesis of standard transcripts, use sections 3.1.1. or 3.1.2. If subsequent 5’4abelmg is Intended, use the modification m Section 3.1.3. 3.1.1. Standard Protocol for Preparative RNA Synthesis (High Molar Amounts with Low Specific Radioactivity) If very high amounts of RNA are needed, specialized condltlons may be superior (see Note 2). For a 100~p.L transcription reaction, combme the following soluttons m a sterile microfuge tube (see Note 4): a 1 pmol of template (for higher RNA yields, a moderate increase to about 10 pmol is suggested). b. 10 pL of 100 mMDTT. c 10 p.L of NTP mix (containing 20 & of each NTP). d Sterile water (calculate the required amount and add before the 10X transcription buffer; otherwise the DNA may precipitate wtth spermidine) (see Notes 3 and 4) e. 10 pL of 10X transcription buffer f. Optional: 50 U of RNasm g 16 pL of 50% PEG h 10 p.L of 0 1% Triton X-100 1. l-5 pCi of [u-32P]-NTP (this is a negligible molar amount, and the specific activtty is unimportant) (see Note 5). J 200 U of phage RNA polymerase (T7, SP6, and so forth, according to your template). Incubate for 1 h at 37’C (may be increased up to 5 h) Stop (see Note 6) by ethanol precipitation from high salt, which removes most of the unincorporated label. Add 100 pL of 4 M ammonium acetate, 20 mA4 EDTA, and 500 pL of ice-cold ethanol. MIX thoroughly and chill on dry ice for 15 mm (or at -70°C for 30 mm or -20°C overnight), microfuge for 15 mm, and remove the supernatant. Dry the pellet m a vacuum centrifuge, and dissolve m 10-20 pL of polyacrylamide gel loading solution Boil for 2 min in a water bath (avoid vigorous bubbling, smnnermg is sufficient) and spin down brtefly Load onto a standard denaturmg polyacrylamide sequencing gel (thickness up to 0 5 mm). Use 20% gels for transcripts up to about 50 nt, 8% for up to 400 nt, and 4% for larger RNAs (see Note 7) To ensure alignment of film and gel for autoradiography, apply permanent radioactive or phosphorescent markers, and expose for 0 5-16 h as necessary. Localize the desired transcript, excise the correspondmg gel piece with a sterile scalpel, and transfer it to a microfuge tube For RNA elution, add 200 pL of polyacrylamide gel elution buffer Agitate vigorously overnight at room temperature Mtcrofuge for a few seconds, remove the solution mto a fresh tube, rinse the gel piece with 100 pL of fresh elution buffer and combme.

Unmod/fied Ribozymes and Substrates

83

10. Precipitate by adding 20 pL of 3 A4 sodium acetate, pH 5.0, and 750 pL of ethanol, and chill as m step 3 above (see Note 8). 11. Microfuge for 15 mm, and remove the supernatant. 12. The yields of 32P-labeled transcripts can be determined by measurmg the Cerenkov radiation The RNA is dtssolved m a standard volume of water (e g , 100 pL,), and it is used directly m a scinttllation counter. No scmtillatton cocktail IS required. The counting efficiency is about 50%. This means l,OOO,OOOcpm are equivalent to 1 @I. Reasonable yields are between 10-100 pmol RNA/pm01 template DNA (see Note 9)

3.1.2. Standard Profoco/ for Synthesis of RNA with High Specific Radioactivity Follow all procedures in Section 3.1.1.) but make the following changes: 1. Replace the standard NTP mrx by NTP labelmg mrx (contaimng 10 mh4 ATP, CTP, GTP, and only 0.2 mM UTP) (see Note 1). 2. Use a high amount of [w~~P]-UTP, e.g., 10-100 uCi. 3 The expected exposure times for autoradiography vary between 1 and 30 mm.

3.1.3. Special Transcription Protocols for Subsequent [5’-32P]-Labeling or for 5’-Modified RNAs For 5’-labelmg, T4 polynucleotide kmase is used to transfer the terminal phosphate group from [Y-~*P]-ATP to a free 5’-hydroxyl of the RNA. Conventional transcripts carry a 5’-triphosphate. In principle, it can be removed by phosphatase

treatment.

However,

for a more convement

procedure with high

labeling efficiencies, RNA IS synthesized directly with a free 5’-hydroxyl group. This can be achieved m two ways. As described in Section 3.1.3.1,) an excess of free guanosine nucleoside is included m the transcription reaction, and it can (partially) replace the 5’-termmal, initiating GTP (8). An alternative with improved efficiency is outlined m Section 3.1.3 -2. In this case, an extra 5’-terminal nucleoside will be added. Here, an Initiator dmucleotide (e.g., ApG) is used, which will quantitatively replace the initiating GTP (7). As outlined in Sections 3.1.3.3. and 3.1.3.4., the same strategy can be used to obtain 5’-capped RNAs (9), to add a longer 5’-terminal sequence, and to introduce site-specific, 5’-proximal nucleotide modifications or nonradioactive labels, like biotin or fluorescein (7). Follow all procedures in Section 3,l. 1.) but make the followmg changes: 3.1.3.1.

TRANSCRIPTS WITH A FREE 5’-HYDROXYL GROUP

A ratio of 1O:l for guanosine:GTP is required. Replace the standard NTP mix to obtain 100 uM GTP (final concentration), and include 1 mM guanosme (final concentration) (Section 3.1.1.) step 1c).

84

K~UPP

The lowered GTP concentration will reduce the total transcript yield, but higher concentrations of the moderately soluble nucleoside guanosme are impracttcable. The yteld of labeled product (cpm per transcription reaction) is comparable to the two-step procedure with phosphatase treatment. 3.1.3.2.

TRANSCRIPTS WITH A FREE 5’-HYDROXYL GROUP AND AN EXTRA ADENOSINE

Include the dmucleotide ApG at an amount equimolar with GTP (Section 3.1.1.) step lc). No other changes are necessary. 3 1.3.3. ADDITION OF A ~-CAP STRUCTURE

Similar to the use of guanosme, an excessof 5: 1 for cap:GTP is suggested. Reduce the GTP to 100 pJ4 GTP, and mclude 500 pM cap dinucleotide (Section 3.1.1., step lc). 3.1.3 4 5’-EXTENDED OR 5’-MODIFIED RNAs

1 The phagepolymeraseshave ahigh preferenceto initiatewith guanosine.It is almost

impossibleto obtain adifferent 5’4ermmal nucleotide;only adenosineISaccepted, but a high excess of ATP over GTP was required to obtam uniform S-ends (I) 2 The addttton of mtttator ohgonucleotides (like ApG) gives more flexibihty Also longer oligonucleotides can be used (up to hexamers have been analyzed), only the 3’-terminal G must be maintained to replace the uuttating GTP. In addition, modtfications can be introduced, like 2’-deoxy-, 2’-O-methyl-, btotmylated, and more recently, fluorescent-labeled nucleotides. For more details, please consult ref 7 (see also Chapter 12).

3.2. End-Labeling 3.2.1. 5’-Labeling

of RNA (See Note 10)

A transcript with a free 5’-hydroxyl group should be used (see Section 3.1.3.). About 105-lo6 cpm can be expected from I pmol RNA. 1 Use about 1 pmol of transcript (with 5’-hydroxyl), add 1 pL of 1 MTns-HCl, pH 8 0, and water to obtain 8 pL

2. Heat-denatureby boiling for 2 mm, and chill on ice. Sptn down briefly. 3. Add 1 pL of 0.2 M MgC&, 32 mM spermrdme, 1 pL of 100 n&Y DTT, 3 pL (10-50 pCi) of [y-32P]-ATP (use htgh spectfic activity, at least 3000 Wmmol), and 1 pL of T4 polynucleottde kinase (10 U). 4. Incubate for 30 min at 37°C. 5 Terrnmate by ethanol precipttation from htgh salt by addmg 1 pL of (5 pg/pL) glycogen (as carrier), 14 pL of 4 A4 ammonmm acetate, pH 7 0, and 70 pL of ethanol. 6. Mix thoroughly, and chill on dry ice for 15 min (or at -70°C for 30 mm or -20°C overnight) 7 Micromge for 15 min, and remove the supernatant.


85

8. Proceed wrth gel purlficatton as described m Sectron 3 1.1 starting at step 4. 9 The expected exposure times for autoradtography should be 1 to 20 min

3.2.2. 3’-Labeling with T4 RNA Ligase This method gives good labeling efficiencies with short RNAs, although 3’-terminal urrdines should be avoided. The alternative procedure with poly(A) polymerase should be considered especially for long RNAs (Section 3.2.3.). 1 Take 1 & (about 1 pmol) of transcript in water, and mix with 1 pL of denaturation mix. 2. Heat-denature by borlmg for 2 mm, chill on me, and then spin briefly 3. Add 2 pL of RNA ligation buffer, I pL of 150 @4 ATP, 1 $ (10-20 @I) of [5’-32P]-pCp (at least 3000 Wmmol), and 1 uL of T4 RNA hgase (10 U) Then incubate overnight at 8-14°C 4. Terminate by ethanol precipitation from high salt by adding 1 pL of (5 pg/pL) glycogen (as carrier), 10 pL of 4 A4 ammonmm acetate, pH 7.0, 3 N of water, and 50 mL of ethanol 5 Proceed as described m Sectron 3.2 1,, starting at step 6.

3.2.3. 3’-Labeling with Yeast PAP This IS the method of choice for 3’-labeling of long RNAs (IO). 1. Take 6 pL (about 1 pmol) of transcript m water, heat-denature by botlmg for 2 mm, chill on me, and spm brtefly. 2. Add 2 & of 5X PAP reaction buffer, 1 uL (10 ~CI) of [a-32P]-3’-dATP, “cordycepm-5’-trtphosphate” (5000 Cmnmol), 1 pL poly(A) polymerase (500 U), and incubate for 20 mm at 30°C. 3 Terminate by ethanol preciprtatron from hrgh salt as in Section 3.2 2. startmg at step 4

3.3. Generation

and Analysis of Sequence Ladders

For the characterization of transcripts and analysts of ribozyme reacttons, m general it IS sufficient to combme one base-specific sequence ladder with a random sequence ladder. For more complete RNA sequence analysts, consult other manuals (3,4) With the indicated amounts of radroactivrty, only an overnight exposure (at -7OOC) is required for autoradiography, if an mtensrfymg screen is used. 3.3.1. Guanosine-Specific

RNA Cleavage with RNase TI

Since the required amounts of enzyme vary it is best to perform a small dilution series. 1 Prepare26 pJLof end-labeledRNA (at least60,000 cpm) contanting26 pg carrier RNA (do not substitute, smce this 1srequired as an RNase substrate)

86

KruPP

2. Dispense 5 pL ahquots m fresh mrcrofuge tubes, and dry down all five samples. 3 Add 4 Ccs,of Tl buffer to each of four of the five samples No enzyme is added to one of these, which becomes the undigested control sample The fifth sample is used for alkali cleavage (see Section 3 2 2.) 4 Premcubate the four tubes for 5 mm at 50°C 5 To the first tube, add 1 $ of RNase Tl (about 3 U of Boehrmger enzyme), mix, and withdraw 1 pL 6 To the second tube, add 1 pL from the first tube, mix, and withdraw 1 4. 7 To the third tube, add 1 pL from the second tube 8. Incubate the four samples for 15 mm at 50°C 9 Stop the reaction by freezing on dry ice. Keep for gel analysis (see Section 3 3 3 )

3.3.2. Random RNA Cleavage with Alkali 1, To the dry RNA sample (Section 3 3.1 , step 2), add 4 pL of alkali mix 2 Heat for 2 mm at 80°C 3 Stop by freezmg on dry ice Keep for gel analysis (see Section 3 3.3 )

3.3.3 Sequenang

Gels and Analysis

Spm all frozen samples from Sections 3 3.1. and 3 3 2 briefly, and load on a standard sequencing gel. 2 Electrophorese and autoradiograph A sample result is shown in Fig 1. The following observations are evident a In the random sequence ladder with alkali, the band mtensmes are very even and decrease regularly from bottom to top. Cleavage occurred m efficient denaturing condmons b. The distances between mdividual bands m the sequence ladder vary There is a large gap before a G, which is smaller for A and U, and even smaller for C This can help to discover differences between the predicted template and the observed transcript sequence c. Although all expected guanosme bands are present m the RNase Tl sequence ladder, the band mtensmes vary greatly This is usually observed m enzymatic digests because of mefficient denaturation in the cleavage reaction d The RNA fragments analyzed m the sequence ladders carry a 3’-terminal phosphate If the ribozyme cleavage products ternnnate with a 3’-hydroxyl (like with RNase P RNA), they mtgrate more slowly m the gel and are shifted approximately one nucleotide position upward Frequently, they migrate somewhat “out of frame” (6)

4. Notes 1 The more expensive [a- 32P]-UTP with high specific activtty is not required However, consider the following The final concentration of UTP should be about 20 I.&!, equivalent to a total amount of 2 nmol in a 100~pL reaction If you use [~x-~~P]-UTP with high specific radioactivity (e.g., 3000 C~/mmol), 100 ~CI are equtvalent to 0 033 nmol (essentially negligible). With low specific activity

Unmodified Ribozymes and Substrates -Ti

87

OH-

G C

Fig. 1. Example of sequence ladders. The first lane (-) is the undigested control, lane TI is the guanosine sequence ladder, and lane OH- is the random sequence ladder. The predicted sequence is indicated at the left margin. (50 Ci/mmol), 100 pCi are equivalent to 2 nmol. This is the total amount required. Accordingly, UTP has to be omitted completely in the NTP labeling mix to obtain maximal labeling efficiency. 2. In general, a final concentration of l-2 mMNTPs is used. Considering the excess of 20 mMMgC1, (recommended to be at least 4 aabove the total NTP concentration), higher concentrations can be used and may result in improved transcript yields, but no general predictions are possible, and optimized conditions have to be worked out for the specific template used. Similarly, excellent yields can be obtained with some templates and a commercially available high yield transcription kit, like AmpliScribe (Epicentre), RiboMAX (Promega), and so forth.

88

KNAPP

3 Always use DEPC-treated water for steps involving 4 5 6

7

8 9.

10.

synthesis, storage, or handling of RNA. To avoid spermldme preclpltatlon of the DNA, transcrlptlon reactions should always be assembled at room temperature. For the synthesis of internally labeled transcripts, any [a-32P]-NTP can be used, since equlmolar concentrations of all four NTPs are used. Some protocols recommend a DNase treatment to digest the DNA template, followed by phenol extraction to remove the polymerase This is not required If the transcripts are precipitated m the presence of EDTA (to mmimlze loss of Mg-RNA precipitate) and gel-purified. Bromophenol blue comlgrates with RNAs of about 7,20, and 75 nt on 20, 8, and 4% polyacrylamlde gels, respectively. Xylene cyan01 comigrates with 27, 70, and 200 nt long RNAs Five micrograms of glycogen can be added as carrier. Glycogen is free of proteins and nucleic acids and does not interfere with any nucleic acid activity. If poor transcript yields are obtained, compare with a reference template (supplied with the enzyme by some commercial suppliers) to confirm that all transcription components are working. The following points may be helpful. a. Poor yield or high amounts of short products (especially if a smear occurs) are observed with your own and with the control template. Possible nuclease contarmnation-replace aII solutions Consider adding RNase inhibitor, If not yet present b. Degradation problem occurs only wtth your template. Phenol extract it repeatedly, ethanol-preclpltate, and wash wrth 70% ethanol. c Poor yield with your template. Maybe your template DNA IS denatured. Avoid dissolving your template in water. Always use TE (20 mM Tns-HCl, pH 8 0, 1 mM EDTA). Short templates can be renatured by heating m TE and slow coolmg. If a large plasmid fragment 1sused, prepare a fresh restriction digest. d If your template is a partially single-stranded synthetic DNA, and only the 18-mer promoter section is double-stranded, which is the most economic type for short RNAs, occasionally, this results m poor transcript yields (1 I) This can be overcome by the use of a special polyamme (IZ). A simple alternative is the elongation of the 18-mer promoter by a few (about five) cycles of PCR to obtain completely double-stranded template DNA (see Chapter 9). e Note that the quality of enzyme batches can vary Do not hesitate to complam to your supplier. f If the desired template contains a number of Us m a row, then increasing the UTP concentration (twofold) may boost transcript yield. g For short templates, increased incubation time, T7 polymerase, or template concentration may improve yields. h For long templates, mcluding morgamc pyrophosphatase (0.25 U/&) may increase transcription yield. If you observe mefficlent labeling, compare with labeling of a reference RNA Consider nuclease contamination m solutions (replace them) or m your RNA sample (phenol-extract and preclpltate).


89

References 1 Krupp, G (1988) RNA synthesis strategies for the use of bacteriophage RNA polymerases. Gene 72,75-89 2 Mulligan, J F. and Uhlenbeck, 0. C (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol. 180, 5 1-62 3 Stahl, D A., Krupp, G., and Stackebrandt, E (1989) RNA sequencing m Nuclezc Acid Sequencmg A Practical Approach (Howe, C J. and Ward, E S., eds ), IRL, Oxford, pp 137-183. 4 Krupp, G (1991) Direct sequence analysis of small RNAs, m Nuclezc Aced Techniques in Bacterral Systematrcs (Stackebrandt, E and Goodfellow, M., eds ), Wiley, New York, pp. 95-114 5 Reyes, V. M. and Abelson, J (1988) Substrate recognmon and splice site determmatton m yeast tRNA sphcmg CelE 55,7 19-730 6 Krupp, G., Kahle, D , Vogt, T , and Char, S. (1991) Sequence changes m both flankmg sequences of a pre-tRNA Influence the cleavage spectficity of RNase P J A401 Blol 217, 637-648. 7 Pitulle, C., Kleineidam R G , Sproat, B., and Krupp, G. (1992) Initiator ohgonucleotides for the combmation of chemical and enzymatic RNA synthesis Gene 112,101-105

8 Harris, M. E and Pace, N. R. (1995) Identification of phosphates involved m catalysts by the ribozyme RNase P RNA RNA 1,2 10-2 18. 9 Konarska, M. M., Padgett, R A., and Sharp, P. A. (1984) Recognition of cap structure in splicing zn vitro of mRNA precursors. Cell 38, 73 l-736 IO. Lmgner, J and Keller, W (1993) 3’-End labelmg of RNA with recombinant yeast poly(A) polymerase Nucleic Acids Res 21,2917-2920 11 Frugier, M., Florentz, C , Hossemt, M W , Lehn, J -M , and Giege, R (1994) Synthetic polyammes stimulate zn vztro transcription by T7 RNA polymerase Nucleic Acids Res 22,2784--2790

T7 Transcript Length Determination Using Enzymatic RNA Sequencing Andrew Siwkowski 1. Introduction The T7 transcription method from single-stranded templates with a doublestranded promoter is a common method of preparing RNA for in vitro rrbozyme studies (I). Although the identification of full-sized rlbozyme transcripts IS fairly straightforward after gel separation, the same cannot be said for the shorter substrate transcription products. Substrate gel separation always results in a heterogeneous population of RNA bands that differ in length. Previous research has shown that the shorter than full-size RNAs are the products of aborted transcription that share Identical S-sequences. The RNAs that are one nucleotrde larger than full srze are owing to the propensity of T7 RNA polymerase for adding a single uncoded nucleotrde to the full-size product (1). RNAs that are significantly larger than the coded transcript can also be produced by T7 RNA polymerase via RNA-directed RNA polymerization (2). This phenomenon 1sbelieved to occur when the initial transcription product can be used as either an mtermolecular or intramolecular RNA primer that is subsequently extended by T7 RNA polymerase. To determine which band on the substrate gel contains the complete sequence coded for by the DNA template, enzymatic RNA sequencing IS used (3,4). This method takes advantage of the cleavage specificity of a variety of RNases that are incubated with the substrate RNA m separate reactions. The reactrons are then run out on a denaturing PAGE gel, and the resulting band patterns are compared with a hydrolysis ladder produced from the same RNA. The resulting mformatton provides a maJorrty of the specific nucleotide sequence of the substrate RNA digested, but more rmporFrom


Btology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

97

92

Siwkowski

tantly provides enough Information when compared to the hydrolysis ladder to obtain the size, m nucleotldes, of the RNA digested. Once the size of one band is determined, the sizes of the remainder of the shorter transcripts can be deduced. Using this method, positive ldentlficatlon of the band of Interest IS possible This procedure is broken down into four main subsections: transcriptlon using T7 RNA polymerase, 5’-dephosphorylatlon of transcripts, 5’-end-labeling of transcripts, and enzymatic dlgestlon of RNA. 2. Materials

2.1. Transcription Required

materials

Using T7 RNA Polymerase are given m Chapter 23, Sectton 2.1

2.2. 5’-Dephosphorylation

of Transcripts

1 0 4 w m vitro transcribed RNA (3 a) 2. Sterile HZ0 3 10X TA buffer 330 mMTns-acetate, pH 7.8,660 mMpotassmm acetate, 100 mA4 magnesium acetate, 5 mM dithlothreltol (DTT) 4. 50 mA4CaC1, 5. HK Phosphatase (1 U/K), Eplcentre Technologies, Madison, WI 6. A 30°C water bath. 7. A 65°C water bath

2.3.5’-End-Labeling 1. 2 3 4. 5. 6. 7. 8. 9 10 11. 12. 13 14. 15 16. 17.

of Transcripts

Dephosphorylated RNA (from Section 3 2.) 1 WATP. 10 mM Spermidme. 10X Kinase buffer. 700 mM Tris-HCl, pH 7.6, 100 mM MgC12, 50 mM DTT r3’P ATP (10 @I/$, 4500 Cl/mmol) Sterile H20 T4 Polynucleotlde kmase (PNK) (10 U/&), Promega, Madison, WI. A 37°C water bath 3 M Sodium acetate, pH 5.2. 100% Ethanol. Glycogen (20 pg/pL), Boehrmger-Mannhelm, Germany. 98% Formamide dye consisting of 10 mA4NazEDTA and 1 mg/mL each of xylene cyan01 and bromophenol blue dyes. A -80°C freezer A 15% PAGE, 7 A4 urea gel A sterile scalpel for excising the RNA from the gel RNA extraction buffer: 0 5 Mammomum acetate, 2 mMNa,EDTA, and 0.5% SDS. A sterile mlcrocentrlfuge tube pestle for grmdmg the excised gel slice

93

T7 Transcript Length Determination 2.4. Enzymatic Digestion

of RNA

1. End-labeled RNA (from Section 3.3 ). 2 Carrter tRNA (1 75 pg/pL). 3 Sterile Hz0 4 RNases at 1 l-J/$,* RNase Tl; RNase U2, RNase Phy M; RNase B cereus 5 RNase buffer compositions: T 1, U2 buffer: 33 mA4 sodium citrate, pH 3 5,9 4 Murea, 1.5 WEDTA, and 0.04% xylene cyan01 Phy M buffer 33 mA4 sodium citrate, pH 5.0,9.4 Murea, 1 5 WEDTA, and 0 04% xylene cyan01 B cereus buffer 60 rmI4 sodium citrate, pH 5.0, 2 7 rmI4 EDTA Hydrolysis buffer 50 mM sodrum phosphate, pH 12 0 Load buffer: 9.8 A4 urea, 1.5 mM EDTA, and 0.05% xylene cyanol. 6 A 50°C water bath 7 A 15% PAGE, 7 M urea gel. All RNases are available from PharmaciaBlotech, Piscataway,NJ All RNase buffers are available from USB, Cleveland, OH (USB product number 76000)

3. Methods 3.1. Transcription Using T7 RNA Polymerase This procedure IS described in detail in Chapter 23 and ~111therefore not be addressed here. However, one issue that deserves reiteratron IS the specrfic activity of the transcription product. The basis for the followmg procedures for RNA sequencing rely on the ability to end-label the RNA to a significantly higher level than is represented by the tntemal

labeling,

whrch occurs during

transcriptton. If the radroacttvity owing to mternal labeling is not significantly less than that resultmg from end-labeling, no useful mformation will be obtamed. The followmg procedures solve thus problem by utilrzmg a small amount of Internally labeled RNA (1.2 pmol) and end-labeling It to a much hrgher specrfic activrty. When used m conjunction with the transcription procedure outlined in Chapter 23, the procedures outlined here will yield endlabeled RNA with a specific activity two to three orders of magnitude higher than the specific activity resulting from internal labeling as a result of transcription This increase IS sufficient to prevent 3’ RNase digestron fragments from appearing on the sequencing gel that is crucial to the success of the procedure. 3.2. 5’-Dephosphorylafion

of Transcripts

To 5’-end-label the RNA, the transcript must first be dephosphorylated. The use of HK phosphatase allows one to bypass the usual requirement of phenol extraction to remove the phosphatase prior to end-labeling. This

94

Siwkowski

enzyme IS efficiently inactivated when incubated at 65°C for 15 mm. This mactlvatlon IS imperative for the subsequent end-labeling to be successful. 1 Assemble the followmg 30 l.tL reactton mrx m a mtcrofuge tube 04p&‘RNA* 3lJL H,O. 20 ClL 1OX TA buffer 3c1L 50 mA4 CaCI,: 3ccL HK Phosphatase (1 U/pL) 1 pL 2. Incubate at 30°C for 1 h. 3 Heat-inactivate the phosphatase at 6S’C for 15 mm

3.3. S-End-Labeling

of Transcripts

1 Add the following to the 30 pL of dephosphorylated RNA from Section 3 2 * 1 cuz/rATP 3c1L 10 @4 sperrmdme 5 pL 10X Kmase buffer 5 pL y32P ATP (10 uCi/pL) 3 pL H20 34 T4PNK(lOU/pL) 1 pL 2 Incubate at 37°C for 1 h 3 Add 5 pL of 3 M sodium acetate, pH 5 2, 150 mL of 100% ethanol, and 1 pL of glycogen (20 pg/uL). 4 Freeze to precipitate at -80°C for 20 min. 5 Microfuge at 14,000g for 20 mm at 4°C and discard the supernatant 6 Dry the pellet under a vacuum 7. Resuspend the pellet m 10 pL of H20 and 10 pL of 98% formamtde dye 8 Heat the sample at 95°C for 2 mm, and snap-cool it on me 9. Load the sample on a 15% PAGE, 7 Murea gel (see Note 1) 10. Visualize the end-labeled RNA usmg autoradiography. 11 Excise the full-stze end-labeled RNA 12 Extract the RNA from the gel as described in Chapter 23, Section 3 1. 13 Resuspend the end-labeled, gel-purified RNA m 10 pL of H20. It IS now ready for use m the RNase digestron reactions

3.4. Enzymatic Digestion of RNA The followmg procedure was derived from a protocol that accompanied the “USB RNA Sequencing Kit-Nuclease Method” (see Note 2). The followmg protocol has been used successfully to enzymatrcally sequence RNA. 1 Make an RNA mtx by adding 6 1.18of carrier tRNA and sterile H20 (to 21 @, total) to the end-labeled RNA from Sectton 3 3. 2. Add 3 ILL of RNA mix to each of the followmg 6 reactions:

T7 Transcript Length Determnat~on Reaction Tl u2 Pby M B cereus

RNase, 1 U/& 1 pLRNaseT1 1 pL RNase U2 1 IL RNase Phy M 1 & RNase B cereus

OHControl 3. 4. 5 6

95 Buffer 7 pL Tl, U2 buffer 7 pL Tl, U2 buffer 7 pL Phy M buffer 2 pI., B cereus buffer 3 I,L hydrolyses buffer 6 pL load buffer

Incubate at 50°C for 60 min Add 6 pL of load buffer to the B cereus and OH-tubes Run on a 40 cm long 15% PAGE, 7 M urea gel. Terminate the gel run when the xylene cyan01 has run l/3 of the way down the gel

3.5. Transcription and Sequencing Results and Interpretation Figure 1 shows the typical results from transcription and sequencing of a ZO-nt RNA. The template and expected full-srze RNA product are as follows: SGCGACUGUGUCCUGAAGAAA -+I STAATACGACTCACTATAGCG 3’ 3’ATTATGCTGAGTGATATCGCTGACACAGGACTTCTTT

3’

RNA product (20-mer) partial duplex template

5’

The template consists of partial duplex DNA containing the double-stranded RNA polymerase promoter region. The transcription start site is indicated (+l). Shown above the template is the anticipated full-size transcript coded for by the template. The first step is to decide which transcription product band isolated from the transcription gel will be sequenced. Based on the fact that the 22 nt DNA marker migrates as an RNA approx 19 nt m length and that the expected full-size transcription product is a 20-mer, band A from the transcrip-

tion gel is a likely candidate for the full-size transcript. Further, the appearance of a prominent band 1 nt larger than band A would correspond to the product of T7 RNA polymerase adding a single uncoded nucleotide to the transcript. For these two reasons, band A was suspected of being the full-size transcript and was sequenced. The occurrence of bands in each of the reaction lanes from the sequencing gel corresponds to the digestion of the end-labeled RNA by each separate RNase. Although each digestron ~111result m two fragments, only those containing the end-labeled S-end of the full-size RNA will appear on the autoradtogram. The sequence of the RNA can then be obtained by observing the band patterns in each reactron lane (seeNote 3). The occurrence of bands corresponds to nucleotide identity m the followmg manner: Tl = G, U2 = A, Phy M = A or U, and B. cereus =C or U (3,4). The sequence can thus be read 5’ to 3’, bottom

Siwko wski

96

T7 Transcription

RNA Sequencing

3’ end ? A A G A A G U C C U G U G

U C A 5’ end

Fig. 1. Transcription and sequencing gels. The autoradiogram on the left is from a 15% PAGE, 7 Murea gel showing the T7 transcription products using the previously depicted template. The lettered products were excised, and the RNA extracted. A portion of the RNA isolated from band A was enzymatically sequenced. The autoradiogram on the right is from a 15% PAGE, 7 Murea gel on which the sequencing reactions were run.

to top, and the bands in the hydrolysis ladder can be associated with specific 3’-base identities. Once the sequence is determined, one can merely count the number of bands apparent in the hydrolysis ladder, starting from a band positively associated with the known sequence coded for by the template and ending with the undigested RNA band, to determine the 3’-end of the sequenced RNA (see Note 4). Based on the invariability of the T7 transcription start site, the 5’ end is already known. With these two pieces of information, the size of the transcript can be determined (see Note 5).

T7 Transcript Length Determination 4. Notes 1 It is important to gel Isolate the end-labeled product to ensure that only the fullstze transcript is used m the RNase digestions. If partial degradation of the RNA has occurred during RNA extraction, dephosphorylatton, or end-labeling, and the end-labeled products are not gel-purified, spurious bands may appear on the sequencing gel autoradiogram, which will render the RNase digestion results unusable. 2. Although the kit 1s no longer avatlable (USB Product No. 76000), the protocol can be obtained through USB technical assistance It contains mformation about how to “fine tune” the procedure for a specific apphcatron 3. The sequencing gel m Fig 1 only shows 17 of the 20 bases from the transcript. The sequence of the three bases at the S-end of the transcript are not shown These digest products ran off the gel durmg the course of electrophorests. Although no sequence mformation was obtained from them, it did not hinder the identification of transcrrpt length determmatron. 4. Some bands that occur m the hydrolysis ladder do not correspond to any observed m the reaction lane. Thts has been attributed to the variable fate of the 2’,3’-cyclic phosphate on the end-labeled fragment produced from hydrolysis This phenomenon is most evident toward the bottom of the gel, which corresponds to the smaller RNA digestion products, but is less obvious wtth the larger fragments 5. The specific base identity of the 3’-terminal nucleottde cannot be determined with this method, and 1stherefore represented on the sequencing gel by V’ Since its presence is represented by the undigested RNA band on the sequencing gel, it can still be accounted for m determmmg the length of the transcript sequenced

Acknowledgments The author would lrke to thank United States Biochemrcal Corporation assistance during the preparation of this manuscript, and Arnold Hampel support of the work contained herein (supported by NIH grant A129870).

for for

References 1 Milhgan, J. F., Groebe, D R , Wttherell, G. W., and Uhlenbeck, 0. C. (1987) Ohgoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Aczds Res 15, 8783-8798. 2. Cazenave, C. and Uhlenbeck, 0. C. (1994) RNA template-directed RNA synthesis by T7 RNA polymerase. Proc Natl. Acad. Sci USA 91,6972-6976 3 Doms-Keller, H (1980) Phy M: an RNase activity specific for U and A residues useful m RNA sequence analysis. Nucleic Acids Res 8,3 133-3 142 4 Donis-Keller, H., Maxam, A. M., and Gilbert, W. (1977) Mapping adenmes, guanmes, and pyrimtdmes in RNA Nucleic Acids Res 4,2527-2538

12 Chemical and Enzymatic Approaches to Construct Modified RNAs Rajesh K. Gaur and Guido Krupp 1. Introduction Synthesis of modified nucleottdes and then incorporatton mto an RNA chain have facilitated our understanding of the functron and mode of actron of spec~fic nucleotrdes within the rrbonuclem acid. Recent developments m the chemical and enzymatic synthesis of RNAs (I-3) have allowed the introductron of single-atom substttutrons at specific positions m an ohgortbonucleotrde. For example, mtroductron of deoxyrtbose moieties in an RNA or the replacement of natural nucleotrde by a base not normally found in nucleic acids ISnow possible (4,5). There are three major targets for modrfication of RNA: the exocyclic base, the sugar, and the mternucleotrde phosphodiester lmkage. In thus chapter, our focus wrll be mainly on the construction of modified RNAs using a combination of chemical and enzymatic techniques. 2. Materials m7G(5’)ppp(5’)G, NTPaS nucleotides and NTPs (0.1 M solutions) can be obtained from Pharmacra. DTT, RNasin, T7 RNA polymerase, and T4 polynucleotide kinase can be obtained from Promega (Madrson, WI). The sources of polyethylene glycol (PEG) 6000-8000 and T4 DNA hgase are Sigma and US Biochemical, respectively. The other reagents and buffers required are: 1. 10X Transcrlptlon buffer 400 n&I Tns-HCl, pH 8.0, 200 mA4 MgCl,, 20 mA4 spermidme. 2. 10X Kmase buffer 500 mM Tris-HCl, pH 8.0, 100 mA4 MgCl,, 100 m&I DTT 3. 10X RNA ligation buffer 500 r&I Tns-HCl, pH 7 5, 10 mA4 MgCl*, 10 mM ATP, 500 pg/mL BSA From


Bfology, Vol 74 Flrbozyme Protocols Humana Press Inc , Totowa, NJ

99

700

Gaur and Krupp

4. Polyacrylamtde gel loadmg buffer: 8 Murea, 0.03% tracking dyes (bromophenol blue and xylene cyanol) 5. 10X Modtfied transcription buffer (MTB): 400 mA4 Tris-HCl, pH 8 0, 20 mJ14 spermidme. 6. 25 mMMnC1, 7 25 mA4 MnCl,, 25 mM MgCl,. 8. 50% PEG 9 0 1% Triton X-100 10 3 A4 Sodium acetate, pH 5.2. 11 Glycogen (5 pg/pL) as carrier. 12. 100% ethanol 13 PhenolKHCl,: phenol:CHC13 isoamyl alcohol m the ratio 50*49:1 with 0 1% 8-hydroxyqumolme. 14 CHCl,/isoamyl alcohol. 24.1 CHC@oamyl alcohol 15. Sterile water

3. Methods 3.1. 5’-Terminal Modified RNA 3 1.1. Introduction of Cap Analog RNA transcribed by RNA polymerase II (~0111) contains a unique Y-terminus, known as the S-cap. This cap consists of a guanosine residue methylated at the N-7 position and linked to the first encoded nucleotide via a triphosphate linkage (6). In addrtton to havmg an important role in RNA metabolism (7-g), this cap structure protects the RNA against 5’-exoribonucleases (I &Z2). Furthermore, for efficient splicing of eukaryotic pre-mRNA substrates, the presence of a S-cap structure has been shown to be important (13). Therefore, for in vitro RNA processing, it IS desirable to transcribe pre-mRNA containmg the 5’-cap structure. Depending on the requirement, high- or low-specific activity RNA can be transcribed using the followmg protocol (see Note 1 and cf Chapter 10 for a standard transcription protocol). 1. For a 50 pL transcription reaction, mix the following components: 1OX Transcription buffer 504 Water 11.5 llL 10 mM m7G (5’)ppp(5’) G 10.0 pL Mixture of NTPs: A and C at 4 mM, U and G at 1 mM 5.0 pL 0 1 MDTT SONRNasm (20 U/uL) 0.5 /.lL [a-32P]UTP (10 @I/&) 10.0 l.lL DNA template (l-2 pg/pL; l-2 pmol) 104 T7 RNA polymerase (20 U/pL) 2.0 /AL 2 Incubate for 2-3 h at 37°C.

Chemical and Enzymatic Approaches

101

3 Add 0.1 vol of 3 M sodmm acetate, pH 5.2, 1 pL of glycogen (5 pgI$) as carrier, and 1.50 pL of cold ethanol, vortex, and freeze in dry me for 5 min (see Note 2) 4. Mtcrofuge for 10 mm at top speed, drscard the supernatant, and wash the RNA pellet wtth 70% ethanol 5. Dtssolve the dry pellet m gel loading buffer (15 a), boil for 2 mm, spin down brtefly, and purrfy the RNA usmg polyacrylamtde gel electrophorests (dependmg on the srze of the RNA, the acrylamtde should be between 4 and 20%).

3. I .2. 5’- Modfica tion Using lnitia tor Oligos Modified nucleotides can be used as mitiators to prime m vitro RNA transcription by adjusting the ratro of GTP to the initiator ohgonucleotide (14,25) RNA transcripts specifically initiated with guanosine, guanosine 5’-monophosphate (GMP), guanosme S-0-( 1-thiomonophosphate) (GMPaS), ApG, AmpG, ApGm, pApGm, biotin-ApG, fluorescem-ApG, and so forth, can be prepared using approprrately modrfied nucleotide(s) (see Note 3) m the transcription reactron (1617). These S-modified RNAs can be used for the preparation of nonradioactive probes useful in sequence analysis by enzymatic or chemical methods (16). Moreover, the free 5’-hydroxyl group of the RNA obtained by nntratmg the transcription reaction with dinucleotrdes, such as ApG, or CpG, allows single-step end-labeling (18) with [Y-~~P]ATP and polynucleotrde kmase. Furthermore, RNA mmated by GMPaS can be derrvattzed with photochemrcal probes specrfic for sulfhydryl groups, such as p-azrdophenacyl bromide (19). 3.2. RNA with Partial or 100% Phosphorothioate Modification Oligoribonucleotides containing phosphorothroate lmkage (20,21) can be synthesized by either chemical or enzymatic means. However, both chemical and enzymatic syntheses of RNA phosphorothioates have some hmrtatrons; for example: l

l

l

Chemical synthesis of RNA is limited to relatively short lengths, whereas enzymatic RNA synthesis does not have such a limitation (see also Section 3.5.2.)

Unlike enzymaticRNA syntheses, site-specrficmcorporationof thephosphorothioate bond IS possible chemically. WhereasenzymatrcRNA synthesisgeneratesa pure isomer(only the Sr,drastereoisomer of NTPclS nucleotides is a substrate for T7 or SP6 RNA polymerase [20,22]), chemical syntheses generates a mixture of S, and R, isomers.

High-performance liquid chromatography (HPLC), in some cases, can be used for the separation of Sp and R, isomers (23). Using the followmg transcription protocol, RNA wtth partial or completely modified phosphodrester linkage can be prepared:

Gaur and Krupp

102 1. Set up a 50 pL transcription reaction as follows. 10X Transcription buffer 5OcLL 30 5 pL Water OlMDTT 50& 10 mMNTPaS (see a-d, below) 25NDNA template (l-2 p&L; l-2 pmol) 1.0 /.lL T7 RNA polymerase (20 U/pL) 5.0 pL [cz-~~P]UTP (vanable) lo& 2 Proceed as m Section 3 1.1 , step 2 Components

of the above transcrtption

reaction can be changed as required

For example: a. By combining CTP, GTP, UTP, and ATPaS, phosphodiester lmakges 5’ to the adenosine can be changed to phosphorothioates b By adjusting the ratio of one of the NTPs with the correspondmg NTPaS, the level of moditicatton of the phosphodrester linkage can be controlled; the mcorporation efficrenctes of NTP and NTPaS are essentially ldenttcal (22). c By prlmmg the transcription reaction with 5’-GMPaS (19) and using only unmodified NTPs, a phosphorothtoate group can specifically be placed at the 5’-termmus of the RNA d. RNA phosphorothroates useful in the modification interference assays (15,24) can be prepared by using a mixture of 1 part of the desired NTPclS and Xparts of the same unmodified NTP (where X is the number of that nucleottde per RNA [2.5]). For example, if a pre-tRNA contains 20 adenosme residues, then a mixture of 5% ATPaS and 95% of ATP generally gives the optimal modtticanon level (see also Chapter 13) For a complete analysis, four separate transcription reactions should be assembled, each with one NTPclS

3.3. Modification Chemical

of 2’-Hydroxl

synthesis of 2’-modified

Groups in RNA RNA phosphoramidrtes

(26 and references

therein) and nucleosrde trrphosphates (27,28) has widened the scope for the mtroduction of such nucleotides mto RNA. Modified nucleotides, such as 2’-fluoro-, 2’-amino-, 2’-O-methyl-, 2’-0-allyl-, or 2’-deoxy-, have been successfully mtroduced into the RNA chain using chemical, enzymatic, or combmed approaches. Using chemical synthesis,tt is possible to introduce 2’-modifications at specrfic posrtions, yet only short RNAs can be synthestzed.Furthermore, 2’-modificatron in combination with the low level of phosphorothroate linkage desirable for modrfication interference study is not possible by chemical synthesis(see Sections3.2. and 3.4.). Here we describe our recently developed protocol for the introduction

of

2’-deoxy- or 2’0methyl-nucleotrdes m RNA using T7 RNA polymerase.

3.3.1. RNA Transcripts Containing 100% of P’-Deoxynucleotide Using the protocol given below, the complete replacement of one NTP by the correspondmg dNTP IS possible. Except for dTTP, multiple mcorporation


703

of other dNTPs should be avotded within the first 10-12 nucleotrdes of the transcript. Multiple insertion of dNTPs at subsequent sites does not sigmficantly affect the efficiency of the transcription reaction. Even combinations of two dNTPs at a time are possible, although this would result m drastically reduced transcrrptlon yields of around 15% of standard reactions (29). 1 For the 100% replacementof ATP by dATP, set up the following 100 pL transcription reaction* 10X MTB 10.0 pL Water 36.0 pL 0.1 MDTT 10.0 pL 20 mA4 NTPs minus ATP 5.0 jJ.L 20 mA4 dATP 5.0 /AL 50% PEG 16.0 pL 0.1% Trtton X- 100 lo& DNA template (l-2 ccg/uL; l-2 pmol) 1.0 pL 25 mM MnCl* (see Note 4) 10.0 p.L [cL-~~P]UTP (variable) lo& T7 RNA polymerase (20 U/pL) 5.0 /AL. 2 Incubate for 3-4 h at 37°C. 3 Terminate the reaction, and isolate and purify the RNA as described m the Section 3.1 .l , starting at step 3. For partial substitution of NTPs by dNTPs or by dNTPaS nucleotides, see Sectton 3 4. and Table 1.

3.3.2. RNA Transcripts with 2’-0 -Methylnucleo tides Total or partial replacement of NTP by 2’-O-methyl NTP is not possible using the standard transcriptron protocol. However, a modified protocol (see Section 3.3.1.) and a combmation of 1% NTP and 99% of the corresponding 2’-0-methyl-NTP, full-length transcripts can be obtained. A moderate mod& cation level of 1560% can be obtained with this protocol (291, The overall yield of the RNA transcript is low and varies from 3-l 3% of the standard transcription reaction (which uses unmodified NTPs). For lower levels of modrficatron or to use 2’-0-methyl-NTPaS nucleotldes m the modrfication interference analysis, see Section 3.4. and Table 1. 3.4. Partially 2’-Modified Transcripts for Modification Interference Analysis In modrfkation interference analysis (1.5,24,29), a specific cleavage reaction is used to detect the modified nucleotides. However, a simple and direct approach is not available for the detection of 2’-modrfied ribose moietres. Thts problem was partially ctrcumvented by combmmg 2’-modificatrons with iodine-cleavable phosphorothioate linkages as described in Chapter 13 (25,30).

104 Table 1 Quantitative of Modified

Gaur and Krupp Data for Incorporation Nucleotides in Transcript9

Modified NTP, %

Modified nucleottde, %

dCTP (90) dCTP (90)* dTTP (90) dCTPaS (90) dCTPaS (90)* dTTPcLS (90) dGTPclS (90)

15 36* 27 7 13* 9 7 6 27 58*

dATPaS (90)

2’-O-Methyl-CTP (99) 2’-O-Methyl-CTP (99)* 2’-O-Methyl-CTPaS (99) 2’-O-Methyl-CTPaS (99)* 2’-O-Methyl-CTPaS (99)

10

34* 17

Discrimmator

Requrred NTP,b %

DN/h’(rnod)

73 46* 55 86 75* 82 86 88 93 79* 98 91* 96

51 16* 24 120 60* 91 120 141

268 72* 890 192* 480

OThesedata are obtamed for tRNAPhe transcripts (29) usmg T7 RNA polymerase The transcrtptlon reactions are performed as described m Section 3 3 1 MnCl, (2 5 mM) 1s used m all transcriptions, except that m some cases, a mixture of 2.5 n&I MnCI, and 2.5 n&I MgCl, gives improved results (indicated by an asterisk) The percentage of modified NTP IS 90% for dNTPs and 99% for 2’-O-methyl-NTPs (mdlcated m parentheses) The resulting percentage of mcorporated modified nucleotldes IS indicated and used to calculate the dlscnmmation factor D,, (modj, bin the last column, the required percentage of modified NTP IS given to obtam 5% of modified nucleotide incorporated m the transcript

Ideally, RNA transcripts should contain only one modified nucleottde per molecule. If both normal and modified nucleotides are mcorporated with equal efficiency, then 1 part modified nucleotide and X parts (where X is the number of that nucleotrde per RNA [25]), unmodified nucleotide should be present in the transcription reaction. However, 2’-modified NTPaS nucleottdes are much poorer substrates for T7 RNA polymerase, and therefore the ratio of modified to unmodified nucleotide should be adjusted using the discrimmation factors (DNmmod)provided m Table 1 (29) and the formula: [NTP,,d For example,

(%)MTP

if a pre-tRNA

(Oh)] = DNmmod X [Nmod (%)/ N (%)] contams

20 adenosmes,

(1) and 5% modified

adenosine in the tRNA transcript gives the desired level of modification, then the dATPccS to ATP ratio using the following formula is: [dATPaS (%)/ATP (%)] = 141 x (5/95)

(2)

[dATPaS (%)/ATP (%)] = 7.4

(3)


105

This means the ratlo of dATPaS IS 7.4 parts in 8.4 parts. Accordmgly, the NTP mix should contam 88% dATPclS and 12% ATP. For a complete analysis, four separate transcription reactions should be performed, each with one modified NTPaS at a time. 3.5. Site-Specific

Modification

of RNAs

Three different approaches can be used for site-specific modlficatlon of RNA. 1 Short RNAs can be synthesized chemically using the proper modified phosphoramldite building blocks. 2 5’-Proximal modifications in long RNA transcripts can be introduced with imtlator oligos (Sectlon 3.1 2.). 3. The greatest flexibility IS possible by ligating chemically synthesized, modified RNAs to either unmodified or modified RNAs (Section 3 5.2 )

3 5.1. Site-Specific Introduction of Phosphorothioate Standard RNA synthesis on an Applied Biosystems

Linkage in RNA

or other DNA/RNA

syn-

thesizer can be used to introduce phosphorothioate lmkages in an RNA oligomer (see Chapters 7 and 8). To generate phosphorothioate linkages, the oxldatlon step during the normal synthesis cycle is replaced by a sulfurization step, using a standard reagent (31,321 or elemental sulfur (see ref. 33; Note 5). The remaining steps are identical to the normal RNA synthesis cycle. After deprotection and isolation, RNA isomers (Sp and I$) may be separated by HPLC (23). 3.5.2. Site-Specific Modifica tron by RNA Ligation The ability of T4 DNA ligase to join two pieces of RNA hybridized to a complementary oligodeoxynucleotide has proven to be a very versatile approach for constructing RNAs modified at specific posltlons (34-36). This semlsynthetlc approach can ultimately be used for site-specific mcorporatlon of a single-atom substitution within even a large RNA (3 7,38). A schematic representation of the method is shown in Fig. 1. One or both RNA molecules may contam specific modifications, introduced by chemical or enzymatic methods (see Note 6). The example detailed in Fig. 1 IS a modlfled nucleotide introduced next to the ligation junction. The 5’-RNA is unmodified, whereas the 3’-RNA molecule is primed with an initiator dinucleottde, 4-thioUpG (modified nucleotides, such as dApG, AmpG, and so on, can also be used). Alternatively, 5’-phosphorylated dinucleotide may be used directly in the transcription reaction, thus improving incorporation efficiency (16) and slmphfying the subsequent workup steps.

Gaur and Krupp

106 3'-RNA

tkIlf

8GcuGucccuuwuuLniuuu 1

GcmwpP-ATP T4 Polynucleotide

kinose

3zPl.? GCUcuCCcuuUUUu~ S.-RN4

Hcllf

~A~GAUGUCAUACIJUAOH

Oligodeoxynucleotlde

splint

1

-A

32 PUS ccuciucccuuuuuu I IIIIIIIIIIIIII CGACACGCAMAM

1

ATP T4 DNA ligase

Ligated

RNA

Fig. 1. Constructton of a site-spectfic modified pre-mRNA substrate 32P-Labeled 4-thtoundme containing pre-mRNA substrate 1sgenerated, for example, from the adenovu-us major late transcript (40). Exons are represented as boxes. The 3’-RNA molecule 1s transcrtbed usmg 4-thtoUpG as mtttator dinucleottde, whereas S-RNA molecule 1s prtmed with m7G (5’)ppp(5’)G Both RNAs are gel-purtfied followed by phosphorylatron of 3’-RNA molecule with [Y-~~P]ATP. The two RNAs are then annealed to the sphnt ohgodeoxynucleottde, and addmon of ATP and T4 DNA hgase yields the ligated RNA

Purify both RNAs by denaturing polyacrylamlde gel electrophoresls and determine the amount of RNA by Cerenkov counting or by UV absorbance (39). If not already phosphorylated, the 3’-RNA molecule 1s phosphorylated with Y-~~P-ATPor unlabeled ATP. 3 5.2.1

5'-PHOSPHORYLATIONOF

3’-RNA

MOLECULE

1 Set up the following 10 pL kmase reactton. RNA (50-100 pmol) 1OX Kmase buffer 1 mA4ATP ([Y-~*P]ATP may be included) T4 polynucleottde kinase (10 U/pL)

7.0 /.lL

1OcLL 1.0 pL lo@-

Chemical and Enzymattc Approaches

107

2 Incubate for 30 min at 37°C. 3 Add 90 pL of water, and extract with 100 pL of phenol/chloroform followed by 100 pL of chloroform 4. Add 10 $ of 3 M sodium acetate (pH 5.2), 300 pL of absolute ethanol, and freeze in dry ice for 5 mm (see Note 2) 5 MicrofQe for 10 mm at top speed, discard the supematant, and wash the pellet with 70% ethanol. 6 Dissolve the dry RNA pellet in water to make a stock solution of 5-10 pmol/pL 3.5 2.2. LIGATION OF 5’- AND 3’-RNA

MOLECULES

1 MIX the following components to hgate the two RNA molecules. 1OX Ligation buffer 5OccL 5’-RNA molecule (50 pmol) 501.1L 3’-RNA molecule (50 pmol) 50$ Splint ohgodeoxynucleotide (100 pmol) (see Note 7) 5 0 pL 2 Heat the reaction mixture to 65°C for 5 mm, and cool slowly to anneal the complementary ohgodeoxynucleotide splint to the two RNAs (see Note 8) 3 After annealing, the reaction volume IS made up to 50 pL by addmg 1 0 pL of 1 M DTT, 2.0 pL of 50% PEG, 1.0 pL of RNasm (20 U/pL), 21 & of sterile water, and 5 0 pL of DNA hgase (10 U/a) 4. Incubate for 3-4 h at 30°C 5 Add 50 6 of water, and extract the reaction mixture with 1 vol of phenol/chloroform followed by extractlon with chloroform. 6 Precipitate the RNA with absolute ethanol, and purify the ligated product by denaturing polyacrylamlde gel electrophoresls. Determine the amount of the ligated RNA by Cerenkov counting. It 1s now ready for use m various apphcations such as those m Chapter 13 4. Notes 1 For preparation of low-specific-activity RNA, the amount of [a-32P]UTP can be reduced to 0.5 &I The amount of NTPs can be scaled up as required 2 Ammomum acetate can also be used for RNA precipitation However, It should be avoided prior to a ligation or kinase step, since these enzymes are Inhibited by ammonium ions. 3. Many dinucleotldes are available from Sigma or USB (Abbrevlatlons used: Am, 2’-0-methyladenosme, dA, 2’-deoxyadenosine; Gm, 2’-0-methylguanosme). Alternatively, modified nucleotldes, such as AmpG or ApGm, can be synthesized using commercially available normal and 2’-O-methyl RNA phosphoramldites (Glen Research). For preparation of biotin-ApG and GMPaS, see refs (16) and (19), respectively. 5’-Allphatlc amino group containing dmucleotides, such as 5’-ammoApG, are very useful in the preparation of blotin and fluorescein-derivatlzed RNAs. Such dinucleotldes can be prepared on an automatic DNA/RNA synthesizer following the standard protocol (see Chapters 7 and 8), except that after the assembly of dmucleotlde (for example, ApG),

108

4 5 6 7 8.

Gaur and Krupp ammo-modifier phosphoramidite (N-MMT-Cn-AmmoModifier, Clontech) is coupled to the 5’-OH group of adenosme. After deprotection, the modified dmucleottde is purified by HPLC and then mcorporated as an mltiator ohgo m a transcription reaction. The primary ammo group at the 5’-terminus of the RNA can then be dertvatized wtth amino-specttic probes Alternatively, dmucleotides derivatized with ammo-specific probes can be used directly in a transcription reaction For modified CTP, use a mixture of 2.5 mA4MnC12 and 2 5 mM MgCl, Sulfurization wtth elemental sulfur should be performed manually, since elemental sulfur may precipitate and clog the delivery tube RNAs containing modified nucleotides, such as nebularme and isoguanosme, at the ligation Junction can be ligated to other RNAs The splint ohgonucleottde should span at least 12-l 5 nucleotides on etther side of the hgatton Junctton. The annealing temperature for hgatton of RNAs shorter than 30 nt should be kept at 16°C

Acknowledgments We are thankful to L. W. McLaughlin for comments, and Nyaya Kelkar and Scott Walker for crltlcal reading of the manuscript. References 1 Heidenreich, O., Pieken, W., and Eckstein, F (1993) Chemically modified RNA approaches and applications. FASEB J. 7,90-96 2. Beaucage, S. L. and Iyer, R. P. (1993) The synthesis of specific rtbonucleotides and unrelated phosphorylated biomolecules by the phosphoramidite method Tetrahedron 49, lo,44 l-l 0,488. 3 Usman, N and Cedergren, R (1992) Explomng the chemical synthesis of RNA TIBS 17,334-339

4 Fu, D -J., RaJur, S. B , and McLaughlin, L W. (1993) Importance of specific guanosme fl-mtrogens and purme ammo groups for efficient cleavage by a hammerhead rtbozyme Bzochemlstry 32, 10,629-l 0,637. 5. Fu, D.-J. and McLaughlin, L. W. (1992) Importance of specific adenosme N7-mtrogens for effictent cleavage by a hammerhead ribozyme A model for magnesmm bmdmg. Bzochemzstry 31, lo,94 l-l 0,949 6 Shatkin, A. J (1976) Capping of eukaryotrc mRNAs. Cell 9,645-653. 7. Hamm, J. and MattaJ, I. W (1990) Monomethylated cap structures facilitate RNA export from the nucleus. Cell 63, 109-l 18. 8. Fihpowicz, W. (1978) Functions of the 5’-termmal m7G cap m eukaryottc mRNA FEBS Lett 96, l-l 1. 9. Shatkin, A. J. (1985) mRNA cap bindmg proteins: Essential factors for mttiatmg translation. Cell 40,223-224. 10. Furuichi, Y., LaFiandra, A., and Shatkm, A. J. (1977) 5’-Termmal structure and mRNA stability. Nature 266,235-239

Chemical

and Enzymatic

Approaches

109

11 Shlmotohno, K , Kodama, Y., Hashlmoto, J , and Miura, K I. (1977) Importance of 5’-terminal blockmg structure to stabilize mRNA m eukaryotlc protein syntheSIS Proc Nat1 Acad Scl USA 74,2734-2738. 12. Murthy, G K., Park, P., and Manley, J. L. (1991) A nuclear mlcrococcal-sensltlve, ATP-dependent exoribonuclease degrades uncapped but not capped RNA substrates Nucleic Acids Res 19,2685-2692. 13. Konarska, M. M., Padgett, R. A., and Sharp, P. A. (1984) Recognition of cap structure m sphcmg in wtro of mRNA precursors. Cell 38,73 l-736 14 Krupp, G., Kahle, D., Vogt, T., and Char, S. (1991) Sequence changes in both flanking sequences of a pre-tRNA influence the cleavage speclficlty of RNase P J. Mel Bzol 217,637-648 15 Gaur, R K and Krupp, G (1993) Modlficatlon interference approach to detect ribose moleties important for the optimal activity of a nbozyme. Nucleic Aczds Res 21,2 l-26 I6 Pitulle, C , Klemeidam, R. G , Sproat, B. S., and Krupp, G. (1992) Initiator ohgonucleotides for the combmation of chermcal and enzymatic RNA synthesis. Gene 112,lO l-105 17. Harris, M E. and Pace, N R. (1995) Identification of phosphates mvolved m catalysis by the rlbozyme RNase P RNA RNA 1,2 10-2 18 18. Stahl, D. A , Krupp, G , and Stackebrandt, E. (1989) RNA sequencing, m Nuclezc Acid Sequencing. A Practxal Approach (Howe, C. J and Ward, E S , eds ), IRL, Oxford, pp 137-183 19. Burgm, A B. and Pace, N. R. (1990) Mapping the active site of rlbonuclease P RNA using a substrate containing a photoaffmity agent EMBO J 9,4 11 l-4 118 20 Eckstem, F (1985) Nucleoside phosphorothloates. Ann Rev Blochem 54,367-402 21 Eckstein, F and Glsh, G (1989) Phosphorothloates in molecular biology. TIBS 14,97-100

22 Griffiths, A D., Potter, B V L., and Eperon, I. C (1987) Stereospecificlty of nucleases towards phosphorothloate-substituted RNA* stereochemistry of transcription by T7 RNA polymerase Nucleic Acids Res 15,4145-4 162 23 Shm, G and Gait, M. J. (1991) Configuratronally defined phosphorothloate-containmg ohgoribonucelotldes m the study of the mechanism of cleavage of hammerhead nbozymes. Nucleic Acrds Res. 19, 1183-l 188 24. Conway, L and Wlckens, M (1987) Analysis of mRNA 3’-end formation by modification interference the only modlficatlons which prevent processmg he m AAUAAA and the poly (A) site EMBO J 6,4177-4184. 25 Ruffner, D E and Uhlenbeck, 0. C. (1990) Thlophosphate interference expenments locate phosphates Important for the hammerhead RNA self-cleavage reaction Nucleic Acids Res 18,6025--6029. 26 Pieken, W. A, Olsen, D B , Benseler, F , Am-up, H., and Eckstem, F. (1991) Kmetlc characterization of nbonuclease-resistant 2’-modified hammerhead rlbozymes Sczence 253,3 14-3 17 27 Aurup, H., Williams, D. M , and Eckstem, F (1992) 2’-Fluoro- and 2’-ammo-2’deoxynucleoslde 5’-tnphosphates as substrates for T7 RNA polymerase. Bzochemzstry 31,9636-9641.

110

Gaur and Krupp

28. Gaur, R. K., Sproat, B. S., and Krupp, G. (1992) Novel solid phase synthesis of 2’-0-methylnbonucleoside 5’-trrphosphates and their a-thro analogues Tetrahedron Lett 33,3301-3304. 29 Conrad, F., Hanne, A., Gaur, R. K., and Krupp, G. (1995) Enzymatic synthesis of 2’-modified nucleic acids: tdentificatton of important phosphate and rtbose moteties m RNase P substrate Nucleic Acids Res 23, 1845-1853. 30 Gaur, R. K. and Krupp, G. (1993) Enzymatic RNA synthesis with deoxynucleostde S-O-(l-thtotrtphosphates) FEBS Lett 315, 56-60 3 1. Iyer, R P., Phillips, L. R , Egan, W., Regan, J B., and Beaucage, S. L (1990) The automated synthesis of sulfur-contammg ohgodeoxyribonucleottdes usmg 3H- 1,2-benzodithtol-3-one 1,l -dioxide as a sulfur-transfer reagent. J Org. Chem 55,46934699 32 Morvan, F., Rayner, B., and Imbach, J. L. (1990) Modified ohgonucleotrdes IV solid phase synthesis and prehmmary evaluation of phosphorothioate RNA as potential antisense agents. Tetrahedron Lett 31, 7 149-7 152. 33 Ott, J and Eckstein, F. (1987) Protection of olrgonucleotide primers against degradation by DNA polymerase I. Blochemutry 26,8237-824 1. 34 Moore, M J. and Sharp, P. A (1992) Site-specific modt’iication of pre-mRNA The 2’-hydroxyl groups at the splice sites. Scrence 256,992-997 35 Moore, M J. and Sharp, P. A (1993) Evidence for two active sites m the sphceosome provided by stereochemistry of pre-mRNA sphcmg. Nature 365, 364-368 36 Tuschl, T , Ng, M M P., Pteken, W., Benseler, F , and Eckstem, F (1993) Importance of exocychc base functional groups of central core guanosmes for hammerhead rtbozyme activity Bzochemistry 32, 11658-l 1668 37 Wyatt, J R , Sontheimer, E J . and Stenz, J. A (1992) Site-specific cross-lmkmg of mammalian U5 snRNP to the 5’ splice site before the first step of pre-mRNA spbcmg. Genes & Dev 6,2542-2553. 38. Gaur, R. K , Valcarcel, J., and Green M. R. (1995) Sequential recognition of the pre-mRNA branch point by U2AF65 and a novel sphceosome-associated 28-kDa protein. RNA 1,407-4 17. 39 Fedor, M J and Uhlenbeck, 0 C. (1990) Substrate sequence effects on “hammerhead” RNA catalytic efficiency Proc Nat1 Acad Scl USA 87, 1668-1672 40 Ztllmann, M., Zapp, M L., and Berget, S M. (1988) Gel electrophorettc tsolatton of splicing complexes containing Ul small nuclear rtbonucleoprotein parttcles Mel Cell B1o1 8, 814-821.

13 Applications

of Modified Transcripts

Rajesh K. Gaur, Frank Conrad, and Guido Krupp 1. Introduction This chapter provides protocols for two different methods that requtre modified transcripts, modification interference and phosphorothioate footprmting. Modification interference is used to identify positions (in substrate or ribozyme RNAs) where moditied nucleotides interfere with ribozyme activity (l-4), Smce all noninterfermg sites can be identified, it is safe to modify these sites without dramatic loss of activity. Thus, these results can be used for the rational design and synthesis of active, highly modified RNAs. In special cases,the enzymatic synthesis of highly modified ribozymes is possible. For example, in the synthesis of hammerhead ribozymes, CTP, GTP, and UTP can be substituted by the correspondmg NTPclS (2). Furthermore, it should be possible to replace UTP by dTTPaS, since deoxyrtbose is acceptable at all uridme positions (5). The recently developed phosphorothioate footprinting procedure is an ideal method to analyze RNA:RNA interactions. As usual, cleavage patterns are compared for free RNA and RNA bound m a complex. Unlike other footprinting methods, here only the chosen RNA type, substrate, or ribozyme carries a welldefined phosphorothioate modification and is thus sensitive to the mild iodine cleavage reaction (6). No undesired modifications occur that completely disrupt Watson.Crick base pairing, like m’A and m3C m footprintmg with chemically modified bases (7). Although not discussedin this chapter, modified transcriptsthat include fluorescent precursors have useful applications. After microinjection of internally fluorescent-labeled transcripts,intracellular distribution can be followed (8) Similarly, the formation of intracellular hybrids between comjected sense and antisense oligonucleotides has been analyzed by applying fluorescence resonance energy transfer (FRET) (9). It should be noted here that the localization of cellular RNAs From

Methods in Molecular Edlted by P C Turner

b?ology, Vol 74 Rbozyme Protocols Humana Press Inc , Totowa, NJ

111

Gaur, Conrad, and Krupp

112

can be conveniently monitored by znsztu hybrldlzatlon with fluorescent-labeled DNA ohgonucleotides, using confocal laser scannmg microscopy (IO). Recently, the site-specifically introduced combmatron of fluorescein and rhodamine dyes in hammerhead and substrate ollgoribonucleotldes has made it possible to use FRET to study rlbozyme kinetics (see Chapter 26). 2. Materials 2.7. Modification interference 2. I. 7. Modification Interference by Chemical Base Modifications of Unmodified Transcripts Pleasenote that all modification reagents are hazardous and potent mutagens All reactions have to be done tn a fume hood. Advlce for the proper discarding

of waste is included in Notes l-3 1 2 3. 4 5. 6.

7

8

9 10.

0 2-l .O x IO6 cpm of end-labeled substrate or nbozyme RNA (Chapter 10) Reaction buffer for your ribozyme and target system. Carrier DNA. e.g., plasmld DNA (avold the use of carrier RNA) 50 r&4 Sodium acetate, pH 4.0 (NaAc) Prepare dlmethyl sulfate (DMS), NaBH,, and diethylpyrocarbonate immediately before use (see Note 1) 2 MNH,OH, pH 10.0, for U-modification Dissolve hydroxylamine hydrochloride m concentrated ammonia (half of the calculated volume to obtain a 2 A4 solution). Add more ammonia until pH 10.0 is reached (control by dispensing drops on pH indicator strips), and add water to the final calculated volume Store frozen at -2O“C (see Note 2) 2 MNH,OH, pH 5.5, for C-modification. Dissolve hydroxylamine hydrochloride m water (half of the calculated volume to obtain a 2 M solution). Adjust to pH 5.5 with diethylamine (indicator strips), and add water to the final calculated volume. Store frozen at -20°C Do not substitute dlethylamme with a different base (see Note 2). 1 MAmIme, pH 4.5. Mix aniline (use a fresh, at most slightly yellowish solution) with water, and adjust to pH 4.5 with acetic acid (mdlcator strips). The mltlally turbid solution will clarify on acldificatlon. Add water to the final calculated volume If a precipitate forms, remove by centrifugation. Store m the dark (wrapped m aluminum foil), frozen at -20°C (see Note 3). “Ice-cold” ethanol for rapid coolmg (stored at -20°C) Polyacrylamlde gel loadmg solution: 8 M urea, 0 03% tracking dyes.

27.2. Modifica t/on Interference by Enzymatic Synthesis of Partially Phosphorothioate-Modified

RNAs

1. 0.2-l .O x IO6 cpm of end-labeled substrate or rlbozyme RNA as partially modlfied transcript (Chapter 12). Note. For each of the four bases, separate RNA synthesis and labeling are required. 2. Reaction buffer for your ribozyme system.

Modified Transcripts 3 4 5 6. 7

113

10 mM HEPES-KOH, pH 7.2. 30 mM I, m ethanol (always prepare a fresh solution of the solid iodine). EtOH-salt-mixture 10 pL of 3 M sodmm acetate, pH 5.0, and 300 pL of ethanol “Ice-cold” 70% ethanol for rapid cooling (stored at -2OT). Polyacrylamide gel loading solutton 8 M urea, 0.03% tracking dyes.

2.2. Phosphorothioate-Footprinting 1, About 50,000-l 00,000 cpm of end-labeled substrate or rtbozyme RNA as partially phosphorothioate-modified transcript (Chapter 12) Note For each of the four bases, separate RNA synthesis and labeling are required 2 Reaction buffer for your rtbozyme system. 3 Prepare fresh solutions of solid iodine m ethanol. 5 mM I,, 10 n&T I,, and 30 mM I2 m ethanol. 4 EtOH-salt mixture. 10 l.tL of 3 Msodmm acetate, pH 5.0, and 300 pL of ethanol 5 “Ice-cold” 70% ethanol for rapid cooling (stored at -2OT). 6 Polyacrylamide gel loading solution 8 Murea, 0.03% tracking dyes.

3. Methods 3.7. Modification interference Partially modified, end-labeled RNAs are used (see Fig. 1) Essentially, each RNA molecule carries only a single modification, and all possible sues are represented For example, a pre-tRNA (with 20 adenosines) is modified m the transcrtption reaction by replacing unmodified ATP with a mixture of 5% ATPoS and 95% ATP After performmg the reaction of interest (e.g., processing by RNase P), unreacted substrate and reaction products are separated by gel electrophoresis. In general, several enzyme:substrate ratios are compared. As a control sample, untreated RNA is also subjected to gel electrophoresis and reisolated to avoid possible artifacts of these treatments. Subsequently, the isolated RNAs are subjected to a cleavage reaction, followed by gel electrophoresis. The obtained cleavage patterns represent the relative amounts of modified nucleotides m the three RNA types. The initial distribution is seen in the control sample. In the unreacted substrate,modified nucleotrdes are detected at positions where they interfere with the analyzed reaction. In contrast, these positions are underrepresented in the reaction products. For these studies, a comparison of the different patterns by densitometer tracing IS often useful. For modtfication interference analysis, the followmg requirements must be met. It must be possible to separate and isolate substrate and reaction products, and to detect the presence of a modification by a specific cleavage reaction. Useful modifications are chemically modified bases, detected by amlme cleavage (I), and phosphorothtoates, cleaved by iodine treatment (2-4). Protocols for both approaches are provided. This includes also our recent extension to modified (2’-deoxy-, 2’-methoxy-) nbose moieties (3,4).

114

Gaur, Conrad, and Krupp Transcription

of partially modified RNA-substrate

-c Gel purification + Endlabeling of the RNA-substrate + Gel purification c Substrate Cleavage Reaction I "One

rl

Molar ratios: FWsubstrate(a) 2

~G~l’ele~t~o~~

Isolation of unreactive substrate 4

t

5

3

i 150 ,-)

Isolation of product 4

4

Fig. 1. Schematic procedure for modification interference analysis Here an example with phosphorothioate modified substrate RNA and iodine cleavage is shown. The end-labeled, partially modified RNA is subjected to the cleavage reaction, and the products are analyzed by gel electrophoresis Subsequently, unreactive substrate and cleaved product are isolated from the gel, separately for each reaction. Finally, the modified nucleotides are detected by iodme cleavage (+ lanes for samples l-5), checked for unspecific background cleavage (- lanes for samples l-5), and compared with a sequence ladder obtained by alkali treatment (lanes OH) ca)Acontrol reaction without ribozyme (lane 1) and reactions with different ribozyme/ substrate ratios (lanes 2-5) are compared. (‘)Interference at this site is overcome by high ribozyme excess. This means that the correspondmg band occurs m the product obtained with high amounts of ribozyme (samples 2). (*)Interference at this site IS not overcome by high ribozyme excess. The corresponding band m the product is absent (samples 5) or weak (samples 2). c3)In the ribozyme reaction, a fragment with this interfering site is cleaved off Interference is obvious by stronger bands m substrate samples 2 and 3.

Mod/fled Transcripts

115

3.1.1. Modification Interference by Chemical Base Modifications of Unmodified Transcripts A generally useful, streamlmed protocol for chemical RNA sequencing 1s provided that avoids the use of hazardous, anhydrous hydrazine (I, II). Endlabeled, umnodtfied transcripts (or otherwrse isolated RNAs) are used, and modified bases are mtroduced. These partially modified RNAs are subjected to the reaction of interest (e.g., target cleavage by ribozyme) and finally analyzed after cleavage by aniline treatment. It is prudent to carry out chemical RNA sequencing first without modtfication Interference to check that all solutions are working and to familiarrze oneself with the protocol. To do this, carry out steps l-3 below (see Notes 4 and 5), omit steps 4 and 5 and contmue from step 6. 1 Chemical base modifications. Mix about 0 2-l .O x lo6 cpm of end-labeled RNA with 80 pg of carrier DNA (carrier RNA should be avoided, since it could copurify with the labeled RNA). 2. Distrtbute to four mtcromge tubes, labeled A, G, U, and C 3 Dry down m a vacuum centrifuge and follow the procedures in Table 1 The partially modttied RNAs created by the operations m Table 1 can be used directly as substrates in the reactton of interest before carrying out the amlme cleavage step 4 Perform your reactton (e g., ribozyme cleavage) as usual. A mimmum of 10,000 cpmsample should be used. Leave an untreated control sample and use several enzyme substrate ratios (expected product formation should range between 20 and 80%) 5 Reisolate (see Note 6) the control RNA, unreactive substrate, and reaction products by gel electrophoresis (see Chapter 10, Section 3.1 1 ) 6 Amlme cleavage: Dtssolve each RNA pellet m 50 pL of 1 A4 aniline, pH 4 5 7 Incubate for 20 min at 60°C 8 Stop the reaction by ethanol precipttatton. Add 150 pL of NaAc, pH 4 0, and 650 pL of ethanol. 9 Mix and centrifuge immediately for 15 min in a microfuge. 10 Remove the supernatants by pipeting, wash the pellets with 800 pL of ethanol, and centrifuge agam for 15 mm 11 Remove the supernatants, dry the pellets, and dissolve each m 5 pL of polyacrylamide gel loading solution If convement, the samples can be stored frozen 12 Denature by boiling for 2 mm, chill on ice, centrifuge briefly, apply onto a sequencing gel, electrophorese, and autoradiograph.

3.1.2. Modification Interference by Enzymatic Synthesis of Part/ally Phosphorothioate-Modified RNAs Phosphorothioates have attracted much attention, both as nuclease-resistant nucleottde modrficattons and as tools In the analysis of reaction mechantsms.

Table 1 Reaction

Conditions

for Chemical

RNA Sequencing= Specificity

ReactIons

v s

Gb

A, G

U

C

Modification

10 pL 0.3% DMS m NaAc

150 & NaAc 1 pL diethylpyrocarbonate

10 pL 2M NH20H (PH 10)

10 /.L 2M NH20H @H55)

Incubation

40 sl9O”C

10 min/90”C

40 s/9O”C

7 min/90”C

STOP and 150 pL NaAc EtOH preclpltatlon

400 pL EtOH 650 pL EtOH

150 pL NaAc

150 pL NaAc 550 & EtOH

550 clr, EtOH

Second EtOH precipitation

-

150 & NaAc 450 & EtOH

150 & NaAc 450 & EtOH

150 pL NaAc 450 & EtOH

EtOH wash

800 j.L EtOH

800 j.L EtOH

800 pL EtOH

800 $ EtOH

“Add the specified modtficatton solutton(s) to the dry RNA, and incubate as indicated Vary the reactton times tf too mild or too strong cleavages are observed The reactions are termmated by mtxmg with NaAc and ethanol No freezmg step 1s required Centrifuge for 1.5 mm m a mtcrofuge Discard the supematant, and contmue with steps as described If desired, the modified RNAs can be stored at -20°C m 800 pL of ethanol at the final wash step Before further use, the washed RNA pellet 1s dried m a vacuum centrifuge Tar the G-speck modtticatton, an addmonal reduction step IS recommended Dissolve the dry RNA m 10 pL of 0 SMNaBH, (m H,O), and incubate for 10 mm on me Stop the reaction by ethanol prectpttatton (add 150 pL of NaAc, 650 pL of ethanol), centrifuge for 15 mm, wash the pellet wtth 800 pL of ethanol, centrifuge again, and dry the pellet For modtficatton interference, proceed from Section 3 1 1 , step 4 If only chemical sequencing IS intended, proceed from Sectton 3 1 1 , step 6

Modified Transcripts

117

Fully modified ribozymes or substrate RNAs are inactive. Therefore, interfering sites must be known where these modifications have to be avoided. Apart from the tedious chemical synthesis and analysis of all possible variants, modification interference is the method of choice. Until recently, only phosphorothioates could be analyzed by using the specific iodine cleavage reaction (2). This was not possible with the very interesting 2’-deoxy- and 2’-O-methylribose modifications, because they could not be detected by a cleavage reaction. This limitation has been overcome by linking the modification with the cleavable phosphorothioate. This was achieved by enzymatic RNA synthesis with 2’-deoxy-ATPaS and 2’-deoxy-TTPaS (3). More recently, we developed (4) modified transcription reaction conditions, to make available the full range of all eight 2’-deoxy- and 2’-methoxy-NTPaS (see Chapter 12). For the interpretation of the data obtained, it must be kept in mind that a few sites where 2’-modifications interfere can remain unnoticed. It is not possible to recognize interfering ribose modifications at those sites where phosphorothioates alone interfere. However, the complete set of all noninterfering sites is recognized. 1. Prepareabout 50,00~500,000 cpm of end-labeled,partially modified RNA This

2. 3. 4. 5. 6. 7 8 9 10

RNA is obtained by enzymatic synthesis, and the modification level should result m about one modified nucleotide position per RNA molecule (see discrimmation factor m Table 1 of Chapter 12 and Notes 7 and 8) Perform steps 4 and 5 in Section 3 1 1. Iodine cleavage: Dissolve the pellets m 10 pL of 10 mMHEPES-KOH, pH 7 2 Denature by heating for 2 mm at 70°C. Chill on ice and centrifuge briefly. Add 1 pL of 30 rnM I2 in ethanol (freshly prepared). Leave for 1 min at room temperature. Stop the reaction by ethanol precipitation. Add 30 pL of an EtOH-salt mixture, freeze on dry ice, and then centrifuge for 15 mm Remove the supernatants by pipetmg, wash the pellets with 800 & of 70% aqueous ethanol, freeze on dry ice, and centrifuge again for 15 min. Remove supernatants, dry the pellets, and dissolve m 5 pL of polyacrylamide gel loading solution. If desired, store frozen Do not heat the sample, centrifuge briefly, apply onto a sequencing gel, electrophorese, and autoradiograph See Fig 1 legend for points regarding interpretation (2-4).

3.2. Phosphorofhioate Footprinting This method was developed initially to analyze the interaction of tRNAs with their cognate synthetases (6). Several advantages m the analysis of RNA recognition are evident: Only the modified RNA can be cleaved, unlike the mdiscrimmate action of nucleases or EDTA-mediated cleavage; only the desired modifications ity of Watson:Crick

are introduced with very moderate effects on the stabilbase pans, in contrast to chemical base modtticatrons,

118


which can disrupt base pairing (7); strict control of the modrfkation level avoids secondary cleavages; rt provides high resolutron up to the level of mdivrdual phosphodiester sites; and last, but not least, the versatrle iodine cleavage reaction can be used m any desired concentration of monovalent and dtvalent ions, and thus can be performed m rlbozyme reaction buffer. 1 Prepare about 60,000 cpm of end-labeled, partially phosphorothloate-modified RNA Thus RNA is obtained by enzymatic synthesis (see Chapter 12), and the modlficatron level should result m about one modified nucleottde positton per RNA molecule (see Notes 7 and 8) 2 Distribute six altquots of the RNA (each about 10,000 cpm) m microfuge tubes, labeled -0 5, -1, -3, and +0 5, +l, +3, and dry m a vacuum centrifuge. 3 Dissolve each sample in 10 pL of reactton buffer for your rlbozyme system The three “-” tubes are left wrthout the reaction partner (rrbozyme or substrate RNA), which is addedto the three “+” tubes (seeNote 9) 4 Iodine cleavage using three different rodme concentrations. Add 1 pL of 5 WI2 m ethanol to the tubes labeled “0.5.” Add 1 pL of 10 mM I2 to the tubes labeled “1,” and add 1 pL of 30 mA4I2 to the tubes labeled “3” 5. Ensure that each tube is left for exactly 1 min at room temperature 6 Stop the reactions by ethanol precipitation and continue exactly as m Section 3. I .2., step 7 (seeNotes 10 and 11).

4. Notes 1. Thesecompoundshydrolyze slowly m water Leftover material can be discarded in a beaker with a large excessof water (but keep one separatebeaker for each compound!) Keep covered m the fume hood, and after a few days, the solutions are harmless 2 Leftover materral can be discarded in a beaker with a large excessof 3 A4FeC13 3 Leftover material can be discardedm a beaker with a large excessof water 4 In addition to the base-specificcleavage reactions, a random sequenceladder is useful It can be obtained by alkali cleavage of the unmodified RNAs (seeChapter 10, Section 3.3.2 ) 5. In chemical RNA sequencing, if you observe high background of nonspecific cleavage products, increasethe reaction times in the modification steps A higher extent of specific cleavage can eliminate nonspectfic fragments 6 Modified RNAs are more sensitive to improper buffer conditions, and nonspecific fragmentatton can occur m the gel elution buffer The gel elution buffer should be carefully adjustedto pH 7 0 (final pH of the mixture’) About 20 pg of carrrer RNA should be added to the mitral 200 $ elutron. Ethanol precipitate as usual, and dry the pellet. Phosphorothroate-modifiedRNAs are also sensitive. If possible, include 10 pg of carrter RNA/sample, e g , durmg gel elution after the modification interference reaction or prior to ethanol precipitation after the iodine cleavage reactions 7 For each of the four bases,a separateRNA synthesis and analysis are required.

Modified Transcripts

119

8. In addttion to the base-specific cleavage reacttons, a random sequence ladder is useful It can be obtained by alkali cleavage of the unmodified RNAs (see Chapter 10, Section 3.3 2.) Also phosphorothioate-modified RNA can be used for alkali cleavage 9 It should be checked (for example, with gel-shift assays) that under the chosen conditions, a high percentage of the partially modified RNA is bound m the enzyme*substrate complex. 10 Significant effects occur consistently at all iodine concentrations 11 In general, the effects m phosphorothioate footprint analysts are rather weak Therefore, it 1s essential to use densitometer scanning of X-ray films (or a phosphortmager) for the comparison of cleavage patterns (6) The goal of this analysis is to obtain a detailed picture of the sites where the conformation of the phosphodtester backbone is changed on complex formation This can result in weaker cleavage or protection, usually interpreted to indicate direct bmdmg sites. If stronger cleavage is observed after complex formation, this is regarded as an (indirect?) effect of conformational changes. An alternative approach 1s bmdmg interference. Here, the positrons are identified where the mtroductton of phosphorothioates interferes with complex formation owing to lost magnesmmbmdmg sites These magnesium sites can be involved directly in complex formation, or they are more distant from the mteractmg sections and cause indirect conformational changes For more details, consult ref. 12

References 1. Kahle, D , Wehmeyer, U., and Krupp, G. (1990) Substrate recognition by RNase P and by the catalytic Ml RNA. identificatton of possible contact points m pretRNAs EMBO J 9, 1929-1937 2 Ruffner, D. E and Uhlenbeck, 0. C (1990) Thiophosphate interference experiments locate phosphates important for the hammerhead RNA self-cleavage reaction Nucleic Acids Res 18, 60254029 3 Gaur, R K and Krupp, G (1993) Modification interference approach to detect ribose moieties important for the optimal activity of a ribozyme Nuclezc Aczds Res 21,2 l-26 4 Conrad, F , Hanne, A , Gaur, R K., and Krupp, G. (1995) Enzymatic synthesis of 2’-modified nucleic acids identification of important phosphate and ribose moieties m RNase P substrates Nuclezc Aczds Res 23, 1845-l 853 5. Perreault, J -P , Wu, T., Cousmeau, B., Ogilvte, K. K., and Cedergren, R (1990) Mixed deoxyribo- and riboohgonucleottdes with catalytic activity Nature 344, 565-567

6. Rudmger, J., Puglist, J D , Putz, J., Schatz, D., Eckstein, F., Florentz, C , and Giege, R. (1992) Determinant nucleottdes of yeast tRNAASp interact directly with aspartyl-tRNA synthetase Proc. Nat1 Acad Scz USA 89,5882-5886 7 Ehresmann, C., Baudm, F , Mougel, M , Romby, P , Ebel, J -P , and Ehresmann, B (1987) Probing the structure of RNAs m solutton Nuclezc Aczds Res 15, 9109-9128.

120


8. Jacobson, M. R., Cao, L G., Wang, Y -L., and Pedersen, T (1994) The RNA subunit of rtbonuclease P rapidly locahzes in the nucleolus after mtcromJectton mto the nucleus of hvmg cells. J Cell Blochem ltIC(Suppl.), 115 9 Sixou, S , Szoka, Jr F C , Green, G A, Giustt, B , Zon, G., and Chin, D J ( 1994) Intracellular ohgonucleottde hybridtzation detected by fluorescence resonance energy transfer (FRET). Nucleic Acids Res 22, 662-668 10. Harders, J , Lukacs, N , Robert-Ntcoud, M , Jovm, T M , and Rtesner, D ( 1989) Imaging of vtroids m nuclei from tomato leaf tissue by zn sztu hybrtdizatton and confocal laser scanning microscopy EMBO J 8, 3941-3949 11 Krupp, G. (199 1) Direct sequence analysis of small RNAs, zn Nuclezc Aced Techniques In Bacterzal Systematlcs (Stackebrandt, E and Goodfellow, M., eds ), Wiley, New York, pp. 95-l 14. 12. Hardt, W.-D, Warnecke, J M , Erdmann, V A, and Hartmann, R K (1995) R,-phosphorothtoate modificattons m RNase P RNA that interfere wtth tRNA bmdmg. EMBO J. 14,2935-2944.

Cloning Strategies for Catalytic Antisense

RNAs

Martin Tabler and Mina Tsagris 1. Introduction Catalytic antisense RNAs combine two RNA-based strategies for gene suppression: the antisense approach and the rlbozyme approach. Like ordinary antisense RNA, catalytic antisense RNAs are characterized by a relatively long stretchof sequences(>30 bases)that are complementary to the target RNA. Snmlar to engineered nbozymes, they contain, however, an additional functional domain (or a multiple thereof) of a catalytic RNA. In other words, catalytic antlsense RNAs associate to their target RNA in the same manner as conventional antlsenseRNAs, and as a second element of their suppressive function, they induce chemical cleavage of the phosphodiester backbone of their target RNA by the same mechanism as nbozymes. Thus, the main distinction between catalytic an&senseRNAs and conventional nbozymes 1sthe size of the antisense regions flanking the catalytic domain, which results m a different cleavage mechanism. Conventlonal rlbozymes can act as true catalysts and are designed for a multiple reaction cycle conslstmg of three phases: 1 Association

with the target RNA

2 Cleavage of the target RNA 3. Dmoclatlon

of the cleavage products.

Having completed these three phases, the ribozyme molecule may enter a new reaction cycle. For effective turnover, assoclatlon of target RNA and dlssoclatton of product RNA must proceed under the same reaction conditions with substantial rates. Effective dissociation requires relatively short antisense sequences. This demand allows just a small window for a reasonable size of the antisense sequence. Problems arise if the target region is embedded m a stable secondary structure so that a relatively small antisense sequence cannot open such a structural element, which may result in ineffective assoclatlon rates. From

Methods Edlted

by


Bology, Humana

121

Vol 74 Rlbozyme Press

Inc , Totowa,

Protocols NJ

122

Tabler and Tsagris

On the contrary, catalytic antisense RNAs are designed for opttmal assoctanon, and a longer anttsense region might be better suited to resolve such stable structural domains of the target RNA. It may find an “entry site” (“kissmg structure”) for hybridizatton, from whtch complete duplex formation proceeds. The reaction scheme of catalytic antisense RNA can be described as: (1) association with the target RNA or (2) cleavage of the target RNA. Compared with multiturnover ribozymes, the product dtssoctation step is disregarded, since the long antisense sequence most likely prevents melting of the duplex RNA. Therefore, catalytic antisense RNAs will inactivate their targets on a 1: 1molar ratio, i.e., a stoichiometric rather than a catalytic mode. However, great attention is paid to the association step, and the length of the antisense arm is chosen for fast hybrtdtzation kinetics (see Chapters 16 and 30). It has been shown that the presence of a catalytic domain m an antrsenseRNA enhancestts inhibitory effects when used to inhibit rephcation of human immunodeficiency virus type 1 (HIV-l) m hvmg cells (I). Catalyttc antisenseRNAs have so far beenbased on hammerheadribozymes and have been applied to suppressthe eye ptgmentation genein Drosophila melanogaster and the npt genein plants (2,3) The following protocol describes a cloning strategy to incorporate the catalytic domain of the hammerhead ribozyme into a cDNA via premade DNA cassettesorigmally described by Tabler and Tsagris (4) some years ago. This strategy requires that certain restriction sites overlap the consensus target sequence for hammerhead ribozymes, NUX&. These sites can be used for mampulattons and msertion of short DNA sequencesas outlined for a SaZI site m Fig. 1. As a result, DNA constructs are generated that allow the synthesis of an antisense RNA that has the catalytic domain of the hammerhead ribozyme mcorporated somewhere m the middle. Other PCR-based strategies for constructmg similar RNAs are described m the Chapter 16. 2. Materials 2.1. Selection of a Target Site 1, Computer facilities for sequenceanalysis. 2 A vector system-preferentially a plasmid vector-that allows m vttro synthesis of RNA from specific promoters by RNA polymerases derived from bactertophages, such as T3, T7, or SP6.

2.2. Preparation

of the Synthetic DNA Cassette

1, Two synthetic DNA oltgonucleotldes. 2. 1OX T4 Polynucleottde kmase (PNK) buffer: 500 mM Tris-HCl, pH 7 6, 100 rmI4 MgCl*, 50 n&I dithiothrettol, 1 mM spermrdme, 0 25 mg/mL BSA (molecular biology grade), 1 m/U ATP. 3. T4 Polynucleottde kmase (molecular biology grade).

Cloning Strategies cDNA

123 5

3’

NNNN ,,,I N’N’N’N’

GTCGAC NNNN II,,,, II,, CAGC T G N’N’N’N’

Sal I dIgesflon

3’

sense

strand

5’

antisense

strand

4

5’NNNN 001, 3’ N’N’N’N’

G d CAGCT

5’NNNN D!lIO 3’ N’N’N’N’

G 0 C

7i~IlIJIlIJflg

TCGAC ;;

NNNN ;,l;s;,;,

3’ 5’

C ;;

NNNN3’ ;,;,I;,;,

5’

4

LIga tlon

4

catalytic

antlsense

RNA

-=Gk=

transcription

Fig. 1. Strategy of constructmg catalytic anttsense RNAs by inserting synthetic DNA cassettes into cDNA The strategy exploits the fact that certain NUX& motifs (N = A, C, G or U, X = A, C, or U) overlap with restriction sites For example, the GUC motif is part of the SalI recognition sequence (G/TCGAC) The four mternal nucleotides TCGA of the WI site correspond to nucleotides 16.1, 17, 1.1, and 1 2 according to the numbermg systems for hammerhead rtbozymes (5, see also Ftg 2 of Chapter 16) These nucleotides are removed by Sal1 digestion and subsequent trimming of the protrudmg ends Then, a synthetic DNA cassette IS inserted, comprismg the catalytic domain (hatched part), and additional terminal nucleotides, which replace three of the four substrate-specific nucleotides (16.1, 1 1, and 1 2) (.5J, previously removed from the protruding SalI ends by trimmmg Depending on the orientation of insertion, an RNA can be transcribed from the recombmant DNA, which is able to cleave the target RNA This msertion strategy can be used for the restriction enzymes listed m Table 1 Depending on the protrudmg ends, the DNA cassette needs to be modtfied accordmgly (modified from ref 4, with permission). 4 A beaker of about 400 mL, filled with about 150-200 mL of botlmg water and a device to incubate a 1 5 mL microfuge tube m the boilmg water (e.g , an Eprak msert, Scotlab).

2.3. Cleaving and 7’rimming the CD/VA 1 About 5 l.tg of a recombmant plasmid DNA. 2 Restriction enzymes. 3. Nuclease Sl buffer: 225 mMNaC1, 30 &potassium acetate, pH 4 5, 200 pA4 ZnS04, and 5% (v/v) glycerol. 4. Nuclease S 1 (molecular biology grade) (Boehrmger Mannhetm). 5. Ice bath. 6 Nuclease Sl stop buffer 300 mM Tris-HCI, pH 8 0, 50 n-J4 EDTA

Tabler and Tsagris

124

7 65°C Water bath 8 Phenol and chloroform/tsoamyl alcohol 24: 1 (v/v) for DNA extraction 9. TE Buffer: 10 mMTris-HCI, pH 8 0, 1 mA4EDTA (store as a 100X stock)

2.4. Incorporation

of the DNA Cassette into cDNA

1. About 0.5 pg of a trimmed DNA prepared according Sectton 3.3. 2 T4 DNA hgase. 3 Blunt-end ligation buffer 50 mA4 Tris-HCl, pH 7 5, 10 mM MgC12, 5% (v/v) PEG 8000, 1 mM DTT, and 100 ILL! ATP (store as 5X buffer without ATP) 4. 12°C Water bath or incubator. 5. Competent Escherrchia coli cells suitable for transformation 6 Restriction enzymes S&I and/or XhoI 7. Materials for DNA sequencing

2.5. Testing the Construct

in a Ribozyme Assay

1 A 32P-labeled m vitro-synthestzed RNA transcript of the target RNA. 2. Restriction enzymes for lmearization of the DNA construct encoding the catalytic antisense RNA. 3. RNase A (DNase-free). 4. Bacteriophage-encoded RNA polymerase (SP6, T3, T7) and transcrtption buffer according the mstructions of the manufacturer 5. Rtbonucleoside-triphosphates. 6. RNasm (RNase-inhibitor). 7. DNase I (RNase-free). 8. Separate stock solutions of 1 it4 Trts-HCl, pH 8.0, 1 M MgCl,, and 250 n-uV EDTA, pH 8.0. 9. Facilities for gel electrophoresis on denaturatmg polyacrylamide gels 10. Gel dryer.

3. Methods 3.7. Selection of a Target Site Suitable for Incorporation of a Premade DNA Cassette Specific for Hammerhead Ribozymes and Subcloning of the cDNA Fragment 1 Check m the target sequence for the presence of the restriction recogmtion sites listed in Table 1. 2. Select a suitable target motif that overlaps with a restriction site For example, If the cDNA contains an &zfl site (G/TCGAC), you can utilize its GUCJ motif for ribozyme construction (see Note 1) 3 Check that the cDNA fragment contams the site m question only once (see Note 2) 4. Check that the transcription vector m which you intend to subclone your cDNA (or m which it is already mserted) does not have the restriction recogmtton sequence that you selected in step 2. If the site m question is present m the polylmker (for example, s&I), make sure that you subclone your cDNA fragment such that the restrtctton site of the polylinker is deleted.

Clonmg Strategies

125

5 Subclone your cDNA fragment mto a transcription vector(s), preferably systems usmg bactertophage-encoded promoters, such as T3, T7, or SP6 You should be able to synthesize in vitro a sense and an antisense RNA of your cDNA. Plasmids that allow transcription m either dtrection owing to the presence of two different promoters, such as the pBluescript (Stratagene, La Jolla, CA) series or related plasmids, are preferred (see Note 3). 3.2. Preparation

of the Synthetic DNA Cassefte

1. Check the sequence of the synthetic cassette according to Table 1 For example, for a SalI site the following two DNA ohgonucleottdes are requtred: 5’ TTTCGGCCTCGAGGCCTCATCAGGA 3’ 5’ TCCTGATGAGGCCTCGAGGCCGAAA 3’ (see Table 1, No 8) 2. Synthesize the two DNA oligonucleotides required for the DNA cassette 3. Dissolve the synthetrc DNA oligonucleotides at a concentration of 1 OD,,, U/n& 4. Take 2 yL of the synthettc DNA oligonucleotide (this corresponds to about 8 pmol) m a total of 20 @. of 1X T4 PNK buffer. 5. Add 5 U of T4 PNK, and incubate at 37°C for 30 mm. 6 Add another 5 U T4 PNK, and incubate for another 30 mm 7 Mix the two kinase reactions 8 Heat the mtxture to 100°C for 1 min m a beaker of water, and let it cool down slowly to room temperature over about 1 h. This will anneal the two ohgos to produce the synthetic double-stranded cassette, which may be directly used for ligation and which can be stored at -20°C.

3.3. Cleaving

and Trimming

the cDNA

1. Digest about 5 pg (at least 2 ug) of the recombmant plasmrd with the restriction enzyme selected from Table 1. 2 Check an aliquot for complete digestion on an agarose gel. 3. Dissolve 2 pg of the cleaved plasmtd m 100 pL of 1X S1 buffer, and premcubate on me for about 10 mm (see Note 4) 4 Dilute nuclease Sl m 1X Si buffer to a final concentration of 1 U/pL, and also preincubate on ice 5 Add 2 U of the nuclease S 1 to the DNA, mix quickly, but do not centrifuge down to avotd any heating of the sample (unless a centrifuge m the cold room is used). 6. Incubate for 20 mm on me 7. Add 100 pL of Sl stop buffer, incubate for 10 min at 65“C, phenol-extract the DNA, extract with chloroforrn/isoamyl alcohol, and recover by precipttation with ethanol or isopropanol. 8. Dissolve the DNA in TE buffer, and load an aliquot on an agarose gel for esttmatlon of recovered maternal.

3.4. lncorporafion

of the DNA Cassette into cDNA

I. Dissolve two aliquots of about 200 ng of trimmed plasmtd DNA m 1X blunt-end ligation buffer

Tabler and Tsagris Table 1 Summary of Different Synthetic DNA Cassettes Suitable for insertion into Restriction Sites for Generation of Ribozyme-Encoding DNAs *----------------------------------------------------------------------------+ ReStT1CtlO” Recognltlonseg 1 sequenceof ) Number b DNAcasseetea enzyTnrme,a) WlCh I I cleavable=

I I

Ill

I

5’

TTCGGCCTCGAGGCCTCATCAG

G

3’

ACCI

3’

AAGCCGGAGCTCCGGAGTAGTC

C

5’

*cc1

(2)

5'

d

Cl.31 &tax

I +-----------------.----------------------------------------------------------+

I

d


T

3' AAGCCGGAGCTCCGGAGTAGTC A I +-.-----------------..-------.-----------------------------------------------+

3’

ACCI

5'

ACCI

d d

e

T TTCGGCCTCGAGGCCTCATCAG A

3'

BSU36I

A AAGCCGGAGCTCCGGAGTAGTC T 3' I +_________________..____________________-------------------------.

5'

ESPI e

I


3'

AAGCCGGAGCTCCGGAGTAGTC

5’

f AVaII Eco01091g

1

(3)

(4)

I I

5'

5’ 3’

GT CA

Ppmur f f

K5tII

I

I

WGAC

I

GTKGAC &,L&GAT

I

?ZT.LCGM

I

-TAC

I

-TAC

I

Cm= Gsu.NAGC -----------+ GI!Z!CC

I I

RGIGKCY

I

RG/Q&XY

I I

CGIWCG

+----------------------------------------------------------------------------+ I

IS1

S’GAT 3 CTA

TTCGGCCTCGAGGCCTCATCAG AAGCCGGAGCTCCGGAGTAGTC

3’ 5’

/

(6’

CT

G/GiU.CC T/G-

AIGmT

BSCYI RIGAKY ______________________________+

I +____-____-_________----------.---------------5’ 3’

BarnHI BCll

BglIx


G

GA AAGCCGGAGCTCCGGAGTAGTC C

I +-----------____________------------------------------------------------------.-+ 5' GT TTCGGCCTCGAGGCCTCATCAG C 3’ CA AAGCCGGAGCTCCGGAGTAGTC G I (I)

3

AYZTI

CI’XAGG

5'

NheI SW1

G/CTi,GC AIUGT

Xbal

h

TI!XJ,GA

3'

Acc651

GIG,XC

5

Kpnr SSlWI

GUCIC CIGTACG T/GT&ZA

.e*rG*

I T A


GA

3’

AVdI

CT

5’

SalI

1

Xhol

I 19’ 5’

T


GG

A AAGCCGGAGCTCCGGAGTAGTC CC 3’ +------------------.-------------------------------~----------------.--..----+ TTCGGCCTCGAGGCCTCATCAG I (lo) 5'3’ +-----------.------------------------------------.-.---.-...

RAGCCGGAGCTCCGGAGTAGTC

3

I

AYaI

ATG TAC

3’ 5’

BspHI

CGG GCC

3’ 5’

BSpEI

TAG

3

ma1

k


I

-GRG

I

I

I

-ATGA _--_-____________+

k

-CGGA

I

-TAGA

I

AAGCCGGAGCTCCGGAGTAGTC AGC 5' +--------------------------------.-----------------------.--.----------------+ (12’

3’ 5

5 GT TTCGGCCTCGAGGCCTCATCAG I I131 3’ CA AAGCCGGAGCTCCGGAGTAGTC I +---------------------------.-------------.---------...----.-----------------+ T TTCGGCCTCGAGGCCTCATCAG I (141 5’ 3 A AAGCCGGAGCTCCGGAGTAGTC I +----.-----------------------------------------------------------------------+

AC TG

3

ssrEIIe

GIGmACC

I

ASel

AWU,ATC

I

5 3 5’

aThe synthetic DNA cassette consists of two DNA ohgonucleotldes, sequence comprises the catalytic domain* 5’ 3’

I I I

-GRG -GAC -GAG

5'

k TTCGGCCTCGAGGCCTCATCAG AAGCCGGAGCTCCGGAGTAGTC I ‘11) 5’3’ +______________.________________________----------------------------...------+

I

I


the double-stranded

3’ 5’,

plus some additional nucleotlde(s) at the S- and/or 3’-end(s), which replace nucleotldes of the restrxtlon site that ~111 be removed by trmunmg, the catalytic domam has been modified so that it contams a StuI and a XhoI site

Cloning Strategies

127

2. Make an estimate of the molar@. A plasmtd of 3000 bp will have a mol wt of about 2 x lo6 Dalton, so that 200 ng would correspond to about 0 1 pmol. 3 Set up two ligation reactlons, one with about a threefold molar excess of DNA cassette and a second one with about a lo-fold molar excess Keep the volume as small as possible (5-10 pL), and incubate at 12°C for 3-12 h with about 2 U of T4 DNA ligase. 4 Transform any suitable E colz strain 5 Screen colomes for the presence of recombinant plasmlds by digesting minipreps with S&I and/or XhoI, which ~111 be introduced by the DNA cassette 6 Confirm correct insertion of the DNA cassette by sequencing. Instead of sequencing, it 1s possible to carry out a ribozyme assay first as described m Section 3 5. However, the exact sequence of each construct should be confirmed

3.5. Testing the Construct

in a Ribozyme Assay

1 Synthesize radloactlvely labeled target RNA by m vitro transcription, and dlssolve It m 10 mM TE buffer (see Note 5) 2 Prepare DNA of the recombinant plasmlds that contam the synthetic cassette. This can be “mmlprep DNA ” 3. Linearize the DNA (about 0.5-l pg) with a restriction enzyme that cleaves downstream of the catalytic antisense RNA. Add about 10 ng of DNase-free RNase to the digestion. 4 Extract twice with phenol and preclpltate the DNA 5. Synthesize catalytic antisense RNA by m vitro transcriptlon with the appropriate RNA polymerase (SP6, T3, T7) m a reactlon volume of 20 pL (without any radlonucleotides, but in the presence of RNasm m a concentration as recommended by the supplier) using all the linear DNA as template. 6. At the end of the reaction (typically about l-2 h), add 1 U of DNase I (RNasefree) to the transcription mixture, and incubate for 5 mm at 37°C 7 Inactivate RNA polymerase and DNase I for 10 mm at 6O’C. 8. Adjust an aliquot of the radioactively labeled substrate RNA to a final concentration of 50 mA4Tris-HCl, pH 8 0, and 30 mMMgC12. Take 10 pL of this mixture, ‘The restrlctlon enzymes that can be used m combmatlon with this DNA cassette CThe recogmtlon sequence 1sgiven and the positton ofthe cleavage site IS indicated, the cleavable motif corresponds to nucleotlde 16 2, 16 1, 17 (5) according to the numbering system for hammerhead RNAs (cf Fig 1) and IS underlined dAccI 1s able to cleave four different sequences, in line with this, cassettes (1) and (2) can be used for this enzyme.

“The nucleotlde N of the recognltlon sequencecan be any nucleotlde and should not be G fw can be A or T and should be T for usmg the msertlon strategy gN should be T hXbaI contains a second motif, cf cassette No (12) ‘AvaI can be used for the insertion strategy if Y = T and the cassettes (8) or (9) are needed depending on whether R = A or R = G kThe nucleotlde preceding the actual recogmtlon sequence forms nucleotlde 16 2 of the resulting hammerhead

128

9. 10 11 12

Tabler and Tsagris add 10 pL of the transcrtptton mixture (obtained with cut DNA), and incubate for 1 h at 37’C Use another 10 pL of labeled substrate RNA as a control, and mcubate under the same conditions with 10 pL of 1X transcription buffer, without any DNA or enzymes added Add EDTA to a final concentration of 25 rnM, phenol-extract, add sodium acetate to a final concentration of 0 2 A4, and precipitate with ethanol Analyze reaction products, together with the control RNA, on a denaturatmg polyacrylamide gel. V&.talize reaction products by autoradiography Check for two defined cleavage products that are not detectable for the control reaction

4. Notes For selecting target regions for the catalytic anttsense RNA, you should consult Chapters 2 and 3 For selecting a cleavable motif from Table 1, it should be noted that different NUX& motifs (N = A, C, G, or U; X = A, C, or U) are cleaved with different efficiencies by catalytic antisense RNAs based on hammerhead ribozymes. The relative rates are also influenced by the sequence context of the NUX& motif, but as an mdication, the following order of preferred motifs may be considered. NUC& > NUA$ > NUU&, and GUX& = AUXJ = > CUXL = UUX*l (6,7). According to our experience, good cleavage results can be expected with a GUC&, AU&, or UUC& motif The insertion strategy requires that the restriction site of interest that you have selected from Table 1 is present only once. Subclonmg of a shorter fragment can overcome problems caused by the presence of several sites It has been described that catalytic antisense RNAs are characterized by long antisense arms. There IS no clear answer regarding how long the antisense flanks should be The essential factor is the association with the target RNA Rittner et al. (8) have described that the association rates are influenced by the length of the antisense RNA It is, however, not possible to predict which length of the antisense flank will result in optimal hybridization Therefore, any length ranging from 10 nucleotides to several hundred nucleotides may be chosen mitially. Subsequently, different sizes of the antisense flanks may be analyzed for their association rates The trimming of the protruding single-stranded ends generated by digestion with restriction enzymes is carried out at 0°C to prevent “mbbhng” of the nuclease mto double-stranded regions of the DNA This is a general problem, especially for DNA termmi with multiple A:T pairs. In that case, the double-stranded DNA ends “breath,” i.e , both strands open for a short period of time Low temperature mmimizes this effect, however, leaving the nuclease Sl sufficiently active for degradation of the single-stranded ends. Other enzymes that degrade smglestranded DNA, for example, mung bean nuclease, are not active at that temperature The RNA transcript used for the ribozyme assay does not necessarily need to be radioactively labeled. Other detection mechamsms, such as staining, ~111 also

Cloning Strategies

129

work. However, conventtonal detection (staining with ethidmm bromide, stlverstammg) ~111 also visuahze the ribozyme RNA.

References 1 Homann, M , Tzortzakakt, S , Rittner, K., Sczaktel, G , and Tabler, M (1993) Incorporatton of the catalytic domain of a hammerhead ribozyme mto anttsense RNA enhances its mhibrtory effect on the replication of human immunodeficrency vms type 1. Nucleic Aczds Res 21,2809-2814 2. Hemrrch, J.-C , Tabler, M., and Louis, C (1993) Attenuation of white gene expression in transgemc Drosophila melanogaster possible role of a catalytic antisense RNA. Dev Genet 14,258-265 3. Wegener, D , Steinecke, P , Herget, T., Petereit, I., Philipp, C., and Schreier, P. H (1994) Expression of a reporter gene 1sreduced by a rtbozyme m transgemc plants Mel Gen Genet 245,465-410

4 Tabler, M. and Tsagrts, M (1991) Cataiyttc anttsense RNAs produced by mcorporatmg ribozyme cassettes mto cDNA. Gene 108, 175-183 5. Hertel, K J., Pardi, A., Uhlenbeck, 0 C., Kotzumt, M., Ohtsuka, E., Uesugt, S , Cedergren, R , Eckstem, F., Gerlach, W. L., Hodgson, R., and Symons, R. H (1992) Numbering system for the hammerhead Nucleic Acids Res 20,3252 6. Shrmayama, T., Nishrkawa, S., and Taira, K. (1995) Generahty of the NUX rule: kinetic analysis of the results of systematic mutations m the trmucleotide at the cleavage site of hammerhead ribozymes. Blochemlstry 34,3649-3654. 7 Zoumadakis, M. and Tabler, M. (1995) Comparative analysis of cleavage rates after systemattc permutation of the NUXJ consensus target motif for hammerhead rtbozymes Nuclerc Acids Res. 23, 1192-l 196. 8. Rtttner, K , Burmester, C , and Sczakrel, G. (1993) In vztro selection of fast hybridizing and effective antisense RNAs directed against human unmunodefictency vu-us type 1 Nucleic Acids Res. 21, 1381-1387.

15 PCR-Based Construction of Long Hammerhead Ribozymes Martin Zillmann

and Gregory Robinson

1. Introduction With the advent of antisense technology, there has been much interest m the use of long RNAs expressed in vivo to inhibit the expression of target genes. More recently, there have been numerous reports that the mcorporation of either hairpin or hammerhead rtbozyme motifs (catalytic antisense) mto such RNAs increases their effectiveness (1-3). This section will describe a generally applicable, simple, PCR-based method to construct catalyttc antisense RNA containing the hammerhead catalytic core that will cleave the target of interest at a GUC sequence.All discussion will focus on the hammerhead motif, although, m prmciple, the haupm motif could be incorporated Instead. Starting with DNA encoding the target, two sets of primers are synthesized (Fig. 1). The primer sets encode partially overlapping half-ribozymes and primers that delmeate the borders of the final ribozyme. Two separate rounds of PCR then create the final rtbozyme, which can either be transcribed directly or cloned into a suitable vector. This synthesis scheme is summarized in Fig. 2. In most of the papers dealmg with catalytic antisense RNA, the ribozyme was constructed by cloning synthetic DNAs into pre-existing or engineered restriction sites (‘2-9). Clearly, the usefulness of this approach is limited by the availability of convenient restrtction sites in the DNA encoding the target that involve the NUX cleavage motif. Several papers describe the synthesis of long hammerhead ribozymes using PCR (20-13). PCR was used either to convert partially overlapping ribozyme coding regions into duplex for transcription or cloning or to alter From

Methods Edlted

by

In Molecular

Srology,

P C Turner

Humana

131


Inc , Totowa,

Protocols NJ

Zillmann and Robinson

132 1

ClE$ $lb v CGAGTAGTGTI’GGGTCGCGAAAGGCCTTGT

S’GAAAGCGTCTAGCCATG 3’ClTTCGCAGATCGGTAC

GCTCAlCACAACCCAckXXlTTCCGGAACA

3’

SGGCC’lTTCGCCTCATCAGGCCGTTAGGCCGAAACCCAACACTACTCG3’ -

hbozyme

GTTGGCAGAAGCTATG CAACCGTCTKGATAC

3’ 5’

BamHl Se SCAC~CATAGClTCTGCCAAC3

Psll we S’CCAQ.@Zf&GAAAGCGTCTAGCCATG3

Core-

Fig. 1. The target DNA and primers for antr-hepatms C vnus model ribozyme. The relevant target DNA sequences are shown m the top panel with the desired cleavage site indicated m larger, bold caprtal letters, and the antlctpated break point in the target RNA is indicated by an arrow.

Primer set #l, shown

m the middle

panel, ~111 be used to amplify the right-hand portion of the target, and prrmer set #2, shown in the lower panel, the left-hand portion of the target Bases m bold type encode the ribozyme core, and hollow type indicates the regron that will bmd the cleavage sate m the target RNA The other bases are target-specific and ~111 differ depending on the target chosen

flanking sequence length. The technique described in this section merges both of these techniques m a novel way, usmg recombinant PCR, a well-established technique (14-16). The ribozyme core IS introduced exactly at the chosen cleavage site with concomttant mtroductron of a phage promoter or cloning sites.

2. Materials 1. 2. 3 4.

Source of target encodmg DNA (plasmtd, phage, PCR fragment, 10 n&I solutrons of the four required primers (see Figs. 1 and 3 10 n&f mixed dNTP stock. 10X Vent polymerase buffer. 100 mMKC1, 100 mM(NH,),SO,, 1% Triton X-100, 200 nnI4 Trts-H2S04, pH 8 8. 5 Vent DNA polymerase (2000 U/mL) from New England Biolabs 6 Tuq DNA polymerase (5000 U/mL).

and so forth) and Note 1) 20 mA4MgS04, (Beverly,

MA).

133

--m-e ---

-we -se

Target PCR

Yz30 bases) that allow efficient association with the target RNA. Owing to their long antisense flanks, multiple turnover cleavage of several target RNA molecules cannot be anticipated, but instead, one molecule of catalytic anttsense RNA is expected to inactivate one target RNA molecule. In those catalytic antisense RNAs described in Chapter 14, the catalytic domain of the hammerhead ribozymes was flanked by two relatively long antisense regions. By contrast, asymmetric hammerhead ribozymes contain only one long antisense flank-the one that forms helix III in the hammerhead complex-whereas the other flank that forms helix I is truncated to as little as three nucleotides (1). This “destgn” (see Fig. 1) has the advantage that the catalytic antisense RNA is physically dissected into its two functional domains, which control (1) association with the target RNA and (2) cleavage of the target RNA. Such an asymmetrtc hammerhead ribozyme resembles an anttsense RNA with an additional cleavage domain (“bombshell”) at the 5’-terminus. The association of the asymmetric hammerhead ribozyme with its target RNA is entirely controlled by the antisense domain downstream of the catalytic domain. This allows straightforward optimization of the length of helix III for efficient association with the target RNA, a method that is outlined m Chapter 30 The general strategy for applying asymmetric hammerhead ribozymes is to create first a construct with a hehx III-forming region of about 200 nt or more. From

Methods III Molecular Edlted by P C Turner

B/o/ogy, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

141

142

Tabler and Sczakiel asymmetrlc

hammerhead Helix

rlbozyme

III

Helix

I

3’

Truncation of

helix

SelectIon fast

3’F

III

head

3’7

for

rlbozymes

5’ 3’-

hybrldiztng

asymmetrlc

!j’

hammer-

5’ 3’7

5’ 3’-E

*’

Fig. 1. The general “design” of an asymmetrrc hammerhead nbozyme is given (top) The actual catalytic domain is flanked by a short helix I, which can be as little as three nucleotides, and a long helix III, consisting of up to 200 nt or more The helix III domain is responsible for association with the target RNA. By truncation of helix III, a fast-hybridizing catalytic RNA can be selected (bottom).

For further improvement, this antisense domam is truncated, and the resultmg catalytic RNAs are experimentally tested for fast hybridization with their target. This will select catalytic RNA with “optimized” bindmg kmetics. Two ways will be considered to generate an asymmetric hammerhead ribozyme. The first approach uses amphfication by the polymerase chain reaction (PCR) to introduce the entire catalytic domain as well as the (short) helix I region via a synthetic DNA ohgonucleotide (see Fig. 2A) This ohgonucleotide should also contam a restriction recogmtion sequence suitable for clonmg mto a transcription vector. Although this approach IS feasible, it does require the synthesis of a DNA ohgonucleotide of 50 nt or more. Owing to the self-complementarity required for the helix II region wlthm the catalytic domam, it is unavoidable that the required DNA ohgonucleotide primer will base pair both within itself and with a second primer molecule. This may cause artifacts durmg PCR amphfication. The second approach makes use of premade DNA vectors that contam the catalytic domain of hammerhead ribozymes with a restriction site engineered mto it. The DNA fragment amphfied by PCR gets inserted mto this restriction site (see Fig. 2B). The complementmg part of the catalytic domain and the helix I region will be provided by the premade plasmid. We have currently about 16 vectors available that can be received on request. If these vectors are used, the oligonucleotide required for PCR amphfication can be much smaller

Asymmetric Hammerhead sense ’

L

Ribozymes

143

primer Helix

III “oa”~ge

Helix

I

Fig. 2. Prtmers required for construction of asymmetric hammerhead nbozymes by PCR amplification (A) Outlines the strategy of Method 1. An asymmetric hammerhead rlbozyme 1sgiven, and the nucleottdes are numbered according to the conventtonal system (2) The “sense primer” 1s of the same polarity as the target RNA and contams typically 12-18 matching nucleotides at its 3’-end (not detailed). This sequence would correspond to nucleottdes (16.n - 16 [n- 111) or 16 n-16 [n- 171) according to the numbermg system (2). At the S-end, the sense primer carries a restrlctton recognition sequence (not detailed) The “antisense primer” contains the four sequences (a), (b), (c), and (d), which are indicated in part A (see Section 3.1.3.). Part (a) contains 10-15 nucleotides matchmg the anttsense sequence of the target RNA close to the selected cleavable NUXJ motif (nucleottdes [ 15.1- 15 lo] or [ 15.1 - 15.151). The anttsense prtmer also comprises the entire catalytic domain (b), which m part A is taken from the satellite of the tobacco rmg spot virus (3), plus the nucleottdes 2.3 -2.1, which represent a short hehx I-formmg region (c). Like the sense primer, also the antisense primer will contain a restriction recognition sequence at its 5’-end (d) (B) Outlines the strategy of Method 2 Here, the catalytic domain is modified It contams a XhoI recogmtron sequence CYTCGAG between nucleotrdes 10.4 and 11.4. The anttsense prtmer contains lust part (b’) of the catalytic domain with the XhoI site plus two additional nucleotrdes at its 5’-end The resultmg amplified DNA fragment, whtch becomes amplified by PCR, 1sinserted into a plasmid vector that delivers the “mtssmg” sequence between nucleottdes 2.3 and 10 3

144

Tabler and Sczakiel

2. Materials 1 Computer facilities for sequence analysis 2 Computer program to select ohgonucleottdes for PCR amphflcation, for example, the program “OLIGO” (distributed by National Biosciences 725 Tower Drive Hamel, MN 55340) 3. Synthetic DNA oligonucleotides, spectfically destgned for the sequence of the target RNA 4. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 m/t4 EDTA (stored as a 100X stock) 5 PCR machme and reactton tubes 6. 5X PCR buffer 100 mA4KC1, 200 mMTrts-HCl, pH 8 8, 100 mA4 (NH&S04, 20 n-J4 MgS04, 1.O % Tnton X-100 7 Bovine serum albumm (molecular-biology grade) at 1 mg/mL 8. Deoxynucleoside trtphosphates (dNTPs): a solution contaimng each dNTP at 10 mM. 9 cDNA of target RNA 10 Tuq polymerase (or equivalent enzyme). 11 Equipment for agarose or polyacrylamtde gel electrophoresis. 12 Phenol and chloroformtsoamyl alcohol 24.1 (v/v) for DNA extraction 13 Restriction enzymes and manufacturer’s buffers. 14 Vector system suitable for m vitro synthesis of RNA 15 T4 DNA hgase and manufacturer’s buffer 16. Competent Escherzchza colz cells suitable for transformatton 17. Matertals for DNA sequencing. 18 A 32P-labeled m vitro-synthesized RNA transcrtpt of the target RNA. 19. RNase A (DNase-free). 20 Bacteriophage-encoded RNA polymerase (SP6, T3, T7) and transcription buffer according the mstructions of the manufacturer 2 1 Rtbonucleoside triphosphates (NTPs) a solution contammg each NTP at 20 mM 22. RNasin (RNase mhibttor). 23 DNase I (RNase-free). 24 Separate stock soluttons of 1 MTns-HCl, pH 8.0,l MMgC12, 250 mA4EDTA, pH 8 0

3. Methods 3.7. Generation of Asymmetric Hammerhead Ribozymes by Direct PCR Amplification 1 Select an NUXJ cleavable motif within your target sequence (see Note 1) This IS the three-nucleottde motif that you would like to cleave by an asymmetric hammerhead ribozyme The two DNA ohgonucleotides required for PCR amphfication must be designed according to the sequence context of the NUX& motif The primer close to the cleavable motif 1s the “antisense primer” and the backprimer that will determme the 3’-end of the asymmetric hammerhead rtbozyme is the “sense prtmer” (Fig. 2A) 2. Design the sense prtmer (see Note 2) to contain about 12-18 nucleotides matching the target RNA. At its 5’-end, it should contain a newly introduced restrtc-

Asymmetric Hammerhead

3.

4

5

6.

Ribozymes

145

tion sate suitable for clonmg the amplified DNA In addition to the terminal restriction site, there should be at least two further nucleotides (preferentially C and G) preceding the recognition sequence. For example, the S-terminal part of the sense primer could be 5’ GGG/AATTC . . , wherein “GG” precedes the EcoRI site G/AATTC, which is itself followed by the stretch of target-specific sequences Design the antisense primer (see Notes 2 and 3), and pay attention to the four sequence elements (a-d) shown m Fig 2, which will be listed from 3’ to 5’ a The sequence (a) represents the target-specific region. It is of antisense polarity with respect to the target RNA It should consist of about l&l5 nucleottdes This implies that the 3’-end of sequence (a) should be located between nucleotides 15.15 and 15.10, respectively, according to the nomenclature for hammerhead ribozymes (2) (see Fig. 2A). The target-specific region should include nucleotide 15 1, which is usually the A residue opposite to the U of the NUX& cleavage motif b The sequence (b) represents the actual catalytic domam, which is attached 5’ to sequence (a). Sequence (b) is usually composed of 22 bases between nucleotrdes 3 and 14 accordmg to the numbering system This could be, for example, the sequence 5’-CsTGATGAGTCCGTGAGGACGAA,,-3’, which is the naturally occurrmg sequence found in the positive strand of the satelhte of tobacco rmgspot vnus (sTobRV) (3) If the presence of restrictton sites within the catalytic domain IS desired, the followmg sequence can be used instead 5’-C3TGATGAGGCCTCGAGGCCGAAi4-3’ This sequence has been successfully tested (4,5). It contains a site for-01 (CTCGAG) and StuI (AGGKCT). c Preceding the catalytic domam, the oligonucleotide needs to have at least the three nucleotides that will form helix I within the hammerhead These are nucleotides 2 3-2 1 according to the numbermg system for hammerheads (2), which are complementary to nucleottdes 1 l-l 3 of the target RNA, that represent the nucleotides downstream of the NUXJ target motif. d Sequence (d) IS located at the 5’-terminus of the antisense primer It should introduce a restriction site for cloning mto a transcription vector. In addition to the recognition site for a restriction endonuclease, it must contain at least two extra nucleotides as outlined in step 2. It IS recommended to check the selected DNA ohgonucleottdes for their potential to form either intramolecular structures (self-complementarity) or drmers by computer programs that are available Both these structures should be munmized or avoided by varying the length of target-specific sequences within the two primers Calculate the proper melting temperatures using an appropriate computer programme (for example, “OLIGO”). Take only those parts of the primer sequences in account that anneal to the cDNA of the target RNA-disregard the newly introduced sequences Synthesize the required DNA oligonucleotides for PCR amplification, and dissolve them in TE buffer at a concentration of 1 pmol/pL (=l pM)

146

Tabler and Sczakiel

7. Dilute the recombmant vector contammg the cDNA template of the target sequence to about 10 pg/pL in TE buffer. 8. Set up the followmg 50 pL PCR reaction (see Notes 4 and 5). Pipet into small reaction tubes (keep to the order given to mmimize possible contammation) Water 5NBSA ( 1 mg/mL) 10 NdNTPs 10 mM 5cLL 5X PCR buffer 10 ClL Sense primer (5 pmol) 5c1L Anttsense primer (5 pmol) 5ccL DNA template ( 10 pg/pL) (see Note 6) 10 pL 9 Add 2 U of Tag polymerase, and depending on the type of PCR machine, you should cover the mixture with a layer of paraffin 011. 10 Carry out the PCR reactton using the following parameters* 7 mm at 94’C, followed by 30 cycles consistmg of: 30 s at 94°C; 30 s at the annealmg temperature, which should be 0-5°C below the melting temperature calculated, and 2 mm at 72°C. A final elongation step at 72’C for 5 mm is carried out, and the reaction mixture cooled to 4°C 11 Check about 10% of the PCR reaction mixture on an appropriate gel system (polyacrylamtde or agarose) for the presence of the expected DNA fragment 12. Extract the reactton mixture with phenol, followed by extraction with chloroform/tsoamyl alcohol (24: l), and collect the DNA by ethanol precipitation and centrifugation. 13. Digest about 0.5 pg ofthe amphfied DNA wrth the two restrtctron enzymes whose recogmtton sequences were engineered mto the sense and antisense primers (see Note 7). 14 Cut an appropriate vector that allows in vitro transcrtption by bactertophagedenved RNA polymerases, such as SP6, T3, or T7 RNA polymerase with the same two restrictton endonucleases, and ligate the DNA fragment into tt Transform competent cells and plate out. 15. Check the resultmg recombinant plasmtds for the presence for the PCR fragment. This is particularly simple if the catalytic domain was designed to contain an addtttonal restriction sate, for example, SluI. 16. Synthesize an asymmetrtc hammerhead ribozyme by m vitro transcrtption (see Chapter 10) and analyze for ribozyme acttvtty as outhned in Chapter 14 17 Confirm correct construction by sequencing

3.2. Generation of Asymmetric Hammerhead Ribozymes by PCR Amplification Using Premade Plasmid Vectors 1 Select an NUX$ cleavable motif within your target sequence as described in Section 3 1 , step 1. Check whether the three following nucleottdes (nucleotides 1 1, 1 2, 1.3, according to the numbermg system of hammerhead ribozymes) match with one of the plasmids listed m Table 1, and ask for the plasmtd from the first author 2 Design the sense primer as described in Section 3.1 , step 2.

Asymmetric Hammerhead Table 1 Summary

Rlbozymes

of Available

147

Three-Nucleotide Hehx I box=

Plasmld pFORTH-AAA pFORTH-AAC pFORTH-ACC pFORTH-ACT PBS-UCU pJH-CAC pFORTH-CCC PBS-Rz 12/3 PBS-Rz12/2 PBS-GCT/AGC pFORTH-GGC PBS-RzlUl pFORTH-TAG pFORTH-TCC PBS-TTA/TAA PBS-Rzl2/0

5’N UX

Helix I Box Vectors Ref.

NNN

Target RNA mot@

AAA AAC ACC ACT AGA CAC ccc GAC GAT GCT GGC GTT TAG TCC TTA TTT

Unpubhshed Unpublished Unpublished Unpublished

1 Unpublished Unpublished

1 1 Unpublished 1 Unpublished Unpublished Unpublished Unpublished I

“The three-nucleotlde helix I box corresponds to the sequence that follows downstream of the NUX& consensus sequencefor hammerheadRNAs For example, plasmld PBS-Rz12/3 can be used for construchon of asymmetric hammerhead rlbozymes for any NTXGAC sequence found in the cDNA of the target RNA. bThe target sequence 1sgwen In its general form as RNA The sequence NNN that follows the NUX& motif represents nucleotldes 1 1, 1 2, and 1 3, according to the numbering system for hammerhead RNAs (2) 3 Design the antisense primer, and pay attention to four sequence elements (a) and (b’) wherein (a) is the same as in Section 3.1 , step 3 Sequence (b’) will be attached 5’ to sequence (a), and it will consist of the sequence 5’-GCCTCGAGGCCGAA14-3’ for plasmids of the PBS series, which contain a XhoI site (CYTCGAG) For other plasmlds listed m Table 1, sequence (b’) slightly differs, and you would be informed of the modifications on receipt of the corresponding plasmld 4 Follow the residual steps of Section 3.1. as described from step 4 onward, except that you should use XhoI m combination with the restriction site engmeered mto the sense primer for digestion of the amplified PCR product It IS also necessary to use the plasmid vector of Table 1 in step 13.

4. Notes 1 For selecting target regions for the planned asymmetric hammerhead rlbozymes and for the mltlal size of hehx III, consult Chapter 2. For the selection of a spe-

Tabler and Sczakiel

2. 3

4

5. 6.

7

ctfic cleavable NUX& motif (N = A, C, G, or U, X = A, C, or U), take mto account that different mottfs are cleaved with varying eftictenctes by hammerhead ribozymes The relative rates are also influenced by the sequence context of the NUX$ motif, but as an mdication, the following order of preferred motifs may be considered: NUC& > NUA& > NUU& and GUX& = AUXL > CUX& = UUX& (6,7), According to our experience, good cleavage results can be expected with a GUC$, AU& or UUC& motif. Please note that the “sense primer” used m PCR amplification is of the same polarity as the target RNA, and the “anttsense primer” has the opposite polartty In addition to the actual asymmetric hammerhead ribozyme, generating a control construct that is mutated m the catalytic domain is recommended, so that it is catalytically inactive When tested in living cells, such a construct can serve as an “anttsense control.” In prmciple, each of the conserved nucleotides can be changed or deleted m order to generate catalytically mcompetent RNA Deletion of G,,, for example, ~111 completely destroy cleavage activity The constructton of asymmetric hammerhead rtbozymes is based on PCR. The actual ampllficatton protocol described has worked well m our hands However, it may well be that other reaction condtttons for PCR may work equally well or better Performmg a control PCR without DNA template added 1srecommended The total amount of DNA template used for PCR ampltficatton is about 100 pg For a typical plasmid with a mol wt of about 2 x lo6 Dalton, this corresponds to about 1@I8 mole or about 600,000 molecules. Digesting the PCR fragments with the two restriction endonucleases that cleave wtthm the sequences of the sense and anttsense primer wtll require a high concentration of enzyme, since it IS a relatively small DNA fragment One mtcrogram of this DNA will therefore have many more sites to be cleaved than 1 pg of plasmtd with a smgle site, let alone 1 pg of h DNA, for which the units of restrtcnon enzymes are usually defined If it 1snot possible to use a high concentratton of the restrtction enzymes, try reducmg the amount of the PCR fragment to achieve complete digestton.

References 1. Tabler, M , Homann, M., Tzortzakakt, S., and Sczaktel, G (1994) A three-nucleotide helix I is sufficient for full activity of a hammerhead ribozyme advantages of an asymmetrtc design Nucleic Aczds Res 22, 3958-3965 2 Hertel, K. J , Pardi, A., Uhlenbeck, 0. C., Koizumt, M , Ohtsuka, E , Uesugt, S , Cedergren, R , Eckstem, F , Gerlach, W L , Hodgson, R , and Symons, R H (1992) Numbering system for the hammerhead Nuclezc Aczds Res 20, 3252 3. Buzayan, J. M , Gerlach, W L , and Bruemng, G (1986) Satellite of tobacco rmgspot vnus RNA a subset of the RNA sequence is suffctent for autolyttc processing. Proc Nat1 Acad Scz USA 83,8859-62 4 Homann, M , Tzortzakaki, S., Rittner, K., Sczaktel, G., and Tabler, M (1993) Incorporatton of the catalytic domain of a hammerhead rtbozyme into antisense

Asymmetric Hammerhead

Ribozymes

149

RNA enhances its mhtbttory effect on the replication of human mnnunodeficlency VKUS type 1. Nuclezc Acids Res 21,280%28 14 5 Heinrich, J.-C., Tabler, M , and Louts, C (1993) Attenuation of whzte gene expression m transgemc Drosophzla melanogaster. posstble role of a catalytic antisense RNA Dev Genetzcs 14,258-265. 6 Shtmayama, T., Ntshtkawa, S , and Taira, K. (1995) Generality of the NUX rule kinetic analysis of the results of systematic mutations in the trmucleotrde at the cleavage site of hammerhead rtbozymes Bzochemzstry 34,3649-3654. 7 Zoumadakts, M and Tabler, M. (1995) Comparatrve analysrs of cleavage rates after systematic permutation of the NUX& consensus target motrf for hammerhead ribozymes. Nuclezc Aczds Res 23, 1192-l 196

17 Minimized

Hammerhead

Ribozymes

Maxine J. McCall, Philip Hendry, and Trevor

J. Lockett

1. Introduction The hammerhead ribozyme as engineered by Haseloff and Gerlach (I) consists of the conserved nucleotides C3-A9 and Gi2-Cr5 2 connected by nucleotides that form stem-loop II, and nucleotrdes at the 5’- and 3’-ends, which form helix I and hehx III, respectively, in complex with the substrate. Such a ribozyme is shown m Fig. 1. Most hammerhead ribozymes of this type are constructed with 12 nucleotrdes in stem-loop II, with four nucleotides in the loop and eight nucleotides forming a 4 bp double helix. Smaller, active rrbozymes can be made by eliminating helix II or truncating its standard 4 bp form (4-s). We define a minizyme (minimized rtbozyme) as a hammerhead ribozyme in which helix II has been replaced by a short lmker containmg no Watson-Crick base pairs, and a mimrrbozyme as one that has a helix II ofjust one basepair. Such ribozymes are chemically synthesized more cheaply and in greater yields than the standard-sized ribozymes, by virtue of the fewer nucleotides they contain. Further reductions in costs and increases in yields may be obtamed when many of the ribonucleotides are replaced by deoxyribonucleotides. Therefore, these minimized rtbozymes are likely to be the economically preferred form of ribozyme developed for use as exogenously supplied pharmaceuticals. The design of DNA-containing mmizymes and miniribozymes is described in this chapter. The design rules are not only applicable to mmlmized ribozymes for commercial use, but also to rrbozymes synthesized on smaller scales for research purposes when costs are an issue. In addition to their economic advantages, minimized ribozymes may be superior to full-sized ribozymes in their function, if helix II in the larger ribozyme interacts detrimentally with parts of the folded mRNA target or other molecules. The possibility of steric interference by helix II is supported by the From

Methods m Molecular Edlteci by P C Turner

Bology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

151

McCall, Hendry, and Lockett

152 H&x

Hehx I

1J.I

5' -------NNNNNNNNG,JJ,6,C,7 3’

NNNNNNNNC,,

&, 44

4

NNNNNN---------NNNNNN 5’

Substrate hbozyme

C,U,Gs A6

43 (42

3’

&,%U,

C-G A.U G-C G-C A G GU

Heltx II Loop II

Fig. 1. An RNA substrate and hammerhead ribozyme m the form described by Haseloff and Gerlach (2). The substrate 1sdrawn containing the triplet GUC, whrch IS the triplet usually chosen for cleavage Cleavage occurs on the 3’-side of C, 7 as shown by the arrow. The remauung sequence of the substrate determines the identities of each N in the ribozyme. The conserved nucleotides C3-A, and G,,-A,, ,(C,, 2) are in the ribozyme. On bmdmg to the substrate, nucleotides m the S- and 3’-arms of the ribozyme form helix I and helix III, respectively. The nucleotrdes joining A, and G,, form helix II and loop II; the sequence of stem-loop II shown here occurs naturally in the satellite RNA (+) strand of tobacco rmgspot virus (2) Generally, most synthetic ribozymes are constructed with 4 bp in helix II and 4 nucleotides m loop II. The nucleotrdes are numbered accordmg to the scheme of Hertel et al. (3)

observation that a mimzyme, in which stem-loop II was replaced by 4 nucleotides, cleaved a 428-nucleotrde RNA transcript m vitro at a faster rate than did a ribozyme with a standard-sized stem-loop II, even though the mmrzyme was slower than the larger ribozyme at cleaving a short 13-mer substrate (8). Therefore, all-RNA miniribozymes, which in general would not be chemically synthesized, but rather formed by transcription from a DNA plasmid in vrtro or m cells, should be considered along with full-sized rrbozymes as potential tools for gene therapy. Guidelines for designing all-RNA minimized rrbozymes are also included here The mnnzymes and mmirrbozymes described here may cleave short substrates with rate constants smaller than those measured for analogous ribozymes. For example, all-RNA miniribozymes have been reported to cleave short substrates with approx 10% the rates observed for full-sized, all-RNA ribozymes (67). DNA-containing miniribozymes cleave short substrates (of approx 13 nucleotides) at better than 20% the rates observed by analogous DNA-containing ribozymes, with the differences between the cleavage rates lessening as the lengths of hehces I and III increase (unpublished data). How-

Minimized Hammerhead 3’nnnnnCA

Rlbozymes A G” t t

153

nnnnnnn 5’ CUG A AGU g t Linker

Mmizyme

Fig. 2. DNA-contammg mnnzyme wrth d(GTTTT) lmker The lurker and the S- and 3’-arms that hybridize to the substrate are composed of deoxyrtbonucleotides (except for A,, 1 and Cl5 *) and conserved nucleottdes are rtbonucleottdes. Upper-case letters represent RNA and lower-case letters DNA. Thts mimzyme 1s designed to bmd to a 1S-nucleottde substrate contammg the sequence GUX and to cleave on the 3’-side of X

ever, since cleavage is probably not the rate-limiting step m the mteraction of rtbozymes with long RNA substrates in vrtro or in cells (8-10), the slower cleavage rates of mmimtzed rtbozymes against short substrates should not be of concern, provided the rate of cleavage is above a threshold (and, of course, that the target site in the cell is accessible to the ribozyme).

At present, we do

not have a reliable value for this threshold cleavage rate. As a guide, a DNAcontaining mmizyme with a lmker of sequence S’dGTTTT, which cleaved a 15-mer substrate m vitro with a rate constant of 0.27 mix’ at 37°C pH 8.2, m 10 rnA4 MgCl,, was effective m inhibiting the production of interleukin-2 m human peripheral blood mononuclear cells (unpubluhed data); a mmtzyme of this type is shown in Fig. 2. A full-sized

DNA-armed rrbozyme cleaved the same short substrate m vitro with a rate constant five times faster than the

mmizyme, but was no more effective than the mmizyme in inhibiting interleukm-2 levels m the peripheral blood cells. 2. Guidelines for Designing Minimized Ribozymes 2.1. The DNA-Containing Minimized Ribozyme DNA-containing minimized ribozymes may be synthesized chemically, as described m Chapters 7 and 8 (see Note 1). In considering the several aspects of designing a minimized ribozyme, the nucleotides of a ribozyme may be classed conveniently mto three separate groups: these are: 1. The conserved nucleottdes. 2 The nucleotides replacing stem-loop II 3 The nucleotides n-rthe 5’- and 3’-hybridizing

arms.

Figures 2 and 3 (A) show two sequencesthat may be used for a DNA-containing minimized ribozyme


154

A

nnnnnnn

3’ nnnnnCA A A G

5’

CUG AGUA

DNA-contammg

mmlnbozyme

c-g t

t t t

B

3’NNNNNCA A A G

NNNNNNN CUG A AGU

5’ All-RNA

mmulbozyme

CG u

u uu

Fig. 3. (A) DNA-containing minmbozyme with d(GTTTTC) lmker and (B) all-RNA mnnribozyme with r(GUUUUC) linker. Upper-case letters represent RNA and lowercase letters DNA These mmmbozymes are designed to bind to 15 nucleottdes of RNA contammg the sequence GUX, and to cleave on the 3’-side of X

2.1.1. The Conserved Nucleotides The identities of the conserved nucleotides are C3-U4-GS-A6-N,-Gs-A9 and Gt2-At3-At4-At5 t-Nt5 2 (11-13). All of these nucleotides should be ribonucleotides for optimum acttvtty. N, may be U or C (see Note 2) N,, 2 must form a Watson-Crick base pair with the nucleotide at position 16.2 in the substrate, so its identity is determined by the sequence of the target RNA (see Note 3).

2.1.2. The Nucleotides Replacing Stem-Loop II The best sequence for nucleotides loming the conserved A9 and Gt2 is d(GTTTTC) as shown in Fig. 3(A). These nucleotides preferentially are deoxyribonucleotides, m order to minimize costs and increase yields. If it 1sessential to keep the number of nucleotides to a mmimum, this sequence may be d(GTTTC), which contams one less deoxyribothymtdme (see Note 4). If nonspecific effects are observed, and it is suspected that these are owing to the miniribozyme binding and cleaving at another site or other sites of sequence stmilar, but not identical to the desired target, then the effects may be reduced by slowing down the cleavage rates by using the sequence d(GTTTT) m place of stem-loop II (see Note 5).

2. I .3. Nucleotides in the 5’- and 3’-Hybridizing Arms The sequence of these nucleotides get RNA. The number of nucleotides

IS determined by the sequence of the tar1s optimally seven or eight in the 5’-arm,

Mmimrzed Hammerhead

155

Rlbozymes

and five or SIX (excluding At5 , and N,, *) m the 3’-arm, so that when bound to the substrate, the mimribozyme forms a helix I and a helix III each of 7-8 bp (see Note 6). Except for A,5 r and Nt5 *, these nucleottdes preferentially are deoxyrtbonucleottdes (see Note 7). 2.7.4. Summary for DNA-Containing

Miniribozymes

A typical sequence for a DNA-contammg minnibozyme will be: 5’-nnnnnnnCUGAUGAgttttcGAAANnnnnn-3’

where upper-case letters represent ribonucleotides, lower-case letters deoxyrrbonucleotides, and the n (and N) are such that the mmiribozyme will form Watson-Crick base pairs when bound to the target RNA. This molecule contains 30 nucleotides ofwhich 12 (40%) are ribonucleotides (seeNote 8). A mmiribozyme of this type 1sdepicted m Fig. 3 (A), where N 1sC. In complex wtth its substrate, the miniribozyme of Fig. 3 will span I5 nucleottdes of the target RNA. 2.2. The A/I-R/VA Minimized Ribozyme All-RNA minimized ribozymes, hke full-sized ribozymes, may be synthesized chemically or transcribed from DNA plasmtds m vitro or m cells, as described in Chapters 7, 8, and 10, respectively. In general, the guidelines for designing all-RNA mmimrzed ribozymes are analogous to those for the DNAcontaining versions, so the above section also should be read. 2.2.1. The Conserved Nucleotides The identitres of the conserved nucleotrdes m all-RNA mimribozymes are the same as for DNA-contaming mimribozymes, and that for Nt5 2 1s determined by the sequence of the target RNA. The best nucleotrde to use for N, 1s U (see Note 9). 2.2.2. The Nucleotides Replacing Stem-Loop II The best sequence for nucleotides Joming the conserved Ag and Glz is r(GUUUUC), or r(GUUUGC) (see Note 10). 2.2.3. Nucleotides in the 5’- and 3’-Hybridizing Arms The sequenceof nbonucleotides in the hybridizing arms must be complementary to the sequence of the target RNA. Since most all-RNA mimribozymes are likely to be made by transcrtption, the number of nucleotrdes m the 5- and 3’-arms 1snot greatly limited by costsof synthesis,and so may be varied. If the concentration of ribozyme is high relative to the substrate, and each mimribozyme is required to cleave only one substratemolecule, then the hybrtdrzing arms of the mininbozyme may contam as many nucleotrdes as the full-length RNA being tar-


156

geted (seeNote 11). If turnover ISrequired, the number of nucleotldes 1s optimally five to etght in the 5’-arm, and three to SIX (excludmg Al 5 1 and N , 5 *) m the 3’-arm, similar to the case for DNA-armed mmlribozyrnes (see Note 12).

2.2.4. Summary for All-RNA Miniribozymes A typical sequence for an all-RNA

mimrlbozyme

5’-(N)$UGAUGAGUUUUCGAAANo,

will be. -3’

where the N nucleotldes are such that the mmlrrbozyme will form WatsonCrick base pairs when bound to the substrate. The values of x and y are typically 7-8 and 5-6, respectively, but may be larger. A mmlrrbozyme of this type is shown in Fig. 3 (B).

3. Notes 1. At present, chlmenc minizymes, mmmbozymes, and nbozymes, which contain nbonucleotides and deoxynbonucleotides, may be made on automated synthesizers by sequentially coupling activated and protected nucleotide monomers to produce a protected nucleotlde chain. During the synthesis, the coupling times for addmg RNA monomers are longer than when adding DNA monomers. The chlmenc oligomer should be treated as If it is 100% RNA when removing the protecting groups and when punfymg the full-length product from the shorter contaminants Compared with then all-RNA counterparts, chimenc oligomers electrophorese a httle more rapidly through polyacrylamlde gels, with mob&y mcreasmg with greater DNA content 2 A DNA-contammg minizyme, in which stem-loop II was replaced by d(TTTT), showed equal cleavage activity against a short RNA substrate when N, was U or C, but a fourfold reduction m cleavage rate when N, was A or G (8) However, a DNAcontaining minmbozyme may requtre N, to be A or G if it is to be exposed to serum, since a DNA-contammg, full-sized nbozyme was degraded m serum by pynmldmespecific endoribonucleases, and U, was a particularly sensitive site (14); alternatively, for protection against these nucleases, N, may be a modified undme (see Note 8) 3 The sequences of RNA molecules targeted by ribozymes and minimized rlbozymes usually contain GUC (G,, *LJlh ,C17, see Fig. 1) where cleavage occurs on the 3’- side of C,,, and hence N,, 2 m the minmbozyme IS usually C. However, rules for choosmg the RNA target sequence appear to be similar for nbozymes and mmimlzed ribozymes, so the target sequence m general may contain NUH, where H 1s not G (13,15-18). 4 We have found that cleavage rate constants for DNA-containmg mmlnbozymes, with d(GTTTTC) or d(GTTTC) linkers, are at least 20% of those for analogous full-sized nbozymes with DNA in stem-loop II and m the hybridizing arms. Actual values for the rate constants vary with the sequence of the target RNA, and with the number of nucleotldes of target RNA bound, with the mmiribozyme sometimes having better activity than the analogous DNA-containing full-sized rtbozyme when the mmlnbozyme bmds to 15 or more nucleotldes of the target

Minimized Hammerhead

5.

6

7

8.

Ribozymes

157

RNA The cleavage rate constant for a mmlribozyme contaming the lmker d(GTTTC) 1sabout 70% that of a mmtribozyme containing the linker d(GTTTTC). Greater discrimmatton between the correct target and one of similar sequence can be achieved by a rtbozyme, either by slowing the rate of chemrstry, or by increasmg the rate of dissoctation of the substrate from the rtbozyme (I 9) The cleavage rate constant for a DNA-containing minizyme with linker d(GTTTT) is about 5- to 1O-fold less than for a mmirtbozyme with d(GTTTC) or d(GTTTTC) linker Unlike full-sized ribozymes, mimribozymes are not advantaged m their cleavage activtttes by having a short S-arm (see Chapter 27) Rather, a similar, small number of nucleotides in each hybridizing arm will assist turnover and reduce the likelihood of dissociation of one of the products being rate determining Seven to eight nucleotides m each hybrrdlzmg arm provide a good balance between fast cleavage (favored m a mimribozyme by more base pairs m helix I and helix III) and turnover (favored by fewer base pairs). In the special case where the target RNA contains a run of G or C residues (but not alternating G-C), so that a run of four or more rG.dC or rC dG basepatrs is formed in the mmirtbozyme-substrate complex, the number of nucleotldes in the correspondmg hybrrdizing arm(s) should be reduced to assist product dtssoctation. Although a small number of nucleotides m the hybridizmg arms assist turnover of the mmutbozyme m vitro, it is not known if the same effect will be observed in vtvo A mtxture of nbonucleottdes and deoxyribonucleotides m the 5’- and 3’-arms may be beneficial m some cases For example, a DNA-contaming mimzyme, with deoxynbonucleottdes at the 5’- and 3’-termmt and nbonucleotides m the hybndizmg arms closer to the cleavage site, cleaved a short target, and a 428-nucleotide RNA transcript containing the sequence of the short target, faster than did a mmtzyme with all-DNA hybridizmg arms or an all-RNA mimzyme (8) Also, melting temperatures of hehces I and III may be manipulated by adjustmg the RNAiDNA composmon of the 5’- and 3’-hybridizing arms. In the extreme case of a target sequence that is pyrtmidme-rich, so that helix I and/or helix III m the ribozymesubstrate complex have a predommantly RNA pyrimrdme strand and a predominantly DNA purine strand, the melting temperatures of those helices will be abnormally low relative to mixed sequence RNA-DNA hybrids; m this case, to ensure bmding at 37’C, it may be wise to include some RNA m the 5’- and 3’-arms of the mmuibozyme. It is likely that some of the nucleotides in a DNA-contammg mmnibozyme will have to be modified (either at the base, the sugar, or the phosphate group) to protect the molecule against nucleases when used in vivo. The nucleotides to be modified and the types of modification most probably can be adapted from those found to be suttable for a Ml-sized, DNA-containing nbozyme (14) or an all-RNA nbozyme (20,21). In general, these studies have shown that almost all ribonucleotides in a hammerhead nbozyme may be modified, with the following important exceptions. Ribonucleondes modified at the 2’-positton of the sugar group cannot be placed at posmons Gs, At5 t, and, to a lesser extent, Gs without loss of cleavage activity, and Gt2 1ssensitive to the type of modification (reviewed m 19). Phosphorothioate linkages in place of the normal phosphodiester bonds 5’ to Ag, A,,, and At4 result m loss of activity (22,23)

158


9 There has been no systematic study on the optimum nucleotlde to use for N, in an all-RNA mmmbozyme In a full-sized all-RNA nbozyme, cleavage rates were found to decrease with varying N, m the order U > G > A > C (13) This contrasts with results obtained for a DNA-contammg mmlzyme as described m Note 2 above 10 We have found that an all-RNA miniribozyme with stem-loop II replaced by r[GUUUUC] (analogous to the best sequence d(GTTTTC) found for DNA-contaming mmmbozymes) cleaves a short synthetic substrate at 20% the rate observed for the analogous, full-sized, all-RNA nbozyme (unpublished data) In another system, when stem-loop II is replaced by r(GUUUGC), cleavage actlvlty 1s10% that of the analogous full-sized nbozyme (7}, this mmmbozyme with r(GUUUGC) lmker was representative of the group of fast-cleaving molecules selected for cleavage activity m vitro from a library of hammerhead nbozymes containing six randomized nucleotldes m place of stem-loop II (7) A third mmmbozyme, with r(GCUUGC) lmker m place of stem-loop II, had a turnover rate constant k,,, at 10% that of the comparable full-sized nbozyme, with a fourfold increase m K, (6) Although the m vitro cleavage of short substrates by all these mmmbozymes 1sslower than by the analogous full-sized nbozymes, the absolute values of then cleavage rate constants are sufficiently fast that they are unlikely to be rate-determmmg m vlvo 11. A long mminbozyme may fold to form a stable mtramolecular structure that 1s incapable of bmdmg to its substrate If this occurs, the number of nucleotldes m the hybrldlzmg arms must be reduced 12 The comments for DNA-containing mmmbozymes m Note 6 also apply to allRNA mmmbozymes If turnover 1snot fast enough, the number of nucleotldes m the hybrldlzmg arms may be reduced, but probably not below 5 m the 5’-arm and 4 (excluding A,, , and C,5 2) in the 3’ arm.

References 1 Haseloff, J and Gerlach, W L. (1988) Simple RNA enzymes with new and highly specific endoribonuclease activities Nature 334, 585-591 2 Buzayan, J M., Gerlach, W. L., Bruemng, G , Keese, P., and Gould, A R. (1986) Nucleotlde sequence of satellite tobacco rmgspot virus RNA and its relationship to multimeric forms Vzrology 151, 186199 3. Hertel, K J., Pardi, A , Uhlenbeck, 0. C., Kolzuml, M , Ohtsuka, E , Uesugl, S , Cedergren, R., Eckstem, F , Gerlach, W. L., Hodgson, R., and Symons, R H (1992) Numbering system for the hammerhead. Nucleic Acrds Res 20,3252 4 Goodchild, J and Kohh, V. (199 1) Rlbozymes that cleave an RNA sequence from human lmmunodeficlency virus the effect of flanking sequence on rate Arch Blochem Blophys

284,386-391

5. McCall, M. J., Hendry, P., and Jennings, P. A. (1992) Mmimal sequence reqmrements for ribozyme activity. Proc Nat1 Acad Scl USA 89, 571&5714 6 Tuschl, T and Eckstem, F. (1993) Hammerhead nbozymes: importance of stemloop II for activity Proc Nat1 Acad Scl USA 90,6991-6994 7 Long, D. M and Uhlenbeck, 0 C (1994) Kinetic characterlsatlon of mtramolecular and intermolecular hammerhead RNAs with stem II deletions. Proc Nat1 Acad Scz USA 91,6977-6981

Minlmued Hammerhead

Ribozymes

159

8 Hendry, P , McCall, M J , Santiago, F S., and Jennmgs, P A (1995) In vitro activity of mmtmised hammerhead ribozymes. Nucleic Acids Res 23,3922-3927 9 Heidenreich, 0 and Eckstem, F (1992) Hammerhead rrbozyme-mediated cleavage of the long termmal repeat RNA of human immunodeficiency virus type 1 .J Blol Chem 267, 1904-1909 10 Ellis, J. and Rogers, J. (1993) Design and spectficrty of hammerhead rtbozymes against calretmin mRNA. Nuclezc Acids Res 21, 5171-5178. 11. Forster, A C and Symons, R. H (1987) Self-cleavage of vrrusord RNA IS performed by the proposed 55-nucleottde active site. Cell 50,9-16. 12 Sheldon, C. C. and Symons, R H (1989) Mutagenesis analysts of a self-cleaving RNA. Nuclezc Acids Res 17, 5679-5685. 13 Ruffner, D E , Stormo, G D , and Uhlenbeck, 0 C (1990) Sequence requirements of the hammerhead RNA self-cleavage reaction. Biochemistry 29, 10,695-l 0,702. 14 Shimayama, T , Nishtkawa, F , Nishikawa, S., and Tan-a, K. (1993) Nuclease-resistant chrmertc ribozymes contammg deoxynbonucleotrdes and phosphorothtoate linkages Nucleic Aczds Res 21,2605-2611 15. Kotzumr, M., Iwat, S., and Ohtsuka, E. (1988) Constructton of a series of several self-cleavmg RNA duplexes usmg synthetic 21-mers FEBS Lett 228,228-230 16 Penman, R , Delves, A , and Gerlach, W. L. (1992) Extended target-site specifictty for a hammerhead rrbozyme. Gene 113, 157-l 63 17. Shtmayama, T., Nishtkawa, S , and Taira, K. (1995) Generality of the NUX rule kinetic analysis of the results of systematic mutations m the trmucleotide at the cleavage site of hammerhead ribozymes Bzochemzstry 34,3649-3654 18. Zoumadakis, M. and Tabler, M (1995) Comparative analysts of cleavage rates after systematic permutation of the NUX consensus target motif for hammerhead ribozymes Nucleic Acids Res 23, 1192-l 196 19 Herschlag, D. (1991) Implmations of rrbozyme kinetics for targeting the cleavage of specific RNA molecules zn vzvo: more isn’t always better. Proc Nat1 Acad Scl USA 88,692 l-6925 20 Bratty, J , Chartrand, P , Ferbeyre, G , and Cedergren, R. (1993) The hammerhead RNA domam, a model ribozyme. Bzochzm Bzophys Acta 1216,345-359 21. Beigelman, L., McSwiggen, J. A , Draper, K G , Gonzalez, C , Jensen, K , Karpelsky, A M., Moolak, A S., Matuhcademic, J., Drrenzo, A B , Haeberlr, P., Sweedler, D , Tracz, D., Grmrm, S., Wmcott, F: E , Thackray, V G , and Usman, N (1995) Chemical modificatton of hammerhead nbozymes-Catalytic activity and nuclease resistance. J B~ol Chem 270,25,702-25,708. 22 Buzayan, J M., van Tol, H., Feldstem, P A., and Bruening, G. (1990) Identification of a non-junction phosphodrester that influences an autolytrc processing reactton of RNA. Nuclezc Acids Res l&4447-445 1 23 Ruffner, D. E. and Uhlenbeck, 0. C. (1990) Thiophosphate interference experrments locate phosphates important for the hammerhead RNA self-cleavage reaction. Nuclezc Acids Res 18,6025-6029

18 Design of Hairpin Ribozymes for In Vitro and Cellular Applications Qiao Yu and John M. Burke 1. Introduction 1.7. Ribozyme Targeting Following the discovery of catalytic RNA (I), a number of different rrbozymes have been found Most rrbozymes carry out site-specific cleavage of the RNA phosphodtester backbone, although important exceptions may be emerging (2,3). The catalytic center and reaction site of several naturally occurring self-cleaving molecules have been dissected, and used to develop rrbozymes that cleave external substrates (4). Because RNA structure IS responsible for both catalytic activity and substrate recognitron, rrbozymes may be engineered to direct the inactrvatron of targeted cellular and viral RNAs through a catalytic cleavage mechamsm (5). 1.2. Hairpin Ribozyme The hanpm nbozyme was originally found m the minus strand of Tobacco Rmgspot Virus Satellite ([-]TRSV) RNA, endowing this RNA with the ability to self-cleave durmg the rephcation cycle without the assistanceof proteins in vitro (6,7). Deletton studies showed the mmimum sequence requirement for the cleavage reaction: a 50-nucleotrde catalytic RNA sequence and a 14-nucleotrde substrate sequence (8) The secondary structure of the complex between the hairpin rrbozyme and its substrate consists of two short mtermolecular hehces (termed Hl and H2) and two mtramolecular hehces (H3 and H4), separated by two internal loops (A and B) (Fig. 1). The rrbozyme catalyzes a reversible, site-specific cleavage reaction to the 5’-side of guanosine within loop A (9). Cleavage yields two products: the 3’-product contains a S-hydroxyl From

Methods Edited

by

in Molecular P C Turner

Biology, Humana

161

Vol 74 Rbozyme Press

Inc , Totowa,

Protocols NJ

162

Yu and Burke HELIX

I

111111

HELIX2

J2/1

A

3’

vi?‘:

51AAACAGA

GUCAA-UA .

GAAe J7/2

;I: A-U

lo

J3/4

C

A

20.

A

G

B

“”

A

J4/3

A ill

A

AC

A

I

y;*

C-G

’ HELIX 4 _ -’

U

30.G

U Fig. 1. The secondary structure of the tram+acting (-)sTRSV hairpin ribozyme and its cognate substrate. Arrow indicates substrate cleavage site, and dashes indicate Watson-Crick base pairs. Ribozyme nucleotides are numbered from l-50. Substrate nucleotides are numbered consecutively from the cleavage site; those to the S-side of the cleavage site have negative numbers, whereas those to the 3’-side have positive numbers. HI-H4 indicate secondary structure elements (helices l-4). A and B indicate nonhelical segments connecting helices (loop A-B).

terminus, and the S-product contains a 2’, 3’-cyclic phosphate terminus. The cleavage reaction has a K, of 30-50 nA4 and kcatof about 2-3 min-’ at 37°C in a buffer containing 12 nG14MgC12, 2 mA4 spermidine, and 40 mA4 Tris-HCl, pH 7.5 (8,ZO). The hairpin ribozyme binds its substrate by WatsonCrick base pairs forming helix 1 and helix 2 (Fig. 1). The substrate specificity of the hairpin ribozyme can, therefore, be altered by changing the ribozyme sequence in helix 1 and helix 2 (II). Selection and mutation assays have shown that most bases within loops A and B are essential for catalytic activity (12,13).

Ribozyme Design

163

2. Materials 2.7. Databases and Software for Accessing and Searching Sequences Public access to genetic sequences 1s available from numerous databases GenBank and other databases can be accessedwith World Wide Web browsing software (e.g., Netscape or Mosaic) through the US National Center for Brotechnology Informatron (NCBI) at http://www.ncbi.nlm.nih.gov/. A relatively comprehensive list of molecular biology databases and software can be found at http://www.public.iastate.edu/-pedro/research-tools.html. Sequences can be searched for potential haupm ribozyme target sites using virtually any sequence analysis software package. We use DNA Strider or MacVector. 2.2. RNA Folding Software Software for predicting RNA secondary structure is publicly available for several types of computer systems.An overview and accessto the software are available at http://hornet.mmg.uci.edu/-hjm/projects/biocomp/ma.folding.html. We use Mulfold (14) for Macintosh. This is available at ftp.bio.indiana.edu/OO/ IUBio-Software%2bData/molbio/mac/mulfold.readme. 3. Methods 3.7. Choosing a Target Site It is not yet possible to predict which of the many potential hairpin ribozyme target sites within a long RNA molecule will be optimal for cleavage m vitro or m vivo. Therefore, it is desirable to choose a number of different potential targets (e.g., 3-6), and design a ribozyme for each potential target for synthesis and evaluation. In attemptmg to target ribozymes against a virus or an mRNA, one should search for potential target sites that are conserved among different isolates, and where possible, among other viruses or mRNAs in the same family (see Chapter 4). It is anticipated that targeting ribozymes to essential sequenceswill decreasethe frequency of viruses or mRNAs that escapethrough cleavage site mutation, and that these rtbozymes may have therapeutic value against several members of the same family in potential chmcal applications and animal studies. The sequence requirement of the substrate for the rtbozyme can be all perfect matches with the optimal hairpin ribozyme substrate sequence from-3 to +4 (RCN/GUCB, B: C,G or U; N: any base; R: G or A); (1I,Z5-18) or suboptimal sequences (NYN/GUCN; Fig. 2). The optimal and suboptimal sites need to be ranked according to sequence conservation. This can be done by searching the sequence data set with the entire sequence capable of being strongly recognized by the rtbozyme (5 nt upstream of the target site through 8 nt downstream of target sequence, with an N at position -1, since it 1s not

164

Yu and Burke

3’-NNNNNN” IIIIII

5’-NNNNNN

A

I

G

A UA

Fig. 2. How to design a hairpin ribozyme. The structural framework of the optimized trans-acting hairpin ribozyme and its substrate. Arrow indicates substrate cleavage site, and dashes indicate Watson-Crick base pairs. N: any base; R: G or A; Y: C or U.

recognized). The extent of site conservation can be quantitated by computer identification, alignment, and analysis using standard search algorithms (e.g., FASTA)

and the GenBank

database.

3.2. Design of a Trans-Acting Hairpin Ribozyme The structural framework of the engineered hairpin ribozymes is outlined in Fig. 2. Base substitutions within the substrate binding domain (helix 1 and helix 2) are necessary for changes in target sites. In contrast, sequences in loop A and loop B are essential for high levels of catalytic activity and so should not be changed. The sole exception is that the U& substitution increases ribozyme activity (16) (Fig. 2). The sequenceof helix 3 is not critically important as long as base pairing is maintained. However, we routinely use the wild-type sequence(Fig. 2). The stability of helix 4 is increased by extension from 3-6 bp and by capping with a stabilizing GUAA tetraloop (Fig. 2). This modification leads to an increase in the catalytic efficiency of the ribozyme (19). We suggest using the same ribozyme

structural framework

as in Fig. 2.

Ribozyme Design

165

3.3. Factors That Can Enhance or Diminish Ribozyme Activity In Vitro Some modifications, such as U39C substltutlon and extension of helix 4, increase the rlbozyme activity significantly, whereas dimerlzatlon or misfoldmg of rlbozyme or substrate may decrease the catalytic activity (20). The dlmerlzation of the hairpin rlbozyme IS inherent, because the bases in both helix 3 and helix 4 are self-complementary, but it can be avoided by using rlbozyme concentrations ~0.5 @4 or by renaturing the ribozyme at 37OC for 10 mm instead of heating up to 90°C and renaturing. The potential misfoldings of both ribozyme and substrate can, to some extent, be predicted and mmlmlzed through the use of RNA folding programs. 3.4. Factors That Can Enhance or Diminish Ribozyme Activity In Vivo The potential factors that may affect rlbozyme activity for m vivo work are. The extensive secondary structure of the target RNA may affect the accesslblhty of the rlbozyme to its substrate. The RNA folding program may be able to predict some of it Proteins or cellular RNAs that can bmd to the target RNA or the rlbozyme may increase or decrease the rlbozyme activity The low Mg2+ concentration m cells IS likely to decrease the rlbozyme activity. The ribozyme efficiency may decrease greatly if it 1snot m the same subcellular location as the target RNA Mutations m the target sequence will cause the mismatch of ribozyme with the substrate, thereby decreasing the rlbozyme efficiency. That IS why conserved sequences are used as target sites. The existence of the numerous rlbonucleases m cells may degrade the nbozyme. Two methods have been used to compensate for the ribonuclease effect m VIVO. One IS to produce large amounts of rlbozyme m the cells by lmkmg the ribozyme sequence to a strong promoter and transfecting the cells. The other method IS to modify the ribozyme chemically, so that it IS nuclease-resistant while maintaining the activity (24), and deliver them to cells by microinJectlon Preliminary results of hairpin ribozyme against HIV-I m human cells are promising despite these potential problems (21-23)

3.5. Alternative Constructs for Trans-Acting Hairpin Ribozymes Both of the alternative constructs of the trans-acting hairpin ribozymes are separated m two pieces. The bisected rlbozyme (Fig. 3B) IS constructed by replacing the three base loop GUU with three G-C base pairs. The activity of this bisected ribozyme IS nearly identical to the intact ribozyme (24). The advantage of using the bisected rlbozyme IS that each piece of RNA can be

166 .-1’ , ‘.-s

Yu and Burke +I

UG,/

‘NNNNNNC I,!,,, NNNNNNA

s,,.---., YRNN , I I I GYNNA-“A“

QAA*q,

A

:-:A-U Q-C

G

M’A

:

v-1:

c

A

A

U

,t [ P-2 A-U

C-G G A “A

/

+I UG . ’ ‘;“;‘:“I’: NNNNNA

NYRNI; I I I I GYNN GA A*,O

B

CA

A

Self-cleaving constructs

3’N

I”

S’AAAUAG~

A-VA

CuGA

GA

$yyy=’ AGCGA3’

I 2-z G-C C-G A-U

E-Z A-U Q-C

G

m*A

C A

A

A

Bisected ribozyme

3wyy:yy

A

C

U u A.40

t

:-: G*A A.” A . A”

C A

Separated domains

C

cAc-GG’ A-U C-G

21; Erg

U-A G-C A-U G A “A

Fig. 3. Alternative haqm rlbozyme constructs Arrow mdlcates substrate cleavage sites, dashes indicate Watson-Crick base pair, dashed lines indicate the covalent linker, and dots indicate noncanonical base pairs N: any base, R G or A, Y C or U (A) Selfcleaving ribozyme, the substrate IS covalently linked to the rlbozyme either at the S-end, at the 3’-end, or both (B) Bisected rlbozyme the rlbozyme 1s dissected along the axis of the helix 3, loop B, and helix 4. Helix 4 is extended by replacing the threebase loop GUU with three G-C base pairs (C) Separated domain ribozyme. the substrate binding domain of the rlbozyme 1s separated from the loop B domain at the hinge region.

synthesized directly from the RNA synthesizer (synthetic RNAs are not practlcal beyond 40 nt). The separate domam rlbozyme (Fig. 3C) is constructed by the separation of the substrate binding domain (nbozyme part of the hehx 1, loop A, and helix 2) from the loop B domain (helix 3, loop B, and helix 4) at the hinge region of the intact ribozyme. The separate domain ribozyme is 104fold less efficient than the intact rlbozyme (25), but it 1svery useful for studymg the tertiary interactions and catalytic mechanisms of the nbozyme. 3.6. Self-Cleaving

Hairpin Ribozyme Constructs In a self-cleaving ribozyme (Fig. 3A), the substrate is covalently linked to the ribozyme, which 1sthe native form of the hairpin rlbozyme and 1sessential for the rolling circle replication of TRSV satellite RNA. The linker between 5’-substrate and 3’-ribozyme must be at least 5 nt to prevent the coaxial stacking of helix 2 and helix 3 (26). The minimum lmker between 3’-ribozyme and S-substrate is usually 4 nt, but it has not been thoroughly studied yet (26,271. In addition to its natural tinctlon, the self-cleaving rlbozyme can be used for posttranscriptional processmg to give a construct with a well-defined 3’-end both m vitro and in vivo (27).

Ribozyme Design

167

3.7. Ribozyme Synthesis and Characterization Two assayscan be used to examme rlbozyme activity m vitro-analysis of catalytic efficiency using oligonucleotide substrates and examination of cleavage extent using long substrates (28) In these assays,oligoribonucleotide analogs of the viral target sequences are directly synthesized using RNA phosphoramidite chemistry on the DNA/RNA synthesizer (see Chapters 7 and 8). To generate hairpin ribozymes that are longer than 40 nt, DNA templates with duplex promoters are generated on the synthesizer and used for m vrtro transcrlptlon with T7 RNA polymerase (29) (see Chapter 10). RNA products are worked up and purified by standard methods (10) Multiple-turnover and single-turnover kinetics are carried out as described m Chapter 23 (Z0,30). 4. Note The state of the art with regard to designing hairpin rlbozymes is such that we can design with a reasonably high level of confidence a rlbozyme that will cleave an oligonucleotide target using the rules described above. Factors that will affect the rlbozyme’s activity, such as folding of the rlbozyme or target into inactive or unreactive conformations, can be dealt with to some extent using RNA folding software, but cannot be anticipated m all cases.This challenge is more daunting when It comes to cleaving long RNA molecules in vitro, and RNA cleavage in VIVO. The relationships between rlbozyme activity m cleavage of ohgonucleotides in vitro and the cleavage of long RNA molecules in vitro and rn vlvo have not been experimentally determined. Acknowledgments This work was supported by research grants AI29829 and AI30534 from the National Institutes of Health. References 1. Cech, T. R., Zaug, A. J , and Grabowski, P. J. (1981) In v&o sphcmg of rRNA precursor in Tetrahymena: involvement of a guanosmenucleotide in the exclslon of the intervening sequence.Cell 27,487-496. 2. Noller, H F , Hoffarth, V., andZlmmak, L. (1992) Unusual resistanceof peptldyl transferaseto protein extraction procedures.Sczence 256, 1416-1419 3. Plccmlli, J. A, McConnell, T S , Zaug, A. J., Noller, H. F., and Cech, T. R. (1992) Ammoacyl esteraseactivity of the Tetrahymena nbozyme. Science256, 1420-1424. 4. Long, D. M. andUhlenbeck,0. C. (1993) Self-cleaving catalyticRNA. FASEB J 7,25-30.

5. Christoffersen, R. E. and Marr, J. J (1995) J A4ed Chem. 38,2023-2037. 6. Prody,G. A., Bakos,J. T., Buzayan,J. M., Schneider,I. R.,andBruening, G (1986) Autolytlc processingof dimeric plant virus satelhteRNA. Sczence 321,1577-l 580.

168

Yu and Burke

7 Haseloff, J and Gerlach, W. L (1989) Sequences required for self-catalysed cleavage of the satellite RNA of tobacco rmgspot virus Gene 82,43-52 8. Hampel, A. and Tntz, R. (1989) RNA catalytic properties of the minimum (-)sTRSV sequence. Blochemwy 28,4929-4933. 9. Chowrtra, B. M and Burke, J M. (1991) Bmdmg and cleavage of nucleic acids by the hatrpm ribozyme Bzochemzstry 30,8518-8522 10 Buzayan, J. M , Hampel, A , and Bruenmg, G. (1986) Nucleotide sequence and newly formed phosphodiester bond of spontaneously ligated satellite tobacco rmgspot vu-us RNA. Nuclezc Acids Res 14,9729-9743 11. Joseph, S., Berzal-Herranz, A., Chowrtra, B. M , Butcher, S E , and Burke, J. M (1993) Substrate selection rules for the hairpin ribozyme determmed by zn wtro selection, mutatton, and analysis of mismatched substrates Genes Dev 7, 136138 12 Berzal-Herranz, A , Joseph, S , and Burke, J M (1992) In vztro selection of acttve hairpin ribozymes by sequential RNA-catalyzed cleavage and ligation reactions Genes Dev 6,129-134. 13. Berzal-Herranz, A., Joseph, S., Chowrira, B. M., Butcher, S. E , and Burke, J. M. (1993) Essential nucleotide sequences and secondary structure elements of the haupm ribozyme. EMBO J 12,2567-2574. 14 Zuker, M (1989) On finding all subopttmal foldmgs of an RNA molecule. Sczence 244,48-52 15 Hampel, A , Tritz, R , Hicks, M , and Cruz, P (1990) “Hanpm” catalytic RNA model* evidence for hehces and sequence requirement for substrate RNA NucZezc Acids Res l&299-304 16. Joseph, S. and Burke, J. M. (1993) Opttmization of an anti-HIV haupm ribozyme by m vitro selection. J BzoE Chem. 268,24,515-24,5 18 17. Anderson, P., Monforte, J., Tritz, R., Nesbitt, S , Hearst, J., and Hampel, A. (1994) Mutagenesis of the hatrpm ribozyme Nuclezc Aczds Res 22, 1096-l 100 18 Sargueil, B. S , McKenna, J , Butcher, S E., and Burke, J. M. (1996) In vztro genetic analysts Identifies noncanonical base pairs used for acttve site alignment by the hanpm rtbozyme, m preparation 19 Sargued, B , Pecchia, D. B., and Burke, J M (1995) An improved verston of the hanpm nbozyme functions as a nbonucleoprotem complex Blochemlstry 34,7739-7748 20. Butcher, S E and Burke, J. M. (1994) A photo-cross-lmkable tertiary structure motif found m functionally distmct RNA molecules is essential for catalytic function of the haupm rtbozyme Biochemistry 33,992-999 21 Ojwang, J. 0 , Hampel, A , Looney, D. J., Wong-Staal, F , and Rappaport, J (1992) Inhibition of human nnmunodefictency vu-us type 1 expresston by a hairpm rtbozyme. Proc. Natl. Acad. Set USA 89, 10,802-10,806. 22. Yu, M., OJwang, J., Yamada, 0, Hampel, A, Rapapport, J , Looney, D., and Wong-Staal, F. (1993) A harrpm rtbozyme mhtbtts expresston of dtverse strams of human mununodeficiency VKUStype 1 Proc Nat1 Acad Scz USA 90,6340-6344 23 Yamada, 0 , Yu, M., Yee, J K , Kraus, G , Looney, D , and Wong-Staal, F (1994) Intracellular nnmun~zation of human T cells with a hairpin ribozyme against human immunodefictency virus type 1 Gene Ther 1,38-45

Rlbozyme Design

169

24. Chowrtra, B. M. and Burke, J. M. (1992) Extensive phosphorothioate substttutton yields highly active and nuclease-reststant hairpin rtbozymes. Nucleic Aczds Res 20,2835-2840 25

26

27

28 29 30

Butcher, S E., Heckman, J E., and Burke, J M (1995) Reconstttutton of halt-pm rtbozyme acttvtty followmg separation of functional domains J Bzol Chem 270, 29,648-29,65 1 Feldstein, P A. and Bruening, G. (1993) Catalytically active geometry m the reversible ctrcularization of “mun-monomer” RNAs derived from the complementary strand of tobacco rmgspot virus satellite RNA. Nuclezc Aczds Res 21, 1991-1998 Chowrua, B. M , Pavco, P A , and McSwrggen, J. A. (1994) In vztro and In vzvo compartson of hammerhead, hairpin, and hepatttts Delta virus self-processing rtbozyme cassettes J Btol Chem 269,25,856--25,864 Lteber, A and Strauss, M (1995) Selectton of efficient cleavage sites in target RNAs by using a rtbozyme expresston library A401 Cell Bzol 15,540-55 1 Mtlhgan, J. F. and Uhlenbeck, 0 C. (1989) Synthesis of small RNAs using T7 RNA polymerase Methods Enzymol 180,5 l-62 Chowrira, B M , Berzal-Herranz, A , and Burke, J M (1993) Ionic requirements for RNA binding, cleavage, and ligation by the hanpm rtbozyme Bzochemzstry 32, 1088-1095.

19 Design of the Hairpin Ribozyme for Targeting Specific RNA Sequences Arnold Hampel, Mary Beth DeYoung, Scott Galasinski, and Andrew Siwkowski 1. Introduction The hairpin ribozyme has been developed and designed to target and cleave efficiently heterologous RNA sequences in a trans-reaction (J-3) Heterologous RNA cleavage has been carried out, targeting rules defined, systemsidentified, and very effective m vivo downregulation of gene expression obtamed using these design rules (4,5) This chapter describes the rules and steps necessary for designing the hanpin ribozyme to cleave specific target sequences efficiently. In the past, these rules have been used to design ribozymes that are very effective against HIV- 1 m vivo. A conventtonal hanpin rtbozyme was designed to cleave the sequence UGCCC*GUCUGUUGUGU, with cleavage at the*, m the 5’-leader of the HIV-I vn-us. When assayedm vivo m human T-cells against mfecttous HIV-l, expression of the virus was decreased by 3-4 logs m the presence of the ribozyme (5). A hairpin tetraloop ribozyme, where loop 3 of the conventional hairpin ribozyme was replaced by a GGAC(UUCG)GUCC tetraloop sequence (3), was designed, also by the rules of this chapter, to cleave a regton m the Pol gene of HIV-l. The sequence cleaved was CACCU*GUCAACAUAA. The tetraloop hairpin rtbozyme targeted to this region also reduced expression of the HIV-l virus by 3-4 logs (6). Currently, both of these ribozymes are bemg prepared for testing m human clmrcal trials as HIV-l antivtrals by Wong Staal (7). Thus, the targeting rules described herein have proven to be very effective m the design and preparation of hairpin ribozymes for the specttic downregulation of gene expression. From



171

Hampel et al.

172 Site

Catalytic RNA U

Loop 4

GUAU$WAC GUG . . .

U

CAC A G Loop 3

CAAAG Helix 4

Loop 2

of

cleavage

3'

50 A U CUGG . . . . . . . . A GACC A mA

20

. . . . . . . m....m 5’basel

AGA Helix 3

Helix 2

Loop 1

Helix 1

Fig. 1. The hairpin ribozymedesignedto cleaveheterologousRNA. Two molecules, the ribozyme(catalytic RNA) and the corresponding substrateRNA, are shown. The B nucleotide is C, G, or U (not A) andthe V nucleotide is G, C, or A (not U).

The engineered conventional hairpin ribozyme (Fig. 1) is capable of being designed to cleave effectively heterologous RNA (4). Without the substrate binding region, it is a basic 36-nt domain that forms two helices (helix 3 and 4) and three internal loops (loops 2,3, and 4). The ribozyme recognizes substrate in two helical regions, helix 1 and 2 by specific base pairing. These two helices flank a 4-base sequence N*GUC (loop 5) in the substrate, and opposite this is a 4-base sequence AGAA (loop 1) in the ribozyme. The targeting rules for substrate recognition and cleavage are a BN*GUC sequence requirement in the substrate with base pairing between ribozyme and substrate in the flanking helices 1 and 2. The * is the site of cleavage. The B nucleotide is the first base of the substrate in helix 2. Helix 2 is fixed at 4 bp for optimal activity. The first basepair in this helix is B:V where B is the basein the substrateand can be G, C, or U. Replacement with an A prevents activity. The V nucleotide, which is the corresponding nucleotide in the ribozyme, does not include a U complement to the substrate A. The remaining three nucleotides in the substrateof this helix can be anything, including wobble basepairs in the first baseof the helix, as long as base pairing is maintained, Helix 1 is of variable length. The native sTRSV hairpin ribozyme sequence has a 6 bp helix 1. This can be extended or shortened with corresponding effects on k,,, and K,. That is, as the arm lengths get longer, K, tends to get smaller, but so does k,,,. The length of helix 1 for optimal catalytic efficiency is dependent on its sequence and must be optimized for each new target sequence. It typically is between 5 and 9 bp for optimal activity. Simple straightforward methods will be described for optimizing the length of this helix. The substrate loop has the sequence N*GUC, where the GUC is preferred for the sTRSV based hairpin ribozyme. The G base is absolutely required with no cleavage of substrate when it is changed. The UC bases are preferred with very low catalytic efficiency, kJK,,,, when they are changed.

Hairpin Ribozyme for Specific RNA Sequences

173

A large number of heterologous targets have been successfully cleaved using these targeting rules. The methods described allow logical development of an optimally active hairpin rrbozyme.

2. Materials Since this chapter describes the principles used to design a hairpin rrbozyme, no specrfic materials are required. The reader 1s referred to other chapters in this book at specific points for details of the appropriate protocols (Chapters 4, 11, and 23), but should also compare Chapter 18.

3. Methods 3.1. Selection

of the Target Sites

1. Using appropriate search methods, search the DNA sequence data bases to identify BN*GUC sequences m the selected RNA transcripts (see Chapter 4) The GUC is the preferred sequence with the G base absolutely required. The UC bases are preferred, since there is very low cleavage activity (k,,,/K,) when they are changed For example, changmg the C results m a 12 fold reduction in cleavage efficiency for A or G and 30-fold reduction for U m this position. The B nucleotide can be a C, G, or U, but cannot be an A. 2. If the target gene has potential heterogeneity, try to identify potential target sites that are in regions of high homology. As detailed in Chapter 4, by using sequence comparison methods, such as BLAST, these regions of homology can be identified 3 In addition to having the BN*GUC requirement and being m conserved sequence regions, the target sites should also be m regions where there is minimal interference from RNA structure or bound proteins. The methods given in Chapters 2 and 3 should help to identify such sites. These preferred regions are often near the S-cap, near the 3’-termmus, and near splice acceptor sites. Sequences near splice donor sites m general have a high degree of secondary structure and should be avoided.

3.2. The Ribozyme 1 With identification of an appropriate target sequence, a hairpin ribozyme should be designed to cleave this target sequence. The conventional hairpin ribozyme should have the features shown in Fig. 1 2 The ribozyme component of helix 2 should be designed to base pair with the four nucleotides upstream of the N*GUC sequence of the target sequence. Standard Watson-Crick base pairs should be used here, since we have not seen any advantage m using wobble base pans. 3 The ribozyme component of helix 1 should be designed to base pair with the 10 nucleotides downstream of the N*GUC sequence. Again, standard Watson-Crick base pairs should be used. We have not seen any obvious constraints in the sequence of helix 1, This is notably true m the first base pan following the *GUC. All four nucleotides work very well in this position. Note that a 10 bp helix 1 can

Hampel et al.

174

be designed, with the intention of using this ribozyme to assay a range of substrates gtvmg a range of hehx 1 lengths m order to optlmlze the length of helix 1 m the final ribozyme sequence (see Chapter 11). By making a ribozyme capable of formmg a range of lengths of hehx 1 up to 10 bp the range of helix 1 lengths can be tested with a single ribozyme 4 The ribozyme DNA template sequence should be synthesized and then transcribed (see Chapter 23) to produce the hairpin ribozyme designed to cleave the specific target sequence selected m Section 3 1 The ribozyme should have a GGG at the S-terminus to facilitate transcription T7 Promoter S'TAATACGACTCACTATAf'GGG 3'ATTATGCTGAGTGATAThCCCNNNNNNNNNNTCTTNNNNTGGTCTCTTT GTGTGCAACACCATATAATGGACCAT5' Astart of transcription (Ribozyme

DNA Template Sequence) We have tested the activity of a number of ribozymes both with and without the SGGG sequence, and found the addition of GGG to the S-terminus has no effect on activity. After transcription, the ribozyme should be isolated from a 10% polyacrylamide-8 M urea gel as described m Chapter 23

3.3. The Substrate A prmciple m designing the substrate for in vitro testing is to keep it short The use of long m vitro substrates IS not recommended, since extensive mterfermg secondary structure may occur in long RNA m the absence of cellular factors Secondary structure m the substrate introduces variables that interfere with the oblective of determmating in vitro catalytic activity For the hairpin ribozyme to be effective, the target sequence must be exposed The use of long hehx 1 lengths to compete out secondary structure IS not encouraged, because the result IS essentially an antisense effect with very low turnover rates. It ts dtfficult to predtct if a structure will be exposed m vivo or not This needs to be determmed experimentally (8) The substrate DNA template sequence should be designed to produce a full length substrate with a 10 bp helix 1 The substrate should begin with a GCG sequence to ensure high transcription levels and the presence of at least one C m the 5’ cleavage fragment This enables detection m the catalytic assay if the transcripts are labeled durmg transcription with radioactive CTP T7 Promoter 5’TAATACGACTCACTATAAGCG 3'ATTATGCTGAGTGATATK!GCNNNNNCTGNNNNNNNNNN5' Astart of transcription

(Substrate

DNA Template Sequence) Transcription should be carried out usmg a- 32P-CTP and the products separated on a 15% polyacrylamide-8 M urea gel as described m Chapter 23

Hairpin Ribozyme for Specific RNA Sequences site

Catalytic RNA G C

Loop 4

GUAUAWAC GUCCGUG . . . . . . . CAGGCAC A

U U

Helix 4

of

cleavage

i

3

U CUGG l

e*e

. .

.

.

l

AGACCAmA Loop 2

.e***.

m....m5’basel

CA24AG Loop 3

175

AGA Helix 3

Helix 2

Loop 1

Helix 1

Fig. 2. Hairpin tetraloop ribozyme. Loop 3 of the native hairpin ribozyme structure (Fig. 1) has been replaced with a GGAC(UUCG)GUCC tetraloop sequence.

5. Substrate RNA bands representing a range of helix 1 lengths can be isolated from the gel (see Chapter 11). In addition to the full-length transcript, a range of transcripts representing substrate with sequentially one less nucleotide on the 3’-terminus are obtained. These bands are owing to premature termination of transcription, which is common from the single-stranded template used here. Each sequentially smaller transcript represents one less nucleotide on the 3’-terminus (confirmed by direct RNA sequencing [see Chapter 1 l]), and thus, serially shortened helix 1 lengths are produced in the ribozyme/substrate complex, which is ultimately formed. These substrate bands can be isolated and correspond to helix 1 lengths of 5-10 bp.

3.4. Optimization

of He/ix I Length

1. Using the range of substrates generated from the substrate transcription in Section 3.3., cleavage assays should be carried out to determine which helix 1 length is optimal. The correct way to do the analysis is to determine catalytic efficiency (k,,,/K,) with multiple turnover reactions for each helix 1 length. This entails much initial effort. A quicker, but less precise method, which points the way to the optimal helix length, is to carry out the cleavage assay with multiple turnover using high substrate concentrations, i.e., higher than the initial estimate of K,. From the initial velocity of this reaction, a first-order rate constant keact is calculated. The high substrate concentration used will cause the K, + [S] term in the denominator of the Michaelis-Menten equation to approach [S] and, consequently, the velocity of the reaction will approach V,,,,,. Thus, at high substrate concentrations, the first-order rate constant, kreact,will approach k,,,. This method is satisfactory for an initial screen of helix 1 lengths. 2. The catalytic activity assays themselves are carried out as described in Chapter 23.

3.5. Tetraloop

Modification

of the Hairpin Ribozyme

1. The tetraloop addition to the hairpin ribozyme is a modification that has greatly improved catalytic efficiency for certain hairpin ribozymes. Loop 3 of the native hairpin ribozyme is replaced with the GGAC(UUCG)GUCC tetraloop sequence. The result of this modification is shown in Fig. 2.

176

Hampel et al.

2. The tetraloop forms a very stable stem loop structure (9) and, thus, likely stablhzes the ribozyme itself against thermal denaturatton Depending on the specific target sequence to be cleaved by the ribozyme, replacement of loop 3 by the tetraloop sequence either has no effect on activity, decreases activity slightly, or activity is greatly mcreased The change m the catalytic parameters of the HIV- 1 pol specific haupm ribozyme was most significant. When the tetraloop addition was made to the basic hair-pm ribozyme, the K,, decreased from 42-4.7 nM and the k,,, increased from 0 2-O 5 mm’ This gave an overall increase m catalytrc efficiency (k,,,/K,) of 15-fold when the tetraloop was added to this sequencespecific ribozyme (6). 3. The hanpm tetraloop ribozyme should be designed to cleave specific target sequences following the same targetmg rules for helix 1 and 2 as for the conventional hairpin ribozyme described above. 4. The DNA correspondmg to the tetraloop hairpm ribozyme should be designed as follows where the sequence corresponding to the tetraloop is underlined. T7 promoter. 5’TAATACGACTCACTATAAGGG 3’ATTATGCTGAGTGATAT*CCCNNNNNNNNNNTCTTNNNNTGGTCTCTTT GTGTGCCTGAAGCCAGGCACCATATAATGGACCAT5’

(Ribozyme DNA Template Sequence) 5 Synthesis of DNA, transcription, and deternunation of catalytic activity should be carried out as for the conventional hanpin ribozyme.

4. Summary The following steps should be taken when designing the hatrpin ribozyme cleave a specific target sequence.

to

1. Select a target sequence contammg BN*GUC where B is C, G, or U 2 Select the target sequence m areas least likely to have extensive interfering structure 3 Design the conventional haupm ribozyme as shown m Fig. 1, such that it can form a 4 bp helix 2 and hehx 1 lengths up to 10 bp 4 Synthesize this ribozyme from single-stranded DNA templates with a doublestranded T7 promoter 5 Prepare a series of short substrates capable of formmg a range of helix 1 lengths of 5-10 bp. 6 Identify these by direct RNA sequencmg. 7 Assay the extent of cleavage of each substrate to identify the optimal length of helix 1 8. Prepare the hairpin tetraloop ribozyme to determine if catalytic efficiency can be improved.

Acknowledgment This work is supported by NIH grant ROl AI29870

to A H.

HaIrpIn Ribozyme for Speafic RNA Sequences

177

References 1 Hampel, A and Tntz, R (1989) RNA catalytic properties of the minimum (-)sTRSV sequence. Blochemutry 28,4929--4933. 2. Hampel, A., Tritz, R., Hicks, M , and Cruz, P. (1990) Hairpin catalytic RNA model* evidence for hehces and sequence requirement for substrate RNA Nucleic Acids Res l&299-304. 3 Anderson, P., Monforte, J , Tritz, R , Nesbttt, S , Hearst, J , and Hampel, A. (1994) Mutagenesis of the hau-pm ribozyme Nuclerc Acids Res. 22, 1096-l 100 4 Ojwang, J , Hampel, A, Looney, D , Wong-Staal, F , and Rappaport, J (1992) Inhibition of human immunodefictency vtrus type-l (HIV-I) expression by a hairpm rtbozyme. Proc Nat1 Acad Scl USA 89, 10,802-10,806. 5 Yamada, 0 , Yu, M , Yee, J , Kraus, G , Looney, D , and Wong-Staal, F (1994) Intracellular tmmumzatton of human T-cells with a hairpin rtbozyme against human immunodeficiency virus type 1 Gene Ther 1,38+5 6 Yu, M , Poeschla E , Yamada, 0 , Degrandis, P , Leavitt, M , Heusch, M , Yee, J , Wong-Staal, F , and Hampel, A (1995) In vztro and zn vzvo characterization of a second functional hairpin ribozyme against HIV-l Vzrology 206,381-386 Wong-Staal, F (1994) Testing the promise of gene therapy HIV-Adv Res Ther 4, 3-8.

Zaug, A and Cech, T (1995) Analysis of the structure of Tetrahymena nuclear RNAs zn vzvo. telomerase RNA, the self-splicing rRNA mtron, and U2 snRNA RNA 1,363-374. Cheong, C , Varam, G , and Tmoco, I (1990) Solution structure of an unusually stable RNA hairpin, 5’ GGAC(UUCG)GUCC Nature 346,680-682.

Design and Preparation of Sequence-Specific RNase P Ribozymes Denis Drainas and Guido Krupp 1. Introduction The catalyttc RNA subunit of Escherichia colz RNase P (Ml RNA) is a structure-specific endonuclease that cleaves pre-tRNA substrates m trans. By combining catalytic and substrate RNAs in one RNA molecule, self-cleavmg ribozymes have been created (Z-3). These constructs were converted to sequence-specific endonucleases by deleting 5’-segments of the tethered tRNA (1) (see Fig. 1). It has also been shown that by linking a guide sequence to the 3’-end of the Ml RNA, a sequence-specific ribozyme could be designed (2) (see Fig. 2). This chapter provides protocols for the construction of sequence-specific RNase P ribozymes following published procedures. Two types of RNase P ribozymes are presented, the cn-cularly permuted E. coli RNase P RNA with an internal guide sequence, termed Endo P (I), and the E. coli RNase P RNA with a guide sequence covalently attached to the 3’-end of the RNase P RNA, termed MlGS RNA (3) (see Ftg. 2). An alternative, but untested, approach is suggested for Endo Pl .RNA (see Note 1 and Fig. 1). 2. Materials 2.1. Construction of Endo P Ribozymes 1. Plasmids:pTP292, p 153Bsttay (available on request from N R. Pace, see ref. I) 2 Primers END01 * S’-CGGAATTCTAATACGACTCACTATAGTTCAGTTGGTTAGAATGCC-3’ END02* S’-CGGAATTCTAATACGACTCACTATAGTTGGTTAGAATGCCTGCC-3’ -*

From, Methods In Molecular Edlted by P C Turner

Bology, Vo/ 74 Rfbozyme Protocols Humana Press Inc , Totowa. NJ

179

A

Endo.Pl RNA

cleavage

site lhker

Rep1 RNA 5’.GGGAGACCGGAAUUCGAGCUCGGUACCCAAAAU

r;7GCCHGGU

Iii

. II

ACGCCCGUAWGAACCCG

-3

T .-

3-AU

CI

kz-,G

Internal Guide

sequence

Rime4

PR92

reverse

Ak

U-A G-C

C-G c U

c A GUC

B EndoP2 RNA Re.PI

RNA

G-C C-G c

c A

U GUC

C EndoP3 RNA Re.Pl

RNA

5

sequence

Fig. 1. Design of sequence specific Endo.P-based RNase P ribozymes Arrows denote sites of cleavage within the exogenous substrate RNAs. The underlined sequences denote the positions of the forward and reverse primers for the PCR Endo P3 RNA 1sa theoretical approach and has not been checked expenmentally.

Sequence-Specific

RNase P Mbozymes

181

1111111

5’- IWNNNNNNNACCAC-3’ -T olil7 Primer

4 linker

* RZF

Fig. 2. Design of a sequence specific MlGS-based RNase P ribozyme The arrow denotes the site of cleavage wtthm the exogenous RNA substrate. The underlined sequences denote the sites for the forward and reverse primers for the PCR The mternal guide sequence is indicated by a series of nucleottdes (N), complementary to the cleaved target sequence (see also Note 3) Stmllar to Endo.Pl RNA, the internal guide sequence forms the 3’-half of a 7 bp acceptor stem, but in this case, no full-size tRNA structure is present (compare ref 1 with ref 2)

3 4 5.

6

7 8 9

PT292 reverse. 5’-GAAGATCTACGGGTTCAGTACGGGCCGT-3’ (see Note 2) Restrtctton enzymes EcoRI, BglII, BumHI, FokI, and manufacturer’s buffers. Reaction buffer (mmus MgClJ 16 5 mA4 PIPES, 44 mM Trts-HCI, pH 8.0, 2.5 A4 ammomum acetate, 0.1% SDS. 100 mMMgC&. Substrate RNAs: either Pre.Pl, Pre P2, or a substrate designed by the reader. These can be chemically synthesized (see Chapters 7 and 8) or transcribed m vitro (see Chapter 10). 1 mg/mL Glycogen as carrier 50 rnA4EDTA. 6% Denaturing polyacrylamtde gel

2.2. Construction

of MlGS RNA

1 Plasmid pTKl17 (available on request from S. Altman, see ref. 2). 2 Primers Forward: 5’-TAATACGACTCACTATAG-3’ Reverse 5’-GTGGTNNNN. NNTATGACCATGATTACGCC-3’ (see Note 3) 3. Transcriptton buffer 40 mMTrts-HCl, pH 7.6,24 mA4MgC12,2 mMspermtdine, 10 mM diothreitol, 0.01% (v/v) Trtton Xl00 Made as a 5X or 10X stock and stored frozen. 4. NTPs. 38 mA4ATP, 53 mA4GTP, 41 mMCTP, 25 mMUTP. 5 RNasm. 6. T7 RNA polymerase. 7. DNase, RNase-free

182

Dramas and Krupp

8. Phenol-chloroform and chloroform. 9 Sephadex G50 column. 10 End-labeled substrate RNA* either uniformly labeled with [cx-~*P] GTP or 5’-end labeled with [Y-~~P] ATP 11 Cleavage reaction buffer. 50 mMTns-HCl, pH 7 5,100 mMNH,Cl, 100 mMMgC1, 12 8MUrea 13 15 or 20% Denaturing polyacrylamide gel

3. Methods

3.1. Construction of Endo P Ribozymes The constructron of Endo P-based ribozymes (see Fig. 1) has been factlttated by the followmg three steps having been taken by workers in the field. 1 The constructton of a circularly permuted RNase P RNA (CPM 1 RNA) (4,5) 2 The construction of a pre-tRNA-RNase P RNA conjugate This tethered molecule consists of cpM1 RNA joined to Bacdlus subth pre-tRNAASP (I) 3 The modification of the tethered molecule to function as a sequence specific endoribonuclease (1).

3.1.7. Protocol for Construction of Endo P DNA Templates 1. Use PCR to construct Endo P 1 or Endo P2 templates using pTP292 and ohgonucleotides END01 or END02 as forward primers and PT292 reverse as the reverse primer (see Chapter 9 for details of the PCR reaction) TP292 was constructed by fusing the 3’-end of pre-tRNA, using a six-nucleotide lmker to the 5’-end of a circularly permuted RNase P gene that begms at position G292 END01 S-CGGAATTCTAATACGACTCACTATAGTTCAGTTGGTTAGAATGCC-3 =’ S’-CGGAATTCTAATACGACTCACTATAGTTGGTTAGAATGCCTGCC-3’ PT292 reverse.5’-GAAGATCTACGGGTTCAGTACGGGCCGT-3’ The END01 and END02 oligonucleotides contain an EcoRI site, a T7 promoter and the 3’-sequences (m bold) correspond to the 5’-proximal sequences of Endo Pl or Endo P2 RNA The PT292 reverse primer contams a BgAI site, and the underlured sequences correspond to the 3’-proximal sequences of Endo P RNA (see Fig 1) 2 The PCR products can be used directly as templates for transcrtption by T7 RNA polymerase (consult Chapter 10 for transcription details and see also Note 2) 3. Alternatively, to clone the templates prior to transcriptton, digest PCR fragments with EcoRI and BgZII according to the manufacturer’s mstructions 4. Insert the EcoRI-BgZII-digested PCR fragments mto the EcoRI and BamHI sues of plasmid p 153Bsttay (5) to create plasmids pENDO 1 and pENDO

3.1.2. Preparation of RNA Transcripts of Endo P Genes RNAs can be synthesized by transcription with T7 RNA polymerase, using the PCR-generated template or plasmtd pENDO (or pEND02), lmeartzed

Sequence-Specific

RNase P Ribozymes

183

with F&I (see Fig. 1and also Chapter 10 where it 1srecommended to use 5 mM of each NTP and 26 mA4 MgClz m the transcnptlon). 3.1.3. Cleavage Assays Cleavage reactions are assembled by mlxmg Endo.P rlbozyme and substrate RNA m reaction buffer (minus MgC&) on ice. To do this, the Endo.P transcripts from Section 3.1.2. should be dissolved m reaction buffer at a concentration of 1 mM. Substrate RNA (e.g., Pre.Pl or Pre.P2, ref. I) should be similarly prepared. 1 Set up a 45 & cleavage reactlon on ice containing 100 ti rlbozyme (e g , Endo.Pl) and 100 ti substrate RNA (1 e , Pre Pl) 2 Heat for 5 min at 65’C 3 Transfer the assay mixture to 50°C. 4. Add MgC12 to 10 mM(1.e) 5 $ of 100 mUstock) 5 Incubate for 60 mm 6 Stop the reaction by ethanol precipitation Add l-2 vol of 50 mMEDTA, 4 pg of glycogen, and 3 vol of Ice-cold ethanol 7 Collect the RNAs by microfugmg at > 10,OOOgfor 15 mm 8 Resolve the product RNAs by electrophoresis through denaturatmg 6% polyacrylamlde-7 Murea gels

3.2. Construction

of MIGS RNA

The strategy for the production of M 1GS RNA rlbozymes 1sto make a DNA template m which a guide sequence (GS) complementary to the target RNA is Joined using an 18-nucleotlde linker to the 3’-end of Ml RNA (2) (see Fig. 2). Large-scale transcrlptlon of this template generates the MlGS nbozyme. The DNA template for MlGS transcription is synthesized by PCR from the gene for M 1 RNA present in the plasmld pTKl17 (6), a derivative of pUC 19 that contains the bacteriophage T7 promoter followed by the gene for Ml RNA (7). The 5’-primer ohgonucleotlde contains the T7 promoter (OliT7), and the 3’-primer oligonucleotide contains the appropriate guide sequence. Primers. Forward (OliT7)* 5’-TAATACGACTCACTATAG-3’ Reverse: 5'-GTGGTNNNNNNNTATGACCATGATTACGCC-3'

In the reverse primer, the bold sequence of 18 nucleotldes at the 3’-end anneals to the pUCl9 sequence of pTK117, the underhned sequence corresponds to the 3’-ACCAC sequence (see Note 4), and the NNNNNNN sequence corresponds to the guide sequence that should be complementary to the chosen target (see Note 3). A large-scale transcrlptlon of the PCR template DNA with T7 RNA qolymerase 1sperformed. For additional details, see Chapter 10 (7).

184

Drainas and Krupp

1 Assemble a 200 or 500 pL transcriptron reaction contammg one-fifth volume of 5X transcription buffer, one-tenth volume of NTP solutton, RNasm (80 U/mL), T7 RNA polymerase (800 U/mL), and DNA template (PCR product) at 40 pg/mL. 2 Incubate overnight at 37’C. 3 Add RNase free DNase to 10 pg/mL, and incubate for 10 min at 37°C 4 Extract the RNAs once with 1 vol of phenol/chloroform and twice with chloroform 5 Ethanol-precipitate by adding 2 vol of cold ethanol 6 Mtcrofuge at > 10,OOOgfor 15 mm Dry the pellet, and dtssolve m sterile water 7. Separate the MlGS RNA from unincorporated nucleottdes by centrtfugation through a Sephadex G50 column (8)

3.2.1. Cleavage Assays 1 Assemble a SO@ cleavage reaction containing 20 n&f MlGS RNA and 50 mA4 labeled substrate RNA m cleavage reaction buffer 2. Incubate for 30 min at 37O or 50°C 3. Stop the reaction wtth an equal volume of 8 M urea 4 Separate the products on a 15 or 20% polyacrylamtde-8 M urea gel, and analyze by autoradiography (see Notes 5 and 6).

4. Notes 1. A possible alternative strategy with ENDO.Pl RNA could follow the concept of the MlGS rtbozyme. Concerning MlGS, the partial tRNA molecule could be replaced by the 3’-terminal half of the acceptor stem, but in contrast to MIGS, tt would be tethered to the internal nucleotide 292 of M 1 RNA. For this approach, primer END0 1 would be replaced by END030 5’-CGGAATTCTAATACGACT CACTATAGTCCGGACCGCCA(Gut linker GGATCC)-3’, in which the bold sequence contains the T7 promoter and the underlmed sequence corresponds to the internal guide sequence. The position of primer END03 is also indicated m Frg. 1. The procedures to obtam PCR-generated or cloned templates are the same as described. Thts construct provides flexibility m the design of the IGS, since tt IS located near the 5’-end and Included m the sequence of primer END03. This suggested approach has not yet been checked experimentally. 2 The PT292 reverse primer has a nme-nucleotide extension for BgflI recogmtion. If the PCR products are used directly as templates, omit these nme nucleottdes 3 The standard acceptor stem is 7 bp, but larger sequences can be used (2) 4 The presence of a 3’-terminal CCA sequence in the gutde sequence 1s important for maximum effctency of cleavage. 5. The addition of C5 protein (to 400 r&Z), in the presence of 5 rr&f MgCl*, sttmulates the cleavage by MlGS RNA by a factor of 30. 6. If longer RNAs are used as substrates, like mRNAs, the concentratton of Mg2’ can be lowered to 20 mA4.

References 1. Frank, D N , Harris, M E., and Pace, N. R. (1994) Rational design of self-cleaving pre-tRNA-ribonuclease P RNA conJugates. Bzochemwry 33, 10,80&10,808

Sequence-Specific

RNase P Ribozymes

185

2 Liu, F. and Altman, S (1995) Inhtbmon of viral gene expresston by the catalytrc RNA subunit of RNase P from Escherzchra colz Genes Dev 9,47 l-480 3 Kikuchl, Y. and Suzuki-FuJtta, K. (1995) Syntheses and self- cleavage reaction of a chrmeric molecule between RNase P-RNA and its model substrate J Bzochem 117,197-200

4 Harris, M E., Nolan, J M , Malhotra, A., Brown, J W , Harvey, S C , and Pace, N. R. (1994) Use ofphotoaffimty crosslmkmg and molecular modeling to analyze the global architecture of rrbonuclease P RNA. EMBO J 13,3953-3963 5. Nolan, J M , Burke, D H , and Pace, N. R. (1993) Circularly permuted tRNAs as spectfic photoafftmty probes of nbonuclease P RNA structure Sczence261,762-765 6. Guerrrer-Takada, C. and Altman, S (1992) Reconstrtutron of enzymatic actrvrty from fragments of M 1 RNA. Proc Nat1 Acad Scl USA 89, 12661270 7. Vtoque, A , Arnez, J , and Altman, S. (1988) Protein-RNA mteractron m the RNase P holoenzyme from Escherichza cok. J Mol Brol 202, 835-848 8. Mamatrs, T , Frttsch, E F , and Sambrook, J. (1982) Molecular Clonzng, A Laboratory Manual. Cold Sprmg Harbor Laboratory Press, Cold Spring Harbor, NY

21 Theoretical Considerations in Measuring Reaction Parameters Timothy

S. McConnell

1. Introduction In determining reaction rates, catalytic RNA molecules follow the same rules as protein enzymes. These RNA enzymes or ribozymes use similar processes to promote their function as do their protein counterparts, such as binding their substrates m order to make brmolecular reactions ummolecular, transitton state stabtlization, and ground state destabilization (1-5). Because rtbozymes also coordinate binding, conformational, and catalytic events, the interpretation of a measured reaction rate can be involved. Although this chapter cannot resolve the meaning of every reaction rate for all mechanisms available, it will dtscuss issues to consider as one proceeds to decipher how a catalyttc RNA works. Because there 1shttle difference in the basic knowledge needed to study RNA and protein enzymes, several texts on enzymology may also provide a good reference for important issues to consider (6,7). However, this chapter will focus on issues parttcularly pertinent to rtbozymes. First, one establishes conditions where one can observe a reaction occurring. In the observed rate of reactton, the disappearance of substrate should show good single-exponential behavior (23 half-lives; see Chapter 22). Then, one varies the concentratton of the important components (e.g., ribozyme, substrate, or cofactor) and observes the effect each has on the reaction. These rate effects are then described in terms of kinetic constants, such as k&Km or k,,,. Without further mechanistic analysis, these constants only describe the effect that a particular component has on the reaction observed under the conditions used; it cannot be concluded that they represent a physical event, such as chemFrom


Biology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa. NJ

187

188

McConnell $ (m.t.) ,’

$ (s.t.1 :

:

:

: 8’

: ‘\

single

turnover:

. ..’

: ,4 *

: : :

: 8’

:

,*-.

: : : :

: 3’

:

: :

‘\

‘.*_,’

,’ ,’

Kd

E+S

-

k, _

k E*S

-

products

k-1

multiple

turnover:

Kd kl E+S

B

E*S

-

k

E*P

e

E+P

k-1

Fig. 1.

Free energy diagramsof single- and multiple-turnover reactions

istry or binding, There IS unique value in examming the kinetics of a reaction beyond the terms “kcat)’ and “K,. ” A detailed kinetic description of a reaction can provide the informatton necessary to equate a rate constant and a physical event. Further, deciphering the energetic contribution that each component makes to the overall reaction attaches the appropriate significance to the interaction studied. Failure to make a correct assessment of the kmetic values obtained can misdirect future study. 2. Reaction Mechanisms and Free Energy Diagrams 2.1. General Considerations A mechanism contains the mmimum number of steps required to describe a reaction. The free energy diagram maps out how each step m the mechanism contributes energetically to the overall reaction (Fig. 1). The peaks of the graph represent how difficult a step m the reaction is to achieve: the higher the peak, the slower the rate. The troughs represent the stability of each ribozyme state relative to each other: the deeper the trough the more stable the ribozyme state. These free energy diagrams are constructed to examine how the assembly of elemental rate constants describes the overall reaction. In a reaction mechanism, each step is described by two elemental rate constants representing the forward and reverse occurrences of a physical event, e.g., binding or chemistry. In the mechanism shown m Fig. 1, k, is the rate

TheoretIcal Considerations

189

constant of substrate association. It describes how fast substrate binds and depends on the concentration of the component (ribozyme or substrate) that is m excess.The term k, is the rate constant of substrate dissociation. It describes how fast substrate falls off the rtbozyme, and is independent of ribozyme or substrate concentration. The equilibrium dissociation constant (or bmdmg constant) of substrate is the ratio of the rate constants of substrate dissociation and association (& = kilk,). The term k, is the rate constant for the chemical step. This concentration-independent term represents how fast cleavage occurs (see Note 1). In combination, the elemental rate constants describe the overall reaction mechanism. Each rate constant is related to free energy by the followmg equation: AG$

= -RTln(hklksT)

(1) where T is the temperature m Kelvin at which the reactions are performed, R is the gas constant (0.001987 kcal/mol * K), h is Planck’s constant (6.63 x 1&34 J * s), kn is Boltzman’s constant (1.38 x 1O-23J/K), and k is the first-order rate constant. For all second-order events (i.e., bmdmg events), an arbitrary concentration is chosen and the pseudo-first-order rate is determined (e.g , if the association rate constant of a substrate is 2 x 1O6W’s’ and 1O4 M substratewas used, then the pseudo-first-order rate is 0.02 se&; AG$ = 21.5 kcal/mol at 50°C). Usually concentrations are chosen that are relevant to the experiments being performed. It is often helpful for problem-solving purposes to complete the diagram with reasonable values that were determmed in related research. For example, the dissociation rate constant of a substrate can be determined if one has measured its bmdmg constant and one assumesthat association rate constant should be that of duplex formation. From this model, the prediction of the rate constant of substrate dissociation will allow one to design an experiment better to measure this value. From a working diagram, you can visualize the consequences of putting together your kmettc data and make predictions about experiments to test the model 2.2. Single- vs Multiple-Turnover

Reactions

“Single-turnover” or “presteady state” experiments examme a ribozyme’s ability to promote the conversion of a single substrate to products (solid curve, Fig. 1). Self-sphcmg RNAs (group I, group II, hammerhead, and so on) are evolutionarily designed to perform a single set of reactions. Single-turnover experiments are best achieved by having a concentration of ribozyme in excess (210 times) of substrate concentration. Under these conditions, each ribozyme will have a chance to react with only one substrate molecule. “Multtple-turn-

over” or “steady-state”experiments examine a rlbozyme’s ability to promote many turnovers (solid and dashed curve, Fig. 1). RNase P, as well as the ribo-

790

McConnell

some and spliceosome (see Note 2), performs multiple-turnover experiments m the cell. These expertments are called “steady-state” because the ribozyme species have reached a constant population; the rates of formation and breakdown have reached a temporary balance utihzing the substrates available. For the purpose of deciphering how a ribozyme works, the single-turnover experiment has one paramount advantage: fewer steps are involved. Consider the free energy diagram in Fig. 1. In multiple-turnover experiments, one must evaluate the importance of all steps m the reactton. In single-turnover experiments, one only has to consider the steps up to the chemical step (see Note 3). Many reaction mechanisms will contam more than three steps, and thus, performmg single-turnover experiments can reduce the number of possible ratelimitmg steps by nearly half. When trymg to determme the sigmficance of the kmettc constants measured, the task becomes much simpler wtth the smgleturnover approach. This issue of having fewer steps to consider will become apparent in the next sections. One physical difference between RNA and protems is the stable secondary structure of an RNA duplex. It ts common for an RNA substrate to make extensive interactions with its cognate ribozymes. The strong bmdmg of an RNA substrate increases the propensity for binding to be rate limiting. In the case of multiple-turnover experiments, this means that the rate of product dtssociatron is likely to be the rate-limiting step, not the chemical step. With a slow product dtssociatton, studying the binding of substrate or the chemical step by a multiple-turnover approach would be difficult. Let us examme a common situatton. One varies the concentration of a substrate m the reaction and obtains rate constants for each condition (see Note 4) When these observed rate constants are plotted as a functton of substrate concentration, they show a square-hyperbohc dependence (Fig. 2). This curve depicts the classic Michaehs-Menten kinetic behavior. Values for k&K,,,, Km, and kc,, can be obtained from thts curve. Many researchers stop wtth the basic characterization of the reaction phenomena. In many situations, this may be sufficient to continue on in other aspectsof catalytic RNA research. However, if one assumesthat K, is a bmdmg constant and k,,, is the chemical step, then one is making a serious oversight. If current or future projects require knowledge of the binding constant or the rate of the chemical step, further testing of the kmettc data is required. A more detatled description of these kinetic values is provided in the following sections. The value of kc,,/& for a substrate in a reaction is determined from the mmal slope of the Michaelis-Menten curve. It is m this concentration range of the substrate where the observed rate constant mcreases linearly. The mea-

Theoretical Conslderatlons

191

Fig. 2. A plot of the observedrate of a ribozymereaction asa function of substrate concentrationdrsplaymg Mrchaelis-Mentenbehavior

sured kcat/K,,, is a second-order rate constant having units of concentration and time (usually M-‘/min or M-‘/s). In the free energy diagram, this value represents the energetic barrier from the startmg initial state (free enzyme) to the highest peak (the rate-limitmg step m the reaction, mdicated by $ m each dragram). In Fig. 3, four free energy diagrams depict different mechanisms for a rrbozyme reaction The solid curve in each dragram represents the reaction under kJK,,, conditions. If the mechanism is a simple two-step process and chemistry is rate-limiting, then k,,,/K, is equal to the rate constant for the chemical step, kc, over the bmdmg constant of the substrate, Kd (k,,,/K, = kJKd; see Fig. 3A). Demonstration that chemistry is rate-limiting would be consistent with this model. Changes m the reactivity of substrate used (a phosphorothioate or any of a variety of modified nucleotides at the cleavage site) or the reaction condmons (pH, divalent metal, or temperature) can be utrlrzed to affect the rate of the chemical step (see Note 5). If there are more than two steps involved m the reaction, the Km term of k,,,/K, may not be equivalent to Kd (see Section 4.). If binding of the substrate is rate-hmitmg (i.e., the binding barrier is the highest), then k,,,/K, equals the rate constant for substrate association, kl (Fig. 3B). To confirm this conclusion, it is recommended to compare this value to similar values measured m model systemswhere the rate constant of assocration is shown to be diffusion-controlled or nucleation-limited. For example, detailed kinetics of the nucleation of RNA duplexes have been measured (8). To rule out a rate-limiting chemrcal step, the substrate or reaction condmons can

McConnell

e

E+S

G==

E*!j

-

E+S

E+S

_

E.S

-

E + s’ =

E*S e

E-S’ = +s

E-S’ -

E.S’*S

-

Fig. 3. Free energy diagrams of four possible reaction mechamsms

be perturbed affecting chemistry, but demonstratmg no effect on the reaction rate (Note 5). The change m the chemical step should not be too large because that may result in a change m rate-limiting step. The failure to see an effect on k,,t/& by affecting the chemical step only eliminates the chemical step from being rate-limrtmg; any other step, mcluding substrate association, could be rate limiting. If more than two steps are important, the defimtion of k&K, can become considerably more mvolved. In Fig. 3C, chemistry remains limitmg, but K, of substrate is not a simple process. It mvolves a two-step process of bmdmg and then a conformational change (E + S = E S = E S’). As drawn, K,,, would represent both binding and conformational change, and thus, k,,,/K, would also reflect both steps. Although the experimental tests for the mechamsms m Fig. 3A and B apply to this mechanism as well, dtfferenttatmg between models in Fig. 3A and C requires more careful analysis of Km. Measuring kcat/Km for a reaction described by the mechanism shown in Fig. 3D is more comphcated. As shown, the rate measured would be a third-order rate constant depending on the concentration of both substrates m the reaction. Measuring reaction rates under these conditions should be avoided. An altemative verston of this mechanism is if the first step of the reaction is not binding of another substrate, but a conformational change. If so, then the second-order l

l

TheoretIcal Considerations

193

rate constant, &/Km, will also reflect this conformational change m addition to bmdmg and chemistry. This may be avoided by finding better premcubation conditions (see Chapter 22) In multiple-turnover experiments, any number of steps could be rate-limiting. As shown in Fig. 1, k,.JK,,, represents the free energy difference between unbound ribozyme and the product dissociation step. There are several scenarios where the rate-hmitmg step for k,,,/K,,, will be neither substrate association nor the chemical step. In these cases, demonstratmg that kcat/Km is too slow to be diffusion controlled and that the chemical step is not hmtting suggests another step determines the rate of reaction. To resolve what other step (i.e., conformational changes) is rate-limiting will require alternative approaches. The value of reducing the number of steps involved by performmg smgle-turnover experiments may avotd these comphcattons. 4. K,,, The value of Km is defined as the concentration of the substrate at one-half maximal velocity. Km IS a kinetic value, not an equilibrium constant; however, sometimes it can equal the equihbrmm dissociation constant of substrate, Kd. Despite the fact that it is described only m terms of concentration (Ml), definmg Km on the free energy profile depends on the individual mechanism. In Fig 3, free energy diagrams demonstrate the differences between the meaning of K,,, m different mechanistic models. As drawn, the mechanistic scheme has rtbozyme species(E and E * S) aligned below then respective stable troughs m the free energy curve. The arrows between the solid and dashed curves indicate the effect of increasing substrate concentration. The dashed curves represent the free energy profile for the substrate (or ribozyme) concentration at Km. The followmg analysts will examme four general mechanistic possibtlities for what Km can represent. 4.1. Case 1 When a simple two-step model (bmdmg and chemistry; Fig. 3A) fits the data and the rate of substrate dissociation (k-,) is faster than that of chemistry, then Km equals Kd. At Km, free ribozyme (trough a) is at the same level as bound ribozyme (trough b), and thus, both states are equally represented. The slower rate of chemistry has allowed an equilibrium to be established between the free and bound rtbozyme states. When one can establish this model, this is an ideal case for kmetically determmmg the binding constant of a substrate. Not only does one directly determine the energetic contribution to binding, but one also has directly related this bmdmg event to catalysts by the rtbozyme. Other methods that measure bmdmg independent of rrbozyme acttvtty always have the caveat that one may observe nonproduc-

194

McConnell

tive binding (a binding event that does not lead to catalysis). The model shown m Fig. 3A cannot be estabhshed by a single experiment. Primary to estabhshmg this model is to provide evidence that the chemical step is ratelimiting. This can be estabhshed by pulse-chase experiments (see Chapter 22) or by repeating the K,,, experiment under conditions that affect the chemical step, but not binding Distinguishing whether substrate assocration or the chemical step is ratelimiting can be accomplished by performing pulse-chase experiments. By fully binding substrate with a high ribozyme concentration (the pulse), all the labeled substrate will be bound m the most stable ribozyme substrate complex. Then, the complex is challenged with excess (unlabeled) product and an essential catalytic element, such as guanosme. If the chemical step is faster than substrate dissociation (k, > ki), then the labeled substrate will react. If substrate dissociation is faster (k, c k,), labeled substrate will fall off and not react. This type of experiment provides an overview of what the reaction profile looks like* Is chemistry or bmdmg rate-limttmg? The results from these experiments could be pivotal m determmmg which mechamsm best descrtbes the reactton being studied.

4.2. Case 2 When the rate constant for the chemical step is faster than the rate constant of substrate dissociation (k, > k-i), K,,, will be greater than & Once the substrate is bound, the barrier to dtssoctate (barrier c, Fig. 3B) is much higher than the barrier (d) for chemistry. Thus, every time the substrate bmds a reaction occurs. This kmetic effect prevents an equihbrmm from establishing between the free and bound statesof the substrate and ribozyme. The reaction rate eventually saturates after the rate of association becomes faster than the rate constant for the chemical step. As shown by the dashed curve, K, occurs at a much higher concentration than Kd (compare to Fig. 3A). A pulse-chase experiment where all the substrate reacts rather than dissociates would provide evidence for this model.

4.3. Case 3 If there are any intermediates that build up subsequent to the binding of substrate, K, will be less than Kti Such intermediates (trough f) will build up when they are more stable than a simple ribozyme-substrate complex (trough e). At Km,the free ribozyme trough only rises to the more stable intermediate (trough f), indicating stronger apparent binding than initially exists between substrate and ribozyme. More stable intermediates may be owing to conformational changes that provide direct mteractions between ribozyme and substrate. Alternatively, substrate may Just be occluded from solvent. In either situation,

Theoretical Considerations

195

K,,,represents a binding constant for a two-step event. Estabhshing thts mechanism requires a comparison of ribozyme binding to that of a relevant model system, such as duplex formation. Also, biophysical approaches that show structural changes on bmdmg can provide strong evidence for this model (9, IO). Considering such a model may provide a better understanding of ribozyme function. 4.4. Case 4

If there is a change in the rate-limiting step to a step other than the binding of substrate or chemistry, K,,, will be less than Kb This other step may be the bmdmg of another substrate or cofactor, as shown in Fig. 3D, or may be a conformational change. As substrate concentration is increased, the rate-hmiting step changes from chemistry ($1) to the bmdmg of the other substrate ($2). Because of the change m the rate-hmitmg step, the rate levels off at substrate concentrations less than that required to measure Kd for S (when troughs g and h would be level). A test of this model would be to demonstrate the loss of an effect on the chemical step (such as a phosphorothioate effect) as the concentration 1sincreased from subsaturating to saturating (1 I).

5. kcat The value k,,$ is the rate of reaction at a saturating concentration of substrate (or ribozyme; Fig. 2). It represents the free energy required to reach the ratelimiting step from the state or statesof ribozyme speciespresent at the concentration used. If there is only one species of bound ribozyme and only one rate-limitmg step, k,,, will be more precisely defined. In Fig. 3A, k,,, represents rate constant for the chemical step, k,. In this case, the rate should be dependent on reaction conditions important for chemistry. Although this mechanism is the preferred case (from the standpoint of collecting data), many enzymes (and apparently ribozymes) have evolved to bmd their substrates sufficiently tightly that the rate of the reaction is diffusioncontrolled. As a result, substrate bmdmg is often rate-limitmg (particularly m multiple-turnover experiments) Perturbing reaction conditions to establish a mechanism like that shown m Fig. 3A is recommended. Determinmg conditions where K,,, = Kd and k,, = kc provides the basis for subsequently describmg the reaction under more biologically relevant conditions where these kinetic terms may be more complicated. It is also true that when saturation is reached for the reaction described by the mechanism m Fig. 3B that the chemical step will be rate-limiting. However, the amount of ribozyme will have far exceeded what is necessary to bind substrate fully. There is the possrbihty that at high concentrations, RNA aggregation and depletion of available Mg2+ will become issues. In these situations,

196

McConnell

it may be useful to prebmd substrate with ribozyme (at a lower concentration, >&) and initiate the reaction with another essential factor, such as guanosme, increased pH, or divalent metal ion. For the mechanism described m Fig. 3C, k,,, also equals kc. While K, mvolves a two-step process, considerably useful information can still be obtained from studying a reaction with this mechanism. There are likely many steps that are kinetically invisible, so establishing that binding occurs in two steps provides a more detailed description of ribozyme function. In the situation where an additional conformational step exists, a major concern is that this step 1sslow relative to the chemical step Then, the situation described for the model m Fig. 3D will apply. The value kcatwould equal the rate of the conformatlonal change. In Fig. 3D, kcat does not equal kc. In fact, this kinetic term may be fairly complicated with more than one step partially rate-hmitmg at saturating concentrations. Since at K, not even half the substrate is bound, all substrate may still not be bound at kinetically “saturating” concentrations. As drawn, kc would be predominated by association of the other substrate, S’. Remember this slow step (Indicated by $2 in Fig. 3D) does not need to be the bmdmg of another substrate and does not need to precede substrate binding. It could be a conformatronal change that precedes the chemical step. Then kc would reflect the rate constant of this conformatronal change. Establishing characteristics expected for the chemical step will be important in characterizing a reactron that fits this model. As seen m the multiple-turnover mechanism m Fig. 1, kc,, IS equal to the rate of product dissociation (8m.t.). Although this may be a useful value to obtam, it will take further experimentation to establish that kcat 1sequal to the rate of product release. Measuring multiple-turnover rate constants can still be valuable, but it IS best if these experiments complement an established single-turnover approach. In Chapter 22, a multiple-turnover experiment is described m order to measure the burst of product release after the first turnover. Such an observation establishes that a step after chemical conversion is rate-limiting. Each of the four possible mechanisms shown have provided general issues to consider in measuring kinetics of RNA catalysis. These models represent common kinetic situations. However, they do not represent all possibilities. There is also the prospect that more than one situatron wrll apply For example, the binding of RNA substrate to the Tetrahymena ribozyme is limited by the rate constant of association (like Fig. 3B), but substrate bmdmg 1salso a twostep process (like Fig. 3C) (1,22). From this analysis, a basis for deciphermg reaction kinetics is available providing the opportumty to understand catalysis by RNA further.

Theoretical Considerations

197

6. Notes 1. Like all reactions, k, IS also reversible, but usually experimental design will allow the reverse reaction to be ignored. 2 The RNA portions of the sphceosome and of the ribosome have yet to be shown to be the catalytic portion of the RNA-protein complexes However, the RNAs of these complexes are known to be directly involved in substrate recognmon 3 One exception to this is the situation where product formation is very unstable, and substrates are rapidly reformed. Then one must consider the next step beyond the chemical step 4. The term substrate will be used from here on in this chapter for simplicity. The term substrate can refer to other cofactors, such as guanosme or Mg2+ or a protem facilitator. Also, m single-turnover experiments, the ribozyme (not the substrate) concentration is varied to measure kinetic constants for substrate, if that substrate is being experimentally observed (1 e , the 32P-labeled substrate). 5 Changing the identity of substrate or changing the reaction conditions to affect the rate of chemistry may also affect binding. The effect of these changes on substrate bmdmg must be tested independently

References 1. Cech, T R , Herschlag, D , Piccnilli, J A , and Pyle, A M. (1992) RNA catalysis by a Group I ribozyme. J Bzol Chem 267, 17,479-17,482 2. Narhkar, G J., Gopalakrishnan, V., McConnell, T. S , Usman, N., and Herschlag, D. (1995) Use of bmdmg energy by an RNA enzyme for catalysis by positioning and substrate destabilization Proc Nat1 Acad. Scl USA 92, 3668-3672 3. Pan, T , Long, D M , and Uhlenbeck, 0 C (1993) Divalent metal ions m RNA folding and catalysis, m The RNA WorZd (Gestland, R. F. and Atkins, J. F., eds ), Cold Spring Harbor Laboratory Press, Plamview, NY, pp 271-302 4 Cech, T R. (1993) Structure and mechanism of the large catalytic RNAs group I and group II and nbonuclease P, m The RNA World (Gestland, R. F. and Atkins, J F , eds ), Cold Spring Harbor Laboratory Press, Plainview, NY, pp 239-269 5 Hertel, K J., Herschlag, D., and Uhlenbeck, 0 C. (1994) A kinetic and thermodynamic framework for the hammerhead rrbozyme reaction Bzochemzstry 33, 3374-3385. 6 Fersht, A (1977) Enzyme Structure and Mechanzsm, 2nd ed W H Freeman and Company, New York. 7 Jencks, W P (1969) Catalyszs zn Chemistry and Enzymology. McGraw Hill, New York. 8. Turner, D H , Sugimoto, N , and Freier, S. M (1990) Thermodynamics and kinetics of base-pairing and of DNA and RNA self-assembly and helix coil transition, m Nuclezc Aczds, Landolt-Bornstem, Springer-Verlag, Berlin, pp. 201-227 9. Bevilacqua, P. C., Kierzek, R., Johnson, K. A., and Turner D. H. (1992) Dynam-

ics of ribozyme bmdmg of substrate revealed by flourescence-detected stoppedflow methods. Science 258,1355-l 358.

198

McConnell

10 Wang, J.-F, Downs, W. D., and Cech, T R (1993) Movement of the gmde sequence during RNA catalysts by a group I ribozyme. Sczence 260,504-508. 11 Herschlag, D and Khosla, M (1994) Compartson of pH dependenctes of the Tetrahymena rtbozyme reactions with RNA 2’-substituted and phosphorothioate substrates reveals a rate-ltmtting conformattonal step Bzochemzstry 33, 5291-5297. 12 Cech, T. R., Bevtlacqua, P C., Doudna, J A, McConnell, T S , Strobel, S A , and Weinstein, L. B (1993) Mechanism and structure of a catalytic RNA molecule, m Robert A Welch Foundatzon Conferences on Chemical Research, vol 37, Welch Foundation, Houston, TX, pp 91-110

22 Experimental Approaches for Measuring Reaction Parameters Timothy

S. McConnell

1. Introduction To understand the function of a ribozyme, it is necessary to decipher the reaction the catalytic RNA promotes. As more and more RNA catalysts are discovered, then activity will be compared to gam greater understanding of how each functions. Measurement of reaction parameters provides vital mformation to quantify differences between rtbozymes (2). There is also an increased interest, both academic and mdustrral, in utihzmg reactions promoted by the catalytic RNA m VIVO.A firmer understanding of catalysis of a ribozyme in vitro will supply a stronger basis for describing how cellular factors may affect RNA catalysis m viva (2). The first objective for characterlzmg a ribozyme reaction is estabhshmg condmons where the reaction is “well behaved,” i.e., that it occurs via a single exponential decay (%Sremalnlng = e-kt, Fig. 1). Ideally under single-turnover reaction conditions, activity should be linear on a semilogarithmic plot for at least three half-lives. Conditions that result in more than 30% unreacted substrate should be avoided. In special cases,such as a phosphorothioate substrate where only one diasteriomer readily reacts, one can accurately measure the reaction rate (and the fraction unreacted) simply by taking more time-pomts. If any unreacted substrate is observed, the data should be corrected for unreacted substrate (%Scorrected = [%S, - %S,]/[ 100 - “/OS,] x 100, where %S, and %S, are the remaining substrate at any time and infinrte time, respectively). Although contemporary computer programs will allow you to fit a nonzero endpoint to the data, it requires two variables to be fit decreasing the accuracy of the rate constant measurement. If an unreacted fraction is unavoidable, a standard correction for all related data is advisable. From

Methods III Molecular Edtted by P C Turner


199

200

McConnell

1

2 Time bun)

3

Fig. 1. A semllogarlthmlc plot of the disappearanceof substrateas a function of time demonstratmga t1,2= 1 min and single-exponentialdecayof three half-lives

Finding appropriate premcubation conditions 1s of primary importance m obtaming good kmetlc behavior from a ribozyme. Because alternative secondary interactlons of RNA can be stable with slow rates of conformatlonal change, it 1s necessary to allow time for all the RNA molecules to find a stable and active structure. This often requires appropriate salt (Mg2+ and monovalent) concentrations as well as a sufficient temperature to allow the RNA molecules to search conformational possibilltles and find a stable active structure. For the Tetrahymena ribozyme, a premcubation of at least 2 mM Mg2+ and 10 mm at 50°C 1srequired in order to fold -90% of the ribozyme molecules into an active conformation (3). There exist a number of variations of preincubatlon condltlons that allow folding of RNA molecules mto an active form (4-Q. The following methods were originally designed to measure rate constants for a group I ribozyme. However, the explanations should provide information that is applicable to any nbozyme. Accurately measuring any rate constant requires some knowledge of other related rate constants m the reaction mechanism. The methods describe how each experiment 1sperformed after a basic survey of the reaction (like Fig. 1) has been done to obtain estimates for kinetic values. Estimates of related rate constants should be confirmed by experimentation m order to establish the working model. 2. Materials The materials used are common among all the methods. However, these materials will vary depending on the ribozyme. It 1simportant to have equip-

Ribozyme Kinetics

201

ment that accurately measures volumes, temperature, and time for these experiments. 1 Sterile, RNase-free (sihcomzed, optional) mtcrofuge tubes 2. P-20 and P-10 Pipetmen, at least one accurately calibrated to 0 5 pL 3 20% Polyacrylamide, 7-8 Murea gel; 1X TBE (0 1 MTrts-borate, pH 8 3, 1 mA4 EDTA). 4 Constant temperature water circulator and bath. 5 Radioanalytic scanner or densitometer. 6 L-2 1 Sea I rrbozyme, 220 luV stock, gel- and column purified (7) 7. Gel-purtfted 32P-end-labeled substrates, CCCUCUA, CCCUC(dU)A, and CCCUCUspA (where “dU” indicates a 2’-deoxyribose and “sp” mdmates a phosphorothroate). 8 Unlabeled CCCUCUA and CCCUCU, 220 pA4. 9 Guanosine (G), 24 mM stock (heat to 65°C to dissolve before use) 10 Sterile deionized water. 11 5X Stock of Mg/Mes reaction buffers: 250 mM Mes, pH 5 5 and 7.0 (at 25”(Z), 50 mM MgC12 (final concentrations of 50 mM Mes and 10 mM MgC12). 12. Stop buffer containing 80% formamide and 50 WEDTA, with 0 05% bromophenol blue, 0 05% xylene cyanol, and 2 mA4 Tris-borate, pH 8.3

3. Methods 3.1. Measuring kc&,,, for Guanosine This method is applicable for measurmg the second-order rate constant,k,,,lK,, for a substrate or cofactor that IS not the observable (or labeled) substrate m the reactton. For the following single-turnover experiments (Sections 3.1.-3.4.), the ribozyme concentratron, [El, must be much greater than (210-fold) the 32P-labeled substrate concentratton, [S] (3). 1 Choose a ribozyme concentration (200 “M) that is greater than Kd for substrate and binds sufficiently fast on initiation of the reaction such that association is not rate-limiting m the reaction. The rate constant of association multtplred by the ribozyme concentration plus the rate constant of dissoctation gives the observed rate to equilibrmm, keq = k, x [E] + k-i = lO*M-*lmin x 200 nA4+ 0.2 mu-‘, = 20 mu-r, tij2 = ln2/k,, = 2 s (see Chapter 21, Section 3.). 2. Choose guanosine concentrations for each reactron ranging from 0 to ~20% of Km (see Note 1). 3. Prepare a time-course for each reaction that includes a preincubation start time, a reaction start time, and a stop time for each time-point taken (six time-points are suggested) The time-points should be distributed such that half are m the first half-life of the reaction and half are in the second and third half-lives of the reaction (see Notes 2 and 3). 4 Prepare and number reaction and stop microfuge tubes. Aliquot 6 pL of stop buffer mto each stop tube

McConnell

202

5. To each reaction tube, add 4 IJL of 5X reaction buffer, pH 7 0, 2 pL of 2 pM ribozyme, 2 pL, of the appropriate 10X (O-50 @4) guanosine stock and 10 pL of water (see Note 4) 6. Begin time-courses by premcubatmg each mixture at 50°C as its start time occurs. After the 20 mm premcubation, reactions are initiated with 2 pL of -20,000 cpm/pL 32P-CCCUCUA, mixing rapidly usmg a Pipetman. Ahquots (1 5-2 &) are then taken out of the reaction tube, and mixed into a stop tube (step 4) at each designated time-point and placed on ice. 7 Load samples on a 20% polyacrylamide 7 M urea gel, and electrophorese long enough to separate substrate and product sufficiently 8 Analyze data with a radioanalytic scanner/densitometer quantitating the amount of substrate and product at each time-pomt. Determine the percentage of substrate remammg at each tune-pomt and plot %S remammg (%S = counts S/[counts S + counts P] X 100) as a function of time on a semiloganthmic graph (Fig 1). Determme kobsfor each reaction from the exact half-time of the reaction or an exponential tit to the data 9. Plot kobsas a function of [G]. it should be linear. Determmmg the slope of the lme that is kcat/K,,, for guanosme (see Note 5) If the plot shows curvature (a levelmg off) at higher concentrations, then lower concentrations of G should be used

3.2. Measuring

k&t,,,

for Substrate

This method 1s applicable for measurmg kca,/Kmfor the 32P-labeled substrate in the reaction. Because this reaction IS done m single-turnover ([El >> [S]), it is the ribozyme concentration that dictates the reaction rate (3). 1. Choose ribozyme concentrations (3-20 nM) for each reaction from zero to ~20% of K,,, (see Note 6). 2. Repeat steps 3 and 4 of Section 3 1. 3 To each reaction tube add 4 pL of 5X reaction buffer, pH 7 0,2.3 $ of 8.6 mA4 G (65’C) stock, 2 pL of the appropriate 10X (30-200 nM) ribozyme stock, and 9 7 pL of water. 4 Repeat steps 6-8 of Section 3.1 5. Plot kobsas a function of [El: it should be linear. Determme the slope of the lure, which is k,,dK, for substrate (see Note 7)

3.3. Measuring

K, for Guanosine

This method IS an expanded version of Sectton 3.1. The guanosme concentration ranges below and above K, and the identlty of substrate is changed m order to observe the reaction at high [G] (8,9). 1 Use a high (200 nM) rtbozyme concentration (see Section 3 1 , step 1) 2 Choose guanosine concentrations such that half are above the expected Km and half below (see Notes 2,3, and 8). A mmtmum of six concentrations are required. 3 Repeat steps 3 and 4 of Section 3 1 In addmon, label another tube for ribozyme m each reaction.

Ribozyme Kinetics

203

4 To each reaction tube, add 4 pL of 5X reactton buffer, pH 7 0,2 ).tL of -40,000 cpm 32P-CCCUC(dU)A, 2 pL of the appropriate 10X (O-50 pA4) guanosme stock and 9.6 pL of water. To the rtbozyme tube m each reaction, add 2.4 pL of 2 pA4 ribozyme and 0.6 pL of 5X reaction buffer (see Note 9). 5 Begin time-courses by preincubatmg each rrbozyme and reaction tube at 50°C as its start time occurs (see Note 10) After the 20 min premcubatron, reactions are initiated by adding 2.4 pL of rtbozyme, mixing rapidly using a Prpetman Aliquots (1 5-2 pL,> are then removed as in Section 3.1 , step 6. 6 Repeat steps 7 and 8 in Section 3.1. 7 Plot kobsas a function of [G]: the data should show a square hyperbolic curve, and not be srgmotdal (see Notes 5,9, and 11). Fit the data using a least-squares tit to the Michaelis-Menten equation. kobs = k,,,[G]I(K, + [G]) Note kcat 1salso determined for single turnover by this fit.

3.4. Measuring K,,, for Substrate For strong binding ohgonucleotides (& < 10 nM), measurmg K, may not be very useful because dissociation 1soften slower than chemistry (k, c k,; see Section 4 of Chapter 21). For weaker bmding

substrates where km, > kc, a K,,,

measurement can be valuable (Z). For trght binding substrates,one can decrease the rate of chemistry by decreasing the pH or the guanosme concentratron, or using a less reactive substrate. However, tt 1srecommended that pulse-chase be used for measurmg the binding of substrate where k-, I kc. Here 1sa method for measuring the binding of a weaker bmdmg substrate (-20 n&I) with a lower reactivity. 1. Choose rrbozyme concentrations (3-200 &I) such that half are above Km and half below (see Note 8) 2. Follow steps 2-4 of Section 3 2 , but only use the slightly weaker bmdmg (and slower reacting) substrate, CCCUC(dU)A, and use the pH 5 5 5X reaction buffer Under these conditions, the chemrstry ~111 be slower than the rate constant of substrate drssoctation (see Sectron 3., Chapter 21) 3. Plot kobs as a function of [E] the data should show a square hyperbolic curve and not be stgmotdal (see Notes 11, and 12). Fit the data using a least-squares fit to the equation kobs = ~c,,[WWm+ PI)

3.5. Measuring Bursts and Multiple-Turnover Kinetics Performing some multiple-turnover experiments can be useful in conjunctton with single-turnover experiments. Such comparrsons can distingursh between possible mechanisms. For strong bmdmg substrates, evidence of a burst suggests that a step after chemistry, a conformational change, or product release 1srate-limiting. For weak binding substrates, determining that k,,, for single- and multiple-turnover are equal provides evidence for the same step being rate-ltmrtmg under both condmons (see Section 5. of Chapter 2 1).

McConnell 1. Choose substrate concentrations that are greater than both Kd and [El. To measure the burst of a strong bindmg substrate, choose an [S] that 1s3-l 0 x [E] For weak bmding substrates, it may be necessary to have several hundred to several thousand times excess substrate to measure kcataccurately. 2. Prepare a time-course for each reaction that includes a premcubation start time, a reaction start time, and a stop time for each time-pomt taken (six time-points are suggested). The time-points should be distributed such that all are taken before 20% of the substrate is consumed. 3 Prepare and number reaction and stop microfuge tubes Aliquot 6 pL of stop buffer into each stop tube. 4 To each reaction tube, add 4 pL of 5X reaction buffer, pH 7 0, 2 pL of 1 @4 ribozyme, 2 pL of 8.6 mM guanosme stock, and 8 pL of water 5 Begin time-courses by preincubatmg each mixture at 50°C as its start time occurs After the 20 mm premcubation, reactions are mmated with 4 pL of -20,000 cprr&L 32P-CCCUCUA and five times the concentration of unlabeled CCCUCUA (determmed in step 1, 10 CIM), mixmg rapidly using a Pipetman. Time-points are taken as m Section 3.1 6. Follow steps 7 and 8 of Section 3.1.) but only plot the fraction of product formed vs time, and obtain a linear fit to the data. The slope of the lme is kobsand k,,, = k ohsx [S]/[E] When a burst exists, it should equal the ratio of enzyme to substrate m the reaction if a step after chemistry is fully rate-hmitmg.

3.6. Pulse-Chase

Dissociation

Measurements

Pulse-chase experiments are very powerful experiments providing means of measuring elemental rate constants as well as distmgutshmg between mechanistic models. A pulse-chase experiment allows a ribozyme-substrate complex to form, and then challenges it with a competitor or by dilution ($5). This challenge provides the ability to question whether the energetic barrter for bmdmg is greater than that of the chemical step. If the bound substrate goes on to react after the challenge, then the binding barrier is greater. If substrate dtssocrates and does not react, then the chemical step is slower than dissoctation (see Note 13). The first pulse-chase experiment measures the dissociation rate constant (kl). 1 Prepare a time-course for each reaction that includes a premcubation start time, a 16-mm spin time (see Note lo), a pulse start time, a chase start time (20 s later), and a stop time for each time-pomt taken @ix time-points are suggested). The timepoints should be distributed as described in Section 3.1., keeping m mind that the observed rate of reaction is equal to the sum of the rate of chemistry and dissociation 2. To each reaction tube, add 1 pL of 5X reaction buffer, pH 7 0, 1 pL of 2 I.~V ribozyme (sufficient to bind substrate fully and rapidly), and 1 pL of water. 3. Make chase solutions of 10 pL of 5X reaction buffer, pH 7 0, 5 pL of 20 l.uV CCCUCU, and no G, 5 pL of 10 @4 G, or 11.6 pL of 8.6 mM G, and water to a final volume of 50 pL (see Note 14).

Rbozyme Kmetics

205

4. Begin time-courses by premcubatmg each mixture at 50°C as its start time occurs. After the 20 mm preincubatton, reactions are initiated with 2 pL of -50,000 cpm/pL of 32P-CCCUCUA, mixmg raprdly using a Pipetman. 5. At 20 s, rapidly mix in chase solution. Aliquots (2 pL+) are then removed from the reaction tube, mixed into a stop tube at each designated time-point and placed on ice. 6. Follow steps 7 and 8 of Section 3.1 The chase with high G should show that all substrate has reacted to product, indicating that the rate constant of the chemical step is faster than that of ohgonucleotrde dissociatton For 0 and 1 pMG, the rate constant for dissociation is determined by subtractmg the rate of reaction (k[O or 1 pMG], measured in Section 3.1.) from the observed rate of the pulse-chase reactton (kobs = k, + k[O or 1 pM G]). Since some substrate will dissociate before reactmg, to measure the pulse-chase reaction rate, the data must be corrected for unreacted substrate (see Section 1.).

3.7. Pulse-Double-Chase

Dissociation

Measurements

An alternative pulse-chase experiment provides data that directly measure the dissociation rate constant (k-r) without having to correct for the rate of reaction by G. In this experiment, the chase is broken into two parts. The first sets up the competition between ribozyme-bound 32P-labeled substrate and excess unlabeled product. The second chase causes all the bound substrate to react to product. Such pulse-double-chase experiments allow you to examine a varrety of condrtions that may affect substrate binding: the first chase may have a perturbed pH, a different drvalent ion or salt, or other factor, and the second chase essentially returns the ribozyme to its highly reactive condrtions. 1. Prepare a time-course for each reaction that includes a preincubation start time, a 16 min spm time (see Note lo), a pulse start time, a chase start time (20 s later), a second chase time for each time-point taken (six time-points are suggested), and a stop time 2-3 mm later. The time-points for mixing an ahquot from the first chase into the second should be distributed over the first three half-lives of the reactton, as descrtbed m Section 3 1 2. To each reaction tube, add 1 I.~L of 5X reaction buffer, pH 7 0 and 2 pL of 1 pM rtbozyme (sufficient to bmd substrate fully). 3 For each reaction, make a chase 1 solution of 3 pL of 5X reaction buffer, 2 pL of 20 pMCCCUCU, and 10 pL of water (see Note 14). Also, make a chase 2 soiutton of 24 pL of 5X reaction buffer, pH 7 0, 12 pL of 20 pMCCCUCU (220 x [El) or 14 pL of 8.6 mM G, and water to 120 pL final volume Aliquot 20 pL of chase 2 solution mto SIX tubes, one for each time-point. 4. Begm time-courses by preincubating each mixture at 50°C as its start time occurs After the 20 mm premcubation, reactions are initiated by adding 2 pL of -50,000 cpm/pL 32P-CCCUCUA to the ribozyme tube, mixing rapidly using a Pipetman 5. At 20 s, rapidly mix m chase 1 solution. Ahquots (2 pL) are then taken out of the chase 1 reaction tube and rapidly mtxed into a chase 2 tube at each designated

206

McConnell

time-point. After 2 mm of reaction m each chase 2 tube, an ahquot (2 pL) 1s removed, added to the stop tube, and placed on ice. 6 Follow steps 7 and 8 of Section 3 1 As time contmues during the first chase, more substrate falls off and less product IS formed, since all bound substrate reacts to product m the second chase Thus, the disappearance of product is plotted on a semilogarithmtc plot as a functron of time. The observed rate 1s equal to the rate constant of substrate dissoctatton (k-i). If hydrolysis of substrate is significant durmg the 20 s bmdmg step or during the first chase, there will be a portton of product formed at infinite ttme. This can be corrected for by the same type of correctton used m single-turnover expertments (%Pcorrected = [%P, - %P,)/( 100 - %PJ x 100, where %P, and %P, are the remaining product at any time and infinite ttme, respectively)

3.8. Pulse-Chase

Association

Measurements

If condttions can be established where chemtstry is faster than substrate dtssociation, a pulse-chase experiment can be performed to measure the assoctation rate constant (k,) of strong binding substrates (see Note 15). In thts experiment, it is the pulse time that is varied and the chase time that 1s constant. 1 Prepare a time-course for each reaction that includes a premcubation start time, a pulse start time, a chase time for each time-point taken (&lx time points are suggested), and a stop time 2-3 minutes later The observed rate will be the sum of the assoctation rate (ki[E]) and the dtssoctatton rate constant (k,). Time-points should be distributed over the first three half-lives of the reactton, as described m Section 3.1 2 Prepare and number reaction, chase, and stop mtcrofuge tubes. Ahquot 9 pL of stop buffer mto each stop tube. Make chase soluttons of 24 pL of 5X reaction buffer, pH 7 0,6 pL of 20 w CCCUCU (220 x [El) or 11.6 pL of 8 6 mA4G and water to 120 pL final volume. 3. To each reaction tube, add 4 uL of 5X reaction buffer, pH 7 0,2 pL of 30-l 00 w ribozyme, and 12 pL of water 4. Begin time-courses by preincubatmg each mixture at 50°C as its start time occurs After the 20 mm premcubatton, reactions are mtttated with 2 pL of -20,000 cpm 32P-CCCUCUA (~1 nA4), mtxmg rapidly using a Ptpetman. 5. Ahquots (2 pL) are then taken out of the pulse reaction tube and raptdly mixed mto a chase tube at each designated time-point. After 2 mm of reaction m each chase tube, an ahquot (3 pL) is removed, added to the stop tube, and placed on Ice 6 Follow steps 7 and 8 of Section 3 1 Since the observed rate constant is the sum of the on and off rates (kobs= k, [E] + k,), the dtssoctatton rate constant must be measured m an independent experiment (see Secttons 3 6 and 3.7.).

4. Notes 1. Because of the fast reaction of the Tetrahymena ribozyme, 5 pA4 G 1sthe maxtmum convenient concentration under these conditions

Rlbozyme Kinetics 2 Estimating

3 4

5

6

7

8

9

10. 11

12

13

207

the rate of a reaction or its half-life (/cobs= 0 693/t,,,) is difficult without prior knowledge of the reaction rate. An mmal test is suggested with a few concentrations m the range one expects to use and with a broader range of time-points Because of a 20 mm premcubation time followed by fast time-points, it is best to stagger the start times of each reaction such that time-pomts can be conveniently taken. For best results, concentrations should be measured accurately, and ahquots made with a well-maintained Pipetman Taking ahquots for time-points may be done with a less accurate Pipetman Controls for this experiment are to vary [E] over the range of G concentrations used to show that [E] does not affect the rate Controls showing an effect on the rate by varying pH or by using substrate containing a phosphorothioate substrate provide evidence that the chemical step is rate-llmitmg (8-10). Because the rate of chemistry (k,) is faster than the rate of dissociation (k,) for CCCUCUA, K,,, (-4 CUM)is much higher than Kd (5 nM). Ribozyme concentrations above Kd are allowable m this case provided a high (21 mA4) G concentration is used (see Section 4. of Chapter 21) Vary [G] and [S] to show that these do not affect the reaction rate If changing the [S] affects the rate, mcrease the ratio of [E] to [S]. If changing the [G] affects the rate, then Increase the [G], tfposstble. An exceptron to these controls 1s If the rate of chemistry is slow compared to substrate dissociation (see Section 3 of Chapter 2 1). Ideally concentrations should go up to 10X K,,,. It is necessary that concentrations reach 4X K,,, such that sufficrent saturation is seen. Failure to observe saturation means that higher concentrations are required to determine Km. The inability to measure the rate at higher concentratrons means that K,” cannot be determmed under the conditions used. Ribozyme is incubated separately from the rest of the reactton components, so that the rrbozyme starts in the same initial state under all conditions. Whenever possible, the concentrations that need the most accurate measurements should be added to the reaction tube before premcubatron, and the essentral component whose exact concentration matters less is then added to mitiate the reaction. After 16 min, it may be necessary to mrcrofkge the ribozyme tube for 10 s to pull down evaporated water There exist several computer programs capable of least-squares fitting of data to equations This approach IS more rigorous than traditional inverse plots (I I), and avoids the error of trying to determine Km wtthout havmg reached saturation or without enough data below Km When one changes the conditions (pH, [G], temperature, substrate identity) to affect the rate of chemtstry, there IS no guarantee that this ~111 also affect the bmdmg constant being measured. Such changes must be attempted by trial and error with this caveat m mind. If dissociation is sigmficantly faster than chemistry, then the rate constant of substrate dissociation cannot be measured under the conditions used A pulse-

208

McConnell

double-chase experiment may be used if conditions can be found where the rate of chemistry 1sfaster than dissociation. Nevertheless, the experiment 1sworthwhile m that tt provides srgmticant mformatron about possible mechanisms for the reaction, 14. Controls Include adding a chase without product to measure the rate of chemtstry, adding the chase solution before the labeled substrate to show the effectiveness of the chase, and adding stop solution instead of chase solution to measure the amount of substrate that reacts during the 20 s pulse step. 15. This expenment is limited to substrates that bmd tightly (k-, < k,). This IS because the enzyme concentration must be high enough that there 1ssignificant binding to substrate, but low enough that the association rate (k, [El) can be measured.

References 1 Zaug, A J , Davila-Aponte, J , and Cech, T. R (1994) Catalysis of RNA cleavage by a rtbozyme derived from the group I mtron of Anabena pre-tRNA(leu) Biochemistry 33, 14,935-14,947 2 Herschlag, D , Khosla, M , Tsuchrhashi, Z., and Karpel, R L (1994) An RNA chaperone activity of non-specific RNA binding proteins tn hammerhead ribozyme catalysis. EMBO J 13, 2913-2924 3 Herschlag, D. and Cech, T R. (1990) Catalysts of RNA cleavage by the Tetrahymena thermophila nbozyme. 1. Kinetic description of the reaction of an RNA substrate complementary to the active site. Biochemistry 29, 10,159-l 0,17 1. 4. Pan, T. (1995) Higher order folding and domain analysis of the ribozyme from Bacillus subtdis ribonuclease P Blochemlstry 34,902-909 5. Hertel, K J , Herschlag, D., and Uhlenbeck, 0. C (1994) A kinetic and thermodynamic framework for the hammerhead rrbozyme reaction. Bzochemrstry 33, 3374-3385 6. Chowrira, B M., Berzal-Herranz, A., and Burke, J. M. (1993) Ionic requirements for RNA bmdmg, cleavage, and ligation by the hatrpm ribozyme Blochemlstry 32,1088-1095 7. Zaug, A J , Grosshans, C A , and Cech, T R (1988) Sequence-specific endoribonuclease activity of the Tetrahymena ribozyme: enhanced cleavage of certain ohgonucleottde substrates that form mismatched ribozyme-substrate complexes. Biochemistry 27, 8924-893 1. 8. McConnell, T. S , Cech, T R., and Herschlag, D (1993) Guanosme bmdmg to the Tetrahymena ribozyme. thermodynamic couplmg with oligonucleottde binding Proc Natl Acad SCL USA 90,8362-8366. 9. McConnell, T. S and Cech, T R (1995) A postttve entropy change for guanosme binding and the chemical step m the Tetrahymena ribozyme reaction Bzochemutry 34,40564067 10. Herschlag, D , Piccrrtlli, J. A., and Cech, T R (1991) Rtbozyme-catalyzed and nonenzymatic reactions of phosphate diesters rate effects upon substitution of sulfur for a nonbrtdgmg phosphoryl oxygen atom. Biochemzstry 30,4844-4854. 11. Fersht, A (1977) Enzyme Structure and Mechanism, 2nd ed. W H Freeman and Company, New York

23 Determination of Catalytic Parameters for Hairpin Ribozymes Mary Beth DeYoung, Andrew Siwkowski, and Arnold Hampel 1. Introduction Ribozymes have been successfully designed to downregulate gene expression in vivo. To enhance the probability of success in vivo, the mvesttgator should have available the rrbozyme with the highest catalytic activity feasible. This can only be determined by in vrtro assays for catalytic efficiency and engineering the ribozyme appropriately to optimize this catalytic efficiency. Catalytic effictency ISkJK,,,, where kc,, 1sthe turnover number of the reaction and Km the true Michaelis constant. The kcat and Km values are best obtained mdrvidually by measuring catalytic activrty m reactions where rrbozyme 1shmrting and a range of excess substrate concentrations are used such that the ribozyme turns over (1). Functionally, Km 1s the substrate concentration required to achieve half-maximum reaction velocity (V,,,), and the turnover number kcat is obtained by dividing the V,,, by the ribozyme concentratron (K,,,JPW since Lax = k,,,[Rz]. The Km is a combination of the individual rate constants comprrsmg the overall reactron and, as such, does not reflect the rate of any given reaction step. Burst kinetic methods for the measurement of kcat/Km ratios where substrate is limiting and ribozyme IS m excess do not measure true kc,, and Km values, since no turnover occurs. These methods should be avoided for the objectives of this chapter. Although rt IS of interest to measure individual rate constants for the reaction (the rates of assocration and dissociation of rrbozyme and substrate; the chemical step of the reaction; and the rates of dtssocration of product from the ribozyme), it is not normally necessary to do this detailed kinetic analysis for selection of a catalytically efficient ribozyme for a substrate of therapeutic interest. From

Methods m Molecular E&ted by P C Turner


209

210

De Young, Siwko wski, and Hampel

Our laboratory has tested the acttvtty of more than 100 hanpm rtbozymes. Many of these are targeted to cleave sttes on diverse substrates, such as RNA from HIV-l, HIV-2, human papillomavirus, hepatitis B vnus, as well as a variety of mRNAs from specific genes in both plants and animals. Others are variants of the hairpin rrbozyme designed to improve substrate specificity, catalytic efficiency, or cellular stability. Some mutations were created to determme the sequence motifs required for ribozyme activity and the residues likely to interact in heltces (2,3) (see Chapter 37). For all of these studies, an accurate, rapid, and reproducible method for determining the relative catalytic efficiencies of the ribozymes was necessary. The lowest K,,, values attained for the hairpin ribozyme have been 7 ti (4) and the highest k,,, observed has been 2.l/min (5). Catalytic effictenctes are generally in the range of 106-1 0’ 11S’/min. The method for determining the catalytic parameters of hairpin ribozymes will be given in two parts. The first describes the preparation of ribozyme and substrate RNA suitable for kinetic analysis, and the second describes planning and performance of the kinetic experrments. The methods and materials themselves are components and variations of previously published procedures (1-6). Preparation of ribozyme and substrate RNA mvolves obtammg oligodeoxynucleotides with the proper codmg sequences, annealmg the olrgodeoxynucleotides to form partial duplexes, transcrtbmg radioactively labeled RNA from the DNA duplexes with T7 RNA polymerase, purifying the RNA transcripts via polyacrylamide gel electrophoresis (PAGE), and quantitatmg transcripts isolated from the gel based on their radioacttve content. The substrate and ribozyme transcripts are then resuspended to concentrations > 100 nM, mixed m various proporttons m the presence of cleavage buffer, and allowed to react at 37°C for defined time intervals. Substrate and products are separated by PAGE, detected by autoradiography, and quantitated by scmtillanon counting of the bands. The change in product concentration as a function of time at a given substrate concentration is used to calculate mtttai reaction velocity (V). The K,,,, Vmax,and &at are calculated from at least eight substrate concentrations and their associated velocmes using the Michaelis-Menten equation: (1) Y,,, and Km are calculated using a non-linear curve-fitting program. V,,,,, 1s divided by the ribozyme concentration [R] to give k,,,. The catalytic efficiency is then obtained by dividing kcatby Km. Based on these values, the cleavage properties of a given ribozyme are Judged as acceptable or msuflicient for the desired application. In some cases, cleavage properties may be improved by altering the ribozyme as described in Chapter 19.

211

Halt-pin Ribozymes 2. Materials 2.1. Transcription

of Ribozyme and Substrate RNA

1 Fresh deionized or glass-distilled water. No DEPC or other RNase-denaturing treatment is needed 2. Sterile plastlcware, mcludmg 0.5 and 1 5 mL plastic microcentrlfuge tubes and standard automatic plpet tips. 3 Gloves, which should be worn at all times to avoid contammatmg the experiment with RNases 4 Accurate, precise, and well-mamtamed Plpetmen or equivalents, including one l-10 pL Plpetman dedicated to kmetlcs. 5. Formamide dye mix: 98% molecular biology grade formamlde (deionized), 10 mM EDTA with 1 mg/mL xylene cyanol, and bromphenol blue. Store frozen m ahquots. A working solution kept at 4°C 1s stable for several months. 6. A 10% polyacrylamlde/7 Murea gel. 10 mL of 50% polyacrylamlde (24.1 w.w acrylamide:bls-acrylamide), 2 1 g of urea, 5 mL of 1OX TBE (890 mA4Tris, 20 mM dlsodium EDTA, 890 mM boric acid, pH 8.3), fresh, stenle water to 50 mL, 50 pL of TEMED solution and 350 pL of 100 mg/mL ammonium persulfate. Alternatlvely, use a 15% polyacrylamlde gel consistmg of the above ingredients with 15 mL of the polyacrylamide stock Gels are made withm 24 h of use 7. Gel runnmg buffer 1X TBE (a 1 10 dilution of the 10X TBE stock). 8. Plastic wrap to cover radioactive gels during autoradlography (e.g., Saran Wrap). 9 Materials for autoradiographic detection of radioactlve transcripts, including autoradlographlc film (e.g., FuJi), tape and a pencil for marking the film, an autoradiographic cassette, and photographic developing and fixing solutions 10 A sterile scalpel for excising RNA bands from polyacrylamlde gels 11 100% Ethanol used only for working with RNA. 12 A standard laboratory mlcrocentrlfuge capable of spinning at > 10,OOOg. 13. Synthetic DNA ohgonucleotlde templates coding for ribozymes and substrates, which include the T7 promoter sequence followed by the mltiatmg nucleotldes CCC (for rlbozyme templates) or CGC (for substrate templates) to improve T7 RNA polymerase transcrlptlon (7). Rlbozyme and substrate sequences are designed as described m Chapter 19. 14. An ohgodeoxynucleotlde complementary to the T7 promoter sequence m step 13. This sequence can be used generally for transcribing all nbozyme or all substrate sequences The sequence used for rlbozymes is 5’-TAATACGACTCACTATA GGG-3’, and that used for substrate DNA templates 1s 5’-TAATACGACTCA CTATAGCG-3’ (see Note 1). 15. 1 MTns-HCI, pH 7.5. 16 2X Transcription buffer* 8% polyethylene glycol3000,0.2% Triton X-100,2 mM spermidme, 10 r&Y DTT, 80 mM Tris-HCl, pH 8 0, and 12 n-J4 MgCl* This solution 1snot further concentrated to avoid precipitation. It 1s stored frozen and must be thoroughly mixed before use 17. 10 mA4 NTP solution: ATP, CTP, GTP, and UTP each at 10 mM. Store at -20°C m allquots. Avoid repeated freeze/thawmg

212

De Young, Siwkowski, and Hampel

18. Labeled nucleottde a32P-CTP (10 pC@L, 3,000 Cl/mmol) (e g., ICN Duarte, CA) for transcript labeling. Store frozen, and use within 1 wk of the reference date. When m use, keep the reagent on ice. Repeated freeze/thawing and holding at room temperature ~111 inactivate 19 T7 RNA polymerase 20 U/pL (e.g., Ambion, Austin, TX, cat. #2084) (see Note 2) 20. RNasm (40 U/pL), an RNase mhtbttor from Promega (Madison, WI) 21 RNase-free DNase I (2U/pL), from Ambton (Austin, TX) cat #2222 22 Gel extraction buffer for extracting RNA transcrtpts from gels 0 5 Mammomum acetate, 2 mA4 EDTA, and 0 5 mg/mL SDS. 23 A homogemzmg pestle sized to fit a 1 5 mL mtcrocentrifuge tube for grinding gel fragments (Research Products International Corp , Mt Prospect, IL) 24 A laboratory shaker for agitating microcentrifuge tubes rapidly and continuously (e.g., Eppendorf #5532 Mixer) 25 Glycogen 20 mg/mL (e.g , Boehrmger-Mannhelm, Germany, cat. # 90 1393) 26 70% Ethanol, 2 mM EDTA

2.2. Determination

of Catalytic Parameters

In addition to many of the materials in Section 2.1, the followmg are required* 1 4X Cleavage buffer: 8 mM spermldme, 48 mM MgCl,, and 160 mM Trts-HCl, pH75 2 The ribozyme and substrate transcripts prepared as above. 3 Bio-Safe scmtillation flurd (e.g., Research Products International Corp , Mt. Prospect, IL, cat #l 11195) 4 Scintillation vials 5 The PC-compatible program Tablecurve 2D v.3 for wm32 from Jandel Scientific Software Co., San Rafael, CA or equivalent

3. Methods 3.1. Transcription

of Ribozyme and Substrate

RNA

1. Resuspend in sterile dH20 DNA ollgonucleotldes, either made m house, or purchased from a commercial source, such as Ohgos Etc. (Wtlsonvtlle, OR) Purify by reverse-phase chromatography or PAGE (see Note 3) Following purification, dissolve each DNA sample m distilled water and determme its concentration by measuring the opttcal density (OD) (1 OD,,, unit = 33 ug/mL of oligonucleotide). Using these values, prepare DNA soluttons at 100 ng/pL In a 100 pL total volume, combine equimolar amounts of the DNA ohgonucleotlde coding for the ribozyme or substrate and the respective T7 promoter ohgonucleotlde to give a final DNA concentration of 100 ng/pL Include 1 pL of 1 MTns-HCl, pH 7 5 Heat to 90°C and then allow to equilibrate to room temperature As the solution cools, the DNA strands anneal to form a duplex. The annealed mixture can be stored frozen for repeated use.

Hairptn Ribozymes

213

2 Assemble the transcription mixture m the followmg order: DNA complex (100 ng/$) NTPmix(lOmM) 2X Transcriptron buffer dHzO to make a final volume of 50 pL RNasm a3*P-CTP

3 4

5.

6

7.

8

9

10

4-10 pL 2.5-5 pL 25

NJ

1lJ-J 2-4

CLL

At this point mix thoroughly before adding the enzyme. T7 RNA polymerase, 1 pL. After adding the a3*P-CTP, caution must be used to prevent radioactive contamination. The experimental process should be monitored carefully and contmuously with a Geiger-Mueller counter from this step onward Incubate at 37°C for 3 h (see Note 4), then add 1 pL of DNase to remove DNA template from the mixture, and incubate for a further 30 min (see Note 5). Terminate the DNase treatment by adding 50 pL of formamide dye mix or by ethanol precipitation. To precipitate, add 125 pL of 100% ethanol, and cool at -80°C for 30 mm or -20°C overnight Mrcrofuge at >lO,OOOg for 15 mm, and remove the supernatant, dry the precipitate, and redissolve in 8 pL of TE or water Then add 8 p.L of formamide dye Heat either sample type to 90°C for 3 mm, and cool rapidly on ice This denatures any RNA secondary structure that mtght interfere with electrophoretic mobihty Load the transcription reaction mixture onto a 10% polyacrylamide gel for ribozymes or a 15% polyacrylamide gel for substrates For the nonprecipttated samples (m step 4), large-sized wells capable of holding 100 pL should be used in preparing the gels (see Note 6) Run the gels (40 cm) with substrate RNA samples untrl the bromphenol blue dye front leaves the gel. Run nbozyme samples until the xylene cyan01 front has moved approx */3 of total distance down the gel. This ensures better separation of the desired RNA transcripts from transcripts that are one or more bases longer or shorter See Fig. 1 for the typical appearance of the separation procedure. Identrficatton of the correct bands is necessary and is best done by direct RNA sequencing (see Note 7). Cover the gel with Saran Wrap, and lay a piece of autoradiographic film on top. If tape is apphed to the wrapped gel overlapping the edges of the film and pencil marks showing the tape locations are put on the film, this will allow correct realignment of the film and gel after development. A successful, high-yield transcription requires only a 2-5-mm exposure. Realign the developed film with the gel to reveal the location of the desired transcript bands. Excise them from the gel with a sterile scalpel, and transfer to 1.5 mL mrcrocentrrfuge tubes Add 0.5 mL of gel extraction buffer, and grind the gel piece with a homogemzmg pestle. The gel slurry IS then shaken rapidly on a shaker for at least 60 mm to extract the RNA. Centrifuge the gel slurry at > 10,OOOgm a microfuge for 20 mm at room temperature to sediment the gel pieces Remove the supematant to another tube. Add 2 5 vol

214


71nt DNA -

;

r/ :r-S 53nt RNA-

1

Fig. 1. Typical autoradiographafter PAGE of an RNA ribozyme and substratetranscription reaction. (A) Purification of ribozyme transcripts on a 10% gel. Lane 1, DNA markers; lane 2, a 53 nt reference RNA transcript; lane 3, a 55 nt experimental RNA transcript(R). (B) Purification of substratetranscriptson a 15%gel. Lane 1, DNA markers; lane 2, a 17nt referenceRNA transcript; lane 3, a 17 nt experimentalRNA transcript (S).

11.

12. 13.

14.

of 100% ethanol and 1 pL of 20 mg/mL glycogen. The glycogen is added to improve precipitation of small RNA fragments. It is important that no gel fragmentsbe transferred at this point, since they may introduce spuriousradioactivity, which interferes with transcript quantitation. Precipitate the RNA at 40°C for 30 min or -20°C overnight. The overnight precipitation at -20°C gives the best yield of thesesmall RNAs. It is then centrifuged in a microcentrifuge at 4°C for 30 min at >lO,OOOg.Wash the pellet two times with 70% ethanol, and 2 mA4 EDTA. The washesare important to remove any SDS remaining fi-om the extraction buffer, During the extraction process,the SDS prevents RNaseactivity and protects the integrity of the transcript; however, residual SDS will also inhibit ribozyme cleavage and thereby interfere with kinetic analysis.Avoid all potassiumsalts,sincepotassiumSDS forms an insoluble precipitate. Dry the RNA transcript pellet and store frozen until use. It should be used for experiments within a week owing to decay of radioactivity. The amount of RNA obtained from the transcription reaction is quantitated based on its radioactivity by Cerenkov counting. The counting efficiency of a given scintillation counter for 32Pshould first be determined by measuring the cpm produced by a sampleof known dpm. Count the dried RNA samplesdirectly in a scintillation counter, and calculate the yield of RNA transcript from the cpm observed. The dpm are calculated from cpm using the counting efficiency. Dpm are then converted to pCi using the equivalency 1 @I = 2.22 x lo6 dpm. The number of pmoles of C nt in the sample is then calculatedby multiplying the numberof molesof CTP addedby the fraction of the addedradioactivity incorporated into the RNA transcript. The equation is: pmol of C in sample= pmol of CTP addedx [pCi in isolated transcript/(pCi CTP addedx decay factor)]

(2)

215

Halt-pin Rlbozymes

The decay factor is a correction for the half-life of 32P For example, on the reference date, the decay factor value is 1, and after 14 3 d, tt is 0 5 (the t,,, of 32P is 143 d) The number of pmoles of C m the sample is converted to pmoles of RNA using the number of C residues in a given RNA transcript pmol of RNA m transcript = pmol C m sample/(mol C/m01 of RNA)

(3)

Yields vary with different templates, but this method can produce up to 400 pmol or 5 pg of high-specific-activity RNA

3.2. Deferminafion

of Cafalyfk

Parameters

1 A ribozyme with unknown catalytic parameters should be tested in several stages. Inmally, resuspend the substrate transcript at a concentration of 400 nM and ribozyme at a concentration of 80 nM to give a 5: 1 substrate:ribozyme ratio An 8 pL cleavage reaction is then assembled that consists of 2 pL each of ribozyme transcript, substrate transcript, dH20, and 4X cleavage buffer. Control reactions should include mcubation of substrate m cleavage buffer without ribozyme and mcubation of ribozyme m cleavage buffer without substrate Additional controls are the original sTRSV native hairpin ribozyme and substrate 2 Incubate the above mixtures for 1 h at 37°C. Add 8 pL of formamide dye mix to stop the reactions, and place on ice Heat to 90°C, snap-cool, and separate on a 15% polyacrylamtde gel which is run until the bromphenol blue dye front has moved M m. 3. Cover the gel with Saran Wrap, altgn with carefully marked autoradtography film, and expose at -80°C overnight. After development, the location and mtenstty of the radioactive substrate and product bands are observed An example of a cleavage gel is shown in Fig. 2. This is a typtcal gel for determination of kmettc constants 4 After realignment of the film and gel, excise the bands, and place them m scmtillation vials with scmttllation fluid Determme the cpm per band by hquld scmtillation counting (see Notes 8 and 9). 5. Calculate the fraction of substrate converted to product as follows* Fraction cleaved = [cpm (P)/[cpm (S) + cpm (P)]

(4)

where P is product produced and S is substrate remaining The product concentration is calculated as: (Product) = fraction cleaved x (substrate added)

(5) Since the ratio of ribozyme to substrate is l-5 in this example, a cleavage fraction of more than 0 20 is necessary for ribozyme turnover to occur If no turnover is observed, the reaction was single-event. It is then necessary to alter the ribozyme sequence to improve its cleavage efficiency, 1 e , the ribozyme arm hybridizmg to the substrate to form helix 1 may be excessively long such that product departure is very slow


216 12345

6

78

9

10

11

12

Fig. 2. A typical autoradiograph of a ribozyme/substrate cleavage reaction. Ribozyme kinetics: Ribozyme (2.5 nA4) was incubated with varying concentrations of substrate (lane I,4000 ti, lane 2,300O ti, lane 3,200O nM; lane 4,150O nM, lane 5,1000 nM; lane 6,750 ti, lane 7,500 nA$ lane 8,250 nM; lane 9,125 ti, and lane 10,62.5 nA4) for 2 h at 37°C. Lane 11 contains the substrate (125 nM), which was incubated under identical conditions, but without ribozyme. Lane 12 contains the contents of a completion reaction, which contained 62.5 nM ribozyme and 125 nM substrate, which was subjected to identical cleavage conditions as the kinetics reactions. This is used to determine the extent of cleavage, since some of the substrate is typically uncleavable. (R) is ribozyme, (S) substrate, (3’F) 3’ cleavage fragment, (5’F) 5’ cleavage fragment.

6. Based on the results from the initial cleavage reaction, design a time-course experiment to verify multiple turnover and give a first approximation for the range of the kinetic constants as well. If 100% cleavage has been obtained, lower concentrations of ribozyme and shorter reaction times should be tested. Dilute the ribozyme stocks appropriately, and perform cleavage reactions as before. 7. The results of the time-course experiment can be used to calculate an approximate reaction turnover, which, in turn, can be used to design conditions for formal kinetic analysis. For example, if 50 nM of product are detected from 10 nM of ribozyme in 5 min, five turnovers occurred in that time, giving a reaction rate of l/min. For accurate correlation of reaction velocity with substrate concentration, ~20% of the initial substrate concentration should be cleaved in order to stay in the linear range of product vs time. The counts produced must be significant compared to background (usually >lOO cpm/band). For the above hypothetical reaction, 1 nM of ribozyme should give 1 nA4 of product in 1 min or 10 nM of product in 10 min. If the lowest substrate concen-

217

Halt-pm Ribozymes

tratron tested IS 100 nM, appropriate reaction condtttons are a 10 mm reaction with 1 nMof ribozyme 8 Determine k,.,, and K, values for the rtbozyme and substrate. This IS done with multiple-turnover reactions (see Note 10). Cleavage reactions are done by determmmg mtttal velocity of the reactton using a range of substrate concentrattons around the proJected K,,,, wtth ribozyme concentration fixed At least two time intervals should be done for each ribozyme/substrate combmatton m order to show lmearity of the reaction and determine mtttal velocity To perform the experiment, substrate, ribozyme, water, and cleavage buffer are combined as indicated for a defined time period, electrophoresed as described, and detected by autoradtography. The mmal substrate and ribozyme concentrattons are known Velocity is determined as the concentration of product generated per minute For each kinetic assay, the percent cleavable substrate IS corrected from the timecourse For example, by these T7 transcription methods, only 80-90% of the prepared substrate can be cleaved 9 The values for substrate and veloctty are entered into a curve-fitting program, such as the Jandel Sctentlfic Tablecurve program The data are fit to a “userdefined equatton,” which IS y = A x/(B + X)

(6)

where y is velocity, x is mittal substrate concentratton, A IS Vmax,and B IS K,,,. The output draws the curve of best fit through the points, gives a statistical esttmate (r2) of how well the data are defined by the equation, shows a 90% confidence interval, and gives values for A and B. The kcat IS calculated by dtvtding A (V,,,) by the rtbozyme concentration (see Note 11) 10. The kinetic experiments are repeated several times, adJustmg substrate concentration around the Km to give an even distribution of points to define the curve (see Note 12) Rrbozyme concentratton and time are adjusted to give multiple turnover for each time-point and to stay near the linear part of the initial veloctty curve. To show reproductbthty, it IS best to use substrate from separate transcrtptton reactions to verify that the stock concentrations are accurate. An error m the stock concentration of substrate introduces a systematic error m Km Using this method, minimal variations m k,,, and Km can be achieved.

4. Notes 1. The DNA partial duplexes used for transcription of substrate and rtbozyme are designed to improve the RNA yield. This IS accomplished by adding a GGG or GCG sequence to the 5’-end of the desired transcript, which improves T7 RNA polymerase initiation (7), and which extends the DNA duplex past the initiation site, thus improving stability at 37°C Although T7 RNA polymerase requires the DNA duplex for bmdmg, tt dissociates the two strands at the mmatton site durmg transcriptton so the length of the complementary region followmg the promoter is unimportant. Full complementartty would requtre the synthesis of addtttonal oligodeoxynucleotides and is clearly not necessary

218

DeYoung, Siwkowski, and Hampel

2. A variety of highly purified, high-concentratton T7 RNA polymerases are currently commerctally avatlable However, m our experience, they do not all perform equally well We find that Ambion T7 RNA polymerase produces fewer bands that are not the size of the template that makes band tdentificatton easier 3 The method of oligodeoxynucleotide purification used affects RNA transcription yield. Our laboratory has had the greatest success wtth HPLC-purified DNA We use an Aquapore RP-300 7-pm Brownlee reverse-phase column eluted with a gradient of acetomtrile-trtethylammomum acetate, pH 7.0. Thts method 1s fast, and the volatile solvents used for elutton are easily removed rn V~CUOto give a highly purified salt-free sample. A desalting column can be used, but does not yield comparable results for transcription by T7 RNA polymerase. Gel purilication and subsequent removal of salts are much longer and more laborious 4 A variety of reaction times have been tested for their effect on yield Although presumably longer reaction times should result m higher yields, we have not observed this to be the case past 6-8 h Overmght reactions result m lower yields, perhaps owing to a lessened effectiveness of the RNase mhibttor. Addmon of 2 5 & of 10 mi!4 GTP halfway through the mcubation can increase transcription yields 5 DNase I 1sused to termmate the transcription reaction because it was found that, despite the difference m molecular weights, small quanttttes of ohgodeoxynucleotides were copuntied with the RNA transcripts durmg gel electrophorests Since the DNA 1scomplementary to the RNA sequences, thts could interfere with nbozyme acttvny 6 Transcription reactions can either be loaded directly mto large-capacity lanes on polyacrylamtde gels or ethanol-prectpttated. The former procedure IS more rapid, mtroduces less risk of spreadmg radioactivity m the lab, and no RNA 1s lost owing to mcomplete precipitation or resuspension. However, the latter procedure allows the reactron to be electrophoresed m a smaller-diameter well, resulting m a more concentrated RNA band with less associated polyacrylamide, which gives a more efficient RNA extraction. A critical step m the transcription reaction is identification of the desired tran7. script band(s) (8). Addition or subtractton of a base from either the substrate or ribozyme could result m altered rtbozyme-substrate hybridization, which would stgntticantly affect reaction kinetics. Ideally, the major band on the gel should be the same size as the coding region of the template, but m practice, this IS not always true. A control transcript with a dommant band of known size or kmased RNA or DNA standards should be used for comparison Smce DNA ohgonucleottdes migrate at a different rate than RNA, synthesized RNA either kmased by T4 PNK with Y~~P-ATP for 30 mm at 37°C to 5’-end label the RNA or internally labeled by T7 transcription with a32P-CTP is recommended, although the mtgration rate of short substrate RNAs (16-20 nt) can be sequence-dependent We routinely use a T7-transcribed standard, whtch has been sequenced by direct RNA sequencing. Even though the purification of the transcript is done on 7 A4 urea gels, we often see sequence-dependent variations m mobility of RNA To be certain of the tdentification of the RNA bands, tt 1stherefore necessary to identify the correct band by direct RNA sequencing (see Chapter 11).

Hairpin Ribozymes

8.

9.

10.

11,

12

A typical transcriptton for both rtbozyme and substrate IS shown m Fig. 1. We have found that when the single-stranded template method for transcribing RNA is used, the correct ribozyme transcript band is fairly easy to Identify (Fig. 1A). It 1salways the dommant band This can be confirmed by direct RNA sequencing (see Chapter 1 l), but that IS rarely necessary. Ftgure 1B shows a typical transcription of a substrate by these methods Note that many smaller and larger bands are found in the transcript. One can estimate the correct transcript by comparing its mobtltty with that of a control reference transcript that has previously been sequenced This has been done for the example shown m Fig. 1. A 17-mer experimental transcript (lane 3) IS shown next to a reference 17-mer transcript (lane 2). Note, however, that the experimental transcript moves about i/z band different to the reference transcript This IS owing to mobility dependence on the sequence of the RNA. Therefore, to be certam that the correct band is selected, tt 1srecommended that the correct transcript be conIirmed by direct RNA sequencing (see Chapter 11). The number of C residues m the substrate RNA transcript can be used to verify that the product bands have been excised correctly. The molar ratio of Cs in each product band should correspond to the ratio of the counts A “GCG” sequence 1s used instead of “GGG” m substrate mitratton to increase the number of radioactive residues m the transcript and ensure the S-cleavage product is labeled A phosphonmager, if available, can also be used to quantitate the products of a ribozyme reaction. Although results are obtamed more rapidly with the phosphorimager screen,the linearity of the responsemust be monitored. In our hands, a series of twofold dtluttons of kinased RNA yielded a biphastc relationship between radtoacttve counts and the amount of RNA transcript. A correction factor wasrequired so that low counts from the products were on the same scale as the more concentrated substrate. We recommend that kmetic charactertzatton of ribozymes be done using multtple-turnover reactions (excess substrate) as opposed to burst reactions (excess ribozyme) Burst reacttons do not include the on/off rate of substrate, which is crucial for the operational ribozyme/substrate reaction The kc,,/&, values measured by burst kinetics are not Michaelis-Menten-defined parameters The nonlinear calculation method described is recommended over a linear transformation of the Michaelis-Menten equation, such as Lmeweaver-Burke The latter plot of l/V vs l/[S] results m a disproportionate emphasis on low substrate concentrations, which give a high value of l/[S] The nonlinear curve-fitting method gives equal emphasis to all points. In our experience, fewer points appear anomalous when fit to a curve rather than a line. Neither kc,, nor Km can be accurately determined unless V,,,,X 1s approached experimentally. This requires observation of a defimttve plateau m the graph of V vs [S], which can require substrate concentrattons several times greater than the K,,, When a ribozyme has a K,,, >5 @4, thts can be difficult to achieve because transcription yields may be msufficient to achieve the needed concentrattons of substrate. In such sttuattons, larger amounts of high-quality chemically synthesized RNA may be required (9)

220


Acknowledgment This work is supported by NIH grant ROl AI29870

to A H.

References 1. Ferscht, A (1985) Enzyme Structure and Mechanzsm W. H Freeman and Company, New York. 2. Hampel, A., Trrtz, R., Htcks, M., and Cruz, P. (1990) Hanpm catalytic RNA model: evtdence for helices and sequence requtrement for substrate RNA Nuclezc Aczds Res 18,299-304 3 Anderson, P., Monforte, J , Tritz, R , Nesbitt, S., Hearst, J., and Hampel, A. (1994) Mutagenesis of the hairpm rtbozyme. Nuclezc Aczds Res 22, 1096-l 100. 4 Yu, M., Poeschla, E., Yamada, 0, Degrandis, P , Leavitt, M., Heusch, M., Yee, J , Wong-Staal, F , and Hampel A (1995) In vztro and in vzvo characterization of a second functional hairpin ribozyme against HIV-l Virology 206, 38 1-386. 5. Hampel, A. and Tritz, R ( 1989) RNA catalytic properties of the mmimum (-)sTRSV sequence Blochemzstry 28,492!%4933. 6 Sambrook, J , Fritsch, E., and Mama&, T (1989) Molecular Cloning A Laboratory ManuaE Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 7 Milhgan, J , Groebe, G., and Uhlenbeck, 0 C. (1987) Ohgoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nuclezc Aczds Res 15,8783-8798. 8. Cazenave, C. and Uhlenbeck, 0. C (1994) RNA template-directed RNA synthesis by T7 RNA polymerase. Proc Natl. Acad Scz USA 91,6972-6976 9 TSOU, D , Hampel, A , Andrus, A., and Vmayak, R (1995) Large scale synthesis of oligonucleotldes on high-loaded polystyrene (HLP) support NucEeoszdes and Nucleotzdes 14, 1481-1492

24 Characterizing

Ribozyme Cleavage Reactions

Philip Hendry, Maxine J. McCall, and Trevor

J. Lockett

1. Introduction Ribozymes are strands of RNA that are able to catalyze reactions. The ability to quantify accurately the catalytic activity of rtbozymes is central to the process of defining their mechanisms of action. The catalyzed reaction is most commonly a trans-esterification reaction, resulting m cleavage of a strand of RNA that may or may not be part of the ribozyme strand. The aim of this chapter is to describe in detail the processes by which kinetic information can be extracted from a ribozyme-substrate system. The methods will be discussed with particular reference to hammerhead rtbozymes, but some of the techniques may be applicable to other ribozymes. The hammerhead ribozyme was discovered as a self-cleaving RNA m certain plant viroids and satellite RNAs (Z). Shortly after the conserved features of the hammerhead were defined (2,3), it was shown that it would act as a true enzyme, m cleaving multiple substrates in a bimolecular reaction (4). There are a number of ways that the self-cleaving hammerhead can be divided mto two separate strands. The most useful of those is that which separates almost all of the conserved nucleottdes onto the ribozyme strand, leaving the substrate strand with only the UX requirement (5) (see Fig. 1). This is the commonly used trans-cleaving form of the hammerhead ribozyme, and the reader can assume that hereafter the terms ribozyme and substrate refer to this particular arrangement. In the most general terms, the trans-cleavage of a substrate by a hammerhead ribozyme can be described by the processes in Scheme 1. The ribozyme and substrate form a complex In the presence of some divalent metal ions, usually Mg2+, the substrate is cleaved, and the two separate products dissociate from the ribozyme. In one well-studied example, rate constants have been From


Bology, Vol 74 Rtbozyme Protocols Humana Press Inc , Totowa, NJ

221

Hendry, McCall, and Lockett

222 Substrate -3

I I I I I I I I I IUI

x I I I I I I I I I I I 3’ 5’

Fig. 1. Hammerhead rtbozyme and substrate showing the most commonly used form, where almost all of the conserved nucleottdes are located on the rtbozyme strand Only the sequence 5’ UX IS required on the substrate strand, X = A, C, or U, although not all such sequences are cleaved wtth the same efficiency (9-12)

R+

h

S -ii-- -1

Scheme 1. Minimal

k3

RS 4

kz

k-z

RP,P,

d

-3 k4

\ k-4

RP’ + “k%

R + p, + p

k RP, + Pl Y k-6

2

kmetrc scheme for hammerhead rrbozyme

assigned for all the steps m the process (20). In thus chapter, we will descrrbe the measurement of the cleavage step, k2, as well as the kinetic parameters, kc,, and K,, for the entire catalytic cycle. 2. Materials Other chapters in this volume describe the synthesis of ribozymes and substrates. Whether they are made by transcrrption from DNA templates (Chapter 10) or by solid-phase synthesis (Chapters 7 and 8), it 1simportant that they be accurately quantrtated and as homogeneous as possible. 1. 10 pJ4 Rrbozyme 2. 10 uA4 32P-labeled substrate. 3 Stock buffers (autoclaved). 500 mM Tris-HCl at pH 8 0, pH 7 50, and pH 7.0, 500 mA4 Mes, pH 6 5. 4 100 mM MgC12 (autoclaved) 5 Stop/loadmg solution 90% formamtde, 20 mM EDTA, and gel tracking dyes, made by mixing 9.0 mL of formamtde (detomzed), 0 4 mL of EDTA (500 mM), 0.3 mL of xylene cyan01 FF l%, and 0 3 mL of bromophenol blue 1%

Charactenzmg Cleavage 6 7 8 9 10

223

40% Acrylamide/bts-acrylamide (19 1) stock solutton Urea 10X TBE buffer: 890 mMTris-borate, pH 8 3,40 mMEDTA. Apparatus for runnmg polyacrylamide gels. Phosphortmagmg system (e g., Molecular Dynamtcs [Sunnyvale, CA], FUJI [Tokyo, Japan], and so forth) or scmtillation counter

3. Methods 3.1. Ribozyme Excess Conditions Under conditions of ribozyme excess,dissociation of the cleavage products from the rrbozyme play no part in determining the rate of the reaction. If the ribozyme and substrate are preannealed in the absence of Mg2+, then mmation of the reaction by the addition of Mg2+ should allow direct quantitation simply of the cleavage step, k2 m Scheme 1. The exact concentrations of ribozyme and substrate required to ensure that essentially all of the substrate is bound to ribozyme

~111 vary with the length and sequence of the duplex formed between

the two and the temperature of the reaction. As a starting point, try 1 pA.4 ribozyme and 0.5 l.uV substrate. However, if the observed rates vary significantly on changing the ribozyme

concentratrons,

provtdmg

that the rtbozyme

remains in excess, it is likely that the complex is not fully formed, and the concentrations of the ribozyme may need to be increased (see Note 1). The conditions of the experiment, pH, temperature, and MgC12 concentration can be varied widely. There are no “standard” conditions. However, 10 or 25 mA4 MgC12,pH 7.5 or 8.0, and a temperature of 25 or 37OC are quite commonly used and will allow easy comparisons to be made with published data. Discussion of the effects of these variables on the cleavage rates can be found Chapter 25. 1. In a reactton tube, place the rtbozyme, 32P-labeled substrate, buffer at appropriate concentrations, and add water to make the volume to 18 pL. 2. Heat the solution to 85°C for 2 mm, centrifuge briefly, then place in a water bath at the appropriate temperature, and allow to equilibrate for several mmutes. 3 To initiate the reaction, add 2 pL of MgC12 solution at 10 times the required concentratton and at the required temperature, and mix well 4 As rapidly as possible (5 or 10 s after initiation), remove a 2 pL sample (using a fresh tip), and quench by adding it to 4 pL of the formamide stop solutton 5. Continue to remove 2 pL samples at appropriate times (see Note 2) 6. When all the requtred samples have been taken, heat the samples m stop buffer to 85’C for 2 min, and then load 2-3 pL of each sample onto a denaturmg polyacrylamide gel The gel concentration depends on the size of the labeled fragments to be separated. We typically use a 15% gel for fragments in the size range 5-25 nt For other fragment stzes, see ref. Il. 7 At the end of the run, separate the glass plates, cover the gel wtth a thm film of plastic, and place underneath a phosphorimager screen for an appropriate time

224

Hendry, McCall, and Lockett 0 167

0.33

0.50

0.75

1.0

20

30

5.0

10,Ominutes

Fig. 2. Typical image of a ribozyme excess cleavage experiment. The substrate was 5’-end-labeled with 32P-phosphate; the ribozyme was unlabeled. Above each lane are the sample times. The boxes drawn around the bands in the first lane exemplify how the extent of cleavage is quantified. The net pixel intensity (background subtracted) in both boxes at each time-point was summed, and the intensity in the S-product box divided by that total.

8. Scan the screen in the phosphorimager, and the image is ready to be analyzed (see Note 3). In this example (see Fig. 2), the substrate is 5’-end-labeled with 32P-phosphate, and the image should consist of two bands per lane. One is the uncleaved substrate, and the other is the 5’-cleavage product, the 3’-cleavage product being unlabeled. 9. Using the quantitation routine in the phosphorimager software, draw constantsized rectangular boxes around each of the bands in every lane. Choose an area of the gel containing no bands as the background. 10. Calculate the pixel intensity within each box and then the intensity of the 5’-cleavage product as a proportion of the total (substrate + 5’-cleavage product) intensity for each lane. At this stage, the data are in the form of percent cleavage at a series of time-points. If the cleavage reaction involves a transcribed substrate, it may be simpler to label the substrate during transcription by incorporation of an a-labeled ribonucleotide. In this case, both cleavage products will usually be labeled, and the quantitation of the amount of cleavage should take into account the amount of label expected in each product. 11. Plot these data as in Fig. 3 to give a qualitative picture of the efficiency of cleavage, which can be further analyzed to extract rate constants. In most instances, if all the substrate is present as a complex with the ribozyme throughout the life of the experiment, the appearance of cleavage products will follow an exponential curve. If this is the case, the data will tit an equation of the type below: pt = pm-

[ex~(~obst)PA1

(1)

where P, is the amount of product at time t, P, is the amount of product at t = 00, kobs is the first-order rate constant for the reaction, and P, is the difference between the percentage of product at t = ~0and t = 0. This is a conventional firstorder kinetic equation from which k ,,bs,P,, and P, are determined by least-squares fitting of the data (see Note 4). A line of best tit is also plotted along with the entered data points (Fig. 3). The half-life of the reaction, rather than the rate constant, is often quoted in publications. For a first-order reaction, the relationship between t’12 and kobs is given by: t’f2 = o.693/kob,.

Charactenzmg Cleavage

225

a0

0 0

2

4

time

6

0

10

(min)

Fig. 3. Product vs time plot usmg the data from Fig. 2. The curve 1s calculated by the program MacCurveFlt to equation (11,with the calculated parameters being kobs= 0.90 f 0 03 min-‘, P, = 85.9 + 0 6% and PA = 82.9 f 1.0%

3.2. Substrate Excess Conditions A complementary method of analysrsof the cleavage kinetics of nbozymes is performed with the substrateconcentratron much greater than that of the ribozyme. Under these condmons, each nbozyme has the opportumty to cleave multiple substrate molecules. Unlike the method described in Section 3.1.) every step in the cleavage reaction (Scheme 1) 1spotentially rate-determmmg. Under these condtttons, the ribozyme is behaving as an enzyme,and this method 1sas used for conventional enzyme kinetics, and yields k,,, and K, values for the nbozyme. Choice of ribozyme and substrate concentrations is dependent on a number of factors. The rtbozyme concentratron should be much lower than the K, for the reactron, but tt should be hrgh enough to allow reasonable amounts of cleavage m reasonable time. Typical values are in the range l-10 r&I (see Note 5). Substrate concentrations should be much higher than the ribozyme concentration, and cover a wide range above and below the K,,, for the reactton. Temperature, pH, and Mg2’ concentratron can also be manipulated to vary reaction rates. 1 In a reaction tube, place the ribozyme, buffer, and Mg*+ solutions at five times the required concentrations to give a stock ribozyme solution 2 In separate tubes, place 32P-labeled substrate soluttons, so that they will make the required substrate concentratton on dtlutton to 20 $, adding water to make the volume to 16 p,L 3. Heat the nbozyme solution and the substrate solutions separately to 85°C for 2 mm. 4 Centrifuge briefly, and then place all the solutions at the reaction temperature 5. Initiate the reactrons by addmg 4 pL of the rtbozyme solutron to each of the substrate solutions


226

Slope lnltlal Substrate Concentration

(nM)

50 8

P

150

i,

i time

i (mm)

i

Fig. 4. Product vs ttme plot of a substrate excess expertment. In thts example, the rtbozyme concentratton 1s 10 nM, and the substrate concentratton varied from 100-2000 nA4. The slopes of the lines are calculated by least-squares fitting and shown on the right stde of the figure

6 At various times remove 2 pL of the reaction solutton, and quench by addition to 4 pL of the stop solution. Sample times can be evenly spaced and should be ttmed so that by the last pomt, < 10% of the substrate has been consumed (see Note 6) 7 Separate the 5’-end-labeled product from the substrate on a denaturmg polyacrylamtde gel as descrtbed in Section 3 1 , starting at step 6 8 Once the proportton of cleavage at each ttme-pomt has been determined, multlply that proportion by the substrate concentratton to give the concentration of product at each trme-point 9. For each substrate concentration, plot the concentration of product against time, and determine the slope of the lme (see Ftg. 4). This gives the rate of reaction, or velocity V, at each substrate concentratton The enzyme kmettc parameters can be extracted from these data by a number of methods, we will describe the EadteHofstee method (see Note 7) For each substrate concentratton, plot the rate of reaction against the rate of reactton dtvtded by the substrate concentratton (Fig 5) The result should be a strwght line, the slope of whtch 1s equal to -K,,, and the intercept is equal to V,, VmaxIS the maximum velocity of the reactton at saturating substrate concentration. This 1sobvtously dependent on the ribozyme concentratton and 1stherefore usually converted to the quantity k,,, by dtvtdmg by the rtbozyme concentratton, i.e., kc,, = I’,,,,,/ [Rbz]. Km 1s known as the Michaelts constant and 1s defined as the substrate concentratton at half the maximum reaction velocity. In terms of the rate constants in Scheme 1, K, = (kl + k2)lkl. Therefore, under conditions where

Characterizmg Cleavage

227

70

y - 64

0.02

0 00

Reactlon

084

- 607 25x R2 - 0 962

0 04

0.06

0.08

c 10

Velocity/[substrate]

Fig. 5. Analysis of the data from Fig. 4 by Eadie-Hofstee plot. km,is much greater than k2, K,,, IS equal to k-,/k, or KS,the substrate dissociation

constant for the rlbozyme

4. Notes 1. The measurement of k2by this method assumes that the ribozymc+substrate complex is formed in the absence of Mg2+, is able to bind Mg2+ rapidly to form the active complex, and all the substrate remains bound throughout the course of the reactlon These conditions will often be met However, this 1snot always the case, for example (12), where a modified ribozyme needed to be incubated in MgCl* for extended periods to achieve consistent results. 2. If rapid sampling is required, it 1srecommended that the reactions are performed m the wells of a 96-well tray wtth the stop solutions placed in adjacent wells. Usmg this technique, we have been able to take samples at 5 s intervals. If the reaction is too rapid to collect samples by this method, you may be able to slow the reaction down to an easily measurable rate by altermg the reaction conditions, such as pH or temperature (see Chapter 25) 3. In the absence of a phosphorimager, it is possible to quantltate the cleavage by the cut-and-count method After electrophoresls, the glass plates are separated, leaving the gel attached to one of the plates, which is then covered with thm plastic film, and m a dark room, a sheet of X-ray film is carefully aligned over the gel. Followmg exposure, the film is developed and dried. Then rectangular boxes are drawn onto the film over the bands of Interest The film is then reahgned beneath the gel and glass plate, and the portlons of the gel correspondmg to the required bands are cut out, placed mto tubes, and counted by Cerenkov counting in a scintillation counter


228

0

5dO Substrate

Fit to the equation V = (V,,,*

10’00

15'00

Concentration

[S])/(K,

2(

(nfvl)

+ [S])

“max = 68 +- 4 nM/mln Km = 698 +- 92

Fig. 6. Analysis of the data from Fig. 4 by nonlinear least-squares fittmg to the equation. V = (I’,,,* [S])/ (K, + [S]), yielding values for V,,, = 68 f 4 nM/mm, and

K,,,=7OOk9OnM 4 We have used a Macintosh Program called MacCurveFit, which is available by anonymous ftp from sumex-aim stanford.edu. To use this program, the input data are time and P,, and the output are kobs,P,, and P, 5 We have experienced difficulty with performing experiments with the ribozyme at 1 r&f or less At such low concentrations of ribozyme, there appeared to be significant amounts of the ribozyme adsorbed onto the surfaces of the tube and making it unavailable to participate m the reaction. 6. Cleavage of more than about 10% of the substrate is not advisable, because the rate of the reaction will be dependent on the substrate concentration In addition, note should be made of the fact that the rate of cleavage can change after the cleavage of 1 eq of substrate For example, tf the rate of dissociation of one of the products is slow, then 1 eq of substrate may be cleaved rapidly, followed by a much slower cleavage rate For this reason, it is advisable to start sampling after the cleavage of 1 eq, or at least follow the cleavage until 3 or 4 eq are cleaved This is obviously particularly applicable at low substrate concentrattons 7. Alternatively the enzyme parameters can be extracted using the double-reciprocal plot, 1 e., l/rate vs l/[Substrate], where the slope gtves Km/V,,,,,and the intercept is equal to l/VmaX Further, the data may be extracted directly by a nonlinear curve fitting of the data to the equation V= (V,,,,,* [S])/ (Km+ [S]) as shown m Fig. 6.

Charactermng

Cleavage

229

References 1 Symons, R H (1992) Small catalytic RNAs. Ann. Rev Bzochem 61,641-671 2 Forster, A. C and Symons, R H (1987) Self-cleavage of plus and minus RNAs of a vnusoid and a structural model for the active sites Cell 49,2 1 I-20 3. Forster, A C. and Symons, R. H. (1987) Self-cleavage of vnusoid RNA is performed by the proposed 55-nucleottde active site. Cell 50,9-16 4 Uhlenbeck, 0. C (1987) A small catalytic ohgoribonucleottde Nature 328,596-600 5. Haseloff, J and Gerlach, W. L. (1988) Simple RNA enzymes with new and highly specific endoribonuclease activmes Nature 334,585-591 6 Ruffner, D E., Stormo, G D., and Uhlenbeck, 0 C. (1990) Sequence Requirements of the hammerhead RNA self-cleavage reaction Bzochemzstry 29, 10,69>10,702. 7 Perriman, R., Delves, A , and Gerlach, W L. (1992) Extended target-sate spectficity for a hammerhead rtbozyme Gene 113, 157-l 63. 8 Shimayama, T , Nishtkawa, S , and Tatra, K. (1995) Generaltty of the NUX rule* Kinetic analysts of the results of systematic mutations m the trmucleottde at the cleavage site of hammerhead ribozymes. Biochemistry 34,3649-3654 9 Zoumadakts, M and Tablet-, M. (1995) Comparattve analysts of cleavage rates after systematic permutatton of the NUX consensus target motif for hammerhead rrbozymes Nucleic Acids Res 23, 1192-l 196. 10. Hertel, K. J., Herschlag, D., and Uhlenbeck, 0. C. (1994) A kinetic and thermodynamic framework for the hammerhead rtbozyme reaction Blochemlstry 33, 3374-3385. 11 Sambrook, J., Frrtsch, E F., and Maniatts, T. Molecular Clonwg* A Laboratory Manual, 2nd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. 6 37 12. Thomson, J B , Tuschl, T., and Eckstein, F. (1993) Activity of hammerhead ribozymes contammg non-nucleottdrc linkers Nucleic Acids Res 21,5600-5603

25 Defining Optimum Reaction Conditions for Hammerhead

Ribozymes

Philip Hendry, Maxine J. McCall, and Trevor J. Lockett 1. Introduction 7.1. Ribozyme Cleavage Hammerhead rtbozymes, m their truns-cleaving form catalyze the cleavage of complementary RNA strands, which contam the UX sequence (where X 1s A, U, or C) Immediately 5’ to the site of cleavage, although not all such sequences are cleaved with the same efficiency (1,2). The reactivtty of the hammerhead rtbozyme 1sassumed to follow the model outlmed in Scheme 1, i.e., ribozyme and substrate anneal, cleavage takes place, and then dissociation of the two products occurs independently. The m vitro study of hammerhead activity allows manipulation of the reaction conditions in order to gain mstght into the detail of the cleavage reaction. The detailed study of a number of ribozyme-substrate systems has essentially defined the response of the standard hammerhead domain to changes m the key parameters that affect the rate of the cleavage step in Scheme 1 (3-7). These are temperature, pH, and metal ton concentration, usually Mg2+. 1.2. Temperature In conditions where the cleavage step is rate-determining, increasing temperature increases the rate constant for cleavage of the ribozymesubstrate complex. The reported activation energies for the cleavage processvary from 50-80 kJ/mol (4,7,8). A typical value of 60 kJ/mol corresponds to a doubling of the cleavage rate constant for every 10°C increase in temperature (at biologically relevant temperatures). The bmdmg of the ribozyme to the substrate is dependent on the hybridization of complementary strands of nucleic acid. This process is also From

Methods Edlted by


B/ology, Humana

231


Inc , Totowa,

Protocols NJ


232

R+

S +

kl

b

RS W

k-1

k-2

Scheme 1. Basic schemefor the reaction of hammerheadrrbozymes

highly temperature-dependent, wtth hybridization disfavored at high temperatures. Finally, the release of cleavage products from the ribozyme under substrate excessconditions can be rate-determinmg tf the temperature 1stoo low.

1.3. pH Cleavage takes place at the 3’-side of the UX sequence m the substrate. The immediate cleavage products of the hammerhead ribozyme terminate m a S-hydroxyl and a 2’,3’-cyclic phosphate (9). The cleavage reaction is assumed to proceed in a single step, since the configuratton at the phosphorus center is inverted in the process (20,l I). These observations imply that the nucleophile in the reaction is the 2’-hydroxyl of Ci7. It is generally accepted that in order for the reaction to proceed at a reasonable rate, the 2’-hydroxyl must be deprotonated. The p& of 2’-hydroxyl groups m RNA is about 11.4 (12). The pK, of the 2’-hydroxyl in the hammerhead will be reduced by coordination to the Mg 2+, but never the less, will be substantially greater than the pH of the normal reaction conditions, pH 6.0-8.0. Therefore, only a very small proportion of the 2’-hydroxyl groups will be deprotonated at any given time at neutral pH. The rate of the cleavage reaction will therefore be dependent on the pH of the reaction, theoretically an increase m rate constant of lo-fold for each pH unit, or a slope of 1.O on a log kobsvs pH plot (see Note 1). 1.4. Magnesium /on Concentration The effect of metal tons on the reactivity of the hammerhead rtbozyme has been extensively studied (36). The ribozyme requires the presence of drvalent metal ions for the reaction to occur, and appears to have a reasonable affmty for them, with apparent dissoctation constants for the presumed natural cofactor, Mg2+, on the order of 10 mM. Other metal ions, including Mn2+, Co2+, Zn2+, Ca2+,Cd2+, and a few others (.5,13), are able to support cleavage by the rtbozyme, although some require the addition of 0.5 Wspermine presumably to promote the formation of the active structure (see Note 2).

2. Materials 1 10 N Ribozyme. 2 10 pA432P-labeledsubstrate.

Reaction Conditions 3, Stock buffers (autoclaved). 500 mMTris-HCl at pH 8 0, pH 7 5, and pH 7 0,500 mA4 Mes, pH 6 5 4 100 n&I MgC& (autoclaved) 5. Stop/loadmg solutton. 90% formamide, 20 rmI4 EDTA, and gel tracking dyes, made by mrxmg 9.0 mL of formamrde (deromzed), 0.4 mL of EDTA (500 m&I), 0.3 mL of xylene cyan01 FF I%, and 0.3 mL of bromophenol blue 1% 6 40% Acrylamtde/brs-acrylamtde (19.1) stock solution. 7 Urea. 8 10X TBE buffer. 890 mMTns-borate, pH 8.3,40 mM EDTA. 9. Apparatus for runnmg polyacrylamide gels. 10 Phosphonmagmg system (e.g., Molecular Dynamics [Sunnyvale, CA], FUJI [Tokyo, Japan], and so forth) or scmtrllatton counter.

3. Methods 3.1. Temperature

Dependence

1, Determine the temperature dependence of the ribozyme cleavage reaction under study, usmg the rrbozyme excess method descrrbed m Chapter 24 Using this procedure, the ribozyme and substrate are preannealed at the reaction temperature, and the reaction IS mutated by the addition of MgCl, Under these condrtions, it is Important that the rrbozyme and substrate concentrattons are such that complex formatton is complete. Having the ribozyme and substrate preannealed, any ambigutttes relating to the formatton of the complex between the ribozyme and substrate are avoided, and because the ribozyme is in excess of the substrate, each ribozyme cleaves a maximum of a single substrate Therefore, product drssoctatron does not contribute to the observed cleavage rates, avoiding another potential source of confusron. The procedure IS very simple, and full details are given in Chapter 24 (see Notes 3 and 4) 2. Analyze the data according to the Arrhemus equation Log k = (E,/2 303*RT) + log A

(1)

3 Plot log k vs l/T (in “K), and estrmate the acttvatlon energy (E,) for the reaction, from the slope of the line (see Fig. 1). The constant A in this equation is known as the pre-exponential or frequency factor, and is not important for the purposes of this experiment.

3.1.1. interpretation At low temperatures, the observed rate constants increase with temperature. Eventually, as the temperature is increased further, the rate constant will plateau and then decline. The temperature at which the maximum rate is observed varies from ribozyme to ribozyme, and the subsequent decline can be attributed to a number of different causes.One primary cause may be the melting of the duplex between the ribozyme and substrate, i.e., the complex between the ribozyme and substrate is not fully formed at those temperatures. If this is the

234

Hendry, McCall, and Lockett Temperature 45

-21

0 0031

37

.

I

0 0032

(OC)

30

I

0.0033

20

.

I

0.0034

1 /Temperature

5

.

I

00035

*

0.

D36

(OK)

Fig. 1. Arrhenms plot for the temperature dependence of a number of ribozyme and substrate pairs The reactions were carrted out with ribozyme m excess of substrate at pH 6.45 and 10 mM MgCl*. The data are taken from ref (8). The substrates are 13-mers, and the data points 0 and n are for ribozymes with RNA-hybridizmg arms. The data A are for the rtbozymes analogous to 0, but with DNA in the hybridizmg arms, showmg the expected reduction m affinity

case, you would expect the temperature optimum to be concentratton-dependent, Alternatively, the decline in cleavage rate constant at htgh temperature may be owmg to the structure of the catalytrc domam of the hammerhead being disrupted above a certain temperature This effect would be independent of rrbozyme and substrate concentratron. For certain hammerhead derivatives contaming deletions rn helix II, which destabilize the core nucleotides, we have observed quite low temperature optima, which orrgmate n-r the mstabllrty of the conserved domain (ZS).

3.2. pH Dependence 1. Measure the pH dependence of the hammerhead cleavage reaction under condttions of ribozyme excess where the potentially complicatmg steps of substrate association and product drssoctation are not involved. Using these conditions, the ribozyme and substrate are preannealed m the absence of Mg2+, and the reaction mmated by addition of Mg2+ in the manner described m Chapter 24 2 Extract the observed rate constants from the data by performing a pH vs log kobsPlot

235

React/on CondGions loO l-

s=

##

A

4

*-‘C

.5

01

2

A

9 0.01

Fig. 2. pH Dependence of a number of rlbozymes and modified nbozymes, with the rlbozyme m excess of the substrate, at 37°C and 10 m&J MgC$. Data are taken from refs 8 and I4 The data l are for a modified rlbozyme lackmg hehx II, which results m significant loss of activity under these conditions. 3. Measure the pH dependence of the complete cleavage cycle with substrate m excess This can be achieved m a number of ways k,,, and Km can be determined at each pH Alternatively, the substrate concentration can be fixed at a saturating level and the maximum rate determined at each pH. This latter option is simplest, since it requires only a single reaction to determine the rate of cleavage Aslde from the cleavage step, the other steps m the rlbozyme cycle as shown in Scheme 1 involve either hybndlzatlon or dlssoclatlon of complementary RNA strands The rate constants for these processes are not expected to vary significantly in the range of pHs typically used m hammerhead cleavage reactions, 1 e , 6 O-8 0, because there are no slgmficant changes in protonation state of nucleic acids m this range

3.2.1. interpretation Figure 2 shows the pH dependence of a number of ribozymes and modified ribozymes determined under condttions of rtbozyme excess. At low pHs, the rate constants for cleavage by all these ribozymes are linearly dependent on hydroxtde ion concentration. This is the behavior expected if the cleavage 1s dependent on the deprotonation of a single functional group and the p& of that group 1s significantly greater than the pH values investigated. The identity of the group responsible for the kmetlc pK, has not been established, but the group that is ultimately required to be deprotonated 1s the 2’-hydroxyl of the nucleotide X at the site of cleavage (X,,). If the cleavage step 1sthe rate-determmmg step, a plot of log kobs vs pH should yield a straight line with a slope of 1, as observed at low pH.


236

As the pH is increased, some of the cleavage rate constants deviate from the straight line, and plateau or decline with increases m pH. There may be a number of explanations for this; the rate may become too fast to measure reliably (this is a particular problem for experiments where the ribozyme is m excess, since at high pH, the reactions may have half-lives as short as a few seconds). Another possibility is that as the chemical cleavage step increases in rate, some other step in the process (for example, product dlssoclatlon) becomes ratehmltmg (this would particularly apply to experiments that are conducted wtth substrate in excess). At high pH, there may be a deprotonation of the bases m the hybridizing arms, which decreases the avidity of the interaction with the substrate (12). Alternatively, base deprotonation may be occurring within the catalytic domain and either disrupting the structure or interfering with the chemistry of the process. The highest pH reported at which there was still a linear relationship between log kobsand pH is about 9.3 (see Fig. 2) (15). This was obtamed for a modified rlbozyme lacking helix II. This suggeststhat the kinetic p& is at least about 10, and suggests that deviations from linearity at lower pH occasionally observed are owing to factors other than complete deprotonatlon of the 2’-hydroxyl on nucleotlde X17. 3.3. Magnesium

Ion Dependence

1. Measure the dependence of the cleavage rate constants on metal Ion concentration using either ribozyme or substrate excess conditions as described in Chapter 24 (see Note 5)

2 Because most observations on the MgC12 dependence of the hammerhead cleavage reactlon to date have found that the data can be fit to a simple equlhbrmm between the rlbozyme and metal ion, plot kobs vs [MgCl,] which can be analyzed

according to the equation* ‘kbs

= hmx

+

CWiWKwg Msl)

(2)

3.3.1. Interpretation Figure 3 shows a typical set of data, fitted to such an equation. Although there is a single equlllbrmm constant to describe the Interaction, this says nothing about the number of metal ions Involved m the active complex, We (81 and others (13,16) have observed that at least for some rlbozymes there is a different dependence on magnesium ion concentration. In those cases, the cleavage rate constants continued to increase with increasing magnesium ion concentration,

showing no sign of reaching

a plateau even up to 1.0 M

MgC12 in one case (13, Id). For the most part, reported analyses of MgC12 dependence of rlbozyme activity have been conducted without regard for the effect of ionic strength on the system. This will almost certainly have an effect on the result. Ideally the

Reaction Conditions

0

237

10

20

30

40

50

[M&t21 (mM) Fig. 3. Mg2+ concentration dependence for a typical ribozyme Data are taken from ref. 6, Fig. 3, pH 8 9. The lme IS calculated for a simple interaction with an apparent dlssoclation constant of 5.0 n-144and a maximum reaction rate of 5 5 min-I.

ionic strength of the medium should be kept constant by adjustment with a noninteracting salt, such as sodium chloride. The ionic strength (cl) of a solution is given by the equation, u = 1/2C,(C, Z,*), where C, is the concentration of each ion m solution, and Z, is the charge on that ton. As an example, the ionic strength of a 100 mM solution of NaCl is 100 mM, but a 100 mM solution of MgC12 has an ionic strength of 300 mA4. 3.4. Choosing the Opfhum Conditions There are many factors that should be considered when choosing conditions for a series of experiments. One is the purpose of the experiments: What are you trying to show? If the study is simply of the m vitro cleavage activity of a piece of RNA you might choose, for example, conditions under which the substrate is cleaved very rapidly, e.g., 45°C 100 mMMgC12, and pH 9.0. On the other hand, rf the study is a prelude to in vlvo work m which a particular ribozyme will be expected to work in a mammalian cell, you might want to choose conditions more closely resembling that, e.g., 37°C pH 7.0, and 1 mMMgC1, (see Note 6). It should be noted that there is not a standard set of conditions and most workers m this field have then own favored condrtions. Although these latter conditions are supposedly more “biological,” the m vitro conditions are actually very different from the environment encountered in the cell. The ribozyme may find itself in a highly compartmentalized soup of proteins and nucleic acid, some of which will interact with the ribozyme or substrate (14,17,18), and it may be advantageous to attempt to carry out the kinetic characterizatton of the ribozyme m the presence of a cellular or nuclear extract from relevant cells.


238 4.

Notes

1 Because rtbozymes and substrates are RNA, they are susceptible to hydrolysis under alkaline condttions Caution should be exercised above pH 9 0, especially at elevated temperatures or with prolonged exposure 2. Different metal ions acttvate the hammerhead to different extents In general, Mn2+ is the most effective at promoting the cleavage reaction Caution needs to be used when using high concentrations (>5 mM) of Mn2+ ions because of then tendency to cause precipitation of the RNA 3 Particular attention should be paid to the buffer medium during the mvestigation of the temperature effects of rtbozymes. All buffered solutions vary m pH with changes m temperature. If the temperature is varied over a wide range, the pH can vary significantly. The cleavage by ribozymes is generally highly dependent on pH. Therefore, unless care IS taken, a change in cleavage rate observed can be mistakenly ascribed to the temperature change when it may be owing to the pH change. Tris buffers are particularly affected m this way (19) The change m pH is approx -0.03 1 pH U/“C. Although this appears quite small, it must be remembered that if the pH was measured at 25°C and the reaction performed at 45°C the pH would be 0 62 U less than measured, potentially reducing the observed reaction rate by more than fourfold. 4 These reactions are typically carried out m very small volumes, 2&30 p.L. If the reactions are rapid, very significant errors can be introduced because of the temperature changes associated with ptpetmg small volumes If possible keep the reactions rates to manageable magnitude by choosmg a suitable pH for the reactions and if possible, equiltbratmg the pipets and tips at the reaction temperature 5 When measuring the metal ion dependence, it is important to remember that you may need different stop solutions than the standard ones The stop solutton should contam an excess of EDTA over the amount of MgCl, in the reaction 6 The total concentration of Mg2’ ions intracellularly is approx 10 mM, but the free Mg2+ is on the order of 0.5-i .5 mM m a number of different tissues m rat (20)

References 1 Perrtman, R., Delves, A., and Gerlach, W. L. (1992) Extended target-site specificity for a hammerhead ribozyme Gene 113, 157-163 2 Shimayama, T , Nishtkawa, S., and Taira, K (1995) Generality of the NUX rule kmettc analysis of the results of systematic mutattons m the trmucleottde at the cleavage site of hammerhead rtbozymes Blochemlstry 34,3649-3654 3. Perreault, J -P., Labuda, D., Usman, N , Yang, J.-H , and Cedergren, R. (1991) Relationship between 2’- hydroxyls and magnesium bindmg in the hammerhead RNA domain: a model for rtbozyme catalysis. Bzochemzstry 30,4020-4025. 4. Uhlenbeck, 0. C (1987) A small catalytic ohgoribonucleotide Nature 328, 596-600.

5 Dahm, S. C and Uhlenbeck, 0 C (199 1) Role of divalent metal tons m the hammerhead RNA cleavage reaction Btochemutry 30,9464-9469

Reactmn Conditions

239

6 Dahm, S C , Derrick, W. B , and Uhlenbeck, 0. C (1993) Evidence for the role of solvated metal hydroxtde m the hammerhead cleavage mechanism. Blochemrstry 32, 13,040-13,045 7 Takagi, Y and Taua, K (1995) Temperature-dependent change m the rate-determining step in a reaction catalyzed by a hammerhead ribozyme FEBSLett 361, 273-276

8 Hendry, P. and McCall, M J (1995) A comparison of the in vztro activity of DNA-armed and all-RNA hammerhead nbozymes. Nuclezc AczdsRex 23,3928-3936. 9 Buzayan, J M , Gerlach, W L , and Bruenmg, G (1986) Non-enzymic cleavage and ligation of RNAs complementary to a plant virus satelhte RNA Nature 323, 349-353 10 van Tol, H , Buzayan, J M , Feldstein, P A , Eckstem, F , and Bruenmg, G (1990) Two autolytic processmg reacttons of a satellite RNA proceed with inversion of configuratton Nucleic Aclds Res 18, 1971-1975. 11. Slim, G. and Gait, M J. (1991) Configurationally defined phosphorotioate-containmg ohgoribonucleotides in the study of the mechanism of cleavage of hammerhead rtbozymes Nuclezc Aczds Res 19, 1183-l 188. 12 Saenger, W (1984) Prmclples of Nuclezc Aczd Structure Sprmger-Verlag, New York, p. 108. 13. Sawata, S , Shimayama, T , Komtyama, M., Kumar, P. K., Ntshikawa, S , and Taira, K. (1993) Enhancement of the cleavage rates of DNA-armed hammerhead ribozymes by various divalent metal ions. Nucleic Aczds Res 21,5656-60. 14 Sioud, M (1994) Interaction between tumour necrosis factor alpha ribozyme and cellular protems-mvolvement m ribozyme stability and activity. J MoZ Bzol 242,619-629

15. Hendry, P , McCall, M J Santtago, F S , and Jennings, P. A (1995) The zn vztro activity of mmtmised hammerhead ribozymes Nucleic Aczds Res. 23,3922-3927 16 Shimayama, T , Ntshikawa, S , and Taira, K (1995) Extraordmary enhancement of the cleavage activity of a DNA-armed hammerhead ribozyme at elevated concentrations of Mg2+ ions. FEBS Lett 368, 304-306. 17. Tsuchrhasht, Z., Khosla, M , and Herschlag, D. (1993) Protein enhancement of hammerhead rrbozyme catalysis Sczence 262,99--l 02 18. Bertrand, E. L. and Rosst, J. J. (1994) Facthtatton of hammerhead ribozyme catalysis by the nucleocapsid protem of HIV-l and the heterogeneous nuclear rtbonucleoprotem A 1 EMBO J 13,2904-29 12 19 Good, N. E., Wmget, G. D., Winter, W., Connolly, T N., Izawa, S , and Singh, R. M. M (1966) Hydrogen ion buffers for biological research Bzochemzstry 5,467-477 20. Veloso, D , Guynn, R W , Oskarsson, M , and Veech, R L. (1973) The concentrations of free and bound magnesium m rat tissues. J Biol Chem 248,48 1 l-48 19

Using Fluorescence Resonance Energy Transfer to Investigate Hammerhead Ribozyme Kinetics Thomas A. Perkins and John Goodchild 1. Introduction

Small catalytic RNA motifs, such asthe hammerhead or hanpm rrbozyme, have been used to design artificial nucleases that can cleave a selected target RNA sequence(Z-3). This was first demonstrated by Uhlenbeck in which the catalytic core of a hammerhead motif was combined with antrsenseflanking sequencesin a trans-acting rrbozyme (I). The mechanism of action of such rrbozymes may have as many as 12 steps or more (see Fig. 1) (4). The catalytic turnover of these ribozymes 1soften hmited not by the chemical cleavage of the target RNA, but by either substrateassociation or product dissociation. Knowledge of the factors that contrtbute to the rates of associationand dissociation of the substrateor product is important m destgmng more catalytrcally active hammerheadnbozymes.Although the kinetic parameters that are significant in the cleavage of a target RNA by a trans-acting hammerhead ribozyme have been determined using conventtonal electrophoretrc techmques(5), obtaining these parameters in real time and m solution may be accomplished using fluorescence resonance energy transfer (FRET). FRET 1sa photophysical phenomenon in which the electronic excited state of a donor chromophore may transfer its excited state energy nonradratrvely to an acceptor molecule. Depending on the identity of the donor and the acceptor, this transfer of energy may occur by two mechanisms: overlap of donor and acceptor electron orbitals (Dexter mechanism) (6) or a Coulombtc mteractton between the excited state donor and the ground state acceptor (Forster mechanism) (7). This protocol deals exclusrvely with energy transfer occurrmg by a Fdrster mechanism. The efficiency of energy transfer occurring by this mechanism IS dependent on the distance between the donor and acceptor (7): E = [l/l From

Methods

m Molecular

Edtted by P C Turner

+ (ZU&J6]

Bology,

Humana

241

Vol

(1)

74 Rfbozyme

Protocols

Press Inc , Totowa,

NJ

Perkins and Goodchild

242

R+S

4=

k3 R

.‘L

“I

k,

k,

RoS

--+

p5’.R.p3’

k-3

k-5

k6 fl

k-1 p5’

+

R.P3’

P5’ + R + P3’

k-6

Fig. 1. Mechamsm of RNA substrate cleavage by a trans-actmg rtbozyme (4).

-

Fig. 2. Using FRET to monitor hybrtdizatton of donor and acceptor-labeled complementary ohgonucleotrdes D = donor, A = acceptor, EnT = energy transfer.

where E = energy transfer efficiency, R = the distance between donor and acceptor, and RO= the critical distance in which the rate of energy transfer between the donor and acceptor IS equal to the sum of the rates of all other

processes that deplete the excited state of the donor. FRET is used increasmgly as a tool for studying nucleic actd hybridization Q-13). In this technique, the 3’-terminus of an oligonucleotide is labeled with a donor (or acceptor), and its complement is labeled on the 5’-end with an acceptor (or donor) (Fig. 2). Labelmg

the nucleic acids in this fashion permits

momtormg of the hybridization process m solution For a totally dissociated complementary pair, energy transfer will be poor or nonexistent. Energy transfer effctency increases when the ohgonucleotides hybridize and the distance between the donor/acceptor pair decreases.Thus, the change m energy transfer efficiency with time may be used to study the kinetics of hybridization. This technique can been extended to determine the kinetics of hybridization of RNA substratesor products to trans-actmg hammerhead ribozymes using appro-

Fluorescence Resonance Energy Transfer

243

pnately labeled oligonucleotldes. For this protocol, we chose fluorescein, an energy transfer donor, and tetramethylrhodamine, an energy transfer acceptor, as the donor/ acceptor pair. These dyes have been well characterized spectroscopically and are commercially available in reactive derivatized forms suitable for labeling nucleic acids with ammo-modified termini. The labeling protocol, data collection, and fitting are described here. The prmcipal advantages of this technique are* 1. The use of nonradioactively labeled materials, 2 Sensltlvlty afforded by fluorescence instrumentation, and 3 Determmatlon of kinetics m real time and in solution A potential disadvantage to the method, however, 1s that fluorescent dyes may interact with the duplex and change the rates of hybridization. If relative rates of hybrldizatlon between two similarly labeled duplexes are being compared, this may not be important

2. Materials 2. I. Fluorescent

Labeling

1. 0 4 MNaHC03/Na2C03* titrate a 0.4 M NaHCO, solution with 1 MNaOH the pH = 9 0 2 N,N-Dlmethylformamide 3 Sterile distilled HZ0 4 N-Hydroxysuccnnmlde ester of 5- (and 6-) carboxytetramethylrhodamme 5- (and 6-) carboxyfluorescem 5 N-Butanol 6 2 0 MNaCI. 7 Absolute ethanol 8. Sequagel@ concentrate, buffer, and dlluent, or equivalent. 9 TBE buffer: 0.1 MTris-borate, pH 8.3, 1 mA4EDTA. 10. 0.5 M Ammomum acetate. 11. Centrex MF-5 centrifugal filters

2.2. Collection

until

or

of Kinetic Data by Fluorescence

1. PTI AlphaScan II fluorescence spectrophotometer equipped with a 75-W highpressure xenon lamp, magnetic stir motor, and temperature-controlled cell block. 2. 1 x 1 cm fluorescence cuvet equipped with a cuvet magnetic stir bar 3. 100 mM Tns-HCl, pH 7 4 4 25MMgC1, 5 Sterile dlstllled water

3. Methods 3.1. Fluorescent

Labeling

The method that 1s used for labelmg the RNA substrates, cleavage products, and the hammerhead ribozyme are described below (see Note 1). The sub-

244


strates, products, and rrbozymes are chemrcally synthesized using standard automated phosphoramidite chemistry. The substrate is rendered noncleavable by mtroducmg a deoxybase at the cleavage site. Terrmnal ammo linkers are used for fluorescent labeling, and several are commercially available. Typttally, a 3’-amino-modifier support (Glen Research [Sterlmg, VA], 3’-AmmoModifier C7 CPG, cat. no. 20-2957-01) is used for synthesrzmg substrates and cleavage products, whtle the final couplmg at the 5’-terminus of the hammerhead ribozyme uses a CS-amino-modified deoxythymrdine phosphoramtdtte (Glen Research, Ammo-Modtfier C2 dT, cat. no. 10-1037-02). 1 Dtssolve 28 nmol of the 5’- or 3’-ammo-modttied ohgonucleottde m 180 pL of sterile water in a screw-cap 1 5 mL microfuge tube 2 Add a mixture of 180 pL of 0 4 M NaHC0JNa2C03, pH 9.0. NJ-dtmethylformamide:water (3:2-l), vortex, and centrifuge briefly m a mtcrocentrtfuge 3 Add 1 5 mg of the fluorescent dye, vortex, and centrifuge briefly m a microcentrtfuge 4 Wrap the tube m aluminum foil to shield from light 5 Gently shake the mixture on a rotating mixer for 15 h at room temperature 6. Centrifuge the mixture briefly in a mrcrocentrifuge, and then transfer the solution to a 15 mL centrifuge tube 7 Rinse the microfuge tube wtth water, and add the rinses to the reaction mixture 8. Dilute the mixture to 6 mL with sterile water 9 Extract the mixture with n-butanol to a volume of 500 pL A large portion of the unreacted dye 1sextracted mto the orgamc butanol phase, whtch should be discarded 10. Transfer the concentrated aqueous phase to a 1.5 mL mtcrofuge tube, and continue extracting with n-butanol to a final volume of approx 100 pL 11 Add 35 p.L of water, 15 pL of 2.0 MNaCl, 450 pL of absolute ethanol, and vortex. 12 Chill the mixture on ice for 30 min, and then centrifuge the mixture at > 10,OOOg for 20 mm in a mrcrocentrifuge at room temperature 13 Discard the supernatant 14 Rinse the pellet with 450 pL of absolute ethanol, centrifuge briefly, and discard the supernatant. 15 Dissolve the pellet in 150 pL of water, and add 150 pL of 95% formamide, 10 mM EDTA, pH 8.0, and 0 1% Orange G tracking dye. 16 Warm the sample to 92°C for 3 mm, and then purify by denaturmg PAGE using Sequagel concentrate, buffer, and dtluent to prepare the gel. 17 Excuse the fluorescent band from the gel, and transfer to a 15 mL centrifuge tube 18. Crush and soak the band m 0.5 Mammomum acetate overnight. 19 Filter the ammomum acetate and gel mixture usmg a Centrex centrifugal filter, and transfer the filtrate to a 15 mL centrifuge tube 20 Extract the filtrate with n-butanol to a final volume of 100 pL, transfer the concentrated aqueous phase to a 1.5 mL microfuge tube, and discard the butanol phase 21 Add 35 pL of water, 15 pL of 2.0 A4NaCl, and 450 pL of absolute ethanol 33 Incubate at -20°C for 17 h, and then centrifuge at >lO,OOOg for 30 mm LA

Fluorescence

Resonance Energy Transfer

245

23 Discard the supernatant, and dry the peliet zn vucuo for 15 mm. 24 Resuspend the pellet m 100 clr, of sterile water

The degree of fluorescent labeling can be approximated from the UV-visible absorbance spectrum of the dye-labeled oligonucleotide. For a singly labeled ohgonucleotide, the followmg relationship should be observed for fluorescein-labeled oligonucleotides:

(A26dfbd = (%dE492)

(2)

and for rhodamme-labeled ohgonucleotides. (3) where A = the measured absorbance of the dye-labeled ohgonucleotide at the specified wavelength (see Note 2), &26o= the calculated extinction coefficient for the nucleic acid m question at 260 nm (see Note 3), a4g2= the extinction coefficient for the NHS ester of 5- (and 6-) carboxyfluorescein at 492 nm m pH 9.0 aqueous buffer (see Note 3), and a550= the extinction coefficient for the NHS ester of 5 (and 6-) carboxytetramethylrhodamme m pH 9.0 aqueous buffer (see Note 3). @2601A550)

= (&260&50)

3.2. Collection of Kinetic Data by Fluorescence A method for monitormg the kmencsof nbozyme:substrateor nbozymecleavage product hybridization by fluorescence is described here (see Note 4). In brief, the fluorescence of the fluorescein-labeled substrate or product is monitored as a function of time before and after addition of the rhodamine-labeled ribozyme. Conversely, the fluorescence of a fluorescein-labeled ribozyme may be momtored after adding a rhodamine-labeled substrate or product. The key here is that fluorescem emission is monitored, not rhodamme emission. In prmciple, it should be possible to monitor an increase in rhodamme emission, but rhodamine emission is complicated by emission owing to direct excitation of the rhodamme chromophore. 1. Prepare a 40 mI4 solution of the fluorescein-labeled noncleavable substrate or product by dissolvmg a 12 $ aliquot of a 10 u.U stock m 1500 pL of 100 mM Trrs-HCl, pH 7.4, m a quartz fluorrmeter cuvet equipped with a magnetic stir bar 2 Add 24 0 uL of 2 5 MMgC12 and 1462 pL of sterile water 3 Place the cuvet in the cell block of the fluorescence spectrophotometer, and equrhbrate the sample at 37°C with rapid strrrmg for 15 mm. 4. Set the excitation wavelength of the spectrophotometer to 472 nm and the emission wavelength to 520 nm. 5 The data-collectron mode should be set so that emission counts are collected as a

function of time. For aPTI AlphaScanII, the instrumentis setup sothat emission counts will be collected at a rate of 2 data points/s for 10 mm

Perkins and GoodchIld

246

Excltatlon Emission Excltatlon volume Cuvette

Fig. 3. Adding an aliquot of a rhodamme-labeled ohgonucleotide to a solution of the fluorescem-labeled complement m a cuvet that is placed m the excitation beam of the fluorescence spectrophotometer Note the posmon of the pipet ttp and the excitation beam.

6 In a darkened room (see Note 5), open the sample compartment, and begin collecting 520 nm emission counts as a function of time. Be sure the solution is stirred rapidly and continuously (see Note 6) 7. After about 20 s, pipet 2.0 uL of a 60 @4 solutton of the rhodamine-labeled ribozyme into the cuvet using an automatic pipeter. Make sure that the prpet tip does not strike the excitation beam (see Fig. 3) 8. Collect the 520 nm emission decay for 10 mm (see Note 7) An example of raw data that have been obtained using this method 1sgiven m Fig. 4A The rrbozyme was a truns-acting ribozyme with 6 bases in the antisense flanking sequences The target was a 26-base RNA with a deoxycytidme at the GUC cleavage site

3.3. Manipulation

and Analysis of Data

The data obtained by the method m Section 3.2. may be fit assuming a twostate model that approaches equtllbrmm: E+S

kl =

E.S

(4)

k-1

where E = ribozyme, S = substrate or product, and E * S = rlbozyme:substrate or ribozyme:product complex The kmetlcs for this system are conveniently described m terms of the rate of change in the extent of reaction x as the system approaches equtlibrmm (I 4). The rate expression for this reaction may be given by: (&/dt) = k,(e-x)(s-x)-k,(e

s +x)

(5)


247

B

0

40

80

120

160

200

0

40

80

120

160

200

80x10’

75

g 5 6

D

70

65

60

0

I ’ I ’ I ’ I

40

80

120

160

tlmdsec

Fig. 4. Edtttng raw fluorescence data for curve fittmg. (A) Raw data. (B) Raw data wrth the emlssron baselme before addrtton of the rhodamme-labeled rlbozyme deleted (C) Resealed data with ttme t = 20 s in C set to time t = 0 s. (D) Final data after normaltzing The fit is represented by a solid line.

where e = concentration of rtbozyme at time t = 0, s = concentration of substrate or product at t = 0, and e . s = rtbozyme/substrate or rtbozyme/product concentration at t = 0. This equation may also be expressed as: (&/dt) = kt(s --x)(rs -a) -k-,x

(6)

where e = rs and e * s = 0. At equilibrium, (dxldt) = 0 and x = x,, the maximal change m system component concentratrons as the reaction approaches equihbrmm. Substituting these expressions into Eq. (6) and solving for kl: kl = kl [(s -xc) (rs -x,)/x,]

(7)


248

After substituting Eq. (7) into Eq. (6), the integrated form (Z2) of Eq. (6) may be given by: x=P(l-Z)-(1

+z)(-q)“2/(2z-2)

(8)

where p = - [(rs2 + x2,)/x,]

(9)

q = 4rs2 - {[(rs2 + xQ2/xe]}2

(10)

Z = exp {kit (-q)1’2 + In [p- (-q)“2/p + (-q)“2])

(11)

1 Using a suitable curve-fitting program or text editor (see Note 8), delete the data representing the emission baseline before addition of the rhodamme-labeled ribozyme (see Fig. 4). In Fig. 4A, this IS the data between t = 0 s and t = 20 s 2 Rescale the data so that the point where the rhodamme-labeled rtbozyme was added is now time t = 0 s. For example, If the nbozyme was added at time t = 20 s after mttiatmg the collectron of 520 nm emrssron counts, then rescale the data by subtracting 20 s from each time-point. 3. Subtract the residual 520 nm emission counts that are observed at 100% hybrrdization from each data point (see Note 9) 4. Divide the data by the time-point with the highest emission counts. This 1s normally the first time-point 5. Multrply by the concentration of the fluorescem-labeled substrate or product. 6 The data can now be fit to Eq (8) Four fittmg parameters are used r, x,, the initial substrate or product concentratron, and the forward rate constant k, (see Note 8). 7 The off rate constant k-r can then be calculated using Eq. (7), above.

4. Notes 1 The protocol that was used for labeling the RNA substrates, cleavage products, and the hammerhead rtbozyme was based on a previously reported procedure (IS) that used Sephadex G-25 to remove unreacted dye from the labeled oligonucleotrde. The present method uses n-butanol extraction and ethanol preciprtatron to remove the excess dye This 1s both cheaper and less prone to nuclease contamination. 2 The absorbance of the dye-labeled ohgonucleotrde should be measured m pH 9 0 buffer, because the visible absorbance of fluorescetn and rhodamme are extremely pH dependent. It should be noted that the absorbance of the ohgonucleotrde 1s also sensitive to the pH of the solutron, but not as sensitive as the dyes. Because of this pH dependence, the expressions for determining extent of labeling are only an approximatron The absorbance at 260 nm of the dye-labeled oligonucleotrde 1s a sum of absorbances owing to the dye and the unlabeled ohgonucleotide. Assummg that the absorbance at 260 nm IS a sum of absorbances of chromophores that are elec-

Fluorescence Table 1 Extinction

Resonance Energy Transfer

Coefficients

of Fluorescent

249

Dyes at pH 9.0

26,500 28,500

5- (and 6-)Carboxy-fluorescein 5- (and 6-)Carboxy-tetramethylrhodamme

78,700b 69,400b

“The form of the dye IS the N-hydroxysuccnumrde (NHS) ester 6The vtsrble extmctron coefficrent for the fluorescem dye was measured at 492 nm, for the rhodamme dye, the extmctlon coeffcrent was measured at 550 nm

tromcally nonintereactmg, the absorbance of the dye at this wavelength should be subtracted from the total absorbance to obtain the absorbance owmg only to the oligonucleotide

A260&y where

A260011go

=A 260,ohgo

* -

(~26O,dye/%s,dye)

= absorbance of the unlabeled

(12)

* Awfye

ollgonucleotide

at 260 nm,

A260,ohgo * = ‘absorbance of dye-labeled ohgonucleotide, &26s,dye= extinction coefficient of the dye at 260 nm, a,,,,dye= extinction coefficient of the dye m the visible range (492 or 550 mn), and&dye = the absorbance of the dye m the visible range. This corrected A260 is substituted into the Eqs. (2) and (3). 3 The extmction coeffictent for the oligonucleotide at 260 nm may be calculated from the base sequence usmg a nearest-neighbor interaction approximatton (16). The measured extinction coefficients for the dyes m 0 1 A4 NaHCOJNa,CO,, pH 9.0, are m Table 1 4. Although the method was written for a PTI AlphaScan II fluorescence spectrophotometer equrpped with a 75 W high-pressure xenon lamp and a temperature-controlled cell block with a magnetic stirrer, any commercially available fluorescence spectrophotometer

interfaced with a computer for continuous data collectton should

be suitable as long as emission counts can be collected as a function of time. 5 There 1s more than one way to introduce the altquot of rtbozyme mto the cuvet while collectmg emtsston counts Some mstruments are configured so that a sample may be added while collecting emission data without opening the sample compartment. The manner that an individual user will add the ahquot will depend on the mstrument. For the PTI AlphaScan II, it 1seasiest to dim the lights m the room, open the sample compartment, start collecting emtsston data, and then add the sample The computer monitor and the spectrophotometer lamp provide adequate lighting to allow you to see. One will need to determine how much stray

light can be detected by the spectrophotometer with the emission monochromator set to 520 nm and then adJust the light level in the room accordmgly

This is

done by collectmg emtsston counts in a completely darkened room with the sample compartment opened. Then, start adJustmg the light level m the room until you can see without causing an increase m the emtsston level

6. Mixing artifacts for the hybrtdizatron are not expected to be important under these conditions (7).

250

Perkins and GoodchIld

7 The PTI AlphaScan II interfaced with a PC-compatible computer collects data and stores them m binary form, which 1s unreadable by a text editor or most curve-fitting programs. Preferably, the data should be stored m ASCII text format The PTI AlphaScan II program can change the binary data into ASCII format, as will most other spectrophotometer programs. 8. A fitting program that is highly recommended for the Macintosh@ computer 1s called Igor (Wavemetncs, Lake Oswego, OR) This package ~111 read raw ASCII data with little or no prior editing of the data into a format readable by the program. To fit the data using this program, a user-defined function must be declared on the Procedure page. A program listing for this function follows Function Equlhbnum(w,t) Wave w;Variable t Variable alpha,beta,q,C,D alpha = w[O]*w[ 1]*2 beta = -1*((alpha+w[2]*2)/w[2]) q = sqrt(-1*(4*alpha-beta*2)) C = ln((beta-q)/(beta+q)) D = exp(w[3]*t*q+C) return(w[ l]-(((D-l)*beta + (D+l)*q)/(2-2*D))) End The two values m parentheses, w and t, after the function name Equillbnum are Igor waves. The variable t contains the time m seconds for each data point. The wave w 1s a user-defined wave that contams the four parameters needed to fit the data These parameters, which are defined above, are r, x,, the initial substrate and product concentrations, and k, These values are referred to m wave w by subscripts m brackets. Thus, r = w[O], mital concentrations = w[l], X, = w[2], and kl = w[3] 9. Before the data are fit, knowledge of the quenching efficiency at 100% hybndlzation must be determined. This value is easily determined by titrating a solution of the fluorescein-labeled substrate or product (or nbozyme) with the rhodammelabeled rlbozyme (or substrate or product) until no change is observed m the fluorescem emission. In some cases, especially when ribozymes with short flanking sequences with a low GC content are used, this may not be practical because a large Kd for the complex would require a prohlbltlvely large amount of the labeled ribozyme or llgand. This problem may be overcome by titrating the fluorescein-labeled oligonucleotide with its rhodamme-labeled complement The duplex that is formed should have a considerably higher Kd. Thus, a much smaller amount of labeled oligonucleotide will be required to titrate to 100% hybndlzatlon.

References 1. Uhlenbeck, 0. C (1987) A small catalytic ollgorlbonucleotlde Nature 328, 596600. 2 Hampel, A. and Tntz, R. (1989) RNA catalytic properties of the mmlmum (-)sTRSV sequence Bzochemzstry 28,49294933.


251

3 Feldstein, P. A , Buzayan, J. M., and Bruenmg, G. (1989) Two sequences participating m the autolytic processmg of satellite tobacco rmgspot vuus complementary RNA Gene 82,53-61 4. Fedor, M. J. and Uhlenbeck, 0. C. (1992) Kinetics of intermolecular cleavage by hammerhead ribozymes Biochemistry 31, 12,042-12,054. 5 Hertel, K. J., Herschlag, D., and Uhlenbeck, 0. C. (1994) A kinetic and thermodynamic framework for the hammerhead ribozyme reaction Blochemrstry 33, 3374-3385. 6 Dexter, D. L. (1953) A theory of sensitized luminescence m solids J Chem Phys 21,836-850

7 Forster, T (1948) Intermolecular energy transference and fluorescence Ann. Phys 2, 55-75. 8 Heller, M. J. and Morrison, L. E (1985) Chemilummescent and fluorescent probes for DNA hybridization systems, in Rapid Detection and IdentiJicatlon of Infectzous Agents (Kingsbury, D. T. and Falkow, S., eds.), Academic, New York, pp. 245-256 9. Cardullo, R A., Agrawal, S., Flores, C., Zamecmk, P C , and Wolf, D E. (1988) Detection of nucleic acid hybridization by nonradiative fluorescence resonance energy transfer. Proc Nat1 Acad Scz USA 85,8790-8794 10 Morrison, L E and Stols, L M (1993) Sensitive fluorescence-based thermodynamic and kmetic measurements of DNA hybridization m solution Bzochemzstry 32,3095-3 104. 11 Perkins, T. A., Goodman, J L., and Kool, E. T. (1993) Accelerated displacement of duplex DNA by a synthetic circular ohgodeoxynucleotide J Chem Sot Chem Commun 215-216 12 Yang, M., Soumitra, S G , and Millar, D P (1994) Direct measurement of thermodynamic and kinetic parameters of DNA triple helix formation by fluorescence spectroscopy. Biochemistry 33, 15,329-15,337. 13. Parkhurst, K. M. and Parkhurst, L. J. (1995) Kinetic studies by fluorescence resonance energy transfer employing a double-labeled ohgonucleotide: hybrrdization to the oligonucleotide complement and to a single-stranded DNA. Biochemzstry 34,285-292. 14 Moore, J. W. and Pearson, R. G. (1981) Complex Reactions, m Kznetzcs and Mechanism John Wiley, New York, pp. 304-307. 15. Sinha, N D. and Striepeke, S. (1991) Oligonucleotides with reporter groups attached to the 5’-terminus, m Ollgonucleotldes and Analogues A Practical Approach (Eckstem, F., ed.), Oxford University Press, New York, pp 200,201. 16 Borer, P. N (1975) Optical properties of nucleic acids, absorption, and circular dichroism spectra, m Handbook of Bzochemzstry and Molecular Bzology (Fasman, G. D , ed), CRC, Cleveland, OH, p. 589.

27 Design of Hybridizing Arms in Hammerhead Ribozymes Philip Hendry, Maxine J. McCall, and Trevor

J. Lockett

1. Introduction Hammerhead ribozymes as typically used in their trans-cleaving form are defined by their hybridizing arms, the remainder of the molecule being essentially constant. A major determinant of the nature of the hybridizing arms is then sequence, which is m turn determined by the sequence of the RNA at the cleavage site that is targeted. Therefore, the first step in designing hybridizing arms is to choose a target site. There are a number of methods that have been used. We will outline the techniques used without going mto detail, because at least some of the techniques are the subject of other chapters in this book. 7.7. Target Sites A common technique for selectmg “accessible” target sites 1s the use of RNA foldmg programs (see Chapters 2 and 3). The predicted secondary structure of the target RNA is examined, and potential cleavage sites that are not located m stable hehces are chosen (1). In our experience, this method 1srather unreliable and should be used with caution, and preferably only as an adjunct to other techniques. Another method that can be used 1soligo screening (see Chapter 5), where DNA oligonucleotides either complementary to the target RNA or short random sequences are allowed to hybridize to the target, which is then treated with RNase H, which cleaves the RNA at sites where DNA is hybridized (2,3). A third technique (see Chapter 6) used to select potential target sites utilizes ribozymes with random hybridizing arms and identifies cleavage sites in the target RNA by RACE/PCR (4). This method has the advantage of being able to be applied to total cellular RNA isolated from the target cells. A fourth strategy is based on the notion that ribozyme-accessible smgleFrom


Bfology, Vol 74 Ribozyme Protocols Humana Press Inc , Totowa, NJ

253

Hendry, McCall, and Lockett stranded regions of a parttcular RNA will be partrcularly susceptible to nuclease digestion and can thus be Identified by nuclease treatment of radioactively labeled transcribed RNA. Finally, there ts the “educated guess,” where target sites surroundmg particular regions, such as the AUG mttiation codon, splice Junctions, and the polyadenylation signal, are targeted on the assumption that these regions must be relatively accessible to regulatory factors and are therefore likely also to be accessible to rrbozymes at least at certam stages of the life-time of the message. Whatever the method of selection of the rtbozyme target site, once the site 1s chosen, there remain a number of variables to consrder. These are addressed rn the followmg sectton. 1.2. In Vitro Design This section summarizes the factors that one would constder when designmg hybridizing arms for hammerhead rtbozymes to be used m the cleavage of RNA substrates tn vitro. 1. Does the proposed hammerhead self-hybrtdtze? This may occur tf etther of the arms has a srgmficant degree of complementartty to the other or to other regtons of the ribozyme This problem is really self-evident If the rtbozyme binds strongly to itself rt will have difficulty in binding to the substrate. 2 How stable is the proposed duplex with the substrate7 There are a number of reasons to consider the stabihty of the duplex. The complex between rlbozyme and substrate needs to be stable under the conditions of the expertment, and tf turnover is a consideration, the cleavage products should dissociate raptdly 3 A factor related to duplex stability is the question of substrate dissociatton rate What is the substrate dtssoctation rate compared with the cleavage rate? Herschlag (s) has pointed out that for optimum selectivtty (cleavage of correct substrate vs mismatched substrate), the rate constant for substrate dtssoctation should be much greater than the rate constant for the cleavage. This will allow the perfectly matched substrate to bmd and cleave preferentially, but tf cleavage is much faster than dissoctatton, even mismatched substrates will undergo cleavage. 4 Should the hybridizing arms be symmetrtc (same length) or asymmetric7 Which arm should be longer? What 1sthe minimum arm length? These are questions that are currently only able to be answered for in vitro condtttons Symmetric ribozymes have the advantage that the two cleavage products have stmtlar lengths of hybridized regions and should have comparable dtssociatron rates, thereby maximizing the rate of product dissoctation and therefore turnover for any gtven number of hybridizing bases in the substrate. There is, however, some evtdence that m vitro cleavage of short RNA substrates by hammerhead ribozymes proceeds most effctently if helix I is about five or SIX nucleottdes in length (vzde znfra) 5 For the most part, ribozymes are made by transcrtptton either m vitro or wtthm the target cells and are therefore composed exclustvely of RNA. However,

l-lybndizing Arms

255

ribozymes that are synthesized chemically are able to be extensively modified, and the chemical composition of the hybrtdizmg arms can be varied, for example, by mcorporation of DNA Because DNA-RNA hybrids are generally less stable than RNA-RNA duplexes, mcorporation of DNA mto the hybrtdizmg arms can assist in the design of ribozymes (6-9) For example, if a certain length of hybridizing arm IS required, but the resultmg ribozyme folds mto a stable inactive conformation, substitution of the hybridizing arms with DNA ~111 destabilize that structure and consequently allow an increase m the rates of formation of the rtbozyme-substrate complex. DNA-hybridizing arms also have the effect of increasing the rate constants for product dissociation followmg cleavage (9)

1.3. In Vivo Design It 1sprobably too soon to be confident about the optimum design for hammerhead rlbozymes for m vlvo use. However, by making some assumptions about the intracellular environment as experienced by an RNA molecule, we may be able to project some of the m vitro experience onto the m vivo situation. 1 The stability of the ribozyme m viva IS a particularly important design criterion Unprotected RNA would typtcally have a life-time on the order of a few seconds m human serum for example. 2 The problem of self-association of ribozymes and the assoctated question of how the rtbozyme binds to the substrate in VIVO may not be as big a problem as expected by simple extrapolation from m vitro experiments There are many steps mvolved m nucleic acid metabolism that are mediated by sequence-specific hybridization It stands to reason therefore that there would be factors, at least m the nucleus, that would assist m the correct hybridization of complementary nucleic acid sequences. A number of protein factors have been described that m vitro are able to enhance cleavage rates and/or stabilize the hammerhead ribozyme (10-14). As a consequence of this, effective substrate binding m viva and product dissociation may be possible even for relatively long-armed nbozymes, which do not turnover m vitro 3 The cleavage of long RNAs is generally several orders of magnitude slower than short substrates by the same ribozyme (15,16). It 1s likely that the rate of cleavage of long substrates is governed by the rate of formation of the active complex In vivo thts is also likely to be true, not withstanding the effects of enhancement by proteins Therefore, for cleavage of long substrates, it may be advantageous for the cleavage rate and dissociation rate to be at least comparable. If the cleavage efficiency in vwo IS determined by the rate at which the ribozyme and target RNA are able to hybridize correctly, making the rate of substrate dissociation much greater than the rate for cleavage (5) would simply decrease the overall cleavage efficiency 4 How many hybridizmg bases are required for selectivity in the pool of mRNA7 In a typical mammalian cell, it has been estimated that there are up to approx 20,000 different mRNA species (27). If their average length is 2 kb, there is a


256

sequence complexrty of 4 x 1O7 Statrstrcally, to be able to define a umque target sequence m that amount of complexity would require a sequence on the order of 13 nucleotrdes (413 w 7 x 107).

2. Materials 2.1. Computer

Programs

The program MFOLD and variants of rt are avatlable vta the mternet. We have used a version called Mulfold 2.0. This runs on a Macintosh computer

and is available from Don Gilbert, Biocomputing Office, Biology Department, Indiana Umverstty, Bloommgton, by anonymous ftp: ftp mbro bro.mdtana.edu user* anonymous cd [archrve.molbro mat] get mulfold.hqx Another useful piece of software IS available from the same source and is used for drawing the output from the Mulfold program. It is called Loopdloop

and is available using the ftp procedure above except: get loopdloop.hqx. 2.2. Measurement

of Substrate Dissociation

Rate

1 2 3 4. 5. 6.

10 pA4 Solution of rrbozyme. 10 @I Solution of 32P-labeled substrate 250 @I Solutron of unlabeled substrate. 100 nuI4 Stock solution of stenle MgCl,. 500 mA4Trrs-HCl, pH 7.5, containing 1 mMEDTA. Stop solution. 90% formamrde, 20 mMEDTA, 0.1% bromophenol blue, and 0 1% xylene cyanol. 7 Apparatus for running polyacrylamrde gels. 8. Phosphorrmager device or X-ray film and scmttllatron counter.

3. Methods It is not possible to describe a single “method” to design the hybridizing arms of a hammerhead ribozyme optrmally. The design of the ribozyme is dependent on the use to which the rtbozyme will be put and on the relatrve weighting that 1sgiven to each of the issueswe have raised in the mtroductron. In this section, we will describe a number of techniques that may be useful in answering some of the design questions raised m the introduction. 3.7. Theoretical Analysis The MFOLD program, by Zucker and Jaeger (I&20),

and derivatives of it, are used to predict the secondary structures of RNA molecules based solely on

their sequence. It is widely available and runs on many different computer

Hybridizing Arms

257 A A G

AC uU

C C U GG

u"u

UG

A

C G 'Au

cC" 5'

RA-1 O/l 0

3'

RA-6/6

Fig. 1. Examples of output from MFOLD program, showing the most stable predicted RNA secondary structures for two hammerhead rrbozymes Rbz 10 + 10 folds mto a stable structure wrth the 5’-hybridizing arm unavailable to bmd the substrate. Rbz 6 + 6, a version of Rbz 10 + 10, with the four terminal nucleotides removed from each end, is not predicted to form any stable structure, except for the requtred helix II. Hybridizing arms are shown m bold platforms, includmg personal computers. It is a simple and raped procedure to enter the proposed sequence and fold it using this program. The atm of this

process 1sto design a rrbozyme m which the most energetically favored conformation 1sone m which the hybridizing arms are not predicted to be in any stable structures. If this is not possible, then a conformation in which the hybridizing arms are free should be relatively close in energy terms to the most stable structure. This is exemplified m Fig. 1; a ribozyme with 10 + 10 hybridtzmg arms was folded, and the most stable fold was predicted to adopt a stable helix involving most of the S-hybridizing arm. When the ribozyme was shortened to a 6 + 6 ribozyme, in the most stable fold, only the desired helix II was predicted to form, with both hybrtdizing arms not predicted to be in any stable secondary structure. This is a facile method of structure prediction However, the results should be treated with a degree of caution and scepticism. Freter et al. (21) have comptled a comprehensive list of thermodynamtc parameters for the interaction of RNA strands in 1 MNaCI. These data can be used to calculate predicted melting temperatures for complementary RNA strands. 3.2. Measurement of Rates of Substrate Dissociation Using the reaction outlined in Scheme 1, once the rrbozyme-substrate complex has formed, it can undergo one of two possible reactions. The substrate can be cleaved, or rt can dissociate from the ribozyme. The balance between these two paths 1simportant m determmmg the specificrty and the efficiency of the reaction (vzde supra).


258 k3 kl

R+

S

kz

+

RS k -1

e

RPl + P2 k%

J

RPlP2

-3

R + P, + P,

k,

k-2 \ k-4

RP, +Pl

k Y k-6

Scheme 1. Reaction scheme for hammerhead ribozyme cleavage Under a given set of corn&tons, the rate constant for the cleavage reaction IS determined using saturating concentrations of ribozyme and substrate (with

the ribozyme in excess) (see Chapter 24). Under these conditions, since all the substrate is bound to ribozyme, and dissociation of reaction products 1s irrelevant, what is measured is the rate constant for the cleavage reaction k2. In a parallel

expertment,

at the time of mitratron

of the reactron wtth addition

of

magnesium, a large excess of unlabeled substrate is added to the reactton mix. Under these conditions, any labeled substrate that dissociates prior to cleavage will be diluted out by the unlabeled substrate and remam uncleaved. Determination of the amount of the labeled substrate cleaved under each condition allows the measurement of the ratio of k2 to kel. 1. In each of two reaction tubes, place 6 pL of 10 l&f ribozyme, 3 pL of 10 @4 32P-5’-end-labeled substrate, and 3 clr, of 500 rnA4Tris-HCI, pH 7.5, 1 mMEDTA 2. Seal the tubes, place in an 85°C water bath for 2 mitt, and then place mto a water bath at the reaction temperature (e.g ,37V). 3. After allowmg several minutes for annealmg and equilibration, mutate the control reaction by the adding 18 pL of 16.7 mM MgCl, solution at 37’C At this point, there 1s 30 & of solution containing 2 @4 ribozyme, 1 pA4 labeled substrate, in 50 mMTris buffer, pH 7 5, and 10 mA4 MgCl* 4 Remove samples at the appropriate time Intervals to follow the cleavage of the substrate almost to completion. In this example with an expected rate constant for the cleavage of around 1 min-‘, samples are removed at 10,20,30,40,60,90, 120, 180, and 240 s (see Fig 2) The 2 pL samples are removed and quenched nnmediately by addition to 4 pL of 85% formamide contammg 20 mM EDTA and gel-tracking dyes. 5 Initiate the test reaction by addmg 18 pL of a solution contammg 16.7 p,V MgCI, and 200 @4 of unlabeled substrate 6. Remove 2 pL samples, and quench at similar times to those for the reaction above, 7 Determme the degree of cleavage at each time-pomt for both reactions by separation using a denaturmg polyacrylamtde gel, and quantitation of the substrate and product bands by phosphorimager analysts as described m Chapter 24. 8 Plot the data as m the example m Fig. 2 The rate constant for the reaction in the absence of excess unlabeled substrate (control reaction) is fitted to the usual firstorder equation pt = pm-

([exp(-kbst)PAI)

(1)

Hybridizmg Arms

259

6’0

120

time

2140

(set)

Fig. 2. HypothetIcal example of an experiment to measure the rates of k2 and k,. In this example, the final ribozyme concentration 1s2 pA& and 1spreannealed with 1 pA4 labeled substrate m the presence of buffer and a trace of EDTA. The reactlon 1s either initiated by the addition of MgCl, to 10 mA4 0, or the same amount of MgCl, and unlabeled substrate to a final concentration of 120 pA4 Cl. The data for the control reaction have been fit to a first-order kinetic equation with a rate constant of 1 mm’, and a final percent cleavage of 90%. The data for the reaction m the presence of excess unlabeled substrate were fit to a first-order kmetlc equation, with kobs= 3 ml&, P, = 30% The dissociated uncleaved labeled substrate mixes with the unlabeled substrate and is cleaved in a multiple turnover, resulting m the sloping baseline The turnover number for the catalytic reaction (k,,,) is 1 0 mm-’ as described m Chapter 24 where P, is the amount of product at time t, P, is the amount of product at t = co, kobsis the first-order rate constant for the reaction and P, is the difference between the percentage of product at t = 00 and t = 0. The data obtained for the reaction m the presence of excess unlabeled substrate (test reaction) 1sthe fitted to the equation* P, = P, - ([exp(-k&)PJ)

+ a*t

(2)

where the new term, a*t, simply allows for the fact that the reaction 1snow m substrate excess, and the labeled substrate that dissociates mixes with the pool of unlabeled substrate and 1sslowly cleaved with the bulk unlabeled substrate. The maximum rate for the turnover reaction (V,,,) and therefore kcat,(V,,,/[Rlbozyme]), can be deduced from the slope of the line for the following reaction (a m Eq. 2) (see Note 1). However, this mformatlon is not required for the determination of the substrate dissociation rate constant.

The ratio of the cleavage reaction rate to the rate of substrate dissociation, )j where the symbols are as defined m W-1, 1s equal to Lest4Lont - Pmtest Fig. 2. In that example, the control reaction cleaved 90% of the substrate (see Note 2), and the amount of substrate cleaved in the in&al stage of the compe-

260


tition reaction was 30%. The ratio k2/k-, is therefore equal to (30/90 - 30), or l/z. The value for k2 from the control experiment is 1 mini, and therefore the value for k-, is 2 mint (see Note 3). The rate constant for the dissociation of the substrate can also be deduced from the observed rate constant for the decay of the nbozyme substrate complex in the presence of excess unlabeled substrate, if it is slow enough, since under these conditions, kobs = k-, + k2. 3.3. Symmetry of Hybridkhg Arms The total number of nucleotides involved m base pairing between the ribozyme and substrate is determined by the need for specificity, selectivity, and turnover as discussed above. The way that the total interaction is divided between hehces I and III will now be discussed. We have observed that at least in the cleavage of short substratesin vitro, optimum cleavage rates are observed with hehx I lengths of around 5 bp. The optimum position of the catalytic domain relative to the ends of the ribozyme (i.e., the length of each arm) is most easily determined m the followmg manner. A single ribozyme with say 10 + 10 hybridizing arms, and a series of substrates that form helices I and III of various lengths with that ribozyme are synthesized. In this way, you can avoid the expense of synthesis of a series of ribozymes. The cleavage rate constants t’or each substrate are determined separately under ribozyme excess conditions. The results obtained from this investigation are transferable to length of hybridizing arms on the rtbozyme, since the important factor appears to be the length of the helix that is formed rather the length of the substrate or ribozyme armper se (vzde infia) As an example, we have measured the cleavage rate constants of a number of different substrates with a single 10 + 10 ribozyme. The ribozyme and substrates are shown in Fig. 3 (see Note 4). The kinetics were performed with ribozyme in excess,and the ribozyme-substrate complex was preformed prior to initiation of the reaction with MgCl*. Despite this and the fact that product dissociation has no effect on the observed cleavage rates, the rates of cleavage differed markedly (see Table 1). As a control, we confirmed that both S16-1O/5 and S 16-5/l 0 were cleaved at approximately the same rate by the shorter-armed ribozyme, RA-6/6. Finally, we demonstrated that the critical factor for rapid cleavage rate was the length of the helix rather that the number of bases 3’ of the cleavage site in the substrate, by synthesizing the ribozyme TAT RA-5/10 and showing that it cleaved the lo/IO substratewith high efficiency (see Note 5). For multiple-turnover situations where a certain total of hybridizing bases IS required for specificity, the lengths of the two hybridizing arms of the ribozyme must be designed taking into account the rate of cleavage of the bound substrate (helix I preferably -5 nt) and the rate of dissociation of the 5’-cleavage product (helix III not too long) m order to maximize the overall turnover rate

Hybridizing Arms

261 SIUCCUGGAAGU

SZl-lO/lO

S’FGAAGU

S13-6/6

5’IGAAGU

516-S/10 Sl&1

o/5

S’IUCCUGGAAG

U

C

AGCCUAGGAcl3’

c

AGCC

C

AGCCUAGGAcl3’

C

AGCCt]3’

u

a13

RB-lO/lO

RA-616

RA-S/10

3’ [a

G G U C C U UIC

Fig. 3. Schematic representanon of the structures of the substrates and rrbozymes m the study of the effect of symmetry of hybridizing arms. Upper-case letters are ribonucleotides. Lower-case letters are deoxyrtbonucleotides

4. Notes 1. k,,, for the reaction can be deduced from the slope (a) of the line of the followmg reaction m this experiment. First, the slope is converted from % cleavage/mm into a concentratton/mm by multiplication by the total (labeled + unlabeled) substrate concentration That number is then dtvrded by the ribozyme concentration to give k,,, in units of mm-‘. 2. Most hammerhead cleavage reactions, even under ribozyme excess conditions, cleave 400% of the substrate, whether It has been transcribed or made by sohdphase synthesis.


262 Table 1 Cleavage

Rate Constantsa

Ribozyme

Substrate

RB-lO/lO RB-lO/lO RB-lO/lO RB-lO/lO RA-616 RA-616 RA-5/10

s21-IO/10 S13-616 s13-5/10 s13-100 s13-5/10 s13-10/5 s21-10110

kobs,mm’ 044 45 0 07 85 3 lb 3.gb 6.5

aConditions nbozyme excess,pH 8 0,lO mhf MgCl,, 37°C bpH 7 13,lO mkfMgC&,

37’C

3 The measurement of k-, by thus method rehes on a number of assumptions One is that all the labeled substrate m the reaction 1sfully bound to ribozyme at the time of addition of magnesium ions This can be checked by varying the ribozyme and substrate concentration, and remeasuring the k2/kpl ratio. Another assumption 1s that the complex that is formed m the absence of Mg*+ is able to bmd Mg*+ rapidly without dissociatron of the ribozyme and substrate. We have demonstrated that this is the case for at least some ribozymes, where k, is >k-, (6). However, if the cleavage reaction is slow enough, (kobs< -1 mm-‘), this assumption can be avoided by adding Mg*+ to start the reaction, allowmg the reaction to proceed for a short period, and then adding the unlabeled substrate See for example ref (22) It is also assumed that the presence of a large concentration of unlabeled substrate in the reaction has no effect on either k2 or k-, Again this assumption can be avoided by usmg a different technique. Instead of preventing rebinding of labeled substrate by addition of a swamping amount of unlabeled substrate, after initiation of the reaction with Mg *+, the reaction is diluted to such an extent that should the labeled substrate dissociate, rt will not reassociate again during the life-time of the experiment (23). 4. The nomenclature is as follows. all-RNA nbozymes are designated RA; DNA-armed rtbozymes are designated RB, substrates by the letter S, and their length m nucleotides The numerals after the hyphen represent the number of bases (5’/3’) available to form helmes wrth the substrates or ribozymes. For example, RA-5/10 represents an all-RNA ribozyme, m which the 5’-arm (which forms helix I) 1s5 nt in length, whereas the 3’-arm (helix III) is 10 nt long. S 16-5/10 is a 16-mer substrate that has 5 nt on the 5’-side (forms helix III) of Cr7, and 10 nt on the 3’-side (forms helix I) of Ci7. 5 In this series of experiments, the 10 + 10 nbozyme had hybridizmg arms composed of DNA, since the activity of the all-RNA ribozyme with 10 + 10 arms was compromised by self-hybridizatton and/or the formation of mactive ribozymesubstrate complexes (6).

Hybridizing Arms

263

References 1 L’Huilher, P. J., Davis, S. R , and Bellamy, A. R (1992) Cytoplasmic delivery of ribozymes leads to efficient reduction in alpha-lactalbumm mRNA levels m C 1271 mousecells. EMBOJ 11,4411-4418 2. Godard, G., Francois, J C., Duroux, I, Asseline, U., Chasstgnol, M , Thuong, N., Helene, C., and Saisonbehmoaras, T (1994) Photochemically and chemically acttvatable antisense oligonucleotides: comparison of their reactivities towards DNA and RNA targets Nuclezc Acids Res 22,4789-4795 3 De Young, M. B., Kincadedenker, J., Boehm, C A , Riek, R. P , Mamone, J A , McSwiggen, J. A., and Graham, R M. (1994) Functional characterizatton of ribozymes expressed using Ul and T7 vectors for the mtracellular cleavage of ANF mRNA. Bzochemrstry 33, 12,127-12,138. 4. Lieber, A. and Strauss, M (1995) Selection of efficient cleavage sttes m target RNAs by using a rrbozyme expression library. Mol Cell Bzol 15,540-55 1 5 Herschlag, D. (1991) Imphcations of ribozyme kinetics for targeting the cleavage of specific RNA molecules zn VIVO. more isn’t always better Proc Nat1 Acad. Scz USA 88,692 I-6925.

6 Hendry, P and McCall, M J. (1995) A comparison of the zn vitro acttvity of DNA-armed and all-RNA hammerhead nbozymes. Nucleic Aczds Res 23,392&3936. 7 Hendry, P , McCall, M J , Santiago, F S., and Jennings, P. A (1992) A nbozyme with DNA m the hybrtdismg arms displays enhanced cleavage ability NucEerc Aczds Res 20,5737-5741

8. Shtmayama, T., Nishtkawa, F., Nishtkawa, S., and Taira, K. (1993) Nuclease resistant chrmenc ribozymes contammg deoxynbonucleotides and phosphorothioate linkages Nuclezc Aczds Res 21, 2605-26 11. 9. Taylor, N R., Kaplan, B E., Swrderski, P , Lr, H., and Rossi, J J. (1992) Chtmerit DNA-RNA hammerhead rrbozymes have enhanced zn vztro catalytic effictency and increased stablbty zn vzvo. Nuclezc Aczds Res. 20,4559-4565 10. Herschlag, D., Khosla, M., Tsuchthashi, Z., and Karpel, R L (1994) An RNA chaperone activity of non-specific RNA binding proteins in hammerhead ribozyme catalysis. EMBO J 13,29 13-2926. 11. Tsuchihashi, Z., Khosla, M., and Herschlag, D (1993) Protem enhancement of hammerhead ribozyme catalysts Sczence 262,99-102 12. Sioud, M. (1994) Interaction between tumour necrosis factor alpha nbozyme and cellular proteins-mvolvement m ribozyme stability and activity J MOE Bzol 242,6 19-629 13. Bertrand, E. L. and Rossi, J J (1994) Facilitatton of hammerhead ribozyme catalysrs by the nucleocapstd protein of HIV-l and the heterogeneous nuclear rrbonucleoprotein A 1. EMBO J 13,2904-2912. 14. Hetdenreich, O., Kang, S. H , Brown, D. A., Xu, X., Swiderski, P., ROSSI, J J., Eckstem, F., and Nerenberg, M (1995) Ribozyme-mediated RNA degradation m nuclei suspensron. Nuclezc Acids Res 23, 2223-2228. 15 Hendry, P McCall, M. J Santiago, F. S , and Jennings, P. A. (1995) The zn vztro acttvrty of mmlmised hammerhead ribozymes. NucEerc Acids Res. 23,3922-3927

264

Hendry, McCall, and Locketf

16 Heidenretch, 0. and Eckstein, F (1992) Hammerhead rtbozyme mediated cleavage of the long terminal repeat RNA of HIV-I J. &of. Chem 267, 1904-1909. 17. Alberts, B., Bray, D , Lewis, J , Raff, M., Roberts, K., and Watson, J. D. (1994) Molecular Biology of the Cell, 3rd ed. Garland Publishing, New York, p. 369 18. Zuker, M (1989) On findmg all suboptimal foldings of an RNA molecule Sczence 244,48-52. 19. Jaeger, J. A, Turner, D. H., and Zuker, M. (1989) Improved predictions of secondary structures for RNA. Proc Nat1 Acad. SCL USA 86,7706-77 10 20. Jaeger, J. A., Turner, D H., and Zuker, M (1989) Predtctmg optimal and suboptimal secondary structure for RNA, in Molecular Evolution Computer Analysis ofProtein and Nucleic Acid Sequences, vol. 183 (Doohttle, R. F , ed.), Academic, San Diego, CA, pp 28 l-306. 21. Freier, S. M , Krerzek, R., Jaeger, J A., Sugtmoto, N., Caruthers, M. H , Nerlson, T., and Turner, D. H. (1986) Improved free-energy parameters for predicttons of RNA duplex stability Proc Nat1 Acad. Scl USA 83,9373-9377. 22. Fedor, M. and Uhlenbeck, 0. C. (1992) Kmettcs of mtermolecular cleavage by hammerhead rrbozymes. Biochemistry 31, 12,042-12,054 23. Werner, M. and Uhlenbeck, 0. C (1995) The effect of base mtsmatches m the substrate recognition hehces of hammerhead rtbozymes on bmdmg and catalysis Nucleic Acids Res 23, 2092-2096.

28 Optimization of Hammerhead Flanking Sequences Using Oligonucleotide Facilitators John Goodchild 1. Introduction The ability to catalyze selected chemical reactions could be of great theoretical and practical value. Uhlenbeck first demonstrated a general method to design catalysts that could distinguish the intended substrates from other, very srmrlar molecules (I). The reaction catalyzed was phosphodrester exchange within the backbone of an RNA that led to chain cleavage at the site of reaction. Activity was achieved by generating the “hammerhead” structural motif found m certain self-cleaving RNA molecules (2), and selectivity resulted from appropriate Watson-Crick base pairing between the catalyst and its substrate. Haseloff and Gerlach subsequently proposed the structure shown m Fig. 1 that has been used most often m designing hammerhead ribozymes to cleave specific RNA sequences (3). An active complex is generated by binding of a ribozyme strand, R, and a substrate, S. This catalyzes the phosphodiester exchange within the substrate backbone that results in chain cleavage at the site indicated by the arrow. The first step in the process, hybridization of R and S by base pairing of the sequencesthat flank the catalytic core, can be critical for the kinetics of the process, which may be governed by the properties of the flanking sequences. A desirable feature for synthetic rrbozymes m general would seem to be high catalytic turnover where many substrate molecules are cleaved in a short time by a small number of ribozyme molecules. Among other things, turnover IS determined by the kinetics and thermodynamrcs of the interactions of the ribozyme, its substrate, and the products. This chapter will consider some of these issues and, in particular, the use of oligonucleotides as cofactors for ribozyme reactions. From


Biology, Vol 74 Ribozyme Protocols Humana Press Inc , Totowa, NJ

265

Goodchild

266

S5’ G-C C-G

F

G-C C-G G-C A-T

A-T C-G A-T G-C A- T A-U A-U A-U U-A C ‘G AA

A‘Uc$qy~ y5’ P2 CUCAU

u AGGCCG

AA R

U,dddd,

G” GUA

Fig. 1. Structuresof representatrveexamplesof a ribozyme (R), substrate(S), and facilitator (F). The siteof cleavageof the substrateis mdrcatedby the arrow. Cleavage of the substrategives two products, Pl and P2, where Pl is the product bound to the facrlitator

2. Kinetics of Ribozyme Reactions Cleavage of RNA by a hammerhead ribozyme is a multistep process. It requires hybridization of the substrate and catalyst to form an active complex that leads to the chemical exchange reaction For multiple turnover, the ribozyme must then rid itself of the cleavage products m order to bmd further substrate molecules. Each step m the process is, in principle, reversible, leading to at least 12 rate constants that are shown m Fig. 2 (4,5), although, m practice, reversal of the cleavage reaction is negligible with hammerhead ribozymes (6). Figure 2 shows the simplest pathway for the process, but it is possible that other steps may be required by some or all hammerheads. For example, binding of the substrate might not occur m a single, cooperative step (7) or the R. S complex mrght need to undergo a conformational change before cleavage can occur. The rate-lrmitmg step is not the same for all hammerheads and may be determined by such factors as unfavorable secondary structure withm either the substrate or ribozyme that might hinder formation of the active complex (7,&j. However, in general, it seems likely that the properties of the flanking sequences will influence the ability of a ribozyme to cleave multiple copies of the substrate.

Hammerhead

R+S

267

Flanking Sequences

R-S

‘P2

‘Pl+P2

Fig. 2. Rate constants m a mmlmal reaction pathway for hammerhead cleavage (4) R, S, P 1, and P2 are defined m Fig 1,

To illustrate this, consider a hypothetical hammerhead that IS not compromised by unwanted secondary structures m either R or S that might hinder hybridization or cleavage reactions. Let this ribozyme have very long flanking sequences, say 50 or more nucleotides on each side. This ribozyme should function perfectly well in cleaving the first molecule of substrate. However, the cleavage products, Pl and P2, will be bound to the ribozyme by 50 bp and so will dissociate extremely slowly. Their presence will hinder the ability of R to bmd to further copies of S, so the rate of cleavage will slow down after the first round. This discontinuity m rate owing to product mhibmon has been termed burst kmetics (9). Such ribozymes, where the rate-limiting step for turnover is dissociation of one or more of the products, obviously do not perform well in cleaving multiple copies of the substrate. Now, consider the effect of reducmg the length of the flanking sequences m R. At some point, dissociation of products will cease to be a problem, and some other step will become rate-limitmg. This might be the cleavage reaction or the rate at which R and S hybridize together. The length of flanking sequence where this transition occurs will depend on the stability of the helices formed by the flanking sequences, and hence, on their base composition and on any chemical modifications. In one case that we studied, this occurred with somewhere between 6 and 10 bases m each flanking sequence (10, II) If flanking sequences are shortened still further, eventually, the R * S complex will become too unstable to form or to exist long enough for the cleavage reaction to occur. Again, this ~111depend on base composition but we found such a cutoff when flankmg sequences were reduced from five to four nucleotides on each side (20). Important factors determining the kmetics of multiple-turnover reactions, then, are likely to be the dissociation constants of hehces formed by the ribozyme flanking sequences when they hybridize to the substrate. For the greatest rate of cleavage, the substrate should bmd sufficiently strongly and the products sufficiently weakly for highest turnover. The process is controlled by an

268

Goodchild

interplay of the rate constants for the formation and dissociation of these helices that require subtle optimizatton. Length, base composition, and chemical modifications would all be expected to influence kmetics, and there are many such examples m the literature (8-22). 3. Criteria for Ribozymes To Be Used as Drugs In work using chemically synthesized ribozymes, it ts usually desired to mmimize chain lengths and often to maximize turnover. This may mean workmg with the shortest practical flanking sequences. In our own work, for example, we proposed the followmg criteria for developmg rtbozymes to be used as drugs (2 0). 1 They should have the minimum chain length for ease of chemical synthesis and purification 2 They should have the maximum achrevable catalytic turnover 3 They should cleave the substrate specifically 4 They should work in conditions similar to those inside cells where, for example, magnesium ion concentratrons are generally around 1 mA4, which IS well below the optimum concentratron for synthetic hammerheads (I) 5. They should be suitably protected against degradation by nucleases.

Shortenmg the flanking sequences from 1O-6 bases was helpful for the first two criteria (II), but perhaps not for the third, which calls for specifictty. This depends on the length of the target sequence that is recognized, that is, on the combined lengths of the flanking sequences.Although atarget sequence should not be too long (23), one that is too short can occur m molecules other than the intended substrate, leading to unwanted cleavage events, In addressing this concern, we turned to the use of facilitator oligonucleotides that bind to the substrate contiguously with the ribozyme (Fig. 1). 4. Facilitator Oligonucleotides Facilitator oligonucleotrdes that hybridize to the substrate next to the ribozyme can act as cofactors for the rrbozyme. They can stimulate turnover by over 500-fold with shorter flanking sequences that are favored for ribozymes made by chemical synthesis (10). In a series of related ribozymes, greatest activity in the presence of a facilitator was seen with 6-base flanking sequences, but greatest stimulation by the facilitator occurred with only 5 and slight activity was found even with 4. A noncomplementary control olrgonucleottde dtd not stimulate cleavage in this way. As predicted, with longer flanking sequences,where product dissociation was thought to be rate-limitmg, a facilitator slowed down cleavage (IO). Modified oligonucleotides, such as phosphorothioates and 2’Gmethyl derivatives function as facilitators, which is encouraging for possible biologi-

Hammerhead

Flanking Sequences

269

cal applications. Best results have been obtained with the 2’Gmethyl derivatives that hybridize more strongly. The phenomenon is also dependent on the chain length of the facilitator. With unmodified ollgonucleotides, activity increased with length from 6-l 3 nucleotides, but not much beyond. The longer facilitators are required in amounts stoichiometric with the substrate, since they do not dissociate readily from the products. It may be expected that the optimum length for different backbones will vary with their ability to hybridize. In our own laboratory, we have improved cleavage at numerous cleavage sites in both long and short RNA substrates, with various modified hammerhead ribozymes as well as a hairpin ribozyme (unpublished results). In the case of long substrates, such as viral or messenger RNAs, facilitators may improve reactions where either ribozymes or substrates are m excess. For short substrates, however, enhancement was seen only with substrate m excess.Denman has also reported IO-fold stimulation cleaving the mRNA for Alzheimer amyloid peptide precursor (24). Synthetic hammerhead ribozymes require concentrations of magnesium ion m excess of 20 mA4 for greatest activity (1,25). The metal is believed to be required for the catalytic step (26), but might play a structural role also. Facilitators are particularly useful in stimulating hammerheads in much lower concentrations of magnesium as required by the fourth criteria above for therapeutic applications. 5. Mechanism of Facilitator Action A ribozyme with short flanking sequences may give poor turnover owmg either to slow formation of the R * S complex or dissociation that occurs more rapidly than the cleavage reaction, We proposed that facilitators might stack onto nbozyme flanking sequenceto stabilizethe R * S complex (10,27). This could be similar to the apparent cooperative binding between two contiguous antisense oligonucleotides and their target RNA (28-M). Support for this mechanism comes from reduction m facilitator effect if it does not abut the end of the ribozyme directly (27). Another possibility was that the facilitator relieved secondary structure within the substrate that inhibited binding of the ribozyme. This may occur to some extent with large RNA substrates where facilitators can stimulate cleavage even in the presence of a large excess of ribozyme. However, it is not the most important mechanism as shown by our kinetic results summarized below. In Chapter 26, we described a technique that uses fluorescence resonance energy transfer (FRET) to determine rate constantsfor the various stepsm Fig. 2. This was used to demonstrate that the presence or absence of the facilitator binding site made no difference to the rate of R * S complex formation, so the role of the facilitator, m this case,was not to disrupt secondary structure within

Goodchild

270

the substrate. It was then shown that the faclhtator stablhzed the R * S complex by about 50-fold. This derived from a fivefold increase in kl and a lo-fold decrease m k,. In contrast, bmdmg of the product P 1 was stabilized by a factor of only about 5 in the presence of the facilitator, the major effect again bemg on the dlssoclation rate of the complex, k4 (45). Overall, then, with short flankmg sequences, the facllltator favored formation of the complex between rlbozyme and substrate over that between rlbozyme and products, and so assisted the cleavage process. 6. Conclusions Facilitators may be most useful when binding of the ribozyme to Its substrate 1s compromlsed. Examples Include rlbozymes with flanking sequences that hybridize poorly because they are too short, poorly accessible target sites m large RNA substrates, or low magnesium ion concentration. As a result, facilitators may help realize the first four of the criteria for therapeutic rlbozymes outlined earlier. They improve catalytic turnover with the shortest ribozymes that are most desirable for practical application, they improve performance in low concentrations of magnesium ion, and they increase the number of base pan-s used to recognize the substrate cleavage site. This last point should result m increased selectivity as the facilitator serves to flag the desired target and to accelerate cleavage at this site over all others. References 1 Uhlenbeck, 0 C. (1987) A small catalytic oligorlbonucleotlde Nature 328, 596400. 2 Symons, R. H (1992) Small catalytic RNAs. Annu Rev Bzochem 61,641-671 3. Haseloff, J. and Gerlach, W L (1988) Simple RNA enzymes with new and highly specific endoribonuclease activltles. Nature 334, 585-591 4 Fedor, M. J and Uhlenbeck, 0. C (1992) Kmetlcs of mtermolecular cleavage by hammerhead nbozymes. Blochemlstry 31, 12,042-12,054 5 Hertel, K J , Herschlag, D , and Uhlenbeck, 0 C (1994) A kinetic and thermodynamic framework for the hammerhead rlbozyme reaction Bzochemzstry 33, 3314-3385. 6. Hertel, K J. and Uhlenbeck, 0 C (1995) The internal equilibrium of the hammerhead rlbozyme reaction. Blochemrstry 34, 1744-I 749 7. Fedor, M J and Uhlenbeck, 0. C. (1990) Substrate sequence effects on “hammerhead” RNA catalytic efficiency Proc Nat1 Acad Sci USA 87, 1668-1672 8 Hendry, P , McCall, M J., Santiago, F S , and Jennings, P A (1992) A rlbozyme with DNA m the hybrldlsmg arms displays enhanced cleavage ability Nuclezc

Aczds Res 20,5731-5741 9 Taylor, N R., Kaplan, B E , Swiderskl, P., Ll, H. T., and Rossl, J J (1992) Chlmeric DNA-RNA hammerhead ribozymes have enhanced zn vztro catalytx efficiency and increased stability Envwo. Nucleic Acrds Res. 20,455!9-4565.

Hammerhead

Flanking Sequences

271

10. Nesbitt, S and Goodchtld, J. (1994) Further studies on the use of ohgonucleottde facthtators to increase ribozyme turnover. Antzsense Res Dev 4,243-249 11 Goodchild, J. and Kohli, V. (199 1) Ribozymes that cleave an RNA sequence from human immunodeficiency vnus the effect of flanking sequence on rate. Arch Btochem Blophys 284,386-391 12 Heidenreich, 0 and Eckstem, F. (1992) Hammerhead ribozyme-mediated cleavage of the long terminal repeat RNA of human tmmunodeficiency virus type 1. J Biol Chem. 267, 1904-l 909 13. Crtsell, P , Thompson, S., and James, W. (1993) Inhibition of HIV-l replication by ribozymes that show poor activity in vitro. Nucleic Acids Res 21,5251-5255 14. Ellis, J and Rogers, J (1993) Design and specificity of hammerhead rtbozymes against calretinin messenger RNA Nuclezc Acids Res 21, 5 17 l-5 178. 15 Sawata, S , Shtmayama, T , Komiyama, M , Kumar, P IS. R., Nishikawa, S , and Taira, K. (1993) Enhancement of the cleavage rates of DNA-armed hammerhead ribozymes by various divalent metal ions. Nuclezc Aczds Res 21, 5656-5660.

16 Bertrand, E., Pictet, R., and Grange, T. (1994) Can hammerhead ribozymes be efficient tools to inactivate gene function? Nucleic Actds Res 22,293-300 17. Lange, W., Daskalakis, M., Fmke, J , and Dolken, G. (1994) Comparison of different ribozymes for efficient and specttic cleavage of BCR/ABL related mRNAs FEBS Lett 338,175-178. 18 Tabler, M , Homann, M., Tzortzakaki, S , and Sczakiel, G (1994) A three-nucleottde helix I is sufficient for full activity of a hammerhead rtbozyme. advantages of an asymmetric design. Nuclex Aczds Res 22,3958-3965 19. Palfner, K., Kneba, M., Htddemann, W , and Bet-tram, J. (1995) Improvement of hammerhead ribozymes cleaving mdr-1 mRNA. Biol Chem Hoppe. Seyler 376, 289-295 20 Dahm, S. C. and Uhlenbeck, 0 C (1990) Characterization

21. 22.

23

24 25.

26.

of deoxy- and ribocontaining ohgonucleotide substrates in the hammerhead self-cleavage reaction Blochlmle 72,819-823. Shtmayama, T. (1994) Effects of deoxyribonucleotide substitutions m the substrate strand on hammerhead ribozyme-catalyzed reactions. Gene 149,41-46. Shimayama, T., Nishikawa, S , and Tana, K. (1995) Extraordinary enhancement of the cleavage activity of a DNA-armed hammerhead ribozyme at elevated concentrations of Mg2+ ions. FEBS Lett 368,304-306 Herschlag, D. (199 1) Imphcattons of rtbozyme kmetics for targeting the cleavage of specific RNA molecules zn vzvo’ More isn’t always better. Proc Nat1 Acad Sci USA 88,6921-6925 Demnan, R. B. (1993) Cleavage of full-length beta-APP messenger RNA by hammerhead rtbozymes. Nuclezc Aczds Res. 21,4119-4 125 Dahm, S. C. and Uhlenbeck, 0. C. (199 1) Role of divalent metal ions in the hammerhead RNA cleavage reaction. Blochemutry 30,9464-9469. Pyle, A. M. (1993) Rlbozymes: a distinct class of metalloenzymes. Sczence 261, 709-714

272

Goodchild

27. Goodchtld, J. (1992) Enhancement of ribozyme catalytic acttvtty by a contiguous ohgodeoxynucleotide (facilitator) and by 2’-0-methylation. Nucleic Aczds Res 20,4607-4612. 28. Bordier, B , Helene, C., Barr, P. J., Litvak, S., and Sarihcottm, L (1992) In vitro effect of antisense ohgonucleottdes on human immunodeflciency virus type-l reverse transcription Nuclex Aczds Res 20, 5999-6006. 29 Porumb, H , Bertrand, J.-R., Paoletti, J , Vasseur, J.-J., Rayner, B , Imbach, J -L , and Malvy, C. (1992) 9-Aminoelhpticine-derivatized alpha- and beta- oligodeoxynucleotides targeted to the cap of beta-globm mRNA: hybridization to natural and engineered mRNA, mhibttton of translation, and improved effect of tandem chams. Antrsense Res Dev 2,279-292 30. Kotler, L. E , Zevm-Sonkin, D , Sobolev, I. A., Beskm, A. D , and Ulanovsky, L. E. (1993) DNA sequencing modular primers assembled from a library of hexamers or pentamers. Proc Nat1 Acad. Scl USA 90,4241-4245 31. Lin, S -B., Blake, K. R., Miller, P S., and Ts’o, P. 0. P. (1989) Use of EDTA derivatization to characterize mteractions between oligodeoxyribonucleoside methylphosphonates and nucleic acids. Bzochemzstry 28, 1054-1061. 32 Maher, L J , III and Dolmck, B. J. (1988) Comparattve hybrid arrest by tandem antisense oligodeoxyribonucleotides or ohgodeoxyribonucleoside methylphosphonates in a cell-free system Nuclex AczdsRes 16,3341-3358. 33 Distefano, M. D , Shin, J A., and Dervan, P. B (1991) Cooperative binding of ohgonucleottdes to DNA by triple helix formation dimertzation via Watson-Crick hydrogen bonds J Am. Chem Sot. 113,5901-5902. 34. Kutyavin, I V., Podymmogin, M. A , Bazhma, Y. N , Fedorova, 0. S., Knorre, D G , Levina, A S., Mamayev, S. V , and Zarytova, V. F (1988) N-(2-Hydroxyethyl) phenazinmm derivatives of oligonucleotides as effecters of the sequence-specific modtficatton of nucleic acids with reactive ohgonucleotide dertvatives. FEBS Lett 238,35-38. 35 Goodchild, J., Carroll, E , III, and Greenberg, J R (1988) Inhibition of rabbit P-globm synthesis by complementary ohgonucleotides* tdentiticatton of mRNA sites sensitive to mhibttton. Arch Bzochem Bzophys 263,401-409 36 Gryaznov, S. M and Lloyd, D. H (1993) Modulation of oligonucleotide duplex and triplex stability via hydrophobic interactions Nucleic Aczds Res 25,5909-5915. 37 Siegrist, C A and Mach, B. (1993) Antisense ohgonucleottdes specific for regulatory factor RFX-1 inhibit inducible but not constitutive expression of all maJor histocompattbility complex class II genes. Eur. J Immunol 23, 2903-2908. Azhikina, T , Veselovskaya, S., Myasnikov, V , Potapov, V , Ermolayeva, 0 , 38 and Sverdlov, E (1993) Strings of contiguous modified pentanucleotides with increased DNA-binding affinity can be used for DNA sequencing by primer waikmg Proc Nat1 Acad Scz USA 90, 11,460-l 1,462 39 Colocci, N. and Dervan, P. B (1994) Cooperative binding of 8-mer ohgonucleotides containing 5-( 1-propynyl)-2’-deoxyuridme to adJacent DNA sites by triplehehx formation J Am Chem Sot 116, 785,786

Hammerhead

Flanku-tg

Sequences

273

40. Kteleczawa, J , Dunn, J J , and Studier, F. W (1992) DNA sequencmg by primer walking with strmgs of conttguous hexanucleottdes. Sczence 258, 1787-l 79 1 41. Pttha, P M and Ts’o, P 0 P (1969) The interactions of adenosme and ademne heptanucleoside hexaphosphate with polyundylic acid Blochemlstry 8,5206-52 17 42. Springgate, M W. and Poland, D. (1973) Cooperative and thermodynamtc parameters for ohgomosmate-polycytidylate complexes. Blopolymers 12,2241-2260 43. Walter, A E , Turner, D H , Kim, J., Lyttle, M. H , Muller, P., Mathews, D H., and Zuker, M. (1994) Coaxial stackmg of helixes enhances bmdmg of oligoribonucleottdes and improves predictions of RNA folding Proc Nat1 Acad Scl USA 91,92 18-9222 44 Godard, G., Francots, J. C., Duroux, I., Asseline, U., Chassignol, M., Thuong, N., Helene, C , and Satsonbehmoaras, T. (1994) Photochemtcally and chemically acttvatable antisense ohgonucleotides* compartson of then reacttvtttes towards DNA and RNA targets. Nucleic Acids Res 22,4789-4795 45 Perkins, T A, Goodchtld, J , and Wolf, D. E. (1996) Fluorescence resonance energy transfer analysts of ribozyme kinetics reveals the mode of action of a facthtator oligonucleottde Bzochemzstry, in press

29 Enhancement of Ribozyme Function by RNA Binding Proteins Nan Sook Lee, Edouard

Bertrand, and John J. Rossi

1. Introduction The hammerhead ribozyme motif can be engineered to functton as a sequence-specific endoribonuclease for use as a specific Inhibitor of gene expression (1,2). However, efficient inhibition often requires high ribozyme concentrations and a large excess of ribozyme over substrate (3). Moreover, the extent of inhibition seen with an inactive ribozyme mutant is often on the same order of magnitude as for the active version owing to antisense effects (4). Thus far, it appears that in vivo applications of ribozymes have not taken full advantage of their demonstrated in vitro potential. A major difference between the m vivo and m vitro ribozyme reactions is that most or all RNAs are not freely diffusing in the cell, but normally exist as ribonucleoprotem (RNP) complexes. It has recently been shown that many of the major proteins associatedwith RNAs in vivo affect RNA foldmg by promoting annealing (5), unwinding, and strand exchange(6). Therefore, interactions between theseproteins and either the ribozyme or its substratemay affect ribozyme activity. Ribozyme binding and cleavage could be inhibited by steric hindrance or via protein-mediated unwinding. Proteins may also enhance ribozyme binding via annealing activities, and ribozyme turnover via strand-exchangeactivities. Recently, some RNA binding proteins, the nucleocapsid protein of HIV- 1 (NCp7) and the heterogeneous nuclear nbonucleoprotem Al, showed facilitation of hammerhead ribozyme catalysis (7,s). The protems bind RNA nonspecifically, and exhibit both annealmg and unwinding activities. Their unwindmg activity can directly lead to RNA-RNA annealing, since denaturation of mtramolecular structures promotes mtermolecular renaturation. Therefore, it is useful to study the effect of RNA binding proteins on the ribozyme cleavage reaction. From



275

Lee, Bertrand, and Rossi

276 2. Materials

5 6

7 8 9 10 11 12 13 14 15

Sterile distilled water (dH20). Sterile TE buffer 100 mM Tris-HCl, pH 8 0, 0 1 m&Z EDTA DNA templates m suitable transcription vectors (see Note 1) MEGAscriptTM in vitro transcript kits for large-scale synthesis of RNA (Ambion, Austin, TX) or equivalent. These contain. T7, T3, or SP6 RNA polymerase, 10X transcription buffer, NTP solutton (75 mM for T7 or T3,50 mM for SP6), RNasefree DNase I(2 U/l.&), ammonmm acetate stop solutton 5 Mammomum acetate, 100 rnA4 EDTA, llthmm chloride precipttatton solution. 7 5 A4 lithium chloride, 50 mMEDTA, 2X gel loading buffer 80% formamide, 0.1% bromophenol blue, 0.1% xylene, and RNase-free dHzO RNase-free dHzO for dilution of transcriptton reaction (DEPC-treated water) Labeled nucleotide, [a-32P]-UTP (Amersham, Arlington Heights, IL), or btotmor dtgoxtgenm-labeled UTP (Boehrmger Mannhelm, Indtanapohs, IN), for mcluston m the reaction as a tracer to aid m the quantnation and quality assessment of the RNA synthesized For purification of RNA transcripts. buffer or water-saturated phenol/chloroform, isopropyl alcohol, 70 and 95% ethanol. Suitable restriction enzymes and manufacturers’ buffers. Sterile 1.5 mL mlcrofuge tubes. Rtbozyme cleavage reaction buffer. 20 mMMgCl*, 140 mA4KCl,20 mMTns-HCI, pH 7 5 A stock solution of at least 2X should be made. Purified proteins to be analyzed (50 ng/pL) Cleavage stop solution* 0.5% SDS and 25 mM EDTA Linear polyacrylamide as a carrier for precipitation (9) Sterile glycerol. 1OX TBE buffer: 900 mM Trts-borate, pH 8 3,20 mA4 EDTA

3. Methods 3.1. Plasmid Constructions

and RNA Synthesis

1 Construct the plasmids that will be transcrtbed m vitro to generate rtbozyme transcripts, by clonmg synthetic ohgonucleotides for the rtbozymes and then substrates into the polylmkers of pBluescrlpt KS+ or SK+, or pGem 9z2 Linearize these plasmids by digestion with a suitable restrictton enzyme (seeNote 2) 3. After restriction enzyme digestton, purify each template by phenol/chloroform extraction and ethanol prectpitatton according to standard procedures (see Note 3), and dissolve in water or TE buffer at a convenient concentration (e.g , 0 5 mg/mL) 4. Set up 20 pL run-off transcriptton reactions m microfuge tubes by adding the following reagents m order at room temperature* RNase-free dH,O to make a final volume of 20 pL, 2 pL of 10X transcription buffer, 8 pL of 75 mA4NTP, 1 pg of the linearized and purified template DNA, and 2 pL of RNA polymerase (see Note 4). 5 Mix the contents, and incubate the reaction at 37’C for 2-6 h, dependmg on the size and mtrmslc transcription efficiency of the template.

RNA Binding

Proteins

277

6 Add 1 $ of RNase-free DNase I (2 U/pL) to the reaction, mix, and incubate at 37’C for 15 min 7. Stop the reaction by adding 115 & of RNase-free dHZO and 15 pL of ammonium acetate stop solution, and mix thoroughly. 8 Extract the reactlon once with an equal volume of phenol/chloroform and once with an equal volume of chloroform. 9 Precipitate the RNA by addmg 1 vol of isopropyl alcohol and mlxmg well. 10 Chill the reactlon for at least 15 mm at -20°C. 11. Mlcrofuge at >lO,OOOg for 15 mm to pellet the RNA 12 Carefully remove the supernatant solution, and resuspend the RNA m RNasefree dH,O or TE buffer 13. Determine the RNA concentration by UV absorption or usmg the percentage of nucleotlde mcorporation mto TCA msoluble material (between 25 and 65%).

3.2. RNA Binding Assays To examme the binding of a purified protein to the transcribed substrate RNA, the mobility shift RNA bindmg assayIS used. The final reaction volume recommended for this assay IS 10 &: 1. Heat ahquots of the transcribed substrate RNAs (Section 3.1 , step 13) for 1 mm at 90°C 2. After coolmg to room temperature, add cleavage reactlon buffer (e g., 5 & of a 2X stock) 3 Further incubate the RNAs for 5 min at room temperature, and then add different concentrations of the purified RNA binding protein to be tested (e.g., 10-100 ng/pL) to different aliquots. 4 After 15 mm of mcubatlon at 37”C, add glycerol to a final concentration of 10% 5 Immediately load the samples onto a 1% agarose gel buffered with 0.5X TBE or

onto a 6% polyacrylamide gel buffered with 1X TBE 6 Electrophorese the samples at room temperature, with a voltage of 6 V/cm for the agarose gels and of 12 V/cm for the polyacrylamide gels.

3.3. Ribozyme Cleavage Assays Hammerhead ribozymes can be assayed for cleavage by measurement of RNA substrate cleavage products m denaturing polyacrylamlde gels. 1 Heat Independently, for 1 min at 9O”C, aliquots of the transcribed rlbozymes and substrates (Section 3.1 , step 13). 2. After cooling to room temperature, add cleavage reaction buffer (e g., 5 pL of a 2X stock) 3. Further incubate the RNAs for 5 mm at room temperature, and then add the punfied RNA binding protem to each tube usmg the concentration selected in Section 3 2. 4 Combme rlbozyme and substrate, and incubate at 37°C for the desired time. 5. Stop the reactlon by mixing with an equal volume of cleavage stop solution and then with 100 pI., of phenol/chloroform.

278

Lee, Bertrand, and Rossi

6 Add sterile water to bring the aqueousphaseto 100 & extract, and precipitate with ethanol in the presence of 2 5 pg of linear polyacrylamide 7 Analyze the RNAs on denaturmg polyacrylamide gels, and subsequently scan on either a radroanalyttc tmager or a phosphortmagmg system.

3.4. Kinetics To examine the enhancement of ribozyme function by the purified protem, the kmetics of the cleavage reaction should be determined. The steady-state cleavage rates under multiple-turnover conditions are determined using 2 nM ribozyme and 20 nM substrate. The reactions are lmear for the first 20 mm, during which time aliquots are sampled. The Initial cleavage velocities under single-turnover conditions are determined at a concentration of 2 nM substrate and 20 tiribozyme over a 10 mm time-course followmg mltiation of the reactton. kCa,/Km values are determmed

under single-turnover

condrtron (10).

1 Incubate 2 nA4of substrate with increasing concentration of ribozyme ( 1O-l 00 nM) for 30-60 mm at 37’C 2. Stop the reaction by mixing with an equal volume of stop solution 3 Analyze on a denaturing polyacrylamide gel, and scan on either an radioanalytic imager or a phosphorimagmg system. 4 Plot (-ln Frac [S])/t against the ribozyme concentration, where Frac [S] is the fractton of remaining substrate and t is the reaction time. 5 Ftt the curves to a line, the slope of which is k,,,lK,

4. Notes 1 A concentratton of 0 5 pg/pL in sterile dH,O or TE buffer IS useful 2 In each case, the enzyme must cleave the plasmtd distal to the ribozyme sequences and the T7, T3, or SP6 promoter, which is to be used for transcription. 3 To purify and precipitate DNA, follow steps 8-12 m Sectton 3 l., but m step 9, add 2 5 volume of 95% ethanol instead of isopropyl alcohol 4 To generate trace-labeled substrates, process as for the nonradioactive nbozymes, but include 1 pL of [~x-~*P]-UTP m place of an equal volume of water.

Acknowledgments This work was supported by the National Institutes of Health (NIH) Grants AI 25959 and AI 29329. References 1 Haseloff, J. and Gerlach, W. L (1988) Sample RNA enzymes with new and highly specific endortbonuclease activities. Nature 334, 585-591. 2 Sarver, N., Cantm, E M., Chang, P S., Zaia, J. A , Ladne, P. A , Stephens, D A , and ROSSI, J J. (1990) Ribozymes as potenttal anti-HIV-1 therapeutic agents Science 247, 1222-l 225

RNA Sinding Proteins

279

3. Steinecke, P., Herget, T., and Schreler, P. H (1992) ExpressIon of a chlmerlc rlbozyme gene results m endonucleolytlc cleavage of target mRNA and a concomitant reduction of gene expression zn vivo. EMBO J. 11, 1525-1530 4 Zhao, J J and Pick, L (1993) Generating loss-of-function phenotypes of thefushz tarazu gene with a targeted rlbozyme tn Drosophda Nature 365,448-45 1. 5. Portman, D and Dreyfuss, G (1994) RNA annealmg actlvltles In HeLa nuclei EMBO J 3,213-221.

6 Casas-Fmet, J R., Smith, J. D., Kumar, A., Kim, J. G., Wilson, S H., and Karpel, R L. (1993) Mammalian heterogeneous rlbonucleoprotem Al and its constituent domains. J Mol. Biol. 229, 873-889. 7 Tsuchlhashr, Z., Khosla, M , and Herschlag, D. (1993) Protein enhancement of hammerhead ribozyme catalysis Science 262,99-102 8 Bertrand, E. L and Rossl, J. J. (1994) Facllitatlon of hammerhead ribozyme catalysis by the nucleocapsld protein of HIV-l and the heterogeneous nuclear rlbonucleoprotem Al EMBO J 13, 2904-2912. 9 Gaillard, C and Strauss, F. (1990) Ethanol precipitation of DNA with lmear polyacrylamlde as carrier Nucleic Acids Res 18, 378 10 Heldenrelch, 0. and Eckstem, F. (1992) Hammerhead nbozyme-mediated cleavage of the long terminal repeat RNA of human lmmunodeficlency virus type 1 J Blol Chem 267, 1904-1909

Selection of Fast-Hybridizing Complementary RNA Species In Vitro Ralf Kronenwett

and Georg Sczakiel

1. Introduction For naturally occurring antisense-regulatedsystems,it has been found that the rate for the associationof complementary RNA strandsm vitro reflects the biological effectiveness of the antisenseRNA m viva (I). Recently, a similar correlation has been identified for artificial HIV- 1-directed antisenseRNA in human cells (2). In the caseof nbozymes, i.e., molecules that first bmd then target via complementary sequencesand, subsequently,hydrolyze the cleavable motif, it is reasonable to assumethat the biological effectiveness in living cells is influenced by the ability of fast associationas well. Thus, one could conclude that the tdentification of fasthybridizing nbozyme speciessupports the searchfor biologically effecttve ones. It is of practical use that hammerhead ribozymes can be designed such that essentially one antisense arm (except 3 or 4 bp) can be deleted, giving rise to an asymmetric hammerhead nbozyme (ref 3; seealso Chapter 16). Here, we describe an m vitro protocol for the identification of fast-associating RNA speciesout of a pool of successively 3’-shortened homologs of a given antisense RNA or asymmetric hammerhead rtbozyme. The basis of the method is (1) to generate a pool of antisense species that have one end (5’ or 3’) in common and differ by the length of the opposite portion, and (2) to measure the rate of annealing with a given target RNA m vitro for each individual species.Thereby, fast-hybridizing antisensespeciescan be identified and distmguished from slow-hybridmng ones. By use of a phosphorimager system,quantitative data can be calculated. 2. Materials For the preparation of all buffers and solutions, use DEPC-treated water. Add DEPC to water at 0.1% (v/v) and autoclave for 15 min or, after mcubation at 37OC for 12 h, heat to 100°C for 15 min. From

Methods m Molecular Edhd by P C Turner

B/o/ogy, Vol 74 Rtbozyme Protocols Humana Press Inc , Totowa, NJ

281

Kronenwett and Sczakiel

282 2.1. Alkaline Hydrolysis 1 2 3 4 5 6 7.

8. 9

of 5’-Labeled

Full-Length

Antisense

RNA

TE 10 mM Tns-HCI, pH 8 0, 1 mMEDTA. 0.5 MNaHC03 store at room temperature 3 A4 Sodium acetate, pH 5 2 Ethanol, absolute Stop buffer 50 mMTris-HCl, pH 8 0, 15 mMEDTA, 0 2% SDS, 8 Murea, 0 04% bromphenol blue, 0.04% xylene cyan01 Store at room temperature TBE electrophoresis buffer 89 mMTr~s, 89 mMbonc acid, 2 mMEDTA, pH 8 3 (4) 10 pmol of full-length antisense RNA, treated with DNase I, dephosphorylated and 5’-labeled with [Y-~~P]ATP by T4 polynucleotlde kmase as described m ref 4 (see Notes l-3) Equipment to perform polyacrylamlde gel electrophoresis (12% polyacrylamlde gel contammg 8 M urea [200 x 400 x 0 4 mm]) Sephadex G-50TM (Pharmacla, Freiburg, Germany)

2.2. Generation of Size Marker of RNA Length by RNase Tl Digestion 1. 5 pL of full-length antisense RNA, 5’-labeled with [Y-~~P]ATP by T4 polynucleotlde kmase and desalted by gel filtration as described m Section 3 1.) step 3 2 10X Hybrldlzatlon buffer 1 MNaCl, 200 mMTris-HCl, pH 7.4, 100 mMMgC1, Store at -20°C. 3 Stop buffer and TBE as in Section 2 1 4 1 pL of RNaseTl (100 U/pL) Dilute RNaseTl 1.20 in distilled water munedlately before use 5. Equipment to perform polyacrylamlde gel electrophoresls (12% polyacrylamlde gel contammg 8 M urea [200 x 400 x 0.4 mm])

2.3. Determination

of the Optimal Target RNA Concentration

1 Full-length antisense RNA (l-5 pL), 5’-labeled with [Y-~*P]ATP by T4 polynucleotlde kmase and desalted by gel filtration as described m Sectlon 3 1 , step 3 2 Target RNA (about IO pmol) 3 10X Hybrldlzatlon buffer, stop buffer, and TBE as m Sectlon 2 2 4 Equipment to perform polyacrylamlde gel electrophoresls (4% polyacrylamlde gel containing 8 M urea [ 150 x 180 x 1 mm])

2.4. In Vitro Selection Assay 1. Target RNA (l-8 pmol) 2 400 ng unlabeled full-length antisense RNA. 3. TE, 3 M sodium acetate, ethanol, 1OX hybrldlzatlon buffer, stop buffer, and TBE as in Sectlons 2 1 -2 3 4 Equipment to perform agarose gel electrophoresls (1.2% agarose gel [ 140 x 150 mm], poured with TBE electrophoresls buffer, containing 200 ng/mL ethldium bromide) 5 Needle of a syringe (diameter 1 2 mm). 6 Glass wool, silanized (Serva, Heidelberg, Germany) 7 500 mL of liquid nitrogen.

Fast- Hybridizing Complementary

RNA

283

8 Equipment to perform polyacrylamtde gel electrophorests (12% polyacrylamtde gel containing 8 Murea [200 x 400 x 0.4 mm])

3. Methods 3.1. Alkaline Hydrolysis of 5’-Labeled Full-Length Antisense RNA In this section, the best condltlons for alkaline hydrolysis are determined. About 10 pmol of 5’-labeled

full-length

antisense RNA, purified

by gel filtra-

tion (Sephadex G-50) after the labeling reaction and eluted from the column with 400 pL of TE, are required 1. Transfer 100 pI. ahquots of S-radrolabeled anttsense RNA (about 2 5 pmol) mto three reaction tubes, respectively 2 Add to each tube 150 pL of 0 5 A4 NaHCO,, and heat the mixtures at 96”C, one for 11 mm, one for 13 mm, and the thrrd for 15 min. After mcubatmg, chill the samples in ice water 3 Desalt the hydrolyses products by gel filtration Elute the peak fraction with 400 pL of TE 4 Precipitate the hydrolyzed RNA by addmg 0 1 vol of sodium acetate and 2 2 vol of ethanol Redissolve the RNA in 12 pL of TE 5 Heat an ahquot of the labeled full-length RNA (diluted with stop buffer), ahquots of the three hydrolyzed RNA pools (2 pL each m stop buffer), and the fractions of the different time-points of the RNase Tl digestion (see Section 3.2.) for 5 min to 95V, and load them onto a 12% denaturmg polyacrylamide sequencing gel contammg 8 A4 urea 6 Stop the gel running when the xylene cyan01 dye has migrated unttl approx 12 cm from the lower edge of the gel. Dry the gel, and expose it to X-ray film overmght 7 Identify reaction condmons at which the hydrolysis products should be dtstributed equally from the full-length RNA to the shortest visible RNA species (see Notes 4 and 5)

3.2. Generation of Size Marker of RNA Length by RNase Tl Digestion 1. For RNase Tl digestion, prepare five reaction tubes contammg 7 pL of stop buffer 2 Mix 5 pL of 5’-labeled parental antisense RNA with 2 pL of 10X hybridtzation buffer and 9 & of disttlled water. 3 Start the RNase reaction at room temperature by addmg 4 p.L of diluted RNase Tl 4. After 15 s, 30 s, 1 mm, 5 mm, and 10 mm, remove 3 pL. ahquots, and transfer them mto the prepared stop buffer-contammg reaction tubes 5 Analyze ahquots of different time-pomts by denaturing polyacrylamide gel electrophoresis as described m Section 3.1., steps 5 and 6 RNase Tl cleaves after single-stranded G, so you can identify the G posmons withm the RNA ladder

3.3. Determination of the Optimal Target RNA Concentration For choosing the target RNA, see Note 1. The unlabeled target RNA (IO400 nM) 1s m large excess over labeled antisense RNA (Cl nM) under the reaction condrtrons used m the m vitro selectton assay, which means that the


284

reaction follows pseudo-first-order kinetics. Therefore, the half-life of the association reaction is proporttonal to the target RNA concentration. One should choose a target RNA concentratton that allows one to follow the disappearance of a single-stranded RNA species wrthin a time-course of 16 mm To find a suttable concentratron, one has to determine for each target RNA the half-life of the hybrrdizatton reaction for different target RNA concentrations, for example, by using 50, 150, and 300 nM target RNA concentratron prtmartly. Prepare for each hybrrdizatron reaction SIX reaction tubes containing 30 pL of stop buffer m an ice water bath The hybrrdrzatron reaction mixtures for every target RNA concentratron to be tested are as follows. 2 pL of 10X hybridrzatron buffer, the respectrve amount of target RNA, and the labeled full-length antisense RNA m a final volume of 20 pL, Start the hybndizatron kinetics by adding the labeled antrsense RNA, and incubate at 37°C Remove at different time-points (2,4,8, 16, and 32 mm) 3 pL ahquots, and transfer them as fast as possible mto the precooled and stop buffer contammg reaction tubes Load the probes of the different time-points onto a 4% polyacrylamide gel (150 x 180 x 1 mm) containing 8 Murea Run the gel m TBE electrophoresis buffer at room temperature until the xylene cyan01 dye reaches the lower edge of the gel. Dry the gel, and expose it to a X-ray film. On the X-ray film, you should see decreasing single-strand and increasing hybrid bands Estimate by eye the half-life-time of decreasmg smgle-strand RNA for each target RNA concentration you tested Choose for your in vitro selectron assay a target RNA concentration at which the half-life-time is about 4-8 mm For quantrtatrve analysrs of band intensities and detennmatron of exact secondorder rate constant of the hybrrdrzation reaction, you can scan the dried gels by a phosphorimager (e g , Molecular Dynamrcs) (see Note 11).

3.4. In Vitro Selection Assay The experimental procedure IS schematically shown m Fig. 1. Use for the assay the hydrolyzed RNA pool with hydrolysis products dtstnbuted equally from the fulllength RNA to the shortest visible RNA species (determrned in Section 3.1.) and the surtable target RNA concentration, at which the half-life-time of hybridtzatron reaction IS about 4-8 min (deternnned in Section 3.3.). To achieve a native secondary structure, the hydrolyzed antisense RNA must be heated to 75°C for 10 mm and cooled down slowly to 37°C in a water bath before using rt in hybndrzation assays. 1. Prepare five reactron tubes contammg 30 & of stop buffer, and place them m an ice water bath. 2 Mix the appropriate amount of target RNA (see Notes 6 and 7) with 2 pL of 1OX hybndrzation buffer and drstilled water to a final volume of 12 p.L on ice Add 8 pL of the hydrolyzed 5’-labeled antisense RNA (prepared as described m Sectron 3.1.), mrx gently, transfer a 3 pL ahquot into a prepared stop buffer contam-

Fast-Hybridizing

Complementary

RNA

285

analysis of RNA after labelling and alkaline hydrolysis (denaturing polyacrylamide gel)

hybridization between antisense RNA pool and target RNA anlkense

RNAs

0’ ’ 2”

target RNA I + 4’1

6’1

16’

time

,--:-;--:o

single strand 0’ 2’ 4’ 6’16’ ---_ ---_ ----------_e-m--------_ --------v-s---_ ---------_ ---_ ---_-se----------

hybrids

hybrids 0’ 2’ 4’ 6’16’

-------

-

------

isolation of the RNA fractions from the gel

-

--

--- ----- -----

separation of single strand and hybrid fractions (native agarose gel)

analysis of isolated RNA fractions and identification of fast hybridizing antisense RNAs (brackets) (denaturing polyacrylamide gel)

-

Fig. 1. Schemattc depiction of the experimental procedure.

ing reaction tube unmedtately, and then incubate the remaining hybridization reaction mix at 37°C. After 2,4,8, and 16 min, transfer further 3 pL aliquots into the other ice-cold stop buffer-containing tubes. 3 Load the 5 aliquots onto a 1 2% mrdi agarose gel (poured with TBE electrophoreSISbuffer and containing 200 ng/mL ethidium bromide) To identify the bands of

286

4 5.

6 7

8. 9 10

11

12 13

14

Kronenwett and Sczakiel the smgle-strand fractions, additlonally load at the right and the left edge of the gel 200 ng of unlabeled full-length antisense RNA. You do not need a marker for the bands of the hybrid fractions, because usually there IS enough target RNA for detectlon of the hybrids by UV radiation. Run the gel in TBE buffer until the bromphenol blue dye has moved about 3 cm During the gel run, prepare the tubes for elutlon of the RNA fractions from the gel slices m the followmg manner: take for each single-strand and each hybrid fraction band one 1 5 mL mlcrofuge tube (so for five time-points you need 10 tubes) Take a needle of a syrmge with a diameter of 1 2 mm, and heat It using a gas burner until glowmg. Then melt two holes mto the lid and one hole mto the bottom of each reactlon tube. Afterward fill the hole at the bottom of the tube with silamzed glass wool usmg forceps The compressed glass wool m each tube should have a height of about 3-5 mm measured from the bottom (see Note 2). After the gel run, view the agarose gel on a long-wavelength UV transillummator, and locate the bands of the RNA fractions Usmg a sharp scalpel, cut out the IO gel slices contammg the single-strand and hybrid RNA fractions, transfer each slice m one of the glass wool-filled tubes, and close them. For cutting the hybrid bands, you can make incisions directly at the edges of the bands. For detection of the smgle-strand bands, which are not easily visible, use the antisense RNA marker bands, which you loaded at the edges of the gel. The single-strand fraction, which consists of RNA species of different lengths (each shorter than the full-length RNA), IS distributed more dlffusely on the gel than the hybrtd bands Therefore, you have to make the mclsion about 1 cm m front and munedlately at the back edge of the full-length antisense RNA marker band Put the tubes contaming the gel shces m liquid nitrogen for 10 mm Stick each frozen gel shce-containing tube into a 1 5 mL mlcrofuge tube, and centrifuge both together for 20 mm at room temperature at >lO,OOOg, so that the RNAcontainmg buffer can flow out of the thawing gel shce mto the 1.5 mL outer tube Repeat the freezing of the gel slices and centrlfugatlon usmg a fresh 1 5 mL mlcrofuge tube Pool the flowthroughs from respective gel slices that are usually between 400 and 800 pL and contain the RNA fractions. For preclpltatlon of the RNA, add 0 1 vol of 3 M sodium acetate and 2 vol of ethanol precooled on ice water MIX well and Incubate for at least 15 mm at -70°C (see Note 8) Mxrofuge at 4°C for 20 min at >lO,OOOg, and remove the supernatant carefully. Redissolve the pellets m 10 pL (smgle-strand fractions) or 5 pL (hybrid fractions) of TE Add 30 pL (single-strand fractions) or 15 $ (hybrid fractions) of stop buffer to each RNA solution (see Note 9) After denaturing by heating for 5 min to 95”C, load the samples onto a 12% polyacrylamlde sequencmg gel (40 cm length) containing 8 M urea As size marker for RNA length, additionally load the best RNase Tl digestlon of the fulllength antisense RNA, which you prepared m Section 3.2. Run the sequencmg gel under denaturing condltlons (see Note 10)

Fast-Hybrldizmg

Complementary

RNA

287

15 Dry the gel, and expose It to X-ray film for about 2 d 16 Fast-hybndlzmg antlsense RNA species can be Identified by their fast dlsappearante m the single-strand fraction and, correspondmgly, by their early occurrence m the double-strand fraction For quantitative analysis, 1.e , the calculation of second-order rate constants for each RNA species, see Note 11

4. Notes When constructing the plasmld for m vitro transcription of the antisense RNA, one has to pay attention so that as few as possible noncomplementary nucleotldes between the RNA-polymerase promotor and the antlsense sequences are present Additional nucleotldes may influence the kinetic behavior of the hydrolyzed antisense RNA species AddItional sequences at the 3’-end do not matter, smce they are removed by alkaline hydrolysis Parental antisense RNAs between 60 and 150 nt are sultable for the m vitro selectlon assay Target RNA should be longer than 500 nt Otherwise, you cannot separate the single-strand from the hybrid fractions by agarose gel electrophoresis. It is important to avoid degradation of the full-length RNA Work on ice unless other temperatures are mdlcated m the protocol, and wear disposable gloves all the time Special care has to be taken with the preparative agarose gel electrophoresls. Clean electrophoresls chambers and combs with a 10% SDS solution before usmg, rinse them m water, and incubate them with a 3% H202 solution for 10 mm When filling the reaction tubes with glass wool, sterilize the forceps for 10 s m the flame of a gas burner before using. It is absolutely necessary to analyze the parental antisense RNA by denaturing polyacrylamlde gel electrophoresis In the presence of degradation products, one cannot assign exactly the single RNA bands after alkaline hydrolysis. If difficulties are experienced labeling a parental antisense RNA without degradation, purification of the full-length antisense RNA by excising it out of a preparative denaturing polyacrylamlde gel 1s recommended. The optimal time for alkaline hydrolysis must be determined for each parental antisense RNA Individually Incubation times m the range of 11, 13, and 15 mm are recommended m the first experiment If unsatisfactory RNA ladders result, the alkaline hydrolysis has to be repeated with a new RNA preparation and dlffering mcubatlon times. The shorter the RNA length, the longer the mcubatlon time for alkaline hydrolysis. Especially during the alkaline hydrolysis, a major part of the RNA may adhere irreversibly to the plastic reaction tube, and as a result, you do not have enough RNA for performing an in vitro selection assay In this case, use silamzed reaction tubes for alkaline hydrolysis. For calculating second-order rate constants of the different antisense RNA species, you have to make sure that the target RNA concentration is in a significant molar excess over the sum of antisense species (i e., the concentration of endlabeled full-length antlsense RNA) in the hybridization reactions (at least more than threefold, and better if more than lo-fold molar excess)

288


7 It is recommended to perform the in vitro selection assay at least at two different target RNA concentrations Ideally, the half-life-time depends lmearly on the target RNA concentration 8. After elution of the RNA from the agarose gel slices, it is possible that the volume is too much for addmg the appropriate amount of sodium acetate and ethanol to a 1 5 mL tube If so, the pooled flowthroughs can be split between two or three tubes as necessary to permit precipitation 9 The yield of the labeled RNA fractions at the end of the assay can differ from one experiment to another. If the amount is too low, one can reduce the volume of stop buffer used to redissolve the precipitated RNA (Sectton 3.4 , step 13). 10 The denaturing gel conditions for analyzmg the RNA ladder allow detection of RNA species down to about 20 nt. On a 12% denaturmg polyacrylamide gel (m TBE) the xylene cyan01 marker comigrates with RNA of approx 55 nt. In the first gel run, try to analyze RNA species between 20 and 70 nt RNA spectes longer than 70 nt can be analyzed m a second gel run, if necessary. 11 To measure the amount of 32P-labeled RNA contained m mdividual bands, scan the dried gel by using a phosphorimager (e.g., Molecular Dynamics, Krefeld, Germany), and use the compatible software (e.g., Molecular Dynamics, Image Quant). If the target RNA is in large excess over the sum of antisense species, the reaction is of pseudo-first-order and the annealmg rate is not dependent on the concentration of the 32P-labeled antisense species. The second-order rate constant for a given antisense species k, can be calculated as follows* k, = ln2/(t,,, x conctarget)(t,,, = half-life)

(1)

12 The m vitro selection assay described uses 5’-labeled antisense RNA It is possible to perform the alkalme hydrolysis and m vitro selection assay with 3’-labeled RNA 3’-labeling of RNA with T4 RNA ligase has been described (5). The use of 3’-labeled RNA would be suitable for selecting fast-hybridmng asymmetrm hammerhead ribozymes, which associate via helix I

References 1 Wagner, E G. W. and Simons, R. W (1994) Antisense RNA control in bacteria, phage and plasmids. Annu Rev Mcrobiol 48, 713-740. 2 Rittner, K , Burmester, C., and Sczakiel, G. (1993) In vrtro selection of fasthybridizing and effective antisense RNAs directed against the human immunodeticiency virus type 1 Nucleic Acids Res 21, 138 1-1387. 3. Tabler, M., Homann, M., Tzortzakaki, S., and Sczakiel, G. (1994) A three-nucleotide helix I IS sufficient for full activity of a hammerhead ribozyme advantages of an asymmetric design Nuclerc Acids Res 22, 3958-3965 4. Sambrook, J., Fntsch, E. F., and Mama& T. (1989) Molecular Clonmg. a Laboratory Mznual, 2nd ed , Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY 5 Barrio, J. R., Barrio, M C , Leonard, N J., England, T E , and Uhlenbeck 0 C (1978) Synthesis of modified nucleoside 3’,5’-biphosphates and their mcorporation into oligoribonucleotides with T4 RNA hgase Bzochemlstry 17,2077-208 1

31 In Vitro Selection Bruno Sargueil

of Hairpin Ribozymes

and John M. Burke

1. Introduction In vitro selection methods are powerful tools for the selection of molecules with defined characterrstics from complex starting populations (1,2). We have developed a powerful m vitro selection method for analysis of the hairpin ribozyme (3-5). The selection method relies on two sequential RNA-catalyzed reactions, cleavage, and ligation (Fig. 1) In vitro selection of ribozymes, like Darwinian selection of orgamsms, proceeds through an iterative process consrstmg of three major steps: mutation, selectron of the molecules fulfillmg the selection criteria, and replication of the selected molecules. Mutations are mtroduced at specific sites in the RNA by using mixtures of DNA phosphoramidites for the solid-phase synthesis of transcriptional templates. Therefore, the experimentalist has complete control of the sites where mutations are to be introduced as well as control over the frequency of mutagenesis. In addition, random mutations can be introduced during the replication of the DNA template regeneration through the use of mutagenic polymerase chain reaction (PCR). In this method, active han-pin ribozyme variants are selected on the basis of their abihty to catalyzetwo sequential reactions, self-cleavage of RNA followed by RNA-catalyzed ligation. We refer to this as apositive selection. Addmonally, anegative selectron can be done m which molecules that have lost catalytic mncnon are replicated. The population of molecules is significantly amplified durmg two drstinct stepsof the selection protocol, PCR and in vitro transcription. Therefore, it is possible to isolate active molecules that constitute only a minuscule fraction of a highly complex starting population of RNA variants. The basic principle of the selection method is shown in Fig. 1 and outlined here. Complex populations of ribozyme variants are generated by in vitro tranFrom


Bology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

289

290

Sarguell and Burke Cloning

and sequencing

RNA catalysed

ligation

Fig. 1. In vitro selection scheme. Steps are shown for one round of m vitro selectron for both active and inactive molecules The hairpin ribozyme 1srepresented as a schematic secondary structure P 1, P2, and P3 are the primer-binding sate sequences P 1, T7P1, P2, and P3 prrmers are the primers used for reverse transcription and PCR amplrfication of the molecules (note that P2 and P3 primers are complementary to P2 and P3, respectively, whereas Pl prrmer has the same polarrty as Pl)

scription of corresponding populations of variant synthetic DNA templates. A self-cleaving construct is used, in which the S-end of the substrate 1sjoined to the 3’-end of the ribozyme through a short lmker sequence. Durrng the transcrrptron reactton, active molecules undergo self-cleavage, generating two products. The large cleavage product is derived from the 5’-end of the selfcleaving molecule and contains the S-primer-binding site (Pl), ribozyme, linker, and the S-half of the substrate, which terminates in a 2’,3’ cychc phosphate. The small cleavage product is derived from the 3’-end of the self-cleaving RNA, and contains the 3’-segment of the substrate (with a 5’-OH group) and an arttficial primer-binding site termed P2. Following gel purification of the large cleavage product, a ligation reaction is carried out using a synthetic ligation substrate. This substrate carrres a 5’-OH group and corresponds to the 3’-cleavage product, except that tt 1s linked to a new primer-binding site, termed P3. The result of these reactions is that active molecules lose primer-bmdmg site P2 and acquire a new one, P3.

Hairpin Ribozymes

291

Following the ribozyme-catalyzed reacttons, RNA 1srephcated m a threestep procedure Selected active molecules are then converted to cDNA usmg reverse transcriptase and primer P3. Substantial quantities of DNA are generated by PCR in which the downstream primer is P3 and the upstream primer (Pl) reintroduces a promoter sequence. In order to characterize the activity of the selected pool or to initiate a subsequent round of selectton, the doublestranded PCR product is used as template for transcrtption of self-cleaving RNA molecules that are sigmficantly enriched in catalytic activtty over the startmg pool. Inactive molecules can be replicated in an analogous manner using the P2 primer instead of P3. Active and inactive molecules can be replicated separately from the same starting population. The detailed composition of the RNA pool can be characterized at any point during the selection experiments by cloning cDNA molecules that have been amplified by PCR. Indivtdual clones are then characterized by sequencing and by analyzmg self-cleavage and trans-cleavage activities. The m vitro selection methods require proficiency in a wide variety of experimental methods, including solid-phase DNA and RNA synthesis, in vitro transcription, ribozyme cleavage and ligation reactions, gel purification of RNA, cDNA synthesis, PCR, molecular cloning, and DNA sequencing. Because of the large number of experimental techniques used m a selection experiment, this article focuses on methods specific to in vitro selection, and does not serve as a detailed introduction to all of the component methods (e.g., PCR, cloning, and sequencing). 2. Materials 2.1. Design and Synthesis of the Transcriptional Template: Establishing the Population of Sequence Variants 1. Custom-synthesized DNA, RNA, or mixed oligonucleotides,or accessto in-house DNA/RNA synthesisfacilities 2. 400 mA4Tris-HCI, pH 8.0 3 500 mA4NaCl. 4. 100 mM MgC12. 5. 10mMdNTP solution: dATP, dCTP, dGTP, and dTTP, each at 10mM 6 100mM Dlthrothreitol (DTT). 7 T7 DNA polymerase. 8. Ethanol. both 100 and 70% in sterile water. 2.2. Transcription and Self-Cleavage Reactions 1 Duplex DNA templatesfrom Section 3.1. 2. 20 mMNTP solution* ATP, CTP, GTP, and UTP eachat 20 mM 3. a-32P-NTP(e.g., a-32P-CTP,600 Wmmol, Amersham). 4 20 mM Spendme.

292 5. 6. 7 8. 9.

Sargueil and Burke T7 RNA polymerase. Steps 2,4, and 6 of Sectton 2 1 RNA elution buffer. 0 5 A4 ammonium acetate, 0.1% SDS, 1 mM EDTA An 8% polyacrylamide, 7 A4 urea gel wtth running buffer Ligation substrate (see Section 3.3.).

2.3. Ligation 1 2 3 4 5 6.

Reaction

Gel-purified ribozyme cleavage products from Section 3.2. 100 mMMgC1, 3 M Sodmm acetate, pH 7 0 40 mA4Tris-HCI, pH 7 5 Phenol and chloroform for nucleic acid extraction Items 4,7, and 8 from Section 2.2.

2.4. Reverse

Transcription

1 5X RT buffer 50 mMTns-HCl, pH 8 3,250 mA4KCl,50 mMDTT, and 5 mMdNTP 2. AMV reverse transcriptase (e.g., from Umted States Biochemical) 3 100 mM MgCI,

2.5. Amplification 1. 2 3 4 5 6.

Pl or T7Pl primer. 100 mA4 MgClz 500mMKCl 100 mM Tris-HCl, pH 8 3 Tuq DNA polymerase (e g., AmphTaq, Perkm-Elmer PCR machme

2.6. Analysis 1. 2 3. 4. 5.

Cetus)

of the Selected Molecules

Restriction enzymes and manufacturer’s buffers Agarase (e.g., Gelase, Epicentre Technologies). 2% low-melting agarose gel and runnmg buffer. Transcription reagents from Section 2.2. Pancreatic ribonuclease inhibitor (e.g., RNasm, Promega, Madison, WI)

3. Methods The sequence complexrty of the starting pool depends on the nature of the experiment that is designed. A limited number of nucleotides (ca. I1 7) can be completely randomized (i.e., equal frequency of all bases at each variant POW tion), whereas other positions are fixed, through the use of the “small-scale” selection protocol described below, with reasonable expectations of exploring

most of the desired sequence space. For example, we used this modular randomization approach to examme the secondary structure of the ribozyme-substrate complex (3,4,6). If more positions must be randomized, an appropriately

Hairpin Ribozymes

293

larger starting pool can be transcribed by scaling up the transcription reaction (7,8). Additional mutations can be introduced between two rounds of selection using mutagenic PCR (9). Alternatively, one can introduce random mutations into the molecule by using mtentionally contaminated (“doped”) phosphoramtdttes during template synthesis (see Note 1). Again, the researcher can choose which sites are mutated and which are not. The expected distribution of mutations is readily calculated and controlled, so that pools of molecules containing, for example, all possible single- and double-base substitutions can be generated. Mutagemc PCR can be used to introduce additional random mutations during the course of the selection experiment. One example of this latter approach is the optimization of the activity of a hairpin ribozyme targeted against a conserved HIV sequence (10). The analysis of suboptimal sequences can also be very mformative (see Note 2).

3.1. Design and Synthesis of the Transcriptional Template: Establishing the Population of Sequence Variants The starting pool of molecules is transcribed from a DNA template produced by solid-phase chemical synthesis Synthesis of the template is where the population of sequence variants is established. The design of the starting pool is critically important and must be carried out with considerable forethought. Inclusion of the essential modules described below results in a DNA template that is at least 125 nt long. This is too long for efficient synthesis as a single oligonucleotide. Therefore, we divide the sequence mto two oligonucleotides containing 3’-terminal overlaps of at least 10 nt in an invariant region. These two ohgonucleotides are annealed and converted to a double-stranded template. 1 Synthesize two 3’-overlapping DNA templates, which, when fully duplex, contam the following sequences, in a 5’ to 3’ order (Fig. 2). a A promoter for in vitro transcription. This protocol uses the 17 nt promoter for bacteriophage T7 RNA polymerase unmediately followed by two “Gs” (S-TAATACGACTCACTATA/GG3’). b A primer-binding site, designated as Pl (18-24 nt) containing a restriction site suitable for clonmg immediately downstream of a transcription promoter in your favorite plasmid vector This site should be chosen so that it will be unlikely to appear in the ribozyme sequence following one or two mutations Furthermore, this sequence and its corresponding oligonucleotide primer must be chosen so that it IS suitable for use in PCR, along with the two other primers and bmding sites used for the selection protocol In practice, this means that the primers should have a T,,, of approx 50°C and no possibility of dimerization by bmdmg to the other primer used in the PCR. In particular, complementarity at or near the 3’-ends should be avoided, because it gives rise to primer dimers in the PCR and decreases yield the of the desired products

Sargueil and Burke

294 Overlapping

Double

oligonucleotides

strand

DNA

used

template

to

generate

3’

T7 promoter

Pl

binding

T7Pl

strand

template:

to the site

,:, I site

5’ 5’

double

Site corresponding ribozyme cleavage

:

T7 RNA polymerase Restrictr imtlatlon site + IGG

5’

the

5 linker (including restriction we)

a

P2 binding

3’

p1 b

3’

site

P2

5

3’ Ligation 5’ OH

substrate P3 binding

(RNA) slte3, 5

Fig. 2. Oligonucleotides used for the in vitro selection process and schematic representation of the double-stranded DNA template used to synthesize the starting pool. The location and polarity of the oligonucleotides used for reverse transcription and for amplification are shown in reference to the double-stranded DNA template. The role of each of the oligonucleotides is described in the text. The RNA ligation substrate can be synthesized as an RNA-DNA hybrid by chemical synthesis or as an RNA by T7 transcription. TAG represent the “Tag” sequence identifying the starting pool. The restriction sites are those used to clone the selected molecules.

c. For each selection experiment, it is useful to introduce a characteristic trinucleotide sequence tag downstream of the Pl-binding site and upstream of the ribozyme. This sequence is carried along and amplified during the selection protocol, and serves as a control against PCR contamination if the same primers are used for multiple selection experiments (see Note 3). d. The ribozyme sequence, containing the desired mutations, is inserted downstream of the tag sequence. The “wild-type” ribozyme is 50 nt, but this can vary according to the demands of the particular selection experiment. e. A linker sequence is inserted tethering the 3’-end of the ribozyme to the 5’-end of the substrate. The shortest linker known to work efficiently is CCCCC (11). We have found it to be useful to introduce a unique restriction site in the linker. This enables the investigator to generate trans-acting ribozymes from selected clones. This restriction site can also be used as a control to screen plasmids for the presence of the ribozyme insert. If a restriction site is inserted, we strongly advise choosing a restriction enzyme that generates 5’-overhangs or blunt ends, because runoff transcription of 3’-overhangs generates aberrant products.

295

Hairpin Ribozymes

2. 3. 4 5 6.

f. The substrate sequence is inserted downstream of the linker If desired, the substrate can be mutated or randomized in the same manner as the ribozyme g. Finally, the template termmates with a second primer-binding site, designated P2 As for P1, thts contams a restrtctton sate utilized for cDNA clonmg and for linearizing recombinant plasmids for runoff transcription for self-cleavage assays Another unique restriction site can also be mtroduced m P2 for the same purpose This should be designed using the same considerattons described in b. and e. above Anneal 200 pmol of each of the two overlapping ohgonucleotides m 40 mMTrisHCI, pH 8,50 mM NaCl and 10 mA4 MgCI, Heat to 90°C for 1 mm, and then slowly cool to room temperature Keeping the buffer constant, add DTT to 10 nuV, dGTP, dATP, dTTP, and dCTP to 0 5 n-&each, and 8.5 U of T7 DNA polymerase. Incubate for 30 min at room temperature or at 37°C if the 3’-termmal duplex is adequately stable Precipitate the double-stranded DNA with 2 5 vol of ethanol, mtcrofuge to collect the DNA, and wash the pellet wtth 70% ethanol

3.2. Transcription

2 3 4. 5 6 7. 8

9 10 11 12 13

and Self-Cleavage

Reactions

Set up a 100-1000 pL transcription reaction containing 200 pm01 of template, 40 mMTris-HCl, pH 8.0,25 mMMgCIZ, 5 mA4DTT, 1 mMspermidme, 2-4 mM NTP, IO-50 pCi of one CX-~*PNTP (for example CX-~*PCTP) and T7 RNA polymerase (10 ug). Incubate for 3-4 h at 37°C (see Note 4) Precipitate by adding 0.1 vol of 3 MNaOAc and 2.5 vol of cold ethanol. Pellet m a mrcrofuge at 210,OOOg for 10 min, and then wash the pellet wrth 70% ethanol Redissolve m 400 pL of 40 mA4 Trts-HCl, pH 7.5 Denature the molecules for 1 mm at 90°C then add MgC12 to bring the mixture to 12 mA4 Mg*+ (see Note 5), and snap-cool on ice for 10 min Incubate for 30 mm at 37°C to permit self-cleavage to proceed to completion Precipitate the RNA as m steps 2 and 3. Electrophorese the experimental RNAs (which include active and inactive molecules) and wild-type control RNA through an 8% polyacrylamide-7 M urea gel. Leave an empty lane between samples to help avoid cross-contammatton. Use the wild-type control as a marker to cut out the gel segments that contam the cleavage products from the experimental lanes (see Note 6) Crush the acrylamide, and soak overnight at 4°C m 500 pL (two to three times the slice volume) of RNA elutron buffer Mtcrofuge brrefly to pellet the acrylamide, and transfer the supematant to a new tube. Then rinse the polyacrylamtde once with 100 pL of fresh elution buffer Combine the two supernatants Extract once with phenol and once with chloroform The RNA molecules are then precipitated by adding 2.5 vol of ethanol and storing at -20°C overnight (see Note 7)

Sargueil and Burke

296 3.3. Ligation

Reaction

The substrate for the hgation reaction contains a 9 nt RNA segment correspondmg to the 3’-cleavage product; it has a S-OH termmus. It contams a new pnmerbinding site (P3, IS-20 nt) downstream. This molecule is required m relatively large quantities, and can be synthesized by either solid-phase synthesis or m vitro transcription. If it is chemically synthesized, for ease and economy of synthesis, we make RNA/DNA hybrid oligonucleotides, in which the 5’ mne nucleotides (corresponding to substrate) are RNA and the primer-binding site is DNA. However, the substrate can also be synthesized by m vitro transcription using T7 RNA polymerase (12) using ohgonucleotides as a template (see Note 8). If one wishes to study mutations in the substrate sequences corresponding to the 3’-cleavage product, one must introduce those mutations during synthesis of the ligation substrate. Because this sequence is lost during self-cleavage, it is not posstble to do multiple-round selections of active molecules in which sequences to the 3’-side of the cleavage site are selected and then maintained in the population. 1 Estimate the amount of the gel-purified cleavage product by measuring the amount of 32P recovered 2 Resuspend to a final concentration no >O 5 @4 in 40 mM Tris-HCI, pH 7.5, and 2 mM spermidine (see Note 9) 3. Add the RNA ligation substrate to a final concentration of 3 pA4 (note that some substrate used as carrier IS already present) 4. Denature the ribozyme and substrate by heating for 1 mm at 9O’C. 5. Add MgCl* to a final concentration of 12 mM, and incubate for 30 mm on ice followed by 30 min at 4’C. 6. Gel-purify the ligated fraction on an 8% polyacrylamide-7 Murea gel as in Section 3.2., steps 8-12. Use the wild-type molecules as control and gel marker as previously. 7 Following elution, precipitate the ligated molecules, which will be present in very small quanttties during early rounds of selection, with ethanol in the presence of 100 pmol of primer P3 (see Notes 10-12)

3.4. Reverse

Transcription

The purified ligation product has the potential to self-cleave m the presence of magnesium ions. Cleavage results in the loss of the primer-binding site for P3. Consequently, the active molecules that have undergone cleavage will not be reverse-transcribed and amplified. To inhibit self-cleavage, purtfied ligation products should be kept on ice in absence of free Mg2+ as much as possible. 1 The precipitated RNA pellet is resuspended in 20 pL of 10 mMTris-HCl, 50 mA4KC1, 10 mA4DTT, and 1 mMdNTP (see Note 13) 2. Equilibrate the reaction mix at 44°C.

pH 8 3,

Hairpin Ribozymes

297

3 Add 6 U of AMV reverse transcrtptase, and then add MgCl? to brmg the reaction to a final concentratton of 5 mM MgCl, 4. Allow reverse transcrtptton to proceed for 30 mm at 4448°C (see Note 14).

3.5. Amplification Amplificatton of the selected cDNA occurs in the same reaction tube as the reverse transcrtption. 1 Maintaining the KC1 and buffer concentratrons, adjust the volume to 100 pL while adding 100 pmol of pnmer P1 (or a T7P 1 pnmer if another round of selection IS to be conducted), MgCl, to a final concentration of 2 mM, and 2.5 U of Taq polymerase No additional DTT, dNTPs, or P3 primer are required beyond what is already present 2 The cDNA IS amplified usmg a standard PCR protocol* 3 mm at 92°C then 30 cycles of 92°C for 1 mm, 55°C for 1 mm ,72”C for 1 mm, and a final incubation at 72’C for 5 min 3 Extract the PCR product wrth phenol and chloroform If another round of selectton IS going to be carried out, half of the PCR product is transcribed as m Sectton 3.2

3.6. Analysis of the Selected Molecules If the selection products are to be cloned and analyzed, the cDNA is then digested with the restriction enzymes whose sites are included in the Pl and P3 primer sequences (see Note 15) 1. Digest the cDNA wrth the appropriate restriction enzymes usmg the manufacturer’s condmons. 2. Purify the digested products on a 2% low-melting agarose gel usmg the agarosedigesting enzyme agarase following the manufacturer’s protocol. 3. Clone the DNA fragments into a plasmtd downstream of a smtable transcrtpttonal promoter (T7, SP6, or T3) using standard molecular-btology protocols (I 3) 4. Perform standard plasmtd mmtpreps. 5 To confirm clomng of the cDNAs, digest the plasmtds with the restriction enzyme whose unique site was included in the lmker between the ribozyme and substrate (see Section 3.1.). 6 To verify the self-cleavage acttvity of the selected molecules, lmeartze half of a small-scale plasmid preparation wtth a restriction enzyme present downstream of the substrate 7. Phenol-extract, chloroform-extract, and precipitate the DNA 8 Set up a 50 uL transcrtptton reaction that includes 50 mA4 Tris-HCl, pH 8.0, 20 nnI4 MgC12, 2 rmI4 spermtdme, 50 m&I NaCl, 5 mM DTT, 1 mM each of the four NTPs, 10 uCi a-32P-CTP, 0 1% Trnon X-100, 0.1 U of pancreatic RNase inhtbttor, and T7 RNA polymerase. Incubate for 3 h at 37°C 9 Analyze the radiolabeled transcription product on an 8% polyacrylamtde-7 M urea gel. The extent of cleavage permits a rough esttmation of the relative acttvrty of the selected clones 10 A fifth of the small-scale plasmrd preparatron can be used for DNA sequence analysts

298

Sargueil and Burke

4. Notes 1 Custom mixtures of DNA and RNA phosphoramltldes that have been prepared to the user’s speclficatlons can be obtained from Glen Research. This permits more accurate control over the composltlon of starting pools of molecules than 1stypltally obtained by manual mixing or by programming the synthesizer. 2. Relatively homogeneous populations of optimized rlbozymes may m many cases be obtamed after approximately five rounds of selection However, It IS also highly informative to look at suboptlmal sequences, obtained after one or two rounds of selection 3 As for any PCR experiment, contamination can be a problem if care is not taken Normal precautions and controls are sufficient to avoid this problem (14) In addition, it is useful to design two downstream primers and ligation substrates (P3 sequences) and to use them alternately during successive rounds of a multiple-round selection experiment As an extra precaution, we routinely introduce unique short code sequences (trinucleotide sequence tags) immediately upstream of the rlbozyme during template synthesis. 4. Under these condltlons, most of the molecules with moderate to high levels of activity will self-cleave during transcription To ensure relatively complete selfcleavage of active molecules, the transcription mix IS subjected to a cleavage reaction after precipitation. 5. The MgC$ added can be up to 50 mMMg*’ if one wishes to recover molecules with relatively low activities 6 During the first rounds of selection, the active molecules represent a minor fraction of the RNA that cannot be readily detected (3). To localize the cleaved fraction and to monitor all the steps, a mock selection process 1scarried out m parallel using a wild-type construct identical m length to the pool Extreme care must be taken to avoid contamination of the experimental sample by the positive control during all steps of the protocol, from ohgonucleotide deprotectlon through PCR, transcnptlon, and gel purlficatlon 7 Because the active fraction IS likely to represent only a very few molecules durmg early rounds of selection, preclpltatlon IS facilitated using carrier We prefer to use 3 pg (ca. 300 pmol) of the RNA hgatlon substrate (see Section 3 3 ) Note that all of the purification steps are carried out on Ice. If desired, inactive molecules can be recovered from the same selection by using the same protocol, but to generate cDNA for the inactive fraction, proceed directly to the reverse transcription (Section 3 4.) using primer P2 8. RNA ligation substrate generated by transcription must be dephosphorylated, since a 5’-OH terminus is required for ribozyme-catalyzed ligation. This 1s achieved by mcubatmg the RNA with 1 U of calf intestinal alkaline phosphatase (e.g., Boehringer Mannheim)/SO pmol of RNA m 50 mA4Tris-HCl, pH 8.5,0.1 mM EDTA for 1 h at 50°C. 9 The concentration must be no >O 5 @to avoid rlbozyme dlmerlzatlon (81. 10 The cleavage and ligation reaction conditions described here are commonly used, but are not essential. Virtually all parameters may be changed to select for a par-

Hairpln Ribozymes

11

12.

13 14.

15.

299

ttcular property of the rtbozyme, or to regulate the stringency of the selection The hgatton step IS the primary determinant of the level of stringency m the selectton process. For example, Joseph and Burke (10) increased ligation stringency by reducmg magnesium concentratton to 0.05 mM and reaction time to 5 mm One can tmagme, for example, designing selecttons for a ribozyme able to react with a chemically modified substrate or operating in a very different buffer composmon The mvesttgator has less control over reaction stringency during cleavage than during hgatlon, smce self-cleavage proceeds during the transcrtptton. Self-cleavage can be diminished by mnnmtzing magnesium concentration during transcription. At the ligation step, strmgency can be Increased by. a Decreasing the concentration of the hgation substrate, b Decreasmg the magnesium concentration; and/or c Decreasing the reaction time. In theory, this means that molecules isolated from multtple rounds of selection have been primarily selected for ligation activity. In practice, however, we have always found that ligation activity correlates with cleavage acttvtty During early rounds of selection, it is common to recover false posmves among the pool of “active” molecules, 1 e , molecules that have acquired P3, but that prove to have no self-cleavage activity. These probably result from trans-reacttons catalyzed by active molecules in the same pool. Contammation of the pool of active molecules with such false posmves can be diminished to some extent by minimizing RNA concentratton during the self-cleavage and ligation steps Note that KC1 inhibits rtbozyme acttvtty to some extent (IS) and that the P3 primer has been added during purification of the ligated molecules. Note that the rtbozyme activity decreases wrth temperature over 37°C Therefore the reaction should be carried out at the highest temperature at which the reverse transcrtptase preparation works effictently. Exactly the same protocol can be used to characterize the populatton of macttve molecules, by simply substitutmg the P2 primer for the P3 prtmer m the reverse transcrtptton and PCR steps

Acknowledgments This work was supported by research grants AI29829 and A130534 from the Natlonal Institutes of Health. References 1. Szostak, J W (1992) In vztro genetics. Trends Blochem Scz 17, 89-93 2. Joyce, G. F (1992) Directed molecular evolution Scz Am. 267,90-97 3 Berzal-Herranz, A., Joseph, S , and Burke, J M (1992) In vztro selection of active hairpin ribozymes by sequential RNA-catalyzed cleavage and ligation reactions Genes Dev 6, 129-134 4. Berzal-Herranz, A , Joseph, S , Chowrna, B. M., Butcher, S. E , and Burke, J. M (1993) Essenttal nucleotide sequences and secondary structure elements of the hanpm rtbozyme EMBO J 12,2567-2574

300

Sargueil and Burke

5 Burke, J M (1994) The hairpin ribozyme Nuclex Acids Mol B~ol. 8, 105-l 18 6. Joseph, S., Berzal-Herranz, A , Chowrtra, B. M., Butcher, S. E., and Burke, J M (1993) Substrate selection rules for the hairpin ribozyme determmed by zn vztro selection, mutation, and analysis of mismatched substrates. Genes Dev 7, 130-138. 7. Zaug, A. J , Grosshans, C. A., and Cech, T R. (1988) Sequence-specific endoribonuclease activity of the Tetrahymena ribozyme. Enhanced cleavage of certain ohgonucleotide substrates that form mismatched ribozyme-substrate complexes. Blochemlstry 27, 8924-893 1. 8 Butcher, S. E. and Burke, J. M (1994) A photo-cross-lmkable tertiary structure mottf found m functionally distmct RNA molecules is essential for catalytic function of the hairpin ribozyme. Brochemistry 33,992-999. 9 Cadwell, R C. and Joyce, G. F (1992) Randomization of genes by PCR mutagenesls PCR Methods Appl 2,28-33 10. Joseph, S. and Burke, J M. (1993) Optimization of an anti-HIV hanpm rtbozyme by zn v&-o selection J Blol Chem 268,24,5 15-24,5 18. 11. Feldstem, P. A. and Bruemng, G. (1993) Catalytically active geometry m the reversible ctrculartzation of “mim-monomer” RNAs derived from the complementary strand of tobacco rmgspot virus satelhte RNA Nuclezc Aczds Res 21, 1991-1998 12 Milligan, J F. and Uhlenbeck, 0 C. (1989) Synthesis of small RNAs using T7 RNA polymerase Methods Enzymol 180, 5 l-62. 13 Sambrook, J , Frisch, E F., and Maniatis, T. (1989) Molecular Clonzng A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY 14 Ausubel, F M., Brent, R , Kmgston, R E , Moore, D D , Seidman, J G , Smith, J A , and Struhl, K. (1992) Current Protocols in Molecular Bzology Wiley, New York 15. Chowrira, B. M., Berzal-Herranz, A , and Burke, J M. (1993) Ionic requirements for RNA bmdmg, cleavage, and hgatton by the hairpin ribozyme. Blochemlstry 32,1088-1095

32 The Detection of Hammerhead Ribozyme Cleavage by R%PCR Methods Rhonda Perriman 1. Introduction There are several methods available for the direct and indirect detection of hammerhead nbozyme-mediated cleavage of substrate RNAs m vlvo. The Indirect methods include the use of antisense and/or mutant ribozyme constructs to differentiate between inactivation by cleavage and inactivation by other means. In addition, comparison between a wild-type substrate and a mutant substrate, in which the target triplet has been altered to be a non-cleavable sequence, can provide indirect evidence for m vlvo cleavage. The direct approaches (listed in increasing levels of sensitivity) include RNA analysis by Northern blot, RNase protection assays,and reverse transcnptase-PCR (RT-PCR) (but see also Chapters 33 and 34). To date there has only been one report of the direct analysis of cleavage products by Northern blot (I), and one group have successfully applied RNase protection assays(2-4). The more general approach has been to employ RT-PCR (5-10). In this method, primers are designed to amplify from the target RNA, one fragment spanning the cleavage site and another from one side of the cleavage site. The ratio of these two products (product 1 and product 2--see Fig. l), as compared to those from RNA isolated from controls (such as substrate only, substrate + antisense or inactive nbozyme) gives an indication of in vlvo cleavage. Since this method generally mvolves the use of a cDNA made using oligo-dT primers, only the accumulation of the 3’xleavage product is analyzed (see Fig. 1). It should also be noted that since the cleavage products are probably less stable than the uncleaved substrate RNA, they will be present m a lower abundance than the homologous uncleaved sequences. This means that the ratio of prodFrom

Methods m Molecular Edlied by P C Turner


301

Pemrnan

302 Rz target I

site

Reverie transcribe mRNA usmg ohgo dT-TAG pruner Rz target 3’

4

.

.

. .

.

.

. .

.

.

. t

. .

site . .

.

.

.

. m .

.

..L.......

s

. .

.

. .

.

.

.

.

TTTTTTn

TAG

. .

1--

-__c

primer la (47O-l66)

pnmer 1 (198.216)

PCR amphticatmn I+2 oria+Zpnmers

5’

*rfmar 2 (TAG)

ustng

3 6

5’ 3’

-_--.1.-...--....--.--......--.

AAAAAAAA. TTTTTTTT

3 5

Fig. 1. Schematic representation of reverse transcription and PCR analysis of ribozyme-derived cleavage products from a specific substrate RNA. The ratio of product 1 product 2 ~111be reduced m the presence of the rlbozyme when compared with nonnbozyme-containing controls.

uct 1:product 2 (see Fig. 1) should only be taken as evidence of m vivo cleavage occurrmg, not an accurate measurement of the percentage cleavage. This chapter will detatl the protocol for the analysis of m vivo cleavage products of a spectfic substrate RNA using RT-PCR. This method has been successfully used for the analysis of cleavage products derived from chloramphenicol acetyltransferase (CAT) mRNA in tobacco protoplasts (IO). Areas within the protocol that may require adjustments for other target RNAs ~111be discussed. 2. Materials

2.7. Preparation of RNA Samples The use of autoclaved tubes and reagents and wearing of gloves are strongly recommended when working with RNA. Although DNA present m the RNA samples should not cause mts-priming during the RT reaction (owing to the

Hammerhead Ribozyme Cleavage

303

use of the olrgo-dT primer), it may cause variation when determining the RNA concentrations in each sample. For this reason, we recommend treating the RNA samples with DNase (RQl) prior to carrying out the reverse transcription. 1 DNase (RQI from Promega, Madison, WI)* store at -20°C, and mamtam on ice 2 RNasm (Promega) store at -20°C and maintain on ice 3 10X DNase buffer 50 mMTns-HCl, pH 8 0,50 mMNaC1,lO mA4MgCl,, 100 mA4 DTT Store at -20°C 4 Phenol (H,O-saturated). chloroform: isoamyl alcohol (24.24: 1). store at 4°C. 5 Chloroform isoamyl alcohol (24.1) store at 4°C 6 3.6 M LiCl. store at 4°C. 7 3 MNH,-acetate: store at 4°C 8 Ethanol (store at-20°C) and 3 MNa-acetate, pH 6.0 (store at room temperature).

2.2. Reverse Transcription All reagents listed should be stored at -20°C. In particular, components m steps 3, 5, and 6 should be maintained on ice when m direct use and rapidly returned to -20°C. 1 5X RT buffer: 250 mMTns-HCl, pH 8.3,375 mMKCl,15 mMMgCl,, 5 mMDTT. 2 10 mM Deoxynucleottde triphosphates (dNTPs)* diluted from 100 mA4 solutions (e.g., Pharmacia Biotech, Uppsala, Sweden). 3 RNasin from Promega 4 0.5 pg/pL ohgo-dT primer. the primer used here comprised 25 dTTP bases plus an 18-base unique sequence (optional--see Note 1 and Fig. 1) at the 5’-end 5. SUPERSCRIPTTMreverse transcriptase (Ltfe Technologies, Gaithersburg, MD) 6 Total RNA at 0 5 mg/mL At a minimum, this should include RNA preparations from tissue-expressmg substrate +/- nbozyme. In addition, substrate +/- antisense or mactive ribozyme, or mutant substrate +I- ribozyme, antisense, or inactive rtbozyme will provide further evidence for m viva cleavage (see Note 2)

2.3. PCR Reaction and Analysis 1 PCR primers: 18-20 bases m length at 0.15 pg/pL (Primers equivalent to primer 1, la, and 2 m Fig 1 are required) (see Notes 3 and 4). Store at -20°C 2 10X PCR buffer: 500 mMKCl,200 mMTris-HCl, pH 8.4,25 mMMgCl*. Store at -20°C 3 Tuqpolymerase 5 U/pL (Perkm-Elmer Cetus, San Jose, CA). store at -20°C 4 10 r&4 dNTPs (as in Section 2 2.): store at -20°C 5 Agarose 6 1X TBE buffer: 80 mMTris-borate, pH 8.3,4 mMEDTA. 7 Denaturing buffer 1 5 MNaCl, 0 5 MNaOH. 8. Neutralizing buffer: 1.5 MNaCl, 1 M Tris-HCl, pH 8.3

9. Hybond N+ membrane(Amersham,Buckinghamshire,UK). 10 10X SSC buffer: 1 5 M NaCl, 0.15 M trtsodmm citrate, pH 7.0

304

Perriman

11 Hybridtzatton buffer. 50% formamide, 7% SDS, 0.25 mM NaH,PO,, 1 mM EDTA, 0 25 MNaCl 12 a-32P-dCTP-labeled probe (e.g , DNA fragment labeled using multiprime kit, Amersham) 13. Rinse buffer. 2X SSC, 0.1% SDS 14 Wash buffer. 25 mM NaH2P04, 1 mMEDTA, 1% SDS 15 Kodak (Rochester, NY) XAR film and/or phosphortmager (e.g , Molecular Dynamics, Sunnyvale, CA)

3. Methods 3.1. Preparation

of RNA Samples

1 For each RNA sample, combme the followmg: RNA (30-40 pg) m 84 pL of H20, 10 pL of 10X DNase buffer, 2 pL of RNasm, and 4 pL of RQl DNase 2 Incubate at 37’C for 30 mm 3 Add an equal volume of phenolchloroformisoamyl alcohol (24 24 l), and vortex mix for I mm 4 Microfuge for 5 mm at >lO,OOOg, and remove the top aqueous phase to a new tube 5 Re-extract with an equal volume of chloroform. isoamyl alcohol (24.1) 6 Take the aqueous phase, and add 200 pL of 3 MNH4-AC and 900 pL of 3 6 M LiCl Incubate on ice for at least 1 h 7 Microfuge at > 10,OOOgfor 10 min (at 4°C) 8 Discard supematant, and resuspend the pellet m 100 pL of H20 9. Reprecipitate RNA in 3 vol of ethanol and 0 1 vol of 3 M Na-Ac 10 Wash the pellet with 10% ethanol, dry briefly (under vacuum), dissolve, and determine the RNA concentration by reading the optical density at 260 nm (see ref II) 11 Finally, resuspend RNA at a concentratton of 0 5 mg/mL

3.2. Reverse

Transcription

1 Mix, in a final volume of 10 I.& 1 pg of total RNA (see Note 5) and 0 5 pg of oligo-dT prtmer 2 Incubate for 5 min at 65°C and quick-chill on ice. 3. Add 10 pL of 5X RT buffer, 1 pL of RNasm, 2 5 pL of 10 mM dNTPs, 100 U of SUPERSCRIPTTM reverse transcriptase, and H20 to 50 pL (see Note 6) 4. Incubate at 37”-50°C depending on the RNA (see Notes 7 and 8) for 1 h 5 Ddute to 200 pL with H20. This reaction can be stored at -20°C for several weeks.

3.3. PCR Reactions and Analysis 3.3.1. Determining the Exponential Range of Amplification The first step m the PCR reactions IS to ensure that the PCR amplification IS m the exponential range of amphficatlon. For this, six identical PCR reactions are set up and removed at designated cycles for analysis by agarose gel electrophoresls.

Hammerhead

Rlbozyme Cleavage

305

1 Using the cDNA derived from total RNA expressing substrate only, set up the followmg PCR reaction m SIX Identical lots (it is important to use microfuge tubes specifically designed for use in the PCR machine) 20 pI. of cDNA (see Note 9), 2.5 pL of primer 1, 2.5 pL of primer 2, 1 pL of 10 mM dNTPs, 5 pL of 10X PCR buffer, 18 5 p.L of H,O, and 0 5 pL of Tuq polymerase. 2 Set the PCR machme for the desired cycle conditions (see Note 10) taking mto account the theoretical meltmg temperature of the primers The optimum cycle conditions for the specific target sequence (i.e., CAT mRNA) and primers used here were. 1 cycle of 94°C for 1 min, 52’C for 2 min, 72°C for 10 mm + 25 cycles of 94°C for 1 mm, 52°C for 2 min, 72°C for 3 min. In addition, program the PCR machine so that it pauses after cycle 10, 15, 20, 25, 30, and 40 At each pause, remove one PCR reaction and store at 4°C 3 Analyze 10 pL of each PCR reaction by loading on a 1.5% agarose gel (this will vary depending on the expected product size-see ref I I) and stammg with 0.5 pg/mL ethtdium bromide Visualize under UV light and photograph. 4. The optimum cycle number is determined by analyzing the relative mtensmes of ethidmm bromide staining for each amplification product. The cycle number that corresponds to the ampllflcation product within the exponential range is selected by taking the reaction showing increasing product accumulation. It is important to select a cycle number that sits both before and after reactions showing mcreasing product accumulation to ensure the selected conditions are within the exponential range (see Notes 1 l-13). 5 Use the selected cycle number for the subsequent PCR analysis of cleavage products

3.3.2. PCR Analysis of Cleavage Products Having determined the PCR condttions for the exponential amplrfication of the designated target RNA, we can now analyze for cleavage products by including the cDNA made from RNA from tissue that is expressing substrate RNA + ribozyme (and other appropriate controls--see Note 2). Two PCR reactions are run concurrently for each independent cDNA (see Fig. lj-cme

reaction 1sdesigned to amplify from full-length message (and thus represents uncleaved product only-product 1), whereas the second amplifies from message 3’ of the ribozyme target site (representing both cleaved and uncleaved target RNA-product 2). The ratio of product 1:product 2 should approximate 1 m all cases. However, tf in vivo cleavage is occurring, the ratto from the cDNA-expressing substrate + ribozyme will be reduced. 1 For product 1 amphfication-for each independent cDNA, mix together components as listed in step 1 of Section 3.3 1 2. For product 2 ampl~fication--concurrently, for each cDNA, set up a second set of PCR reactions, identical to those for step 1, but replacing primer 1 with primer 1a 3. Carry out PCR reactions using the conditions determined m Section 3.3.1.) and store at 4°C.

Pemman

306 3.3.3.

Determrnrng the Ratro of PCR Products

The most accurate means of determming the ratio of product 1: product 2 IS by agarose gel electrophoresis, Southern blottmg, and hybrtdizatron (1 I) using 32P-labeled probe. 1 Load, run, and visualize PCR reactron products as described m step 3 of Sectton 3.3.1 2 Denature the DNA by placmg the agarose gel in 1 5 MNaCl 0.5 MNaOH for 40 min at room temperature 3 Rinse briefly m H20 and neutrahze the gel m 1 5 MNaCl, 1 MTrts-HCI, pH 8 3, for a further 40 mm. 4. Transfer the DNA to Hybond N+ m 10X SSC buffer usmg the wtck method (1 I) of transfer 5. FIX the DNA to the membrane by UV crosslmkmg at 1200 m for 100 s 6. Prehybrldrze in 10 mL of hybridization buffer by gently shaking at 42°C for at least 2 h 7 Prepare radroactlve DNA probe correspondmg to the cDNA of the target RNA (e.g , usmg an Amersham multtprime kit as per manufacturer’s specifications). 8 Denature the DNA probe at 100°C for 5 mm. 9 Pour off prehybrtdizatton mix, and replace with 10 mL of fresh buffer 10 Add approx 1/5of the denatured DNA probe, and hybrldtze by gently shaking at 42°C ovemtght. 11 Rinse the membrane briefly m 2X SSC, 0 1% SDS 12 Wash twice m wash buffer at 60°C for 20 min 13 Vtsuahze the bands by autoradtography. 14 Quantify radioactivity m each product 1 and product 2 band from each cDNA using a phosphortmager 15 Determme the ratto of radtoacttvtty representmg product 1. product 2 for each independent cDNA (see Note 14). 4. Notes 1 Although it may seem more desirable to use a sequence-spectfic primer for the reverse transcriptton, this can lead to problems with priming from minute amounts of contaminating DNA (DNase treatment IS not 100%). Thts can be overcome by carrying out the RT reaction using an oligo dT-prtmer. We use an ohgo dT-primer that has an 18 nt unique sequence at the 5’-end Subsequent PCR reacttons are primed from this sequence (see Fig 1). 2 We cannot stress enough the importance of controls m the mterpretatlon of RT-PCR analysts of cleavage products. As a mmtmum, it IS essential to have RNA Isolated from tissue expressmg substrate RNA alone and substrate RNA + rrbozyme. More destrable 1s also to include RNA isolated from tissue that IS expressing substrate RNA + macttve ribozyme and/or substrate RNA + antisense. 3 The use of a computer program to analyze potential primers IS recommended Such programs ~111 raprdly determine the theoretical meltmg temperature (r,)

Hammerhead

4

5

6.

7.

8.

9. 10

11.

Ribozyme Cleavage

307

for individual primers enabling the selection of annealing temperature during the PCR reactions. In addition, these programs can identify false primmg sites, potential hairpin formations, and primer dimers-any or all of which can dramatically affect the results of a quantitative PCR It IS wise to select prtmmg sites for primers 1 and la (see Fig l), which will amplify products that vary in length by no more than 200-300 bp, and measure ~1 kb m total length. Some workers have reported a weak correlation between the length of the product and its reduced amphtication (12), although others have suggested no observable difference (13). Also, to analyze for in vivo cleavage, primer 1a must be designed to anneal 3’ of the ribozyme cleavage site The relative concentratton of total RNA m the RT reaction may need to be altered, dependmg on the esttmated abundance of the substrate message One microgram 1s a good starting point If desired, the eftictency of the RT reaction can be monitored by substituting one of the dNTPs wtth a32P-dNTP Incorporation of this radtonucleottde during reverse transcription provides a guide to the efficiency of the reaction Incorporation can be assayed either by analysis on a gel and subsequent exposure to X-ray film or determmmg TCA-precipitable counts The RT temperature may need to be Increased dependmg on the length of the substrate RNA and whether it contains strong secondary and/or tertiary structures (SUPERSCRIPTTM II works well at temperatures between 37” and 50°C); 45’C worked best for CAT mRNA. As far as we have been able to ascertain, the conditions used for reverse transcrtptton do not allow in vitro cleavage. This was determined by “spikmg” m m vitro transcripts of both substrate and ribozyme RNAs, at a concentrationJudged to be approximately equal to the m vtvo-derived message, and carrying out analogous RT-PCR reactions The quantity of the cDNA used m the PCR can also vary for different substrate RNAs. Usually it is not necessary to use more than %-‘/is of the diluted cDNA reaction. The selection of the PCR amplification conditions is likely to be the greatest area of substrate-to-substrate variation Although the condrtions listed m this protocol were ideal for detecting CAT mRNA dertved from an autonomously replicatmg viral-based vector (and expressed usmg the endogenous viral coat-protem promoter-see IO), they may be inappropriate for other substrate RNAs. If no signal is obtained using the conditions listed here, two rounds of amphtication may be required. For this, I would recommend taking a reaction after 25 cycles, ethanol/ 3 MNa-acetate precrpitatmg and reamplifymg for another 25 cycles. For further information, there are several excellent books available contaming hints for PCR amplification (e.g , 14) Once a substrate mRNA-derived signal has been obtained, establishing that the PCR reaction IS m the exponentral range of amplification is essential for the analysis of ribozyme-derived cleavage products, since the process relies on a ratio between two independent amplification products from several independent sources of

308

Perriman

RNA These condttrons ~111 vary considerably depending on the type of PCR machme and the sequence of the substrate mRNA. For this reason, it is essential to carry out this step for each independent target mRNA bemg analyzed. 12, Another cntrcal aspect to address is mmrmizmg tube-to-tube vanatron We recommend the removal of contaminating DNA from RNA samples and the accurate determmatron of RNA concentratron pnor to carrying out the RT reaction. In addition, producing a master mix of components for the reverse transcnptron and the PCR reaction (1 e., excluding the RNA and cDNA components, respectively) can also mmrmaze the ptpetmg error often assoctated with ahquotmg multiple small volumes 13 Once the RT and PCR conditions have been established, tt IS essential to mamtam them for the duration of the analysis of cleavage products for a specific substrate RNA 14 To ensure the accuracy of results, this process of analysis of cleavage products usmg RT-PCR should be repeated a minimum of three times using independent sources of RNA

References 1. Saxena, S. K and Ackerman, E. J. (1990) Ribozymes correctly cleave a model substrate and endogenous RNA In vlvo. J Blol. Chem 265, 17,106--17,109 2 Stemecke, P., Herget, T., and Schreier, P. H (1992) Expression of a chtmerrc rtbozyme results m endonucleolyttc cleavage of target mRNA and a concomttant reduction of gene expressron in VEVOEMBO J 11, 15 15-l 530. 3 Stemecke P , Steger, G , and Shreter, P H (1994) A stable hammerhead structure 1snot required for endonucleolytic activity of a rrbozyme zn vzvo Gene 149,47-54 4 Wegener, D , Stemecke, P., Herget, T , Petereit, I., Phthpp, C , and Schrerer, P H (1994) Expression of a reporter gene is reduced by a nbozyme in transgemc plants Mel Gen Genet 245,465-470 5 Cantor, G. H , McElwam, T F , Brrkebak, T A , and Palmer, G H (1993) Rrbozyme cleaves rex/tux mRNA and mhtbrts bovine leukemia virus expression Proc Nat1 Acad Scz USA 90, 10,932-10,936 6 Dropuhc, B , Lin, N H , Martin, M A., and Jeang, K T (1992) Functional charactertsatron of a U5 ribozyme. intracellular suppression of human mrmunodefictency vu-us type I expression. J Vwol. 66, 1432-1441 7 Sarver, N., Cantin, E. M , Chang, P S , Zaia, J A, Ladne, P A , Stephens, D A , and Ross:, J J (1990) Rrbozymes as potential anti-HIV-1 therapeutic agents Scrence 247, 1222-1225. 8. Scanlon, K J., Ishrda, H., and Kasham-Sabet, M (1994) Ribozyme-mediated reversal of the multidrug-resistance phenotype Proc Nat1 Acad Scr USA 91, 11,123-l 1,127. 9 Potter, P. M , Harris, L. C , Remack, J S , Edwards, C. C , and Brent, T P. (1993) Ribozyme-mediated modulatron of human 06-methylguanme-DNA methyltransferase expression Cancer Res 53, 173 1-I 734 10. Perrtman, R., Bruemng, G. B., Denms, E. S., and Peacock, W. J (1995) Efficient rrbozyme delivery to plant cells. Proc Nat1 Acad Scr USA 92,6175-6 179

Hammerhead

Ribozyme Cleavage

309

11 Sambrook, J , Frttsch, E F , and Mamatrs, T. (1989) Molecular Clonzng A Laboratory Manual Cold Sprmg Harbor Laboratory, Cold Spring Harbor, NY 12 Golde, T E., Estus, S., Uslak, M., Younkm, L H., and Younkm, S. G. (1990) Expression of /3-amylotd protein precursor mRNAs. recognmon of a novel alternatively spliced form and quantitation m Alzhetmers disease using PCR Neuron 4,253-261

13 Chelly, J., Kaplan, J. C., Mane, P , Gautron, S., and Kahn, A. (1988) Transcription of the dystrophm gene m human muscle and non-muscle ttssues Nature 333, 858-860. 14 Inms, M. A., Gelfand, D H , Snmsky, J J , and Whtte, T. J. (eds.) (1990) PCR Protocols A Gmde to Methods and Appllcatzons Academic, San Diego, CA

33 Detection of Ribozyme Cleavage Products Using Reverse Ligation-Mediated PCR (RL-PCR) Edouard Bertrand, Micheline Fromont-Racine, Raymond Pictet, and Thierry Grange 1. Introduction Among the multiple publications that describe the use of rrbozymes to knock out gene expression, only a few have directly proven that the rrbozymes were catalytically active m VIVO(I-.?) Most studres rely on mdirect evidence, such as a decrease m the level of the target RNA, and the compartson of the ribozyme with a mutant version that has lost cleavage activity. However, demonstratton of the m VIVOactrvrty of a rtbozyme requires detection of its cleavage products. For example, a rtbozyme hybridized to its target RNA could promote its degradation mdrrectly, through cellular, double-strand specific RNases (4). Furthermore, a mutant rtbozyme could be inactive for reasons independent of the loss of catalytic actrvrty (e.g., the mutation could induce a change m the 3-D structure of the rrbozyme, resulting in less efficrent hybridization to the target RNA). Most investigators report that rrbozyme cleavage products are undetectable by classical techniques, such as Northern blot or RNase protectron assays(5). We have solved this problem by developing a method sensitive enough to detect, with the precision of one nucleotrde, single or multiple 5’-ends resulting from the cleavage of a partrcular RNA, even when this RNA is highly diluted wlthm a complex RNA populatron, such as that of a mamrnahan cell. This method, reverse ligation-mediated PCR (RL-PCR; 6), uses the power of PCR ampltficatron, and is therefore extremely sensitive and specific for the RNA to be analyzed. Conventronal PCR requires that the sequences at both ends of a region to be amplified be known, and therefore PCR amplification of a population of molecules that have one unknown and variable end necessitates an alternative strategy. Mueller and Wold have developed such a strategy that is From

Methods Edlted

by

m Molecular

Bfology,

P C Turner

Humana

311


Inc , Totowa.

Protocols NJ

Bertrand et al.

312 Total cellular RNA S’OH p

3’

5’Gppp p

3’

s-m II Phosphorylatlon of the 5’-OH ends

T4 polynucleotlde I

5’ P p

klnase

3’

~‘GPPP p

3’

s-w

2

RNA linker 5’ PPP ++Y\ + T4 RNA hgase

Addmon of a RNA hnker to all available 5’-P RNA ends 5’ ppp /\ha*p

I

3’ 3’

5’Gppp p s-w 3 Synthesis of a cDNA complementary to the analyzed RNA L 5’ PPP N*, 3’ -5’ 5’Gppp p

Primer 1 3’45’ + AMV Reverse Transcnptase 3’ 3’

S-VW 4 PCR amplification and labeling of the cDNA

Linker primer

I

5’ --+

3’

Labelled prher 2 3’ C-&5’ + Taq DNA polymerase

~:,zx~f& 1 Sequencing

gel

Fig. 1. Schematic descrlptlon of the RL-PCR procedure (modified from ref. 6). RNA molecules are represented as wavy lines and DNA molecules as straight lines. The RNA linker, its DNA counterpart, and its complementary strand are represented by dotted lines Primers 1 and 2 are represented by thick lines

appropriate when DNA is the starting material (7). It relies on the ligation to the unknown end of a lmker of discrete length and base compositlon. This provides a DNA template suitable for exponential amplificatton with preservation of single-base resolution. RL-PCR utilizes a similar ligation strategy, but allows for the use of RNA as the startmg material. It 1s schematized in Fig. 1. Starting from total cellular RNA, there are four steps: 1. Phosphorylation of the 5’-OH ends of the total RNA using T4 polynucleotlde kmase. This is necessary to allow ligation of the RNA lmker, since rlbozyme cleavage products have 5’-OH terminl,

RL-PCR

313

G A G

/

Fig. 2. Detection of ribozyme cleavage product using RL-PCR (modified from ref. I). The analysis was performed using total RNA from cells transfected with various expression vectors. No Rz: RNA from cells expressing only the target RNA. Rz: RNA from cells expressing both the target RNA and the ribozyme (the arrow indicates the ribozyme cleavage product). No Targ: RNA from cells expressing neither the target nor the ribozyme. G and A > G: total RNA from cells expressing the target subjected to chemical sequencing (8). The sequence of the target is written on the left, and the phosphodiester bond cleaved by the ribozyme is marked with a star. 2. Nonspecific ligation of an RNA linker to all available S-P ends using T4 RNA ligase; 3. Specific synthesis of a cDNA complementary to the RNA region to be analyzed by extension of a primer (primer 1) using AMV reverse transcriptase; and 4. PCR amplification of the cDNA and labeling of the PCR products.

The cDNA is amplified using two DNA primers, one that is radiolabeled and specific for the sequence to be analyzed (primer 2, nested with respect to primer l), and one that corresponds to the RNA linker (linker primer). The PCR products are then analyzed on a sequencing gel. The positions of the 5’-ends are determined either by comparison with an RNA sequence ladder (8), also amplified using RL-PCR (Fig. 2), or by direct sequencing of the purified product. Other detection methods derived from RT-PCR use ligation or tailing of an anchor to the end of a synthesized cDNA (9-I 1). Attachment of an anchor to the 3’-end of a cDNA results in amplification of products representing both the full-length mRNA and smaller molecules that are a consequence of arrested elongation during the reverse transcription step. Such undesired amplification can titrate away the primers and can generate spurious bands, which may interfere with the detection of cleavage products, particularly if they are much less abundant than the intact RNA species analyzed. RL-PCR avoids these problems because the linker is ligated to the 5’-phosphate ends of an RNA: the fulllength mRNA will not be amplified because of the cap at the 5’-end, and the

314

Bertrand et al.

mcomplete cDNAs will not be amplified because they do not contain a copy of the linker sequence. RL-PCR is not only useful for the detection of rrbozyme cleavage products (I), but has also been used for the mapping and clomng of the 5’-termun of mRNA (22), and for in vivo footprmtmg analysis of RNA-protein mteracttons (6)

2. Materials All materials and chemicals used m molecular biology should be considered to be a potentral health hazard. Particular care should be taken during the handling of phenol, polyacrylamtde, formamide, drethylpyrocarbonate (DEPC), and radtotsotopes. All reagents are prepared and all reactions are performed using drstrlled water (dH,O) that has been treated with DEPC and autoclaved (Z3) Reaction buffers, nucleottde and olrgonucleotrde solutrons, and enzymes are stored at -20°C Synthetic oltgonucleotrdes are purified on a 10% sequencmg gel, followed by reverse-phase chromatography on a Sep-Pack C 18 column (Waters, Milford, MA) as described (13, see also Section 3.1.1.).

2. I. Reagent Preparation 2.1.7. Synthesis of the RNA Linker 1 Two synthetic olrgonucleotrdes that, after annealing, form a hemrduplex, allowmg synthesis of the RNA linker by m vitro transcription wrth T7 RNA polymerase (14) the sequences of the ohgonucleotides we use are. Top = 5’-TAATACGACTCACTATAG-3’, and Bottom = 5’-TTTCAGCGAGGGTCAGCCTATGCCCTATAGTGAGTCGTATTA-3’ These ohgonucleotrdes allow synthesis of an RNA linker with the followmg sequence* S-GGGCAUAGGCUGACCCUCGCUGAAA-3’. This sequence gives satrsfactory results, and we have not tried to modify it The first three bases are G residues to allow for efficient lurker synthesis, whereas the last three bases are A residues to increase ligation efficiency by T4 RNA hgase (6) The rest of the sequence was chosen arbitrarily The 5’-end of the lurker IS a 5’-ppp, which cannot be used as a donor in the hgatron reactron, thus avordmg homopolymenzatron (6) 2 10X Annealing buffer 100 mA4Trrs-HCl, pH 8 3, 50 mMMgC1, 3. 10X Transcrrptron buffer: 400 mM Trrs-HCl, pH 8 3, 10 r&I spermrdme, 0.1% Triton X-100, 80 mMMgC12. 4

IOOmMDTT.

5. Human placental rlbonucleasemhlbltor. 6 T7 RNA polymerase 7. Rrbonucleotlde trrphosphates, ATP, CTP, GTP, and UTP, drssolved at 100 mM m dH,O, equilibrated to pH 7 0 with 50 mMTrrs-HCl, pH 7 0, and the concentration adjusted to 40 mM following verification of the optical density as described

RL-PCR

8 9 10. 11 12 13 14. 15

315

(13). The stock solutions are mixed to give a working solution containing all four rNTPs at a concentratton of 10 mM each 3 MNa acetate, pH 5.6 100 and 70% Ethanol 10X TBE. 890 n&I Tris-borate, pH 8 3, 20 mA4 EDTA 50% Formamide m 1X TBE. Preparative 12% polyacrylamlde 8 M urea gel (prepared with DEPC-treated dH,O), as described (13) The gel IS 3 mm thick, 20 cm long with a 5 cm wide well Elutlon buffer, 10 mMTrts-HCI, pH 8 0,100 mMNaC1, 1 mMEDTA, 0 1% SDS. Sep-Pack C 18 column 100 and 60% methanol

2.1 2. Labeling of Primer 2 1 Synthetic DNA primer 2 (100 ug/mL): the selection of primer 1 and primer 2 sequence should be done srmultaneously and follow these guidelmes* a The method works better rf primer 2 hybridizes closely (usually 20-50 nt away) 3’ to the expected rrbozyme cleavage site, b Primer 1 should hybrtdtze 3’ to primer 2 without overlappmg with it; c We have usually chosen primers such that their melting temperatures (T,,,) are around 52’C for primer 1 and 65°C for primer 2 Melting temperatures are estimated using the formula T,,, (“C) = 4 (G + C) + 2 (A + T) (1.5) This combmatton of estimated melting temperatures usually provides the needed specificity and efficiency for the various primer extensions (see Note 4). Furthermore, because of its lower T,, residual primer 1 does not interfere during the PCR and labeling steps, d. Primer sequences (including that of the DNA linker) should be checked for the absence of intramolecular secondary structure and primer crosshybridization using a computer program (for example, Ollgo 4 0) 2. [r-‘*PI ATP at ~7000 Cl/mmol, 20 mCt/mL. 3 10X Kmase buffer 500 mA4 Trts-HCl, pH 7 6, 100 n-J4 MgC12, 50 nnI4 DTT, 1 nnI4 spermme, 1 mA4 EDTA 4. T4 Polynucleotide kmase

2.2. RL-PCR Procedure 2.2.1. Phosphorylation of the 5’-Ends of the Total Cellular R/VAs 1. 2. 3 4

10X Kmase buffer: see Sectton 2 1 2. 10mMATP T4 Polynucleotide kmase Total cellular RNA (see Note 1).

2.2.2. Ligation of the R/VA Linker to the Total Cellular R/l/As 1. Synthetic RNA linker (100 &mL). 2 10X Ligase buffer 500 mM Tris-HCl, pH 7.5, 100 mA4 MgCl2. 3 200 mMDTT.

Bertrand et al.

316 4. 5 6 7. 8 9

1 mMATP. 1 mg/mL RNase-free BSA Human placental ribonuclease mhibitor. T4 RNA ligase. 3 MNa acetate, pH 5 6. 100 and 70% ethanol

2.2.3. Synthesis of a cDNA Complementary

to the Analyzed RNA

1 Synthetic DNA prtmer 1 (10 pg/mL) primer 1 sequence should be selected accordmg to the rules in Section 2.1 2 2 10X RTITaq buffer 650 mA4 Tris-HCl, pH 8 8, 100 mA4 b-mercaptoethanol, 165 mA4 (NH&SO4 3 60 mA4MgClz 4 Deoxynucleottde triphosphates, dATP, dCTP, dGTP, and dTTP dissolved at 100 mM m dH,O, equilibrated to pH 7.0 wtth 50 mM Tris-HCl, pH 7.0, and the concentratton adjusted to 50 mA4 following verification of the optical density as described (13). The stock solutions are mixed m order to give a working solutton containing all four dNTPs at a concentratton of 5 mM each 5. AMV reverse transcnptase

2.2.4. PCR Amplification and Labeling of the cDNA 1 Synthetic DNA lmker primer (1 mg/mL): its sequence corresponds to that of the RNA linker (Section 2 1.1.). It is 5’-GGGCATAGGCTGACCCTCGCTGAAA-3’ 2. Labeled primer 2: see Section 3.1 2. 3 10X RTITaq buffer: see Section 2.2.3 4. 2 mg/mL DNase-free BSA. 5 Taq DNA polymerase. 6 Redisttlled phenol equihbrated with Tris-HCl, pH 8.0, as described (IS), and mixed wtth chloroform, 3’ 1, v/v. 7 3MNa acetate, pH 5.6. 8. 100% Ethanol 9. Formamide dye buffer and sequencmg polyacrylamide (6%) gel containmg urea as described (13).

3. Methods RL-PCR is divided into four stepsthat are schematized in Fig. 1. These steps follow each other and are conveniently

performed

with the following

schedule*

cellular RNA phosphorylation (step I), as well as the start of the ligation of the RNA lmker (step 2) on day 1; the ligation

is mcubated overmght,

and is stopped

at the begmning of day 2, reverse transcription (step 3) and PCR (step 4) can also be performed on day 2, although gel electrophoresis of the PCR products is more convemently done on day 3, In addition to these four stepsthat make up the basic RL-PCR procedure, we describe two additional procedures that allow one to

RL-PCR

317

prepare reagents needed during RL-PCR. They are the preparation of the RNA linker, which 1s more convemently done on a large scale (allowmg recovery of 10-30 pg of lmker, which allows for the analysis of 100-300 samples), and the labeling of primer 2, which ts more conveniently done on a small scale (because the labeled primer IS best used wtthm 1 wk). When starting up RLPCR for the first time, rt IS best to verify the efficiency, fidelity, and spectfictty of the techntque with some simple control experiments (see Notes 2-4).

3.1. Reagent Preparation 3. I. 1. Synthesis of the RNA Linker When preparing the RNA linker for the first time, tt is best to test the synthesis conditrons on a small scale before using the large-scale reaction conditions described below. 1 MIX m a reaction tube* 4 pg of the Bottom Oligo, 1.8 pg of the Top Ohgo, 4 & of 10X annealing buffer, and dH,O to a volume of 40 pL. Heat the tube at 95OC for 1 mm, and then incubate at 42°C for 15 min 2 Place the tube at room temperature, and add m this order 160 pL of the 10 mA4 rNTPs solution, 20 pL of the 0 1 M DTT solutton, 90 pL of dH20, 40 pL of 10X transcriptton buffer, 10 & of RNase mhibttor (200 U), and 40 pL of T7 RNA polymerase (1000 U) 3. Let the reaction proceed for 3-4 h at 42°C We have observed that the reaction can precipitate sometimes m the course of RNA syntheses because of the htgh concentration of nucleotides In this case, it is possrble to recover the precrpltated RNA as follows: spm down the prectpitate m a mtcrofuge, resuspend the pellet in 200 pL of 3 Mammomum sulfate, and dtlute it IO-fold wrth dHzO before ethanol precipitation A lower concentratton of nucleotides and magnesium (2 and 6 mA4, respectively) can also be used to crrcumvent the problem, but the yield will be lower 4 Prepare the 12% acrylamtde-urea gel as described (13) 5. Precipttate the nuclerc acrds by adding 0.1 vol of 3 M Na acetate and 3 vol of 100% ethanol Microfuge at >lO,OOOg for 10 mm, and wash the pellet extensively with 70% ethanol Dry brrefly, and resuspend the pellet in 100 pL of 50% formamrde m 1X TBE 6 Heat the sample at 95’C for 1 mm, put immediately on ice, and load the sample onto the preparative gel. In a netghbormg well, load a mol-wt marker (for example, a DNA ohgonucleotide of 20-30 bases) diluted m formamtde buffer with xylene cyan01 and bromophenol blue (1 mg/mL each). Run the gel at 50°C (250 V for a 15 x 20 cm gel) until the bromophenol blue reaches the bottom of the gel 7 Vtsualize the bands by UV shadowing as described (13) Two to four consecutive bands should be seen with a size close to 25 bases. This heterogeneity IS owing to the RNA polymerase, which sometimes adds l-3 nt at the end of the expected transcript (I 4) The band correspondmg to the shortest product of these consecutive bands is cut and eluted overnight at 37°C m 2 mL of elutton buffer

318

Bertrand et al.

8. Purify the RNA linker by reverse-phase chromatography on Sep-Pack Cl 8 column as follows. prior to use, wash the column with 4 mL of 100% methanol, and then with 4 mL of dHzO. Apply the eluted sample to the column. Wash the column twice with 3 mL of dH,O. Elute the RNA linker with 1.5 mL of 60% methanol 9. Evaporate the solvent m a SpeedVac, and resuspend the RNA lmker m 100 pL of dH,O Estimate the amount of lurker recovered, and analyze its quality by runrung 1 pL on a gel In these conditions, the amount of linker obtained should be on the order of I@-30 pg Adjust the linker concentration to z-100 ng/pL, and store at -80°C.

3.1.2. Labeling of Primer 2 1. In a reaction tube, mix 1 pL of primer 2 (100 ng), 2.5 pL of [Y-~~P] ATP (50 pCi, 7 pmol), 2 pL of 10X kmase buffer, 1 pL of T4 polynucleotide kmase (10 U), and dH20 to a final volume of 20 pL This generates enough material for the analysis of 10 samples 2 Incubate for 30 mm at 37°C 3 Stop the reaction by incubating for 5 mm at 95’C The primer IS used without further purification

3.2. RL-PCR Procedure 3.2.1. Step I: Phosphorylation of the 5’-Ends of the Total Cellular RNAs 1 In a reaction tube, place 7 p.L of total cellular RNA (see Notes l-4) diluted m dH,O at a concentration of 1 mg/mL 2 Add 1 pL of 1OX kmase buffer, 1 pL of 10 mM ATP, and 1 pL of T4 polynucleotide kmase (10 U). 3 Mix and incubate at 37’C for 15 mm 4 Stop the reaction by freezing.

3.2.2. Step 2: Ligation of the RNA Lmker to the Total Cellular RNAs 1. In a reaction tube, mix 1 pL (0 7 pg RNA) of the phosphorylation reaction of step 1 (Section 3 2 1.) with 1 p.L of RNA linker (0.1 ug), 1 p.L of 10X hgase buffer, 1 @ of 200 mMDTT, 1 pL of 1 mMATP, 1 pL of RNase free BSA (1 pg), 1 pL of human placental ribonuclease inhibitor (20 U), 1 pL of RNA hgase (3 U), and 2 $ of dH20. 2 Incubate the tube overnight at 17°C 3 Precipitate the RNA by adding 1 pL of 3 MNa acetate, pH 5 6, and 25 pL of 100% ethanol Microfirge at >lO,OOOg for 10 min, and wash the pellet with 70% ethanol 4 Dry briefly and resuspend m 12 ,uL of dH20

3 2.3. Step 3: Synthesis of a cDNA Complementary to the Analyzed RNA The incubations PCR apparatus.

of Steps 3 and 4 are more conveniently

performed

m the

RL-PCR

319

1, Place 6 pL of the ligated RNA (350 ng) from Section 3.2.2. m a reaction tube that fits in a PCR apparatus 2 Incubate for 1 min at 95’C to denature the RNA 3. Put at 42”C, and add 1 pL of primer 1 (10 ng), 1 $ of 10X RTITaq buffer, and 1 & of 60 mA4 MgCI, 4. Mix and let the primer hybndlze by Incubating for 30 min at 42°C (see Note 4). 5. Without taking the tube out of the PCR apparatus, add 1 pL of a mixture contammg 5 mMof each dNTPs and 3 U of AMV reverse transcnptase. 6. MIX and incubate for 30 min at 42’C (see Note 4) 7. Stop the reaction by Incubating for 5 mm at 95°C 8. Place the tube on ice and proceed directly to Sectlon 3.2.4

3.24. Step 4: PCR Amplification and Labeling of the cDNA 1. To the reverse transcriptlon reactlon of Sectlon 3.2.3 , add 1 pL of DNA linker primer (1 pg), 2 pL of the labeling reaction (corresponding to 10 ng of primer 2, Section 3 1.2 ), 1 pL of 1OX RTITaq buffer, 2 ,uL of DNase free BSA (4 pg) and 3 pL of dH20 MIX and overlay the sample with paraffin oil. 2. Incubate for 3 min at 95°C. 3 While maintainmg the tube at 95”C, add 1 pL of a mixture containing 5 mA4 of each dNTPs and 1 U of Taq DNA polymerase. 4 MIX and PCR-amplify for 15-30 cycles (see Notes 5-7): 30 s at 95”C, 3 mm at the annealing temperature (T, of primer 2 mmus 5”C, see Note 4), 3 mm at 74°C Fimsh by an extension step of 10 mm at 74’C 5. Analyze the reactlon products on a sequencing gel (13). Two mlcrollters of the reaction diluted with 2 pL of formamide dye buffer can be loaded directly after denaturation Alternatively, if larger quantities of the amplified material are to be loaded, the material can be phenol-extracted and concentrated by ethanol precipitation before loading

4. Notes 1 Most RNA extraction procedures are well suited for RL-PCR Because It allows recovery of both nuclear and cytoplasmic RNA, we routinely use the LKYurea method (16). To avoid DNA contammatlon that can adversely affect the procedure, the RNAs are treated with DNase I (mcubatlon for 30 mm at 37°C of a 50 pL reactlon contammg 1 U of RNase-free DNase I m 50 mM Tris-HCl, pH 7 5, 10 mA4MgC12), phenol/chloroform-extracted, and ethanol-precipitated). 2 To control for the efficiency of the reaction, one should first perform RL-PCR with m vitro transcribed RNAs using* (a) the target RNA (approx 100 ng), and (b) the target RNA cleaved by the rlbozyme (approx 100 ng, with about 50% of cleaved product). When the PCR 1s driven up to saturation, the untreated target should give a ladder correspondmg to the fraction of RNA that is degraded during or after the transcription reaction (see Notes 5-7) Since the full-length RNA carries a triphosphate at Its 5’-terminus, it cannot be ligated to the RNA linker, therefore, no product correspondmg to the intact RNA will be amplified. The

rtbozyme-treated RNA should give only the band correspondmg to the cleavage products of the target RNA (no background degradation products should be seen, see Notes 6 and 7) Note that because of the addition of the RNA linker, the correct product is 25 bases longer than the distance separating the cleavage point from the 5’-end of primer 2 If the correct product 1snot obtained, each step of the reaction (phosphorylation, ligation, reverse transcrtptron, and PCR) has to be checked separately The efficiency of RL-PCR can be estimated by momtormg the number of cycles allowmg detection of the rtbozyme cleavage product Before saturation, i.e., when ~10% of the primer 2 is mcorporated (see Note 5), the eftictency of the RL-PCR can be estimated using the following formula: % of Primer 2 Incorporated = (2 EPCR)” EP EL * ERT Nz/Np

(1)

where E is the efficiency of each step (PCR* polymerase chain reaction, P. phosphorylation, L ligation, RT. reverse transcription), n is the number of cycles during the PCR, NI is the number of mmal reacttve molecules, and Np IS the number of primer molecules. We have not measured directly the efficiency of each step, except for the PCR step for which we found a value of 90% In our hands, using 300 fmol of target (100 ng of a 0 5 kb long RNA cleaved at 50%), approx 10% of primer 2 was elongated by the 10th cycle m the condtttons described here. This experimental value corresponds to a combmed efficiency of 6% for the phosphorylatton, ligation, and reverse transcription steps An efficiency of 40% for each step could account for this value 3. To control for the tidehty of the reaction, i.e., to ensure that all potential cleavage products m the region under analysis are amplified with a similar efficiency (thus IS important for some applications of the RL-PCR, as m viva footprmtmg, 6), amplification of a sequence ladder of the target RNA is recommended. This also allows the precise location of the cleavage points to be determined without sequencing the amplified products (see Fig 2) The RNA sequence reactions can be performed wtth m vitro synthesized RNA or total cellular RNA It is best to use these two sources, because it allows for the control of both the fideltty and the specifictty of the reaction (see Note 4). Either chemical or enzymatic RNA sequencing procedures are well suited for this purpose (8,17). When using the chemrcal sequencing procedure, the phosphorylatton of the substrate RNA (step 1) can be omitted, because the 5’-end of the sequence products is phosphorylated. 4 To control for the specificity of RL-PCR, It IS advisable to analyze total RNA from cells that do and do not express the target RNA. Total RNAs from cells expressing the target RNA can be used directly (case l), although it IS best first to submit them to sequencing reactions (case 2) When the PCR is driven up to saturation (see Notes 5 and 6), a ladder should be seen only with the RNA originatmg from cells expressing the target RNA (see Fig 2), which correspond etther to background degradation of the target RNA m case 1 (see Notes 6 and 7) or to the sequencing products m case 2. If bands are obtained from cells m which the target RNA is not expressed, other negative controls are useful (a) no RNA, and (b) no reverse transcrtptase Bands m the “no RNA” control may be owing either

RL-PCR to prrmer dtmer formatton, contammatton by carryover of PCR products, or plasmid DNA. Check again carefully the sequence of the primers, change the reagents, and use filter tips. Bands m the “no reverse transcrtptase” control mdtcate the presence of contammatmg DNA m the RNA preparation This contaminating DNA can be either of genomtc or plasmid origin (plasmid DNA is often a problem when transiently transfected cells are analyzed), and is removed by treatmg the RNA sample wtth DNase I (see Note 1). The absence of bands m these two controls indicates that the background IS owing to a lack of specificity of hybrrdizatron of the primers during the reverse transcriptton and PCR steps. We have observed that the lack of specificity during reverse transcription is parttcularly harmful. Since the RNA linker 1sadded to all available S-P-ends, any nonspecific reverse transcription event will generate a molecule able to hybridize with the linker primer specifically. This increases the probabthty of aspecttic amplification during the PCR In some cases, the lack of specificity of the reverse transcription step can be determined with a primer extension performed with radiolabeled primer 1 To improve the specific@ of the reverse transcription step, one can first raise the temperature of primer hybridization and reverse transcriptton (up to 50°C, since at higher temperatures, the AMV reverse transcriptase 1s not sufficiently active). If this does not work, change primer 1 To improve the spectfictty during the PCR reaction, one can also raise the annealing temperature of this step If unsuccessful, one can either change primer 2 or use a third primer (primer 3). In this latter case, tt is recommended to use a pnmer 3 with a T,,, of about 75°C that is nested internally and overlapping primer 2, as described for the LM-PCR procedure (7) When a third pnmer IS used, the usual PCR (Section 3 2 4 ) 1sperformed with 100 ng of unlabeled primer 2, and the PCR products can be visualized by performmg a second round of PCR with radtolabeled primer 3 as described (6). 5 When a quantitative comparison between samples is necessary, particular attention should be paid to the number of cycles performed during the PCR By definition, the higher they are, the higher the sensitivity However, as for all PCR-derived techniques, RL-PCR can reach saturation (the plateau effect, 18), parttcularly when the malortty of one of the primers has been elongated Once this point 1s reached, performing more cycles will only increase the signal marginally Therefore, if too many cycles are performed, the PCR products from all samples may become amplified to a similar level, even if the correspondmg RNAs were present in very different amounts at the start of the reaction A simple way to control for PCR saturation is to follow the reaction by withdrawmg ahquots, usually every 3 cycles after the 15th cycle. For the RL-PCR to be semiquantitative, we found that more than 90% of the labeled pnmer should remam unincorporated 6. Saturation during PCR can lead to results that have to be interpreted carefully, mainly because RL-PCR is so sensitive that the background degradation of the target RNA can be amphtied and vtsuahzed (see Note 7). An example of such a situation IS given m Fig. 2 In this experiment, the specificity of RL-PCR 1sdemonstrated by the absence of signal in the sample that contains cellular RNA devoid of target RNA (lane “No Targ”), whereas both the fidelity and the specificity of

322

Bertrand et al.

the reactton are shown by the correct amplification of the sequencing products of the target RNA (lane “G” and “A > G”) When RL-PCR IS performed on RNA extracted from cells that express the target, but not the rrbozyme, the background degradation of the target RNA can be seen as a ladder (lane “No Rz”, see Note 7) When RL-PCR is performed on RNA extracted from cells that express both the target and the rrbozyme, a unique band, which corresponds to the size expected for the rrbozyme cleavage product, can be detected (lane “Rz”) This band 1s of srmilar mtensrty to the background degradatron m the lane “No Rz ” Surprrsmgly, there IS an apparent loss of background degradation when the specific cleavage product is detected. Since there 1sno reason to suppose that the expression of the rrbozyme reduces background degradation, this result suggests that the background degradation products have been amplified with a lower efficiency m the “Rz” sample. This could be easily achieved rf all PCR reactions are driven up to saturation and rf the level of rrbozyme cleavage products IS higher than that of background degradation products During the course of PCR, because of this higher level of reactive S-ends in the “Rz” sample, the saturation 1sreached earlier than m the “No Rz” sample, before the background degradation products are sufficiently amplified In the “No Rz” sample, these products continue to be efficiently amplified during addltronal PCR cycles until they also reach saturation 7 We have observed two types of background degradation profiles a reproducible quasi-continuous ladder or a more discrete pattern that varres from experiment to experiment. These two types of profiles can be explained by statistical consrderatrons. If RL-PCR IS performed using too little RNA template, only a fraction of the degradation products present m the ortgmal populatron will be detected, and the pattern will vary from experiment to experiment In contrast with sufficient RNA template, the pattern will be reproducible

Acknowledgments We thank D. Steel for critical reading of the manuscript. This work was supported in part by the CNRS and grants from the Association de Recherche sur le Cancer and the Llgue Nationale Franqalse contre le Cancer. E. B. was supported by a fellowship from the Association de Recherche sur le Cancer. References 1 Bertrand, E., Prctet, R , and Grange, G. (1994) Can hammerhead ribozymes be efficient tools for mactivatmg gene function? Nucleic Acids Res 22,293-300 2 Saxena, S K. and Ackerman, E J (1990) Ribozymes correctly cleave a model substrate and endogenous RNA rn vlvo. J BloZ C/rem. 265, 17,106-l 7,109 3 Steinecke, P , Herget, T , and Schreler, P. H (1992) Expresslon

of a chlmerlc

ribozyme gene results m endonucleolytrc cleavage of target mRNA and a concomitant reduction of gene expression rn vwo EMBO J 11, 1525-1530.

4 Hildebrandt, M. and Nellen, W. (1992) Differentral antisense transcrrptton from the Dxtyostelium EB4 gene locus. rmphcattons on anttsense-medrated regulatton of mRNA stability Cell 69, 197-204

RL-PCR

323

5. Symons, R H (1992) Small catalytic RNAs. Annu Rev Bzochem 61,641-671. 6. Bertrand, E., Fromont-Racme, M , Ptctet, R , and Grange, T (1993) Visualization of the zn vlvo mteractton of a regulatory protein wtth RNA. Proc Nat1 Acad Scz USA 90,3496-3500. 7 Mueller, P. and Wold, B. (1989)1n vivo footprinting of a muscle specific enhancer by hgatton mediated PCR. Science 246,780-786. 8. Peattte, D. A. (1979) Direct chemical method for sequencmg RNA Pruc Natl Acad Scl USA 76, 1760-1764. 9 Frohman, M A , Dush, M K., and Martm, G. R. (1988) Rapid production of fulllength cDNAs from rare transcripts. amphficatton using a single gene-specific ohgonucleotide primer Proc Natl. Acad Scl USA 85,8998-9002. 10 Edwards, J B., Delort, J , and Mallet, J. (1991) Oligodeoxyrrbonucleotide ligation to single-stranded cDNAs. a new tool for clonmg 5’ ends of mRNAs and for constructing cDNA libraries by zn vitro amplification Nucleic Aczds Res 19, 5227-5232.

11 Trout& A B., McHeyzer, W M , Pulendran, B., and Nossal, G. J. (1992) Ltgation-anchored PCR: a sample amphficatton techmque with smgle-sided speciticity [published erratum appears m Proc Nat/ Acad Scz USA (1993) 90, 37751 Proc Nat1 Acad SCI USA 89,9823-9825 12 Fromont-Racme, M , Bertrand, E , Pictet, R , and Grange, T. (1993) A highly sensitive method for mapping the 5’ termmt of mRNAs. Nuclezc Aczds Res 21, 1683,1684

13 Sambrook, J , Fntsch, E. F , and Mamatis, T. (1989) Molecular Clonzng A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY 14. Mtlltgan, J , F , Groebe, D R., Wttherell, G. W., and Uhlenbeck, 0 C (1987) Oligoribonucleottde synthesis using T7 RNA polymerase and synthetic DNA template. Nucleic Acids Res 15, 8783-8798 15 Meinkoth, J and Wahl, G (1984) Hybridization of nucleic acids tmmobilized on solid supports. Anal Blochem 138,267-284. 16 Auffray, C and Rougeon, R (1980) Purificatton of mouse immunoglobulm heavy-chain messenger RNAs from total myeloma tumor RNA. Eur J Biochem 107,303-3

14.

17. Ehresmann, C., Baudm, F , Mougel, M., Romby, P., Ebel, J. P., and Ehresmann, B. (1987) Probmg the structure of RNA m solutron. Nucleic Acids Res 15,9109-9128. 18 Inms, M A. and Gelfand, D. H (1990) Opttmizatton of PCRs, In: PCR Protocols A Guzde to Methods andApplzcattons (buns, M. A , Gelfand, D. H., Snmsky, J J., and White, T W, eds ), Academic, San Diego, CA, pp. 3-12.

Quantitation of Ribozyme Target Abundance by QCPCR Amber A. Beaudry and James A. McSwiggen Introduction Rlbozymes show promise as therapeutic agents for the downregulatlon of specific target RNAs mslde cells. To demonstrate the efficacy of a given rlbozyme treatment, one needs to show that the treatment ameliorates the dlsease condltlon relative to a control treatment. As part of that demonstration, rt 1suseful to show that treatment with rlbozyme also results m a lowered abundance of the target RNA (see Note 1). This chapter describes the application of the quantitative, competittve polymerase chain reaction (QCPCR) technique for evaluating the abundance of RNAs targeted for ribozyme-mediated destruction. A number of different techniques are available for measurmg RNA abundance. They include Northern blotting, RNase protection assays(RPA), reverse transcription-PCR (RT-PCR), ligation-mediated-PCR (LM-PCR), and QCPCR (1,2). Of the assayslisted, QCPCR generally offers the greatest accuracy and sensitivity for quantltatmg low-abundance messages,but It also tends to be the most laborious of the techmques when used for accurate quantltatlon (see Note 2). For this reason, we recommend reservmg the QCPCR assay for situations where Northern blot or RPA techniques do not provide sufficient sensitlvlty. The great sensitivity of PCR assaysderives from exponential amplification of the target nucleic acid. Each round of PCR amplification can produce up to double the number of copies of the target, so that as few as l-10 copies often can be amplified to a detectable concentration range after only 30-40 rounds of amplification. However, this same process also amplifies mmor sample deviations into major discrepancies in the quantitation of the final product (see Note 3). In QCPCR, minor sample deviations are mitigated by adding a known amount of competitor nucleic acid into each assay to act as an internal stan1.

From


Bology, Vol 74 Rbozyme Protocols Humana Press Inc , Totowa, NJ

325

Beaudry and McSwiggen

326 A

FP Target

s-

(300-500

bp)

3 RP

Rest Enz Competitor

FP S-

*

3 RP

Deletion Competitor

FP 5’-

0 01

Fig. 1. Overview of QCPCR Concept (A) Representation of target and competitor PCR products. Competitor sequences contam either a restriction site mutation (*) or a deletion that makes them distmguishable from the target after PCR amplification The S-3’ labels refer to the coding strand orientation. The FP sequence matches the coding sequence, whereas the RP IS complementary to the codmg sequence. (B) Idealized plot of QCPCR results. Increasing the ratto of competttor to target results m more competitor and less target in the PCR products

dard. The competrtor nucleic acid IS generally RNA that has been designed to resemble the target RNA as closely as possible. The competrtor differs from the target RNA by containing a small deletton, insertion, or point mutatton (Fig. 1A) that makes it distinguishable from the target RNA through gel mobility differences (deletions or insertions) or through differential sensitivity to cleavage by a restriction enzyme (point mutations). The competrtor is reversetranscribed and PCR-amplified along with the target, and at a similar rate. Consequently, the relative amounts of competrtor and target at the end of the amplificatron process should be the same as prior to amplification (Fig. lB), only now both are present at detectable levels. The abundance of the target

327

QCPCR

RNA m the reaction can then be calculated from the known amounts of mput competitor, combined with the measured relative amounts of competitor and target. In principle, a single competitor concentration could be used to determine target RNA concentration. In practxe, multiple competitor concentrations are used to improve the sensitivity and detection range of the assay(see Note 2). 2. Materials Caution! Great care must be taken to avoid contamination of PCR reagents (see Section 3.1.). All reagents that are used for setting up reactions should only be opened inside a PCR hood and should not be used for purposes other than this assay. Materials for gel analysis do not fall into this category Items marked with (*) are stored at -20°C. 2.1. Items Common to Ail Reactions 1 Sterile, RNase-free water 2. 0.1X TE buffer: 1 mMTns-HCI, 0 1 WEDTA,

pH 8.0. 3. Nusleve GTG agarose (FMC, Rockland, ME) 4 10X TAE buffer 40 mM Tris-acetate, 1 m/U EDTA, pH 7.8 Use at 1X for running gels. 5. Agarose gel markers: use 1 &lane (e.g., I-kb ladder, BRL, Galthersburg, MD) (*). 6. 100 p&L yeast tRNA m 0.1X TE buffer, pH 8.0 (e.g., Sigma, St. Louis, MO) (*) 7 Mineral oil. 8. Sterile disposable medicine droppers (also called transfer pipets). 9. Sterile snap-top mlcrocentrlfuge tubes (sized to thermocycler block). 10 Thermocycler. 11 10X Agarose gel loading dye 50% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanol. 12 Ethldium bromide or Sybr Green (Molecular Probes, Eugene, OR) (*) for staining agarose gels.

2.2. Preparation

of Competitor

RNA

1 Forward and reverse mutant primers (FM and RM, respectively) for introducing deletions, insertions, or point mutations into competitor: 20 @4 (*). 2. Forward and reverse gene-specific primers (FG and RG, respectively) for amphfication of competitor DNA* 20 pM (*). 3 Forward primer containing T7 RNA polymerase promoter (FG7) for transcribmg the competitor PCR product into RNA: 20 @4 (*) 4. GeneAmp PCR kit (Amphtaq, Perkm Elmer, Foster City, CA) or PCR Core Kit (Boehrmger Mannhelm, Indianapolis, IN) (*). 5 GlassMax DNA Isolation system (BRL) 6. Ambion T7 MegaScrlpt RNA transcriptlon kit (Amblon, Austin, TX) (*) 7 Target gene (preferably as a plasmid) to use in making the competitor (*) 8 In vitro transcribed, target RNA for assay validation (*).


328 2.3. Reverse

Transcription

and First PCR

1 Total cellular RNA (store at -7O’C) 2 In vrtro transcribed, control RNAs diluted m 100 pg/mL tRNA (see Section 2 I., step 6) (*), 3 Forward and reverse assay primers for PCR amphficatron (FP and RP, respectively), designed to grve PCR product of 300-500 bp. Note that the RP primer is used for both the reverse transcriptron and first PCR steps 20 l.aV (*) 4 32P-labeled FP or RP for use m heteroduplex step (If quantrtatron is to be by radroactive method) 5. RT mix-amounts are per tube (make up a “master mix” for more than you need) 2 pL of 10X PCR buffer (Rephpack ktt-Boehrmger Mannhelm, Indtanapohs, IN) (*) 2 pL of 10 mM dNTPs (Replipack kit-Boehrmger Mannhelm) (*). 2 4 pL of 25 mA4 MgCl, (Replipack kit-Boehrmger Mannhetm) (*) 0.6 & of sterile water 1 pL of RNase mhrbitor (USB/Amersham, Cleveland, OH) (*) 1 pL of Superscript II reverse transcrtptase (BRL) (*) (For “no RT” mix, omit the RNase inhibitor and the Superscript RT) 6 PCR- 1 mrx-amounts are per tube (make up a “master mix” for more than you need) 66.9 pL of sterile water. 8 pL of 10X PCR buffer (Rephpack kit-Boehrmger Mannhelm) (*) 3 6 l,tL of 25 mM MgC12 (Replipack kit-Boehringer Mannhelm) (*). 1 pL of 20 @f forward assay primer, FP (*) 0.5 pL of Tug polymerase (2.5 U) (*). 7 For opttonal second PCR, forward and reverse nested assay primers are needed (FN and RN, respectively), located internal to the FP and RP primers (Ftg 2D) and designed to give PCR product of 300-500 bp 20 pA4 (*) 8. Optronal PCR-2 mrx-amounts are per tube (make up a “master mrx” for more than you need)* 80 5 pL of sterile water. 10 pL of 10X PCR buffer (Rephpack krt-Boehrmger Mannhelm) (*) 2 pL of 10 mJ4 dNTPs (Replipack krt-Boehringer Mannheim) (*) 2 5 p.L of 20 l&nested forward primer, FN (*) 2 5 pL of 20 pA4 nested reverse prrmer, RN (*) 0 5 p.L of Tuq polymerase (2 5 U) (*)

2.4. Separation

and Quantitation

of Restriction

Site Competitor

1 Restrtctron enzyme specific for competttor fragment (*) 2 1OX Digest buffer for selected restriction enzyme (*)

3. Methods 3.7. General Considerations

in PCR Amplification

PCR amplificatton can proceed from as little as one molecule Thus, extreme caution should be taken to prevent contammation

of template. of the reac-

329

QCPCR FG

A

FM *

5’-

3

-

* RM

RG

FM * 5’

*

3

RG

PCR /

C RG

D

l7-f

-

FP

FN .*.....

* *

....... RN

RP

Fig. 2. Construction of competitor DNA. The 5’-3’ labels refer to the coding strand orrentatron. The FG and FM primers match the coding sequence, whereas the RG and RM primers are complementary to the coding sequence. The asterisk (*) indicates the site of the deletion or point mutation used in generating the competitor. (A) Posmon of PCR primers for synthesizing competttor. (B) Preparation of mutant half-fragments (C) Joining of mutant half-fragments to generate competitor template with T7 promoter attached The FG7 primer has T7 promoter sequences appended to the 5’-side of the FG primer sequences. (D) The complete competitor template with attached T7 promoter sequences (T7) and introduced mutation site (*). The relative posrtrons of the QCPCR assay primers are shown. The FP and optional FN primers match the coding sequence, whereas the RP and optional RN primers are complementary to the coding sequence.

tions. If you are unfamiliar with the types of precautions that are necessary, please take the time to review the references on this matter (3,4). In partrcular, we use barrter prpet tips and dedtcated pipets, as well as dedicated reagents reserved only for PCR. In addition, we carry out the reactions in three separate areas: a dedrcated biologrcal hood for setting up reactions and primers, a separate bench away from the PCR hood for adding template, and a thud, separate area for gel analysis of PCR products. Finally, we employ great care in handling of all reagents to minimize crosscontamination through the generation of aerosols; it is useful to “quick-spin” tubes in a microcentrifuge before openmg

Beaudry and McSwlggen to decrease possible aerosols. We have found that shortcuts m these matters do not save time and often result in the loss of precious samples.

3.2. Preparation

of Competitor

Preparation and validation of the competitor fragment can easily be the most time-consummg portion of this assay. The competitor sequence is usually designed to be ldentlcal to the target sequence, except that a small deletion, insertion, or restriction site mutation is introduced to dlstmgulsh it from the target RNA (Fig. I). Restrictton site competttors are most stmllar to the target RNA-usually differing at only one or two bases, dtstant from the primer sites-and thus, should perform almost ldentlcally to the target for both reverse transcription and PCR amplification. However, one must perform a digest of the PCR products to dlstmgulsh the restrlctlon site competitor from the target (through gel mobility differences). This adds another step to an already long procedure, and it introduces the likelihood that incomplete restriction digestion ~111 complicate the results. Deletion and insertion competitors do not require the restriction digestion step because their size difference makes them dlstmguishable from the target PCR products (we used 50 bp deletions from 500 bp fragments). However, these competitors raise the posslbllity of having dlsslmilar efficiencies of reverse transcription and/or PCR amplification, especially if they introduce a significant change m the GC content or the secondary structure of the competitor. Dissimilar amplification rates will generate systematic errors m the esttmatlon of target abundance, as will mcomplete digestlon for restriction site competitors. We have been successful with both types of competitors, although we have encountered both types of problems as well. We recommend trying a deletion competitor first, since it is easier to use. Competitor constructs should be checked carefully to prove that they are performing as they should (see Section 3.2., steps 5-7). The followmg protocols are modified from Higuchi (5) and are outlined in Fig. 2. 1. Design and order oligonucleotlde primers for the construction of competitors. For a restriction site competitor, search the target sequence for an unique sit-r for lack of a common restriction enzyme site (1 e , EcoRI or HzndIII) The site needs to be wlthin the PCR ampllficatlon region and far enough Inside to be distinguishable from the target by gel mob&y after restriction dlgestlon (Fig 2A), 50-150 bp mto a 500 bp PCR product should suffice. To remove or Introduce a unique restriction site, one needs two complementary primers (FM and RM m Fig 2), each contammg the one or two base changes, which generate the desired mutation One primer will be sense to the target gene, or “forward” (FM), and the other will be antisense, or “reverse” (RM). Primer length should be based on the estimated annealing temperature, with an uninterrupted base-pamng region that gives a 5040°C annealmg temperature (see Note 4) A good length to start with

QCPCR

2.

3

4

5

6

7.

331

1s40 nt, with 20 nt upstream and 20 nt downstream of the base to be mutated For a deletion competitor, choose a region of the target gene to be deleted, again, 50 bp removed from a 500 bp PCR product should suffice Make primers that contam about 20 nt of sequence upstream of the piece to be deleted and about 20 nt downstream The estimated annealing temperature of each of these two regions should be 5@-6O”C. Again, you will need two primers (FM and RM) that are complementary to each other It 1sour experience that primers received from ohgonucleotlde synthesis suppliers do not usually require gel purification before use m PCR. Prepare half-fragments of competitors using PCR amplification from a clone or fragment of target gene DNA, these halves will then be combined to make the competitor. Set up two PCR reactlons for generating competitor halves from your gene target (Fig. 2B) The first reaction should include target DNA plus the FG and the RM primer, whereas the second reaction should contain target DNA plus the FM and the RG primer. Set up standard PCR reactions (using GeneAmp kit or PCR core kit), and amplify using 50-55’C as the annealing temperature Purify PCR products on a Nusleve GTG agarose gel, and Isolate DNA fragments using a Glassmax column (see Note 5) Ensure that the size of the fragments are as expected before contmumg Join half-fragments m a new PCR reaction (Fig. 2C). Mix 2-10% of each of the purified fragments obtained from step 2, with RG and FG7 primers (see Note 6) Amplify as in step 2 Analyze products on an agarose gel (along with size markers) to verify that the PCR product 1sthe correct size. At some point, the competitor DNA should be sequenced to ensure identity; we use USB’s Sequenase Kit for PCR products (USB/Amersham) Make RNA transcripts from the new competitor fragment. Use the Amblon T7 Megascrlpt kit as described m the manufacturer’s guide DNase-treat the RNA products as directed, gel-purify to remove free nucleotldes (or purify through a spm column), and then precipitate with isopropanol Quantitate the competitor RNA by UV spectroscopy, and rerun an ahquot on a gel to verify that no breakdown has occurred during purification Make dllutlons of competitor over several log ranges using 100 pg/mL tRNA as the dlluent (for stability and storage) At this point, one can test the “limit of detection” for the competitor by determmmg the mmlmum amount needed to give a visible product. Using the dilution series as the only input, perform reverse transcnptlon and PCR amplification as described below. We have seen the hmlts of detection range from 1O-l 000 molecules, depending on the target gene. Test for contaminating DNA m the competitor, smce this can alter the quantltatlon in the assay step Use the RNA as input to a standard PCR amplification (use the GeneAmp or PCR Core Kit along with the FP and RP primers) There should be no amplification product m 50 fmol (or less) of competitor RNA after 30 cycles of amplification If there 1scontammatmg DNA m the competitor RNA, redo the DNase I treatment and punficatlon; retest for DNA contaminants. Test the competitor’s usefulness by performing a QCPCR assay agamst a known quantity of target RNA (transcribe as for the competitor, see step 4) Perform the

Beau&y and McSwiggen

332

QCPCR assay as described below, keeping the concentration of the input RNA constant while varying the amount of input competitor The results of the quantttatton should be close to the actual input of the target gene, if they are not, the competitor or the FP and RP prtmers should be redesigned Do not skip this step It IS very important to validate the competttor before trying to quantitate biological samples (see Note 7) 3.3. QCPCR

Assay

3.3. I. Reverse Transcription 1 Prepare total cellular RNA (6) from whole tissue or from the tissue-culture cells to be analyzed (see Note 8), rehydratmg m 0.1X TE to a volume of 5&100 pL (6) 2 Decide the concentratton range of competitor that will be used. It will be sufflcient to choose a competttor dtlution range that flanks the target concentrations by two orders of magmtude (see Note 9). As previously stated, it is useful to determine the abundance of target RNA while vahdatmg the competitor sequence; that should provide a good guess for the range of competttor needed for accurate quantitatton. Start by making log-range dtlution steps; later you can make semilog or finer steps (see Note 10). 3. Plan out the control reactions. The controls listed m Table 1 have become the standards for our QCPCR reactions, although many others could be considered as well The key pomt is that positive and negative controls, and size markers must be mcluded to ensure that the observed PCR products are actually from the target and competitor RNAs The “No RT” control should be included for every sample to ensure that the sample has been properly treated to remove DNA The controls that provide size markers should be run once per gel (see Note 11) 4. In a PCR hood, label tubes for the reactions. You will need 5-7 tubes/sample (one for each competttor concentration) plus tubes for the required control reactions 5. In tubes from step 4, ahquot 1 @., of RP primer, additional sterile water if required (see Note 12), and two drops of mmeral oil from a sterile disposable medicine dropper 6 On a separate bench away from the PCR hood, add 5 pL of the competitor dilutions into each tube from step 5 (1 dilutton/tube). Add 5 @ of total RNA from step 1. The volume of these tubes should be 11 pL at this point. 7. Heat the tubes to 90°C for 3 min, and then place on ice for 1 mm Centrifuge briefly to reduce the possibihty of aerosols. 8 To each tube add, 9 pL of RT mix (prepared m the PCR hood Just prior to using) To “No RT” tubes, add 7 pL of “No RT” mix. 9 Incubate at 42’C for 30-60 min, and then at 95’C for 5 min to inactivate RT These steps can be done in the thermocycler

3.3.2. First PCR 1 Add to each tube, 80 p.I of fresh PCR-1 mix (made up in the PCR hoodlust prior to using)

Table 1 Control Reactions Control name

for QCPCR Target RNA’

Analysis Competitor RNA”

PCR Pmer9

RT mlxa

+

t

No RT

Cell or Tissue Target

0

t

“No RT” Mii

Target Positive #l

PlasmIdwith TargetGene

0

t

+

Purpose l

l

l l l

Target Positive #2

Transcribed Target RNA

0

t

t

l l l

Competitor Positive

0

t

+

t

l l l

Cell Positive

Cell or Tissue Target

0

t

t

l

Check for contammatlon of primers, RT Mix, and PCR mix by target RNA or DNA Check for contaminating target DNA in the Cellor Tissue-extractedtarget RNA Positive control for PCR reaction steps. Size marker for target PCR product Checkfor undesiredPCR product rmgratmg at competitor position. Positive control for RT reaction steps. Size marker for target PCRproduct Checkfor undesiredPCR product rmgratmg at competitor position. Positive control for all reaction steps Size marker for competitor PCRproduct Check for undesiredPCR product migratmg at target position Demonstratepresenceof target RNA m target cell or tissue. Neededwhen competitor dilution seriesproducesonly competitor PCRproduct and no target PCR product.

“Thesecolumnsindicatethat specificcomponents of the QCPCR reaction that should be omitted (0), included m the standard amounts (+), or modified m the manner mdicated to generate the given control reaction

Beaudry and McSwiggen 2. Begin the following thermocyclerprogram (seeNote 13): Denaturetarget at 95°C for 5 mm 30-35 Cyclesof Denatureat 94°C for 30 s. Anneal at 40-70°C for 30 s dependingon primer T,, (seeNote 13) Elongate at 72“C for 1 mm. Complete synthesisat 72°C for 5-10 mm 3.3.3. Nested, Second PCR (Optional) Performing nested PCR increases the probability of spectfic amplificatton as well as increasing the yield of the product for isolation. It is often necessary to do nested PCR to visualize the products when the target is at very low levels. 1 In the PCR hood, prepare PCR-2 mix as in Section 2 , allquot 98 pL into sterile snap-top microfuge tubes, and cover with two drops of mineral oil. Be sure to set up one or two tubes to be used for negative controls of PCR-2; that is, they should contain PCR-2 mix and mineral oil only 2 On a separate bench away from the PCR hood, pipet 2 pL of PCR-1 reaction products into the PCR-2 tubes from step 1. Use extreme caution during the transfer, it is easy to generate aerosols, which could cause crosscontammation 3. Place tubes m the thermocycler using the same program as m the first PCR reaction

3.3.4. Resolution of Heteroduplexes As the PCR reaction nears completion, target and competttor PCR products will sometimes

anneal to one another to form heteroduplexes.

These heterodu-

plexes contribute to inaccuracies m the quantttation and must be removed if possible. A final round of PCR amplkation at a 1:5 dilutton helps to resolve the heteroduplexes mto homoduplex PCR products. 1 In the PCR analysis area (see Note 14), make a 1.5 dilution of the PCR products, using fresh PCR mix as the diluent (PCR-1 mix, or PCR-2 mix if nested PCR was performed, substitute 32P-labeled primer for one of the PCR primers if quantitation is to be by radioactive method). A convement dilution is 4 pL of PCR product into 16 pL of fresh mix 2. Place in the thermocycler for one cycle using 95°C for 5 mm, anneal at 40-70°C (see Note 13) for 30 s, and elongate at 72°C for 10 mm

3.4. Separation and Quantitation of PCR Products The separation and quantttation of the PCR products should be done m a separate PCR analysis area (see Note 14). The steps involved will vary somewhat depending on whether a competitor was used that contains a deletion or a restriction site modification.

335

QCPCR 3 4. I. Deletion Competitor

1. Remove 10 p.Lof PCRproduct for analysis,and addto 1 pL of 1OX agarosegel loading dye. 2. Load sampleson an agarosegel. Use 3-4% Nusleve GTG agarosetn 1X TAE for 250-500 bp fragments Run the gel at appropriate current for the sizeof the gel (seeNote 15). 3. Stain with ethidium bromide or Sybr Green if using nonradioactive samples. 4. If the samples are radioactive, dry the gel prior to quantitatlon (to prevent diffusion of bands) Place the gel on a gel dryer on top of two layers of Whatman filter paper, and then cover the gel with plastic wrap followed by the cover of the gel dryer. Dry at 40-50°C for several hours with the vacuum on. 5 Quantltate the amount of competitor and target m each sample using fluorography, densltometry, scmtlllatlon counting, or radlolmagmg, as appropriate (see Note 16)

3.4.2. Res tnction Site Compe trtor 1 Clean up the PCR products if necessary (see Note 17)

2. Set up a 20 pL restrlctlon digestion contammg 10 & of PCR product, 10-20 U of restriction enzyme, and the appropriate buffer Incubate at the manufacturer’s recommended digestion temperature for l-2 h Add 2 @ of 10X gel loading dye 3 Load samples on gels and analyze as in Section 3.4 1 , steps 2-5

3.5. Calculation

of Target RNA Abundance

The most straightforward approach to determining target RNA abundance IS to find the competitor dllutlon that produces equal concentrations of competltor and target m the PCR product; that competitor dilution will represent (roughly) the abundance of target m the original sample. A more accurate method for determining target RNA abundance is to perform a nonlinear, leastsquares fit to the entire series of competitor dilutions made against a given target sample. The latter approach has a number of advantages over the former. First, the least-squares fit allows one to interpolate between data points to improve precision. Second, more data points are included in the least-squares estimate, so that measurement error IS mitigated. Third, the least-squares fit easily accommodates background adjustments when the PCR products yield ClOO% competitor or target, respectively, for the all-competitor or the all-target controls. 1, Plot the “measured fraction or percent of competitor” from the QCPCR reactlons vs the “amount of input competitor” as m Fig. 3. Use a graphing program that contains a nonlinear, least-squares fitting routine. We use Kaleldagraph (Synergy Software, Reading, PA)


336 100

I

’

’

““1’1

1

Input Measured

80

-A-

100%

-+-

90%

(100%) 66%

-@-75%

70%

+50%

49%

-m-

10%

12%

f-

100

1000

104

IO5

Input Competitor (molecules)

10”

1 37x10smolecules

10’

108

IO9

RNA

Fig. 3. Example of a QCPCR target dilution series used to evaluate the sensitlvlty of QCPCR in detecting reductions m target RNA levels. Varymg amounts of m vitro transcribed target RNA were mixed mto a background of cellular RNA and were then quantitated by QCPCR. The amount of input message 1scompared to the amount measured from QCPCR. There is good correlation between the actual input and measured amount of message.

2 Fit the data to the followmg equation* F = B0 + (Blo,, - BO) [C/(C + T)]

(1)

where F 1sthe “measured fraction of competitor” and C is the “amount of mput competitor ” The fitting routme returns three values. T, the “target RNA abundance” (which has the same units as input competitor), and the background values, B. and B,,,, which represent the “measured fraction of competitor” determined when 0 and 100% competitor 1s present in the reaction. The end result of the QCPCR assay should be curves like the ones shown m Fig. 3. In this figure, the QCPCR assay was evaluated for Its sensltlvity m picking up slight to modest reductions m target RNA levels extracted from cells. Note that even a 10% reduction in target RNA is detectable m this figure, and that there 1s good agreement between the amount of target RNA spiked into these reactions and the amount of target RNA calculated from the least-squares fits to the data.

QCPCR

337

3.6. QCPCR of Housekeeping

Genes Often it is useful to quantitate a housekeeping gene from cellular samples. When one IS comparmg target levels in two or more cellular samples, quantitation of a gene that stays at a relatively constant level m the cell allows for normalization of the data. It is a way to control for variations in cell number, for efficiency of total RNA extraction, and for integrity of the total RNA at the start of the assay Examples of housekeeping genes are p-actin and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH). Knowledge ofyour cell type and target is helpful in choosing a housekeeping gene. The gene you choose should not vary with varying levels of your target. In other words, downregulation of the target by ribozyme activity should not change the level of the chosen housekeeping gene. Prepare and test a competitor to the housekeeping gene as descrtbed above. When settmg up the QCPCR tubes, include a reverse prtmer for the housekeepmg gene m step 5 of the reverse transcription protocol (Section 3.3.1 ) When adding the RNA to the tubes, add 5 pL of total RNA, 2.5 pL of target competrtor RNA, and 2 5 pL of housekeeping competitor RNA Proceed with the reverse transcription protocol (Sectton 3.3 1 ). Include controls for both the target and the housekeeping genes Prepare PCR mixes with primers for both gene sets. We have found rt helpful to do the nested PCR reactions separately, that ts, target amphficatton in one tube and housekeeping gene m another tube to allow for ease m analysis of final products. This results in twice the number of gels, but 1s worth the effort when the time comes to do the quantitation Carry the housekeeping gene competmve PCR through all the steps as for the target At the end of quantitation, all target levels can be normalized to the housekeepmg gene levels, and thus data can be compared 4. Notes 1 The ultimate demonstratron of ribozyme efficacy would include evidence that the lowered target RNA abundance actually 1sowing to cleavage at the rtbozyme target site Such demonstrations are often made difficult by the rapid turnover of cleaved message and will not be addressed m this chapter (see Chapter 33). 2. QCPCR assays can be designed with fewer data points than are recommended in this chapter. Fewer data pomts will mean less effort per sample, but tt also will mean less accurate quantitation of RNA abundance 3 Minor discrepancies can artse from a wade vartety of sources Differences m tissue extractton efficiencies and pipetmg errors are likely sources of minor deviations, as are differential efficiencies of reverse transcription and PCR amphfication. Constder the case where two samples contam the same amount of target

nucleic acid, but that sample2 containsslightly more salt or a small amount of organic solvent, whtch causes the target nucleic acid to be amphfied 5% less

338

4.

5

6.

7.

8

9. 10

11.

12

Beaudry and McSwiggen efficiently than m sample 1 After 30 rounds of amphflcatton, the amount of sample 2 relative to sample 1 will be (.95)30 = 0 2 15 Thus, sample 2 would appear to have only 21% of the material seen m sample 1 We often calculate annealing temperatures by usmg a standard formula where G/C base pairs are given 4°C and A/T base pairs are given 2°C. There are computer programs that use more sophistmated methods to determine annealing temperatures. Examples for the Macintosh include. GeneWorks (Intelhgenetics, Mountam View, CA) and Oligo (National Biosciences, Plymouth, MN) Gel purificatton serves to remove any of the initial template left m the reactton, thus preventing It from amplifying m the next step This IS important, since you do not want any of your target to contaminate the competitor If you do not see amphticatton products from this PCR, try reducing the annealing temperature by 5°C and checking to ensure that you have added the correct primers to the reaction Sometimes the primer that was chosen will not work at all, in that case, try redestgnmg the primer and/or competitor sites The FG and FG7 primers differ only m that the FG7 primer has the T7 promoter sequence appended to tts 5’-end. In many instances, the FG7 primer can be used m both steps of the reaction. However, we have found that the presence of a T7 promoter m the primers can sometimes interfere with PCR amplification from a template containing the T7 sequence. If you have access to a cell line that expresses good levels of your target gene, we recommend practicing on total RNA from these cells to get a good feel for the assay. We are usually looking for a reduction m target message owing to ribozymemediated cleavage m a particular cell type. Thus, we often practice by using untreated cells, since they should have higher levels of the mRNA target than will be observed after rtbozyme treatment We add 1 pL of 20 mg/mL giycogen to the extracted total RNA lust before tsopropanol prectpttation A second prectpitatron m ethanol is recommended to get the RNA completely clean For example, if the target RNA is expected to fall m the range of 105-lo6 molecules, then a competttor RNA range of 103-lo8 molecules will give a good safely margin. The accuracy of the quantitatton is directly related to the number and spacmg of the mput competitor concentrations Accurate quantttation is best achieved when competitor concentrations fall within IO-fold, and preferably three- to fivefold, of the target concentratton In addition, tt is desirable to have 2-3 points within accurate quantrtatton range of the target concentration to control for outhers The most important controls are the negative control and the “no RT” control for each sample (see Table 1) Amplification of the total cellular RNA without reverse transcriptase 1sa control for contammatmg DNA that might have been introduced during the purification steps. The contammatmg DNA can “add” to the quantitation and give a higher readmg than is actually the case Thus, it IS important to run this control, especrally if the sample has very low levels of target RNA For the control reactions, you wtll need to add sterile water m place of template to bring the volume up to the desired level.

QCPCR

339

13 The annealmg temperature can be estimated from the formula m Note 4; we usually work 5-10°C below the calculated annealing temperature For target products longer than 500 bp, the extension time at 72’C can be lengthened from 1 mm to 2 mm 14 We have a separate area set aside for the analysis of PCR products, so as not to contaminate the other work areas with amplified products 15 Be careful not to run the gels at an elevated temperature, since the Nusieve GTG agarose has a low melting point For some targets, it has been useful to run the samples on sequencmg gels, that is, we run the samples on denaturmg, 68% polyacrylamide gels In that case, the gels are dried under vacuum as wtth a standard sequencing gel 16 We find that radtoimagmg using the Molecular Dynamics PhosphorImager to be particularly fast and efficient. 17 Some restriction enzymes ~111 not work in PCR buffer conditions It may be necessary to clean up the fragments before doing the digests, using chloroform extractton and ethanol prectpnation, or using the GlassMax DNA isolation system.

References 1 Grlliland, G., Perrin, S., and Bunn, H. F. (1990) Competmve PCR for quantttation of mRNA, m PCR Protocols* A Guide to Methods andApplrcatlons (Inms, M. A , Gelfand, D. H., Snmsky, J. J., and White, T. J., eds.), Academic, San Dtego, CA, PP 60-69 2. Thompson, J., Brodsky, I., and Yunis, J. (1992) Molecular quantitatton of restdual disease in chronic myelogenous leukemia after bone marrow transplantation Blood 79, 1629-l 635 3 Kwok, S (1990) Procedures to mmimize PCR-product carry-over, in PCR Protocols A Guzde to Methods andApp1icatzon.s (Inms, M. A., Gelfand, D. H., Sninsky, J. J , and White, T. J , eds.), Academic, San Diego, CA, pp. 142-145 4 Orrego, C. (1990) Organizing a laboratory for PCR work, in PCR Protocols A Gurde to iwethods and Apphcatzons (Inms, M. A., Gelfand, D. H , Snmsky, J. .I., and White, T. J., eds ), Academic, San Diego, CA, pp 447454. 5. Higuchi, R (1990) Recombinant PCR, m PCR Protocols A Gwde to Methods and Applications (Inms, M. A, Gelfand, D. H , Sninsky, J. J and White, T J., eds), Academic, San Diego, CA, pp. 177-183. 6. Chomczynski, P. and Sacchl, N. (1987) Single-step method of RNA isolation by acid guamdinium thiocyanate-phenol-chloroform extraction Anal Brochem 162, 156-159

35 Trans-Splicing

Reactions by Ribozymes

Joshua T. Jones, Seong-Wook

Lee, and Bruce A. Sullenger

1. Introduction

Pans-cleaving ribozymes can be targeted to cut specific RNAs in vitro, which has led to much interest m their potential to destroy specific messages inside cells. Here, we will describe a different reaction catalyzed by ribozymes that may allow them to be employed to “revise” genetic mstructions, not just destroy them (see Fig. 1) (I). The Tetruhymena thermophilu self-sphcmg group I mtron naturally excises itself from pre-rRNAs by performing two successive transesterification reactions (see Fig. 2A) (2). First, the phosphodiester bond that attaches it to a 5’-exon is broken. Then, holding onto the S-exon via base patrmg with its 5’-exon binding site, the ribozyme catalyzes the ligation of the 5’-exon onto the 3’-exon to liberate itself. Careful characterization of this reaction has illustrated that the vast majority of sequence requirements for such sphcmg are contained within the mtron. The sequence of the 3’-exon can be made of virtually any sequence, and the 5’-exon must only have a uridine at the splice site and maintain basepairing between the end of the exon and the mtron’s 5’-exon binding site (see Fig. 2A). A slightly shortened version of the Tetrahymena group I ribozyme called L-2 1 (3) has been shown to mediate trans-splicing of ohgonucleotides m vitro (see Fig. 2B) (4,5). Recently, this trans-splicing ribozyme was employed to repair defective mRNAs to yield functional messages in vtvo (6). Thus, trunssplicing ribozymes can generate stable reaction products, which can go on to be translated m cells. Such reactions should prove to be useful in the study of RNA catalysis in vivo. Also, because genetic information is altered at the RNA level, truns-splicmg rtbozymes may serve as the basis for an alternative approach to gene therapy. From


B/ology, Vol 74 Rfbozyme Protocols Humana Press Inc , Totowa, NJ

341

342

Jones, Lee, and Sullenger B

A DNA

-

RNA

TRANS-CLEAVAGE

\\\\\\\\\\\\\\\\\\\\

RNA Destroyed

PROTEIN No Protem Produced

Modfled

Protein Produced

Fig. 1. hbozyme-medlateddestructlonof RNA vs nbozyme-medlated revlslonof RNA. The followmg protocols describe the steps one needs to take to design and analyze a trans-sphcmg reaction m vitro. First, we will describe how to transcribe and isolate a trans-splicing rlbozyme derived from the L-21 version of the Tetrahymena mtron (3), with any 3’-exon appended to the end of the nbozyme. Next, we wrll describe how to perform a nbozyme-mediated transsplicing reaction with the desired S-substrate RNA m vitro. Fmally, we ~111 describe how one can analyze the trans-splicing products via reverse transcription and the polymerase chain reaction (RT-PCR) followed by dideoxy sequencing of the amplified fragments. 2. Materials All materials

and chemicals used in molecular

biology

techniques should be

considered to be potential health hazards, and appropriate handling procedures should be employed

(see Notes 1 and 2).

2.1. Transcription and Gel Isolation of a Tram-Splicing Ribozyme 1, A plasmid containing aproperly engineeredL-2 1(active and inactive) rlbozyme preceded by a T7 RNA polymerase promoter, and followed by the desired 3’-exon sequence (see Notes 3 and 4). 2 The appropriate restriction endonuclease and manufacturer’s buffer to cleave the plasmld before run-off transcription

Tram-Splicing

343

Reactions B

A # 5’ exon u/,/,,,z7/w,v,m/ lntron

2?5-??,/,

1

Cleavage

/ m/,,,,,, I

Cleavage of target

/,11,/,////

1

Ligation

P~III,,,,,,,,,

\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ +!r Ligation of target and 3’ exon 1 ,,,,,,,,,,,,,,,,,~,,,,,,,,,,,,,,,,,”~” +

+

Fig. 2. Self-sphcmg and targeted trans-sphcing

3 10X Trans-splicing transcription buffer: 400 mA4 Trts-HCl, pH 8 0, 50 mA4 MgC&, 100 mM DTT, 40 mJ4 spermidine. 4. Mix of ATP, GTP, CTP, and UTP each at a concentration of 10 mM, pH 7 0 5 Sterile dtsttlled H,O. 6 [cL-~~P] ATP (10 mCi/mL, 3000 Ci/mmol): ensure the age of the radioactive label is ~14 d old. 7 T7 RNA polymerase 8. 37°C Water bath 9. TE buffer: 10 mk! Trts-HCl, pH 8 0, 1 mA4 EDTA. 10. RNA elutlon solution 0.4 MNaCl, 10 mM EDTA, 2% SDS. 11 10X TBE* 890 nnI4 Trts-borate, pH 8 3,20 mM EDTA. 12 2X Loading buffer with urea: 0 1X TBE, 0.1% xylene cyanol, 0.1% bromophenol blue, 20% sucrose, 7 M urea. 13 Polyacrylamide gel with 8 M urea (store polyacrylamide at 4°C and TBE buffer at room temperature) 14 Spectrophotometer 15. Phenol chlorofotmisoamyl alcohol (49.5:49.5*1) solution (store at 4°C): this should be used m a fume hood.

2.2. In Vitro Trans-Splicing 1 2X Spltcing buffer: 100 mA4HEPES, 2. 50°C Water bath

pH 7.0, 300 mA4NaC1, 10 mh4MgC12.

Jones, Lee, and Sullenger

344 3 4. 5 6. 7 8 9. 10

37°C Water bath 5’-RNA substrate (see Note 5). Body-labeled ribozyme with attached 3’-exon from Section 3 1 100 @4GTP. OSMEDTA. 2X Loading buffer wtth urea (see Section 2.1.). Polyacrylamtde gel with urea (see Section 2 1 ) 65°C Water bath

2.3. Sequencing

of Trans-Spliced

Products

1 RNA reaction products from Section 3 2. 2 Reverse transcriptase with manufacturer’s 5X buffer (e.g , Boehrmger Mannhelm [Indianapolls, IN], 25 U/$) 3. A primer (10 @4) that anneals to a specified region of the 3’-exon approx 100 nt downstream of the predicted splice site and that contains a convenient cloning site at its 3’-end (we design ours with a BamHI restnctton site) 4. 65°C Water bath. 5 10rniVdNTPs 6 37°C Water bath 7 Taq DNA polymerase (5 U/l&) and manufacturer’s PCR reaction buffer with Mg2+ (e g , Boehrmger Manhelm). 8 A primer (10 pA4) that is spectfic for a region of the 5’-substrate approx 100 nt upstream from the predicted splice site and that contains a convenient clonmg site at its 5’-end (we design ours with a KpnI restriction site). 9. Agarose gel containing ethidium bromide (10 pg/mL). 10 Light mineral 011 11. DNA thermal cycler (e.g., Perkin Elmer). 12 Phenol*chloroform.isoamyl alcohol, 49.5.49 5 1, v/v/v (store at 4°C) 13 5MNaCl 14. Ethanol. 15 Microcentrifuge m a cold room 16 70% Ethanol 17. All reagents needed for subcloning the amplified product into a plasmtd (e.g., pUC 19) that can be grown m Escherichza colz 18. 2 MNaOH. 19. 3 MNa acetate, pH 5.2 20. Sterile dH20 21. Sequencing primer for sequencing products cloned into the polylinker of pUC19 (e g , #1201 reverse sequencing primer New England Biolabs, Beverly, MA) 22. Sequencing kit (e g , Sequenase kit, U.S. Biochemicals, Cleveland, OH). 23 [a-35S] dATP for sequencing (10 mCt/mL, 1000 Ct/mmol) 24. Sequencing gel apparatus. 25. Denaturing polyacrylamide sequencmg gel.

Tram-Splicing

Reactrons

345

3. Methods 3.1. Transcription and Gel Isolation of a Trans-Splicing Ribozyme For this protocol, one needs a plasmld construct that contains the L-21 (or the L-2 1 dead) version of the group I rlbozyme (3) preceded by a T7 promoter and followed by the desired 3’-exon. Digest the plasmld with a restriction endonuclease that cleaves Just downstream of the 3’-exon, and gel-purify the digested DNA. The rlbozyme template is now ready for a runoff transcription to generate the trans-splicing nbozyme. 1 Add xl pg of gel-purified dlgested template DNA to the following, which should be assembled m order. dHzO to 100 & reaction volume, 10 clr, of 10X transcnptlon buffer, 30 pL of 10 mMNTPs, 1 pL of [u-~~P] ATP, and 5 & of T7 RNA polymerase (see Notes 68). 2. Incubate for 2 h at 37°C 3. Add 100 Ils, of phenol.chloroform*lsoamyl alcohol and vortex 4. Microfuge at >lO,OOOg for -30 s to separate the layers and remove the top aqueous phase to a new tube Discard the phenol:chloroform layer into an organic waste container. 5. Add NaCl to a final concentration of 0.3 Mand 2 vol of ethanol Place on dry ice until frozen (~5 mm) 6 Microfuge at >lO,OOOg for 20 mm at 4°C. 7 Discard the supernatant, and wash the pellet with 1 mL of 70% ethanol. 8. Resuspend the RNA pellet m 25 pL of TE buffer. 9. To the resuspended RNA, add 25 pL of 2X loading buffer, heat to 6YC for 5 mm, and electrophorese the RNA on a 4% polyacrylamide gel contammg 8 M urea (see Note 9) 10. Place the gel on a sheet of X-ray film m a darkroom, and develop the exposed film to determine the location of the ribozyme-3’-exon transcript 11. Using a razor blade, excise the full-length ribozyme with attached 3’-exon 12 Soak the gel slice in 1 mL of RNA elutlon solution overnight at 4°C with shaking. 13. Remove the elutlon buffer, and extract it with an equal volume of phenol chloroform:lsoamyl alcohol Remove the aqueous layer, and add twice the volume of ethanol to precipitate on dry ice as described in steps 5-7, above. 14 Resuspend the pellet m 25 @. of dH20. Derermme the concentration of RNA by analyzing a dilution of the sample m a spectrophotometer. 15. Store the RNA at -20°C until needed

3.2. In Vitro Tram-Splicing Before beginning the trans-splicing reaction, you should prepare a set of labeled microcentrifuge tubes correspondmg to the time-points to be taken m the reaction. Place 3.0 pi, of the reaction stop solution (2X loading buffer + 10mM EDTA) mto each tube.

346


1 Preheat the body-labeled rtbozyme-3’-exon RNA (200 nA4) from Section 3.1. m 10 pL of 1X splicing buffer at 50°C for 5 min Simultaneously, preheat the 5’substrate RNA (1 l&Q m 1X splicing buffer with GTP (100 pM) 2 Equilibrate both tubes at 37°C for 2 mm. 3 Start reactions by combining the 10 p.L solution of the 5’-substrate/GTP and the 10 & solution containing the labeled ribozyme-3’-exon 4 Remove 3 pL of the reaction at times t = 0, 2, 10,60, and 180 mm, and quickly add it to the appropriate tube containing 3 pL of the stop solution 5 To analyze the reaction products, heat the sample at 65’C for 5 mm, and electrophorese them on a 4% polyacrylamide gel contammg 8 M urea 6. Visualize the products by exposing the gel to X-ray film. 7 If splicing has proceeded correctly, the body-labeled rtbozyme-3’-exon RNA should be converted to free ribozyme and trans-spliced 5’-3’ exon RNAs

3.3. Sequencing of Tram-Spliced Products This protocol can be employed to determine the sequence around the transspltcmgjunction. An m vitro trans-splicing reactron should be performed as in Section 3.2. using a rtbozyme that is not radroactlvely labeled. The sequence surroundmg the spltce junction ts then amplified using RT-PCR. Finally, the amplified fragments wrll be subcloned and sequenced using the dideoxy method. 1 Add 10 pL of the trans-sphcing reaction to the following. 10 pL of 5X reverse transcriptase buffer, 10 pL of downstream primer (10 pM) complementary to a region of the 3’-exon sequences, and 14 pL of dH20 2. Heat to 65°C for 2 mm, and then cool to room temperature for :T.5 mm. 3 Add 5 pL of 10 mM dNTPs and 1 pL of AMV reverse transcriptase (25 U/pL) 4 Incubate at 37“C for 30 mm. 5 Add 10 pL of 10X PCR buffer, 5 pL of 10 mM dNTPs, 10 p.L of upstream primer (10 @4) specific for the 5’-substrate sequence, and 24 pL of dH,O 6. Heat to 95’C and add 1 pL of Tuq DNA polymerase (5 U/pL) 7. Amplify for 30 cycles as follows 95°C (30 s), 55°C (30 s), 73°C (30 s) 8 Analyze an aliquot of the reaction on an agarose gel containmg 10 pg/mL ethtdmm bromide (optional). 9 Remove the PCR mix to a clean microfuge tube, add an equivalent volume of phenol:chloroform:isoamyl alcohol, and vortex 10. Microfuge at >lO,OOOg for 030 s to separate layers and remove the top aqueous phase to a new tube. Dispose of the phenol.chloroform layer by placing in an organic waste contamer 11. Add NaCl to a final concentration of 0.3 M and 2 vol of ethanol. Freeze on dry ice. 12. Microtige at > 10,OOOgfor 20 min at 4°C. 13. Discard the supematant, and wash the pellet with 70% ethanol. 14. Resuspend the pellet in 100 pL of dH20

Tram-Splicing

Reactions

347

15 Subclone the amplified fragment into a convenient plasmtd (e g., pUC 19), and grow It up m E ~011. 16 Denature 2-3 pg of the isolated plasmtd DNA m a final concentratton of 0.2 M NaOH for 5 mm at room temperature Add 0.4 vol of 3 MNa acetate, pH 5.2, and 4 vol of ethanol Freeze on dry ice, and then microfuge at >lO,OOOg for 20 mm at 4°C. Wash the pellet with 70% ethanol. 17. Resuspend the DNA m 7 pL of dH,O. Add 1 pL of sequencing buffer (e.g., Sequenase buffer, U.S. Btochemtcals [Cleveland, OH]) and I pL of the approprtate sequencing primer (0 5 pmol/pL) 18. Heat to 65°C for =2 mm and then slow cool to room temperature for 20 mm. 19. Sequence the plasmid inserts using the dideoxy method Separate the sequence ladders on a 8% denaturing polyacrylamide sequencing gel

4. Notes 1. Generally, all reagents used m the above protocols should be stored at -20°C unless autoclaved ahquots are stable at room temperature 2 Because these procedures mvolve RNA, gloves should be worn at all times. All solutions, tubes, pipet tips, and anything else coming in contact with the RNA should be RNase-free. 3 The L-21 form of the ribozyme used lacks the first 2 1 nucleotides of the 5’-end of the group I self-splicmg mtron from which it was derived (3). The mactive rtbozyme is generated by deleting 93 nucleotides of the catalytic core including the G binding site (6) 4 The 5’-exon bmdmg site on the ribozyme and the 3’-exon sequence can be changed by conventional cloning techmques. 5. There are no sequence requirements for the 5’-substrate, except that the region Just 5’ of the wanted splice sue must be able to base pair with the guide sequence of the rtbozyme and that a uridine residue be present at the ligation site. 6. Before proceeding, one needs to note that he/she 1s workmg with radroactive maternal, and must employ appropriate precautions durmg its use and disposal 7 In vitro transcrtption of the rtbozyme-3’-exon RNA is performed m 5 mMMgCl* and 3 mM NTPs to inhibit 3’-exon hydrolysis. 8. One can specifically reduce the concentration of the nonradioactive ATP IO-fold in the transcription reaction to generate ribozyme-3’-exon RNAs wrth a higher specific activity 9 Gel type and concentration should be chosen based on the size of the ribozyme3’-exon transcript. For RNAs >I kb, rtbozyme transcripts should be Isolated from a low-melting agarose gel

References 1. Sullenger, B. A. (1995) Revising messages traveling along the cellular mformation superhighway Chem Btol 2,249-253. 2 Cech, T. R (1990) Self splicing of group I introns Annu Rev Biochem 59, 543-568

348


3 Zaug, A. J , Grosshans, C. A , and Cech, T. A (1988) Sequence-spectftc endortbonuclease actwtty of the Tetrahymena rtbozyme. enhanced cleavage of certain oligonucleottde substrates that form mismatched rtbozyme-substrate complexes Biochemistry 27,8924-893 1 4 Inoue, T , Sulhvan, F X., and Cech, T. R. (1985) Intermolecular exon hgatton of the rRNA precursor of Tetrahymena. oligonucleotides can functton as 5’ exons. Cell 43,43 l-437 5 Been, M. D and Cech, T R. (1986) One bmdmg site determines sequence spectticity of Tetrahymena pre-rRNA self splicing, trans-sphcing, and RNA enzyme activity Cell 47,207-2 16 6. Sullenger, B A. and Cech, T. R. (1994) Rrbozyme-medtated repair of defective mRNA by targeted trans-sphcmg. Nature 371,6 19622.

Ligation of RNA Molecules by the Hairpin Ribotyme Alfred0

Bertal-Herranz

and John M. Burke

1. Introduction Ribozymes are capable of catalyzing a variety of RNA cleavage, ligation, and sphcmg reacttons. Of these three reaction types, ligation 1sthe least-studied, primarily because of practical difficulttes m achtevmg reasonable reaction effictencies. Rrbozyme-catalyzed hgatton reactions are of interest for several reasons. Fn-st,ligation 1sthe critical step m a powerful m vitro selection scheme that has been developed m our laboratory (J-3). Second, understanding the chemistry, thermodynamtcs, and kmetics of the ligation reaction is tmportant for understanding the reaction m vitro and in the native biologtcal environment of the rtbozyme. Third, learning to exploit the ligation reaction will enhance our ability to manipulate RNA molecules m vitro, and may directly contribute to our efforts to develop a technology of engineered ribozymes for targeted RNA cleavage and recombination m VIVO. The rtbozymesdescribed in this volume are classified into several groups based on RNA structure and reaction chemistry (4). Ribozymes that catalyze RNA cleavage and ligation reactions that generate and utilize termini with Y-hydroxyls and 2’,3’-cyclic phosphates(e.g., the hammerhead nbozyme, hepatitis 6 ribozyme, Neurospora vs rtbozyme, and hairpin rtbozyme) are widely studied. In contrast with protein ribonucleases, each of these ribozymes catalyzes a reaction that is highly sequence-specttic and where this specttictty is entirely determined by RNA-RNA mteractions. Typically, 8-12 bases are effectively recognized by the rtbozymes mentioned above. These same rtbozymes can catalyze formation of a 3’-5’-phosphodiester linkage. In infected plant cells and in the testtube, linear forms of the negative-polarity strand of the satellite RNA associated with tobacco rmgspot virus ([-]sTRSV) containing the hairpin ribozyme domain give rise to circular RNA molecules From



349

Berzal-Herranz and Burke

350 HELIX

3

Ligation

product

(cleavage

substrate)

HELIX 2

,.GCC

ts .

“c cagu

uuuguc 111111

Ill1 G”CA&50

AAACAG

+

5

5’ gcgugaca-guccuguuu

‘*..

1

3’

AA*

/ GIG

10

H&L I

L/GA T/ON

CLEAVAGE

Ligation (cleavage

A U

A

,oguCcUguuu 3’LS

5’LS

A

G

I’ gcgugaca>p

20.

substrates product)

A” A

;0

AU

I

HELIX 4

Fig. 1. Reversrblecleavagereaction catalyzed by the halrpm nbozyme. A secondary structure model of the ribozyme-substrate complex IS shown on the right (2) RNA substrates for the hgatlon reaction 3’LS and 5’LS are Indicated. Upper-case letters

indicate rrbozyme,lower-caseletters tndtcatesubstrate Arrows indicate the cleavage ligation site. The pentacytrdmelinker Joining the S-end of the substrateto the 3’-end of the rtbozymem the self-cleaving rtbozyme-substrateconstructis indicated by dotted Imes. In trans-actmgconstructs,rrbozyme,and substrateare separatemolecules (5,6). This ligation reaction involves transesterrfication chemistry, and 1s accompanied by loss of a 2’-3’-cyclic phosphate m the 5’-ligation substrate. This chapter focuses on the m vitro RNA ligation reaction catalyzed by the hairpin ribozyme (Fig. 1). The 50 nt trans-acting ribozyme was developed to catalyze cleavage of an external RNA substrate (7,8). The cleavage products can be used as substrates by the hanpin catalytic domain to catalyze a RNA hgatton reaction (I, and Berzal-Herranz et al., unpublished data). All available data are consistent with the hypothesis that the ligation reaction occurs through a simple reversal of the cleavage mechanism (2,9-12, and Berzal-Herranz et al., unpublished data). As for cleavage, ligation is a highly sequence-specific event. This opens the possibility of engineering hairpin ribozymes for developing sequence-specific RNA ligases for RNA mampulation. Group I ribozymes also catalyze formation of 3’-5’ phosphodiester linkages. However, formation of a new bond is always accompanied by concomitant cleavage of another 3’-5’ phosphodiester linkage in a transesterrficatton reaction (23).

Ligation of RNA Molecules

351

Here, we describe two different protocols for ligation reactions by the hairpm rlbozyme (see Fig. 1). They differ in the number of molecular species mvolved. The first mvolves a bimolecular reaction, where the 5’-substrate for ligation (containing the 2’,3’-cychc phosphate) is covalently linked to the 3’-end of the ribozyme, and the 3’-substrate (contammg a 5’-OH) is provided m trans. Ligation (“self-1igatlon”) yields a single molecular species containing the ribozyme covalently linked to the ligation product. The second IS a trlmolecular reactlon where the hairpin ribozyme catalyzes ligation of two short RNA substrates in a truns-reaction that yields the ligation product and regenerates free nbozyme. 2. Materials As for all rlbozyme reactions, it IS critical that all steps be carried out in a nbonuclease-free environment (see Note 1). All solutions should be prepared using diethyl pyrocarbonate (DEPC) to inhibit protein nbonucleases, unless spec&ally indicated as follows. Add DEPC to a final concentration of 0.1% (v/v), and stir vigorously

for 10 min. Autoclave

solutions to destroy unreacted DEPC.

1. DEPC-treated d&lled, deionized water (ddHzO). 2. 1 MMgCl*. 3. 1 M Tris-HCl, pH 7 5, prepared in DEPC-treated ddHzO Do not add DEPC to solutions containmg Trls buffers. 4 For the bimolecular reaction (Section 3 1.), two RNA molecules are required (see Fig 1): first, the ribozyme covalently tethered to the S-ligation substrate (Rz-SLS) and, second, the 3’-substrate for ligation containmg a 5’-OH group (3’LS) Note that the 3’-ligation substrate IS identical to the 5’-cleavage product. After chemlcal synthesis or m vitro transcrlptlon (see Note 2), all RNA molecules should be stored in DEPC-treated ddH20 at -20°C 5. For the trimolecular reaction (Section 3.2.), three RNA molecules are required (see Fig. 1) first, the 50 nt truns-acting rlbozyme (Rz), second, the 5’-ligation substrate containing the 2’-3’-cyclic phosphate (5’LS, identical to the 5’-cleavage product), and third, the 3’-ligation substrate (3’LS), as described above

3. Methods 3.1. Bimolecular

Reaction

1. Mix the two RNA species (Rz-5’LS and 3’LS) in a mlcrocentrlfuge tube in a buffer containing 40 mMTris-HCl, pH 7 5 (see Note 3). Either or both RNA species may be radloactlvely labeled for ease m visualizing and quantitatmg reaction results. Either species may be labeled with trace quantities of an CX-~*PNTP. Alternatively, the Rz-S’LS may be 5’-end labeled with Y-~*P-ATP and T4 polynucleotide kinase, and/or the 3’LS may be 3’-end-labeled with [5’-32P] pCp and T4 RNA hgase 2 Denature the RNA by mcubatmg at 95°C for 90 s.

Berzal- Herranz and Burke

352

3 Transfer the sample to an me-water bath, and incubate for 15 mm to allow the RNA molecules to renature and the substrate to anneal to the ribozyme. 4 Initiate the ligation reaction at 4°C by addition of MgCI, to a final concentration of5mM. 5 Incubate samples at 4°C for times up to 2 h (see Fig. 2 and Notes 4 and 5) 6 Terminate the reaction by quenching with excess EDTA and adding formamide loadmg buffer

3.2. Trimolecular

Reaction

1 Mix the three RNA species (Rz, S’LS, and 3’LS) m a microcentrifuge tube m a buffer containing 40 mM Trts-HCl, pH 7.5 (see Notes 2 and 3) Label 5’LS or 3’LS, or both, with 32P to follow and quantitate the reaction. 5’LS can be mternally labeled or 5’-end-labeled 2 Denature the RNA by mcubatmg at 95’C for 90 s 3 Transfer the sample to an ice-water bath, and incubate for 15 min to allow the RNA molecules to renature and the substrate to anneal to the ribozyme 4 Initiate the ligation reaction at 4°C by addition of MgCl, to a final concentration of 10 mM. 5 Incubate the samples at 4°C for times up to 2 h (see Fig 2 and Notes 4 and 5) 6. Terminate the reactton by quenching with excess EDTA and adding formamtde loadmg buffer

4. Notes 1 To carry out the experiments described m this chapter, it IS necessary to create an experimental environment that is strictly free of ribonucleases to ensure integrity of the ribozyme, RNA substrates, and reaction products A detailed description of precautions and procedures for creating rtbonuclease-free laboratory envnonments has been provided (14) 2 RNA molecules to be ligated by the hairpm ribozyme must fulfill certain sequence and structure requirements, as must the cognate ribozyme. Information concerning the requirements for designmg effective ban-pm ribozymes and substrates can be found m Chapters 18 and 19. Two requirements are partmularly critical. First, the base at the 5’-end of 3’LS must be guanosme (10) with a 5’-hydroxyl group Second, the nucleotide at the 3’ end of the other legation substrate (SLS or Rz-S’LS) must contain a 2’,3’-cyclic phosphate (7,8) The 3’LS RNA substrate can most readily be generated by solid-phase RNA synthesis (15). Alternatively, it can be generated by m vitro transcrtption of ohgonucleotide templates with T7 or SP6 RNA polymerase (16). If this latter method is used, the S-termmal guanosme triphosphate must be enzymatically dephosphorylated with alkaline phosphatase (17). The 2’-3’-cyclic phosphate terminus of the 5’LS can readily be obtained by cleavage of the appropriate RNA molecule with a hairpin ribozyme or, alternatively, a hammerhead, HDV, or VS rtbozyme. Alternatively, tt may be generated chemically, by periodate oxtdation followed by p-elimination (18)


0

20

353

40

60

60

100

120

140

TIME (min) Fig. 2. Temperature dependence of the ligation reaction. The effect of temperature on the bimolecular ligation reaction is shown. The figure shows a plot of a time-course for hgatron at mdicated temperatures. Ligation reactions were carried out in a buffer containing 5 mM MgC12 and 40 mM Tris-HCI, pH 7.5. RNA molecules were denatured at 95°C for 1 5 mm and then renatured on ice for 30 min m the absence of MgCl,. Samples were equilibrated at the desired temperature for 15 mm Ligation reactions were initiated by adding MgCl, Results were quantitated using a radioanalytical imagmg mstrument

3. For the bimolecular reaction, the yield of ligated product increases with the concentration of the 3’LS, reachmg a maximum at 3 l.1J4 A 60 1 ratio of 3’LS to Rz-S’LS was found to be the optimum (50 nM Rz-S’LS, 3 p/U 3’LS) For the trimolecular reaction, the yield of ligated product Increases with the concentratron of substrates, reaching the maximum at 2 @4 of 3’LS In contrast, we did not observe saturation of the reaction at 5’LS concentrations up to 25 @4 The reason for this 1s unknown, but may possibly be owmg to conformational heterogeneity of the wild-type hairpin ribozyme (3). Concentrations of 3’LS higher than 3 pM (bimolecular reaction) and 2 l.uU (trimolecuiar reaction) have an mhibitory effect on the overall reaction. This inhibitory effect cannot be overcome by increasing concentrations of the other RNA species involved in the reaction. 4. For both reactions described, we found that 4’C is the optimal temperature for the ligation reaction. If necessary, RNA ligation can also be achieved at other temperatures, with a somewhat lower yreld of hgated product (see Fig. 2). 5 The hairpin ribozyme can catalyze the hgation of a DNA molecule analog of the 3’LS to the 5’LS RNA m a sequence-specific reaction, under the same conditions described above. However, reaction efficiency is much lower than with an RNA

Berzal-Herranz and Burke

354

3’LS. A more effctent reactton can be obtamed by mcreasing MgCI, concentration to 25 mM or higher (Berzal-Herranz et al , unpublished data). Because the nucleottde at the posmon immediately 5’ to the cleavage sate (correspondmg to the 3’-end of the 5’LS) 1sthe only essential rtbonucleotide within the substrate for the cleavage reaction (19), it 1slikely that the hanpin nbozyme can catalyze ligation of two DNA molecules (3’LS and 5’LS) if the latter species has a single rtbonucleottde with a 2’,3’-cychc phosphate at its 3’-end

Acknowledgments This work was supported by research grants AI29892 Nattonal Institutes of Health

and AI30534

from the

References 1 Berzal-Herranz, A , Joseph, S., and Burke, J M. (1992) In vztro selection of active hau-pm rtbozymes by sequential RNA-catalyzed cleavage and hgatton reactions Genes Dev 6, 129-l 34 2 Berzal-Herranz, A , Joseph, S , Chowrira, B M , Butcher, S E , and Burke, J M (1993) Essential nucleottde sequences and secondary structure elements of the hairpm ribozyme EMBO J 12,2567-2574. 3 Joseph, S. and Burke, J M (1993) Optimization of an anti-HIV hairpin ribozyme by zn vztro selection. J Bzol Chem 268,24,5 15-24,518 4 Symons, R H (1992) Small catalytic RNAs. Annu Rev Bzochem 61,641-671 5 Prody, G A, Bakos, J T., Buzayan, J. M., Schneider, I. R., and Bruenmg, G. (1986) Autolytic processing of dimeric plant virus satellite RNA Science 231, 1577-1580. 6 Buzayan, J M , Gerlach, W L , and Bruenmg, G (1986) Non-enzymatic cleavage and ligation of RNAs complementary to a plant vuus satellite RNA. Nature 323,349-353 7 Hampel, A. and Tntz, R. (1989) RNA catalytic properties of the mmtmum (-)sTRSV sequence. Biochemistry 28,4929-4933. 8 Feldstem, P A , Buzayan, J M., and Bruemng, G. (1989) Two sequences parttcipating in the autolyttc processmg of satellite tobacco rmgspot vnus complementary RNA. Gene 82,53-d 1. 9. Buzayan, J. M., Feldstem, P. A , Bruening, G , and Eckstein, F (1988) RNA mediated formation of a phosphorothioate diester bond. Bzochem Biophys Res Commun 156,340-347 10. Chowrira, B. M., Berzal-Herranz, A , and Burke, J M. (1991) Novel guanosine requirement for catalysts by the hairpin ribozyme. Nature 354, 320-322. 11. Joseph, S., Berzai-Herranz, A., Chowrira, B. M., Butcher, S. E., and Burke, J M. (1993) Substrate selection rules for the hairpin rtbozyme determined by zn vzfro selection, mutation, and analysts of mismatched substrates. Genes Dev. 7, 130-l 38. 12. Chowrira, B M , Berzal-Herranz, A., and Burke, J M (1993) Ionic requirements for RNA binding, cleavage, and ltgatton by the haupm ribozyme Bzochemzstry 32, 1088-1095.


355

13 Cech, T R and Bass, B L (1986) Btologtcal catalysts by RNA Annu Rev Blochem 55,599-629 14 Blumberg, D. D (1987) Creatmg a rtbonuclease-free envtronment Methods Enzymol 152,20-24 15 Wmcott, F., DtRenzo, A., Shaffer, C , Grimm, S., Tracz, D , Workman, C , Sweedler, D., Gonzalez, C , Scarmge, S., and Usman, N. (1995) Synthesis, deprotectton, analysis and purtticatton of RNA and rtbozymes. Nucleic Acids Res 23,2677-2684.

16 Mulligan, J. F. and Uhlenbeck, 0 C (1989) Synthesis of small RNAs using T7 RNA polymerase Methods Enzymol 180, 5 l-62 17 Butcher, S E. and Burke, J M. (1994) A photo-cross-lmkable tertiary structure motif found m functionally distinct RNA molecules IS essential for catalytic function of the haupin ribozyme Blochemlstry 33, 992-999 18 Hertel, K. J., Herschlag, D , and Uhlenbeck, 0 C (1994) A kinetic and thermodynamic framework for the hammerhead ribozyme reactton. Blochemlstry 33, 3374-3385

19. Chowrua, B M. and Burke, J. M (1991) Binding and cleavage of nucleic acids by the “haupm” rtbozyme Blochemlstry 30, 8518-8522

37 Mutagenesis and Modeling of the Hairpin Ribozyme Family Andrew Siwkowski, Mary Beth DeYoung, Pamela Anderson, and Arnold Hampel 1. Introduction This chapter describes methods for the successful two-dlmensional modeling of a small catalytic RNA. Our laboratory has used these methods to model and name the hairpin ribozyme family based on secondary structure predicted from computer modeling and mutagenesis (see Chapter 19) (I, 2,3), The methodology has two basic components: postulation and testing of the model. Postulation of the model is mitially done by computer modeling usmg methods, such as those described rn Chapters 2 and 3. A number of excellent RNA folding programs, using the latest RNA structural informatlon, give the preferred mmlmal energy structures. These structures provide a starting point for the determination of the RNA secondary structures. Homology in the hairpin nbozyme sequencewas found in three parent RNAs m nature, the negative strands of the satellite RNAs from tobacco ringspot vn-us (sTRSV), chicory yellow mottle virus (sCYMVl), and arabls mosaic virus (sArMV) (45). The homologous sequencescan be identified via DNA database searches.The hairpin ribozymes from all three of these sourceshave been shown to catalyzecleavage of their corresponding substrateRNAs m v&o (4,. Comparisons of minimum energy structures in these three systemsprovide valuable twodimensional structural mformatlon. The initial structural comparisons were made based on conserved homologous nucleotides, known essential and nonessential nucleotides, and Watson-Crick pairing m a region of known helix found by modelmg and confirmed by mutagenesisin the sTRSV-based hanpm nbozyme (3). To test a model based on mmlmum energy and phylogenetlc comparisons, it 1snecessary to directly mutate basesin the structures and determine the effect From


Btology, Vol 74 Rlbozyme Protocols Humana Press Inc , Totowa, NJ

357

Siwkowski et al

358

of these changes on catalytic activity. Using this system of analysis, a variety of information is obtained. Mutagenesis of the RNA provides essential structural information to test the predicted models. It 1seasily done for small ribozymes to provide extensive mformation without the necessity of selection. Mutagenesis data can both eliminate and suggest a model from a group of mmimum energy structures predicted by computer modeling and phylogenetrc homology Mutagenesis of small RNAs is designed to identify the two-dimenstonal helical and loop structures The methods are straightforward and very predictive The mutagenesis methods themselves allow one to define regions of base pairing. The approach is to mutate the predicted regions of base pairing to both mismatch and alternative predicted base pairs. These mutations are then all tested individually m comparison to the native nonmutated rtbozyme to compare the effects of the mutation on cleavage activity and/or catalytic eftictency. We have done this for the hairpin rtbozyme-substrate complex, and have identified four hehces and five loops in the structure (see Fig. 1). The two-dimensional structure of the hanpm rtbozyme as determmed by the methods described in this chapter consists of a basic catalytic unit composed of two helices (helices 3 and 4) and three loops. Two of the loops are opposite each other, loops 2 and 4, whereas loop 3 is at the end of a hair-pm stem. Helix 3 has 4 bp and helix 4 has 3 bp. When the substrate binds to the ribozyme, two additional helices and two additional loops form. The two hehces are hehces 1 and 2. Helix 2 has a maximum of 4 bp, with 4 bp being optimal. Helix 1 is of variable length. The two loops formed between the ribozyme and substrate are loops 1 and 5. Loop 1 is in the ribozyme sequence and 1scharacterized by the 4 nucleotides AGAA in the sTRSV ribozyme and CGAA in both the sArMV and sCYMV1 ribozymes. The substrate loop is also 4 nt and has the sequence A*GUC m the sTRSV ribozyme and A*GUA m both the sArMV and sCYMV 1 ribozymes. Cleavage of substrate 1sat the *. 2. Materials 2.1. Sequence Searches and Modeling A simple modern PC or Macintosh computer with accessto the inter-net is required for sequence searching and modeling. 2.2. Mutagenesis Analysis The materials required are the same as those in Chapter 23. 1. 2 3 4

A DNA synthesizeror commercialsupplierfor ohgonucleotidesfor mutagenesis. Electrophoresisfacilities. Photographic facilities Liquid scintillation counter or phosphoimager.

359

Mutagenesis and Modeling

Catalytic

Loop

3

sTRSV Hairpin Ribozyme site of cleavege I RNA Loop 4

Loop

Hehx 4

2

Hehx 3

Hehx 2

Loop

1

Helix

1

sCYMV1 Hairpin Ribozyme we of cleavage Catalytic

Loop 3

RNA

LOOP 4

Helix 4

LOOP 2

RNA

-A

Helix 3

Helix 2

LOOP 1

Helix 1

sArMV Hairpin site Ribozyme ofcleavage

Loop 3 Hellr

4

LOOP 2

Helix 3

Helix 2

LOOP 1

Helix 1

Fig. 1. Comparison of three naturally occurring hairpin ribozymes Illustrated above are the catalytic centers of hairpm ribozymes from the (-) strands of satellites from sTRSV, sCYMV 1, and sArMV. Boxed sequences are common to all three ribozymes. 3. Methods 3.1. Computer

Modeling

The program RNAdraw

version 1.O is an excellent up-to-date RNA structure

modeling program available on the mtemet as freeware. It 1savailable on the RNAdraw homepage at: http:\\mango.mef.ki.se\“ole\rnadraw\rnadraw.html.

360

Siwkowski et al.

It is PC windows-compatible, menu-driven, and very easy to use. For mformation and questions regardmg the program, write to [email protected]. Updates are available on this homepage at brocolli.mfn.ki.se in the pub\rnadraw directory. 3.2. Phylogenetic

Comparisons

of the Three Structures

1 Carry out phylogenetic comparisons In the case of the hairpin ribozyme, since known required nucleotides in the sTRSV based hairpin ribozyme had been previously determined (3), these were used as a basis for phylogenetic searches. The sequence A20 to C44 from the sTRSV hairpm rlbozyme containing the malority of these required nucleotides was used for initial DNA database sequence/structure searches and comparisons 2 Carry out sequence alignments Usmg a search/alignment program, such as BLAST (6), the sequences found m the satellite RNAs from the negative strands of the satellite RNAs from sCYMV1 and sArMV were aligned with the sTRSV ribozyme as shown m Fig. 1. The majority of phylogenetically conserved nucleotides were found m loops 2 and 4 All are shown as boxed regions m Fig 1 When the structural comparisons are made, a helix 4 containing 3 bp and a variable loop 3 are apparent m all three ribozyme structures 3 Identify potential RNA hehces Hehces can be predicted by the occurrence ofparallel complementary bases, which differ between two sources When the sequences flanking the conserved sequence were included m the modeling, a helix 3 also formed 4 Search for a corresponding substrate sequence By analogy with the sTRSV system, a correspondmg substrate sequence should exist When regions upstream of the conserved regions identified above were examined, substrate sequences were found such that hehces 1 and 2 formed (see Note 1). 5 Identify possible essential and nonessential nucleotides for catalysis based on sequence and structural homology comparisons (see Note 2) 6. Look for possible altered substrate specificities apparent from sequence and structural comparisons (see Note 3)

3.3. Mutagenesis Mutagenesis methods are used to confirm structural features in the twodimensional model of the sequences.The methods m general are as described m Chapter 23. 3.3.1. Confirmation

of He/ices

The existenceof helices can be confirmed by mismatch and compensatory base changes. The logic is that a potential base pan is mmally identified by computer modeling and phylogenetic comparison, and then systematically mutated and assayed. 1 Make a mtsmatch change in one member of the pair. 2. Make a mismatch change m the other member.

361

Mutagenesis and Modeling

3 Make corresponding compensatory changes so the base pair reforms 4 Compare catalytic activity between all mutant combinations and native forms If activity is lost in the mismatch and regained in the compensatory base pair, a base pair is predicted to exist This method has been used to confirm all four helices in the sTRSV-based hairpin ribozyme.

3.3.2. Prediction/Confirmation

of loop Regions

Loop regions in a two-drmenstonal model are those in which helices cannot be found by the above methods. The identification of loops is thus by inference and is more subjective than the prediction of helrces. Error 1s minimized, however, when single base changes are made that do not have any effect on activity. This identifies nonessential bases, which are in unpaired regions, i e., loops.

3.3.3. Prediction/Confirmation

of a Hinge

For the sTRSV hairpin ribozyme, when the single mutation A15+G, U49-+A, or U49+C was made, activity was retained. This showed very clearly that the A 15 :U49 base pair, predicted by computer modeling to occur between helices 2 and 3, is not requrred for catalysis. Smce the Al5 nt is between two known helices of 4 bp each, and many essential nucleotides are found further down the structure, it is likely a hinge exists at Al 5 such that the molecule can fold back on itself in three dlmenstons.

3.3.4. The Catalytic Actiwty Assay 1, Prepare RNA A DNA template strand is first synthesized, which contams the (-) strand of the T7 RNA polymerase promoter on its 3’-end and the complementary sequence of the desired rtbozyme on its 5’-end. The (+) strand of the T7 promoter is then annealed to the template. This results m a double-stranded T7 promoter region, which is required for T7 RNA polymerase transcription. Preparation of RNA is described in Chapter 23 2 Compare catalytic rates using standard condition reactions The methods for cleavage activity are described m Chapter 23 In standard reaction comparisons, both native and mutated ribozymes are used in parallel reactions, which contam identical ribozyme concentrations, substrate concentrations, and reaction conditions. The cleavage products are then quantttated, and the percentage of initial substrate that was converted mto product is calculated Any difference in cleavage percentages between the two reactions reflects the effect of the mutation(s) This method is particularly useful m determining the presence of both mtermolecular and intramolecular hehces. Typical reaction conditions for these experiments utilize 10-25 nM ribozyme and 100-200 nZt4 substrate, which are then incubated together m 40 mA4 Tris-HCl, pH 7.5, 12 mM MgCl,, and 2 mM spermidine. Reaction times are generally from 30 mm to 2 h (see Note 4). An example of this method for showing a base pair is given for the sTRSV hairpin ribozyme in Table 1. The mismatch mutations have no activity, whereas activity

Siwkowski et al.

362 Table 1 Use of Compensatory Mutations to Determine Helix Formation Mutation

Percent substrate cleaved

Helix 3 C17+G G47+C C 17-+G/G47-C

NC NC 21%

Helix 4 C27-G G35-C C27-G/G35C

NC NC 10%

NC, no cleavage 1sat least partially restored m the alternate base pair mutants. In addition to [dentlfymg a base pair, these results clearly show a sequence preference m the helix as well (see Note 5) 4. Notes 1 By proceeding upstream and searching for a sequence to base pair to the 5’-end of the rlbozyme m a manner analogous to that of the sTRSV system, a substrate sequence was found. When this was modeled, it had an A*GUA substrate loop, which 1s only one nucleotide different from the A*GUC found m sTRSV In helix 2 the sequences are different among all three RNAs, yet both the sTRSV and sCYMV1 rlbozymes were capable of forming a 4-base Watson-Crick helix 2 The native sequence of the sArMV-derived hairpin ribozyme supported only a 3-bp helix 2. However, a single base mutation in the substrate, which allowed the formation of a 4-base helix 2, was tested As a result of this mutation, cleavage levels were raised to a level comparable to those of the sCYMVl-derived hairpin nbozyme. This tirther supported the hypothesis that, m all three naturally occurring hairpin ribozymes, helix 2 formation 1sas predicted from computer modeling 2 Bases that differ between homologs may be an indication that they are not an essential part of catalysis. An example of such a base exists m loop 1 of sTRSV In sTRSV, the 7th nucleotlde IS an A, whereas m sCYMV1, the corresponding base 1sa C. Later mutagenesis studies indicated that an A, G, or C m this position supports similar levels of catalysis by the sTRSV-derived hairpin nbozyme, thus supporting the idea that the identity of this base is nonessential m catalysis. 3. The significance of different bases occurring m stmllar domains 1s sometimes difficult to determine For instance, sCYMV1 and sTRSV loop 5 regions are identical with one exception; m sTRSV the 8th nucleotlde 1s a C, whereas sCYMV1 contams an A at the same posltlon. While making a model, one may be tempted to say that this base position can be occupied by either an A or a C, but

Mutagenem and Modeling

363

the issue 1smore comphcated than that Changing A to C m sCYMV1 or C to A m sTRSV drastically decreases the efficiency of catalysis Clearly there is a compensatory base (or bases) change elsewhere m the ribozyme that accounts for the accommodation of the A or C m this posttton In searchmg for what this compensatory change may be, only a limited number of essential positions in the sTRSV hairpin ribozyme are different for the sCYMV1 and sArMV rtbozymes Specifically, only three positions m the ribozymes fit this criteria. They are A7, A20, and C44 m the sTRSV ribozyme, which correspond to C7, G20, and U46 in the sCYMV1 ribozyme and C7, C20 and C46 in the sArMV rtbozyme The effects of these base changes on substrate *GUX requirement can be analyzed by mutagenesis, with the aim of understanding the site selection of these rtbozymes 4 This method for catalytic activity comparison is a first approximation and not without error In the Michaelis-Menten equation, the initial velocity is a function of substrate concentration, k,,, and I$,. If these are different for the different mutations, simple comparisons of catalytic activity at a single substrate concentration should be replaced by determmation of k,,, and K, in ribozyme-llmitmg reactions such that turnover occurs. Comparisons would then be made using catalytic efficiency (k,,,lK,) Methods are as given in Chapter 23 5 Although useful m determining the presence of helices, the logic cannot be extended to verification of the absence of a helix If, for instance, a specific functional group on a residue present m a helix contributes either to the catalytic event or to the formation of the catalytic conformation, it would not be expected that activity would be recovered through compensatory mutations to restore the helix When residues are suspected of contributmg to catalysis m a manner other than mere helix formation, it IS useful to examine the mutation’s effect on catalysts m terms of kinetic parameters (k,.,, and K,). The methodology for determmmg these parameters is described m Chapter 23

References 1. Hampei, A. and Trnz, R (1989) RNA catalytic properties of the muumum (-)sTRSV sequence Blochemlstry 28,4929-4933 2 Hampel, A., Trttz, R , Hicks, M., and Cruz, P (1990) Hairpin catalytic RNA model* evidence for helrces and sequence requirement for substrate RNA. Nuclezc AcidsRes 18,299-304 3 Anderson, P., Monforte, J., Trnz, R., Nesbitt, S., Hearst, J , and Hampel, A (1994) Mutagenesis of the hau-prn ribozyme Nucleic Aczds Res. 22, 1096-l 100 4 DeYoung, M B., Srwkowskl, A , Lian, Y , and Hampel, A. (1995) Catalytic properties of hairpin ribozymes derived from chicory yellow mottle vuus and arabis mosaic vu-us satellite RNAs. Bzochemutry 34, 15,785-15,791, 5 Rubino, L , Tousignant, M., Steger, G , and Kaper, J. (1990) Nucleotide sequence and structural analysis of two satellite RNAs associated with chicory yellow mottle virus J Gen. Vzrol 71, 1897-1903. 6 Altschul, S., Gish, W., Miller, W , Myers, E , and Lipman, D (1990) Basic local alignment search tool J Mol Blol. 215,403-410.

Preparation of Homogeneous Ribozyme RNA for Crystallization Jennifer

A. Doudna

1. Introduction The development of m vitro transcription methods has facilitated research in RNA structural biology m recent years. There is now increasing interest m determming atomic resolution structures of RNA by X-ray crystallography. The first step m this process is the production of a homogeneous sample of the RNA molecule of interest for crystallization trials. Although m vitro transcription routmely generates milligram quanttties of a specific RNA sequence, the RNA must be purified away from other reaction components prior to use. In addition, bacteriophage polymerases, such as T7 and SP6, usually add an extra nucleotide onto the 3’-end of about half of the transcripts, resulting in a heterogeneous population of RNA (1). Smce the ends of the RNA can affect the folding of the molecule and may be involved in crystal contacts, it is important to remove the heterogeneous 3’-ends prior to crystalhzation. A method is presented here for generating homogeneous RNA transcripts and purifying them for crystallization trials. My colleagues and I have used thts method to produce RNAs ranging m size from 7@-160 nucleotides, and several of these samples have subsequently been crystallized.

2. Materials 2.1. Transcription,

Processing, and Precipitation

of the RNA Sample

1. One milligram

of a plasmid construct consisting of the exact sequence of interest flanked by a T7 RNA polymerase promoter sequence upstream and a self-cleaving hepatitis 6 ribozyme sequence (2) downstream. The plasmid should be Imearized with a restriction enzyme that cuts mrmediately after the hepatitis 6 ribozyme sequence (see Note 1). From


Bology, Vol 74 Rfbozyme Protocols Humana Press Inc , Totowa, NJ

365

Doudna

366

2 Sterile 40 mL polypropylene centrifuge tubes 3 1 M Stock solutions of Tris-HCl, pH 8.1, MgCl,, dithiothreitol (DTT), and spermtdme all soluttons should be prepared wtth sterile diethylpyrocarbonate (DEPC)-treated water. 4 0.1 A4 Stocks of ATP, CTP, GTP, and UTP, pH adjusted to 8 0 wtth NaOH 5 1% Trtton X- 100 6 Sterile DEPC-treated water (see Note 2). 7 37°C Water bath 8. 65°C Water bath 9 0 5 MEDTA. 10 3 MNaCl 11 Ice-cold 100% ethanol 12 2X Formamide loading buffer 90% (v v) deiomzed formamide, 1X TBE, 0 4% (w:v) each of xylene cyanol, and bromophenol blue

2.2. Gel Purification,

2 3 4 5 6 7 8 9 10. 11 12 13. 14 15

Concentration,

and Analysis of RNA

40% Acrylamide stock dissolve 76 g of acrylamide and 4 g of his-acrylamide m water to give 200 mL of solutton. 10% Ammonmm persulfate (APS) solution (w v) m water. TEMED 10X TBE. 890 mMTns-borate, pH 8.3,20 mMEDTA 3 mm Thtck Teflon spacers and comb for gel 24 x 29 cm. Razor blades Plastic wrap Sterile disposable 50 mL centrtfuge tubes (e.g , Fisher) Handheld short-wave UV lamp Fluorescent thin-layer chromatography (TLC) plate for UV shadowing stlma gel 60 or cellulose impregnated with GF254 or equivalent fluor (e g., #801063, Machery-Nagel, Germany) 10 mL Syrmges. 0 45 pm Filtermg apparatus Amtcon ultrafiltration apparatus and Argon source YM3, lo- or 30-mol-wt cutoff membranes from Amicon, as appropriate 0.2 pm Spm filters (e g., Amicon)

3. Methods 3.1. Transcription, and Precipitation

Processing, of the RNA Sample

In this procedure, RNA transcripts consistmg of the sequence of interest followed by a self-cleavmg hepatitis 6 rrbozyme are produced at 37”C, followed by mcubatron at 65°C to facilitate 6 ribozyme cleavage. The processed transcripts are then precipitated to concentrate the RNA prior to polyacrylamlde gel purtfrcation.

RNA TranscrIption and Punficatlon

367

1. Set up a 10 mL transcription reaction m a 40 mL sterile centrifuge tube. Fmal concentrations of reagents should be as follows: 30 mM Tris-HCl, pH 8.1,25 mM MgCl,, 2 mMspermidme, 10 mMDTT, 0.01% Triton X-100,4 &each of ATP, CTP, GTP, and UTP, 0 25-0.5 mg of linearized plasmrd template (see Note 3), and 0 5 mg T7 RNA polymerase (see Note 4) Incubate the transcription reaction at 37°C for 3 h (see Note 5). Remove and save 10 pL for analysis Incubate the transcription reaction at 65°C for 1 h Remove 10 pL for analysis Check for complete processing of the 6 rrbozyme sequence by adding 10 pL of 2X formamide loading buffer to each reserved sample and loading samples onto a 10% denaturmg polyacrylamide gel containmg 7 M urea. 7 When the bromophenol blue dye reaches the bottom of the gel, stop the electrophorests, stain gel with ethidmm bromide solution (10 pL of 10 mg/mL stock solution in 300 mL of water) to vrsualrze the RNA bands If 6 ribozyme processing is complete, proceed to next step. If processing is incomplete, see Note 6 8 Add 0.5 mL of 0.5 M EDTA solutron to the transcriptton reaction, and mix well to dissolve any magnesmm pyrophosphate precipitate 9 Add 1 mL of 3 MNaCl to the transcriptron reaction, mix, and add 22 mL of 100% ethanol Mix and freeze at -80°C (or on dry ice) for at least 1 h or overnight.

3.2. Gel Purification,

Concentration,

and Analysis of RNA

In this procedure, an RNA sample from a transcription reaction 1s separated from nucleotrdes, aborted transcripts, salts, and polymerase by preparatrve denaturing polyacrylamide gel electrophoresls. The RNA is eluted from the gel, concentrated by ultrafiltration, and analyzed for purity by analytical gel electrophoresis. 1 Resuspend the RNA sample (after precipitation) in 1 mL of sterile DEPC-treated water. Add 1 mL of 2X formamide loading buffer, and heat the sample m a 65°C water bath to dissolve the pellet completely. 2 Prepare 200 mL of polyacrylamide gel solution of the appropriate percentage for the RNA sample (see Table 1). The gel solution should contain 1X TBE buffer and 7 A4 urea. 3 Prepare gel plates. Wash plates thoroughly with detergent, rinse copiously with distilled water, rinse with ethanol, and dry with absorbent tissue. Wash Teflon spacers the same way, and then assemble the gel plates with 3 mm spacers between the plates on either side. A Teflon rectangle 24 x 3 cm is used to form the well for the sample. Clip together the plates with bmder clamps, and tape the bottom and sides of the assembled gel plates with 4 cm wide tape. 4. Pour 30 mL of the gel solution into a beaker, add 0 4 mL of 10% APS solution and 0.05 mL of TEMED, mix well, and pour mto the gel plate assembly. Allow to polymerize completely (about 20 mm, depending on the gel percentage).

Doudna

368 Table 1 Separation Range of Different Acrylamide Gel Percentage9 Acrylamide cont. (%) 35 5.0 80 12 15

Effective size range for separation (bp) 1000-2000 80-500 60-400 40-200 25-150

XC (bp) 460 260 160 70 60

BPB (b) 100 65 45 20 15

OThlstable can be used as an approximate guide for choosmg the percentage of polyacrylamrde to use, where XC is xylene cyan01FF marker dye, BPB is bromophenol blue marker dye, and sizesare for double-stranded DNA (from ref. 3). 5. Add 1 mL of 10% APS and 0.15 mL of TEMED to the remaining gel solution, mtx well, and pour into the gel plate assembly Insert the comb 1- 1 5 cm deep and allow to polymerrze completely (about 1 h) 6 Remove the tape from the plates, clip plate assembly to the gel apparatus, add 1X TBE buffer to cover top and bottom of the gel, remove comb, and rinse well with buffer. 7 Apply the sample to the well in a thin, even stream. Run the gel at 25 W (see Note 7) 8. When dye mtgratton indicates the gel is ready, turn off the power, remove the plate assembly, and pry the plates open carefully The gel will remam stuck to one plate. Cover the gel with plastic wrap, flip over, and pull off the other glass plate Cover the exposed side of the gel with plastic wrap, place the gel on top of a fluorescent TLC plate, and visualize the RNA bands with handheld UV lamp 9 Excise band(s) of interest wtth a clean razor blade, sltce into 4 cm segments, and place in the barrel(s) of sterile 10 mL syringe(s) Squeeze band(s) through the syringe(s) mto a sterile 50 mL plastic centrifuge tube(s) (see Note 8). Place tube(s) on dry ice or at -80°C for 15 min, and then m a 37°C water bath for 15 mm. Add 25 mL of sterile DEPC-treated water to tube contents, agitate overnight at 4°C. 10 Filter each eluted RNA sample through a 0.45 pm filter to remove crushed acrylamide Wash filtrate twice with 50 mL of sterile DEPC-treated water Place eluate in Amicon ultrafiltratton apparatus, using appropriate mol-wt cutoff membrane for sample. Apply Argon pressure to filter urea, salts, and acrylamrde away from the RNA sample. When the sample volume m the Amtcon apparatus becomes 20 mM) and at temperatures above 37°C Inefficient processing can be Improved by adding addrttonal magnesium ion to the reaction, heating at 65-70°C, and m some cases, by adding 5-10% formamide or l-2 M urea to the reaction RNA sequences that are highly structured (i e., base-paired) near the cleavage site have been problematic, it may be necessary to change the sequence around the cleavage site or include an “antisense” DNA strand m the reaction to compete with the interfering structure 7. It is Important to avoid overheating of the gel plates during electrophorests, since this may result m aberrant migration of the RNA as well as plate cracking. 8. For gels ~12% in acrylamide, crush with a glass rod or by dicing bands finely with a razor blade

Acknowledgments J. A. D. is a Lucille P. Markey Scholar in Biomedrcal Science, and this work was supported m part by a grant from the Lucille P Markey Charitable Trust.

References 1. Milhgan, J. F. and Uhlenbeck, 0. C. (1989) Synthesis of small RNAs using T7 RNA polymerase. Methods Enzymol 180,5 142

370

Doudna

2 Tanner, N. K., Schaff, S., Thtll, G , Petit-Koskas, E., Cram-Denoyelle, A., and Westhof, E (1994) A three-dimensional model of hepatitis delta vuus rtbozyme based on biochemical and mutational analyses. Curr Blol 4,488-498. 3. Sambrook, J., Fttsch, E F., and Mama&, T (1989) MoZecular Cloning A Laboratory Manual (Nolan, C , ed ) Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY 4. Grosshans, C. and Cech, T. R. (1991) A hammerhead ribozyme allows synthesis of a new form of the Tetrahymena rlbozyme homogeneous m length with a 3’ end blocked for transesteriticatton. Nuclerc Acids Res 19, 3875-3880 5 Price, S. R., Ito, N , Oubrtdge, C., AVIS, J. M , and Nagat, K. (1995) Crystalhzatton of RNA-protem complexes. I Methods for the large-scale preparation of RNA suitable for crystallographic studtes J A401 Blol 249,398-408. 6. Been, M. D (1994) Cis- and trans-acting ribozymes from a human pathogen, hepatitis delta ribozyme Trends Blochem. Scl 19,25 l-256

39 Establishing Suitability of RNA Preparations for Crystallization Determination of Polydispersity Adrian R. Ferr&d’Amart$

and Jennifer

A. Doudna

Introduction Successful crystallization of ribozymes and ribozyme domains depends on covalent homogeneity of the sample, conformational homogeneity of the preparation, and an efficient and broad sampling of solution conditions where crystals might nucleate and grow. Chapter 38 presents methods to prepare multimilligram quantities of pure RNA, and Chapter 40 describes strategies for determinmg crystallization conditions. This chapter presents two methods to determine the conformational homogeneity (polydispersity) of RNA preparations. These methods have been successfully used to determine which of several related constructs of a given target molecule are likely to crystallize, enabling the experimenter to focus on the most promismg candidate, and constitute an important step in a successful strategy for crystallization. The first method is polyacrylamide gel electrophoresis (PAGE) under nondenaturing conditions. The equipment needed for its implementation is readily available in laboratories engaged in RNA research, and the technique is familiar to many experimenters. Native PAGE, however, is limited to evaluation of polydispersity under low-romc-strength conditions and IS relatively time-consuming. Its principal drawback is that it involves separation, not examination of the sample directly in solution. Size-exclusion or gel-filtration chromatography, a technique not considered in this chapter, suffers from the same hmitation. The second method presented is examination of RNA samples by dynamic light scattering (DLS) (I). This nondestructive technique allows determination of the conformational homogeneity of RNA m solutions containing a wide 1.

From


B/o/ogy, Vol 74 Rfbozyme Protocols Humana Press Inc , Totowa, NJ

371

372

Ferr&d’AmarcS and Doudna

range of electrolytes and additives m a few minutes, but requires access to suitable mstrumentation. The commercral avatlabrhty of compact, mrcroprocessor-controlled DLS instruments and the excellent emprrrcal correlation (23) between monodrspersrty as determined by DLS and crystallizabrhty have made the technique very popular m laboratories engaged m macromolecular structure determinatton (4,5). A detailed example of the mterpretatron of DLS data collected for evaluation of crystalhzabrlrty 1sgiven m Note 8 2. Materials 2.1. Native Gel Electrophoresis 1 40% Acrylamtde stock: dissolve 76 g of acrylamide and 4 g of bis-acrylamtde m water to give 200 mL of solution 2 10X Tns-HEPES-EDTA (THE) buffer. 100 mMTns-HEPES, pH 7 0,l mMEDTA 3 1 MMgCl, 4 Gel electrophorests apparatus, mcluding gel plates (we use plates 10 x 11.5 in. and 9 x 11 5 in.), 0.5 mm thick spacers and comb, gel box, power leads, and power supply 5. 10X Native loading buffer. 1X THE, 10% (w/v) sucrose, 0 4% xylene cyanol, and 10 mA4MgC1,. 6. 37°C Water bath. 7 6YC Water bath 8 90°C Water bath or heat block 9. UV transillummator.

2.2. Dynamic Light Scattering 1 DLS mstrument (e.g., dp-801, Protein Solutions, Inc., Charlottesville, VA, see Note 1) 2. Anotop- 10 200 A pore syringe filters (e.g Whatman, see Note 2) and syringes 3. 2 mg/mL Solution of bovine serum albumin (BSA) m PBS (see Note 3) 4 0 1% (w/v) SDS m detomzed disttlled water. 5. Deionized distilled DEPC-treated water. 6. Annealed RNA sample from Section 3 1 6. 10 mA4 MgC&, 50 mM Mes-KOH, pH 6 0 7 Centricon mtcroconcentrator (Amtcon) or similar device

3. Methods 3.1. Native Gel Electrophoresis The procedure described here mvolves first annealing the RNA sample m buffer and magnesium, and then analyzing the mobility of the sample on a nondenaturing polyacrylamrde gel containing magnesmm m the matrtx and buffer 1 Prepare four samples for each RNA to be tested as follows Into each of four tubes, pipet l-2 pg of the RNA and 1X native loading buffer m a final volume of

Polydispersity of RNA Samples

2

3

4

5

373

10 pL Tube 1, no mcubatlon; tube 2, incubateat 37°C for 10min and let cool to room temperature; tube 3, incubate at 65°C for 10 mm and let cool to room temperature; tube 4, incubate at 90°C for 5 mm and place at room temperature Prepare a 10% native polyacrylamlde gel containing 10% 29.1 acrylamlde.blsacrylamlde gel solution, 1X THE buffer, and 10 mA4MgC1, The gel should be -0 5 mm thick, with lanes 0.5-l cm wide Set up the gel apparatus with 1X THE buffer containing 10 mMMgC1, as the runmng buffer Begin electrophoresis at 10 W, and load the samples as the gel 1srunnmg Run until the xylene cyan01 dye reaches the middle of the gel (approx 4-5 h) Stop the electrophoresls, open the plates, and cover the exposed gel with plastic wrap Invert, remove the other gel plate, place gel, still on the plastic wrap, m a glass dish, and cover it with ethidlum brormde solution ( 10 pL of 10 mg/mL ethldlum bromide solution m -200 mL of water) Swirl gently on rotating shaker for 10 mm. Visualize the RNA bands by placing the gel on a UV transilluminator (see Note 4).

3.2. Dynamic Light Scattering The procedure described here IS suitable for the dp-801 DLS instrument. The RNA sample should first be annealed and brought into the solution conditions under which it IS to be examined (see Note 5). For this example, the RNA is annealed at pH 6.0 in a moderate concentration of magnesium chloride with no supporting electrolyte or additives, and examined under these conditions. The DLS instrument should be prepared for use by aligning its laser and cleanmg the fluidlcs (or “plumbmg”) if this has not been done recently. Then the sample examined. The dp-801 will output a table of experimentally determined apparent diffusion coefficients, derived quantities, and residual errors m the analysis of the experimental data. Some example outputs and then mterpretation are given in Note 8. 1. Anneal the RNA At least 150 pL of annealed RNA should be prepared (see Note 6). The mmlmum ribozyme concentration (see Note 7) necessary for the experiment

dependson the molecule’s size as a rough guide, 3 mg/mL for a relative mol wt (J4J of 10,000; 2 mg/mL for M,. 20,000; 1 mg/mL for M, 40,000. If the molecule ohgomerizes, its apparent size will be larger, necessltatmg a lower concentratlon Annealing 1s described In Chapter 40. For this example, the RNA will have been annealed m 10 n&Y MgCL, 50 mM Mes-KOH, pH 6.0 (see Note 5). 2. Align laser Inject 150 pL oca 2 mg/mL solution of BSA in PBS into the dp-801 through an Anotop-10 200 A filter using a suitable syringe (a 1 mL disposable syringe or a 250 & Hamilton syringe) Start the “count rate” display, and turn the laser alignment knob slowly in either direction until the number of counts IS maxlmlzed. Do not move the instrument after this. Flush out the protein with 1 mL of deionized water. 3 Clean the fluidics of the instrument by qectmg 1 mL of 0 1% SDS solution (without an Anotop filter) into the instrument and letting it stand inside for 1 h Thoroughly flush the instrument with deionized water after this.

374

Ferr&d’Amar&

and Doudna

4 Inject 1 mL of 10 mA4 MgCl,, 50 mM Mes-KOH, pH 6.0, through an Anotop filter Start the “count rate” mode of the instrument, and slowly mlect 150 pL of the sample through an Anotop filter There should be no more resistance to flow than when mlectmg BSA The displayed count rate should exceed “20” for accurate measurements. Extt the “count rate” mode, and start “acquire data” The instrument will output analysis results approximately every minute Collect 5-20 measurements 5. To recover the sample, flush the flutdtcs with 1.5 mL of 10 mMMgCl,, 50 mA4 Mes-KOH, pH 6.0, and collect the effluent. The ribozyme can now be concentrated in a Centricon concentrator and used for further experiments if desired 6 If more samples are to be analyzed, prime the fluidics with the appropriate buffer, and repeat steps 4 and 5, above At the end of the session, flush the mstrument with 2-3 mL of deionized water

4. Notes 1 DLS mstrumentatton can be constructed from standard electronic and optical components, but operation of such a setup can be technically demanding. The interested reader can consult refs (6) and (7). 2. It is very important to use 200 A filters to remove dust particles. These filters are also useful to remove excess dust from samples destined for crystalhzation, if excessive nucleation is a problem If the ribozyme sample does not traverse the 200 A filter, it is very heavtly aggregated and unsuitable for crystallization, 3 A BSA solution particularly suitable for this purpose because of its reproducibly low monodisperstty is the 2 mg/mL solution in glass ampules sealed under argon (oxidation results m polydisperse BSA) distributed by Pierce 4 RNA samples appropriate for crystalhzation should typically be at least 95% “pure” by native gel analysts For samples that have crystalhzed m our hands, the vast majority of the RNA runs as a single species on a native gel 5 Typically an RNA construct is first examined after annealing m the presence of 1-15 mA4 MgCl, and 20-100 mM of a buffer of pH 5 &6 6, m the annealing solution. See Chapter 40 for a detailed annealmg protocol. If the sample is not monodispersed, DLS can be performed under conditions that are known to be relevant to the activity of the ribozyme For instance, Group II mtrons can be exammed m the presence of high (-1 M) concentrations of, e g , KC1 and 100-200 mM MgCl,, and Group I mtrons m the presence of saturating concentrations of GTP It is a good idea to examme rtbozymes with and without their substrates and mhibitors, if known In general, “well-behaved” molecules tend to be monodispersed under a variety of conditions 6 Sample volumes of as little as 50 pL can be used m the dp-801, m prmciple, since the flow cell has a volume of -7 pL. However, delivering such a small volume across the syringe filter and through the fluidics mto the flow cell is very challengmg. Volumes of - 100 pL can be exammed by mJectmg the sample and then “chasing” it with - 100 & of au-, which is itself pushed with some buffer The air avoids dilution of the sample. If experiments are attempted with such small vol-


375

umes, tt is also worth preceding the sample with a volume of an for the same reason Note however that any air bubbles left in the flow cell will result m unmterpretable scattering. Having a larger sample volume is also convenient if a bubble does develop, since delivering a few additional tens of microliters of sample will usually dislodge the bubble from the flow cell. 7 The concentrations under which samples are examined by DLS are typically 2- to lo-fold lower than those used for crystallization experiments (see Chapter 40). Lack of aggregation under these relattvely dilute conditions appears to be an excellent predictor of lack of aggregation at higher concentrations 8. DLS allows measurement of the translational diffusion coefficient (Dr) of a macromolecule undergoing Browman motion in solution through analysts of the intensity fluctuations of laser light scattered by the solute If there is a single macromolecular species, the experiment provides a direct measurement of Dr. Analysts of the autocorrelation functton can also provide data regarding sample polydrspersity The technique is exquisitely sensitive to aggregation, since the mtensity of scattered light is proportional to the square of the mass of the solute particle. The shape and density of the solute are typically unknown, so the dp-801 calculates an equivalent hydrodynamic radius of gyration (Ru) from D, using the Stokes-Einstein equation, and a mol-wt estimate using an empirical calibration curve obtained from assorted globular proteins of known mass. The output hydrodynamic radii and molecular weights are approximations only, and can differ substantially from real values for nonglobular, or partially or totally unfolded, or anomalously hydrated macromolecules. For the purpose of assessing crystalhzability, however, the values of Dr, Ru, and M,. are of little sigmticance. What matters is that these values are uniform over several measurements, indicative of monodispersity. The illuminated sample volume is on the order of a few microliters, and the presence of even a small number of aggregates will become apparent as large fluctuations in Dr Examples of $-SO 1 outputs obtained from three different related RNA constructs are given n-r Table 1. The three RNAs share a common structural core, with flanking sequences progressively deleted from “A” through “C ” The constructs were first examined for biochemical activity, and then then suitability for crystallization was evaluated by DLS. Construct “A” is highly aggregated, as evidenced by the fluctuatron m the apparent values of Dr, Rn, and M,. The polydispersity values (which represent the standard deviation of the dtstrtbutton of Ru) are also quite large Because of this, molecule “A” is unsuitable for crystallrzation, at least under the solution condition examined here. The apparent M, IS much larger than expected from the covalent molecular weight of the RNA (a:30 kDa) This could be owing either to ohgomerization/aggregation or to an increased hydrodynamic drag resultmg from an unfolded portion of the molecule. As mentioned above, if the apparent M, is constant, its disagreement with covalent molecular weight should not be of concern Deletion of 16 and 19 nucleotrdes, respectively, to yield molecules “B” and “C” results m progressively “better behaved” molecules. Molecule “B” still

376

Ferr&d’Amarb

Table 1 Examples

of dp-801 DLS Output@

Sample

for Three Related

and Doudna

RNA Constructs IV,., kDa

Dr, 1@13m2/s

RH, nm

Polydispersity, nm

284 293 291 295 292

5.0 4.9 4.9 4.8 49

1.954 1416 1.900 1.714 1.923

144 136 139 135 138

775 713 741 780 831

27 30 29 2.7 26

1 049 1 188 1 140 0.969 0.756

35 43 39 35 30

895 899 889 909 898

25 25 2.5 2.5 25

0 710 0.735 0 744 0 704 0 741

28 28 29 28 28

RNA “A” 89 nt

RNA “B” 73 nt

RNA “C” 70 nt

OTheresults of five successive measurements from each sample are shown for comparison

shows significant fluctuatton of D-r, Rn, and Iv&, but drsplays smaller poly(and smaller RH/polydlsperslty ratios) This molecule also displays an apparent IV,., which is m good agreement with the monomeric molecular mass Molecule “C” is an example of a monodisperse RNA, a promising candidate for crystalhzation. The values of Dr, R,, and A4,.are stable, the Ru/polydispersny ratio IS small, and the apparent I$ is indicative of a monomeric, globular molecule After being subjected to a smgle round of sparse-matrix setups (see Chapter 40), molecule “C” yielded crystals, whereas “A” and “B” produced none. It is, of course, possible that an exhaustive screening of crystalhzation conditions might yield conditions where “B” or even “A” crystallizes However, given that all three molecules share the same core structure, the path of least resistance to a three-dimensional structure is focusmg on the monodispersed construct. dispersitles

Acknowledgments A. R. F. is a Fellow of the Jane Coffin Childs Memorial Fund for Medical Research. This investigation has been aided by a grant from The Jane Coffin Childs Memorial Fund for Medical Research. J. A. D. IS a Lucille P. Markey Scholar in Biomedical

Science, and this work was supported m part by a grant

from the Lucille P. Markey Charitable Trust.


377

References 1. Schmitz, K. S (1990) An Introduction to Dynamx Lzght Scattering by Macromolecules Academic, San Diego 2 Zulauf, M. and D’ Arty, A. (1992) Light scattering of proteins as a criterion for crystallization J Crystal Growth 122, 102-106 3 Fe&-D’Amare, A R. and Burley, S. K (1994) Use of dynamic light scattering to assesscrystallizability of macromolecules and macromolecular assemblies Structure 2,357-359

4. D’Arcy, A (1994) Crystalhzmg proteins-a rational approach? Acta Crystallographm D50,469-47 1, 5 Fe&-D’Amart, A. R and Burley, S K. (1997) Dynamic light scattering as a tool for evaluatmg crystalhzability of macromolecules. Methods Enzymol 276, 157-l 66. 6. Wrlson, W W. (1990) Monitoring crystallization experiments using dynamic light scattering: assaying and momtormg protein crystallization m solution Methods 1, 110-117. 7. Mikol, V. and Giegt, R. (1992) The physical chemistry of protein crystallization, in Crystallization of Nucleic Acids and Proteins. A Practical Approach (Ducruix, A. and Gtegt, R., eds ), IRL Press, Oxford, pp 219-239.

A Sparse Matrix Approach to Crystallizing Ribozymes Jamie H. Cate and Jennifer

and RNA Motifs

A. Doudna

1. Introduction With the discovery of RNA catalysts and the role of RNA m many essential biologtcal processes, our need to learn the fundamentals of RNA structure has become acute. X-ray crystallography is the only means available to determine the three-dimensional structure of many biologically mterestmg RNAs owing to then size.To begin an RNA crystallography project, one needs to synthesize mrlhgram quantities of homogeneous RNA, as described in Chapters 38 and 39. This chapter covers an efficient way to obtain leads to crystallization conditions for an RNA macromolecule. Initial crystals can then be optimized for diffractton studies m subsequent experiments. Owing to the large number of variables one could screen m trying to obtain crystals, initial crystallization screens have been developed that are biased toward conditions that have worked for other macromolecules (r-5). The method presented below is based on a sparse matrix screen for RNA (3) using vapor diffusion to bring the RNA to supersaturation (6). See Chapter 41 for a related approach. First, the specialized materials that need to be prepared to set up crystallization experiments are described. The second section covers the preparation of solutions. Third, the setup and storage of crystalhzatron trays are described. Finally, the analysis of the crystallization attempts is briefly discussed. 2. Materials 2.1. Trays and Cover Slips 1 Linbro tissue-culturetrays (24-well, ICN-Flow). 2 22 mm Glasscircular cover shps From



379

Cate and Doudna

380

3 2% Dimethyldichlorostlane m toluene (this solution should be used m the hood and disposed of properly; dimethyldichlorosilane should be stored desiccated at 4°C) 4 95% Ethanol 5 Forceps, flat blade (i.e., Millipore MF filter forceps) 6 Pressurized and filtered an (0.2 pm filter) 7. 10 mL Syringes 8 Vaseline. 9 Modeling clay.

2.2. Solutions 1 Diethlypyrocarbonate (DEPC), which IS toxic, should be stored at 4°C. 2 Sterile distilled water, DEPC-treated (see Section 3.2 ). 3 1 M Stocks of the followmg buffers and salts m DEPC-treated distilled water potassium succmate, pH, 5 5, potassium cacodylate, pH, 6.0 (toxic), potassium PIPES, pH, 6 5, potassium MOPS, pH, 7 0, potassium HEPES, pH, 7 5, Tris-HCI, pH, 8 0, MgC12, Mg(OAc)z, MgS04, CaC12, SrCl*, BaCl,, N&l,, CuS04, CrCI,, CoCl,, spermine-HCl, spermidme-HCl. Spermine and spermidme stocks should be stored at -20°C. 4. Precipitatmg agents. amrnomum sulfate, polyethylene glycol 8000 (PEG SOOO), 2-methyl-2,4-pentanediol (MPD), 1,6-hexanediol, t-butyl alcohol, ethanol, isopropanol, 1,Cdioxane (possible carcinogen). 5 0.2 pm Syrmge filters. 6. RNA solution at 210.0 mg/mL (see Section 3 2 for details)

2.3. Crystallization

Setup, Storage, and Observations

1 Dissectmg microscope with crosspolarizers (x60 magnification 2. Styrofoam boxes capable of holding Linbro trays.

is suffictent).

3. Methods 3.1. Trays and Cover Slips 1 Drop the cover slips mdividually mto a 2% dichlorodimethylsilane solution with shaking for 15 mm This should be done in the hood. Pour off the liquid into a waste container m the hood (see Note 1) 2. Rinse the cover slips thoroughly with 95% ethanol to remove the toluene, dichlorodimethylsilane, and HCl generated during the silamzation process. 3 Blow dry the cover slips mdrvidually with the filtered pressurized air, and store m a container free of dust particles (see Note 2) 4 Melt Vaseline, and pull into 10 mL syringes by aspiration (see Note 3). 5 Blow out each well with the pressurized air to remove plastic shavings. 6 After the Vaseline cools and sohdifies, place a bead of Vaseline on the hp of each well of two Lmbro trays Leave a very small gap to allow air to escape before the cover slip is sealed in place (see Section 3.3.). 7 Place small balls of modeling clay in the inside comers of the Lmbro tray lid to keep the lid suspended above grease

381

Sparse Matrix Approach Table 1 Solutions

for Annealing

Tube no. 21 22 2.3 2.4 2.5 2.6 27 2.8 2.9

Solution set II, pH, and salt*

RNA + set II to anneal, total volume (pL)

5 5, MgC12 5 5, MgS04 6.0, MgClz 6 0, MgSO‘, 6 5, M&I, 6 5, WdOAc)z 7.0, M&l2 7 5, M&l2 8.0, M&l2

44 44 39.6 4.4 35.2 8.8 44.0 44 0 8.8

‘100 mMbuffer, 10-20 mh4Mg salt

3.2. Preparation

of Solutions

We have found that using DEPC-treated water and disposable pipets and tubes minimizes RNA degradation owing to contaminating RNases. For crystallization experiments, all solutions should be filtered through 0.2 m filters. In addition, the drvalent salts should be of high quahty to reduce degradation problems from contaminating transitron metals, such as zinc and manganese (see Note 4). 1 To each liter of distilled water, add 200 pL of DEPC and autoclave 2. Filter and store the RNA sample m approx 10 mM buffer (pH ~7.0) at 4°C. The RNA should be about 10-l 5 mg/mL, 1 OD at 260 nm = 40 pg/mL (see Note 5). 3. Make the followmg well solutions with DEPC-treated water and filter (all % values are v:v)* 1,2, and 3 Mammomum sulfate, 7 and 15% isopropanol, 8 and 10% t-butyl alcohol, 5, 15, 25, and 30% 1,4-dioxane, 5, 10, 15, and 25% MPD, 20% ethanol, 4% PEG 8000, 10% 1,6-hexanediol, and 2.5 mM spermme. Fifty milliliters of each are sufficient for several sparse matrix setups The spermme solution should be made fresh or stored at -2O’C between uses Store PEG 8000 at 4°C to avoid bacterial growth. 4 Make solution set II (2X solutions) shown in Table 1 with filtered stock solutions One milhliter of each is more than sufficient. Use 100 mA4buffer and 10-20 mMMg*+. 5. Make solution set III shown m Table 2 with filtered stock solutions. One mtlliliter of each is more than sufficient. Since many of these solutions contain spermine or spermidme, they should be stored at -20°C between uses. The amounts listed m Table 2 are for 5X stocks.

3.3. Crystallization

Setup, Storage, and Observations

1. Prepare the nine annealing mixes m 0.7 mL microcentrifuge in Table 1,

tubes as described

382

Cate and Doudna

Table 2 Solution Set III (Additives) Tube no 31 32 33 34 35 36 37 38 39 3 10 3 11 3 12 3 13 3 14 3 15 3 16 3 17 3 18 3.19 320 3 21 3 22 3.23 3 24 3 25 3 26 327 3 28 329 3 30 331 3 32 3 33 3 34 335 336 337 338 3 39 3 40 341 342 3.43 344

Polyamme, mkf Spermme (spm), 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 2 5 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 5 0 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 spm, 7 5 Spermldme (spd), 5 0 spd, 5 0 spd, 5 0 spd, 5 0 spd, 5 0

Mg salta, mM 80 80 55 80 80 5 30 80, MgSO, 30 5 80 55 80 80 55 5 5 55 30 80 5 5

Other dwalent, lOmA Ca Ba

co

co co

Ca co Ca co co

:8 30, Mg(OAc), 5 30 55 80, MgSO, 30 5 380 30 30 30, MidOAch 30 5 80 55

SP Cr Nl cuso4

Ca Ca Ba Sr Nl

:5

cuso‘q

55 55

co

OMgCl, unless otherwise Indicated Dwalent metals are chloride salts, unless otherwise mdlcated Chrommm IStrwalent bSrS04 crystalhzes often at 4°C

Sparse Matrix Approach

383

2 Heat the annealing mixes for 10 mm at 65°C m a heating block. Keep the tubes covered with alummum foil to mitnmize evaporation of the solutions and condensation on the lids of the tubes 3. Allow the tubes to cool slowly to room temperature Centrifuge the tubes briefly after they have cooled to collect any condensation that may have formed See Note 4 for additional annealmg protocols 4 Prepare 44 0.7 mL microcentnfuge tubes with the appropriate amount of the annealing mix and solution from set III as described in Table 3 5. Add 1 mL of well solutton to each of the wells of the Lmbro tray as described m Table 3 The Linbro trays have numbered columns 1-6 and lettered rows A-D For example, condmon 22 1swell D4 m the first tray, and condmon 36 is well B6 in the second tray. 6. On a cover slip, mix the RNA mix for condition 1 with well solutton in ratios of 2 1,2 2, and 1 2 (m pL) Flip the cover slip gently, and seal over well Al Repeat for the other 43 conditions (see Note 6). 7 Using the dissection mtcroscope, make notes on the drops tmmedtately after finishing the trays (see Note 7). 8 Replace the lid of the tray, and store the trays m a Styrofoam box or a constanttemperature incubator to buffer against temperature changes (see Note 8). 9. Repeat steps 1-8 for screening at addrttonal temperatures, I e., 4 or 30°C Use Styrofoam boxes to move trays between temperatures (see Note 9). 10. Trays should be analyzed under the dissection microscope after about a week to see which drops contam precipitate, which drops are clear, and with luck, which drops have crystals. These observations will be useful m designing a second round of screening 11 Store the trays and make observattons over the next 3-4 mo, mcreasmg the time between observattons (see Note 10).

4. Notes 1 Some companies sell prestlamzed cover slips, but these are more expensive. Other srlamzmg reagents have not worked as well m our hands The cover slips must be well-silamzed because the organic precipitants used m this screen lower the surface tension of the drops, which causes them to spread out. MPD seems to be the worst m this regard If the cover slips are not well silanized, It is (nearly) tmposstble to set up 3 drops/cover slip (see Note 6 and Section 3.3 ) 2 Some sources of pressurtzed air can contam tmy droplets of oil in the delivered an, which can be removed by an m-lme filter 3 Vacuum grease can be used for room-temperature or 30°C trays, but 1svery dtfficult to work with at 4°C tf one needs to remove a cover slip to recover drop contents 4. Though we generally start by using 6065°C for annealing, other temperatures may be more useful Several annealing temperatures and coolmg speeds could be tested by runmng the annealed RNA on native polyacrylamide gels or using dynamic light scattering (see Chapter 39). A different screen recently published

Cate and Doudna

384 Table 3 Tray Setup Tube no., tray no , and well ID 1 (l.Al) 2 (1.A2) 3 (1 A3) 4 (1 A4) 5 (1.A5) 6 (1 A6) 7 (l.Bl) 8 (1.B2) 9 (1 B3) 10 (l.B4) 11 (l.BS) 12 (l.B6) 13 (1 Cl) 14 (1 C2) 15 (lC3) 16 (1 C4) 17 (1 C5) 18 (l.C6) 19 (l.Dl) 20 (1.D2) 21 (1 D3) 22 (l.D4) 23 (1.05) 24 (1 .D6) 25 (2 Al) 26 (2.A2) 27 (2.A3) 28 (2 A4) 29 (2 A5) 30 (2.A6) 31 (2 Bl) 32 (2 B2) 33 (3 B3) 34 (2.B4) 35 (2.B5) 36 (2.B6) 37 (2.Cl) 38 (2.C2) 39 (2 C3) 40 (2.C4) 41 (2.C5) 42 (2 C6) 43 (2 Dl) 44 (2 D2)

Well solutton

Drop solution, 4 4 pL annealed + 1.1 & additives

15% Isopropanol 4% PEG 8000 7% Isopropanol 3 M Ammomum sulfate 2 M Ammonmm sulfate 10% MPD 2 M Ammomum sulfate 25% MPD 15% 1,4-Dioxane 25% 1,4-Dioxane 10% 1,6-Hexanedrol 1 M Ammomum sulfate 4% PEG 8000 2 M Ammonium sulfate 20% Ethanol 7% Isopropanol 5% 1,4-Dioxane 8% t-Butanol 5% 1,4-Droxane 15% MPD 15% Isopropanol 25% MPD 5% MPD 15% MPD 3 M Ammomum sulfate 5% MPD 8% t-Butanol 25% 1,4-Dtoxane 5% MPD 30% 1,4-Dtoxane 10% t-Butanol 2 5 mM Spermme 15% MPD 3 M Ammonmm sulfate 25% 1,4-Dtoxane 30% 1,4-Droxane 7% Isopropanol 15% 1,CDroxane 1 M Ammonmm sulfate 20% Ethanol 15% Isopropanol 15% 1,4-Dioxane 20% Ethanol 1 M Ammomum sulfate

2 3 + 3.1 2.3 + 3.2 2.5 + 3.3 2.1 + 3.4 27+35 25+36 2.7 + 3.7 24+38 25+39 27+3 10 28+3 11 2.8 -I- 3.12 2.8 + 3 13 2.8 + 3.14 2.5 + 3.15 25+3 16 2.8 + 3 17 2.3 + 3.18 29+3 19 2 5 + 3.20 2.3 + 3.21 2.5 + 3.22 2.5 + 3 23 2 8 + 3.24 26+325 27+326 28+327 28+328 22+329 2.7 + 3.30 2 7 + 3.31 28+332 27+333 23+334 2 6 + 3.35 2.7 + 3.36 2.3 + 3.37 2.3 + 3.38 28-I-339 29+340 2.3 + 3.41 27+343 23+343 2 7 + 3.44

Sparse Matrix Approach

5.

6

7

8

9 10.

performs the annealing m the presence of polyamme and buffer with little or no other salts present (5). If the RNA is degrading durmg the annealing step, addrnon of 0.1 mA4 EDTA may reduce the problem. The concentration of RNA for storage needs to be high enough for the dilutions involved in setting up the drops, but not so high as to form aggregates We have observed the formatron of gels if the RNA 1sstored at high concentrations. These gels will often dissolve if the RNA IS warmed to room temperature or a little warmer. To support the cover slip while setting up drops, one can use the lid of the Lmbro tray wtth one part of the cover shp shghtly off the edge. We often use a 1.5 mL microcentrtfuge tube firmly secured in a tube rack This has the advantage that the edge of the tube lid IS approximately the boundary within which all three drops must be set up We usually pipet the solutions onto the cover shp in the shape of an L (an asymmetric shape) so that the drops can be distinguished later. We usually do not pipet up and down to mix the well and drop solutrons. Layering one on the other works fine for mixing such small volumes. To avord heartache later, rt IS important to observe the drops right after setting them up to look for foreign particles that may have fallen into the drops (talc, pieces of plastic from the pipet tips, and so forth) We always wear gloves when settmg up RNA crystallization experiments, making sure to wear talc-free gloves or wash off any talc before handling the solutions. One should also write down whether prectpitate formed unmediately or not. This wtll help m the destgn of future experrments Since this screen uses several volatile precipttants (including MPD), many of the drops will actually grow m size over time. This is probably owing to the fact that there IS no salt component m the well solutrons for the volatrle compounds Thus, the drop size tends to grow to decrease the romc strength of the drop One posstble means of avoiding this problem is to take 1 mL aliquots of the well solutions to use m additton to the RNA solution on the cover slip, and add 150 w NaCl to the solutions that actually go m the well This approach also helps the 2.5 mA4 spermme condttion, which, in the absence of addmonal ionic strength m the well, will not drive the drops to concentrate as in a standard vapor drfmsron experiment We have had good results for crystallization at room temperature and 30°C whereas some of the tRNAs (mcludmg tRNAPhe) ytelded crystals at 443°C (7) Precipitates are generally along a contmuum between granular (distinct particles) and flocculent Granular precipitates m general are better than flocculent prectpttates in terms of how close the condmons are to ones m whrch crystals ~111grow (2). In addrtron, one should also cross the polarizers to see rf putative crystals or precipitates are bnefrmgent, I e , glow when the background IS dark. Bnefrmgence occurs because crystals rotate plane-polarrzed light (6). One should be aware of the fact that birefrmgence is harder to interpret when the polarized light passes through plastic One should remove the lid of the Lmbro tray before making observatrons Then only the plastic at the bottom of the well will mterfere wrth bnefrmgence, though not too severely

386

Cate and Doudna

Acknowledgments J. H. C. 1ssupported by an NIH predoctoral National Research Service Award. J A. D. 1sa Lucille P. Mar-key Scholar m Biomedical Science,and this work was supported in part by a grant from the Lucille P Markey Charitable Trust References 1 Jancarrk, J. and Kim, S -H (1991) Sparse matrtx sampling. a screenmg method for crystalhzatlon of proteins J Appl Crystallog 24,409-4 11 2 Carter, C. J and Carter, C W (1979) Protein crystalhzatron using mcomplete factorial experiments J BloZ Chem 254, 12,219--12,223. 3 Doudna, J A., Grosshans, C., Goodmg, A., and Kundrot, C E. (1993) Crystalhzatron of rrbozymes and small RNA motifs by a sparse matrix approach Proc Nat1 Acad. SCL USA 90,7829-7833

4. Baeyens, K. J , Jancarik, J., and Holbrook, S R (1994) Use of low-molecularweight polyethylene glycol rn the crystallrzatron of RNA olrgomers. Acta Crystallogr

D50, 764-767.

5 Scott, W G , Finch, J T., Grenfell, R , Fogg, J., Smrth, T , Gart, M J , and Klug, A (1995) Rapid crystalhzatron of chemically synthesized hammerhead RNAs using a double screening procedure. J Mel Bzol 250, 327-332 6. McPherson, A. (1989) Preparatzon and Analyszs of Protezn Crystals, Robert E Krieger Publishing, Malabar, FL 7 Dock, A -C , Lorber, B , Moras, D., Prxa, G , Threrry, J.-C., and Greg& R. (1984) Crystallization of transfer rrbonuclerc acids Bzochemze 66, 17%20 1

41 Crystallographic Analyses of Chemically Synthesized Modified Hammerhead RNA Sequences as a General Approach Toward Understanding Ribozyme Structure and Function William G. Scott 1. Introduction Solid-support chemical synthesis of RNA (I), though costly, has the advantage of allowing the incorporatton without restriction of any desired nucleotide sequence, including sequenceswhtch contain special modified nucleotides. For example, the crystal structure of an all-RNA hammerhead ribozyme containing a modified 2’-O-methylcytosme at the active site to prevent cleavage has recently been solved (2,3). Incorporation of the 2’-methoxyl moiety specifically at the cleavage site of the nbozyme can only be accomphshed by using the chemical synthesis approach. Many “unnatural” hammerhead RNA sequence modtlications, including modified purme and pyrimidine bases,2’-fluoro- and 2’-aminomodified riboses, and phosphorothioates (among many other examples), have been synthesized by a variety of research groups for probing the hammerhead RNA reaction mechanism and structure. Modified sequences,including ones contaming unnatural bases,can be synthesizedand crystallized in the same conditions as those used to produce the origmal crystals for a variety of applications. For example, a hammerhead RNA substratestrand containing a photolabtle moiety protecting the active site in a manner analogous to the 2’-O-methylcytosine at the active site, has recently been crystallized in the same conditions and space group as the originally solved crystal form. This will allow the structure of the modified hammerhead RNA to be solved with a single data set based on the (publicly distributed) coordinates of the original structure. The ultimate purpose of this particular modified hammerhead RNA is for time-resolved crysFrom

Methods IR Molecular Edrted by P C Turner

Bology, Vol 74 Rbozyme Protocols Humana Press Inc , Totowa, NJ

387

388

Scott

tallographtc experiments where removal of the photolabrle protecting group with an Xe flashlamp will initiate the cleavage reaction in the crystal by exposmg a free 2’-hydroxyl at the actrve site. Both dynamrc and static crystallography experiments are thus made possible by combinmg the techmque of RNA chemical synthesis with the previously elucidated structure and crystallization conditions. Such an approach therefore allows a completely general method for obtaining and analyzmg crystals of modified hammerhead RNAs. Solving a crystal structure of an unknown nucleic acid by rsomorphous replacement or molecular replacement can be a difficult task best undertaken by, or in collaboratton with, an experienced crystallographer. However, growing crystals of a modified form of the previously solved hammerhead RNA sequence will be a much more strarghtforward process, which simply involves purtfymg the desired RNA sequences,setting up crystalhzattons m previously determined conditions, and collectmg and processmg a single X-ray data set. A descrrptron of the methods used previously for each of these relattvely sample steps follows.

2. Materials Chemically synthesized RNA prepared using rlbonucleos1de phosphoramldltes (Glen Research, Cambto, UK) and assembled on an Applied Biosystems 380 B solid-phase ohgonucleotlde synthesizer.

Sequencrng-grade40% acrylamrde:bis-acrylamrde(19 1) solution (e g., Sever-n Biotech Ltd.) was used for oligonucleotrde punficatlon. Crystallization reagents: cacodylic acrd, spermine (Sigma), ammonium acetate, lithium sulfate, lithium acetate, magnesmm acetate, magnesium sulfate, calcium chloride (BDH), polyethylene glycol (PEG) 6000, and anhydrous glycerol (Fluka) Crystallization solution A: 23% PEG 6000,100 mMNH40Ac or 100 mMLiOAc, 10 mM MgC& or 10 mA4 CaC12, 50 mM NH4(CH&As02 buffered at pH 6.5 (by adding NH40H to cacodylic acid), O-5% glycerol and 1 m&I sperm1ne (added fresh Just before use) Crystallization solution B* 1.8 A4 L1$04, O-25 mM MgS04, and 50 mA4 Na(CH&As02 buffered at pH 6.0 (by adding NaOH to cacodyllc acrd). Crystallization mrcrobndges (Crystal Microsystems or Hampton Research). Other optional materials useful for RNA crystalhzation, such as a set of 48 solutions for screenmg RNA crystallization conditions, can be purchased (Hampton Research)

3. Methods 3.1. Chemical Synthesis

of Hammerhead

RNA for Crystallization

1. Synthesize each of the RNA strands using ohgorlbonucleotrde phosphoramldlte chemistry, mcorporatmg a 2’-0-methylcytosme m the active sate of the “substrate” RNA strands (see Note 1). 2 Desalt the crude RNA by dialysis (although this could also be done by gel filtration).

Crystallographic 3.2. Purification

Analyses of Chemically

389 Synthesized

RNAs

1 Purify the desalted crude RNA on 15 or 20% polyacrylamtde, 8 M urea denaturing gels run at 37 W 2 Electroelute and dralyze extensively against salt (1 MNaCl or NH40Ac). 3. Dialyze against pure water 4. Lyophilize the RNA and redrssolveto a concentrationof 0.5 or 1.0&of enzyme+

substratestrandsin 10mMcacodylatebuffer, pH 6.0 or 6.5, with or without 1rnA4 spermme, dependmg on which of two crystalhzation methods IS to be employed (see Section 3.3.) 5 Prior to crystalhzatton, heat the RNA enzyme-substrate complex to 85°C and slow-cool m a heat block to room temperature

3.3. Crystallization of Hammerhead RNAs The original crystalhzation conditions were obtained using a sparse matrix of 48 RNA crystallization conditions, which was developed for crystalhzmg the synthetic hammerhead RNA constructs (as well as other RNAs and RNAprotein complexes). Two sets of conditions yielded similar-quality crystals. The first of these employed PEG 6000 as a precipitating agent and contained a relatively low concentratton of monovalent salt. It also requires the presence of 10 mM Mg(OAc), or CaC12.The second set of conditions employed 1.8 M LiZSO as a precipitating agent either in the presence or absence of divalent cation. (The latter condttton is useful for crystalhzmg hammerhead RNAs where the cleavage site nucleotide is unprotected by a modification such as a 2’-O-methylcytosine.) Although the originally pubhshed structure is from the first set of conditions, the crystal structures for both crystal forms have now been solved and the coordinates are available. The packing schemes differ between the two crystal forms. Therefore, it is advisable to try both sets of conditions If possible. The best crystals were obtained using the sittmg drop method m either crystallization solution A or crystallization solution B. 1. Prepare crystallization solutions A and B as described in Section 2. 2. MIX very thoroughly a 2-5 pL ahquot of the previously annealed RNA solution (0.5 mM hammerhead RNA in 10 rmI4 cacodylate buffer, pH 6.5, m the first case or 1.O m&I hammerhead RNA in 10 rmI4 cacodylate buffer, pH 6 0, m the second case) with an equal volume of crystalhzation solutron A or B. 3 Pipet the 4-10 pL mixtures mto sitting drop crystallization microbridges, whtch are placed m the wells of a 24-well Linbro tissue-culture plate surrounded by vapor-dtffusion reservons of 0 75 mL of the same crystallization solutton (A or B) placed m each of the wells used m the experiment 4 Seal the wells using thick 22 mm dtameter cover glasses usmg vacuum grease applied sparingly around the well rims

5. Allow the crystalhzationsto equilibrate at 20°C (seeNote 2)

3.4. Data Collection and Structural Analysis Both hammerhead RNA crystal forms diffract with approxtmately the same quality and to about 3.0 A resolution. To obtain reasonable-quality data, a highintensity X-ray source (i.e., from a synchrotron crystallography beamline) must be employed, although a lower-quality data set might be obtainable from a conventional laboratory X-ray source. The crystals are highly X-ray-sensitive and must be frozen m a cryoprotectant. The crystals must be kept frozen using a nitrogen cold stream capable of mamtammg the temperature of the crystal at 100°K. The procedure for freezing hammerhead RNA crystals is described below. 1 Select a suitablecrystalfor X-ray analysts. Such a crystal must appear single and without imperfections, and should be at least 0 25 mm m its smallest dtmenston 2. Obtain a freezing loop and appropriate goniometer head (see Notes 3 and 4) 3 Prepare solutron A or B as appropriate for the crystals, but mclude m the solutton a total concentration of 25% glycerol in the case of solutron A, or 20% glycerol in the case of solutton B 4 Remove the crystal from the srttmg drop (preferably using the freezing loop), and mrmedtately immerse it into a large excess (about 0 25 mL) of the freezmg solution prepared m step 3. Allow the crystal to equilibrate for at least 15 mm, but no

longer than 3 h. 5. Remove the crystal using the loop, and mrmedtately plunge the loop + crystal assembly mto an awaiting 2.5 mL vial of hqurd propane cooled by surroundmg hqutd nitrogen. 6 Mount the crystal on a compatible goniometer head such that the loop IS placed m the center of the cooled-nitrogen stream. The temperature of the nitrogen stream should be mamtamed at 100°K

The methods for data collection and processmg are often peculiar to mdividual laboratories. In our experience, data collected at 3 A resolution on an MAR imaging plate detector and processed using the software package DENZO worked well. The refinement of the data against the structure has been carried out using the software package X-PLOR m which a single round of simulated annealing refinement, followed by conventional Powell mmimization and temperature-factor refinement, produced a structure with a reasonable R-factor and very good geometry using as a starting structure the pubhcly available coordmates for the appropriate crystal form. 4. Notes 1. The RNA was synthesized from Glen Research rtbonucleosrde phosphoramtdttes purchased from Cambto and assembled on an Apphed Btosystems 380 B solid-phase ohgonucleotrde synthesizer on 1, 5, or 10 pm01 scales, and deprotected using methanohc ammonia and tetrabutylammonium fluoride as described prevtously (1)

Crystallograph/c Analyses

391

2 In almost all cases m which crystals appeared, they did so within 2 or 3 d using Condition A, or overnight usmg Condition B 3 The gomometer head can be either homemade or purchased from Hampton Research 4 Our experience is that a loop shghtly smaller m diameter than the crystal works best

Acknowledgments Aaron Klug, John Finch, Stephen Price, James Murray, and Barry Stoddard

have been valued collaborators in developing these methods. References 1 Gait, M. J , Pritchard, C , and Slim, G (1991) Ohgoribonucleotide synthesis, in Oligonucleotlde Synthesu, A Practical Approach ( Eckstein, F , ed.), Oxford Umversity Press, Oxford, pp 25-48 2. Scott, W G., Finch, J. T., Grenfell, R , Fogg, J , Smith, T., Gait, M J , and Klug, A. (I 995) Rapid crystallization of chemically synthesized hammerhead RNAs using a double screemng procedure. J Mol BloI. 250,327-332. 3. Scott, W G , Finch, J. T., and Klug, A. (1995) The crystal structure of an all-RNA hammerhead ribozyme: a proposed mechanism for RNA catalytic cleavage Cell 81,991-1002

42 tRNA Delivery Systems for Ribozymes Rhonda Perriman and Rob de Feyter 1. Introduction The dehvery and expression of hammerhead ribozymes to eukaryotrc cells have largely been achreved using RNA polymerase II (pol II)-based promoters for transcription of rtbozyme sequences. These constructs produce transcripts that are capped (S-m7G) at the S-end and contain long tracts of adenine residues (i.e., are polyadenylated) at the 3’-end. Although there is a large body of literature (11 that suggests the successof pol II-based ribozyme constructs in reducing target gene activtty, several other studies have provided evidence for alternate modes of delivery. This chapter will review the methods for the use of RNA polymerase III-based delivery systems. In partrcular, rt will focus on the use of tRNA molecules as delivery systems for hammerhead rrbozymes. tRNAs have several advantages as delivery systemsfor rrbozymes. They are abundantly expressed (2) and are extremely stable molecules (3). Additionally, unlike RNA pol II transcripts, they are small and do not contain long transcription leaders or polyA sequences.Furthermore, since the structure of the tRNA is known (4), ribozyme msertion sites can be situated to mimmtze any reduction in cleavage owing to interactions with the surrounding tRNA sequence. Sequences transcribed by RNA pol III contain two highly conserved sequence blocks, A and B (Fig. l), downstream of the transcription start site, both of which are essential for active transcription. In tRNAs, A and B are separated by a region rangmg from 3 l-93 bases.Engineered A-B box separations have extended this range to 2 l-365 bases (5,6). However, this separation may vary for different tRNA sequences. This chapter will outline the regions of the tRNA molecule that, to date, have been successfully used for insertion of ribozyme sequences for delivery From

Methods Edlted

by

m Molecular

B/o/ogy,

P C Turner

Humana

393


Inc , Totowa,

Protocols NJ

394

Perriman and de Feyter

TX start

lC-G C-G 2 G-C’O A-U SC-G

G /%? ,,aGAGC 20

-

01

ACUGG CU A-U- ArGeG G-C *=

Fig. 1. Tobacco tyrosine tRNA Arrows indicate transcription start (TX start) and stop (TX stop) sites, and three (circled) sites used for prevtous ribozyme msertions. The CCA 3’-triplet is added to the 3’-end of the mature tRNA, followmg removal of the 3’- and S-flanking sequence (smaller ttahctzed sequence). A and B boxes are highly conserved RNA polymerase III transcription factor binding domains, w at posittons 35 and 55 is a pseudouridine, and ttahcized region 1sa 13-base mtron. Introns have been found in all eukaryotic tyrosine tRNAs characterized to date to cells. In addition, the experimentation involved m mserting the ribozyme and assessing its utility prior to expression in vivo will be discussed. For methods of delivery of DNA into cells, the reader is referred to Chapters 43-46. 2. Materials

2.7. Selection of tRNA and Selecting the Site for Ribozyme Insertion The selection of the tRNA sequence and the site for ribozyme msertion do not require any laboratory materials. Some guidelines for these selection processes are hsted m Sections 3.1. and 3.2. and further discussed in Note 1.

395

tRNA Delivery Systems

2.2. Site-Directed Mutagenesis for Insertion of Ribozyme Domain into tRNA Sequence 2.2.1, Production of Smgle-Stranded

Template DNA

1 Selected tRNA gene inserted m a pGEM@ vector (or equivalent, see Note 2) 2. Transformation competent cells of Escherlchza colz strain BW3 13 (ung-, dur, or other ung- stram). Store at -80°C. 3 LB agar plates contammg 100 pg/mL ampicillin. Store at 4°C. 4. LB broth containing 100 clg/mL ampicillin (LB-amp). 5 M13K07 helper phage (210” PFU/mL). Store at 4°C 6 Kanamycin sulfate (25 mg/mL). sterile solution m water. Store at 4°C. 7 20% (w/v) Polyethylene glycol (PEG), 2 S MNaCl solution 8 TES buffer 50 rnA4 Tris-HCl, pH 7 6,5 mM EDTA, 0 5% SDS 9. Phenol (HZ0 saturated) chloroform~isoamyl alcohol (25 24 1) 10 3 MNa-acetate, pH 6 0 11 Ethanol. 12. Agarose. 13 10X TBE buffer 890 mM Tris-borate, pH 8 3,20 mMEDTA 14 0 5 pg/mL Ethtdmm bromide Store at 4°C.

2.2.2. Design, Synthesis and Phosphorylation

of Oligonucleotlde

1 2 3 4 5

Access to oligonucleottde synthesis Vacuum centrifuge (e g , Speedvac). Sterile distilled HzO. UV absorbance spectrophotometer T4 Polynucleotide kmase (PNK) and manufacturer’s buffer (e.g., from New England Biolabs, Beverly, MA). Store PNK and buffer at -20°C and maintain on ice 6 10 mA4 ATP. Store at -20°C.

2.2.3. Site-Directed Insertion of Ribozyme Sequence into tRNA Gene 1 Single-stranded template DNA (produced as in Section 3.3 1 ) 2 Ohgonucleotide-containing nbozyme sequence (produced as m Section 3.3 2 ) 3 Sequenase@ (Arlington Heights, IL), or other DNA polymerase (see Note 3). Store at -20°C and maintain on ice while m use. 4. 10X Sequenase reaction buffer, or equivalent buffer for the DNA polymerase used Store at -20°C. 5. 100 mA4 Stock solutions of dATP, dCTP, dGTP, and dTTP. Store at -20°C. 6 100 mM Dtthiothrettol. Store at -20°C. 7 10 mA4 ATP. Store at -20°C 8. T4 DNA ligase. Store at -20°C and mamtam on me while in use. 9 Transformation competent cells ofE. cok laboratory strain, e.g , JM109 (or other ul2g+ strain) Store at -80°C 10. LB broth, dissolve 10 g of Bacto-tryptone, 5 g of Bacto-yeast extract, and 10 g NaCl m water. Adjust the pH to 7 0 with NaOH, and make up to 1000 mL.

396

Perriman and de feyter

11. Items 3, 12, 13, and 14 from Section2 2.1. 12. Dideoxysequencinglut (e.g.,Sequenase sequencingkit, United StatesBiochemicals) Store at -20°C.

2.3. In Vitro Analysis of tRNA Ribozyme 2.3.1. In Vitro Cleavage Analysis Detailed protocols for materials and methods involved in the production of in vttro transcribed RNAs and subsequent in vitro cleavage assaysare listed m Chapters 10, 19, and 23. Sectton 3.4.1. lists only information pertinent to the analysts of the effictency of tRNA rtbozymes and does not requtre any further materials other than those listed for other m vitro cleavage assays. 2.3.2. RNA-Ribozyme

In Vitro Processing Analysis

1 Wheat germ extract or rabbit reticulocyte lysate (see Note 4 for selection of cellfree extract for m vitro processmg) (e.g., from Promega, Madison, WI) Store at -80°C and mamtam on Ice whtle m use. 2. 5X Processmg buffer 30 mMMg acetate, 400 mM spermme, 500 mMK acetate, 100 mM Tris-acetate, pH 7 5, 75 mM dithiothreitol, 4% Triton-X 100, 500 fl CTP, 5 mA4ATP 3. 32P-aNTP-radiolabeled m vitro transcribed tRNA ribozyme RNA (see Chapter 10 for detailed protocols on enzymattc synthesis of RNA). 4 Items 9-l 1 of Section 2.2 1

3. Methods 3.1. Selection of a tRNA Before modifying a tRNA gene for delivery of rtbozyme sequences to cells, the tRNA must be selected. Nuclear-derived tRNAs of methtonine-(tRNAMet) and tyrosme-(tRNATYr) have been used as rtbozyme delivery vehtcles for expression in Xey1opus, human, and tobacco cell lines (7-14). In each case, the selection crtterta for the tRNA was simply to ensure that the gene was dertved from the organism m which the tRNA rtbozyme was to be expressed. Although the analysis has been far from exhaustive, neither type of tRNA appeared to have any advantage or dtsadvantage over the other (see Note 1). Based on this, we suggest the followmg when selecting a tRNA for rtbozyme delivery. 1. Unless specifically targetmg an organelle sequence, select a nuclear-derived tRNA origmatmg from the orgamsm m which you are working (preferably a

tRNA that is already cloned) 2. Familiarize yourself wtth the tRNA gene sequence-locate the A and B boxes, the transcription start and termmation sites, and any endogenous intron that may be present (some of these are marked on the tobacco tRNATy’ sequence m Fig. 1 The reader can also consult reviews for general characteristics of tRNAs (1.5,16)

tRNA Delivery Systems 3.2. Selecting

397

the Site for Ribozyme Insertion

Once you have obtained a cloned tRNA gene, the next step IS to select the site for insertion of the ribozyme sequence. Figure 1 has highlighted the A and B boxes, transcription start and stop sites. In addition, the three sites previously selected for insertion and expression of rlbozyme sequenceswithin either the tRNAMet or tRNATyr sequencesare arrowed. Any of these are a good starting pomt for obtaining tRNA ribozyme expression, although there are other possible insertion sites (see Note 1). 3.3. Site-Directed Mutagenesis for Insertion of the Ribozyme Domain into the fRNA Sequence Our preferred protocol for modifying the tRNA gene, and adding the ribozyme sequence, IS based on the site-directed mutagenesis protocol of Kunkel et al. (I 7). 3 3.1. Production of Single-Stranded

Template DNA

1 Introduce the plasmid containing the cloned tRNA gene into BW3 13 (ung-) competent cells (I e., by electroporatlon or chemicaltransformation). 2 Select for transformed colonies by spreading dilutions of the cells from the transformation procedure on LB-agar plates contaming amplclllin (100 &mL) and incubating overnight at 37°C. 3. Pick a single colony and maculate 2 mL of LB-amp m a sterile test tube Shake at 37OC 4 When the broth culture has become highly turbid (approx 5-6 h), transfer 60 clr, to a new test tube containing 3 mL of LB-amp Add 2 x lo7 PFU of Ml3K07 helper phage, and shake at 37°C for 2 h 5. Add 4 pL of kanamycm solution Contmue shakmg at 37’C overnight. 6. Divide the culture between two mlcrofuge (1.5 mL) tubes, and pellet the cells in a mlcrofuge at 210,OOOg for 10 mm. Remove 1 mL of supematant from each tube, and add to 0.27 mL of PEG/NaCl in two fresh tubes Cool the tubes on ice for 15 min. 7. Pellet the phage particles by mlcrocentrlfugation at 210,OOOg for 10 mm. Remove all the supematant (if necessary, recentrifugmg the tube briefly to remove the remainmg liqmd). 8. Resuspend each pellet m 100 pL of TES, and combme both tube contents 9 Add 200 pL of phenol*chloroform.lsoamyl alcohol, vortex for 30 s, and mlcrofuge at 210,OOOg for 5 min to separate the aqueous phase. 10. Remove the upper aqueous phase to a fresh tube, takmg care not to take any white material from the interphase 11 Repeat steps 9 and 10. 12. Add 20 r.lc of 3 MNa-acetate and 600 & of ethanol. MIX and cool at -20°C for at least 20 mm

398


13. Mtcrofuge for 10 mm at 210,OOOg. Pour off the liquid, and wash the salts away from the DNA by adding 1 mL of 70% ethanol and recentrifugmg the tube for 2 mm Remove the supernatant and dry off the remaining solvent under vacuum. 14 Resuspend the DNA m 40 pL of H20, and use 4 pL for site-directed mutagenesis 15 Check for the presence of single-stranded DNA by gel electrophoresis of 4 pL on an agarose/TBE gel, stammg the gel with 0.05 pg/mL ethidium bromide.

3.3.2. Design, Synthesis, and Phosphorylation

of Oligonucleotide

The ohgonucleotide primer for site-directed insertion of the ribozyme moiety must contam two sequences that are complementary to the single-stranded DNA template and that flank the insertion site. These complementary sequences must be a mmimum of 10 nucleotides each Design and synthesize the ohgonucleotide taking account of these rules (see Note 5) Determine the concentration of the ohgonucleotide by diluting a sample loo-fold and measuring the absorbance at 260 nm The concentration can be calculated according to the formula Concentration (pg/mL) = absorbance x dilution factor x 33

(1) Phosphorylate the 5’-end of the oligonucleotide by mixmg 1 ug of olrgonucleotide and 20 U of T4 polynucleotrde kmase m 1X PNK buffer contammg 1 mA4 ATP. Incubate the mixture at 37°C for 1 h. The phosphorylated ohgonucleotrde can be used directly m the followmg procedure (see Notes 6 and 7)

3.3.3. Site-Directed insertion of Ribozyme Sequence into tRNA Gene 1. Mix 4 pL of single-stranded template DNA with 100 ng of phosphorylated oligonucleotide m a total volume of 10 pL m a microfuge tube Incubate the mixture at 65’C for 10 min to anneal the oligonucleotide and template. 2 Transfer the tube to 37°C and allow it to equilibrate for several minutes. 3. Add 10 pL of a mixture contammg the followmg: 2X Sequenase buffer, 1 mA4 each dATP, dCTP, dGTP, and dTTP, 20 mM dithiothreitol, 0 6 mM ATP, 400 U of T4 DNA ltgase, 3 U of Sequenase (or other DNA polymerase; see Note 3) 4 Incubate the mixture at 37°C for 1 h. 5. Use one-tenth of the mixture to transform competent cells of E colz strain JM 109 (see Note 8). If electroporation IS used as the transformation method, remove salts from the DNA mixture by ethanol precipitation as follows. Add 180 pL of water, and then follow Section 3.3 1 , steps 12-14. If chemical transformation is used, 2 pL of the mrxture can be used directly without precipitation 6 Select for ampicillm-resistant colonies on LB agar contammg 100 pg/mL ampicillin 7 Isolate plasmid DNA from SIX or more cultures grown from mdividual colotnes Any standard plasmid DNA preparation method ~111 do (IS). 8 Analyze plasmid DNAs for insertion of the ribozyme moiety by restriction digestion/gel electrophoresis and/or DNA sequencing (see Notes 9 and 10)

tRNA Delivery Systems

399

3.4. In Vitro Analysis of the tRNA Ribozyme 3.4.7. In Vitro Cleavage Analysis of Target RNA Since detailed methods for performing m vitro cleavage reactions are described m Chapters 22-24, this section will outline only those methods pertinent to tRNA ribozyme constructions. We recommend m vitro testmg transcripts of chimeric tRNA ribozyme constructs for their ability to cleave target RNA, prior to in vivo mvestlgations. The tRNA rlbozyme transcripts can be generated by in vitro transcnption, which 1sdetailed in Chapter 10 (18). These m vitro transcripts will also contam sequences5’ and 3’ (such as those derived from the vector, and noncoding or preprocessed sequence derived from the tRNA gene), which may not be present in m vivo transcripts. If desired, these sequences can be trimmed off by in vitro processing reactions as described in Section 3.4.2., or by transcription of PCR-generated fragments (see Note 11). 3.4.2. In Vitro Processing of tRNA-Ribozyme Transcripts In vitro processing of tRNA ribozyme transcripts can be carried out using cell-free extracts from wheat germ or rabbit retlculocyte lysate (see Note 4). In addition to provldmg a “mature” tRNA rlbozyme transcript for m vitro cleavage analyses, m vitro processing can provide information on the behavior and potential intracellular location of chimeric tRNAs in vlvo. Complete maturation of the tRNA transcript 1sprobably essential for export from the nucleus to the cytoplasm (19). The loss of any one of the processmg steps may be critical in determining the mtracellular location of that tRNA. This could determine the types of substrate RNAs a chimeric tRNA ribozyme could successfully target and inactivate. Below 1sa simple procedure, based on the work of Stange and Beler (20), for assaying processmg of chimerlc tRNA rlbozyme transcripts m wheatgerm extract. 1 Preparel-2 pmol of a-32P-NTP radlolabeled m vitro transcribed tRNA rlbozyme RNA (see Section 3 4 1 ) 2. Mix with 1 Ccz,of wheat germ extract, 2 pL of 5X processing buffer, and make up to 10 pL with sterile Hz0 3 Incubate at 30°C for 1 h. 4 Increase the volume to 200 & with H20, extract with phenol*chloroform*lsoamyl alcohol, and ethanol-precipitate as outlmed in Section 3 3.1., steps 9-13 5. Resuspend by vortexmg and pipetmg in 100% formamide loading dye (containing bromophenol blue and xylene cyan01 tracking dyes). 6. Analyze by gel electrophoresls on a denaturing polyacrylamlde gel

4. Notes 1 Three siteswithin tRNATyror tRNAMetgeneshave been selectedpreviously for rlbozyme insertion (see Fig 1)

400

2.

3

4

5.

6

7. 8. 9

Perriman and de Feyter a A rtbozyme was inserted mto the anttcodon loop of a tRNAMet or a tRNATyr for use m Xenopus oocytes or tobacco suspension cells, respectively (7,13). b Another ribozyme was Inserted into the endogenous mtron of a tRNATyr for use in Xenopus oocytes (I 0,12) c A ribozyme was inserted at the 3’-end of a tRNAMet gene for use in human cell lmes (9,11,14) These sites m tRNAs are only a few of a large number of possible insertion sites. Provided the A and B box sequences are maintained (and spaced appropriately), the tRNA motif 1snot required for htgh-level RNA pol III expression. This means that the scope for nbozymes expressed using the tRNA-promoter sequences is large The addmon of stabthzmg sequences can improve rtbozyme Intracellular stab&y (14) If choosmg to construct tRNA ribozymes in which the ribozyme is mserted at sites other than those previously tested, we recommend several excellent revtews on tRNA structure and function (15, I6), which will aid m site selection For the production of single-stranded template DNA, the cloning vector contammg the tRNA gene must have sequences that allow packaging of single-stranded DNA (e g , “phagemtds” containing the fl origin of replication), such as the pGEM fs) series from Promega (Madison, WI) Thts protocol begins after the tRNA has been inserted mto such a vector We have found that Sequenase (Umted States Btochemrcals) IS the best DNA polymerase for this purpose. If this 1snot available, it can be substituted with T4 or T7 DNA polymerases Both of these are available from several commerctal suppliers. If choosmg to carry out cell-free processing of the tRNA rtbozyme transcripts, the selection of the cell-free extract may be crmcal m obtammg an accurate mdication of the efficiency and extent of processmg Previous analyses on human, plant, and yeast tRNAs have shown that tRNAs dertved from different kmgdoms can be processed along different pathways depending on the source of the processing extract (21,22) For this reason, we recommend using wheat germ extract for plant-derived tRNAs and rabbit rettculocyte lysate for animal-derived tRNAs The length of each flanking sequence on the ohgonucleotide for msertton of the ribozyme domain should be no < 1O-l 2 nucleotides Shorter sequences will result m reduced annealmg and lower mutagenesis frequenctes Longer sequences are not necessary and increase the cost of synthesis Further puriticatton of the ribozyme-containing ohgonucleotide is not normally necessary If, however, the mutagenesis 1sunsuccessful, the ohgonucleotide can be gel-purified by polyacrylamtde gel electrophoresis (18). This could be necessary wtth longer oligonucleotide sequences (>60 nt). We routinely obtain mutagenesis frequencies of 50% or greater using this method If the frequency is much lower, follow Note 6 For the rescue of ribozyme-contammg plasmtds followmg mutagenesis, any ung+ stram of E cofz will do To analyze for the success of the mutagenesis reactton, restrtctton digestion and/ or direct seauence analvsis can be nerformed Ideallv. when desienmz the

tRNA

Delivery

Systems

401

mutagemc ribozyme-containing oligonucleottde, the mcorporatton of a unique restriction enzyme recogmtion site provides a rapid primary assay for the success of the mutagenesis. In addttton, we recommend sequencing through the ribozyme insertion to ensure the integrity of the rtbozyme domain. 10 If no unique restrtctton enzyme recognition site can be incorporated with the ribozyme domain, we recommend usmg a restriction enzyme(s) that generates a fragment that spans the rtbozyme insertion site, and that is not more than 200 bp m size. Smce msertion of the rtbozyme moiety results m only a 22 bp increase m the size of this fragment, an alteration of this size would not be easily detected on a larger restriction fragment II PCR fragments lacking the 5’-upstream and 3’-downstream vector sequences can be made for transcription of tRNA ribozyme molecules corresponding to “processed” forms. This requires that two ohgonucleotide primers be designed and synthesized for the PCR. The first of these (5’-end) must contain an RNA polymerase promoter sequence (e.g., for T7 or SP6 RNA polymerase) followed immediately by the mature tRNA sequence (20 nt), such that transcription with the RNA polymerase m vitro would synthesize RNA with the correct 5’-terminus of the mature tRNA rtbozyme. T7 RNA polymerase functions best if the first three nucleotides of the RNA are G-purme-purme, so use of this polymerase may require addition of one or more nucleotides to the 5’-end of the RNA for efficient synthesis The second primer (3’-end) consists of a sequence complementary to the last 20 nt of the tRNA rtbozyme. PCR reactions using the two primers and tRNA ribozyme contammg plasmtd as template are performed, yielding DNA fragments that can be used directly for m vitro transcrtption, or, alternattvely, cloned mto plasmid vectors for subsequent transcription

References 1 Bratty, J , Chartrand, P , Ferbeyre, G , and Cedergren, R. (1993) The hammerhead RNA domam, a model ribozyme Blochlm Bzophys Acta 1216,345-359 2. Darnell, J. (1986) Macromolecules in procaryotic and eucaryotic cells, m h4oZecuZar Cell Bzology (Darnell, J., Lodish, H., and Baltimore, D. eds.), Scientific American Books, New York, pp. 261-267 3 Karnahl, U. and Wasternack, C. (1992) Half-life of cytoplasmic rRNA and tRNA, of plastid rRNA and of urldme nucleotides m heterotrophically and photoorganotrophically grown cells of Euglena gracrEzs and its apoplastic mutant W3BUL. Int. J Blochem. 24,493-497

4. Holbrook, S R., Sussman, J L., Warrant, R. W., and Kim, S. H. (1978) Crystal structure of yeast phenylalanme transfer RNA J A401 Btol 123,63 l-660 5 Baker, R E., Hall, B. D., Camier, S., and Sentenac, A. (1987) Gene size differentially affects the binding of yeast transcription factor t to two mtragemc regions. Proc Nat1 Acad Scr USA 84,8768-8772

6. Fabrtzio, P., Coppo, A., Frusctom, P , Benedettr, P , Di Segm, G., and TocchmlValentim, G. P (1987) Comparative mutational analysis of wild-type and stretched tRNALeU gene promoters. Proc Nat1 Acad Sci USA 84, 8763-8767

402


7. Cotten, M. and Bnnstiel, M. L. (1989) Ribozyme mediated destruction of RNA zn vwo. EMBO J. 8,3861-3866. 8 Yuyuma, N., Ohkawa, J., Inokuchi, Y , Shuai, M., Sato, A., Nishikawa, S., and Taira, K ( 1992) Construction of a tRNA-embedded-ribozyme trmunmg plasmid Bzochem. Biophys Res. Commun. 186,1271-1279. 9 Shore, S. K., Nabusa, P. M., and Reddy, E. P. (1993) Rtbozyme mediated cleavage of the bcr-abl oncogene transcrtpt: rn vitro cleavage of RNA and tn vtvo loss of P2 10 protein kmase activity. Oncogene 8, 3 183-3 188. 10. Bouvet, P., Dtmitrov, S , and Wolffe, A. P. (1994) Specific regulation ofXenopus chromosomal 5s rRNA gene transcription m VIVOby histone Hl. Genes Dev 8, 1147-I 159 11. Baier, G., Coggeshall, K. M , Baler-Bitterlich, G , Giampa, L., Telford, D , Herbert, E., Shih, W., and Altman, A. (1994) Construction and characterisatton of lck- and fyn-specific tRNA ribozyme chimeras Mol. Immunol 31,923-932 12. Kandolf, H (1994) The H IA histone variant IS an zn vzvo repressor of oocyte-type 5s gene transcription in Xenopus laevis embryos. Proc Nat1 Acad Set USA 91, 7257-7261. 13 Perriman, R. J , Bruenmg, G B., Dennis, E. S., and Peacock, W. J (1995) Effective ribozyme delivery to plant cells. Proc Nat1 Acad Set USA 92,6175-6 179 14. Thompson, J D , Ayers, D F , Malmstrom, T A., McKenzie, T L , Ganousis, L , Chowrira, B M , Couture, L , and Stmchcomb, D. T (1995) Improved accumulation and activity of ribozymes expressed from a tRNA-based RNA polymerase III promoter Nucletc Acids Res 23,2259-2268. 15. Schmnnel, P R , Soll, D , and Abelson, J. N (eds) (1986) Transfer RNA Structure, Properttes and Recognttton Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 16 Geiduschek, E P and Tocchini-Valentini, G. P (1988) Transcription by RNA polymerase III. Ann Rev Btochem 57,873-914 17 Kunkel, T. A , Roberts, J D., and Zakour, R A (1987) Rapid and efficient site specific mutagenesis without phenotypic selection, in Methods Enzymol 154, 367-382

18. Sambrook, J., Fritsch, E. F , and Maniatis, T., eds. (1989) Molecular Clonzng A Laboratory Manual, 2nd ed Cold Spring Harbor Laboratory Press, Cold Sprmg Harbor, NY. 19 Tobian, J A., Drmkard L , and Zasloff, M. (1985) tRNA nuclear transport definmg the critical regions of human tRNAMet by point mutagenesis Cell 43, 4 15-422 20 Stange, N and Beier, H (1987) A cell-free plant extract for accurate pre-tRNA processing, splicing and modification EMBO J 6, 28 1 l-28 18. 21 van Tol, H., Stange, N., Gross, H. J., and Beier, H. (1987) A human and plant mtron-contammg tRNATyr gene are both transcribed m a HeLa cell extract but spliced along different pathways. EMBO J 6,35-4 1 22 Stange, N., Gross, H J., and Beier, H. (1988) Wheat germ sphcmg endonuclease IS highly specific for plant pre-tRNAs. EMBO J 7, 3823-3828.

Expressing

Ribozymes

in Plants

Rob de Feyter and Judith Gaudron 1. Introduction The hammerhead and hanpm rrbozyme motifs were first identified and characterized in small, circular RNA molecules (satellite RNAs, vtrords) associated wrth some diseases m plants (I). The ribozyme activity is necessary for rephcatton of these RNAs, functtomng to cleave linear concatamertc forms to monomeric units Since these naturally occurring rrbozymes function in plants, the apphcatlon of synthetic ribozymes for control of gene expression m plants seems reasonable, Despite this, there are relatively few reports of synthetic rrbozyme activity in plant cells or whole plants (2,3) compared to the numerous publications of activity m animal and human cells (4.5). Thus IS perhaps surprismg, since it 1sgenerally easier to introduce DNA into plant cells and regenerate transgenic plants than to make transgenic animals. Transformatron of many plant species, particularly dicotyledonous plants, IS routme m many laboratorres The approach usually taken for application of ribozymes in plants IS to construct a gene for expression of ribozyme RNA, transform the plant species of interest with the gene, and analyze stably transformed plants for expression of the gene and phenotyptc modtticatton. The gene construct can be tested imtrally m transient assaysusing protoplasted plant cells (6,7), although the results obtained may not necessarily mdrcate activity in whole plants (R. Perriman, unpublished data). Alternative forms of dehvermg the ribozyme RNA are to use viral vectors that can replicate and move systemically in plant tissues (8,9) or to deliver rtbozyme constructs transiently into plant tissues by particle bombardment (IO). This chapter will outline methods for stably mtroducmg genes into plants and detecting expression of rtbozyme RNA m transformed tissue. Since transFrom


&o/ogy, Vol 74 Rlboryme Protocols Humana Press Inc , Totowa, NJ

403

de Feyter and Gaudron

404

formation methods vary for different plant species, we will focus on transformation of a model plant species, tobacco. 2. Materials 2.1. Choice of Expression

System

1 Plasmid containing the chosen promoter and terminator sequences or tRNA or snRNA gene 2. Restriction enzymes, T4 DNA ligase, gel electrophorests equipment, and so forth, for standard recombinant DNA work

2.2. Insertion

of Ribozyme Gene Cassette into Binary Vector

1. Binary T-DNA vector (see Section 3.2.). 2. Rtbozyme gene construct with sequences for expression in plant cells, made as in Section 3.1. 3 Materials as m Sectton 2 1 , step 2

2.3. Introduction of Gene Constructs into Agrobacterium by Triparental Conjugation 1 Ribozyme gene construct in binary T-DNA vector, made as m Section 3 2., m a rtfamptcm-senstttve strain of Escherzchla co/z 2 Agrobacterwm tumefaclens AGL 1 (I I) or equivalent strain, rifampicm-resistant 3. E. coEz strain carrying the helper plasmtd pRK2013, kanamycm-resistant, rifampicm-sensttive 4 Transformatton competent cells of E colz strain DH5a or equivalent. 5 Anttbtottc stock solutions* a. Kanamycm sulfate (Kan), 25 mg/mL m water, filter-sterilized. store at 4°C. b. Tetracycline-HCl (Tet), 15 mg/mL m 50% methanol: dissolve Tet m the methanol first, and then add the water. Store at -2O’C in the dark c Rtfamptcm (Rif), 50 mg/mL m dtmethyl sulfoxtde: store at -20°C m the dark. d. Carbemctllm (Carb), 50 mg/mL m water, filter-sterilized store at 4°C 6 Luria Bertam broth (LB) dtssolve 10 g of Bacto-tryptone, 5 g of Bacto-yeast extract, and 10 g NaCl m water Adjust the pH to 7.0 with NaOH, and make up to 1000 mL 7 LB agar plates, some with 25 ug/mL Kan, or 50 pg/mL Rif, or 5 pg/mL Tet (see Note l), some with both Rif and Tet or Rif and Carb (50 pg/mL), and some without anttbtotics. Plates with Rif can be stored at 4°C wrapped m alummmm foil, for several weeks 8 Sterile 30% glycerol 9 Incubators and shakers at 28°C and 37°C. 10 Sterile test tubes and flasks for growth of bacterial broth cultures, sterile centrtfuge bottle (100 mL capacity), and sterile 1.5 mL microfuge tubes. 11 Low-speed centrifuge and a microfuge 12 Materials as for Section 2.1.) step 2

Expressing Ribozymes in Plants 2.4. Agrobacterium-Mediated

Transformation

405 of Tobacco

1. A. tumefaclens AGLl containing the rtbozyme gene construct m the binary vector, made as m Section 3.3., resistant to tetracyclme (see Note 1). 2. Axemcally grown tobacco plants, grown m stertle jars contammg MSpot medium (see Note 2). 3. MilhQ deiomzed water for plant tissue culture 4. Stock solutions for plant tissue-culture media: a. MS Vitamins (1000X concentration): prepare m 100 mL of MtlhQ water by adding 50 mg of nicotmic acid, 50 mg of pyridoxine HCI, 10 mg of thiamine HCl, and 200 mg of glycme Store at -20°C in 1 mL ahquots for up to 6 mo. b. MS iron/EDTA (200X concentration): prepare in 500 mL of MilhQ water by adding 3 35 g of dtsodium EDTA and 2 7 g of FeCls * 6H20 Store at 4°C c. Indole 3-acetic acid (IAA) (an auxm plant hormone), 1 mg/mL: dissolve 100 mg of IAA m 1 mL of absolute ethanol, add 3 mL of 1 MKOH, make up to 80 mL with water, adJust the pH to 6.0 with 1 MHCl, and make up to 100 mL. Store at -20°C m 0.5 mL ahquots. This can be autoclaved in MS media d. 6-Benzylamino purme (BAP) (a cytokinin plant hormone), 0.1 mg/mL: weigh 50 mg of BAP, add 10 mL of 0 2 MHCl, heat gently to dtssolve, and make up to 500 mL with MtlliQ water. Store at 4°C. Can be autoclaved in MS media. e. Cefotaxtme ((‘Claforan@” from Roussel Uclafl: 50 mg/mL in M&Q water filter-stertlize, and store at -2O’C m 5 mL ahquots for up to 4 mo f. Ttmenti# (Beecham): 50 mg/mL m MilltQ water. filter-sterihze, and store at -20°C in 0.5 mL aliquots g. Kan 50 mghL m MtlhQ water Filter-sterthze, and store at-20°C in 1 mL ahquots. 5. Murashtge Minimal Orgamcs Medium (MS powder, from Gtbco BRL). 6. MS broth* dissolve 35 g of MS powder/L of MtlliQ water. Autoclave 7 Stertle plastic Jars, approx 7 cm in dtameter wtth screw caps 8 Plant tissue-culture media. a MSpot medium, for tip/node regeneration and propagation of axenically grown tobacco: prepare m 500 mL of M&Q water by adding 17.5 g of MS powder, 0 5 mL of MS vitamm stock, 2.5 mL of MS uon/EDTA stock, and 3 g of agar. Autoclave, allow to cool to approx 45”C, and pour mto sterile screwcapped jars to a depth of approx 2 cm. Allow the medium to sohdtfy before closmg the contamers Before using, store the prepared jars for at least a week at room temperature to check for growth of contaminants b. MS1 plates, for coculttvation with Agrobacterium. Prepare in 500 mL of MtlhQ water by adding 17.5 g of MS powder, 0.5 mL of MS vitamins, and 2.5 mL of MS tron/EDTA Adjust the pH to 4.8 with 1 MHCl. Add 3 5 g of agar. Autoclave, cool to 45°C and pour mto Petri dishes. c MS2 plates, for shoot regeneratton: prepare in 500 mL of MilllQ water by addmg 17.5 g of MS powder, 0.5 mL of MS vitamms, 2.5 mL of MS iron/ EDTA, 0.25 mL of IAA, 5 mL of BAP, and 3 g of agar. Autoclave, allow to cool to 45’C, and then add 1 mL of Kan, 5 mL of cefotaxtme, and 0.5 mL of Ttmentin solutions. Pour into deep-sided Petrt dashes.

406

9. 10 Il. 12 13.

de Feyter and Gaudron d. MS3 medium, for root regeneration Prepare as for MS2, except decreasing the IAA to 0 025 mL/500 mL and omittmg the BAP and cefotaxime. Pour mto deep-sided Petri dishes and sterile screw-capped Jars. LB containing 1 5 pg/mL Tet Sterile MilhQ water in screw-capped Jars. Sterile 3MM filter paper, tweezers, scalpel, and centrifuge bottle (100 mL capacny). Lammar flow hood. Culture room, 2628°C 16 h light/8 h dark cycle

2.5. Small-Scale

Preparation

of RNA and DNA from Plants

1. Phenol-EDTA. 500 g of phenol (molecular-biology-grade), 45 mL of distilled water, 5 mL of 0 2 Mdisodmm EDTA (pH 8 0), and 0.5 g of 8-hydroxyqumolme Store at 4”C, and warm to melt. 2. TE3D. to 50 mL of water, add 24 2 g of Trrs base, 7.4 g of disodmm EDTA, 10 g of Nomdet P-40, 15 g of lithium dodecyl sulfate, and 10 g of sodmm deoxycholate Dissolve components m the order indicated The three detergents can be added together Stir the mtxture overnight at room temperature to form a clear solution Store at room temperature. 3 P-Mercaptoethanol 4. Acid-washed sand (e g , from BDH) 5 Grinder fitted with 7 mm glass rod (see Note 3) 6 3 A4 Ammonium acetate-EDTA: to 807 mL of water, add 23 1 g of ammonmm acetate and 2 mL of 0 2 M disodmm EDTA, pH 8 0 Autoclave and store at room temperature. 7 Chloroform*tsoamyl alcohol (24 1 v/v) 8. 3 6 A4 LiCl-EDTA: to 918 rnL of water, add 5 mL of 0.2 M drsodmm EDTA, pH 8.0, and 153 g of LtCl. Autoclave and store at 4°C. 9. TE 10 mMTris-HCl, 1 mMEDTA, pH 8 0. Autoclave 10 Ethanol, tsopropanol. 11. RNase A, 1 mg/mL m water’ boil the solution for 10 min after preparation to macttvate contammatmg DNase. Store at 4°C 12 3 MSodmm acetate/acetic acid, pH 5.2. adJust 60 mL of 5 Msodmm acetate to pH 5.2 with glacial acetic acid. Make up to 100 mL Autoclave and store at room temperature. 13. Microfuge, UV absorbance spectrophotometer

2.6. Semiquantitative Reverse Transcription Method for Detecting Ribozyme Expression 1. 2 3. 4.

(RT)-PCR Levels

PCR machme. Ohgonucleotide primers for cDNA synthesis and PCR amplification (see Note 4) 1OX RT-PCR buffer: 0 5 A4 Tns-HCl, pH 8.3,O 5 MKCl, 40 mA4 MgCl* (seeNote 5) Deoxyribonucleotide trtphosphates a mixture containing 20 mA4 each dATP, dCTP, dGTP, and dTTP. Store at -20°C. 5 1 A4 Dithtothreitol (DTT)

Expressing Ribozymes In Plants

407

6 RNase mhlbltor (e.g , RNasm from Promega, Madison, WI), reverse transcrlptase (e.g., Superscript from Glbco BRL), and Tuq DNA polymerase. 7 Sterile mlcrofuge tubes, tubes or plates for PCR machme 8 Water baths at 65, 37, and 42°C 9. Materials for gel electrophoresis, including TBE buffer 10X TBE. 890 mMTrisborate, pH 8 3, 20 mh4 EDTA

3. Methods 3.1. Choice of Expression System The ribozyme may be expressed m plant cells using a strong, constitutlve promoter, e.g., cauliflower mosaic virus 3% promoter (12) or a tissue-specific promoter. Alternatively, the ribozyme sequence can be inserted into tRNA (see Chapter 42) or snRNA genes for expression as chimerlc tRNA rlbozyme or snRNA

rtbozyme

RNA.

It 1s probably

best to keep the ribozyme

molecule

small, thus minimizing potential intra- and/or intermolecular interactions that could interfere with active nbozyme/substrate hybrid formation. If RNA of a cytoplasmically

replicating

plant virus 1s targeted for inactivation,

an lmpor-

tant consideration is that the rlbozyme should be cytoplasmically localized. This should occur if the RNA

contains

appropriate

signals for translation,

including a 5’-cap structure and a 3’-polyA sequence. These methods begin with a ribozyme construct in hand, cloned in a plasmld vector. Considering the time and effort involved in transformation of plants and then analysis,we recommend that the ribozyme first be tested in in vitro cleavage reactions (see Chapters 22-24) and the genebe sequencedto ensure it IS correct. 1. Select an appropriate expression system. 2. Insert the rlbozyme sequence, e.g , between the promoter and termmator regions, m the correct onentatlon, using standard recombinant DNA techmques (13). 3. Confirm the construct is correct by restriction enzyme digestion and analysis by gel electrophoresis

3.2. Insertion of Ribozyme Gene Cassette info Binary Vector For Agrobacterium-medtated transformation, the promoter-nbozyme-termlnator cassettemust be inserted into a T-DNA vector. Numerous binary T-DNA vectors are avatlable as are reviews describing them (14-Z 7). These vectors contain one or both border sequences for transfer of the T-DNA from Agrobactenum to the plant cells, sequences for replication of the plasmld m Agrobacterium and E. colz, a selectable marker for use m bacteria, a selectable marker within the T-DNA that functions m plant cells, and cloning sites. Most binary vectors have sequences that allow conjugative transfer of the plasmld from E. co11to Agrobacterzum (see Section 3.3.). We prefer the T-DNA to contam an additional gene, tailored for expression m plant cells, whose func-

408


tion can be easily assayed (e.g., the GUS gene). Such a gene simphlies of regenerated plants and genetic analysis of progeny.

analysis

1. Select an available binary vector with appropriate features. 2. Insert the promoter-ribozyme-terminator cassette into the T-DNA region by standard recombinant DNA techniques (13) 3 Confirm the construct is correct by restrtction enzyme digestion and analysts by gel electrophorests

3.3. Introduction of Gene Constructs into Agrobacterium by Triparental Conjugation Triparental conjugation is one of the techmques that can be used for transfer of a bmary vector-nbozyme gene construct from E. coli to Agrobucterium, before transfer into plant cells. An alternative method 1selectroporanon (IS). In the conjugative method, the T-DNA vector plasmid is transferred from E coli to Agrobuctenum recipients using a helper plasmid, such as pRK2013, and Agrobuctenum transconjugants are selected using both the antibiotic resistance markers on the binary vector, e.g., tetracyclme resistance (see Note l), and m Agrobacterzum (e.g., rifampicin resistance). The latter selects against the E coli donor and helper strains. 1 Grow stocks of,4 tumefaczens strain AGLl on LB agar plates contaming Rif and Carb for 2-3 d at 28’C These cultures can be stored for several days at 4°C before use, but are best used immediately. For long-term storage, scrape off the growth with a sterile loop or toothpick, mix the cells evenly m 0.5 mL of LB, and dilute with an equal volume of sterile 30% glycerol before freezing at -70°C These stocks are stable for years. 2 Streak out E colz carrying the helper plasmid pRK2013 onto LB agar with 25 pg/mL Kan and E cok containing the binary vector ribozyme gene onto LB agar contammg the approprtate anttbiotic (e g., Tet). Incubate these plates at 37°C overnight 3. Inoculate 100 mL of LB m a 500 mL flask with a loopful of AGL 1 cells from the streaked plate. Incubate for 24 h with shaking at 28°C On the same day, inoculate 2 mL LB cultures with the helper strain and donor strain, each contammg the appropriate anttbtotics Incubate these two cultures overnight at 37°C with shaking 4 On the next morning, dilute both the E colz helper and donor cultures loo-fold into 1 mL samples of fresh LB, without anttbtottcs Grow these cultures at 37’C for 4 h with shaking (see Note 6). 5 Transfer the AGLl culture, which should be highly turbid, to a sterile centrifuge bottle, and pellet the cells at 75OOg for 5 mm (e.g., 8000 rpm for 5 mm m Beckman JA14 rotor or equivalent). Resuspend the cells m 1 mL of LB. At the same time, spin down both the E colz cultures 210,OOOg for 1 mm m 1.5 mL mtcrofuge tubes, and wash the cells by resuspendmg each pellet m 1 mL of LB and recentrifugmg the tubes Resuspend each pellet m 50 p.L of LB 6. Spot 10 pL of the concentrated AGLl suspension onto a dry LB agar plate, and allow the liquid to soak into the agar. Spot 5 pL samples of both the concentrated

409

Expressmg Ribozymes in Plants

E colz donor and helper suspensions onto the AGLl spot, again allowing the hqmd to soak m. Also prepare control spots. AGL 1 plus helper, AGL 1 plus donor. Incubate the plate at 28°C overmght to allow plasmid transfer. 7. Transfer each “blob” of cells to 100 pL of LB, resuspend the cells evenly, and plate dilutions onto LB agar contaming 50 pg/mL Rif and 5 pg/mL Tet. Incubate these selecttve plates at 28°C for 2-3 d. If numerous colonies appear from conJugations where all three strams were mixed, but relatively few from the control mixtures, the conJugation has been successful (see Note 7) 8. Several single colomes from the trtparental conJugatton are touched wtth a sterile loop or toothpick, and streaked onto fresh LB agar/Rlf/Tet plates to maintain a pure culture. Incubate these plates at 28°C for 2-3 d (see Note 8). Bacterial growth from these plates can be used for long-term storage (see Section 3 3 , step 1) The remainder of each single colony 1sused for small-scale plasmid preparattons (13) to check the presence and integrity of the plasmids m Agrobacterzum (see Note 9).

3.4. Agrobacterium-Mediated

Transformation

of Tobacco

We present a method for transformatton of tobacco, adapted from Horsch et al. (19), using Agrobacterzum to transfer the T-DNA segment to plant cells. Selectton of transformed cells IS achieved by the presence of a selectable marker on the T-DNA (e.g., resistance to Kan m this method) and mclusron of the selective agent in the regeneration media. The conditions for cocultivation, selection of transformed cells, and regeneratton of transformed plants will vary for other plant species and other binary vector combmattons. Transformation of monocotyledonous plants 1s generally achieved by particle bombardment techniques (20,21) and is not described here. This method applies to a binary vector carrying a Tet resistance gene for selection in Agrobacterium. All transfers and mampulattons should be carried out m a laminar flow hood under aseptic conditrons where possible. 1. Inoculate 100 mL of LB contammg 1 5 pg/mL Tet wtth freshly grown Agrobacterzum transconjugant cells from the LB/Rtf/Tet plate. Incubate the culture at 28“C for 24 h with shakmg 2. Transfer the culture to a sterile centrifuge bottle, and harvest the cells by centrifugation at 7500g for 5 mm (e g ,800O rpm for 5 mm m a Beckman JA14 rotor or equivalent) 3. To remove traces of antibtotics, resuspend the cells m 25 mL of MS broth, repellet the cells, and finally resuspend them m 10 mL of MS broth. 4. Transfer the suspension to a high-sided petri dish. Cut off sterile leaves of axemtally grown tobacco plants (see Note 2), and place m the bacterial suspension Cut the leaf into 8 to 10 mm squares. Leave the leaf pieces m the suspension for at least 5 mm, making sure the cut edges get wet

5. Dram the leaf pieces briefly on the side of the dash,and transfer them to MS1 plates (no antibiotics)

The pieces can be crowded together, but do not overlap


410

6 7 8

9. 10

11

12

them. Tape the sides of the plate, and leave m a culture room at 26-28X for 48 h cocultivation. After 2 d, place the leaf pieces in a jar of stertle water Swirl gently to rinse off excess Agrobacterzum. Repeat rinse m another jar of stertle water Transfer the leaf pieces to sterile filter paper, and blot briefly Transfer the leaf pieces to MS2 plates containing 500 pg/mL cefotaxime and 50 pg/mL Timentm to kill Agrobacterzum and 100 pg/mL Kan, rn high-sided Petri dishes Do not crowd the leaf pieces. Leave room for leaf expansion. Tape the sides of the plate and leave m culture room for 2 wk Transfer the leaf pieces to fresh MS2 plates contaming cefotaxtme, Timentm, and Kan every 2 wk until healthy shoots develop (see Note 10) When shoots have formed, remove them with a scalpel and transfer, without callus attached, to MS3 agar contaimng 100 pg/mL Kan m a deep Petri dish If the tissue is transformed, roots will form m 7-14 d (see Note 11) When roots have formed, trim the roots back to a few millimeters and transfer to MS3 agar contammg Kan in sterile, screw-capped Jars Plants will develop a mat of roots if transformed Once plants have extensive roots, they can be transplanted to soil m the greenhouse after washing away the agar. Keep the plants covered with plastic jars and shadecloth for several days, and acclimatize them slowly to the glasshouse environment over 2 wk

3.5. Small-Scale Analysis

Preparation

of RNA and DNA from Plants

of regenerated plants generally

follows the sequence.

a Proving the plants are transformed, b. Measuring expression levels of the transgene(s); and c. Analyzing plants for the desired phenotype.

The first can be accomplished by assaying for enzyme actlvltles encoded by the T-DNA (e.g., neomycin phosphotransferase [22] or GUS [2.?]) or detection of sequences m the T-DNA

by Southern blot hybrrdrzation

or PCR. Both

(1) and (2) can be achieved simultaneously by Northern blot hybrldizatlon or reverse transcription-PCR

(RT-PCR).

We descrrbe a small-scale,

raped method

for preparing total RNA and/or DNA from plant tissues that IS suitable for analysis by Northern

blot, RT-PCR,

or PCR techniques.

The method is suitable

for most dicot plants, but has also been adapted for monocots (see Note 12) 1. Remove 100-200 mg of leaf tissue, and place m a 1 5 mL microfuge tube. 2 Per 12 samples, mix 2 5 mL of phenol-EDTA with 1 25 mL of TE3D and 50 pL of P-mercaptoethanol 3. Add a small quantity of acid-washed sand and 300 pL of the phenol/TE3D/ mercaptoethanol mixture to each tube 4. Grind the plant tissue to an even slurry with a 7 mm glass rod, fitted m a mechanical grinder (see Note 3)

Expressmg Ribozymes in Plants

8.

9 10 11 12

13. 14 15

411

Add 250 uL of ammoruum acetate and 400 pL of chloroform.tsoamyl alcohol to each tube Cap the tubes tightly, and shake them vigorously for about a minute (seeNote 13) Mtcrofuge the tubes at 210,OOOg for 10 mm, preferably at 4’C to give a firm interface Transfer 300 & of upper, aqueous phase to a fresh tube, taking care not to remove any green organic phase For RNA isolation, add 900 pL of 3.6 A4 LiCl-EDTA solution, mtx by mverston, and keep at 4’C for at least 15 mm. Smaller RNAs may require longer precipitation times For DNA isolation, add 300 pL of tsopropanol, mtx by mverston, and keep at -20°C for at least 20 mm Mtcrofnge tubes at 210,OOOg for 10 mm, and decant the supernatant carefully Add 1 mL of cold 70% ethanol, centrifuge the tubes again for 2 mm, and decant the ethanol Allow the tubes to dram on a tissue. Resuspend the pellet m 100 pL of TE For DNA tsolation, add 1 uL of RNase A, and incubate the tubes at 37’C for 5 mm For RNA rsolatron, go directly to the next step. Add 100 pL of phenol chloroform*tsoamyl alcohol. Vortex the tube vtgorously for 10 s, cool tt on ice, and microfuge at 210,OOOg for 10 min. Remove the upper, aqueous phase, and precipitate the RNA or DNA by adding 10 pL of sodium acetate and 300 pL of ethanol. Invert the tubes to mix, and then cool at -20°C for at least 20 mm Repeat step 8, including the 70% ethanol wash. Dry the RNA or DNA pellet under vacuum, and resuspend the material m 40 pL of sterile water. Measure the concentratton of RNA or DNA by diluting 5 pL wrth 500 pL of water and measurmg the absorbance at 260 nm. Calculate the concentration of nucleic acid by assuming that a solution of RNA containing 40 pg/mL or DNA containing 50 pg/mL gives an&e of 1 0 (see Note 14).

3.6. Semiquantitative RT-PCR Method for Detecting Ribozyme Expression Levels Detection of ribozyme (see Notes 15 and 16).

expression 1s easily achieved by RT-PCR

methods

3.6.7. Reverse TranscrIptIon 1 Mix 1 ug of total RNA and 100 ng of a primer that is complementary to the 3’-region of the ribozyme RNA, i.e., 3’-primer (see Note 4) in a total volume of 5 pL. Do this m duplicate since one set of reactions will have the reverse transcriptase omitted. Also, set up a control tube with water instead of the RNA (negative control) Incubate the tubes at 65°C for 5 mm. 2 Transfer the tubes to a 37’C water bath, and allow them to equtlibrate 3 To one tube of each pan and to the negative control tube (see Note 17), add 5 pL of a mixture contaming 2X RT-PCR buffer, 2 mMeach dATP, dCTP, dGTP, and dTTP, 20 m&f DTT, 3 U of RNase inhibitor, and 40 U of reverse transcrtptase. For the second tube of each pair, add an identical mixture, except omit the reverse

412


transcrtptase. Immediately transfer each tube to a 42°C water bath, and incubate at this temperature for 40 mm 4. The mixture can be used directly m PCR reactions, e.g., as m Section 3 6 2

3.6.2. PCR Reaction 1. Mix 3.3 pL of each RT mixture with 10 pL of a mixture contammg 1X RT-PCR buffer, 100 ng each of the 5’- and 3’-primers, and 1 U of Tag DNA polymerase (see Note 18) A positive control reaction can be set up by adding 1 pg of plasmid containing the sequence to be amplified with all of the components for the RT and PCR Each mixture can be added directly mto microtiter format trays for the PCR machme or mto capillaries or tubes, depending on the PCR machme avarlable. For tubes, an overlay of oil should be used 2. Amplify the specific sequence, for example, using the followmg condtttons 95°C for 1 mm, 30 cycles of (95’C for 15 s, 50°C for 15 s, and 72°C for 30 s) (see Notes 5 and 19) 3 Analyze the products of the amplification by gel electrophoresis, lookmg for the DNA fragment corresponding to the desired sequence. The fragment should be absent in reactions where RT was omitted (see Note 20). The fragment should also be absent from the negative control (see Notes 17 and 2 1).

4. Notes 1. Many binary vectors carry a gene for resistance to Tet, and the method we describe uses this antibiotic as the selective agent for bacterta containing the vector. For binary vectors with other selective marker genes, substitute Tet with the appropriate antibiotic throughout the method 2 Tobacco leaf tissue used for the transformation should be from actively growing, tender, green plants. If lower leaves of the plant are yellowmg with age, transformation frequencies will be reduced. Routinely propagate axemc tobacco plants by tip subculture every 4 wk to mamtain healthy stocks for transformation. 3. An electric-powered grinder is recommended. A simple way to set one up is to clamp an electric drill to a retort stand, with power supplied through a variable voltage transformer to control the drill speed. A 7 mm glass rod, conically ground to tit the bottom of 1.5 mL microfuge tubes, is inserted mto the chuck We routinely process more than 100 plant samples/d in this way. 4 Both primers should be of DNA and be approx 20 nt long One (3’-primer) must be complementary m sequence to a region toward the 3’-end of the ribozyme RNA, whereas the other (S-primer) must be complementary to a region toward the 3’-end of the cDNA produced by reverse transcriptase, primed by the 3’-primer We prefer primers with roughly equal GC.AT ratios and one or two Gs or Cs at the 3’-end. 5 The Mg*’ concentratton m the RT step IS usually 4 mM, but can be increased to 10 &if desired. We use a series of RT-PCR buffers wtth varying Mg2’ concentrations, and adJust the Mg2+ concentrations m the RT and PCR steps as required for optimal amplification

Expressing Rlbozymes in Plants

413

6 The method we present uses Agrobacterzum and E colt cultures that are actively growing, I e , m exponential phase of growth This gives more reliable results m the triparental conjugation than using stationary-phase cultures. 7 The difference in colony numbers should be at least lOOO-fold. 8 To be sure the colornes contam only Agrobacterium, a duplicate plate can be streaked and incubated at 37°C This temperature does not allow growth ofdgrobacterzum, but does allow growth of contaminatmg E coli that are Rif-resistant 9 Plasmids m these preparations are best reintroduced into E colz, and analyzed by restriction digestion and gel electrophoresis to ensure that the desired DNA construct has been transferred to Agrobacterzum Small-scale plasmid preparations from Agrobacterzum often do not yield enough plasmtd to visuahze directly on agarose gels 10 If no small, prtmordial green shoots form within 3-4 wk, the transformation has failed This IS usually owing to loss of virulence of the Agrobacterzum culture and can be overcome by choosmg a second, independent transconjugant from the triparental conjugatton 11 Root growth in the presence of Kan is an excellent mdtcator of transformatton For tobacco, >60% of shoots will eventually form roots 12 The method is particularly suitable for leafy green plant species, but has been successfully adapted to rice and barley leaf tissue with addition of a freezmg step using liquid mtrogen prior to grinding with the phenol/TE3D/mercaptoethanol mixture 13. We find it easiest to process samples m batches of 10 or 12 If step 5 is performed much later than step 4, RNA yields may be reduced 14 This method usually yields more than 10 pg of total RNA or DNA from approx 100 mg of tobacco leaf This 1sadequate for Northern blotting or for PCR methods of analysis. 15 RT-PCR analysis is at least lOOO-fold more sensmve than Northern blot hybrtdizatton m detecting specific RNA expression, is more raptd to perform, and large numbers of samples can be handled more easily than for Northern blotting Moreover, RT-PCR can readily distmguish transgene RNA from a similar wild-type RNA, e.g , measuring expression of a tRNA rrbozyme m the presence of the correspondmg wild-type tRNA molecules. In this example, specificity is conferred by destgnmg one obgonucleottde primer (preferably the 3’-one) to be complementary to part or all of the nbozyme motif, with the second primer within the tRNA portion of the tRNA ribozyme 16 A degree of quantitatton of the RT-PCR can be achieved by using an m vitro transcribed RNA, of known concentration, as a standard m parallel RT-PCR reactions This RNA must be similar to the ribozyme RNA that is to be detected m transgemc plants, and IS added m known amounts (0.001-10 pg of specific transcript) to total RNA isolated from a nontransformed control plant. It is essential that the template DNA used m the in vitro transcrtption is thoroughly removed. We do this with three rounds of DNase treatment, each followed by LiCl precipitation of the RNA, each cycle of treatment removing approx 99 9% of the remammg DNA. The RNA must be tested for absence of DNA, as shown by a requirement for reverse transcrtptase to obtam the specific amplified frag-

414

17. 18 19.

20.

21

de Feyter and Gaudron ment. Quantttatton can be achieved m the RT-PCR reactions by mcludmg traces of a radloactrve nucleotrde trlphosphate m the PCR reactions and measuring incorporation mto the specific amplified fragment It is important to test a range of ampltficatron cycles m the PCR step (we usually test 15,20,25 and 30 cycles) to ensure the amplification IS still m the exponential, not linear, phase The negative control tube should always be last m the series since its purpose IS to detect nonspectfic amphficatton and/or contammation The PCR reaction can be scaled up to 40 Ccs,or more if reqmred It is usually worthwhile to optimize the PCR condtttons. We always test the sensitivity of the PCR detection, which can be done by usmg DNA containing the target sequence (e.g , plasmtd) as template. The PCR should be able to detect readily 1 pg of specific sequence and, ideally, 0.001 pg of spectfic sequence Factors to optimize for are Mg2+ concentration (2, 4, 6, 8, and 10 mM MgCl,), annealing temperature in the PCR (45, 50, 55, and 6O”C), and levels of ohgonucleotrde primers and Tuq DNA polymerase. If the fragment correspondmg to the target sequence 1spresent m both amphfications of a pan (+/- reverse transcrtptase), the problem may be the presence of traces of genomtc DNA in the RNA preparation. If the PCR reaction is extremely efficient, specific sequences m this DNA may be amphfied and detected. This can be overcome by DNase treatment of the RNA preparation, or more simply by reducing the number of amphfication cycles m the PCR One of the greatest problems with PCR detection is contammatton of materials or equipment with traces of DNA correspondmg to the sequence to be detected This shows up as the presence of the spectfic fragment m the negative control reactton. We avoid this problem by having a set of mtcroptpetors dedtcated to assembling PCR reactions and reactton buffers that are never used for manipulatton of completed PCR reactions or concentrated DNA soluttons The problem can also be minimized by reducing the number of amphficatlon cycles to the mmtmum needed.

References 1 Bruenmg, G. (1989) Comptlation of self-cleaving sequences from plant virus satellite RNAs and other sources Methods Enzymol 180, 546-558 2. Wegener, D., Stemecke, P , Herget, T , Petereit, I, Phtlipp, C., and Schreter, P (1994) Expression of a reporter gene is reduced by a rtbozyme m transgemc plants A401 Gen Genet 245,465470. 3. McIntyre, C. L., Bettenay, H. M., and Manners, J. M. (1996) Strategies for the suppression of peroxidase gene expression m tobacco. II. In vlvo suppression of peroxidase activity m transgemc tobacco using ribozyme and antisense constructs Transgentc Res 5,263-270 4. Bratty, J., Chartrand, P , Ferbeyre, G , and Cedergren, R. (1993) The hammerhead RNA domain, a model rtbozyme. Blochrm. Blophys. Acta 1216,345-359. 5 Stull, R. A. and Szoka, F. C. (1995) Antigene, rlbozyme and aptamer nucleic acid drugs: progress and prospects. Pharm Res 12,465-483

Expressmg Ribozymes m Plants

415

6. Stemecke, P., Herget, T., and Schreier, P. H. (1992) Expression of a chrmeric ribozyme gene results m endonucleolyttc cleavage of target messenger RNA and a concomttant reductton of gene expression rn vlvo EMBO J 11, 1525-l 530 7. Penman, R. J., Bruenmg, G. B , Dennis, E. S , and Peacock, W J (1995) Effective rtbozyme delivery to plant cells Proc Nat1 Acad Scz USA 92, 6175-6179. 8 Donson, J , Kearney, C M , Htlf, M E , and Dawson, W 0 (1991) Systemic expression of a bacterial gene by tobacco mosaic virus-based vectors. Proc Nat1 Acad Scz USA 88,72&I-7208. 9. Chapman, S., Kavanagh, T , and Baulcombe, D. (1992) Potato virus X as a vector for gene expression m plants. Plant J 2, 549-557 10 Klein, T M , Wolf, E D., Wu, R., and Sanford, J. C (1987) High-velocity mtcroprojecttles for dehvermg nucleic acids mto hvmg cells Nature 329,70-73 11 Lazo, G R., Stem, P. A , and Ludwig, R A. (1991) A DNA transformatton-competent Arabzdopszs genomic library in Agrobacterium Biotechnology 9,963-967. 12 Odell, J T., Nagy, F., and Chua, N.-H. (1985) Identification of DNA sequencesrequired for acttvtty of the cauliflower mosaic vnus 35s promoter. Nature 313,8 10-B 12 13 Sambrook, J., Fntsch, E F., and Mamatts, T. (1989) Molecular CZonwzg.A Laboratory Manual, 2nd ed Cold Spnng Harbor Laboratory Press, Cold Spring Harbor, NY. 14. An, G (1987) Binary Tt vectors for plant transformatton and promoter analysts Methods Enzymol 153,292-305. 15 Deblaere, R , Reynaerts, A, Hofie, H , Hemalsteens, J.-P, Leemans, J , and Van Montagu, M (1987) Vectors for cloning m plant cells. Methods Enzymol 153,277-292 16 McBride, K E. and Summerfelt, K R. (1990) Improved binary vectors for Agrobacterzum-mediated plant transformation Plant Mol Bzol 14,269-276 17. Gruber, M Y and Crosby, W L. (1993) Vectors for plant transformatton, m Methods zn Plant Molecular Bzology and Bzotechnology (Glick, B. R and Thompson, J. E., eds.), CRC, Boca Raton, FL., pp. 89-l 19 18. Lin, J -J. (1994) Optimtzation of the transformatton efficiency of Agrobacterzum tumefaczens cells using electroporation. Plant Scz 101, 11-15. 19. Horsch, R. B , Fry, J. E , Hoffmann, N L , Elchholtz, D , Rogers, S G., and Fraley, R T. (1985) A simple and general method of transferring genes mto plants Sczence 227, 1229-123 1 20 Chrtstou, P., Ford, T. L , and Kofron, M (1991) Productton of transgenic rice (Oryza satzva L.) plants from agronomically important Indica and Japonica vartettes via electric discharge particle acceleratton of exogenous DNA mto immature zygotic embryos Bzotechnology 9,957-962 21 Vastl, V., Castillo, A. M , Fromm, M. E , and Vasrl, I. K (1992) Herbicide reststant fertile transgenic wheat plants obtained by mrcroproJectile bombardment of regenerable embryogemc callus Bzotechnology 10,667-674. 22. McDonnell, R E., Clark, R. D., Smith, W A., and Hinchee, M. A (1987) A stmphfied method for the detection of neomycin phosphotransferase II acttvtty m transformed plant tissues Plant Mol Brol Reporter 5, 380-386.

23. Jefferson, R A. (1987) Assayingchlmeric genesin plants: the GUS gene fusion system Plant Mel BIOI Reporter 5,387-405

Using Microinjection of Xenopus Oocytes to Express and Optimize Ribozymes In Vivo Philip C. Turner 1, Introduction Although it appears to be relatively easy to design ribozymes that cleave their targets and produce detectable cleavage products in vitro, especially when both molecules are quite small, the detection of cleavage products m viva has been remarkably difficult It is generally assumed that the cleavage products are very unstable and experimenters have tended to look for overall decreases m target RNA levels or to examme the effects on protein levels or on biological activity (e.g., resistance to HIV replication). In some caseswhere an apparent ribozyme effect has been claimed, it is therefore possible that inhibition may be due to factors other than cleavage of the target by ribozyme The Xenopus oocyte has proved to be one of the best systems for studymg the effects of ribozymes m cells and there are a number of reports m the literature of the successful use of ribozymes m oocytes (1-3). In the majority of these, the authors have micromjected RNA transcripts of target and/or ribozyme. In our hands, the oocyte has also proved to be extremely useful for injecting DNAs that encode the rrbozyme and transcript RNAs. Following DNA injection, it is possible to detect transcripts of both ribozyme and target, to detect both 5’ and 3’ cleavage products when the ribozyme is active, and to examine various aspects of the ribozyme-target interaction within the nucleus and cytoplasm of the cell. This chapter describes protocols for using oocytes to express ribozymes and then targets in vivo and to detect and quantify cleavage products so that the efficiency of the ribozymes can be optimized. As m vitro cleavage is not a particularly good predictor of m vwo cleavage, the oocyte system provides a fairly rapid, m viva testing ground that could be used before more expensive cell culture studies. From


Bology, Vat 74 Ftfbozyme Protocols Humana Press Inc , Totowa, NJ

417

418

Turner

2. Materials 2.1. DNA Constructs 1. Clone contammg the target sequence. 2 Restriction enzymes and manufacturer’s buffers. 3. Agarose gel and runnmg buffer (e.g., 1% agarose in 1X TBE 10X TBE 890 mk! Tris-borate, pH 8.3, 20 mM EDTA). 4 Calf mtestmal phosphatase (CIP) 5 T4 DNA hgase and manufacturer’s buffer. 6 Competent bacteria 7 Selective agar plates (e g , LB-agar plates contaming 75 pg/mL amptctllm) 8 Ribozyme expresston vector 9 Ohgonucleotides. 5’-phosphorylated complementary ohgonucleottdes encodmg the desired ribozyme sequence and having overhanging ends enabling direct clonmg into the rtbozyme expression vector

2.2. Preparation,

Injection,

and Incubation

of Oocytes

1. Modified Barth X (MBX): 88 mMNaC1, 1 0 mMKCL2.4 r&NaHCOs, 0.82 mA4 MgSO, 7H20, 0 33 mM Ca(N0&*4Hz0, 0 41 mM CaCl, 6H20, 15 mM HEPES-NaOH, pH 7.6. Benzyl pemctllm and streptomycm sulfate can be added to 0 01 g/L to prevent bacterial growth 2. A small part of a Xenopus Zaevzs ovary maintained m MBX at 1820°C. 3 Cooled mcubator (18-2O’C) 4 Mtcromjection apparatus. Thts conststs of a low-power stereo mtcroscope, with a wide field of view (e.g., Leica, Wild M3Z, Milton Keynes, UK), a micromanipulator on which to mount and move the injection needle (e.g , Smger, MK4, Singer Instrument Co., Somerset, UK), and a mtcromjector (e g., Drummond Nanoject oocyte mlector, Broomall, PA [although the needle can stmply be attached to a syringe driven by a screw device to incrementally advance the plunger]) The needle tip dtmensions are crmcal for nuclear mlections and should be ~20 pm externally and sharp 5 Mtcroscope slides, small Petrt dishes for the mcubatton of batches of injected oocytes and cutoff and rounded Pasteur pipets for transferring oocytes from dish to dish 6 DNA solutions for injection (e g , mtxtures of target DNA construct and rtbozyme DNA construct at total concentrattons not exceedmg 0 4 mg/mL)

2.3. Processing 1 2 3 4

of injected Oocytes

Injected oocytes from Sectton 3 2 Low-power stereo microscope. 1 5 mL Mtcrofuge tubes and liquid nitrogen, tf freezing the oocytes Oocyte homogenizatton buffer: 1% SDS (w/v), 1.5 mA4 MgCl*, 10 n-J4 NaCl, 1 mg/mL proteinase K, 10 mM Trts-HCl, pH 7 6 5 4MNaCl

Microinjection of Xenopus Oocytes

419

6 Phenol saturated with either oocyte homogenization buffer or 10 mM Tris-HCl, pH75 7. Phenol-chloroform: prepared by mixing equal volumes of buffer saturated phenol and CHCl,. 8 Chloroform. 9. Ethanol for precipitation 10. Diethyl pyrocarbonate (DEPC) treated water: add DEPC to 0 1% and incubate for several hours at 37°C then autoclave for 15 min. 11 DNase I, RNase-free (e g., Boehringer Mannheim, Lewes, UK)

2.4. RNase Protection 1. 2. 3. 4 5 6. 7 8. 9. 10 11 12 13. 14 15 16. 17. 18 19 20.

Assay

Clone containing the target sequence Restriction enzymes and manufacturer’s buffers. Transcription vector (e g , pGEM3 or 4 from Promega, Madison, WI) Chloroform and ethanol for extraction and precipitation. DEPC-treated water. 10 mMDithiothreito1 (DTT). 10 mMNTPs minus UTP* a solution containing ATP, CTP, and GTP each at 10 mA4 10X Transcription buffer: 0 4 M Tris-HCl, pH 7.5, 60 mM MgCl*, 20 mM spermidme, 50 mMNaC1. 32P-UTP at 4-800 Cl/mm01 RNA polymerase (e g , SP6 or T7). Acrylamtde gel loading buffer: 10 mL of formamide, 200 pL of 0 5 M EDTA, pH 8 0, and 10 mg each of xylene cyan01 FF and bromophenol blue. 6% Acrylamide-7 M urea gel and running buffer (1X TBE) Plastic film (e.g., Saran Wrap) and X-ray film (e.g., Fuji RX. London, UK). Elution buffer: 0.2% SDS, 0.3 M sodium acetate Hybridization buffer. 40 mM PIPES, pH 6.4, 1 mA4 EDTA, 0.4 M NaCl, 80% deionized formamide RNase buffer: 300 mMNaC1, 10 mMTris-HCl, pH 7.4,5 mMEDTA, 0.4 pg/mL RNase T 1, 8 pg/mL RNase A 10% Sodium dodecyl sulfate (SDS) 10 mg/mL Protemase K 1 mg/mL tRNA carrier Phosphorimager.

3. Methods 3.1. DNA Constructs The type of DNA constructs required will depend on whether it is intended to microinject the oocytes with ribozyme and target RNAs directly, or inject with DNA that will be transcribed m oocytes to produce the ribozyme and target molecules. In the former case, in vitro transcription vectors are used,

such as pGEM, and RNA transcripts of both rlbozyme and target can be pro-

Turner duced using protocols described m Chapter 10. If this approach 1s taken, the experimenter can choose to label the transcripts during synthesis, which will eliminate the need to perform a detection assay such as Northern blotting or RNase protection (see Section 3.4.). Addltionally, it 1spossible to carry out m vitro assays of ribozyme efficiency (see Chapters 23 and 24) although the detection of in vitro cleavage is no guarantee that cleavage will occur in vivo. As protocols for the productlon of rlbozyme and target RNAs m vitro have been covered in other chapters, this contribution will focus on the production and use of DNA constructs for injection. 3.1.1. Target (Reporter) Constructs A wide variety of different genes and DNA constructs have been injected mto Xenopus oocytes with subsequent detection of transcripts. These range from sea

urchin histone genes to constructs containing mammalian viral promoters, and although some promoters have been shown to work inefficiently or maccurately, the general advice would be to try an existing construct first before transferring the target sequence to a vector that has previously been shown to work in Xenopus. If starting from scratch, choosing a vector that is known to work m Xenopus and/or mammalian cells makes sense.The reader should also consider whether to make a construct that produces primary transcripts with mtrons and whether or not they become polyadenylated, as these features are likely to mfluence the accessibility of the target RNA to cleavage by ribozymes. In our studies, we have used a vector (pAH4), based on a Xenopus H4 histone gene in which the coding region has been replaced by a multiple cloning site. The construct retains the hlstone promoter and transcription mltlatlon site and generates transcripts that are 3’ processed by the U7 snRNP system. We have used it, not only to produce full-length transcripts by cloning in complete cDNAs, but also to produce mRNA fragments to compare cleavage efficiencies of complete and partial mRNAs in vivo. On Northern blots of injected oocyte RNA, discrete sized products are detected correspondmg to the sizesof fragments cloned mto the multiple cloning site. The following protocol is based on using this vector but is basically the same for any target construct. 1 Examinethe target sequencefor sultablerestrlctlon sitesfor clonmg (seeNotes 1 and 2) 2. Digest the starting DNA (either genomlc clone, cDNA clone, or PCR product) with the chosen restrlctlon enzymes, using the manufacturer’s mstructlons. 3 Gel recover the desired restrlctlon fragments 4 Digest pAH4 with the same 2 restrxtlon enzymes or a compatible pair (see Notes 3 and 4). 5. Dephosphorylate the vector with calf intestinal phosphatase (CIP) and/or gel recover the linear vector.

Microqect~on

of Xenopus Oocytes

421

6 Ligate vector and target insert using a couple of different molar ratios of vectormsert (see Note 5). 7 Transform competent bacteria (e.g., E cob DHSa) and plate out on ampictllm plates 8 Confirm clonmg by colony PCR or restriction digestion and DNA sequencing 3.7.2.

Ribozyme Constructs

The selection of a particular in vivo expression system for ribozymes 1s affected by a number of considerattons, such as promoter strengths, transcript termination and stability, the desire to have additional sequences attached to the ribozyme sequence, and intracellular localization. tRNA based Pol III pro-

moters are efficient and have been used successfully for the production of ribozymes

m Xenopus

oocytes and other systems. Chapter 42 details their

design, advantages, and use. In general, the ribozyme 1s embedded within a partial or complete tRNA and would normally become mainly cytoplasmic, but by using tRNA constructs that do not allow the transcripts to become fully matured, nuclear localization can be achieved (see Chapter 42). Other efficiently transcribed Pol III genes such as adenovnus VA or human 7SL and 7SK should be easily developed to express rrbozymes, provided that thought is put mto mechanisms of ensurmg stability, such as 3’ stem-loop structures. Small Pol II transcription units such as snRNA genes have also been developed by us and others to express ribozymes. They are nearly as compact as Pol III genes and have the added advantage that ribozymes can be mserted into regions of the snRNA that are normally involved m base-pairing mteractions

m the various RNA processing events in the cell. By retammg protein binding sites from the snRNA sequences,the ribozyme can be protected and targeted to the nucleus. Ribozymes have also been expressed using other Pol II promoters (e.g., viral promoters) as polyadenylated transcripts, which presumably become cytoplasmrc, though here again the inclusion of a small unsphceable intron should cause retention m the nucleus, but may affect stability, if not intranuclear location.

Whichever expression systemis ultimately chosen, the construction of a ribozyme in viva expression construct is very similar to the protocol in Section 3.1.1. 1. Choose and examine the basic expression vector for restrictton sites that will enable the ribozyme to be Inserted m the correct orientation at the correct position 2 Digest with the chosen restrlctton enzymes, dephosphorylate with CIP, and/or gel purify 3. Synthesize 2 complementary ohgonucleotides encoding the desired ribozyme sequence and containing protrudmg ends compatible with the sites used to prepare the vector. If the vector is dephosphorylated, these ohgos will need to be phosphorylated at their 5’-ends by treatment with T4 polynucleotide kmase 4. Anneal the phosphorylated oligonucleotides by simply coolmg them slowly from 90°C to room temperature

Turner

422

5 Ligate vector and duplex oltgonucleottdes usmg a couple of different molar ratios of vectorinsert (see Note 5) 6 Transform competent bacterta (e.g., E toll DH5a) and plate out on amptcillm plates or change the anttbtotic selection tf necessary 7 Confirm clonmg by colony PCR or restrictton dtgestton and DNA sequencing.

3.2. Preparation, Injection, and hcubation of Oocytes Adult female Xenopus laevis m good condition can contain ovaries that make up one-third of the body weight. The ovaries are composed of lobes of connective tissue, to which are attached oocytes in various stages of development. It is normally the largest (Stage VI) oocytes that are used for microinjection; for further detatls on the maintenance, handling, and use of frogs, consult Colman (4). 1 Use watchmaker’s forceps to tear off small pieces of ovary, taking care to keep them submerged in a Petri dish of MBX. 2 Pluck indtvidual Stage VI oocytes off the connective tissue by holding the piece of ovary with forceps with one hand and pullmg an oocyte with forceps using the other hand. The action 1s hke pullmg a grape off the vme It is also possible to use a loop of stiff metal to pluck off the oocytes An alternattve method 1s to digest the pieces of ovary with collagenase to release the oocytes (see Note 6) 3 Transfer the individual Stage VI oocytes to a dish of fresh MBX and return them to the incubator (1 S’C) until needed (see Note 7) 4 Fill the microinJection needle with sample (see Note 8) As lO,OOOg for 15 mm to collect the nucleic acid pellet, dry, and dissolve in 100 pL of DEPC-treated water. 12. Add 1 & of DNase I (RNase free) and incubate at 37°C for 30 mm 13 Extract with 100 pL of CHCls and microfuge at 2 10,OOOgfor 5 min 14 Transfer the supematant to a new tube and precipitate the RNA with 250 pL of ethanol 15 Microfuge at 2 10,OOOgfor 15 mm to collect the pellet, dry, and dissolve at 4 pL/ oocyte m DEPC-treated water Keep on ice or frozen

3.4. RNase Protection

Assay

Having obtained RNA from the injected oocytes, rt 1snecessary to assay the

samples for the presence of intact target molecules as well as ribozyme cleavage products. The most direct approach would be to perform Northern

blots,

Turner but RNase protection is more sensitive and can be more informative about the precise point of cleavage. Other methods such as those based on PCR are described in Chapters 32-34. To perform an RNase protection assay, a probe needs to be prepared and hybridized to the RNA sample. After hybridization, the hybridized RNA sample is then dtgested with a mixture of RNase A and Tl to remove the unhybridized and smgle-stranded probe. The sample is then analyzed by PAGE

3.47. Preparation of Probe To produce a radloactrve single strand of RNA that is complementary to the target RNA, it is usually necessary to subclone a fragment of the target gene mto an in vitro transcription vector. An alternative IS to use PCR to amplify a region encompassing the cleavage site using a pan of primers, one of which introduces an RNA polymerase promoter sequence such that an antisense transcript can be made. As m vitro transcription using the latter approach seems to be less efficient, the former is descrtbed here. 1 Examine the target sequence for the presence of restrrctron sates upstream and downstream of the rlbozyme cleavage site 2 Choose a combmatron of restrlctton enzymes that produces a fragment of 150-250 bp contammg the rlbozyme cleavage site m the central third of the molecule The enzymes should be chosen, not only to allow easy purification of the desired fragment, but also to permit direct clomng mto an m vitro transcription vector such as pGEM (see Note 17) 3. Digest the clone containing the target sequence wrth restriction enzymes, using the manufacturer’s mstructrons, gel recover the fragment. 4. Digest the m vitro transcrtption vector with compatible enzymes. 5 Perform steps 5-8 of Section 3 1 1. to obtain the desired RNase protection construct. 6 Linearize 10 ug of the construct by using a restrrctlon enzyme that cuts the vector sequence such that m vitro transcriptton using one of the RNA polymerase promoters will yteld a single-stranded RNA probe that 1scomplementary to the sense strand of the target (see Note 18). 7. Purify the linear DNA by CHC13 extraction and ethanol precipitation. Dtssolve the pelleted DNA at 0.5 pg/pL For each labeling reactron, 1 pg IS sufficient 8. Assemble the following in vitro transcrrptron reaction at room temperature: DEPC-treated water (to 20 @,) 8cIL hnearlzed DNA (1 pg) 2PJ10 mA4DTT 2I.1L 10 mM NTPs (minus UTP) l/J1OX transcription buffer 2cLL RNase inhibitor 20 U (optional) 1FLL 32P-UTP (4-800 Wmmoie) 3uJRNA polymerase, 20 U (e.g., SP6 or T7) 1 pL

Micromjection of Xenopus Oocytes

425

9 Incubate at 37°C for 1 h 10 Stop the reactlon by adding 20 p.L of gel loading buffer, heat to 95°C for 3 mm, and purl@ the entire sample by PAGE, using a 6% acrylamide-7 Murea gel with a wide slot if necessary. 11 Cover the wet gel in plastic film and expose to X-ray film for 5 min 12. Mark the position of the probe band on a spare sheet of X-ray film and cut through the film to produce a rectangular window around the band as a guide Lay this on top of the wet gel lmmg up the film edges m the same way as the original exposure 13 Carefully excise the probe band and transfer the acrylamide slice to a mlcrofuge tube containing 500 pL of elution buffer Elute the probe for at least 2 h (see Note 19) 14 Transfer the supernatant to a new tube, extract with 500 & of CHCl,, and precipitate by adding 1 mL of ethanol. 15 Dissolve in 200 pL of DEPC-treated water or hybridization buffer (1 pL 1ssufficlent for the assay of each sample).

3.4.2. Hybridization and Assay Having produced radioactive probe, as well as RNA from microinjected oocytes, which has been DNase treated, the hybridization step of the RNase protection assay can be set up. Various controls should be carried out, for example using an equivalent amount of tRNA or RNA from unmjected oocytes. Also m the case of detectmg ribozyme activity in vlvo, it 1s useful to assay a sample of RNA obtained from oocytes that were injected separately with rlbozyme and target but were mixed at homogenization. This control shows that ribozyme cleavage products do not arise during extraction and assay. 1 For each sample to be assayed, preclpltate the RNA from 1 oocyte (4 pL) m a new mlcrofuge tube by adding 10 pL of ethanol. 2. Pellet the RNA by microfuging at 210,OOOg for 10 min. 3. Dry the pellet briefly (3 min under vacuum) and dissolve m 29 pL of hybridtzatlon buffer 4 To each dissolved sample, add 1 pL of probe from Section 3.4. l., step 15 (see Note 20) 5 Heat the samples to 90°C for 5 mm and transfer munedlately to a water bath or incubator at 45’C and incubate for 5 h or overnight if more convenient 6 Stop the hybridization by adding 300 @. of RNase buffer and incubating at 3O“C for 60 mm 7 Add 20 pL of 10% SDS and 10 & of 10 mg/mL protemase K and incubate at 37°C for 15 mm. 8 Add 10 p.L of 1 mg/mL tRNA as carrier and extract once with 400 pL of CHC& 9. Precipitate the supernatant by adding 1 mL of ethanol and chillmg the samples for 15 mm on dry ice 10 Pellet the RNA by mlcrofuging at 210,OOOg for 15 min, dram, dry for 3 mm under vacuum, and dissolve the pellets in 20 & of gel loading buffer.

426

Turner +

- M f-

probe (517)

5’ product(380)

3’ product (103)

-

uI1,

Fig. 1. In vivo cleavage by ribozymes. Oocytes were injected with DNA encoding part of /3-galactosidase and in lane (+) DNA encoding a ribozyme designed to cleave this transcript. In lane (-), no ribozyme DNA was coinjected, but an identical result would have been obtained if a mutated ribozyme had been coinjected or if RNA from oocytes separately injected with target and ribozyme DNA (but mixed at homogenization) had been analyzed. M is 44~~1 digested pBR322 marker. The 5’ and 3’ cleavage products, which are present only in lane (+), are marked. 11. Analyze half the sample by PAGE using a 6% polyacrylamide-7 A4 urea gel, heating the samples to 95’C for 3 min before loading. 12. After electrophoresis and drying the gel it can either be exposed to X-ray film for 1-7 d or to a phosphorimager screen for l-3 d, which permits better quantification of the data using procedures that are explained in the manufacturer’s manual. Figure 1 shows typical results. 4. Notes 1. If no suitable restriction sites are available, PCR can be used to create unique compatible sites at each end of the target sequence and after digestion, the gel purified PCR product can be cloned into the expression vector.

Microinjection of Xenopus Oocytes

427

2. It IS important to consider the direction of clonmg so that transcripts of the sense strand are produced (i.e., mRNA). 3. To ensure complete dIgestIon of the vector, use excess enzyme in optimal buffer condmons. Vector that has only been cut by one of a pair of enzymes will create a high background m the clonmg 4. Where 1 of the 2 enzymes chosen 1s known not to cut efficiently or to require very specific buffer conditrons, it is advisable to digest to completion with this enzyme first because gel analysis can mdicate how successful this digestion has been. The second enzyme can then be used m excess 5 Typically, 50-100 ng of vector 1s ligated to insert using molar ratios m the range 3.1 to 1.3 6 For collagenase treatment, break the ovary fragments into small bits, then mcubate for 2 h at room temperature (or until the follicle sheath 1sremoved) in 15 mL of OR buffer containing 2 mg/mL collagenase B (Boehrmger). 10X OR buffer 1s 0.825 MNaCl, 25 mM KCl, 10 m1!4 MgCl,, 50 mM HEPES, pH 7.4. Wash the oocytes 3X m MBX The oocytes are then ready to use (store at 18-20°C) 7. Incubating freshly stripped oocytes overnight before injection can allow time for unhealthy oocytes to become apparent before they are injected. 8 Typically we inject target DNA*ribozyme DNA at a ratio of 1: 10 or greater and not exceeding a total DNA concentration of 0.4 mg/mL Higher concentrations of DNA can cause transcription artefacts such as premature termination Higher concentrations of RNA samples can be injected but controls must be included to show that cleavage has not taken place m the mixture of ribozyme and target prior to, and during, mJectlon. 9. Instead of a screw-driven syringe or a commercial injector (e g , Drummond), some workers use an air pump with a forward and reverse switch 10. Some workers use nylon mesh to line up a batch of 10-20 oocytes in MBX m the correct orientation for nuclear Injection Other modifications mclude holdmg the needle fixed and moving the microscope platform to push the oocyte onto the needle. 11. For nuclear injections, it 1s possible to centrifuge the oocytes at very low speed until the nucleus (germinal vesicle) floats up to show a circular thmnmg of the pigment on the animal hemisphere of the partially flattened oocytes Centnfugation at 1OOg for 5 mm 1s about sufficient, but the exact conditions need determined empmcally. 12. Commercial injectors can be set to deliver specific volumes. Hand-pulled needles need to be calibrated. If the needle has reasonably parallel sides then a volume of 50 nL is roughly equivalent to about one-twentieth of the length of 1 pL of sample 13 To achieve optimal survival of nuclear InJected oocytes, it is important to control the followmg parameters a Needle size. If the needle tip 1stoo large, the oocyte cannot repair the damage and often the nucleus escapes through the hole b. Avoid letting the oocytes dry out If there 1sno seepage of sample from the needle, then it may be best to inject under MBX, which will help to keep the oocytes cool and wet If seepage IS a problem, then inject oocytes m a droplet of MBX, retum-

428

14

15

16

17 18

19

20

Turner mg each inJected oocyte to a dish of MBX as soon as possible Cooling the mtcroscope slide or inJection dish can help survival by reducing evaporation. The animal and vegetal hemispheres should be clearly black and yellowish/green, respectively, and a prgment-free equatorial band should be apparent. Oocytes that have been leakmg or have lost then normal pattern of pigmentation should be reJected. If the oocytes are to be fracttonated mto nucleus and cytoplasm, tt 1s probably best not to freeze them. The simplest method for fractionation is to boll a batch of oocytes in a fixed volume of MBX (e g., 200 pL) for a fixed time of l-3 min. It is necessary to establish the times using some spare oocytes After botlmg, the oocytes can be dissected using forceps The nucleus appears as a cloudy white sphere among the pale yolk around the center of the ammal hemisphere To extract protein, the oocytes can be lysed by homogemzatton (or raptdly pipetmg up and down) m 200 pL of TE (10 mM Trts-HCl, pH 7.5, 1 mMEDTA) contammg 1 mMphenylmethylsulfony1 fluonde (PMSF) as protease mhtbitor To remove pigment and yolk mtcrofuge at 10,OOOgfor 10 mm at 4’C and transfer the supernatant to a new tube avoidmg both pellet (pigment) and the floatmg yolk/fat layer If no suttable sites are present, PCR clomng can be used to subclone a spectfic fragment spanning the cleavage sate. Try to use a restrtction enzyme that generates a 5’ overhang or blunt end on cleavage If this cannot be avotded, the protruding 3’ end can be removed by treatment with T4 DNA polymerase or the Klenow fragment of DNA pol I m the presence of all 4 dNTPs (100 ClM) Some DNAs are transcribed well and routmely generate few prematurely terminated fragments. If the probe usually looks good, there IS no need to gel purify it. Elevated temperature and agitatton speed up elutton. Alternatively make up a mtx of probe and hybridizatton buffer and add 30 uL to each sample Dissolve well

Acknowledgments Thanks are due to Gary Evans, Helen James, Nick Watkins, and Nlgel Savery for then- contrtbuttons to work mvolvmg rrbozymes m my lab, and to BBSRC, NWCRF, The Wellcome Trust, and Gene Shears Pty Ltd. for funding.

References 1 Cotten, M and Bunsttel, M. L (1989) Ribozyme mediated destructton of RNA zn vwo. EMBO J. 8,3861-3866 2. Saxena, S. K. and Ackerman, E J (1990) Ribozymes correctly cleave a model substrate and endogenous RNA zn VEVO.J. Bzol Chem 265, 17,106-17,109. 3 Bouvet, P., Dimttrov, S., and Wolffe, A. P. (1994) Specific regulatton ofXenopus chromosomal5S rRNA gene transcrtption in vzvo by htstone Hl Genes Develop 8,1147-l 159 4. Colman, A (1984) Translation m Xenopus oocytes, m Transcrlptron and Translatzon A Practzcal Approach (Hames, B. D. and Higgins, S. J , eds ), IRL, Oxford, UK, pp 27 l-278

Exogenous Cellular Delivery of Ribozymes and Ribozyme Encoding Daniela Castanotto,

DNAs

Edouard Bertrand, and John Rossi

1. Introduction To examme the effects of a rrbozyme m VIVO,a major obstacle to overcome is the delivery of these molecules into the cells. A serious drawback of exogenous delivery is that the mhtbrtory effects of the nucleic acids so delivered are transient and require repeated administrations. Despite this, exogenously delivered molecules can incorporate chemical modifications, which Increase stability, although these modified bases and sugar-phosphate backbones can contribute to toxicity of the molecules. Further investigation is needed to establish whether the advantages of chemical modifications will overcome the general disadvantages of exogenous delivery. RNA synthesized m vitro by T7 RNA polymerase can also be exogenously delivered

An advantage of this approach is that the ribozyme

can be inserted

m larger transcripts containing structural features (stem loops), which confer stability.

A disadvantage

is that these extra sequences can negatively

affect the

catalytic activity of the rrbozyme (I). Many techniques have been developed to introduce functronal, naked, DNA, and some of these may also be applicable

to the delivery

of synthetic RNA,

1 DNA is complexed with various compounds (e g., polylysme) or to hpophilic groups (2-4), which increase cellular uptake. 2 DNA can be complexed with receptor hgands for specific targeting and locahzanon to defined types of cells (5). 3 Conlugates of DNA and hpophihc derivatives can have higher antiviral activity as shown in the case of HIV- 1 (4,6)

These procedures introduce nucleic acids mto the cytoplasm, but accessto the nucleus is remarkably poor, as a consequence of the degradation of the From

Methods Edlted

by

m Molecular

Stology,

P C Turner

Humana


Inc , Totowa,

Protocols NJ

430

Cas tano tto, Bertrand, and Rossi

nucleic acids m the cytoplasm or endocytotic vesicles, and because of the phystcal barrier of the nuclear membrane. Some delivery techniques address this issue by including non-htstone nuclear proteins (71, phage parttcles (a), or adenovnus protein in the nucleic acid-containmg complex (9). These proteins can mediate to some extent the migration of nucleic acids to the nucleus either by protectmg the DNA from degradation or by factlitatmg the transfer through the nuclear membrane. RNA molecules are extremely sensitive to degradation m the media and require protection from serum ribonucleases. To date, the most commonly utlhzed technique for dehvermg presyntheslzed RNA molecules mto cultured cells is via liposome encapsulatron. Exogenously synthesized ribozymes, whether chemically or biochemically synthesized, can be delivered to cells m culture via catiomc ltposomes. Ribozymes delivered m this manner can be used to scan a target to assessthe most vulnerable site and can also be used for therapeutic applicattons. Although tt IS possible to determine directly the accessibility of a parttcular sequence m vivo (10) or m cell extracts, it requires intensive labor. Thus, accessible regions of the target should be found empntcally by deslgnmg separate rtbozymes to target several potential sites and testing their relative effectiveness. This chapter summarizes protocols for in vitro transcription of ribozymes and subsequent m vitro cleavage reacttons, which can be used to select efficient ribozymes. A protocol for encapsulatton and delivery of nucleic acids follows. Fmally, promoter systems,viral vectors, and m vtvo rtbozyme cleavage assaysare dtscussed. 2. Materials 2.1. In Vitro Transcription 1 Template DNA

a lmearlzed plasmld containing rlbozyme or substrate sequences

downstreamof a T7 promoter, or syntheticDNA equrvalents 2 400 mA4Tns-HCl, 3. 100 mMMgC12. 4 100mMNaCl 5. lOOmA4DTT

6. 5 MNTP

pH 7.5.

solution: 5 nMof eachATP, CTP, GTP, UTP

7 T7 RNA polymerase 8 RNase-free DNase (e g , Boehrmger, Indianapolis,

IN)

2.2. In Vitro Ribozyme CIeawage Reactions 1. Rlbozyme. chemically

synthesized or m vitro transcribed as m Section 3.1

2 Substrate.chemically synthesizedor in vitro transcribedas m Section 3.1. 3 20 mMTris-HCl, 4 500 &KC1

pH 7 5

Exogenous Cellular Delivery

431

5. 100 mMMgC1,. 6 Gel loading buffer. formamide containing 0.1% xylene cyanol, 0.1% bromophenol blue, and 20 mM EDTA 7 7 MUrea, polyacrylamide gel and runnmg buffer (usually 1X TBE* 89 mM Trtsborate, pH 8 3, 2 mM EDTA)

2.3. Cationic Liposome 1. 2. 3. 4.

5 6 7 8 9 10. 11. 12. 13 14. 15 16. 17 18 19 20 2 I.

Encapsulation

of Ribozymes and Delivery

Vortex mixer COZ incubator. Laminar flow hood. Lrpofectm (Gibco/BRL [Grand Island, NY] or other cationic ltptd analog reagents) the reagent consists of 0.5 mg/mL DOTMA and 0.5 mg/mL DOPE m sterile water (see Note 1) Optt-MEM I (Gibco) medium Serum (dependent on cell lines) DMEM high glucose (Irvme, Santa Ana, CA). 1X PBS (Irvine). Fungi Bact (Irvine) Pen-Strep (Irvine) Fungtzone (Irvine) P-Mercaptoethanol. Sodium pyruvate (Irvine) Trypsm (1X) (Irvine). Sodium bicarbonate (7 5%) solution 200 mM L-glutamme Plasmtd DNA containing rtbozyme gene transcrtpttonal unit. RNA produced from m vitro transcription or chemically synthesized. Chemrcally synthesized rtbozyme Polystyrene tubes, sterile, 17 x 100 mm (FALCON, Franklin Lakes, NJ) 60 mm Culture dish (Costar, Cambridge, MA).

3. Methods 3.1. In Vitro Transcription RNA molecules may be enzymatically synthesized using RNA polymerases. T7, T3, and SP6 RNA polymerases are commonly employed. The DNA templates encoding the rtbozyme and substrateseither derive from linearized, plasmid DNA, or synthetic ohgonucleotides harboring the ribozyme (or substrate) sequence. In the case of plasmids, the DNA bearing the ribozyme encoding gene (or the substrate target for the m vitro assays) should be cloned m a transcriptional unit and inserted as close to the RNA polymerase promoter as possible. The plasmid should be lmeartzed immediately downstream of the rrbozyme (or substrate) sequence to mmimize the amount of vector-derived flanking sequences in the transcrtpts.

432

Castanotto, Bertrand, and ROSSI

1. In a 1 5 mL microcentrifuge tube mix: 50 nA4 template DNA; 40 mM Trts-HCl, pH 7.5; 6 mA4 MgCl,; 5 mA4NaC1, 10 mMDTT; 0.5-l mM each of ATP, CTP, GTP, UTP; and 1O-20 U of T7 RNA polymerase. 2 Incubate at 37°C for l-3 h. 3. Remove the template DNA by a brief treatment with 1 pL of RNase-free DNase (1 pg/pL), and purify by extraction and precipitation (see Notes 2-4).

3.2. In Vitro Ribozyme Cleavage Reactions 1 Heat to 90°C for 2 mm two separate tubes containing either the nbozyme or substrate C2P-labeled target) m a solution of 20 mMTns-HCl, pH 7 5, and O-140 mM KC1 (or NaCl) The volume of the reactions and the concentration of ribozyme and substrate can vary. A noncleavmg mutant version of the ribozyme should be used as a control 2 Renature the samples for 5 min at the temperature chosen for the cleavage reaction (37-55’C) m presence of 10 mM MgCl, 3 Mix different amounts of rrbozyme and target (depending on the purpose of the analysis, either eqmmolar, excess of ribozyme, or excess of target) at the desired temperature. Different time-points should be taken from O-3 h (see Note 5). 4 Stop the reactions by adding an equal volume of formamide gel loading buffer. 5. Denature the samples by heatmg to 90°C for 2 mm, and analyze the cleavage products on a 7 A4 urea, polyacrylamide gel Values for k,,jK,,, can be determmed by incubating a constant concentration of substrate (around 1 nM) with increasing excess of ribozyme for a constant time. The k,,,/K,,, value is denved using the equation -ln(Frac S) / t = k,,,/K,

* [rrbozyme]

(1)

where Frac S is the fraction of remammg substrate and t is time (11)

3.3. Cationic Liposome

Encapsulation

of Ribozymes and Delivery

Liposomes are comprised of one or more concentric phospholipid bilayers (whtch can mcorporate lipid-soluble substances) surrounding an aqueous compartment that can incorporate water-soluble substances.Size and lipid compo-

sltlon can vary, and different liposomes exhibit different characteristics as m vlvo delivery systems. l

l

Negatively charged lipids can increase the efficiency of cellular uptake; saturated lipids and the presence of cholesterol can increase hposome stability Liposomes can be covalently attached to antibody molecules, resultmg m specific binding to cellular antigens (12) and allowing specific targeting to different types of cells

Exogenous Cellular Delivery l

l

l

pH-sensitive hposomes, on exposure to the low-pH environment of the endosomes, fuse with the endosome membranes. Immunoliposomes (pH-sensitive liposomes conjugated to monoclonal antibodies) can be successfully targeted to cell-surface receptors m vitro and m vivo (13). The primary mechanism for cellular uptake of llposomes seems to be endocytoSIS(14) Once in the cytoplasm, the llposomes are degraded, and the nucleic acids contained inside are released.

1 Plate exponentially growing cells m tissue-culture dishes at 5 x lo5 cells/well, and grow overnight in a CO, Incubator at 37°C to 80% confluency 2. Dilute the presyntheslzed DNA or RNA molecules from Section 3. l., and the Llpofectm reagent (BRL) with Opti-MEM I (Gibco) medium. The amounts of nucleic acids and llposome suspension need to be optimized for each cell type 3. Mix the diluted reagent from the previous step, vortex gently, and incubate for 5-10 mm at room temperature (see Note 6). If RNA is used, you may perform this step on ice to avoid chemical and enzymatic degradation. 4. Wash the cells three times with serum-free medium. 5. Add the liposome complex, and incubate the cells at 37°C m a CO, incubator (5-10% CO,) for 3-6 h. In general, transfection efficiency increases with time, although after 8 h, toxic condltlons may develop 6. Add 3 mL of medium with 20% of serum (the serum 1s dependent on the cell type, fetal calf serum may be used). 7. Incubate the cells for 24-48 h at 37°C in a CO, incubator 8 Harvest the cells, and assay for gene actlvtty (see Section 3 6.).

3.4. Promoter Expression Systems for Endogenously Expressed Ribozymes Endogenous delivery involves the expression of an antisense RNA or a rlbozyme from a DNA template permanently maintained wlthm the cell. Examples of expression systems are given m Fig. 1, and have recently been reviewed elsewhere (15). The reader should consider the following: 1 Expression of these molecules can be dlrected by polymerase II (Pol II) or polymerase III (Pol III) promoters. Pol II promoters include those promoters of viral origin, the long-terminal repeat (LTR) promoter sequences of retrovnuses, or cellular promoters, such as the p-actm promoter. 2. Use of a strong promoter 1s often desirable, but high-level expression may be difficult to achieve. Tandem repeats of the antisense or rlbozyme genes, under the control of the same promoter, may help to alleviate this obstacle by increasing the effective concentration of each transcript Inducible, repressible, or tlssue-specltic promoters can be used to confer temporal, cell-type, and cell-specrfic expression, and may temper other problems, such as cellular toxlclty generated by high levels of expression within the cells.

3 Endogenousexpressionfrom a Pol II promoter, with the exceptionof a few specialized cases, such as the human Ul snRNA Pol II promoter, necessitates a

434

Castanotto, Bertrand, and Rossi A -m

S’UTR

?‘T TTR

AAAA(200 B

C

A BOX

B BOX

D

Fig. 1. Promoter systems for the intracellular expression of ribozymes. In (A)-(D), the top line depicts the gene encoding the ribozyme, and the transcript derived from that gene is illustrated beneath it. (A) depicts a typical RNA Pol II-type promoter for driving ribozyme transcripts. An important consideration in utilizing a Pol II system is that the ribozyme transcript will contain varying lengths of 5’- and 3’-appended sequences, including the poly (A) tract. (B) and (C) depict RNA Pol III promoter cassettes derived from a tRNA gene. The ribozyme replaces part of the pseudouracil stem loop and aminoacylacceptor stem (B), or is inserted into the anticodon loop (C). In both cases, intact A and B boxes are required for expression. A stretch of five uracils terminates transcription, and the transcript is not capped. (D) Shows a representation of the mammalian U6 small nuclear RNA (snRNA gene) promoter. This is a Pol III promoter, but unlike the tRNA gene, the promoter regulatory elements lie upstream of the mature coding sequence. The ribozyme construct is positioned immediately after the capping signal (a small stem loop structure). Transcription termination is signaled by a region of five uracils. DSE represents the distal sequence element, and PSE the proximal sequence element. polyadenylation signal, which allows addition of a poly (A) tail. This, along with the 5’-m7GpppG cap, common to Pol II transcripts, may prolong the intracellular half-life of the RNA molecules.

Exogenous Cellular Del/very 4. Expressing rtbozyme molecules under the control of Pol III promoters affords addtttonal advantages: Pol III-driven gene expression seems to occur at high levels in all ttssues and cell types The sizes of Pol III-transcribed genes are smaller, presenting more defined transcrtpts 5 Other expression strategies are posstble For instance, an snRNA transcrtptton unit that mcorporates portrons of the snRNA structural sequence and protein bmdmg sues could be used This can facilitate targeting to the nucleus. Another option 1s to Insert a ribozyme mto the acceptor arm or the anttcodon loop of a tRNA gene, which has resulted m higher levels of expresston and stabihty of the rtbozyme (16). However, this tRNA expresston system has been shown to alter posttranscrtpttonal processmg and cellular transport

3.5. Viral Vectors Although the ribozyme or antisense expression vector can be delivered with hposomes, integration of the foreign DNA mto the host genome does not occur with a high frequency. More promismg and efficient technologies employ viral vectors. Different viral vectors have the capacity to infect a variety of cell types with high efficiency. Several classesof vu-al vectors are being exploited for dehvery of genes m vtvo, including DNA (adenovnuses, herpesvirus, adeno-associated vu-us [AAV]) and RNA retroviruses. General concerns persist with the use of viral pathogens such as residual infectivity, toxicity, and rescue of mfectivity by recombination. Addittonally, each viral vector has its own set of advantages and disadvantages, which ultimately dictate its use in a specific application. To date, the most extensively utilized viral vectors have been retroviruses. This class of vnuses can infect a wide variety of cell types resulting m longterm persistence as a consequence of integration mto the host chromosome. However, the integration process requires cell rephcatton, thereby restricting retroviral use to actively divtdmg cells. Other potential concerns are low vector titers, lack of specific integration sites, the possibility of activating protooncogenes, and the potential for infectious helper virus rescue owing to recombmation. Nonetheless, retroviruses possessproperties for efficient and effective in viva delivery, and are currently the method of choice An important consideration m expressing rtbozymes from a retroviral vector is the posttionmg of the ribozyme transcription unit. In Fig. 2 A-D, several examples of ribozyme expression from a retrovn-al vector are illustrated. The most popular retrovtral backbones utilize the amphotropic retroviral vectors developed by Miller and Rossman (I 7) These have been engineered with convenient cloning sites m both the U3 regions of the LTRs and wtthm the remnants of viral genes. If clomng of ribozyme genes into retroviral vectors is the method of choice, it is strongly encouraged that several modes for rtbozyme

Cas tano tto, Bertrand, and Rossi

436

C

Neo

RZ

Neo

E

1 4

I-Ed

ITR

---+

Fig. 2. Examples of viral vector constructs for ribozyme delivery and expression. (A)--(D) depict different versions of retroviral vectors. In (A) and (C), the ribozyme (Rz) is expressedaspart of the retroviral LTR transcript. In (B), the ribozyme is driven by a Pol III promoter that is inserted asa double copy in the U3 region of the LTRs of the viral vector. In this construct, the direction of transcription is the sameas that of the viral LTR promoter. In (D), the Pol III-ribozyme construct is transcribed in the opposite direction to the viral LTR. In (E), expressionof a ribozyme from an AAV is depicted. The ITRs have weak promoter function, but are generally not useful for expressing insertedgenes.The ribozyme can be transcribed in either orientation using Pol II or Pol III transcriptional units. The arrows representthe direction and extent of transcription. Neomycin phosphotransferase(Neo) and retroviral packaging signals (w) are indicated.

be tested. Packaging cell lines for amphotropic retroviral vectors, such as the NIH 3T3-derived PA3 17 cell system, are available through the ATCC and individual investigators. It is beyond the scope of this protocol to go into packaging methodologies. Those interested in pursuing retroviral-mediated gene transfer should consult some of the original manuscripts, which clearly describe the methodologies used for packaging and transduction (I 7,181. transcription

Exogenous Cellular Del/very

437

Another promismg vector system for rtbozyme gene delivery ts AAV, which has been successfully used to transduce antisense RNA inhibitory to HIV infection (19). The AAVs are nonpathogenic, integrating viruses that require helper viruses for rephcation of then genome. The AAV vector can exist autonomously at high copy number withm a cell and can integrate mto the host chromosomes as well. An example of an AAV vector useful for ribozyme expression is presented m Fig. 2E. As is the case for retroviral vectors, both Pol II and Pol III promoters can be utilized for ribozyme expression m AAV vectors. Comfection with a helper virus, such as adenovuus, is required for productive mfection (19,20). Molecular clones of the AAV genome, such as that depicted in Fig. 2E, are infectious followmg transfection mto helper-vnusinfected cells (20). The packaged DNA is single-stranded, and only the 145base-long palmdromic repeats or Inverted terminal repeats (ITRs) are required for efficient packaging in the appropriate packaging cell line. In addition to the ribozyme transcriptional unit, it is useful to incorporate a selectable marker, such as the neomycin phosphotransferase gene. Those interested in using AAV as a vector for ribozyme delivery should consult the published protocols (19,20). 3.6. In Vivo Assays for Ribozyme Function For m vtvo analyses, standard techniques are performed at the levels of RNA (Northern blots, primer extension, PCR), and Western blots or direct protein assays.Assays based on virus titer, reduction of infectivity, and proviral DNA are good mdicators of viral inhibition. The RNA analyses should reveal a reduced amount of the targeted RNA and, m some cases,the presence of cleavage products. However, smce RNA analysis is not by itself conclusive evidence for ribozyme-mediated cleavage, a mutant, noncleaving ribozyme should always be used as control to establish that any effect seen in vivo is a result of a specific ribozyme activity. 4. Notes

1. Reagents functionally similar to the Lipofectm agent, such as Lipofect ACE (Gibco/BRL), Transfectase (Gibco/BRL), Lipofect-AMINE (Gibco/BRL), Transfectam RM (Promega,Madison, WI), andDOTAP (Boehringer-Mannheim Corp.), can all be used in this procedure. 2 To produce radiolabeled transcriptsuseonly 0 0l-O.5 mM nonradioactive UTP, and 10 $1 of [cx~~P]UTP (3000 Ci/mmol) Over 90% of the radioactivity can be incorporated into the transcripts. 3 The addition of spermidine increasesthe efficiency of the reaction This step should be performed at room temperatureto avoid DNA precipitation 4 In vitro transcription can yield RNA up to 50 timesthe amount of DNA template utilized in the reaction

Castmotto, Bertrand, and Row

438

5 For kinetic determmattons, you may incubate a constant concentration of substrate (around 10 nM) with increasing amounts of ribozyme (begmnmg wtth twofold molar excess of ribozyme) for a fixed time 6. Prepare this complex in a polystyrene tube, because tt can sttck to polypropylene.

Acknowledgment This work was supported by NIH grants AI 25959 and AI 29329.

References 1. Taylor, N and ROSSI, J J (1991) Ribozyme mediated cleavage of an HIV-l gag RNA The effects of non-targeted sequences and secondary structure on rtbozyme cleavage acttvny. Antlsense Res Dev 1, 173-186 2. Leonetti, J P , Degols, G., and Lebleu, B. (1990) Biological activity of ohgonucleottde-poly (L-lysme) comugates: Mechanism of cell uptake Bzoconjugate Chem 1, 149-153. 3 Boutorin, A S , Guskova, L. V , Inanova, E M , Kobetz, N D., Zarytova, V. F., Ryte, A S , Yurchenko, L. V., and Vlassov, V V (1989) Synthesis of alkylatmg ohgonucleotide dertvattves contammg cholesterol or phenazmmm residues at their 3’-termmus and then interaction with DNA within mammalian cells FEBS Lett 254, 12%132 4. Letsinger, R L , Zhang, G., Sun, D K , Ikeuchi,

T , and Sarm, P S. (1989) Cholesteryl-comugated oligonucleottdes: synthesis, properties, and activity as inhibitors of replication of human mnnunodeficiency virus in cell culture. Proc Nat1 Acad SCL USA g&6553-6556. 5. Wu, G Y , Wilson, J M., Shalaby, F , Grossman, M , Shafrttz, D A , and Wu, C. H (1991) Receptor mediated gene dehvery in vzvo .I Bzol Chem 266, 14,338-14,342 6 Abromova, T V , Blinov, V M , Vlassov, V. V , Gorn, V V , Zarytova, V F ,

7. 8.

9

10

Ivanova, E. M., Konevets, D A, Plyasunova, 0. A, Pokrovsky, A G., Sandahchtev, L. S , Svmarchuk, F P , Starostm, V P., and Chaplygma, S R (1991) Anti-HIV activity of antisense oltgonucleotides bearing hpophtltc and alkylatmg groups at the 5’ terminus Nucleotldes and Nucleosldes 10,4 19-422 Kaneda, Y , Kunimttsu, I., and Uchida, T. (1989) Increased expression of DNA co-introduced with nuclear protein m adult rat hver Science 243,375-378 Sugawa, H., Uchtda, T , Yoneda, Y , Ishmra, M , and Okada, Y (1985) Large macromolecules can be introduced mto cultured mammalian cells using erythrocyte membrane vesicles. Exp. Cell Res 159,4 10-d 18. Curiel, D T., Wagner, E., Cotten, M., Bunsttel, M L., Agarwal, S , Lt, C. M , Loechel, J., and Hu, P. C. (1992) High efficiency gene transfer mediated by adenovnus coupled to DNA-polylysine complexes Hum Gen Ther 3, 147-154 Bertrand, E., Fromont-Racine, M., Pictet, R., and Grange, T (1993) Visualization of the mteractton of a regulatory protein with RNA in vzvo Proc Nat1 Acad Scl USA 90,3496-3500

Exogenous Cellular Del/very

439

11 Freter, S M , Kterzek, R , Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Netlson, T , and Turner, D H (1986) Improved free-energy parameters for predtcttons of RNA duplex stability Proc Nat1 Acad. Scl USA 83,9373-9377. 12 Wright, S and Huang, L (1989) Anttbody directed hposomes as drug delivery vehicles Adv Drug Delzvery Rev 3, 343-390. 13 Ho, R. J. Y , Rouse, B T , and Huang, L (1987) Target-sensitive tmmunohposomes as an efficient drug carrier for antiviral acttvity. J. Biol Chem 262, 13,973-l 3,978. 14 Alvmg, C. R. (1988) Macrophages as targets of liposome-encapsulated antimicrobial agents. Adv Drug Delivery Rev 2, 107-128 15. Rosst, J J (1995) Controlled, targeted, intracellular expresston of rtbozymes: progress and problems Trends Bzotechnology 13,301-306 16. Cotten, M. and Birnstiel, M. L. (1989) Ribozyme mediated destructton of RNA zn vivo. EMBO J 12,3861-3866 17 Miller, A. D. and Rossman, G. J. (1989) Improved retrovnal vectors for gene transfer and expression Biotechniques 7,980-990 18 Miller, A. D. and Buttimore, C. (1986) Redesign of retrovirus packaging cell lines to avoid recombination leading to helper w-us production MoZ Cell Blol 6,289s2902. 19. Chatterjee, S., Johnson, P R , and Wong, K K , Jr (1992) Dual target inhibttton of HIV-l zn vzvo by means of an adeno-associated virus anttsense vector Sczence 258, 1485-1488. 20. ChatterJee, S and Wong, K. K., Jr. (1993) Adeno-associated viral vectors for the delivery of antisense RNA Methods. A Companion to Methods Enzymol 5,5 l-59

Optimization of Lipid-Mediated Ribozyme Delivery to Cells in Culture Suzy A. Brown and Thale C. Jarvis 1. Introduction Ribozymes have consrderable potential as agents to modify gene expression. Strategies have recently been reported for modifying synthetic hammerhead rrbozymes to render them nuclease-resistant while retaining catalytic actrvrty (I). Modified rtbozymes therefore offer promise as therapeutics. An important component m obtaining efficacy of a ribozyme on its intracellular target 1sthe ability to introduce the ribozyme mto the cell efficiently and reproducibly. Although cells in culture will take up free oligonucleotide via endocytosis (2), the process is inefficient and usually does not result m an efficacious dose being delivered. Thus, many methods have been described for enhancing this process. Cationic lipid-mediated delivery of plasmid DNA mto a cell was first described by Felgner et al. (3). In the last several years, cationic hpids have been used extensively to enhance cellular uptake of DNA and RNA. Cattonic lipids can interact with the negatively charged phosphate groups on DNA or RNA to form a lip&DNA (RNA) complex. When incubated with cells, these complexes are believed to fuse with the cell membrane (4) or more likely undergo endocytosis (5). Different cell types require significantly different transfection condttrons to yield optimal uptake of ribozyme Therefore, it is necessary to experiment with a variety of parameters to determine the optimal set of condmons for each cellular system. Since assays that measure the efficacy of a ribozyme on its intracellular target can be labor-intenstve, it is advantageous to use a prescreen to identify and eliminate transfectron condmons that result m high toxicity and/or low uptake of ribozyme. Here we describe such a screen using cationic From

Methods Edlted by


Biology, Humana

441

Vol 74 Rfbozyme Protocols Press Inc , Totowa, NJ

442

Brown and Jarvis

lipid-mediated delivery of ribozyme to cells. This method focuses on suspension cells, but we have Included notes for adaptmg the protocol to adherent cells. Factors that affect lipid-mediated ribozyme uptake by a given cell type include: 1 Type of cattonic hptd and its formulation* In general, tt 1sdestrable to test dtfferent cattomc lipids to determme the best dehvery vehicle for a particular cell type Although a variety of catiomc lipids have recently become commercially available, for the sake of simplrcity, this method will focus only on LipofectAMINETM (Life Technologres, Grand Island, NY) LipofectAMINE is a polycattomc lipid 2,3-dloleyoxy-N-[2(spermlnecarboxamldo)ethyl]-~,N-dlmethyl1-propanammmm trifluoroacetate (DOSPA) complexed with a neutral phosphohpid dioleoylphosphatidylethanolamme (DOPE) 2. Charge ratio of hptd to ribozyme An important factor to optimize IS the net charge of the resulting lipid-ribozyme complex. We have found that effcactous delivery generally requires a net positive charge on the complex Neutral complexes tend to aggregate, and negatively charged complexes result m poor uptake For instance, a calculated 2 1 charge ratio of lipid to ribozyme occurs when there are two postttve charges on the lipid complex for every negative charge on the ribozyme molecule. Thus, a 2.1 charge ratio complex IS expected to have a net positive charge. 3. Culture medmm used during the uptake period. Generally, higher uptake of hptd-

ribozyme complex is achieved in serum-freemedium, although serum-contammg medium can also be used especially if the cells are sensitive to the potential toxic effects of the lipid The use of serum-reduced medmm formulations, such as Opti-MEM (Life Technologies) may be advantageous for some cell types To mmimize cell toxicity, tt is recommended that antibtottcs be omitted from the transfection medium 4 Duration of the uptake period: The optimal transfectton time will need to be determined for each cell type Typically, cells are exposed to lip&RNA complexes for 2-24 h prior to washout

Using a 96-well format, 4X LipofectAMINE solutions are prepared and complexed with an equal volume of 4X ribozyme solution, yieldmg 2X lipidribozyme complexes. A range of LipofectAMINE and ribozyme concentrations are tested that result in a matrix of different 1ipid:ribozyme charge ratios After allowing the complexes to form, they are added to an equal volume of ahquoted cell suspension, which results in the desired 1X concentration of the complex with the cells. Followmg an incubation period of varying lengths, the cells are washed and analyzed for uptake of the lipid-ribozyme complex as well as for cytotoxic effects. Carboxyfluorescemated ribozyme (CF ribozyme) is used in this method, thereby allowmg analysis of ribozyme uptake by fluorescence-activated flow cytometry and fluorescence microscopy. Flow cytometry will determme the percentage of cells having cell-associated CF

Lipid-Media ted Ribozyme Delivery

443

ribozyme and measure relative amounts of fluorescent rtbozyme associatedwith the cells. Fluorescence mrcroscopy will distinguish between cell-surface-associated vs mtracellular lipid--CF rrbozyme complex, and can provide mformatton on intracellular localization of the CF ribozyme. Cytotoxicity can be measured by proptdmm Iodide uptake during flow cytometry or fluorescent microscopy. Long-term cytotoxtctty can be measured using commercrally available cytotoxrcrty or proliferatton assays, such as CellTiter 96TM from Promega (Madison, WI) whtch IS not described in this method. 2. Materials 2.1. Equipment 1. 2 3 4. 5.

Flow cytometer. Fluorescent microscope with 40X ObJeCtlVe and appropriate fluorescence filters Microplate adapters for centrifuge rotor. Multtchannel ptpet Microplate shaker (e.g. Lab-Line Instruments, Melrose Park, IL).

2.2. Solutions 1 2. 3. 4 5. 6. 7. 8.

9. 10. 11 12. 13 14 15 16 17 18

and Reagents

5-Carboxyfluorescem succmimidyl ester (Molecular Probes, Eugene, OR, # C-22 10). Basic Blue 24. 1 mg/mL in HZ0 (Sigma, St Louis, MO). Ethanol. 0.1 MNaHCOs, pH 8.3 5 MNaCl Tissue-culture-grade HZ0 (e.g , Srgma, St. LOUIS, MO) Synthetic hammerhead ribozyme (6). Synthetic hammerhead ribozyme containing an ammo modifier C6 dT (Glen Research, Sterling, VA, #lo-1039) in loop II. This modified amtdtte replaces the second A of the GAAA tetra loop sequence. 5-50 mL Sterile polystyrene tubes (e.g., Falcon Labware, Lincoln Park, NJ). Sterile polypropylene mtcrotubes m 96-well format (e g , Bto-Rad, Hercules, CA) Antibiotrc-free transfection medium, such as serum-free growth medium, OptiMEM (Life Technologtes), or serum-containmg growth medmm Sterile U-bottom polystyrene 96-well microplate (e g , Falcon Labware) Sterile V-bottom polystyrene 96-well microplate (e.g , Nunc, Napervtlle, IL) Flat-bottom 96-well tissue-culture mtcroplate (e.g., Costar, Cambridge, MA) LtpofectAMINE (#I 8324-012). store at 4’C under argon. Growth medium (appropriate for cell type). Proptdium iodide. 500 ug/mL (Boehrmger Mannheim, Indianapolls, IN). Store at 4°C m the dark Hank’s balanced salt solution (HBSS) phenol-red-free (Bto-Whittaker, Walkersville, MO), 1 0% BSA, 0 2% Na-aztde: filter through a 0.2 pm membrane to remove particulates and store at 4°C.

444

Brown and Jarvis

3. Methods 3.7. Carboxyfluorescein

Labeling

of Ribozyme

1 Add 20 pL of 100 mM 5-carboxyfluorescem succmtmtdyl ester m DMF to 400 pL of 200 @4 synthetic hammerhead rtbozyme containing an ammo modifier C6 dT m 0.1 MNaHCO,, pH 8 3 (25: 1 molar excess of carboxyfluorescem to ribozyme) Incubate at room temperature m the dark for 2 h 2 Precipitate the rtbozyme by addmg 40 pL of 5 MNaCl and 1 mL of cold ethanol Incubate at -20°C for 30 mm. Microfuge at 2 10,OOOgfor 10 min at 4°C. Remove the supernatant, and an-dry the pellet for 15 mm 3 Resuspend the pellet in 400 pL of 0 1 MNaHCO,, pH 8.3, and repeat the ethanol prectpttation of the ribozyme unttl all the free carboxyfluorescem has been removed (1 e., until the supernatant IS clear and not yellow). 4 Resuspend the final pellet in tissue-culture-grade H,O to the desired concentration (approx 100 l.uW) Store the stock solutton at -2O’C m the dark. 5 To verify efficient labeling of the rtbozyme, run an ahquot on a denaturing polyacrylamide-7 Murea gel Stain the gel with basic blue 24 (mcubate the gel for 1 h at room temperature with shaking, and destain m H,O for 2 h). Observe under UV light and compare fluorescent rtbozyme band to basic blue 24-stained band(s). Unlabeled ribozyme will migrate slightly faster than carboxyfluorescemlabeled ribozyme Greater than 90% of the total rtbozyme should be labeled wtth carboxyfluorescem.

3.2. Preparation of Lipid-Ribozyme Complex LipofectAMINE consistsof a 1:3 w/w complex of DOSPA:DOPE. The stock is 2 mg/mL total lipid or 1 mM DOSPA. For the sake of simplicity when the protocol refers to a concentration of LipofectAMINE, this will represent the actual DOSPA

concentration

(e.g., 1 mM LipofectAMINE

represents 1 mM

DOSPA). A range of LtpofectAMINE concentrations and 1ipid:ribozyme charge ratios should be tested. A typical range would be 2-15 pJ4 final concentration of LipofectAMINE (2-3 p.U increments) combined with ribozyme concentrations that result in 1ipid:ribozyme complexes having a net posttive charge (e.g., posmve:negative charge ratios of 2: 1,4* 1, and 8.1) (see Note 1) If eight LipofectAMINE concentrations are tested with four dtfferent hp~dribozyme charge ratios, this would result in a matrix of 32 dtfferent conditrons. Additionally, one can test different transfection media and uptake duratton in the same experiment, thereby allowmg many conditions to be tested in one experiment. 1 In sterile polystyrene tubes, prepare the desired range of 4X LtpofectAMINE concentrations in prewarmed transfection medmm (see Note I). Vortex well. 2 Ahquot 100 pL of 4X LipofectAMINE to the wells of a U-bottom polystyrene 96-well mtcroplate

Lipid-Mediated

Ribozyme Del/very

445

3 Prepare 4X CF ribozyme m prewarmed transfection medium m polypropylene mtcrotubes (96-well format) Include proper controls (see Note 2) 4 Using a multichannel pipet, transfer 100 & of 4X ribozyme to correspondmg wells of a U-bottom polystyrene 96-well plate containing 100 pL of 4X LipofectAMINE (step 2) This yields a 2X LipofectAMINE-ribozyme complex 5 Vortex complexes for 30 s on a microplate shaker (see Note 3). 6. Incubate the plate for 20 mm m a humidified 37’C, CO, incubator. During the mcubation period, proceed to Section 3 3. 7. Remove the complexes from the Incubator when the cells are ready, and vortex once prior to adding to cells as described m Section 3.3.

3.3. Transfection

of Cells With Lipid-Ribozyme

Complex

Wash suspension cells twice in prewarmed (37’C) transfectton medium (see Note 4 for adherent cells) Resuspend the cells at 2-4 million cells/ml m transfection medium Aliquot 100 pL of cell suspension into the wells of a flat-bottom 96-well tissue-culture plate Add 100 pL of 2X LipofectAMINE-ribozyme complex from Section 3 2 , step 7 Vortex on a microplate shaker for 10 s. Incubate for 2-24 h in a humrdified 37°C CO2 incubator. Transfer cell suspension to a V-bottom 96-well plate (see Note 5). Centrifuge at 18Og for 5 min. Wash the cell pellets twtce in growth medium, and resuspend m 200 pL of growth medium. Transfer 50 pL of cell suspensions to a flat-bottom microplate for analysts by fluorescence microscopy (see Sectton 3.5.) Centrifuge the remammg 150 pL of cell suspensions from step 4, remove the supernatants, and resuspend the cell pellets in 200 pL of HBSS, 1.0% BSA, and 0.2% Na-azide for flow cytometric analysis (see Section 3.4.)

3.4. Assessment

of Uptake by Flow Cytometric

Analysis

1 Transfer cell suspensions from Section 3 3., step 6, to microtubes (or tubes appropriate for flow cytometric analysts) containing 400 pL of HBSS, 1.O% BSA, and 0 2% Na-azide 2. Set fluorescent detectors on the flow cytometer using approprtate controls (see Note 2) 3 Just prior to analysis, add proptdmm iodide to the samples to a final concentration of 1.O pg/mL and analyze (see Note 6) Figure 1 shows an example of several different LipofectAMINE transfectton condittons for murme B cells Condition D yields a higher percentage of transfected cells and with lower cytotoxtcity than condttion C or B Figure 2 shows a comparison of transfection of two different cell types. A srgnificant fraction of the lymphocytes are refractory to transfectton, and the transfected population shows great heterogeneity in the amount of ribozyme uptake In contrast, the fibroblasts behave as a homogeneous population wtth virtually 100% transfection.

446

Brown and Jarvis

-] D

1

: .;.‘:.‘.:.

Fig. 1. Dot plots of flow cytometric analysis of murine B lymphocytes. Cells were treated for 4 h in serum-free medium with 3 different LipofectAMINE-CF ribozyme concentrations, which correspond to a 4: 1 charge ratio of lipid to ribozyme. The X-axis (FLl) represents CF ribozyme fluorescence. The Y-axis (FL2) represents propidium iodide fluorescence. Events (dots) in the lower left quadrant represent live cells with background fluorescence. Dead cells are represented in the upper left quadrant, and dead cells having CF ribozyme associated with them are in the upper right quadrant. Live cells, which are positive for fluorescein (have CF ribozyme associated with them) are represented in the lower right quadrant. (A) Untreated cells (background fluorescence). (B) 7.2 pA4 LipofectAMINE + 200 nM CF ribozyme: 42% of the cells are dead, 16% of the cells are positive for fluorescein, and 42% of the cells are not transfected. (C) 3.6 fl LipofectAMINE + 100 nA4 CF-ribozyme: 2 1% of the cells are dead, 28% of the cells are positive for fluorescein, and 5 1% of the cells are not transfected. (D) 1.8 ~.IJVLipofectAMINE + 50 niV CF ribozyme: 10% of the cells are dead, 41% of the cells are positive for fluorescein, and 49% of the cells are not transfected.

3.5. Assessment

of Uptake by Fluorescence

Microscopy

1. From Section 3.3., step 5, return the cells to the incubator, and allow to settle for 30 min. 2. Observe the cells using a 40X objective and the appropriate fluorescent filter directly in the flat-bottom 96-well microplate.

Lipid-Mediated

Ribozyme Delivery

B LYMPHOCYTES

447

Fibroblasts

Fig. 2. Histogram profiles of flow cytometric analysis of murine B-lymphocytes and HS27 fibroblasts. The histograms depict live cells only. The open profiles represent untreated cells (background fluorescence), and the shaded profiles represent cells treated with LipofectAMINE-CF ribozyme complex. (A) Murine B-lymphocytes (suspension cells) were incubated with 3.6 @4 LipofectAMINE + 100 ti CF ribozyme in serum-free medium for 4 h; 37% of the cells show CF-ribozyme association. (B) HS27 fibroblasts (adherent cells) were incubated with 5.6 p/V LipofectAMINE + 200 nA4 CF ribozyme in serum-free medium for 2.5 h; 100% of the cells show CF ribozyme association. 3. Propidium iodide can be added to the wells to a final concentration of 1 pg/mL to discriminate between live and dead cells (see Notes 6 and 7). 4. Notes I. DOSPA has 4 positive charges/molecule. Hence, the concentration of positive charges in the LipofectAMINE stock solution is 4 mM. Sample calculation: suppose the ribozyme contains 36 negative charges/molecule. To achieve a predicted 8: 1 charge ratio of (+) lipid charges to (-) phosphates for a 200 nM solution of ribozyme, one would need 14.4 pJ4 DOSPA. In this method, complexing is performed using a 4X concentration of lipid and of ribozyme. Therefore, 57.6 $4 LipofectAMINE (DOSPA) would be mixed with 800 nA4 ribozyme to achieve this charge ratio. 2. Suggested controls to include are: a. No LipofectAMINE and no ribozyme; b. LipofectAMINE + nonfluorescent ribozyme; and c. No LipofectAMINE + CF ribozyme. Controls 1 and 2 will be used to set fluorescence detectors on the flow cytometer. Control 1 is used to set the background fluorescence for fluorescein and propidium iodide. Control 2 with the addition of 1 pg/mL propidium iodide is used to compensate electronically for the overlap of the propidium iodide fluorescence signal (FL2) into the fluorescein fluorescence signal (FLl). To compensate electronically for the overlap of the fluorescein fluorescence signal into the

448

3 4

5.

6.

7

Brown and Jarvis proptdmm iodide fluorescence stgnal, use one of the test samples that 1s predicted to have a reasonable level of fluorescent fluorescence and to whtch propidmm iodide has not been added Control 3 will yield information on potential nonlipid-mediated CF ribozyme uptake When mtxmg the plate on the microplate shaker, make sure the liquid m the wells is vortexing Start on a low setting, and increase the speed such that the liquid mixes, but does not splash. This method can be adapted for adherent cells lO,OOO-20,000 cells are plated mto a 96well flat-bottom ttssue-culture plate 1 d prior to the transfection expertment. Transfection and washes are carried out m the same flat-bottom 96-well mtcrottter plate. For flow cytometrtc analysts, cells are trypsinized, transferred to a V-bottom 96-well plate, and washed prior to analysis For fluorescent mtcroscopy, cells are washed in the 96-well flat-bottom plate, propidium iodide is added, and the cells are then visualized. After the cells are mcubated with LipofectAMINE ribozyme complex, some cell types may adhere lightly to the bottom of the well This situatton may require trituratton when transferring out of the flat-bottom microplate to the V-bottom microplate to ensure good cell recovery After transfer, tt IS advised that the flatbottom microplate be Inspected under the microscope to verify that all cells have been recovered. During flow cytometric analysis, live cells may appear slightly positive for propidium iodide This may be attributable to propidtum iodide entering the cell vta ltptd-mediated uptake or proptdtum iodide assoctatmg wtth LtpofectAMINE rtbozyme complexes on the cell surface Dead cells will be more highly postttve for propidmm iodide (approx lo-fold higher), which should allow for dtscriminatton of live vs dead cells If needed, the percentage of dead cells can be determmed by an alternative method, such as trypan blue exclusion. Fluorescence microscopy 1s recommended as a way to determme whether the LipofectAMINE CF ribozyme complex IS mtracellular or merely cell-surfaceassociated. When a htghly positive fluorescein signal is observed by flow cytometric analysis (1 e., off scale), this may indicate that the cells have a high level of cell-surface-associated as opposed to mtracellular CF rtbozyme.

References 1 Beigelman, L , McSwiggen, J A , Draper, K. G , Gonzalez, C., Jensen, K , Karpeisky, A. M , Modak, A S., Matuhc-Adamtc, J., Dn-enzo, A B , Haeberh, P , Sweedler, D , Tracz, D., Grnnm, S , Wmcott, F E , Thackray, V G., and Usman, N. (1995) Chemical modification of hammerhead ribozymes. J Bzol Chew. 270, 25,702-25,708. 2 Akhtar, S. and Juhano, R L (1992) Cellular uptake and intracellular fate of antisense ohgonucleottdes. Trends Cell Blol. 2, 139-144 3. Felgner, P L., Gadek, T R., Helm, M , Roman, R , Chan, H. W , Wenz, M , Northrop, J. P , Ringold, G M., and Damelsen, M. (1987) Transfectton: a highly

Llpid-Mediated

Ribozyme Delivery

449

efficient, lipid-mediated DNA-transfection procedure. Proc. Natl. Acad Scz. USA 84,7414-7417 4. Felgner, P L. and Rmgold, G. M. (1989) Cattonic liposome-mediated transfectton Nature 337,387,388 5 Jaaskelamen, I., Monkkonen, J , and Urtit, A. (1994) Oligonucleotide-catiomc liposome interactions. A physicochemical study. Blochim Bzophys Acta 1195, 115-123. 6 Wmcott, F., DiRenzo, A., Shaffer, C., Grimm, S , Danuta, T., Workman, C , Sweedler, D , Gonzalez, C., Scaringe, S., and Usman, N (1995) Synthesis, deprotection, analysis and purification of RNA and ribozymes. Nuclezc Aczds Res 23,2677-2684

47 Retroviral Delivery and Anti-HIV Testing of Hammerhead Laurence

Ribozymes

Cagnon and John Rossi

1. Introduction Successful ribozyme-mediated gene therapy for HIV infection has to take mto account several factors: 1 The therapeutic gene must interfere with or shut down the expression of essential viral genes. 2. This requires a vector system for gene delivery and expression m HIV-sensitive cells. 3. To bypass the high genetic variabihty of the HIV-l replication process, the target sequence should be chosen in highly conserved sequences of HIV- 1. These fortunately are mostly present in the essential regulatory genes (tat, rev) or sequences (PBS, U5), which are required to produce infectious viral particles (1).

Previous experiments in human T-cell lines (2) have demonstrated the efficiency of hammerhead ribozymes targeted to HIV to interfere with viral production. The modification of human cells sensitive to HIV infection, i.e., T4 cells, by a therapeutic gene, such as a ribozyme, would provide intracellular immunity, which could lead to a decreased spreading of the virus. 1.1. Choice of Vector for Delivery of Ribozymes For lasting results, the viral target cells have to express constitutively the anti-HIV ribozyme. Viral vectors, such as retroviral (RV) or adeno associated virus (AAV) vectors, lead to a permanent modlficatlon of the transduced cells by mtegrating into the host genome. The RV vectors, based on the Moloney Murine Leukemia Virus (MoMLV), are the most commonly used vectors for stable gene transfer. However, the use of AAV vectors seems safer than From

Methods Ed&d

by

m Molecular

Biology,

P C Turner

Humana

451


Inc , Totowa,

Protocols NJ

452

Cagnon and ROSSI

retrovnal vectors for human gene therapy; indeed, integration of retroviruses occurs randomly m the host genome, with a possible activation of oncogenes. Moreover, the integration of RVs occurs only m dividing cells, whereas the AAV vector infects nondividmg cells and shows a limited repertoire of mtegration sites (S. Chatterjee, personal commumcation). Wild-type AAV has never shown pathogenesis in humans (despite infecting over 90% of the population). These AAV vectors have a broad host range, which is also an advantage when compared to the RV vectors. Although AAV is at a very early stage m terms of development as a viral vector system for gene delivery, an AAV vector expressing an antisense gene has been shown to inhibit HIV-l m an m vitro system (3). 1.2. Choice

of Viral Gene

Targets

for Anti-HIV

Therapy

Ribozyme gene therapy for AIDS requires the choice of a conserved HIV mRNA sequence carrying an NUH sequence where the catalytic domain of the ribozyme will cleave the target sequence (N is any nucleotide, U is uridine, and H may be A, U, or C (4). Cleavage of the HIV-l RNA by ribozymes would be expected to prevent their translation or the reverse transcription of the genome, as well as to stimulate degradation of the RNAs. In contrast to an antisense strategy, the ribozyme target sequence can be anywhere m the transcribed sequence. Translation will be stopped by the cleavage, whereas antisense DNA

or RNA cannot stop translation once it has begun, and antisense RNAs can be dissociated from their target by the translation complex. Hybridization of the ribozyme to its target requires a minimum side of the central catalytic domain (5).

of six base-pairing

arms on either

Details on the selection of target sites m viral RNAs can be found m Chapter 4. Once the vector and target have been chosen and the DNA constructs made (see Notes l-3), testing their efficiency stably transfected human cells.

can be conducted rn either transient or

2. Materials 1 Retrovnus vectors, carrying the rlbozyme genes. 2 Cell lines. the PA3 17 amphotroplc cell line (6) is used as a packaging cell lme to produce the defective recombinant retrovlruses The human embryonal kidney 293 cell line (ATCC: CRL 1573) is used for transient inhibitory assay or for producing HIV- 1-infectious particles from a cloned HIV- 1 strain. The CEM cell line (ATCC. CCL 119) is used for the propagation of HIV. 3. Dulbecco’s Modified Eagle’s Medium (DMEM), with high glucose concentration supplemented with 10% fetal calf serum (FCS) is used for growing the PA 3 17 amphotroplc packaging cells and the 293 embryonal kidney cells 4 Human T-lymphocytes of the CEM cell line are maintained in RPM1 with 10% FCS

453

Retroviral Delivery and Anti-HIV Testing

5 Phosphate-buffered saline (PBS): 1% NaCl, 0.025% KCl, 0.14% Na,HPO, (anhydrous), 0 37% KH,PO, (all w/v), pH 7 2. Autoclave to sterilize 6 Versene-trypsm: 0.05% trypsm, 0.54 mA4 EDTA in PBS, filter-sterilized usmg a 0 22 pm filter 7 2X BBS (transfectton buffer). 2X BES-buffered saline, pH 6.95 (exact pH adjustment 1s required) composed of 50 mA4 NJ-bls (2-hydroxyethyl)-2aminoethanesulfomc acid (BES) (Calblochem, San Diego, CA), 280 mM NaCl, 1.5 mM Na,HP04, with pH adjusted to 6.95 using 1 N NaOH. Filter-sterilize using a 0.22 pm filter Store in aliquots at -2O’C. 8 100X polybrene: 800 pg/mL dissolved m PBS and filter-sterilized using a 0 22 pm filter 9 2 5 M CaCl, filter-sterilized using a 0 22 pm filter. 10. Geneticin (G418) stock solution: 100 mg/mL dissolved in 10 WHEPES, pH 7.9, filter-sterilized using a 0.22 pm filter 11 HIV-l p24 antigen-specific ELISA kit (e g , Coulter Corporation, Hialeah, FL). 12 pBRU2 is a plasmld carrying the proviral infectious DNA of the HIV-1BRU strain (7) and is used for the production of infectious HIV- 1.

3. Methods 3.1. Transient

Inhibition

Assay

For transient HIV-l inhibition assays, plasmids carrying the rlbozyme gene or the HIV-l proviral DNA are cotransfected into 293 cells m the ratio of 10/l using calcium phosphate precipitation (8). Medium 1s removed 16 h after transfection, and the cells are rmsed three times with PBS. The cultures are then maintained in 5 mL of medium. Amounts of viral core antigen (~24) m supernatants are determined, 24-48 h after the transfectlon, by usmg a commercially available HIV-l p24 antlgen-specific ELISA kit. 1. Trypsmize exponentially growmg 293 cells using versene-trypsin, and plate at approx 60% confluency in a six-well cluster (lo5 cells/well) 1 d prior to transfection. 2 Before transfectlon, remove the old medmm, and replace with 5 mL of fresh medium. Allow the new medium to equilibrate for 1 h in the incubator 3 Mix 5-10 pg of the chosen plasmid DNA (or plasmid combinations) with

0.25 mL of 0.25 M CaCI, Add 0.25 mL of 2X BBS, and incubate the mixture for 10-20 mm at room temperature (see Note 4).

4. Mix the precipitate gently to ensure adequate suspenston, add the calcium phosphate-DNA preclpltate (0.5 mL) to the culture dropwise, and swirl the plates gently to distribute evenly 5. Incubate the cells for 24-48 h, taking samples of supernatant at different times

for p24 evaluation by ELISA following Section 3 5.)

the manufacturer’s

instructlons

(see

454

Cagnon and Rossi

3.2. Inhibition Assay in Cells Stably Transfected by the Anti-HIV-l Ribozymes 3.2.1. Choice of Cells to Transduce Hemoporetic stem cells are a good chorce because 1. These cells express CD34 antrgen, which allows then selection from patient blood 2. They can be modified and then reinlected into the blood circulation of the patient to recolonize the bone marrow. 3 They give rise to the different cell types infected by HIV, which will increase the level of protection.

Prior to transductron of CD34+ cells, CEM cell lines are used for evaluating the rrbozyme efficacy in vivo. 3.2.2. Transduction of Cells with Recombinant RV Vectors These vectors, based on the MoMLV, are the most commonly used vectors for stable gene transfer. The RV systems consist of two elements, a defective vector and a packaging cell line. The defective retroviral backbone consists of two long terminal repeats (LTRs) and the sequences necessary for packaging viral RNA, known as the psi region (Y); much of the structural coding sequence can be deleted, and is often replaced by a selectable marker gene, such as Neo. The transgene could be inserted m several different locations m the retroviral backbone. An msertron mto the U3 region of the 3’LTR will result in a duplication of the transgene on viral replication. The packagmg cell line codes for the functronal gag, pol, and env proteins to transcomplement the defective provnuses and produce packaged vectors The transfection of the vector construct mto the packaging cell lme allows the productton of defective recombinant retrovuuses carrying the therapeutic gene, but these vectors are unable to replicate. Cocultivation of the packagmg line and the vector with the target cells, or direct infection from viral stocks can be used to transduce the targeted hemopoietrc cells. With cocultivatron, the highest transduction frequencies (up to 100%) can be achieved. Each method is described m turn. T-lymphocytes are transduced by cocultivatron with high-titer PA3 17 packaging cell clones. 1. Irradiate the PA3 17 vector-producing cells (4500 rad), and plate at a density of 2 x lo6 cells/100 mm dish m RPMI, 10% FCS 2. On the next day, add 1 x lo6 T-Lymphocyte cells to each plate, and supplement the medium with polybrene to a final concentratton of 8 pg/mL

Retroviral Delivery and Anti- HIV Testing

455

3 Coculttvate the T-lymphocytes and PA3 17 cells for 60 h 4 Collect the nonadherent T-cells, andculture m RPMI, 10%FCSwith 0.5-l mg/mL

G4 18until resistantcell pools are obtained,usually 2-3 wk later. For direct infection with retroviral stocks, usually undiluted virus stocks are used, but when necessary, the vnus concentration can be diluted or increased by concentration (lo- to loo-fold maximally). The method of infection with the viral stock is stmilar to the method described m Section 3.4.2. for mfectmg CEM cells by HIV-l. 1 Collect 5 x 1O6T-cells from an exponentially growing culture 2. Resuspend the cells m 2 mL of RPM1 5% FCS containing the desired amount of RV stock and 8 pg/mL of polybrene 3. Allow the infection to proceed for 90-120 min at 37°C Shake pertodtcally to

resuspendthe cells 4 Add 10 mL of sterthzed PBS. Centrifuge for 10 mm at 12OOg, remove the vtruscontaining supematant, add 10mL of fresh medium, and split in culture plates. 5 Collect the T-cells, and culture rn RPM1 and 10% FCS with 0.5-l mg/mL G418 until resistant cell pools are obtained, usually 2-3 wk later

3.3. Expression of Ribozymes in Transduced Cells Total cellular RNA is extracted from vector transduced T-cells and analyzed for the expression of ribozymes by Northern blotting. 1 Extract total cellular RNA from the transduced T-cells, for example, using the acid-phenol guamdmmm thtocyanate method (9). 2 Subject 20 pg of total cellular RNA to electrophoresis in a 1% agarose gel contaming 5 4% formaldehyde 3 Transfer to nylon membranes

4. Probe the blots with labeled rrbozymegenes. 3.4. Infection

of T-Ceils With HIV-1 and Analysis

3.4.1. HIV- 1 Infectious Virus Preparation 1 To obtain HIV-l mfecttous vnus, transfect 293 cells (5 x lo6 cells m 5 mL of medium) with 10 pg of pBRU2 (Same protocol as m Section 3 1 ) 2 Collect the culture supernatant contammg the HIV- 1 cell-free vnus moculum 48 h after transfection. 3. Filter through a 0.8 pm pore size filter, and propagate by acute infection of CEM cells for 3 wk prior to mfectton of other cells 4 Collect viral stocks from the supernatant of CEM-producing cells by clarifying the culture supernatant by centnfirgation at 7000g for 30 mm and filtering through a 0.8 pm pore size filter 5 Titrate by p24 evaluation and store at -80°C

456

Cagnon and ROSSI

3.4.2. infection of CEM Cells with HIV-1 CEM cells are infected with HIV- 1 by direct infection from the viral stocks. 1. Collect 5 x lo6 CEM cells from an exponentially growing culture 2 Resuspend the cells m 2 mL of RPMI, 5% FCS containing the desired amount of HIV-l stock, and 8 pg/mL of polybrene. 3 Allow the mfection to proceed for 90-120 mm at 37°C Shake periodically to resuspend the cells 4 Add 10 mL of sterilized PBS Centrifuge for 10 mm at 12OOg, remove the vnuscontaining supernatant, add 10 mL of fresh medium, and spht m culture plates 5 Various times after mfection, the supematant is taken and checked for p24 viral antigen concentration. Usually, the production of p24 1s detectable 3 d after the infection, but it could take as long as 1 wk, especially if low titers of HIV- 1 virus have been used

3.5. P24 Viral Evaluation Determination of HIV- 1 p24 antigen is performed by a specific ELISA krt Several kits from different manufacturers are now available, and since the manufacturers’ protocol details vary, only a general description follows based on the Coulter Corporatton kit that we have used. The technique uses 96-well microplates coated with anti-HIV-1 p24 antibody. Supernatants from cell cultures are added to the wells with Triton X-100 (usually used at a final concentration of 0.5%), which mactivates the virus. An incubatton of 30 mm at 37°C allows the binding of p24 from the supernatant to the coated anti-p24 antibodies. Several washes m PBS are performed. Next, a detector antibody is incubated for 30 mm at 37°C. PBS washes follow. This detector antibody is linked to biotin, which allows detection by streptavtdm-horseradish peroxtdase (HRP). A standard curve dilutton is performed with a calibrated p24 sample (provided in the kit), usually ranging from 12.5-200 pg/mL. The colored reaction obtained m the presence of the HRP substrate, i.e., orthophenylenedtamine-HCl (OPD), is evaluated in a mtcrotiter plate reader at 490 nm with a reference filter at 620 nm. 4. Notes 1. Although numerous investigators have demonstrated ribozyme efficacy against HIV, it is important to include a crippled ribozyme and vector alone control m mittal testing of rtbozyme constructs. 2 It is also important to consider what type of promoter will be used and what the sequence context of the rtbozyme will be. Both Pol II and Pol III promoters have been successfully employed for ribozyme expression and HIV challenges The sequence context will m part be determined by the promoters.

Retroviral Delivery and Anti-HIV Testing

457

3. An RNA folding program analysts of the ribozyme transcript 1suseful m predtcting whether or not the rrbozyme will base pan with the target m the context of the RNA within which it IS transcribed (IO). 4 To compare different condittons, transfect the same amounts of DNA, usmg a carrier plasmtd tf necessary.

Acknowledgment This work was supported by NIH grants AI 25959 and AI 29329.

References 1. Levy, J A. (1993) Pathogenesls of human tmmunodefictency virus infection Mlcrobiol Rev 57, 183-289. 2. Zhou, C., Bahner, I C., Larson, G. P., Zata, J. A, Rosst, J. J , and Kohn, E B (1994) Inhibitton of HIV- 1 m human T-lymphocytes by retrovirally transduced anti-tat and rev hammerhead ribozymes Gene 149,33-39. 3 Chatterjee, S., Johnson, P. R., and Wong K. K., Jr. (1992) Dual-target mhtbitton of HIV-I zn vitro by means of an adeno-associated vnus antrsense vector Science 258, 1485-1488. 4. Ruffner, D. E., Stormo, G. D., and Uhlenbeck, 0. C. (1990) Sequence requtrements of the hammerhead RNA self-cleavage reaction. Biochemwry 29, 10,695-10,702 5 Bertrand, E. L and Rossl, J J. (1994) Facilitation of hammerhead rtbozyme catalysis by the nucleocapsid protein of HIV-l and the heterologous nuclear rtboprotem A 1. EMBO J 13,2904-29 12. 6 Miller, A D and Buttimore, C (1986) Redesign of retrovirus packaging cell lmes to avoid recombination leading to helper vuus productton. Mol Cell. Bzol 6, 2895-2902 7. Wain-Hobson, S., Somgo, P., Danos, O., Cole, S., and Ahzon, M. (1985) Nucleotide sequence of the AIDS virus, LAV Cell 40,~17 8. Chen, C. and Okayama, H. (1987) High efficiency transformatton of mammalian cells by plasmtd DNA Mol Cell Blol 7,2745-2752. 9. Chomczynski, P. and Saccht, N. (1987) Single-step method of RNA isolatton by acid guamdmmm thiocyanate-phenol-chloroform extraction. Anal. Bzochem 162, 955-963, 10. Zuker, M. and Stieger, P. (1981) Optimal computer folding of large RNA sequences using thermodynamtcs and auxiliary mformatron Nuclerc Aczds Res 9, 133-148

Hairpin Ribozyme Gene Therapy for AIDS Elizabeth A. Duarte, Mark C. Leavitt, Osamu Yamada, and Mang Yu 1. Introduction

Acquired mumme deficiency syndrome (AIDS) is a deadly disease that 1s the pathological consequence of infection with human immunodeficlency VKLIS (HIV). The virus is spread via body fluids, and infection results m progressive immune dysfunction, most notably a loss of CD4+ cells, leading to a myriad of opportumstlc mfectlons and maladies. In spite of public education efforts that were expected to control the epidemic, the vu-us continues to spread, emphasizing that a means to battle the disease IS mandatory. Despite extensive efforts by researchers around the world, an effective vaccine or chemotherapy drug has not been developed for preventing this deadly disease, nor 1sone expected in the foreseeable future This failure of conventional methods mdlcates that more novel approaches need to be explored. HIV-l, like other retroviruses, reverse transcribes its genomlc RNA mto DNA, which integrates permanently into the host’s chromosomes where it behaves as a resident cellular gene (I). Consldermg this life cycle, HIV-l infection may be considered an acquired genetic disease, and hence, a genetic therapeutic approach may efficiently combat the virus.

7.7. Gene Therapy for the Treatment of HIV-7 Infection Gene therapy 1sa relatively young, but promising means to prevent a variety of ailments, including cancer, genetic diseases,and those caused by infectious agents (2). Initially, gene therapy alms to correct genetic disorders by mtroducmg a gene into the cells of an mdlvldual to perform the functions of either a defective or mlssmg gene For infectious diseases, treatment would entail delivering a therapeutic gene; in particular, gene therapy for HIV-I aims to discover genes that would inhibit HIV- 1 rephcatlon, and introduce and express From


Bology, Vol 74 Rfbozyme Protocols Humana Press Inc , Totowa, NJ

459

460

Duarte et al. 9 Loop

U U G Loop

4

UAUAUUA C

GUGG I II CACA Helix

4

3

Yf;f; A GACC %AAG

Helix

Cleavage

3G Au u A yypp” 3

site Loop

5

J *GU

c

A m A HOIIXz A G Loop

-3’

,@pJgE

-5’ Helix

Substrate Rlbozyme

RNA RNA

1

1

LOOP 3

Fig. 1. Diagram of a hairpin ribozyme. This ribozyme was designed (as an example) to target the HIV- 1 sequence 5’-UUGGA*GUCAGGAACUA-3’. The underlined nucleotides m the ribozyme must be customized, or changed, for each sequence targeted The AAA sequence m loop 2 of the ribozyme must be changed to UGC to generate a disabled ribozyme (this is a necessary control to demonstrate that any mhibmon m HIV- 1 replication is not owing solely to the anttsense property of the ribozyme) these genes in the appropriate

cells of the patient (3-5). Although

this chapter

describes the design and testing of hanpin rrbozymes for the treatment of HIV- 1, these methods should be applicable

toward the treatment

of other RNA-medi-

ated diseases if the nucleotide sequences are known, including those of both cellular (i.e., oncogene) and viral origin. Ribozyme gene therapy for treating AIDS and other diseasesoffers the major advantage of being permanent with potentially no side effects. In contrast, chemotherapy drug treatments usually require continual administratron, often have serious side effects, and can lead to the generation of resistant mutants within a short time. Strategies for gene therapy to treat AIDS include the use of ribozymes, decoy RNAs, antisense RNA, and production of therapeutic proteins (soluble CD4, antibodies, and HIV-l antigens) and transdominant modification of HIV- 1 proteins (5). Ribozymes are small catalytic RNA molecules, the most studied types bemg the hairpin and hammerhead. This chapter focuses on hairpin ribozyme gene therapy for HIV mfection. Hairpin-based ribozymes cleave substrates at maxi-

mum rates at lower Mg2+ concentrations than hammerhead ribozymes, thus, hairpin ribozymes may be more effective mtracellularly because optimal cleavage occurs at near physiological conditions. Hair-pm ribozymes are 50-60 nt catalytic RNAs that are derived from the minus strand of tobacco rmgspot vnus satellite

RNA,

and named as such because the binding

of the catalyttc

and

substrate RNA creates a hairpin two-dimensional structure having four hehcal domains

and five loop structures as shown in Fig. 1 (6). Two of these helmes

result from the specific binding of the substrate and ribozyme. As shown m Fig. 1, the N*GUC sequence (the * represents the cleavage site) is located between these substrate recognmon sequences. Hairpin ribozymes can be

Hairpin Ribozyme Therapy for AIDS

461

designed to cleave a given RNA sequence m a highly specific manner (6-S). The sequence necessary for ribozyme cleavage is 5’-NNNBN*GUCNNN NNNNN .......-3’. The ribozyme base pairs with the two regions flanking the N*GUC sequence in the target RNA molecule. The N can be any nucleotide, whereas B can be U, C, or G, but not A. Recently, it has been shown that naturally occurring ribozyme backbones can be improved to give better cleavage, Yu et al. (9) reported that a hairpin ribozyme that was modified to contain a structure-stabilizing tetraloop had a cleavage efficiency unprecedented for hairpin ribozymes. In the past several years, we have been quite successful in using ribozymes to inhibit HIV-l replication in vitro and in tissue culture. Especially, freshly isolated human peripheral blood lymphocytes (PBLs) from multiple donors were transduced with a murine retroviral vector expressing a ribozyme against the U5 leader sequence. These cells showed up to a 1OO-fold reduction in vuus production when challenged by HIV- 1viral clones and clinical isolates as compared to control-vector transduced cells, which remained fully sensitive (10). Furthermore, CD34+ cells from fetal cord blood were transduced with retroviral vectors containing a ribozyme. The transduced cells then differentiated into macrophage-like cells m vitro, and after challenge with a macrophage tropic HIV-l strain, they resisted infection (9). In addition, these treatments had no effect on the viability or growth kinetics of the ribozyme-expressing cells. These findings demonstrate that PBLs and stem/progenitor cells are feasible target cells for gene therapy for the treatment of HIV-l infections. There are numerous reasons for the ability of these ribozymes to inhibit HIV- I replication. Unlike antisense molecules, ribozymes are catalytic, and can cleave and inactivate multiple copies of their substrates. Ribozymes also have the unique ability to inhibit three stages of the viral life cycle: incoming genomic RNA, viral mRNAs for all structural and accessory genes, and progeny genomic RNA (21). For example, expression of a hanpin nbozyme in transduced T-cell lines reduced proviral DNA synthesis by about 50-fold (12). Ribozymes are also expected to have little or no toxicity because their high specificity should minimize the nonspecific inhibition of host genes, and since they are composed of RNA, they are expected to have little or no immunogenicety. This contrasts with other forms of therapies that utilize proteins that may generate a vigorous immune response (see Chapter 49). In addition, multiple ribozyme targets exist in the HIV-l genome so that multitarget ribozyme vectors can be designed that should increase the overall effectiveness of the therapy. Multiple-target therapy using rrbozymes against the most conserved regions m the HIV- 1 genome should mmimize the generation of escape mutants. Another advantage of multitarget ribozymes can result from exploitation of their kinetic parameters. For example, apol ribozyme has

462

Duarte et al.

a high substrate affinity, but a low cleavage rate, whereas the leader sequence rlbozyme requires higher substrate concentration, but has a faster cleavage rate (I 3). Thus, the former could act as a “house cleaner” after the number of viral targets decreases followmg the activity of the leader sequence rlbozyme Furthermore, the various stages of the HIV-l life cycle may be targeted. The cleavage of a specific target by a ribozyme may either be enhanced or decreased in the cellular environment by such things as base palrmg m the secondary structure, tertiary folding, association with proteins, or association with negative stranded DNA. Thus, m vlvo activity 1sdifficult to predict merely based on in vitro data. In other words, some ribozymes that perform poorly in vitro may not necessarily perform poorly m VIVO.For example, a higher level of inhibition was observed in HeLa cells relative to the maximal percent cleavage observed m vitro (Z4). However, such problems would also be encountered when using antisense or decoy RNAs. 1.2. Ribozymes and the Generation of Resistant Mutants A concern with the treatment of AIDS with ribozymes, as with other forms of therapy, is the generation of resistant mutants. Viral polymerases exhibit an extremely high mutation frequency, which generates genetically complex heterogeneous populations referred to as a quasispecies (25,16). These quasispecies have the potential to adapt rapidly to new environments, enabling them to become resistant to drugs and escape the lfnmune responses initiated by unmunization. HIV-l RT has been shown to have an unusually poor fidelrty, with an estimated error rate of 1 substitutlon/l700-4000 polymerized nucleotides (I 7,28). The high specificity of rrbozyme cleavage, which would prevent cleavage of nontargeted RNA, can lead to the generation of resistant mutants by single-site mutations. Fortunately, however, resistant mutants have not been detected in antileader sequence ribozyme-transduced cells, even following long-term cultlvatlon. T-cell lines stably expressing the rlbozyme gene showed resistance to HIV-l infection for up to 35 d (19); in contrast, AZTreslstant mutants appear followmg a few weeks of m vitro cultivation One reason may be that the ribozyme was designed to target only the most conserved regions. Within diverse strains of HIV-l, there are regions that are highly conserved, implying that mutations in these sequences are debilitating In fact, an HIV-l cDNA clone with a site-directed mutation was generated to study resistant mutants for the anti-U5 ribozyme. For this study, HIV MNa has a single base substitution of A for G at the cleavage site of N*GUC for the anti-U5 ribozyme, which should render it refractory to the rlbozyme (6,19). Molt-4/8 cells with or without expression of the ant&J5 rlbozymes were transfected with the mutated virus. Surpnsmgly, the repllcatmg virus obtained from parental Molt-4/8 (without ribozyme) cells was all reverted wild-type virus,


463

and the ribozyme-expressmg cells were protected from mfection of thts mutated virus. The results indicated that some sequencesare indispensable for HIV-I rephcation (Yamada et al., unpublished). Therefore, choice of conserved target sites is very important. 1.3. Methods for Delivering Ribozymes into Cells Gene therapy methods for delivermg ribozymes to cells include the standard murine retroviral vectors, which are relatively efficient, safe, and capable of integrating stably (20). However, murine retroviruses infect only divrdmg cells, whereas one of the major target cells of HIV-l is the monocyte/macrophage, which is nondividmg. Furthermore, it is difficult to concentrate murine retrovnuses to a high titer. Another concern is that the packaging cell lines used for the generation of the retroviral vectors may generate replication-competent helper virus. Thus, alternative methods for gene transfer are being sought for the treatment of HIV-l. One promising approach mvolves the usage of vectors based on adeno-associated vuus (AAV) AAV is a nonpathogenic replication-defective DNA vu-us of the parvovirus family that requires co-infection with adenovirus and other viruses to propagate. It can stably integrate as a provirus mto a defined region on chromosome 19 without requumg cell division-a major advantage over retroviral vectors, since potentially deleterious ex vivo manipulations may be avoided. It has been shown that AAV vectors can stably and efficiently insert anti-HIV therapeutic genes into hematoporetic cells (21). Disadvantages with using this vector method include a 4.7 kb limit on the size of the inserted gene, the risk of adenovtrus contammatton, and the possibility of the integrated gene being excised. The major obstacle to be overcome m developing ribozyme gene therapy, as with other forms of intracellular immunization, will be getting the ribozyme genes mto the appropriate cells. HIV-l mainly infects blood cells, T-lymphocytes, and monocyte/macrophages, which are derived from hematopoietic stem cells. Stem cells give rise to cells of hematopoiettc lineage, including brain macrophages and microghal cells, and are capable of self-renewal, which makes them an attractive cell type for mtroducmg the ribozymes (22). Since there is no effective m viva gene delivery system yet, therapy could entail removmg the hematopoietic stem cells from an AIDS patient or allogemc donor and transducing them with a vector containing the ribozyme gene. These cells would then be infused back mto the patient, where they are expected to repopulate permanently all the hematoporetic cell lineages of the immune system. Since these cells would have a selective advantage because of their resistance to HIV- 1, they should flourish, which is essential for success.Potential hurdles to be overcome include obtammg gene-transfer efficiencies that are therapeutttally effective, mmimizmg manipulations that could affect the repopulation of

464

Duarte et al.

the transduced stem cells, optimizing the level of expression of the transduced gene in daughter cells, and mimmizmg the toxicity of the vector during stem cell development. However, this approach appears promismg, since a hairpin ribozyme was able to inhibit viral gene expression and rephcation m monocytes/macrophagesderived from CD34+ hematopoietic stem/progenitor cells (9). In summary, ribozymes offer a novel and promising approach toward treatmg HIV-l infections. Obviously, some questions remain to be answered, including what is the best delivery and expression system,what cells should be targeted, will transduced cells be selected for within the body, and so forth. The followmg sections describe the creation of hairpin ribozymes for use as an AIDS therapeutic, which, obviously, would also provide a reference for the treatment of other target diseases. 2. Materials The method described m this chapter may be carried out in any wellequipped standard molecular biology/tissue-culture laboratory. Expertments mvolving HIV require at least a BL-2 facility and BL-3 working conditions (refer to “Biosafety m Microbiological and Biomedical Laboratories” HHS publication #CDC 93-8395, US Government Prmtmg Office, Washington DC 202-5 12-2356). Specific equipment and supplies required include: 1 Cloning vector containingin vivo expressiblenbozyme(e g., the Moloney Murme Leukemia Virus-derived vector, LNL6 or other retroviral plasmids,such asN2) 2 PA3 17 or other retroviral packagingcell line (seeNote 1). 3 Dulbecco’sModified Eagle’sMedium (DMEM). this shouldbesupplementedwith 1mA4sodiumpyruvate, 100U/mL penicillin, and 10% FCS (e.g., from Gibco). 4. Phosphate-bufferedsaline (pH 7.4, Ca2+-and Mg2+-free) 5. 0.45 pm Pore sizesterile filter 6 T-cell lines, e g., CEM, Jurkat, Molt 4. 7. Polybrene (hexadimethrmebromide, Abbott Laboratories) 8. RPMI- 1640medium supplementedwith 100 U/mL penicillin, 100 pg/mL streptomycin, 10% FCS, and400 pg/mL G418 (Gibco) 9. p24 ELISA kit. 10. HIV-l stocks. 11. Biosafety Cabinet Class2. 3. Methods: Transduction of Cells with Anti-HIV Ribozymes and Challenge with Virus 3.7. Ribozyme Design The first thing to decide is the sequence to be targeted. We mitially targeted HIV-l sequences that contain BNGUC sequences (B can be any nucleotide except A, and N can be any nucleotide) and are at least 85% conserved among

HaIrpin Ribozyme Therapy for AIDS

465

different isolates. These sequences can be Identified by searching in GenBank usmg the Bioseq program (Aspmall); see also Chapter 4. Once Identified, oligonucleotides for ribozyme production must be synthesized to generate mserts for introduction into a vector. One oligonucleotide must be designed to generate a functional ribozyme, whereas the other must create a disabled (Inactive) ribozyme. Dtsabled rtbozymes are a necessary control to show that any antiHIV activity is not owing to the antisense abtlities of the ribozyme. Perhaps the best way to illustrate the construction of the ribozyme 1svia an example (Fig. 1). This ribozyme was designed to target the rev/env coding region of HIV- I RNA (HXB2: 8629-8644) (19). As illustrated, the ribozyme must be designed to cleave the sequence 5’-UUGGA*GUCAGGAACUA-3’. For cleavage, the four basesflanking the 5’-end of the cleavage site N*GUC, and the eight basesflanking the 3’-end of the cleavage site must base pan with the ribozyme (Fig. 1). Thus, when designing a rlbozyme to target a given sequence, these sequences must be changed for binding to the substrate RNA. The backbone of the ribozyme remains the same, regardless of the sequence to be targeted. However, to generate a disabled ribozyme, the AAA sequence m the loop 2 region (Fig. 1) is replaced by CGU. For ligation into a cloning vector, the ohgonucleotides should have two single-stranded DNA portions that contain a restriction site. In this example, the oligonucleotides have sequencesat the S-end for ligation into BarnHI-digested DNA and sequences at the 3’-end for ligation into MM-digested DNA. Thus, the followmg pans of ohgonucleotides should be synthesized for generating active and inactive nbozymes. 1 Active rrbozyme + strand: 5'-gatccTAGTTCCTAG~~CCAGAGAAACACACGTTGTGGTATA~ACCTGGTa-3' 3'-gATCAAGGATCTTGGTTTGGTCTCTTTGTGTGCAACACCATATAATGGACCA 2 Inactive rlbozyme + strand 5'-gatccTAGTTCCTAG~ACCAGAGCGTCACACGTTGTGGTATATTACCTGGTa-3' 3'-gATCAAGGATCTTGGTTGGTCTCGCAGTGTGTGCAACACCATATAATGGAC The underlined sequencescorrespond to those flanking the catalytic domain; these bind to the HIV-l RNA and must be customized for each sequence targeted. The lowercase letters correspond to the ligation sites, and the italicized and bold sequences are those that generate the disabled ribozyme. Using the method described above, the oligonucleotides can be hybridized and directly introduced into a retroviral vector (see Note 2). 3.2. Vector Design The choice of vector and construct for introducing and expressing a ribozyme will depend upon many factors, mcluding the cells to be targeted,

466

Duarte et al.

level of expresslon required, researcher’s preference, and so on (see Chapter 45). The retrovn-al vector we use is LNL6, and it 1s derived from Moloney Murine Leukemia virus. We have had reasonably good results driving the ribozyme with an internal human tRNAVa’ promoter and usmg a Pol III termlnator (see Chapter 42). Once an expresslon vector 1sdecided on, the vector and insert need to be ligated and competent cells transformed and screened. If positive colonies are found, we recommend doing a mmiprep for sequencmg the plasmld DNA to confirm the construction. If the sequence is correct, a maxiprep of the plasmld DNA should be prepared for use in transduction (see Section 3.3.). 3.3. Retroviral

Vector Packaging

and Transduction

1. Plate PA3 17 cells (see Note 1) onto a 100 mm Petri dish m DMEM at a concentration suitable to obtam subconfluence the next day (generally 5 x lo5 cells/plate) 2. The next day, transfect the subconfluent PA3 17 cells with the retroviral vector plasmid (20 ~8) using the calcium phosphate method Do not change the medium before the transfection 3 After 12 h, wash the cells twice with phosphate-buffered saline (pH 7 4, Ca*+and Mg2+-free), and incubate for an additional 24 h m fresh medium 4 On the next day, collect the culture medium from the transfected PA317 cells, and filter through a 0 45 p pore size filter to remove cell debris. 5 Transduce 1 x 1O6human CD4+ cells (e g., Molt-4 /8 or Jurkat) by adding 10 mL of the supernatant collected from the transduced PA3 17 cells m the presence of polybrene (final concentration 4 pg/mL). 6 After 48 h, remove the supematant from the cells and culture them m RPMI- 1640 medium supplemented with penicillin, streptomycm, FCS, and G418. Change the medium every 3 d. Resistant cells can be selected by growth m G4 1g-containing medium for up to 3-4 wk. Once stably transduced Molt-4 cells are obtained, the ability of the ribozyme to inhibit the replication of HIV-l can be tested by challenging them with HIV-l described m Section 3 4.

3.4. Challenging

Ribozyme Transduced

Cells with HIV-1

Infect the G418-selected nbozyme-transduced cells with HIV-l at an mput m 0.1. of 0,001-O 1 for 2 h, and then wash the cells twice with RPMJ-1640 HIV-l strain HXB2 can be used, which can be produced from the molecular clones pHXB2C 2. Initially, culture the cells at lo5 cells/mL m RPMI-1640 medium supplemented with 10% FCS Thereafter, spht the cells every 3-4 d to mamtam a cell concentration of approx 2 x lo5 cells/ml 3. Collect the supematants every other day after the infection, and determine the level of HIV- 1 p24 antigen-using an HIV- 1 antigen capture ELISA test kit and followmg the manufacturer’s mstructlons


467

4. Notes 1 We package our constructs using an amphotroptc retrovual packaging cell line, such as PA3 17 2 Rtbozymes containing the tetraloop ribozyme as described m Yu et al. (13) may also be created in this way. Although ribozymes with this modification may have a higher catalytic efficiency than conventional rtbozymes, this 1snot necessartly universally true.

References 1. Vaishnav, Y N and Wong-Staal, F (1991) The biochemistry of AIDS. Annu Rev Blochem 60,577-630. 2. Mulligan, R C. (1993) The basic science of gene therapy. Science 260,926-932 3 Balttmore, D. (1988) Gene therapy. intracellular immunization. Nature 335,395-396 4. Rossi, J , Elkms, D., Zaia, J , and Sulhvan, S. (1992) Ribozymes as anti-HIV therapeutic agents: principles, applications and problems AIDS Res Hum Retrowuses 8, 183-l 89. 5 Yu, M , Poeschla, E., and Wong-Staal, F. (1994) Progress toward gene therapy for HIV infection Gene Ther 1, 13-26 6. Hampel, A , Tritz, R., Hicks, M., and Cruz, P (1990) Hairpin catalytic RNA model. evidence for hehces and sequence requirement for substrate RNA Nuclezc Aczds Res 18,299-304. 7 Hampel, A., Nesbitt, S , Tritz, R , and Altschuler, M (1993) The hatrpm ribozyme, m Methods. A Companion to Methods m Enzymology (Abelson, J. and Simon, M., eds.), American Press, San Diego, pp. 37-42. 8 Anderson, P., Monforte, J., Tritz, R., Nesbitt, S., Hearst, J , and Hampel, A. (1994) Mutagenesis of the halt-pm rtbozyme. Nucleic Aczds Res 22, 10961100 9. Yu, M., Leavitt, M C , Maruyama, M., Yamada, 0 , Young, D., Ho, A D , and Wong-Staal, F. (1995) Intracellular nnmun~zation of human fetal cord blood stem/ progenitor cells with a ribozyme agamst human immunodeficiency vu-us type 1 Proc Nat1 Acad Scl USA 92,699-703 10 Leavitt, M C , Yu, M., Yamada, 0 , Kraus, G., Looney, D , Poeschla, E , and Wong-Staal, F (1994) Transfer of an anti-HIV-l rtbozyme gene mto primary human lymphocytes. Hum Gene Ther 5,1115-l 120. 11 Rossi, J J and Sarver, N (1992) Catalytic anttsense RNA (nbozymes) their potential and use as an an&HIV-l therapeutic agents Adv Exp Med Biol. 312,95-109 12. Yamada, 0 , Kraus, G , Leavitt, M. C , Yu, M , and Wong-Staal, F (1994) Acttvity and cleavage site spectficity of an anti-HIV hairpm rtbozyme m human T cells Vzrology 205, 12 l-l 26 13 Yu, M , Poeschla, E , Yamada, O., Degrandis, P , Leavitt, M C , Heusch, M., Yee, J.-K., Wong-Staal, F , and Hampel, A (1995) In vitro and zn vlvo characterization of a second functional hairpin ribozyme against HIV- 1. VzroIogv 206,38 l-386 14 Yu, M , OJwang, J., Yamada, 0, Hampel, A., Rappaport, J , Looney, D , and Wong-Staal, F. (1993) A hanpin ribozyme inhibits expression of diverse strains of human unmunodeflctency VKUStype 1 Proc Nat1 Acad Scz USA 90,6340-6344.

468

Duarte et al.

15 Holland, J J , Spmdler, K., Horodyskt, F., Grabau, E , Nichol, S , and VandePol, S (1982) Rapid evolution of RNA genomes Sczence 215, 1577-1585. 16. Duarte, E. A., Novella, I S , Weaver, S C., Domingo, E., Wain-Hobson, S., Clarke, D K , Moya, A , Elena, S F , de la Torre, J C , and Holland, J. J. (1994) RNA vu-us quastspecies* significance for viral disease and epidemiology. Znfect Agents andDzs. 3,201-214

17 Preston, B D , Potesz. B J , and Loeb, L. A. (1988) Fidelity of HIV-l reverse transcrtptase Sczence 242, 1168-l 17 1. 18. Roberts, J. D , Bebenek, K., and Kunkel, T A (1988) The accuracy of reverse transcriptase from HIV- 1. Sczence 242, 117 1-l 173 19 Yamada, 0 , Yu, M , Yee, J.-K , Kraus, G., Looney, D., and Wong-Staal, F (1994) Intracellular immunization of human T cells with a hanpm ribozyme against human immunodeticiency virus type 1. Gene Ther 1,38-45. 20. Miller, A D (1992) Retroviral Vectors Curr Top Mzcroblol Immunol 158, l-24 2 1 Muzyczka, N (1992) Use of adeno-associated vu-us as a general transductton vector for mammalian cells Curr Top Mzcrobzol ImmunoE 158,97-129 22. Nienhms, A. W., McDonagh, K. T., and Bodme, D. M. (1991) Gene transfer mto hematopoietic cells. Cancer 67, 2700-2704

Clinical Aspects of Ribozymes as Therapeutics in Gene Therapy David Looney and Mang Yu 1. Introduction By June 1995, 112 gene therapy trials had been approved by the NIH Recombinant DNA Advisory Committee (RAC) in the US, involving 500 actual, planned, or projected patients (Z-3). Marking trials comprise roughly 20% (25 m total) of all approved studtes, while the remamder are considered to have therapeutic objectives. All together 87 treatment protocols are active, including 9 trials directed toward treatment of HIV infection, 21 that address genetic disorders, 1 each involving treatment of autoimmune or atherosclerotic disease, and 55 studies that target cancer therapy in some form (see Fig. 1). Therapeutic trials include 38 in vivo studies and 42 ex vtvo studies, all together employing over 81 vectors (50 murine, 15 adenovirus, 1 AAV), as well as several other delivery systems (12 lipid mediated and 3 naked DNA delivery protocols). Treatment studies involving protein expression include replacement studies (e.g., ADA deficiency, cystic fibrosis, a-l -antitrypsin deficiency, Gaucher’s disease, familial hypercholesterolemia, and Hunter syndrome), and trials aimed to produce immunomodulation or immunoprophylaxis (including mtroduction of genetically engineered cytotoxic lymphocytes, vectors expressing viral protems, and vectors expressing cytokines, such as GM-CSF, IL-2, IL-3, IL-6, IL-7, IL-12, and TNF, into malignant cells [Z-3/). Other trials involved mtroduction of toxin genes, particularly thymidine kinase (hsv-tk), mto tumor tissue or protective genes (e.g., human multidrug resistance gene) into normal hematopoetic tissue to protect bone marrow during cytotoxic chemotherapy. Only a handful of approved trials mvolve therapeutic strategies other than protein production, including mtroduction of vectors producmg antisense RNA From


Botogy, Vol 74 Ribozyme Protocols Humana Press kc, Totowa, NJ

469

470 60 $j 50‘E

-W-

HIV

-e

Genetic

+

Cancer

1990

1991

1992

1993

1994

1995

Year

Fig 1. Approved gene therapy trtals m the US Data from the Office of Recombinant DNA Activities (ORDA) as published m Human Gene Therapy summaries m Gene Therapy Newsletter Issue 12, pp l-2 (1995) was used to construct a cumulative graph indtcatmg active approved protocols in the indicated areas. The group designated as “Other” includes protocols for autoimmune diseases and atherosclerotic vascular dtsease, and may not mclude protocols for which RAC approval was deferred with subsequent submission directly to the FDA.

directed against msulin-like growth factor 1, myc and&, as well as antisense against HIV- 1 tat/rev (2,3). At this time, only two protocols for therapeutic use of catalytic RNA have been introduced, both directed against HIV- 1. The pau-

city of ribozyme protocols may, in part, reflect the immaturity of ribozyme technologies owing to the relatively recent discovery and mvestigation of ribozymes. It may also illustrate some of the inherent difficulties faced by many strategies for the use of ribozymes, whose successfrequently depends on efficient transduction of a large number of target cells, owing to restriction of the activity of the therapeuttc vector to the intracellular environment. For example, consider the relatively greater ease of designing vectors, delivery systems,and implementmg trials to demonstrate clmical effects where the goal is replacement of a missmg protein component (e.g., adenosme deammase) rather than protection of large numbers of susceptible cells against an infectious agent (e.g., HIV) Nonetheless, owing to the flexibility of ribozymes, a likely lack of mnnuno-

genicity, and overall tremendous perceived potential, interest m ribozymes as chmcal modalmes ts clearly increasing at an accelerating pace. In this chapter, we hope to address the unique potential and disadvantages of ribozymes for gene therapy, concentrating on the clmical conditions where ribozymes might

Clinical Aspects

471

best be used to advantage or avoided, and addressing the considerations for design and implementation of human trials using ribozyme-expressing vectors. Although this review ~111concentrate on viral vector gene therapy strategies using ribozymes designed only to cleave target RNA, readers are reminded that rtbozymes constructed from chemically modified RNA or DNA delivered by other methods (see Chapters 45 and 46) may have different applications with very different implications for design of clinical trials We hope to use our experience with preparations for a PhaseI trial of ribozyme treatment of HIV- 1 mfection to exemplify some of the issuesfacing investigators contemplatmg or designing ribozyme clinical trials. 7.7. Potential Applications of Ribozymes Ribozymes have been proposed as potentially efficacious therapeutics for treatment of a variety of infectious agents. Even targeting of prokaryotic pathogens is possible through the use of phage or other delivery systems. Vectors expressing ribozymes have been used for cleaving essential gene products (4,5), and most significantly, ribozymes have been proposed as efficacious therapeutics for the treatment of HIV infection and AIDS (6). Other speculative (perhaps currently even fanciful) strategies for the use of ribozymes that might be broadly applicable to treatment or prevention of protozoal, fungal, viral, or bacterial infection might include the use of ribozymes delivered directly as modified RNAs to cleave and reduce expression of messages for cellular receptors for specific agents on the mucosal surface. The expandmg scope of ribozyme technology covered m this book and other reviews (7-14) introduces the potential of ribozymes as generalized RNAediting molecules, capable of targeting cellular transcripts for destruction, alteration, or repair. This represents a vast array of possible tools to alter intracellular processes. To date, the development of ribozymes for human clmical trials has centered on viral pathogens, and rtbozymes would appear to offer some unique advantages when compared to antisense or protein-expression strategies for treatment of viral infection. As addressed m more detail m the precedmg chapters, ribozymes offer the advantages of catalytic action over inhibitory drugs or antisense RNA. By protectmg cells agamst viral cytopathic effects, ribozymes may promote survival of populations of functional transduced cells m viva, potentially leading to increased therapeutic effects over time. By producing only therapeutic RNAs, rrbozymes are likely to avoid entirely or at least largely (antibodies directed against small nuclear RNAs have been detected m several autoimmune disorders [25]) the problems of immune eradication of transduced cells or production of autoimmune antibodies, which have developed even m patients given recombinant human products (16). For persistent agents, such as

472

Looney and Yu

retrovtrus infecttons like HIV-l, gene therapy would appear to offer an ideal route to permanent protection of cells, either through ex vivo therapy with transduced, protected, expanded autologous T-lymphocytes, or hematopoetic stem cell precursors, or via m viva gene therapy by targetable, injectable vectors, as future vector technology permits. Aside from HIV-l, for which two clinical protocols are currently being advanced for regulatory approval m the US, a number of other vu-al agents would appear to be suitable for targeting via catalytic RNAs. In particular, several other RNA viruses represent logical candidates for development through the stage of ribozyme clinical trials owing to lack of currently efficacious and acceptable therapy, prevalence, economic potential, and other considerations. Among the rhinoviruses, enteroviruses, and picornaviruses, a number of conserved potential target sites can be identified. Topical apphcation of either vector or naked modified ribozyme nucleic acid to mucosal surfaces might represent strategies to investigate m clmical trials for prophylaxis of these very common agents, In addition, the relatively innocuous nature of illness commonly produced by many of these vu-uses(e.g., rhinoviruses) would make actual challenge feasible in small initial trials, making efficacy much more easy to establish. Although economic considerations and design of clinical trials might be much more difficult to approach, the hemorrhagic fever viruses, by virtue of the severity of such illnesses and lack of very effective currently available therapeutic agents, might be another group of vu-uses that should be considered. Hepatitis C virus, owing to the very high rate of chronic infection with this agent and its role in cirrhosis and liver failure (2 7), along with the possibility of easy anatomic targeting of vectors to the liver through administration via the portal vein, represents another attractive target for ribozyme therapy trials m the near future. Ribozyme therapy of DNA virus infections, although perhaps somewhat more problematic, has been considered for inhibition using catalytic RNAs. By inhibiting expression of the early genes of many DNA viruses (e.g., herpes simplex virus), it should be possible to block virus replication and the production of progeny virions, suggesting applicability to either prophylactic or therapeutic uses. Similarly, antisense oligonucleotides have been shown to be capable of inhibiting expression of herpesvirus genes (EBV LMP) responsible for latency and necessaryfor episomal replication and transformation (18), suggesting that these messagesare susceptible to catalytic RNA cleavage. Hepatitis B vnus (HBV) represents a unique target, by virtue of the presence of an essential pregenomic RNA phase m the viral rephcation cycle, which precedes reverse transcription into viral DNA, making the targeting of HBV analogous to strategies targeting retroviruses (18,29). Hepatitis D vnus infection, a causeof

Clinical Aspects

473

fulminant hepatitis in hepatitis B virus-infected individuals, 1sanother agent to which consideration for ribozyme therapy has been given (20,21). 7.2. Ribozymes as Antineoplastic Agents Targetmg of the replication of oncogenic DNA viruses may afford a method of reducing the incidence or even the actual treatment of malignant conditions. For example, the LMP gene of EBV, which is necessary for persistence, eptsoma1replication, and transformation of infected B-cells, has been shown to be capable of interruption by rtbozymes targeting EBV RNA. EBV is involved m over 70% of AIDS-related B-cell lymphomas and roughly half of Hodgkin’s disease tumors (22), though the role ofEBV m transformation and oncogenesis remains controverstal. Stmilarly, HBV represents the principal risk factor for the development of hepatoma m much of the world (23). Other oncogenic viruses that might be targeted include papillomavnus and perhaps the newly discovered y herpesvirus associated with Kaposi’s sarcoma (24), if this vnus can be shown to play a causal role in induction of this malignancy. Although promising, many questions remain unanswered concerning the efficacy of interrupting replication of such DNA viruses, as the role of the virus may be to produce imtial expansion and hyperplasia of a pool of target cells (e.g., EBV), which undergo subsequent genetic events and which may not be affected by rtbozyme inhibition of vn-us rephcation. With sophisticated molecular techniques, an ever-increasing number of neoplastic conditions have been shown to contain characteristic genetic lesions that may be susceptible to targeting by the use of vectors expressing catalytic RNAs. One outstanding example mcludes targetmg of the bcr-abl translocanon messages present in Philadelphia chromosome-positive adult chronic myelogenous leukemia (25,26) by ribozymes in vitro. A fusion RNA associated with adult promyelocytic leukemia, produced by a chromosomal translocation (15,17) involving a retinotd receptor gene, has also been shown to be susceptible to ribozyme cleavage (26,271. Other translocations and mutations present in a variety of hematopoetic tumors may be susceptible to targeting for message cleavage. Ribozyme-expressing vectors have been demonstrated to be capable of mhibitmg H-ras (derived from melanoma and bladder tumor lines) transformation of tibroblasts in vitro, as well as mod@mg the m viva phenotype of such tumors (28-331, as evidenced by reduction m tumor burden and aggressiveness m murine models. Alternative strategies for the use of rrbozyme-expressing vectors in the treatment of cancer include the introduction into malignant cells of transgenes designed to obviate resistance to antmeoplastrc drugs, to prevent resistance or restore susceptibility to conventional chemotherapeuttc agents, Rtbozymes active m vitro against messages encoding resistance to daunorubicm and methotrexate, as well as the human

474

Looney and Yu

multidrug resistance gene (mdr) have been described (33-36), and ribozymeexpressmg vectors have been shown in some systemsto be more effective than exogenous antisense oligodeoxynucleotides m restormg sensitivity to some cytotoxic agents (daunorubicin, for example). Since many, if not all, malignancies would appear to be the result of sequentral genetic lessons, however, simple inhibition of a single oncogene may not prove to be an effective or appropriate strategy. Conversely, as more RNA-editing capabilities are added to the repertoire of ribozyme technology, additional genetic lesions may become susceptible to the action of therapeuttc ribozymes. 1.3. Ribozymes and Heritable Diseases This theoretical possible use of ribozymes has not been the object of much speculation, perhaps because most (if not all) of the many autosomal-recessive human disorders represent conditions resulting from the lack of production of a normal factor. Even dominant human genetic diseases where prelimmary evidence would indicate that unique features of the mutant gene are responsible for disease expression (e.g., Huntmgton’s disease,where changes in numbers of CAG repeats result in the polyglutamme expansion m the huntmgtm protein encoded m the IT1 5 gene on chromosome 4) seem to involve molecular changes that are not easily amenable to targeting mutant genes (37-39). If specific polymorphisms that are linked to the actual deleterious mutatron(s) can be dtscovered, these sitesmight also afford potential targets for rrbozymes. In diseases where the effect of mutatton would be to increase the level of a cellular protein, catalytic RNAs might represent a mechanism of reducing effective expression of the encoded protein, thus altering disease penetrance. Genetic condittons, such as adult polycystic kidney disease, caused by translocation, deletions, or sphcmg defects m the PKD 1 gene located on chromosome 16, might also be amenable to strategies to alter the prevalence or nature of mutant messages (40). In contrast, other groups of genettc disorders, such as familial hypercholesterolemta (41,42) and anttthrombm III deficiency (43) (autosomal-dominant heritable disorders where the net effect of complex groups of genetic lesions is a reduction m the levels of normal proteins), would seem more suitable to be considered for replacement gene therapy. 1.4. Status and Design of Ribozyme Clinical Trials--Points to Consider Currently two clinical trials for ribozyme treatment of HIV- 1 mfection (one using a hairpin ribozyme and the other a hammerhead ribozyme approach) have been advanced before regulatory agencies (RAC and the Food and Drug Administration) m the US. These mclude a protocol for ex VIVOtransduction and infusion of autologous T-lymphocytes from infected individuals usmg

Clinical Aspects

475

murme vectors producing a hairpin rtbozyme directed against the U5 leader sequence of HIV (F. Wong-Staal, IND 941015), and a protocol for the transduction and transplantatton of CD34 peripheral blood-derived stem cells m HIV-l infected individuals using murme vectors contammg a hammerhead ribozyme targetmg HIV tat RNA (J. Rosenblatt, submitted). The overall strategy with which these trials have been approached is not radically different from any other trial, with a few Important exceptions. Imtially, preclmical work concentrated on development of m vitro data concernmg inhibition of viral replication in laboratory cell lines (44-47). Later, this work was extended to demonstrate activity in primary cells (48,49), and eventually to experiments showing mhibitton of endogenous virus replication m peripheral blood mononuclear cells (PBMC) derived from HIV-infected individuals. In parallel, work on cord blood-derived CD34+ hematopoietic stem cells demonstrated the ability of murine retroviral vector delivered ribozymes to protect derived myeloid cell clones (50), and yet other studies were needed to demonstrate the ability to transduce and expand safely peripheral blood T-cells from infected individuals. Additional protocols have been submitted to evaluate the ability to mobilize, harvest, and transduce CD34 hematopoetic progenitors safely from PBMC obtained from HIV-l infected individuals. In preparation for the Phase I trial of ex vivo rtbozyme gene therapy for HIV infection, vector development and the production, and stringent testmg of vectors for clinical use in GMP facilities have proceeded concomitantly. The overall design of these initial trials, involving small numbers of patients, generally involving administration of transduced cells with little hope of producing therapeutic effects, and entailing extensive and very expensive ex vivo manipulation, undoubtedly appears cumbersome, complex, and perhaps may be of limited feasibility for widespread clinical implementation. As technology for introducing stable vectors mto hematopoietic stem cells improves, the prospects for therapeutic applications in HIV Infection and other areas will brighten considerably. These first efforts are likely to appear primitive as new delivery systems and vectors are developed in the coming years. Though it would appear that the delivery of the magic ribozyme bullets in a single injection is still some distance m the future, the technology does not appear to be unattamable, and the potential rewards and current pace of vector development are such that future delivery of ribozyme gene therapies m a syringe is more likely to be inevitable than impossible. 1.5. General Principles in Design of Ribozyme Gene Therapy Trials Just as with in vitro experiments, rtbozyme-containing vectors lend themselves to a variety of interesting and valuable strategies to obtain additional

Looney and Yu mformation from otherwise rather straightforward Phase I and Phase I/II trials. One pomt that mvestigators should always consider m any gene therapy trial is that every gene therapy trial is a gene marking trial. Ribozymes may be relatively ideal m this regard, since vectors not expressing proteins should be less susceptible to nonspecific ehmmation by host cytotoxic lymphocytes. Such a capability lends itself to designing prehmmary trials as “two-in-one” studies, for example, by treating the Infused cells as simply being gene marked (especially applicable if a control vector is included) to obtain information on the distribution of the target cells m questton m the disease state bemg treated. In the design of the current ex vivo rtbozyme T-cell trial, autologous CD4+ cells transduced with control vector will be administered along with cells transduced with ribozyme-expressing vector. Thts allows evaluatton of the use of “tracer” tagged lymphocytes to model the kinetics of destruction of activated T-cells m HIV-mfected mdtviduals, as well as the obvious comparison to the survival of cells transduced with ribozyme-transducing vector. Another facet of hanpin rtbozymes m particular is the ease with which macttve ribozymes can be constructed, containing only a few nucleotide differences in the active site, away from the hybridizing regions, allowing comparison of antisense activity with RNA catalysis directly. Additionally, although as with any Phase I study, the small number of patients who will be included m small initial trials precludes reliable detection of all but the most frequent toxicittes, the abihty to include both vector and ribozyme-inactive controls provides mvestigators with the opportumty to construct trials that can obtain large amounts of informatton on the efficacy and mechanism of action of ribozymes m viva. Although not a substitute for trials demonstrating actual clmical efficacy, such “proof of concept” trials may provide considerable incentive to proceed with trials mvolving larger numbers of patients or escalating doses of transduced cells. 1.6. Approaching Evaluation of Safety: Concerns and Strategies Although direct impact of the expression of ribozymes on cell viability is easily approached and quantified m the laboratory, and the presence of substantial cellular toxicity would ltkely preclude further development of a given vector, in vitro mformation is likely to be of extremely limited use m reassuring the clnncal investigator concernmg the potential toxicities to be encountered in human use. For example, although no interference with mitogen or lectm-driven proliferation of T-cells transduced with HIV-l leader sequence ribozyme expressing vectors can be discerned, less mformation is available on antigen-specific proliferation, and other immunological studies suggest such expanded cells might well be anergic for a substantial period of time. In addition, although substantial data exist concerning the (relatively mild) toxic

C/mica/ Aspects

477

effects of administration of large numbers of activated lymphocytes (LAK, TIL, the ongomg ADA trials) to uninfected individuals (.51-53), a umque concern exists for HIV, where the activated CD4+ lymphocytes being infused potenttally represent an ideal host for virus replication, raising questions concerning the potential for a massive burst of virus replication with infusion, should cells not be protected m vivo, or from the fraction of nontransduced or rtbozyme nonexpressing cells Infused. Although cell-culture model systems can be used to approach some of these concerns, the models are imperfect and much less complex than the in vtvo situation, and must be specifically addressed in experimental plans as potential toxictttes. Similarly, concerns about the oncogenic potential of retroviral vectors and the very remote potential of ribozymes to be “accidentally” toxic or oncogenic by virtue of nonspecific cleavage of essential cellular messagesor anttoncogene messages (54) are essentially impossible to approach in vitro, and will not be answered other than by extended human trials. Animal trials may be difficult to perform (as with HIV, where nonhuman primate animal models may be imperfect reflections of human disease, and be expensive and time-consuming to perform), but can provide direct evidence of safety and efficacy, though human toxicity can never be perfectly addressed except by the actual human trial. Small animal models for intracellular vs cellular therapy are probably extremely limited m utility, except perhaps highly artificial models (transgenic mice, SCID-hu-PBL or SCID-thymus-liver) in murine systems. The potential delayed toxicity of all gene therapy vectors involving integration (I.e., malignancy) also necessitates lifelong follow-up of volunteers, adding additional concerns to study design, funding, and execution. 1.7. Regulatory Issues Although not unique to ribozyme gene therapy protocols, and perhaps not even applicable to novel delivery strategies, the use of recombinant DNA necessitates that a number of points be addressed in protocols for human experimentation, as required by appropriate regulatory agencies (see refs. 55-68 for some of the most pertinent documents for US researchers). In the United States, the ones most pertinent for the design of clinical trials include: 1. Some rationale for the use of genetherapy over other approachesand currently available therapeuticoptions. 2 A summaryof the expectedeffects of the genetherapy treatmenton the natural history of the diseasebeing addressed 3. A description of what segmentsof the afflicted population(s) would be targeted by genetherapy. 4. A completedescriptionofthe vector, gene(s),regulatory element(s),and btological systemsto be used and then construction.

Looney and Yu

478

5. Sufficient assurancethat all feasible steps have been taken to define exactly what material is to be adnumstered to patients and steps taken to assurepurity, including elmunation of prokaryotic or viral contamination, especially replication-competent retrovirus. 6 Description of quality-control tests, which will be performed on each batch of cell preparations before infusing cells in patients 7. Explanation of the rationale for the numbers and types of patients chosen or excluded, and estimation of the anticipated level of cells to be transferred or transduced to achieve cluucal effects 8 Summary of in vitro and animal precluucal data on safety of vector and transgene, especially any potential toxicity that might affect germ-lure cells, and a discussion of how applicable the models studied are to human trials (5.5,56) A number of examples m the current Phase I ex vivo trial can serve to illustrate some of these concerns. First, consider the preclmical work that has been done to provide a rationale for the use of gene therapy in humans. Ribozymes were first shown to inhibit rephcation of T-cell-adapted viruses m selected transduced laboratory cell lmes, then diverse strains of HIV were demonstrated to be susceptible to ribozyme action, and finally, primary cells and endogenous virus from PBMC from infected mdividuals have been shown to be inhibited by transduction with ribozyme-expressing, but not control, retroviral vectors. In addition, studies m SCID-hu mice have been undertaken to demonstrate the effect of ribozymes m an in vivo system, and small animal (rabbit) mfusion models for study of toxicity and evaluation of planned procedures for detection of vector and transgene survival and expression (QC-PCR-based assays[69]). Note that although these models provide some (quite crude) information on the potential effects of cell mfusion or vector admmistration, they are not capable of addressing the most serious potential toxicity of ribozyme gene therapy, namely that of distant though exceedingly unlikely mduction of mahgnancy through

integration events during nonrephcatmg vector admmistration, or malignancy owing to the inadvertent admmistratton of rephcation-competent retrovnus. Models of cell survival based on pubhshed studies of viral and CD4+ cell kmetics have been constructed as a guide to timing of tests and test selection and strategtes to be used (70,71). Other clinical end points that have been addressed include momtormg for HIV burden, and how best to measure effects of infusion on viral replication. Toxicity (based on CD4 number) end points and the power of planned trials to detect significant

survival

differences

be-

tween control vector and ribozyme-transduced cells have been made Extensive evaluation of the ex viva procedures used to obtain, transduce, and expand cells, including evaluation of agents to suppress replication of endogenous vu-us in cultures transduced with control vector, has been performed, and volumi-

nous standard operating procedures governing every aspect, from leukapheresis to transport through processing and expansion to mfusion, have been developed.

Clinical Aspects

479

A triad of regulatory hurdles must be leaped for final approval of gene therapy trials in the US, including local instrtutronal revtew boards, RAC review, and approval of an investigational new drug use request from the US Food and Drug Administration (FDA). Investigators would be well served by always remembering that ongomg dialogues with regulatory agenciesare essentialin defining problems and reaching satisfactory solutions. Drscussions with regulatory agencies have resulted in a considerable number of refinements to the PhaseI ex vivo trial of ribozyme gene therapy for HIV infection. For example, as a result of suggestions made in review, antibiotics and antifungals were eliminated from culture media, as was addition of any nonhuman serum or plasma products to cell cultures durmg expansion of transduced cells. Other review agencies have pointed out salient rationales and unanticipated justifications for changes m clinical study design, To reiterate, although it may sometimes be difficult to recall, the regulatory process is many times the clinical investigator’s best friend. Other issues which will face any clinical investigator include: 1 Documentation of personnel trammg 2 Acquisition of dedicated facllmes and equipment. 3 Balancing concerns over what laboratory studies for safety are to be done prior to infusion with what is feasible to do in the limited time between when the blologlcal product is produced and when It must be used.

As an example of the last consideration, compromises must be negotiated on final checks that will be performed to detect the presence of microbial contaminants or replication-competent retrovirus (RCR) on quality-control aliquots of expanded cell cultures, and that must be completed before infusion takes place. Although it is reasonable, for example, to require bacterial broth cultures obtained 24 h prior to infusion of transduced cell preparations to be negative, for example, extensive and sensitive testing for RCR cannot be performed as raprdly. Although not directly applicable to Phase I studies, risk vs benefit analyses and plans for accelerated entry of patients into Phase I/II expanded trials have also been suggested to be appropriate by National Institute of Health (NIH) reviewers, even when in the earliest stagesof planning for chmcal trials. The US investigators must also be well aware of the reporting requirements for gene therapy trials, including semiannual data reporting required by the FDA, NIH/ORDA, and RAC, m addition to the routine adverse event reported to the local mstitutional review boards, the NIH office for protection from research risks, the FDA, and NIH/ORDA. 1.8. Informed Consent As with other gene therapy protocols, clmical protocols for ribozyme gene therapy involve special concerns for the protection of human subjects, some of

480

Looney and Yu

which can be exceedingly difficult to address m a satisfactory manner. Public Interest may dtctate publication of newsletters or fact sheets to update concerned community groups on the status of the trial. When the study is being performed by mvestigators who are also responsible for clinical patient care, special provisions to avoid conflicts of interest (both bias toward patients in inclusion and bias toward pressuring patients to be included) need to be addressed. The complex technical issues involved in such a trtal necessitate elaborate steps and an extended consent document to ensure subjects understand the procedures and rusksinvolved. Invasive procedures performed solely for research purposes (such as planned tonsillar biopsies to evaluate redistribution and survival of transduced cells outside the circulation m the current T-cell ex viva HIV ribozyme trial) represent an additional delicate issue. To obtain adequate enrollment, financial compensation for uncomfortable invasive procedures may need to be offered, raising questions of bias in obtaining informed consent. Some local mstitutional review boards generally require separate consent for each procedure. Simtlarly, if the study will require that subjects abstain from the use of agents that are usually administered as part of currently accepted medical therapy for the treated condition (e.g , antiretroviral drugs), issues of bias m patient choice and fairness of informed consent may also be raised. Both recommendations and reviews have suggested that consents to autopsy be included in gene therapy study consents. However, agreements that Invalidate the right of relatives or other mdivtduals to whom the subject has granted power-of-attorney to rescind consent have been questioned. Indemnification issues and long-term follow-up represent other difficult to resolve considerations. Lifelong followup is mandated by regulatory agencies, but hfelong funding is far from assured. Although institutions generally have agreed to provide care for complications of therapy, even if remote (though one can envisage disagreements over responsibility for subjects with unexpected or atypical neoplasia, for example), regular follow-up for the presence of RCR requires that independent arrangements be made. Thts is also vexing m regard to the expectation of subjects to cooperate long after the period of the initial trial, an issue that must be specifitally addressed in protocols. Privacy m the face of media scrutiny and longterm control of sensitive patient identification information and records may extend beyond the period usually required for drug trials. 1.9. Selection of Subjects Initial trials of ribozyme gene therapy will be hmited to small numbers of patients owing to considerations of safety and expense. Although such issues comphcate study design, requiring compromises to be made between desired study power and the number of subjects who can practically be included, the

Clinical Aspects hmitatton m numbers of subjects also presents decisions concernmg patient selection and mechanisms to ensure equitable entry into trials for various groups of subjects, Recruitment procedures should be explicitly detailed in protocols, and should include mechanisms to address concerns about mvestigator conflict of interest (see Section 1.8.) and efforts to be made to ensure that all potential study subjects be informed concerning study availability. It should be recognized by the investigator that restrictions on entry criteria, such as requirements for a particular treatment history (e.g., antiviral drugs allowed), or on the subset of subjects that will be studied for a particular disease condition (e.g., selection of HIV patients with high or low levels of plasma viral RNA, or patients with a given permissible range of CD4+ lymphocyte counts) must be carefully justified and explicitly detailed in protocols. In addition, agencies have suggested that mechanisms, such as patient lotteries, be included in trial design if more than the estimated needed number of subjects are likely to apply for, or be identified by, screening procedures. 1.10. Conclusion The year 1996 will seethe first implementation of one or more ribozyme gene therapy trials. Undoubtedly, many more trials in the plannmg stage will surface m this period as well. Ribozymes represent unique therapeutic tools with many capabilmes not imagmedjust a few years ago, with apphcabihty to a wide range of human disease conditions, only a few of which have been discussed m this chapter. Although the bulk of this book has dealt with technical issues m ribozyme action and delivery, the applications for biotechnology m general and for human therapy are broad and exciting. Although viral infectious agents may be the first and most straightforward targets to which ribozymes are directed m a clnncal setting, the use of ribozymes for neoplastic disorders and other conditions is no less promising, with virtually unlimited potential. For AIDS and HIV infection, representing “acquired genetic diseases,” ribozyme gene therapy offers the potential of nontoxic treatment for a condition that is frequently lethal despite optimal current therapeutics. By transduction of appropriate progenitor cells and avoiding expression of foreign proteins making transduced cells susceptible to mrrnune eradication, it may be possible to produce cells protected from HIV infection on a sustained basis, and in viva selection for ribozyme-transduced cells through resistance to viral cytopathic effects may afford enhanced clinical activity. Similarly, protectron of critical immune effector cells might allow even ex vivo therapeutic strategies for protection of T-cells more therapeutic successthan anticipated. References 1 Culver, K W (1995) The June 1995 RAC Meeting 12, 1,2.

Gene Ther Newsletter

482

Looney and Yu

2. Recombinant DNA Advisory Committee (RAC) Data Management ReportDecember 1994 and Human Gene Marker/Therapy Protocols ( 1994). Hum Gene Ther. 5, 111 l-l 127, 1537-1545. 3. ORDA/NIH Reports and Human Gene Marker/Therapy Protocols (1995) Hum Gene Ther 6,265-274,391-393,539-548.

4 Penman, R. J. and Gerlach, W L. (1990) Mampulatmg gene expression by ribozyme technology Curr. Optnton Biotechnol. 1,86-91. 5 Sioud, M and Drlica, K (199 1) Prevention of human immunodeficiency virus type 1 integrase expression in Escherzchia colt’ by a ribozyme. Proc. Nat1 Acad Scl USA 88,7303-7307

6 Sarver, N , Cantm, E M , Chang, P S , Zaia, J. A, Ladne, P A, Stephens, D A, and Rossr, J J. (1990) Ribozymes as potential anti-HIV- 1 therapeutic agents Sczence 247,1222-l 225 7 Poeschla, E. and Wong-Staal, F. (1994) Antrviral and anticancer rrbozymes. Curr Optnton Oncol 6,60 I-606.

8. Kiehntopf; M , Esqurvel, E L , Brach, M. A., and Herrmann, F. (1995) Ribozymes biology, biochemrstry, and implrcatrons for clinical medtcme. J A401 Med 73, 65-7 1 9. ROSSI, J. J (1995) Therapeutic antisense and rrbozymes. Br Med. Bull 51,2 17-225 10. Kiehntopf, M., Esquivel, E. L., Brach, M. A., and Herrmann, F. (1995) Clmical applications of ribozymes. Lancet 345, 1027-l 03 1. 11. Gibson, I. (1994) Antisense DNA and RNA strategies new approaches to therapy. J Royal Coil Phys. (Lond) 28,507-5 11 12. Yu, M , Poeschla, E , and Wong-Staal, F (1994) Progress towards gene therapy for HIV infection. Gene Ther 1, 13-26 13. Jenks, S. (1993) Gene therapy advances slowly mto the clmlc. J Natl. Cancer Znst 85, 1186-1181 14. ROSSI, J. J., Cantm, E. M., Sarver, N., and Chang, P. F. (1991) The potential use of catalytic RNAs m therapy of HIV infection and other diseases. Pharmacol and Ther 50,245-254.

15 Bernstein, R. M (1990) Humoral autoimmunity m systemic rheumatic disease A review J Royal Co11 Phys (Lond) 24, 18-25 16 Brogden, R. N. and Heel, R. C (1987) Human msulm. A review of its biological activity, pharmacokinetics and therapeutic use Drugs 34,350-371 17 Tang, E. (1991) Hepatitis C VII-US. A review. Western J Med 155, 164-I 68 18. Offensperger, W B , Blum, H. E., and Gerok, W. (1994) Molecular therapeutic strategies m hepatitis B virus infection Clzn Invest 72,737-741. 19. Roth, G., Curiel, T , and Lacy, J. (1994) Epstein-Barr viral nuclear antigen 1 antrsense oligodeoxynucleotide inhibits proliferation of Epstein-Barr vuus-mnnortallzed B cells. Bfood 84, 582-587. 20 Carreno, V , Bartolome, J , MadeJon, A (1994) Hepatitis delta vu-us mfection molecular biology and treatment Dig Du. 12,265-275. 2 1. Lai, M. M., Chao, Y C , Chang, M. F , Lin, J. H , and Gust, I. (199 1) Functional studies of hepatitis delta antigen and delta vuus RNA Prog Clm Btol Res 364,283-292.

Clinical Aspects

483

22. Joske, D. and Knecht, H. (1993) Epstein-Barr virus in lymphomas: a review. Blood Rev. 7,2 15-222 23 Yoffe, B. and Noonan, C A. (1992) Hepatms B virus New and evolvmg issues Dig Dls Scl 37, 1-9

24. Chang, Y., Cesarman, E , Pessm, M. S., Lee, F., Culpepper, J., Knowles, D. M., and Moore, P. S. (1994) Identification of herpesvirus-like DNA sequences in AIDS-associated Kapost’s sarcoma. Science 266, 1865-l 869. 25 Leopold, L. H., Shore, S. K , Newkuk, T. A, Reddy, R M., and Reddy, E P (1995) Multi-unit rtbozyme-mediated cleavage of bcr-abl mRNA m myeloid leukemias Blood 85,2 162-2 170. 26. Leopold, L. H., Shore, S K , Newkirk, T., Mangan, K., and Reddy, E. P. (1994) Ribozyme mediated therapy for chrome myelogenous leukemia. Prog Clan Blol Res. 389, 175-182 27 Pace, U , Bockman, J. M., MacKay, B J , Miller, W H , Jr, Dmitrovsky, E , and Goldberg, A. R. (1994) A ribozyme which dtscrrmmates in vitro between PML/ RAR alpha, the t( 15; 17)-associated fusion RNA of acute promyelocytic leukemia, and PML and RAR alpha, the transcripts from the nonrearranged alleles. Cancer Res. 54,6365-6369.

28 Feng, M., Cabrera, G., Deshane, J., Scanlon, K. J., and Curiel, D. T. (1995) Neoplastic reversion accomphshed by high efficiency adenoviral-mediated delivery of an anti-ras rtbozyme. Cancer Res 55,2024-2028. 29 Funato, T , Shitara, T , Tone, T., Jiao, L., Kasham-Sabet, M., and Scanlon, K. J. (1994) Suppression of H-ras-mediated transformation m NIH3T3 cells by a ras ribozyme. Blochem Pharmacol. 48, 1471-1475 30 Ohta, Y , Tone, T., Shitara, T., Funato, T., Jiao, L., Kashfian, B I., Yoshida, E , Horng, M , Tsai, P., Lauterbach, K , et al (1994) H-ras ribozyme-mediated alteration of the human melanoma phenotype. Ann NY Acad. SCL 716,242-253. 31. Kasham-Sabet, M., Funato, T., Florenes, V. A., Fodstad, O., and Scanlon, K. J. (1994) Suppression of the neoplastic phenotype zn vzvo by an anti-ras ribozyme. Cancer Res. 54,900-902

32 Tone, T , Kasham-Sabet, M., Funato, T., Shitara, T., Yoshida, E., Kashfian, B I , Horng, M , Fodstadt, 0 , and Scanlon, K. J. (1993) Suppression of EJ cells tumorigenicity In Vwo 7,47 11176 33 Kashani-Sabet, M., Funato, T., Tone, T , Jtao, L , Wang, W., Yoshida, E., Kashfinn, B. I., Shttara, T., Wu, A. M., Moreno, J. G., et al. (1992) Reversal of the malignant phenotype by an anti-ras nbozyme Antzsense Res Devel 2,3-15. 33. Bertram, J., Palmer, K., Ktlhan, M., Brysch, W., Schlingensiepen, K. H., Hiddemann, W., and Kneba, M (1995) Reversal of multiple drug resistance m vztro by phosphorothioate ohgonucleotides and nbozymes. Anti-Cancer Drugs 6, 124-134. 34 Kobayashi, H., Kim, N , Halatsch, M E , Ohnuma, T. (1994) Specificity of nbozyme designed for mutated DHFR mRNA. Blochem Pharmacol. 47,1607-l 6 13. 35. Kobayashi, H , Dorai, T., Holland, J F., and Ohnuma, T. (1994) Reversal of drug sensitivity in multidrug-resistant tumor cells by an MDRl (PGYl) ribozyme Cancer Res 54, 127 l-1275

Looney and Yu

484

36. Helm, P S., Scanlon, K J., and Dietel, M (1994) Reverston of multidrug resistance m the P-glycoprotein-positive human pancreatic cell lme (EPP85- 18 1RDB) by introductton of a hammerhead ribozyme. Br. J Cancer 70,23%243 37 Carlock, L , Gutridge, K , and Vo, T (1994) A Sau3A polymorphtsm m the 5’ end of the IT15 gene that nonrandomly segregates with the Huntington disease trrnucleotide expansion Hum Genet 93,457-459. 38 Kremer, B., Goldberg, P , Andrew, S. E., Thetlmann, J., Telenms, H., Zeisler, J , Squmert, F., Lin, B , Bassett, A., Almqvist, E , et al (1994) A worldwtde study of the Huntington’s disease mutation. The sensitivity and specificity of measuring CAG repeats N Engl. J A4ed 330,1401-1406 39 Goldberg, Y P , Telenms, H , and Hayden, M R (1994) The molecular genettcs of Huntington’s disease Curr Opmlon Neurol 7,325-332. 40 The European Polycysttc Kidney Disease Consortmm (1994) The polycysttc ktdney disease 1 gene encodes a 14 kb transcrtpt and lies wtthm a duplicated region on chromosome 16 Cell 77,88 l-894 4 1 Assoulme, L., Levy, E , Feoh-Fonseca, J. C., Godbout, C , and Lambert, M. (1995) Famthal hypercholesterolemta: molecular, btochemical, and clmtcal charactertzatton of a French-Canadian pediatric population Pedlatrrcs 96,239-246. 42 Wilson, J. M., Grossman, M., Raper, S E., Baker, J. R. Jr, Newton, R. S., and Thoene, J. G. (1992) Ex vzvo gene therapy of famihal hypercholesterolemta Hum Gene Ther 3, 179-222. 43 Lane, D. A., Olds, R J., and Them, S. L. (1994) Anttthrombin III* summary of first database update Nucleic Acids Res 22,3556-3559. 44. OJwang, J O., Hampel, A., Looney, D. J., Wong-Staal, F., and Rappaport, J (1992) Inhibition of human mnnunodeficrency vnus type 1 expression by a hatrpm ribozyme. Proc Nat1 Acad SCI USA 89, 10,802-10,806 45. Yu, M , OJwang, J., Yamada, O., Hampel, A., Rapapport, J., Looney, D., and Wong-Staal, F (1993) A hairpin ribozyme inhibits expresston of dtverse strains of human tmmunodeficiency virus type 1. Proc Natl. Acad Scl USA 90,63406344. [Published erratum appears m Proc Natl Acad Scz USA 90,8303] 46. Yamada, 0 , Yu, M., Yee, J. K., Kraus, G., Looney, D., and Wong-Staal, F. (1994) Intracellular immunization of human T-cells with a haupm rtbozyme against human mnnunodeficiency VU-UStype 1 Gene Ther 1,39-45. 47. Sun, L Q., Wang, L., Gerlach, W. L , and Symonds, G. (1995) Target sequencespecific mhtbmon of HIV-l rephcatton by ribozymes directed to tat RNA Nuclerc Acids Res. 23,2909-29 13. 48. Leavitt, M. C , Yu, M., Yamada, O., Kraus, G , Looney, D., Poeschla, E , and Wong-Staal, F. (1994) Transfer of an antt-HIV- 1 rtbozyme gene into primary human lymphocytes Hum Gene Ther 5,1115-l 120 49. Sun, L Q , Pyatt, J., Smythe, J., Wang, L , Macpherson, J., Gerlach, W , and Symonds, G. (1995) Resistance to human immunodeficiency vu-us type 1 infection conferred by transduction of human peripheral blood lymphocytes wtth rtbozyme, anttsense, or polymeric trans-acttvatton response element constructs. Proc Nat1 Acad Scl USA 92,7272-7276

Clinical Aspects

485

50 Yu, M., Leavttt, M. C., Maruyama, M , Yamada, O., Young, D., Ho, A D , and Wong-Staal, F (1995) Intracellular unmun~zation of human fetal cord blood stem/ progenitor cells with a ribozyme against human immunodefictency vnus type 1 Proc Natl. Acad Scz US A 92,699-703

5 1 Hoogerbrugge, P. M , von Beusechem, V W., Kaptem, L. C , Emerhand, M P , and Valerio, D. (1995) Gene therapy for adenosme deammase deficiency. Brat Med Bull 51,72-81 52 Cat, Q , Rubm, J T , and Lotze, M. T. (1995) Genetically marking human cells. results of the first clnncal gene transfer studies Cancer Gene Ther 2, 125-316 53 Miller, A R, Skotzko, M J , Rhoades, K., Belldegrun, A S , TSO, C L , Kaboo, R , McBride, W. H., Jacobs, E., Kohn, D. B , Moen, R , et al. (1992) Simultaneous use of two retroviral vectors m human gene marking trials feastbtltty and potential applications. Hum Gene Ther 3,619-624. 54. Foa, R (1994) Interleukm-2 and gene therapy m the management of acute lymphoblastic leukaemia Balllleres Clm Haematol 7,421-434. 55. Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) (1994) Fed Regcster 59, FR 34496 56. Guidelines for Research Involvmg Recombinant DNA Molecules (NIH Gutdelines) (1994) Amendment Fed Register 59, FR 40 170. 57. Guidelines for Research Involving Recombinant DNA Molecules (NIH Guidelines) (1995) Amendment. Fed Regrster 60, FR 20726 58 Collection of Leukocytes for Further Manufacturing. CBER January 198 1, G006, Congresstonal and Consumer Affairs Branch (HFM- 12), Rockvtlle, MD 208521448 (USA) 59 Uniform Labeling of Blood and Blood Components CBER, August 1985, GO10 Congressional and Consumer Affairs Branch (HFM-12), Rockville, MD. 208521448 (USA). 60. Guidelines for Adverse Experience Reporting for Licensed Biological Products. CBER, 1O/l 5/93, GO24 Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD. 20852-1448 (USA). 61 Points to Consider in Human Somatic Cell Therapy and Gene Therapy. CBER, 8/ 27/9 1, PO08. Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD. 20852- 1448 (USA) 62 Pomts to Consider m the Characterization of Cell Lines Used to Produce Biologicals CBER, 7/12/93, PO12 Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD 20852- 1448 (USA) 63 FDA’s Pohcy Statement Concerning Cooperative Manufacturing Arrangements for Licensed Biologics CBER, 1 l/25/92, FOOl. Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD 20852- 1448 (USA) 64. Application of Current Statutory Authorities to Human Somatic Cell Therapy Products and Gene Therapy Products CBER, 10/27/94, F007. Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD. 208521448 (USA)

486

Looney and Yu

65 Adverse Experience Reporting Requirements for Licensed Biological Products, Final Rule CBER, 10127194, F007. Congressional and Consumer Affairs Branch (HFM-12), Rockville, MD. 20852-1448 (USA). 66 Biotechnology Facthty Requirements, Part I-Facility & Systems Design. CBER, A002. Congressional and Consumer Affarrs Branch (HFM-12), Rockville, MD 20852-1448 (USA). 67 Biotechnology Facthty Requirements, Part II-Gperatmg Procedures and Vahdatton. CBER, A003. Congressional and Consumer Affairs Branch (HFM- 12), Rockville, MD. 20852-1448 (USA). 68. The National Task Force on AIDS Drug Development, Drug Development Subcommittee Gene Therapy IND Issues. September 13-14, 1995. Appendix. 69. Yu, M., Poeschla, E., Yamada, O., Degrandis, P , Leavitt, M. C , Heusch, M., Yees, J. K., Wong-Staal, F., and Hampel, A. (1995) In vztro and in vlvo characterization of a second functional hanpm nbozyme against HIV-l, Virology 206,381-386 70 Ho, D. D., Neumann, A. U., Perelson, A. S., Chen, W , Leonard, J M., and Markowrtz, M. (1995) Rapid turnover of plasma virions and CD4 lymphocytes m HIV- 1 infection. Nature 373, 123-l 26 71. Piatak, M Jr, Saag, M. S , Yang, L. C., Clark, S J , Kappes, J. C , Luk, K C , Hahn, B. H., Shaw, G. M., and Lifson, J. D. (1993) Hugh levels of HIV-l in plasma durmg all stagesof infection determmed by competitive PCR. Sczence259,1749-l 754

Ribozyme Protocols

Ribozyme Protocols

Antisense and Ribozyme Methodology: Laboratory Companion (Laboratory Companion Series)

Neuropeptide Protocols

Retinoid Protocols

Polyamine Protocols

Kinesin Protocols

Chaperonin Protocols

Glycovirology Protocols

Arabidopsis Protocols

Superantigen Protocols

p53 Protocols

Superantigen Protocols

HIV Protocols

Genomics Protocols

Polyamine Protocols

YAC Protocols

Immunochemical Protocols

Mycotoxin Protocols

Pesticide Protocols

Interleukin Protocols

GTPase Protocols

Kinesin Protocols

Bioconjugation Protocols

Genomics Protocols

Integrin Protocols

Integrin protocols

Flavoprotein Protocols

Genomics Protocols

Genomics Protocols

Ribozyme Protocols