Quality Assurance in the Pathology Laboratory: Forensic, Technical, and Ethical Aspects

Quality Assurance in the Pathology Laboratory Forensic, Technical, and Ethical Aspects © 2011 by Taylor and Francis G...

Author: J Bogusz Maciej | Maciej J. Bogusz

44 downloads 864 Views 4MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form

DOWNLOAD PDF

Quality Assurance in the

Pathology Laboratory Forensic, Technical, and Ethical Aspects

© 2011 by Taylor and Francis Group, LLC

Quality Assurance in the

Pathology Laboratory Forensic, Technical, and Ethical Aspects Edited by Maciej J. Bogusz

Boca Raton London New York

CRC Press is an imprint of the Taylor & Francis Group, an informa business


CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2011 by Taylor and Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business No claim to original U.S. Government works Printed in the United States of America on acid-free paper 10 9 8 7 6 5 4 3 2 1 International Standard Book Number: 978-1-4398-0234-2 (Hardback) This book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, please access www.copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com


Table of Contents

Preface Editor Contributors

vii ix xi

Part I Quality Assurance of Chemometric Methods and Pathology: Selected Topics

1

The Preanalytical Phase in Quality Assurance

3

Giuseppe Lippi and Gian Cesare Guidi

2

Quality Assurance of Point-of-Care and On-Site Drug Testing

15

James H. Nichols

3

Quality Assurance of Identification with Chromatographic–Mass Spectrometric Methods

45

Maciej J. Bogusz

4

Quality Assurance of Quantification Using Chromatographic Methods with Linear Relation between Dose and Detector Response Georg Schmitt and Rolf Aderjan


v

77

vi Table of Contents

Part II Quality Assurance Aspects of Newly Emerging Methods in Pathology and Laboratory Medicine

5

Pharmacogenomics, Personalized Medicine, and Personalized Justice Influencing the Quality and Practice of Forensic Science

93

Steven H.Y. Wong

6

Quality Aspects in Autopsy versus Virtopsy

121

Michael J. Thali and Stephan A. Bolliger

Part III Accreditation, Standards, and Education: Their Role in Maintaining Quality

7

Role of Accreditation Procedures in Maintaining Quality

139

Maciej J. Bogusz and Huda Hassan

8

Role of Governmental and Professional Organizations in Setting Quality Standards in Pathology and Laboratory Medicine and Related Areas

205

Maciej J. Bogusz

9

Education and Training in the Changing Environment of Pathology and Laboratory Medicine

289

Gian Cesare Guidi and Giuseppe Lippi

10

Quality Assurance Aspects of Interpretation of Results in Clinical and Forensic Toxicology

345

Katrin M. Kirschbaum and Frank Musshoff

Index © 2011 by Taylor and Francis Group, LLC

363

Preface

The real purpose of the scientific method is to make sure Nature hasn’t misled you into thinking you know something you don’t actually know. If you get careless or go romanticizing scientific information, giving it a flourish here and there, Nature will soon make a complete fool out of you. Pirsig (2000)

It is impossible to define “quality” in one sentence. The term has several definitions, each formulated according to different requirements and perspectives. According to the descriptive approach, quality may be seen as a set of wanted or unwanted features. Following are a few descriptive definitions of quality taken from www.businessdictionary.com and www.thefreedictionary.com: • Measurable and verifiable aspect of a thing or phenomenon, expressed in numbers or quantities, such as lightness or heaviness, thickness or thinness, softness or hardness. • Attribute, characteristic, or property of a thing or phenomenon that can be observed and interpreted, and may be approximated (quantified) but cannot be measured, such as beauty, feel, flavor, taste. • An inherent or distinguishing characteristic: a property or personal trait. According to the subjective and demanding approach, quality is seen as a set of features that should satisfy general expectations or particular requirements. This approach has been expressed in the following definitions: • Measure of excellence or state of being free from defects, deficiencies, and significant variations. • The totality of features and characteristics of a product or service that bears its ability to satisfy stated or implied needs (ISO 8402-1986). • Degree to which a set of inherent characteristics fulfill requirements. The standard defines “requirement” as need or expectation (ISO 9000-2005). From these examples, it may be seen that quality is related to particular human activities and cannot be unequivocally defined and easily measured.


vii

viii Preface

This is in agreement with the findings of some authors, as follows: “Quality refers to the amount of the unpriced attributes contained in each unit of the priced attribute” (Leffler, 1982); “Quality is neither mind nor matter, but a third entity independent of the two, even though Quality cannot be defined, you know what it is” (Pirsig, 2000). Irrespective of all definitions and views, the striving for good quality seems to be an intrinsic feature of the human mind and acting. This was reflected by the formulation of all “good practices,” such as GLP, GMP, GMLP, GCP, GCLP, and others. It is also obvious that achieving a certain quality is a moving target since it is related to requirements and expectations that change constantly. This book is divided into three parts. Part I deals with selected aspects of quality assurance of quantifiable methods that are applied in laboratory medicine and toxicology. Part II discusses the quality aspects of emerging disciplines—personalized therapy and virtopsy. The chapters in this part present regulatory and logistic instrumentation that ensure quality in laboratory methods. Part III reviews the quality of professional education at the graduate and postgraduate levels in pathology and laboratory medicine. The concept of this book is to provide a general insight into the quality assurance aspects of pathology and laboratory medicine. It should be helpful in improving laboratory work and, at the same time, should show the possibilities and limits of all logistic and legal tools related to quality issues. The chapters, written by authors who have long been involved in the theoretical and practical aspects of laboratory activity, cover the most relevant problems of quality assurance. However, they do not provide an encyclopedic view on quality issues. Rather, they should stimulate people involved to monitor their work closely and critically. The quality control of laboratory activities may be organized, but the quality itself cannot be achieved without commitment and constantly high expectations. I would like to express my gratitude to Becky Masterman and Patricia Roberson from Taylor & Francis for their continuous support, patience, and help during the writing and preparation of this book. Maciej J. Bogusz

References Leffler, K.B. Ambiguous changes in product quality, American Economic Review, 72, 956–967, December 1982. Pirsig, R.M. Zen and the Art of Motorcycle Maintenance, Harper Perennial, New York, 2000.


Editor

Maciej J. Bogusz is currently a senior clinical scientist at the Royal Clinic in Riyadh, Saudi Arabia. His scientific interests include the pharmacology and toxicology of illicit drugs and their active metabolites, and the application of modern analytical methods (particularly liquid chromatography-mass spectrometry [LC-MS]) in clinical and forensic toxicology. He is an internationally recognized expert in this area. Dr. Bogusz has additionally performed several studies on the toxicological aspects of herbal remedies. Recently, he developed several methods concerning therapeutic drug monitoring of Â�clinically relevant drugs (i.e., immunosuppressants) using LC-MS. Dr. Bogusz graduated as a physician from Copernicus University School of Medicine in Krakow, Poland, in 1963. In his professional career, he was a research scientist at the Institute of Forensic Research in Krakow and chief toxicologist at the Institute of Forensic Medicine in Krakow. He was board certified in clinical chemistry and forensic medicine in Poland. Since 1986, he has been working in Germany as a Privat-Dozent at the Institute of Legal Medicine at the Ruprecht-Karl University of Heidelberg. He is a diplomate of the German Board of Forensic Toxicologists. From 1990 until 2000, he worked at the Institute of Forensic Medicine at the Aachen University of Technology (RWTH) as a professor of forensic and clinical toxicology. In 2000, he joined the Toxicology Laboratory at the King Faisal Specialist Hospital and Research Centre in Riyadh and later the Royal Toxicology Laboratory. Dr. Bogusz is the author of over 160 original publications in international journals and 8 book chapters and is the editor of 2 books. He is a member of numerous scientific toxicological organizations, such as the International Association of Forensic Toxicologists, the International Association of Therapeutic Drug Monitoring and Clinical Toxicology, the Forensic Science Society, the German Society of Forensic Toxicology and Chemistry, and the Society of Forensic Toxicologists. His name is included in several scientific encyclopedias such as Marquis Who’s Who in the World, 1980–1981, 1993– 1994, 2003; Man of Achievement, St. Ives, U.K.; Who’s Who of Contemporary Achievement, Cambridge, U.K.; and in Who’s Who of German Medicine— Most Frequently Cited German Scientists (Vless Verlag 1995).


ix

Contributors

Rolf Aderjan

Giuseppe Lippi

Maciej J. Bogusz

and

Institute of Legal Medicine and Traffic Medicine Ruprechts-Karl University Heidelberg, Germany

Faculty of Medicine and Surgery Department of Life and Reproduction Sciences University of Verona Verona, Italy

Royal Toxicology Laboratory Royal Clinics Riyadh, Kingdom of Saudi Arabia

Department of Pathology and Laboratory Medicine University Hospital of Parma Parma, Italy

Stephan A. Bolliger

Department of Forensic Medicine Institute of Forensic Medicine University of Bern Bern, Switzerland

Frank Musshoff

Institute of Forensic Medicine Rheinische Friedrich-Wilhelms-University Bonn, Germany

Gian Cesare Guidi

Faculty of Medicine and Surgery Department of Life and Reproduction Sciences University of Verona Verona, Italy

James H. Nichols

Faculty, School of Medicine Tufts University Boston, Massachusetts and

Huda Hassan

Clinical Chemistry Baystate Health Springfield, Massachusetts

Department of Forensic Medicine and Science University of Glasgow Glasgow, Scotland, United Kingdom

Georg Schmitt

Katrin M. Kirschbaum

Institute of Legal Medicine and Traffic Medicine Ruprechts-Karl University Heidelberg, Germany

Institute of Forensic Medicine Rheinische Friedrich-Wilhelms-University Bonn, Germany


xi

xii

Michael J. Thali

Center of Forensic Imaging and Virtopsy Institute of Forensic Medicine University of Bern Bern, Switzerland

Steven H.Y. Wong

Pathology Department Medical College of Wisconsin


Contributors and Toxicology Department and Pharmacogenomics Milwaukee County and Drug Evaluation Laboratory Wisconsin Community Services Milwaukee, Wisconsin

Quality Assurance of Chemometric Methods and Pathology: Selected Topics


I


1

Giuseppe Lippi and Gian Cesare Guidi

Contents 1.1 Introduction 1.2 Medical and Diagnostic Errors 1.3 Overview on Diagnostic Errors 1.4 The Preanalytical Variability 1.5 Prevention and Management of Preanalytical Errors 1.6 Conclusions References

3 3 5 7 8 11 11

1.1â•‡Introduction Laboratory diagnostics is an essential part of the clinical decision making because it substantially contributes to the clinical decision making by providing valuable information for the screening, diagnosis, therapeutic monitoring, and follow-up of most—if not all—human disorders. Several changes have occurred in the organization of laboratory diagnostics over the past decades, mainly driven by the widespread introduction of point-of-care testing, centralization of activities in large core laboratories, as well as the increase in number and complexity of diagnostic testing worldwide. As such, laboratory diagnostics, and likewise other medical disciplines, are not as safe as they should be.

1.2â•‡Medical and Diagnostic Errors Several former studies on patients’ safety published in the 1990s drew attention to the fact that potentially serious medical errors (over half of which are preventable) can occur in the medical care with a relatively high frequency (i.e., up to 7%) and cost the healthcare system a huge amount of money (e.g., between $17 and $29 billion a year in the United States) [1,2]. This striking evidence led the U.S. Institute of Medicine (IOM) to release the foremost report “To Err is Human,” where it was clearly reported that as many as © 2011 by Taylor and Francis Group, LLC

3

4

Quality Assurance in the Pathology Laboratory

98,000 people die each year needlessly due to preventable medical harm [3], the equivalent of three jumbo-jet crashes every 2 days [4]. After the publication of “To Err is Human,” both the IOM and the U.S. government recognized the urgent need to establish firm actions to be proactive for reducing this otherwise concerning estimate of preventable harms to the patients, paving the way to the publication of a second report in 2001, entitled “Crossing the Quality Chasm: A New Health Care System for the 21st Century” [5]. In this document, the IOM reinforced the call for fundamental change to close the quality gap in healthcare, recommending also a radical redesign of the U.S. healthcare system based on a set of 10 new rules to guide patient– clinician relationships, a recommended organizing framework to harmonize the efforts in payment and accountability with improvements in quality. In the same year, the World Health Organization supported the institution of the “World Alliance for Patient Safety,” aimed at facilitating the development of patient-safety policy and practice in all member states. Irrespective of the remarkable attention placed on patient safety in the following years, in 2009, the consumers’ union released a further document entitled “To Err is Human—To Delay Is Deadly,” concluding that “ten years later—the publication of To Err is Human—a million lives lost, billions of dollars wasted” [6]. This expert, independent, nonprofit U.S. organization underlined that it is impossible to establish whether real progresses have been made in the field of patient safety. On the contrary, due to the poor transparency and little to null awareness and public reporting of medical errors, no significant reduction has occurred in the burden of preventable medical errors, which still account for more than 100,000 deaths yearly. Although various descriptions exist for “medical error,” three reasonable and similar definitions have been provided by Reason (failure of a planned sequence of mental or physical activities to achieve its intended outcome when these failures cannot be attributed to chance) [7], Leape (unintended act [either omission or commission] or an act that does not achieve its intended outcome) [4], and the IOM (the failure of a planned action to be completed as intended—that is a error of action—or the use of a wrong plan to achieve an aim—that is an error of intention—) [3]. The area of agreement among all these interpretations is the exclusion of natural history of disease, as well as of the predictable complications of a correctly performed medical procedure, from the adverse outcome. The IOM also classifies medical errors according to four clinical path categories: “diagnostic,” “treatment,” “prevention,” and “others.” As such, while medical errors are traditionally perceived as a wrong therapeutic action (e.g., wrong site surgery, administration of the wrong drug to the right patient or vice versa, blood incompatibility, development of an otherwise preventable medical complication such as venous thromboembolism or hospital-acquired infection), diagnostic errors have instead a great dignity in the daily practice, inasmuch as in © 2011 by Taylor and Francis Group, LLC


5

vitro diagnostics and imaging studies contribute for up to 70% to the clinical decision making.

1.3â•‡Overview on Diagnostic Errors The most reliable definition of diagnostic error is that provided by the U.S. Agency for Healthcare Research and Quality, as “… any mistake or failure in the diagnostic process leading to a misdiagnosis, a missed diagnosis, or a delayed diagnosis” [8]. This definition encompasses any failure in timely access to care; elicitation or interpretation of symptoms, signs, or laboratory results; formulation and weighing of differential diagnosis and timely Â�follow-up; and specialty referral or evaluation [9]. As regards laboratory errors, the most suitable definition is that originally endorsed by Bonini et al. as “a diagnosis that is missed, wrong, or delayed, as detected by some subsequent definitive test or finding,” which has been further acknowledged and adopted by the ISO Technical Report 22367, as “a defect occurring at any part of the laboratory cycle, from ordering tests to reporting, interpreting, and reacting to results” [10]. According to these definitions, the unique framework for considering where mistakes can occur in laboratory testing services is obviously the total testing process, so that mistakes can occur in each of its various steps or in any of the places where a handoff can occur, starting from test request and ending with the physician’s reaction to laboratory data, according to the foremost Lundberg’s “brain-to-brain” loop. A recent survey administered at 20 grand rounds presentations across the United States and by mail at two collaborating institutions overviewed diagnostic errors, describing their causes, seriousness, and frequency. After exclusion of cases lacking sufficient details were excluded, 583 errors were identified, 162 (28%) of which were rated as major, 241 (41%) as moderate, and 180 (31%) as minor or insignificant. The most common missed or delayed diagnoses were related to pulmonary embolism (4.5%), drug reactions or overdose (4.5%), lung cancer (3.9%), colorectal cancer (3.3%), acute coronary syndrome (3.1%), breast cancer (3.1%), and stroke (2.6%). More interestingly, most errors occurred in the testing phase (failure to order, report, and follow-up laboratory results) (44%), followed by clinician assessment errors (failure to consider and overweighing competing diagnosis) (32%), history taking (10%), physical examination (10%), and referral or consultation errors and delays (3%). As regards laboratory errors, the most frequent occurrences were failure/delay in ordering needed test/s, erroneous laboratory reading of test, failed or delayed reporting of result/s to clinicians, failed or delayed follow-up of (abnormal) test results, technical errors or poor processing of specimen/test and sample mixup or mislabeled (e.g., wrong patient/test) [9]. © 2011 by Taylor and Francis Group, LLC

6


Although it is difficult—if not impossible—to provide a real estimation of laboratory errors due to a variety of causes (e.g., underestimation of the problem, underreporting, huge organizational heterogeneity among different countries and facilities, the lack of an universal approach for identification and reporting), mistakes in laboratory diagnostics can occur with an overall frequency of 0.1%–0.3% “events,” 0.1%–0.5% patients, and 0.01%– 0.5% test results [11]. While these numbers appear innocent as compared with the error rate in other medical areas, they become otherwise significant considering the huge amount of tests that each laboratory performs in the daily practice. For example, translating these estimates to the activity of a medium-sized laboratory (e.g., performing 3 millions exams per year), the number of testing errors per day would range between 82 and 247. All these potential problems and errors have a strong influence on patient outcome and healthcare expenditures, so that interventions targeted at reducing uncertainties within the laboratory diagnostics would offer a great potential benefit for improving total quality in laboratory medicine. Although it is reportedly difficult to associate a diagnostic error to an adverse health outcome, within certain areas of testing, especially coagulation testing [12], the consequences of laboratory mistakes might be serious, especially for those considered as “diagnostic.” Patients might hence be diagnosed with a particular condition, when in fact they do not have it (i.e., a “false positive” result), or else a patient with a real pathology might be missed (i.e., a “false negative” result). Some foremost investigations on adverse events related to laboratory errors attest that 9%–15% of laboratory errors might negatively impact on patient care, with the risk of inappropriate care being estimated between 2% and 7%, thereby higher than, or equal to, many other nonmedical activities [11]. Plebani and Carraro also concluded that while most of the laboratory mistakes (74%) might not affect patient outcomes, in 19% of the patients, they might be associated with further inappropriate investigations and unjustifiable increase in costs, whereas in 6.4% of the patients, they might be associated with inappropriate care or inappropriate modification of therapy [13]. Within the healthcare, laboratory medicine has been foremost in achieving awareness of diagnostic errors and pursuing the issue of patient safety by focusing notable efforts on quality control methods and quality assessment programs dealing with analytical aspects of testing over the past century. In the early 1920s, the American Society of Clinical Pathologists, the precursor of the current College of American Pathologist (CAP), had already started a voluntary proficiency testing program focused on analytical quality [14]. In the following years, the CAP promoted several studies and investigations to collect and analyze results on a variety of performance measures, including magnitude and significance of errors, strategies for error reduction, and willingness to implement each of these performance measures [15]. As such, the analytical uncertainty in the total testing process has been drastically © 2011 by Taylor and Francis Group, LLC


7

reduced during these years, while other extra-analytical activities have been partially or completely ignored, thereby becoming progressively the areas of major uncertainty in laboratory diagnostics. A growing body of evidence accumulated in recent years demonstrates in fact that errors occur more frequently before (preanalytical) and after (postanalytical) the test has been performed. Most errors are due to preanalytical factors (46%–68.2% of total errors), though a high error rate (18.5%–47% of total errors) has also been observed in the postanalytical phase [13]. In particular, the manually intensive activities of the preanalytical phase are those characterized by the highest possible degree of understandardization and vulnerability throughout the total testing process [16–20].

1.4â•‡ The Preanalytical Variability Until in vivo measurements will translate from theory to practice and thereby become widely available, laboratory diagnostics would only be possible after collecting suitable and representative biological specimens. As such, any single step of the preanalytical phase carries an inherent hazard and may hide the possibility of an error. There is increasing awareness, therefore, that further improvements in the total quality and efficacy of laboratory diagnostics should outstrip the traditional borders of the clinical laboratory, embracing those neglected activities (i.e., sample collection, handling, and storage) that lie outside the walls of the traditional clinical laboratory and in fact add value to the diagnostic performance [16–20]. Regardless of the high impact of preanalytical mistakes on total quality in laboratory diagnostics, there is a considerable difference between in- and outpatients error rates (i.e., from 2 to 10 times higher in the former case), which has been attributed to human factors related to skill in drawing blood, major standardization in procedures of outpatients clinics under the authority of laboratory professional, and the sheer amount of laboratory usage for inpatients. Overall, inappropriate quality and quantity of specimen account for over 60% of the preanalytical errors. Data from the most representative studies on this issue consistently show that problems directly related to the collection of the biological specimens are the leading causes of preanalytical variability, including hemolyzed (54%), insufficient (21%), incorrect (13%), and clotted (5%) samples [21]. In vitro hemolysis, in particular, which mirrors a more generalized process of blood and vascular cell damage occurring during phlebotomy rather than in vivo hemolysis, is the most frequent reason for specimen rejection, five times more frequent than the next one (insufficient specimen quantity) [22]. In hematological and coagulation testing, clotted specimens are also a frequent reason for rejection, whereas a wrong container or an insufficient sample has the highest frequency of rejection in © 2011 by Taylor and Francis Group, LLC

8


pediatrics [23,24]. Additional problems, such as incorrect sample identification or handling, might occur beyond the blood drawing process, though their prevalence is reportedly much lower, because in most cases, it would go undetected. While misidentification of general laboratory specimens is estimated to represent ∼1% of all diagnostic errors, it can produce the most serious harm to the patient, when not promptly detected. As such, by extrapolation of the adverse event rate to all U.S. hospital-based laboratories, more than 160,000 adverse events per year can be expected from misidentification of patients’ laboratory specimens [25]. A higher prevalence of errors is frequently observed in samples referred from pediatric and emergency departments and, expectedly, the frequency distribution of specific preanalytical problems is different among the hospital wards. Specimens not received prevail from the emergency care units, surgical and clinical departments, whereas clotted and hemolyzed specimens are frequently referred from pediatric and emergency departments, respectively [23,24]. These epidemiological observations have a plausible explanation, because most of the preanalytical activities are still manually intensive, more vulnerable to human errors, and fall outside the control of laboratory professionals.

1.5â•‡ Prevention and Management of Preanalytical Errors One concept that should be clearly affirmed when dealing with medical errors, laboratory errors, as well as preanalytical errors is that there is no magic bullet to solve all the problems. Actually, a drastic solution might be conjectured, that is, the elimination of all those processes more vulnerable to errors and uncertainty. As mentioned previously, however, this is practically unfeasible because preanalytical activities still are—and will remain for long—almost necessary steps for obtaining suitable samples for testing. As such, the most reliable strategy to reduce uncertainty and contextually errors in this unavoidable step of the total testing process is to establish a multifaceted strategy entailing (1) prediction/prevention of accidental events through exhaustive process analysis, reassessment and rearrangement of quality requirements, dissemination of operative guidelines and best-practice recommendations, reduction of complexity and error-prone activities, introduction of error-tracking systems, and continuous monitoring of performances; (2) increasing and diversifying defensive mechanisms and barriers through application of multiple and heterogeneous systems to identify nonconformities; and (3) decreasing the overall vulnerability of the system through implementation of reliable and objective detection systems and causal relation charts, education, and training [18,20]. First and foremost to succeeding in this process is the introduction of process analysis and root cause analysis (RCA). The lesson learned from © 2011 by Taylor and Francis Group, LLC


9

improvement methodologies applied to other contexts (i.e., industrial production) such as six sigma and lean management have valuable applications for reducing time and errors required to complete an operation or production and might therefore be suitable options for reorganizing the activities of clinical laboratories as well. Since all human failures, including medical errors, do have a preceding cause, RCA is a valuable aid, since it is based on a retrospective analytical approach, which has found broad applications to investigate major industrial accidents [26]. Basically, RCA focuses on identifying the latent conditions that underlie variation in medical performance and, if applicable, developing recommendations for improvements to decrease the likelihood of a similar incident in the future. The failure mode and effect analysis (FMEA) is increasingly quoted as a reliable tool for risk management, which was originally developed by the U.S. Army and further introduced in aerospace and automobile industry. It is based on a systematic process for identifying potential process failures before they occur, making it possible to recognize potential solutions that will eliminate or minimize the inherent hazards. This model has been modified and simplified by the U.S. Department of Veteran Affairs. National Center for Patient Safety developed a simplified version of FMEA (HFMEA) for implementation in health care [27]. Whatever the solution adopted, this approach encompasses clear problem understanding, feasibility study, requirements engineering, developmental design, and compliance with established laboratory standards issued by certification or accreditation agencies. As such, the use of these tools would entail a greater familiarity and comprehension of how a particular preanalytical activity develops, a comprehensive description of duties and responsibilities, and establishment of safety requirements and performance indicators integrated within the development of the system, aimed at reducing latent and potentially active failures. The second step is the continuous education of the healthcare staff, inside and especially outside the laboratory. Considering that most preanalytical steps take place before the specimens arrive within the laboratory environment [17], dissemination of best practices (e.g., quality manuals) for collection and handling of biological specimens is foremost, along with widespread introduction of certification procedures for the healthcare personnel deputed to collect biological samples [28,29]. The information to be provided to all the operators involved in responsibilities of collection and handling of the specimens includes clear concepts on preanalytical variables such as time of sampling, biological variability, posture, tourniquet application, collection tools, order of draw, procedures for handling, transportation and storage of specimens, indications on the effect of at least commonly encountered influence and interference factors. The third useful step is discontinuation or reduction of those (human) preanalytical activities more vulnerable to errors and uncertainty. Although © 2011 by Taylor and Francis Group, LLC

10


very little can be done to automate the phase of blood collection thus far, multiple and multifaceted forms of automation are instead emerging in multiple steps of the total testing process, including the preanalytical phase. Automation has the potential to rationalize the workflow, reduce the stress, decrease the burden of manual errors, as well as ensure a greater degree of safety for the operators. Computerized physician order entry, automatic preparation of sample collections tools with pre-labeling of primary tubes, positive patient identification (by traditional barcodes, smart cards, radio-frequency identification, optical character recognition, or voice recognition devices), “active tubes” (e.g., “lab-on-a-chip integrated containers” storing patient data and measuring physiological—temperature/humidity/flow rate—and metabolic data—glucose concentration), automatic transport systems (i.e., pneumatic tubes conveyer, robots), and preanalytical workstations all are valuable options that would limit or replace manually intensive procedures and therefore the chance of human errors throughout these activities [18,20]. The fourth crucial step is the implementation of a comprehensive risk management strategy, focused on what, why, where, and when problems may arise and what can be done to avoid, tolerate, or reduce their adverse outcomes. Preliminarily, this strategy requires identification and implementation of specific, detailed, and reliable error detection systems based on performance indicators that would monitor most—if not all—of the critical steps, reducing risks and preventing undesirable conditions [30,31]. Although we all know that measuring and especially reporting errors is not so simple, nor pleasing and gratifying, a starting point must be established. The recent project “Model of Quality Indicator,” undertaken by the Working Group, “Laboratory Errors and Patient Safety (WG-LEPS)” instituted by the division of Education and Management (EMD) of the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) must be regarded as a foremost foundation to promote and encourage investigations into errors in laboratory medicine, collect data available on this issue, and recommend strategies and procedures for improving patient safety [32]. The logic consequence is furthermore the selection of those laboratory events arising transversally across the total testing process that are more closely associated with a real (severe) harm for the patient. As such, development and implementation of “sentinel events” besides those traditionally used in general medicine and surgery i.e., is a suitable approach, since it would allow to gain new knowledge about incidents and hold both providers and stakeholders much more accountable for patient safety [33,34]. The final step is the translation of the valuable concepts of internal quality control (IQC) and external quality assessment (EQA) to the preanalytical phase. Although this is not expected to be easy, there are already some valuable examples that an EQA program expressly developed for the preanalytical phase is feasible and useful. Since 1998, the Sociedad Española © 2011 by Taylor and Francis Group, LLC


11

de Bioquímica Clínica y Patología Molecular (SEQC) has developed an EQA program for the preanalytical phase, focused on the analysis of causes for rejection of samples usually collected in clinical laboratories. The participants are asked to record the number and causes for rejection of routine and/or stat samples encountered in their laboratories. Data gathered throughout 10 blood cycles for the preanalytical phase have also been analyzed already, demonstrating that this approach might provide laboratories with a useful tool for an easier follow-up of their state of the art and, incidentally, allowing them to implement continuous improvement [35]. Most recently, a multicenter evaluation of the hemolysis index (HI) as an indicator of preanalytical quality has been carried out to investigate the feasibility of establishing an EQA for the management of hemolytic specimens across different clinical laboratories in Europe [36]. Reference sera containing varying amounts of spiked hemolyzed blood were shipped to seven separate laboratories and the HI was tested in triplicate. Noticeably, a good agreement of measurements was recorded among the various laboratories, and the discrepancies were further attenuated by normalizing results according to instrument-specific alert values, thus proving the tangible benefits of this program [36,37].

1.6â•‡ Conclusions Laboratory professionals are familiar with the concept of product security, which is basically concerned with avoiding vulnerabilities intrinsic to a manufactured item, such as a specific analyzer. Unfortunately, this is not enough for ensuring total quality in laboratory diagnostics [38]. While compliance with cost-containment policies worldwide has forced laboratory professionals to reorganize structures and activities, the increasing awareness of the complexity of the total testing process and the availability of technological advances are both paving the way to radically increase accuracy and safety, enabling quality intervention and monitoring in all the multifaceted activities of the preanalytical phase, as well as benchmarking quality of healthcare facilities and professionals with blood collection responsibilities.

References 1. Lazarou J, Pomeranz BH, and Corey PN. Incidence of adverse drug reactions in hospitalized patients: A meta-analysis of prospective studies. JAMA 1998; 279:1200–1205. 2. Berwick DM and Leape LL. Reducing errors in medicine. BMJ 1999; 319:136–137. 3. Kohn KT, Corrigan JM, and Donaldson MS. To Err Is Human: Building a Safer Health System. Washington, DC: National Academy Press, 1999. 4. Leape LL. Error in medicine. JAMA 1994; 272:1851–1857. © 2011 by Taylor and Francis Group, LLC

12


5. Institute of Medicine. Crossing the Quality Chasm: A New Health Care System for the 21st Century. Washington, DC: National Academy Press, 2001. 6. Consumers Union. To Err is Human—To Delay is Deadly. Available at: http:// www.safepatientproject.org/2009/05/to_err_is_humanto_delay_is_dea.html (last accessed January 12, 2010). 7. Reason J. The nature of error. In: Reason J, ed. Human Error. New York: Cambridge University Press, 1990. pp. 1–18. 8. Schiff GD, Kim S, Abrams R et al. Diagnosing diagnostic errors: Lessons from a multi-institutional collaborative project. In: Advances in Patient Safety: From Research to Implementation, vol. 2. Agency for Healthcare Research and Quality Web site. www.ahrq.gov/qual/advances (accessed January 12, 2010). 9. Schiff GD, Hasan O, Kim S, Abrams R, Cosby K, Lambert BL, Elstein AS et al. Diagnostic error in medicine: Analysis of 583 physician-reported errors. Arch. Intern. Med. 2009; 169:1881–1887. 10. ISO/PDTS 22367. Medical laboratories: Reducing error through risk management and continual improvement: Complementary element. 11. Plebani M. Errors in clinical laboratories or errors in laboratory medicine? Clin. Chem. Lab. Med. 2006; 44:750–759. 12. Favaloro EJ, Lippi G, and Adcock DM. Preanalytical and postanalytical variables: The leading causes of diagnostic error in hemostasis? Semin. Thromb. Hemost. 2008; 34:612–634. 13. Plebani M and Carraro P. Mistakes in a stat laboratory: Types and frequency. Clin. Chem. 1997; 43:1348–1351. 14. Hilborne LH, Lubin IM, and Scheuner MT. The beginning of the second decade of the era of patient safety: Implications and roles for the clinical laboratory and laboratory professionals. Clin. Chim. Acta 2009; 404:24–27. 15. Raab SS. Improving patient safety through quality assurance. Arch. Pathol. Lab. Med. 2006; 130:633–637. 16. Lippi G, Guidi GC, Mattiuzzi C, and Plebani M. Preanalytical variability: The dark side of the moon in laboratory testing. Clin. Chem. Lab. Med. 2006; 44:358–365. 17. Lippi G, Salvagno GL, Montagnana M, Franchini M, and Guidi GC. Phlebotomy issues and quality improvement in results of laboratory testing. Clin. Lab. 2006; 52:217–230. 18. Lippi G and Guidi GC. Risk management in the preanalytical phase of laboratory testing. Clin. Chem. Lab. Med. 2007; 45:720–727. 19. Lippi G, Fostini R, and Guidi GC. Quality improvement in laboratory medicine: Extra-analytical issues. Clin. Lab. Med. 2008; 28:285–294. 20. Lippi G. Governance of preanalytical variability: Travelling the right path to the bright side of the moon? Clin. Chim. Acta 2009; 404:32–36. 21. Lippi G, Bassi A, Brocco G, Montagnana M, Salvagno GL, and Guidi GC. Preanalytic error tracking in a laboratory medicine department: Results of a 1-year experience. Clin. Chem. 2006; 52:1442–1443. 22. Lippi G, Blanckaert N, Bonini P, Green S, Kitchen S, Palicka V, Vassault AJ, and Plebani M. Haemolysis: An overview of the leading cause of unsuitable specimens in clinical laboratories. Clin. Chem. Lab. Med. 2008; 46:764–772.



13

23. Salvagno GL, Lippi G, Bassi A, Poli G, and Guidi GC. Prevalence and type of pre-analytical problems for inpatients samples in coagulation laboratory. J. Eval. Clin. Pract. 2008; 14:351–353. 24. Lippi G, Bassi A, Solero GP, Salvagno GL, and Guidi GC. Prevalence and type of preanalytical errors on inpatient samples referred for complete blood count. Clin. Lab. 2007; 53:555–556. 25. Lippi G, Blanckaert N, Bonini P, Green S, Kitchen S, Palicka V, Vassault AJ, Mattiuzzi C, and Plebani M. Causes, consequences, detection, and prevention of identification errors in laboratory diagnostics. Clin. Chem. Lab. Med. 2009; 47:143–153. 26. Reason JT. Human Error. New York: Cambridge University Press, 1990. 27. DeRosier J, Stalhandske E, Bagian JP, and Nudell T. Using health care failure mode and effect analysis: The VA national center for patient safety’s prospective risk analysis system. Joint Comm. J. Qual. Improv. 2002; 5:248–267. 28. Lippi G, Salvagno GL, Montagnana M, and Guidi GC. The skilled phlebotomist. Arch. Pathol. Lab. Med. 2006; 130:1260–1261. 29. Lippi G, Mattiuzzi C, and Guidi GC. Laboratory quality improvement by implementation of phlebotomy guidelines. MLO Med. Lab. Obs. 2006; 38:6–7. 30. Simundic AM and Topic E. Quality indicators. Biochem. Med. 2008; 18:311–319. 31. Lippi G and Guidi GC. Preanalytic indicators of laboratory performances and quality improvement of laboratory testing. Clin. Lab. 2006; 52:457–462. 32. Sciacovelli L and Plebani M. The IFCC working group on laboratory errors and patient safety. Clin. Chim. Acta 2009; 404:79–85. 33. Lippi G, Mattiuzzi C, and Plebani M. Event reporting in laboratory medicine. Is there something we are missing? MLO Med. Lab. Obs. 2009; 41:23. 34. Lippi G and Plebani M. The importance of incident reporting in laboratory diagnostics. Scand. J. Clin. Lab. Invest. 2009; 69:811–813. 35. Alsina MJ, Alvarez V, Barba N, Bullich S, Cortés M, Escoda I, and Martínez-Brú C. Preanalytical quality control program—An overview of results (2001–2005 summary). Clin. Chem. Lab. Med. 2008; 46:849–854. 36. Plebani M and Lippi G. Hemolysis index: quality indicator or criterion for sample rejection? Clin. Chem. Lab. Med. 2009; 47:899–902. 37. Lippi G, Luca Salvagno G, Blanckaert N, Giavarina D, Green S, Kitchen S, Palicka V, Vassault AJ, and Plebani M. Multicenter evaluation of the hemolysis index in automated clinical chemistry systems. Clin. Chem. Lab. Med. 2009; 47:934–939. 38. Plebani M and Lippi G. To err is human. To misdiagnose might be deadly. Clin. Biochem. 2010; 43:1–3.



2

James H. Nichols

Contents Abbreviations 2.1 Point-of-Care Testing Definition 2.2 On-Site Drug Testing Methodologies 2.3 Quality Assurance versus Quality Control 2.4 Quality Management System Essentials 2.5 The Role of the Laboratory Director 2.6 Quality Control 2.7 Laboratory Quality Control Based on Risk Management 2.8 Developing a Quality Control Plan for a POC Drug Test 2.9 Summary References

15 15 17 21 22 29 31 33 36 43 43

Abbreviations CAP CLIA 88 CLSI CMS COLA FDA ISO MDMA POC SAMHSA

College of American Pathologists Clinical Laboratory Improvement Amendments of 1988 Clinical and Laboratory Standards Institute Centers for Medicaid and Medicare Services Commission on Office Laboratory Accreditation U.S. Food and Drug Administration International Organization for Standardization 3,4-Methylenedioxymethamphetamine Point-of-care Substance Abuse and Mental Health Services Administration

2.1â•‡ Point-of-Care Testing Definition Point-of-care (POC) testing is defined as clinical laboratory testing conducted close to the site of patient care, typically by clinical personnel whose © 2011 by Taylor and Francis Group, LLC

15

16


primary training is not in the clinical laboratory sciences or by patients (self-testing) [1]. POC testing is essentially any laboratory testing conducted outside the central or core laboratory. In the context of drug testing, POC testing can refer to laboratory tests conducted in a satellite laboratory, physician’s office, pain management clinic, pharmacy clinic, rehabilitation center, prison, sports program, or other location where drug testing results are needed to assess patient status. POC testing may be conducted in stationary locations or in mobile transport vehicles, like helicopters, ambulances, cruise ships, and even the space shuttle. This type of testing is sometimes referred to as on-site, near-patient, ancillary, bedside, remote, or satellite laboratory testing. POC testing may involve simple single-use testing devices or may be conducted on more complex laboratory instrumentation. A variety of staff may be involved in performing POC testing. It cannot only be conducted by physicians, nurses, psychiatrists, and other clinical staff but may also be conducted by coaches, police officers, and staff with minimal medical knowledge or formal laboratory experience or training. This raises concern over the reliability of test results conducted by staff with little experience or training. POC drug testing may be performed for forensic (legal) reasons or for clinical management. Drug testing can be conducted in prisons and by police officers to detect the use of prescription and illegal drugs with the intent of prosecuting the person. Businesses may require drug testing after accidents as part of the investigation of on-the-job injuries. Companies also require pre-employment drug screening of job candidates to detect drug use prior to employment. Rehabilitation and pain management clinics may conduct drug testing to ensure that patients are compliant with their program and not selling medications or continuing abuse. Sports programs may conduct testing on athletes to detect banned substances or use of drugs that may enhance performance. In general, forensic drug testing requires confirmation of screening tests by mass spectrometry or another alternate methodology that is legally defensible. A screening test is generally a broad-spectrum immunoassay or other test that can quickly assess a large number of samples for the presence or absence of a number of drugs. Confirmatory testing is more specific and can provide a definitive test result for individual drugs or drug classes. Confirmatory testing is often more labor intensive and takes longer for results than rapid screening methods. For this reason, simple screening tests may be performed on-site to determine initial reactivity, followed by confirmatory testing of reactive samples. Confirmatory testing is generally performed in a central or reference laboratory specializing in drug testing and mass spectrometry. Prosecution of individuals for driving under the influence, expulsion of athletes from a competitive sporting event, and removing a patient from a rehabilitation or pain management program for noncompliance with © 2011 by Taylor and Francis Group, LLC


17

medication contracts all require definitive test results by a confirmatory method. On the other hand, clinical treatment decisions need to be made more rapidly than the availability of confirmation testing and are often made in conjunction with the patient’s symptoms. Such management, based on screening tests alone, is common in hospital and emergency room settings and can be acceptable provided that physicians understand the limitations of screening methods.

2.2â•‡On-Site Drug Testing Methodologies On-site drug testing is a screening test intended to initially detect the presence or absence of selected drugs and drug classes in the patient’s sample. If the test result is intended for forensic purposes, the specimen will need to be confirmed by a different methodology, most likely gas chromatography mass spectrometry. Clinical utilization of the test results may or may not require confirmation testing, depending on the patient’s symptoms, the clinical history, and the specific case scenario. When confirmatory testing is required, locations that cannot perform confirmatory testing on-site will need to send the specimen to another laboratory where confirmatory testing can be performed. Transport of forensic samples additionally requires chainof-custody paperwork to ensure documentation of specimen handling and control of the specimen before, during, and after analysis. On-site drug testing can be conducted using laboratory instrumentation or simple POC testing kits. Analysis of specimens using laboratory instrumentation requires dedicated space since most laboratory instrumentation is large, heavy, and not intended to be moved. Laboratory instrumentation can conduct urine testing for a variety of drugs of abuse as well as therapeutic drug monitoring levels in serum/plasma for a number of drugs, including antiepileptics, antidepressants, immunosuppressants, antibiotics, and other medications. This chapter will focus on the quality assurance of portable, single-use drug tests that can be conducted in many locations by a number of different individuals for the purposes of rapidly screening patients for drug use. Results of such tests can be utilized for forensic purposes, preemployment checks, or clinical management. A menu of drugs of abuse and drugs with high potential for overdose (tricyclic antidepressants) is available in POC format, including amphetamines, barbiturates, benzodiazepines, cannabinoids, methadone, opiates, phencyclidine, and propoxyphene (Table 2.1). These tests are available to analyze urine specimens and are approved by the U.S. Food and Drug Administration (FDA), and categorized as “waived” or “moderate complexity” testing under the Clinical Laboratory Improvement Amendments of 1988 (CLIA’88) [2]. CLIA’88 laws apply to any laboratory test (including drug testing) used to diagnose, treat, or manage © 2011 by Taylor and Francis Group, LLC

18

Quality Assurance in the Pathology Laboratory Table 2.1â•…List of Available POC Drug Tests for On-Site Rapid Testing Point-of-Care Drug Tests Oral fluid specimens Ethanol Amphetamine Methamphetamine Cannabinoids Cocaine Phencyclidine Opiate Urine specimens Amphetamines Methamphetamine MDMA (3,4-methylenedioxymethamphetamine)—ecstasy Barbiturates Benzodiazepines Cannabinoids Methadone Phencyclidine Propoxyphene Opiates Buprenorphine (suboxone) Oxycodone Tricyclic antidepressants Note: This list is not comprehensive, and only intended to give the reader an idea of the wide menu of laboratory drug tests available for conducting on-site drug testing.

patient care decisions, wherever the test is performed. Forensic testing is outside of CLIA’88, and the quality of forensic laboratories is certified by agencies other than the Centers for Medicaid and Medicare Services (CMS). For instance, federal workplace drug testing is covered under the Substance Abuse and Mental Health Services Administration (SAMHSA) regulations for federal workplace drug testing programs [3]. Ethanol POC tests are FDA approved and available for testing urine specimens, but ethanol is more commonly performed by breathalyzer or in oral fluid samples to avoid the dilutional effects of urine. Drugs of abuse testing can also be conducted on oral fluid samples and are FDA approved for a limited menu of drugs. Oral fluid is collected in an absorbent swab and manually dispensed onto the test kit through a syringe barrel using the pressure of the syringe plunger on the swab. Use of such tests beyond the FDA intended use or on other specimen types (blood, gastric contents, plasma/serum, vitreous humor, etc.) would © 2011 by Taylor and Francis Group, LLC


19

categorize these tests as “high complexity” under CLIA’88 in the United States and would require the laboratory to more extensively evaluate the clinical and technical performance of the kit before use on actual patient samples. POC drug tests employ immunochromatographic methodologies. Most rapid drug tests utilize a one-step process that requires applying a few drops of sample to the test kit and waiting 10–20â•›min before reading results (Figure 2.1). These tests are based on the principle of drug competition for a limited amount of antibody attached to a colored bead, colloidal gold, or other colorimetric compound. Application of the sample solubilizes the labeled antibody and the sample/antibody mixture wicks down an absorbent paper chromatogram where the drug or control compound has been applied in a linear zone across the direction of migration. If no drug is present in the sample, the labeled antibody is free and available to bind the drug on the test kit and form a visible line. A separate antibody–antigen reaction occurs at the control zone of the test kit and forms a visible control line. So, a negative test result will display two lines: a line in the drug zone and a second line in the control zone of the kit. If the drug is present in the sample above the cutoff concentration for the test, all of the labeled antibody will bind to the

Negative 2 lines

Direction of migration

Positive 1 line

Figure 2.1â•‡ One-step immunochromatography. Drug in the patient’s sample

competes for the labeled antibody with the drug attached to a linear zone on a chromatogram. A few drops of the patient sample solubilize the labeled antibody, and the mixture wicks down a paper, encountering drug and control zones. If no drug is present in the sample, the labeled antibody binds the drug on the chromatogram and forms a visible line. A separate control-antibody reaction forms a line in the control zone. So, a negative test result develops two lines, the drug and control. If drug is present in the sample above the cutoff concentration, the labeled antibody binds to the patient’s sample, and no line is visible in the drug test zone of the chromatogram. A positive test result develops one line, the control.


20


drug in the sample. As the mixture migrates past the drug zone of the test kit, no labeled antibody sites will be available to bind to the drug zone, so the antibody label continues to migrate to the end of the chromatogram. The separate control antibody will form a single line at the control area. A positive test result is interpreted as the disappearance of a line at the drug area, so one line is visible at the control area. One manufacturer’s POC drug test utilizes a three-step immunochromatography method. This is the only kit that actually forms a line at the drug area with a positive test result. The manufacturer achieves this by first incubating the patient’s sample with both a fluorescent molecule attached to the drug and antibodies directed against the drug or drug classes (Figure 2.2). The fluorescent molecule can be labeled with more than one drug; Figure 2.2 αB

αD

Step 1— incubate sample and reagents

B

A E

C

A

D

E

B

C D

αA

αE

αB

Step 2— load device Step 3— wash Positive 2 lines

A E

B

D C

AA D D C E E B

CB

Negative 1 line (control) αA

αB αD αE Direction of migration

αC (control)

Figure 2.2â•‡ Three-step immunochromatography. Drugs (A, B, D, and E) and con-

trol (C) are bound to a fluorescent compound. This labeled fluorophore is incubated with the patient sample and antibodies directed against the drugs. After timed incubation, the mixture is applied to a chromatogram and allowed to wick down the paper. In the final step, the chromatogram is washed and interpreted using an electronic reader. Alternatively, a colorimetric compound (colloidal gold or colored beads) can be used to interpret the test visually. If no drug is present in the patient’s sample, antibodies bind to the drug fluorophore, and when the mixture migrates down the chromatogram, no drug-label sites are available to bind to antidrug antibody (αA, αB, αD, and αE) zones on the chromatogram. A separate anti-control antibody (αC) zone binds the fluorophore and creates a fluorescent control line. A negative result develops one line, the control. A drug in the patient’s sample competes for antidrug antibodies (αA, αB, αD, αE), allowing the drug-label sites to remain free and bind to antidrug antibody zones on the chromatogram. A positive test result develops two lines, a line at the drug zone present in the sample and the control line. The test in this figure is positive for drug B. © 2011 by Taylor and Francis Group, LLC


21

displays four different drugs (A, B, D, and E) and a control antigen attached to the label. After a timed incubation, the test mixture is loaded onto the test kit and allowed to migrate down the paper. After a second timed interval, a wash solution is applied to the kit and the test results are interpreted by scanning the chromatogram in an electronic reader. Alternatively, a colored label can be used to allow visual interpretation of test results. If there is no drug in the patient’s sample, the antibody will bind to the specific drugs attached to the fluorescent label. After loading onto the kit, the label will pass several test zones on the chromatogram, which contains antibody directed against various drugs coated onto the chromatographic paper. With no drug in the sample, all of the antibodies block the drug-binding sites on the fluorescent label, and the label migrates past the antibody bound to the chromatogram to the end of the chromatogram. The fluorescent label binds to the control antibody on the chromatogram and forms a line that is interpreted by the test kit reader. A wash step ensures removal of any residual test mixture and minimizes background fluorescence signal. If the sample contains the drug above the cutoff concentration, the drug binds to the antidrug antibody and leaves the fluorescent-labeled drug open and available to bind to the chromatogram, forming a line of fluorescence. So, in the three-step immunochromatography method, a line develops for a positive reaction. A positive test result will thus have two lines: the test drug line and the control line, while a negative test result will produce only one line, the control. Most drug tests are optimized to reproducibly provide the appropriate test response for a sample with a concentration ±20%–25% of the cutoff concentration. However, appropriate timing of the test is important as ghost lines at both the drug and control areas may develop as the kit dries, due to nonspecific binding of the label. Overdevelopment could thus lead to an incorrect interpretation.

2.3â•‡ Quality Assurance versus Quality Control Quality is defined as a degree of excellence (grade) and a superiority in kind [4]. For laboratory testing, quality is an inherent feature of the laboratory result that characterizes the nature of the laboratory. The laboratory’s—and the laboratory director’s—reputation relies on the quality of the test result. So, for optimum patient care, laboratories necessarily want to generate the best results possible. A defined quality assurance program is required to deliver quality test results. Quality assurance differs from quality control. Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance. Quality assurance, on the other © 2011 by Taylor and Francis Group, LLC

22

Quality Assurance in the Pathology Laboratory Table 2.2â•…Definitions of Quality Assurance and Quality Control Quality Assurance versus Quality Control Quality assurance The practice that encompasses all procedures and activities directed toward ensuring that a specified quality of product is achieved and maintained Quality control A set of procedures designed to monitor the test method and test results to ensure appropriate test system performance

hand, is the practice that encompasses all procedures and activities directed toward ensuring that a specified quality of product is achieved and maintained (Table 2.2). One of the first methods for laboratory quality assurance was the Folin and Wu glucose method for the determination of glucose using alkaline copper reduction (copper and phosphomolybdic acid) [5]. This method described the purity of the chemicals required to perform the test, prepared reagents from these chemicals, conducted the test using standard written procedures, measured the reaction in a well-maintained spectrophotometer, and estimated glucose concentration from a standard curve calculated with each batch of samples. This method focused on the need for documented procedures that must be followed with each analysis to ensure quality test results. This is one of the first published procedures to emphasize the quality management system philosophy that forms the basis of later International Organization for Standardization (ISO) 9000 series standards [6–8]. Industry has adopted the ISO 9000 standards, and a variety of manufacturers have certified compliance with ISO 9000 standards and quality management principles. The industrial concept of quality management has been interpreted for the laboratory setting in the Clinical Laboratory Standards Institute (CLSI) HS1 [9] and the ISO 15189 [10] standards, as well as for POC testing in the ISO 22870 [11] standard. Quality management is also very applicable to the forensic laboratory setting, since the quality management system principles are relevant to a variety of different industries and organizations.

2.4â•‡ Quality Management System Essentials These CLSI and ISO standards apply a core set of 12 quality system essentials basic to any organization across all operations in the health-care path of workflow that defines how a particular product or service is provided (Table 2.3). The laboratory must be part of an organization that has sufficient facilities to operate in a safe manner. Adequate personnel should be trained and competent to perform the procedure, and the equipment must be validated prior to patient testing and have regular ongoing maintenance. © 2011 by Taylor and Francis Group, LLC


23

Table 2.3â•… Quality System Essentials for a Laboratory Quality System Essentials The laboratory Organization Facilities and safety Personnel Equipment Purchasing and inventory The work Process control (preanalytic, analytic, and postanalytic) Documents and records Information management Quality monitoring Assessments—external and internal Occurrence management Customer satisfaction Process improvement

All supplies must be traceable by lot and shipment and performance verified prior to use on samples. The process of analysis must be controlled and documented. Records of patient testing must be maintained and all procedures and policies must be under document control to prevent unexpected changes without supervisory approval. Management of information is thus important, both in protecting confidentiality and for providing traceability of the testing process from sample to reagent to result. Finally, the laboratory must assess the quality of its results, and respond to complaints and occurrences. Customer satisfaction should be monitored and performance improved when issues are noted. Each component of a quality management system is discussed in more detail below. A laboratory, whether a formal dedicated space or a POC facility, must be part of an organization that sets the quality standards. POC drug testing may be conducted in a physician’s office under the direction of a physician in that practice, or the physician’s office may be part of a larger health-care system and adopt that system’s organizational policies. POC drug testing could also be part of an athletic program under an academic organization or conducted on prisoners or suspected intoxicated drivers under the judicial system. Regardless of the location or need for testing, POC drug testing must be conducted under the supervision of a larger organization. That organization sets expectations for quality of POC test results and must provide the necessary resources to provide that level of quality, whether those resources are staff, time, or materials. Moreover, the organization must define levels of authority and responsibility as well as monitor POC drug test quality and overall effectiveness of the quality management system. © 2011 by Taylor and Francis Group, LLC

24


Facilities and safety are the next quality management system essential. POC drug testing may not be performed in permanent facilities, but that does not negate the need for safety considerations. Staff performing the test will need to use infection precautions, monitor environmental conditions for reagent storage and test analysis, and ensure disposal of used test kits, transfer pipettes, gloves, specimen containers, and other biohazardous materials. Tests will need to be conducted in a safe and ergonomic environment. Staff must be protected from physical hazards and biohazardous materials, and staff should be trained on proper safety techniques and incident follow-up for spills, splashes, or contact with kit reagents (material safety data sheets). Personnel are an important quality management system essential. Staff performing the POC drug tests should have the appropriate education, experience, and qualifications to fulfill the job requirements and skills necessary to perform the testing. Simple CLIA waived drug tests have no specific personnel qualifications or training requirements. Staff only need to follow the manufacturer’s directions. For moderate complexity testing, staff must be properly oriented and trained on the specific device. Such training should ensure that staff can document the necessary skills to perform the test [2] (Table 2.4). The testing personnel are responsible for specimen processing, test performance, and for reporting test results (Table 2.5). Each individual must only perform those tests that are authorized by the laboratory director and that require a degree of skill commensurate with the individual’s Table 2.4â•… CLIA’88 Training Requirements for Moderate Complexity POC Drug Testing Training Requirements for CLIA’88 Moderate Complexity POC Drug Testing Skills required for proper specimen collection (including patient preparation, if applicable), labeling, handling, preservation, processing or preparation, transportation, and storage of specimens Skills required for implementing all standard laboratory procedures Skills required for performing each test method and for proper instrument use Skills required for performing preventive maintenance, troubleshooting, and calibration procedures related to each test performed Working knowledge of reagent stability and storage Skills required to implement the quality control policies and procedures of the laboratory An awareness of the factors that influence test results Skills required to assess and verify the validity of patient test results, through the evaluation of quality control sample values prior to reporting of patient test results Source: Health and Human Services, Health Care Financing Administration Public Health Service, 1992, 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule, Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). Note: Staff training must ensure that each individual performing test analysis documents these requirements. © 2011 by Taylor and Francis Group, LLC


25

Table 2.5â•… CLIA’88 Testing Personnel Responsibilities Testing Personnel Responsibilities Follow the laboratory’s procedures for specimen handling and processing, test analyses, reporting, and maintaining records of patient test results Maintain records that demonstrate that proficiency testing samples are tested in the same manner as patient samples Adhere to the laboratory’s quality control policies, document all quality control activities, instrument and procedural calibrations, and maintenance performed Follow the laboratory’s established corrective action policies and procedures whenever test systems are not within the laboratory’s established acceptable levels of performance Be capable of identifying problems that may adversely affect test performance or reporting of test results, and either correct the problems or immediately notify (supervisory staff) Document all corrective actions taken when test systems deviate from the laboratory’s established performance specifications Source: Health and Human Services, Health Care Financing Administration Public Health Service. 1992. 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule. Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). Notes: The testing personnel are responsible for specimen processing, test performance, and reporting test results. These tasks are part of this job function.

education, training or experience, and technical abilities [2]. Periodic competency assessment is necessary to ensure that testing personnel are maintaining skills and performing job functions and conducting testing appropriately. The organization should provide personnel with periodic performance appraisals and opportunities for professional development either through the supervisory staff or in conjunction with human resources. Equipment is another quality management system essential. For POC drug testing, the kits are single-use and disposable, but some manufacturers offer test readers that will need to be validated prior to use to ensure performance within the manufacturer’s specifications. This equipment will need to be maintained and calibrated. Records of service and periodic verification of performance should be documented, especially after major service or recalibration. This documentation should include associated computer hardware, software, and interfaces. As many records are converting from paper documentation to electronic records, federal guidelines, 21 CFR Part 11, define the criteria by which electronic records and electronic signatures are considered reliable and equivalent to paper records [12]. Purchasing and inventory management of equipment, reagents, and supplies is also a quality management system essential. POC drug tests are not only available directly through manufacturer purchase but also may be acquired through laboratory distribution companies. Quality management requires vendor qualification and evaluation to ensure that the distributor can supply the required reagents when needed and that those products © 2011 by Taylor and Francis Group, LLC

26


are shipped and received in such a way as to document lots and shipments for performance qualification prior to use on patient samples. This requires material tracking of purchase orders, shipments, and receipt of reagents, and evaluation of a subset of kits received with each shipment to ensure appropriate test performance. Such material tracking keeps verified reagents separate from those reagents that have been received but are not yet tested and cleared for use on patient samples. Changes in collection kits may need validation to ensure that a change in manufacturer or product does not alter test performance. This may be applicable with changes in swabs utilized for oral fluid collection, transfer pipettes, and even plastic urine containers, especially for drugs like cannabinoids that could adhere to the plastics in the container. The entire test analysis should be controlled from preanalytic, analytic, to postanalytic processes. Process control involves understanding customer expectations or clinical needs and designing an operational workflow that will meet those needs. The total testing process from test order through patient preparation, sample collection, test performance, and reporting of test results should be mapped and validated to meet clinical expectations. Within the analysis, the testing procedure should be documented in a way that will prevent process changes. Any changes to the testing procedure will necessarily require validation to ensure that the change has not altered technical performance. The use of quality control or analysis of samples with known test results can document stable test performance over time and, together with other control processes like internal instrument checks, play a role in the monitoring of test performance. The selection and frequency for performing control processes depends on a combination of the individual device and manufacturer provided controls, the health-care setting and how the test result will be utilized, as well as the regulatory environment and legal requirements for control frequency. CLSI is currently drafting a document, EP23 Laboratory Quality Control Based on Risk Management, which describes how to develop a quality control plan for individual tests and health-care settings [13]. CLSI EP23 and the strategy for developing a quality control plan for POC drug tests based on risk management will be discussed in further detail later in this chapter. Documents and records are a fundamental part of a quality management system. Policies and procedures should be written in a standard format, for staff to easily find the necessary information. Document control is a key consideration, since the creation, revision, review, and approval processes must be controlled so that only one version of the document is implemented in practice. Laboratories may have one master procedure, with working copies of a procedure at the bench. As revisions are made, every copy must be updated, including the master copy and all working copies. Document control is more easily maintained in a single site, like a physician’s office or hospital laboratory, but for decentralized POC testing, the same procedure may need to be © 2011 by Taylor and Francis Group, LLC


27

copied to dozens of locations. Revision and updating of decentralized procedures becomes complicated as each change must be forwarded to multiple locations and old policies replaced with current versions. CLIA’88 mandates annual management review and signature to ensure that policies and procedures are current [2]. So, policies need to be reviewed and updated regularly. Documents and records of testing need to be stored for some years even after a policy or procedure is discontinued. Document storage requirements vary by regulatory agency and state, but records must minimally be maintained for at least 2 years after discontinuation of a procedure [2]. Federal guidelines, 21CFR Part 11, describe criteria for reliability of electronic records and electronic signatures as equivalents to paper documentation [12]. Information management is thus a critical component of a quality management system. Privacy of test records and results is one aspect of information management. Privacy is a particular concern with drug testing results as positive drug tests can lead to child custody disputes in court, denial of employment, expulsion from rehabilitation programs, health insurance denial, and other forms of discrimination. POC drug tests and other screening tests should always be treated as tentative pending confirmation by a more definitive method, unless the test result is required for emergency management in conjunction with the patient’s symptoms. Only the ordering physician and staff with direct patient care responsibilities should have access to the test result, and electronic medical records should track the time/date and the identity of individuals who access test results. So, data records require different access levels of authority, where some personnel may be restricted from access (because the test results do not belong to their patient), while others can view, report, or even modify a test result. Beyond privacy, accuracy of data is another concern with laboratory information management. Manual entry of test results can lead to typographical errors, so transcription must be proofed before results are accepted. Electronic transmission of results across an instrument interface requires not only verification of the transmission accuracy but also checks on the security of data transmission. Institutional firewalls and other computer privacy barriers or data encryption may be needed in order to safely transmit test results electronically. The effectiveness of the quality management system should be monitored. Occurrence management is one aspect of monitoring that involves identifying and documenting test or instrument failures and physician complaints. Complaints and events should be classified and analyzed for trends that may indicate a systematic problem. The investigation of these events may be an opportunity for root cause analysis into the possible sources of the incident and for performance improvement. Internal and external assessments are another means of monitoring the effectiveness of the quality management system (Table 2.6). Internal © 2011 by Taylor and Francis Group, LLC

28

Quality Assurance in the Pathology Laboratory Table 2.6â•… Examples of Some Internal and External Laboratory Quality Monitors Internal and External Quality Monitors Internal quality monitors Quality control performance Sample correlation Test or equipment failure and other occurrences Delta checks External quality monitors Complaints Laboratory inspections Proficiency testing Customer service surveys

assessments include laboratory monitors of quality and could encompass quality control sample result performance, reagent and equipment failure investigations, sample correlations (with reagent shipments, new lots, etc.), delta checks, and other quality monitors. Sample correlations are the comparison of results between different lots or shipments of reagent and should be conducted on arrival of each shipment and periodically to ensure stable performance during storage. Delta checks are the comparison of a patient’s previous result against their current result and are most relevant for quantitative test results on physiologic parameters that do not change rapidly over time (like creatinine). External assessments include monitors outside of the laboratory and could encompass inspections by accreditation agencies and proficiency testing. Laboratory inspection is required for moderate complexity testing every 2 years under CLIA’88; however, laboratories performing only CLIA’88 waived tests have no specific inspection requirement [2]. Laboratories performing waived tests may only be inspected due to physician or patient complaints filed with the CMS centers that regulate clinical laboratories. Federal workplace urine drug testing laboratories must be inspected initially before certification and twice annually after certification [3]. Proficiency testing is the analysis of samples conducted like patient tests, where the results are reported to an accreditation agency and compared against other laboratories performing the same test methodology. Proficiency surveys grade the laboratory’s performance and assess the laboratory’s overall capacity to produce a test result that is comparable to other laboratories on the same test. Customer service is an additional external quality monitor and a quality management system essential. The laboratory should know physician expectations and patient needs and periodically determine customer satisfaction. This could be assessed by surveying physicians and/or patients regarding the



29

perceived quality of test results, but customer service can also be documented by tracking complaints. Both internal and external quality monitors should be evaluated, and when trends or problems are noted, the monitor should be investigated for sources of variation, changes made to correct the issue, and an action plan developed for ongoing quality improvement. Performance improvement is an expected outcome of monitoring the quality management system and another essential component of a quality management system. Process improvement identifies opportunities for improvement and implements corrective actions and preventive measures to avert incidents and complaints. Once improvements are implemented, internal and external monitors will assess the effectiveness of the changes. In summary, the quality management system has 12 essentials that together define a comprehensive plan to ensure the quality of test results. The essentials address the organization and clinical need of the test, acquisition of reagents and equipment, method validation, personnel qualifications and training, and control over the testing process (preanalytic, analytic, and postanalytic). Internal and external monitors assess the effectiveness of the quality management system, document occurrences, and identify opportunities for performance improvement.

2.5â•‡ The Role of the Laboratory Director The laboratory director has ultimate responsibility for the quality of laboratory results reported under his or her direction. In this capacity, the laboratory director plays a central leadership role in laboratory management. The laboratory director holds a CLIA’88 certificate that allows the laboratory to perform testing under the director’s supervision. The laboratory director must ensure compliance with all legal and regulatory aspects of CLIA’88 (Table 2.7). Although the laboratory director can delegate some functions within the laboratory, he or she is ultimately responsible for ensuring compliance. When problems are noted through inspection or proficiency testing, it is the laboratory director’s medical license that is restricted through his or her ability to bill Medicare and Medicaid for a period of months to years, depending on the severity of the incident. So, the federal government takes laboratory directorship seriously and wants directors to play an active role in laboratory management rather than just apply their name to licensing paperwork. For this reason, a laboratory director can only hold a maximum of five CLIA’88 certificates. Laboratory inspectors look for documentation of active participation by the laboratory director, through meeting minutes, signatures on policies and procedures, review of control and proficiency test results, and participation in performance improvement or other laboratory committees and activities.


30


Table 2.7â•…Responsibilities of a Laboratory Director under CLIA’88 Laboratory Director Responsibilities under CLIA’88 If qualified, may perform duties of technical supervisor, clinical consultant, general supervisor, and testing personnel, or delegate these responsibilities to qualified personnel If delegated, the laboratory director remains responsible for ensuring that duties are properly performed Must be accessible to laboratory to provide onsite, telephone, or electronic consultation as needed May direct no more than five laboratories Must ensure quality laboratory services for all aspects of test performance (preanalytic, analytic, and postanalytic) Must ensure laboratory conditions are appropriate for testing performed and provide a safe environment in which employees are protected from hazards Must ensure test methodologies have the capability of providing quality results required for patient care Must ensure verification procedures are adequate to determine performance characteristics Must ensure personnel are performing tests as required for accurate and reliable results Must ensure laboratory is enrolled in an approved proficiency testing program and that proficiency samples are tested as required, results are returned within the expected timeframes, reports are reviewed to evaluate laboratory’s performance, and corrective action plans are followed when proficiency testing is unacceptable Must ensure that quality control and quality assurance programs are established and maintained Must ensure acceptable levels of analytical performance for each test Must ensure that patient test results are reported only when the test system is functioning properly and that remedial actions are taken and documented whenever significant deviations from established performance are identified Must ensure that test result reports include pertinent information required for interpretation Must ensure that consultation is available on the quality of test results and their interpretation Must employ a sufficient number of laboratory personnel with appropriate education, experience, and training; properly supervise and accurately perform tests; and report results Must ensure that prior to patient testing, all personnel have the appropriate education, experience, receive the training appropriate for the type and complexity of services offered, and have demonstrated ability to perform testing operations reliably, and to report accurate results Must ensure that policies and procedures are established for monitoring individuals who conduct any phase of testing (preanalytic, analytic, or postanalytic), to assure they are competent and maintain their competency, and to identify needs for remedial training and continuing education to improve skills Must ensure that an approved procedure manual is available to all personnel Must specify, in writing, the responsibilities and duties of each consultant and supervisor, as well as each person engaged in all phases of testing; identify which examinations each individual is authorized to perform, whether supervision is required, and whether supervisory or director review is required prior to reporting test results Source: Health and Human Services, Health Care Financing Administration Public Health Service, 1992, 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule, Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). © 2011 by Taylor and Francis Group, LLC


31

The laboratory director must provide for technical and general supervision of the testing process and provide clinical consultation to physicians on the ordering and interpretation of test results. The laboratory director must be a doctor of medicine or a doctor of osteopathy licensed to practice medicine or osteopathy in the state in which the laboratory is located and have laboratory training or experience consisting of at least 1 year directing or supervising non-waived laboratory testing or laboratory training obtained during medical residency (as with physicians certified in hematology). Alternatively, the laboratory director can have at least 20 credit hours of continuing medical education in laboratory practice commensurate with director’ responsibilities. Pathologists accredited by the American Board of Pathology or American Osteopathic Board of Pathology may also be laboratory directors, as well as PhD holders in a chemical, physical, biological, or clinical laboratory science, who are certified by the American Board of Medical Microbiology, the American Board of Clinical Chemistry, the American Board of Bioanalysis, or the American Board of Medical Laboratory Immunology. Those who have earned a master’s or bachelor’s degree in similar disciplines with at least 1 or 2 years of laboratory training experience, respectively, and at least 1 or 2 years of laboratory supervisory experience, respectively, can also qualify as a laboratory director. These qualifications are required because laboratory directors must ensure that they personally meet the qualifications for technical and general supervision of a laboratory, which includes selecting appropriate test methods to meet clinical needs, verification of test procedures and establishing the laboratory’s test performance characteristics, establishing a quality control program, resolving technical problems and ensuring remedial actions are taken, ensuring patient test results are not reported until corrective action is taken, identifying training needs, and ensuring testing personnel are competent. Additionally, the laboratory director must provide clinical consultation to ensure that the tests ordered by physicians meet the clinical expectations, that reports include pertinent information required for interpretation, and that consultation on the quality of test results concerning specific patient conditions is available.

2.6â•‡ Quality Control Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance (Table 2.2). Quality control is only a part of a total quality assurance program for the laboratory. The history of quality control evolved from the manufacturing industry, where a sample of the product was tested for flaws or defects. Whenever the percentage of defective products rose above a critical level, the manufacturing plant would need to implement changes to the © 2011 by Taylor and Francis Group, LLC

32


manufacturing line to reduce the rate or percentage of defective products to an acceptable level. Quality control concepts entered the clinical laboratory in the mid1900s, where a sample of known concentration was analyzed with each batch of patient specimens. If the control sample generated the expected test result within analytical tolerance, the assay performance was assumed to be acceptable. Control samples are stabilized or frozen so that aliquots of the sample can be analyzed with each day’s patients to verify assay performance over time. The control results detect performance from all parts of the test system, including the reagent, the instrumentation, and the operator. Reagent degradation, instrument malfunction or calibration errors, and operator mistakes will lead to changes in the control results that indicate a problem with the analysis. Patient results can thus be held until the problem is fixed and control results return to the expected values. At that time, patient samples can be reanalyzed and reported. Therefore, controls are useful in verifying the suitability of test systems (sample, reagents, instruments, and/or users), monitoring the precision and trueness of measurement results, preventing false-negative and false-positive results, preventing fault conditions that could lead to inaccurate results, and troubleshooting problems that require corrective action [14]. Because controls are sensitive to the entire system performance, laboratory quality standards have adopted requirements for laboratories to analyze a minimum number of controls with each day’s analytical runs. CLIA’67 was the first quality law for clinical laboratories in the United States that mandated the performance of two levels of quality control, at a normal and abnormal concentration of analyte, each day of patient testing. CLIA’88 reinforced this need for two levels of controls at least every 24â•›h of testing, and private accreditation agencies like the College of American Pathologists (CAP), the Joint Commission, and the Commission on Office Laboratory Accreditation (COLA) followed suit with similar requirements for accredited laboratories. Two levels of controls each day of testing have thus become the de facto historical standard for good laboratory practice. Controls do a good job at detecting analytical problems where the error occurs at one point in time onward in a systematic fashion (Figure 2.3). Take a laboratory analyzer that utilizes bulk liquid reagents. This type of analyzer may produce hundreds of tests from a single bottle of reagent. Regent degradation or an analyzer problem will affect all controls and patient samples run from that bottle of reagent or on that analyzer in the same manner. The problem, however, may not be detected until the next control analysis. For example, a laboratory may analyze controls at 9:00 a.m. each day, but if a line leak occurs at 11:00 a.m., that problem may not be detected until the next control analysis at 9:00 a.m. the next day (Figure 2.3). At that time, the laboratory will need to troubleshoot the problem, fix the line, and then © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing Hemolyzed sample Quality control

Quality control 09:00

33

11:00

01:15

09:00

Line leak

Figure 2.3â•‡ Systematic versus random errors. Consider a laboratory instrument where two levels of quality control samples are analyzed each day at 9:00 a.m. A line leak occurs on the instrument at 11:00 a.m., leading to partial reagent dispensing that decreases test results by 25% from 11:00 a.m. until the error is corrected (systematic error). The line leak would not be detected until the next control samples are analyzed at 9:00 a.m. the next morning. All patients will need to be reanalyzed once the instrument error is fixed. A hemolyzed sample analyzed at 1:15 p.m. increases test results by 50% (random error), but control samples will not detect this error, which affects only one sample.

reanalyze all patient specimens from 11:00 a.m. the previous day. This is a lot of reanalysis, lost productivity, and expense. In addition, if results were autoverified and released before the next control analysis, the test results may need to be corrected and physicians called with the corrected result. This leads to physician concern over the quality of the laboratory results. Controls either need to be analyzed more frequently than once a day or patient results need to be held until successful performance of the next control samples. However, control samples do not detect every type of analytical error. Take a hemolyzed sample or a sample of a patient with an interfering drug or metabolite (Figure 2.3). Controls analyzed once a day will not detect random errors with a single sample. POC drug tests are single-use devices intended to analyze one sample per kit. Analysis of a control sample on one kit uses up the test and will not necessarily detect errors with the very next kit even in the same box of tests. To ensure quality results with single-use POC tests, a different control strategy is required that can better detect random errors with each test.

2.7â•‡Laboratory Quality Control Based on Risk Management Good laboratory practice to ensure the quality of test results requires a thorough understanding of the total testing process—preanalytic, analytic, and postanalytic. Weak steps in the testing process, where there is the risk of a hazard or error occurring, will require preventive measures or mitigations to reduce the risk of error to a clinically acceptable level. © 2011 by Taylor and Francis Group, LLC

34


Input information Medical requirements for the test results

Corrective and preventative action and continuous quality improvement

Regulatory and accreditation requirements

Test system information provided by the manufacturer

Information about health care and test-site setting

Process Risk assessment

Output Quality control plan

Process Post implementation monitoring

Figure 2.4â•‡ Process to develop and continually improve a quality control plan. (Reproduced from Clinical and Laboratory Standards Institute, EP23 Laboratory Quality Control Based on Risk Management, CLSI, Wayne, PA, in press.)

Process control is one of the quality management system essentials defined by the CLSI HS1 and ISO 9000 series standards [6–9]. Developing a quality control plan for a specific test method requires information about risks of failure with the testing device, either provided by the manufacturer in the package insert or other information and publications about the test, knowledge about clinical need, how the test result will be utilized, the laboratory setting and operators, as well as the local quality laws and accreditation standards regulating the test performance (Figure 2.4). CLSI EP23 describes how to develop a quality control plan based on risk management that is customized for a specific test and laboratory setting [13]. CLSI EP23 is based on industrial risk management principles defined in ISO 14971 [15]. CLSI EP23 processes information from the manufacturer, the laboratory setting, and the local quality regulations to develop a quality control plan (Figure 2.4). Once implemented, the effectiveness of the quality control plan is monitored, failures are investigated, and the quality control plan modified to keep the risk of error to a clinically acceptable level in a continuous quality improvement cycle. Sources of laboratory error can come from the environment, the operator, or the analysis (Table 2.8). Environmental sources of error can occur from temperature, including reagent overheating or freezing (during transportation and storage) and instrument performance out of acceptable temperature ranges; humidity (during storage or test analysis particularly with electronic © 2011 by Taylor and Francis Group, LLC


35

Table 2.8â•… Examples of Environmental, Operator-Related, and Analytic Sources of Error for Laboratory Testing Sources of Laboratory Error Environmental Temperature Humidity Airflow Light intensity Altitude Operator Improper specimen preparation and handling Incorrect test interpretation Failure to follow test system instructions Analysis Calibration incorrect Mechanical failure

instruments); poor airflow (around instruments, leading to overheating or too much airflow impeding test development); light exposure (during storage or poor lighting during test interpretation); and even altitude (effects on instruments like blood gas analyzers). Operators can inadvertently make errors in specimen collection, processing, and handling, or fail to follow manufacturer instructions, take analytical shortcuts, and even misinterpret test results, such as interpreting the appearance of a POC drug test line as positive rather than negative, or vice versa. Analytical errors can occur with improper instrument calibration and mechanical failures, or from sample interferences and cross-reacting drugs. Manufacturers incorporate a variety of process controls to minimize the risk of common laboratory errors. Historical performance of two levels of control samples each day of testing can detect some test system problems, but there are other types of controls that are being incorporated into newer tests, particularly single-use POC tests. Many of these tests utilize “on-board” controls that are analyzed with each sample and test kit. The control line on a POC drug test is one example of this type of “on-board” control. This line is developed at the same time that the drug test line is developed, but utilizes a separate antigen–antibody reaction to ensure that the test kit is viable, has not expired, and was stored properly. The control line can also detect that an adequate sample volume was applied to the test kit and that the test development was timed and interpreted appropriately. The control line also can detect sample problems like interfering compounds or adulterants in a urine drug sample and viscosity issues with sample flow, since failure to develop © 2011 by Taylor and Francis Group, LLC

36


a control line will indicate an invalid test kit or sample. This type of “onboard” quality control is thus sensitive to random errors that can occur with individual samples or test kits. Analyzers also have built-in system checks that can control for instrument function, electrical problems, and even calibration errors. Finally, external control programs, in the form of blind proficiency samples, send the laboratory a set of blind samples a few times a year and grade an individual laboratory’s performance against other laboratories performing the same test methods. EP23 assists laboratories in determining which control processes are most appropriate to an individual test device in their laboratory setting and provides justification for the frequency of performing selected controls. The laboratory director has ultimate responsibility for the quality of test results under his or her direction, so he or she must decide on an appropriate quality control plan for each testing method. Some laboratories may have more tolerance for error because the test results will be confirmed by another method before action is taken while other laboratories will demand more stringent control because the test result is definitive and may result in immediate medical decisions. The control plan is thus customized for a specific testing method and laboratory setting.

2.8â•‡Developing a Quality Control Plan for a POC Drug Test A quality control plan is usually developed on initial implementation of a new test method, although the quality control plan can be developed on a test already in clinical use, to better define quality processes and improve the quality of test results. The laboratory director should collect information about the test from the package insert and other available information provided by the manufacturer, as well as the local quality regulations and details about the clinical need, who will perform the test, and how the test result will be utilized in making medical decisions (Figure 2.4). This information is processed through a risk assessment to evaluate those risks of highest priority and to determine control processes that will reduce those risks to a clinically acceptable level. While it is never possible to eliminate all probability of risk, the goal of developing a quality control plan is to control risk within acceptable limits in order to meet clinical need. Let us consider a simple POC drug test. This is a single-use test kit that can be utilized in a formal laboratory or taken on-site to deliver drug testing closer to the site of patient care, such as a physician’s office, ambulance, or into the field for use by police in the prison system, and by athletic programs. The test requires a urine sample and is classified as a waived device by CLIA’88. The package insert indicates no need to analyze controls on a © 2011 by Taylor and Francis Group, LLC


37

regular basis, since each kit contains a separate control area that detects test viability, appropriate sample application, and test development and interpretation. Test results are read visibly by the operator at 15â•›min after application of three drops of urine as the appearance of a line in the drug test area (negative) and as the disappearance of a line in the drug test area (positive for drug in the sample above the cutoff concentration). The manufacturer indicates that control samples can be analyzed whenever the laboratory questions the performance of the test kits, but does not make recommendations regarding the frequency or conditions when control samples should be analyzed. Although CLIA’88 waived test regulations only require the laboratory to follow manufacturer’s instructions, there are a number of risks of error with such POC test kits even when manufacturer’s instructions are followed. Some laboratories may find the manufacturer’s risk acceptable, but in other situations, the risk of error from simply following manufacturer’s instructions may not meet clinical expectations. In either case, the laboratory director should assess the risk of performing the test in their laboratory and sign off their acceptance of the quality control plan implemented by the laboratory, whether that is to follow manufacturer’s instructions or to supplement additional control processes. Sources of error can be environmental, operator related, or analytic in nature. Each risk should be considered separately. Risks, and the rationale for controlling each risk, can be documented in a table format that, when completed, will comprise the laboratory’s quality control plan for the POC drug test (Table 2.9). Let us consider the possibility of test kit degradation during shipment. The POC drug test kits should be maintained at room temperature, within a temperature range of 10°C–40°C, and protected from heat and freezing. Since the laboratory director will have no control over shipping conditions, there is a possibility of test kits being exposed to extreme temperatures during shipment. By testing a positive and negative control upon arrival of each shipment of test kits, whether from the same lot or different lots of test kits, the laboratory director can ensure the appropriate performance of the kits before use on patient samples. A positive and negative control should be selected with drug concentrations close to the cutoff concentration (±20%–25% of cutoff), so the control is sensitive to changes in the test kit performance. Controls that are very positive and very negative may not adequately determine minor changes in test kit performance; thus, controls with concentrations close to the cutoff are preferred. This control process is added to the quality control plan (Table 2.9). The residual risk with this mitigation can be assessed by comparing the frequency of the error (hazard) with the consequences for not detecting or preventing the error (hazard). The frequency of this hazard or probability of harm can be estimated from historical data on compromised shipments sent to the laboratory or from the manufacturer regarding the frequency of returned shipments. This © 2011 by Taylor and Francis Group, LLC

38


Table 2.9â•…Sample Quality Control Plan for a Hypothetical POC Drug Test

Targeted Failure Mode (Hazard)

Automated Control Effective?

Test kit degradation during shipment due to extreme temperature exposure

Partially effective. “On-board” controls detect test kit viability

Test kit degradation during storage, due to temperature exposure

Partially effective. “On-board” controls detect test kit viability

Too much or too little sample

Yes. “On-board” controls detect significant variation in sample volume Partially effective. “On-board” controls will detect significant variations in timing Partially effective. “On-board” controls only detect some adulterants Not effective. “On-board” controls not effective in detecting drug cross-reactivity

Incorrect test development timing

Sample adulteration

Drug cross-reaction

Quality Control Plan Analyze positive and negative control upon arrival of new shipments of test kits prior to use on patient samples Analyze positive and negative control periodically (once a month) to ensure test kit viability Check test kit control zone with each test. Repeat tests with invalid control line Implement a timer with an audible alarm. Validate timer readout at 15â•›min, once per year Implement adulteration tests (or switch to oral fluid drug testing) Confirmatory testing for any questionable test results or whenever drug cross-reactivity is suspected

Is Residual Risk Acceptable? (Yes/No) Yes

Yes

Yes

Yes

Yes

Yes

Notes: The targeted failure mode or risk of error (hazard) is described, the manufacturer’s control is assessed for effectiveness, and the laboratory’s quality control plan is described. The residual risk after implementation of the quality control plan is assessed for clinical effectiveness. If residual risk is still unacceptable, additional control processes will be required to reduce the risk to a clinically acceptable level.

estimate can be subjectively described as follows, as indicated in ISO 14971 [15] and EP23 [13]: • Frequentâ•›=â•›once per week • Probableâ•›=â•›once per month • Occasionalâ•›=â•›once per year © 2011 by Taylor and Francis Group, LLC


39

• Remoteâ•›=â•›once every few years • Improbableâ•›=â•›once in the life of the test system This laboratory estimates that a shipment may be compromised somewhere between occasional (once a year) and remote (once every few years). Since analyzing control samples on each shipment will detect compromised test kits before they are used on patient samples, the frequency of an error with the control process in place is improbable. The severity of harm to patient outcome should the error/hazard not be detected or prevented is also estimated [13,15] as follows: • Negligibleâ•›=â•›inconvenience or temporary discomfort • Minorâ•›=â•›temporary injury or impairment not requiring professional medical intervention • Seriousâ•›=â•›injury or impairment requiring professional medical intervention • Criticalâ•›=â•›permanent impairment or life-threatening injury • Catastrophicâ•›=â•›results in patient death The severity of harm for a POC drug test will depend on how the test result is being utilized. If the POC result is being followed with a confirmation result, there is negligible consequence from a false-positive result, since all positive POC drug tests will be followed with a confirmatory test. However, a temperature-compromised reagent is more likely to give a false-negative result. A false-negative test may miss abuse that could lead to patient harm from continued abuse that is not detected, since negative tests may not be confirmed. This could be serious, or even catastrophic, if the consequence of undetected abuse leads to patient death. In an emergency room, medical management may occur only based on the screening POC drug test, without confirmation, so the severity of harm may be serious if the negative test leads to surgery and there is a drug interference with anesthesia. The frequency of error can be combined with the severity of harm to determine the clinical acceptability of the control process (Table 2.10). An improbable frequency of error or probability of harm combined with a serious to even catastrophic severity of harm is still clinically acceptable, so the clinical acceptability of this control process is documented in the laboratory’s quality control plan (Table 2.9). The risk for each potential error or hazard is assessed in a similar manner. For example, temperature can also affect test kit performance during storage. In a clinical laboratory with controlled temperature conditions, the probability of this hazard is remote (once every few years) and may only occur if the temperature control fails due to power outage. However, if the test kit is transported in a vehicle (e.g., in an ambulance or by visiting nurse), the probability of this hazard is much greater. If the test kits must be refrigerated, © 2011 by Taylor and Francis Group, LLC

40


Table 2.10â•…Risk Evaluation Table to Determine the Clinical Acceptability of Residual Risk after Implementation of a Control Process Severity of Harm

Probability of harm

Negligible

Minor

Serious

Critical

Catastrophic

Frequent Probable Occasional Remote Improbable

Unacceptable Acceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Unacceptable Acceptable Acceptable

Unacceptable Unacceptable Unacceptable Unacceptable Acceptable

Source: Reproduced from Clinical and Laboratory Standards Institute, EP23 Laboratory Quality Control Based on Risk Management, CLSI, Wayne, PA, in press. Notes: The probability of harm is a semiquantitative estimate of the probability of harm (frequency of an error occurring) multiplied by the severity of harm and consequence to patient outcome with the control process should the hazard go undetected. Shaded boxes indicate unacceptable clinical risk that requires additional control processes.

there is a higher probability that the refrigerator temperatures may go out of range (particularly when a door is left open), so refrigerated reagents may have a higher probability of temperature degradation than reagents stored at room temperature. In either case, a control strategy can be utilized that periodically analyzes control samples during storage (i.e., once a month). This reduces the probability of reagent degradation during storage to remote (once every few years), since compromised test kits will be detected before use on patient samples. In addition, if the test kits are not stored in a vehicle and removed with other sensitive medications and devices, the frequency of this hazard is also lower. The severity of harm is serious if a compromised test kit is utilized, but the “on-board” control should detect a compromised test kit and, in conjunction with periodic control performance, the risk of using a temperature-compromised test is remote. This control process can be added to the laboratory’s quality control plan (Table 2.9). The potential for operator errors in sample application can also be evaluated by a similar risk assessment process. Operators can apply too much or too little sample, which could lead to inaccurate results. The “on-board” controls should detect over-loading (flooding the test reagents) and underloading (too little reagent to migrate down the chromatogram). With “onboard” controls, the frequency of accepting an inaccurate result due to wrong sample application should be remote (once every few years) and is a factor of the operator properly interpreting the test results. Use of an electronic test reader would reduce the probability of this hazard to improbable, but an instrumented test reader would require calibration, maintenance, and be subject to other mechanical device failures. So, instrumented POC drug tests are a higher (moderate complexity) test under CLIA’88, with additional validation, training, and control requirements. The severity of harm would © 2011 by Taylor and Francis Group, LLC


41

be serious if an inaccurate test result were released, but the combination of remote frequency with serious harm is clinically acceptable. The use of “onboard” controls to detect sample application errors by the operator is added to the laboratory’s quality control plan. There is a risk of operators failing to time the test result appropriately. The manufacturer of this test recommends reading the result visually after 15â•›min. Under-development and over-development could lead to inaccurate results. The test “on-board” controls will detect significant variations in test timing, but the risk of mistiming the development would be significantly less if the laboratory implements a timer to ensure that the test is appropriately developed. However, a timer must be validated periodically (once per year), to ensure that it is appropriately calibrated to read 15â•›min. With the use of a timer, the frequency of timing errors by the operator are probable (once per month), and result from the operator getting pulled away to take care of other tasks and forgetting to return to the test. A timer with an audible alarm that must be turned off reduces this possibility to occasional (once per year). Analysis of control samples periodically, using the timer, will further verify the appropriateness of test timing and timer calibration. The severity of incorrect test timing can be serious, but occasional multiplied by serious severity of harm is clinically acceptable. The use of a timer with an audible alarm is added to the laboratory’s quality control plan. The risk of analytical errors includes sample adulteration and test crossreactivity with other drugs in the patient’s sample. Sample adulterants are compounds that produce false-negative test results when added to the sample. The risk of sample adulteration is greater in patients who are conscious and motivated to fool their drug test. So the frequency of this hazard will vary, depending on the clinical application of the POC drug test. In an emergency room, with obtunded patients, the frequency of sample adulteration will be much less than at a rehabilitation center or in an athletic program. Adulterants like strong acids and bases that destroy antibody binding will affect the reactivity of both drug and control antibodies in the test kit. “On-board” controls will thus be sensitive to a number of common adulterants and invalidate the test result. However, there are some adulterants that may selectively affect drug structure while preserving control reactivity, like Stealth, a peroxide–peroxidase mixture. The laboratory can implement specific adulteration tests to detect the presence of common adulterants like acids, bases, nitrates, dichromate, glutaraldehyde, salts, and dilution. These tests are recommended anytime there is a likely risk of adulteration and adulteration tests are required by the federal workplace drug programs. Alternatively, the laboratory can implement oral fluid drug testing that can be collected in the presence of the patient, without violating personal privacy, which is a concern with urine collections. Use of either adulteration testing or switching from urine to oral fluid POC drug testing can reduce the © 2011 by Taylor and Francis Group, LLC

42


probability of adulteration risk to occasional (once a year) or remote (once every few years). The consequences, however, of not detecting drug use can be serious or of even greater severity of harm to the patient. Combined, the implementation of adulteration testing or oral fluid testing will reduce this risk to a clinically acceptable level. Drug cross-reactivity is another risk to consider for POC drug testing. The frequency of cross-reactivity depends on the specific drug test and drug class being detected. For instance, amphetamine drug tests are subject to much more cross-reactivity with over-the-counter cold medicines than are cocaine tests. Laboratories can certainly change to another manufacturer if the frequency of false-positive drug tests is significant, but confirmatory testing will provide a more definitive test result than any screening POC drug test. Confirmatory testing is recommended anytime drug-cross reactivity is suspected or the test results do not match the clinical patient history and symptoms. With confirmatory testing, the probability of false-positivity due to drug cross-reactivity is occasional (once per year), and the severity of harm is minor to negligible since clinical action will wait for confirmatory test results. The residual risk of cross-reactivity could occur only from drugs or drug classes that are not readily detected by the confirmatory methods; thus there is still some residual risk, particularly with new and investigational drug protocols. However, the combined probability of drug cross-reactivity (occasional) with the severity of harm when using confirmatory testing (negligible) is clinically acceptable. The need for confirmatory testing with any questionable test results is added to the laboratory’s quality control plan. The laboratory’s quality control plan for this hypothetical POC drug test can be summarized as follows: • Follow manufacturer’s instructions for test performance and interpretation of “on-board” controls. • Analyze two levels of control samples (±20%–25% of cutoff concentration) on arrival of each shipment of test kits and monthly thereafter. • Utilize a timer with an audible alarm to time test development and verify calibration of timer readout annually. • Utilize adulteration testing for POC drug tests performed outside of the emergency room when the frequency of adulteration is significant. • Utilize confirmatory testing whenever there is suspected drug crossreactivity or the screening test results do not match the clinical picture. The laboratory’s quality control plan defines the control processes that will be implemented to minimize the risk of specific hazards or errors with POC © 2011 by Taylor and Francis Group, LLC


43

drug testing. Once implemented, the effectiveness of the quality control plan will be monitored to determine failures, complaints, or occurrence trends that need to be investigated. It is never possible to predict the risk of all potential errors initially when implementing a new testing method, so, over time, the quality control plan will necessarily need to be modified as new risks are uncovered in a continuous quality improvement cycle.

2.9â•‡Summary POC testing is clinical laboratory testing conducted close to the site of patient care. POC testing is often done with simple single-use test kits that are portable and can be conducted in a range of clinical settings. The quality of POC tests is often questionable, given the number of different personnel and the variety of education levels and laboratory experience. A total quality assurance program is required to ensure the quality of test results. Quality management system essentials that are utilized for central laboratory tests are applicable to POC tests. The laboratory director is ultimately responsible for the quality of test results under his or her direction. Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance. Developing a quality control plan requires mapping the testing process (preanalytic, analytic, and postanalytic) and understanding the risks for hazards or errors that may occur at each step of the testing process. Control processes are implemented to mitigate risk and reduce the risk of errors to a clinically acceptable level. A quality control plan is customized to the specific test method, the clinical application of the test result, the clinical setting and testing personnel, and the local quality regulations. Once implemented, the effectiveness of a quality control plan is monitored and modified as new risks are uncovered to continuously improve the quality of test results and reduce risk to a clinically acceptable level. POC drug tests are a specific application of POC testing, which pose their own hazards and risks of error. The quality of POC drug tests can be managed through development of a quality control plan and utilization of a total quality management system in a manner similar to central laboratory tests.

References 1. National Academy of Clinical Biochemistry. 2006. Introduction. In: Laboratory Medicine Practice Guideline: Evidence Based Practice for Point of Care Testing, ed. J.H. Nichols, Washington, DC: AACC Press, pp. vi–viii. 2. Health and Human Services, Health Care Financing Administration Public Health Service. 1992. 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule. Federal Register 57(40):7001–7243. © 2011 by Taylor and Francis Group, LLC

44


Recent revisions available at http://www.cms.hhs.gov/CLIA (accessed on October 2010). 3. Substance Abuse and Mental Health Services Administration, April 13, 2004. Mandatory guidelines and proposed revisions to mandatory guidelines for federal workplace drug testing programs; Notices. Federal Register 69(71):19644– 19673. Available at http://www.drugfreeworkplace.gov/federal.html (accessed on October 2010). 4. Merriam-Webster, Inc. 1983. Webster’s Ninth New Collegiate Dictionary, Springfield, MA. 5. Folin O. and Wu H. 1919. A system of blood analysis. J. Biol. Chem. 38:81–110. 6. International Organization for Standardization. 2005. ISO 9000:2005 Quality Management Systems: Fundamentals and Vocabulary. Geneva, Switzerland: ISO. 7. International Organization for Standardization. 2000. ISO 9001:2000 Quality Management Systems: Requirements. Geneva, Switzerland: ISO. 8. International Organization for Standardization. 2000. ISO 9004:2000 Quality Management Systems: Guidelines for Performance Improvement. Geneva, Switzerland: ISO. 9. Clinical and Laboratory Standards Institute. 2004. HS1-A2 A Quality Management System Model for Health Care. Wayne, PA: CLSI. 10. International Organization for Standardization. 2007. ISO 15189:2007 Medical Laboratories: Particular Requirements for Quality and Competence. Geneva, Switzerland: ISO. 11. International Organization for Standardization. 2006. ISO 22870:2006 Point-ofCare Testing: Requirements for Quality and Competence. Geneva, Switzerland: ISO. 12. U.S. Food and Drug Administration, Department of Health and Human Services. Code of Federal Regulations Title 21, Part 11. Electronic records; Electronic signatures. http://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/CFRSearch. cfm?CFRPart=11 (accessed on October 2010). 13. Clinical and Laboratory Standards Institute. 2009. EP23 Laboratory Quality Control Based on Risk Management. Wayne, PA: CLSI (in press). 14. International Organization for Standardization. 2004. ISO 15198:2004 Clinical Laboratory Medicine—In vitro Diagnostic Medical Devices—Validation of User Quality Control Procedures by the Manufacturer. Geneva, Switzerland: ISO. 15. International Organization for Standardization. 2005. ISO 14971:2005 Medical Devices—Application of Risk Management to Medical Devices. Geneva, Switzerland: ISO.


Quality Assurance of Identification with Chromatographic–Mass Spectrometric Methods

3

Maciej J. Bogusz

Contents Abbreviations 3.1 Introduction 3.2 Role of Screening Procedures in Identification 3.3 Methodical Considerations 3.3.1 Optimization of Sample Pretreatment 3.3.2 Optimization of Chromatographic Separation 3.3.3 Optimization of MS Detection 3.4 Legal and Regulatory Aspects of Identification 3.4.1 FDA Guidance 3.4.2 U.S. Pesticide Agency Requirements 3.4.3 European Commission Requirements 3.4.4 WADA Criteria 3.4.4.1 Chromatographic Separation Requirements 3.4.4.2 Mass Spectrometric Requirements 3.4.5 AORC Criteria 3.4.5.1 Chromatography 3.4.5.2 Low-Resolution Mass Spectrometry 3.4.6 CAP Criteria 3.5 Closing Remarks References

Abbreviations AAFS AORC CAP CLIA

American Academy of Forensic Sciences Association of Official Racing Chemists College of American Pathologists Clinical Laboratory Improvement Amendments


45

45 46 49 51 51 53 54 60 60 62 63 64 65 65 66 66 67 67 68 70

46


CMS EI FDA FTICR-MS FWHM GC-MS GTFCh HHS LC-MS mDa MRM NIH RRT RT SIM SOFT SOHT SOP SRM TOF UPLC WADA

Centers for Medicare and Medical Services Electron impact ionization Food and Drug Administration Fourier transform ion cyclotron resonance mass spectrometry Full width at half-maximum height Gas chromatography–mass spectrometry German Society of Toxicological and Forensic Chemistry U.S. Department of Health and Human Services Liquid chromatography–mass spectrometry Millidalton Multiple reaction monitoring National Institutes of Health Relative retention time Retention time Selected ion monitoring Society of Forensic Toxicologists Society of Hair Testing Standard operation procedure Selected reaction monitoring Time-of-flight Ultra-performance liquid chromatography World Anti-Doping Agency

3.1â•‡Introduction The subject of identification in relation to life sciences can be defined in several ways. The Free Dictionary [1] provides following definitions of identification: Identification—the act of designating or identifying something; evidence of identity; something that identifies a person or thing. Positive identification— evidence proving that you are who you say you are; evidence establishing that you are among the group of people already known to the system; recognition by the system leads to acceptance; a system for positive identification can prevent the use of a single identity by several people. Negative identification—evidence proving that you are not who you say you are not; evidence establishing that you are not among a group of people already known to the system; recognition by the system leads to rejection; a system for negative identification can prevent the use of multiple identities by a single person.

In Wikipedia [2] the following is given: The function of identification is to map a known quantity to an unknown entity so as to make it known. The known quantity is called the identifier (or ID) and the unknown entity is what needs identification. A basic requirement © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

47

for identification is that the ID be unique. IDs may be scoped, that is, they are unique only within a particular scope. IDs may also be built out of a collection of quantities such that they are unique on the collective. Identification is the capability to find, retrieve, report, change, or delete specific data without ambiguity. This applies especially with information stored in databases. In database normalization it is the central, defining function to the discipline.

The Wordreference dictionary [3] defines recognition, identification as a process of recognizing something or someone by remembering; “a politician whose recall of names was as remarkable as his recognition of faces.” In philosophy, identity (also called sameness) is whatever makes an entity definable and recognizable, in terms of possessing a set of qualities or characteristics that distinguish it from entities of a different type. Or, in layman’s terms, identity is whatever makes something the same or different. This includes operational definition that yields either a yes or a no value for whether a thing is present in a field of observation, or that distinguishes the thing from its background, allowing one to determine what is and what is not included in it. All the above-mentioned definitions may be transferable to analytical chemistry or toxicology. Even the example of a politician, who is able to recognize thousands of faces, is not far from the efficient library search used in various identification procedures. In analytical chemistry, the process of mental recognition is replaced by computer software, comparing registered mass spectra or UV spectra with the library, instead of comparing human faces with the memory. According to de Zeeuw and Franke [4], the process of identification starts with the comparison of an unknown substance with the reference substances, whose properties are stored in the database. When more than one matching compound is selected, the process of identification must continue, using further criteria, until only one substance remains on the list. These authors have formulated the following questions, relevant for chromatographic–mass spectrometric procedures: How can analytical properties be compared (e.g., how to compare mass spectra?)? What should be considered as an “adequate” match? Is there a difference between confirmation and identification? What are the requirements for suitable databases? What are the criteria to reject substances? What is the probability of correctness of the identification? De Zeeuw and Franke distinguished three types of identification: structure elucidation as identification of a pure compound by powerful spectrometric methods, confirmation as a result of successful comparison of the properties © 2011 by Taylor and Francis Group, LLC

48


of the expected substance with the reference substance, and recognition as a result of positive matching of the properties of the unknown substance with the reference database. In recommendations formulated by Food and Drug Administration (FDA) [5], confirmation is similarly defined as “Unambiguous identification of a compound’s presence by comparison to a reference standard (mass spectrometric).” However, the term “confirmation” may be used in another meaning. In forensic toxicology and doping control, the usual analytical strategy consists of two steps: screening procedure, usually performed with highly sensitive but less specific methods (mainly immunoassays or tandemMS using only one transition), and confirmation of the positive result of screening procedure, which is done with the methods of highest possible specificity, like full-scan GC-MS [6], or LC-MS-MS in MRM mode using three transitions or product spectra [7,8]. Similar definition was given by the U.S. Department of Agriculture [9] for pesticide identification: “Confirmation: Verification of a previous analyte identification that is performed by another analytical system.” De Zeeuw [10] warned against using confirmation procedures as the only proof of identification and postulated the use of various identification procedures, and not only MS. He also criticized the use of different identification criteria in different guidelines, which may lead to contradictory interpretation of the results of mass spectrometric analysis. Nevertheless, instrumental techniques consisting of various chromatographic separation procedures hyphenated with mass spectrometric detection are regarded as sufficient tools for unequivocal identification, if particular requirements are met. These requirements, i.e., the establishing analytical threshold, which is appropriate high for particular task, are formulated by responsible organizations or bodies on national or international level. Lehotay et al. [11] proposed the following definitions of results of various identifying procedures: • Indication as nonquantitative result from a general screening method of lower specificity (e.g., immunoassay) • Determination as a quantitative result from a method that meets the acceptable performance criteria for the quantitative purpose of analysis (e.g., GC with element-specific detector) • Identification as a qualitative result from a method capable of providing structural information (e.g., GC-MS) • Confirmation as a combination of two or more analyses that are in agreement with each other, ideally using methods of independent approaches. Lehotay et al. [11] introduced also the term “limit of identification” (LOI), which is defined as the lowest concentration for which the identification criteria are met © 2011 by Taylor and Francis Group, LLC


49

Bethem et al. [12] in report of the working group of the ASMS Measurements and Standards Committee went even farther in differentiation of the degree of confidence LOIs. They suggested the following terminology for communication to a client (from lowest to highest confidence step): nonnegative; presumptive; suspected; tentative identification; indicated; identified; identified with confidence; confirmed; identified with utmost certainty. They advised to avoid such terminology as “detected” or “absent.”

3.2â•‡Role of Screening Procedures in Identification Screening mass spectrometric procedures, often used as a first step of identification, may be divided into two main groups: target, substance-oriented screening and nontarget screening. In the case of nontarget screening, which is often used in clinical and forensic toxicology as “general unknown” analysis, capillary GC-EI-MS is a logical choice. Full-scan mass spectra, obtained with EI-MS, are not very dependent on the instrument and chromatographic conditions applied. Comprehensive libraries of reference EI mass spectra, comprising thousands of substances, are available nowadays [13–15]. This makes possible tentative identification through library search—even without the reference compound. It must be stressed, that the decision concerning preliminary selection and identification based on the statistical analysis of mass spectrum matching with the reference library spectra should be always done by an expert toxicologist. He decides, depending on the case, when the identification level is achieved [10,16,17]. In the case when the reference compound for comparative analysis is not available, the decision concerning the spectrum identity should be taken under utmost consideration, particularly in the case of some “exotic” compounds proposed by the instrument software as candidates for identification. In the full-scan GC-MS-EI, at least four selective ions, including—if possible—molecular ion, should be present in proper abundance ratios. If possible, mass spectra belonging to matrix compounds and affecting the identification should be filtered out. This may greatly enhance the identification power of GC-MS screening [18]. In most identification procedures used in legally sensitive fields, e.g., doping analysis, forensic toxicology, or food quality monitoring, then tentative identification through GC-EI-MS library must be followed by the confirmation step, using the reference compound, run in identical conditions as the analyzed specimen. LC-MS is potentially more amenable for screening purposes than GC-MS since it covers a much broader spectrum of compounds of different polarities. However, this technique suffers several important limitations, both on chromatographic and mass spectrometric side. LC, despite its universality, is a far less selective separation technique than capillary GC. On © 2011 by Taylor and Francis Group, LLC

50


the other hand, mass spectra of compounds collected with various LC-MS instruments, may vary greatly in regard to relative abundance of fragment ions, even if identical nominal conditions are applied [19]. This makes the direct use of mass spectral data acquired in another laboratory very difficult. For these reasons, LC-MS is an excellent technique for targeted screening or confirmation, but it is not easily applicable for a broad-spectrum search, e.g., in “general unknown” analysis. Nevertheless, in the last years several spectral libraries, comprising hundreds of compounds, were developed using LC-MS [20,21], LC-MS-MS [22,23], or LC-MS-time-of-flight (TOF) [24–26]. The reviews of this topic were recently done by Gergov [27] and by Marquet [28]. Target screening and subsequent confirmation are employed if the particular set of compounds is to be identified. This is the case in the search for scheduled, controlled compounds, e.g., drugs of abuse [29], doping substances [30,31], or food contaminants [32]. In this situation, very specific methods, like GC-MS-MS, LC-MS-MS, both in MRM mode, GC-TOF-MS, or GC-MS-SIM, are applicable. Identification is achieved through the comparison of the chromatographic mobility and the presence of particular fragment ions in intensities corresponding to preset values, observed in reference standards. Limited, task-oriented reference libraries were built for particular groups of compounds. Comprehensive reference data libraries, e.g., for pesticides, based on LC-MS, may comprise several hundred substances. The definition of positive identification or confirmation after LC-MS screening may vary. Some authors mentioned high coincidence of at least two of three spectra generated at three fragmentation energies [33], others a match of at least 60% in reverse-fit library search [34] or similarity of at least five of the most abundant ions [35]. LC-MS-MS (negative ionization ESI, MRM mode) was used by Bogusz et al. [36] for detection of chloramphenicol in food samples (chicken or shrimp meat, honey). Three transitions of deprotonated molecule were monitored. The following criteria of positive identification of chloramphenicol were formulated: retention time (RT) of target within ±1% of internal standard (deuterated analog of target), the presence of three product ions originating from the precursor, and the intensity ratios of product ions in the range of ±2 SD of the mean control values, i.e., ±25%. A different identification strategy was applied by Mottier et al. [37] for determination of chloramphenicol in chicken meat with negative ionization LC-MS-MS. These authors took advantage of the presence of two chlorine atoms in the molecule and used two precursor ions: m/z 321 and m/z 323. The transitions of each isotopic form of deprotonated molecule to product ions m/z 152 and m/z 257 were monitored. The identification criteria were as follows: RT of target within ±1% of internal standard (deuterated analog of target), the variability of the intensity ratios of product ions in the range of 15%–25% of the mean control values. © 2011 by Taylor and Francis Group, LLC


51

Since the intensity and sometimes pattern of fragmentation in LC-MS is related to the particular technique and conditions used, it was generally postulated that the reference standard should be analyzed in exactly the same conditions as examined sample, at best in the same analytical run. The requirements concerning quality of mass-spectrometric screening procedures were reviewed and discussed by various authors, like Drummer [38], Stimpfl et al. [39,40], and Maurer [41] in relation to clinical and forensic toxicology, and Thevis and Schänzer [30] in relation to doping analysis.

3.3â•‡Methodical Considerations There are numerous possible factors, which may affect the identification through mass-spectra library, on various steps of identification procedure; the influence of coextracted matrix compounds, incomplete chromatographic separation of compounds, general instrument condition or detector saturation, and peak distortion through excess of the substance. All these factors may change the abundance of ions in a particular mass spectrum and cause mismatching with consequent false interpretation, like false-positive or false-negative identification [42,43]. There are several approaches to optimize the identification process with MS. These approaches may be divided into optimization of sample pretreatment, optimization of chromatographic separation, and optimization of mass spectrometric detection itself. 3.3.1â•‡Optimization of Sample Pretreatment Optimal, matrix-oriented sample pretreatment is of critical importance in GC-EI-MS identification procedure. It may involve cleavage of conjugates, derivatization, or several cleanup steps. Among isolation procedures used in GC-MS screening and identification, liquid–liquid extraction [13] and solidphase extraction (SPE) [44] were mainly used. In the last years, solid-phase micro-extraction (SPME) is more and more applied, as solvent-free method, particularly useful for screening of volatile compounds of natural or synthetic origin [e.g., 45–48]. For some compounds, particularly large molecules with haptenogenic properties, immunoaffinity extraction procedures were developed. Ho et al. [7] isolated insulin originating from various sources (human, bovine, and porcine) from horse plasma by immunoaffinity precipitation with antibodycoated magnetic beads followed by molecular weight centrifugal extraction. Obtained extracts were analyzed by LC-MS-MS, using nanospray ionization source and QTrap mass spectrometer. For screening purposes, single transition to one common tyrosine immonium ion (m/z 136) was applied (Figure 3.1). The confirmation was done with at least three transition © 2011 by Taylor and Francis Group, LLC

52


Intensity (cps)

XIC of + MRM (7 pairs): 1162.5/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL... 26.50

2706 2000

25.54

Humalog

25.78

Human insulin 27.24

1000 0

Max. 8984.7 cps.

22.5

23.0

23.5

24.0

24.5

26.0 25.0 25.5 Time (min)

26.5

27.0

27.79 28.24

27.5

28.0

28.5

Intensity (cps)

XIC of + MRM (7 pairs): 1166.0/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 1.7 × 10–4 cps. 25.52

2000

Novolog

1000 0

25.0 25.5 26.0 26.5 27.0 27.5 28.0 28.5 Time (min) XIC of + MRM (7 pairs): 1157.2/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 2.0 × 10–4 cps. Intensity (cps)

22.5

23.0

23.5

24.0

24.5

25.96

1000

Porcine insulin

500 0

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

Intensity (cps)

XIC of + MRM (7 pairs): 1147.7/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL... 25.24

1500

25.64

1000

28.5

Max. 8895.0 cps.

Bovine insulin 27.97

500 0

28.0

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

28.0

28.5

Intensity (cps)

XIC of + MRM (7 pairs): 1150.8/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 1.9 × 10–4 cps. 25.62

1.00e4

Equine insulin (endogenous)

5000.00 0.00

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

28.0

28.5

Figure 3.1â•‡ Product-ion chromatograms of the targeted insulins obtained from the analysis of a plasma sample spiked with five exogenous insulins at 0.05â•›ng/ mL each. (From Ho, E.N.M. et al., J. Chromatogr. A., 1201, 183–190, 2008. With permission.)



53

characteristics for the particular insulin, taking also RT into account. The method was applied in doping-control analysis, as a tool of differentiation of equine insulin from the exogenous ones. 3.3.2â•‡Optimization of Chromatographic Separation Capillary GC is mature technique, in relation to the efficiency of chromatographic separation. Nevertheless, there are recent examples showing that this art of chromatography may be refined, in order to facilitate identification in complex mixtures or matrices. van der Lee et al. [32] presented a targeted screening procedure for 106 scheduled pesticides and contaminants in animal feed matrix. The procedure was based on solvent extraction, gel permeation chromatography (GPC) cleanup, and two-dimensional GC with full-scan TOF-MS. All compounds were automatically detected at the level exceeding 50â•›ng/mL. Twodimensional GC followed by TOF-MS was also applied by Banerjee et al. [49] for multiresidue analysis of pesticides in grapes. A combination of a nonpolar and a polar capillary column connected in series was used. The method resolved the co-elution problems as observed in full scan one-dimensional GC-MS analysis and allowed chromatographic separation of 51 pesticides within 24â•›min run time with library-searchable mass spectrometric confirmation. The limit of detection improved by 2–12 times on GCxGC-TOF-MS against GC-TOF-MS because of sharper and narrower peak shapes. An automated direct sample introduction (DSI) technique coupled to comprehensive two-dimensional GC-TOF MS was applied for the development of a screening method for 17 polychlorinated dibenzo-p-dioxins/dibenzofurans and 4 non-ortho polychlorinated biphenyls (PCBs) in fish oil [50]. Comparison of instrumental performance between DSI-GCxGC/TOF-MS and the traditional gas chromatographic high-resolution mass spectrometry (GC-HRMS) method showed good agreement of results for standard solutions analyzed in blind fashion. Relatively high tolerance of the DSI technique for lipids in the final extracts enabled a streamlined sample preparation procedure that only required GPC and SPE clean-up with graphitized carbon black. This analytical screening method for has the potential to monitor fish oil contaminated with dioxin and dioxin-like PCBs at or above current food safety limits. Kolbrich et al. [51] applied two-dimensional GC-EI-MS (SIM) with cryofocusing for determination of methylenedioxyethylamphetamine (MDMA) and its metabolites, 3,4-methylenedioxyamphetamine (MDA), 4-hydroxy3-methoxymethamphetamine and 4-hydroxy-3-methoxyamphetamine in human plasma. This assay provided low limits of quantification and the chromatographic system should be suitable for application to other analytes and complex matrices.


54


In contrast to capillary GC, HPLC shows far less effective separation power. The last few years brought distinct progress in this area through introduction of fine-particle columns (particle size below 2â•›μm), requiring much higher working pressure. This technique, known as ultra-performance liquid chromatography (UPLC), enabled much better separation in a shorter time and has been immediately introduced in combination with MS for identification purposes. In the field of doping analysis, UPLC enabled highthroughput analysis, particularly of diuretic compounds. Ventura et al. [52] detected 34 scheduled diuretics and other doping agents in urine extracts, using UPLC-MS-MS in negative and positive ionization mode. Total analysis time was 5â•›min, and the method fulfilled the requirements established by the World Anti-doping Agency (WADA). Thörngren et al. [53] developed UPLC-MS-MS-based screening method of 130 substances (diuretics, central nervous system stimulants, and opiates) for direct injections of urine samples. Samples were injected on a reversed phase column connected to a fast polarity switching and rapid scanning tandem mass spectrometer with an electrospray interface. The software used to evaluate the results produced reports containing a small-sized window for each component and a data table list with flags to indicate any adverse analytical findings in the sample. The report could be processed automatically using application software, which interpret the data and indicate if there is a suspicious sample. One 96-well plate could be analyzed within 16â•›h. Several applications of UPLC-MS concerned pesticide residue analysis. UPLC-TOF-MS was applied for the rapid qualitative and quantitative analysis of 100 pesticides targeted in strawberry [54]. Accurate mass measurement of positive and negative ions allowed their extraction following “full mass range data acquisition” with negligible interference from background or coeluting species observed during UPLC gradient separation (in a cycle time of 6.5â•›min per run). Mass measurement accuracies of ≤5â•›ppm were achieved consistently throughout the separation, mass range, and concentration range of interest thus providing the opportunity to obtain discrete elemental compositions of target ions. In another study [55], 90 pesticides were screened in fruit juices by UPLC-MS-MS (MRM) after simple acetonitrile extraction. The separation was achieved in 11â•›min run. 3.3.3â•‡Optimization of MS Detection Accurate mass determination emerged as one of the most promising identification tools in contemporary MS. The measured elemental mass allows to calculate the elemental formula of the ion, and therefore to confirm the identity of known compound in the case of library search [24] or to identify of an unknown ion. The mass accuracy may be expressed in absolute values,



55

usually in millidaltons (mDa), or in relative values, e.g., in parts per million (ppm). These values are calculated as follows:

mDa; ([(m/z )measured − (m/z )calculated ]) × 1000 ppm; 106 ×

([(m/z )measured − (m/z )calculated ]) (m/z )measured

According to FDA guidelines, the mass accuracy required for the identification/confirmation should be within 5â•›ppm (corresponding to around 2.5â•›mDa) for masses below m/z 500 [5]. Mass accuracy depends on the instrument used; for quadrupole or ion-trap instrument, the mass accuracy of 50–100â•›mDa is possible, for TOF or quadrupole-time-of-flight (QTOF) below 10â•›mDa, for Fourier transform ion cyclotron resonance (FTICR)-MS and orbitrap—1â•›mDa and less. Some new constructions of triple–quadrupole instruments show accurate mass capabilities below 1â•›mDa [56]. Mass resolution is very important parameter related to mass accuracy. Mass resolution defines the ability of a mass spectrometer to separate ions of different m/z values and is usually calculated from the formula: M/ΔM, where M is the m/z value of a single-charged ion, and ΔM, is a difference between the M and the next m/z value ion that can be distinguished from M. ΔM is usually expressed as full width at half-maximum height (FWHM) of two adjacent separable mass spectral peaks. For modern instruments, like TOFs, orbitraps, or FTICR-MS, the resolution of 20,000 and higher is possible. Besides toxicological screening [24,27], high-resolution accurate MS has been applied in other screening and identification procedures. Hernandez et al. [47] developed a procedure based on GC coupled to high-resolution TOF-MS (GC/TOF-MS) for targeted and non-targeted screening of organic pollutants in water. SPME was applied for the isolation of 60 organic pollutants, including pesticides, octyl/nonyl phenols, pentachlorobenzene, and polycyclic aromatic hydrocarbons. The identification was carried out by evaluating the presence of up to five representative m/z ions per analyte, measured at high mass accuracy, and the attainment of their Q/q (Q, quantitative ion; q, confirmative ion) intensity ratio. This strategy led to the detection of target compounds in several water samples at low part-per-billion levels. Full-spectrum acquisition data generated by the TOF-MS analyzer also allowed subsequent investigation of the presence of polybrominated diphenyl ethers and several fungicides in samples after MS data acquisition, without the need to reanalyze the water samples. In addition to targeted screening, nontargeted analysis was also tested by application of deconvolution software. Several organic pollutants that did not form a part of the list of contaminants investigated were identified in the water samples, thanks to the


56


sensitivity of TOF-MS in full-spectrum acquisition mode and the accurate mass information provided by instrument. Several hundreds of crop-protection products were recently banned from use by European and U.S. environmental agencies and therefore became an issue for environment controlling laboratories. Since it was difficult to monitor all these compounds with GC-MS, LC-MS, or LC-MS-MS, Thurman and Ferrer [57] developed a nontargeted screening procedure based on the combination of LC-TOF-MS, LC-IT-MS, and LC-Q-TOF-MS. As reference databases, The Merck Index and ChemIndex, both commercially available, were applied. The identification strategy consisted of four steps: full-scan LC-TOF-MS analysis, library search for empirical formulas and any A+2 isotopes (for halogens or S), LC-ITMS or LC-Q-TOF-MS-MS for structure elucidation, and final comparative standard analysis. Accurate mass determination may be very useful in the analysis of such compounds, which cannot yield characteristic fragment ions in tandem mass spectrometric analysis, particularly in MRM mode. Nielen et al. [58] compared the performance of various high-resolution LC-MS techniques for hormone residue analysis in food samples. The authors used three types of instruments: LC-QTOF-MS, LC-FTIR-MS, and LC-FT-Orbitrap-MS n. The authors stressed the need of optimal sample pretreatment and clean-up for instruments with lower mass accuracy (around 20â•›ppm) since the LC resolution and MS resolution are strongly interrelated and have a major impact on mass accuracy. The instruments with higher mass resolution may accommodate a less completely resolved chromatographic separation. This may be illustrated by the analysis of stanozolol; the inexplicable fragment observed in QTOF-MS (m/z 161.1223 at mass resolution 5000 FWHM) analysis appeared in LC-FTIR-MS as a doublet of ions having minor mass differences (m/z 161.1073 and m/z 161.1324, mass resolution 250,000). The authors postulated resolution of ≥70,000 (FWHM) as sufficient for elucidating of elemental composition of product ions up till m/z 400 (Figure 3.2). Besides high-resolution accurate mass MS, other instrumental solutions were recently applied for identification purposes. Most promising was the application of information dependent acquisition (IDA) in combination with enhanced product ion (EPI) spectrum. This technique has been used by Stanley et al. [8] for the screening of acidic drugs in equine plasma and neutral drugs in equine urine. For plasma, acetonitrile/internal standard precipitation followed by centrifugation was used; urine specimens were only spiked with internal standard and centrifuged. The chromatography consisted of on-line extraction with Oasis HLB column and separation on Chromolith RP-18e column, using isocratic elution. The drugs were detected with QTRAP hybrid tandem MS, equipped with heated nebulizer and TurboIonSpray sources and working in MRM mode. One transition was monitored for each drug. IDA was applied; if the signal was greater than the © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic 100

57

%

161.1223

0

161

(a)

162

m/z

161.1073 C10H13N2

100

161.1324 C12H17

90

Relative abundance

80 70 60 50 40 30 20 10 0 (b)

161.10

161.11

161.12 m/z

161.13

161.14

Figure 3.2â•‡ Characteristic details of (a) the QTOFMS/MS and (b) LTQMS2/FTIR

product ion mass spectra of stanozolol representing one example of the doublet product ions. (From Nielen, M.W.F. et al., Anal. Chim. Acta, 586: 122–129, 2007. With permission.)

preselected value, the EPI spectrum was recorded. Positive ionization was used for 11 neutral drugs and negative for 32 acidic drugs. Unequivocal identification was achieved for almost all drugs. However, in the case of anabolic steroids, highly similar EPI spectra were observed, and the authors found the method unsuited for this group of compounds. Drees et al. [59] compared the identification ability of MRM ratios and MRM-IDA, using QTrap hybrid triple quadrupole/linear ion trap MS. Fourteen selected drugs of abuse were examined at various concentrations. For MRM-only experiments, two transitions were monitored and ion ratios were calculated. In the case of © 2011 by Taylor and Francis Group, LLC

58


MRM-IDA, the product mass spectrum (EPI) was recorded when the product ion abundance exceed the defined level. Both methods performed well at low concentrations; at very high concentrations, the MRM-IDA method gave better chance of confirmation. Thermo Scientific introduced recently a new interface—the FAIMS (highfield asymmetric waveform ion mobility spectrometry). The FAIMS interface is located in the atmospheric pressure region between the ion source and the mass spectrometer and allows to selectively isolate target compounds based on a number of physical properties, including charge state and molecular conformation. FAIMS provides an increase in selectivity by utilizing changes that occur in the behavior of an ion when subjected to alternating low and high electric fields. These changes in ion behavior are used by FAIMS to provide ion filtering, resulting in LC-MS chromatograms with reduced chemical background and endogenous interferences. FAIMS is compatible with quadrupole and ion-trap instruments and found applications for identification of compounds in complex matrices, e.g., in doping analysis or in pharmaceutical analysis [60]. A combination of LC-MS-MS and/or GC-MS-nitrogen-phosphorous detector (NPD) was used by Thevis et al. [61] to identify compounds present in confiscated black market drug preparations, containing mainly anabolic steroids or sexual stimulants. The drugs were isolated with simple methanolic extraction and subjected to LC-MS-MS examination on QTrap instrument equipped with ESI source working in MRM mode. Gradient elution was applied in order to separate all compounds. For each drug, three transitions were monitored. For GC-MS-NPD examination, an inlet splitter was applied, and the injected sample was separated on two identical columns; one was connected with EI-MS detector, the other with NPD. The calculation of relative-ion intensities (ion ratios) is usually applied as one of identification features. Bogusz et al. [36] and Mottier et al. [37] used intensity ratios of product ions in LC-MS-MS procedures for identification of chloramphenicol in food samples. Feng et al. [62] developed LC-MS-MS procedure for simultaneous determination of 30 various drugs of abuse in urine. Three transitions were monitored for each drug. The intensity ratios of the two fragment ions to most abundant fragment ion were calculated and used to confirm the identity. These ratios should be in the range of ±3 SD as determined in the validation procedure. Concheiro et al. [63] published an LC-MS-MS study on the simultaneous determination of various drugs of abuse in urine. The procedure was based on SPE in the presence of deuterated analogs, separation on an Atlantis dC18 column and ESI MS-MS (positive ions) in MRM mode. Two transitions were monitored for each drug. Among the usual validation parameters, like linearity, recovery, within-day and between-day precision, and accuracy, limit of detection and quantitation, freeze-and-thaw stability, and matrix effect, also relative ion intensities © 2011 by Taylor and Francis Group, LLC


59

were tested, in within-day and between-day mode. The ion intensities were calculated at two concentration levels in within-day and between-day regime. It was demonstrated that the variability of results was much higher in between-day experiments than in within-day experiments (Table 3.1). The authors concluded that relative ion intensity should be taken with caution as an identification criterion, and strongly recommended to analyze standard sample with the real sample in the same day, in order to fulfill the established criteria. Stein and Heller (the authors are associated with NIST and FDA, respectively) published a very important study on the factors responsible for falsepositive identification with MS [64]. The following experiments were done: From the reduced NIST/EPA/NIH mass spectral library [15], comprising 96,464 entries, every tenth spectrum (roughly 9600 spectra) was chosen as a search spectrum. These search spectra were eliminated from the library before performing the search, so all library spectra that matched the search spectrum for a given set of constraints were false positives. Search experiments were performed using different number of peaks for matching, the number ranging from one to eight peaks. The abundance window of 0.25 was set, i.e., the search and library spectrum at given m/z was considered a match if the difference in abundance was less than 25%. It was shown that the number of peaks as well as peak abundance clearly reduced the falsepositive probability. The authors concluded that more than three fragment ions (in full scan or SIM mode) should be used for identification and the m/z values of that should be carefully selected. Highly probable peak correlations such as 14â•›amu difference (methyl group loss) or 18â•›amu (water loss) should Table 3.1â•… Variability of Relative Ion Intensities of Various Drugs

Compound

Within-Day Relative Ion Intensities (%)

Between-Day Relative Ion Intensities (%), Low Concentration

Between-Day Relative Ion Intensities (%), High Concentration

EME BEG A MA MDA MDMA Morphine Codeine 6-AM Methadone EDDP LSD

55.6â•›±â•›3.7 58.8â•›±â•›5.8 58.8â•›±â•›9.8 66.7â•›±â•›2.7 21.7â•›±â•›5.8 26.3â•›±â•›2.2 38.5â•›±â•›4.7 37.0â•›±â•›6.8 62.5â•›±â•›6.3 50.0â•›±â•›3.3 50.0â•›±â•›3.3 22.2â•›±â•›5.6



Source: From Concheiro, M. et al., J. Anal. Toxicol., 31, 573–580, 2007. With permission. © 2011 by Taylor and Francis Group, LLC

60


be avoided. The importance of the use of most appropriate ions (which are usually ions with the highest m/z value and not the ions with the highest intensity) was stressed by Lehotay et al. [11].

3.4â•‡Legal and Regulatory Aspects of Identification Several professional organizations as well as national and international agencies formulated recommendations and guidelines concerning criteria for identification with mass spectrometric methods. These documents may be divided into two main groups. The first group form strict legal regulations or requirements on national and international level, as issued by U.S. government agencies for clinical laboratories [65], for pesticide testing laboratories [9], and for workplace drug testing [66], by European Union [67], or by WADA for doping control [68]. The second group comprises nonbinding recommendations and guidelines of professional organizations on national and international level, like the guidelines of the FDA [5], Association of Official Racing Chemists (AORC) [69], College of American Pathologists (CAP) [70], Society of Forensic Toxicologists [71], or German Society of Toxicological and Forensic Chemistry [72]. 3.4.1â•‡FDA Guidance U.S. FDA published final guidance for the development, evaluation, and application of mass spectrometric methods for confirming the identity of animal drug residues [5]. The history of development of this document, which has been published in 2003, was described by Hill [73]. FDA stressed that the guidance contains nonbinding recommendations and does not establish legally enforceable responsibilities. Therefore, throughout the text the word “should” has been used instead of “shall,” e.g., used in the WADA document concerning identification criteria. According to FDA guidelines, the confirmatory mass spectrometric procedures should address each of the following points: Validation package from originating laboratory containing replicate samples, original and spiked, demonstration of zero false-positive rate, demonstration of ≤10% false-negative rate at the tolerance level, demonstration of ruggedness and non-interference of other drugs or matrix components. Method description, containing also structure and full spectrum of target compound, spectral data on at least three structurally specific ions that completely define the parent molecule or more if nonspecific ions are included, proposed fragment ions structures, consistent with fragmentation patterns, justification for specificity of selected ions or scan range, confirmation and operational criteria, as well as quality-control section. © 2011 by Taylor and Francis Group, LLC


61

Confirmation criteria, in the confirmation procedure, the comparison standard(s) should be analyzed contemporaneously, in the presence of extracted matrix if appropriate. Any of the following MS chromatograms may be used: total ion chromatogram (TIC), reconstructed ion chromatogram (RIC), SIM, or selected reaction monitoring (SRM). Flow injection analysis is discouraged. The chromatographic peak should exceed a signalto-noise threshold of 3:1, and the RT should not differ from the RT of standard more than 2% for GC-MS or 5% for LC-MS. Mass spectral matching criteria vary depending on the MS acquisition mode: In the full-scan and partial-scan MS1, the spectrum should contain at least three structurally specific ions, and the spectrum should visually match the spectrum of the standard. An acceptability range of ±20% on relative abundance of major ions is recommended. Library search algorithms should not be used to confirm identity. All structurally specific ions, mentioned in the method description should be present and their relative abundances should correspond to those of standard. The presence of other unrelated prominent ions should be explained (e.g., from matrix compounds). If background subtraction was used, it should be specified and indicated. In the MS1 SIM, relative abundances of three structurally specific ions should match the standard within ±10% (absolute). In the case of four or more structurally specific ions, the match level is ±15% (absolute). Relative abundances for more than three ions, which include less specific ions like isotopes or due to loss of water, should match the comparison standard within ±10%. In the full-scan and partial-scan MSn, the spectrum should visually match the spectrum of the standard, and there should be general correspondence between relative abundances obtained in sample and standard. All structurally specific ions, mentioned in the method description should be present. If structurally specific precursor ion completely dissociates to product ions, the appearance of at least two structurally specific product ions should be sufficient in MSn+1. The presence of other unrelated prominent ions should be explained (e.g., from matrix compounds). If background subtraction was used, it should be specified and indicated. In MSn SRM, if a precursor ion is completely dissociated, the relative abundance of structurally specific product ions should match the comparison standard within ±10% in the case when two ions were monitored, and within ±20% in the case when three or more ions were monitored. Quality control should include the following points: establishing system suitability, running at least one control and one fortified control sample, control of possible carryover. FDA formulated general recommendations concerning exact mass measurements in confirmatory analysis. Exact mass measurement is defined by © 2011 by Taylor and Francis Group, LLC

62


FDA as mass assignment to more than one decimal place. The use of this technique will be evaluated on a case-by-case basis, until specific standards applied in residue analysis are generally accepted. It was recommended that the instrument design and operating conditions should be described; the mass resolution and peak purity should be demonstrated to be sufficient to provide only one predominant component per mass peak in the range of the peak of interest. Mass accuracy for reference standards should be expressed in ppm. At lower mass (m/z below 500), 5â•›ppm difference may be sufficient to confirm a unique elemental composition. At masses above m/z 500 is certainly not enough. If multiple candidates occur within the mass measurement, the alternatives should be individually evaluated for their reasonableness. 3.4.2â•‡U.S. Pesticide Agency Requirements U.S. Pesticide Agency published standard operating procedure (SOP) for identification, confirmation, and quantitation of pesticide residues using GC and LC with mass spectrometric detection [9]. This SOP was written in order to combine the requirements of all MS and MS/MS procedures used in pesticide residue analysis into a single document. It was generally based on FDA recommendations presented above but also showed some differences. The SOP represents the minimum requirements for pesticide analysis, and each laboratory shall have own written procedures, implementing these requirements. In the case of full-scan GC-MS, the spectra should be recorded in the range of 20–500â•›amu. A minimum of three structurally specific ions, preferably including a molecular ion, meeting the signal-to-noise 3:1 ratio are required. Isotopic cluster ions may be used as one of three significant ions. The relative intensity ratios of each ion should be within ±20% of the ratios observed in the reference standard. The use of library search software for EI analysis is mandatory. The use of library search in “soft” ionization techniques, e.g., GC-CI-MS was discouraged. Chromatographic criteria (RT accuracy) for GC-MS were not formulated in this document. In GC-MS-MS analysis, RT of the target compound shall not differ more than ±0.05â•›min from the reference standard or ±0.01 relative retention time (RRT). In MS-MS analysis, two transitions from one precursor ion or from two precursors should be monitored. The relative intensity ratios of each ion should be within ±20% of the ratios observed in the reference standard, and the abundance of each ion should exceed a signal-to-noise ratio of 3:1. For LC-MS analysis, the apparatus should be capable of scanning 50–1200â•›amu in full-scan mode. RT of target compound shall not differ more than ±0.5â•›min from the reference standard or ±0.01 RRT. A minimum of three structurally specific ions, preferably including protonated or deprotonated molecule, meeting the signal-to-noise ratio 3:1 are required. Isotopic cluster ions may be used as one of three significant ions. The relative intensity © 2011 by Taylor and Francis Group, LLC


63

ratios of each ion should be within ±20% of the ratios observed in the reference standard. In LC-MS/MS analysis, chromatographic requirements (RT or RRT) are the same as for LC-MS, whereas mass spectrometric requirements are identical as for GC-MS-MS. 3.4.3â•‡ European Commission Requirements The European Commission published in 2002 [67] lists requirements concerning performance of analytical methods and interpretation of results. In this document, performance criteria for mass spectrometric detection were formulated. It was stated that on-line or off-line chromatographic separation is a prerequisite for mass spectrometric confirmation. For both GC-MS and LC-MS, the minimum acceptable RT for the target compound should be at least twice the RT corresponding to the void volume of the column (i.e., the dead time, or Rto). The RRT of the analyte (ratio target:internal standard) should not differ from that of the reference standard more than ±0.5% for GC and ±2.5% for LC. Mass spectrometric detection shall be carried out in full-scan mode, SIM, as well as MS-MSn techniques such as SRM or other techniques in combination with appropriate ionization modes. For full-scan MS, the presence of minimum four diagnostic ions with relative intensity more than 10% in the reference spectrum is obligatory. The molecular ion should be included if its intensity is above 10%. For SIM, the molecular ion should be preferably included. The signal-tonoise ratio for each diagnostic ion shall be ≥3:1. Maximum permitted tolerances for relative ion intensities are as in the Table 3.2. For identification, EC defined identification points (IPs) system. In this system, at least four points are required for the confirmation of identity. The number of points earned by a particular technique is shown in the Table 3.3. According to these criteria, e.g., four characteristic ions are needed if GC-MS or LC-MS is applied, or one precursor and two products for GC-MS-MS or LC-MS-MS. Nielen et al. [58] proposed additional identification criteria to the four-point classification, based on HRMS (Table 3.4). The arbitrary IP system has been generally criticized by Lehotay et al. [11] for lack of appropriate scientific justification. These authors asked: For example, what are the differences in the rates of false positives and false negatives by requiring four IPs for banned substances over three IPs for registered compounds? Why should a high-resolution ion always be worth two points in the IP system, and MS2 ions always be worth 1.5, whereas the (pseudo)molecular ion is only worth 1? What is defined as “high” resolution? © 2011 by Taylor and Francis Group, LLC

64


Table 3.2â•…Maximal Permitted Tolerances in Abundance Ratios in Comparison with the Standard Relative Intensity (% of Base Peak)

>50% >20%–50% >10%–20% ≤10%

EC [67]

EC [67]

CAP [70]

GC-EI-MS

GC-CI-MS, GC-MSn, LC-MS, LC-MSn ±20% ±25% ±30% ±50%

LC-MS

±10% ±15% ±10% ±50%

±20% ±25% ±30% ±50%

n

WADA [68] GC-EI-MS

±10% Absolute ±20% Relative ±5% Absolute

WADA [68] GC-CI-MS; GC-MSn LC-MS; LC-MSn ±10% Absolute ±25% Relative ±10% Absolute

Notes: FDA [5] used flat rate of permitted tolerances: within ±20% of relative abundance for MS scan and MSn SRM (three transitions) and ±10% for MS-SIM and MSn SRM (three transitions). PDP [9] used flat rate of ±20% of relative abundance (absolute difference) for all MS techniques. AORC [69] used flat rate of ±10% absolute or ±30% relative abundance (whichever is greater) for single-stage MS, and ±20% absolute or ±40% relative (whichever is greater) for MS-MS and related techniques. Table 3.3â•…IPs Earned by Various MS Techniques according to EC MS Technique LR-MS LR-MSn precursor ion LR-MSn product ion HR-MS HR-MSn precursor ion LR-MSn product ion

IPs Earned per Ion 1.0 1.0 1.5 2.0 2.0 2.5

Source: From EU Commission, Off. J. Eur. Comm., L221, 8, 2002. Note: LR-MS, low-resolution mass spectrometry; HR-MS, high-resolution mass spectrometry.

3.4.4â•‡WADA Criteria The WADA [68] formulated criteria that must be fulfilled in order to identify a prohibited, scheduled substance in urine or blood of an examined athlete with chromatographic–mass spectrometric procedures. These criteria are divided into separation and detection requirements and are as follows. © 2011 by Taylor and Francis Group, LLC


65

Table 3.4â•… Proposal for Additional LC/MS Criteria to Be Implemented in EC Recommendations [67] Given by Nielen et al. [58] Mass Resolution (FWHM)

Mass Accuracy (mDa)

Screening Confirmation

10,000 ≥10,000

±50 (window) ≤5

HR confirmation

≥20,000

≤5

MS/MS identification of unknowns

≥10,000

≤5

Goal

Remarks Relative retention time ≤2.5% 1.5 identification points/ion or product ion; at least one ion ratio; relative retention time ≤2.5%; N.B.: LC/biogram: 1 additional identification point Two identification points/ion or product ion; at least one ion ratio; relative retention time ≤2.5% Confirm postulated structure by NMR and/or confirm accurate masses at mass resolution ≥70,000 (FWHM)

3.4.4.1 Chromatographic Separation Requirements For capillary GC, the RT of the analyte shall not differ by more than 1% or ±0.2â•›min (whichever is smaller) from that of the same substance in spiked urine sample. For HPLC, the RT of the analyte shall not differ by more than 2% or ±0.4â•›min (whichever is smaller) from that of the same substance in spiked urine sample. These criteria may be relaxed, if the shift in RT may be explained (e.g., by sample overload). 3.4.4.2 Mass Spectrometric Requirements 3.4.4.2.1â•‡ Full-Scan Modeâ•… Full-scan or partial-scan mode is the preferred approach to identification. A partial scan may begin at an m/z value greater than any abundant ion due to the derivatizing agent or chemical ionization reagent. All diagnostic ions with a relative abundance greater than 10% in the reference spectrum obtained from a reference material must be present in the spectrum of the unknown peak. The relative abundance of three diagnostic ions shall not differ by more than the defined amount (see Table 3.2) from the relative intensities of the same ions observed in the reference spectrum (obtained from spiked urine, reference collection sample, or reference material). It is not permissible to collect additional ions and select those ratios that are within defined tolerance. If the computer-based mass spectral library searching or matching is used, the results should be reviewed by a qualified scientist. If three diagnostic ions with a relative abundance greater than 5% are not available, a second derivative, yielding different diagnostic ions shall be © 2011 by Taylor and Francis Group, LLC

66


prepared, or a second ionization or fragmentation technique, based on different physical principle shall be used. In any case, a minimum of two diagnostic ions is mandatory for each mass spectrum. 3.4.4.2.2â•‡ SIM Modeâ•… At least three diagnostic ions must be acquired, with the signal-to-noise ratio >3 for the least intense ion. The relative intensities of ions shall not differ by more than the defined amount (see Table 3.2) from the relative intensities of the same ions observed in the reference spectrum (obtained from spiked urine, reference collection sample, or reference material). For diagnostic ions with a relative abundance of less than 5% in the reference, the ion must be present in the unknown. The concentration of detected compound should be comparable with those in the reference sample. If three diagnostic ions are not available, a second derivative shall be prepared, or a second ionization or fragmentation technique, based on different physical principle shall be used. In any case, a minimum of two diagnostic ions is mandatory for each mass spectrum. 3.4.4.2.3â•‡ Tandem MS Detectionâ•… The data can be acquired either in fullscan or SRM mode. The precursor ion should be present in both modes. When monitoring more than one product ion, the relative intensities of any of the ions shall not differ by more than the amount given in the table from the relative intensities acquired from a spiked reference sample. The signalto-noise ratio for the least intense ion should be greater than 3. For a diagnostic ion with a relative abundance of less than 5% in the reference, the ion must be present in the unknown. 3.4.5â•‡AORC Criteria The AORC consists of individuals, not laboratories, and is limited to those concerned with the detection of drugs in racing animals. In 2003, AORC published “Guidelines for the Minimum Criteria for Identification by Chromatography and Mass Spectrometry” [69]. It was stated that gas chromatographic separation coupled to mass spectrometric detection can be sufficiently specific to be used alone as a confirmatory method. The analysis should follow specific injection sequence; negative control, system blank, test sample, system blank, and reference sample (reference material or positive control). The following requirements for chromatography and low-resolution MS were formulated. 3.4.5.1 Chromatography When a suitable internal standard was used, the RRT should not vary from that in the reference sample by more than ±1% for GC and ±2% for LC. The RT value should not vary more than ±1% or 6â•›s for GC and ±2% for LC. These figures concerned “conventional” GC and LC. If high-efficiency separation techniques © 2011 by Taylor and Francis Group, LLC


67

were used, the laboratories should set appropriate criteria for the technique used. It must be noted, however, that capillary GC received already status of conventional method, whereas packed GC columns are hardly used nowadays. 3.4.5.2 Low-Resolution Mass Spectrometry A minimum of three ions is required for any full-scan technique. The ions selected should be a molecular ion, quasi-molecular ion of fragment ion whose presence and abundance are characteristic of the test substance. The molecular ion or quasi-molecular ion must be included, if it is present at relative abundance ≥5% in the test spectrum. For product-ion scan MS/MS, the selection of the precursor ion should be avoided. However, it may be included in the case of insufficient ions, provided its relative abundance is between 10% and 80% in the test spectrum. Further techniques or derivatizations may be used if a single technique produces less than three ions suitable for matching. The signal-to-noise ratio of any selected ion must be well above 3:1 in the single ion traces. Within the common mass range, all ions with relative abundance >10% that can be ascribed to the analyte and appearing in the reference spectrum must also be present in the test spectrum. The maximum permitted tolerances for the matching ions for single-stage MS was set at 10% absolute or 30% relative, whichever is greater, and for MS-MS at 20% absolute or 40% relative, whichever is greater. The presence of extraneous ions with m/z larger than 100 in the test spectrum should not exceed 20% relative abundance, unless it can be demonstrated to be extraneous using extracted ion chromatograms. In the case when SIM is used instead of full-scan analysis, a minimum of four ions should be selected for matching, and with stricter tolerances on their relative abundances than those required for full-scan techniques. 3.4.6â•‡ CAP Criteria The CAP in their “Chemistry and Toxicology Checklist” of the Laboratory Accreditation Program formulated requirements, relevant for identification with chromatographic–mass spectrometric methods [70]. In the case of single-stage GC-MS or LC-MS, the identification should be done on the base of ion ratios, using at least two ion ratios, whenever possible. Suggested tolerance limit for GC-MS is ±20% of those of calibrators, for LC-MS the limit is ±30%. If only one ratio of two characteristic ions is available, it may be acceptable if there are other identifying characteristics, e.g., RT. The internal standard should be identified with at least one ion ratio. If full-scan MS is used, the laboratory should set and validate its own threshold of “spectral match” or fit for identification purposes. For tandem MS (GC-MS-MS or LC-MS-MS) in SRM mode, at least one transition and one ion ratio should be monitored, together with RT. However, © 2011 by Taylor and Francis Group, LLC

68


Table 3.5â•…Summary of Identification Requirements as Formulated by Various Organizations Parameter Method GC-MS/RT tolerance GC-MS/RRT tolerance LC-MS/RT tolerance LC-MS/RRT tolerance MS scan minimal number of ions MS SIM minimal number of ions MSn scan minimal number of ions MSn SRM number of transitions HRMS minimal number of ions Signal-to-noise threshold

FDA [5]

EC [67]

2%

WADA [68]

PD [9]

1% or 0.2′

0.05′

1%

0.01′

1% or 0.01′

0.5′

2%

0.1

2% or 0.02′

0.5% 5%

2% or 0.4′ 2.5%

CAP [70]

AORC [69]

3

4

3

3

3

3

3

4

3

3

3

4

3

4

3

3

2

2

2

2

2

3

3

3

3

2 3

3

3

if enough ions of sufficient abundance exist, two or more ion ratios should be monitored. Ion ratios determined from full-scan analysis are an acceptable identification method and should fulfill the same criteria as for SRM mode. Tolerance limits should be adequate to the method employed and should be supported by references or own data. In another approach, a twofold acceptance criteria of data is applied, for at least three ion ratios and scoring system according to EC requirements [64]. The tolerances of ion ratios differ according to the abundance of ions (see Table 3.2). Table 3.5 shows the summary of requirements as formulated by various organizations.

3.5â•‡ Closing Remarks The criteria of identification of compounds with chromatography-MS are certainly not chiseled in stone like the Ten Commandments. It is rather a moving target, changing its position in relation to actual knowledge, and continuously setting new requirements, which vary according to particular discipline and final task of the analysis. It is understandable that the strictest © 2011 by Taylor and Francis Group, LLC


69

requirements are set in these areas, where the results of identification bring legal sanctions. For these reasons, several organizations issued more or less detailed conditions, recommendations, or guidelines, defining minimal attributes necessary for identification. These documents concern both chromatographic and mass spectrometric aspects of the analysis. There is general agreement concerning the kind of parameters to be controlled, e.g., RT, number of ions, or ion intensity ratios. However, the exact numerical criteria, formulated by different bodies or organizations, show distinct variations. This may lead to confusing situation, since the same result may be interpreted in different way. This was already criticized by de Zeeuw [10] who stated: “It cannot be that one and the same test result may lead to positive identification when using Guideline A and a negative identification when using Guideline B.” The same problem has been raised by van Eenoo and Delbeke [74], who compared the regulations concerning mass spectrometric identification in doping and residue analysis and found differences, which may lead to different interpretation of the same result. Moreover, they observed that none of organizations involved have defined a minimum scan range for full-scan MS. According to the authors, it seems illogical that different sets of criteria exist for fields of analysis that are so close related. More recently, Faber [75] discussed the inconsistencies between and within various recommendations concerning residue and doping analysis. Such lack of internal consistency in criteria for acceptable variability of ion abundance ratios (as depicted in Table 3.2) causes paradoxical situation, as shown in the Figure 3.3. Faber [75] proposed a statistics-based interpretation of results, based on characterization of uncertainty in the measurement result.

10 abs

25 rel

15 abs

Tolerance ()

15 12.5 10 6.25

0

25

50

75

100

Relative abundance ()

Figure 3.3â•‡ WADA tolerance as a function of relative abundance ratio for MS-MS

analysis results. (From Faber, N.M., Accred. Qual. Assur., 14, 111, 2009. With permission.)


70


All valid recommendations, which are products of common knowledge in given discipline, should be treated as momentary, frozen picture of the present situation on the field of analytical identification. As Hill wrote: “Regulatory guidances are not a substitute for good science, they do however provide a framework that should initiate the questions why and how” [73]. It will be always the final task of the expert involved in identification to answer the question: “Did I identify this compound according to the best available knowledge?” besides the question: “Did I fulfill all formal conditions, necessary for identification?” At this point, professional ethics meets the professional competence.

References 1. http://www.thefreedictionary.com/identification (accessed March 3, 2009). 2. http://en.wikipedia.org/wiki/Identification_(information) (accessed March 3, 2009). 3. http://wordreference.com/definition/identification (accessed March 3, 2009). 4. de Zeeuw R.A. and Franke J.P. 2000. General unknown analysis. In: Forensic Science: Handbook of Analytical Separations, vol. 2. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 567–599. 5. Guidance for Industry. 2003. Mass spectrometry for confirmation of the identity of animal drug residues. U.S. Department of Health and Human Services. Food and Drug Administration, Center for Veterinary Medicine, Laurel, MD, May 1. Available at: http://www.fda.gov/downloads/AnimalVeterinary/ GuidanceComplianceEnforcement/GuidanceforIndustry/UCM052658.pdf 6. Segura J., Ventura R., Marcos J., and Gallego R.G. 2008. Doping substances in human and animal sport. In: Forensic Science: Handbook of Analytical Separations, 2nd edn., vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 699–744. 7. Ho E.N.M., Wan T.S.M., Wong A.S.Y., Lam K.H.K., and Stewart B.D. 2008. Doping control analysis of insulin and its analogues in equine plasma by liquid chromatography-tandem mass spectrometry. J. Chromatogr. A 1201: 183–190. 8. Stanley S.M.R., Wee W.K., Lim B.H., and Foo H.C. 2007. Direct-injection screening for acidic drugs in plasma and neutral drugs in equine urine by differentialgradient LC–LC coupled MS/MS. J. Chromatogr. B 848: 292–302. 9. U.S. Department of Agriculture. 2007. Agriculture Marketing Service, Science & Technology, Pesticide Data Program, January 1. Available at: http://www.ams. usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5061501 10. de Zeeuw R.A. 2004. Substance identification: The weak link in analytical toxicology. J. Chromatogr. B 811: 3–12. 11. Lehotay S.L., Mastovska K., Amirav A., Fialkov A.B., Alon T., Martos P.A., de Kok A., and Fernandez-Alba A. 2008. Identification and confirmation of chemical residues in food by chromatography-mass spectrometry and other techniques. Trends Anal. Chem. 27: 1070–1090. 12. Bethem R., Boison J., Gale J., Heller D., Lehotay S., Loo J., Musser S., Proce P., and Stein S. 2003. Establishing the fitness for purpose of mass spectrometric methods. J. Am. Soc. Mass Spectrom. 14: 528–541. © 2011 by Taylor and Francis Group, LLC


71

13. Maurer H.H., Pfleger K., and Weber A. 2007. Mass Spectral Library of Drugs, Poisons, Pesticides, Pollutants, and their Metabolites. Weinheim, Germany: Wiley-VCH. 14. McLafferty F.W. 2001. Registry of Mass Spectral Data, 7th edn. New York: Wiley. 15. US Department of Commerce. 2005. NIST/EPA/NIH Mass Spectral Library. New York: Wiley. 16. Rivier L. 2003. Criteria for the identification of compounds by liquid chromatography-mass spectrometry and liquid chromatography-multiple mass spectrometry in forensic and doping analysis. Anal. Chim. Acta 492: 69–82. 17. Rivier L. 2006. Identification and confirmation criteria for LC-MS. In: Applications of LC-MS in Toxicology, A. Polettini, ed. London, U.K.: Pharmaceutical Press, pp. 97–109. 18. Stimpfl T., Demuth W., Varmuza K., and Vycudilik W. 2003. Systematic toxicological analysis: Computer-assisted Identification of poisons in biological materials. J. Chromatogr. B 789: 3–7. 19. Bogusz M.J., Maier R.D., Kruger K.D., Webb K.S., Romeril J., and Miller M.L. 1999. Poor reproducibility of in-source collisional atmospheric pressure ionization mass spectra of toxicologically relevant drugs. J. Chromatogr. A 844: 409–418. 20. Weinmann W., Wiedemann A., Eppinger B., Renz M., and Svoboda M. 1999. Screening for drugs in serum by electrospray ionization/collision-induced dissociation and library searching. J. Am. Soc. Mass Spectrom. 10: 1028–1037. 21. Saint-Marcoux F., Lachatre G., and Marquet P. 2003. Evaluation of an improved general unknown screening procedure using liquid chromatography-electrospray mass spectrometry and high performance liquid chromatography-diode array detection. J. Am. Soc. Mass Spectrom. 14: 14–22. 22. Weinmann W., Gergov M., and Goerner M. 2000. MS/MS libraries with Â�triple-quadrupole tandem mass spectrometers for drug identification and drug screening. Analysis 28: 934–941. 23. Marquet P., Saint-Marcoux F., Gamble T.N., and Leblanc L.J. 2003. Comparison of a preliminary procedure for the general unknown screening of drugs and toxic compounds using a quadrupole-linear ion-trap mass spectrometry with a liquid chromatography-mass spectrometry reference technique. J. Chromatogr. B 789: 9–18. 24. Gergov M., Boucher G.B., Ojanpera I., and Vuori E. 2001. Toxicological screening of urine for drugs by liquid chromatography/time-of-flight mass spectrometry with automated library search based on elemental formulas. Rapid Commun. Mass Spectrom. 15: 521–526. 25. Decaestecker T.N., Vande Casteele S.R., Wallemacq P.E., van Peteghem C.H., Defore D.L., and van Bocxlaer J.F. 2004. Information-dependent acquisitionmediated LC-MS/MS screening procedure with semiquantitative potential. Anal. Chem. 76: 6365–6373. 26. Nielen M.W., Bovee T.F., van Engelen M.C., Rutgers P., Hamers A.R., van Rhijn J.A., and Hoogenboom L.A. 2006. Urine testing for designer steroids by liquid chromatography with androgen bioassay detection and electrospray quadrupole time-of-flight mass spectrometry identification. Anal. Chem. 78: 424–431. 27. Gergov M. 2008. Forensic screening with liquid chromatography-mass spectrometry. In: Forensic Science: Handbook on Analytical Separations, vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 491–511. © 2011 by Taylor and Francis Group, LLC

72


28. Marquet P. 2006. Identification and confirmation criteria for LC-MS. In: Applications of LC-MS in Toxicology, A. Polettini, ed. London, U.K.: Pharmaceutical Press, pp. 111–130. 29. van Thuyne W., van Eenoo P., and Delbeke F.T. 2007. Comprehensive screening method for the qualitative detection of narcotics and stimulants using single step derivatization. J. Chromatogr. B 857: 259–265. 30. Thevis M. and Schänzer W. 2005. Examples of doping control analysis by liquid chromatography-tandem mass spectrometry: Ephedrines, beta-receptor blocking agents, diuretics, sympaticomimetics, and cross-linked hemoglobins. J. Chromatogr. Sci. 43: 22–31. 31. Georgakopoulos C.G., Vonaparti A., Stamou M., Kiousi P., Lyris E., Angelis Y.S., Tsoupras G., Wuest B., Nielen M.W., Panderi I., and Koupparis M. 2007. Preventive doping control analysis: Liquid and gas chromatography time-offlight mass spectrometry for detection of designer steroids. Rapid Commun. Mass Spectrom. 21: 2439–2446. 32. van der Lee M.K., van der Weg G., Trang W.A., and Mol H.G. 2008. Qualitative screening and quantitative determination of pesticides and contaminants in animal feed using comprehensive two-dimensional gas chromatography with time-of-flight mass spectrometry. J. Chromatogr. A 1186: 325–339. 33. Hough J.M., Haney C.A., and Voyksner R.D. 2000. Evaluation of electrospray transport CID for the generation of searchable libraries. Anal. Chem. 72: 2265–2270. 34. Venisse N., Marquet P., Duchoslav E., Dupuy J.L., and Lachâtre G. 2003. A general unknown screening procedure for drugs and toxic compounds in serum using liquid chromatography-electrospray-single quadrupole mass spectrometry. J. Anal. Toxicol. 27: 7–14. 35. Bristow A.W., Nichols W.F., Webb K.S., and Conway B. 2002. Evaluation of protocols for reproducible electrospray in-source collisionally induced dissociation on various liquid chromatography/mass spectrometry instruments and the development of spectral libraries. Rapid Commun. Mass Spectrom. 16: 2374–2386. 36. Bogusz M.J., Hassan H., Al-Enazi E., Ibrahim Z., and Al-Tufail M. 2004. Rapid determination of chloramphenicol and its glucuronide in food products by liquid chromatography–electrospray negative ionization tandem mass spectrometry. J. Chromatogr. B 807: 343–356. 37. Mottier P., Parisod V., Gremaud E., Guy P.A., and Stadler R.H. 2003. Determination of the antibiotic chloramphenicol in meat and seafood products by liquid chromatography–electrospray ionization tandem mass spectrometry. J. Chromatogr. B 994: 75–84. 38. Drummer O.H. 2007. Requirements for bioanalytical procedures in postmortem toxicology. Anal. Bioanal. Chem. 188: 1495–1503. 39. Stimpfl T. 2006. General Unknown Screening Using GC-MS. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8, W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 846–852. 40. Stimpfl T. and Vycudilik W. 2004. Automatic screening in postmortem toxicology. Forensic Sci. Int. 142: 115–127. 41. Maurer H.H. 2006. Hyphenated mass spectrometric techniques—Indispensable tools in clinical and forensic toxicology and in doping control. J. Mass Spectrom. 41: 1399–1413. © 2011 by Taylor and Francis Group, LLC


73

42. Maurer H.H. and Peters F.T. 2006. Analyte identification using library searching in GC-MS and LC-MS. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8. W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 115–121. 43. Maurer H.H. 2008. Forensic screening with GC-MS. In: Forensic Science: Handbook on Analytical Separations, vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier, pp. 425–445. 44. Drummer O.H. 1999.Chromatographic screening techniques in systematic toxicological analysis. J. Chromatogr. B 733: 27–45. 45. Pontes M., Marques J.C., and Câmara J.S. 2007. Screening of volatile composition from Portuguese multifloral honeys using headspace solid-phase microextraction-gas chromatography-quadrupole mass spectrometry. Talanta 74: 91–103. 46. Buszewski B., Ulanowska A., Ligor T., Jackowski M., Kłodziñska E., and Szeliga J. 2008. Identification of volatile organic compounds secreted from cancer tissues and bacterial cultures. J. Chromatogr. B 868: 88–94. 47. Hernandez F., Portolés T., Pitarch E., and López F.J. 2007. Target and nontarget screening of organic micropollutants in water by solid-phase microextraction combined with gas chromatography/high-resolution time-of-flight mass spectrometry. Anal. Chem. 79: 9494–9504. 48. Brown S.D., Rhodes D.J., and Pritchard B.J. 2007. A validated SPME-GC-MS method for simultaneous quantification of club drugs in human urine. Forensic Sci. Int. 171: 142–150. 49. Banerjee K., Patil S.H., Dasgupta S., Oulkar D.P., Patil S.B., Savant R., and Adsule P.G. 2008. Optimization of separation and detection conditions for the multiresidue analysis of pesticides in grapes by comprehensive two-dimensional gas chromatography-time-of-flight mass spectrometry. J. Chromatogr. A 1190: 350–357. 50. Hoh E., Lehotay S.J., Mastovska K., and Huwe J.K. 2008. Evaluation of automated direct sample introduction with comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry for the screening analysis of dioxins in fish oil. J. Chromatogr. A 1201: 69–77. 51. Kolbrich E.A., Lowe R.H., and Huestis M.A. 2008. Two-dimensional gas chromatography/electron-impact mass spectrometry with cryofocusing for simultaneous quantification of MDMA, MDA, HMMA, HMA, and MDEA in human plasma. Clin. Chem. 54: 379–387. 52. Ventura R., Roig M., Montfort N., Sáez P., Bergés R., and Segura J. 2008. Highthroughput and sensitive screening by ultra-performance liquid chromatography tandem mass spectrometry of diuretics and other doping agents. Eur. J. Mass Spectrom. 14: 191–200. 53. Thörngren J.O., Ostervall F., and Garle M. 2008. A high-throughput multicomponent screening method for diuretics, masking agents, central nervous system (CNS) stimulants and opiates in human urine by UPLC-MS/MS. J. Mass Spectrom. 43: 980–992. 54. Taylor M.J., Keenan G.A., Reid K.B., and Fernández D.U. 2008. The utility of ultra-performance liquid chromatography/electrospray ionization time-offlight mass spectrometry for multi-residue determination of pesticides in strawberry. Rapid Commun. Mass Spectrom. 22: 2731–2746. © 2011 by Taylor and Francis Group, LLC

74


55. Romero-González R., Garrido Frenich A., and Martinez Vidal J.L. 2008. Multiresidue method for fast determination of pesticides in fruit juices by ultra performance liquid chromatography coupled to tandem mass spectrometry. Talanta 76: 211–225. 56. Niessen W.M.A. 2006. High-Resolution Mass Spectrometry and Accurate Mass Determination. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8. W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 27–36. 57. Thurman E.M., and Ferrer I. 2006. Identification of unknown environmental contaminants using multidimensional LC-MS strategies involving TOF-MS, ion-trap MSn, and Q-TOF-MS-MS. In The Encyclopedia of Mass Spectrometry, vol. 8, Hyphenated Methods, ed. W.M.A. Niessen. Amsterdam, the Netherlands: Elsevier, pp. 587–603. 58. Nielen M.W.F., van Engelen M.C., Zuiderent R., and Ramaker R. 2007. Screening and confirmation criteria for hormone residue analysis using liquid chromatography accurate mass time-of-flight, Fourier transform ion cyclotron resonance and orbitrap mass spectrometry techniques. Anal. Chim. Acta 586: 122–129. 59. Drees J.C., Sasaki T.A., Stone J.A., Chen K.H., and Wu A.H. 2007. The advantages and limitations of MRM vs. full scan MS/MS for drug confirmation using LC/MS/MS. Poster K35 on the 55th Conference of American Society of Mass Spectrometry, Indianapolis, IN. 60. http://www.thermoscientific.com/wps/portal/ts/products/detail?productId=119 61722&groupType=PRODUCT&searchType=0 (accessed July 2, 2010). 61. Thevis M., Schrader Y., Thomas A., Sigmund G., Geyer H., and Schänzer W. 2008. Analysis of confiscated black market drugs using chromatographic and mass spectrometric approaches. J. Anal. Toxicol. 32: 232–240. 62. Feng J., Wang L., Dai I., Harmon T., and Bernert J.T. 2007. Simultaneous determination of multiple drugs of abuse and relevant metabolites inn urine by LC-MS-MS. J. Anal. Toxicol. 31: 359–368. 63. Concheiro M., De Castro A., Quintela O., Cruz A., and López-Rivadulla M. 2007. Determination of illicit drugs and their metabolites in human urine by liquid chromatography tandem mass spectrometry including relative ion intensity criterion. J. Anal. Toxicol. 31: 573–580. 64. Stein S.E. and Heller D.N. 2006. On the risk of false positive identification using multiple ion monitoring in qualitative mass spectrometry: Large-scale intercomparisons with a comprehensive mass spectral library. J. Am. Soc. Mass Spectrom. 17: 823–835. 65. Department of Health and Human Services, Health Care Financing Administration, Public Health Service, 42 CFR, Part 405, 1992. Clinical Laboratory Improvement Amendments of 1988; Final Rule. Federal Register 57, No. 40, 967–1087. Available at: http://www.cms.hhs.gov/CLIA 66. Department of Health and Human Services, Substance Abuse and Mental Health Services Administration. 2004. Mandatory Guidelines and Proposed Revisions to Mandatory Guidelines for Federal Workplace Drug Testing Programs. Federal Register 69, No. 71, 19644–19732. Available at: http://workplace.samsha.gov 67. EU Commission. 2002. Commission Decision of 12 August 2002 implementing Council Directive 96/23/EC concerning the performance of analytical methods and the interpretation of results. Off. J. Eur. Comm. L221: 8–34. © 2011 by Taylor and Francis Group, LLC


75

68. World Anti-Doping Agency (WADA). 2004. Identification criteria for qualitative assays incorporating chromatography and mass spectrometry. WADA Technical Document TD2003IDCR, pp. 1–5. 69. Association of Official Racing Chemists. 2003. AORC guidelines for the minimum criteria for identification by chromatography and mass spectrometry, Storrs Mansfield, CT. Available at: http://cobra.vdl.iastate.edu/aorc-2/ AORC%20MS%20Criteria.pdf 70. College of American Pathologists. Commission on Laboratory Accreditation. Laboratory Accreditation Program. Chemistry and toxicology checklist, 2006, pp. 57–59. 71. Society of Forensic Toxicologists. SOFT/AAFS Forensic Toxicology Laboratory Guidelines, 2006, pp. 1–24. Available at: http://www.soft-tox.org/?pn=publicatio ns&sp=Laboratory_Guidelines 72. German Society of Toxicological and Forensic Chemistry. 1998. Anlage zu den Richtlinien der GTFCh zur Qualitätssicherung bei forensisch-toxikologischen Untersuchungen. Toxichem. Krimtech. 65: 18–24. http://www.gtfch.org/tk/ tk67_1/akqual.pdf GTFCh (71) 73. Hill H.M. 2003. Chromatography in a regulated environment. In: Bioanalytical Separations: Handbook of Analytical Separations, vol. 4. I.D. Wilson, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 373–409. 74. van Eenoo P. and Delbeke F.T. 2004. Criteria in chromatography and mass spectrometry—A comparison between regulations in the field of residue and doping analysis. Chromatographia 59: 39–44. 75. Faber N.M. 2009. Regulations in the field of residue and doping analysis should ensure the risk of false positive declaration is well-defined. Accred. Qual. Assur. 14: 111–115.


Quality Assurance of Quantification Using Chromatographic Methods with Linear Relation between Dose and Detector Response

4

Georg Schmitt and Rolf Aderjan

Contents 4.1 4.2 4.3 4.4

Introduction The PDCA Cycle Calibration Laboratories Method Validation 4.4.1 Selectivity 4.4.2 Calibration Model 4.4.3 Precision 4.4.4 Bias 4.4.5 Limit of Detection 4.4.6 The Lower Limit of Quantification 4.4.7 Statistical Process Control 4.4.8 Measurement Uncertainty 4.4.8.1 Horwitz Equation 4.4.8.2 Reporting of Uncertainty 4.4.8.3 Compliance against Limits 4.5 Practical Examples (Forensic Toxicology) 4.6 Proficiency Testing Schemes References

77 78 79 79 79 80 80 80 81 81 81 82 86 86 87 87 89 89

4.1â•‡Introduction Quality assurance (QA) is an objective assessment of a laboratory’s capability and commitment to produce repeatable, defendable, and accurate data. QA includes regulation of the quality of raw materials, assemblies, products, and © 2011 by Taylor and Francis Group, LLC

77

78


components; services related to production; and management, production, and inspection processes. Two key principles characterize QA: “fit for purpose” and “right at the first time.” It is important to realize also that quality is determined by the intended users. However, a considerable part of users of results of quantitative measurements may be unaware of the necessary quality measures behind reported results. This is particularly important in forensic issues, at court and in jurisdiction, where not only forensic medical experts but also analytical laymen rely on reported results, which need to be correct, objective, and reproducible by any other lab working with comparable methods and standards. Therefore, internationally accepted standards must anticipate forensic analytical quality needs. To achieve these objectives, international standards should be used. Reliable analytical methods are required for compliance with national and international regulations in all areas of analysis. According to the “harmonized guidelines for singlelaboratory validation of methods of analysis” (IUPAC technical report), a laboratory must take appropriate measures to ensure that it is capable of providing and does provide data of the required quality [1]. Appropriate measures for QA should be • • • •

Using validated methods of analysis Using internal quality control (QC) procedures Participating in proficiency testing schemes Becoming accredited to an International Standard (ISO/IEC 17025 includes the points above)

4.2â•‡ The PDCA Cycle The most popular tool used to determine QA is the plan-do-check-adjust cycle, commonly abbreviated as PDCA (Figure 4.1). The four-step model is part of the ISO 27001, which specifies a set of requirements for the establishment, implementation, monitoring and review, maintenance, and improvement of an information security management system (ISMS). Just as a circle has no end, the PDCA cycle should be repeated again and again for continuous improvement [2]: Plan Act

Do Check

Figure 4.1â•‡ PDCA model. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

79

Plan Establish ISMS policy, objectives, processes, and procedures relevant to managing risk and improving information security to deliver results in accordance with an organization’s overall policies and objectives. Do Implement and operate the ISMS policy, controls, processes, and procedures. Check Assess and, where applicable, measure process performance against ISMS policy, objectives, and practical experience, and report the results to management for review. Adjust Take corrective and preventive actions, based on the results of the internal ISMS audit and management review or other relevant information, to achieve continual improvement of the ISMS. The PDCA is part of the QA of calibration laboratories and also used in the statistical process control.

4.3â•‡ Calibration Laboratories For calibration laboratories, the ISO 17025 is the main standard. This norm provides the structure using the industry standard ISO 9001 approach. It embraces trusted methods and frameworks to help provide a stable quality environment. This includes also the principles of the PDCA and validated methods [3].

4.4â•‡Method Validation Validation of methods is an integral part of QA to demonstrate the applicability for the intended use. According to IUPAC technical report, typical performance characteristics of analytical methods are applicability, selectivity, calibration, trueness, precision, recovery, operating range, limit of quantification, limit of detection, sensitivity, and ruggedness. Additional parameters may be relevant for particular analytical purpose. Bioanalytical methods in clinical and forensic toxicology are used for identification and determination of drugs and poisons in biological fluids or tissues. For quantitative bioanalytical procedures, at least the following validation parameters should be evaluated [1,4]: selectivity, calibration model, precision, bias, limit of detection, the lower limit of quantification (LLOQ), statistical process control, and measurement uncertainty. These parameters will be discussed in turn. 4.4.1â•‡Selectivity According to IUPAC technical report, selectivity was defined as “the degree to which a method can quantify the analyte accurately in the presence of © 2011 by Taylor and Francis Group, LLC

80


interferents. Ideally, selectivity should be evaluated for any important interferent likely to be present.” Method: Analysis of at least six sources of blank matrix. Analysis of one to two zero samples (blank matrix with internal standard). Acceptance criteria: Absence of interfering signals. 4.4.2â•‡ Calibration Model The choice of an appropriate calibration model is necessary for the quantification process. For the decision, the concentrations of an analyte are plotted against the measured values obtained from an analytical device. Usually, the linear model will be preferred because it can be easily calculated. Analytical devices whose responses are not linear can also be described by nonlinear models. In special cases, standard addition was applied to solve matrix problems. Therefore, the sample was split into aliquots and spiked with analyte [5]. Method: Analysis of at least four to five concentration levels spaced over the concentration range of interest (IUPAC technical report demands six concentration levels). The highest calibration standard defines also the upper limit of quantification (ULOQ). Acceptance criteria: Statistical test of model fit and acceptable accuracy and precision data. 4.4.3â•‡ Precision Precision can be the “within-laboratory reproducibility, where operator and/ or equipment and/or time and/or calibration can be varied, but in the same laboratory.” It is usually specified as standard deviation (SD). Method: Analysis of five to six replicates per level under repeatability conditions. Control samples at low and high concentrations relative to calibration range. Acceptance criteria: Relative standard deviation (RSD) within ±15% (±20% near LLOQ). 4.4.4â•‡Bias The bias is usually specified as deviation from the reference value or the “difference between mean measured value from a large series of test results and an accepted reference value (a certified or nominal value).” Method: Analysis of certified reference material (CRM) instead of control samples (can be carried out with the validation of the precision in one experiment, see above). Acceptance criteria: Bias within ±15% of nominal value (±20% near LLOQ). © 2011 by Taylor and Francis Group, LLC


81

4.4.5â•‡Limit of Detection The limit of detection (LOD) is the smallest amount or concentration of an analyte that can be reliably distinguished from zero. Depending on the intended use, it must not be part of the validation procedure. For practical use, the LOD can be determined with a simple procedure. The values for this “practical” LOD were greater than the possible “instrumental” LOD. Method: Analysis of the LOD using spiked samples with decreasing concentrations of the analyte. Acceptance criteria: Checking for compliance with identification criteria or a signal-to-noise ratio (SNR) ≥3. Alternative: The statistical approach using data of the calibration function is also possible and part of the ISO 11843 [6,7]. With the assumption of homogeneous variances, the concentration of the prediction interval at zero was calculated. With this approach, the LOD is defined as a 50% probability of the analyte being present or not present and based on an accepted probability for a false-positive decision. The probability of false-positive results declines with higher concentrations. 4.4.6â•‡ The Lower Limit of Quantification The LLOQ defines the concentration below which the analytical method cannot operate with an acceptable precision. Method: Control samples with an analyte concentration near the LOQ. Alternatively, analysis of spiked samples with decreasing concentrations of the analyte. Acceptance criteria: Compliance with accuracy and precision data of control samples near LLOQ or a SNR ≥ 10. Alternative: The statistical approach using data of the calibration function is also possible (see description for LOD). The LLOQ refers to the minimum quantity, which can be determined with both defined probability level and acceptable relative uncertainty. Using the formulas of the ISO 8466, it is possible to calculate the measurement uncertainty of analytical results (only considering the calibration process) [8,9]. 4.4.7â•‡Statistical Process Control For the control of precision and accuracy statistical process control charts, also known as Shewhart charting system can be used. A control chart helps to distinguish between statistical and unusual variation in a process. Normally, a control chart is divided into several, at least three, zones (the upper control limit [UCL], the centre line, and the lower control limit [LCL]). Then, data points representing measurements from the process at different times will be inserted [19]. © 2011 by Taylor and Francis Group, LLC

82

Quality Assurance in the Pathology Laboratory Concentration

+3s

99.73 %

95.44 %

+2s X –2s –3s

UCL Centre line

LCL

Time

Figure 4.2â•‡ Control chart.

Normally, the data points fluctuate within the 3-sigma limits with a level of confidence of greater than 99% (Figure 4.2). 4.4.8â•‡Measurement Uncertainty The measurement uncertainty (MU) defines the range of the values that could reasonably be attributed to the measured quantity. MU is defined in metrological terminology as “parameter, associated with the result of a measurement, that characterizes the dispersion of the values that could reasonably be attributed to the measurand.” An alternative definition is given in the ISO 3534 as “an estimate attached to a test result, which characterizes the range of values within which the true value is asserted to lie.” This definition seems to be easier to explain but has the disadvantage that the true value itself can never be known and this generally requires further explanations [10]. For the estimation of the MU, the Guide to the Expression of Uncertainty in Measurement (GUM) established the following steps [11]:

1. Define the measurand. 2. Build the model equation. 3. Identify the sources of uncertainty. 4. If necessary, modify the model. 5. Evaluate the input quantities and calculate the value of the result. 6. Estimate the standard uncertainty of input quantities. 7. Calculate the combined standard uncertainty of the result. 8. Present the result (as standard or expanded uncertainty). 9. Analyze the uncertainty contributions.



Step 1

Step 2

Step 3

83

Specify measurand Convert components to standard deviations

Identify uncertainty sources

Calculate combined standard uncertainty

Simplify by grouping sources covered by existing data

Step 4

Review and if necessary re evaluate large components

Quantify grouped components

Calculate expanded uncertainty

Quantify remaining components

Figure 4.3â•‡ Summarizing the uncertainty estimation.

This rule was interpreted for analytical chemistry by EURACHEM [12] (Figure 4.3). When all uncertainty components are known, the combined uncertainty can be calculated. Uncertainty components, which are less than one-third of the largest, need not be evaluated in detail. The EURACHEM/CITAC guide is a “Bottom-Up” approach in which the measurand and the input quantities upon which it depends were involved: Step 1: Specify measurand The measurand should be given in the relevant standard operating procedure or other method description. Step 2: Identify uncertainty sources When estimating uncertainty, all relevant uncertainty sources have to be taken into account. The sources can be shown using a “cause and effect” diagram, commonly called fish-bone diagram (Figure 4.4). This kind of diagram identifies many possible causes for an effect. Step 3: Quantify uncertainty components This step includes the estimation or determination of single contributions to uncertainty associated with a number of separate sources. Each individual standard uncertainty component can be expressed as SD using © 2011 by Taylor and Francis Group, LLC

ui = SDi

84

Quality Assurance in the Pathology Laboratory RSD Reproducibility within laboratory Sample

Value

Cref Uncertainty of the nominal/certified value RMSbias Method and lab bias (reference material, interlab comparison, validation)

Figure 4.4â•‡ Measurement uncertainty model (fish-bone diagram).

The number of observations (n) from which the SD is calculated should be 30 or more. Step 4: Calculate combined uncertainty The combined uncertainty is determined by the Gaussian “error propagation law” using the following formula:

u = u12 + u22 + u32 +

The information obtained gives a level of confidence of approximately 68%. The expanded uncertainty is calculated from the combined uncertainty using the formula

U = k ⋅u

where U is the expanded uncertainty u is the combined uncertainty k is the coverage factor Using k = 2 or k = 3, the level of confidence is approximately 95% or 99.7%. For small observations (nâ•›â•›A 449Gâ•›>â•›A 752Aâ•›>â•›G 815Aâ•›>â•›G C1003T

Thrl359 Asp360Glu

12% of wild-type 5% of wild-type ND Decreased None

PM ND PM

Leu191 Arg150His His251Arg Glu272Gly Arg335Trp Pro489Ser

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; ND, not determined; PM, poor metabolizer.

Table 5.2â•… Cytochrome P450 2C19 Alleles

Allele

Functional Nucleotide Change

CYP2C19*1 CYP2C19*2

None G681A

CYP2C19*3

G636A

CYP2C19*4

A-G initiation codon C1297T G385A

CYP2C19*5 CYP2C19*6

Amino Acid Change

Enzyme Activity

Associated Phenotype

Allele Frequency

None Splicing defect Stop codon

Normal None

EM PM

None

PM

None

None

PM

0.67 0.23 (0.15–0.31) 0.104 (0.05–0.16) 0.00–0.006

Arg433Trp Arg132Gin

None ND

PM PM

0.00–0.009 0.00–0.009

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; PM, poor metabolizer. © 2011 by Taylor and Francis Group, LLC

Allele CYP2D6*1 CYP2D6*1X2 CYP2D6*2 CYP2D6*2XNa CYP2D6*3 CYP2D6*4 CYP2D6*4X2 CYP2D6*5 CYP2D6*6 CYP2D6*7 CYP2D6*8 CYP2D6*9 CYP2D6*10 CYP2D6*11 CYP2D6*12 CYP2D6*13 CYP2D6*14 CYP2D6*15 CYP2D6*16

Functional Nucleotide Changes None Gene duplication 2850Câ•›>â•›T, G4180C Gene duplication A2549 deletion G1846A G1846A, gene duplication Gene duplication T1707 deletion A2935C G1758T 2613–2615 or delAGA C100T G883C G124A CYP2D6/CYP2D7 hybrid G1758A 138inst CYP2D7P/CYP2D6 hybrid

Structural Effect

Activity

Associated Phenotype

Allele Frequency

None None Arg296Cys,Ser486Thr Arg296Cys,Ser486Thr Frameshift Splicing defect Splicing defect CYP2D6 deleted Frameshift His324Pro Stop codon Lys281 deleted Pro34Ser,Ser486Thr Splicing defect Gly42Arg Frameshift Gly169Arg

Normal Increased Decreased Increased None None None None None None None Decreased Decreased None None None None None None

EM UM EM UM PM PM PM PM PM PM PM EM EM PM PM PM PM PM PM

0.364 (0.337–0.392) 0.0051 (0.0019–0.033) 0.324 (0.298–0.352) 0.0134 (0.008–0.022)b 0.0204 (0.0131–0.0302) 0.207 (0.184–0.231) 0.0008 (0.0000–0.0047) 0.0195 (0.0124–0.0292) 0.0093 (0.0047–0.0166) 0.0008 (0.0000–0.0047) 0.0000 (0.0000–0.0031) 0.0178 (0.0111–0.0271) 0.0153 (0.0091–0.0240) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0008 (0.0000–0.0047) 0.0008 (0.0000–0.0047)

Frameshift


101

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; ND, not determined; PM, poor metabolizer. Partial list, for a complete list refer to http://www.imm.ki;se/ CYPaileles/cyp2d6.htm a Nâ•›=â•›2, 3, 4, 5, or 13. b Frequency for Nâ•›=â•›2.

Pharmacogenomics, Personalized Medicine, Personalized Justice

Table 5.3â•… Cytochrome P450 2D6 Alleles

102

Table 5.4â•…Allelic Frequency in Diverse Racial/Ethnic Populations

EU, CA U.S., CA Turkish Chinese Japanese Mex Am Ethiopians AA

F

F

NF

NF

NF

NF

R

R

D

*1

*2

*3

*4

*5

*6

*9

*10

Tot

0.334–0.364 0.37–0.404 0.371 0.23 0.43 0.572

0.285–0.329 0.262–0.337 0.353 0.20 0.123–0.129 0.228

0.1–0.2 0.01 0 0.1

0.189–0.207 0.175–0.199 0.113 A) TPMT*3B TPMT*3C (A>G) TPMT*3C CYP2C19*2 (A>G) CYP2C19*2 CYP2C19*3 (A>G) CYP2C19*3 CYP2C9*3 (C>T) CYP2C9*2 CYP2C9*3 (A>C) CYP2C9*3 CYP2D6 (*6, *4, *3, *9, *41) CYP2D6

SNP

Sequence 5′ 3′

Size (bp)

Position SNP

Forward TTCACTTTAGTACAGTAGCTAC

1150 525

Reverse TCACCATGCTTCAGGAAGC Forward ATTACACACTCGTCTGCACAC

1150 554

Reverse GGTCTCAAACTCCTGGG Forward ACAATTCAGAGTTCAGGAAATT

1150 570

Reverse ATCACCTGAACCTGGGAGGC Forward AAAAGCTTTGAAATCCCCAACTA 1090 552 Reverse ATTCCTAACCAGCTGTCICATC Forward ACAGAAGTCATTTAACTGCTCTG

1092 558

Reverse TTTGCATTTCTCCAATGACTTC Forward GCCATCTGAGTGGCAAGTAT

1150 610

Reverse AGAAACCCCAGAGAAGTCAG Forward TCCATCCAGGTCAGTAACAG

1150 521

Reverse AAGTTGACAGATTAACATCATC Forward CACCTGCACTAGGGAGGT

2330 *6.519

Reverse

CCCTGCCTATACTCTGGAC

*4:658 *3:1370 *9:1434 *41:1809

Source: Reproduced from van der Straaten, T. et al., Pharmacogenomics, 9, 1261, 2008.

of these plasmid samples were checked by genotyping using Pyrosequencing for TPMT and CYP2D6, RFLP for CYP 2C9 and Taqman assay for CYP2C19, and 100% concordance was obtained. The authors cautioned the limitation of SNP genotyping that exclusion of SNPs do not necessarily confirmed a wild-type (*1) genotype. 5.4.6â•‡ Commercial Sources Maine Molecular Quality Controls Incorporated (MMQCI) and ParagonDX— Quality control products of MMQCI, such as INTROL•, are manufactured from synthetic DNA suspended in a patented, non-infectious, blood-like matrix, containing two synthetic alleles in mimicking genomic DNA [60]. For example, INTROL PGx 1 Control contains two synthetic alleles of Cytochrome © 2011 by Taylor and Francis Group, LLC

112


Table 5.9â•… Plasmids SNP

Synonym

rs Number

Plasmid Number

Genotype

1707Tdel G1846A 2549Adel 2613– 2615AGdel G2988A C3608T

*6 *4 *3 *9

rs5030655 rs3892097 rs4986774 rs5030656

40, 41, 42 1 2 3, 4

1707Tdel 1846A 2549Adel 2613–2615AGAdel

*41 *2

rs28371725 rs1799853

A42614C

*3

rs1057910

G19154A

*2

rs4244285

G17948A

*3

rs4986893

2988A 3608C 3608T 42614A 42614C 19154G 19154A 17948G 17948A

TPMT

G238C

*2

rs1800462

TPMT

G460A

*3B

rs1800460

A719G

*3C

rs1142345

5 6 7 9, 10, 11 12, 13 18 20 22, 23, 24 25, 26, 27, 28 29 30, 31, 32 33, 34, 35, 36 43 39 37, 38

Gene CYP2D56

CYP2C9

CYP2C19

a

238G 238C 460G 460A 719A 719G

Source: Reproduced from van der Straaten, T. et al., Pharmacogenomics, 9, 1261, 2008. a As a reference for CYP2D6 SNPs a plasmid control was used with the wild-type nucleotides as designated positions (available on request).

P450 2C9 (CYP2C9), Cytochrome P450 4F2 (CYP4F2), and Vitamin K Epoxide Reductase Complex, Subunit 1 (VKORC1) DNA. ParagonDx offers reference controls: CYP2C9, CYP2C19*2, CYP2C19*3 and CYP2C19*17, CYP2D6, VKORC1, UGT1A1, MTHFR, and NAT2, as shown by Table 5.10 [61].

5.5â•‡Molecular Autopsy, PGx Algorithm, and Selected Cases PGx is gradually gaining awareness and, hopefully, acceptance by the forensic community. Recent indication is the inclusion of PGx information in a handbook by Molina [62] recent publications [37,38] and a chapter by Jortani, Stauble, and Wong [63]. In order to enhance the use of PGx as an adjunct for forensic pathology/toxicology—molecular autopsy, a PGx algorithm has been proposed to guide the selection of candidate cases, as shown by Figure 5.8. Case selection was initiated by forensic pathology/toxicology review, focusing © 2011 by Taylor and Francis Group, LLC


113

Table 5.10â•… ParagonDx’s Gene Control/Defining Mutations Gene Control CYP2D6 *4A/*2AxN CYP2D6 *2M/*17 CYP2D6 *29/*2AxN CYP2D6 *6B/*41 CYP2D6 *1/*5 CYP2D6 *3A/*4A

Defining Mutations *4 (1846G>; *10 (100C>T); *2AxN (CYP450 gene duplication, 1584C>G, 2850C>T) *2M (−15B4C, 2850C>T); *17 (1023C>T) *29 (1659G>A, 3183G>A); *2AxN (CYP450 gene duplication, 1584C>G, 2850>T) *6 (1707T>del); *41 (2988G>A) *5 (CYP2D6 gene deletion) *3 (2549A>del); *4 (1846G>A); *10 (100C>T)

Not for use in diagnostic procedures. Patent pending CYP2D6 ′35/′41 ′35 (3IG>A); ′41 (2988G>A) CYP2D6 ′1/′9 ′9 (2613.2615delAGA) CYP2D6 ′1/′6B ′6 (1707T>del) CYP2D6 ′5/′41 ′5 (CYP2D6 gene deletion); ′41 (2988G>A) CYP2D6 ′5/′5 ′5 (CYP2D6 gene deletion) None (lacks polymorphic sites) CYP2D6 ′IA/′IA CYP2D6 ′4A/′7 ′4 (1846G>A); ′7 (2935A>C) CYP2D6 ′5/′17 ′5 (CYP2D6 gene deletion), ′17 (1023C> T) CYP2D6 ′4/′4xN ′4 (1846G>A); ′4xN (CYP450′ gene duplication, -1846G>A) CYP2D6 *1/*1xN ′1 XN (CYP450 gene duplication, lacks polymorphic sites) CYP2D6 ′2A/*2A ′2A (−1584C>G,2850C> T) CYP2D6 ′1/′2A ′2A (−1584C>G,2850C> T) CYP2D6 ′10B/′10B ′10 (100C>T) None (lacks polymorphic sites) CYP2C19 ′1/*1 CYP2CI9 1/′′′2 ′2 (+19154G> A) CYP2CI9 ′1/′3 ′3 (+17948 G>A) None (lacks polymorphic sites characteristic CYP2C9 ′I/*1 of CYP2C9 ′2, ′3, ′4, ′5, ′8 and ′11) CYP2C9 *1/*3 ′3 (+42614 A>C) CYP2C9 *2/*3 *2 (+3608 C>T); *3 (+42614 A+C), VKORC + 11173CT VKORC1 (+ 1173C>?T) CYP2C9 *2A/*2A CYP2~9 Control—Homozygous for ′2 CYP2C9 *1/*2 (2 (+3608 C>T) CYP2C9 ′3/′*3 ′3 (+42614 A>C) VKORCI (·1639GG/+1173CC/+3730AA) VKORCI (·1 639G>A; 1173C> T; 3730G>A) VKORCI (−I639GG/+1173CC/+3730AA) VKORCI (−1639G>AL; 1173C> T; 3730G>A) VKORCI (−I639GG/+ 1173CC/+3730GG) VKORCI (−1639G>A; 1173C>T; 3730G>A) VKORCI (−1639GA/+1173CT/+3730GG) VKORCI (·1639G>A; 1173C>T; 3730G>A) VKORCI (*1639AA/+ 1173TT/+3730GG) VKORC1 (−1639G>A; 1173C>T; 3730G>A) VKORCI (·1639GA/+ I173CT/+3730GA) VKORC1 (·1639G>,A; 1173C>T; 3730G>,A) (continued) © 2011 by Taylor and Francis Group, LLC

114


Table 5.10 (continued)â•… ParagonDx’s Gene Control/Defining Mutations Gene Control

Defining Mutations ′I (6TA repeats) *1 (6TA repeats); ′37(8TA repeats) *28 (7TA repeats) *28 (7TA repeats): ″36(5TA repeats) ′1 (6TA repeats); ″28 (7TA repeats)

UGT1A1 *1/*1 UGT1A1 ′1/′37 UGT1AI ′28/′28 UGTIAI *28/′36 UGT1A1 ′1/28

Source: Reproduced from ParagonDx, http://www.paragondx.com/paragon/70/HumanGenomoic-Quality-Controls/, accessed February 9, 2010).

Forensic pathology review Comprehensive drug screen A. Is there an elevated (toxic) drug level?

Yes

Covariables to consider

Covariables considered A–J J. Was the intent of the decedent suicide? No

Yes

No

A. Toxic drug Level B. High metabolic ratio (acute vs. chronic) C. Drug interactions (micromedex) D. Drug metabolized by P450 (polymorphic) E. Sample site (peripheral, heart, etc.) F. Fallani’s intervals (I, II, III, IV) G. Case Hx/death scene investigation H. Medical Hx-medications/drug of abuse I. Autopsy findings J. Intent (suicide)

Toxicology case review

E. Was peripheral blood used? Yes

No F. Postmortem redistribution may cause elevated level

C/H. Are any other drugs detected?

Perform tissue levels and/or alternative blood sources

Yes

No

C. Drug–drug interaction may cause elevated level D. Is the drug metabolized by a polymorphic ensyzme? Yes

No

Perform genotyping. May show genetic predisposition for toxicity Finalize death certification

Figure 5.8â•‡ Proposed Milwaukee pharmacogenomic algorithm for forensic pathology/toxicology. (With permission from Jannetto, P.J. et al., J. Anal. Tox., 26, 438, 2002.) © 2011 by Taylor and Francis Group, LLC


115

on medical history, autopsy and toxicology findings such as metabolic ratio(s), if available. In the event of elevated drug concentrations, co-variables A–J are then considered in detail. One of the concerns is the effect of postmortem drug redistribution/metabolism which may be minimized/eliminated by using peripheral blood or other samples such as vitreous humor. Other key considerations would include possible drug–drug interaction and diversion. This latter scenario would render the decedent to be less tolerant to drug toxicity. Once the case is selected, the collected blood samples are then transferred to a PGx/molecular laboratory with chain-of-custody to ensure samples integrity. The origin of using PGx as PJ may be credited to a report of a fluoxetine fatality [64]. The report was about a 9 year old boy, diagnosed with attention deficit hyperactivity disorder, obsessive-compulsive disorder, and Tourette’s syndrome. For these disorders, he was medicated with methylphenidate, clonidine, and fluoxetine. He later developed GI toxicity, incoordination and disorientation, seizures, and cardiac arrest. High fluoxetine and norfluoxetine concentrations were detected in postmortem analysis. PGx showed that he was a poor CYP2D6 metabolizer, with impaired metabolism and therefore accumulation of fluoxetine and norfluoxetine. Other published reports including findings for methadone [37], oxycodone [38], and others [10,11].

5.6â•‡ Conclusions Rapid advances in genomic medicine, coupled with innovations in molecular diagnostics and instrumentation such as LC/MS/MS, have propelled the frontiers of forensic science. Pivotal to successful adoption, PGx quality assurance would strengthen the scientific foundation, and clinical and forensic efficacy. As PGx is emerging, the support of the scientific and communities along with key governmental agencies would point to successful applications which would result in tangible benefit of patient safety—PM. However, “misapplications” might result in the legal proceedings as in the form of PJ. It would be important for the colleagues in forensic science to embrace these developments and to provide input and interpretation wherever appropriate. In so doing, the forensic community would benefit from avoiding adopting “junk” sciences, and would be a vital part in enabling PM and PJ.

References 1. Wong, S.H., Happy, C., Blinka, D. et al. 2010. From personalized medicine to personalized justice—The promise of pharmacogenomics in the justice system. Pharmacogenomics, 11(6), 731–737. 2. Miller, E.D. 2009. A bold leap into the future—Personalized medicine is key to the new genes to society curriculum. In: Hopkins Medicine, ed. S.E. Pasquale. Johns Hopkins Medicine: Baltimore, MD, p. 48. © 2011 by Taylor and Francis Group, LLC

116


3. Golgin, E. 2009. Epigenetic suicide note. The Scientist, 23(8), 18–19. 4. FDA updates warfarin labeling with PGx-guided dosing ranges. http://www. genomeweb.com/dxpgx/fda-updates-warfarin-labeling-pgx-guided-dosingranges (accessed March 16, 2010). 5. FDA’s boxed warning for clopidogrel. http://www.fda.gov/NewsEvents/ Newsroom/PressAnnouncements/ucm204253.htm (accessed March 13, 2010) (accessed March 16, 2010). 6. van der Strarten, T., Swen, J., Baak-Pablo, R., Guchelaar, H.J. 2008. Use of plasmid-derived external quality control samples in pharmacogenetic testing. Pharmacogenomics 9, 1261–1266. 7. Jeffreys, A.J., Wilson, V., and Thein, S.L. 1985. Individual-specific fingerprints of human DNA. Nature, 316(6023), 76–79. 8. Wong, S.H. 2007. Pharmacogenomics and personalized medicine for drug addiction and toxicology: Towards personalized justice? In: 11th Asian Pacific Congress of Clinical Biochemistry, Beijing, China. 9. Wong, S.H.Y. and Happy, C. 2009. Personalized justice, translational pharmacogenomics and personalized medicine—Relevant to the forensic sciences? Tox. Talk. 33, 22–23. 10. Wong, S.H., Jentzen, J.M., Shi, R.N., and the Forensic Pathology/Toxicology Methadone Pharmacogenomics Study Group (FPTMPGxSG). 2008. Personalized medicine enabling personalized justice: Methadone pharmacogenomics as an adjunct—For molecular autopsy, and for addiction and driving under the influence of drugs (DUID). Clin. Chem. Lab. Med. 46, A118. 11. Wong, S.H.Y. (in press) Pharmacogenomics as molecular autopsy—An adjunct to forensic pathology/toxicology: From Gregor Mendel to personalized medicine and personalized justice. In: Clarke’s Analysis of Drugs and Poisons, eds. A.C. Moffat, D. Osselton, and B. Widdop, 4th edn. Royal Pharmaceutical Society Publishing: London, U.K. 12. Personalized Medicine Coalition. http://www.personalizedmedicinecoalition. org/ (accessed February 3, 2010). 13. Chen, H.-Y., Yu, S.-L., Chen, C.-H. et al. 2007. A five-gene signature and clinical outcome in non-small-cell lung cancer. NEJM 356, 11–20. 14. Herbst, R.S. and Lippman, S.M. 2007. Molecular signatures of lung cancer— Towards personalized therapy. NEJM 356, 76–78. 15. Linder, M.W., Prough, R.A., and Valdes, R. Jr. 1997. Pharmacogenetics: A laboratory tool for optimizing therapeutic efficiency. Clin. Chem. 43(2), 254–266. 16. Evans, W.E. and McLeod, H.L. 2003. Pharmacogenomics—Drug disposition, drug targets and side effects. NEJM 348, 538–549. 17. Weinshilboum, R. 2003. Inheritance and drug response. NEJM 348(6), 529–537. 18. Linder, M.W., Evans, W.E., and McLeod, H.L. 2006. Application of pharmacogenetic principles to clinical pharmacology. In: Applied Pharmacokinetics and Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans. Lippincott Williams & Wilkins: Philadelphia, PA, pp. 165–185. 19. Home Page of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee at Karolinska Institute. http://www.imm.ki.se/CYPalleles/(accessed February 2, 2010).



117

20. Cytochrome P450 drug interaction table. 2009. http://medicine.iupui.edu/ flockhart/table.htm 21. Bradford, L.D. 2002. CYP2D6 allele frequency in European Caucasians, Asians, Africans and their descendants. Pharmacogenomics 3(2), 229–243. 22. American Association for Clinical Chemistry. 2005. Top ten pharmacogenomics tests. Clinical Laboratory News. Washington, DC, May. 23. Wadelius, M. and Pirmohamed, M. 2007. Pharmacogenetics of warfarin: Current status and future challenges. Pharmacogen. J. 8(7), 99–111. 24. Stehle, S., Kirchheiner, J., Lazar, A., and Fuhr, U. 2008. PGXs of oral anticoagulants. Clin. Pharmacokin. 47, 565–594. 25. Kangelaris, K.N., Bent, S., Nussbaum, R.L., Garcia, D.A., and Tice, J.A. 2009. Genetic testing before anticoagulation? A systematic review of PGX dosing of warfarin. J. Gen. Intern. Med. 24, 656–664. 26. Caldwell, M.D., Awad, T., Johnson, J.A. et al. 2008. CYP4F2 genetic variant alters required warfarin dose. Blood. 111, 4106–4112. 27. Gage, B.F., Eby, C., Johnson, J.A. et al. 2008. Use of PGX and clinical factors to predict the therapeutic dose of warfarin. Clin. Pharmacol. Ther. 84, 326–331. 28. McLeod, H.L. and Watters, J.B. 2004. Irinotecan pharmacogenetics: Is it time to intervene? J. Cin. Onconl. (Editorial) 22, 1356–1359. 29. Mallal, S., Nolan, D., Witt, C. et al. 2002. Association between presence of HLAB*5701, HLA-DR7, and HLA-DQ3 and hypersensitivity toHIV-1 reverse-transcriptase inhibitor abacavir. Lancet 359, 727–732. 30. Mallal, S., Phillips, E., Carosi, G. et al. 2008. HLA-B*5701 Screening for hypersensitivity to abacavir. NEJM 358, 568–579. 31. Hetherington, S., Hughes, A.R., Mosteller, M. et al. 2002. Genetic variations in HLA-B region and hypersensitivity reactions to abacavir. Lancet 359, 1121–1122. 32. Nolan, D. 2009. HLA-B*5701 screening prior to abacavir prescription: Clinical and laboratory aspects. Crit. Rev. Clin. Lab. Sci. 46(3), 153–165. 33. Panel on Antiretroviral Guidelines for Adult and Adolescents. Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents. Department of Health and Human Services. November 3, 2008, pp. 1–146. Available at http:// www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf 34. Chung, W.H., Hung, S.I., Hong, H.S. et al. 2004. Medical genetics: A marker for Stevens–Johnson syndrome. Nature 428, 486. 35. Hung, S.I., Chung, W.H., Liou, L.B. et al. 2005. HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proc. Natl. Acad. Sci. USA 102, 4134–4139. 36. Payne, D. 2006. Methodologies for pharmacogenetic testing. Clin. Chem. News 32(7), 14–16. 37. Sirot, E.J. and Beaumann, P. 2009. Therapeutic drug monitoring and pharmacogenetic tests in pharmacovigilance—When and what? Eur. Psych. 24(S1), S107–S109. 38. Wong, S.H.Y., Wagner, M.A., Jentzen, J.M., Schur, C., Bjerke, J., Gock, S.B., and Chang, C.J. 2003. Pharmacogenomics as an adjunct of molecular autopsy for forensic pathology/toxicology: Does genotyping CYP2D6 serve as an adjunct for certifying methadone toxicity? J. Forensic Sci. 48, 1406–1415.


118


39. Jannetto, P.J., Wong, S.H.Y., Gock, S, Sahin, E., and Jentzen, J.M. 2002. Pharmacogenomics as an adjunct to forensic toxicology: Genotyping oxycodone cases for cytochrome P450 (CYP) 2D6. J. Anal. Tox. 26, 438–447. 40. Wong, S.H.Y., Gock, S.B., Shi, R.Z. et al. 2006. Pharmacogenomics as an aspect of molecular autopsy for forensic pathology/toxicology. In: Pharmacogenomics and Proteomics: Enabling the Practice of Personalized Medicine, eds. S.H.Y. Wong, M. Linder, and R. Valdes Jr. AACC Press: Washington, DC, pp. 311–320. 41. President’s Council of Advisors on Science and Technology issued a report, entitled Priorities for personalized medicine. 2008. http://www.whitehouse.gov/ administration/eop/ostp (accessed February 24, 2009). 42. Leavitt, M. 2007. September 2007 report on Personalized HEALTH CARE: Opportunities, pathways, resources. http://www.hhs.gov/myhealthcare/news/ phc-report.pdf (accessed February 10, 2010). 43. Woodcock, J. 2009. A difficult balance—Pain management, drug safety and the FDA. NEJM 361, 2105–2107. 44. Drug Information Association. 2010. A report on CDER-FDA is fast-tracking a 5 drugs study for breast cancer. March 18. 45. Auxter, S. 2002. Taking a new approach to in vitro diagnostics regulation—A new FDA office to oversee IVDs from conception on. Clin. Lab. News 28(11), 1. 46. FDA-CDRH’s guidance for pharmacogenetic tests and genetic tests for heritable markers, 2007. http://www.fda.gov/downloads/MedicalDevices/ DeviceRegulationandGuidance/GuidanceDocuments/ucm071075.pdf (accessed February 20, 2010). 47. Mansfield, E., Tezak, X., Altaie, S., Simon, K., and Gutman, S. 2007. Biomarkers for pharmacogenetic and pharmacogenomic studies: Special issues in analytical performance. Drug Discov. Today Technol. Crit. Path 4(1), 21–24. 48. Payne, D.A. and Carr, J. 2010. Methodology and quality assurance considerations in pharmacogenetics testing. In: Guidelines and Recommendations for Laboratory Analysis and Application of Pharmacogenetics to Clinical Practice. Laboratory Medicine Practice Guidelines, eds. R. Valdes, D. Payne, M.W. Linder, G. Burckart, D. Farkas, F. Frueh, H. McLeod, J.-P. Morrello, A. Rahman, G. Ruano, L. Shaw, S. Jortani, W. Steimer, and S. Wong. The National Academy of Clinical Biochemistry. American Association for Clinical Chemistry: Washington, DC, pp. 11–13. 49. Linder, M.W. and Steimer, W. 2010. Clinical laboratory services considerations. In: Guidelines and Recommendations for Laboratory Analysis and Application of Pharmacogenetics to Clinical Practice. Laboratory Medicine Practice Guidelines, eds. R. Valdes, D. Payne, M.W. Linder, G. Burckart, D. Farkas, F. Frueh, H. McLeod, J.-P. Morrello, A. Rahman, G. Ruano, L. Shaw, S. Jortani, W. Steimer, and S. Wong. The National Academy of Clinical Biochemistry. American Association for Clinical Chemistry: Washington, DC, pp. 14–17. 50. College of American Pathologists a one-month PGx fellowship at the University of California Irvine. http://www.cap.org/apps/cap.portal?_ nfpb=true&cntvwrPtlt_actionOverride=%2Fportlets%2FcontentViewer%2Fsh (accessed March 1, 2010). 51. Pharmacogenetics Core Laboratory (PCL) at the University of Pittsburgh. http://www.dept-med.pitt.edu/clinpharm/laboratories.html#pharm (accessed March 2, 2010). © 2011 by Taylor and Francis Group, LLC


119

52. Ferreira-Gonzalez, A. 2009. Lab organization, regulation, and reimbursement in molecular pathology. In: AACC Workshop on Principles and Practices of Molecular Diagnostics and Pharmacogenomics. AACC: Chicago, IL. 53. Schur, B.C., Bjerke, J., Nuwayhid, N., and Wong, S.H. 2001. Genotyping of Â�cytochrome P450 2D6 *3 and *4 mutations using conventional PCR. Clin. Chem. Acta. 308, 25–31. 54. College of American Pathologists (CAP)’s Proficiency testing programs and interlaboratory sample exchange programs for molecular genetic testing for heritable diseases and conditions include pharmacogenetic proficiency testing (PGx). (CAP 2010 survey catalog – http://www.cap.org/apps/docs/laboratory_ accreditation/2008_pt_enrollment_guide.pdf). 55. CDC’s Genetic Testing Reference Materials Coordination Program (GeT-RM). http://wwwn.cdc.gov/dls/genetics/rmmaterials/default.aspx (accessed January 15, 2010). 56. CDC—Characteristics of the cell line for CYP2D6 is in the following table. http://wwwn.cdc.gov/dls/genetics/rmmaterials/pdf/CYP2D6_GeneConsensus. pdf (accessed January 15, 2010). 57. Committee on Human Medicinal Products. 2007. Reflection paper on pharmacogenomic samples, testing and data handling. European Medicines Agency (EMEA) (Doc. Ref. EMEA/CHMP/PGxWP/201914/2006). http://www.emea. europa.eu (accessed February 15, 2010). 58. Listing of quality control and reference material producers on a global basis. http://www.eurogentest.org/laboratories/qau/referencematerials/ and http://www.eurogentest.org/web/info/public/unit1/reference_materials/rm_ databases.xhtml (accessed February 6, 2010). 59. Javis, M., Iyer, R.K, Williams, L.O. et al. 2005. A novel method for creating artificial mutant samples for performance evaluation and quality control in clinical molecular genetics. J. Mol. Diagn. 7, 247–251. 60. Maine Molecular Quality Controls Incorporated. http://www.mmqci.com/qcPGx1.php (accessed February 9, 2010). http://www.paragondx.com/paragon/70/Human-Genomoic 61. ParagonDx. Quality-Controls/(accessed February 9, 2010). 62. Molina, D.K. 2010. Handbook of Forensic Toxicology for Medical Examiners. CRC Press: Boca Raton, FL, pp. 1–370 (Appendix C—PGXs, 343–347). 63. Jortani, S., Stauble, E., and Wong, S.H.Y. (in press). Pharmacogenetics in clinical and forensic toxicology: Opioid overdoses and deaths. In: Handbook of Drug Interaction—A Clinical and Forensic Guide, eds. A. Mozayani and L.P. Raymond. Humana Press: Totowa, NJ. 64. Sallee, F.R., DeVane, C.L., and Ferrell, R.E. 2000. Fluoxetine-related death in a child with cytochrome P-450 2D6 genetic deficiency. J. Child. Adolsec Psychopharmacol. 10, 327–334.

Web Sites http://www.genome.gov/glossary.cfm http://www.geneclinics.org http://www.cdc.gov/genomics/hugenet/reviews.htm © 2011 by Taylor and Francis Group, LLC

120


http://www.cancer.gov/cancer_information/pdq http://www.ncbi.nlm.nih.gov/omin/ http://www4.od.nih.gov/oba/sacgt.htm http://www.nhlbi.nih.gov/resources/docs/cht-book.htm http://www.nhlbi.nih.gov/about/factpdf.htm http://www.cardiogenomics.med.harvard.edu http://www.nhgri.nih.gov/Policy_and _public_affairs/Legislation/insure.htm http://medicine.iupui.edu/flockhart/table.htm http://www.imm.ki.se/CYPalleles/ http://www.aidsinfonyc.org/tag/science/pgp.html http://www.hhs.gov/news/speech/2006/060630.html



6

Michael J. Thali and Stephan A. Bolliger

Contents 6.1 Introduction 6.1.1 History 6.1.2 Clinical Autopsy 6.1.3 Forensic Autopsy 6.1.4 Virtopsy 6.2 Techniques 6.2.1 Conventional Clinical and Forensic Autopsy 6.2.2 Virtopsy 6.2.2.1 Photogrammetry-Supported 3D Optical Surface Scanning 6.2.2.2 Computed Tomography 6.2.2.3 Magnetic Resonance Tomography 6.2.2.4 Data Fusion 6.3 Comparison of Quality Aspects in Autopsy and Virtopsy References

121 121 122 122 122 123 123 124 124 125 126 126 127 132

6.1â•‡Introduction 6.1.1â•‡History The term “autopsy” comes from the word composition “autos” and “opsomei,” which together mean “seeing (for) oneself.” For this reason, “autopsy” is itself already a quality concept as one sees from the adage: “One only believes what one has seen for oneself.” Autopsies are carried out in various fields and, historically, they have also been popular in various epochs and medical professional disciplines. On the one hand, a few hundred years ago, the anatomic autopsy served especially for understanding the human body with regard to morphology and function. The aim of using cadavers then was to obtain anatomic and physiologic knowledge in order to understand basic somatic functions such as the makeup of the organs, the connections of the circulation system, as


121

122


well as the nervous system. Today, anatomic sectioning serves primarily in the preclinical training of medical students. 6.1.2â•‡ Clinical Autopsy The main focus of the pathologic or clinical autopsy is no longer on clarifying how humans are constructed but rather on the quality control (QC) of clinical diagnostics and therapy [1–8]. Only a few decades ago, the rate of autopsies, depending on social and medical understanding, was still 10% or more. In the last years and in many places, though, the proportion of postmortem autopsies, used in hospitals for QC or for clearing up uncertainties, has fallen back, in some cases to less than 10% [9,10]. The task of pathologists has tended to develop away from the cadaver toward biopsy histopathology. In the last decades, there have been numerous publications that plausibly maintain that this reduction is dangerous and that autopsies are still needed in order to reveal diagnostic and therapeutic errors [11–13]. Autopsies, from a clinical, “educational,” and epidemiologic point of view, are therefore very valuable [14]. It is undeniable that the main interest of doctors, who have ascribed to healing patients in accordance with the Hippocratic Oath, has never been the deceased because, in the end, the cadaver ultimately represents a failure of the medical art. 6.1.3â•‡Forensic Autopsy Forensic medicine has the task of examining the so-called uncommon death as well as determining the aftereffects of violence to living persons. The best definition for an uncommon death was given by the former director of the Institute for Forensic Medicine of the University of Zürich, Prof. Fritz Schwarz: “Uncommon deaths are those that occur suddenly, unexpectedly, with suspicion of the aftereffects of violence, even when it might have occurred earlier.” In Switzerland, uncommon deaths must be reported to the district attorney, who will then commission further examinations, such as an autopsy. In forensic medicine, autopsies serve for clarifying the cause and manner of death. Since forensic medicine is frequently concerned with violent death and bodily harm, it focuses more on reconstruction of the course of events rather than microscopic and/or metabolic findings, as opposed to clinical pathologists. 6.1.4â•‡ Virtopsy Over hundred years ago, Wilhelm Conrad Röntgen introduced radiology into medicine. To this have now been added ultrasound, computer tomography (CT), magnetic resonance tomography (MRT), as well as all their respective © 2011 by Taylor and Francis Group, LLC


123

subspecialities and, in the clinic, they now belong to the methodic standards. The situation has been different in forensic medicine where, except classical x-ray, imaging methods were ignored for a long time. In the middle of the 1990s, the Institute for Forensic Medicine in Bern conducted a project dedicated to improve forensic medicine by applying different imaging techniques. The project was eventually called “Virtopsy,” a word derived from “virtual” and “autopsy,” because we wanted to emphasize the objectivity and not the subjectivity and therefore, eliminated the word “autos” (self). The goal of the Virtopsy Project [15–17] was to document findings three dimensionally using the most modern technologies (surface scanning, CT scanning, and magnetic resonance imaging [MRI] scanning), supplemented by postmortem biopsies and angiography. The imaging methods of Virtopsy, described in more detail in the following text, have revolutionized forensic pathology with regard to documentation and reconstruction. The project initially focused on corpses, but now it also serves in assessing living victims of assault.

6.2â•‡ Techniques 6.2.1â•‡ Conventional Clinical and Forensic Autopsy As far as we are aware, the standards as to how an anatomic or pathologic autopsy is performed are approximately the same in most countries. By and large, the standards have been anchored within the frameworks of professional or supra-regional societies. In the field of forensic autopsy, there are minimum standards from various societies or guidelines that have been negotiated by local QC organizations. Autopsy quality obviously depends, though, on the school, the training, and the experience of the pathologist. On the European mainland, the forensic autopsy has its roots in Austria/Hungary. Especially, the Germanspeaking countries in Europe orient themselves thereon. In America, a recently published report of the National Research Councils of the National Academies entitled “Strengthening Forensic Science in the United States: A Path Forward” showed that, especially in the area of forensic science, more quality standards are needed. A conventional clinical autopsy typically consists of an external examination of the corpse, an opening of the cranial, the thoracic and abdominal cavities, and an inspection/dissection of the internal organs. Of these organs, samples for histological and/or microbiological examinations are taken. The most relevant findings are photographed and noted on sketches. In addition to these steps, conventional forensic autopsy cases are frequently x-rayed and samples for chemical and toxicological analyses are taken. Besides the photographs and sketches, a written autopsy protocol documents the findings © 2011 by Taylor and Francis Group, LLC

124


and the conclusions of the examiner are summarized in a written report or expertise. 6.2.2â•‡ Virtopsy Today, the Institute for Forensic Medicine in Bern uses the following technologies routinely: Photogrammetry-supported three-dimensional (3D) optical surface scanning Computer tomography, supplemented by postmortem angiography and/or postmortem biopsies Magnetic resonance imaging Data fusion 6.2.2.1 Photogrammetry-Supported 3D Optical Surface Scanning Modern 3D surface scanners are mainly utilized in the industry (automobile fabrication, aerospace technology, and product deformation analyses). We have modified these 3D surface scanners in such a way that it is now possible to document the exterior of both the living and the deceased (Figure 6.1). This occurs in true-to-scale 3D resolution and with color information. Somatic injuries, due in the living to healing and in the deceased, to biological decay, are recorded for all posterity in three dimensions. In this way, patterned injuries to the body, which permit one to make inferences about the object that caused the injury, can be compared years later, if need be, with a possible injurious instrument. The injury shape agreement analysis, thus,

Figure 6.1â•‡ Surface scanning. The projector at the end of a robot arm casts striped light onto the object to be scanned, thus gaining information as to the surface structure.



125

is no longer time dependent. Such data, say for obtaining a second opinion, can now be sent around the world via the Internet or other data transmission channels. For example, injuries due to teeth or dentures, shoe imprints, tire profiles, and all other forms of patterned, violent effects to the bodily surface can be documented in three dimensions in this way [18–24] and are then available globally for later analyses and/expertises. 6.2.2.2 Computed Tomography Through the use of CT examinations, one can look into the body interior noninvasively (Figures 6.2 through 6.4). The essential findings from the somatic interior can thus be documented within a few minutes, in the clinic just as in forensic medicine [25–27]. It is undisputed that, when using CT, there are still autopsy findings that cannot be recorded in that way [28–32]. Our experience after more than 10 years shows, though, that using CT somatic findings can be documented and so visualized in three dimensions that these can be understood by lay persons. Due to the resolution of today’s CT instruments, not every bodily finding that one can detect in an autopsy can be documented by this means. For this reason, besides CT, we have developed a method of postmortem angiography (Figure 6.5), similar to what is found in the clinic. With postmortem angiography, the vasculature can be displayed [33–37]. Through this, it is possible to verify the smallest injuries that arise, for example, through gunshots or stabbings as well as in operations. Even leaks in the vascular bed and the coronary valves can be displayed in this way.

Figure 6.2â•‡ CT, 3D reconstruction of the skull of a suicidal gunshot to the mouth. Note the outward beveling at the vertex, indicating an exit defect.


126


For the possibility of histological examinations, we extended noninvasive Virtopsy by means of postmortem biopsies [38–39], in order to obtain tissue specimens from the cadaver (Figure 6.6). These tissue specimens are then made accessible for microscopic examinations. Experience has shown that—with the methods just described already—60%–80% of forensically relevant findings could be documented. 6.2.2.3 Magnetic Resonance Tomography For a high soft tissue resolution, not achievable to date with CT, one can perform an MRT scan. An MRT examination is essential, especially when it comes to coronary examinations, say in order to diagnose an infarct [40]. Also, findings in the brain, liver, etc., are better visualized than in CT [41–44] Figure 6.7). Essential is also the much better displayed soft tissue coverings that are of interest to the Figure 6.3â•‡ CT, 3D bone forensic pathologist, in contrast with the clinician. reconstruction. Note Thus, for example, impact injuries that occur as a the pelvic girdle fractures. Such an image is result of a traffic accident or the effects of violence easily appreciable, even to the neck (manual strangulation) become observ- for medical laypersons, able very readily. Experience in this area has already such as members of the brought us so far that we have sent victims of stran- court. gulations for clinical MRT examining in order to document the injuries [45,46]. Today, it is possible for us to examine the severity of lesions of living victims of strangulation, even if no injuries are seen in the clinical examination. In the early part of 2010, our Total Imaging Matrix TIM-MRI system, which has been in operation since 2009, could be extended with the so-called synthetic MRI software. The advantage of this TIM synthetic MRI system lies in the fact that in one examination step, various MRI sequences (such as T1-T2-PD, etc.) could be performed from tip to toe without any change of the surface traces (Figure 6.8). 6.2.2.4 Data Fusion Thanks to modern software, it is now possible to merge the data from the surface scannings and radiologic data (MRT and CT) into one data set. In addition to the body data set of living persons and of the deceased, we have now begun to include, in cooperation with the accident investigation service of the Bern cantonal police, the injurious objects (which can be an automobile or some other object) in the documentation [19]. This has gone so far © 2011 by Taylor and Francis Group, LLC


(a)

127

(b)

Figure 6.4 (See color insert following page 180.)â•‡ Shotgun gunshot to the

back. Semitranslucent skeletal reconstruction: (a) frontal view and (b) lateral view. Objects of a very high radioopacity, such as the pellets (encircled) or the hip prosthesis (arrow) are colored blue by the computer. Such an image makes assessment of the pellet distribution easier than an autopsy.

that we now also document in 3D the scene of the event (say in homicides or complex traffic accidents) with scanning methods. In this way, the situation can be displayed comprehensively. This means that the body and/or the injury that is involved, the causative object, and the 3D event scene are compiled together into one data set. In this way, the accident can be reconstructed virtually.

6.3â•‡Comparison of Quality Aspects in Autopsy and Virtopsy Autopsy is generally regarded as the “gold standard” in postmortem examination. Indeed, clinics rely on clinical autopsies, for example, to answer questions regarding effectiveness of a certain treatment regimen or the course of a © 2011 by Taylor and Francis Group, LLC

128


Figure 6.5â•‡ CT, 3D reconstruction with virtual removal of the left side of the

skull after postmortem whole-body angiography. The cerebral arteries are clearly visible.

Figure 6.6â•‡ Robot arm performing a biopsy. The biopsy needle can be guided accurately based on the CT images to sample a certain region of interest.

neoplastic disorder. Such an autopsy can deliver a multitude of specimens for further examination or research to an extent obviously not possible to gain in living patients. Alas, the rate of clinical autopsies is declining more or less rapidly due to increasing objections of the next of kin for religious and cultural reasons. © 2011 by Taylor and Francis Group, LLC


(a)

129

(b)

Figure 6.7 (See color insert following page 180.)â•‡ (a) Axial CT of the head

showing a region highly suspicious for a cerebral hemorrhage (yellow arrow). Note also the bubbles in the brain (green arrows), which are due to putrefaction, gas production of this decomposing body. (b) MRT of hemorrhage-sensitive sequence showing the CT findings even more clearly.

(a)

(b)

Figure 6.8â•‡ Traffic accident victim (pedestrian): (a) TIM, T1-weighted sequence showing fluid (blood) in the left thoracic cavity (arrow) and (b) T2 sequence showing a signal increase of the right lung due to blood aspiration (encircled). © 2011 by Taylor and Francis Group, LLC

130


The forensic autopsy, dedicated to determining the manner of death and reconstructing the course of events, is immensely important in examining a fatality in which involvement of a third party is suspected or cannot be excluded. The forensic autopsy is indeed so important that many countries have laws that prevent the next of kin being able to prevent such examinations and that hardly any judge would try a case without having the autopsy report. However, the autopsy—clinical and forensic—has several drawbacks. Although relevant autopsy findings are often documented by photography, less relevant or normal, inconspicuous findings are—if at all—only documented by the autopsy protocol. Therefore, one has to rely on the examiner’s experience in discriminating relevant from less relevant findings. In clinical autopsies, which rely heavily on histology, this generally does not pose great problems. However, in forensic autopsies, the experience and the integrity of the examiner may be challenged at court. Here, the forensic examiner is forced to prove the findings. According to our experience, the challenging of a forensic examiner’s competence is an increasing phenomenon. Therefore, the forensic examiner is well advised to take photographs of all findings—injured or pathologically altered as well as inconspicuous—in order to prove that, for example, a cardiac disease did or did not influence the victims outcome in, say, a shooting incident. In Switzerland, such a situation, namely a generally nonlethal gunshot injury which, due to a preexisting cardiac disease ultimately became fatal, will influence a judge’s verdict in favor of the defendant. However, even an x-ray or a photograph of a finding may pose problems. These methods reduce a three-dimensional structure to a two-dimensional image. The object in question can therefore only be viewed in one plane and fails to deliver information of the areas not depicted. With forensic imaging as described earlier, several important advantages arise. Certain findings such as gas within the vascular bed indicating a gas embolism may be missed entirely if one does not take (time consuming) appropriate measures at autopsy. Decomposing corpses may also pose difficulties at autopsy. Often, liquefying organs such as the brain are only kept in shape by thin boundaries, which are destroyed at autopsy, thus giving rise to the organ oozing out, eluding further investigation. As forensic imaging does not harm such boundaries, the chances of assessing decomposing organs are greatly enhanced. Furthermore, foreign objects—perhaps case relevant (i.e., bullet fragments, knife tips, etc.) or useful for identification of the corpse (i.e., dental fillings, prosthesis, etc.)—can be identified rapidly.



131

Acceptance of traditional autopsy has decreased dramatically in the past few years. By scanning corpses, a triage is possible. Many cases that would have been autopsied otherwise would not need further investigation. On the other hand, due to the greater acceptance of noninvasive forensic methods, a broader triage system is possible: when signs of a third-party involvement exist at postmortem imaging, then the arguments for an autopsy are much stronger. One might hypothesize that screening a greater proportion of deceased persons by imaging might help detect a larger number of homicides. MSCT and MRI, combined with postmortem angiography and imageguided biopsy, also have the potential to replace traditional autopsy in many cases, and therefore, to provide a viable examination technique for cultural circles in which autopsy is not welcome. Three-dimensionally reconstructed radiological images are, according to our experience, definitively preferred to by members of the court who do not possess medical knowledge of the typical blood-rich autopsy photographs. However, we believe that forensic imaging has an even greater advantage, namely, the reproducibility of findings. The surface of a corpse (or other object) and internal findings can be documented to scale. The hereby resulting 3D documentation can be stored digitally The data structure of these digital records is ideal for digital storage: by creating 3D images of bodies, instruments, and vehicles suspected of creating injuries and crime scenes, cases can be reexamined decades later, even after burial of the body and liberation of the crime scene. This reexamination can be undertaken by a completely different, unprejudiced group, giving rise to “forensic telemedicine,” a method that would correspond to the routinely performed “telepathology” conferences in clinical pathology. This technique will enhance quality assurance by allowing a neutral second opinion and a benchmark comparison. In daily forensic practice, it has become evident that through applying forensic imaging, an increase in quality and an improvement in forensic diagnostics can be achieved; and the examination results based on the imaging are often quicker and, thanks to a more visual 3D reconstruction, can be displayed in a way that lay persons can understand and comprehend. Momentarily, in terms of workflow and process, this Virtopsy system integration is the only forensic examination track in a forensic institute that has brought together all the modalities and technologies in this form for daily use and research. The method is so promising that we, at the Institute for Forensic Medicine in Bern, have built up an examination sequence of the abovementioned methods. In the last months, we have been able to integrate the various examination methods of the surface scannings, the CT as well as the postmortem angiography and biopsies within one examination room. And


132


we have optimized all of it with robot support. The resulting product is our “Virtobot.” Further developments in this field will surely follow. Imaging approaches with higher resolutions as well as faster software-based merging of the data are to be aimed for. Our goal is to create additional benefits in forensic clarification of events, entirely in accordance with our institute motto: “In every case—create clarity.”

References 1. Nichols L, Aronica P, and Babe C. 1998. Are autopsies obsolete? Am J Clin Pathol. 110: 210–218. 2. van den Tweel JG. 1999. Autopsies as an important indicator for quality control. Ned Tijdschr Geneeskd. 143: 2351–2354. 3. Dehner LP. 2010. The medical autopsy: Past, present, and dubious future. Mo Med. 107: 94–100. 4. Lundberg GD. 1998. Low-tech autopsies in the era of high-tech medicine: Continued value for quality assurance and patient safety. JAMA 280: 1273–1274. 5. Zarbo RJ, Baker PB, and Howanitz PJ. 1999. The autopsy as a performance measurement tool—Diagnostic discrepancies and unresolved clinical questions: A college of American pathologists Q-probes study of 2479 autopsies from 248 institutions. Arch Pathol Lab Med. 123: 191–198. 6. Smith CJ, Scott SM, and Wagner BM. 1998. The necessary role of the autopsy in cardiovascular epidemiology. Hum Pathol. 29: 1469–1479. 7. Burke MC, Aghababian RV, and Blackbourne B. 1990. Use of autopsy results in the emergency department quality assurance plan. Ann Emerg Med. 19: 363–366. 8. Fernando LBM. 2008. Place of autopsy in quality assurance of curative service. Galle Med J. 13: 51–54. 9. Shojania KG and Burton EC. 2008. The vanishing nonforensic autopsy. N Engl J Med. 358: 873–875. 10. Sinard JH. 2001. Factors affecting autopsy rates, autopsy request rates, and autopsy findings at a large academic medical center. Exp Mol Pathol. 70: 333–343. 11. Aalten CM, Samson MM, and Jansen PA. 2006. Diagnostic errors; the need to have autopsies. Neth J Med. 64: 186–190. 12. Marwick C. 1995. Pathologists request autopsy revival. JAMA. 273: 1889–1891. 13. Xiao J, Krueger GR, Buja LM, and Covinsky M. 2009. The impact of declining clinical autopsy: Need for revised healthcare policy. Am J Med Sci. 337: 41–46. 14. Burton JL and Underwood J. 2007. Clinical, educational, and epidemiological value of autopsy. Lancet 369: 1471–1480. 15. Thali MJ, Yen K, Schweitzer W, Vock P, Boesch C, Ozdoba C, Schroth G et al. 2003. Virtopsy, a new imaging horizon in forensic pathology: Virtual autopsy by postmortem multislice computed tomography (MSCT) and magnetic resonance imaging (MRI)—A feasibility study. J Forensic Sci. 48: 386–403. 16. Bolliger SA, Thali MJ, Ross S, Buck U, Naether S, and Vock P. 2008. Virtual autopsy using imaging: Bridging radiologic and forensic sciences. A review of the Virtopsy and similar projects. Eur Radiol. 18: 273–282.



133

17. Thali MJ, Dirnhofer R, and Vock PP, eds. 2009. The Virtopsy Approach-3D Optical and Radiological Scanning and Reconstruction in Forensic Medicine, CRC Press, Boca Raton, FL. 18. Buck U, Albertini N, Naether S, and Thali MJ. 2007. 3D documentation of footwear impressions and tyre tracks in snow with high resolution optical surface scanning. Forensic Sci Int. 171: 157–164. 19. Buck U, Naether S, Braun M, Bolliger S, Friederich H, Jackowski C, Aghayev E, Christe A, Vock P, Dirnhofer R, and Thali MJ. 2007. Application of 3D documentation and geometric reconstruction methods in traffic accident analysis: With high resolution surface scanning, radiological MSCT/MRI scanning and real data based animation. Forensic Sci Int. 170: 20–28. 20. Thali MJ, Braun M, and Dirnhofer R. 2003. Optical 3D surface digitizing in forensic medicine: 3D documentation of skin and bone injuries. Forensic Sci Int. 137: 203–208. 21. Thali MJ, Braun M, Markwalder TH, Brueschweiler W, Zollinger U, Malik NJ, Yen K, and Dirnhofer R. 2003. Bite mark documentation and analysis: The forensic 3D/CAD supported photogrammetry approach. Forensic Sci Int. 135: 115–121. 22. Thali MJ, Braun M, Brueschweiler W, and Dirnhofer R. 2003. Morphological imprint: Determination of the injury-causing weapon from the wound morphology using forensic 3D/CAD-supported photogrammetry. Forensic Sci Int. 132: 177–181. 23. Brüschweiler W, Braun M, Dirnhofer R, and Thali MJ. 2003. Analysis of patterned injuries and injury-causing instruments with forensic 3D/CAD supported photogrammetry (FPHG): An instruction manual for the documentation process. Forensic Sci Int. 132: 130–138. 24. Thali MJ, Braun M, Brüschweiler W, and Dirnhofer R. 2000. Matching tire tracks on the head using forensic photogrammetry. Forensic Sci Int. 11: 281–287. 25. Thali MJ, Schweitzer W, Yen K, Vock P, Ozdoba C, Spielvogel E, and Dirnhofer R. 2003. New horizons in forensic radiology: The 60-second digital autopsy-fullbody examination of a gunshot victim by multislice computed tomography. Am J Forensic Med Pathol. 24: 22–27. 26. Leth PM. 2009. Computerized tomography used as a routine procedure at postmortem investigations. Am J Forensic Med Pathol. 30: 219–222. 27. Ljung P, Winskog C, Persson A, Lundström C, and Ynnerman A. 2006. Full body virtual autopsies using a state-of-the-art volume rendering pipeline. IEEE Trans Vis Comput Graph. 12: 869–876. 28. Aghayev E, Christe A, Sonnenschein M, Yen K, Jackowski C, Thali MJ, Dirnhofer R, and Vock P. 2008. Postmortem imaging of blunt chest trauma using CT and MRI: Comparison with autopsy. J Thorac Imaging. 23: 20–27. 29. Christe A, Ross S, Oesterhelweg L, Spendlove D, Bolliger S, Vock P, and Thali MJ. 2009. Abdominal trauma—Sensitivity and specificity of postmortem noncontrast imaging findings compared with autopsy findings. J Trauma. 66: 1302–1307. 30. Jacobsen C and Lynnerup N. 2010. Craniocerebral trauma—Congruence between post-mortem computed tomography diagnoses and autopsy results: A 2-year retrospective study. Forensic Sci Int. 194: 9–14.


134


31. Jacobsen C, Bech BH, and Lynnerup N. 2009. A comparative study of cranial, blunt trauma fractures as seen at medicolegal autopsy and by computed tomography. BMC Med Imaging. 9: 18. 32. Filograna L, Tartaglione T, Filograna E, Cittadini F, Oliva A, and Pascali VL. 2010. Computed tomography (CT) virtual autopsy and classical autopsy discrepancies: Radiologist’s error or a demonstration of post-mortem multi-detector computed tomography (MDCT) limitation? Forensic Sci Int. 195: e13–e17. 33. Grabherr S, Djonov V, Friess A, Thali MJ, Ranner G, Vock P, and Dirnhofer R. 2006. Postmortem angiography after vascular perfusion with diesel oil and a lipophilic contrast agent. AJR Am J Roentgenol. 187: W515–W523. 34. Jackowski C, Bolliger S, Aghayev E, Christe A, Kilchoer T, Aebi B, Périnat T, Dirnhofer R, and Thali MJ. 2006. Reduction of postmortem angiographyinduced tissue edema by using polyethylene glycol as a contrast agent dissolver. J Forensic Sci. 51: 1134–1137. 35. Grabherr S, Gygax E, Sollberger B, Ross S, Oesterhelweg L, Bolliger S, Christe A, Djonov V, Thali MJ, and Dirnhofer R. 2008. Two-step postmortem angiography with a modified heart-lung machine: Preliminary results. AJR Am J Roentgenol. 190: 345–351. 36. Ross S, Spendlove D, Bolliger S, Christe A, Oesterhelweg L, Grabherr S, Thali MJ, and Gygax E. 2008. Postmortem whole-body CT angiography: Evaluation of two contrast media solutions. AJR Am J Roentgenol. 190: 1380–1389. 37. Flach PM, Ross SG, Bolliger SA, Preiss US, Thali MJ, and Spendlove D. 2010. Postmortem whole-body computed tomography angiography visualizing vascular rupture in a case of fatal car crash. Arch Pathol Lab Med. 134: 115–119. 38. Aghayev E, Ebert LC, Christe A, Jackowski C, Rudolph T, Kowal J, Vock P, and Thali MJ. 2008. CT data-based navigation for post-mortem biopsy—A feasibility study. J Forensic Leg Med. 15: 382–387. 39. Aghayev E, Thali MJ, Sonnenschein M, Jackowski C, Dirnhofer R, and Vock P. 2007. Post-mortem tissue sampling using computed tomography guidance. Forensic Sci Int. 166: 199–203. 40. Jackowski C, Christe A, Sonnenschein M, Aghayev E, and Thali MJ. 2006. Postmortem unenhanced magnetic resonance imaging of myocardial infarction in correlation to histological infarction age characterization. Eur Heart J. 27: 2459–2467. 41. Patriquin L, Kassarjian A, Barish M, Casserley L, O’Brien M, Andry C, and Eustace S. 2001. Postmortem whole-body magnetic resonance imaging as an adjunct to autopsy: Preliminary clinical experience. J Magn Reson Imaging. 13: 277–287. 42. Bisset R. 1998. Magnetic resonance imaging may be alternative to necropsy. BMJ. 317: 1450. 43. Roberts IS, Benbow EW, Bisset R, Jenkins JP, Lee SH, Reid H, and Jackson A. 2003. Accuracy of magnetic resonance imaging in determining cause of sudden death in adults: Comparison with conventional autopsy. Histopathology 42: 424–430. 44. Ros PR, Li KC, Vo P, Baer H, and Staab EV. 1990. Preautopsy magnetic resonance imaging: Initial experience. Magn Reson Imaging. 8: 303–308.



135

45. Christe A, Thoeny H, Ross S, Spendlove D, Tshering D, Bolliger S, Grabherr S, Thali MJ, Vock P, and Oesterhelweg L. 2009. Life-threatening versus non-lifethreatening manual strangulation: Are there appropriate criteria for MR imaging of the neck? Eur Radiol. 19: 1882–1889. 46. Yen K, Vock P, Christe A, Scheurer E, Plattner T, Schön C, Aghayev E, Jackowski C, Beutler V, Thali MJ, and Dirnhofer R. 2007. Clinical forensic radiology in strangulation victims: Forensic expertise based on magnetic resonance imaging (MRI) findings. Int J Legal Med. 121: 115–123.


Accreditation, Standards, and Education: Their Role in Maintaining Quality


III


7

Maciej J. Bogusz and Huda Hassan

Contents Abbreviations 7.1 Definitions of Accreditation 7.2 Role and Aims of Accreditation Components in Pathology and Laboratory Medicine 7.2.1 Role of Proficiency Testing 7.2.2 Role of Inspection 7.2.3 Role of Quality Management 7.2.3.1 Quality Management Plan 7.2.3.2 Requirements of CAP, ISO 15189, and ISO/EC 17025 Regarding QM 7.3 Legal Frames, Regulations, and Accreditation Bodies in Pathology, Laboratory Medicine, and Related Areas 7.3.1 International Standards of ISO 7.3.1.1 Development of ISO 17025 and ISO 15189 7.3.1.2 Relationship between ISO 9001, ISO 17025, and ISO 15189 7.3.1.3 Management Requirements of ISO 15189 7.3.1.4 Technical Requirements of the ISO 15189 7.3.1.5 Technical Requirements of the ISO/IEC 17025:2005 7.3.1.6 Accreditation of Testing Laboratories and Medical Laboratories According to ISO 17025 and/or ISO 15189 7.3.2 International Accreditation Organizations 7.3.2.1 International Laboratory Accreditation Cooperation 7.3.2.2 International Accreditation Forum


139

140 141 143 143 147 149 149 150 153 153 156 156 157 162 166 168 172 172 173

140


175 7.3.3 U.S. Regulations and Accreditation Organizations 7.3.3.1 Centers for Medicare and Medicaid Services Clinical Laboratory Improvement Act (CMS CLIA) 175 7.3.3.2 Commission on Office Laboratory Accreditation 177 178 7.3.3.3 College of American Pathologists (CAP) 187 7.3.3.4 JCIA 7.3.3.5 Other U.S. Nonmedical Accreditation 190 Organizations 191 7.3.4 European Accreditation Organizations 191 7.3.4.1 European Cooperation for Accreditation 192 7.3.4.2 European Standards Organization CEN 7.3.5 Accreditation Organizations and Policies in Selected 194 Countries 194 7.3.5.1 Canada 194 7.3.5.2 United Kingdom 7.3.5.3 Germany 195 196 7.3.5.4 Finland 196 7.3.5.5 Italy 196 7.3.5.6 France 197 7.3.5.7 China 197 7.3.5.8 Developing Countries 199 7.4 Publications and Journals on Accreditation 201 References

Abbreviations A2LA American Association for Lab Accreditation American Association of Blood Banks AABB ANSI-ASQ American National Standards Institute-American Society for Quality American Osteopathic Association AOA ASCLD-LAB American Society of Crime Lab Directors/Laboratory Accreditation Board College of American Pathologists CAP CEN Comité Europeen de Normalisation (European Standards Organization) Comité International des Poids et Mesures CIPM CLIA Clinical Laboratory Improvement Amendments CLSI Clinical and Laboratory Standard Institute CMS Centers for Medicare and Medical Services Commission on Office Laboratory Accreditation COLA Clinical Pathology Accreditation CPA © 2011 by Taylor and Francis Group, LLC


141

DAP Deutsches Akkreditierungssystem Prüfwesen (German Accreditation System for Testing) European Cooperation for Accreditation EA EC4 The European Communities Confederation of Clinical Chemistry and Laboratory Medicine External quality assessment EQA EQALM European Committee for External Quality Assurance Programmes in Laboratory Medicine Food Analysis Performance Assessment Scheme FAPAS Food and Drug Administration FDA Good clinical laboratory practice GCLP Good laboratory practice GLP U.S. Department of Health and Human Services HHS IAF International Accreditation Forum International Accreditation Service IAS ICSCA Industry cooperation on standards and conformity assessment The International Electrotechnical Commission IEC IFCC International Federation of Clinical Chemistry and Laboratory Medicine IFSTP International Federation of Societies of Toxicologist Pathologists International Laboratory Accreditation Cooperation ILAC International Organization for Standardization ISO Joint Commission JC Joint Commission International Accreditation JCIA Laboratory Accreditation Bureau L-A-B LAP Laboratory Accreditation Program of CAP LIS Laboratory Information System National Voluntary Accreditation Program NVLAP OIML Organisation Internationale de Métrologie Légale PJLABS Perry Johnson Laboratory Accreditation Service PT Proficiency testing QM Quality management Standard operation procedure SOP UKAS United Kingdom Accreditation Service UNIDO United Nations Industrial Development Organisation

7.1â•‡Definitions of Accreditation Accreditation may be defined on several ways. Various dictionaries provide general definitions of accreditation, as © 2011 by Taylor and Francis Group, LLC

142


Accreditation—the act of granting credit or recognition (especially with respect to educational institution that maintains suitable standards) [1,2],

or Accreditation: Certification of competence in specified subject or areas of expertise, and of the integrity of an agency, firm, group, or person, awarded by a duly recognized and respected accrediting organization [3].

According to Merriam-Webster online dictionary “to accredit” means to give official authorization or approval of; … to recognize (an educational institution) as maintaining standards that qualify the graduates for admission to higher or more specialized institutions or for professional practice; to consider or recognize as outstanding [4].

International Standard Organization, which is involved in issuing accreditation standards, described accreditation as third party attestation related to a conformity assessment body conveying formal demonstration of its competence to carry out specific conformity measurement tasks. Conformity assessment body was defined as a body that performs conformity assessment services and that can be the object of accreditation, whereas conformity assessment was the demonstration that specified requirements relating to a product, process, system, person or body are fulfilled [5]. International accreditation service coordinators, like International Laboratory Accreditation Cooperation (ILAC) or International Accreditation Forum (IAF), gave the following views on accreditation: Accreditation allows people to make an informed decision when selecting a laboratory, as it demonstrates competence, impartiality and capability. It helps to underpin the credibility and performance of goods and services [6]. Accreditation reduces risk for business and its customers by assuring them that accredited bodies are competent to carry out the work they undertake [7]. For U.K. Accreditation Service (UKAS), accreditation (by UKAS) means that evaluators i.e., testing and calibration laboratories, certification and inspection bodies have been assessed against internationally recognized standards to demonstrate their competence, impartiality and performance capability. It is the ability to distinguish between a proven, competent evaluator that ensures that the selection of a laboratory, certification or inspection body is an informed choice and not a gamble [8].

Accreditation is followed by certification—a procedure by which a third party gives written assurance (certificate) that a product, process, or service conforms to specific requirements. © 2011 by Taylor and Francis Group, LLC


143

All definitions of accreditation contain two main elements: • The purpose of accreditation, which is to prove, recognize, and certify the competence of the involved institution or organization in defined area. In definitions given by organizers and providers of accreditation service, this is completed with the benefits for prospective client or customer. • The means of how to achieve accreditation, which is done by independent, impartial, and competent assessors against internationally recognized standards. Both elements are relevant in pathology, laboratory medicine, and related areas. The purpose and benefits of accreditation, i.e., the answer to the question “Why accredit?” is well recognized throughout the world. However, the technical requirements, organizational efforts, and high cost of accreditation procedures are still associated with the fact that in many countries the answer to the question “How to achieve accreditation?” is extremely difficult, if not impossible.

7.2â•‡Role and Aims of Accreditation Components in Pathology and Laboratory Medicine Generally, the certificate of accreditation is a seal of quality of the laboratory service involved in any field. It allows clients to make an informed decision when selecting a laboratory for a particular service, on the basis of proven and documented competence and credibility. These features are particularly important in such sensitive areas, like pathology and laboratory medicine. Incompetent and unreliable laboratory service may, on the one hand, jeopardize the health and even the life of the patient involved, and, on the other hand, not only may it ruin the reputation of the particular laboratory, but it could also affect the entire quality and image of medical service in the covered area. For these reasons, the quality assurance of the medical laboratory activities is a must. It has been recognized more than two decades ago that the best way to achieve and maintain the high level of laboratory work is to certify its work though accreditation process. 7.2.1â•‡Role of Proficiency Testing Proficiency testing (PT), which is a synonym of the term “external quality assessment” (EQA) used in Europe and South America, is a component of a laboratory’s total quality system that is intended to verify on a periodic basis that laboratory results conform to the expectations for quality set by the organizing body. © 2011 by Taylor and Francis Group, LLC

144


PT schemes have multiple uses in laboratory medicine. It begins with the PT of diagnosis/identification procedures (e.g., troponins in diagnosis of myocardial infarction or detection of toxic compound in body fluids) on screening and confirmation level up to monitoring the course of illness and the effects of treatment. For the former, the specificity and sensitivity of the methods are of primary importance; for the latter, the robustness and low variability are most relevant. A major limitation of PT is the tendency to maintain the quality at a certain level rather than to stimulate improvement [9]. Technically, PT is an assessment of a laboratory’s analytical performance in comparison to its peers or to an external, accuracy-based reference system. Miller reviewed recently the role of PT in achieving the main task of accreditation, i.e., the standardization and harmonization [10]. “Peer grouping” is the most common procedure used in assigning a target value in PT assessment in pathology and laboratory medicine. This approach is necessary because most control materials used for PT are modified during preparation in such a manner that the matrix is altered relative to native clinical samples and the PT samples are not commutable with native clinical samples. Therefore, it is assumed that “peer groups” that represent similar technology are likely to achieve the same result and the mean value of the peer group may be calculated as the target value. Peer groups are usually formed as instrument/method groupings from the same manufacturer. The second possibility to assign a target value is by measurement of a PT sample using a reference measurement procedure. This approach can be used when the PT material is commutable with native clinical samples. A commutable PT sample is one that has an equivalent mathematical relationship as that observed for native clinical samples between all the different measurement procedures represented in the survey. The topic of commutability has been reviewed recently by Panteghini [11] and is discussed in the Chapter 8.4.2. Since it is uncommon that PT samples are commutable with native clinical samples, target value assignment with a reference measurement procedure is used only in limited cases. Thompson et al. [12] compared the performance of accredited and nonaccredited methods, using the Food Analysis Performance Assessment Scheme (FAPAS•) PT scheme (which is accredited by UKAS). Fifty qualifying examples of analyte-test material combination were selected at random from the reports from the year 2006. The accredited/nonaccredited subsets of results from each example were subjected to a statistical analysis to determine whether any significant differences between the distributions of results could be detected. The proportion of outliers was about twice as high among the nonaccredited group. However, this difference did not reach the level of significance.



145

Wilson reviewed EQA schemes, applied in toxicology in the United Kingdom [13]. A variety of schemes monitor quantitative performance for analysis of toxic agents such as paracetamol, salicylate, ethanol, and carboxyhemoglobin. Their usefulness for toxicologists depended on the concentration range, which should extend fully into the toxic range, and on the matrix used (synthetic, of animal origin or serum as opposed to whole human blood). A scheme for quantitative determinations of a wider range of toxicological analytes such as opioids, benzodiazepines, and tricyclic antidepressants in human blood has been piloted by the U.K. National External Quality Assessment Scheme (UKNEQAS). Specialist schemes were available for drugs of abuse testing in urine and for hair analysis. While these programs provided much useful information on the performance of analytical techniques, they failed to monitor the integrated processes that are needed in investigation of toxicological cases. In practice, both qualitative and quantitative tests are used in combination with case information to guide the evaluation of the samples and to develop an interpretation of the analytical findings that is used to provide clinical or forensic advice. EQA programs that combine the analytical and interpretative aspects of case studies are available from EQA providers such as UKNEQAS and the Dutch KKGT program (Stichting Kwaliteitsbewaking Klinische Geneesmiddelanalyse en Toxicologie). In an older study, Ferrara et al. [14] reviewed the validity and effectiveness of quality control procedures in light of the principles of analytical toxicology and in awareness of the profound influence which analytical results have in the fields of health and social security. The need of very high degree of reliability of laboratory work was stressed, and factors contributing to the quality of analytical results and methods used to check their reliability were discussed. The technical background and organization of internal and external quality control procedures were presented, with particular reference to educational aspects. Travers presented specific needs of developing countries in relation to EQA, from the view of College of American Pathologists (CAP) [15]. In response to requests from World Health Organization (WHO), CAP organized an EQA program for Latin America. The supply of material for distribution was facilitated, and training in quality management (QM) was promoted. CAP collaborated with the Caribbean Epidemiology Center, responsible for dissemination of all EQA activities through Latin America. Unfortunately, this program did not work and by 1998 practically stopped. According to the author, there are several conditions, which should be met to achieve success in implementation of EQA in developing countries, like laboratory medicine culture, national culture, level of basic services, mode of use of laboratory test and their interpretation, vendor capabilities, and budget allocated for EQA programs.


146


In a recent study, Thomas [9] performed a survey on EQA schemes in laboratory medicine among 22 EQA organizations representing 407 schemes. The purpose of the study was to determine a frequency of control rounds per year and the number of samples distributed per round. A wide variation was found both within and between disciplines, such as biochemistry, hematology, microbiology, hemostasis, immunology, and histopathology. The median for all disciplines was four rounds per year, for biochemistry six rounds per year, and for hematology three rounds per year. There are several providers of PT programs and schemes. The European Proficiency Testing Information System (EPTIS) [16] helps to find a suitable PT scheme in any region or worldwide. EPTIS database lists almost 1000 schemes, mainly in the fields of chemical and mechanical testing. A comprehensive body of PT schemes available for clinical chemistry, toxicology, and related areas is available on this Web site. Several professional bodies issued guidelines regarding organization of PT programs and evaluation of PT results. European Committee for External Quality Assurance Programmes in Laboratory Medicine (EQALM) is assembling nonprofit organizations for external quality assurance programs in laboratory medicine and established working groups on specific scientific matters (e.g., on hematology, microbiology, nomenclature, among others). Detailed description of the activities of EQALM is done on its homepage [17]. International Federation of Clinical Chemistry (IFCC) formulated detailed guidelines concerning organization of PT programs, which are also published on the homepage of EQALM [18]. This document is divided into three sections. The first general section describes the scope of the guidelines, gives references (mainly International Organization for Standardization [ISO] standards), and definitions of the terms used. The second section is devoted to management system requirements, like quality management system (QMS), document control, use of subcontractors, client feedback, corrective and preventive action, records, internal audits, and management reviews, among others. The third section describes technical requirements, concerning management, staffing, and training, facilities, organization and logistics, choice of methods or procedures, data analysis and interpretation, communication with participants, confidentiality, collusion, and falsification of results. There are two appendices; Appendix A presents commonly used statistical methods for treatment of PT data, whereas Appendix B gives cross-references to ISO 9000, ISO Guide 43-1, and ISO/EC 17025. In the United States, the U.S. Department of Health & Human Services (HHS), acting through Centers of Medicare & Medicaid Services (CMS), published a list of approved PT providers [19]. The list comprises providers offering PT programs in the following disciplines: chemistry (including routine chemistry, endocrinology, and toxicology), cytology, diagnostic immunology, general immunology, hematology, immunohematology, and © 2011 by Taylor and Francis Group, LLC


147

microbiology. The CMS-approved cytology PT Programs are provided by the CAP, the State of Maryland Cytology PT Program, and the American Society for Clinical Pathology program. The Clinical and Laboratory Standards Institute (CLSI) [20] provided practical guidance for clinical laboratories regarding use and evaluation of PT results. This document, which is addressed principally to U.S. laboratories, includes guidance on selection of a PT program, PT sample handling procedures, evaluation and reporting process, investigation of and response to unsatisfactory scores, and monitoring PT performance over time. The guidance also covers assessment of pre- and post-examination phases of laboratory testing, and using PT as an educational tool [21]. As concerns unacceptable PT results, the CLSI guideline suggests identifying the source of the problem through defined scheme. This scheme classifies possible problem areas such as clerical errors, methodological problems, equipment problems, technical problems caused by personnel errors, and problems with the PT material. Each problem area is divided into detailed possible sources of errors. 7.2.2â•‡Role of Inspection The internationally recognized standard for the competence of inspection bodies is ISO/IEC 17020:1998 “General criteria for the operation of various types of bodies performing inspection.” This standard is identical to European standard EN 45004. ISO/IEC 17020 should not be confused with the QM standard ISO 9001:2000. The latter is specific to QMSs and does not require evaluation of the technical competence of an inspection body. Therefore, ISO 9001:2000 should not be regarded as an acceptable alternative to ISO 17020. ILAC and IAF issued “Guidance on the Application of ISO/IEC 17020” [22]. This document deals with the following issues of the standard: scope; definitions; administrative requirements; independence, impartiality, and integrity; confidentiality; organization and management; quality system; personnel; facility and equipment; inspection methods and procedures; handling inspection samples and items; records; inspection reports and inspection certificate; subcontracting; complaints and appeals; cooperation; and appendices. According to the guidance, the following elements should be included in inspection reports and certificates: • Designation of the document, i.e., as an inspection report or an inspection certificate, as appropriate (mandatory) • Identification of the document, i.e., date of issue and unique identification (mandatory) • Identification of the issuing body (mandatory) © 2011 by Taylor and Francis Group, LLC

148

• • • •

• • • •

• • • • • • • •


Identification of the client (mandatory) Description of the inspection work ordered (mandatory) Date(s) of inspection (mandatory) Identification of the object(s) inspected and, where applicable, identification of the specific components that have been inspected and identification of locations where particular methods have been applied (mandatory) Information on what has been omitted from the original scope of work (mandatory) Identification or brief description of the inspection method(s) and procedure(s) used, mentioning the deviations from, additions to or exclusions from the agreed methods and procedures Identification of equipment used for measuring/testing Where applicable, and if not specified in the inspection method or procedure, reference to or description of the sampling method and information on where, when, how, and by whom the samples were taken If any part of the inspection work has been subcontracted, the results of this work shall be clearly identified (mandatory) Information on where the inspection was carried out Information on environmental conditions during the inspection, if relevant The results of the inspection including a declaration of conformity and any defects or other non-compliances found (results can be supported by tables, graphs, sketches, and photographs) (mandatory) A statement that the inspection results relate exclusively to the work ordered or the object(s) or the lot inspected A statement that the inspection report shall not be reproduced except in full without the approval of the inspection body and the client The inspector’s mark or seal Names (or unique identification) of the staff members who have performed the inspection and in cases when secure electronic authentication is not undertaken, their signature (mandatory)

The Belgian company “To the Point Consulting” [23] offers special ISO 17020 implementation package to inspection bodies from around the world. The package contains a quality manual, procedures, and quality records that comply with ISO 17020, and covers all sections and subsections of the ISO 17020 standard in a matching way. It defines a baseline system that satisfies ISO 17020 requirements and provides model of a quality system. The inspection may be announced or unannounced. The advantage of unannounced inspection is that it reflects the quality of laboratory work in real-life situation. It is known and understandable that an announced © 2011 by Taylor and Francis Group, LLC


149

inspection is preceded by the meticulous preparation of the laboratory staff and facilities. In such situation, the main accent is put on passing the inspection and not on delivering quality results. This may mask various existing drawbacks. The example of the laboratory in a prestigious U.S. hospital, which successfully passed announced inspections for years and was delivering faulty, life-threatening results, was described by Ehrmeyer and Laessig [24]. In any case, the inspection must be associated with permanent internal audit, focused on fault finding, and not on punishment, as formulated by ISO 15189. 7.2.3â•‡Role of Quality Management 7.2.3.1 Quality Management Plan In clinical laboratories, the QMS is necessary for improvement of services provided by the laboratory in order to improve of patient’s care and safety. Continuous assessment of the laboratory management will effect in constant readiness for inspection. According to Bachner [25], the QMS in pathology and laboratory medicine was defined as a “set of key quality elements that must be in place for an organization’s work operations to function in a manner that meets the organization’s stated quality objectives.” The key quality elements used in the pathology and laboratory medicine are Organization, Personnel resources, Equipment, Supplier and customer issues, Process Control, Documents and Records, Occurrence Management, Assessments, Process Improvement, Facilities and Safety, Information management, and Customer Service and Satisfaction. The elements of the QM plan should be developed by leadership of after careful analysis of these elements. QM plan in clinical laboratory belongs to Clinical Laboratory Improvement Amendments 88 (CLIA’88) and CAP accreditation requirement to ensure that the laboratory participates in monitoring and evaluation of the quality and appropriateness of services provided. It is the responsibility of the laboratory director for implementation of the QM plan. A QM plan is describing the scope of services and organizational chart of the laboratory section, monitoring the pre-analytic, post-analytic phase for testing, quality control system assuring the delivery the accurate and timely results needed in patient care, enhancing employee training and competency assessment, document control requirements, procedures for monitoring of quality control, internal and external quality indicators, customer satisfaction, and reporting of internal quality improvement activities [25]. Plan format which can be in the laboratory format, or according to CLSI (NCCLS) guidelines (GP-22 or GP-26), ISO 9000 series, ISO 15189 accreditation and standards, Joint Commission (JC) Model for Improvement of Organizational Performance or American association of blood banks (AABB) quality program. © 2011 by Taylor and Francis Group, LLC

150


The QM plan should include all analytic cycles in all sections as well as the mission statement to provide quality and patient safety, risk assessment, monitoring and control activities such as identifying indicators and metrics, identification of problems, information and communication, and continuous improvement. In relation to the QM implementation, the following points are relevant: determination of delegation and responsibility, specification of the frequency of activities, creation of Quality Committee and documentation of its activity, quality improvement report, and documents responding to complaints, problems, and adverse events. During the on-site inspection of the clinical laboratory the inspector will be looking for written QM plan, involvement of the laboratory director in the QMS, monitoring process for improvement, communication within organization, incorporation of proficiency data and corrective action, employee and client’s satisfaction survey results, and utilization of the incident reports for improvement [25]. 7.2.3.2 Requirements of CAP, ISO 15189, and ISO/EC 17025 Regarding QM The CAP recently introduced an educational accreditation program based on the ISO 15189 standard for medical laboratory [26]. The core benefit of using ISO 15189 standards comes from following its comprehensive and highly structured approach for QM. The ISO 15189 standard, designed specifically for the medical laboratories, covers 15 management requirements and 8 technical requirements. As an initial step of QM implementation along the ISO 15189 lines, the “gap analysis” should take place. The laboratory should conduct the internal audit for its processes, to identify the weak areas. Some laboratory may request a pre-assessment from CAP which takes place 9 days before the final accreditation assessment. Once the laboratory passes the final assessment, a 3 year cycle begins; in the first year and second years, two surveillances are scheduled, and during the third year, on-site accreditation is required. Even though many countries adopted the ISO standards as national basis for their accreditation of the medical laboratories, the CMS is not yet ready to make the ISO 15189 a required part of laboratory accreditation under CLIA. The reason is that some requirements in the ISO 15189 are more general and not as stringent or specific as CLIA regulations. For example, the ISO 15189 standard requires having a competent laboratory director, in CLIA this requirements is more specific and indices the training, education, required experience, and responsibilities for this position [26]. Several authors investigated the role and influence of QM on the quality of laboratory work in various disciplines. Bak et al. [27] performed a study to investigate most common used certification and accreditation systems in terms of their efficacy in improving the functional outcome of the rehabilitation © 2011 by Taylor and Francis Group, LLC


151

from the patient’s perspective. None of the eight identified accreditation and certification systems seemed to be especially appropriate for outcome-based optimizing of rehabilitation process. It was concluded that QMSs in terms of functional health have been provided poor evidence of effectiveness, implementation, and the positive influence on patient’s functional health to deliver an economic benefit. More research is needed to improve evidence in terms of measurable benefit of accreditation and certification of health care providers for patients and other stakeholders. Lehmann [28] evaluated the Â�standards and checklists of CLIA’88 and CAP Laboratory Accreditation Program (LAP) to check the applicability and conformance to ISO 9001 Section 4. Section 4 of ISO 9001 contains 20 aspects of a quality system that must be addressed by an organization in order to receive ISO 9001 certification. This concept was extended to the clinical laboratory when a quality system program establishes for the customer (patient/clinician) that the purchased product (requested information on a submitted specimen-test result) meets established quality norms. Policies and procedures must be available in organization to ensure quality product and be certified. For organization to be certified it must go through the inspection process and demonstrating that it meets defined standards. Grunnet [29] assessed the role and influence of QM on the activity of blood banks in Denmark. The level of implementation of QM in transfusion centers in Denmark is at the accreditation level with reference to the European Union (EU) Blood Directives the Danish Blood Law and is in many aspects equivalent to the ISO 15189 standard. Blood banks are separate hospital departments covering all aspects of the transfusion activity with specially trained medical doctors (separate medical specialty), donor selection, production of blood components, testing for selected infectious markers, blood grouping and compatibility testing, investigation of adverse reactions/complications to transfusions and constructive dialogs with representative users of the services from the blood bank and blood bank personnel in the Hospital Transfusion Committees to secure appropriate use (clinical doctors and nurses) and relevant accessibility of blood components and laboratory testing (the blood bank output). The following tools of QM are in use: a quality manual (overall objectives), master description of procedures (master plans), standard operating procedures (SOPs), and a well-prepared feedback system using quality control measurements of blood components and laboratory tests, through reports of variations (deviation from intended result or SOP), complaints, systematic internal audits, updated educational records of all personnel involved in the activities of the blood bank, assurance that all equipment and utensils are only taken in use after proper validation/qualification and that a maintenance plan or acceptance test is in action. Furthermore, a relevant number of external proficiency tests were carried out to secure the analytical quality of all key parameters in the laboratory. Every second year, the blood bank was inspected by the Danish Medical © 2011 by Taylor and Francis Group, LLC

152


Agency and identified issues must be addressed in a written response within a time limit. The issues pointed out can deal with the building, personnel, apparatuses, equipment, utensils, processing, data management, corrective actions, and other issues relevant for the fulfillment of the requirements of a European blood bank setting in 2007. In addition, the area of transfusion is surveyed at a national level (blood components/blood donor accidents/clinical practice of transfusion treatments). In conclusion, the author stated that the benefits of QM surpassed the costs by creating high-quality products and services for the benefit of patients, blood donors, hospitals, and personnel in the blood bank. The requirements of ISO 15189 were evaluated by Burnett [30] in terms of organization and a QMS, highlighting the importance of evidence, document control, control of records, and clinical material. Examples were provided from the area of resource management (RSM), pre-analytical, analytical, and post-analytical processes. The importance of evaluation and continual improvement were demonstrated in relation of the internal and external audit assessment, nonconformity, corrective and preventive action, and management review. Garcia et al. [31] conducted a study to calculate various annual QM indicators and implement them as a management tool in laboratories. Twenty annual items over 5 years were collected and calculated in three laboratories under belonging to Public Hospital Network in Catalonia, Spain. The Laboratory Manual Index Program from CAP was used as a reference. The analytical quality indicators versus. productivity were also compared and the annual budget laboratory deviation was calculated. The information obtained from these indicators provided laboratories with a useful benchmarking tool to determine the results of management change and understand the real situation in laboratories. It was concluded that no standardization on the management data exists and different characteristics needs to be unified. Kailner [32] compared the QM requirements in standards ISO 17025 and ISO 15189. ISO 17025/1.1 claims that it “specifies the general requirements a laboratory has to meet if it is to be recognized as competent to carry out tests and/or calibrations, including sampling.” ISO 15189 claims that it is applicable to all types of medical laboratories, but not to reference measurement laboratories. The responsibilities of the laboratories are defined in different way in these two standards. In 17025/4.1.2 “It is the responsibility of the laboratory…to satisfy the needs of the client, the regulatory authorities or organizations providing recognition,” whereas in 15189/4.1.1. “Medical laboratory services, including appropriate consultative services, shall meet the needs of patients, and all clinical personnel responsible for patient care.” Additionally, 15189/4.1.4 requires that medical laboratory services participate in quality improvement activities that deal with improvement of patient care. In other words, the 15189 standard requires that the medical laboratory should be an active part in health care. © 2011 by Taylor and Francis Group, LLC


153

Theodorou and Anastasakis [33] prepared management review checklist for ISO/EC 17025 and ISO 15189 QMSs. This checklist comprises requirements for both standards as follows: • • • • • • • • • • • • • • •

Follow-up of previous management reviews (for ISO 15189 only) Suitability of policies and procedures (for ISO 17025 only) Reports from managerial and supervisory personnel Outcome of recent internal audits Nonconformities Corrective and preventive actions Assessments by external bodies Results of external quality assessments, interlaboratory comparisons, or proficiency tests Changes in the volume and type of the work Customer feedback Complaints Recommendations for improvement—quality indicators Monitoring of turnaround times (TATs)(for ISO 15189 only) Evaluation of suppliers (for ISO 15189 only) Other relevant factors (QC activities, resource, staff training) (for ISO 17025 only)

Comprehensive checklist was prepared according to these requirements.

7.3â•‡Legal Frames, Regulations, and Accreditation Bodies in Pathology, Laboratory Medicine, and Related Areas There is a multitude of international and national organizations responsible for creating accreditation standards and for implementation of existing ones. Main players, as well as links between them, are depicted in the Figure 7.1. This subchapter presents most important standards—ISO/EC 17025 and ISO 15189 as well as accreditation bodies, providing international accreditation services for medical and analytical laboratories. 7.3.1â•‡International Standards of ISO ISO (http://www.iso.org/iso/home.htm) is the world’s largest developer and publisher of international standards. It was founded in 1946 in London by representatives of 25 countries, who decided to create a new international organization, with the object “to facilitate the international coordination and unification of industrial standards.” ISO officially began operations in 1957 in Geneva, Switzerland. Currently, ISO is a network of the national standards institutes of 159 countries (one member per country), with a Central © 2011 by Taylor and Francis Group, LLC

154


ILAC 82 countries

IAF 52 countries ISO 159 countries

CIPM OIML UNIDO IEC

15189 17025 EU

US Medical labs

Non-medical labs

HHS CLIA

A2LA IAS* NVLAP L-A-B PJLABS ASCLD ANSI

COLA CAP* JCIA* AABB AOA

EA 33 EU countries 18 NON-EU

CEN 30 EU countries

National accreditation services (UKAS*, CPA*, DAP*, DACh* etc.)

Solid line rectangles: Accreditation bodies Broken line rectangle: Cooperating bodies Circles: Standardization bodies * Offering international accreditation service

Figure 7.1â•‡ Relation between various standardization and accreditation organizations on international level (upper part), European level (right lower part), and in the United States (left lower part). Abbreviations in text.

Secretariat in Geneva that coordinates the system. No matter what the size or strength of that economy, each participating member in ISO has one vote. Every full member of ISO has the right to take part in the development of any standard, which it judges to be important to its country’s economy. Since ISO is a nongovernmental organization, it forms a bridge between the public and private sectors. Many of its member institutes are part of the governmental structure of their countries, or are mandated by their government. Other members have their roots uniquely in the private sector, having been set up by national partnerships of industry associations. As a nongovernmental organization, ISO has no legal authority to enforce the implementation of its standards. ISO does not regulate or legislate. However, countries may decide to adopt ISO standards as regulations or refer to them in legislation, for which they provide the technical basis. In such a way, ISO standards may become a market requirement, mainly those concerned with health, safety, or the environment. ISO standards are technical agreements, which provide the framework for compatible technology worldwide. More than 17,500 International Standards and other types of normative documents are in the current portfolio of ISO. The standards encompass a broad range of activities, such as agriculture © 2011 by Taylor and Francis Group, LLC


155

and construction mechanical engineering, manufacturing and distribution, transport, medical devices, information and communication technologies, and standards for good management practice and for services. ISO launches the development of new standards in response to the requirement of its national member (acting in the name of national industry or business sector). If accepted, the work item is assigned to 1 of 193 existing technical committees. Proposals may also be made to set up technical committees to cover new scopes of activity. The standards are being developed by experts from the industrial, technical, and business sectors which have asked for the standards, and which subsequently put them to use. At the end of 2006, there were 3041 technical bodies in the ISO system. The experts involved originate from government agencies, testing laboratories, consumer associations, nongovernmental organizations, and academic circles. ISO collaborates with the United Nations Organization and its specialized agencies and commissions, particularly those involved in the harmonization of regulations and public policies, such as CODEX Alimentarius, on food safety measurement, management, and traceability or WHO on health technologies, among others. The basic ISO standard for medical laboratories is ISO 15189:2007 Medical laboratories—Particular requirements for quality and competence. The following ISO standards are also relevant in pathology and laboratory medicine: • ISO 15198:2004: Clinical laboratory medicine—In vitro diagnostic medical devices: Validation of user quality control procedures by the manufacturer • ISO 2287:2006: Point-of-Care Testing: Requirements for Quality and Competence • ISO 15190:2003: Medical laboratories—Requirements for safety • ISO 15195:2003: Laboratory medicine—Requirements for reference measurement laboratories • ISO 22609:2004: Clothing for protection against infectious agents— Medical face masks: Test method for resistance against penetration by synthetic blood • ISO/TS 22367:2008: Medical laboratories—Reduction of error through risk management and continual improvement • ISO 17593:2007: Clinical laboratory testing and in vitro medical devices—Requirements for in vitro monitoring systems for self-testing of oral anticoagulant therapy • ISO/TR 18112:2006: Clinical laboratory testing and in vitro diagnostic test systems—In vitro diagnostic medical devices for professional use: Summary of regulatory requirements for information supplied by the manufacturer © 2011 by Taylor and Francis Group, LLC

156


In laboratories working in related areas (e.g., forensic toxicology, doping control, workplace drug testing, and food testing) the standard: “ISO/EC 17025:2005— General requirements for the competence of testing and calibration laboratories” is relevant. The standards ISO 15189 and ISO/EC 17025 will be discussed in more detailed way. 7.3.1.1 Development of ISO 17025 and ISO 15189 Historically, international standards for medical and analytical laboratories were formulated in 1990s. ISO 9000 series offered certification, and ISO Guide 25 leaded to accreditation. In Europe, the content of the ISO Guide 25 were accepted as EN 45001. In 1992, both ISO and Comité Europeen de Normalisation (CEN) agreed to accept each other standards and to eliminate the duplication, the ISO Guide 25 was revised, and ISO 17025 was generated instead and by agreement of the CEN the ISO 17025 also become European standard EN 17025 [34]. This standard was written to accommodate all analytical laboratories, as has been applied for medical laboratories as well. There were no specific sector of ISO standards for QM and technical competence in the medical laboratory in the past, which is why in the past the medical laboratory had to follow two separate lines to achieve recognition: one line is relying on the QMS and this was represented by ISO 9000:2000, the second line was technical competence, which was represented in ISO 17025 [34]. However, clinical chemists raised several points, which are relevant for medical laboratories and were not represented in ISO Guide 25/EN 45001, like patient preparation and sample treatment, medical competence of medical laboratory, or safety regulations comprising patient and staff safety. As a consequence, ISO 17025 had become a standard in late 1990s for analytical laboratories, and ISO 15189 for medical laboratories. Although the ISO 15189:2003 is based on both ISO 9000:2000 and ISO/ IEC 17025 standards, it contains in addition to the analytical competence also requirements that are specific for the medical laboratories such as consultative and interpretation activities. The benefits of the accreditation of the medical laboratory are improving the quality of the work, proper documentation of the work flow, total QM, education and competency of laboratory staff, focus in patients outcome and improvement of interdepartmental cooperation, improved efficacy or laboratory services, improved quality of the system, improved patient safety and trust, better comparability of results [34]. 7.3.1.2 Relationship between ISO 9001, ISO 17025, and ISO 15189 The relationship between the ISO 9001, ISO/IEC 17025, and ISO 15189 may be summarized as follows: ISO 9001:2000 is one of the standards family (ISO 9000:2000, ISO 9001:2000, ISO 9004:2000) that are related to the QMS. It includes specific © 2011 by Taylor and Francis Group, LLC


157

requirement of the QMS for continuous improvement and providing a product that meets user needs but it specifies neither the report product or services nor the technical services. ISO 17025 standard operates in accordance of the ISO 9001:2000 but it includes the general requirements that are needed for accreditation and the competency of testing and calibration laboratory. ISO 17025 can be applied to all testing and calibration laboratories regardless of the number of personnel and scope of its activities. It can be applied for the laboratory that develops its QM and technical systems to improve its operations. ISO 17025 standards does not cover the compliance with regulatory and safety requirement of laboratory’s activities. ISO 17025:1999 does not address the following issues, which are present in ISO 15189: Pre-analytical phase which is important for interpretation of medical laboratory data; analytical phase concerning requirements of internal quality control and external quality assessment; post-analytical requirements for TAT, STAT, and critical results. ISO 15189 is the international standard designed specifically for the accreditation and covering particular quality and competence requirements of the medical laboratory. Table 7.1 shows the comparison of management and technical requirements of two standards. 7.3.1.3 Management Requirements of ISO 15189 ISO/IEC 17025 and ISO 15189 are almost identical in management requirements. There are some differences in the arrangement of some items and rewording some management key titles in the ISO 15189 [35–38]. 7.3.1.3.1â•‡ Organizationâ•… Medical laboratory shall be legally identifiable and if there is legal liability insurance or a governmental cover, the responsibility of the laboratory personnel who are involved in the sample testing should be given to identify the conflicts of interest. Appropriate communication process in relation to the effectiveness of the QMS should be established within the laboratory. Organizational chart of the laboratory should be established. Laboratory management responsibility such as designing, implementation, maintenance and improvement of the quality system, providing appropriate authority and support to the laboratory personnel to perform their duties, establishing policies and procedures to maintain confidential information. Quality manager and deputies for all key functions should be appointed. 7.3.1.3.2â•‡ Quality Management Systemâ•… A quality policy statement should include policies and objectives of the QM under the authority of the laboratory director. Management should ensure that policies, processes, programs, procedures, and instructions are documented and understood, implemented and available in a quality manual to all relevant personnel. The quality © 2011 by Taylor and Francis Group, LLC

158


Table 7.1â•…Management and Technical Requirements for ISO/IEC 17025:2005 and ISO 15189:2003 ISO/IEC 17025:2005 [35,36]

ISO 15189:2007 [37–39]

Designed for Testing and Calibration Laboratories

Designed for Medical Laboratory

4 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 4.10 4.11 4.12 4.13 4.14

5 5.1 5.2

5.3 5.4 5.5 5.6 5.7 5.8 5.9

Management Requirements Organization Quality management system Document control Review of requests, tenders, and contracts Subcontracting of tests and calibrations Purchasing services and supplies Service to the customers Complaints Control of nonconforming testing and/or calibration work Improvement Corrective action Preventive action Control of records Internal audits

Technical Requirements

4

Management Requirements

4.1 4.2 4.3 4.4

Organization Quality management system Document control Review of contracts

4.5

Examination by referral laboratories

4.6 4.7 4.8 4.9

External services and supplies Advisory services Resolution of complaints Identification and control of non conformities Corrective action Preventive action Continual improvement Quality and technical records Internal audits Management review

4.10 4.11 4.12 4.13 4.14 4.15 5

Resources and Technical Requirements

Personnel Accommodation and environmental conditions and safety audit Test and calibration methods and method validation Equipment Measurement tractability Sampling

5.1 5.2

Personnel Accommodation and environmental conditions

5.3

Laboratory equipment

5.4 5.5 5.6

Handling and transportation of test and calibration items Assuring the quality of test results Reporting the results

5.7

Pre-examination procedures Examination procedure Assuring the quality of examination procedures Post-examination process

5.8 5.9

Reporting results Management of information system



159

manual should include the scope of services for all services provided by the laboratory, the laboratory management’s statement of the laboratory’s standard of service, QMS’s objectives, knowledge of the all personnel laboratory who involve with examinations activities with the quality documentation and implement the policies and procedures at all times, the laboratory’s good practice commitment to compliance with ISO standards. The description of the QMS and the role of the responsibilities of technical and quality managers should also be included in the quality manual. All laboratory personnel should read and be trained in the use and application of the quality manual. The quality manual should be under the authority and responsibility of the quality manager. 7.3.1.3.3â•‡ Document Controlâ•… Documents control policies and procedures should be established and maintained in the laboratory including the internal and external records. The policy should describe the type of documents and records, retention, archiving and discarding the obsolete ones, identifying the authorized individual who will sign and approve documents and signatures frequency, also identifying who is responsible for management review. A list of procedures including current revisions and their distribution and maintenance should be described in the document control policy. Controlled record could be such documents like memos, forms, normative documents, or technical records such as work notes, test reports, calibration, observations, and data calculations. Management records include internal audit, management reviews, corrective and preventive action records, and PT reports. All documents relevant to the QMS should be identified by the title, edition or current revision date, source identification, etc. Technical literature should be available to all laboratory individuals. 7.3.1.3.4â•‡ Review of Contractâ•… In case the laboratory enters into a contract to provide medical laboratory services, a policy to review request, tenders, and contracts should be established. The requirements, including the methods to be used, should be adequately defined and documented. The laboratory should have the capability and resources to meet these requirements. The policy should describe steps to be taken in case of amendments to the contract and who should be informed in case of any deviation from the contract. 7.3.1.3.5â•‡ Examination by Referral Laboratoriesâ•… Effective policy and procedure should be established by the laboratory for evaluating the selection of referral laboratory or consultants who will provide second opinion for histopathology, cytology, and related disciplines. The policy should indicate who is responsible for selecting and monitoring the © 2011 by Taylor and Francis Group, LLC

160


quality of referral laboratory and evaluate that the consultant is Â�competent to Â�perform requested Â�examinations. The laboratory should have a list of all referral laboratories that the laboratory uses including location and addresses. If the referring laboratory will prepare the reports, the report shall include all essential elements reported by referral laboratory without alteration that might affect in the clinical interpretation. The laboratory shall advise the customer that the work to be done by subcontractor in writing and, when appropriate, gain the approval of the customer, recommended in writing. 7.3.1.3.6â•‡ External Services and Suppliesâ•… Laboratory management shall define and document its policies and procedures for the selection and evaluation of the suppliers and the purchased external services that might affect the quality of its services equipment and consumables that may affect the quality of the laboratory services should not be used until they have been tested and verified that they meet the specifications defined in the procedure acceptance criteria. Inventory control system should be available in the laboratory to maintain uninterrupted services. 7.3.1.3.7â•‡ Advisory Servicesâ•… Professional appropriate laboratory staff shall provide advice on choice of examinations, type of sample, frequency, and interpretation for the results when appropriate. 7.3.1.3.8â•‡ Service to Customerâ•… The laboratory shall cooperate with customers for clarifying the customer’s request in relation to their tests performed, maintain confidentiality of customer’s laboratory work, provide the customer reasonable access to relevant area for witnessing of testes performed, and getting customer feedback to improve the management system. 7.3.1.3.9â•‡ Resolution of Complaintsâ•… A policy should be established in the laboratory for resolution complaints received from patients, clinicians, customers, and other parties including investigation of the problems and correction action. All records shall be maintained as required. 7.3.1.3.10â•‡ Identification and Control of Nonconformitiesâ•… Laboratory should have a policy and procedures to detect the nonconforming work, i.e., activity, which in any aspect does not conform to the laboratory procedures or does not agree or meet the requirements of the QMS or the requesting clinician. The policy and procedures to ensure the actions to be taken are identified and corrective action is taken immediately: the medical significance of the nonconforming work, immediate notification of clinician, identification of the personnel responsible for problem resolving, and the responsibility of authorization of the resumption of examinations. Nonconforming © 2011 by Taylor and Francis Group, LLC


161

work records should be maintained, and already released nonconforming Â�examinations results should be recalled if necessary. An evaluation of the significance of the nonconforming work shall be done to monitor the trends and initiate preventive actions. 7.3.1.3.11â•‡ Preventive Actionâ•… Preventive Action Plan can be developed by identifying some potential nonconformities either technical or concerning quality system and monitoring to reduce the recurrence and find an opportunities for improvement. 7.3.1.3.12â•‡ Continual Improvementâ•… The laboratory shall develop, document, and implement an action plan for improvement. Quality indicators can be chosen by the laboratory management that contribute to patient care by systematically monitoring and evaluating them to find opportunities for improvement. All laboratory personnel and relevant users should have access to suitable educational and training about performance improvement program. Continual improvement of effectiveness of management system can be achieved using quality system, internal audit analysis data, corrective and preventive actions and management review. 7.3.1.3.13â•‡ Quality and Technical Recordsâ•… A policy and procedure for maintaining QM and technical records should be established in the laboratory, including access collection, storage, safe disposal, retrieval, backup system, and suitable environment to store. The retention time of records should be identified. 7.3.1.3.14â•‡ Internal Auditsâ•… A policy and procedure for internal audit shall be established and conducted in the laboratory for all management and technical elements, in order to identify areas critically important to patient care and to verify that the laboratory operation continues to comply with quality system and standards. The plan should include the frequencies, type of audit, methodologies, and required documentations. The plan should be organized and carried out by qualified personnel or quality manager. Findings and corrections actions should be recorded. Follow-up procedures should be defined. 7.3.1.3.15â•‡ Management Reviewâ•… Annual management review of the laboratory’s QMS and medical services, including examination and advisory activities is an international standard requirement to ensure the effectiveness and adequacy of QMS in support patient care and to introduce an opportunity for improvement. Management review shall include but not limited to the following: follow-up of the previous management review; status of correction action and prevention action taken; reports from managerial and © 2011 by Taylor and Francis Group, LLC

162


supervisory personnel; internal audits outcome; assessment by external body; interlaboratory comparison and PT; any change in the workload and scope of service; complaints and other relevant factors; quality Indicators including monitoring of TAT; nonconformities; evaluation of supplies and suppliers; other relevant factors, such as quality control activities, resources, and staff training; and customer’s feedbacks. All finding and actions of the annual review should be recorded and the laboratory staff should be informed. The management shall ensure that those actions are carried out within an appropriate timescale. 7.3.1.4 Technical Requirements of the ISO 15189 Most of these requirements [36–39] are common with the requirements of ISO 17025 standard [35]. The requirements specific for the ISO 17025 will be presented later. 7.3.1.4.1â•‡ Personnelâ•… Laboratory management should define the qualifications and duties for all personnel, job descriptions and maintain records of relevant education, professional qualifications, training, and experience. Staff resources shall be adequate to the workload performed in addition to carrying out other functions of QMS. Laboratory personnel should have the qualification and training background and profound theoretical knowledge to be able to discharge the responsibilities. Personnel authorization to perform particular tasks such as sampling, examinations, operation of specific equipment, use of the laboratory information system should be defined by the laboratory management and should be checked at regular interval. All personnel in the laboratory should maintain the confidentiality of the patient results. The laboratory shall use personnel who are employed by, or under contract to, the laboratory. 7.3.1.4.2â•‡ Accommodation and Environmental Conditionsâ•… The laboratory should have adequate space allocated for the workload without Â�compromising the quality of work, quality control procedure, and safety of personnel or patient care services. The laboratory should be designed for the efficiency of its operation, minimize the risk of injuries and occupational illness. Laboratory facilities for examination should allow correct performance of examinations, including energy sources, ventilation, water, waste disposal, environmental conditions, and housekeeping. Environmental conditions should be monitored and recorded according to specifications. Corrective action should be undertaken when the recorded value of the environmental conditions is outside the acceptable limits. Incompatible activities should be separated to prevent cross-contamination. Access to, and use of, areas potentially affecting the quality of the examinations shall be controlled. Efficient communication system, hygiene plan, safety precaution instructions should © 2011 by Taylor and Francis Group, LLC


163

be available in the laboratory. Whole staff should be regularly checked up by plant physician. 7.3.1.4.3â•‡ Laboratory Equipmentâ•… Equipment and its software used for testing, calibration, and sampling shall be capable of achieving the accuracy required and shall comply with specifications relevant to the tests and/ or calibrations concerned. The laboratory shall be furnished with equipments required for the sample collection, sample preparation, examination, and storage. A policy should be available in the laboratory describing the standard requirements of the laboratory equipments. Performance check shall include new equipments, used equipments after repair. Daily performance check shall be performed for routine equipment to ensure its compliance with specifications relevant to examination. The policy should also include the procedure of labeling equipments, storing, transferring, routine maintenance, and safety and electrical check and the frequency of the testing. The laboratory shall provide suitable space for repairs and appropriate personal protective equipment. Backup equipment should be available in case of emergency. Software used in the equipment that was used for collection, processing, recording, and reporting should be updated, documented, and suitably validated. Procedures shall be established and implemented for protecting the integrity of data at all times. Computer programs should be adequately labeled and evaluated. Equipments including hardware, software, reagents, and reference material shall be protected from unauthorized access and alterations or tampering that might invalidate examination results. Instructions on handling (procurement, marking, and storage) of reagents, chemicals, hazardous chemicals, as well as the Safety Data sheets of all chemicals used in the laboratory, should be available in the laboratory and accessible to all employees. All chemicals and reagent reference materials should be labeled according to identity, concentration, and expiry date and should be appropriately stored. The type and quality of reagents and chemicals should be defined in the method, a protocol for use reagents kits should be also defined. 7.3.1.4.4â•‡ Pre-Examination Proceduresâ•… Pre-examination procedures include specific information and description of the request form. Request form should contain information about patient like name, gender, age, authorized requesting physician’s name, tests ordered, sample types, and some clinical information relevant to patient. Instructions of proper collection and handling of primary samples should be documented and available to the laboratory staff responsible for sample collection. The manual of specimen collection should be in place and should include a list of all available offered examinations, consent form if applicable, procedures for preparation of patient, identification of primary © 2011 by Taylor and Francis Group, LLC

164


samples, and sample collection procedures. The manual should also include the transportation instruction of the primary samples within time frame and proper conditions appropriate to the specimens and requested examinations, Primary samples should be traceable by recording all specimens in accession book, worksheet, or computer system. Criteria of acceptance or rejection of primary samples should be developed and documented. Periodic review of samples volume required for phlebotomy to ensure collecting suitable volume for appropriate examinations should be done. All requests and samples should be reviewed by authorized personnel to decide which examinations and the methods to be used in performing them. A protocol for collecting, handling, transporting, special requirements, and reporting of urgent samples should be prepared. Retention of samples in case of repletion needed should be documented according to stability of each test offered. 7.3.1.4.5â•‡ Examination Procedureâ•… Examination procedure describes the adequacy of the procedures to be used for sample examination. Published procedures in established textbooks, journals, or international and national guidelines are preferred after appropriate validation. In-house procedures shall be appropriately validated and fully documented. The procedure selected for use shall be evaluated and validated before being used for medical examination for the following: precision, accuracy, linearity, limit of detection, limit of quantification, and specificity. All procedures and methods should be documented, available to all staff and reviewed at defined intervals (usually annually). Card system can be used as a quick reference at the workbench, provided that a complete manual is available for reference. Any deviation from the procedure shall be reviewed, documented, dated, and authorized. New kits with major change in the reagents shall be checked for performance and adequacy for intended use. Methods or procedures should include purpose of examination, principle of the procedure, validation and performance specifications, type of samples, type of container and additives, required equipment and reagents, calibration procedure, quality control procedures, and procedure steps. Critical value shall be included in procedure where appropriate, laboratory interpretation and safety precautions should be given, as well as potential causes of variability. Reference intervals should be periodically reviewed and when the laboratory changes the examination or pre-examination procedure if required. Any changes in the procedures should be explained to users of the laboratory. 7.3.1.4.6â•‡ Quality Control Assurance of Examination Proceduresâ•… The laboratory should have a quality control program to verify providing of quality results. Uncertainty of the results should be determined by the laboratory where relevant, the sources that may contribute to uncertainty may © 2011 by Taylor and Francis Group, LLC


165

include sampling, transport, storage, sample preparation, sample portion selection, calibrators and reference materials, equipment used, environmental conditions, condition of the sample, changes of operator. Calibration of measuring system should be performed to ensure that the results traceable to SI units. Other elements to provide confidence to the results including participation of suitable inter-laboratory program, certified reference material, examination by other procedure, using standard established method, when traceability is provided by supplier, a documentation of statements regarding reagents should be provided for the laboratory. The laboratory should participate with inter-laboratory comparison such as the external quality assessment schemes for each examination performed in the laboratory. The results of external quality assessment should be monitored and correction actions should be initiated when the control criteria are not fulfilled. All inter-laboratory samples should be analyzed under the same condition of routine patient samples. In case the inter-laboratory comparison program is not available, the laboratory should have alternative mechanism for determining the acceptability of the procedures such as exchange sample with other laboratories. In case the examinations performed using different procedures or equipment or at different sites, the laboratory should have a mechanism for verifying the comparability of the results in an appropriate time intervals. Other quality-control-related issues such as the type and frequency for using control materials should be adequate for the internal quality control. Procedure should be established for parameters with no quality requirements to detect tolerable deviations and undertake correction actions of such deviations. In case the internal quality control or calibrators are not available, the laboratory should have alternative procedure to check the validity of the results. 7.3.1.4.7â•‡ Post-Examination Processâ•… The post-examination process includes revision of the results by authorized personnel before releasing them based on the available clinical information. All results should be checked for writing mistakes and transmission error. A policy shall exist for storage of primary samples, disposal of biological and other wastes (e.g., infectious, causing injuries, radioactive, inflammable, explosive, irritant, etching, and poisonous waste articles). Reporting results policy should be in the laboratory which include the formatting, define the authorized personnel to receive the reports within an agreed and the time interval of receiving the report. Report shall also be legible without mistakes in transcription and should include but not be limited to identification of the procedure, identification and address of the laboratory issued the reports, unique identification of patient, requestor, time and date of samples collection and receiving in the laboratory, time and date of releasing the report, type of samples, principle of procedure used for examination, examination result’s unit (in SI units), © 2011 by Taylor and Francis Group, LLC

166


biological reference intervals, interpretation of results if required, any comments about adequacy of the primary samples that might compromise the final results, identification of authorized individual who releases the report, and signature of the personnel checking the releasing report. To maintain consistency, the description of examination should follow the vocabulary, syntax recommended by one or more of the organization (IUPAC, CEN, WHO). Policy and procedure of the reports should include the method of retrieval of report, retention time of reported data according to medically relevant. The laboratory should have a policy and procedure for immediate notification of the requesting physicians (or other clinic personnel responsible for patient care about critical values), which includes results sent to referral laboratories for examinations. If results were transmitted as interim reports (by phone or verbally), final written report should be released to the requestor. All records of critical values should be maintained to include the time, date, responsible laboratory employee, person notified, examinations results, and comments for any difficulty encountered. TAT should be established in the laboratory for all examinations according to the clinical needs. A policy should be established in the laboratory in case of not meeting the TAT criteria. In such cases, TAT should be reviewed by the laboratory management when necessary and corrections actions should be in place to identify the problems. Procedures should be in place for verifying the correctness of all transcriptions between referring when releasing examination results to referral laboratory. The laboratory should have written policies and procedures in case of alterations, revision, or amendment of reports and should include time, date, and name of person responsible for the change or revision or amendment. Original results should be included and alteration, revision and amendment should be clearly indicated in the report. 7.3.1.5 Technical Requirements of the ISO/IEC 17025:2005 7.3.1.5.1â•‡ Test and Calibration Methods and Method Validationâ•… ApproÂ� priate methods should be used for all tests including sampling, handling, transport storage, and preparation for item to be tested and/or calibrated, procedures for operation equipment used. Latest valid edition of published methods shall preferably be used. Methods developed by the laboratory also can be used if they are validated. The customer shall be informed about the methods that have been selected. Nonstandard methods can be developed in the laboratory if all required resources are available and if it is fully validated to confirm that the methods are fit for the intended use, the test method should contain identification, scope, type of tests and/or calibration, apparatus, reference standards and reference materials required, proper environmental conditions, © 2011 by Taylor and Francis Group, LLC


167

description and steps of procedure, acceptance and rejection criteria, procedure for estimation of uncertainty. If testing laboratory is performing its own calibration, it should apply a procedure to estimate the uncertainty of measurement for all type of calibrations, all uncertainty components should be taken into account using appropriate method of analysis. The laboratory should check calculations and data transfer in regular and systemic manner. When computers and automated equipment are used for testing and/or calibration, the laboratory shall perform evaluation and confirm the adequacy of the used software, maintain confidentiality, proper maintenance of computers and automated equipment to ensure proper function to maintain the integrity of test and calibration data [35,39]. 7.3.1.5.2â•‡ Measurement Traceabilityâ•… The laboratory shall have an established program and procedure for the calibration of its equipment, participation in an inter-laboratory comparisons program. Calibration and processing reference standard, reference materials shall be traceable to SI units of measurement or to certified reference materials. Intermediate checks need to maintain confidence in the calibration status of reference, transfer or working standards and reference materials shall be performed according to define procedures and schedules. 7.3.1.5.3â•‡ Samplingâ•… A sampling plan and sampling procedures should be available in the laboratory when it carries out sampling of substances, materials, and products. Sampling processes should identify the factors to be controlled to ensure the validity of the test and calibration results. The laboratory should record in detail with appropriate sampling data any deviations, additions, or exclusions from documented sampling procedure if requested by customer, a procedure of recording data related to sampling should be available in the laboratory and should include the sampling procedure use, identification of the sampler, environmental conditions, diagram of sampling location as necessary. 7.3.1.5.4â•‡ Handling and Transportation of Test and Calibration Itemsâ•… A procedure should be available in the laboratory for handling, protection storage, retention, transportation, and disposal of test and calibrations items. System for identifying the tests items should be established in the laboratory and this shall be retained throughout the life of the item. 7.3.1.5.5â•‡ Assuring the Quality of Test Resultsâ•… Quality control procedures should be established in the laboratory for monitoring the validity of tests and/or calibrations performed this includes regular use of certified reference materials and/or internal quality control using secondary reference © 2011 by Taylor and Francis Group, LLC

168


materials, participation in inter-laboratory comparison or PT schemes, testing calibrations using different methods. The procedure should include detection of trends, statistical techniques for reviewing the results, correction actions shall be taken for the results found outside the predefined criteria. 7.3.1.5.6â•‡ Reporting the Resultsâ•… Test report should include the information on the standard, a clear interpretation of the test results and more information required by standard. When the test report contains results of tests performed by subcontractors, these results shall be clearly identified. Procedures should be established and implemented for protecting the data and the results in the case of transmission of results by telephone, telex, facsimile, or other electronic or electromagnetic means. Amendments to a test report after releasing the report should be documented as supplement to the original test report and shall meet all the requirements of the international standard. 7.3.1.6 Accreditation of Testing Laboratories and Medical Laboratories According to ISO 17025 and/or ISO 15189 The procedure described below applies to the accreditation of testing and medical laboratories according to DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 within the framework of the activities of DAP (Deutsches Akkreditierungssystem Prüfwesen) GmbH (German Accreditation System for Testing) [39]. In order for testing laboratory to be accredited by DAP they have to have the following: • Concluded a contract with DAP for conducting an accreditation • Fulfill the criteria for the testing laboratories according to DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189, international guidelines of European Cooperation for Accreditation (EA) and ILAC • Fulfill the technical criteria of the DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 The preliminary meeting will be conducted between the applicant and DAP assessor to inform the applicant about the process of the accreditation operations and discuss any problems that might influence the process of accreditation. The focus of the meeting will be on the scope of accreditation, information of the content, sequence and costs of accreditation and the obligations of both parties after the accreditation has been granted. Generally, the procedure includes the following steps: check of documents, on-site assessment, accreditation, surveillance, extension of accreditation, and reaccreditation following a reassessment. These steps will be presented in detail. © 2011 by Taylor and Francis Group, LLC


169

7.3.1.6.1â•‡ Formal Checking of the Application for Accreditation and the Submitted Documentsâ•… In this stage, the applications for an accreditation are inspected if they are in compliance with the rules of the EU or worldwide accreditation associations (EA, ILAC). Once the requirements are fulfilled, the DAP office will acknowledge the application, nominate the case manager, lead assessor, and select the respective sector committee. The application fee will be invoiced and the contract with the applicant will be prepared. 7.3.1.6.2â•‡ Pre-Assessmentâ•… The pre-assessment may be conducted to ensure the suitability of accreditation. The laboratory should have all necessary documents for the pre-assessment process. The pre-assessment includes evaluation of laboratory personnel, equipment, and premises and is conducted by the assigned lead assessor or assessor and by case manager in certain cases. The following main aspects are subjected to pre-assessment: • Checking of the prerequisites as regards to personnel, equipment, and premises for accreditation • Evaluation of the management system adequacy • Checking of the documentations • Establishing the scope of accreditation • Exchange of experience and clarification of open questions of the accreditation process 7.3.1.6.3â•‡ Assessment of the Documentsâ•… The lead assessor checks the required documents for DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 that were submitted by the laboratory. The laboratory should be informed about any serious nonconformity. If the document review resulted with no serious nonconformities, the lead assessor informs the DAP office and the date of on-site assessment will be scheduled. 7.3.1.6.4â•‡ Assessment of the Testing Laboratoryâ•… The assessment team consists of the lead assessor and one assessor at least, the time of assessment depends on the scope of accreditation. The assessment of the testing laboratory consists of introductory meeting, assessment of requirements related to organization, management, verification of the technical requirements, and final meeting. The assessors use checklists and forms for conducting the assessment and their focus during the on-site assessment will be on the implementation of the activities for achieving the quality Â�objectives, the organizational structure, the qualification of the personnel, and the technical equipment as well as the cooperation with the customers. The technical competence of laboratory assessed, in relation to selection of test equipments and measuring devices, calibration of measuring equipment, © 2011 by Taylor and Francis Group, LLC

170


its maintenance and repair, traceability of the measured values to national, standard measures, the verification and validation of test methods will be evaluated. The introductory meeting will be attended by the head of the testing laboratory and quality manager, other responsible laboratory staff and assessors. The participants will be introduced to each others, confirming the application scope and accreditation criteria (specifying the standard and other technical requirements), course of the accreditation, confirming the confidentiality, informing about the classification of non conformities, determining the time of assessment, and other news of the accreditation body. 7.3.1.6.5â•‡ Technical Interviewsâ•… The assessor should focus on the following issues: adequacy of management system; cooperation with customers of testing laboratory; competency of the staff members and the head of testing laboratory to manage the operation of the laboratory; and suitability of resources such as equipments, space, and number of staff for the test methods applied. The control of documents should comprise control of documents and records, subcontracting tests, conducting of representative test methods, maintenance and calibration condition of the testing and other equipment, participation in proficiency tests, their evaluation and documentation, availability of reliable sample marking and sample identification systems, availability of test or working instructions, contents and structure of the test reports, internal quality activities for the individual test methods, overall process in the testing laboratory from the inquiry, the tender, receipt of samples, report compliance with additional requirements, e.g., EA requirements, juridical or governmental requirements (if necessary), technical notes of DAP, specific sector committee, or decisions of the committee for accreditation. The testing laboratory has to show to the assessment team documents and records to enable that the appraisal relevant to the items mentioned above is possible. 7.3.1.6.6â•‡ Final Meetingâ•… The final meeting will include overall summary of the assessment and recommendation of the assessment team on the granting of accreditation after the possible corrective action has been implemented or restriction of the scope applied for accreditation, if applicable. Each assessor will provide information of the stated nonconformities and will specify suitable corrective actions. In case of initial accreditations, 5 months at most are given to complete the corrective action, otherwise 2 months after the assessment. Open questions should be clarified. Within the agreed time schedule, the testing laboratory shall provide the documentation on conducting the corrective actions to the assessors.



171

7.3.1.6.7â•‡ Assessment Reports: Recommendation for Accreditationâ•… Three weeks after the assessment, each assessor needs to submit a report on the area assessed. The lead assessor will prepare the final report and all other documents needed to the case manager who forwards them to the responsible sector committee. A copy of assessment reports will be immediately send by DAP office to testing laboratory. The report will be evaluated by the responsible sector committee/s in addition to other required documents and issue their recommendation on accreditation to the DAP Managing Director. Recommendation for accreditation should be submitted to the sector committee within 6 months from the last day of the assessment. 7.3.1.6.8â•‡ Granting Accreditation and Issuing the Certificateâ•… The DAP Managing Director grants the accreditation on the basis of the recommendation by the sector committee. The accreditation is usually valid for a period of 5 years. The accreditation certificate is signed by the DAP Managing Director then it will be send to customer with information on the conditions resulting from the accreditation, the possible surveillance and next assessment period. 7.3.1.6.9â•‡ Surveillanceâ•… The surveillance procedure consists of periodic checking if the prerequisites for accreditation continue to exist. The checking is done by on-site assessments of the accredited bodies. The assessments for surveillance are scheduled by the case manager on the basis of the DAP rules and the recommendations of the sector committees. The surveillance procedure involves obtaining additional information, checking changes of the management documentation, requesting documents, test reports and proofs for the surveillance of the management system, the testing laboratory the accreditation may be extended by new test areas or methods within the assessment of surveillance. During the 5 years validity of accreditation, at least three assessments should be conducted. The first assessment for surveillance to be conducted is within 12 months following the granting of the accreditation. The second and third assessment for surveillance may be extended to 18 months. The surveillance assessment sequence is similar to the initial accreditation with its check of the documents, on-site assessment, checking the corrective action, preparing and checking reports as well as the recommendation of the sector committee. If the on-site surveillance assessment resulted in nonconformities, the testing laboratory shall provide evidence of correction within 2 months following the on-site assessment. If the nonconformities have not been closed out, the accreditation may be suspended or withdrawn. All reports shall be submitted to the case manager or lead assessor within 3 weeks. After receipt at the DAP Office and the following review, a copy of the reports is immediately sent to the testing laboratory.


172


7.3.1.6.10â•‡ Reassessment and Reaccreditationâ•… Reassessment is done for the purpose of reaccreditation; the scope of the reassessment corresponds more or less to the scope of an initial accreditation. The purpose is to ensure that the laboratory continues to comply with accreditation criteria by the accredited body and to evaluate the effectiveness of the management system. In case of a reassessment, as a rule, other assessors are to be assigned as compared to the previous accreditation procedure, whereas the lead assessor may be the same as before. The time limit between two reassessments may not exceed 60 months. An application for reaccreditation should be filled and submitted by testing laboratory to DAP office. The reassessment should take place in time before the expiry of the accreditation to have a close connection to the previous accreditation. In many situations, it is more preferable for the testing laboratory to use the third surveillance for the reaccreditation. Eight months before the reaccreditation expires, the DAP Office informs the testing laboratory on the possibility of a reaccreditation. It is possible to extend or reduce the scope of accreditation during reaccreditation procedure. 7.3.2â•‡International Accreditation Organizations 7.3.2.1 International Laboratory Accreditation Cooperation International Laboratory Accreditation Cooperation (ILAC) [6] is an international cooperation of laboratory and inspection accreditation bodies formed in 1977 with the aim of developing international cooperation for facilitating trade by promotion of the acceptance of accredited test and calibration results. In 1996, ILAC became a formal cooperation with a charter to establish a network of mutual recognition agreements among accreditation bodies that would fulfill this aim. In 2000, 36 laboratory accreditation bodies, full members of ILAC, from 28 economies worldwide signed an “ILAC Arrangement” in Washington, DC to promote the acceptance of technical test and calibration data for exported goods. The arrangement came into effect on January 31, 2001. The “ILAC Arrangement” provided significant technical underpinning to international trade. The key to the Arrangement is the developing global network of accredited testing and calibration laboratories that are assessed and recognized as being competent by ILAC arrangement signatory accreditation bodies. The signatories have, in turn, been peer-reviewed and shown to meet ILAC’s criteria for competence. The ultimate aim was increased use and acceptance by industry as well as government of the results from accredited laboratories, including results from laboratories in other countries. In this way, the free-trade goal of “product tested once and accepted everywhere” could be realized. The ILAC network consists of 125 bodies representing 82 different economies. Worldwide there are almost 29,000 laboratories © 2011 by Taylor and Francis Group, LLC


173

accredited by an ILAC signatory, and there are over 5000 accredited inspection bodies. ILAC provides a focus for • Developing and harmonizing laboratory and inspection accreditation practices • Promoting laboratory and inspection accreditation to industry, governments, regulators, and consumers. In this field, a number of multilingual brochures on accreditation has been published and is available on the home page of ILAC. As concerns medical laboratories, ILAC applies ISO 15189 standard, for other related testing laboratories (e.g., for forensic laboratories) ISO 17025 is recommended. • Assisting and supporting developing national accreditation systems • Global recognition of laboratories and inspection facilities via the ILAC • Arrangement, thus facilitating acceptance of test, inspection, and calibration data accompanying goods across national borders ILAC developed close links and strategic partnerships with key organizations operating in ILAC’s sphere of work, and has signed Memoranda of Understanding with the following international bodies: Comité International des Poids et Mesures (CIPM), Industry Cooperation on Standards and Conformity Assessment (ICSCA), IAF/ISO, United Nations Industrial Development Organisation (UNIDO), The International Electrotechnical Commission (IEC), and Organisation Internationale de Métrologie Légale (OIML). 7.3.2.2 International Accreditation Forum The International Accreditation Forum, Inc. (IAF) [7] is the world association of Conformity Assessment Accreditation Bodies and other bodies interested in conformity assessment in the fields of management systems, products, services, personnel, and other similar programs of conformity assessment. The IAF was formed from the first meeting of “Organisations that Accredit Quality System Registrars and Certification Programs,” which was held in 1993 in Houston, USA. The meeting was attended by representatives from the United States, Mexico, the Netherlands, the United Kingdom, Australia/New Zealand, Canada, and Japan. The purpose of the IAF was to operate a program for the accreditation of bodies dealing with conformity assessment, in order to ensure that certification of products, processes, or services in one region or country should be accepted in other regions or countries. Also, through the program the IAF aimed to ensure that equivalent conformity assessment procedures used by organizations should be developed. © 2011 by Taylor and Francis Group, LLC

174


Fifty-two states are members of the IAF. Membership of the IAF is separated into a number of categories. 7.3.2.2.1â•‡ Accreditation Body Membershipâ•… Open to organizations that conduct and administer programs by which they accredit bodies for certification of quality systems, products, services, personnel, environmental management systems, as well as other programs of conformity assessment. Accreditation body members must declare their intention to join the IAF. 7.3.2.2.2â•‡ Association Membershipâ•… Open to organizations or associations that represent a similar group of entities, either internationally or within an economy or region. 7.3.2.2.3â•‡ Partner Membershipâ•… Open to entities representing the interests within an economy, region or internationally, of parts of governments, regulators or of organizations which are nonaccreditation bodies, but which have an interest in conformity assessment, and which support the objectives of IAF. Partner Members may be invited to participate in the technical work of IAF. 7.3.2.2.4â•‡ Special Recognition Statusâ•… The IAF has the discretion to give special recognition status to organizations that share a common objective with the Corporation. These organizations may be represented and participate at IAF Member meetings but are not eligible to vote. Special recognition status may also be granted to Regional groupings where the implementation of the IAF Multilateral Recognition Arrangements (MLA) is promoted. 7.3.2.2.5â•‡ Observer Membershipâ•… In cases where the IAF Board of Directors believes it is in the best interests of IAF Members to develop closer relationships with a particular entity, the Board may grant Observer status to such an entity for a period not exceeding 1 year, but subject to annual renewal. An Observer Member may be invited to attend any meeting of IAF and/or participate in its technical work, as determined by the Board from time to time. However, Observer Members are not eligible to vote on any matter. IAF members accredit certification or registration bodies that issue certificates attesting that an organization’s management products or personnel comply with a specified standard (called conformity assessment) and are competent to do the work they undertake and are not subject to conflicts of interest. The second purpose of the IAF is to establish mutual recognition arrangements, known as MLA, between its accreditation body members. The objective of the MLA is that it will cover all accreditation bodies in all countries in the world, thus eliminating the need for suppliers of products © 2011 by Taylor and Francis Group, LLC


175

or services to be certified in each country where they sell their products or services. IAF has programs to • Develop guidance, rules, and procedures for the operation of accreditation, certification/registration, and mutual recognition programs resulting in “certified once, accepted everywhere” • Ensure that all accreditation body members operate to the highest standards of competence and probity, and only accredit bodies that have demonstrated that they are competent and impartial • Harmonize accreditation procedures and their implementation based on international standards and guides, and IAF guidance on their application • Develop guidance, rules, and procedures for the operation of specific sector conformity assessment schemes to meet the needs of specific industries • Develop guidance, rules, and procedures for the operation of compliance programs to satisfy regulatory or government requirements • Exchange information between accreditation bodies • Cooperate in the training of assessors and other personnel • Contribute to the work of ISO and other relevant international bodies • Liaise with the regional groups of accreditation bodies • Liaise with other relevant bodies such as ILAC, ISO, and industry groups • Assist emerging accreditation bodies in low and medium income economies IAF is publishing communiqués, policy documents, guidance documents, mandatory documents, information documents, newsletters, and others. IAF provides cooperation with national accreditation bodies in pathology, laboratory medicine, and related areas through nominated contact organizations and persons. 7.3.3â•‡U.S. Regulations and Accreditation Organizations 7.3.3.1 Centers for Medicare and Medicaid Services Clinical Laboratory Improvement Act (CMS CLIA) CLIA is responsible for all activities concerning certification, inspection, and accreditation of medical laboratories in the United States. This is legally based on the Clinical Laboratory Improvement Act, known as “CLIA’88” [40]. This legal rule has been presented and discussed in detail in the Chapter 8 of this book. The CLIA certification program is self-funded through fees paid by its participants. It is administered by the CMS, which is a division of © 2011 by Taylor and Francis Group, LLC

176


HHS. CMS is charged with the administration and implementation of CLIA and collaborates with the Food and Drug Administration (FDA) and with the Centers for Disease Control and Prevention (CDC). FDA is responsible for the categorization of laboratory tests, whereas CDC provides scientific and technical support. CMS is also responsible for recognizing of private, nonprofit organizations whose requirements are at least equal to those of CLIA. These organizations are entitled to issue certificate of accreditation, which is equal to CLIA compliance. Following organizations have deemed status under CLIA: • COLA—Formerly the Commission on Office Laboratory Accreditation; deemed under CLIA’88 since 1993, the JC since 1997; originally for Physician Office Laboratories (POLs), now provides accreditation service also for community hospitals and some industrial laboratories; inspections by professional staff surveyors focused on education and adopting a quality systems approach to laboratory testing • CAP—the most comprehensive in coverage of all types of clinical laboratories; peer review process; deemed by CLIA’88 and the JC • Joint Commission—Formerly the Joint Commission on Accreditation of Healthcare Organizations (JCAHO), and before that the JC on Accreditation of Hospitals; deemed under CLIA since 1995; laboratory surveys are performed by experienced medical technologists • AABB—accredits organizations collecting, processing, distributing, or transfusing blood and blood components • American Society for Histocompatibility and Immunogenetics— deemed under CLIA’88, JC, and the states of Florida, Oregon, and Washington. Facilities, staff, and procedures are inspected with an emphasis on education and assistance with correction of deficiencies • American Osteopathic Association (AOA)—deemed under CLIA’88 since 1995 for AOA-accredited hospitals According to the CMS CLIA database updated December 2008, [41] 209,499 nonexempt medical laboratories were registered. 129,219 laboratories had waiver certificate, 38,383 performed Provider-Performed Microscopy (PPM), 19,261 were CLIA-compliant, and 16,238 were accredited. In CLIA-exempt states (New York and Washington) together 6398 laboratories were registered. Most laboratories were accredited by COLA (6465), followed by CAP (5386) and JC (2753). The majority of COLA accreditation concerned POLs (6128). As of 2007, the CMS, CAP, and JC inspections are unannounced. This should ensure that the inspection reviews the laboratories during routine, everyday operation. In addition, the inspectors are focusing more on the laboratory © 2011 by Taylor and Francis Group, LLC


177

work itself instead of reviewing documentation in areas usually separated from the laboratory. The JC uses tracer methodology, following testing through all stages, whereas CAP involves in-depth reviews of sample tests with interviews for bench technologists in order to check their level of understanding. Rauch and Nichols [42] provided an overview of the medical laboratory accreditation and inspection process in the United States. A prevailing concern is the questionable quality of waived testing. There has been an increasing fraction of laboratories that offer only waived testing, usually as POLs. Fifty-three percent POLs are offering only waived tests, 12% are CLIAcompliant, 29% are doing PPM examinations, and only 6% are accredited, all of them by COLA (status of 2007). The facilities offering only waived tests are not subject to routine inspections and only occasionally may be chosen as part of a sample for purposes of auditing. Inspections of POLs in eight states have found issues that raised concern over the quality of test results produced in POLs with certificate of waiver. Among the issues noted during these inspections • Laboratory did not have or follow manufacturer’s instructions • Laboratory did not perform maintenance or function checks as required • Laboratory used expired reagents • Laboratory did not perform quality control as required • Laboratory did not provide training of testing personnel • Laboratory did not evaluate staff for accurate or reliable testing • Laboratory was performing testing beyond its CLIA certificate level According to Rauch and Nichols [42], there is a need to expand regulatory oversight over such laboratories. CMS has set a goal of inspecting at least 2% of POLs with certificates of waiver each year. Repeat inspections noted significant improvement in more than 75% of the POLs that were revisited. 7.3.3.2 Commission on Office Laboratory Accreditation COLA [43] was founded in 1988 as a private alternative to help laboratories stay in compliance with the new CLIA. In 1993, the Health Care Financing Administration (now CMS) granted COLA deeming authority under CLIA, and in 1997, the JCAHO also recognized COLA’s LAP. After 35,000 surveys in which COLA’s practical, educational accreditation methods helped POLs stay in compliance with CLIA, COLA expanded its program offerings to include hospital and independent laboratories. Completing COLA’s accreditation program means that the clinical laboratory is in compliance with CLIA and is recognized by the JCAHO. Following types of laboratories are accredited by COLA: POLs, Community Hospitals, mobile clinics, Veterans Administration facilities, © 2011 by Taylor and Francis Group, LLC

178


and laboratories of the Department of Defense. COLA is approved by CMS to accredit laboratories in the following specialties: Chemistry, hematology, microbiology, immunology, immunohematology/transfusion services, pathology, including cytology, histopathology, and oral pathology. Additionally to laboratory services, COLA is providing accreditation in management services. QMSs Accreditation Program for Medical Laboratories is a COLA-developed, modern laboratory accreditation process that combines proven QM and business process techniques with traditional laboratory medicine assessment. The QMS process produces higher quality and improved patient safety in laboratory testing, while significantly strengthening process efficiency and lowering cost and risk. 7.3.3.3 College of American Pathologists (CAP) The LAP of the CAP [44] was established in 1961. It received approval as an accrediting organization under the CLIA by the CMS, an agency within the U.S. HHS. The main goal of the LAP is to improve the patient safety by developing the quality of pathology and laboratory services through education and standard setting to ensure that laboratories meet or exceed high-quality standard requirements. CAP is offering accreditation services worldwide. Also, a number of European medical laboratories are accredited according to the standards of the CAP. Accreditation by CAP is based on standards that are translated into checklists and that usually do not refer to EN or ISO standards. However, due to the special relevance of the ISO/EN 15189 standard, CAP is now offering a nonregulated, voluntary accreditation according to this standard. This program does not replace the CLIA-based LAP, but complements CAP accreditation and other quality systems. According to CAP, this program optimizes processes to improve patient care, strengthen quality standards while reducing institutional errors and risks, and controls costs. CAP 15189 is offering a highly disciplined approach to implementing and sustaining change. The accreditation programs examine pre-analytical, analytical, and post-analytical aspects of QM in the laboratory. These include the performance and monitoring of general quality control, test methodologies and specifications, reagents, controls and media, equipment, specimen handling, test reporting and internal performance assessment, and external PT. In addition, personnel requirements, safety, document management, and other administrative practices are included in the inspection process. Laboratories that meet accreditation requirements distinguish themselves as quality laboratories. 7.3.3.3.1â•‡ General Structure of CAP Accreditation Bodiesâ•… The Council on Accreditation (CoA) sets the strategic direction for the LAP and monitors its overall effectiveness in ensuring that participating laboratories © 2011 by Taylor and Francis Group, LLC


179

meet regulatory and CAP requirements. The CoA also provides oversight to the Commission on Laboratory Accreditation (CLA), a group of qualified pathologists appointed to advance the LAP to administer the programs through the principles of peer review and education toward the CAP goal to ensure that the programs continue to meet the scientific, service, and regulatory needs of participants; and to enhance the recognition of the pathologist as a physician in clinical decision making and consultation through the role of laboratory director. The CLA oversees and coordinates the activities of the five CLA committees in the development, maintenance, and implementation of accreditation checklists and standards, inspection processes, inter-inspection assessment tools, complaint investigations, and program education, under collaboration with CAP scientific resource committees to keep the programs and their requirements current. The Accreditation Committee is another arm of the CoA responsible for ensuring objectivity and consistency in CAP accreditation decision making by centralizing the decision-making criteria and processes. The Accreditation Committee makes investigation and accreditation decisions in those cases requiring committee action based on approved policy (i.e., more challenging and immediate jeopardy cases that may require a nonroutine inspection, suspension, probation, or conditional accreditation decisions). The Regional Commissioner is responsible for all accreditation activities of a specified group of laboratories. This includes the timely assignment of inspectors, review of inspection findings, and resolution of issues that may arise over accreditation decisions. Following the on-site inspection, the Regional Commissioner, in conjunction with CAP technical staff, reviews the findings and the laboratory’s corrective action. Deputy, State, and Division Commissioners assist the Regional Commissioners. State and Division Commissioners are responsible for identifying and assigning inspectors for their geographic regions. They must make sure that inspections are conducted on a timely basis and in accordance with CLA policy. The inspectors who conduct the on-site laboratory inspections are the main members of the program. The inspection team leader is a boardcertified pathologist who has received training and has participated in several inspections as a team member. Inspection team members are other pathologists, doctoral scientists, supervisory-level medical technologists, pathology residents and fellows, and other individuals who have expertise in the area of the laboratory that they are to inspect. The Laboratory Accreditation staff is composed of technical and administrative personnel who carry out the policies and procedures of the CLA and are responsible for the management and operation of the program. Since the majority of laboratories seek accreditation through CAP, all phases of the accreditation process will be now presented in details. © 2011 by Taylor and Francis Group, LLC

180


7.3.3.3.2â•‡ Application and Pre-Inspection Phase: Laboratory Dutiesâ•… A laboratory that would like to become accredited by CAP must submit an application request and once the request has been processed, application materials will be sent to the laboratory in one binder including four sections. The first section will have all the necessary application forms. The other three parts of the binder include “The Standards for Laboratory, Accreditation,” the “CAP Laboratory accreditation Manual” [45], and “Inspection Checklists.” These materials are available for review at the CAP Web site [44] before applying to the program. A new applicant to the accreditation program has up to 6 months to complete and return the application. Laboratories must participate in a CAP-accepted PT program for each patient reportable test. Each laboratory within an institution that operates under a separate CLIA license must submit separate application request forms to be accredited separately by CAP. In pre-inspection phase, application materials (forms and supplemental material) must be prepared and completed by the laboratory. The application form addresses general laboratory information including demographics, personal, contacts, licensure and certification, affiliated laboratories, and conditions of accreditation. All necessary details are given in the forms. For an initial accreditation, a test catalog shall be included. The laboratory must complete a roster for each laboratory section, including any non-laboratory based employees performing point-of-care-testing classified by CMS as moderate or high complexity. All disciplines practiced by the laboratory must be listed in the application, and all disciplines will be inspected. CAP does not accredit portions of laboratories. The accreditation letter lists only those disciplines that are reviewed at the time of the on-site inspection. Laboratories that add disciplines after the inspection must notify the College in writing; in some cases, additional inspections may be required. Laboratories applying for the Forensic Drug Testing (FDT) Accreditation Program must also submit the special “litigation packet” information, including details on QC and chain of custody procedures, analytical data on detection and quantitation of cannabinoids, and samples of documentation. 7.3.3.3.3â•‡ Preparing for the Inspection: Inspector’s Dutiesâ•… Inspectors and team leaders need to complete a mandatory CAP-prescribed training to promote a consistent understanding of program standards and ensure a uniform application of techniques. The training could be online self-study, live training seminar or live workshop for the team leader and team members. Team leader should be selected according to multiple criteria, including completing training, known conflicts of interest, and qualifications. Generally, one inspector is needed for the laboratory general inspection, and one for each of the following checklist combinations: hematology and © 2011 by Taylor and Francis Group, LLC


181

urinalysis; chemistry and toxicology, microbiology and immunology, and anatomic pathology and cytopathology. If the laboratory does not have a donor center, Transfusion Medicine can be combined with another checklist, such as Immunology or Point of Care. Adjustments to the number of inspectors should be made based upon the experience of the inspectors and the extent of testing in the laboratory. All inspectors should be familiar with the safety and test method validation requirements in the Laboratory General Checklist. Inspectors assigned to other checklist may assist the laboratory general inspector for the large full service laboratory. The team leader assembles an inspection team appropriate for the size and scope of the laboratory and check if specific expertise is needed. Also number of inspection days needed to perform the inspection will be recommended. After accepting the assignment for particular laboratory, the inspection team leader should arrange the inspection date. The inspection should occur within the 30 calendar days before laboratory’s accreditation date. A letter should be send to the laboratory director(s) indicating the inspection date, projected schedule, team listing, special requests (e.g., histology slides for review), and preliminary instructions regarding availability of documentation (personnel and training records, procedure manuals, PT results, test validation studies, quality control and maintenance records, and a sampling of completed case records, as applicable). For unannounced inspections, neither the college nor the team leader will communicate to the laboratory the date of the inspection, the name of the team leader, or the composition of the inspection team. 7.3.3.3.4â•‡ Conducting the Inspectionâ•… Three documents are fundamental to the inspection process: the standards for laboratory accreditation, the checklists, and the inspector’s summation report (ISR). The standards of the laboratory accreditations include • Standard I defines responsibilities and role of the laboratory director. • Standard II concerns the physical facilities and safety of the laboratory, including space, instrumentation, furnishings, communication systems, supplies, ventilation, piped gases and water, public utilities, and security. • Standard III encompasses quality control and performance improvement. This includes discussions of quality control, PT, instrument maintenance, QM, and performance improvement requirements. • Standard IV includes the inspection requirements of the program. On-site inspection by an external team and interim self-inspection are the cornerstones of the inspection requirement. The checklists are used by inspectors to determine if the laboratory meets the requirements set out in © 2011 by Taylor and Francis Group, LLC

182


the standards. The checklists are revised periodically and include approximately 3000 questions. Similar checklist questions may appear in multiple discipline-specific checklists. According to the activity menu and the scope of service of the laboratory the checklist will be determined and customized for each section by the inspection staff. More than one checklist can be applied for the any laboratory section. Customized checklists reduce the number of non-applicable checklist questions. Supervisors should prepare for inspection using the appropriate specific checklist(s). The laboratory will be inspected with the checklist version that has been sent with the application/reapplication packet even if another version was released between the time of application/reapplication and the actual inspection. The checklists are organized by specific laboratory disciplines and/or important management operations as follows: laboratory feneral, anatomic pathology, chemistry and toxicology, cytogenetics, cytopathology, flow cytometry, hematology and coagulation, histocompatibility, immunology, limited service laboratory, microbiology, molecular pathology, point-of-care testing, team leader assessment of director and quality, transfusion medicine, urinalysis, FDT, reproductive laboratory. Checklists are automatically mailed to accreditation program participants approximately 9 months prior to the inspection anniversary date and again at accreditation mid-cycle during the self-evaluation year. An electronic check list copy can be downloaded from CAP Web site [44]. For the laboratory that they want to anticipate and prepare for upcoming checklist requirements, reviewing the most recent edition of each checklist “checklist with commentary” will be very helpful since the revised checklists not only includes the questions but also the explanation, example, and references to assist understanding and interpretation of the checklist requirements. Each question is uniquely numbered, worded, and designed to produce a “Yes” response, which means that the laboratory is in compliance with the item; a “No” response, which means the laboratory does not comply; or “N/A,” which means that the question does not apply in this situation. Each question on the checklist specified according to how serious affect the patient care by indicating in top of each question either Phase I or Phase II deficiencies. Phase I questions do not seriously affect the quality of patient care or significantly endanger the welfare of a laboratory worker. If a laboratory is cited with a Phase I deficiency, correction and a written response to the CAP are required, but supportive documentation of deficiency correction is not required. Phase II questions may seriously affect the quality of patient care or the health and safety of the hospital or laboratory personnel. All Phase II deficiencies must be corrected before accreditation is granted by the CLA. © 2011 by Taylor and Francis Group, LLC


183

When a laboratory is in compliance but it can improve its process, a recommendation can be given. Recommendation could be relate to the way the laboratory is doing something or keeping records it might not be related to a checklist item. The laboratory is not obligated to respond to or implement a recommendation. A recommendation that should have been cited as a deficiency will be changed to a deficiency by CAP staff, and a deficiency response will be required from the laboratory. Deficiencies cited by the inspection team may be challenged if the resolution of a disagreement between laboratory personnel and an inspector cannot be achieved before or during the summation conference. The Regional Commissioner will review disputed items and determine if the deficiency can be removed from the record. All inspection findings are confidential. They should not be discussed in any context other than the inspection itself. Moreover, they should not be disclosed to anyone not associated with the accreditation process unless appropriate prior documented consent has been obtained. Accreditation must be carried out in an impartial and objective manner, uninfluenced by any personal, financial, or professional interest of any individual acting on behalf of the CAP LAP. Prior to unannounced inspections, the team leaders are required to sign a statement attesting to the absence of conflict of interest. There are three techniques used by the inspector in order to obtain useful information about the laboratory being inspected. The three techniques are known as “READ–OBSERVE–ASK.” “READ” means review of records and documents; “OBSERVE–ASK” means direct observation of laboratory activities and asking open-ended, probing questions. The use of these techniques eliminates the need to ask every single checklist question, as the dialog between inspector and the laboratory may address 5–10 checklist questions at a time. The list of deficiencies from the previous on-site inspection provided in the inspector’s packet must be reviewed and ensured that they have been appropriately addressed. 7.3.3.3.5â•‡ Post-Inspection Phaseâ•… The inspection ends with the Summation Conference. During Pre-summation Team Meeting all members of inspection team is checking the consistency of inspection reports and provide a review of cited deficiencies. ISR is then completed with listed deficiencies and description of the reason of the noncompliance. The ISR report must be readable for accurate documentation and appropriate follow up. Recommendations should be recorded in the ISR. A pre-summation conference should be attended by laboratory director, laboratory administration and personnel involve with inspection. The team leader should introduce the inspectors and their assignment and state the goal of the LAP and the main objective to maintain high-quality laboratory work © 2011 by Taylor and Francis Group, LLC

184


and to be in compliance with CLIA’88 and CAP checklists. The inspection team should identify areas for improvement by citing deficiencies. Another purpose of this meeting is to share information regarding how other laboratories accomplish compliance and make recommendations for the laboratories to achieve better patient care services. All responses for found deficiencies should be submitted with all evidence documentations within 30 calendar days of the inspections. The laboratory should send their deficiency response using the CAP response form and send to CAP and keep the copy in the laboratory. The timeframe for receiving the accreditation decision is 75 days. The decision to accredit a laboratory is made by the Regional Commissioner when the laboratory has provided acceptable documented responses to a Phase I and Phase II deficiencies and correction actions. If the laboratory is in non compliance with accreditation standard and failed to correct cited deficiencies within reasonable period may be presented to CLA for an accreditation decision. For denied laboratory, an official notification by certified mail will be send to all agencies that accepting CAP accreditation [46]. 7.3.3.3.6â•‡ Accreditation Requirements for Forensic Drug Testing by CAPâ•… CAP checklist contains special chapter devoted to FDT. The requirements specific for FDT are presented below. 7.3.3.3.6.1â•‡ Personnelâ•… Minimum personnel qualifications for analytical testing in the FDT laboratory should be equivalent to those required under CLIA 1988 guidelines. The laboratory should have an organizational chart, personnel policies, and job descriptions that define qualifications and duties for all positions. Personnel files should contain qualifications and continuing education records for each employee. The director or scientific director should meet at least one of the following qualifications: certified as a Diplomate by the American Board of Forensic Toxicology, certified by the American Board of Clinical Chemistry in Toxicological Chemistry, MD certified in clinical and/or forensic pathology with at least 2 years’ experience in analytical toxicology, and PhD in a chemical and/or biological discipline with at least 2 years’ experience in analytic toxicology. Additionally, the director or scientific director should have appropriate experience in forensic applications of analytical toxicology, such as in-court testimony, attendance at relevant continuing education programs, research, and publications in analytical toxicology. 7.3.3.3.6.2â•‡ Extent of Services Providedâ•… For the laboratory performing both screening and confirmatory testing of forensic drug samples, the positive results by screening MUST be confirmed before reporting using scientifically acceptable mass spectrometric method. For positive ethanol © 2011 by Taylor and Francis Group, LLC


185

results, one of separate aliquot of the original specimen should be tested by Â�scientifically acceptable gas chromatographic method. The laboratory should include the cutoff points for screening and confirmation testing for all drug classes. In the case of urine drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. In the case of oral fluid drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, cocaine, norcocaine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. For hair drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, cocaine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. 7.3.3.3.6.3â•‡ Proficiency Testingâ•… The laboratory should be enrolled with CAP/ AACC Forensic Urine Drug Testing or CAP—accepted alternative PT program. For the tests where the PT is not available, or if it is available but with different matrix, an alternative assessment should be performed at least semi biannually to validate the performance. A documented procedure must be available for proper handling, analysis, review, and reporting of PT sample. All PT must be integrated within routine laboratory workload together with routine batch and analysis performed by personnel who routinely test patient/client samples using the same documented procedure for testing. An evidence of evaluation, corrective actions for unacceptable PT results must be documented. 7.3.3.3.6.4â•‡ Quality Managementâ•… The QM should include monitoring the problem of collection client samples, chain of custody problems, or transportation delay. A system must be in place to ensure the improvement of the process. Laboratory must be able to detect any diluted or potentially adulterated sample. 7.3.3.3.6.5â•‡ Quality Control/Standard Operating Proceduresâ•… The scientific director is responsible for the overall QC Program. QC program must be clearly defined and available to all laboratory staff; it should include delegation of responsibilities, general policies, and analytic details. A documented procedure must be in place to detect the significant clerical and analytical errors before reporting the results. The control used for all commonly screening tests should includes drug free, a controls that are 25% below or above the cutoff for negative and positive control, respectively. The control must comprise 10% of the samples in the batch and at least one control must be in the end of the batch. QC results must be recorded or plotted in a way to allow continuous review and easily detect a failed QC results. Correction actions must be taken immediately in case of QC results failure and results © 2011 by Taylor and Francis Group, LLC

186


of action must be documented. The QC must be evaluated for acceptability before reporting results and periodic review of QC must be performed by laboratory director or designee. 7.3.3.3.6.6â•‡ Specimen Handlingâ•… The inspector should inspect the specimen receipt, verification of identity, accessioning, external and internal chain of custody, and labeling. The evaluation of the samples received should include sample volume, any adulteration and dilution check, evaluation of integrity of seals or secured containers, aliquoting, storing, and completion of records. Any observed problem processes that are contradictive with the documentation should be discussed with laboratory director. All specimens must be stored in secure area to which only the authorized individuals can have access. A documented procedure must assure that all positive specimens are retained in their original container for 1 year in freezer. For urine specimens, a documented procedure must be in place to measure the specimen validity (at a minimum testing for creatinine is required). In case of the oral fluid, to check the specimen validity testing the IgG is required. For all hair specimens, the laboratory should have validated procedures to control for potential external contamination. 7.3.3.3.6.7â•‡ Reporting of Resultsâ•… The laboratory should have a protocol for the reporting of results to clients or their representatives. The protocol should includes the date of specimen collection, date of specimen receipt, donor and client identification information, laboratory unique specimen identification number, specimen matrix tested (for hair specimen the site of collection), drug analyzed as part of the FDT, cutoff values per drug for both screening and confirmation tests, positive and/or negative results, date of report. Only confirmed positives results are reported as positive. Laboratory must have a documented protocol for ensuring the reliability and confidentiality of telephone reports and electronically reported results. 7.3.3.3.6.8â•‡ Recordsâ•… The laboratory should have a documented procedure that define which records, and for how long records must be maintained to meet client, legal, regulatory, and accreditation requirements. The following records must be maintained for 2 years: laboratory security access logs, accessioning logs, chain-of-custody documents and requisitions, analytical data from screening and confirmation analyses, specimen reports, QC program records, instrument maintenance and calibration records, reagent/standard/ calibrator/control preparation and verification records. Method performance validation records should be kept for at least 2 years after retirement of procedure, as well as personnel files on all laboratory personnel involved with the FDT performed by the laboratory, PT survey results, reports, and corrective © 2011 by Taylor and Francis Group, LLC


187

actions, previous CAP FDT on-site inspection records and corrective actions, previous CAP FDT self-inspection records and corrective actions, previous CAP general on-site inspection records and corrective actions appropriate to the FDT laboratory. 7.3.3.3.6.9â•‡ Method Performance Validationâ•… For FDT, CAP formulated criteria for mass spectrometry (GC-MS, LC-MS, GC-MS/MS, and LC-MS/MS). These criteria are presented in details in the Chapter 3.3.4.6 of this book. 7.3.3.4 JCIA Joint commission international accreditation (JCIA) was created in 1998 as a major division of JC’s international subsidiary. The JCIA as a part of JCAHO is an organizational accreditation program that evaluates the operation and management system of the health care organizations to ensure a high-standard patient care, safe, and effective and well-managed organization [46,47]. The WHO partnered with The JC and JC International to establish the world’s first WHO Collaborating Centre dedicated solely to patient safety solutions [48]. New medical staff requirements established by the JC include the development of ongoing professional practice evaluation and focused on professional practice evaluation. Accreditation Council for Graduate Medical Education and the American Board of Medical Specialties jointly developed processes and incorporate the general competencies of patient care, medical knowledge, practice-based learning and improvement, interpersonal and communication skills, professionalism and systems-based practice The CAP mad resources available to assist members and their facilities in implementing the new requirements and improving patient care [49]. 7.3.3.4.1â•‡ Accreditation Programs and Accreditation Standards of JCIAâ•… The following accreditation programs of JCIA are available through JCIA: • • • • • • •

Ambulatory care Care continuum Clinical laboratory Disease or condition-specific care certification Hospitals Medical transport Primary care

For each of these programs, particular standards were established. Since Clinical LAP is most relevant in this book, it will be presented in more © 2011 by Taylor and Francis Group, LLC

188


detailed way. JCIA formulated Clinical Laboratory Standards [50], which concern the following fields: • Quality management and improvement (QMI) system, including planning, documenting implementation, and monitoring of QMI program; designing system and processes according to quality improvement principles; identifying key indicators to monitor structures, processes, and outcomes; reference laboratory services; and QMI process documentation requirements. • Management and leadership (MGT) standards, including planning, responsibility, and authority; communication and coordination, QMI documentation, and review. • RSM standards, including provision of resources; human resources; infrastructure and facilities, laboratory equipment, environment, and safety. • Planning, provision, and development of laboratory services. • Monitor, analyze, and improve standards, including general quality control; histopathology and cytopathology; clinical chemistry, hematology and coagulation; microbiology; urinalysis and clinical microscopy; diagnostic immunology and serology; radioisotope testing; blood bank and transfusion service; histocompatibility testing, and cytogenetics. • International patient safety goals: The purpose of the International Patient Safety Goals is to promote specific improvements in patient safety by identifying problematic areas in health care and laboratory services. The following goals apply to accredited laboratories: identify patients correctly, improve effective communication, and reduce the risk of health care-associated infections. It is notable in these standards that the main accent was put on administration part (QMI, MGT) and on quality control. The standards concerning resources and laboratory services, which concern the core functions of laboratory services, are presented in less detailed manner. Dhatt and Sheiban [47] divided 11 JCIA hospital standards into two groups. The first group covered the patient care standards and included access and continuity of care, patient and family rights, assessment of patients (AOP), care of patients (COP), and patient family education. The second group of standards is related to health care organization management standards that includes QMI; prevention and control of infections (PCI); Â�governance, leadership, and direction; facility management, and safety (FMS); staff qualifications and education and management of information (MOI). Some of the hospital standards are also applicable to the laboratory such as AOP, COP, QMI, PCI, and FMS. The most relevant standard to the © 2011 by Taylor and Francis Group, LLC


189

laboratory is the AOP, which can be applied by the laboratory for better patient services and care and includes availability of laboratory services that meet applicable local and national standards, laws, and regulation; availability of clinical pathology services; availability of Laboratory Safety Program; availability of the results on timely manner by defining the TAT for each tests in the laboratory; availability of the essential reagents and other supplies; availability of procedures for sample collecting, identifying, handling, safe transporting, and disposing; establishing a normal range for results, which must be includes in patient reports; establishing and monitoring of quality control procedures. COP.5.3 standard is applicable to the hospital as well to the laboratory that indicates that the laboratory should have policies and procedures instructions for handling, use, and administration of blood and blood products. FMS.5 can be also as a core standard for organization and the laboratory and this assessing the presence of a plan for the inventory, handling, storage, use control, and disposal of hazardous materials. QMI.1 requires that the hospital and laboratory participate in planning and monitoring a QMI plan. QMI.3.2 and QMI.3.6 are both indicative of the requirements concerning laboratory and radiology safety, quality control programs, and the use of blood and blood products, respectively. Most of the AOP and QMI standards are relevant to ISO 15189 standards such as 4.1—Organization and management is relevant to AOP.5, 4.7—Advisory services vs. (AOP.5.12), 4.12—Continual improvement vs. (QMI.3.2), 5.1—Personnel vs. (AOP.5.3), 5.3—Laboratory equipment vs. (AOP.5.5), 5.4—Reexamination procedure vs. (AOP.5.7), and 5.8—Reporting of results vs. (AOP5.8). 7.3.3.4.2â•‡ JCIA Accreditation Processâ•… Availability of resources is the first step to get started in the accreditation process and this includes JCIA Standards for Hospitals, Survey Process Guide (available on the Web site of JCIA, web-based training on introduction to the international accreditation process, newsletters and publications, both in printed and electronic form. Twelve to twenty-four months prior to the survey, the organization should obtain JCI Standards manual and begin preparing for JCIA. Six to nine months prior to the survey, the application should be submitted and schedule survey dates should be established within 2 months prior to the survey, JCI survey Team Leader will contact the applied organization to determine survey agenda. Within 2 months after survey, the Accreditation Decision and official Survey Findings Reports from JCI will be submitted to the organization. 7.3.3.4.3â•‡ Recognition by Accrediting Organizations and Other Government Agenciesâ•… JCAHO accepts CAP accreditation of hospital laboratories. JC laboratory surveyor will not survey CAP-accredited © 2011 by Taylor and Francis Group, LLC

190


laboratories. During the hospital’s survey, however, an administrative surveyor will Â�examine laboratory safety and a physician surveyor will request and review information on the performance improvement activities of the laboratory and its medical staff. Occasionally the JC validates the CAP inspection process by sending an observer along with a CAP inspection team [51]. 7.3.3.5 Other U.S. Nonmedical Accreditation Organizations There are a number of American governmental and private organizations, involved in accreditation services for laboratories of biological, chemical, or forensic profile. Most of them are members of ILAC or IAF. As a basic standard these organizations are using ISO 17025 standard. American Association for Lab Accreditation (A2LA) [52], is a nonprofit, nongovernmental organization providing comprehensive services in laboratory accreditation and laboratory-related training. Laboratory accreditation is based on ISO/IEC 17025:2005. A2LA also offers programs for accreditation of inspection bodies, PT providers, reference material producers and product certification bodies. Laboratories are accredited in the numerous fields, among them in Biological, Calibration, Chemical, and Environmental. In addition to the broad fields, specifically tailored programs are available for animal drugs, environmental lead (Pb), fertilizers, and food testing, among others. International Accreditation Service, Inc. (IAS), United States [53] offers accreditation programs for testing and calibration laboratories according to ISO 17025 and collaborates with various international organizations, like EA. National Voluntary Laboratory Accreditation Program (NVLAP) [54], is offered by National Institute of Standard and Technology. Among others nonrelated procedures, NVLAP accredits procedure for asbestos fiber analysis. Laboratory Accreditation Bureau (L-A-B) [55] is recognized by ILAC and other organizations to provide ISO/IEC 17025 laboratory accreditation services to testing and calibration labs. L-A-B is recognized to ISO/IEC 17011 for accrediting labs to ISO/IEC 17025. Perry Johnson Laboratory Accreditation, Inc. [56] offers accreditation to ISO/IEC 17025 for laboratories performing testing and/or calibration in a wide range of fields, including, among others, chemical and biological testing. American Society of Crime Lab Directors/Laboratory Accreditation Board (ASCLD/LAB) [57] offers “an ISO-PLUS Program of Crime Laboratory Accreditation ISO/IEC 17025 enhanced by ASCLD/LAB-International Supplemental Requirements.” It means that any laboratory seeking ASCLD/ LAB-International accreditation must demonstrate conformance to the requirements in ISO/IEC 17025:2005, as well as the ASCLD/LAB-International Supplemental requirements for the accreditation of forensic science testing laboratories (2006). The following forensic fields are mentioned: controlled © 2011 by Taylor and Francis Group, LLC


191

substances, toxicology, trace evidence, biology, firearms/toolmarks, questioned documents, latent prints, crime scene, and digital and multimedia evidence. Additionally, special Breath Alcohol Calibration Accreditation Program is offered. American National Standards Institute—American Society for Quality National Accreditation Board LLC (ANSI-ASQ) provides accreditation services under the ACLASS [58] and ANAB [59] brands. Under the ACLASS brand, the organization accredits ISO/IEC 17025 testing and calibration laboratories, ISO/IEC 17020 inspection bodies, and ISO Guide 34 reference material producers. Under the ANAB brand, the organization is the U.S. accreditation body for management systems and accredits certification bodies for ISO 9001 QMSs, ISO 14001 environmental management systems, ISO 22000 food safety management systems, ANSI/AIHA Z10, CSA Z1000, and BS OHSAS 18001 occupational health and safety management systems, among others. 7.3.4â•‡ European Accreditation Organizations 7.3.4.1 European Cooperation for Accreditation EA [60] is a nonprofit association which was set up in 1997 and registered as an association in the Netherlands in 2000. EA is the European network of nationally recognized accreditation bodies located in the European geographical area and has 35 full members representing 33 European countries. Additionally, 18 non-European accreditation bodies have signed a contract of cooperation with EA. The EA missions consist of • Defining, harmonizing, and building consistency in accreditation as a service in Europe, by ensuring common interpretation of the standards used by its members • Ensuring transparency of the operations (including assessments) performed and results provided by its members • Maintaining a multilateral agreement on mutual recognition between accreditation schemes and reciprocal acceptance of accredited conformity assessment services and results • Managing a peer evaluation system consistent with international practices—EA as a region is a member of ILAC and IAF • Acting as a technical resource on matters related to the implementation and operation of the European policies on accreditation EA covers accreditation of laboratories (including testing and calibration), inspection bodies, and certification bodies. EA has seven committees: three technical committees (Certification Committee, Inspection Committee, © 2011 by Taylor and Francis Group, LLC

192


and the Laboratory Committee), which discuss all technical issues related respectively to the accreditation of certification bodies, inspection bodies, and laboratories, with the view of establishing best practice and fostering harmonization. The standards for the work in EA are • • • • •

Laboratories: ISO/IEC 17025, ISO 15189 Inspection: ISO/IEC 17020 Product Certification: EN 45011 (ISO/IEC Guide 65) Personnel Certification: ISO/IEC 17024 Management Systems Certification: ISO/IEC 17021

To other committees belong Multilateral Agreement Council, Harmonization Horizontal Committee, Communication and Publications Committee, and the Financial Oversight Committee. Huisman et al. [61] have collated an inventory of the accreditation procedures for medical laboratories in the EU. The survey was done for the European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4). It was found that accreditation of medical laboratories in the countries of the EU is mostly carried out in cooperation with national accreditation bodies. These national accreditation bodies work together in a regional cooperation, the EA. Professionals are trained to become assessors and play a prominent role in the accreditation process. The extent of the training is diverse. The frequency of assessments and surveillance visits differed from country to country and ranges from 1 to 4 years. More harmonization was postulated in this respect, based on a frequency that can be pragmatically handled by laboratory professionals. In the majority of EA bodies, accreditation is carried out on a test-by-test basis. Many professionals would prefer accreditation of the entire service provided within the actual field of testing (hematology, immunology, etc.), with accreditation granted if the majority of tests offered within a service field fulfill the requirements of the ISO 15189 standard. The scope of accreditation is a major point of discussions between the EC4 Working Group on Accreditation and representatives of accreditation bodies in the EA Medical Laboratory Committee. 7.3.4.2 European Standards Organization CEN CEN (= fr. Comité Europeen de Normalisation) [62] is formally appointed by the European Commission to elaborate and present European standards. CEN’s National Members are the National Standards Organizations of 30 European countries. There is only one member per country. They have voting rights in the General Assembly and Administrative Board of CEN and provide delegations to the Technical Board, which defines the work program. It is the responsibility of the CEN National Members to implement European © 2011 by Taylor and Francis Group, LLC


193

Standards as national standards, to distribute and sell them, and to withdraw any conflicting national standards. CEN is publishing the European Standards (EN), CEN Workshop Agreements, CEN Technical Specifications (CEN/TS), and CEN Technical Reports (CEN/TR). The standards are classified by industrial sector according to the system elaborated by the ISO in order to unify the classification of data about standards throughout the world. Following sectors are relevant to medical, pathological, or related laboratories: “Heath care technology” and “Environment–Health Protection–Safety.” Explosive growth of CEN and of its work program created the suspicion in some areas of the world that the single European market was intended to protect European industry from foreign incursions, what might be termed the “Fortress Europe syndrome.” It was very difficult for non-Europeans to obtain information about European standardization activities and, at the same time, there were obvious defections of western European national standards bodies from the international standardization arena, particularly in some specific areas. The response to this negative development was an agreement on the exchange of technical information between ISO and CEN (called the Lisbon Agreement, approved in 1989), which provided for full and mutual exchange of information between ISO and CEN on their respective activities. This step has been widened in the Vienna Agreement in 1991. The idea behind the agreement was to ensure that, to the largest possible extent, International Standards and European Standards are compatible or, even better, identical. Another major consideration was to make rational use of the resources available for standardization by avoiding duplication of work— this meaning that there had to be agreement on work allocation between ISO and CEN, as there were simply not sufficient expert resources available for ISO and CEN to conduct their standardization activities completely independently. The agreement on technical cooperation between ISO and CEN was approved by ISO Council resolution 18/1990 and CEN General Assembly resolution 3/1990. This agreement (called the Vienna Agreement) was published in June 1991. It is accompanied by common ISO/CEN “Guidelines for the TC/SC Chairmen and Secretariats for implementation,” approved in 1992 and revised in September 1998. The “codified” Vienna Agreement was approved by ISO Council and the CEN Administrative Board in 2001 [63]. Spitzenberger and Edelhauser [64] who reviewed the legal framework of medical laboratories in Europe indicated that although EN ISO/IEC 17025 and EN ISO 15189 provide useful requirements for laboratory testing, these standards are insufficient for giving full presumption of conformity in connection with requirements set by European directives. Additional regulatory documents and standards should be considered. Additionally, laboratory accreditation in usually performed on voluntary basis, whereas compliance with European criteria is mandatory. © 2011 by Taylor and Francis Group, LLC

194


7.3.5â•‡Accreditation Organizations and Policies in Selected Countries 7.3.5.1 Canada Li and Adeli [65] reviewed the current status of laboratory quality regulations and accreditation standards in Canada. Laboratory regulations and accreditation standards in Canada are standardized on a provincial but not on national basis. Overseen by the provincial government, each province constructs or subcontracts its own accreditation body. While ISO 15189 has been accepted in all provinces as the standard for accreditation of medical laboratories in Canada, there are variations in extent and pace to implement these standards. Five provinces have their own accreditation bodies, while in the other five provinces medical laboratories are accredited by Canadian Counsel on Health Service Accreditation. Each of these accreditation bodies has developed their own standards, implementing the ISO documents to variable extent. The following ISO standards were incorporated in accreditation standards: ISO 15189 and ISO 17025 (for accreditation requirements), ISO/IEC 17025 (for general requirements for the competence of testing and calibrating laboratories), ISO 17011 (for accreditation processes), ISO 10011 or ISO 19011 (for assessor training), ISO 22870 (for point of care testing), and ISO 15190 (for safety). There is clearly a need for uniform implementation of the accreditation concept using the same standards including ISO standards, ILAC guidelines, and guidelines of professional societies. Collaboration among PT providers to share information technology, and academic and educational resources to manage their PT operations should also be strongly encouraged. 7.3.5.2 United Kingdom The UKAS [8] is the sole national accreditation body recognized by government to assess, against internationally agreed standards, organizations that provide certification, testing, inspection, and calibration services. Special UKAS Web site [66] provides search possibilities for all laboratories involved in testing and calibration and accredited to ISO 17025 standard. Accreditation by UKAS demonstrates the competence, impartiality, and performance capability of these evaluators. UKAS is a non-profit-distributing company, limited by guarantee, and operates under a Memorandum of Understanding with the Government through the Secretary of State for Innovation, Universities, and Skills. UKAS members are the Secretary of State for Innovation, Secretary of State for Environment, Food and Rural Affairs, the Association of British Certification Bodies, British Measurement and Testing Association, Confederation of British Industry, the Safety Assessment Federation, Food Standards Agency, and Health Protection Agency, among others. The UKAS © 2011 by Taylor and Francis Group, LLC


195

is a signatory to the EA, mutual recognition agreements and has signed a number of international agreements, which help to lower barriers to trade by ensuring international acceptance of certificates issued under the umbrella of UKAS accreditation. As regards medical laboratories, there are two laboratory accreditation bodies within the United Kingdom: UKAS and Clinical Pathology Accreditation (UK) Ltd (CPA) [67]. UKAS and CPA have formed a partnership. The partnership enables the two organizations to cooperate on the development of accreditation policy and facilitates the exchange of best practice. The partnership is aimed at strengthening the authority and reputation of accreditation both in the United Kingdom and internationally by bringing together two organizations with established reputations in their respective fields. It is also a means of reducing the risk of fragmenting accreditation and avoiding proliferation of accreditation standards for laboratories. UKAS and CPA are working together to maximize the international recognition of accreditation. UKAS is recognized by Government as the national accreditation body and is the signatory of international mutual recognition agreements on behalf of the United Kingdom. It is intended that the partnership will in due course be incorporated into these agreements. The partnership introduced international standards for laboratory accreditation (ISO 17025 and ISO 15189) that enables UKAS and CPA to work on common criteria and thereby making a partnership possible. Both partners maintain respective control over professional (technical) decisions and standards. However, UKAS shall retain the Government’s sole recognition status as the National Accreditation Body. CPA is providing External Quality Assurance Schemes for clinical biochemistry, genetics, microbiology, hematology and blood transfusion, histopathology, and immunology. The search engine on the CPA Web site provides detailed information concerning particular medical laboratories, accredited under CPA. 7.3.5.3 Germany German Accreditation Council (DAR) [68] is coordinating all laboratory accreditation services in Germany. The council encompasses several accreditation bodies, like German Accreditation Body Chemistry (DACH) [69], German Accreditation System for Testing (DAP) [70], German Calibration Service (DKD), Association for Accreditation and Certification (GAZ), as well as Federal Ministry of Economics and Technology and German Institute for Standardisation (DIN). Medical laboratories (clinical chemistry, immunology, microbiology, virology, transfusion medicine, human genetics, and pathology) are accredited through DACH and DAP on the base of ISO 15189 standard. For other related laboratories (like forensic testing units, performing forensic autopsies, forensic DNA investigations, blood alcohol determination for forensic purposes, and forensic toxicology analyses), ISO 17025 © 2011 by Taylor and Francis Group, LLC

196


standard is used. Accreditation and supervision of inspection bodies is done according to ISO/IEC 17020 standard. Two hundred and fifty-eight medical laboratories and 52 forensic laboratories and institutes are currently accredited by DACH and DAP on various methods to ISO 15189, ISO 17025, and ISO 17020 standards (status April 2009). 7.3.5.4 Finland Accreditation is voluntary in Finland, but it has become a part of normal daily routines in main laboratories. Accreditation body in Finland is the Finnish Accreditation Service, FINAS, which is within the parent organization, the Centre for Metrology and Accreditation, and under the Ministry of Employment and the Economy. FINAS uses technical auditors who are clinical biochemists, clinical microbiologists, and specialist physicians. These technical auditors come from the university and central hospital laboratories as well as from big private laboratories. Clinical laboratories have been mainly accredited against ISO/IEC 17025, but ISO 15189 is also used. Five laboratories have been accredited against ISO 15189. All 5 university hospital laboratories are accredited and they have 12 accredited laboratories. Three out of 20 central hospital laboratories have accreditation, as well as 6 private laboratories. Laboratories are accredited against ISO/CEN 17025 or ISO 15189, but both standards are used at the same time in some cases. Accredited laboratories are mainly clinical chemistry/biochemistry and hematology laboratories (16 laboratories), but 11 microbiology, 5 pathology, 5 genetic testing, and 5 clinical physiology laboratories are also accredited [71]. 7.3.5.5 Italy From the recent presentation of Ceriotti [72], it is obvious that in Italy so far there does not exist any nationwide, uniform requirement for quality standards in laboratory medicine. Italy is divided into 20 regions, and each of them has a different organization and different minimal quality requirements for National Health Service. Around 300 out of around 4200 clinical laboratories volunteered to proceed with ISO 9001 certification. Six laboratories are accredited in the United Kingdom by CPA. The ISO 15189 standard is considered to be a reference standard for the accreditation, but up to now, an official accreditation body dedicated to clinical laboratories does not exist. 7.3.5.6 France Gouget [73] reviewed the situation in French medical laboratories. The development of quality assurance started during the 1990s with the publication of guidelines for good practice (GBEA). Accreditation of the hospitals by French National Authority for Health was set up by the French government in order to bring together a number of activities designed to improve the quality of patient care and to guarantee equity within the healthcare system. © 2011 by Taylor and Francis Group, LLC


197

Recently, the Ministry of Health (MOH) launched a mission, with the aim of initiating a new reform of the French medical biology sector, and of reorganizing laboratory medicine in the public and private sector. One of the common approaches is quality. It requires, as elsewhere in health sector, through the adoption of professional reference and due process, as well as controls by both peers and national authorities. The scope of accreditation is a major point of discussion between the accreditation bodies, the MOH and Professionals. One objective is to implement the standard ISO 15189 today for the accreditation of medical laboratories at the international level with particular requirements for quality and competence specifically designed for medical laboratories, which contains requirements for both quality systems and competence. ISO 15189 should promote harmonization of accreditation programs at an international level. 7.3.5.7 China In 1982, the Chinese MOH set up the National Center for Clinical Laboratory (NCCL), responsible for the quality of clinical laboratories. With the help of WHO and U.K. scholars, NCCL organized training courses on Quality Assurance and began to run the External Quality Assurance Programmes for big hospitals all over China in the 1980s. Then, every province sets up their local Center for Clinical Laboratories and also runs the EQA for local big hospitals. NCCL has been encouraging the clinical laboratories to work on accreditation since the middle of 1990s. So far, there are 5 clinical laboratories which have received CAP accreditation and more than 30 laboratories which have received ISO 15189 accreditation. Since the majority of Chinese clinical laboratories have had difficulty in receiving accreditation of ISO 15189, NCCL began to prepare a regulation for management of clinical laboratories, which was approved by MOH in 2006. The requirements of this regulation are less strict than those in ISO 15189, but it also consists of 56 articles, which are integrated into six sections titled general provision, administration, QM, safety management, supervision, and complementary. Quality and Safety management are the main sections in this regulation. MOH emphasized the investigation and monitoring of the medical service in 2005 and the regulation of management of clinical laboratories became the basic requirements for every clinical laboratory nationwide [74]. 7.3.5.8 Developing Countries Difficult situation of developing countries on the area of accreditation and QM of laboratories in developing countries was depicted in the excellent paper of Ahmad et al. [75] on the example of Pakistan. Qualified pathologists in developing countries are very well aware that a total QMS with mechanism to be part of an internationally recognized accreditation process is the only guarantee of a reasonable and reliable pathology service. However, the © 2011 by Taylor and Francis Group, LLC

198


ground realities make it virtually impossible to implement such a system. Pathologists in Pakistan, like in other developing countries, suffer from numerous handicaps, like limited number of qualified specialists, and instrumentation. According to an estimate based on membership of Pathology Societies, there were 109 pathologists per million populations in England while in Pakistan there were only 2.6. As a consequence, in Islamabad area, 57% of labs were supervised by non-pathologists, mostly technicians. The situation is similar in neighboring countries. There is no National Lab policy for reagents or regulatory authority in eight out of nine countries in WHO SEAR region. Poor maintenance facilities and frequent power outages make the situation worse. Accreditation under the internationally recognized programs like ISO 15189 is too expensive for most laboratories. In India, only 0.17% of laboratories have achieved accreditation [76]. The situation in Pakistan is similar. It is only recently that an effort has been initiated to start accreditation process under ISO 15189. Some large labs do have accreditation under ISO 9000/17025. According to the current situation, only a few laboratories are likely to meet ISO 15189 standards. Two-tier system has been proposed to improve this situation; it was recommended that accreditation based on ISO 15189 be introduced on a voluntary basis, for large laboratories. An accrediting body like Pakistan National Accreditation Council (PNAC) can be entrusted with the task of inspections and certification of laboratories which fulfill the criteria laid down. The candidate labs should be prepared for accreditation by providing educational material, courses, and workshops. Government should assist this process by providing subsidy to PNAC for carrying out these activities in collaboration with professional bodies like College of Pathologists Pakistan. On the other hand, for the vast majority of laboratories in the country, which are not able to qualify for the ISO standards in their present condition, another option was proposed. The College of Pathologists Pakistan will register laboratories, which meet minimum criteria of requirements. These laboratories will be required to introduce and adhere to internal quality standards. The most important requirement will be to participate in PT program. They will be assessed at periodic intervals to ensure, that they follow the recommended QMS. They will be issued a distinctive College emblem so that they can be distinguished from unregistered quack-run laboratories. This system may be helpful in providing a workable and comprehensive system through which pathology laboratories in the country will be able to offer a reliable service. According to Ahmad et al., this system can be adopted for use in other developing countries. Specific situation in Jordan medical laboratory service was presented by Qutishat [77]. Seventy percent of Jordan’s area is desert, and 45% of a population of approximately 5.6 million is under 15 years of age, and only 2.5% of the total population is above 65 years of age. Health services in © 2011 by Taylor and Francis Group, LLC


199

Jordan are provided by different sectors: private sector with majority of laboratories, followed by MOH, UNRWA services to Palestinian refugees, Charity Societies, Royal Medical Services, and University Hospitals. All private labs must receive the license by the licensing committee, which is formed by the representatives of the main medical sectors (MOH, military, universities, and private). All laboratories must implement internal quality and participate in a national or international EQAS. There is no regulation in Jordan that obliges laboratories or hospitals to be accredited and only few laboratories have been accredited by international organizations like CAP or JC. Recently, Jordanian Institute of Standards and Metrology (JISM) formed specialized unit on accreditation, mainly involved with nonmedical laboratories. In 2008, JISM started pilot project on accreditation of the medical labs, based on the ISO 15189.

7.4â•‡ Publications and Journals on Accreditation The journal Accreditation and Quality Assurance, published by Springer Verlag, has been established in 1996 as the information and discussion forum for all aspects relevant to quality, transparency, and reliability of measurement results in chemical and biological sciences. The journal serves the information needs of researchers, practitioners, and decision makers dealing with quality assurance and QM, including the development and application of metrological principles and concepts such as traceability or measurement uncertainty in the following fields: environment, nutrition, consumer protection, geology, metallurgy, pharmacy, forensics, clinical and laboratory medicine, and microbiology. The journal publishes general papers, practitioner’s reports, and reviews and provides a discussion forum for unorthodox ideas, remarkable observations, diverging views, and stimulating questions. In addition, recent developments of legislation and standardization, as well as reports from international bodies or meetings are given. The journal is publishing application papers regarding measurements in such disciplines as environment, nutrition, consumer protection, geology, metallurgy, pharmacy, forensics, clinical and laboratory medicine, microbiology and in all other fields of chemical and biological sciences. The journal is focusing on the following topics: accreditation and certification; quality assurance; tools for quality control; QM; metrology in chemistry, including traceability of measurement results, measurement uncertainty, comparability and equivalence of measurement results; verification and validation, calibration, and statistical simulations; purity assessment and sampling; interlaboratory comparison (PT, EQA), reference materials, reference measurements, dissemination and propagation of reference values; applied statistics for metrology; concepts and terminology; quantities and units. © 2011 by Taylor and Francis Group, LLC

200


Apart from Accreditation and Quality Assurance, several journals devoted to clinical chemistry are publishing special issues on laboratory accreditation. Clinical Biochemistry, an official organ of the Canadian Society of Clinical Chemists, recently published special issue, presenting the lectures held on the First International Symposium on Quality and Accreditation in Laboratory Medicine in Istanbul, Turkey in 2008. [78]. Clinica Chimica Acta, published in 2001 special issue devoted to European view on accreditation and related areas, like harmonization, EQA, and laboratory inspection [79]. Several books on accreditation and related topics appeared in last years. Springer Verlag published two books, which contain selected articles from the Accreditation and Quality Assurance. The book “Traceability in Chemical Measurement” [80] collects 20 outstanding papers on the topic, mostly published from 1999–2002 in the journal Accreditation and Quality Assurance. They provide the rationale for why it is important to integrate the concepts of validation and traceability and especially to include suitable reference materials into the standard procedures of every analytical laboratory. In addition, this anthology considers the benefits to both the analytical laboratory and the user of the results. The second book “Validation in Chemical Measurement” [81] presents 31 outstanding selected papers on the validation, published in the period 2000–2003 in the journal. David Burnett, a recognized expert on the field on laboratory accreditation, published two books on this topic, dealing mainly with the implementation of the ISO 15189 standard: “Understanding Accreditation in Laboratory Medicine (Management and Technology in Laboratory Medicine)” [82] and “A Practical Guide to Accreditation in Laboratory Medicine” [83]. The author outlined the structure of an “Ideal Standard” for medical laboratories, with an appendix providing cross references to the relevant international standards. The fictional “Pathology Laboratory of St Elsewhere’s Hospital Trust” serves as an example of how to use and implement quality manual, procedures, and forms. A more recent book on the implementation of the ISO 15189 standard was authored by Cooper and Gillions in 2007 [84]. The authors provided the practical details that are needed to implement the ISO 15189 guidelines for medical laboratories, particularly the proper use and application of statistical quality control for assuring quality and competence in a laboratory (Section 5.6 of the requirement: “Assuring the quality of examination procedures”). Practical examples of policies and procedures are provided in the book along with summary checklists that offer constructive advice on meeting the basic needed requirements. JC published in 2009 an “Accreditation Process Guide for Laboratories” [85]. Wenclawiak et al. [86] published a book on quality assurance in analytical chemistry. The book was addressed to laboratory analysts and their © 2011 by Taylor and Francis Group, LLC


201

trainers or teachers. Topics covered in this book include accreditation—ISO 17025, Â�certification—ISO 9000, PT, basic statistics, measurement uncertainty, Â�glossary/institutions, fit for the purpose (philosophy), quality manual, validation of methods, accreditation vs. certification, good laboratory practice (GLP), calibration—detection limit, reference materials, control charts, metrology/ traceability, TQM, and cost of quality. The accompanying CD contains more than 700 Power Point slides, ready for use as training material. Another book dealing with the accreditation on the base of ISO 17025 standard was written by Wilson and Weir and was dedicated for food and drink laboratories [87].

References 1. http://www.thefreedictionary.com/accreditation (accessed March 12, 2009) 2. http://www.wordreference.com/definition/accreditation (accessed March 12, 2009) 3. http://www.businessdictionary.com/definition/accreditation.html (accessed March 12, 2009) 4. http://www.merriam-webster.com/dictionary/accreditation (accessed March 12, 2009) 5. EN ISO/EC 17011:2004: Conformity assessment—Vocabulary and general principles. 6. http://www.ilac.org/home.html (accessed March 12, 2009) 7. http://www.iaf.nu/ (accessed March 12, 2009) 8. http://www.ukas.com/about-accreditation/What_is_Accreditation/What_is_ Accreditation.asp (accessed March 12, 2009) 9. Thomas A. 2009. External quality assessment in laboratory medicine: Is there a rationale to determine frequency of surveys? Accred. Qual. Assur. 14: 439–444. 10. Miller W.G. 2009. The role of proficiency testing in achieving standardization and harmonization between laboratories. Clin. Biochem. 42: 232–235. 11. Panteghini M. 2009. Traceability as a unique tool to improve standardization in laboratory medicine. Clin. Biochem. 42: 236–240. 12. Thompson M., Mathieson K., Owen L., Damant A.P., and Wood R. 2009. The relationship between accreditation status and performance in a proficiency test. Accred. Qual. Assur. 14: 73–78. 13. Wilson J.F. 2002. External quality assessment schemes for toxicology. Forensic Sci. Int. 128: 98–103. 14. Ferrara D.S., Tedeschi L., Frison G., and Brusini G. 1998. Quality control in toxicological analysis. J. Chromatogr. B 713: 227–243. 15. Travers H. 2002. Quality Assurance programs for countries in need: A global view from the College of American Pathologists. Accred. Qual. Assur. 7: 364–366. 16. http://www.eptis.bam.de/en/index.htm (accessed March 20, 2009) 17. http://www.eqalm.org/ (accessed March 20, 2009) 18. IFCC, C-AQ Guidelines for the Requirements for the Competence of EQAP organizers in medical laboratories, version 3/2002. Available at: http://www. eqalm.org/. (accessed March 12, 2009). 19. http://www.cms.hhs.gov/CLIA/downloads/ptlist.pdf (accessed March 20, 2009) © 2011 by Taylor and Francis Group, LLC

202


20. http://www.clsi.org/ (accessed March 25, 2009) 21. Clinical and Laboratory Standards Institute (CLSI). 2007. Using Proficiency Testing to Improve the Clinical Laboratory; Approved Guideline, 2nd edn. CLSI document GP27-A2 (ISBN 1-56238-632-8). Clinical and Laboratory Standards Institute, Wayne, PA. 22. http://www.compad.com.au/cms/iaf/workstation/upFiles/600630.IAFILAC-A4_2004_guidance_on_the_application_of_ISO-IEC_17020_2007-04. pdf (accessed April 3, 2009) 23. http://www.iso-17020.com/index.html (accessed April 3, 2009) 24. Ehrmeyer S.S. and Laessig R.H. 2008. Can auditing save us from a quality disaster? Accred. Qual. Assur. 13: 139–144. 25. Bachner, P. College of American Pathologist (CAP). 2009. How to prepare and comply with your quality management plan. 2009 LAP Audioconference Series, February 18, 2009. Department of Pathology and Laboratory Medicine, University of Kentucky College of Medicine, Slides 1–43. 26. Malone B. 2009. AACC—January Clinical Laboratory News: ISO accreditation comes to America—Are labs ready to embrace an international quality management system? Clin. Lab. News 35(1): 1–5. 27. Bak P., Bocker B., Müller W.D., Lohsträter A., and Smolenski U.C. 2004. Certification and accreditation systems as an instrument of quality management in the rehabilitation (Part 2)—Characteristics of most widely used systems. Physikalische Medizin Rehabilitationsmedizin Kurortmedizin 14: 243–248. 28. Lehmann H.P. 1998. Certification standards transfer: From committee to laboratory. Clin. Chim. Acta 278: 121–144. 29. Grunnet N. 2006. The Different Tools in Quality Management. ISBT Science Series, vol. 2, 2007, pp. 150–158. 30. Burnett D. 2006. ISO 15189: 2003—Quality management, evaluation and continual improvement. Clin. Chem. Lab. Med. 44: 733–739. 31. Salas Garcıa A., Vilaplana Perez C., Calderon Ruiz A., Gimeno Bosch C., Perez Jove J., Sevillano Herrada C., Bosch Llobet M.A., and Boquet Miquel X. 2008. Benchmarking and quality management indicators in three medical laboratories. Accred. Qual. Assur. 13: 123–132. 32. Kailner A. 1998. Quality management in the medical laboratory: A comparison of draft standards. Clin. Chim. Acta 278: 111–119. 33. Theodorou D.G. and Anastasakis P.C. 2009. Management review checklist for ISO/IEC 17025 and ISO 15189 quality-management systems. Accred. Qual. Assur. 14: 107–110. 34. Plebani M. 2004. Accreditation of the Medical Laboratory—ISO 15189/ISO 17025. Encyclopedia of Medical Genomics and Proteomics. Editors: Jürgen F., Maurizio P., Informa Healthcare. Available at: http://www.informaworld.com/ smpp/content∼db=all∼content=a713544798 35. DAP-Checklist for the Assessment of Testing Laboratories against DIN EN ISO/IEC 17025:2005 http://www.dap.de/doce.html. CH-PL-17025-e, August 10, 2006, Revision 2.0, pp. 1–19. 36. Burnett D.A. 2002. Companion to ‘A practical Guide to Accreditation in Laboratory Medicine’ for use with ISO 15189:2003 Medical Laboratories— Particular requirements for quality and competence. ISBN 0902429396 (www.acb.org.uk). ACB Venture Publications. © 2011 by Taylor and Francis Group, LLC


203

37. Burnett D. 2007. ISO 15189:2007—A Practical Tool for the Management of Quality in the Medical Laboratory, Lisbon, Portugal, November 8, 2007. Slides 1–40. 38. DAP I. DAP Checklist for medical laboratories according to DIN EN ISO 15189:2007*—Form CH-ML-15189_e/Rev. 2.1/29.04.08. 39. DAP Rules Accreditation of Testing Laboratories and Medical Laboratories, http://www.dap.de/doce.html. RW II.1_e. Release date September 2006, Revision 6.0, pp. 1–10. 40. 42 CFR Part 493—Laboratory Requirements. 10-1-04 Edition, pp. 967–1087. http://wwwn.cdc.gov/clia/regs/toc.aspx, http://www.access.gpo.gov/nara/cfr/ waisidx_04/42cfr493_04.html 41. http://www.cms.hhs.gov/CLIA (accessed April 15, 2009) 42. Rauch C.A. and Nichols J.H. 2007. Laboratory accreditation and inspection. Clin. Lab. Med. 27: 845–858. 43. www.cola.org (accessed April 17, 2009) 44. http://www.cap.org/apps/cap.portal?_nfpb=true&_pageLabel=accreditation (accessed April 18, 2009) 45. Sharkey E. ed. 2009. Laboratory Accreditation Manual. College of American Pathologists. Available at: http://www.cap.org/apps/docs/laboratory_accreditation/2009_lapmanual.pdf 46. http://www.jointcommissioninternational.org/ (accessed April 22, 2009) 47. Dhatt G.S. and Al Sheiban A. 2008. Joint commission international accreditation: A laboratory perspective. Accred. Qual. Assur. 13: 161–164. 48. JCI Accreditation and Certification. Available at: http://www.jointcommissionâ•‰ international.org/common/pdfs/jcia/JCIA_Brochure-new_branding.pdf 49. Catalano E.W., Ruby S.G., Talbert M.L., and Knapman D.G. 2009. College of American Pathologists considerations for the delineation of pathology clinical privileges. Arch. Path. Lab. Med. 133: 613–618. 50. http://www.jointcommissioninternational.org/common/pdfs/jcia/Standards_ Only-Clinical_Lab-1st_edition.pdf (accessed April 22, 2009) 51. Laboratory Accreditation Manual—lnspector Information and Laboratory Information July 2007 Edition, College of American Pathologists, Laboratory Accreditation Manual. 52. http://www.a2la.org/ (accessed May 3, 2009) 53. http://www.iasonline.org/ (accessed May 3, 2009) 54. http://ts.nist.gov/standards/accreditation/index.cfm (accessed May 3, 2009) 55. http://www.l-a-b.com/ (accessed May 3, 2009) 56. http://www.pjlabs.com/default.htm (accessed May 3, 2009) 57. http://www.ascld-lab.org/international/indexinternational.html (accessed May 3, 2009) 58. http://www.aclasscorp.com (accessed May 3, 2009) 59. http://www.anab.org/ (accessed May 3, 2009) (accessed 60. http://www.european-accreditation.org/content/home/home.htm May 10, 2009) 61. Huisman W., Horvath A.R., Burnett D., Blaton V. et al. 2007. Accreditation of medical laboratories in the European Union. Clin. Chem. Lab. Med. 45: 268–275. 62. http://www.cen.eu/cenorm/homepage.htm (accessed May 10, 2009) 63. http://www.iso.org/iso/about/the_iso_story/iso_story_vienna_agreement.htm (accessed May 11, 2009) © 2011 by Taylor and Francis Group, LLC

204


64. Spitzenberger F. and Edelhauser E. 2006. Accreditation of medical laboratories in Europe: Statutory framework, current situation and perspectives. Transfus. Med. Hemother. 33: 384–392. 65. Li H. and Adeli H. 2009. Laboratory quality regulations and accreditation standards in Canada. Clin. Biochem. 42: 249–255. 66. http://www.ukas.org/ (accessed May 20, 2009) 67. http://www.cpa-uk.co.uk/ (accessed May 20, 2009) 68. http://www.dar.bam.de/index.html (accessed May 20, 2009) 69. http://www.dach-gmbh.de/ (accessed May 20, 2009) 70. http://www.dap.de/ (accessed May 20, 2009) 71. Laitinen P. 2009. Laboratory and quality regulations and accreditation standards in Finland. Clin. Biochem. 42: 312–313. 72. Ferruccio Ceriotti F. 2009. Laboratory quality regulations and accreditation standards in Italy. Clin. Biochem. 42: 317. 73. Gouget B. 2009. Organization and evolution of the regulation and standards in France for the clinical laboratories. Clin. Biochem. 42: 314. 74. Yang Z. 2009. The laboratory accreditation and regulations of clinical laboratory in China. Clin. Biochem. 42: 310. 75. Ahmad M., Khan F.A., and Ahmad S.A. 2009. Standardization of pathology laboratories in Pakistan: Problems and prospects. Clin. Biochem. 42: 259–262. 76. Chakraborty S. 2003. Are Indian clinical laboratories prepared to accept the present accreditation system? Express Healthc Manage News 16–30. 77. Qutishat A.S. 2009. Medical laboratory quality and accreditation in Jordan. Clin. Biochem. 42: 256–258. 78. Uras F. ed. 2009. Highlight section: Quality & accreditation in laboratory medicine. Clin. Biochem. 42: 229–434. 79. Proceedings of the 7th International Conference on Laboratory Medicine “Quality and accreditation of medical laboratories: State-of-the-art, harmonization and projects in the European Union”. Clin. Chim. Acta 2001. 309: 109–215. 80. Paul De Bièvre P. and Günzler H. 2005. Traceability in Chemical Measurement, 1st edn. Springer, Berlin, Germany, pp. 1–281. 81. Paul De Bièvre P. and Günzler H. 2005. Validation in Chemical Measurement, 1st edn. Springer, Berlin, Germany, pp. 1–186. 82. Burnett D. 1997. Understanding Accreditation in Laboratory Medicine (Management & Technology in Laboratory Medicine). American Association for Clinical Chemistry, Washington, DC, pp. 1–310. 83. Burnett D., Poyser K.H., and Sherwood R.A. 2002. A Practical Guide to Accreditation in Laboratory Medicine. ACB Venture Publications, London, U.K., pp. 1–307. 84. Cooper G. and Gillions T. 2007. Producing Reliable Test Results in the Medical Laboratory. Bio-Rad Laboratories, ISBN-10: 0979285704, pp. 1–80. 85. Joint Commission Accreditation Healthcare Organizations. 2009. 2009 Accreditation Process Guide for Laboratories. Joint Commission Resources; Spi edition. ISBN-10: 1599402645. 86. Wenclawiak B.W., Koch M., and Hadjicostas E. 2004. Quality Assurance in Analytical Chemistry: Training and Teaching. Springer Verlag, Heidelberg, Germany, ISBN-10: 354040578X, pp. 1–280. 87. Wilson S. and Weir G. 1995. Food and Drink Laboratory Accreditation: A Practical Approach. Springer Verlag, Heidelberg, Germany, ISBN-10: 0412599201, pp. 1–262. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations in Setting Quality Standards in Pathology and Laboratory Medicine and Related Areas

8

Maciej J. Bogusz

Contents Abbreviations 8.1 Introduction 8.2 U.S. Government Regulations and Recommendations 8.2.1 Clinical Laboratory Improvement Amendments Issued by U.S. Department of Health and Human Services 8.2.2 Regulations Issued by FDA 8.2.2.1 Identification Issues 8.2.2.2 Quantitation and Method Validation Issues 8.2.2.3 Validation of Electronic Records and Signatures 8.2.2.4 Quality Assurance of Waived Tests and Diagnostic Devices 8.2.3 Regulation Issued by Substance Abuse and Mental Health Administration 8.2.3.1 Specimen Kind and Collection 8.2.3.2 Analytical Aspects of WDT 8.2.3.3 Quality Assurance Aspects of WDT 8.2.4 Guidelines on Good Clinical Laboratory Practice Issued by National Institutes of Health 8.2.4.1 Standards for Organization and Personnel 8.2.4.2 Standards for Laboratory Equipment 8.2.4.3 Standards for Test Facility Operation 8.2.4.4 Quality Control Program 8.2.4.5 Standards for Verification of Performance Specification © 2011 by Taylor and Francis Group, LLC

205

207 208 208 208 216 217 217 227 235 238 239 240 241 243 244 245 245 246 246

206


8.2.4.6 Standards for Records and Reports 8.2.4.7 Standards for Physical Facilities 8.2.4.8 Standards for Specimen Transport and Management 8.2.4.9 Standards for Personnel Safety 8.2.4.10 Standards for Laboratory Information System 8.2.4.11 Standards for Quality Management 8.2.5 Recommendations of the National Research Council Concerning U.S. Forensic Sciences Community: Creation of the National Institute of Forensic Science 8.3 European Union Regulations and Recommendations 8.3.1 Quality Assurance of Human Resources Coordinated on European Level: The Activity of the European Communities Confederation of Clinical Chemistry and Laboratory Medicine 8.3.1.1 Professional Competence Issues 8.3.1.2 Ethical Issues 8.3.1.3 European Coordination Issues 8.3.2 European Community Activity Concerning Performance of Analytical Methods and Interpretation of Results 8.3.3 European Committee for External Quality Assurance Programmes in Laboratory Medicine 8.4 Professional International and National Organizations 8.4.1 International Conference on Harmonisation 8.4.2 Joint Committee on Traceability in Laboratory Medicine 8.4.3 International Federation of Societies of Toxicologist Pathologists 8.4.4 Recommendations of Organizations of Forensic Toxicologists 8.4.4.1 Forensic Toxicology Laboratory Guidelines Issued by SOFT/AAFS 8.4.4.2 Activity of the College of American Pathologists for Forensic Sciences 8.4.4.3 The International Association of Forensic Toxicologists Guidelines 8.4.4.4 Guidelines of the Society of Hair Testing 8.4.4.5 Guidelines of the German Society of Toxicological and Forensic Chemistry References


247 249 249 250 250 251 252 257

257 258 260 261 262 263 264 264 266 267 269 269 276 276 278 281 284

Role of Governmental and Professional Organizations

207

Abbreviations AAFS American Academy of Forensic Sciences British Association of Research Quality Assurance BARQA Bureau Internationale des Poids et Mesures BIPM College of American Pathologists CAP Clinical Laboratory Improvement Amendments CLIA Clinical and Laboratory Standard Institute CLSI Centers for Medicare and Medical Services CMS Diode Array Detector DAD EC4 The European Communities Confederation of Clinical Chemistry and Laboratory Medicine EFCC European Federation of Clinical Chemistry and Laboratory Medicine External quality assurance EQA EQALM European Committee for External Quality Assurance Programmes in Laboratory Medicine Food and Drug Administration FDA Good Clinical Laboratory Practice GCLP Gas chromatography-mass spectrometry GC-MS GCP Good Clinical Practice Good Laboratory Practice GLP German Society of Toxicological and Forensic Chemistry GTFCh U.S. Department of Health and Human Services HHS ICH International Conference on Harmonisation IFCC International Federation of Clinical Chemistry and Laboratory Medicine IFSTP International Federation of Societies of Toxicologist Pathologists ILAC International Laboratory Accreditation Cooperation ISO International Organization for Standardization Joint Committee on Traceability in Laboratory Medicine JCTLM LC-MS Liquid chromatography-mass spectrometry LIS Laboratory Information System LLOQ Lower limit of quantification LOD Limit of detection Medical review officer MRO NIFS National Institute of Forensic Science NIH National Institutes of Health NIST National Institute of Standards and Technology PT Proficiency testing Quality management QM


208

SAMHSA SOFT SoHT SOP TIAFT TLC ULOQ WDT


Substance Abuse and Mental Health Administration Society of Forensic Toxicologists Society of Hair Testing Standard operation procedure The International Association of Forensic Toxicologists Thin layer chromatography Upper limit of quantification Workplace drug testing

8.1â•‡Introduction Examinations, performed in hospital, pathological, or forensic laboratories, are applied in very sensitive areas, like, e.g., preventive cancer screening, workplace drug testing, or in emergency situations. The results of such examinations may have direct impact on the health and well-being of the society, or on the individual fate or professional career of an individual person. Therefore, the government agencies and ministries in many countries, as well as professional organizations, undertook efforts to assure and control the quality of work in the areas in question. Various legal acts, recommendations, or guidelines were directed into improvement of the technical, logistical, and administrative aspects of laboratory activities. Special attention was given to the assurance of appropriate competence level of human resources. It was not possible to review in this chapter the whole multitude of legal acts and recommendations issued in every country in the world. The intention was to present most relevant and most representative regulations.

8.2â•‡U.S. Government Regulations and Recommendations 8.2.1â•‡Clinical Laboratory Improvement Amendments Issued by U.S. Department of Health and Human Services The Clinical Laboratory Improvement Amendments, known commonly as CLIA 88 law, was passed in response to press articles, revealing poor laboratory practices, particularly in the field of cancer diagnosis and prevention. CLIA 88 was issued by U.S. Department of Health and Human Services (HHS) [1] and became a general quality assurance standard for all laboratories, testing human specimens for medical purposes. CLIA 88 is divided into several subparts, like General Provisions, Certificate of Waiver, Registration Certificate, Certificate of Accreditation issued by HHS, Accreditation issued by a Private, Nonprofit Organization, General Administration, Participation in Proficiency Testing, Proficiency Testing Programs for Nonwaived Testing, © 2011 by Taylor and Francis Group, LLC


209

Facility Administration, Quality System for Nonwaived Testing, Personnel for Nonwaived Testing, Inspection, Enforcement Procedures, and Consultations. According to CLIA definitions, laboratory means a facility for the biological, microbiological, serological, chemical, immunohematological, hematological, biophysical, cytological, pathological, or other examination of materials derived from the human body for the purpose of providing information for the diagnosis, prevention, or treatment of any disease or impairment of, or the assessment of the health of human beings. These examinations also include procedures to determine, measure, or otherwise describe the presence or absence of various substances or organisms in the body. Facilities only collecting or preparing specimens (or both) or only serving as a mailing service and not performing testing are not considered laboratories. All laboratories must be certified to perform testing on human specimens under the CLIA rules. There are some exceptions of this condition. The laboratories, performing only simple, waived tests as certified by Food and Drug Administration (FDA) do not need to register, to be accredited, and to participate in proficiency testing programs according to CLIA rules. Additionally, the laboratory is CLIA-exempt if • It only performs testing for forensic purposes. • It is a research laboratory testing human specimens but do not report patient-specific results for the diagnosis, prevention, or treatment of any disease or impairment of, or the assessment of the health of individual patients. • It is a laboratory certified by the Substance Abuse and Mental Health Services Administration (SAMHSA), in which drug testing is performed, which meets SAMHSA guidelines and regulations. However, all other testing conducted by a SAMHSA-certified laboratory is subject to CLIA rules. Laboratory tests are categorized as one of the following: • Waived tests, which are simple laboratory examinations and procedures cleared and approved by FDA for home use, employ methodologies that are so simple and accurate as to render the likelihood of erroneous results negligible, or pose no reasonable risk of harm to the patient if the test is performed incorrectly. • Tests of moderate complexity, including the provider-performed microscopy (PPM) procedures. • Tests of high complexity. The categorization is based on following criteria: required knowledge, training and experience of the analyst, complexity of reagents and material © 2011 by Taylor and Francis Group, LLC

210


preparation, characteristics of operational steps (pipetting, timing etc.), calibration, stability, complexity, and availability of materials, test system troubleshooting and equipment maintenance, interpretation, and judgment. Each of these criteria is scored in two or three categories, depending on the difficulty and complexity of the test. FDA is the institution responsible for the categorization of each test. A laboratory may perform only waived tests, only tests of moderate complexity, only PPM procedures, only tests of high complexity, or any combination of these tests. The whole system of quality assurance, as formulated by CLIA rules, is divided into the following steps: 1. Certified registration procedure (or certification of waiver for simple laboratories). 2. Certificate of accreditation under CLIA. Most important requirements for a certificate of accreditation, as formulated by CLIA, are summarized as follows: Laboratories issued a certificate of accreditation must (1) treat proficiency testing samples in the same manner as patient samples; (2) notify the approved accreditation program no later than 6 months after any deletions or changes in test methodologies; (3) comply with the requirements of the approved accreditation program; (4) permit random sample validation and complaint inspections; (5) permit HHS to monitor the correction of any deficiencies found through the inspections; (6) authorize the accreditation program to release to HHS the laboratory’s inspection findings whenever HHS conducts random sample or complaint inspections; and (7) authorize its accreditation program to submit to HHS the results of the laboratory’s proficiency testing. A certificate of accreditation is valid for no more than 2 years. 3. Alternative accreditation. Alternatively to CLIA accreditation, accreditation may be done by a private, nonprofit accreditation organization (e.g., CAP—College of American Pathologists), or exemption can be made under an approved state laboratory program. Alternative accreditation or exemption is accepted on equivalency basis, i.e., that an accreditation organization or a state laboratory program are equal to or more stringent than the CLIA requirements taken as a whole. 4. Successful participation in proficiency testing for laboratories performing nonwaived testing. Each laboratory performing nonwaived testing must successfully participate in approved proficiency testing program for each specialty, subspecialty, and analyte or test in which the laboratory is certified under CLIA. If a laboratory fails to participate successfully in proficiency testing for a given specialty, subspecialty, analyte or test, as defined in this section, or fails to © 2011 by Taylor and Francis Group, LLC


211

take remedial action when an individual fails gynecologic cytology, Centers for Medicare and Medical Services (CMS) impose sanctions. If a laboratory fails to perform successfully in a CMS-approved proficiency testing program, for the initial unsuccessful performance, CMS may direct the laboratory to undertake training of its personnel or to obtain technical assistance, or both, rather than imposing alternative or principle sanctions except when one or more of the following conditions exists: (1) There is immediate jeopardy to patient health and safety. (2) The laboratory fails to provide CMS or a CMS agent with satisfactory evidence that it has taken steps to correct the problem identified by the unsuccessful proficiency testing performance. (3) The laboratory has a poor compliance history. 5. Proper facility administration for nonwaived testing. 6. Quality system for nonwaived testing, including quality assessment (QA) of general laboratory system, preanalytic, analytic, and postanalytic systems. 7. Personnel for laboratories performing nonwaived testing of moderate and high complexity. 8. Inspection system. 9. Enforcement procedures.

As concerns point 4, following assessment criteria of participation in proficiency testing were established for bacteriology, mycobacteriology, mycology, parasitology, virology, syphilis serology, general immunology, routine chemistry, urinalysis, endocrinology, toxicology, and hematology: • Failure to attain an overall testing event score of at least 80% is unsatisfactory performance. • Failure to participate in a testing event is unsatisfactory performance and results in a score of 0 for the testing event. • Failure to return testing results to the proficiency testing program within the time frame specified by the program is unsatisfactory performance and results in a score of 0 for the testing event. • For any unsatisfactory testing event for reasons other than a failure to participate, the laboratory must undertake appropriate training and employ the technical assistance necessary to correct problems associated with a proficiency testing failure. Remedial action must be taken and documented, and the laboratory must maintain the documentation for 2 years from the date of participation in the proficiency testing event. • Failure to achieve an overall testing event score of satisfactory performance for two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. © 2011 by Taylor and Francis Group, LLC

212


Table 8.1â•… CLIA—Criteria for Acceptable Performance—General Clinical Chemistry Analyte or Test Alanine aminotransferase (ALT/SGP) Albumin Alkaline phosphatase Amylase Aspartate aminotransferase (AST/SGOT) Bilirubin, total Blood gas pO2 pCO2 pH Calcium, total Chloride Cholesterol, total Cholesterol, high-density lipoprotein Creatine kinase Creatine kinase isoenzymes Creatinine Glucose (excluding glucose performed on monitoring devices cleared by FDA for home use Iron, total Lactate dehydrogenase (LDH) LDH isoenzymes Magnesium Potassium Sodium Total protein Triglycerides Urea nitrogen Uric acid

Criteria for Acceptable Performance Target valueâ•›±â•›20% Target valueâ•›±â•›10% Target valueâ•›±â•›30% Target valueâ•›±â•›30% Target valueâ•›±â•›20% Target valueâ•›±â•›0.4â•›mg/dL orâ•›±â•›20% (greater) Target valueâ•›±â•›3 SD Target valueâ•›±â•›5â•›mm Hg orâ•›±â•›8% (greater) Target valueâ•›±â•›0.04 Target valueâ•›±â•›1.0â•›mg/dL Target valueâ•›±â•›5% Target valueâ•›±â•›10% Target valueâ•›±â•›30% Target valueâ•›±â•›30% MB elevated (presence or absence) or Target valueâ•›±â•›3â•›SD Target valueâ•›±â•›0.3â•›mg/dL or ±15% (greater). Target value 6â•›mg/dL or 10% (greater)

Target valueâ•›±â•›20% Target valueâ•›±â•›20% LDH1/LDH2 (+ or −) or Target valueâ•›±â•›30% Target valueâ•›±â•›25% Target valueâ•›±â•›0.5â•›mmol/L Target valueâ•›±â•›4â•›mmol/L Target valueâ•›±â•›10% Target valueâ•›±â•›25% Target valueâ•›±â•›2â•›mg/dL orâ•›±â•›9% (greater) Target valueâ•›±â•›17%

Tables 8.1 through 8.3 show acceptable performance criteria for clinical chemistry, endocrinology, and toxicology, respectively. It is interesting to find that most criteria for quantitative examinations are less restrictive than those recommended by FDA in the “Guidance for Industry” [2]. In this document, the accuracy threshold was set at ±15% of theoretical value. For cytology (pap smears, gynecologic examinations), following criteria were formulated: • The laboratory must ensure that each individual engaged in the examination of gynecologic preparations is enrolled in a CMS-approved © 2011 by Taylor and Francis Group, LLC


213

Table 8.2â•… CLIA—Criteria for Acceptable Performance—Endocrinology Analyte or Test

Criteria for Acceptable Performance

Cortisol Free thyroxine Human chorionic gonadotropin (excluding urine pregnancy tests done by visual color comparison categorized as waived tests) T3 uptake Triiodothyronine Thyroid-stimulating hormone Thyroxine

Target valueâ•›±â•›25% Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD positive or negative

Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD Target valueâ•›±â•›20% or 1.0â•›mcg/dL (greater)

Table 8.3â•… CLIA—Criteria for Acceptable Performance—Toxicology Analyte or Test Alcohol, blood Blood lead Carbamazepine Digoxin Ethosuximide Gentamicin Lithium Phenobarbital Phenytoin Primidone Procainamide (and metabolite) Quinidine Tobramycin Theophylline Valproic acid

Criteria for Acceptable Performance Target valueâ•›±â•›25% Target valueâ•›±â•›10% or 4â•›mcg/dL (greater) Target valueâ•›±â•›25% Target valueâ•›±â•›20% orâ•›±â•›0.2â•›ng/mL (greater) Target valueâ•›±â•›20% Target valueâ•›±â•›25% Target valueâ•›±â•›0.3â•›mmol/L orâ•›±â•›20% (greater) Target valueâ•›±â•›20% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25%

proficiency testing program, if available in the state in which he or she is employed. The laboratory must ensure that each individual is tested at least once per year and obtains a passing score. To ensure this annual testing of individuals, an announced or unannounced testing event will be conducted on-site in each laboratory at least once each year. Laboratories will be notified of the time of each announced on-site testing event at least 30 days prior to each event. Additional testing events will be conducted as necessary in each state or region for the purpose of testing individuals who miss the on-site testing event and for retesting individuals. © 2011 by Taylor and Francis Group, LLC

214


• The laboratory must ensure that each individual participates in an annual testing event that involves the examination of a 10-slide test set. Individuals who fail this testing event are retested with another 10-slide test set. Individuals who fail this second test are subsequently retested with a 20-slide test. Individuals are given not more than 2â•›h to complete a 10-slide test and not more than 4â•›h to complete a 20-slide test. Unexcused failure to appear by an individual for a retest will result in test failure with resulting remediation and limitations on slide examinations. The responses of each proficiency testing are divided into four categories: (a) “Unsatisfactory for diagnosis,” (b) Normal or benign changes,” (c) “Low-grade squamous epithelial lesions,” and (d) “High-grade lesion and carcinoma.” Criteria for scoring system for 10-slide and 20-slide tests are shown in Table 8.4. • If a laboratory fails to ensure that individuals are tested or those who fail a testing event are retested, or fails to take required remedial actions, CMS will initiate intermediate sanctions or limit the laboratory’s certificate to exclude gynecologic cytology testing under CLIA, and, if applicable, suspend the laboratory’s medicare and medicaid payments for gynecologic cytology testing. Table 8.4 shows details of acceptable performance criteria for cytology. It should be noted that the proficiency testing system for cytological examinations, as mandated by CLIA, has been heavily criticized as inefficient and giving misleading results [3–5]. For immunohematology (ABO group and D typing) and hematology compatibility testing, the requirements concerning successful participation are as follows: • Failure to attain a score of at least 100% of acceptable responses for each analyte or test in each testing event is unsatisfactory analyte performance for the testing event. • Failure to attain an overall testing event score of at least 100% is unsatisfactory performance. • Failure to participate in a testing event is unsatisfactory performance and results in a score of 0 for the testing event. • Failure to return proficiency testing results within the time frame specified by the program is unsatisfactory performance and results in a score of 0 for the testing event. • For any unsatisfactory testing event for reasons other than a failure to participate, the laboratory must undertake appropriate training and employ the technical assistance necessary to correct problems associated with a proficiency testing failure. For any unacceptable © 2011 by Taylor and Francis Group, LLC


215

Table 8.4â•… CLIA—Criteria for Scoring System for Cytology: Gynecologic Examinations Correct Examinee’s Examinee’s Examinee’s Examinee’s Response Response: A Response: B Response: C Response: D Supervisors— 10-slide test

A B C D

10 5 5 0

0 10 0 −5

0 0 10 5

0 0 5 10

Cytotechnologists— 10-slide test

A B C D

10 5 5 0

0 10 0 −5

5 5 10 10

5 5 10 10

Supervisors— 20-slide test

A B C D

2 2.5 2.5 0

0 5 0 −10

0 0 5 2.5

0 0 2.5 5

Cytotechnologists— 20-slide test

A B C D

2 2.5 2.5 0

0 5 0 −10

2.5 2.5 5 5

2.5 2.5 5 5

Notes: A maximum of 10 points for a correct response and a maximum of minus five (−5) points for an incorrect response on a 10-slide test set is provided. For example, if the correct response on a slide is “high-grade squamous intraepithelial lesion” (category “D” on the scoring system chart) and an examinee calls it “normal or negative” (category B), then the examinee’s point value on that slide is calculated as minus five (−5). Each slide is scored individually in the same manner. The individual’s score for the testing event is determined by adding the point value achieved for each slide preparation, dividing by the total points for the testing event and multiplying by 100. On a 20-slide test set, maximums of five points for a correct response and minus ten (−10) points for an incorrect response is provided.

analyte or unsatisfactory testing event score, documented remedial action must be taken, and the documentation must be maintained by the laboratory for 2 years from the date of participation in the proficiency testing event. • Failure to achieve satisfactory performance for the same analyte in two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. • Failure to achieve an overall testing event score of satisfactory for two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. The general concept of QA, based on on-site inspections and meeting generic, external quality standards, as required in CLIA 88, was criticized © 2011 by Taylor and Francis Group, LLC

216


as inadequate and bringing sometimes unexpected results. It may happen that the laboratory, which passes inspection, does not ensure proper quality. This phenomenon has been raised by Ehrmeyer et al. [6], who gave an example of a failure in the auditing and inspection process: A 243-bed hospital has been a participant on all phases of the CLIA 88 auditing process for over 15 years, and was also “accredited with distinction” by CAP program. Nevertheless, the hospital laboratory was reporting over long period the results of the tests of vital importance (HIV and hepatitis) generated by a faulty system whose internal QA program has been signaling “out of control” status. Four hundred and sixty persons were affected. This status has been consciously ignored by hospital administration, and the analysts were forced by their supervisors to report test results despite of the warnings. The hospital administration failed to take any action despite events that signaled problems in the laboratory including complaints, lost contracts with external customers, occurrence reports, and an employee exposure to blood-borne HIV pathogens. A former laboratory employee, who forwarded a complaint to the state authorities, pinpointing the specific piece of faulty equipment, the specific tests where the problem was occurring, as well as the specific manipulations of the data, revealed all problems. It should be noted that the state inspectors had visited the lab some month before this complaint and sounded no alarms. However, the next inspection, performed afterward, found serious deficiencies and significant problems related to the operation and management of the laboratory. The whole story was reported in detail by the local press [7] and analyzed by the federal authorities [8]. From this example, it is clear that the delivery of quality test results, and not passing inspections, is a priority, which should be ensured in the legal way. According to Ehrmeyer et al., this may be done if auditing is a component of a continuous quality improvement system, promoted by the leadership. This approach is formulated by ISO 15289. However, if auditing is a fault-finding process leading to negative repercussions for all involved, it is unlikely to be effective. 8.2.2â•‡Regulations Issued by FDA FDA is without doubt the most central agency, responsible for issuance of guidances and recommendations related to quality assurance of various laboratory methods, also on the field of pathology and laboratory medicine. The role of FDA was stressed in the CLIA 88 law. It this document, FDA was named as responsible for qualification of waived and nonwaived methods, and for the complexity categorization of nonwaived tests. Most important FDA documents concern identification with laboratory methods [9], validation of



217

quantitative methods [2], use of electronic records and signatures [10,11], and requirements for waived tests [12]. 8.2.2.1 Identification Issues Guidelines and requirements concerning identification were discussed in detail in Chapter 3 (QA of identification with chromatographic—mass spectrometric methods). FDA documents concerning other issues will be presented in this section. 8.2.2.2 Quantitation and Method Validation Issues FDA during the last 20 years published series of documents on the validation of bioanalytical methods [13]. In the final stage, these documents were summarized as the official guidance for industry (2). Since the international bodies or organizations, like, e.g., The International Conference on Harmonisation (ICH) of Technical Requirements for Registration of Pharmaceuticals for Human Use did not cover all aspects of the analytical process, the guidelines formulated by FDA were used as the basis of in-house standard operating procedures (SOPs) and guidelines applied in pathology and laboratory medicine not only in the United States, but also in the whole world. The purpose of the guidance was to provide assistance in developing bioanalytical method validation information used in human clinical pharmacology, bioavailability, and bioequivalence studies requiring pharmacokinetic evaluation. This guidance also applies to bioanalytical methods used for nonhuman pharmacology/toxicology studies and preclinical studies as well. The information in the guidance generally applies to bioanalytical separation procedures such as gas chromatography (GC) or liquid chromatography (LC), usually combined with mass spectrometric detection such as LC-MS, LC-MS-MS, GC-MS, and GC-MS-MS performed for the quantitative determination of drugs and/or metabolites in biological matrices such as blood, serum, plasma, or urine. This guidance also applies to other bioanalytical methods, such as immunological and microbiological procedures, and to other biological matrices, such as tissue and skin samples. General recommendations for bioanalytical method validation were given, which can be adjusted or modified depending on the specific type of analytical method used. The fundamental parameters for this validation include accuracy, precision, selectivity, sensitivity, reproducibility, and stability. Validation involves documenting, through the use of specific laboratory investigations, that the performance characteristics of the method are suitable and reliable for the intended analytical applications. The acceptability of analytical data corresponds directly to the criteria used to validate the method.


218


Published methods of analysis are often modified to suit the requirements of the laboratory performing the assay. These modifications should be validated to ensure suitable performance of the analytical method. When changes are made to a previously validated method, the analyst should exercise judgment as to how much additional validation is needed. During the course of a typical drug development program, a defined bioanalytical method undergoes many modifications. The evolutionary changes to support specific studies and different levels of validation demonstrate the validity of an assay’s performance. Different types and levels of validation are defined and characterized as follows: Full validation is important when developing and implementing a bioanalytical method for the first time, when new drug entity is involved or if metabolites are added to an existing assay for quantification. Partial validations are modifications of already validated bioanalytical methods. Partial validation can range from one intra-assay accuracy and precision determination to a nearly full validation. Typical bioanalytical method changes that fall into this category include bioanalytical method transfers between laboratories or analysts, change in analytical methodology (e.g., change in detection systems, in instruments, and/or software platforms), change in matrix or anticoagulant, change in sample processing procedures, change in species within matrix (e.g., rat plasma to mouse plasma), change in relevant concentration range, or selectivity demonstration of an analyte in the presence of concomitant medications or specific metabolites. Cross-validation is a comparison of validation parameters when two or more bioanalytical methods are used to generate data within the same study or across different studies. An example of cross-validation would be a situation where an original validated bioanalytical method serves as the reference and the revised bioanalytical method is the comparator. The comparisons should be done both ways. Cross-validation should also be considered when data generated using different analytical techniques (e.g., LC-MS-MS vs. ELISA) in different studies are included in a regulatory submission. The analytical laboratory should have a written set of SOPs to ensure a complete system of quality control and assurance. The SOPs should cover all aspects of analysis from the time the sample is collected and reaches the laboratory until the results of the analysis are reported. The SOPs also should include record keeping, security and chain of sample custody, sample preparation, and analytical tools such as methods, reagents, equipment, instrumentation, and procedures for quality control (QC) and verification of results. The process by which a specific bioanalytical method is developed, validated, and used in routine sample analysis can be divided into the following:



219

• Reference standard preparation. • Bioanalytical method development and establishment of assay procedure. • Application of validated bioanalytical method to routine drug analysis and acceptance criteria for the analytical run and/or batch. These three processes were described in the following sections of the guidance. 8.2.2.2.1â•‡ Reference Standard Preparationâ•… Analysis of drugs and their metabolites in a biological matrix is carried out using samples spiked with calibration (reference) standards and using QC samples. An authenticated analytical reference standard of known identity and purity should be used to prepare solutions of known concentrations. If possible, the reference standard should be identical to the analyte. When this is not possible, an established chemical form (free base or acid, salt or ester) of known purity can be used. Three types of reference standards are usually used: certified reference standards, commercially supplied reference standards obtained from a reputable commercial source, or other materials of documented purity custom synthesized by an analytical laboratory or other noncommercial establishment. The source and lot number, expiration date, certificates of analyses when available, and/or internally or externally generated evidence of identity and purity should be furnished for each reference standard. 8.2.2.2.2â•‡ Bioanalytical Method Development: Chemical Assayâ•… The method development and establishment phase defines the chemical assay. Typical method development and establishment for a bioanalytical method include determination of selectivity, accuracy, precision, recovery, calibration curve, and stability of analyte in spiked samples. Selectivity is the ability of an analytical method to differentiate and quantify the analyte in the presence of other components in the sample. For selectivity, analyses of blank samples of the appropriate biological matrix should be obtained from at least six sources. Each blank sample should be tested for interference, and selectivity should be ensured at the lower limit of quantification (LLOQ). If the method is intended to quantify more than one analyte, each analyte should be tested to ensure that there is no interference. Accuracy of an analytical method describes the closeness of mean test results obtained by the method to the true value (concentration) of the analyte. Accuracy is determined by replicate analysis of samples containing known amounts of the analyte at a minimum of three concentrations in the range of expected concentrations using a minimum of five determinations per concentration. The mean value should be within 15% of the actual value


220


except at LLOQ, where it should not deviate by more than 20%. The deviation of the mean from the true value serves as the measure of accuracy. Precision of an analytical method describes the closeness of individual measures of an analyte when the procedure is applied repeatedly to multiple aliquots of a single homogeneous volume of biological matrix. Precision should be measured using a minimum of five determinations per concentration at a minimum of three concentrations in the range of expected concentrations. The precision determined at each concentration level should not exceed 15% of the coefficient of variation (CV) except for the LLOQ, where it should not exceed 20% of the CV. Precision is further subdivided into within-run and intra-batch precision or repeatability. Recovery of an analyte in an assay is the detector response obtained from an amount of the analyte added to and extracted from the biological matrix, compared to the detector response obtained for the true concentration of the pure authentic standard. Recovery pertains to the extraction efficiency of an analytical method within the limits of variability. The extent of recovery of an analyte and of the internal standard should be consistent, precise, and reproducible. Recovery experiments should be performed by comparing the analytical results for extracted samples at three concentrations (low, medium, and high) with not extracted standards that represent 100% recovery. Calibration (standard) curve is the relationship between instrument response and known concentrations of the analyte. A calibration curve should be prepared in the same biological matrix as the samples in the intended study. Concentrations of standards should be chosen on the basis of the concentration range expected in a particular study. A calibration curve should consist of a blank sample (matrix sample processed without internal standard), a zero sample (matrix sample processed with internal standard), and six to eight nonzero samples covering the expected range, including LLOQ. 8.2.2.2.2.1â•‡ Lower Limit of Quantificationâ•… The lowest standard on the calibration curve should be accepted as the limit of quantification if the following conditions are met: The analyte response at the LLOQ should be at least five times the response compared to blank response and should be reproducible with a precision of 20% and accuracy of 80%–120%. 8.2.2.2.2.2â•‡ Calibration Curve/Standard Curve/Concentration-Responseâ•… The following conditions should be met in developing a calibration curve: ±20% deviation of the LLOQ from nominal concentration and ±15% deviation of standards other than LLOQ from nominal concentration. At least four out of six nonzero standards should meet the above criteria, including the LLOQ and the calibration standard at the highest concentration. Stability of an analyte in a particular matrix and container system is relevant only to that matrix and container system and should not be extrapolated © 2011 by Taylor and Francis Group, LLC


221

to other matrices and container systems. Stability procedures should evaluate the stability of the analytes during sample collection and handling, after longterm (frozen at the intended storage temperature) and short-term (benchtop, room temperature) storage, and after going through freeze and thaw cycles and the analytical process. Conditions used in stability experiments should reflect situations likely to be encountered during actual sample handling and analysis. The procedure should also include an evaluation of analyte stability in stock solution. All stability determinations should use a set of samples prepared from a freshly made stock solution of the analyte in the appropriate analytefree, interference-free biological matrix. Stock solutions of the analyte for stability evaluation should be prepared in an appropriate solvent at known concentrations. 8.2.2.2.2.3â•‡ Freeze and Thaw Stabilityâ•… Analyte stability should be determined after three freeze and thaw cycles, using, at least, three aliquots at each of the low and high concentrations. The samples should be thawed unassisted at room temperature. When completely thawed, the samples should be refrozen for 12–24â•›h under the same conditions. The freeze– thaw cycle should be repeated two more times and then analyzed on the third cycle. If an analyte is unstable at the intended storage temperature, the stability sample should be frozen at −70°C during the three freeze and thaw cycles. 8.2.2.2.2.4â•‡ Short-Term Temperature Stabilityâ•… Three aliquots of each of the low and high concentrations should be thawed at room temperature and kept at this temperature from 4 to 24â•›h (based on the expected duration that samples will be maintained at room temperature in the intended study) and analyzed. 8.2.2.2.2.5â•‡ Long-Term Stabilityâ•… The storage time in a long-term stability evaluation should exceed the time between the date of first sample collection and the date of last sample analysis. Long-term stability should be determined by storing at least three aliquots of each of the low and high concentrations under the same conditions as the study samples. The concentrations of all the stability samples should be compared to the mean of back-calculated values for the standards at the appropriate concentrations from the first day of longterm stability testing. 8.2.2.2.2.6â•‡ Stock Solution Stabilityâ•… The stability of stock solutions of drug and the internal standard should be evaluated at room temperature for at least 6â•›h. If the stock solutions are refrigerated or frozen for the relevant period, the stability should be documented after completion of the desired storage time, the stability should be tested by comparing the instrument response with that of freshly prepared solutions. © 2011 by Taylor and Francis Group, LLC

222


8.2.2.2.2.7â•‡ Post-Preparative Stabilityâ•… The stability of processed samples, including the resident time in the autosampler, should be determined. The stability of the drug and the internal standard should be assessed over the anticipated run time for the batch size in validation samples by determining concentrations on the basis of original calibration standards. 8.2.2.2.3â•‡ Bioanalytical Method Development: Microbiological and Ligand-Binding Assayâ•… Many of the bioanalytical validation parameters and principles discussed above are also applicable to microbiological and ligand-binding assays (LBAs). However, these assays possess some unique characteristics that should be considered during method validation. 8.2.2.2.3.1â•‡ Selectivity Issuesâ•… As with chromatographic methods, microbiological and LBAs should be shown to be selective for the analyte. The following recommendations for dealing with two selectivity issues should be considered: 8.2.2.2.3.2â•‡ Interference from Substances Physicochemically Similar to the Analyteâ•… Cross-reactivity of metabolites, concomitant medications, or endogenous compounds should be evaluated individually and in combination with the analyte of interest. When possible, the immunoassay should be compared with a validated reference method (such as LC-MS) using incurred samples and predetermined criteria for agreement of accuracy of immunoassay and reference method. The dilutional linearity to the reference standard should be assessed using study (incurred) samples. Selectivity may be improved for some analytes by incorporation of separation steps prior to immunoassay. 8.2.2.2.3.3â•‡ Matrix Effects Unrelated to the Analyteâ•… The standard curve in biological fluids should be compared with standard curve in buffer to detect matrix effects. Parallelism of diluted study samples should be evaluated with diluted standards to detect matrix effects. Nonspecific binding should be determined. 8.2.2.2.3.4â•‡ Quantification Issuesâ•… Microbiological and immunoassay standard curves are inherently nonlinear and, in general, more concentration points may be recommended to define the fit over the standard curve range than for chemical assays. A minimum of six nonzero calibrator © 2011 by Taylor and Francis Group, LLC


223

concentrations, run in duplicate, is recommended. The concentration– response relationship is most often fitted to a four- or five-parameter logistic model, although others may be used with suitable validation. The use of anchoring points in the asymptotic high- and low-concentration ends of the standard curve may improve the overall curve fit. Generally, these anchoring points will be at concentrations that are below the established LLOQ and above the established upper limit of quantitation (ULOQ). Whenever possible, calibrators should be prepared in the same matrix as the study samples or in an alternate matrix of equivalent performance. Both ULOQ and LLOQ should be defined by acceptable accuracy, precision, or confidence interval criteria based on the study requirements. For all assays, the key factor is the accuracy of the reported results. This accuracy can be improved by the use of replicate samples. In the case where replicate samples should be measured during the validation to improve accuracy, the same procedure should be followed as for unknown samples. The following recommendations apply to quantification issues: • If separation is used prior to assay for study samples but not for standards, it is important to establish recovery and use it in determining results. • Key reagents, such as antibody, tracer, reference standard, and matrix should be characterized appropriately and stored under defined conditions. • Assessments of analyte stability should be conducted in true study matrix (e.g., should not use a matrix stripped to remove endogenous interferences). • Acceptance criteria: At least 67% (four out of six) of QC samples should be within 15% of their respective nominal value, 33% of the QC samples (not all replicates at the same concentration) may be outside 15% of nominal value. In certain situations, wider acceptance criteria may be justified. Assay reoptimization or validation should be done when there are changes in key reagents, like labeled analyte (tracer), antibody, and matrix. Method development experiments should include a minimum of six runs conducted over several days, with at least four concentrations (LLOQ, low, medium, and high) analyzed in duplicate in each run. 8.2.2.2.4â•‡ Application of Validated Method to Routine Drug Assaysâ•… Assays of all samples of an analyte in a biological matrix should be completed within the time period for which stability data are available. In general, biological samples can be analyzed with a single determination without duplicate or replicate analysis if the assay method has acceptable © 2011 by Taylor and Francis Group, LLC

224


variability as defined by validation data. This is true for procedures where precision and accuracy variabilities routinely fall within acceptable tolerance limits. For a difficult procedure with a labile analyte where high precision and accuracy specifications may be difficult to achieve, duplicate or even triplicate analyses can be performed for a better estimate of analyte. A calibration curve should be generated for each analyte to assay samples in each analytical run and should be used to calculate the concentration of the analyte in the unknown samples in the run. The spiked samples can contain more than one analyte. An analytical run can consist of QC samples, calibration standards, and either all the processed samples to be analyzed as one batch or a batch composed of processed unknown samples of one or more volunteers in a study. The calibration (standard) curve should cover the expected unknown sample concentration range in addition to a calibrator sample at LLOQ. Estimation of concentration in unknown samples by extrapolation of standard curves below LLOQ or above the highest standard is not recommended. Instead, the standard curve should be redefined or samples with higher concentration should be diluted and reassayed. It is preferable to analyze all study samples from a subject in a single run. Once the analytical method has been validated for routine use, its accuracy and precision should be monitored regularly to ensure that the method continues to perform satisfactorily. To achieve this objective, a number of QC samples prepared separately and representing lower, middle, and higher concentration range should be analyzed with processed test samples at intervals based on the total number of samples. At least four of every six QC samples should be within ±15% of their respective nominal value. The results of the QC samples provide the basis of accepting or rejecting the run. Based on the analyte and technique, a specific SOP (or sample) should be identified to ensure optimum operation of the system used. It is important to establish an SOP or guideline for repeat analysis and acceptance criteria. This SOP or guideline should explain the reasons for repeating sample analysis. Reasons for repeat analyses could include repeat analysis of clinical or preclinical samples for regulatory purposes, inconsistent replicate analysis, samples outside of the assay range, sample processing errors, equipment failure, poor chromatography, and inconsistent pharmacokinetic data. Reassays should be done in triplicate if sample volume allows. The rationale for the repeat analysis and the reporting of the repeat analysis should be clearly documented. The following acceptance criteria should be considered for accepting the analytical run: • Standards and QC samples can be prepared from the same verified spiking stock solution or verified matrix. • Standard curve samples, blanks, QCs, and study samples can be arranged as considered appropriate within the run. © 2011 by Taylor and Francis Group, LLC


225

• Matrix-based standard calibration samples should meet the criteria formulated above. • Acceptance criteria for accuracy and precision of QC samples should correspond to those outlined above. • Samples involving multiple analytes should not be rejected based on the data from one analyte failing the acceptance criteria. • The data from rejected runs need not be documented, but the fact that a run was rejected and the reason for failure should be recorded. 8.2.2.2.4.1â•‡ Documentationâ•… The validity of an analytical method should be established and verified by laboratory studies, and documentation of successful completion of such studies should be provided in the assay validation report. General and specific SOPs and good record keeping are an essential part of a validated analytical method. The data generated for bioanalytical method establishment and the QCs should be documented and available for data audit and inspection. Documentation for submission to the agency should include summary information, method development and establishment, bioanalytical reports of the application of any methods to routine sample analysis, and other information applicable to method development and establishment, and/or to routine sample analysis. Summary information should include • Summary table of validation reports, including analytical method validation, partial revalidation, and cross-validation reports. The table should be in chronological sequence, and include assay method identification code, type of assay, and the reason for the new method or additional validation (e.g., to lower the limit of quantitation). • Summary table with a list, by protocol, of assay methods used. The protocol number, protocol title, assay type, assay method identification code, and report code should be provided. • A summary table allowing cross-referencing of multiple identification codes should be provided (e.g., when an assay has different codes for the assay method, validation reports, and bioanalytical reports, especially when the sponsor and a contract laboratory assign different codes). Documentation for method development and establishment should include • An operational description of the analytical method • Evidence of purity and identity of drug standards, metabolite standards, and internal standards used in validation experiments • A description of stability studies and supporting data © 2011 by Taylor and Francis Group, LLC

226


• A description of experiments conducted to determine accuracy, precision, recovery, selectivity, limit of quantification, calibration curve (equations and weighting functions used, if any), and relevant data obtained from these studies • Documentation of intra- and inter-assay precision and accuracy • Information about cross-validation study data, if applicable • Legible annotated chromatograms or mass spectrograms, if applicable • Any deviations from SOPs, protocols, or good laboratory practices (GLPs) (if applicable), and justifications for deviations Documentation of the application of validated bioanalytical methods to routine drug analysis should include • Evidence of purity and identity of drug standards, metabolite standards, and internal standards used during routine analyses. • Summary tables containing information on sample processing and storage. Tables should include sample identification, collection dates, storage prior to shipment, information on shipment batch, and storage prior to analysis. Information should include dates, times, sample condition, and any deviation from protocols. • Summary tables of analytical runs of clinical or preclinical samples. Information should include assay run identification, date and time of analysis, assay method, analysts, start and stop times, duration, significant equipment and material changes, and any potential issues or deviation from the established method. • Equations used for back-calculation of results. • Tables of calibration curve data used in analyzing samples and calibration curve summary data. • Summary information on intra- and inter-assay values of QC samples and data on intra- and inter-assay accuracy and precision from calibration curves and QC samples used for accepting the analytical run. QC graphs and trend analyses in addition to raw data and summary statistics are encouraged. • Data tables from analytical runs of clinical or preclinical samples. Tables should include assay run identification, sample identification, raw data and back-calculated results, integration codes, and/or other reporting codes. • Complete serial chromatograms from 5% to 20% of subjects, with standards and QC samples from those analytical runs. For pivotal bioequivalence studies for marketing, chromatograms from 20% of serially selected subjects should be included. In other studies, chromatograms from 5% of randomly selected subjects in each study © 2011 by Taylor and Francis Group, LLC


• •

•

•

227

should be included. Subjects whose chromatograms are to be submitted should be defined prior to the analysis of any clinical samples. Reasons for missing samples. Documentation for repeat analyses. Documentation should include the initial and repeat analysis results, the reported result, assay run identification, the reason for the repeat analysis, the requestor of the repeat analysis, and the manager authorizing reanalysis. Repeat analysis of a clinical or preclinical sample should be performed only under a predefined SOP. Documentation for reintegrated data. Documentation should include the initial and repeat integration results, the method used for reintegration, the reported result, assay run identification, the reason for the reintegration, the requestor of the reintegration, and the manager authorizing reintegration. Reintegration of a clinical or preclinical sample should be performed only under a predefined SOP. Deviations from the analysis protocol or SOP, with reasons and justifications for the deviations.

Other information applicable to both method development and establishment, and/or to routine sample analysis could include the following: • Lists of abbreviations and any additional codes used, including sample condition codes, integration codes, and reporting codes • Reference lists and legible copies of any references • SOPs or protocols covering the following areas: Calibration standard acceptance or rejection criteria, calibration curve acceptance or rejection criteria, quality control sample and assay run acceptance or rejection criteria, acceptance criteria for reported values when all unknown samples are assayed in duplicate, sample code designations, including clinical or preclinical sample codes and bioassay sample code, assignment of clinical or preclinical samples to assay batches, sample collection, processing, and storage, repeat analyses of samples, and reintegration of samples 8.2.2.3 Validation of Electronic Records and Signatures The standpoint of FDA on the applicability of electronic records and signatures in all FDA-regulated industries (e.g., drug or medical device manufacturers, biotech companies, or biologics developers) was formulated in the Title 21 CFR Part 11 of the Code of Federal Regulations in 1997 (10). The intention of the agency was to permit the widest possible use of electronic technology in all FDA-controlled areas. This rule applies to paper records required by the agency regulations by providing that electronic ones may replace each such paper record, under defined criteria. © 2011 by Taylor and Francis Group, LLC

228


The entire, original text of the 21 CFR Part 11 Final Rule is as follows: Part 11—Electronic Records; Electronic Signatures Subpart A—General Provisions 11.1 Scope 11.2 Implementation 11.3 Definitions Subpart B—Electronic Records 11.10 Controls for closed systems 11.30 Controls for open systems 11.50 Signature manifestations 11.70 Signature/record linking Subpart C—Electronic Signatures 11.100 General requirements 11.200 Electronic signature components and controls 11.300 Controls for identification codes/passwords Authority: Secs. 201–903 of the Federal Food, Drug, and Cosmetic Act (21 U.S.C. 321–393); sec. 351 of the Public Health Service Act (42 U.S.C. 262). Subpart A—General Provisions § 11.1 Scope (a) The regulations in this part set forth the criteria under which the agency considers electronic records, electronic signatures, and handwritten signatures executed to electronic records to be trustworthy, reliable, and generally equivalent to paper records and handwritten signatures executed on paper. (b) This part applies to records in electronic form that are created, modified, maintained, archived, retrieved, or transmitted, under any records requirements set forth in agency regulations. This part also applies to electronic records submitted to the agency under requirements of the Federal Food, Drug, and Cosmetic Act and the Public Health Service Act, even if such records are not specifically identified in agency regulations. However, this part does not apply to paper records that are, or have been, transmitted by electronic means. (c) Where electronic signatures and their associated electronic records meet the requirements of this part, the agency will consider the electronic signatures to be equivalent to full handwritten signatures, initials, and other general signings as required by agency regulations, unless specifically excepted by regulation(s) effective on or after Federal Register/Vol. 62, No. 54/Thursday, March 20, 1997/Rules and Regulations 13465 August 20, 1997. © 2011 by Taylor and Francis Group, LLC


229

(d) Electronic records that meet the requirements of this part may be used in lieu of paper records, in accordance with § 11.2, unless paper records are specifically required. (e) Computer systems (including hardware and software), controls, and attendant documentation maintained under this part shall be readily available for, and subject to, FDA inspection. § 11.2 Implementation (a) For records required to be maintained but not submitted to the agency, persons may use electronic records in lieu of paper records or electronic signatures in lieu of traditional signatures, in whole or in part, provided that the requirements of this part are met. (b) For records submitted to the agency, persons may use electronic records in lieu of paper records or electronic signatures in lieu of traditional signatures, in whole or in part, provided that (1) The requirements of this part are met. (2) The document or parts of a document to be submitted have been identified in public docket No. 92S–0251 as being the type of submission the agency accepts in electronic form. This docket will identify specifically what types of documents or parts of documents are acceptable for submission in electronic form without paper records and the agency receiving unit(s) (e.g., specific center, office, division, branch) to which such submissions may be made. Documents to agency receiving unit(s) not specified in the public docket will not be considered as official if they are submitted in electronic form; paper forms of such documents will be considered as official and must accompany any electronic records. Persons are expected to consult with the intended agency receiving unit for details on how (e.g., method of transmission, media, file formats, and technical protocols) and whether to proceed with the electronic submission. § 11.3 Definitions (a) The definitions and interpretations of terms contained in section 201 of the act apply to those terms when used in this part. (b) The following definitions of terms also apply to this part: (1) Act means the Federal Food, Drug, and Cosmetic Act (secs. 201–903 (21 U.S.C. 321–393)). (2) Agency means the Food and Drug Administration. (3) Biometrics means a method of verifying an individual’s identity based on measurement of the individual’s physical feature(s) or © 2011 by Taylor and Francis Group, LLC

230


(4)

(5)

(6)

(7)

(8)

(9)

repeatable action(s) where those features and/or actions are both unique to that individual and measurable. Closed system means an environment in which system access is controlled by persons who are responsible for the content of electronic records that are on the system. Digital signature means an electronic signature based upon cryptographic methods of originator authentication, computed by using a set of rules and a set of parameters such that the identity of the signer and the integrity of the data can be verified. Electronic record means any combination of text, graphics, data, audio, pictorial, or other information representation in digital form that is created, modified, maintained, archived, retrieved, or distributed by a computer system. Electronic signature means a computer data compilation of any symbol or series of symbols executed, adopted, or authorized by an individual to be the legally binding equivalent of the individual’s handwritten signature. Handwritten signature means the scripted name or legal mark of an individual handwritten by that individual and executed or adopted with the present intention to authenticate a writing in a permanent form. The act of signing with a writing or marking instrument such as a pen or stylus is preserved. The scripted name or legal mark, while conventionally applied to paper, may also be applied to other devices that capture the name or mark. Open system means an environment in which system access is not controlled by persons who are responsible for the content of electronic records that are on the system.

Subpart B—Electronic Records § 11.10 Controls for closed systems Persons who use closed systems to create, modify, maintain, or transmit electronic records shall employ procedures and controls designed to ensure the authenticity, integrity, and, when appropriate, the confidentiality of electronic records, and to ensure that the signer cannot readily repudiate the signed record as not genuine. Such procedures and controls shall include the following: (a) Validation of systems to ensure accuracy, reliability, consistent intended performance, and the ability to discern invalid or altered records. (b) The ability to generate accurate and complete copies of records in both human readable and electronic form suitable for inspection,



231

review, and copying by the agency. Persons should contact the agency if there are any questions regarding the ability of the agency to perform such review and copying of the electronic records. (c) Protection of records to enable their accurate and ready retrieval throughout the records retention period. (d) Limiting system access to authorized individuals. (e) Use of secure, computer-generated, time-stamped audit trails to independently record the date and time of operator entries and actions that create, modify, or delete electronic records. Record changes shall not obscure previously recorded information. Such audit trail documentation shall be retained for a period at least as long as that required for the subject electronic records and shall be available for agency review and copying. (f) Use of operational system checks to enforce permitted sequencing of steps and events, as appropriate. (g) Use of authority checks to ensure that only authorized individuals can use the system, electronically sign a record, access the operation or computer system input or output device, alter a record, or perform the operation at hand. (h) Use of device (e.g., terminal) checks to determine, as appropriate, the validity of the source of data input or operational instruction. (i) Determination that persons who develop, maintain, or use electronic record/electronic signature systems have the education, training, and experience to perform their assigned tasks. (j) The establishment of, and adherence to, written policies that hold individuals accountable and responsible for actions initiated under their electronic signatures, in order to deter record and signature falsification. (k) Use of appropriate controls over systems documentation, including (1) Adequate controls over the distribution of, access to, and use of documentation for system operation and maintenance. (2) Revision and change control procedures to maintain an audit trail that documents time-sequenced development and modification of systems documentation. § 11.30 Controls for open systems Persons who use open systems to create, modify, maintain, or transmit electronic records shall employ procedures and controls designed to 13466 Federal Register/Vol. 62, No. 54/Thursday, March 20, 1997/Rules and Regulations ensure the authenticity, integrity, and, as appropriate, the confidentiality of electronic records from the point of their creation to the point of their receipt. Such procedures and controls shall include those identified in § 11.10,


232


as appropriate, and additional measures such as document encryption and use of appropriate digital signature standards to ensure, as necessary under the circumstances, record authenticity, integrity, and confidentiality. § 11.50 Signature manifestations (a) Signed electronic records shall contain information associated with the signing that clearly indicates all of the following: (1) The printed name of the signer (2) The date and time when the signature was executed (3) The meaning (such as review, approval, responsibility, or authorship) associated with the signature (b) The items identified in paragraphs (a)(1), (a)(2), and (a)(3) of this section shall be subject to the same controls as for electronic records and shall be included as part of any human readable form of the electronic record (such as electronic display or printout) § 11.70 Signature/record linking Electronic signatures and handwritten signatures executed to electronic records shall be linked to their respective electronic records to ensure that the signatures cannot be excised, copied, or otherwise transferred to falsify an electronic record by ordinary means. Subpart C—Electronic Signatures § 11.100 General requirements (a) Each electronic signature shall be unique to one individual and shall not be reused by, or reassigned to, anyone else. (b) Before an organization establishes, assigns, certifies, or otherwise sanctions an individual’s electronic signature, or any element of such electronic signature, the organization shall verify the identity of the individual. (c) Persons using electronic signatures shall, prior to or at the time of such use, certify to the agency that the electronic signatures in their system, used on or after August 20, 1997, are intended to be the legally binding equivalent of traditional handwritten signatures. (1) The certification shall be submitted in paper form and signed with a traditional handwritten signature to the Office of Regional Operations (HFC–100), 5600 Fishers Lane, Rockville, MD 20857. (2) Persons using electronic signatures shall, upon agency request, provide additional certification or testimony that a specific electronic signature is the legally binding equivalent of the signer’s handwritten signature. © 2011 by Taylor and Francis Group, LLC


233

§ 11.200 Electronic signature components and controls (a) Electronic signatures that are not based on biometrics shall (1) Employ at least two distinct identification components such as an identification code and password. (i) When an individual executes a series of signings during a single, continuous period of controlled system access, the first signing shall be executed using all electronic signature components; subsequent signings shall be executed using at least one electronic signature component that is only executable by, and designed to be used only by, the individual. (ii) When an individual executes one or more signings not performed during a single, continuous period of controlled system access, each signing shall be executed using all of the electronic signature components. (2) Be used only by their genuine owners. (3) Be administered and executed to ensure that attempted use of an individual’s electronic signature by anyone other than its genuine owner requires collaboration of two or more individuals. (b) Electronic signatures based upon biometrics shall be designed to ensure that they cannot be used by anyone other than their genuine owners. § 11.300 Controls for identification codes/passwords Persons who use electronic signatures based upon use of identification codes in combination with passwords shall employ controls to ensure their security and integrity. Such controls shall include the following: (a) Maintaining the uniqueness of each combined identification code and password, such that no two individuals have the same combination of identification code and password. (b) Ensuring that identification code and password issuances are periodically checked, recalled, or revised (e.g., to cover such events as password aging). (c) Following loss management procedures to electronically deauthorize lost, stolen, missing, or otherwise potentially compromised tokens, cards, and other devices that bear or generate identification code or password information, and to issue temporary or permanent replacements using suitable, rigorous controls. (d) Use of transaction safeguards to prevent unauthorized use of passwords and/or identification codes, and to detect and report in an immediate and urgent manner any attempts at their unauthorized use to the system security unit, and, as appropriate, to organizational management. © 2011 by Taylor and Francis Group, LLC

234


(e) Initial and periodic testing of devices, such as tokens or cards, that bear or generate identification code or password information to ensure that they function properly and have not been altered in an unauthorized manner. Dated: March 11, 1997. William B. Schultz, Deputy Commissioner for Policy. [FR Doc. 97–6833 Filed 3–20–97; 8:45 am] Together with the rule itself, in the 21 CFR Part 11 the FDA presents 49 comments on several aspects of the proposed rule, as well as the response of the agency. The response was formulated in 138 points. Some selected comments and agency standpoints are presented as follows: Some comments addressed whether the agency’s policy on electronic records and signatures should be issued as a regulation or recommendation/ guideline. FDA has concluded that regulation (Final Rule) is necessary to establish uniform and enforceable standard in this area. One comment asked whether paper records created by the computer would be subject to Part 11. The comment cited, as an example, the situation in which a computer system collects toxicology data that are printed out as “raw data.” In the response, the agency noted that specific requirements in existing regulations might affect the particular records at issue. Part 11 is not intended to apply to computer systems that are merely incidental to the creation of paper records (i.e., the use of word processing software). In such cases, the computer systems function essentially like manual typewriters or pens, and any signatures would be traditional handwritten signatures. Similar comment raised the question whether a signature that is first handwritten and then captured electronically (e.g., by scanning) is an electronic or handwritten signature. FDA advised that when the act of signing with a pen or stylus is preserved, the result is a handwritten signature. The word “signature” should not be limited to paper technology. The agency disagreed with the comment, suggesting replacing “electronic signature” with “electronic identification” or “electronic authorization.” In the view of the agency, the use of the word “signature” stresses the equivalence and significance of various electronic technologies with the traditional handwritten signature. Several comments objected to the planned inspectional authority of the FDA, regarding it as too broad and potentially detrimental to sensitive information. However, the agency advised that the inspections planned under Part 11 are subject to the same legal limitations as FDA inspections under other regulations. The agency responded that it would not routinely seek to inspect especially sensitive information, such as passwords or private keys, © 2011 by Taylor and Francis Group, LLC


235

nevertheless reserves the right to conduct the inspections, consistent with statutory limitations. The persons involved may change their passwords and private keys after FDA inspection. One comment argued that the validation of commercially available software is not necessary because such software has already been thoroughly validated. The agency disagreed and indicated that commercial availability is no guarantee of “thorough validation.” The need of validation of such software is not diminished by the fact that it was not written by prospective users. Many comments objected to the requirement that FDA should be provided with electronic copies of electronic records for inspection and proposed to provide FDA with readable paper copies. The agency disagreed and stressed that FDA should be able to conduct audits efficiently and thoroughly using the same technology. In 2003, FDA published nonbinding recommendation presenting the current thinking regarding the scope and application of 21 CFR Part 11 [11]. This document was intended as a guidance, which should be viewed only as recommendation, unless specific regulatory requirements are cited. The reason of the guidance was the concern, raised by a number or users, who saw the 21 CFR Part 11 requirements as unnecessarily restrictive, causing excessive costs, and discouraging innovation and technological advances. As a result of these concerns, the agency decided to review the Part 11 documents in anticipation to revise provisions of that regulation. It was announced that a new, revised Part 11 would be released in 2006. This, however, did not happen until now. The FDA representative stated publicly that the timetable for release is “flexible” [14]. Therefore, Part 11 remains in effect until reexamined. The recommendation of 2003 stressed that Part 11 rule is applicable only if the records in electronic format are used in place of paper format. On the other hand, when persons used computers to generate paper printouts of electronic records, and those paper records meet all requirements of the applicable predicate rules, the use of computer systems in the generation of paper records would not trigger Part 11. FDA defines electronic records as such, which are maintained in electronic format in place of paper format. On the other hand, records or signatures that are not required to be retained electronically, but are nonetheless maintained in electronic format, are not Part 11 records. The decision, whether specific records are Part 11 records, was left to the user, who should document such decision. 8.2.2.4 Quality Assurance of Waived Tests and Diagnostic Devices In the CLIA 88, waived tests were defined as test system, assay, or examination that HHS has determined meets the CLIA criteria as specified for waiver [1]. © 2011 by Taylor and Francis Group, LLC

236


Waived tests should meet specific criteria as follows: • Should be cleared by FDA for home use • Should employ methodologies so simple and accurate as to render the likelihood of erroneous results negligible • Pose no reasonable risk of harm if the test is performed incorrectly The examples of such tests are dipstick or tablet reagent for urinalysis, urine pregnancy test, blood glucose monitoring devices, among others. Since the secretary of HSS has delegated to FDA the authority to determine whether particular tests are “simple” and have “an insignificant risk of an erroneous result,” FDA issued in 2008 recommendations for manufacturers of in vitro diagnostic devices, which submit waiver applications to this agency [12]. The following components were recommended to include in a CLIA waiver application: • A description of device that demonstrates it is simple to use • The results of risk analysis including the identification of potential sources of error for the device • The results of studies demonstrating insensitivity of the test system to environmental and usage variations under conditions of stress • The results of risk evaluation and control including a description of measures implemented to mitigate the risk of errors, and validation and/or verification studies demonstrating the ability of failure alert, fail-safe mechanisms, and other control measures incorporated into device to mitigate the risk of errors, even under conditions of stress • A description of the design and results of clinical studies conducted to demonstrate that the device has an insignificant risk of erroneous result in the hands of the intended user • Proposed labeling with instructions for use consistent with a device that is “simple” FDA defined following characteristics of a “simple test”: Is a fully automated instrument or a unitized or self-contained test; uses direct unprocessed specimens, such as capillary blood (fingerstick), venous whole blood, nasal swabs, throat swabs, or urine; needs only basic, non-technique-dependent specimen manipulation, including any for decontamination; needs only basic, non-technique-dependent reagent manipulation, such as “mix reagent A and reagent B”; needs no operator intervention during the analysis steps; needs no technical or specialized training with respect to troubleshooting or interpretation of multiple or complex error codes; needs no electronic or mechanical maintenance beyond simple tasks, e.g., changing a battery or © 2011 by Taylor and Francis Group, LLC


237

power cord; produces results that require no operator calibration, interpretation, or calculation; produces results that are easy to determine, such as “positive” or “negative,” a direct readout of numerical values, the clear presence or absence of a line, or obvious color gradations; provides instructions in the package insert for obtaining and shipping specimens for confirmation testing in cases where such testing is clinically advisable. A “simple test” should not have the following characteristics: • Sample manipulation is required to perform the assay. Sample manipulation includes processes such as centrifugation, complex mixing steps, or evaluation of the sample by the operator for conditions such as hemolysis or lipemia. For this reason, tests that use plasma or serum are not considered simple. • Measurement of an analyte could be affected by conditions such as sample turbidity or cell lysis. • Meets the qualifications to perform moderate- or high-complexity testing. Besides demonstration of simplicity, the waiver application should demonstrate insignificant risk of an erroneous result. Generally, the risk of an erroneous result should be far less for waived tests than nonwaived tests. It should be demonstrated in CLIA waiver application that the test system design is robust, e.g., insensitive to environmental and usage variation, and that all known sources of error are effectively controlled. Most risk control measures should be fail-safe measures or failure alert mechanisms. Whenever feasible, external control materials should be included in the test kit. External control materials for waived tests should be ready to use or employ only very simple preparation steps, e.g., breaking a vial in order to mix liquid and dry components of the control material. Reconstitution steps should not require pipetting by the user. For both quantitative and qualitative tests, the levels of the control materials should correspond to the medical decision level(s) relevant to the indications for use for the test. The waived test should deliver accurate results, i.e., comparable to tests whose results of measurements are traceable to designated references of higher order, usually national or international standards. The clinical studies to support CLIA waiver should compare results obtained with the device proposed for CLIA waiver to results obtained by a comparative method, performed in a laboratory setting by laboratory professionals. According to Rauch and Nichols [15], the use of waived tests creates serious concern from the quality point of view. There is an increasing fraction of laboratories offering only waived tests, usually as physician office laboratories. These facilities are only occasionally subject to random control. Such random inspections performed in eight states have found numerous © 2011 by Taylor and Francis Group, LLC

238


deficiencies, like laboratory did not have or follow manufacturer’s instructions, the maintenance or function checks were not performed, expired reagents were used, testing personnel were not trained or evaluated, and sometimes the lab performed testing beyond its certificate level. In conclusion, it was stated that the labs performing waived tests should be subject to routine regulatory oversight. 8.2.3â•‡Regulation Issued by Substance Abuse and Mental Health Administration Workplace drug testing (WDT) is a complex, multifaceted procedure of great social importance. It was established to achieve certain benefits and to fulfill legal obligations as well. The expected benefits of WDT are decreased absenteeism, improved safety, enhanced professional efficiency, lower workplace costs, and increased public trust. Drug testing was also organized in order to comply with national regulations, with contract or insurance carrier requirements, or to establish ground for discipline firing of the employee. However, WDT brings also some intrinsic dangers, like creating an inquisitive and invigilatory atmosphere in the workplace, stigmatization and mobbing in the case of unconfirmed publicized positive test result, or even ruining somebody’s private life and professional career in the case of false positive result. For this reason, all aspects of WDT have to be subjected to very strict QA and QC. The legal history of WDT in United States begun in 1986, when President Reagan issued Executive Order 12564, establishing the goal for a drug-free federal workplace [16]. In this document, it has been stated that The Federal government, as the largest employer in the Nation, can and should show the way towards achieving drug-free workplaces through a program designed to offer drug users a helping hand and, at the same time, demonstrating to drug users and potential drug users that drugs will not be tolerated in the Federal workplace.

The use of illegal drugs, on or off duty, by Federal employees was inconsistent not only with the law-abiding behavior expected of all citizens but also with the special trust placed in such employees as servants of the public: Further, the order stated that drug consumers tend to be less productive, less reliable, and prone to greater absenteeism than their fellow employees who do not use illegal drugs. The use of illegal drugs, on or off duty, by Federal employees also can pose a serious health and safety threat to members of the public and to other employees, and may pose a serious risk to national security, the public safety, and the effective enforcement of the law. The head of each executive agency was obliged to establish a program to mandatory test for the use of illegal drugs by employees in sensitive positions as well as a program for voluntary employee drug testing. In addition, the head of each executive © 2011 by Taylor and Francis Group, LLC


239

agency was authorized to test an employee for illegal drug use in the case of reasonable suspicion of drug use, or other defined circumstances. In response to the executive order, HHS, acting through responsible agency Substance Abuse and Mental Health Services Administration (SAMSHA), issued in 1988 first mandatory guidelines for federal workplace drug testing programs. These guidelines were revised in 1994, 1997, and in 2004. In the last document, not only the guidelines but also several revisions were proposed, concerning expanding of the specimen list and drug list as well [17]. In November 2008, SAMSHA announced final revisions, taking into account proposals formulated in 2004 guidelines [18]. The whole procedure of WDT, as presented in the guidelines, was divided into several sections: • General: Applicability, definitions, future revisions • Scientific and technical requirements (specimen collection, laboratory personnel, procedures, QA and QC, reporting, protection of records) • Certification of laboratories engaged in urine drug testing for federal agencies • Procedures for review of suspension of proposed revocation of a certified laboratory The most relevant aspects of WDT will be presented below. 8.2.3.1 Specimen Kind and Collection Under the term “specimen” or “sample,” only urine specimens are defined as suitable for drug testing. In the proposed revisions to mandatory guidelines [17], HHS proposed to establish scientific and technical guidelines for the testing of hair, sweat, and oral fluid specimens in addition to urine specimens. Detailed technical procedures concerning sampling, validity, and cutoff levels in all specimens were formulated. However, in the final revision, announced November 24, 2008 [18], HHS took a more cautious approach than the 2004 proposals, regarding the use of alternative specimens. It was stated that further study and analysis is needed before the addition of alternative specimens to the WDT program. The collection procedure is under the responsibility of collector—a trained individual, who instructs and assists a donor and receives the urine specimen. Training documentation of the collector must be maintained for a minimum of 2 years. The collector must not have any personal or direct professional relationship with the donor. The collection site must be secure to prevent unauthorized access to specimens, supplies, and records. The entire WDT collection procedure must be done using chain of custody, which starts at the collection site. This is © 2011 by Taylor and Francis Group, LLC

240


documented using the custody and control form. This form consists of five pages, designated for the laboratory, medical review officer (MRO), collector, employer, and for the donor, and must be duly filled throughout the whole procedure. The collection procedure begins with the unequivocal verification of donor identity, followed by urine specimen collection to an appropriate container. The specimen volume should be at least 30â•›mL for a single specimen or 45â•›mL for a split specimen, and the temperature, measured within 4â•›min after collection, should be in the range 32°C–38°C/90°F–100°F. Visual inspection of the specimen should not reveal any signs of adulteration (unusual color or odor, excessive foaming). The container should be sealed in the presence of the donor, who has to sign appropriate form together with the collector. The specimen must be submitted to the laboratory not later than 24â•›h after the collection. Any irregularities occurring during the collection procedure should be documented. 8.2.3.2 Analytical Aspects of WDT The President’s Executive Order 12564 [16] defines “illegal drugs” as those included in Schedule I or II of the Controlled Substances Act. Since the schedules cover hundreds of drugs, it is not feasible to test every urine specimen routinely for all of them. The guidelines stated that in applicant testing and random testing at a minimum, urine specimens should be tested for marijuana and cocaine. The test panel may be extended to screening for opiates, amphetamines, and phencyclidine. In the case of reasonable suspicion of drug use, post accident, or unsafe practice testing, the presence of any drug listed in Schedule I or II may be tested. The entire analysis is divided into two steps: Initial drug test and confirmatory drug test. The latter test is applied for specimens identified as positive in the former test. The initial test shall use an immunoassay that meets the requirements of the FDA for commercial distribution. Initial testing shall be performed at permanent location, meet forensic standards, participate in proficiency testing and QA programs, and be subject to site inspection. Confirmatory test must use combined chromatographic separation with mass spectrometric identification, like GC/MS, GC/MS/MS, LC/MS, or LC/MS/MS. The initial testing is divided into two parts: Drug testing and specimen validity testing. The initial cutoff concentrations are shown on Table 8.5. It should be noted that in the entire text of the guidelines the term “Marijuana” or “Marijuana Metabolite” is used. This is hardly correct; marijuana is one of the known preparations of Cannabis sativa plant (together with hashish and hashish oil), cannot metabolize, and cannot be directly detected in urine. More correct term should be “Cannabis-related compounds” (for initial test) and “THC and metabolites” (for confirmatory test). Apart from initial drug testing, the validity testing of urine specimen shall be performed. This © 2011 by Taylor and Francis Group, LLC


241

Table 8.5â•…SAMSHA—Initial Urine Test Cutoff Levels Drug

Concentration (ng/mL)

Marijuana metabolites Cocaine metabolites Opiate metabolites Phencyclidine Amphetamines MDMA

50 300 2000 25 1000 500

Table 8.6â•…SAMSHA—Criteria of Urine Specimen Validity Adulteration

Substitution

Dilution

pHâ•›>â•›11 orâ•›

Quality Assurance in the Pathology Laboratory: Forensic, Technical, and Ethical Aspects

Quality Assurance in the Analytical Chemistry Laboratory

Quality Assurance

Forensic Pathology,

Knight's Forensic Pathology (Saukko, Knight's Forensic Pathology)

Quality Assurance and Quality Control in the Analytical Chemical Laboratory: A Practical Approach

Quality Assurance and Quality Control in the Analytical Chemical Laboratory: A Practical Approach (Analytical Chemistry)

The Forensic Anthropology Laboratory

the forensic laboratory handbook

Challenges in Analytical Quality Assurance

Challenges in Analytical Quality Assurance

Dairy Processing and Quality Assurance

Dairy Processing and Quality Assurance

Paediatric Forensic Medicine and Pathology

Power Transformers Quality Assurance

Forensic Pathology: Principles and Practice

forensic pathology reviews

forensic pathology reviews

The Laboratory Quality Assurance System: A Manual of Quality Procedures and Forms

Guide to Forensic Pathology

Handbook of Forensic Pathology

Forensic Pathology of Trauma

Forensic Pathology, Second Edition

Forensic Pathology Reviews, Volume 1 (Forensic Pathology Reviews)

Forensic Pathology of Trauma

Forensic Pathology Reviews Volume 4 (Forensic Pathology Reviews)

Forensic Pathology Reviews Volume 2 (Forensic Pathology Reviews)

Quality in Laboratory Hemostasis and Thrombosis

Quality in Laboratory Hemostasis and Thrombosis

Quality Assurance in Environmental Monitoring: Instrumental Methods

Quality Assurance in Dialysis, Second Edition

Quality Assurance in the Pathology Laboratory: Forensic, Technical, and Ethical Aspects

Quality Assurance in the Analytical Chemistry Laboratory