PRINS and In Situ PCR Protocols

1 Oligonucleotide

PRINS DNA Synthesis

John R. Gosden and Diane Lawson 1. Introduction The technique for labeling chromosomesby annealing an oligonucleotide DNA primer to the denatured DNA of chromosome preparations on glass slides and extending it enzymatically in situ with the incorporation of labeled nucleotides was fust described by Koch et al. in 1989 (I). Since then, the technique has been greatly improved in reliability, sensitivity, and resolution, and now provides a viable, rapid alternative to conventional fluorescence in situ hybridization (FISH) for many investigations, particularly the identification of chromosome aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the human chromosome complement of somatic hybrid cell lines (Zd). 2. Materials 2.1. Primed In Situ Syf7thesis 1. Twin-Frost glassslides and 22 x 40 mm coverslips: The slides must be cleaned by soaking in ethanol to which a few drops of HCl have beenadded,followed by polishing with a cleanpiece of muslin, before the cells aredepositedon the slide. Coverslips must be cleanedin the sameway before use. 2. PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4MgC12, 0.1% BSA. 3. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St.Albans, UK), diluted 1:10 with sterile distilled HzO. 4. 2’-Deoxycytidine 5’-triphosphate(dCTP): 100-mM solution (PharmaciaBiotech) diluted 1:10 with sterile distilled H20. 5. 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia Biotech) diluted 1:10with sterile distilled H20. 6. 2’-Deoxythymidine5’-triphosphate(dTTP): lOO-mJ4solution(PharmaciaBiotech) diluted 1:100with sterile distilled H,O. From. Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Ed&d by. J. R Gosden Humana Press Inc., Totowa, NJ

2

Gosden and Lawson

7. Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Lewes, Sussex, UK). 8. Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger Mannherm). 9. FluoroRed (Amersham International, plc, Buckinghamshire, England). 10. FluoroGreen (Amersham International). 11. FluoroBlue (Amersham International). 12. Ohgonucleotide primer(s) at 250 ng/pL (see Note 1) 13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus [Advanced Biotechnologies Ltd., Leatherhead, England]). 14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011 Poing, Germany) (see Note 2). 15. Stop buffer (500 mM NaCl, 50 n1J4 EDTA). 16. Flat-bed thermal cycler (see Note 3). 17. Water bath at 65°C

2.2. Detection 1 Dried skimmed milk powder. 2. Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlingame, CA). 3. Avidin-DCS-Texas red (Av-TR) (Vector Labs). 4. Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm). 5. Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim). 6. Propidium iodide (20 pg/mL) (Sigma). 7. 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma). 8. VectaShreld (Vector Labs). 9. 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3. 10. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100. 11. Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder. 12. Incubator or water bath at 37’C and water bath at 45°C. 13. Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux II with Pleomopak filter system)

3. Methods

3.1. Standard PRINS 1. You will need cells or chromosomes, prepared from peripheral blood lymphocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8) (see Note 5). 2. Oligonucleotide primers are prepared on an Applied Biosystems (Foster City, CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions. Recommendations for some successful chromosome-specific primers are given in Table 1 (but see Note 4). 3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 @Lof the selected labeled dUTP (biotin,

PRINS

3

Table 1 Examples of Chromosome-Specific Oligonucleotides and a Primer for All Human Centromeres F673 (20-mer) F60 (30mer)

D16Z1, Satellite II D 172 1, alphoid

G33 (19-mer) 168 (17-mer)

D9Z 1, Satellite III CenP-B Box

4. 5. 6.

7.

TTCTTTTCATACCGCATTCT ATTGCACTTCTTTGAGGAGTACCG TAGTAA AATCAACCCGAGTGCAATC CTTCGTTGGAAACGGGA

digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appropriate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add distilled water to 50 PI.,, Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and place 40 $ on a clean coverslip. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the least risk of introducing air bubbles) and seal with rubber cement Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat block of a thermal cycler. A suitable basic program for the Hybaid OmniGeneTM In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min. On completion of the program, remove the seal (it peels off easily by rubbing one comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C. Leave the coverslips in place, unless they come off readily with the seal; they will in any case fall off in the stop buffer. After 1 min, transfer the slides to a stain dish containing wash buffer. They may be held in this solution overnight if convenient (but see Note 7)

3.2. Detection It is important that the slides do not become dry at any time during this process. The following steps apply only to slides in which the PRINS reaction has been labeled with biotin or digoxigenin. Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step, and are simply mounted (see step 6). 1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds. 2. Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from the slide, and pick up the coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 min. 3. Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in blocking buffer. For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC and anti-DIG rhodamine are better at 1: 100 dilution. Make sufficient buffer for a 40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed during storage and can cause high and nonspecific background.

4

Go&en and Lawson

4. Remove the cover&p from the slide, shake surplus fluid off both the sltde and the coverslip, and add 40 pL of reporter solution to the same coverslip. Replace the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp filter paper) at 37°C for 30 mm. 5. Warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C. 6. After the final wash, shake off surplus fluid and mount slides in VectaShleld containing the appropriate counterstain: For slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield). Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored m the dark at 4°C for several months. If the stain shows signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC, 0.05% Triton X-100 (the covershp will fall off at this point), and remount as above Figure 1 shows some typlcal results. 7. Multiple sequential PRINS reactions may be performed on the same sample in order to quantify a number of chromosomes. For details of the method, see Chapter 6 and ref. 6 8. The technique may also be combined with FISH. After the stop buffer, the shdes are passed through an ethanol series (70, 90, 100%) and air-dried before performing a normal FISH procedure, omitting any denaturation of the chromosomal DNA. Detection of the PRINS product and the hybridized FISH probe is then performed simultaneously (9) This provides a rapid method for identifying the chromosomal target located by the FISH. 4. Notes 1. Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol preclpltatlon and washing. If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed and only increase the cost of the product. 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely avallable. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines designed for PCR in microtubes, with a plate added to the heated block. Thermal transfer and temperature control m such a system are rarely satisfactory The procedure can be carried out by transferrmg slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the

PRINS

Fig. 1. (see color plate number 1 after p. 82) Examples of PRINS reactions with the primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the label detected with avidin-FITC. Chromosomes were counterstained with a mixture of DAPI and propidium iodide. (A) Chromosome 16. (B) Chromosome 9. (C) Chromosome 17. (D) CenP-B box primer (labels all centromeres).

transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively. 4. As an alternative, complete systems for chromosome identification by PRINS are becoming available (e.g., Advanced Biotechnologies, Leatherhead, England). 5. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months. Slides are prepared fresh each week by gently centrifuging the suspension to precipitate the cells, resuspending in fresh fix, repeating this process, and finally resuspending in sufficient fix to give a suitable density and putting one drop on a clean slide, which is allowed to dry at room temperature. The balance of the suspension may then be diluted suitably with fix and returned to -2O’C. Using slides more than l-2 wk old can be successful, but may lead to reduced sensitivity and greater variability. 6. The majority of chromosome-specific alphoid sequences produce adequate signal with a single primer at a concentration of 250 ng/50 l.tL reaction. In some

Go&en and Lawson cases, a clearer signal with less background may be produced with paired pnmers, at the same concentration, whereas in others, the concentration of primer may be reduced, with a concomitant reduction in crossreaction to related chromosomal sequences. 7. Slides that have been labeled directly with fluorochromes may still be held m this solution overnight if convenient, but should be kept in the dark to prevent bleaching and fading of the label.

References 1. Koch, J E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265 2. Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D. (199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet CeEZGenet. 57, 100-l 04. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by ohgonucleotide primed in situ DNA synthesis (PRINS). Hum. A401 Genet. 3,93 l-946. 4 Gosden, J and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequences in situ. Cytogenet Cell Genet. 68,57-60. 5. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ labelling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54. 6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,29-33. 7. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral blood for high resolution, in Methods in Molecular Biology, vol 29. Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. l-10. 8. Fletcher, J. (1994) Immortalized cells lines: chromosome preparation and bmding, in Methods in Molecular Bzology, vol. 29: Chromosome Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 51-57. 9. Warburton, P. E., Haaf, T., Gosden, J., Lawson, D , and Willard, H. F. (1996) Characterization of a chromosome-specific chimpanzee alpha satellite subset: evolutionary relationship to subsets on human chromosomes. Genomlcs 33,220-228

Chromosome-Specific Jean-Paul

PRINS

Charlieu and Franck Pellestor

1. Introduction The identification of mdlvidual chromosomes IS of great Importance in cytogenetics, in order to detect aneuploidies or chromosomal rearrangements associated with genetic diseases. This can be achieved by several techniques based either on the intrinsic staining properties of the chromosomes in producing bands (the banding pattern being specific for each pair of chromosomes) (1) or the use of a DNA probe to detect specifically a region of the chromosome by fluorescence in sztuhybridization (FISH) (2). The use of centromeric a satellite sequences as FISH probes is very popular because of the specificity of these sequences. cz Satellite (or alphoid) DNA 1s a family of tandemly repeated sequences present at the centromere of all human chromosomes (3). Subfamilies, some of them specific for one or a small group of chromosomes, can be identified within alphoid DNA both by the periodic distribution of restriction sites and the nucleotide sequence of the 171-bp basic motif (4). These chromosome-specific subfamilies can therefore be used as FISH probes. This approach is limited, however, since the DNA sequencesof some subfamilies are very close to each other, and crosshybridization can occur between the centromeric sequences of several pairs of chromosomes. This is the case with chromosomes 13 and 2 1, for example, which share 99.7% homology in their alphoid sequences (5,. The development of the primed in situ (PRINS) technique of labeling DNA (68) introduced a solution to this problem. The PRINS procedure consists of the use of a small oligonucleotide (usually 18-22 nucleotides) from the sequence of interest as a primer. The primer is annealed to the denatured DNA of a chromosome or cell preparation. An in situ DNA synthesis reaction is performed with the incorporation of a labeled precursor (biotindUTP or digoxygenin-dUTP), using a thermostable DNA polymerase. A single From

Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols Edlted by. J R Gosden Humana Press Inc., Totowa, NJ

7

8

Charlieu and Pellestor

base mismatch between the target and the probe will produce a less stable hybrid when using a primer than for a long FISH probe. In addition, if the mismatching nucleotide is located at the 3’-end of the PRINS primer, it will prevent any elongation by the DNA polymerase. We have developed several chromosome-specific a-satellite primers for PRINS, each of them carrying at least a chromosome-specific nucleotide at its 3’-end, and we describe in this chapter the use of two of them for the detection of human chromosomes 13 and 21. Other primers are available in the literature (9,ZO) or on request, but we are presenting only the conditions of use for the two most difficult, differing only at one position. 2. Material

2.1. Slides 1. Chromosome spreads are prepared from peripheral blood usmg standard methods (fixation in methanol:acetic acrd 3: 1). 2. 20X SSC: 3M NaCl, 0.3M Nas-citrate (can be stored for several months at room temperature). 3. 70,90, and 100% ethanol. 4. Formamrde (Prolabo, Paris, France): Formamide must be deionized by mixing with Amberlite resm (Sigma, St. Louis, MO), allowing to stand for at least 1 h, and then filtering. Deionized formamide is stored at +4”C.

2.2. PRIM Reaction 1. Primers: Synthetic oligonucleotides are used as primers m the PRINS experiments. Their nucleotide sequences are as follows (11): 13A (chromosome 13): 5’-TGATGTGTGTACCCAGCT-3’ 21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’ Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for 1 mm at maximum speed in a bench-top microfuge. Dry the pellets under vacuum, and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu-

tion. Store small aliquots (50 pL) at -2OT (seeNotes 1 and 2). 2. 2’-Deoxyadenosine

5’-triphosphate

(dATP) (Boehringer

Mannheim,

Meylan,

France): Resuspendin Hz0 to obtain a 100-M stocksolution (store at -2O’C). 3. 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim):

Resuspend to

obtain a 100~mMstock solution (-2O’C). 4. 2’-Deoxyguanosine

5’-triphosphate (dGTP) (Boehringer Mannheim):

Resuspend

to obtain a 100~mMstocksolution (-2OT). 5. 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): to obtain a 100-n&f stock solution (-20°C). 6. Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C). 7. Glycerol 87% (Prolabo). 8. Tuq DNA polymerase (Boehringer Mannhetm). Store at -2O’C 9. 10X Taq buffer (provided with the enzyme) (-2O’C).

Resuspend

Chromosome-Specific PRIM

9

10. Stop buffer: 500 n&f NaCl, 50 mM EDTA, pH 8.0 (can be stored at room temperature for several months). 11. Sterile, deionized, double-distilled water. 12. Water bath at 60°C. 13. Water bath at 72°C. 14. 1.5~mL microcentrifuge tubes (sterilized by autoclaving). 15. Coverslips (22 x 40). 16. Thermal cycling machine equipped with a flat block (e.g., Techne PHC3).

2.3. Detection 1. 2. 3. 4. 5. 6. 7.

Washing solution: 4X SSC, 0.05% Tween 20. Blocking solution: washing buffer plus 5% nonfat dry milk. Make fresh each time. Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA). Propidium iodide (PI) (Sigma). Antifade solution Vectashield (Vector Labs). Staining Jars. Microscope equipped for detection of FITC and PI fluorescence

3. Methods 3.1. Slides 1. Store slides prepared according to standard methods at room temperature for 5 d before use. 2. Just before the PRINS reaction, dehydrate the slides by passage through an ethanol series (70,90, 100%) at room temperature, 3 min each step, and air-dry. 3. Denature the chromosomal DNA on the slides by immersing them in 70% formamide, 2X SSC, at 72°C for 2 min, dehydrating through an ice-cold ethanol series (70,90, lOO%), and an-drying (see Note 3).

3.2. PRINS Reaction 1. Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP, dGTP, and dTTP l/l 0 in sterile, distilled water. In a sterile microcentrifuge tube, mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL of 1 m&f biotin-16 dUTP, and 55 pL of glycerol. Mix well and store at -2O’C. 2. Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add sterile distilled water to a final volume of 50 pL. 3. Preheat the reaction mix at 60°C in a water bath. 4. Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the thermal cycler. 5. Set up the program for PRINS: 12 min at the annealing temperature (60°C for primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C. 6. When starting the program, heat the slide(s) and the coverslip at the annealing temperature for 5 min. Then put the reaction mix onto the slide and cover

Char-lieu and Pellestor

10

by the coverslip. Incubate the slide at the annealing temperature for a further 7 min; the temperature is automatically raised to 72°C at the beginning of the elongation step. 7. At the end of the elongation time, transfer the slide to 100 mL of preheated stop buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip. Then transfer the slide to 100 mL of washing solution. The shdes can stay m thus buffer overnight at 4°C if convenient

3.3. Detection 1. Wash the slides twice for 3 min at room temperature in washing solution, with gentle agitation. 2. Drain the excess washing solution and apply 100 pL of blocking solution to each slide 3. Incubate for 10 min at room temperature under a coverslip. 4. Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin diluted to 5 pg/mL in blocking solution to the slide. Cover with a new coverslip and incubate at 37°C for 30 min in a moist chamber. 5. Remove the coverslip and wash the slide three times (5 mm each) m washmg solution, at room temperature, with gentle agitation. 6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld antifade solution containing 0.5 l.tglmL propidium iodide. 7 Examine the shde by fluorescence microscopy (Fig. 1).

4. Notes 1. Chromosome-spectfic primers sometimes differ from each other by only one nucleotide at the 3’-end, as for the primers described here. It is therefore advtsable to purify the primers by HPLC to avoid contammation by shorter products am+ mg from premature stops during syntheses.Storage of the primers in small aliquots also prevents degradation of the primers by repeated cycles of freeze-thawing. 2. The concentration of the primers can be determined by using the Beer-Lambert equation: c = A26d%mi

xL

(1)

where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~is the molar extinction coefficient (M-l), and L is the path length (cm) of the spectrophotometer cuvet. The molar extinction coefficient for an oligonucleottde can be determined as follows: &max= (number of A x 15,200) + (number of C x 7050) + (number of G x 12,010) + (number of T x 8400) M-l

(2)

3. We describe here formamide denaturation, which gave more consistent results in our hands, but it is also possible to denature the chromosomes by heating the slide at 95“C for 3 min as part of the thermal cycle. In this case, omit step 3 of Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min,

Chromosome-Specific

PRINS

11

Fig. 1. PRINS detection of chromosomes 13 (A) and 21 (B). The detection was performed according to the protocol described in the text. The chromosomes were counterstained with propidium iodide. Arrows indicate the chromosome-specific signals. annealing temperature for 7 min, and 72°C for 30 min. The preheated reaction mix is added after the initial denaturation step. 4. The annealing temperature was determined empirically for each primer, and those described here were found to give specific labeling in our hands with our PCR machine and in our laboratory. However, slight adjustments may be necessary if these primers are to be used in other laboratories, since each PCR machine may have a different thermal response curve. The conditions described here must therefore be taken as indications only, and not as absolute rules. When testing new PRTNS primers, a good start for the annealing temperature is 5°C under the empirically determined melting temperature (T’,) of the primer: 4°C x (G + C) +

12

Charlieu and Pellestor 2°C x (A + T). The annealing temperature is then modified according to the signal and/or the specificity obtained.

References 1, Sumner, A. T. (1994) Chromosome banding and identification: absorption stainmg, m Methods in Molecular Bzology, vol. 29, Chromosome Analysis Protocols (Gosden, J. R., ea.), Humana, Totowa, NJ, pp. 5%81. 2. Lichter, P. and Ried, T. (1994) Molecular analysis of chromosome aberrations: in situ hybridization, in Methods in Molecular Biology, vol. 29, Chromosome Analyszs Protocols (Gosden, 3. R., ed.), Humana, Totowa, NJ, pp. 449-478. 3. Choo, K. H,, Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nuclezc Aczds Res. 19, 1179-I 182. 4. Willard, H. F. and Waye, J. S. (1987) Hierarchical order in chromosome-specific human alpha satellite DNA. Trends Genet. 3, 192-198. 5, Jorgensen, A. L., Bostock, C. J., and Bak, A. L. (1987) Homologous subfamilies of human alphoid repetitive DNA on different nucleolus organizing chromosomes Proc. Natl. Acad. Scz. USA 84, 1075-1079. 6. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, L. (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265. 7. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-936. 8. Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charlieu, J.-P. (1995) Rapid in situ detection of chromosome 2 1 by PRINS technique. Am. J. Med. Genet. 56, 393-397.

9. Pellestor, F., Girardet, A., Andrea, B., Lefort, G., and Charlieu, J.-P. (1994) The use of PRINS technique for a rapid in situ detection of chromosomes 13, 16, 18, 21, X and Y. Hum. Genet. 95,12-17. 10. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J.-P. (1995) Selection of chromosome specific primers and their use in simple and double PRINS technique for rapid in situ identification of human chromosomes. Cytogenet. Cell. Genet. 70, 138-142 11. Charlieu, J.-P., Murgue, B., Marcais, B., Bellis, M., and Roizes, G. (1992) Discrimination between alpha satellite DNA sequences from chromosomes 21 and 13 by using polymerase chain reaction, Genomics 14,5 15,5 16.

3 Bright-Field Microscopic Detection of Oligonucleotide PRINS-Labeled DNA in Chromosome Preparations Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction Primed dn situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences m cell (I-4) and tissuepreparations (5; seealso Chapter 5). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequencein situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,6,7). The detection limit of the PRINS technique appears to be on the order of low-copy sequences (3,8’. Recently, multiple-target PRINS approaches were reported using sequential PRINS reactions with differently modified nucleotides combined with fluorescence detection (6,7,9). For the simultaneous identification of more than two DNA sequences, however, DNA counterstaining or chromosome banding is in principle not possible, since the available fluorescence colors are utilized for specific target detection. Here we describe a bright-field microscopic procedure for the simultaneous detection of up to three different PRINS-labeled DNA target sequences in contrasting colors in both interphase and metaphase cells (Fig. lA,B). DNA sequences were detected by the precipitates of the horseradish peroxidasediaminobenzidine (PO-DAB, brown color), alkaline phosphatase-fast red From Methods m Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by* J. R Gosden Humana Press Inc , Totowa, NJ

13

Speel et al.

Fig. 1. (see color plate number 2 after p. 82) (A) Bright-field detection of chromosome 9 and 7 centromeres with biotin/PO-DAB (brown) and digoxigenin/APase-fast red (red), respectively, in a human lymphocyte metaphase spread after double-target PRINS, hematoxylin counterstaining and PBS/glycerol (1:9) embedding. (B) Brightfield detection of chromosome 9,7, and Y centromeres with biotin/PO-DAB (brown), digoxigenin/APase-fast red (red), and fluorescein/PO-TMB (green), respectively, in a human lymphocyte metaphase spread after triple-target PRINS, hematoxylin counterstaining and BSA/formaldehyde embedding.

(APase-fast red, red color), and horseradish peroxidase-tetramethylbenzidine (PO-TMB, green color). Chromosomes and nuclei were counterstained with hematoxylin before bright-field microscopical visualization. Such an approach, which had been first described for ISH (IO), has the advantage that no fluorescence microscope with a confocal system or CCD camera for image analysis and processing is required. Furthermore, no fading of the in situ enzyme precipitation products occurs since they are permanently localized. 2. Materials 2.1. PRINS

DNA Labeling

1. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mJ4 solutions of dATP, dCTP, dGTP, and dTTP. 2. Ultrapure ddNTP set (Pharmacia): 5-W solutions of ddATP, ddCTP, ddGTP, and ddTTP. 3. Biotin- 16-dUTP, digoxigenin- 1 I-dUTP, and fluorescein- 12-dUTP (Boehringer, Mannheim, Germany). 4. Oligonucleotide primer (see Table 1) at 250 ng/pL. 5. Tuq DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St. Giles, UK). 6. Klenow DNA polymerase (Boehringer). 7. Formamide (Fluka, Bornem, Belgium). 8. 20X SSC: 3MNaC1, 300 m&I trisodium citrate, pH 7.0.

Bright- Field Microscopic Detection Table 1 Sequences of Oligonucleotide Name E528 G33 G35 D600

Primers Used in PRINS

Human origin Chromosome Chromosome Chromosome Chromosome

15

Sequence

7 centromere 9 centromere 11 centromere Y centromere

AGCGATTTGAGGACAATTGC AATCAACCCGAGTGCAATC GAGGGTTTCAGAGCTGCTC TCCATTCGATTCCATTTTTTT CGAGAA

9. 10X Taq buffer: 500 mMKC1, 100 mMTns-HCl, pH 8.3, 15 mMMgC12, 0.1% bovine serum albumin (BSA) (Sigma, St. Louis, MO). 10. 10X Klenow buffer: 500 mMTris-HCl, pH 7.2,lOO mMMgS04, 100 mMDTT, 1.5 mg/mL BSA. 11. PRINS stop buffer: 500 mMNaC1,50 rnJ4 EDTA, pH 8 0. 12. Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X-100. 13. Ethanol/37% HCl (100. 1)-cleaned microscope slides and coverslips 14. Rubber cement. 15. Water bath at 65’C. 16. Thermal cycler (Hybaid Ommgene Flatbed) (Hybaid, Teddington, UK). 17. Humid chamber. 18. Incubator at 37°C.

2.2. ~fnzyme Cytochemicel 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19.

Detection

Dried skimmed milk powder. Normal goat serum (NGS). Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark). Mouse antidigoxm (MADig) (Sigma). Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako). Rabbit anti-FITC (RAFITC) (Dako). Horseradish peroxidase-conjugated swine antirabbit IgG (SWARPO) (Dako). Peroxidase (PO) inactivation solution: O.OlN HCI. 30% H202 (Merck, Darmstadt, Germany). Diaminobenzidine (DAB) (Sigma). 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma). Dioctyl sodium sulfosuccinate (DSSS) (Sigma). Sodium tungstate (Sigma). Naphthol-ASMX-phosphate (Sigma). Fast red TR (Sigma). Polyvinylalcohol (PVA), mol wt 40,000 (Sigma) Nitro blue tetrazolium salt (NBT) (Boehrmger). 5-Bromo-4-chloro-3-indolyl phosphate (BCIP) (Boehringer). PO-DAB buffer: O.lM imidazole (Merck) in PBS, pH 7.6.

76

Speel et al.

20. PO-TMB buffer: 100 & citrate-phosphate buffer, pH 5.1. 21 APase buffer: 0 2MTns-HCl, pH 8.5, 10 mMMgCl*, 5% PVA. 22. Hematoxylin: Hematoxylin (Solution Gill no. 3) (Slgma):distrlled water (1:4). 23. Immersion oil (Zeiss). 24. BSA (Sigma). 25. Formaldehyde 37% (Merck). 26. Blockmg buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 27 Washing buffers: 4X SSC, 0.05% Triton X-100; PBS, 0.05% Triton X-100. 28 Incubator at 37’C. 29 Bright-field microscope (Zeiss Axtophot). 30. Kodak Color Gold 100 ASA film. 3 1 Blue and magenta filters

3. Methods 3.7. PRINS DNA Synthesis 1. Metaphase chromosomes are freshly prepared from peripheral blood lymphocytes by standard methods, fixed in methanol:acetic acid (3:1), and spread on acid/alcohol cleaned slides (see Note 1). 2. Slides are passed through an alcohol series (70,90, and lOO%, 2 min each), which helps m preserving chromosome morphology, and air-dried. 3. Chromosomal DNA 1sdenatured m 70% formamide, 2X SSC, pH 7.0, for 2 mm at 7O”C, followed by dehydration of the slides with 70% ethanol at 4”C, 90 and 100% ethanol, and an-drying. 4 The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide m 40 pL IS used for primers of 16-30 bases complementary to repeated sequences. 5. The PRMS reaction mix is made up on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water Dilute 100 mM dTTP 1: 100. Put together in a microcentrifuge tube: 1 u,L of each of the diluted dNTPs, 1 pL of either 1 nnl4 biotm- 16-dUTP, digoxigenin-1 1-dUTP, or fluorescein- 12-dUTP (see Note 2), 5 $ of 10X Tuq buffer, 250 ng of oligonucleotide, 1 U Taq polymerase, and distilled water to 50 $. 6. Place 40 pL of this mixture under a coverslip on the slide, seal with rubber cement, an-dry the rubber cement, and transfer to the heating block of the thermal cycler. 7. Each PRINS reaction cycle consists of 5 min at the appropriate annealing temperature (see Note 3) and 15 min at 72°C for in situ primer extension. 8. Stop the PRINS reaction by transferring the slides (after removal of the rubber solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65OC for 1 min. 9. For sequential PRINS reactions, it was found essential to prevent free 3’-ends of the newly synthesized DNA from being used as primers for subsequent reactions. This can be achieved by incubatmg the slides with Klenow DNA polymerase together with ddNTPs. The reaction mix is made up as follows: Dilute 5 mM of all four ddNTPs 1: 10 with distilled water. Put together in a microcentrifuge tube

Bright- Field Microscopic Detection

17

Table 2 Enzyme Cytochemical Detection Systems That Can Be Used for PRINS-Labeled DNAa Detection Label

1st layer

2nd layer

Biotin Biotin

Avidin-Eb Avidin-E

HaptenC Hapten Hapten

Antihapten Ab-E Moused antihapten Ab Mouse antihapten Ab

Hapten

Mouse antihapten Ab

Hapten

Mouse antihapten Ab

Brotin-labeled antiavidin Ab Antimouse Ab-E Rabbit antimouse Ab-E Biotin-labeled antimouse Ab Drgoxigenin-labeled antimouse Ab

3rd layer Avidm-E

Antirabbit Ab-E ABC Anti-digoxigenin Ab-E

aFurther amplification of PRINS signals may be achieved by combining these detection systems with peroxrdase-mediated deposition of hapten- or fluorochrome-labeled tyramldes (1 I, 12) bAbbreviations.Ab, antibody;ABC, avidin biotmylatedenzyme(horseradish peroxidaseor alkalinephosphatase) complex;E, enzyme(horseradish peroxidaseor alkalinephosphatase). CHapten = biotm,digoxtgenm,FITC, or DNP. dAntihaptenantibodyratsedm anotherspecies(e.g., rabbit,goat,swine)canalsobe usedas primary antibody in PIUNS detection schemes.

2.5 @ of each of the ddNTPs, 5 pL of 10X Klenow buffer, 1 U Klenow DNA polymerase, and distilled water to 50 @,. 10. Place 40 & of this mixture under a coverslip on the slide, transfer to a humid chamber, and incubate for 1 h at 37°C in an incubator. 11. Dehydrate the slides as described in step 2 and au-dry before running the next PRINS reaction with another primer and different reporter. 12. Finally, transfer the slides to washing buffer at room temperature and wash for 5 min.

3.2. Enzyme Cytochemical

Detection

1. Place 40 l,tL of blocking buffer under a coverslip on the slide and leave for 5 min at room temperature to reduce background stammg in the detection procedures. 2. Dilute detection molecules as follows: Dilute avidin conjugates m blocking buffer and antibody conjugates in PBS, 0.05% Tnton X-100,2% NGS. 3 For single-target detection, incubate the slides for 30 mm at 37’C with the first detection layer (Table 2), and wash 2 x 5 min m the appropriate washmg buffer (4X SSC, 0.05% Triton X-100 for avidin, and PBS, 0.05% Triton X- 100 for antibody molecules). Repeat this step with the next detection layer until all incubations are complete.

Speel et al.

18 Table 3 Enzyme Cytochemical Reactions That Can Be Used for In Situ Nucleic Enzyme

Enzyme reagents

Acid Detectiona

Embedding

Absorption color

Reference Graham and Karnovsky, 1966 (13) Speel et al., 1994 (IO) Speel et al.,

POb

HZO, + DAB

Aqueous/ organic

Brown

PO

HZ02 + TMB

Organic

Green

APase

N-ASMX-P + fast red TR BCIP + NBT

Aqueous

Red

Aqueous

Blue/purple

APase

1992 (14)

McGadey, 1970 l1.5)

OOther enzyme reactlons that have been used for in SW nucleic acid detectlon are described elsewhere (12,16) bAbbrevlatlonsAPase,alkahnephosphatase, BCIP, 5-bromo-4-chloro-3-mdolyl phosphate; DAB, dlaminobenzldme; N-ASMX-P, naphthol-ASMX-phosphate; NBT, mtrobluetetrazohum, PO,horseradish peroxldase,TMB, tetramethylbenzldme 4 After the last detectionlayer, washsampleswith PBS for 5 min at room temperature

and visualize the DNA target by an appropriate enzyme reaction (see 5, and Table 3) 5. To detect multiple DNA targets labeled with different haptens, a combmatlon of enzyme cytochemlcal detection systems is chosen from Table 2. Smce the enzymes horseradish peroxidase (PO) and alkaline phosphatase (APase) can generate a number of differently colored precipitates (see Table 3), multiple DNA targets can be visualized simultaneously by suitable combmattons of enzyme

reactions. If the entire detection procedure uses more than one PO or APase reaction, the first applied enzyme can be inactivated after the first detection reaction by incubating the sample in O.OlM HCl for 10 min at room temperature. Then, the next detection system can be applied, followed by the appropriate enzyme reaction (Note 4). 6. As an example, a protocol for triple-target PRINS is outlined in Table 4 (Note 5). Protocols for bicolor detection of nucleic acid sequences in situ can be derived from this protocol or can be found elsewhere(Note 6) (10,17-21). 7. Visualize the PRINS-labeled DNA targets with one of the following

enzyme reactions (Note 7): a. PO-DAB reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 & 30% H202 just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37’C, wash 3 x 5 min with PBS, dehydrate (optionally), and coverslip with an aqueous or organic mounting medium b. PO-TMB reaction: Dissolve 100 mg sodium tungstate m 7.5 mL PO-TMB buffer and adjust the pH of this solution to 5.0-5.5 with 37% HCl. Just before

Bright-Field Microscopic Detection

19

Table 4 Enzyme Cytochemical Detectlon Protocol for Three Nucleic Acid Sequences In Situ, Labeled with PRINS Using Blotin-, Digoxigenin-, and FITC-Modified Nucleotides, Respectivelya Detection step 1. 2. 3. 4. 5.

6. 7.

8. 9. 10

Detect biotin with AvP@ (diluted 1:50) Visualize PO activity in brown (PO-DAB) as described in Section 3.2., step 7a Inactivate residual PO activity with O.OliVHCl Detect digoxigenm and FITC with MADig/RAFITC (both diluted 1:2000) Detect primary antibodies with GAMAPase/SWARPO (diluted 1:25 and 1:lOO) Visualize APase activity in red (APase-fast red) as described in Section 3 2., step 7c Visualize PO activity in green (PO-TMB) as described in Section 3.2., step 7b Counterstam with hematoxylin Air-dry Embed in a protein matrixC

Time 30 min 5 min

Temperature 37°C 37OC

10 min

Room temperature

30 mm

37Y!

30 min

37°C

5-10 min

37OC

1-2 min

37°C

1s 10 min 10 min

Room temperature Room temperature 37OC

OFor details of detection systems, see Table 2. bAbbreviations used: APase, alkaline phosphatase; AvPO, PO-conjugated avidm; DAB, diaminobenzidine; GAMAPase, APase-conlugated goat antrmouse IgG; MADig, mouse antidigoxin; PO, horseradish peroxtdase; RAFITC, rabbit anti-FITC IgG, SWARPO, PO-conjugated swine an&rabbit IgG cFor details of the protein matrrx, see Section 3.2., step 9.

use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C. Mix both solutions, add 10 pL HzOz, and overlay each sample with 100 pL under a coverslip. Incubate the slides for l-2 min at 37Y!, wash 3 x 1 min with ice-cold 0. 1Mphosphate buffer, pH 6.0, dehydrate (optionally), and coverslip with an organic mounting medium or immersion oil. c. APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phosphate in 250 pL buffer without PVA, and 5 mg fast red TR m 750 Ccs,buffer without PVA just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and coverslip with an aqueous mounting medium (Note 8). d. Alkaline phosphatase-NBT/BCIP reaction: Dissolve 1.8 mg BCIP in 100 @., N,N-dimethylformamide and 3.3 mg NBT in 660 & distilled water and add

20

Speel et al.

subsequently to 9.24 mL APase buffer. Overlay each sample with 100 pL under a coverslip. Incubate the slides for 15-60 min at 37”C, wash 3 x S min with PBS, and coverslip with an aqueous mounting medium (Note 8). 8. Aher all enzyme reactions have been performed, counterstain the samples with hematoxylin, wash 1 x S min m tap water and 1 x 2 min in distilled water, and air-dry if you wish. 9 Mount single-target PRINS samples in the embedding medium required for the used enzyme precipitate, as outlined in steps 7a-d and Table 3. Mount multiple-target PRINS samples m the embedding medmm required for the used enzyme precipitates, unless they need different mounting. In that case, apply a protein embedding layer by smearmg 50 pL of a mixture of 40 mg/mL BSA m distilled water and 4% formaldehyde onto the slides. Air-dry for 10 min at 37°C (Note 9) 10. Examine slides under a bright-field microscope. Microphotographs can be made usmg blue and magenta filters and Kodak 100 ASA film.

4. Notes 1. Slides should be used within a week of preparation and stored in a vacuum deslccator until use. Cell suspensions can be stored for up to 3 mo at -20°C. 2. In the case of labeling with biotin- 1QdUTP or fluorescem-12-dUTP, a four times decrease of the concentration of dTTP in the PRINS reaction mix resulted m significantly stronger labeling of DNA sequences. Under the described standard conditions, digoxigenin-1 l-dUTP provides the highest sensitivity. However, all the modified nucleotides are suited for detection of repeated sequences zn sm. 3. The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. 4. Enzyme inactivation by an incubation with O.OlMHCl has no demonstrably negative effect on the stability of the synthesized DNA and its incorporated reporters (blotin, digoxigenin, FITC). 5. If multiple enzyme reactions are utilized, the PO-TMB reaction must always be performed last, since the resulting precipitate proved to be unstable in aqueous solutions with a pH above 6.0 (e.g., distilled water and PBS). 6. In case of enzyme activity detection after application of a PO and APase conjugate, the APase reaction must always be performed first to prevent inactivation of APase during the PO reaction. 7. It is recommended to follow every enzyme reaction under the microscope to ensure discrete localization of the in sztu signals. 8. Do not dehydrate the slides after the APase reaction, since the precipitate dissolves (partially) in organic solvents. Optionally, you may air-dry the slides after rinsing in distilled water. 9. Embedding in a protein layer is essential to prevent dissolving of the enzyme reaction product in an aqueous or organic mounting medium, or in immersion oil. In this way, it ensures stabilization of the enzyme precipitates and, in addition, optimal visualization of color contrast.

Bright- Field Microscopic Detection

21

References 1. Bains, M. A., Agarwal, R., Pringle, J. H., Hutchinson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by pnmer-induced in situ (PRINS) fluorescent nucleotide labeling. Exp. Ceil Res 208,321-326 2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hmdkjmr, S., Kolvraa, S., and Bolund, L. (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labelmg with fluorescein-12-dUTP. Cytogenet. Cell Genet. 60, l-3. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identificatron by oligonucleotide-primed in s~tu DNA synthesis (PRINS). Hum Mol. Genet 3,93 l-936. 4. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mel Reprod. Dev. 40,333-337. 5. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. (1996) Raprd brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA m chromosome preparations and frozen tissue sections. Biotechniques 20,226234. 6. Hindkjmr, J., Koch, J , Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-154. 7. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,2!3-33. 8 Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in s&u detection of the B-hordem gene cluster on barley chromosome 1H Proc. Natl. Acad. Scz. USA 90, 11,821-l 1,824. 9. Volpi, E. V. and Baldini, A. (1993) MultiPRINS. a method for multicolor primed m situ labeling. Chromosome Res. 1,257-260. 10. Speel, E. J. M , Jansen, M. P. H. M., Ramaekers, F. C. S., and Hopman, A. H N. (1994) A novel triple-color detection procedure for brightfield microscopy, combinmg in situ hybridization with immunocytochemistry. J. Histochem Cytochem 42,1299-1307. 11. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed reporter deposition, a novel method of signal amplification Amplrfication to immunoassays J Immunol Methods 125,279-285. 12. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical detection systems form situ hybridization, and the combination wtth immunocytochemistry. Histomchem. J. 27,833-858. 13. Graham, R. C. and Karnovsky, M. J. (1966) The early stages of absorption of injected horseradish peroxidase in the proximal tissues of mouse kidney with structural cytochemistry by a new technique. J. Histochem. Cytochem. 14,291-302. 14. Speel, E J. M., Schutte, B., Wiegant, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1992) A novel fluorescence detection method for m situ hybndtzation, based on the alkaline phosphatase-fast red reaction. J. Histochem. Cytochem. 40,1299-1308.

22

Speel et al.

15. McGadey, J. (1970) A tetrazolium method for non-specific alkaline phosphatase. Histochemistry 23, 180-l 84. 16. Speel, E. J. M., Kamps, M., Bonnet, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1993) Multicolour preparations for in situ hybridization using precipitating enzyme cytochemistry in combination with reflection contrast microscopy. Histochemistry 100,357-366. 17. Hopman, A. H. N., Wiegant, J., Raap, A. K., Landegent, J. E., Van der Ploeg, M., and Van Duijn, P. (1986) B&color detection of two target DNAs by non-radioactive in situ hybridization. Histochemistry 85, l-4. 18. Emmerich, P., Loos, P., Jauch, A., Hopman, A. H. N., Wlegant, J., Higgins, M. J., White, B. N., Van der Ploeg, M., Cremer, C., and Cremer, T. (1989) Double in situ hybridization in combination with digital image analysis: a new approach to study interphase chromosome topography. Exp. Cell Res 181, 126-140 19. Herrington, C. S., Burns, J., Graham, A. K., Bhatt, B., and McGee, J. 0’. D (1989) Interphase cytogenetics using biotin and digoxygenin labeled probes II: simultaneous differential detection of human and papilloma virus nucleic acids in individual nuclei. J. Clin. Pathol. 42,601-606. 20. Mullink, H., Walboomers, J. M. M., Raap, A. K., and Meyer, C. J L. M. (1989) Two color DNA in situ hybridization for the detection of two viral genomes using non-radioactive probes. Histochemrstry 91, 195-198 21. Kerstens, H. M. J., Poddighe, P. J., and Hanselaar, A. G. J M. (1994) Doubletarget m situ hybridization in brightfield microscopy. J. Histochem. Cytochem 42, 1071-1077.

Analysis of Sperm Aneuploidy by PRINS Franck Pellestor and Jean-Paul Charlieu 1.

Introduction

The estimation of aneuploidy rate in human gametes is a subject of interest and research because nondisjunctions make a major contribution to the chromosomal abnormalities found in humans. Numerous questions remain concerning the occurrence and the etiology of such aneuploidy in gametes. Since human sperm is easier to obtain than mature human oocytes,most of the studies have focused on male gametes. In the last decade, direct information on the chromosomal constitution of human sperm has been obtained thanks to the introduction of the in vitro human sperm-hamster egg fertilization system, which allows the karyotyping of human sperm complements (I,2). This new experimental system has provided a direct method to investigate several points (distribution of nondisjunction, sex ratio, paternal age effect, relationship to infertility) and to determinate the meiotic segregation of chromosomal rearrangements (3,4). The method is time-consuming, labor-intensive, and of little profit in terms of sperm karyotypes obtained. Recently, several laboratories have adapted the interphase fluorescence in situ hybridization (FISH) technique to sperm in order to assessdirectly the incidence of disomy in human gametes (5,6). Aneuploidy has thus been estimated for several chromosomes usmg centromeric repeat probes. However, the use of centromeric probes presents some limitations because several human chromosomes share high levels of homology in their a-satellite DNA sequences, resulting in crosshybridization in FISH reactions (7). The most striking example concerns chromosomes 13 and 21 for which this homology reaches 99.3% (8). In addition, the FISH analysis of spermatozoa is hampered by the fact that the DNA in sperm heads is highly condensed and of difficult access. From: Methods fn Molecular Biology, Vol 71: PRINS and In Situ PCR Protocols Edited by J. R Gosden Humana Press Inc , Totowa, NJ

23

Pellestor and Charlieu

24

The primed in situ (PRINS) technique provides an alternative approach for direct chromosomal detection, Because of the high complementarity between the oligonucleotide primer and its genomic target, PRINS appears to be more efficient than FISH for discriminating between a-satellite DNA sequences.The limitation of the PRINS method for the analysis of nondisjunction in human sperm was initially that only one chromosome could be labeled. Thus, the distinction between diploidy and disomy could not be done by PRINS (9). The recent introduction of multicolor PRlNS protocols has allowed us to overcome this problem (10, II). We have adapted our protocol to human sperm. The efficiency of the method has also been improved by the use of a new sperm pretreatment protocol that permits the simultaneous decondensation and denaturation of sperm nuclei. In PRINS, the decondensation of the sperm head is a less limiting factor than in FISH (where the probes are 200-500 bases long) because of the small size of the oligonucleotide primers (18-30 nucleotides). This facilitates their penetration into sperm nuclei and their access to the genomic sequences, resulting in a more homogeneous and more rapid labeling of sperm nuclei (Fig. 1).

2. Materials 2.7. Preparation of Sperm Samples 1. Phosphate-bufferedsaline (PBS) (Gibco BRL,,Eragny, France). 2. Methanol, 99% (Prolabo, Paris, France). 3. Ethanol, 99% (Prolabo). 4. Glacial acetic acid (Prolabo). 5. 3MNaOH. 6. Clean microscope glass slides.

2.2. Dual-Color

PRINS Reaction

1, 2’-Deoxyadenosine

S-triphosphate

(dATP) 100 mkf (Boehringer

Mannheim,

Meylan, France). 2. 2’-Deoxycytosine5’-triphosphate(dCTP) 100mM(Boehringer Mannheim). 3. 2’-Deoxyguanosine 5’-triphosphate (dGTP) 100 n&f (Boehringer Mannheim) 4. 2’-Deoxythymidine 5’-triphosphate (dTTP) 100 & (Boehringer Mannhelm). 5. Labeled dUTP (1 n&I): Biotin-16-dUTP (Boehringer Mannheim), digoxrgenin11-dUTP (Boehringer Mannheim), fluorescein- 12-dUTP (Boehringer Mannheim), and tetramethylrhodamine-6-dUTP (Boehringer Mannheim). 6. 2’.3’-Dideoxy-adenosine-5’kphosphate (ddATP) 10 mM (Boehringer Mannhelm) 7. 2’.3’-Dideoxy-cytrdine-5’kphosphate (ddCTP) 10 mM(Boehringer Mannheim) 8. 2’.3’-Dideoxy-guanosine-5’-triphosphate (ddGTP) 10 mA4 (Boehringer Mannheim). 9. 2’.3’-Dideoxy-thymidine-5’-triphosphate (ddTTP) 10 mM(Boehrmger Mannheim). 10. Taq DNA polymerase (Boehringer Mannheim) (store at -20°C). Il. 10X Tuq buffer (Boehringer Mannheim) (store at -20°C).

Analysis of Sperm Aneuploidy

25

Fig. 1. (see color plate number 3 after p. 82) Examples of dual-color PRINS labeling of human sperm nuclei. (A,B) Normal haploid spermatozoa bearing distinctive green (chromosome 21) and red (chromosome 9) fluorescent spots. (C) PRINS labeling of a disomic sperm nuclei for chromosome 18. The a satellite DNA of the chromosome 18 is labeled with biotin and detected with fluorescein-avidin-DCS. The c1 satellite of the chromosome 12 is labeled with digoxigenin and detected with antidigoxigeninrhodamine. The arrow indicates a sperm nucleus showing two distinctive green fluorescein spots. (D) A diploid sperm (arrow) observed in a direct labeling PRJNS reaction performed with fluorescein-12-dUTP and rhodamine-6-dUTP for the detection of chromosomes 13 and 16, respectively. The marked nucleus shows two green and two red fluorescent signals. This nucleus is larger than normal haploid sperm nuclei. 12. 13. 14. 15. 16. 17. 18. 19. 20. 2 1.

Glycerol, 87% (Prolabo). Stop buffer: 500 mMNaC1,50 mMEDTA, pH 8.0 (store at 4’C). 20X SSC solution: 3MNaCl,0.3Mtrisodium citrate (store at 4°C). Washing buffer: 4X SSC, pH 7.0,0.05% Tween-20 (Boehringer Mannheim). Blocking buffer: Washing buffer plus 5% nonfat dry milk. Make fresh each time. 10X NT buffer: 500 mMTris-HCl, pH 7.2,50 mMMgS04, 0.1 mMdithiothreito1, 1 mg/mL BSA (store at 4’C). Klenow enzyme (Boehringer Mannheim) (store at -2O’C). Oligonucleotide primer at 50 pmol/$ (see Note 1 and Table 1). Deionized, double-distilled water. Water bath at 72°C.

Pellestor and Charlieu

26 Table 1 The Characteristics of the Oligonucleotide Name

Locus

Chromosome location

9c

a sat

9

12c

ci sat

12

13A

CLsat

13

16c

cxsat

16

18c

a sat

18

21A

a sat

21

22. 23. 24. 25.

Primers Used

Sequences 5’ TATCTGCAAGCG GACGTTTTA 3’ 5’ GTTCAATTCACA GAGTAT 3’ 5’ TGATGTGTGTAC CCAGCT 3’ 5’ TTCTTTTCATAC CGCATTCT 3’ 5’ ATGTGTGTCCTC AACTAAAG 3’ 5’ TGATGTGTGTAC CCAGCC 3’

Annealing temperature, T 51

Optimal concentration, PM 150

60

200

60

100

53

75

65

100

61

150

Water bath at the annealing temperature. 1.5~mL sterile microcentrifuge tubes. Coverslips (22 x 40 mm). PCR machine fitted with a flat plate block. Programs are given for the Techne PHC-3 and the Hybaid Omnigene.

2.3. Detection 1. 2. 3. 4. 5. 6. 7

Fluorescein-Avidin-DCS (Vector Labs, Burlingame, CA). Antidigoxigenin-rhodamine, Fab fragments (Boehringer Mannheim). Anttfade solution Vectashteld (Vector Labs). Propidium iodide (Sigma, St. Louis, MO). 4’, 6-Diamidine-2-phenylindole dihydrochlroride (DAPI) (Boehringer Mannheim). Staining jars. Microscope equipped with triple band pass filter (DAPI:FITC:rhodamine).

3. Methods

3.1. Preparation of Sperm Sample 1, Freshly ejaculated sperm sample is allowed to liquefy at room temperature for 30 min (see Note 2). 2. Dilute sperm 1:lO in PBS and centrifuge for 8 mm at 600g. 3. Resuspend the pellet in 1 mL of fixative (3:1, methanol:glacial acettc acid). 4. Fix 1 h at -2O’C. 5. Place in fresh fixative. 6. Drop the cell suspension on a clean microscope slide from a height of about 5 cm.

Analysis of Sperm Aneuploidy

27

7. The slide is air-dried and stored for l-5 d at room temperature before use for the PRINS reaction. 8. Immediately before the PRLNS reaction, the slide is denatured in 3MNaOH at room temperature for 3-l 1 min depending on its age (see Note 3). 9. Pass slide through ethanol series (70,90, lOO%), 3 min each step, and air-dry.

3.2. PRINS Reaction 3.2.1. First PRINS Reaction 1. Preparation of 10X dNTP mixtures: Dilute 100 mM dATP, dCTP, dGTP, and dTTP 1: 10 in drstilled water. In a microcentrifnge tube, put 10 pL of each diluted dATP, dCTP, and dGTP. Add 0.25 & of diluted dTTP, 25 pL of a l-n&f labeled dUTP, and 55 pL of glycerol 87%. Well mix and store at -20°C. 2. Make up the PRINS reaction mixture by mixing 200 pmol of the oligonucleotide primer, 5 pL 10X Tuq polymerase buffer, 5 pL 10X dNTP mixture (incorporating biotin- 16-dUTP or fluorescein- 12-dUTP), and 2.5 U of Taq DNA polymerase in a 1.5~nIL microcentrifuge tube. Add sterile, double-distilled water to a final volume of 50 pL. 3. Preheat the tube in a water bath at the annealing temperature. 4. Place the prepared slide and a coverslip on the plate block of the PCR machine. 5. Set program for the appropriate temperature. The program consists of two steps: a. Twelve minutes at the annealing temperature, specific to the primer used (see Note 4 and Table 1). The slide and the coverslip are heated alone for 5 min to get them to the annealing temperature. The PRTNS reaction mixture is then placed on the slide and covered with the coverslip. The slide is incubated for a further 7 min at the annealing temperature. b. Thirty minutes at 72’C for nucleotide chain elongation. At the beginning of this second step, the temperature is automatically raised to 72°C. 6. Transfer the slide quickly to 100 mL of preheated stop buffer at 72°C for 3 min to terminate the PRINS reaction.

3.2.2. Intermediate ddNTP Reaction 1. Transfer the slide to 50 mL. of 1X NT buffer at room temperature and wash twice for 5 min with gentle agitation. 2. ddNTP mixture: Mix equal amounts of the four 10 mMddNTPs. Add 1 pL of this stock solution to 199 pL of distilled water to make a 50 @4 ddNTP mixture. Store at -20°C. 3. Make up ddNTP reaction mixture by mixing 4 pL of 50 pA4ddNTP mixture, 4 pL. of 1OX NT buffer, 2 U of Klenow enzyme, and distilled water to a total of 40 pL, 4. Apply the ddNTP reaction mixture to the slide and incubate for 10 min at 37°C (or 30 min at room temperature). This intermediate reaction blocks the free 3’-ends of the first elongation fragment and so prevents mixing of labeling. 5. Wash in stop buffer for 3 min at room temperature. 6. Wash twice for 5 min in 1X NT buffer at room temperature.

28

Pellestor and Char-lieu

3.2.3. Second PRl/VS Reaction 1. In 1S-mL microcentrifugation tube, prepare the second PRINS reaction mixture, including a new primer specific for another chromosome and digoxlgemn- I 1-dUTP or rhodamine-6-dUTP (see Section 3.2.1.) step 2). 2. Prewarm this mixture at the annealing temperature specific for the new primer. 3. Drain excess fluid, and place the slide again on the plate block of the PCR machine. 4 Set program for the second PRINS reaction (see Section 3.2.1.) step 5). 5. Stop the reaction by immersing the slide in stop buffer at 72°C for 3 min.

3.2.4. Detection 1. Wash the slide twice for 3 min at room temperature in 4X SSC, 0.05% Tween-20 with gentle agitation. 2. Drain the slide and apply 100 pL of blockmg buffer. 3. Incubate for 10 min at room temperature under a coverslip. 4. Remove coverslip, drain excess fluid, and apply 100 pL of a 1: 1 mixture of avldin DCS-FITC (5 @nL) and antidigoxigenin-rhodamine (20 pg/rnL) in blockmg buffer to the slide. Place on a new coverslip and incubate for 30 min at 37’C in a moist chamber. 5. Remove the coverslip and wash the slide three times for 5 min in 4X SSC, 0.05% Tween-20 at room temperature with gentle agitation. 6. Drain excess fluid and mount in Vectashield antlfade solution contaming DAPI (0.25 &mL). In case of direct labeling (PRINS reactions performed with fluorescem- 12-dUTP and rhodamine-6-dUTP), omit steps 2-5. 7. Cover with a 22X 40-mm glass coverslip. 8. Examine the slide under UV fluorescence equipped with triple band pass filter (Fig. 1).

4. Notes 1. Primers are oligonucleotides, typically 18-30 bases long, specific for a-satellite DNA sequences of human chromosomes. They are identified by comparing the a-satellite DNA sequence of each chromosome to the consensus a-satellite DNA sequence of human chromosomes established by Choo et al. (12). The primer sequences are selected from the region with the most nucleotide divergences. They are generated on an Applied Biosystem DNA synthesizer (model 38 1A) according to the manufacturer’s instructions. Their sequences and the technical conditions are given in Table 1. For convenience, primers are diluted to 50 pmol/& and stored at -2OY. 2. The human semen sample is usually collected in a sterile container and is processed as soon as liquefaction has occurred. A normal sperm sample should liquefy within 30 min of collection at room temperature. The liquefaction may be hastened by incubating sperm samples at 37°C. 3. The use of a 3M NaOH solution allows the simultaneous decondensation and denaturation of sperm nuclei, with the possibility of a rapid control of the degree

Analysis of Sperm Aneuploidy

29

of nuclear decondensation under the microscope. The time of opttmal NaOH treatment depends on the age of the sperm preparation slides. The longer the slides were aged, the longer they need 3MNaOH treatment: 2 d old, 4 min; 4 d old, 6 min; 6 d old, 8 min; 8 d old, 11 min. Combined with PRINS, this method provides excellent results, i.e., homogeneous sperm decondensation and subsequently a high level of sperm labeling. 4. For each primer, the theoretical melting temperature is calculated, but optimal annealing temperatures must be determined empirically. Usually, efficient annealing temperatures are in the -5 to +5’C range around the theoretical melting temperature (Table 1).

1. Yanagimachi, R., Yanagimachi, H., and Rogers, B. J. (1976) The use of zona-free animal ova as a test system for the assessment of the fertilizing capacity of human spermatozoa. Biol Reprod. 15,471-476. 2. Rudak, E., Jacobs, P. A., and Yanagimachi, R. (1978) Direct analysis of the chromosome constitution of human spermatozoa. Nature 274,9 1 l-9 13. 3. Martin, R. H. and Rademaker, A. (1988) The relationship between sperm chromosomal abnormalities and sperm morphology in humans. Mut. Res. 207,159-l 64. 4. Pellestor, F., Sele, B., Jalbert, H., and Jalbert, P. (1989) Direct segregation analysis of reciprocal translocations: a study of 283 sperm karyotypes from four carriers. Am. J. Hum. Genet. 44,464-473. 5. Guttenbach, M., Schakowski, R., and S&mid, M. (1994) Incidence of chromosome 3, 7, 10, 11, 17 and X disomy in mature sperm nuclei as determined by non-radioactive in situ hybridization. Hum. Genet. 93,7-12. 6. Bischoff, F. Z., Nguyen, D. D., Burt, K. J., and Shaffer, L. G. (1994) Estimates of aneuploidy using multicolor fluorescence in situ hybridizatton on human sperm. Cytogenet. Cell. Genet. 66,237-243. 7. Lebo, R. V., Flandermeyer, R. R., Diukman, R., Lynch, E. D., Lepercq, J. A., and Golbus, M. S. (1992) Prenatal diagnosis with repetitive m situ hybridization probes. Am. J. Med. Genet. 43,848-854. 8. Willard, H. F. and Waye, J. S. (1987) Hierarchical order in chromosome specific human alpha satellite DNA. Trends Genet. 3, 192-198. 9. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling on human spermatozoa. Mol. Reprod. Dev. 40,333-337. 10. Gosden, J, and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRMS). Hum. Mol. Genet. 3,93 l-936. 11. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C!. A., Kolvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in situ by primed in situ labeling (PRJNS). Cytogenet. Cell. Genet. 66, 152-154. 12. Choo, K. H., Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991) A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res 19,1179-l 182.

PRINS DNA Synthesis on Frozen Tissue Sections Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction Primed in situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences in cell preparations (1-4). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,5,6). The detection limit of the PRINS technique appears to be in the order of low-copy sequences (3,7). Here we describe an easy protocol for the application of the PRINS labeling reaction to frozen tissue sections (81. In this way, individual cells can be identified in their tissue context and be analyzed for their copy numbers of specific chromosome regions. Both tissue fixation and proteolytic digestion before performing the PRINS reaction proved to be the critical steps in the total procedure permitting access of the PRINS reactants, while preserving the morphology of the nuclei in the tissue. Such pretreatment steps have also been shown to be essential for efficient application of ISH to tissue sections (9, IO). Examples are shown of fluorescence and bright-field detection protocols for labeled DNA sequences m normal diploid tissue nuclei (Fig. lC-E). From. Methods in Molecular Biology, Vol. 71’ PRINS and In Situ PCR Protocols EdlIed by J R Gosden Humana Press Inc., Totowa, NJ

31

Fig. 1. (see color plate number 2 after p. 82) (C) Bright-field detection of chromosome 9 centromeres with biotin/PO-TMB in a frozen tissue section of normal colon epithelium after PRINS, hematoxylin counterstaining, and immersion oil embedding. (D) Brightfield detection of chromosome 9 centromeres with biotin/PO-DAB in a frozen tissue section of normal bladder epithelium after PRINS, hematoxylin counterstaining, and PBS/glycerol (1:9) embedding. (E) Direct fluorescence detection of chromosome 9 centromeres with fluorored (red) in a frozen tissue section of normal bladder epithelium after PRINS and PBS/glycerol/DABCO embedding with DAPI counterstaining.

2. Materials 2.1. PRINS DNA Labeling 1. Pepsin from porcine stomach mucosa (2500-3500 U/mg) (Sigma, St. Louis, MO). 2. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100~mM solutions of dATP, dCTP, dGTP, and dTTP. 3. Biotin- 16-dUTP, digoxigenin- 11 -dUTP, fluorescein- 12-dUTP (Boehringer, Mannheim, Germany), fluorored-dUTP (Amersham, Little Chalfont, UK). 4. Oligonucleotide primers (see Table 1 of Chapter 3) at 250 ng/pL. 5. Tag DNA polymerase (Boehringer) or AmpliTaq (Perkin Elmer, Chalfont St. Giles, UK). 6. Bovine serum albumin (BSA) (Sigma). 7. 20X SSC: 3MNaC1, 300 n-&I trisodium citrate, pH 7.0.

PRINS DNA Synthesis 8. 9. 10. 11. 12. 13. 14.

33

10X Tuqbuffer: 500 mMKC1, 100 mMTris-HCl, pH 8.3,15 mMMgCl,, 0.1% BSA. PRINS stop buffer: 500 mMNaCl,50 mMEDTA, pH 8.0. Washing buffer: 4X SSC (diluted from 20X SSC), 0.05% Triton X- 100. Ethanol/37% HCl(100: I)-cleaned microscope slides and coverslips. Rubber cement. Water bath at 65*C. Thermal cycler (Hybaid Omnigene Flatbed) (Hybaid, Teddington, UK).

2.2. Cyfochefnicel

Defection

1. Dried skimmed milk powder. 2. Normal goat serum (NGS).

3. Horseradish peroxidase-conjugated avidin (AvPO) (Dako, Glostrup, Denmark). 4. Horseradish peroxidase-conjugated sheep antidigoxigenin Fab fragments (SHADigPO) (Boehringer). 5. 30% HzOz (Merck, Darmstadt, Germany). 6. Diaminobenzidine (DAB) (Sigma). 7. 3,3’,5,5’-Tetramethylbenzidine (TMB) (Sigma). 8. Dioctyl sodium sulfosuccinate (DSSS) (Sigma). 9. Sodium tungstate (Sigma). 10. Immersion oil (Zeiss). 11. Vectashield (Vector Brunschwig Chemie, Amsterdam, The Netherlands). 12. 4’,6-Diamidino-2-phenyl indole (DAPI) (Sigma). 13. PO-DAB buffer: 0. 1M imidazole (Merck) in PBS, pH 7.6. 14. PO-TMB buffer: 100 m&f citrate-phosphate buffer, pH 5.1. 15. Hematoxylin: Hematoxylin (Solution Gill no. 3) (Sigma):dutrlled water (1:4). 16. Blocking buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 17 Washing buffer: 4X SSC, 0.05% Triton X-100. 18. Incubator at 37“C. 19. Zeiss Axiophot microscope (for fluorescence and bright-field microscopy). 20. Kodak 400 ASA and 100 ASA film. 2 1. Blue and magenta filters.

3. Methods 3.1. PRINS DNA Synthesis 1. Fresh tissue samples obtained after surgical resection are snap frozen in liquid nitrogen. From each sample, cut 4-pm sections with a cryostat, mount them on poly+lysine-coated slides, and store at -20°C until use. 2. Air-dry slides, fix in methanol:acetic acid (3:l) for 10 min at room temperature (see Note l), and air-dry again. 3. Wash slides for 5 min in PBS and 2 min in O.OlMHCl. 4. Treat samples with 100 pg/mL pepsin in O.OlMHCl for 10 min at 37’C, wash for 2 min in O.OlMHCl at 37OC, and pass the slides through an ethanol series starting with 70% ethanol in O.OlM HCl (Note 2).

34

Speel et al.

5. Postfix samples in 1% paraformaldehyde m PBS for 20 min at 4”C, wash in PBS for 5 min, dehydrate, and subject slides to the PRINS procedure. 6. Prepare the PRINS reaction mix on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water. Dilute 100 m/l4 dTTP 1: 100. Put together in a mlcrocentrifuge tube: 1 pL of each of the diluted dNTPs, 1 & of either 1 mM biotin- 16-dUTP, digoxigenin- 11-dUTP, fluorescein-12-dUTP, or fluororeddUTP (see Note 3), 5 pL of 10X Tag buffer, 250 ng of oligonucleotide (see Note 4), 1 U Taq polymerase, and distilled water to 50 pL. 7. Place 40 $ of this mixture under a coverslip on the slide, seal with rubber cement, air-dry the rubber cement, and transfer to the heating block of the thermal cycler. 8. Each PRINS reaction cycle consists of 2 min at 94°C (for denaturation of cellular DNA, see Note 5), 5 min at the appropriate annealing temperature (see Note 6), and 15 mm at 72°C for zn situ primer extension. 9. Stop the PRINS reaction by tran& -ing the slides (after removal of the rubber solution seal) to 50 mL. of PRINS stL buffer in a Coplin jar at 65’C for 1 min. 10. Transfer the slides to washing buffer at room temperature, and wash for 5 mm.

3.2. Enzyme Cytochemical

Detection

1. Place 40 & of blocking buffer under a coverslip on the slide, and leave for 5 min at room temperature to reduce background staining in the detection procedures 2. Wash slides for 5 min in washing buffer. 3. For reactions using biotin- 16-dUTP: Dilute AvPO 1: 100 in blocking buffer and apply 50 pL under a coverslip. Incubate slides for 30 min at 37’C in a humid chamber (Note 7). 4. For reactions using digoxigenin- 11-dUTP: Dilute SHADlgPO 1: 100 in blocking buffer and treat as in step 3 (Note 7). 5. Fluorescein-12-dUTP and fluorored-dUTP need no additional reporter and are simply mounted as described in step 11 (see Note 7). 6. Wash slides for 2 x 5 min in washing buffer and for 5 min tn PBS. 7. Visuahze the PRINS-labeled DNA target by an appropriate horseradish peroxidase (PO) reactlon (I I; see also Chapter 3): a. Horseradish peroxldase-diaminobenzidine (PO-DAB) reaction: Mix 1 mL 5 mg/mL DAB in PBS, 9 mL PO-DAB buffer, and 10 $ 30% Hz02 just before use, and overlay each sample with 100 pL under a coverslip. Incubate the slides for 5-15 min at 37”C, wash 3 x 5 min with PBS, and dehydrate optionally. b. Horseradish peroxidase-tetramethylbenzidine (PO-TMB) reaction: Dissolve 100 mg sodium tungstate in 7.5 mL PO-TMB buffer, and adJust the pH of this solution to 5.0-5.5 with 37% HCl. Just before use, dissolve 20 mg DSSS and 6 mg TMB in 2.5 mL 100% ethanol at 80°C. Mix both solutions with 10 & H202, and overlay each sample with 100 J.& under a coverslip. Incubate the slides for l-2 mm at 37”C, wash 3 x 1 min with ice-cold O.lM phosphate buffer (pH 6.0), and dehydrate.

PRINS DNA Synthesis

35

8 After performing the enzyme reaction, counterstain the samples with hematoxylin, wash for 5 min in tap water and 2 mm in distilled water, and air-dry if you wish. 9. Mount samples with the PO-DAB or PO-TMB precipitate in an organic mounting medium or immersion oil. The PO-DAB precipitate can also be embedded in an aqueous mounting medium. Mount samples with fluorescent PRINS signals in Vectashield containing 0.5 pg/mL DAPI. 10. Examine slides with absorption PRINS signals under a bright-field microscope. Microphotographs can be made using blue and magenta filters and Kodak 100 ASA film. Slides with fluorescent PRINS signals can be analyzed under a fluorescence microscope equipped with suitable filters. Selected cells can be either directly photographed using Kodak 400 ASA film, visualized with a charge-coupled device (CCD) camera, or scanned with a confocal scanning laser microscope (CSLM).

4. Notes 1. Fixation of frozen tissue sections with other fixatives, such as acetone (10 min at -2O’C), methanol (10 min at -2OY!), methanol/acetone (1 min at -2O”C/3 x 5 s room temperature), 70% ethanol (10 min at -2O’C), and 70% ethanol/l% formaldehyde (10 min at -2O”C), resulted in poor preservation of cell morphology after PRINS. In addition, we frequently observed fluorescent staining of the entire nucleus after PRINS labeling of methanol/acetone-fixed tissue sections, probably caused by nuclease activities that survived methanol-acetone fixation (8). 2. Dehydration of the samples after pepsin treatment starting with 70% ethanol in O.OlMHCl helps in preserving cell morphology (manuscript in preparation). 3. In the case of labeling with biotin- 16-dUTP or fluorescein- 12-dUTP, a four times decrease of the concentration of dTTP in the PRINS reaction mix resulted in significant stronger labeling of DNA sequences. Under the described standard conditions, digoxigenin-1 l-dUTP and fluorored-dUTP provide the highest sensitivity. However, all the modified nucleotides are suitable for detection of repeated sequences in situ. 4. The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide in 40 & is used for primers of 16-30 bases complementary to repeated sequences. 5. Separate denaturation of cellular DNA in 70% formamide/2X SSC, pH 7.0, for 2 min at 70°C before the PRINS reaction, as is usually performed for chromosome preparations, resulted in no or only weak PRINS labeling of DNA sequences in situ. Whether this is caused by inefficient primer annealing or extension is not clear at the moment. The same phenomenon is also observed for PRINS on ethanol-fixed cells (see Chapter 8). 6. The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. 7. Amplification of PRINS signals can be achieved as follows: a. AvPO detection of biotin-16-dUTP may be followed by incubation with biotinylated goat antiavidin (Vector), 1: 100 diluted in blocking buffer, and again AvPO.

Speel et al.

36

b. SHADigPO detection of digoxigenin-1 l-dUTP may be substituted with incubation with monoclonal mouse antidigoxin (Sigma), PO-ConJugated rabbit antimouse IgG (Dako), and PO-conjugated swine antirabbrt IgG (Dako). c. FITC-12-dUTP signals may be amplified by incubation with monoclonal mouse anti-FITC (Dako) and FITC-conjugated rabbit antimouse IgG (Dako). d. Fluorored-dUTP signals cannot be amplified, since antirhodamin antibodies are not commercially available at this time. e. Amplification of PRINS signals may also be achreved by combimng these detection systems with peroxidase-mediated deposition of hapten- or fluorochrome-labeled tyramides (12,13)

References 1 Bains, M. A., Agarwal, R., Pringle, J. H., Hutchmson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by primer-induced in srtu (PRINS) fluorescent nucleotide labeling. Exp Cell Res. 208,321-326. 2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., HindkJaer, S., Kiilvraa, S , and Bolund, L (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labeling with fluorescein-12-dUTP. Cytogenet Cell Genet 60, l-3. 3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-936. 4. Pellestor, F., Girardet, A., Lefort, G., Andrea, B., and Charheu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mol. Reprod Dev 40,333-337. 5. Him&jar, J., Koch, J., Terkelsen, C., Brandt, C. A., Karlvraa, S., and Bolund, L (1994) Fast, sensitive multicolor detection of nucleic acids in .sn.uby primed m situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54. 6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultrPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet. 95,29-33. 7. Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in situ detection of the B-hordein gene cluster on barley chromosome 1H. Proc. N&l. Acud. Sci. USA 90, 11,821-l 1,824. 8. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N. (1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA in chromosome preparations and frozen tissue sections. Biotechniques 20,226-234. 9. Hopman, A. H. N., Van Hooren, E., Van der Kaa, C. A., Vooijs, G P., and Ramaekers, F. C. S. (1991) Detection of numerical chromosome aberrations using in situ hybridization in paraffin sections of routinely processed bladder cancers. Mod. Path01 4,503-513. 10. Hopman, A. H. N., Poddighe, P. J., Moesker, O., and Ramaekers, F. C. S. (1992) Interphase cytogenetics: an approach to the detection of genetic aberrations m

PRINS DNA Synthesis

37

tumours, in Diagnostic Molecular Pathology, A Practical Approach, vol. 1 (Herrington, C. S. and McGee, J. O’.D., eds.), IRL, Oxford, pp. 141-167 11. Speel, E. J. M., Jansen, M. P. H. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1994) A novel trrple-color detection procedure for brightfield microscopy, combining in situ hybridization with immunocytochemrstry J. Hzstochem. Cytochem. 42,1299-1307.

12. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G J. (1989) Catalyzed reporter deposition, a novel method of signal amplification. Amplification to immunoassays. J. Immunol. Methods 125,279-285. 13. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemrcal detection systems for in situ hybridrzation, and the combmatron with immunocytochemistry. Histochem. J 27,833-858.

Multiple Sequential Oligonucleotide Primed /n Sctu DNA Syntheses (MULTI-PRINS) John R. Gosden and Diane Lawson 1. Introduction Conventional PRINS (if it is possible to use such a description for a relatively new technique) is capable of identifying and quantifying chromosomes or chromosome pairs in metaphase or interphase cells (1-4). Each PRINS reaction can only identify one pair of homologous chromosomes, because the nature of the reaction means that the product of only one primer or primer pair can be specifically labeled in each reaction. However, by inserting a blocking step after each PRINS reaction to ensure that the 3’-ends of the products of the previous reaction cannot act as primers for the next reaction, it is possible to perform several PRINS reactions on a single slide, and therefore ascertain the number of each of several pairs of chromosomes present in a given sample.

2. Materials 2.1. PRINS Synthesis 1. Twin-Frost glass slides and 22 x 40 mm covershps The slides must be cleaned by soakingm ethanol,to which a few drops of HCI have been added,followed by

polishing with a cleanpiece of muslin before the cells are depositedon the slide. 2. 3. 4. 5.

Coverslips must be cleaned in the same way before use. PRINS buffer (10X): 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 m/L4 MgCl,, 0.1% BSA. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled H20. 2’-Deoxycytidine 5’-triphosphate (dCTP): lOO-rmI4solution (Pharmacia Biotech), diluted 1: 10 with sterile distilled H,O. 2’-Deoxyguanosine 5’-triphosphate (dGTP): 100-M solution (Pharrnacia Biotech), diluted 1.10 with sterile distilled H,O. From

Methods m Molecular Biology, Vol. 71’ PRM and In Situ PCR Protocols Edlted by J FL Gosden Humana Press lnc , Totowa, NJ

39

Gosden and Lawson

40 Table 1 Primers for X and Y Chromosomes D599 (27-mer)

DYZl

D600 (27-mer)

DYZl (pair for D599) DXZl DXZI (pair for E563)

E563 (23-mer) E564 (23-mer)

TGGGCTGGAATGGAAAGGAATCGAAAC TCCATTCGATTCCATTTTTTTCGAGAA ATAATTTCCCATAACTAAACACA TGTGAAGATAAAGGAAAAGGCTT

6. 2’-Deoxythymidine 5’-triphosphate (dTTP): 100-d solution (Pharmacia Biotech), diluted 1: 100 with sterile distilled H,O. 7. Biotin- 16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim, Germany). 8. Digoxigenin-I 1- deoxyuridine-5’-triphosphate (Dig- 1 l-dUTP) (Boehringer Mannheim). 9. FluoroRed (Amersham International, plc., Buckinghamshire, England). 10. FluoroGreen (Amersham International, plc.). 11. FluoroBlue (Amersham International, plc.). 12. Oligonucleotide primer(s) at 250 ng/mL. See Note 1 Examples of primers are shown in Table 1, and results wrth these primers in Fig. 1. 13. Tug DNA polymerase (Tuq [Boehringer], AmpliTuq [Perkm Elmer, Foster Crty, CA] or ThermoprimerlUs [Advanced Biotechnologies Ltd., Leatherhead, England]). 14. Rubber cement (vulcanizing solution) (e.g , Tip-Top, Stahlgruber, DS-8011 Pomg, Germany) (see Note 2). 15 Stop buffer: 500 mM NaCl, 50 mA4 EDTA. 16. Flat-bed thermal cycler (see Note 3). 17. Water bath at 65OC.

2.2. Blocking 1 2. 3. 4. 5. 6

0.025 mA4 2’,3’ dideoxyadenosine 5’-triphosphate (ddATP) (Pharmacia). 0.025 mM2’,3’ dideoxycytidine 5’-triphosphate (ddCTP) (Pharmacia). 0.025 mM2’,3’ dideoxyguanosine 5’-triphosphate (ddGTP) (Pharmacta). 0.025 mA4 2’,3’ dideoxythymtdine 5’-triphosphate (ddTTP) (Pharmacia). DNA polymerase 1, large fragment (Klenow enzyme) (Boehringer Mannheim). 10X Nick translation buffer (10X NT): OSM Tris-HCl, pH 7.2, O.lM MgS04, 0.1 n&f dtthiothreitol, 1.5 mg/mL BSA.

2.3. Defection 1. 2. 3. 4. 5.

Dried skimmed milk powder. Avidin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlingame, CA). Avidm-DCS-Texas red (Av-TR) (Vector Labs). Antidtgoxigenin-fluorescein (anti-DIG-FITC) (Boehringer Mannheim). Antidigoxigenin-rhodamine (anti-DIG-rhodamine) (Boehringer Mannheim).

MUL TI-PRINS

Fig. 1. (see color plate number 4 after p. 82) Double PRINS with primers for X and Y chromosomes. These primers produce cleaner signal with less background when used in pairs as shown in Table 1. (A) X chromosome labeled with biotin and detected with avidinFITC; Y chromosome labeled with FluoroRed. (B) X chromosome labeled with digoxigenin and detected with antidigoxigenin-rhodamine; Y chromosome labeled with biotin and detected with avidin-FITC. Note label clear in interphase nuclei aswell as on chromosomes. 6. 7. 8. 9. 10. 11. 12. 13.

Propidium iodide (20 pg/mL). 4’,6-diamidino-2-phenylindole 2 HCl (DAPI) (100 pg/mL). VectaShield (Vector Labs). 20X SSC: 3.0MNaC1,0.30Mtri-sodium citrate, pH 7.3. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100. Blocking buffer: Wash buffer with the addition of 5% skimmed milk powder. Incubator or water bath at 37’C and water bath at 45°C. Microscope equipped for epifluorescence (e.g., Zeiss Axioskop or Leitz Ortholux II with Pleomopak filter system).

3. Methods 3.1. PRINS Perform the first PRINS reaction as described in Chapter 1, using biotin or digoxigenin as the label (see Note 4).

Gosden and Lawson

42 3.2. Block

1. Make up the block reaction with (for each slide) 4 I,& of each of the four ddNTPs, plus 4 & 10X NT, and distilled water to a total of 40 pL. 2. After the stop buffer (Section 3.1.) step 7 in Chapter l), pass the slides through an ethanol series, air-dry, rinse them briefly in 1X nick translation buffer, and shake off the surplus fluid. 3. Add 1 U Klenow enzyme/slide to the block reaction and altquot 40 pL onto each covershp 4 Pick up the coverslips with the slides and incubate m a humid chamber (e.g , a plastic box contaimng damp filter paper) for 1 h at 37’C. 5. Pass the slides through an ethanol series (70,90, and lOO%), and air-dry before starting the second PRINS reaction.

3.3. Second and Third PRINS 1. Make up a standard PRINS reaction mix, with a different primer and reporter (e g., use biotin for the first PRINS, digoxigenin for the second, and FluoroRed for a third), and perform annealing and extension stages of the reaction, omitting the denaturation step (see Note 5). 2. Stop as before, and, if a third PRINS is required, go through the blockmg process again (Section 3.2., steps 1-5) before carrying out the third PRINS. 3 Otherwise, transfer to 4X SSC; 0.05% Triton X-100

3.4. Detection It is important this process.

that the slides do not become

dry at any time

during

1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45’C for a few seconds. 2. Put 40 pL blocking buffer on a clean coverslip, shake surplus wash buffer from slide, and pick up coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 mm. 3. Dilute reporters (see Note 6) in blocking buffer (antidigoxtgenm-fluorochrome at 1: 100 dilution; avidin-fluorochrome at 1:500). Make sufficient for 40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed during storage that can cause htgh and nonspecific background. 4. Remove the coverslip from the slide, shake surplus fluid off both slide and coverslip, and add 40 $ of reporter solutton to the same coverslip. Replace the slide, and incubate (unsealed) in a moist chamber (e.g., a sandwich box lined with damp filter paper) at 37°C for 30 min. 5. Meanwhile, warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove coverslips, and wash slides 3 x 2 mm in wash buffer at 45°C. 6. After the final wash, shake off surplus fluid and mount slides in VectaShield. For double PRINS, this may contain the appropriate counterstain: For slides labeled with rhodamine or Texas red plus FITC, this should be DAPI (5 pg/lOO pL

MULTI-PRINS

43

VectaShield, i.e., 5 pL DAPI stock/100 pL Vectashield); for triple PRINS, no counterstain can be used (see Note 7). Use 20-30 pL mountant/slide, blot surplus by covermg slide and coverslip with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored in the dark at 4OC for several months. If the stain shows signs of fading, simply remove the coverslip, soak the slide overnight in 4X SSC, 0.05% Triton X-100, and remount as above.

4. Notes 1. Oligonucleotide primers can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol precipitation and washing. If this facility is not available, they may be obtained from commercial sources (e.g., Advanced Biotechnologies Ltd., Leatherhead, England), but purification steps, such as HPLC, are not needed and only increase the cost of the product, 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found Tip-Top fulfills all these parameters, and 1s readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely available. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines desrgned for PCR m microtubes, with a plate added to the heated block. Thermal transfer and temperature control in such a system are rarely satisfactory. The procedure can be carried out by transferring slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precise, and the temperature drop during the transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which take 4 and 20 slides, respectively. 4. The order m which primers are used is important. The reaction giving the weakest signal should be performed first, with the strongest label (digoxigenin or biotin), and that with the strongest signal last, with the weakest label (a direct fluorochrome label). This is significant for two reasons: The weakest signal contains the fewest new molecules, and thus has the least number of free 3’-ends to block, and any renaturation of chromosomal DNA during the annealing and extension step will be minimized, giving the most efficient reaction condittons. 5. No denaturation is needed after the first PIUNS, since the chromosomal DNA remains denatured through the PRINS incubations. 6. Choose reporters with care. Texas red avidin (Av-TR) gives a signal clearly distinguished from antidigoxigenin-FITC, and these are the best choices for double PRINS. However, for triple PRINS, the choice will depend on whether all three primers are chromosome-specific (as in Fig. 1A) or whether one of them is intended to produce a banding pattern (as in Fig. 1B). 7. If only two pairs of chromosomes are being targeted, a third primer labeling the Ah sequence can be used, since this produces an R-band pattern. If three

Gosden and Lawson

44

pairs of chromosomes are targeted, no colors are left for staining the chromosome arms, but there is usually sufficient background stain for these to be visible (see Fig. 1A).

References 1. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Ohgonucleotide-priming methods for the chromosome-specific labellmg of alpha satellite DNA in situ. Chromosoma 98,259-265. 2. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mttchell, A., and Porteous, D. (1991) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet. Cell Genet 57, 100-104. 3. Gosden, J. and Lawson, D (1994) Rapid chromosome identification by oligonucleotide primed m situ DNA synthesis (PRINS). Hum. Mel Genet. 3,93 l-946. 4. Gosden, J. and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequences m situ. Cytogenet. Cell Genet. 68, 57-60.

Oligonucleotide PRINS DNA Synthesis on Extended Chromatin Preparations Yoshiro Shibasaki and John R. Gosden 1. Introduction One of the inherent problems with conventronal fluorescent in situ hybridization (FISH) on metaphase chromosomes has been the difficulty in resolving closely associated markers. Any targets separated by less than about 1 Mb (1 x 1O6bp) tend to appear as a single locus on metaphasechromosomes.The first approach to improving this resolution was hybridization to interphase nuclei (Z,Z), in which, because the chromatin is decondensed, the markers are further apart and, therefore, more easily resolved. However, the chromatin in interphase nuclei is not identifiable as discrete strands, so it is both difficult to see whether two markers are definitely linked and impossible to tell whether, if they are physically linked, the chromatin between them follows a straight course or a convoluted one. Thus, it is necessary to measure the distance between a large number of signal pairs to establish modal and average figures for the distance between them. By this means, it has been possible to establish physical distances between markers as little as W-100 kb (5 x 104-10’ kbp) apart. Recently, a number of methods have been described that permit the generation of free, partly decondensed chromatin fibers (3-7). FISH can be performed on this material with much greater resolution than on metaphase chromosomes, and because the path of the chromatin fibers is generally linear, if not entirely straight, and can be readily traced, mapping physical distances and establishing linkage is relatively easy, and markers can be mapped when they are separated by as little as 3-5 kb. An alternative approach can be made with Oligonucleotide Primed In Situ DNA synthesis (PRINS) (see Chapter 1 and refs. &I I). This technique can be usefully applied to extended chromatin both for the structural analysis of chromatin organization and, by combining FISH From

Methods in Molecular Bology, Vol 71: PRlNS and In Situ PCR Protocols Edited by J R Gosden Humana Press Inc , Totowa, NJ

45

Shibasaki and Gosden

46

with PRINS, for relating mapped markers to specific chromatin

organization

patterns (12).

2. Materials 2.1. Extended 1. 2. 3. 4 5.

Chroma tin

Cleaned glass slides as in Chapter 1. Lysis solution: 50 mA4NaOH, 30% ethanol. Phosphate-buffered saline (PBS). Methanol. Ethanol series: 70,95, 100%.

2.2. PRINS 1. PRINS buffer (10X): 500 mMKC1, 100 mMTris-HCl, pH 8.3, 15 mMMgC12, 0.1% BSA. 2. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-w solution (Pharmacia Biotech, St. Albans, UK), diluted 1: 10 with sterile distilled H,O. 3. 2’-Deoxycytidine 5’-triphosphate (dCTP): lOO-tisolution (Pharmacra Blotech), diluted 1: 10 with sterile dlstilled H20. 4. 2’-Deoxyguanosine 5’-triphosphate (dGTP): 100-d solution (Pharmacia Biotech), diluted 1: 10 with stenle distilled H20. 5. 2’-Deoxythymidine 5’-triphosphate (dTTP): 100-n& solution (Pharmacia Biotech), diluted 1: 100 with sterile distilled H,O. 6. Digoxlgenin- 11 -deoxyundme-5’-triphosphate (Dig-1 1-dUTP) (Boehringer Mannheim, Lewes, Sussex). 7. FluoroRed (Amersham Internatlonal, plc, Buckinghamshire, England). 8. FluoroGreen (Amersham International). 9. Oligonucleotlde primer(s) at 250 ng/mL. See Note 1. 10. Taq DNA polymerase (Tag [Boehringer], AmpliTuq [Perkm Elmer, Foster City, CA], or ThermoprimeP’us [Advanced Biotechnologies Ltd., Leatherhead, England]). 11. Rubber cement (vulcanizing solution) (e.g., Tip-Top, Stahlgruber, DS-80 11 Poing, Germany) (see Note 2). 12. Stop buffer: 500 mMNaC1,50 mM EDTA. 13. Flat-bed thermal cycler (see Note 3). 14 Water bath at 65’C.

2.3. Detection 1. 2. 3. 4. 5. 6.

Dried skimmed milk powder. Antidigoxigenin-fluorescein (anti-DIG-FITC) (Boehringer Mannheim). Antidigoxigenin-rhodamine (anti-DIG-rhodamine) (Boehringer Mannheim). Propidium iodide (20 pg/mL) (Sigma, St. Louis, MO). 4’,6-Diamidino-2-phenylindole 2 HCl (DAPI) (100 @rnL) (Sigma). VectaShield (Vector Labs, Burlingame, CA).

PRlNS on Chromatin

47

Table 1 Examples of Primers Used with Extended ChromatiV E528 (20-mer) D7Z 1, alphoid AGCGATTTGAGGACAATTGC E529 (20-mer) D7Zl (pair CCACCTGAAAATGCCACAGC for E528) 435 (26-mer) p satellite AGTGCAGAGATATGTCACAATGCCCC 450 (19-mer) Ah, 5’-end of AAAGTGCTGGGATTACAGG consensus OResultswith these pnmers are shownm Fig. 1.

7. 8. 9. 10. 11.

20X SSC: 3.OMNaCI,0.30Mtrisodium citrate, pH 7.3. Washbuffer: 4X SSC(diluted from stock20X SSC),0.05% Triton X-100. Blocking buffer: wash buffer with the addition of 5% skimmedmilk powder. Incubator or water bath at 37OCand water bath at 45°C. Microscopeequippedfor epifluorescence(e.g.,Zeiss Axioskop or Leitz Ortholux II with Pleomopakfilter system).

3. Method 3.1. Extended Chrometin In the center of a cleaned glass slide, drop 20 clr, of fixed-cell suspension (stored metaphase chromosome preparations kept in fix at -20°C can be used for up to 1 yr). Before the drop is completely dried, immerse the slides in PBS in a Coplin jar and incubate for 1 min. This procedure neutralizes the acid fix in which the cells are suspended. Blot excessby shaking the slide and touching the edge to filter paper, and pipet 100 pL of lysis solution on the slide held horizontally followed by 100 & of methanol gently on top of the lysis solution. The rapid change of surface tension pulls out the chromatin fibers from the lysed cells. Blot excess fluid as above and air-dry the slides. When they are dry, pass the slides through an ethanol series from 70 to 100% and air-dry. Place the slides in an incubator at 80°C for 1 h, and allow to cool. 3.2. PRINS 1. Slides of extendedcbromatin as above should be storedunder vacuum at room temperatureandusedwithin a weekof preparation.Always usenormal metaphase chromosomepreparations(as in Chapter 1) as controls for eachreaction. 2. Oligonucleotide primers are prepared on an Applied Biosystems(Foster City, CA) Model 381A DNA synthesizeraccording to the manufacturer’s instructions. Examplesof primers are given in Table 1, and resultswith theseprimers shown in Fig. 1. 3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the diluted nucleotide triphosphates, plus 1 & of the selected labeled dUTP

48

Shibasaki and Gosden

Fig. 1. (see color plate number 5 after p. 82) PRINS with extended chromatin. (A) Chromosome 7-specific c1satellite labeled with biotin and detected with avidin-FITC. This satellite DNA is located at the centromere of chromosome 7. Note the extension of what is normally a highly condensed region of chromatin. (B) l3 satellite, labeled directly with FluoroRed and counterstained with DAPI. This is a fairly low-copynumber tandem repeated sequence, with the highest concentrations at the centromere of chromosome 1 and adjacent to the ribosomal DNA on the acrocentric chromosomes. Note the concentrations of label, interspersed with unlabeled DNA, indicating that only some of the DNA is complementary to the primer, and that other sequences are interspersed with the S satellite. (C) Alu, labeled with biotin and detected with avidinFITC. A clear distinction can be seen between the &u-rich and&u-poor regions of the chromatin strand.

PRINS on Chromatin

4.

5. 6. 7. 8.

9.

49

(digoxigenin or a fluorochrome-dUTP), 5 pL 10X PRINS buffer, and 1 pL of the appropriate oligonucleotide primer (see Note 5) into a microcentrifuge tube, and add distilled water to 50 pL. Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and place 40 JJL on a clean coverslip. It is simpler, when using the same primer reaction on several slides (e.g., extended chromatin and normal controls), to make up a bulk reaction nux (50 & x n, where n is the number of slides) and aliquot to the coverslips. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with least risk of introducing air bubbles), and seal with rubber cement. Dry the seal (a cold air fan is quick and safe), and transfer the slides to the flat block of a thermal cycler. A suitable basic program for the Hybaid OmniGene In Situ, or Hybaid OmniSlide is at 93°C for 3 min; at 6O’C for 5-10 min; at 72’C for 15 min. On completion of the program, remove the seal (it peels off easily by rubbing one corner) and transfer the slides for 1 min to a Coplin jar containing stop buffer at 65°C. Leave the coverslips in place, unless they come off readily with the seal; they will m any case fall off in the stop buffer. If the slides are subsequently to be subjected to FISH, treat as in Note 6; otherwise, continue as in Section 3.3. After 1 min, transfer the slides to a stain dish containmg wash buffer. They may be held in this solution overnight if convenient (but see Note 7).

3.3. Detection It is important that the slides do not become dry at any time during this process. The following steps apply only to slides in which the PRINS reaction has been labeled with digoxigenin. Slides in which the reaction used a fluorochrome-dUTP as the label require no detection step and are simply mounted (see step 6). 1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is warmed to 45“C for a few seconds. 2. Put 40 pL blocking buffer on a clean coverslip, shake surplus wash buffer from slide, and pick up coverslip containing blocking buffer. Leave (unsealed) at room temperature for 5 min. 3. Dissolve reporter (antldigoxigenin-fluorochrome) in blocking buffer at 1: 100 dilution Make sufficient for 40 ,&/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that may have formed durmg storage, and can cause high and unspecific background. 4. Remove the coverslip from the slide, shake surplus fluid off both slide and coverslip, and add 40 pL of reporter solution to the same coverslip. Replace the slide and incubate in a moist chamber (e.g., a sandwich box lined with damp filter paper) at 37°C for 30 min. 5, Meanwhile, warm a reagent bottle contaming wash buffer to 45°C in a water bath. Remove coverslips and wash slides 3 x 2 min in wash buffer at 45°C.

50

Shibasaki and Gosden

6. After the final wash, shake off surplus fluid and mount slides m VectaShield containing the appropriate counterstain: for slides labeled with rhodamine or Texas red, this should be DAPI (5 pg/lOO pL VectaShleld, i.e., 5 cls, DAPI stock/100 & Vectashield); for shdes labeled with FITC!, this should be a propidlum iodide/DAPI mixture (7.5 pL of each stock solution1100 & VectaShield). Use 20-30 pL mountant/slide, blot surplus by covering slide and coverslip with a tissue and pressing gently to expel excess mountant, and seal with rubber cement. Slides may be stored in the dark at 4°C for several months. If the stain shows signs of fading, simply remove the coverslip, soak the slide overnight m 4X SSC, 0.05% Triton X-100, and remount as above.

4. Notes 1. Oligonucleotide pruners can be synthesized on an ABI DNA synthesizer and used without further purification other than alcohol precipitation and washing. If this facility is not available, they may be obtained from commercial sources, but purification steps, such as HPLC, are not needed, and only increase the cost of the product. 2. The requirement for a suitable seal is that it should be reasonably robust, provide a vapor-tight seal, and be easily and completely removed at the end of the procedure. We have found that Tip-Top fulfills all these parameters and is readily available from bicycle repair shops. 3. Thermal cyclers with a flat bed for microscope slides are not yet widely available. Some of the products sold for this purpose are not altogether suitable, since they are ad hoc modifications of machines deslgned for PCR in microtubes, with a plate added to the heated block. Thermal transfer and temperature control in such a system are rarely satisfactory. The procedure can be carried out by transferring slides through a series of water baths at appropriate temperatures, but this too means that temperature control cannot be precue, and the temperature drop during the transfer from water bath to water bath leads to high backgrounds. The most suitable purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid (Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively. 4. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for several months. Slides are prepared fresh each week by gently centrifuging to precipitate, resuspending in fresh fix, repeating this process, and finally resuspending in sufficient fix to give a suitable density and putting one drop on a clean slide, which is allowed to dry at room temperature. The balance of the suspension may then be diluted suitably with fix and returned to -20°C. Using slides more than 1-2 wk old can be successful, but may lead to reduced sensltivity and greater variability. 5. The majority of chromosome-specific repeated sequence primers produce adequate signal with a single primer at a concentration of 250 ng/50 pL reaction. Dispersed repeated sequences (e.g., Alu) and tandem repeated sequences (e.g., p satellite) produce good clear signals at the same concentration.

PRINS on Chromatin

51

6. To combine PRINS with FISH, after the stop buffer (Section 3.2., step 8) transfer slides directly to 70% ethanol at -2O*C for 2 min, then pass through 90 and 100% ethanol, and allow to dry. Thereafter, proceed with normal FISH, without a slide denaturation step, simply warming slides and coverslips to 37°C before adding the labeled, preannealed probe, as described by Lichter and Ried (13). 7. Slides that have been labeled directly with fluorochromes may still be held in this solution overnight if convenient, but should be kept in the dark to prevent bleaching and fading of the label.

References 1. Trask, B. J. (199 1) Fluorescence in situ hybridization: applications in cytogenetits and gene mapping. Trends Genet. 7, 149-154. 2. Van den Engh, G., Sachs, R., and Trask, B. (1992) Estimating distance from DNA sequence location in cell nuclei by a random walk model. Science 257,14 1O-14 12. 3. Heng, H. H. Q., Squire, J., and Tsui, L.-C. (1992) High resolution mapping of mammalian genes by in situ hybridization to free chromatin. Proc. Natl. Acad Sci. USA 89,9509-95 13. 4. Wiegant, J., Kalle, W., Mullenders, L., Brookes, S., Hoovers, J M. N , Dauwerse, J. G., van Ommen, G. J B., and Raap, A. K. (1992) High-resolution m situ hybridization using DNA halo preparations. Hum. Mol. Genet 1,587-591. 5. Parra, I. and Windle, B. (1993) High resolution visual mapping of stretched DNA by fluorescent hybridization. Nature Genet. 5, 17-21. 6. Heiskanen, M., Karhu, R., Hellsten, E., Peltonen, L., Kallionemi, 0. P., and Palotie, A. (1994) High resolution mapping using fluorescence in situ hybridtzation to extended DNA fibers prepared from agarose-embedded cells. BioTechniques 17,928-933. 7. Senger, G., Jones, T. A., Fidlerova, H., Sanseau, P., Trowsdale, J., Dutt, M., and Sheer, D. (1944) Released chromatin: linearized DNA for high resolution fluorescence in situ hybridization. Hum. Mol Genet. 3, 1275-1280. 8. Koch, J. E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 98,259-265. 9. Gosden, J., Hanratty, D., Starling, J., Fantes, J., Mitchell, A., and Porteous, D. (1991) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chromosome mapping, banding and investigation of sequence organization. Cytogenet. Cell Genet. 57, 100-104. 10. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide primed in situ DNA synthesis (PRINS). Hum. Mol. Genet. 3,93 l-946. 11. Gosden, J. and Lawson, D. (1995) Instant PRINS: a rapid method for chromosome identification by detecting repeated sequencesin situ. Cytogenet. Cell Genet 68,57-60. 12. Shibasalu, Y. and Gosden, J. R. Manuscript m preparation. 13. Lichter, P. and Ried, T. ( 1994) Molecular analysis of chromosome aberrations, in Methods in Molecular Biology, vol. 29: Chromosome Analysis Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 449-478.

8

Combined lmmunocytochemistry and PRINS DNA Synthesis for Simultaneous Detection of Phenotypic and Genomic Parameters in Cells Ernst J. M. Speel, Diane Lawson, Frans C. S. Ramaekers, John R. Gosden, and Anton H. N. Hopman 1. Introduction

Primed in situ (PRINS) labeling has become an alternative to in situ hybridization (ISH) for the localization of nucleic acid sequences in cell (1-4) and tissue preparations (5; see also Chapter 5). In the PRINS method, an unlabeled primer (restriction fragment, PCR product, or oligonucleotide) is annealed to its complementary target sequence in situ. The primer serves as an initiation site for in situ chain elongation using a thermostable DNA polymerase and labeled nucleotides, which can be detected directly by fluorescence microscopy, such as fluorochrome-labeled dNTPs, or indirectly using, e.g., biotin- or digoxigenin-dUTP and the application of fluorochrome-conjugated avidin or antibody molecules (3,6,7). The detection limit of the PRINS technique appears to be on the order of low-copy sequences (3,8). The combination of PRINS and immunocytochemistry (ICC) enables us, for example, to immunophenotype cells containing a specific chromosomal content or viral infection. The successand sensitivity of such a combined procedure depends on such factors, as preservation of cell morphology and protein epitopes, accessibility of nucleic acid targets, lack of crossreaction between the different detection procedures, good color separation, and stability of fluorochromes and enzyme cytochemical precipitates. Since several steps in the PRINS procedure (enzymatic digestion, post fixation, denaturation at high temperatures) may destroy antigenic determinants, a procedure starting with ICC From

Methods in Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols Edited by J. R Gosden Humana Press Inc. Totowa, NJ

53

54

Speel et al.

Fig. 1. (see color plate number 2 after p. 82) (F) Fluorescence detection of chromosome 9 centromeres with digoxigenin/SHADigFITC in H460 cells after PRINS and Vectashield embedding with PI counterstaining. (G) Simultaneous fluorescence detection of EGF receptor with APase-fast red (red) and four chromosome 7 centromeres with biotin/AvFITC (green) in C 12 1-TN6 cells after immunostaining, PRINS, and Vectashield embedding without counterstain. (H) Simultaneous fluorescence detection of NCA?vI antigen with APase-fast red (red) and three chromosome 9 centromeres with digoxigenin/SHADigFITC (green) in H460 cells after immunostaining, PRINS, and Vectashield embedding without counterstaining (compare with F).

and followed by PRINS is usually preferred. A variety of procedures have already been reported for the combination of ICC and ISH (for a review, see ref. 9). Here we describe the application of a sensitive, high-resolution fluorescence alkaline phosphatase (APase)-fast red ICC staining method (10) in combination with subsequent PRINS labeling of DNA target sequences to biological cell preparations. The advantageous slow-fading properties of the APase-fast red precipitate as well as its stability during enzymatic pretreatment steps and the entire PRINS procedure are essential for accurate immunostaining. As a model system, somatic cell hybrid and tumor cell lines have been used for simultaneous detection of surface antigens (EGF receptor, neural cell-adhesion molecule) and repeated chromosome-specific DNA sequences(Fig. 1F-H).

lmmunocytochemistry

and PRiNS

55

2. Materials 2.7. Enzyme Cyfochemicai Antigen Detection 1. Normal goat serum (NGS). 2. Monoclonal antibody (MAb) EGFRl, directed against the epidermal growth factor receptor (a kind gift of V. van Heyningen, Edinburgh, UK). 3. MAb 163A5, directed against a cell-surface marker of JlC14 cells (II). 4. MAb RNLI, directed against the neural cell-adhesion molecule (N-CAM) (22). 5. Alkaline phosphatase-conjugated goat antimouse IgG (GAMAPase) (Dako, Glostrup, Denmark). 6. Naphthol-ASMX-phosphate (Sigma, St. Louis, MO). 7. Fast red TR (Sigma). 8. Polyvinylalcohol (PVA), mol wt 40,000 (Sigma). 9. APase buffer: 0.2MTris-HCl, pH 8.5, 10 mMMgC&, 5% PVA. 10. Blocking buffer: PBS (diluted tirn stock 10X PBS), 0.05% Triton X- 100,2-5% NGS. 11. Washing buffer: PBS, 0.05% Triton X- 100.

2.2. PRINS DNA Labeling 1. Pepsin from porcine stomach mucosa (2500-3500 U/mg) (Sigma). 2. Ultrapure dNTP set (Pharmacia, Uppsala, Sweden): 100 mM solutions of dATP, dCTP, dGTP, and dTTP. 3. Biotin- I6-dUTP, dtgoxigenin- 11-dUTP, and fluorescein-l ZdUTP (Boehringer, Mannheim, Germany). 4. Ohgonucleotide primer (see Table 1 m Chapter 3). 5. Tuq DNA polymerase (Boehringer) or AmphTuq (Perkin Elmer, Chalfont St. Giles, UK). 6. Bovine serum albumm (BSA) (Sigma). 7. Dried skimmed milk powder. 8. FIT&conjugated avidin (AvFITC) (Vector, Brunschwig Chemie, Amsterdam, The Netherlands). 9. FITC-conjugated sheep antidigoxigenin Fab fragments (SHADigFlTC) (Boehringer). 10. Vectashield (Vector). 11. 4’,6-Diamidino-2-phenyl indole (DAPI) (Sigma). 12. 20X SSC: 3MNaCI,300 mM trisodium citrate, pH 7.0. 13. 10X Tag buffer: 500 m&f KCl, 100 mA4 Tris-HCl, pH 8.3, 15 mM MgCl,, 0.1% BSA. 14. PRINS stop buffer: 500 mMNaCI,50 mMEDTA, pH 8.0. 15. Blocking buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Triton X-100, 5% skimmed milk powder. 16. Washing buffer: 4X SSC, 0.05% Triton X-100. 17. Ethanol:37% HCl(lO0: l)-cleaned microscope slides and coverslips. 18. Rubber cement. 19. Water bath at 65OC. 20. Thermal cycler (Hybaid Omnigene Flatbed) (Hybatd, Teddington, UK).

Speel et al.

56 2 1. 22. 23. 24.

Humid chamber. Incubator at 37’C. Zeiss Axiophot microscope. Kodak 400 ASA film.

3. Methods 3.1. Enzyme Cytochemical Antigen Detection 1. Culture hybrid (C121-TN6, JlC14) and tumor (H460) cell lines on glass slides by standard methods (11,13,14), fix in cold methanol (-20°C) for 5 s and cold acetone (4°C) for 3 x 5 s, air-dry, and store at -20°C until use (see Note 1). 2. Incubate slides for 10 min at room temperature with blocking buffer. 3. Incubate slides for 45 min at room temperature with undiluted culture supernatant of the appropriate antigen-specific MAb containing 2% NGS. 4. Wash slides for 2 x 5 mm with washing buffer. 5. Incubate slides for 45 min at room temperature with GAMAPase, diluted 1:50 in blocking buffer (see Note 2). 6. Wash slides for 5 min with washing buffer and for 5 min with PBS. 7. Visualize the antigen with the APase-fast red reaction: Mix 4 mL APase buffer, 1 mg naphthol-ASMX-phosphate tn 250 I.& buffer without PVA, and 5 mg fast red TR in 750 pL buffer without PVA just before use. Overlay each sample with 100 pL under a coverslip. Incubate the shdes for 5-l 5 mm at 37°C and wash 3 x 5 min with PBS (see Notes 3-5).

3.2. PRlNS DNA Labeling 1. Process cells for PRINS as follows: Wash slides for 2 min at 37’C with O.OlM HCl, incubate the samples with 100 pg/rnL pepsin in O.OlM HCl for 20 mm at 37’C, wash again with O.OlM HCl for 2 min, and postfix the slides in 1% paraformaldehyde in PBS for 20 mm at 4OC. Wash cells m PBS for 5 min at room temperature, followed by a wash step in 1X Tag buffer for 5 min at room temperature. 2. Prepare the PRINS reaction mix on ice as follows: Dilute 100 mM dATP, dGTP, and dCTP 1: 10 with distilled water. Dilute 100 mM dTTP 1: 100. Put together in a microcentrifuge tube: 1 pL of each of the diluted dNTPs, 1 pL of either 1 mM biotin- 16-dUTP, digoxigenin- 11-dUTP, or fluorescein- 12-dUTP (see Note 6), 5 pL of 10X Tuq buffer, 250 ng of oligonucleotide (see Note 7), 1 U Taq polymerase, and distilled water to 50 &. 3. Place 40 pL of this mixture under a coverslip on the slide, seal with rubber

cement,air-dry the rubber cement,and transfer to the heating block of the thermal cycler.

4. Each PRINS reaction cycle consistsof 2 min at 94°C (denaturation of cellular DNA, see Note 8), 5 mm at the appropriate annealing temperature (see Note 9), and 15 min at 72°C for in sztu primer extension. 5. Stop the PRINS reaction by transferring the slides (after removal of the rubber

solution seal) to 50 mL of PRINS stop buffer in a Coplin jar at 65°C for 1 min.

lmmunocytochemistry and PRINS

57

6. Transfer the slides to washing buffer at room temperature and wash for 5 min. 7. Place 40 pL of blocking buffer under a coverslip on the slide and leave for 5 min at room temperature to reduce background staining in the detection procedures. 8. Wash slides for 1 x 5 min in washing buffer. 9. For reactions using biotin-16-dLJTP: Dilute AvFITC 1: 100 in blocking buffer and apply 50 pL under a coverslip. Incubate slides for 30 min at 37°C in a humid chamber (Note 10). 10. For reactions using digoxigenin-1 l-dUTP: Dilute SHADigFITC 1: 100 in blocking buffer and treat as in 9 (see Note 10). 11. Fluorescein- 12-dUTP needs no additional reporter and is simply mounted as described in 13 (see Note 10). 12. Wash slides for 2 x 5 min in washing buffer. Alternatively, you may wash the slides for 5 min in PBS and dehydrate them. 13. Mount the slides in Vectashield containing 0.5 pg/mL DAPI. 14. Examine the slides under a microscope equipped with suitable filters. Selected cells can be directly photographed using Kodak 400 ASA film, vrsuahzed with a charge-coupled device (CCD) camera, or scanned with a confocal scanning laser microscope (CSLM).

4. Notes 1. Since methanol-acetone fixation is a very mild fixation procedure, preservation of cell morphology may be a serious problem after PRINS. Furthermore, we frequently observe fluorescent staining of the entire nucleus after PRINS labeling, probably caused by nuclease activities that survive methanol-acetone fixation. Therefore, other fixatives should be tested that are compatible with antigen detection and result in a better cell morphology and specific PRINS labeling. In the case of the H460 cells, a fixation with cold 70% ethanol (-20°C) for 10 min proved to be a valid alternative. 2. If amplification of the immunocytochemical signal is needed, a third detection step may be added after this second incubation step. For details of possible reagents to use, see Table 2 in Chapter 3. 3. It is recommended to monitor the enzyme reaction under the microscope to adjust the reaction time to ensure the precipitate becoming discretely localized and not so dense that it shields nucleic acid sequences in the PRINS reaction. 4. To ensure the specificity of the APase-fast red staining, a control slide with FITCconjugated secondary antibodies is recommended for comparison. Staining specificity can be lost if cells contain endogenous APase activity. This endogenous enzyme activity can be inhibited by the addition of levamisole (Sigma) to the reaction medium to a final concentration of l-5 mM. 5. Do not dehydrate the slides after the APase reaction, because the precipitate dissolves in organic solvents. Optionally, you may air-dry the slides after rinsing in distilled water. 6. In the case of labeling with biotin-16-dUTP or fluorescein-12-dUTP, a fourfold decrease in the concentration of dTTP in the PRINS reaction mix resulted in

58

7.

8.

9. 10. a.

b.

c. d.

Speel et al. significantly stronger labeling of DNA sequences. Under the standard conditions described, digoxigenin-1 1-dUTP provides the highest sensitivity. However, all the modified nucleotides are suited for detection of repeated sequences in situ. The concentration of the appropriate oligonucleotide resulting in positive signals needs to be determined by experiment. Generally, 250 rig/slide m 40 pL are used for prtmers of 16-30 bases complementary to repeated sequences. Separate denaturation of cellular DNA in 70% formamide/2X SSC, pH 7.0 for 2 mm at 70°C before the PRINS reaction, as is usually performed for chromosome preparations, resulted in no or only weak PRINS labeling of DNA sequences in sm. Whether this is caused by inefficient primer annealmg or extension is not clear at the moment. The same phenomenon is also observed for PRINS on frozen tissue sections (5, see Chapter 5) The optimum primer annealing temperature is only determined empirically. We usually try a series from 45 to 7O”C, in 5°C steps. Amphtication of PRNS signals can be achieved as follows: AvFITC detection of biotin-16-dUTP may be followed by mcubation with biotinylated goat antiavtdin (Vector), 1: 100 diluted in blocking buffer, and again AvFITC. SHADigFITC detection of digoxlgenm-1 1-dUTP may be followed by incubation with FITC-conjugated antisheep IgG (Boehrmger) or as described for FITCI2-dUTP amplification (see Note 10~). Fluorescein-12-dUTP signals may be amplified by incubation with monoclonal mouse antiFITC (Dako) and FITC-conjugated rabbit antimouse IgG (Dako). Amplification of PRINS signals may also be achieved by utilizing peroxidasemediated deposition of hapten- or fluorochrome-labeled tyramides (9,I5).

References 1, Bains, M. A., Agarwal, R., Prmgle, J. H., Hutchinson, R. M., and Lauder, I. (1993) Flow cytometric quantitation of sequence-specific mRNA in hemapoietic cell suspensions by primer-induced in situ (PRINS) fluorescent nucleotide labeling. Exp Ceil Res. 208,321-326.

2. Koch, J., Mogensen, J., Pedersen, S., Fischer, H., Hindkjar, S., Kolvraa, S., and Bolund, L. (1992) Fast one-step procedure for the detection of nucleic acids in situ by primer-induced sequence-specific labeling with fluorescein- 12-dUTP. Cytogenet. Cell Genet. 60, l-3. 3. Gosden, J and Lawson, D. (1994) Rapid chromosome identification by oligonucleotide-primed in situ DNA synthesis (PRlNS). Hum. Mol. Genet 3,93 1-936. 4. Pellestor, F., Girardet, A., Lefort, G., And&o, B., and Charlieu, J. P. (1995) PRINS as a method for rapid chromosomal labeling of human spermatozoa. Mol. Reprod. Dev. 40,333-337.

5. Speel, E. J. M., Lawson, D., Ramaekers, F. C. S., Gosden, J. R., and Hopman, A. H. N (1996) Rapid brightfield detection of oligonucleotide primed in situ (PRINS) labeled DNA in chromosome preparations and frozen tissue sections. Biotechniques 20,226-234.

lmmunocytochemistry and PRINS

59

6. HindkjEr, J., Koch, J., Terkelsen, C., Brand& C. A., Kblvraa, S., and Bolund, L. (1994) Fast, sensitive multicolor detection of nucleic acids in srtu by primed in situ labeling (PRINS). Cytogenet. Cell Genet. 66, 152-154. 7. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) MultiPRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum. Genet 95,29-33. 8. Abbo, S., Dunford, R. P., Miller, T. E., Reader, S. M., and King, I. P. (1993) Primer-mediated in situ detection of the B-hordein gene cluster on barley chromosome 1H. Proc. Nutl. Acad. Sci. USA 90, 11,821-l 1,824. 9. Speel, E. J. M., Ramaekers, F. C. S., and Hopman, A. H. N. (1995) Cytochemical detection systems for in situ hybridization, and the combination with mnnunocytochemistry. Histochem. J. 21,833-858. 10. Speel, E. J. M., Herbergs, J., Ramaekers, F. C. S., and Hopman, A. H. N. (1994) Combined immunocytochemistry and fluorescence in situ hybridization for simultaneous tricolor detection of cell cycle, genomic, and phenotypic parameters of tumor cells. J. Histochem. Cytochem. 42,96 1-966. 11. Glaser, T., Housman, D., Lewis, W. H., Gerhard, D., and Jones, C. (1989) A finestructure deletion map of chromosome 1 lp: analysis of Jl series hybrids. Somatic Cell A401 Genet 15,477-501. 12. Boerman, 0. C., Mtjnheere, E. P., Broers, J. L. V., Vooijs, G. P., and Ramaekers, F. C. S. (1991) Biodistribution of a monoclonal antibody (RNL-I) against the neural cell adhesion molecule (NCAM) in athymic mice bearing human smallcell lung-cancer xenografts. Int. J. Cancer 48,457-462. 13. Dorm, J. R., Inglis, J. D., and Porteous, D. J. (1989) Selection for precise targeting of a dominant marker by homologous recombinatron. Science 243,1357-1360. 14. Camey, D. N., Gazdar, A. F., Bepler, G., Guccion, J. G., Marangos, P. J , Moody, T. W., Zweig, M. H., and Minna, J. D. (1985) Establishment and identification of small cell lung cancer cell lines having classic and variant features. Cancer Res. 45,2913-2923.

15. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989) Catalyzed reporter depositron, a novel method of signal amplification. Amplification to immunoassays. J. Immunol. Methods 125,279-285.

9 Chromosomal PRINS DNA Labeling Combined with Indlrect lmmunocytochemistry Arthur R. Mitchell 1. Introduction The technique of in situ hybridization developed initially by Pardue and Gall (1) and Jones (2) can be placed on a par with Southern (3) hybridtzation in the enormous contribution it has given to the fields of cellular and molecular biology in eukaryotes. Initially developed for repetitive DNAs in mammalian cells, it is now used to assign the chromosomal loci of all kinetic classes of DNA molecules throughout the animal and plant kingdoms. PRINS hybridization developed by Koch et al. (4) was a clever improvisation using oligonucleotide primers to anneal to chromosomal DNA sequencesfollowed by extension using DNA polymerase. A reporter molecule (a digoxigenin or biotinylated deoxynucleotide triphosphate) was incorporated during the reaction. The reporter molecule was then detected using an immunocytochemical approach. Improvements to the basic PRINS technique involve direct incorporation of fluorochrome-tagged deoxynucleotide triphosphates, negating the need for secondary labeling and, the “cycling PRINS” (5) reactions. Here, multidenaturation, annealing, and extension steps are carried out giving greater sensitivity and signal strength, especially when dealing with low-copy chromosomal repeat sequences. Chromosomes, however, do not contain only DNA molecules. More than half of the bulk of a chromosome consists of protein molecules, which themselves can be separated into two classes: the histone and the nonhistone proteins. The interacfions of proteins from these two classeswith chromosomal DNA lead to the formation of a visible chromosome when eukaryotic cells undergo mitotic and meiotic cell divisions. The precise mechanism underlying this process is not well understood. This is parFrom

Methods MI Molecular B!ology, Vol. 71’ PRlNS and In Situ PCR Protocols Edited by J R Gosden Humana Press Inc , Totowa, NJ

61

62

Mitchell

titularly the case for the nonhistone proteins. Some nonhistone proteins (like the histones, which interact with DNA sequences to form the basic nucleosoma1 structure) must also bind directly to specific nucleotide sequences along the backbone of the DNA molecule. One example consists of the scaffold proteins (6). These are nonhistones that are thought to be responsible for attaching specific DNA sequencesto the chromosome scaffold. From the scaffold attachment sites, it is thought that loops of DNA, 100-200 kb m length, protrude into the surrounding matrix of the cell. The functional significance of these loops remains unclear, but it is thought that this is one of the intermediary higher-order structures necessary for the formation of a condensed chromosome. Nor&stone proteins are also thought to be integral parts of the kinetochore of mammalian chromosomes (7). This specialized structure is found at the primary constrictron of mammalian chromosomes and is the site of attachment of spindle microtubules during cell division. An understanding of the proteins associated with this structure has come from the use of autoantibodies from some CREST patients who have a complex scleroderma syndrome (8). Other nonhistone proteins, such as HP1 of Drosophila (9) and Its homologs in human and mouse genomes (IO), interact with other as yet unknown chromosomal proteins leading to the condensation of heterochromatic domains within mammalian chromosomes. Antibodies have been raised against other nonhistone proteins (II) and against histone molecules that have undergone posttranslatlonal modifications, such as acetylation (IZ), using indirect mununofluorescence as the means of detecting the position of these proteins on chromosomes. These results have increased our understanding of how some of the protein constituents of chromosomes interact with one another. An extremely useful approach has been the combination of the two techniques described above, i.e., PRINS, using sequence-specific DNA primers, with indirect rmmunocytochemistry, using antibodies raised against defined proteins. The precise spatial relationship on the metaphase chromosome of a known family of DNA sequences with, for example, a protein thought to be associated with kinetochore structure can be directly correlated by this approach. This chapter describes such a procedure. As the number of antibodies against cytologically important proteins increases, the application of this approach will become increasingly popular with molecular cytologtsts. 2. Materials

2.1, Blood Lymphocyte Cultures 1. Dulbecco’s phosphate-buffered saline (PBS) solution: 0.2 g/L KU, 8.0 g/L NaCl, 0.2 g/L KH2P04, 1.5 g/L Na2HP04. 2. Potassium chromosome medium (KCM) solution: 120 mM KCl, 20 mA4 NaCl, 10 mA4Tris-HCl, pH 8.0,0.5 mkfEDTA, 0.1% (v/v) Triton X-100.

Chromosomal PRINS

63

3. RPMI-1640 medium (Gibco-BRL, Life Technologies Ltd., Paisley, Scotland). 4. Fetal Calf serum (Gibco-BRL). 5. Glutamine (Sigma, Poole, Dorset, England) stock solution 0.3% in water, filter-sterilized. 6. Colcemid (Boehringer Mannheim, Lewes, Sussex) stock solution, ng/mL in water, filter-sterilized. 7. Lymphopaque (Nyegaard Diagnostica, Norway). 8. Lipopolysaccharide (Sigma). 9. Coulter counter or other cell counter. 10. Cytocentrifuge (Ames Cyto-Tek or Shandon Cytospin). 11. Bench-top centrifuge (e.g., WIFUG or Chilspin [Fisons, England]). 12. CO, controlled mcubator.

2.2. Antibodies 1. Normal goat serum (NGS) (Scottish Antibody Production, Law Hospital, Scotland). 2. FITC-labeled second antibody, rabbit antimouse, or rabbit antihuman immunoglobulins (Sigma). 3. Primary antibody-autoimmune anticentromere serum (a gift from George Nuki, Rheumatic Diseases Unit, Western General Trust Hospital, Edinburgh). 4. Blocking solution-4X SSC, 0.05% Triton X- 100,0.6% dried skimmed nonfat milk.

2.3. PRINS 1. dNTP solution-containing the following 2’-deoxyribonucleotide 5’-triphosphates (Pharmacia, Biotech, St. Albans, England): 2.0 mM 2’-deoxyadenostne Striphosphate (dATP); 2.0 n&Q-deoxyguanosine 5’-triphosphate (dGTP); 2.0 mM 2’-deoxycytidine 5’-triphosphate (dCTP); and 0.1 mA42’-deoxythymidine 5’-triphosphate (dTTP). 2. 10X Tuq DNA polymerase buffer (Boehringer Mannheim). 3. Tag DNA polymerase (Boehringer Mannheim). 4. Digoxigenin-l l-2’-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehringer Mannheim). 5. 5-(N-[N-biotinyl-a-amino caproyll-3-amino-allyl) uridine 5’ triphosphate (Bio 11-dUTP) (Sigma). 6. Specific primer (from 15-32 bases in length) oligonucleotide solution in O.OlM Tris-HCl, pH 7.4. The concentration should be 300-500 ng/pL.

2.4. Chromosome

Staining and Detection

1. DAPI (4’, 6-diamidino-2-phenylindole) (Sigma). 2. Formalin solution (4% v/v formaldehyde in KCM) (1: 10 dilution of formaldehyde, which in concentrated solution is at 40%; the final concentration is 4%). 3. Texas red avidin (Vector Labs, Burlingame, CA). 4. Vectashield (Vector Labs). 5. Antidigoxigenin rhodamine-labeled FAB fragments (Boehringer Mannhetm).

64

Mitchell

3. Methods 3.7. Lymphocyte Cultures from Mouse Spleen Cells 1, Kill mice by cervical dislocation and remove the spleen under sterile conditions (see Note 1). 2. Remove cells from the spleen by forcmg 2 x 5 mL of RPM1 medium through it using a 25-gage needle in a Petri dish. Pellet the cells at 135g for 10 mm, and resuspend m 2 mL RPM1 medium. 3. Add 3 mL of phosphate-buffered saline, and load the cell suspension onto 3 mL of lymphopaque. Centrifuge the sample at 91 lg for 20 min at room temperature using a swing-out rotor (no brake). 4. Remove the lymphocyte layer (a clearly visible band) usmg either a fine plastic pipet or 2 l-gage needle syringe, and wash the cells in RPM1 containing 15% fetal calf serum (FCS) supplemented with glutamine (to a final concentration of 0.03%). 5. Pellet the cells at low speed (as in step 3), and resuspend in 10 mL of the same medium (as in step 4). 6. Count cells with hemocytometer. 7. Set up cultures of 10-r& vol in RPM1 containing the glutamine supplement (step 4) to lo6 cells/ml for 72 h at 37°C. Add the lipopolysaccharide (Sigma) to 0.25 mg/mL to stimulate cell growth. 8. Dividing lymphocytes grow as columns of cells on the surface of the culture dish. The number of these columns of cells is normally a good indicator of the health of the culture.

3.2. Human Blood Lymphocyte Cultures (see Note 2) 1. Defibrinate blood with sterile glass rod. 2. Dilute the defibrinated blood (10-20 mL) with 5-10 mL of either RPMI-1640 medium or PBS, and load onto 3.5 mL of lymphopaque as described in Section 3. l., step 3. Centrifuge, and so forth, as described in Section 3 l., step 3 and onward.

3.3. Metaphase Preparations 1. Add colcemid to each culture to a final concentration of 0 1 pg/mL for l-2 h 2. Release the cells from the flask surface by physically hitting the side of the flask using the palm of your hand. Pellet the cells at low speed (see Section 3.1.) step 2). 3. Pour off supernatant, or suck off using vacuum Ime. 4. Resuspend the cells in approx 10 mL of hypotonic solution (75 mMKCl), and either incubate at 37OC for 10 min or alternatively at room temperature for 12 mm.

3.4. Metaphase Spreads 1. Determine the concentration of the cells in the hypotomc solution using a hemocytometer or other cell-counting device. 2. The optimum cell concentration for the preparation of metaphase spreads using an Ames Cyto-Tek cytocentrifuge (Bayer Diagnostics UK, Basingstoke, UK) is l-2 x 10s cells /mL. 3 The Ames Cyto-Tek cytocentrifhge uses 0.5- or l-n& disposable sample chambers.

Chromosomal PRINS

65

4, Dilute the sample with hypotonic KC1 to the correct concentration. 5. Load the correct volume and centrifuge for 10 min at 2500g onto alcoholcleaned slides. 6. Check the first spreads under phase-contrast microscopy to ensure that the cell concentration requires no adjustment (see Note 3). 7. Wipe the surrounding edges of the square of cells on the slide using a tissue to remove excess fluid. 8. Allow slide to stand in the air for 2 min. 9. Place slide in a Coplin jar containing KCM for 10 min at room temperature.

3.5. UV Fhorescence 1. Add 50 fi Vectashield. 2. Add coverslip (alcohol-cleaned), and seal with rubber solution. 3. Detect signal under UV fluorescence using appropriate filters for FITC (green signal), Texas red, or rhodamine (red signal) and DAPI (blue signal) (see Note 4). 4. Photograph images using Kodak T-max 400 (black and white) or Kodak Ektachrome Pan 400 (color). 5. Alternatively, capture images using a microscope equipped with a CCD camera coupled with a digital imaging system. Examples

of results obtained by this method are shown in Figs. 1 and 2.

3.6. Antibody

Reactions

1. Remove excess KCM by draining, followed by wiping the slide edges with a tissue. 2. Place slide in a moist chamber (a sandwich box with wetted tissues or Whatman’s filter paper) making sure that the slide is above the moist layer by laying it on glass or plastic runners. 3. Add the first (primary antibody) diluted 1:300-1:500 in KCM contaming 10% NGS. Use 40-50 pL of antibody solution/slide and cover this using either a square of Parafilm or an alcohol-cleaned coverslip. 4. Incubate for 1 h at room temperature. 5. Wash slide in KCM to remove unbound primary antibody. Normally 2-3 x 5 min washes in Coplin jars are sufficient. Drain the excess fluid as in step 1 above. 6. Apply the second (FITC-labeled) antibody (1:20) dilution in KCM with 10% NGS. Use the same procedure as described in step 3 above. 7. Incubate for 40-60 min (see Note 5). 8. Wash slide in KCM for 5-10 min to remove excess antibody. 9. Fix the chromosomes on slide in KCM containing 10% (v/v) formalin. 10. Wash slide in water. 11. Air-dry and store in the dark at room temperature.

3.7. PRINS 3.7.1. Pretreatment I. The following procedure is recommended to increase the fluorescent signal (see Note 6).

Fig. 1. PRINS on human lymphocyte chromosomes prepared as described in the text, combined with an immunocytochemical procedure for kinetochore detection. The oligonucleotide AAAGAAGCITKTGAGAAACTGCTTAGTGT was used in this reaction, It is specific for the human alphoid consensus sequence. The antibody used for the kinetochore labeling wasCREST ACA serum (seete@ The PRINS product wasdetected with rhodamine, whereas the CREST was detected using FITC-labeled antihuman IgG. Chromosomes were counterstained with DAPI. Three sequential photographs were taken, each with a filter specific for a single fluomchmme. (A) PRINS labeling (rhodamine). (B) Position of CREST ACA serum (FITC). (C) DAPI-stained chromosomes. Note that in this figure, the signals from both the alphoid DNA and CREST labeling are at the same position on each human chromosome.

Chromosomal

PRINS

67

Fig. 2. PRINS reaction using an oligonucleotide specific for human classical satellite DNA III combined with immunocytochemical detection of kinetochores. The oligonucleotide was (CCATT)7. CREST ACA serum was used to locate the kinetochores. Labeling and photography are as for Fig. 1. (A) PRINS labeling. (B) CREST ACA labeling. (C) DAPI-stained chromosomes. Note that, in this instance, the CREST signal and the simple-sequence satellite DNA do not colocalize to the same position on human chromosome 9 (arrows).

68

Mitchell

2. Immerse slide in 0. 1MNaOH for 10-40 s (see Note 7) followed by neutralization with 2 x 5 min washes in O.OlM Tris-HCl, pH 7.4. Finally, wash slide briefly in distilled water before air-drying. 3. Dip slide into 3: 1 methanol-acetic acid for 2 x 2 min (see Note 8). Follow this by washing in O.OlM Tris-HCl, as in step 2. 4. Pass slide through 70,90, and 100% alcohols (all at 4°C). Allow 2 min for each alcohol step. 5. Air-dry the slide. 6. The slide can be stored in the dark for several weeks at room temperature at this stage.

3.7.2. Denaturation 1. Denature chromosomal DNA by putting the slides into 30 mM NaOH and 1M NaCl (check pH, making sure it is above 12.0) for 45 min at 4°C. 2 Neutralize in O.OlMTris-HCl, pH 7.4 (two changes), usmg Coplm jars. 3. Remove excess fluid by draining. Follow this by blowmg a Jet of air across the slide using a pipet and bulb until dry.

3.7.3. Annealing and Extension 1. To each slide (prewarmed to the annealing temperature) add 50 & of a solution containing: 5 pL of 10X Tuq buffer, 2.5 pL of dNTPs solution, 1.5 pL oligonucleotide primer, 1.0 $ Dig-l l-dUTP or Bio-1 I-dUTP, 37 $ distilled H,O, 1 pL Taq DNA polymerase. 2 Add prewarmed coverslip (alcohol-cleaned), and seal using rubber solution. 3. Anneal for 10 min at 50-55’C. 4. Extend at 64°C for 20-25 min.

3.7.4. Detection 1. Remove the coverslip carefully using a scalpel blade (avoid moving the coverslip across the chromosome spread). 2. Place slide in 50 mMEDTA, 100 mMNaC1 at 4°C for 3 min. 3. Place slide in 4X SK, 0.05% Triton (at 4’C) for 3 min. The slide can be stored at 4°C in this solution at this stage. Alternatively, it can be washed briefly m water and air dried. 4. Place slide in blocking solution (at 4’C) for 3 min. 5. Remove excess fluid by drainmg. 6. Add 50 pL of blocking solution containing 1: 100 dilution of Texas red-conjugated avldin to detect incorporated bio-1 l-dUTP or 1: 100 dilution of antidigoxlgemn-rhodamme FAB fragment to detect incorporated dig- 11-dUTP. 7. Cover with a coverslip or Parafilm square and incubate m a moist chamber as described m Section 3.6., step 4 for 40 min. 8. Wash in 4X SSC, 0.05% Triton for 3 min at room temperature. 9. Stain chromosomal DNA with DAPI for 5 min. Use 50 pL. from a 1 pg/mL solution. Cover with coverslip or Parafilm square.

Chromosomal P/?/A/S

69

10. Remove coverslip and wash in water for 5 min. 11. Air-dry.

4. Notes 1. The spleen is easily located, since it lies Just beneath the skin surface on the left rear dorsal surface. Use spray to sterilize the surroundmg fur with absolute alcohol. Cut the fur and pull it back to reveal the underlying skin. The spleen can be seen as the dark red oblong structure lying directly beneath the skin, Make an incision into the skin and pull out the spleen using sterile forceps. Separate from internal organs with sterile scissors. 2. It is inadvisable to culture blood lymphocytes from oneself. There are risks involving immortalization of your own cells. 3. Low concentrations of cells lead to metaphase spreads containing stretched or pulled chromosomes. Too high a concentration of cells tends to produce dense clumps of cells with poorly spread divisions. It is worthwhile at this stage adjusting concentrations by a factor of 2 or 3 (up or down) to obtain optimum spreads. 4. With the Leitz Ortholux-2 microscope, the corresponding filters are A, I 2/3, and N2, respectively (see Section 3.5 , step 3). 5. For human cells, the second antibody is goat antihuman immunoglobulin. In the case of mouse chromosomes, the second antibody is goat antimouse immunoglobulin. 6. The procedure adopted for the fixation of antibodies to chromosomal proteins often makes accessibility to the chromosomal DNA sequences by DNA polymerases extremely difficult. The end result is either a poor signal or no signal at all after PRINS has been carried out. Thus, additional treatments are required to improve accessibility. 7. The time required will vary according to the repeated DNA family of sequences under study and the cell type from which the chromosome preparation was made. 8. This again may vary according to the cell type and family of repetitive DNAs under study.

References 1. Pardue, M. L. and Gall, J. G. (1969) Molecular hybridization of radioactive DNA to the DNA of cytological preparations Proc Nat1 Acad. SCL USA 64, 600-604. 2. Jones, K. (1970) Chromosomal and nuclear location of mouse satellite DNA in individual cells. Nature 225,912-915. 3. Southern, E. M. (1975) Detection of specific sequences among DNA fragments

separated by gel electrophoresis. J. Mol. Biol. 98,503-5 17 4. Koch, J. E., Kelvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I. (1989) Oligonucleotide-priming methods for the chromosome-specific labeling of alpha satellite DNA in situ. Chromosoma 98,259-265. 5. Gosden, J. and Hanratty, D. (1993) PCR in situ: A rapid alternative to in sztu hybridization for mapping short, low copy number sequences without isotopes. BloTechniques 15,78-80.

70

Mitchell

6. Saitoh, N., Goldberg, I. G., Wood, E. R., and Eamshaw, W. C. (1994) Scl 1: an abundant chromosome scaffold protein is a member of a family of putative ATPases with an unusual predicted tertiary structure. J. Cell Biol 127,303-3 18. 7. Cooke, C. A., Bernat, R. L., and Earnshaw, W. C. (1990) CENP-B; a major human centromere protein located beneath the kinetochore. J. Cell Biol 110,1475-1488. 8. Earnshaw, W. C. and Rothfield, N. (1985) Identification of a fannly of human centromere proteins using auto-immune sera from patients with scleroderma Chromosoma 91,3 13-321. 9. James, T. C. and Elgin, S. C. R. (1986) Identification of a nonhistone chromosomal protein associated with heterochromatin m Drosophila melanogaster and Its gene. Mol. Cell Biol. 6,3862-3872 10. Saunders, W. S., Chue, C , Goebl, M., Craig, C., Clark, R. F., Powers, J. A., Eissenberg, J. C., Elgin, S. C. R., Rothfield, N. F., and Earnshaw, W C. (1993) Molecular cloning of a human homologue of Drosophila heterochromatm protein HP1 using anti-centromere auto-antibodies with anti-chrome specificny J Cell SCI. 104,573-582.

11. Meehan, R. R., Lewis, J. D., and Bird, A. P. (1992) Characterisation of MeCP2, a vertebrate DNA binding protein with affinity for methylated DNA. Nucleic Acids Res 20,5082-5092.

12. Turner, B. M. and Fellows, G. (1989) Specific antibodies reveal ordered and cellcycle-related use of histone-H4 acetylation sites in mammalian cells. Eur J. Biochem 179, 13 1-139.

10 Direct ln Situ Single-Copy (DISC)-PCR Deryl L. Troyer, Hongyan Xie, and Jie Hu 1. Introduction The physical mapping of functional genes and polymorphic markers is obviously important for understanding genome organization in higher organisms, Fluorescence in situ hybridization of labeled DNA to metaphase chromosome spreads has been a very effective means of accomplishing this goal (1,2), but it is difficult to routinely detect sequences