Platelet Factor 4-CXCL4

Platelet Factor 4 Gera Neufeld*, Gal Akiri and Zehava Vadasz Department of Biology, Technion, Israel Institute of Technology, Technion City, Haifa, 32000, Israel * corresponding author tel: 972-4-8294216, fax: 972-4-8225153, e-mail: [email protected] DOI: 10.1006/rwcy.2000.10006.

SUMMARY Platelet factor 4 (PF4) is a heparin-binding pisasu CXC chemokine, which is expressed in megakaryocytes and stored in the  granules of platelets. However, other cell types such as activated human leukocytes can also synthesize PF4. PF4 does not share certain proinflammatory properties of other CXC family members because it lacks a critical Nterminal Glu-Leu-Arg sequence, the `ELR motif'. It is an inhibitor of angiogenesis but it is unclear what its other functions are. It can promote clotting through the sequestration of heparin but can also act as an anticoagulant because it promotes the generation of activated protein C, a potent anticoagulant.

BACKGROUND

Discovery Platelet factor 4 (PF4) was first mentioned in 1965 as a platelet-derived anti-heparin factor (Niewiarowski et al., 1965). The amino acid sequences of bovine and human PF4 were determined in 1985 (Ciaglowski and Walz, 1985) and the cDNA was cloned in the same year (Poncz et al., 1987). The crystal structure of human PF4 was solved by 1994 (Zhang et al., 1994).

Structure Mature human PF4 is composed of 70 amino acids. PF4 is a member of the chemokine family. In addition two homologous genes coding for closely related proteins called PF4alt and PF4var1 have also been identified (Green et al., 1989; Eisman et al., 1990). Although its structure places it among the members

of the CXC family of chemokines, PF4 does not share certain proinflammatory properties of other CXC family members because it lacks a critical N-terminal Glu-Leu-Arg sequence, the `ELR motif', which precedes the first cysteine residue. These three amino acids appear to be important in ligand/receptor interactions on neutrophils, and in the determination of the effect of PF4 on angiogenesis (Strieter et al., 1995; Petersen et al., 1996). The N-terminal of PF4 contains highly negatively charged amino acids and protrudes out of the protein in the crystal structure (Zhang et al., 1994). In contrast the C-terminal region of the polypeptide is unusual in that it contains a repetitive motif (KKIIKKLL) containing positively charged and hydrophobic pairs of amino acids. This repetitive sequence is the core of the heparin-binding domain of PF4. Structurally, mature human PF4 is a symmetrical, tetrameric molecule made up of four identical PF4 subunits. A positively charged ring of lysine and arginine side-chains encircles the PF4 tetramer sphere, presenting multiple potential sites and orientations for heparin binding. N-terminal residues, previously defined as an extended loop region, form antiparallel sheet-like structures that form noncovalent associations between PF4 dimers. These antiparallel sheet-like structures are positioned lateral to the -bilayer motif and stabilize the tetrameric unit (Zhang et al., 1994). PF4 is released from  granules of platelets as a complex with chondroitin-4sulfate proteoglycan (Levine et al., 1990), but displays a higher affinity towards heparin and heparan sulfate glycosaminoglycans (Stringer and Gallagher, 1997).

Main activities and pathophysiological roles See section on Normal physiological roles.

1096 Gera Neufeld, Gal Akiri and Zehava Vadasz

GENE AND GENE REGULATION

Chromosome location

Accession numbers

The gene for human PF4 is located on chromosome 4 at the q12-21 region (Griffin et al., 1987).

See Table 1.

Relevant linkages

Sequence

The subfamily of polypeptide chemoattractants known as CXC chemokines to which PF4 belongs is

See Figure 1.

Table 1 Available PF4 and PF4-related cDNA sequences Species

Accession no.

Name

GenBank locus

Reference

Human

NM_002619 M25897 NM_002620 M26167

Homo sapiens PF4 mRNA Human PF4 mRNA, complete CDS Homo sapiens PF4 variant 1 (PF4V1) mRNA Human PF4 variation 1 (PF4var1) gene

HUMPF4A PF4V1 HUMPF4V1A

Mouse

BAA75660

PF4

BAA75660

Rat

M15254

Rat PF4 gene

RATPF4

Doi et al., 1987

Bovine

g130303

PF4

PLF4_BOVIN

Ciaglowski et al., 1986

Poncz et al., 1987 Green et al., 1989 Green et al., 1989

Sheep

g266800

PF4

PLF4_SHEEP

Shigeta et al., 1991

Pig

P30034

PF4

PLF4_PIG

Proudfoot et al., 1995

Figure 1 Nucleotide sequences of PF4 in human, mouse, and rat. Human cDNA

ATGAGCTCCGCAGCCGGGTTCTGCGCCTCACGCCCCGGGGCTGCCTTCCTGGGGGTTGCTGCTGCCTGCCACTTGTGGTCGCCTTCGC CAGCGCTGAAGCTGAAGAAGATGGGGACCTGCAGTGCCTGTGGAAGACCACCTCCCAGGTCCGTCCCAGGCACATCACCAGCCTGGAG GTGATCAAGGCCGGACCCCACTGCCCCACTGCCCAACTGATAGCCACGCTGAAGAATGGAAGGAAAATTTGCTTGGACCTGCAAGCCC CGCTGTACAAGAAAATAATTAAGAAACTTTTGGAGAGTTAG Mouse cDNA

ATGAGCGTCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGTCCTGAGCTGCTGCTTCTGGGCCTGTTGTTTCTGCCAGCGGTGGTTGCTG TCACCAGCGCTGGTCCCGAAGAAAGCGATGGAGATCTTAGCTGTGTGTGTGTGAAGACCATCTCCTCTGGGATCCATCTTAAGCACAT CACCAGCCTGGAGGTGATCAAGGCAGGACGCCACTGTGCGGTTCCCCAGCTCATAGCCAACCCTGAAGAATGGGAGGAAAATTTGCCT GGACCGGCAAGCACCCCTATATAAGAAAGTAATCAAGAAAATCCTGGAGAAGTTAG Rat cDNA

ATGAGTGCCGCTGCGGTGTTTCGAGGCCTCCGGCCCAGCCCTGAGCTGCTTCTTCTGGGTCTGCTGTTGCTGCCAGCTGTGGTTGCTG TCACCAGGGCTAGTCCTGAAGAAAGCGACGGAGATCTTAGCTGTGTGTGTGTGAAGACCAGTTCTTCCAGGATCCATCTCAAACGCAT CACCAGCCTGGAGGTGATCAAAGCAGGACCCCACTGTGGCGGGTTCCCCAGCTCATAGCCACGCTGAAGAATGGGAGCAAAATTTGCC TGGACCGGCAAGTACCTCTGTTATAAGAAAATAATCAAGAAACTCCTGGAGAGTTAG

Platelet Factor 4 1097 characterized by the ability to induce concentrationdependent directional migration and activation of leukocytes. The genes for CXC chemokines map to human chromosome 4q13-21, with the exception of SDF-1, which is on chromosome 10 (Tunnacliffe et al., 1992; Shirozu et al., 1995). The family displays four highly conserved cysteine residues, with the first two cysteines separated by one nonconserved amino acid residue. The percent identity based on nucleotide sequence between family members is not strong (43± 24%) (Figure 1).

Regulatory sites and corresponding transcription factors The human PF4 gene contains three exons and spans approximately 1000 bp (Eisman et al., 1990). Exon 1 encodes the 50 UTR and the signal sequence for secretion up to the last 2 bp. Exon 2 encodes 41 amino acids and about two-thirds of the 70 amino acids of the mature PF4, and exon 3 contains the rest and the 30 UTR (Eisman et al., 1990). Transgenic mice expressing prokaryotic -galactosidase coupled to 1.1 kb of the 50 upstream region of the PF4 gene express this construct almost exclusively in megakaryocytes. However, low levels of expression are also found in adrenal glands (Ravid et al., 1991a). Two important control elements were identified upstream to the translation start site. A GATA element is located at ÿ31 whose conversion to a TATA box decreases tissue specificity, and a megakaryocyte-specific enhancer/silencer domain located between ÿ448 and ÿ112 (Ravid et al., 1991b). The enhancer/silencer

domain possesses three positively acting subdomains from ÿ380 to ÿ362, ÿ270 to ÿ257, and ÿ137 to ÿ120, as well as a negatively acting subdomain at ÿ184 to ÿ151 which is able to reduce overall transcription but has no effect on tissue specificity. The subdomain from ÿ380 to ÿ362 (P3 ) is most critical in restricting gene expression driven either by the PF4 promoter or by a heterologous promoter to the megakaryocytic lineage. Deletion of either the whole enhancer/silencer domain or the sub-domain from ÿ380 to ÿ362 or ÿ137 to ÿ120 reduces transcription in megakaryocytes by 10- to 30-fold.

PROTEIN

Sequence See Figure 2.

Description of protein See Figure 3.

Discussion of crystal structure The structure of PF4 consists of four polypeptide chains that form a tetrameric unit. N-terminal residues, previously defined as a random coil or extended loop region, form antiparallel sheet-like structures that form noncovalent associations between dimers. These antiparallel sheet-like structures are

Figure 2 Amino acid sequences for human, mouse, and rat PF4. The signal sequence for secretion is underlined.

1098 Gera Neufeld, Gal Akiri and Zehava Vadasz Figure 3 Crystal structure of a PF4 dimer and a PF4 tetramer (from Zhang et al., 1994).

Posttranslational modifications PF4 is cleaved between Thr16 and Ser17, a site located downstream from the highly conserved and structurally important CXC motif, by a protease present in activated human leukocyte culture supernates. The N-terminal processed PF4 exhibited a 30to 50-fold greater growth inhibitory activity on endothelial cells as compared with intact PF4 (Gupta et al., 1995).

CELLULAR SOURCES AND TISSUE EXPRESSION

Eliciting and inhibitory stimuli, including exogenous and endogenous modulators positioned lateral to the -bilayer motif and stabilize the tetrameric unit. A positively charged ring of lysine and arginine side-chains encircles the PF4 tetramer sphere, presenting multiple potential sites and orientations for heparin binding. The electrostatic interactions of multiply charged amino acid side chains and hydrogen bonding interactions at the AB/CD dimer interface serve to stabilize the tetrameric structure further (Zhang et al., 1994). PF4 binds to chondroitin sulfate and to heparin and heparan sulfate (Stringer and Gallagher, 1997). PF4 binds with high affinity and specificity to an approximately 9 kDa sequence in heparan sulfate. This protected fragment is enriched in N-sulfated disaccharides and iduronate 2-O-sulfate residues, the latter being important for binding to PF4. The major structural motif of the fragment appears to consist of a pair of sulfated domains positioned at both ends separated by a central mainly N-acetylated region. According to a proposed model the heparan sulfate fragment wraps around the ring of positive charges on PF4 with the iduronate 2-Osulfates within the sulfated domains binding strongly to lysine clusters on opposite faces of the PF4 tetramer (Stringer and Gallagher, 1997).

The cytokine IL-6 increases PF4 expression in megakaryocytes. This is probably the result of the presence of an IL-6-responsive element CTGGGA in the PF4 promoter (Ravid et al., 1995). The hematopoietic transcription factor GATA-1, which binds to the GATA box, and the transcription factor Ets-1 increase PF4 expression (Minami et al., 1998). The T-cluster-binding protein (TCBP) has a 78% homology to that of nucleolysin. TCBP specifically binds to the T-cluster and the proximal T-rich region of the PF4 promoter and represses PF4 transcription (Doi et al., 1997).

RECEPTOR UTILIZATION A definite receptor for PF4 has not been described. PF4 binds to cell surface heparan sulfate proteoglycans which also function as receptors for IP-10, another chemokine that inhibits angiogenesis (Luster et al., 1995; Petersen et al., 1999). A cell surface chondroitin sulfate proteoglycan has been found to act as a receptor for tetrameric PF4 on neutrophils (Petersen et al., 1998).

Important homologies PF4 has a homolog named PF4alt or PF4var1 (Green et al., 1989; Eisman et al., 1990). -Thromboglobulin is also a platelet  granule protein released in large amounts following platelet activation. -Thromboglobulin has approximately 70% amino acid identity with PF4 (Majumdar et al., 1991).

IN VITRO ACTIVITIES

In vitro findings PF4 is not chemotactic, it has anti-angiogenic effects in vitro and in vivo.

Platelet Factor 4 1099

Bioassays used Inhibition of DNA synthesis or cell proliferation assays: a variety of cells are used for this assay including fibroblasts (Jouan et al., 1999) and endothelial cells (Gengrinovitch et al., 1995). Cells are stimulated with bFGF or with VEGF and inhibition of proliferation or thymidine incorporation is measured.

IN VIVO BIOLOGICAL ACTIVITIES OF LIGANDS IN ANIMAL MODELS

Normal physiological roles Clotting Despite more than two decades of research, the role of PF4 in clotting is not yet completely understood. It may act as a procoagulant by virtue of its high affinity towards heparin and heparan sulfate glycosaminoglycans, resulting in the sequestration of heparin and thus preventing the binding of heparin to antithrombin III. A common complication of heparin anticlotting treatment is heparin-induced thrombocytopenia. This complication seems to be the result of PF4 binding to heparin. The immune system can recognize this complex and generate antibodies directed against PF4/heparin complexes, leading to the development of this autoimmune disease (Shoenfeld, 1997; Horne and Hutchison, 1998). PF4 also binds directly to thrombomodulin and to protein C. Thrombomodulin is an anionic protein cofactor that promotes thrombin cleavage of protein C to generate activated protein C, a potent anticoagulant. The interactions of PF4 with both proteins activate the interaction of protein C with thrombin and the generation of activated protein C. Since protein C acts as an anticoagulant, it follows that PF4 can also act as an anticoagulant in addition to its procoagulant activity that is based upon its heparinbinding capability (Slungaard and Key, 1994; Dudek et al., 1997). PF4 also inhibits factor XII activation during contact activation of plasmatic coagulation, leading to inhibition of coagulation (Dumenco et al., 1988). Megakaryocyte Differentiation PF4 was reported to inhibit differentiation of megakaryocytes from CD34-expressing cells (Xi et al., 1996).

Angiogenesis Another important activity of PF4 is the inhibition of angiogenesis (Maione et al., 1990). This antiangiogenic capability makes PF4 an inhibitor of tumor growth (Maione et al., 1990; Sharpe et al., 1990; Tanaka et al., 1997). The mechanism by which PF4 inhibits angiogenesis is unclear, and the subject of ongoing research. PF4 binds heparin very strongly, and it was shown that peptides derived from its heparin-binding C-terminal domain also possess anti-angiogenic properties. However, high concentrations of these peptides are required for the antiangiogenic activity as compared with the PF4 concentrations required for similar effects (Maione et al., 1990). The mitogenic activities of angiogenic growth factors, such as basic fibroblast growth factor (bFGF), are potentiated by heparin and heparan sulfates (Fannon and Nugent, 1996). It was postulated that PF4 may sequester cell surface heparan sulfate proteoglycans that potentiate the receptorbinding ability of bFGF, resulting in the inhibition of bFGF activity. Indeed, there is some experimental proof supporting this hypothesis (Watson et al., 1994). However, a PF4 mutant that lacks the heparin-binding domain also inhibits angiogenesis (Maione et al., 1991), indicating that the heparin-binding mechanism is not the only mechanism by which PF4 affects angiogenesis. It was subsequently found that heparin-binding proteins such as bFGF, keratinocyte growth factor, protamine, the 165 amino acid form of vascular endothelial growth factor (VEGF165 ), and acidic fibroblast growth factor bind directly to PF4. The binding may be mediated by the very acidic Nterminal of PF4 and may lead to the inhibition of the angiogenic activity of heparin-binding angiogenic factors (Gengrinovitch et al., 1995). The binding depends upon the ability to bind heparin since basic proteins that do not bind to heparin ± such as cytochrome C ± do not bind to PF4. Recently, the binding between bFGF and PF4 was found to result in the inhibition of the interaction of bFGF with its receptors (Perollet et al., 1998). Nevertheless, these mechanisms cannot be the only mechanisms by which PF4 inhibits the activity of angiogenic growth factors. They do not explain, for example, how PF4 inhibits the activity of VEGF121 , a VEGF form that does not bind to heparin and does not require heparan sulfate proteoglycans to bind to VEGF receptors. Interestingly, PF4 inhibits the biological activity of VEGF121 without affecting the binding of VEGF121 to VEGF receptors (Gengrinovitch et al., 1995). These results are also supported by other independent observations

1100 Gera Neufeld, Gal Akiri and Zehava Vadasz which indicate that inhibition by PF4 is independent of the type of stimulus used for the induction of cell proliferation and that PF4 inhibits the activity of nonheparin-binding growth factors (Gupta and Singh, 1994). It was found that PF4 induces changes in the expression of cell cycle regulatory proteins such as P-21/waf-1 regardless of the growth-stimulating factor used (Gentilini et al., 1999). These observations indicate that alternative nonheparin-binding mechanisms by which PF4 inhibits angiogenesis may exist. This notion is also supported by experiments which have shown that a nonheparin-binding mutant of PF4 is still able to inhibit angiogenesis (Maione et al., 1991).

References Ciaglowski, R. E., and Walz, D. A. (1985). Amino acid sequence homology between bovine and human platelet proteins. Comp. Biochem. Physiol. [B] 82, 715±719. Ciaglowski, R. E., Snow, J., and Walz, D. A. (1986). Isolation and amino acid sequence of bovine platelet factor 4. Arch. Biochem. Biophys. 250, 249±256. Doi, T., Greenberg, S. M., and Rosenberg, R. D. (1987). Structure of the rat platelet factor 4 gene: a marker for megakaryocyte differentiation. Mol. Cell Biol. 7, 898±904. Doi, T., Minami, T., Itoh, M., Aburatani, H., Kawabe, Y., Kodama, T., Kondo, N., Satoh, Y., Asayama, T., and Imanishi, T. (1997). An alternative form of nucleolysin binds to a T-cluster DNA in the silencer element of platelet factor 4 gene. Biochem. Biophys. Res. Commun. 235, 625±630. Dudek, A. Z., Pennell, C. A., Decker, T. D., Young, T. A., Key, N. S., and Slungaard, A. (1997). Platelet factor 4 binds to glycanated forms of thrombomodulin and to protein C ± A potential mechanism for enhancing generation of activated protein C. J. Biol. Chem. 272, 31785±31792. Dumenco, L. L., Everson, B., Culp, L. A., and Ratnoff, O. D. (1988). Inhibition of the activation of Hageman factor (factor XII) by platelet factor 4. J. Lab. Clin. Med. 112, 394±400. Eisman, R., Surrey, S., Ramachandran, B., Schwartz, E., and Poncz, M. (1990). Structural and functional comparison of the genes for human platelet factor 4 and PF4alt. Blood 76, 336±344. Fannon, M., and Nugent, M. A. (1996). Basic fibroblast growth factor binds its receptors, is internalized, and stimulates DNA synthesis in balb/c3T3 cells in the absence of heparan sulfate. J. Biol. Chem. 271, 17949±17956. Gengrinovitch, S., Greenberg, S. M., Cohen, T., Gitay-Goren, H., Rockwell, P., Maione, T. E., Levi, B., and Neufeld, G. (1995). Platelet factor-4 inhibits the mitogenic activity of VEGF-121 and VEGF-165 using several concurrent mechanisms. J. Biol. Chem. 270, 15059±15065. Gentilini, G., Kirschbaum, N. E., Augustine, J. A., Aster, R. H., and Visentin, G. P. (1999). Inhibition of human umbilical vein endothelial cell proliferation by the CXC chemokine, platelet factor 4 (PF4), is associated with impaired downregulation of p21Cip1/WAF1. Blood 93, 25±33. Green, C. J., Charles, R. S., Edwards, B. F., and Johnson, P. H. (1989). Identification and characterization of PF4varl, a human gene variant of platelet factor 4. Mol. Cell Biol. 9, 1445.

Griffin, C. A., Emanuel, B. S., LaRocco, P., Schwartz, E., and Poncz, M. (1987). Human platelet factor 4 gene is mapped to 4q12-q21. Cytogenet. Cell Genet. 45, 67±69. Gupta, S. K., and Singh, J. P. (1994). Inhibition of endothelial cell proliferation by platelet factor-4 involves a unique action on S phase progression. J. Cell Biol. 127, 1121±1127. Gupta, S. K., Hassel, T., and Singh, J. P. (1995). A potent inhibitor of endothelial cell proliferation is generated by proteolytic cleavage of the chemokine platelet factor 4. Proc. Natl Acad. Sci. USA 92, 7799±7803. Horne, M. K., and Hutchison, K. J. (1998). Simultaneous binding of heparin and platelet factor-4 to platelets: Further insights into the mechanism of heparin-induced thrombocytopenia. Am. J. Hematol. 58, 24±30. Jouan, V., Canron, X., Alemany, M., Caen, J. P., Quentin, G., Plouet, J., and Bikfalvi, A. (1999). Inhibition of in vitro angiogenesis by platelet factor-4-derived peptides and mechanism of action. Blood 94, 984±993. Levine, S. P., Knieriem, L. K., and Rager, M. A. (1990). Platelet factor 4 and the platelet secreted proteoglycan: immunologic characterization by crossed immunoelectrophoresis. Blood 75, 902±910. Luster, A. D., Greenberg, S. M., and Leder, P. (1995). The IP-10 chemokine binds to a specific cell surface heparan sulfate site shared with platelet factor 4 and inhibits endothelial cell proliferation. J. Exp. Med. 182, 219±231. Maione, T. E., Gray, G. S., Petro, J., Hunt, A. J., Donner, A. L., Bauer, S. I., Carson, H. F., and Sharpe, R. J. (1990). Inhibition of angiogenesis by recombinant human platelet factor-4 and related peptides. Science 247, 77±79. Maione, T. E., Gray, G. S., Hunt, A. J., and Sharpe, R. J. (1991). Inhibition of tumor growth in mice by an analogue of platelet factor 4 that lacks affinity for heparin and retains potent angiostatic activity. Cancer Res. 51, 2077±2083. Majumdar, S., Gonder, D., Koutsis, B., and Poncz, M. (1991). Characterization of the human beta-thromboglobulin gene. Comparison with the gene for platelet factor 4. J. Biol. Chem. 266, 5785±5789. Minami, T., Tachibana, K., Imanishi, T., and Doi, T. (1998). Both Ets-1 and GATA-1 are essential for positive regulation of platelet factor 4 gene expression. Eur. J. Biochem. 258, 879±889. Niewiarowski, S., Farbiszewski, R., and Poplawski, A. (1965). Neutralization of antithrombin VI (fibrinogen breakdown products) with platelet antiheparin factor (platelet factor 4). Thromb. Diath. Haemorrh. 14, 490±499. Perollet, C., Han, Z. C., Savona, C., Caen, J. P., and Bikfalvi, A. (1998). Platelet factor 4 modulates fibroblast growth factor 2 (FGF-2) activity and inhibits FGF-2 dimerization. Blood 91, 3289±3299. Petersen, F., Ludwig, A., Flad, H. D., and Brandt, E. (1996). TNF-alpha renders human neutrophils responsive to platelet factor 4 ± Comparison of PF-4 and IL-8 reveals different activity profiles of the two chemokines. J. Immunol. 156, 1954±1962. Petersen, F., Bock, L., Flad, H. D., and Brandt, E. (1998). A chondroitin sulfate proteoglycan on human neutrophils specifically binds platelet factor 4 and is involved in cell activation. J. Immunol. 161, 4347±4355. Petersen, F., Brandt, E., Lindahl, U., and Spillmann, D. (1999). Characterization of a neutrophil cell surface glycosaminoglycan that mediates binding of platelet factor 4. J. Biol. Chem. 274, 12376±12382. Poncz, M., Surrey, S., LaRocco, P., Weiss, M. J., Rappaport, E. F., Conway, T. M., and Schwartz, E. (1987). Cloning and characterization of platelet factor 4 cDNA derived from a human erythroleukemic cell line. Blood 69, 219±223.

Platelet Factor 4 1101 Proudfoot, A. E., Magnenat, E., Haley, T. M., Maione, T. E., and Wells, T. N. (1995). The complete primary structure of glycosylated porcine platelet factor 4. Eur. J. Biochem. 228, 658±664. Ravid, K., Beeler, D. L., Rabin, M. S., Ruley, H. E., and Rosenberg, R. D. (1991a). Selective targeting of gene products with the megakaryocyte platelet factor 4 promoter. Proc. Natl Acad. Sci. USA 88, 1521±1525. Ravid, K., Doi, T., Beeler, D. L., Kuter, D. J., and Rosenberg, R. D. (1991b). Transcriptional regulation of the rat platelet factor 4 gene: interaction between an enhancer/ silencer domain and the GATA site. Mol. Cell Biol. 11, 6116± 6127. Ravid, K., Kuter, D. J., and Rosenberg, R. D. (1995). rmIL-6 stimulates the transcriptional activity of the rat PF4 gene. Exp. Hematol. 23, 397±401. Sharpe, R. J., Byers, H. R., Scott, C. F., Bauer, S. I., and Maione, T. E. (1990). Growth inhibition of murine melanoma and human colon carcinoma by recombinant human platelet factor 4. J. Natl Cancer Inst. 82, 848±853. Shigeta, O., Lu, W. Q., Holt, J. C., Edmunds, L. H. J., and Niewiarowski, S. (1991). Ovine platelet factor 4: purification, amino acid sequence, radioimmunoassay and comparison with platelet factor 4 of other species. Thromb. Res. 64, 509±520. Shirozu, M., Nakano, T., Inazawa, J., Tashiro, K., Tada, H., Shinohara, T., and Honjo, T. (1995). Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene. Genomics 28, 495±500. Shoenfeld, Y. (1997). Heparin-induced thrombocytopenia as an autoimmune disease ± Idiotypic evidence for the role of antiheparin/PF4 autoantibodies. Isr. J. Med. Sci. 33, 243±245. Slungaard, A., and Key, N. S. (1994). Platelet factor 4 stimulates thrombomodulin protein C-activating cofactor activity ± A structure-function analysis. J. Biol. Chem. 269, 25549±25556. Strieter, R. M., Polverini, P. J., Kunkel, S. L., Arenberg, D. A., Burdick, M. D., Kasper, J., Dzuiba, J., Vandamme, J., Walz, A., Marriott, D., Chan, S. Y., Roczniak, S., and Shanafelt, A. B.

(1995). The functional role of the ELR motif in CXC chemokine-mediated angiogenesis. J. Biol. Chem. 270, 27348± 27357. Stringer, S. E., and Gallagher, J. T. (1997). Specific binding of the chemokine platelet factor 4 to heparan sulfate. J. Biol. Chem. 272, 20508±20514. Tanaka, T., Manome, Y., Wen, P., Kufe, D. W., and Fine, H. A. (1997). Viral vector-mediated transduction of a modified platelet factor 4 cDNA inhibits angiogenesis and tumor growth. Nature Med. 3, 437±442. Tunnacliffe, A., Majumdar, S., Yan, B., and Poncz, M. (1992). Genes for beta-thromboglobulin and platelet factor 4 are closely linked and form part of a cluster of related genes on chromosome 4. Blood 79, 2896±2900. Watson, J. B., Getzler, S. B., and Mosher, D. F. (1994). Platelet factor 4 modulates the mitogenic activity of basic fibroblast growth factor. J. Clin. Invest. 94, 261±268. Xi, X. D., Caen, J. P., Fournier, S., Schlegel, N., Amiral, J., Sibony, O., Blot, P., and Han, Z. C. (1996). Direct and reversible inhibition of platelet factor 4 on megakaryocyte development from CD34(+) cord blood cells: Comparative studies with transforming growth factor beta 1. Br. J Haematol. 93, 265±272. Zhang, X. H., Chen, L. Q., Bancroft, D. P., Lai, C. K., and Maione, T. E. (1994). Crystal structure of recombinant human platelet factor 4. Biochemistry 33, 8361±8366.

ACKNOWLEDGEMENTS This work was supported by grants from the Israel Academy of Sciences and the Israel Cancer Research Fund (ICRF) to G.N.